Selection Of Cancer Mutations For Generation Of A Personalized Cancer Vaccine

Abstract

The present invention relates to a method for selecting cancer neoantigens for use in a personalized vaccine. This invention relates as well to a method for constructing a vector or collection of vectors carrying the neoantigens for a personalized vaccine. This invention further relates to vector and collection of vectors comprising the personalized genetic vaccine and the use of said vectors in cancer treatment.

Description

[0001] The present invention relates to a method for selecting cancer neoantigens for use in a personalized vaccine. This invention relates as well to a method for constructing a vector or collection of vectors carrying the neoantigens for a personalized vaccine. This invention further relates to vectors and collection of vectors comprising the personalized vaccine and the use of said vectors in cancer treatment.

BACKGROUND OF THE INVENTION

[0002] Several tumor antigens have been identified and classified into different categories: cancer-germ-line, tissue differentiation antigens and neoantigens derived from mutated self-proteins (Anderson et al., 2012). Whether the immune responses against self-antigens have an impact on tumor growth is a matter of debate (reviewed in Anderson et al., 2012). In contrast, recent compelling evidences support the notion that neoantigens, generated in the tumor as a consequence of mutations in coding sequences of expressed genes, represent a promising target for vaccination against cancer (Fritsch et al., 2014).

[0003] Cancer neoantigens are antigens present exclusively on tumor cells and not on normal cells. Neoantigens are generated by DNA mutations in tumor cells and have been shown to play a significant role in recognition and killing of tumor cells by the T cell mediated immune response, mainly by CD8.sup.+ T cells (Yarchoan et al., 2017). The advent of massively parallel sequencing methods commonly referred to as next generation sequencing (NGS), which allows to determine the complete sequence of a cancer genome in a timely and inexpensive manner, unveiled the mutational spectra of human tumors (Kandoth et al., 2013). The most frequent type of mutation is a single nucleotide variant and the median number of single nucleotide variants found in tumors varies considerably according to their histology. Since very few mutations are generally shared among patients, the identification of mutations generating neoantigens requires a personalized approach.

[0004] Many mutations are indeed not seen by the immune system because either potential epitopes are not processed/presented by the tumor cells or because immune tolerance led to elimination of T cells reactive with the mutated sequence. Therefore, it is beneficial to select, among all potential neoantigens, those having the highest chance to be immunogenic, to define the optimal number to be encoded by a vaccine and finally a preferred vaccine layout for optimizing immunogenicity. Furthermore not only neoantigens generated by single nucleotide variant mutations but also neoantigens generated by insertions/deletion mutations that generate a frameshift peptide are important, the latter is expected to be particular immunogenic. Recently two different personalized vaccination approaches based either on RNA or on peptides have been evaluated in phase-I clinical studies. The data obtained shows that vaccination indeed can both expand pre-existing neoantigen-specific T cells and induce a broader repertoire of new T-cell specificity in cancer patients (Sahin et al., 2017). The main limitation of both approaches is the maximum number of neoantigens that are targeted by the vaccination. The upper limit for the peptide-based approach, based on their published data, is of twenty peptides and was not reached in all patients because in some cases peptides could not be synthesized. The described upper limit for the RNA-based approach is even lower, since they include only 10 mutations in each vaccine (Sahin et al., 2017).

[0005] The challenge for a cancer vaccine in curing cancer is to induce a diverse population of immune T cells capable of recognizing and eliminating as large a number of cancer cells as possible at once, to decrease the chance that cancer cells can "escape" the T cell response and are not being recognized by the immune response. Therefore, it is desirable that the vaccine encodes a large number of cancer specific antigens, i.e. neoantigens. This is particular relevant for a personalized genetic vaccine approach based on cancer specific neoantigens of an individual. In order to optimize the probability of success as many neoantigens as possible should be targeted by the vaccine. Moreover, experimental data support the notion that effective immunogenic neoantigens in patients cover a broad range of predicted affinities for the patient's MHC alleles (e.g. Gros et al., 2016). Most of the current prioritization methods instead apply an affinity threshold, for example the frequently used 500 nM limit, that may limit the selection of immunogenic neoantigens. There is therefore a need for a priorization method that avoids the limitations of current methods (e.g. exclusion due to low predicted affinity) and for a vaccination approach that allows for a personalized vaccine targeting a large and therefore broader and more complete set of neoantigens.

SUMMARY OF THE INVENTION

[0006] In a first aspect, the present invention provides a method for selecting cancer neoantigens for use in a personalized vaccine comprising the steps of: [0007] (a) determining neoantigens in a sample of cancerous cells obtained from an individual, wherein each neoantigen [0008] is comprised within a coding sequence, [0009] comprises at least one mutation in the coding sequence resulting in a change of the encoded amino acid sequence that is not present in a sample of non-cancerous cells of said individual, and [0010] consists of 9 to 40, preferably 19 to 31, more preferably 23 to 25, most preferably 25 contiguous amino acids of the coding sequence in the sample of cancerous cells, [0011] (b) determine for each neoantigen the mutation allele frequency of each of said mutations of step (a) within the coding sequence, [0012] (c) determining the expression level of each coding sequence comprising at least one of said mutations, [0013] (i) in said sample of cancerous cells, or [0014] (ii) from an expression database of the same cancer type as the sample of cancerous cells, [0015] (d) predicting the MHC class I binding affinity of the neoantigens, wherein [0016] (I) the HLA class I alleles are determined from the sample of non-cancerous cells of said individual, [0017] (II) for each HLA class I allele determined in (I) the MHC class I binding affinity of each fragment consisting of 8 to 15, preferably 9 to 10, more preferably 9, contiguous amino acids of the neoantigen is predicted, wherein each fragment is comprising at least one amino acid change caused by the mutation of step (a), and [0018] (III) the fragment with the highest MHC class I binding affinity determines the MHC class I binding affinity of the neoantigen, [0019] (e) ranking the neoantigens according to the values determined in steps (b) to (d) for each neoantigen from highest to lowest values, yielding a first, a second and a third list of ranks, [0020] (f) calculating a rank sum from said first, second and third list of ranks and ordering the neoantigens by increasing rank sum, yielding a ranked list of neoantigens, [0021] (g) selecting 30-240, preferably 40-80, more preferably 60, neoantigens from the ranked list of neoantigens obtained in (f) starting with the lowest rank.

[0022] In a second aspect, the present invention provides a method for constructing a personalized vector encoding a combination of neoantigens according to the first aspect of the invention for use as a vaccine, comprising the steps of: [0023] (i) ordering the list of neoantigens in at least 10{circumflex over ( )}5-10{circumflex over ( )}8, preferably 10{circumflex over ( )}6 different combinations, [0024] (ii) generating all possible pairs of neoantigen junction segments for each combination, wherein each junction segment comprises 15 adjoining contiguous amino acids on either side of the junction, [0025] (iii) predicting the MHC class I and/or class II binding affinity for all epitopes in junction segments wherein only HLA alleles are tested that are present in the individual the vector is designed for, and [0026] (iv) selecting the combination of neoantigens with the lowest number of junctional epitopes with an IC50 of .ltoreq.1500 nM and wherein if multiple combinations have the same lowest number of junctional epitopes the combination first encountered is selected.

[0027] In a third aspect, the present invention provides a vector encoding the list of neoantigens according to the first aspect of the invention or the combination of neoantigens according to the second aspect of the invention.

[0028] In a fourth aspect, the present invention provides a collection of vectors encoding each a different set of neoantigens according to the first aspect of the invention or the combination of neoantigens according to the second aspect of the invention, wherein the collection comprises 2 to 4, preferably 2, vectors and preferably wherein the vector inserts encoding the portion of the list are of about equal size in number of amino acids.

[0029] In a fifth aspect, the present invention provides a vector according to the third aspect of the invention or a collection of vectors according to the fourth aspect of the invention for use in cancer vaccination.

LIST OF FIGURES

[0030] In the following, the content of the figures comprised in this specification is described. In this context please also refer to the detailed description of the invention above and/or below.

[0031] FIG. 1: Generation of neoantigens derived from a SNV: (A) generation of 25mer neoantigens with the mutation centered and flanked by 12 wt aa upstream and downstream, (B) generation of 25mer neoantigens including more than one mutation and (C) generation of a neoantigen shorter than a 25mer when the mutation is close to the end or start of the protein sequence.

[0032] FIG. 2: Generation of neoantigens derived from indels generating a frameshift peptide (FSP). The process comprises splitting of FSPs into smaller fragments, preferably 25mers.

[0033] FIG. 3: Schematic description of the generation of the RSUM ranked list from the three individual rank scores

[0034] FIG. 4: Schematic description of the procedure to optimize the length of overlapping neoantigens derived from a FSP.

[0035] FIG. 5: Schematic description of the procedure to split K (preferably 60) neoantigens into two smaller lists of approximately equal overall length.

[0036] FIG. 6: Examples of FSP fragment merging: Example 1 refers to the FSP generated by the 2 nucleotide deletion chr11:1758971_AC. Four neoantigen sequences (FSP fragments) are merged into one 30 amino acid long neoantigen. Example 2 refers to the FSP generated by the one nucleotide insertion chr6:168310205_-_T. two neoantigen sequences (FSP fragments) are merged into one 31 amino acid long neoantigen.

[0037] FIG. 7: Validation of the prioritization method: Mutations from 14 cancer patients were ranked applying the prioritization method from Example 1. The figure reports the position in the ranked list for mutations that have been experimentally shown to induce an immune response. Ranks are indicated by a circle (A) or a square (B) for RSUM ranking including the patients' NGS-RNA data (A) or without the patients' NGS-RNA data (B)

[0038] FIG. 8: Immunogenicity of a single GAd vector or two GAd vectors encoding 62 neoantigens. One GAd vector encoding all 62 neoantigens in a single expression cassette (GAd-CT26-1-62) induces a weaker immune response compared to two co-administered GAd vectors each encoding 31 neoantigens (GAd-CT26-1-31+GAd-CT26-32-62) or one GAd vector encoding for two cassettes of 31 neoantigens each (GAd-CT26 dual 1-31 & 32-62). BalbC mice (6 mice/group) were immunized intramuscularly with (A) 5.times.10{circumflex over ( )}8 vp of GAd-CT26-1-62 or by co-administration of two vectors GAd-CT26-1-31+GAd-CT26-32-62 (5.times.10{circumflex over ( )}8 vp each) and (B) 5.times.10{circumflex over ( )}8 vp of GAd-CT26-1-62 or 5.times.10{circumflex over ( )}8 vp of dual cassette vector GAd-CT26 dual 1-31 & 32-62. T cell responses were measured on splenocytes of vaccinated mice at the peak of the response (2 weeks post vaccination) by ex-vivo IFN.gamma. ELISpot. Responses were evaluated by using 2 peptide pools, each composed of 31 peptides encoded by the vaccine constructs (pool 1-31 neoantigens 1 to 31; pool 32-62 neoantigens 32 to 62). Each of the polyneoantigen vectors comprises a T cell enhancer sequence (TPA) added to the N-terminus of the assembled polyneoantigens and an influenza HA tag at the C-terminus for monitoring expression.

DETAILED DESCRIPTIONS OF THE INVENTION

[0039] Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0040] Preferably, the terms used herein are defined as described in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, H. G. W, Nagel, B. and Klbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).

[0041] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being optional, preferred or advantageous may be combined with any other feature or features indicated as being optional, preferred or advantageous.

[0042] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. Some of the documents cited herein are characterized as being "incorporated by reference". In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence.

[0043] In the following, the elements of the present invention will be described. These elements are listed with specific embodiments; however, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and/or preferred elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.

Definitions

[0044] In the following, some definitions of terms frequently used in this specification are provided. These terms will, in each instance of its use, in the remainder of the specification have the respectively defined meaning and preferred meanings.

[0045] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents, unless the content clearly dictates otherwise.

[0046] The term "about" when used in connection with a numerical value is meant to encompass numerical values within a range having a lower limit that is 5% smaller than the indicated numerical value and having an upper limit that is 5% larger than the indicated numerical value.

[0047] In the context of the present specification, the term "major histocompatibility complex" (MHC) is used in its meaning known in the art of cell biology and immunology; it refers to a cell surface molecule that displays a specific fraction (peptide), also referred to as an epitope, of a protein. There a two major classes of MHC molecules: class I and class II. Within the MHC class I two groups can be distinguished based on their polymorphism: a) the classical (MHC-Ia) with corresponding polymorphic HLA-A, HLA-B, and HLA-C genes, and b) the non-classical (MHC-Ib) with corresponding less polymorphic HLA-E, HLA-F, HLA-G and HLA-H genes.

[0048] MHC class I heavy chain molecules occur as an alpha chain linked to a unit of the non-MHC molecule .beta.2-microglobulin. The alpha chain comprises, in direction from the N-terminus to the C-terminus, a signal peptide, three extracellular domains (.alpha.1-3, with .alpha.1 being at the N terminus), a transmembrane region and a C-terminal cytoplasmic tail. The peptide being displayed or presented is held by the peptide-binding groove, in the central region of the .alpha.1/.alpha.2 domains.

[0049] The term ".beta.2-microglobulin domain" refers to a non-MHC molecule that is part of the MHC class I heterodimer molecule. In other words, it constitutes the .beta. chain of the MHC class I heterodimer.

[0050] Classical MHC-Ia molecules principle function is to present peptides as part of the adaptive immune response. MHC-Ia molecules are trimeric structures comprising a membrane-bound heavy chain with three extracellular domains (.alpha.1, .alpha.2 and .alpha.3) that associates non-covalently with .beta.2-microglobulin (.beta.2m) and a small peptide which is derived from self-proteins, viruses or bacteria. The .alpha.1 and .alpha.2 domains are highly polymorphic and form a platform that gives rise to the peptide-binding groove. Juxtaposed to the conserved .alpha.3 domain is a transmembrane domain followed by an intracellular cytoplasmic tail.

[0051] To initiate an immune response classical MHC-Ia molecules present specific peptides to be recognized by TCR (T cell receptor) present on CD8.sup.+ cytotoxic T lymphocytes (CTLs), while NK cell receptors present in natural killer cells (NK) recognize peptide motifs, rather than individual peptides. Under normal physiological conditions, MHC-Ia molecules exist as heterotrimeric complexes in charge of presenting peptides to CD8 and NK cells, however,

[0052] The term "human leukocyte antigen" (HLA) is used in its meaning known in the art of cell biology and biochemistry; it refers to gene loci encoding the human MHC class I proteins. The three major classical MHC-Ia genes are HLA-A, HLA-B and HLA-C, and all of these genes have a varying number of alleles. Closely related alleles are combined in subgroups of a certain allele. The full or partial sequence of all known HLA genes and their respective alleles are available to the person skilled in the art in specialist databases such as IMGT/HLA (http://www.ebi.ac.uk/ipd/imgt/hla/).

[0053] Humans have MHC class I molecules comprising the classical (MHC-Ia) HLA-A, HLA-B, and HLA-C, and the non-classical (MHC-Ib) HLA-E, HLA-F, HLA-G and HLA-H molecules. Both categories are similar in their mechanisms of peptide binding, presentation and induced T-cell responses. The most remarkable feature of the classical MHC-Ia is their high polymorphism, while the non-classical MHC-Ib are usually non-polymorphic and tend to show a more restricted pattern of expression than their MHC-Ia counterparts.

[0054] The HLA nomenclature is given by the particular name of gene locus (e.g. HLA-A) followed by the allele family serological antigen (e.g. HLA-A*02), and allele subtypes assigned in numbers and in the order in which DNA sequences have been determined (e.g. HLA-A*02:01). Alleles that differ only by synonymous nucleotide substitutions (also called silent or non-coding substitutions) within the coding sequence are distinguished by the use of the third set of digits (e.g. HLA-A*02:01:01). Alleles that only differ by sequence polymorphisms in the introns, or in the 5' or 3' untranslated regions that flank the exons and introns, are distinguished by the use of the fourth set of digits (e.g. HLA-A*02:01:01:02L).

[0055] MHC class I and class II binding affinity prediction; example of methods known in the art for the prediction of MHC class I or II epitopes and for the prediction of MHC class I and II binding affinity are Moutaftsi et al., 2006; Lundegaard et al., 2008; Hoof et al., 2009; Andreatta & Nielsen, 2016; Jurtz et al., 2017. Preferably the method described in Andreatta & Nielsen, 2016 is used and, in case this method does not cover one of the patients's MHC alleles, the alternative method decribed by Jurtz et al., 2017 is used.

[0056] Genes and epitopes related to human autoimmune reactions and the associated MHC alleles can be identified in the IEDB database (https://www.iedb.org) by applying the following query criteria: "Linear epitopes" for category Epitope, "Humans" for category Host and "Autoimmune disease" for category Disease.

[0057] The term "T cell enhancer element" refers to a polypeptide or polypeptide sequence that, when fused to an antigenic sequence or peptide, increases the induction of T cells against neo-antigens in the context of a genetic vaccination. Examples of T cell enhancers are an invariant chain sequence or fragment thereof; a tissue-type plasminogen activator leader sequence optionally including six additional downstream amino acid residues; a PEST sequence; a cyclin destruction box; an ubiquitination signal; a SUMOylation signal. Specific examples of T-cell enhancer elements are those of SEQ ID NOs 173 to 182.

[0058] The term `coding sequence` refers to a nucleotide sequence that is transcribed and translated into a protein. Genes encoding proteins are a particular example for coding sequences.

[0059] The term `allele frequency` refers to the relative frequency of a particular allele at a particular locus within a multitude of elements, such as a population or a population of cells. The allele frequency is expressed as a percentage or ratio. For example the allele frequency of a mutation in a coding sequence would be determined by the ratio of mutated versus non-mutated reads at the position of the mutation. A mutation allele frequency wherein at the location of the mutation 2 reads determined the mutated allele and 18 reads showed the non-mutated allele would define a mutation allele frequency of 10%. The mutation allele frequency for neoantigens generated from frameshift peptides is that of the insertion or deletion mutation causing the frameshift peptide, i.e. all mutated amino acids within the FSP would have the same mutation allele frequency, which is that of the frameshift causing insertion/deletion mutation.

[0060] The term `neoantigen` refers to cancer-specific antigens that are not present in normal non-cancerous cells.

[0061] The term `cancer vaccine` refers in the context of the present invention to a vaccine that is designed to induce an immune response against cancer cells.

[0062] The term `personalized vaccine` refers to a vaccine that comprises antigenic sequences that are specific for a particular individual. Such a personalized vaccine is of particular interest for a cancer vaccine using neoantigens, since many neoantigens are specific for the particular cancer cells of an individual.

[0063] The term "mutation" in a coding sequence refers in the context of the present invention to a change in the nucleotide sequence of a coding sequence when comparing the nucleotide sequence of a cancerous cell to that of a non-cancerous cell. Changes in the nucleotide sequence that does not result in a change in the amino acid sequence of the encoded peptide, i.e. a `silent` mutation, is not regarded as a mutation in the context of the present invention. Types of mutations that can result in the change of the amino acid sequence are without being limited to non-synonymous single nucleotide variants (SNV), wherein a single nucleotide of a coding triplet is changed resulting in a different amino acid in the translated sequence. A further example of a mutation resulting in a change in the amino acid sequence are insertion/deletion (indel) mutations, wherein one or more nucleotides are either inserted into the coding sequence or deleted from it. Of particular relevance are indel mutations that result in the shift of the reading frame which occurs if a number of nucleotides are inserted or deleted that are not dividable by three. Such a mutation causes a major change in the amino acid sequence downstream of the mutation which is referred to as a frameshift peptide (FSP).

[0064] The term `Shannon entropy` refers to the entropy associated with the number of conformations of a molecule, e.g. a protein. Methods known in the art to calculate the Shannon entropy are Strait & Dewey, 1996 and Shannon 1996. For a polypeptide the Shannon entropy (SE) can be calculated as SE=(-.SIGMA.p.sub.c(aa.sub.i)log(p.sub.c(aa.sub.i)))/N wherein p.sub.c(aa.sub.i) is the frequency of amino acid i in the polypeptide and the sum is calculated over all 20 different amino acids and N is the length of the polypeptide.

[0065] The term "expression cassette" is used in the context of the present invention to refer to a nucleic acid molecule which comprises at least one nucleic acid sequence that is to be expressed, e.g. a nucleic acid encoding a selection of neoantigens of the present invention or a part thereof, operably linked to transcription and translation control sequences. Preferably, an expression cassette includes cis-regulating elements for efficient expression of a given gene, such as promoter, initiation-site and/or polyadenylation-site. Preferably, an expression cassette contains all the additional elements required for the expression of the nucleic acid in the cell of a patient. A typical expression cassette thus contains a promoter operatively linked to the nucleic acid sequence to be expressed and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Additional elements of the cassette may include, for example enhancers. An expression cassette preferably also contains a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from a different gene.

[0066] The "IC50" value refers to the half maximal inhibitory concentration of a substance and is thus a measure of the effectiveness of a substance in inhibiting a specific biological or biochemical function. The values are typically expressed as molar concentration. The IC50 of a molecule can be determined experimentally in functional antagonistic assays by constructing a dose-response curve and examining the inhibitory effect of the examined molecule at different concentrations. Alternatively, competition binding assays may be performed in order to determine the IC50 value. Typically, neoantigen fragments of the present invention exhibit an IC50 value of between 1500 nM-1 pM, more preferably 1000 nM to 10 pM, and even more preferably between 500 nM and 100 pM.

[0067] The term "massively parallel sequencing" refers to high-throughput sequencing methods for nucleic acids. Massively parallel sequencing methods are also referred to as next-generation sequencing (NGS) or second-generation sequencing. Many different massively parallel sequencing methods are known in the art that differ in setup and used chemistry. However, all these methods have in common that they perform a very large number of sequencing reactions in parallel to increase the speed of sequencing.

[0068] The term "Transcripts Per Kilobase Million" (TPM) refers to a gene-centered metric used in massively parallel sequencing of RNA samples that normalizes for sequencing depth and gene length. It is calculated by dividing the read counts by the length of each gene in kilobases, resulting in reads per kilobases (RPK). Divide the number of all RPK values in a sample by 1,000,000 resulting in a `per million scaling factor`. Divide the RPK values by the `per million scaling factor` resulting in a TPM for each gene.

[0069] The overall expresion level of the gene harboring the mutation is expressed as TPM. Preferably, the "mutation-specific" expression values (corrTPM) is then determined from the number of mutated and non-mutated reads reads at the position of the mutation.

[0070] The corrected expression value corrTPM is calculated as corrTPM=TPM*(M+c)/(M+W+c). M is the number of reads spanning the location of the mutation generating the neoantigen and W is the number of reads without the mutation spanning the location of the mutation generating the neoantigens. The value c is a constant larger than 0, preferably 0.1. The value c is particular important if M and/or W is 0.

EMBODIMENTS

[0071] In the following different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous. In a first aspect, the present invention provides a method for selecting cancer neoantigens for use in a personalized vaccine comprising the steps of: [0072] (a) determining neoantigens in a sample of cancerous cells obtained from an individual, wherein each neoantigen [0073] is comprised within a coding sequence, [0074] comprises at least one mutation in the coding sequence resulting in a change of the encoded amino acid sequence that is not present in a sample of non-cancerous cells of said individual, and [0075] consists of 9 to 40, preferably 19 to 31, more preferably 23 to 25, most preferably 25 contiguous amino acids of the coding sequence in the sample of cancerous cells, [0076] (b) determine for each neoantigen the mutation allele frequency of each of said mutations of step (a) within the coding sequence, [0077] (c) determining the expression level of each coding sequence comprising at least one of said mutations, [0078] (i) in said sample of cancerous cells, or [0079] (ii) from an expression database of the same cancer type as the sample of cancerous cells, [0080] (d) predicting the MHC class I binding affinity of the neoantigens, wherein [0081] (I) the HLA class I alleles are determined from the sample of non-cancerous cells of said individual, [0082] (II) for each HLA class I allele determined in (I) the MHC class I binding affinity of each fragment consisting of 8 to 15, preferably 9 to 10, more preferably 9, contiguous amino acids of the neoantigen is predicted, wherein each fragment is comprising at least one amino acid change caused by the mutation of step (a), and [0083] (III) the fragment with the highest MHC class I binding affinity determines the MHC class I binding affinity of the neoantigen, [0084] (e) ranking the neoantigens according to the values determined in steps (b) to (d) for each neoantigen from highest to lowest values, yielding a first, a second and a third list of ranks, [0085] (f) calculating a rank sum from said first, second and third list of ranks and ordering the neoantigens by increasing rank sum, yielding a ranked list of neoantigens, [0086] (g) selecting 30-240, preferably 40-80, more preferably 60, neoantigens from the ranked list of neoantigens obtained in (f) starting with the lowest rank.

[0087] Many cancer neoantigens are not `seen` by the immune system because either potential epitopes are not processed/presented by the tumor cells or because immune tolerance led to elimination of T cells reactive with the mutated sequence. Therefore, it is beneficial to select, among all potential neoantigens, those having the highest chance to be immunogenic. Ideally a neoantigen would have to be present in a high number of cancer cells, being expressed in sufficient quantities and being presented efficiently to immune cells.

[0088] By selecting neoantigens comprising cancer specific mutations that have a certain mutation allele frequency, are abundantly expressed and are predicted to have a high binding affinity to MHC molecules, the chance of an immune response being induced is significantly increased. The present inventors have surprisingly found that these parameters can be most efficiently used to select suitable neoantigens elicits an increased immune response using a prioritizing method that the different parameters into account. Importantly, the method of the invention also considers neoantigens where allele frequency, expression level or predicted MHC binding affinity are not amongst the highest observed. For example a neoantigen with a high expression level and a high mutation allele frequency but a relatively low predicted MHC binding affinity can still be included in the list of selected neoantigens.

[0089] The method of the invention therefore does not use cut-off criteria commonly applied in selection processes but takes into account that neoantigens with a very high predicted suitability according to one parameter are not simply excluded from the list due to sub-optimal suitability in other parameters. This is in particular relevant for neoantigens with parameters only missing a certain cut-off criteria slightly.

[0090] Any mutation in a coding sequence (i.e. a genomic nucleic acid sequence being transcribed and translated) that is present only in cancer cells of an individual and not in healthy cells of the same individual are potentially of interest as immunogenic (i.e. capable of inducing an immune response) neoantigens. The mutation in the coding sequence must also result in changes in the translated amino acid sequence, i.e. a silent mutation only present on the nucleic acid level and without changing the amino acid sequence is therefore not suitable. Essential is that the mutation, regardless of the exact type of mutation (change of single nucleotides, insertion or deletions of single or multiple nucleotides, etc.), results in an altered amino acid sequences of the translated protein. Each amino acid present only in the altered amino acid sequence but not in the amino acid sequence resulting from the coding gene as present in the non-cancerous cells is considered to be a mutated amino acid in the context of this specification. For example mutations of the coding sequence such as insertion or deletion mutations resulting in frameshift peptides would result in a peptide wherein each amino acid that is encoded by a shifted reading frame is to be regarded as a mutated amino acid.

[0091] The mutation of the coding sequence can in principle be identified by any method of DNA sequencing of the sample obtained from an individual. A preferred method for obtaining the DNA sequence necessary to identify the mutation in the coding sequence of the individual is a massively parallel sequencing method.

[0092] The allele frequency of the mutation (i.e. the ratio of non-mutated vs mutated sequences at the position of the mutation) in the coding sequence is also an important factor for neoantigens being used in a vaccine. Neoantigens with a high allele frequency are present in a substantial number of cancer cells, resulting in neoantigens comprising these mutations being a promising target of a vaccine.

[0093] In a similar fashion it is of importance how abundantly a neoantigen is expressed within the cancer cells. The higher the expression of a neoantigen in cancer cells the more suitable is the neoantigen and the higher is the chance for a sufficient immune response against such cells. The present invention can be exercised with different ways of assessing the expression levels of neoantigens. The expression of the neoantigens can be assessed directly in the sample of cancerous cells. The expression can be measured by different methods that preferably represent the whole transcriptome, various such methods are known to the skilled person. Preferably, a method providing a fast, reliable and cost effective method to measure the transcriptome is used. One such preferred method is massively parallel sequencing.

[0094] Alternatively, if no direct measurement is available, which can e.g. be due to technical or economic reasons, expression databases can be used. The skilled person is aware of available expression databases containing gene expression data of different cancer types. A typical non-limiting example of such a database is TCGA (https://portal.gdc.cancer.gov/). The expression of genes comprising the mutation identified in step (a) of the method in the same type of tumor as the individual the vaccine is designed for can be searched in these databases and can be used to determine an expression value.

[0095] It is further of importance that the selected neoantigens are efficiently presented to immune cells by MHC molecules on the cancer cells. There are different methods known in the art to predict the binding affinity of peptides to MHC class I (and class II) molecules (Moutaftsi et al., 2006; Lundegaard et al., 2008; Hoof et al., 2009; Andreatta & Nielsen, 2016; Jurtz et al., 2017). Since the MHC molecules are a highly polymorphic group of proteins with significant differences between individuals it is important to determine the MHC binding affinity for the type of MHC molecules present on the individual's cells. The MHC molecules are encoded by the group of highly polymorphic HLA genes. The method therefore uses the DNA sequencing results utilized in step (a) to identify the mutations in coding sequences to identify the HLA alleles present in the individual. For each MHC molecule corresponding to the identified HLA alleles in the individual, the MHC binding affinity to the neoantigens is determined. Towards these ends the amino acid sequence of the neoantigen is determined by in silico translation of the coding sequence. The resulting neoantigen amino acid sequence is then divided into fragments consisting of 8 to 15, preferably 9 to 10, more preferably 9, contiguous amino acids, wherein the fragment must contain at least one of the mutated amino acids of the neoantigen. The size of the fragment is restricted by the size of peptides the MHC molecule can present. For each fragment the MHC binding affinity is predicted. The MHC binding affinity is usually measured as half maximal inhibitory concentration (IC50 in [nM]). Hence, the lower the IC50 value is the higher is the binding affinity of the peptide to the MHC molecule. The fragment with the highest MHC binding affinity determines the MHC binding affinity of the neoantigen the fragment is derived from.

[0096] The method of the present invention then uses the parameters determined in steps (b) to (d), i.e. mutation allele frequency, expression level and predicted MHC class I binding affinity of the neoantigen, to select the most suitable neoantigens by applying a prioritization method to these parameters. Therefore the parameters are sorted on a ranked list. The neoantigen with the highest mutation allele frequency is assigned the first rank, i.e. rank 1, in a first list of ranks. The neoantigen with the second highest mutation allele frequency is assigned the second rank in the first list of ranks etc. until all identified neoantigens are assigned a rank on the first list of ranks.

[0097] Similarly the expression level of each coding sequence is ranked from highest to lowest, with the neoantigen with the highest expression value being assigned rank 1, the neoantigen with the second highest levels is assigned rank 2 etc. until all identified neoantigens are assigned a rank on the second list of ranks.

[0098] The MHC class I binding affinity of the neoantigens are ranked from highest to lowest binding affinity with the neoantigen with the highest MHC class I binding affinity is assigned rank 1, the neoantigen with the second highest binding affinity is assigned rank 2 etc. until all neoantigens are assigned a rank on the third list of ranks.

[0099] If any of the neoantigens has an identical mutation allele frequency, expression level and/or MHC class I binding affinity as another neoantigens, both antigens are assigned the same rank on the relevant list of ranks.

[0100] The method then uses a prioritization method that takes into account all three rankings by calculating a rank sum of the three lists of ranks. For example a neoantigen that has rank 3 on the first list of ranks, rank 13 on the second list of ranks and rank 2 on the third list or ranks has a rank sum of 18 (3+13+2). After the rank sum has been calculated for each neoantigen the rank sums are ranked according to their rank sum with the lowest rank sum being assigned rank 1 etc. yielding a ranked list of neoantigens. Neoantigens with an identical rank sum are assigned the same rank on the ranked list of neoantigens.

[0101] The final number of neoantigens present in the list is dependent on the number of mutations detected in each patient. The number of neoantigens to be used in a vaccine is limited by the vehicle or vehicles used to deliver the vaccine. For example if a single viral vector is used as a delivery vehicle, as can be the case for a genetic vaccine, the maximum insert size of this vector would limit the number of neoantigens that can be used in each vector.

[0102] Therefore, the method of the present invention selects 25-250, 30-240, 30-150, 35-80, preferably 55-65, more preferably 60 neoantigens from the list of ranked neoantigens starting with the neoantigen that has the lowest rank (i.e. lowest rank number, rank 1). In case the neoantigens are selected to be present in one set (e.g. single vehicle of a monovalent vaccine) 25-80, 30-70, 35-70, 40-70, 55-65, preferably 60 neoantigens are selected. The neoantigens not included in the first set can however be encoded by additional viral vectors for a multi-valent vaccination based on co-administration of up to 4 viral vectors.

[0103] In a preferred embodiment of the first aspect of the present invention, steps (a) and (d)(I) are performed using massively parallel DNA sequencing of the samples.

[0104] In a preferred embodiment of the first aspect of the present invention, steps (a) and (d)(I) are performed using massively parallel DNA sequencing of the samples and the number of reads at the chromosomal position of the identified mutation is: [0105] in the sample of cancerous cells at least 2, preferably at least 3, 4, 5, or 6, [0106] in the sample of non-cancerous cells is 2 or less, i.e. 2, 1 or 0, preferably 0. In an preferred alternative embodiment of the first aspect of the invention the number of reads at the chromosomal position of the identified mutation are higher in the sample of cancerous cells than in the sample of non-cancerous cells, wherein the difference between the samples is statistically significant. A statistically significant difference between two groups can be determined by a number of statistical tests known to the skilled person. One such example of a suitable statistical test is Fisher's exact test. For the purpose of the present invention two groups are considered to be different from each other if the p-value is below 0.05.

[0107] These criteria are applied to further select for neoantigens wherein the identified mutation is detected with a particular high technical reliability.

[0108] In a preferred embodiment of the first aspect of the present invention the method comprises a step (d') in addition to or alternatively to step (d), wherein step (d') comprises: [0109] determining the HLA class II alleles in the sample of non-cancerous cells of said individual, [0110] predicting the MHC class II binding affinity of the neoantigen, wherein [0111] for each HLA class II allele determined the MHC class II binding affinity for each fragment of 11 to 30, preferably 15, contiguous amino acids of the neoantigen is predicted, wherein each fragment is comprising at least one mutated amino acid generated by the mutation of step (a), and [0112] the fragment with the highest MHC class II binding affinity determines the MHC class II binding affinity of the neoantigen; wherein the MHC class II binding affinity is ranked from highest to lowest MHC class II binding affinity, yielding a fourth list of ranks that is included in the rank sum of step (f).

[0113] In this embodiment an alternative or additional selection parameter is added. The MHC class II binding affinity is predicted in slightly larger fragments due to the peptides presented by MHC class II molecules being larger in size than those of MHC class I peptides. The MHC class II binding affinity is also ranked from the highest to the lowest binding affinity, with the neoantigen with the highest MHC class II binding affinity being assigned rank 1 etc. until all neoantigens are assigned a rank in the fourth list of ranks.

[0114] In case the MHC class II binding affinity is used as an additional selection parameter the fourth list is included additionally in the rank sum calculation. In case the MHC class II binding affinity is used as an alternative to the MHC class I binding affinity of step (d) the rank sum in step (f) is calculated on the first, second and fourth list of ranks only.

[0115] In a preferred embodiment of the first aspect of the present invention the at least one mutation of step (a) is a single nucleotide variant (SNV) or an insertion/deletion mutation resulting in a frame-shift peptide (FSP).

[0116] In a preferred embodiment of the first aspect of the present invention wherein the mutation is a SNV and the neoantigen has the total size defined in step (a) and consists of the amino acid caused by the mutation, flanked on each side by a number of adjoining contiguous amino acids, wherein the number on each side does not differ by more than one unless the coding sequence does not comprise a sufficient number of amino acids on either side, wherein the neoantigen has the total size defined in step (a). Preferably the mutated amino acid resulting from a SNV is located within the `middle` of the neoantigen (i.e. flanked by an equal number of amino acids). This provides an equal chance of the mutation being present at the end or start of an epitope. The neoantigen is therefore selected with approximately (i.e. differ by not more than one) the same number of surrounding amino acids resulting from the coding sequence on each side of the mutated amino acids.

[0117] In a preferred embodiment of the first aspect of the present invention wherein the mutation results in a FSP and each single amino acid change caused by the mutation results in a neoantigen that has the total size defined in step (a) and consists of:

[0118] (i) said single amino acid change caused by the mutation and 7 to 14, preferably 8, N-terminally adjoining contiguous amino acids, and

[0119] (ii) a number of contiguous amino acids adjoining the fragment of step (i) on either side, wherein the number of amino acids on either side differ by not more than one, unless the coding sequence does not comprise a sufficient number of amino acids on either side,

[0120] wherein the MHC class I binding affinity of step (d) and/or the MHC class II binding affinity of step (d') is predicted for the fragment of step (i).

[0121] Each mutated amino acid of the FSP defines one distinct neoantigen. Each neoantigen consists of a mutated amino acid and a number of amino acids being one amino acid shorter than the size of the fragment used to determine MHC class I binding affinity (i.e. 7 to 14) which are located N-terminally of the mutated amino acid. The neoantigen further consists of a number of contiguous amino acids derived from the coding sequence that form with the sequence of the neoantigen fragment of step (i) a contiguous sequence in the coding sequence. The number of amino acids surrounding the neoantigen fragment of step (i) on either side differs by only one, wherein the total size of the neoantigen is as defined in step (a). The neoantigen fragment of step (i) is used to determine the MHC class I and/or class II binding affinity.

[0122] For example a mutated amino acid on relative position 20 of a translated coding sequence would define a neoantigen fragment including a contiguous amino acid sequence of 8 contiguous amino acids (i.e. fragment of step (i)) ranging from position 12 to 20. The complete neoantigen sequence of 25 amino acids according to step (ii) would consist of amino acids 4 to 28. The neoantigen fragment ranging from position 12 to 20 consisting of 9 amino acids would be used to determine the MHC binding affinity.

[0123] In a preferred embodiment of the first aspect of the present invention the mutation allele frequency of the neoantigen determined in step (b) in the sample of cancerous cells is at least 2%, preferably at least 5%, more preferably at least 10%.

[0124] In a preferred embodiment of the first aspect of the present invention step (g) further comprises removing neoantigens from genes linked to autoimmune disease, from the ranked list of neoantigens. The skilled person is aware of neoantigens associated with autoimmune diseases from public databases. One such example of a database is the IEDB database (www.iedb.org). Exclusion of a neoantigen candidate can be performed both at the gene level if the gene harboring the mutation belongs to one of those genes linked to autoimmune disease in the IEDB database or, in a less stringent manner, not only if the patient has a mutation in a gene known to be involved in autoimmunity but one of the patient's MHC alleles is also identical to the allele described in the IEDB database for the human autoimmune disease epitope in connection with the described autoimmune phenomenon.

[0125] In a preferred embodiment neoantigens associated with an autoimmune disease are not removed from the ranked list of neoantigens if the database specifies a certain MHC class I allele for this association and the corresponding HLA allele was not found in the individual in step (d)(I).

[0126] In a preferred embodiment of the first aspect of the present invention step (g) further comprises removing neoantigens with a Shannon entropy value for their amino acid sequence lower than 0.1 from said ranked list of neoantigens.

[0127] In a preferred embodiment of the first aspect of the present invention the expression level of said coding genes in step (c)(i) is determined by massively parallel transcriptome sequencing.

[0128] In a preferred embodiment of the first aspect of the present invention the expression level determined in step (c)(i) uses a corrected Transcripts Per Kilobase Million (corrTPM) value calculated according to the following formula

corrTPM = TPM * ( M + c M + W + c ) ##EQU00001##

wherein M is the number of reads spanning the location of the mutation of step (a) that comprise the mutation and W is the number of reads spanning the location of the mutation of step (a) without the mutation and TPM is the Transcripts Per Kilobase Million value of the gene comprising the mutation and the c is a constant larger than 0, preferably c is 0.1.

[0129] In a preferred embodiment of the first aspect of the present invention the rank sum in step (f) is a weighted rank sum, wherein the number of neoantigens determined in step (a) is added to the rank value of each neoantigen: [0130] in the third list of ranks for which the prediction of MHC class I binding affinity of step (d) resulted in an IC50 value higher than 1000 nM and/or [0131] in the fourth list of ranks for which the prediction of MHC class II binding affinity of step (d') resulted in an IC50 value higher than 1000 nM.

[0132] This weighing of the MHC binding affinity penalizes a very low MHC class I and/or class II binding affinity by adding ranks.

[0133] In a preferred embodiment of the first aspect of the present invention the rank sum in step (f) is a weighted rank sum, wherein in case of step (c)(i) being performed by massively parallel transcriptome sequencing, the rank sum of step (f) is multiplied by a weighing factor (WF), wherein WF is [0134] 1, if the number of mapped transcriptome reads for the mutation is >0, [0135] 2, if the number of mapped transcriptome reads for the mutation is 0 and the number of mapped reads for the non-mutated sequence is 0 and the transcripts-per-million (TPM) value is at least 0.5, [0136] 3, if the number of mapped transcriptome reads for the mutation is 0 and the number of mapped reads for the non-mutated sequence is >0 and the transcripts-per-million (TPM) value is at least 0.5, [0137] 4, if the number of mapped transcriptome reads for the mutation is 0 and the number of mapped reads for the non-mutated sequence is 0 and the transcripts-per-million (TPM) value is <0.5, or [0138] 5, if the number of mapped transcriptome reads for the mutation is 0 and the number of mapped reads for the non-mutated sequence is >0 and the transcripts-per-million (TPM) value is <0.5.

[0139] The weighing matrix penalizes certain neoantigens for which the sequencing results are either of poor quality (i.e. number of mapped reads is low) and/or if the expression value (i.e. TPM value) is below a certain threshold. This mode of weighing (i.e. prioritizing) certain parameters provides neoantigens with a better immunogenicity than using cutoff values for the single parameters, which would eliminate certain neoantigens due to a low suitability in one parameter even though other parameter qualifies the neoantigen as suitable.

[0140] In a preferred embodiment of the first aspect of the present invention step (g) comprises an alternative selection process, wherein the neoantigens are selected from the ranked list of neoantigens starting with the lowest rank until a set maximum size in total overall length in amino acids for all selected neoantigens is reached, wherein the maximum size is between 1200 and 1800, preferably 1500 amino acids for each vector. The process can be repeated in a multivalent vaccination approach, wherein the maximum size indicated above applies for each vehicle used in the multivalent approach. For example a multivalent approach based on 4 vectors could for example allow a total limit of 6000 amino acids. This embodiment takes the maximum size for neoantigens allowed by a certain delivery vehicle into account. Therefore, the number of neoantigens selected from the ranked list is not determined by the number of neoantigens but takes the size of neoantigens into account. A number of small neoantigens in the ranked list of antigens would allow to include more antigens within the list of selected antigens.

[0141] In a preferred embodiment of the first aspect of the present invention two or more neoantigens are merged into one new neoantigen if they comprise overlapping amino acid sequence segments. In some case neoantigens can contain overlapping amino acid sequences. This is particularly often the case for FSP derived neoantigens. In order to avoid redundant overlapping sequences the neoantigens are merged into a single new neoantigen that consists of the non-redundant portions of the merged neoantigens. A merged new neoantigen can have a size larger than defined in step (a) of the first aspect of the invention, depending on the number of neoantigens merged and the degree of overlap.

[0142] In a preferred embodiment of the first aspect of the present invention the personalized vaccine is a personalized genetic vaccine. The term `genetic vaccine` is used synonymously to `DNA vaccine` and refers to the use of genetic information as a vaccine and the cells of the vaccinated subject produce the antigen the vaccination is directed against.

[0143] In a preferred embodiment of the first aspect of the present invention the personalized vaccine is a personalized cancer vaccine.

[0144] In a second aspect, the present invention provides a method for constructing a personalized vector encoding a combination of neoantigens according to the first aspect of the invention for use as a vaccine, comprising the steps of:

[0145] (i) ordering the list of neoantigens in at least 10{circumflex over ( )}5-10{circumflex over ( )}8, preferably 10{circumflex over ( )}6 different combinations,

[0146] (ii) generating all possible pairs of neoantigen junction segments for each combination, wherein each junction segment comprises 15 adjoining contiguous amino acids on either side of the junction,

[0147] (iii) predicting the MHC class I and/or class II binding affinity for all epitopes in junction segments wherein only HLA alleles are tested that are present in the individual the vector is designed for, and

[0148] (iv) selecting the combination of neoantigens with the lowest number of junctional epitopes with an IC50 of .ltoreq.1500 nM and wherein if multiple combinations have the same lowest number of junctional epitopes the combination first encountered is selected.

[0149] The list of selected neoantigens according to the first aspect of the invention can be arranged into a single combined neoantigen. The junctions where the individual neoantigens are joined can result in novel epitopes that may lead to unwanted off target effects not related to epitopes being present on cancerous cells. Therefore, it is advantageous if the epitopes created by the junction of individual neoantigens have a low immunogenicity. Towards these ends the neoantigens are arranged in different orders resulting in different junction epitopes and the MHC class I and class II binding affinity of those junction epitopes is predicted. The combination with the lowest number of junctional epitopes with an IC50 value of .ltoreq.1500 nM is selected. The number of different combinations of selected neoantigens is limited primarily by computing power available. A compromise between computing resources used and accuracy needed is if 10{circumflex over ( )}5-10{circumflex over ( )}8, preferably 10{circumflex over ( )}6 different combinations of neoantigens are used wherein the MHC class I and/or class II binding affinity of the junctional epitopes of each neoantigen junction is predicted.

[0150] In an alternative second aspect, the present invention provides a method for constructing a personalized vector encoding a combination of neoantigens for use as a vaccine, comprising the steps of:

[0151] (i) ordering a list of neoantigens in at least 10{circumflex over ( )}5-10{circumflex over ( )}8, preferably 10{circumflex over ( )}6 different combinations,

[0152] (ii) generating all possible pairs of neoantigen junction segments for each combination, wherein each junction segment comprises 15 adjoining contiguous amino acids on either side of the junction,

[0153] (iii) predicting the MHC class I and/or class II binding affinity for all epitopes in junction segments wherein only HLA alleles are tested that are present in the individual the vector is designed for, and

[0154] (iv) selecting the combination of neoantigens with the lowest number of junctional epitopes with an IC50 of .ltoreq.1500 nM and wherein if multiple combinations have the same lowest number of junctional epitopes the combination first encountered is selected.

[0155] The list of neoantigens can be arranged into a single combined neoantigen. The junctions where the individual neoantigens are joined can result in novel epitopes that may lead to unwanted off target effects not related to epitopes being present on cancerous cells. Therefore, it is advantageous if the epitopes created by the junction of individual neoantigens have a low immunogenicity. Towards these ends the neoantigens are arranged in different orders resulting in different junction epitopes and the MHC class I and class II binding affinity of those junction epitopes is predicted. The combination with the lowest number of junctional epitopes with an IC50 value of .ltoreq.1500 nM is selected. The number of different combinations of selected neoantigens is limited primarily by computing power available. A compromise between computing resources used and accuracy needed is if 10{circumflex over ( )}5-10{circumflex over ( )}8, preferably 10{circumflex over ( )}6 different combinations of neoantigens are used wherein the MHC class I and/or class II binding affinity of the junctional epitopes of each neoantigen junction is predicted.

[0156] In a third aspect, the present invention provides a vector encoding the list of neoantigens according to the first aspect of the invention or the combination of neoantigens according to the second aspect of the invention.

[0157] It is preferred that the vector comprises one or more elements that enhance immunogenicity of the expression vector. Preferably such elements are expressed as a fusion to the neoantigens or neoantigens combination polypeptide or are encoded by another nucleic acid comprised in the vector, preferably in an expression cassette.

[0158] In a preferred embodiment of the third aspect of the invention the vector additionally comprises a T-cell enhancer element, preferably (SEQ ID NO: 173 to 182), more preferably SEQ ID NO: 175, that is fused to the N-terminus of the first neoantigen in the list.

[0159] The vector of the third aspect or the collection of vectors of the fourth aspect, wherein the vector in each case is independently selected from the group consisting of a plasmid; a cosmid; a liposomal particle, a viral vector or a virus like particle; preferably an alphavirus vector, a venezuelan equine encephalitis (VEE) virus vector, a sindbis (SIN) virus vector, a semliki forest virus (SFV) virus vector, a simian or human cytomegalovirus (CMV) vector, a Lymphocyte choriomeningitis virus (LCMV) vector, a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated virus vector a poxvirus vector, a vaccinia virus vector or a modified vaccinia ankara (MVA) vector. It is preferred that a collection of vectors, wherein each member of the collection comprises a polynucleotide encoding a different antigen or fragments thereof and, which is thus typically administered simultaneously uses the same vector type, e.g. an adenoviral derived vector.

[0160] The most preferred expression vectors are adenoviral vectors, in particular adenoviral vectors derived from human or non-human great apes. Preferred great apes from which the adenoviruses are derived are Chimpanzee (Pan), Gorilla (Gorilla) and orangutans (Pongo), preferably Bonobo (Pan paniscus) and common Chimpanzee (Pan troglodytes). Typically, naturally occurring non-human great ape adenoviruses are isolated from stool samples of the respective great ape. The most preferred vectors are non-replicating adenoviral vectors based on hAd5, hAd11, hAd26, hAd35, hAd49, ChAd3, ChAd4, ChAd5, ChAd6, ChAd7, ChAd8, ChAd9, ChAd10, ChAd11, ChAd16, ChAd17, ChAd19, ChAd20, ChAd22, ChAd24, ChAd26, ChAd30, ChAd31, ChAd37, ChAd38, ChAd44, ChAd55, ChAd63, ChAd73, ChAd82, ChAd83, ChAd146, ChAd147, PanAd1, PanAd2, and PanAd3 vectors or replication-competent Ad4 and Ad7 vectors. The human adenoviruses hAd4, hAd5, hAd7, hAd11, hAd26, hAd35 and hAd49 are well known in the art. Vectors based on naturally occurring ChAd3, ChAd4, ChAd5, ChAd6, ChAd7, ChAd8, ChAd9, ChAd10, ChAd11, ChAd16, ChAd17, ChAd19, ChAd20, ChAd22, ChAd24, ChAd26, ChAd30, ChAd31, ChAd37, ChAd38, ChAd44, ChAd63 and ChAd82 are described in detail in WO 2005/071093. Vectors based on naturally occurring PanAd1, PanAd2, PanAd3, ChAd55, ChAd73, ChAd83, ChAd146, and ChAd147 are described in detail in WO 2010/086189.

[0161] In a preferred embodiment of the third aspect of the present invention, the vector comprises two independent expression cassettes wherein each expression cassette encodes a portion of the list of neoantigens according to the first aspect of the invention or the combination of neoantigens according to the second aspect of the invention. Preferably, the portion of the list encoded by the expression cassettes are of about equal size in number of amino acids.

[0162] In a preferred embodiment of the third aspect of the present invention the vector comprises an expression cassette encoding the selected neoantigens of the ranked list of neoantigens according to the first aspect of the invention wherein the list of selected neoantigens is split into two parts of approximately equal length, wherein the two parts are separated by an internal ribosome entry site (IRES) element or a viral 2A region (Luke et al., 2008), for example the aphtovirus Foot and Mouth Disease Virus 2A region (SEQ ID NO: 184 APVKQTLNFDLLKLAGDVESNPGP) which mediates polyprotein processing by a translational effect known as ribosomal skip (Donnelly et al., J. Gen. Virology 2001). Optionally in each of the two parts a T-cell enhancer element, preferably (SEQ ID NO: 173 to 182), more preferably SEQ ID NO: 175, is fused to the N-terminus of the first neoantigen in the list.

[0163] In a fourth aspect, the present invention provides a collection of vectors encoding each a portion of the list of neoantigens according to the first aspect of the invention or the combination of neoantigens according to the second aspect of the invention, wherein the collection comprises 2 to 4, preferably 2, vectors and preferably wherein the vector inserts encoding the portion of the list are of about equal size in number of amino acids.

[0164] In a fifth aspect, the present invention provides a vector according to the third aspect of the invention or a collection of vectors according to the fourth aspect of the invention for use in cancer vaccination.

[0165] The vector of the third aspect of the invention or the collection of vectors according to the fourth aspect of the invention for use in cancer vaccination, wherein the cancer is selected from the group consisting of malignant neoplasms of lip, oral cavity, pharynx, a digestive organ, respiratory organ, intrathoracic organ, bone, articular cartilage, skin, mesothelial tissue, soft tissue, breast, female genital organs, male genital organs, urinary tract, brain and other parts of central nervous system, thyroid gland, endocrine glands, lymphoid tissue, and haematopoietic tissue.

[0166] In a preferred embodiment of the fifth aspect of the invention the vaccination regimen is a heterologous prime boost with two different viral vectors. Preferred combinations are Great Apes derived adenoviral vector for priming and a poxvirus vector, a vaccinia virus vector or a modified vaccinia ankara (MVA) vector for boosting. Preferably these are administered sequentially with an interval of at least 1 week, preferably of 6 weeks.

EXAMPLES

[0167] The present invention describes a method to score tumor mutations for their likelihood to give rise to immunogenic neoantigens. This approach analyzes the next generation DNA sequencing (NGS-DNA) data and, optionally, the next generation RNA sequencing (NGS-RNA) data of a tumor specimen and the NGS-DNA data of a normal sample obtained from the same patient as described below.

[0168] The personalized approach relies on NGS data obtained by analyzing samples collected from a cancer patient. For each patient, NGS-DNA exome data from tumor DNA are compared to those obtained from normal DNA in order to identify somatic mutations confidently present in the tumor and not in the normal sample that generate changes in the amino acid sequence of a protein.

[0169] Normal exome DNA is further analyzed to determine the patient HLA class I and class II alleles. NGS-RNA data from the tumor sample, if available, is analyzed to determine the expression of genes harbouring the mutations.

[0170] The examples below refer to the following aspect of the invention:

Example 1: Description of the prioritization method Example 2: Application of the prioritization method to an existing literature NGS dataset Example 3: Validation of the prioritization method

[0171] Validation of the prioritization method was performed by measuring its performance against a dataset (published studies) in which both NGS data and immunogenic neoantigens are described. In the example the prioritization method a and b are used. This example shows that by selecting the top 60 neoantigens a very high portion of known immunogenic neoantigens are included in the vaccine, both by using method a (with patient NGS-RNA) or method b (no patient NGS-RNA).

[0172] Example 4: optimization of neoantigen layout for synthetic genes encoding neoantigens to be delivered by a genetic vaccine vector.

[0173] Demonstration that splitting 62 selected neoantigens obtained from a mouse model into two syntetic genes (total 31+31=62 neoantigens) results in improved immunogenicity compared to the use of one synthetic gene encoding for 62 neoantigens.

Example 1: Description of the Priorization Method

[0174] Step 1: Identification of Mutations that can Generate a Neoantigen

[0175] Mutations defined as confidently present in the tumor ideally but not exclusively fulfil the following criteria: [0176] mutation allele frequency (MF) in the tumor DNA sample>=10%, [0177] ratio of the MF between the tumor DNA sample and the control DNA sample>=5, [0178] number of mutated reads at the chromosomal position of somatic variant in the tumor DNA>2, [0179] number of mutated reads at the chromosomal position of somatic variant in the normal DNA<2,

[0180] Two types of somatic mutations are considered within the method of the present invention: single nucleotide variants (SNVs) generating a non-synonymous codon change with a resulting mutated amino acid in a protein and insertions/deletions (indels) that generate frameshift peptides (FSPs) by changing the reading frame of a protein-encoding mRNA.

Step 2: Generate the Structure of Each Neoantigen

Step 2.1:

[0181] For each mutation a neoantigen peptide sequence is generated in the following way:

a) SNVs:

[0182] A 25 amino acid long sequence is generated with the mutated amino located in the centre and flanked, on both sides, by preferably A=12 non-mutated amino acids (FIG. 1). In cases where the mutation is localized close to the N-terminus or C-terminus of the protein less than A=12 non-mutated amino acids will be included. A minimal number of 8 non-mutated amino acids is added either upstream or downstream of the mutation. This ensures that the neoantigen can contain a 9mer neoepitope with at least 1 mutated amino acids. Adding for example 4 non-mutated amino acids upstream and 2 downstream is not possible, this would correspond to a very short protein.

[0183] Occasionally two (or even more) mutations, SNVs and/or indels, are present within a small distance (distance less than or equal to A amino acids) in the protein. In these cases the segment of the A non-mutated amino acids that is added N-terminal or C-terminal will be modified such that the additional mutation(s) is(are) present. (FIG. 1).

[0184] For each neoantigen a MHC class I 9mer epitope prediction is then performed with the patient's HLA alleles identified from the NGS-DNA exome data. The IC50 value associated with the neoantigen is then chosen as the one with the lowest IC50 value across all predicted epitopes that comprise at least 1 mutated amino acids and across all of the patient's class I alleles.

b) Frame-Shift Peptides (FSPs):

[0185] For FSPs maximal N=12 non-mutated amino acids are added at the N-terminus of the FSP (FIG. 2A); if less than 12 non-mutated amino acids are present upstream of the FSP only these are added. In case a SNV leading to a mutated amino acid is present within the added non-mutated segment the mutated amino acid is included. This generates an expanded FSP peptide sequence.

[0186] The resulting expanded FSP peptide sequence is then split into 9 amino acid long fragments and MHC class I 9mer epitope prediction is performed (with the patient's HLA alleles) on all fragments containing at least 1 mutated amino acid. The IC50 value associated with each fragment is then chosen as the lowest predicted IC50 value across all the alleles examined.

[0187] Each 9 amino acid fragment is then expanded into a 25 amino acid long neoantigen sequence by adding the 8 upstream and 8 downstream amino acids to the N-terminal and C-terminal end of the fragment, respectively (FIG. 2B). For 9 amino acid fragments close to the N- or C-terminal end of the expanded FSP less amino acids are added.

[0188] The resulting neoantigen sequences with their associated IC50 are then added to the list of neoantigen sequences obtained from the SNVs.

Step 2.2 (Optional)

[0189] An optional safety filter is then performed on the RSUM ranked list of neoantigens in order to remove those neoantigens that represent a potential risk of inducing autoimmunity. The filter examines if the gene encoding for the neoantigen is part of a black list of genes (for example retrieved from the IEDB database) containing known class I and class II MHC epitopes linked to autoimmune disease. If available, the list also contains the HLA allele of the epitope.

[0190] Neoantigens are removed if their originating mutation is from one of the genes in the black list and at the same time one of the HLA alleles of the patient corresponds to the HLA linked with the gene to autoimmunity disease.

[0191] For genes in the black list where no information on the epitope's HLA allele is available, the neoantigen is removed independently from the patient's HLA alleles.

Step 2.3 (Optional)

[0192] The list of candidate neoantigens is then filtered to remove neoantigens that encode peptides with a low complexity amino acid sequence (presence of segments in the sequence where one or more amino acid(s) are repeated multiple times).

[0193] Once converted into a nucleotide sequences these segments are likely to represent regions with a high content in G or C nucleotides. These regions can therefore generate problems either during the initial construction/synthesis of the vaccine expression cassette and/or they could also negatively affect expression of the encoded polypeptides.

[0194] The identification of low complexity amino acid sequences is performed by estimating the Shannon entropy of the neoantigen sequence divided by its length in amino acids. The Shannon entropy is a metric commonly used in information theory and measures the average minimum number of bits needed to encode a string of symbols based on the alphabet size and the frequency of the symbols.

[0195] In the present method the metric has been applied to the string of amino acids present in neoantigen sequence. Neoantigens that have a Shannon entropy value lower than 0.10 are removed from the list.

Step 3:

Description of the Process for Prioritization of a Patient's Neoantigens

[0196] Data required for performing the prioritization are [0197] List of M neoantigens (from non-synonymous SNVs or frameshift indels) from Step 2 [0198] Mutant allele frequency data for each neoantigen from Step 1 [0199] Expression data for each neoantigen: from RNA sequencing data (Step 1) or, as an alternative method (B) (if no NGS-RNA data is available from the tumor sample), from a general gene-level expression database of the same tumor type [0200] Predicted MHC class I binding affinity for the best mutated 9mer epitope for each neoantigen (from step 3).

[0201] The prioritization strategy is based on an overall score obtained by the combination of three separate independent rank score values (RFREQ, REXPR, RIC50). The three rank score values are obtained by ordering the list of M neoantigens independently according to one of the following parameters (the result will therefore be three different ordered lists of neoantigens, each list thus providing a rank score).

Step 3.1: Allele Frequency Rank Score (RFREQ)

[0202] Each neoantigens is associated with the observed tumor allele frequency of the mutation generating the neoantigen. The list of M neoantigens is ordered from the highest allele frequency to the lowest allele frequency. The neoantigen with the highest allele frequency has a rank score RFREQ equal to 1, the second highest a rank score RFREQ=2 and so on. If neoantigens with identical allele frequency are present they are given the same rank score RFREQ, i.e. the lowest rank score might be less than M (Table 1)

TABLE-US-00001 TABLE 1 Neoantigens with equal mutant allele frequency get the same rank score RFREQ Mutant allele frequency RFREQ SNV101 0.48 1 SNV16 0.43 2 SNV34 0.35 3 SNV87 0.33 4 SNV23 0.32 5 FSP4_5 0.3 6 SNV120 0.28 7 SNV11 0.26 8 SNV67 0.21 9 SNV18 0.21 9 SNV109 0.2 10

Step 3.2: RNA Expression Rank Score (REXPR)

[0203] The expression level of each neoantigen is determined from the tumor NGS-RNA data by calculating the gene-centred Transcripts Per Kilobase Million (TPM) value (Li & Dewey, 2011) considering all mapped reads. The TPM value is then modified taking into account the number of mutated and wild type reads spanning the location of the mutation in the NGS-RNA transcriptome data (corrTPM):

corrTPM = TPM .function. ( gene ) * ( num .times. .times. reads .times. .times. ( mut ) + 0 . 1 num .times. .times. reads .times. .times. ( mut ) + numreads .function. ( w .times. t ) + 0 . 1 ) ##EQU00002##

[0204] A preferred value of 0.1 is added to both the numerator and enumerator in order to include also cases where no reads are present at the location of the mutation.

[0205] If no NGS-RNA sequencing data is available from the patient's tumor, the corrTPM is replaced, for each neoantigen, by the corresponding gene's median TPM value as present in an expression database from the same tumor type.

[0206] Neoantigens are then ranked according to the expression level as determined by the corrTPM value. Ordering is from highest expression (score REXP equal to 1) down to lowest expression. Neoantigens with the same corrTPM value are given the same rank score REXPR (Table 2).

TABLE-US-00002 TABLE 2 Neoantigens with equal expression value corrTPM get the same rank score REXPR corrTPM REXPR SNV11 47.53 1 SNV88 46.9 2 SNV34 37.64 3 SNV67 29.72 4 SNV23 26.12 5 SNV55 21.66 6 SNV63 21.37 7 SNV34 17.74 8 SNV93 17.74 8 SNV18 11.52 9 FSP4_5 10.41 10

Step 3.3: HLA Class-I Binding Prediction (RIC50)

[0207] For each SNV or FSP-derived neoantigen peptide, the likelihood of MHC class I binding is defined as the best predicted (lowest) IC50 value among all predicted 9mer epitopes that include the mutated amino acid(s) or include one mutated amino acid from the FSP. Prediction is performed only against the MHC class I alleles present in the patient determined by analysis of the normal DNA sample.

[0208] The list of neoantigens is then ordered from the lowest predicted IC50 value (RIC50 score equal to 1) to the highest predicted IC50 value. Neoantigens with the same IC50 value are given the same rank score RIC50 (Table 3).

TABLE-US-00003 TABLE 3 Neoantigens with equal IC50 values get the same rank score RIC50 IC50 RIC50 SNV67 1 1 SNV11 1.3 2 SNV23 3.5 3 SNV61 3.8 4 SNV26 4.2 5 SNV62 4.2 5 SNV105 7.2 6 SNV69 8.4 7 SNV18 9.6 8 SNV34 12.7 9 FSP4_5 16.4 10

Step 3.4:

[0209] The final prioritization (ranking) of the neoantigens is then done by calculating a weighted sum (RSUM) of the 3 individual rank scores and ranking the neoantigens from lowest to highest RSUM value (FIG. 3). Weighting is applied in the following way:

RSUM=(RFREQ+REXPR+(k+RIC50))*WF Formula (I):

[0210] In formula (I) k is a constant value that is added to the RIC50 value in the case the predicted epitope has an IC50 value higher than 1000 nM (this penalizes neoantigens with a high RIC50 score value, i.e. with a high IC50 value).

[0211] The value for k is determined in the following way.

k = { M = .times. number .times. .times. of .times. .times. candidate .times. .times. neoantigens if .times. .times. MHCI IC .times. .times. 50 .times. .times. prediction > 1000 .times. nM 0 if .times. .times. MHCI IC .times. .times. 50 .times. .times. prediction .ltoreq. 1000 .times. nM ##EQU00003##

[0212] Occasionally NGS-RNA data, for technical reasons, does not provide coverage at the location of the mutation, neither for the non-mutated amino acids nor for the mutated amino acids in an otherwise expressed gene. WF is a down-weighting factor (down-weighting because the resulting RSUM value is increased and the neoantigen is ranked further down in the list) taking into account cases where no mutated reads were observed in the NGS-RNA transcriptome data.

WF = { 1 mut .times. .times. reads .times. .times. RNAseq > 0 2 mut .times. .times. reads .times. .times. RNAseq = 0 ; wt .times. .times. reads .times. .times. RNAseq = 0 ; TPM .gtoreq. 0.50 3 mut .times. .times. reads .times. .times. RNAseq = 0 ; wt .times. .times. reads .times. .times. RNAseq > 0 ; TPM .gtoreq. 0.50 4 mut .times. .times. reads .times. .times. RNAseq = 0 ; wt .times. .times. reads .times. .times. RNAseq = 0 ; TPM < 0.50 5 mut .times. .times. reads .times. .times. RNAseq = 0 ; wt .times. .times. reads .times. .times. RNAseq > 0 ; TPM < 0.50 ##EQU00004##

[0213] This generates a RSUM ranked list of neoantigens.

[0214] Neoantigens that have the same RSUM score are further prioritized according to their RIC50 score (FIG. 3). If both the RSUM score and the RIC50 score are identical neoantigens are further prioritized according to their REXPR score. In case the RSUM score, the RIC50 score and the REXPR score are identical neoantigens are further prioritized according to their RFREQ score. In case the RSUM score, the RIC50 score, the REXPR and the RFREQ score are identical neoantigens are further prioritized according to the uncorrected gene-level TPM value.

Step 4:

Step 4.1:

[0215] The final list of M ranked neoantigens is then analyzed by a method that determines which and how many neoantigens can be included in the vaccine vector.

[0216] The method works with an iterative procedure. At each iteration a list of the N best ranked neoantigens necessary to reach the maximum insert size of L amino acids (preferably 1500 amino acids) is created. If the list of N neoantigens contains more than one partially overlapping neoantigens derived from the same FSP, a merging step is performed to avoid the inclusion of redundant stretch of the same amino acid sequence. (FIG. 4). If after the merging step, the total length of the included neoantigens still does not reach the maximum desired insert size, a new iteration is performed by adding the next neoantigen from the ranked list.

[0217] The procedure stops when adding the next neoantigen to the already selected list of N neoantigens would exceed the maximum desired insert size L.

[0218] The precise value of N can therefore decrease due to the presence of merged FSP-derived neoantigens (length longer than a 25mer) or increase due to the presence of neoantigens containing mutations close to the N- or C-terminus of the protein (these neoantigens will be shorter than a 25mer).

[0219] Output is a list of N neoantigens with a total length less or equal to L=1500aa.

Step 4.2:

[0220] The ordered list is then split into two parts of approximately equal length (FIG. 5). The skilled person is aware that a number of different ways are feasible how to split the list into two parts.

Step 4.3:

[0221] The list of N selected neoantigen sequences is then re-ordered according to a method that minimizes the formation of predicted junctional epitopes that may be generated by the juxtaposition of two adjacent neoantigen peptides in an assembled polyneoantigen polypeptide. One million of scrambled layouts of the assembled polyneoantigen are generated each with a different neoantigen order. Each layout is then analyzed to determine the number of predicted junctional epitopes with an IC50<=1500 nM for one of the patient's HLA alleles. While looping over all one million layouts the layout with the minimal number of predicted junctional epitopes encountered up to that point is remembered. If later on a second layout with the same minimal number of predicted junctional epitopes is found the layout first encountered is kept.

Example 2: Application of the Priorization Method to One Existing Literature Dataset

[0222] The prioritization method described in Example 1 was applied to a NGS dataset from a pancreatic cancer sample (Pat_3942; Tran et al. 2015) for which one experimentally validated immunogenic reactivity has been reported. Tumor/normal exome and the tumor transcriptome NGS raw data were downloaded from the NCBI SRA database [SRA IDs:SRR2636946; SRR2636947; SRR4176783] and analyzed with a pipeline that characterizes the patient's mutanome.

[0223] The mutation detection pipeline utilized comprised 8 steps:

a) Quality control and optimization of reads: [0224] Preliminary quality control of the raw sequence data was performed with FastQC 0.11.5 (Andrews, https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) Paired reads with length less than 50 bp were filtered out. After visual inspection, the remaining reads were optionally trimmed at the 5' and 3' end using Trimmomatic-0.33 (Bolger et al., 2014) to remove sequenced bases with low quality and to improve the quality of reads suitable (QC-filtered reads) for alignment to the reference genome. b) Read alignment against the reference genome: [0225] The QC-filtered DNA reads were then aligned against the human reference genome version GRCh38/hg38 by using the BWA-mem algorithm (Li & Durbin, 2009) with default parameters. The QC-filtered RNA reads were aligned using the Hisat2 2.2.0.4 (Kim et al., 2015) software keeping all parameters as default. Read pairs for which only one read was aligned and paired reads that aligned to more than one genomic locus with the same mapping score were filtered out using Samtools 1.4 (Li et al., 2009).

c) Alignment Optimization:

[0225] [0226] DNA read alignments were further processed by a procedure that optimized the local alignment around small insertions or deletions (indels), marked duplicated reads and recalibrated the final base quality score in the realigned regions. Indel realignment was performed using tools RealignerTargetCreator and IndelRealigner from the GATK software version 3.7 (McKenna et al., 2010). Duplicated reads were detected and marked using MarkDuplicates from Picard version 2.12 (http://broadinstitute.github.io/picard). Base quality score recalibration was performed using BaseRecalibrator and PrintReads of GATK version 3.7 (McKenna et al., 2010). Polymorphisms annotated in the human dbSNP138 release (https://www.ncbi.nlm.nih.gov/projects/SNP/snp_summary.cgi?view+summary=v- iew+summary&build_id=138) were used as a list of known sites in order to generate the base recalibration model.

d) HLA Determination:

[0226] [0227] Patient-specific HLA class-I type assessment was performed by aligning the QC-filtered DNA reads from the normal sample on the portion of hg38 genome that encodes the class-I human haplotypes with BWA-mem (Li & Durbin, 2009). Read pairs for which only one read was aligned and read pairs aligned to more than one locus with the same mapping score were filtered out using Samtools 1.4 (Li et al., 2009). Finally, determination of the most likely haplotypes of the patient was performed with the optytipe software (Szolek et al., 2014). HLA class-II type assessment was performed by aligning the QC-filtered DNA reads from the normal sample on the portion of hg38 genome that encodes the class-II human haplotypes with BWA-mem (li & Durbin, 2009). Determination of the most likely class-II haplotypes of the patient was performed with the HLAminer software (Warren et al., 2012).

e) Variant Calling:

[0227] [0228] Somatic variant calling of single nucleotide variants (SNVs) and small indels is performed on the recalibrated DNA read data by mutect2 (Cibulskis et al., 2012) included in GATK version 3.7 [25] and by Varscan2 2.3.9 (Koboldt et al., 2012) by explicitly comparing the tumor sample vs. the normal control sample. All parameters were kept to default. SCALPEL (Fang et al., 2014) with default parameters was used as additional tool for variant calling of indels. Signifiant somatic variants, detected by at least one of the algorithms, were then mapped onto the human Refseq transcriptome using the Annovar software (Wang et al., 2010) and further filtered. Only SNVs that generate non-synonymous (missense) change in a codon or indels that generate a change of the reading frame within the coding sequence of protein-coding genes (frameshift indels) were retained. SNVs that generate premature stop-codons were excluded. For each detected variant, the number of mutated and wt reads observed in the aligned NGS data from DNA and RNA samples was then determined with a custom tool that utilizes mpileup of Samtools 1.4 (Li et al., 2009).

f) Neoantigen Generation:

[0228] [0229] Each somatic variant was translated into a peptide containing the mutated amino acid. For SNVs the neoantigen peptides were generated by adding 12 wild type amino acids upstream and downstream of the mutated amino acid. Exceptions in length occurred for 5 mutations for which the mutated amino acid was mapped at less of 12 amino acids of distance from the N-terminal or from the C-terminal. Multiple 25-mer peptides were generated in 3 cases in which a SNV induced an amino acid change in multiple alternative splicing iso forms with distinct protein sequences. For the indels generating FSP were added 12 wild type amino acids upstream to the first new amino acid. Modified FSPs that have a final length of at least nine amino acids were retained.

g) Neoantigens' HLA-I Binding Predictions:

[0229] [0230] The likelihood of MHC-I binding was determined as the best predicted (lowest) IC50 value among all predicted 9-mer epitopes that include the mutated amino acid(s). Predictions were performed by using the IEDB_recommended method of the IEDB software (Moutaftsi et al., 2006). The netMHCpan (Hoof et al., 2009) method was used in case a MHC-I haplotype was not covered by the IEDB_recommended method (Moutaftsi et al., 2006).

h) Final Selection of Confident Variants:

[0230] [0231] The initial list of SNVs and indels causing a frameshift was then further reduced by selecting only mutations that fulfil the following criteria: [0232] mutation allele frequency (MF) in the tumor DNA sample>=10% [0233] ratio of the MF in the tumor DNA sample and in the control DNA sample>=5 [0234] mutated reads at chromosomal position of somatic variant in the tumor DNA>2 [0235] mutated reads at chromosomal position of somatic variant in the normal DNA<2

[0236] The final list of 129 neoantigen encoding mutations confidently detected in patient Pat_3942 included 4 frameshift generating indels and 125 SNVs. The 125 SNVs generate 128 neoantigens, 3 out of which derived from mutations mapped on multiple alternative splicing isoforms. The 4 frameshift indels generate 4 FSPs with a total length of 307 amino acids and a total of 260 neoantigen sequences. The total length of all 388 neoantigens derived either from SNVs or frameshift indels was 3942 amino acids.

[0237] The maximal insert size (including expression control elements) that can be accommodated by genetic vaccines, for example adenoviral vectors, is limited thus imposing a maximal size of L amino acids to the encoded polyneoantigen. Typical values for L for adenoviral vectors are in the order of 1500 amino acids, smaller than the cumulative length of 3942 amino acids for all neoantigens. The prioritization strategy described in Example 1 was therefore applied in order to select an optimal subset of ranked neoantigens compatible with the 3942 amino acid limit

[0238] Table 4 reports all 60 selected neoantigens selected to reach a cumulative length of 1485 aa. The selection process included 6 neoantigen sequences derived from the FSP chr11:1758971_AC_-(2 nucleotide deletion), 2 neoantigen sequences from the FSP chr6:168310205_-_T (1 nucleotide insertion) and 1 neoantigen sequences from FSP chr163757295_GATAGCTGTAGTAGGCAGCATC_-(22 nucleotide deletion; SEQ ID NO:185). During selection several overlapping FSP-derived neoantigen sequences were merged in order to remove redundant sequence segments (Table 5). Details of the merged neoantigen sequences are shown in FIG. 6.

[0239] All neoantigen sequences generated by the 129 confidently detected mutations in Pat_3942 are listed in Table 6 including the associated values of the three parameters (mutant allele frequency MFREQ, corrected expression value corrTPM, best predicted IC50 value for MHC class I 9mer epitopes MIC50), the resulting three independent rank scores (RFREQ, REXPR, RIC50), the weighting factor WF, the weighted RSUM value and the resulting RSUM rank.

[0240] Importantly, all three neoantigen sequences reported to induce T-cell reactivity in the patient (Tran et al., 2015) were selected within the top 60 neoantigens by the prioritization strategy.

TABLE-US-00004 TABLE 4 List of 60 neoantigens selected for the Pat_3942. Mutated aa in SNV-derived neoantigens are indicated in bold. For FSP-derived neoantigens amino acids that are part of the frameshift peptide are also in bold. Neoantigen sequences with experimentally verified to induce T-cell reactivity are labelled TP in the column "Final Rank" .Genomic coordinates given are with respect to human genome assembly GRch38/hg38. ID (COORD; SEQ BEST WT; ID NEO- Corr PRED. NEOAG FINAL MUT) NO: ANTIGEN LENGTH AFREQ TPM TPM IC50 RFREQ REXPR RIC50 RSUM WF RANK RANK chr17: 12 YIRLVEP 25 0.71 53.33 46.90 269.58 6 6 32 44 1 1 1 74748 GSPAENA 996_G_C GLLAGDR LVEV chr11: 13 YFWNIAT 25 0.42 9.30 4.01 84.40 31 35 12 78 1 2 2 117189 IAVFYV 364_C_T LPVVQLV ITYQT chr14: 14 VTLEDFY 25 0.33 88.08 37.64 12.02 71 8 2 81 1 3 3 228755 GVFSSL 65_C_T GYTHLAS VSHPQ chr2: 15 EKCQFAH 25 0.38 113.35 47.53 250.90 50 5 31 86 1 4 4 432252 GFHELC 54_G_A SLTRHPK YKTEL chr11: 16 TPDFTSL 25 0.40 57.51 29.72 289.70 40 10 36 86 1 5 5 664928 DVLTFV 72_C_T GSGIPAG INIPN chr11: 17 SAFGAGF 25 0.42 56.16 21.37 416.00 34 14 40 88 1 6 6 739756 CTTVIT 12_C_T SPVDWK TRYMN chr22: 18 ESLHSIL 25 0.63 12.42 11.52 795.10 12 19 57 88 1 7 7 193558 AGSDMM 53_G_A VSQILLT QHGIP chr1: 19 AMRLLHD 25 0.39 33.40 17.74 204.82 45 15 29 89 1 8 8 160292 QVGVIL 5892_T_A FGPYKQL FLQTY chr8: 20 APTEHKA 25 0.42 56.91 26.12 487.10 33 11 45 89 1 9 9 226189 LVSHNA 194_G_C SLINVGS LLQRA chr3: 21 LPRGLSL 25 0.38 5.70 5.70 108.60 46 29 18 93 1 10 10 184338 SSLGSV 462_C_T RTLRGWS RSSRP chr1: 22 ERWEDVK 25 0.37 43.68 21.66 207.98 52 13 30 95 1 11 11 206732 EEMTSD 591_C_A LATMRVD YEQIK chr1: 23 LYSCIAL 25 0.72 3.15 3.15 761.20 4 37 56 97 1 12 12 928434 KVTANK 66_G_T MEMEHSL ILNNL chr6: 24 LVLSLVF 25 0.37 24.54 10.41 183.20 54 21 25 100 1 13 13 137200 ICFYIR 930_T_C KINPLKE KSIIL chrX: 25 PFSTLTP 22 0.33 26.41 9.15 48.58 70 25 7 102 1 14 14 531929 RLHLPY 98_C_T PQQPPQQ QL chr14: 26 AANIPRS 25 0.40 7.69 5.78 683.30 37 28 52 117 1 15 15 716856 ISSDGH 16_G_A PLERRLS PGSDI chr8: 27 YYIVRVL 25 0.35 1.02 0.82 31.80 65 53 6 124 1 16 16 707342 GTLGIM 06_T_A TVFWVCP LTIFN chr13: 28 WQLRFSH 25 0.24 28.04 9.87 17.86 98 23 4 125 1 17 17 237601 LVGYGG 77_G_C RYYSYLM SRAVA chr1: 29 HYTQSET 25 0.44 0.88 0.46 483.56 24 61 44 129 1 18 18 237783 EFLLSS 918_G_C AETDENE TLDYE chr2: 30 QSISRNH 25 0.37 10.33 10.33 930.40 54 22 65 141 1 19 19 156568 VVDISK TP 935_G_A SGLITIA GGKWT chr2: 31 LLQCVQK 25 0.31 5.52 2.27 181.12 77 43 24 144 1 20 20 203049 MADGLQ 917_G_C EQQQALS ILLVK chr11: 32 TGLFGQT 25 0.28 12.56 5.48 184.10 88 30 27 145 1 21 21 376291 NTGFGD TP 2_G_T VGSTLFG chr7: NNKLT 604100 33 LQENGLA 25 0.28 43.46 24.50 559.50 88 12 49 149 1 22 22 2_A_T GLSAST IVEQQLP LRRNS chr11: 34 GSLSGYL 30 0.31 460.80 2.03 279; 79 44 34 157 1 23; 23 175897 SQDTV 1126.6; 52; 1_AC_-- GALPVSV 1161.9; 53; VSLCP 1694.6 59 GRCQSG chr18: 35 SYAEQGT 25 0.64 0.89 0.89 131.70 9 52 20 162 2 24 24 824417 NCDEAV 3_T_G SFMDTHN LNGRS chr7: 36 NAMDQLE 25 0.33 4.53 2.80 795.92 72 39 58 169 1 25 25 120953 QRVSEL 341_C_G FMNAKKN KPEWR chr7: 37 GDAEAEA 25 0.29 28.56 12.60 944.20 87 17 67 171 1 26 26 100866 LARSAS 373_A_G ALVRAQQ GRGTG chr9: 38 MRNLKF 18 0.45 6.22 6.22 419.90 21 27 41 178 2 27 27 108931 FRTLEFR 129_T_A DIQGP chr6: 39 ARPPGSV 31 0.27 2.65 1.34 391.51; 92 48 38 178 1 28; 28 168310 EDAGQ 841.6 31 205_--_T AVGHILA QACVY RAVQCSR chr11: 40 PEHLLLL 18 0.31 460.80 2.03 833.33 79 44 60 183 1 29 29 175897 PEQGP 1_AC_-- RCAAWG chr3: 41 VHWTVDQ 25 0.41 0.77 0.77 15.81 36 54 3 186 2 30 30 786612 QSQYIK 37_G_T GYKILYR PSGAN chr7: 42 ETTSHST 25 0.23 9.63 9.63 104.10 101 24 16 280 2 32 31 100958 PGFTSL 504_C_T ITTTETT SHSTP chr4: 43 PVFTHEN 25 0.67 0.77 0.07 50.32 7 83 8 294 3 33 32 185593 IQGGGV 889_T_A PFQALYN YTPRN chrX: 44 TTLSSIK 25 0.43 0.75 0.75 937.87 27 56 66 298 2 34 33 332132 VEVASR 8_T_G QAETTTL DQDHL chr16: 45 CCYGKQL 24 0.13 4.88 4.88 689.40 102 33 53 376 2 35 34 375729 CTIPRR 5_GATAG IGIISVR CTGTAG SVSQ TAGGCA GCAT C_-- chr1: 46 DVLADDR 25 0.37 0.88 0.08 2.77 57 80 1 414 3 36 35 237591 DDYDFM 836_T_A MQTSTYY YSVRI chr16: 47 ALTGAWA 25 0.33 1.15 0.10 22.00 73 77 5 465 3 37 36 359742 MEDFYM 2_G_A ARLVPPL VPQRP chr6: 48 CPNQKVL 25 0.50 0.03 0.03 100.85 17 92 15 496 4 38 37 497332 KYYYVW 09_G_C QYCPAGN WANRL chr13: 49 QDGIPGD 25 0.25 5.20 0.25 53.80 97 66 9 516 3 39 38 242229 EGLELL 01_G_T SADSAVP VAMTQ chr2: 50 TNSTAAS 25 0.43 472.90 166.15 2115.34 28 2 500 530 1 40 39 700880 RPPVTQ 42_T_A RLVVPAT QCGSL chr13: 51 QEIEEKL 25 0.375 68.76 31.79 1381.75 51 9 476 536 1 41 40 106559 IEEETL 614_C_A RRVEELV AKRVE chr15: 52 TDFIREE 25 0.61 1.82 1.82 1618.50 13 46 480 539 1 42 41 101686 YHKRDI 041_A_T TEVLSPN MYNSK chr16: 53 MSEAC 17 0.35 27.87 16.09 1144.35 62 16 466 544 1 43 42 65003.sub.-- RDSTSSL G_A QRKKP chr17: 54 HDKEVYD 25 0.71 11.87 11.87 3393.50 5 18 526 549 1 44 43 635835 IAFSRT 26_G_A GGGRDMF ASVGA chr6: 55 EIPTAAL 25 0.35 13.08 8.86 1039.10 65 26 461 552 1 45 44 876059 VLGVNI 25_G_A TDHDLTF GSLTE chr16: 56 SSLIIHQ 25 0.47 0.43 0.43 1629.60 19 62 482 563 1 46 45 252401 RTHTGK 54_C_T KPYQCGE chr17: CGKSF 767380 57 SGNLLGR 25 0.73 43.46 43.46 4847.50 3 7 553 563 1 47 46 3_G_A NSFEVC VCACPGR DRRTE

chr6: 58 SCLLILE 25 0.43 0.01 0.01 75.89 28 103 10 564 4 48 47 730419 FVMIVI 54_G_A FGLEFII RIWSA chr19: 59 LTEGQKR 25 0.38 0.07 0.07 83.74 48 82 11 564 4 49 48 127533 YFEKLL 03_G_C IYCDQYA SLIPV chr6: 60 QAPTPAP 25 0.45 1190.79 550.66 4742.67 22 1 549 572 1 50 49 307444 STIPGL 39_G_A RRGSGPE IFTFD chr1: 61 VAIIPYF 25 0.63 0.02 0.02 357.40 11 96 37 576 4 51 50 110603 ITLGTQ 966_C_G LAEKPED AQQGQ chr11: 62 PGHGLPP 25 0.31 460.80 2.03 1202.07 79 44 468 591 1 54 51 175897 HLRQQR 1_AC_-- AARLRQP DAAEA chr7: 63 IIEKHFG 25 0.38 2.82 1.00 2045.92 48 51 498 597 1 55 52 991737 EEEDER TP 80_G_C QTLLSQV IDQDY chr16: 64 YEIGRQF 25 0.37 150.39 71.89 4282.32 56 3 542 601 1 56 53 756317 RNEGIH 89_C_G LTHNPEF TTCEF chr2: 65 RLMWKSQ 25 0.31 0.73 0.03 281.00 76 91 35 606 3 57 54 202961 YVPYDE 406_G_A IPFVNAG SRAVV chr9: 66 QAQSKFK 25 0.35 13.35 5.38 2391.60 67 31 508 606 1 58 55 113176 SEKQNQ 616_C_T KQLELKV TSLEE chr12: 67 SFCDGLV 25 0.42 2.27 1.19 3437.40 33 49 527 609 1 60 56 122986 HDPLRQ 679_G_C KANFLKL LISEL chr9: 68 LDGGDFV 25 0.38 18.72 4.24 3526.80 50 34 532 616 1 61 57 127953 SLSSRK 924_C_T EVQENCV RWRKR chr3: 69 QSLPLET 25 0.75 0.00 0.00 502.77 1 107 47 620 4 62 58 154427 FSFLLI 638_G_A LLATTVT PVFVL chr7: 70 GKFDELA 25 0.35 0.13 0.13 2006.53 63 72 493 628 1 63 59 456486 TENHCH 83_G_A RIKILGD CYYCV chr20: 71 VGSSLPE 25 0.26 169.84 50.85 3489.10 96 4 531 631 1 64 60 359541 ASPPAL 42_G_A EPSSPNA AVPEA

TABLE-US-00005 TABLE 5 Merged FSP-derived neoantigens for Pat_3492. Amino acids that are part of the frameshift peptide (mutated amino acids) are indicated in bold. Genomic coordinates given are with respect to human genome assembly GRch38/hg38. Merged FSP BEST (SEQ ID Final NEOAG Corr PRED. NEOAG ID NO) rank PEPTIDE AFREQ TPM TPM IC50 RFREQ REXPR RIC50 RSUM WF RANK chrll: GSLSGYL 23 GSLSGY 0.31 460.8 2.03 279 79 44 34 157 1 23 1758 SQDTVG LSQDTV 971.sub.-- ALPVSV GALPVS AC_-- VSLCPG VVSLC RCQSG (SEQ ID (SEQ ID NO: 73) NO: 72) chr11: YLSQDT 0.31 460.8 2.03 1126.6 79 44 465 588 1 52 1758 VGALPV 971.sub.-- SVVSLC AC_-- PGRCQS G (SEQ ID NO: 74) chr11: LSGYLS 0.31 460.8 2.03 1161.9 79 44 467 590 1 53 1758 QDTVGA 971.sub.-- LPVSVV AC_-- SLCPGR C (SEQ ID NO: 75) chr11: SGYLSQ 0.31 460.8 2.03 1694.6 79 44 483 606 1 59 1758 DTVGAL 971.sub.-- PVSVVS AC_-- LCPGRC Q (SEQ ID NO: 76) chr6: ARPPGS 28 ARPPGS 0.27 2.65 1.34 841.6 92 48 61 201 1 31 1683 VEDAGQ VEDAG 1020 AVGHIL QAVGHI 5_--_T AQACV LAQAC YRAVQC (SEQ ID SR NO: 78) (SEQ ID chr6: NO: 77) EDAGQA 0.27 2.65 1.34 381.51 92 48 38 178 1 28 1683 VGHILA 1020 QACVYR 5_--_T AVQCSR (SEQ ID NO: 79)

TABLE-US-00006 TABLE 6 All 388 neoantigens for Pat_3492 ordered by their RSUM rank. For FSP-derived neoantigens amino acids that are part of the frameshift peptide are also in bold. Neoantigen sequences with experimentally verified to induce T-cell reactivity are labelled TP in the column "Final Rank". Genomic coordinates given are with respect to human genome assembly GRch38/hg38. corr BEST NEOAG ID TYPE AFREQ TPM TPM IC50 RFREQ REXPR RIC50 RSUM WF RANK chr17:74748996_G_C SNV 0.71 53.33 46.90 269.58 6 6 32 44 1 1 chr11:117189364.sub.-- SNV 0.42 9.30 4.01 84.40 31 35 12 78 1 2 C_T chr14:22875565_C_T SNV 0.33 88.08 37.64 12.02 71 8 2 81 1 3 chr2:43225254_G_A SNV 0.38 113.35 47.53 250.90 50 5 31 86 1 4 chr11:66492872_C_T SNV 0.40 57.51 29.72 289.70 40 10 36 86 1 5 chr11:73975612_C_T SNV 0.42 56.16 21.37 416.00 34 14 40 88 1 6 chr22:19355853_G_A SNV 0.63 12.42 11.52 795.10 12 19 57 88 1 7 chr1:160292592_T_A SNV 0.39 33.40 17.74 204.82 45 15 29 89 1 8 chr8:22618914_G_C SNV 0.42 56.91 26.12 487.10 33 11 45 89 1 9 chr3:184338462_C_T SNV 0.38 5.70 5.70 108.60 46 29 18 93 1 10 chr1:206732591_C_A SNV 0.37 43.68 21.66 207.98 52 13 30 95 1 11 chr1:92843466_G_T SNV 0.72 3.15 3.15 761.20 4 37 56 97 1 12 chr6:137200930_T_C SNV 0.37 24.54 10.41 183.20 54 21 25 100 1 13 chrX:53192998_C_T SNV 0.33 26.41 9.15 48.58 70 25 7 102 1 14 chr14:71685616_G_A SNV 0.40 7.69 5.78 683.30 37 28 52 117 1 15 chr8:70734206_T_A SNV 0.35 1.02 0.82 31.80 65 53 6 124 1 16 chr13:23760177_G_C SNV 0.24 28.04 9.87 17.86 98 23 4 125 1 17 chr1:237783918_G_C SNV 0.44 0.88 0.46 483.56 24 61 44 129 1 18 chr2:156568935_G_A SNV 0.37 10.33 10.33 930.40 54 22 65 141 1 19 chr2:203049917_G_C SNV 0.31 5.52 2.27 181.12 77 43 24 144 1 20 chr11:3762912_G_T SNV 0.28 12.56 5.48 184.10 88 30 27 145 1 21 chr7:6041002_A_T SNV 0.28 43.46 24.50 559.50 88 12 49 149 1 22 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 279.00 79 44 34 157 1 23 chr18:8244173_T_G SNV 0.64 0.89 0.89 131.70 9 52 20 162 2 24 chr7:120953341_C_G SNV 0.33 4.53 2.80 795.92 72 39 58 169 1 25 chr7:100866373_A_G SNV 0.29 28.56 12.60 944.20 87 17 67 171 1 26 chr9:108931129_T_A SNV 0.45 6.22 6.22 419.90 21 27 41 178 2 27 chr6:168310205_--_T FSP 0.27 2.65 1.34 391.51 92 48 38 178 1 28 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 833.33 79 44 60 183 1 29 chr3:78661237_G_T SNV 0.41 0.77 0.77 15.81 36 54 3 186 2 30 chr6:168310205_--_T FSP 0.27 2.65 1.34 841.60 92 48 61 201 1 31 chr7:100958504_C_T SNV 0.23 9.63 9.63 104.10 100 24 16 280 2 32 chr4:185593889_T_A SNV 0.67 0.77 0.07 50.32 7 83 8 294 3 33 chrX:3321328_T_G SNV 0.43 0.75 0.75 937.87 27 56 66 298 2 34 chr16:3757295_GATA FSP 0.13 4.88 4.88 689.40 102 33 53 376 2 35 TGTAGTAGGCAGCAT GCC_-- chr1:237591836_T_A SNV 0.37 0.88 0.08 2.77 57 80 1 414 3 36 chr16:3597422_G_A SNV 0.33 1.15 0.10 22.00 73 77 5 465 3 37 chr6:49733209_G_C SNV 0.50 0.03 0.03 100.85 17 92 15 496 4 38 chr13:24222901_G_T SNV 0.25 5.20 0.25 53.80 97 66 9 516 3 39 chr2:70088042_T_A SNV 0.43 372.90 166.15 2115.34 28 2 500 530 1 40 chr13:10655961 SNV 375.00 68.76 31.79 1381.75 51 9 476 536 1 41 3_G_A chr15:10168604 SNV 0.61 1.82 1.82 1618.50 13 46 480 539 1 42 1_A_T chr16:65003_G_A SNV 0.35 27.87 16.09 1144.35 62 16 466 544 1 43 chr17:63583526_G_A SNV 0.71 11.87 11.87 3393.50 5 18 526 549 1 44 chr6:87605925_G_A SNV 0.35 13.08 8.86 1039.10 65 26 461 552 1 45 chr16:25240154_C_T SNV 0.47 0.43 0.43 1629.60 19 62 482 563 1 46 chr17:7673803_G_A SNV 0.73 43.46 43.46 4847.50 3 7 553 563 1 47 chr6:73041954_G_A SNV 0.43 0.01 0.01 75.89 28 103 10 564 4 48 chr19:12753303_G_C SNV 0.38 0.07 0.07 83.74 48 82 11 564 4 49 chr6:30744439_G_A SNV 0.45 1190.79 550.66 4742.67 22 1 549 572 1 50 chr1:110603966_C_G SNV 0.63 0.02 0.02 357.40 11 96 37 576 4 51 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 1126.60 79 44 465 588 1 52 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 1161.90 79 44 467 590 1 53 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 1202.07 79 44 468 591 1 54 chr7:99173780_G_C SNV 0.38 2.82 1.00 2045.92 48 51 498 597 1 55 chr16:75631789_C_G SNV 0.37 150.39 71.89 4282.32 56 3 542 601 1 56 chr2:202961406_G_A SNV 0.31 0.73 0.03 281.00 76 91 35 606 3 57 chr9:113176616_C_T SNV 0.35 13.35 5.38 2391.60 67 31 508 606 1 58 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 1694.60 79 44 483 606 1 59 chr12:12298667 SNV 0.42 2.27 1.19 3437.40 33 49 527 609 1 60 9_G_C chr9:127953924_C_T SNV 0.38 18.72 4.24 3526.80 50 34 532 616 1 61 chr3:154427638_G_A SNV 0.75 0.00 0.00 502.77 1 107 47 620 4 62 chr7:45648683_G_A SNV 0.35 0.13 0.13 2006.53 63 72 493 628 1 63 chr20:35954142_G_A SNV 0.26 169.84 50.85 3489.10 96 4 531 631 1 64 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 2532.96 79 44 510 633 1 65 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 2839.18 79 44 513 636 1 66 chr14:10514734 SNV 0.27 25.00 10.81 3223.39 95 20 523 638 1 67 6_G_A chr1:50195710_G_T SNV 0.37 0.06 0.06 141.47 53 85 22 640 4 68 chr10:7172643_C_G SNV 375.00 0.22 0.22 466.80 51 67 42 640 4 69 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 3107.70 79 44 517 640 1 70 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 3108.98 79 44 518 641 1 71 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 3214.82 79 44 522 645 1 72 chr6:168310205_--_T FSP 0.27 2.65 1.34 2289.13 92 48 505 645 1 73 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 3653.37 79 44 533 656 1 74 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 3971.20 79 44 538 661 1 75 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 4165.90 79 44 540 663 1 76 chr6:168310205_--_T FSP 0.27 2.65 1.34 3305.80 92 48 524 664 1 77 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 4356.25 79 44 545 668 1 78 chr6:168310205_--_T FSP 0.27 2.65 1.34 3463.60 92 48 529 669 1 79 chr19:15238949_C_T SNV 0.37 11.00 5.09 6845.76 58 32 580 670 1 80 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 4759.12 79 44 550 673 1 81 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 4946.07 79 44 554 677 1 82 chr6:125081449_C_A SNV 0.47 0.13 0.01 89.20 19 104 13 680 5 83 chr11:56642316_T_C SNV 0.31 0.16 0.16 138.80 78 71 21 680 4 84 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 5336.03 79 44 558 681 1 85 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 6066.90 79 44 567 690 1 86 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 6138.94 79 44 569 692 1 87 chr6:168310205_--_T FSP 0.27 2.65 1.34 4806.94 92 48 552 692 1 88 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 6399.44 79 44 576 699 1 89 chr9:35396877_G_C SNV 0.32 8.21 1.43 7055.49 75 47 584 706 1 90 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 7057.30 79 44 585 708 1 91 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 7128.50 79 44 587 710 1 92 chr12:10014263 SNV 0.37 2.69 2.69 10099.80 56 41 617 714 1 93 2_C_T chr9:72245167_G_T SNV 0.27 3.02 1.03 6183.34 93 50 572 715 1 94 chr9:72245168_A_T SNV 0.27 3.02 1.03 6183.34 93 50 572 715 1 95 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 8182.38 79 44 595 718 1 96 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 8737.40 79 44 600 723 1 97 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 9175.65 79 44 608 731 1 98 chr6:168310205_--_T FSP 0.27 2.65 1.34 8785.58 92 48 601 741 1 99 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 10356.18 79 44 619 742 1 100 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 10624.37 79 44 622 745 1 101 chr9:104504822_T_C SNV 0.38 0.08 0.08 822.70 47 81 59 748 4 102 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 10920.75 79 44 627 750 1 103 chr6:168310205_--_T FSP 0.27 2.65 1.34 9878.80 92 48 613 753 1 104 chr2:23758023_T_A SNV 0.30 0.64 0.64 9976.94 82 57 616 755 1 105 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 11571.94 79 44 632 755 1 106 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 11865.32 79 44 639 762 1 107 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 11993.50 79 44 640 763 1 108 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 12302.10 79 44 644 767 1 109 chr14:20014472_C_A SNV 0.35 0.00 0.00 125.40 66 107 19 768 4 110 chr16:48139305_G_C SNV 0.34 0.00 0.00 106.10 68 107 17 768 4 111 chr6:168310205_--_T FSP 0.27 2.65 1.34 10951.63 92 48 628 768 1 112 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 12791.00 79 44 650 773 1 113 chr6:168310205_--_T FSP 0.27 2.65 1.34 11784.46 92 48 635 775 1 114 chr5:13735855_G_A SNV 0.30 0.11 0.11 411.75 81 74 39 776 4 115

chr11:1758971_AC_-- FSP 0.31 460.80 2.03 12923.30 79 44 653 776 1 116 chr6:168310205_--_T FSP 0.27 2.65 1.34 11857.00 92 48 638 778 1 117 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 13652.17 79 44 660 783 1 118 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 14287.03 79 44 663 786 1 119 chr6:168310205_--_T FSP 0.27 2.65 1.34 12583.44 92 48 646 786 1 120 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 14296.31 79 44 664 787 1 121 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 14693.10 79 44 665 788 1 122 chr13:35159543_G_C SNV 0.29 0.05 0.05 183.73 85 87 26 792 4 123 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 15452.22 79 44 671 794 1 124 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 15454.40 79 44 672 795 1 125 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 15751.50 79 44 674 797 1 126 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 15852.90 79 44 676 799 1 127 chr6:168310205_--_T FSP 0.27 2.65 1.34 13712.13 92 48 661 801 1 128 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 16323.72 79 44 681 804 1 129 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 16590.60 79 44 684 807 1 130 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 17904.32 79 44 688 811 1 131 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 18021.12 79 44 690 813 1 132 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 18197.08 79 44 691 814 1 133 chr20:41421411_C_G SNV 0.21 3.16 3.16 16039.05 101 36 678 815 1 134 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 18340.60 79 44 692 815 1 135 chrX:22273538_G_C SNV 0.30 0.00 0.00 92.50 83 107 14 816 4 136 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 19542.38 79 44 697 820 1 137 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 19699.47 79 44 699 822 1 138 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 20295.52 79 44 702 825 1 139 chr6:168310205_--_T FSP 0.27 2.65 1.34 16675.60 92 48 685 825 1 140 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 20605.06 79 44 703 826 1 141 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 20630.27 79 44 705 828 1 142 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 20638.98 79 44 706 829 1 143 chr6:168310205_--_T FSP 0.27 2.65 1.34 17925.30 92 48 689 829 1 144 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 20708.55 79 44 708 831 1 145 chr2:167245082_T_G SNV 0.37 0.03 0.03 902.70 53 91 64 832 4 146 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 20766.88 79 44 709 832 1 147 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 21556.30 79 44 712 835 1 148 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 21623.54 79 44 713 836 1 149 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 22010.18 79 44 718 841 1 150 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 22110.20 79 44 719 842 1 151 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 22153.29 79 44 720 843 1 152 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 22354.83 79 44 721 844 1 153 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 22550.39 79 44 723 846 1 154 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 23193.80 79 44 725 848 1 155 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 23265.15 79 44 726 849 1 156 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 23324.88 79 44 727 850 1 157 chr6:168310205_--_T FSP 0.27 2.65 1.34 21707.50 92 48 716 856 1 158 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 24982.10 79 44 736 859 1 159 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 25114.40 79 44 738 861 1 160 chr6:168310205_--_T FSP 0.27 2.65 1.34 22541.60 92 48 722 862 1 161 chr20:54157259_C_T SNV 0.30 0.09 0.09 710.20 83 79 54 864 4 162 chr20:54157259_C_T SNV 0.30 0.09 0.09 710.20 83 79 54 864 4 163 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 25633.30 79 44 741 864 1 164 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 25736.92 79 44 742 865 1 165 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 25960.10 79 44 744 867 1 166 chr6:168310205_--_T FSP 0.27 2.65 1.34 23828.67 92 48 729 869 1 167 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 27215.57 79 44 748 871 1 168 chr11:26721564_C_G SNV 0.33 0.01 0.01 493.20 69 103 46 872 4 169 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 27397.60 79 44 750 873 1 170 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 28238.14 79 44 752 875 1 171 chr3:32818692_G_-- FSP 0.23 0.02 0.02 150.50 100 96 23 876 4 172 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 28447.59 79 44 754 877 1 173 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 29421.77 79 44 756 879 1 174 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 29826.27 79 44 757 880 1 175 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 31274.12 79 44 761 884 1 176 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 31497.22 79 44 765 888 1 177 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 32523.71 79 44 766 889 1 178 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 33278.00 79 44 770 893 1 179 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 33437.17 79 44 771 894 1 180 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 34250.42 79 44 772 895 1 181 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 34429.49 79 44 773 896 1 182 chr11:1758971_AC_-- FSP 0.31 460.80 2.03 38230.68 79 44 776 899 1 183 chr6:168310205_--_T FSP 0.27 2.65 1.34 31468.96 92 48 764 904 1 184 chr3:77596673_A_T SNV 0.23 0.01 0.01 203.50 99 100 28 908 4 185 chr3:32818692_G_-- FSP 0.23 0.02 0.02 270.50 100 96 33 916 4 186 chr3:32818692_G_-- FSP 0.23 0.02 0.02 479.90 100 96 43 956 4 187 chr3:32818692_G_-- FSP 0.23 0.02 0.02 505.00 100 96 48 976 4 188 chr3:32818692_G_-- FSP 0.23 0.02 0.02 661.08 100 96 50 984 4 189 chr3:32818692_G_-- FSP 0.23 0.02 0.02 714.80 100 96 55 1004 4 190 chr5:140842565_G_A SNV 0.27 0.01 0.01 884.93 94 101 63 1032 4 191 chr3:32818692_G_-- FSP 0.23 0.02 0.02 877.84 100 96 62 1032 4 192 chr3:32818692_G_-- FSP 0.23 0.02 0.02 949.20 100 96 68 1056 4 193 chr1:228340587_G_T SNV 0.46 0.56 0.56 1734.70 20 59 486 1130 2 194 chr18:56691285_G_T SNV 0.54 0.61 0.61 2190.30 15 58 502 1150 2 195 chrX:50598303_G_T SNV 0.36 1.99 1.99 1552.80 59 45 478 1164 2 196 chr7:6551366_G_C SNV 0.35 0.50 0.50 1340.50 64 60 475 1198 2 197 chr12:89610020_C_T SNV 0.35 2.77 2.77 2031.40 67 40 496 1206 2 198 chr6:107707925_A_G SNV 0.28 0.04 0.00 662.40 89 106 51 1230 5 199 chr16:3757295_GATA FSP 0.13 4.88 4.88 1628.90 102 33 481 1232 2 200 GCTGTAGTAGGCAGCAT C_-- chrX:18258064_C_T SNV 0.35 0.76 0.76 3122.43 66 55 519 1280 2 201 chr16:3757295_GATA FSP 0.13 4.88 4.88 2896.90 102 33 514 1298 2 202 GCTGTAGTAGGCAGCAT C_-- chr19:48735476_G_T SNV 0.74 2.60 2.60 9946.44 2 42 614 1316 2 203 chrX:152936478_C_G SNV 0.27 2.82 2.82 4704.39 92 38 548 1356 2 204 chr16:3757295.sub. GATA FSP 0.13 4.88 4.88 4689.60 102 33 547 1364 2 205 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 5611.12 102 33 559 1388 2 206 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 8166.46 102 33 594 1458 2 207 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 8978.45 102 33 606 1482 2 208 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 11787.80 102 33 636 1542 2 209 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 12052.00 102 33 642 1554 2 210 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 12434.20 102 33 645 1560 2 211 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 20628.70 102 33 704 1678 2 212 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 20993.02 102 33 710 1690 2 213 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 21762.73 102 33 717 1704 2 214 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 24607.60 102 33 731 1732 2 215 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 24793.40 102 33 734 1738 2 216 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 26390.85 102 33 745 1760 2 217 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 27260.40 102 33 749 1768 2 218 GCTGTAGTAGGCAGCAT C_-- chr16:3757295_GATA FSP 0.13 4.88 4.88 27813.60 102 33 751 1772 2 219 GCTGTAGTAGGCAGCAT C_-- chr12:6817323_C_A SNV 0.29 6.71 0.13 1732.98 84 73 485 1926 3 220 chr8:8377042_G_A SNV 0.37 4.62 0.11 3074.00 52 75 516 1929 3 221 chr3:13614024_C_T SNV 0.43 6.35 0.20 5164.00 26 69 556 1953 3 222 chrX:136044485_C_T SNV 0.40 3.38 0.31 6187.55 41 65 573 2037 3 223 chr19:37565848_G_C SNV 0.67 0.20 0.20 2317.89 8 70 506 2336 4 224

chr14:79861690_G_A SNV 0.42 0.04 0.04 1287.30 32 90 472 2376 4 225 chr14:79861690_G_A SNV 0.42 0.04 0.04 1287.30 32 90 472 2376 4 226 chr14:79861690_G_A SNV 0.42 0.04 0.04 1287.30 32 90 472 2376 4 227 chr17:44778052_C_T SNV 0.64 0.09 0.09 2413.58 10 78 509 2388 4 228 chrX:152766846_A_G SNV 0.44 0.00 0.00 1259.60 23 107 471 2404 4 229 chr2:1267461_G_A SNV 0.40 0.07 0.07 2378.10 38 84 507 2516 4 230 chr16:76467454_T_G SNV 0.42 0.00 0.00 2009.50 30 107 494 2524 4 231 chr20:35434630_T_C SNV 0.32 0.03 0.03 1111.53 74 94 464 2528 4 232 chr1:152314593_C_G SNV 0.37 0.00 0.00 1325.91 55 107 474 2544 4 233 chr5:157343307_C_G SNV 0.36 0.00 0.00 1227.98 60 107 470 2548 4 234 chr5:153811068_G_A SNV 0.40 0.00 0.00 1857.36 42 107 490 2556 4 235 chr10:105255724.sub.-- SNV 0.38 0.02 0.02 2013.58 49 95 495 2556 4 236 C_G chr7:134568320_A_T SNV 0.36 0.00 0.00 1793.80 60 107 487 2616 4 237 chr6:159804633_C_T SNV 0.39 0.21 0.21 4334.62 43 68 544 2620 4 238 chrX:34131242_C_T SNV 0.39 0.00 0.00 2276.45 44 107 504 2620 4 239 chr3:32818692_G_-- FSP 0.23 0.02 0.02 1058.50 100 96 462 2632 4 240 chr3:32818692_G_-- FSP 0.23 0.02 0.02 1087.90 100 96 463 2636 4 241 chr4:176168671_G_A SNV 0.57 0.02 0.02 4779.70 14 98 551 2652 4 242 chr2:184936876_A_G SNV 0.30 0.03 0.03 1898.15 80 93 492 2660 4 243 chrX:105220039_G_A SNV 0.41 0.00 0.00 3345.76 35 107 525 2668 4 244 chr3:32818692_G_-- FSP 0.23 0.02 0.02 1290.90 100 96 473 2676 4 245 chr17:80090197_A_G SNV 0.40 0.40 0.40 6137.68 39 63 568 2680 4 246 chr3:32818692_G_-- FSP 0.23 0.02 0.02 1405.50 100 96 477 2692 4 247 chr3:32818692_G_-- FSP 0.23 0.02 0.02 1717.75 100 96 484 2720 4 248 chr3:32818692_G_-- FSP 0.23 0.02 0.02 1815.40 100 96 488 2736 4 249 chr3:32818692_G_-- FSP 0.23 0.02 0.02 1849.50 100 96 489 2740 4 250 chr3:32818692_G_-- FSP 0.23 0.02 0.02 1870.22 100 96 491 2748 4 251 chrX:151180935.sub.-- SNV 0.43 0.04 0.04 6377.67 29 88 575 2768 4 252 T_A chr3:32818692_G_-- FSP 0.23 0.02 0.02 2034.30 100 96 497 2772 4 253 chr3:32818692_G_-- FSP 0.23 0.02 0.02 2096.09 100 96 499 2780 4 254 chr3:32818692_G_-- FSP 0.23 0.02 0.02 2202.40 100 96 503 2796 4 255 chr3:32818692_G_-- FSP 0.23 0.02 0.02 2769.94 100 96 511 2828 4 256 chr3:32818692_G_-- FSP 0.23 0.02 0.02 2800.71 100 96 512 2832 4 257 chr3:32818692_G_-- FSP 0.23 0.02 0.02 2973.24 100 96 515 2844 4 258 chr3:32818692_G_-- FSP 0.23 0.02 0.02 3183.11 100 96 520 2864 4 259 chr2:206177163.sub.-- SNV 0.36 0.06 0.06 6187.82 60 86 574 2880 4 260 C_G chr19:31279054.sub.-- SNV 0.64 0.32 0.32 12623.68 10 64 647 2884 4 261 C_T chr3:32818692_G_-- FSP 0.23 0.02 0.02 3454.02 100 96 528 2896 4 262 chr3:87264320_G_C SNV 0.37 0.00 0.00 5983.30 53 107 566 2904 4 263 chr3:32818692_G_-- FSP 0.23 0.02 0.02 3477.00 100 96 530 2904 4 264 chr18:32677240.sub.-- SNV 0.49 0.00 0.00 8898.95 18 107 603 2912 4 265 C_G chr3:32818692_G_-- FSP 0.23 0.02 0.02 3686.04 100 96 534 2920 4 266 chr3:32818692_G_-- FSP 0.23 0.02 0.02 3708.97 100 96 535 2924 4 267 chr3:32818692_G_-- FSP 0.23 0.02 0.02 3775.45 100 96 536 2928 4 268 chr3:32818692_G_-- FSP 0.23 0.02 0.02 3822.90 100 96 537 2932 4 269 chr3:32818692_G_-- FSP 0.23 0.02 0.02 4006.60 100 96 539 2940 4 270 chr3:32818692_G_-- FSP 0.23 0.02 0.02 4278.47 100 96 541 2948 4 271 chr3:32818692_G_-- FSP 0.23 0.02 0.02 4312.30 100 96 543 2956 4 272 chr17:35746314_G_A SNV 0.63 0.04 0.04 12000.37 11 89 641 2964 4 273 chr10:25221118_G_C SNV 0.28 0.02 0.02 5031.73 90 97 555 2968 4 274 chr3:32818692_G_-- FSP 0.23 0.02 0.02 4492.50 100 96 546 2968 4 275 chr9:17342330_A_C SNV 0.52 0.06 0.01 1613.40 16 104 479 2995 5 276 chr3:32818692_G_-- FSP 0.23 0.02 0.02 5285.90 100 96 557 3012 4 277 chr3:32818692_G_-- FSP 0.23 0.02 0.02 5612.09 100 96 560 3024 4 278 chr3:32818692_G_-- FSP 0.23 0.02 0.02 5630.28 100 96 561 3028 4 279 chr3:32818692_G_-- FSP 0.23 0.02 0.02 5659.80 100 96 562 3032 4 280 chr3:32818692_G_-- FSP 0.23 0.02 0.02 5689.90 100 96 563 3036 4 281 chr3:32818692_G_-- FSP 0.23 0.02 0.02 5930.90 100 96 565 3044 4 282 chr20:49373631_G_C SNV 0.28 0.00 0.00 5746.60 91 107 564 3048 4 283 chr3:32818692_G_-- FSP 0.23 0.02 0.02 6139.41 100 96 570 3064 4 284 chr3:32818692_G_-- FSP 0.23 0.02 0.02 6160.50 100 96 571 3068 4 285 chr3:32818692_G_-- FSP 0.23 0.02 0.02 6454.30 100 96 577 3092 4 286 chr3:32818692_G_-- FSP 0.23 0.02 0.02 6638.53 100 96 578 3096 4 287 chr3:32818692_G_-- FSP 0.23 0.02 0.02 6804.11 100 96 579 3100 4 288 chr3:32818692_G_-- FSP 0.23 0.02 0.02 6848.80 100 96 581 3108 4 289 chr3:32818692_G_-- FSP 0.23 0.02 0.02 7034.10 100 96 582 3112 4 290 chr3:32818692_G_-- FSP 0.23 0.02 0.02 7048.24 100 96 583 3116 4 291 chr3:32818692_G_-- FSP 0.23 0.02 0.02 7114.70 100 96 586 3128 4 292 chr6:26506794_A_G SNV 0.29 0.00 0.00 7601.31 87 107 589 3132 4 293 chr3:32818692_G_-- FSP 0.23 0.02 0.02 7381.50 100 96 588 3136 4 294 chr3:32818692_G_-- FSP 0.23 0.02 0.02 7750.64 100 96 590 3144 4 295 chr3:32818692_G_-- FSP 0.23 0.02 0.02 7925.40 100 96 591 3148 4 296 chr3:32818692_G_-- FSP 0.23 0.02 0.02 7949.12 100 96 592 3152 4 297 chr3:32818692_G_-- FSP 0.23 0.02 0.02 8085.74 100 96 593 3156 4 298 chr1:237004287_C_G SNV 0.36 0.00 0.00 10648.42 61 107 623 3164 4 299 chr3:32818692_G_-- FSP 0.23 0.02 0.02 8191.58 100 96 596 3168 4 300 chr2:109449244_T_C SNV 0.33 0.25 0.01 1019.10 72 102 460 3170 5 301 chr3:32818692_G_-- FSP 0.23 0.02 0.02 8271.93 100 96 597 3172 4 302 chr3:32818692_G_-- FSP 0.23 0.02 0.02 8567.05 100 96 598 3176 4 303 chr3:32818692_G_-- FSP 0.23 0.02 0.02 8612.10 100 96 599 3180 4 304 chr3:32818692_G_-- FSP 0.23 0.02 0.02 8877.89 100 96 602 3192 4 305 chr3:32818692_G_-- FSP 0.23 0.02 0.02 8963.69 100 96 604 3200 4 306 chr3:32818692_G_-- FSP 0.23 0.02 0.02 8974.37 100 96 605 3204 4 307 chr3:32818692_G_-- FSP 0.23 0.02 0.02 9105.70 100 96 607 3212 4 308 chr3:32818692_G_-- FSP 0.23 0.02 0.02 9348.30 100 96 609 3220 4 309 chr3:32818692_G_-- FSP 0.23 0.02 0.02 9448.60 100 96 610 3224 4 310 chr3:32818692_G_-- FSP 0.23 0.02 0.02 9647.54 100 96 611 3228 4 311 chr3:32818692_G_-- FSP 0.23 0.02 0.02 9671.30 100 96 612 3232 4 312 chr3:32818692_G_-- FSP 0.23 0.02 0.02 9950.63 100 96 615 3244 4 313 chr3:32818692_G_-- FSP 0.23 0.02 0.02 10203.10 100 96 618 3256 4 314 chr3:32818692_G_-- FSP 0.23 0.02 0.02 10520.50 100 96 620 3264 4 315 chr3:32818692_G_-- FSP 0.23 0.02 0.02 10583.18 100 96 621 3268 4 316 chr2:178590588_T_G SNV 0.38 0.11 0.11 19366.19 46 76 696 3272 4 317 chr3:32818692_G_-- FSP 0.23 0.02 0.02 10665.70 100 96 624 3280 4 318 chr3:32818692_G_-- FSP 0.23 0.02 0.02 10733.44 100 96 625 3284 4 319 chr3:32818692_G_-- FSP 0.23 0.02 0.02 10905.52 100 96 626 3288 4 320 chr3:32818692_G_-- FSP 0.23 0.02 0.02 11377.89 100 96 629 3300 4 321 chr3:32818692_G_-- FSP 0.23 0.02 0.02 11520.50 100 96 630 3304 4 322 chr3:32818692_G_-- FSP 0.23 0.02 0.02 11539.68 100 96 631 3308 4 323 chr19:53141032_C_A SNV 0.23 0.33 0.03 1205.50 100 94 469 3315 5 324 chr3:32818692_G_-- FSP 0.23 0.02 0.02 11753.52 100 96 633 3316 4 325 chr3:32818692_G_-- FSP 0.23 0.02 0.02 11765.10 100 96 634 3320 4 326 chr3:32818692_G_-- FSP 0.23 0.02 0.02 11842.62 100 96 637 3332 4 327 chr3:32818692_G_-- FSP 0.23 0.02 0.02 12102.86 100 96 643 3356 4 328 chr12:40364940_T_A SNV 0.38 0.06 0.01 3199.80 47 105 521 3365 5 329 chr3:32818692_G_-- FSP 0.23 0.02 0.02 12656.64 100 96 648 3376 4 330 chr3:32818692_G_-- FSP 0.23 0.02 0.02 12691.33 100 96 649 3380 4 331 chr3:32818692_G_-- FSP 0.23 0.02 0.02 12828.00 100 96 651 3388 4 332 chr3:32818692_G_-- FSP 0.23 0.02 0.02 12851.35 100 96 652 3392 4 333 chr3:32818692_G_-- FSP 0.23 0.02 0.02 12946.10 100 96 654 3400 4 334 chr3:32818692_G_-- FSP 0.23 0.02 0.02 12961.52 100 96 655 3404 4 335 chr3:32818692_G_-- FSP 0.23 0.02 0.02 13342.29 100 96 656 3408 4 336 chr3:32818692_G_-- FSP 0.23 0.02 0.02 13355.58 100 96 657 3412 4 337 chr3:32818692_G_-- FSP 0.23 0.02 0.02 13399.40 100 96 658 3416 4 338 chr3:32818692_G_-- FSP 0.23 0.02 0.02 13632.20 100 96 659 3420 4 339 chr2:40429308_C_G SNV 0.29 0.18 0.02 2142.39 86 99 501 3430 5 340 chr3:32818692_G_-- FSP 0.23 0.02 0.02 14044.57 100 96 662 3432 4 341 chr3:32818692_G_-- FSP 0.23 0.02 0.02 14772.61 100 96 666 3448 4 342 chr3:32818692_G_-- FSP 0.23 0.02 0.02 15038.22 100 96 667 3452 4 343 chr3:32818692_G_-- FSP 0.23 0.02 0.02 15092.20 100 96 668 3456 4 344 chr3:32818692_G_-- FSP 0.23 0.02 0.02 15276.50 100 96 669 3460 4 345 chr3:32818692_G_-- FSP 0.23 0.02 0.02 15414.60 100 96 670 3464 4 346 chr3:32818692_G_-- FSP 0.23 0.02 0.02 15700.12 100 96 673 3476 4 347

chr3:32818692_G_-- FSP 0.23 0.02 0.02 15851.40 100 96 675 3484 4 348 chr3:32818692_G_-- FSP 0.23 0.02 0.02 15910.46 100 96 677 3492 4 349 chr3:32818692_G_-- FSP 0.23 0.02 0.02 16085.80 100 96 679 3500 4 350 chr3:32818692_G_-- FSP 0.23 0.02 0.02 16257.45 100 96 680 3504 4 351 chr3:32818692_G_-- FSP 0.23 0.02 0.02 16325.14 100 96 682 3512 4 352 chr3:32818692_G_-- FSP 0.23 0.02 0.02 16570.20 100 96 683 3516 4 353 chr3:32818692_G_-- FSP 0.23 0.02 0.02 17462.94 100 96 686 3528 4 354 chr3:32818692_G_-- FSP 0.23 0.02 0.02 17746.36 100 96 687 3532 4 355 chr4:41626984_A_-- FSP 0.43 0.00 0.00 28309.42 25 107 753 3540 4 356 chr3:32818692_G_-- FSP 0.23 0.02 0.02 18668.33 100 96 693 3556 4 357 chr3:32818692_G_-- FSP 0.23 0.02 0.02 18966.40 100 96 694 3560 4 358 chr3:32818692_G_-- FSP 0.23 0.02 0.02 18997.40 100 96 695 3564 4 359 chr3:32818692_G_-- FSP 0.23 0.02 0.02 19654.12 100 96 698 3576 4 360 chr3:32818692_G_-- FSP 0.23 0.02 0.02 19765.22 100 96 700 3584 4 361 chr3:32818692_G_-- FSP 0.23 0.02 0.02 20186.50 100 96 701 3588 4 362 chr3:32818692_G_-- FSP 0.23 0.02 0.02 20672.50 100 96 707 3612 4 363 chr3:32818692_G_-- FSP 0.23 0.02 0.02 21269.90 100 96 711 3628 4 364 chr3:32818692_G_-- FSP 0.23 0.02 0.02 21631.73 100 96 714 3640 4 365 chr3:32818692_G_-- FSP 0.23 0.02 0.02 21665.22 100 96 715 3644 4 366 chr3:32818692_G_-- FSP 0.23 0.02 0.02 22959.31 100 96 724 3680 4 367 chr3:32818692_G_-- FSP 0.23 0.02 0.02 23755.06 100 96 728 3696 4 368 chr3:32818692_G_-- FSP 0.23 0.02 0.02 23864.03 100 96 730 3704 4 369 chr3:32818692_G_-- FSP 0.23 0.02 0.02 24620.96 100 96 732 3712 4 370 chr3:32818692_G_-- FSP 0.23 0.02 0.02 24726.14 100 96 733 3716 4 371 chr3:32818692_G_-- FSP 0.23 0.02 0.02 24803.80 100 96 735 3724 4 372 chr3:32818692_G_-- FSP 0.23 0.02 0.02 25104.30 100 96 737 3732 4 373 chr3:32818692_G_-- FSP 0.23 0.02 0.02 25420.90 100 96 739 3740 4 374 chr3:32818692_G_-- FSP 0.23 0.02 0.02 25464.08 100 96 740 3744 4 375 chr3:32818692_G_-- FSP 0.23 0.02 0.02 25831.50 100 96 743 3756 4 376 chr3:32818692_G_-- FSP 0.23 0.02 0.02 26890.66 100 96 746 3768 4 377 chr3:32818692_G_-- FSP 0.23 0.02 0.02 26967.88 100 96 747 3772 4 378 chr3:32818692_G_-- FSP 0.23 0.02 0.02 28923.39 100 96 755 3804 4 379 chr3:32818692_G_-- FSP 0.23 0.02 0.02 29869.22 100 96 758 3816 4 380 chr3:32818692_G_-- FSP 0.23 0.02 0.02 30437.50 100 96 759 3820 4 381 chr3:32818692_G_-- FSP 0.23 0.02 0.02 30767.65 100 96 760 3824 4 382 chr3:32818692_G_-- FSP 0.23 0.02 0.02 31304.90 100 96 762 3832 4 383 chr3:32818692_G_-- FSP 0.23 0.02 0.02 31310.69 100 96 763 3836 4 384 chr3:32818692_G_-- FSP 0.23 0.02 0.02 32580.77 100 96 767 3852 4 385 chr3:32818692_G_-- FSP 0.23 0.02 0.02 32618.86 100 96 768 3856 4 386 chr3:32818692_G_-- FSP 0.23 0.02 0.02 33215.41 100 96 769 3860 4 387 chr3:32818692_G_-- FSP 0.23 0.02 0.02 35308.13 100 96 775 3884 4 388

[0241] Example 3: Validation of the prioritization method In order to validate the prioritization method datasets with a total of 30 experimentally validated immunogenic neoantigens with CD8.sup.+ T-cell reactivity were analysed (Table 7). The datasets comprise biopsies from 13 cancer patients across 5 different tumor types for which NGS raw data (normal/tumor exome NGS-DNA and tumor NGS-RNA transcriptome) is available.

[0242] NGS data were downloaded from the NCBI SRA website and processed with the same NGS processing pipeline applied in Example 1. Mutations for 28 out of the 30 reported experimentally validated neoantigens were identified by applying the NGS processing pipeline disclosed in Example 2 (two mutations were not detected due to the very low number of mutated reads). For each patient sample the total list of all neoantigens identified was then ranked according to the method described in Step 3 in Example 1 assuming a target maximal polypeptide (polyneoantigen) size of 1500 amino acids.

[0243] Table 8 shows the predicted MHC class I IC50 values for the 28 neoantigens, for only 9mer epitope prediction or for predictions including epitopes from 8 up to 11 amino acids. In both cases several neoantigens are present where the best (lowest) IC50 values are well above (higher) than the 500 nM threshold value frequently applied in the art for the selection of neoantigen vaccine candidates and, consequently, would have been excluded from the personalized vaccine.

[0244] FIG. 7A shows the RSUM rank obtained by the prioritization method for the 28 detected experimentally validated neoantigens. A dotted line (FIG. 5A) indicates the maximal number of neoantigen 25mers (60) that can be accommodated in an adenoviral personalized vaccine vector with an insert capacity (excluding expression control elements) of about 1500 amino acids.

[0245] 27 out of the 30 experimentally validated neoantigens (90%) are present in the top 60 neoantigens and therefore would have been included in the personalized vaccine vector. The priorization was then repeated assuming that no NGS-RNA expression data from the patient's tumor was available. The corrTPM expression value for each neoantigen was estimated as the median TPM value of the corresponding gene in the TCGA expression data for that particular tumor type [NCBI GEO accession:GSE62944]. FIG. 7B shows that also in this case a large portion (25 out of 30=83%) experimentally validated neoantigens would have been included in the vaccine vector. Importantly, for each of the examined datasets there was at least one validated neoantigen that would have been included in the personalized vaccine vector. Further details including the RSUM ranking results with and without NGS-RNA data for the 28 validated neoantigens are listed in Table 7.

[0246] Both results therefore confirmed that the prioritization method is able to select, in the presence but also in the absence of transcriptome data from the patient's tumor, a list of neoantigens that includes the most relevant neoantigens, i.e. those neoantigens with experimentally verified immunogenicity that should be included in a personalized vaccine vector.

TABLE-US-00007 TABLE 7 List of literature datasets and neoantigens used as benchmark. For each dataset neoantigens with experimentally validated T-cell reactivity are listed. The mutated amino acid is indicated in bold and underlined. For mutations generating two distinct neoantigens due to the presence of two alternative splicing isoforms only the neoantigen with the lower RSUM rank is reported (indicated by a *). Genomic coordinates given are with respect to human genome assembly GRch38/hg38. Study RSUM RSUM PUB rank rank SEQ Tumor MED Patient Mutation (with (no ID type ID ID ID RNASeq) RNASeq) NO NeoAg sequence Melanoma 26901407 Pat3998 chrX: 1 2 80 DSLQLVFGIELM 15276714 KVDPIGHVYIFA 9_C_T T Melanoma 26901407 Pat3998 chr4: 3* 4* 81 SLLPEFVVPYMI 3986228 YLLAHDPDFTRS 6_G_A Q Melanoma 26901407 Pat3998 chr17: 13 23 82 PHIKSTVSVQII 6196177 SCQYLLQPVKHE 3_G_A D Melanoma 26901407 Pat3784 chrX: 5 4 83 VVISQSEIGDAS 15435308 CVRVSGQGLHEG 2_G_A H Melanoma 26901407 Pat3784 chr21: 36 53 84 RKTVRARSRTPS 3355501 CRSRSHTPSRRR 0_C_T R Melanoma 26901407 Pat3784 chr20: 112 247 85 REKQQREALERA 1637897 PARLERRHSALQ 6_A_G R Melanoma 26901407 Pat3903 chr10: 8 6 86 TLKRQLEHNAYH 6900586 SIEWAINAATLS 2_C_T Q Ovarian 2954554 CTE0010 chr11: 16 6 87 VTVRVADINDHA 6641192.sub.-- LAFPQARAALQV G_A P Ovarian 2954554 CTE0010 chr6: 31 41 88 LRPRRVGIALDY 3018600 DWGTVTFTNAES 8_T_A Q Ovarian 2954554 CTE0011 chr17: 18 1 89 GYVGIDSILEQM 7748228 HRKAMKQGFEFN 8_G_A I Ovarian 2954554 CTE0012 chr1: 40 5 90 IIVGVLLAIGFI 1361436 CAIIVVVMRKMS 5_G_T G Ovarian 2954554 CTE0014 chr11: 2 1 91 PREGSGGSTSDY 1189205 LSQSYSYSSILN 8_G_C K Ovarian 2954554 CTE0019 chr4: 3 14 92 RRAGGAQSWLWF 1827997 VTVKSLIGKGVM 20_C_T L Rectal 26516200 Pat3942 chr2: 19 27 93 QSISRNHVVDIS 1565689 KSGLITIAGGKW 35_G_A T Rectal 26516200 Pat3942-- chr11: 21 34 94 TGLFGQTNTGFG 3762912 DVGSTLFGNNKL G_T T Rectal 26516200 Pat3942 chr16: 54 83 95 YEIGRQFRNEGI 7563178 HLTHNPEFTTCE 9_C_G F Colon 26516200 Pat4007 chr6: 3 2 96 PILKEIVEMLFS 3196432 HGLVKVLFATET 9_G_A F Colon 26516200 Pat4007 chr17: 6 10 97 VKKPHRYRPGTV 7577895 TLREIRRYQKST 0_C_T E Colon 26516200 Pat3995 Chr17: 13 7 98 FVTQKRMEHFYL 8033947 SFYTAEQLVYLS 2_A_G T Colon 26516200 Pat3995 chr10: 20 11 99 DLSIRELVHRIL 1332935 LVAASYSAVTRF 92_G_A I Colon 26516200 Pat3995 chr12: 28 52 100 MTEYKLVVVGAD 2524535 GVGKSALTIQLT 0_C/T Colon 26516200 Pat4032 chr11: 2 2 101 DPDCVDRLLQCT 4332361 QQAVPLFSKNVH 4_G/A S Colon 26516200 Pat4032 chr18: 4 9 102 VNRWTRRQVILC 6283015 ETCLIVSSVKDS 5_G/A L Colon 26516200 Pat4032 chr12: 16 26 103 RHRYLSHLPLTC 1205651 KFSICELALQPP 20_G/A V Breast 29867227 Pat4136 chr11: 40* 41* 104 LLASSDPPALAS 6287165 TNAEVTGTMSQD 2_A/C T Breast 29867227 Pat4136 chr7: 41 44 105 TLNSKTYDTVHR 1223202 HLTVEEATASVS 59_C/T E Breast 29867227 Pta4136 chr8: 47 50 106 GYNSYSVSNSEK 1184713 HIMAEIYKNGPV 3_C_G E Breast 29867227 Pta4136 chr9: 53 74 107 MPYGYVLNEFQS 1114370 CQNSSSAQGSSS 83_G_A N

TABLE-US-00008 TABLE 8 Predicted MHC class I IC50 values (nM) for the 28 neoantigens. Genomic coordinates given are with respect to human genome assembly GRch38/hg38. SEQ best best best IC50 ID MHC class I score best IC50 score 8-11mer PATID Mutation ID Neoantigen NO allele 9mer 9mer(nM) 8-11mer (nM) Pat3998 chrX: DSLQLVFGIELMK 80 HLA-A*30:02 0.3 52.24 0.3 52.24 152767149_C_T VDPIGHVYIFAT Pat3998 chr4: SLLPEFVVPYMIY 81 HLA-C*03:03 2.4 3.92 2.4 3.92 39862286_G_A LLAHDPDFTRSQ Pat3998 chr17: PHIKSTVSVQIIS 82 HLA-A*30:02 0.35 39.15 0.35 39.15 61961773_G_A CQYLLQPVKHED Pat3784 chrX: VVISQSEIGDASC 83 HLA-B*07:02 2 741.59 2 741.59 154353082_G_A VRVSGQGLHEGH Pat3784 chr21: RKTVRARSRTPSC 84 HLA-B*07:02 0.5 468.72 0.5 468.72 33555010_C_T RSRSHTPSRRRR Pat3784 chr20: REKQQREALERAP 85 HLA-B*07:02 2.3 4030.25 0.85 156.78 16378976_A_G ARLERRHSALQR Pat3903 chr10: TLKRQLEHNAYHS 86 HLA-A*24:02 0.55 180.52 0.55 180.52 69005862_C_T IEWAINAATLSQ CTE0010 chr11: VTVRVADINDHAL 87 HLA-C*03:03 33.1 16.81 33.1 16.81 6641192_G_A AFPQARAALQVP CTE0010 chr6: RPRRVGIALDYDW 88 HLA-A*02:01 2.3 154.56 1.15 92.02 30186007_C_A GTVTFTNAESQE CTE0011 chr17: GYVGIDSILEQMH 89 HLA-A*11:01 0.35 20.44 0.35 20.44 77482288_G_A RKAMKQGFEFNI CTE0012 chr1: IIVGVLLAIGFIC 90 HLA-A*02:01 0.6 32.33 0.6 32.33 13614365_G_T AIIVVVMRKMSG CTE0014 chr11: PREGSGGSTSDYL 91 HLA-A*01:01 0.15 4.13 0.15 4.13 11892058_G_C SQSYSYSSILNK CTE0019 chr4: RRAGGAQSWLWFV 92 HLA-A*02:11 2.55 5.66 2.55 5.66 182799720_C_T TVKSLIGKGVML Pat3942 chr2: QSISRNHVVDISK 93 HLA-C*16:01 7.2 930.4 7.2 930.4 156568935_G_A SGLITIAGGKWT Pat3942 chr11: TGLFGQTNTGFGD 94 HLA-C*16:01 2.2 184.1 2.2 184.1 3762912_G_T VGSTLFGNNKLT Pat3942 chr16: YEIGRQFRNEGIH 95 HLA-A*29:02 4.55 4282.32 10 2679.82 75631789_C_G LTHNPEFTTCEF Pat4007 chr6: PILKEIVEMLFSH 96 HLA-A*03:01 0.1 6.25 0.1 6.25 31964329_G_A GLVKVLFATETF Pat4007 chr17: VKKPHRYRPGTVT 97 HLA-C*07:02 0.2 31 0.2 31 75778950_C_T LREIRRYQKSTE Pat3995 chr17: FVTQKRMEHFYLS 98 HLA-B*18:01 0.15 5.49 0.15 5.49 80339472_A_G FYTAEQLVYLST Pat3995 chr10:1332935 DLSIRELVHRILL 99 HLA-A*32:01 1.3 106.56 1.3 106.56 92_G_A VAASYSAVTRFI Pat3995 chr12: MTEYKLVVVGADG 100 HLA-C*05:01 1.25 4671.02 1.25 4671.02 25245350_C_T VGKSALTIQLI Pat4032 chr11:433236 DPDCVDRLLQCTQ 101 HLA-A*02:13 1.1 26.4 1.1 26.4 14_G_A QAVPLFSKNVHS Pat4032 chr18: VNRWTRRQVILCE 102 HLA-A*02:13 2.3 120.9 2.3 120.9 62830155_G_A TCLIVSSVKDSL Pat4032 chr12: RHRYLSHLPLTCK 103 HLA-A*03:01 1.15 339.34 3.5 190.4 120565120_G_A FSICELALQPPV Pat4136 chr11: LLASSDPPALAST 104 HLA-B*35:01 4.4 1066.8 4.4 1066.8 62871652_A_C NAEVTGTMSQDT Pat4136 chr7: TLNSKTYDTVHRH 105 HLA-B*57:01 1.75 1314.73 2.1 560.5 122320259_C_T LTVEEATASVSE Pat4136 chr8: GYNSYSVSNSEKH 106 HLA-B*57:01 2.5 2822.89 2.5 2822.89 11847133_C_G IMAEIYKNGPVE Pat4136 chr9: MPYGYVLNEFQSC 107 HLA-B*35:01 19 9289.43 19 9289.43 111437083_G_A QNSSSAQGSSSN

Example 4: Optimization of Neoantigen Layout for Synthetic Genes Encoding Neoantigens to be Delivered by a Genetic Vaccine Vector

[0247] A polyneoantigen containing 60 neoantigens will result in an artificial protein with a total length of about 1500 amino acids that need to be encoded by an expression cassette inserted into a genetic vaccine vector. Expression of such a long artificial proteins can be suboptimal thus affecting the level of immunogenicity induced against the encoded neoantigens. Splitting the polyneoantigen into two pieces thus could help to obtain higher levels of induced immunogenicity.

[0248] A polyneoantigen composed of 62 neoantigens (Table 9) derived from the murine tumor cell line CT26 was therefore tested, using adenoviral vector GAd20, in different layouts (FIGS. 8A and 8B) for its capacity to induce immungenicity in vivo: in a single vector layout with all 62 neoantigens encoded by a single polyneoantigen (GAd20-CT26-62, SEQ ID NO: 170), in a two vector layout each encoding half of the 62 neoantigens (GAd-CT26-1-31+GAd-CT26-32-62, SEQ ID NOs: 171, 172), and in a third layout with the same two separate expression cassettes present in a single vector (GAd-CT26 dual 1-31 & 32-62). One TPA T-cell enhancer element (SEQ ID NO: 173) was present at the N-terminus of the polyneoantigen containing the 62 neoantogens and one TPA T-cell enhancer element was present at the N-terminus of each of the two 31 neoantigens constructs. A HA peptide sequence (SEQ ID NO: 183) was added at the C-terminal end of the assembled neo-antigens for the purpose of monitoring expression.

[0249] Immunogenicity was determined in vivo by immunizing groups (n=6) of naive BalbC mice intramuscularly once with a dose of 5.times.10{circumflex over ( )}8 viral particles (vp). T cell responses were measured 2 weeks post immunization on splenocytes by INF.gamma. ELISpot for recognition of peptide pools containing the 25mer neoantigens.

[0250] GAd20-CT26-62, expressing the long polyneoantigen, demonstrated a sub-optimal induction of neoantigen specific T cell responses when compared to the co-administered two vector layout GAd-CT26-1-31/GAd-CT26-32-62 (FIG. 8A). Therefore, dividing a long polyneoantigen into two shorter polyneoantigens of approximately equal length provided a significantly improved immunogenic response. Importantly, also the dual cassette vector GAd-CT26 dual 1-31 & 32-62 (FIG. 8B) induced a level of immunogenicity that was significantly higher than that of GAd-CT26-1-62, and comparable to that observed for the combination of two adenoviral vectors GAd-CT26-1-31+GAd-CT26-31-62 (FIGS. 8A & B).

[0251] Dividing the long polyantigen into two approximately equally sized smaller polyneoantigens thus provides a vaccine vector composition (one dual cassette vector or two distinct vectors) with superior immunogenic properties.

TABLE-US-00009 TABLE 9 List of 62 CT26 neoantigens. The order of the individual neoantigens in the polyneoantigen encoded by the various constructs is shown Order Order Order Order dual GAd- GAd- GAd- GAd-CT26-1- SEQ CT26- CT26- CT26- 31 + GAd- ID 1-62 1-31 32-62 CT26-32-62 NO CT26 Neoantigens 1 1 1 (cassette 1) 108 PGPQNFPPQNMFEFPPHLSPPLLPP 2 2 2 (cassette 1) 109 GAQEEPQVEPLDFSLPKQQGELLER 3 3 3 (cassette 1) 110 AVFAGSDDPFATPLSMSEMDRRNDA 4 4 4 (cassette 1) 111 HSGQNHLKEMAISVLEARACAAAGQ 5 5 5 (cassette 1) 112 ILPQAPSGPSYATYLQPAQAQMLTP 6 6 6 (cassette 1) 113 MSYAEKSDEITKDEWMEKL 7 7 7 (cassette 1) 114 GAGKGKYYAVNFSMRDGIDDESYGQ 8 8 8 (cassette 1) 115 YRGADKLCRKASSVKLVKTSPELSE 9 9 9 (cassette 1) 116 DSNLQARLTSYETLKKSLSKIREES 10 10 10 (cassette 1) 117 HSFIHAAMGMAVTWCAAIMTKGQYS 11 11 11 (cassette 1) 118 LRTAAYVNAIEKIFKVYNEAGVTFT 12 12 12 (cassette 1) 119 FEGSLAKNLSLNFQAVKENLYYEVG 13 13 13 (cassette 1) 120 DPRAAYFRQAENDMYIRMALLATVL 14 14 14 (cassette 1) 121 LRSQMVMKMREYFCNLHGFVDIETP 15 15 15 (cassette 1) 122 DLLAFERKLDQTVMRKRLDIQEALK 16 16 16 (cassette 1) 123 IKREKCWKDATYPESFHTLESVPAT 17 17 17 (cassette 1) 124 GRSSQVYFTINVNLDLSEAAVVTFS 18 18 18 (cassette 1) 125 KPLRRNNSYTSYIMAICGMPLDSFR 19 19 19 (cassette 1) 126 TTCLAVGGLDVKFQEAALRAAPDIL 20 20 20 (cassette 1) 127 IYEFDYHLYGQNITMIMTSVSGHLL 21 21 21 (cassette 1) 128 PDSFSIPYLTALDDLLGTALLALSF 22 22 22 (cassette 1) 129 YATILEMQAMMTLDPQDILLAGNMM 23 23 23 (cassette 1) 130 SWIHCWKYLSVQSQLFRGSSLLFRR 24 24 24 (cassette 1) 131 YDNKGITYLFDLYYESDEFTVDAAR 25 25 25 (cassette 1) 132 AQAAKNKGNKYFQAGKYEQAIQCYT 26 26 26 (cassette 1) 133 QPMLPIGLSDIPDEAMVKLYCPKCM 27 27 27 (cassette 1) 134 HRGAIYGSSWKYFTFSGYLLYQD 28 28 28 (cassette 1) 135 VIQTSKYYMRDVIAIESAWLLELAP 29 29 29 (cassette 1) 136 PRGVDLYLRILMPIDSELVDRDVVH 30 30 30 (cassette 1) 137 QIEQDALCPQDTYCDLKSRAEVNGA 31 31 31 (cassette 1) 138 ALASAILSDPESYIKKLKELRSMLM 32 1 1 (cassette 2) 139 VIVLDSSQGNSVCQIAMVHYIKQKY 33 2 2 (cassette 2) 140 MKSVSIQYLEAVKRLKSEGHRFPRT 34 3 3 (cassette 2) 141 KGGPVKIDPLALMQAIERYLVVRGY 35 4 4 (cassette 2) 142 LQDDPDLQALLKASQLLKVKSSSWR 36 5 5 (cassette 2) 143 LIAHMILGYRYWTGIGVLQSCESAL 37 6 6 (cassette 2) 144 TSVDQHLAPGAVAMPQAASLHAVIV 38 7 7 (cassette 2) 145 EISVRIATIPAFDTIMETVIQRELL 39 8 8 (cassette 2) 146 KTSREIKISGAIEPCVSLNSKGPCV 40 9 9 (cassette 2) 147 QGLANYVITTMGTICAPVRDEDIRE 41 10 10 (cassette 2) 148 ELSRRQYAEQELKQVRMALKKAEKE 42 11 11 (cassette 2) 149 IETQQRKFKASRASILSEMKMLKEK 43 12 12 (cassette 2) 150 SIFLDDDSNQPMAVSRFFGNVELMQ 44 13 13 (cassette 2) 151 RPDSYVRDMEIEAASHHVYADQPHI 45 14 14 (cassette 2) 152 TLSAMSNPRAMQVLLQIQQGLQTLA 46 15 15 (cassette 2) 153 VMKGTLEYLMSNTPTAQSLRESYIF 47 16 16 (cassette 2) 154 AAELFHQLSQALKVLTDAAARAAYD 48 17 17 (cassette 2) 155 TGLYFRKSYYMQKYFLDTVTEDAKV 49 18 18 (cassette 2) 156 CRNNVHYLNDGDAIIYHTASIGILH 50 19 19 (cassette 2) 157 DINDNNPSFPTGKMKLEISEALAPG 51 20 20 (cassette 2) 158 REGILQEESIYKPQKQEQELRALQA 52 21 21 (cassette 2) 159 INPTMIISNTLSKSAIATPKISYLL 53 22 22 (cassette 2) 160 QDLHNLNLLSLYANKLQTVAKGTFS 54 23 23 (cassette 2) 161 QEIQTYAIALINVLFLKAPEDKRQD 55 24 24 (cassette 2) 162 CYNYLYRMKALDGIRASEIPFHAEG 56 25 25 (cassette 2) 163 QSIHSFQSLEESISVLPSFQEPHLQ 57 26 26 (cassette 2) 164 TDFCLRNLDGTLCYLLDKETLRLHP 58 27 27 (cassette 2) 165 CEVTRVKAVRILPCGVAKVLWMQGS 59 28 28 (cassette 2) 166 GYDSRSARAFPYANVAFPHLTSSAP 60 29 29 (cassette 2) 167 TDKELREAMALLAAQQTALEVIVNM 61 30 30 (cassette 2) 168 LSRPDLPFLIAAVFFLVVAVWGETL 62 31 31 (cassette 2) 169 LYYTTVRALTRHNTMLKAMFSGRME

REFERENCES

[0252] Andersen R S, Kvistborg P, Frosig T M, Pedersen N W, Lyngaa R, Bakker A H, Shu C J, Straten Pt, Schumacher T N, Hadrup S R. (2012). Parallel detection of antigen-specific T cell responses by combinatorial encoding of MHC multimers. Nat Protoc, 7(5), 891-902. doi:10.1038/nprot.2012.037 [0253] Andreatta M & Nielsen M. (2016). Gapped sequence alignment using artificial neural networks: application to the MHC class I system. Bioinformatics, 32(4), 511-517. doi:10.1093/bioinformatics/btv639 [0254] Andrews, S. FastQC A Quality Control tool for High Throughput Sequence Data. Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc. [0255] Bolger A M, Lohse M, Usadel B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30(15), 2114-2120. doi:10.1093/bioinformatics/btu170 [0256] Cibulskis Kl, Lawrence M S, Carter S L, Sivachenko A, Jaffe D, Sougnez C, Gabriel S, Meyerson M, Lander E S, Getz G. (2013). Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat Biotechnol, 31(3), 213-219. doi:10.1038/nbt.2514 [0257] Donnelly M L, Hughes L E, Luke G, Mendoza H, ten Dam E, Gani D, Ryan M D. (2001) The `cleavage` activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring `2A-like` sequences. J Gen Virol. 200182(Pt 5):1027-41. [0258] Fang H, Wu Y, Narzisi G, O'Rawe J A, Barron L T, Rosenbaum J, Ronemus M, Iossifov I, Schatz M C, Lyon G J. (2014). Reducing INDEL calling errors in whole genome and exome sequencing data. Genome Med, 6(10), 89. doi:10.1186/s13073-014-0089-z [0259] Fritsch E F, Rajasagi M, Ott P A, Brusic V, Hacohen N, Wu C J. (2014). HLA-binding properties of tumor neoepitopes in humans. Cancer Immunol Res, 2(6), 522-529. doi:10.1158/2326-6066.CIR-13-0227 [0260] Gros A, Parkhurst M R, Tran E, Pasetto A, Robbins P F, Ilyas S, Prickett T D, Gartner J J, Crystal J S, Roberts I M, Trebska-McGowan K, Wunderlich J R, Yang J C1, Rosenberg S A. (2016). Prospective identification of neoantigen-specific lymphocytes in the peripheral blood of melanoma patients. Nat Med. 22(4):433-8. doi: 10.1038/nm.4051. [0261] Hoof I, Peters B, Sidney J, Pedersen L E, Sette A, Lund O, Buus S, Nielsen M. (2009). NetMHCpan, a method for MHC class I binding prediction beyond humans. Immunogenetics, 61(1), 1-13. doi:10.1007/s00251-008-0341-z [0262] Jurtz V, Paul S, Andreatta M, Marcatili P, Peters B, Nielsen M. (2017). NetMHCpan-4.0: Improved Peptide-MHC Class I Interaction Predictions Integrating Eluted Ligand and Peptide Binding Affinity Data. J Immunol, 199(9), 3360-3368. doi:10.4049/jimmunol.1700893 [0263] Kandoth C, McLellan M D, Vandin F, Ye K, Niu B, Lu C, Xie M, Zhang Q, McMichael J F, Wyczalkowski M A, Leiserson M D M, Miller C A, Welch J S, Walter M J, Wendl M C, Ley T J, Wilson R K, Raphael B J, Ding L. (2013). Mutational landscape and significance across 12 major cancer types. Nature, 502(7471), 333-339. doi:10.1038/nature12634 [0264] Kim D, Langmead B, Salzberg S L. (2015). HISAT: a fast spliced aligner with low memory requirements. Nat Methods, 12(4), 357-360. doi:10.1038/nmeth.3317 [0265] Koboldt D C, Zhang Q, Larson D E, Shen D, McLellan M D, Lin L, Miller C A, Mardis E R, Ding L, Wilson R K. (2012). VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing. Genome Res, 22(3), 568-576. doi:10.1101/gr.129684.111 [0266] Li B & Dewey C N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics, 12, 323. doi:10.1186/1471-2105-12-323 [0267] Li H & Durbin R. (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 25(14), 1754-1760. doi:10.1093/bioinformatics/btp324 [0268] Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R; 1000 Genome Project Data Processing Subgroup. Genome Project Data Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics, 25(16), 2078-2079. doi:10.1093/bioinformatics/btp352 [0269] Luke G A, de Felipe P, Lukashev A, Kallioinen S E, Bruno E A, Ryan M D. (2008) Occurrence, function and evolutionary origins of `2A-like` sequences in virus genomes. J Gen Virol. 2008 89(Pt 4):1036-42. doi: 10.1099/vir.0.83428-0.

[0270] Lundegaard C, Lamberth K, Harndahl M, Buus S, Lund O, Nielsen M. (2008). NetMHC-3.0: accurate web accessible predictions of human, mouse and monkey MHC class I affinities for peptides of length 8-11. Nucleic Acids Res, 36(Web Server issue), W509-512. doi:10.1093/nar/gkn202

[0271] McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo M A. (2010). The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res, 20(9), 1297-1303. doi:10.1101/gr.107524.110

[0272] Moutaftsi M, Peters B, Pasquetto V, Tscharke D C, Sidney J, Bui H H, Grey H, Sette A. (2006). A consensus epitope prediction approach identifies the breadth of murine T(CD8+)-cell responses to vaccinia virus. Nat Biotechnol, 24(7), 817-819. doi:10.1038/nbt1215

[0273] Sahin U, Derhovanessian E, Miller M, Kloke B P, Simon P, Lower M, Bukur V, Tadmor A D, Luxemburger U, Schrors B, Omokoko T, Vormehr M, Albrecht C, Paruzynski A, Kuhn A N, Buck J, Heesch S, Schreeb K H, Muller F, Ortseifer I, Vogler I, Godehardt E, Attig S, Rae R, Breitkreuz A, Tolliver C, Suchan M, Martic G, Hohberger A, Sorn P, Diekmann J, Ciesla J, Waksmann O, Bruck A K, Witt M, Zillgen M, Rothermel A, Kasemann B, Langer D, Bolte S, Diken M, Kreiter S, Nemecek R, Gebhardt C, Grabbe S, Holler C, Utikal J, Huber C, Loquai C, Tureci O. Personalized RNA mutanome vaccines mobilize poly-specific therapeutic immunity against cancer. Nature, 547(7662), 222-226. doi:10.1038/nature23003

[0274] Shannon, C. E. (1997). The mathematical theory of communication. 1963. M D Comput, 14(4), 306-317.

[0275] Strait & Dewey. (1996). The Shannon information entropy of protein sequences. Biophys. J. 1996 Biophys J. 71(1),148-55.

[0276] Szolek A, Schubert B, Mohr C, Sturm M, Feldhahn M, Kohlbacher 0. (2014). OptiType: precision HLA typing from next-generation sequencing data. Bioinformatics, 30(23), 3310-3316. doi:10.1093/bioinformatics/btu548

[0277] Tran E, Ahmadzadeh M, Lu Y C, Gros A, Turcotte S, Robbins P F, Gartner J J, Zheng Z, Li Y F, Ray S, Wunderlich J R, Somerville R P, Rosenberg S A. (2015). Immunogenicity of somatic mutations in human gastrointestinal cancers. Science, 350(6266), 1387-1390. doi:10.1126/science.aad1253 [0278] Wang K, Li M, Hakonarson H. (2010). ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res, 38(16), e164. doi:10.1093/nar/gkq603 [0279] Warren R L, Choe G, Freeman D J, Castellarin M, Munro S, Moore R, Holt R A. (2012). Derivation of HLA types from shotgun sequence datasets. Genome Med, 4(12), 95. doi:10.1186/gm396 [0280] Yarchoan M, Johnson B A 3rd, Lutz E R, Laheru D A, Jaffee E M. (2017). Targeting neoantigens to augment antitumour immunity. Nat Rev Cancer, 17(9), 569. doi:10.1038/nrc.2017.74

Sequence CWU 1

1

184198PRTArtificial Sequencecomplete FSP 1Gly Ser Leu Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro1 5 10 15Val Ser Val Val Ser Leu Cys Pro Gly Arg Cys Gln Ser Gly Glu Ala 20 25 30Gly Leu Trp Gly Gly His Gln Ala Ala Arg His His Leu His Arg Ser 35 40 45Gln Val Arg Trp His Pro Gly His Gly Leu Pro Pro His Leu Arg Gln 50 55 60Gln Arg Ala Ala Arg Leu Arg Gln Pro Asp Ala Ala Glu Ala Gly Gly65 70 75 80Pro Glu His Leu Leu Leu Leu Pro Glu Gln Gly Pro Arg Cys Ala Ala 85 90 95Trp Gly230PRTArtificial SequenceAssembled FSP 2Gly Ser Leu Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro1 5 10 15Val Ser Val Val Ser Leu Cys Pro Gly Arg Cys Gln Ser Gly 20 25 30323PRTArtificial SequenceFSP fragment 3Gly Ser Leu Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro1 5 10 15Val Ser Val Val Ser Leu Cys 20425PRTArtificial SequenceFSP fragment 4Leu Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro Val Ser1 5 10 15Val Val Ser Leu Cys Pro Gly Arg Cys 20 25525PRTArtificial SequenceFSP fragment 5Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro Val Ser Val1 5 10 15Val Ser Leu Cys Pro Gly Arg Cys Gln 20 25625PRTArtificial SequenceFSP fragment 6Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro Val Ser Val Val Ser1 5 10 15Leu Cys Pro Gly Arg Cys Gln Ser Gly 20 25725PRTArtificial SequenceFSP fragment 7Pro Gly His Gly Leu Pro Pro His Leu Arg Gln Gln Arg Ala Ala Arg1 5 10 15Leu Arg Gln Pro Asp Ala Ala Glu Ala 20 25818PRTArtificial SequenceFSP fragment 8Pro Glu His Leu Leu Leu Leu Pro Glu Gln Gly Pro Arg Cys Ala Ala1 5 10 15Trp Gly931PRTArtificial Sequencecomplete FSP 9Ala Arg Pro Pro Gly Ser Val Glu Asp Ala Gly Gln Ala Val Gly His1 5 10 15Ile Leu Ala Gln Ala Cys Val Tyr Arg Ala Val Gln Cys Ser Arg 20 25 301022PRTArtificial SequenceFSP fragment 10Ala Arg Pro Pro Gly Ser Val Glu Asp Ala Gly Gln Ala Val Gly His1 5 10 15Ile Leu Ala Gln Ala Cys 201124PRTArtificial SequenceFSP fragment 11Glu Asp Ala Gly Gln Ala Val Gly His Ile Leu Ala Gln Ala Cys Val1 5 10 15Tyr Arg Ala Val Gln Cys Ser Arg 201225PRTArtificial Sequenceneoantigen 12Tyr Ile Arg Leu Val Glu Pro Gly Ser Pro Ala Glu Asn Ala Gly Leu1 5 10 15Leu Ala Gly Asp Arg Leu Val Glu Val 20 251325PRTArtificial Sequenceneoantigen 13Tyr Phe Trp Asn Ile Ala Thr Ile Ala Val Phe Tyr Val Leu Pro Val1 5 10 15Val Gln Leu Val Ile Thr Tyr Gln Thr 20 251425PRTArtificial Sequenceneoantigen 14Val Thr Leu Glu Asp Phe Tyr Gly Val Phe Ser Ser Leu Gly Tyr Thr1 5 10 15His Leu Ala Ser Val Ser His Pro Gln 20 251525PRTArtificial Sequenceneoantigen 15Glu Lys Cys Gln Phe Ala His Gly Phe His Glu Leu Cys Ser Leu Thr1 5 10 15Arg His Pro Lys Tyr Lys Thr Glu Leu 20 251625PRTArtificial Sequenceneoantigen 16Thr Pro Asp Phe Thr Ser Leu Asp Val Leu Thr Phe Val Gly Ser Gly1 5 10 15Ile Pro Ala Gly Ile Asn Ile Pro Asn 20 251725PRTArtificial Sequenceneoantigen 17Ser Ala Phe Gly Ala Gly Phe Cys Thr Thr Val Ile Thr Ser Pro Val1 5 10 15Asp Val Val Lys Thr Arg Tyr Met Asn 20 251825PRTArtificial Sequenceneoantigen 18Glu Ser Leu His Ser Ile Leu Ala Gly Ser Asp Met Met Val Ser Gln1 5 10 15Ile Leu Leu Thr Gln His Gly Ile Pro 20 251925PRTArtificial Sequenceneoantigen 19Ala Met Arg Leu Leu His Asp Gln Val Gly Val Ile Leu Phe Gly Pro1 5 10 15Tyr Lys Gln Leu Phe Leu Gln Thr Tyr 20 252025PRTArtificial Sequenceneoantigen 20Ala Pro Thr Glu His Lys Ala Leu Val Ser His Asn Ala Ser Leu Ile1 5 10 15Asn Val Gly Ser Leu Leu Gln Arg Ala 20 252125PRTArtificial Sequenceneoantigen 21Leu Pro Arg Gly Leu Ser Leu Ser Ser Leu Gly Ser Val Arg Thr Leu1 5 10 15Arg Gly Trp Ser Arg Ser Ser Arg Pro 20 252225PRTArtificial Sequenceneoantigen 22Glu Arg Trp Glu Asp Val Lys Glu Glu Met Thr Ser Asp Leu Ala Thr1 5 10 15Met Arg Val Asp Tyr Glu Gln Ile Lys 20 252325PRTArtificial Sequenceneoantigen 23Leu Tyr Ser Cys Ile Ala Leu Lys Val Thr Ala Asn Lys Met Glu Met1 5 10 15Glu His Ser Leu Ile Leu Asn Asn Leu 20 252425PRTArtificial Sequenceneoantigen 24Leu Val Leu Ser Leu Val Phe Ile Cys Phe Tyr Ile Arg Lys Ile Asn1 5 10 15Pro Leu Lys Glu Lys Ser Ile Ile Leu 20 252522PRTArtificial Sequenceneoantigen 25Pro Phe Ser Thr Leu Thr Pro Arg Leu His Leu Pro Tyr Pro Gln Gln1 5 10 15Pro Pro Gln Gln Gln Leu 202625PRTArtificial Sequenceneoantigen 26Ala Ala Asn Ile Pro Arg Ser Ile Ser Ser Asp Gly His Pro Leu Glu1 5 10 15Arg Arg Leu Ser Pro Gly Ser Asp Ile 20 252725PRTArtificial Sequenceneoantigen 27Tyr Tyr Ile Val Arg Val Leu Gly Thr Leu Gly Ile Met Thr Val Phe1 5 10 15Trp Val Cys Pro Leu Thr Ile Phe Asn 20 252825PRTArtificial Sequenceneoantigen 28Trp Gln Leu Arg Phe Ser His Leu Val Gly Tyr Gly Gly Arg Tyr Tyr1 5 10 15Ser Tyr Leu Met Ser Arg Ala Val Ala 20 252925PRTArtificial Sequenceneoantigen 29His Tyr Thr Gln Ser Glu Thr Glu Phe Leu Leu Ser Ser Ala Glu Thr1 5 10 15Asp Glu Asn Glu Thr Leu Asp Tyr Glu 20 253025PRTArtificial Sequenceneoantigen 30Gln Ser Ile Ser Arg Asn His Val Val Asp Ile Ser Lys Ser Gly Leu1 5 10 15Ile Thr Ile Ala Gly Gly Lys Trp Thr 20 253125PRTArtificial Sequenceneoantigen 31Leu Leu Gln Cys Val Gln Lys Met Ala Asp Gly Leu Gln Glu Gln Gln1 5 10 15Gln Ala Leu Ser Ile Leu Leu Val Lys 20 253225PRTArtificial Sequenceneoantigen 32Thr Gly Leu Phe Gly Gln Thr Asn Thr Gly Phe Gly Asp Val Gly Ser1 5 10 15Thr Leu Phe Gly Asn Asn Lys Leu Thr 20 253325PRTArtificial Sequenceneoantigen 33Leu Gln Glu Asn Gly Leu Ala Gly Leu Ser Ala Ser Thr Ile Val Glu1 5 10 15Gln Gln Leu Pro Leu Arg Arg Asn Ser 20 253430PRTArtificial Sequenceneoantigen 34Gly Ser Leu Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro1 5 10 15Val Ser Val Val Ser Leu Cys Pro Gly Arg Cys Gln Ser Gly 20 25 303525PRTArtificial Sequenceneoantigen 35Ser Tyr Ala Glu Gln Gly Thr Asn Cys Asp Glu Ala Val Ser Phe Met1 5 10 15Asp Thr His Asn Leu Asn Gly Arg Ser 20 253625PRTArtificial Sequenceneoantigen 36Asn Ala Met Asp Gln Leu Glu Gln Arg Val Ser Glu Leu Phe Met Asn1 5 10 15Ala Lys Lys Asn Lys Pro Glu Trp Arg 20 253725PRTArtificial Sequenceneoantigen 37Gly Asp Ala Glu Ala Glu Ala Leu Ala Arg Ser Ala Ser Ala Leu Val1 5 10 15Arg Ala Gln Gln Gly Arg Gly Thr Gly 20 253818PRTArtificial Sequenceneoantigen 38Met Arg Asn Leu Lys Phe Phe Arg Thr Leu Glu Phe Arg Asp Ile Gln1 5 10 15Gly Pro3931PRTArtificial Sequenceneoantigen 39Ala Arg Pro Pro Gly Ser Val Glu Asp Ala Gly Gln Ala Val Gly His1 5 10 15Ile Leu Ala Gln Ala Cys Val Tyr Arg Ala Val Gln Cys Ser Arg 20 25 304018PRTArtificial Sequenceneoantigen 40Pro Glu His Leu Leu Leu Leu Pro Glu Gln Gly Pro Arg Cys Ala Ala1 5 10 15Trp Gly4125PRTArtificial Sequenceneoantigen 41Val His Trp Thr Val Asp Gln Gln Ser Gln Tyr Ile Lys Gly Tyr Lys1 5 10 15Ile Leu Tyr Arg Pro Ser Gly Ala Asn 20 254225PRTArtificial Sequenceneoantigen 42Glu Thr Thr Ser His Ser Thr Pro Gly Phe Thr Ser Leu Ile Thr Thr1 5 10 15Thr Glu Thr Thr Ser His Ser Thr Pro 20 254325PRTArtificial Sequenceneoantigen 43Pro Val Phe Thr His Glu Asn Ile Gln Gly Gly Gly Val Pro Phe Gln1 5 10 15Ala Leu Tyr Asn Tyr Thr Pro Arg Asn 20 254425PRTArtificial Sequenceneoantigen 44Thr Thr Leu Ser Ser Ile Lys Val Glu Val Ala Ser Arg Gln Ala Glu1 5 10 15Thr Thr Thr Leu Asp Gln Asp His Leu 20 254524PRTArtificial Sequenceneoantigen 45Cys Cys Tyr Gly Lys Gln Leu Cys Thr Ile Pro Arg Arg Ile Gly Ile1 5 10 15Ile Ser Val Arg Ser Val Ser Gln 204625PRTArtificial Sequenceneoantigen 46Asp Val Leu Ala Asp Asp Arg Asp Asp Tyr Asp Phe Met Met Gln Thr1 5 10 15Ser Thr Tyr Tyr Tyr Ser Val Arg Ile 20 254725PRTArtificial Sequenceneoantigen 47Ala Leu Thr Gly Ala Trp Ala Met Glu Asp Phe Tyr Met Ala Arg Leu1 5 10 15Val Pro Pro Leu Val Pro Gln Arg Pro 20 254825PRTArtificial Sequenceneoantigen 48Cys Pro Asn Gln Lys Val Leu Lys Tyr Tyr Tyr Val Trp Gln Tyr Cys1 5 10 15Pro Ala Gly Asn Trp Ala Asn Arg Leu 20 254925PRTArtificial Sequenceneoantigen 49Gln Asp Gly Ile Pro Gly Asp Glu Gly Leu Glu Leu Leu Ser Ala Asp1 5 10 15Ser Ala Val Pro Val Ala Met Thr Gln 20 255025PRTArtificial Sequenceneoantigen 50Thr Asn Ser Thr Ala Ala Ser Arg Pro Pro Val Thr Gln Arg Leu Val1 5 10 15Val Pro Ala Thr Gln Cys Gly Ser Leu 20 255125PRTArtificial Sequenceneoantigen 51Gln Glu Ile Glu Glu Lys Leu Ile Glu Glu Glu Thr Leu Arg Arg Val1 5 10 15Glu Glu Leu Val Ala Lys Arg Val Glu 20 255225PRTArtificial Sequenceneoantigen 52Thr Asp Phe Ile Arg Glu Glu Tyr His Lys Arg Asp Ile Thr Glu Val1 5 10 15Leu Ser Pro Asn Met Tyr Asn Ser Lys 20 255317PRTArtificial Sequenceneoantigen 53Met Ser Glu Ala Cys Arg Asp Ser Thr Ser Ser Leu Gln Arg Lys Lys1 5 10 15Pro5425PRTArtificial Sequenceneoantigen 54His Asp Lys Glu Val Tyr Asp Ile Ala Phe Ser Arg Thr Gly Gly Gly1 5 10 15Arg Asp Met Phe Ala Ser Val Gly Ala 20 255525PRTArtificial Sequenceneoantigen 55Glu Ile Pro Thr Ala Ala Leu Val Leu Gly Val Asn Ile Thr Asp His1 5 10 15Asp Leu Thr Phe Gly Ser Leu Thr Glu 20 255625PRTArtificial Sequenceneoantigen 56Ser Ser Leu Ile Ile His Gln Arg Thr His Thr Gly Lys Lys Pro Tyr1 5 10 15Gln Cys Gly Glu Cys Gly Lys Ser Phe 20 255725PRTArtificial Sequenceneoantigen 57Ser Gly Asn Leu Leu Gly Arg Asn Ser Phe Glu Val Cys Val Cys Ala1 5 10 15Cys Pro Gly Arg Asp Arg Arg Thr Glu 20 255825PRTArtificial Sequenceneoantigen 58Ser Cys Leu Leu Ile Leu Glu Phe Val Met Ile Val Ile Phe Gly Leu1 5 10 15Glu Phe Ile Ile Arg Ile Trp Ser Ala 20 255925PRTArtificial Sequenceneoantigen 59Leu Thr Glu Gly Gln Lys Arg Tyr Phe Glu Lys Leu Leu Ile Tyr Cys1 5 10 15Asp Gln Tyr Ala Ser Leu Ile Pro Val 20 256025PRTArtificial Sequenceneoantigen 60Gln Ala Pro Thr Pro Ala Pro Ser Thr Ile Pro Gly Leu Arg Arg Gly1 5 10 15Ser Gly Pro Glu Ile Phe Thr Phe Asp 20 256125PRTArtificial Sequenceneoantigen 61Val Ala Ile Ile Pro Tyr Phe Ile Thr Leu Gly Thr Gln Leu Ala Glu1 5 10 15Lys Pro Glu Asp Ala Gln Gln Gly Gln 20 256225PRTArtificial Sequenceneoantigen 62Pro Gly His Gly Leu Pro Pro His Leu Arg Gln Gln Arg Ala Ala Arg1 5 10 15Leu Arg Gln Pro Asp Ala Ala Glu Ala 20 256325PRTArtificial Sequenceneoantigen 63Ile Ile Glu Lys His Phe Gly Glu Glu Glu Asp Glu Arg Gln Thr Leu1 5 10 15Leu Ser Gln Val Ile Asp Gln Asp Tyr 20 256425PRTArtificial Sequenceneoantigen 64Tyr Glu Ile Gly Arg Gln Phe Arg Asn Glu Gly Ile His Leu Thr His1 5 10 15Asn Pro Glu Phe Thr Thr Cys Glu Phe 20 256525PRTArtificial Sequenceneoantigen 65Arg Leu Met Trp Lys Ser Gln Tyr Val Pro Tyr Asp Glu Ile Pro Phe1 5 10 15Val Asn Ala Gly Ser Arg Ala Val Val 20 256625PRTArtificial Sequenceneoantigen 66Gln Ala Gln Ser Lys Phe Lys Ser Glu Lys Gln Asn Gln Lys Gln Leu1 5 10 15Glu Leu Lys Val Thr Ser Leu Glu Glu 20 256725PRTArtificial Sequenceneoantigen 67Ser Phe Cys Asp Gly Leu Val His Asp Pro Leu Arg Gln Lys Ala Asn1 5 10 15Phe Leu Lys Leu Leu Ile Ser Glu Leu 20 256825PRTArtificial Sequenceneoantigen 68Leu Asp Gly Gly Asp Phe Val Ser Leu Ser Ser Arg Lys Glu Val Gln1 5 10 15Glu Asn Cys Val Arg Trp Arg Lys Arg 20 256925PRTArtificial Sequenceneoantigen 69Gln Ser Leu Pro Leu Glu Thr Phe Ser Phe Leu Leu Ile Leu Leu Ala1 5 10 15Thr Thr Val Thr Pro Val Phe Val Leu 20 257025PRTArtificial Sequenceneoantigen 70Gly Lys Phe Asp Glu Leu Ala Thr Glu Asn His Cys His Arg Ile Lys1 5 10 15Ile Leu Gly Asp Cys Tyr Tyr Cys Val 20 257125PRTArtificial Sequenceneoantigen 71Val Gly Ser Ser Leu Pro Glu Ala Ser Pro Pro Ala Leu Glu Pro Ser1 5 10 15Ser Pro Asn Ala Ala Val Pro Glu Ala 20 257230PRTArtificial SequenceAssembled FSP 72Gly Ser Leu Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro1 5 10 15Val Ser Val Val Ser Leu Cys Pro Gly Arg Cys Gln Ser Gly 20 25 307323PRTArtificial SequenceFSP fragment 73Gly Ser Leu Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro1 5 10 15Val Ser Val Val Ser Leu Cys 207425PRTArtificial SequenceFSP fragment 74Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro Val Ser Val Val Ser1 5 10 15Leu Cys Pro Gly Arg Cys Gln Ser Gly 20 257525PRTArtificial SequenceFSP fragment 75Leu Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro Val Ser1 5 10 15Val Val Ser Leu Cys Pro Gly Arg Cys 20 257625PRTArtificial SequenceFSP fragment 76Ser Gly Tyr Leu Ser Gln Asp Thr Val Gly Ala Leu Pro Val Ser Val1 5 10 15Val Ser Leu Cys Pro Gly Arg Cys Gln 20 257731PRTArtificial SequenceAssembled FSP 77Ala Arg Pro Pro Gly Ser Val Glu Asp Ala Gly Gln Ala Val Gly His1 5 10 15Ile Leu Ala Gln Ala Cys Val Tyr Arg Ala Val Gln Cys Ser Arg 20 25 307822PRTArtificial SequenceFSP fragment 78Ala Arg Pro Pro Gly Ser Val Glu Asp Ala Gly Gln Ala Val Gly His1 5 10 15Ile Leu Ala

Gln Ala Cys 207924PRTArtificial SequenceFSP fragment 79Glu Asp Ala Gly Gln Ala Val Gly His Ile Leu Ala Gln Ala Cys Val1 5 10 15Tyr Arg Ala Val Gln Cys Ser Arg 208025PRTArtificial Sequenceneoantigen 80Asp Ser Leu Gln Leu Val Phe Gly Ile Glu Leu Met Lys Val Asp Pro1 5 10 15Ile Gly His Val Tyr Ile Phe Ala Thr 20 258125PRTArtificial Sequenceneoantigen 81Ser Leu Leu Pro Glu Phe Val Val Pro Tyr Met Ile Tyr Leu Leu Ala1 5 10 15His Asp Pro Asp Phe Thr Arg Ser Gln 20 258225PRTArtificial Sequenceneoantigen 82Pro His Ile Lys Ser Thr Val Ser Val Gln Ile Ile Ser Cys Gln Tyr1 5 10 15Leu Leu Gln Pro Val Lys His Glu Asp 20 258325PRTArtificial Sequenceneoantigen 83Val Val Ile Ser Gln Ser Glu Ile Gly Asp Ala Ser Cys Val Arg Val1 5 10 15Ser Gly Gln Gly Leu His Glu Gly His 20 258425PRTArtificial Sequenceneoantigen 84Arg Lys Thr Val Arg Ala Arg Ser Arg Thr Pro Ser Cys Arg Ser Arg1 5 10 15Ser His Thr Pro Ser Arg Arg Arg Arg 20 258525PRTArtificial Sequenceneoantigen 85Arg Glu Lys Gln Gln Arg Glu Ala Leu Glu Arg Ala Pro Ala Arg Leu1 5 10 15Glu Arg Arg His Ser Ala Leu Gln Arg 20 258625PRTArtificial Sequenceneoantigen 86Thr Leu Lys Arg Gln Leu Glu His Asn Ala Tyr His Ser Ile Glu Trp1 5 10 15Ala Ile Asn Ala Ala Thr Leu Ser Gln 20 258725PRTArtificial Sequenceneoantigen 87Val Thr Val Arg Val Ala Asp Ile Asn Asp His Ala Leu Ala Phe Pro1 5 10 15Gln Ala Arg Ala Ala Leu Gln Val Pro 20 258825PRTArtificial Sequenceneoantigen 88Leu Arg Pro Arg Arg Val Gly Ile Ala Leu Asp Tyr Asp Trp Gly Thr1 5 10 15Val Thr Phe Thr Asn Ala Glu Ser Gln 20 258925PRTArtificial Sequenceneoantigen 89Gly Tyr Val Gly Ile Asp Ser Ile Leu Glu Gln Met His Arg Lys Ala1 5 10 15Met Lys Gln Gly Phe Glu Phe Asn Ile 20 259025PRTArtificial Sequenceneoantigen 90Ile Ile Val Gly Val Leu Leu Ala Ile Gly Phe Ile Cys Ala Ile Ile1 5 10 15Val Val Val Met Arg Lys Met Ser Gly 20 259125PRTArtificial Sequenceneoantigen 91Pro Arg Glu Gly Ser Gly Gly Ser Thr Ser Asp Tyr Leu Ser Gln Ser1 5 10 15Tyr Ser Tyr Ser Ser Ile Leu Asn Lys 20 259225PRTArtificial Sequenceneoantigen 92Arg Arg Ala Gly Gly Ala Gln Ser Trp Leu Trp Phe Val Thr Val Lys1 5 10 15Ser Leu Ile Gly Lys Gly Val Met Leu 20 259325PRTArtificial Sequenceneoantigen 93Gln Ser Ile Ser Arg Asn His Val Val Asp Ile Ser Lys Ser Gly Leu1 5 10 15Ile Thr Ile Ala Gly Gly Lys Trp Thr 20 259425PRTArtificial Sequenceneoantigen 94Thr Gly Leu Phe Gly Gln Thr Asn Thr Gly Phe Gly Asp Val Gly Ser1 5 10 15Thr Leu Phe Gly Asn Asn Lys Leu Thr 20 259525PRTArtificial Sequenceneoantigen 95Tyr Glu Ile Gly Arg Gln Phe Arg Asn Glu Gly Ile His Leu Thr His1 5 10 15Asn Pro Glu Phe Thr Thr Cys Glu Phe 20 259625PRTArtificial Sequenceneoantigen 96Pro Ile Leu Lys Glu Ile Val Glu Met Leu Phe Ser His Gly Leu Val1 5 10 15Lys Val Leu Phe Ala Thr Glu Thr Phe 20 259725PRTArtificial Sequenceneoantigen 97Val Lys Lys Pro His Arg Tyr Arg Pro Gly Thr Val Thr Leu Arg Glu1 5 10 15Ile Arg Arg Tyr Gln Lys Ser Thr Glu 20 259825PRTArtificial Sequenceneoantigen 98Phe Val Thr Gln Lys Arg Met Glu His Phe Tyr Leu Ser Phe Tyr Thr1 5 10 15Ala Glu Gln Leu Val Tyr Leu Ser Thr 20 259925PRTArtificial Sequenceneoantigen 99Asp Leu Ser Ile Arg Glu Leu Val His Arg Ile Leu Leu Val Ala Ala1 5 10 15Ser Tyr Ser Ala Val Thr Arg Phe Ile 20 2510024PRTArtificial Sequenceneoantigen 100Met Thr Glu Tyr Lys Leu Val Val Val Gly Ala Asp Gly Val Gly Lys1 5 10 15Ser Ala Leu Thr Ile Gln Leu Ile 2010125PRTArtificial Sequenceneoantigen 101Asp Pro Asp Cys Val Asp Arg Leu Leu Gln Cys Thr Gln Gln Ala Val1 5 10 15Pro Leu Phe Ser Lys Asn Val His Ser 20 2510225PRTArtificial Sequenceneoantigen 102Val Asn Arg Trp Thr Arg Arg Gln Val Ile Leu Cys Glu Thr Cys Leu1 5 10 15Ile Val Ser Ser Val Lys Asp Ser Leu 20 2510325PRTArtificial Sequenceneoantigen 103Arg His Arg Tyr Leu Ser His Leu Pro Leu Thr Cys Lys Phe Ser Ile1 5 10 15Cys Glu Leu Ala Leu Gln Pro Pro Val 20 2510425PRTArtificial Sequenceneoantigen 104Leu Leu Ala Ser Ser Asp Pro Pro Ala Leu Ala Ser Thr Asn Ala Glu1 5 10 15Val Thr Gly Thr Met Ser Gln Asp Thr 20 2510525PRTArtificial Sequenceneoantigen 105Thr Leu Asn Ser Lys Thr Tyr Asp Thr Val His Arg His Leu Thr Val1 5 10 15Glu Glu Ala Thr Ala Ser Val Ser Glu 20 2510625PRTArtificial Sequenceneoantigen 106Gly Tyr Asn Ser Tyr Ser Val Ser Asn Ser Glu Lys His Ile Met Ala1 5 10 15Glu Ile Tyr Lys Asn Gly Pro Val Glu 20 2510725PRTArtificial Sequenceneoantigen 107Met Pro Tyr Gly Tyr Val Leu Asn Glu Phe Gln Ser Cys Gln Asn Ser1 5 10 15Ser Ser Ala Gln Gly Ser Ser Ser Asn 20 2510825PRTArtificial SequenceCT26 neoantigen 108Pro Gly Pro Gln Asn Phe Pro Pro Gln Asn Met Phe Glu Phe Pro Pro1 5 10 15His Leu Ser Pro Pro Leu Leu Pro Pro 20 2510925PRTArtificial SequenceCT26 neoantigen 109Gly Ala Gln Glu Glu Pro Gln Val Glu Pro Leu Asp Phe Ser Leu Pro1 5 10 15Lys Gln Gln Gly Glu Leu Leu Glu Arg 20 2511025PRTArtificial SequenceCT26 neoantigen 110Ala Val Phe Ala Gly Ser Asp Asp Pro Phe Ala Thr Pro Leu Ser Met1 5 10 15Ser Glu Met Asp Arg Arg Asn Asp Ala 20 2511125PRTArtificial SequenceCT26 neoantigen 111His Ser Gly Gln Asn His Leu Lys Glu Met Ala Ile Ser Val Leu Glu1 5 10 15Ala Arg Ala Cys Ala Ala Ala Gly Gln 20 2511225PRTArtificial SequenceCT26 neoantigen 112Ile Leu Pro Gln Ala Pro Ser Gly Pro Ser Tyr Ala Thr Tyr Leu Gln1 5 10 15Pro Ala Gln Ala Gln Met Leu Thr Pro 20 2511319PRTArtificial SequenceCT26 neoantigen 113Met Ser Tyr Ala Glu Lys Ser Asp Glu Ile Thr Lys Asp Glu Trp Met1 5 10 15Glu Lys Leu11425PRTArtificial SequenceCT26 neoantigen 114Gly Ala Gly Lys Gly Lys Tyr Tyr Ala Val Asn Phe Ser Met Arg Asp1 5 10 15Gly Ile Asp Asp Glu Ser Tyr Gly Gln 20 2511525PRTArtificial SequenceCT26 neoantigen 115Tyr Arg Gly Ala Asp Lys Leu Cys Arg Lys Ala Ser Ser Val Lys Leu1 5 10 15Val Lys Thr Ser Pro Glu Leu Ser Glu 20 2511625PRTArtificial SequenceCT26 neoantigen 116Asp Ser Asn Leu Gln Ala Arg Leu Thr Ser Tyr Glu Thr Leu Lys Lys1 5 10 15Ser Leu Ser Lys Ile Arg Glu Glu Ser 20 2511725PRTArtificial SequenceCT26 neoantigen 117His Ser Phe Ile His Ala Ala Met Gly Met Ala Val Thr Trp Cys Ala1 5 10 15Ala Ile Met Thr Lys Gly Gln Tyr Ser 20 2511825PRTArtificial SequenceCT26 neoantigen 118Leu Arg Thr Ala Ala Tyr Val Asn Ala Ile Glu Lys Ile Phe Lys Val1 5 10 15Tyr Asn Glu Ala Gly Val Thr Phe Thr 20 2511925PRTArtificial SequenceCT26 neoantigen 119Phe Glu Gly Ser Leu Ala Lys Asn Leu Ser Leu Asn Phe Gln Ala Val1 5 10 15Lys Glu Asn Leu Tyr Tyr Glu Val Gly 20 2512025PRTArtificial SequenceCT26 neoantigen 120Asp Pro Arg Ala Ala Tyr Phe Arg Gln Ala Glu Asn Asp Met Tyr Ile1 5 10 15Arg Met Ala Leu Leu Ala Thr Val Leu 20 2512125PRTArtificial SequenceCT26 neoantigen 121Leu Arg Ser Gln Met Val Met Lys Met Arg Glu Tyr Phe Cys Asn Leu1 5 10 15His Gly Phe Val Asp Ile Glu Thr Pro 20 2512225PRTArtificial SequenceCT26 neoantigen 122Asp Leu Leu Ala Phe Glu Arg Lys Leu Asp Gln Thr Val Met Arg Lys1 5 10 15Arg Leu Asp Ile Gln Glu Ala Leu Lys 20 2512325PRTArtificial SequenceCT26 neoantigen 123Ile Lys Arg Glu Lys Cys Trp Lys Asp Ala Thr Tyr Pro Glu Ser Phe1 5 10 15His Thr Leu Glu Ser Val Pro Ala Thr 20 2512425PRTArtificial SequenceCT26 neoantigen 124Gly Arg Ser Ser Gln Val Tyr Phe Thr Ile Asn Val Asn Leu Asp Leu1 5 10 15Ser Glu Ala Ala Val Val Thr Phe Ser 20 2512525PRTArtificial SequenceCT26 neoantigen 125Lys Pro Leu Arg Arg Asn Asn Ser Tyr Thr Ser Tyr Ile Met Ala Ile1 5 10 15Cys Gly Met Pro Leu Asp Ser Phe Arg 20 2512625PRTArtificial SequenceCT26 neoantigen 126Thr Thr Cys Leu Ala Val Gly Gly Leu Asp Val Lys Phe Gln Glu Ala1 5 10 15Ala Leu Arg Ala Ala Pro Asp Ile Leu 20 2512725PRTArtificial SequenceCT26 neoantigen 127Ile Tyr Glu Phe Asp Tyr His Leu Tyr Gly Gln Asn Ile Thr Met Ile1 5 10 15Met Thr Ser Val Ser Gly His Leu Leu 20 2512825PRTArtificial SequenceCT26 neoantigen 128Pro Asp Ser Phe Ser Ile Pro Tyr Leu Thr Ala Leu Asp Asp Leu Leu1 5 10 15Gly Thr Ala Leu Leu Ala Leu Ser Phe 20 2512925PRTArtificial SequenceCT26 neoantigen 129Tyr Ala Thr Ile Leu Glu Met Gln Ala Met Met Thr Leu Asp Pro Gln1 5 10 15Asp Ile Leu Leu Ala Gly Asn Met Met 20 2513025PRTArtificial SequenceCT26 neoantigen 130Ser Trp Ile His Cys Trp Lys Tyr Leu Ser Val Gln Ser Gln Leu Phe1 5 10 15Arg Gly Ser Ser Leu Leu Phe Arg Arg 20 2513125PRTArtificial SequenceCT26 neoantigen 131Tyr Asp Asn Lys Gly Ile Thr Tyr Leu Phe Asp Leu Tyr Tyr Glu Ser1 5 10 15Asp Glu Phe Thr Val Asp Ala Ala Arg 20 2513225PRTArtificial SequenceCT26 neoantigen 132Ala Gln Ala Ala Lys Asn Lys Gly Asn Lys Tyr Phe Gln Ala Gly Lys1 5 10 15Tyr Glu Gln Ala Ile Gln Cys Tyr Thr 20 2513325PRTArtificial SequenceCT26 neoantigen 133Gln Pro Met Leu Pro Ile Gly Leu Ser Asp Ile Pro Asp Glu Ala Met1 5 10 15Val Lys Leu Tyr Cys Pro Lys Cys Met 20 2513423PRTArtificial SequenceCT26 neoantigen 134His Arg Gly Ala Ile Tyr Gly Ser Ser Trp Lys Tyr Phe Thr Phe Ser1 5 10 15Gly Tyr Leu Leu Tyr Gln Asp 2013525PRTArtificial SequenceCT26 neoantigen 135Val Ile Gln Thr Ser Lys Tyr Tyr Met Arg Asp Val Ile Ala Ile Glu1 5 10 15Ser Ala Trp Leu Leu Glu Leu Ala Pro 20 2513625PRTArtificial SequenceCT26 neoantigen 136Pro Arg Gly Val Asp Leu Tyr Leu Arg Ile Leu Met Pro Ile Asp Ser1 5 10 15Glu Leu Val Asp Arg Asp Val Val His 20 2513725PRTArtificial SequenceCT26 neoantigen 137Gln Ile Glu Gln Asp Ala Leu Cys Pro Gln Asp Thr Tyr Cys Asp Leu1 5 10 15Lys Ser Arg Ala Glu Val Asn Gly Ala 20 2513825PRTArtificial SequenceCT26 neoantigen 138Ala Leu Ala Ser Ala Ile Leu Ser Asp Pro Glu Ser Tyr Ile Lys Lys1 5 10 15Leu Lys Glu Leu Arg Ser Met Leu Met 20 2513925PRTArtificial SequenceCT26 neoantigen 139Val Ile Val Leu Asp Ser Ser Gln Gly Asn Ser Val Cys Gln Ile Ala1 5 10 15Met Val His Tyr Ile Lys Gln Lys Tyr 20 2514025PRTArtificial SequenceCT26 neoantigen 140Met Lys Ser Val Ser Ile Gln Tyr Leu Glu Ala Val Lys Arg Leu Lys1 5 10 15Ser Glu Gly His Arg Phe Pro Arg Thr 20 2514125PRTArtificial SequenceCT26 neoantigen 141Lys Gly Gly Pro Val Lys Ile Asp Pro Leu Ala Leu Met Gln Ala Ile1 5 10 15Glu Arg Tyr Leu Val Val Arg Gly Tyr 20 2514225PRTArtificial SequenceCT26 neoantigen 142Leu Gln Asp Asp Pro Asp Leu Gln Ala Leu Leu Lys Ala Ser Gln Leu1 5 10 15Leu Lys Val Lys Ser Ser Ser Trp Arg 20 2514325PRTArtificial SequenceCT26 neoantigen 143Leu Ile Ala His Met Ile Leu Gly Tyr Arg Tyr Trp Thr Gly Ile Gly1 5 10 15Val Leu Gln Ser Cys Glu Ser Ala Leu 20 2514425PRTArtificial SequenceCT26 neoantigen 144Thr Ser Val Asp Gln His Leu Ala Pro Gly Ala Val Ala Met Pro Gln1 5 10 15Ala Ala Ser Leu His Ala Val Ile Val 20 2514525PRTArtificial SequenceCT26 neoantigen 145Glu Ile Ser Val Arg Ile Ala Thr Ile Pro Ala Phe Asp Thr Ile Met1 5 10 15Glu Thr Val Ile Gln Arg Glu Leu Leu 20 2514625PRTArtificial SequenceCT26 neoantigen 146Lys Thr Ser Arg Glu Ile Lys Ile Ser Gly Ala Ile Glu Pro Cys Val1 5 10 15Ser Leu Asn Ser Lys Gly Pro Cys Val 20 2514725PRTArtificial SequenceCT26 neoantigen 147Gln Gly Leu Ala Asn Tyr Val Ile Thr Thr Met Gly Thr Ile Cys Ala1 5 10 15Pro Val Arg Asp Glu Asp Ile Arg Glu 20 2514825PRTArtificial SequenceCT26 neoantigen 148Glu Leu Ser Arg Arg Gln Tyr Ala Glu Gln Glu Leu Lys Gln Val Arg1 5 10 15Met Ala Leu Lys Lys Ala Glu Lys Glu 20 2514925PRTArtificial SequenceCT26 neoantigen 149Ile Glu Thr Gln Gln Arg Lys Phe Lys Ala Ser Arg Ala Ser Ile Leu1 5 10 15Ser Glu Met Lys Met Leu Lys Glu Lys 20 2515025PRTArtificial SequenceCT26 neoantigen 150Ser Ile Phe Leu Asp Asp Asp Ser Asn Gln Pro Met Ala Val Ser Arg1 5 10 15Phe Phe Gly Asn Val Glu Leu Met Gln 20 2515125PRTArtificial SequenceCT26 neoantigen 151Arg Pro Asp Ser Tyr Val Arg Asp Met Glu Ile Glu Ala Ala Ser His1 5 10 15His Val Tyr Ala Asp Gln Pro His Ile 20 2515225PRTArtificial SequenceCT26 neoantigen 152Thr Leu Ser Ala Met Ser Asn Pro Arg Ala Met Gln Val Leu Leu Gln1 5 10 15Ile Gln Gln Gly Leu Gln Thr Leu Ala 20 2515325PRTArtificial SequenceCT26 neoantigen 153Val Met Lys Gly Thr Leu Glu Tyr Leu Met Ser Asn Thr Pro Thr Ala1 5 10 15Gln Ser Leu Arg Glu Ser Tyr Ile Phe 20 2515425PRTArtificial SequenceCT26 neoantigen 154Ala Ala Glu Leu Phe His Gln Leu Ser Gln Ala Leu Lys Val Leu Thr1 5 10 15Asp Ala Ala Ala Arg Ala Ala Tyr Asp 20 2515525PRTArtificial SequenceCT26 neoantigen 155Thr Gly Leu Tyr Phe Arg Lys Ser Tyr Tyr Met Gln Lys Tyr Phe Leu1 5 10 15Asp Thr Val Thr Glu Asp Ala Lys Val 20 2515625PRTArtificial SequenceCT26 neoantigen 156Cys Arg

Asn Asn Val His Tyr Leu Asn Asp Gly Asp Ala Ile Ile Tyr1 5 10 15His Thr Ala Ser Ile Gly Ile Leu His 20 2515725PRTArtificial SequenceCT26 neoantigen 157Asp Ile Asn Asp Asn Asn Pro Ser Phe Pro Thr Gly Lys Met Lys Leu1 5 10 15Glu Ile Ser Glu Ala Leu Ala Pro Gly 20 2515825PRTArtificial SequenceCT26 neoantigen 158Arg Glu Gly Ile Leu Gln Glu Glu Ser Ile Tyr Lys Pro Gln Lys Gln1 5 10 15Glu Gln Glu Leu Arg Ala Leu Gln Ala 20 2515925PRTArtificial SequenceCT26 neoantigen 159Ile Asn Pro Thr Met Ile Ile Ser Asn Thr Leu Ser Lys Ser Ala Ile1 5 10 15Ala Thr Pro Lys Ile Ser Tyr Leu Leu 20 2516025PRTArtificial SequenceCT26 neoantigen 160Gln Asp Leu His Asn Leu Asn Leu Leu Ser Leu Tyr Ala Asn Lys Leu1 5 10 15Gln Thr Val Ala Lys Gly Thr Phe Ser 20 2516125PRTArtificial SequenceCT26 neoantigen 161Gln Glu Ile Gln Thr Tyr Ala Ile Ala Leu Ile Asn Val Leu Phe Leu1 5 10 15Lys Ala Pro Glu Asp Lys Arg Gln Asp 20 2516225PRTArtificial SequenceCT26 neoantigen 162Cys Tyr Asn Tyr Leu Tyr Arg Met Lys Ala Leu Asp Gly Ile Arg Ala1 5 10 15Ser Glu Ile Pro Phe His Ala Glu Gly 20 2516325PRTArtificial SequenceCT26 neoantigen 163Gln Ser Ile His Ser Phe Gln Ser Leu Glu Glu Ser Ile Ser Val Leu1 5 10 15Pro Ser Phe Gln Glu Pro His Leu Gln 20 2516425PRTArtificial SequenceCT26 neoantigen 164Thr Asp Phe Cys Leu Arg Asn Leu Asp Gly Thr Leu Cys Tyr Leu Leu1 5 10 15Asp Lys Glu Thr Leu Arg Leu His Pro 20 2516525PRTArtificial SequenceCT26 neoantigen 165Cys Glu Val Thr Arg Val Lys Ala Val Arg Ile Leu Pro Cys Gly Val1 5 10 15Ala Lys Val Leu Trp Met Gln Gly Ser 20 2516625PRTArtificial SequenceCT26 neoantigen 166Gly Tyr Asp Ser Arg Ser Ala Arg Ala Phe Pro Tyr Ala Asn Val Ala1 5 10 15Phe Pro His Leu Thr Ser Ser Ala Pro 20 2516725PRTArtificial SequenceCT26 neoantigen 167Thr Asp Lys Glu Leu Arg Glu Ala Met Ala Leu Leu Ala Ala Gln Gln1 5 10 15Thr Ala Leu Glu Val Ile Val Asn Met 20 2516825PRTArtificial SequenceCT26 neoantigen 168Leu Ser Arg Pro Asp Leu Pro Phe Leu Ile Ala Ala Val Phe Phe Leu1 5 10 15Val Val Ala Val Trp Gly Glu Thr Leu 20 2516925PRTArtificial SequenceCT26 neoantigen 169Leu Tyr Tyr Thr Thr Val Arg Ala Leu Thr Arg His Asn Thr Met Leu1 5 10 15Lys Ala Met Phe Ser Gly Arg Met Glu 20 251701582PRTArtibeus aztecus 170Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly1 5 10 15Ala Val Phe Val Ser Pro Ser Gln Glu Ile His Ala Arg Pro Gly Pro 20 25 30Gln Asn Phe Pro Pro Gln Asn Met Phe Glu Phe Pro Pro His Leu Ser 35 40 45Pro Pro Leu Leu Pro Pro Gly Ala Gln Glu Glu Pro Gln Val Glu Pro 50 55 60Leu Asp Phe Ser Leu Pro Lys Gln Gln Gly Glu Leu Leu Glu Arg Ala65 70 75 80Val Phe Ala Gly Ser Asp Asp Pro Phe Ala Thr Pro Leu Ser Met Ser 85 90 95Glu Met Asp Arg Arg Asn Asp Ala His Ser Gly Gln Asn His Leu Lys 100 105 110Glu Met Ala Ile Ser Val Leu Glu Ala Arg Ala Cys Ala Ala Ala Gly 115 120 125Gln Ile Leu Pro Gln Ala Pro Ser Gly Pro Ser Tyr Ala Thr Tyr Leu 130 135 140Gln Pro Ala Gln Ala Gln Met Leu Thr Pro Met Ser Tyr Ala Glu Lys145 150 155 160Ser Asp Glu Ile Thr Lys Asp Glu Trp Met Glu Lys Leu Gly Ala Gly 165 170 175Lys Gly Lys Tyr Tyr Ala Val Asn Phe Ser Met Arg Asp Gly Ile Asp 180 185 190Asp Glu Ser Tyr Gly Gln Tyr Arg Gly Ala Asp Lys Leu Cys Arg Lys 195 200 205Ala Ser Ser Val Lys Leu Val Lys Thr Ser Pro Glu Leu Ser Glu Asp 210 215 220Ser Asn Leu Gln Ala Arg Leu Thr Ser Tyr Glu Thr Leu Lys Lys Ser225 230 235 240Leu Ser Lys Ile Arg Glu Glu Ser His Ser Phe Ile His Ala Ala Met 245 250 255Gly Met Ala Val Thr Trp Cys Ala Ala Ile Met Thr Lys Gly Gln Tyr 260 265 270Ser Leu Arg Thr Ala Ala Tyr Val Asn Ala Ile Glu Lys Ile Phe Lys 275 280 285Val Tyr Asn Glu Ala Gly Val Thr Phe Thr Phe Glu Gly Ser Leu Ala 290 295 300Lys Asn Leu Ser Leu Asn Phe Gln Ala Val Lys Glu Asn Leu Tyr Tyr305 310 315 320Glu Val Gly Asp Pro Arg Ala Ala Tyr Phe Arg Gln Ala Glu Asn Asp 325 330 335Met Tyr Ile Arg Met Ala Leu Leu Ala Thr Val Leu Leu Arg Ser Gln 340 345 350Met Val Met Lys Met Arg Glu Tyr Phe Cys Asn Leu His Gly Phe Val 355 360 365Asp Ile Glu Thr Pro Asp Leu Leu Ala Phe Glu Arg Lys Leu Asp Gln 370 375 380Thr Val Met Arg Lys Arg Leu Asp Ile Gln Glu Ala Leu Lys Ile Lys385 390 395 400Arg Glu Lys Cys Trp Lys Asp Ala Thr Tyr Pro Glu Ser Phe His Thr 405 410 415Leu Glu Ser Val Pro Ala Thr Gly Arg Ser Ser Gln Val Tyr Phe Thr 420 425 430Ile Asn Val Asn Leu Asp Leu Ser Glu Ala Ala Val Val Thr Phe Ser 435 440 445Lys Pro Leu Arg Arg Asn Asn Ser Tyr Thr Ser Tyr Ile Met Ala Ile 450 455 460Cys Gly Met Pro Leu Asp Ser Phe Arg Thr Thr Cys Leu Ala Val Gly465 470 475 480Gly Leu Asp Val Lys Phe Gln Glu Ala Ala Leu Arg Ala Ala Pro Asp 485 490 495Ile Leu Ile Tyr Glu Phe Asp Tyr His Leu Tyr Gly Gln Asn Ile Thr 500 505 510Met Ile Met Thr Ser Val Ser Gly His Leu Leu Pro Asp Ser Phe Ser 515 520 525Ile Pro Tyr Leu Thr Ala Leu Asp Asp Leu Leu Gly Thr Ala Leu Leu 530 535 540Ala Leu Ser Phe Tyr Ala Thr Ile Leu Glu Met Gln Ala Met Met Thr545 550 555 560Leu Asp Pro Gln Asp Ile Leu Leu Ala Gly Asn Met Met Ser Trp Ile 565 570 575His Cys Trp Lys Tyr Leu Ser Val Gln Ser Gln Leu Phe Arg Gly Ser 580 585 590Ser Leu Leu Phe Arg Arg Tyr Asp Asn Lys Gly Ile Thr Tyr Leu Phe 595 600 605Asp Leu Tyr Tyr Glu Ser Asp Glu Phe Thr Val Asp Ala Ala Arg Ala 610 615 620Gln Ala Ala Lys Asn Lys Gly Asn Lys Tyr Phe Gln Ala Gly Lys Tyr625 630 635 640Glu Gln Ala Ile Gln Cys Tyr Thr Gln Pro Met Leu Pro Ile Gly Leu 645 650 655Ser Asp Ile Pro Asp Glu Ala Met Val Lys Leu Tyr Cys Pro Lys Cys 660 665 670Met His Arg Gly Ala Ile Tyr Gly Ser Ser Trp Lys Tyr Phe Thr Phe 675 680 685Ser Gly Tyr Leu Leu Tyr Gln Asp Val Ile Gln Thr Ser Lys Tyr Tyr 690 695 700Met Arg Asp Val Ile Ala Ile Glu Ser Ala Trp Leu Leu Glu Leu Ala705 710 715 720Pro Pro Arg Gly Val Asp Leu Tyr Leu Arg Ile Leu Met Pro Ile Asp 725 730 735Ser Glu Leu Val Asp Arg Asp Val Val His Gln Ile Glu Gln Asp Ala 740 745 750Leu Cys Pro Gln Asp Thr Tyr Cys Asp Leu Lys Ser Arg Ala Glu Val 755 760 765Asn Gly Ala Ala Leu Ala Ser Ala Ile Leu Ser Asp Pro Glu Ser Tyr 770 775 780Ile Lys Lys Leu Lys Glu Leu Arg Ser Met Leu Met Val Ile Val Leu785 790 795 800Asp Ser Ser Gln Gly Asn Ser Val Cys Gln Ile Ala Met Val His Tyr 805 810 815Ile Lys Gln Lys Tyr Met Lys Ser Val Ser Ile Gln Tyr Leu Glu Ala 820 825 830Val Lys Arg Leu Lys Ser Glu Gly His Arg Phe Pro Arg Thr Lys Gly 835 840 845Gly Pro Val Lys Ile Asp Pro Leu Ala Leu Met Gln Ala Ile Glu Arg 850 855 860Tyr Leu Val Val Arg Gly Tyr Leu Gln Asp Asp Pro Asp Leu Gln Ala865 870 875 880Leu Leu Lys Ala Ser Gln Leu Leu Lys Val Lys Ser Ser Ser Trp Arg 885 890 895Leu Ile Ala His Met Ile Leu Gly Tyr Arg Tyr Trp Thr Gly Ile Gly 900 905 910Val Leu Gln Ser Cys Glu Ser Ala Leu Thr Ser Val Asp Gln His Leu 915 920 925Ala Pro Gly Ala Val Ala Met Pro Gln Ala Ala Ser Leu His Ala Val 930 935 940Ile Val Glu Ile Ser Val Arg Ile Ala Thr Ile Pro Ala Phe Asp Thr945 950 955 960Ile Met Glu Thr Val Ile Gln Arg Glu Leu Leu Lys Thr Ser Arg Glu 965 970 975Ile Lys Ile Ser Gly Ala Ile Glu Pro Cys Val Ser Leu Asn Ser Lys 980 985 990Gly Pro Cys Val Gln Gly Leu Ala Asn Tyr Val Ile Thr Thr Met Gly 995 1000 1005Thr Ile Cys Ala Pro Val Arg Asp Glu Asp Ile Arg Glu Glu Leu 1010 1015 1020Ser Arg Arg Gln Tyr Ala Glu Gln Glu Leu Lys Gln Val Arg Met 1025 1030 1035Ala Leu Lys Lys Ala Glu Lys Glu Ile Glu Thr Gln Gln Arg Lys 1040 1045 1050Phe Lys Ala Ser Arg Ala Ser Ile Leu Ser Glu Met Lys Met Leu 1055 1060 1065Lys Glu Lys Ser Ile Phe Leu Asp Asp Asp Ser Asn Gln Pro Met 1070 1075 1080Ala Val Ser Arg Phe Phe Gly Asn Val Glu Leu Met Gln Arg Pro 1085 1090 1095Asp Ser Tyr Val Arg Asp Met Glu Ile Glu Ala Ala Ser His His 1100 1105 1110Val Tyr Ala Asp Gln Pro His Ile Thr Leu Ser Ala Met Ser Asn 1115 1120 1125Pro Arg Ala Met Gln Val Leu Leu Gln Ile Gln Gln Gly Leu Gln 1130 1135 1140Thr Leu Ala Val Met Lys Gly Thr Leu Glu Tyr Leu Met Ser Asn 1145 1150 1155Thr Pro Thr Ala Gln Ser Leu Arg Glu Ser Tyr Ile Phe Ala Ala 1160 1165 1170Glu Leu Phe His Gln Leu Ser Gln Ala Leu Lys Val Leu Thr Asp 1175 1180 1185Ala Ala Ala Arg Ala Ala Tyr Asp Thr Gly Leu Tyr Phe Arg Lys 1190 1195 1200Ser Tyr Tyr Met Gln Lys Tyr Phe Leu Asp Thr Val Thr Glu Asp 1205 1210 1215Ala Lys Val Cys Arg Asn Asn Val His Tyr Leu Asn Asp Gly Asp 1220 1225 1230Ala Ile Ile Tyr His Thr Ala Ser Ile Gly Ile Leu His Asp Ile 1235 1240 1245Asn Asp Asn Asn Pro Ser Phe Pro Thr Gly Lys Met Lys Leu Glu 1250 1255 1260Ile Ser Glu Ala Leu Ala Pro Gly Arg Glu Gly Ile Leu Gln Glu 1265 1270 1275Glu Ser Ile Tyr Lys Pro Gln Lys Gln Glu Gln Glu Leu Arg Ala 1280 1285 1290Leu Gln Ala Ile Asn Pro Thr Met Ile Ile Ser Asn Thr Leu Ser 1295 1300 1305Lys Ser Ala Ile Ala Thr Pro Lys Ile Ser Tyr Leu Leu Gln Asp 1310 1315 1320Leu His Asn Leu Asn Leu Leu Ser Leu Tyr Ala Asn Lys Leu Gln 1325 1330 1335Thr Val Ala Lys Gly Thr Phe Ser Gln Glu Ile Gln Thr Tyr Ala 1340 1345 1350Ile Ala Leu Ile Asn Val Leu Phe Leu Lys Ala Pro Glu Asp Lys 1355 1360 1365Arg Gln Asp Cys Tyr Asn Tyr Leu Tyr Arg Met Lys Ala Leu Asp 1370 1375 1380Gly Ile Arg Ala Ser Glu Ile Pro Phe His Ala Glu Gly Gln Ser 1385 1390 1395Ile His Ser Phe Gln Ser Leu Glu Glu Ser Ile Ser Val Leu Pro 1400 1405 1410Ser Phe Gln Glu Pro His Leu Gln Thr Asp Phe Cys Leu Arg Asn 1415 1420 1425Leu Asp Gly Thr Leu Cys Tyr Leu Leu Asp Lys Glu Thr Leu Arg 1430 1435 1440Leu His Pro Cys Glu Val Thr Arg Val Lys Ala Val Arg Ile Leu 1445 1450 1455Pro Cys Gly Val Ala Lys Val Leu Trp Met Gln Gly Ser Gly Tyr 1460 1465 1470Asp Ser Arg Ser Ala Arg Ala Phe Pro Tyr Ala Asn Val Ala Phe 1475 1480 1485Pro His Leu Thr Ser Ser Ala Pro Thr Asp Lys Glu Leu Arg Glu 1490 1495 1500Ala Met Ala Leu Leu Ala Ala Gln Gln Thr Ala Leu Glu Val Ile 1505 1510 1515Val Asn Met Leu Ser Arg Pro Asp Leu Pro Phe Leu Ile Ala Ala 1520 1525 1530Val Phe Phe Leu Val Val Ala Val Trp Gly Glu Thr Leu Leu Tyr 1535 1540 1545Tyr Thr Thr Val Arg Ala Leu Thr Arg His Asn Thr Met Leu Lys 1550 1555 1560Ala Met Phe Ser Gly Arg Met Glu Gly Tyr Pro Tyr Asp Val Pro 1565 1570 1575Asp Tyr Ala Ser 1580171832PRTArtificial SequenceGAd20-CT26-62 polyneoantigen 171Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly1 5 10 15Ala Val Phe Val Ser Pro Ser Gln Glu Ile His Ala Arg Pro Gly Pro 20 25 30Gln Asn Phe Pro Pro Gln Asn Met Phe Glu Phe Pro Pro His Leu Ser 35 40 45Pro Pro Leu Leu Pro Pro Gly Ala Gln Glu Glu Pro Gln Val Glu Pro 50 55 60Leu Asp Phe Ser Leu Pro Lys Gln Gln Gly Glu Leu Leu Glu Arg Ala65 70 75 80Val Phe Ala Gly Ser Asp Asp Pro Phe Ala Thr Pro Leu Ser Met Ser 85 90 95Glu Met Asp Arg Arg Asn Asp Ala His Ser Gly Gln Asn His Leu Lys 100 105 110Glu Met Ala Ile Ser Val Leu Glu Ala Arg Ala Cys Ala Ala Ala Gly 115 120 125Gln Ile Leu Pro Gln Ala Pro Ser Gly Pro Ser Tyr Ala Thr Tyr Leu 130 135 140Gln Pro Ala Gln Ala Gln Met Leu Thr Pro Met Ser Tyr Ala Glu Lys145 150 155 160Ser Asp Glu Ile Thr Lys Asp Glu Trp Met Glu Lys Leu Gly Ala Gly 165 170 175Lys Gly Lys Tyr Tyr Ala Val Asn Phe Ser Met Arg Asp Gly Ile Asp 180 185 190Asp Glu Ser Tyr Gly Gln Tyr Arg Gly Ala Asp Lys Leu Cys Arg Lys 195 200 205Ala Ser Ser Val Lys Leu Val Lys Thr Ser Pro Glu Leu Ser Glu Asp 210 215 220Ser Asn Leu Gln Ala Arg Leu Thr Ser Tyr Glu Thr Leu Lys Lys Ser225 230 235 240Leu Ser Lys Ile Arg Glu Glu Ser His Ser Phe Ile His Ala Ala Met 245 250 255Gly Met Ala Val Thr Trp Cys Ala Ala Ile Met Thr Lys Gly Gln Tyr 260 265 270Ser Leu Arg Thr Ala Ala Tyr Val Asn Ala Ile Glu Lys Ile Phe Lys 275 280 285Val Tyr Asn Glu Ala Gly Val Thr Phe Thr Phe Glu Gly Ser Leu Ala 290 295 300Lys Asn Leu Ser Leu Asn Phe Gln Ala Val Lys Glu Asn Leu Tyr Tyr305 310 315 320Glu Val Gly Asp Pro Arg Ala Ala Tyr Phe Arg Gln Ala Glu Asn Asp 325 330 335Met Tyr Ile Arg Met Ala Leu Leu Ala Thr Val Leu Leu Arg Ser Gln 340 345 350Met Val Met Lys Met Arg Glu Tyr Phe Cys Asn Leu His Gly Phe Val 355 360 365Asp Ile Glu Thr Pro Asp Leu Leu Ala Phe Glu Arg Lys Leu Asp Gln 370 375 380Thr Val Met Arg Lys Arg Leu Asp Ile Gln Glu Ala Leu Lys Ile Lys385 390 395 400Arg Glu Lys Cys Trp Lys Asp Ala Thr Tyr Pro Glu Ser Phe His Thr 405 410

415Leu Glu Ser Val Pro Ala Thr Gly Arg Ser Ser Gln Val Tyr Phe Thr 420 425 430Ile Asn Val Asn Leu Asp Leu Ser Glu Ala Ala Val Val Thr Phe Ser 435 440 445Lys Pro Leu Arg Arg Asn Asn Ser Tyr Thr Ser Tyr Ile Met Ala Ile 450 455 460Cys Gly Met Pro Leu Asp Ser Phe Arg Thr Thr Cys Leu Ala Val Gly465 470 475 480Gly Leu Asp Val Lys Phe Gln Glu Ala Ala Leu Arg Ala Ala Pro Asp 485 490 495Ile Leu Ile Tyr Glu Phe Asp Tyr His Leu Tyr Gly Gln Asn Ile Thr 500 505 510Met Ile Met Thr Ser Val Ser Gly His Leu Leu Pro Asp Ser Phe Ser 515 520 525Ile Pro Tyr Leu Thr Ala Leu Asp Asp Leu Leu Gly Thr Ala Leu Leu 530 535 540Ala Leu Ser Phe Tyr Ala Thr Ile Leu Glu Met Gln Ala Met Met Thr545 550 555 560Leu Asp Pro Gln Asp Ile Leu Leu Ala Gly Asn Met Met Ser Trp Ile 565 570 575His Cys Trp Lys Tyr Leu Ser Val Gln Ser Gln Leu Phe Arg Gly Ser 580 585 590Ser Leu Leu Phe Arg Arg Tyr Asp Asn Lys Gly Ile Thr Tyr Leu Phe 595 600 605Asp Leu Tyr Tyr Glu Ser Asp Glu Phe Thr Val Asp Ala Ala Arg Ala 610 615 620Gln Ala Ala Lys Asn Lys Gly Asn Lys Tyr Phe Gln Ala Gly Lys Tyr625 630 635 640Glu Gln Ala Ile Gln Cys Tyr Thr Gln Pro Met Leu Pro Ile Gly Leu 645 650 655Ser Asp Ile Pro Asp Glu Ala Met Val Lys Leu Tyr Cys Pro Lys Cys 660 665 670Met His Arg Gly Ala Ile Tyr Gly Ser Ser Trp Lys Tyr Phe Thr Phe 675 680 685Ser Gly Tyr Leu Leu Tyr Gln Asp Val Ile Gln Thr Ser Lys Tyr Tyr 690 695 700Met Arg Asp Val Ile Ala Ile Glu Ser Ala Trp Leu Leu Glu Leu Ala705 710 715 720Pro Pro Arg Gly Val Asp Leu Tyr Leu Arg Ile Leu Met Pro Ile Asp 725 730 735Ser Glu Leu Val Asp Arg Asp Val Val His Gln Ile Glu Gln Asp Ala 740 745 750Leu Cys Pro Gln Asp Thr Tyr Cys Asp Leu Lys Ser Arg Ala Glu Val 755 760 765Asn Gly Ala Ala Leu Ala Ser Ala Ile Leu Ser Asp Pro Glu Ser Tyr 770 775 780Ile Lys Lys Leu Lys Glu Leu Arg Ser Met Leu Met Val Ile Val Leu785 790 795 800Asp Ser Ser Gln Gly Asn Ser Val Cys Gln Ile Ala Met Val His Tyr 805 810 815Ile Lys Gln Lys Tyr Gly Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser 820 825 830172790PRTArtificial SequenceGAd-CT26-1-31 polyneoantigen 172Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly1 5 10 15Ala Val Phe Val Ser Pro Ser Gln Glu Ile His Ala Arg Met Lys Ser 20 25 30Val Ser Ile Gln Tyr Leu Glu Ala Val Lys Arg Leu Lys Ser Glu Gly 35 40 45His Arg Phe Pro Arg Thr Lys Gly Gly Pro Val Lys Ile Asp Pro Leu 50 55 60Ala Leu Met Gln Ala Ile Glu Arg Tyr Leu Val Val Arg Gly Tyr Leu65 70 75 80Gln Asp Asp Pro Asp Leu Gln Ala Leu Leu Lys Ala Ser Gln Leu Leu 85 90 95Lys Val Lys Ser Ser Ser Trp Arg Leu Ile Ala His Met Ile Leu Gly 100 105 110Tyr Arg Tyr Trp Thr Gly Ile Gly Val Leu Gln Ser Cys Glu Ser Ala 115 120 125Leu Thr Ser Val Asp Gln His Leu Ala Pro Gly Ala Val Ala Met Pro 130 135 140Gln Ala Ala Ser Leu His Ala Val Ile Val Glu Ile Ser Val Arg Ile145 150 155 160Ala Thr Ile Pro Ala Phe Asp Thr Ile Met Glu Thr Val Ile Gln Arg 165 170 175Glu Leu Leu Lys Thr Ser Arg Glu Ile Lys Ile Ser Gly Ala Ile Glu 180 185 190Pro Cys Val Ser Leu Asn Ser Lys Gly Pro Cys Val Gln Gly Leu Ala 195 200 205Asn Tyr Val Ile Thr Thr Met Gly Thr Ile Cys Ala Pro Val Arg Asp 210 215 220Glu Asp Ile Arg Glu Glu Leu Ser Arg Arg Gln Tyr Ala Glu Gln Glu225 230 235 240Leu Lys Gln Val Arg Met Ala Leu Lys Lys Ala Glu Lys Glu Ile Glu 245 250 255Thr Gln Gln Arg Lys Phe Lys Ala Ser Arg Ala Ser Ile Leu Ser Glu 260 265 270Met Lys Met Leu Lys Glu Lys Ser Ile Phe Leu Asp Asp Asp Ser Asn 275 280 285Gln Pro Met Ala Val Ser Arg Phe Phe Gly Asn Val Glu Leu Met Gln 290 295 300Arg Pro Asp Ser Tyr Val Arg Asp Met Glu Ile Glu Ala Ala Ser His305 310 315 320His Val Tyr Ala Asp Gln Pro His Ile Thr Leu Ser Ala Met Ser Asn 325 330 335Pro Arg Ala Met Gln Val Leu Leu Gln Ile Gln Gln Gly Leu Gln Thr 340 345 350Leu Ala Val Met Lys Gly Thr Leu Glu Tyr Leu Met Ser Asn Thr Pro 355 360 365Thr Ala Gln Ser Leu Arg Glu Ser Tyr Ile Phe Ala Ala Glu Leu Phe 370 375 380His Gln Leu Ser Gln Ala Leu Lys Val Leu Thr Asp Ala Ala Ala Arg385 390 395 400Ala Ala Tyr Asp Thr Gly Leu Tyr Phe Arg Lys Ser Tyr Tyr Met Gln 405 410 415Lys Tyr Phe Leu Asp Thr Val Thr Glu Asp Ala Lys Val Cys Arg Asn 420 425 430Asn Val His Tyr Leu Asn Asp Gly Asp Ala Ile Ile Tyr His Thr Ala 435 440 445Ser Ile Gly Ile Leu His Asp Ile Asn Asp Asn Asn Pro Ser Phe Pro 450 455 460Thr Gly Lys Met Lys Leu Glu Ile Ser Glu Ala Leu Ala Pro Gly Arg465 470 475 480Glu Gly Ile Leu Gln Glu Glu Ser Ile Tyr Lys Pro Gln Lys Gln Glu 485 490 495Gln Glu Leu Arg Ala Leu Gln Ala Ile Asn Pro Thr Met Ile Ile Ser 500 505 510Asn Thr Leu Ser Lys Ser Ala Ile Ala Thr Pro Lys Ile Ser Tyr Leu 515 520 525Leu Gln Asp Leu His Asn Leu Asn Leu Leu Ser Leu Tyr Ala Asn Lys 530 535 540Leu Gln Thr Val Ala Lys Gly Thr Phe Ser Gln Glu Ile Gln Thr Tyr545 550 555 560Ala Ile Ala Leu Ile Asn Val Leu Phe Leu Lys Ala Pro Glu Asp Lys 565 570 575Arg Gln Asp Cys Tyr Asn Tyr Leu Tyr Arg Met Lys Ala Leu Asp Gly 580 585 590Ile Arg Ala Ser Glu Ile Pro Phe His Ala Glu Gly Gln Ser Ile His 595 600 605Ser Phe Gln Ser Leu Glu Glu Ser Ile Ser Val Leu Pro Ser Phe Gln 610 615 620Glu Pro His Leu Gln Thr Asp Phe Cys Leu Arg Asn Leu Asp Gly Thr625 630 635 640Leu Cys Tyr Leu Leu Asp Lys Glu Thr Leu Arg Leu His Pro Cys Glu 645 650 655Val Thr Arg Val Lys Ala Val Arg Ile Leu Pro Cys Gly Val Ala Lys 660 665 670Val Leu Trp Met Gln Gly Ser Gly Tyr Asp Ser Arg Ser Ala Arg Ala 675 680 685Phe Pro Tyr Ala Asn Val Ala Phe Pro His Leu Thr Ser Ser Ala Pro 690 695 700Thr Asp Lys Glu Leu Arg Glu Ala Met Ala Leu Leu Ala Ala Gln Gln705 710 715 720Thr Ala Leu Glu Val Ile Val Asn Met Leu Ser Arg Pro Asp Leu Pro 725 730 735Phe Leu Ile Ala Ala Val Phe Phe Leu Val Val Ala Val Trp Gly Glu 740 745 750Thr Leu Leu Tyr Tyr Thr Thr Val Arg Ala Leu Thr Arg His Asn Thr 755 760 765Met Leu Lys Ala Met Phe Ser Gly Arg Met Glu Gly Tyr Pro Tyr Asp 770 775 780Val Pro Asp Tyr Ala Ser785 790173281PRTHomo sapiens 173Met Ala Asp Ser Ala Glu Asp Ala Pro Met Ala Arg Gly Ser Leu Ala1 5 10 15Gly Ser Asp Glu Ala Leu Ile Leu Pro Ala Gly Pro Thr Gly Gly Ser 20 25 30Asn Ser Arg Ala Leu Lys Val Ala Gly Leu Thr Thr Leu Thr Cys Leu 35 40 45Leu Leu Ala Ser Gln Val Phe Thr Ala Tyr Met Val Phe Gly Gln Lys 50 55 60Glu Gln Ile His Thr Leu Gln Lys Asn Ser Glu Arg Met Ser Lys Gln65 70 75 80Leu Thr Arg Ser Ser Gln Ala Val Ala Pro Met Lys Met His Met Pro 85 90 95Met Asn Ser Leu Pro Leu Leu Met Asp Phe Thr Pro Asn Glu Asp Ser 100 105 110Lys Thr Pro Leu Thr Lys Leu Gln Asp Thr Ala Val Val Ser Val Glu 115 120 125Lys Gln Leu Lys Asp Leu Met Gln Asp Ser Gln Leu Pro Gln Phe Asn 130 135 140Glu Thr Phe Leu Ala Asn Leu Gln Gly Leu Lys Gln Gln Met Asn Glu145 150 155 160Ser Glu Trp Lys Ser Phe Glu Ser Trp Met Arg Tyr Trp Leu Ile Phe 165 170 175Gln Met Ala Gln Gln Lys Pro Val Pro Pro Thr Ala Asp Pro Ala Ser 180 185 190Leu Ile Lys Thr Lys Cys Gln Met Glu Ser Ala Pro Gly Val Ser Lys 195 200 205Ile Gly Ser Tyr Lys Pro Gln Cys Asp Glu Gln Gly Arg Tyr Lys Pro 210 215 220Met Gln Cys Trp His Ala Thr Gly Phe Cys Trp Cys Val Asp Glu Thr225 230 235 240Gly Ala Val Ile Glu Gly Thr Thr Met Arg Gly Arg Pro Asp Cys Gln 245 250 255Arg Arg Ala Leu Ala Pro Arg Arg Met Ala Phe Ala Pro Ser Leu Met 260 265 270Gln Lys Thr Ile Ser Ile Asp Asp Gln 275 280174281PRTSinipera chuatsi 174Met Ala Asp Ser Ala Glu Asp Ala Pro Met Ala Arg Gly Ser Leu Ala1 5 10 15Gly Ser Asp Glu Ala Leu Ile Leu Pro Ala Gly Pro Thr Gly Gly Ser 20 25 30Asn Ser Arg Ala Leu Lys Val Ala Gly Leu Thr Thr Leu Thr Cys Leu 35 40 45Leu Leu Ala Ser Gln Val Phe Thr Ala Tyr Met Val Phe Gly Gln Lys 50 55 60Glu Gln Ile His Thr Leu Gln Lys Asn Ser Glu Arg Met Ser Lys Gln65 70 75 80Leu Thr Arg Ser Ser Gln Ala Val Ala Pro Met Lys Met His Met Pro 85 90 95Met Asn Ser Leu Pro Leu Leu Met Asp Phe Thr Pro Asn Glu Asp Ser 100 105 110Lys Thr Pro Leu Thr Lys Leu Gln Asp Thr Ala Val Val Ser Val Glu 115 120 125Lys Gln Leu Lys Asp Leu Met Gln Asp Ser Gln Leu Pro Gln Phe Asn 130 135 140Glu Thr Phe Leu Ala Asn Leu Gln Gly Leu Lys Gln Gln Met Asn Glu145 150 155 160Ser Glu Trp Lys Ser Phe Glu Ser Trp Met Arg Tyr Trp Leu Ile Phe 165 170 175Gln Met Ala Gln Gln Lys Pro Val Pro Pro Thr Ala Asp Pro Ala Ser 180 185 190Leu Ile Lys Thr Lys Cys Gln Met Glu Ser Ala Pro Gly Val Ser Lys 195 200 205Ile Gly Ser Tyr Lys Pro Gln Cys Asp Glu Gln Gly Arg Tyr Lys Pro 210 215 220Met Gln Cys Trp His Ala Thr Gly Phe Cys Trp Cys Val Asp Glu Thr225 230 235 240Gly Ala Val Ile Glu Gly Thr Thr Met Arg Gly Arg Pro Asp Cys Gln 245 250 255Arg Arg Ala Leu Ala Pro Arg Arg Met Ala Phe Ala Pro Ser Leu Met 260 265 270Gln Lys Thr Ile Ser Ile Asp Asp Gln 275 28017527PRTSinipera chuatsi 175Gly Gln Lys Glu Gln Ile His Thr Leu Gln Lys Asn Ser Glu Arg Met1 5 10 15Ser Lys Gln Leu Thr Arg Ser Ser Gln Ala Val 20 2517616PRTSinipera chuatsi 176Gln Ile His Thr Leu Gln Lys Asn Ser Glu Arg Met Ser Lys Gln Leu1 5 10 15177187PRTParalichthys olivaceus 177Met Ser Glu Thr Gln Thr Leu Leu Gly Ala Pro Arg Gln Gln Thr Ala1 5 10 15Val Asp Val Gly Ala Pro Ala Gln Gly Gly Arg Ser Ala Asn Ala Tyr 20 25 30Lys Val Val Gly Leu Thr Val Leu Ala Cys Val Leu Val Met Ser Gln 35 40 45Ala Met Ile Ile Tyr Phe Leu Val Asn Gln Arg Gly Asp Ile Lys Ser 50 55 60Leu Glu Glu Gln His Ser Gly Leu Asn Glu Gln Leu Thr Lys Gly Arg65 70 75 80Ser Ala Ser Met Ser Met Gln Leu Pro Ser Ser Phe His Ser Leu Thr 85 90 95Phe Asp Glu Lys Ser Ser Thr Arg Ala Pro Glu Glu Thr Gly Pro Pro 100 105 110Gln Ala Thr Gln Cys Gln Leu Glu Ala Ala Gly Glu Lys Pro Val Gln 115 120 125Val Pro Gly Leu Arg Pro Asp Cys Asp Glu Arg Gly Leu Tyr Arg Leu 130 135 140Lys Gln Cys Leu Lys His Arg Cys Trp Cys Val Asn Pro Ala Asn Gly145 150 155 160Glu Gln Ile Pro Gly Ser Leu Gly Lys Glu Asp Val Thr Cys Asn Lys 165 170 175Gly Val His Ser Val Gly Leu Asp Lys Val Leu 180 18517827PRTParalichthys olivaceus 178Asn Gln Arg Gly Asp Ile Lys Ser Leu Glu Glu Gln His Ser Gly Leu1 5 10 15Asn Glu Gln Leu Thr Lys Gly Arg Ser Ala Ser 20 2517916PRTParalichthys olivaceus 179Asp Ile Lys Ser Leu Glu Glu Gln His Ser Gly Leu Asn Glu Gln Leu1 5 10 15180197PRTBoleophthalmus pectiniros 180Met Glu His Ala Ser Glu Asp Ala Pro Leu Ala Arg Asp Ser Gly Thr1 5 10 15Gly Ser Glu Gln Ala Leu Val Val Pro Thr Ala Pro Arg Arg Gly Ser 20 25 30Asn Ser His Ala Val Lys Ile Ala Gly Ile Thr Thr Leu Val Cys Leu 35 40 45Leu Val Ser Ala Gln Val Phe Thr Ala Tyr Met Val Phe Asp Gln Lys 50 55 60Gln Gln Ile Gln Gly Leu Gln Thr Ser Asn Gln Arg Leu Glu Lys Gln65 70 75 80Met Gly Gln Arg Pro Arg Glu Ser Leu Lys Lys Ile Val Met Pro Ala 85 90 95Asn Ser Met Pro Ile Leu Asp Phe Phe Asp Asp Gly Lys Ser Pro Gln 100 105 110Asn Ser Pro Lys Ala Glu Pro Pro Lys Gln Asp Val Ala Pro Pro Ser 115 120 125Val Glu Lys Gln Leu Gln Glu Leu Met Lys Val Phe Thr Asp Phe Pro 130 135 140Gln Met Asn Glu Ser Phe Leu Ala Asn Leu Gln Thr Met Lys Gln Lys145 150 155 160Val Ser Glu Thr Asp Trp Lys Ser Phe Glu Ala Trp Met His Tyr Trp 165 170 175Leu Ile Phe Gln Met Ala Gln Lys Thr Ser Thr Pro Thr Pro Gln Pro 180 185 190Asp Gly Gly Ser Lys 19518127PRTBoleophthalmus pectiniros 181Asp Gln Lys Gln Gln Ile Gln Gly Leu Gln Thr Ser Asn Gln Arg Leu1 5 10 15Glu Lys Gln Met Gly Gln Arg Pro Arg Glu Ser 20 2518216PRTBoleophthalmus pectiniros 182Gln Ile Gln Gly Leu Gln Thr Ser Asn Gln Arg Leu Glu Lys Gln Met1 5 10 1518311PRTInfluenza A virus 183Gly Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser1 5 1018424PRTAphthovirus A 184Ala Pro Val Lys Gln Thr Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly1 5 10 15Asp Val Glu Ser Asn Pro Gly Pro 20

Claims

1. A method for selecting cancer neoantigens for use in a personalized vaccine comprising the steps of: (a) determining neoantigens in a sample of cancerous cells obtained from an individual, wherein each neoantigen is comprised within a coding sequence, comprises at least one mutation in the coding sequence resulting in a change of the encoded amino acid sequence that is not present in a sample of non-cancerous cells of said individual, and consists of 9 to 40, preferably 19 to 31, more preferably 23 to 25, most preferably 25 contiguous amino acids of the coding sequence in the sample of cancerous cells, (b) determine for each neoantigen the mutation allele frequency of each of said mutations of step (a) within the coding sequence, (c) determining the expression level of each coding sequence comprising at least one of said mutations, (i) in said sample of cancerous cells, or (ii) from an expression database of the same cancer type as the sample of cancerous cells, (d) predicting the MHC class I binding affinity of the neoantigens, wherein (I) the HLA class I alleles are determined from the sample of non-cancerous cells of said individual, (II) for each HLA class I allele determined in (I) the MHC class I binding affinity of each fragment consisting of 8 to 15, preferably 9 to 10, more preferably 9, contiguous amino acids of the neoantigen is predicted, wherein each fragment is comprising at least one amino acid change caused by the mutation of step (a), and (III) the fragment with the highest MHC class I binding affinity determines the MHC class I binding affinity of the neoantigen, (e) ranking the neoantigens according to the values determined in steps (b) to (d) for each neoantigen from highest to lowest values, yielding a first, a second and a third list of ranks, (f) calculating a rank sum from said first, second and third list of ranks and ordering the neoantigens by increasing rank sum, yielding a ranked list of neoantigens, (g) selecting 30-240, preferably 40-80, more preferably 60, neoantigens from the ranked list of neoantigens obtained in (f) starting with the lowest rank.

2. The method according to claim 1, wherein steps (a) and (d)(I) are performed using massively parallel DNA sequencing of the samples and wherein the number of reads comprising the mutation at the chromosomal position of the identified mutation is: in the sample of cancerous cells at least 2, preferably at least 3, in the sample of non-cancerous cells is 2 or less, preferably 0.

3. The method according to claim 1, wherein the method comprises a step (d') in addition to or alternatively to step (d), wherein step (d') comprises: determining the HLA class II alleles in the sample of non-cancerous cells of said individual, predicting the MHC class II binding affinity of the neoantigen, wherein for each HLA class II allele determined the MHC class II binding affinity for each fragment of 11 to 30, preferably 15, contiguous amino acids of the neoantigen is predicted, wherein each fragment is comprising at least one mutated amino acid generated by the mutation of step (a), and the fragment with the highest MHC class II binding affinity determines the MHC class II binding affinity of the neoantigen; wherein the MHC class II binding affinity is ranked from highest to lowest MHC class II binding affinity, yielding a fourth list of ranks that is included in the rank sum of step (f).

4. The method of claim 1, wherein the at least one mutation of step (a) is a single nucleotide variant (SNV) or an insertion/deletion mutation resulting in a frame-shift peptide (FSP).

5. The method according to claim 4, wherein the mutation is a SNV and the neoantigen has the total size defined in step (a) and consists of the amino acid caused by the mutation, flanked on each side by a number of adjoining contiguous amino acids, wherein the number on each side does not differ by more than one unless the coding sequence does not comprise a sufficient number of amino acids on either side, wherein the neoantigen has the total size defined in step (a).

6. The method according to claim 4, wherein the mutation results in a FSP and each single amino acid change caused by the mutation results in a neoantigen that has the total size defined in step (a) and consists of: (i) said single amino acid change caused by the mutation and 7 to 14, preferably 8, N-terminally adjoining contiguous amino acids, and (ii) a number of contiguous amino acids adjoining the fragment of step (i) on either side, wherein the number of amino acids on either side differ by not more than one, unless the coding sequence does not comprise a sufficient number of amino acids on either side, wherein the MHC class I binding affinity of step (d) and/or the MHC class II binding affinity of step (d') is predicted for the fragment of step (i).

7. The method according to claim 1, wherein the mutation allele frequency of the neoantigen determined in step (b) in the sample of cancerous cells is at least 2%, preferably 5%, more preferably at least 10%.

8. The method according to claim 1, wherein step (g) further comprises removing neoantigens from genes linked to autoimmune disease, and/or neoantigens with a Shannon entropy value for their amino acid sequence lower than 0.1 from said ranked list of neoantigens.

9. The method according to claim 1, wherein the expression level of said coding genes in step (c)(i) is determined by massively parallel transcriptome sequencing and wherein the expression level determined in step (c) (i) uses a corrected Transcripts Per Kilobase Million (corrTPM) value calculated according to the following formula corrTPM=TPM*((M+c)/(M+W+c)) wherein M is the number of reads spanning the location of the mutation of step (a) that comprise the mutation and W is the number of reads spanning the location of the mutation of step (a) without the mutation and TPM is the Transcripts Per Kilobase Million value of the gene comprising the mutation and the c is a constant larger than 0, preferably 0.1.

10. The method according to claim 1, wherein the rank sum in step (f) is a weighted rank sum, wherein the number of neoantigens determined in step (a) is added to the rank value of each neoantigen: in the third list of ranks for which the prediction of WIC class I binding affinity of step (d) resulted in an IC50 value higher than 1000 nM and/or in the fourth list of ranks for which the prediction of WIC class II binding affinity of step (d') resulted in an IC50 value higher than 1000 nM; and/or in case of step (c)(i) being performed by massively parallel transcriptome sequencing, the rank sum of step (f) is multiplied by a weighing factor (WF), wherein WF is 1, if the number of mapped transcriptome reads for the mutation is >0, 2, if the number of mapped transcriptome reads for the mutation is 0 and the number of mapped reads for the non-mutated sequence is 0 and the transcripts-per-million (TPM) value is at least 0.5, 3, if the number of mapped transcriptome reads for the mutation is 0 and the number of mapped reads for the non-mutated sequence is >0 and the transcripts-per-million (TPM) value is at least 0.5, 4, if the number of mapped transcriptome reads for the mutation is 0 and the number of mapped reads for the non-mutated sequence is 0 and the transcripts-per-million (TPM) value is <0.5, or 5, if the number of mapped transcriptome reads for the mutation is 0 and the number of mapped reads for the non-mutated sequence is >0 and the transcripts-per-million (TPM) value is <0.5.

11. The method according to claim 1, wherein step (g) comprises an alternative selection process, wherein the neoantigens are selected from the ranked list of neoantigens starting with the lowest rank until a set maximum size in total overall length in amino acids for all selected neoantigens is reached, wherein the maximum size is between 1200 and 1800, preferably 1500 amino acids for each vector of a monovalent or multivalent vaccine; and optionally wherein two or more neoantigens are merged into one new neoantigen if they comprise overlapping amino acid sequence segments.

12. A method for constructing a personalized vector encoding a combination of neoantigens according to claim 1 for use as a vaccine, comprising the steps of: (i) ordering the list of neoantigens in at least 10{circumflex over ( )}5-10{circumflex over ( )}8, preferably 10{circumflex over ( )}6 different combinations, (ii) generating all possible pairs of neoantigen junction segments for each combination, wherein each junction segment comprises 15 adjoining contiguous amino acids on either side of the junction, (iii) predicting the MHC class I and/or class II binding affinity for all epitopes in junction segments wherein only HLA alleles are tested that are present in the individual the vector is designed for, and (iv) selecting the combination of neoantigens with the lowest number of junctional epitopes with an IC50 of .ltoreq.1500 nM and wherein if multiple combinations have the same lowest number of junctional epitopes the combination first encountered is selected.

13. A vector encoding the list of neoantigens according to claim 1, optionally additionally comprising a T-cell enhancer element, preferably (SEQ ID NO: 173 to 182), more preferably SEQ ID NO: 175, is fused to the N-terminus of the first neoantigen in the list, and optionally wherein the vector is comprising two independent expression cassettes wherein each expression cassette encodes a portion of the list of neoantigens of claim 1 and wherein the portion of the list encoded by the expression cassettes are of about equal size in number of amino acids.

14. A collection of vectors encoding each a portion of the list of neoantigens according to claim 1, wherein the collection comprises 2 to 4, preferably 2, vectors and preferably wherein the inserts in these vectors encoding the portion of the list are of about equal size in number of amino acids.

15. A method for treating or limiting development of cancer, comprising administering to a subject in need thereof the vector according to claim 13 in an amount effective to treat or limit development of cancer in the subject.

16. A vector encoding the combination of neoantigens according to claim 12, optionally additionally comprising a T-cell enhancer element, preferably (SEQ ID NO: 173 to 182), more preferably SEQ ID NO: 175, is fused to the N-terminus of the first neoantigen in the list, and optionally wherein the vector is comprising two independent expression cassettes wherein each expression cassette encodes a portion of the combination of neoantigens according to claim 12 and wherein the portion of the list encoded by the expression cassettes are of about equal size in number of amino acids.

17. A collection of vectors encoding each a portion of the combination of neoantigens according to claim 12, wherein the collection comprises 2 to 4, preferably 2, vectors and preferably wherein the inserts in these vectors encoding the portion of the list are of about equal size in number of amino acids.

18. A method for treating or limiting development of cancer, comprising administering to a subject in need thereof the vector according to claim 16 in an amount effective to treat or limit development of cancer in the subject.

19. A method for treating or limiting development of cancer, comprising administering to a subject in need thereof the collection of vector according to claim 17 in an amount effective to treat or limit development of cancer in the subject.