U.S. patent application number 16/972647 was filed with the patent office on 2021-11-04 for methods of regenerating and transforming cannabis.
This patent application is currently assigned to The State of Israel, Ministry of Agriculture & Rural Development, Agricultural Research Organization. The applicant listed for this patent is The State of Israel, Ministry of Agriculture & Rural Development, Agricultural Research Organization. Invention is credited to Samuel BOCOBZA, Oded COHEN, Reut COHEN PEER, Moshe Arie FLAISHMAN.
Application Number | 20210337753 16/972647 |
Document ID | / |
Family ID | 1000005770930 |
Filed Date | 2021-11-04 |
United States Patent
Application |
20210337753 |
Kind Code |
A1 |
FLAISHMAN; Moshe Arie ; et
al. |
November 4, 2021 |
METHODS OF REGENERATING AND TRANSFORMING CANNABIS
Abstract
Methods of in vitro clonal propagation, regeneration and
transformation in Cannabis are provided. Also provided is the use
of such methods in improvements of cannabis cultivars such as via
breeding.
Inventors: |
FLAISHMAN; Moshe Arie;
(Herzliya, IL) ; COHEN PEER; Reut; (Kiryat-Ono,
IL) ; COHEN; Oded; (Nir Zvi, IL) ; BOCOBZA;
Samuel; (Tel Aviv, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The State of Israel, Ministry of Agriculture & Rural
Development, Agricultural Research Organization |
Rishon-LeZion |
|
IL |
|
|
Assignee: |
The State of Israel, Ministry of
Agriculture & Rural Development, Agricultural Research
Organization
Rishon-LeZion
IL
(ARO) (VOLCANI CENTER)
|
Family ID: |
1000005770930 |
Appl. No.: |
16/972647 |
Filed: |
June 6, 2019 |
PCT Filed: |
June 6, 2019 |
PCT NO: |
PCT/IL2019/050653 |
371 Date: |
December 7, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62681697 |
Jun 7, 2018 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01G 22/00 20180201;
A01G 31/00 20130101; A01H 4/008 20130101; A01H 4/005 20130101; A01H
6/28 20180501 |
International
Class: |
A01H 4/00 20060101
A01H004/00; A01H 6/28 20060101 A01H006/28; A01G 22/00 20060101
A01G022/00 |
Claims
1. A method of in-vitro propagating cannabis, the method
comprising: (a) culturing a cannabis plant part comprising a
meristem on a solid culture medium so as to obtain an explant; and
subsequently (b) subjecting said explant to a cell wall disrupting
agent; (c) culturing said explant in a liquid medium; and
optionally subsequently wherein steps (a)-(c) are effected for 1 to
n times until emergence of leaves suitable for regeneration.
2. The method of claim 1, further comprising sterilizing said
explant prior to (a).
3. The method of claim 1, wherein said liquid medium comprises said
cell wall disrupting agent.
4. The method of claim 1, wherein said step (c) is performed while
shaking.
5. The method of claim 1, wherein step (a) is performed for 7-30
days.
6. The method of claim 1, wherein step (c) is performed for 5-30
days.
7. The method of claim 1, wherein said meristem is an apical
meristem or an axillary meristem.
8. The method of claim 1, wherein said explant comprising said
meristem is of a stem.
9. The method of claim 1, wherein said explant is from a
seedling.
10. The method of claim 1, wherein said explant is from a mature
plant.
11. The method of claim 1, further comprising removing leaves and
necrotic regions from said explant between steps (a) to (c).
12. The method of claim 1, wherein said cell wall disrupting agent
is selected from the group consisting of a chemical, an enzyme and
a physical treatment.
13. The method of claim 1, wherein said enzyme comprises a
plurality of enzymes.
14. The method of claim 12, wherein said enzyme is provided at a
sub-lethal concentration.
15. The method of claim 1, wherein said enzyme is selected from the
group consisting of pectinase, cutinase and a combination
thereof.
16. The method of claim 1, wherein in said steps (a) said solid
medium is devoid of said cell wall disrupting agent.
17. The method of claim 1, wherein said emergence of leaves
suitable for regeneration is manifested by rooting and
acclimatization.
18. (canceled)
19. A method of cannabis regeneration in a tissue culture, the
method comprising culturing regenerable cannabis explant in-vitro
in a solid medium comprising at least one regeneration agent and a
cell wall disrupting agent so as to regenerate cannabis.
20. The method of claim 19, wherein said regenerable cannabis
explant is obtained by a method of in-vitro propagating cannabis,
the method comprising: (a) culturing a cannabis plant part
comprising a meristem on a solid culture medium so as to obtain an
explant; and subsequently (b) subjecting said explant to a cell
wall disrupting agent; (c) culturing said explant in a liquid
medium; and optionally subsequently wherein steps (a)-(c) are
effected for 1 to n times until emergence of leaves suitable for
regeneration.
21-63. (canceled)
Description
[0001] This application claims the benefit of priority of U.S.
Provisional Patent Application No. 62/681,697 filed on 7 Jun. 2018,
the contents of which are incorporated herein by reference in their
entirety.
SEQUENCE LISTING STATEMENT
[0002] The ASCII file, entitled 77944 Sequence Listing.txt, created
on 5 Jun. 2019, comprising 49,173 bytes, submitted concurrently
with the filing of this application is incorporated herein by
reference.
FIELD AND BACKGROUND OF THE INVENTION
[0003] The present invention, in some embodiments thereof, relates
to methods of regenerating and transforming cannabis.
[0004] Cannabis sativa L. is an annual herb. It is among the
earliest cultivated plants which originated in Central Asia. It is
valued as a food, oil, fiber, medicinal and recreational drug
source and, consequently, has been dispersed throughout the world.
Cannabis sativa L. (marijuana) contains cannabinoids, a unique
class of terpenophenolic compounds which accumulates mainly in
glandular trichomes of the plant. Over 100 cannabinoids have been
isolated from marijuana, the major biologically active compound
being A9-tetrahydrocannabinol, commonly referred as THC.
[0005] The development of genetic transformation technology for
plants has resulted in a great progress toward the genetic design
of plants with enhanced production traits, such as herbicide,
insect and disease resistance. Commercial cultivars of several
transgenic plants have been released. The development of new
Cannabis cultivars with improved traits could be further
facilitated using biotechnological strategies. The dioecious life
cycle of many Cannabis varieties complicates breeding efforts
towards improvement of specific traits, such as resistance to pests
and diseases. Development of a tissue culture system to regenerate
cannabis plantlets and an Agrobacterium mediated transformation
protocol would permit exploitation of a greater amount of genetic
diversity for plant improvement and would facilitate clonal
multiplication of plants with desirable traits.
[0006] There are only a small number of reports concerning tissue
culture of Cannabis. Most of these studies were aimed at developing
a cell culture system to obtain secondary metabolites, particularly
the class of cannabinoids that are distinctive to the genus
Cannabis (Turner et al., 1980). Callus cultures (Hemphill et al.,
1978; Heitrich and Binder, 1982) and suspension cultures (Veliky
and Genest, 1972; Itokawa et al., 1977; Hartsel et al., 1983; Loh
et al., 1983; Braemer and Paris, 1987) have been established for
extraction of secondary metabolites and biotransformation
studies.
[0007] Methods to multiply C. sativa plants in-vitro via
stimulation of axillary buds on nodal segments, or induction of
adventitious buds in the shoot tips have been described (Lata et
al., 2009 vitro Cell. Dev. Biol. Plant 45, 12-19. doi:
10.1007/s11627-008-9167-5; Wang et al., 2009 Pak. J. Bot. 41,
603-608). It was shown that micro-propagated plants are genetically
stable; therefore the method is appropriate and useful for the
clonal multiplication of this important crop (Lata et al., 2010
Planta Med. 76, 1629-1633. doi: 10.1055/s-0030-1249773; Lata et al.
Journal of Applied Research on Medicinal and Aromatic Plants 3
(2016) 18-26).
[0008] A protocol has also been developed for the propagation of
hemp via the synthetic seed technology. According to this
procedure, axillary buds or nodal segments are encapsulated in
calcium alginate beads (Lata et al., 2009 Physiol. Mol. Biol.
Plants 15, 79-86. doi: 10.1007/s12298-009-0008-8, Lata 2011
Biotechnol. Lett. 33, 2503-2508. doi: 10.1007/s10529-011-0712-7),
which can then be stored and subsequently used for clonal
propagation of the plant. This system was shown to allow the growth
of homogeneous and genetically stable Cannabis plants even after 6
months of storage (Lata et al., 2011, Biotechnol. Lett. 33,
2503-2508. doi: 10.1007/s10529-011-0712-7).
[0009] Organ regeneration, in particular shoots, can be quite
cumbersome and therefore the screening of different plant growth
regulator concentrations and combinations has to be carried out to
find the right culture medium composition.
[0010] Cannabis sativa is a notorious recalcitrant plant to
transformation, because the regeneration efficiencies are quite low
(Slusarkiewicz-Jarzina et al., 2005 Acta Biol. Cracov. Ser. Bot.
47, 145-151).
[0011] Genome editing is a promising new technique for plant
breeding. With designer nucleases called CRISPR-Cas9 mutations can
be precisely directed to any gene of interest. Successful genome
editing requires simple genetics (diploid) and the availability of
a high-quality genomic DNA sequence. Following editing, the
CRISPR-Cas genes should be removed, for example by crossing and
selecting null-segregates that inherit the induced mutation.
Crossing is not suitable for heterozygous crops like Cannabis, in
which varieties are vegetatively propagated. Methods for transient
expression in leaf protoplasts need to be developed.
[0012] Additional background art includes:
[0013] Zhao et al., 2017--Nature plants. 3(12). 956;
[0014] MacKinnon, L., McDougall, G., Azis, N., and Millam, S.
(2001). "Progress towards transformation of fibre hemp," in Annual
Report of the Scottish Crop Research Institute 2000/2001, eds W. H.
Macfarlane Smith and T. D. Heilbronn (Dundee: SCRI Invergowrie),
84-86;
[0015] U.S. Patent Application Publication number: 20120311744;
SUMMARY OF THE INVENTION
[0016] According to an aspect of some embodiments of the present
invention there is provided a method of in-vitro propagating
cannabis, the method comprising:
(a) culturing a cannabis plant part comprising a meristem on a
solid culture medium so as to obtain an explant; and subsequently
(b) subjecting the explant to a cell wall disrupting agent; (c)
culturing the explant in a liquid medium; and optionally
subsequently wherein steps (a)-(c) are effected for 1 to n times
until emergence of leaves suitable for regeneration.
[0017] According to some embodiments of the invention, the method
further comprises sterilizing the explant prior to (a).
[0018] According to some embodiments of the invention, the liquid
medium comprises the cell wall disrupting agent.
[0019] According to some embodiments of the invention, the step (c)
is performed while shaking.
[0020] According to some embodiments of the invention, step (a) is
performed for 7-30 days.
[0021] According to some embodiments of the invention, step (c) is
performed for 5-30 days.
[0022] According to some embodiments of the invention, the meristem
is an apical meristem or an axillary meristem.
[0023] According to some embodiments of the invention, the explant
comprising the meristem is of a stem.
[0024] According to some embodiments of the invention, the explant
is from a seedling.
[0025] According to some embodiments of the invention, the explant
is from a mature plant.
[0026] According to some embodiments of the invention, the method
further comprises removing leaves and necrotic regions from the
explant between steps (a) to (c).
[0027] According to some embodiments of the invention, the cell
wall disrupting agent is selected from the group consisting of a
chemical, an enzyme and a physical treatment.
[0028] According to some embodiments of the invention, the enzyme
comprises a plurality of enzymes.
[0029] According to some embodiments of the invention, the enzyme
is provided at a sub-lethal concentration.
[0030] According to some embodiments of the invention, the enzyme
is selected from the group consisting of pectinase, cutinase and a
combination thereof.
[0031] According to some embodiments of the invention, in the step
(a), the solid medium is devoid of the cell wall disrupting
agent.
[0032] According to some embodiments of the invention, the
emergence of leaves suitable for regeneration is manifested by
rooting and acclimatization
[0033] According to an aspect of some embodiments of the present
invention there is provided a regenerable cannabis explant
obtainable according to the method as described herein.
[0034] According to an aspect of some embodiments of the present
invention there is provided a method of cannabis regeneration in a
tissue culture, the method comprising culturing regenerable
cannabis explant in-vitro in a solid medium comprising at least one
regeneration agent and a cell wall disrupting agent so as to
regenerate cannabis.
[0035] According to an aspect of some embodiments of the present
invention there is provided a method of in-vitro cannabis
transformation, the method comprising, contacting a regenerable
cannabis explants in-vitro with a polynucleotide encoding an
expression product of interest and a cell wall disrupting
agent.
[0036] According to some embodiments of the invention, the method
further comprises wounding the leaves prior to contacting.
[0037] According to some embodiments of the invention, the
transformation comprises a transient transformation.
[0038] According to some embodiments of the invention, the
transformation comprises a stable transformation.
[0039] According to some embodiments of the invention, the
contacting is effected by bombardment or Agrobacterium.
[0040] According to an aspect of some embodiments of the present
invention there is provided a method of in planta cannabis
regeneration, the method comprising:
[0041] (a) removing, exposing and/or wounding a meristem of a
cannabis tissue so as to obtain a meristem-depleted cannabis
tissue; and
[0042] (b) treating the meristem-depleted cannabis tissue with a
composition comprising at least one plant hormone which allow for
meristem regeneration;
[0043] According to an aspect of some embodiments of the present
invention there is provided a method of in planta cannabis
transformation, the method comprising:
[0044] (a) removing, exposing and/or wounding a meristem of a
cannabis tissue so as to obtain a meristem-depleted cannabis
tissue; and
[0045] (b) treating the meristem-depleted cannabis tissue with a
composition comprising at least one plant hormone that allows plant
regeneration and with a composition comprising a nucleic acid
sequence encoding an expression product of interest.
[0046] According to some embodiments of the invention, the
composition comprising the at least one plant hormone that allow
plant regeneration and the composition comprising the nucleic acid
sequence of interest are the same compositions.
[0047] According to some embodiments of the invention, the
composition comprising at least one plant hormone that allow plant
regeneration and the composition comprising the nucleic acid
sequence of interest are different compositions.
[0048] According to some embodiments of the invention, treating
with the composition comprising at least one plant hormone that
allow plant regeneration and the composition comprising the nucleic
acid sequence of interest is performed concomitantly.
[0049] According to some embodiments of the invention, treating
with the composition comprising at least one plant hormone that
allow plant regeneration and the composition comprising the nucleic
acid sequence of interest is performed sequentially.
[0050] According to some embodiments of the invention, the
sequentially is within an interval of 24-96 h.
[0051] According to some embodiments of the invention, the cannabis
plant is a seedling.
[0052] According to some embodiments of the invention, the cannabis
plant is a mature plant.
[0053] According to some embodiments of the invention, the mature
plant comprises at least two nodes.
[0054] According to some embodiments of the invention, the exposing
is effected while leaving a single leaf or cotyledon to allow
photosynthesis.
[0055] According to some embodiments of the invention, the
composition is formulated such that allows attachment of the
composition to a surface of the meristem-depleted cannabis
tissue.
[0056] According to some embodiments of the invention, at least one
of the composition comprising at least one plant hormone and a
composition comprising a nucleic acid sequence of interest
comprises an emulsifier.
[0057] According to an aspect of some embodiments of the present
invention there is provided a method of cannabis regeneration via
somatic embryogenesis, the method comprising:
[0058] (a) culturing a callus or a regenerable cannabis explant in
a liquid culture while shaking till appearance of globular
structures;
[0059] (b) culturing the globular structures in a liquid culture
while shaking till appearance of leaves.
[0060] According to some embodiments of the invention, step (a) is
effected in the presence of CPPU; and wherein step (b) is effected
in the presence of CPPU+TBD.
[0061] According to some embodiments of the invention, the step (a)
is effected in the absence of TBD.
[0062] According to an aspect of some embodiments of the present
invention there is provided a method of in-vitro cannabis
transformation, the method comprising, contacting a leaf producible
according to the method as described herein with a polynucleotide
encoding an expression product of interest.
[0063] According to some embodiments of the invention, the
polynucleotide is comprised in a formulation comprising
Agrobacterium or PEG.
[0064] According to an aspect of some embodiments of the present
invention there is provided a method of producing cannabis
protoplasts, the method comprising, treating a cannabis tissue with
macerozyme R-10 and mannitol, so as to obtain protoplasts.
[0065] According to some embodiments of the invention, the method
further comprises treating with cellulose onzuka R-10 and/or
hemicelluloses.
[0066] According to some embodiments of the invention, the
macerozyme R-10 is provided at a concentration of 0.4-1.5%.
[0067] According to some embodiments of the invention, the
hemicelluloses is provided at a concentration of 0.5-2%.
[0068] According to some embodiments of the invention, the onzuka
R-10 provided at a concentration of 0.5-3%.
[0069] According to an aspect of some embodiments of the present
invention there is provided protoplasts obtainable according to the
method as described herein.
[0070] According to an aspect of some embodiments of the present
invention there is provided a method of cannabis transformation,
the method comprising contacting the protoplasts as described
herein with a composition comprising a nucleic acid sequence
encoding an expression product of interest.
[0071] According to an aspect of some embodiments of the present
invention there is provided a method of cannabis transformation,
the method comprising contacting pollen of a cannabis plant with
particles comprising a nucleic acid sequence encoding an expression
product of interest under a magnetic field that concentrates the
particles and allows penetration of the nucleic acid sequence of
interest into the pollen.
[0072] According to some embodiments of the invention, the pollen
is used up to 12 hours post harvesting.
[0073] According to some embodiments of the invention, the cannabis
is Cannabis sativa.
[0074] According to an aspect of some embodiments of the present
invention there is provided a method of cannabis regeneration, the
method comprising transforming an explants of the cannabis with a
regenerating gene and allowing the tissue to regenerate.
[0075] According to some embodiments of the invention, the
transforming is according to the method as described herein.
[0076] According to some embodiments of the invention, the
regenerating gene comprises a nucleic acid sequence of CsBBM and
CsSERK1 or a homolog of same.
[0077] According to an aspect of some embodiments of the present
invention there is provided a transformed cannabis plant obtainable
as described herein.
[0078] According to some embodiments of the invention, the nucleic
acid sequence encoding an expression product of interest is
selected from the group consisting of a genome editing agent, an
RNA silencing agent, a regeneration agent, a gene conferring an
agriculturally valuable agent and a modulator of cannabis
metabolome.
[0079] According to an aspect of some embodiments of the present
invention there is provided a method of breeding, the method
comprising crossing the plant as described herein with another
cannabis plant.
[0080] According to some embodiments of the invention, the method
further comprises selecting for a phenotype of interest.
[0081] According to some embodiments of the invention, the
phenotype comprises presence or absence of a transgene.
[0082] According to some embodiments of the invention, the
phenotype of interest comprises an agriculturally valuable trait
and/or a cannabis valuable trait.
[0083] Unless otherwise defined, all technical and/or scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which the invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of
embodiments of the invention, exemplary methods and/or materials
are described below. In case of conflict, the patent specification,
including definitions, will control. In addition, the materials,
methods, and examples are illustrative only and are not intended to
be necessarily limiting.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0084] Some embodiments of the invention are herein described, by
way of example only, with reference to the accompanying drawings.
With specific reference now to the drawings in detail, it is
stressed that the particulars shown are by way of example and for
purposes of illustrative discussion of embodiments of the
invention. In this regard, the description taken with the drawings
makes apparent to those skilled in the art how embodiments of the
invention may be practiced.
[0085] In the drawings:
[0086] FIG. 1 shows the establishment of Cannabis tissue culture.
Ten different cannabis cultivars seedlings and shoot cuttings were
sterilized and grown on 1/2 MS medium supplemented with 10 g/L
sucrose, 5.5 g/L agar at a pH of 6.8 with different plant hormone
combinations under light for 16 h per day. Most cultivars exhibited
limited growth on solid media supplemented with different hormonal
combinations.
[0087] FIG. 2 is a bar graph showing tissue culture response to
various growth media. Growth rate was scored from 1 (growth arrest)
to 5 (rapid growth).
[0088] FIGS. 3A-C are images showing Cannabis plant propagation in
tissue culture using "liquid treatment" according to the embodiment
described in the Examples section. FIG. 3A--28 days old tissue
culture in solid medium presents low growth and development. FIG.
3B--49 days old which is 21 days in the "liquid treatment"
according to the embodiment described in the Examples section. FIG.
3C--The same plant after the "liquid treatment" (FIG. 3B), cultured
in a solid medium;
[0089] FIG. 4 shows the results of a combined treatment with liquid
media with sub-lethal doses of cuticle nicking enzymes and plant
and surfactants;
[0090] FIGS. 5A-C show rooting and acclimatization of Cannabis
plants generated according to FIG. 4. FIG. 5A--In-vitro plant after
solid-liquid-solid culturing with the nicking enzymes in liquid
phase. FIG. 5B--Plants in rooting cylinders. FIG. 5C--Potted plants
in the greenhouse one month after acclimatization (planting).
[0091] FIG. 6 is an image showing Cannabis regeneration from
different plant tissues (leaves and calli from tissue culture,
cotyledons from seeds).
[0092] FIG. 7 shows cannabis transformation of different plant
tissues. Successful transformation of several cannabis cultivars
using the uidA-intron and nptII genes. Efficient transient
transformation of leaves, hypocotyls, callus and cotyledons of
several Cannabis cultivars (upper panel). Positive PCR was shown in
all tested clones (lower panel).
[0093] FIGS. 8A-F are images showing Cannabis seedlings in planta
regeneration using the "regeneration paste" according to the
embodiment described in the Examples section with appropriate plant
hormone combinations. FIG. 8A. Seedling meristem--the striped line
indicates the cutting, wounding place. FIG. 8B. Peeling and
exposing the tissue between the cotyledon and stem. Note that there
is no meristem hidden. Cutting start is indicated by arrowheads,
FIG. 8C. Scanning electron micrograph of the cut seedling, FIG. 8D.
Stereoscope micrograph of the cut seedling, FIGS. 8E-F.
Regenerating shoots, arrowhead indicates the remains of the removed
stem.
[0094] FIG. 9 is an image showing in planta regeneration of
cannabis cuttings, using the "regeneration paste" according to the
embodiment described in the Examples section with appropriate plant
hormone combinations. Plant regeneration was observed 14 days after
application of the "regeneration past".
[0095] FIGS. 10A-C show in planta transformation using the
Agrobacterium strain EHA 105 harboring the binary vector pME504
that carries the genes for .beta.-glucuronidase (GUS) and neomycin
phosphotransferase (npt II). The proof of transformability in the
TO generation was indicated by the GUS histochemical staining
analysis of the seedlings and molecular characterization and GUS
and nptII, using PCR.
[0096] FIGS. 11A-C show in planta transformation using the
Agrobacterium strain EHA 105 harboring the binary vector pX11 that
carries the genes for nptII and betalains. The proof of
transformability in the T.sub.0 generation was indicated by
betalains staining (FIGS. 11A-B) and PCR.
[0097] FIGS. 12A-B show a liquid culture (FIG. 12A) and globular
stage embryos (FIG. 12B) that was initiated on B5 media,
supplemented with 10 mg/l CPPU.
[0098] FIGS. 13A-B show plant regeneration on liquid media.
Suspension culture with globular stage embryos (FIG. 13A) callus
formation (FIG. 13B) and plant regeneration (FIG. 13C) was
initiated on B5 media, supplemented with 10 mg/l CBD-CPPU.
[0099] FIG. 14 is a graph showing mesophyll protoplasts yield
(.times.10.sup.6) in three different cultivars of Cannabis sativa
under a variety of enzymatic treatments.
[0100] FIGS. 15A-B show cannabis protoplasts isolated after
enzymatic treatment (complex of enzymes C).
[0101] FIG. 16 shows protoplast transformation using the RFP
gene.
[0102] FIGS. 17A-D are images of optical microscopy of Cannabis
pollen. FIG. 17A--Pollen grain stained with Safranine O. FIG.
17B--Germination of pollen grain after 18 h. (FIG. 17C--Transformed
pollen grain expressing the exogenous reporter GUS gene. FIG.
17D--No transformation staining control.
[0103] FIG. 18 shows the Sequences of the CsBBM and CsSERK1 genes
(SEQ ID NOs: 2 and 1, respectively). Transcript sequences were
obtained from the database available at
www(dot)medicinalplantgenomics(dot)msu(dot)edu/index(dot)shtml.
Start and stop codons are highlighted in yellow.
[0104] FIG. 19 is a map of the plasmid used to induce somatic
embryogenesis and genome editing in Cannabis plants. The CAS9 is
under the control of the CsUBIQUITIN10 promoter (SEQ ID NO: 11);
the CsBBM, and CsSERK1 genes are under the same CsUBIQUITIN10
promoter (SEQ ID NO: 11).
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0105] The present invention, in some embodiments thereof, relates
to methods of regenerating and transforming cannabis.
[0106] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not
necessarily limited in its application to the details set forth in
the following description or exemplified by the Examples. The
invention is capable of other embodiments or of being practiced or
carried out in various ways.
[0107] Cannabis is currently witnessing a revival because of its
rich repertoire of phytochemicals, its fibers and its agricultural
features, namely resistance to drought and pests, well-developed
root system preventing soil erosion and lower water requirement
with respect to other crops, e.g., cotton. Cannabis varieties
producing oil, biomass and phytochemicals are currently cultivated.
The availability of genome sequences greatly helps molecular
studies on this important crop (van Bakel et al., 2011, The draft
genome and transcriptome of Cannabis sativa. Genome Biol. 12:R-102.
doi: 10.1186/gb-2011-12-10-R-102). In addition, the scientific
community is very much interested in harnessing Cannabis
pharmacological power.
[0108] However, to date, there are only a small number of reports
concerning tissue culture of Cannabis. Most of these studies were
aimed at developing a cell culture system to obtain secondary
metabolites, particularly the class of cannabinoids that are
distinctive to the genus Cannabis (Turner et al., 1980). Callus
cultures (Hemphill et al., 1978; Heitrich and Binder, 1982) and
suspension cultures (Veliky and Genest, 1972; Itokawa et al., 1977;
Hartsel et al., 1983; Loh et al., 1983; Braemer and Paris, 1987)
have been established for extraction of secondary metabolites and
biotransformation studies. However transgenic cultivars of Cannabis
plants have not yet been released and research has not demonstrated
that this technology can be applied.
[0109] Whilst reducing embodiments of the invention to practice,
the present inventors were able to regenerate cannabis in culture
and to develop protocols for plant transformation either on tissue
explants, pollen or even in planta.
[0110] These protocols can be exploited towards genetic
manipulation of this crop plant by way of over-expression, genome
editing or silencing which can benefit the entire cannabis
industry.
[0111] The term "plant" as used herein encompasses whole plants, a
grafted plant, ancestors and progeny of the plants and plant parts,
including seeds, shoots, stems, roots (including tubers),
rootstock, scion, and plant cells, tissues and organs. The plant
may be in any form including suspension cultures, embryos,
meristematic regions, callus tissue, leaves, gametophytes,
sporophytes, pollen, and microspores.
[0112] The terms "cannabis" refers to the genus which includes all
different species including Cannabis sativa, Cannabis indica and
Cannabis ruderalis as well as wild Cannabis.
[0113] Cannabis is diploid, having a chromosome complement of
2n=20, although polyploid individuals have been artificially
produced and are also contemplated herein. The first genome
sequence of Cannabis, which is estimated to be 820 Mb in size, was
published in 2011 by a team of Canadian scientists (van Bakel et
al, supra).
[0114] All known strains of Cannabis are wind-pollinated and the
fruit is an achene. Most strains of Cannabis are short day plants,
with the possible exception of C. sativa subsp. sativa var.
spontanea (=C. ruderalis), which is commonly described as
"auto-flowering" and may be day-neutral.
[0115] According to a specific embodiment, the plant is of C.
sativa.
[0116] Cannabis has long been used for drug and industrial
purposes: fiber (hemp), for seed and seed oils, extracts for
medicinal purposes, and as a recreational drug. The selected
genetic background (e.g., cultivar) depends on the future use.
Industrial hemp products are made from Cannabis plants selected to
produce an abundance of fiber. Some Cannabis strains have been bred
to produce minimal levels of THC, the principal psychoactive
constituent responsible for the psychoactivity associated with
marijuana. Marijuana has historically consisted of the dried
flowers of Cannabis plants selectively bred to produce high levels
of THC and other psychoactive cannabinoids. Various extracts
including hashish and hash oil are also produced from the
plant.
[0117] Thus, for example, a CBD rich strain can be selected from a
group consisting of Golan, Avidekel, Fedora 17, ACDC, and any
combination thereof; or wherein said cannabis plant is a THC rich
strain; said THC rich strain is selected from a group consisting of
Everest, Black Destroyer, Critical Neville Haze, Mataro Blue, LSD
OG Kush, Pineapple Chunk, Blue Monster Holk, Y Griega, Satori,
Tutankhamon, and any combination thereof.
[0118] Some additional varieties are provided infra in Example 1 of
the Examples section which follows (e.g., WON21, Pinola, Goodrich,
Glory, Lemon Haze, Jack herer, Lemon Haze Bnn., Cheese and
SLH.).
[0119] The term "variety" as used herein has identical meaning to
the corresponding definition in the International Convention for
the Protection of New Varieties of Plants (UPOV treaty), of Dec. 2,
1961, as Revised at Geneva on Nov. 10, 1972, on Oct. 23, 1978, and
on Mar. 19, 1991. Thus, "variety" means a plant grouping within a
single botanical taxon of the lowest known rank, which grouping,
irrespective of whether the conditions for the grant of a breeder's
right are fully met, can be i) defined by the expression of the
characteristics resulting from a given genotype or combination of
genotypes, ii) distinguished from any other plant grouping by the
expression of at least one of the said characteristics and iii)
considered as a unit with regard to its suitability for being
propagated unchanged.
[0120] The term "variety" is interchangeable with "cultivar".
[0121] As mentioned, embodiments of the invention relate to
cannabis transformation and plant regeneration. It will be
appreciated that the process of tissue transformation is dependent
on the ability of the plant to regenerate. The protocol of
regeneration can be selected from in-vitro regeneration and in
planta regeneration.
[0122] As used herein "regeneration" or "regenerating" refers to
the development of a whole plant from somatic cells e.g., in tissue
culture (in-vitro) or in planta.
[0123] As used herein "regenerable" refers to the ability to
develop into a whole plant in-vitro.
[0124] According to a specific embodiment, the regeneration
efficiency using embodiments of the invention is at least 50%
(regenerants from the source tissue or organ).
[0125] According to a specific embodiment, the regeneration
efficiency using embodiments of the invention is at least 60%.
[0126] According to a specific embodiment, the regeneration
efficiency using embodiments of the invention is at least 70%.
[0127] According to a specific embodiment, the regeneration
efficiency using embodiments of the invention is at least 80%.
[0128] According to a specific embodiment, the regeneration
efficiency using embodiments of the invention is at least 90%.
[0129] According to a specific embodiment, the transformation
efficiency using embodiments of the invention is at least 60%
(e.g., in transient transformation).
[0130] According to a specific embodiment, the transformation
efficiency using embodiments of the invention is at least 70%
(e.g., in transient transformation).
[0131] According to a specific embodiment, the transformation
efficiency using embodiments of the invention is at least 80%
(e.g., in transient transformation).
[0132] According to a specific embodiment, the transformation
efficiency using embodiments of the invention is at least 90%
(e.g., in transient transformation).
[0133] According to a specific embodiment, the transformation
efficiency using embodiments of the invention is at least 1% (e.g.,
in stable transformation).
[0134] According to a specific embodiment, the transformation
efficiency using embodiments of the invention is at least 2% (e.g.,
in stable transformation).
[0135] According to a specific embodiment, the transformation
efficiency using embodiments of the invention is at least 3% (e.g.,
in stable transformation).
[0136] According to a specific embodiment, the transformation
efficiency using embodiments of the invention is at least 5% (e.g.,
in stable transformation).
[0137] A common mode of plant regeneration both in planta and
in-vitro is de novo organogenesis, in which plant cuttings or
explants first form ectopic apical meristems and subsequently
develop shoots and roots. Meristems are specialized plant tissues
where new cells, tissues and organs are generated through cell
division and differentiation. Plants can also regenerate through
somatic embryogenesis in-vitro, whereby isolated protoplasts or
cells first develop cellular structures similar to zygotic embryos
and subsequently generate whole plant bodies, as contemplated
herein and further described hereinbelow. Both of these
regeneration processes occur either directly from parental tissues
(e.g., leaves, stems, roots) or indirectly via the formation of a
callus.
[0138] An in-vitro regeneration protocol may first be preceded by a
step of clonal propagation for large scale, reproducible, uniform
(.+-.10%) production of plant material/explant.
[0139] As used herein a "regenerable explant" refers to regenerable
cells (cannabis cells) for use in tissue culture for transforming
and regenerating Cannabis. A tissue culture which includes
regenerable cells is capable of regenerating plants having the
physiological and morphological characteristics of Cannabis
(transformed or no-transformed).
[0140] According to a specific embodiment "transformed" refers to
transgenic.
[0141] According to another embodiment, "transformed" refers to
non-transgenic, such as by means of genome-editing.
[0142] The regenerable cells in such tissue cultures can be from
embryos, protoplasts, meristematic cells, callus, pollen, leaves,
anthers, pistils, roots, root tips, flowers, seeds, pods, bolls,
buds, stems, or the like.
[0143] According to a specific embodiment, the regenerable cells
are suitable for applying a regeneration protocol.
[0144] The present inventors have realized through a series of
laborious experiments, that the key factor for successful in-vitro
propagation (as determined by time dependent biomass accumulation)
is an initial growth on a solid medium, transfer to a liquid medium
and transfer back to a solid medium, so as to allow the explants to
exploit the substances in the media. This, combined with a
treatment with a cell wall disrupting agent is pertinent to the
success of clonal propagation.
[0145] Thus, according to an aspect of the invention there is
provided a method of in-vitro propagating cannabis, the method
comprising:
(a) culturing a cannabis plant part comprising a meristem on a
solid culture medium so as to obtain an explant; and subsequently
(b) subjecting the explant to a cell wall disrupting agent; (c)
culturing the explant in a liquid medium; and optionally wherein
steps (a)-(c) are effected for 1 to n times until emergence of
leaves suitable for regeneration.
[0146] As used herein "in-vitro propagation" or "plant
micropropagation" refers to an integrated process in which cells,
tissues or organs of a selected plant are isolated, surface
sterilized, and incubated in a growth-promoting aseptic environment
to produce many clone plantlets (Altman, 2000, Spier, R. E.
Encyclopedia of Cell Technology. New York: John Wiley &. Sons,
916-929).
[0147] Thus, somatic cells, under appropriate conditions, can
differentiate to a whole plant.
[0148] According to a specific embodiment, the process of clonal
propagation is done under aseptic conditions.
[0149] According to a specific embodiment, the plant part taken to
the tissue culture is sterilized prior to initiation of
culturing.
[0150] For instance, the plant part is washed under abundant water
flow (e.g., for 2 hours) followed by alcohol treatment (e.g., 70%
ethanol) and optionally NaClO (e.g., 1.5%) that may be repeated as
needed.
[0151] Thus, a cannabis plant part comprising a meristem is
cultured on a solid culture medium so as to obtain an explant.
[0152] As used herein "meristem" refers to a plant tissue
containing undifferentiated cells (meristematic cells), found in
zones of the plant where growth can take place. Meristematic cells
give rise to various organs of the plant and keep the plant
growing. There are three types of meristematic tissues: apical (at
the tips), intercalary (in the middle) and lateral (axial, at the
sides).
[0153] According to a specific embodiment, the meristem is an
apical or an axillary meristem.
[0154] According to a specific embodiment, the plant part is of a
stem, e.g., shoot tips or axillary buds.
[0155] According to a specific embodiment, the plant part comprises
both apical and axillary meristems.
[0156] According to a specific embodiment, the plant part comprises
a root meristem.
[0157] According to a specific embodiment, the plant part comprises
a root tip.
[0158] A plant part and a tissue may be interchangeable herein.
[0159] Such a tissue can be taken from a mature plant or a seedling
e.g., having two true leaves that are then cut from the roots (a
seedling may be more responsive than a mature plant) due to
different levels of plant hormones present in the plants. The
present inventors were able to show clonal propagation for both
options (see Example 1).
[0160] According to a specific embodiment, the plant part comprises
a nodal segment.
[0161] Typically, the medium used for clonal propagation (or
regeneration or transformation) is a basal medium like white
medium, Nitsch and Nitsch medium, B5 medium and Gamborf medium.
[0162] According to a specific embodiment, the medium is Murashige
and Skoog (1962) (MS medium).
[0163] The strength of the medium or combination of media can be
optimized for the protocol (e.g., propagation, regeneration or
transformation).
[0164] According to a specific embodiment, the medium is 1/2 MS
medium supplemented with sucrose at a pH of 6.8.
[0165] According to a specific embodiment, the carbon source is at
a concentration of 1-4%.
[0166] According to a specific embodiment, the pH is 5.4-7.2.
[0167] Measures should be taken to supplement the medium with an
appropriate mineral nutrition and carbon source (e.g., sucrose,
glucose, maltose and galactose as well as the sugar-alcohols
glycerol and sorbitol). The carbohydrates added to the culture
medium supply energy for the metabolism. The addition of a carbon
source in any nutrition medium is essential for in-vitro growth and
development because photosynthesis in culture is typically
insufficient.
[0168] Culture media can be classified as liquid or solid. The
liquid media have the advantage of faster and cheaper propagation
than the solid ones. However, a serious disadvantage of using
liquid in for clonal propagation is that shoot (stems), which are
perpetually submerged in liquid cultures may become hyperhydric and
hence cannot undergo clonal propagation.
[0169] According to a specific embodiment, the medium is 1/2 MS
medium supplemented with sucrose and hormone combinations.
[0170] The present inventors have found that for successful clonal
propagation the explants require a first culturing period on a
solid phase followed by liquid culturing and return to the solid
phase.
[0171] Thus, a first stage of solid medium culturing is effected
for 7-30 days (e.g., 21 days) or as long as the explant benefits
from the solid culture and can absorb the nutrients/carbon source
from the medium. The gelling agent that may be used to solidify the
culture may change. Typically used are Agar and Gelrite. As the
concentration of the gelling agent e.g., Agar may affect the
development (e.g., root) the concentration is up to 1% e.g., Agar
is 0.7%-1.0% w/w (e.g., 0.8%).
[0172] In order to improve the absorption of carbon source,
minerals or other factors (e.g., regeneration agents,
transformation agents etc. as further described hereinbelow), the
explants may be treated with a cell wall disrupting agent. This can
be performed at any step of the culturing e.g., during culturing on
the solid phase and/or at the liquid phase.
[0173] According to a specific embodiment, the cell wall disrupting
agent is present only at the liquid culture phase (i.e., absent
from the solid medium).
[0174] As used herein "a cell wall disrupting agent" refers to a
chemical, biological or physical treatment of the explant that
results in damage to the cell wall but not affecting cell viability
either due to degradation, hydrolysis of the polymers e.g.,
polyesters of the cuticle and/or suberin layers or mechanical
breakdown of the cell wall.
[0175] Examples of such enzymes can be found in The Journal of
Experimental Botany, Vol. 64, No. 12, pp. 3519-3550, 2013
doi:10.1093/jxb/ert201; Darwin Review Biochemistry and
physiological roles of enzymes that `cut and paste` plant cell-wall
polysaccharides; and Catalysts of plant cell wall loosening,
[Daniel J. Cosgrove 2016, which describe enzymes and other proteins
e.g., expansions, that can be used in cell wall disruption.
[0176] These include, but are not limited expansions,
endoglucanases, endotransglucosylases as well as, cutinase, pectin
methyesterases and pectin modifying enzymes. From the whole range
of CAZy groups, approximately 22 families are associated with
enzymes that postsynthetically modify the plant cell wall. Plant
glycosidases are mostly grouped in GH families 1, 2, 3, 27, 29, 31,
35, 36, 38, 51, and 95, while plant glycanases fall into GH
families 2, 5, 9, 10, 16, 17, 28, and 81.
[0177] The cell wall disrupting agent may therefore be present in
the liquid culture medium, the solid culture medium [towards the
end of culturing on a solid medium i.e., not from the initiation of
step (a)] or the explants may be taken out of the culture and
treated with the cell wall disrupting agent before transfer to the
liquid medium.
[0178] According to a specific embodiment, the treatment with the
cell wall disrupting agent is (e.g., only) at the liquid phase.
[0179] According to a specific embodiment, the biological treatment
comprises enzymes (e.g., "cuticle nicking enzymes").
[0180] Measures are taken to use the cell wall disrupting agent at
sub-lethal dose/concentration i.e., less than lethal, but
sufficiently high to disrupt the cell wall. Damage to the cell wall
can be determined using various means including visual detection
using a light microscope. Cell viability should be determined as
well (e.g., staining, FACS etc.).
[0181] According to a specific embodiment, the enzymes are a fungal
mix of pectin and cutinase enzymes.
[0182] As used herein, a cutinase (EC 3.1.1.74) is an enzyme that
catalyzes the chemical reaction cutin+H.sub.2O cutin monomers.
[0183] According to a specific embodiment, the enzyme is a pectic
enzyme e.g., pectin lyase (EC 4.2.2.10) which catalyzes the
eliminative cleavage of (1.fwdarw.4)-.alpha.-D-galacturonan methyl
ester to give oligosaccharides with
4-deoxy-6-O-methyl-.alpha.-D-galact-4-enuronosyl groups at their
non-reducing ends.
[0184] Enzymes are available from commercial vendors e.g., BSG
HandCraft Liquid Pectic Enzyme; Cutinase (Sigma, Ferdinand Maria
Quincy). It will be appreciated that a single cell wall disrupting
agent can be used, however combinations of 2, 3, 4, or more agents
can be used (of the same or different types i.e., biological,
chemical and physical).
[0185] According to a specific embodiment, the enzymes used include
a pectic enzyme and a cutinase. As shown in Examples 2, the
combination of the two enzymes increases explants growth rate in
culture.
[0186] Accordingly, cutinase is available as a fungal mix of pectin
and cutinase enzymes that is commercially available such as from
BSG HandCraft Liquid Pectic Enzyme; Cutinase--Sigma, Ferdinand
Maria Quincy.
[0187] At the liquid stage (which is a discrete stage from the
solid medium culturing stage) the same base medium, carbohydrates
and/or minerals can be used except that the polymerizing agent
(e.g., agar) is absent. However, different media and/or supplements
can be used as well.
[0188] Culturing in the liquid medium may be effected for
.kappa.-30 days (e.g., 21 days).
[0189] According to a specific embodiment, culturing is effected
while shaking the container in which the explant is placed (in the
liquid medium). There are numerous agitation methods including
orbital, horizontal orbital shaking with limited amount of
liquid.
[0190] Shaking prevents covering the whole explant with the medium
during culturing at the liquid phase.
[0191] At any stage from the initiation of culturing (a-c), leaves
(i.e., differentiated structures) and necrotic regions that can't
regenerate are removed.
[0192] Additional agents that can be included in the culture (be it
the solid phase, liquid phase, or all phases) include, but are not
limited to, plant hormones, enzymes, vitamins, carbohydrates and
minerals.
[0193] As mentioned, optionally, after culturing in the liquid
medium the explant is transferred to culturing under solid
conditions, for 20-45 days, and the whole process i.e., liquid,
solid may be repeated for n number of times (e.g., 2, 3, 4, 5 or
more times).
[0194] According to a specific embodiment, transfer from a solid to
a liquid medium is taking place every 3-4 weeks, which
significantly improves the growth and development.
[0195] Different strains may require different time periods for the
propagation, generally requiring between 50 to 100 days. Culturing
may be terminated once leaves suitable for regeneration emerge.
According to a specific embodiment, such leaves are up to 48 days
old (e.g., 21-48 days counting from transfer of the culture from
liquid to solid), having up to about 0.5 cm width of surface area
and optionally can be easily wounded such as with a scalpel or as
further described hereinbelow.
[0196] The ability to regenerate can be determined using methods
which are well known in the art e.g., rooting and
acclimatization.
[0197] Elongation and root induction or development (rooting
phase): This phase is designed to induce the establishment of fully
developed plantlets. It is the last period in-vitro before
transferring the plantlets to ex vitro conditions. Root induction
is typically effected on a root induction solid medium in the
presence of IBA and optionally other ingredients such as thiamine
and possibly myo-inositol and/or charcoal. Rooting is much affected
by the salt concentration in the medium. Also, the presence of
auxins (e.g., IBA, IAA, NAA) at this stage is important as opposed
to cytokinins. At rooting, it is important to balance the humidity
required for rooting and the plant sensitivity to humidity. Under
such considerations it is possible to lower the amount of the
gelling agent (e.g., agar), add desiccating agents (e.g., silicone
balls) and aerating the culture dishes. The use of gibberellins in
the rooting medium may reduce or prevent the formation of
adventitious roots and shoots, although it can stimulate root
formation when present in low concentrations.
[0198] Transfer to ex vitro condition is also termed as
"acclimatization". Acclimatization is defined as the climatic or
environmental adaptation of an organism, especially a plant that
has been moved to a new environment (Kozai and Zobayed, 2003
www(dot)doi(dot)org/10(dot)1002/0471250570(dot)spi001). Measures
are taken to protect the regenerated explants from dehydration,
which is typically done by graded lowering of the humidity by
stepwise transferring from a greenhouse or tunnel (e.g., covered
with a polyethylene sheet) to partial covering to no covering at
all.
[0199] An example of a rooting and acclimatization protocol is
provided in Example 1 which follows.
[0200] The results may be evaluated several weeks after assay
initiation (e.g., 3-5 weeks).
[0201] The skilled artisan would take into consideration other
parameters during culturing. These include, but are not limited to,
gas exchange and relative air humidity inside the culture
vessel.
[0202] The culture vessel is typically a closed system but some gas
exchange may occur dependent on the vessel. The use of closures
with filters or vented vessels which allow gas exchange may
increase the photosynthetic capacity, the multiplication rate and
the survival of plants at the acclimatization stage.
[0203] According to a specific embodiment, the relative humidity in
the culture (i.e., culture vessel) is 90%. The temperature and
light regimen employed for regeneration are known to the skilled
artisan and typically including long day (e.g., 16 h) at 24.degree.
C.
[0204] Also contemplated herein is a regenerable cannabis explant
obtainable according to the method described herein. It will be
appreciated that the process of clonal propagation does not form a
callus.
[0205] Once any regenerable cannabis explant is available (e.g.,
such as by the clonal propagation method described herein), it can
be subjected to regeneration.
[0206] Thus, according to an aspect of the invention there is
provided a method of cannabis regeneration in a tissue culture, the
method comprising culturing a regenerable cannabis explant in a
solid medium comprising at least one regeneration agent and a cell
wall disrupting agent so as to regenerate cannabis.
[0207] The regenerable cannabis explants can be a product of the
clonal propagation as described above. Also contemplated are
germinated seeds, including cotyledons, leaves hypocotyls;
alternatively, calli.
[0208] Regeneration protocols are known in the art.
[0209] Basically, in addition to a basal salt mixture the medium
comprises at least one auxin, at least one cytokinin and optionally
at least one gibberellin. Typically, the basal salt mixture used is
half strength MS (Murashige and Skoog) medium, the auxin is
indol-3-butyric acid (IBA), the cytokinin is 6-benzylaminopurine
(BA) the gibberellic acid is GA.sub.3. The medium typically further
comprises as a carbon source. The medium further comprises,
vitamins, myoinositol and thiamine-HCl and the pH of the medium is
kept in the range of from about 4.5 to about 6.5 (e.g.,
5.5-5.9).
[0210] The cultures are exposed to a cool fluorescent light in a
photoperiod of 16 h of light and 8 h dark, at 25.degree. C.
Typically, the light intensity is in the range of between 40-70
.mu.mol/m.sup.2s. Under these conditions (the propagation medium
and the light regime) elongation of the micropropagating shoots and
the formation of leaves from the shoot buds occur within about 2-4
weeks.
[0211] The medium for each strain can be further adjusted according
to the strain's needs such as with cytokinins (e.g., TDZ, ZEATIN,
NAA), activated charcoal, phloroglucinol, concentrations of
GA/auxion cytokinin etc.
[0212] According to a specific embodiment, the regeneration is
effected in line with the protocols listed in Example 2 of the
Examples section which follows.
[0213] Regeneration from leaves can be done from 3 to 4 weeks old
plants by placing the leaves on regeneration medium with the cell
wall disrupting agent, as described. The cultures are kept for a
number of days (e.g., 7 days) in low light intensity (e.g., 2.5
mmol/m2 s) followed by exposure to high light intensity (e.g., 40
mmol/m2 s) at room temperature (e.g., 25.degree. C.), in a 16/8 h
photoperiod. Leaf explants can be examined after 14 and 21 days and
the percentage of explant producing shoots is determined.
[0214] Regeneration from cotyledon can be done as follows: Seeds
are disinfected and put in a culture medium. Seeds are germinated
(e.g., in the dark for 2 d and thereafter transferred to light).
Cotyledons from large seedlings that contain two true leaves are
cut and placed on a regeneration medium with the cell wall
disrupting agent. The cultures are kept in high light intensity
(e.g., 40 mmol/m2 s) at room temperature (e.g., 25.degree. C.), in
a 16/8 h photoperiod.
[0215] Callus is induced such as by the following protocol. 21 days
old tissue culture is placed on a PR12 solid medium (MS, 2%
sucrose, 2 mg/l BA, 1 mg/l GA3, 0.8 sigma agar, pH 5.8) to
encourage the creation of callus. Two weeks later, calli are placed
on a regeneration medium with the cell wall disrupting agent [e.g.,
Murashige and Skoog (MS) medium salt mixture, containing 0.05-5.0
.mu.M thidiazuron, supplemented with 100 mg/l myo-inositol, 1 mg/l
thiamine-HCl, 2% sucrose (w/v) at pH 5.7, with 5 ml pectic enzymes
reaction mixture (0.25 ml 10% enzyme, 0.25 ml 200 mM Tris-HCl)].
The cultures are kept in high light intensity (40 mmol/m2 s) at 25
8 C, in a 16/8 h photoperiod.
[0216] The regeneration can be prior to, concomitantly with, or
following DNA transformation.
[0217] Thus, according to an aspect there is provided a method of
in-vitro cannabis transformation, the method comprising, contacting
a regenerable cannabis explant with a polynucleotide encoding an
expression product of interest and a cell wall disrupting
agent.
[0218] Thus, for regeneration and transformation the use of a cell
wall disrupting agent as described above is contemplated.
[0219] It will be appreciated that additional wounding the explant
(e.g., leaves) may improve the efficiency when done prior to the
contacting with the polynucleotide.
[0220] Wounding induces numerous cellular responses including the
production of plant hormones, loss of cell to cell communication
and disruption of long distance signaling. It is suggested that the
AP2/ERF-type transcriptional regulator WIND1 and its homolog WIND2,
WIND3 or AIND4 are induced upon wounding and promote callus
formation at cut sites.
[0221] Wounding can be effected physically e.g., by the use of a
scalpel or a sandpaper, which scratches the plant surface.
[0222] As mentioned, the transformation introduces a polynucleotide
encoding an expression product of interest.
[0223] As used herein "expression product" refers to an RNA or
protein (also referred to herein as "polypeptide").
[0224] According to a specific embodiment, the expression product
is a protein.
[0225] According to a specific embodiment, the expression product
brings about overexpression of an endogenous gene or homolog
thereof or of a foreign gene expression product altogether. In
embodiments of such cases, the expression product is heterologous
to the plant/tissue being transformed.
[0226] It will be appreciated that the heterologous expression
product can bring about down regulation of an endogenous gene such
as by way of genome editing or RNA silencing.
[0227] The term "heterologous" as used herein refers to exogenous,
not-naturally occurring within a native cell of a cannabis plant of
a specific developmental stage, or not expressed in a plant, not
expressed in a particular plant species, or is expressed at a
different expression level or localization in the plant, than the
native protein.
[0228] However, using genome editing for instance can also effect
overexpression of an endogenous gene (e.g., by way of a "gain of
function").
[0229] Genome editing as contemplates herein also mediates loss of
function.
[0230] As used herein, the term "polypeptide" is used
interchangeably with the terms "peptides", "oligopeptides" and
"proteins" and refers to a biomolecule composed of amino acids of
any length, linked together by peptide bonds.
[0231] The polypeptide of interest can be, for example, a plant
polypeptide, a bacterial polypeptide, a viral polypeptide a
mammalian polypeptide or a synthetic polypeptide (e.g., chimeric
nuclease, nuclease e.g. cas9). Thus, the heterologous polypeptide
of interest may be a plant polypeptide or protein that is a variant
or mutated form of a plant polypeptide or protein or a polypeptide
or protein not naturally found in the plant species, line or
variety.
[0232] As used herein the term "polynucleotide" refers to a single
or double stranded nucleic acid sequence which is isolated and
provided in the form of an RNA sequence, a complementary
polynucleotide sequence (cDNA), a genomic polynucleotide sequence
and/or a composite polynucleotide sequences (e.g., a combination of
the above).
[0233] The term "isolated" refers to at least partially separated
from the natural environment.
[0234] According to one embodiment, the heterologous polypeptide of
interest may include, but is not limited to, a reporter
polypeptide, an antiviral polypeptide, a viral moiety, an antiviral
polypeptide, an antifungal polypeptide, an antibacterial
polypeptide, an insect resistance polypeptide, a herbicide
resistance polypeptide, a biotic or abiotic stress tolerance
polypeptide, a pharmaceutical polypeptide, a growth inducing
polypeptide, a growth inhibiting polypeptide, an enzyme, a
transcription factor and a transposase.
[0235] Exemplary proteins which may be produced, include, but are
not limited to: nucleases, kinases, proteases, enzymes, hormones,
proteins that provide resistance to diseases, antimicrobial
proteins, antiviral proteins, and proteinaceous DNA editing
agents.
[0236] According to one embodiment, the heterologous polypeptide of
interest comprises two or more (e.g., 2, 3, 4) heterologous
polypeptides.
[0237] According to one embodiment, the heterologous polypeptide of
interest enables modifying the plant genome, e.g., nuclease.
[0238] As used herein the term "nuclease" refers to any
polypeptide, or complex comprising a polypeptide, that can generate
a strand break in the genome, e.g. in genomic DNA. According to an
embodiment, the cleavage is site specific usually conferred by an
auxiliary subunit, alternatively the nuclease is inherently
specific to a target sequence of interest.
[0239] As used herein, the term "cleavage" or "DNA cleavage" refers
to the breakage of the covalent backbone of a DNA molecule. Both
single-stranded cleavage and double-stranded cleavage are possible,
and double-stranded cleavage can occur as a result of two distinct
single-stranded cleavage events. DNA cleavage can result in the
production of either blunt ends or staggered ends.
[0240] Exemplary nucleases which may be used in accordance with the
present teachings include restriction enzymes (e.g. type II
restriction endonuclease), topoisomerases [e.g. DNA gyrase,
eukaryotic topoisomerase II (topo II), and bacterial topoisomerase
IV (topo IV)], recombinases (e.g. Cre recombinase, Hin
recombinase), integrases, DNAses, endo-exonucleases (e.g.
micrococcal nuclease) and homing endonucleases.
[0241] According to one embodiment, the nuclease utilized may
comprise a non-specific DNA cleavage domain, for example, a type II
restriction endonuclease such as the cleavage domain of the FokI
restriction enzyme (GenBank accession number J04623).
[0242] According to one embodiment, the nuclease is a
meganuclease.
[0243] As used herein, the term "meganuclease" refers to a
double-stranded endonuclease having a large polynucleotide
recognition site, e.g. DNA sequences of at least 12 base pairs (bp)
or from 12 bp to 40 bp. The meganuclease may also be referred to as
rare-cutting or very rare-cutting endonuclease. The meganuclease of
the invention may be monomeric or dimeric. The meganuclease may
include any natural meganuclease such as a homing endonuclease, but
may also include any artificial or man-made meganuclease endowed
with high specificity, either derived from homing endonucleases of
group I introns and inteins, or other proteins such as zinc finger
proteins or group II intron proteins, or compounds such as nucleic
acid fused with chemical compounds.
[0244] Artificial meganucleases of the invention include, but are
not limited to, custom-made meganucleases which are meganucleases
derived from any initial meganuclease, either natural or not,
presenting a recognition and cleavage site different from the site
of the initial meganuclease, i.e. the custom-made meganuclease
cleaves a novel site with an efficacy at least 10 fold, at least 50
fold or at least 100 fold more than the natural meganuclease.
[0245] Custom-made meganucleases may be produced by any method
known in the art, for example, by preparing a library of
meganuclease variants and isolating, by selection and/or screening,
the variants able to cleave the targeted DNA sequence. The
diversity could be introduced in the meganuclease by any method
known to one skilled in the art, for example, the diversity may be
introduced by targeted mutagenesis (i.e. cassette mutagenesis,
oligonucleotide directed codon mutagenesis, targeted random
mutagenesis), by random mutagenesis (i.e. mutator strains,
Neurospora crassa system (U.S. Pat. No. 6,232,112; WO 01/70946,
error-prone PCR), by DNA shuffling, by directed mutation or a
combination of these technologies (See Current Protocols in
Molecular Biology, Chapter 8 "Mutagenesis in cloned DNA", Eds
Ausubel et al., John Wiley and Sons). The diversity may be
introduced at positions of the residues contacting the DNA target
or interacting (directly or indirectly) with the DNA target, or may
be introduced specifically at the positions of the interacting
amino acids. In libraries generated by targeted mutagenesis, the 20
amino acids can be introduced at the chosen variable positions.
According to an embodiment, the amino acids present at the variable
positions are the amino acids well-known to be generally involved
in protein-DNA interaction. More particularly, these amino acids
are generally the hydrophilic amino acids, e.g. comprise D, E, H,
K, N, Q, R, S, T, Y. Synthetic or modified amino acids may also be
used.
[0246] The custom-made meganuclease may be derived from any initial
meganuclease.
[0247] According to one embodiment, the initial meganuclease is
selected so as its natural recognition and cleavage site is the
closest to the targeted DNA site. According to an embodiment, the
initial meganuclease is a homing endonuclease. Homing endonucleases
fall into 4 separated families on the basis of well conserved amino
acids motifs, namely the LAGLIDADG family, the GIY-YIG family, the
His-Cys box family, and the HNH family (Chevalier et al., 2001,
N.A.R, 29, 3757-3774). According to one embodiment, the homing
endonuclease is a I-Dmo I, PI-Sce I, I-SceI, PI-Pfu I, I-Cre I,
I-Ppo I, or a hybrid homing endonuclease I-Dmo I/I-Cre I called
E-Dre I (as taught in Chevalier et al., 2001, Nat Struct Biol, 8,
312-316).
[0248] Further details relating to meganucleases are found in U.S.
Pat. No. 8,697,395 which is incorporated herein by reference.
[0249] According to another embodiment, of the present invention,
the nuclease comprises an oligonucleotide-dependent nuclease such
as Cas or a RISC.
[0250] RISC enzymes are taught in Martinez J, Tuschl T. RISC is a
5' phosphomonoester-producing RNA endonuclease. Genes Dev. 2004;
18:975-980. Also contemplated are sequence modifications to improve
plant expression i.e., homologs that are at least 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%. Homology and identity are also
contemplated herein (e.g., using Blast(N)/(P) with default
parameters).
[0251] According to one embodiment, the Cas9 or RISC is attached to
a single guide RNA (sgRNA) to cleave genomic DNA in a sequence
specific manner, hence the polynucleotide may encode the RNA
targeting moiety such as a gRNA.
[0252] As used herein "a single guide RNA" or "sgRNA" refers to a
chimeric RNA molecule which is composed of a clustered regularly
interspersed short palindromic repeats (CRISPR) RNA (crRNA) and
trans-encoded CRISPR RNA (tracrRNA). The crRNA defines a
site-specific targeting of the Cas9 protein. The sequence is 19-22
nucleotides long e.g., 20 consecutive nucleotides complementary to
the target and is typically located at the 5' end of the sgRNA
molecule. The crRNA may have 100% complementation with the target
sequence although at least 80%, 85%, 90%, and 95% global homology
to the target sequence are also contemplated according to the
present teachings.
[0253] The tracrRNA is 100-300 nucleotides long and provides a
binding site for the nuclease e.g., Cas9 protein forming the
CRISPR/Cas9 complex.
[0254] According to a specific embodiment a plurality of sgRNAs are
provided to the plant cell that are complementary to different
target nucleic acid sequences and the nuclease e.g., Cas9 enzyme
cleaves the different target nucleic acid sequences in a site
specific manner.
[0255] It will be appreciated that the sgRNA may be encoded from
the same expression vector as the nuclease, e.g. Cas9. Additionally
or alternatively, the sgRNA may be encoded from another nucleic
acid construct and thus the CRISPR-Cas9 complex is encoded from a
nucleic acid construct system.
[0256] According to another embodiment, sgRNA is encoded from the
plant expression vector of the invention. In such a case the
nuclease, e.g. Cas9, may be encoded from another nucleic acid
construct and thus the CRISPR-Cas9 complex is encoded from a
nucleic acid construct system.
[0257] Likewise, the plurality of sgRNAs may be encoded from a
single vector or from a plurality of vectors as described herein.
The use of a plurality of sgRNAs allows multiplexing.
[0258] Thus, the RNA-guided endonuclease of the invention comprises
at least one nuclease (e.g. Cas9 or RISC) and at least one RNA
binding domain (e.g. CRISPR). CRISPR/Cas proteins of the invention
may comprise a nuclease domain, DNA binding domain, helicase
domain, RNAse domain, protein-protein interaction domain and/or a
dimerization domain.
[0259] According to one embodiment, the CRISPR/Cas protein can be a
wild type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a
fragment of a wild type or modified CRISPR/Cas protein.
Furthermore, the CRISPR/Cas protein can be modified to increase
nucleic acid binding affinity and/or specificity, or to alter an
enzymatic activity of the protein. For example, nuclease (i.e.,
Cas9) domains of the CRISPR/Cas protein can be modified.
[0260] Non-limiting examples of suitable Cas proteins which may be
used in accordance with the present teachings include Cas3, Cas4,
Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2,
Cas8b, Cas8c, Cas9, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2,
Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or
CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1,
Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10,
Csx16, CsaX, Csx3, Cszl, Csx15, Csf1, Csf2, Csf3, Csf4, and
Cu1966.
[0261] According to a specific embodiment, the cas nuclease is
Cas9. Cas9 is a monomeric DNA nuclease guided to a DNA target
sequence adjacent to the protospacer adjacent motif (PAM). The Cas9
protein comprises two nuclease domains homologous to RuvC and HNH
nucleases. The HNH nuclease domain cleaves the complementary DNA
strand whereas the RuvC-like domain cleaves the non-complementary
strand and, as a result, a blunt cut is introduced in the target
DNA.
[0262] In some embodiments, the CRISPR/Cas system comprises a wild
type Cas9 protein or fragment thereof.
[0263] In other embodiments, the CRISPR/Cas system comprises a
modified Cas9 protein. For example, the amino acid sequence of the
Cas9 protein may be modified to alter one or more properties (e.g.,
nuclease activity, affinity, stability, etc.) of the protein.
Alternatively, domains of the Cas9 protein not involved in
RNA-guided cleavage can be eliminated from the protein such that
the modified Cas9 protein is smaller than the wild type Cas9
protein.
[0264] According to one embodiment, the Cas9 protein can be
modified to lack at least one functional nuclease domain. According
to one embodiment, the Cas9 protein can be modified to lack all
nuclease activity. According to another embodiment, the CRISPR/Cas
system is fused with various effector domains, such as DNA cleavage
domains. The DNA cleavage domain can be obtained from any
endonuclease or exonuclease. Non-limiting examples of endonucleases
from which a DNA cleavage domain can be derived include, but are
not limited to, restriction endonucleases and homing endonucleases
(see, for example, New England Biolabs Catalog or Belfort et al.
(1997) Nucleic Acids Res.). In exemplary embodiments, the cleavage
domain of the CRISPR/Cas system is a FokI endonuclease domain or a
modified FokI endonuclease domain.
[0265] Various methods for designing CRISPR/Cas are known in the
art and may be implemented in accordance with the present
teachings. Further details relating to CRISPR/Cas can be found in
PCT publication no. WO 2014089290 which is incorporated herein by
reference in its entirety. According to another embodiment of the
present invention, the nuclease comprises a chimeric nuclease.
[0266] As used herein the phrase "chimeric nuclease" refers to a
synthetic chimeric polypeptide which forms a single open reading
frame (ORF) and mediates DNA cleavage in a sequence specific
manner.
[0267] According to a specific embodiment, the chimeric nucleases
of this aspect of the present invention comprise separate domains
for nucleic acid binding (e.g. DNA binding) and for nucleic acid
cleavage (e.g. DNA cleavage), such that cleavage is sequence
specific.
[0268] As used herein the phrase "sequence specific" refers to a
distinct chromosomal location at which nucleic acid cleavage (e.g.
DNA cleavage) is introduced.
[0269] As used herein the phrase "nucleic acid binding domain"
refers to a native or synthetic amino acid sequence such as of a
protein motif that binds to double- or single-stranded DNA or RNA
in a sequence-specific manner (i.e. target site).
[0270] In order to induce efficient gene targeting, the nucleic
acid (e.g. DNA) binding domain of the present invention needs to be
coupled to a DNA cleavage domain (e.g. nuclease) as to permit DNA
cleavage within a workable proximity of the target sequence. A
workable proximity is any distance that still facilitates the
sequence targeting. Optionally, the DNA binding domain overlaps the
target sequence or may bind within the target sequence.
[0271] According to one embodiment, the chimeric nuclease induces a
single stranded or a double stranded cleavage in the target
site.
[0272] In generating chimeric nucleases any DNA or RNA binding
domain that recognizes the desired target sequence (e.g. DNA
binding sequence) with sufficient specificity may be employed. A
variety of such DNA and RNA binding domains are known in the
art.
[0273] Examples of DNA binding domains include, but are not limited
to, a meganuclease binding domain, a helix-turn-helix (pfam 01381)
binding domain, a leucine zipper (ZIP) binding domain, a winged
helix (WH) binding domain, a winged helix turn helix domain (wHTH)
binding domain, a helix-loop-helix binding domain, a transcription
activator-like (TAL) binding domain, a recombinase, and a zinc
finger binding domain.
[0274] In an exemplary embodiment of the present invention, the DNA
binding domain is a zinc finger binding domain.
[0275] Thus, according to an embodiment of this aspect, the
chimeric nuclease is a chimeric protein comprising a specific zinc
finger binding domain (e.g., pfam00096) and the DNA cleavage
domain, such as that of the FokI restriction enzyme (also referred
to herein as the FokI cleavage domain), termed herein zinc finger
nuclease (ZFN).
[0276] The zinc finger domain is 30 amino acids long and consists
of a recognition helix and a 2-strand beta-sheet. The domain also
contains four regularly spaced ligands for Zinc (either histidines
or cysteines). The Zn ion stabilizes the 3D structure of the
domain. Each finger contains one Zn ion and recognizes a specific
triplet of DNA basepairs.
[0277] Zinc finger domains can be engineered to bind to a
predetermined nucleotide sequence. Each individual zinc finger
(e.g. Cys2/His2) contacts primarily three consecutive base pairs of
DNA in a modular fashion [Pavletich et al., Science (1991)
252:809-817; Berg et al., Science (1996) 271:1081-1085]. By
manipulating the number of zinc fingers and the nature of critical
amino acid residues that contact DNA directly, DNA binding domains
with novel specificities can be evolved and selected [see, e.g.,
Desjarlais et al., Proc. Natl. Acad. Sci. USA (1992) 89:7345-7349;
Rebar et al., Science (1994) 263:671-673; Greisman et al., Science
(1997) 275:657-661; Segal et al., Proc. Natl. Acad. Sci. USA (1999)
96:2758-2763]. Hence, a very wide range of DNA sequences can serve
as specific recognition targets for zinc finger proteins. Chimeric
nucleases with several different specificities based on zinc finger
recognition have been previously disclosed [see for example, Huang
et al., J. Protein Chem. (1996) 15:481-489; Kim et al., Biol. Chem.
(1998) 379:489-495].
[0278] Various methods for designing chimeric nucleases with zinc
finger binding domains are known in the art.
[0279] In one embodiment the DNA binding domain comprises at least
one, at least two, at least 3, at least 4, at least 5 at least 6
zinc finger domains, binding a 3, 6, 9, 12, 15, or 18 nucleotide
sequence, respectively. It will be appreciated by the skilled
artisan that the longer the recognition sequence is, the higher the
specificity that will be obtained.
[0280] Specific DNA binding zinc fingers can be selected by using
polypeptide display libraries. The target site is used with the
polypeptide display library in an affinity selection step to select
variant zinc fingers that bind to the target site. Typically,
constant zinc fingers and zinc fingers to be randomized are made
from any suitable C2H2 zinc fingers protein, such as SP-1, SP-1C,
TFIIIA, GLI, Tramtrack, YY1, or ZIF268 [see, e.g., Jacobs, EMBO J.
11:4507 (1992); Desjarlais & Berg, Proc. Natl. Acad. Sci.
U.S.A. 90:2256-2260 (1993)]. The polypeptide display library
encoding variants of a zinc finger protein comprising the
randomized zinc finger, one or more variants of which will be
selected, and, depending on the selection step, one or two constant
zinc fingers, is constructed according to the methods known to
those in the art. Optionally, the library contains restriction
sites designed for ease of removing constant zinc fingers, and for
adding in randomized zinc fingers. Zinc fingers are randomized,
e.g., by using degenerate oligonucleotides, mutagenic cassettes, or
error prone PCR. See, for example, U.S. Pat. Nos. 6,326,166,
6,410,248, and 6,479,626.
[0281] Zinc fingers can also be selected by design. A designed zinc
finger protein is a protein not occurring in nature whose
design/composition results principally from rational criteria.
Rational criteria for design include application of substitution
rules and computerized algorithms for processing information in a
database storing information of existing ZFP designs and binding
data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; and
6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO
02/016536 and WO 03/016496.
[0282] According to another embodiment, the chimeric nuclease is a
TALENs or a compact-TALENs (cTALENs).
[0283] As used herein, the term "TALENs" or "Transcription
Activator-Like Effector Nucleases" refers to the artificial
restriction enzymes generated by fusing the TAL effector DNA
binding domain to a DNA cleavage domain. TALENs of the invention
enable efficient, programmable, and specific DNA cleavage.
[0284] It will be appreciated that Transcription activator-like
effectors (TALEs) can be quickly engineered to bind practically any
DNA sequence. The term TALEN, as used herein, is broad and includes
a monomeric TALEN that can cleave double stranded DNA without
assistance from another TALEN. The term TALEN is also used to refer
to one or both members of a pair of TALENs that are engineered to
work together to cleave DNA at the same site. TALENs that work
together may be referred to as a left-TALEN and a right-TALEN.
Further details relating to TALENS can be found in U.S. Pat. Nos.
8,450,471; 8,440,431; 8,440,432; and U.S. Pat. Applic. No.
20140256798 all of which are incorporated herein by reference in
their entirety.
[0285] TALEs are proteins secreted by Xanthomonas bacteria. The DNA
binding domain of TALEs contains a highly conserved 33-34 amino
acid sequence with the exception of the 12th and 13th amino acids.
These two locations are highly variable [Repeat Variable Diresidue
(RVD)] and show a strong correlation with specific nucleotide
recognition. This simple relationship between amino acid sequence
and DNA recognition has allowed for the engineering of specific DNA
binding domains by selecting a combination of repeat segments
containing the appropriate RVDs.
[0286] TALENs of the invention are typically constructed using a
non-specific DNA cleavage domain, such as the non-specific DNA
cleavage domain of FokI endonuclease. Thus, wild-type FokI cleavage
domain may be used as well as FokI cleavage domain variants with
mutations designed to improve cleavage specificity and cleavage
activity. The FokI domain functions as a dimer, requiring two
constructs with unique DNA binding domains for sites in the target
genome with proper orientation and spacing. Both the number of
amino acid residues between the TALEN DNA binding domain and the
DNA cleavage domain (e.g. FokI cleavage domain) and the number of
bases between the two individual TALEN binding sites are parameters
for achieving high levels of activity. The number of amino acid
residues between the TALEN DNA binding domain and the DNA cleavage
domain (e.g. FokI cleavage domain) may be modified by introduction
of a spacer between the plurality of TAL effector repeat sequences
and the nuclease (e.g. FokI endonuclease domain). The spacer
sequence may be 12 to 30 nucleotides.
[0287] Furthermore, compact TALENs (cTALENs) may be used according
to the present teachings. These cTALENs are typically designed with
the partially specific I-TevI catalytic domain and are monomeric
DNA-cleaving enzymes, i.e. TALENs which are half-size,
single-polypeptide compact transcription activator-like effector
nucleases (see Beurdeley M. et al., Nature Communications (2013) 4:
1762, which is incorporated herein by reference in its
entirety).
[0288] The relationship between amino acid sequence and DNA
recognition of the TALEN binding domain allows for designable
proteins. In this case software programs (e.g. DNAWorks) may be
used which calculate oligonucleotides suitable for assembly in a
two step PCR; oligonucleotide assembly followed by whole gene
amplification. Modular assembly schemes for generating engineered
TALE constructs may also be used. Both methods offer a systematic
approach to engineering DNA binding domains that are conceptually
similar to the modular assembly method for generating zinc finger
DNA recognition domains (described hereinabove).
[0289] Qualifying the nucleases (e.g. ZFN, TALENs and CRISPR/Cas)
and meganucleases thus generated for specific target recognition
can be effected using methods which are well known in the art.
[0290] A method for designing the nucleases (e.g. chimeric
nucleases, ZFN, TALENs, Cas9, RISC, meganucleases) for use in gene
targeting may include a process for testing the toxicity of the
nuclease on a cell. Such a process may comprise expressing in the
cell, or otherwise introducing into a cell, the nuclease and
assessing cell growth or death rates by comparison against a
control. The tendency of a nuclease to cleave at more than one
position in the genome may be evaluated by in-vitro cleavage
assays, followed by electrophoresis (e.g. pulsed field
electrophoresis may be used to resolve very large fragments) and,
optionally, probing or Southern blotting. In view of the present
disclosure, one of ordinary skill in the art may devise other tests
for cleavage specificity.
[0291] The heterologous polypeptide of interest (e.g. nuclease)
disclosed herein may further comprise at least one nuclear
localization signal (NLS) which facilitates the transport of the
nuclease to the DNA-containing organelle. In general, an NLS
comprises a stretch of basic amino acids which is recognized by
specific receptors at the nuclear pores. The NLS can be located at
the N-terminus, the C-terminal, or in an internal location of the
nuclease.
[0292] Essentially any NLS may be employed, whether synthetic or a
naturally occurring NLS, as long as the NLS is one that is
compatible with the target cell (i.e. plant cell).
[0293] Although nuclear localization signals are discussed
herewith, the present teachings are not meant to be restricted to
these localization signals, as any signal directed to a
DNA-containing organelle is envisaged by the present teachings.
Such signals are well known in the art and can be easily retrieved
by the skilled artisan.
[0294] Nuclear localization signals which may be used according to
the present teachings include, but are not limited to, SV40 large T
antigen NLS, acidic M9 domain of hnRNP A1, the sequence KIPIK in
yeast transcription repressor Mata2 and the complex signals of U
snRNPs, tobacco NLS and rice NLS.
[0295] In other exemplary embodiments, the localization signal for
a DNA containing organelle can be a mitochondrial localization
signal (MLS) or a chloroplast localization signal (CLS).
[0296] Mitochondrion localization signals (MLS) which may be used
according to the present teachings include, but are not limited to
the transition signals of, Beta ATPase subunit [cDNAs encoding the
mitochondrial pre-sequences from Nicotiana plumbaginifolia
.beta.-ATPase (nucleotides 387-666)], Mitochondrial chaperonin
CPN-60 [cDNAs encoding the mitochondrial pre-sequences from
Arabidopsis thaliana CPN-60 (nucleotides 74-186] and COX4 [the
first 25 codons of Saccharomyces cerevisiae COX4 which encodes the
mitochondrial targeting sequence].
[0297] Chloroplast localization signals which may be used according
to the present teachings include, but are not limited to the
transition signals of the ribulose-1,5-bisphosphate carboxylase
(Rubisco) small subunit (ats1A) associated transit peptide, the
transition signal of LHC II, as well as the N-terminal regions of
A. thaliana SIG2 and SIG3 ORFs.
[0298] See also
www(dot)springerlink(dot)com/content/p65013h263617795/.
[0299] Alternatively, the chloroplast localization sequence (CLS)
may be derived from a viroid [Evans and Pradhan (2004) US
2004/0142476 A1]. The viroid may be an Avsunviroidae viroid, for
example, an Avocado Sunblotch Viroid (ASBVd), a Peach Latent Mosaic
Virus (PLMVd), a Chrysanthemum Chlorotic Mottle Viroid (CChMVd) or
an Eggplant Latent Viroid (ELVd).
[0300] According to a specific embodiment of the present invention,
the localization signal may comprise a chloroplast localization
signal.
[0301] In some embodiments, the heterologous polypeptide of
interest (e.g. nuclease) further comprises at least one
cell-penetrating domain. In one embodiment, the cell-penetrating
domain can be a cell-penetrating peptide (CPP) sequence derived
from Tat, Tat2, arginine-rich intracellular delivery peptides
(AID), pVEC, transportan and penetratin.
[0302] According to a specific embodiment of the present invention,
the CPP sequence comprises a dimmer of the Tat molecule (Tat2)
which has an increased ability to translocate across plant cell
membranes because of the presence of high number of arginine
residues.
[0303] Various cloning kits can be used according to the teachings
of some embodiments of the invention [e.g., GoldenGate assembly kit
by New England Biolabs (NEB)].
[0304] According to a specific embodiment, the nucleic acid
construct is a binary vector. Examples for binary vectors are
pBIN19, pBI101, pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen or
pPZP (Hajukiewicz, P. et al., Plant Mol. Biol. 25, 989 (1994), and
Hellens et al, Trends in Plant Science 5, 446 (2000)).
[0305] Examples of other vectors to be used in other methods of DNA
delivery (e.g. transfection, electroporation, bombardment, viral
inoculation) are: pGE-sgRNA (Zhang et al. Nat. Comms. 2016
7:12697), pJIT163-Ubi-Cas9 (Wang et al. Nat. Biotechnol 2004 32,
947-951), pICH47742::2.times.355-5'UTR-hCas9(STOP)-NOST (Belhan et
al. Plant Methods 2013 11; 9(1):39), pAHC25 (Christensen, A. H.
& P. H. Quail, 1996. Ubiquitin promoter-based vectors for
high-level expression of selectable and/or screenable marker genes
in monocotyledonous plants. Transgenic Research 5: 213-218),
pHBT-sGFP(S65T)-NOS (Sheen et al. Protein phosphatase activity is
required for light-inducible gene expression in maize, EMBO J. 12
(9), 3497-3505 (1993).
[0306] According to a specific embodiment, the vector is the binary
vector, pME 504.
[0307] According to a specific embodiment, the transformation
comprises a transient transformation.
[0308] According to a specific embodiment, the transformation
comprises a stable transformation.
[0309] Various methods are known for plant transformation. For
example, transient transformation can be done in the absence of a
selection marker for 3-14 days. Stable transformation will
typically require 4-10 weeks in the presence of a selection marker
(e.g., antibiotics). Further transformation protocols are described
hereinbelow.
[0310] The delivery of nucleic acids into a plant cell (contacted)
in embodiments of the invention can be done by any method known to
those of skill in the art, including, for example and without
limitation: by desiccation/inhibition-mediated DNA uptake (See,
e.g., Potrykus et al. (1985) Mol. Gen. Genet. 199:183-8); by
electroporation (See, e.g., U.S. Pat. No. 5,384,253); by agitation
with silicon carbide fibers (See, e.g., U.S. Pat. Nos. 5,302,523
and 5,464,765); by Agrobacterium-mediated transformation (See,
e.g., U.S. Pat. Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877,
5,981,840, and 6,384,301); by acceleration of DNA-coated particles
(See, e.g., U.S. Pat. Nos. 5,015,580, 5,550,318, 5,538,880,
6,160,208, 6,399,861, and 6,403,865) and by Nanoparticles,
nanocarriers and cell penetrating peptides (WO201126644A2;
WO2009046384A1; WO2008148223A1) in the methods to deliver DNA, RNA,
Peptides and/or proteins or combinations of nucleic acids and
peptides into plant cells.
[0311] Other methods of transfection include the use of
transfection reagents (e.g. Lipofectin, ThermoFisher), dendrimers
(Kukowska-Latallo, J. F. et al., 1996, Proc. Natl. Acad. Sci. USA
93, 4897-902), cell penetrating peptides (Mae et al., 2005,
Internalisation of cell-penetrating peptides into tobacco
protoplasts, Biochimica et Biophysica Acta 1669(2):101-7) or
polyamines (Zhang and Vinogradov, 2010, Short biodegradable
polyamines for gene delivery and transfection of brain capillary
endothelial cells, J Control Release, 143(3):359-366).
[0312] According to a specific embodiment, the introduction of DNA
into plant cells is effected by electroporation.
[0313] According to a specific embodiment, the introduction of DNA
into plant cells is effected by bombardment/biolistics.
[0314] According to a specific embodiment, the introduction of DNA
into plant cells is effected by Agrobacterium mediated
transformation.
[0315] Viruses that have been shown to be useful for the
transformation of plant hosts include CaMV, TMV, TRV and BV.
Transformation of plants using plant viruses is described in U.S.
Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published
Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV);
and Gluzman, Y. et al., Communications in Molecular Biology: Viral
Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189
(1988). Pseudovirus particles for use in expressing foreign DNA in
many hosts, including plants, is described in WO 87/06261.
[0316] Construction of plant RNA viruses for the introduction and
expression of non-viral exogenous nucleic acid sequences in plants
is demonstrated by the above references as well as by Dawson, W. O.
et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J.
(1987) 6:307-311; French et al. Science (1986) 231:1294-1297; and
Takamatsu et al. FEBS Letters (1990) 269:73-76.
[0317] When the virus is a DNA virus, suitable modifications can be
made to the virus itself. Alternatively, the virus can first be
cloned into a bacterial plasmid for ease of constructing the
desired viral vector with the foreign DNA. The virus can then be
excised from the plasmid. If the virus is a DNA virus, a bacterial
origin of replication can be attached to the viral DNA, which is
then replicated by the bacteria. Transcription and translation of
this DNA will produce the coat protein which will encapsidate the
viral DNA. If the virus is an RNA virus, the virus is generally
cloned as a cDNA and inserted into a plasmid. The plasmid is then
used to make all of the constructions. The RNA virus is then
produced by transcribing the viral sequence of the plasmid and
translation of the viral genes to produce the coat protein(s) which
encapsidate the viral RNA.
[0318] Construction of plant RNA viruses for the introduction and
expression in plants of non-viral exogenous nucleic acid sequences
such as those included in the construct of some embodiments of the
invention is demonstrated by the above references as well as in
U.S. Pat. No. 5,316,931.
[0319] In one embodiment, a plant viral nucleic acid is provided in
which the native coat protein coding sequence has been deleted from
a viral nucleic acid, a non-native plant viral coat protein coding
sequence and a non-native promoter, preferably the subgenomic
promoter of the non-native coat protein coding sequence, capable of
expression in the plant host, packaging of the recombinant plant
viral nucleic acid, and ensuring a systemic infection of the host
by the recombinant plant viral nucleic acid, has been inserted.
Alternatively, the coat protein gene may be inactivated by
insertion of the non-native nucleic acid sequence within it, such
that a protein is produced. The recombinant plant viral nucleic
acid may contain one or more additional non-native subgenomic
promoters. Each non-native subgenomic promoter is capable of
transcribing or expressing adjacent genes or nucleic acid sequences
in the plant host and incapable of recombination with each other
and with native subgenomic promoters. Non-native (foreign) nucleic
acid sequences may be inserted adjacent the native plant viral
subgenomic promoter or the native and a non-native plant viral
subgenomic promoters if more than one nucleic acid sequence is
included. The non-native nucleic acid sequences are transcribed or
expressed in the host plant under control of the subgenomic
promoter to produce the desired products.
[0320] In a second embodiment, a recombinant plant viral nucleic
acid is provided as in the first embodiment except that the native
coat protein coding sequence is placed adjacent one of the
non-native coat protein subgenomic promoters instead of a
non-native coat protein coding sequence.
[0321] In a third embodiment, a recombinant plant viral nucleic
acid is provided in which the native coat protein gene is adjacent
its subgenomic promoter and one or more non-native subgenomic
promoters have been inserted into the viral nucleic acid. The
inserted non-native subgenomic promoters are capable of
transcribing or expressing adjacent genes in a plant host and are
incapable of recombination with each other and with native
subgenomic promoters. Non-native nucleic acid sequences may be
inserted adjacent the non-native subgenomic plant viral promoters
such that said sequences are transcribed or expressed in the host
plant under control of the subgenomic promoters to produce the
desired product.
[0322] In a fourth embodiment, a recombinant plant viral nucleic
acid is provided as in the third embodiment except that the native
coat protein coding sequence is replaced by a non-native coat
protein coding sequence.
[0323] The viral vectors are encapsidated by the coat proteins
encoded by the recombinant plant viral nucleic acid to produce a
recombinant plant virus. The recombinant plant viral nucleic acid
or recombinant plant virus is used to infect appropriate host
plants. The recombinant plant viral nucleic acid is capable of
replication in the host, systemic spread in the host, and
transcription or expression of foreign gene(s) (isolated nucleic
acid) in the host to produce the desired protein.
[0324] Genome transformation can be evaluated phenotypically, i.e.,
by the presence/absence of a certain trait e.g., antibiotic
resistance, resistance to disease or herbicide, morphologically
(e.g., plant height), reporter gene expression (e.g., GUS) etc.
[0325] Genome transformation can also be evaluated molecularly.
This is of specific significance in the case of genome editing.
[0326] Thus, regenerated tissues/plants are validated for the
presence of a transformation event. The following provides such
validation methods for genome editing events, also referred to
herein as "mutation" or "edit", dependent on the type of editing
sought e.g., insertion, deletion, insertion-deletion (Indel),
inversion, substitution and combinations thereof.
[0327] Methods for detecting sequence alteration are well known in
the art and include, but not limited to, DNA sequencing (e.g., next
generation sequencing), electrophoresis, an enzyme-based mismatch
detection assay and a hybridization assay such as PCR, RT-PCR,
RNase protection, in-situ hybridization, primer extension, Southern
blot, Northern Blot and dot blot analysis. Various methods used for
detection of single nucleotide polymorphisms (SNPs) can also be
used, such as PCR based T7 endonuclease, Hetroduplex and Sanger
sequencing.
[0328] Another method of validating the presence of a DNA editing
event e.g., Indels comprises a mismatch cleavage assay that makes
use of a structure selective enzyme (e,g. m endonuclease) that
recognizes and cleaves mismatched DNA.
[0329] The mismatch cleavage assay is a simple and cost-effective
method for the detection of indels and is therefore the typical
procedure to detect mutations induced by genome editing. The assay
uses enzymes that cleave heteroduplex DNA at mismatches and
extrahelical loops formed by multiple nucleotides, yielding two or
more smaller fragments. A PCR product of .about.300-1000 bp is
generated with the predicted nuclease cleavage site off-center so
that the resulting fragments are dissimilar in size and can easily
be resolved by conventional gel electrophoresis or high-performance
liquid chromatography (HPLC). End-labeled digestion products can
also be analyzed by automated gel or capillary electrophoresis. The
frequency of indels at the locus can be estimated by measuring the
integrated intensities of the PCR amplicon and cleaved DNA bands.
The digestion step takes 15-60 min, and when the DNA preparation
and PCR steps are added the entire assays can be completed in <3
h.
[0330] Two alternative enzymes are typically used in this assay. T7
endonuclease 1 (T7E1) is a resolvase that recognizes and cleaves
imperfectly matched DNA at the first, second or third
phosphodiester bond upstream of the mismatch. The sensitivity of a
T7E1-based assay is 0.5-5%. In contrast, Surveyor.TM. nuclease
(Transgenomic Inc., Omaha, Nebr., USA) is a member of the CEL
family of mismatch-specific nucleases derived from celery. It
recognizes and cleaves mismatches due to the presence of single
nucleotide polymorphisms (SNPs) or small indels, cleaving both DNA
strands downstream of the mismatch. It can detect indels of up to
12 nt and is sensitive to mutations present at frequencies as low
as .about.3%, i.e. 1 in 32 copies.
[0331] Yet another method of validating the presence of an editing
even comprises the high-resolution melting analysis.
[0332] High-resolution melting analysis (HRMA) involves the
amplification of a DNA sequence spanning the genomic target (90-200
bp) by real-time PCR with the incorporation of a fluorescent dye,
followed by melt curve analysis of the amplicons. HRMA is based on
the loss of fluorescence when intercalating dyes are released from
double-stranded DNA during thermal denaturation. It records the
temperature-dependent denaturation profile of amplicons and detects
whether the melting process involves one or more molecular
species.
[0333] Yet another method is the heteroduplex mobility assay.
Mutations can also be detected by analyzing re-hybridized PCR
fragments directly by native polyacrylamide gel electrophoresis
(PAGE). This method takes advantage of the differential migration
of heteroduplex and homoduplex DNA in polyacrylamide gels. The
angle between matched and mismatched DNA strands caused by an indel
means that heteroduplex DNA migrates at a significantly slower rate
than homoduplex DNA under native conditions, and they can easily be
distinguished based on their mobility. Fragments of 140-170 bp can
be separated in a 15% polyacrylamide gel. The sensitivity of such
assays can approach 0.5% under optimal conditions, which is similar
to T7E1 (After reannealing the PCR products, the electrophoresis
component of the assay takes .about.2 h.
[0334] Other methods of validating the presence of editing events
are described in length in Zischewski 2017 Biotechnol. Advances
1(1):95-104.
[0335] It will be appreciated that positive clones can be
homozygous or heterozygous for the transformation event. The
skilled artisan will select the clone for further
culturing/regeneration according to the intended use.
[0336] It will be appreciated that crossing of the plant can be
effected to improve agricultural traits, losing a transgene, also
known as "crossing out" (e.g., nuclease after genome editing was
successfully implemented), or generation of inbreds or hybrids.
[0337] Following the present teachings, the present inventors were
able to exhibit at least 50% regeneration efficiency, as calculated
by the number of regenerates on the leaves/the total number of
treated leaves.
[0338] Whilst reducing embodiments of the invention to practice,
the present inventors have devised a protocol for in planta
regeneration and transformation. Meristems are responsible for
repair after injury: when the clonal zone of the shoot apical
meristem is locally ablated, surrounding cells in the peripheral
zone reconstruct the functional meristem. In shoots, meristems in
axillary buds are kept dormant by the presence of apical meristems.
Upon loss of these apical meristems, apical dormancy is broken and
axillary buds begin to grow.
[0339] As used herein "in planta" means not under the sterile
conditions of a tissue culture.
[0340] Accordingly, there is provided a method of in planta
cannabis regeneration, the method comprising:
(a) removing, exposing and/or wounding a meristem of a cannabis
tissue so as to obtain a meristem-depleted cannabis tissue; and (b)
treating said meristem-depleted cannabis tissue with a composition
comprising at least one plant hormone (e.g., cytokinin, auxin
gibberellins, ethylene, ABA, Jasmonic acid);
[0341] According to a specific embodiment, the at least one plant
hormone comprises a cytokinin and an auxin.
[0342] Also provided is a method of in planta cannabis
transformation, the method comprising:
(a) removing, exposing and/or wounding a meristem of a cannabis
tissue so as to obtain a meristem-depleted cannabis tissue; and (b)
treating said meristem-depleted cannabis tissue with a composition
comprising at least one plant hormone (e.g., cytokinin, auxin
gibberellins, ethylene, ABA Jasmonic acid) that allows plant
regeneration and with a composition comprising a nucleic acid
sequence encoding an expression product of interest;
[0343] According to a specific embodiment, the at least one plant
hormone comprises a cytokinin and an auxin.
[0344] According to this aspect, the cannabis tissue is a tissue
that comprises meristems (axial or apical) prior to their depletion
as described.
[0345] According to an embodiment of the invention, cannabis seeds
are allowed to germinate and grow until a size when at least two
nodes are observed.
[0346] In order to expose the meristem, one cotyledon and the
meristem with its leaves (i.e., of a seedling) are cut off from the
seedling (e.g., at 145.degree.), leaving the seedling with only one
cotyledon so as to allow photosynthesis. Other embodiments of the
invention relate to the same protocol when done on a mature plant
(e.g., cutting having 2 nodes of an adult plant). In the latter
case too, at least one leaf (e.g., not more than 1 leaf) is left to
allow photosynthesis.
[0347] At this stage the tissue is treated with hormone(s). For
example, cytokinin and auxin, at the relevant ratios. In addition
gibberellin. ethylene, ABA and/or Jasmonic acid can be added.
[0348] The use of a paste formulation may enhance penetration,
though other modes of applications (e.g., spraying, dropping) can
be used too.
[0349] According to a specific embodiment, the composition is
formulated such that allows attachment of the composition to a
surface of the meristem-depleted cannabis tissue.
[0350] According to a specific embodiment, the formulation
comprises (e.g., ALGANATE) a nanoemulsion paste prepared according
to Pereira et al., 2017 (Colloids and surfaces B: Biointerfaces
150:141-152) e.g., cytokinins and auxin gibberellins, ethylene,
aba, Jasmonic acid hormones combinations are mixed with
nanoemulsion (e.g., 3:4 v/v) to create a "regeneration paste". The
paste is spread on the wounded cuttings.
[0351] According to a specific embodiment the nanoemulsion
comprises lanolin.
[0352] As used herein "nanoemulsion" refers to clear,
thermodynamically stable, isotropic liquid mixtures of oil, water
and surfactant, frequently in combination with a co-surfactant. The
aqueous phase may contain salt(s) and/or other ingredients, and the
"oil" may actually be a complex mixture of different hydrocarbons
and olefins, in contrast to ordinary emulsions,
[0353] The regeneration can be effected together with the
transformation (in this case, when Agrobacterium is used, it is
better to employ a microemulsion that can comprise the bacterial
cells). Accordingly, the composition which comprises the
regenerating hormones can include also the nucleic acid of
interest. Conversely, the same composition (e.g., alginate based)
can be used for both transformation and regeneration even if taken
in 2 different steps.
[0354] In a sequential embodiment, whereby the transformation step
follows regeneration, the transformation composition is applied
0-96 hours following application of the regeneration composition
comprising the hormones.
[0355] It will be appreciated that the plant can be first
transformed and then subjected to a regeneration protocol.
[0356] According to a specific embodiment, the transformation is
Agrobacterium-based. Agrobacterium can be applied to the cannabis
tissue in different modes e.g., dipping, microencapsulation,
injecting and dripping.
[0357] Transformation and methods of validation are described
herein.
[0358] Also provided herein is a method of cannabis regeneration
via somatic embryogenesis, the method comprising:
[0359] (a) culturing a callus or a regenerable cannabis explant in
a liquid culture while shaking till appearance of globular
structures (e.g., as in FIG. 13A);
[0360] (b) culturing said globular structures in a liquid culture
while shaking till appearance of leaves.
[0361] According to a specific embodiment, the regenerable cannabis
explant is obtained according to the protocol of clonal propagation
as described above.
[0362] According to a specific embodiment, the culturing is
effected under shaking (such as described hereinabove) to elicit
the development of embryonic tissue i.e., dedifferentiation that is
followed by differentiation in the presence of CPPU and
CPPU+cBD.
[0363] According to a specific embodiment, step (a) is effected in
the presence of CPPU; and wherein step (b) is effected in the
presence of CPPU+cBD.
[0364] According to a specific embodiment, step (a) is effected in
the absence of cBD.
[0365] According to a specific protocol regeneration via somatic
embryogenesis is effected as follows: a tissue explants having leaf
segments of 1.5 cm diameter and 4-5 cm length are selected.
Innermost leaf whorls are cut obliquely (0.5-1.0 cm), injured with
a sharp scalpel blade in order to achieve callus initiation
(de-differentiation). Leaf segments are used as explants for
inoculation on MS medium (Murashige and Skoog 1962) supplemented
with 2,4-D (4.0 mg/L) and kinetin [Kin] (0.5 mg/L). After 2-3 weeks
the cultures are incubated at 25.+-.2.degree. C. at 70-80% humidity
in dark in liquid Gamborg B5 medium supplemented with 6% sucrose
and different plant hormones including the CPPU and cBD. The media
was refreshed every three weeks.
[0366] Also provided is a method of in-vitro cannabis
transformation, the method comprising, contacting a leaf producible
according to the method as described herein with a polynucleotide
encoding an expression product of interest. According to a specific
embodiment, the polynucleotide is comprised in a formulation
comprising Agrobacterium or PEG (as described herein).
[0367] Plants can also regenerate from protoplast or pollen. Whilst
reducing embodiments of the invention to practice, the present
inventors have identified a protocol for the efficient production
of protoplasts using enzymatic digestion.
[0368] Accordingly there is provided a method of producing cannabis
protoplasts, the method comprising, treating a cannabis tissue with
macerozyme R-10 and mannitol, so as to obtain protoplasts.
[0369] As used herein "protoplast" refers to a plant cell devoid of
a cell wall.
[0370] Protoplasts can be isolated from a wide variety of cannabis
tissues and organs that include leaves, roots, shoot apices,
embryos, microspores and mesophyll tissue of seedlings (e.g.,
cotyledons) or mature plants (e.g., leaves). In addition, callus
and suspension cultures also serve as sources for protoplast
isolation.
[0371] A sterile tissue is used. Disinfection can be done any time
before the production of protoplasts.
[0372] The present inventors have found that a combination of
macerozyme R-10 and mannitol allows the survival of at least 4% of
isolated protoplasts following 48 hours cultivation in a liquid
(drop) culture. In addition less than 1% of the protoplasts
developed a cell wall.
[0373] Macerozyme R-10 is a macerating enzyme from the Rhizopus sp.
which is suited for the isolation of plant cells. The enzyme has
pectinase and hemicellulase activity. Macerozyme R-10 is
commercially available from a number of vendors including but not
limited to Sigma-Aldrich, GoldBio(dot)Com and Yakult Pharmaceutical
Industries Co.
[0374] As used herein "Mannitol" is used herein as a carbon source.
It will be appreciated that other carbon sources such as sorbitol,
fructose, glucose, galactose and sucrose can be alternatively used.
Mannitol, being metabolically inert, may be preferred.
[0375] In an exemplary protocol, sterile cotyledons are cut to fine
pieces (e.g., 1-5 mm) and incubated in a cell wall degrading
solution e.g., W5--1.5% cellulose, 0.5% macerozyme, 0.4% mannitol,
20 mM KCl, 20 mM MES, 10 mM CaCl.sub.2 and 0.1% BSA, placed in
vacuum for 10 min and then shaken for 5 h at 50 rpm pH 4.5-7. The
protoplasts are then filtered, diluted and pelleted by
centrifugation. Up to now the procedure is done at room
temperature. The protoplasts are re-suspended in a cell wall
degrading solution (e.g., W5) and incubated on ice, before being
centrifuged again and re-suspended in a solution containing
mannitol and MgCl.sub.2.
[0376] According to a specific embodiment, treating the tissue is
also done with onzuka R-10 and/or hemicelluloses.
[0377] Cellulose or hemicelluloses are used to release the
protoplasts from the cell debris.
[0378] As used herein "Onzuka R-10" refers to a cellulase derived
from Trichoderma viride, which decomposes plant cell walls.
[0379] Other Onzuka cellulases can also be used e.g., Onzuka FA and
Onzuka.
[0380] According to a specific embodiment, macerozyme R-10 is
provided at a concentration of 0.4-1.5%.
[0381] According to a specific embodiment, said hemicellulose is
provided at a concentration of 0.5-2%.
[0382] According to a specific embodiment, said Onzuka is provided
at a concentration of 0.5-3%.
[0383] According to a specific embodiment, said mannitol is
provided at a concentration of 0.1-0.3%.
[0384] The various enzymes for protoplast isolation are
commercially available. For instance, Macerozyme R-10 is
commercially available from a number of vendors including, but not
limited to, Sigma-Aldrich, GoldBio(dot)Com and Yakult
Pharmaceutical Industries Co.
[0385] The enzymes are typically used at a pH 4.5 to 6.0 (e.g.,
5.8), temperature 25-30.degree. C. (e.g., room temperature) with a
wide variation in incubation period that may range from half an
hour to 20 hours (e.g., 5 hours).
[0386] The enzyme digested plant cells, besides protoplasts contain
undigested cells, broken protoplasts and undigested tissues. The
cell clumps and undigested tissues can be removed by filtration.
This is followed by centrifugation and washings of the protoplasts.
After centrifugation, the protoplasts are recovered in a solution
which may contain percoll or a combination of mannitol and salt
(e.g., MgCl.sub.2).
[0387] According to a specific embodiment at least 50-70% of the
preparation comprises protoplasts that are viable and intact.
[0388] Thus, according to an embodiment, the isolated protoplasts
are tested for viability and ability to undergo sustained cell
divisions and regeneration.
[0389] Examples of methods for assessing protoplast viability
include but are not limited to, fluorescein diacetate (FDA)
staining method--The dye accumulates inside viable protoplasts
which can be detected by fluorescence microscopy; phenosafranine
stain is selectively taken up by dead protoplasts (turn red) while
the viable cells remain unstained; exclusion of Evans blue dye by
intact membranes; measurement of cell wall formation--Calcofluor
white (CFW) stain binds to the newly formed cell walls which emit
fluorescence; Oxygen uptake by protoplasts which can be measured by
oxygen electrode; Photosynthetic activity of protoplasts; and
ability of protoplasts to undergo continuous mitotic divisions
(this is a direct measure).
[0390] Such protoplasts can be subjected to a method of
transformation.
[0391] Typically in the absence of cell wall the DNA can be
transferred using simple reagents such as PEG.
[0392] Thus, according to an embodiment of the invention,
introducing DNA into protoplasts comprises polyethylene glycol
(PEG)-mediated DNA uptake. For further details see Karesch et al.
(1991) Plant Cell Rep. 9:575-578; Mathur et al. (1995) Plant Cell
Rep. 14:221-226; Negrutiu et al. (1987) Plant Cell Mol. Biol.
8:363-373.
[0393] Based on the present teachings the present inventors were
able to successfully introduce the RFP gene to cannabis
protoplasts.
[0394] Also provided are protoplasts (transformed or not)
obtainable according to the present teachings.
[0395] Protoplasts are then cultured under conditions that allow
them to grow cell walls, start dividing to form a callus, develop
shoots and roots, and regenerate whole plants.
[0396] The very first step in protoplast culture is the development
of a cell wall around the membrane of the protoplast. This is
followed by the cell divisions that give rise to a small colony.
The cell colonies may be grown continuously as cultures or
regenerated to whole plants. Protoplasts are cultured either in
semisolid agar or liquid medium. In an embodiment, protoplasts are
first allowed to develop cell wall in liquid medium, and then
transferred to agar medium.
[0397] Solid culture (e.g., Agarose): The concentration of the agar
should be such that it forms a soft agar gel when mixed with the
protoplast suspension e.g., 0.5-0.7%. According to a specific
embodiment, the plating of protoplasts is carried out by Bergmann's
cell plating technique. In agar cultures, the protoplasts remain in
a fixed position, divide and form cell clones. The advantage with
agar culture is that clumping of protoplasts is avoided.
[0398] According to another embodiment, a liquid culture is used.
Liquid culture may be used for protoplast cultivation for the
following reasons:
1. It is easy to dilute and transfer. 2. Density of the cells can
be manipulated as desired. 3. Osmotic pressure of liquid medium can
be altered as desired.
[0399] In general, the nutritional requirements of protoplasts are
similar to those of cultured plant cells, as mentioned above (e.g.,
MS).
[0400] According to some embodiments, the following considerations
are taken place:
1. The medium should be devoid of ammonium, and the quantities of
iron and zinc should be less. 2. The concentration of calcium
should be 2-4-times higher than used for cell cultures. This is
needed for membrane stability. 3. High auxin/kinetin ratio is
suitable to induce cell divisions while high kinetin/auxin ratio is
required for regeneration. 4. Glucose is the preferred carbon
source by protoplasts although a combination of sugars (glucose and
sucrose) can be used. 5. The vitamins used for protoplast cultures
are the same as used in standard tissue culture media.
[0401] Osmoticum and osmotic pressure:
[0402] As used herein "Osmoticum" refers to the reagents/chemicals
that are added to increase the osmotic pressure of a liquid.
[0403] The isolation and culture of protoplasts require osmotic
protection until they develop a strong cell wall. In fact, if the
freshly isolated protoplasts are directly added to the normal
culture medium, they will burst. Thus, addition of an osmoticum is
essential for both isolation and culture media of protoplast to
prevent their rupture.
[0404] According to a specific embodiment, the osmoticum is
non-ionic. The non-ionic substances most commonly used are soluble
carbohydrates such as mannitol, sorbitol, glucose, fructose,
galactose and sucrose. According to a specific embodiment, mannitol
is used.
[0405] According to a specific embodiment, the osmoticum is ionic.
Potassium chloride, calcium chloride and magnesium phosphate are
the ionic substances in use to maintain osmotic pressure. When the
protoplasts are transferred to a culture medium, the use of
metabolically active osmotic stabilizers (e.g., glucose, sucrose)
along with metabolically inert osmotic stabilizers (mannitol) is
advantageous. As the growth of protoplasts and cell wall
regeneration occurs, the metabolically active compounds are
utilized, and this results in the reduced osmotic pressure so that
proper osmolarity is maintained.
[0406] The culture techniques of protoplasts may vary.
[0407] According to a specific embodiment, the feeder layer
technique or micro drop culture is used.
[0408] The process of cell wall formation in cultured protoplasts
starts within a few hours after isolation that may take two to
several days under suitable conditions. As the cell wall
development occurs, the protoplasts lose their characteristic
spherical shape. The newly developed cell wall by protoplasts can
be identified by using calcofluor white fluorescent stain. The
freshly formed cell wall is composed of loosely bound micro fibrils
which get organized to form a typical cell wall. This process of
cell wall development requires continuous supply of nutrients,
particularly a readily metabolised carbon source (e.g.
sucrose).
[0409] Cell wall development is found to be improper in the
presence of ionic osmotic stabilizers in the medium. The
protoplasts with proper cell wall development undergo normal cell
division. On the other hand, protoplasts with poorly regenerated
cell wall show budding and fail to undergo normal mitosis.
[0410] As the cell wall formation around protoplasts is complete,
the cells increase in size, and the first division generally occurs
within 2-7 days. Subsequent divisions result in small colonies, and
by the end of third week, visible colonies (macroscopic colonies)
are formed. These colonies are then transferred to an osmotic-free
(mannitol or sorbitol-free) medium for further development to form
callus.
[0411] With induction and appropriate manipulations, the callus can
undergo organogenic or embryogenic differentiation to finally form
the whole plant.
[0412] Plant regeneration can be done from the callus obtained
either from protoplasts or from the culture of plant organs. There
are however, certain differences in these two calli. The callus
derived from plant organs carries preformed buds or organized
structures, while the callus from protoplast culture does not have
such structures.
[0413] To augment any of the above regeneration protocols, the
present inventors have identified regenerating genes termed CsBBM
(SEQ ID NO: 2 and 6) and CsSERK1 (SEQ ID NO: 1 and 10) that can
facilitate plant regeneration.
[0414] Also contemplated are naturally occurring or synthetic
homologs (e.g., of at least 30%, 40%, 50% or 80% nucleic acid
identity of same).
[0415] Thus, according to an aspect of the invention there is
provided a method of cannabis regeneration, the method comprising
transforming an explant or plant (i.e., in planta) of the cannabis
with a regenerating gene [e.g., CsBBM (SEQ ID NO: 2 and 6) and
CsSERK1 (SEQ ID NO: 1 and 10)] and allowing the tissue to
regenerate.
[0416] Such homologues can be, for example, at least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least 98%, at least 99% or 100% identical to SEQ ID
NO:10 (amino acid sequence of CsSerk1), as determined using the
BestFit software of the Wisconsin sequence analysis package,
utilizing the Smith and Waterman algorithm, where gap weight equals
50, length weight equals 3, average match equals 10 and average
mismatch equals -9.
[0417] According to an additional or an alternative embodiment, the
homologues can be, for example, at least 50%, at least 60%, at
least 70%, at least 80%, at least 85%, at least 86%, at least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least 98%, at least 99% or 100% identical to SEQ ID
NO:6 (amino acid sequence of CsBBM), as determined using the
BestFit software of the Wisconsin sequence analysis package,
utilizing the Smith and Waterman algorithm, where gap weight equals
50, length weight equals 3, average match equals 10 and average
mismatch equals -9.
[0418] Naturally occurring homologs are provided in BnBBM, AthBBM,
ZmBBM, AtSERK1, BnSERK1, SISERK1. (SEQ ID NOs: 3-9).
[0419] Protocols for transformation (viral or non-viral dependent)
are described throughout the specification.
[0420] Promoters useful for expression can be constitutively active
or inducible (see e.g., WO2017/115353, WO2016/030885).
[0421] Nucleic acid sequences of the polypeptides of some
embodiments of the invention may be optimized for plant expression.
Examples of such sequence modifications include, but are not
limited to, an altered G/C content to more closely approach that
typically found in the plant species of interest, and the removal
of codons atypically found in the plant species commonly referred
to as codon optimization.
[0422] Also provided is a method of cannabis transformation. The
method comprises contacting pollen of a cannabis plant with
particles comprising a nucleic acid sequence encoding an expression
product of interest under a magnetic field that concentrates said
particles and allows penetration of said nucleic acid sequence of
interest into said pollen.
[0423] Transformation under a magnetic field is typically referred
to as "magnetofection".
[0424] The ability to transform cannabis using magnetofection is
surprising, since to date the pollen apertures of cannabis have
never been described.
[0425] This method is advantageous since it does not require plant
regeneration.
[0426] In this system, exogenous DNA loaded with magnetic
nanoparticles is delivered into pollen in the presence of a
magnetic field.
[0427] The present inventors have surprisingly uncovered that fresh
pollen i.e., up to 12 hours post harvesting exhibits better
transformability.
[0428] Accordingly, magnetic nanoparticles (MNPs) are used as DNA
carriers that can pass through the apertures in the pollen with the
directional potential of a magnetic field (externally applied).
Hence, positively charged polyethyleneimine-coated Fe.sub.3O.sub.4
MNPs are used as the DNA carriers for binding and condensing with
electric negative DNA to form MNP-DNA complexes. After mixing
MNP-DNA complexes with pollen, a magnetic field is then applied to
direct the MNP-DNA complexes into the pollen through the apertures
before pollination. Plants expressing a transgene of interest are
then obtained typically after selection e.g., with an
antibiotic.
[0429] According to an exemplary protocol, plasmid DNA (e.g., 1 ug)
is left to bind with MNP's (MAGBIO, USA) at room temperature, prior
to adding the transformation media: 10 g--40 Sucrose,
H.sub.3BO.sub.3--10.3 mg, KNO.sub.3-- 2.3 mg,
Ca(NO.sub.3).sub.2--10.3 mg, MnSO.sub.4--10.3 mg, MgSO.sub.4
7H2O--10.3 mg, GA.sub.3--3 mg, H.sub.2O up to 100 ml.
[0430] Pollen (1-10 million grains) added to the medium containing
the bound MNP-plasmid and left on a magnet (Chemicell) for 30 min
at room temp and dried in 30.degree. C. for 30 min.
[0431] Based on the present teachings the present inventors were
able to successfully introduce the GUS gene to cannabis pollen.
[0432] Any of the plant material described herein can be used for
the generation of cannabis plants with advanced agricultural,
nutritional, pharmaceutical, recreational properties, as compared
to no-transformed plants of the same genetic background,
developmental stage and growth conditions but not being
transformed, also referred to herein as "control".
[0433] As used herein the term "about" refers to .+-.10%.
[0434] The terms "comprises", "comprising", "includes",
"including", "having" and their conjugates mean "including but not
limited to".
[0435] The term "consisting of" means "including and limited
to".
[0436] The term "consisting essentially of" means that the
composition, method or structure may include additional
ingredients, steps and/or parts, but only if the additional
ingredients, steps and/or parts do not materially alter the basic
and novel characteristics of the claimed composition, method or
structure.
[0437] As used herein, the singular form "a", "an" and "the"
include plural references unless the context clearly dictates
otherwise. For example, the term "a compound" or "at least one
compound" may include a plurality of compounds, including mixtures
thereof.
[0438] Throughout this application, various embodiments of this
invention may be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual numbers within that range, for example, 1, 2, 3,
4, 5, and 6. This applies regardless of the breadth of the
range.
[0439] Whenever a numerical range is indicated herein, it is meant
to include any cited numeral (fractional or integral) within the
indicated range. The phrases "ranging/ranges between" a first
indicate number and a second indicate number and "ranging/ranges
from" a first indicate number "to" a second indicate number are
used herein interchangeably and are meant to include the first and
second indicated numbers and all the fractional and integral
numerals therebetween.
[0440] As used herein the term "method" refers to manners, means,
techniques and procedures for accomplishing a given task including,
but not limited to, those manners, means, techniques and procedures
either known to, or readily developed from known manners, means,
techniques and procedures by practitioners of the chemical,
pharmacological, biological, biochemical and medical arts.
[0441] As used herein, the term "treating" includes abrogating,
substantially inhibiting, slowing or reversing the progression of a
condition, substantially ameliorating clinical or aesthetical
symptoms of a condition or substantially preventing the appearance
of clinical or aesthetical symptoms of a condition.
[0442] When reference is made to particular sequence listings, such
reference is to be understood to also encompass sequences that
substantially correspond to its complementary sequence as including
minor sequence variations, resulting from, e.g., sequencing errors,
cloning errors, or other alterations resulting in base
substitution, base deletion or base addition, provided that the
frequency of such variations is less than 1 in 50 nucleotides,
alternatively, less than 1 in 100 nucleotides, alternatively, less
than 1 in 200 nucleotides, alternatively, less than 1 in 500
nucleotides, alternatively, less than 1 in 1000 nucleotides,
alternatively, less than 1 in 5,000 nucleotides, alternatively,
less than 1 in 10,000 nucleotides.
[0443] It is understood that any Sequence Identification Number
(SEQ ID NO) disclosed in the instant application can refer to
either a DNA sequence or a RNA sequence, depending on the context
where that SEQ ID NO is mentioned, even if that SEQ ID NO is
expressed only in a DNA sequence format or a RNA sequence
format.
[0444] It is appreciated that certain features of the invention,
which are, for clarity, described in the context of separate
embodiments, may also be provided in combination in a single
embodiment. Conversely, various features of the invention, which
are, for brevity, described in the context of a single embodiment,
may also be provided separately or in any suitable subcombination
or as suitable in any other described embodiment of the invention.
Certain features described in the context of various embodiments
are not to be considered essential features of those embodiments,
unless the embodiment is inoperative without those elements.
[0445] Various embodiments and aspects of the present invention as
delineated hereinabove and as claimed in the claims section below
find experimental support in the following examples.
EXAMPLES
[0446] Reference is now made to the following examples, which
together with the above descriptions, illustrate the invention in a
non limiting fashion.
[0447] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in
Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989);
Perbal, "A Practical Guide to Molecular Cloning", John Wiley &
Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A
Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory
Press, New York (1998); methodologies as set forth in U.S. Pat.
Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057;
"Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E.,
ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan
J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical
Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn.
(1994); Mishell and Shiigi (eds), "Selected Methods in Cellular
Immunology", W. H. Freeman and Co., New York (1980); available
immunoassays are extensively described in the patent and scientific
literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153;
3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654;
3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219;
5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J.,
ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins
S. J., eds. (1985); "Transcription and Translation" Hames, B. D.,
and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R.
I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986);
"A Practical Guide to Molecular Cloning" Perbal, B., (1984) and
"Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols:
A Guide To Methods And Applications", Academic Press, San Diego,
Calif. (1990); Marshak et al., "Strategies for Protein Purification
and Characterization--A Laboratory Course Manual" CSHL Press
(1996); all of which are incorporated by reference as if fully set
forth herein. Other general references are provided throughout this
document. The procedures therein are believed to be well known in
the art and are provided for the convenience of the reader. All the
information contained therein is incorporated herein by
reference.
Example 1
In-Vitro Propagation, Hardening and Rooting of Cannabis
Cultivars
[0448] Cannabis has acquired considerable importance as a food,
oil, fiber, medicinal and recreational drug source crop all over
the world. This extraordinary versatile important plant material
naturally calls for development of suitable protocols for
production of sufficient number of uniform planting materials from
Cannabis varieties through biotechnological intervention. Among the
biotechnological approaches, micropropagation is one of the most
feasible techniques, allows efficient and rapid clonal propagation
of many economically important crops.
[0449] This study describes an efficient in-vitro propagation,
hardening and rooting procedures for obtaining plantlets from shoot
tips and seedlings of Cannabis sativa L. Ten different cannabis
cultivars seedlings and shoot cuttings were sterilized and grown on
half-strength 1/2 MS medium supplemented with 10 g/L sucrose, 5.5
g/L Agar at a pH of 6.8 with different plant hormone combinations
under light for 16 h per day. Limited growth was observed on the
solid media supplemented with different hormonal combinations in
most of the cultivars tested. In order to increase cannabis plant
permeability, a protocol was developed that utilizes "liquid
treatment" in which the tissue culture explants are transferred
from solid to liquid media supplemented with several sublethal
concentrations of cuticle nicking enzymes every 3-4 weeks,
resulting in significantly improved growth and development. The
proliferated buds were successfully rooted on solid MS medium
supplemented with resulting in 85% rooting of the plantlets.
In-vitro clonal propagation, rooting and acclimatized plantlet
production was established for 10 different Cannabis cultivars. The
procedure requires a 50-70 days cycle for the In-vitro clonal
propagation (20 days for shoot multiplication and 30 days for root
induction) which includes 15-30 days for acclimatized plantlet
production. Different strains may have different procedure time
generally requiring between 50 to 100 days.
[0450] Materials and Methods
[0451] Plant Material
[0452] Ten different Cannabis cultivars representing a wide range
of genetic diversity (Table 1) were used in this study. A few of
them are hemp with low/non THC mainly used for fiber while the
others are Cannabis cultivars with high THC and other cannabinoids
for medical and recreational usage (e.g., 0-22% THC and 0.2-13%
CBD). The plants of C. sativa were grown from seeds and
cuttings.
TABLE-US-00001 TABLE 1 No. Name Type Usage Origin 106 WON21 Sativa
Fiber type China 108 Pinola Sativa Fiber type, Oil Canada Dioecious
201 Goodrich Sativa Medical China 202 Glory Sativa Medical China
206 Lemon Haze Sativa Drug type Europe 207 White widow Hybrid Drug
type Europe 208 Jack herer Hybrid Drug type Europe 209 Lemon Haze
Bnn. Hybrid Drug type, Medical Europe 212 Cheese Hybrid Drug type,
Medical Europe 213 SLH Hybrid Drug type, Medical Europe
[0453] Establishment and Propagation of Cannabis Tissue Culture
from Mature Plants
[0454] Tissue Sterilization:
[0455] Cutting tissues from mature plants that contained apical and
axillary meristems were washed under abundant water flow for 3 h.
Tissues were then washed in ethanol 70% for 10 secs prior to 20 min
wash in 1.5% NaClO.
[0456] Tissues were further abundantly washed 4 times in distilled
water and set on different sterile proliferation growth medium. In
order to determine an ideal composition for each line (Table
2).
[0457] Tissue Propagation
[0458] Every 21 days plants were transferred to a fresh propagation
medium after carefully removing the leaves and exposure of side
meristem.
[0459] Establishment and Propagation from Seeds
[0460] Seeds Sterilization and Germination
[0461] Seeds washed under abundant water flow for 2 h, then washed
in ethanol 70% for 10 secs prior to 20 min wash in 1.5% NaClO
supplemented with 0.1% Tween 20. Seeds were further abundantly
washed 4 times in distilled water and set onto a sterile growth
medium (1/2MS, 2% Sucrose, 0.8% agar). Seeds were germinated in the
dark for 2 d and were then transferred to light. Two weeks later,
large seedlings that contained at least two true leaves were cut
from their roots and transferred to different sterile proliferation
growth media. In order to determine an ideal composition for each
line (Table 2).
[0462] Liquid Treatment
[0463] Young shoots were depleted from their leaves and necrotic
tissue. They were then transferred to liquid medium that contained
all growth components excluding Agar as mention in Table 2, below.
Plantlets were grown in 250 ml jars containing 5 ml medium for
shaking for 21 days and then transferred back to solid media.
[0464] Premium Liquid Treatment
[0465] Adding several sublethal concentrations of cuticle nicking
enzymes to the liquid stage of the "liquid treatment". 5 ml enzyme
reaction mixture (0.25 ml 10% fungal mix of pectin and cutinase
enzyme (BSG HandCraft Liquid Pectic Enzyme; Cutinase--Sigma,
Ferdinand Maria Quincy 0.25 ml 200 mM Tris-HCl) was added to 5 ml
liquid media. Plants were incubated for 30 min in 30.degree. C.,
then transferred to fresh liquid media.
[0466] The same medium was used for liquid and solid culturing.
TABLE-US-00002 TABLE 2 The different Proliferation media (PR), used
for Cannabis tissue culture in this study Ingredients PR13 PR12 PR
11 PR 11 + PG PR14 PR 18A PR 18B PR 18C MS 1 MS 0222 1 MS 0222 1 MS
0221 1 MS 0222 1 MS B5 1 MS 0222 1 MS 0222 1 MS 0222 MS vitamins 1
ml/l Sugar 2% 2% 3% 3% 3% 3% 3% 3% BA 2 mg/l 2 mg/l 1 mg/l 1 mg/l
0.25 mg/l TDZ 0.11 mg/l 0.11 mg/l Zeatin 2 mg/l NAA 1 mg/l IBA 0.2
mg/l 0.2 mg/l 0.05 mg/l 0.5 mg/1 GA3 1 mg/l 1 mg/l 0.05 mg/l 0.05
mg/l 0.1 mg/l 2.4 mg/l 0.2 mg/1 thiamine-HCl 0.5 mg/l 0.5 mg/l
Myo-inositol 100 mg/1 100 mg/l 100 mg/l 0.5 mg/1 Phlorpglucinol 89
mg/l 100 mg/1 Activated 500 mg/l Charcoal Agar 0.8% 0.8% 0.8% 0.8%
0.8% 0.8% 0.8% 0.8% SigmaAgar S igmaAgar SigmaAgar SigmaAgar
SigmaAgar gelrite gelrite gelrite PH 5.8 5.8 5.7 5.7 5.8 5.8 5.8
5.8
[0467] Rooting and Acclimatization
[0468] Rooting and acclimatization experiments were carried out
initially with Cannabis cultivars 213 and 108.
[0469] Shoot was cultivated individually in a tube with root
induction (RI) medium composed of half strength MS medium (1/2MS)
supplemented with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 90
mg/l phloroglucinol, 2% sucrose (w/v), 0.25% activated charcoal
(AC), with or without IBA (at different concentrations (0, 1, 2
mg/1) and 0.8% agar. Soil mixture was moistened by soaking the
rooting cylinders in liquid RI medium supplemented with either 0,
1, or 2 mg/l IBA. Each treatment consisted of 10 shoots and results
were scored after 4 weeks. Each experiment was repeated three
times.
[0470] Results
[0471] Effect of Cuticle Necking Enzymes and Transfer of Plants
from Solid to the Liquid Medium on Proliferation of Cannabis Tissue
Culture
[0472] A tissue culture protocol was established for 10 different
Cannabis cultivars representing a wide range of genetic diversity
(FIG. 1). Several proliferation (PR) media were tested to determine
the optimal medium for each cultivar based on their growth rate
after 1-3 months (Table 2). Results are shown in FIG. 2.
[0473] Further analysis of the tissue culture showed a decline in
the growth rate after 6 growth cycles probably because of limited
ingredients uptake (FIG. 3A). In order to increase cannabis plant
permeability a protocol for "liquid treatment" was developed in
which the tissue culture was transferred from solid to liquid media
every 3-4 weeks, and as a result significantly improved their
growth and development (FIGS. 3B-C).
[0474] To further increase plant permeability, the "liquid
treatment" was supplemented by adding several sublethal cuticle
nicking enzymes to the liquid stage with the aim of creating cracks
in the plant cuticle. Pectin and cutinases are extracellular
enzymes catalyzing the hydrolysis of the polyesters of the cuticle
and the suberin layers, which protect plant surfaces. A protocol
referred to as "premium liquid treatment" refers to the presence of
cell wall degrading enzymes (Table 3, FIG. 4).
TABLE-US-00003 TABLE 3 Tissue culture response to "premium liquid
treatment". Growth rate was measured from 1 (growth arrest) to 5
(rapid growth). Cultivar Cultivar Cultivar Cultivar Cultivar
Cultivar Cultivar Cultivar Cultivar Cultivar 201 202 206 207 208
209 212 213 106 108 Liquid 3 4 3 2 3 3 2 1 3 2 media Liquid 4 5 5 5
4 4 5 5 4 5 media with pectic Enzymes Liquid 4 5 5 5 5 4 4 5 3 5
media with cutinases enzymes Solid 5 5 5 5 5 5 5 5 5 5 medium after
"premium liquid treatment"
[0475] The combined liquid media with sublethal cuticle nicking
enzymes and plant surfactants ("premium liquid treatment")
increased plant growth and development in a significant manner.
Moreover, the change in the cannabis cultivars surface permeability
lasted even when the plants were sub-cultured again on solid medium
(FIG. 4).
[0476] Rooting and Acclimatization
[0477] To obtain root induction, different concentrations of IBA
were examined. The shoots were placed in a tube containing rooting
medium containing 0, 1, or 2 mg/l IBA. Using this method with 2
mg/l IBA, about 85% of the shoots formed roots. However, only low
percentage of these plants successfully acclimatized under
greenhouse conditions. According to the second approach, shoots
were cultured directly in rooting cylinders. After 4 weeks, 100%
root formation was achieved, independently of the concentration of
auxin used (FIGS. 5A-C). These plants had better hardening and
underwent easier acclimatization in greenhouse conditions. In-vitro
clonal propagation, rooting and acclimatized plantlet production
was established for 10 different Cannabis cultivars. According to
an embodiment of the invention, the procedure requires a 50-70 days
cycle for the In-vitro clonal propagation (20 days for shoot
multiplication and 30 days for root induction) which includes 15-30
days for acclimatized plantlet production.
Example 2
Cannabis Regeneration and Transformation Using Tissue Culture
[0478] The development of new Cannabis cultivars with improved
traits could be facilitated through the application of
biotechnological strategies. The purpose of this study was to
establish efficient regeneration of Cannabis in tissue culture and
to establish a protocol for Agrobacterium-mediated transformation
for foreign gene introduction.
[0479] Induction of high-frequency shoot regeneration using nodal
segments containing axillary buds from tissue culture plants of
Cannabis sativa was achieved on premium treatment media with
cuticle nicking enzymes, added to Murashige and Skoog (MS) medium
salt mixture, containing 0.05-5.0 .mu.M thidiazuron, supplemented
with 100 mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v)
at pH 5.7) with 5 ml cuticle nicking enzymes reaction mixture (0.25
ml 10% enzyme, fungal mix of pectin and cutinase (BSG HandCraft
Liquid Pectic Enzyme; Cutinase--Sigma, Ferdinand Maria Quincy 0.25
ml 200 mM Tris-HCl). The quality and quantity of regenerates were
better with media treatment with cuticle nicking enzymes and
thidiazuron (0.5 .mu.M thidiazuron). Adding 7.0 .mu.M of
gibberellic acid into a medium containing 0.5 .mu.M thidiazuron
slightly increased shoot growth. Stem and leaf segments from
seedlings and tissue culture of four Cannabis varieties were placed
on Murashige and Skoog medium with Gamborg B5 vitamins (MB)
supplemented with different combination of plant growth regulators
and 3% sucrose, and 8 g 121 agar. Large masses of callus were
produced within 4 weeks for all cultivars. Transformation with
Agrobacterium tumefaciens strain EHA105 harboring the vector pME
504 carrying the nptII and the uidA-intron genes for Cannabis
callus, hypocotyls, leaves and cotyledons were established.
Material and Methods
[0480] Regeneration Using Premium Treatment
[0481] Regeneration from Cannabis plant material using tissue
culture, germinated leaves, cotyledons and hypocotyls were used for
regeneration. The plants were placed on a petri dish containing 20
ml regeneration media using premium treatment with cuticle nicking
enzymes: MS salt mixture, supplemented with 100 mg/l myo-inositol,
1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7) with and without 5
ml pectic enzymes reaction mixture (0.25 ml 10% enzyme fungal mix
of pectin and cutinase 0.25 ml 200 mM Tris-HCl).
[0482] Regeneration from Leaves
[0483] Three youngest expanding leaves isolated from 3 to 4 weeks
old plants were with and placed on regeneration medium with cuticle
nicking enzymes (Murashige and Skoog (MS) medium salt mixture,
containing 0.05-5.0 .mu.M thidiazuron, supplemented with 100 mg/l
myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7, with
5 ml pectic enzymes reaction mixture (0.25 ml 10% cuticle nicking
enzyme in 0.25 ml 200 mM Tris-HCl). The cultures were kept for 7
days in low light intensity (2.5 mmol/m2 s) followed by exposure to
high light intensity (40 mmol/m2 s) at 25.degree. C., in a 16/8 h
photoperiod. Leaf explants were examined after 14 and 21 days and
the percentage of explant producing shoots were calculated.
[0484] Regeneration from Cotyledon
[0485] Seeds were washed under abundant water flow for 2 h, and
then washed in ethanol 70% for 10 secs prior to 20 min wash in 1.5%
NaClO with 0.1% Tween 20. Seeds washed 4 times in distilled water
and set onto a sterile growth medium (1/2MS, 2% Sucrose, 0.8%
agar). Seeds were germinated in the dark for 2 days and were then
transferred to light. Two weeks later, cotyledon from large
seedlings that contained two true leaves were cut and placed on
regeneration medium with cuticle nicking enzymes (Murashige and
Skoog (MS) medium salt mixture, containing 0.05-5.0 .mu.M
thidiazuron, supplemented with 100 mg/l myo-inositol, 1 mg/l
thiamine-HCl, 2% sucrose (w/v) at pH 5.7, with 5 ml pectic enzymes
reaction mixture (0.25 ml 10% enzyme, 0.25 ml 200 mM Tris-HCl). The
cultures were kept in high light intensity (40 mmol/m2 s) at
25.degree. C., in a 16/8 h photoperiod.
[0486] Regeneration from Callus
[0487] 21 days old tissue culture were placed on PR12 solid media
(MS, 2% sucrose, 2 mg/l BA, 1 mg/l GA3, 0.8 sigma agar, pH 5.8) to
encourage the creation of callus. Two weeks later, calli were
replaced on regeneration medium with cuticle nicking enzymes
(Murashige and Skoog (MS) medium salt mixture, containing 0.05-5.0
.mu.M thidiazuron, supplemented with 100 mg/l myo-inositol, 1 mg/l
thiamine-HCl, 2% sucrose (w/v) at pH 5.7, with 5 ml pectic enzymes
reaction mixture (0.25 ml 10% enzyme, 0.25 ml 200 mM Tris-HCl). The
cultures were kept in high light intensity (40 mmol/m2 s) at 25 8
C, in a 16/8 h photoperiod.
[0488] Agrobacterium tumefaciens Strain and Plasmid
[0489] The super-virulent Agrobacterium tumefaciens strain EHA 105
harboring the vector pME 504 carrying the nptII and the uidA-intron
genes was used. An Agrobacterium culture was grown overnight in LB
medium with appropriate antibiotics. Bacteria were spun down by
centrifugation (4000 rpm for 15 min), resuspended in liquid SIM
medium supplemented with 100 .mu.M Acetosyringone (AS) to obtain a
final OD600 of 0.7, and incubated in an orbital shaker at
28.degree. C. and 250 rpm for 4 h.
[0490] Cannabis Transformation
[0491] Leaves of 3-4 weeks old micropropagated shoots were wounded
and immersed in the bacterial suspension for 20 min, dry-blotted on
a filter paper and cultured on regeneration medium using the
premium treatment with sublethal cuticle nicking enzymes based on
MS salt mixture, supplemented with 2.0 mg/l TDZ and 2 mg/l IBA, 100
mg/l myo-inositol, 1 mg/l thiamine-HCl, 2% sucrose (w/v) at pH 5.7)
whit 5 ml pectic enzymes reaction mixture (0.25 ml 10% enzyme, 0.25
ml 200 mM Tris-HCl). Transformation was evaluated by GUS
staining.
[0492] GUS Staining
[0493] Fresh plant material was transferred to a histochemical
reagent (1.1 mM X-Gluc in 100 mM potassium phosphate buffer pH 7.0:
5 mM potassium ferrocyanide, 5 mM potassium ferricyanide and 0.1%
Triton X-100) and incubated for one hour to overnight at 37.degree.
C. After staining, the disks were transferred to 70% ethanol for 1
h to overnight until bleached.
[0494] Molecular Confirmation of Transformation
[0495] To verify the presence and integration of the nptII and GUS
genes, all selected clones were subjected to molecular analyses by
PCR. Plant genomic DNA was isolated from leaves according to
Murray. M. G, and W. Fm Thompson. "Rapid isolation of high
molecular weight plant DNA." Nucleic acids research 8.19 (1980):
4321-4326.
[0496] The oligonucleotide primers used for the PCR amplification
of a 645 bp fragment of the nptII gene were:
TABLE-US-00004 Direct primer (SEQ ID NO: 12) 5'-GCC GCT TGG GTG GAG
AGG CTA T-3' (63.6.degree. C.); Reverse primer (SEQ ID NO: 13)
5'-GAG GAA GCG GTC AGC CCA TTC-3' (60.degree. C.).
The primers for a 676 bp fragment of the GUS gene were:
TABLE-US-00005 GUSup (SEQ ID NO: 14) 5'-CGA GCG ATT TGG TCA TGT GAA
G-3' (57.5.degree. C.); GUSlow primer (SEQ ID NO: 15) 5'-CAT TGT
TTG CCT CCC TGC TGC GGT T-3' (55.9.degree. C.) (Sigma).
[0497] Amplification was performed in aliquots of 25 .mu.l using a
thermal cycler (Biometra). The PCR conditions for amplification of
the nptII gene fragment were 95.degree. C. for 5 min, followed by
35 cycles at 94.degree. C. for 1 min, 62.degree. C. for 1 min,
72.degree. C. for 1 min, and a final extension at 72.degree. C. for
10 min. Amplification of the uidA-intron fragment was performed
according to the following program: 95.degree. C. for 5 min
followed by 35 cycles at 94.degree. C. for 45 s, 55.degree. C. for
45 s, 72.degree. C. for 45 s, and a final extension at 72.degree.
C. for 10 min.
[0498] Results
[0499] The "Regeneration Premium treatment" with cuticle nicking
enzymes increased Cannabis regeneration rate. In preliminary
experiments, about 5 to 10% of the explants exhibited shoot
regeneration when cultured on a regeneration medium supplemented
with hormones.
[0500] In order to increase plant regeneration rate a "regeneration
premium treatment" was added including the addition of cuticle
nicking enzymes to the solid medium. "Regeneration Premium
treatment" increased plant regeneration ten times more compared
with non-treated plants in all the tested cultivars (Table 4).
TABLE-US-00006 TABLE 4 The effect of hormones concentration and
"regeneration premium treatment" on shoot regeneration of several
cannabis lines (% regeneration) Cultivar Cultivar Cultivar Cultivar
Cultivar Cultivar Cultivar Cultivar 201 202 208 209 212 213 106 108
MS 5 3 4 5 8 9 11 22 regeneration medium MS 46 61 55 49 50 57 61 52
regeneration medium + Pectic Enzymes MS 53 66 60 49 55 60 75 70
regeneration medium + Pectic Enzymes + Triton X-100 + s
[0501] The "premium treatment" enhanced cannabis regeneration from
different plant organs: plant cotyledons, callus and leaves (FIG.
4).
[0502] Transformation
[0503] The present study describes the successful transformation of
several cannabis cultivars using the uidA-intron and nptII genes.
An efficient transient transformation of leaves, hypocotyls, callus
and cotyledons of several Cannabis cultivars was observed (FIG. 7
upper panel). Transformation of the selected clones has been
confirmed by GUS histochemical assay and molecular analysis.
Positive PCR was shown in all tested clones (FIG. 7, lower panel).
The transformation was confirmed by GUS staining and PCR. Stable
transformation is tested by subcultures of the plants in selective
conditions of 100 mg 1-1 kanamycin.
Example 3
In Planta Regeneration and Transformation of Cannabis Cultivars
[0504] Alternate methods that avoid/minimize tissue culture would
be beneficial for the development of new transgenic Cannabis
cultivars. Transgenic Cannabis plants have been produced by a
tissue-culture independent Agrobacterium tumefaciens-mediated
transformation procedure. One of the two cotyledons of germinated
Cannabis seedlings was excised. Unique regeneration method using
plant hormones in a nano-encapsulation paste were introduced to the
excised apical meristem of the germinating seedling. Regeneration
of more than 80% of the germinating seedlings was obtained. A
similar regeneration ratio was achieved with adult Cannabis plants
of three different cultivars, suggesting that the nano
encapsulation paste induces efficient regeneration. Agrobacterium
strain EHA 105 harboring the binary vector pME504 that carries the
genes for .beta.-glucuronidase (GUS) and neomycin
phosphotransferase (npt II), or the plasmid carrying the nptII and
betalain genes (Polturak. Guy, et al. "Engineered gray mold
resistance, antioxidant capacity, and pigmentation in
betalain-producing crops and ornamentals." Proceedings of the
National Academy of Sciences (2017): 201707176).
[0505] For in planta transformation, Agrobacterium strain EHA 105
harboring the different binary plasmids was mixed with the
emulsifier paste to enhance attachment to the cut plant surface.
The proof of transformability in the TO generation was indicated by
the GUS histochemical analysis of the seedlings (wounded seedlings
with the single cotyledon) ten days after co-cultivation and was
further confirmed by PCR analysis and typical betalains red leaves
expression. Molecular characterization and GUS and betalains
expression analysis were done using PCR.
[0506] Materials and Methods
[0507] Plant Material
[0508] Seeds--Cannabis Sativa L. seeds (from various cultivars)
were surface sterilized with 1.5% sodium hypo chloric acid followed
by several washes with sterile water. Seeds were germinated on
sterile, wet, filter paper disks until visible root emergence.
[0509] Seedlings--seeds were germinated in solid media (soil,
vermiculite, MS, etc.) until first two true leaves were observed
(between 2-4 true leaves).
[0510] Plants--seeds were allowed to germinate and grow to a size
when at list two nodes were observed.
[0511] "Pre-Regeneration Tissue Preparation"
[0512] One cotyledon and the meristem with its leaves were cut off
from the seedlings at 145.degree., leaving the seedling with only
one cotyledon. Plants were allowed to grow until at least 2 nodes
were apparent, then the shoot was cut off from lowest leaf at
145.degree., leaving the plant with only one leaf.
[0513] "Regeneration Paste"
[0514] Several hormonal combinations sets were made and applied to
cut seedlings and cut plants by spraying or by ALGANATE.TM.
nanoemulsion paste prepared according to Pereira et al., 2017
(Colloids and surfaces B: Biointerfaces 150:141-152); different
cytokinins and auxin hormones combinations in various
concentrations were mixed with nanoemulsion (usually 3:4 v/v) to
create a "regeneration paste". The paste was spread on the wounded
cuttings
[0515] Imaging for the Detection of in Planta Regeneration
[0516] Scanning Electron Microscopy
[0517] Scanning Electron Microscopy was done with a Hitachi
TM-3030Plus microscope. Imaging was done under low vacuum
conditions without any sample preparation.
[0518] Histology
[0519] The tissue was fixed in 10% Formalin, 5% acetic acid and 50%
alcohol (FAA) for 24 h, followed by gradual dehydration in a set of
increasing concentrations of ethanol, which was replaced by
Histo-Clear and embedded in paraffin. The embedded tissue was cut
to 10 .mu.m sections using a Lecica RM2245 microtome and stained
with Safranin/Fast Green. Samples were viewed using light
microscope (DMLB, Leica) or stereoscope (MZFLIII, Leica).
[0520] Agrobacterium tumefaciens Strain and Plasmid
[0521] Super-virulent A. tumefaciens strain EHA105 harboring the
vector pME 504 carrying the uidA-intron reporter gene and the nptII
resistant genes or the vector pX11 carrying the nptII and betalain
genes were used. See also Poluraka et al. PNAS Aug. 22, 2017. 114
(34) 9062-9067;
[0522] Bacteria were spun down by centrifugation (8000 g for 10
min). Bacteria were re-suspended in a transformation buffer (1 MS,
5.86 g/l MES, 1% sucrose, pH 7.0) with 100 mg/l acetosyringone, to
obtain a final OD600 of 0.6, and incubated in an orbital shaker at
28.degree. C. while shaking at 250 rpm for 3 h until plant
infection.
[0523] Plant material (micropropagated shoots from tissue culture,
seedling or seeds) were vacuum infiltrated for 5 min in a vacuum
desiccator. The infiltration followed by co-cultivation with the
agrobacterium for 30 min at R.T, then transferred for further
growth on infection medium.
[0524] Pre-Transformation Tissue Preparation
[0525] Prior to agrobacterium transformation, all tissues were
mechanically treated; seeds were cut, pressed or punched with the
root remaining intact. One cotyledon and the meristem with its
leaves were cut off from the seedlings at 145.degree., leaving the
seedling with only one cotyledon. Plants were allowed to grow until
at least 2 nodes were apparent, then the shoot was cut off from the
lowest leaf at 145.degree., leaving the plant with only one
leaf.
[0526] Agro Mediated Transformation
[0527] Binary plasmids for various genetic modification purposes
were introduced into Agrobacterium tumefaciens. Agrobacterium was
applied to the tissue in different ways; a. dipping, b.
microencapsulation, c. injecting and d. dripping. In any case,
agrobacterium comprising the desired plasmid was grown in the
presence of selective antibiotics which were later replaced by an
activation medium. In case of dipping, treated seeds or seedlings
were co-cultivated with the bacteria for 2 min to several hours.
When microencapsulation was applied, several activating media were
tested: MSO, half MSO, SIM and CT.
[0528] Microencapsulation Transformation
[0529] Agrobacterium was grown and activated as described in
materials and methods, and then it was mixed with lanolin
nano-emulsifier (according to Zhang et al 2014 (Nanotechnology,
25(12), 125101) usually at 3:4 (v/v) ratio. The resultant paste was
spread on the cutting up to 24 h after performance of the cut.
[0530] GUS Staining
[0531] A fresh plant material was transferred to a histochemical
reagent (1.1 mM X-Gluc in 100 mM potassium phosphate buffer pH 7.0:
5 mM potassium ferrocyanide, 5 mM potassium ferricyanide and 0.1%
Triton X-100) and incubated for one hour to overnight at 37.degree.
C. After staining, the disks were transferred to 70% ethanol for 1
h to overnight until bleached.
[0532] Betalains Separation
[0533] For betalains observation, fresh tissue (0.5 g) was ground
in the presence of CTAB buffer (3% CTAB, 28% NaCl, 4% EDTA, 10%
Tris HCl, 3% PVP and 25% water), mixed with chloroform and
centrifuged.
[0534] Results
[0535] In Planta Regeneration Using a Regeneration Paste
[0536] Genetic modifications (i.e. genome editing, gene transfer,
etc.`) require a platform for introducing those modifications into
the plant cells and an efficient method for regenerating the
modified cells only to get a new, modified plant. In many cases,
this could be the bottleneck for establishing an efficient
transformation protocol. Development of an in planta transformation
protocol may eliminate the use of tissue culture.
[0537] Seedlings were germinated in solid media, when first two
leaves were observed (FIGS. 8A-B) the meristem with its leaves and
one of the cotyledons was removed (FIGS. 8A-D). The wounded tissue
was spread with the regeneration paste. The seedlings were left to
grow at 16 h light and after 7 days regeneration from around the
cut area was observed (FIGS. 8E-F). After 7 days regeneration
events were observed and after 12 days seedlings were evaluated for
different events as shown in Table 5 below.
[0538] Young 3-5 weeks old Cannabis plants immerging from cuttings
were left to grow until at list two nodes were observed, then the
stem was cut at the same way the seedlings were, leaving only one
leaf. The wound was spread with the regeneration paste and the
plants were left at 16 h light, allowing the plant to regenerate
(FIG. 9).
TABLE-US-00007 TABLE 5 The effects of different hormones by
spreading the "regeneration paste" on various cannabis strains:
recovery from injury is indicated as recovery percentage.
R(regenerate), M(meristem), C(callus), N(no change). t005 t006 t009
Spreading Spreading Spreading t010 t001 t002 t003 t004 400 mg/l 100
mg/l t007 t008 500 mg/l Spreading Spreading Spreading Spreading
Spreading BAP ZEATIN Spreading Spreading ZEATIN + MS 0222 Treatment
4000 mg/l 2000 mg/l 50 mg/l 50 mg/l 50 mg/l 50 mg/l 1000 mg/l 2000
mg/l 1000 mg/l 2 mg/l TDZ cultivar BAP BAP BAP BAP IBA IBA ZEATIN
ZEATIN IAA 2 mg/l IBA #102 .gtoreq.70% .gtoreq.70% 10% .gtoreq.70%
.gtoreq.70% .gtoreq.70% Not tasted Not tasted Not tasted
.gtoreq.70% Mortality Mortality recovery Mortality Mortality
Mortality Mortality 3% M 97%N #106 Not tasted Not tasted Not tasted
Not tasted 50% 75% Not tasted Not tasted Not tasted 50% recovery
recovery recovery 10% M 45% R 40% R 35% R 15% M 30% M 55% N 30% C
25% C 10% N 5% N #107 Not tasted Not tasted Not tasted Not tasted
50% 50% Not tasted Not tasted Not tasted 25% recovery recovery
recovery 55% R 50% R 100% N 37% C 20% C 8% N 30% N #108 Not tasted
Not tasted Not tasted 72% Not Not tasted 80% 80% 80% Not tasted
recovery tasted recovery recovery recovery 9% R 71% R 30% R 8% R 6%
M 7% M 30% M 28% M 85% N 22% N 40% N 60% C 4% N
In Planta Microencapsulation Agrobacterium Transformation
[0539] In planta Agrobacterium application is complicated due to
poor attachment of the bacteria to the wounding area. For in planta
transformation, Agrobacterium strain EHA 105 harboring the
different binary plasmids were mixed with emulsifier paste to
enhance attachment to the cut plant surface. Agrobacterium was
grown and activated as described in materials and methods, and then
it was mixed with lanolin nano-emulsifier usually at 3:4 (v/v)
ratio. The resultant paste was spread on the cutting up to 24 h
after the wounding. Agrobacterium strain EHA 105 harboring the
binary vector pME504 that carries the genes for
.beta.-glucuronidase (GUS) and neomycin phosphotransferase (npt
II), or the plasmid pX11 carrying the nptII and betalain genes were
used for transformation. The proof of transformability in the TO
generation was indicated by the GUS histochemical analysis of the
seedlings, ten days after co-cultivation and was further confirmed
by PCR analysis and typical betalains red leaf expression (FIGS.
10A-C to 11A-C). Molecular characterization and GUS and betalains
expression analysis were done using PCR (FIGS. 10A-C to 11A-C).
Example 4
Regeneration of Cannabis sativa Via Somatic Embryogenesis
[0540] Materials and Methods
[0541] Leaf segments from tissue culture grown on the solid medium
(1.5 cm diameter and 4-5 cm long) of two Cannabis cultivars (108
and 201) were used. Innermost leaf whorls were cut obliquely
(0.5-1.0 cm), injured with sharp scalpel blade in order to achieve
callus initiation. Leaf segment, were used as explant for
inoculation on MS medium (Murashige and Skoog 1962) supplemented
with 2,4-D (4.0 mg/L) and kinetin [Kin] (0.5 mg/L). After 2-3 weeks
the cultures were incubated at 25.+-.2 C at 70-80% humidity in dark
in liquid Gamborg B5 medium supplemented with 6% sucrose and
different plant hormones (Table 1). The media was refreshed every
three weeks.
[0542] Leaf segments from tissue culture from two different
genotypes (108 and 201) have been used as primary explants. The
explants were chopped to small pieces (as less as 0.5 mm) and
cultivated in liquid Gamborg B5 medium supplemented with 6% sucrose
and different plant hormones (Table 1). The media were refreshed
every three weeks.
[0543] Results
[0544] Cannabis sativa Micropropagation Via Somatic
Embryogenesis--Effect of Cannabidiol (CBD) with CPPU
Microemulsion
[0545] The first globular shaped embryos were observed 4 weeks
after initiation.
[0546] CPPU (at a concentration of 10 mg/1) alone or as a CBD-CPPU
microemulsion was essential for the embryo initiation. Low amounts
of embryos were generated in media with 2iP--3 mg/l CPPU but the
addition of the CBD-CPPU microemulsion dramatically increased
somatic embryogenesis. The embryos were cultivated on gyratory
shaker at dark.
TABLE-US-00008 TABLE 6 Type of the hormones used in Somatic embryo
initiation in cannabis explants: Hormone Concentration [mg/l]
CBD-CPPU 10 CPPU 10 2.4D 2iP 3 Kinetin 2 Zeatin 1 TDZ 2 Picloram
12.5 Dihydric zeatin 2 Kinetin ribosid 2 BAP 1
[0547] The initiated suspension cultures along with embryos in
globular stage (FIGS. 12A-B) were sub-cultured in the same medium
for three weeks. Part of the cultures was transferred to B5 Gamborg
media, supplemented with different hormones/chemicals (Table 2) to
provoke embryo elongation and further development. The cultures
were transferred to fresh media every three weeks.
TABLE-US-00009 TABLE 7 Different supplements were used in hemp
somatic embryo development: Supplements to B5 media Concentration
for E development [mg/l] CPPU 10 CPPU 20 CPPU and 6% sucrose 10
(instead of 3%) CPPU and 6% sucrose 20 (instead of 3%) CBD-CPPU and
6% sucrose 20 (instead of 3%) 2iP 3 TDZ/Piclorame 2/12.5 PEG 4000
1%
[0548] Some of the somatic embryos after the second sub-culture on
B5 media, supplemented with CBD-CPPU and 6% sucrose (instead of 3%)
underwent to torpedo shaped embryos.
[0549] With some of the torpedo shaped embryos, after the third
subculture on B5 media supplemented with CBD-CPPU and 6% sucrose,
plants regeneration occurred in the liquid media (FIGS. 13A-C).
Example 5
Protoplasts Isolation and Transformation in Three Different
Cannabis Cultivars
[0550] Protoplasts were successfully isolated in all tested
Cannabis cultivars. The combination and concentration of the
enzymes, as well as the time for treatment were optimized. Presence
and optionally concentration (0.5 M) of mannitol were important for
protoplast culture. About 4% of the protoplasts survived after 48
hours cultivation in liquid culture. Some of the protoplasts
developed cell wall--less than 1%. Protoplast transformation was
also established.
[0551] Material and Methods
[0552] Protoplast Isolation
[0553] Seeds were sterilized with 1.5% sodium hypochlorite for 20
min, followed by a series of washes with sterile water. Seeds were
left to germinate on sterile MS media and cotyledons were harvested
when emerged. Cotyledons were cut to fine pieces and incubated in a
cell wall degrading solution containing 1.5% cellulose, 0.5%
macerozyme, 0.4% mannitol, 20 mM KCl, 20 mM MES, 10 mM CaCl.sub.2
and 0.1% BSA, placed in vacuum for 10 min and then shaken for 5 h
at 50 rpm. The protoplasts were then filtered through a 100 .mu.m
mesh, diluted with 1 volume of W5 (150 mM NaCl, 125 mM CaCl2, 5 mM
KCl, and 2 mM MES) and pelleted by centrifugation (Room
temperature, 2 min at 300 g). The protoplasts were re-suspended in
W5 solution and incubated for 30 min on ice, before being
centrifuged again and re-suspended in 100 .mu.l of MMg solution
containing, 0.4 M mannitol and 15 mM MgCl2.
[0554] Protoplast Transformation
[0555] Red fluorescent protein (RFP), a visual marker, in plasmid
DNA (5-20 .mu.g) was added to protoplasts and an equal volume of
40% PEG solution (in 0.2 M mannitol and 0.1 M CaCl.sub.2). The
mixture was incubated for 15-30 min. Two volumes of W5 were added
to each sample, centrifuged for 2 min, re-suspended in 1 ml of W5,
and then incubated at room temperature for 16-24 hr.
[0556] Results
[0557] Three different combinations of enzymes (Table 8) were
tested for the ability to isolate protoplasts from three cultivars
of Cannabis sativa (cultivar 1, 2, 3 are 201, 202, 203). Leaf
explants were enzymatically treated either for 4 hours or for 17
hours. Only one of the enzyme's combination--enzyme mix C, was
efficient (FIG. 14). Protoplasts were isolated from all three
tested cultivars. The cultivars were differing in the yield of the
protoplasts (FIG. 14). Maximum protoplasts were harvested from
cannabis cultivar 1 (Protoplast concentration was
2.2.times.10.sup.6/ml). The protocol for protoplasts isolation was
optimized regarding the medium composition--concentrations of
Mannitol, CaCl.sub.2 and PVP pretreatment. The isolated protoplasts
(FIGS. 15A-B) were filtered through a 100 .mu.m mesh, diluted with
1 volume of W5 (150 mM NaCl, 125 mM CaCl2, 5 mM KCl, and 2 mM MES)
and pelleted by centrifugation. Purified protoplasts were
cultivated under dark condition in droplets double layer
(liquid/solid) culture.
TABLE-US-00010 TABLE 8 Combination of enzymes used in hemp
protoplasts A Cellulisine - 4% Driselase - 0.3% B Cellulose Onozuka
R-10 - 2% Hemicellulose - 1% Driselase - 0.3% C Cellulose Onozuka
R-10 - 1.5% Hemicellulose - 1% Macerozyme R-10 - 0.4%
[0558] Protoplast Transformation
[0559] As mentioned above, an efficient cannabis protoplast
isolation protocol was developed using different plant tissues.
FIG. 16 shows protoplast transformation using the RFP gene (Chung,
Sang-Min, Ellen L. Frankman, and Tzvi Tzfira. "A versatile vector
system for multiple gene expression in plants." Trends in plant
science 10.8 (2005): 357-361).).
[0560] This protoplast isolation protocol allowed protoplast
isolation from 10 different cannabis strains that were clonally
propagated in culture.
Example 6
[0561] Cannabis pollen transformation Most of the current
transformation methods require plant regeneration from tissue
culture, involving long and laborious processes. In order to
overcome the constraints of in-vitro tissue culture regeneration,
pollen-mediated transformation methods are considered to be
promising alternatives. Pollen release active DNA to the ovary
during pollination and fertilization. Transgenic seeds can be
directly generated through pollination with exogenous
DNA-transformed pollen. In pollen magnetofection technology,
positively charged, polyethyleneimine-coated Fe.sub.3O.sub.4 MNPs
(Magnetic Nano Particles) are used as DNA carriers for binding and
condensing with electric negative DNA to form MNP-DNA complexes.
Here is shown for the first time positive Cannabis pollen
transformation using the GUS reporter gene, by employing the
magnetofection technology.
[0562] Material and Methods
[0563] Plasmid
[0564] For Cannabis pollen transformation, the binary vector
CsUBQ::GUS was used. The plasmid carries the GUS reporter gene
under the Cannabis Sativa UBQ 10 promoter.
[0565] Pollen
[0566] Pollen collected from four different samples in two
replicates was used:
[0567] 1. Fresh, `malenized` from genotype 213;
[0568] 2. One-month-old, `malenized` from genotype 212;
[0569] 3. Two-month-old, male from genotype 108;
[0570] 4. Two-month-old, `malenized` from genotype 216;
[0571] Samples were tested for viability prior to
transformation.
[0572] Transformation
[0573] 1 ug of plasmid was left to bind with MNP's (MAGBIO, USA)
for 30 min at room temperature, prior to adding the transformation
media: 10 g--40 g Sucrose, H.sub.3BO.sub.3--10.3 mg, KNO.sub.3--2.3
mg, Ca(NO.sub.3).sub.2--10.3 mg, MnSO.sub.4--10.3 mg, MgSO.sub.4
7H2O--10.3 mg, GA.sub.3--3 mg, H.sub.2O up to 100 ml.
[0574] Pollen (1-10 million grains) added to the Media containing
bound MNP's--plasmid and left on a magnet (Chemicell) for 30 min at
room temp and dried in 30.degree. C. for 30 min.
[0575] Results
[0576] Cannabis pollen characteristics and imaging. Cannabis is
wind pollinated and therefore, its pollen grain diameter is about
25 um and there are about half million grains per 1 mg of pollen
(data not shown). Cannabis pollen was examined under light
microscope in the presence of Safranine 0 (FIG. 17A) and it clearly
shows apertures where the pollen wall is absent or reduced Pollen
viability was confirmed by incubating pollen grains on germination
media and after 18 h pollen tubes were observed (FIG. 17B).
[0577] Exogenous Gene Expression in Cannabis Pollen
[0578] In order to test whether exogenous genes can be expressed in
pollen, a reporter gene in CsUBQ::GUS plasmid was transformed into
cannabis pollen using the MNPs. If the GUS gene is successfully
transformed, the GUS protein (.beta.-Glucuronidase) will be
expressed, which can then be stained blue by X-gluc solution.
Optical microscopy showed that pollen grains were stained blue by
X-gluc, suggesting that MNP-DNA complexes did not inhibit
transformation function and that the GUS gene was indeed
successfully transformed and expressed (FIG. 17C).
Example 7
Identification and Isolation of the CsBBM and CsSERK1 Genes
[0579] In order to identify the homologous genes of the BBM and
SERK1 genes in Cannabis, blast analysis was performed using the
Arabidopsis BBM and SERK1 genes (SEQ ID NOs: 3 and 7) as a bait.
The sequences of the genes that show the highest homology to these
genes are shown in FIG. 18. To isolate the CsBBM and CsSERK1 genes,
total RNA was extracted from Cannabis calli, followed by cDNA
synthesis. Then, candidate genes were isolated from cDNA generated
out of RNA from regenerating Cannabis callus using the primers 5'
ATGAGTATTATTACTAATGATAGTAATCTCAG3' (SEQ ID NO: 16) and
TTATTCCATGCCGAATATTGGTGTT3' (SEQ ID NO: 17) for CsBBM, and 5'
ATGGAAGGTGATGCCTTGCATAGTC3 (SEQ ID NO: 18) and
5'TTACCITCGGACCAGATAACTCGACC3' (SEQ ID NO: 19) for CsSERK1.
[0580] These cDNA were amplified using specific primers for the
CsBBM and CsSERK1 genes and cloned into pCAMBIA binary vectors
under the control of a constitutive 35S promoter and fused to an
expression cassette of the CAS9 gene, under the control of the
CsUBIQUITIN10 promoter (SEQ ID NO: 11, FIG. 19).
[0581] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims.
[0582] All publications, patents and patent applications mentioned
in this specification are herein incorporated in their entirety by
reference into the specification, to the same extent as if each
individual publication, patent or patent application was
specifically and individually indicated to be incorporated herein
by reference. In addition, citation or identification of any
reference in this application shall not be construed as an
admission that such reference is available as prior art to the
present invention. To the extent that section headings are used,
they should not be construed as necessarily limiting.
[0583] In addition, any priority document(s) of this application
is/are hereby incorporated herein by reference in its/their
entirety.
Sequence CWU 1
1
1912292DNACannabis sativa 1gtttgggttt ggggttgggg taggaatttt
ttgtgatgtt gtgtttgggt gtggcatacc 60atttggatct aaggtttttg gttacttaga
ctaaaatagc aagggaggaa atatggaaag 120gaagaagctt tggtggtctt
cattttgcct ttggttgatt ttggtagttc atcctttatg 180ggtgattatg
gtatctgcta atatggaagg tgatgccttg catagtctga ggtccaattt
240acaggatccc aacaatgttc tgcagagttg ggatcccacc cttgtaaacc
cgtgtacatg 300gtttcatgtc acttgcaaca atgataatag tgtgataagg
gttgatcttg gaaatgcagc 360tttgtctggt caacttgttc cacagcttgg
ccttctcaag aatttacaat atttggaact 420ttacagtaat aacattagtg
gaacaattcc tagtgatttg gggaatttga ccagcttggt 480tagcttggat
ctgtatttga atagttttac tggtcctatc ccggacacct tgggcaagtt
540gtcaaaatta agatttcttc ggcttaacaa caatagtctg acgggtccaa
ttcctatgtc 600gttgaccaac atcacctcac tgcaagtgct ggatctgtca
aataacaaat taaccggaga 660ggttccagac aatggctcgt tttctttatt
cactcccatc agttttgcta ataacttaaa 720tctatgtggc ccggttactg
gacgaccctg cccaggatcc cccccatttt cacctcctcc 780tccttttgtc
ccaccacccc caatttcagt cccaggtgga aatagtgcga ctggggctat
840tgctggtgga gttgctgctg gtgctgcttt attatttgct gctcctgcta
ttgcatttgc 900ttggtggcgt cgaaggaagc cacaagaatt tttctttgat
gtacccgctg aggaggatcc 960tgaagttcat cttgggcagc ttaaaaggtt
ttcgttgcga gaattacaag tggcaactga 1020tagttttagc aacaaaaaca
ttctgggacg gggtggattt ggtaaggtct acaaaggtcg 1080ccttgcagat
ggttctttgg ttgctgtaaa gagactgaaa gaagagcgta cacctggtgg
1140cgagttgcag tttcaaacag aagtagagat gatcagtatg gctgtgcatc
ggaatcttct 1200tcgattacgt gggttctgta tgacaccaac tgaacgatta
cttgtttatc cttatatggc 1260taatgggagt gttgcctcat gcttaagaga
acggccgcca caccaactgc ctcttgattg 1320gcctactagg aaacgaatag
cattgggttc tgcaaggggt ctttcgtatt tgcatgatca 1380ttgcgatcca
aaaattattc atcgtgatgt gaaagctgct aatattttgt tggatgagga
1440gtttgaagca gttgttggag atttcggttt ggctaaactt atggactaca
aggacactca 1500tgttactaca gctgtacgag gcacaatcgg gcatattgct
ccagagtacc tctctaccgg 1560gaagtcttct gagaaaaccg atgtgtttgg
ctatggaatc atgcttttgg aattaattac 1620tggacagaga gcttttgatc
ttgctcggct tgcaaatgat gatgatgtca tgttgctcga 1680ctgggtgaaa
ggactactga aagagaagaa gttggaaatg ctggtggacc ccgatcttca
1740aaagaactac atagaatccg aagtagagca gcttattcag gttgcactgc
tctgcacaca 1800aggttctccc atggaccgac caaagatgtc agaggtggtg
agaatgctcg aaggcgatgg 1860cttggccgag agatgggatg aatggcaaaa
agtggaagta ctacgacaag aagtcgaact 1920agcccctcat ccaaactcag
actggatagt agactcaacc gaaaacttgc atgcggtcga 1980gttatctggt
ccgaggtaac cctggcacaa tagaaagtgg aagaaaaagg gaatttactt
2040acaacttaat tttttttaat taattataat agcttttttt tcttcttctt
aatgaccata 2100atctgattaa tgtctctttg taagtccatt ctgcattgta
ttcgttacat ttgtgcatat 2160gagagtcgca ttggtaaggt gcaaatttgt
attgtctgct gcagtgtgac aaaagccata 2220gatgttttta taatatatga
agctgtggca gtttttatct tttgttcact gcagcagaca 2280atacaaattt gc
229221661DNACannabis sativa 2aataataata ataataatat tatgagtatt
attactaatg atagtaatct cagttgccag 60ctggaagcgc cgccgtctgc ggtggctccg
gtgtcgtcta agaagaccgt tgacactttt 120ggtcaacgta cctctatata
ccgtggtgtt actcgacata gatggactgg tagatatgaa 180gctcatttgt
gggacaacag ttgccgaaga gaaggccaga gtagaaaagg gcgacaagtt
240tatttgggtg gatatgataa agaagaaaag gcagcaagag cttatgattt
ggctgccctt 300aagtactggg gtcctaccac cactacaaat tttgcagtgt
ctaattacga aaaagaatta 360gaagatatga cgaacatgac taggcaagaa
ttcgttgctt cacttcgaag gaaaagtagt 420ggattttcta gaggagcttc
aatatacaga ggcgtcacaa ggcaccacca acatggtcga 480tggcaggcaa
gaattggaag agtagcagga aacaaagatc tctaccttgg cacctttagc
540acacaagaag aagcagccga ggcatacgac atcgcggcga taaaattccg
aggcctaaac 600gccgtaacaa acttcgacat gagccgttac gacgttaaaa
gcatagccaa ctctaatctc 660cccgttggag gaatgtcaaa caacaccaaa
ctttccaaaa cctcacccga acgggcgatt 720gacaacctat catcgcccgc
ttcatcatcc ctcgtcgcct tctcctcctc ggccaccacc 780aacaacaaca
acacaacacc ccaacaacaa caacaacaac aaatgtcctc caatctaagc
840tttactcttc ccatcaaaca agacctaaca acaacgacaa catcgtcaac
ggattattgg 900tcaaacattt tcggtttcca aaaccctaac cctagtagta
ctactagtac tactccttcc 960ttattgttgg gccataatag tcacaacctc
tcggccacat caactaatgc aacaacaact 1020acaacaacaa caagtaatgg
agggtattat ggtaatttca tcgagtcaat ttctaataat 1080aataataata
atactaactt gggttatgga tcaggattaa gtagctggat tagtaatagt
1140aatcataata ttaacggagg gagtagtaat agtagtaatg ttcataatca
tcttcatcat 1200catcatcatc atgaagttgt tcatgcgaaa caacctagtc
tttttcaaac accaatattc 1260ggcatggaat aataatgatg atgatttttc
tcgcacactt gttggaaaac tactggcacg 1320tgggaatctg tggtgtttga
atttgcatgg aaaagggagc tagggttgtt gttgttgtta 1380ttgtaataat
aataataata tggtggaaac tgacaatatt catcataata ttatttttca
1440tgagagatga gaatgtagta gtgaaatagc tagtactaac tgaagttggg
ttcttttagg 1500gaccatgttt ttactttttt attatatttt ttgctttttc
tttttccttt agtttcatta 1560ctagatctac tgacattatt attattctag
gtgttaagga aaggaatcct ttttgtaatc 1620cttagttttt ttcatatata
ttatataaat gcaccttctt c 16613522PRTArabidopsis thaliana 3Met Asn
Gln Thr Gln Arg Trp Gly Ser Leu Cys Phe Leu Ser Ile Asp1 5 10 15Trp
Asp Ile Asn Gly Gly Ala Cys Asn Asn Ile Asn Asn Asn Glu Gln 20 25
30Asn Gly Pro Lys Leu Glu Asn Phe Leu Gly Arg Thr Thr Thr Ile Tyr
35 40 45Asn Thr Asn Glu Thr Val Val Asp Gly Asn Gly Asp Cys Gly Gly
Gly 50 55 60Asp Gly Gly Gly Gly Gly Ser Leu Gly Leu Ser Met Ile Lys
Thr Trp65 70 75 80Leu Ser Asn His Ser Val Ala Asn Ala Asn His Gln
Asp Asn Gly Asn 85 90 95Gly Ala Arg Gly Leu Ser Leu Ser Met Asn Ser
Ser Thr Ser Asp Ser 100 105 110Asn Asn Tyr Asn Asn Asn Asp Asp Val
Val Gln Glu Lys Thr Ile Val 115 120 125Asp Val Val Glu Thr Thr Pro
Lys Lys Thr Ile Glu Ser Phe Gly Gln 130 135 140Arg Thr Ser Ile Tyr
Arg Gly Val Thr Arg His Arg Trp Thr Gly Arg145 150 155 160Tyr Glu
Ala His Leu Trp Asp Asn Ser Cys Lys Arg Glu Gly Gln Thr 165 170
175Arg Lys Gly Arg Gln Val Tyr Leu Gly Gly Tyr Asp Lys Glu Glu Lys
180 185 190Ala Ala Arg Ala Tyr Asp Leu Ala Ala Leu Lys Tyr Trp Gly
Thr Thr 195 200 205Thr Thr Thr Asn Phe Pro Leu Ser Glu Tyr Glu Lys
Glu Val Glu Glu 210 215 220Met Lys His Met Thr Arg Gln Glu Tyr Val
Ala Ser Leu Arg Arg Lys225 230 235 240Ser Ser Gly Phe Ser Arg Gly
Ala Ser Ile Tyr Arg Gly Val Thr Arg 245 250 255His His Gln His Gly
Arg Trp Gln Ala Arg Ile Gly Arg Val Ala Gly 260 265 270Asn Lys Asp
Leu Tyr Leu Gly Thr Phe Gly Thr Gln Glu Glu Ala Ala 275 280 285Glu
Ala Tyr Asp Ile Ala Ala Ile Lys Phe Arg Gly Leu Ser Ala Val 290 295
300Thr Asn Phe Asp Met Asn Arg Tyr Asn Val Lys Ala Ile Leu Glu
Ser305 310 315 320Pro Ser Leu Pro Ile Gly Ser Ser Ala Lys Arg Leu
Lys Asp Val Asn 325 330 335Asn Pro Val Pro Ala Met Met Ile Ser Asn
Asn Val Ser Glu Ser Ala 340 345 350Asn Asn Val Ser Gly Trp Gln Asn
Thr Ala Phe Gln His His Gln Gly 355 360 365Met Asp Leu Ser Leu Leu
Gln Gln Gln Gln Glu Arg Tyr Val Gly Tyr 370 375 380Tyr Asn Gly Gly
Asn Leu Ser Thr Glu Ser Thr Arg Val Cys Phe Lys385 390 395 400Gln
Glu Glu Glu Gln Gln His Phe Leu Arg Asn Ser Pro Ser His Met 405 410
415Thr Asn Val Asp His His Ser Ser Thr Ser Asp Asp Ser Val Thr Val
420 425 430Cys Gly Asn Val Val Ser Tyr Gly Gly Tyr Gln Gly Phe Ala
Ile Pro 435 440 445Val Gly Thr Ser Val Asn Tyr Asp Pro Phe Thr Ala
Ala Glu Ile Ala 450 455 460Tyr Asn Ala Arg Asn His Tyr Tyr Tyr Ala
Gln His Gln Gln Gln Gln465 470 475 480Gln Ile Gln Gln Ser Pro Gly
Gly Asp Phe Pro Val Ala Ile Ser Asn 485 490 495Asn His Ser Ser Asn
Met Tyr Phe His Gly Glu Gly Gly Gly Glu Gly 500 505 510Ala Pro Thr
Phe Ser Val Trp Asn Asp Thr 515 5204579PRTBrassica napus 4Met Asn
Asn Asn Trp Leu Gly Phe Ser Leu Ser Pro Tyr Glu Gln Asn1 5 10 15His
His Arg Lys Asp Val Tyr Ser Ser Thr Thr Thr Thr Val Val Asp 20 25
30Val Ala Gly Glu Tyr Cys Tyr Asp Pro Thr Ala Ala Ser Asp Glu Ser
35 40 45Ser Ala Ile Gln Thr Ser Phe Pro Ser Pro Phe Gly Val Val Val
Asp 50 55 60Ala Phe Thr Arg Asp Asn Asn Ser His Ser Arg Asp Trp Asp
Ile Asn65 70 75 80Gly Cys Ala Cys Asn Asn Ile His Asn Asp Glu Gln
Asp Gly Pro Lys 85 90 95Leu Glu Asn Phe Leu Gly Arg Thr Thr Thr Ile
Tyr Asn Thr Asn Glu 100 105 110Asn Val Gly Asp Gly Ser Gly Ser Gly
Cys Tyr Gly Gly Gly Asp Gly 115 120 125Gly Gly Gly Ser Leu Gly Leu
Ser Met Ile Lys Thr Trp Leu Arg Asn 130 135 140Gln Pro Val Asp Asn
Val Asp Asn Gln Glu Asn Gly Asn Ala Ala Lys145 150 155 160Gly Leu
Ser Leu Ser Met Asn Ser Ser Thr Ser Cys Asp Asn Asn Asn 165 170
175Asp Ser Asn Asn Asn Val Val Ala Gln Gly Lys Thr Ile Asp Asp Ser
180 185 190Val Glu Ala Thr Pro Lys Lys Thr Ile Glu Ser Phe Gly Gln
Arg Thr 195 200 205Ser Ile Tyr Arg Gly Val Thr Arg His Arg Trp Thr
Gly Arg Tyr Glu 210 215 220Ala His Leu Trp Asp Asn Ser Cys Lys Arg
Glu Gly Gln Thr Arg Lys225 230 235 240Gly Arg Gln Val Tyr Leu Gly
Gly Tyr Asp Lys Glu Glu Lys Ala Ala 245 250 255Arg Ala Tyr Asp Leu
Ala Ala Leu Lys Tyr Trp Gly Thr Thr Thr Thr 260 265 270Thr Asn Phe
Pro Met Ser Glu Tyr Glu Lys Glu Val Glu Glu Met Lys 275 280 285His
Met Thr Arg Gln Glu Tyr Val Ala Ser Leu Arg Arg Lys Ser Ser 290 295
300Gly Phe Ser Arg Gly Ala Ser Ile Tyr Arg Gly Val Thr Arg His
His305 310 315 320Gln His Gly Arg Trp Gln Ala Arg Ile Gly Arg Val
Ala Gly Asn Lys 325 330 335Asp Leu Tyr Leu Gly Thr Phe Gly Thr Gln
Glu Glu Ala Ala Glu Ala 340 345 350Tyr Asp Ile Ala Ala Ile Lys Phe
Arg Gly Leu Thr Ala Val Thr Asn 355 360 365Phe Asp Met Asn Arg Tyr
Asn Val Lys Ala Ile Leu Glu Ser Pro Ser 370 375 380Leu Pro Ile Gly
Ser Ala Ala Lys Arg Leu Lys Glu Ala Asn Arg Pro385 390 395 400Val
Pro Ser Met Met Met Ile Ser Asn Asn Val Ser Glu Ser Glu Asn 405 410
415Ser Ala Ser Gly Trp Gln Asn Ala Ala Val Gln His His Gln Gly Val
420 425 430Asp Leu Ser Leu Leu His Gln His Gln Glu Arg Tyr Asn Gly
Tyr Tyr 435 440 445Tyr Asn Gly Gly Asn Leu Ser Ser Glu Ser Ala Arg
Ala Cys Phe Lys 450 455 460Gln Glu Asp Asp Gln His His Phe Leu Ser
Asn Thr Gln Ser Leu Met465 470 475 480Thr Asn Ile Asp His Gln Ser
Ser Val Ser Asp Asp Ser Val Thr Val 485 490 495Cys Gly Asn Val Val
Gly Tyr Gly Gly Tyr Gln Gly Phe Ala Ala Pro 500 505 510Val Asn Cys
Asp Ala Tyr Ala Ala Ser Glu Phe Asp Tyr Asn Ala Arg 515 520 525Asn
His Tyr Tyr Phe Ala Gln Gln Gln Gln Thr Gln Gln Ser Pro Gly 530 535
540Gly Asp Phe Pro Ala Ala Met Thr Asn Asn Val Gly Ser Asn Met
Tyr545 550 555 560Tyr His Gly Glu Gly Gly Gly Glu Val Ala Pro Thr
Phe Thr Val Trp 565 570 575Asn Asp Asn5706PRTZea mays 5Met Ala Thr
Val Asn Asn Trp Leu Ala Phe Ser Leu Ser Pro Gln Glu1 5 10 15Leu Pro
Pro Ser Gln Thr Thr Asp Ser Thr Leu Ile Ser Ala Ala Thr 20 25 30Ala
Asp His Val Ser Gly Asp Val Cys Phe Asn Ile Pro Gln Asp Trp 35 40
45Ser Met Arg Gly Ser Glu Leu Ser Ala Leu Val Ala Glu Pro Lys Leu
50 55 60Glu Asp Phe Leu Gly Gly Ile Ser Phe Ser Glu Gln His His Lys
Ser65 70 75 80Asn Cys Asn Leu Ile Pro Ser Thr Ser Ser Thr Val Cys
Tyr Ala Ser 85 90 95Ser Ala Ala Ser Thr Gly Tyr His His Gln Leu Tyr
Gln Pro Thr Ser 100 105 110Ser Ala Leu His Phe Ala Asp Ser Val Met
Val Ala Ser Ser Ala Gly 115 120 125Val His Asp Gly Gly Ser Met Leu
Ser Ala Ala Ala Ala Asn Gly Val 130 135 140Ala Gly Ala Ala Ser Ala
Asn Gly Gly Gly Ile Gly Leu Ser Met Ile145 150 155 160Lys Asn Trp
Leu Arg Ser Gln Pro Ala Pro Met Gln Pro Arg Ala Ala 165 170 175Ala
Ala Glu Gly Ala Gln Gly Leu Ser Leu Ser Met Asn Met Ala Gly 180 185
190Thr Thr Gln Gly Ala Ala Gly Met Pro Leu Leu Ala Gly Glu Arg Ala
195 200 205Arg Ala Pro Glu Ser Val Ser Thr Ser Ala Gln Gly Gly Ala
Val Val 210 215 220Val Thr Ala Pro Lys Glu Asp Ser Gly Gly Ser Gly
Val Ala Gly Ala225 230 235 240Leu Val Ala Val Ser Thr Asp Thr Gly
Gly Ser Gly Gly Ala Ser Ala 245 250 255Asp Asn Thr Ala Arg Lys Thr
Val Asp Thr Phe Gly Gln Arg Thr Ser 260 265 270Ile Tyr Arg Gly Val
Thr Arg His Arg Trp Thr Gly Arg Tyr Glu Ala 275 280 285His Leu Trp
Asp Asn Ser Cys Arg Arg Glu Gly Gln Thr Arg Lys Gly 290 295 300Arg
Gln Gly Gly Tyr Asp Lys Glu Glu Lys Ala Ala Arg Ala Tyr Asp305 310
315 320Leu Ala Ala Leu Lys Tyr Trp Gly Ala Thr Thr Thr Thr Asn Phe
Pro 325 330 335Val Ser Asn Tyr Glu Lys Glu Leu Glu Asp Met Lys His
Met Thr Arg 340 345 350Gln Glu Phe Val Ala Ser Leu Arg Arg Lys Ser
Ser Gly Phe Ser Arg 355 360 365Gly Ala Ser Ile Tyr Arg Gly Val Thr
Arg His His Gln His Gly Arg 370 375 380Trp Gln Ala Arg Ile Gly Arg
Val Ala Gly Asn Lys Asp Leu Tyr Leu385 390 395 400Gly Thr Phe Ser
Thr Gln Glu Glu Ala Ala Glu Ala Tyr Asp Ile Ala 405 410 415Ala Ile
Lys Phe Arg Gly Leu Asn Ala Val Thr Asn Phe Asp Met Ser 420 425
430Arg Tyr Asp Val Lys Ser Ile Leu Asp Ser Ser Ala Leu Pro Ile Gly
435 440 445Ser Ala Ala Lys Arg Leu Lys Glu Ala Glu Ala Ala Ala Ser
Ala Gln 450 455 460His His His Ala Gly Val Val Ser Tyr Asp Val Gly
Arg Ile Ala Ser465 470 475 480Gln Leu Gly Asp Gly Gly Ala Leu Ala
Ala Ala Tyr Gly Ala His Tyr 485 490 495His Gly Ala Ala Trp Pro Thr
Ile Ala Phe Gln Pro Gly Ala Ala Thr 500 505 510Thr Gly Leu Tyr His
Pro Tyr Ala Gln Gln Pro Met Arg Gly Gly Gly 515 520 525Trp Cys Lys
Gln Glu Gln Asp His Ala Val Ile Ala Ala Ala His Ser 530 535 540Leu
Gln Asp Leu His His Leu Asn Leu Gly Ala Ala Gly Ala His Asp545 550
555 560Phe Phe Ser Ala Gly Gln Gln Ala Ala Ala Ala Ala Ala Met His
Gly 565 570 575Leu Ala Ser Ile Asp Ser Ala Ser Leu Glu His Ser Thr
Gly Ser Asn 580 585 590Ser Val Val Tyr Asn Gly Gly Val Gly Asp Ser
Asn Gly Ala Ser Ala 595 600 605Val Gly Ser Gly Gly Gly Tyr Met Met
Pro Met Ser Ala Ala Gly Ala 610 615 620Thr Thr Thr Ser Ala Met Val
Ser His Glu Gln Met His Ala Arg Ala625 630 635 640Tyr Asp Glu Ala
Lys Gln Ala Ala Gln Met Gly Tyr Glu Ser Tyr Leu 645 650 655Val Asn
Ala Glu Asn Asn Gly Gly Gly Arg Met Ser Ala Trp Gly Thr 660 665
670Val Val Ser Ala Ala Ala Ala Ala Ala Ala Ser Ser Asn Asp Asn Ile
675 680 685Ala Ala Asp Val Gly His Gly Gly Ala Gln Leu Phe Ser Val
Trp Asn 690
695 700Asp Thr7056416PRTCannabis sativa 6Met Ser Ile Ile Thr Asn
Asp Ser Asn Leu Ser Cys Gln Leu Glu Ala1 5 10 15Pro Pro Ser Ala Val
Ala Pro Val Ser Ser Lys Lys Thr Val Asp Thr 20 25 30Phe Gly Gln Arg
Thr Ser Ile Tyr Arg Gly Val Thr Arg His Arg Trp 35 40 45Thr Gly Arg
Tyr Glu Ala His Leu Trp Asp Asn Ser Cys Arg Arg Glu 50 55 60Gly Gln
Ser Arg Lys Gly Arg Gln Val Tyr Leu Gly Gly Tyr Asp Lys65 70 75
80Glu Glu Lys Ala Ala Arg Ala Tyr Asp Leu Ala Ala Leu Lys Tyr Trp
85 90 95Gly Pro Thr Thr Thr Thr Asn Phe Ala Val Ser Asn Tyr Glu Lys
Glu 100 105 110Leu Glu Asp Met Thr Asn Met Thr Arg Gln Glu Phe Val
Ala Ser Leu 115 120 125Arg Arg Lys Ser Ser Gly Phe Ser Arg Gly Ala
Ser Ile Tyr Arg Gly 130 135 140Val Thr Arg His His Gln His Gly Arg
Trp Gln Ala Arg Ile Gly Arg145 150 155 160Val Ala Gly Asn Lys Asp
Leu Tyr Leu Gly Thr Phe Ser Thr Gln Glu 165 170 175Glu Ala Ala Glu
Ala Tyr Asp Ile Ala Ala Ile Lys Phe Arg Gly Leu 180 185 190Asn Ala
Val Thr Asn Phe Asp Met Ser Arg Tyr Asp Val Lys Ser Ile 195 200
205Ala Asn Ser Asn Leu Pro Val Gly Gly Met Ser Asn Asn Thr Lys Leu
210 215 220Ser Lys Thr Ser Pro Glu Arg Ala Ile Asp Asn Leu Ser Ser
Pro Ala225 230 235 240Ser Ser Ser Leu Val Ala Phe Ser Ser Ser Ala
Thr Thr Asn Asn Asn 245 250 255Asn Thr Thr Pro Gln Gln Gln Gln Gln
Gln Gln Met Ser Ser Asn Leu 260 265 270Ser Phe Thr Leu Pro Ile Lys
Gln Asp Leu Thr Thr Thr Thr Thr Ser 275 280 285Ser Thr Asp Tyr Trp
Ser Asn Ile Phe Gly Phe Gln Asn Pro Asn Pro 290 295 300Ser Ser Thr
Thr Ser Thr Thr Pro Ser Leu Leu Leu Gly His Asn Ser305 310 315
320His Asn Leu Ser Ala Thr Ser Thr Asn Ala Thr Thr Thr Thr Thr Thr
325 330 335Thr Ser Asn Gly Gly Tyr Tyr Gly Asn Phe Ile Glu Ser Ile
Ser Asn 340 345 350Asn Asn Asn Asn Asn Thr Asn Leu Gly Tyr Gly Ser
Gly Leu Ser Ser 355 360 365Trp Ile Ser Asn Ser Asn His Asn Ile Asn
Gly Gly Ser Ser Asn Ser 370 375 380Ser Asn Val His Asn His Leu His
His His His His His Glu Val Val385 390 395 400His Ala Lys Gln Pro
Ser Leu Phe Gln Thr Pro Ile Phe Gly Met Glu 405 410
4157625PRTArabidopsis thaliana 7Met Glu Ser Ser Tyr Val Val Phe Ile
Leu Leu Ser Leu Ile Leu Leu1 5 10 15Pro Asn His Ser Leu Trp Leu Ala
Ser Ala Asn Leu Glu Gly Asp Ala 20 25 30Leu His Thr Leu Arg Val Thr
Leu Val Asp Pro Asn Asn Val Leu Gln 35 40 45Ser Trp Asp Pro Thr Leu
Val Asn Pro Cys Thr Trp Phe His Val Thr 50 55 60Cys Asn Asn Glu Asn
Ser Val Ile Arg Val Asp Leu Gly Asn Ala Glu65 70 75 80Leu Ser Gly
His Leu Val Pro Glu Leu Gly Val Leu Lys Asn Leu Gln 85 90 95Tyr Leu
Glu Leu Tyr Ser Asn Asn Ile Thr Gly Pro Ile Pro Ser Asn 100 105
110Leu Gly Asn Leu Thr Asn Leu Val Ser Leu Asp Leu Tyr Leu Asn Ser
115 120 125Phe Ser Gly Pro Ile Pro Glu Ser Leu Gly Lys Leu Ser Lys
Leu Arg 130 135 140Phe Leu Arg Leu Asn Asn Asn Ser Leu Thr Gly Ser
Ile Pro Met Ser145 150 155 160Leu Thr Asn Ile Thr Thr Leu Gln Val
Leu Asp Leu Ser Asn Asn Arg 165 170 175Leu Ser Gly Ser Val Pro Asp
Asn Gly Ser Phe Ser Leu Phe Thr Pro 180 185 190Ile Ser Phe Ala Asn
Asn Leu Asp Leu Cys Gly Pro Val Thr Ser His 195 200 205Pro Cys Pro
Gly Ser Pro Pro Phe Ser Pro Pro Pro Pro Phe Ile Gln 210 215 220Pro
Pro Pro Val Ser Thr Pro Ser Gly Tyr Gly Ile Thr Gly Ala Ile225 230
235 240Ala Gly Gly Val Ala Ala Gly Ala Ala Leu Leu Phe Ala Ala Pro
Ala 245 250 255Ile Ala Phe Ala Trp Trp Arg Arg Arg Lys Pro Leu Asp
Ile Phe Phe 260 265 270Asp Val Pro Ala Glu Glu Asp Pro Glu Val His
Leu Gly Gln Leu Lys 275 280 285Arg Phe Ser Leu Arg Glu Leu Gln Val
Ala Ser Asp Gly Phe Ser Asn 290 295 300Lys Asn Ile Leu Gly Arg Gly
Gly Phe Gly Lys Val Tyr Lys Gly Arg305 310 315 320Leu Ala Asp Gly
Thr Leu Val Ala Val Lys Arg Leu Lys Glu Glu Arg 325 330 335Thr Pro
Gly Gly Glu Leu Gln Phe Gln Thr Glu Val Glu Met Ile Ser 340 345
350Met Ala Val His Arg Asn Leu Leu Arg Leu Arg Gly Phe Cys Met Thr
355 360 365Pro Thr Glu Arg Leu Leu Val Tyr Pro Tyr Met Ala Asn Gly
Ser Val 370 375 380Ala Ser Cys Leu Arg Glu Arg Pro Pro Ser Gln Pro
Pro Leu Asp Trp385 390 395 400Pro Thr Arg Lys Arg Ile Ala Leu Gly
Ser Ala Arg Gly Leu Ser Tyr 405 410 415Leu His Asp His Cys Asp Pro
Lys Ile Ile His Arg Asp Val Lys Ala 420 425 430Ala Asn Ile Leu Leu
Asp Glu Glu Phe Glu Ala Val Val Gly Asp Phe 435 440 445Gly Leu Ala
Lys Leu Met Asp Tyr Lys Asp Thr His Val Thr Thr Ala 450 455 460Val
Arg Gly Thr Ile Gly His Ile Ala Pro Glu Tyr Leu Ser Thr Gly465 470
475 480Lys Ser Ser Glu Lys Thr Asp Val Phe Gly Tyr Gly Ile Met Leu
Leu 485 490 495Glu Leu Ile Thr Gly Gln Arg Ala Phe Asp Leu Ala Arg
Leu Ala Asn 500 505 510Asp Asp Asp Val Met Leu Leu Asp Trp Val Lys
Gly Leu Leu Lys Glu 515 520 525Lys Lys Leu Glu Met Leu Val Asp Pro
Asp Leu Gln Thr Asn Tyr Glu 530 535 540Glu Arg Glu Leu Glu Gln Val
Ile Gln Val Ala Leu Leu Cys Thr Gln545 550 555 560Gly Ser Pro Met
Glu Arg Pro Lys Met Ser Glu Val Val Arg Met Leu 565 570 575Glu Gly
Asp Gly Leu Ala Glu Lys Trp Asp Glu Trp Gln Lys Val Glu 580 585
590Ile Leu Arg Glu Glu Ile Asp Leu Ser Pro Asn Pro Asn Ser Asp Trp
595 600 605Ile Leu Asp Ser Thr Tyr Asn Leu His Ala Val Glu Leu Ser
Gly Pro 610 615 620Arg6258621PRTBrassica napus 8Met Glu Thr Ile His
Val Ala Phe Ile Leu Leu Ser Leu Ile Leu Leu1 5 10 15Pro Asn His Ala
Ser Ala Asn Leu Glu Gly Asp Ala Leu His Thr Leu 20 25 30Arg Val Thr
Leu Val Asp Pro Asn Asn Val Leu Gln Ser Trp Asp Pro 35 40 45Thr Leu
Val Asn Pro Cys Thr Trp Phe His Val Thr Cys Asn Asn Glu 50 55 60Asn
Ser Val Ile Arg Val Asp Leu Gly Asn Ala Glu Leu Ser Gly His65 70 75
80Leu Val Pro Glu Leu Gly Val Leu Lys Asn Leu Gln Tyr Leu Glu Leu
85 90 95Tyr Ser Asn Asn Ile Thr Gly Pro Ile Pro Ser Asn Leu Gly Asn
Leu 100 105 110Thr Asn Leu Val Ser Leu Asp Leu Tyr Leu Asn Ser Phe
Thr Gly Pro 115 120 125Ile Pro Glu Ser Leu Gly Lys Leu Ser Lys Leu
Arg Phe Leu Arg Leu 130 135 140Asn Asn Asn Thr Leu Thr Gly Ser Ile
Pro Met Ser Leu Thr Asn Ile145 150 155 160Thr Thr Leu Gln Val Leu
Asp Leu Ser Asn Asn Gln Leu Ser Gly Ser 165 170 175Val Pro Asp Asn
Gly Ser Phe Ser Leu Phe Thr Pro Ile Ser Phe Ala 180 185 190Asn Asn
Leu Asp Leu Cys Gly Pro Val Thr Ser His Pro Cys Pro Gly 195 200
205Ser Pro Pro Phe Ser Pro Pro Pro Pro Phe Ile Pro Pro Pro Pro Val
210 215 220Ser Thr Pro Ser Gly Tyr Gly Ile Thr Gly Ala Ile Ala Gly
Gly Val225 230 235 240Ala Ala Gly Ala Ala Leu Leu Phe Ala Ala Pro
Ala Ile Ala Phe Ala 245 250 255Trp Trp Arg Arg Arg Lys Pro His Asp
Ile Phe Phe Asp Val Pro Ala 260 265 270Glu Glu Asp Pro Glu Val His
Leu Gly Gln Leu Lys Arg Phe Ser Leu 275 280 285Arg Glu Leu Gln Val
Ala Ser Asp Gly Phe Ser Asn Lys Asn Ile Leu 290 295 300Gly Arg Gly
Gly Phe Gly Lys Val Tyr Lys Gly Arg Leu Ala Asp Gly305 310 315
320Thr Leu Val Ala Val Lys Arg Leu Lys Glu Glu Arg Thr Pro Gly Gly
325 330 335Glu Leu Gln Phe Gln Thr Glu Val Glu Met Ile Ser Met Ala
Val His 340 345 350Arg Asn Leu Leu Arg Leu Arg Gly Phe Cys Met Thr
Pro Thr Glu Arg 355 360 365Leu Leu Val Tyr Pro Tyr Met Ala Asn Gly
Ser Val Ala Ser Cys Leu 370 375 380Arg Glu Arg Pro Pro Ser Gln Pro
Pro Leu Asp Trp Pro Thr Arg Lys385 390 395 400Arg Ile Ala Leu Gly
Ser Ala Arg Gly Leu Ser Tyr Leu His Asp His 405 410 415Cys Asp Pro
Lys Ile Ile His Arg Asp Val Lys Ala Ala Asn Ile Leu 420 425 430Leu
Asp Glu Asp Phe Glu Ala Val Val Gly Asp Phe Gly Leu Ala Lys 435 440
445Leu Met Asp Tyr Lys Asp Thr His Val Thr Thr Ala Val Arg Gly Thr
450 455 460Ile Gly His Ile Ala Pro Glu Tyr Leu Ser Thr Gly Lys Ser
Ser Glu465 470 475 480Lys Thr Asp Val Phe Gly Tyr Gly Ile Met Leu
Leu Glu Leu Ile Thr 485 490 495Gly Gln Arg Ala Phe Asp Leu Ala Arg
Leu Ala Asn Asp Asp Asp Val 500 505 510Met Leu Leu Asp Trp Val Lys
Gly Leu Leu Lys Glu Lys Lys Leu Glu 515 520 525Met Leu Val Asp Pro
Asp Leu Gln Thr Asn Tyr Glu Glu Arg Glu Leu 530 535 540Glu Gln Val
Ile Gln Val Ala Leu Leu Cys Thr Gln Gly Ser Pro Met545 550 555
560Glu Arg Pro Lys Met Ser Glu Val Val Arg Met Leu Glu Gly Asp Gly
565 570 575Leu Ala Glu Arg Trp Asp Glu Trp Gln Lys Val Glu Ile Leu
Arg Glu 580 585 590Asp Val Asp Leu Ser Pro Asn Leu His Ser Asp Trp
Ile Val Asp Ser 595 600 605Thr Tyr Asn Leu His Ala Val Glu Leu Ser
Gly Pro Arg 610 615 6209629PRTSolanum lycopersicum 9Met Val Lys Val
Met Glu Lys Asp Thr Val Val Val Ser Leu Val Val1 5 10 15Trp Leu Ile
Leu Val Val Tyr His Leu Lys Leu Ile Tyr Ala Asn Met 20 25 30Glu Gly
Asp Ala Leu His Ser Leu Arg Val Asn Leu Gln Asp Pro Asn 35 40 45Asn
Val Leu Gln Ser Trp Asp Pro Thr Leu Val Asn Pro Cys Thr Trp 50 55
60Phe His Val Thr Cys Asn Asn Asp Asn Ser Val Ile Arg Val Asp Leu65
70 75 80Gly Asn Ala Ala Leu Ser Gly Leu Leu Val Pro Gln Leu Gly Leu
Leu 85 90 95Lys Asn Leu Gln Tyr Leu Glu Leu Tyr Ser Asn Asn Ile Ser
Gly Leu 100 105 110Ile Pro Ser Asp Leu Gly Asn Leu Thr Asn Leu Val
Ser Leu Asp Leu 115 120 125Tyr Leu Asn Asn Phe Val Gly Pro Ile Pro
Asp Ser Leu Gly Lys Leu 130 135 140Ser Lys Leu Arg Phe Leu Arg Leu
Asn Asn Asn Ser Leu Thr Gly Asn145 150 155 160Ile Pro Met Ser Leu
Thr Asn Ile Ser Ser Leu Gln Val Leu Asp Leu 165 170 175Ser Asn Asn
Arg Leu Ser Gly Ala Val Pro Asp Asn Gly Ser Phe Ser 180 185 190Leu
Phe Thr Pro Ile Ser Phe Ala Asn Asn Leu Asp Leu Cys Gly Pro 195 200
205Val Thr Gly Arg Pro Cys Pro Gly Ser Pro Pro Phe Ser Pro Pro Pro
210 215 220Pro Phe Val Pro Pro Pro Pro Ile Ser Ala Pro Gly Gly Asn
Gly Ala225 230 235 240Thr Gly Ala Ile Ala Gly Gly Val Ala Ala Gly
Ala Ala Leu Leu Phe 245 250 255Ala Ala Pro Ala Ile Ala Phe Ala Trp
Trp Arg Arg Arg Lys Pro Gln 260 265 270Glu Tyr Leu Phe Asp Val Pro
Ala Glu Glu Asp Pro Glu Val His Leu 275 280 285Gly Gln Leu Lys Arg
Phe Ser Leu Arg Glu Leu Gln Val Ala Thr Asp 290 295 300Ser Phe Ser
Asn Lys Asn Ile Leu Gly Arg Gly Gly Phe Gly Lys Val305 310 315
320Tyr Lys Gly Arg Leu Ala Asp Gly Ser Leu Val Ala Val Lys Arg Leu
325 330 335Lys Glu Glu Arg Thr Pro Gly Gly Glu Leu Gln Phe Gln Thr
Glu Val 340 345 350Glu Met Ile Ser Met Ala Val His Arg Asn Leu Leu
Arg Leu Arg Gly 355 360 365Phe Cys Met Thr Pro Thr Glu Arg Leu Leu
Val Tyr Pro Tyr Met Ala 370 375 380Asn Gly Ser Val Ala Ser Cys Leu
Arg Glu Arg Pro Pro Ser Glu Pro385 390 395 400Pro Leu Asp Trp Pro
Thr Arg Lys Arg Ile Ala Leu Gly Ser Ala Arg 405 410 415Gly Leu Ser
Tyr Leu His Asp His Cys Asp Pro Lys Ile Ile His Arg 420 425 430Asp
Val Lys Ala Ala Asn Ile Leu Leu Asp Glu Glu Phe Glu Ala Val 435 440
445Val Gly Asp Phe Gly Leu Ala Lys Leu Met Asp Tyr Lys Asp Thr His
450 455 460Val Thr Thr Ala Val Arg Gly Thr Ile Gly His Ile Ala Pro
Glu Tyr465 470 475 480Leu Ser Thr Gly Lys Ser Ser Glu Lys Thr Asp
Val Phe Gly Tyr Gly 485 490 495Ile Met Leu Leu Glu Leu Ile Thr Gly
Gln Arg Ala Phe Asp Leu Ala 500 505 510Arg Leu Ala Asn Asp Asp Asp
Val Met Leu Leu Asp Trp Val Lys Gly 515 520 525Leu Leu Lys Glu Lys
Lys Leu Glu Met Leu Val Asp Pro Asp Leu Gln 530 535 540Asn Lys Tyr
Val Glu Ala Glu Val Glu Gln Leu Ile Gln Val Ala Leu545 550 555
560Leu Cys Thr Gln Ser Asn Pro Met Asp Arg Pro Lys Met Ser Glu Val
565 570 575Val Arg Met Leu Glu Gly Asp Gly Leu Ala Glu Arg Trp Asp
Glu Trp 580 585 590Gln Lys Val Glu Val Leu Arg Gln Glu Val Glu Leu
Ala Pro His Pro 595 600 605Gly Ser Asp Trp Leu Val Asp Ser Thr Glu
Asn Leu His Ala Val Glu 610 615 620Leu Ser Gly Pro
Arg62510598PRTCannabis sativa 10Met Glu Gly Asp Ala Leu His Ser Leu
Arg Ser Asn Leu Gln Asp Pro1 5 10 15Asn Asn Val Leu Gln Ser Trp Asp
Pro Thr Leu Val Asn Pro Cys Thr 20 25 30Trp Phe His Val Thr Cys Asn
Asn Asp Asn Ser Val Ile Arg Val Asp 35 40 45Leu Gly Asn Ala Ala Leu
Ser Gly Gln Leu Val Pro Gln Leu Gly Leu 50 55 60Leu Lys Asn Leu Gln
Tyr Leu Glu Leu Tyr Ser Asn Asn Ile Ser Gly65 70 75 80Thr Ile Pro
Ser Asp Leu Gly Asn Leu Thr Ser Leu Val Ser Leu Asp 85 90 95Leu Tyr
Leu Asn Ser Phe Thr Gly Pro Ile Pro Asp Thr Leu Gly Lys 100 105
110Leu Ser Lys Leu Arg Phe Leu Arg Leu Asn Asn Asn Ser Leu Thr Gly
115 120 125Pro Ile Pro Met Ser Leu Thr Asn Ile Thr Ser Leu Gln Val
Leu Asp 130 135 140Leu Ser Asn Asn Lys Leu Thr Gly Glu Val Pro Asp
Asn Gly Ser Phe145 150 155 160Ser Leu Phe Thr Pro Ile Ser
Phe Ala Asn Asn Leu Asn Leu Cys Gly 165 170 175Pro Val Thr Gly Arg
Pro Cys Pro Gly Ser Pro Pro Phe Ser Pro Pro 180 185 190Pro Pro Phe
Val Pro Pro Pro Pro Ile Ser Val Pro Gly Gly Asn Ser 195 200 205Ala
Thr Gly Ala Ile Ala Gly Gly Val Ala Ala Gly Ala Ala Leu Leu 210 215
220Phe Ala Ala Pro Ala Ile Ala Phe Ala Trp Trp Arg Arg Arg Lys
Pro225 230 235 240Gln Glu Phe Phe Phe Asp Val Pro Ala Glu Glu Asp
Pro Glu Val His 245 250 255Leu Gly Gln Leu Lys Arg Phe Ser Leu Arg
Glu Leu Gln Val Ala Thr 260 265 270Asp Ser Phe Ser Asn Lys Asn Ile
Leu Gly Arg Gly Gly Phe Gly Lys 275 280 285Val Tyr Lys Gly Arg Leu
Ala Asp Gly Ser Leu Val Ala Val Lys Arg 290 295 300Leu Lys Glu Glu
Arg Thr Pro Gly Gly Glu Leu Gln Phe Gln Thr Glu305 310 315 320Val
Glu Met Ile Ser Met Ala Val His Arg Asn Leu Leu Arg Leu Arg 325 330
335Gly Phe Cys Met Thr Pro Thr Glu Arg Leu Leu Val Tyr Pro Tyr Met
340 345 350Ala Asn Gly Ser Val Ala Ser Cys Leu Arg Glu Arg Pro Pro
His Gln 355 360 365Leu Pro Leu Asp Trp Pro Thr Arg Lys Arg Ile Ala
Leu Gly Ser Ala 370 375 380Arg Gly Leu Ser Tyr Leu His Asp His Cys
Asp Pro Lys Ile Ile His385 390 395 400Arg Asp Val Lys Ala Ala Asn
Ile Leu Leu Asp Glu Glu Phe Glu Ala 405 410 415Val Val Gly Asp Phe
Gly Leu Ala Lys Leu Met Asp Tyr Lys Asp Thr 420 425 430His Val Thr
Thr Ala Val Arg Gly Thr Ile Gly His Ile Ala Pro Glu 435 440 445Tyr
Leu Ser Thr Gly Lys Ser Ser Glu Lys Thr Asp Val Phe Gly Tyr 450 455
460Gly Ile Met Leu Leu Glu Leu Ile Thr Gly Gln Arg Ala Phe Asp
Leu465 470 475 480Ala Arg Leu Ala Asn Asp Asp Asp Val Met Leu Leu
Asp Trp Val Lys 485 490 495Gly Leu Leu Lys Glu Lys Lys Leu Glu Met
Leu Val Asp Pro Asp Leu 500 505 510Gln Lys Asn Tyr Ile Glu Ser Glu
Val Glu Gln Leu Ile Gln Val Ala 515 520 525Leu Leu Cys Thr Gln Gly
Ser Pro Met Asp Arg Pro Lys Met Ser Glu 530 535 540Val Val Arg Met
Leu Glu Gly Asp Gly Leu Ala Glu Arg Trp Asp Glu545 550 555 560Trp
Gln Lys Val Glu Val Leu Arg Gln Glu Val Glu Leu Ala Pro His 565 570
575Pro Asn Ser Asp Trp Ile Val Asp Ser Thr Glu Asn Leu His Ala Val
580 585 590Glu Leu Ser Gly Pro Arg 59511750DNAArtificial
sequenceCsUBIQUITIN10 promoter nucleic acid sequence 11ccgtgaaaac
ttaacacagt acacaatatt tttgagcccc atagtaaaaa aataaaaaag 60ttaaaaattt
gagtatgtgg cgtaaaaatt ccatatatat ggaatatgga agatatatag
120aagggataat tacaccacat cgtgaaattt cttagttttt tactttcata
ctgtggggcg 180gaattttttt caaaaatact gtgtgagttt tatactggtt
aagttttcac tgttgttcta 240cggttgtttt tagttgttcc actgttattt
ttagttgttc tgttttgtat tctattttgt 300attctattgt tgttttataa
aaatatagta ttttttaaaa aatttccggg tgacagtatt 360tttataaatt
ttcttatata aaactaaacc taataacgag gcccagccca gtaacacttc
420taaatctcaa aatgggtcaa aaatgtttta actagaagcc caagcccatt
aaacaggcaa 480tgaatgacgt cattaccgta ggaattggtg gtcttggaaa
ggccaactcg acaaaactaa 540tattccaaac tttgcgtgta agcggagcgt
aagacacgtc atcctttata cgtggcctaa 600tataattggt aaccctagtc
aagtgggttt ggtttggcct gaccaagtcg gtttaggatt 660tatccatttc
cttctttttt aaaaaaagaa atatcagaga aagtcggtca agttgattta
720taaattgcct cttacccttc atctttcatc 7501222DNAArtificial
sequenceSingle strand DNA oligonucleotide 12gccgcttggg tggagaggct
at 221321DNAArtificial sequenceSingle strand DNA oligonucleotide
13gaggaagcgg tcagcccatt c 211422DNAArtificial sequenceSingle strand
DNA oligonucleotide 14cgagcgattt ggtcatgtga ag 221525DNAArtificial
sequenceSingle strand DNA oligonucleotide 15cattgtttgc ctccctgctg
cggtt 251632DNAArtificial sequenceSingle strand DNA oligonucleotide
16atgagtatta ttactaatga tagtaatctc ag 321725DNAArtificial
sequenceSingle strand DNA oligonucleotide 17ttattccatg ccgaatattg
gtgtt 251824DNAArtificial sequenceSingle strand DNA oligonucleotide
18tggaaggtga tgccttgcat agtc 241925DNAArtificial sequenceSingle
strand DNA oligonucleotide 19ttacctcgga ccagataact cgacc 25
* * * * *