U.S. patent application number 17/377514 was filed with the patent office on 2021-11-11 for genetic markers associated with response to crth2 receptor antagonists.
This patent application is currently assigned to Merck Sharp & Dohme Corp.. The applicant listed for this patent is Merck Sharp & Dohme Corp.. Invention is credited to Steven Greenberg, Zifang Guo, Joshua McElwee, Devan V. Mehrotra, Gregory J. Opiteck, Peggy H. Wong.
Application Number | 20210348235 17/377514 |
Document ID | / |
Family ID | 1000005725323 |
Filed Date | 2021-11-11 |
United States Patent
Application |
20210348235 |
Kind Code |
A1 |
Opiteck; Gregory J. ; et
al. |
November 11, 2021 |
GENETIC MARKERS ASSOCIATED WITH RESPONSE TO CRTH2 RECEPTOR
ANTAGONISTS
Abstract
The present invention provides genetic markers on human
chromosome 1 that are associated with a beneficial response to
CRTH2 receptor antagonists. These CRTH2 receptor antagonist
response markers are useful, inter alia, to identify patients who
are most likely to benefit from treatment with CRTH2 receptor
antagonist compositions and drug products, in methods of treating
patients having a disease susceptible to treatment with a CRTH2
receptor antagonist, and in methods for selecting the most
appropriate therapy for such patients.
Inventors: |
Opiteck; Gregory J.; (San
Diego, CA) ; Wong; Peggy H.; (Summit, NJ) ;
McElwee; Joshua; (Jamaica Plains, MA) ; Mehrotra;
Devan V.; (Lansdale, PA) ; Greenberg; Steven;
(East Hanover, NJ) ; Guo; Zifang; (Princeton,
NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Merck Sharp & Dohme Corp. |
Rahway |
NJ |
US |
|
|
Assignee: |
Merck Sharp & Dohme
Corp.
Rahway
NJ
|
Family ID: |
1000005725323 |
Appl. No.: |
17/377514 |
Filed: |
July 16, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15745926 |
Jan 18, 2018 |
11091806 |
|
|
PCT/US16/43234 |
Jul 21, 2016 |
|
|
|
17377514 |
|
|
|
|
62196128 |
Jul 23, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 45/06 20130101;
C12Q 1/6883 20130101; C12Q 2600/106 20130101; A61K 31/437 20130101;
A61K 31/47 20130101; C07D 215/14 20130101; C07D 471/04 20130101;
C12Q 2600/156 20130101 |
International
Class: |
C12Q 1/6883 20060101
C12Q001/6883; A61K 31/437 20060101 A61K031/437; A61K 31/47 20060101
A61K031/47; C07D 215/14 20060101 C07D215/14; C07D 471/04 20060101
C07D471/04; A61K 45/06 20060101 A61K045/06 |
Claims
1. A method of treating a patient with asthma comprising:
administering a therapeutically effective amount of
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)
-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetrahydropyrido[1,2-a]indol-10-y1}-acet-
ic acid or a pharmaceutically acceptable salt thereof to the
patient, wherein said patient, prior to the administration of the
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid or the pharmaceutically
acceptable salt thereof, has tested positive for at least one copy
of the G allele of rs12118655
2. (canceled)
3. A method of diagnosing in a patient who is susceptible to
treatment with
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-
-tetrahydropyrido[1,2-a]indo-10-y1}-acetic acid or a
pharmaceutically acceptable salt thereof and treating asthma, said
method comprising: (a) obtaining a biological sample from a human
patient; (b) detecting whether the G allele of rs12118655 is
present in the biological sample; (c) diagnosing the patient as
susceptible to treatment with
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid or the pharmaceutically
acceptable salt thereof when the presence of the G allele of
rs12118655 in the biological sample is detected; and (d)
administering a therapeutically effective amount of
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid or the pharmaceutically
acceptable salt thereof.
4. The method of claim 3, wherein step (d) further comprises
administering a leukotriene receptor antagonist to the patient.
5. (canceled)
6. The method of claim 4, wherein in step (d) the leukotriene
receptor antagonist is montelukast.
7-17. (canceled)
18. The method of claim 1, wherein montelukast is administered to
the patient in addition to
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid or the pharmaceutically
acceptable salt thereof.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to genetic markers on human
chromosome 1 that are predictive of a beneficial response to
therapy with CRTH2 receptor antagonists.
BACKGROUND OF THE INVENTION
[0002] Identification of any publication in this section or any
section of this application is not an admission that such
publication is prior art to the present invention.
[0003] Asthma is a highly prevalent disease associated with
significant morbidity and mortality, and accounting for high direct
and indirect healthcare expenditures. World Health Organization
(WHO) data currently estimate the prevalence of asthma to be 300
million individuals worldwide, with this number expected to
increase to 400 million by 2025. It is estimated that approximately
15 million disability adjusted life years are lost to asthma, and
one in 250 deaths is due to asthma. Masoli M, et al., for the
Global Initiative for Asthma (GINA) Program, Allergy 2004;
59:469-78. This high disease burden is in part due to patients who
are not well controlled on standard therapy. Bateman E D, et al.,
Am J Respir Crit Care Med 2004; 170:836-44. In addition, compliance
with standard inhaler therapy is relatively low. It is estimated
that 44.2% and 51.5% of patients who begin a combination and
concurrent inhalational therapy, respectively, do not renew their
initial prescription during the first year. Marceau C, et al., J
Allergy Clin Immunol 2006; 118:574-81. Alternative options to
inhalers include oral agents, such as montelukast and zileuton, as
well as methylxanthines such as aminophylline; however, these
agents are recognized to be less potent than inhaled agents.
Therefore, a need exists for new, well-tolerated oral therapies
that effectively treat asthma, either alone or in combination with
available therapies.
[0004] Chemoattractant Receptor-homologous molecule on Th2 cells
(CRTH2) is a G protein-coupled receptor for the prostaglandin D2
(PGD2) expressed on eosisnophils, basophils and Th2 cells. In
vitro, PGD2 and some of its CRTH2-selective metabolites can recruit
and activate these leukocytes by 1) stimulating the expression of
the surface protein CD11b which favors cell adhesion to the
vascular wall and transmigration of cells from the blood
circulation to the inflamed tissue and 2) stimulating cell movement
to the site of inflamation (chemotaxis). CRTH2 activation also
leads to the stimulation of Th2 cytokines release, such as IL-13
from the TH2 cells and to the stimulation of basophil and
eosinophil degranulation.
[0005] Existing pre-clinical and clinical data suggest that the
PGD2/CRTH2 pathway is fundamental to the recruitment and activation
of key pro-inflammatory leukocytes contributing to asthma. Shichijo
M, Arimura A, Hirano Y, et al. Clin Exp Allergy 2009 September;
39(9):1404-14; Lukacs N W, Berlin A A, Franz-Bacon K, et al. Am J
Physiol Lunch Cell Mol Physiol 2008:295:L767-79; Uller L, Mathiesen
J M, Alenmyr L, et al. Respir Res 2007; 8:161. In humans, a CRTH2
genetic polymorphism leading to increased CRTH2 mRNA stability is
significantly associated with asthma in two independent
populations. Huang J-L, Gao P-S, Mathias R A, Yao T-C, Chen L-C,
Kuo M-L, et al. Hum Mol Genet 2004; 13(21):2691-7. Ramatroban, a
dual TP/CRTH2 antagonist is reported to exhibit some degree of
efficacy in allergic rhinitis and is commericialized in Japan.
Ishizuka T, Matsui T, Okamoto Y, et al., Cardiovasc Drug Rev 2004;
22:71-90. Furthermore a recent Phase IIa clinical study conducted
in a patient population afflicted with eosinophilic severe asthma,
demonstrated reduction of sputum eosinophils in patients treated
with of the CRTH2 antagonist, fevipiprant. European Medical Journal
Respir. 2014; 2:50-57. Taken together, these findings are
consistent with a potentially important role for CRTH2 inhibition
in the treatment of asthma.
[0006] The therapeutic effect of CRTH2 receptor antagonists can
vary widely among patients afflicted with asthma. In order to
better target patients who might respond better to CRTH2 receptor
and thereby provide a better and more cost-effective treatments for
asthma, a need exists for a way of identifying patients who are
most likely to benefit through treatments wtih CRTH2 receptor
antagonists. This invention addresses that need.
SUMMARY OF THE INVENTION
[0007] The present invention is based on the discovery that genetic
polymorphisms such as single nucleotide polymorphisms (SNP) on
human chromosome 1 are significantly associated with response to
treatment with CRTH2 receptor antagonists in patients suffering
from a disorder associated with CRTH2 receptor function. The
genetic polymorphisms associated with response to CRTH2 receptor
antagonist therapy are referred to herein as the "CRTH2 antagonist
response markers."
[0008] One of these genetic polymorphisms is a SNP which is a C/T
polymorphism, identified as rs12748961 in the NCBI SNP Database.
The presence of the C allele is associated with a better treatment
response, with the C/C or C/T genotype associated with a 4.5-fold
better improvement in Forced Expiratory Volume in one second
(FEV.sub.1) in asthmatic patients. While the C allele is the minor
allele in Caucasians, since it is present at a substantially higher
frequency in a population of Asian ancestry than in the overall
population, the rs12748961 polymorphism may guide medical
practitioners, health authorities, and medical insurance providers
in selecting a suitable population of asthmatic patients which
might benefit from CRTH2 receptor antagonist therapy.
[0009] The inventors also identified associations between other
genetic polymorphisms on chromosome 1 with a beneficial response to
a CRTH2 receptor antagonist, e.g., improvements in FEV.sub.1 score
in asthmatic patients. The genetic polymorphisms associated with a
beneficial response to CRTH2 receptor antagonist therapy are
described in Table 1 below, wherein PS means polymorphic site
according to the SNP NCBI database and "-" in the second column
indicates that the variant represents a deletion or insertion
variant.
TABLE-US-00001 TABLE 1 CRTH2 Antagonist Response Markers
Polymorphic Better Site Response (PS) Alleles Allele rs12748961 T/C
C rs12118655 A/G G rs6679073 C/A A rs12564209 C/G G rs3805 T/G/A G
rs71633561 G/C C rs71970505 ATGCAGACTGT/-- -- rs12132270 C/T T
rs67625805 T/-- -- rs3747972 A/G* A rs11557080 G/A A rs71633563 C/T
T rs34848415 A/-- -- rs1891091 A/G* A *The NCBI database indicates
that rs3747972 and rs1891091 are RefSNP Alleles for the reverse
strands.
[0010] In Table 1, the designations of "-" as entries in columns 2,
indicate that the variant is a deletion or insertion variant. For
instance, in rs67625805, the alternate allele represents a deletion
of the T nucleotide at the corresponding position. As another
example, in rs71970505, a 11-residue nucleotide segment is absent
in one of the alleles, where as in the alternative allele, the
nucleotide segment ATGCAGACTGT is present at the corresponding
position of the nucleotide sequence.
[0011] The inventors herein contemplate that testing individuals
for the presence of at least one or more of the CRTH2 Antagonist
Response Markers in Table 1 will be useful in a variety of
pharmacogenetic products and methods that involve identifying
subjects most likely to respond to therapy for CRTH2 receptor
antagonists for disorders susceptible to treatment with CRTH2
receptor antagonists, and in helping physicians decide whether to
prescribe a CRTH2 receptor antagonist to a patient afflicted with
asthma. For instance, the inventors contemplate that testing
subjects for the presence of at least one copy of the C allele for
the rs12748961 SNP will be useful for such products and methods,
and in helping such physicians.
[0012] Accordingly, in embodiment no. 1, the invention provides
method of treating a patient with a disorder susceptible to
treatment with a CRTH2 receptor antagonist comprising:
[0013] administering a therapeutically effective amount of the
CRTH2 receptor antagonist to the patient,
[0014] wherein said patient, prior to the administration of the
CRTH2 receptor antagonist, has tested positive for at least one
copy of a better response allele selected from a CRTH2 receptor
antagonist marker selected from Table 1 above.
[0015] In a first aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the C allele of the rs12748961
SNP.
[0016] In a second aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the G allele of the rs12118655
SNP.
[0017] In a third aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the A allele of the rs6679073
SNP.
[0018] In a fourth aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the G allele of the rs12564209
SNP.
[0019] In a fifth aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the G allele of the rs3805
SNP.
[0020] In a sixth aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the C allele of the rs71633561
SNP.
[0021] In a seventh aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the deletion allele of the
rs71970505 SNP (indicated as "-" in the Better Response Allele
column of Table 1).
[0022] In an eighth aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the T allele of the rs12132270
SNP.
[0023] In a ninth aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the deletion allele of the
rs67625805 SNP (indicated as "-" in the Better Response Allele
column of Table 1).
[0024] In a tenth aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the A allele of the rs3747972
SNP.
[0025] In an eleventh aspect of embodiment no. 1, said patient,
prior to the administration of the CRTH2 receptor antagonist, has
tested positive for at least one copy of the A allele of the
rs11557080 SNP.
[0026] In a twelfth aspect of embodiment no. 1, said patient, prior
to the administration of the CRTH2 receptor antagonist, has tested
positive for at least one copy of the T allele of the rs71633563
SNP.
[0027] In a thirteenth aspect of embodiment no. 1, said patient,
prior to the administration of the CRTH2 receptor antagonist, has
tested positive for at least one copy of the deletion allele of the
rs34848415 SNP (indicated as "-" in the Better Response Allele
column of Table 1).
[0028] In a fourteenth aspect of embodiment no. 1, said patient,
prior to the administration of the CRTH2 receptor antagonist, has
tested positive for at least one copy of the A allele of the
rs1891091 SNP.
[0029] In a fifteenth aspect of embodiment no. 1 (including any one
of the first-fourteenth aspects), the method further comprises
administering a leukotriene antagonist such as montelukast,
zafilukast, or pranlukast to the patient. In a sixteenth aspect of
embodiment no. 1 (including any one of the first-fifteenth
aspects), the method further comprises administering montelukast to
the patient.
[0030] In embodiment no. 2, the invention provides a drug product
which comprises a pharmaceutical composition and prescribing
information,
[0031] wherein the pharmaceutical composition comprises a CRTH2
receptor antagonist and the prescribing information comprises a
pharmacogenetic indication,
[0032] wherein the pharmacogenetic indication comprises the
treatment of a disease susceptible to treatment with the CRTH2
receptor antagonist in patients who test positive for at least one
copy of a better response allele selected from a CRTH2 receptor
antagonist marker as set forth in Table 1 above.
[0033] In a first aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the C allele of the rs12748961
SNP.
[0034] In a second aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the G allele of the rs12118655
SNP.
[0035] In a third aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the A allele of the rs6679073
SNP.
[0036] In a fourth aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the G allele of the rs12564209
SNP.
[0037] In a fifth aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the G allele of the rs3805
SNP.
[0038] In a sixth aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the C allele of the rs71633561
SNP.
[0039] In a seventh aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the deletion allele of the
rs71970505 SNP.
[0040] In an eighth aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the T allele of the rs12132270
SNP.
[0041] In a ninth aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the deletion allele of the
rs67625805 SNP.
[0042] In a tenth aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the A allele of the rs3747972
SNP.
[0043] In an eleventh aspect of embodiment no. 2, the
pharmacogenetic indication comprises the treatment of a disease
susceptible to treatment with the CRTH2 receptor antagonist in
patients who test positive for at least one copy of the A allele of
the rs11557080 SNP.
[0044] In a twelfth aspect of embodiment no. 2, the pharmacogenetic
indication comprises the treatment of a disease susceptible to
treatment with the CRTH2 receptor antagonist in patients who test
positive for at least one copy of the T allele of the rs71633563
SNP.
[0045] In a thirteenth aspect of embodiment no. 2, the
pharmacogenetic indication comprises the treatment of a disease
susceptible to treatment with the CRTH2 receptor antagonist in
patients who test positive for at least one copy of the deletion
allele of the rs34848415 SNP.
[0046] In a fourteenth aspect of embodiment no. 2, the
pharmacogenetic indication comprises the treatment of a disease
susceptible to treatment with the CRTH2 receptor antagonist in
patients who test positive for at least one copy of the A allele of
the rs1891091 SNP.
[0047] In a fifteenth aspect of the drug product set forth in
embodiment no. 2 (including any one of the first-fourteenth
aspects), the drug product further comprises a leukotriene
antagonist such as montelukast, zafilukast, or pranlukast. In a
sixteenth aspect of embodiment no. 2 (including any one of the
first-fourteenth aspects) the drug product further comprises
montelukast.
[0048] In embodiment no. 3, the invention provides the use of a
CRTH2 receptor antagonist in the manufacture of a medicament for
treating a patient having a disease susceptible to treatment with a
CRTH2 receptor antagonist and a positive test for at least one copy
of the better response allele selected from a CRTH2 receptor
antagonist marker as set forth in Table 1 above.
[0049] In a first aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the C allele of the
rs12748961 SNP.
[0050] In a second aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the G allele of the
rs12118655 SNP.
[0051] In a third aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the A allele of the
rs6679073 SNP.
[0052] In a fourth aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the G allele of the
rs12564209 SNP.
[0053] In a fifth aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the G allele of the rs3805
SNP.
[0054] In a sixth aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the C allele of the
rs71633561 SNP.
[0055] In a seventh aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the deletion allele of the
rs71970505 SNP.
[0056] In an eighth aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the T allele of the
rs12132270 SNP.
[0057] In a ninth aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the deletion allele of the
rs67625805 SNP.
[0058] In a tenth aspect of embodiment no. 3, the patient has a
positive test for at least one copy of the A allele of the
rs3747972 SNP.
[0059] In an eleventh aspect of embodiment no. 3, the patient has a
positive test for least one copy of the A allele of the rs11557080
SNP.
[0060] In a twelfth aspect of embodiment no. 3, the patient has a
positive test for least one copy of the T allele of the rs71633563
SNP.
[0061] In a thirteenth aspect of embodiment no. 3, the patient has
a positive test for at least one copy of the deletion allele of the
rs34848415 SNP.
[0062] In a fourteenth aspect of embodiment no. 3, the patient has
a positive test for at least one copy of the A allele of the
rs1891091 SNP.
[0063] In embodiment no. 4, the invention provides a method of
selecting a therapy for treating a patient having a disease
susceptible to treatment with a CRTH2 receptor antagonist, in which
a patient's genotype at a polymorphic site selected from those set
forth in Table 1 is determined and reported, the method
comprising:
[0064] consulting the report to identify that the patient has at
least one copy of the better response allele of the CRTH2
antagonist response marker; and
[0065] based on that consultation, treating the patient with the
CRTH2 receptor antagonist.
[0066] In a first aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
C allele of the rs12748961 SNP.
[0067] In a second aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
G allele of the rs12118655 SNP.
[0068] In a third aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
A allele of the rs6679073 SNP.
[0069] In a fourth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
G allele of the rs12564209 SNP.
[0070] In a fifth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
G allele of the rs3805 SNP.
[0071] In a sixth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
C allele of the rs71633561 SNP.
[0072] In a seventh aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
deletion allele of the rs71970505 SNP.
[0073] In an eighth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
T allele of the rs12132270 SNP.
[0074] In a ninth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
deletion allele of the rs67625805 SNP.
[0075] In a tenth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
A allele of the rs3747972 SNP.
[0076] In an eleventh aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
A allele of the rs11557080 SNP.
[0077] In a twelfth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
T allele of the rs71633563 SNP.
[0078] In a thirteenth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one copy of the
deletion allele of the rs34848415 SNP.
[0079] In a fourteenth aspect of embodiment no. 4, the report is
consulted to identify that the patient has at least one of the A
allele of the rs1891091 SNP.
[0080] In embodiment no. 5, the invention provides a screening
method for selecting patients for treatment with a CRTH2 receptor
antagonist from a group of patients having a disorder susceptible
to treatment with the CRTH2 receptor antagonist, comprising testing
each member of the group for the presence of at least one copy of
the better response allele of a CRTH2 antagonist response marker
selected from those set forth in Table 1 above, wherein a positive
test is the presence of at least one copy of the better response
allele of the CRTH2 antagonist response marker.
[0081] In a first aspect of embodiment no. 5, each member of the
group is tested for the presence of at least one copy of the C
allele of the rs12748961 SNP, wherein a positive test is the
presence of at least one copy of the C allele of the rs12748961
SNP.
[0082] In a second aspect of embodiment no. 5, each member of the
group is tested for the presence of at least one copy of the G
allele of the rs12118655 SNP, wherein a positive test is the
presence of at least one copy of the G allele of the rs12118655
SNP.
[0083] In a third aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the A allele
of the rs6679073 SNP, wherein a positive test is the presence of at
least one copy of the A allele of the rs6679073 SNP.
[0084] In a fourth aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the G allele
of the rs12564209 SNP, wherein a positive test is the presence of
at least one copy of the G allele of the rs12564209 SNP.
[0085] In a fifth aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the G allele
of the rs3805 SNP, wherein a positive test is the presence of at
least one copy of the G allele of the rs3805 SNP.
[0086] In a sixth aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the C allele
of the rs71633561 SNP, wherein a positive test is the presence of
at least copy of the C allele of the rs71633561 SNP.
[0087] In a seventh aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the deletion
allele of the rs71970505 SNP, wherein a positive test is the
presence of at least one copy of the deletion allele of the
rs71970505 SNP.
[0088] In an eighth aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the T allele
of the rs12132270 SNP, wherein a positive test is the presence of
at least one copy of the T allele of the rs12132270 SNP.
[0089] In a ninth aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the deletion
allele of the rs67625805 SNP, wherein a positive test is the
presence of at least one copy of the deletion allele of the
rs67625805 SNP.
[0090] In a tenth aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the A allele
of the rs3747972 SNP, wherein a positive test is the presence of at
least one copy of the A allele of the rs3747972 SNP.
[0091] In an eleventh aspect of embodiment no. 5, each member of
the group is tested for the presence at least one copy of the A
allele of the rs11557080 SNP, wherein a positive test is the
presence of at least one copy of the A allele of the rs11557080
SNP.
[0092] In a twelfth aspect of embodiment no. 5, each member of the
group is tested for the presence at least one copy of the T allele
of the rs71633563 SNP, wherein a positive test is the presence of
at least one copy of the T allele of the rs71633563 SNP.
[0093] In a thirteenth aspect of embodiment no. 5, each member of
the group is tested for the presence at least one copy of the
deletion allele of the rs34848415 SNP, wherein a positive test is
the presence of at least one copy of the deletion allele of the
rs34848415 SNP.
[0094] In a fourteenth aspect of embodiment no. 5, each member of
the group is tested for the presence at least one copy of the A
allele of the rs1891091 SNP, wherein a positive test is the
presence of at least one copy of the A allele of the rs1891091
SNP.
[0095] In embodiment no. 6, the invention provides a kit for
testing a patient having a disease susceptible to treatment with a
CRTH2 receptor antagonist for the presence or absence of at least
one copy of the better response allele selected from one of the
CRTH2 antagonist response markers as set forth in Table 1 above,
which comprises a set of oligonucleotides designed to genotype at
least one of the CRTH2 antagonist response markers.
[0096] In a first aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs12748961 SNP.
[0097] In a second aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs12118655 SNP.
[0098] In a third aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs6679073 SNP.
[0099] In a fourth aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs12564209 SNP.
[0100] In a fifth aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs3805 SNP.
[0101] In a sixth aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs71633561 SNP.
[0102] In a seventh aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs71970505 SNP.
[0103] In an eighth aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs12132270 SNP.
[0104] In a ninth aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs67625805 SNP.
[0105] In a tenth aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs3747972 SNP.
[0106] In an eleventh aspect of embodiment no. 6, the at least one
of the CRTH2 antagonist response markers is the rs11557080 SNP.
[0107] In a twelfth aspect of embodiment no. 6, the at least one of
the CRTH2 antagonist response markers is the rs71633563 SNP.
[0108] In a thirteenth aspect of embodiment no. 6, the at least one
of the CRTH2 antagonist response markers is the rs34848415 SNP.
[0109] In a fourteenth aspect of embodiment no. 6, the at least one
of the CRTH2 antagonist response markers is the rs1891091 SNP.
[0110] In a fifteenth aspect of the kit of embodiment no. 6
(including any one of the first-fourteenth aspects), the
oligonucleotides are allele specific oligonucleotide (ASO) probes.
In specific aspects, the oligonucleotides are immobilized on a
solid surface.
[0111] In embodiment no. 7, the invention provides a method of
diagnosing a patient who is susceptible to treatment with a CRTH2
receptor antagonist and treating asthma, said method comprising:
[0112] (a) obtaining a biological sample (e.g., a blood sample such
as a plasma sample) from a human patient; [0113] (b) detecting
whether a better response allele of at least one of the CRTH2
receptor antagonist markers in the Table 1 above is present in the
blood sample; [0114] (c) diagnosing the patient as susceptible to
treatment with a CRTH2 receptor antagonist when the presence of the
better response allele in the blood sample is detected; and [0115]
(d) administering a therapeutically effective amount of a CRTH2
receptor antagonist to the diagnosed patient.
[0116] In one aspect of embodiment no. 7, wherein step (d) further
comprises administering a leukotriene receptor antagonist to the
patient. For example, the leukotriene receptor antagonist can be
montelukast or a pharmaceutically acceptable salt thereof.
[0117] In one aspect of embodiment no. 7, in step (b), the C allele
of the CRTH2 receptor antagonist response marker is rs12748961 SNP
is detected, and
[0118] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the C allele of the
rs12748961 SNP is detected.
[0119] In another aspect of embodiment no. 7, in step (b), the G
allele of the CRTH2 receptor antagonist response marker is
rs12118655 SNP is detected, and
[0120] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the G allele of the
rs12118655 SNP is detected.
[0121] In another aspect of embodiment no. 7, in step (b), the A
allele of the CRTH2 receptor antagonist response marker is
rs6679073 SNP is detected, and
[0122] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the A allele of the
rs6679073 SNP is detected.
[0123] In another aspect of embodiment no. 7, in step (b), the G
allele of the CRTH2 receptor antagonist response marker is
rs12564209 SNP is detected, and
[0124] step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the G allele of the
rs12564209 SNP is detected.
[0125] In another aspect of embodiment no. 7, in step (b), the G
allele of the CRTH2 receptor antagonist response marker is rs3805
SNP is detected, and
[0126] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the G allele of the
rs3805 SNP is detected.
[0127] In another aspect of embodiment no. 7, in step (b), the C
allele of the CRTH2 receptor antagonist response marker is
rs71633561 SNP is detected, and
[0128] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the C allele of the
rs71633561 SNP is detected.
[0129] In another aspect of embodiment no. 7, in step (b), the
deletion allele of the CRTH2 receptor antagonist response marker is
rs71970505 SNP is detected, and
[0130] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the deletion allele
of the rs71970505 SNP is detected.
[0131] In another aspect of embodiment no. 7, in step (b), the T
allele of the CRTH2 receptor antagonist response marker is
rs12132270 SNP is detected, and
[0132] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the T allele of the
rs12132270 SNP is detected.
[0133] In another aspect of embodiment no. 7, in step (b), the
deletion allele of the CRTH2 receptor antagonist response marker is
rs67625805 SNP is detected, and
[0134] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the deletion allele
of the rs67625805 SNP is detected.
[0135] In another aspect of embodiment no. 7, in step (b), the A
allele of the CRTH2 receptor antagonist response marker is
rs3747972 SNP is detected, and
[0136] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the A allele of the
rs3747972 SNP is detected.
[0137] In another aspect of embodiment no. 7, in step (b), the A
allele of the CRTH2 receptor antagonist response marker is
rs11557080 SNP is detected, and
[0138] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the A allele of the
rs11557080 SNP is detected.
[0139] In another aspect of embodiment no. 7, in step (b), the T
allele of the CRTH2 receptor antagonist response marker is
rs71633563 SNP is detected, and
[0140] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the T allele of the
rs71633563 SNP is detected.
[0141] In another aspect of embodiment no. 7, in step (b), the
deletion allele of the CRTH2 receptor antagonist response marker is
rs34848415 SNP is detected, and
[0142] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the deletion allele
of the rs34848415 SNP is detected.
[0143] In another aspect of embodiment no. 7, in step (b), the A
allele of the CRTH2 receptor antagonist response marker is
rs1891091 SNP is detected, and
[0144] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the A allele of the
rs34848415 SNP is detected.
[0145] In one aspect of embodiment no. 7, in step (d) the diagnosed
patient is administered an effective amount of the CRTH2 receptor
antagonist {(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H
-[1,2,3]triazol-1-y1]-6,7,8,9-tetrahydropyrido[1,2-a]indol-10-y1}-acetic
acid and the leukotriene receptor antagonist montelukast.
[0146] In one particular aspect of embodiment no. 7,
[0147] in step (b), the better response allele that is sought to be
detected is the C allele of the CRTH2 receptor antagonist response
marker is rs12748961 SNP;
[0148] in step (c), the patient is diagnosed as susceptible to
treatment with a CRTH2 receptor antagonist when the C allele of the
rs12748961 SNP is detected; and
[0149] in step (d), the diagnosed patient is administered an
effective amount of the CRTH2 receptor antagonist
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid and the leukotriene
receptor antagonist montelukast.
[0150] In embodiment no. 8, the invention provides for the (i)
method of embodiment no. 1, (ii) drug product of embodiment no. 2,
(iii) use of embodiment no. 3, (iv) method of embodiment no. 4, (v)
method of embodiment no. 5, a (vi) kit of embodiment no. 6, or a
method of embodiment no. 7; wherein the patient is susceptible to
treatment with a CRTH2 receptor antagonist has a positive test for
at least one copy of the better response allele for at least two of
the CRTH2 receptor antagonist markers in Table 1 above. For
example, in this embodiment, the patient susceptible to treatment
with a CRTH2 receptor antagonist is identified where patients have
both at least one copy of the C allele of the rs12748961 SNP and at
least one copy of the G allele of the rs12118655 SNP.
[0151] In certain embodiments of the methods, uses, drug products,
or kits described in the embodiments above, the CRTH2 receptor
antagonist is {(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H
-[1,2,3]triazol-1-y1]-6,7,8,9-tetrahydropyrido[1,2-a]indol-10-y1}-acetic
acid or
2-(2-methyl-1-(4-(methylsulfonyl)-2-(trifluoromethyl)benzyl)-1H-p-
yrrolo[2,3-b]pyridin-3-y1)acetic acid (fevipiprant), or a
pharmaceutically acceptable salt of either compound.
[0152] In certain embodiments of the methods, uses, drug products,
or kits described in the embodiments above, the disorder
susceptible to treatment with a CRTH2 receptor antagonist is
asthma.
BRIEF DESCRIPTION OF THE DRAWINGS
[0153] FIG. 1 shows reference nucleotide sequences for the CRTH2
antagonist response markers with the variant position indicated in
bold font in the NCBI SNP database as of Jun. 7, 2015.
[0154] FIG. 2 is graphical depiction of a study design used in
measuring the efficacy of patients treated with a CRTH2 receptor
antagonist and montelukast.
[0155] FIG. 3 illustrates the estimated mean within-patient
difference in FEV.sub.1 score improvement (mL) at Week 4 between a
combination of Compound A and montelukast vs. a combination of
placebo and montelukast in individuals who carry no copies of the C
allele (C=0) and in individuals who carry one or two copies of the
C allele (C=1+2) at rs12748961 from the clinical study summarized
in FIG. 2.
[0156] FIG. 4 shows the the minor allele (C) frequency for
rs12749861 overall and across different populations based on the
1000 Genomes data set.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0157] So that the invention may be more readily understood,
certain technical and scientific terms are specifically defined
below. Unless specifically defined elsewhere in this document, all
other technical and scientific terms used herein have the meaning
that would be commonly understood by one of ordinary skill in the
art to which this invention belongs when used in similar contexts
as used herein.
[0158] As used herein, including the appended claims, the singular
forms of words such as "a," "an," and "the," include their
corresponding plural references unless the context clearly dictates
otherwise.
[0159] "About" when used to modify a numerically defined parameter,
e.g., the dosage for a therapeutic agent discussed herein, or the
length of treatment time, means that the parameter may vary by as
much as 10% above or below the stated numerical value for that
parameter.
[0160] "Allele" is a particular form of a gene or other genetic
locus, distinguished from other forms by its particular nucleotide
sequence, the term allele also includes one of the alternative
polymorphisms (e.g., a SNP) found at a polymorphic site.
[0161] "Beneficial result" means a desired clinical result of
treatment with a CRTH2 receptor antagonist, including but not
limited to: alleviation of one or more disease symptoms,
diminishment of extent of disease (e.g., improvement in FEV.sub.1
in the context of the treatment of asthma), stabilized (i.e., not
worsening) state of disease, slowing of disease progression,
amelioration or palliation of a disease state, prolonging survival
(as compared to expected survival if not treated), relapse-free
survival, remission (whether partial or total) and cure (i.e.,
elimination of the disease).
[0162] "Better response allele" is the particular form of a gene or
other genetic locus, where if present in a patient, results in an
improved clinical measure (e.g., an improved FEV.sub.1 measure) as
compared to the measure in a patient where such form of the gene or
other genetic locus is absent.
[0163] "Consists essentially of" and variations such as "consist
essentially of" or "consisting essentially of" as used throughout
the specification and claims, indicate the inclusion of any recited
elements or group of elements, and the optional inclusion of other
elements, of similar or different nature than the recited elements,
which do not materially change the basic or novel properties of the
specified dosage regimen, method, or composition.
[0164] "Individual" or "animal" or "patient" or "mammal," is meant
any human subject, particularly a mammalian subject, for whom any
of the claimed compositions and methods is needed or may be
beneficial. In preferred embodiments, the individual is an adult
human, i.e., at least 18 years of age.
[0165] "Isolated" is typically used to reflect the purification
status of a biological molecule such as RNA, DNA, oligonucleotide,
or protein, and in such context means the molecule is substantially
free of other biological molecules such as nucleic acids, proteins,
lipids, carbohydrates, or other material such as cellular debris
and growth media. Generally, the term "isolated" is not intended to
refer to a complete absence of other biological molecules or
material or to an absence of water, buffers, or salts, unless they
are present in amounts that substantially interfere with the
methods of the present invention.
[0166] "Locus" refers to a location on a chromosome or DNA molecule
corresponding to a gene, a physical feature such as a polymorphic
site, or a location associated with a phenotypic feature.
[0167] "Nucleotide pair" is the set of two nucleotides (which may
be the same or different) found at a polymorphic site on the two
copies of a chromosome from an individual.
[0168] "Oligonucleotide" refers to a nucleic acid that is usually
between 5 and 100 contiguous bases in length, and most frequently
between 10-50, 10-40, 10-30, 10-25, 10-20, 15-50, 15-40, 15-30,
15-25, 15-20, 20-50, 20-40, 20-30 or 20-25 contiguous bases in
length. The sequence of an oligonucleotide can be designed to
specifically hybridize to any of the allelic forms of a locus; such
oligonucleotides are referred to as allele-specific probes. If the
locus is a PS comprising a SNP, the complementary allele for that
SNP can occur at any position within an allele-specific probe.
Other oligonucleotides useful in practicing the invention
specifically hybridize to a target region adjacent to a PS with
their 3' terminus located one to less than or equal to about 10
nucleotides from the PS, preferably about 5 nucleotides. Such
oligonucleotides hybridizing adjacent to a PS are useful in
polymerase-mediated primer extension methods and are referred to
herein as "primer-extension oligonucleotides". In a preferred
embodiment, the 3'-terminus of a primer-extension oligonucleotide
is a deoxynucleotide complementary to the nucleotide located
immediately adjacent to the PS.
[0169] "Pharmaceutically acceptable" refers to molecular entities
and compositions that are "generally regarded as safe"-e.g., that
are physiologically tolerable and do not typically produce an
allergic or similar untoward reaction, such as gastric upset and
the like, when administered to a human. In another embodiment, this
term refers to molecular entities and compositions approved by a
regulatory agency of the federal or a state government or listed in
the U.S. Pharmacopeia or another generally recognized pharmacopeia
for use in animals, and more particularly in humans.
[0170] "Polymorphic site" or "PS" refers to the position in a
genetic locus or gene at which a polymorphism is found, e.g.,
single nucleotide polymorphism (SNP), restriction fragment length
polymorphism (RFLP), variable number of tandem repeat (VNTR),
dinucleotide repeat, trinucleotide repeat, tetranucleotide repeat,
simple sequence repeat, insertion element such as Alu, and deletion
or insertion of one or more nucleotides. A PS is usually preceded
by and followed by highly conserved sequences in the population of
interest and thus the location of a PS is typically made in
reference to a consensus nucleic acid sequence of thirty to sixty
nucleotides that bracket the PS, which in the case of a SNP is
commonly referred to as the "SNP context sequence". The location of
the PS may also be identified by its location in a consensus or
reference sequence. The skilled artisan understands that the
location of a particular PS may not occur at precisely the same
position in a reference or context sequence in each individual in a
population of interest due to the presence of one or more
insertions or deletions in that individual as compared to the
consensus or reference sequence. Moreover, it is routine for the
skilled artisan to design robust, specific and accurate assays for
detecting the alternative alleles at a polymorphic site in any
given individual, when the skilled artisan is provided with the
identity of the alternative alleles at the PS to be detected and
one or both of a reference sequence or context sequence in which
the PS occurs. Thus, the skilled artisan will understand that
specifying the location of any PS described herein by reference to
a particular position in a reference or context sequence is merely
for convenience and that any specifically enumerated nucleotide
position literally includes whatever nucleotide position the same
PS is actually located at in the same locus in any individual being
tested for the presence or absence of a genetic marker of the
invention using any of the genotyping methods described herein or
other genotyping methods well-known in the art.
[0171] "Reference SNP" or "rs" number refers to an accession number
assigned to an individual SNP by the National Center for
Biotechnology Information (NCBI).
[0172] "Treat" or "Treating" means to administer a therapeutic
agent, such as a composition containing CRTH2 receptor antagonists
described herein, internally or externally to an individual in need
of the therapeutic agent. Individuals in need of the agent include
individuals who have been diagnosed as having, or at risk of
developing, a condition or disorder susceptible to treatment with
the agent, as well as individuals who have, or are at risk of
developing, one or more adverse effects of treatment with a first
therapeutic agent that are susceptible to alleviation with a second
therapeutic agent. Typically, the therapeutic agent is administered
in a therapeutically effective amount, which means an amount
effective to produce one or more beneficial results. The
therapeutically effective amount of a particular agent may vary
according to factors such as the disease state, age, and weight of
the patient being treated, and the sensitivity of the patient,
e.g., ability to respond, to the therapeutic agent. Whether a
beneficial or clinical result has been achieved can be assessed by
any clinical measurement typically used by physicians or other
skilled healthcare providers to assess the presence, severity or
progression status of the targeted disease, symptom or adverse
effect. Typically, a therapeutically effective amount of an agent
will result in an improvement in the relevant clinical
measurement(s) over the baseline status, or over the expected
status if not treated, of at least 5%, usually by at least 10%,
more usually at least 20%, most usually at least 30%, preferably at
least 40%, more preferably at least 50%, most preferably at least
60%, ideally at least 70%, more ideally at least 80%, and most
ideally at least 90%. For instance, in one embodiment wherein the
condition or disorder is asthma, a clinical measure of improvement
is an improvement in the FEV.sub.1 measure. While an embodiment of
the present invention (e.g., a treatment method or article of
manufacture) may not achieve the desired clinical benefit or result
in every patient, it should do so in a statistically significant
number of patients as determined by any statistical test known in
the art such as the Student's t-test, the chi.sup.2-test, the
U-test according to Mann and Whitney, the Kruskal-Wallis test
(H-test), Jonckheere-Terpstra-test and the Wilcoxon-test.
II. Utility of CRTH2 Antagonist Response Marker of the
Invention
[0173] The phenotypic effect of the response marker described
herein supports the use of this marker in a variety of commercial
applications, including but not limited to, clinical trials of
investigational or previously approved CRTH2 receptor antagonist
drugs in patients selected on the basis of the presence or absence
of this response marker, pharmaceutical compositions and drug
products comprising a CRTH2 receptor antagonist for treating
patients who have this response marker, diagnostic methods, and
pharmacogenetic treatment methods, which involve tailoring a
patient's drug therapy based on whether the patient has this
marker.
[0174] The utility of any of the commercial applications claimed
herein does not require that the correlation between the presence
of a response marker of the invention and the occurrence of the
desired response to the CRTH2 receptor antagonist be observed in
100% of the individuals that receive the CRTH2 receptor antagonist;
nor does it require a diagnostic method or kit to have a specific
degree of specificity or sensitivity in determining the presence or
absence of the response marker in every individual, nor does it
require that a diagnostic method claimed herein be 100% accurate in
predicting for every individual whether the individual is likely to
have a beneficial response to a CRTH2 receptor antagonist. Thus,
the inventors herein intend that the terms "determine",
"determining" and "predicting" should not be interpreted as
requiring a definite or certain result; instead these terms should
be construed as meaning that a claimed method provides an accurate
result for the majority of individuals, or that the result or
prediction for any given individual is more likely to be correct
than incorrect.
[0175] Preferably, the accuracy of the result provided by a
diagnostic method of the invention is one that a skilled artisan or
regulatory authority would consider suitable for the particular
application in which the method is used. Similarly, the utility of
the claimed drug products and treatment methods does not require
that they produce the claimed or desired effect in every
individual; all that is required is that a clinical practitioner,
when applying his or her professional judgment consistent with all
applicable norms, decides that the chance of achieving the claimed
effect of treating a given individual according to the claimed
method or with the claimed drug product is sufficiently high to
warrant prescribing the treatment or drug product.
A. Testing for a CRTH2 Antagonist Response Marker of the
Invention
[0176] The presence or absence of the CRTH2 antagonist response
markers may be detected by any of a variety of genotyping
techniques commonly used in the art. Typically, such genotyping
techniques employ one or more oligonucleotides that are
complementary to a region containing, or adjacent to, the PS of
interest. The sequence of an oligonucleotide used for genotyping a
particular PS of interest is typically designed based on a context
sequence for the PS.
[0177] The location, in a particular individual, of the polymorphic
site identified above is in a reference coding or genomic DNA
sequence surrounding the PS of interest or in one of the context
sequences described in Table 2 below, or their complementary
sequences.
TABLE-US-00002 TABLE 2 Context sequences for SNPs associated with
CRTH2 Receptor Antagonist Response SEQ PS Short Context
Sequences.sup.1 ID NO: rs12748961 CTCTTCACTATGTTGAAATTGGGTC 1
TTCTTCCCCAAAGATTGAAGAGAAT rs12118655 TCAGATGGGAAATATTGCAGGGGCT 2
TATGGTCTCCATCGCAACTACTCAC rs6679073 TTTTGAGACTGGCAAATGTTCTGCA 3
CCAGTATCTGCTCAATACTTTTGTG rs12564209 CAAAAGTCTTTAGGATAGTCTCTGG 4
TCACAGTAAGTGCTACGTAAGTGTT rs3805 TTTTTATACATGTTATTTTAGGGCA 5
AAGCTGAGTACTATACCCCCACACC rs71633561 GAGGTAGGAGAATCACTTGAACCCA 6
GGGTCAGAGGTTGTGGTGAGCCGAG rs71970505 AGTTTGCAAAGTAACCCATTTGGCC 7
and 14 AAGTCATACAACTCTAGAGGGACAA (-allele) rs12132270
CTCCTATCTCCATTTTACTCTTATG 8 CTACCCCCAGAATAGGTTTTCTGGA rs67625805
GGTGGTAATGTATATTTATCTTAAA 9 TTTTTTTTTTTTTTTGAGACGGAGT rs3747972
GCGGATCGCCTGAGATCAGGAGTTC 10 AGACCAGCCTGGCCAACATGGTGAA rs11557080
CGCAATGGTGTGATCTCAGCTCACT 11 CAACCTCTAACTCCCAGGTTCAAGC rs71633563
CTGCCTACAAAAGTATCAGGCAAGA 12 AGGCCTCACGTTAGATGAGATAGTA rs34848415
GGCAATAAGAGTGAAACTCCATCTC 13 AAAAAAAAAAAAAAAAAATCTATTT rs1891091
ACCTCCTCCCATAAATTGCAGAATC 15 ATTCCCTTCCTGCCCACTCTCAGTG
.sup.1Context sequence reported in NCBI SNP Database on June 23,
2016; indicates C or T indicates A or G; indicates A or C;
indicates C or G; indicates A/G/T; indicates C or G; indicates the
absence (-) or presence of ATGCAGACTGT; indicates C or T; indicates
the absence (-) or presence of T; indicates A or G; indicates A or
G; indicates C or T; indicates the absence (-) or presence of A,
and indicates A or G.
[0178] As recognized by the skilled artisan, nucleic acid samples
containing a particular PS may be complementary double stranded
molecules and thus reference to a particular site on the sense
strand refers as well to the corresponding site on the
complementary antisense strand. Similarly, reference to a
particular genotype obtained for a PS on both copies of one strand
of a chromosome is equivalent to the complementary genotype
obtained for the same PS on both copies of the other strand. By way
of example, a C/C genotype for the rs12748961 PS on the coding
strand for the gene is equivalent to a G/G genotype for that PS on
the noncoding strand.
[0179] The context sequences recited herein, as well as their
complementary sequence, may be used to design probes and primers
for genotyping the CRTH2 antagonist response markers in a nucleic
acid sample obtained from a human subject of interest using any of
a variety of methods well known in the art that permits the
determination of whether the individual has at least one copy for
the better response allele. Nucleic acid molecules utilized in such
methods generally include RNA, genomic DNA, or cDNA derived from
RNA.
[0180] Typically, genotyping methods involve assaying a nucleic
acid sample prepared from a biological sample obtained from the
individual to determine the identity of a nucleotide or nucleotide
pair present at one or more polymorphic sites of interest. Nucleic
acid samples may be prepared from virtually any biological sample.
For example, convenient samples include whole blood serum, semen,
saliva, tears, fecal matter, urine, sweat, buccal matter, skin and
hair. Somatic cells are preferred since they allow the
determination of the identity of both alleles present at the PS of
interest.
[0181] Nucleic acid samples may be prepared for analysis using any
technique known to those skilled in the art. Preferably, such
techniques result in the isolation of genomic DNA sufficiently pure
for determining the genotype for the desired polymorphic site(s) in
the nucleic acid molecule. To enhance the sensitivity and
specificity of that determination, it is frequently desirable to
amplify from the nucleic acid sample a target region containing the
PS to be genotyped. Nucleic acid isolation and amplification
techniques may be found, for example, in
[0182] Sambrook, et al., Molecular Cloning: A Laboratory Manual
(Cold Spring Harbor Laboratory, New York) (2001).
[0183] Any amplification technique known to those of skill in the
art may be used in practicing the present invention including, but
not limited to, polymerase chain reaction (PCR) techniques. PCR may
be carried out using materials and methods known to those of skill
in the art (See generally PCR Technology: Principals and
Applications for DNA Amplification (ed. H. A. Erlich, Freeman
Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and
Applications (eds. Innis, et al., Academic Press, San Diego,
Calif., 1990); Matilla et al., Nucleic Acids Res. 19: 4967 (1991);
Eckert et al., PCR Methods and Applications 1: 17 (1991); PCR (eds.
McPherson et al., IRL Press, Oxford); and U.S. Pat. No. 4,683,202.
Other suitable amplification methods include the ligase chain
reaction (LCR) (see Wu and Wallace, Genomics 4: 560 (1989) and
Landegren et al., Science 241: 1077 (1988)), transcription
amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86: 1173
(1989)), self-sustained sequence replication (Guatelli et al.,
Proc. Nat. Acad. Sci. USA, 87: 1874 (1990)); isothermal methods
(Walker et al., Proc. Natl. Acad. Sci. USA 89:392-6 (1992)); and
nucleic acid-based sequence amplification (NASBA).
[0184] The amplified target region is assayed to determine the
identity of at least one of the alleles present at a PS in the
target region. If both alleles of a locus are represented in the
amplified target, it will be readily appreciated by the skilled
artisan that only one allele will be detected at a PS in
individuals who are homozygous at that PS, while two different
alleles will be detected if the individual is heterozygous for that
PS.
[0185] The identity of the allele may be identified directly, known
as positive-type identification, or by inference, referred to as
negative-type identification. For example, where a SNP is known to
be guanine or cytosine in a reference population, a PS may be
positively determined to be either guanine or cytosine for an
individual homozygous at that site, or both guanine and cytosine,
if the individual is heterozygous at that site. Alternatively, the
PS may be negatively determined to be not guanine (and thus
cytosine/cytosine) or not cytosine (and thus guanine/guanine). In
either case, where it is determined that at least one copy of a
better response allele is present as set forth in Table 1, that
determination is deemed to be a positive test result for the better
response allele in the methods, uses, drug products, or kits
described herein.
[0186] Identifying the allele or pair of alleles (e.g., the two
nucleotides in case of a SNP) at a PS in a nucleic acid sample
obtained from an individual may be accomplished using any technique
known to those of skill in the art. Preferred techniques permit
rapid, accurate assaying of multiple PS with a minimum of sample
handling. Some examples of suitable techniques include, but are not
limited to, direct DNA sequencing of the amplified target region,
capillary electrophoresis, hybridization of allele-specific probes,
single-strand conformation polymorphism analysis, denaturing
gradient gel electrophoresis, temperature gradient electrophoresis,
mismatch detection; nucleic acid arrays, primer specific extension,
protein detection, and other techniques well known in the art. See,
for example, Sambrook, et al., Molecular Cloning: A Laboratory
Manual (Cold Spring Harbor Laboratory, New York) (2001); Ausubel,
et al., Current Protocols in Molecular Biology (John Wiley and
Sons, New York) (1997); Orita et al., Proc. Nat. Acad. Sci. USA 86,
2766-2770 (1989); Humphries et al., in MOLECULAR DIAGNOSIS OF
GENETIC DISEASES, Elles, ed., pp. 32 1-340, 1996; Wartell et al.,
Nucl. Acids Res. 18:2699-706 (1990); Hsu et al. (1994)
Carcinogenesis 15:1657-1662; Sheffield et al., Proc. Natl. Acad.
Sci. USA 86:232-6 (1989); Winter et al., Proc. Natl. Acad. Sci. USA
82:7575 (1985); Myers et al. (1985) Nature 313:495; Rosenbaum and
Reissner (1987) Biophys Chem. 265:12753; Modrich, Ann. Rev. Genet.
25:229-53 (1991); U.S. Pat. Nos. 6,300,063; 5,837,832; 5,459,039;
and HuSNP Mapping Assay, reagent kit and user manual, Affymetrix
Part No. 90094 (Affymetrix, Santa Clara, Calif.).
[0187] In preferred embodiments, the identity of the allele(s) at a
PS is determined using a polymerase-mediated primer extension
method. Several such methods have been described in the patent and
scientific literature and include the "Genetic Bit Analysis" method
(WO 92/15712) and the ligase/polymerase mediated genetic bit
analysis (U.S. Pat. No. 5,679,524. Related methods are disclosed in
WO 91/02087, WO 90/09455, WO 95/17676, and U.S. Pat. Nos. 5,302,509
and 5,945,283. Extended primers containing the complement of the
polymorphism may be detected by mass spectrometry as described in
U.S. Pat. No. 5,605,798.
[0188] Another primer extension method employs allele specific PCR
(Ruano, G. et al., Nucl. Acids Res. 17:8392 (1989); Ruano, G. et
al., Nucl. Acids Res. 19:6877-82 (1991); WO 93/22456; Turki et al.,
J. Gun. Invest. 95:1635-41 (1995)).
[0189] Yet another primer extension method for identifying and
analyzing polymorphisms utilizes single-base extension (SBE) of a
fluorescently-labeled primer coupled with fluorescence resonance
energy transfer (FRET) between the label of the added base and the
label of the primer. Typically, the method, such as that described
by Chen et al., Proc. Nat. Acad. Sci. 94:10756-61 (1997) uses a
locus-specific oligonucleotide primer labeled on the 5' terminus
with 5-carboxyfluorescein (FAM). This labeled primer is designed so
that the 3' end is immediately adjacent to the polymorphic site of
interest. The labeled primer is hybridized to the locus, and single
base extension of the labeled primer is performed with
fluorescently labeled dideoxyribonucleotides (ddNTPs) in
dye-terminator sequencing fashion, except that no
deoxyribonucleotides are present. An increase in fluorescence of
the added ddNTP in response to excitation at the wavelength of the
labeled primer is used to infer the identity of the added
nucleotide.
[0190] A preferred genotyping assay is a TaqMan.RTM. SNP Genotyping
Assay from Thermo Fisher Scientific, Waltham, Mass., USA, or an
assay having about the same reliability, accuracy and specificity.
In certain embodiments of such an assay, two allele-specific probes
are used to target a specific PS, with each probe having a distinct
fluorescent label bonded to it as well as a quencher molecule. In
addition, two allele-specific primers are used. Upon extension of
the DNA strand, the Taq DNA polymerase cleaves the fluorescent
label which cleavage results in fluorescence emissions which can be
detected.
[0191] In all of the above methods, the accuracy and specificity of
an assay designed to detect the identity of the allele(s) at any PS
is typically validated by performing the assay on DNA samples in
which the identity of the allele(s) at that PS is known.
Preferably, a sample representing each possible allele is included
in the validation process. For diploid loci such as those on
autosomal chromosomes, the validation samples will typically
include a sample that is homozygous for the major allele at the PS,
a sample that is homozygous for the minor allele at the PS, and a
sample that is heterozygous at that PS. These validation samples
are typically also included as controls when performing the assay
on a test sample (i.e., a sample in which the identity of the
allele(s) at the PS is unknown). The specificity of an assay may
also be confirmed by comparing the assay result for a test sample
with the result obtained for the same sample using a different type
of assay, such as by determining the sequence of an amplified
target region believed to contain the PS of interest and comparing
the determined sequence to context sequences accepted in the art,
such as the context sequences provided herein.
[0192] The length of the context sequence necessary to establish
that the correct genomic position is being assayed will vary based
on the uniqueness of the sequence in the target region (for
example, there may be one or more highly homologous sequences
located in other genomic regions). The skilled artisan can readily
determine an appropriate length for a context sequence for any PS
using known techniques such as BLASTing the context sequence
against publicly available sequence databases. For amplified target
regions, which provide a first level of specificity, examining the
context sequence of about 30 to 60 bases on each side of the PS in
known samples is typically sufficient to ensure that the assay
design is specific for the PS of interest. Occasionally, a
validated assay may fail to provide an unambiguous result for a
test sample. This is usually the result of the sample having DNA of
insufficient purity or quantity, and an unambiguous result is
usually obtained by repurifying or reisolating the DNA sample or by
assaying the sample using a different type of assay.
[0193] For detecting PS characterized by an insertion/deletion
variations, a number of assay techniques can be employed.
Insertion/deletion variants can be detected by Sanger sequencing
methods which employ di-deoxynucleosidetriphosphates. In some
embodiments, commercially available software packages such as
Mutation Surveyor.RTM. software available from SoftGenetics LLC,
State College, Pa., USA that can detect homozygous and heterozygous
insertion/deletion variants. In addition, the fragment analysis
method disclosed in Hjelm et al. in The Journal of Molecular
Diagnostics 12(5), pp 607-610 (2010) can be used to characterize
insertion and deletion variants.
[0194] Programs such as Variant Caller with Multinomial
Probabilistic Mode as disclosed in Scientific Reports, 3, 2161
(2013) and at http://emu.src.riken.jp/VCMM/ can be used to detect
insertion/deletion variants with high accuracy. Another method for
the detection of insertion/deletion variants is disclosed in Z.
Yhang et al., Nucleic Acids Research 43(9) 349 (2015), which relies
on amplicon labeling and automated capillary electrophoresis.
[0195] Further, in performing any of the methods described herein
that require determining the presence or absence of the CRTH2
antagonist response markers, such determination may be made by
consulting a data repository that contains sufficient information
on the patient's genetic composition to determine whether the
patient has the marker. Preferably, the data repository lists
whether the CRTH2 antagonist response markers are present and
absent in the individual. The data repository could include the
individual's patient records, a medical data card, a file (e.g., a
flat ASCII file) accessible by a computer or other electronic or
non-electronic media on which appropriate information or genetic
data can be stored. As used herein, a medical data card is a
portable storage device such as a magnetic data card, a smart card,
which has an on-board processing unit and which is sold by vendors
such as Siemens of Munich Germany, or a flash-memory card. If the
data repository is a file accessible by a computer; such files may
be located on various media, including: a server, a client, a hard
disk, a CD, a DVD, a personal digital assistant such as a smart
phone, a tape, a zip disk, the computer's internal ROM
(read-only-memory) or the internet or worldwide web. Other media
for the storage of files accessible by a computer will be obvious
to one skilled in the art.
[0196] The invention also contemplates that testing for the CRTH2
antagonist response markers may be determined by investigating
whether the individual has an allele, e.g., a particulare
nucleotide sequence, at a different locus that is in high linkage
disequilibrium (LD) with the better response allele for the
rs12748961 SNP or one of the other CRTH2 antagonist response
markers identified in Table 1 above. Two particular alleles at
different loci on the same chromosome are said to be in LD if the
presence of one of the alleles at one locus tends to predict the
presence of the other allele at the other locus. Such variants,
which are referred to herein as linked variants, or proxy variants,
may be any type of variant (e.g., a SNP, insertion or deletion
variant) that is in high LD with the better response allele of
interest.
[0197] Linked variants are readily identified by determining the
degree of linkage disequilibrium (LD) between the better response
allele of the rs12748961 SNP, for example, and a candidate linked
allele. The candidate linked variant may be an allele of a
polymorphism that is currently known. Other candidate linked
variants may be readily identified by the skilled artisan using any
technique well-known in the art for discovering polymorphisms.
[0198] The degree of LD between a better response allele in one of
the CRTH2 antagonist response markers, e.g., the rs12748961 SNP,
and a candidate linked variant may be determined using any LD
measurement known in the art. LD patterns in genomic regions are
readily determined empirically in appropriately chosen samples
using various techniques known in the art for determining whether
any two alleles (e.g., between nucleotides at different PSs) are in
linkage disequilibrium (see, e.g., GENETIC DATA ANALYSIS II, Weir,
Sineuer Associates, Inc. Publishers, Sunderland, Mass. 1996). The
skilled artisan may readily select which method of determining LD
will be best suited for a particular population sample size and
genomic region. One of the most frequently used measures of linkage
disequilibrium is r.sup.2, which is calculated using the formula
described by Devlin et al. (Genomics, 29(2):311-22 (1995)). r.sup.2
is the measure of how well an allele X at a first locus predicts
the occurrence of an allele Y at a second locus on the same
chromosome. The measure only reaches 1.0 when the prediction is
perfect (e.g., X if and only if Y).
[0199] In one embodiment, the locus of the linked variant is in a
genomic region of about 100 kilobases, more preferably about 10 kb
that spans any of the PS of the rs12748961 SNP. Other linked
variants are those in which the LD with the better response allele
has a r.sup.2 value, as measured in a suitable reference
population, of at least 0.75, more preferably at least 0.80, even
more preferably at least 0.85 or at least 0.90, yet more preferably
at least 0.95, and most preferably 1.0. The reference population
used for this r.sup.2 measurement may be the general population, a
population using the CRTH2 receptor antagonist, a population
diagnosed with a particular condition for which the CRTH2 receptor
antagonist shows efficacy or a population whose members are
self-identified as belonging to the same ethnic group, such as
Caucasian, African American, Hispanic, Latino, Native American and
the like, or any combination of these categories. Preferably the
reference population reflects the genetic diversity of the
population of patients to be treated with a CRTH2 receptor
antagonist.
[0200] In some embodiments such as the r2 in reported in Table 6 in
Example 2, the r2 is the Pearson correlation coefficient squared,
where the Pearson correlation coefficient is calculated from the
genotype data (numerically coded as 0, 1, 2 being the number of
minor alleles of each variant for each subject) between each
variant and rs12748961. r2 ranges from 0 to 1, with 1 representing
two perfectly correlated variants and 0 representing two
independent variants (based on the analysis dataset).
[0201] In some embodiments, a physician determines whether a
patient has the CRTH2 receptor antagonist response marker described
herein by ordering a diagnostic test, which is designed to
determine whether the patient has at least one copy of the better
response allele of one of the CRTH2 antagonist response markers in
Table 1, e.g., the rs12748961 SNP. Preferably the test determines
the identity of both alleles, i.e., the genotype, at this PS. In
some embodiments, the testing laboratory will prepare a nucleic
acid sample from a biological sample (such as a blood sample or
buccal swab) obtained from the patient. In some embodiments, a
blood sample from the patient is drawn by the physician or a member
of the physician's staff, or by a technician at a diagnostic
laboratory. In some embodiments, the patient is provided with a kit
for taking a buccal swab from the inside of her cheek, which the
patient then gives to the physician's staff member or sends
directly to the diagnostic laboratory.
[0202] In some embodiments, the testing laboratory does not know
the identity of the individual whose sample it is testing; i.e.,
the sample received by the laboratory is made anonymous in some
manner before being sent to the laboratory. For example, the sample
may be merely identified by a number or some other code (a "sample
ID") and the results of the diagnostic method can be reported to
the party ordering the test using the sample ID.
[0203] In some embodiments, after the test results have been
obtained, the testing laboratory generates a test report which
indicates whether the better response allele is present or absent
at the genotyped polymorphic site, and preferably indicates whether
the patient is heterozygous or homozygous for the better response
allele. In some embodiments, the test report is a written document
prepared by the testing laboratory and sent to the patient or the
patient's physician as a hard copy or via electronic mail. In other
embodiments, the test report is generated by a computer program and
displayed on a video monitor in the physician's office. The test
report may also comprise an oral transmission of the test results
directly to the patient or the patient's physician or an authorized
employee in the physician's office. Similarly, the test report may
comprise a record of the test results that the physician makes in
the patient's file.
[0204] In one embodiment, if the patient tests positive for at
least one copy of the better response allele, then the test report
further indicates that the patient tested positive for a genetic
marker associated with a likely response to treatment with a CRTH2
antagonist, while if the individual tests negative for the better
response allele, then the test report further indicates that the
patient tested negative for a genetic marker associated with a
likely response to treatment with a CRTH2 antagonist.
[0205] Typically, the individual would be tested for the presence
of a CRTH2 receptor antagonist response marker prior to initiation
of the CRTH2 receptor antagonist therapy, but it is envisioned that
such testing could be performed at any time after the individual is
administered the first dose of a CRTH2 receptor antagonist. For
example, the treating physician may be concerned that the patient
has not responded adequately and desires to test the individual to
determine whether continued treatment with the CRTH2 receptor
antagonist is warranted. In some embodiments, a physician may
determine whether or not an individual should be tested for a CRTH2
receptor antagonist response marker. For example, the physician may
be considering whether to prescribe for the patient a
pharmaceutical product that is indicated for patients who test
positive for the CRTH2 receptor antagonist response marker.
[0206] In deciding how to use the CRTH2 receptor antagonist
response marker test results in treating any individual patient,
the physician may also take into account other relevant
circumstances, such as the disease or condition to be treated, the
age, weight, gender, genetic background and race of the patient,
including inputting a combination of these factors and the genetic
marker test results into a model that helps guide the physician in
choosing a therapy and/or treatment regimen with that therapy.
[0207] Detecting the presence or absence of any of the CRTH2
receptor antagonist response markers may be performed using a kit
that has been specially designed for this purpose. In one
embodiment, a kit of the invention comprises a set of
oligonucleotides designed for identifying each of the alleles at
the PS, e.g., in rs12748961.
[0208] In some embodiments, the oligonucleotides in the kit are
either allele-specific probes or allele-specific primers. In other
embodiments, the kit comprises primer-extension oligonucleotides.
In still further embodiments, the set of oligonucleotides is a
combination of allele-specific probes, allele-specific primers and
primer-extension oligonucleotides. The kit may comprise
oligonucleotides designed for detecting the presence of other
genetic markers associated with response to CRTH2 receptor
antagonist therapy.
[0209] Oligonucleotides in kits of the invention must be capable of
specifically hybridizing to a target region of a polynucleotide. As
used herein, specific hybridization means the oligonucleotide forms
an anti-parallel double-stranded structure with the target region
under certain hybridizing conditions, while failing to form such a
structure with non-target regions when incubated with the
polynucleotide under the same hybridizing conditions. In some
embodiments, the target region contains the PS of interest, while
in other embodiments, the target region is located one to 10
nucleotides adjacent to the PS.
[0210] The composition and length of each oligonucleotide in the
kit will depend on the nature of the genomic region containing the
PS as well as the type of assay to be performed with the
oligonucleotide and is readily determined by the skilled
artisan.
[0211] For example, the polynucleotide to be used in the assay may
constitute an amplification product, and thus the required
specificity of the oligonucleotide is with respect to hybridization
to the target region in the amplification product rather than in
genomic or cDNA isolated from the individual. As another example,
if the kit is designed to genotype two or more polymorphic sites
simultaneously, the melting temperatures for the oligonucleotides
for each PS in the kit will typically be within a narrow range,
preferably less than about 5.degree. C. and more preferably less
than about 2.degree. C.
[0212] In some embodiments, each oligonucleotide in the kit is a
perfect complement of its target region. An oligonucleotide is said
to be a "perfect" or "complete" complement of another nucleic acid
molecule if every nucleotide of one of the molecules is
complementary to the nucleotide at the corresponding position of
the other molecule. While perfectly complementary oligonucleotides
are preferred for detecting polymorphisms, departures from complete
complementarity are contemplated where such departures do not
prevent the molecule from specifically hybridizing to the target
region as defined above. For example, an oligonucleotide primer may
have a non-complementary fragment at its 5' end, with the remainder
of the primer being completely complementary to the target region.
Alternatively, non-complementary nucleotides may be interspersed
into the probe or primer as long as the resulting probe or primer
is still capable of specifically hybridizing to the target
region.
[0213] In some preferred embodiments, each oligonucleotide in the
kit specifically hybridizes to its target region under stringent
hybridization conditions. Stringent hybridization conditions are
sequence-dependent and vary depending on the circumstances.
Generally, stringent conditions are selected to be about 5.degree.
C. lower than the thermal melting point (Tm) for the specific
sequence at a defined ionic strength and pH. The Tm is the
temperature (under defined ionic strength, pH, and nucleic acid
concentration) at which 50% of the probes complementary to the
target sequence hybridize to the target sequence at equilibrium. As
the target sequences are generally present in excess, at Tm, 50% of
the probes are occupied at equilibrium.
[0214] Typically, stringent conditions include a salt concentration
of at least about 0.01 to 1.0 M sodium ion concentration (or other
salts) at pH 7.0 to 8.3 and the temperature is at least about
25.degree. C. for short oligonucleotide probes (e.g., 10 to 50
nucleotides). Stringent conditions can also be achieved with the
addition of destabilizing agents such as formamide. For example,
conditions of 5.times.SSPE (750 mM NaCl, 50 mM NaPhosphate, 5 mM
EDTA, pH 7.4) and a temperature of 25-30.degree. C. are suitable
for allele-specific probe hybridizations. Additional stringent
conditions can be found in Molecular Cloning: A Laboratory Manual,
Sambrook et al., Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
(1989), chapters 7, 9, and 11, and in NUCLEIC ACID HYBRIDIZATION, A
PRACTICAL APPROACH, Haymes et al., IRL Press, Washington, D.C.,
1985.
[0215] One non-limiting example of stringent hybridization
conditions includes hybridization in 4.times. sodium
chloride/sodium citrate (SSC), at about 65-70.degree. C. (or
alternatively hybridization in 4.times. SSC plus 50% formamide at
about 42-50.degree. C.) followed by one or more washes in 1.times.
SSC, at about 65-70.degree. C. A non-limiting example of highly
stringent hybridization conditions includes hybridization in
1.times. SSC, at about 65-70.degree. C. (or alternatively
hybridization in 1.times. SSC plus 50% formamide at about
42-50.degree. C.) followed by one or more washes in 0.3.times. SSC,
at about 65-70.degree. C. A non-limiting example of reduced
stringency hybridization conditions includes hybridization in
4.times. SSC, at about 50-60.degree. C. (or alternatively
hybridization in 6.times. SSC plus 50% formamide at about
40-45.degree. C.) followed by one or more washes in 2.times. SSC,
at about 50-60.degree. C. Stringency conditions with ranges
intermediate to the above-recited values, e.g., at 65-70.degree. C.
or at 42-50.degree. C. are also intended to be encompassed by the
present invention. SSPE (1.times.SSPE is 0.15M NaCl, 10 mM
NaH.sub.2PO.sub.4, and 1.25 mM EDTA, pH 7.4) can be substituted for
SSC (1.times. SSC is 0.15M NaCl and 15 mM sodium citrate) in the
hybridization and wash buffers; washes are performed for 15 minutes
each after hybridization is complete.
[0216] The hybridization temperature for hybrids anticipated to be
less than 50 base pairs in length should be 5-10.degree. C. less
than the melting temperature (Tm) of the hybrid, where Tm is
determined according to the following equations. For hybrids less
than 18 base pairs in length, Tm (.degree. C.)=2(# of A+T
bases)+4(# of G+C bases). For hybrids between 18 and 49 base pairs
in length, Tm (.degree. C.)=81.5+16.6(log.sub.10[Na.sup.+])+0.41(%
G+C)-(600/N), where N is the number of bases in the hybrid, and
[Na.sup.+] is the concentration of sodium ions in the hybridization
buffer ([Na.sup.+] for 1.times. SSC=0.165 M).
[0217] The oligonucleotides in kits of the invention may be
comprised of any phosphorylation state of ribonucleotides,
deoxyribonucleotides, and acyclic nucleotide derivatives, and other
functionally equivalent derivatives. Alternatively, the
oligonucleotides may have a phosphate-free backbone, which may be
comprised of linkages such as carboxymethyl, acetamidate,
carbamate, polyamide (peptide nucleic acid (PNA)) and the like
(Varma, in MOLECULAR BIOLOGY AND BIOTECHNOLOGY, A COMPREHENSIVE
DESK REFERENCE, Meyers, ed., pp. 6 17-20, VCH Publishers, Inc.,
1995). The oligonucleotides may be prepared by chemical synthesis
using any suitable methodology known in the art, or may be derived
from a biological sample, for example, by restriction digestion.
The oligonucleotides may contain a detectable label, according to
any technique known in the art, including use of radiolabels,
fluorescent labels, enzymatic labels, proteins, haptens,
antibodies, sequence tags and the like. The oligonucleotides in the
kit may be manufactured and marketed as analyte specific reagents
(ASRs) or may constitute components of an approved diagnostic
device.
[0218] In some embodiments, the set of oligonucleotides in the kit
have different labels to allow simultaneous determination of the
identity of the alleles at two or more polymorphic sites. The
oligonucleotides may also comprise an ordered array of
oligonucleotides immobilized on a solid surface such as a
microchip, silica beads (such as BeadArray technology from
Illumina, San Diego, Calif.), or a glass slide (see, e.g., WO
98/20020 and WO 98/20019). Kits comprising such immobilized
oligonucleotides may be designed to perform a variety of
polymorphism detection assays, including but not limited to probe
hybridization and polymerase extension assays.
[0219] Kits of the invention may also contain other reagents such
as hybridization buffer (e.g., where the oligonucleotides are to be
used as allele-specific probes) or dideoxynucleotide triphosphates
(ddNTPs; e.g., where the alleles at the polymorphic sites are to be
detected by primer extension). Kits designed for use in
polymerase-mediated genotyping assays, may also contain a
polymerase and a reaction buffer optimized for the
polymerase-mediated assay to be performed.
[0220] Kits of the invention may also include reagents to detect
when a specific hybridization has occurred or a specific
polymerase-mediated extension has occurred. Such detection reagents
may include biotin-or fluorescent-tagged oligonucleotides or ddNTPs
and/or an enzyme-labeled antibody and one or more substrates that
generate a detectable signal when acted on by the enzyme.
[0221] It will be understood by the skilled artisan that the set of
oligonucleotides and reagents for performing the assay will be
provided in separate receptacles placed in the kit container if
appropriate to preserve biological or chemical activity and enable
proper use in the assay.
[0222] In other embodiments, each of the oligonucleotides and all
other reagents in the kit have been quality tested for optimal
performance in an assay designed to determine the genotype for at
least one or more of the PS in Table 1 above, e.g., for the
rs12748961 SNP. In some embodiments, the kit includes an
instruction manual that describes how to use the determined
genotype to assign, to the tested nucleic acid sample, the presence
or absence of a response marker.
[0223] In some preferred embodiments, the set of oligonucleotides
in the kit are allele-specific oligonucleotides. As used herein,
the term allele-specific oligonucleotide (ASO) means an
oligonucleotide that is able, under sufficiently stringent
conditions, to hybridize specifically to one allele of a PS, at a
target region containing the PS while not hybridizing to the same
region containing a different allele. As understood by the skilled
artisan, allele-specificity will depend upon a variety of readily
optimized stringency conditions, including salt and formamide
concentrations, as well as temperatures for both the hybridization
and washing steps.
[0224] Examples of hybridization and washing conditions typically
used for ASO probes and primers are found in Kogan et al., "Genetic
Prediction of Hemophilia A" in PCR PROTOCOLS, A GUIDE TO METHODS
AND APPLICATIONS, Academic Press, 1990, and Ruaflo et al., Proc.
Nati. Acad. Sci. USA 87:6296-300 (1990).
[0225] Typically, an ASO will be perfectly complementary to one
allele while containing a single mismatch for the other allele. In
ASO probes, the single mismatch is preferably within a central
position of the oligonucleotide probe as it aligns with the
polymorphic site in the target region (e.g., approximately the 7th
or 8th position in a 15mer, the 8th or 9th position in a 16mer, and
the 10th or 11th position in a 20mer). The single mismatch in ASO
primers is located at the 3' terminal nucleotide, or preferably at
the 3' penultimate nucleotide. ASO probes and primers hybridizing
to either the coding or noncoding strand are contemplated by the
invention.
[0226] In some embodiments, the kit comprises a pair of
allele-specific oligonucleotides for each PS to be assayed, with
one member of the pair being specific for one allele (e.g., the
better response allele) and the other member being specific for the
other allele. In such embodiments, the oligonucleotides in the pair
may have different lengths or have different detectable labels to
allow the user of the kit to determine the genotype for the assayed
PS.
[0227] In still other preferred embodiments, the oligonucleotides
in the kit are primer-extension oligonucleotides. Termination mixes
for polymerase-mediated extension from any of these
oligonucleotides are chosen to terminate extension of the
oligonucleotide at the PS of interest, or one base thereafter,
depending on the alternative nucleotides present at the PS.
[0228] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping at least one of the
polymorphic sites in Table 1. In one embodiment, one ASO probe in
the pair comprises a nucleotide sequence of at least 15 nucleotides
that is identical to or perfectly complementary to the better
response allele of the context sequence shown in Table 2 and the
other ASO probe in the pair comprises a nucleotide sequence of at
least 15 nucleotides that is identical to or perfectly
complementary to the other allele of the context sequence shown in
Table 2.
[0229] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs12748961 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs12748961 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs12748961 SNP.
[0230] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs12118655 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs12118655 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs12118655 SNP.
[0231] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs6679073 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs6679073 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the rs6679073
SNP.
[0232] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs12564209 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs12564209 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs12564209 SNP.
[0233] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs3805 SNP. In
one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the rs3805
SNP and the other ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the other allele of the the rs3805
SNP.
[0234] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs71633561 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs71633561 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs71633561 SNP.
[0235] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs71970505 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs71970505 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs71970505 SNP.
[0236] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs12132270 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs12132270SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs12132270 SNP.
[0237] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs67625805 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs67625805 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs67625805 SNP.
[0238] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs3747972 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs3747972 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the rs3747972
SNP.
[0239] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs11557080 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs11557080 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs11557080 SNP.
[0240] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs71633563 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs71633563 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs71633563 SNP.
[0241] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs34848415 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs34848415 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the
rs34848415 SNP.
[0242] In another embodiment, the kit comprises a pair of allele
specific oligonucleotide probes for genotyping the rs1891091 SNP.
In one embodiment, one ASO probe in the pair comprises a nucleotide
sequence of at least 15 nucleotides that is identical to or
perfectly complementary to the better response allele of the
rs1891091 SNP and the other ASO probe in the pair comprises a
nucleotide sequence of at least 15 nucleotides that is identical to
or perfectly complementary to the other allele of the the rs1891091
SNP.
B. Pharmaceutical Compositions, Drug Products and Treatment
Regimens
[0243] An individual to be tested in, or treated by, any of the
methods and products described herein is a human subject in need of
treatment with a CRTH2 receptor antagonist. In some embodiments,
the individual has been diagnosed with, or exhibits a symptom of, a
disease susceptible to treatment with a CRTH2 receptor antagonist.
In other embodiments, the CRTH2 receptor antagonist drug to be used
has been approved for use in treating an indication with which the
individual has been diagnosed.
[0244] In some embodiments, the CRTH2 receptor antagonist used in
the pharmaceutical compositions, drug products, kits methods, and
uses of the present invention may be any known CRTH2 receptor
antagonist.
[0245] In one embodiment, the CRTH2 receptor antagonist is the
compound of the formula I as disclosed in U.S. Pat. No. 8,394,819,
the disclosure of which is hereby incorporated by reference as if
fully set forth herein. This patent discloses a compound of formula
I
##STR00001##
or a pharmaceutically acceptable salt thereof, wherein:
##STR00002##
represents either
##STR00003##
Y.sub.1 is selected from optionally substituted aryl and
--C(R.sub.2)(R.sub.3)(R.sub.4); Y.sub.2 is selected from H and
--C.sub.1-6alkyl; Z is selected from H and --C.sub.1-6alkyl;
R.sub.1a and R.sub.1b are independently selected from H, halogen,
--OC.sub.1-6alkyl, --O-haloC.sub.1-6alkyl, --C.sub.1-6alkyl,
haloC.sub.1-6alkyl, optionally substituted aryl and
--(C.sub.1-3alkylene)-optionally substituted aryl; R.sub.2 is
selected from H; --C.sub.1-6alkyl optionally substituted with
halogen, --OH or --NHSO.sub.2CH.sub.3; --OH; --OC.sub.1-6alkyl;
--S(O).sub.nC.sub.1-6alkyl; --CN; optionally substituted aryl;
optionally substituted --O-aryl and optionally substituted
heteroaryl, wherein n is 0, 1 or 2; R.sub.3 is selected from H,
--C.sub.1-6alkyl, C.sub.1-6haloalkyl, optionally substituted aryl
and optionally substituted heteroaryl; and R.sub.4 is selected from
H, --C.sub.1-6alkyl, C.sub.1-6haloalkyl, optionally substituted
aryl and optionally substituted heteroaryl; or R.sub.3, R.sub.4 and
the carbon atom to which they are attached together form
--C.sub.3-6cycloalkyl, fluorenyl or --C.sub.3-6heterocyclyl having
a ring heteroatom selected from --N(R.sup.a)--, --O--and --S--; or
R.sub.3, R.sub.4 together represent C.sub.1-6alkylidene; R.sup.a is
H, C.sub.1-6alkyl or --C(O)C.sub.1-6alkyl; and the optional
substituent for aryl and heteroaryl is 1 to 4 groups independently
selected from halogen, --C.sub.1-3alkoxy, --C.sub.1-3haloalkyl,
hydroxy-C.sub.1-3alkyl, --S(O)n-C.sub.1-3alkyl, amino, and mono-
and di-(C.sub.1-3alkyl)amino.
[0246] In specific embodiments, the CRTH2 receptor antagonist is
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid or a pharmaceutically
acceptable salt thereof.
[0247] In other embodiments, the CRTH2 receptor antagonist is an
antagonist disclosed in U.S. Pat. No. 8,592,383, the disclosure of
which is hereby incorporated by reference as if fully set forth
herein. In specific embodiments, the CRTH2 receptor antagonist is
selected from:
[0248] 4-{cyclopropyl[cis,
cis-4-{[4-(trifluoromethoxy)phenyl]carbonyl}-2,3,3a,4,9,9a
-hexahydro-1H-cyclopenta[b]quinolin-9-y1]amino}-4-oxobutanoic
acid,
[0249]
4-[cyclopropyl[cis,cis-7-fluoro-2,3,3a,4,9,9a-hexahydro-4-[4-(trifl-
uoromethoxy)benzoyl]-1H-cyclopenta[b]quinolin-9-y1]amino]-4-oxobutanoic
acid,
[0250]
4-(cyclopropyl((3aS,9R,9aR)-7-fluoro-4-(4-(trifluoromethoxy)benzoyl-
)-2,3,3a,4,9,9a
-hexahydro-1H-cyclopenta[b]quinolin-9-y1)amino)-4-oxobutanoic
acid,
[0251]
4-[cyclopropyl[cis,cis-1,2,2a,3,8,8a-hexahydro-3-[4-(trifluorometho-
xy)benzoyl]cyclobuta[b]quinolin-8-y1]amino]-4-oxobutanoic acid,
[0252]
(R)-1-((cis,cis-3-(benzyloxycarbonyl)-5,6-difluoro-1,2,2a,3,8,8a
-hexahydrocyclobuta[b]quinolin-8-y1)(cyclopropyl)carbamoyl)azetidine-2-ca-
rboxylic acid, or a pharmaceutically acceptable salt thereof.
[0253] In another embodiment, the compound is
2-(2-methyl-1-(4-(methylsulfonyl)-2-(trifluoromethyl)benzyl)-1H-pyrrolo[2-
,3-b]pyridin-3-y1)acetic acid (fevipiprant), or a pharmaceutically
acceptable salt thereof as disclosed in U.S. Pat. No.
7,666,878.
[0254] In another embodiment, the compound is
3-((3R)-3-{[(4-fluorophenyl)sulfonyl]amino}-1,2,3,4-tetrahydro-9H-carbazo-
l-9-y1)propanoic acid (ramatroban) or a pharmaceutically acceptable
salt thereof.
[0255] In some embodiments, the CRTH2 receptor antagonist is
administered in combination with a leukotriene receptor antagonist,
such as montelukast, zafilukast, or pranlukast. In specific
embodiments, the leukotriene receptor antagonist is montelukast.
The CRTH2 receptor antagonist and leukotriene receptor antagonist
can be administered in the same or separate dosage forms.
[0256] In specific embodiments of the combination therapy, the
CRTH2 antagonist is
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid or a pharmaceutically
acceptable salt thereof, and the leukotriene receptor antagonist is
montelukast. In other specific embodiments, the CRTH2 receptor
antagonist is fevipiprant or a pharmaceutically acceptable salt
thereof and the leukotriene receptor antagonist is montelukast.
[0257] Disorders that may be treated with the pharmaceutical
compositions, drug products, kits, methods, and uses of the present
invention in accordance with the present invention are generally
those that are susceptible to treatment with CRTH2 receptor
antagonist therapy, i.e., the CRTH2 receptor antagonist achieves a
clinically measurable beneficial result in a group of patients with
the disease. Exemplary diseases and conditions susceptible to
treatment with a CRTH2 receptor antagonist include but are not
limited to diseases include asthma, congestion, allergic rhinitis,
atopic dermatitis, chronic obstructive pulmonary disease ("COPD"),
dermatitis, inflammatory bowel disease, rheumatoid arthritis,
allergic nephritis, conjunctivitis, bronchial asthma, food allergy,
systemic mast cell disorder, anaphylactic shock, urticaria, eczema,
itching, inflammation, ischemia-reperfusion injury, cerebrovascular
disorders, pleuritis, ulcerative colitis, eosinophil-related
diseases, such as Churg-Strauss syndrome and sinusitis, and
basophile-related diseases, such as basophilic leukemia and
basophilic leukocytosis, in humans and other mammals. Examples of
cerebrovascular disorders include stroke.
[0258] In certain embodiments, the present invention provides a
pharmaceutical composition, drug product, kit, method, or use for
treating asthma, congestion, allergic rhinitis or COPD which
include instructions for administering a therapeutically effective
dose of CRTH2 receptor antagonist to a patient in need of such
treatment. In a specific embodiment, the disease or condition being
treated is asthma. In another embodiment, the disease or condition
being treated is COPD.
[0259] In addition, the CRTH2 receptor antagonists can inhibit
prostanoid-induced smooth muscle contraction by antagonizing
contractile prostanoids or mimicking relaxing prostanoids and hence
may be used in the inventive methods of treatment for dysmenorrhea,
premature labor and eosinophil-related disorders.
[0260] In preferred embodiments, the CRTH2 receptor antagonist
response marker of the present invention is used in conjunction
with any CRTH2 receptor antagonist monotherapy or combination
therapy treatment regimen comprising a CRTH2 receptor antagonist
and a leukotriene receptor antagonist, e.g., montelukast, for
treating asthma, including allergic asthma.
[0261] The doses and dosage regimen of the other agents used in the
combination therapies of the present invention for the treatment of
disorders susceptible to treatment by a CRTH2 antagonist can be
determined by the attending clinician, taking into consideration
the approved doses and dosage regimen in the package insert; and
the age, sex and general health of the patient. Agents administered
in combination therapy can be administered simultaneously (i.e., in
the same composition or in separate compositions one right after
the other) or sequentially. This is particularly useful when the
components of the combination are given on different dosing
schedules, e.g., one component is administered once daily and
another every six hours, or when the preferred pharmaceutical
compositions are different, e.g., one is a tablet and one is a
capsule. A kit comprising the separate dosage forms is therefore
advantageous.
[0262] When administering a combination therapy that is selected to
treat a patient based on the presence or absence of a CRTH2
receptor antagonist response marker in the patient, the therapeutic
agents in the combination, or a pharmaceutical composition or
compositions comprising the therapeutic agents, may be administered
in any order such as, for example, sequentially, concurrently,
together, simultaneously and the like. The amounts of the various
therapeutic agents in such combination therapy may be different
amounts (different dosage amounts) or same amounts (same dosage
amounts). In some embodiments, the agents in the combination are
administered in doses commonly employed when such agents are used
as monotherapy for treating the patient's disease or condition,
while in other embodiments, the agents are administered in doses
lower than the doses commonly employed when such agents are used as
monotherapy for treating the disease or condition.
[0263] In some embodiments, the therapeutic agents used in
combination therapy are present in the same pharmaceutical
composition, which may be suitable for oral administration,
intravenous administration, subcutaneous administration or
parenteral administration.
[0264] In a specific embodiment, the therapeutic agents used in
combination therapy are present in the same pharmaceutical
composition, which is a tablet suitable for oral
administration.
[0265] The inventors herein also contemplate that the CRTH2
receptor antagonist response marker described herein could be used
to seek regulatory approval to market a new CRTH2 receptor
antagonist drug product for a pharmacogenetic indication, i.e., an
indication that includes a disease component and a CRTH2 receptor
antagonist marker component. The disease component is a disease
susceptible to treatment with the CRTH2 receptor antagonist and the
genetic marker component is a patient who tests positive for at
least one copy of one of the better response alleles as set forth
in Table 1 (e.g., for at least one of one copy of the C allele of
the rs12748961 SNP. Similarly, the inventors herein contemplate
that the CRTH2 receptor antagonist response marker is useful for
seeking approval of such pharmacogenetic indications for currently
approved CRTH2 receptor antagonist drugs that physicians are
reluctant to prescribe for certain diseases based on the marginal
benefit/risk ratio of the drug for such diseases in the general
population.
[0266] Seeking approval for a pharmacogenetic indication typically
involves measuring the incidence of a desired response to a drug in
two separate groups of patients treated with the drug. Each
individual within one of the groups has disease and genetic
profiles that place the individual within the proposed
pharmacogenetic indication. The individuals in the other group may
be randomly selected without regard to whether they have the
genetic marker component of the proposed pharmacogenetic
indication. Alternately, the individuals are assigned to the other
group in a manner that results in a "control" group in which the
percentage of individuals who meet and do not meet the genetic
marker component is similar to what is observed in the general
population, or in a population of patients with the disease
component of the proposed pharmacogenetic indication. The drug
product for which approval is sought could be administered to the
two groups in a prospective trial. Alternatively, a retrospective
pharmacogenetic analysis of patients previously treated with the
drug could be performed.
[0267] The drug product for which a pharmacogenetic indication is
being sought could be evaluated with other therapeutically active
agents, for example another drug with efficacy for treating the
disease or condition in the proposed pharmacogenetic indication or
an agent that is intended to reduce the incidence of an adverse
effect caused by the drug. In some embodiments, the pharmacogenetic
indication for which regulatory approval is sought may include
other markers (genetic markers or biomarkers) or predictors of
response to the drug.
[0268] The pharmacogenetic study could be designed in consultation
with representatives of the regulatory agency or government entity
from whom approval is required before marketing the pharmacogenetic
drug product in a particular country. Preferably, the regulatory
agency is authorized by the government of a major industrialized
country, such as Australia, Canada, China, a member of the European
Union, Japan, South Korea, Taiwan and the like. Most preferably the
regulatory agency is authorized by the government of the United
States and the type of application for approval that is filed will
depend on the legal requirements set forth in the last enacted
version of the Food, Drug and Cosmetic Act that are applicable for
the drug product and may also include other considerations such as
the cost of making the regulatory filing and the marketing strategy
for the drug product. For example, if the pharmaceutical
formulation in the drug product has previously been approved for
the disease component of the proposed pharmacogenetic indication,
then the application might be a paper NDA, a supplemental NDA or an
abbreviated NDA, but the application might need to be a full NDA if
the pharmaceutical formulation has never been approved before; with
these terms having the meanings applied to them by those skilled in
the pharmaceutical arts or as defined in the Drug Price Competition
and Patent Term Restoration Act of 1984.
[0269] One desired outcome of a pharmacogenetic clinical trial
using the CRTH2 receptor response marker of the invention is
approval to market a drug product which comprises (1) a CRTH2
receptor antagonist pharmaceutical composition and (2) prescribing
information which includes a pharmacogenetic indication for which
the pharmaceutical composition is recommended. Prescribing
information is typically found in the product insert, also
frequently referred to as the package insert or label, for the
drug.
[0270] As discussed above, the pharmacogenetic indication has two
components: a disease component and the CRTH2 receptor response
marker component. Thus, the prescribing information would describe
a genetically defined group of patients for which the drug has
demonstrated efficacy for one or more diseases, symptoms or medical
conditions. In some embodiments, the prescribing information will
discuss how to identify individuals who are in the genetically
defined group. For example, in some embodiments, the prescribing
information states that the drug is indicated for individuals who
test positive for the better response allele of a CRTH2 receptor
antagonist response marker described herein. Alternately, the
prescribing information may state that the drug is contraindicated
for individuals who test negative for a better response allele of a
CRTH2 receptor antagonist response marker described herein. In some
preferred embodiments, the prescribing information includes the
name of at least one approved diagnostic test to be used for
detecting the presence or absence of the required genetic marker
component of the pharmacogenetic indication. As described above, a
pharmacogenetic indication in a pharmacogenetic drug product of the
invention may include additional markers or predictors of response
to the CRTH2 receptor antagonist pharmaceutical composition and/or
a requirement to use the drug in combination with one or more other
therapeutically active agents (e.g., montelukast). The prescribing
information may include information on recommended dosages and
treatment regimens.
[0271] In preferred pharmacogenetic drug products of the invention,
the pharmaceutical composition comprises a CRTH2 receptor
antagonist selected from
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-
-tetrahydropyrido[1,2-a]indol-10-y1}-acetic acid and fevipiprant.
More preferably, the pharmaceutical composition comprises a CRTH2
receptor antagonist which is
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid and a leukotriene
receptor antagonist such as montelukast. A preferred
pharmacogenetic indication for the drug products of the invention
comprises the use of the pharmaceutical composition for the
treatment of patients suffering from asthma and at least one copy
of one of the better response alleles for the CRTH2 response
antagonist markers set forth in Table 1. In preferred embodiments,
the patients test positive for at least one copy of the C allele
for the rs12748961 SNP. In some embodiments, the prescribing
information states that the CRTH2 receptor antagonist
pharmaceutical composition is indicated in combination with a
leukotriene receptor antagonist (e.g., montelukast) for treating
patients suffering from asthma.
[0272] Any or all analytical and mathematical operations involved
in performing the methods and uses described herein or in using the
kits, composition and drug products described herein may be
implemented by a computer. For example, the computer may execute a
computer program that assigns the presence or absence of the better
response allele of the CRTH2 receptor antagonist response marker to
an individual based on genotype data inputted by an employee of a
testing laboratory or by the treating physician. In addition, the
same computer or a different computer may output the predicted
response to CRTH2 receptor antagonist therapy based on that
response marker assignment. Data relating to the presence or
absence of the better response allele of a CRTH2 receptor
antagonist response marker in an individual may be stored as part
of a relational database (e.g., an instance of an Oracle database
or a set of ASCII flat files) containing other clinical and/or
genetic data for the individual. These data may be stored on the
computer's hard drive or may, for example, be stored on a CD ROM or
on one or more other storage devices accessible by the computer.
For example, the data may be stored on one or more databases in
communication with the computer via a network.
EXAMPLES
[0273] The following examples are provided to more clearly describe
the present invention and should not be construed to limit the
scope of the invention.
Example 1
[0274] Identification of the single nucleotide polymorphism (SNP)
associated with FEV.sub.1 response to treatment with CRTH2 receptor
antagonist/montelukast combination therapy.
[0275] In order to identify genetic contributions to treatment
response, the inventors conducted a pharmacogenetic (PGx) analysis
on asthmatic study subjects who had undergone a clinical trial with
a CRTH2 receptor antagonist to assess whether the mean treatment
difference varies across patient subgroups defined by several
pre-specified single nucleotide polymorphisms (SNPs).
Summary of the Clinical Study Design
[0276] FIG. 2 is graphical depiction of the study design. The study
was a 17-week randomized, double-blind, placebo-controlled,
crossover study with in-house blinding to evaluate the effect of
{(7R)-4-fluoro-7-[5-(4-fluorobenzyl)-1H-[1,2,3]triazol-1-y1]-6,7,8,9-tetr-
ahydropyrido[1,2-a]indol-10-y1}-acetic acid (hereinafter "Compound
A") on FEV.sub.1 when dosed for 4 weeks in asthmatic subjects with
persistent symptoms while receiving montelukast (ML). Overall, 104
patients completed the study. Period I was a pre-study period.
Subjects receiving long acting beta-agonists (LABAs) with inhaled
corticosteroid (ICS), either separately or as part of a fixed-dose
combination, were asked to discontinue the LABA component while
still receiving ICS. Period II was a 2- to 4-week run-in period
during which subjects receive open-label montelukast (ML) and
single-blind placebo (PBO). Subjects receiving ICS or other
controllers were required to taper off these medications while
receiving montelukast; Period III was a 4-week, double-blind,
randomized treatment period during which subjects received either
Compound A 150 mg or matching-image placebo while continuing to
receive montelukast 10 mg QD; Period IV was a 4-week wash out
period during which subjects receive placebo in a single-blind
fashion while continuing to receive montelukast 10 mg QD; Period V
was a 4-week double-blind period during which subjects were crossed
over to the opposite treatment not received during Period III.
[0277] The primary efficacy endpoint of the study was forced
expiratory volume in 1 second (FEV.sub.1) after 4 weeks of dosing,
and the study had 85% power to detect a true overall mean treatment
difference of 110 mL.
[0278] A pharmacogenetic analysis was also performed to assess
whether the mean treatment difference varies across patient
subgroups defined by several pre-specified SNPs.
Genotype and Clinical Data
[0279] Based on a pre-specified list of single nucleotide
polymorphisms (SNPs) associated with the CRTH2 gene, peripheral
blood eosinophil and basophil counts, serum IgE levels and
periostin lung expression quantitive trait loci (eQTLs), genetic
data for 5,092 SNPs were generated using a next generation
sequencing platform. After removal of SNPs with no observed
genotype variation, 85 remained. Subsequent dropping of SNPs with
minor allele frequency (MAF)<1% resulted in 70 SNPs being
included in the pharmacogenetics statistical analysis.
[0280] The efficacy data set for the pharmacogenetics analysis was
based on 103 patients since one of the study subjects who completed
the study was excluded because no genotyping data was collected for
this patient.
Statistical Methods
Evaluation of the Overall Mean Treatment Difference in FEV.sub.1
(Ignoring Genetics)
[0281] A common analysis for crossover designs with longitudinal
measurements in each period uses a linear mixed effects "cell
means" model with the clinical measure (here, FEV.sub.1) as the
dependent variable, and sequence (S=M.fwdarw.P, P.fwdarw.M),
treatment (T=M,P), visit (V=0,2,4 weeks), and all possible
interactions involving S, T, and V as independent variables;
M=Compound A+montelukast, P=placebo+montelukast. In addition, to
minimize assumptions, a covariance matrix without imposition of any
structure (such as compound symmetry) is used to account for the
intra-patient correlations among FEV.sub.1 responses over time and
across the two treatments within each sequence.
[0282] This common analysis can be misleading if both of the
following conditions are encountered in either crossover sequence:
(i) the observed mean difference in baseline means for the two
treatments is "far" from zero, and (ii) baseline and post-baseline
responses are very strongly correlated (correlation .apprxeq.0.9 or
higher). In preparation for the pharmacogenetic analysis, both of
these conditions were observed in the FEV.sub.1 data. Consequently,
we analyzed the FEV.sub.1 data using an extension of the method of
analysis described in Mehrotra D V, Pharmaceutical Statistics 13,
376-387 (2014). This second analytical method is specifically
designed for crossover analyses with baseline measurements. To do
so, we added "xdiff" (baseline difference between treatments M and
P) and interactions between xdiff and all the other fixed effect
terms involving S, T, and V to the aforementioned common analysis
crossover model; the mean treatment difference at week 4 was
estimated at xdiff=0 via the SAS code below.
TABLE-US-00003 PROC MIXED DATA=pgxsub; WHERE visit>0; CLASS seq
trt visit subjid; MODEL fev1=seq|trt|visit|xdiff/DDFM=KR; REPEATED
trt*visit/SUBJECT=subjid TYPE=UN; LSMEANS trt*visit/AT xdiff=0
PDIFF CL; RUN;
[0283] In the SAS code above, patients with a missing xdiff value
are automatically removed from the analysis. To generate results in
which all 103 patients are retained in the analysis, missing period
2 baseline FEV.sub.1 values (resulting in missing xdiff values,
which was the case for .about.20% of the patients due to dropout)
were imputed separately in each sequence via a simple linear
regression model with the period 2 baseline as the dependent
variable and the corresponding period 1 baseline as the independent
variable. As noted earlier, the observed correlation between period
1 and period 2 FEV.sub.1 baselines was .apprxeq.0.9 in both
sequences, providing reassurance that the imputed values for
missing period 2 baselines had good reliability.
[0284] The key difference between the standard crossover analysis
and the second analysis described above can be explained via their
respective estimands (i.e., target parameters). The estimand for
the former is
E[Y.sub.M-X.sub.M)-(Y.sub.P-X.sub.P)]=E[(Y.sub.M-Y.sub.P)-(X.sub.M-X.sub.-
P)], where E(z) denotes the population mean of z, while the
estimand for the latter is
E[(Y.sub.M-Y.sub.P)|(X.sub.M-X.sub.P)=0], where X.sub.M is the
baseline FEV.sub.1 before treatment M, Y.sub.M is the week 4
FEV.sub.1 following treatment M, and so on. Note that the new
analysis "adjusts" for a baseline imbalance when comparing
post-baseline FEV.sub.1 values between treatments by imposing the
condition X.sub.M-X.sub.P=0 (or equivalently, X.sub.M=X.sub.P);
this conditioning ensures a fair comparison of M and P while also
reducing the variability of the estimate of the target parameter,
relative to the standard analysis.
PGx Analysis: Assessing Whether Mean Treatment Differences in
FEV.sub.1 are Associated with SNP(s)
[0285] For the pharmacogenetics analysis, in the model just
described above, fixed effect terms for genotype (coded as G=0, 1,
or 2 depending on the number of minor alleles for the given SNP)
and treatment by genotype interaction were added, the latter being
of primary interest. To avoid instability in estimated model
parameters, for any given SNP, the G=1 and G=2 genetic subgroups
were combined if the number of patients in the latter subgroup was
less than 5. Each SNP was analyzed separately. The following SAS
code was used for the PGx analysis:
TABLE-US-00004 PROC MIXED DATA=pgxsub; WHERE visit>0; CLASS seq
trt visit subjid; MODEL fev1=seq|trt|visit|xdiff g trt*g/DDFM=KR;
REPEATED trt*visit/SUBJECT=subjid TYPE=UN; ESTIMATE `TxG
interaction` trt*g 1 -1/CL; LSMEANS trt*visit/AT (xdiff g)=(0 0)
PDIFF CL; LSMEANS trt*visit/AT (xdiff g)=(0 1) PDIFF CL; LSMEANS
trt*visit/AT (xdiff g)=(0 2) PDIFF CL; ODS OUTPUT ESTIMATES=pgxout;
BY SNP; RUN;
[0286] The 70 p-values (one for each SNP) derived via the above SAS
code were evaluated for statistical significance after a Bonferroni
adjustment. Accordingly, a SNP was deemed statistically significant
if the associated p-value was less than 0.05/70=0.00071
[0287] Sensitivity analyses: To assess robustness of the main
pharmacogenetic analysis described above, sensitivity analyses were
conducted in which terms for race-group and treatment by race-group
interaction were included in the pharmacogenetics analysis model,
with race-group represented as a binary indicator variable for
self-reported race of either "white"/other or "multiple"/other.
Results
Evaluation of the Overall Mean Treatment Difference at Week 4
(Ignoring Genetics)
[0288] Table 3 displays FEV.sub.1 (mL) summary statistics by
sequence and treatment for week 0 (baseline), week 4, and change
from baseline at week 4. The last two columns show summary
statistics for derived within-patient variables Xdiff (difference
in baseline values prior to M and
[0289] P) and .DELTA..DELTA. (difference in change from baseline
after M and P), both based on completers only.
[0290] Two observations in Table 3 are noteworthy. First, while the
baseline means prior to administration of M and P are similar in
the M.fwdarw.P sequence (2270 vs. 2297 mL), they are notably
different in the P.fwdarw.M sequence (2452 vs. 2226 mL) based on
all patients with available data; the same concern about a baseline
imbalance in the P.fwdarw.M sequence surfaces when focusing on the
completers only based on the Xdiff mean of 153 mL. Second, the mean
.DELTA..DELTA. values are also strikingly different between the two
sequences; the mean .DELTA..DELTA. of 133 mL in the first sequence
is larger than the 110 mL effect that the trial was designed to
detect, but the corresponding observed difference in the second
sequence is in the opposite direction (-78 mL).
TABLE-US-00005 TABLE 3 FEV.sub.1 (mL) summaries for observed data
and relevant derived variables Compound A + montelukast Placebo +
montelukast Completers [M] [P] only W 0 W 4 W 4 - W 0 W 0 W 4 W 4 -
W 0 Xdiff .DELTA..DELTA. M.fwdarw.P Mean 2270 2365 96 2297 2258 -23
-24 133 (N = 51) (SE) (78) (95) (49) (97) (98) (46) (47) (65) N 51
46 46 44 39 39 38 38 P.fwdarw.M Mean 2452 2507 42 2226 2290 58 153
-78 (N = 52) (SE) (96) (97) (42) (82) (100) (41) (41) (66) N 41 39
39 52 48 48 39 39 SE = standard error; .DELTA..DELTA. = treatment
difference [M - P] in change from baseline at week 4 (W 4 - W
0)
[0291] Results based on the second analytical method described in
the Statistical Methods section, where xdiff is used as a covariate
and estimation of the mean treatment difference is obtained after
imposing the condition xdiff=0, are given in Table 4.
TABLE-US-00006 TABLE 4 Estimated mean treatment difference in
FEV.sub.1 (mL) at Week 4 using the new method of analysis Missing
period 2 FEV.sub.1 baselines imputed:* No (N = 85**) Yes (N = 103)
LSMean (95% CI) 120 (56,184) 122 (56,187) P-value .0004 .0004
*regression-based imputation of period 2 baseline given period 1
baseline in the given sequence; **N is the number of patients
included in the analysis.
[0292] The results in Table 4 suggest that, relative to placebo,
Compound A appears to be notably more effective in improving
FEV.sub.1 levels, on average, after four weeks of treatment in
patients who continue to take montelukast as background
therapy.
[0293] The pharmacogenetic analysis results described below inform
on whether the apparent mean net benefit of .about.120 mL is evenly
distributed across the trial population or driven primarily by a
genetics-based subgroup.
PGx Analysis: Assessing Whether Mean Treatment Differences in FEV1
are Associated with SNP(s)
[0294] A total of 70 SNPs were assessed in the analysis. Among the
70 SNPs analyzed, only one (rs12748961) had a p-value that was
smaller than the Bonferroni threshold of 0.00071.
[0295] Table 5 shows the estimated mean treatment difference at
week 4 by genotype subgroup for SNP rs12748961, along with the
statistically significant p-value for the treatment by genotype
interaction. For this SNP, the number of patients in the C=0, 1 and
2 genetic subgroups were 74, 27 and 2, respectively; the latter two
subgroups were combined prior to the PGx analysis, for reasons
noted in the Statistical Methods section.
TABLE-US-00007 TABLE 5 FEV.sub.1 (mL): Estimated Mean Treatment
Difference at Week 4 by Genotype Subgroup for rs12748961 Test for
Treatment C = 0 C .gtoreq. 1 by Genotype (N = 74) (N = 29)
interaction LSMean (95% CI) 59 (-11,129) 268 (167,370) p = 0.0005*
*less than the Bonferroni-adjusted p-value threshold of .05/70 =
.00071 to account for 70 statistical tests. C is number of copies
of the C allele.
[0296] A graphical representation of the results in Table 5 is
provided in FIG. 3. The apparently beneficial overall drug effect
appears to be largely driven by the mean of .about.30% of the trial
population who possess at least one copy of the C allele
(C.gtoreq.1) of the rs12748961 SNP; the estimated benefit of
Compound A in the remaining 70% of the patients appears to be
relatively small.
[0297] Sensitivity analyses in which terms for race-group and
treatment by race-group interaction were added to the
pharmacogenetics analysis model delivered results that were very
similar to those reported above for all the SNPs.
[0298] The minor allele frequency for rs12748961 is reported to be
.about.20%, as established by the 1000 Genomes Project, based on
the world-wide population, as shown in FIG. 4. Paul Julian Kersey
et al., "Ensembl Genomes 2013: scaling up access to genome-wide
data," Nucleic Acids Research 2014, 42 (D1): D546-D552. However,
there are dramatic differences in its frequency between the Asian
versus African populations as is also shown in FIG. 4, which might
provide unique medical and/or commercial opportunities in treating
populations having a higher frequency of the C allele with CRTH2
receptor antagonists, such as Compound A.
Example 2
[0299] Identification of additional genetic variants associated
with FEV.sub.1 response to treatment with CRTH2 receptor
antagonist/montelukast combination therapy.
[0300] A second investigation was performed to identify additional
genetic markers other than rs12748961, that are predictive of a
beneficial response to CRTH2 receptor antagonist/montelukast
combination.
[0301] Blood samples from patients from the study described above
were further genotyped using the Merck Custom Axiom Array. The
Merck Custom Axiom Array was designed using the UK Biobank Axiom
Genotyping Array as a backbone with custom content to include more
diversity for common SNPs in different ethnic populations and
additional content for drug metabolizing enzymes. This
investigation comprised the same patient population as decribed
above in Example 1, except that one patient's data was excluded
because too little DNA was available for further genotyping. Data
from a total of 102 subjects were included in this
investigation.
[0302] Genetic imputation was performed based on the assayed
variants on Merck Custom Axiom Array (after genetic quality
control) using the IMPUTE2 software which is an genotype imputation
and haplotype phasing program based on the disclosure in B. N.
Howie, et al., "A flexible and accurate genotype imputation method
for the next generation of genome-wide association studies," PLoS
Genetics (2009) 5(6): e1000529. As explained in Howie et al.,
imputation methods predict unobserved genotypes in a study sample
by using a population genetic model to extrapolate allelic
correlations measured in a reference panel. In this case, sequence
data from the 1000 Genome Project were used as the imputation
reference dataset. Imputed variants with low imputation certainty
(information metric<0.3) were excluded from the analysis.
[0303] This investigation comprised testing all PSs with a minor
allele frequency (MAF)>0.05 in the region of 200 kB with
rs12748961, for both assayed and imputed PSs. A total of 1054 PSs
(including 111 assayed variants) were analyzed. The same
statistical method as described in Example 1 was applied in this
analysis.
[0304] Table 6 lists the PSs which show or are predicted to have a
treatment effect by genotype interaction with a p-value of
<0.001. The minor allele frequency (MAF) based on the analysis
dataset is reported in the second column. The third column
indicates whether the particular PS was assayed via the Axiom Merck
Custom Array. The fifth column indicates the Pearson correlation
squared with respect to presence of the C allele of the rs12748961
SNP.
TABLE-US-00008 TABLE 6 r.sup.2 with PS MAF Assayed p-value
rs12748961 rs12748961 0.152 Y 0.00054 1.00 rs12118655 0.152 Y
0.00010 0.93 rs6679073 0.223 0.00048 0.52 rs12564209 0.152 0.00054
1.00 rs3805 0.157 0.00054 0.97 rs71633561 0.152 0.00054 1.00
rs71970505 0.152 0.00054 1.00 rs12132270 0.157 0.00055 0.89
rs67625805 0.170 0.00076 0.91 rs3747972 0.162 0.00076 0.93
rs11557080 0.157 0.00086 0.96 rs71633563 0.157 Y 0.00086 0.96
rs34848415 0.396 0.00092 0.09 rs1891091 0.137 0.00113 0.89
[0305] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described
herein will become apparent to those skilled in the art from the
foregoing description. Such modifications are intended to fall
within the scope of the appended claims.
[0306] Patents, patent applications, publications, product
descriptions, and protocols are cited throughout this application,
the disclosures of which are incorporated herein by reference in
their entireties for all purposes.
Sequence CWU 1
1
15151DNAHomo sapiensmisc_feature(26)..(26)can be C or T 1ctcttcacta
tgttgaaatt gggtcnttct tccccaaaga ttgaagagaa t 51251DNAHomo
sapiensmisc_feature(26)..(26)can be A or G 2tcagatggga aatattgcag
gggctntatg gtctccatcg caactactca c 51351DNAHomo
sapiensmisc_feature(26)..(26)can be A or C 3ttttgagact ggcaaatgtt
ctgcanccag tatctgctca atacttttgt g 51451DNAHomo
sapiensmisc_feature(26)..(26)can be C or G 4caaaagtctt taggatagtc
tctggntcac agtaagtgct acgtaagtgt t 51551DNAHomo
sapiensmisc_feature(26)..(26)can be A, G or T 5tttttataca
tgttatttta gggcanaagc tgagtactat acccccacac c 51651DNAHomo
sapiensmisc_feature(26)..(26)can be C or G 6gaggtaggag aatcacttga
acccangggt cagaggttgt ggtgagccga g 51761DNAHomo sapiens 7agtttgcaaa
gtaacccatt tggccatgca gactgtaagt catacaactc tagagggaca 60a
61851DNAHomo sapiensmisc_feature(26)..(26)can be C or T 8ctcctatctc
cattttactc ttatgnctac ccccagaata ggttttctgg a 51951DNAHomo
sapiensmisc_feature(26)..(26)can be absent or T 9ggtggtaatg
tatatttatc ttaaantttt tttttttttt tgagacggag t 511051DNAHomo
sapiensmisc_feature(26)..(26)can be A or G 10gcggatcgcc tgagatcagg
agttcnagac cagcctggcc aacatggtga a 511151DNAHomo
sapiensmisc_feature(26)..(26)can be A or G 11cgcaatggtg tgatctcagc
tcactncaac ctctaactcc caggttcaag c 511251DNAHomo
sapiensmisc_feature(26)..(26)can be C or T 12ctgcctacaa aagtatcagg
caaganaggc ctcacgttag atgagatagt a 511351DNAHomo
sapiensmisc_feature(26)..(26)can be absent or A 13ggcaataaga
gtgaaactcc atctcnaaaa aaaaaaaaaa aaaatctatt t 511450DNAHomo sapiens
14agtttgcaaa gtaacccatt tggccaagtc atacaactct agagggacaa
501551DNAHomo sapiensmisc_feature(26)..(26)n can be A or G
15acctcctccc ataaattgca gaatcnattc ccttcctgcc cactctcagt g 51
* * * * *
References