U.S. patent application number 17/211033 was filed with the patent office on 2021-11-11 for treatment of fibrosis using fxr ligands.
The applicant listed for this patent is Intercept Pharmaceuticals, Inc.. Invention is credited to Stefano FIORUCCI, Roberto PELLICCIARI, Mark PRUZANSKI.
Application Number | 20210346400 17/211033 |
Document ID | / |
Family ID | 1000005728339 |
Filed Date | 2021-11-11 |
United States Patent
Application |
20210346400 |
Kind Code |
A1 |
FIORUCCI; Stefano ; et
al. |
November 11, 2021 |
TREATMENT OF FIBROSIS USING FXR LIGANDS
Abstract
The present invention relates to a method for inhibiting
fibrosis that occurs in an organ where the farnesoid X receptor
(FXR) is expressed. This method involves the step of administering
a high potency, activating ligand of FXR in an effective amount to
a patient who is suffering from a cholestatic condition. The
invention also provides pharmaceutical compositions containing an
effective amount of an FXR ligand and kits for dispensing the
pharmaceutical compositions.
Inventors: |
FIORUCCI; Stefano; (Perugia,
IT) ; PELLICCIARI; Roberto; (Perugia, IT) ;
PRUZANSKI; Mark; (New York, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Intercept Pharmaceuticals, Inc. |
New York |
NY |
US |
|
|
Family ID: |
1000005728339 |
Appl. No.: |
17/211033 |
Filed: |
March 24, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16228944 |
Dec 21, 2018 |
10987362 |
|
|
17211033 |
|
|
|
|
15299559 |
Oct 21, 2016 |
10258633 |
|
|
16228944 |
|
|
|
|
11081002 |
Mar 14, 2005 |
9498484 |
|
|
15299559 |
|
|
|
|
60552865 |
Mar 12, 2004 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/575 20130101;
A61P 1/16 20180101; A61K 9/0053 20130101 |
International
Class: |
A61K 31/575 20060101
A61K031/575; A61P 1/16 20060101 A61P001/16; A61K 9/00 20060101
A61K009/00 |
Claims
1. A method for inhibiting fibrosis in a subject not suffering from
a cholestatic condition, the method comprising the step of
administering to the subject an effective amount of a ligand
specific for the farnesoid X receptor (FXR), wherein the fibrosis
to be inhibited occurs in an organ where FXR is expressed, with the
proviso that the ligand is not chenodeoxyxholic acid (CDCA) or
ursodeoxycholic acid (UDCA).
2. A method for inhibiting fibrosis in a subject not suffering from
a cholestatic condition, the method comprising the step of
administering to the subject an effective amount of a ligand
specific for the farnesoid X receptor (FXR), wherein the fibrosis
to be inhibited occurs in an organ where FXR is expressed, with
wherein the ligand has an EC.sub.50 no greater than 5 .mu.M in a
cell-free FXR assay or in a cell-based FXR transactivation
assay.
3. The method of claim 2, wherein the ligand has an EC.sub.50 no
greater than 1 .mu.M.
4. The method of claim 1, wherein the cholestatic condition is
defined as having abnormally elevated serum levels of alkaline
phosphatase, .gamma.-glutamyl transpeptidase (GGT), and 5'
nucleotidase.
5. The method of claim 4, wherein the cholestatic condition is
further defined as presenting with at least one clinical
symptom.
6. The method of claim 5, wherein the symptom is itching
(pruritus).
7. The method of claim 1, wherein the fibrosis is selected from the
group consisting of liver fibrosis, kidney fibrosis, and intestinal
fibrosis.
8. The method of claim 1, wherein the cholestatic condition is
selected from the group consisting of primary biliary cirrhosis,
primary sclerosing cholangitis, drug-induced cholestasis,
hereditary cholestasis, and intrahepatic cholestasis of
pregnancy.
9. The method of claim 1, wherein the subject is not suffering from
a cholestatic condition associated with a disease or condition
selected from the group consisting of primary liver and biliary
cancer, metastatic cancer, sepsis, chronic total parenteral
nutrition, cystic fibrosis, and granulomatous liver disease.
10. The method of claim 1, wherein the ligand is selected from the
group consisting of 6ECDCA, tauro-6ECDCA, 6EUDCA, GW4064,
6.alpha.-MeCDCA, 6.alpha.-PrCDCA, fexaramine, and
guggulsterone.
11. The method of claim 1, wherein the subject has liver fibrosis
associated with a disease selected from the group consisting of
hepatitis B; hepatitis C; parasitic liver diseases; post-transplant
bacterial, viral and fungal infections; alcoholic liver disease
(ALD); non-alcoholic fatty liver disease (NAFLD); non-alcoholic
steatohepatitis (NASH); liver diseases induced by methotrexate,
isoniazid, oxyphenistatin, methyldopa, chlorpromazine, tolbutamide,
or amiodarone; autoimmune hepatitis; sarcoidosis; Wilson's disease;
hemochromatosis; Gaucher's disease; types III, IV, VI, IX and X
glycogen storage diseases; ai-antitrypsin deficiency; Zellweger
syndrome; tyrosinemia; fructosemia; galactosemia; vascular
derangement associated with Budd-Chiari syndrome, veno-occlusive
disease, or portal vein thrombosis; and congenital hepatic
fibrosis.
12. The method of claim 1, wherein the subject has intestinal
fibrosis associated with a disease selected from the group
consisting of Crohn's disease, ulcerative colitis, post-radiation
colitis, and microscopic colitis.
13. The method of claim 1, wherein the subject has renal fibrosis
associated with a disease selected from the group consisting of
diabetic nephropathy, hypertensive nephrosclerosis, chronic
glomerulonephritis, chronic transplant glomerulopathy, chronic
interstitial nephritis, and polycystic kidney disease.
14. A kit for inhibiting fibrosis in a subject not suffering from a
cholestatic condition, wherein the fibrosis to be inhibited occurs
in an organ where farnesoid X receptor (FXR) is expressed, the kit
comprising: an effective amount of a ligand specific for FXR, with
the proviso that the ligand is not chenodeoxyxholic acid (CDCA) or
ursodeoxycholic acid (UDCA); and, an instructional material
teaching the indications, dosage, and schedule of administration of
the ligand to the patient.
15.-16. (canceled)
17. The kit of claim 14, wherein the fibrosis is selected from the
group consisting of liver fibrosis, kidney fibrosis, and intestinal
fibrosis.
18. The kit of claim 14, wherein the ligand is selected from the
group consisting of 6ECDCA, tauro-6ECDCA, 6EUDCA, GW4064,
6.alpha.-MeCDCA, 6.alpha.-PrCDCA, fexaramine, and
guggulsterone.
19. The kit of claim 14, wherein the ligand is presented in a
pharmaceutical composition suitable for oral or intravenous
administration.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation of U.S.
application Ser. No. 16/228,944, filed on Dec. 21, 2018, which is a
division of U.S. application Ser. No. 15/299,559, filed on Oct. 21,
2016, now U.S. Pat. No. 10,258,633, issued on Apr. 16, 2019, which
is a continuation of U.S. application Ser. No. 11/081,002, filed on
Mar. 14, 2005, now U.S. Pat. No. 9,498,484, issued on Nov. 22,
2016, which claims priority to U.S. Provisional Application No.
60/552,865, filed Mar. 12, 2004.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Mar. 23, 2021, is named "IPHA-004_C02US_SeqList_ST25.txt" and is
about 2.26 KB in size.
FIELD OF THE INVENTION
[0003] The present invention relates to the prevention, treatment,
and/or reversal of fibrosis. In particular, this invention relates
to the novel use of ligands specific for farnesoid X receptor (FXR)
in patients with fibrotic liver, intestinal, or renal diseases who
do not also suffer from a cholestatic condition, in order to
inhibit the development and progression of fibrosis in those
tissues where FXR is expressed.
BACKGROUND OF THE INVENTION
[0004] Fibrosis is characterized by an excessive accumulation of
collagen in the extracellular matrix of the involved tissue. It is
a long-standing and challenging clinical problem for which no
effective treatment is currently available. The production of
collagen is a highly regulated physiological process, the
disturbance of which may lead to the development of tissue
fibrosis. The formation of fibrous tissue is part of the normal
beneficial process of healing after injury. In some cases, however,
an abnormal accumulation of fibrous material can severely interfere
with the normal function of the affected tissue or even cause the
complete loss of function of the affected organ.
[0005] Liver fibrosis, for instance, represents a major-medical
problem with significant morbidity and mortality. In a variety of
liver diseases, chronic injury leads to progressive fibrosis that
the liver is able to compensate for over as long as 20-30 years;
eventually, however, patients begin to experience symptoms and
signs of liver failure due to severe fibrosis and cirrhosis.
Worldwide chronic viral hepatitis infections, particularly by
Hepatitis B and C virus, represent the major cause of liver
fibrosis; however, within the United States chronic alcohol
consumption has traditionally been the leading cause of hepatic
fibrosis and cirrhosis. Currently, with the rapid increase in the
prevalence of obesity in the general population, non-alcoholic
fatty liver disease (NAFLD) is becoming the most prevalent
condition associated with liver fibrosis and may become the leading
cause of liver fibrosis associated morbidity and mortality in
coming years. Other known causes of liver fibrosis include
parasitic infection, autoimmune diseases, iron or copper storage
disorders, and biliary obstruction. Liver fibrosis can be
classified as a wound healing response to a variety of chronic
stimuli that is characterized by an excessive deposition of
extracellular matrix proteins, of which type I collagen
predominates. This excess deposition of extracellular matrix
proteins disrupts the normal architecture of the liver resulting in
structural and functional damages to the organ. If left untreated,
liver fibrosis can progress to liver cirrhosis ultimately leading
to organ failure and death. Many other debilitating and potentially
fatal diseases also lead to fibrosis of organs such as the
intestine, kidney, heart, and lung.
[0006] Because of the pivotal role of collagen production during
fibrosis, many studies have focused on the regulation of collagen
expression and proliferation of fibroblasts, the major cell type
responsible for collagen synthesis. In the liver, the hepatic
stellate cell (HSC) is the primary fibrogenic cell type.
[0007] A variety of compounds have been identified as anti-fibrosis
agents via different mechanisms of action, including the
suppression of collagen expression. For example, pantethine
(D-bis-(N-pantothenyl-.beta.-aminoethyl)-disulfide) has been
reported to be effective for the inhibition of hepatic fibrosis
(U.S. Pat. No. 4,937,266); a hydrazine derivative, benzoic
hydrazide, has been shown to be a powerful antifibrotic agent (U.S.
Pat. Nos. 5,374,660 and 5,571,846); the use of angiotensin
inhibitors in combination with nitric oxide stimulators to inhibit
the progression of fibrosis is disclosed in U.S. Pat. Nos.
5,645,839 and 6,139,847; 6,005,009 describes methods using certain
pyridoxal benzoyl hydrazones or their analogs for inhibiting
fibrosis; U.S. Pat. No. 6,117,445 describes the use of A.sub.1
adenosine receptor antagonists and/or P.sub.2X purinoceptor
antagonists for treating or preventing fibrosis and sclerosis. More
recently, somatostatin agonists, hepatocyte growth factors (HGFs),
chymase inhibitors, and antagonists of IL-13 have been reported to
effectively inhibit fibrosis (U.S. Pat. Nos. 6,268,342, 6,303,126,
6,500,835, and 6,664,227).
[0008] The farnesoid X receptor (FXR), also known as the bile acid
receptor (BAR) and NR1H4, is a member of the nuclear receptor
superfamily of ligand-activated transcription factors and forms,
with retinoid X receptor (RXR), a heterodimer receptor crucial for
bile acid homeostasis (Forman et al., Cell 81:687-693, 1995; Lu et
al., J. Biol. Chem., 17:17, 2001). FXR is expressed in various
tissues including the liver, kidney, intestine, colon, ovary, and
adrenal gland (Forman et al., Cell 81:687-693, 1995).
[0009] Containing a conserved DNA-binding domain (DBD) and a
C-terminal ligand-binding domain (LBD), FXR binds to and becomes
activated by a variety of naturally occurring bile acids, including
the primary bile acid chenodeoxycholic acid (CDCA) and its taurine
and glycine conjugates (Makishima et al., Science 284:1362-1365,
1999; Parks et al., Science 284:1365-1368, 1999; Wang et al., Mol.
Cell., 3:543-553, 1999). Upon activation, the FXR-RXR heterodimer
binds the promoter region of target genes and regulates the
expression of several genes involved in bile acid homeostasis. For
example, the activation of FXR in the liver leads through the
direct induction of the nuclear receptor short heterodimer partner
(SHP) to the reduced expression of CYP7A, a gene encoding an enzyme
catalyzing the rate-limiting step in bile acid synthesis (Schwartz
et al., Curr. Opin. Lipidol., 9:113-119, 1998); whereas the
activation of FXR in the intestine leads to increased expression of
a bile acid-binding protein (I-BABP), which is involved in the
active transport of bile acids in the ileum (Kanda et al., Biochem.
1, 330:261-265, 1998). For a more detailed list of FXR-regulated
genes, see, e.g., WO 03/016288, pages 22-23.
[0010] Because of the importance of FXR in bile acid homeostasis,
FXR-activating ligands have been proposed for use to treat a
variety of cholestatic liver diseases and conditions where the
normal enterohepatic bile flow is blocked or has otherwise ceased
(see, e.g., WO 02/072598 and WO 03/090745).
[0011] While not intending to be bound to any particular theory,
the present inventor revealed that FXR activation can down-regulate
collagen synthesis and resulting fibrosis through a mechanism
involving SHP and other FXR target genes. Thus, FXR-activating
ligands are effective anti-fibrosis agents in tissues and organs
where FXR is present, such as liver, kidney, intestine, etc. The
present disclosure provides a new method for preventing, treating
and/or reversing fibrosis, based on the surprising discovery of
previously unknown properties of FXR-activating ligands.
BRIEF SUMMARY OF THE INVENTION
[0012] In one aspect, this invention provides a method for
inhibiting fibrosis in a subject not suffering from an underlying
cholestatic condition. This method comprises the step of
administering to the subject an effective amount of a ligand
specific for the farnesoid X receptor (FXR), in order to inhibit
fibrosis that might occur in an organ where FXR is expressed. The
FXR ligand used in the claimed method is not chenodeoxycholic acid
(CDCA) or ursodeoxycholic acid (UDCA); in the alternative, the
ligand has an EC.sub.50 no greater than 5 .mu.M in a cell-free FXR
assay or in a cell-based FXR transactivation assay. In a preferred
embodiment, the ligand has an EC.sub.50 no greater than 1
.mu.M.
[0013] In some embodiments, the cholestatic condition is defined as
having abnormally elevated serum levels of alkaline phosphatase,
.gamma.-glutamyl transpeptidase (GGT), and 5' nucleotidase. In one
exemplary embodiment, the abnormally elevated serum level is
greater than about 125 IU/L for alkaline phosphatase, greater than
about 65 IU/L for GGT, and greater than about 17 IU/L for 5'
nucleotidase. In other embodiments, the cholestatic condition is
defined as presenting with at least one clinical symptom in
addition to having abnormally elevated serum levels of alkaline
phosphatase, GGT, and 5' nucleotidase. In one exemplary embodiment,
the clinical symptom is itching (pruritus).
[0014] In some embodiments, the fibrosis to be inhibited by the
method of this invention is liver fibrosis, kidney fibrosis, or
intestinal fibrosis. In other embodiments, the subject is not
suffering from a cholestatic condition such as primary biliary
cirrhosis, primary sclerosing cholangitis, drug-induced
cholestasis, hereditary cholestasis, or intrahepatic cholestasis of
pregnancy. In yet other embodiments, the subject is not suffering
from a cholestatic condition associated with a disease or condition
such as primary liver and biliary cancer, metastatic cancer,
sepsis, chronic total parenteral nutrition, cystic fibrosis, or
granulomatous liver disease.
[0015] In some embodiments, the FXR ligand is 6ECDCA, tauro-6ECDCA,
6EUDCA, GW4064, 6.alpha.-MeCDCA, 6.alpha.-PrCDCA, fexaramine, or
guggulsterone.
[0016] In some embodiments, the fibrosis to be inhibited is liver
fibrosis associated with a disease such as hepatitis B; hepatitis
C; parasitic liver diseases; post-transplant bacterial, viral and
fungal infections; alcoholic liver disease (ALD); non-alcoholic
fatty liver disease (NAFLD); non-alcoholic steatohepatitis (NASH);
liver diseases induced by methotrexate, isoniazid, oxyphenistatin,
methyldopa, chlorpromazine, tolbutamide, or amiodarone; autoimmune
hepatitis; sarcoidosis; Wilson's disease; hemochromatosis;
Gaucher's disease; types III, IV, VI, IX and X glycogen storage
diseases; .alpha.1-antitrypsin deficiency; Zellweger syndrome;
tyrosinemia; fructosemia; galactosemia; vascular derangement
associated with Budd-Chiari syndrome, veno-occlusive disease, or
portal vein thrombosis; or congenital hepatic fibrosis.
[0017] In other embodiments, the fibrosis to be inhibited is
intestinal fibrosis associated with a disease such as Crohn's
disease, ulcerative colitis, post-radiation colitis, or microscopic
colitis.
[0018] In some further embodiments, the fibrosis to be inhibited is
renal fibrosis associated with a disease such as diabetic
nephropathy, hypertensive nephrosclerosis, chronic
glomerulonephritis, chronic transplant glomerulopathy, chronic
interstitial nephritis, or polycystic kidney disease.
[0019] In another aspect, this invention provides a kit for
inhibiting fibrosis in a subject not suffering from a cholestatic
condition. The fibrosis to be inhibited occurs in an organ where
farnesoid X receptor (FXR) is expressed. This kit comprises an
effective amount of a ligand specific for FXR and an instructional
material teaching the indications, dosage, and schedule of
administration of the ligand to the patient. The FXR ligand in the
claimed kit is not chenodeoxycholic acid (CDCA) or ursodeoxycholic
acid (UDCA); in the alternative, the ligand has an EC.sub.50 no
greater than 5 .mu.M in a cell-free FXR assay or in a cell-based
FXR transactivation assay. In a preferred embodiment, the ligand
has an EC.sub.50 no greater than 1 .mu.M.
[0020] In some embodiments, the kit is used for inhibiting liver
fibrosis, kidney fibrosis, or intestinal fibrosis. In other
embodiments, the kit comprises an FXR ligand such as 6ECDCA,
tauro-6ECDCA, 6EUDCA, GW4064, 6.alpha.-MeCDCA, 6.alpha.-PrCDCA,
fexaramine, or guggulsterone In yet other embodiments, the FXR in
the claimed kit is presented in a pharmaceutical composition
suitable for oral or intravenous administration.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1A shows the expression of FXR in the primary cultures
of HSCs and HSC-T6, at mRNA level by RT-PCR.
[0022] FIG. 1B shows the expression of FXR in the primary cultures
of HSC-TS at protein level by Western blot analysis. FIG. 1B also
demonstrates that the amount of FXR in HSC increases over time
during culture and its increase parallels the expression of
.alpha.-smooth muscle actin (.alpha.SMA), a marker of HSCs
differentiation into myofibroblast-like cells.
[0023] FIG. 2A shows the expression of NTCP, BSEP, CYP7A1, and SHP
in HSC.
[0024] FIG. 2B shows the expression of these genes regulated by FXR
ligands (panel b). The results of quantitative RT-PCR in FIG. 2B
illustrates that exposure to 6-ECDCA (a synthetic FXR ligand) and
to CDCA (a natural FXR ligand) leads to a 2-fold increase of SHP
and BSEP mRNA and a 50-70% reduction of NTCP and CYP7A1 mRNA.
[0025] FIG. 3A shows results of RT-PCR and quantitative RT-PCR,
indicating that exposure of HSCs to FXR ligands 6-ECDCA (1 .mu.M),
CDCA (20 .mu.M), or GW4064 (100 nM) reduces the expression of type
I collagen as measure by assessing al mRNA expression by
methods.
[0026] FIG. 3B shows results of Northern blot analysis, which
confirm the results shown in FIG. 3B.
[0027] FIG. 4A shows a bar graph of the results of HSC
proliferation assays, indicating that 6-ECDCA does not prevent HSCs
proliferation induced by thrombin, PDGF, or TGF.sup..beta.1, as
assessed by determining [.sup.3H]-thymidine incorporation.
[0028] FIG. 4B shows results of HSC proliferation assays,
indicating that 6-ECDCA does not prevent HSCs proliferation induced
by thrombin, PDGF, or TGF.beta.1, as assessed by determining
[3H]-thymidine incorporation.
[0029] FIG. 4C shows results of HSC proliferation assays,
indicating that 6-ECDCA does not prevent HSCs proliferation induced
by thrombin, PDGF, or TGF.beta.1, as assessed by cell counting.
[0030] FIG. 4D shows that, FXR ligands do not drive HSCs to
apoptosis.
[0031] FIG. 5A shows FXR ligands-mediated inhibition of collagen al
release, as measured by determining hydroxyproline concentrations
in cell supernatants.
[0032] FIG. 5B is a bar graph showing FXR ligands-mediated
inhibition of collagen al release, as measured by determining
hydroxyproline concentrations in cell.
[0033] FIG. 6A shows that SHP overexpression in HSC-T6 abrogates al
expression on resting HSC-T6, as measured by QRT-PCR.
[0034] FIG. 6B shows results of Northern blot analysis.
[0035] FIG. 6C shows that SHP overexpression in HSC-T6 prevents al
induction caused by thrombin, TGF.beta.1, and PDGF.
[0036] FIG. 7A shows that abrogation of SHP expression, by specific
small interference RNA (siRNA), reverses al mRNA inhibition caused
by FXR ligands.
[0037] FIG. 7B shows that silencing of SHP also prevents inhibition
of al expression induced by FXR ligands on HSCs treated with
mitogenic factors such as thrombin, TGF and PDGF.
[0038] FIG. 7C shows results of Northern blot analysis confirming
the effect of SHP on al mRNA.
[0039] FIG. 8A shows the levels of collagen deposition,
hydroxyproline, and al collagen mRNA in the livers of BDL rats
treated or untreated with 6ECDCA.
[0040] FIG. 8B shows the levels of hydroxyproline in the livers of
BDL rats treated or untreated with 6ECDCA.
[0041] FIG. 8C shows the levels of al collagen mRNA in the livers
of BDL rats treated or untreated with 6ECDCA.
DEFINITIONS
[0042] "Fibrosis" refers to a condition involving the development
of excessive fibrous connective tissue, e.g., scar tissue, in a
tissue or organ. Such generation of scar tissue may occur in
response to infection, inflammation, or injury of the organ due to
a disease, trauma, chemical toxicity, and so on. Fibrosis may
develop in a variety of different tissues and organs, including the
liver, kidney, intestine, lung, heart, etc.
[0043] The term "inhibiting" or "inhibition," as used herein,
refers to any detectable positive effect on the development or
progression of a disease or condition. Such a positive effect may
include the delay or prevention of the onset of at least one
symptom or sign of the disease or condition, alleviation or
reversal of the symptom(s) or sign(s), and slowing or prevention of
the further worsening of the symptom(s) or sign(s).
[0044] As used herein, a "cholestatic condition" refers to any
disease or condition in which bile excretion from the liver is
impaired or blocked, which can occur either in the liver or in the
bile ducts. Intrahepatic cholestasis and extrahepatic cholestasis
are the two types of cholestatic conditions. Intrahepatic
cholestasis (which occurs inside the liver) is most commonly seen
in primary biliary cirrhosis, primary sclerosing cholangitis,
sepsis (generalized infection), acute alcoholic hepatitis, drug
toxicity, total parenteral nutrition (being fed intravenously),
malignancy, cystic fibrosis, and pregnancy. Extrahepatic
cholestasis (which occurs outside the liver) can be caused by bile
duct tumors, strictures, cysts, diverticula, stone formation in the
common bile duct, pancreatitis, pancreatic tumor or pseudocyst, and
compression due to a mass or tumor in a nearby organ.
[0045] Clinical symptoms and signs of a cholestatic condition
include: itching (pruritus), fatigue, jaundiced skin or eyes,
inability to digest certain foods, nausea, vomiting, pale stools,
dark urine, and right upper quadrant abdominal pain. A patient with
a cholestatic condition can be diagnosed and followed clinically
based on a set of standard clinical laboratory tests, including
measurement of levels of alkaline phosphatase, .gamma.-glutamyl
transpeptidase (GGT), 5' nucleotidase, bilirubin, bile acids, and
cholesterol in a patient's blood serum. Generally, a patient is
diagnosed as having a cholestatic condition if serum levels of all
three of the diagnostic markers alkaline phosphatase, GGT, and 5'
nucleotidase, are considered abnormally elevated. The normal serum
level of these markers may vary to some degree from laboratory to
laboratory and from procedure to procedure, depending on the
testing protocol. Thus, a physician will be able to determine,
based on the specific laboratory and test procedure, what is an
abnormally elevated blood level for each of the markers. For
example, a patient suffering from a cholestatic condition generally
has greater than about 125 IU/L alkaline phosphatase, greater than
about 65 IU/L GGT, and greater than about 17 IU/L 5' nucleotidase
in the blood. Because of the variability in the level of serum
markers, a cholestatic condition may be diagnosed on the basis of
abnormal levels of these three markers in addition to at least one
of the symptoms mentioned above, such as itching (pruritus).
[0046] A "ligand" specific for FXR refers to a natural or synthetic
compound that binds to FXR and is thereby capable of specifically
stimulating ligand-dependent FXR transcriptional activity
differentiated from the baseline level determined in the absence of
any ligand. In this application, the term "an FXR ligand" is
interchangeable with "an FXR-activating ligand."
[0047] The term "effective amount" as used herein refers to an
amount of compound (e.g., an FXR-activating ligand) that produces
an acute or chronic therapeutic effect upon appropriate dose
administration. The effect includes the prevention, correction,
inhibition, or reversal of the symptoms, signs and underlying
pathology of a disease/condition (e.g., fibrosis of the liver,
kidney, or intestine) and related complications to any detectable
extent. The exact amount and dosing schedule will depend on the
purpose of the treatment, and will be ascertainable by one skilled
in the art using known techniques (see, e.g., Lieberman,
Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art,
Science and Technology of Pharmaceutical Compounding (1999); and
Pickar, Dosage Calculations (1999)).
[0048] The term "organ" refers to a differentiated structure (as in
a heart, lung, kidney, liver, etc.) consisting of cells and tissues
and performing some specific function in an organism. This term
also encompasses bodily parts performing a function or cooperating
in an activity (e.g., an eye and related structures that make up
the visual organs). The term "organ" further encompasses any
partial structure of differentiated cells and tissues that is
potentially capable of developing into a complete structure (e.g.,
a lobe or a section of a liver).
DETAILED DESCRIPTION OF THE INVENTION
[0049] For the first time, ligands specific for the farnesoid X
receptor (FXR), particularly those capable of activating FXR at a
low concentration, are shown to be effective in treating or
preventing fibrosis in tissues or organs such as liver, kidney, and
intestine, in patients who are not suffering from a cholestatic
condition.
[0050] Without being bound to any particular theory, the present
inventor discovered that FXR plays an important role in regulating
the synthesis of collagen primarily via the actions of SHP that FXR
directly regulates in a ligand-dependent fashion. This discovery
therefore allows the use of FXR-activating ligands for the
effective prevention, treatment, and/or reversal of fibrosis in
tissues where FXR is expressed, particularly in patients who are
not suffering from any condition for which the use of FXR ligands
has been previously suggested, e.g., in cholestatic conditions
where the anti-cholestatic therapeutic effect of an FXR ligand may
also indirectly inhibit fibrosis.
I. Identification of Patient Population
[0051] The present invention relates to the prophylactic and
therapeutic use of FXR ligands in patients who: (1) suffer from
fibrosis or certain diseases/conditions that are known to lead to
fibrosis in a tissue or organ in which FXR is expressed; and (2) do
not suffer from a cholestatic condition that may secondarily cause
liver fibrosis, where such patients are treated with an FXR ligand
to inhibit ongoing liver fibrosis or prevent the development of
liver fibrosis. The description below allows for determination if a
patient falls within the population suitable for treatment pursuant
to the present invention.
A. Expression of FXR in an Organ
[0052] One must first determine the status of FXR expression in an
organ or a tissue prior to determining whether an FXR ligand may be
used to effectively inhibit fibrosis in this organ. The detection
of FXR expression can be accomplished at two different levels:
nucleic acid level and polypeptide level.
[0053] 1. FXR Expression at Nucleic Acid Level
[0054] The polynucleotide sequence encoding human FXR has been
identified by Forman et al. (Cell 81:687-93, 1995) and available as
GenBank Accession No. NM_005123. Based on this information, FXR
gene expression can be detected at nucleic acid level in a human
patient sample. A variety of methods of specific DNA and RNA
measurement using nucleic acid hybridization techniques are
commonly used (e.g., Sambrook and Russell, Molecular Cloning, A
Laboratory Manual (3rd ed.) 2001). Some methods involve an
electrophoretic separation (e.g., Southern blot for detecting DNA
and Northern blot for detecting RNA), but detection of DNA or RNA
can be carried out without electrophoresis as well (such as by dot
blot, or in situ hybridization if the detection is made within a
target tissue). The presence of nucleic acid encoding FXR in the
cells of a particular organ can also be detected by polymerase
chain reaction (PCR) or PCR-based methods, e.g., real-time PCR and
reverse transcription polymerase chain reaction (RT-PCR), using
sequence-specific primers.
[0055] 2. FXR Expression at Protein Level
[0056] The expression of FXR in an organ can be confirmed by
detecting FXR protein in a tissue sample from this organ. The amino
acid sequence of human FXR can be determined based on its coding
sequence, e.g., GenBank Accession No. NM_51023, and is set forth in
publications such as WO 00/76523. Various immunological assays
(such as enzyme-linked immune absorbent assay (ELISA), Western
blot, and immunohistochemistry) can be used by those skilled in the
art to measure the level of FXR gene product, particularly using
polyclonal or monoclonal antibodies that react specifically with
the FXR polypeptide, (e.g., Harlow and Lane, Antibodies, A
Laboratory Manual, Chapter 14, Cold Spring Harbor, 1988; Kohler and
Milstein, Nature, 256:495-497, 1975). Such techniques require
antibody preparation by selecting antibodies with high specificity
against the FXR polypeptide or an antigenic portion thereof. The
methods of raising polyclonal and monoclonal antibodies are well
established and their descriptions can be found in the literature,
see, e.g., Harlow and Lane, supra; Kohler and Milstein, Eur. J.
Immunol., 6:511-519, 1976.
[0057] Production of Antibodies Against FXR
[0058] Methods for producing polyclonal and monoclonal antibodies
that react specifically with an immunogen of interest are known to
those of skill in the art (see, e.g., Coligan, Current Protocols in
Immunology Wiley/Greene, N Y, 1991; Harlow and Lane, Antibodies: A
Laboratory Manual Cold Spring Harbor Press, N Y, 1989; Stites et
al. (eds.) Basic and Clinical Immunology (4th ed.) Lange Medical
Publications, Los Altos, Calif., and references cited therein;
Goding, Monoclonal Antibodies: Principles and Practice (2d ed.)
Academic Press, New York, N.Y., 1986; and Kohler and Milstein
Nature 256: 495-497, 1975). Such techniques include antibody
preparation by selection of antibodies from libraries of
recombinant antibodies in phage or similar vectors (see, Huse et
al., Science 246: 1275-1281, 1989; and Ward et al., Nature 341:
544-546, 1989).
[0059] In order to produce antisera containing antibodies with
desired specificity, the polypeptide of interest (e.g., human FXR)
or an antigenic fragment thereof can be used to immunize suitable
animals, e.g., mice, rats, rabbits, goats, horses, or monkeys. A
standard adjuvant, such as Freund's adjuvant, can be used in
accordance with a standard immunization protocol. Alternatively, a
synthetic antigenic peptide derived from that particular
polypeptide can be conjugated to a carrier protein and subsequently
used as an immunogen.
[0060] The animal's immune response to the immunogen preparation is
monitored by taking test bleeds and determining the titer of
reactivity to the antigen of interest. When appropriately high
titers of antibody to the antigen are obtained, blood is collected
from the animal and antisera are prepared. Further fractionation of
the antisera to enrich antibodies specifically reactive to the
antigen and purification of the antibodies can be performed
subsequently, see, Harlow and Lane, supra, and the general
descriptions of protein purification provided above.
[0061] Monoclonal antibodies are obtained using various techniques
familiar to those of skill in the art. Typically, spleen cells from
an animal immunized with a desired antigen are immortalized,
commonly by fusion with a myeloma cell (see, Kohler and Milstein,
Eur. Immunol. 6:511-519, 1976). Alternative methods of
immortalization include, e.g., transformation with Epstein Barr
Virus, oncogenes, or retroviruses, or other methods well known in
the art. Colonies arising from single immortalized cells are
screened for production of antibodies of the desired specificity
and affinity for the antigen, and the yield of the monoclonal
antibodies produced by such cells may be enhanced by various
techniques, including injection into the peritoneal cavity of a
vertebrate host.
[0062] Additionally, monoclonal antibodies may also be
recombinantly produced upon identification of nucleic acid
sequences encoding an antibody with desired specificity (e.g.,
specifically recognizing human FXR) or a binding fragment of such
antibody by screening a human B cell cDNA library according to the
general protocol outlined by Huse et al., supra. The general
principles and methods of recombinant polypeptide production
discussed above are applicable for antibody production by
recombinant methods.
[0063] Immunoassays for Detecting FXR Expression
[0064] Once antibodies specific for FXR are available, the presence
and amount of FXR in a sample, e.g., a small section of tissue, can
be measured by a variety of immunoassay methods (such as ELISA or
Western blot) providing qualitative and quantitative results to a
skilled artisan. For a review of immunological and immunoassay
procedures in general see, e.g., Stites, supra; U.S. Pat. Nos.
4,366,241; 4,376,110; 4,517,288; and 4,837,168.
[0065] (a) Labeling in Immunoassays
[0066] Immunoassays often utilize a labeling agent to specifically
bind to and label the binding complex formed by the antibody and
the target protein (e.g., human FXR). The labeling agent may itself
be one of the moieties comprising the antibody/target protein
complex, or may be a third moiety, such as another antibody, that
specifically binds to the antibody/target protein complex. A label
may be detectable by spectroscopic, photochemical, biochemical,
immunochemical, electrical, optical or chemical means. Examples
include, but are not limited to, magnetic beads (e.g.,
Dynabeads.TM.), fluorescent dyes (e.g., fluorescein isothiocyanate,
Texas red, rhodamine, and the like), radiolabels (e.g., .sup.3H,
.sup.125I, .sup.35S, .sup.14C, or .sup.32P), enzymes (e.g., horse
radish peroxidase, alkaline phosphatase, and others commonly used
in an ELISA), and colorimetric labels such as colloidal gold or
colored glass or plastic (e.g., polystyrene, polypropylene, latex,
etc.) beads.
[0067] In some cases, the labeling agent is a second antibody
bearing a detectable label. Alternatively, the second antibody may
lack a label, but it may, in turn, be bound by a labeled third
antibody specific to antibodies of the species from which the
second antibody is derived. The second antibody can be modified
with a detectable moiety, such as biotin, to which a third labeled
molecule can specifically bind, such as enzyme-labeled
streptavidin.
[0068] Other proteins capable of specifically binding
immunoglobulin constant regions, such as protein A or protein G,
can also be used as the label agents. These proteins are normal
constituents of the cell walls of streptococcal bacteria. They
exhibit a strong non-immunogenic reactivity with immunoglobulin
constant regions from a variety of species (see, generally,
Kronval, et al. J. Immunol., 111:1401-1406 (1973); and Akerstrom,
et al., J. Immunol., 135:2589-2542 (1985)).
[0069] (b) Immunoassay Formats
[0070] Immunoassays for detecting a target protein of interest
(e.g., FXR) from samples may be either competitive or
noncompetitive. Noncompetitive immunoassays are assays in which the
amount of captured target protein is directly measured. In one
preferred "sandwich" assay, for example, the antibody specific for
the target protein can be bound directly to a solid substrate where
the antibody is immobilized. It then captures the target protein in
test samples. The antibody/target protein complex--thus immobilized
is then bound by a labeling agent, such as a second or third
antibody bearing a label, as described above.
[0071] In competitive assays, the amount of target protein in a
sample is measured indirectly by measuring the amount of an added
(exogenous) target protein displaced (or competed away) from an
antibody specific for the target protein by the target protein
present in the sample. In a typical example of such an assay, the
antibody is immobilized and the exogenous target protein is
labeled. Since the amount of the exogenous target protein bound to
the antibody is inversely proportional to the concentration of the
target protein present in the sample, the target protein level in
the sample can thus be determined based on the amount of exogenous
target protein bound to the antibody and thus immobilized. See,
e.g., Karlson et al., Lab. Invest., 70:705-710 (1994).
[0072] In some cases, western blot (immunoblot) analysis is used to
detect and quantify the presence of FXR in the samples. The
technique generally comprises separating sample proteins by gel
electrophoresis on the basis of molecular weight, transferring the
separated proteins to a suitable solid support (such as a
nitrocellulose filter, a nylon filter, or a derivatized nylon
filter) and incubating the samples with the antibodies that
specifically bind the target protein. These antibodies may be
directly labeled or alternatively may be subsequently detected
using labeled antibodies (e.g., labeled sheep anti-mouse
antibodies) that specifically bind to the antibodies against FXR.
See, e.g., Pineda et al., J. Neurotrauma, 18:625-634 (2001); Bowler
et al., J. Biol. Chem., 277:16505-16511 (2002).
[0073] Various in situ immunochemical staining methods using
antibodies against FXR are also useful for demonstrating the
presence of FXR in a tissue sample.
[0074] Other assay formats include liposome immunoassays (LIA),
which use liposomes designed to bind specific molecules (e.g.,
antibodies) and release encapsulated reagents or markers. The
released chemicals are then detected according to standard
techniques (see, Monroe et al., Amer. Clin. Prod. Rev., 5: 34-41
(1986)).
[0075] In addition, functional assays may also be performed for
detecting the presence of FXR in a tissue sample. Assays for
detecting the biological activity of FXR are generally described in
a later section.
B. Diagnosing Fibrosis
[0076] Fibrosis is a pathophysiological process in response to
tissue injury due to viral or bacterial infection, inflammation,
autoimmune disease, trauma, drug toxicity, and so on. During this
process, an excess amount of collagen is expressed and fibrous
material forms in the extracellular space of the affected tissue.
Thus, fibrosis can be generally recognized based on the distinct
morphology of fibrous tissue in a biopsy of the organ in which
fibrosis is suspected. Other means for detecting the presence of
fibrosis or developing fibrosis include computerized axial
tomography (CAT or CT) scan, ultrasound, magnetic resonance imaging
(MRI), and monitoring the level of one or more serum markers known
to be indicative of fibrosis (e.g., various types of
collagens).
[0077] The precise manner of diagnosing fibrosis also varies
depending on the organ where the fibrotic process takes place. For
instance, biopsies are generally effective for diagnosing fibrosis
of most organs, whereas endoscopy involving a fiber optic
instrument (e.g., a sigmoidoscope or a colonoscope) can be a less
traumatic alternative to detect fibrosis of certain organs such as
the intestine.
[0078] 1. Biopsy for Detecting Liver Fibrosis
[0079] Standard procedures have been established for obtaining
biopsy from a given organ. For example, a liver specimen can be
obtained during exploratory surgery, but is more often obtained by
inserting a biopsy needle through the skin and into the liver.
Before this procedure, termed percutaneous liver biopsy, is
performed, the person receives a local anesthetic. Ultrasound or CT
scans may be used to locate the abnormal area from which the
specimen is to be taken.
[0080] In transvenous liver biopsy, a catheter is inserted into a
neck vein, threaded through the heart, and placed into one of the
hepatic veins that drain the liver. The needle of the catheter is
then inserted through the wall of the vein into the liver. This
procedure is less likely to injure the liver than is percutaneous
liver biopsy. It is especially useful in people who bleed easily,
which is a complication of severe liver disease.
[0081] Upon obtaining a liver biopsy, the sample is examined and
given a score to indicate the presence and level of fibrosis in the
sample. Most frequently used scoring systems include the METAVIR or
modified HAI (ISHAK) scoring system. The Knodell scoring system can
also be used for analyzing the liver sample. The criteria used in
scoring liver samples are well established and known to those of
skilled in the art. For example, the METAVIR system provides five
gradings: F0 indicates the absence of fibrosis; F1 indicates portal
fibrosis without septa; F2 indicates portal fibrosis and some
septa; F3 indicates septal fibrosis without cirrhosis; and F5
indicates the presence of cirrhosis. See, e.g., Bedossa and
Poynard, Hepatology 24:289-293, 1996.
[0082] Biopsy is not only useful for the diagnosis of liver
fibrosis, it can also aid physicians to assess the effectiveness of
fibrosis treatment/prevention methods of the present invention by
monitoring the progression of fibrosis using methodologies known in
the art. See, e.g., Poynard et al., Lancet 349:825, 1997.
[0083] 2. Serum Markers for Liver Fibrosis
[0084] There are numerous known serum markers whose level can be
indicative of the presence and/or severity of liver fibrosis. Blood
tests measuring markers, e.g., hyaluronic acid, laminin, undulin
(type IV collagen) pro-peptides from types I, II, and IV collagens,
lysyl oxidase, prolyl hydroxylase, lysyl hydroxylase, PIIINP, PICP,
collagen VI, tenascin, collagen XIV, laminin P1, TIMP-1, MMP-2,
.alpha.2 macroglobulin, haptoglobin, gamma glutamyl transpeptidase,
.gamma. globulin, total bilirubin, apolipoprotein A1, etc.,
according to the established methods can thus be useful for both
the diagnosis of fibrosis and monitoring of fibrosis progression in
the liver.
[0085] 3. Other Markers
[0086] Additional markers, such as nucleic acid markers, can be
used for detecting and/or monitoring fibrosis. For instance, Wnt-4
has recently been indicated in laboratory experiments as a gene
that plays an important role in renal fibrosis, where its mRNA
expression is significantly increased in the fibrotic tissue in the
kidney (see, e.g., Surendran et al., J Pediatr. 140:119-24, 2002).
The quantitative detection of gene expression of this type of
markers can be useful in the diagnosis and monitoring of
fibrosis.
C. Identifying Patients with Elevated Risk of Developing
Fibrosis
[0087] Because the method of the present invention is also
effective for the prevention of the onset of fibrosis or the
slowing of its progression after onset, patients with heightened
risk of fibrosis fall within the patient population suitable for
treatment using the method of the present invention. Such patients
are identified based on prior diagnosis of certain diseases and
conditions known to lead to fibrosis. The following sections
describe the means to diagnose some of these diseases and
conditions. There are, however, additional diseases/conditions that
are known to elevate a patient's risk of developing fibrosis later
in life and that can be readily diagnosed by a physician. The
treatment of patients suffering from any of these
diseases/conditions with an FXR ligand to prevent, inhibit, or
reverse fibrosis is within the contemplation of the present
inventor and within the scope of the present invention. Such
treatment may be warranted for a short through lifetime course, as
is warranted for a given patient with a given disease/condition and
as determined by one skilled in the art of treating such
patients.
[0088] 1. Liver Fibrosis
[0089] The following are some examples of diseases known to
significantly increase a patient's risk of developing liver
fibrosis: (i) chronic liver infections (including chronic hepatitis
B and hepatitis C viral infection; schistosomiasis and other
parasitic liver diseases; post-transplant bacterial, viral and
fungal infections); (ii) alcoholic liver disease; (iii)
non-alcoholic fatty liver disease (NAFLD) or non-alcoholic
steatohepatitis (NASH); (iv) drug and chemical induced liver
diseases (including methotrexate, isoniazid, oxyphenistatin,
methyldopa, chlorpromazine, tolbutamide, and amiodarone); (v)
autoimmune disease (including autoimmune hepatitis, sarcoidosis,
and lupoid hepatitis); (vi) storage diseases resulting from inborn
errors of metabolism (including Wilson's disease, hemochromatosis,
Gaucher's disease, types III, IV, VI, IX and X glycogen storage
diseases, ai-antitrypsin deficiency, Zellweger syndrome,
tyrosinemia, fructosemia, and galactosemia); (vii) vascular
derangement (including Budd-Chiari syndrome, veno-occlusive
disease, and portal vein thrombosis); and (viii) congenital hepatic
fibrosis.
[0090] Hepatitis B
[0091] Hepatitis B causes inflammation of the liver due to the
infection by hepatitis B virus (HBV, a DNA virus belonging to the
family of Hepadnaviridae). An acute HBV infection usually lead to
recovery, but rarely can also lead to acute liver failure, and
sometimes to chronic infection. The chronic infection can result in
a healthy carrier state or progress through fibrosis to cirrhosis
and its complications, including liver cancer.
[0092] Acute hepatitis B is the initial, rapid onset, short
duration illness that results from infection with HBV. About 70% of
adults with acute hepatitis B have few or no symptoms, whereas the
remaining 30% develop significant symptoms two to four months
following exposure to the HBV. The most common symptoms of acute
hepatitis B are fatigue, loss of appetite, nausea, vomiting, dark
urine, light stools, and abdominal pain over the region of the
liver. Jaundice often accompanies these other symptoms.
[0093] The diagnosis of chronic hepatitis B can be made, by
definition, only after six months from the onset of acute hepatitis
B. Most individuals with chronic hepatitis B infection remain
asymptomatic for many years, even up to two or three decades.
During this time, the patient's liver blood tests usually are at
most mildly abnormal and the inflammation and scarring (i.e.,
fibrosis) of the liver progresses slowly. Occasionally, however,
these individuals with otherwise inactive chronic hepatitis B may
develop flares (reactivation) of acute symptoms, elevated liver
blood tests, and inflammation of the liver. These flares resemble
acute hepatitis and can cause more rapid progression of liver
fibrosis.
[0094] Besides the above-described symptoms, diagnosis of hepatitis
B is confirmed by blood test detecting antibodies against HBV.
[0095] Hepatitis C
[0096] Infection by the hepatitis C virus (HCV, an RNA virus and a
member of the Flaviviridae family) is one of the most significant
health problems affecting the liver. More than 4 million Americans
(1.3% of the U.S. population) and an estimated 170 million
individuals in the world (3% worldwide) are infected with HCV.
About 85% of individuals initially infected with this virus will
become chronically infected, usually for decades. The other 15% of
HCV infected individuals simply have an acute infection.
[0097] At the beginning of an HCV infection, only about 25% of
patients exhibit the characteristic symptoms of acute hepatitis.
These symptoms include fatigue, muscular aches, poor appetite, and
low-grade fever. Rarely, yellowing of the skin and/or eyes
(jaundice) also occurs.
[0098] As the hepatitis becomes chronic, most individuals remain
asymptomatic and can only be diagnosed through routine blood work
when HCV antibodies are detected. In well compensated disease,
infected individuals may exhibit no symptoms despite the
progressive liver inflammation, necrosis, and fibrosis that is a
ubiquitous feature of the chronic infectious process. Other
patients may experience chronic or intermittent fatigue and a
diminished sense of well-being as a result of advancing disease. On
the other hand, fatigue has been described in some individuals with
relatively mild disease.
[0099] A number of diagnostic tests are currently available for HCV
infection. Screening tests are done to determine the presence of
antibodies to HCV in the blood. The enzyme immunosorbent assay
(EIA) is the conventional, initial screening test to diagnose HCV
infection by measuring specific antibodies to HCV antigens. This
test, therefore, is referred to as the anti-HCV antibody test.
Patients who have elevated liver enzymes (ALT/AST) and/or any of
the risk factors for HCV can be diagnosed to have HCV with a
greater than 95% certainty when the EIA is positive.
[0100] When an individual with low risk of HCV infection is tested
positive by EIA, confirmatory testing is conducted using a
specialized assay that likewise tests for antibodies against the
HCV proteins. This assay is called the Recombinant Immunoblot Assay
(RIBA).
[0101] Since HCV is an RNA virus, several diagnostic assays are
based on the detection of the HCV RNA in a person's blood. These
tests are referred to as molecular tests because they examine the
virus at the molecular level. The two most common systems for
measuring HCV RNA are the reverse transcription polymerase chain
reaction (RT-PCR) assay and the branched chain DNA (bDNA) assay.
Recently, a third type of assay, called transcription-mediated
amplification (TMA), has been become available.
[0102] Alcoholic Liver Disease
[0103] Alocholic liver disease (ALD) is a chronic liver disease
caused by excessive consumption of alcohol. The symptoms of ALD are
usually non-specific, and do not necessarily indicate the severity
of the underlying liver damage. General ALD symptoms include
fatigue, nausea and vomiting, diarrhea, or abdominal pains. Many
patients, even with advanced ALD marked by progressive liver
fibrosis and toxicity, may have no symptoms and their condition is
only diagnosed by liver blood tests. Only in the more advanced
stages of decompensated ALD (severe alcoholic hepatitis or
cirrhosis) will the sufferer present with more specific
liver-related symptoms such as jaundice, ascites, hematemesis, or
encephalopathy.
[0104] The diagnosis of ALD is established based on a history of
alcohol abuse, blood tests showing the presence and severity of
liver damage. Ultrasound scan of the liver can help assess the
severity of disease and exclude other conditions with similar
symptoms. Liver biopsy is the most reliable means to determine the
present and stage of ALD.
[0105] Non-Alcoholic Fatty Liver Disease
[0106] Non-alcoholic fatty liver disease (NAFLD) refers to a wide
spectrum of liver diseases ranging from simple fatty liver
(steatosis), to non-alcoholic steatohepatitis (NASH), to cirrhosis.
All of the stages of NAFLD have in common the accumulation of fat
in the hepatocytes. In NASH, the fat accumulation is associated
with varying degrees of inflammation (hepatitis) and scarring
(fibrosis) of the liver. NAFLD and NASH occur in individuals who do
not consume excessive amounts of alcohol. Yet, in many respects,
the histological picture of an NAFLD biopsy is similar to what can
be seen in liver disease caused by alcohol abuse. NAFLD and NASH
are considered the primary fatty liver diseases. The secondary
fatty liver diseases include those that occur in other types of
liver disease. Thus, alcoholic liver disease (ALD) is the most
frequent secondary fatty liver disease. Secondary fatty liver can
also occur in chronic viral hepatitis C (HCV), chronic viral
hepatitis B (HBV), chronic autoimmune hepatitis (AIH), and Wilson's
disease.
[0107] The symptoms of NAFLD and NASH are identical. They are
usually not dramatic and tend to be non-specific (as can also be
observed in other diseases). The symptoms are minimal in most
patients, who may, however, experience occasional, vague right
upper-quadrant abdominal pain. This pain characteristically is dull
and aching, without a predictable pattern of occurrence. It is not
an intense, sudden, and severe pain, as might occur with, for
example, gallstones. The abdominal pain in NAFLD and NASH is
thought to be due to the stretching of the liver covering (capsule)
when the liver enlarges and/or when there is inflammation in the
liver. In contrast to ALD, hepatitis B, or hepatitis C, symptoms of
severe, acute liver failure (e.g., jaundice, intense fatigue, loss
of appetite, nausea, vomiting, and confusion) are not observed in
NAFLD or NASH. Obesity and related conditions (e.g., diabetes,
hypertension) are frequent seen among those suffering from NAFLD or
NASH, and the classic signs of insulin resistance often dominate
the physical exam in NAFLD and NASH. Acanthosis nigricans, a dark
pigmentation of the skin of the armpits and neck, can be a sign of
insulin resistance and is frequently seen in children with NASH.
When the liver is palpated, it usually feels normal. However, when
very large amounts of fat accumulate in the liver, it can be become
quite large with a soft, rounded edge that can be easily felt by
the doctor.
[0108] In addition to the symptoms described above, a diagnosis of
NAFLD or NASH is made based on the following criteria: clinical
and/or biochemical signs of insulin resistance; chronically
elevated ALT; signs of fatty liver on ultrasound; exclusion of
other causes of elevated ALT and fatty liver. Only a liver biopsy,
however, can establish a definite diagnosis and determine the
severity of NAFLD or NASH.
[0109] Parasitic Liver Diseases
[0110] Various parasitic diseases are known to damage the liver and
lead to fibrosis or even cirrhosis. Clonorchiasis, for instance, is
an infection by the liver fluke Clonorchis sinensis. Patients
initially infected with this parasite usually have no symptoms
until the worm load reaches more than 500. Common symptoms are
chills, diarrhea, fever, lower abdominal pain, jaundice, and
swelling of the liver. To diagnose the disease, a medical history
should be taken including questions on diet, travel, regions where
previously resided. A physical examination should include gentle
palpation of the liver. Further testing includes endoscopy and
examination of stool sample for eggs.
[0111] O. tenuicollis (O. felineus) and O. viverrini are two other
parasites that are closely related to Clonorchis sinensis and can
lead to permanent liver damage. The diagnostic methods are similar
to that described above. Close comparison of the morphology of the
eggs and adult worms is necessary to distinguish the infections by
these parasites.
[0112] Schistosomiasis is another parasitic disease of liver,
gastrointestinal tract, and bladder caused by schistosomes,
trematode worms that parasitize people who come into contact with
contaminated water.
[0113] There are three main species of these trematode worms
(flukes)--Schistosoma haematobium, S. japonicum, and S.
mansoni--that cause disease in humans. Within days after infection,
a patient may develop a rash or itchy skin. Fever, chills, cough,
and muscle aches can begin within 1-2 months of infection, even
though most people have no symptoms at the early phase of
infection. Eggs of the parasites travel to the liver or pass into
the intestine or bladder. Rarely, eggs are found in the brain or
spinal cord and can cause seizures, paralysis, or spinal cord
inflammation. For people who are repeatedly infected for many
years, the parasite can damage the liver, intestines, lungs, and
bladder.
[0114] The diagnosis of schistosomasis involves examination of a
patient's stool or urine samples for the eggs and/or the adult
parasite. A blood test has been developed to detect antibodies
against this parasite. Medical history reflecting possible exposure
to contaminated water is also helpful for making a proper
diagnosis.
[0115] Autoimmune Hepatitis
[0116] Autoimmune hepatitis, also known as lupoid hepatitis,
involves inflammation of the liver caused by immune cells that
mistake the liver's normal cells for a foreign tissue or pathogen.
A person with autoimmune hepatitis has autoantibodies circulating
in the bloodstream that cause the immune system to attack the
liver. This disease is associated with other autoimmune diseases,
including: thyroiditis, type 1 diabetes, ulcerative colitis,
hemolytic anemia, and proliferative glomerulonephritis.
[0117] Symptoms of autoimmune hepatitis may include dark urine,
loss of appetite, fatigue, general discomfort, uneasiness, or ill
feeling (malaise), abdominal distention, generalized itching, pale
or clay-colored stools, nausea, and vomiting.
[0118] Diagnosis can be made based on several criteria such as
liver biopsy showing chronic hepatitis and fibrosis, abnormal liver
function tests, as well as tests associated with autoimmune
hepatitis, e.g., positive antinuclear antibodies, positive
anti-smooth muscle antibody, positive anti-liver kidney microsomal
antibody, positive anti-mitochondrial antibody, elevated
sedimentation rate, elevated serum IgG.
[0119] Sarcoidosis
[0120] Another autoimmune disease that affects the liver is
sarcoidosis. Sarcoidosis is a disease that causes small lumps, or
granulomas, due to chronic inflammation to develop in a great range
of body tissues. Sarcoidosis can appear in almost any body organ,
but most often starts in the lungs or lymph nodes. It also affects
the eyes, liver and skin; and less often the spleen, bones, joints,
skeletal muscles, heart and central nervous system (e.g., brain and
spinal cord). In the majority of cases, the granulomas clear up
with or without treatment. In cases where the granulomas do not
heal and disappear, the tissues tend to remain inflamed and become
fibrotic.
[0121] Neonatal Liver Diseases
[0122] Neonatal liver diseases refer to severe liver disorders that
occur in newborns in the neonatal period (i.e., the first 60 days
of life). The possible causes of these disorders may include viral
infection, hereditary metabolic diseases, neoplasia, and vascular
problems. The infants affected frequently have jaundice, do not
gain weight and grow normally, and have enlarged liver and spleen.
The infants cannot absorb vitamins for proper growth.
[0123] In addition to the above symptoms, the diagnosis of neonatal
liver diseases is aided by liver biopsy, especially in the cases
where the condition is not caused by viral infection.
[0124] Wilson's Disease
[0125] Wilson's Disease is an inherited autosomal recessive
disorder in which too much copper accumulates in the body. Although
the accumulation of copper begins at birth, symptoms of the
disorder appear later in life, between the ages of 6 and 40. A
diagnostic feature of Wilson's Disease is what is called a
Kayser-Fleischer ring, a deep copper-colored ring around the edge
of the cornea. It represents copper deposits in the eye.
[0126] The most significant clinical consequence for about 40
percent of patients with Wilson's Disease is liver disease. In
other patients, the first symptoms are neurological or psychiatric
or both, and include tremor, rigidity, drooling, difficulty with
speech, abrupt personality change, grossly inappropriate behavior,
and inexplicable deterioration of performance at school or work,
neurosis or psychosis.
[0127] Wilson's Disease can also be diagnosed by genetic testing to
identify both copies of mutated gene, which has been localized to
chromosome 13 between 13q14.3-q21.1.
[0128] Hemochromatosis
[0129] Hemochromatosis is an inherited disorder of excessive body
accumulation of iron. It is common among the white population,
affecting approximately 1 in 400 individuals of European ancestry.
Hemochromatosis patients are believed to absorb from their diet
excessive amounts of iron, which becomes accumulated over time in
the liver, bone marrow, pancreas, skin, and testicles.
[0130] Patients with early hemochromatosis have no symptoms, and
the disease may be discovered when elevated iron blood levels are
noted by routine blood testing. In males, symptoms may not appear
until 40-50 years of age. Iron deposits in the skin cause darkening
of the skin. Since females lose iron through menstrual blood loss,
they develop organ damage from iron accumulation 15-20 years later
than men on average.
[0131] Iron deposits in the pituitary gland and testicles cause
shrinkage of the testicles and impotence. Iron deposits in the
pancreas cause a decrease in insulin production resulting in
diabetes mellitus. Iron deposits in the heart muscle can cause
heart failure as well as abnormal heart rhythms. Iron accumulation
in the liver causes scarring of the liver (fibrosis and cirrhosis)
and an increased risk of developing liver cancer.
[0132] Initial screening for hemochromatosis involves tests for
levels of blood iron and ferritin, the latter is a blood protein
that serves as an indicator of the amount of iron stored in the
body. Blood iron and ferritin levels are high in patients with.
Since ferritin can also be elevated in certain infections, such as
viral hepatitis and other inflammations in the body, ferritin
increase alone is not sufficient to accurately diagnose
hemochromatosis.
[0133] The most accurate test for hemochromatosis is measuring the
iron content of liver tissue obtained by a biopsy. A biopsy
involves the removal of a sample of liver tissue for analysis and
is usually performed with a needle under local anesthesia. After
numbing the skin and the underlying tissues, the doctor inserts a
needle into the liver through the right lower rib cage, sometimes
under ultrasound guidance. The tissue obtained by the needle is
studied under a microscope for liver damage or cirrhosis. The
amount of iron in the liver is usually significantly elevated in
hemochromatosis.
[0134] Finally, genetic testing can effectively confirm a diagnosis
of hemochromatosis. The gene for hereditary hemochromatosis, HFE,
was identified in 1996 and can be identified in blood testing of 90
percent of patients with northern European ancestry.
[0135] Glycogen Storage Diseases
[0136] Glycogen storage diseases (GSD), also known as glycogenoses,
are genetically linked metabolic disorders that involve the enzymes
regulating glycogen metabolism and are characterized by deposition
of an abnormal type of quantity of glycogen in the tissues. GSDs
often manifest the symptoms early in a patient's infancy or
childhood. In some cases, however, the conditions may go undetected
until adulthood or even old age. Varying by type, there are four
major symptoms that typically lead a doctor to suspect GSDs: low
blood sugar, enlarged liver, retarded growth, and an abnormal blood
biochemistry profile. A definitive diagnosis is obtained by biopsy
of the affected organ or organs, where the biopsy sample is tested
for its glycogen content and assayed for enzyme activity. There are
DNA-based techniques for diagnosing some GSDs from more easily
available samples, such as blood or skin. These DNA techniques can
also be used for prenatal testing.
[0137] In certain types of GSDs, disruption of glycogen metabolism
often leads to the accumulation of abnormal metabolic by-products,
which can damage organs such as the liver and the kidneys. Among
all GSDs, types III, IV, VI, IX, and X are the most relevant to the
onset of liver fibrosis.
[0138] Type III glycogen storage disease (Cori's disease) is
characterized by the absence of debranching enzyme,
amylo-1,6-glucosidase which causes the accumulation of a
polysaccharide of the limit dextrin type. The structure of glycogen
stored in the liver and muscle is abnormal and the amount is
markedly increased. Most noticeable is the short outer branch of
the glycogen, thus only a small portion of this abnormal glycogen
is functionally active as an accessible source of glucose. Symptoms
of this disorder include enlargement of the liver, hypoglycemia,
ketosis, hyperuricemia, hyperlipemia, etc. In youths affected by
this disease, growth is impaired, puberty is often delayed, and
bones may be weakened by osteoporosis. Blood platelets are also
affected and frequent nosebleeds and easy bruising are common.
Primary symptoms improve with age, but after age 20-30, liver
tumors, chronic renal disease, and gout may appear. The diagnosis
of this condition is based on the above symptoms and confirmed by
examining of the glycogen structure.
[0139] Type IV glycogen storage disease (Andersen's disease) is
characterized by the absence of branching enzyme (.alpha.-1,4 to
.alpha.-1,6), with the result that the glycogen constructed in type
IV GSD has very long outer branches and is insoluble. As the
abnormal glycogen accumulates in the cells, cell death leads to
organ damage. Infants born with GSD IV appear normal at birth, but
are diagnosed with enlarged livers and failure to thrive within
their first year. Infants who survive beyond their first birthday
develop cirrhosis of the liver by age 3-5 and die as a result of
chronic liver failure. The diagnosis of this disease is aided by
the detection of the characteristic abnormal glycogen
structure.
[0140] Type VI glycogen storage disease (Hers' disease) is caused
by liver phosphorylase deficiency, which blocks the first step of
glycogenolysis. In contrast to most other GSDs, which involve
autosomal mutations, type VI GSD is linked to the X chromosome. In
this disease, phosphorylase deficiency results in increased amount
of glycogen in the liver. Symptoms include enlargement of the
liver, hypoglycemia, ketosis, hyperuricemia, hyperlipemia, etc. Low
blood sugar is one of the key symptoms. Mildly retarded growth can
occur in affected youths.
[0141] Type IX glycogen storage disease is caused by liver glycogen
phosphorylase kinase (PhK) deficiency and, symptom-wise, is very
similar to type VI GSD. The main differences are that the symptoms
may not be as severe and may also include exercise-related problems
in the muscles, such as pain and cramps. The symptoms abate after
puberty with proper treatment. Most cases of GSD IX are linked to
the X chromosome and therefore affect males. Enzymatic testing and
measuring glycogen content provides a definitive diagnosis.
[0142] An enzyme that activates glycogen phosphorylase to stimulate
glycogen breakdown in various tissues, PhK is a tetrameric enzyme
made up of four different subunits (.alpha..beta..gamma..delta.)
that are responsible for various subtypes of GSD IX, that differ
both in tissue affected (liver/muscle/RBC/Cardiac tissue) and in
mode of inheritance. The genes for .alpha., .beta., and .gamma.
subunits have been cloned and mapped to X chromosome (.alpha.),
chromosome 16q12 (.beta.), and chromosome 7p12 (.gamma.).
[0143] The most common form of PhK deficiency is the X-linked form,
and it mainly affects the liver. Clinically patients with this form
of PhK deficiency present in infancy with hepatomegaly, mild
hypoglycemia, growth retardation, hyperlipidemia, hyperketosis, and
delayed motor development. The symptoms improve with age, and adult
patients have normal stature and normal liver.
[0144] The autosomal recessive form of PhK deficiency affects both
liver and muscle depending on whether mutation has occurred in the
.alpha. or .beta. subunit of the enzyme. Symptoms could range from
mild myopathy with muscle cramping to severe myopathic form.
[0145] Type X glycogen storage disease is an autosomal recessive
disease caused by a deficiency of a cyclic adenosine monophosphate
(AMP)-dependent phosphoglycerate mutase and presents symptoms
similar to GSDs VI and IX. The gene involved in this condition has
been mapped to chromosome 7p12-p13.
[0146] .alpha.1-Antitrypsin Deficiency
[0147] .alpha.1-antitrypsin deficiency is a hereditary disease in
which a lower-than-normal level of .alpha.1-antitrypsin is present
in the lungs. .alpha.1-antitrypsin is a protein that is made in the
liver and then released into the bloodstream. In normal lungs,
.alpha.1-antitrypsin protects the lungs from the harmful effects of
neutrophil elastase. In a patient suffering from
.alpha.1-antitrypsin deficiency, damage to lung tissues by
neutrophil elastase may lead to emphysema and breathing difficulty.
The most noticeable symptom of this disorder is the shortness of
breath during daily activities. Liver diseases associated with this
disease include those with early onset, such as hepatitis or
neonatal jaundice, or those with late onset, such as cirrhosis and
primary cancer of the liver (Hepatoma).
[0148] .alpha.1-antitrypsin deficiency can be diagnosed based on
symptoms such as shortness of breath and a chronic cough. Blood
test for .alpha.1-antitrypsin level and pulmonary function test can
also aid the diagnosis. Since this disease is caused by an
autosomal recessive mutation, the most definitive diagnosis is
based on results of genetic testing.
[0149] Gaucher's Disease
[0150] Gaucher's disease is caused by a genetic defect in an enzyme
glucocerebrosidase. This enzyme helps the body break down the
chemical glucocerebroside. The defective enzyme in patients with
Gaucher's disease leads to the accumulation of glucocerebroside in
the spleen, liver, and lymph nodes. Gaucher's disease is most
common in Ashkenazi Jews (those of European origin), however,
variants have been described in all ethnic groups. Depending on the
precise type of the disease, affected patients may have varying
degrees of symptoms. The most frequent early sign of Gaucher's
disease is enlargement of the spleen. There can be associated
fatigue, anemia, and a low count of platelets. Severe bone
involvement can lead to pain and collapse (aceptic necrosis) of the
bone of the hips, shoulders, and spine. Poor lung and brain
function, and even seizures, can occur.
[0151] The diagnosis of Gaucher's disease is confirmed by a special
test in which the activity of .beta.-glucocerbrosidase of
fibroblasts activity is measured. Patients with Gaucher's disease
have less than 15% of the normal level of glucocerebrosidase.
Because of the genetic nature of the disease, diagnosis based on
gene testing is also possible.
[0152] Zellweger Syndrome
[0153] Zellweger syndrome is a genetic disorder, also called the
cerebrohepatorenal syndrome, characterized by the reduction or
absence of peroxisomes in the cells of the liver, kidneys, and
brain. Zellweger syndrome is one of a group of disorders called the
leukodystrophies, all of which affect the myelin sheath, the fatty
covering which acts as an insulator on nerve fibers in the brain.
The most common features of Zellweger syndrome include an enlarged
liver, high levels of iron and copper in the blood, and vision
disturbances. Some affected infants may show prenatal growth
failure. Symptoms at birth may include lack of muscle tone and an
inability to move. Other symptoms may include unusual facial
characteristics, mental retardation, seizures, and an inability to
suck and/or swallow. Jaundice and gastrointestinal bleeding may
also occur.
[0154] This disease is caused by mutations in any of several
different genes involved in peroxisome formation. These genes lie
on at least two different chromosome locations including chromosome
2 (region 2p15) and chromosome 7 (region 7q21-q22). Thus, its
diagnosis can be confirmed by genetic testing.
[0155] Tyrosinemia
[0156] Hereditary tyrosinemia is a genetic inborn error of
metabolism associated with severe liver disease in infancy. The
disease is inherited in an autosomal recessive fashion. The
clinical features of the disease tend to fall into two categories:
in the acute form of the disease, abnormalities appear in the first
month of life. Babies may show poor weight gain, enlarged liver and
spleen, distended abdomen, swelling of the legs and increased
tendency to bleeding, particularly nose bleeds. Jaundice may or may
not be prominent. In a more chronic form of tyrosinemia,
enlargement of the liver and spleen are prominent, the abdomen is
distended with fluid, weight gain may be poor, and vomiting and
diarrhea occur frequently. Affected patients usually develop
cirrhosis and its complications. In older patients, there is an
increases risk of liver cancer.
[0157] In diagnosing this disease, liver tests are often used. Low
serum albumin and clotting factors are frequently found. The liver
enzymes transaminases may be mildly to moderately elevated, but the
bilirubin is increased to a variable extent. Because of the
biochemical defect, abnormal products may be measured in the urine
which confirm diagnosis. These are parahydroxy phenylactic acid and
parahydroxy phenylpyruvic acid. In addition, succinylacetone and
succinylacetoacetate are found in the urine. There may be
hypoglycemia and evidence of loss of certain substances in the
urine including sugar, protein, and amino acids. The basic
biochemical defect is an abnormality in a key enzyme in the
metabolism of an essential amino acid, phenylalanine. The enzyme is
fumarylacetoacetate hydrolase (FAH), which is markedly reduced in
affected patients. Prenatal diagnosis is possible and can be
performed by measuring succinylacetone in the amniotic fluid or
fumarylacetoacetate hydrolase (FAH) in amniotic fluid cells.
[0158] Fructosemia
[0159] Fructosemia, also known as fructose intolerance or fructose
aldolase B-deficiency, is a metabolic disease caused by the absence
of an enzyme, 1-phosphofructaldolase (i.e., fructose aldolase B).
Hereditary fructose intolerance is inherited as an autosomal
recessive disease. It may be as common as 1 in 20,000 in some
European countries. In fructose-intolerant people, ingestion of
fructose (fruit sugar) and sucrose (cane or beet sugar, table
sugar) produces complicated chemical changes that cannot be
corrected because of the absence of the enzyme
1-phosphofructaldolase. Ingestion of fructose causes profound
hypoglycemia and progressive liver damage. The diagnosis of this
condition is based on the fructose intolerant symptoms, test
results that measure the level of fructose aldolase B, and genetic
analysis to identify mutation(s) in the gene.
[0160] Galactosemia
[0161] Galactosemia is a rare hereditary disease leading not only
to cirrhosis in infants, but more seriously, to early devastating
illness if not diagnosed quickly. This disease is caused by
elevated levels of galactose in the blood resulting from a
deficiency of the liver enzyme, GALT (galactose-1-phosphate uridyl
transferase), required for its metabolism. Galactosemia is
inherited as an autosomal recessive trait. There are two forms of
the disease, GALT deficiency (classic galactosemia) and galactose
kinase deficiency. Of the two, the GALT deficiency is the most
severe. The GALT gene is in chromosome 9p13.
[0162] People with galactosemia are unable to metabolize the simple
sugar galactose. If an infant with galactosemia is given milk,
galactose builds up in the infants system causing damage to the
liver, brain, kidneys and eyes. Individuals with galactosemis
cannot tolerate any form of milk (human or otherwise) or any other
galactose-containing food. Exposure to milk products will result in
liver damage, mental retardation, cataract formation, and kidney
failure. Typically, a newborn infant with galactosemia, upon being
fed milk, will develop jaundice, vomiting, lethargy, irritability,
and convulsions. The liver is enlarged and the blood sugar may be
low. Continued feeding of milk products to the infant leads to
cirrhosis of the liver, cataract formation in the eye resulting in
partial blindness, and mental retardation.
[0163] The symptoms of galactosemia include jaundice, vomiting,
poor feeding, poor weight gain, lethargy, irritability,
convulsions, and opacities in the lenses of the eyes. The signs
detected include hepatomegaly, hypoglycemia, aminoaciduria,
cirrhosis, ascites, cataracts, and mental retardation.
[0164] The diagnosis is usually based on the demonstration of a
lack of activity of the enzyme GALT in erythrocytes. Prenatal
diagnosis is also feasible by direct measurement of the enzyme.
DNA-based testing is also possible for diagnosing the
condition.
[0165] Chronic Inflammatory Condition
[0166] Chronic inflammatory hepatic condition is a progressive
liver disease and can lead to fibrosis or death if complete liver
failure occurs. Cause of this condition may be bacterial or viral
infection, exposure to toxic agents, or in some cases, unknown.
[0167] Clinical signs of this disease can range from mild to
severe. Typical symptoms may include fatigue, weight loss, nausea,
vomiting, increased urination and defecation, fluid collecting in
the abdomen (ascites), jaundice, blood in the stool, and abnormal
neurological behavior. A definitive diagnosis of chronic
inflammatory hepatic disease is made by examination of a biopsy
specimen.
[0168] Vascular Derangement
[0169] Vascular disorders may also contribute to the heightened
risk of liver fibrosis. The most frequent abnormality of
circulation to affect the liver is congestive heart failure, which
leads to reduced outflow of blood from the liver. Other causes of
hepatic congestion include constrictive pericarditis, obstruction
of the inferior vena cava and hepatic veins (Budd-Chiari syndrome),
occlusion of the small hepatic veins (veno-occlusive disease), and
portal vein thrombosis. Increased resistance to hepatic venous
outflow results in congestive hepatomegaly, dilation of hepatic
venules and sinusoids, and hypoxia. The hypoxia in turn leads to
hepatocyte damage with possible fibrosis and cirrhosis.
[0170] Drug Toxicity
[0171] Toxins such as alcohol, drugs, or poisons can cause
hepatitis directly (by damaging liver tissue) or indirectly (by
reducing defenses or stimulating an autoimmune response); both can
lead to liver fibrosis.
[0172] Alcohol is primarily metabolized by the liver, producing
various metabolites that can cause liver damage. The risk of
hepatic toxicity increases if more than 40 grams of alcohol, or
about four drinks, are consumed per day.
[0173] Numerous medications can damage the liver, ranging from
mild, asymptomatic alteration in liver chemistries to hepatic
failure and death. Liver toxicity may or may not be dose-related.
Dilantin (an anti-convulsant), methotrexate (a drug used to treat
various neoplastic diseases, psoriasis and rheumatoid arthritis),
chlorpromazine (an anti-psychotic drug), and isoniazid (an
anti-tuberculosis agent) are examples of drugs that can cause
"viral-like" hepatitis.
[0174] Both environmental and industrial toxins can cause a wide
variety of changes in the liver. Hepatic damage is not necessarily
dose-dependent and can range from mild, asymptomatic inflammation
to fulminant failure or progressive fibrosis and cirrhosis.
[0175] Patients with risk of developing liver fibrosis due to their
exposure to drugs or toxins are generally identified by review of
their medical history and continued monitoring of their liver
function.
[0176] Congenital Hepatic Fibrosis
[0177] Congenital hepatic fibrosis (CHF) is a rare hereditary
disorder characterized by periportal fibrosis with irregularly
shaped proliferating bile ducts, intrahepatic portal hypertension,
and esophageal varices. CHF is associated with an impairment of
renal functions, usually caused by an autosomal recessive
polycystic kidney disease (ARPKD). The disease is inherited in an
autosomal recessive fashion, but sporadic cases do occur. The
typical liver abnormalities include hepatomegaly, portal
hypertension, and hepatic fibrosis. Many patients with CHF also
show bleeding from the gastrointestinal tract (e.g., from stomach
and intestines). Diagnosis of CHF is made based on these symptoms,
especially the association with ARPKD. Genetic testing is also a
possible means for diagnosing the condition.
[0178] 2. Intestinal Fibrosis
[0179] Several diseases are known to increase a patient's risk of
developing intestinal fibrosis, including: Crohn's disease,
ulcerative colitis, post-radiation colitis, and microscopic
colitis.
[0180] Crohn's Disease
[0181] Crohn's disease is a chronic inflammatory disease of the
intestines. It primarily causes ulcerations (breaks in the lining)
of the small and large intestines, but can affect the digestive
system anywhere from the mouth to the anus. It also is called
granulomatous enteritis or colitis, regional enteritis, ileitis, or
terminal ileitis. The cause of Crohn's disease is not yet
understood. It has traditionally been classified as an autoimmune
disease and some scientists now suspect that infection by certain
bacteria, such as strains of mycobacterium, may be the cause of
this disease.
[0182] Common symptoms of Crohn's disease include abdominal pain,
diarrhea, and weight loss. Less common symptoms include poor
appetite, fever, night sweats, rectal pain, and rectal bleeding.
The symptoms of Crohn's disease are dependent on the location, the
extent, and the severity of the inflammation. The different
subtypes of Crohn's disease and their symptoms are: [0183] (1)
Crohn's colitis is inflammation that is confined to the colon.
Abdominal pain and bloody diarrhea are the common symptoms. Anal
fistulae and peri-rectal abscesses also can occur. [0184] (2)
Crohn's enteritis refers to inflammation confined to the small
intestine (the first part, called the jejunum or the second part,
called the ileum). Involvement of the ileum alone is referred to as
Crohn's ileitis. Abdominal pain and diarrhea are the common
symptoms. Obstruction of the small intestine also can occur. [0185]
(3) Crohn's terminal ileitis is inflammation that affects only the
very end of the small intestine (terminal ileum), the part of the
small intestine closest to the colon. Abdominal pain and diarrhea
are the common symptoms. Small intestinal obstruction also can
occur. [0186] (4) Crohn's entero-colitis and ileo-colitis are terms
to describe inflammation that involve both the small intestine and
the colon. Bloody diarrhea and abdominal pain are the common
symptoms. Small intestinal obstruction also can occur.
[0187] Crohn's terminal ileitis and ileo-colitis are the most
common types of Crohn's disease. Up to one third of patients with
Crohn's disease may have one or more of the following conditions
involving the anal area: [0188] (1) Swelling of the tissue of the
anal sphincter, the muscle at the end of the colon that controls
defecation. [0189] (2) Development of ulcers and fissures (long
ulcers) within the anal sphincter. These ulcers and fissures can
cause bleeding and pain with defecation. [0190] (3) Development of
anal fistulae (abnormal tunnels) between the anus or rectum and the
skin surrounding the anus). Mucous and pus may drain from the
openings of the fistulae on the skin. [0191] (4) Development of
pen-rectal abscesses (collections of pus in the anal and rectal
area). Peri-rectal abscesses can cause fever, pain and tenderness
around the anus.
[0192] The diagnosis of Crohn's disease is suspected in patients
with fever, abdominal pain and tenderness, diarrhea with or without
bleeding, and anal diseases. Laboratory blood tests may show
elevated white cell counts and sedimentation rates, both of which
suggest infection or inflammation. Other blood tests may show low
red blood cell counts (anemia), low blood proteins, and low body
minerals, reflecting loss of these elements due to chronic
diarrhea.
[0193] Barium x-ray studies can be used to define the distribution,
nature, and severity of the disease. Barium is a chalky material
that is visible by x-ray and appears white on x-ray films. When
barium is ingested orally (Upper GI Series), it fills the intestine
and pictures (x-rays) can be taken of the stomach and the small
intestines. When barium is administered through the rectum (Barium
Enema), pictures of the colon and the terminal ileum can be
obtained. Barium x-rays can show ulcerations, narrowing, and,
sometimes, fistulae of the bowel.
[0194] Direct visualization of the rectum and the large intestine
can be accomplished with flexible viewing tubes (colonoscopes).
Colonoscopy is more accurate than barium x-rays in detecting small
ulcers or small areas of inflammation of the colon and terminal
ileum. Colonoscopy also allows for small tissue samples (biopsies)
to be taken and sent for examination under the microscope to
confirm the diagnosis of Crohn's disease. Colonoscopy also is more
accurate than barium x-rays in assessing the degree (activity) of
inflammation.
[0195] Computerized Axial Tomography (CAT or CT) scanning is a
computerized x-ray technique that allows imaging of the entire
abdomen and pelvis. It can be especially helpful in detecting
abscesses.
[0196] Most recently, video capsule endoscopy has been added to the
list of diagnostic tests for diagnosing Crohn's disease. For video
capsule endoscopy, a capsule containing a minature video camera is
swallowed. As the capsule travels through the small intestine, it
sends video images of the lining of the small intestine to a
receiver carried on a belt at the waist. The images are downloaded
and then reviewed on a computer. The value of video capsule
endoscopy is that it can identify the early, mild abnormalities of
Crohn's disease. Video capsule endoscopy may be particularly useful
when there is a strong suspicion of Crohn's disease but the barium
x-rays are normal. (Barium x-rays are not as good at identifying
early, mild Crohn's disease.)
[0197] Ulcerative Colitis
[0198] Ulcerative colitis is another chronic inflammatory condition
that is closely related to Crohn's disease but usually involves
only the rectum, or rectum and sigmoid colon at the distal end of
the colon. These are called ulcerative proctitis and
procto-sigmoiditis, respectively. Collectively, Crohn's disease and
ulcerative colitis are frequently referred to as inflammatory bowel
disease (IBD).
[0199] Common symptoms of ulcerative colitis include rectal
bleeding and diarrhea, but there is a wide range of symptoms among
patients with this disease. Variability of symptoms reflects
differences in the extent of disease (i.e., the amount of the colon
and rectum that are inflamed) and the intensity of inflammation.
Generally, patients with inflammation confined to the rectum and a
short segment of the colon adjacent to the rectum have milder
symptoms and a better prognosis than patients with more widespread
inflammation of the colon. The different types of ulcerative
colitis are classified according to the location and the extent of
inflammation: [0200] (1) Ulcerative proctitis refers to
inflammation that is limited to the rectum. In many patients with
ulcerative proctitis, mild intermittent rectal bleeding may be the
only symptom. Other patients with more severe rectal inflammation
may, in addition, experience rectal pain, urgency (sudden feeling
of having to defecate and a need to rush to the bathroom for fear
of soiling), and tenesmus (ineffective, painful urge to move one's
bowels). [0201] (2) Proctosigmoiditis involves inflammation of the
rectum and the sigmoid colon (a short segment of the colon
contiguous to the rectum). Symptoms of proctosigmoiditis, like that
of proctitis, include rectal bleeding, urgency, and tenesmus. Some
patients with proctosigmoiditis also develop bloody diarrhea and
cramps. [0202] (3) Left-sided colitis involves inflammation that
starts at the rectum and extends up the left colon (sigmoid colon
and the descending colon). Symptoms of left-sided colitis include
bloody diarrhea, abdominal cramps, weight loss, and left-sided
abdominal pain. [0203] (4) Pancolitis or universal colitis refers
to inflammation affecting the entire colon (right colon, left
colon, transverse colon and the rectum). Symptoms of pancolitis
include bloody diarrhea, abdominal pain and cramps, weight loss,
fatigue, fever, and night sweats. Some patients with pancolitis
have low-grade inflammation and mild symptoms that respond readily
to medications. Generally, however, patients with pancolitis suffer
more severe disease and are more difficult to treat than those with
more limited forms of ulcerative colitis. [0204] (5) Fulminant
colitis is a rare but severe form of pancolitis. Patients with
fulminant colitis are extremely ill with dehydration, severe
abdominal pain, protracted diarrhea with bleeding, and even shock.
They are at risk of developing toxic megacolon (marked dilatation
of the colon due to severe inflammation) and colon rupture
(perforation). Patients with fulminant colitis and toxic megacolon
are treated in the hospital with potent intravenous medications.
Unless they respond to treatment promptly, surgical removal of the
diseased colon is necessary to prevent colon rupture.
[0205] The diagnosis of ulcerative colitis is suggested by the
symptoms of abdominal pain, rectal bleeding, and diarrhea. As the
first step, stool specimens are collected for analysis to exclude
infection and parasites, since these conditions can cause colitis
that mimics ulcerative colitis. Blood tests may then be conducted
and show anemia and an elevated white blood cell count or
sedimentation rate (commonly referred to as SED rate). An elevated
white blood cell count and SED rate both reflect ongoing
inflammation in the colon. Confirmation of ulcerative colitis
requires a test to visualize the large intestine. Flexible tubes
inserted through the rectum (sigmoidoscopes and colonoscopes)
permit direct visualization of the inside of the colon to establish
the diagnosis and to measure the extent of the colitis. Small
tissue samples (i.e., biopsies) can be obtained during the
procedure to determine the severity of the colitis. Knowledge of
the extent and severity of the colitis is important in choosing
among treatment options. A barium enema x-ray may also indicate the
diagnosis of ulcerative colitis. During a barium enema, a chalky
substance is administered into the rectum and injected into the
colon. Barium is radio-paque and can outline the colon on x-ray
pictures. A barium enema is less accurate and useful than direct
visualization techniques in the diagnosis of ulcerative
colitis.
[0206] Post-Radiation Colitis
[0207] Post-radiation colitis is a type of persistent colon
irritation that occurs in patients who have been previously exposed
to a significant amount of irradiation, such as those who have
received radiotherapy for treating cancers. Although the general
symptoms are similar to those of non-radiation related irritated
colon conditions, such as pain and chronic diarrhea, patients
suffering from post-radiation colitis are easily identified based
on their medical history.
[0208] Microscopic Colitis
[0209] Microscopic colitis (MC) encompasses the two morphologically
distinct entities of collagenous colitis (CC) and lymphocytic
colitis (LC). Patients with MC generally present with chronic
diarrhea, which can be associated with cramping and bloating.
Endoscopic and radiological examinations are usually normal.
Histological assessment reveals inflammation consisting
predominantly of lymphocytic infiltration, and a thickened
subepithelial collagen band is diagnostic of CC. Both LC and CC can
be associated with autoimmune diseases such as celiac disease,
diabetes, arthritis, and thyroiditis, yet the precise mechanisms
involved in the pathogenesis remain unclear.
[0210] 3. Renal Fibrosis
[0211] A variety of kidney diseases and conditions are known to
increase a patient's likelihood of developing renal fibrosis,
eventually leading to end-stage renal disease and the need for
dialysis and transplant. These diseases and conditions include:
diabetic nephropathy, hypertensive nephrosclerosis, chronic
glomerulonephritis, chronic transplant glomerulopathy, chronic
interstitial nephritis, polycystic kidney disease, and other less
common diseases affecting the kidney.
[0212] Diabetic Nephropathy
[0213] Diabetic nephropathy is a kidney disease associated with
long-standing diabetes. Also known as Kimmelstiel-Wilson disease
(or syndrome), it affects the network of tiny blood vessels (the
microvasculature) in the glomerulus, a key structure in the kidney
that is composed of capillary blood vessels and is critically
necessary for the filtration of the blood.
[0214] The symptoms of this disease include excessive filtration of
protein into the urine (proteinuria), frothy urine (signifying
protein in urine), high blood pressure (hypertension), leg swelling
(worse after walking/standing), itching, nausea/vomiting,
unexplained weight loss, fatigue/lethargy, increased need to
urinate at night, and requiring less pills or insulin to control
diabetes.
[0215] Diabetic nephropathy generally causes progressively impaired
kidney function. In its severe form, this disease can lead to
kidney failure and end-stage renal disease, and a patient may
require chronic kidney dialysis or a kidney transplant. Diabetic
nephropathy is also referred to as intercapillary
glomerulonephritis.
[0216] Hypertensive Nephrosclerosis
[0217] Hypertensive nephrosclerosis is the hardening (sclerosis) of
the kidney in connection with hypertension. The kidney plays an
important role in regulating blood pressure. Kidney diseases may
affect the function of the kidneys and disrupt such regulation,
resulting in elevated blood pressure. On the other hand, kidney
damages may result from hypertension for a prolonged period, as
high blood pressure can affect the cardiovascular system by causing
the blood vessels to narrow and thicken.
[0218] At its early stage, hypertensive nephrosclerosis may not
display any significant symptoms for a long time. When present,
common symptoms include: high blood pressure, headache, neck
discomfort, fatigue, nausea or vomiting, and protein in urine
(proteinuria).
[0219] Chronic Glomerulonephritis
[0220] Glomerulonephritis is an inflammatory condition that affects
predominantly the glomeruli, the filtering heads of the nephrons in
the kidney. Chronic glomerulonephritis usually leads to end-stage
kidney disease.
[0221] The general symptoms of glomerulonephritis include blood or
protein in urine, frothy urine (usually indicative of protein in
urine), dark or pink-colored urine, leg swelling, systemic diseases
such as diabetes or autoimmune diseases with systemic
manifestations, e.g., unexplained weight loss, arthritis, or skin
rash.
[0222] There are a number of different conditions that may cause
glomerulonephritis or result from glomerulonephritis. Some of these
conditions are discussed below. One example of a
glomerulonephritis-related condition is IgA nephropathy, a kidney
disease where Ig A deposits inside the glomeruli within the kidney.
The IgA deposits prevent this filtering process, leading to the
symptoms of blood and protein in the urine and swelling in the
hands and feet. This disease causes glomerular inflammation that
ultimately results in the impairment or even the complete loss of
kidney function.
[0223] Autoimmune diseases can also give rise to
glomerulonephritis. One such example is lupus nephritis (or
glomerulonephritis secondary to lupus). In other cases, infections
by bacteria (e.g., Streptococcus) or viruses (e.g., HIV or HBV),
particularly in children under the age of ten, can cause
post-infection glomerulonephritis.
[0224] Glomerulonephritis also relates to focal segmental
glomerulosclerosis (FSGS), an illness that occurs when scar tissue
forms in some of the glomeruli of the kidney. The term "focal"
means that some of the glomeruli become scarred, while others
remain normal. The term "segmental" means that only part of an
individual glomerulus is damaged. Symptoms of FSGS include foamy
urine, swelling of the body (i.e., generalized edema, from retained
fluids), weight gain, and poor appetite.
[0225] A diagnosis can be made based on: a urinalysis, which shows
protein, with or without small amounts of blood; a renal biopsy,
which shows evidence of scarring; and an immunofluorescence
microscopy test, which shows deposits of IgM.
[0226] There are two types of Membranoproliferative
glomerulonephritis, which are kidney disorders with similar
symptoms that result in disrupted or decreased kidney function,
caused by inflammation and changes in the microscopic structure of
kidney cells. Symptoms include: blood in the urine, dark urine,
cloudy urine, decrease in urine volume, swelling of any part of the
body, changes in mental status (e.g., decreased alertness,
decreased concentration). A physical examination will reveal these
symptoms to a varying degree. A diagnosis is aided by urinalysis
and confirmed by kidney biopsies.
[0227] Rapidly progressive glomerulonephritis is a form of kidney
disease that causes damage to the internal structures of the
kidneys and rapid loss of function, with crescent-shaped
abnormalities showing on a biopsy of the kidney. Common symptoms
include: edema, dark or smoke-colored urine, blood in the urine,
decreased urine volume, fever, muscle aches, joint aches, shortness
of breath, cough, general ill-feeling, abdominal pain, loss of
appetite, diarrhea, and the like. To diagnose this condition, a
physical examination combined with blood tests and urinalysis can
reveal many of the above symptoms, as well as increased BUN and
creatinine, decreased creatinine clearance, and/or the presence of
anti-glomerular basement membrane antibodies and anti-neutrophil
cytoplasmic antibodies (ANCAs). A kidney biopsy confirms crescentic
glomerulonephritis.
[0228] Scleroderma is an autoimmune disease of the connective
tissue, also called systemic sclerosis. This condition is
characterized by the fibrosis in the skin and organs of the body.
The diagnosis of scleroderma is based on the finding of the
clinical features of the illnesses. Nearly all patients with
scleroderma have blood tests that suggest autoimmunity, antinuclear
antibodies (ANAs). A particular antibody, the anticentromere
antibody, is found almost exclusively in the limited, or CREST,
form of scleroderma. Anti-Scl 70 antibody (antitopoisomerase I
antibody) is most often seen in patients with the diffuse form of
scleroderma.
[0229] Vasculitis is a general term for a group of uncommon
diseases that feature the inflammation of the blood vessels,
leading to the damages to the walls of various blood vessels.
Laboratory testing of blood or body fluids in a patient with active
vasculitis generally indicates inflammation in the body. Depending
on the degree of organ involvement, a variety of organ function
tests may be abnormal and thus indicative of the condition. The
diagnosis of vasculitis is ultimately established after a biopsy of
involved tissue (e.g., kidney) demonstrates the pattern of blood
vessel inflammation. Depending upon the situation, an alternative
to biopsy can be an x-ray test of the blood vessels, e.g., an
angiogram.
[0230] Wegener's granulomatosis (WG) is a rare disease that affects
many different organs including the respiratory system (sinuses,
nose, windpipe, and the lungs) and the kidneys. One of the main
features of the disease is an inflammation of the blood vessels (or
vasculitis). The inflammation narrows the blood vessels and reduces
the blood flow to the affected organs, subsequently damages
affected tissues and organs.
[0231] The precise cause of WG remains unknown but is thought to
relate to an autoimmune condition. In fact, auto-antibodies are
often detected in some WG patients. One of the most common symptoms
of WG is a chronic runny nose and other cold-like symptoms that do
not respond to standard treatment. The cold symptoms gradually
worsen and could lead to sinusitis (inflammation of the sinuses),
middle ear infection (otitis media), cough, coughing of blood, and
inflammation of the lung (pleuritis and pneumonia). Other symptoms
include fever, fatigue, loss of appetite, weight loss, joint pain,
night sweats, change in urine color, and weakness. Kidney disease
is the most serious development of WG.
[0232] The blood tests of WG patients often show anemia (low red
cell count) and high white blood cell counts. If the kidneys are
involved, red blood cells are seen in the urine when viewed under a
microscope. Also, blood tests aimed at measuring kidney function
may show abnormalities. Chest X-rays are used to determine if the
lungs are involved. Kidney biopsy and CT scans of sinuses or lungs
are also important tools used in diagnosing WG.
[0233] A specific type of antibody called anti-neutrophil
cytoplasmic antibody (ANCA) is seen in the blood of about 90% of
the patients with WG. The ANCA is a type of self-antibodies against
an individual's own white blood cells (i.e., the neutrophils).
These anti-neutrophil cytoplasmic antibodies are also found in
other inflammatory conditions and diseases (such as HIV infection).
The ANCA test is useful for confirming a diagnosis of WG, but
cannot be used by itself to make a diagnosis.
[0234] Polyarteritis nodosa (PAN) is a rare autoimmune disease
characterized by spontaneous inflammation of the arteries of the
body. The most commonly involved organs include intestines and
kidneys. Impaired function or pain in any of these organs can be a
symptom. Poor blood supply to the bowels can cause abdominal pain
and bleeding. Fatigue, weight loss, and fever are also often
observed in patients. The cause of PAN is unclear, though it has
been reported following HBV infection.
[0235] The diagnosis of PAN is supported by tests that indicate
inflammation including elevation of blood sedimentation rate and
c-reactive protein. The white blood cell count and platelet count
can be elevated, while the red blood count is decreased (anemia).
Some patients may be positive for the HBV tests. Urine testing can
show the presence of protein and red blood cells in the urine. In
some cases, abnormalities can be observed in nerve function tests.
The diagnosis is confirmed by a biopsy or an angiogram of involved
tissue, which reveals the inflamed blood vessels.
[0236] In addition, Goodpasture syndrome is an autoimmune disease
characterized by a combination of lung and kidney
disease--specifically, pulmonary hemorrhage (bleeding in the lungs)
and glomerulonephritis (inflammation of the glomerulus)--due to
severe inflammation in the basement membranes of the alveolus of
the lung and the glomerulus in the kidney with the formation of
antibodies to components of the basement membrane at both sites.
Clinical symptoms include cough with bloody sputum, bloody urine,
decreased urine output, fatigue, hypertension, swelling (edema),
and unexplained weight loss. The syndrome has also been named
anti-glomerular basement membrane antibody disease.
[0237] Chronic Transplant Glomerulopathy
[0238] Chronic transplant glomerulopathy refers to a variety of
conditions that occur in patients who have received a kidney
transplant and have the characteristic changes in kidney structure
including mesangial matrix expansion, mesangial proliferation,
basement membrane thickening with double contours, and peripheral
mesangial interposition, sometimes accompanied by focal segmental
sclerosis. These changes are usually associated with marked
proteinuria, often in the nephrotic range. Diagnosis of these
conditions is made based on review of medical history (whether a
patient is a transplant receipient), urinalysis, and kidney
biopsy.
[0239] Chronic Interstitial Nephritis
[0240] Interstitial nephritis is a type of nephritis due to
disorders of the connective tissue within the kidney, severe
allergic reactions, exposure to toxic substances, transplant
rejection, urinary blockage, or other factors, resulting in
inflammation of the space between the renal tubules and may include
inflammation of the tubules. Symptoms of interstitial nephritis may
include fever, pain in the kidney area, increased or decreased
urine output, fever, mental status changes (ranging from drowsiness
to confusion to coma), nausea or vomiting, rash, swelling of the
body, weight gain due to fluid retention, and blood or protein in
the urine.
[0241] An examination of a patient suffering from interstitial
nephritis may reveal edema or fluid overload, or signs of volume
depletion, with abnormal sounds heard when listening with a
stethoscope to the heart or lungs. The blood pressure commonly is
high. A urinalysis often shows small amounts of protein and
sometimes red blood cells, renal tubular cells, and other
abnormalities. WBCs and WBC casts in the urine (particularly
eosinophils) are often seen. CBC may demonstrate eosinophilia
(higher than normal eosinophil count). Urine specific gravity and
osmolality show there is a failure to concentrate urine even when
water intake is restricted. Urine pH may show a failure to acidify
urine appropriately. Arterial blood gases and blood chemistry may
show metabolic acidosis. BUN and creatinine levels are used to
assess level of kidney functioning. RBC--urine shows increased red
blood cells indicating kidney disease. Finally, a kidney biopsy can
confirm the diagnosis of interstitial nephritis and is used to
evaluate the extent of damage to the kidney.
[0242] Polycystic Kidney Disease
[0243] Polycystic kidney disease (PKD) is a disorder that is
characterized by the growth of numerous cysts in the kidneys. The
cysts are filled with fluid. PKD cysts can replace much of the mass
of the kidneys, thereby reducing kidney function and leading to
kidney failure. When PKD causes kidneys to fail, which usually
happens only after many years, the patient requires dialysis or
kidney transplantation. About one-half of people with the primary
form of PKD progress to kidney failure or end-stage renal disease
(ESRD).
[0244] PKD can cause cysts in the liver and problems in other
organs, such as the heart and blood vessels in the brain. These
complications help doctors distinguish PKD from the usually
harmless "simple" cysts that often form in the kidneys in later
years of life.
[0245] There are two major inherited forms of PKD and a
non-inherited form. Autosomal dominant PKD is the most common,
inherited form. Symptoms usually develop between the ages of 30 and
40, but they can begin as early in childhood. About 90 percent of
all PKD cases are autosomal dominant PKD. The most common symptoms
are pain in the back and the sides (between the ribs and hips), and
headaches. The dull pain can be temporary or persistent, mild or
severe. People with autosomal dominant PKD also can experience the
following problems: urinary tract infections; hematuria (blood in
the urine); liver and pancreatic cysts; abnormal heart valves; high
blood pressure; kidney stones; aneurysms (bulges in the walls of
blood vessels) in the brain; and diverticulosis (small sacs on the
colon).
[0246] To diagnose autosomal dominant PKD, a doctor typically
observes three or more kidney cysts using ultrasound imaging. The
diagnosis is strengthened by a family history of autosomal dominant
PKD and the presence of cysts in other organs.
[0247] In most cases of autosomal dominant PKD, the person's
physical condition appears normal for many years, even decades, so
the disease can go unnoticed. Physical checkups and blood and urine
tests may not lead to diagnosis. Once cysts have formed, however,
diagnosis is possible with imaging technology. Ultrasound is used
most often. Since ultrasound imaging employs no injected dyes or
radiation and is safe for all patients, including pregnant women.
It can also detect cysts in the kidneys of a fetus.
[0248] More powerful imaging methods such as CAT scan and MRI also
can detect cysts. The advancement in molecular technology has also
made DNA testing a possibility to confirm a diagnosis of autosomal
dominant PKD before cysts develop.
[0249] Autosomal recessive PKD is a second inherited form of the
disease. It is relatively rare. Autosomal recessive PKD is caused
by a genetic defect that is different from the one that causes
autosomal dominant PKD. Parents who do not have the disease can
have a child with the disease if both parents carry the abnormal
gene and both pass the gene to their baby. The chance of this
happening (when both parents carry the abnormal gene) is one in
four. If only one parent carries the abnormal gene, the baby cannot
get the disease.
[0250] The symptoms of autosomal recessive PKD can begin in the
earliest months of life, even in the womb, so it is often called
"infantile PKD." Children born with autosomal recessive PKD usually
develop kidney failure within a few years. The severity of the
disease varies. Babies with the worst cases die hours or days after
birth. Children with an infantile version may have sufficient renal
function for normal activities for a few years. People with the
juvenile version may live into their teens and twenties and usually
suffer liver problems as well.
[0251] Children with autosomal recessive PKD display symptoms
including high blood pressure, urinary tract infections, and
frequent urination. The disease usually affects the liver, spleen,
and pancreas, and causes low blood-cell counts, varicose veins, and
hemorrhoids. Because kidney function is crucial for early physical
development, children with autosomal recessive PKD are usually
smaller than average size.
[0252] In diagnosing this disease, ultrasound imaging of the fetus
or newborn baby can reveal cysts in the kidneys, but does not
distinguish between the cysts of auto-somal recessive and autosomal
dominant PKD. An ultrasound examination of relatives' kidneys can
be helpful in making the correct diagnosis. For example, a parent
or grandparent with autosomal dominant PKD cysts could help confirm
the diagnosis of autosomal dominant PKD in a fetus or child. It is
extremely rare, although not impossible, for a person with
autosomal recessive PKD to become a parent. Because autosomal
recessive PKD tends to scar the liver, ultrasound imaging of the
liver also aids in the diagnosis.
[0253] Similar to the diagnosis of autosomal dominant PKD,
autosomal recessive PKD can also be definitively diagnosed based on
DNA analysis.
[0254] Acquired cystic kidney disease (ACKD) is a non-inherited
form of PKD and tends to occur in later years of life. ACKD often
develops in association with long-term kidney problems (e.g.,
kidney damage and scarring), especially in patients who have kidney
failure and who have been on dialysis for a long time. About 90
percent of people on dialysis for 5 years develop ACKD. Patients
with ACKD can have any underlying kidney disease, such as
glomerulonephritis or the kidney disease caused by diabetes.
[0255] The cysts of ACKD may bleed. Thus, the first noticeable
symptom of ACKD is blood in the urine, or hematuria. Diagnosis of
ACKD is confirmed using ultrasound, CAT scan, or an MRI of the
kidneys. In addition, kidney tumors, including kidney (renal)
cancer, can also develop in people with ACKD. Although renal cancer
is rare, it occurs at least twice as often in ACKD patients as in
the general population.
II. The Exclusion of Cholestatic Conditions
A. Cholestatic Conditions
[0256] Although various cholestatic conditions are likely to lead
to liver fibrosis, the present invention does not encompass the
treatment/prevention of liver fibrosis in a patient who is already
suffering from a cholestatic condition, such as primary biliary
cirrhosis, primary sclerosing cholangitis, drug-induced
cholestasis, hereditary cholestasis, and intrahepatic cholestasis
of pregnancy, cholestasis associated with total parenteral
nutrition, sepsis, and cystic fibrosis. The following describes how
to exclude patients with these cholestatic conditions when
practicing the present invention.
B. Diagnosis of Cholestatic Conditions
[0257] The typical symptoms of a cholestatic condition include
itching (pruritus), fatigue, jaundiced skin or eyes, inability to
digest certain foods, nausea, vomiting, pale stools, dark urine,
and right upper quadrant abdominal pain. Organ failure may occur in
cases of sepsis (but not from cholestasis itself), and rash or
fever may result in some cases of drug-induced cholestasis.
[0258] The diagnosis of a cholestatic condition is generally based
on the detection of elevated levels of conjugated bilirubin,
alkaline phosphatase, .gamma.-glutamyltranspeptidase (GGT), 5'
nucleotidase, bile acids, and cholesterol in a patient's blood. For
each of the above-named conditions, specific diagnostic criteria
may apply.
[0259] Primary biliary cirrhosis (PBC) is a chronic disease
characterized by slow, progressive inflammation and destruction of
the small bile ducts within the liver. The inflammation and
destruction interfere with the excretion of bile, cause scarring,
and eventually lead to cirrhosis. In the early stages of PBC, the
main problem is the build up of substances (like bile acids,
cholesterol) in the blood, which are normally excreted into the
bile. Many PBC patients have no symptoms of disease and are
diagnosed by finding an abnormality on routine liver blood tests.
Itching and fatigue are common symptoms. Other signs include
jaundice, cholesterol deposits in the skin, fluid accumulation in
the ankles and abdomen, and darkening of the skin. Several other
disorders are often associated with PBC. The most common is
impaired functioning of the tear and salivary glands, causing dry
eyes or mouth. Arthritis and thyroid problems may also be present.
Renal stones and gallstones may develop. Bone softening and
fragility leading to fractures can occur in late stages of the
disease.
[0260] PBC diagnosis is based on several indications: the patient
may have symptoms (such as itching) suggesting bile duct damage;
laboratory tests, such as the alkaline phosphatase activity test,
may confirm the diagnosis. The test for anti-mitochondrial
antibodies (AMA) is particularly useful as it is positive in nearly
all PBC patients. Infrequently, the bile ducts are X-rayed to rule
out possibilities of other causes of biliary tract disease, such as
obstruction. A liver biopsy is useful in confirming the diagnosis
and in giving information on the severity and extent of liver
damage.
[0261] The criteria for a definitive diagnosis of PBC have been
established to identify all patients with classic PBC and exclude
any patient with a questionable diagnosis. A definitive diagnosis
of PBC is made in a patient who has all three of the following:
cholestatic liver tests (alkaline phosphatase and GGT elevated more
than ALT and AST); AMA positive at a titer of greater than or equal
to 1:40; and positive reading of a diagnostic or compatible liver
biopsy.
[0262] In a patient suffering from primary sclerosing cholangitis
(PSC), the bile ducts inside and outside the liver become inflamed
and scarred. As the scarring increases, the ducts become blocked,
which leads to the buildup of bile in the liver and damages liver
cells. Various causes of PSC have been speculated, including
bacterial or viral infection or abnormalities of the immune
system.
[0263] The main symptoms of PSC are itching, fatigue, and jaundice.
An infection in the bile ducts can cause chills and fever. PSC is
diagnosed through cholangiography, which involves injecting dye
into the bile ducts and taking an X ray image. Cholangiography can
be performed as an endoscopic procedure (endoscopic retrograde
cholangiopancreatography, ERCP), through radiology or surgery, or
with magnetic resonance imaging (MRI).
[0264] Drug-induced cholestasis refers to blockage of the bile flow
from the liver due to certain medication. Many drugs can cause this
type of cholestasis. Some more common culprits include: gold salts,
nitrofurantoin, anabolic steroids, oral contraceptives,
chlorpromazine, prochlorperazine, sulindac, cimetidine,
erythromycin, tobutamide, imipramine, ampicillin, and other
penicillin-based antibiotics. Other medications can also
unexpectedly cause cholestasis in some individuals. Symptoms of
drug-induced cholestasis are similar to other cholestatic
conditions, namely, itching, jaundiced skin or eyes, very dark
urine, very pale stools, fever or rash from drug sensitivity, right
upper quadrant abdominal pain, and nausea/vomiting. A diagnosis of
drug-induced cholestasis is made based on blood tests revealing
elevated bilirubin and alkaline phosphatase levels in addition to a
careful review of medical history.
[0265] Hereditary cholestasis is an inherited form of cholestatic
condition, an autosomal recessive disease. With many symptoms
similar to those of the non-hereditary type of cholestasis, this
condition is diagnosed and distinguished from the non-hereditary
type based on the early onset of the symptoms and family medical
history. Genetic testing is the most reliable method for
identifying patients with this condition. For instance, ATP8B1
(FIC1) and ABCB11 (BSEP) have been identified as two genes involved
in hereditary cholestasis (see, e.g., van Mil et al., Semin Liver
Dis. 21:535-44, 2001; Chen et al., J Pediatr. 140:119-24,
2002).
[0266] Intrahepatic cholestasis of pregnancy (ICP) is a cholestatic
condition seen in pregnant women. Women ICP may show symptoms such
as anorexia, fatigue, greasy stools, dark urine, and epigastric
discomfort. Urinary tract infections are more common in women with
ICP than unaffected pregnant women. Finally, a deficiency of
vitamin K can develop in women who have a prolonged course of ICP.
The diagnosis of ICP is based on blood tests showing elevated
levels of bile acids and certain liver enzymes (e.g., alkaline
phosphatase, GGT, 5' nucleotidase). The presence of itching without
a primary rash also helps to confirm the diagnosis. A liver biopsy
or ultrasound is rarely needed to establish the diagnosis.
[0267] Cholestasis associated with total parenteral nutrition is a
type of cholestasis that occurs in patients who receive 100% of
their nutrition parenterally. Although the clinical features may be
similar to other cholestatic conditions, these patients are easy to
identify as they are being given liquid nutrition through a
catheter intravenously.
[0268] Potentially a life-threatening condition, sepsis is also
referred to as a "blood stream infection." This condition reflects
the body's response to an infection and features the presence of
infectious organisms (such as bacterium, virus, fungus, yeast,
parasite, etc.) or their toxins in the blood or in other tissue of
the body. Sepsis may be associated with clinical symptoms of
systemic illness, such as fever, chills, malaise, low blood
pressure, and reduced mental alertness. Diagnosis of sepsis is
based on blood cultures to detect the presence of bacteria or
yeasts, which may have spread from another site in the body.
[0269] Cystic Fibrosis (CF), caused by a genetic defect inherited
in an autosomal recessive fashion, is a chronic, progressive, and
frequently fatal disease of the body's mucus glands. The clinical
features of this disease include: chronic infections of the lungs,
emphysema, progressive respiratory insufficiency, gastrointestinal
problems (including pancreas and liver), pancreatic insufficiency
(with no secretion of trypsin and other digestive enzymes into the
intestine), intestinal obstruction at birth, continuing deficiency
of pancreatic enzymes, biliary tract obstruction, constriction of
the common bile duct, cirrhosis of the liver, recurrent episodes of
pain in the right lower part of the abdomen, adenocarcinoma of the
ileum, heart problems such as cor pulmonale, and reproductive
problems such as male infertility. Laboratory tests are necessary
for diagnosing CF. A CF patient often shows positive sweat test
results, lack of trypsin in the stool (and high level of trypsin in
blood serum). The gene implicated in CF has been identified, thus
DNA testing is the most reliable diagnostic tool for this
condition.
III. FXR Ligands
A. Assays for Identifying FXR Ligands
[0270] Several assay systems have been established for identifying
FXR ligands, particularly those with high potency to activate FXR.
For example, a candidate compound can be tested in a cell-free
co-regulator recruitment assay to determine if the compound is an
FXR-activating ligand and its efficacy. Briefly, this system
utilizes the binding between FXR and a co-regulator protein or
peptide. Co-regulators are nuclear proteins known to be recruited
to FXR upon FXR's binding to its ligand (e.g., SRC1). The
ligand-dependent recruitment of a co-regulator protein or peptide
to FXR is measured by various methods such as fluorescence
resonance energy transfer (FRET), fluorescence polarization or
luminescent proximity assays. Either a human FXR or rat FXR may be
used for this purpose. For a detailed description of this assay
system, see, e.g., Maloney et al., J. Med. Chem., 43:2971-2974,
2000; Pellicciari et al., J. Med. Chem., 45:3569-3572, 2002; Cui et
al., J. Bio. Chem., 277:25963-25969, 2002; and Jones et al.,
Methods Enzymol., 364:53-71, 2003.
[0271] Alternatively, candidate compounds can be tested for their
binding potency to FXR in cell-free assays such as gel filtration
or scintillation proximity assays where radioligands are used, see,
e.g., Jones et al., Methods Enzymol., 364:53-71, 2003.
[0272] Another assay system useful for testing a compound for its
FXR ligand properties is a whole cell model (e.g., in hepatic
stellate cells) involving a reporter gene (such as luciferase or
.beta.-galactosidase) controlled by a transcription regulatory
element responsive to a ligand activated FXR. Either human or rat
FXR can be used in the assay. The level of reporter activity
indicates a test compound's effectiveness as an FXR activating
ligand. For a detailed description of such a reporter gene-based
screening system, see, e.g., Goodwin et al., Mol. Cell., 6:517-526,
2000; Cui et al., J. Bio. Chem., 277:25963-25969, 2002.
[0273] In either of the two classes of assay systems described
above, the potency of a particular FXR ligand is measured by its
EC.sub.50 (i.e., the concentration of a ligand necessary to produce
50% of the maximum value of a measured effect) demonstrated during
the assay. The FXR ligands suitable for use in the present
invention are those with an EC.sub.50 no greater than 5 .mu.M,
preferably no greater than 2 .mu.M, more preferably no greater than
1.5 .mu.M, and most preferably no greater than 1 .mu.M, as
determined in a cell-free FXR assay or a cell-based transactivation
assay using a human or rat FXR according to the methods described
in the references named above.
[0274] In addition, there are established methods for the screening
of a ligand specific for FXR and not for other nuclear receptors,
particularly RXR. For example, WO 00/76523 describes an assay
system in which the recombinant RXR is mutated by a single point
substitution (RXR.sub.D322P) to eliminate the RXR ligand-binding
site, such that the use of FXR-RXR.sub.D322P heterodimer permits
unambiguous identification of compounds that are capable of
modulating FXR activity.
[0275] Compounds of similar or dissimilar chemical structures have
demonstrated their ability to specifically bind FXR. For instance,
WO00/40965, WO00/76523, WO03/015771, WO03/015777, WO03/016280,
WO03/016288, WO03/030612, and WO03/043581 provide a long list of
such compounds as potential candidates for FXR-activating
ligands.
B. Examples of Known FXR-Activating Ligands
[0276] A growing list of known FXR-specific ligands includes
chenodeoxycholic acid (CDCA), 6ECDCA, GW4064, 6.alpha.-MeCDCA,
6.alpha.-PrCDCA, fexaramine, lithocholic acid (LCA), cholate (CA),
ursodeoxycholic acid (UDCA), and deoxycholic acid (DCA) (see, e.g.,
Pellicciari et al., J. Med. Chem., 45:3569-3572, 2002). Among the
FXR ligands, those with a lower EC50, e.g., no greater than 5
.mu.M, preferably no greater than 2 .mu.M, more preferably no
greater than 1.5 .mu.M, and most preferably no greater than 1
.mu.M, when tested in a cell-free assay or a cell-based
transactivation assay using a human or rat FXR, are effective for
the practice of this invention. An FXR ligand exhibiting an
EC.sub.50 no greater than 0.2 .mu.M or no greater than 0.1 .mu.M,
such as 6ECDCA, is particularly effective for the treatment method
of this invention (see, e.g., Fiorucci et al., Gastroenterology
127:1497-1512, 2004). These FXR ligands can be chemically
synthesized according to well known methods or some of them can be
purchased from commercial suppliers such as Sigma-Aldrich (USA),
Erregierre (Italy), and Hengchanlong Pharmaceuticals (China).
IV. Pharmaceutical Compositions and Administration
[0277] The present invention also provides pharmaceutical
compositions comprising an effective amount of an FXR ligand for
treating fibrosis in both prophylactic and therapeutic
applications. Pharmaceutical compositions of the invention are
suitable for use in a variety of drug delivery systems. Suitable
formulations for use in the present invention are found in
Remington's Pharmaceutical Sciences, Mack Publishing Company,
Philadelphia, Pa., 17th ed. (1985). For a brief review of methods
for drug delivery, see, Langer, Science 249: 1527-1533 (1990).
[0278] The pharmaceutical compositions of the present invention can
be administered by various routes, e.g., oral, subcutaneous,
intramuscular, intravenous, or intraperitoneal. The referred routes
of administering the pharmaceutical compositions are oral,
subcutaneous, and intravenous at daily doses of about 0.01-5000 mg,
preferably 5-500 mg, of the FXR ligand for a 70 kg adult human per
day. The appropriate dose may be administered in a single daily
dose or as divided doses presented at appropriate intervals, for
example as two, three, four, or more subdoses per day.
[0279] For preparing pharmaceutical compositions containing an FXR
ligand, inert and pharmaceutically acceptable carriers are used.
The pharmaceutical carrier can be either solid or liquid. Solid
form preparations include, for example, powders, tablets,
dispersible granules, capsules, cachets, and suppositories. A solid
carrier can be one or more substances that can also act as
diluents, flavoring agents, solubilizers, lubricants, suspending
agents, binders, or tablet disintegrating agents; it can also be an
encapsulating material.
[0280] In powders, the carrier is generally a finely divided solid
that is in a mixture with the finely divided active component,
e.g., an FXR ligand. In tablets, the active ingredient (FXR ligand)
is mixed with the carrier having the necessary binding properties
in suitable proportions and compacted in the shape and size
desired.
[0281] For preparing pharmaceutical compositions in the form of
suppositories, a low-melting wax such as a mixture of fatty acid
glycerides and cocoa butter is first melted and the active
ingredient is dispersed therein by, for example, stirring. The
molten homogeneous mixture is then poured into convenient-sized
molds and allowed to cool and solidify.
[0282] Powders and tablets preferably contain between about 5% to
about 70% by weight of the active ingredient of FXR ligand.
Suitable carriers include, for example, magnesium carbonate,
magnesium stearate, talc, lactose, sugar, pectin, dextrin, starch,
tragacanth, methyl cellulose, sodium carboxymethyl cellulose, a
low-melting wax, cocoa butter, and the like.
[0283] The pharmaceutical compositions can include the formulation
of the active compound of an FXR ligand with encapsulating material
as a carrier providing a capsule in which the FXR ligand (with or
without other carriers) is surrounded by the carrier, such that the
carrier is thus in association with the compound. In a similar
manner, cachets can also be included. Tablets, powders, cachets,
and capsules can be used as solid dosage forms suitable for oral
administration.
[0284] Liquid pharmaceutical compositions include, for example,
solutions suitable for oral or parenteral administration,
suspensions, and emulsions suitable for oral administration.
Sterile water solutions of the active component (e.g., an FXR
ligand) or sterile solutions of the active component in solvents
comprising water, buffered water, saline, PBS, ethanol, or
propylene glycol are examples of liquid compositions suitable for
parenteral administration. The compositions may contain
pharmaceutically acceptable auxiliary substances as required to
approximate physiological conditions, such as pH adjusting and
buffering agents, tonicity adjusting agents, wetting agents,
detergents, and the like.
[0285] Sterile solutions can be prepared by dissolving the active
component (e.g., an FXR ligand) in the desired solvent system, and
then passing the resulting solution through a membrane filter to
sterilize it or, alternatively, by dissolving the sterile compound
in a previously sterilized solvent under sterile conditions. The
resulting aqueous solutions may be packaged for use as is, or
lyophilized, the lyophilized preparation being combined with a
sterile aqueous carrier prior to administration. The pH of the
preparations typically will be between 3 and 11, more preferably
from 5 to 9, and most preferably from 7 and 8.
[0286] The pharmaceutical compositions containing FXR ligands can
be administered for prophylactic and/or therapeutic treatments. In
therapeutic applications, compositions are administered to a
patient already suffering from fibrosis of an organ where FXR is
expressed, in an amount sufficient to prevent, cure, reverse, or at
least partially slow or arrest the symptoms of the disease and its
complications. An amount adequate to accomplish this is defined as
a "therapeutically effective dose." Amounts effective for this use
will depend on the severity of the disease or condition and the
weight and general state of the patient, but generally range from
about 0.1 mg to about 2,000 mg of the compound per day for a 70 kg
patient, with dosages of from about 5 mg to about 500 mg of the
compound per day for a 70 kg patient being more commonly used.
[0287] In prophylactic applications, pharmaceutical compositions
containing FXR ligands are administered to a patient susceptible to
or otherwise at risk of developing fibrosis in an organ where FXR
is expressed, e.g., liver, kidney, intestine, etc., in an amount
sufficient to delay or prevent the onset of the fibrostic symptoms.
Such an amount is defined to be a "prophylactically effective
dose." In this use, the precise amounts of the FXR ligand again
depend on the patient's state of health and weight, but generally
range from about 0.1 mg to about 2,000 mg for a 70 kg patient per
day, more commonly from about 5 mg to about 500 mg for a 70 kg
patient per day.
[0288] Single or multiple administrations of the compositions can
be carried out with dose levels and pattern being selected by the
treating physician. In any event, the pharmaceutical formulations
should provide a quantity of an FXR ligand sufficient to
effectively inhibit fibrosis in the patient, either therapeutically
or prophylatically.
V. Kits
[0289] The invention also provides kits for preventing, treating,
or reversing fibrosis according to the method of the present
invention. The kits typically include a pharmaceutical composition
that contains an effective amount of a ligand specific for FXR and
capable of stimulating FXR's transcriptional activity, as well as
informational material containing instructions of how to dispense
the pharmaceutical composition, including description of the type
of patients who may be treated (e.g., a person at risk of
developing liver fibrosis in an organ where FXR is expressed but
not suffering from a cholestatic condition), the schedule (e.g.,
dose and frequency) and route of administration, and the like.
EXAMPLES
[0290] The following examples are provided by way of illustration
only and not by way of limitation. Those of skill in the art will
readily recognize a variety of non-critical parameters that could
be changed or modified to yield essentially similar results.
Example 1: FXR Ligand-Mediated Suppression of Collagen Type A1
Expression in Hepatic Stellate Cells (HSC)
[0291] Liver fibrosis leading eventually to cirrhosis is a scarring
process of the liver that includes components of both increased
fibrogenesis and wound contraction. Hepatic stellate cells (HSCs)
are recognized as the main cell type responsible for liver
fibrogenesis. In chronic liver disease, HSCs acquire an "activated"
phenotype, which includes increased proliferation, contractility,
fibrogenesis, matrix degradation, chemotaxis, and cytokine release
(Friedman, J. Biol. Chem. 275:2247-2250, 2000). The current
paradigm postulates that the activated state of HSCs is achieved
through the transformed microenvironment, which is supported in
part by the growth factors Platelet-Derived Growth Factor (PDGF)
and Transforming Growth Factor (TGF)-.beta., reactive oxygen
intermediates released by hepatocytes and by the fibrillar matrix
generated by previously activated HSCs, as well as in response to
stimulation with thrombin and its type I receptor (proteinase
activate receptor 1, or PAR-1) (Fiorucci, et al., Hepatology,
39:365-75, 2004). The .alpha.-1 type of collagen I (al) represents
the major collagen subtype found in the normal and cirrhotic liver
(Friedman, J. Biol. Chem., 275:2247-2250, 2000). Collagen al is
generated in the fibrotic and cirrhotic liver by activated
HSCs.
[0292] Bile acids act as signaling molecules that regulate their
own biosynthesis and transport by binding to and activating the
farnesoid X receptor (FXR), also known as NR1H4 and the bile acid
receptor (BAR), a nuclear receptor expressed in tissues exposed to
bile acids, such as liver, intestine, gallbladder, and kidney. FXR
alters transcription by binding DNA sequences composed of two
inverted repeats separated by one nucleotide (IR-1) as a
heterodimer with the 9-cis-retinoic acid (9-cis-RA) receptor (RXR,
also known as NR2B1). In hepatocytes, upon activation, FXR
initiates a transcription of a cohort of genes that function to
decrease the concentration of bile acids within the hepatocyte.
Specifically, activated FXR induces the expression of the genes
encoding BSEP, multidrug resistance protein 3 (MDR3; ABCB4), and
MRP2. In addition, activation of FXR by both its naturally
occurring ligands (e.g., chenodeoxycholic acid, CDCA) and synthetic
ligands (e.g., 6ECDCA and GW4064) leads to a feedback repression of
Na.sup.+/taurocholate co-transporting polypeptide (NTCP; SLC10A1),
CYP7A1 and CYP8B1. These genes encode cholesterol
7.alpha.-hydroxylase and sterol 12.alpha.-hydroxylase, both of
which are central to the synthesis of bile acids from cholesterol.
The FXR-dependent suppression of CYP7A1 is mediated by the
transcriptional repressor, short heterodimer partner (SHP; NROB2),
an atypical nuclear receptor that lacks a DNA-binding domain. Thus,
upon activation, FXR directly induces expression of SHP, which in
turn interacts with liver receptor homolog-1 (LRH-1; NR5A2), a
known positive regulator of CYP7A1 and represses its
transcriptional activity. Studies performed in mice harboring a
disrupted SHP gene have confirm the importance of the FXR-SHP-LRH-1
cascade in suppression of CYP7A1 (see, e.g., Forman et al., Cell
81:687-693, 1995; Seol et al., Mol. Endocrinol. 9:72-85, 1995;
Sinal et al., Cell 102:731-744, 2000; Ananthanarayanan et al., J.
Biol. Chem., 276: 28857-28865, 2001; Holt et al., Genes Dev.,
17:1581-91, 2003; Kast et al., J. Biol. Chem., 277:2908-2915, 2002;
Goodwin et al., Mol. Cell 6:517-526, 2000; and Lu et al., Mol. Cell
6:507-515, 2000).
[0293] The goals of the study presented hereafter are: 1) to
demonstrate whether HSCs express FXR; 2) to demonstrate whether FXR
ligands modulate collagen al expression and synthesis in vitro; and
3) to define molecular intermediates of this effect. Two types of
HSCs were used in this study, either freshly isolated cells in
primary cultures or an immortalized cell line (HSC-T6) obtained
from rat HSCs.
[0294] The results as shown in FIGS. 1A and 1B demonstrate that
both primary cultures of HSCs and HSC-T6 express FXR, as assessed
by measuring mRNA (FIG. 1B) by reverse transcription polymerase
chain reaction (RT-PCR) and protein by Western blot analysis. (FIG.
1B) FIG. 1B demonstrates that the amount of FXR in HSC increases
over time during culture and its increase parallels the expression
of .alpha.-smooth muscle actin (.alpha.SMA), a marker of HSC
differentiation into myofibroblast-like cells. Thus, while HSCs
acquire their differentiated phenotype, they also express FXR.
Consistent with this, FXR expression was also detected in
HSC-T6.
[0295] It was then assessed whether HSCs express genes that are
known FXR transcriptional targets. As shown in FIG. 2A, NTCP, BSEP,
CYP7A1, and SHP expression was detected in HSC. Furthermore, as
shown in FIG. 2 Panel b, the expression of these genes in HSC is
regulated by FXR ligands. The quantitative RT-PCR shown in FIG. 2B
illustrates that exposure to 6ECDCA, a synthetic FXR ligand, (at a
concentration of 1 .mu.M) and to CDCA, a natural FXR ligand, (at a
concentration of 20 .mu.M) results in a 2-fold increase of SHP and
BSEP mRNA and a 50-70% reduction of NTCP and CYP7A1 mRNA.
[0296] As illustrated in FIG. 3A, exposure of HSCs to FXR ligands
6ECDCA (1 .mu.M), CDCA (20 .mu.M), and GW4064 (100 .mu.M) reduces
the expression of type I collagen as measure by assessing al mRNA
expression by RT-PCR and quantitative RT-PCR. These observations
have been confirmed by Northern blot analysis, as shown in FIG.
3B.
[0297] The inhibitory effect FXR ligands exert on synthesis of al
collagen in vitro is not related to inhibition of HSC proliferation
or induction of HSC death, since, as illustrated in FIGS. 4A, 4B
and 4C, 6ECDCA does not prevent HSC proliferation induced by
thrombin, PDGF, and TGF.sup..beta.1, as assessed by determining
[.sup.3H]-thymidine incorporation (FIGS. 4A and 4B) or cell
counting (FIG. 4C). Furthermore, FXR ligand exposure does not
result in any HSC apoptosis (FIG. 4D).
[0298] As illustrated in FIGS. 5A and 5B, FXR ligands also inhibit
collagen al release as measured by determining hydroxyproline
concentrations in cell supernatants, a measure of collagen release
from HSCs.
[0299] Because the al gene lacks an IR that might be used by FXR to
bind the al promoter, we have investigated mediators involved in
the inhibition of al expression induced by FXR ligands in HSC and
found evidence that SHP induction is strictly required by FXR
ligands in order to inhibit al expression. Indeed, as illustrated
in FIGS. 6A,6B and 6C, SHP overexpression in HSC-T6 abrogates al
expression on resting HSC-T6 as measured by QRT-PCR (FIG. 6A) and
Northern blot analysis (FIG. 6B), and prevents al induction caused
by thrombin, TGF.beta.1 and PDGF. (FIG. 6C)
[0300] In contrast, as illustrated in FIGS. 7A 7B and 7C,
abrogation of SHP expression by specific small interference RNA
(siRNA), reversed al mRNA inhibition caused by FXR ligands (FIG.
7A). Silencing SHP also prevented inhibition of al expression
induced by FXR ligands in HSCs treated with mitogenic factors such
as thrombin, TGF and PDGF (FIG. 7B). These data were confirmed by
Northern blot analysis. (FIG. 7C)
[0301] In summary, data presented herein demonstrate that HSCs, the
cells that produce collagen in the liver and are responsible for
liver fibrosis, express FXR and that exposure of these cells to
natural or synthetic ligands of FXR downregulates collagen al mRNA
and secretion by a mechanism that involves the induction of
SHP.
Materials and Methods
Real Time PCR
[0302] Quantitation of the expression genes was performed by
Real-Time Polymerase Chain Reaction (Q-RTPCR). Total RNA was
isolated (TRIzol reagent-Invitrogen) from rat hepatic stellate
cells (HSC) or T6 cell line starved for 24 h and stimulated with
FXR ligand 6ECDCA 1 .mu.M for 18 hours. One .mu.g RNA was purified
of the genomic DNA by DNaseI treatment (Invitrogen) for 15 min at
room temperature. The DNaseI is inactivated at 95.degree. C. for 5
minutes in presence of 2.5 mM EDTA. The RNA was random
reverse-transcribed with Superscript III (Invitrogen) in 20 .mu.l
reaction volume. One hundred ng template was used in 25 .mu.l final
volume reaction of Real-Time PCR contained the following reagents:
0.3 .mu.M of each primer and 12.5 .mu.l of 2.times.SYBR Green PCR
Master MIX (Bio-Rad). All reactions were performed in triplicate
and the thermal cycling conditions were: 2 minutes at 95.degree.
C., followed by 50 cycles of 95.degree. C. for 10 seconds, and
60.degree. C. for 30 seconds in iCycler iQ instrument (Biorad,
Hercules, Calif.). The mean value of the replicates for each sample
was calculated and expressed as cycle threshold (CT: cycle number
at which each PCR reaction reaches a predetermined fluorescence
threshold, set within the linear range of all reactions). The
amount of gene expression was then calculated as the difference
(.DELTA.C.sub.T) between the C.sub.T value of the sample for the
target gene and the mean C.sub.T value of that sample for the
endogenous control (Actin). Relative expression was calculated as
the difference (.DELTA..DELTA.C.sub.T) between the .DELTA.C.sub.T
values of the test sample and of the control sample (WT) for each
target gene. The relative quantitation value was expressed and
shown as 2-.DELTA..DELTA.C.sub.T All PCR primers were designed
using software PRIMER3-OUTPUT using published sequence data from
the NCBI database. Primers: Rat SHP: 5' cctggagcagccctcgt 3' (SEQ
ID NO: 1) and 5' aacactgtatgcaaaccgagga 3' (SEQ ID NO: 2); Rat FXR:
5' tggactcatacagcaaacagaga 3' (SEQ ID NO: 3) and 5'
gtctgaaaccctggaagtctttt 3' (SEQ ID NO: 4); Rat Col1A1: 5'
tctccaagaggcagggttc 3' (SEQ ID NO: 5) and 5' ggttagcttcggctcatgc 3'
(SEQ ID NO: 6); Rat c-Jun: 5' gaagcagagcatgaccttga 3' (SEQ ID NO:
7) and 5' gacgtgagaaggtccgagtt 3 (SEQ ID NO: 8)'; Rat JunD: 5'
atcttgggctgctcaaactc 3' (SEQ ID NO: 9) and 5' gccaccttagggtagaggaa
3' (SEQ ID NO: 10); Rat Actin: 5' ttaatgtcacgcacgatttc 3'(SEQ ID
NO: 11) and 5' taccactggcattgttgatgg 3' (SEQ ID NO: 12).
Northern Blot Analysis
[0303] Levels of Collagen I alpha I were determined by Northern
blot analyses of total RNA samples prepared from primary hepatic
stellate cells (HSC), T6 and HepG2 cell lines. For this purpose, 10
.mu.g total RNA was resolved by gel electrophoresis (1% agarose
containing 0.98 M formaldehyde). Immediately after electrophoresis
the RNA was transferred to a positively charged Nylon membrane
(Amersham Life Sciences crop.). The transferred RNA was
cross-linked to the membrane by UV light. The membrane was
prehybridized for 4 hours in 6.times.SSC and 2% SDS and
subsequently hybridized at 65.degree. C. for 20 h with
32.sup.P-labeled probes for collagen I alpha I or GAPDH (as
internal control). Hybridized membranes were washed at a final
stringency of 1.times.SSC, 1.0% SDS at 65.degree. C. and exposed to
Kodak AR-2 film at -80.degree. C. The data are expressed relative
to the internal GAPDH.
Western Blot Analysis
[0304] Confluent cultures of HSC or T6 cell lines were serum
starved for 48 h and then incubated for 18 h at 37.degree. C. in
DMEM with or without either Thrombin (10 units/ml), 6ECDCA (1
.mu.M). Total lysates were prepared by cells solubilization in SDS
Laemmly sample buffer (62.5 mM Tris-HCl, pH 6.8, 10% glycerol 2%
SDS, 0.015% Bromophenol Blue), and 3-4X105 cells were
electrophoresed on 10% polyacrylamide gels. Separated proteins were
then transferred to nitrocellulose membranes (BioRad), and the
membranes were probed with primary antibodies to c-Jun, JunD, SHP,
FXR, .alpha.SMA (Santa Cruz Biotechnology). The anti-immunoglobulin
G horseradish peroxidase conjugate (Bio-Rad) was added as the
secondary antibody, and specific protein bands were visualized
using enhanced chemiluminescence (ECL; Amersham corp.) following
the manufacturer's suggested protocol.
Co-Immunoprecipitation Assay
[0305] To prepare extracts for immunoprecipitation, primary HSC
cells, or T6 and T6 over-expressing SHP cells were first washed
three times with ice cold PBS and then lysed by sonication in E1A
buffer (50 mM Hepes, pH 7, 250 mM NaCl, 0.1% NP-40, 5 mM EDTA, 1 mM
DTT, 1 mM PhenylMethylSulfonyl Fluoride, 1 mg/ml leupeptin, 1 mg/ml
aprotinin and 1 mg/ml pepstatin A). The lysates were clarified from
membrane detrites by centrifugation at 13,000 g for 10 min, and the
protein concentrations in the supernatant extracts was adjusted to
1 mg/ml. From one to four mg total proteins or 10.sup.7 cells
lysates were immunoprecipitated with anti SHP, anti JunD or anti
c-Jun (Santa Cruz Biotechnology, Santa Cruz, Calif.) or anti CD28
as uncorrelated antibody (control) overnight at +4.degree. C. in
the presence of 10 .mu.l protein A sepharose (Amersham Pharmacia
Biotechnology, Piscataway, N.J.). The resultant immunoprecipitate
was washed 5 times with E1A and then subjected to SDS-PAGE and
immunoblotted with antibodies (reverse) used in
immunoprecipitates.
Transduction of the Viral Vector Mediated SHP Gene in T6 Cells
[0306] The SHP coding sequence was cloned from rat primary
hepatocyte. Briefly one .mu.g total RNA was retro-trascribed with
SuperScript III reverse trascriptase (Invitrogen) in 20 .mu.l
reaction using 0.3 .mu.M Random Hexamers. Two hundred cDNA template
was used to amplify the coding sequence of SHP with Pfu DNA
polimerase (Stratagene) in 50 .mu.l PCR reaction using specific
primers 5'-CATGAGCACCAGCCAACCAG-3' (SEQ ID NO: 13) and
5'-CTGGAACAGGTCACCTGAGC-3 (SEQ ID NO: 14). SHP coding sequence was
first cloned in pCR2.1 vector (TOPO-TA cloning--Invitrogen) and
then sub-cloned in retroviral vector PINCO. 293T modified packaging
cells (DNX) were cultured in DMEM medium with 10% FBS and calcium
phosphate transiently transfected with PINCO-SHP chimera and PINCO
alone as negative control. 48 hours' post-transfection the
supernatant viral was recuperated and used to infect T6 cells.
PINCO vector leads the EGFP (Emerald Green Fluorescence Protein)
gene that allows the separation of the infected cells (green) from
non-infected cells. A pure population of the T6 cells expressing
SHP was obtained by FACS (Fluorescence Activated Cell Sorter)
separation. The SHP expression was detected by Western Blot
analysis.
Example 2: Administration of FXR Ligands Results in Reduced
Fibrosis in Bile Duct Ligated (BDL) Rats
[0307] BDL is a model of chronic cholestasis. In this model,
however, progressive liver fibrosis leads to the development of
cirrhosis 3-4 weeks after ligation and it is therefore also used as
a model of liver fibrosis (Kountouras et al., Br. J. Exp. Pathol.,
65:305-311, 1984). Because this model allows us to test the effect
of anti-fibrotic remedies, we administered rats 3 days after BDL
with 6ECDCA at the dose of 1 and 3 mg/kg per os per day for 2
weeks. The protocol's study was approved by the Animal Study
Committee of the University of Perugia. Hepatic fibrosis was
induced in 8-9 weeks old male Wistar rats (Charles River, Monza,
Italy) by BDL. BDL was performed as originally described by
Kountouras et al. (Br. J. Exp. Pathol. 65: 305-311; 1984). One week
after BDL, rats were randomized to receive one of the following
treatments, placebo (subcutaneous injection of 100 .mu.L PBS) or
6ECDCA at the doses 1 and 3 mg/kg/day by oral route. Animals were
then followed for 3 weeks.
[0308] At the end of the study surviving rats were sacrificed under
pentobarbital sodium anesthesia (50 mg/kg i.p) and terminally bled
via cardiac puncture. The blood was centrifuged at 7250 g for 20
minutes at 4.degree. C.; the resultant serum was stored at
-20.degree. C. until analysis (a maximum of 2 weeks). At the time
of death, the bile duct ligature was confirmed to be intact with
proximal dilatation of the common bile duct. After weight
determination, specimens of livers were snap frozen in liquid
nitrogen and stored at -70.degree. C. for subsequent analysis. For
histologic examination portions of the right and left liver lobes
(10-15 mg/each) from each animal were fixed in 10% formalin,
embedded in paraffin, sectioned, and stained with hematoxylin and
eosin or Sirius red. For Sirius red staining, the sections were
incubated for 30 minutes in 0.1% Sirius red F3B (Sigma Chemical
Co.) containing saturated picric acid and 0.1% Fast Green. After
rinsing twice with distilled water, sections were briefly
dehydrated with 70% ethanol and coverslipped. Collagen surface
density from liver samples was quantified using a computerized
image analysis system as described previously (Image Acquisition
System Ver.005, Delta Sistemi, Rome, Italy). The surface density of
collagen in blinded specimens was measured at a video screen
display magnification according to the method described by Rockey
and Chung (Rockey, D. C., Chung, J. J. J. Clin. Invest.
98:1381-1388, 1996) and expressed as a percent (the ratio of
collagen surface area per total analyzed field surface). The
average of the score taken from 10 random fields was used to
generate a single score for each animal's liver.
[0309] As illustrated in FIGS. 8A, 8B and 8C, in vivo delivery of
6ECDCA resulted in significant reduction of liver collagen
deposition as measured by scoring of Sirius-red staining (FIG. 8A),
liver hydroxyproline content (FIG. 8B), and liver al mRNA by RT-PCR
(FIG. 8C). Quantitative analysis of Sirius Red stained collagen in
the liver demonstrated a reduction in liver collagen content by 62%
after treatment with 6ECDCA. In FIG. 8 data are mean.+-.SE; *
indicates P<0.01 versus sham operated and **, P<0.01 versus
BDL. "Central" and "portal" refer to the central vein and the
portal tract areas, as well as the parenchymal area immediately
surrounding these spaces. "All" refers to all hepatic areas, as
visualized under low magnification.
Example 3: Administration of FXR Ligands to Inhibit Fibrosis
[0310] The present invention can be practiced according to the
following example. A 58-year old female patient, weighing about 60
kg, suffers from chronic Hepatitis C Virus (HCV) infection and is
seeking treatment to inhibit development and progression of liver
fibrosis. The patient's blood serum levels of alkaline phosphatase,
GGT, and 5' nucleotidase are considered to fall within a range that
is not indicative of a cholestatic condition. After assessment of
liver fibrosis status and staging by performing liver biopsy and/or
measurement of non-invasive serum markers, tablets containing
6ECDCA are prescribed to the patient for oral administration on a
twice-per-day schedule. A total of 300 mg 6ECDCA is taken each day.
The patient is on this schedule for the remainder of her life. The
development or progression of liver fibrosis can be monitored based
on measuring serum markers or analyzing liver biopsy.
[0311] All patents, patent applications, and other publications
cited in this application are incorporated by reference in the
entirety for all purposes.
Sequence CWU 1
1
14117DNARat 1cctggagcag ccctcgt 17222DNARat 2aacactgtat gcaaaccgag
ga 22323DNARat 3tggactcata cagcaaacag aga 23423DNARat 4gtctgaaacc
ctggaagtct ttt 23519DNARat 5tctccaagag gcagggttc 19619DNARat
6ggttagcttc ggctcatgc 19720DNARat 7gaagcagagc atgaccttga
20820DNARat 8gacgtgagaa ggtccgagtt 20920DNARat 9atcttgggct
gctcaaactc 201020DNARat 10gccaccttag ggtagaggaa 201120DNARat
11ttaatgtcac gcacgatttc 201221DNARat 12taccactggc attgttgatg g
211320DNARat 13catgagcacc agccaaccag 201420DNARat 14ctggaacagg
tcacctgagc 20
* * * * *