U.S. patent application number 17/410908 was filed with the patent office on 2021-12-23 for bacterial vaccine components and uses thereof.
The applicant listed for this patent is SOCPRA - SCIENCES ET GENIE, s.e.c.. Invention is credited to MARIANNE ALLARD, MOUSSA S. DIARRA, PIERRE LACASSE, CHRISTIAN LEBEAU JACOB, FRANCOIS MALOUIN, DANIEL SCHOLL, CELINE STER, BRIAN GEOFFREY TALBOT.
Application Number | 20210393762 17/410908 |
Document ID | / |
Family ID | 1000005822565 |
Filed Date | 2021-12-23 |
United States Patent
Application |
20210393762 |
Kind Code |
A1 |
MALOUIN; FRANCOIS ; et
al. |
December 23, 2021 |
BACTERIAL VACCINE COMPONENTS AND USES THEREOF
Abstract
Agents, compositions, methods and kits useful for the treatment
and diagnosis of Staphylococcal intramammary infection are
disclosed. The agents, compositions, methods and kits are derived
from genes expressed during Staphylococcal intramammary infection,
and more particularly genes SACOL0029, based on the gene
nomenclature from the Staphylococcus aureus COL (SACOL) genome.
Inventors: |
MALOUIN; FRANCOIS; (EASTMAN,
CA) ; ALLARD; MARIANNE; (SHERBROOKE, CA) ;
LEBEAU JACOB; CHRISTIAN; (SHERBROOKE, CA) ; TALBOT;
BRIAN GEOFFREY; (SHERBROOKE, CA) ; SCHOLL;
DANIEL; (MONT SAINT-HILAIRE, CA) ; LACASSE;
PIERRE; (SHERBROOKE, CA) ; DIARRA; MOUSSA S.;
(AGASSIZ, CA) ; STER; CELINE; (SHERBROOKE,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SOCPRA - SCIENCES ET GENIE, s.e.c. |
Sherbrooke |
|
CA |
|
|
Family ID: |
1000005822565 |
Appl. No.: |
17/410908 |
Filed: |
August 24, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16749597 |
Jan 22, 2020 |
11129884 |
|
|
17410908 |
|
|
|
|
16013494 |
Jun 20, 2018 |
10576139 |
|
|
16749597 |
|
|
|
|
15344688 |
Nov 7, 2016 |
10029004 |
|
|
16013494 |
|
|
|
|
14513987 |
Oct 14, 2014 |
9566322 |
|
|
15344688 |
|
|
|
|
13583054 |
Nov 15, 2012 |
8889150 |
|
|
PCT/CA2011/050145 |
Mar 17, 2011 |
|
|
|
14513987 |
|
|
|
|
61314670 |
Mar 17, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/56938 20130101;
A61K 2039/552 20130101; A61K 39/00 20130101; A61K 39/085 20130101;
C12Q 1/689 20130101; A61K 2039/522 20130101; A61K 2039/55566
20130101; C12Q 2600/158 20130101 |
International
Class: |
A61K 39/085 20060101
A61K039/085; G01N 33/569 20060101 G01N033/569; C12Q 1/689 20060101
C12Q001/689 |
Claims
1. A method for immunizing a mammal against a Staphylococcal
intramammary infection (IMI), said method comprising administering
to said mammal an effective amount of a composition comprising an
oil and at least one polypeptide, wherein said polypeptide is: (a)
a polypeptide encoded by SACOL0029, wherein the polypeptide
comprises SEQ ID NO: 78; (b) a polypeptide comprising an amino acid
at least 95% identical to the full-length of the polypeptide of
(a); (c) a polypeptide comprising an immunogenic fragment of (a);
(d) any combination of (a) to (c).
2. The method of claim 1, wherein the polypeptide is a polypeptide
comprising the amino acid sequence of SEQ ID NO: 78.
3. The method of claim 1, wherein the polypeptide (b) is a
polypeptide comprising an amino sequence at least 98% identical
overall to the full-length of SEQ ID NO: 78.
4. The method of claim 1, comprising administering to said mammal
an effective amount of a combination of polypeptides.
5. The method of claim 4, wherein said combination of polypeptides
further comprises: (i) (a) a polypeptide encoded by SACOL0442
comprising residues 36-203 of the amino acid sequence of SEQ ID NO:
37 or SEQ ID NO: 48; (b) polypeptide comprising an amino acid at
least 95% identical to the full-length of the polypeptide of (a);
(c) a polypeptide comprising an immunogenic fragment of (a); or (d)
any combination of (a) to (c), wherein said polypeptide has the
ability to elicit an immune response in a mammal; and/or; (ii) (a)
a polypeptide encoded by SACOL0720 comprising residues 310 to 508
of the amino acid sequence of SEQ ID NO: 62 or SEQ ID NO: 74; (b)
polypeptide comprising an amino acid at least 95% identical to the
full-length of the polypeptide of (a); (c) a polypeptide comprising
an immunogenic fragment of (a); or (d) any combination of (a) to
(c), wherein said polypeptide has the ability to elicit an immune
response in a mammal.
6. The method of claim 5, wherein said polypeptide (i) is a
polypeptide comprising residues 36 to 203 of the amino acid
sequence of SEQ ID NO: 37 or SEQ ID NO: 48; and/or polypeptide of
(ii) a polypeptide comprising residues 309 to 508 of the amino acid
sequence of SEQ ID NO: 62 or SEQ ID NO: 74.
7. The method of claim 5, wherein said immunogenic fragment of
(i)(c) and/or (ii)(c) comprises one or more of the following amino
acid sequences: TFGIYPKADASTQN (SEQ ID NO: 17), KDTINGKSNKSRNW (SEQ
ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19); and/or said
immunogenic fragment of (ii) (c) comprises one or more of the
following amino acid sequences: QFGFDLKHKKDALA (SEQ ID NO: 20),
TIKDQQKANQLAS (SEQ ID NO: 21), KDINKIYFMTDVDL (SEQ ID NO: 22) or
DVDLGGPTFVLND (SEQ ID NO: 23).
8. The method of claim 1, wherein said Staphylococcal intramammary
infection is caused by one or more Staphylococcus aureus
strains.
9. The method of claim 1, further comprising administering to said
mammal an effective amount of an adjuvant.
10. The method of claim 9, wherein said adjuvant comprises alum,
oil, cyclic-diguanosine-5'-monophosphate (c-di-GMP),
polyphosphasine or pathogen-associated molecular patterns
(PAMPS).
11. The method of claim 10, wherein said PAMPS is unmethylated
dinucleotides (CpG) or microbial polysaccharides.
12. The method of claim 9, wherein said (i) polypeptide, (ii)
adjuvant, or both (i) and (ii) are comprised in a pharmaceutical
composition.
13. The method of claim 12, wherein said pharmaceutical composition
further comprises one or more pharmaceutically acceptable
excipients.
14. The method of claim 1, wherein said mammal is a cow.
15. method of claim 14, wherein said IMI is associated with bovine
mastitis.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This Application is a Divisional Application of U.S.
application Ser. No. 16/013,494, filed Jun. 20, 2018, now allowed,
which is a Divisional Application of U.S. application Ser. No.
15/344,688, filed Nov. 7, 2016 now issued under U.S. Pat. No.
10,029,004, which is a Continuation Application of U.S. application
Ser. No. 14/513,987 filed Oct. 14, 2014, now issued under U.S. Pat.
No. 9,566,322, which is a Divisional Application of U.S.
application Ser. No. 13/583,054 filed on Nov. 15, 2012, now issued
under U.S. Pat. No. 8,889,150, which is a National Entry
Application of PCT Application No. PCT/CA2011/050145 filed on Mar.
17, 2011 and published in English under PCT Article 21(2), which
itself claims benefit of U.S. Provisional Application Ser. No.
61/314,670, filed on Mar. 17, 2010. All documents above are
incorporated herein in their entirety by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] Not applicable.
FIELD OF THE INVENTION
[0003] The present invention relates to novel vaccine targets and
components. More specifically, the present invention is concerned
with novel antigens which represent vaccine components, processes
of manufacturing same, methods using same, and methods of
preventing and treating microbial infections involving the
administration of same.
REFERENCE TO SEQUENCE LISTING
[0004] Pursuant to 37 C.F.R. 1.821(c), a sequence listing is
submitted herewith as an ASCII compliant text file named
14870_22-Sequence_listing, created on Jan. 2, 2020 and having a
size of 194 kilobytes. The content of the aforementioned file is
hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
[0005] Bovine mastitis is the most frequent and costly disease for
dairy producers and Staphylococcus aureus is considered to be the
transmittable bacterium that is the most often responsible for the
development of the disease (Sears et al., 2003). Staphylococcal
intramammary infections (IMI), which may lead to mastitis, are
difficult to treat and frequent relapses are common (Sandholm et
al., 1990). Bacterial susceptibility to antibiotics in vitro is a
poor predictor of therapeutic efficacy in chronically infected cows
(Owens et al., 1997). Although infections that follow treatment of
mastitis can be due to newly acquired strains, they are often the
result of the persistence of the original infective organism
(Sandholm et al., 1990; Myllys et al., 1997). Existing therapies
thus often fail to eliminate the infection and it would be highly
desirable to find novel approaches to prevent or treat
staphylococcal IMI.
[0006] A lack of vaccine efficacy and protective ability has been
noted for commercially available S. aureus vaccines (Middleton,
2008). A number of additional Staphylococci vaccines and vaccine
components have been described and proposed. The use of milk or
low-iron media as surrogate systems for exploring S. aureus genes
that are expressed during IMI do not fully replicate the actual
mammalian host environment that may vary in nutrient composition,
in interactions with host cells and in immune response components,
to name just a few differences. Hence, the S. aureus components
currently proposed as vaccine are not necessarily the components
that are expressed during IMI at multiple points in time, by
multiple strains (including chronic strains) and in multiple hosts.
Thus, it would be highly desirable to identify S. aureus genes that
are expressed during IMI at multiple points in time, by multiple
strains, and in multiple hosts, so that a selection of genes and
gene-encoded products (e.g., proteins) can be used either alone or
in combination for protection against IMI and mastitis.
[0007] The present invention seeks to meet these and other
needs.
[0008] The present description refers to a number of documents, the
content of which is herein incorporated by reference in their
entirety.
SUMMARY OF THE INVENTION
[0009] In an aspect, the present invention provides a method for
preventing and/or treating Staphylococcal intramammary infection
(IMI) in a mammal, said method comprising administrating to said
mammal an effective amount of at least one agent, wherein said
agent is: (a) a polypeptide encoded by a gene, wherein said gene is
SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353,
SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599,
based on the gene nomenclature from the Staphylococcus aureus COL
(SACOL) genome set forth in NCBI Reference Sequence NC_002951.2;
(b) a polypeptide encoded by a gene from a same operon as one of
the genes of (a); (c) an immunogenic fragment of (a) or (b); (d) an
immunogenic variant of any one of (a) to (c); (e) a nucleic acid
encoding the polypeptide of any one of (a) to (d); or (f) any
combination of (a) to (e).
[0010] In another aspect, the present invention provides a use of
an agent, wherein said agent is: (a) a polypeptide encoded by a
gene, wherein said gene is SACOL0029, SACOL0264, SACOL0442,
SACOL0718, SACOL0720, SACOL1353, SACOL1416, SACOL1611, SACOL1944,
SACOL2144, SACOL2365 or SACOL2599 based on the gene nomenclature
from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI
Reference Sequence NC_002951.2; (b) a polypeptide encoded by a gene
from a same operon as one of the genes of (a); (c) an immunogenic
fragment of (a) or (b); (d) an immunogenic variant of any one of
(a) to (c); (e) a nucleic acid encoding the polypeptide of any one
of (a) to (d); or (f) any combination of (a) to (e), for preventing
and/or treating Staphylococcal intramammary infection (IMI) in a
mammal.
[0011] In another aspect, the present invention provides a use of
an agent, wherein said agent is: (a) a polypeptide encoded by a
gene, wherein said gene is SACOL0029, SACOL0264, SACOL0442,
SACOL0718, SACOL0720, SACOL1353, SACOL1416, SACOL1611, SACOL1944,
SACOL2144, SACOL2365 or SACOL2599 based on the gene nomenclature
from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI
Reference Sequence NC_002951.2; (b) a polypeptide encoded by a gene
from a same operon as one of the genes of (a); (c) an immunogenic
fragment of (a) or (b); (d) an immunogenic variant of any one of
(a) to (c); (e) a nucleic acid encoding the polypeptide of any one
of (a) to (d); or (f) any combination of (a) to (e), for the
preparation of a medicament for preventing and/or treating
Staphylococcal intramammary infection (IMI) in a mammal.
[0012] In another aspect, the present invention provides a
pharmaceutical composition for preventing and/or treating
Staphylococcal intramammary infection (IMI) in a mammal, said
composition comprising: (a) at least one agent, wherein said agent
is (i) a polypeptide encoded by a gene, wherein said gene is
SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353,
SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599
based on the gene nomenclature from the Staphylococcus aureus COL
(SACOL) genome set forth in NCBI Reference Sequence NC_002951.2;
(ii) a polypeptide encoded by a gene from a same operon as one of
the genes of (i); (iii) an immunogenic fragment of (i) or (ii);
(iv) an immunogenic variant of any one of (i) to (iii); (v) a
nucleic acid encoding the polypeptide of any one of (i) to (iv); or
(vi) any combination of (i) to (v). It may optionally comprise (b)
a pharmaceutically acceptable excipient.
[0013] In another aspect, the present invention provides a
pharmaceutical composition comprising: (a) at least one agent,
wherein said agent is: (i) a polypeptide encoded by a gene, wherein
said gene is SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720,
SACOL1353, SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or
SACOL2599, based on the gene nomenclature from the Staphylococcus
aureus COL (SACOL) genome set forth in NCBI Reference Sequence
NC_002951.2; (ii) a polypeptide encoded by a gene from a same
operon as one of the genes of (a); (iii) an immunogenic fragment of
(i) or (ii); (iv) an immunogenic variant of any one of (i) to
(iii); (v) a nucleic acid encoding the polypeptide of any one of
(i) to (iv); or (vi) any combination of (i) to (v); and (b) a
pharmaceutically acceptable excipient.
[0014] In another aspect, the present invention provides a kit for
the prevention and/or treatment of Staphylococcal IMI, comprising
(a) at least one agent, wherein said agent is: (i) a polypeptide
encoded by a gene, wherein said gene is SACOL0029, SACOL0264,
SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416, SACOL1611,
SACOL1944, SACOL2144, SACOL2365 or SACOL2599, based on the gene
nomenclature from the Staphylococcus aureus COL (SACOL) genome set
forth in NCBI Reference Sequence NC_002951.2; (ii) a polypeptide
encoded by a gene from a same operon as one of the genes of (a);
(iii) an immunogenic fragment of (i) or (ii); (iv) an immunogenic
variant of any one of (i) to (iii); (v) a nucleic acid encoding the
polypeptide of any one of (i) to (iv); or (vi) any combination of
(i) to (v); and (b) instructions to use the kit for the prevention
and/or treatment of Staphylococcal IMI.
[0015] In another aspect, the present invention provides a method
of diagnosing Staphylococcal IMI in a mammal, said method
comprising: determining a level of expression of at least one gene,
wherein said gene is SACOL0029, SACOL0264, SACOL0442, SACOL0718,
SACOL0720, SACOL1353, SACOL1416, SACOL1611, SACOL1944, SACOL2144,
SACOL2365 or SACOL2599, or the level of activity of a polypeptide
encoded by said one or more genes, in a biological sample from said
mammal; and comparing said level of expression or activity to a
reference level of expression or activity; wherein a higher
expression or activity in said biological sample relative to said
reference expression or activity is indicative that said mammal has
staphylococcal IMI.
[0016] In another aspect, the present invention provides a kit for
the diagnosis of Staphylococcal IMI, comprising (a) at least one
ligand, wherein said at least one ligand binds to: (i) a
polypeptide encoded by a gene, wherein said gene is SACOL0029,
SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416,
SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599, based on
the gene nomenclature from the Staphylococcus aureus COL (SACOL)
genome set forth in NCBI Reference Sequence NC_002951.2; (ii) a
polypeptide encoded by a gene from a same operon as one of the
genes of (a); (iii) an immunogenic fragment of (i) or (ii); (iv) an
immunogenic variant of any one of (i) to (iii); (v) a nucleic acid
encoding the polypeptide of any one of (i) to (iv); or (vi) any
combination of (i) to (v); and (b) instructions to use the kit for
the diagnosis of Staphylococcal IMI.
[0017] In another aspect, the present invention provides a method
for preventing and/or treating Staphylococcal intramammary
infection (IMI) in a mammal, said method comprising administrating
to said mammal an effective amount of at least one agent, wherein
said agent is a live attenuated form of Staphylococcus aureus
comprising a mutation in a gene, wherein said gene is SACOL0029,
SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416,
SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599, based on
the gene nomenclature from the Staphylococcus aureus COL (SACOL)
genome set forth in NCBI Reference Sequence NC_002951.2, and
wherein the mutation is a deletion or an insertion.
[0018] In another aspect, the present invention provides a use of
an agent, wherein said agent is a live attenuated form of
Staphylococcus aureus comprising a mutation in a gene, wherein said
gene is SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720,
SACOL1353, SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or
SACOL2599, based on the gene nomenclature from the Staphylococcus
aureus COL (SACOL) genome set forth in NCBI Reference Sequence
NC_002951.2, and wherein the mutation is a deletion, an insertion
or a substitution of one or more nucleotides, for preventing and/or
treating Staphylococcal intramammary infection (IMI) in a mammal or
for the preparation of a medicament for preventing and/or treating
Staphylococcal intramammary infection (IMI) in a mammal.
[0019] In another aspect, the present invention provides a
pharmaceutical composition for preventing and/or treating
Staphylococcal intramammary infection (IMI) in a mammal, said
composition comprising an agent, wherein said agent is a live
attenuated form of Staphylococcus aureus comprising a mutation in a
gene, wherein said gene is SACOL0029, SACOL0264, SACOL0442,
SACOL0718, SACOL0720, SACOL1353, SACOL1416, SACOL1611, SACOL1944,
SACOL2144, SACOL2365 or SACOL2599, based on the gene nomenclature
from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI
Reference Sequence NC_002951.2, and wherein the mutation is a
deletion, an insertion or a substitution of one or more
nucleotides.
[0020] In another aspect, the present invention provides a kit for
the prevention and/or treatment of Staphylococcal IMI, comprising
at least one agent, wherein said agent is a live attenuated form of
Staphylococcus aureus comprising a mutation in a gene, wherein said
gene is SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720,
SACOL1353, SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or
SACOL2599, based on the gene nomenclature from the Staphylococcus
aureus COL (SACOL) genome set forth in NCBI Reference Sequence
NC_002951.2, and wherein the mutation is a deletion, an insertion
or a substitution of one or more nucleotides.
[0021] In an embodiment, the above-mentioned gene from the same
operon as one of the genes of (a) is SACOL0720, and wherein said
one or more genes of (a) is SACOL0718.
[0022] In an embodiment, the above-mentioned one or more genes is
SACOL0442, SACOL0718, SACOL0720 or any combination thereof. In a
further embodiment, the above-mentioned one or more genes is
SACOL0442, SACOL0720 or both.
[0023] In another embodiment, the above-mentioned methods, uses,
pharmaceutical compositions or kits comprise a combination of
agents. In a further embodiment, the above-mentioned combination of
agents comprises: (i) a first agent, wherein said first agent is
(a) a polypeptide encoded by SACOL0442, (b) an immunogenic fragment
of (a); (c) an immunogenic variant of (a) or (b); (d) a nucleic
acid encoding the polypeptide of any one of (a) to (c); or (e) any
combination of (a) to (d): and (ii) a second agent, wherein said
second agent is (a) a polypeptide encoded by SACOL0720, (b) an
immunogenic fragment of (a); (c) an immunogenic variant of (a) or
(b); (d) a nucleic acid encoding the polypeptide of any one of (a)
to (c); or (e) any combination of (a) to (d).
[0024] In an embodiment, the above-mentioned gene is SACOL0442 and
the immunogenic fragment comprises one or more of the following
amino acid sequences: TFGIYPKADASTQN (SEQ ID NO: 17),
KDTINGKSNKSRNW (SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO:
19).
[0025] In another embodiment, the above-mentioned gene is SACOL0720
and the immunogenic fragment comprises one or more of the following
amino acid sequences: QFGFDLKHKKDALA (SEQ ID NO: 20), TIKDQQKANQLAS
(SEQ ID NO: 21), KDINKIYFMTDVDL (SEQ ID NO: 22) or DVDLGGPTFVLND
(SEQ ID NO: 23).
[0026] In an embodiment, the above-mentioned Staphylococcal
intramammary infection is caused by one or more Staphylococcus
aureus strains.
[0027] In an embodiment, the above-mentioned methods, uses,
pharmaceutical compositions or kits further comprise an adjuvant.
In a further embodiment, the above-mentioned adjuvant is alum,
Emulsigen.TM. D, cyclic-diguanosine-5'-monophosphate (c-di-GMP),
polyphosphasine or pathogen-associated molecular patterns (PAMPS).
In yet a further embodiment, the above-mentioned PAMPS is
unmethylated dinucleotides (CpG) or microbial polysaccharides.
[0028] In an embodiment, the above-mentioned (i) agent, (ii)
adjuvant, or both (i) and (ii) are comprised in a pharmaceutical
composition.
[0029] In an embodiment, the above-mentioned pharmaceutical
composition further comprises one or more pharmaceutically
acceptable excipients.
[0030] In an embodiment, the above-mentioned mammal is a cow.
[0031] In an embodiment, the above-mentioned IMI is associated with
bovine mastitis.
[0032] In an embodiment, the above-mentioned reference expression
or activity is a level of expression or activity determined in a
corresponding biological sample from a mammal known to not having
staphylococcal IMI. In another embodiment, the above-mentioned
level of expression is determined by measuring the level of
expression of a mRNA transcribed from said one or more genes. In
another embodiment, said level of expression is determined by
measuring the level of expression of a polypeptide encoded by said
one or more genes.
[0033] In an embodiment, the above-mentioned biological sample is
milk.
[0034] In an embodiment, the above-mentioned kit comprises a
combination of ligands.
[0035] In an embodiment, the above-mentioned combination of ligands
comprises ligands which bind to: (i) a first agent, wherein said
first agent is (a) a polypeptide encoded by SACOL0442, (b) an
immunogenic fragment of (a); (c) an immunogenic variant of (a) or
(b); (d) a nucleic acid encoding the polypeptide of any one of (a)
to (c); or (e) any combination of (a) to (d): and (ii) a second
agent, wherein said second agent is (a) a polypeptide encoded by
SACOL0720, (b) an immunogenic fragment of (a); (c) an immunogenic
variant of (a) or (b); (d) a nucleic acid encoding the polypeptide
of any one of (a) to (c); or (e) any combination of (a) to (d).
[0036] In another aspect, the following items are also
provided:
[0037] 1. A method for immunizing a mammal against a Staphylococcal
intramammary infection (IMI), said method comprising administrating
to said mammal an effective amount of a composition comprising an
emulsified oil and at least one agent, wherein said agent is:
[0038] (a) a polypeptide encoded by a gene, wherein said gene is
SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353,
SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599,
based on the gene nomenclature from the Staphylococcus aureus COL
(SACOL) genome set forth in NCBI Reference Sequence
NC_002951.2;
[0039] (b) a polypeptide encoded by a gene from a same operon as
one of the genes of (a);
[0040] (c) a polypeptide comprising an amino acid at least 60%
identical overall to the polypeptide of (a) or (b);
[0041] (d) a polypeptide comprising an immunogenic fragment of any
one of (a) to (c);
[0042] (e) a polypeptide comprising an immunogenic variant of any
one of (a) to (d);
[0043] (f) a nucleic acid encoding the polypeptide of any one of
(a) to (e);
[0044] (g) a live attenuated form of Staphylococcus aureus
comprising a mutation in a gene, wherein said gene is SACOL0029,
SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416,
SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599, based on
the gene nomenclature from the Staphylococcus aureus COL (SACOL)
genome set forth in NCBI Reference Sequence NC_002951.2, and
wherein the mutation is a deletion, an insertion or a substitution
of one or more nucleotides; or
[0045] (h) any combination of (a) to (g).
[0046] 2. The method of item 1, wherein the polypeptide (a) is a
polypeptide comprising the amino acid sequence of SEQ ID NO: 78,
SEQ ID NO: 80, SEQ ID NO: 37, SEQ ID NO: 48, SEQ ID NO: 83, SEQ ID
NO: 62, SEQ ID NO: 74, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90,
SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96 and/or SEQ ID NO:
98.
[0047] 3. The method of item 1, wherein (b) said gene from the same
operon as one of the genes of (a) is SACOL0720, and wherein said
gene of (a) is SACOL0718; (ii) said gene is SACOL0442, SACOL0718,
SACOL0720 or any combination thereof; or (iii) said gene is
SACOL0442, SACOL0720 or both.
[0048] 4 The method of item 1, comprising administrating to said
mammal an effective amount of a combination of agents.
[0049] 5. The method of item 4, wherein said combination of agents
further comprises:
[0050] (a) a polypeptide encoded by SACOL0442; (b) polypeptide
comprising an amino acid at least 60% identical overall to the
polypeptide of (a); (c) a polypeptide comprising an immunogenic
fragment of (a) or (b); (d) a polypeptide comprising an immunogenic
variant of any one of (a) to (c); (e) a nucleic acid encoding the
polypeptide of any one of (a) to (d); (f) a live attenuated form of
Staphylococcus aureus comprising a mutation in a gene, wherein said
gene is SACOL0442; or (g) any combination of (a) to (f); and/or
[0051] (a) a polypeptide encoded by SACOL0720; (b) polypeptide
comprising an amino acid at least 60% identical overall to the
polypeptide of (a); (c) a polypeptide comprising an immunogenic
fragment of (a) or (b); (d) a polypeptide comprising an immunogenic
variant of any one of (a) to (c); (e) a nucleic acid encoding the
polypeptide of any one of (a) to (d); (f) a live attenuated form of
Staphylococcus aureus comprising a mutation in a gene, wherein said
gene is SACOL0720; or (g) any combination of (a) to (f).
[0052] 6. The method of item 1, wherein said gene is (i) SACOL0442
and wherein said immunogenic fragment comprises one or more of the
following amino acid sequences: TFGIYPKADASTQN (SEQ ID NO: 17),
KDTINGKSNKSRNW (SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19);
or (ii) SACOL0720 and wherein said immunogenic fragment comprises
one or more of the following amino acid sequences: QFGFDLKHKKDALA
(SEQ ID NO: 20), TIKDQQKANQLAS (SEQ ID NO: 21), KDINKIYFMTDVDL (SEQ
ID NO: 22) or DVDLGGPTFVLND (SEQ ID NO: 23).
[0053] 7. The method of item 1, wherein said Staphylococcal
intramammary infection is caused by one or more Staphylococcus
aureus strains.
[0054] 8. The method of item 1, further comprising administering to
said mammal an effective amount of an adjuvant.
[0055] 9. The method of item 8, wherein said adjuvant is alum,
emulsified oil, cyclic-diguanosine-5'-monophosphate (c-di-GMP),
polyphosphasine or pathogen-associated molecular patterns
(PAMPS).
[0056] 10. The method of item 9, wherein said PAMPS is unmethylated
dinucleotides (CpG) or microbial polysaccharides.
[0057] 11. The method of item 8, wherein said (i) agent, (ii)
adjuvant, or both (i) and (ii) are comprised in a pharmaceutical
composition.
[0058] 12. The method of item 11, wherein said pharmaceutical
composition further comprises one or more pharmaceutically
acceptable excipients.
[0059] 13. The method of item 1, wherein said mammal is a cow.
[0060] 14. The method of item 13, wherein said IMI is associated
with bovine mastitis.
[0061] 15. A pharmaceutical composition comprising: [0062] (i) at
least one agent, wherein said agent is: [0063] (a) a polypeptide
encoded by a gene, wherein said gene is SACOL0029, SACOL0264,
SACOL0442, SACOL0718, SACOL0720, SACOL 1353, SACOL1416, SACOL1611,
SACOL 1944, SACOL2144, SACOL2365 or SACOL2599, based on the gene
nomenclature from the Staphylococcus aureus COL (SACOL) genome set
forth in NCBI Reference Sequence NC_002951.2; [0064] (b) a
polypeptide encoded by a gene from a same operon as one of the
genes of (a); [0065] (c) a polypeptide comprising an amino acid at
least 60% identical overall to the polypeptide of (a) or (b);
[0066] (d) a polypeptide comprising an immunogenic fragment of any
one of (a) to (c); [0067] (e) a polypeptide comprising an
immunogenic variant of any one of (a) to (d); [0068] (f) a nucleic
acid encoding the polypeptide of any one of (a) to (e); [0069] (g)
a live attenuated form of Staphylococcus aureus comprising a
mutation in a gene, wherein said gene is SACOL0029, SACOL0264,
SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416, SACOL1611,
SACOL1944, SACOL2144, SACOL2365 or SACOL2599, based on the gene
nomenclature from the Staphylococcus aureus COL (SACOL) genome set
forth in NCBI Reference Sequence NC_002951.2, and wherein the
mutation is a deletion, an insertion or a substitution of one or
more nucleotides; or [0070] (h) any combination of (a) to (g);
and
[0071] (ii) a pharmaceutically acceptable excipient.
[0072] 16. The pharmaceutical composition of item 15, wherein the
polypeptide (a) is a polypeptide comprising the amino acid sequence
of SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 37, SEQ ID NO: 48, SEQ
ID NO: 83, SEQ ID NO: 62, SEQ ID NO: 74, SEQ ID NO: 86, SEQ ID NO:
88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96
and/or SEQ ID NO: 98.
[0073] 17. The pharmaceutical composition of item 15, wherein (i)
said gene from the same operon as one of the gene of (a) is
SACOL0720, and wherein said gene of (a) is SACOL0718; (ii) said
gene is SACOL0442, SACOL0718, SACOL0720, or any combination
thereof; or (iii) said gene is SACOL0442, SACOL0720 or both.
[0074] 18. The pharmaceutical composition of item 15, comprising a
combination of agents.
[0075] 19. The pharmaceutical composition of item 15, wherein said
combination of agents comprises:
[0076] (a) a polypeptide encoded by SACOL0442; (b) polypeptide
comprising an amino acid at least 60% identical overall to the
polypeptide of (a); (c) a polypeptide comprising an immunogenic
fragment of (a) or (b); (d) a polypeptide comprising an immunogenic
variant of any one of (a) to (c); (e) a nucleic acid encoding the
polypeptide of any one of (a) to (d); (f) a live attenuated form of
Staphylococcus aureus comprising a mutation in a gene, wherein said
gene is SACOL0442; or (g) any combination of (a) to (f); and/or
[0077] (a) a polypeptide encoded by SACOL0720; (b) polypeptide
comprising an amino acid at least 60% identical overall to the
polypeptide of (a); (c) a polypeptide comprising an immunogenic
fragment of (a) or (b); (d) a polypeptide comprising an immunogenic
variant of any one of (a) to (c); (e) a nucleic acid encoding the
polypeptide of any one of (a) to (d); (f) a live attenuated form of
Staphylococcus aureus comprising a mutation in a gene, wherein said
gene is SACOL0720; or (g) any combination of (a) to (f).
[0078] 20. The pharmaceutical composition of item 15, wherein said
gene is (i) SACOL0442 and wherein said immunogenic fragment
comprises one or more of the following amino acid sequences:
TFGIYPKADASTQN (SEQ ID NO: 17), KDTINGKSNKSRNW (SEQ ID NO: 18) or
KDGGKYTLESHKELQ (SEQ ID NO: 19); or (ii) SACOL0720 and wherein said
immunogenic fragment comprises one or more of the following amino
acid sequences: QFGFDLKHKKDALA (SEQ ID NO: 20), TIKDQQKANQLAS (SEQ
ID NO: 21), KDINKIYFMTDVDL (SEQ ID NO: 22) or DVDLGGPTFVLND (SEQ ID
NO: 23).
[0079] 21. The pharmaceutical composition of item 15, further
comprising an adjuvant.
[0080] 22. The pharmaceutical composition of item 21, wherein said
adjuvant is alum, emulsified oil,
cyclic-diguanosine-5'-monophosphate (c-di-GMP), polyphosphasine or
pathogen-associated molecular patterns (PAMPS).
[0081] 23. The pharmaceutical composition of item 22, wherein said
PAMPS is unmethylated dinucleotides (CpG) or microbial
polysaccharides.
[0082] 24. The pharmaceutical composition of item 15, wherein said
(i) agent, (ii) adjuvant, or both (i) and (ii), are comprised in a
pharmaceutical composition.
[0083] 25. The pharmaceutical composition of item 24, wherein said
pharmaceutical composition further comprises one or more
pharmaceutically acceptable excipients.
[0084] 26. A kit for the prevention and/or treatment of
Staphylococcal IMI, comprising
[0085] (i) at least one agent, wherein said agent is:
[0086] (a) a polypeptide encoded by a gene, wherein said gene is
SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353,
SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599,
based on the gene nomenclature from the Staphylococcus aureus COL
(SACOL) genome set forth in NCBI Reference Sequence
NC_002951.2;
[0087] (b) a polypeptide encoded by a gene from a same operon as
one of the genes of (a);
[0088] (c) a polypeptide comprising an amino acid at least 60%
identical overall to the polypeptide of (a) or (b);
[0089] (d) a polypeptide comprising an immunogenic fragment of any
one of (a) to (c);
[0090] (e) a polypeptide comprising an immunogenic variant of any
one of (a) to (d);
[0091] (f) a nucleic acid encoding the polypeptide of any one of
(a) to (e);
[0092] (g) a live attenuated form of Staphylococcus aureus
comprising a mutation in a gene, wherein said gene is SACOL0029,
SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416,
SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599, based on
the gene nomenclature from the Staphylococcus aureus COL (SACOL)
genome set forth in NCBI Reference Sequence NC_002951.2, and
wherein the mutation is a deletion, an insertion or a substitution
of one or more nucleotides; or
[0093] (h) any combination of (a) to (g); and
[0094] (ii) instructions to use the kit for the prevention and/or
treatment of Staphylococcal IMI.
[0095] 27. The kit of item 26, wherein the polypeptide (a) is a
polypeptide comprising the amino acid sequence of SEQ ID NO: 78,
SEQ ID NO: 80, SEQ ID NO: 37, SEQ ID NO: 48, SEQ ID NO: 83, SEQ ID
NO: 62, SEQ ID NO: 74, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90,
SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96 and/or SEQ ID NO:
98
[0096] 28. The kit of item 26, wherein (i) said gene from the same
operon as one of the gene of (a) is SACOL0720, and wherein said
gene of (a) is SACOL0718; (ii) said gene is SACOL0442, SACOL0718,
SACOL0720, or any combination thereof; or (iii) said gene is
SACOL0442, SACOL0720 or both.
[0097] 29. The kit of item 26, comprising a combination of
agents.
[0098] 30. The kit of item 29, wherein said combination of agents
comprises:
[0099] (a) a polypeptide encoded by SACOL0442; (b) polypeptide
comprising an amino acid at least 60% identical overall to the
polypeptide of (a); (c) a polypeptide comprising an immunogenic
fragment of (a) or (b); (d) a polypeptide comprising an immunogenic
variant of any one of (a) to (c); (e) a nucleic acid encoding the
polypeptide of any one of (a) to (d); (f) a live attenuated form of
Staphylococcus aureus comprising a mutation in a gene, wherein said
gene is SACOL0442; or (g) any combination of (a) to (f); and/or
[0100] (a) a polypeptide encoded by SACOL0720; (b) polypeptide
comprising an amino acid at least 60% identical overall to the
polypeptide of (a); (c) a polypeptide comprising an immunogenic
fragment of (a) or (b); (d) a polypeptide comprising an immunogenic
variant of any one of (a) to (c); (e) a nucleic acid encoding the
polypeptide of any one of (a) to (d); (f) a live attenuated form of
Staphylococcus aureus comprising a mutation in a gene, wherein said
gene is SACOL0720; or (g) any combination of (a) to (f).
[0101] 31. The kit of item 26, wherein said gene is (i) SACOL0442
and wherein said immunogenic fragment comprises one or more of the
following amino acid sequences: TFGIYPKADASTQN (SEQ ID NO: 17),
KDTINGKSNKSRNW (SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19);
or (ii) SACOL0720 and wherein said immunogenic fragment comprises
one or more of the following amino acid sequences: QFGFDLKHKKDALA
(SEQ ID NO: 20), TIKDQQKANQLAS (SEQ ID NO: 21), KDINKIYFMTDVDL (SEQ
ID NO: 22) or DVDLGGPTFVLND (SEQ ID NO: 23).
[0102] 32. The kit of item 26, further comprising an adjuvant.
[0103] 33. The kit of item 32, wherein said adjuvant is alum,
emulsified oil, cyclic-diguanosine-5'-monophosphate (c-di-GMP),
polyphosphasine or pathogen-associated molecular patterns
(PAMPS).
[0104] 34. The kit of item 33, wherein said PAMPS is unmethylated
dinucleotides (CpG) or microbial polysaccharides.
[0105] 35. The kit of item 32, wherein said (i) agent, (ii)
adjuvant, or both (i) and (ii), are comprised in a pharmaceutical
composition.
[0106] 36. The kit of item 35, wherein said pharmaceutical
composition further comprises one or more pharmaceutically
acceptable excipients.
BRIEF DESCRIPTION OF THE DRAWINGS
[0107] In the appended drawings:
[0108] FIG. 1 shows the types of Staphylococcus aureus strains
isolated from cows: chronic and systematically isolated strains
from cows with clinical symptoms. Chronic isolates were isolated
from cows shedding a genetically identical S. aureus strain >55
days apart, between dry off and calving as illustrated (1.sup.st
and 2.sup.nd samples). Systematically isolated strains were taken
at calving or in the lactation period from cows shedding high
somatic cell counts (SCC) in milk or having signs of inflammation
(mastitis). Somatic cells are leukocytes (white blood cells). The
SCC is an indicator of the quality of milk. The number of somatic
cells increases in response to pathogenic bacteria like S.
aureus.
[0109] FIG. 2 shows the genetic relatedness of the S. aureus
isolates used in the studies described herein as determined by
comparative genomic DNA hybridization data obtained for 530 genes
printed on DNA arrays. Underlined isolates are chronic strains.
Unrelated reference strains and isolates randomly/systematically
picked from bovine mastitis cases with clinical symptoms during
lactation are shown for comparison.
[0110] FIG. 3 shows Q-PCR analyses reporting the relative level of
gene expression for indicators of virulence: hld (Agr-dependent
exotoxin production), icaC (ica-dependent biofilm production) and
overall biofilm production (measured by a spectrophotometric method
with crystal violet) in S. aureus isolates grown in a cultivation
medium in vitro. Chronic isolates #3 (black inverted triangle),
#557 (black circle) and #1290 (black diamond) are compared to a
collection of systematically isolated strains from bovine mastitis
with clinical signs (black squares, where isolate SHY97-3906, a
previously described strain isolated from a typical mastitis case
with clinical signs, is represented as the open square). Q-PCR
results are presented as fold-expression compared to the reference
strain Newbould (ATCC 29740) and biofilm production is reported as
a percentage of that produced by strain SHY97-3906. All Q-PCR
results are normalized using the level of expression of gyr.
[0111] FIG. 4 shows the description of the method used for
isolating bacteria from mastitis milk samples. (A) Milk before
first centrifugation with (Prot (+)) or without (Prot (-)) casein
protease. (B) After first centrifugation. (C) After "RNA Protect"
treatment and centrifugation (last step). A large bacterial pellet
is recovered from milk treated with casein protease.
[0112] FIGS. 5A-5C show experimental infection profiles caused by
chronic strains #3, #557 and #1290 and by a strain isolated from a
typical mastitis case SHY97-3906 in cows reported as a function of
bacterial (CFU) (left Y axis) or somatic cell counts (SCC) (right Y
axis) over the infection period. FIGS. 5A, 5B and 5C represent cows
#313, cow #307 and cow #5325, respectively. The four different S.
aureus strains used in this study are represented as black bars and
dots (SHY97-3906), white bars and dots (chronic isolate #3), grey
bars and dots (chronic isolate #557) and shaded bars and
star-shaped dots (chronic isolate #1290). Cow #5325 was euthanized
at day 15.
[0113] FIG. 6 shows a Venn diagram of the genes differentially
expressed in the chronic strains taken all together (isolates #3,
#557 and #1290) versus SHY97-3906 isolated from a typical mastitis
case with clinical signs.
[0114] FIG. 7 shows a Venn diagram of the 43 genes found to be
strongly expressed in microarray experiments using bacterial
samples from cow #307 at day 8 (A) and day 10 (B) of infection, and
in cow #5325 at day 10 of infection (C). The number of bacterial
samples in which the genes were shown to be expressed is indicated
in parenthesis and the gene names in bold characters were selected
for Q-PCR analyses (see FIG. 8).
[0115] FIG. 8 shows quantitative PCR analyses of genes found to be
strongly expressed by S. aureus collected from cow's IMI (cow).
Gene expression was compared to that measured in S. aureus
cultivated in vitro in Mueller-Hinton broth supplemented with iron
(broth+iron), in iron-restricted broth (broth-iron), and in freshly
collected non-mastitis milk in vitro (milk in vitro). All results
are normalized using the level of expression of gyrB and are
presented as Log10 values of the relative expression ratios. The
horizontal bar represents the median ratio value of all samples.
Significant differences between the median and a ratio of zero
(representing no change in the expression of the gene) are shown
(*=P<0.05; **=P<0.01; ***=P<0.005; unpaired t-test). RNA
samples from S. aureus grown in two different animals were
analyzed: cow #5325 at day 10 of infection with isolates SHY97-3906
( ), #3 (.DELTA.), #557 (.diamond.), and #1290 (.quadrature.), cow
307 at day 8 of infection (same symbol shapes, black symbols) and
cow #307 at day 14 of infection (same symbol shapes, grey symbols).
For the sample collected from strain #1290 in cow #5325 at day 10
of infection (.quadrature.), the error bars are shown. Relative
gene expression is shown for a capsular biosynthesis gene (capM), a
gene of unknown function (SACOL2171), a transcriptional regulator
of unknown function (SACOL2325), an ABC transporter of unknown
function (SACOL0718) and a chromosomally encoded gene not
previously characterized (SACOL0442).
[0116] FIG. 9 shows the organization of the SACOL0718-720 predicted
operon in S. aureus strains COL, N315, RF122, USA300 and MSSA476.
The two genes overlap by 10 nucleotides. The arrow indicates the
direction of transcription. The genome position of the predicted
-10 and -35 boxes of the promoter region is also indicated.
[0117] FIGS. 10A-10B show the growth kinetics of the S. aureus
strain ATCC 29213 and the isogenic three mutants ATCC
29213.DELTA.SACOL0442a (.DELTA.442a), ATCC 29213.DELTA.SACOL0442b
(.DELTA.442b) and AT0029213 .DELTA.SACOL0720 (.DELTA.720). Mutants
for genes SACOL0442 and SACOL0720 were produced by gene replacement
(.DELTA.442a) or by intron insertion (.DELTA.442b and .DELTA.720).
Prior to experimental bovine IMI, the relative growth of the
parental strain and the mutants was evaluated in vitro in freshly
collected milk (FIG. 10A). In FIG. 10A, the mean CFU/ml (log10) for
the 4 strains is represented over time following a small or large
inoculum (left and right panels, respectively). FIG. 10B shows the
mean bacterial counts recovered from the milk of eight (8)
experimentally infected multiparous Holstein cows in mid lactation
as a function of time. Each of the 8 cows was infused intra-mammary
with the four S. aureus strains (ATCC 29213 and mutants
.DELTA.442a, .DELTA.442b, and .DELTA.720) and the position of each
strain in each of the four mammary gland quarters alternated
between the animals. The infections were carried out for 21 days.
Milk of the infected quarters was collected and the determination
of viable bacterial counts was performed. Solid circles and open
line represent growth of the parent strain and the open symbols and
solid lines the growth of the three mutants as indicated on the
graph.
[0118] FIGS. 11A-11D show a nucleic acid (FIGS. 11A-C) and amino
acid (FIG. 11D) sequence alignment of SACOL0442 from various
Staphylococcus aureus strains (nucleic acid sequences: MW0345 (MW2)
(SEQ ID NO: 24); SAS0347 (MSSA476) (SEQ ID NO: 25); SACOL0442 (Col)
(SEQ ID NO: 26); SAOUHSC_00354 (nctc8325) (SEQ ID NO: 27);
NWMN_0362 (NEWMAN) (SEQ ID NO: 28); SAUSA300_0370 (USA300-FPR3757)
(SEQ ID NO: 29); SaurJH1_0429 (JH1)(SEQ ID NO: 30); SAHV_0367 (Mu3)
(SEQ ID NO: 31); SaurJH9_0419 (JH9) (SEQ ID NO: 32); SAV0370 (Mu50)
(SEQ ID NO: 33); SA0357 (N315) (SEQ ID NO: 34); SAB0321 (RF122)(SEQ
ID NO: 35); and consensus (SEQ ID NO: 36); amino acid sequences:
SACOL0442 (Col) (SEQ ID NO: 37); SAOUHSC_00354 (nctc8325) (SEQ ID
NO: 38); NWMN_0362 (NEWMAN) (SEQ ID NO: 39); SAUSA300_0370
(USA300-FPR3757) (SEQ ID NO: 40); SaurJH1_0429 (JH1)(SEQ ID NO:
41); SAHV_0367 (Mu3) (SEQ ID NO: 42); SaurJH9_0419 (JH9) (SEQ ID
NO: 43); SAV0370 (Mu50) (SEQ ID NO: 44); SA0357 (N315) (SEQ ID NO:
45); SAS0347 (MSSA476) (SEQ ID NO: 46); SAB0321 (RF122)(SEQ ID NO:
47); and consensus (SEQ ID NO: 48). Alignments are based on the
sequences available from multiple Staphylococcus aureus strains,
including the bovine mastitis isolate RF122. The amino acid
sequence of MW0345 (MW2) (SEQ ID NO: 75) is not included in the
alignment. The characteristics of the compared strains are provided
in FIG. 13. Under each alignment, an asterisk (*) indicates a 100%
match of nucleotide or amino acid between all strains compared; a
double-dot (:) indicates that conserved substitutions have been
observed and a single dot ( ) means that semi-conserved
substitutions are observed.
[0119] FIGS. 12A-12K show a nucleic acid (FIGS. 12A-H) and amino
acid (FIGS. 12I-K) sequence alignment of SACOL0720 from various
Staphylococcus aureus strains. (nucleic acid sequences: SaurJH
1_0700 (JH 1) (SEQ ID NO: 49); SaurJH9_0685 (JH9) (SEQ ID NO: 50);
SAHV_0659 (Mu3) (SEQ ID NO: 51); SAV0662 (Mu50) (SEQ ID NO: 52);
SA0617 (N315) (SEQ ID NO: 53); MW0624 (MW2) (SEQ ID NO:54); SAS0627
(MSSA476) (SEQ ID NO: 55); SACOL0720 (SEQ ID NO: 56); SAUSA300_0648
(USA300-FPR3757) (SEQ ID NO: 57); SAOUHSC_00668 (NCTC8325) (SEQ ID
NO: 58); NWMN_0631 (Newman) (SEQ ID NO: 59); SAB0611 (RF122) (SEQ
ID NO: 60); consensus (SEQ ID NO: 61); amino acid sequence:
SACOL0720 (SEQ ID NO: 62); SAUSA300_0648 (USA300-FPR3757) (SEQ ID
NO: 63); SAOUHSC_00668 (NCTC8325) (SEQ ID NO: 64); NWMN_0631
(Newman) (SEQ ID NO: 65); SaurJH1_0700 (JH1) (SEQ ID NO: 66);
SaurJH9_0685 (JH9) (SEQ ID NO: 67); SAHV_0659 (Mu3) (SEQ ID NO:
68); SAV0662 (Mu50) (SEQ ID NO: 69); SA0617 (N315) (SEQ ID NO: 70);
MW0624 (MW2) (SEQ ID NO: 71); SAS0627 (MSSA476) (SEQ ID NO: 72);
SAB0611 (RF122) (SEQ ID NO: 73); consensus (SEQ ID NO: 74).
Alignments are based on the sequences available from multiple
Staphylococcus aureus strains, including the bovine mastitis
isolate RF122. The characteristics of the compared strains are
provided in FIG. 13. Under each alignment, an asterisk (*)
indicates a 100% match of nucleotide or amino acid between all
strains compared; a double-dot (:) indicates that conserved
substitutions have been observed and a single dot ( ) means that
semi-conserved substitutions are observed.
[0120] FIG. 13 shows the characteristics of the Staphylococcus
aureus strains whose sequences are aligned at FIGS. 11A-D and
12A-K.
[0121] FIGS. 14A-14C show the predicted cellular localization of
proteins SACOL0442 (FIG. 14A), SACOL0718 (FIG. 14B) and SACOL0720
(FIG. 14C), and FIG. 14D shows the predicted transmembrane helices
of protein SACOL0720 (SEQ ID NO: 62). In FIG. 14D, "I" and "i"
represent intracellular amino acids, "H" and "h" represent amino
acids part of helix and are localized in the membrane, "O" and "o"
represent amino acids that are extracellular, i.e., localized
outside the cytoplasmic membrane (capital letters indicate a
stronger prediction relative to lower case letters). The
highlighted and boxed sequence is the longest extracellular
sequence of the protein that was used as a vaccine component in
Example 7. Cellular localization was determined using the web site:
http://psort.org/index.html (Gardy J. L. et al., Bioinformatics
2005 21(5):617-623; doi:10.1093/bioinformatics/bti057) and amino
acid composition at the web site:
http://www.expasy.ch/tools/protparam.html (Gasteiger E. et al., The
Proteomics Protocols Handbook, Humana Press (2005), pp. 571-607).
The localization of the transmembrane helix was provided by the
server ExPASy.TM. proteomic server:
http://www.enzim.hu/hmmtop/index.html (G. E. Tusnady and I. Simon
(2001), Bioinformatics 17, 849-850).
[0122] FIG. 15 shows total IgG titers in serums of mice vaccinated
with SACOL0442 and SACOL0720. Antibody titers were determined by
ELISA. One group of animals (10 mice per group) received two
injections of saline, one group received 2 injections of 100 .mu.g
of polypeptide SACOL0442, one group received 2 injections of 100
.mu.g of polypeptide SACOL720, one group received 2 injections of
100 .mu.g of polypeptide SACOL1781, and one group received 2
injections of 100 .mu.g of each of all three polypeptides premixed
together (SACOL0442, SACOL0720, and SACOL1781). The 2 injections
were performed 3 weeks apart. Three weeks after the second
immunization, mice were euthanized and blood collected for the
determination of total IgG titers by ELISA. Each dot represents the
serum titer of one mouse. Horizontal bars are the means for each
group (dotted grey lines, antigens injected individually; solid
black lines, antigens injected in combination).
[0123] FIG. 16 shows total IgG antibody titers in serums of dairy
cows vaccinated with SACOL0442 and SACOL0720. One group of animals
(5 cows per group) received two injections of saline, one group
received 2 injections of 300 .mu.g of polypeptide SACOL0442, one
group received 2 injections of 300 .mu.g of polypeptide SACOL720
and one group received 2 injections of 300 .mu.g of each of the two
polypeptides premixed together (SACOL0442, SACOL0720). The 2
injections were performed 10 weeks apart. Blood was collected every
two weeks for the determination of the total IgG antibody liters by
ELISA. Data represent the mean of each group. Solid lines and solid
symbols represent total IgG antibody titer against SACOL0720 and
open lines and open symbols present total IgG antibody titers
against SACOL0442. Circles (solid for SACOL0720 and open for
SACOL0442) represent the antibody titers for the group that
received saline. Triangles (solid for SACOL0720 and open for
SACOL0442) represent the antibody titers for the two groups that
received each one of the two polypeptides. Squares (solid for
SACOL0720 and open for SACOL0442) represent the antibody titers for
the group that received both polypeptides.
[0124] FIGS. 17A-17D show IgG1 and IgG2 antibody titers at week 16,
in serums of dairy cows vaccinated with SACOL0442 and SACOL0720
(total IgG titers from the same samples at week 16 were shown in
FIG. 16). As described in FIG. 16, one group of animals (5 cows per
group) received two injections of saline, one group received 2
injections of 300 .mu.g of polypeptide SACOL0442, one group
received 2 injections of 300 .mu.g of polypeptide SACOL720 and one
group received 2 injections of 300 .mu.g of each of the two
polypeptides premixed together (SACOL0442, SACOL0720). The 2
injections were performed 10 weeks apart. Blood was collected at
week 16 for the determination of IgG1 and IgG2 antibody titers by
ELISA. FIGS. 17A and B show IgG1 and IgG2 isotypes titers,
respectively against polypeptide SACOL0442, FIGS. 17C and D show
IgG1 and IgG2 isotypes titers, respectively against polypeptide
SACOL0720. Each dot on the graphs represents the serum titer of one
cow (black squares, week 16, open circles, pre-immune titers before
immunization). Horizontal bars are the medians for each group
(solid lines, immune serums at week 16, open lines, pre-immune
serums before immunizations).
[0125] FIG. 18 shows the amino acid (SEQ ID NO: 76) sequence of
SACOL01781 from S. aureus MW2 strain.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0126] In a first aspect, the present invention provides a method
for preventing and/or treating Staphylococcal intramammary
infection (IMI) in a mammal, said method comprising administrating
to said mammal an effective amount of an agent, wherein said agent
is: (a) a polypeptide encoded by a gene, wherein said gene is
SACOL0029, SACOL0100, SACOL0101, SACOL0105, SACOL0148, SACOL0154,
SACOL0204, SACOL0205, SACOL0264, SACOL0442, SACOL0461, SACOL0608,
SACOL0660, SACOL0688, SACOL0690, SACOL0704, SACOL0718, SACOL0720,
SACOL0829, SACOL1054, SACOL1142, SACOL1145, SACOL1320, SACOL1353,
SACOL1416, SACOL1611, SACOL1637, SACOL1680, SACOL1781, SACOL1812,
SACOL1867, SACOL1912, SACOL1944, SACOL2092, SACOL2144, SACOL2169,
SACOL2171, SACOL2321, SACOL2325, SACOL2342, SACOL2365, SACOL2379,
SACOL2385 or SACOL2599, based on the gene nomenclature from the
Staphylococcus aureus COL (SACOL) genome set forth in NCBI
Reference Sequence NC_002951.2; (b) a polypeptide encoded by a gene
from a same operon as one of the genes of (a); (c) an immunogenic
fragment of (a) or (b); (d) an immunogenic variant of any one of
(a) to (c); (e) a nucleic acid encoding the polypeptide of any one
of (a) to (d); or (f) any combination of (a) to (e).
[0127] In another aspect, the present invention provides a use of
an agent, wherein said agent is: (a) a polypeptide encoded by a
gene, wherein said gene is SACOL0029, SACOL0100, SACOL0101,
SACOL0105, SACOL0148, SACOL0154, SACOL0204, SACOL0205, SACOL0264,
SACOL0442, SACOL0461, SACOL0608, SACOL0660, SACOL0688, SACOL0690,
SACOL0704, SACOL0718, SACOL0720, SACOL0829, SACOL1054, SACOL1142,
SACOL1145, SACOL1320, SACOL1353, SACOL1416, SACOL1611, SACOL1637,
SACOL1680, SACOL1781, SACOL1812, SACOL1867, SACOL1912, SACOL1944,
SACOL2092, SACOL2144, SACOL2169, SACOL2171, SACOL2321, SACOL2325,
SACOL2342, SACOL2365, SACOL2379, SACOL2385 or SACOL2599, based on
the gene nomenclature from the Staphylococcus aureus COL (SACOL)
genome set forth in NCBI Reference Sequence NC_002951.2; (b) a
polypeptide encoded by a gene from a same operon as one of the
genes of (a); (c) an immunogenic fragment of (a) or (b); (d) an
immunogenic variant of any of (a) to (c); (e) a nucleic acid
encoding the polypeptide of any one of (a) to (d); or (f) any
combination of (a) to (e), for preventing and/or treating a
Staphylococcal intramammary infection (IMI) in a mammal.
[0128] In another aspect, the present invention provides a use of
an agent, wherein said agent is: (a) a polypeptide encoded by a
gene, wherein said agent is SACOL0029, SACOL0100, SACOL0101,
SACOL0105, SACOL0148, SACOL0154, SACOL0204, SACOL0205, SACOL0264,
SACOL0442, SACOL0461, SACOL0608, SACOL0660, SACOL0688, SACOL0690,
SACOL0704, SACOL0718, SACOL0720, SACOL0829, SACOL1054, SACOL1142,
SACOL1145, SACOL1320, SACOL1353, SACOL1416, SACOL1611, SACOL1637,
SACOL1680, SACOL1781, SACOL1812, SACOL1867, SACOL1912, SACOL1944,
SACOL2092, SACOL2144, SACOL2169, SACOL2171, SACOL2321, SACOL2325,
SACOL2342, SACOL2365, SACOL2379, SACOL2385 or SACOL2599, based on
the gene nomenclature from the Staphylococcus aureus COL (SACOL)
genome set forth in NCBI Reference Sequence NC_002951.2; (b) a
polypeptide encoded by a gene from a same operon as one of the
genes of (a); (c) an immunogenic fragment of (a) or (b); (d) an
immunogenic variant of any one of (a) to (c); (e) a nucleic acid
encoding the polypeptide of any one of (a) to (d); or (f) any
combination of (a) to (e), for the preparation of a medicament for
preventing and/or treating Staphylococcal intramammary infection
(IMI) in a mammal.
[0129] In another aspect, the present invention provides a
pharmaceutical composition (e.g., a vaccine) for preventing and/or
treating Staphylococcal intramammary infection (IMI) in a mammal,
said composition comprising an agent, wherein said agent is: (a) a
polypeptide encoded by a gene, wherein said gene is SACOL0029,
SACOL0100, SACOL0101, SACOL0105, SACOL0148, SACOL0154, SACOL0204,
SACOL0205, SACOL0264, SACOL0442, SACOL0461, SACOL0608, SACOL0660,
SACOL0688, SACOL0690, SACOL0704, SACOL0718, SACOL0720, SACOL0829,
SACOL1054, SACOL1142, SACOL1145, SACOL1320, SACOL1353, SACOL1416,
SACOL1611, SACOL1637, SACOL1680, SACOL1781, SACOL1812, SACOL1867,
SACOL1912, SACOL1944, SACOL2092, SACOL2144, SACOL2169, SACOL2171,
SACOL2321, SACOL2325, SACOL2342, SACOL2365, SACOL2379, SACOL2385 or
SACOL2599, based on the gene nomenclature from the Staphylococcus
aureus COL (SACOL) genome set forth in NCBI Reference Sequence
NC_002951.2; (b) a polypeptide encoded by a gene from a same operon
as one of the genes of (a); (c) an immunogenic fragment of (a) or
(b); (d) an immunogenic variant of any one of (a) to (c); (e) a
nucleic acid encoding the polypeptide of any one of (a) to (d); or
(f) any combination of (a) to (e), and optionally one or more
pharmaceutically acceptable excipients/carriers.
[0130] The Genbank accession numbers for the above-mentioned S.
aureus genes and encoded polypeptides are depicted in Table I
below:
TABLE-US-00001 TABLE I Genbank accession numbers for the
IMI-associated S. aureus genes and encoded polypeplides described
herein. Gene name GenBank Gene ID No. GenBank protein No. SACOL0029
3236748 (SEQ ID NO: 77) YP_184940.1(SEQ ID NO: 78) SACOL0100
3236858 YP_185004.1 SACOL0101 3236840 YP_185005.1 SACOL0105 3236844
YP_185009.1 SACOL0148 3236734 YP_185048.1 SACOL0154 3238707
YP_185054.1 SACOL0204 3236774 YP_185103.1 SACOL0205 3236775
YP_185104.1 SACOL0264 3236683 (SEQ ID NO: 79) YP_185159.1(SEQ ID
NO: 80) SACOL0442 3236485 (SEQ ID NO: 81) YP_185332.1(SEQ ID NO:
37) SACOL0461 3236475 YP_185351.1 SACOL0608 3236353 YP_185493.1
SACOL0660 3238251 YP_185544.1 SACOL0688 3236721 YP_185570.1
SACOL0690 3236723 YP_185572.1 SACOL0704 3236241 YP_185586.1
SACOL0718 3236599 (SEQ ID NO: 82) YP_185600.1(SEQ ID NO: 83)
SACOL0720 3236600 (SEQ ID NO: 84) YP_185601.1(SEQ ID NO: 62)
SACOL0829 3238649 YP_185703.1 SACOL1054 3236163 YP_185919.1
SACOL1142 3236098 YP_186005.1 SACOL1145 3237661 YP_186008.1
SACOL1320 3236394 YP_186175.1 SACOL1353 3236077 (SEQ ID NO: 85)
YP_186206.1(SEQ ID NO: 86) SACOL1416 3236563 (SEQ ID NO: 87)
YP_186268.1(SEQ ID NO: 88) SACOL1611 3236575 (SEQ ID NO: 89)
YP_186451.1(SEQ ID NO: 90) SACOL1637 3238018 YP_186477.1 SACOL1680
3238476 YP_186520.1 SACOL1781 3236594 YP_186614.1 SACOL1812 3238705
YP_186645.1 SACOL1867 3236101 (SEQ ID NO: 99) YP_186695.1 (SEQ ID
NO: 100) SACOL1912 3236086 YP_186737.1 SACOL1944 3237515 (SEQ ID
NO: 91) YP_186769.1(SEQ ID NO: 92) SACOL2092 3238693 YP 186907.1
SACOL2144 3237436 (SEQ ID NO: 93) YP_186957.1(SEQ ID NO: 94)
SACOL2169 3237416 YP 186981.1 SACOL2171 3237418 YP 186983.1
SACOL2321 3238070 YP 187128.1 SACOL2325 3238483 YP 187132.1
SACOL2342 3235997 YP 187148.1 SACOL2365 3238203 (SEQ ID NO: 95)
YP_187170.1(SEQ ID NO: 96) SACOL2379 3237628 YP 187183.1 SACOL2385
3238646 YP 187189.1 SACOL2599 3237186 (SEQ ID NO: 97)
YP_187390.1(SEQ ID NO: 98)
[0131] In an embodiment, the above-mentioned gene is SACOL0029,
SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416,
SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599.
[0132] As used herein, the term "vaccine" refers to any
compound/agent (vaccine component), or combinations thereof,
capable of inducing/eliciting an immune response in a host and
which permits to treat and/or prevent an infection and/or a
disease. Therefore, non-limiting examples of such agent include
proteins, polypeptides, protein/polypeptide fragments, immunogens,
antigens, peptide epitopes, epitopes, mixtures of proteins,
peptides or epitopes as well as nucleic acids, genes or portions of
genes (encoding a polypeptide or protein of interest or a fragment
thereof) added separately or in a contiguous sequence such as in
nucleic acid vaccines, and the like.
[0133] An immunogenic fragment of a protein/polypeptide is defined
as a part of a protein/polypeptide which is capable of
inducing/eliciting an immune response in a host. In an embodiment,
the immunogenic fragment is capable of eliciting the same immune
response in kind, albeit not necessarily in amount, as the
protein/polypeptide. An immunogenic fragment of a
protein/polypeptide preferably comprises one or more epitopes of
said protein/polypeptide. An epitope of a protein/polypeptide is
defined as a fragment of said protein/polypeptide of at least about
4 or 5 amino acids in length, capable of eliciting a specific
antibody and/or an immune cell (e.g., a T cell or B cell) bearing a
receptor capable of specifically binding said epitope. Two
different kinds of epitopes exist: linear epitopes and
conformational epitopes. A linear epitope comprises a stretch of
consecutive amino acids. A conformational epitope is typically
formed by several stretches of consecutive amino acids that are
folded in position and together form an epitope in a properly
folded protein. An immunogenic fragment as used herein refers to
either one, or both, of said types of epitopes. In an embodiment,
the immunogenic fragment of a protein/polypeptide comprises at
least 4 or 5 amino acid residues. In a further embodiment, the
immunogenic fragment comprises at least 6, 7, 8, 9, 10, 13, 14, 15,
20, 25, 30, 50 or 100 consecutive amino acids of the native
protein/polypeptide.
[0134] As will be understood by the person of ordinary skill,
agents (proteins/polypeptides, fragments thereof) having
non-naturally occurring modifications (e.g., immunogenic variants)
and which are capable of inducing an immune response specific for
the unmodified agent (e.g., capable of inducing the production of
antibodies capable of recognizing the unmodified agent) are also
within the scope of the term "vaccine component". For example, the
vaccine components of the present invention can be modified to
enhance their activity, stability, and/or bioavailability, and/or
to reduce their toxicity. Conservative amino acid substitutions may
be made, like for example replacement of an amino acid comprising
an acidic side chain by another amino acid comprising an acidic
side chain, replacement of a bulky amino acid by another bulky
amino acid, replacement of an amino acid comprising a basic side
chain by another amino acid comprising a basic side chain, and the
like. A person skilled in the art is well able to generate variants
of a protein/polypeptide. This is for instance done through
screening of a peptide library or by peptide changing programs. An
immunogenic variant according to the invention has essentially the
same immunogenic properties of said protein in kind, not
necessarily in amount. An immunogenic variant of a
protein/polypeptide of the invention may for instance comprise a
fusion protein and/or chimeric protein. For example, the biological
function of protein SACOL0442 identified herein is predicted to be
an exotoxin, enterotoxin or superantigen and it could potentially
interfere with the mammalian immune system and antibody production,
and/or show some toxicity in the host. Although such interference
was not observed when the SACOL0442 polypeptide was used in
combination with for example SACOL0720 during immunization (FIG.
15), it may be useful to modify the protein or polypeptide used for
vaccination so that the biological activity of the exotoxin is
decreased. For such a purpose, it is possible to inactivate the
exotoxin with chemicals (e.g., formaldehyde). It is also possible
to use molecular biology techniques to delete or mutate the
putative region(s) involved in exotoxin activity without loosing
immunogenicity (Chang et al., 2008). Another example is the
conjugation or mixture of amino acid-based components with nucleic
acids (e.g., genes or portions of genes added separately or in a
contiguous sequence) carbohydrates such as those found in microbial
polysaccharide capsules or biofilms.
[0135] In an embodiment, the above-mentioned polypeptide is a
polypeptide normally secreted or expressed at the surface of the
bacteria (e.g., Staphylococcus aureus).
[0136] In another embodiment, the above-mentioned polypeptide, or a
polypeptide substantially identical to said polypeptide, is
expressed in at least two different strains of Staphylococcus
aureus. Substantially identical as used herein refers to
polypeptides having at least 60% of similarity, in embodiments at
least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98% or 99% of similarity in their amino acid sequences. In
further embodiments, the polypeptides have at least 60%, 70%, 75%,
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of
identity in their amino acid sequences.
[0137] In an embodiment, the above-mentioned immunogenic fragment
comprises a sequence that is conserved (i.e. identical) in at least
two different strains of Staphylococcus aureus. In further
embodiments, the above-mentioned immunogenic fragment comprises a
sequence that is conserved (i.e. identical) in at least 3, 4, 5, 6,
7, 8, 9 or 10 different strains of Staphylococcus aureus. In
another embodiment, the above-mentioned strains of Staphylococcus
aureus are COL, RF122, NCTC 8325, JH1, JH9, Newman, Mu3, Mu50,
USA300-FPR3757, N315, MW2 or MSSA476. In an embodiment, the
above-mentioned strains of Staphylococcus aureus are associated
with bovine mastitis (e.g., RF122).
[0138] The similarity and identity between amino acid or nucleotide
sequences can be determined by comparing each position in the
aligned sequences. Optimal alignment of sequences for comparisons
of similarity and/or identity may be conducted using a variety of
algorithms, for example using a multiple sequence alignment
program/software well known in the art such as ClustalW.TM.,
SAGA.TM., UGENE.TM. or T-coffee.TM.. Examples of multiple sequence
alignments are described in the examples below and depicted in
FIGS. 11A-D and FIGS. 12A-K.
[0139] Also within the context of the present invention is the in
vivo administration of a nucleic acid of the invention to a mammal
so that one or more proteins/polypeptides (or a fragment thereof)
of interest is/are expressed in the mammal (e.g., nucleic acid
vaccine, DNA or RNA vaccine).
[0140] The nucleic acid of the present invention preferably
comprises a nucleotide sequence that encodes one or more
proteins/polypeptides noted above (or fragments thereof) operably
linked to regulatory elements needed for gene expression, such as a
promoter, an initiation codon, a stop codon, enhancers, and a
polyadenylation signal. Regulatory elements are preferably selected
that are operable in the species to which they are to be
administered.
[0141] The nucleic acid of the present vaccine can be "naked" DNA
or can be operably incorporated in a vector. Nucleic acids may be
delivered to cells in vivo using methods well known in the art such
as direct injection of DNA, receptor-mediated DNA uptake,
viral-mediated transfection or non-viral transfection and
lipid-based transfection, all of which may involve the use of
vectors. Direct injection has been used to introduce naked DNA into
cells in vivo (see e.g., Acsadi et al. (1991) Nature 332:815-818,
Wolff et al. (1990) Science 247:1465-1468). A delivery apparatus
(e.g., a "gene gun") for injecting DNA into cells in vivo may be
used. Such an apparatus may be commercially available (e.g., from
BioRad). Naked DNA may also be introduced into cells by complexing
the DNA to a cation, such as polylysine, which is coupled to a
ligand for a cell-surface receptor (see for example Wu, G. and Wu,
C. H. (1988) J. Biol. Chem. 263: 14621, Wilson et al. (1992) J.
Biol. Chem. 267: 963-967, and U.S. Pat. No. 5,166,320). Binding of
the DNA-ligand complex to the receptor may facilitate uptake of the
DNA by receptor-mediated endocytosis. A DNA-ligand complex linked
to adenovirus capsids which disrupt endosomes, thereby releasing
material into the cytoplasm, may be used to avoid degradation of
the complex by intracellular lysosomes (see for example Curiel et
al. (1991) Proc. Natl. Acad. Sci. USA 88: 8850, Cristiano et al.
(1993) Proc. Natl. Acad. Sci. USA 90:2122-2126).
[0142] Useful delivery vectors include biodegradable microcapsules,
immuno-stimulating complexes (ISCOMs) or liposomes, and genetically
engineered attenuated live vectors such as viruses or bacteria.
Examples of suitable attenuated live bacterial vectors include
Salmonella typhimurium, Salmonella typhi, Shigella, Bacillus,
Lactobacillus, Bacille Calmette-Guerin (BCG), Escherichia coli,
Vibrio cholerae, Campylobacter, or any other suitable bacterial
vector, as is known in the art. Methods of transforming live
bacterial vectors with an exogenous DNA construct are well
described in the art. See, for example, Joseph Sambrook and David
W. Russell, Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(2001).
[0143] Preferred viral vectors include Bacteriophages, Herpes
virus, Adenovirus, Polio virus, Vaccinia virus, defective
retroviruses, adeno-associated virus (AAV) and Avipox. Methods of
transforming viral vector with an exogenous DNA construct are also
well described in the art. See Sambrook and Russell, above.
[0144] Liposome vectors are unilamellar or multilamellar vesicles,
having a membrane portion formed of lipophilic material and an
interior aqueous portion. The aqueous portion is used in the
present invention to contain the polynucleotide material to be
delivered to the target cell. It is generally preferred that the
liposome forming materials have a cationic group, such as a
quaternary ammonium group, and one or more lipophilic groups, such
as saturated or unsaturated alkyl groups having about 6 to about 30
carbon atoms. One group of suitable materials is described in
European Patent Publication No. 0187702, and further discussed in
U.S. Pat. No. 6,228,844 to Wolff et al., the pertinent disclosures
of which are incorporated by reference. Many other suitable
liposome-forming cationic lipid compounds are described in the
literature. See, e.g., L. Stamatatos, et al., Biochemistry 27:3917
3925 (1988), and H. Eibl, et al., Biophysical Chemistry 10:261 271
(1979). Alternatively, a microsphere such as a
polylactide-coglycolide biodegradable microsphere can be utilized.
A nucleic acid construct is encapsulated or otherwise complexed
with the liposome or microsphere for delivery of the nucleic acid
to a tissue, as is known in the art.
[0145] Alternatively, the nucleic acid (e.g., DNA or RNA) may be
incorporated in a cell in vitro or ex vivo by transfection or
transformation, and the transfected or transformed cell (e.g., an
immune cell such as a dendritic cell), which expresses the protein
or polypeptide of interest (or a fragment thereof), may be
administered to the host. Following administration, the cell will
express the protein or polypeptide of interest (or a fragment
thereof) in the host, which will in turn lead to the induction of
an immune response directed against the protein, polypeptide or
fragment thereof.
[0146] Also encompassed by the methods, uses, pharmaceutical
compositions and kits of the present invention is passive
immunization, which is the injection of antibodies or antiserum,
previously generated against the pathogen, in order to protect or
cure a recipient animal of an infection or future infection.
Protection fades over the course of a few weeks during which time
the active immunization with protein and/or DNA (as described
above) will have time to generate a lasting protective response.
Serum for passive immunization can be generated by immunization of
donor animals using the S. aureus antigens (proteins, polypeptides
or nucleic acids), as described above. This serum, which contains
antibodies against the antigens, can be used immediately or stored
under appropriate conditions. It can be used to combat acute
infections (IMI) or as a prophylactic (Tuchscherr et al., 2008).
Use of antibodies or serums in a passive immunization can be
combined with other agents such as an antibiotic to increase the
cure rate of an infection currently in progress or to increase
protection against an imminent infection.
[0147] Also encompassed by the methods, uses, pharmaceutical
compositions and kits of the present invention is immunization with
the Staphylococcus aureus bacteria in attenuated live or
inactivated form (e.g., S. aureus having at least one of the genes
of the present invention mutated (e.g., .DELTA.442a, .DELTA.442b
and .DELTA.720 of SACOL442 and SACOL720, as described in Example
6). Mutation as used herein includes a substitution, a deletion
and/or an insertion of one or more nucleotides that prevents
expression of the polypeptide encoded by a gene of the present
invention or that prevents expression of a functional polypeptide.
In a preferred embodiment, the mutation prevents expression of the
polypeptide (e.g., .DELTA.442a, .DELTA.442b and .DELTA.720 of
SACOL442 and SACOL720, as described in Example 6). In another
specific embodiment, the mutation is a deletion or an insertion. It
is expected that a mutated strain of S. aureus having a mutation at
any position of one of the genes of the present invention that
prevents expression of the polypeptide can be used as an attenuated
live vaccine in accordance with the present invention. Attenuated
live vaccines, i.e. vaccines comprising the bacterium according to
the invention in a live attenuated form, have the advantage over
inactivated vaccines that they best mimic the natural way of
infection. In addition, their replicating abilities allow
vaccination with low amounts of bacteria; their number will
automatically increase until it reaches the trigger level of the
immune system. From that moment on, the immune system will be
triggered and will finally eliminate the bacteria. A minor
disadvantage of the use of live attenuated bacteria however might
be that inherently there is a certain level of virulence left. This
need not be a real disadvantage as long as the level of virulence
is acceptable, i.e. as long as the vaccine at least decreases the
mammal IMI symptoms. Of course, the lower the rest virulence of the
live attenuated vaccine is, the less influence the vaccination has
on weight gain during/after vaccination.
[0148] The components identified in accordance with the teachings
of the present invention have a prophylactic and/or therapeutic
value such as they can be used to raise an immune response to
prevent and/or combat diseases or conditions, and more particularly
diseases or conditions related to microbial infections.
[0149] The terms "treat/treating/treatment" and
"prevent/preventing/prevention" as used herein, refers to eliciting
the desired biological response, i.e., a therapeutic and
prophylactic effect, respectively. In accordance with the subject
invention, the therapeutic effect comprises one or more of a
decrease/reduction in the severity of the disease (e.g., a
reduction or inhibition of infection), a decrease/reduction in
symptoms and disease-related effects, an amelioration of symptoms
and disease-related effects, and an increased survival time of the
affected host animal, following administration of the at least one
agent (or of a composition comprising the agent). In accordance
with the invention, a prophylactic effect may comprise a complete
or partial avoidance/inhibition or a delay of infection, and an
increased survival time of the affected host animal, following
administration of the at least one agent (or of a composition
comprising the agent).
[0150] As used herein, the term "pharmaceutically acceptable"
refers to vaccine components (e.g., excipients, carriers) and
compositions that are physiologically tolerable and do not
typically produce an allergic or similar untoward reaction, such as
gastric upset, dizziness and the like, when administered to a
subject. Preferably, as used herein, the term "pharmaceutically
acceptable" means approved by regulatory agency of the federal or
state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and in
humans. The term "excipient" refers to a diluent, carrier, or
vehicle with which the vaccine components of the present invention
may be administered. Sterile water or aqueous saline solutions and
aqueous dextrose and glycerol solutions may be employed as
carriers, particularly for injectable solutions.
[0151] In an embodiment, the agent of the present invention is
administered in combination with an adjuvant or immunostimulant.
Suitable adjuvant or immunostimulant that may improve the efficacy
of components to raise an immune response include but is not
limited to oils (e.g., mineral oils, emulsified oil such as
EMULSIGEN.TM.-D), metallic salts (e.g., alum, aluminum hydroxide or
aluminum phosphate), natural and artificial microbial components
(e.g., bacterial liposaccharides, Freund's adjuvants, muramyl
dipeptide (MDP), cyclic-diguanosine-5'-monophosphate (c-di-GMP),
pathogen-associated molecular patterns (PAMPS)), plant components
(e.g., Quil A), and/or one or more substances that have a carrier
effect (e.g., bentonite, latex particles, liposomes, ISCOM.TM. and
polyphosphazine (PCPP) copolymers). Immunization with synthetic
nanoparticles (such as those made from a biodegradable synthetic
polymer like poly(D,L-lacticco-glycolic acid)) containing antigens
plus ligands that signal through TLR to stimulate proinflammatory
cytokines is also possible (Kasturi et al, 2011).
[0152] Vaccine components of the invention may be administered in a
pharmaceutical composition. Pharmaceutical compositions may be
administered in unit dosage form. Any appropriate route of
administration may be employed, for example, parenteral,
subcutaneous, intramuscular, intramammary, intracranial,
intraorbital, ophthalmic, intraventricular, intracapsular,
intraarticular, intraspinal, intracisternal, intraperitoneal,
intranasal, aerosol, or oral administration. Examples of specific
routes of administration include parenteral, e.g., intravenous,
intradermal, subcutaneous, intramammary; oral (e.g., inhalation);
transdermal (topical); transmucosal, and rectal administration.
[0153] Conventional pharmaceutical practice may be employed to
provide suitable formulations or compositions to administer such
vaccine components with or without adjuvants to subjects. Methods
well known in the art for making pharmaceutical compositions and
formulations are found in, for example, Remington: The Science and
Practice of Pharmacy, (20.sup.th ed.) ed. A. R. Gennaro A R., 2000,
Lippincott: Philadelphia. Formulations for parenteral
administration may, for example, contain excipients, sterile water,
or saline, polyalkylene glycols such as polyethylene glycol,
miglyol, oils of vegetable origin, or hydrogenated napthalenes.
Biocompatible, biodegradable lactide polymer, lactide/glycolide
copolymer, or polyoxyethylene-polyoxypropylene copolymers may be
used to control the release of the compounds. Other potentially
useful parenteral delivery systems for compounds of the invention
include ethylenevinyl acetate copolymer particles, osmotic pumps,
implantable infusion systems, and liposomes. Formulations for
inhalation or intramammary injection may contain excipients, or
example, lactose, or may be aqueous solutions containing, for
example, polyoxyethylene-9-lauryl ether, miglyol, glycocholate and
deoxycholate, or may be oily solutions (e.g., paraffin oil) for
administration in the form of nasal drops, or as a gel.
[0154] Therapeutic formulations may be in the form of liquid
solutions or suspension; for oral administration, formulations may
be in the form of tablets or capsules; and for intranasal
formulations, in the form of powders, nasal drops, or aerosols.
Solutions or suspensions used for parenteral, intradermal,
intramammary or subcutaneous application can include the following
components: a sterile diluent such as water for injection, saline
solution, fixed oils (e.g., paraffin oil), polyethylene glycols,
glycerine, propylene glycol, miglyol or other synthetic solvents,
antibacterial agents such as benzyl alcohol or methyl parabens;
antioxidants such as ascorbic acid or sodium bisulfite; chelating
agents such as ethylenediaminetetraacetic acid; reducing agents
such dithiothreitol, buffers such as acetates, citrates or
phosphates and agents for the adjustment of tonicity such as sodium
chloride or dextrose. The pH can be adjusted with acids or bases,
such as hydrochloric acid or sodium hydroxide. The parenteral
preparation can be enclosed in ampoules, disposable syringes or
multiple dose vials made of glass or plastic.
[0155] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous or
intramammary administration, suitable carriers include
physiological saline, bacteriostatic water, Cremophor.TM. ELTM
(BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
[0156] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets or feed. For the purpose of oral vaccine
administration, the active components can be incorporated with
excipients and used in the form of tablets, troches, capsules or in
feed. Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel.TM., or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0157] For administration by inhalation, the vaccine components are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as carbon dioxide, or a nebulizer.
[0158] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0159] Liposomal suspensions (including liposomes targeted to
specific cell types) can also be used as pharmaceutically
acceptable carriers.
[0160] The pharmaceutical compositions may also contain preserving
agents, solubilising agents, stabilising agents, wetting agents,
emulsifiers, sweeteners, colorants, odorants, salts for the
variation of osmotic pressure, buffers, coating agents or
antioxidants. They may also contain other therapeutically valuable
agents.
[0161] Intravenous, intramuscular, intramammary or oral
administration is a preferred form of use. The dosages in which the
components of the present invention are administered in effective
amounts depend on the nature of the specific active ingredient, the
host and the requirements of the subject and the mode of
application. In general, an amount of about 0.01 mg-500 mg per
dose, come into consideration.
[0162] Toxicity or efficacy of vaccine components to elicit an
immune response can be determined by standard procedures in cell
cultures or experimental animals. The dose ratio between toxic and
immune stimulatory effects can be measured. Components that exhibit
large ratios are preferred. While components that exhibit toxic
side effects may be used, care should be taken to design a delivery
system in order to minimize potential damage to cells and, thereby,
reduce side effects.
[0163] Data obtained from cell culture assays and laboratory animal
studies can be used in formulating a range of dosage for use in
large animals and humans. The dosage of such components lies
preferably within a range of administered concentrations that
include efficacy with little or no toxicity. The dosage may vary
within this range depending upon the dosage form employed and the
route of administration utilized.
[0164] The skilled artisan will appreciate that certain factors may
influence the dosage required to effectively raise an immune
response in a subject. Moreover, the therapeutically effective
amount of a component of the present invention may require a series
of doses.
[0165] The present invention also encompasses kits comprising the
components of the present invention. For example, the kit can
comprise one or more components. The components can be packaged in
a suitable container and device for administration. The kit can
further comprise instructions for using the kit.
[0166] The present invention also provides a method of diagnosing
Staphylococcal IMI in a mammal, said method comprising: determining
a level of expression of at least one gene, wherein said gene is
SACOL0029, SACOL0100, SACOL0101, SACOL0105, SACOL0148, SACOL0154,
SACOL0204, SACOL0205, SACOL0264, SACOL0442, SACOL0461, SACOL0608,
SACOL0660, SACOL0688, SACOL0690, SACOL0704, SACOL0718, SACOL0720,
SACOL0829, SACOL1054, SACOL1142, SACOL1145, SACOL1320, SACOL1353,
SACOL1416, SACOL1611, SACOL1637, SACOL1680, SACOL1781, SACOL1812,
SACOL1867, SACOL1912, SACOL1944, SACOL2092, SACOL2144, SACOL2169,
SACOL2171, SACOL2321, SACOL2325, SACOL2342, SACOL2365, SACOL2379,
SACOL2385 or SACOL2599, based on the gene nomenclature from the
Staphylococcus aureus COL (SACOL) genome set forth in NCBI
Reference Sequence NC_002951.2, or the level of activity of a
polypeptide encoded by said one or more genes (at least one gene),
in a biological sample from said mammal; and comparing said level
of expression or activity to a reference level of expression or
activity; wherein a higher expression or activity in said
biological sample relative to said reference expression or activity
is indicative that said mammal has staphylococcal IMI.
[0167] In an embodiment, the above-mentioned reference expression
or activity is a level of expression or activity determined in a
corresponding biological sample from a mammal known to not having
staphylococcal IMI. Such reference expression or activity may be an
expression or activity corresponding to an average or median
expression or activity calculated based on measurements made in
several subjects not suffering from the condition (e.g., known to
not having staphylococcal IMI). The reference expression or
activity may be adjusted or normalized for age, gender, race, or
other parameters.
[0168] In an embodiment, the above-mentioned at least one gene is
SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353,
SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or
SACOL2599.
[0169] "Sample" or "biological sample" refers to any solid or
liquid sample isolated from a live being. In a particular
embodiment, it refers to any solid (e.g., tissue sample) or liquid
sample isolated from a mammal, such as milk, a biopsy material
(e.g., solid tissue sample), blood (e.g., plasma, serum or whole
blood), saliva, synovial fluid, urine, amniotic fluid and
cerebrospinal fluid. Such sample may be, for example, fresh, fixed
(e.g., formalin-, alcohol- or acetone-fixed), paraffin-embedded or
frozen prior to analysis of the infectious agents expression
level.
[0170] In an embodiment, the above-mentioned biological sample is
milk.
[0171] In an embodiment, the above-mentioned mammal is a cow.
[0172] In an embodiment, the above-mentioned level of expression is
determined by measuring the level of expression of a
polypeptide/protein encoded by said one or more genes. Methods to
measure the amount/level of selected polypeptides/proteins of this
invention (one or more of the polypeptides noted above) are well
known in the art. Protein/polypeptide levels may be detected either
directly using affinity reagents, such as an antibody or a fragment
thereof (for methods, see for example Harlow, E. and Lane, D (1988)
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.), or a ligand (natural or
synthetic) which binds the protein.
[0173] Protein/polypeptide levels may be detected based on other
properties, for example by measurement of the protein's activity,
which may entail enzymatic activity to produce a detectable product
(e.g., with altered spectroscopic properties) or a detectable
phenotype (e.g., alterations in cell growth/function).
[0174] Examples of methods to measure the amount/level of selected
proteins/polypeptides include, but are not limited to: Western
blot, immunoblot, enzyme-linked immunosorbant assay (ELISA),
radioimmunoassay (RIA), immunoprecipitation, surface plasmon
resonance, chemiluminescence, fluorescent polarization,
phosphorescence, immunohistochemical analysis, matrix-assisted
laser desorption/ionization time-of-flight (MALDI-TOF) mass
spectrometry, microcytometry, microarray, microscopy, flow
cytometry, and assays based on a property of the protein including
but not limited to DNA binding, ligand binding, interaction with
other protein partners or enzymatic activity.
[0175] In an embodiment, the amount of the polypeptide/protein
within the methods of the present invention is detected using
antibodies that are directed specifically against the
polypeptide/protein. The term "antibody" as used herein encompasses
monoclonal antibodies, polyclonal antibodies, multispecific
antibodies (e.g., bispecific antibodies), and antibody fragments,
so long as they exhibit the desired biological activity or
specificity. "Antibody fragments" comprise a portion of a
full-length antibody, generally the antigen binding or variable
region thereof. Interactions between antibodies and a target
polypeptide are detected by radiometric, colorimetric, or
fluorometric means. Detection of antigen-antibody complexes may be
accomplished by addition of a secondary antibody that is coupled to
a detectable tag, such as for example, an enzyme, fluorophore, or
chromophore.
[0176] Methods for making antibodies are well known in the art.
Polyclonal antibodies can be prepared by immunizing a suitable
subject (e.g., rabbit, goat, mouse, or other mammal) with the
polypeptide/protein of interest or a fragment thereof as an
immunogen. A polypeptide/protein "fragment" "portion" or "segment"
is a stretch of amino acid residues of at least about 5, 7, 10, 14,
15, 20, 21 or more amino acids of the polypeptide noted above. The
antibody titer in the immunized subject can be monitored over time
by standard techniques, such as with an enzyme linked immunosorbent
assay (ELISA) using immobilized exosomal marker polypeptide or a
fragment thereof. At an appropriate time after immunization, e.g.,
when the antibody titers are highest, antibody-producing cells can
be obtained from the animal, usually a mouse, and can be used to
prepare monoclonal antibodies by standard techniques, such as the
hybridoma technique originally described by Kohler and Milstein
(1975) Nature 256: 495-497, the human B cell hybridoma technique
(Kozbor et al. (1983) Immunol. Today 4: 72), the EBV-hybridoma
technique (Cole et al. (1985) in Monoclonal Antibodies and Cancer
Therapy, ed. Reisfeld and Sell (Alan R. Liss, Inc., New York,
N.Y.), pp. 77-96) or trioma techniques. The technology for
producing hybridomas is well known (see generally Coligan et al.,
eds. (1994) Current Protocols in Immunology, John Wiley & Sons,
Inc., New York, N.Y.).
[0177] Alternatively to preparing monoclonal antibody-secreting
hybridomas, a monoclonal antibody can be identified and isolated by
screening a recombinant combinatorial immunoglobulin library (e.g.,
an antibody phage display library) with a polypeptide or a fragment
thereof to thereby isolate immunoglobulin library members that bind
the polypeptide. Kits for generating and screening phage display
libraries are commercially available (e.g., the Pharmacia
Recombinant Phage Antibody System.TM., Catalog No. 27-9400-01; and
the Stratagene SurfZAP.TM. Phage Display Kit, Catalog No.
240612).
[0178] Furthermore, antibodies directed against one or more of the
polypeptides/proteins described herein may be obtained from
commercial sources.
[0179] The use of immobilized antibodies specific for the
polypeptides/proteins is also contemplated by the present invention
and is well known by one of ordinary skill in the art. The
antibodies could be immobilized onto a variety of solid supports,
such as magnetic or chromatographic matrix particles, the surface
of an assay place (such as microtiter wells), pieces of a solid
substrate material (such as plastic, nylon, paper), and the like.
An assay strip could be prepared by coating the antibody or a
plurality of antibodies in an array on solid support. This strip
could then be dipped into the test sample and then processed
quickly through washes and detection steps to generate a measurable
signal, such as a colored spot.
[0180] The analysis of a plurality (2 or more) of
polypeptides/proteins may be carried out separately or
simultaneously with one test sample. Several polypeptides/proteins
may be combined into one test for efficient processing of a
multiple of samples.
[0181] The analysis of polypeptides/proteins could be carried out
in a variety of physical formats as well. For example, the use of
microtiter plates or automation could be used to facilitate the
processing of large numbers of test samples. Alternatively, single
sample formats could be developed to facilitate immediate treatment
and diagnosis in a timely fashion. Particularly useful physical
formats comprise surfaces having a plurality of discrete,
addressable locations for the detection of a plurality of different
analytes. Such formats include protein microarrays, or "protein
chips" (see, e.g., Ng and Ilag, J. Cell Mol. Med. 6: 329-340, 2002)
and capillary devices.
[0182] In an embodiment, the above-mentioned level of expression is
determined by measuring the level of expression of a mRNA
transcribed from said one or more genes.
[0183] Methods to determine nucleic acid (mRNA) levels are known in
the art, and include for example polymerase chain reaction (PCR),
reverse transcriptase-PCR (RT-PCR), SAGE, quantitative PCR (q-PCR),
Southern blot, Northern blot, sequence analysis, microarray
analysis, detection of a reporter gene, or other DNA/RNA
hybridization platforms. For RNA expression, preferred methods
include, but are not limited to: extraction of cellular mRNA and
Northern blotting using labeled probes that hybridize to
transcripts encoding all or part of one or more of the nucleic
acids encoding the protein/polypeptide of this invention;
amplification of mRNA expressed from one or more of the nucleic
acids encoding the proteins/polypeptides of this invention using
specific primers, polymerase chain reaction (PCR), quantitative PCR
(q-PCR), and reverse transcriptase-polymerase chain reaction
(RT-PCR), followed by quantitative detection of the product by any
of a variety of means; extraction of total RNA from the biological
sample, which is then labeled and used to probe cDNAs or
oligonucleotides encoding all or part of the nucleic acids encoding
the proteins/polypeptides of this invention, arrayed on any of a
variety of surfaces.
[0184] The present invention also provides a kit or package
comprising reagents useful for determining the amount/level of one
or more proteins/polypeptides of the present invention, for example
a ligand that specifically bind to proteins/polypeptides, such as a
specific antibody, or to a nucleic acid encoding a
protein/polypeptide, such as an oligonucleotide (e.g., primer or
probe). Such kit may further comprise, for example, instructions
for the diagnosis of Staphylococcal IMI, control samples (e.g.,
samples to which the test sample may be compared to establish the
diagnostic), containers, reagents useful for performing the methods
(e.g., buffers, enzymes, immunodetection reagents, etc). The kit
may further include where necessary agents for reducing background
interference in a test, agents for increasing signal, software and
algorithms for combining and interpolating marker values to produce
a prediction of clinical outcome of interest, apparatus for
conducting a test, calibration curves and charts, standardization
curves and charts, and the like. The present invention also
provides a kit or package comprising one or more agents of the
present invention for treating and/or preventing Staphylococcal
IMI. Such kit may further comprise, for example, instructions for
the prevention and/or treatment of IMI in a mammal.
[0185] The use of the word "a" or "an" when used in conjunction
with the term "comprising" in the claims and/or the specification
may mean "one" but it is also consistent with the meaning of "one
or more", "at least one", and "one or more than one".
[0186] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as
"contains" and "contain") are inclusive or open-ended and do not
exclude additional, un-recited elements or method steps.
MODE(S) FOR CARRYING OUT THE INVENTION
[0187] The present invention is illustrated in further details by
the following non-limiting examples.
EXAMPLE 1: MATERIALS AND METHODS
[0188] Staphylococcus aureus strains. Two types of Staphylococcus
aureus isolates from cows were used in this study: chronic and
systematically isolated strains (i.e. strains isolated from bovine
mastitis with clinical signs (high somatic cell counts (SCC) in
milk or signs of inflammation). Chronic isolates were from cows
shedding a genetically identical S. aureus strain >55 days
apart, between dry off and calving as illustrated in FIG. 1
(1.sup.st and 2.sup.nd samples). Systematically isolated strains
were taken at calving or in the lactation period from cows shedding
high somatic cell counts (SCC) in milk or signs of inflammation
(mastitis). For the experimental infections described further
below, 3 chronic strains were used (#3, #557 and #1290) and were
compared to SHY97-3906, a previously described strain isolated from
a typical mastitis case with clinical signs (Diarra et al., 2002)
and of a known in vitro transcriptome (Allard et al., 2006). The
collection of isolates used in this study is shown in Table II
below.
TABLE-US-00002 TABLE II Staphyplococcus aureus mastitis isolates
used in the studies described herein Interval Isolate Type Date
(days) Herd Cow Quarter 3 Chr 20 Oct. 2005 -- 3 37 1 151 Chr 4 Jan.
2006 77 3 37 1 54 Chr 18 Nov. 2005 -- 2 147 4 353 Chr 10 Feb. 2006
85 2 147 4 140 Chr 1 Jan. 2006 -- 8 46 3 552 Chr 3 Apr. 2006 93 8
46 3 205 Chr 31 Jan. 2006 -- 8 40 4 996 Chr 20 May 2007 110 8 40 4
557 Chr 3 Apr. 2006 -- 3 16 1 1429 Chr 29 Jun. 2006 88 3 16 1 2099
Chr 25 Aug. 2006 -- 2 96 3 3992 Chr 17 Nov. 2006 85 2 96 3 1290 Chr
16 Jul. 2006 -- 1 83 4 2483 Chr 8 Sep. 2006 55 1 83 4 2484 Chr 15
Sep. 2006 -- 4 39 1 4210 Chr 8 Dec. 2006 85 4 39 1 3237 Chr 29 Sep.
2006 -- 4 36 4 4334 Chr 22 Dec. 2006 85 4 36 4 G3 R 15 Mar. 2006 --
12 19 C G6 R 16 Mar. 2006 -- 11 249 C G7 R 16 Mar. 2006 -- 11 156 C
G11 R 22 Mar. 2006 -- 5 28 C G17 R 3 Apr. 2006 -- 10 106 C G18 R 24
Mar. 2006 -- 7 15 C G23 R NA -- NA NA NA G26 R 6 Apr. 2006 -- 6 135
C G28 R 13 Apr. 2006 -- 5 32 C G51 R 16 Nov. 2005 -- 5 13 C 275 R
NA -- NA NA NA SHY97-3906 R From mastitis; Diarra, M S et al.,
2002; Allard et al., 2006 NA Newbould R From mastitis; Prasad and
Newbould, 1968 (ATCC 29740) NA ATCC 49775 -- Reference strain from
human -- ATCC 51811 -- Reference strain from human -- MRSA COL --
Reference MRSA strain from human -- N315 -- Reference MRSA strain
from human -- Chr, chronic; R, random; C, mix of all quarters; NA,
not available
[0189] Comparative genomic hybridization of S. aureus isolates. The
genetic relatedness of S. aureus isolates was determined by
comparative genomic DNA hybridization data obtained for 530 genes
printed on arrays as described previously (Atalla et al., 2008) and
is shown in FIG. 2.
[0190] Production of biofilms by S. aureus isolates. Biofilm
formation was evaluated by spectrophotometry in microplates using
crystal violet staining, as previously described with a few
modifications (Brouillette et al., 2005). Briefly, strains were
cultured from frozen stocks onto BHI agar plates and incubated
overnight at 35.degree. C. Three colonies were then inoculated into
7 ml of BHI containing 0.25% of supplemental glucose and incubated
at 35.degree. C. for 18 h with shaking at 225 rpm. This culture was
then diluted to 0.5 McFarland in BHI 0.25% glucose and transferred
into wells of a flat-bottom polystyrene microtiter plate half full
of the same medium. The plates were then incubated at 35.degree. C.
for 24 or 48 h. The supernatant was then discarded and the wells
were delicately washed three times with 200 .mu.l of PBS. The
plates were dried, stained for 30 min with crystal violet, washed
twice with 200 .mu.l of water and allowed to dry again. A volume of
200 .mu.l of 95% ethanol was added to each well and plates were
incubated at room temperature for 1 h with frequent agitation. The
absorbance of each well was then measured at 560 nm using a plate
reader (Bio-Tek Instruments). The results were collected from at
least three independent experiments in which the biofilm formation
of each culture tested was evaluated in four replicates.
[0191] In vitro culture conditions. For bacterial growth in low and
high iron concentrations, bacteria were first grown in
Mueller-Hinton broth (MHB, Becton Dickinson Sparks, Md., USA) in an
orbital shaker (225 RPM) at 35.degree. C. At an A.sub.600nm of 0.6
(approx. 1.times.10.sup.8 CFU/ml), the culture was divided in two
pre-warmed sterile flasks. Iron limitation was induced by addition
of 2,2-dipyridyl (Sigma Chemicals, St-Louis, Mo.) at 600 .mu.M to
one culture, whereas FeCl.sub.3 was added to the other culture at
10 .mu.M. The growth rate of S. aureus in the presence of
supplemental 2,2-dipyridyl or FeCl.sub.3 was equivalent in both
test conditions and these supplements did not affect the
exponential growth during the one-hour treatment period. After 1 h,
the cultures reached an A.sub.600nm of 1.0 (approx. 10.sup.9
CFU/ml) and 5 ml of each culture were treated with RNAprotect.TM.
(QIAgen, Mississauga, ON, Canada) for 10 min before harvesting the
cells by centrifugation. For bacterial growth in freshly collected
non-mastitic milk, S. aureus SHY97-3906, #3, #557 and #1290 were
first grown overnight in MHB in an orbital shaker (225 RPM) at
35.degree. C. In the morning, 250 ml of fresh milk was inoculated
with bacteria from the overnight culture to obtain a bacterial
concentration of approximately 10.sup.4 CFU/ml. Bacterial growth
was allowed for 7h in an orbital shaker (225 RPM) at 35.degree. C.
before isolating the bacteria from milk as described below. For
bacterial growth destined to the qPCR amplification of icaC and hld
genes, S. aureus was grown in brain heart infusion (BHI) broth (BD,
ON, Canada) until the cultures reached an A.sub.600nm of 0.6.
[0192] Animals. All animal experiments were approved by local
institutional animal care committees and conducted in accordance
with the guidelines of the Canadian Council on Animal Care. Animals
were kept in a level 2 confinement barn for the entire duration of
each trial. Eight Multiparous Holstein cows in mid lactation were
housed at the Dairy and Swine Research and Development Centre of
Agriculture and Agri-Food Canada in Sherbrooke, QC, Canada. Cows
were selected as not infected before the experiment by bacterial
analysis of aseptic milk samples and somatic cell count (SCC)
determination.
[0193] Experimental infections. Before the animal trials, the
relation between the absorbance of bacterial cultures (A.sub.600nm)
and CFU was determined as previously described (Petitclerc et al.,
2007). The morning of the challenge, a volume of the overnight
culture of S. aureus in MHB was transferred to 200 ml of fresh MHB
to obtain an A.sub.600nm of 0.1 and grown at 35.degree. C. without
shaking until the A.sub.600nm reached a value corresponding to
10.sup.8 CFU/ml in the exponential phase of growth. Bacteria were
then diluted in sterile physiological saline (Baxter Healthcare
Corporation, Deerfield, Ill.) to obtain 50 CFU in 3 ml.
Intramammary (IM) infusions were performed the same day immediately
after the late evening milking. Each individual mammary gland
quarter was infused with 3 ml of a bacterial suspension. Each of
the 8 cows was infused with the four different S. aureus strains
and the position of each strain in the four quarters alternated
between the animals. Infusion of mammary quarters with bacteria was
performed according to the procedure described by Nickerson et al.
(1999) with few modifications. All infusions were performed after
milking. Before inoculation, the teat end of each quarter was
thoroughly wiped to remove gross contamination and dipped in a
solution of iodine. After a minimum of 30 second contact time,
teats were wiped dry and subsequently scrubbed with gauzes soaked
in 70% ethanol. Teats were allowed to air-dry. Foremilk was then
discarded and the IM infusion was performed. Immediately
afterwards, all quarters were thoroughly massaged and teats dipped
again with an iodine solution. Disposable gloves were worn
throughout the procedure and changed before proceeding to the next
animal.
[0194] Milk samples. Milk samples were always aseptically collected
before milking the experimentally infected cows using the procedure
suggested by the National Mastitis Council (1996). After foremilk
was discarded, a 10 ml milk sample was collected for each
individual quarter in a 50 ml sterile vial. Milk samples were
serially diluted and 200 .mu.l plated on TSA and on mannitol salt
agar plates (MSA; Becton Dickinson Sparks, Md., USA) for S. aureus
identification. Plates were then incubated for 24 h at 35.degree.
C. before colony counting. The dilution that showed between 30 and
300 colonies was the one considered for the calculation of
bacterial concentration. Considering the wide range of dilutions
plated and the great number of samples to be tested, only one plate
per sample was considered. Samples that showed 0 colonies for the
undiluted milk was considered to have a concentration of .ltoreq.5
CFU/ml. The concentration of lactose, protein, fat and SCC in milk
which indicates the presence of leukocytes in response to an
infection were determined in a commercial laboratory (Valacta Inc.,
Ste-Anne-de-Bellevue, QC, Canada). This was done every two days
over the 18-day period of experimental infections.
[0195] Milk collection for bacterial isolation. Milk was collected
from each quarter of each cow every 2-4 days in the morning for a
total of 18 days. Milk was harvested using individual quarter
milking units. Prior to milking, the four reservoirs were
disinfected with 70% ethanol. A maximum of one litre of milk was
collected for centrifugation and isolation of bacteria.
[0196] Bacterial isolation from milk. Mastitic milk from
experimentally infected cows or freshly collected milk from
non-infected cows used for bacterial growth in vitro was treated
with 200 .mu.g/ml of protease from bovine pancreas (Sigma) for 10
min in an orbital shaker (100 RPM) at 35.degree. C. After the
treatment, the milk was centrifuged 15 minutes at 4000 g. The
supernatant was discarded and the pellet was washed with PBS and
centrifuged. The supernatant was discarded and the bacterial cell
pellet was suspended in 1 ml PBS and treated with RNAprotect.TM.
for 10 min before harvesting the cells by centrifugation. The cell
pellet was then stored frozen at -86.degree. C.
[0197] RNA extraction and purification. Bacterial pellets from in
vitro and in vivo growth conditions were suspended in 200 .mu.l of
TE buffer containing 200 .mu.g/ml lysostaphin.TM. (Sigma). Cell
lysis was allowed for 1 h at room temperature before RNA extraction
with the TRIzol.TM. Max bacterial RNA isolation Kit (Invitrogen,
Carlsbad, Calif., USA) followed by a DNase treatment with TURBO.TM.
DNase (Ambion, Austin, Tex., USA). RNA from bacteria isolated from
the milk of infected cows underwent an additional purification step
using the MICROBEnrich.TM. Kit from Ambion followed by a second
round of DNase treatment with TURBO.TM. DNase (Ambion). The RNA
concentration in samples was determined by an A.sub.260nm reading
and the samples were stored at -86.degree. C. until used.
[0198] cDNA probe synthesis. Fluorescent probes for hybridization
to DNA arrays were generated through an aminoallyl cDNA labelling
procedure. Briefly, 2.5-5 .mu.g of total RNA was mixed with 5 .mu.g
of random hexamers (Amersham Biosciences, Piscataway, N.J., USA).
This mixture was denatured at 70.degree. C. for 10 min. Reverse
transcription was carried out in the presence of RT buffer
(Invitrogen), 10 mM DDT, dNTP mix (final concentration: 500 .mu.M
dATP, dCTP, dGTP, 300 .mu.M dTTP and 200 .mu.M
5-[3-Amioally]-2-dUTP (Sigma)) and 400 U of Superscript.TM. II RT
was added to the RNA preparation and the reaction was allowed to
occur for 2 h at 42.degree. C. The RNA was hydrolyzed after
transcription with 200 mM NaOH and 100 mM EDTA at 65.degree. C. for
15 min. The reaction was neutralized with 333 .mu.M HEPES pH 7.5.
The cDNAs were purified before fluorescent labeling through three
passages on a Microcon.TM. YM30 (Millipore). The resulting
aadUTP-cDNA was coupled with NHS-Cy5 (Fluorolink.TM. Cy5
monoreactive pack, Amersham Biosciences) in the presence of 100
.mu.M NaHCO.sub.3, pH 9.0 for 1 h at room temperature. The
reactions were quenched with 1.25 .mu.M hydroxylamine for 15 min at
room temperature. The fluorescent cDNAs were purified by using a
QIAquick.TM. PCR purification kit (QIAgen), including three washing
steps with buffer PE, before eluting in water.
[0199] DNA arrays. Arrays were previously described (Allard et al.,
2006; Moisan et al., 2006) and contained a selection of 530 known
or putative genes implicated in iron/cation-transport and
acquisition systems, virulence (biofilm genes, adhesins, toxins and
homologs of such genes), secretion, general stress responses,
sensory/regulator systems, antibiotic resistance and various
biosynthesis and metabolism genes. Genes were first amplified by
PCR using Sigma Genosys.TM. (Oakville, ON, Canada) primers based on
the published genome sequence of the S. aureus COL genome as well
as other primers that were designed using the Primer3.TM. software
(primer3_www.cgi v 0.2). PCR products were then purified using the
QIAquick.TM. PCR purification kit, precipitated, suspended at a
concentration of 150 ng/.mu.l in 50% DMSO and printed in triplicate
on Corning.TM. GAPS II slides (Corning, Corning, N.Y., USA) with
the help of the Microarray printing platform of the Biotechnology
Research Institute of Montreal (Montreal, QC, Canada). Control
spots were from the Lucidea Universal Scorecard (Amersham,
Piscataway, N.J.).
[0200] Hybridization to DNA arrays and analysis. The probes were
suspended in 16.5 .mu.l of hybridization buffer (5X SSC, 0.1% SDS,
25% formamide). The prehybridizalion, hybridization and washing
steps were done as prescribed for Corning.TM. Gaps II Slides.
Hybridization signals for each spot were quantified with the
ScanArrayExpress.TM. Microarray Scanner and the
ScanArrayExpress.TM. software V 2.2.0.0022 (Perkin Elmer,
Wellesley, Mass., USA). A mean intensity value was calculated as
the: .SIGMA.(intensity of every spots)/number of genes on
array=100%. Only genes with a Cy5 signal intensity of .gtoreq.100%,
i.e., greater or equal to the mean Cy5 intensity of the entire
array were analyzed. Thus, this report identifies only genes that
were strongly expressed in vivo during mastitis because their
signal intensities on arrays were higher than average.
[0201] Quantitative PCR (qPCR). Additional RNA preparations were
obtained for qPCR analyses. Bacteria were collected from broth
cultures (low-iron and iron-rich) as well as from milk (in vitro
and in vivo) as described above. Also, RNA was extracted as
mentioned earlier. Total RNA (2-5 .mu.g) was reversed transcribed
with 0.5 mM dNTP, 50 ng random hexamers and 200 U of Invitrogen
Superscript.TM. II Reverse Transcriptase according to the
manufacturer recommendations. RNA was denatured and the cDNAs were
purified with QIAquick.TM. PCR purification kit. One .mu.l of cDNA
was amplified on the Stratagene.TM. MX3000P Real-Time PCR
(Sratagene, LaJolla, Calif. USA) with a master mix composed of 6 mM
Tris-HCl pH 8.3, 25 mM KCl, 4 mM MgCl2, 75 mM trehalose, 0.1% (v/v)
Tween.TM. 20, 0.1 mg/ml nonacetylated BSA, 0.07x SYBR green
(Invitrogen), 125 nM dNTPs and 0.5 U JumpStart.TM. Taq DNA
Polymerase (Sigma), and 100 nM of the primers listed in Table III
below. Reaction mixtures were denatured for 10 min at 95.degree.
C., followed by 40 cycles of 1 min at 60.degree. C., 1 min at
72.degree. C. and finished with a dissociation ramp from 55.degree.
C. to 95.degree. C. The level of expression of each gene was
calculated by using the Ct of the in vitro experiments as the
calibrator (expression fold=2.sup.-.DELTA.Ct, where .DELTA.Ct
represents the difference between the Ct of the in vitro and in
vivo conditions). The fold expression of genes from each experiment
was then normalized with their respective gyrB expression level.
The gyrB gene was found to be constitutively expressed during
growth up to the early stationary phase (Goerke et al., 2000),
which is well within the boundaries of the growth experiments
described herein. Also, it was found that the expression of gyrB in
the in vitro as well as in the in vivo conditions was not
significantly modulated.
TABLE-US-00003 TABLE III Sequence of primers used for quantitative
PCR (qPCR). ORF Gene Description Forward sequence Reverse sequence
SACOL0005 gyrB DNA gyrase, B GGTGCTGGGCAAATACAAGT
TCCCACACTAAATGGTGCAA subuni (SEQ ID NO: 1) (SEQ ID NO: 2) SACOLO148
capM Capsular AGGTCCTAGACCAGCGCTTT TCTCTCCCATCACTTGAGC
polysaccharide (SEQ ID NO: 3) (SEQ ID NO: 4) biosynthesis SACOL0442
Exotoxin, putative CATACACAGTTGCTGGCAGAG CAAGCCATAGGAAATATGAGCA
(SEQ ID NO: 5) (SEQ ID NO: 6) SACOL0718 ABC transporter,
GCACAAGAAGTGTTGCGAGA GTCGTTTTCCCAGATCCAGA unknown function (SEQ ID
NO: 7) (SEQ ID NO: 8) SACOL2022 hld Delta-hemolysin,
TAATTAAGGAAGGAGTGATTTCA TTTTTAGTGAATTTGTTCACTGTGT RNA III ATG C
(SEQ ID NO: 9) (SEQ ID NO: 10) SACOL2171 Unknown function,
CAATGCATCGCGAAAACTTA GCTTAGCTTGTGGGAACTGG possibly iron- (SEQ ID
NO: 11) (SEQ ID NO: 12) related SACOL2325 Transcriptional
CATCTCGGCTTAGGTTACGC TTTTTCGGCCTAAGTTTGGA regulator, LysR (SEQ ID
NO: 13) (SEQ ID NO: 14) family SACOL269 icaA Biosynthesis of
TTGCGTTAGCAAATGGAGAC AATGCGTGCAAATACCCAAG polysaccharides, (SEQ ID
NO: 15) (SEQ ID NO: 16) biofilms
[0202] Sequence alignments. Nucleic acid and amino acid sequences
of S. aureus genes (including SACOL0442 and SACOL0720, as well as
other genes) and encoded proteins from Staphylococcus aureus
strains COL, RF122, NCTC 8325, JH1, JH9, Newman, Mu3, Mu50,
USA300-FPR3757, N315, MW2 or MSSA476 were obtained from the
Comprehensive Microbial Resource (CMR) of the J. Craig Venter.TM.
Institute at http://cmr.jcvi.org/tigr-scripts/CMR/CmrHomePage.cgi
(Peterson, J. D., et al., Nucleic Acids Res. 2001 29(1): 123-5).
The sequences were submitted to a multiple sequence alignment
program for DNA or proteins, ClustalW2.TM., available online for
free from the European Bioinformatics Institute (www.ebi.ac.uk;
Larkin M. A. et al., 2007. Bioinformatics 23(21): 2947-2948).
[0203] Purification of proteins encoded by S. aureus genes
expressed during IMI. Genes or part of the genes were cloned into
the vector pQE-30 (Qiagen) downstream to a polyhistidine signal to
allow protein expression in Escherichia coli and purification of
the expressed his-tagged polypeptides using a nickel affinity
column (Qiagen Ni-NTA 1018244). Expression of the recombinant
proteins and their purification was performed according to the
manufacturers recommendations (Qiagen).
[0204] Immunization of mammalian species and measurement of
antibody titers. Mice were immunized with the antigens (purified
recombinant proteins, polypeptides or epitopes of interest, alone
or in combination). For example, each animal group composed of ten
mice received a different antigen (100 .mu.g per injection), a
combination of antigens (100 .mu.g of each per injection) or saline
(i.e. the control non-immunized group). Mice were immunized twice 3
weeks apart. The antigens or saline was combined with the adjuvant
Emulsigen.RTM.-D (MVP Technologies, Omaha, USA). Injections were
performed subcutaneously in 400 .mu.l on the back of the mice.
Blood samples were performed in the mandibular vein before each
injection and, 3 weeks after the second injection, mice were
euthanized and maximum blood was sampled. The levels of specific
antibodies against the immunizing antigens were determined. Levels
of antibodies were evaluated using standard ELISA methodology
(Loiselle et al., 2009). Briefly 96-well plates were coated with
individual purified antigen and then saturated with non-specific
protein. After incubation with serial dilutions of the serums and
washes, a secondary antibody conjugated to an enzyme (HRP) was
added and the presence of antibodies was detected with a
colorimetric reaction.
[0205] Immunization in cows. Each animal group composed of 5 cows
receives a different antigen (300 .mu.g per injection), a
combination of antigens (300 .mu.g of each per injection) or saline
(i.e. the control non-immunized group). The antigens or saline is
combined with the adjuvant Emulsigen.RTM.-D. After blood samplings
for the determination of pre-immune levels of antibodies, a final
volume of 3 ml per dose of antigens or saline is injected
subcutaneously in the neck of the cows. Blood samplings is
performed every 2 weeks. Ten weeks after the first injection, the
second injection is performed subcutaneously in the neck on the
other side of the animals. The levels of the specific antibodies is
determined as described for the mice immunization.
[0206] Evaluation of antibody binding on bacterial surface.
Bacteria were incubated at 4.degree. C., under gentle agitation,
with a solution of PBS-2% BSA containing a 1/500 dilution of rabbit
serum to block staphylococcal protein A, which can bind non
specifically the Fc fragment of immunoglobulins. After 2 washes
with PBS-2% BSA-0.02% tween20.TM., bacteria were incubated at
4.degree. C., under gentle agitation, in PBS-2% PBS containing 10
.mu.l of bovine pre immune or immune serum against the antigen of
interest. After 2 washes with PBS-2% BSA-0.02% tween20.TM.,
bacteria were incubated for one hour at 4.degree. C., under gentle
agitation, in PBS-2% PBS containing a 1/1000 dilution of
FITC-conjugated goat anti-bovine IgG. After 3 washes with PBS-2%
BSA-0.02% tween20.TM., bacteria were suspended in PBS with 1%
formaldehyde. Surface labeling was then analyzed by flow cytometry
using a BD FACSCalibur.TM. instrument and the CellQuest.TM. Pro
software.
[0207] Identification of B cell epitopes. With a combination of
prediction software including BCPred Predictions (EL-Manzalawy et
al., 2008a), AAP Predictions (Chen J et al., 2007), FBCPred
Prediction (EL-Manzalawy et al., 2008b) and ABCPred (Saha, S. and
Raghava G. P. S., 2006), available at
http://bioinfo.bgu.ac.il/bsu/immunology/epitope_pred/index.htm,
http://ailab.cs.iastate.edu/bcpreds/index.html and elsewhere, B
cell epitopes, i.e., short amino acid sequences that will be
recognized by B cells, thus inducing the production of antibodies
by B cells, were determined for several vaccine components.
[0208] Identification of T cell epitopes. Computer driven
algorithms can also be used to facilitate identification of T cell
epitopes i.e., short amino acid sequences that will bind MHC
molecules (MHC class I and/or II) and be recognized by T cells,
thus inducing a cellular immune response. The antigens may be
subjected to analysis by the Epimatrix.TM. System
(http://www.epivax.com/platform/) to identify putative T cell
epitopes. This in-silico technique divides the total sequence of
the antigen into fragments of 9 amino acids overlapping by 8 amino
acids. This pool of 9-mer peptides is then screened for predicted
affinity against a group of known MHC class I and class II alleles.
The resulting scores can be used to rate putative epitopes on a
common scale which can then be tested in vitro. The technique is
applicable to any animal for which a sufficient knowledge of MHC
sequences is available. (De Groot et al., 2008).
EXAMPLE 2: VALIDATION OF CHRONIC S. aureus STRAINS
[0209] Comparative genomic hybridization data for the members of
chronic isolate pairs collected from cows >55 days apart between
dry-off and calving (FIG. 2, underlined isolates), show a high
genetic relatedness. Unrelated reference strains (S. aureus N315,
MRSACOL, Newbould, ATCC 49775, ATCC 51811 and SHY97-3906) and
isolates randomly or systematically picked from bovine mastitis
cases with clinical symptoms during lactation (annoted "R" in Table
I above) are also shown in FIG. 2 for comparison. This analysis
confirmed that the isolates that were collected from the same cow
and the same quarter >55 days apart, were genetically identical.
It is clear that the chronic isolates #3, #557, and #1290 used in
the studies described herein have the ability to cause an IMI and
persist in the mammary gland for a long period of time (i.e., are
able to cause a chronic IMI).
[0210] FIG. 3 shows Q-PCR analyses reporting the relative level of
gene expression for indicators of virulence such as hld
(Agr-dependent exotoxin production), icaC (ica-dependent biofilm
production) and overall biofilm production (measured by a
spectrophotometric method with crystal violet) for S. aureus
isolates grown in a cultivation medium in vitro. Chronic isolates
(#3, 557, 1290) were compared to a collection of systematically
isolated strains from bovine mastitis with clinical signs (where
isolate SHY97-3906 is represented as the open square). Q-PCR
results are presented as fold-expression relative to the reference
strain Newbould (ATCC 29740) and biofilm production is reported as
a percentage of that produced by strain SHY97-3906. All Q-PCR
results were normalized based on the level of expression of gyrA.
The primers used for the analysis are shown in Table II above. This
analysis confirmed that the chronic isolates used in the Examples
described herein substantially differ in their basal level of gene
expression for known virulence determinants and for biofilm
production compared with the population of systematically collected
isolates from clinical mastitis cases during lactation. These
characteristics described for the chronic isolates resemble those
reported for S. aureus strains isolated from persistent bovine IMI
(Melchior et al., 2009).
EXAMPLE 3: EFFICIENT ISOLATION OF BACTERIA FROM THE MILK OF
EXPERIMENTALLY INFECTED COWS
[0211] The method used for isolating bacteria from mastitis milk
samples is illustrated in FIG. 4. The bacterial pellet recovered
from milk treated with proteases (prot+, FIG. 4) was much larger
and allowed greater amounts of microbial RNA to be isolated for DNA
microarray and qPCR experiments compared to that obtained from the
untreated bacterial pellet (prot-, FIG. 4). A DNA microarray
experiment comparing the transcriptional profiles of S. aureus
grown in vitro in milk treated with casein protease to that of S.
aureus cells grown in untreated milk did not show significant gene
modulation. Quantitative PCR analysis for 4 genes expressed in S.
aureus grown in an iron-restricted medium in vitro and under
iron-rich conditions show that a 2-hour delay before RNA extraction
(time period between milking and RNA extraction) did not affect the
observed modulations in expression of iron-regulated genes (isdB,
ferritin and SACOL2170) and did not affect expression of the
housekeeping gene gyrB. The integrity of bacterial messenger RNA
directly isolated from mastitis milk should therefore not be
affected by the time required for isolation of bacteria after
milking of the infected cow.
EXAMPLE 4: EXPERIMENTAL INFECTION PROFILES IN COWS
[0212] Experimental infection profiles for strain SHY97-3906 and
the 3 chronic strains (#3, 557, 1290) in 3 different cows are
reported in FIGS. 5A-5C as a function of bacterial (left Y axis) or
somatic cell counts (right Y axis) over the infection period. Data
show that all bacterial isolates are able to establish an
intra-mammary infection in cows although the host (cow) seems to
influence the level of bacterial counts, cow #313 showing low
bacterial counts vs. cow #5325 showing high counts for all tested
isolates. Milk samples with high bacterial counts (obtained from
cows #307 and 5325) were thereafter used for transcriptional
analyses.
EXAMPLE 5: S. aureus GENES EXPRESSED DURING IMI IN COWS
[0213] The transcriptional profile of S. aureus strains infecting
the mammary glands of cows was determined by DNA microarray
experiments. The relative levels of expression of the
differentially expressed genes and the 20 genes expressed by both
of the two groups of isolates (i.e., from chronic or acute
mastitis) are reported in Table IV below. FIG. 6 shows the Venn
diagram of the genes differentially expressed in the chronic
strains taken all together (isolates #3, #557 and #1290) versus
SHY97-3906 isolated from a typical mastitis case with clinical
signs (acute mastitis). This analysis shows that the two types of
isolates (chronic vs. typical mastitis isolate (acute)) present
different gene expression profiles and that specific genes may be
more strongly expressed in each group. These specific sub-groups of
genes constitute therapeutic or vaccine targets to treat specific
clinical cases. Also of interest are the genes commonly expressed
by both types of isolates (20 genes in this case, identified by a
plus [+] sign in Table IV below), which may be used to treat acute
and/or chronic cases.
[0214] FIG. 7 shows the Venn diagram of the 43 genes found to be
strongly expressed in microarray experiments (Table IV below) using
bacterial samples from cow #307 at day 8 (A) and day 10 (B) of
infection, and in cow #5325 at day 10 of infection (C). The number
of bacterial samples in which the genes were shown to be expressed
is indicated in parenthesis and the gene names that are represented
in bold characters were chosen for qPCR analyses (FIG. 8). This
analysis allows identification of genes that are expressed by one
or more isolates in one or more cows at one or more time points
during the infection.
[0215] Several genes shown in FIG. 7 were thus expressed in one of
the following situations: (i) expressed in more than one strain,
(ii) observed in more than one cow and/or (iii) at more than one
time point. The expression of 5 such interesting S. aureus genes in
5 to 12 independent samples collected from cows with IMI was thus
verified and confirmed by qPCR (FIG. 8). These included the
capsular biosynthesis gene (cap), a gene of unknown function
(SACOL2171), a transcriptional regulator of unknown function
(SACOL2325), an ABC transporter of unknown function (SACOL0718) and
a chromosomally encoded gene not previously characterized
(SACOL0442). In parallel, gene expression was compared to that
measured in S. aureus cultivated in vitro in Muller-Hinton broth
supplemented with iron (broth+iron), in iron-restricted broth
(broth-iron), and in freshly collected non-mastitic milk in vitro
(milk in vitro) in order to identify the environmental stimuli
involved in gene expression (FIG. 8).
[0216] It was observed (i) that the expression of capM was reduced
in cows and in milk compared to that seen in vitro, (ii) that gene
SACOL2171 was up-regulated by iron restriction either in cows, in
milk or in iron-restricted broth in vitro, (iii) that the
expression of SACOL0718 and SACOL2325 were specifically induced by
the milk environment (i.e. up-regulated in cows compared to any
broth in vitro but equivalent to that seen in fresh milk) and (iv)
that gene SACOL0442 was exclusively expressed during infection in
the cow, i.e., more expressed in cows compared to any other
environment. The summary of the expression profile determined by
DNA array and qPCR analyses for genes SACOL0442 and SACOL0718 in
different strains, cows and time points during infection is
reported in Table V below. As seen, SACOL442 and SACOL0718 are
representative examples of S. aureus genes that exhibit sustained
expression during IMI and this independently of individual S.
aureus strains. Table VI below lists 11 genes (i.e. SACOL442,
SACOL0718 and 9 other genes) for which expression had never been
reported before, when S. aureus was grown in "other" mammalian
environments (i.e. different from the bovine mammary gland
environment, as used herein) (Allard et al., 2006; Burlak et al.,
2007; Goerke et al., 2000; Garzoni et al., 2007) or in surrogate
cultivation media such as in human neutrophils in vitro (Voyich et
al., 2005), an iron-restricted medium in vitro (Allard et al.,
2006; Maresso et al., 2006), in milk in vitro (Lammers et al.,
2000) or when S. aureus mastitis isolates were grown in vitro
(Taverna et al., 2007). The genes depicted in Table VI thus
represent excellent targets for prevention and/or treatment of S.
aureus IMI, for example as components for a vaccine composition
aimed at preventing S. aureus IMI. Also, reports of S. aureus genes
expressed in surrogate media or in mammalian environment other than
the mammary gland can actually lead away from what is reported here
for S. aureus genes expressed during bovine IMI. For example, the
gene capM (SACOL0148) was reported to be expressed in a mastitis
isolate grown on a blood agar plate in vitro (Taverna et al., 2007)
but is shown here to be less expressed during bovine IMI than that
measured after growth in vitro (FIG. 8). It has been previously
demonstrated that the genes capM, csb33, csb28, pflB, glpK, and
SACOL0154 (listed in Table III above) were all less expressed
during growth of S. aureus in tissue cages implanted in the
peritoneal cavity of mice than when measured in vitro (Allard et
al., 2006), whereas a strong expression of all these genes during
bovine IMI is shown in the instant studies. Indeed, the host
defense barriers and immune response, the infected mammary gland
tissue and tissue damage, as well as the altered composition and
low oxygen tension of the mastitis milk of cows suffering from IMI
all create a unique and complex environment that would be difficult
to mimic in other animal models of infection, in surrogate systems
or other cultivation media (Mayer et al., 1988; Park et al.,
2007).
[0217] Gene SACOL0718 identified in Tables III and V is part of an
operon comprising genes SACOL0718-SACOL0720 as illustrated in FIG.
9 and as determined by programs known by those in the field
(Prediction of operon: www.microbesonline.org, Dehal P. S. et al.,
Nucleic Acids Res. 2010 Jan; 38(Database issue): D396-400. Epub
2009 Nov. 11; Promoter search: www.softberry.com, Srivastava S et
al., Bioinformation 2008, 3(4):173-6. Epub 2008 Dec. 6). The
predicted function of these genes is the formation of an ABC
transporter composed of an ATP-binding protein and a permease
(Table V below). SACOL0720 was not detected in the microarray
experiments (Table III above) because it was not included in the
composition of the DNA array (Allard et al., 2006). However, it is
well known that genes from operons are expressed from the same
promoter sequence and are translated into proteins from the same
messenger RNA. Therefore, given that expression of SACOL0718 is
detected during IMI, it may be predicted that expression of
SACOL0720 certainly also occurs and thus that both SACOL0718 and
SACOL720 represent targets for prevention and/or treatment of S.
aureus IMI.
[0218] Table IV: S. aureus genes (43 genes) with significant levels
of expression (intensity>100%) during bovine IMI as determined
in microarray experiments. Genes are listed by name (if attributed)
as well as by open reading frame (ORF) numbers for three different
S. aureus strains for which the genome is sequenced (MRSA COL, N315
and the mastitis isolate RF122). Such genes are also reported in
the Venn diagrams of FIGS. 6 and 7. The 20 genes expressed by both
chronic strains as well as by strain SHY97-3906 (common) are
indicated by a plus (+) sign.
TABLE-US-00004 TABLE IV ORF ORF ORF Com- Cow 307, Day 8 Cow 307,
Day 10 Cow 5325, Day 10 Gene COL RF122 N315 Description mon SHY97
#3 #557 #1290 SHY97 #3 #557 #1290 SHY97 #3 0029 -- 35 Biosynthesis
of cofactors + 106.6 195.4 356.4 sbnA 0100 55 112 Staphylobactin
biosynthesis 440.5 sbnB 0101 56 113 Staphylobactin biosynthesis
559.4 sbnF 0105 60 117 Staphylobactin biosynthesis 395.7 capM 0148
102 156 Capsular polysaccharide + 1187.2 291.6 592.3 568.2 177.9
347.7 181.0 208.7 351.9 biosynthesis 0154 108 162 Aldehyde
dehydrogenase 136.8 pflB 0204 164 218 Formate acetyltransferase +
1825.5 465.6 pflA 0205 165 219 Formate-lyase activating + 1300.8
231.8 enzyme 0264 216o 266 ABC transporter, unknown 111.8 function
0442 321 357 Exotoxin, putative + 383.8 115.3 201.3 227.2 145.1
115.8 guaA 0461 341 376 GMP synthase + 396.3 213.0 720.5 555.2
331.7 335.6 135.6 156.5 209.8 sdrC 0608 513 519 Virulence adhesin +
132.3 173.6 312.1 adh 0660 557 562 Alcool deshydrogenase, + 110.5
2228.3 168.2 Zn containing mntC 0688 581o 587 Manganese ABC 273.8
transporter mntA 0690 583o 589 Manganese ABC 168.8 transporter fhuA
0704 596 602 Ferrichrome transport 162.1 ATP-binding protein 0718
610 616 ABC transporter, unknown + 116.8 171.5 108.7 110.6 function
trxB 0829 717 719 Thioredoxin reductase 258.3 menB 1054 912 898
Enoyl-CoA hydratase/ + 132.2 115.0 112.8 222.6 isomerase family
isdD 1142 996 979 Iron transport from heme + 142.5 200.0 srtB 1145
999 982 Sortase B + 107.4 109.3 125.2 434.1 672.1 glpK 1320 1161
1141 Glycerol kinase 163.2 1353 -- 1157 ABC transporter, unknown
115.5 function 1416 1236o 1213 ABC transporter, unknown 103.9 117.1
function 1611 1426o 1383 Transcription regulator 118.0 homolog dnaK
1637 1452o 1409 Chaperone protein 264.1 csb8 1680 -- 1452 Conserved
protein 120.9 isdH 1781 1590o 1552 Iron transport from heme + 120.1
117.2 rot 1812 1622o 1583 Regulator of toxin, Rot 116.2 splC 1867
1671o 1629 Serine protease 111.0 csb33 1912 1788o 1671
Glucosamine-6-phosphate + 110.8 186.8 176.5 158.2 220.9 isomerase
1944 1818o 1702 Hypothetical protein + 138.0 277.4 murA 2092 1984o
1902 UDP-NAcGlc-1- + 104.2 116.4 carboxyvinyltransferase 2144 2033o
1958 ABC transporter, unknown 377.6 function 2169 2060o 1981
Siderophore biosynthesis, + 112.8 177.3 putative 2171 2062 1983
Siderophore biosynthesis, + 100.4 114.0 144.0 128.4 putative csb28
2321 2205o 2119 Oxidoreductase 129.9 dehydrogenase/reductase 2325
2209 2123 Trapscriptional regulator, + 242.1 364.9 LysR family corA
2342 2226o 2137 Magnesium and cobalt 106.9 transport protein 2365
2248o 2158 Hypothetical protein + 106.9 124.7 198.0 csb19 2379 2261
2170 Conserved protein 116.2 2385 2266 2175 HSP 20 family protein
123.7 2599 2457o 2369 Homolog to FeoB, Fe2+ 101.8 transport protein
Proportion of genes (%) with significant level of 6.6 5.4 7.5 5.9
16.7 16.7 16.1 15.4 7.6 8.3 expression (intensity >100%) on
arrays
TABLE-US-00005 TABLE V Mastic milk samples in which the expression
of SACOL0442 (upper panel) or SACOL0718 (lower panel) was detected
on DNA array or by qPCR for 4 different S. aureus strains at 3
different lime points in two cows. S. aureus strains Cow Day of
infection SHY97-3609 3 557 1290 Gene SACOL0442 307 8 .circle-solid.
.circle-solid. .circle-solid. .circle-solid. 307 10 .circle-solid.
ND .circle-solid. .circle-solid. 307 14 .circle-solid.
.circle-solid. .circle-solid. .circle-solid. 5325 10 .circle-solid.
.circle-solid. .circle-solid. .circle-solid. Gene SACOL0718 307 8
.circle-solid. .circle-solid. .circle-solid. .circle-solid. 307 10
.circle-solid. .circle-solid. ND ND 307 14 .circle-solid.
.circle-solid. .circle-solid. .circle-solid. 5325 10 .circle-solid.
.circle-solid. .circle-solid. .circle-solid. ND, not detected.
TABLE-US-00006 TABLE VI Names and annotations for a selection of 11
genes or operons taken from the 43 genes found to be strongly
expressed in microarray experiments (Table III above) and for which
expression had never been reported when S. aureus was grown in a
different mammalian environment or in surrogate cultivation media
such as in human neutrophils in vitro, in iron-restricted media or
in milk in vitro or when S. aureus mastitis isolates were grown in
vitro. Annotations are compared for representatives of the S.
aureus sequenced genomes (MRSA COL, N315, RF122 [a mastitis
isolate], USA300, MSSA476). Gene SACOL COL N315 RF122 USA300
MSSA476 0442 enterotoxin, similar to hypothetical enterotoxin,
putative putative exotoxin 2 protein putative exported protein
0718- ABC ABC ABC ABC putative ABC 0720 transporter, transporter,
transporter, transporter, transporter ATP-binding ATP-binding
ATP-binding ATP-binding protein and protein and protein and protein
and protein and permease permease permease permease permease 2365
lipoprotein, hypothetical lipoprotein, lipoprotein, lipoprotein,
putative protein, similar putative putative putative to TpgX
protein 0029 HMG-CoA probable -- conserved -- synthase, HMG-CoA
hypothetical truncation synthase protein 1416 peptide ABC
oligopeptide probable peptide ABC putative transporter, transporter
oligopeptide transporter, oligopeptide permease membrane membrane
permease transport system protein, permease permease protein
permease putative domain (opp2c) 1944 conserved conserved conserved
conserved putative hypothetical hypothetical hypothetical
hypothetical membrane protein protein protein protein protein 1611
transcriptional ferric uptake zinc-specific ferric uptake
zinc-specific regulator, Fur regulator metalloregulator regulation
metalloregulatory family homolog (zur) protein (fur) protein 2599
conserved hypothetical probable transporter putative domain protein
protein, similar membrane gate domain membrane to ferrous iron
protein protein protein transporter 2144 ABC ABC ABC ABC ABC
transporter, transporter, transporter, transporter, transporter,
ATP-binding ATP-binding ATP-binding ATP-binding ATP-binding protein
protein protein protein protein 1353 ABC hypothetical -- ABC
putative transporter, protein, similar transporter, membrane
permease to ABC permease protein protein, transporter protein
putative integral 0264 ABC conserved probable ABC ABC putative ABC
transporter, hypothetical transporter ATP transporter, transporter
ATP- ATP-binding protein binding protein ATP-binding binding
protein protein protein
EXAMPLE 6: ATTENUATION OF S. aureus VIRULENCE
[0219] Mutants for genes SACOL0442 and SACOL0720 were produced by
gene replacement for mutant .DELTA.442a, (Mitchell et al., 2008)
and by intron insertion for mutants .DELTA.442b and .DELTA.720
(TargeTron Gene Knockout System, Sigma Aldrich (Chen et al.,
2007)). The mutants were carried out in the S. aureus parental
strain ATCC 29213 that could be easily transformed by
electroporation. For creating mutant .DELTA.442a, a 223-pb fragment
of gene SACOL0442 in strain ATCC 29213 was deleted and replaced by
insertion of the 1300-bp erythromycin resistance gene ermA between
positions 188 and 411 of the nucleotide sequence of SACOL0442. For
creating mutants .DELTA.442b and .DELTA.720, the Group II intron
(fragment size of approx. 2 Kb) from the TargeTron Gene Knockout
System inserted itself into the target chromosomal gene between
nucleotide positions 45 and 46 for gene SACOL0442 and between
positions 803 and 804 for gene SACOL0720, respectively. Prior to
experimental IMI with the mutants, their growth, compared to the
parental strain, was evaluated in vitro in freshly collected milk
(FIG. 10A). No difference between the growth of the 3 mutants and
the parental strain was observed. Eight healthy lactating cows were
then inoculated intramammary with 25-250 CFU of the parental strain
and of the three mutants and the infection was followed for 21
days. Each of the 8 cows was infused with the four S. aureus
strains and the position of each strain in the four quarters
alternated between the animals. Milk of the infected quarters was
collected and the determination of viable bacterial counts was
performed. Each of the three mutants showed a significant reduction
of bacterial counts in milk compared to the parental strain (FIG.
10B). The virulence of each of the mutants is thus attenuated
compared to the parental strain. These results demonstrate the
importance of the expression of genes SACOL0442 and SACOL0718-720
for the infection process. Antibodies directed toward their gene
products should greatly impair the ability of S. aureus to cause
bovine IMI (see Examples 8-11). Besides, attenuated bacterial
strains have been used as live vaccines (for example, PRIORIX.RTM.
is a combined measles, mumps and rubella, live, attenuated vaccine:
VARILRIX.RTM., is a varicella virus vaccine, live, attenuated
(Oka-strain); BCG, is a vaccine for tuberculosis using the
attenuated live bacteria Mycobacterium bovis) and thus, the use of
the mutants described herein (e.g., .DELTA.442a, .DELTA.442b and
.DELTA.720 mutants) for immunization of cows is another approach to
stimulate immunity and to protect the animal against a future
infection by a fully virulent strain. Hence, a mutation/deletion of
any of the genes identified here as being expressed by S. aureus
during bovine IMI may attenuate virulence and such resulting
attenuated mutants could be used in a live attenuated vaccine
method for immunization.
EXAMPLE 7: RELATEDNESS OF SOME S. aureus GENES AND PROTEINS
[0220] FIGS. 11A-11D show the nucleic acid (FIGS. 11A-11C) and
amino acid (FIG. 11D) alignments of vaccine components SACOL0442
and SACOL0720 of all Staphylococcus aureus sequenced strains,
including the strain RF122 isolated from bovine mastitis. The
sequences for SACOL0442 and SACOL0720 show a similarity of about 94
to 100% among the compared strains and are thus considered as
highly conserved among these representative S. aureus strains. The
fact that these genes/proteins could be found in strains isolated
from multiple sources strengthens their potential as targets (e.g.,
vaccine candidates) as it would target most S. aureus udder
infections (IMI infections).
[0221] Similarly, Table VII below shows the percentage of
similarity and identity of the amino acid sequences corresponding
to some of the S. aureus genes expressed in vivo during bovine IMI
(Table VI above) for some representatives of the sequenced S.
aureus genomes. Again, a high degree of similarity and identity was
observed (>92.7%), confirming that these genes and encoded
proteins represent good target for protection against multiple S.
aureus strains. There is also about 40% identity and about 60%
similarity between the amino acid sequence of SACOL0442 and that of
other putative exotoxins such as SACOL0469, SACOL0470, SACOL0472
and SACOL0473 (also known as SA0383 exotoxin 7 [set7], SA0384
exotoxin 8 [set8], SA0385 exotoxin 9 [set9] and SA0389 exotoxin 13
[set13] in strain N315, respectively) (www.jcvi.org). Although
these components are not the same genes or proteins, it is possible
to find common protein regions, fragments or epitopes for use in
vaccines with broader applications and thus aim at the prevention
and control of many types of S. aureus infections in addition to
IMI. Some genetically related bacterial species or genus such as
Staphylococcus epidermidis, Streptococcus, Listeria and others may
also have homologs of these genes or proteins. Thus, it may also be
possible to find common protein regions, fragments or epitopes for
use in vaccines with broader applications aimed at the prevention
and control of many types of bacterial infections. For example, the
S. aureus gene SACOL1416 shows about 30% sequence homology to
Streptococcus agalactiae gene SAJ1496 and Listeria gene LWE0119 and
the S. aureus gene SACOL0718 shows about 40-50% sequence homologies
to Streptococcus agalactiae gene SAJ1013 and Listeria gene LWE1764
(www.jcvi.org). Noteworthy, Streptococcus agalactiae is also a
pathogen involved in IMI and Listeria is a pathogen often
contaminating milk products (Bradley, 2002; Jayarao et al.,
2001).
TABLE-US-00007 TABLE VII Percentage similarity (% sim) and identity
(% ide) of the amino acid sequences corresponding to some of the S.
aureus genes expressed in vivo during bovine IMI (Table IV above)
for some representatives of the sequenced Staphylococcus aureus
genomes (strains N315, RF122, USA300-FPR3757 and MSSA476 compared
to the MRSA COL strain). Gene COL N315 RF122 USA300 MSSA476 SA- % %
% % % % % % % % COL ide sim ide sim ide sim ide sim ide sim 0442
100 100 99.5 99.5 94.6 98 100 100 95.6 98.0 0718 100 100 99.6 100
99.6 100 99.6 100 99.6 100 0720 100 100 99.4 99.7 99.4 100 100 100
99.4 99.7 2365 100 100 98.5 98.5 97.1 98.1 100 100 99.0 99.0 0029
100 100 100 100 -- -- 100 100 -- -- 1416 100 100 99.6 100 98.2 99.6
100 100 100 100 1944 100 100 100 100 99.6 99.6 100 100 100 100 1611
100 100 100 100 100 100 100 100 100 100 2599 100 100 99.8 100 99.1
99.8 100 100 99.8 99.8 2144 100 100 94.6 98.5 92.7 96.2 99.6 99.6
96.2 99.2 1353 100 100 99.6 99.6 -- -- 100 100 99.6 100 0264 100
100 99.5 99.5 99.1 99.5 100 100 99.1 99.1
EXAMPLE 8: PREPARATION OF VACCINES
[0222] Bioinformatic software provided sequence and structural
information on proteins SACOL0718, SACOL0720 and SALCOL0442 that
were useful for preparing such proteins in vaccine compositions
(FIGS. 14A-C). For example, protein SACOL0442 was determined to be
extracellular (secreted bacterial protein). The cellular
localization of protein SACOL0718 and its amino acid composition
showing 45% of hydrophobic amino acids suggest that it is
associated with the bacterial cytoplasmic membrane. Protein
SACOL0720 was also predicted to be associated with the bacterial
cytoplasmic membrane. Protein SACOL0720 contains 10 transmembrane
helices and it was possible to identify a region exposed at the
surface of the bacterium.
[0223] For vaccine preparation, most of the SACOL0442 protein was
used (polypeptide comprising amino acids 44 to 159 in the sequence
depicted at FIG. 11D (the full sequence of SACOL0442 is set forth
in SEQ ID NO: 37)) and as such, excluded its transport signal
(amino acids 1 to 35). The predicted extracellular region of
protein SACOL0720 (o-annotated amino acids 309 to 508 in the
sequence depicted at FIG. 14D (the full sequence of SACOL0720 is
set forth in SEQ ID NO: 62)) was also used in a vaccine
composition. In the same way, the extracellular region of the
SACOL1781 protein (polypeptide comprising amino acids 41 to 895 of
protein IsdH (the full sequence of SACOL1781 is set forth in SEQ ID
NO: 76), see also FIG. 18); (www.jcvi.org)) was used as an
additional vaccine component.
EXAMPLE 9: IMMUNOGENICITY OF VACCINE OF THE PRESENT INVENTION IN
MICE
[0224] Each of the purified polypeptides derived from SACOL0442,
SACOL0720 and SACOL1781, independently or all together in
combination, were tested for antibody production in mice. Antibody
titers in sera of mice vaccinated with SACOL0442, SACOL0720 and
SACOL1781 (in the presence of the adjuvant Emulsigen.RTM.-D) are
shown in FIG. 15. One group of animals (10 animals per group) twice
received saline, one received 2 injections of 100 .mu.g of
polypeptide SACOL0442, one group received 2 injections of 100 .mu.g
of polypeptide SACOL0720, one group received 2 injections of 100
.mu.g of polypeptide SACOL1781, and one group received 2 injections
of 100 .mu.g of each three polypeptides SACOL0442, SACOL0720 and
SACOL1781 premixed together in a combination. The 2 injections were
performed 3 weeks apart, and 3 weeks after the second immunization
mice were euthanized and blood collected for the determination of
antibody titers by ELISA. Results from FIG. 15 show that the
polypeptides used for immunization were indeed immunogenic (i.e.,
able to stimulate an immune response and antibody production).
Results also show that the combination of polypeptides SACOL0442
and SACOL0720 to another antigen such as SACOL1781 did not reduce
or alter antibody production compared to that measured when
SACOL0442 and SACOL0720 were injected independently. Such a vaccine
composition (SACOL0442 and/or SACOL0720 with or without other
antigens) is thus a practical useful approach for raising
antibodies against multiple antigens of interest. Such a
combination vaccine could then provide protection against bovine
IMI as well as protection against other diseases that may require
other vaccine components for immunization.
EXAMPLE 10: IMMUNOGENICITY OF VACCINE OF THE PRESENT INVENTION IN
COWS
[0225] Immunizations were also performed in dairy cows. Antibody
titers in sera of cows vaccinated with the polypeptide fragments of
SACOL0442, SACOL0720 described in Example 8 (in the presence of the
adjuvant Emulsigen.RTM.-D) are shown in FIG. 16. One group of
animals (5 animals per group) received 2 injections of saline, one
group received 2 injections of 300 .mu.g of polypeptide SACOL0442,
one group received 2 injections of 300 .mu.g of polypeptide
SACOL0720 and one group received 2 injections of 300 .mu.g of each
of the two polypeptides SACOL0442 and SACOL0720 premixed together
in a combination. The 2 injections were performed 10 weeks apart,
and blood was collected for the determination of total IgG antibody
titers by ELISA. Results from FIG. 16 show that the polypeptides
used for immunization were also highly immunogenic in cows and that
combining the antigens for immunization also does not significantly
modify the immune response compared to that obtained using
individual antigens. The determination of the isotypes is presented
in FIGS. 17A-D. Immunization of cows leads to the induction of an
immune response with the presence of both IgG1 and IgG2. Isotype
IgG2 is known to be helpful for opsonization of S. aureus and to
increase bovine neutrophil functions (Guidry et al., 1993; Barrio
et al., 2003). It is known that using different types of adjuvant
and/or vaccine administration vehicles or routes can modulate the
resulting balance of IgG1 and IgG2 for specific needs (Spickler and
Roth, 2003). The capacity of bovine antibodies induced by
immunization to bind their target proteins (e.g., SACOL0720) at the
bacterial surface was evaluated. Bacteria grown for 8 hours in
freshly collected milk were used for this assay as this condition
was shown to allow expression of SACOL0718-720 as measured by qPCR
(FIG. 8). Evaluation of antibody binding on the bacterial surface
was done using flow cytometry as described in "Example 1 materials
and methods". It was found that 22.2% more bacteria were bound by
labeled antibodies in the presence of the bovine immune serum
raised against SACOL0720 in comparison to the labeling obtained in
presence of the control pre-immune serum. This demonstrates that
bovine antibodies induced against SACOL0720 are able to bind to the
protein at the surface of the bacteria. Such antibody binding
(opsonization) is known to help neutrophils phagocytic and killing
activity (Guidry et al. 1993; Barrio et al., 2003).
EXAMPLE 11: EPITOPES OF INTEREST
[0226] As an alternative of using the entire proteins or a long
region of the polypeptides of interest for vaccination, it is also
possible to specifically used small peptide regions predicted to be
recognized by the B or T cells from the mammalian immune system.
Identification of the B cell epitopes (that is to say short amino
acid sequences that will be recognized by the immune system and
able to induce the production of antibodies by the B cells) among
some of the proteins of interest such as SACOL0442 and SACOL0720
are shown in Table VIII below. For each protein, the predicted B
cell epitopes are presented with their position in the protein
sequence. The score was obtained from 4 distinct programs: BCPred
Predictions, AAP Predictions, FBCPred Predictions and ABCPred.
[0227] Similarly, computer driven algorithms can also be used to
facilitate the identification of T cell epitopes (that is to say
short amino acid sequences that will be recognized by the immune
system and able to induce a cellular response by T cells) for use
as vaccines against Staphylococcus aureus infection. The proteins
of interest can be subjected to analysis by the Epimatrix.TM.
system to identify putative T cell epitopes. This in-silico
technique divides the total sequence of the antigen into fragments
of 9 amino acids overlapping by 8 amino acids. This pool of 9-mer
is screened for predicted affinity against a group of known MHC
class I and class II alleles. The resulting scores can be used to
rate putative epitopes on a common scale which can then be tested
in vitro. The technique is applicable to any animal for which a
sufficient knowledge of MHC sequences is available. (De Groot et
al., 2008)
[0228] The B or T cell epitopes can therefore be used in vaccine
compositions alone or in combination with an assemblage of
proteins, peptides or other epitopes. In addition, any B or T cell
epitopes as well as any other epitopes can be presented in a
contiguous sequence (such as in a protein fusion approach) by using
genetic and protein engineering methods.
TABLE-US-00008 TABLE VIII Identification of B cell epitopes among
some of the proteins of interest (A) SACOL0442 and (B) SACOL0720.
For each protein, the predicted B cell epitopes are presented with
their position in the protein sequence and the prediction score
they obtained using 4 distinct softwares BCPred Predictions, AAP
Predictions, FBCPred Predictions and ABCPred. SACOL0442 Potential B
cell epitope Position into the sequence score TFGIYPKADASTQN (SEQ
ID NO: 17) 26 0.840 KDTINGKSNKSRNW (SEQ ID NO: 18) 72 0.848
KDGGKYTLESHKELQ (SEQ ID NO: 19) 159 1.000 (B) SACOL0720 Potential B
cell epitope Position into the sequence score QFGFDLKHKKDALA (SEQ
ID NO: 20) 468 0.981 TIKDQQKANQLAS (SEQ ID NO: 21) 325 0.898
KDINKIYFMTDVDL (SEQ ID NO: 22) 428 0.890 DVDLGGPTFVLND (SEQ ID NO:
23) 436 0.993
EXAMPLE 12: USE OF S. aureus GENES EXPRESSED DURING IMI AS
DIAGNOSTIC TOOLS
[0229] The diagnosis of S. aureus IMI is difficult and requires
time. Traditionally, milk samples are taken and shipped to a
microbiology laboratory where cultivation of S. aureus is achieved
using various artificial growth media. Following growth and if
growth occur (usually 24 h after sample arrival), the microorganism
need to be identified as S. aureus among other possible pathogens
by a variety of biochemical tests which could take up an additional
24 h. For milk producers, this delay represents a serious economic
loss as cows suspected to have acquired an IMI need to be removed
from the milk production herd while cows not tested for S. aureus
but that have subclinical IMI may continue to contaminate the bulk
milk tank. It would thus be highly desirable to develop a novel
tool for rapid detection of S. aureus in milk to permit a rapid
intervention by milk producers or veterinarians.
[0230] As an alternative of using traditional microbial cultures to
identify S. aureus in milk samples of cows with or without clinical
signs of IMI and mastitis, the products of the S. aureus genes
identified as expressed during IMI (either the messenger RNA, the
protein or the metabolic product subsequent to the protein
activity) may be used as diagnostic tools. Indeed, the detection of
such specific products, for example in milk, blood or biopsies,
would indicate the presence of S. aureus. Since such products are
strongly expressed during IMI, their detection would also strongly
correlate with this specific type of infection.
[0231] For example, detection of the putative exotoxin SACOL0442
that is secreted in the extracellular milieu, i.e., in milk during
mastitis, would be a strong indication that the cow is infected by
S. aureus since the gene is only expressed during IMI. The
detection of the putative exotoxin SACOL0442 can be easily achieved
by the use of a specific antibody and an ELISA technique or a dip
stick approach or the like and the signal of detection can be
easily amplified by a variety of signal amplification techniques.
Such techniques could rapidly be performed by the microbiology
laboratory or even on-farm by the milk producer himself, hence
gaining valuable time. Alternatively, detection of messenger RNA
(mRNA) from the genes expressed during IMI would also indicate the
presence of S. aureus in milk. Detection of mRNA is possible after
its release from bacteria by a cell lysis step, copying mRNA into
complementary DNA by reverse transcription and by PCR
amplification.
REFERENCES
[0232] Allard, M., H. Moisan, E. Brouillette, A. L. Gervais, M.
Jacques, P. Lacasse, M. S. Diarra, and F. Malouin. 2006.
Transcriptional modulation of some Staphylococcus aureus
iron-regulated genes during growth in vitro and in a tissue cage
model in vivo. Microbes Infect. 71679-1690.
[0233] Allard, M., C. Ster, L. St-James, P. Lacasse, M. S. Diarra,
C. L. Jacob, and F. Malouin. 2008. Transcriptional Analysis of In
Vivo-Expressed Genes in Staphylococcus aureus During Bovine
Mastitis. American Society for Microbiology General Meeting.
Boston, USA. Jun. 1-5, 2008 (Poster)
[0234] Atalla, H., C. Gyles, C. L. Jacob, H. Moisan, F. Malouin,
and B. Mallard. 2008. Characterization of a Staphylococcus aureus
small colony variant (SCV) associated with persistent bovine
mastitis. Foodborne Pathog 5:785-799.
[0235] Barkema, H. W., Y. H. Schukken, and R. N. Zadoks. 2006.
Invited Review: The role of cow, pathogen, and treatment regimen in
the therapeutic success of bovine Staphylococcus aureus mastitis. J
Dairy Sci. 89:1877-1895.
[0236] Bradley, A. 2002. Bovine mastitis: an evolving disease. Vet
J. 164:116-128.
[0237] Barrio, M. B., P. Rainard, F. B. Gilbert, B. Poutrel. 2003.
Assessment of the opsonic activity of purified bovine sIgA
following intramammary immunization of cows with Staphylococcus
aureus. J. Dairy Sci. 86:2884-2894.
[0238] Brouillette, E., M. Hyodo, Y. Hayakawa, D. K. Karaolis, and
F. Malouin. 2005. 3',5'-cyclic diguanylic acid reduces the
virulence of biofilm-forming Staphylococcus aureus strains in a
mouse model of mastitis infection. Antimicrob. Agents Chemother.
49:3109-3113.
[0239] Burlak, C., C. H. Hammer, M. A. Robinson, A. R. Whitney, M.
J. McGavin, B. N. Kreiswirth, and F. R. Deleo. 2007. Global
analysis of community-associated methicillin-resistant
Staphylococcus aureus exoproteins reveals molecules produced in
vitro and during infection. Cell Microbiol. 9:1172-1190
[0240] Chang, B. S., J. S. Moon, H. M. Kang, Y. I. Kim, H. K. Lee,
J. D. Kim, B. S. Lee, N. C. Koo, Y. H. Park. 2008. Protective
effects of recombinant staphylococcal enterotoxin type C mutant
vaccine against experimental bovine infection by a strain of
Staphylococcus aureus isolated from subclinical mastitis in dairy
cattle. Vaccine. 26:2081-2091.
[0241] Chen J., H Liu., J. Yang, K. Chou. 2007. Prediction of
linear B-cell epitopes using amino acid pair antigenicity scale.
Amino Acids 33:423-428
[0242] Chen Y., L. Caruso, B. McClane, D. Fisher, P. Gupta. 2007.
Disruption of a toxin by introduction of a foreign gene into the
chromosome of Clostridium perfringens using targetron induced
mutagenesis. Plasmid. 58:182-189.
[0243] De Groot, A. S., J. McMurry, and L. Moise. 2008. Prediction
of immunogenicity: in silico paradigms, ex vivo and in vivo
correlates. Curr Opinion in Phamnacol. 8:620-626.
[0244] Dehal P S, Joachimiak M P, Price M N, Bates J T, Baumohl J
K, Chivian D, Friedland G D, Huang K H, Keller K, Novichkov P S,
Dubchak I L, Alm E J, Arkin A P. MicrobesOnline: an integrated
portal for comparative and functional genomics. Nucleic Acids Res.
2010 Jan; 38(Database issue): D396-400. Epub 2009 Nov. 11.
[0245] Diarra, M. S., D. Petitclerc, and P. Lacasse. 2002. Response
of Staphylococcus aureus isolates from bovine mastitis to exogenous
iron sources. J. Dairy Sci. 85:2141-2148.
[0246] EL-Manzalawy Y, Dobbs D, Honavar V. 2008a. Predicting linear
B-cell epitopes using string kernels. J Mol Recognit 21:
243-255.
[0247] EL-Manzalawy Y, Dobbs D, Honavar V. 2008b. Predicting
flexible length linear B-cell epitopes. 7.sup.th International
Conference on Computational Systems Bioinformatics, Stanford,
Calif. pp. 121-131
[0248] Eng, N. F., S. Garlapati, V. Gerdts, A. Potter, L. A.
Babiuk, and G. K. Mutwiri. 2010. The Potential of Polyphosphazenes
for Delivery of Vaccine Antigens and Imnnunotherapeutic Agents.
Curr Drug Deliv. 7(1):13-30.
[0249] Gardy, J. L., M. R. Laird, F. Chen, S. Rey, C. J. Walsh, M.
Ester and F. S. L. Brinkman. 2005. PSORTb v.2.0: Expanded
prediction of bacterial protein subcellular localization and
insights gained from comparative proteome analysis. Bioinformatics
21(5):617-623; doi:10.1093/bioinformatics/bti057
[0250] Garzoni, C., P. Francois, A. Huyghe, S. Couzinet, C.
Tapparel, Y. Charbonnier, A. Renzoni, S. Lucchini, D. P. Lew, P.
Vaudaux, W, L. Kelley, and J. Schrenzel. 2007. A global view of
Staphylococcus aureus whole genome expression upon internalization
in human epithelial cells. BMC Genomics. 8:171.
[0251] Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins
M. R., Appel R. D., Bairoch A. Protein Identification and Analysis
Tools on the ExPASy Server; (In) John M. Walker (ed): The
Proteomics Protocols Handbook, Humana Press (2005), pp. 571-607
[0252] Goerke, C., S. Campana, M. G. Bayer, G. Doring, K.
Botzenhart, and C. Wolz. 2000. Direct quantitative transcript
analysis of the agr regulon of Staphylococcus aureus during human
infection in comparison to the expression profile in vitro. Infect
Immun. 68:1304-1311.
[0253] Guidry, A. J., L. M. Berning, C. N. Hambleton.1993.
Opsonization of Staphylococcus aureus by bovine immunoglobulin
isotypes. J. of Dairy Sci. 76:1285-1289.
[0254] Haveri, M., A. Roslof, L. Rantala, and S. Pyorala. 2007.
Virulence genes of bovine Staphylococcus aureus from persistent and
nonpersistent intramammary infections with different clinical
characteristics. J Appl Microbiol. 103:993-1000.
[0255] Hogarth, C. J., J. L. Fitzpatrick, A. M. Nolan, F. J. Young,
A. Pitt, and P. D. Eckersall. 2004. Differential protein
composition of bovine whey: a comparison of whey from healthy
animals and from those with clinical mastitis. Proteomics.
4:2094-2100.
[0256] Jayarao, B. M., D. R. Henning. 2001. Prevalence of foodborne
pathogens in bulk tank milk. J Dairy Sci. 84:2157-2162.
[0257] Karaolis, T. K. Means, D. Yang, M. Takahashi, T. Yoshimura,
E. Muraille, D. Philpott, J. T. Schroeder, M. Hyodo, Y. Hayakawa,
B. G. Talbot, E. Brouillette, and F. Malouin. 2007. Bacterial
c-di-GMP is an immunostimulatory molecule. J Immunol.
178:2171-2181.
[0258] Kasturi, S. P. et al. 2011. Programming the magnitude and
persistence of antibody responses with innate immunity. Nature
470:543-547.
[0259] Lammers, A., E. Kruijt, K. C. van de, P. J. Nuijten, and H.
E. Smith. 2000. Identification of Staphylococcus aureus genes
expressed during growth in milk: a useful model for selection of
genes important in bovine mastitis? Microbiology. 146:981-987.
[0260] Larkin M. A., Blackshields G., Brown N. P., Chenna R.,
McGettigan P. A., McWilliam H.*, Valentin F.*, Wallace I. M., Wilm
A., Lopez R., Thompson J. D., Gibson T. J. and Higgins D. G. 2007.
ClustalW and ClustalX version 2. Bioinformatics 2007 23(21):
2947-2948.
[0261] Linghua, Z., T. Xingshan, Z. Fengzhen. 2006. The efficacy of
CpG oligodinucleotides, in combination with conventional adjuvants,
as immunological adjuvants to swine streptococcic septicemia
vaccine in piglets in vivo. Int Immunopharmacol. 6:1267-76.
[0262] Loiselle, M. C., C. Ster, B. G. Talbot, X. Zhao, G. F.
Wagner, Y. R. Boisclair, and P. Lacasse. 2009. Impact of postpartum
milking frequency on the immune system and the blood metabolite
concentration of dairy cows. J Dairy Sci. 92:1900-1912.
[0263] Lowe, A. M., D. T. Beattie, and R. L. Deresiewicz. 1998.
Identification of novel staphylococcal virulence genes by in vivo
expression technology. Mol Microbiol. 27:967-976.
[0264] Maresso, A. W., and O. Schneewind. 2006. Iron acquisition
and transport in Staphylococcus aureus. Biometals. 19:193-203.
[0265] Mayer, S. J., A. E. Waterman, P. M. Keen, N. Craven, and F.
J. Bourne. 1988. Oxygen concentration in milk of healthy and
mastitic cows and implications of low oxygen tension for the
killing of Staphylococcus aureus by bovine neutrophils. J Dairy Res
55:513-519.
[0266] Melchior, M. B., M. H. vanOsch, R. M. Graat, E. van
Duijkeren, D. J. Mevius, N. Nielen, W. Gaastra, J. Fink-Gremmels.
2009. Biofilm formation and genotyping of Staphylococcus aureus
bovine mastitis isolates: evidence for lack of
penicillin-resistance in Agr-type II strains. Vet. Microbiol.
137:83-89.
[0267] Middleton, J. R. 2008. Staphylococcus aureus antigens and
challenges in vaccine development. Expert Rev Vaccines.
7:805-815.
[0268] Moisan, H., E. Brouillette, C. L. Jacob, P. Langlois-Begin,
S. Michaud, and F. Malouin. 2006. Transcription of virulence
factors in Staphylococcus aureus small-colony variants isolated
from cystic fibrosis patients is influenced by SigB. J Bacteriol.
188:64-76.
[0269] Mitchell, G., C. A. Lamontagne, E. Brouillette, G. Grondin,
B. G. Talbot, M. Grandbois, F. Malouin. 2008. Staphylococcus aureus
SigB activity promotes a strong fibronectin-bacterium interaction
which may sustain host tissue colonization by small-colony variants
isolated from cystic fibrosis patients. Mol Microbiol
70:1540-1555.
[0270] Myllys, V., J. Ridell, J. Bjorkroth, I. Biese, and S.
Pyorala. 1997. Persistence in bovine mastitis of Staphylococcus
aureus clones as assessed by random amplified polymorphic DNA
analysis, ribotyping and biotyping. Vet Microbiol. 57:245-251.
[0271] National Mastitis Council. 1996. Current Concept of Bovine
Mastitis. 4 ed. National Mastitis Council, Madison, Wis.
[0272] Nickerson, S. C., W. E. Owens, L. K. Fox, C. C. Scheifinger,
T. R. Shryock, and T. E. Spike. 1999. Comparison of tilmicosin and
cephapirin as therapeutics for Staphylococcus aureus mastitis at
dry-off. J Dairy Sci. 82:696-703.
[0273] Owens, W. E., C. H. Ray, J. L. Watts, and R. J. Yancey.
1997. Comparison of success of antibiotic therapy during lactation
and results of antimicrobial susceptibility tests for bovine
mastitis. J Dairy Sci. 80:313-317.
[0274] Park, Y. K., H. C. Koo, S. H. Kim, S. Y. Hwang, W. K. Jung,
J. Kim, S. Shin, R. Kim, and Y. Park. 2007. The analysis of milk
components and pathogenic bacteria isolated from bovine raw milk in
Korea. J Dairy Sci. 90:5405-5414.
[0275] Peles, F., M. Wagner, L. Varga, I. Hein, P. Rieck, K.
Gutser, P. Kereszt ri, G. Kardos, I. Turcsanyi, B. Beri, and A.
Szabo. 2007. Characterization of Staphylococcus aureus strains
isolated from bovine milk in Hungary. Int J Food Microbiol.
118:186-93.
[0276] Peterson, J. D., Umayam, L. A., Dickinson, T., Hickey, E.
K., White, O. 2001. The Comprehensive Microbial Resource. Nucleic
Acids Res. 29(1): 123-5.
[0277] Pelitclerc, D., K. Lauzon, A. Cochu, C. Ster, M. S. Diarra,
and P. Lacasse. 2007. Efficacy of a lactoferrin-penicillin
combination to treat {beta}-lactam-resistant Staphylococcus aureus
mastitis. J Dairy Sci. 90:2778-2787.
[0278] Pragman, A. A., and P. M. Schlievert. 2004. Virulence
regulation in Staphylococcus aureus: the need for in vivo analysis
of virulence factor regulation. FEMS Immunol Med Microbiol.
42:147-154.
[0279] Saha S. and Raghava G. P. S. BcePred: Prediction of
Continuous B-Cell Epitopes in Antigenic Sequences Using
Physico-chemical Properties. In G. Nicosia, V. Cutello, P. J.
Bentley and J. Timis (Eds.) ICARIS 2004, LNCS 3239, 197-204,
Springer, 2004.
[0280] Saha, S and Raghava G. P. S., (2006) Prediction of
Continuous B-cell Epitopes in an Antigen Using Recurrent Neural
Network. Proteins, 65(1),40-48.
[0281] Sandholm, M., L. Kaartinen, and S. Pyorala. 1990. Bovine
mastitis--why does antibiotic therapy not always work? An overview.
J Vet Phamacol Therap. 13:248-260.
[0282] Schaffer, A. C., and J. C. Lee. 2009. Staphylococcal
vaccines and immunotherapies. Infect Dis Clin North Am.
23:153-171.
[0283] Sears, P. M. and McCarthy, K. K. 2003. Management and
treatment of staphylococcal mastitis. Vet Clin North Am Food Anim
Pract 19:171-185.
[0284] Sibbald, M. J., A. K. Ziebandt, S. Engelmann, M. Hecker, A.
de Jong, H. J. Harmsen, G. C. Raangs, I. Stokroos, J. P. Arends, J.
Y. Dubois, and J. M. van Dijl. 2006. Mapping the pathways to
staphylococcal pathogenesis by comparative secretomics. Microbiol
Mol Biol Rev. 70:755-788.
[0285] Silanikove, N., F. Shapiro, and G. Leitner. 2007.
Posttranslational ruling of xanthine oxidase activity in bovine
milk by its substrates. Biochem Biophys Res Commun.
363:561-565.
[0286] Somerville, G. A., and R. A. Proctor. 2009. At the
crossroads of bacterial metabolism and virulence factor synthesis
in Staphylococci. Microbiol Mol Biol Rev. 73:233-248.
[0287] Sprickler A. R. and J. A. Roth. Adjuvants in veterinary
vaccines: mode of action and adverse effects. 2003. 17:273-281.
[0288] Srinivasan, V., A. A. Sawant, B. E. Gillespie, S. J.
Headrick, L. Ceasaris, and S. P. Oliver. 2006. Prevalence of
enterotoxin and toxic shock syndrome toxin genes in Staphylococcus
aureus isolated from milk of cows with mastitis. Foodborne Pathog
Dis. 3:274-83.
[0289] Srivastava S, Singh V, Kumar V, Verma P C, Srivastava R,
Basu V, Gupta V, Rawat A K. Identification of regulatory elements
in 16S rRNA gene of Acinetobacter species isolated from water
sample. Bioinformation. 2008, 3(4):173-6. Epub 2008 Dec. 6.
[0290] Taverna, F., A. Negri, R. Piccinini, A. Zecconi, S. Nonnis,
S. Ronchi, and G. Tedeschi. 2007. Characterization of cell wall
associated proteins of a Staphylococcus aureus isolated from bovine
mastitis case by a proteomic approach. Vet Microbiol.
119:240-247
[0291] Tollersrud, T., A. H. Kampen, and K. Kenny. 2006.
Staphylococcus aureus enterotoxin D is secreted in milk and
stimulates specific antibody responses in cows in the course of
experimental intramammary infection. Infect Immun.
74:3507-3512.
[0292] Tuchscherr, L. P., F. R. Buzzola, L. P. Alvarez, J. C. Lee,
and D. O. Sordelli. 2008. Antibodies to capsular polysaccharide and
clumping factor A prevent mastitis and the emergence of
unencapsulated and small-colony variants of Staphylococcus aureus
in mice. Infect Immun. 76:5738-5744.
[0293] Tusnady, G. E. and Simon, I. 2001. The HMMTOP transmembrane
topology prediction server" Bioinformatics 17, 849-850
[0294] Voyich, J. M., K. R. Braughton, D. E. Sturdevant, A. R.
Whitney, B. Said Salim, S. F. Porcella, R. D. Long, D. W. Dorward,
D. J. Gardner, B. N. Kreiswirth, J. M. Musser, and F. R. DeLeo.
2005. Insights into mechanisms used by Staphylococcus aureus to
avoid destruction by human neutrophils. J Immunol.
175:3907-3919.
[0295] WO/2003/091279
[0296] WO/2004/043405
[0297] WO/2008/152447
[0298] WO/2005/007683
[0299] WO/2006/059846
[0300] Ziebandt, A. K, H. Kusch, M. Degner, S. Jaglitz, M. J.
Sibbald, J. P. Arends, M. A. Chlebowicz, D. Albrecht, R. Pantucek,
J. Do kar, W. Ziebuhr, B. M. Broker, M. Hecker, J. M. van Dijl, and
S. Engelmann. 2010. Proteomics uncovers extreme heterogeneity in
the Staphylococcus aureus exoproteome due to genomic plasticity and
variant gene regulation. Proteomics 285(47)36794-36803.
Sequence CWU 1
1
102120DNAartificial sequencesynthetic PCR primer 1ggtgctgggc
aaatacaagt 20220DNAartificial sequencesynthetic PCR primer
2tcccacacta aatggtgcaa 20320DNAartificial sequencesynthetic PCR
primer 3aggtcctaga ccagcgcttt 20419DNAartificial sequencesynthetic
PCR primer 4tctctcccat cacttgagc 19521DNAartificial
sequencesynthetic PCR primer 5catacacagt tgctggcaga g
21622DNAartificial sequencesynthetic PCR primer 6caagccatag
gaaatatgag ca 22720DNAartificial sequencesynthetic PCR primer
7gcacaagaag tgttgcgaga 20820DNAartificial sequencesynthetic PCR
primer 8gtcgttttcc cagatccaga 20926DNAartificial sequencesynthetic
PCR primer 9taattaagga aggagtgatt tcaatg 261026DNAartificial
sequencesynthetic PCR primer 10tttttagtga atttgttcac tgtgtc
261120DNAartificial sequencesynthetic PCR primer 11caatgcatcg
cgaaaactta 201220DNAartificial sequencesynthetic PCR primer
12gcttagcttg tgggaactgg 201320DNAartificial sequencesynthetic PCR
primer 13catctcggct taggttacgc 201420DNAartificial
sequencesynthetic PCR primer 14tttttcggcc taagtttgga
201520DNAartificial sequencesynthetic PCR primer 15ttgcgttagc
aaatggagac 201620DNAartificial sequencesynthetic PCR primer
16aatgcgtgca aatacccaag 201714PRTStaphylococcus aureus 17Thr Phe
Gly Ile Tyr Pro Lys Ala Asp Ala Ser Thr Gln Asn1 5
101814PRTStaphylococcus aureus 18Lys Asp Thr Ile Asn Gly Lys Ser
Asn Lys Ser Arg Asn Trp1 5 101915PRTStaphylococcus aureus 19Lys Asp
Gly Gly Lys Tyr Thr Leu Glu Ser His Lys Glu Leu Gln1 5 10
152014PRTStaphylococcus aureus 20Gln Phe Gly Phe Asp Leu Lys His
Lys Lys Asp Ala Leu Ala1 5 102113PRTStaphylococcus aureus 21Thr Ile
Lys Asp Gln Gln Lys Ala Asn Gln Leu Ala Ser1 5
102214PRTStaphylococcus aureus 22Lys Asp Ile Asn Lys Ile Tyr Phe
Met Thr Asp Val Asp Leu1 5 102313PRTStaphylococcus aureus 23Asp Val
Asp Leu Gly Gly Pro Thr Phe Val Leu Asn Asp1 5
1024612DNAStaphylococcus aureus 24atgttcaaaa aaaatgactc gaaaaattca
attctattaa aatctattct atcgctaggt 60atcatctatg ggggaacatt tggaatatat
ccaaaagcag acgcgtcaac acaaaattcc 120ccaagtgtac aagataaaca
attccaaaaa gttgaagaag taccaaataa ttcagaaaaa 180gctttggtta
aaaaacttta cgatagatac agccaaaata caataaacgg aaaatctaat
240aaatctagga attgggttta ttcagagaga cctttaaatg aaaaccaagt
tcgtataaat 300ttagaaggaa catacagagt tgctgataga gtatatacac
ctaagagaaa tattactctt 360aataaagaag ttgtcacttt aaaggaattg
gatcatatca taagatttgc tcatatttct 420tatggcttat atatgggaga
acatttgcct aaaggtaaca tcgtcataaa tacaaaagat 480ggcggtaaat
atacattaga gtcgcataaa gagctacaaa aagataggga aaatgtaaaa
540attaatacag ccgatataaa aaatgtaact ttcaaacttg tgaaaagtgt
taatgacatt 600gaacaagttt ga 61225612DNAStaphylococcus aureus
25atgttcaaaa aaaatgactc gaaaaattca attctattaa aatctattct atcgctaggt
60atcatctatg ggggaacatt tggaatatat ccaaaagcag acgcgtcaac acaaaattcc
120ccaagtgtac aagataaaca attccaaaaa gttgaagaag taccaaataa
ttcagaaaaa 180gctttggtta aaaaacttta cgatagatac agccaaaata
caataaacgg aaaatctaat 240aaatctagga attgggttta ttcagagaga
cctttaaatg aaaaccaagt tcgtataaat 300ttagaaggaa catacagagt
tgctgataga gtatatacac ctaagagaaa tattactctt 360aataaagaag
ttgtcacttt aaaggaattg gatcatatca taagatttgc tcatatttct
420tatggcttat atatgggaga acatttgcct aaaggtaaca tcgtcataaa
tacaaaagat 480ggcggtaaat atacattaga gtcgcataaa gagctacaaa
aagataggga aaatgtaaaa 540attaatacag ccgatataaa aaatgtaact
ttcaaacttg tgaaaagtgt taatgacatt 600gaacaagttt ga
61226612DNAStaphylococcus aureus 26atgttcaaaa aatatgactc aaaaaattca
atcgtattaa aatctattct atcgctaggt 60atcatctatg ggggaacatt tggaatatat
ccaaaagcag acgcgtcaac acaaaattcc 120tcaagtgtac aagataaaca
attacaaaaa gttgaagaag taccaaataa ttcagaaaaa 180gctttggtta
aaaaacttta cgatagatac agcaaggata caataaatgg aaaatctaat
240aaatctagga attgggttta ttcagagaga cctttaaatg aaaaccaagt
tcgtatacat 300ttagaaggaa catacacagt tgctggcaga gtgtatacac
ctaagaggaa tattactctt 360aataaagaag ttgtcacttt aaaagaattg
gatcatatca taagatttgc tcatatttcc 420tatggcttgt atatgggaga
acatttgcct aaaggtaaca tcgtcataaa tacaaaagat 480ggtggtaaat
atacattaga gtcgcataaa gagctacaaa aagataggga aaatgtaaaa
540attaatacag ccgatataaa aaatgtaact ttcaaacttg tgaaaagtgt
taatgacatt 600gaacaagttt ga 61227612DNAStaphylococcus aureus
27atgttcaaaa aatatgactc aaaaaattca atcgtattaa aatctattct atcgctaggt
60atcatctatg ggggaacatt tggaatatat ccaaaagcag acgcgtcaac acaaaattcc
120tcaagtgtac aagataaaca attacaaaaa gttgaagaag taccaaataa
ttcagaaaaa 180gctttggtta aaaaacttta cgatagatac agcaaggata
caataaatgg aaaatctaat 240aaatctagga attgggttta ttcagagaga
cctttaaatg aaaaccaagt tcgtatacat 300ttagaaggaa catacacagt
tgctggcaga gtgtatacac ctaagaggaa tattactctt 360aataaagaag
ttgtcacttt aaaagaattg gatcatatca taagatttgc tcatatttcc
420tatggcttgt atatgggaga acatttgcct aaaggtaaca tcgtcataaa
tacaaaagat 480ggtggtaaat atacattaga gtcgcataaa gagctacaaa
aagataggga aaatgtaaaa 540attaatacag ccgatataaa aaatgtaact
ttcaaacttg tgaaaagtgt taatgacatt 600gaacaagttt ga
61228612DNAStaphylococcus aureus 28atgttcaaaa aatatgactc aaaaaattca
atcgtattaa aatctattct atcgctaggt 60atcatctatg ggggaacatt tggaatatat
ccaaaagcag acgcgtcaac acaaaattcc 120tcaagtgtac aagataaaca
attacaaaaa gttgaagaag taccaaataa ttcagaaaaa 180gctttggtta
aaaaacttta cgatagatac agcaaggata caataaatgg aaaatctaat
240aaatctagga attgggttta ttcagagaga cctttaaatg aaaaccaagt
tcgtatacat 300ttagaaggaa catacacagt tgctggcaga gtgtatacac
ctaagaggaa tattactctt 360aataaagaag ttgtcacttt aaaagaattg
gatcatatca taagatttgc tcatatttcc 420tatggcttgt atatgggaga
acatttgcct aaaggtaaca tcgtcataaa tacaaaagat 480ggtggtaaat
atacattaga gtcgcataaa gagctacaaa aagataggga aaatgtaaaa
540attaatacag ccgatataaa aaatgtaact ttcaaacttg tgaaaagtgt
taatgacatt 600gaacaagttt ga 61229612DNAStaphylococcus aureus
29atgttcaaaa aatatgactc aaaaaattca atcgtattaa aatctattct atcgctaggt
60atcatctatg ggggaacatt tggaatatat ccaaaagcag acgcgtcaac acaaaattcc
120tcaagtgtac aagataaaca attacaaaaa gttgaagaag taccaaataa
ttcagaaaaa 180gctttggtta aaaaacttta cgatagatac agcaaggata
caataaatgg aaaatctaat 240aaatctagga attgggttta ttcagagaga
cctttaaatg aaaaccaagt tcgtatacat 300ttagaaggaa catacacagt
tgctggcaga gtgtatacac ctaagaggaa tattactctt 360aataaagaag
ttgtcacttt aaaagaattg gatcatatca taagatttgc tcatatttcc
420tatggcttgt atatgggaga acatttgcct aaaggtaaca tcgtcataaa
tacaaaagat 480ggtggtaaat atacattaga gtcgcataaa gagctacaaa
aagataggga aaatgtaaaa 540attaatacag ccgatataaa aaatgtaact
ttcaaacttg tgaaaagtgt taatgacatt 600gaacaagttt ga
61230612DNAStaphylococcus aureus 30atgttcaaaa aatatgactc aaaaaattca
atcgtattaa aatctattct atcgctaggt 60atcatctatg ggggaacatt tggaatatat
ccaaaagcag acgcgtcaac acaaaattcc 120tcaagtgtac aagataaaca
attacaaaaa gttgaagaag taccaaataa ttcagaaaaa 180gctttggtta
aaaaacttta cgatagatac agcaaggata caataaatgg aaaatctaat
240aaatctagga attgggttta ttcagagaga cctttaaatg aaaaccaagt
tcgtatacat 300ttagaaggaa catacacagt tgctgataga gtatatacac
ctaagagaaa tattactctt 360aataaagaag ttgtcacttt aaaggaattg
gatcatatca taagatttgc tcatatttct 420tatggcttat atatgggaga
acatttgcct aaaggtaaca tcgtcataaa tacaaaagat 480ggcggtaaat
atacattaga gtcgcataaa gagctacaaa aagataggga aaatgtaaaa
540attaatacag ccgatataaa aaatgtaact ttcaaacttg tgaaaagtgt
taatgacatt 600gaacaagttt ga 61231612DNAStaphylococcus aureus
31atgttcaaaa aatatgactc aaaaaattca atcgtattaa aatctattct atcgctaggt
60atcatctatg ggggaacatt tggaatatat ccaaaagcag acgcgtcaac acaaaattcc
120tcaagtgtac aagataaaca attacaaaaa gttgaagaag taccaaataa
ttcagaaaaa 180gctttggtta aaaaacttta cgatagatac agcaaggata
caataaatgg aaaatctaat 240aaatctagga attgggttta ttcagagaga
cctttaaatg aaaaccaagt tcgtatacat 300ttagaaggaa catacacagt
tgctgataga gtatatacac ctaagagaaa tattactctt 360aataaagaag
ttgtcacttt aaaggaattg gatcatatca taagatttgc tcatatttct
420tatggcttat atatgggaga acatttgcct aaaggtaaca tcgtcataaa
tacaaaagat 480ggcggtaaat atacattaga gtcgcataaa gagctacaaa
aagataggga aaatgtaaaa 540attaatacag ccgatataaa aaatgtaact
ttcaaacttg tgaaaagtgt taatgacatt 600gaacaagttt ga
61232612DNAStaphylococcus aureus 32atgttcaaaa aatatgactc aaaaaattca
atcgtattaa aatctattct atcgctaggt 60atcatctatg ggggaacatt tggaatatat
ccaaaagcag acgcgtcaac acaaaattcc 120tcaagtgtac aagataaaca
attacaaaaa gttgaagaag taccaaataa ttcagaaaaa 180gctttggtta
aaaaacttta cgatagatac agcaaggata caataaatgg aaaatctaat
240aaatctagga attgggttta ttcagagaga cctttaaatg aaaaccaagt
tcgtatacat 300ttagaaggaa catacacagt tgctgataga gtatatacac
ctaagagaaa tattactctt 360aataaagaag ttgtcacttt aaaggaattg
gatcatatca taagatttgc tcatatttct 420tatggcttat atatgggaga
acatttgcct aaaggtaaca tcgtcataaa tacaaaagat 480ggcggtaaat
atacattaga gtcgcataaa gagctacaaa aagataggga aaatgtaaaa
540attaatacag ccgatataaa aaatgtaact ttcaaacttg tgaaaagtgt
taatgacatt 600gaacaagttt ga 61233612DNAStaphylococcus aureus
33atgttcaaaa aatatgactc aaaaaattca atcgtattaa aatctattct atcgctaggt
60atcatctatg ggggaacatt tggaatatat ccaaaagcag acgcgtcaac acaaaattcc
120tcaagtgtac aagataaaca attacaaaaa gttgaagaag taccaaataa
ttcagaaaaa 180gctttggtta aaaaacttta cgatagatac agcaaggata
caataaatgg aaaatctaat 240aaatctagga attgggttta ttcagagaga
cctttaaatg aaaaccaagt tcgtatacat 300ttagaaggaa catacacagt
tgctgataga gtatatacac ctaagagaaa tattactctt 360aataaagaag
ttgtcacttt aaaggaattg gatcatatca taagatttgc tcatatttct
420tatggcttat atatgggaga acatttgcct aaaggtaaca tcgtcataaa
tacaaaagat 480ggcggtaaat atacattaga gtcgcataaa gagctacaaa
aagataggga aaatgtaaaa 540attaatacag ccgatataaa aaatgtaact
ttcaaacttg tgaaaagtgt taatgacatt 600gaacaagttt ga
61234612DNAStaphylococcus aureus 34atgttcaaaa aatatgactc aaaaaattca
atcgtattaa aatctattct atcgctaggt 60atcatctatg ggggaacatt tggaatatat
ccaaaagcag acgcgtcaac acaaaattcc 120tcaagtgtac aagataaaca
attacaaaaa gttgaagaag taccaaataa ttcagaaaaa 180gctttggtta
aaaaacttta cgatagatac agcaaggata caataaatgg aaaatctaat
240aaatctagga attgggttta ttcagagaga cctttaaatg aaaaccaagt
tcgtatacat 300ttagaaggaa catacacagt tgctgataga gtatatacac
ctaagagaaa tattactctt 360aataaagaag ttgtcacttt aaaggaattg
gatcatatca taagatttgc tcatatttct 420tatggcttat atatgggaga
acatttgcct aaaggtaaca tcgtcataaa tacaaaagat 480ggcggtaaat
atacattaga gtcgcataaa gagctacaaa aagataggga aaatgtaaaa
540attaatacag ccgatataaa aaatgtaact ttcaaacttg tgaaaagtgt
taatgacatt 600gaacaagttt ga 61235612DNAStaphylococcus aureus
35atgttcaaaa aatatgactc aaaaaattca atcgtattaa aatctattct atcgctaggt
60atcatctatg ggggaacatt tggaatatat ccaaaagcag acgcgtcaac acaaaattcc
120tcaagtgtac aagataaaca attccaaaaa gttgaagaag taccaaataa
ttcagaaaaa 180gctttggtta aaaaactgta cgatagatac agccaaaata
caataaacgg aaaatctaat 240aaagctagga attgggttta ttcagagaga
cctttaaatg aaaatcaagt tcgcatacat 300ttagaaggta catacagagt
tgctgataga gtgtatacac ctaagaggaa cattactctt 360aataaagaag
ttgtcacttt aaaagaattg gatcatatca taagatttgc tcatatttct
420tatggcttat atatgggaga acatttgcct aaaggtaaca tcgtcataaa
tacaaagaat 480ggcggtaaat atacattaga gtcgcacaaa gagttacaaa
agaataggga aaatgtagaa 540attaatactg atgatataaa aaatgtaact
ttcgaacttg tgaaaagtgt taatgacatt 600gaacaagttt ga
61236612DNAStaphylococcus aureusmisc_feature(13)..(13)n is a, c, g,
or tmisc_feature(21)..(21)n is a, c, g, or tmisc_feature(33)..(34)n
is a, c, g, or tmisc_feature(121)..(121)n is a, c, g, or
tmisc_feature(144)..(144)n is a, c, g, or
tmisc_feature(198)..(198)n is a, c, g, or
tmisc_feature(214)..(214)n is a, c, g, or
tmisc_feature(216)..(217)n is a, c, g, or
tmisc_feature(228)..(228)n is a, c, g, or
tmisc_feature(244)..(244)n is a, c, g, or
tmisc_feature(285)..(285)n is a, c, g, or
tmisc_feature(294)..(294)n is a, c, g, or
tmisc_feature(298)..(298)n is a, c, g, or
tmisc_feature(309)..(309)n is a, c, g, or
tmisc_feature(317)..(317)n is a, c, g, or
tmisc_feature(326)..(327)n is a, c, g, or
tmisc_feature(333)..(333)n is a, c, g, or
tmisc_feature(348)..(348)n is a, c, g, or
tmisc_feature(351)..(351)n is a, c, g, or
tmisc_feature(384)..(384)n is a, c, g, or
tmisc_feature(420)..(420)n is a, c, g, or
tmisc_feature(429)..(429)n is a, c, g, or
tmisc_feature(477)..(478)n is a, c, g, or
tmisc_feature(483)..(483)n is a, c, g, or
tmisc_feature(507)..(507)n is a, c, g, or
tmisc_feature(514)..(514)n is a, c, g, or
tmisc_feature(522)..(523)n is a, c, g, or
tmisc_feature(538)..(538)n is a, c, g, or
tmisc_feature(549)..(549)n is a, c, g, or
tmisc_feature(551)..(552)n is a, c, g, or
tmisc_feature(574)..(574)n is a, c, g, or t 36atgttcaaaa aanatgactc
naaaaattca atnntattaa aatctattct atcgctaggt 60atcatctatg ggggaacatt
tggaatatat ccaaaagcag acgcgtcaac acaaaattcc 120ncaagtgtac
aagataaaca attncaaaaa gttgaagaag taccaaataa ttcagaaaaa
180gctttggtta aaaaactnta cgatagatac agcnannata caataaangg
aaaatctaat 240aaanctagga attgggttta ttcagagaga cctttaaatg
aaaancaagt tcgnatanat 300ttagaaggna catacanagt tgctgnnaga
gtntatacac ctaagagnaa nattactctt 360aataaagaag ttgtcacttt
aaangaattg gatcatatca taagatttgc tcatatttcn 420tatggcttnt
atatgggaga acatttgcct aaaggtaaca tcgtcataaa tacaaannat
480ggnggtaaat atacattaga gtcgcanaaa gagntacaaa annataggga
aaatgtanaa 540attaatacng nngatataaa aaatgtaact ttcnaacttg
tgaaaagtgt taatgacatt 600gaacaagttt ga 61237203PRTStaphylococcus
aureus 37Met Phe Lys Lys Tyr Asp Ser Lys Asn Ser Ile Val Leu Lys
Ser Ile1 5 10 15Leu Ser Leu Gly Ile Ile Tyr Gly Gly Thr Phe Gly Ile
Tyr Pro Lys 20 25 30Ala Asp Ala Ser Thr Gln Asn Ser Ser Ser Val Gln
Asp Lys Gln Leu 35 40 45Gln Lys Val Glu Glu Val Pro Asn Asn Ser Glu
Lys Ala Leu Val Lys 50 55 60Lys Leu Tyr Asp Arg Tyr Ser Lys Asp Thr
Ile Asn Gly Lys Ser Asn65 70 75 80Lys Ser Arg Asn Trp Val Tyr Ser
Glu Arg Pro Leu Asn Glu Asn Gln 85 90 95Val Arg Ile His Leu Glu Gly
Thr Tyr Thr Val Ala Gly Arg Val Tyr 100 105 110Thr Pro Lys Arg Asn
Ile Thr Leu Asn Lys Glu Val Val Thr Leu Lys 115 120 125Glu Leu Asp
His Ile Ile Arg Phe Ala His Ile Ser Tyr Gly Leu Tyr 130 135 140Met
Gly Glu His Leu Pro Lys Gly Asn Ile Val Ile Asn Thr Lys Asp145 150
155 160Gly Gly Lys Tyr Thr Leu Glu Ser His Lys Glu Leu Gln Lys Asp
Arg 165 170 175Glu Asn Val Lys Ile Asn Thr Ala Asp Ile Lys Asn Val
Thr Phe Lys 180 185 190Leu Val Lys Ser Val Asn Asp Ile Glu Gln Val
195 20038203PRTStaphylococcus aureus 38Met Phe Lys Lys Tyr Asp Ser
Lys Asn Ser Ile Val Leu Lys Ser Ile1 5 10 15Leu Ser Leu Gly Ile Ile
Tyr Gly Gly Thr Phe Gly Ile Tyr Pro Lys 20 25 30Ala Asp Ala Ser Thr
Gln Asn Ser Ser Ser Val Gln Asp Lys Gln Leu 35 40 45Gln Lys Val Glu
Glu Val Pro Asn Asn Ser Glu Lys Ala Leu Val Lys 50 55 60Lys Leu Tyr
Asp Arg Tyr Ser Lys Asp Thr Ile Asn Gly Lys Ser Asn65 70 75 80Lys
Ser Arg Asn Trp Val Tyr Ser Glu Arg Pro Leu Asn Glu Asn Gln 85 90
95Val Arg Ile His Leu Glu Gly Thr Tyr Thr Val Ala Gly Arg Val Tyr
100 105 110Thr Pro Lys Arg Asn Ile Thr Leu Asn Lys Glu Val Val Thr
Leu Lys 115 120 125Glu Leu Asp His Ile Ile Arg Phe Ala His Ile Ser
Tyr Gly Leu Tyr 130 135 140Met Gly Glu His Leu Pro Lys Gly Asn Ile
Val Ile Asn Thr Lys Asp145 150 155 160Gly Gly Lys Tyr Thr Leu Glu
Ser His Lys Glu Leu Gln Lys Asp Arg 165 170 175Glu Asn Val Lys Ile
Asn Thr Ala Asp Ile Lys Asn Val Thr Phe Lys 180 185 190Leu
Val Lys Ser Val Asn Asp Ile Glu Gln Val 195
20039203PRTStaphylococcus aureus 39Met Phe Lys Lys Tyr Asp Ser Lys
Asn Ser Ile Val Leu Lys Ser Ile1 5 10 15Leu Ser Leu Gly Ile Ile Tyr
Gly Gly Thr Phe Gly Ile Tyr Pro Lys 20 25 30Ala Asp Ala Ser Thr Gln
Asn Ser Ser Ser Val Gln Asp Lys Gln Leu 35 40 45Gln Lys Val Glu Glu
Val Pro Asn Asn Ser Glu Lys Ala Leu Val Lys 50 55 60Lys Leu Tyr Asp
Arg Tyr Ser Lys Asp Thr Ile Asn Gly Lys Ser Asn65 70 75 80Lys Ser
Arg Asn Trp Val Tyr Ser Glu Arg Pro Leu Asn Glu Asn Gln 85 90 95Val
Arg Ile His Leu Glu Gly Thr Tyr Thr Val Ala Gly Arg Val Tyr 100 105
110Thr Pro Lys Arg Asn Ile Thr Leu Asn Lys Glu Val Val Thr Leu Lys
115 120 125Glu Leu Asp His Ile Ile Arg Phe Ala His Ile Ser Tyr Gly
Leu Tyr 130 135 140Met Gly Glu His Leu Pro Lys Gly Asn Ile Val Ile
Asn Thr Lys Asp145 150 155 160Gly Gly Lys Tyr Thr Leu Glu Ser His
Lys Glu Leu Gln Lys Asp Arg 165 170 175Glu Asn Val Lys Ile Asn Thr
Ala Asp Ile Lys Asn Val Thr Phe Lys 180 185 190Leu Val Lys Ser Val
Asn Asp Ile Glu Gln Val 195 20040203PRTStaphylococcus aureus 40Met
Phe Lys Lys Tyr Asp Ser Lys Asn Ser Ile Val Leu Lys Ser Ile1 5 10
15Leu Ser Leu Gly Ile Ile Tyr Gly Gly Thr Phe Gly Ile Tyr Pro Lys
20 25 30Ala Asp Ala Ser Thr Gln Asn Ser Ser Ser Val Gln Asp Lys Gln
Leu 35 40 45Gln Lys Val Glu Glu Val Pro Asn Asn Ser Glu Lys Ala Leu
Val Lys 50 55 60Lys Leu Tyr Asp Arg Tyr Ser Lys Asp Thr Ile Asn Gly
Lys Ser Asn65 70 75 80Lys Ser Arg Asn Trp Val Tyr Ser Glu Arg Pro
Leu Asn Glu Asn Gln 85 90 95Val Arg Ile His Leu Glu Gly Thr Tyr Thr
Val Ala Gly Arg Val Tyr 100 105 110Thr Pro Lys Arg Asn Ile Thr Leu
Asn Lys Glu Val Val Thr Leu Lys 115 120 125Glu Leu Asp His Ile Ile
Arg Phe Ala His Ile Ser Tyr Gly Leu Tyr 130 135 140Met Gly Glu His
Leu Pro Lys Gly Asn Ile Val Ile Asn Thr Lys Asp145 150 155 160Gly
Gly Lys Tyr Thr Leu Glu Ser His Lys Glu Leu Gln Lys Asp Arg 165 170
175Glu Asn Val Lys Ile Asn Thr Ala Asp Ile Lys Asn Val Thr Phe Lys
180 185 190Leu Val Lys Ser Val Asn Asp Ile Glu Gln Val 195
20041203PRTStaphylococcus aureus 41Met Phe Lys Lys Tyr Asp Ser Lys
Asn Ser Ile Val Leu Lys Ser Ile1 5 10 15Leu Ser Leu Gly Ile Ile Tyr
Gly Gly Thr Phe Gly Ile Tyr Pro Lys 20 25 30Ala Asp Ala Ser Thr Gln
Asn Ser Ser Ser Val Gln Asp Lys Gln Leu 35 40 45Gln Lys Val Glu Glu
Val Pro Asn Asn Ser Glu Lys Ala Leu Val Lys 50 55 60Lys Leu Tyr Asp
Arg Tyr Ser Lys Asp Thr Ile Asn Gly Lys Ser Asn65 70 75 80Lys Ser
Arg Asn Trp Val Tyr Ser Glu Arg Pro Leu Asn Glu Asn Gln 85 90 95Val
Arg Ile His Leu Glu Gly Thr Tyr Thr Val Ala Asp Arg Val Tyr 100 105
110Thr Pro Lys Arg Asn Ile Thr Leu Asn Lys Glu Val Val Thr Leu Lys
115 120 125Glu Leu Asp His Ile Ile Arg Phe Ala His Ile Ser Tyr Gly
Leu Tyr 130 135 140Met Gly Glu His Leu Pro Lys Gly Asn Ile Val Ile
Asn Thr Lys Asp145 150 155 160Gly Gly Lys Tyr Thr Leu Glu Ser His
Lys Glu Leu Gln Lys Asp Arg 165 170 175Glu Asn Val Lys Ile Asn Thr
Ala Asp Ile Lys Asn Val Thr Phe Lys 180 185 190Leu Val Lys Ser Val
Asn Asp Ile Glu Gln Val 195 20042203PRTStaphylococcus aureus 42Met
Phe Lys Lys Tyr Asp Ser Lys Asn Ser Ile Val Leu Lys Ser Ile1 5 10
15Leu Ser Leu Gly Ile Ile Tyr Gly Gly Thr Phe Gly Ile Tyr Pro Lys
20 25 30Ala Asp Ala Ser Thr Gln Asn Ser Ser Ser Val Gln Asp Lys Gln
Leu 35 40 45Gln Lys Val Glu Glu Val Pro Asn Asn Ser Glu Lys Ala Leu
Val Lys 50 55 60Lys Leu Tyr Asp Arg Tyr Ser Lys Asp Thr Ile Asn Gly
Lys Ser Asn65 70 75 80Lys Ser Arg Asn Trp Val Tyr Ser Glu Arg Pro
Leu Asn Glu Asn Gln 85 90 95Val Arg Ile His Leu Glu Gly Thr Tyr Thr
Val Ala Asp Arg Val Tyr 100 105 110Thr Pro Lys Arg Asn Ile Thr Leu
Asn Lys Glu Val Val Thr Leu Lys 115 120 125Glu Leu Asp His Ile Ile
Arg Phe Ala His Ile Ser Tyr Gly Leu Tyr 130 135 140Met Gly Glu His
Leu Pro Lys Gly Asn Ile Val Ile Asn Thr Lys Asp145 150 155 160Gly
Gly Lys Tyr Thr Leu Glu Ser His Lys Glu Leu Gln Lys Asp Arg 165 170
175Glu Asn Val Lys Ile Asn Thr Ala Asp Ile Lys Asn Val Thr Phe Lys
180 185 190Leu Val Lys Ser Val Asn Asp Ile Glu Gln Val 195
20043203PRTStaphylococcus aureus 43Met Phe Lys Lys Tyr Asp Ser Lys
Asn Ser Ile Val Leu Lys Ser Ile1 5 10 15Leu Ser Leu Gly Ile Ile Tyr
Gly Gly Thr Phe Gly Ile Tyr Pro Lys 20 25 30Ala Asp Ala Ser Thr Gln
Asn Ser Ser Ser Val Gln Asp Lys Gln Leu 35 40 45Gln Lys Val Glu Glu
Val Pro Asn Asn Ser Glu Lys Ala Leu Val Lys 50 55 60Lys Leu Tyr Asp
Arg Tyr Ser Lys Asp Thr Ile Asn Gly Lys Ser Asn65 70 75 80Lys Ser
Arg Asn Trp Val Tyr Ser Glu Arg Pro Leu Asn Glu Asn Gln 85 90 95Val
Arg Ile His Leu Glu Gly Thr Tyr Thr Val Ala Asp Arg Val Tyr 100 105
110Thr Pro Lys Arg Asn Ile Thr Leu Asn Lys Glu Val Val Thr Leu Lys
115 120 125Glu Leu Asp His Ile Ile Arg Phe Ala His Ile Ser Tyr Gly
Leu Tyr 130 135 140Met Gly Glu His Leu Pro Lys Gly Asn Ile Val Ile
Asn Thr Lys Asp145 150 155 160Gly Gly Lys Tyr Thr Leu Glu Ser His
Lys Glu Leu Gln Lys Asp Arg 165 170 175Glu Asn Val Lys Ile Asn Thr
Ala Asp Ile Lys Asn Val Thr Phe Lys 180 185 190Leu Val Lys Ser Val
Asn Asp Ile Glu Gln Val 195 20044203PRTStaphylococcus aureus 44Met
Phe Lys Lys Tyr Asp Ser Lys Asn Ser Ile Val Leu Lys Ser Ile1 5 10
15Leu Ser Leu Gly Ile Ile Tyr Gly Gly Thr Phe Gly Ile Tyr Pro Lys
20 25 30Ala Asp Ala Ser Thr Gln Asn Ser Ser Ser Val Gln Asp Lys Gln
Leu 35 40 45Gln Lys Val Glu Glu Val Pro Asn Asn Ser Glu Lys Ala Leu
Val Lys 50 55 60Lys Leu Tyr Asp Arg Tyr Ser Lys Asp Thr Ile Asn Gly
Lys Ser Asn65 70 75 80Lys Ser Arg Asn Trp Val Tyr Ser Glu Arg Pro
Leu Asn Glu Asn Gln 85 90 95Val Arg Ile His Leu Glu Gly Thr Tyr Thr
Val Ala Asp Arg Val Tyr 100 105 110Thr Pro Lys Arg Asn Ile Thr Leu
Asn Lys Glu Val Val Thr Leu Lys 115 120 125Glu Leu Asp His Ile Ile
Arg Phe Ala His Ile Ser Tyr Gly Leu Tyr 130 135 140Met Gly Glu His
Leu Pro Lys Gly Asn Ile Val Ile Asn Thr Lys Asp145 150 155 160Gly
Gly Lys Tyr Thr Leu Glu Ser His Lys Glu Leu Gln Lys Asp Arg 165 170
175Glu Asn Val Lys Ile Asn Thr Ala Asp Ile Lys Asn Val Thr Phe Lys
180 185 190Leu Val Lys Ser Val Asn Asp Ile Glu Gln Val 195
20045203PRTStaphylococcus aureus 45Met Phe Lys Lys Tyr Asp Ser Lys
Asn Ser Ile Val Leu Lys Ser Ile1 5 10 15Leu Ser Leu Gly Ile Ile Tyr
Gly Gly Thr Phe Gly Ile Tyr Pro Lys 20 25 30Ala Asp Ala Ser Thr Gln
Asn Ser Ser Ser Val Gln Asp Lys Gln Leu 35 40 45Gln Lys Val Glu Glu
Val Pro Asn Asn Ser Glu Lys Ala Leu Val Lys 50 55 60Lys Leu Tyr Asp
Arg Tyr Ser Lys Asp Thr Ile Asn Gly Lys Ser Asn65 70 75 80Lys Ser
Arg Asn Trp Val Tyr Ser Glu Arg Pro Leu Asn Glu Asn Gln 85 90 95Val
Arg Ile His Leu Glu Gly Thr Tyr Thr Val Ala Asp Arg Val Tyr 100 105
110Thr Pro Lys Arg Asn Ile Thr Leu Asn Lys Glu Val Val Thr Leu Lys
115 120 125Glu Leu Asp His Ile Ile Arg Phe Ala His Ile Ser Tyr Gly
Leu Tyr 130 135 140Met Gly Glu His Leu Pro Lys Gly Asn Ile Val Ile
Asn Thr Lys Asp145 150 155 160Gly Gly Lys Tyr Thr Leu Glu Ser His
Lys Glu Leu Gln Lys Asp Arg 165 170 175Glu Asn Val Lys Ile Asn Thr
Ala Asp Ile Lys Asn Val Thr Phe Lys 180 185 190Leu Val Lys Ser Val
Asn Asp Ile Glu Gln Val 195 20046203PRTStaphylococcus aureus 46Met
Phe Lys Lys Asn Asp Ser Lys Asn Ser Ile Leu Leu Lys Ser Ile1 5 10
15Leu Ser Leu Gly Ile Ile Tyr Gly Gly Thr Phe Gly Ile Tyr Pro Lys
20 25 30Ala Asp Ala Ser Thr Gln Asn Ser Pro Ser Val Gln Asp Lys Gln
Phe 35 40 45Gln Lys Val Glu Glu Val Pro Asn Asn Ser Glu Lys Ala Leu
Val Lys 50 55 60Lys Leu Tyr Asp Arg Tyr Ser Gln Asn Thr Ile Asn Gly
Lys Ser Asn65 70 75 80Lys Ser Arg Asn Trp Val Tyr Ser Glu Arg Pro
Leu Asn Glu Asn Gln 85 90 95Val Arg Ile Asn Leu Glu Gly Thr Tyr Arg
Val Ala Asp Arg Val Tyr 100 105 110Thr Pro Lys Arg Asn Ile Thr Leu
Asn Lys Glu Val Val Thr Leu Lys 115 120 125Glu Leu Asp His Ile Ile
Arg Phe Ala His Ile Ser Tyr Gly Leu Tyr 130 135 140Met Gly Glu His
Leu Pro Lys Gly Asn Ile Val Ile Asn Thr Lys Asp145 150 155 160Gly
Gly Lys Tyr Thr Leu Glu Ser His Lys Glu Leu Gln Lys Asp Arg 165 170
175Glu Asn Val Lys Ile Asn Thr Ala Asp Ile Lys Asn Val Thr Phe Lys
180 185 190Leu Val Lys Ser Val Asn Asp Ile Glu Gln Val 195
20047203PRTStaphylococcus aureus 47Met Phe Lys Lys Tyr Asp Ser Lys
Asn Ser Ile Val Leu Lys Ser Ile1 5 10 15Leu Ser Leu Gly Ile Ile Tyr
Gly Gly Thr Phe Gly Ile Tyr Pro Lys 20 25 30Ala Asp Ala Ser Thr Gln
Asn Ser Ser Ser Val Gln Asp Lys Gln Phe 35 40 45Gln Lys Val Glu Glu
Val Pro Asn Asn Ser Glu Lys Ala Leu Val Lys 50 55 60Lys Leu Tyr Asp
Arg Tyr Ser Gln Asn Thr Ile Asn Gly Lys Ser Asn65 70 75 80Lys Ala
Arg Asn Trp Val Tyr Ser Glu Arg Pro Leu Asn Glu Asn Gln 85 90 95Val
Arg Ile His Leu Glu Gly Thr Tyr Arg Val Ala Asp Arg Val Tyr 100 105
110Thr Pro Lys Arg Asn Ile Thr Leu Asn Lys Glu Val Val Thr Leu Lys
115 120 125Glu Leu Asp His Ile Ile Arg Phe Ala His Ile Ser Tyr Gly
Leu Tyr 130 135 140Met Gly Glu His Leu Pro Lys Gly Asn Ile Val Ile
Asn Thr Lys Asn145 150 155 160Gly Gly Lys Tyr Thr Leu Glu Ser His
Lys Glu Leu Gln Lys Asn Arg 165 170 175Glu Asn Val Glu Ile Asn Thr
Asp Asp Ile Lys Asn Val Thr Phe Glu 180 185 190Leu Val Lys Ser Val
Asn Asp Ile Glu Gln Val 195 20048203PRTStaphylococcus
aureusmisc_feature(5)..(5)Xaa can be any naturally occurring amino
acidmisc_feature(12)..(12)Xaa can be any naturally occurring amino
acidmisc_feature(41)..(41)Xaa can be any naturally occurring amino
acidmisc_feature(48)..(48)Xaa can be any naturally occurring amino
acidmisc_feature(72)..(73)Xaa can be any naturally occurring amino
acidmisc_feature(82)..(82)Xaa can be any naturally occurring amino
acidmisc_feature(100)..(100)Xaa can be any naturally occurring
amino acidmisc_feature(106)..(106)Xaa can be any naturally
occurring amino acidmisc_feature(109)..(109)Xaa can be any
naturally occurring amino acidmisc_feature(160)..(160)Xaa can be
any naturally occurring amino acidmisc_feature(175)..(175)Xaa can
be any naturally occurring amino acidmisc_feature(180)..(180)Xaa
can be any naturally occurring amino
acidmisc_feature(184)..(184)Xaa can be any naturally occurring
amino acidmisc_feature(192)..(192)Xaa can be any naturally
occurring amino acid 48Met Phe Lys Lys Xaa Asp Ser Lys Asn Ser Ile
Xaa Leu Lys Ser Ile1 5 10 15Leu Ser Leu Gly Ile Ile Tyr Gly Gly Thr
Phe Gly Ile Tyr Pro Lys 20 25 30Ala Asp Ala Ser Thr Gln Asn Ser Xaa
Ser Val Gln Asp Lys Gln Xaa 35 40 45Gln Lys Val Glu Glu Val Pro Asn
Asn Ser Glu Lys Ala Leu Val Lys 50 55 60Lys Leu Tyr Asp Arg Tyr Ser
Xaa Xaa Thr Ile Asn Gly Lys Ser Asn65 70 75 80Lys Xaa Arg Asn Trp
Val Tyr Ser Glu Arg Pro Leu Asn Glu Asn Gln 85 90 95Val Arg Ile Xaa
Leu Glu Gly Thr Tyr Xaa Val Ala Xaa Arg Val Tyr 100 105 110Thr Pro
Lys Arg Asn Ile Thr Leu Asn Lys Glu Val Val Thr Leu Lys 115 120
125Glu Leu Asp His Ile Ile Arg Phe Ala His Ile Ser Tyr Gly Leu Tyr
130 135 140Met Gly Glu His Leu Pro Lys Gly Asn Ile Val Ile Asn Thr
Lys Xaa145 150 155 160Gly Gly Lys Tyr Thr Leu Glu Ser His Lys Glu
Leu Gln Lys Xaa Arg 165 170 175Glu Asn Val Xaa Ile Asn Thr Xaa Asp
Ile Lys Asn Val Thr Phe Xaa 180 185 190Leu Val Lys Ser Val Asn Asp
Ile Glu Gln Val 195 200491755DNAStaphylococcus aureus 49atgacagagt
catatccaat tattaaggaa ggctcacaag tcggaagcta ctttctattt 60ttcatcataa
ttgcattttt gttatatgcc aatgtgttat ttattaaacg acgaagttat
120gagcttgcat tatatcaaac attaggttta tctaaattca acattattta
tatactaatg 180ctcgaacaat tactaatatt tataattacg gcaatattag
gtattattat tggtattttt 240ggttcaaaac tgttattaat gattgtcttt
acattattag gaattaaaga aaaggttcca 300attattttta gtttgagggc
ggtatttgaa acattaatgt taatcggtgt cgcttatttt 360ttaacctctg
ctcaaaattt tatattagtg ttcaaacaat ctatttcaca gatgtcaaag
420aataaccagg ttaaagaaac aaatcataat aaaattacat ttgaagaggt
tgttttaggc 480atcttaggta tagtattgat tatcacagga tactatctat
ctttgaacat tgttcaatat 540tatgattcta tcggtatact tatgtttatt
ttattgtcaa ctgtgattgg ggcatactta 600ttttttaaaa gctctgtttc
tctagttttt aaaatggtga agaagtttag aaaaggtgtt 660ataagtgtaa
atgatgtcat gttctcatca tctattatgt atcgtattaa gaaaaatgct
720ttttcactta cggtcatggc aatcatttca gcgattactg tttcagttct
ttgctttgct 780gctataagta gagcgtcctt atcaagtgaa ataaaatata
ctgcaccaca cgacgttaca 840attaaagacc aacaaaaagc taatcaatta
gcaagtgaat taaacaatca aaaaattcct 900catttttata attataaaga
agtaattcat acgaaattgt ataaagataa tttatttgat 960gtaaaagcga
aagaaccata caatgtaaca attactagtg ataaatatat ccctaatact
1020gatttgaaac gtggacaagc tgatttgttt gtagcggaag gttctatcaa
agatttagtg 1080aaacataaga agcatggtaa ggcaattata ggaacgaaaa
aacatcatgt taatattaag 1140ttacggaaag atattaataa aatctatttt
atgacagatg ttgatttagg tggaccaacg 1200tttgtcttaa atgacaaaga
ctatcaagaa ataagaaagt atacaaaagc aaagcatatc 1260gtctctcaat
ttggattcga tttgaaacat aaaaaagatg ctttagcatt agaaaaagtg
1320aaaaataaag ttgataaatc tattaaaaca agaagtgaag cgataagctc
aatatcaagt 1380ttaaccggaa tattattatt tgtaacatca tttttaggta
ttacattctt gattgctgta 1440tgttgcatta tatacattaa gcaaatagat
gaaaccgaag atgagttaga gaattatagt 1500atattgagaa agcttggatt
tacacaaaaa
gatatggcaa ggggactaaa gtttaaaatt 1560atgtttaatt ttgggttacc
tttagttatt gcactatcac atgcatattt tacatcatta 1620gcatatatga
aattaatggg tacaacgaat caaataccgg ttttcatagt aatgggatta
1680tacatttgta tgtatgctgt ttttgcagtg acggcttata atcattccaa
gcgaacaatt 1740agacattcca tataa 1755501755DNAStaphylococcus aureus
50atgacagagt catatccaat tattaaggaa ggctcacaag tcggaagcta ctttctattt
60ttcatcataa ttgcattttt gttatatgcc aatgtgttat ttattaaacg acgaagttat
120gagcttgcat tatatcaaac attaggttta tctaaattca acattattta
tatactaatg 180ctcgaacaat tactaatatt tataattacg gcaatattag
gtattattat tggtattttt 240ggttcaaaac tgttattaat gattgtcttt
acattattag gaattaaaga aaaggttcca 300attattttta gtttgagggc
ggtatttgaa acattaatgt taatcggtgt cgcttatttt 360ttaacctctg
ctcaaaattt tatattagtg ttcaaacaat ctatttcaca gatgtcaaag
420aataaccagg ttaaagaaac aaatcataat aaaattacat ttgaagaggt
tgttttaggc 480atcttaggta tagtattgat tatcacagga tactatctat
ctttgaacat tgttcaatat 540tatgattcta tcggtatact tatgtttatt
ttattgtcaa ctgtgattgg ggcatactta 600ttttttaaaa gctctgtttc
tctagttttt aaaatggtga agaagtttag aaaaggtgtt 660ataagtgtaa
atgatgtcat gttctcatca tctattatgt atcgtattaa gaaaaatgct
720ttttcactta cggtcatggc aatcatttca gcgattactg tttcagttct
ttgctttgct 780gctataagta gagcgtcctt atcaagtgaa ataaaatata
ctgcaccaca cgacgttaca 840attaaagacc aacaaaaagc taatcaatta
gcaagtgaat taaacaatca aaaaattcct 900catttttata attataaaga
agtaattcat acgaaattgt ataaagataa tttatttgat 960gtaaaagcga
aagaaccata caatgtaaca attactagtg ataaatatat ccctaatact
1020gatttgaaac gtggacaagc tgatttgttt gtagcggaag gttctatcaa
agatttagtg 1080aaacataaga agcatggtaa ggcaattata ggaacgaaaa
aacatcatgt taatattaag 1140ttacggaaag atattaataa aatctatttt
atgacagatg ttgatttagg tggaccaacg 1200tttgtcttaa atgacaaaga
ctatcaagaa ataagaaagt atacaaaagc aaagcatatc 1260gtctctcaat
ttggattcga tttgaaacat aaaaaagatg ctttagcatt agaaaaagtg
1320aaaaataaag ttgataaatc tattaaaaca agaagtgaag cgataagctc
aatatcaagt 1380ttaaccggaa tattattatt tgtaacatca tttttaggta
ttacattctt gattgctgta 1440tgttgcatta tatacattaa gcaaatagat
gaaaccgaag atgagttaga gaattatagt 1500atattgagaa agcttggatt
tacacaaaaa gatatggcaa ggggactaaa gtttaaaatt 1560atgtttaatt
ttgggttacc tttagttatt gcactatcac atgcatattt tacatcatta
1620gcatatatga aattaatggg tacaacgaat caaataccgg ttttcatagt
aatgggatta 1680tacatttgta tgtatgctgt ttttgcagtg acggcttata
atcattccaa gcgaacaatt 1740agacattcca tataa
1755511755DNAStaphylococcus aureus 51atgacagagt catatccaat
tattaaggaa ggctcacaag tcggaagcta ctttctattt 60ttcatcataa ttgcattttt
gttatatgcc aatgtgttat ttattaaacg acgaagttat 120gagcttgcat
tatatcaaac attaggttta tctaaattca acattattta tatactaatg
180ctcgaacaat tactaatatt tataattacg gcaatattag gtattattat
tggtattttt 240ggttcaaaac tgttattaat gattgtcttt acattattag
gaattaaaga aaaggttcca 300attattttta gtttgagggc ggtatttgaa
acattaatgt taatcggtgt cgcttatttt 360ttaacctctg ctcaaaattt
tatattagtg ttcaaacaat ctatttcaca gatgtcaaag 420aataaccagg
ttaaagaaac aaatcataat aaaattacat ttgaagaggt tgttttaggc
480atcttaggta tagtattgat taccacagga tactatctat ctttgaacat
tgttcaatat 540tatgattcta tcggtatact tatgtttatt ttattgtcaa
ctgtgattgg ggcatactta 600ttttttaaaa gctctgtttc tctagttttt
aaaatggtga agaagtttag aaaaggtgtt 660ataagtgtaa atgatgtcat
gttctcatca tctattatgt atcgtattaa gaaaaatgct 720ttttcactta
cggtcatggc aatcatttca gcgattactg tttcagttct ttgctttgct
780gctataagta gagcgtcctt atcaagtgaa ataaaatata ctgcaccaca
cgacgttaca 840attaaagacc aacaaaaagc taatcaatta gcaagtgaat
taaacaatca aaaaattcct 900catttttata attataaaga agtaattcat
acgaaattgt ataaagataa tttatttgat 960gtaaaagcga aagaaccata
caatgtaaca attactagtg ataaatatat ccctaatact 1020gatttgaaac
gtggacaagc tgatttgttt gtagcggaag gttctatcaa agatttagtg
1080aaacataaga agcatggtaa ggcaattata ggaacgaaaa aacatcatgt
taatattaag 1140ttacggaaag atattaataa aatctatttt atgacagatg
ttgatttagg tggaccaacg 1200tttgtcttaa atgacaaaga ctatcaagaa
ataagaaagt atacaaaagc aaagcatatc 1260gtctctcaat ttggattcga
tttgaaacat aaaaaagatg ctttagcatt agaaaaagtg 1320aaaaataaag
ttgataaatc tattaaaaca agaagtgaag cgataagctc aatatcaagt
1380ttaaccggaa tattattatt tgtaacatca tttttaggta ttacattctt
gattgctgta 1440tgttgcatta tatacattaa gcaaatagat gaaaccgaag
atgagttaga gaattatagt 1500atattgagaa agcttggatt tacacaaaaa
gatatggcaa ggggactaaa gtttaaaatt 1560atgtttaatt ttgggttacc
tttagttatt gcactatcac atgcatattt tacatcatta 1620gcatatatga
aattaatggg tacaacgaat caaataccgg ttttcatagt aatgggatta
1680tacatttgta tgtatgctgt ttttgcagtg acggcttata atcattccaa
gcgaacaatt 1740agacattcca tataa 1755521890DNAStaphylococcus aureus
52atgaccttta acgagataat atttaaaaat ttccgtcaaa atttatcaca ttatgccatc
60tatctttttt cattaattac gagtgtagta ttgtatttta gctttgtagc attaaaatac
120gcgcataaac taaacatgac agagtcatat ccaattatta aggaaggctc
acaagtcgga 180agctactttc tatttttcat cataattgca tttttgttat
atgccaatgt gttatttatt 240aaacgacgaa gttatgagct tgcattatat
caaacattag gtttatctaa attcaacatt 300atttatatac taatgctcga
acaattacta atatttataa ttacggcaat attaggtatt 360attattggta
tttttggttc aaaactgtta ttaatgattg tctttacatt attaggaatt
420aaagaaaagg ttccaattat ttttagtttg agggcggtat ttgaaacatt
aatgttaatc 480ggtgtcgctt attttttaac ctctgctcaa aattttatat
tagtgttcaa acaatctatt 540tcacagatgt caaagaataa ccaggttaaa
gaaacaaatc ataataaaat tacatttgaa 600gaggttgttt taggcatctt
aggtatagta ttgattacca caggatacta tctatctttg 660aacattgttc
aatattatga ttctatcggt atacttatgt ttattttatt gtcaactgtg
720attggggcat acttattttt taaaagctct gtttctctag tttttaaaat
ggtgaagaag 780tttagaaaag gtgttataag tgtaaatgat gtcatgttct
catcatctat tatgtatcgt 840attaagaaaa atgctttttc acttacggtc
atggcaatca tttcagcgat tactgtttca 900gttctttgct ttgctgctat
aagtagagcg tccttatcaa gtgaaataaa atatactgca 960ccacacgacg
ttacaattaa agaccaacaa aaagctaatc aattagcaag tgaattaaac
1020aatcaaaaaa ttcctcattt ttataattat aaagaagtaa ttcatacgaa
attgtataaa 1080gataatttat ttgatgtaaa agcgaaagaa ccatacaatg
taacaattac tagtgataaa 1140tatatcccta atactgattt gaaacgtgga
caagctgatt tgtttgtagc ggaaggttct 1200atcaaagatt tagtgaaaca
taagaagcat ggtaaggcaa ttataggaac gaaaaaacat 1260catgttaata
ttaagttacg gaaagatatt aataaaatct attttatgac agatgttgat
1320ttaggtggac caacgtttgt cttaaatgac aaagactatc aagaaataag
aaagtataca 1380aaagcaaagc atatcgtctc tcaatttgga ttcgatttga
aacataaaaa agatgcttta 1440gcattagaaa aagtgaaaaa taaagttgat
aaatctatta aaacaagaag tgaagcgata 1500agctcaatat caagtttaac
cggaatatta ttatttgtaa catcattttt aggtattaca 1560ttcttgattg
ctgtatgttg cattatatac attaagcaaa tagatgaaac cgaagatgag
1620ttagagaatt atagtatatt gagaaagctt ggatttacac aaaaagatat
ggcaagggga 1680ctaaagttta aaattatgtt taattttggg ttacctttag
ttattgcact atcacatgca 1740tattttacat cattagcata tatgaaatta
atgggtacaa cgaatcaaat accggttttc 1800atagtaatgg gattatacat
ttgtatgtat gctgtttttg cagtgacggc ttataatcat 1860tccaagcgaa
caattagaca ttccatataa 1890531890DNAStaphylococcus aureus
53atgaccttta acgagataat atttaaaaat ttccgtcaaa atttatcaca ttatgccatc
60tatctttttt cattaattac gagtgtagta ttgtatttta gctttgtagc attaaaatac
120gcgcataaac taaacatgac agagtcatat ccaattatta aggaaggctc
acaagtcgga 180agctactttc tatttttcat cataattgca tttttgttat
atgccaatgt gttatttatt 240aaacgacgaa gttatgagct tgcattatat
caaacattag gtttatctaa attcaacatt 300atttatatac taatgctcga
acaattacta atatttataa ttacggcaat attaggtatt 360attattggta
tttttggttc aaaactgtta ttaatgattg tctttacatt attaggaatt
420aaagaaaagg ttccaattat ttttagtttg agggcggtat ttgaaacatt
aatgttaatc 480ggtgtcgctt attttttaac ctctgctcaa aattttatat
tagtgttcaa acaatctatt 540tcacagatgt caaagaataa ccaggttaaa
gaaacaaatc ataataaaat tacatttgaa 600gaggttgttt taggcatctt
aggtatagta ttgattacca caggatacta tctatctttg 660aacattgttc
aatattatga ttctatcggt atacttatgt ttattttatt gtcaactgtg
720attggggcat acttattttt taaaagctct gtttctctag tttttaaaat
ggtgaagaag 780tttagaaaag gtgttataag tgtaaatgat gtcatgttct
catcatctat tatgtatcgt 840attaagaaaa atgctttttc acttacggtc
atggcaatca tttcagcgat tactgtttca 900gttctttgct ttgctgctat
aagtagagcg tccttatcaa gtgaaataaa atatactgca 960ccacacgacg
ttacaattaa agaccaacaa aaagctaatc aattagcaag tgaattaaac
1020aatcaaaaaa ttcctcattt ttataattat aaagaagtaa ttcatacgaa
attgtataaa 1080gataatttat ttgatgtaaa agcgaaagaa ccatacaatg
taacaattac tagtgataaa 1140tatatcccta atactgattt gaaacgtgga
caagctgatt tgtttgtagc ggaaggttct 1200atcaaagatt tagtgaaaca
taagaagcat ggtaaggcaa ttataggaac gaaaaaacat 1260catgttaata
ttaagttacg gaaagatatt aataaaatct attttatgac agatgttgat
1320ttaggtggac caacgtttgt cttaaatgac aaagactatc aagaaataag
aaagtataca 1380aaagcaaagc atatcgtctc tcaatttgga ttcgatttga
aacataaaaa agatgcttta 1440gcattagaaa aagtgaaaaa taaagttgat
aaatctatta aaacaagaag tgaagcgata 1500agctcaatat caagtttaac
cggaatatta ttatttgtaa catcattttt aggtattaca 1560ttcttgattg
ctgtatgttg cattatatac attaagcaaa tagatgaaac cgaagatgag
1620ttagagaatt atagtatatt gagaaagctt ggatttacac aaaaagatat
ggcaagggga 1680ctaaagttta aaattatgtt taattttggg ttacctttag
ttattgcact atcacatgca 1740tattttacat cattagcata tatgaaatta
atgggtacaa cgaatcaaat accggttttc 1800atagtaatgg gattatacat
ttgtatgtat gctgtttttg cagtgacggc ttataatcat 1860tccaagcgaa
caattagaca ttccatataa 1890541890DNAStaphylococcus aureus
54atgaccttta acgagataat atttaaaaat ttccgtcaaa atttatcaca ttatgccatc
60tatctttttt cattaattac gagtgtagta ttgtatttta gctttgtagc attaaaatac
120gcgcataaac taaacatgac agagtcatat ccaattatta aggaaggctc
acaagtcgga 180agctactttc tatttttcat cataattgca tttttgttat
atgccaatgt gttatttatt 240aaacgacgaa gttatgagct tgcattatat
caaacattag gtttatctaa attcaacatt 300atttatatac taatgctcga
acaattacta atatttataa ttacggcaat attaggtatt 360attattggta
tttttggttc aaaactgtta ttaatgattg tctttacatt attaggaatt
420aaagaaaagg ttccaattat ttttagtttg agggcggtat ttgaaacatt
aatgttaatc 480ggtgtcgctt attttttaac ctctgctcaa aattttatat
tagtgttcaa acaatctatt 540tcacagatgt caaagaataa ccaggttaaa
gaaacaaatc ataataaaat tacatttgaa 600gaggttgttt taggcatctt
aggtatagta ttgattacca caggatacta tctatctttg 660aacattgttc
aatattatga ttctatcggt atacttatgt ttattttatt gtcaactgtg
720attggggcat acttattttt taaaagctct gtttctctag tttttaaaat
ggtgaagaag 780tttagaaaag gtgttataag tgtaaatgat gtcatgttct
catcatctat tatgtatcgt 840attaagaaaa atgctttttc acttacggtc
atggcaatca tttcagcgat tactgtttca 900gttctttgct ttgctgctat
aagtagagcg tccttatcaa gtgaaataaa atatactgca 960ccacacgacg
ttacaattaa agaccaacaa aaagctaatc aattagcaag tgaattaaac
1020aatcaaaaaa ttcctcattt ttataattat aaagaagtaa ttcatacgaa
attgtataaa 1080gataatttat ttgatgtaaa agcgaaagaa ccatacaatg
taacaattac tagtgataaa 1140tatatcccta atactgattt gaaacgtgga
caagctgatt tgtttgtagc ggaaggttct 1200atcaaagatt tagtgaaaca
taagaagcat ggtaaagcag ttataggaac gaaaaaacat 1260catgttaata
ttaagttgcg gaaagatatt aataaaatct attttatgac agatgttgat
1320ttaggtggac caacgtttgt cttaaatgac aaagactatc aagaaataag
aaagtataca 1380aaagcaaagc atatcgtctc tcaatttgga ttcgatttga
aacataaaaa agatgcttta 1440gcattagaaa aagtgaaaaa taaagttgat
aaatctatta aaacaagaag tgaagcgata 1500agctcaatat caagtttaac
cggaatatta ttatttgtaa catcattttt aggtattaca 1560ttcttgattg
ctgtatgttg cattatatac ataaagcaaa tagatgaaac cgaagatgag
1620ttagagaatt atagtatttt gagaaagctt ggatttacac aaaaagatat
ggcaagggga 1680ctaaagttta aaattatgtt taattttggg ttacctttag
ttattgcact atcacatgca 1740tattttacat cattagcata tatgaaatta
atgggtacaa cgaatcaaat accggttttc 1800atagtaatgg gattatacat
ttgtatgtat gctgtttttg cagtgacggc ttataatcat 1860tccaagcgaa
caattagaca ttccatataa 1890551890DNAStaphylococcus aureus
55atgaccttta acgagataat atttaaaaat ttccgtcaaa atttatcaca ttatgccatc
60tatctttttt cattaattac gagtgtagta ttgtatttta gctttgtagc attaaaatac
120gcgcataaac taaacatgac agagtcatat ccaattatta aggaaggctc
acaagtcgga 180agctactttc tatttttcat cataattgca tttttgttat
atgccaatgt gttatttatt 240aaacgacgaa gttatgagct tgcattatat
caaacattag gtttatctaa attcaacatt 300atttatatac taatgctcga
acaattacta atatttataa ttacggcaat attaggtatt 360attattggta
tttttggttc aaaactgtta ttaatgattg tctttacatt attaggaatt
420aaagaaaagg ttccaattat ttttagtttg agggcggtat ttgaaacatt
aatgttaatc 480ggtgtcgctt attttttaac ctctgctcaa aattttatat
tagtgttcaa acaatctatt 540tcacagatgt caaagaataa ccaggttaaa
gaaacaaatc ataataaaat tacatttgaa 600gaggttgttt taggcatctt
aggtatagta ttgattacca caggatacta tctatctttg 660aacattgttc
aatattatga ttctatcggt atacttatgt ttattttatt gtcaactgtg
720attggggcat acttattttt taaaagctct gtttctctag tttttaaaat
ggtgaagaag 780tttagaaaag gtgttataag tgtaaatgat gtcatgttct
catcatctat tatgtatcgt 840attaagaaaa atgctttttc acttacggtc
atggcaatca tttcagcgat tactgtttca 900gttctttgct ttgctgctat
aagtagagcg tccttatcaa gtgaaataaa atatactgca 960ccacacgacg
ttacaattaa agaccaacaa aaagctaatc aattagcaag tgaattaaac
1020aatcaaaaaa ttcctcattt ttataattat aaagaagtaa ttcatacgaa
attgtataaa 1080gataatttat ttgatgtaaa agcgaaagaa ccatacaatg
taacaattac tagtgataaa 1140tatatcccta atactgattt gaaacgtgga
caagctgatt tgtttgtagc ggaaggttct 1200atcaaagatt tagtgaaaca
taagaagcat ggtaaagcag ttataggaac gaaaaaacat 1260catgttaata
ttaagttgcg gaaagatatt aataaaatct attttatgac agatgttgat
1320ttaggtggac caacgtttgt cttaaatgac aaagactatc aagaaataag
aaagtataca 1380aaagcaaagc atatcgtctc tcaatttgga ttcgatttga
aacataaaaa agatgcttta 1440gcattagaaa aagtgaaaaa taaagttgat
aaatctatta aaacaagaag tgaagcgata 1500agctcaatat caagtttaac
cggaatatta ttatttgtaa catcattttt aggtattaca 1560ttcttgattg
ctgtatgttg cattatatac ataaagcaaa tagatgaaac cgaagatgag
1620ttagagaatt atagtatttt gagaaagctt ggatttacac aaaaagatat
ggcaagggga 1680ctaaagttta aaattatgtt taattttggg ttacctttag
ttattgcact atcacatgca 1740tattttacat cattagcata tatgaaatta
atgggtacaa cgaatcaaat accggttttc 1800atagtaatgg gattatacat
ttgtatgtat gctgtttttg cagtgacggc ttataatcat 1860tccaagcgaa
caattagaca ttccatataa 1890561890DNAStaphylococcus aureus
56atgaccttta acgagataat atttaaaaat ttccgtcaaa atttatcaca ttatgccatc
60tatctttttt cgttaattac gagtgtagta ttgtatttta gctttgtagc attaaaatac
120gctcataaac taaacatgac agagtcatat ccaattataa aggaaggctc
acaagtcgga 180agctactttc tatttttcat cataattgca tttttgttat
atgccaatgt gttatttatt 240aaacgacgaa gttatgagct tgcattatat
caaacattag gtttatctaa attcaacatt 300atttatatac taatgctcga
acaattacta atatttataa ttacggcaat attaggtatt 360attattggta
tttttggttc gaaactgtta ttaatgattg tctttacatt attaggaatt
420aaagaaaagg ttccaattat ttttagtttg agggcggtat ttgaaacatt
aatgttaatc 480ggtgtcgctt attttttaac atctgctcaa aattttatat
tagtgttcaa acaatctatt 540tcacagatgt caaagaataa ccaggttaaa
gaaacaaatc ataataaaat tacatttgaa 600gaggttgttt taggcatctt
aggtatagta ttgattacca caggatacta tctatctttg 660aacattgttc
aatattatga ttctatcggt acacttatgt ttattttatt gtcaactgtg
720attggggcat acttattttt taaaagctct gtttctctag tttttaaaat
ggtgaagaag 780tttagaaaag gtgttataag tgtaaatgat gtcatgttct
catcatctat tatgtatcgt 840attaagaaaa atgctttttc acttacggtc
atggcaatca tttcagcgat tactgtttca 900gttctttgct ttgctgctat
aagtagagcg tccttatcaa gtgaaataaa atatactgca 960ccacacgacg
ttacaattaa agaccaacaa aaagctaatc aattagcaag tgaattaaac
1020aatcaaaaaa ttcctcattt ttataattat aaagaagtaa ttcatacgaa
attgtataaa 1080gataatttat ttgatgtaaa agcgaaagaa ccatacaatg
taacaattac tagtgataaa 1140tacatcccta atactgattt gaaacgtggg
caagctgatt tatttgtagc ggaaggttct 1200atcaaagatt tagtgaaaca
taagaagcat ggtaaggcaa ttataggaac gaaaaaacat 1260catgttaata
ttaagttacg taaagatatt aataaaatct attttatgac agatgttgat
1320ttaggtggac caacgtttgt cttaaatgac aaagactatc aagaaataag
aaagtataca 1380aaggcaaagc atatcgtctc tcaatttgga ttcgatttga
aacataaaaa agatgcttta 1440gcattagaaa aagcgaaaaa taaagttgat
aaatctattg aaacaagaag tgaagcgata 1500agctcaatat caagtttaac
cggaatatta ttatttgtaa catcattttt aggtattaca 1560ttcttgattg
ctgtatgttg cattatatac ataaagcaaa tagatgaaac cgaagatgag
1620ttagagaatt atagtatttt gagaaagctt ggatttacac aaaaagatat
ggcaagggga 1680ctaaagttta aaattatgtt taattttggg ttacctttag
ttattgcact atcacatgca 1740tattttacat cattagcata tatgaaatta
atgggtacaa cgaatcaaat accggttttc 1800atagtaatgg gattatacat
ttgtatgtat gctgtttttg cagtgacggc ttataatcat 1860tccaagcgaa
caattagaca ttccatataa 1890571890DNAStaphylococcus aureus
57atgaccttta acgagataat atttaaaaat ttccgtcaaa atttatcaca ttatgccatc
60tatctttttt cgttaattac gagtgtagta ttgtatttta gctttgtagc attaaaatac
120gctcataaac taaacatgac agagtcatat ccaattataa aggaaggctc
acaagtcgga 180agctactttc tatttttcat cataattgca tttttgttat
atgccaatgt gttatttatt 240aaacgacgaa gttatgagct tgcattatat
caaacattag gtttatctaa attcaacatt 300atttatatac taatgctcga
acaattacta atatttataa ttacggcaat attaggtatt 360attattggta
tttttggttc gaaactgtta ttaatgattg tctttacatt attaggaatt
420aaagaaaagg ttccaattat ttttagtttg agggcggtat ttgaaacatt
aatgttaatc 480ggtgtcgctt attttttaac atctgctcaa aattttatat
tagtgttcaa acaatctatt 540tcacagatgt caaagaataa ccaggttaaa
gaaacaaatc ataataaaat tacatttgaa 600gaggttgttt taggcatctt
aggtatagta ttgattacca caggatacta tctatctttg 660aacattgttc
aatattatga ttctatcggt acacttatgt ttattttatt gtcaactgtg
720attggggcat acttattttt taaaagctct gtttctctag tttttaaaat
ggtgaagaag 780tttagaaaag gtgttataag tgtaaatgat gtcatgttct
catcatctat tatgtatcgt 840attaagaaaa atgctttttc acttacggtc
atggcaatca tttcagcgat tactgtttca 900gttctttgct ttgctgctat
aagtagagcg tccttatcaa gtgaaataaa atatactgca 960ccacacgacg
ttacaattaa agaccaacaa aaagctaatc aattagcaag tgaattaaac
1020aatcaaaaaa ttcctcattt ttataattat aaagaagtaa ttcatacgaa
attgtataaa 1080gataatttat ttgatgtaaa agcgaaagaa ccatacaatg
taacaattac tagtgataaa 1140tacatcccta atactgattt gaaacgtggg
caagctgatt tatttgtagc ggaaggttct 1200atcaaagatt tagtgaaaca
taagaagcat ggtaaggcaa ttataggaac gaaaaaacat 1260catgttaata
ttaagttacg taaagatatt aataaaatct attttatgac agatgttgat
1320ttaggtggac caacgtttgt cttaaatgac
aaagactatc aagaaataag aaagtataca 1380aaggcaaagc atatcgtctc
tcaatttgga ttcgatttga aacataaaaa agatgcttta 1440gcattagaaa
aagcgaaaaa taaagttgat aaatctattg aaacaagaag tgaagcgata
1500agctcaatat caagtttaac cggaatatta ttatttgtaa catcattttt
aggtattaca 1560ttcttgattg ctgtatgttg cattatatac ataaagcaaa
tagatgaaac cgaagatgag 1620ttagagaatt atagtatttt gagaaagctt
ggatttacac aaaaagatat ggcaagggga 1680ctaaagttta aaattatgtt
taattttggg ttacctttag ttattgcact atcacatgca 1740tattttacat
cattagcata tatgaaatta atgggtacaa cgaatcaaat accggttttc
1800atagtaatgg gattatacat ttgtatgtat gctgtttttg cagtgacggc
ttataatcat 1860tccaagcgaa caattagaca ttccatataa
1890581800DNAStaphylococcus aureus 58ttgtatttta gctttgtagc
attaaaatac gctcataaac taaacatgac agagtcatat 60ccaattataa aggaaggctc
acaagtcgga agctactttc tatttttcat cataattgca 120tttttgttat
atgccaatgt gttatttatt aaacgacgaa gttatgagct tgcattatat
180caaacattag gtttatctaa attcaacatt atttatatac taatgctcga
acaattacta 240atatttataa ttacggcaat attaggtatt attattggta
tttttggttc gaaactgtta 300ttaatgattg tctttacatt attaggaatt
aaagaaaagg ttccaattat ttttagtttg 360agggcggtat ttgaaacatt
aatgttaatc ggtgtcgctt attttttaac atctgctcaa 420aattttatat
tagtgttcaa acaatctatt tcacagatgt caaagaataa ccaggttaaa
480gaaacaaatc ataataaaat tacatttgaa gaggttgttt taggcatctt
aggtatagta 540ttgattacca caggatacta tctatctttg aacattgttc
aatattatga ttctatcggt 600acacttatgt ttattttatt gtcaactgtg
attggggcat acttattttt taaaagctct 660gtttctctag tttttaaaat
ggtgaagaag tttagaaaag gtgttataag tgtaaatgat 720gtcatgttct
catcatctat tatgtatcgt attaagaaaa atgctttttc acttacggtc
780atggcaatca tttcagcgat tactgtttca gttctttgct ttgctgctat
aagtagagcg 840tccttatcaa gtgaaataaa atatactgca ccacacgacg
ttacaattaa agaccaacaa 900aaagctaatc aattagcaag tgaattaaac
aatcaaaaaa ttcctcattt ttataattat 960aaagaagtaa ttcatacgaa
attgtataaa gataatttat ttgatgtaaa agcgaaagaa 1020ccatacaatg
taacaattac tagtgataaa tacatcccta atactgattt gaaacgtggg
1080caagctgatt tatttgtagc ggaaggttct atcaaagatt tagtgaaaca
taagaagcat 1140ggtaaggcaa ttataggaac gaaaaaacat catgttaata
ttaagttacg taaagatatt 1200aataaaatct attttatgac agatgttgat
ttaggtggac caacgtttgt cttaaatgac 1260aaagactatc aagaaataag
aaagtataca aaggcaaagc atatcgtctc tcaatttgga 1320ttcgatttga
aacataaaaa agatgcttta gcattagaaa aagcgaaaaa taaagttgat
1380aaatctattg aaacaagaag tgaagcgata agctcaatat caagtttaac
cggaatatta 1440ttatttgtaa catcattttt aggtattaca ttcttgattg
ctgtatgttg cattatatac 1500ataaagcaaa tagatgaaac cgaagatgag
ttagagaatt atagtatttt gagaaagctt 1560ggatttacac aaaaagatat
ggcaagggga ctaaagttta aaattatgtt taattttggg 1620ttacctttag
ttattgcact atcacatgca tattttacat cattagcata tatgaaatta
1680atgggtacaa cgaatcaaat accggttttc atagtaatgg gattatacat
ttgtatgtat 1740gctgtttttg cagtgacggc ttataatcat tccaagcgaa
caattagaca ttccatataa 1800591755DNAStaphylococcus aureus
59atgacagagt catatccaat tataaaggaa ggctcacaag tcggaagcta ctttctattt
60ttcatcataa ttgcattttt gttatatgcc aatgtgttat ttattaaacg acgaagttat
120gagcttgcat tatatcaaac attaggttta tctaaattca acattattta
tatactaatg 180ctcgaacaat tactaatatt tataattacg gcaatattag
gtattattat tggtattttt 240ggttcgaaac tgttattaat gattgtcttt
acattattag gaattaaaga aaaggttcca 300attattttta gtttgagggc
ggtatttgaa acattaatgt taatcggtgt cgcttatttt 360ttaacatctg
ctcaaaattt tatattagtg ttcaaacaat ctatttcaca gatgtcaaag
420aataaccagg ttaaagaaac aaatcataat aaaattacat ttgaagaggt
tgttttaggc 480atcttaggta tagtattgat taccacagga tactatctat
ctttgaacat tgttcaatat 540tatgattcta tcggtacact tatgtttatt
ttattgtcaa ctgtgattgg ggcatactta 600ttttttaaaa gctctgtttc
tctagttttt aaaatggtga agaagtttag aaaaggtgtt 660ataagtgtaa
atgatgtcat gttctcatca tctattatgt atcgtattaa gaaaaatgct
720ttttcactta cggtcatggc aatcatttca gcgattactg tttcagttct
ttgctttgct 780gctataagta gagcgtcctt atcaagtgaa ataaaatata
ctgcaccaca cgacgttaca 840attaaagacc aacaaaaagc taatcaatta
gcaagtgaat taaacaatca aaaaattcct 900catttttata attataaaga
agtaattcat acgaaattgt ataaagataa tttatttgat 960gtaaaagcga
aagaaccata caatgtaaca attactagtg ataaatacat ccctaatact
1020gatttgaaac gtgggcaagc tgatttattt gtagcggaag gttctatcaa
agatttagtg 1080aaacataaga agcatggtaa ggcaattata ggaacgaaaa
aacatcatgt taatattaag 1140ttacgtaaag atattaataa aatctatttt
atgacagatg ttgatttagg tggaccaacg 1200tttgtcttaa atgacaaaga
ctatcaagaa ataagaaagt atacaaaggc aaagcatatc 1260gtctctcaat
ttggattcga tttgaaacat aaaaaagatg ctttagcatt agaaaaagcg
1320aaaaataaag ttgataaatc tattgaaaca agaagtgaag cgataagctc
aatatcaagt 1380ttaaccggaa tattattatt tgtaacatca tttttaggta
ttacattctt gattgctgta 1440tgttgcatta tatacataaa gcaaatagat
gaaaccgaag atgagttaga gaattatagt 1500attttgagaa agcttggatt
tacacaaaaa gatatggcaa ggggactaaa gtttaaaatt 1560atgtttaatt
ttgggttacc tttagttatt gcactatcac atgcatattt tacatcatta
1620gcatatatga aattaatggg tacaacgaat caaataccgg ttttcatagt
aatgggatta 1680tacatttgta tgtatgctgt ttttgcagtg acggcttata
atcattccaa gcgaacaatt 1740agacattcca tataa
1755601890DNAStaphylococcus aureus 60atgaccttta acgagataat
atttaaaaat ttccgtcaaa atttatcaca ttatgccatc 60tatctttttt cattaattac
gagtgtagta ttgtatttta gctttgtagc attaaaatac 120gctcataaac
taaacatgac agagtcatat ccaattataa aggaaggctc acaagtcgga
180agctactttc tatttttcat cataattgca tttttgttat atgccaatgt
gttatttatt 240aaacgacgaa gttatgagct tgcattatat caaacattag
gtttatctaa attcaacatt 300atttatatac taatgctcga acaattacta
atatttataa ttacggcaat attaggtatt 360attattggta tttttggttc
gaaactgtta ttaatgattg tctttacatt attaggaatt 420aaagaaaagg
ttccaattat ttttagtttg agggcggtat ttgaaacatt aatgttaatc
480ggtgtcgctt attttttaac atctgctcaa aattttatat tagtgttcaa
acaatctatt 540tcacagatgt caaagaataa ccaggttaaa gaaacaaatc
ataataaaat tacatttgaa 600gaggttgttt taggcatctt aggtatagta
ttgattacca caggatacta tctatctttg 660aacattgttc aatattatga
ttctatcggt acacttatgt ttattttatt gtcaactgtg 720attggggcat
acttattttt taaaagctct gtttctctag tttttaaaat ggtgaagaag
780tttagaaaag gtgttataag tgtaaatgat gtcatgttct catcatctat
tatgtatcgt 840attaagaaaa atgctttttc acttacggtc atggcaatca
tttcagcgat tactgtttca 900gttctttgct ttgctgctat aagtagagcg
tccttatcaa gtgaaataaa atatactgca 960ccacacgacg ttacaattaa
agaccaacaa aaagctaatc aattagcaag tgaattaaac 1020aatcaaaaaa
ttcctcattt ttataattat aaagaagtaa ttcatacgaa attgtataaa
1080gataatttat ttgatgtaaa atcgaaacaa ccatacaatg taacaattac
tagtgataaa 1140tacatcccta gtactgattt gaaacgtggg caagctgatt
tgtttgtagc ggaaggttct 1200atcaaagatt tagtgaaaca taagaagcat
ggtaaagcag ttataggaac gaaaaaacat 1260catgttaata ttaagttacg
taaagatatt aataaaatct attttatgac agatgttgat 1320ttaggtggac
caacgtttgt cttaaatgac aaagactatc aagaaataag aaagtataca
1380aaggcaaagc atatcgtctc tcaatttgga ttcgatttga aacataaaaa
agatgcttta 1440gcattagaaa aagcgaaaaa taaagttgat aaatctattg
agacaagaag tgaagcgata 1500agctcaatat caagtttaac cggaatatta
ttatttgtaa catcattttt aggtattaca 1560ttcttgattg ctgtatgttg
cattatatac attaagcaaa tagatgaaac cgaagatgag 1620ttagagaatt
atagtatatt gagaaagctt ggatttacac aaaaagatat ggcaagggga
1680ctaaagttta aaattatgtt taattttggg ttacctttag ttattgcact
atcacatgca 1740tattttacat cattagcata tatgaaatta atgggtacaa
cgaatcaaat accggttttc 1800atagtaatgg gattatacat ttgtatgtat
gctgtttttg cagtgacggc ttataatcat 1860tccaagcgaa caattagaca
ttccatataa 1890611755DNAStaphylococcus
aureusmisc_feature(24)..(24)n is a, c, g, or
tmisc_feature(366)..(366)n is a, c, g, or
tmisc_feature(503)..(503)n is a, c, g, or
tmisc_feature(557)..(557)n is a, c, g, or
tmisc_feature(967)..(967)n is a, c, g, or
tmisc_feature(973)..(973)n is a, c, g, or
tmisc_feature(1008)..(1008)n is a, c, g, or
tmisc_feature(1016)..(1016)n is a, c, g, or
tmisc_feature(1035)..(1035)n is a, c, g, or
tmisc_feature(1047)..(1047)n is a, c, g, or
tmisc_feature(1101)..(1101)n is a, c, g, or
tmisc_feature(1105)..(1105)n is a, c, g, or
tmisc_feature(1143)..(1143)n is a, c, g, or
tmisc_feature(1146)..(1146)n is a, c, g, or
tmisc_feature(1248)..(1248)n is a, c, g, or
tmisc_feature(1319)..(1319)n is a, c, g, or
tmisc_feature(1345)..(1345)n is a, c, g, or
tmisc_feature(1347)..(1347)n is a, c, g, or
tmisc_feature(1458)..(1458)n is a, c, g, or
tmisc_feature(1503)..(1503)n is a, c, g, or
tmisc_feature(1592)..(1592)n is a, c, g, or t 61atgacagagt
catatccaat tatnaaggaa ggctcacaag tcggaagcta ctttctattt 60ttcatcataa
ttgcattttt gttatatgcc aatgtgttat ttattaaacg acgaagttat
120gagcttgcat tatatcaaac attaggttta tctaaattca acattattta
tatactaatg 180ctcgaacaat tactaatatt tataattacg gcaatattag
gtattattat tggtattttt 240ggttcgaaac tgttattaat gattgtcttt
acattattag gaattaaaga aaaggttcca 300attattttta gtttgagggc
ggtatttgaa acattaatgt taatcggtgt cgcttatttt 360ttaacntctg
ctcaaaattt tatattagtg ttcaaacaat ctatttcaca gatgtcaaag
420aataaccagg ttaaagaaac aaatcataat aaaattacat ttgaagaggt
tgttttaggc 480atcttaggta tagtattgat tancacagga tactatctat
ctttgaacat tgttcaatat 540tatgattcta tcggtanact tatgtttatt
ttattgtcaa ctgtgattgg ggcatactta 600ttttttaaaa gctctgtttc
tctagttttt aaaatggtga agaagtttag aaaaggtgtt 660ataagtgtaa
atgatgtcat gttctcatca tctattatgt atcgtattaa gaaaaatgct
720ttttcactta cggtcatggc aatcatttca gcgattactg tttcagttct
ttgctttgct 780gctataagta gagcgtcctt atcaagtgaa ataaaatata
ctgcaccaca cgacgttaca 840attaaagacc aacaaaaagc taatcaatta
gcaagtgaat taaacaatca aaaaattcct 900catttttata attataaaga
agtaattcat acgaaattgt ataaagataa tttatttgat 960gtaaaancga
aanaaccata caatgtaaca attactagtg ataaatanat ccctantact
1020gatttgaaac gtggncaagc tgatttnttt gtagcggaag gttctatcaa
agatttagtg 1080aaacataaga agcatggtaa ngcanttata ggaacgaaaa
aacatcatgt taatattaag 1140ttncgnaaag atattaataa aatctatttt
atgacagatg ttgatttagg tggaccaacg 1200tttgtcttaa atgacaaaga
ctatcaagaa ataagaaagt atacaaangc aaagcatatc 1260gtctctcaat
ttggattcga tttgaaacat aaaaaagatg ctttagcatt agaaaaagng
1320aaaaataaag ttgataaatc tattnanaca agaagtgaag cgataagctc
aatatcaagt 1380ttaaccggaa tattattatt tgtaacatca tttttaggta
ttacattctt gattgctgta 1440tgttgcatta tatacatnaa gcaaatagat
gaaaccgaag atgagttaga gaattatagt 1500atnttgagaa agcttggatt
tacacaaaaa gatatggcaa ggggactaaa gtttaaaatt 1560atgtttaatt
ttgggttacc tttagttatt gnactatcac atgcatattt tacatcatta
1620gcatatatga aattaatggg tacaacgaat caaataccgg ttttcatagt
aatgggatta 1680tacatttgta tgtatgctgt ttttgcagtg acggcttata
atcattccaa gcgaacaatt 1740agacattcca tataa
175562629PRTStaphylococcus aureus 62Met Thr Phe Asn Glu Ile Ile Phe
Lys Asn Phe Arg Gln Asn Leu Ser1 5 10 15His Tyr Ala Ile Tyr Leu Phe
Ser Leu Ile Thr Ser Val Val Leu Tyr 20 25 30Phe Ser Phe Val Ala Leu
Lys Tyr Ala His Lys Leu Asn Met Thr Glu 35 40 45Ser Tyr Pro Ile Ile
Lys Glu Gly Ser Gln Val Gly Ser Tyr Phe Leu 50 55 60Phe Phe Ile Ile
Ile Ala Phe Leu Leu Tyr Ala Asn Val Leu Phe Ile65 70 75 80Lys Arg
Arg Ser Tyr Glu Leu Ala Leu Tyr Gln Thr Leu Gly Leu Ser 85 90 95Lys
Phe Asn Ile Ile Tyr Ile Leu Met Leu Glu Gln Leu Leu Ile Phe 100 105
110Ile Ile Thr Ala Ile Leu Gly Ile Ile Ile Gly Ile Phe Gly Ser Lys
115 120 125Leu Leu Leu Met Ile Val Phe Thr Leu Leu Gly Ile Lys Glu
Lys Val 130 135 140Pro Ile Ile Phe Ser Leu Arg Ala Val Phe Glu Thr
Leu Met Leu Ile145 150 155 160Gly Val Ala Tyr Phe Leu Thr Ser Ala
Gln Asn Phe Ile Leu Val Phe 165 170 175Lys Gln Ser Ile Ser Gln Met
Ser Lys Asn Asn Gln Val Lys Glu Thr 180 185 190Asn His Asn Lys Ile
Thr Phe Glu Glu Val Val Leu Gly Ile Leu Gly 195 200 205Ile Val Leu
Ile Thr Thr Gly Tyr Tyr Leu Ser Leu Asn Ile Val Gln 210 215 220Tyr
Tyr Asp Ser Ile Gly Thr Leu Met Phe Ile Leu Leu Ser Thr Val225 230
235 240Ile Gly Ala Tyr Leu Phe Phe Lys Ser Ser Val Ser Leu Val Phe
Lys 245 250 255Met Val Lys Lys Phe Arg Lys Gly Val Ile Ser Val Asn
Asp Val Met 260 265 270Phe Ser Ser Ser Ile Met Tyr Arg Ile Lys Lys
Asn Ala Phe Ser Leu 275 280 285Thr Val Met Ala Ile Ile Ser Ala Ile
Thr Val Ser Val Leu Cys Phe 290 295 300Ala Ala Ile Ser Arg Ala Ser
Leu Ser Ser Glu Ile Lys Tyr Thr Ala305 310 315 320Pro His Asp Val
Thr Ile Lys Asp Gln Gln Lys Ala Asn Gln Leu Ala 325 330 335Ser Glu
Leu Asn Asn Gln Lys Ile Pro His Phe Tyr Asn Tyr Lys Glu 340 345
350Val Ile His Thr Lys Leu Tyr Lys Asp Asn Leu Phe Asp Val Lys Ala
355 360 365Lys Glu Pro Tyr Asn Val Thr Ile Thr Ser Asp Lys Tyr Ile
Pro Asn 370 375 380Thr Asp Leu Lys Arg Gly Gln Ala Asp Leu Phe Val
Ala Glu Gly Ser385 390 395 400Ile Lys Asp Leu Val Lys His Lys Lys
His Gly Lys Ala Ile Ile Gly 405 410 415Thr Lys Lys His His Val Asn
Ile Lys Leu Arg Lys Asp Ile Asn Lys 420 425 430Ile Tyr Phe Met Thr
Asp Val Asp Leu Gly Gly Pro Thr Phe Val Leu 435 440 445Asn Asp Lys
Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys Ala Lys His 450 455 460Ile
Val Ser Gln Phe Gly Phe Asp Leu Lys His Lys Lys Asp Ala Leu465 470
475 480Ala Leu Glu Lys Ala Lys Asn Lys Val Asp Lys Ser Ile Glu Thr
Arg 485 490 495Ser Glu Ala Ile Ser Ser Ile Ser Ser Leu Thr Gly Ile
Leu Leu Phe 500 505 510Val Thr Ser Phe Leu Gly Ile Thr Phe Leu Ile
Ala Val Cys Cys Ile 515 520 525Ile Tyr Ile Lys Gln Ile Asp Glu Thr
Glu Asp Glu Leu Glu Asn Tyr 530 535 540Ser Ile Leu Arg Lys Leu Gly
Phe Thr Gln Lys Asp Met Ala Arg Gly545 550 555 560Leu Lys Phe Lys
Ile Met Phe Asn Phe Gly Leu Pro Leu Val Ile Ala 565 570 575Leu Ser
His Ala Tyr Phe Thr Ser Leu Ala Tyr Met Lys Leu Met Gly 580 585
590Thr Thr Asn Gln Ile Pro Val Phe Ile Val Met Gly Leu Tyr Ile Cys
595 600 605Met Tyr Ala Val Phe Ala Val Thr Ala Tyr Asn His Ser Lys
Arg Thr 610 615 620Ile Arg His Ser Ile62563629PRTStaphylococcus
aureus 63Met Thr Phe Asn Glu Ile Ile Phe Lys Asn Phe Arg Gln Asn
Leu Ser1 5 10 15His Tyr Ala Ile Tyr Leu Phe Ser Leu Ile Thr Ser Val
Val Leu Tyr 20 25 30Phe Ser Phe Val Ala Leu Lys Tyr Ala His Lys Leu
Asn Met Thr Glu 35 40 45Ser Tyr Pro Ile Ile Lys Glu Gly Ser Gln Val
Gly Ser Tyr Phe Leu 50 55 60Phe Phe Ile Ile Ile Ala Phe Leu Leu Tyr
Ala Asn Val Leu Phe Ile65 70 75 80Lys Arg Arg Ser Tyr Glu Leu Ala
Leu Tyr Gln Thr Leu Gly Leu Ser 85 90 95Lys Phe Asn Ile Ile Tyr Ile
Leu Met Leu Glu Gln Leu Leu Ile Phe 100 105 110Ile Ile Thr Ala Ile
Leu Gly Ile Ile Ile Gly Ile Phe Gly Ser Lys 115 120 125Leu Leu Leu
Met Ile Val Phe Thr Leu Leu Gly Ile Lys Glu Lys Val 130 135 140Pro
Ile Ile Phe Ser Leu Arg Ala Val Phe Glu Thr Leu Met Leu Ile145 150
155 160Gly Val Ala Tyr Phe Leu Thr Ser Ala Gln Asn Phe Ile Leu Val
Phe 165 170 175Lys Gln Ser Ile Ser Gln Met Ser Lys Asn Asn Gln Val
Lys Glu Thr 180 185 190Asn His Asn Lys Ile Thr Phe Glu Glu Val Val
Leu Gly Ile Leu Gly 195 200 205Ile Val Leu Ile Thr Thr Gly Tyr Tyr
Leu Ser Leu Asn Ile Val Gln 210 215 220Tyr Tyr Asp Ser Ile Gly Thr
Leu Met Phe Ile Leu Leu Ser Thr Val225 230 235 240Ile Gly Ala Tyr
Leu Phe Phe Lys Ser Ser Val Ser Leu Val Phe Lys 245 250 255Met Val
Lys Lys Phe Arg Lys Gly Val Ile Ser Val Asn Asp Val Met 260 265
270Phe Ser Ser Ser Ile Met Tyr Arg Ile Lys Lys Asn Ala Phe Ser Leu
275 280 285Thr Val Met Ala Ile Ile Ser Ala Ile Thr Val Ser Val Leu
Cys Phe 290 295 300Ala Ala Ile Ser Arg Ala Ser Leu Ser Ser Glu Ile
Lys Tyr Thr Ala305 310 315 320Pro His Asp Val Thr Ile Lys Asp Gln
Gln Lys Ala Asn Gln Leu Ala 325 330 335Ser Glu Leu Asn Asn Gln Lys
Ile Pro His Phe Tyr Asn Tyr Lys Glu 340 345 350Val Ile His Thr Lys
Leu Tyr Lys Asp Asn Leu Phe Asp Val Lys Ala 355 360 365Lys Glu Pro
Tyr Asn Val Thr Ile Thr Ser Asp Lys Tyr Ile Pro Asn 370 375 380Thr
Asp Leu Lys Arg Gly Gln Ala Asp Leu Phe Val
Ala Glu Gly Ser385 390 395 400Ile Lys Asp Leu Val Lys His Lys Lys
His Gly Lys Ala Ile Ile Gly 405 410 415Thr Lys Lys His His Val Asn
Ile Lys Leu Arg Lys Asp Ile Asn Lys 420 425 430Ile Tyr Phe Met Thr
Asp Val Asp Leu Gly Gly Pro Thr Phe Val Leu 435 440 445Asn Asp Lys
Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys Ala Lys His 450 455 460Ile
Val Ser Gln Phe Gly Phe Asp Leu Lys His Lys Lys Asp Ala Leu465 470
475 480Ala Leu Glu Lys Ala Lys Asn Lys Val Asp Lys Ser Ile Glu Thr
Arg 485 490 495Ser Glu Ala Ile Ser Ser Ile Ser Ser Leu Thr Gly Ile
Leu Leu Phe 500 505 510Val Thr Ser Phe Leu Gly Ile Thr Phe Leu Ile
Ala Val Cys Cys Ile 515 520 525Ile Tyr Ile Lys Gln Ile Asp Glu Thr
Glu Asp Glu Leu Glu Asn Tyr 530 535 540Ser Ile Leu Arg Lys Leu Gly
Phe Thr Gln Lys Asp Met Ala Arg Gly545 550 555 560Leu Lys Phe Lys
Ile Met Phe Asn Phe Gly Leu Pro Leu Val Ile Ala 565 570 575Leu Ser
His Ala Tyr Phe Thr Ser Leu Ala Tyr Met Lys Leu Met Gly 580 585
590Thr Thr Asn Gln Ile Pro Val Phe Ile Val Met Gly Leu Tyr Ile Cys
595 600 605Met Tyr Ala Val Phe Ala Val Thr Ala Tyr Asn His Ser Lys
Arg Thr 610 615 620Ile Arg His Ser Ile62564599PRTStaphylococcus
aureus 64Met Tyr Phe Ser Phe Val Ala Leu Lys Tyr Ala His Lys Leu
Asn Met1 5 10 15Thr Glu Ser Tyr Pro Ile Ile Lys Glu Gly Ser Gln Val
Gly Ser Tyr 20 25 30Phe Leu Phe Phe Ile Ile Ile Ala Phe Leu Leu Tyr
Ala Asn Val Leu 35 40 45Phe Ile Lys Arg Arg Ser Tyr Glu Leu Ala Leu
Tyr Gln Thr Leu Gly 50 55 60Leu Ser Lys Phe Asn Ile Ile Tyr Ile Leu
Met Leu Glu Gln Leu Leu65 70 75 80Ile Phe Ile Ile Thr Ala Ile Leu
Gly Ile Ile Ile Gly Ile Phe Gly 85 90 95Ser Lys Leu Leu Leu Met Ile
Val Phe Thr Leu Leu Gly Ile Lys Glu 100 105 110Lys Val Pro Ile Ile
Phe Ser Leu Arg Ala Val Phe Glu Thr Leu Met 115 120 125Leu Ile Gly
Val Ala Tyr Phe Leu Thr Ser Ala Gln Asn Phe Ile Leu 130 135 140Val
Phe Lys Gln Ser Ile Ser Gln Met Ser Lys Asn Asn Gln Val Lys145 150
155 160Glu Thr Asn His Asn Lys Ile Thr Phe Glu Glu Val Val Leu Gly
Ile 165 170 175Leu Gly Ile Val Leu Ile Thr Thr Gly Tyr Tyr Leu Ser
Leu Asn Ile 180 185 190Val Gln Tyr Tyr Asp Ser Ile Gly Thr Leu Met
Phe Ile Leu Leu Ser 195 200 205Thr Val Ile Gly Ala Tyr Leu Phe Phe
Lys Ser Ser Val Ser Leu Val 210 215 220Phe Lys Met Val Lys Lys Phe
Arg Lys Gly Val Ile Ser Val Asn Asp225 230 235 240Val Met Phe Ser
Ser Ser Ile Met Tyr Arg Ile Lys Lys Asn Ala Phe 245 250 255Ser Leu
Thr Val Met Ala Ile Ile Ser Ala Ile Thr Val Ser Val Leu 260 265
270Cys Phe Ala Ala Ile Ser Arg Ala Ser Leu Ser Ser Glu Ile Lys Tyr
275 280 285Thr Ala Pro His Asp Val Thr Ile Lys Asp Gln Gln Lys Ala
Asn Gln 290 295 300Leu Ala Ser Glu Leu Asn Asn Gln Lys Ile Pro His
Phe Tyr Asn Tyr305 310 315 320Lys Glu Val Ile His Thr Lys Leu Tyr
Lys Asp Asn Leu Phe Asp Val 325 330 335Lys Ala Lys Glu Pro Tyr Asn
Val Thr Ile Thr Ser Asp Lys Tyr Ile 340 345 350Pro Asn Thr Asp Leu
Lys Arg Gly Gln Ala Asp Leu Phe Val Ala Glu 355 360 365Gly Ser Ile
Lys Asp Leu Val Lys His Lys Lys His Gly Lys Ala Ile 370 375 380Ile
Gly Thr Lys Lys His His Val Asn Ile Lys Leu Arg Lys Asp Ile385 390
395 400Asn Lys Ile Tyr Phe Met Thr Asp Val Asp Leu Gly Gly Pro Thr
Phe 405 410 415Val Leu Asn Asp Lys Asp Tyr Gln Glu Ile Arg Lys Tyr
Thr Lys Ala 420 425 430Lys His Ile Val Ser Gln Phe Gly Phe Asp Leu
Lys His Lys Lys Asp 435 440 445Ala Leu Ala Leu Glu Lys Ala Lys Asn
Lys Val Asp Lys Ser Ile Glu 450 455 460Thr Arg Ser Glu Ala Ile Ser
Ser Ile Ser Ser Leu Thr Gly Ile Leu465 470 475 480Leu Phe Val Thr
Ser Phe Leu Gly Ile Thr Phe Leu Ile Ala Val Cys 485 490 495Cys Ile
Ile Tyr Ile Lys Gln Ile Asp Glu Thr Glu Asp Glu Leu Glu 500 505
510Asn Tyr Ser Ile Leu Arg Lys Leu Gly Phe Thr Gln Lys Asp Met Ala
515 520 525Arg Gly Leu Lys Phe Lys Ile Met Phe Asn Phe Gly Leu Pro
Leu Val 530 535 540Ile Ala Leu Ser His Ala Tyr Phe Thr Ser Leu Ala
Tyr Met Lys Leu545 550 555 560Met Gly Thr Thr Asn Gln Ile Pro Val
Phe Ile Val Met Gly Leu Tyr 565 570 575Ile Cys Met Tyr Ala Val Phe
Ala Val Thr Ala Tyr Asn His Ser Lys 580 585 590Arg Thr Ile Arg His
Ser Ile 59565584PRTStaphylococcus aureus 65Met Thr Glu Ser Tyr Pro
Ile Ile Lys Glu Gly Ser Gln Val Gly Ser1 5 10 15Tyr Phe Leu Phe Phe
Ile Ile Ile Ala Phe Leu Leu Tyr Ala Asn Val 20 25 30Leu Phe Ile Lys
Arg Arg Ser Tyr Glu Leu Ala Leu Tyr Gln Thr Leu 35 40 45Gly Leu Ser
Lys Phe Asn Ile Ile Tyr Ile Leu Met Leu Glu Gln Leu 50 55 60Leu Ile
Phe Ile Ile Thr Ala Ile Leu Gly Ile Ile Ile Gly Ile Phe65 70 75
80Gly Ser Lys Leu Leu Leu Met Ile Val Phe Thr Leu Leu Gly Ile Lys
85 90 95Glu Lys Val Pro Ile Ile Phe Ser Leu Arg Ala Val Phe Glu Thr
Leu 100 105 110Met Leu Ile Gly Val Ala Tyr Phe Leu Thr Ser Ala Gln
Asn Phe Ile 115 120 125Leu Val Phe Lys Gln Ser Ile Ser Gln Met Ser
Lys Asn Asn Gln Val 130 135 140Lys Glu Thr Asn His Asn Lys Ile Thr
Phe Glu Glu Val Val Leu Gly145 150 155 160Ile Leu Gly Ile Val Leu
Ile Thr Thr Gly Tyr Tyr Leu Ser Leu Asn 165 170 175Ile Val Gln Tyr
Tyr Asp Ser Ile Gly Thr Leu Met Phe Ile Leu Leu 180 185 190Ser Thr
Val Ile Gly Ala Tyr Leu Phe Phe Lys Ser Ser Val Ser Leu 195 200
205Val Phe Lys Met Val Lys Lys Phe Arg Lys Gly Val Ile Ser Val Asn
210 215 220Asp Val Met Phe Ser Ser Ser Ile Met Tyr Arg Ile Lys Lys
Asn Ala225 230 235 240Phe Ser Leu Thr Val Met Ala Ile Ile Ser Ala
Ile Thr Val Ser Val 245 250 255Leu Cys Phe Ala Ala Ile Ser Arg Ala
Ser Leu Ser Ser Glu Ile Lys 260 265 270Tyr Thr Ala Pro His Asp Val
Thr Ile Lys Asp Gln Gln Lys Ala Asn 275 280 285Gln Leu Ala Ser Glu
Leu Asn Asn Gln Lys Ile Pro His Phe Tyr Asn 290 295 300Tyr Lys Glu
Val Ile His Thr Lys Leu Tyr Lys Asp Asn Leu Phe Asp305 310 315
320Val Lys Ala Lys Glu Pro Tyr Asn Val Thr Ile Thr Ser Asp Lys Tyr
325 330 335Ile Pro Asn Thr Asp Leu Lys Arg Gly Gln Ala Asp Leu Phe
Val Ala 340 345 350Glu Gly Ser Ile Lys Asp Leu Val Lys His Lys Lys
His Gly Lys Ala 355 360 365Ile Ile Gly Thr Lys Lys His His Val Asn
Ile Lys Leu Arg Lys Asp 370 375 380Ile Asn Lys Ile Tyr Phe Met Thr
Asp Val Asp Leu Gly Gly Pro Thr385 390 395 400Phe Val Leu Asn Asp
Lys Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys 405 410 415Ala Lys His
Ile Val Ser Gln Phe Gly Phe Asp Leu Lys His Lys Lys 420 425 430Asp
Ala Leu Ala Leu Glu Lys Ala Lys Asn Lys Val Asp Lys Ser Ile 435 440
445Glu Thr Arg Ser Glu Ala Ile Ser Ser Ile Ser Ser Leu Thr Gly Ile
450 455 460Leu Leu Phe Val Thr Ser Phe Leu Gly Ile Thr Phe Leu Ile
Ala Val465 470 475 480Cys Cys Ile Ile Tyr Ile Lys Gln Ile Asp Glu
Thr Glu Asp Glu Leu 485 490 495Glu Asn Tyr Ser Ile Leu Arg Lys Leu
Gly Phe Thr Gln Lys Asp Met 500 505 510Ala Arg Gly Leu Lys Phe Lys
Ile Met Phe Asn Phe Gly Leu Pro Leu 515 520 525Val Ile Ala Leu Ser
His Ala Tyr Phe Thr Ser Leu Ala Tyr Met Lys 530 535 540Leu Met Gly
Thr Thr Asn Gln Ile Pro Val Phe Ile Val Met Gly Leu545 550 555
560Tyr Ile Cys Met Tyr Ala Val Phe Ala Val Thr Ala Tyr Asn His Ser
565 570 575Lys Arg Thr Ile Arg His Ser Ile
58066584PRTStaphylococcus aureus 66Met Thr Glu Ser Tyr Pro Ile Ile
Lys Glu Gly Ser Gln Val Gly Ser1 5 10 15Tyr Phe Leu Phe Phe Ile Ile
Ile Ala Phe Leu Leu Tyr Ala Asn Val 20 25 30Leu Phe Ile Lys Arg Arg
Ser Tyr Glu Leu Ala Leu Tyr Gln Thr Leu 35 40 45Gly Leu Ser Lys Phe
Asn Ile Ile Tyr Ile Leu Met Leu Glu Gln Leu 50 55 60Leu Ile Phe Ile
Ile Thr Ala Ile Leu Gly Ile Ile Ile Gly Ile Phe65 70 75 80Gly Ser
Lys Leu Leu Leu Met Ile Val Phe Thr Leu Leu Gly Ile Lys 85 90 95Glu
Lys Val Pro Ile Ile Phe Ser Leu Arg Ala Val Phe Glu Thr Leu 100 105
110Met Leu Ile Gly Val Ala Tyr Phe Leu Thr Ser Ala Gln Asn Phe Ile
115 120 125Leu Val Phe Lys Gln Ser Ile Ser Gln Met Ser Lys Asn Asn
Gln Val 130 135 140Lys Glu Thr Asn His Asn Lys Ile Thr Phe Glu Glu
Val Val Leu Gly145 150 155 160Ile Leu Gly Ile Val Leu Ile Ile Thr
Gly Tyr Tyr Leu Ser Leu Asn 165 170 175Ile Val Gln Tyr Tyr Asp Ser
Ile Gly Ile Leu Met Phe Ile Leu Leu 180 185 190Ser Thr Val Ile Gly
Ala Tyr Leu Phe Phe Lys Ser Ser Val Ser Leu 195 200 205Val Phe Lys
Met Val Lys Lys Phe Arg Lys Gly Val Ile Ser Val Asn 210 215 220Asp
Val Met Phe Ser Ser Ser Ile Met Tyr Arg Ile Lys Lys Asn Ala225 230
235 240Phe Ser Leu Thr Val Met Ala Ile Ile Ser Ala Ile Thr Val Ser
Val 245 250 255Leu Cys Phe Ala Ala Ile Ser Arg Ala Ser Leu Ser Ser
Glu Ile Lys 260 265 270Tyr Thr Ala Pro His Asp Val Thr Ile Lys Asp
Gln Gln Lys Ala Asn 275 280 285Gln Leu Ala Ser Glu Leu Asn Asn Gln
Lys Ile Pro His Phe Tyr Asn 290 295 300Tyr Lys Glu Val Ile His Thr
Lys Leu Tyr Lys Asp Asn Leu Phe Asp305 310 315 320Val Lys Ala Lys
Glu Pro Tyr Asn Val Thr Ile Thr Ser Asp Lys Tyr 325 330 335Ile Pro
Asn Thr Asp Leu Lys Arg Gly Gln Ala Asp Leu Phe Val Ala 340 345
350Glu Gly Ser Ile Lys Asp Leu Val Lys His Lys Lys His Gly Lys Ala
355 360 365Ile Ile Gly Thr Lys Lys His His Val Asn Ile Lys Leu Arg
Lys Asp 370 375 380Ile Asn Lys Ile Tyr Phe Met Thr Asp Val Asp Leu
Gly Gly Pro Thr385 390 395 400Phe Val Leu Asn Asp Lys Asp Tyr Gln
Glu Ile Arg Lys Tyr Thr Lys 405 410 415Ala Lys His Ile Val Ser Gln
Phe Gly Phe Asp Leu Lys His Lys Lys 420 425 430Asp Ala Leu Ala Leu
Glu Lys Val Lys Asn Lys Val Asp Lys Ser Ile 435 440 445Lys Thr Arg
Ser Glu Ala Ile Ser Ser Ile Ser Ser Leu Thr Gly Ile 450 455 460Leu
Leu Phe Val Thr Ser Phe Leu Gly Ile Thr Phe Leu Ile Ala Val465 470
475 480Cys Cys Ile Ile Tyr Ile Lys Gln Ile Asp Glu Thr Glu Asp Glu
Leu 485 490 495Glu Asn Tyr Ser Ile Leu Arg Lys Leu Gly Phe Thr Gln
Lys Asp Met 500 505 510Ala Arg Gly Leu Lys Phe Lys Ile Met Phe Asn
Phe Gly Leu Pro Leu 515 520 525Val Ile Ala Leu Ser His Ala Tyr Phe
Thr Ser Leu Ala Tyr Met Lys 530 535 540Leu Met Gly Thr Thr Asn Gln
Ile Pro Val Phe Ile Val Met Gly Leu545 550 555 560Tyr Ile Cys Met
Tyr Ala Val Phe Ala Val Thr Ala Tyr Asn His Ser 565 570 575Lys Arg
Thr Ile Arg His Ser Ile 58067584PRTStaphylococcus aureus 67Met Thr
Glu Ser Tyr Pro Ile Ile Lys Glu Gly Ser Gln Val Gly Ser1 5 10 15Tyr
Phe Leu Phe Phe Ile Ile Ile Ala Phe Leu Leu Tyr Ala Asn Val 20 25
30Leu Phe Ile Lys Arg Arg Ser Tyr Glu Leu Ala Leu Tyr Gln Thr Leu
35 40 45Gly Leu Ser Lys Phe Asn Ile Ile Tyr Ile Leu Met Leu Glu Gln
Leu 50 55 60Leu Ile Phe Ile Ile Thr Ala Ile Leu Gly Ile Ile Ile Gly
Ile Phe65 70 75 80Gly Ser Lys Leu Leu Leu Met Ile Val Phe Thr Leu
Leu Gly Ile Lys 85 90 95Glu Lys Val Pro Ile Ile Phe Ser Leu Arg Ala
Val Phe Glu Thr Leu 100 105 110Met Leu Ile Gly Val Ala Tyr Phe Leu
Thr Ser Ala Gln Asn Phe Ile 115 120 125Leu Val Phe Lys Gln Ser Ile
Ser Gln Met Ser Lys Asn Asn Gln Val 130 135 140Lys Glu Thr Asn His
Asn Lys Ile Thr Phe Glu Glu Val Val Leu Gly145 150 155 160Ile Leu
Gly Ile Val Leu Ile Ile Thr Gly Tyr Tyr Leu Ser Leu Asn 165 170
175Ile Val Gln Tyr Tyr Asp Ser Ile Gly Ile Leu Met Phe Ile Leu Leu
180 185 190Ser Thr Val Ile Gly Ala Tyr Leu Phe Phe Lys Ser Ser Val
Ser Leu 195 200 205Val Phe Lys Met Val Lys Lys Phe Arg Lys Gly Val
Ile Ser Val Asn 210 215 220Asp Val Met Phe Ser Ser Ser Ile Met Tyr
Arg Ile Lys Lys Asn Ala225 230 235 240Phe Ser Leu Thr Val Met Ala
Ile Ile Ser Ala Ile Thr Val Ser Val 245 250 255Leu Cys Phe Ala Ala
Ile Ser Arg Ala Ser Leu Ser Ser Glu Ile Lys 260 265 270Tyr Thr Ala
Pro His Asp Val Thr Ile Lys Asp Gln Gln Lys Ala Asn 275 280 285Gln
Leu Ala Ser Glu Leu Asn Asn Gln Lys Ile Pro His Phe Tyr Asn 290 295
300Tyr Lys Glu Val Ile His Thr Lys Leu Tyr Lys Asp Asn Leu Phe
Asp305 310 315 320Val Lys Ala Lys Glu Pro Tyr Asn Val Thr Ile Thr
Ser Asp Lys Tyr 325 330 335Ile Pro Asn Thr Asp Leu Lys Arg Gly Gln
Ala Asp Leu Phe Val Ala 340 345 350Glu Gly Ser Ile Lys Asp Leu Val
Lys His Lys Lys His Gly Lys Ala 355 360 365Ile Ile Gly Thr Lys Lys
His His Val Asn Ile Lys Leu Arg Lys Asp 370 375 380Ile Asn Lys Ile
Tyr Phe Met Thr Asp Val Asp Leu Gly Gly Pro Thr385 390 395 400Phe
Val Leu Asn Asp Lys Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys 405 410
415Ala Lys His Ile Val Ser Gln Phe Gly Phe Asp Leu Lys His Lys Lys
420 425 430Asp Ala Leu Ala Leu Glu Lys Val Lys Asn Lys Val Asp Lys
Ser Ile 435 440 445Lys Thr Arg Ser Glu Ala Ile Ser Ser Ile Ser Ser
Leu Thr Gly Ile 450
455 460Leu Leu Phe Val Thr Ser Phe Leu Gly Ile Thr Phe Leu Ile Ala
Val465 470 475 480Cys Cys Ile Ile Tyr Ile Lys Gln Ile Asp Glu Thr
Glu Asp Glu Leu 485 490 495Glu Asn Tyr Ser Ile Leu Arg Lys Leu Gly
Phe Thr Gln Lys Asp Met 500 505 510Ala Arg Gly Leu Lys Phe Lys Ile
Met Phe Asn Phe Gly Leu Pro Leu 515 520 525Val Ile Val Leu Ser His
Ala Tyr Phe Thr Ser Leu Ala Tyr Met Lys 530 535 540Leu Met Gly Thr
Thr Asn Gln Ile Pro Val Phe Ile Val Met Gly Leu545 550 555 560Tyr
Ile Cys Met Tyr Ala Val Phe Ala Val Thr Ala Tyr Asn His Ser 565 570
575Lys Arg Thr Ile Arg His Ser Ile 58068584PRTStaphylococcus aureus
68Met Thr Glu Ser Tyr Pro Ile Ile Lys Glu Gly Ser Gln Val Gly Ser1
5 10 15Tyr Phe Leu Phe Phe Ile Ile Ile Ala Phe Leu Leu Tyr Ala Asn
Val 20 25 30Leu Phe Ile Lys Arg Arg Ser Tyr Glu Leu Ala Leu Tyr Gln
Thr Leu 35 40 45Gly Leu Ser Lys Phe Asn Ile Ile Tyr Ile Leu Met Leu
Glu Gln Leu 50 55 60Leu Ile Phe Ile Ile Thr Ala Ile Leu Gly Ile Ile
Ile Gly Ile Phe65 70 75 80Gly Ser Lys Leu Leu Leu Met Ile Val Phe
Thr Leu Leu Gly Ile Lys 85 90 95Glu Lys Val Pro Ile Ile Phe Ser Leu
Arg Ala Val Phe Glu Thr Leu 100 105 110Met Leu Ile Gly Val Ala Tyr
Phe Leu Thr Ser Ala Gln Asn Phe Ile 115 120 125Leu Val Phe Lys Gln
Ser Ile Ser Gln Met Ser Lys Asn Asn Gln Val 130 135 140Lys Glu Thr
Asn His Asn Lys Ile Thr Phe Glu Glu Val Val Leu Gly145 150 155
160Ile Leu Gly Ile Val Leu Ile Thr Thr Gly Tyr Tyr Leu Ser Leu Asn
165 170 175Ile Val Gln Tyr Tyr Asp Ser Ile Gly Ile Leu Met Phe Ile
Leu Leu 180 185 190Ser Thr Val Ile Gly Ala Tyr Leu Phe Phe Lys Ser
Ser Val Ser Leu 195 200 205Val Phe Lys Met Val Lys Lys Phe Arg Lys
Gly Val Ile Ser Val Asn 210 215 220Asp Val Met Phe Ser Ser Ser Ile
Met Tyr Arg Ile Lys Lys Asn Ala225 230 235 240Phe Ser Leu Thr Val
Met Ala Ile Ile Ser Ala Ile Thr Val Ser Val 245 250 255Leu Cys Phe
Ala Ala Ile Ser Arg Ala Ser Leu Ser Ser Glu Ile Lys 260 265 270Tyr
Thr Ala Pro His Asp Val Thr Ile Lys Asp Gln Gln Lys Ala Asn 275 280
285Gln Leu Ala Ser Glu Leu Asn Asn Gln Lys Ile Pro His Phe Tyr Asn
290 295 300Tyr Lys Glu Val Ile His Thr Lys Leu Tyr Lys Asp Asn Leu
Phe Asp305 310 315 320Val Lys Ala Lys Glu Pro Tyr Asn Val Thr Ile
Thr Ser Asp Lys Tyr 325 330 335Ile Pro Asn Thr Asp Leu Lys Arg Gly
Gln Ala Asp Leu Phe Val Ala 340 345 350Glu Gly Ser Ile Lys Asp Leu
Val Lys His Lys Lys His Gly Lys Ala 355 360 365Ile Ile Gly Thr Lys
Lys His His Val Asn Ile Lys Leu Arg Lys Asp 370 375 380Ile Asn Lys
Ile Tyr Phe Met Thr Asp Val Asp Leu Gly Gly Pro Thr385 390 395
400Phe Val Leu Asn Asp Lys Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys
405 410 415Ala Lys His Ile Val Ser Gln Phe Gly Phe Asp Leu Lys His
Lys Lys 420 425 430Asp Ala Leu Ala Leu Glu Lys Val Lys Asn Lys Val
Asp Lys Ser Ile 435 440 445Lys Thr Arg Ser Glu Ala Ile Ser Ser Ile
Ser Ser Leu Thr Gly Ile 450 455 460Leu Leu Phe Val Thr Ser Phe Leu
Gly Ile Thr Phe Leu Ile Ala Val465 470 475 480Cys Cys Ile Ile Tyr
Ile Lys Gln Ile Asp Glu Thr Glu Asp Glu Leu 485 490 495Glu Asn Tyr
Ser Ile Leu Arg Lys Leu Gly Phe Thr Gln Lys Asp Met 500 505 510Ala
Arg Gly Leu Lys Phe Lys Ile Met Phe Asn Phe Gly Leu Pro Leu 515 520
525Val Ile Ala Leu Ser His Ala Tyr Phe Thr Ser Leu Ala Tyr Met Lys
530 535 540Leu Met Gly Thr Thr Asn Gln Ile Pro Val Phe Ile Val Met
Gly Leu545 550 555 560Tyr Ile Cys Met Tyr Ala Val Phe Ala Val Thr
Ala Tyr Asn His Ser 565 570 575Lys Arg Thr Ile Arg His Ser Ile
58069629PRTStaphylococcus aureus 69Met Thr Phe Asn Glu Ile Ile Phe
Lys Asn Phe Arg Gln Asn Leu Ser1 5 10 15His Tyr Ala Ile Tyr Leu Phe
Ser Leu Ile Thr Ser Val Val Leu Tyr 20 25 30Phe Ser Phe Val Ala Leu
Lys Tyr Ala His Lys Leu Asn Met Thr Glu 35 40 45Ser Tyr Pro Ile Ile
Lys Glu Gly Ser Gln Val Gly Ser Tyr Phe Leu 50 55 60Phe Phe Ile Ile
Ile Ala Phe Leu Leu Tyr Ala Asn Val Leu Phe Ile65 70 75 80Lys Arg
Arg Ser Tyr Glu Leu Ala Leu Tyr Gln Thr Leu Gly Leu Ser 85 90 95Lys
Phe Asn Ile Ile Tyr Ile Leu Met Leu Glu Gln Leu Leu Ile Phe 100 105
110Ile Ile Thr Ala Ile Leu Gly Ile Ile Ile Gly Ile Phe Gly Ser Lys
115 120 125Leu Leu Leu Met Ile Val Phe Thr Leu Leu Gly Ile Lys Glu
Lys Val 130 135 140Pro Ile Ile Phe Ser Leu Arg Ala Val Phe Glu Thr
Leu Met Leu Ile145 150 155 160Gly Val Ala Tyr Phe Leu Thr Ser Ala
Gln Asn Phe Ile Leu Val Phe 165 170 175Lys Gln Ser Ile Ser Gln Met
Ser Lys Asn Asn Gln Val Lys Glu Thr 180 185 190Asn His Asn Lys Ile
Thr Phe Glu Glu Val Val Leu Gly Ile Leu Gly 195 200 205Ile Val Leu
Ile Thr Thr Gly Tyr Tyr Leu Ser Leu Asn Ile Val Gln 210 215 220Tyr
Tyr Asp Ser Ile Gly Ile Leu Met Phe Ile Leu Leu Ser Thr Val225 230
235 240Ile Gly Ala Tyr Leu Phe Phe Lys Ser Ser Val Ser Leu Val Phe
Lys 245 250 255Met Val Lys Lys Phe Arg Lys Gly Val Ile Ser Val Asn
Asp Val Met 260 265 270Phe Ser Ser Ser Ile Met Tyr Arg Ile Lys Lys
Asn Ala Phe Ser Leu 275 280 285Thr Val Met Ala Ile Ile Ser Ala Ile
Thr Val Ser Val Leu Cys Phe 290 295 300Ala Ala Ile Ser Arg Ala Ser
Leu Ser Ser Glu Ile Lys Tyr Thr Ala305 310 315 320Pro His Asp Val
Thr Ile Lys Asp Gln Gln Lys Ala Asn Gln Leu Ala 325 330 335Ser Glu
Leu Asn Asn Gln Lys Ile Pro His Phe Tyr Asn Tyr Lys Glu 340 345
350Val Ile His Thr Lys Leu Tyr Lys Asp Asn Leu Phe Asp Val Lys Ala
355 360 365Lys Glu Pro Tyr Asn Val Thr Ile Thr Ser Asp Lys Tyr Ile
Pro Asn 370 375 380Thr Asp Leu Lys Arg Gly Gln Ala Asp Leu Phe Val
Ala Glu Gly Ser385 390 395 400Ile Lys Asp Leu Val Lys His Lys Lys
His Gly Lys Ala Ile Ile Gly 405 410 415Thr Lys Lys His His Val Asn
Ile Lys Leu Arg Lys Asp Ile Asn Lys 420 425 430Ile Tyr Phe Met Thr
Asp Val Asp Leu Gly Gly Pro Thr Phe Val Leu 435 440 445Asn Asp Lys
Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys Ala Lys His 450 455 460Ile
Val Ser Gln Phe Gly Phe Asp Leu Lys His Lys Lys Asp Ala Leu465 470
475 480Ala Leu Glu Lys Val Lys Asn Lys Val Asp Lys Ser Ile Lys Thr
Arg 485 490 495Ser Glu Ala Ile Ser Ser Ile Ser Ser Leu Thr Gly Ile
Leu Leu Phe 500 505 510Val Thr Ser Phe Leu Gly Ile Thr Phe Leu Ile
Ala Val Cys Cys Ile 515 520 525Ile Tyr Ile Lys Gln Ile Asp Glu Thr
Glu Asp Glu Leu Glu Asn Tyr 530 535 540Ser Ile Leu Arg Lys Leu Gly
Phe Thr Gln Lys Asp Met Ala Arg Gly545 550 555 560Leu Lys Phe Lys
Ile Met Phe Asn Phe Gly Leu Pro Leu Val Ile Ala 565 570 575Leu Ser
His Ala Tyr Phe Thr Ser Leu Ala Tyr Met Lys Leu Met Gly 580 585
590Thr Thr Asn Gln Ile Pro Val Phe Ile Val Met Gly Leu Tyr Ile Cys
595 600 605Met Tyr Ala Val Phe Ala Val Thr Ala Tyr Asn His Ser Lys
Arg Thr 610 615 620Ile Arg His Ser Ile62570629PRTStaphylococcus
aureus 70Met Thr Phe Asn Glu Ile Ile Phe Lys Asn Phe Arg Gln Asn
Leu Ser1 5 10 15His Tyr Ala Ile Tyr Leu Phe Ser Leu Ile Thr Ser Val
Val Leu Tyr 20 25 30Phe Ser Phe Val Ala Leu Lys Tyr Ala His Lys Leu
Asn Met Thr Glu 35 40 45Ser Tyr Pro Ile Ile Lys Glu Gly Ser Gln Val
Gly Ser Tyr Phe Leu 50 55 60Phe Phe Ile Ile Ile Ala Phe Leu Leu Tyr
Ala Asn Val Leu Phe Ile65 70 75 80Lys Arg Arg Ser Tyr Glu Leu Ala
Leu Tyr Gln Thr Leu Gly Leu Ser 85 90 95Lys Phe Asn Ile Ile Tyr Ile
Leu Met Leu Glu Gln Leu Leu Ile Phe 100 105 110Ile Ile Thr Ala Ile
Leu Gly Ile Ile Ile Gly Ile Phe Gly Ser Lys 115 120 125Leu Leu Leu
Met Ile Val Phe Thr Leu Leu Gly Ile Lys Glu Lys Val 130 135 140Pro
Ile Ile Phe Ser Leu Arg Ala Val Phe Glu Thr Leu Met Leu Ile145 150
155 160Gly Val Ala Tyr Phe Leu Thr Ser Ala Gln Asn Phe Ile Leu Val
Phe 165 170 175Lys Gln Ser Ile Ser Gln Met Ser Lys Asn Asn Gln Val
Lys Glu Thr 180 185 190Asn His Asn Lys Ile Thr Phe Glu Glu Val Val
Leu Gly Ile Leu Gly 195 200 205Ile Val Leu Ile Thr Thr Gly Tyr Tyr
Leu Ser Leu Asn Ile Val Gln 210 215 220Tyr Tyr Asp Ser Ile Gly Ile
Leu Met Phe Ile Leu Leu Ser Thr Val225 230 235 240Ile Gly Ala Tyr
Leu Phe Phe Lys Ser Ser Val Ser Leu Val Phe Lys 245 250 255Met Val
Lys Lys Phe Arg Lys Gly Val Ile Ser Val Asn Asp Val Met 260 265
270Phe Ser Ser Ser Ile Met Tyr Arg Ile Lys Lys Asn Ala Phe Ser Leu
275 280 285Thr Val Met Ala Ile Ile Ser Ala Ile Thr Val Ser Val Leu
Cys Phe 290 295 300Ala Ala Ile Ser Arg Ala Ser Leu Ser Ser Glu Ile
Lys Tyr Thr Ala305 310 315 320Pro His Asp Val Thr Ile Lys Asp Gln
Gln Lys Ala Asn Gln Leu Ala 325 330 335Ser Glu Leu Asn Asn Gln Lys
Ile Pro His Phe Tyr Asn Tyr Lys Glu 340 345 350Val Ile His Thr Lys
Leu Tyr Lys Asp Asn Leu Phe Asp Val Lys Ala 355 360 365Lys Glu Pro
Tyr Asn Val Thr Ile Thr Ser Asp Lys Tyr Ile Pro Asn 370 375 380Thr
Asp Leu Lys Arg Gly Gln Ala Asp Leu Phe Val Ala Glu Gly Ser385 390
395 400Ile Lys Asp Leu Val Lys His Lys Lys His Gly Lys Ala Ile Ile
Gly 405 410 415Thr Lys Lys His His Val Asn Ile Lys Leu Arg Lys Asp
Ile Asn Lys 420 425 430Ile Tyr Phe Met Thr Asp Val Asp Leu Gly Gly
Pro Thr Phe Val Leu 435 440 445Asn Asp Lys Asp Tyr Gln Glu Ile Arg
Lys Tyr Thr Lys Ala Lys His 450 455 460Ile Val Ser Gln Phe Gly Phe
Asp Leu Lys His Lys Lys Asp Ala Leu465 470 475 480Ala Leu Glu Lys
Val Lys Asn Lys Val Asp Lys Ser Ile Lys Thr Arg 485 490 495Ser Glu
Ala Ile Ser Ser Ile Ser Ser Leu Thr Gly Ile Leu Leu Phe 500 505
510Val Thr Ser Phe Leu Gly Ile Thr Phe Leu Ile Ala Val Cys Cys Ile
515 520 525Ile Tyr Ile Lys Gln Ile Asp Glu Thr Glu Asp Glu Leu Glu
Asn Tyr 530 535 540Ser Ile Leu Arg Lys Leu Gly Phe Thr Gln Lys Asp
Met Ala Arg Gly545 550 555 560Leu Lys Phe Lys Ile Met Phe Asn Phe
Gly Leu Pro Leu Val Ile Ala 565 570 575Leu Ser His Ala Tyr Phe Thr
Ser Leu Ala Tyr Met Lys Leu Met Gly 580 585 590Thr Thr Asn Gln Ile
Pro Val Phe Ile Val Met Gly Leu Tyr Ile Cys 595 600 605Met Tyr Ala
Val Phe Ala Val Thr Ala Tyr Asn His Ser Lys Arg Thr 610 615 620Ile
Arg His Ser Ile62571629PRTStaphylococcus aureus 71Met Thr Phe Asn
Glu Ile Ile Phe Lys Asn Phe Arg Gln Asn Leu Ser1 5 10 15His Tyr Ala
Ile Tyr Leu Phe Ser Leu Ile Thr Ser Val Val Leu Tyr 20 25 30Phe Ser
Phe Val Ala Leu Lys Tyr Ala His Lys Leu Asn Met Thr Glu 35 40 45Ser
Tyr Pro Ile Ile Lys Glu Gly Ser Gln Val Gly Ser Tyr Phe Leu 50 55
60Phe Phe Ile Ile Ile Ala Phe Leu Leu Tyr Ala Asn Val Leu Phe Ile65
70 75 80Lys Arg Arg Ser Tyr Glu Leu Ala Leu Tyr Gln Thr Leu Gly Leu
Ser 85 90 95Lys Phe Asn Ile Ile Tyr Ile Leu Met Leu Glu Gln Leu Leu
Ile Phe 100 105 110Ile Ile Thr Ala Ile Leu Gly Ile Ile Ile Gly Ile
Phe Gly Ser Lys 115 120 125Leu Leu Leu Met Ile Val Phe Thr Leu Leu
Gly Ile Lys Glu Lys Val 130 135 140Pro Ile Ile Phe Ser Leu Arg Ala
Val Phe Glu Thr Leu Met Leu Ile145 150 155 160Gly Val Ala Tyr Phe
Leu Thr Ser Ala Gln Asn Phe Ile Leu Val Phe 165 170 175Lys Gln Ser
Ile Ser Gln Met Ser Lys Asn Asn Gln Val Lys Glu Thr 180 185 190Asn
His Asn Lys Ile Thr Phe Glu Glu Val Val Leu Gly Ile Leu Gly 195 200
205Ile Val Leu Ile Thr Thr Gly Tyr Tyr Leu Ser Leu Asn Ile Val Gln
210 215 220Tyr Tyr Asp Ser Ile Gly Ile Leu Met Phe Ile Leu Leu Ser
Thr Val225 230 235 240Ile Gly Ala Tyr Leu Phe Phe Lys Ser Ser Val
Ser Leu Val Phe Lys 245 250 255Met Val Lys Lys Phe Arg Lys Gly Val
Ile Ser Val Asn Asp Val Met 260 265 270Phe Ser Ser Ser Ile Met Tyr
Arg Ile Lys Lys Asn Ala Phe Ser Leu 275 280 285Thr Val Met Ala Ile
Ile Ser Ala Ile Thr Val Ser Val Leu Cys Phe 290 295 300Ala Ala Ile
Ser Arg Ala Ser Leu Ser Ser Glu Ile Lys Tyr Thr Ala305 310 315
320Pro His Asp Val Thr Ile Lys Asp Gln Gln Lys Ala Asn Gln Leu Ala
325 330 335Ser Glu Leu Asn Asn Gln Lys Ile Pro His Phe Tyr Asn Tyr
Lys Glu 340 345 350Val Ile His Thr Lys Leu Tyr Lys Asp Asn Leu Phe
Asp Val Lys Ala 355 360 365Lys Glu Pro Tyr Asn Val Thr Ile Thr Ser
Asp Lys Tyr Ile Pro Asn 370 375 380Thr Asp Leu Lys Arg Gly Gln Ala
Asp Leu Phe Val Ala Glu Gly Ser385 390 395 400Ile Lys Asp Leu Val
Lys His Lys Lys His Gly Lys Ala Val Ile Gly 405 410 415Thr Lys Lys
His His Val Asn Ile Lys Leu Arg Lys Asp Ile Asn Lys 420 425 430Ile
Tyr Phe Met Thr Asp Val Asp Leu Gly Gly Pro Thr Phe Val Leu 435 440
445Asn Asp Lys Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys Ala Lys His
450 455 460Ile Val Ser Gln Phe Gly Phe Asp Leu Lys His Lys Lys Asp
Ala Leu465 470 475 480Ala Leu Glu Lys Val Lys Asn Lys Val Asp Lys
Ser Ile Lys Thr Arg 485 490 495Ser Glu Ala Ile
Ser Ser Ile Ser Ser Leu Thr Gly Ile Leu Leu Phe 500 505 510Val Thr
Ser Phe Leu Gly Ile Thr Phe Leu Ile Ala Val Cys Cys Ile 515 520
525Ile Tyr Ile Lys Gln Ile Asp Glu Thr Glu Asp Glu Leu Glu Asn Tyr
530 535 540Ser Ile Leu Arg Lys Leu Gly Phe Thr Gln Lys Asp Met Ala
Arg Gly545 550 555 560Leu Lys Phe Lys Ile Met Phe Asn Phe Gly Leu
Pro Leu Val Ile Ala 565 570 575Leu Ser His Ala Tyr Phe Thr Ser Leu
Ala Tyr Met Lys Leu Met Gly 580 585 590Thr Thr Asn Gln Ile Pro Val
Phe Ile Val Met Gly Leu Tyr Ile Cys 595 600 605Met Tyr Ala Val Phe
Ala Val Thr Ala Tyr Asn His Ser Lys Arg Thr 610 615 620Ile Arg His
Ser Ile62572629PRTStaphylococcus aureus 72Met Thr Phe Asn Glu Ile
Ile Phe Lys Asn Phe Arg Gln Asn Leu Ser1 5 10 15His Tyr Ala Ile Tyr
Leu Phe Ser Leu Ile Thr Ser Val Val Leu Tyr 20 25 30Phe Ser Phe Val
Ala Leu Lys Tyr Ala His Lys Leu Asn Met Thr Glu 35 40 45Ser Tyr Pro
Ile Ile Lys Glu Gly Ser Gln Val Gly Ser Tyr Phe Leu 50 55 60Phe Phe
Ile Ile Ile Ala Phe Leu Leu Tyr Ala Asn Val Leu Phe Ile65 70 75
80Lys Arg Arg Ser Tyr Glu Leu Ala Leu Tyr Gln Thr Leu Gly Leu Ser
85 90 95Lys Phe Asn Ile Ile Tyr Ile Leu Met Leu Glu Gln Leu Leu Ile
Phe 100 105 110Ile Ile Thr Ala Ile Leu Gly Ile Ile Ile Gly Ile Phe
Gly Ser Lys 115 120 125Leu Leu Leu Met Ile Val Phe Thr Leu Leu Gly
Ile Lys Glu Lys Val 130 135 140Pro Ile Ile Phe Ser Leu Arg Ala Val
Phe Glu Thr Leu Met Leu Ile145 150 155 160Gly Val Ala Tyr Phe Leu
Thr Ser Ala Gln Asn Phe Ile Leu Val Phe 165 170 175Lys Gln Ser Ile
Ser Gln Met Ser Lys Asn Asn Gln Val Lys Glu Thr 180 185 190Asn His
Asn Lys Ile Thr Phe Glu Glu Val Val Leu Gly Ile Leu Gly 195 200
205Ile Val Leu Ile Thr Thr Gly Tyr Tyr Leu Ser Leu Asn Ile Val Gln
210 215 220Tyr Tyr Asp Ser Ile Gly Ile Leu Met Phe Ile Leu Leu Ser
Thr Val225 230 235 240Ile Gly Ala Tyr Leu Phe Phe Lys Ser Ser Val
Ser Leu Val Phe Lys 245 250 255Met Val Lys Lys Phe Arg Lys Gly Val
Ile Ser Val Asn Asp Val Met 260 265 270Phe Ser Ser Ser Ile Met Tyr
Arg Ile Lys Lys Asn Ala Phe Ser Leu 275 280 285Thr Val Met Ala Ile
Ile Ser Ala Ile Thr Val Ser Val Leu Cys Phe 290 295 300Ala Ala Ile
Ser Arg Ala Ser Leu Ser Ser Glu Ile Lys Tyr Thr Ala305 310 315
320Pro His Asp Val Thr Ile Lys Asp Gln Gln Lys Ala Asn Gln Leu Ala
325 330 335Ser Glu Leu Asn Asn Gln Lys Ile Pro His Phe Tyr Asn Tyr
Lys Glu 340 345 350Val Ile His Thr Lys Leu Tyr Lys Asp Asn Leu Phe
Asp Val Lys Ala 355 360 365Lys Glu Pro Tyr Asn Val Thr Ile Thr Ser
Asp Lys Tyr Ile Pro Asn 370 375 380Thr Asp Leu Lys Arg Gly Gln Ala
Asp Leu Phe Val Ala Glu Gly Ser385 390 395 400Ile Lys Asp Leu Val
Lys His Lys Lys His Gly Lys Ala Val Ile Gly 405 410 415Thr Lys Lys
His His Val Asn Ile Lys Leu Arg Lys Asp Ile Asn Lys 420 425 430Ile
Tyr Phe Met Thr Asp Val Asp Leu Gly Gly Pro Thr Phe Val Leu 435 440
445Asn Asp Lys Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys Ala Lys His
450 455 460Ile Val Ser Gln Phe Gly Phe Asp Leu Lys His Lys Lys Asp
Ala Leu465 470 475 480Ala Leu Glu Lys Val Lys Asn Lys Val Asp Lys
Ser Ile Lys Thr Arg 485 490 495Ser Glu Ala Ile Ser Ser Ile Ser Ser
Leu Thr Gly Ile Leu Leu Phe 500 505 510Val Thr Ser Phe Leu Gly Ile
Thr Phe Leu Ile Ala Val Cys Cys Ile 515 520 525Ile Tyr Ile Lys Gln
Ile Asp Glu Thr Glu Asp Glu Leu Glu Asn Tyr 530 535 540Ser Ile Leu
Arg Lys Leu Gly Phe Thr Gln Lys Asp Met Ala Arg Gly545 550 555
560Leu Lys Phe Lys Ile Met Phe Asn Phe Gly Leu Pro Leu Val Ile Ala
565 570 575Leu Ser His Ala Tyr Phe Thr Ser Leu Ala Tyr Met Lys Leu
Met Gly 580 585 590Thr Thr Asn Gln Ile Pro Val Phe Ile Val Met Gly
Leu Tyr Ile Cys 595 600 605Met Tyr Ala Val Phe Ala Val Thr Ala Tyr
Asn His Ser Lys Arg Thr 610 615 620Ile Arg His Ser
Ile62573629PRTStaphylococcus aureus 73Met Thr Phe Asn Glu Ile Ile
Phe Lys Asn Phe Arg Gln Asn Leu Ser1 5 10 15His Tyr Ala Ile Tyr Leu
Phe Ser Leu Ile Thr Ser Val Val Leu Tyr 20 25 30Phe Ser Phe Val Ala
Leu Lys Tyr Ala His Lys Leu Asn Met Thr Glu 35 40 45Ser Tyr Pro Ile
Ile Lys Glu Gly Ser Gln Val Gly Ser Tyr Phe Leu 50 55 60Phe Phe Ile
Ile Ile Ala Phe Leu Leu Tyr Ala Asn Val Leu Phe Ile65 70 75 80Lys
Arg Arg Ser Tyr Glu Leu Ala Leu Tyr Gln Thr Leu Gly Leu Ser 85 90
95Lys Phe Asn Ile Ile Tyr Ile Leu Met Leu Glu Gln Leu Leu Ile Phe
100 105 110Ile Ile Thr Ala Ile Leu Gly Ile Ile Ile Gly Ile Phe Gly
Ser Lys 115 120 125Leu Leu Leu Met Ile Val Phe Thr Leu Leu Gly Ile
Lys Glu Lys Val 130 135 140Pro Ile Ile Phe Ser Leu Arg Ala Val Phe
Glu Thr Leu Met Leu Ile145 150 155 160Gly Val Ala Tyr Phe Leu Thr
Ser Ala Gln Asn Phe Ile Leu Val Phe 165 170 175Lys Gln Ser Ile Ser
Gln Met Ser Lys Asn Asn Gln Val Lys Glu Thr 180 185 190Asn His Asn
Lys Ile Thr Phe Glu Glu Val Val Leu Gly Ile Leu Gly 195 200 205Ile
Val Leu Ile Thr Thr Gly Tyr Tyr Leu Ser Leu Asn Ile Val Gln 210 215
220Tyr Tyr Asp Ser Ile Gly Thr Leu Met Phe Ile Leu Leu Ser Thr
Val225 230 235 240Ile Gly Ala Tyr Leu Phe Phe Lys Ser Ser Val Ser
Leu Val Phe Lys 245 250 255Met Val Lys Lys Phe Arg Lys Gly Val Ile
Ser Val Asn Asp Val Met 260 265 270Phe Ser Ser Ser Ile Met Tyr Arg
Ile Lys Lys Asn Ala Phe Ser Leu 275 280 285Thr Val Met Ala Ile Ile
Ser Ala Ile Thr Val Ser Val Leu Cys Phe 290 295 300Ala Ala Ile Ser
Arg Ala Ser Leu Ser Ser Glu Ile Lys Tyr Thr Ala305 310 315 320Pro
His Asp Val Thr Ile Lys Asp Gln Gln Lys Ala Asn Gln Leu Ala 325 330
335Ser Glu Leu Asn Asn Gln Lys Ile Pro His Phe Tyr Asn Tyr Lys Glu
340 345 350Val Ile His Thr Lys Leu Tyr Lys Asp Asn Leu Phe Asp Val
Lys Ser 355 360 365Lys Gln Pro Tyr Asn Val Thr Ile Thr Ser Asp Lys
Tyr Ile Pro Ser 370 375 380Thr Asp Leu Lys Arg Gly Gln Ala Asp Leu
Phe Val Ala Glu Gly Ser385 390 395 400Ile Lys Asp Leu Val Lys His
Lys Lys His Gly Lys Ala Val Ile Gly 405 410 415Thr Lys Lys His His
Val Asn Ile Lys Leu Arg Lys Asp Ile Asn Lys 420 425 430Ile Tyr Phe
Met Thr Asp Val Asp Leu Gly Gly Pro Thr Phe Val Leu 435 440 445Asn
Asp Lys Asp Tyr Gln Glu Ile Arg Lys Tyr Thr Lys Ala Lys His 450 455
460Ile Val Ser Gln Phe Gly Phe Asp Leu Lys His Lys Lys Asp Ala
Leu465 470 475 480Ala Leu Glu Lys Ala Lys Asn Lys Val Asp Lys Ser
Ile Glu Thr Arg 485 490 495Ser Glu Ala Ile Ser Ser Ile Ser Ser Leu
Thr Gly Ile Leu Leu Phe 500 505 510Val Thr Ser Phe Leu Gly Ile Thr
Phe Leu Ile Ala Val Cys Cys Ile 515 520 525Ile Tyr Ile Lys Gln Ile
Asp Glu Thr Glu Asp Glu Leu Glu Asn Tyr 530 535 540Ser Ile Leu Arg
Lys Leu Gly Phe Thr Gln Lys Asp Met Ala Arg Gly545 550 555 560Leu
Lys Phe Lys Ile Met Phe Asn Phe Gly Leu Pro Leu Val Ile Ala 565 570
575Leu Ser His Ala Tyr Phe Thr Ser Leu Ala Tyr Met Lys Leu Met Gly
580 585 590Thr Thr Asn Gln Ile Pro Val Phe Ile Val Met Gly Leu Tyr
Ile Cys 595 600 605Met Tyr Ala Val Phe Ala Val Thr Ala Tyr Asn His
Ser Lys Arg Thr 610 615 620Ile Arg His Ser
Ile62574584PRTStaphylococcus aureusmisc_feature(168)..(168)Xaa can
be any naturally occurring amino acidmisc_feature(186)..(186)Xaa
can be any naturally occurring amino
acidmisc_feature(323)..(323)Xaa can be any naturally occurring
amino acidmisc_feature(325)..(325)Xaa can be any naturally
occurring amino acidmisc_feature(339)..(339)Xaa can be any
naturally occurring amino acidmisc_feature(369)..(369)Xaa can be
any naturally occurring amino acidmisc_feature(440)..(440)Xaa can
be any naturally occurring amino acidmisc_feature(449)..(449)Xaa
can be any naturally occurring amino
acidmisc_feature(531)..(531)Xaa can be any naturally occurring
amino acid 74Met Thr Glu Ser Tyr Pro Ile Ile Lys Glu Gly Ser Gln
Val Gly Ser1 5 10 15Tyr Phe Leu Phe Phe Ile Ile Ile Ala Phe Leu Leu
Tyr Ala Asn Val 20 25 30Leu Phe Ile Lys Arg Arg Ser Tyr Glu Leu Ala
Leu Tyr Gln Thr Leu 35 40 45Gly Leu Ser Lys Phe Asn Ile Ile Tyr Ile
Leu Met Leu Glu Gln Leu 50 55 60Leu Ile Phe Ile Ile Thr Ala Ile Leu
Gly Ile Ile Ile Gly Ile Phe65 70 75 80Gly Ser Lys Leu Leu Leu Met
Ile Val Phe Thr Leu Leu Gly Ile Lys 85 90 95Glu Lys Val Pro Ile Ile
Phe Ser Leu Arg Ala Val Phe Glu Thr Leu 100 105 110Met Leu Ile Gly
Val Ala Tyr Phe Leu Thr Ser Ala Gln Asn Phe Ile 115 120 125Leu Val
Phe Lys Gln Ser Ile Ser Gln Met Ser Lys Asn Asn Gln Val 130 135
140Lys Glu Thr Asn His Asn Lys Ile Thr Phe Glu Glu Val Val Leu
Gly145 150 155 160Ile Leu Gly Ile Val Leu Ile Xaa Thr Gly Tyr Tyr
Leu Ser Leu Asn 165 170 175Ile Val Gln Tyr Tyr Asp Ser Ile Gly Xaa
Leu Met Phe Ile Leu Leu 180 185 190Ser Thr Val Ile Gly Ala Tyr Leu
Phe Phe Lys Ser Ser Val Ser Leu 195 200 205Val Phe Lys Met Val Lys
Lys Phe Arg Lys Gly Val Ile Ser Val Asn 210 215 220Asp Val Met Phe
Ser Ser Ser Ile Met Tyr Arg Ile Lys Lys Asn Ala225 230 235 240Phe
Ser Leu Thr Val Met Ala Ile Ile Ser Ala Ile Thr Val Ser Val 245 250
255Leu Cys Phe Ala Ala Ile Ser Arg Ala Ser Leu Ser Ser Glu Ile Lys
260 265 270Tyr Thr Ala Pro His Asp Val Thr Ile Lys Asp Gln Gln Lys
Ala Asn 275 280 285Gln Leu Ala Ser Glu Leu Asn Asn Gln Lys Ile Pro
His Phe Tyr Asn 290 295 300Tyr Lys Glu Val Ile His Thr Lys Leu Tyr
Lys Asp Asn Leu Phe Asp305 310 315 320Val Lys Xaa Lys Xaa Pro Tyr
Asn Val Thr Ile Thr Ser Asp Lys Tyr 325 330 335Ile Pro Xaa Thr Asp
Leu Lys Arg Gly Gln Ala Asp Leu Phe Val Ala 340 345 350Glu Gly Ser
Ile Lys Asp Leu Val Lys His Lys Lys His Gly Lys Ala 355 360 365Xaa
Ile Gly Thr Lys Lys His His Val Asn Ile Lys Leu Arg Lys Asp 370 375
380Ile Asn Lys Ile Tyr Phe Met Thr Asp Val Asp Leu Gly Gly Pro
Thr385 390 395 400Phe Val Leu Asn Asp Lys Asp Tyr Gln Glu Ile Arg
Lys Tyr Thr Lys 405 410 415Ala Lys His Ile Val Ser Gln Phe Gly Phe
Asp Leu Lys His Lys Lys 420 425 430Asp Ala Leu Ala Leu Glu Lys Xaa
Lys Asn Lys Val Asp Lys Ser Ile 435 440 445Xaa Thr Arg Ser Glu Ala
Ile Ser Ser Ile Ser Ser Leu Thr Gly Ile 450 455 460Leu Leu Phe Val
Thr Ser Phe Leu Gly Ile Thr Phe Leu Ile Ala Val465 470 475 480Cys
Cys Ile Ile Tyr Ile Lys Gln Ile Asp Glu Thr Glu Asp Glu Leu 485 490
495Glu Asn Tyr Ser Ile Leu Arg Lys Leu Gly Phe Thr Gln Lys Asp Met
500 505 510Ala Arg Gly Leu Lys Phe Lys Ile Met Phe Asn Phe Gly Leu
Pro Leu 515 520 525Val Ile Xaa Leu Ser His Ala Tyr Phe Thr Ser Leu
Ala Tyr Met Lys 530 535 540Leu Met Gly Thr Thr Asn Gln Ile Pro Val
Phe Ile Val Met Gly Leu545 550 555 560Tyr Ile Cys Met Tyr Ala Val
Phe Ala Val Thr Ala Tyr Asn His Ser 565 570 575Lys Arg Thr Ile Arg
His Ser Ile 58075203PRTStaphylococcus aureus 75Met Phe Lys Lys Asn
Asp Ser Lys Asn Ser Ile Leu Leu Lys Ser Ile1 5 10 15Leu Ser Leu Gly
Ile Ile Tyr Gly Gly Thr Phe Gly Ile Tyr Pro Lys 20 25 30Ala Asp Ala
Ser Thr Gln Asn Ser Pro Ser Val Gln Asp Lys Gln Phe 35 40 45Gln Lys
Val Glu Glu Val Pro Asn Asn Ser Glu Lys Ala Leu Val Lys 50 55 60Lys
Leu Tyr Asp Arg Tyr Ser Gln Asn Thr Ile Asn Gly Lys Ser Asn65 70 75
80Lys Ser Arg Asn Trp Val Tyr Ser Glu Arg Pro Leu Asn Glu Asn Gln
85 90 95Val Arg Ile Asn Leu Glu Gly Thr Tyr Arg Val Ala Asp Arg Val
Tyr 100 105 110Thr Pro Lys Arg Asn Ile Thr Leu Asn Lys Glu Val Val
Thr Leu Lys 115 120 125Glu Leu Asp His Ile Ile Arg Phe Ala His Ile
Ser Tyr Gly Leu Tyr 130 135 140Met Gly Glu His Leu Pro Lys Gly Asn
Ile Val Ile Asn Thr Lys Asp145 150 155 160Gly Gly Lys Tyr Thr Leu
Glu Ser His Lys Glu Leu Gln Lys Asp Arg 165 170 175Glu Asn Val Lys
Ile Asn Thr Ala Asp Ile Lys Asn Val Thr Phe Lys 180 185 190Leu Val
Lys Ser Val Asn Asp Ile Glu Gln Val 195 20076895PRTStaphylococcus
aureus 76Met Asn Lys His His Pro Lys Leu Arg Ser Phe Tyr Ser Ile
Arg Lys1 5 10 15Ser Ile Leu Gly Val Ala Ser Val Ile Val Ser Thr Leu
Phe Leu Ile 20 25 30Thr Ser Gln His Gln Ala Gln Ala Ala Glu Asn Thr
Asn Thr Ser Asp 35 40 45Lys Ile Ser Glu Asn Gln Asn Asn Asn Ala Thr
Thr Thr Gln Pro Pro 50 55 60Lys Asp Thr Asn Gln Thr Gln Pro Ala Thr
Gln Pro Ala Asn Thr Ala65 70 75 80Lys Thr Tyr Pro Ala Ala Asp Glu
Ser Leu Lys Asp Ala Ile Lys Asp 85 90 95Pro Ala Leu Glu Asn Lys Glu
His Asp Ile Gly Pro Arg Glu Gln Val 100 105 110Asn Phe Gln Leu Leu
Asp Lys Asn Asn Glu Thr Gln Tyr Tyr His Phe 115 120 125Phe Ser Ile
Lys Asp Pro Ala Asp Val Tyr Tyr Thr Lys Lys Lys Ala 130 135 140Glu
Val Glu Leu Asp Ile Asn Thr Ala Ser Thr Trp Lys Lys Phe Glu145 150
155 160Val Tyr Glu Asn Asn Gln Lys Leu Pro Val Arg Leu Val Ser Tyr
Ser 165 170 175Pro Val Pro Glu Asp His Ala Tyr Ile Arg Phe Pro Val
Ser Asp Gly 180 185 190Thr Gln Glu Leu Lys Ile Val Ser Ser Thr Gln
Ile Asp Asp
Gly Glu 195 200 205Glu Thr Asn Tyr Asp Tyr Thr Lys Leu Val Phe Ala
Lys Pro Ile Tyr 210 215 220Asn Asp Pro Ser Leu Val Lys Ser Asp Thr
Asn Asp Ala Val Val Thr225 230 235 240Asn Asp Gln Ser Ser Ser Asp
Ala Ser Asn Gln Thr Asn Thr Asn Thr 245 250 255Ser Asn Gln Asn Thr
Ser Thr Ile Asn Asn Ala Asn Asn Gln Pro Gln 260 265 270Ala Thr Thr
Asn Met Ser Gln Pro Ala Gln Pro Lys Ser Ser Ala Asn 275 280 285Ala
Asp Gln Ala Ser Ser Gln Pro Ala His Glu Thr Asn Ser Asn Gly 290 295
300Asn Thr Asn Asp Lys Thr Asn Glu Ser Ser Asn Gln Ser Asp Val
Asn305 310 315 320Gln Gln Tyr Pro Pro Ala Asp Glu Ser Leu Gln Asp
Ala Ile Lys Asn 325 330 335Pro Ala Ile Ile Asp Lys Glu His Thr Ala
Asp Asn Trp Arg Pro Ile 340 345 350Asp Phe Gln Met Lys Asn Asp Lys
Gly Glu Arg Gln Phe Tyr His Tyr 355 360 365Ala Ser Thr Val Glu Pro
Ala Thr Val Ile Phe Thr Lys Thr Gly Pro 370 375 380Ile Ile Glu Leu
Gly Leu Lys Thr Ala Ser Thr Trp Lys Lys Phe Glu385 390 395 400Val
Tyr Glu Gly Asp Lys Lys Leu Pro Val Glu Leu Val Ser Tyr Asp 405 410
415Ser Asp Lys Asp Tyr Ala Tyr Ile Arg Phe Pro Val Ser Asn Gly Thr
420 425 430Arg Glu Val Lys Ile Val Ser Ser Ile Glu Tyr Gly Glu Asn
Ile His 435 440 445Glu Asp Tyr Asp Tyr Thr Leu Met Val Phe Ala Gln
Pro Ile Thr Asn 450 455 460Asn Pro Asp Asp Tyr Val Asp Glu Glu Thr
Tyr Asn Leu Gln Lys Leu465 470 475 480Leu Ala Pro Tyr His Lys Ala
Lys Thr Leu Glu Arg Gln Val Tyr Glu 485 490 495Leu Glu Lys Leu Gln
Glu Lys Leu Pro Glu Lys Tyr Lys Ala Glu Tyr 500 505 510Lys Lys Lys
Leu Asp Gln Thr Arg Val Glu Leu Ala Asp Gln Val Lys 515 520 525Ser
Ala Val Thr Glu Phe Glu Asn Val Thr Pro Thr Asn Asp Gln Leu 530 535
540Thr Asp Val Gln Glu Ala His Phe Val Val Phe Glu Ser Glu Glu
Asn545 550 555 560Ser Glu Ser Val Met Asp Gly Phe Val Glu His Pro
Phe Tyr Thr Ala 565 570 575Thr Leu Asn Gly Gln Lys Tyr Val Val Met
Lys Thr Lys Asp Asp Ser 580 585 590Tyr Trp Lys Asp Leu Ile Val Glu
Gly Lys Arg Val Thr Thr Val Ser 595 600 605Lys Asp Pro Lys Asn Asn
Ser Arg Thr Leu Ile Phe Pro Tyr Ile Pro 610 615 620Asp Lys Ala Val
Tyr Asn Ala Ile Val Lys Val Val Val Ala Asn Ile625 630 635 640Gly
Tyr Glu Gly Gln Tyr His Val Arg Ile Ile Asn Gln Asp Ile Asn 645 650
655Thr Lys Asp Asp Asp Thr Ser Gln Asn Asn Thr Ser Glu Pro Leu Asn
660 665 670Val Gln Thr Gly Gln Glu Gly Lys Val Ala Asp Thr Asp Val
Ala Glu 675 680 685Asn Ser Ser Thr Ala Thr Asn Pro Lys Asp Ala Ser
Asp Lys Ala Asp 690 695 700Val Ile Glu Pro Asp Ser Asp Val Val Lys
Asp Ala Asp Asn Asn Ile705 710 715 720Asp Lys Asp Val Gln His Asp
Val Asp His Leu Ser Asp Met Ser Asp 725 730 735Asn Asn His Phe Asp
Lys Tyr Asp Leu Lys Glu Met Asp Thr Gln Ile 740 745 750Ala Lys Asp
Thr Asp Arg Asn Val Asp Lys Gly Ala Asp Asn Ser Val 755 760 765Gly
Met Ser Ser Asn Val Asp Thr Asp Lys Asp Ser Asn Lys Asn Lys 770 775
780Asp Lys Val Ile Gln Leu Asn His Ile Ala Asp Lys Asn Asn His
Asn785 790 795 800Gly Lys Ala Ala Lys Leu Asp Val Val Lys Gln Asn
Tyr Asn Asn Thr 805 810 815Asp Lys Val Thr Asp Lys Lys Thr Thr Glu
His Leu Pro Ser Asp Ile 820 825 830His Lys Thr Val Asp Lys Thr Val
Lys Thr Lys Glu Lys Ala Gly Thr 835 840 845Pro Ser Lys Glu Asn Lys
Leu Ser Gln Ser Lys Met Leu Pro Lys Thr 850 855 860Gly Glu Thr Thr
Ser Ser Gln Ser Trp Trp Gly Leu Tyr Ala Leu Leu865 870 875 880Gly
Met Leu Ala Leu Phe Ile Pro Lys Phe Arg Lys Glu Ser Lys 885 890
89577218DNAStaphylococcus aureus 77cattagataa agagaaacac ttaaatatgc
tagaatctag agagcaatta tcagtcgaag 60aatacgaaac attctttaac agatttgata
atcaagaatt tgatttcgaa cgtgaattga 120cacaagatcc atattcaaaa
gtatacttat acagtataga agaccatatc agaacatata 180agatagagaa
ataaactagt ggccgattgt gcttgatg 2187855PRTStaphylococcus aureus
78Met Leu Glu Ser Arg Glu Gln Leu Ser Val Glu Glu Tyr Glu Thr Phe1
5 10 15Phe Asn Arg Phe Asp Asn Gln Glu Phe Asp Phe Glu Arg Glu Leu
Thr 20 25 30Gln Asp Pro Tyr Ser Lys Val Tyr Leu Tyr Ser Ile Glu Asp
His Ile 35 40 45Arg Thr Tyr Lys Ile Glu Lys 50
5579858DNAStaphylococcus aureus 79tattcaaaca ataagtcatc gattattcat
gacatttata tatgcacttg ctatgggtat 60cgtatacttg attattttca tgtaaaggag
cgtaactgat gatagaaatt aataaccttt 120caaagcgtta ccgtaacaaa
cagattttca atcatttaac tatgtccttt gatagtaatc 180gtttaaccgt
attacttggt gataatggtg ctggaaaatc aacattactt cgtatgattg
240ctggtattga aaaagctaat gatggaacta tcaactattt cggcgaaaaa
tggaatcaaa 300gacaaataca aaatcacatc ggttatgtgc cacaagacat
tgcgttattt gaacacatga 360cagtggctga aaacattaaa ttttttaaat
cactttgtaa aaatccaatt aacgatacaa 420ctatcaacga atatttacag
caattaaact ttgatgatac gtctgccaaa gtatctacat 480tgtccggtgg
gaataaacgt aaaattaata tattagtagg tttactaggt caacctcgaa
540ttctcatttt agatgaaccg acagttggta ttgatttaaa atctagacat
gacatccacc 600aactacttaa catcatgaaa tctaaatgtt taattatatt
aactacccat catttagatg 660aagttgaagc acttgcagat gatatcaagt
taattggcca agatcctttt tatcaacatg 720ttttagagga caaacaatgg
acttatacct attattaaaa cgaaaaaatc ccaagctgcg 780tatgatatcg
caacttggga ttttctgtat tatctacttt gcaagtatga cgttgggtct
840actgcatatt gattaccg 85880219PRTStaphylococcus aureus 80Met Ile
Glu Ile Asn Asn Leu Ser Lys Arg Tyr Arg Asn Lys Gln Ile1 5 10 15Phe
Asn His Leu Thr Met Ser Phe Asp Ser Asn Arg Leu Thr Val Leu 20 25
30Leu Gly Asp Asn Gly Ala Gly Lys Ser Thr Leu Leu Arg Met Ile Ala
35 40 45Gly Ile Glu Lys Ala Asn Asp Gly Thr Ile Asn Tyr Phe Gly Glu
Lys 50 55 60Trp Asn Gln Arg Gln Ile Gln Asn His Ile Gly Tyr Val Pro
Gln Asp65 70 75 80Ile Ala Leu Phe Glu His Met Thr Val Ala Glu Asn
Ile Lys Phe Phe 85 90 95Lys Ser Leu Cys Lys Asn Pro Ile Asn Asp Thr
Thr Ile Asn Glu Tyr 100 105 110Leu Gln Gln Leu Asn Phe Asp Asp Thr
Ser Ala Lys Val Ser Thr Leu 115 120 125Ser Gly Gly Asn Lys Arg Lys
Ile Asn Ile Leu Val Gly Leu Leu Gly 130 135 140Gln Pro Arg Ile Leu
Ile Leu Asp Glu Pro Thr Val Gly Ile Asp Leu145 150 155 160Lys Ser
Arg His Asp Ile His Gln Leu Leu Asn Ile Met Lys Ser Lys 165 170
175Cys Leu Ile Ile Leu Thr Thr His His Leu Asp Glu Val Glu Ala Leu
180 185 190Ala Asp Asp Ile Lys Leu Ile Gly Gln Asp Pro Phe Tyr Gln
His Val 195 200 205Leu Glu Asp Lys Gln Trp Thr Tyr Thr Tyr Tyr 210
21581796DNAStaphylococcus aureus 81taatcaagag ttaagatgaa tttaattcat
gaacacgtct attattttta taattgtagc 60aaataaagct ttacatcaag gaggtaatta
aatatgttca aaaaatatga ctcaaaaaat 120tcaatcgtat taaaatctat
tctatcgcta ggtatcatct atgggggaac atttggaata 180tatccaaaag
cagacgcgtc aacacaaaat tcctcaagtg tacaagataa acaattacaa
240aaagttgaag aagtaccaaa taattcagaa aaagctttgg ttaaaaaact
ttacgataga 300tacagcaagg atacaataaa tggaaaatct aataaatcta
ggaattgggt ttattcagag 360agacctttaa atgaaaacca agttcgtata
catttagaag gaacatacac agttgctggc 420agagtgtata cacctaagag
gaatattact cttaataaag aagttgtcac tttaaaagaa 480ttggatcata
tcataagatt tgctcatatt tcctatggct tgtatatggg agaacatttg
540cctaaaggta acatcgtcat aaatacaaaa gatggtggta aatatacatt
agagtcgcat 600aaagagctac aaaaagatag ggaaaatgta aaaattaata
cagccgatat aaaaaatgta 660actttcaaac ttgtgaaaag tgttaatgac
attgaacaag tttgaaatta agctaaatta 720gtatatatag tgttttatcg
ctaatacttt gaaagttagg tatctaaagg tgcctagctt 780tctttgttat gattag
79682990DNAStaphylococcus aureus 82catcaatgca gcttcaacgt tataataaga
tagatgttag tcatatgtta aattgaagat 60acaagtgcca aagcctaaag gaaatgaagt
taagataaat tataggagtg ttaaagtggc 120aattttagaa gtaaaacaat
taacaaaaat atatggaact aaaaaaatgg cacaagaagt 180gttgcgagat
atcaatatgt ctattgaaga aggcgagttt attgctatta tgggtccctc
240tggatctggg aaaacgacat tattaaatgt tttaagttca attgattata
tttcacaagg 300ttctattaca ttaaaaggaa aaaaattaga aaagctttca
aacaaggaat tatctgatat 360acgcaagcat gatattggtt ttatttttca
agagtataat ttactgcata cattgactgt 420taaagaaaac ataatgttac
cactaacggt acagaagtta gataaagaac atatgttaaa 480tcgttatgaa
aaagtagcag aagcattaaa tatattggat attagtgata aatatccctc
540tgaattgtct ggtggacaaa ggcaacgaac atcagctgcc agagcattta
taacattgcc 600ttctattata tttgctgacg aaccaacagg tgcactggat
tctaaaagta ctcaagattt 660attaaaacga ttaacaagaa tgaatgaagc
atttaagtct acaattatta tggtaacgca 720tgatcctgtt gcagcaagct
atgcaaatcg agtagtgatg ctaaaagatg gtcaaatttt 780cactgaatta
taccaagggg atgacgataa acataccttt ttcaaagaaa taatacgtgt
840acaaagtgtt ttaggtggcg ttaattatga cctttaacga gataatattt
aaaaatttcc 900gtcaaaattt atcacattat gccatctatc ttttttcgtt
aattacgagt gtagtattgt 960attttagctt tgtagcatta aaatacgctc
99083253PRTStaphylococcus aureus 83Met Ala Ile Leu Glu Val Lys Gln
Leu Thr Lys Ile Tyr Gly Thr Lys1 5 10 15Lys Met Ala Gln Glu Val Leu
Arg Asp Ile Asn Met Ser Ile Glu Glu 20 25 30Gly Glu Phe Ile Ala Ile
Met Gly Pro Ser Gly Ser Gly Lys Thr Thr 35 40 45Leu Leu Asn Val Leu
Ser Ser Ile Asp Tyr Ile Ser Gln Gly Ser Ile 50 55 60Thr Leu Lys Gly
Lys Lys Leu Glu Lys Leu Ser Asn Lys Glu Leu Ser65 70 75 80Asp Ile
Arg Lys His Asp Ile Gly Phe Ile Phe Gln Glu Tyr Asn Leu 85 90 95Leu
His Thr Leu Thr Val Lys Glu Asn Ile Met Leu Pro Leu Thr Val 100 105
110Gln Lys Leu Asp Lys Glu His Met Leu Asn Arg Tyr Glu Lys Val Ala
115 120 125Glu Ala Leu Asn Ile Leu Asp Ile Ser Asp Lys Tyr Pro Ser
Glu Leu 130 135 140Ser Gly Gly Gln Arg Gln Arg Thr Ser Ala Ala Arg
Ala Phe Ile Thr145 150 155 160Leu Pro Ser Ile Ile Phe Ala Asp Glu
Pro Thr Gly Ala Leu Asp Ser 165 170 175Lys Ser Thr Gln Asp Leu Leu
Lys Arg Leu Thr Arg Met Asn Glu Ala 180 185 190Phe Lys Ser Thr Ile
Ile Met Val Thr His Asp Pro Val Ala Ala Ser 195 200 205Tyr Ala Asn
Arg Val Val Met Leu Lys Asp Gly Gln Ile Phe Thr Glu 210 215 220Leu
Tyr Gln Gly Asp Asp Asp Lys His Thr Phe Phe Lys Glu Ile Ile225 230
235 240Arg Val Gln Ser Val Leu Gly Gly Val Asn Tyr Asp Leu 245
250842456DNAStaphylococcus aureus 84agcatttata acattgcctt
ctattatatt tgctgacgaa ccaacaggtg cactggattc 60taaaagtact caagatttat
taaaacgatt aacaagaatg aatgaagcat ttaagtctac 120aattattatg
gtaacgcatg atcctgttgc agcaagctat gcaaatcgag tagtgatgct
180aaaagatggt caaattttca ctgaattata ccaaggggat gacgataaac
ataccttttt 240caaagaaata atacgtgtac aaagtgtttt aggtggcgtt
aattatgacc tttaacgaga 300taatatttaa aaatttccgt caaaatttat
cacattatgc catctatctt ttttcgttaa 360ttacgagtgt agtattgtat
tttagctttg tagcattaaa atacgctcat aaactaaaca 420tgacagagtc
atatccaatt ataaaggaag gctcacaagt cggaagctac tttctatttt
480tcatcataat tgcatttttg ttatatgcca atgtgttatt tattaaacga
cgaagttatg 540agcttgcatt atatcaaaca ttaggtttat ctaaattcaa
cattatttat atactaatgc 600tcgaacaatt actaatattt ataattacgg
caatattagg tattattatt ggtatttttg 660gttcgaaact gttattaatg
attgtcttta cattattagg aattaaagaa aaggttccaa 720ttatttttag
tttgagggcg gtatttgaaa cattaatgtt aatcggtgtc gcttattttt
780taacatctgc tcaaaatttt atattagtgt tcaaacaatc tatttcacag
atgtcaaaga 840ataaccaggt taaagaaaca aatcataata aaattacatt
tgaagaggtt gttttaggca 900tcttaggtat agtattgatt accacaggat
actatctatc tttgaacatt gttcaatatt 960atgattctat cggtacactt
atgtttattt tattgtcaac tgtgattggg gcatacttat 1020tttttaaaag
ctctgtttct ctagttttta aaatggtgaa gaagtttaga aaaggtgtta
1080taagtgtaaa tgatgtcatg ttctcatcat ctattatgta tcgtattaag
aaaaatgctt 1140tttcacttac ggtcatggca atcatttcag cgattactgt
ttcagttctt tgctttgctg 1200ctataagtag agcgtcctta tcaagtgaaa
taaaatatac tgcaccacac gacgttacaa 1260ttaaagacca acaaaaagct
aatcaattag caagtgaatt aaacaatcaa aaaattcctc 1320atttttataa
ttataaagaa gtaattcata cgaaattgta taaagataat ttatttgatg
1380taaaagcgaa agaaccatac aatgtaacaa ttactagtga taaatacatc
cctaatactg 1440atttgaaacg tgggcaagct gatttatttg tagcggaagg
ttctatcaaa gatttagtga 1500aacataagaa gcatggtaag gcaattatag
gaacgaaaaa acatcatgtt aatattaagt 1560tacgtaaaga tattaataaa
atctatttta tgacagatgt tgatttaggt ggaccaacgt 1620ttgtcttaaa
tgacaaagac tatcaagaaa taagaaagta tacaaaggca aagcatatcg
1680tctctcaatt tggattcgat ttgaaacata aaaaagatgc tttagcatta
gaaaaagcga 1740aaaataaagt tgataaatct attgaaacaa gaagtgaagc
gataagctca atatcaagtt 1800taaccggaat attattattt gtaacatcat
ttttaggtat tacattcttg attgctgtat 1860gttgcattat atacataaag
caaatagatg aaaccgaaga tgagttagag aattatagta 1920ttttgagaaa
gcttggattt acacaaaaag atatggcaag gggactaaag tttaaaatta
1980tgtttaattt tgggttacct ttagttattg cactatcaca tgcatatttt
acatcattag 2040catatatgaa attaatgggt acaacgaatc aaataccggt
tttcatagta atgggattat 2100acatttgtat gtatgctgtt tttgcagtga
cggcttataa tcattccaag cgaacaatta 2160gacattccat ataaaatata
cagatggctt tcagtagagt agtggattcg gattcacgaa 2220ctatactgga
agctttttat tataaatgaa gagaagttat atttttagca tgtatagttg
2280aatactgggt taaaatacca tattaataat gaagtaaagg tatgagtgat
tatgaaagtg 2340ttttgaatga aatatattta attggtgatg cttttaattg
aaaagattaa caggattcaa 2400ctttgtaaat tgtattaaat gtgagaaaat
aaaagtatat tcattgagag atatat 245685952DNAStaphylococcus aureus
85atacgatttt atatcttcaa caacttcata ttaatttgga tgatattgaa atacaaaaag
60tctcaattgt tgattcatac ttcaacaata aaaagcaaag gggatctaat tatgatacta
120agttacttga aaatcgaatt taaagttata atgcgtaaaa aaacaacatt
aatattatct 180attttatttc ctgttatatt ctatatatta tttacttcga
tattggaatt gccggaagat 240gttaaaccta aattttataa agagtatatg
tatagtatga cggtttatag tttgttaagt 300tttagtttac taacttttcc
attagatatt attaatgaaa aacaaaatga atggcgccaa 360agattaatgg
taacaccatt tacttttact agttattata tttcaaaagt agtgaaaact
420atgctgcaat ttgcaatagc gatattagtt atttttatgg ttggacattt
ttataaaggt 480gttgcaatga gtgcagttca atggttagag tcaggaatat
ttttatggtt aggtgcgtct 540ctattaataa cttttggcat attattttct
ttgttaaatg atattcaaaa aacaagtgct 600ttagctaata tcgtaacaat
tggtttagca gtattaggtg gattgtggtt tccgataaac 660acatttccaa
attggcttca acatgttgct catgttttac cgagctatca tttgcgtaaa
720ctaggtgtag atattgcttc aaatcatcat atcaatttaa tatcatttgc
tataatactc 780ttgtatgctt tagggagtat aatagcagta tattgtatta
gtcattttaa aagggcggaa 840taaaatatga aatttttaaa agatacttca
attgctgaaa tatcgtctat actttatctg 900atttttccta ttgccggtat
attttttaat gaagtatatg gtcccaaatg gt 95286243PRTStaphylococcus
aureus 86Met Ile Leu Ser Tyr Leu Lys Ile Glu Phe Lys Val Ile Met
Arg Lys1 5 10 15Lys Thr Thr Leu Ile Leu Ser Ile Leu Phe Pro Val Ile
Phe Tyr Ile 20 25 30Leu Phe Thr Ser Ile Leu Glu Leu Pro Glu Asp Val
Lys Pro Lys Phe 35 40 45Tyr Lys Glu Tyr Met Tyr Ser Met Thr Val Tyr
Ser Leu Leu Ser Phe 50 55 60Ser Leu Leu Thr Phe Pro Leu Asp Ile Ile
Asn Glu Lys Gln Asn Glu65 70 75 80Trp Arg Gln Arg Leu Met Val Thr
Pro Phe Thr Phe Thr Ser Tyr Tyr 85 90 95Ile Ser Lys Val Val Lys Thr
Met Leu Gln Phe Ala Ile Ala Ile Leu 100 105 110Val Ile Phe Met Val
Gly His Phe Tyr Lys Gly Val Ala Met Ser Ala 115 120 125Val Gln Trp
Leu Glu Ser Gly Ile Phe Leu Trp Leu Gly Ala Ser Leu 130 135 140Leu
Ile Thr Phe Gly Ile Leu Phe Ser Leu Leu
Asn Asp Ile Gln Lys145 150 155 160Thr Ser Ala Leu Ala Asn Ile Val
Thr Ile Gly Leu Ala Val Leu Gly 165 170 175Gly Leu Trp Phe Pro Ile
Asn Thr Phe Pro Asn Trp Leu Gln His Val 180 185 190Ala His Val Leu
Pro Ser Tyr His Leu Arg Lys Leu Gly Val Asp Ile 195 200 205Ala Ser
Asn His His Ile Asn Leu Ile Ser Phe Ala Ile Ile Leu Leu 210 215
220Tyr Ala Leu Gly Ser Ile Ile Ala Val Tyr Cys Ile Ser His Phe
Lys225 230 235 240Arg Ala Glu871081DNAStaphylococcus aureus
87gttgttatta tcaatacgat tgctgattta ttaacgttat tacttgatcc gaagcagcgt
60ttacaattag gaaatccaaa aatcaaaacc aatacaccat tgatatcaga aagtagtgac
120cgtcatgcat aaaatatttt caaagaataa cctgatattt tttgtattcg
ttgcatttat 180ttttgtggta attgtactgc aattctttgt cagtagtgaa
aatgcaacca aagtcaattt 240atcacaaact tttgaaccta ttagttggtt
gcatttatta ggaactgatg attatgggag 300agatttattt acccgaatta
ttatcggtgc acgttcaaca ttgtttgtta ctgttttaac 360attaatagct
atcgttgtca taggtgttac actaggtcta tttgccggat acaaaaaagg
420gtggattgaa cgattagtgt taaggtttat tgatgttggt ctaagtattc
cagaatttat 480catcatgatt gctttagcaa gtttttttca accatcttta
tggaatttag ttatctcaat 540tacattaata aaatggatga attacacaag
gttgactaga agtatagtta atagcgaaat 600gaataagcct tatataaaaa
tggcacaatt atttcatgta ccaacaagaa caatattaat 660acgtcattta
acacctaaaa ttataccggc tattatcgtt ttgatggtcg ttgatttcgg
720taaaatcatt ctatatataa gttcactatc atttattggg ttaggtgcac
aaccgccaac 780accagagtgg ggcgctatgt tgcaacaagg tcgtgatttt
atttcgtctc atccaattat 840gttgattgca cctgcttcag tcattgctat
aactatttta atttttaatt taaccggtga 900tgcactaaga gatagattgc
tgaaacaacg gggtgaatat gatgagtctc attgatatac 960aaaatttaac
aataaagaat actagtgaga aatctcttat taaagggatt gatttgaaaa
1020tttttagtca acagattaat gccttgattg gagagagcgg cgctggaaaa
agtttgattg 1080c 108188276PRTStaphylococcus aureus 88Met His Lys
Ile Phe Ser Lys Asn Asn Leu Ile Phe Phe Val Phe Val1 5 10 15Ala Phe
Ile Phe Val Val Ile Val Leu Gln Phe Phe Val Ser Ser Glu 20 25 30Asn
Ala Thr Lys Val Asn Leu Ser Gln Thr Phe Glu Pro Ile Ser Trp 35 40
45Leu His Leu Leu Gly Thr Asp Asp Tyr Gly Arg Asp Leu Phe Thr Arg
50 55 60Ile Ile Ile Gly Ala Arg Ser Thr Leu Phe Val Thr Val Leu Thr
Leu65 70 75 80Ile Ala Ile Val Val Ile Gly Val Thr Leu Gly Leu Phe
Ala Gly Tyr 85 90 95Lys Lys Gly Trp Ile Glu Arg Leu Val Leu Arg Phe
Ile Asp Val Gly 100 105 110Leu Ser Ile Pro Glu Phe Ile Ile Met Ile
Ala Leu Ala Ser Phe Phe 115 120 125Gln Pro Ser Leu Trp Asn Leu Val
Ile Ser Ile Thr Leu Ile Lys Trp 130 135 140Met Asn Tyr Thr Arg Leu
Thr Arg Ser Ile Val Asn Ser Glu Met Asn145 150 155 160Lys Pro Tyr
Ile Lys Met Ala Gln Leu Phe His Val Pro Thr Arg Thr 165 170 175Ile
Leu Ile Arg His Leu Thr Pro Lys Ile Ile Pro Ala Ile Ile Val 180 185
190Leu Met Val Val Asp Phe Gly Lys Ile Ile Leu Tyr Ile Ser Ser Leu
195 200 205Ser Phe Ile Gly Leu Gly Ala Gln Pro Pro Thr Pro Glu Trp
Gly Ala 210 215 220Met Leu Gln Gln Gly Arg Asp Phe Ile Ser Ser His
Pro Ile Met Leu225 230 235 240Ile Ala Pro Ala Ser Val Ile Ala Ile
Thr Ile Leu Ile Phe Asn Leu 245 250 255Thr Gly Asp Ala Leu Arg Asp
Arg Leu Leu Lys Gln Arg Gly Glu Tyr 260 265 270Asp Glu Ser His
27589535DNAStaphylococcus aureus 89cttatgatta caatggctta tcagaaaatg
cgaatgaagt ttaaaaaggg agctaatatc 60aatgaataca aatgatgcta ttaaaatttt
aaaagagaac ggtttaaaat atacagataa 120acgtaaagat atgttagata
tttttgtcga agaagataag tatataaacg caaagtatat 180acaacaagtt
atggatgaaa attatcctgg aatttcattc gacacaatat atagaaacct
240gcacttattt aaagatttag gaattattga aaatacagaa cttgatggtg
aaatgaagtt 300tagaatcgct tgtacaaacc atcatcatca tcattttatc
tgtgaaaagt gtggagatac 360aaaggtaata gattattgtc caatagatca
gataaaatta tcactacctg gtgttaatat 420tcacaaacac aaacttgaag
tttatggtgt atgtgagtct tgccaagatt aatataaaga 480aatgagattt
atgcacattt ggtcagatgt atgcataaat ctcatttttt aaatt
53590136PRTStaphylococcus aureus 90Met Asn Thr Asn Asp Ala Ile Lys
Ile Leu Lys Glu Asn Gly Leu Lys1 5 10 15Tyr Thr Asp Lys Arg Lys Asp
Met Leu Asp Ile Phe Val Glu Glu Asp 20 25 30Lys Tyr Ile Asn Ala Lys
Tyr Ile Gln Gln Val Met Asp Glu Asn Tyr 35 40 45Pro Gly Ile Ser Phe
Asp Thr Ile Tyr Arg Asn Leu His Leu Phe Lys 50 55 60Asp Leu Gly Ile
Ile Glu Asn Thr Glu Leu Asp Gly Glu Met Lys Phe65 70 75 80Arg Ile
Ala Cys Thr Asn His His His His His Phe Ile Cys Glu Lys 85 90 95Cys
Gly Asp Thr Lys Val Ile Asp Tyr Cys Pro Ile Asp Gln Ile Lys 100 105
110Leu Ser Leu Pro Gly Val Asn Ile His Lys His Lys Leu Glu Val Tyr
115 120 125Gly Val Cys Glu Ser Cys Gln Asp 130
13591912DNAStaphylococcus aureus 91attgaaactc aaattcaaca aacttcaact
gaaaaaatag caacagaaaa aacatcgtat 60ctaataaatt atatgaacgc tgtggcatag
aaaggcggcg aaacatgaca cacaaatata 120tatcaacgca aatgttgatc
atttttactg cattaatgat tattgccaat ttttactaca 180tattttttga
aaaaattggc tttttactcg ttctattatt gggatgtgta ttagtttatg
240taggatatct ttattttcat aaaatacgtg gccttttggc gttttggata
ggcgcgctat 300taattgcatt cacattattg tctaataagt atacaatcat
catcttgttc gtctttttat 360tattacttat tgtgcgttat ttaatacaca
agtttaaacc aaaaaaagta gttgcgacgg 420atgaggttat gacttcacca
tcttttatta aacaaaagtg gtttggtgag caacgtacac 480cagtttatgt
atataagtgg gaagatgtac aaattcaaca tggaattggc gacctacata
540ttgacttaac aaaagctgca aatattaagg aaaataatac cattgttgtt
agacacattt 600taggtaaagt gcaggttata ttgccggtta attacaatat
taatttacat gtagctgctt 660tttatggaag tacttacgtg aatgaaaaat
catataaagt tgaaaataac aatattcata 720ttgaagaaat gatgaaaccg
gataactata cagttaatat ctacgtatca acgtttatcg 780gagacgtaga
ggtgatttat cgatgaacca ctacattaga acaattggtt caatgctcat
840cttagtatat agcatgctag ctgcatttct gttcatcgat aaagtttttg
taaatatcat 900ctattttcaa gg 91292233PRTStaphylococcus aureus 92Met
Thr His Lys Tyr Ile Ser Thr Gln Met Leu Ile Ile Phe Thr Ala1 5 10
15Leu Met Ile Ile Ala Asn Phe Tyr Tyr Ile Phe Phe Glu Lys Ile Gly
20 25 30Phe Leu Leu Val Leu Leu Leu Gly Cys Val Leu Val Tyr Val Gly
Tyr 35 40 45Leu Tyr Phe His Lys Ile Arg Gly Leu Leu Ala Phe Trp Ile
Gly Ala 50 55 60Leu Leu Ile Ala Phe Thr Leu Leu Ser Asn Lys Tyr Thr
Ile Ile Ile65 70 75 80Leu Phe Val Phe Leu Leu Leu Leu Ile Val Arg
Tyr Leu Ile His Lys 85 90 95Phe Lys Pro Lys Lys Val Val Ala Thr Asp
Glu Val Met Thr Ser Pro 100 105 110Ser Phe Ile Lys Gln Lys Trp Phe
Gly Glu Gln Arg Thr Pro Val Tyr 115 120 125Val Tyr Lys Trp Glu Asp
Val Gln Ile Gln His Gly Ile Gly Asp Leu 130 135 140His Ile Asp Leu
Thr Lys Ala Ala Asn Ile Lys Glu Asn Asn Thr Ile145 150 155 160Val
Val Arg His Ile Leu Gly Lys Val Gln Val Ile Leu Pro Val Asn 165 170
175Tyr Asn Ile Asn Leu His Val Ala Ala Phe Tyr Gly Ser Thr Tyr Val
180 185 190Asn Glu Lys Ser Tyr Lys Val Glu Asn Asn Asn Ile His Ile
Glu Glu 195 200 205Met Met Lys Pro Asp Asn Tyr Thr Val Asn Ile Tyr
Val Ser Thr Phe 210 215 220Ile Gly Asp Val Glu Val Ile Tyr Arg225
230931017DNAStaphylococcus aureus 93ggcagaaatg cgtaaaaatg
aagtgtttta tttatttaaa tagtctgaca attaagggtg 60ttatgttaat atgattttat
gagaagtatg gagtagcaat aaaggggtga cctcgcatgt 120taattcaatt
agatcaaatt gggcgaatga agcaaggaaa aacaatttta aaaaagattt
180cttggcaaat tgctaaaggt gataaatgga tattatatgg gttgaatggt
gctggcaaga 240caacacttct aaatatttta aatgcgtatg agcctgcaac
atctggaact gttaaccttt 300tcggtaaaat gccaggcaag gtagggtatt
ctgcagagac tgtacgacaa catataggtt 360ttgtatctca tagtttactg
gaaaagtttc aagagggtga aagagtaatc gatgtggtga 420taagcggtgc
ctttaaatca attggtgttt atcaagatat tgatgatgag atacgtaatg
480aagcacatca attacttaaa ttagttggaa tgtctgctaa agcgcaacaa
tatattggtt 540atttatctac cggtgaaaaa caacgagtga tgattgcacg
agctttaatg gggcaacccc 600aggttttaat tttagatgag ccagcagctg
gtttagactt tattgcacga gaatcgttgt 660taagtatact tgactcattg
tcagattcat atccaacgct tgcgatgatt tatgtgacgc 720actttattga
agaaataact gctaactttt ccaaaatttt actgctaaaa gatggccaaa
780gtattcaaca aggcgctgta gaagacatat taacttctga aaacatgtca
cgatttttcc 840agaaaaatgt agcagttcaa agatggaata atcgattttc
tatggcaatg ttagagtaaa 900tattttgcaa ataataagta ataatgacaa
aatttaatta agataaaatg gacagtggag 960ggcaatatag ataacgtaaa
agcaatattt ttggacatgg atggaacaat tttacat 101794260PRTStaphylococcus
aureus 94Met Leu Ile Gln Leu Asp Gln Ile Gly Arg Met Lys Gln Gly
Lys Thr1 5 10 15Ile Leu Lys Lys Ile Ser Trp Gln Ile Ala Lys Gly Asp
Lys Trp Ile 20 25 30Leu Tyr Gly Leu Asn Gly Ala Gly Lys Thr Thr Leu
Leu Asn Ile Leu 35 40 45Asn Ala Tyr Glu Pro Ala Thr Ser Gly Thr Val
Asn Leu Phe Gly Lys 50 55 60Met Pro Gly Lys Val Gly Tyr Ser Ala Glu
Thr Val Arg Gln His Ile65 70 75 80Gly Phe Val Ser His Ser Leu Leu
Glu Lys Phe Gln Glu Gly Glu Arg 85 90 95Val Ile Asp Val Val Ile Ser
Gly Ala Phe Lys Ser Ile Gly Val Tyr 100 105 110Gln Asp Ile Asp Asp
Glu Ile Arg Asn Glu Ala His Gln Leu Leu Lys 115 120 125Leu Val Gly
Met Ser Ala Lys Ala Gln Gln Tyr Ile Gly Tyr Leu Ser 130 135 140Thr
Gly Glu Lys Gln Arg Val Met Ile Ala Arg Ala Leu Met Gly Gln145 150
155 160Pro Gln Val Leu Ile Leu Asp Glu Pro Ala Ala Gly Leu Asp Phe
Ile 165 170 175Ala Arg Glu Ser Leu Leu Ser Ile Leu Asp Ser Leu Ser
Asp Ser Tyr 180 185 190Pro Thr Leu Ala Met Ile Tyr Val Thr His Phe
Ile Glu Glu Ile Thr 195 200 205Ala Asn Phe Ser Lys Ile Leu Leu Leu
Lys Asp Gly Gln Ser Ile Gln 210 215 220Gln Gly Ala Val Glu Asp Ile
Leu Thr Ser Glu Asn Met Ser Arg Phe225 230 235 240Phe Gln Lys Asn
Val Ala Val Gln Arg Trp Asn Asn Arg Phe Ser Met 245 250 255Ala Met
Leu Glu 26095818DNAStaphylococcus aureus 95gacgtctttg gtaacaagcc
atgaaaagat acacatggta gatatgtatt tcaagattat 60tcaatgaata tcgaattata
ggaggagata tgtatgaaaa gattagttac agggttacta 120gcattatcat
tatttttagc tgcatgtggt caagatagtg accaacaaaa agacggtaat
180aaagaaaaag atgataaagc gaaaactgaa caacaagata aaaaaacaaa
tgattcatct 240aaagataaga aagataataa agatgatagt aaagacgtaa
acaaagataa taaagataat 300agtgcaaacg ataaccagca acaatctaat
tcaaatgcaa caaacaatga ccaaaaccaa 360acaaataata accaatcaag
taataaccaa gcgaataata atcaaaaatc aagttacgtt 420gcaccatatt
atggacaaaa tgccgcgccg gttgcacgtc aaatttatcc gtttaatgga
480aataaaaatc aagctttaca gcaattgcca aatttccaaa cagctttaaa
tgcggctaat 540aatgaagcaa ataaatttgg tagtaataat aaagtgtata
atgattattc tattgaagaa 600cataatggca actataagta tgtgtttagt
tttaaagacc caaatgcaaa tggaaaatat 660tcaattgtaa cggttgatta
tactggacaa gcaatggtta ctgatccaaa ctaccaacaa 720taatgttaat
ataactatga tgcaagttaa aaaataaaac ggtaaactct ataatatgaa
780ttagggttta ccgttttttg cgtattttaa agtatcaa
81896209PRTStaphylococcus aureus 96Met Lys Arg Leu Val Thr Gly Leu
Leu Ala Leu Ser Leu Phe Leu Ala1 5 10 15Ala Cys Gly Gln Asp Ser Asp
Gln Gln Lys Asp Gly Asn Lys Glu Lys 20 25 30Asp Asp Lys Ala Lys Thr
Glu Gln Gln Asp Lys Lys Thr Asn Asp Ser 35 40 45Ser Lys Asp Lys Lys
Asp Asn Lys Asp Asp Ser Lys Asp Val Asn Lys 50 55 60Asp Asn Lys Asp
Asn Ser Ala Asn Asp Asn Gln Gln Gln Ser Asn Ser65 70 75 80Asn Ala
Thr Asn Asn Asp Gln Asn Gln Thr Asn Asn Asn Gln Ser Ser 85 90 95Asn
Asn Gln Ala Asn Asn Asn Gln Lys Ser Ser Tyr Val Ala Pro Tyr 100 105
110Tyr Gly Gln Asn Ala Ala Pro Val Ala Arg Gln Ile Tyr Pro Phe Asn
115 120 125Gly Asn Lys Asn Gln Ala Leu Gln Gln Leu Pro Asn Phe Gln
Thr Ala 130 135 140Leu Asn Ala Ala Asn Asn Glu Ala Asn Lys Phe Gly
Ser Asn Asn Lys145 150 155 160Val Tyr Asn Asp Tyr Ser Ile Glu Glu
His Asn Gly Asn Tyr Lys Tyr 165 170 175Val Phe Ser Phe Lys Asp Pro
Asn Ala Asn Gly Lys Tyr Ser Ile Val 180 185 190Thr Val Asp Tyr Thr
Gly Gln Ala Met Val Thr Asp Pro Asn Tyr Gln 195 200
205Gln971716DNAStaphylococcus aureus 97gttgaaaatg ataatgccaa
attatgctat atctataaat ttagagcgcg atttgcagta 60cttgcacatc ttttaacaca
gcgggaaggc ttaccagcta aacaagatgt cattgaaaat 120tatcaaaaaa
atcaaatgta tttagatgat tattcatgtt gtgaagtgtc atgcacatgt
180tagaagtgaa atatgatatg agaactgggc attatacgcc catacctaat
gaacctcatt 240atttggttat tagtcatgcg gataaactta ccgcaacaga
aaaagcgaaa ttaagattat 300taatcataaa acagaaatta gatatttcat
tggcagaaag tgtagtttct tcgcctatag 360cgagtgaaca tgtgatagaa
caattgacac tatttcaaca tgagcgacga catttaagac 420ctaaaataag
tgcgacattt ttagcctggt tgttgatatt tttaatgttt gcattgccaa
480tcggtatcgc ttatcaattt tcagattggt ttcaaaatca gtatgtgtca
gcatggatag 540aatatttaac tcaaacaaca ttgctcaatc acgatatatt
acagcatata ttatttggtg 600attatggtgt gctatcactt ggaacatatt
cgctcgtatg ggcattgccg gttgtaatat 660tgattagttt atcaactgct
ataattgatc aaacaggact caaatcatgg atgatatggg 720caattgaacc
gtcaatgtta tggataggat tacaaggtaa tgatatcgtg ccactattag
780aagggtttgg atgtaatgca gcagctattt cacaagcagc acaccaatgc
catacctgca 840cgaagacaca gtgtatgagt ttaataagct ttggtagttc
ttgtagttat caaataggtg 900cgacattatc tatttttagt gtagctggaa
agtcatggct atttatgccg tacttaatat 960tagtactttt aggtggcatc
ttacataata ggatatggtt gaaaaagaat gatcaacaac 1020ttagcgttcc
gctaccttat gataggcaat tacatatgcc aaatatacgt caaatgttgc
1080tacaaatgtg gcaaaatata caaatgttta tcgttcaagc gctacctatt
tttatcacaa 1140tctgtcttat tgttagtatt ttatcactaa cgccaatttt
gaatgtttta tcacaaatat 1200ttacacctat attatcgtta ttaggcatct
cgtcagaatt gtcaccaggg attttatttt 1260caatgattcg aaaagacggc
atgctcttgt ttaatttgca tcagggcgcc ttattacaag 1320gaatgacagc
aacacagtta ctactacttg tgttttttag ttcaacattt acagcgtgct
1380cggtcacaat gacgatgctt ttgaaacatt taggtggtca gtcagcacta
aaattaattg 1440gaaagcaaat ggtgacatca ttgtctttag ttattggtgt
aggcatcatt gttaaaatag 1500taatgctgat tatttaaaaa aaatgaacta
taactgaata tagagtcatg tcagtcaata 1560ggagatctat cttggaatat
gctattcata tgaagtataa gaggagagtc gcagatgaaa 1620atagttatta
taggtgggtt tttaggtggc ggtaaaacga ctgtcttaaa tcatttgctc
1680gctgaatcat taaaggaatc gctgaaacca gcagtc
171698439PRTStaphylococcus aureus 98Met Arg Thr Gly His Tyr Thr Pro
Ile Pro Asn Glu Pro His Tyr Leu1 5 10 15Val Ile Ser His Ala Asp Lys
Leu Thr Ala Thr Glu Lys Ala Lys Leu 20 25 30Arg Leu Leu Ile Ile Lys
Gln Lys Leu Asp Ile Ser Leu Ala Glu Ser 35 40 45Val Val Ser Ser Pro
Ile Ala Ser Glu His Val Ile Glu Gln Leu Thr 50 55 60Leu Phe Gln His
Glu Arg Arg His Leu Arg Pro Lys Ile Ser Ala Thr65 70 75 80Phe Leu
Ala Trp Leu Leu Ile Phe Leu Met Phe Ala Leu Pro Ile Gly 85 90 95Ile
Ala Tyr Gln Phe Ser Asp Trp Phe Gln Asn Gln Tyr Val Ser Ala 100 105
110Trp Ile Glu Tyr Leu Thr Gln Thr Thr Leu Leu Asn His Asp Ile Leu
115 120 125Gln His Ile Leu Phe Gly Asp Tyr Gly Val Leu Ser Leu Gly
Thr Tyr 130 135 140Ser Leu Val Trp Ala Leu Pro Val Val Ile Leu Ile
Ser Leu Ser Thr145 150 155 160Ala Ile Ile Asp Gln Thr Gly Leu Lys
Ser Trp Met Ile Trp Ala Ile 165 170 175Glu Pro Ser Met Leu Trp Ile
Gly Leu Gln Gly Asn Asp Ile Val Pro 180
185 190Leu Leu Glu Gly Phe Gly Cys Asn Ala Ala Ala Ile Ser Gln Ala
Ala 195 200 205His Gln Cys His Thr Cys Thr Lys Thr Gln Cys Met Ser
Leu Ile Ser 210 215 220Phe Gly Ser Ser Cys Ser Tyr Gln Ile Gly Ala
Thr Leu Ser Ile Phe225 230 235 240Ser Val Ala Gly Lys Ser Trp Leu
Phe Met Pro Tyr Leu Ile Leu Val 245 250 255Leu Leu Gly Gly Ile Leu
His Asn Arg Ile Trp Leu Lys Lys Asn Asp 260 265 270Gln Gln Leu Ser
Val Pro Leu Pro Tyr Asp Arg Gln Leu His Met Pro 275 280 285Asn Ile
Arg Gln Met Leu Leu Gln Met Trp Gln Asn Ile Gln Met Phe 290 295
300Ile Val Gln Ala Leu Pro Ile Phe Ile Thr Ile Cys Leu Ile Val
Ser305 310 315 320Ile Leu Ser Leu Thr Pro Ile Leu Asn Val Leu Ser
Gln Ile Phe Thr 325 330 335Pro Ile Leu Ser Leu Leu Gly Ile Ser Ser
Glu Leu Ser Pro Gly Ile 340 345 350Leu Phe Ser Met Ile Arg Lys Asp
Gly Met Leu Leu Phe Asn Leu His 355 360 365Gln Gly Ala Leu Leu Gln
Gly Met Thr Ala Thr Gln Leu Leu Leu Leu 370 375 380Val Phe Phe Ser
Ser Thr Phe Thr Ala Cys Ser Val Thr Met Thr Met385 390 395 400Leu
Leu Lys His Leu Gly Gly Gln Ser Ala Leu Lys Leu Ile Gly Lys 405 410
415Gln Met Val Thr Ser Leu Ser Leu Val Ile Gly Val Gly Ile Ile Val
420 425 430Lys Ile Val Met Leu Ile Ile 43599720DNAstaphylococcus
aureus 99atgaataaaa atatagtcat taaaagcatg gcagcattag ccattctaac
ctcagtaact 60ggaataaatg ctgcagtcgt tgaagagaca caacaaatag caaatgcaga
gaagaatgtt 120acgcaagtta aagatacaaa tatttttcca tataatggcg
tcgtttcatt taaagatgcg 180acaggttttg taattggaaa aaatacaatt
atcaccaata aacatgtatc aaaagattat 240aaagttggcg atagaattac
tgcccatcca aacggtgaca aaggaaatgg tggtatatat 300aaaattaaaa
gcatttctga ttatccgggt gatgaagaca tctctgtcat gaatattgaa
360gaacaagcag tcgaacgtgg accaaaaggc tttaatttta atgaaaatgt
ccaagcattc 420aattttgcga aagatgctaa agttgatgac aaaattaaag
ttattggtta cccattacct 480gctcaaaata gttttaaaca gtttgaatct
acaggaacta taaaaagaat caaagacaat 540attttaaatt ttgatgcata
cattgaaccc gggaattcag gatcaccagt tctaaattct 600aacaatgagg
tcataggtgt ggtgtatggc ggtattggaa aaattggttc tgaatataat
660ggtgccgtat actttacgcc tcaaatcaaa gattttattc aaaagcacat
tgaacaataa 720100239PRTstaphylococcus aureus 100Met Asn Lys Asn Ile
Val Ile Lys Ser Met Ala Ala Leu Ala Ile Leu1 5 10 15Thr Ser Val Thr
Gly Ile Asn Ala Ala Val Val Glu Glu Thr Gln Gln 20 25 30Ile Ala Asn
Ala Glu Lys Asn Val Thr Gln Val Lys Asp Thr Asn Ile 35 40 45Phe Pro
Tyr Asn Gly Val Val Ser Phe Lys Asp Ala Thr Gly Phe Val 50 55 60Ile
Gly Lys Asn Thr Ile Ile Thr Asn Lys His Val Ser Lys Asp Tyr65 70 75
80Lys Val Gly Asp Arg Ile Thr Ala His Pro Asn Gly Asp Lys Gly Asn
85 90 95Gly Gly Ile Tyr Lys Ile Lys Ser Ile Ser Asp Tyr Pro Gly Asp
Glu 100 105 110Asp Ile Ser Val Met Asn Ile Glu Glu Gln Ala Val Glu
Arg Gly Pro 115 120 125Lys Gly Phe Asn Phe Asn Glu Asn Val Gln Ala
Phe Asn Phe Ala Lys 130 135 140Asp Ala Lys Val Asp Asp Lys Ile Lys
Val Ile Gly Tyr Pro Leu Pro145 150 155 160Ala Gln Asn Ser Phe Lys
Gln Phe Glu Ser Thr Gly Thr Ile Lys Arg 165 170 175Ile Lys Asp Asn
Ile Leu Asn Phe Asp Ala Tyr Ile Glu Pro Gly Asn 180 185 190Ser Gly
Ser Pro Val Leu Asn Ser Asn Asn Glu Val Ile Gly Val Val 195 200
205Tyr Gly Gly Ile Gly Lys Ile Gly Ser Glu Tyr Asn Gly Ala Val Tyr
210 215 220Phe Thr Pro Gln Ile Lys Asp Phe Ile Gln Lys His Ile Glu
Gln225 230 23510114PRTArtificial
sequenceConsensusmisc_feature(1)..(2)Xaa can be any naturally
occurring amino acidmisc_feature(1)..(2)Xaa can be any naturally
occurring amino acidmisc_feature(11)..(11)Xaa can be any naturally
occurring amino acid 101Xaa Xaa Thr Ile Asn Gly Lys Ser Asn Lys Xaa
Arg Asn Trp1 5 1010215PRTArtificial
sequenceConsensusmisc_feature(2)..(2)Xaa can be any naturally
occurring amino acid 102Lys Xaa Gly Gly Lys Tyr Thr Leu Glu Ser His
Lys Glu Leu Gln1 5 10 15
* * * * *
References