U.S. patent application number 17/073253 was filed with the patent office on 2021-11-25 for lasofoxifene treatment of breast cancer.
The applicant listed for this patent is Duke University. Invention is credited to Kaitlyn Andreano, Ching-yi Chang, Stephanie L. Gaillard, Donald P. McDonnell.
Application Number | 20210361596 17/073253 |
Document ID | / |
Family ID | 1000005585309 |
Filed Date | 2021-11-25 |
United States Patent
Application |
20210361596 |
Kind Code |
A1 |
Andreano; Kaitlyn ; et
al. |
November 25, 2021 |
LASOFOXIFENE TREATMENT OF BREAST CANCER
Abstract
The disclosure provides methods for treating estrogen receptor
positive (ER.sup.+) cancer in women with an effective amount of
lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof. The disclosure also includes the detection of the
Estrogen Receptor 1 (ESR1) gene mutations that lead to endocrine
resistance and treatment of endocrine resistant ER.sup.+
cancers.
Inventors: |
Andreano; Kaitlyn; (Durham,
NC) ; Chang; Ching-yi; (Durham, NC) ;
McDonnell; Donald P.; (Chapel Hill, NC) ; Gaillard;
Stephanie L.; (Durham, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Duke University |
Durham |
NC |
US |
|
|
Family ID: |
1000005585309 |
Appl. No.: |
17/073253 |
Filed: |
October 16, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16265109 |
Feb 1, 2019 |
10905659 |
|
|
17073253 |
|
|
|
|
15939218 |
Mar 28, 2018 |
10258604 |
|
|
16265109 |
|
|
|
|
15729320 |
Oct 10, 2017 |
|
|
|
15939218 |
|
|
|
|
62502299 |
May 5, 2017 |
|
|
|
62457759 |
Feb 10, 2017 |
|
|
|
62406859 |
Oct 11, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 45/06 20130101;
A61K 31/00 20130101; A61K 9/7023 20130101; A61P 35/04 20180101;
A61P 35/00 20180101; A61K 31/192 20130101; C12Q 2600/112 20130101;
A61K 9/0036 20130101; C12Q 1/6886 20130101; C12Q 1/6827 20130101;
C12Q 2600/156 20130101; A61K 9/0053 20130101; A61K 31/138 20130101;
A61K 31/40 20130101; A61P 5/00 20180101 |
International
Class: |
A61K 31/138 20060101
A61K031/138; A61K 31/00 20060101 A61K031/00; A61P 35/00 20060101
A61P035/00; A61P 5/00 20060101 A61P005/00; A61P 35/04 20060101
A61P035/04; A61K 9/00 20060101 A61K009/00; A61K 31/40 20060101
A61K031/40; A61K 45/06 20060101 A61K045/06; C12Q 1/6886 20060101
C12Q001/6886; A61K 9/70 20060101 A61K009/70; A61K 31/192 20060101
A61K031/192; C12Q 1/6827 20060101 C12Q001/6827 |
Claims
1. A method of reducing the progression of estrogen receptor
positive human epidermal growth factor receptor 2 negative
(ER.sup.+/HER2.sup.-) locally advanced or metastatic breast cancer
in a patient, wherein the cancer has at least one gain of function
missense mutation within the ligand binding domain (LBD) of the
Estrogen Receptor 1 (ESR1) gene, the method comprising:
administering a therapeutically effective amount of lasofoxifene, a
pharmaceutically acceptable salt thereof, or a functional
derivative thereof to the patient.
2. (canceled)
3. The method of claim 1, wherein the patient has previously been
treated with an aromatase inhibitor.
4. The method of claim 3, wherein the aromatase inhibitor is
exemestane, letrozole, or anastrozole.
5. The method of claim 1, wherein lasofoxifene is administered as
lasofoxifene tartrate.
6. The method of claim 1, wherein lasofoxifene is administered by
oral administration.
7. The method of claim 6, wherein lasofoxifene is administered at 5
mg/day per os.
8. The method of claim 1, further comprising administering to the
patient an additional agent selected from the group consisting of
an aromatase inhibitor, a CDK4/6 inhibitor, an mTOR inhibitor, a
PI3K inhibitor, an HSP90 inhibitor, a HER2 inhibitor, and an HDAC
inhibitor.
9. The method of claim 8, wherein the additional agent is an
aromatase inhibitor.
10. The method of claim 8, wherein the additional agent is a CDK4/6
inhibitor.
11. The method of claim 8, wherein the additional agent is an mTOR
inhibitor.
12. The method of claim 8, wherein the additional agent is a PI3K
inhibitor.
13. The method of claim 8, wherein the additional agent is an HSP90
inhibitor.
14. The method of claim 8, wherein the additional agent is a HER2
inhibitor.
15. The method of claim 8, wherein the additional agent is an HDAC
inhibitor.
16. The method of claim 1, wherein the patient is
postmenopausal.
17. (canceled)
18. (canceled)
19. (canceled)
20. The method of claim 1, wherein the patient's cancer has
progressed on a non-steroid aromatase inhibitor (AI), fulvestrant,
AI in combination with a CDK4/6 inhibitor, or fulvestrant in
combination with a CDK4/6 inhibitor.
21. The method of claim 1, wherein the at least one gain of
function missense mutation is in any one of amino acids D538, Y537,
L536, P535, V534, S463, V392, and E380 of the ER.alpha.
protein.
22. The method of claim 21, wherein the at least one gain of
function missense mutation is D538G, Y537S, Y537N, Y537C, Y537Q,
L536R, L536Q, P535H, V534E, S463P, V392I, or E380Q.
23. The method of claim 21, wherein the at least one gain of
function missense mutation is in amino acid D538 or Y537 of the
ER.alpha. protein.
24. The method of claim 23, wherein the at least one of gain of
function missense mutation is D538G, Y537S, Y537N, Y537C, or Y537Q.
Description
1. CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of co-pending Ser. No.
16/265,109, filed Feb. 1, 2019, which is a continuation of U.S.
application Ser. No. 15/939,218, filed Mar. 28, 2018, which is a
continuation of U.S. application Ser. No. 15/729,320, filed Oct.
10, 2017, which claims the benefit of U.S. Provisional Application
Nos. 62/502,299, filed May 5, 2017; 62/457,759, filed Feb. 10,
2017; and 62/406,859, filed Oct. 11, 2016, each of which is
incorporated in its entirety by reference.
2. SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted via EFS-Web and is hereby incorporated by
reference in its entirety. Said ASCII copy, created on Oct. 16,
2020, is named 47450US_CRF_sequencelisting.txt, and is 2,237 bytes
in size.
3. BACKGROUND OF THE INVENTION
[0003] Estrogen receptor positive (ER.sup.+) breast cancers are a
group of breast cancers that express estrogen receptor .alpha.
(ER.alpha.). Approximately 70% of breast cancers are ER.sup.+ and
are, therefore, treated with endocrine therapy. Endocrine therapy
has led to significant improvement in outcome of women with
ER.sup.+ breast cancer by lowering the level of estrogen or
blocking estrogen signaling. However, its effectiveness is limited
by intrinsic and acquired endocrine resistance.
[0004] Recent studies have shown evidence for the temporal
selection of functional Estrogen Receptor 1 (ESR1) gene mutations
as potential drivers of endocrine resistance during the progression
of ER.sup.+ breast cancer. See Jeselsohn et al., Clinical Cancer
Research 20(7): 1757-1767 (2014). The mutations in ESR1, the gene
encoding ER.alpha., change the conformation of the ER.alpha.
protein, increase its interaction with its co-activators, promote
an active form of the receptor in absence of hormone, and assist
tumor cells in evading hormonal treatment. See Thomas and
Gustafsson, Trends in Endocrinology and Metabolism 26(9): 467-476
(2015).
[0005] There thus remains a need to develop new therapeutic
strategies that are effective to treat tumors harboring mutations
in ESR1, and that can therefore be used to treat breast cancer
patients who have developed endocrine resistance or who are at risk
of developing endocrine resistance.
4. SUMMARY OF THE INVENTION
[0006] We engineered ER.alpha. expression constructs to express
four ESR1 mutations in the ligand binding domain (LBD) of the
ER.alpha. protein, Y537S, Y537N, Y537C, and D538G, and introduced
these expression constructs into cells in culture. These mutations
are found in ER.sup.+ metastatic breast cancer patients who have
been treated with endocrine therapy. See Jeselsohn et al., Nature
Reviews Clinical Oncology 12(10): 573-583 (2015); Jeselsohn et al.,
Clinical Cancer Research 20(7): 1757-1767 (2014); Robinson et al.,
Nature Genetics 45(12): 1446-1451(2013); Thomas and Gustafsson,
Trends in Endocrinology and Metabolism 26(9): 467-476 (2015); and
Toy et al., Nature Genetics 45(12): 1439-1445 (2013).
[0007] Using an estrogen receptor-responsive reporter construct, we
confirmed in an ovarian cell line and in a breast cancer cell line
that all mutants are constitutively active as compared to wild type
ER.alpha.. We then treated the cells with lasofoxifene, a selective
ER modulator (SERM), and found that lasofoxifene effectively
inhibited the transcriptional activity of the ER.alpha. LBD mutants
in a dose-response manner, at concentrations that are clinically
achievable.
[0008] In a second series of experiments, we confirmed that
lasofoxifene is able to reduce viability of the breast cancer cell
line MCF7 stably transfected with either the Y537S or D538G ESR1
mutant receptor, at clinically achievable concentrations.
[0009] Accordingly, in a first aspect, a method of treating locally
advanced or metastatic breast cancer in women is presented. The
method comprises selecting for treatment a patient who has been
diagnosed with estrogen receptor positive (ER.sup.+) locally
advanced or metastatic breast cancer, and administering to the
selected patient an effective amount of lasofoxifene, a
pharmaceutically acceptable salt thereof, or a prodrug thereof.
[0010] In various embodiments, the selected patient has previously
been treated with one or more lines of endocrine therapy. In
certain embodiments, the patient has previously been treated with a
plurality of lines of endocrine therapy.
[0011] In some embodiments, the endocrine therapy that the patient
has previously been treated with is a selective ER modulator
(SERM). In certain embodiments, the SERM is tamoxifen, raloxifene,
bazedoxifene, toremifene, or ospemifene.
[0012] In some embodiments, the endocrine therapy that the patient
has previously been treated with is a selective ER degrader (SERD).
In certain embodiments, the SERD is fulvestrant, RAD1901, ARN-810
(GDC-0810), or AZD9496.
[0013] In some embodiments, the endocrine therapy that the patient
has previously been treated with is an aromatase inhibitor. In
certain embodiments, the aromatase inhibitor is exemestane
(Aromasin.RTM.), letrozole (Femara.RTM.), or anastrozole
(Arimidex.RTM.).
[0014] In some embodiments, the patient has disease progression
after endocrine therapy. In some embodiments, the patient is
resistant to endocrine therapy.
[0015] In various embodiments, the patient's cancer has at least
one gain of function missense mutation within the ligand binding
domain (LBD) of the Estrogen Receptor 1 (ESR1) gene. In some
embodiments, the patient has previously been determined to have at
least one gain of function missense mutation within the ligand
binding domain (LBD) of the Estrogen Receptor 1 (ESR1) gene. In
certain embodiments, the method further comprises the earlier step
of: determining that the patient has at least one gain of function
missense mutation within the ligand binding domain (LBD) of the
Estrogen Receptor 1 (ESR1) gene.
[0016] In some embodiments, the at least one of gain of function
missense mutation is in any one of amino acids D538, Y537, L536,
P535, V534, S463, V392, or E380.
[0017] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid D538. In some preferred
embodiments the mutation is D538G.
[0018] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid Y537. In some embodiments,
the mutation is Y537S, Y537N, Y537C, or Y537Q. In some preferred
embodiments, the mutation is Y537C.
[0019] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid L536. In some embodiments,
the mutation is L536R or L536Q.
[0020] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid P535. In some embodiments,
the mutation is P535H.
[0021] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid V534. In some embodiments,
the mutation is V534E.
[0022] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid S463. In some embodiments,
the mutation is S463P.
[0023] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid V392. In some embodiments,
the mutation is V392I.
[0024] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid E380. In some embodiments,
the mutation is E380Q.
[0025] In some embodiments, the serum estradiol level of the
patient is at least 0.35 ng/dL. In some embodiments, the serum
estradiol level of the patient is about 0.30 ng/dL to about 0.35
ng/dL. In some embodiments, the serum estradiol level of the
patient is about 0.25 ng/dL to about 0.30 ng/dL.
[0026] In various embodiments, lasofoxifene is administered to the
selected ER.sup.+ locally advanced or metastatic breast cancer
patient as lasofoxifene tartrate. In various embodiments,
lasofoxifene is administered by oral, intravenous, transdermal,
vaginal topical, or vaginal ring administration. In certain
embodiments, lasofoxifene is administered by oral administration.
In some of these embodiments, lasofoxifene is administered at about
0.5 mg/day per os (p.o.) to about 10 mg/day per os. In certain
embodiments, lasofoxifene is administered at about 0.5 mg/day per
os to about 5 mg/day per os. In certain embodiments, lasofoxifene
is administered at about 1 mg/day per os to about 5 mg/day per os.
In certain embodiments, lasofoxifene is administered at about 1
mg/day per os. In certain embodiments, lasofoxifene is administered
at about 5 mg/day per os. In various embodiments, lasofoxifene is
administered once every day, once every two days, once every three
days, once every four days, once every five days, once every six
days, once every week, once every two weeks, once every three
weeks, or once every month.
[0027] In certain embodiments, the method further comprises
treating the patient with at least one additional endocrine
therapy. In some embodiments, the patient is treated with the
additional endocrine therapy at original doses. In some other
embodiments, the patient is treated with the additional endocrine
therapy at doses higher than original doses. In certain
embodiments, the additional endocrine therapy is treatment with a
selective ER modulator (SERM) other than lasofoxifene. In certain
embodiments, the additional endocrine therapy is treatment with a
selective ER degrader (SERD). In certain embodiments, the
additional endocrine therapy is treatment with an aromatase
inhibitor.
[0028] In various embodiments, the method further comprises
administering to the ER.sup.+ locally advanced or metastatic breast
cancer patient an effective amount of cyclin-dependent kinase 4/6
(CDK4/6) inhibitor. In certain embodiments, CDK4/6 inhibitor is
palbociclib, abemaciclib, or ribociclib. In some embodiments, the
method further comprises administering to the patient an effective
amount of mammalian target of rapamycin (mTOR) inhibitor. In
certain embodiments, the mTOR inhibitor is Everolimus. In some
embodiments, the method further comprises administering to the
patient an effective amount of phosphoinositide 3-kinase (PI3K)
inhibitor or heat shock protein 90 (HSP90) inhibitor. In some
embodiments, the method further comprises administering to the
patient an effective amount of human epidermal growth factor
receptor 2 (HER2) inhibitor. In certain embodiments, the HER2
inhibitor is trastuzumab (Herceptin.RTM.) or ado-trastuzumab
emtansine (Kadcyla.RTM.). In some embodiments, the method further
comprises administering to the patient an effective amount of a
histone deacetylase (HDAC) inhibitor. In some of these embodiments,
the HDAC inhibitor is vorinostat (Zolinza.RTM.), romidepsin
(Istodax.RTM.), chidamide (Epidaza.RTM.), panobinostat
(Farydak.RTM.), belinostat (Beleodaq.RTM., PXD101), valproic acid
(Depakote.RTM., Depakene.RTM., Stavzor.RTM.), mocetinostat
(MGCD0103), abexinostat (PCI-24781), entinostat (MS-275),
pracinostat (SB939), resminostat (4SC-201), givinostat (ITF2357),
quisinostat (JNJ-26481585), kevetrin, CUDC-101, AR-42, tefinostat
(CHR-2835), CHR-3996, 4SC202, CG200745, rocilinostat (ACY-1215), or
sulforaphane. In some embodiments, the method further comprises
administering to the patient an effective amount of a checkpoint
inhibitor. In some of these embodiments, the checkpoint inhibitor
is an antibody specific for programmed cell death protein 1 (PD-1),
programmed death-ligand 1 (PD-L1), or cytotoxic
T-lymphocyte-associated protein 4 (CTLA-4). In certain embodiments,
the PD-1 antibody is pembrolizumab (Keytruda.RTM.) or nivolumab
(Opdivo.RTM.). In certain embodiments, the CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). In some embodiments, the method further
comprises administering to the patient an effective amount of
cancer vaccine.
[0029] In some embodiments, the patient is premenopausal. In
certain embodiments, the patient has locally advanced or metastatic
ER+/HER2- breast cancer. In some of these embodiments, the patient
has progressed on her first hormonal treatment while on a
non-steroid aromatase inhibitor (AI), fulvestrant, AI in
combination with a CDK4/6 inhibitor, or fulvestrant in combination
with a CDK4/6 inhibitor.
[0030] In some embodiments, the patient is perimenopausal. In
certain embodiments, the patient has locally advanced or metastatic
ER+/HER2- breast cancer. In some of these embodiments, the patient
has progressed on her first hormonal treatment while on a
non-steroid aromatase inhibitor (AI), fulvestrant, AI in
combination with a CDK4/6 inhibitor, or fulvestrant in combination
with a CDK4/6 inhibitor.
[0031] In some embodiments, the patient is postmenopausal. In
certain embodiments, the patient has locally advanced or metastatic
ER+/HER2- breast cancer. In some of these embodiments, the patient
has progressed on her first hormonal treatment while on a
non-steroid aromatase inhibitor (AI), fulvestrant, AI in
combination with a CDK4/6 inhibitor, or fulvestrant in combination
with a CDK4/6 inhibitor.
[0032] In another aspect, a method of treating primary breast
cancer in women is presented. The method comprises selecting for
treatment a patient who has been diagnosed with estrogen receptor
positive (ER.sup.+) primary breast cancer, and administering to the
selected patient an effective amount of lasofoxifene, a
pharmaceutically acceptable salt thereof, or a prodrug thereof.
[0033] In various embodiments, lasofoxifene is administered to the
selected ER.sup.+ primary breast cancer patient as lasofoxifene
tartrate. In some embodiments, lasofoxifene is administered by
oral, intravenous, transdermal, vaginal topical, or vaginal ring
administration. In certain embodiments, lasofoxifene is
administered by oral administration. In some of these embodiments,
lasofoxifene is administered at about 0.5 mg/day per os to about 10
mg/day per os. In certain embodiments, lasofoxifene is administered
at about 0.5 mg/day per os to about 5 mg/day per os. In certain
embodiments, lasofoxifene is administered at about 1 mg/day per os
to about 5 mg/day per os. In certain embodiments, lasofoxifene is
administered at about 1 mg/day per os. In certain embodiments,
lasofoxifene is administered at about 5 mg/day per os. In various
embodiments, lasofoxifene is administered once every day, once
every two days, once every three days, once every four days, once
every five days, once every six days, once every week, once every
two weeks, once every three weeks, or once every month.
[0034] In various embodiments, the method of treating ER.sup.+
primary breast cancer further comprises treating the patient with
at least one additional endocrine therapy. In some embodiments, the
patient is treated with the additional endocrine therapy at
original doses. In some other embodiments, the patient is treated
with the additional endocrine therapy at doses higher than original
doses. In certain embodiments, the additional endocrine therapy is
treatment with a selective ER modulator (SERM) other than
lasofoxifene. In certain embodiments, the additional endocrine
therapy is treatment with a selective ER degrader (SERD). In
certain embodiments the additional endocrine therapy is treatment
with an aromatase inhibitor.
[0035] In various embodiments, the method further comprises
administering to the ER.sup.+ primary breast cancer patient an
effective amount of cyclin-dependent kinase 4/6 (CDK4/6) inhibitor.
In certain embodiments, CDK4/6 inhibitor is palbociclib,
abemaciclib, or ribociclib. In some embodiments, the method further
comprises administering to the patient an effective amount of
mammalian target of rapamycin (mTOR) inhibitor. In certain
embodiments, the mTOR inhibitor is Everolimus. In some embodiments,
the method further comprises administering to the patient an
effective amount of phosphoinositide 3-kinase (PI3K) inhibitor or
heat shock protein 90 (HSP90) inhibitor. In some embodiments, the
method further comprises administering to the patient an effective
amount of human epidermal growth factor receptor 2 (HER2)
inhibitor. In certain embodiments, the HER2 inhibitor is
trastuzumab (Herceptin.RTM.) or ado-trastuzumab emtansine
(Kadcyla.RTM.). In some embodiments, the method further comprises
administering to the patient an effective amount of a histone
deacetylase (HDAC) inhibitor. In some of these embodiments, the
HDAC inhibitor is vorinostat (Zolinza.RTM.), romidepsin
(Istodax.RTM.), chidamide (Epidaza.RTM.), panobinostat
(Farydak.RTM.), belinostat (Beleodaq.RTM., PXD101), valproic acid
(Depakote.RTM., Depakene.RTM., Stavzor.RTM.), mocetinostat
(MGCD0103), abexinostat (PCI-24781), entinostat (MS-275),
pracinostat (SB939), resminostat (4SC-201), givinostat (ITF2357),
quisinostat (JNJ-26481585), kevetrin, CUDC-101, AR-42, tefinostat
(CHR-2835), CHR-3996, 4SC202, CG200745, rocilinostat (ACY-1215), or
sulforaphane. In some embodiments, the method further comprises
administering to the patient an effective amount of a checkpoint
inhibitor. In some of these embodiments, the checkpoint inhibitor
is an antibody specific for programmed cell death protein 1 (PD-1),
programmed death-ligand 1 (PD-L1), or cytotoxic
T-lymphocyte-associated protein 4 (CTLA-4). In certain embodiments,
the PD-1 antibody is pembrolizumab (Keytruda.RTM.) or nivolumab
(Opdivo.RTM.). In certain embodiments, the CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). In some embodiments, the method further
comprises administering to the patient an effective amount of
cancer vaccine.
[0036] In certain embodiments, the patient is premenopausal. In
certain embodiments, the patient is perimenopausal. In certain
embodiments, the patient is postmenopausal.
[0037] In another aspect, a method of adjuvant therapy for estrogen
receptor positive (ER+) breast cancer is presented. The method
comprises administering to a patient who has received primary
treatment for ER+ breast cancer an effective amount of
lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof, in combination with an aromatase inhibitor.
[0038] In some embodiments, lasofoxifene is administered
continuously during the administration of the aromatase inhibitor.
In some embodiments, lasofoxifene is administered cyclically during
the administration of the aromatase inhibitor. In certain
embodiments, the dosing regimen of lasofoxifene is different from
the dosing regimen of the aromatase inhibitor.
[0039] In various embodiments, lasofoxifene is administered as
lasofoxifene tartrate as adjuvant therapy in combination with an
aromatase inhibitor. In some embodiments, the aromatase inhibitor
is exemestane (Aromasin.RTM.), letrozole (Femara.RTM.), or
anastrozole (Arimidex.RTM.). In some embodiments, lasofoxifene is
administered by oral, intravenous, transdermal, vaginal topical, or
vaginal ring administration. In certain embodiments, lasofoxifene
is administered by oral administration. In some of these
embodiments, lasofoxifene is administered at about 0.5 mg/day per
os to about 10 mg/day per os. In certain embodiments, lasofoxifene
is administered at about 0.5 mg/day per os to about 5 mg/day per
os. In certain embodiments, lasofoxifene is administered at about 1
mg/day per os to about 5 mg/day per os. In certain embodiments,
lasofoxifene is administered at about 1 mg/day per os. In certain
embodiments, lasofoxifene is administered at about 5 mg/day per os.
In various embodiments, lasofoxifene is administered once every
day, once every two days, once every three days, once every four
days, once every five days, once every six days, once every week,
once every two weeks, once every three weeks, or once every
month.
[0040] In various embodiments, the method of adjuvant therapy for
estrogen receptor positive (ER+) breast cancer further comprises
treating the patient with at least one additional endocrine
therapy. In certain embodiments, the additional endocrine therapy
is treatment with a selective ER degrader (SERD).
[0041] In various embodiments, the method of adjuvant therapy for
estrogen receptor positive (ER+) breast cancer further comprises
administering to the patient an effective amount of
cyclin-dependent kinase 4/6 (CDK4/6) inhibitor. In certain
embodiments, CDK4/6 inhibitor is palbociclib, abemaciclib, or
ribociclib. In some embodiments, the method further comprises
administering to the patient an effective amount of mammalian
target of rapamycin (mTOR) inhibitor. In certain embodiments, the
mTOR inhibitor is Everolimus. In some embodiments, the method
further comprises administering to the patient an effective amount
of phosphoinositide 3-kinase (PI3K) inhibitor or heat shock protein
90 (HSP90) inhibitor. In some embodiments, the method further
comprises administering to the patient an effective amount of human
epidermal growth factor receptor 2 (HER2) inhibitor. In certain
embodiments, the HER2 inhibitor is trastuzumab (Herceptin.RTM.) or
ado-trastuzumab emtansine (Kadcyla.RTM.). In some embodiments, the
method further comprises administering to the patient an effective
amount of a histone deacetylase (HDAC) inhibitor. In some of these
embodiments, the HDAC inhibitor is vorinostat (Zolinza.RTM.),
romidepsin (Istodax.RTM.), chidamide (Epidaza.RTM.), panobinostat
(Farydak.RTM.), belinostat (Beleodaq.RTM., PXD101), valproic acid
(Depakote.RTM., Depakene.RTM., Stavzor.RTM.), mocetinostat
(MGCD0103), abexinostat (PCI-24781), entinostat (MS-275),
pracinostat (SB939), resminostat (4SC-201), givinostat (ITF2357),
quisinostat (JNJ-26481585), kevetrin, CUDC-101, AR-42, tefinostat
(CHR-2835), CHR-3996, 4SC202, CG200745, rocilinostat (ACY-1215), or
sulforaphane. In some embodiments, the method further comprises
administering to the patient an effective amount of a checkpoint
inhibitor. In some of these embodiments, the checkpoint inhibitor
is an antibody specific for programmed cell death protein 1 (PD-1),
programmed death-ligand 1 (PD-L1), or cytotoxic
T-lymphocyte-associated protein 4 (CTLA-4). In certain embodiments,
the PD-1 antibody is pembrolizumab (Keytruda.RTM.) or nivolumab
(Opdivo.RTM.). In certain embodiments, the CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). In some embodiments, the method further
comprises administering to the patient an effective amount of
cancer vaccine.
[0042] In some embodiments, lasofoxifene is administered in an
amount and on a schedule sufficient to improve bone mass. In some
embodiments, lasofoxifene is administered in an amount and on a
schedule sufficient to improve symptoms of VVA.
[0043] In certain embodiments, the patient is premenopausal. In
certain embodiments, the patient is perimenopausal. In certain
embodiments, the patient is postmenopausal.
[0044] In another aspect, a method of treating cancers other than
breast cancer in women is presented. The method comprises selecting
for treatment a patient who has been diagnosed with estrogen
receptor positive (ER.sup.+) cancer, other than breast cancer, and
has at least one gain of function mutations in the Estrogen
Receptor 1 (ESR1) gene, and administering to the selected patient
an effective amount of lasofoxifene, a pharmaceutically acceptable
salt thereof, or a prodrug thereof. In some embodiments, the
patient has been diagnosed with ER.sup.+ ovarian cancer. In some
other embodiments, the patient has been diagnosed with ER.sup.+
lung cancer.
[0045] In various embodiments, lasofoxifene is administered to the
selected patient with ER.sup.+ cancer, other than breast cancer, as
lasofoxifene tartrate. In some embodiments, lasofoxifene is
administered by oral, intravenous, transdermal, vaginal topical, or
vaginal ring administration. In certain embodiments, lasofoxifene
is administered by oral administration. In some of these
embodiments, lasofoxifene is administered at about 0.5 mg/day per
os to about 10 mg/day per os. In certain embodiments, lasofoxifene
is administered at about 0.5 mg/day per os to about 5 mg/day per
os. In certain embodiments, lasofoxifene is administered at about 1
mg/day per os to about 5 mg/day per os. In certain embodiments,
lasofoxifene is administered at about 1 mg/day per os. In certain
embodiments, lasofoxifene is administered at about 5 mg/day per os.
In various embodiments, lasofoxifene is administered once every
day, once every two days, once every three days, once every four
days, once every five days, once every six days, once every week,
once every two weeks, once every three weeks, or once every
month.
[0046] In various embodiments, the method of treating ER.sup.+
cancer, other than breast cancer, further comprises treating the
patient with at least one additional endocrine therapy. In some
embodiments, the patient is treated with the additional endocrine
therapy at original doses. In some other embodiments, the patient
is treated with the additional endocrine therapy at doses higher
than original doses. In certain embodiments, the additional
endocrine therapy is treatment with a selective ER modulator (SERM)
other than lasofoxifene. In certain embodiments, the additional
endocrine therapy is treatment with a selective ER degrader (SERD).
In certain embodiments the additional endocrine therapy is
treatment with an aromatase inhibitor.
[0047] In various embodiments, the method further comprises
administering to the patient with ER.sup.+ cancer, other than
breast cancer, an effective amount of cyclin-dependent kinase 4/6
(CDK4/6) inhibitor. In certain embodiments, CDK4/6 inhibitor is
palbociclib, abemaciclib, or ribociclib. In some embodiments, the
method further comprises administering to the patient an effective
amount of mammalian target of rapamycin (mTOR) inhibitor. In
certain embodiments, the mTOR inhibitor is Everolimus. In some
embodiments, the method further comprises administering to the
patient an effective amount of phosphoinositide 3-kinase (PI3K)
inhibitor or heat shock protein 90 (HSP90) inhibitor. In some
embodiments, the method further comprises administering to the
patient an effective amount of human epidermal growth factor
receptor 2 (HER2) inhibitor. In certain embodiments, the HER2
inhibitor is trastuzumab (Herceptin.RTM.) or ado-trastuzumab
emtansine (Kadcyla.RTM.). In some embodiments, the method further
comprises administering to the patient an effective amount of a
histone deacetylase (HDAC) inhibitor. In some of these embodiments,
the HDAC inhibitor is vorinostat (Zolinza.RTM.), romidepsin
(Istodax.RTM.), chidamide (Epidaza.RTM.), panobinostat
(Farydak.RTM.), belinostat (Beleodaq.RTM., PXD101), valproic acid
(Depakote.RTM., Depakene.RTM., Stavzor.RTM.), mocetinostat
(MGCD0103), abexinostat (PCI-24781), entinostat (MS-275),
pracinostat (SB939), resminostat (4SC-201), givinostat (ITF2357),
quisinostat (JNJ-26481585), kevetrin, CUDC-101, AR-42, tefinostat
(CHR-2835), CHR-3996, 4SC202, CG200745, rocilinostat (ACY-1215), or
sulforaphane. In some embodiments, the method further comprises
administering to the patient an effective amount of a checkpoint
inhibitor. In some of these embodiments, the checkpoint inhibitor
is an antibody specific for programmed cell death protein 1 (PD-1),
programmed death-ligand 1 (PD-L1), or cytotoxic
T-lymphocyte-associated protein 4 (CTLA-4). In certain embodiments,
the PD-1 antibody is pembrolizumab (Keytruda.RTM.) or nivolumab
(Opdivo.RTM.). In certain embodiments, the CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). In some embodiments, the method further
comprises administering to the patient an effective amount of
cancer vaccine.
[0048] In certain embodiments, the patient is premenopausal. In
certain embodiments, the patient is perimenopausal. In certain
embodiments, the patient is postmenopausal.
[0049] In another aspect, a method of treating a female patient
suffering from breast cancer who is at risk of acquiring a gain of
function missense mutation within the ligand binding domain (LBD)
of the Estrogen Receptor 1 (ESR1) gene is presented. The method
comprises administering to the female patient an effective amount
of lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof.
[0050] In another aspect, a method of treating a female patient
suffering from breast cancer who is at risk of acquiring resistance
to endocrine therapy is presented. The endocrine therapy is
optionally (i) selective ER modulator (SERM) therapy, (ii)
selective ER degrader (SERD) therapy, (iii) aromatase inhibitor
(AI) therapy, or (iv) any combination of (i), (ii) and/or (iii).
The method comprises administering to the female patient an
effective amount of lasofoxifene, a pharmaceutically acceptable
salt thereof, or a prodrug thereof.
[0051] In some embodiments, the patient has primary breast cancer.
In some of these embodiments, the primary breast cancer is locally
advanced.
[0052] In various embodiments, the patient has been treated with
endocrine therapy, optionally wherein the endocrine therapy is (i)
selective ER modulator (SERM) therapy, (ii) selective ER degrader
(SERD) therapy, (iii) aromatase inhibitor (AI) therapy, or (iv) any
combination of (i), (ii) and/or (iii).
[0053] In another aspect, a method of treating a female patient
suffering from estrogen receptor positive (ER+) primary breast
cancer is presented. The method comprises administering to a female
patient an effective amount of lasofoxifene, a pharmaceutically
acceptable salt thereof, or a prodrug thereof.
[0054] In some embodiments, the patient is at risk of acquiring
resistance to endocrine therapy, optionally wherein the endocrine
therapy is (i) selective ER modulator (SERM) therapy, (ii)
selective ER degrader (SERD) therapy, (iii) aromatase inhibitor
(AI) therapy, or (iv) any combination of (i), (ii) and/or
(iii).
[0055] In certain embodiments, the primary breast cancer is locally
advanced.
[0056] In some embodiments, the patient has been treated with
endocrine therapy, optionally wherein the endocrine therapy is (i)
selective ER modulator (SERM) therapy, (ii) selective ER degrader
(SERD) therapy, (iii) aromatase inhibitor (AI) therapy, or (iv) any
combination of (i), (ii) and/or (iii).
[0057] In another aspect, a method of treating a female patient
suffering from estrogen receptor positive (ER+) locally advanced or
metastatic breast cancer is presented. The method comprises
administering to a female patient an effective amount of
lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof.
[0058] In various embodiments, the selected patient has previously
been treated with one or more lines of endocrine therapy. In
certain embodiments, the patient has previously been treated with a
plurality of lines of endocrine therapy.
[0059] In some embodiments, the endocrine therapy that the patient
has previously been treated with is a selective ER modulator
(SERM). In certain embodiments, the SERM is tamoxifen, raloxifene,
bazedoxifene, toremifene, or ospemifene.
[0060] In some embodiments, the endocrine therapy that the patient
has previously been treated with is a selective ER degrader (SERD).
In certain embodiments, the SERD is fulvestrant, RAD1901, ARN-810
(GDC-0810), or AZD9496.
[0061] In some embodiments, the endocrine therapy that the patient
has previously been treated with is an aromatase inhibitor. In
certain embodiments, the aromatase inhibitor is exemestane
(Aromasin.RTM.), letrozole (Femara.RTM.), or anastrozole
(Arimidex.RTM.).
[0062] In some embodiments, the patient has disease progression
after endocrine therapy. In some embodiments, the patient is
resistant to endocrine therapy.
[0063] In various embodiments, the patient's cancer has at least
one gain of function missense mutation within the ligand binding
domain (LBD) of the Estrogen Receptor 1 (ESR1) gene. In some
embodiments, the patient has previously been determined to have at
least one gain of function missense mutation within the ligand
binding domain (LBD) of the Estrogen Receptor 1 (ESR1) gene. In
certain embodiments, the method further comprises the earlier step
of: determining that the patient has at least one gain of function
missense mutation within the ligand binding domain (LBD) of the
Estrogen Receptor 1 (ESR1) gene.
[0064] In some embodiments, the at least one of gain of function
missense mutation is in any one of amino acids D538, Y537, L536,
P535, V534, S463, V392, or E380.
[0065] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid D538. In some preferred
embodiments the mutation is D538G.
[0066] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid Y537. In some embodiments,
the mutation is Y537S, Y537N, Y537C, or Y537Q. In some preferred
embodiments, the mutation is Y537C.
[0067] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid L536. In some embodiments,
the mutation is L536R or L536Q.
[0068] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid P535. In some embodiments,
the mutation is P535H.
[0069] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid V534. In some embodiments,
the mutation is V534E.
[0070] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid S463. In some embodiments,
the mutation is S463P.
[0071] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid V392. In some embodiments,
the mutation is V392I.
[0072] In certain embodiments, the at least one gain of function
missense mutation is in the amino acid E380. In some embodiments,
the mutation is E380Q.
[0073] In various embodiments, lasofoxifene is administered to the
selected ER.sup.+ locally advanced or metastatic breast cancer
patient as lasofoxifene tartrate. In various embodiments,
lasofoxifene is administered by oral, intravenous, transdermal,
vaginal topical, or vaginal ring administration. In certain
embodiments, lasofoxifene is administered by oral administration.
In some of these embodiments, lasofoxifene is administered at about
0.5 mg/day per os (p.o.) to about 10 mg/day per os. In certain
embodiments, lasofoxifene is administered at about 0.5 mg/day per
os to about 5 mg/day per os. In certain embodiments, lasofoxifene
is administered at about 1 mg/day per os to about 5 mg/day per os.
In certain embodiments, lasofoxifene is administered at about 1
mg/day per os. In certain embodiments, lasofoxifene is administered
at about 5 mg/day per os. In various embodiments, lasofoxifene is
administered once every day, once every two days, once every three
days, once every four days, once every five days, once every six
days, once every week, once every two weeks, once every three
weeks, or once every month.
[0074] In certain embodiments, the method further comprises
treating the patient with at least one additional endocrine
therapy. In some embodiments, the patient is treated with the
additional endocrine therapy at original doses. In some other
embodiments, the patient is treated with the additional endocrine
therapy at doses higher than original doses. In certain
embodiments, the additional endocrine therapy is treatment with a
selective ER modulator (SERM) other than lasofoxifene. In certain
embodiments, the additional endocrine therapy is treatment with a
selective ER degrader (SERD). In certain embodiments, the
additional endocrine therapy is treatment with an aromatase
inhibitor.
[0075] In various embodiments, the method further comprises
administering to the ER.sup.+ locally advanced or metastatic breast
cancer patient an effective amount of cyclin-dependent kinase 4/6
(CDK4/6) inhibitor. In certain embodiments, CDK4/6 inhibitor is
palbociclib, abemaciclib, or ribociclib. In some embodiments, the
method further comprises administering to the patient an effective
amount of mammalian target of rapamycin (mTOR) inhibitor. In
certain embodiments, the mTOR inhibitor is Everolimus. In some
embodiments, the method further comprises administering to the
patient an effective amount of phosphoinositide 3-kinase (PI3K)
inhibitor or heat shock protein 90 (HSP90) inhibitor. In some
embodiments, the method further comprises administering to the
patient an effective amount of human epidermal growth factor
receptor 2 (HER2) inhibitor. In certain embodiments, the HER2
inhibitor is trastuzumab (Herceptin.RTM.) or ado-trastuzumab
emtansine (Kadcyla.RTM.). In some embodiments, the method further
comprises administering to the patient an effective amount of a
histone deacetylase (HDAC) inhibitor. In some of these embodiments,
the HDAC inhibitor is vorinostat (Zolinza.RTM.), romidepsin
(Istodax.RTM.), chidamide (Epidaza.RTM.), panobinostat
(Farydak.RTM.), belinostat (Beleodaq.RTM., PXD101), valproic acid
(Depakote.RTM., Depakene.RTM., Stavzor.RTM.), mocetinostat
(MGCD0103), abexinostat (PCI-24781), entinostat (MS-275),
pracinostat (SB939), resminostat (4SC-201), givinostat (ITF2357),
quisinostat (JNJ-26481585), kevetrin, CUDC-101, AR-42, tefinostat
(CHR-2835), CHR-3996, 4SC202, CG200745, rocilinostat (ACY-1215), or
sulforaphane. In some embodiments, the method further comprises
administering to the patient an effective amount of a checkpoint
inhibitor. In some of these embodiments, the checkpoint inhibitor
is an antibody specific for programmed cell death protein 1 (PD-1),
programmed death-ligand 1 (PD-L1), or cytotoxic
T-lymphocyte-associated protein 4 (CTLA-4). In certain embodiments,
the PD-1 antibody is pembrolizumab (Keytruda.RTM.) or nivolumab
(Opdivo.RTM.). In certain embodiments, the CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). In some embodiments, the method further
comprises administering to the patient an effective amount of
cancer vaccine.
[0076] In some embodiments, the patient is premenopausal. In
certain embodiments, the patient has locally advanced or metastatic
ER+/HER2- breast cancer. In some of these embodiments, the patient
has progressed on her first hormonal treatment while on a
non-steroid aromatase inhibitor (AI), fulvestrant, AI in
combination with a CDK4/6 inhibitor, or fulvestrant in combination
with a CDK4/6 inhibitor.
[0077] In some embodiments, the patient is perimenopausal. In
certain embodiments, the patient has locally advanced or metastatic
ER+/HER2- breast cancer. In some of these embodiments, the patient
has progressed on her first hormonal treatment while on a
non-steroid aromatase inhibitor (AI), fulvestrant, AI in
combination with a CDK4/6 inhibitor, or fulvestrant in combination
with a CDK4/6 inhibitor.
[0078] In some embodiments, the patient is postmenopausal. In
certain embodiments, the patient has locally advanced or metastatic
ER+/HER2- breast cancer. In some of these embodiments, the patient
has progressed on her first hormonal treatment while on a
non-steroid aromatase inhibitor (AI), fulvestrant, AI in
combination with a CDK4/6 inhibitor, or fulvestrant in combination
with a CDK4/6 inhibitor.
5. BRIEF DESCRIPTION OF THE DRAWINGS
[0079] These and other features, aspects, and advantages of the
present invention will become better understood with regard to the
following description, and accompanying drawings, where:
[0080] FIG. 1A and FIG. 1B show the effects of lasofoxifene on ESR1
ligand binding domain ("LBD") mutations in Caov2 ovarian carcinoma
cells, with FIG. 1A demonstrating that the mutant receptors are
constitutively active and do not respond to 17-.beta. estradiol
("E2"), and FIG. 1B demonstrating that lasofoxifene inhibits the
mutant receptor activity in a dose-response manner.
[0081] FIG. 2A and FIG. 2B show the effects of lasofoxifene on ESR1
LBD mutations in SKBR3 breast adenocarcinoma cells, with FIG. 2A
demonstrating that the mutant receptors are constitutively active
and do not respond to 17-.beta. estradiol (E2), and FIG. 2B
demonstrating that lasofoxifene inhibits the mutant receptor
activity in a dose-response manner.
[0082] FIG. 3A and FIG. 3B show the effects of lasofoxifene on ESR1
LBD mutations in stably transfected MCF7 breast cancer cells, with
FIG. 3A demonstrating that lasofoxifene inhibits the Y537S mutant
receptor activity with increasing dose titration, and FIG. 3B
demonstrating that lasofoxifene inhibits the D538G mutant receptor
activity with increasing dose titration.
6. DETAILED DESCRIPTION OF THE INVENTION
[0083] Endocrine therapy is often used for treatment and prevention
of ER.sup.+ breast cancers. Different types of endocrine therapy
include selective ER modulators (SERMs), such as tamoxifen;
selective ER degraders (SERDs), such as fulvestrant; and aromatase
inhibitors (AIs). Although endocrine therapy has led to a
significant improvement in outcome for women with ER.sup.+ breast
cancer, its effectiveness is limited by intrinsic and acquired
endocrine resistance. Recent studies on the mechanism of endocrine
resistance have demonstrated that in some cases Estrogen Receptor 1
(ESR1) gene mutations lead to the conformational change of the
ER.alpha. protein towards a constitutively active state and result
in ligand-independent activity that is relatively resistant to
tamoxifen, fulvestrant, and estrogen deprivation. See Jeselsohn et
al., Clinical Cancer Research 20(7): 1757-1767 (2014).
[0084] Lasofoxifene is a nonsteroidal selective ER modulator
(SERM). It has high binding affinity for the estrogen receptor and
acts as a tissue-selective estrogen agonist or antagonist. In the
double-blind, placebo-controlled, randomized Postmenopausal
Evaluation and Risk-Reduction with Lasofoxifene (PEARL) trial,
lasofoxifene was found to reduce the risk of osteoporosis. See
Cummings et al., The New England Journal of Medicine 326(8):
686-696 (2010). In the PEARL trial, it was also found that
lasofoxifene reduced the risk of breast cancer in post-menopausal
women with osteoporosis. See LaCroix et al., Journal of the
National Cancer Institute 102(22): 1706-1715 (2010). However, the
effect of lasofoxifene as a treatment for breast cancer, and its
effect on cancers with endocrine resistance, has not previously
been determined.
[0085] Using cell lines with engineered mutations in the ESR1 gene,
we discovered that lasofoxifene inhibits the mutant receptor
activity in a dose-responsive manner at concentrations that can be
achieved clinically, newly making possible methods of treating
ER.sup.+ locally advanced or metastatic breast cancer, ER.sup.+
primary breast cancer, and other ER.sup.+ cancers, including
cancers having ESR1 mutations, using lasofoxifene, whose
effectiveness is not precluded by endocrine resistance.
6.1. Methods of Treatment
[0086] Accordingly, in a first aspect, disclosed herein are methods
of treating cancers in women, comprising selecting for treatment a
patient who has been diagnosed with estrogen receptor positive
(ER.sup.+) cancer. The selected patient is treated with an
effective amount of lasofoxifene, a pharmaceutically acceptable
salt thereof, or a prodrug thereof.
6.1.1. Patient with ER.sup.+ Cancer
[0087] In various embodiments, the patient has been diagnosed with
ER.sup.+ cancer by immunohistochemistry (IHC) performed on a sample
of the patient's cancer. In some embodiments, the patient has been
diagnosed with locally advanced or metastatic ER.sup.+ breast
cancer. In some embodiments, the patient has been diagnosed with
ER.sup.+ primary breast cancer. In some embodiments, the patient
has been diagnosed with an ER.sup.+ cancer other than breast
cancer. In some of these embodiments, the patient has been
diagnosed with ER.sup.+ ovarian cancer. In some of these
embodiments, the patient has been diagnosed with ER.sup.+ lung
cancer.
[0088] In some embodiments, cells of the patient's cancer have
acquired a gain of function missense mutation within the ligand
binding domain (LBD) of the Estrogen Receptor 1 (ESR1) gene.
[0089] In some embodiments, the patient is at risk of acquiring
resistance to endocrine therapy. In particular embodiments, the
patient is at risk of acquiring resistance to endocrine therapy due
to the increased expression of estrogen receptor. In particular
embodiments, the patient is at risk of acquiring resistance to
endocrine therapy due to the increased expression of co-activators
of estrogen receptor. In particular embodiments, the patient is at
risk of acquiring resistance to endocrine therapy due to increased
phosphorylation level and activity of estrogen receptor and its
co-activators. In particular embodiments, the patient is at risk of
acquiring resistance to endocrine therapy due to change of tumor
microenvironment and other host related factors. In some preferred
embodiments, the patient is at risk of acquiring resistance to
endocrine therapy due to mutations in the Estrogen Receptor 1
(ESR1) gene.
[0090] In some of these embodiments, the endocrine therapy to which
the patient is at risk of acquiring resistance is (i) selective ER
modulator (SERM) therapy, (ii) selective ER degrader (SERD)
therapy, (iii) aromatase inhibitor therapy (AI), or (iv) any
combination of (i), (ii) and/or (iii).
6.1.2. Previous Treatment with Endocrine Therapy
[0091] In various embodiments, the ER.sup.+ cancer patient has
previously been treated with one or more lines of endocrine
therapy. In certain embodiments, the patient has previously been
treated with one line of endocrine therapy. In certain other
embodiments, the patient has previously been treated with a
plurality of lines of endocrine therapy. In some embodiments, the
patient has previously been treated with two lines of endocrine
therapy. In some embodiments, the patient has previously been
treated with three lines of endocrine therapy. In some embodiments,
the patient has previously been treated with four or more lines of
endocrine therapy.
[0092] In some embodiments, the endocrine therapy that the patient
has previously been treated with is a selective ER modulator
(SERM). In some embodiments, the selective ER modulator is selected
from tamoxifen, raloxifene, bazedoxifene, toremifene, and
ospemifene. In certain embodiments, the selective ER modulator is
tamoxifen.
[0093] In some embodiments, the endocrine therapy that the patient
has previously been treated with is a selective ER degrader (SERD).
In various embodiments, the selective ER degrader binds to the
estrogen receptor and leads to the proteasomal degradation of the
receptor. In some embodiments, the selective ER degrader is
selected from fulvestrant, RAD1901, ARN-810 (GDC-0810), and
AZD9496. In certain embodiments, the selective ER degrader is
fulvestrant.
[0094] In some embodiments, the endocrine therapy with which the
patient has previously been treated is an aromatase inhibitor (AI).
In various embodiments, the aromatase inhibitor blocks the
production of estrogen. In some embodiments, the aromatase
inhibitor is selected from exemestane (Aromasin.RTM.), letrozole
(Femara.RTM.), and anastrozole (Arimidex.RTM.).
[0095] In some embodiments, the endocrine therapy that the patient
has previously been treated with is ovarian suppression. In certain
embodiments, ovarian suppression is achieved by oophorectomy. In
certain embodiments, ovarian suppression is achieved by
administration of a GnRH antagonist.
[0096] In certain embodiments, the patient's cancer has relapsed or
progressed after the previous endocrine therapy treatment. In some
embodiments, the patient's cancer has relapsed or progressed after
tamoxifen treatment. In some embodiments, the patient's cancer has
relapsed or progressed after fulvestrant treatment. In some
embodiments, the patient's cancer has relapsed or progressed after
aromatase inhibitor treatment. In some of these embodiments, the
patient's cancer has relapsed or progressed after multiple lines of
endocrine therapy treatment.
[0097] In some embodiments, the ER.sup.+ cancer patient has not
been treated previously with endocrine therapy.
[0098] In certain embodiments, the patient is resistant to
endocrine therapy other than lasofoxifene. In some embodiments, the
patient has intrinsic endocrine resistance. In some embodiments,
the patient has acquired endocrine resistance. In particular
embodiments, the patient is resistant to endocrine therapy due to
the increased expression of estrogen receptor. In particular
embodiments, the patient is resistant to endocrine therapy due to
the increased expression of co-activators of estrogen receptor. In
particular embodiments, the patient is resistant to endocrine
therapy due to increased phosphorylation level and activity of
estrogen receptor and its co-activators. In particular embodiments,
the patient is resistant to endocrine therapy due to change of
tumor microenvironment and other host related factors. In some
preferred embodiments, the patient is resistant to endocrine
therapy due to gene mutations in the Estrogen Receptor 1 (ESR1)
gene.
[0099] In various embodiments, the patient is resistant to clinical
doses of one or more SERMs other than lasofoxifene. In some of
these embodiments, the patient is resistant to clinical doses of
tamoxifen. In various embodiments, the patient is resistant to
clinical doses of one or more SERDs. In some of these embodiments,
the patient is resistant to clinical doses of fulvestrant. In
various embodiments, the patient is resistant to clinical doses of
one or more aromatase inhibitors. In various embodiments, the
patient is resistant to higher than clinical doses of one or more
SERMs other than lasofoxifene. In some of these embodiments, the
patient is resistant to higher than clinical doses of tamoxifen. In
various embodiments, the patient is resistant to higher than
clinical doses of one or more SERDs. In some of these embodiments,
the patient is resistant to higher than clinical doses of
fulvestrant. In various embodiments, the patient is resistant to
higher than clinical doses of one or more aromatase inhibitors.
[0100] In certain embodiments, the ER.sup.+ cancer patient has not
been demonstrated to have endocrine resistance. In some of these
embodiments, the patient has not been demonstrated to have
endocrine resistance due to the limitations of the detection
methods.
[0101] In some embodiments, lasofoxifene is administered to the
ER.sup.+ cancer patient after completion of cancer treatment. In
some of these embodiments, lasofoxifene is administered to the
patient to treat occult micrometastasis.
6.1.3. Menopause Status
[0102] In some embodiments, the ER.sup.+ cancer patient is
premenopausal. In specific embodiments, the patient is
premenopausal and has locally advanced or metastatic ER.sup.+
cancer. In particular embodiments, the patient is premenopausal and
has locally advanced or metastatic ER+ breast cancer.
[0103] In certain embodiments, the ER.sup.+ cancer patient is
perimenopausal. In specific embodiments, the patient is
perimenopausal and has locally advanced or metastatic ER.sup.+
cancer. In particular embodiments, the patient is perimenopausal
and has locally advanced or metastatic ER+ breast cancer.
[0104] In typical embodiments, the ER.sup.+ cancer patient is
postmenopausal. In specific embodiments, the patient is
postmenopausal and has locally advanced or metastatic ER.sup.+
cancer. In particular embodiments, the patient is postmenopausal
and has locally advanced or metastatic ER+ breast cancer.
[0105] In certain embodiments, lasofoxifene is administered to a
premenopausal woman with locally advanced or metastatic
ER.sup.+/HER2.sup.- breast cancer. In certain embodiments,
lasofoxifene is administered to a premenopausal woman with locally
advanced or metastatic ER.sup.+/HER2.sup.- breast cancer who has
progressed while on her first hormonal treatment with a non-steroid
aromatase inhibitor (AI), fulvestrant, AI in combination with a
CDK4/6 inhibitor, or fulvestrant in combination with a CDK4/6
inhibitor.
[0106] In certain embodiments, lasofoxifene is administered to a
perimenopausal woman with locally advanced or metastatic
ER.sup.+/HER2.sup.- breast cancer. In certain embodiments,
lasofoxifene is administered to a perimenopausal woman with locally
advanced or metastatic ER.sup.+/HER2.sup.- breast cancer who has
progressed while on her first hormonal treatment with a non-steroid
aromatase inhibitor (AI), fulvestrant, AI in combination with a
CDK4/6 inhibitor, or fulvestrant in combination with a CDK4/6
inhibitor.
[0107] In certain embodiments, lasofoxifene is administered to a
postmenopausal woman with locally advanced or metastatic
ER.sup.+/HER2.sup.- breast cancer. In certain embodiments,
lasofoxifene is administered to a postmenopausal woman with locally
advanced or metastatic ER.sup.+/HER2.sup.- breast cancer who has
progressed while on her first hormonal treatment with on a
non-steroid aromatase inhibitor (AI), fulvestrant, AI in
combination with a CDK4/6 inhibitor, or fulvestrant in combination
with a CDK4/6 inhibitor.
6.1.4. Mutations in ESR1 Gene
[0108] In various embodiments, the patient has an ER.sup.+ cancer,
cells of which have at least one mutation in the Estrogen Receptor
1 (ESR1) gene, which encodes the Estrogen Receptor .alpha.
(ER.alpha.) protein. In some embodiments, the mutation leads to the
ligand-independent activity of the estrogen receptor. In some
embodiments, the mutation leads to enhanced ligand stimulated
activity of estrogen receptor. In some embodiments, the mutation
leads to resistance to endocrine therapy. In some embodiments, the
mutation promotes tumor growth. In some embodiments, the mutation
enhances metastatic activity of cancer. In some preferred
embodiments, the mutation enhances metastatic activity of ER.sup.+
metastatic breast cancer.
[0109] In some embodiments, the mutation arises from a rare and
undetectable pre-existing clone. In some embodiments, the mutation
is acquired de novo during the course of endocrine therapy
treatment. In some preferred embodiments, the mutation is acquired
de novo during the course of endocrine therapy treatment of breast
cancer. In some embodiments, the mutation is acquired de novo after
multiple lines of endocrine therapy treatment. In some embodiments,
the mutation is acquired de novo after multiple lines of endocrine
therapy treatment of metastatic breast cancer. In various
embodiments, the mutant clone expands to become a more dominant
clone over the course of successive lines of endocrine therapy.
[0110] In some embodiments, the mutation in the ESR1 gene is
missense point mutation. In some embodiments, the mutation in the
ESR1 gene is truncating mutation. In some embodiments, the mutation
in the ESR1 gene is gene amplification. In some embodiments, the
mutation in the ESR1 gene is genomic rearrangement.
[0111] In some preferred embodiments, the patient has an ER.sup.+
cancer that has at least one gain of function missense mutation
within the ligand binding domain (LBD) of the ESR1 gene. In various
embodiments, at least one of the mutations is in an amino acid
selected from D538, Y537, L536, P535, V534, S463, V392, and E380.
(The amino acids are numbered according to the ESR1 protein with
the NCBI accession number NP_000116.2.)
[0112] In particular embodiments, the mutation increases the
stability of the agonist conformation of Helix 12 of the ER.alpha.
protein. In some of these embodiments, the mutation increases the
binding of the estrogen receptor to its co-activators. In some of
these embodiments, the mutation leads to hormone independent
activity of estrogen receptor. In some of these embodiments, the
mutation leads to resistance to tamoxifen, fulvestrant, and/or
aromatase inhibitors.
[0113] In certain embodiments, the mutation is in the amino acid
D538. In certain preferred embodiments, the mutation is D538G.
[0114] In certain embodiments, the mutation is in the amino acid
Y537. In some of these embodiments, the mutation is Y537S, Y537N,
Y537C, or Y537Q. In certain preferred embodiments, the mutation is
Y537C.
[0115] In some embodiments, the mutation is in the amino acid L536.
In certain embodiments, the mutation is L536R or L536Q.
[0116] In some embodiments, the mutation is in the amino acid P535.
In certain embodiments, the mutation is P535H.
[0117] In some embodiments, the mutation is in the amino acid V534.
In certain embodiments, the mutation is V534E.
[0118] In some embodiments, the mutation is in the amino acid S463.
In certain embodiments, the mutation is S463P.
[0119] In some embodiments, the mutation is in the amino acid V392.
In certain embodiments, the mutation is V392I.
[0120] In some embodiments, the mutation is in the amino acid E380.
In certain embodiments, the mutation is E380Q.
[0121] 6.1.4.1. Detection of the ESR1 Gene Mutations
[0122] In various embodiments, the patient has been previously
determined to have at least one mutation in the ESR1 gene. Some
embodiments of the methods described herein further include the
step of detecting the mutations in ESR1 gene.
[0123] In some embodiments, massively parallel next generation
sequencing (NGS) is used for detecting the estrogen receptor
mutations in the patient's cancer. In certain embodiments, the
entire genome is sequenced. In certain embodiments, selected gene
panels of cancer-related genes are sequenced. In certain
embodiments, all coding exons within a given set of genes are
sequenced. In certain embodiments, known "hotspot" regions within a
given set of genes are sequenced. However, the inherent error rate
of current next generation sequencing techniques is up to 1%,
limiting the sensitivity and specificity of detection. In some
embodiments, targeted sequencing is used for detecting the presence
of the ESR1 mutations. Although targeted sequencing allows deeper
sequencing, it is also currently limited by the 1% error rate. In
some embodiments, methods with reduced sequencing error rate are
used. In a particular embodiment, Safe-Sequencing System
(Safe-SeqS) is used, which tags each template molecule to allow for
confident identification of rare variants. See Kinde et al.,
Proceedings of the National Academy of Sciences 108(23): 9530-9535
(2011). In particular embodiments, ultrasensitive Duplex sequencing
is used, which independently tags and sequences each of the two
strands of a DNA duplex. See Schmitt et al., Proceedings of the
National Academy of Sciences 109(36): 14508-14513 (2012). In some
embodiments, digital droplet PCR is used, which emulsifies DNA in
thousands to millions of droplets to encapsulate single DNA
molecules, designed with mutant specific primers. See Vogelstein
and Kinzler, Proceedings of the National Academy of Sciences
96(16): 2322-2326 (1999) and Huggett et al., Clinical Chemistry
61(1): 79-88 (2014).
[0124] In some embodiments, the detection of the ESR1 mutations
takes place at the initial diagnosis. In some embodiments, the
detection of the mutations takes place at the time of disease
progression, relapse, or recurrence. In some embodiments, the
detection of the mutations takes place at the time of disease
progression. In some embodiments, the detection of the mutations
takes place at the time when the disease is stable.
[0125] In some embodiments, one or more tissue specimens are
obtained for detection of the mutations. In certain embodiments,
the tissue specimen is a tumor biopsy. In certain embodiments, the
tissue specimen is a biopsy of metastases. In some other
embodiments, liquid biopsies are obtained for detection of the
mutations. In certain embodiments, the liquid biopsy is circulating
tumor cells (CTCs). In certain other embodiments, the liquid biopsy
is cell-free DNA from blood samples.
[0126] In specific embodiments, the ESR1 mutations are monitored by
circulating tumor DNA (ctDNA) analysis. In some embodiments, the
ctDNA analysis is performed throughout the course of treatment. In
some of these embodiments, the ctDNA is extracted from patient
blood samples. In certain embodiments, the ctDNA is evaluated by
digital PCR analysis of the ESR1 mutations.
6.1.5. Estradiol Levels
[0127] In various embodiments, the patient selected for treatment
based on presence of ESR1 gene mutations is further selected based
on serum estradiol level.
[0128] In certain embodiments, the serum estradiol level of the
patient with the ER.sup.+ cancer having an ESR1 gene mutation is at
least 0.20 ng/dL, such as at least 0.25 ng/dL, at least 0.30 ng/dL,
at least 0.35 ng/dL, at least 0.40 ng/dL, at least 0.45 ng/dL, at
least 0.50 ng/dL, at least 0.55 ng/dL, at least 0.60 ng/dL, at
least 0.65 ng/dL, at least 0.70 ng/dL, at least 0.75 ng/dL, at
least 0.80 ng/dL, at least 0.85 ng/dL, at least 0.90 ng/dL, at
least 0.95 ng/dL, or at least 1.0 ng/dL.
[0129] In certain embodiments, the serum estradiol level of the
patient with the ESR1 gene mutation is about 0.20 ng/dL to about
1.0 ng/dL, such as about 0.20 ng/dL to about 0.25 ng/dL, about 0.25
ng/dL to about 0.30 ng/dL, about 0.30 ng/dL to about 0.35 ng/dL,
about 0.35 ng/dL to about 0.40 ng/dL, about 0.40 ng/dL to about
0.45 ng/dL, about 0.45 ng/dL to about 0.50 ng/dL, about 0.50 ng/dL
to about 0.55 ng/dL, about 0.55 ng/dL to about 0.60 ng/dL, about
0.60 ng/dL to about 0.65 ng/dL, about 0.65 ng/dL to about 0.70
ng/dL, about 0.70 ng/dL to about 0.75 ng/dL, about 0.75 ng/dL to
about 0.80 ng/dL, about 0.80 ng/dL to about 0.85 ng/dL, about 0.85
ng/dL to about 0.90 ng/dL, about 0.90 ng/dL to about 0.95 ng/dL,
about 0.95 ng/dL to about 1.0 ng/dL.
6.1.6. Adjuvant Treatment
[0130] In various embodiments, lasofoxifene is administered to the
patient as adjuvant treatment. In certain embodiments, lasofoxifene
is administered to the patient as adjuvant treatment alone. In
certain other embodiments, lasofoxifene is administered to the
patient as adjuvant treatment in combination with other endocrine
therapies. In some embodiments, lasofoxifene is administered to the
patient after the primary treatment. In some of these embodiments,
lasofoxifene is administered to the patient after surgical removal
or debulking of the cancer.
[0131] In some embodiments, lasofoxifene is administered to the
patient as adjuvant therapy in combination with an aromatase
inhibitor (AI). In various embodiments, the aromatase inhibitor is
exemestane (Aromasin.RTM.), letrozole (Femara.RTM.), or anastrozole
(Arimidex.RTM.).
[0132] In various embodiments, the aromatase inhibitor predisposes
the patient to bone-related toxic effects. In some embodiments, the
aromatase inhibitor predisposes the patient to osteoporosis. In
some embodiments, the aromatase inhibitor predisposes the patient
to bone loss. In some embodiments, the aromatase inhibitor
predisposes the patient to bone fractures. In some embodiments, the
aromatase inhibitor predisposes the patient to bone pain.
[0133] In various embodiments, the aromatase inhibitor predisposes
the patient to vulvovaginal atrophy (VVA).
[0134] In some embodiments, lasofoxifene is administered
continuously during the administration of the aromatase inhibitor.
In some other embodiments, lasofoxifene is administered cyclically
during the administration of the aromatase inhibitor. In some
embodiments, lasofoxifene and the aromatase inhibitor are
administered together (simultaneously). In some other embodiments,
lasofoxifene and the aromatase inhibitor are administered
separately (sequentially).
[0135] In certain embodiments, the dosing regimen of lasofoxifene
is different from the dosing regimen of the aromatase inhibitor. In
some of these embodiments, the dosing quantity of lasofoxifene is
different from the dosing quantity of the aromatase inhibitor. In
some embodiments, the dosing schedule of lasofoxifene is different
from the dosing schedule of the aromatase inhibitor. In some
embodiments, the route of administration of lasofoxifene is
different from the route of administration of the aromatase
inhibitor.
[0136] In certain embodiments, the dosing regimen of lasofoxifene
is the same as the dosing regimen of the aromatase inhibitor. In
some embodiments, the dosing quantity of lasofoxifene is the same
as the dosing quantity of the aromatase inhibitor. In some
embodiments, the dosing schedule of lasofoxifene is the same as the
dosing schedule of the aromatase inhibitor. In some embodiments,
the route of administration of lasofoxifene is the same as the
route of administration of the aromatase inhibitor.
[0137] In some embodiments, lasofoxifene is administered as
adjuvant therapy in combination with an aromatase inhibitor to the
patient for one year. In some embodiments, lasofoxifene is
administered as adjuvant therapy in combination with an aromatase
inhibitor to the patient for two years. In some embodiments,
lasofoxifene is administered as adjuvant therapy in combination
with an aromatase inhibitor to the patient for three years. In some
embodiments, lasofoxifene is administered as adjuvant therapy in
combination with an aromatase inhibitor to the patient for four
years. In some embodiments, lasofoxifene is administered as
adjuvant therapy in combination with an aromatase inhibitor to the
patient for five years. In some embodiments, lasofoxifene is
administered as adjuvant therapy in combination with an aromatase
inhibitor to the patient for six years. In some embodiments,
lasofoxifene is administered as adjuvant therapy in combination
with an aromatase inhibitor to the patient for seven years. In some
embodiments, lasofoxifene is administered as adjuvant therapy in
combination with an aromatase inhibitor to the patient for eight
years. In some embodiments, lasofoxifene is administered as
adjuvant therapy in combination with an aromatase inhibitor to the
patient for nine years. In some embodiments, lasofoxifene is
administered as adjuvant therapy in combination with an aromatase
inhibitor to the patient for ten years. In some other embodiments,
lasofoxifene is administered as adjuvant therapy in combination
with an aromatase inhibitor to the patient for more than ten years.
In certain embodiments, lasofoxifene is administered as adjuvant
therapy in combination with an aromatase inhibitor until the
patient's cancer progresses on therapy.
[0138] In some embodiments, lasofoxifene is administered as
adjuvant therapy in combination with an aromatase inhibitor to
increase the disease-free survival of the breast cancer patient. In
some embodiments, lasofoxifene is administered as adjuvant therapy
in combination with an aromatase inhibitor to decrease the
incidence of contralateral breast cancer. In some embodiments,
lasofoxifene is administered as adjuvant therapy in combination
with an aromatase inhibitor to prevent the recurrence or
progression of the cancer.
6.2. Lasofoxifene
[0139] In various embodiments, the selected patient is treated with
an effective amount of lasofoxifene, a pharmaceutically acceptable
salt thereof, or a prodrug thereof. In some preferred embodiments,
lasofoxifene is administered to the selected patient as
lasofoxifene tartrate.
[0140] The term "pharmaceutically acceptable salt" refers to
non-toxic pharmaceutically acceptable salts. See Gould,
International Journal of Pharmaceutics 33: 201-217 (1986) and Berge
et al., Journal of Pharmaceutical Sciences 66(1): 1-19 (1977).
Other salts well known to those in the art may, however, be used.
Representative organic or inorganic acids include, but are not
limited to, hydrochloric, hydrobromic, hydriodic, perchloric,
sulfuric, nitric, phosphoric, acetic, propionic, glycolic, lactic,
succinic, maleic, fumaric, malic, tartaric, citric, benzoic,
mandelic, methanesulfonic, hydroxyethanesulfonic, benzenesulfonic,
oxalic, pamoic, 2-naphthalenesulfonic, p-toluenesulfonic,
cyclohexanesulfamic, salicylic, saccharinic or trifluoroacetic
acid. Representative organic or inorganic bases include, but are
not limited to, basic or cationic salts such as benzathine,
chloroprocaine, choline, diethanolamine, ethylenediamine,
meglumine, procaine, aluminum, calcium, lithium, magnesium,
potassium, sodium and zinc.
[0141] Embodiments also include prodrugs of the compounds disclosed
herein. In general, such prodrugs will be functional derivatives of
the compounds which are readily convertible in vivo into the
required compound. Thus, in the methods of treatment of the present
invention, the term "administering" shall encompass the treatment
of the various disorders described with the compound specifically
disclosed or with a compound which may not be specifically
disclosed, but which converts to the specified compound in vivo
after administration to the subject. Conventional procedures for
the selection and preparation of suitable prodrug derivatives are
described, for example, in "Design of Prodrugs", H. Bundgaard,
Elsevier, 1985.
[0142] Some of the crystalline forms for the compounds may exist as
polymorphs and as such are intended to be included in the present
invention. In addition, some of the compounds may form solvates
with water (i.e., hydrates) or common organic solvents, and such
solvates are intended to be encompassed by some embodiments.
[0143] Where the processes for the preparation of the compounds as
disclosed herein give rise to mixtures of stereoisomers, these
isomers may be separated by conventional techniques such as
preparative chromatography. The compounds may be prepared in
racemic form or as individual enantiomers or diastereomers by
either stereospecific synthesis or by resolution. The compounds
may, for example, be resolved into their component enantiomers or
diastereomers by standard techniques, such as the formation of
stereoisomeric pairs by salt formation with an optically active
base, followed by fractional crystallization and regeneration of
the free acid. The compounds may also be resolved by formation of
stereoisomeric esters or amides, followed by chromatographic
separation and removal of the chiral auxiliary. Alternatively, the
compounds may be resolved using a chiral HPLC column. It is to be
understood that all stereoisomers, racemic mixtures, diastereomers,
cis-trans isomers, and enantiomers thereof are encompassed by some
embodiments.
6.3. Pharmaceutical Compositions
[0144] Methods for treatment of estrogen receptor positive
(ER.sup.+) cancers include administering a therapeutically
effective amount of lasofoxifene, a pharmaceutically acceptable
salt thereof, or a prodrug thereof. The lasofoxifene, the
pharmaceutically acceptable salt, or the prodrug of the invention
can be formulated in pharmaceutical compositions. In addition to
lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof, the composition further comprises a
pharmaceutically acceptable excipient, carrier, buffer, stabilizer
or other materials well known to those skilled in the art. Such
materials should be non-toxic and should not interfere with the
efficacy of the active ingredient. The precise nature of the
carrier or other material can depend on the route of
administration, e.g. oral, intravenous, transdermal, vaginal
topical, or vaginal ring.
[0145] Pharmaceutical compositions for oral administration can be
in tablet, capsule, powder or liquid form. A tablet can include a
solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical
compositions generally include a liquid carrier such as water,
petroleum, animal oil, vegetable oil, mineral oil or synthetic oil.
Physiological saline solution, dextrose or other saccharide
solution or glycols such as ethylene glycol, propylene glycol or
polyethylene glycol can also be included.
[0146] For parenteral administration, the lasofoxifene will be in
the form of a parenterally acceptable aqueous solution which is
pyrogen-free and has suitable pH, isotonicity and stability. Those
of relevant skill in the art are well able to prepare suitable
solutions using, for example, isotonic vehicles such as Sodium
Chloride Injection, Ringer's Injection, Lactated Ringer's
Injection. Preservatives, stabilizers, buffers, antioxidants and/or
other additives can be included, as required.
[0147] Pharmaceutical compositions for vaginal topical
administration can be in the form of ointment, cream, gel or
lotion. The pharmaceutical compositions for vaginal topical
administration often include water, alcohol, animal oil, vegetable
oil, mineral oil or synthetic oil. Hydrocarbon (paraffin), wool
fat, beeswax, macrogols, emulsifying wax or cetrimide can also be
included.
[0148] A composition can be administered alone or in combination
with other treatments, either simultaneously or sequentially,
dependent upon the condition to be treated.
6.4. Treatment Regimens
[0149] In the methods of administering an effective amount of
lasofoxifene in the form of a pharmaceutical composition as
described above for treatment of ER.sup.+ cancer, the terms
"treatment", "treating", and the like are used herein to generally
mean obtaining a desired pharmacologic and/or physiologic effect.
The effect may be prophylactic, in terms of completely or partially
preventing a disease, condition, or symptoms thereof, and/or may be
therapeutic in terms of a partial or complete cure for a disease or
condition and/or adverse effect, such as a symptom, attributable to
the disease or condition. "Treatment" as used herein covers any
treatment of a disease or condition of a mammal, particularly a
human, and includes: (a) preventing the disease or condition from
occurring in a subject which may be predisposed to the disease or
condition but has not yet been diagnosed as having it; (b)
inhibiting the disease or condition (e.g., arresting its
development); or (c) relieving the disease or condition (e.g.,
causing regression of the disease or condition, providing
improvement in one or more symptoms). Improvements in any
conditions can be readily assessed according to standard methods
and techniques known in the art. The population of subjects treated
by the method of the disease includes subjects suffering from the
undesirable condition or disease, as well as subjects at risk for
development of the condition or disease.
[0150] The term "effective amount" means a dose that produces the
desired effect for which it is administered. The exact dose will
depend on the purpose of the treatment, and will be ascertainable
by one skilled in the art using known techniques. See Lloyd, The
Art, Science and Technology of Pharmaceutical Compounding
(1999).
6.4.1. Routes of Administration
[0151] In various embodiments, lasofoxifene is administered by
oral, intravenous, transdermal, vaginal topical, or vaginal ring
administration.
[0152] In some embodiments, lasofoxifene is administered to the
patient by oral administration. In certain embodiments,
lasofoxifene is administered at about 0.5 mg/day per os to about 10
mg/day per os, such as about 0.5 mg/day per os to about 5 mg/day
per os, about 0.5 mg/day per os to about 5 mg/day per os, about 1
mg/day per os to about 5 mg/day per os, about 2 mg/day per os to
about 5 mg/day per os, about 3 mg/day per os to about 5 mg/day per
os, about 4 mg/day per os to about 5 mg/day per os, about 0.5
mg/day per os to about 4 mg/day per os, about 1 mg/day per os to
about 4 mg/day per os, about 2 mg/day per os to about 4 mg/day per
os, about 3 mg/day per os to about 4 mg/day per os, about 0.5
mg/day per os to about 3 mg/day per os, about 1 mg/day per os to
about 3 mg/day per os, about 2 mg/day per os to about 3 mg/day per
os, about 0.5 mg/day per os to about 2 mg/day per os, about 1
mg/day per os to about 2 mg/day per os, or about 0.5 mg/day per os
to about 1 mg/day per os. In some embodiments, lasofoxifene is
administered at about 0.5 mg/day per os. In some embodiments,
lasofoxifene is administered at about 1 mg/day per os. In some
embodiments, lasofoxifene is administered at about 1.5 mg/day per
os. In some embodiments, lasofoxifene is administered at about 2
mg/day per os. In some embodiments, lasofoxifene is administered at
about 2.5 mg/day per os. In some embodiments, lasofoxifene is
administered at about 3 mg/day per os. In some embodiments,
lasofoxifene is administered at about 3.5 mg/day per os. In some
embodiments, lasofoxifene is administered at about 4 mg/day per os.
In some embodiments, lasofoxifene is administered at about 4.5
mg/day per os. In some embodiments, lasofoxifene is administered at
about 5 mg/day per os. In some embodiments, lasofoxifene is
administered at about 6 mg/day per os. In some embodiments,
lasofoxifene is administered at about 7 mg/day per os. In some
embodiments, lasofoxifene is administered at about 8 mg/day per os.
In some embodiments, lasofoxifene is administered at about 9 mg/day
per os. In some embodiments, lasofoxifene is administered at about
10 mg/day per os. In some other embodiments, lasofoxifene is
administered at more than 10 mg/day per os.
[0153] In certain embodiments, when lasofoxifene is administered to
patient whose cancer has not acquired endocrine resistance,
lasofoxifene can be administered at less than 0.5 mg/day per os for
prevention of endocrine resistance. In certain embodiments, when
lasofoxifene is administered to cancer patient as adjuvant
treatment, lasofoxifene can be administered at less than 0.5 mg/day
per os for prevention of endocrine resistance.
[0154] In certain embodiments, lasofoxifene is administered once
every day. In certain embodiments, lasofoxifene is administered
once every two days. In certain embodiments, lasofoxifene is
administered once every three days. In certain embodiments,
lasofoxifene is administered once every four days. In certain
embodiments, lasofoxifene is administered once every five days. In
certain embodiments, lasofoxifene is administered once every six
days. In certain embodiments, lasofoxifene is administered once
every week. In certain embodiments, lasofoxifene is administered
once every two weeks. In certain embodiments, lasofoxifene is
administered once every three weeks. In certain embodiments,
lasofoxifene is administered once every month.
[0155] In some embodiments, lasofoxifene is administered to the
patient by vaginal ring administration. In some of these
embodiments, lasofoxifene is administered once every two weeks. In
some of these embodiments, lasofoxifene is administered once every
three weeks. In some of these embodiments, lasofoxifene is
administered once every month. In some of these embodiments,
lasofoxifene is administered once every two months. In some of
these embodiments, lasofoxifene is administered once every three
months. In some of these embodiments, lasofoxifene is administered
once every four months.
[0156] In some embodiments, lasofoxifene is administered to
ER.sup.+ cancer patient for one year. In some embodiments,
lasofoxifene is administered to the patient for two years. In some
embodiments, lasofoxifene is administered to the patient for three
years. In some embodiments, lasofoxifene is administered to the
patient for four years. In some embodiments, lasofoxifene is
administered to the patient for five years. In some other
embodiments, lasofoxifene is administered to the patient for more
than five years. In certain embodiments, lasofoxifene is
administered to the patient until the patient's cancer progresses
on therapy.
6.4.2. Combination Therapy
[0157] In various embodiments, lasofoxifene is administered either
alone or in combination with other therapies. In certain
embodiments, lasofoxifene is administered in combination with at
least one other therapy. In some embodiments, lasofoxifene and
other therapies are administered together (simultaneously). In some
other embodiments, lasofoxifene and other therapies are
administered at different times (sequentially).
[0158] In particular embodiments, the additional therapy that the
patient is treated with is endocrine therapy. In various
embodiments, the patient is treated with at least one line of
additional endocrine therapy. In some embodiments, the patient is
treated with one line of additional endocrine therapy. In some
other embodiments, the patient is treated with multiple lines of
additional endocrine therapy.
[0159] In some embodiments, the patient is treated with the
additional endocrine therapy at the original doses. In some other
embodiments, the patient is treated with the additional endocrine
therapy at doses higher than original doses. In certain
embodiments, the patient is treated with the additional endocrine
therapy at doses lower than original doses.
[0160] In certain embodiments, the additional endocrine therapy is
treatment with a selective ER modulator (SERM) other than
lasofoxifene. In some of these embodiments, the selective ER
modulator is selected from tamoxifen, raloxifene, bazedoxifene,
toremifene, and ospermifene. In certain embodiments, the selective
ER modulator is tamoxifen.
[0161] In certain embodiments, the additional endocrine therapy is
treatment with a selective ER degrader (SERD). In some of these
embodiments, the selective ER degrader is selected from
fulvestrant, RAD1901, ARN-810 (GDC-0810), and AZD9496. In certain
embodiments, the selective ER degrader is fulvestrant.
[0162] In certain embodiments, the additional endocrine therapy is
treatment with an aromatase inhibitor. In some of these
embodiments, the aromatase inhibitor is selected from exemestane
(Aromasin.RTM.), letrozole (Femara.RTM.), and anastrozole
(Arimidex.RTM.).
[0163] In various embodiments, the additional therapy is
administration to the patient of an effective amount of a cell
cycle inhibitor. In certain embodiments, the additional therapy is
administration of an effective amount of cyclin-dependent kinase
4/6 (CDK4/6) inhibitor. In some embodiments, the additional therapy
is a CDK4/6 inhibitor selected from the group of palbociclib,
abemaciclib, and ribociclib.
[0164] In some embodiments, the additional therapy is
administration to the patient of an inhibitor of a pathway that
cross-talks with and activates the ER transcriptional activity. In
certain embodiments, the additional therapy is a mammalian target
of rapamycin (mTOR) inhibitor. In specific embodiments, the mTOR
inhibitor is Everolimus. In some of these embodiments, lasofoxifene
in combination with Everolimus is administered to a postmenopausal
woman with locally advanced or metastatic breast cancer who has
progressed on a non-steroidal AI and/or fulvestrant either as
monotherapy or in combination with a CDK4/6 inhibitor. In various
embodiments, the additional therapy is a phosphoinositide 3-kinase
(PI3K) inhibitor or a heat shock protein 90 (HSP90) inhibitor.
[0165] In various embodiments, the additional therapy is
administration to the patient of an effective amount of a growth
factor inhibitor. In certain embodiments, the additional therapy is
a human epidermal growth factor receptor 2 (HER2) inhibitor. In
some embodiments, the HER2 inhibitor is trastuzumab
(Herceptin.RTM.). In some other embodiments, the HER2 inhibitor is
ado-trastuzumab emtansine (Kadcyla.RTM.).
[0166] In some embodiments, the additional therapy is administering
to the patient an effective amount of a histone deacetylase (HDAC)
inhibitor. In various embodiments, the HDAC inhibitor is vorinostat
(Zolinza.RTM.), romidepsin (Istodax.RTM.), chidamide
(Epidaza.RTM.), panobinostat (Farydak.RTM.), belinostat
(Beleodaq.RTM., PXD101), valproic acid (Depakote.RTM.,
Depakene.RTM., Stavzor.RTM.), mocetinostat (MGCD0103), abexinostat
(PCI-24781), entinostat (MS-275), pracinostat (SB939), resminostat
(4SC-201), givinostat (ITF2357), quisinostat (JNJ-26481585),
kevetrin, CUDC-101, AR-42, tefinostat (CHR-2835), CHR-3996, 4SC202,
CG200745, rocilinostat (ACY-1215), or sulforaphane. In certain
embodiments, the HDAC inhibitor is entinostat (MS-275) with the
proviso that the patient is not treated with a HER2 inhibitor. In
certain other embodiments, the HDAC inhibitor is vorinostat
(Zolinza.RTM.). In yet certain other embodiments, the HDAC
inhibitor is romidepsin (Istodax.RTM.).
[0167] In some embodiments, the additional therapy is administering
to the patient an effective amount of a checkpoint inhibitor. In
certain embodiments, the checkpoint inhibitor is an antibody. In
some of these embodiments, the checkpoint inhibitor is an antibody
specific for programmed cell death protein 1 (PD-1), programmed
death-ligand 1 (PD-L1), or cytotoxic T-lymphocyte-associated
protein 4 (CTLA-4). In some embodiments, the PD-1 antibody is
pembrolizumab (Keytruda.RTM.) or nivolumab (Opdivo.RTM.). In some
embodiments, the CTLA-4 antibody is ipilimumab (Yervoy.RTM.).
[0168] In certain embodiments, the additional therapy is
administering to the patient an effective amount of cancer
vaccine.
[0169] In some embodiments, the additional therapy is administering
to the patient an effective amount of denosumab.
[0170] In some embodiments, the additional therapy is administering
to the patient an effective amount of a serotonin-norepinephrine
reuptake inhibitor (SNRI), a selective serotonin reuptake inhibitor
(SSRI), or gabapentin. In certain embodiments, the SNRI is
venlafaxine (Effexor.RTM.).
6.4.3. Clinical Endpoints
[0171] 6.4.3.1. Primary Clinical Endpoints
[0172] In various embodiments, the method comprises administering
an amount of lasofoxifene effective to increase the disease-free
survival of the ER.sup.+ cancer patient. In some embodiments, the
method comprises administering lasofoxifene in an amount effective
to reduce recurrence of ER.sup.+ cancer. In some embodiments, the
method comprises administering lasofoxifene in an amount effective
to increase time to recurrence of ER.sup.+ cancer. In some
embodiments, the method comprises administering lasofoxifene in an
amount effective to reduce metastasis of ER.sup.+ cancer. In some
embodiments, the method comprises administering lasofoxifene in an
amount effective to increase duration of progression-free survival
of the ER.sup.+ cancer patient.
[0173] In various embodiments, the method increases the
disease-free survival of the ER.sup.+ breast cancer patient. In
certain embodiments, the method reduces recurrence of ER.sup.+
breast cancer. In certain embodiments, the method increases time to
recurrence of ER.sup.+ breast cancer. In certain embodiments, the
method reduces metastasis of ER.sup.+ breast cancer to bone. In
certain embodiments, the method reduces metastasis of ER.sup.+
breast cancer to tissues other than bone. In certain embodiments,
the method increases duration of progression-free survival of the
ER.sup.+ breast cancer patient.
[0174] In various embodiments, the method increases the
disease-free survival in ER.sup.+ cancer patient with endocrine
resistance. In some embodiments, the method reduces recurrence of
cancer in patient with endocrine resistance. In some embodiments,
the method increases time to recurrence of cancer in patient with
endocrine resistance. In some embodiments, the method reduces
metastasis of cancer in patient with endocrine resistance. In some
embodiments, the method increases duration of progression-free
survival in ER.sup.+ cancer patient with endocrine resistance.
[0175] In some preferred embodiments, the method increases
disease-free survival, reduces recurrence, increases time to
recurrence, reduces metastasis, and/or increases duration of
progression-free survival in patients with ER.sup.+ locally
advanced or metastatic breast cancer that has developed endocrine
resistance. In particular embodiments, the breast cancer has
developed endocrine resistance by acquiring one or more of the ESR1
mutations discussed herein. In some embodiments, the method reduces
the selective pressure and prevents the expansion of the endocrine
resistant clones in ER.sup.+ locally advanced or metastatic breast
cancer during treatment.
[0176] 6.4.3.2. Secondary Clinical Endpoints
[0177] In some embodiments, the method is effective to prevent
fracture and bone loss in women who are concurrently being treated
with one or more drugs causing or predisposing to osteoporosis.
[0178] In some embodiments, the method is effective to decrease
vaginal pH, increase vaginal lubrication, and/or improve vaginal
cell maturation index in women who are concurrently being treated
with one or more drugs causing or predisposing to vulvovaginal
atrophy (VVA).
[0179] In some embodiments, the method reduces one or more symptoms
of sexual dysfunction in women who are concurrently being treated
with one or more drugs causing or predisposing to sexual
dysfunction.
[0180] In some embodiments, the method treats hot flashes in women
who are concurrently being treated with one or more drugs causing
or predisposing to hot flashes.
[0181] In some embodiments, the method increases one or more
quality of life measures selected from joint ache, urogenital
symptoms, bone loss, and bone fractures.
6.5. Further Embodiments
[0182] Further embodiments are provided in the following numbered
embodiments.
1. A method of treating locally advanced or metastatic breast
cancer in women, comprising:
[0183] a) selecting for treatment a patient who has been diagnosed
with estrogen receptor positive (ER+) locally advanced or
metastatic breast cancer; and
[0184] b) administering to the selected patient an effective amount
of lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof.
2. The method of embodiment 1, wherein the patient has previously
been treated with one or more lines of endocrine therapy. 3. The
method of embodiment 2, wherein the patient has previously been
treated with a plurality of lines of endocrine therapy. 4. The
method of embodiment 2 or embodiment 3, wherein the endocrine
therapy that the patient has previously been treated with is a
selective ER modulator (SERM). 5. The method of embodiment 4,
wherein the SERM is tamoxifen, raloxifene, bazedoxifene,
toremifene, or ospemifene. 6. The method of embodiment 2 or
embodiment 3, wherein the endocrine therapy that the patient has
previously been treated with is a selective ER degrader (SERD). 7.
The method of embodiment 6, wherein the SERD is fulvestrant,
RAD1901, ARN-810 (GDC-0810), or AZD9496. 8. The method of
embodiment 2 or embodiment 3, wherein the endocrine therapy that
the patient has previously been treated with is an aromatase
inhibitor. 9. The method of embodiment 8, wherein the aromatase
inhibitor is exemestane (Aromasin.RTM.), letrozole (Femara.RTM.),
or anastrozole (Arimidex.RTM.). 10. The method of any one of
embodiments 2 to 9, wherein the patient has disease progression
after endocrine therapy. 11. The method of any one of embodiments 1
to 10, wherein the patient's locally advanced or metastatic cancer
is resistant to endocrine therapy other than lasofoxifene. 12. The
method of any one of embodiments 1 to 11, wherein the patient's
locally advanced or metastatic cancer has at least one gain of
function missense mutation within the ligand binding domain (LBD)
of the Estrogen Receptor 1 (ESR1) gene. 13. The method of
embodiment 12, wherein the patient has previously been determined
to have at least one gain of function missense mutation within the
ligand binding domain (LBD) of the Estrogen Receptor 1 (ESR1) gene.
14. The method of embodiment 13, further comprising the earlier
step of:
[0185] determining that the patient has at least one gain of
function missense mutation within the ligand binding domain (LBD)
of the Estrogen Receptor 1 (ESR1) gene.
15. The method of any one of embodiments 12 to 14, wherein the at
least one of gain of function missense mutation is in any one of
amino acids D538, Y537, L536, P535, V534, S463, V392, and E380. 16.
The method of embodiment 15, wherein the at least one gain of
function missense mutation is in the amino acid D538. 17. The
method of embodiment 16, wherein the mutation is D538G. 18. The
method of embodiment 15, wherein the at least one gain of function
missense mutation is in the amino acid Y537. 19. The method of
embodiment 18, wherein the mutation is Y537S, Y537N, Y537C, or
Y537Q. 20. The method of embodiment 19, wherein the mutation is
Y537C. 21. The method of embodiment 15, wherein the at least one
gain of function missense mutation is in the amino acid L536. 22.
The method of embodiment 21, wherein the mutation is L536R or
L536Q. 23. The method of embodiment 15, wherein the at least one
gain of function missense mutation is in the amino acid P535. 24.
The method of embodiment 23, wherein the mutation is P535H. 25. The
method of embodiment 15, wherein the at least one gain of function
missense mutation is in the amino acid V534. 26. The method of
embodiment 25, wherein the mutation is V534E. 27. The method of
embodiment 15, wherein the at least one gain of function missense
mutation is in the amino acid S463. 28. The method of embodiment
27, wherein the mutation is S463P. 29. The method of embodiment 15,
wherein the at least one gain of function missense mutation is in
the amino acid V392. 30. The method of embodiment 29, wherein the
mutation is V392I. 31. The method of embodiment 15, wherein the at
least one gain of function missense mutation is in the amino acid
E380. 32. The method of embodiment 31, wherein the mutation is
E380Q. 33. The method of any one of embodiments 12 to 32, wherein
the serum estradiol level of the patient is at least 0.35 ng/dL.
34. The method of any one of embodiments 12 to 32, wherein the
serum estradiol level of the patient is about 0.30 ng/dL to about
0.35 ng/dL. 35. The method of any one of embodiments 12 to 32,
wherein the serum estradiol level of the patient is about 0.25
ng/dL to about 0.30 ng/dL. 36. The method of any one of embodiments
1 to 35, wherein lasofoxifene is administered as lasofoxifene
tartrate. 37. The method of any one of embodiments 1 to 36, wherein
lasofoxifene is administered by oral, intravenous, transdermal,
vaginal topical, or vaginal ring administration. 38. The method of
embodiment 37, wherein lasofoxifene is administered by oral
administration. 39. The method of embodiment 38, wherein
lasofoxifene is administered at about 0.5 mg/day per os to about 10
mg/day per os. 40. The method of embodiment 39, wherein
lasofoxifene is administered at about 0.5 mg/day per os to about 5
mg/day per os. 41. The method of embodiment 40, wherein
lasofoxifene is administered at about 1 mg/day per os to about 5
mg/day per os. 42. The method of embodiment 40, wherein
lasofoxifene is administered at 1 mg/day per os. 43. The method of
embodiment 40, wherein lasofoxifene is administered at 5 mg/day per
os. 44. The method of any one of embodiments 1 to 43, wherein
lasofoxifene is administered once every day, once every two days,
once every three days, once every four days, once every five days,
once every six days, once every week, once every two weeks, once
every three weeks, or once every month. 45. The method of any one
of embodiments 1 to 44, further comprising treating said patient
with at least one additional endocrine therapy. 46. The method of
embodiment 45, wherein said patient is treated with the additional
endocrine therapy at original doses. 47. The method of embodiment
45, wherein said patient is treated with the additional endocrine
therapy at doses higher than original doses. 48. The method of any
one of embodiments 45 to 47, wherein the additional endocrine
therapy is treatment with a selective ER modulator (SERM) other
than lasofoxifene. 49. The method of any one of embodiments 45 to
47, wherein the additional endocrine therapy is treatment with a
selective ER degrader (SERD). 50. The method of any one of
embodiments 45 to 47, wherein the additional endocrine therapy is
treatment with an aromatase inhibitor. 51. The method of any one of
embodiments 1 to 44, further comprising administering to said
patient an effective amount of cyclin-dependent kinase 4/6 (CDK4/6)
inhibitor. 52. The method of embodiment 51, wherein said CDK4/6
inhibitor is palbociclib, abemaciclib, or ribociclib. 53. The
method of any one of embodiments 1 to 44, further comprising
administering to said patient an effective amount of mammalian
target of rapamycin (mTOR) inhibitor. 54. The method of embodiment
53, wherein said mTOR inhibitor is Everolimus. 55. The method of
any one of embodiments 1 to 44, further comprising administering to
said patient an effective amount of phosphoinositide 3-kinase
(PI3K) inhibitor or heat shock protein 90 (HSP90) inhibitor. 56.
The method of any one of embodiments 1 to 44, further comprising
administering to said patient an effective amount of human
epidermal growth factor receptor 2 (HER2) inhibitor. 57. The method
of embodiment 56, wherein said HER2 inhibitor is trastuzumab
(Herceptin.RTM.) or ado-trastuzumab emtansine (Kadcyla.RTM.). 58.
The method of any one of embodiments 1 to 44, further comprising
administering to said patient an effective amount of a histone
deacetylase (HDAC) inhibitor. 59. The method of embodiment 58,
wherein said HDAC inhibitor is vorinostat (Zolinza.RTM.),
romidepsin (Istodax.RTM.), chidamide (Epidaza.RTM.), panobinostat
(Farydak.RTM.), belinostat (Beleodaq.RTM., PXD101), valproic acid
(Depakote.RTM., Depakene.RTM., Stavzor.RTM.), mocetinostat
(MGCD0103), abexinostat (PCI-24781), entinostat (MS-275),
pracinostat (SB939), resminostat (4SC-201), givinostat (ITF2357),
quisinostat (JNJ-26481585), kevetrin, CUDC-101, AR-42, tefinostat
(CHR-2835), CHR-3996, 4SC202, CG200745, rocilinostat (ACY-1215), or
sulforaphane. 60. The method of any one of embodiments 1 to 44,
further comprising administering to said patient an effective
amount of a checkpoint inhibitor. 61. The method of embodiment 60,
wherein said checkpoint inhibitor is an antibody specific for
programmed cell death protein 1 (PD-1), programmed death-ligand 1
(PD-L1), or cytotoxic T-lymphocyte-associated protein 4 (CTLA-4).
62. The method of embodiment 61, wherein said PD-1 antibody is
pembrolizumab (Keytruda.RTM.) or nivolumab (Opdivo.RTM.). 63. The
method of embodiment 61, wherein said CTLA-4 antibody is ipilimumab
(Yervoy.RTM.). 64. The method of any one of embodiments 1 to 44,
further comprising administering to said patient an effective
amount of cancer vaccine. 65. The method of any one of embodiments
1 to 64, wherein the patient is premenopausal. 66. The method of
embodiment 65, wherein the patient has locally advanced or
metastatic ER+/HER2- breast cancer. 67. The method of embodiment
65, wherein the patient has progressed on her first hormonal
treatment while on a non-steroid aromatase inhibitor (AI),
fulvestrant, AI in combination with a CDK4/6 inhibitor, or
fulvestrant in combination with a CDK4/6 inhibitor. 68. The method
of any one of embodiments 1 to 64, wherein the patient is
perimenopausal. 69. The method of embodiment 68, wherein the
patient has locally advanced or metastatic ER+/HER2- breast cancer.
70. The method of embodiment 69, wherein the patient has progressed
on her first hormonal treatment while on a non-steroid aromatase
inhibitor (AI), fulvestrant, AI in combination with a CDK4/6
inhibitor, or fulvestrant in combination with a CDK4/6 inhibitor.
71. The method of any one of embodiments 1 to 64, wherein the
patient is postmenopausal. 72. The method of embodiment 71, wherein
the patient has locally advanced or metastatic ER+/HER2- breast
cancer. 73. The method of embodiment 72, wherein the patient has
progressed on her first hormonal treatment while on a non-steroid
aromatase inhibitor (AI), fulvestrant, AI in combination with a
CDK4/6 inhibitor, or fulvestrant in combination with a CDK4/6
inhibitor. 74. A method of treating primary breast cancer in women,
comprising:
[0186] a) selecting for treatment a patient who has been diagnosed
with estrogen receptor positive (ER+) primary breast cancer;
and
[0187] b) administering to the selected patient an effective amount
of lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof.
75. The method of embodiment 74, wherein lasofoxifene is
administered as lasofoxifene tartrate. 76. The method of embodiment
74 or embodiment 75, wherein lasofoxifene is administered by oral,
intravenous, transdermal, vaginal topical, or vaginal ring
administration. 77. The method of embodiment 76, wherein
lasofoxifene is administered by oral administration. 78. The method
of embodiment 77, wherein lasofoxifene is administered at about 0.5
mg/day per os to about 10 mg/day per os. 79. The method of
embodiment 78, wherein lasofoxifene is administered at about 0.5
mg/day per os to about 5 mg/day per os. 80. The method of
embodiment 79, wherein lasofoxifene is administered at about 1
mg/day per os to about 5 mg/day per os. 81. The method of
embodiment 79, wherein lasofoxifene is administered at 1 mg/day per
os. 82. The method of embodiment 79, wherein lasofoxifene is
administered at 5 mg/day per os. 83. The method of any one of
embodiments 74 to 82, wherein lasofoxifene is administered once
every day, once every two days, once every three days, once every
four days, once every five days, once every six days, once every
week, once every two weeks, once every three weeks, or once every
month. 84. The method of any one of embodiments 74 to 83, further
comprising treating said patient with at least one additional
endocrine therapy. 85. The method of embodiment 84, wherein said
patient is treated with the additional endocrine therapy at
original doses. 86. The method of embodiment 84, wherein said
patient is treated with the additional endocrine therapy at doses
higher than original doses. 87. The method of any one of
embodiments 84 to 86, wherein the additional endocrine therapy is
treatment with a selective ER modulator (SERM) other than
lasofoxifene. 88. The method of any one of embodiments 84 to 86,
wherein the additional endocrine therapy is treatment with a
selective ER degrader (SERD). 89. The method of any one of
embodiments 84 to 86, wherein the additional endocrine therapy is
treatment with an aromatase inhibitor. 90. The method of any one of
embodiments 74 to 83, further comprising administering to said
patient an effective amount of cyclin-dependent kinase 4/6 (CDK4/6)
inhibitor. 91. The method of embodiment 90, wherein said CDK4/6
inhibitor is palbociclib, abemaciclib, or ribociclib. 92. The
method of any one of embodiments 74 to 83, further comprising
administering to said patient an effective amount of mammalian
target of rapamycin (mTOR) inhibitor. 93. The method of embodiment
92, wherein said mTOR inhibitor is Everolimus. 94. The method of
any one of embodiments 74 to 83, further comprising administering
to said patient an effective amount of phosphoinositide 3-kinase
(PI3K) inhibitor or heat shock protein 90 (HSP90) inhibitor. 95.
The method of any one of embodiments 74 to 83, further comprising
administering to said patient an effective amount of human
epidermal growth factor receptor 2 (HER2) inhibitor. 96. The method
of embodiment 95, wherein said HER2 inhibitor is trastuzumab
(Herceptin.RTM.) or ado-trastuzumab emtansine (Kadcyla.RTM.). 97.
The method of any one of embodiments 74 to 83, further comprising
administering to said patient an effective amount of a histone
deacetylase (HDAC) inhibitor. 98. The method of embodiment 97,
wherein said HDAC inhibitor is vorinostat (Zolinza.RTM.),
romidepsin (Istodax.RTM.), chidamide (Epidaza.RTM.), panobinostat
(Farydak.RTM.), belinostat (Beleodaq.RTM., PXD101), valproic acid
(Depakote.RTM., Depakene.RTM., Stavzor.RTM.), mocetinostat
(MGCD0103), abexinostat (PCI-24781), entinostat (MS-275),
pracinostat (SB939), resminostat (4SC-201), givinostat (ITF2357),
quisinostat (JNJ-26481585), kevetrin, CUDC-101, AR-42, tefinostat
(CHR-2835), CHR-3996, 4SC202, CG200745, rocilinostat (ACY-1215), or
sulforaphane. 99. The method of any one of embodiments 74 to 83,
further comprising administering to said patient an effective
amount of checkpoint inhibitor. 100. The method of embodiment 99,
wherein said checkpoint inhibitor is an antibody specific for
programmed cell death protein 1 (PD-1), programmed death-ligand 1
(PD-L1), or cytotoxic T-lymphocyte-associated protein 4 (CTLA-4).
101. The method of embodiment 100, wherein said PD-1 antibody is
pembrolizumab (Keytruda.RTM.) or nivolumab (Opdivo.RTM.). 102. The
method of embodiment 100, wherein said CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). 103. The method of any one of embodiments
74 to 83, further comprising administering to said patient an
effective amount of cancer vaccine. 104. The method of any one of
embodiments 74 to 103, wherein the patient is premenopausal. 105.
The method of any one of embodiments 74 to 103, wherein the patient
is perimenopausal. 106. The method of any one of embodiments 74 to
103, wherein the patient is postmenopausal. 107. A method of
adjuvant therapy of estrogen receptor positive (ER+) breast cancer,
comprising:
[0188] administering to a patient who has received primary
treatment for ER+ breast cancer an effective amount of
lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof, in combination with an aromatase inhibitor.
108. The method of embodiment 107, wherein lasofoxifene is
administered continuously during the administration of the
aromatase inhibitor. 109. The method of embodiment 107, wherein
lasofoxifene is administered cyclically during the administration
of the aromatase inhibitor. 110. The method of any one of
embodiments 107 to 109, wherein the dosing regimen of lasofoxifene
is different from the dosing regimen of the aromatase inhibitor.
111. The method of any one of embodiments 107 to 110, wherein
lasofoxifene is administered as lasofoxifene tartrate. 112. The
method of any one of embodiments 107 to 111, wherein the aromatase
inhibitor is exemestane (Aromasin.RTM.), letrozole (Femara.RTM.),
or anastrozole (Arimidex.RTM.). 113. The method of any one of
embodiments 107 to 112, wherein lasofoxifene is administered by
oral, intravenous, transdermal, vaginal topical, or vaginal ring
administration. 114. The method of embodiment 113, wherein
lasofoxifene is administered by oral administration. 115. The
method of embodiment 114, wherein lasofoxifene is administered at
about 0.5 mg/day per os to about 10 mg/day per os. 116. The method
of embodiment 115, wherein lasofoxifene is administered at about
0.5 mg/day per os to about 5 mg/day per os. 117. The method of
embodiment 116, wherein lasofoxifene is administered at about 1
mg/day per os to about 5 mg/day per os. 118. The method of
embodiment 116, wherein lasofoxifene is administered at 1 mg/day
per os. 119. The method of embodiment 116, wherein lasofoxifene is
administered at 5 mg/day per os. 120. The method of any one of
embodiments 107 to 119, wherein lasofoxifene is administered once
every day, once every two days, once every three days, once every
four days, once every five days, once every six days, once every
week, once every two weeks, once every three weeks, or once every
month. 121. The method of any one of embodiments 107 to 120,
further comprising treating said patient with an additional
endocrine therapy. 122. The method of embodiment 121, wherein the
additional endocrine therapy is treatment with a selective ER
degrader (SERD). 123. The method of any one of embodiments 107 to
120, further comprising administering to said patient an effective
amount of cyclin-dependent kinase 4/6 (CDK4/6) inhibitor. 124. The
method of embodiment 123, wherein said CDK4/6 inhibitor is
palbociclib, abemaciclib, or ribociclib. 125. The method of any one
of embodiments 107 to 120, further comprising administering to said
patient an effective amount of mammalian target of rapamycin (mTOR)
inhibitor. 126. The method of embodiment 125, wherein said mTOR
inhibitor is Everolimus. 127. The method of any one of embodiments
107 to 120, further comprising administering to said patient an
effective amount of phosphoinositide 3-kinase (PI3K) inhibitor or
heat shock protein 90 (HSP90) inhibitor. 128. The method of any one
of embodiments 107 to 120, further comprising administering to said
patient an effective amount of human epidermal growth factor
receptor 2 (HER2) inhibitor. 129. The method of embodiment 128,
wherein said HER2 inhibitor is trastuzumab (Herceptin.RTM.) or
ado-trastuzumab emtansine (Kadcyla.RTM.). 130. The method of any
one of embodiments 107 to 120, further comprising administering to
said patient an effective amount of a histone deacetylase (HDAC)
inhibitor. 131. The method of embodiment 130, wherein said HDAC
inhibitor is vorinostat (Zolinza.RTM.), romidepsin (Istodax.RTM.),
chidamide (Epidaza.RTM.), panobinostat (Farydak.RTM.), belinostat
(Beleodaq.RTM., PXD101), valproic acid (Depakote.RTM.,
Depakene.RTM., Stavzor.RTM.), mocetinostat (MGCD0103), abexinostat
(PCI-24781), entinostat (MS-275), pracinostat (SB939), resminostat
(4SC-201), givinostat (ITF2357), quisinostat (JNJ-26481585),
kevetrin, CUDC-101, AR-42, tefinostat (CHR-2835), CHR-3996, 4SC202,
CG200745, rocilinostat (ACY-1215), or sulforaphane. 132. The method
of any one of embodiments 107 to 120, further comprising
administering to said patient an effective amount of checkpoint
inhibitor. 133. The method of embodiment 132, wherein said
checkpoint inhibitor is an antibody specific for programmed cell
death protein 1 (PD-1), programmed death-ligand 1 (PD-L1), or
cytotoxic T-lymphocyte-associated protein 4 (CTLA-4). 134. The
method of embodiment 133, wherein said PD-1 antibody is
pembrolizumab (Keytruda.RTM.) or nivolumab (Opdivo.RTM.). 135. The
method of embodiment 133, wherein said CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). 136. The method of any one of embodiments
107 to 120, further comprising administering to said patient an
effective amount of cancer vaccine. 137. The method of any one of
embodiments 107 to 136, wherein lasofoxifene is administered in an
amount and on a schedule sufficient to improve bone mass. 138. The
method of any one of embodiments 107 to 136, wherein lasofoxifene
is administered in an amount and on a schedule sufficient to
improve symptoms of VVA. 139. The method of any one of embodiments
107 to 138, wherein the patient is premenopausal. 140. The method
of any one of embodiments 107 to 138, wherein the patient is
perimenopausal. 141. The method of any one of embodiments 107 to
138, wherein the patient is postmenopausal. 142. A method of
treating cancers other than breast cancer in women, comprising:
[0189] a) selecting for treatment a patient who has been diagnosed
with estrogen receptor positive (ER+) cancer, other than breast
cancer, and has at least one gain of function mutations in the
Estrogen Receptor 1 (ESR1) gene; and
[0190] b) administering to the selected patient an effective amount
of lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof.
143. The method of embodiment 142, wherein the patient has been
diagnosed with ER+ ovarian cancer. 144. The method of embodiment
142, wherein the patient has been diagnosed with ER+ lung cancer.
145. The method of any one of embodiments 142 to 144, wherein
lasofoxifene is administered as lasofoxifene tartrate. 146. The
method of any one of embodiments 142 to 145, wherein lasofoxifene
is administered by oral, intravenous, transdermal, vaginal topical,
or vaginal ring administration. 147. The method of embodiment 146,
wherein lasofoxifene is administered by oral administration. 148.
The method of embodiment 147, wherein lasofoxifene is administered
at about 0.5 mg/day per os to about 10 mg/day per os. 149. The
method of embodiment 148, wherein lasofoxifene is administered at
about 0.5 mg/day per os to about 5 mg/day per os. 150. The method
of embodiment 149, wherein lasofoxifene is administered at about 1
mg/day per os to about 5 mg/day per os. 151. The method of
embodiment 149, wherein lasofoxifene is administered at 1 mg/day
per os. 152. The method of embodiment 149, wherein lasofoxifene is
administered at 5 mg/day per os. 153. The method of any one of
embodiments 142 to 152, wherein lasofoxifene is administered once
every day, once every two days, once every three days, once every
four days, once every five days, once every six days, once every
week, once every two weeks, once every three weeks, or once every
month. 154. The method of any one of embodiments 142 to 153,
further comprising treating said patient with at least one
additional endocrine therapy. 155. The method of embodiment 154,
wherein said patient is treated with the additional endocrine
therapy at original doses. 156. The method of embodiment 154,
wherein said patient is treated with the additional endocrine
therapy at doses higher than original doses. 157. The method of any
one of embodiments 154 to 156, wherein the additional endocrine
therapy is treatment with a selective ER modulator (SERM) other
than lasofoxifene. 158. The method of any one of embodiments 154 to
156, wherein the additional endocrine therapy is treatment with a
selective ER degrader (SERD). 159. The method of any one of
embodiments 154 to 156, wherein the additional endocrine therapy is
treatment with an aromatase inhibitor. 160. The method of any one
of embodiments 142 to 153, further comprising administering to said
patient an effective amount of cyclin-dependent kinase 4/6 (CDK4/6)
inhibitor. 161. The method of embodiment 160, wherein said CDK4/6
inhibitor is palbociclib, abemaciclib, or ribociclib. 162. The
method of any one of embodiments 142 to 153, further comprising
administering to said patient an effective amount of mammalian
target of rapamycin (mTOR) inhibitor. 163. The method of embodiment
162, wherein said mTOR inhibitor is Everolimus. 164. The method of
any one of embodiments 142 to 153, further comprising administering
to said patient an effective amount of phosphoinositide 3-kinase
(PI3K) inhibitor or heat shock protein 90 (HSP90) inhibitor. 165.
The method of any one of embodiments 142 to 153, further comprising
administering to said patient an effective amount of human
epidermal growth factor receptor 2 (HER2) inhibitor. 166. The
method of embodiment 165, wherein said HER2 inhibitor is
trastuzumab (Herceptin.RTM.) or ado-trastuzumab emtansine
(Kadcyla.RTM.). 167. The method of any one of embodiments 142 to
153, further comprising administering to said patient an effective
amount of a histone deacetylase (HDAC) inhibitor. 168. The method
of embodiment 167, wherein said HDAC inhibitor is vorinostat
(Zolinza.RTM.), romidepsin (Istodax.RTM.), chidamide
(Epidaza.RTM.), panobinostat (Farydak.RTM.), belinostat
(Beleodaq.RTM., PXD101), valproic acid (Depakote.RTM.,
Depakene.RTM., Stavzor.RTM.), mocetinostat (MGCD0103), abexinostat
(PCI-24781), entinostat (MS-275), pracinostat (SB939), resminostat
(4SC-201), givinostat (ITF2357), quisinostat (JNJ-26481585),
kevetrin, CUDC-101, AR-42, tefinostat (CHR-2835), CHR-3996, 4SC202,
CG200745, rocilinostat (ACY-1215), or sulforaphane. 169. The method
of any one of embodiments 142 to 153, further comprising
administering to said patient an effective amount of checkpoint
inhibitor. 170. The method of embodiment 169, wherein said
checkpoint inhibitor is an antibody specific for programmed cell
death protein 1 (PD-1), programmed death-ligand 1 (PD-L1), or
cytotoxic T-lymphocyte-associated protein 4 (CTLA-4). 171. The
method of embodiment 170, wherein said PD-1 antibody is
pembrolizumab (Keytruda.RTM.) or nivolumab (Opdivo.RTM.). 172. The
method of embodiment 170, wherein said CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). 173. The method of any one of embodiments
142 to 153, further comprising administering to said patient an
effective amount of cancer vaccine. 174. The method of any one of
embodiments 142 to 173, wherein the patient is premenopausal. 175.
The method of any one of embodiments 142 to 173, wherein the
patient is perimenopausal. 176. The method of any one of
embodiments 142 to 173, wherein the patient is postmenopausal. 177.
A method of treating a female patient suffering from breast cancer
who is at risk of acquiring a gain of function missense mutation
within the ligand binding domain (LBD) of the Estrogen Receptor 1
(ESR1) gene, comprising administering to the female patient an
effective amount of lasofoxifene, a pharmaceutically acceptable
salt thereof, or a prodrug thereof. 178. A method of treating a
female patient suffering from breast cancer who is at risk of
acquiring resistance to endocrine therapy, optionally wherein the
endocrine therapy is (i) selective ER modulator (SERM) therapy,
(ii) selective ER degrader (SERD) therapy, (iii) aromatase
inhibitor (AI) therapy, or (iv) any combination of (i), (ii) and/or
(iii), comprising administering to the female patient an effective
amount of lasofoxifene, a pharmaceutically acceptable salt thereof,
or a prodrug thereof. 179. The method of embodiment 177 or
embodiment 178, wherein the patient has primary breast cancer. 180.
The method of embodiment 179, wherein the primary breast cancer is
locally advanced. 181. The method of any one of embodiments 177 to
180, wherein the patient has been treated with endocrine therapy,
optionally wherein the endocrine therapy is (i) selective ER
modulator (SERM) therapy, (ii) selective ER degrader (SERD)
therapy, (iii) aromatase inhibitor (AI) therapy, or (iv) any
combination of (i), (ii) and/or (iii). 182. A method of treating a
female patient suffering from estrogen receptor positive (ER+)
primary breast cancer, comprising administering to a female patient
an effective amount of lasofoxifene, a pharmaceutically acceptable
salt thereof, or a prodrug thereof. 183. The method of embodiment
182, wherein the patient is at risk of acquiring resistance to
endocrine therapy, optionally wherein the endocrine therapy is (i)
selective ER modulator (SERM) therapy, (ii) selective ER degrader
(SERD) therapy, (iii) aromatase inhibitor (AI) therapy, or (iv) any
combination of (i), (ii) and/or (iii). 184. The method of
embodiment 182 or embodiment 183, wherein the primary breast cancer
is locally advanced. 185. The method of any one of embodiments 182
to 184, wherein the patient has been treated with endocrine
therapy, optionally wherein the endocrine therapy is (i) selective
ER modulator (SERM) therapy, (ii) selective ER degrader (SERD)
therapy, (iii) aromatase inhibitor (AI) therapy, or (iv) any
combination of (i), (ii) and/or (iii). 186. A method of treating a
female patient suffering from estrogen receptor positive (ER+)
locally advanced or metastatic breast cancer, comprising
administering to a female patient an effective amount of
lasofoxifene, a pharmaceutically acceptable salt thereof, or a
prodrug thereof. 187. The method of embodiment 186, wherein the
patient has previously been treated with one or more lines of
endocrine therapy. 188. The method of embodiment 186, wherein the
patient has previously been treated with a plurality of lines of
endocrine therapy. 189. The method of any one of embodiments 186 to
188, wherein the patient has disease progression after endocrine
therapy. 190. The method of any one of embodiments 186 to 188,
wherein the endocrine therapy that the patient has previously been
treated with is a selective ER modulator (SERM). 191. The method of
embodiment 190, wherein the SERM is tamoxifen, raloxifene,
bazedoxifene, toremifene, or ospemifene. 192. The method any one of
embodiments 186 to 188, wherein the endocrine therapy that the
patient has previously been treated with is a selective ER degrader
(SERD). 193. The method of embodiment 192, wherein the SERD is
fulvestrant, RAD1901, ARN-810 (GDC-0810), or AZD9496. 194. The
method of any one of embodiments 186 to 188, wherein the endocrine
therapy that the patient has previously been treated with is an
aromatase inhibitor. 195. The method of embodiment 194, wherein the
aromatase inhibitor is exemestane (Aromasin.RTM.), letrozole
(Femara.RTM.), or anastrozole (Arimidex.RTM.). 196. The method of
any one of embodiments 187 to 195, wherein the patient has disease
progression after endocrine therapy. 197. The method of any one of
embodiments 186 to 196, wherein the patient's locally advanced or
metastatic cancer is resistant to endocrine therapy other than
lasofoxifene. 198. The method of any one of embodiments 186 to 197,
wherein the patient has cancer cells with at least one gain of
function missense mutation within the ligand binding domain (LBD)
of the Estrogen Receptor 1 (ESR1) gene. 199. The method of
embodiment 198, wherein the patient has previously been determined
to have at least one gain of function missense mutation within the
ligand binding domain (LBD) of the Estrogen Receptor 1 (ESR1) gene.
200. The method of embodiment 197, further comprising the earlier
step of:
[0191] determining that the patient has at least one gain of
function missense mutation within the ligand binding domain (LBD)
of the Estrogen Receptor 1 (ESR1) gene.
201. The method of any one of embodiments 198 to 198, wherein the
at least one of gain of function missense mutation is in any one of
amino acids D538, Y537, L536, P535, V534, S463, V392, and E380.
202. The method of embodiment 201, wherein the at least one gain of
function missense mutation is in the amino acid D538. 203. The
method of embodiment 202, wherein the mutation is D538G. 204. The
method of embodiment 201, wherein the at least one gain of function
missense mutation is in the amino acid Y537. 205. The method of
embodiment 204, wherein the mutation is Y537S, Y537N, Y537C, or
Y537Q. 206. The method of embodiment 205, wherein the mutation is
Y537C. 207. The method of embodiment 201, wherein the at least one
gain of function missense mutation is in the amino acid L536. 208.
The method of embodiment 207, wherein the mutation is L536R or
L536Q. 209. The method of embodiment 201, wherein the at least one
gain of function missense mutation is in the amino acid P535. 210.
The method of embodiment 209, wherein the mutation is P535H. 211.
The method of embodiment 201, wherein the at least one gain of
function missense mutation is in the amino acid V534. 212. The
method of embodiment 211, wherein the mutation is V534E. 213. The
method of embodiment 201, wherein the at least one gain of function
missense mutation is in the amino acid S463. 214. The method of
embodiment 213, wherein the mutation is S463P. 215. The method of
embodiment 201, wherein the at least one gain of function missense
mutation is in the amino acid V392. 216. The method of embodiment
215, wherein the mutation is V392I. 217. The method of embodiment
201, wherein the at least one gain of function missense mutation is
in the amino acid E380. 218. The method of embodiment 217, wherein
the mutation is E380Q. 219. The method of any one of embodiments
177 to 218, wherein lasofoxifene is administered as lasofoxifene
tartrate. 220. The method of any one of embodiments 177 to 219,
wherein lasofoxifene is administered by oral, intravenous,
transdermal, vaginal topical, or vaginal ring administration. 221.
The method of embodiment 220, wherein lasofoxifene is administered
by oral administration. 222. The method of embodiment 221, wherein
lasofoxifene is administered at about 0.5 mg/day per os to about 10
mg/day per os. 223. The method of embodiment 222, wherein
lasofoxifene is administered at about 0.5 mg/day per os to about 5
mg/day per os. 224. The method of embodiment 223, wherein
lasofoxifene is administered at about 1 mg/day per os to about 5
mg/day per os. 225. The method of embodiment 223, wherein
lasofoxifene is administered at 1 mg/day per os. 226. The method of
embodiment 223, wherein lasofoxifene is administered at 5 mg/day
per os. 227. The method of any one of embodiments 177 to 226,
wherein lasofoxifene is administered once every day, once every two
days, once every three days, once every four days, once every five
days, once every six days, once every week, once every two weeks,
once every three weeks, or once every month. 228. The method of any
one of embodiments 177 to 227, further comprising treating said
patient with at least one additional endocrine therapy. 229. The
method of embodiment 228, wherein said patient is treated with the
additional endocrine therapy at original doses. 230. The method of
embodiment 228, wherein said patient is treated with the additional
endocrine therapy at doses higher than original doses. 231. The
method of any one of embodiments 228 to 230, wherein the additional
endocrine therapy is treatment with a selective ER modulator (SERM)
other than lasofoxifene. 232. The method of any one of embodiments
228 to 230, wherein the additional endocrine therapy is treatment
with a selective ER degrader (SERD). 233. The method of any one of
embodiments 228 to 230, wherein the additional endocrine therapy is
treatment with an aromatase inhibitor. 234. The method of any one
of embodiments 177 to 227, further comprising administering to said
patient an effective amount of cyclin-dependent kinase 4/6 (CDK4/6)
inhibitor. 235. The method of embodiment 234, wherein said CDK4/6
inhibitor is palbociclib, abemaciclib, or ribociclib. 236. The
method of any one of embodiments 177 to 227, further comprising
administering to said patient an effective amount of mammalian
target of rapamycin (mTOR) inhibitor. 237. The method of embodiment
236, wherein said mTOR inhibitor is Everolimus. 238. The method of
any one of embodiments 177 to 227, further comprising administering
to said patient an effective amount of phosphoinositide 3-kinase
(PI3K) inhibitor or heat shock protein 90 (HSP90) inhibitor. 239.
The method of any one of embodiments 177 to 227, further comprising
administering to said patient an effective amount of human
epidermal growth factor receptor 2 (HER2) inhibitor. 240. The
method of embodiment 239, wherein said HER2 inhibitor is
trastuzumab (Herceptin.RTM.) or ado-trastuzumab emtansine
(Kadcyla.RTM.). 241. The method of any one of embodiments 177 to
227, further comprising administering to said patient an effective
amount of a histone deacetylase (HDAC) inhibitor. 242. The method
of embodiment 241, wherein said HDAC inhibitor is vorinostat
(Zolinza.RTM.), romidepsin (Istodax.RTM.), chidamide
(Epidaza.RTM.), panobinostat (Farydak.RTM.), belinostat
(Beleodaq.RTM., PXD101), valproic acid (Depakote.RTM.,
Depakene.RTM., Stavzor.RTM.), mocetinostat (MGCD0103), abexinostat
(PCI-24781), entinostat (MS-275), pracinostat (SB939), resminostat
(4SC-201), givinostat (ITF2357), quisinostat (JNJ-26481585),
kevetrin, CUDC-101, AR-42, tefinostat (CHR-2835), CHR-3996, 4SC202,
CG200745, rocilinostat (ACY-1215), or sulforaphane. 243. The method
of any one of embodiments 177 to 227, further comprising
administering to said patient an effective amount of a checkpoint
inhibitor. 244. The method of embodiment 243, wherein said
checkpoint inhibitor is an antibody specific for programmed cell
death protein 1 (PD-1), programmed death-ligand 1 (PD-L1), or
cytotoxic T-lymphocyte-associated protein 4 (CTLA-4). 245. The
method of embodiment 244, wherein said PD-1 antibody is
pembrolizumab (Keytruda.RTM.) or nivolumab (Opdivo.RTM.). 246. The
method of embodiment 244, wherein said CTLA-4 antibody is
ipilimumab (Yervoy.RTM.). 247. The method of any one of embodiments
177 to 227, further comprising administering to said patient an
effective amount of cancer vaccine. 248. The method of any one of
embodiments 177 to 247, wherein the patient is premenopausal. 249.
The method of embodiment 248, wherein the patient has locally
advanced or metastatic ER+/HER2- breast cancer. 250. The method of
embodiment 249, wherein the patient has progressed on her first
hormonal treatment while on a non-steroid aromatase inhibitor (AI),
fulvestrant, AI in combination with a CDK4/6 inhibitor, or
fulvestrant in combination with a CDK4/6 inhibitor. 251. The method
of any one of embodiments 177 to 247, wherein the patient is
perimenopausal. 252. The method of embodiment 251, wherein the
patient has locally advanced or metastatic ER+/HER2- breast cancer.
253. The method of embodiment 252, wherein the patient has
progressed on her first hormonal treatment while on a non-steroid
aromatase inhibitor (AI), fulvestrant, AI in combination with a
CDK4/6 inhibitor, or fulvestrant in combination with a CDK4/6
inhibitor. 254. The method of any one of embodiments 177 to 247,
wherein the patient is postmenopausal. 255. The method of
embodiment 254, wherein the patient has locally advanced or
metastatic ER+/HER2- breast cancer. 256. The method of embodiment
255, wherein the patient has progressed on her first hormonal
treatment while on a non-steroid aromatase inhibitor (AI),
fulvestrant, AI in combination with a CDK4/6 inhibitor, or
fulvestrant in combination with a CDK4/6 inhibitor.
6.6. Examples
[0192] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way. Efforts have been made to ensure
accuracy with respect to numbers used (e.g., amounts, temperatures,
etc.), but some experimental error and deviation should, of course,
be allowed for.
[0193] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of molecular biology,
cell biology, biochemistry, genetics, cancer biology, and
pharmacology, within the skill of the art. Such techniques are
explained fully in the literature.
6.6.1. Example 1: Efficacy of Lasofoxifene on ESR1 LBD
Mutations
[0194] 6.6.1.1. Methods
[0195] 6.6.1.1.1. Site-Directed Mutagenesis
[0196] ExSite mutagenesis was performed using the corresponding
primers as summarized in Table 1 below on a pENTR2B ER.alpha. WT
construct using Pfu ultra taq polymerase. The primers were PNK
phosphorylated. Following PCR amplification, the products were
digested with DpnI at 37.degree. C. for 1 hr, followed by overnight
ligation at 16.degree. C. Ligated products were transformed into
DH5.alpha. bacterial cells and grown on kanamycin resistant plates.
The pENTR clones were verified by sequencing and then swapped into
the pcDNA-DEST vector using the Gateway system (Invitrogen) for
expression analysis.
TABLE-US-00001 TABLE 1 Primers for Mutagenesis ER Y537N For
AATGACCTGCTGCTGGAGATG SEQ ID NO: 1 ER Y537N Rev
GAGGGGCACCACGTTCTTGCA SEQ ID NO: 2 ER Y537S For
GACCTGCTGCTGGAGATGCTG SEQ ID NO: 3 ER Y537S Rev
GCTGAGGGGCACCACGTTCTT SEQ ID NO: 4 ER Y537C For
TGTGACCTGCTGCTGGAGATG SEQ ID NO: 5 ER Y537C Rev
GCTGAGGGGCACCACGTTCTT SEQ ID NO: 6 ER D538G For
GGTCTGCTGCTGGAGATGCTG SEQ ID NO: 7 ER D538G Rev
ATAGAGGGGCACCACGTTCTT SEQ ID NO: 8
[0197] 6.6.1.1.2. Cell Culture
[0198] Caov2 ovarian carcinoma cells were grown in RPMI-1640 media
(Gibco) supplemented with 8% Fetal Bovine Serum (FBS), Sodium
Pyruvate (NaPyr) and non-essential amino acids (NEAA) and passaged
every 2-3 days. SKBR3 breast adenocarcinoma cells were grown in
DMEM media (Gibco) supplemented with 8% Fetal Bovine Serum (FBS),
Sodium Pyruvate (NaPyr) and non-essential amino acids (NEAA) and
passaged every 2-3 days. Cells were switched into a phenol-red free
RPMI-1640 media supplemented with 8% charcoal stripped fetal bovine
serum (CFS), NaPyr, and NEAA one day before plating for experiment.
Cells were then plated in 96-well plates for experiment in the
phenol red-free media an additional day before transfection.
[0199] 6.6.1.1.3. Reporter Gene Assay
[0200] Caov2 cells were co-transfected with the 7X-TK-ERE-TATA
luciferase reporter gene (Nagel et al., Endocrinology 142(11):
4721-4728 (2001)) and expression constructs for either wild-type or
mutant receptors using Fugene transfection reagent (Promega). SKBR3
cells were co-transfected with 3X-TK-ERE-TATA luciferase reporter
gene in the same conditions. pCMV-.beta.-gal was used as a control
for transfection efficiency and pcDNA was added for a final DNA
concentration of 75 ng per triplicate group. Cells were treated
with indicated ligand five hours post transfection. Following 24
hours of treatment, cells were lysed and the luciferase and
.beta.-gal assays were performed as described previously (Norris et
al., J Biol Chem 270(39): 22777-22782 (1995)) and the plates were
read on the Fusion .alpha.-FP HT plate reader (PerkinElmer Life
Sciences).
[0201] 6.6.1.2. Results
[0202] ER.alpha. expression constructs were engineered to express
one of four different ESR1 LBD mutations, Y537S, Y537N, Y537C, and
D538G, which are found in metastatic breast cancer patients. See
Jeselsohn et al., Nature Reviews Clinical Oncology 12(10): 573-583
(2015); Jeselsohn et al., Clinical Cancer Research 20(7): 1757-1767
(2014); Robinson et al., Nature Genetics 45(12): 1446-1451(2013);
Thomas and Gustafsson, Trends in Endocrinology and Metabolism
26(9): 467-476 (2015); and Toy et al., Nature Genetics 45(12):
1439-1445 (2013). The activity of these mutants was evaluated in a
reconstituted estrogen response element (ERE)-luciferase reporter
assay in Caov2 ovarian carcinoma cells and SKBR3 breast
adenocarcinoma cells. Data normalization is done in respect to the
"0" data point (no ligand) of the wild-type receptor. As previously
reported (Jeselsohn et al., 2014; Robinson et al., 2013; Toy et
al., 2013), all of the mutants studied exhibited substantial
constitutive activity when compared to the activity of wild-type
(WT) ER.alpha. in the absence of its ligand: 17-.beta. estradiol
(E2). While the WT ER.alpha. responds to E2 in a dose-response
matter, the transcriptional activity of the mutants is not
responsive to E2 activation (FIG. 1A and FIG. 2A).
[0203] The ability of lasofoxifene to inhibit the transcriptional
activity of the ER.alpha. mutants was next evaluated under the same
conditions. All inhibition curves were done in the presence of
10.sup.-9 (1 nM) 17-.beta. estradiol. Data normalization was done
in respect to the "0" data point (no lasofoxifene) for each
individual receptor. The plots include data from five independent
experiments and each value is an average of triplicates from each
experiment. Notably, lasofoxifene effectively inhibited the
transcriptional activity of all tested ER.alpha. LBD mutants in a
dose-response manner (FIG. 1B and FIG. 2B).
[0204] The transcriptional IC90 value of lasofoxifene was also
evaluated under the same conditions in Caov2 ovarian carcinoma
cells and SKBR3 breast adenocarcinoma cells. See Maximov et al.,
Current Clinical Pharmacology 8(2): 135-155 (2013). The
transcriptional IC90 value of lasofoxifene evaluated was compared
to the Cmax of these compounds in blood at doses used in prior
clinical trials and approved in Europe. See Assessment Report for
Fablyn, 2009 (EMA). The calculation included Cmax of lasofoxifene
at theoretical doses of 0.5 mg and 1 mg. The additional dose of
lasofoxifene (1 mg) was included to evaluate the potential clinical
efficacy of lasofoxifene at a higher concentration. See Gardner et
al., J Clin Pharmacol 46(1): 52-58 (2006). The results from Caov2
ovarian carcinoma cells and SKBR3 breast adenocarcinoma cells are
summarized in Table 2.
TABLE-US-00002 TABLE 2 Comparison of IC90 Values to Reported Cmax
Values Caov2 SKBR3 Reported Converted (M) Caov2 Ratio SKBR3 Ratio
Compound Cmax Cmax IC90 Cmax/IC90 IC90 Cmax/IC90 WT Lasofoxifene
(0.5 mg) 3.6 ng/mL 9.00E-09 6.68E-12 1346.8 3.30E-09 2.73
Lasofoxifene (1 mg) 6.43 ng/mL 1.55E-08 6.68E-12 2320.4 3.30E-09
4.69 Y537N Lasofoxifene (0.5 mg) 3.6 ng/mL 9.00E-09 7.45E-10 12.08
1.30E-08 0.69 Lasofoxifene (1 mg) 6.43 ng/mL 1.55E-08 7.45E-10 20.8
1.30E-08 1.19 Y537S Lasofoxifene (0.5 mg) 3.6 ng/mL 9.00E-09
1.22E-08 0.74 8.00E-09 1.13 Lasofoxifene (1 mg) 6.43 ng/mL 1.55E-08
1.22E-08 1.27 8.00E-09 1.94 Y537C Lasofoxifene (0.5 mg) 3.6 ng/mL
9.00E-09 2.04E-10 44.07 5.90E-09 1.53 Lasofoxifene (1 mg) 6.43
ng/mL 1.55E-08 2.04E-10 75.98 5.90E-09 2.63 D538G Lasofoxifene (0.5
mg) 3.6 ng/mL 9.00E-09 1.88E-09 4.80 7.10E-09 1.27 Lasofoxifene (1
mg) 6.43 ng/mL 1.55E-08 1.88E-09 8.24 7.10E-09 2.18
[0205] As expected, the WT receptor was the most responsive to
anti-estrogen treatment, with each of the mutants exhibiting
reduced response to the inhibitory actions of lasofoxifene.
Importantly, the pharmacology of each of the mutants was different,
which highlights the need to match patients with the most
appropriate drug. The data suggest that lasofoxifene at a dose of 1
mg is most effective for patients whose tumors express the
mutations in both ovarian and breast cancer settings.
6.6.2. Example 2: Efficacy of Lasofoxifene on ESR1 LBD Mutations
Y537S and D538G in Stable Transfectants
[0206] MCF7 estrogen receptor alpha positive (ER.sup.+) breast
cancer cells were engineered to stably express doxycycline
(DOX)-inducible hemagglutinin (HA)-tagged full length ER with
ligand binding domain mutations Y537S and D538G. The introduction
and expression of the mutants were confirmed by Sanger sequencing,
RNA-sequencing, and western blot.
[0207] The dose response studies were performed in full medium
conditions. Cells were treated with DOX for the induction of
HA-tagged mutated ER or with vehicle as control, and plated in
triplicate. Subsequently, on day 5, cell counting was performed
using the Celigo instrument with Hoechst dye staining to detect
nucleated live cells and propidium iodide to quantify dead cells.
Treatments included vehicle and increasing doses of lasofoxifene
starting from 10.sup.-12M with 10 fold increments up to 10.sup.-6
M. The efficacy of the treatment is inversely proportional to the
cell count.
[0208] The anti-estrogenic activity of lasofoxifene in a breast
cancer model of ER mutations Y537S and D538G identified in Example
1 was confirmed by the ability of lasofoxifene to overcome
resistance with increasing dose titration and kill the stably
transfected cells (FIG. 3A and FIG. 3B).
[0209] IC50 values were calculated using PRISM. The results are
summarized in Table 3.
TABLE-US-00003 TABLE 3 Comparison of IC50 Values in the Absence and
the Presence of DOX DOX No DOX (ESR Fold Treatment Allele (wt only)
mutation) Change Lasofoxifene Y537S 3.6E-10 4.1E-9 11.4
Lasofoxifene D538G 1E-10 1E-9 10
[0210] The results confirmed that lasofoxifene treatment is
effective on the Y537S and D538G mutations, although the Y537S and
D538G mutations require higher concentrations to overcome
resistance.
7. EQUIVALENTS AND INCORPORATION BY REFERENCE
[0211] While the invention has been particularly shown and
described with reference to a preferred embodiment and various
alternate embodiments, it will be understood by persons skilled in
the relevant art that various changes in form and details can be
made therein without departing from the spirit and scope of the
invention.
[0212] All references, issued patents and patent applications cited
within the body of the instant specification are hereby
incorporated by reference in their entirety, for all purposes.
Sequence CWU 1
1
8121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1aatgacctgc tgctggagat g 21221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2gaggggcacc acgttcttgc a 21321DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3gacctgctgc tggagatgct g
21421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4gctgaggggc accacgttct t 21521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5tgtgacctgc tgctggagat g 21621DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 6gctgaggggc accacgttct t
21721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7ggtctgctgc tggagatgct g 21821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8atagaggggc accacgttct t 21
* * * * *