U.S. patent application number 17/366320 was filed with the patent office on 2021-11-04 for method for producing genome-modified plants from plant protoplasts at high efficiency.
The applicant listed for this patent is AICT, INSTITUTE FOR BASIC SCIENCE, SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION. Invention is credited to Sunghwa CHOE, Hyeran KIM, Jin Soo KIM, Jungeun KIM, Soon Il KWON, Je Wook WOO.
Application Number | 20210340554 17/366320 |
Document ID | / |
Family ID | 1000005720673 |
Filed Date | 2021-11-04 |
United States Patent
Application |
20210340554 |
Kind Code |
A1 |
KIM; Jin Soo ; et
al. |
November 4, 2021 |
METHOD FOR PRODUCING GENOME-MODIFIED PLANTS FROM PLANT PROTOPLASTS
AT HIGH EFFICIENCY
Abstract
The present invention relates to a method of increasing the
production efficiency of gene-edited plants, regenerated from plant
protoplasts, by use of a Cas protein-guide RNA ribonucleoprotein
(RNP). According to the present invention, the method of increasing
the production efficiency of gene-edited plants makes it possible
to efficiently produce target gene-mutated plants and to minimize
the introduction of foreign DNA into plants. Thus, the present
invention can be very advantageously used in a wide variety of
fields, including agriculture, food and biotechnology.
Inventors: |
KIM; Jin Soo; (Seoul,
KR) ; KIM; Jungeun; (Seoul, KR) ; CHOE;
Sunghwa; (Gimpo-si, KR) ; WOO; Je Wook;
(Daejeon, KR) ; KWON; Soon Il; (Gunpo-si, KR)
; KIM; Hyeran; (Daejeon, KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
INSTITUTE FOR BASIC SCIENCE
SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION
AICT |
Daejeon
Seoul
Suwon-si |
|
KR
KR
KR |
|
|
Family ID: |
1000005720673 |
Appl. No.: |
17/366320 |
Filed: |
July 2, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15766445 |
Apr 6, 2018 |
|
|
|
PCT/KR2016/011216 |
Oct 6, 2016 |
|
|
|
17366320 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2800/80 20130101;
C12N 15/8206 20130101; C12N 15/8213 20130101; C12N 2310/20
20170501; C12N 15/11 20130101; C12N 9/22 20130101; C12N 15/8298
20130101; C12N 15/8207 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12N 9/22 20060101 C12N009/22; C12N 15/11 20060101
C12N015/11 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 6, 2015 |
KR |
10-2015-0140314 |
Oct 6, 2016 |
KR |
10-2016-0129356 |
Claims
1. A method for increasing the production efficiency of a
genome-edited plant from a plant protoplast, comprising the steps
of: (i) editing a genome of the plant protoplast by a direct
introduction of a Cas protein-guide RNA ribonucleoprotein (RNP) in
which a Cas protein and a guide RNA in the form of naked RNA are
pre-assembled into an isolated plant protoplast without using a
vector; and (ii) producing a genome-edited plant by regenerating
the plant protoplast.
2. The method of claim 1, wherein the guide RNA is specific for a
DNA encoding a target gene.
3. The method of claim 2, wherein the target gene is a
Brassinosteroid Insensitive 2 (BIN2) gene or a
Glucosinolate-oxoglutarate-dependent dioxygenase homolog (GSL-ALK)
gene.
4. The method of claim 1, wherein the editing of a genome is
performed by knocking-out or knocking-in.
5. The method of claim 1, wherein the guide RNA is in the form of a
dual RNA comprising a crRNA and a tracrRNA, or a single-chain guide
RNA (sgRNA).
6. The method of claim 5, wherein the single-chain guide RNA
comprises a part of crRNA and a part of tracrRNA.
7. The method of claim 1, wherein the Cas protein is a Cas9 protein
or a variant of Cas9 Protein in which the catalytic aspartate
residue is substituted with another amino acid.
8. The method of claim 1, wherein the Cas protein recognizes NGG
trinucleotide.
9. The method of claim 1, wherein the Cas protein is linked to a
protein transduction domain.
10. The method of claim 7, wherein the amino acid is alanine.
11. The method of claim 1, wherein the Cas9 protein is derived from
the genus Streptococcus.
12. The method of claim 11, wherein the genus Streptococcus is
Streptococcus pyogenes.
13. The method of claim 1, wherein the plant protoplast is derived
from Lactuca sativa or Brassica oleracea.
14. The method of claim 1, wherein the introduction is performed by
the method selected from the group consisting of microinjection,
electroporation, DEAE-dextran treatment, lipofection,
nanoparticle-mediated transfection, protein transduction
domain-mediated transduction, and PEG-mediated transfection.
15. A plant regenerated from the genome-edited plant protoplast
produced by the method of claim 1.
Description
TECHNICAL FIELD
[0001] The present invention relates to a method of increasing the
production efficiency of genome-edited plants, regenerated from
plant protoplasts, by introducing a Cas protein and a guide RNA
into the plant protoplasts.
BACKGROUND ART
[0002] It remains unclear whether the genome-edited plants will be
regulated under genetically-modified organism (GMO) legislation
passed by the EU, and other countries (Jones, H. D., Nature Plants,
2015, 1: 14011). Molecular scissors (programmable nucleases) induce
small insertions and deletions (indel) or substitutions to
chromosomal target sites that are indistinguishable from naturally
occurring genetic variation. Such genome-edited plants may be
considered GMOs in certain countries, hampering the widespread use
of programmable nucleases in plant biotechnology and agriculture.
For example, when Agrobacterium is used, genome-edited plants
produced thereby have foreign DNA sequences, including the genes of
encoded programmable nucleases in the genome. Removal of these
Agrobacterium-derived DNA sequences by breeding is not feasible in
asexually-reproducing plants such as the grape, potato, or
banana.
[0003] Alternatively, non-integrating plasmids that encode
programmable nucleases can be transfected into plant cells such as
protoplasts. However, the present inventors paid attention to the
fact that transfected plasmids are degraded in cells via endogenous
nucleases and that the resulting small DNA fragments can be
inserted into the Cas9 on-target and off-target sites, as
exemplified in human cells (Kim, S, etc., Genome research, 2014,
24: 1012-1019).
[0004] Delivery of the preassembled Cas9 protein-gRNA
ribonucleoproteins (RNPs), rather than plasmids encoding Cas9
protein, and gRNA into plant cells could avert the possibility of
inserting recombinant DNA into the host genome. Furthermore, as
shown in human cells, RNA-guided engineered nuclease (RGEN) RNPs
cleave chromosomal target sites immediately after transfection and
are degraded rapidly by endogenous proteases in cells, with the
potential to reduce mosaicism, and off-target effects in
regenerated whole plants. Preassembled RGEN RNPs can be used in a
number of applications across plant species, absent prior
optimization of codon usage, as well as promoters to express Cas9
and gRNAs in each species. In addition, RGEN RNPs enable
pre-screening in vitro to select highly active gRNAs, and the
genotyping of mutant clones via restriction fragment length
polymorphism (RFLP) analysis. However, there have been no reports
that indicate that RGEN RNPs were introduced into plant protoplasts
with the effect of confirming genome editing, and that plants
successfully regenerated from the protoplasts.
DISCLOSURE OF INVENTION
Technical Problem
[0005] The present inventors have made extensive efforts to develop
present technology capable of editing the genome of plants by
applying Cas protein-gRNA RNP to the plants. It is found that a
genome-edited plant can be produced with a high efficiency by
introducing a Cas protein and a guide RNA into an isolated plant
protoplast to edit the genome of the plant protoplast and
regenerate the plant protoplast, thereby completing the present
invention.
Technical Solution
[0006] The present disclosure provides a method for increasing the
production efficiency of a genome-edited plant from a plant
protoplast, comprising the steps of: (i) editing a genome of a
plant protoplast by introducing a Cas protein and a guide RNA into
an isolated plant protoplast; and (ii) producing a genome-edited
plant by regenerating the plant protoplast.
[0007] Another aspect of the present invention is to provide a
plant regenerated from the genome-edited plant protoplast produced
by the above method.
[0008] Still another aspect of the present invention is to provide
a composition for increasing the production efficiency of a
genome-edited plant from a plant protoplast comprising a Cas
protein and a guide RNA specific for DNA encoding a target
gene.
Advantageous Effects
[0009] According to the various aspects of the present invention,
the method of increasing the production efficiency of gene-edited
plants makes it possible to efficiently produce target gene-mutated
plants and to minimize the insertion of a foreign DNA into plants.
Thus, by way of example, the present invention can be very
advantageously used in a wide variety of fields, including the
agriculture, food and biotechnology.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1a to 1c show Cas9 protein-guide RNA ribonucleoprotein
(RNP)-mediated gene disruption in lettuce protoplasts. FIG. 1(a)
The target sequence in BRASSINOSTEROID INSENSITIVE 2(BIN2) gene;
FIG. 1(b) Mutation frequencies measured by the T7E1 assay and
targeted deep sequencing in bulk population; FIG. 1(c) Mutant DNA
sequences induced by Cas9 protein-guide RNA ribonucleoprotein (RNP)
in lettuce. The protospacer-adjacent motif (PAM) sequences are
shown in red. Inserted nucleotides are shown in blue. WT:
wild-type.
[0011] FIGS. 2a to 2f show protoplast division and in vitro
redifferentiation after editing of lettuce genes by a direct
introduction of RGEN RNP.
[0012] FIGS. 3a to 3f show a redifferentiation process for
obtaining a target gene (Lsbin2)-edited lettuce plant.
[0013] FIGS. 4a and 4b show genetic analysis of lettuce microcalli
derived from a single protoplast treated with Cas9 protein-guide
RNA. FIG. 4(a) Genotyping of microcalli. (Top) RGEN RFLP analysis.
(Bottom) DNA variant sequences in microcalli. FIG. 4(b) Summary of
genetic variation analysis of BIN2 gene in TO generation.
[0014] FIG. 5 shows the glucosinolate biosynthesis pathway in B.
napus based on genetic analysis.
[0015] FIGS. 6a to 6f show callus formation after transfection of
Cas9 protein-guide RNA RNP into cotyledon-derived protoplasts of
Brassica oleracea. FIG. 6a Cotyledons of Brassica oleracea
seedlings; FIG. 6b isolated protoplasts; FIG. 6c First cell
division after 3 to 5 days of protoplast culture; FIG. 6d
Protoplasts in 2 to 3 weeks of culture after transfection with Cas9
protein-guide RNA RNP; and (FIGS. 6e and 6f) Micro-callus formation
after 9 to 11 weeks of culture. Scale bar: 1 cm FIG. 6a, 10 .mu.m
(FIGS. 6b to 6d), and 1 mm (FIGS. 6e and 6f).
BEST MODE FOR CARRYING OUT THE INVENTION
[0016] Genome editing methods such as zinc finger nuclease (ZFN),
transcription activator-like effector DNA binding protein (TALLEN)
and clustered regularly interspaced short palindromic repeats
(CRISPR)/Cas system are very useful methods capable of inducing
targeted mutations, but the use thereof in plants is limited due to
issues regarding GMOs (genetically modified organisms).
Accordingly, the present inventors have made efforts to develop a
method capable of producing genome-edited plants without inserting
foreign DNA sequences. They found that when a Cas protein and a
guide RNA are introduced into plant protoplasts to edit the genome
of the plant protoplasts, the genomes of the plants produced by
regenerating the genome-edited protoplasts are edited at
significantly high frequencies regardless of target genes. Thus,
the present invention provides a method of increasing the
production efficiency of genome-edited plants, regenerated from
plant protoplasts, by introducing a Cas9 protein and a guide RNA
into the plant protoplasts.
[0017] This will be described in detail hereinafter. In the
meantime, each of the description and the embodiments disclosed
herein may be applied to other description and embodiments. In
other words, any combination of various elements disclosed in the
present invention falls within the scope of the present invention.
In addition, the scope of the present invention should not be
construed to be limited by the specific description or embodiments
described below.
[0018] One aspect of the present invention is directed to a method
for increasing the production efficiency of a genome-edited plant a
plant protoplast comprising the steps of: (i) editing a genome of a
plant protoplast by introducing a Cas protein and a guide RNA into
an isolated plant protoplast; and (ii) producing a genome-edited
plant by regenerating the plant protoplast.
[0019] As used herein, the term "genome editing" or "genome editing
technology" refers to one or more techniques capable of introducing
a targeted variation and/or mutation into the nucleotide sequence
of a genome in animal and/or plant cells, including human cells,
and means of knocking-out or knocking-in a specific gene, or
introducing a variation into a non-coding DNA sequence that
produces no protein. For the purpose of the present disclosure, the
genome editing may mean introducing a mutation or change into a
plant using particularly a Cas protein and a guide RNA. The method
of the present invention can remarkably increase the production
efficiency of a genome-edited plant from a plant protoplast.
[0020] Hereinafter, each step of the method will be described in
detail.
[0021] Step (i) is a step of editing a genome of a plant protoplast
by introducing a Cas protein or a guide RNA into an isolated plant
protoplast. In step (i), a Cas protein and a guide RNA specific for
the DNA encoding a target gene are introduced into a plant
protoplast, whereby the plant protoplast can be transfected within
a short time while minimizing the chance of inserting foreign DNA
into the genome.
[0022] As used herein, the term "Cas protein" means a major protein
component of the CRISPR/Cas system and is a protein that can act as
an activated endonuclease. The Cas protein corresponds to a gene
scissors (or sometimes referred herein as "a molecular scissor")
named RNA-guided engineered nuclease (RGEN). The Cas protein may
form a complex with a CRISPR RNA (crRNA) and a trans-activating
crRNA (tracrRNA) to exhibit the activity thereof.
[0023] The Cas protein recognizes a specific nucleotide sequence in
the genome and causes double strand breaks (DSBs). The double
strand breaks include cleaving the double strands of DNA to make a
blunt end or a cohesive end. DSBs are efficiently repaired by the
homologous recombination or non-homologous end-joining (NHEJ)
mechanism in cells, during which a desired mutation can be
introduced into a target site. In the present disclosure, the Cas
protein may recognize NGG trinucleotide, but is not limited
thereto.
[0024] Information on Cas protein or a gene is available from known
databases such as GenBank of National Center for Biotechnology
Information (NCBI). Specifically, the Cas protein may be a Cas9
protein or a variant thereof. In addition, the Cas protein may be a
Cas protein derived from Streptococcus sp, Neisseria sp.,
Pasteurella sp, Francisella sp, and Campylobacter sp, but is not
limited thereto. More specifically, the Cas protein may be derived
from Streptococcus pyogenes. However, the present invention is not
limited to the above described examples.
[0025] A variant of the Cas9 protein may be in a mutant form of
Cas9 protein in which the catalytic aspartate residue is
substituted with another amino acid, for example, alanine, but is
not limited thereto.
[0026] Furthermore, the Cas protein in the present disclosure may
be a recombinant protein. The term "recombinant" when used herein
with reference, e.g., to a cell, nucleic acid, protein, or vector,
indicates that the cell, nucleic acid, protein or vector, has been
modified by an introduction of a heterologous nucleic acid or
protein or alteration of a native nucleic acid or protein, or that
the cell is modified by being derived from a modified cell. Thus,
for example, a recombinant Cas9 protein can be generated by
reconstituting a Cas9 protein-encoding sequence using a human codon
table.
[0027] The Cas protein may be in a form that enables the protein to
act in the nucleus, or in a form that is easily introduced into a
cell. For example, the Cas protein may be linked to a
cell-penetrating peptide or a protein transduction domain. The
protein transduction domain may be poly-arginine or an HIV-derived
TAT protein, but it is not limited thereto. As a cell-penetrating
peptide or a protein transduction domain, various kinds of
cell-penetrating peptides or protein transduction domains are
well-known in the art besides the above-described example, and thus
a person skilled in the art may apply various examples to the
present invention without any limitations.
[0028] As used herein, the term "guide RNA" means a RNA specific
for a DNA encoding a target gene or sequence. The guide RNA may
bind complementarily to the whole or a portion of the target
sequence so that the Cas protein can cleave the target
sequence.
[0029] Generally, the term "guide RNA" may also refers to a dual
RNA comprising two RNAs, that is, CRISPR RNA (crRNA) and
trans-activating crRNA (tracrRNA). Alternatively, the guide RNA may
refer to a single-chain or single guide RNA (sgRNA) comprising a
first region comprising a sequence which is entirely or partially
complementary to a target DNA sequence, and a second region
comprising a sequence that interacts with RNA-guided nuclease, but
any form of guide RNA that enables RNA-guided nuclease to be active
in the target sequence may be included in the scope of the present
disclosure without any limitations. For example, when the guide RNA
is applied to Cas9, it may be in the form of a dual RNA comprising
crRNA and tracrRNA, or may be in the form of a single guide RNA
(sgRNA) wherein the major regions of crRNA and tracrRNA are fused
to each other. The sgRNA may comprise a region complementary to a
target DNA sequence (herein termed as a "spacer region", "target
DNA recognition sequence", "base pairing region", etc.), and a
hairpin structure for binding to the Cas protein. More
particularly, the sgRNA may comprise a region having a sequence
entirely or partially complementary to a target DNA sequence, a
hairpin structure for binding to the Cas protein, and a terminator
sequence. These elements may be sequentially arranged in the 5' to
3' direction. However, the scope of the present disclosure is not
limited thereto, and any form of a guide RNA may also be used in
the present invention, as long as it comprises a region
complementary to the whole or a portion of a target DNA or a major
region of crRNA.
[0030] The guide RNA may be in the form of naked RNA, but is not
limited thereto. When a guide RNA is to be transfected into a cell
or an organism in the form of naked RNA, the guide RNA can be
prepared using any in vitro transcription system known in the
art.
[0031] The guide RNA or sgRNA may comprise a sequence entirely or
partially complementary to a target DNA sequence, and may comprise
one or more additional nucleotides at the upstream of sgRNA,
particularly the 5' end of the sgRNA. The additional nucleotides
may include guanine (G), but are not limited thereto.
[0032] The present disclosure may be characterized by introducing a
Cas protein and a guide RNA directly into a protoplast without
using an intracellular expression system such as a vector system.
This can minimize the introduction of one or more foreign DNAs into
plants, thereby addressing concerns about GMOs. In an aspect, the
Cas protein and the guide RNA may be prepared in a preassembled
form (i.e., a ribonucleoprotein (RNP) form) before the introduction
of the preassembled form into a protoplast, but are not limited
thereto. In the present disclosure, Cas protein-guide RNA RNP and
RGEN-RNP may be used in the same sense.
[0033] As used herein, the term "target gene" means some genes in
the plant genome to be edited by the present disclosure. Namely,
principally, the target gene is not limited to a particular kind of
gene, and may comprise both a coding region and a non-coding
region. A person skilled in the art can select the target gene
according to a desired variation for the genome-edited plant to be
produced. The target gene may be Brassinosteroid Insensitive 2
(BIN2) gene or Glucosinolate-oxoglutarate-dependent dioxygenase
homolog (GSL-ALK), but is not limited thereto.
[0034] In step (i), the introduction of a Cas protein or a guide
RNA into the plant protoplast may be performed by various methods
known in the art, such as a microinjection, electroporation,
DEAE-dextran treatment, lipofection, nanoparticle-mediated
transfection, protein transduction domain-mediated transduction,
and PEG-mediated transfection so that the Cas protein or the guide
RNA can be delivered into a cell, but is not limited thereto. The
Cas protein may be delivered into a cell in a form complexed with
the guide RNA or in an independent form.
[0035] The introduction may be performed by co-transfection or
serial-transfection. The serial-transfection may be performed by
first transfecting the Cas protein, and then transfecting a naked
guide RNA, but is not limited thereto.
[0036] In the present disclosure, a plant that can be used for
obtaining the plant protoplast is not particularly limited to its
derivation, but the plant protoplast may be derived from Lactuca
sativa or Brassica oleracea.
[0037] Step (ii) is a step of producing a genome-edited plant by
regenerating the plant protoplast whose genome is edited, and may
comprise, but not limited to, the steps of: forming a callus by
culturing the plant protoplast; and producing a regenerated plant
by further culturing the callus.
[0038] Medium compositions that used in the steps of forming the
callus and of producing the regenerated plant from the callus may
be properly selected by a person skilled in the art, depending on
the kind and status of plant. Conditions for such culture are known
in the art.
[0039] Specifically, in order to induce callus formation from the
genome-edited protoplast, the callus may be cultured in a callus
induction medium containing MS salt, 6% myo-inositol, 0.4 mg/L
thiamine-HCl, 2 mg/L 2,4-D, 0.5 mg/L BA and 30% sucrose.
Micro-calli obtained from the culture may be further cultured in a
callus induction solid medium containing MS salt, 0.6%
myo-inositol, 0.4 mg/L thiamine-HCl, 2 mg/L 2,4-D, 0.5 mg/L BA, 3
mg/L AgNO.sub.3, 3% sucrose and 0.4% gelrite, thereby producing
green plantlets, and the plantlets may be transferred to MS basal
medium to induce root production, but the scope of the present
invention is not limited thereto. In addition, a person skilled in
the art can suitably control external environmental conditions such
as temperature and light/dark conditions depending on the kind and
status of plant.
[0040] In a specific example of the present invention, a RNP
targeting brassinosteroid intensive 2(BIN2) gene was introduced
into protoplasts isolated from lettuce, and then the genome-edited
protoplasts were regenerated. As a result, it was shown that the
completely regenerated plant showed a genome editing efficiency of
46%, which is about ten (10)-fold higher than the editing frequency
of the protoplasts (FIGS. 1b and 4b). Furthermore, when the
glucosinolate-oxoglutarate-dependent dioxygenase homolog (GSL-ALK)
gene in protoplasts isolated from Brassica oleracea was disrupted,
like the case of lettuce, it was shown that the genome editing
efficiency was not high (0.0% to 1%) in the protoplasts introduced
with the RNP, but was significantly increased (24.0% to 100%) in
the calli regenerated from the protoplasts (Tables 2 and 3). From
the above-described results, it could be seen that the cell
proliferation and growth rates of RNP-introduced protoplasts in the
regeneration process are increased compared to protoplasts not
introduced with the RNP, and thus the protoplasts are regenerated
into plants.
[0041] Another aspect of the present disclosure is directed to a
plant regenerated from the genome-edited plant protoplast produced
by the above method.
[0042] Still another aspect of the present disclosure is directed
to a composition for increasing the production efficiency of a
genome-edited plant from a plant protoplast, comprising a Cas
protein and a guide RNA specific for a DNA encoding a target
gene.
[0043] The guide RNA, the Cas protein, genome editing of the plant
protoplast, and the plant regenerated from the protoplast are as
described above. The genome-edited plant has a mutation caused by a
targeted mutation based on the composition of the present
invention. The mutation may be any one of deletion, insertion,
translocation and inversion. The position of the mutation may
depend on the sequence of a guide RNA of the composition.
[0044] The target gene may be a Brassinosteroid Insensitive 2
(BIN2) gene or a Glucosinolate-oxoglutarate-dependent dioxygenase
homolog (GSL-ALK) gene, but is not limited thereto.
BEST MODE FOR INVENTION
Examples
[0045] Hereinafter, the present disclosure will be described in
further detail with reference to examples. It will be obvious to a
person having ordinary skill in the art that these examples are for
illustrative purposes only and are not to be construed to limit the
scope of the present invention.
Example 1: Isolation of Plant Protoplasts
[0046] To isolate lettuce protoplasts, lettuce (Lactuca sativa L.)
Cheongchima seeds were sterilized in a solution containing 70%
ethanol and 0.4% hypochlorite for 15 min, washed three times with
distilled water, and cultured on 1/2.times. M/S solid medium
supplemented with 2% sucrose. The culture was performed by growing
in a growth room under a 16-hr light (150 .mu.mol m.sup.-2
s.sup.-1) and 8-hr dark cycle at 25.degree. C. At 7 days of
culture, the cotyledons of lettuce seedlings were digested with an
enzyme solution (1.0% cellulase R10, 0.5% macerozyme R10, 0.45 M
mannitol, 20 mM MES [pH 5.7], CPW solution) by shaking incubation
(40 rpm) for 12 hours at 25.degree. C. in darkness, and then
diluted with an equal volume of W5 solution. The diluted solution
was filtered and centrifuged at 100 g in a round-bottomed tube for
5 min to collect protoplasts. Re-suspended protoplasts were
purified by floating on a CPW 21S solution (21% [w/v]
sucrose-containing CPW solution, pH 5.8), followed by
centrifugation at 80 g for 7 min. The purified protoplasts were
washed with W5 solution and pelleted by centrifugation at 70 g for
5 min. Finally, protoplasts were re-suspended in W5 solution and
counted under the microscope using a hemocytometer.
[0047] To isolate Brassica oleracea protoplasts, plant protoplasts
were isolated from B. oleracea cotyledons. A specific method for
protoplast isolation is as follows. B. oleracea Dongbok seeds were
sterilized with a solution containing 70% ethanol and 1% Clorox for
15 minutes, washed three times with distilled water and sown on MS
(Murashige and Skoog) solid medium (3% sucrose, 0.8% agar, pH 5.8).
Incubation was performed at 25.degree. C. for 5 days. For
protoplast isolation, the cotyledons of 5-day B. oleracea were
isolated and digested with an enzyme solution (cellulase,
pectinase, 3 mM MES (2-(N-morpholino)ethanesulfonic acid), and 9%
mannitol-containing CPW (cell and protoplast washing solution)) by
shaking incubation (35 rpm) for 16 hours at 25.degree. C. in
darkness. Then, the enzyme-treated cotyledons were filtered through
a 50-.mu.m mesh and centrifuged at 100 g in a 14 ml round-bottomed
tube for 5 min. Thereafter, the precipitated protoplasts were
washed twice with 9% mannitol CPW. The washed protoplasts were
purified with 21% sucrose-containing CPW and centrifuged at 100 g
for 5 min. The purified protoplasts were isolated from in the
middle of sucrose layer, washed with 9% mannitol CPW, and then
centrifuged at 50 g for 5 min. The protoplasts were stored at
4.degree. C. until use for transfection.
Example 2: Protoplast Genome Editing
[0048] Prior to transfection, Cas9 protein-containing storage
buffer (20 mM HEPES, pH 7.5, 150 mM KCl, 1 mM DTT, and 10%
glycerol) was mixed with sgRNA and incubated at room temperature
for 10 minutes.
[0049] To introduce double strand breaks (DSBs) in lettuce using an
RNP complex, 5.times.10.sup.5 protoplast cells were transfected
with Cas9 protein (30 .mu.g) premixed with in vitro transcribed
sgRNA (60 .mu.g). Specifically, 5.times.10.sup.5 protoplasts
prepared in Example 1 were re-suspended in 200 .mu.L MMG solution,
mixed gently with 20 .mu.L of RNP complex and 220 .mu.L of freshly
prepared PEG solution (40% [w/v] PEG 4000; Sigma No. 95904, 0.2 M
mannitol and 0.1 M CaCl.sub.2), and then incubated at 25.degree. C.
for 10 min in darkness. After incubation, 950 .mu.L of W5 solution
(2 mM MES [pH 5.7], 154 mM NaCl, 125 mM CaCl.sub.2 and 5 mM KCl)
was added slowly. The resulting solution was mixed well by
inverting the tube. Then, protoplasts were pelleted by
centrifugation at 100 g for 3 min and re-suspended gently in 1 ml
of WI solution (0.5 M mannitol, 20 mM KCl and 4 mM MES, pH 5.7).
Finally, the protoplasts were transferred into multi-well plates
and incubated under dark conditions at 25.degree. C. for 24-48
hours, and genome editing analysis was performed. At the same time,
the protoplasts were transferred to lettuce culture medium and
subjected to plant regeneration procedures.
[0050] In the case of Brassica oleracea, 2.times.10.sup.5
protoplast cells were transfected with Cas9 protein (40 .mu.g)
premixed with in vitro transcribed sgRNA (15 .mu.g). Specifically,
2.times.10.sup.5 protoplast cells prepared in Example 1 were
re-suspended in 200 .mu.L MMG solution (4 mM MES, 0.4 M mannitol
and 15 mM MgCl.sub.2, pH 5.7), mixed gently with a RNP complex and
220 .mu.L of freshly prepared PEG solution (40% [w/v] PEG 4000;
Sigma No. 95904, 0.2 M mannitol and 0.1 M CaCl.sub.2), and then
incubated at 25.degree. C. for 10 min. Thereafter, the same volume
of W5 solution (2 mM MES [pH 5.7], 154 mM NaCl, 125 mM CaCl.sub.2
and 5 mM KCl) was added three times at 10-min intervals,
centrifuged at 50 g for 5 min, and then re-suspended in W5
solution. The transfected protoplasts were incubated at 25.degree.
C. for 24 hours, and then genome editing analysis was performed. At
the same time, the protoplasts were transferred to culture medium
(MS, 6% myo-inositol, 0.4 mg/L thiamine-HCl, 2 mg/L 2,4-D
(dichlorophenoxyacetic acid), 0.5 mg/L BA and 30 g/L sucrose, pH
5.8), incubated at 25.degree. C. for 24 hours, and then subjected
to plant regeneration procedures.
Example 3: Protoplast Regeneration
[0051] For lettuce protoplast regeneration, RNP-transfected
protoplasts were re-suspended in 1/2.times. B5 culture medium
supplemented with 375 mg/L CaCl.sub.2.2H.sub.2O, 18.35 mg/L
NaFe-EDTA, 270 mg/L sodium succinate, 103 g/L sucrose, 0.2 mg/L
2,4-D, 0.3 mg/L 6-benzylaminopurine (6-BAP), and 0.1 g/L MES. Then,
the protoplasts were mixed with a 1:1 solution of 1/2.times. B5
medium and 2.4% agarose to a culture density of 2.5.times.10.sup.5
protoplasts/ml. The protoplasts embedded in agarose were plated
onto 6-well plates, overlaid with 2 ml of 1/2.times. B5 culture
medium, and cultured at 25.degree. C. in darkness. After 7 days,
the medium was replaced with a fresh culture medium, and the
protoplasts were cultured under light conditions (16-hr light [30
.mu.mol m.sup.-2 s.sup.-1] and 8-hr darkness) at 25.degree. C.
After 3 weeks of culture, micro-calli were grown to a few mm in
diameter and transferred to and cultured in MS regeneration medium
supplemented with 30 g/L sucrose, 0.6% plant agar, 0.1 mg/L
.alpha.-naphthalaneacetic acid (NAA), 0.5 mg/L BAP. Induction of
multiple lettuce shoots was observed on the regeneration medium
after about 4 weeks.
[0052] For regeneration of Brassica oleracea protoplasts,
RNP-transfected protoplasts cultured in culture medium were
centrifuged at 50 g for 5 minutes, and the precipitated cells were
re-suspended in callus induction medium (MS salt, 6% myo-inositol,
0.4 mg/L thiamine-HCl, 2 mg/L 2,4-D, 0.5 mg/L BA and 30% sucrose,
pH 5.8) and cultured at 25.degree. C. for 3 to 4 weeks in darkness.
The cultured micro-calli were transferred to callus induction solid
medium (MS salt, 0.6% myo-inositol, 0.4 mg/L thiamine-HCl, 2 mg/L
2,4-D, 0.5 mg/L BA, 3 mg/L AgNO.sub.3, 3% sucrose and 0.4%
gelrite), pH 5.8) and cultured in a light condition (a 16-hr light
cycle with a white fluorescent lamp of about 30 .mu.mol/m.sup.2s)
at 25.degree. C. Some of the calli were used for evaluation of
indel frequency. After 4 weeks of incubation under a light
condition, green plantlets regenerated from the calli derived from
the genome-edited protoplasts were transferred to MS basal medium
to induce root production for regeneration into whole plants.
Example 4: Targeted Deep Sequencing
[0053] The on-target sites were amplified from the genomic DNA of
RGEN-RNP-transfected protoplasts or regenerated calli. Indices and
sequencing adaptors were added by additional PCR. High-throughput
sequencing was performed using Illumina Miseq (v2, 300 cycle). The
primers used are shown in Table 1 below.
TABLE-US-00001 TABLE 1 LsBin2-deepF TAGAAACGGGGGAAACTGTG (SEQ ID
NO: 1) LsBin2-deepR CCCAAAAGAAGCTCAGCAAG (SEQ ID NO: 2) BoGSL-ALK
F1_1-5 GCGAAAAGAATGGGTGCAGA (SEQ ID NO: 3) BoGSL-ALK R1_1-5
TGGCATCCAAAACTGACTTCT (SEQ ID NO: 4) BoGSL-ALK F2_6-9
TCGAGTTACCAGTTGAGGCT (SEQ ID NO: 5) BoGSL-ALK R2_6-9
CGACATGACGTTACCTCATAGTC (SEQ ID NO: 6) BoGSL-ALK F3_10-12
CAGCGAAACGATCCAGAAGT (SEQ ID NO: 7) BoGSL-ALK R3_10-12
CTGACCGCAACATTAGCATCA (SEQ ID NO: 8) BoGSL-ALK F4_13-15
GCGCAGATGATGAGGAGAAG (SEQ ID NO: 9) BoGSL-ALK R4_13-15
AGAATCTCCAGCCATAACAACG (SEQ ID NO: 10)
Example 5: T7E1 Assay
[0054] Genomic DNA was isolated from protoplasts or calli using
DNeasy Plant Mini Kit (Qiagen). The target DNA region was amplified
and subjected to the T7E1 assay. In brief, PCR products were
denatured at 95.degree. C. and cooled slowly to room temperature
using a thermal cycler. Annealed PCR products were incubated with
T7 endonuclease I (e.g, ToolGen, Inc.) at 37.degree. C. for 20 min
and analyzed via agarose gel electrophoresis.
Example 6: RGEN-RFLP Assay
[0055] PCR products (300-400 ng) were incubated in 1.times.NEB
buffer 3 for 60 min at 37.degree. C. with Cas9 protein (1 .mu.g)
and sgRNA (750 ng) in a reaction volume of 10 .mu.l. RNase A (4
.mu.g) was then added to the reaction mixture and incubated at
37.degree. C. for 30 min to remove the sgRNA. The reaction was
stopped by adding 6.times. stop solution (30% glycerol, 1.2% SDS,
and 250 mM EDTA). DNA products were electrophoresed using 2.5%
agarose gel.
Experimental Example 1: Regeneration of Plants from BRASSINOSTEROID
INSENSITIVE 2(BIN2) Gene-Disrupted Lettuce Protoplasts
[0056] The present inventors designed an RNA-guided engineered
nuclease (RGEN) target site to disrupt the BRASSINOSTEROID
INSENSITIVE 2 (BIN2) gene, which encodes a negative regulator in a
brassinosteroid (BR) signaling pathway in lettuce (FIG. 1a; SEQ ID
NO: 11). Next, the present inventors transfected the RGEN
ribonucleoprotein (RNP) into lettuce protoplasts with polyethylene
glycol (PEG) and measured the targeted gene modification
efficiencies caused by RGEN using both the T7 endonuclease 1 (T7E1)
assay and targeted deep sequencing. As a result, insertions and
deletions (indels) were detected at the expected position, that is,
3 nucleotide (nt) upstream of NGG protospacer-adjacent motif (PAM),
with frequencies that ranged from 8.3% to 11% using T7E1 assay and
3.2% to 5.7% using NGS assay (FIGS. 1b and 1c).
[0057] Next, the present inventors performed a regeneration process
to produce plants which comprise the BIN2 variant alleles from
RGEN-RNP-treated protoplasts. As a result, only a fraction
(<0.5%) of the protoplasts could be cultured to form whole
plants via calli (FIGS. 2 and 3). Among these, 35 protoplast lines
were used to perform further analyses (FIG. 4). In brief, the
present inventors performed the RGEN-RFLP assay and targeted deep
sequencing to genotype the lettuce microcalli. RGEN-RFLP assay can
distinguish mono-allelic mutant clones (50% cleavage) from
heterozygous bi-allelic mutant clones (no cleavage) and homozygous
bi-allelic mutant clones (no cleavage) from wild-type clones (100%
cleavage). These analyses showed that two of 35 calli (5.75%)
contained mono-allelic mutations and 14 of 35 calli (40%) contained
bi-allelic mutations at the target site. The above results indicate
that genome-edited lettuces were obtained at a frequency of 46%
without any selection, which is an extremely high frequency
compared to the mutation frequency by RGEN-RNP in bulk populations.
This suggests that RGEN-induced mutations in the BIN2 gene were
stably maintained and accumulated during the regeneration
process.
Experimental Example 2: Regeneration of Plants from
Glucosinolate-Oxoglutarate-Dependent Dioxygenase Homolog (GSL-ALK)
Gene-Disrupted Brassica oleracea Protoplasts
[0058] In order to confirm the phenomenon of Experimental Example 1
while excluding experimental errors, the present inventors
performed an independent experiment in Brassica oleracea. Since the
possibility that the disruption of the BIN2 gene used as the target
in Experimental Example 1 would affect the growth and survival of
the protoplasts in the regeneration process, the present inventors
screened a gene irrelevant to the growth and survival of the
protoplasts or calli. To this end, seven sgRNA sequences (Table 2)
were designed in order to target and disrupt the B. oleracea
glucosinolate-oxoglutarate-dependent dioxygenase homolog (GSL-ALK)
gene encoding a protein that affects side chain mutations in the
glucosinolate pathway.
TABLE-US-00002 TABLE 2 Indel Mutant reads #/ frequency Name sgRNA
sequence Total reads # (%) BoGSL- ACTTCCAGTCATCTATCTCT 0/27157 0
ALK 1 (SEQ ID NO: 12) BoGSL- TGGTCCGAGAGATAGATGAC 2/30038 0 ALK 2
(SEQ ID NO: 13) BoGSL- CTGCTACGCCCTGATTGTGA 261/61752 0.4 ALK 7
(SEQ ID NO: 14) BoGSL- GTCTTGTTACCCTCACAATC 67/33545 0.2 ALK 9 (SEQ
ID NO: 15) BoGSL- AGAATGGTCATAGAGAGCTT 164/62330 0.3 ALK 12 (SEQ ID
NO: 16) BoGSL- ATATGAGATTGAAGGTTTGG 480/82376 0.6 ALK 13 (SEQ ID
NO: 17) BoGSL- ACAACGAAAGAGTTATGAGA 55/85835 0.1 ALK 15 (SEQ ID NO:
18)
[0059] The GSL-ALK gene is a gene having no relation to cell
survival or stress resistance, and it was expected that a result
different from that of Experimental Example 1, that is, a
relatively lower efficiency, would be obtained.
[0060] First, RGEN-RNP was introduced into Brassica oleracea
cotyledon-derived protoplasts by PEG (polyethylene glycol)-mediated
transfection, and the editing frequency of the target gene was
measured using NGS assay. As a result, it was shown that the
frequency was in the range of 0.0% to 1% (Table 2).
[0061] Next, the present inventors performed a regeneration process
to produce whole plants which contain the GSL-ALK gene-edited
alleles from RGEN-RNP-transfected protoplasts (FIG. 6). As a
result, only a fraction (<0.1%) of the Brassica oleracea
cotyledon-derived protoplasts could be cultured to form calli.
Targeted deep sequencing for the regenerated calli was performed to
genotype the Brassica oleracea calli. As a result, like the case of
BIN2 gene-disrupted lettuce, it was shown that genome-edited calli
were present in the analyzed calli at an extremely high frequency
(24 to 100%) compared to the editing frequency in protoplast
populations (Table 3).
TABLE-US-00003 TABLE 3 The total The number of The frequency number
of target gene of edited calli Name analyzed calli editedcalli (%)
BoGSL-ALK 1 3 1 33.3 BoGSL-ALK 2 10 4 40.0 BoGSL-ALK 7 1 1 100.0
BoGSL-ALK 9 7 4 57.1 BoGSL-ALK 25 6 24.0 12 BoGSL-ALK 14 4 28.5 13
BoGSL-ALK 15 4 26.7 15
[0062] The above-described results suggest that when RGEN-RNP is
applied, genome-edited protoplasts are stably maintained and
accumulated regardless of the kind of target gene in the
regeneration process of plant protoplasts. Namely, the present
inventors confirmed that when protoplasts are treated with
RGEN-RNP, cell proliferation and growth are promoted so that plants
can be regenerated with a high efficiency.
[0063] From the foregoing, it will be understood by those skilled
in the art to which the present invention pertains that the present
invention can be carried out in other embodiments without changing
the technical spirit or essential feature thereof. In this regard,
it should be understood that the aforementioned examples are of
illustrative purpose in all aspects but not is limited thereto. The
scope of the present invention should be construed to include the
meaning and scope of the appended claims, and all the alterations
and modified forms which are derived from the equivalent concept
thereof, rather than the detailed description.
Sequence CWU 1
1
64120DNAArtificial SequenceSynthetic (LsBin2-deepF) 1tagaaacggg
ggaaactgtg 20220DNAArtificial SequenceSynthetic (LsBin2-deepR)
2cccaaaagaa gctcagcaag 20320DNAArtificial SequenceSynthetic
(BoGSL-ALK F1_1-5) 3gcgaaaagaa tgggtgcaga 20421DNAArtificial
SequenceSynthetic (BoGSL-ALK R1_1-5) 4tggcatccaa aactgacttc t
21520DNAArtificial SequenceSynthetic (BoGSL-ALK F2_6-9) 5tcgagttacc
agttgaggct 20623DNAArtificial SequenceSynthetic (BoGSL-ALK R2_6-9)
6cgacatgacg ttacctcata gtc 23720DNAArtificial SequenceSynthetic
(BoGSL-ALK F3_10-12) 7cagcgaaacg atccagaagt 20821DNAArtificial
SequenceSynthetic (BoGSL-ALK R3_10-12) 8ctgaccgcaa cattagcatc a
21920DNAArtificial SequenceSynthetic (BoGSL-ALK F4 13-15)
9gcgcagatga tgaggagaag 201022DNAArtificial SequenceSynthetic
(BoGSL-ALK R4 13-15) 10agaatctcca gccataacaa cg 221120DNAArtificial
SequenceSynthetic (BIN2 target site) 11atcacagtga tgctcgtcaa
201220DNAArtificial SequenceSynthetic (BoGSL-ALK 1) 12acttccagtc
atctatctct 201320DNAArtificial SequenceSynthetic (BoGSL-ALK 2)
13tggtccgaga gatagatgac 201420DNAArtificial SequenceSynthetic
(BoGSL-ALK 7) 14ctgctacgcc ctgattgtga 201520DNAArtificial
SequenceSynthetic (BoGSL-ALK 9) 15gtcttgttac cctcacaatc
201620DNAArtificial SequenceSynthetic (BoGSL-ALK 12) 16agaatggtca
tagagagctt 201720DNAArtificial SequenceSynthetic (BoGSL-ALK 13)
17atatgagatt gaaggtttgg 201820DNAArtificial SequenceSynthetic
(BoGSL-ALK 15) 18acaacgaaag agttatgaga 201953DNAArtificial
SequenceSynthetic Sequence 19gttttaaagc atcacagtga tgctcgtcaa
aggatgcctc tcatttatgt caa 532053DNAArtificial SequenceSynthetic
Sequence 20caaaatttcg tagtgtcact acgagcagtt tcctacggag agtaaataca
gtt 532123DNAArtificial SequenceSynthetic Sequence 21atcacagtga
tgctcgtcaa agg 232224DNAArtificial SequenceSynthetic Sequence
22atcacagtga tgctcgtcca aagg 242322DNAArtificial SequenceSynthetic
Sequence 23atcacagtga tgctcgcaaa gg 222424DNAArtificial
SequenceSynthetic Sequence 24atcacagtga tgctcgtaca aagg
242524DNAArtificial SequenceSynthetic Sequence 25atcacagtga
tgctcgtgca aagg 242623DNAArtificial SequenceSynthetic Sequence
26atcacagtga tgctcgtcaa agg 232724DNAArtificial SequenceSynthetic
Sequence 27atcacagtga tgctcgtcca aagg 242820DNAArtificial
SequenceSynthetic Sequence 28atcacagtga tgctcaaagg
202924DNAArtificial SequenceSynthetic Sequence 29atcacagtga
tgctcgtaca aagg 243024DNAArtificial SequenceSynthetic Sequence
30atcacagtga tgctcgtgca aagg 243123DNAArtificial SequenceSynthetic
Sequence 31atcacagtga tgctcgtcaa agg 233224DNAArtificial
SequenceSynthetic Sequence 32atcacagtga tgctcgttca aagg
243324DNAArtificial SequenceSynthetic Sequence 33atcacagtga
tgctcgtaca aagg 243424DNAArtificial SequenceSynthetic Sequence
34atcacagtga tgctcgtgca aagg 243524DNAArtificial SequenceSynthetic
Sequence 35atcacagtga tgctcgtcca aagg 243623DNAArtificial
SequenceSynthetic Sequence 36atcacagtga tgctcgtcaa agg
233724DNAArtificial SequenceSynthetic Sequence 37atcacagtga
tgctcgttca aagg 243824DNAArtificial SequenceSynthetic Sequence
38atcacagtga tgctcgtaca aagg 243920DNAArtificial SequenceSynthetic
Sequence 39atcacagtga tgctcaaagg 204024DNAArtificial
SequenceSynthetic Sequence 40atcacagtga tgctcgtgca aagg
244123DNAArtificial SequenceSynthetic Sequence 41atcacagtga
tgctcgtcaa agg 234224DNAArtificial SequenceSynthetic Sequence
42atcacagtga tgctcgtcca aagg 244324DNAArtificial SequenceSynthetic
Sequence 43atcacagtga tgctcgttca aagg 244420DNAArtificial
SequenceSynthetic Sequence 44atcacagtga tgctcaaagg
204524DNAArtificial SequenceSynthetic Sequence 45atcacagtga
tgctcgttca aagg 244614DNAArtificial SequenceSynthetic Sequence
46atcacagtca aagg 144724DNAArtificial SequenceSynthetic Sequence
47atcacagtga tgctcgttca aagg 244824DNAArtificial SequenceSynthetic
Sequence 48atcacagtga tgctcgttca aagg 244914DNAArtificial
SequenceSynthetic Sequence 49atcacagtca aagg 145024DNAArtificial
SequenceSynthetic Sequence 50atcacagtga tgctcgttca aagg
245124DNAArtificial SequenceSynthetic Sequence 51atcacagtga
tgctcgttca aagg 245221DNAArtificial SequenceSynthetic Sequence
52atcacagtga tgctccaaag g 215324DNAArtificial SequenceSynthetic
Sequence 53atcacagtga tgctcgttca aagg 245424DNAArtificial
SequenceSynthetic Sequence 54atcacagtga tgctcgttca aagg
245524DNAArtificial SequenceSynthetic Sequence 55atcacagtga
tgctcgttca aagg 245622DNAArtificial SequenceSynthetic Sequence
56atcacagtga tgctcgcaaa gg 225724DNAArtificial SequenceSynthetic
Sequence 57atcacagtga tgctcgttca aagg 245823DNAArtificial
SequenceSynthetic Sequence 58atcacagtga tgctcgtcaa agg
235916DNAArtificial SequenceSynthetic Sequence 59atcacagtgt caaagg
166023DNAArtificial SequenceSynthetic Sequence 60atcacagtga
tgctcgtcaa agg 236124DNAArtificial SequenceSynthetic Sequence
61atcacagtga tgctcgttca aagg 246224DNAArtificial SequenceSynthetic
Sequence 62atcacagtga tgctcgttca aagg 246324DNAArtificial
SequenceSynthetic Sequence 63atcacagtga tgctcgttca aagg
246424DNAArtificial SequenceSynthetic Sequence 64atcacagtga
tgctcgttca aagg 24
* * * * *