U.S. patent application number 16/983491 was filed with the patent office on 2021-10-28 for articles and methods directed to personalized therapy of cancer.
This patent application is currently assigned to HESPERIX SA. The applicant listed for this patent is HESPERIX SA, The Scripps Research Institute. Invention is credited to Alexey Anatolievich Belogurov, Alexander Gabibovich Gabibov, Dmitry Dmitrievich Genkin, Richard A. Lerner, Alexey Vyacheslavovich Stepanov, Jia Xie.
Application Number | 20210333282 16/983491 |
Document ID | / |
Family ID | 1000005895390 |
Filed Date | 2021-10-28 |
United States Patent
Application |
20210333282 |
Kind Code |
A9 |
Stepanov; Alexey Vyacheslavovich ;
et al. |
October 28, 2021 |
ARTICLES AND METHODS DIRECTED TO PERSONALIZED THERAPY OF CANCER
Abstract
Described are methods for providing personalized medicine for
the treatment of B cell malignancies including lymphoma. The
methods make use of Chimeric Antigen Receptor (CAR) technology.
Inventors: |
Stepanov; Alexey
Vyacheslavovich; (Moscow, RU) ; Genkin; Dmitry
Dmitrievich; (St. Petersburg, RU) ; Lerner; Richard
A.; (La Jolla, CA) ; Belogurov; Alexey
Anatolievich; (Moscow, RU) ; Gabibov; Alexander
Gabibovich; (Moscow, RU) ; Xie; Jia; (San
Diego, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
HESPERIX SA
The Scripps Research Institute |
VIGANELLO
La Jolla |
CA |
CH
US |
|
|
Assignee: |
HESPERIX SA
VIGANELLO
CA
The Scripps Research Institute
La Jolla
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20200400676 A1 |
December 24, 2020 |
|
|
Family ID: |
1000005895390 |
Appl. No.: |
16/983491 |
Filed: |
August 3, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16753635 |
Apr 3, 2020 |
|
|
|
PCT/RU2018/000653 |
Oct 4, 2018 |
|
|
|
16983491 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 16/2803 20130101;
C12Q 1/6886 20130101; C07K 2317/53 20130101; G01N 33/505 20130101;
G01N 33/57492 20130101; A61K 2039/5158 20130101; A61K 2039/54
20130101; C07K 2317/24 20130101; A61K 2039/5156 20130101; A61K
35/17 20130101; G01N 33/543 20130101; A61K 39/0011 20130101; C12Q
2600/156 20130101; C07K 2317/73 20130101; C07K 2319/33 20130101;
C07K 2319/03 20130101 |
International
Class: |
G01N 33/574 20060101
G01N033/574; A61K 35/17 20060101 A61K035/17; A61K 39/00 20060101
A61K039/00; C07K 16/28 20060101 C07K016/28; C12Q 1/6886 20060101
C12Q001/6886; G01N 33/50 20060101 G01N033/50; G01N 33/543 20060101
G01N033/543 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 4, 2017 |
RU |
2017134483 |
Apr 4, 2018 |
RU |
2018112009 |
Oct 1, 2018 |
RU |
2018134321 |
Claims
1. A method of treating cancer in a subject comprising
concomitantly administering: CAR-expressing T-cells, wherein the
CAR comprises an antigen binding domain that specifically binds a
cancer-specific antigen in a cancer-specific manner; and a vaccine
comprising a polypeptide or a nucleic acid expressing the
cancer-specific antigen, or a cancer-specific fragment thereof.
2. The method of claim 1, wherein the cancer-specific antigen is a
B-cell receptor.
3. The method of claim 1, wherein the polypeptide or nucleic acid
comprises a heavy or light chain variable region, or fragment
thereof.
4. The method of claim 1, wherein the cancer-specific antigen is
expressed in the cancer and comprises a somatic mutation.
5. The method of claim 1, wherein the cancer-specific antigen is
expressed in the cancer and comprises a somatic mutation.
6. The method of claim 5, wherein the non-cancerous cells of the
subject do not have the somatic mutation.
7. The method of claim 5, wherein the mutation is a point mutation,
a splice-site mutation, a frameshift mutation, a read-through
mutation, or a gene-fusion mutation.
8. The method of claim 5, wherein the somatic mutation comprises a
mutation in EGFRvIII, PSCA, BCMA, CD30, CEA, CD22, L1CAM, ROR1,
ErbB, CD123, IL13R.alpha.2, Mesothelin, FR.alpha., VEGFR, c-Met,
5T4, CD44v6, B7-H4, CD133, CD138, CD33, CD28, GPC3, EphA2, CD19,
ACVR2B, anaplastic lymphoma kinase (ALK), MYCN, BCR, HER2, NY-ESO1,
MUC1, or MUC16.
9. The method of claim 5, wherein the cancer comprises a tumor.
10. The method of claim 5, wherein the polypeptide or nucleic acid
comprises the somatic mutation.
11. The method of claim 5, wherein the concomitant administration
occurs at least two times, at least three times, at least four
times, at least five times, at least six times, at least seven
times, at least eight times, at least nine times, or at least ten
times in the subject.
12. The method of claim 5, wherein the CAR-expressing T-cells are
administered before the vaccine.
13. The method of claim 5, wherein the CAR-expressing T-cells are
administered after the vaccine.
14. The method of claim 5, further comprising identifying the
cancer-specific antigen in the subject.
15. The method of claim 14, wherein identifying the cancer-specific
antigen comprises: (i) obtaining cancerous cells from a subject;
(ii) extracting DNA from the cells; and (iii) sequencing the
DNA.
16. The method of claim 15, wherein identifying the cancer-specific
antigen further comprises comparing the DNA sequence obtained from
the cancerous cells to a DNA sequence of the same gene obtained
from non-cancerous cells.
17. The method of claim 14, wherein the DNA is isolated from tumor
cells.
18. The method of claim 14, wherein identifying the cancer-specific
antigen comprises isolating and sequencing circulating cell free
DNA of the subject.
19. The method of claim 14, wherein identifying the cancer-specific
antigen comprises: (i) obtaining cancerous cells from a subject;
(ii) extracting RNA from the cells; (iii) synthesizing cDNA from
the extracted RNA; and (iv) sequencing the cDNA.
20. The method of claim 19, wherein identifying the cancer-specific
antigen further comprises comparing the cDNA sequence obtained from
the cancerous cells to a cDNA sequence of the same gene obtained
from non-cancerous cells.
21. The method of claim 5, wherein the vaccine comprises two or
more polypeptides having overlapping sequences, each expressing a
fragment of the cancer-specific antigen.
22. The method of claim 5, further comprising providing
CAR-expressing T-cells by: (i) identifying an antigen binding
domain that specifically binds the cancer-specific antigen in a
cancer-specific manner; and (ii) expressing a CAR comprising the
antigen binding domain in T-cells.
23. The method of claim 5, wherein the CAR comprises a
transmembrane domain that comprises alpha, beta or zeta chain of
the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9,
CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and/or
CD154.
24. The method of claim 5, wherein the CAR comprises an
intracellular region.
25. The method of claim 24, wherein the intracellular region
comprises a MHC class I molecule, a TNF receptor protein, an
Immunoglobulin-like protein, a cytokine receptor, an integrin, a
signaling lymphocytic activation molecule (SLAM protein), an
activating NK cell receptor, BTLA, a Toll ligand receptor, OX40,
CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD25/CD18),
4-29B (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR,
LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30,
NKp46, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R
alpha, ITGA4, VLA1, CD423, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f,
ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD129,
ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C,
TNFR2, TRANCE/RANKL, DNAM1 (CD226), SLAMF4 (CD244, 304), CD84, CD96
(Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100
(SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3),
BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp,
CD123, a ligand that specifically binds with CD83, and/or CD3 zeta.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 16/753,635, filed Apr. 3, 2020, which is a national stage
filing under 35 U.S.C. .sctn. 371 of international PCT application,
PCT/RU2018/000653, filed Oct. 4, 2018, which claims priority to
Russian Application No. 2017134483, filed Oct. 4, 2017, Russian
Application No. 2018112009, filed Apr. 4, 2018, and Russian
Application No. 2018134321, filed Oct. 1, 2018, the entire contents
of each of which is hereby incorporated herein by reference.
BACKGROUND OF INVENTION
[0002] Lymphoma is a cancer in the lymphatic cells of the immune
system. Typically, lymphomas present as a solid tumor of lymphoid
cells. These malignant cells often originate in lymph nodes,
presenting as an enlargement of the node, i.e., a tumor. It can
also affect other organs in which case it is referred to as
extranodal lymphoma. Extranodal sites include the skin, brain,
bowels and bone. Lymphomas are closely related to lymphoid
leukemias, which also originate in lymphocytes but typically
involve only circulating blood and the bone marrow and do not
usually form static tumors (Parham, P. The immune system. New York:
Garland Science. p. 414, 2005). Treatment involves chemotherapy and
in some cases radiotherapy and/or bone marrow transplantation, and
can be curable depending on the histology, type, and stage of the
disease. More advanced cases of lymphoma are resistant and,
accordingly, novel treatment approaches are needed.
SUMMARY OF INVENTION
[0003] The disclosure provides methods for treatment of B cell
malignancies using personalized medicine. More particularly, the
methods provide for isolating a B cell receptor from a B cell
malignancy in a subject, identifying a ligand for the B cell
receptor, and then treating the subject with the B cell receptor
ligand coupled to a therapeutic agent, e.g., a CART cell in which
the B cell receptor ligand comprises the antigen binding
domain.
[0004] In some embodiments, the methods of the disclosure use an
autocrine-based format to identify B cell receptor ligands specific
to a tumor. Once a B cell receptor ligand is identified, a patient
can be treated with the ligand attached to a therapeutic agent. The
whole process, from diagnosis to treatment can be completed in a
short period of time, e.g., within several weeks. As an example, B
cell receptor ligands may be identified by co-expressing a B cell
receptor from a tumor and a chimeric antigen receptor (CAR) in a T
cell, where the extracellular domain of the CAR comprises a peptide
from a library. Activation of the T cell by the CAR indicates that
the extracellular domain of the CAR has bound the B cell receptor
and the peptide from the peptide library is a B cell receptor
ligand. Alternatively, contemplated herein is the use of phage
display for identification of the B cell receptor ligand.
[0005] The disclosure also provides methods for treatment of cancer
by administering CAR-expressing T-cells, wherein the CAR comprises
an antigen binding domain that specifically binds a cancer-specific
antigen in a cancer-specific manner, e.g., a CAR with an antigen
binding domain comprising a B cell receptor ligand as is described
herein; and a vaccine comprising a polypeptide or a nucleic acid
expressing the same cancer-specific antigen, or a cancer-specific
fragment thereof, e.g., a B cell receptor or fragment thereof. It
has surprisingly been discovered that when a CAR specific for a
cancer antigen and that same antigen are administered to a subject,
the two have a synergistic effect on a reduction in tumor
volume.
[0006] In one aspect, provided herein are methods of treating
lymphoma in a subject. The methods comprise:
[0007] identifying a unique B cell receptor expressed in lymphoma
cells of the subject;
[0008] expressing the unique B cell receptor in a cell;
[0009] contacting the cell with a putative unique B cell receptor
ligand from a library;
[0010] detecting binding of said unique B cell receptor to a
putative unique B cell receptor ligand, thereby identifying a
unique B cell receptor ligand; and
[0011] administering to the subject a therapeutically effective
amount of the B cell receptor ligand coupled to a therapeutic
agent.
[0012] In some embodiments, the putative unique B cell receptor
ligand comprises a peptide, a cyclopeptide, a peptoid, a
cyclopeptoid, a polysaccharide, a lipid, or a small molecule. In
some embodiments, the unique B cell receptor and the putative
unique B cell receptor ligand are co-expressed in T cells. In some
embodiments, the cell comprises a CAR comprising the putative
unique B cell receptor ligand.
[0013] In some embodiments, the unique B cell receptor is contacted
with a putative unique B cell receptor ligand from a library by
phage display. In some embodiments, the library comprises a library
of putative B cell receptor ligands linked to a phage. In some
embodiments, the unique B cell receptor is attached to a solid
support. In some embodiments, contacting unique B cell receptor
with a putative unique B cell receptor ligand from a library
comprises panning the unique B cell receptor attached to a solid
support with the library of putative B cell receptor ligands linked
to a phage for one or more rounds. In some embodiments, each round
of the panning includes negative selection.
[0014] In some embodiments, said detection method comprises
identifying activation of the T cell.
[0015] In another aspect, provided herein are methods of treating
lymphoma in a subject. The methods comprise:
[0016] identifying a unique B cell receptor expressed in lymphoma
cells of the subject;
[0017] co-expressing the unique B cell receptor and putative unique
B cell receptor ligand from a library in a cell;
[0018] detecting binding of said unique B cell receptor to a
putative unique B cell receptor ligand, thereby identifying a
unique B cell receptor ligand; and
[0019] administering to the subject a therapeutically effective
amount of the B cell receptor ligand coupled to a therapeutic
agent.
[0020] In some embodiments, the unique B cell receptor and the
putative unique B cell receptor ligand are co-expressed in T
cells.
[0021] In some embodiments, the T cell comprises a CAR comprising
the putative unique B cell receptor ligand.
[0022] In some embodiments, said detection method comprises
identifying activation of the T cell.
[0023] In some embodiment, the subject is administered the B cell
receptor, or a fragment thereof, concomitantly with the therapeutic
agent.
[0024] In another aspect, provided herein are methods of
identifying a B cell receptor ligand. The methods comprise:
[0025] providing to a population of T cells nucleic acid molecules
encoding a B cell receptor and a library of chimeric antigen
receptors (CARs), wherein each CAR within the library comprises a
distinct putative B cell receptor ligand domain;
[0026] coexpressing the B cell receptor and the library of CARs in
T cells;
[0027] measuring activation of the T cells, wherein the putative B
cell receptor ligand domain of a CAR from the library of CARs
comprises a ligand of the B cell receptor if a T cell expressing
the B cell receptor and the CAR is activated; and
[0028] isolating the nucleic acid molecule encoding the CAR from an
activated T cell; and
[0029] sequencing the putative B cell receptor ligand domain of the
nucleic acid molecule encoding the CAR from the activated T
cell;
[0030] thereby identifying a B cell receptor ligand.
[0031] In some embodiments, the B cell receptor is from a cancer
cell. In some embodiments, the cancer cell is a lymphoma cell. In
some embodiments, the lymphoma cell is obtained from a tumor from a
patient
[0032] In some embodiments, the methods further comprise treating a
subject having lymphoma with the B cell receptor ligand wherein the
B cell receptor is expressed in a tumor from the subject; and the B
cell receptor ligand coupled to a therapeutic agent.
[0033] In some embodiment, the subject is administered the B cell
receptor, or a fragment thereof, concomitantly with the therapeutic
agent.
[0034] In another aspect, provided herein are methods of treating
lymphoma. The methods comprise:
[0035] administering to a subject a therapeutically effective dose
of a B cell receptor ligand coupled to a therapeutic agent,
[0036] wherein the B cell receptor ligand comprises a putative B
cell receptor ligand domain, and wherein a CAR comprising the
putative B cell receptor ligand domain activates a T cell when
co-expressed with the B cell receptor of the lymphoma cells.
[0037] In another aspect, provided herein are methods of treating
lymphoma in a subject. The methods comprise:
[0038] identifying a unique B cell receptor expressed in lymphoma
cells of the subject;
[0039] co-expressing the unique B cell receptor and a chimeric
antigen receptor (CAR) from a library of CARs in a T cell, wherein
each CAR within the library comprises a distinct putative B cell
receptor ligand domain;
[0040] identifying a B cell receptor ligand by identifying an
activated T cell, wherein the putative B cell receptor ligand
domain of the CAR from the library of CARs comprises a ligand of
the unique B cell receptor if the T cell expressing the B cell
receptor and the CAR is activated; and
[0041] administering to the subject a therapeutically effective
dose of the B cell receptor ligand coupled to a therapeutic
agent.
[0042] In some embodiments, the methods further comprise preparing
the B cell receptor ligand coupled to a therapeutic agent.
[0043] In some embodiments, the T cell is activated by
autocrine-based activation of the CAR.
[0044] In some embodiments, identifying a B cell receptor ligand
further comprises isolating the nucleic acid molecule encoding the
CAR from the activated T cell; and sequencing the putative B cell
receptor ligand domain of the nucleic acid molecule encoding the
CAR from the activated T cell.
[0045] In some embodiment, the subject is administered the B cell
receptor, or a fragment thereof, concomitantly with the therapeutic
agent.
[0046] In another aspect, provided herein are methods of treating
lymphoma in a subject comprising:
[0047] identifying a unique B cell receptor expressed in lymphoma
cells of the subject;
[0048] co-expressing the unique B cell receptor and a putative
unique B cell receptor ligand from a library in a cell;
[0049] identifying said unique B cell receptor ligand by a
detection method, wherein a putative unique B cell receptor ligand
is a unique B cell receptor ligand if it interacts with the unique
B cell receptor; and
[0050] administering to the subject a therapeutically effective
amount of the B cell receptor ligand coupled to a therapeutic
agent.
[0051] In some embodiments, the unique B cell receptor and a
putative unique B cell receptor ligand are co-expressed in T
cells.
[0052] In some embodiments, the cell comprises a CAR comprising the
putative unique B cell receptor ligand.
[0053] In some embodiments, said detection method comprises
identifying activation of the T cell.
[0054] In some embodiment, the subject is administered the B cell
receptor, or a fragment thereof, concomitantly with the therapeutic
agent.
[0055] In another aspect, provided herein are methods for treating
lymphoma in a subject comprising: administering to the subject a
therapeutically effective amount of a CART cell expressing a first
CAR, wherein:
[0056] (i) the first CAR comprises an antigen binding domain that
comprises a polypeptide from a cyclopeptide library that binds a
unique B cell receptor expressed in lymphoma cells of the
subject,
[0057] (ii) the antigen binding domain is identified by [0058] (a)
identifying the unique B cell receptor expressed in lymphoma cells
of the subject; [0059] (b) co-expressing the unique B cell receptor
and a second CAR from a library of CARs in a T cell, wherein each
CAR within the library comprises a distinct putative ligand domain
that comprises a polypeptide from a cyclopeptide library; and
[0060] (c) identifying the antigen binding domain of the first CAR
by identifying an
[0061] activated T cell, wherein the putative B cell receptor
ligand domain of the second CAR from the library of CARs comprises
the antigen binding domain of the first CAR if the T cell
expressing the B cell receptor and the second CAR is activated;
and
[0062] (iii) the first CAR has greater specificity and/or activity
than a control.
[0063] In some embodiments, the control comprises a CART cell. In
some embodiments, the antigen binding domain of the CAR expressed
by the CART cell binds a ligand other than a B-cell receptor. In
some embodiments, the antigen binding domain binds CD-19.
[0064] In some embodiments, the first CAR and the second CAR are
the same CAR. In some embodiments, the first CAR and the second CAR
are different CARs.
[0065] In some embodiments, activity comprises cytotoxicity towards
cells expressing the unique B cell receptor relative to a control.
In some embodiments, cytotoxicity of the CART towards cells
expressing the unique B cell receptor is 0%-10% greater than the
control, as measured by % lysis, at an effector:target ratio of
1:1-10:1. In some embodiments, cytotoxicity of the CART towards
cells expressing the unique B cell receptor is at least 10% greater
than the control, as measured by % lysis, at an effector:target
ratio of 10:1 or greater.
[0066] In some embodiments, the control comprises a CAR comprising
an antigen binding domain that binds a ligand other than the B-cell
receptor expressed on the cells expressing the unique B cell
receptor.
[0067] In some embodiments, specificity comprises cytotoxicity
towards cells that do not express the unique B cell receptor. In
some embodiments, cytotoxicity of the CART towards cells that do
not express the unique B cell receptor is less than 10%, as
measured by % lysis. In some embodiments, cytotoxicity of the CART
towards cells that do not express the unique B cell receptor is
0-10% less than the cytotoxicity of a control that binds a ligand
expressed on the cells at an effector:target ratio of less than
10:1. In some embodiments, cytotoxicity of the CART towards cells
that do not express the unique B cell receptor is at least 15% less
than the cytotoxicity of a control that binds a ligand expressed on
the cells at an effector:target ratio of 10:1 or greater.
[0068] In some embodiment, the subject is administered the B cell
receptor, or a fragment thereof, concomitantly with the therapeutic
agent.
[0069] In another aspect, provided herein are methods for treating
lymphoma in subject population comprising:
[0070] selecting subjects having lymphoma; and
[0071] administering to each subject a therapeutically effective
amount of a CART cell expressing a first CAR unique to the B cell
receptor expressed on the lymphoma cells on each subject,
wherein:
[0072] (i) the first CAR comprises an antigen binding domain that
comprises a polypeptide from a cyclopeptide library that binds a
unique B cell receptor expressed in lymphoma cells of each
subject,
[0073] (ii) the antigen binding domain is identified by [0074] (a)
identifying the unique B cell receptor expressed in lymphoma cells
of the subject; [0075] (b) co-expressing the unique B cell receptor
and a second CAR from a library of CARs in a T cell, wherein each
CAR within the library comprises a distinct putative ligand domain
that comprises a polypeptide from a cyclopeptide library; and
[0076] (c) identifying the antigen binding domain of the first CAR
by identifying an activated T cell, wherein the putative B cell
receptor ligand domain of the second CAR from the library of CARs
comprises the antigen binding domain of the first CAR if the T cell
expressing the B cell receptor and the second CAR is activated;
and
[0077] (iii) the first CAR has greater specificity and/or activity
than a control.
[0078] In some embodiments, the control comprises a CART cell. In
some embodiments, the antigen binding domain of the CAR expressed
by the CART cell binds a ligand other than a B-cell receptor. In
some embodiments, the antigen binding domain binds CD-19.
[0079] In some embodiments, the first CAR and the second CAR are
the same CAR. In some embodiments, the first CAR and the second CAR
are different CARs.
[0080] In some embodiments, activity comprises cytotoxicity towards
cells expressing the unique B cell receptor relative to a control.
In some embodiments, cytotoxicity of the CART towards cells
expressing the unique B cell receptor is 0%-10% greater than the
control, as measured by % lysis, at an effector:target ratio of
1:1-10:1. In some embodiments, cytotoxicity of the CART towards
cells expressing the unique B cell receptor is at least 10% greater
than the control, as measured by % lysis, at an effector:target
ratio of 10:1 or greater.
[0081] In some embodiments, the control comprises a CAR comprising
an antigen binding domain that binds a ligand other than the B-cell
receptor expressed on the cells expressing the unique B cell
receptor.
[0082] In some embodiments, specificity comprises cytotoxicity
towards cells that do not express the unique B cell receptor. In
some embodiments, cytotoxicity of the CART towards cells that do
not express the unique B cell receptor is less than 10%, as
measured by % lysis. In some embodiments, cytotoxicity of the CART
towards cells that do not express the unique B cell receptor is
0-10% less than the cytotoxicity of a control that binds a ligand
expressed on the cells at an effector:target ratio of less than
10:1. In some embodiments, cytotoxicity of the CART towards cells
that do not express the unique B cell receptor is at least 15% less
than the cytotoxicity of a control that binds a ligand expressed on
the cells at an effector:target ratio of 10:1 or greater.
[0083] In another aspect, provided herein are methods of of rapidly
identifying a personalized antibody binding ligand specific for a B
cell lymphoma, e.g., a B cell receptor ligand, comprising:
[0084] identifying a B cell receptor from a B cell lymphoma
cell,
[0085] providing to a population of T cells nucleic acid molecules
encoding the B cell receptor and a library of chimeric antigen
receptors (CARs), wherein each CAR within the library comprises a
distinct putative B cell receptor ligand domain;
[0086] coexpressing the B cell receptor and the library of CARs in
T cells;
[0087] measuring activation of the T cells, wherein the putative B
cell receptor ligand domain of a CAR from the library of CARs
comprises a ligand of the B cell receptor if a T cell expressing
the B cell receptor and the CAR is activated; and
[0088] isolating the nucleic acid molecule encoding the CAR from an
activated T cell; and
[0089] sequencing the putative B cell receptor ligand domain of the
nucleic acid molecule encoding the CAR from the activated T
cell;
[0090] thereby identifying a B cell receptor ligand.
[0091] In some embodiments, the B cell receptor ligand is
identified within 4 weeks, within 3 weeks, within 2 weeks, or
within 1 week. In some embodiments, the B cell receptor ligand is
identified within 3 weeks.
[0092] In some embodiments, the B cell lymphoma cell is obtained
from a tumor from a patient.
[0093] In some embodiments, the putative B cell receptor ligand
domain comprises a polypeptide of 30 amino acids or less. In some
embodiments, the putative B cell receptor ligand domain comprises a
polypeptide from a cyclopeptide library. In some embodiments, the
putative B cell receptor ligand domain further comprises an Fc
region.
[0094] In some embodiments, T cell activation is measured by an
increase in expression of CD69 or CD25. In some embodiments, T cell
activation is measured by an increase in expression of a
fluorescent protein reporter gene under the control of Jun,
NF-.kappa.B and/or Rel.
[0095] In some embodiments, the methods further comprise treating a
subject having lymphoma with the B cell receptor ligand, wherein
the B cell receptor ligand coupled to a therapeutic agent.
[0096] In another aspect, provided herein is a chimeric antigen
receptor (CAR) comprising: a putative B cell receptor ligand domain
that comprises a polypeptide from a cyclopeptide library;
[0097] a transmembrane domain; and
[0098] an intracellular region.
[0099] In some embodiments, the CAR activates a T cell when
co-expressed with a B cell receptor, wherein a B cell receptor
ligand of the B cell receptor comprises the putative B cell
receptor ligand domain. In some embodiments, the B cell receptor
ligand comprises the amino acid sequence of any of SEQ ID NOs:
1-3.
[0100] In another aspect, provided herein is a method of treating
lymphoma in a subject comprising:
[0101] identifying a unique B cell receptor expressed in lymphoma
cells of the subject;
[0102] contacting the unique B cell receptor with a phage display
library, wherein the phage display library comprises a library of
putative unique B cell receptor ligands linked to phages;
[0103] detecting binding of said unique B cell receptor to a
putative unique B cell receptor ligand, thereby identifying a
unique B cell receptor ligand; and
[0104] administering to the subject a therapeutically effective
amount of the B cell receptor ligand coupled to a therapeutic
agent.
[0105] In some embodiments, the putative unique B cell receptor
ligand comprises a peptide, a cyclopeptide, a peptoid, a
cyclopeptoid, a polysaccharide, a lipid, or a small molecule.
[0106] In some embodiments, the unique B cell receptor is attached
to a solid support.
[0107] In some embodiments, contacting unique B cell receptor with
a putative unique B cell receptor ligand from a library comprises
panning the unique B cell receptor attached to a solid support with
the library of putative B cell receptor ligands linked to a phage
for one or more rounds. In some embodiments, each round of the
panning includes negative selection.
[0108] In some embodiments, the subject is determined to have
lymphoma.
[0109] In some embodiments, the subject is determined to have one
or more single-nucleotide polymorphisms (SNPs) associated with
lymphoma.
[0110] In some embodiments, identifying a unique B cell receptor
comprises:
[0111] obtaining cells from a biopsy;
[0112] extracting RNA from the cells;
[0113] synthesizing cDNA from the extracted RNA; and
[0114] sequencing the cDNA. In some embodiments, identifying a
unique B cell receptor comprises cloning and sequencing circulating
cell free DNA.
[0115] In some embodiments, the method is performed in 3 weeks or
less.
[0116] In some embodiments, the therapeutic agent comprises a
radioactive isotope.
[0117] In some embodiments, the B cell receptor ligand coupled to a
therapeutic agent comprises a therapeutic CAR. In some embodiments,
the therapeutic agent comprises a chemotherapy. In some
embodiments, the therapeutic agent comprises an immunotherapy.
[0118] In another aspect, provided herein is a method of treating
cancer in a subject. In some embodiments, the method comprises
concomitantly administering: CAR-expressing T-cells, wherein the
CAR comprises an antigen binding domain that specifically binds a
cancer-specific antigen in a cancer-specific manner; and a vaccine
comprising a polypeptide or a nucleic acid expressing the
cancer-specific antigen, or a cancer-specific fragment thereof.
[0119] In some embodiments, the cancer-specific antigen is a B-cell
receptor. In some embodiments, the cancer is a lymphoma. In some
embodiments, the polypeptide or nucleic acid comprises a heavy or
light chain variable region, or fragment thereof.
[0120] In some embodiments, the cancer-specific antigen is
expressed in the cancer and comprises a somatic mutation. In some
embodiments, the non-cancerous cells of the subject do not have the
somatic mutation. In some embodiments, the mutation is a point
mutation, a splice-site mutation, a frameshift mutation, a
read-through mutation, or a gene-fusion mutation. In some
embodiments, the somatic mutation comprises a mutation in EGFRvIII,
PSCA, BCMA, CD30, CEA, CD22, L1CAM, ROR1, ErbB, CD123, IL13Ra2,
Mesothelin, FR.alpha., VEGFR, c-Met, 5T4, CD44v6, B7-H4, CD133,
CD138, CD33, CD28, GPC3, EphA2, CD19, ACVR2B, anaplastic lymphoma
kinase (ALK), MYCN, BCR, HER2, NY-ESO1, MUC1, or MUC16. In some
embodiments, the cancer comprises a tumor. In some embodiments, the
polypeptide or nucleic acid comprises the somatic mutation.
[0121] In some embodiments, the concomitant administration occurs
at least two times, at least three times, at least four times, at
least five times, at least six times, at least seven times, at
least eight times, at least nine times, or at least ten times in
the subject. In some embodiments, the CAR-expressing T-cells are
administered before the vaccine. In some embodiments, the
CAR-expressing T-cells are administered after the vaccine.
[0122] In some embodiments, the method further comprises
identifying the cancer-specific antigen in the subject. In some
embodiments, identifying the cancer-specific antigen comprises: (i)
obtaining cancerous cells from a subject; (ii) extracting DNA from
the cells; and (iii) sequencing the DNA. In some embodiments,
identifying the cancer-specific antigen further comprises comparing
the DNA sequence obtained from the cancerous cells to a DNA
sequence of the same gene obtained from non-cancerous cells. In
some embodiments, the DNA is isolated from tumor cells. In some
embodiments, the cancer-specific antigen comprises isolating and
sequencing circulating cell free DNA of the subject. In some
embodiments, identifying the cancer-specific antigen comprises: (i)
obtaining cancerous cells from a subject; (ii) extracting RNA from
the cells; (iii) synthesizing cDNA from the extracted RNA; and (iv)
sequencing the cDNA. In some embodiments, identifying the
cancer-specific antigen further comprises comparing the cDNA
sequence obtained from the cancerous cells to a cDNA sequence of
the same gene obtained from non-cancerous cells.
[0123] In some embodiments, the vaccine comprises two or more
polypeptides having overlapping sequences, each expressing a
fragment of the cancer-specific antigen.
[0124] In some embodiments, the method further comprises providing
CAR-expressing T-cells by: (i) identifying an antigen binding
domain that specifically binds the cancer-specific antigen in a
cancer-specific manner; and (ii) expressing a CAR comprising the
antigen binding domain in T-cells.
[0125] In some embodiments, the polypeptide is conjugated to
KLH.
[0126] In some embodiments the vaccine is administered by
intravenous, intraperitoneal, transmucosal, oral, subcutaneous,
pulmonary, intranasal, intradermal or intramuscular administration.
In some embodiments the vaccine is administered intratumorally.
[0127] In some embodiments the CAR-expressing T-cells are
administered by intravenous administration.
[0128] In some embodiments, the method further comprises
administering a TLR9 agonist. In some embodiments, the
cancer-specific antigen is OX40.
[0129] In another aspect, provided herein is a composition for
treating cancer in a subject comprising: CAR-expressing T-cells,
wherein the CAR comprises an antigen binding domain that
specifically binds a cancer-specific antigen in a cancer-specific
manner; and a polypeptide or a nucleic acid expressing the
cancer-specific antigen, or a cancer-specific fragment thereof.
[0130] In some embodiments, the cancer-specific antigen is a B-cell
receptor. In some embodiments, the polypeptide or nucleic acid
comprises a heavy or light chain variable region, or fragment
thereof.
[0131] In some embodiments, the cancer-specific antigen is
expressed in the cancer and comprises a somatic mutation.
[0132] In some embodiments, the non-cancerous cells of the subject
do not have the somatic mutation. In some embodiments, the mutation
is a point mutation, a splice-site mutation, a frameshift mutation,
a read-through mutation, or a gene-fusion mutation. In some
embodiments, the somatic mutation comprises a mutation in EGFRvIII,
PSCA, BCMA, CD30, CEA, CD22, L1CAM, ROR1, ErbB, CD123, IL13Ra2,
Mesothelin, FR.alpha., VEGFR, c-Met, 5T4, CD44v6, B7-H4, CD133,
CD138, CD33, CD28, GPC3, EphA2, CD19, ACVR2B, anaplastic lymphoma
kinase (ALK), MYCN, BCR, HER2, NY-ESO1, MUC1, or MUC16. In some
embodiments, the polypeptide or nucleic acid comprises the somatic
mutation.
[0133] In some embodiments, the vaccine comprises two or more
polypeptides having overlapping sequences, each expressing a
fragment of the cancer-specific antigen.
[0134] In some embodiments, the polypeptide is conjugated to
KLH.
[0135] In some embodiments, the method further comprises
administering a TLR9 agonist. In some embodiments, the
cancer-specific antigen is OX40.
[0136] In some embodiments, the CAR, e.g., a CAR described herein,
comprises a transmembrane domain. In some embodiments, the
transmembrane domain comprises alpha, beta or zeta chain of the
T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16,
CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and/or CD154.
[0137] In some embodiments, the CAR, e.g., a CAR described herein,
comprises an intracellular region. In some embodiments, the
intracellular region comprises a MHC class I molecule, a TNF
receptor protein, an Immunoglobulin-like protein, a cytokine
receptor, an integrin, a signaling lymphocytic activation molecule
(SLAM protein), an activating NK cell receptor, BTLA, a Toll ligand
receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1,
LFA-1 (CD25/CD18), 4-29B (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278),
GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1),
NKp44, NKp30, NKp46, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R
gamma, IL7R alpha, ITGA4, VLA1, CD423, ITGA4, IA4, CD49D, ITGA6,
VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1,
ITGAM, CD129, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7,
NKG2D, NKG2C, TNFR2, TRANCE/RANKL, DNAM1 (CD226), SLAMF4 (CD244,
304), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160
(BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM
(SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT,
GADS, SLP-76, PAG/Cbp, CD123, and/or a ligand that specifically
binds with CD83.
[0138] In some embodiments, the CAR, e.g., a CAR described herein,
comprises a hinge domain.
[0139] In some embodiments, the therapeutic agent comprises a
radioactive isotope. In some embodiments, the B cell receptor
ligand coupled to a therapeutic agent comprises a therapeutic CAR.
In some embodiments, the therapeutic agent comprises a
chemotherapy. In some embodiments, the therapeutic agent comprises
an immunotherapy.
[0140] In some embodiments, identifying a unique B cell receptor
comprises: obtaining cells from a biopsy; extracting RNA from the
cells; synthesizing cDNA from the extracted RNA; and sequencing the
cDNA. In some embodiments, identifying a unique B cell receptor
comprises cloning and sequencing circulating cell free DNA.
[0141] In some embodiments, the putative B cell receptor ligand
domain comprises a polypeptide of 30 amino acids or less. In some
embodiments, the putative B cell receptor ligand domain comprises a
polypeptide from a cyclopeptide library. In some embodiments, the
putative B cell receptor ligand domain further comprises an Fc
region.
[0142] In some embodiments, T cell activation is measured by an
increase in expression of CD69 or CD25. In some embodiments, T cell
activation is measured by an increase in expression of a
fluorescent protein reporter gene under the control of Jun,
NF-.kappa.B and/or Rel.
[0143] In some embodiments, the method is performed in 3 weeks or
less.
[0144] In some embodiments, the subject is determined to have
lymphoma. In some embodiments, the subject is determined to have
one or more single-nucleotide polymorphisms (SNPs) associated with
lymphoma.
BRIEF DESCRIPTION OF DRAWINGS
[0145] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present disclosure, which can be better understood
by reference to one or more of these drawings in combination with
the detailed description of specific embodiments presented herein.
In the figures:
[0146] FIG. 1 is a schematic diagram showing the workflow for
selection of ligands for the personalized follicular lymphoma CAR-T
therapy. A lymph node biopsy sample from a patient with Follicular
lymphoma is isolated and the collected tumor cells are used for
identification of the malignant BCR genes after which they are
reconstituted as a membrane bound BCR using PDGFR as a membrane
anchor. The reconstituted malignant BCR, co-expressed with the
cyclopeptide-CAR library on the surface of the Jurkat cell line are
used as a reporter-cell system for selection of the tumor cell
targeting ligand. Following several rounds of panning, the selected
peptide ligands fused to the chimeric antigen receptor are
sequenced and may be immediately used for generation of the
therapeutic T lymphocytes modified by tumor-specific CAR. The
sequences top to bottom correspond to SEQ ID NOs: 31 and 32.
[0147] FIGS. 2A-2C shows autocrine-based selection of malignant
FL-BCR ligands. FIG. 2A shows the reporter system format. FIG. 2B
is flow cytometry data showing verification of the reporter cell
assay by Myc-CAR/anti-Myc antibody pair interaction. FIG. 2C shows
that patient BCR-specific peptides on CAR activate reporter Jurkat
cells transduced by membrane tethered follicular lymphoma BCRs.
[0148] FIGS. 3A-3D are graphs showing the selected peptide ligands
specifically interact with the FL-BCRs and redirects CTLs to kill
tumor cells. FIG. 3A is a series of histograms showing SPR analysis
of the interaction of the selected cyclopeptides CILDLPKFC (FL1)
(SEQ ID NO: 1), CMPHWQNHC (FL2) (SEQ ID NO: 2), and CTTDQARKC (FL3)
(SEQ ID NO: 3) and the malignant BCR. Surface staining of Raji
cells transduced with lymphoma BCR scFv by synthetic biotinylated
peptides and antibody against IgG Fc. For IgG Fc staining, same
Raji cell population flow cytometry result was used as control in
the three histograms. FIG. 3B is a series of graphs showing % cell
lysis. FL-CARTs were co-cultured with Raji cells transduced with
different lymphoma BCRs. Mock transduced T cells and CD19-CART was
used as a comparison. Cytotoxicity was determined by measuring
lactate dehydrogenase release after 6 hours. FIG. 3C shows cells
from the patient's biopsy or control B-cells were stained with the
synthetic biotinylated FL1 peptide. The B-cell population was
identified by B220 specific antibody and the FL1 peptide was
labeled with biotin and detected with FITC labeled streptavidin.
FIG. 3D is a graph showing lysis of B cells derived from the
lymphoma biopsy sample by FL1-CART compared to Myc-CART and Mock
transduced T cells.
[0149] FIGS. 4A-4F show CTLs re-directed by FL1-CAR suppress
lymphomagenesis in vivo. FIG. 4A is a schematic diagram showing
experimental design indicating the engraftment of NOD SCID mice
with 5.times.10.sup.6 Raji-FL1 cells. At day 15, animals (12 per
group) were randomized according to the tumor volume and received
i.v. 3.times.10.sup.6 FL1-CART, CD19-CAR or Myc-CART per mouse at
day 17. FIG. 4B is a series of graphs showing transduction efficacy
of activated, CD3/CD28 bead-expanded human CD8.sup.+ T-cells with
lentiviral based vectors expressing FL1-CAR, Myc-CAR and CD19-CAR
constructs. Cells were stained with IgG1 specific antibody or
protein L. FIG. 4C is a graph showing survival of Raji-FL
xenografted mice treated on day 17 after tumor injection with
3.times.10.sup.6 CTLs (n=12 mice per group). Overall survival
curves were plotted using the Kaplan-Meier method and compared
using the log-rank (Mantel-Cox) test (*p<0.01). FIG. 4D is a
graph showing a tumor growth curve in groups of mice (n=12) treated
by 3.times.10.sup.6 of FL1-CART, CD19-CART or Myc-CART administered
i.v. on day 17 after injection of Raji-FL1. Absolute counts of
adoptively transferred modified T cells were monitored in blood
obtained from retro-orbital puncture using flow cytometry analysis
with a CD3.sup.+ specific antibody (insert). FIG. 4E shows flow
cytometry analysis of the phenotype of FL1-CART cells prior to
injection and on day 21 following the injection. FIG. 4F is a graph
showing relative percentages of naive, central memory and effector
memory CART on day 21 following the injection.
[0150] FIGS. 5A-5C illustrate the structure of the reconstituted
malignant BCR and combinatorial cyclopeptide library. FIG. 5A shows
amino acid sequences of the combinatorial cyclopeptide library
fused with chimeric antigen receptors signaling domains. The
sequence corresponds to SEQ ID NO: 33. FIG. 5B shows reconstituted
malignant BCR fused with the IgG1 Fc hinge and membrane-spanning
PDGFR domain. The sequence corresponds to SEQ ID NO: 34. FIG. 5C
shows a schematic representation of secreted molecules.
[0151] FIG. 6 shows that FL-CARTs do not eliminate Raji cells
without exogenous lymphoma BCR. Only CD-19 CART showed killing
activity on regular Raji cells. Minimum unspecific lysis was
observed when FL1-CAR, FL2-CAR and FL3-CAR T cells were incubated
with Raji cells. Cytotoxicity was determined by measuring lactate
dehydrogenase release after 6 hours.
[0152] FIGS. 7A-7C shows that CTLs redirected by FL1-CAR infiltrate
solid tumors and prevent xenograft metastasis. FIG. 7A shows
bioluminescent imaging of organ-specific metastasis of Raji-FL1
cells (green, indicated by arrows) on day 35 after tumor
implantation in mice treated by CD19-CART, FL1-CART and Myc-CART.
For the Raji-FL1 cells detection mice received i.p. injection of
the D-luciferine. FIG. 7B shows histopathological changes analysis
in tumors from CD19-CART, FL1-CART or Myc-CART treated animals. For
identification of the histopathological changes tumors were stained
with Hematoxylin-Eosin. Lymphoma B cells with basophilic cytoplasm
and high mitotic rate are indicated as black arrows, right panel.
Macrophages containing cellular debris giving the characteristic
"starry sky" appearance are indicated by red arrows, right panel.
Cells thought to be in the state of apoptosis are indicated by
arrows, left panel. FIG. 7C shows immunohistochemical analysis of
CD19-CART, FL1-CART or Myc-CART infiltration into the tumor (black
arrows). The human CD8-specific antibodies were used for CART
staining.
[0153] FIGS. 8A-8E show that malignant B cell receptor recognizes
self-antigen myoferlin. FIG. 8A shows a schematic representation of
myoferlin-driven autoreactive lymphomagenesis. FIG. 8B shows PCR
analysis of bcl-2 rearrangement in FL patient 1 biopsy sample.
Staining of HEp-2 cells (FIG. 8C) and myoferlin-expressing HEK293T
cells (FIG. 8D) with soluble malignant BCR is shown. Shown in FIG.
8E is an alignment of the amino acid sequences of the identified
malignant-specific peptide FL1 with the protein Myoferlin and
surface proteins from Streptococcus mitis and Pneumocytis
jirovecii. The sequences from top to bottom correspond to SEQ ID
NOs: 1, 35, 36, and 37.
[0154] FIG. 9 shows percentages of hCD45+ lymphocytes, CD3+ T cells
and CD19+ B cells in the lymphoid gate of PBMC at different time
points following transplant.
[0155] FIG. 10 shows percentages of CD4+ and CD8+human T cell
subsets in the PBMC at different time points following
transplant.
[0156] FIG. 11 shows levels of human IgM and IgG in humanized mice
plasma at different time points following transplant.
[0157] FIG. 12 shows tumor growth kinetics in experimental
groups.
[0158] FIG. 13 shows quantity of CAR T cells on day 38.
[0159] FIG. 14 shows levels of hCD45+ lymphocytes, CD3+ T cells and
CD19+ B cells in the lymphoid gate in PBMC.
[0160] FIG. 15 shows percentages of CD4+ and CD8+ human T cell
subsets in the PBMC.
[0161] FIG. 16 shows levels of human IgM and IgG in mice plasma at
different time points following transplant.
[0162] FIG. 17 shows the CAR T lentiviral vector.
[0163] FIG. 18 shows tumor growth kinetics in experimental
groups.
[0164] FIG. 19 shows NNK coding moiety flanked by Cysteines used in
the Phage Display Cyclopeptide Library Kit used in Example 3. The
sequences from top to bottom correspond to SEQ ID NOs: 38, 39, and
40.
[0165] FIG. 20 shows ELISA results for the binding of phages
resulting from I-III rounds of panning as described in Example 3
against the BCR of patient FL1 with the BCR of patients FL1 and
FL5. Phage concentrations are, from left to right, 5, 2.5, 1.25,
0.63, and 0.31 mk/well for each round of panning for each antibody
shown.
DETAILED DESCRIPTION OF INVENTION
[0166] The disclosure provides methods for treatment of B cell
malignancies using personalized medicine. More particularly, the
methods provide for isolating a B cell receptor from a B cell
malignancy in a subject, identifying a ligand for the B cell
receptor, and then treating the subject with the B cell receptor
ligand coupled to a therapeutic agent, e.g., a CART cell in which
the B cell receptor ligand comprises the antigen binding domain. In
some embodiments, the methods of the disclosure use an
autocrine-based format to identify B cell receptor ligands specific
to a tumor. By co-expressing a B cell receptor and a library of
putative B cell receptor ligands, a B cell receptor ligand can be
identified by its binding to the B cell receptor. Alternatively,
the B cell receptor ligand can be identified by phage display. The
B cell receptor ligand can be an effective therapeutic when coupled
to a therapeutic agent because it can target the therapeutic agent
to the B cell malignancy by binding the B cell receptor. The
methods described herein are particularly useful for treating B
cell malignancies because B cell tumors are clonal populations
having B cell receptors that are present in all of the cells of the
tumor and only in the cells of the tumor. This allows for the
identification of a personalized therapeutic target with no or very
little off target effects.
[0167] In some embodiments, the methods described herein utilize
autocrine signaling. As such, the methods described herein make use
of autocrine signaling to identify novel therapeutics for treating
B cell malignancies. As is used herein, "autocrine signaling"
refers to a form of cell signaling in which a cell secretes a
hormone or chemical messenger, e.g., an antigen, that binds to
autocrine receptors, e.g., B cell receptors, on that same cell,
leading to changes in the cell.
[0168] As an example, B cell receptor ligands may be identified by
co-expressing a B cell receptor from a tumor and a CAR in a T cell,
where the extracellular domain of the CAR comprises a peptide from
a combinatorial peptide library. Activation of the T cell by the
CAR indicates that the extracellular domain of the CAR has bound
the B cell receptor and the peptide from the peptide library is a B
cell ligand.
[0169] Once a B cell receptor ligand is identified, a patient can
be treated with the ligand attached to a therapeutic agent.
Therapeutic agents can comprise chemotherapeutic drugs,
immunotherapy, or radioactive isotopes. A CAR comprising the B cell
receptor ligand can comprise a therapeutic agent. The CAR can be
the same CAR used to identify the B cell receptor ligand, allowing
for particularly fast identification of a personalized therapeutic
target and synthesis of personalized medicine.
[0170] The whole process, from diagnosis to treatment can be
completed in a short period of time, e.g., within several
weeks.
[0171] The disclosure also provides methods for treatment of cancer
by administering CAR-expressing T-cells, wherein the CAR comprises
an antigen binding domain that specifically binds a cancer-specific
antigen in a cancer-specific manner; and a vaccine comprising a
polypeptide or a nucleic acid expressing the same cancer-specific
antigen, or a cancer-specific fragment thereof. It has surprisingly
been discovered that when a CAR specific for a cancer antigen and
that same antigen are administered to a subject, the two have a
synergistic effect on a reduction in tumor volume.
[0172] In some embodiments, the CAR-expressing T cells comprise the
CAR with the putative B cell receptor ligand, and the vaccine
comprises a fragment or all of the B cell receptor. In some
embodiments, the CAR-expressing T cells comprise an antibody
fragment to an antigen that is specific to cancer cells and the
vaccine comprises a fragment or all of that same antigen.
B Cell Receptors
[0173] The B-cell receptor or BCR is a transmembrane receptor
protein located on the outer surface of B cells. The receptor's
binding moiety is composed of a membrane-bound antibody that, like
all antibodies, has a unique and randomly determined
antigen-binding site generated by V(D)J recombination. When a B
cell is activated by its first encounter with an antigen that binds
to its receptor (its "cognate antigen"), the cell proliferates and
differentiates to generate a population of antibody-secreting
plasma B cells and memory B cells.
[0174] The BCR complexes with CD79, a transmembrane protein, and
generates a signal following recognition of antigen by the BCR.
CD79 is composed of two distinct chains, CD79A and CD79B, which
form a heterodimer on the surface of a B cell stabilized by
disulfide bonding. CD79a and CD79b are both members of the
immunoglobulin superfamily. Both CD79 chains contain an
immunoreceptor tyrosine-based activation motif (ITAM) in their
intracellular tails that they use to propagate a signal in a B
cell, in a similar manner to CD3-generated signal tranduction
observed during T cell receptor activation on T cells.
[0175] As used herein, the term "antibody" refers to a protein that
includes at least one immunoglobulin variable domain or
immunoglobulin variable domain sequence. For example, an antibody
can include a heavy (H) chain variable region (abbreviated herein
as VH), and a light (L) chain variable region (abbreviated herein
as VL). In another example, an antibody includes two heavy (H)
chain variable regions and two light (L) chain variable regions. An
antibody can have the structural features of IgA, IgG, IgE, IgD,
IgM (as well as subtypes thereof).
[0176] The VH and VL regions can be further subdivided into regions
of hypervariability, termed "complementarity determining regions"
("CDR"), interspersed with regions that are more conserved, termed
"framework regions" ("FR"). The extent of the framework region and
CDRs has been precisely defined (see, Kabat, E. A., et al. (1991)
Sequences of Proteins of Immunological Interest, Fifth Edition,
U.S. Department of Health and Human Services, NIH Publication No.
91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917,
see also www.hgmp.mrc.ac.uk). Kabat definitions are used herein.
Each VH and VL is typically composed of three CDRs and four FRs,
arranged from amino-terminus to carboxy-terminus in the following
order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
[0177] The VH or VL chain of the antibody can further include a
heavy or light chain constant region, to thereby form a heavy or
light immunoglobulin chain, respectively. In one embodiment, the
antibody is a tetramer of two heavy immunoglobulin chains and two
light immunoglobulin chains, wherein the heavy and light
immunoglobulin chains are inter-connected by, e.g., disulfide
bonds. In IgGs, the heavy chain constant region includes three
immunoglobulin domains, CH1, CH2 and CH3.
[0178] B-cell malignancies represent a diverse collection of
diseases, including most non-Hodgkin's lymphomas (NHL), some
leukemias, and myelomas. Examples include chronic lymphocytic
leukemia, follicular lymphoma, mantle cell lymphoma and diffuse
large B-cell lymphoma. B cell malignancies can be characterized as
indolent or aggressive. Indolent malignancies, such as follicular
lymphoma, small lymphocytic lymphoma and marginal zone lymphoma,
are characterized by slow growth and a high initial response rate,
followed by a relapsing and progressive disease course. Aggressive
lymphomas, such as diffuse large B-cell lymphoma, mantle cell
lymphoma and Burkitt's lymphoma, are characterized by rapid growth
and lower initial response rates, with shorter overall survival
(OS).
[0179] B cell malignancies are characterized in that they are
clonal populations of B cells. Since they are clonal populations of
B cells, each cancerous cell in the population of cancer cells,
e.g., a tumor, has the same B cell receptor. As such, B cell
receptors on cancerous cells are tumor specific antigens that can
be targeted by the ligand (or "antigen") of the BCR. Accordingly,
disclosed herein are methods for identifying BCR ligands. Once
identified,
[0180] BCR ligands can be used, for example, as a cancer treatment.
Therapeutic agents can be targeted to cancer cells via the
interaction between the BCR and the BCR ligand.
[0181] In some embodiments, the methods described herein comprise
identifying or providing a B cell receptor, e.g., expressed in
cancer cells. In some embodiments, identifying or providing a B
cell receptor comprises acquiring a sample from a subject. In some
embodiments, the sample is a fluid sample, e.g., blood. In some
embodiments, the sample is a tissue sample. In some embodiments,
the sample comprises a, e.g., a tumor sample or a biopsy. In some
embodiments, the biopsy is a lymph node biopsy.
[0182] In some embodiments, the sample is from a subject having or
suspected of having cancer. In some embodiments, the cancer is a B
cell malignancy. In some embodiments, the cancer is a lymphoma. In
some embodiments, the cancer is selected from diffuse large B-cell
lymphoma (DLBCL), follicular lymphoma, marginal zone B-cell
lymphoma (MZL) or mucosa-associated lymphatic tissue lymphoma
(MALT), chronic lymphocytic leukemia (CLL), mantle cell lymphoma
(MCL), Burkitt's lymphoma, lymphoplasmacytic lymphoma, nodal
marginal zone B cell lymphoma (NMZL), splenic marginal zone
lymphoma (SMZL), intravascular large B-cell lymphoma, primary
effusion lymphoma, lymphomatoid granulomatosis, primary central
nervous system lymphoma, ALK-positive large B-cell lymphoma,
plasmablastic lymphoma, large B-cell lymphoma arising in
HHV8-associated multicentric Castleman's disease, and B-cell
lymphoma.
[0183] In some embodiments, the subject is determined to have any
of the cancers described herein. In some embodiments, the subject
is determined to have a B cell malignancy. In some embodiments, the
subject is determined to have lymphoma. In some embodiments, the
subject is determined to have one or more single-nucleotide
polymorphisms associated with cancer, e.g., a B cell malignancy
and/or lymphoma. As used herein "single-nucleotide polymorphism"
(SNP) refers to a DNA sequence variation occurring when a single
nucleotide--A, T, C or G--in the genome (or other shared sequence)
differs between members of a biological species or paired
chromosomes in an individual.
[0184] In some embodiments, identifying or providing a B cell
receptor comprises extracting RNA out of the cells of the sample.
Methods for extracting RNA out of cells are well known to those of
skill in the art and include, for example, phenol/chlorophorm based
extraction methods, or the use of the RNAeasy Kit.TM. (Qiagen).
[0185] In some embodiments, identifying or providing a B cell
receptor comprises synthesizing cDNA out of extracted RNA. Methods
for producing cDNA are well known to those of skill in the art and
comprises the formation of cDNA from mRNA by reverse
transcriptase.
[0186] In some embodiments, identifying or providing a B cell
receptor comprises sequencing the cDNA. The type of sequencing
performed can be, for example, pyrosequencing, single-molecule
real-time sequencing, ion torrent sequencing, sequencing by
synthesis, sequencing by ligation (SOLiD.TM.), and chain
termination sequencing (e.g., Sanger sequencing). Sequencing
methods are known in the art and commercially available (see, e.g.,
Ronaghi et al.; Uhlen, M; Nyren, P (1998). "A sequencing method
based on real-time pyrophosphate". Science 281 (5375): 363; and
Ronaghi et al.; Karamohamed, S; Pettersson, B; Uhlen, M; Nyren, P
(1996). "Real-time DNA sequencing using detection of pyrophosphate
release". Analytical Biochemistry 242 (1): 84-9; and services and
products available from Roche (454 platform), Illumina (HiSeq and
MiSeq systems), Pacific Biosciences (PACBIO RS II), Life
Technologies (Ion Proton.TM. systems and SOLiD.TM. systems)).
[0187] In some embodiments, the B cell receptor is cloned into an
expression vector for expressing the B cell receptor in T cells
using methods described herein.
[0188] In some embodiments, the B cell receptor is cloned into an
scFv format using a vector, e.g., a pComb3X vector.
[0189] In some embodiments, the scFv form of the B cell receptor is
cloned into a vector for expressing the antibody molecules as
dimers with the variable region in the plasma membrane with their
binding sites facing the solvent. In some embodiments, the scFv
form of the B cell receptor is cloned into a vector containing a
linker. In some embodiments, the linker is a a flexible linker to a
membrane-spanning domain of the platelet-derived growth factor
receptor. In some embodiments, the vector further comprises a
constant domain of antibody, e.g., Fc, e.g., IgG1 Fc.
Identifying B-Cell Receptor Ligands
[0190] In some embodiments, the methods described herein comprise
identifying a B cell receptor ligand. Once the B cell receptor is
identified, the ligand of the B cell receptor is identified by
contacting the B cell receptor with putative B cell receptor
ligands, e.g., a library of putative B cell receptor ligands.
[0191] In some embodiments, the methods described herein provide
for co-expressing B cell receptors and a library of putative B cell
receptor ligands in cells, e.g., T cells, and detecting binding of
the B cell receptor to a putative B cell receptor ligand, thereby
identifying a unique B cell receptor ligand.
[0192] In some embodiments, detecting binding comprises measuring
the level of B cell receptor signaling. When the B cell receptor
and a putative B cell receptor ligand are both expressed, e.g., in
a B cell, if the putative B cell receptor ligand is a ligand of the
B cell receptor, the binding of the B cell receptor will initiate a
signaling cascade. It some embodiments, detecting binding comprises
measuring the expression of genes regulated by BCR signaling.
[0193] In some embodiments, the methods described herein provide
for co-expressing B cell receptors and a library of CARs comprising
putative B cell receptor ligand domains in T cells and detecting
binding of the B cell receptor to a putative B cell receptor ligand
by identifying activation of the T cell by the CAR, thereby
identifying a unique B cell receptor ligand.
[0194] In some embodiments, T cells are transduced or transfected
with nucleic acids encoding B cell receptors and CARs and T cell
activation is measured after a period of time. In some embodiments,
T cell activation is measured 2, 4, 6, 8, 12, 16, or 20 hours, or
1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, or 5 days after transduction or
transfection, e.g., 2 days after transduction or transfection.
[0195] In some embodiments, co-expressing the B cell receptors and
CARs comprises culturing T cells transduced or transfected with
nucleic acids encoding B cell receptors and CARs in culture media.
Media for culturing T cells are well known to those of skill in the
art. In some embodiments, T cells are cultured in DMEM or RPMI
medium. In some embodiments, the medium is supplemented with FBS,
e.g, 5-20% FBS, e.g., 10% FBS. In some embodiments, the medium is
supplemented with HEPES, e.g., 1-100 mM HEPES, e.g., 10 mM HEPES.
In some embodiments, the medium is supplemented with penicillin,
e.g., 10-500 U/ml penicillin, e.g., 100 U/ml penicillin. In some
embodiments, the medium is supplemented with streptomycin, e.g.,
10-500 ug/ml streptomycin, e.g., 100 ug/ml streptomycin. In some
embodiments, the medium is supplemented with L-alanyl-L-glutamine,
e.g., 0.1-10 mM L-alanyl-L-glutamine, e.g., 2 mM
L-alanyl-L-glutamine.
[0196] In some embodiments, measuring the level of T cell
activation comprises measuring the nucleic acid or protein level of
a gene expressed in activated T cells. Examples of genes
downregulated during T cell activation include, for example,
L-selectin, CD127, and BCL-2. Examples of genes downregulated
during T cell activation include, for example CD69, CD25, CD40L,
CD44, Ki67, and KLRG1. In some embodiments, the T cell comprises a
fluorescent protein reporter gene under the control of a
transcription factor that activates transcription when the T cell
is activated and measuring activation comprises measuring the
amount of fluorescent protein produced. In some embodiments, the
transcription factor is Jun, NF-.kappa.B or Rel.
[0197] Gene expression can be measured at either the RNA or protein
level. Assays for detecting RNA include, but are not limited to,
Northern blot analysis, RT-PCR, sequencing technology, RNA in situ
hybridization (using e.g., DNA or RNA probes to hybridize RNA
molecules present in the sample), in situ RT-PCR (e.g., as
described in Nuovo G J, et al. Am J Surg Pathol. 1993, 17: 683-90;
Komminoth P, et al. Pathol Res Pract. 1994, 190: 1017-25), and
oligonucleotide microarray (e.g., by hybridization of
polynucleotide sequences derived from a sample to oligonucleotides
attached to a solid surface (e.g., a glass wafer with addressable
location, such as Affymetrix microarray (Affymetrix.RTM., Santa
Clara, Calif.)).
[0198] Assays for detecting protein levels include, but are not
limited to, immunoassays (also referred to herein as immune-based
or immuno-based assays, e.g., Western blot, ELISA, proximity
extension assays, and ELISpot assays), Mass spectrometry, and
multiplex bead-based assays. Other examples of protein detection
and quantitation methods include multiplexed immunoassays as
described for example in U.S. Pat. Nos. 6,939,720 and 8,148,171,
and published U.S. Patent Application No. 2008/0255766, and protein
microarrays as described for example in published U.S. Patent
Application No. 2009/0088329.
[0199] In some embodiments, once an activated T cell is identified,
the CAR expressed in the T cell is identified. Accordingly, in some
embodiments, protocols for identifying activated T cells allow for
the identification of activated T cells and the separation of
activated T cells from unactivated T cells. One example of such a
protocol is flow cytometry. The use of flow cytometry generally,
and Fluorescence-activated cell sorting (FACS) in particular, are
readily known to those of skill in the art for the purpose of cell
sorting based on a variety of properties. In FACS, a heterogeneous
mixture of biological cells can be sorted into two or more
containers, one cell at a time, based upon the specific light
scattering and fluorescent characteristics of each cell. This
allows, for example, for cells to be sorted on the basis of
fluorescent markers. Accordingly, in certain embodiments, T cell
activation can be measured by levels of a fluorescently marked or
labeled transcript or protein. In some embodiments, the expression
level of a protein, e.g., a cell surface localized protein, e.g., a
protein upregulated or downregulated in activated T cells described
herein, can be measured by contacting the cells with an antibody
coupled, covalently or non-covalently, to a fluorescent label. In
some embodiments, the antibody targets the protein upregulated or
downregulated in activated T cells. This can allow the cells to be
sorted based on expression level of a protein upregulated or
downregulated in activated T cells, thereby allowing separation of
activated from unactivated T cells. In one exemplary embodiment,
activated T cells can be identified by binding of the T cells to
GFP-labeled anti-CD69 antibody.
[0200] In some embodiments, detecting binding between a putative B
cell receptor ligand and a cell expressing a B cell receptor
comprises visualizing binding of the putative B cell receptor
ligand to the cell expressing the B cell receptor. For example, in
some embodiments, the ligand is tagged to allow for visualization
of the localization of the ligand. Suitable tags include, for
example, fluorescent genes such as GFP, YFP, RFP and the like. In
some embodiments, localization of the putative B cell receptor
ligand to the cell expressing the B cell receptor can be assessed
using any suitable method known by those of skill in the art, e.g.,
fluorescence microscopy, immunohistochemistry, or FACS. In some
embodiments, a B cell receptor ligand binds to the cells expressing
the B cell receptor and does not bind to the same cell type when
the B cell receptor is not expressed.
[0201] In some embodiments the library pf putative B cell receptor
ligands is contacted to the B cell receptor by phage display.
"Phage display" is a technique by which variant polypeptides are
displayed as fusion proteins to a coat protein on the surface of
phage, e.g. filamentous phage, particles. A utility of phage
display lies in the fact that large libraries of randomized protein
variants can be rapidly and efficiently sorted for those sequences
that bind to a target molecule with high affinity. Display of
peptides and proteins libraries on phage has been used for
screening millions of polypeptides for ones with specific binding
properties. Polyvalent phage display methods have been used for
displaying small random peptides and small proteins through fusions
to either gene 111 or gene VIII of filamentous phage. Wells and
Lowman, Curr. Opin. Struct. Biol., 1992, 3:355-362 and references
cited therein. In monovalent phage display, a protein or peptide
library is fused to a gene 111 or a portion thereof and expressed
at low levels in the presence of wild type gene III protein so that
phage particles display one copy or none of the fusion proteins.
Avidity effects are reduced relative to polyvalent phage so that
sorting is on the basis of intrinsic ligand affinity, and phagemid
vectors are used, which simplify DNA manipulations. Lowman and
Wells, Methods: A companion to Methods in Enzymology, 1991,
3:205-216.
[0202] Phage display of proteins, peptides and mutated variants
thereof, including constructing a family of variant replicable
vectors containing a transcription regulatory element operably
linked to a gene fusion encoding a fusion polypeptide, transforming
suitable host cells, culturing the transformed cells to form phage
particles which display the fusion polypeptide on the surface of
the phage particle, contacting the recombinant phage particles with
a target molecule so that at least a portion of the particle bind
to the target, separating the particles which bind from those that
do not are known and may be used with the transformation method of
the invention. See U.S. Pat. No. 5,750,373; WO 97/09446; U.S. Pat.
Nos. 5,514,548; 5,498,538; 5,516,637; 5,432,018; WO 96/22393; U.S.
Pat. Nos. 5,658,727; 5,627,024; WO 97/29185; O'Boyle et al, 1997,
Virology, 236:338-347; Soumillion et al, 1994, Appl. Biochem.
Biotech., 47:175-190; O'Neil and Hoess, 1995, Curr. Opin. Struct.
Biol., 5:443-449; Makowski, 1993, Gene, 128:5-11; Dunn, 1996, Curr.
Opin. Struct. Biol., 7:547-553; Choo and King, 1995, Curr. Opin.
Struct. Biol., 6:431-436; Bradbury and Cattaneo, 1995, TINS,
18:242-249; Cortese et al., 1995, Curr. Opin. Struct. Biol.,
6:73-80; Allen et al., 1995, TIBS, 20:509-516; Lindquist and
Naderi, 1995, FEMS Micro. Rev., 17:33-39; Clarkson and Wells, 1994,
Tibtech, 12:173-184; Barbas, 1993, Curr. Opin. Biol., 4:526-530;
McGregor, 1996, Mol. Biotech., 6:155-162; Cortese et al., 1996,
Curr. Opin. Biol., 7; 616-621; McLafferty et al., 1993, Gene,
128:29-36. Using phage display, in some embodiments, putative B
cell receptor ligands capable of binding to the B cell receptor as
described herein are isolated from a suitable library. Exemplary
putative B cell receptor ligand libraries include phage-peptide
libraries such as New England Biolabs Ph.D.-7 and Ph.D.-12
libraries. Methods of generating peptide libraries and screening
these libraries are also disclosed in U.S. Pat. Nos. 5,723,286;
5,432,018; 5,580,717; 5,427,908; and 5,498,530. See also U.S. Pat.
Nos. 5,770,434; 5,734,018; 5,698,426; 5,763,192; and 5,723,323. In
the selection process, a putative B cell receptor ligand library
can be probed with the target B cell receptor or a fragment thereof
and members of the library that are capable of binding to the B
cell receptor can be isolated, typically by retention on a support.
Such screening process may be performed by multiple rounds (e.g.,
including both positive and negative selections) to enrich the pool
of putative B cell receptor ligands capable of binding to the B
cell receptor. In some embodiments, negative selection is performed
in each round of panning. Individual clones of the enriched pool
can then be isolated and further characterized to identify those
having desired binding activity and biological activity. Sequences
of the putative B cell receptor ligands can also be determined via
conventional methodology.
[0203] As an example, phage displays typically use a covalent
linkage to bind the protein (e.g., putative B cell receptor ligand
domain) component to a bacteriophage coat protein. The linkage
results from translation of a nucleic acid encoding the putative B
cell receptor ligand domain component fused to the coat protein.
The linkage can include a flexible peptide linker, a protease site,
or an amino acid incorporated as a result of suppression of a stop
codon. Phage display is described, for example, in U.S. Pat. No.
5,223,409; Smith (1985) Science 228:1315-1317; WO 92/18619; WO
91/17271; WO 92/20791; WO 92/15679; WO 93/01288; WO 92/01047; WO
92/09690; WO 90/02809; de Haard et al. (1999) J. Biol. Chem
274:18218-30; Hoogenboom et al. (1998) Immunotechnology 4:1-20;
Hoogenboom et al. (2000) Immunol Today 2:371-8 and Hoet et al.
(2005) Nat Biotechnol. 23(3)344-8. Bacteriophage displaying the
putative B cell receptor ligand domain component can be grown and
harvested using standard phage preparatory methods, e.g. PEG
precipitation from growth media. After selection of individual
display phages, the nucleic acid encoding the selected protein
components can be isolated from cells infected with the selected
phages or from the phage themselves, after amplification.
Individual colonies or plaques can be selected, and then the
nucleic acid may be isolated and sequenced.
[0204] After display library members are isolated for binding to
the target antigen, each isolated library member can be also tested
for its ability to bind to a non-target molecule to evaluate its
binding specificity. Examples of non-target molecules include
streptavidin on magnetic beads, blocking agents such as bovine
serum albumin, non-fat bovine milk, soy protein, any capturing or
target immobilizing monoclonal antibody, or non-transfected cells
which do not express the target. A high-throughput ELISA screen can
be used to obtain the data, for example. The ELISA screen can also
be used to obtain quantitative data for binding of each library
member to the target as well as for cross species reactivity to
related targets or subunits of the target antigen and also under
different condition such as pH 6 or pH 7.5. The non-target and
target binding data are compared (e.g., using a computer and
software) to identify library members that specifically bind to the
target.
Putative B Cell Receptor Ligands
[0205] Provided herein are methods of identifying unique B cell
receptor ligands, e.g., for cancer therapy, comprising identifying
a putative unique B cell receptor ligand as binding a unique B cell
receptor.
[0206] In some embodiments, the putative B cell receptor ligand
comprises a polypeptide. In some embodiments, a putative B cell
receptor ligand comprises a cyclopeptide. In some embodiments, a
putative B cell receptor ligand comprises a peptoid. In some
embodiments, a putative B cell receptor ligand comprises a
cyclopeptoid. In some embodiments, the putative B cell receptor
ligand comprises a polysaccharide. In some embodiments, the
putative B cell receptor ligand comprises a lipid. In some
embodiments, the putative B cell receptor ligand comprises a small
molecule.
[0207] In some embodiments, the putative B cell receptor ligand
comprises an amino acid sequence that encodes a portion or all of a
cellular protein. In some embodiments, the putative B cell receptor
ligand comprises an amino acid sequence that does not encode a
portion or all of a cellular protein.
[0208] In some embodiments, the putative B cell receptor ligand is
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, or 40 amino acids in length, e.g., 9 amino acids in
length. In some embodiments, the putative B cell receptor ligand is
less than 20, less than 15, or less than 10 amino acids in length.
In some embodiments, the putative B cell receptor ligand is 2-20,
5-15, or 7-10 amino acids in length.
[0209] In some embodiments, the putative B cell receptor ligand
comprises the sequence YX.sub.nZ. In some embodiments, Y and Z are
polar uncharged amino acids. In some embodiments, Y and Z are C or
conservative substitutions of C, e.g., S, A, M, or T. In some
embodiments, the putative B cell receptor ligand comprises the
sequence CX.sub.nC. In some embodiments, the putative B cell
receptor ligand comprises the sequence SX.sub.nS. In some
embodiments, the putative B cell receptor ligand comprises the
sequence CX.sub.nS. In some embodiments, the putative B cell
receptor ligand comprises the sequence SX.sub.nC. In some
embodiments, X is any of the 20 amino acids encoded by DNA. In some
embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, or 20, e.g., n is 7. In some embodiments, n is
15 or less, 12 or less, or 9 or less. In some embodiments, n is
2-15, 5-10, or 6-8. In some embodiments, the putative B cell
receptor ligand comprises any of SEQ ID NOs: 1-3.
[0210] In some embodiments, the putative B cell receptor ligand
comprises a cyclopeptide with the sequence CX.sub.nC, and the N-
and C-terminal Cys form a Cys-Cys interaction, circularizing the
cyclopeptide.
[0211] Also provided herein are libraries of putative B cell
receptor ligands.
[0212] In some embodiments, the library of putative B cell receptor
ligands is generated from a cDNA library and with each putative B
cell receptor ligand comprising a portion or all of a cDNA.
[0213] In some embodiments, the library of putative B cell receptor
ligands comprises a peptide library. In some embodiments, the
peptide library is a combinatorial peptide library. In some
embodiments, the putative B cell receptor ligands in the peptide
library comprises the sequence YX.sub.nZ with the putative B cell
receptor ligands differing in X.sub.n sequence. In some
embodiments, Y and Z are polar uncharged amino acids. In some
embodiments, Y and Z are C or conservative substitutions of C,
e.g., S, A, M, or T. In some embodiments, the putative B cell
receptor ligands in the peptide library comprises the sequence
CX.sub.nC with the putative B cell receptor ligands differing in
X.sub.n sequence. In some embodiments, the putative B cell receptor
ligands in the peptide library comprises the sequence SX.sub.nS
with the putative B cell receptor ligands differing in X.sub.n
sequence. In some embodiments, the putative B cell receptor ligands
in the peptide library comprises the sequence CX.sub.nS with the
putative B cell receptor ligands differing in X.sub.n sequence. In
some embodiments, the putative B cell receptor ligands in the
peptide library comprises the sequence SX.sub.nC with the putative
B cell receptor ligands differing in X.sub.n sequence. In some
embodiments, X is any of the 20 amino acids encoded by DNA. In some
embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, or 20, e.g., n is 7. In some embodiments, n is
15 or less, 12 or less, or 9 or less. In some embodiments, n is
2-15, 5-10, or 6-8. In some embodiments, X.sub.n sequence is
generated by PCR with oligonucleotides having degenerate NNN, NNK,
or NNS codons at the X positions. In some embodiments, the
degenerate codons are NNK codons.
[0214] In some embodiments the putative B cell receptor ligand
comprises the antigen binding domain of a CAR. In some embodiments
the putative B cell receptor ligand is linked to a phage, e.g., as
a component of a phage display libaray.
Chimeric Antigen Receptors (CARs)
[0215] Disclosed herein are methods for identifying B cell receptor
ligands by co-expressing B cell receptors and CARs having a
putative B cell receptor ligand domain as an extracellular domain
and measuring T cell activation.
[0216] Also disclosed herein are methods for treating cancer by
treating a subject with CAR-expressing T-cells, wherein the CAR
comprises an antigen binding domain that specifically binds a
cancer-specific antigen in a cancer-specific manner and a vaccine
comprising a polypeptide or a nucleic acid expressing the
cancer-specific antigen, or a cancer-specific fragment thereof.
[0217] In one aspect an exemplary CAR construct disclosed herein
comprise an optional leader sequence, an extracellular putative B
cell receptor ligand domain, a hinge, a transmembrane domain, and
an intracellular stimulatory domain. In one aspect an exemplary CAR
construct comprises an optional leader sequence, an extracellular
putative B cell receptor ligand domain, a hinge, a transmembrane
domain, an intracellular costimulatory domain and an intracellular
stimulatory domain.
[0218] The term "Chimeric Antigen Receptor" or alternatively a
"CAR" refers to a recombinant polypeptide construct comprising at
least an extracellular ligand domain, a transmembrane domain and a
cytoplasmic signaling domain (also referred to herein as "an
intracellular signaling domain") comprising a functional signaling
domain derived from a stimulatory molecule as defined below. In
some embodiments, the domains in the CAR polypeptide construct are
in the same polypeptide chain, e.g., comprise a chimeric fusion
protein. In some embodiments, the domains in the CAR polypeptide
construct are not contiguous with each other.
[0219] Antigen Binding Domain
[0220] In some embodiments, the CAR described herein comprises an
extracellular domain. In some embodiments, the extracellular domain
comprises an antigen binding domain. In some embodiments, the
antigen binding domain is a putative B cell receptor ligand domain
comprising a putative B cell receptor ligand, e.g., a putative B
cell receptor ligand described herein. In some embodiments,
provided herein are a library of CARs with the CARs differing in
their antigen binding domains, e.g., putative B cell receptor
ligand domains. In some embodiments, each CAR within the library
comprises a distinct antigen binding domain, e.g., putative B cell
receptor ligand domain. In some embodiments, the library of CARs
comprises an extracellular domain and the extracellular domain
comprises the library of antigen binding domains, e.g., putative B
cell receptor ligands described herein.
[0221] In some embodiments, the putative B cell receptor ligand
domain further comprises an Fc domain, which is CH2 and CH3 of a
heavy chain constant region. In some embodiments, the Fc domain is
from a heavy chain constant region chosen from, e.g., the heavy
chain constant regions of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2,
IgD, and IgE; particularly, chosen from, e.g., the (e.g., human)
heavy chain constant regions of IgG1, IgG2, IgG3, and IgG4.
[0222] In some embodiments, antigen binding domain comprises an
immunoglobulin chain or fragment thereof, comprising at least one
immunoglobulin variable domain sequence. The term "antigen binding
domain" encompasses antibodies and antibody fragments. In an
embodiment, an antibody molecule is a multispecific antibody
molecule, e.g., it comprises a plurality of immunoglobulin variable
domain sequences, wherein a first immunoglobulin variable domain
sequence of the plurality has binding specificity for a first
epitope and a second immunoglobulin variable domain sequence of the
plurality has binding specificity for a second epitope. In an
embodiment, a multispecific antibody molecule is a bispecific
antibody molecule. A bispecific antibody has specificity for no
more than two antigens. A bispecific antibody molecule is
characterized by a first immunoglobulin variable domain sequence
which has binding specificity for a first epitope and a second
immunoglobulin variable domain sequence that has binding
specificity for a second epitope.
[0223] In some embodiments, the antigen binding domain specifically
binds a cancer-specific antigen.
[0224] In some embodiments, the CARs of the present invention
includes CARs comprising an antigen binding domain (e.g., antibody
or antibody fragment) that binds to a MHC presented peptide.
Normally, peptides derived from endogenous proteins fill the
pockets of Major histocompatibility complex (MHC) class I
molecules, and are recognized by T cell receptors (TCRs) on CD8+T
lymphocytes. The MHC class I complexes are constitutively expressed
by all nucleated cells. In cancer, virus-specific and/or
tumor-specific peptide/MHC complexes represent a unique class of
cell surface targets for immunotherapy. TCR-like antibodies
targeting peptides derived from viral or tumor antigens in the
context of human leukocyte antigen (HLA)-A1 or HLA-A2 have been
described (see, e.g., Sastry et al., J Virol. 2011 85(5):1935-1942;
Sergeeva et al., Blood, 2011 117(16):4262-4272; Verma et al., J
Immunol 2010 184(4):2156-2165; Willemsen et al., Gene Ther 2001
8(21):1601-1608; Dao et al., Sci Transl Med 2013 5(176):176ra33;
Tassev et al., Cancer Gene Ther 2012 19(2):84-100). For example,
TCR-like antibody can be identified from screening a library, such
as a human scFv phage displayed library.
[0225] The antigen binding domain can be any protein that binds to
the antigen including but not limited to a monoclonal antibody, a
polyclonal antibody, a recombinant antibody, a human antibody, a
humanized antibody, and a functional fragment thereof, including
but not limited to a single-domain antibody such as a heavy chain
variable domain (VH), a light chain variable domain (VL) and a
variable domain (VHH) of camelid derived nanobody, and to an
alternative scaffold known in the art to function as antigen
binding domain, such as a recombinant fibronectin domain, and the
like. In some instances, it is beneficial for the antigen binding
domain to be derived from the same species in which the CAR will
ultimately be used in. For example, for use in humans, it may be
beneficial for the antigen binding domain of the CAR to comprise
human or humanized residues for the antigen binding domain of an
antibody or antibody fragment.
[0226] In one aspect, the antigen binding domain comprises a human
antibody or an antibody fragment.
[0227] In one aspect, the antigen binding domain comprises a
humanized antibody or an antibody fragment.
[0228] A humanized antibody can be produced using a variety of
techniques known in the art, including but not limited to,
CDR-grafting (see, e.g., European Patent No. EP 239,400;
International Publication No. WO 91/09967; and U.S. Pat. Nos.
5,225,539, 5,530,101, and 5,585,089, each of which is incorporated
herein in its entirety by reference), veneering or resurfacing
(see, e.g., European Patent Nos. EP 592,106 and EP 519,596; Padlan,
1991, Molecular Immunology, 28(4/5):489-498; Studnicka et al.,
1994, Protein Engineering, 7(6):805-814; and Roguska et al., 1994,
PNAS, 91:969-973, each of which is incorporated herein by its
entirety by reference), chain shuffling (see, e.g., U.S. Pat. No.
5,565,332, which is incorporated herein in its entirety by
reference), and techniques disclosed in, e.g., U.S. Patent
Application Publication No. US2005/0042664, U.S. Patent Application
Publication No. US2005/0048617, U.S. Pat. Nos. 6,407,213,
5,766,886, International Publication No. WO 9317105, Tan et al., J.
Immunol., 169:1119-25 (2002), Caldas et al., Protein Eng.,
13(5):353-60 (2000), Morea et al., Methods, 20(3):267-79 (2000),
Baca et al., J. Biol. Chem., 272(16):10678-84 (1997), Roguska et
al., Protein Eng., 9(10):895-904 (1996), Couto et al., Cancer Res.,
55 (23 Supp):5973s-5977s (1995), Couto et al., Cancer Res.,
55(8):1717-22 (1995), Sandhu J S, Gene, 150(2):409-10 (1994), and
Pedersen et al., J. Mol. Biol., 235(3):959-73 (1994), each of which
is incorporated herein in its entirety by reference. Often,
framework residues in the framework regions will be substituted
with the corresponding residue from the CDR donor antibody to
alter, for example improve, antigen binding. These framework
substitutions are identified by methods well-known in the art,
e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; and Riechmann et al., 1988, Nature, 332:323,
which are incorporated herein by reference in their
entireties.)
[0229] A humanized antibody or antibody fragment has one or more
amino acid residues remaining in it from a source which is
nonhuman. These nonhuman amino acid residues are often referred to
as "import" residues, which are typically taken from an "import"
variable domain. As provided herein, humanized antibodies or
antibody fragments comprise one or more CDRs from nonhuman
immunoglobulin molecules and framework regions wherein the amino
acid residues comprising the framework are derived completely or
mostly from human germline. Multiple techniques for humanization of
antibodies or antibody fragments are well-known in the art and can
essentially be performed following the method of Winter and
co-workers (Jones et al., Nature, 321:522-525 (1986); Riechmann et
al., Nature, 332:323-327 (1988); Verhoeyen et al., Science,
239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences
for the corresponding sequences of a human antibody, i.e.,
CDR-grafting (EP 239,400; PCT Publication No. WO 91/09967; and U.S.
Pat. Nos. 4,816,567; 6,331,415; 5,225,539; 5,530,101; 5,585,089;
6,548,640, the contents of which are incorporated herein by
reference herein in their entirety). In such humanized antibodies
and antibody fragments, substantially less than an intact human
variable domain has been substituted by the corresponding sequence
from a nonhuman species. Humanized antibodies are often human
antibodies in which some CDR residues and possibly some framework
(FR) residues are substituted by residues from analogous sites in
rodent antibodies. Humanization of antibodies and antibody
fragments can also be achieved by veneering or resurfacing (EP
592,106; EP 519,596; Padlan, 1991, Molecular Immunology,
28(4/5):489-498; Studnicka et al., Protein Engineering,
7(6):805-814 (1994); and Roguska et al., PNAS, 91:969-973 (1994))
or chain shuffling (U.S. Pat. No. 5,565,332), the contents of which
are incorporated herein by reference herein in their entirety.
[0230] In some embodiments, an antigen binding domain is derived
from a display library. A display library is a collection of
entities; each entity includes an accessible polypeptide component
and a recoverable component that encodes or identifies the
polypeptide component. The polypeptide component is varied so that
different amino acid sequences are represented. The polypeptide
component can be of any length, e.g. from three amino acids to over
300 amino acids. A display library entity can include more than one
polypeptide component, for example, the two polypeptide chains of a
Fab. In one exemplary embodiment, a display library can be used to
identify an antigen binding domain. In a selection, the polypeptide
component of each member of the library is probed with the antigen,
or a fragment there, and if the polypeptide component binds to the
antigen, the display library member is identified, typically by
retention on a support.
[0231] Retained display library members are recovered from the
support and analyzed. The analysis can include amplification and a
subsequent selection under similar or dissimilar conditions. For
example, positive and negative selections can be alternated. The
analysis can also include determining the amino acid sequence of
the polypeptide component and purification of the polypeptide
component for detailed characterization.
[0232] A variety of formats can be used for display libraries.
Examples include the phage display. In phage display, the protein
component is typically covalently linked to a bacteriophage coat
protein. The linkage results from translation of a nucleic acid
encoding the protein component fused to the coat protein. The
linkage can include a flexible peptide linker, a protease site, or
an amino acid incorporated as a result of suppression of a stop
codon. Phage display is described, for example, in U.S. Pat. No.
5,223,409; WO 92/18619; WO 91/17271; WO 92/20791; WO 92/15679; WO
93/01288; WO 92/01047; WO 92/09690; WO 90/02809. Bacteriophage
displaying the protein component can be grown and harvested using
standard phage preparatory methods, e.g. PEG precipitation from
growth media. After selection of individual display phages, the
nucleic acid encoding the selected protein components can be
isolated from cells infected with the selected phages or from the
phage themselves, after amplification. Individual colonies or
plaques can be picked, the nucleic acid isolated and sequenced.
[0233] Other display formats include cell based display (see, e.g.,
WO 03/029456), protein-nucleic acid fusions (see, e.g., U.S. Pat.
No. 6,207,446), ribosome display, and E. coli periplasmic
display.
[0234] In one aspect the CAR comprises a leader sequence at the
amino-terminus (N-ter) of the antigen binding domain. In one
aspect, the CAR further comprises a leader sequence at the
N-terminus of the antigen binding domain, wherein the leader
sequence is optionally cleaved from the antigen binding domain
(e.g., aa scFv) during cellular processing and localization of the
CAR to the cellular membrane. In some embodiments, the leader
sequence is an interleukin 2 signal peptide.
[0235] Transmembrane Domain
[0236] The transmembrane domain may be derived either from a
natural or from a recombinant source. Where the source is natural,
the domain may be derived from any membrane-bound or transmembrane
protein. In one aspect the transmembrane domain is capable of
signaling to the intracellular domain(s) whenever the CAR has bound
to a target. A transmembrane domain of particular use in this
invention may include at least the transmembrane region(s) of e.g.,
the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3
epsilon, CD45, CD4, CDS, CD8 (e.g., CD8 alpha, CD8 beta), CD9,
CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. In
some embodiments, a transmembrane domain may include at least the
transmembrane region(s) of, e.g., KIRDS2, OX40, CD2, CD27, LFA-1
(CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM
(LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19,
IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4,
CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, rfGAL,
CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18,
LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96
(Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100
(SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME
(SLAMF8), SELPLG (CD162), LTBR, PAG/Cbp, NKG2D, NKG2C, and
CD19.
[0237] In some instances, the transmembrane domain can be attached
to the extracellular region of the CAR, e.g., the ligand domain of
the CAR, via a hinge, e.g., a hinge from a human protein. For
example, in one embodiment, the hinge can be a human Ig
(immunoglobulin) hinge, e.g., an IgG4 hinge, or a CD8a hinge.
[0238] Cytoplasmic Domain
[0239] The cytoplasmic domain or region of the present CAR includes
an intracellular signaling domain. An intracellular signaling
domain is capable of activation of at least one of the normal
effector functions of the immune cell in which the CAR has been
introduced.
[0240] Examples of intracellular signaling domains for use in the
CAR of the invention include the cytoplasmic sequences of the T
cell receptor (TCR) and co-receptors that act in concert to
initiate signal transduction following antigen receptor engagement,
as well as any derivative or variant of these sequences and any
recombinant sequence that has the same functional capability.
[0241] T cell activation can be said to be mediated by two distinct
classes of cytoplasmic signaling sequences: those that initiate
antigen-dependent primary activation through the TCR (primary
intracellular signaling domains) and those that act in an
antigen-independent manner to provide a secondary or costimulatory
signal (secondary cytoplasmic domain, e.g., a costimulatory
domain).
[0242] An "intracellular signaling domain," as the term is used
herein, refers to an intracellular portion of a molecule. The
intracellular signaling domain can generate a signal that promotes
an immune effector function of the CAR containing cell, e.g., a
CART cell or CAR-expressing NK cell. Examples of immune effector
function, e.g., in a CART cell or CAR-expressing NK cell, include
cytolytic activity and helper activity, including the secretion of
cytokines. In embodiments, the intracellular signal domain
transduces the effector function signal and directs the cell to
perform a specialized function. While the entire intracellular
signaling domain can be employed, in many cases it is not necessary
to use the entire chain. To the extent that a truncated portion of
the intracellular signaling domain is used, such truncated portion
may be used in place of the intact chain as long as it transduces
the effector function signal. The term intracellular signaling
domain is thus meant to include any truncated portion of the
intracellular signaling domain sufficient to transduce the effector
function signal. In an embodiment, the intracellular signaling
domain can comprise a primary intracellular signaling domain.
Exemplary primary intracellular signaling domains include those
derived from the molecules responsible for primary stimulation, or
antigen dependent simulation. In an embodiment, the intracellular
signaling domain can comprise a costimulatory intracellular domain.
Exemplary costimulatory intracellular signaling domains include
those derived from molecules responsible for costimulatory signals,
or antigen independent stimulation. For example, in the case of a
CAR-expressing immune effector cell, e.g., CART cell or
CAR-expressing NK cell, a primary intracellular signaling domain
can comprise a cytoplasmic sequence of a T cell receptor, and a
costimulatory intracellular signaling domain can comprise
cytoplasmic sequence from co-receptor or costimulatory
molecule.
[0243] A primary intracellular signaling domain can comprise a
signaling motif which is known as an immunoreceptor tyrosine-based
activation motif or ITAM. Examples of FFAM containing primary
cytoplasmic signaling sequences include, but are not limited to,
those derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3
delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 ("ICOS"), FceRI,
CD66d, DAP10, and DAP12.
[0244] The intracellular signalling domain of the CAR can comprise
the primary signalling domain, e.g., CD3-zeta signaling domain, by
itself or it can be combined with any other desired intracellular
signaling domain(s) useful in the context of a CAR of the
invention. For example, the intracellular signaling domain of the
CAR can comprise a primary signalling domain, e.g., CD3 zeta chain
portion, and a costimulatory signaling domain.
[0245] A costimulatory intracellular signaling domain refers to the
intracellular portion of a costimulatory molecule. The
intracellular signaling domain can comprise the entire
intracellular portion, or the entire native intracellular signaling
domain, of the molecule from which it is derived, or a functional
fragment thereof. The term "costimulatory molecule" refers to the
cognate binding partner on a T cell that specifically binds with a
costimulatory ligand, thereby mediating a costimulatory response by
the T cell, such as, but not limited to, proliferation.
Costimulatory molecules are cell surface molecules other than
antigen receptors or their ligands that are required for an
efficient immune response. Examples of such molecules include a MHC
class I molecule, TNF receptor proteins, Immunoglobulin-like
proteins, cytokine receptors, integrins, signaling lymphocytic
activation molecules (SLAM proteins), activating NK cell receptors,
BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30,
CD40, CDS, ICAM-1, LFA-1 (CD1 la/CD18), 4-1BB (CD137), B7-H3, CDS,
ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2,
SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8alpha,
CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a,
ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103,
ITGAL, CD11a, LFA-1, ITGAM, CD11b, CD11c, ITGB1, CD29, ITGB2, CD18,
LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE/RANKL, DNAM1 (CD226),
SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9
(CD229), CD160 (BY55), PSGL1, CDIOO (SEMA4D), CD69, SLAMF6 (NTB-A,
Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG
(CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, CD19a, and a ligand that
specifically binds with CD83. For example, CD27 co-stimulation has
been demonstrated to enhance expansion, effector function, and
survival of human CART cells in vitro and augments human T cell
persistence and antitumor activity in vivo (Song et al. Blood.
2012; 119(3):696-706).
Expression in Cells
[0246] In some embodiments, the methods described herein comprise
expressing B cell receptors and putative B cell receptor ligands,
e.g., CARs comprising putative B cell receptor ligands, in cells,
e.g., T cells for identifying a B cell receptor ligand, e.g., for
treatment of cancer. The methods described herein also comprise
expressing CARs in T cells for cancer treatment.
[0247] In some embodiments, the disclosure encompasses DNA
constructs for expressing CARs in cells, e.g., T cells. The nucleic
acid sequences coding for the desired molecules can be obtained
using recombinant methods known in the art, such as, for example by
screening libraries from cells expressing the gene, by deriving the
gene from a vector known to include the same, or by isolating
directly from cells and tissues containing the same, using standard
techniques. For example, as is described herein, sequences of B
cell receptors can be derived from cancer cells. Recombinant DNA
and molecular cloning techniques used here are well known in the
art and are described, for example, by Sambrook, J., Fritsch, E. F.
and Maniatis, T. MOLECULAR CLONING: A LABORATORY MANUAL, 2nd ed.;
Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y., 1989
(hereinafter "Maniatis"); and by Silhavy, T. J., Bennan, M. L. and
Enquist, L. W. EXPERIMENTS WITH GENE FUSIONS; Cold Spring Harbor
Laboratory: Cold Spring Harbor, N.Y., 1984; and by Ausubel, F. M.
et al., IN CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, published by
Greene Publishing and Wiley-Interscience, 1987; (the entirety of
each of which is hereby incorporated herein by reference).
[0248] Alternatively, the gene of interest can be produced
synthetically, rather than cloned.
[0249] The present disclosure also provides vectors in which a DNA
of the present disclosure is inserted. Vectors derived from
retroviruses such as the lentivirus are suitable tools to achieve
long-term gene transfer since they allow long-term, stable
integration of a transgene and its propagation in daughter cells.
Lentiviral vectors have the added advantage over vectors derived
from onco-retroviruses such as murine leukemia viruses in that they
can transduce non-proliferating cells, such as hepatocytes. They
also have the added advantage of low immunogenicity. In another
embodiment, the desired B cell receptor or CAR can be expressed in
the cells by way of transposons.
[0250] A "lentivirus" as used herein refers to a genus of the
Retroviridae family. Lenti viruses are unique among the
retroviruses in being able to infect non-dividing cells; they can
deliver a significant amount of genetic information into the DNA of
the host cell, so they are one of the most efficient methods of a
gene delivery vector. HIV, SIV, and FIV are all examples of lenti
viruses. Vectors derived from lenti viruses offer the means to
achieve significant levels of gene transfer in vivo.
[0251] Expression of natural or synthetic nucleic acids encoding B
cell receptors and CARs is typically achieved by operably linking a
nucleic acid encoding the polypeptide expressing the B cell
receptor or CAR or portions thereof to a promoter, and
incorporating the construct into an expression vector. The vectors
can be suitable for replication and integration into eukaryotes.
Typical cloning vectors contain transcription and translation
terminators, initiation sequences, and promoters useful for
regulation of the expression of the desired nucleic acid sequence.
The expression constructs of the disclosure may also be used for
nucleic acid immunization and gene therapy, using standard gene
delivery protocols. Methods for gene delivery are known in the art.
See, e.g., U.S. Pat. Nos. 5,399,346, 5,580,859, 5,589,466,
incorporated by reference herein in their entireties. In another
embodiment, the disclosure provides a gene therapy vector.
[0252] The nucleic acid can be cloned into a number of types of
vectors. For example, the nucleic acid can be cloned into a vector
including, but not limited to a plasmid, a phagemid, a phage
derivative, an animal virus, and a cosmid. Vectors of particular
interest include expression vectors, replication vectors, probe
generation vectors, and sequencing vectors.
[0253] Further, the expression vector may be provided to a cell in
the form of a viral vector. Viral vector technology is well known
in the art and is described, for example, in Sambrook et al. (2001,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, New York), and in other virology and molecular biology
manuals. Viruses, which are useful as vectors include, but are not
limited to, retroviruses, adenoviruses, adeno-associated viruses,
herpes viruses, and lentiviruses. In general, a suitable vector
contains an origin of replication functional in at least one
organism, a promoter sequence, convenient restriction endonuclease
sites, and one or more selectable markers, (e.g., WO 01/96584; WO
01/29058; and U.S. Pat. No. 6,326,193).
[0254] A number of viral based systems have been developed for gene
transfer into mammalian cells. For example, retroviruses provide a
convenient platform for gene delivery systems. A selected gene can
be inserted into a vector and packaged in retroviral particles
using techniques known in the art. The recombinant virus can then
be isolated and delivered to cells of the subject either in vivo or
ex vivo. A number of retroviral systems are known in the art. In
some embodiments, retrovirus vectors are used. A number of
retrovirus vectors are known in the art. In some embodiments,
lentivirus vectors are used.
[0255] Additional promoter elements, e.g., enhancers, regulate the
frequency of transcriptional initiation. Typically, these are
located in the region 30-110 bp upstream of the start site,
although a number of promoters have recently been shown to contain
functional elements downstream of the start site as well. The
spacing between promoter elements frequently is flexible, so that
promoter function is preserved when elements are inverted or moved
relative to one another. In the thymidine kinase (tk) promoter, the
spacing between promoter elements can be increased to 50 bp apart
before activity begins to decline. Depending on the promoter, it
appears that individual elements can function either cooperatively
or independently to activate transcription.
[0256] One example of a suitable promoter is the immediate early
cytomegalovirus (CMV) promoter sequence. This promoter sequence is
a strong constitutive promoter sequence capable of driving high
levels of expression of any polynucleotide sequence operatively
linked thereto. Another example of a suitable promoter is
Elongation Factor-1a (EF-1a). However, other constitutive promoter
sequences may also be used, including, but not limited to the
simian virus 40 (SV40) early promoter, mouse mammary tumor virus
(MMTV), human immunodeficiency virus (HIV) long terminal repeat
(LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter,
an Epstein-Barr virus immediate early promoter, a Rous sarcoma
virus promoter, as well as human gene promoters such as, but not
limited to, the actin promoter, the myosin promoter, the hemoglobin
promoter, and the creatine kinase promoter. Further, the disclosure
is not limited to the use of constitutive promoters. Inducible
promoters are also contemplated as part of the disclosure. The use
of an inducible promoter provides a molecular switch capable of
turning on expression of the polynucleotide sequence which it is
operatively linked when such expression is desired, or turning off
the expression when expression is not desired. Examples of
inducible promoters include, but are not limited to a
metallothionine promoter, a glucocorticoid promoter, a progesterone
promoter, and a tetracycline promoter. In some embodiments, the
promoter is a EF-1a promoter.
[0257] In order to assess the expression of a B cell receptors or
CAR or portions thereof, the expression vector to be introduced
into a cell can also contain either a selectable marker gene or a
reporter gene or both to facilitate identification and selection of
expressing cells. In other aspects, the selectable marker may be
carried on a separate piece of DNA and used in a co-transfection
procedure. Both selectable markers and reporter genes may be
flanked with appropriate regulatory sequences to enable expression
in the host cells. Useful selectable markers include, for example,
antibiotic-resistance genes, such as neo and the like, and
fluorescent genes such as GFP, YFP, RFP and the like. In some
embodiments, reporter genes or selectable marker genes are excluded
from a CAR polypeptide used in a therapy as described herein.
[0258] Reporter genes are used for identifying potentially
transfected cells and for evaluating the functionality of
regulatory sequences. In general, a reporter gene is a gene that is
not present in or expressed by the recipient organism or tissue and
that encodes a polypeptide whose expression is manifested by some
easily detectable property, e.g., enzymatic activity, antibiotic
resistance or fluorescence. Expression of the reporter gene is
assayed at a suitable time after the DNA has been introduced into
the recipient cells. Suitable reporter genes may include genes
encoding luciferase, beta-galactosidase, chloramphenicol acetyl
transferase, secreted alkaline phosphatase, or the green
fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters
479: 79-82). Suitable expression systems are well known and may be
prepared using known techniques or obtained commercially. In
general, the construct with the minimal 5' flanking region showing
the highest level of expression of reporter gene is identified as
the promoter. Such promoter regions may be linked to a reporter
gene and used to evaluate agents for the ability to modulate
promoter-driven transcription.
[0259] Methods of introducing and expressing genes into a cell are
known in the art. In the context of an expression vector, the
vector can be readily introduced into a host cell, e.g., mammalian,
bacterial, yeast, or insect cell by any method in the art. For
example, the expression vector can be transferred into a host cell
by physical, chemical, or biological means. In some embodiments,
the host cell is a T cell.
[0260] Physical methods for introducing a polynucleotide into a
host cell include calcium phosphate precipitation, lipofection,
particle bombardment, microinjection, electroporation, and the
like. Methods for producing cells comprising vectors and/or
exogenous nucleic acids are well-known in the art. See, for
example, Sambrook et al. (2001, Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory, New York). A preferred
method for the introduction of a polynucleotide into a host cell is
calcium phosphate transfection.
[0261] Biological methods for introducing a polynucleotide of
interest into a host cell include the use of DNA and RNA vectors.
Viral vectors, and especially retroviral vectors, have become the
most widely used method for inserting genes into mammalian, e.g.,
human cells. Other viral vectors can be derived from lentivirus,
poxviruses, herpes simplex virus I, adenoviruses and
adeno-associated viruses, and the like. See, for example, U.S. Pat.
Nos. 5,350,674 and 5,585,362.
[0262] Chemical means for introducing a polynucleotide into a host
cell include colloidal dispersion systems, such as macromolecule
complexes, nanocapsules, microspheres, beads, and lipid-based
systems including oil-in-water emulsions, micelles, mixed micelles,
and liposomes. An example of a colloidal system for use as a
delivery vehicle in vitro and in vivo is a liposome (e.g., an
artificial membrane vesicle).
Sources of Cells
[0263] In some embodiments, cells are transfected with nucleic
acids expressing a B cell receptor and/or a CAR. The term
"transfected" or "transformed" or "transduced" as used herein
refers to a process by which exogenous nucleic acid is transferred
or introduced into the host cell. A "transfected" or "transformed"
or "transduced" cell is one which has been transfected, transformed
or transduced with exogenous nucleic acid. The cell includes the
primary subject cell and its progeny.
[0264] In some embodiments, the cells are mammalian cells. In some
embodiments, the cells are human cells. In some embodiments, the
cells are immune cells, e.g., B cells, T cells, or NK cells. In
particular embodiments, the cells are T cells.
[0265] Immune cells (e.g., T cells) can be obtained from a number
of sources, including peripheral blood mononuclear cells, bone
marrow, lymph node tissue, cord blood, thymus tissue, tissue from a
site of infection, ascites, pleural effusion, spleen tissue, and
tumors. The immune cells (e.g., T cells) may also be generated from
induced pluripotent stem cells or hematopoietic stem cells or
progenitor cells. In some embodiments, any number of immune cell
lines, including but not limited to T cell lines, including, for
example, Hep-2, Jurkat, and Raji cell lines, available in the art,
may be used. In some embodiments, immune cells (e.g., T cells) can
be obtained from a unit of blood collected from a subject using any
number of techniques known to the skilled artisan, such as
Ficoll.TM. separation. In some embodiments, cells from the
circulating blood of an individual are obtained by apheresis. The
apheresis product typically contains lymphocytes, including T
cells, monocytes, granulocytes, B cells, NK cells, other nucleated
white blood cells, red blood cells, and platelets. In some
embodiments, the cells collected by apheresis may be washed to
remove the plasma fraction and to place the cells in an appropriate
buffer or media for subsequent processing steps. In some
embodiments, the cells are washed with phosphate buffered saline
(PBS). In an alternative embodiment, the wash solution lacks
calcium and may lack magnesium or may lack many if not all divalent
cations. Again, surprisingly, initial activation steps in the
absence of calcium lead to magnified activation. As those of
ordinary skill in the art would readily appreciate a washing step
may be accomplished by methods known to those in the art, such as
by using a semi-automated "flow-through" centrifuge (for example,
the Cobe 2991 cell processor, the Baxter CytoMate, or the
Haemonetics Cell Saver 5) according to the manufacturer's
instructions. After washing, the cells may be resuspended in a
variety of biocompatible buffers, such as, for example,
Ca.sup.2+-free, Mg.sup.2+-free PBS, PlasmaLyte A, or other saline
solution with or without buffer. Alternatively, the undesirable
components of the apheresis sample may be removed and the cells
directly resuspended in culture media.
[0266] In some embodiments, immune cells (e.g., T cells) are
isolated from peripheral blood lymphocytes by lysing the red blood
cells and depleting the monocytes, for example, by centrifugation
through a PERCOLL.TM. gradient or by counterflow centrifugal
elutriation. A specific subpopulation of T cells, such as
CD3.sup.+, CD28.sup.+, CD4.sup.+, CD8.sup.+, CD45RA.sup.+, and
CD45RO.sup.+T cells, can be further isolated by positive or
negative selection techniques.
[0267] Enrichment of a T cell population by negative selection can
be accomplished with a combination of antibodies directed to
surface markers unique to the negatively selected cells. One method
is cell sorting and/or selection via negative magnetic
immunoadherence or flow cytometry that uses a cocktail of
monoclonal antibodies directed to cell surface markers present on
the cells negatively selected. For example, to enrich for CD4.sup.+
cells by negative selection, a monoclonal antibody cocktail
typically includes antibodies to CD14, CD20, CD11b, CD16, HLA-DR,
and CD8. In certain embodiments, it may be desirable to enrich for
or positively select for regulatory T cells which typically express
CD4.sup.+, CD25.sup.+, CD62L.sup.hi, GITR.sup.+, and
FoxP3.sup.+.
[0268] Alternatively, in certain embodiments, T regulatory cells
are depleted by anti-C25 conjugated beads or other similar method
of selection.
Methods of Treatment
[0269] Provided herein are methods of treatment using the B cell
receptor ligands identified herein. In particular, provided herein
are methods for rapid treatment of B cell malignancies. For
example, the methods described herein allow for the rapid
identification of a B cell receptor ligand by co-expressing a CAR
having a putative B cell receptor ligand and a B cell receptor in a
T cell, and identifying binding of the putative B cell receptor
ligand to the B cell receptor by activation of the B cell, and in
some embodiments, the same CAR used in identification of the B cell
receptor ligand can be used for treatment, allowing for the rapid
identification and treatment of B cell malignancies. In some
embodiments, provided herein are methods of treatment using B cell
receptor ligands that activate a T cell when a CAR comprising the B
cell ligand is co-expressed with the B cell receptor of the
lymphoma cells of a subject being treated in T cells.
[0270] In some embodiments, a subject is treated with a B cell
receptor ligand coupled to a therapeutic agent.
[0271] In some embodiments, the B cell receptor ligand coupled to a
therapeutic agent comprises a therapeutic CAR, e.g., a CAR
described herein, expressed in a T cell as is described herein,
e.g., a CAR-T cell. In some embodiments, the therapeutic CAR
comprises a CAR used in a method of identifying a B cell
receptor.
[0272] In some embodiments, the CART cell, e.g., a T cell
expressing a CAR described herein, results in greater specificity
and/or activity than a control. In some embodiments, the control
comprises a CAR T cell. In some embodiments, the CAR T cell has an
antigen binding domain specific for an antigen unrelated to cancer.
In some embodiments, the CAR T cell has an antigen binding domain
specific for a cancer-specific antigen, as is described herein.
[0273] In some embodiments, activity and specificity can be
demonstrated by cytotoxicity. In some embodiments, activity
comprises cytotoxicity, e.g., as measured by % lysis, towards cells
expressing the unique B cell receptor relative to a control. In
some embodiments, the % lysis is 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%,
8%, 9%, 10%, 15%, 20%, or more greater than a control.
[0274] In some embodiments, specificity comprises cytotoxicity,
e.g., as measured by % lysis, towards cells that do not express the
unique B cell receptor. In some embodiments, the % lysis is 0.1%,
1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or more less
than a control. In some embodiments, % lysis is measured at an
effector:target ratio of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1,
9:1, 10:1, or greater.
[0275] In some embodiments, subjects treated with the CART cell,
e.g., a T cell expressing a CAR described herein, exhibit reduced
cytokine release syndrome (CRS) relative to a subject treated with
a control.
[0276] As used herein, "coupled" refers to the association of two
molecules though covalently and non-covalent interactions, e.g., by
hydrogen, ionic, or Van-der-Waals bonds. Such bonds may be formed
between at least two of the same or different atoms or ions as a
result of redistribution of electron densities of those atoms or
ions. For example, a B cell ligand may be coupled to a therapeutic
agent as a fusion protein.
[0277] In some embodiments, a therapeutic agent comprises a
radioactive isotope such as an .alpha.-, .beta.-, or
.gamma.-emitter, or a .beta.- and .gamma.-emitter.
[0278] In some embodiments, a therapeutic agent comprises a
chemotherapy. Chemotherapeutic agents include, for example,
including alkylating agents, anthracyclines, cytoskeletal
disruptors (Taxanes), epothilones, histone deacetylase inhibitors,
inhibitors of topoisomerase I, inhibitors of topoisomerase II,
kinase inhibitors, nucleotide analogs and precursor analogs,
peptide antibiotics, platinum-based agents, retinoids, vinca
alkaloids and derivatives thereof. Non-limiting examples include:
(i) anti-angiogenic agents (e.g., TNP-470, platelet factor 4,
thrombospondin-1, tissue inhibitors of metalloproteases (TIMP1 and
TIMP2), prolactin (16-Kd fragment), angiostatin (38-Kd fragment of
plasminogen), endostatin, bFGF soluble receptor, transforming
growth factor beta, interferon alpha, soluble KDR and FLT-1
receptors, placental proliferin-related protein, as well as those
listed by Carmeliet and Jain (2000)); (ii) a VEGF antagonist or a
VEGF receptor antagonist such as anti-VEGF antibodies, VEGF
variants, soluble VEGF receptor fragments, aptamers capable of
blocking VEGF or VEGFR, neutralizing anti-VEGFR antibodies,
inhibitors of VEGFR tyrosine kinases and any combinations thereof;
and (iii) chemotherapeutic compounds such as, e.g., pyrimidine
analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and
cytarabine), purine analogs, folate antagonists and related
inhibitors (mercaptopurine, thioguanine, pentostatin and
2-chlorodeoxyadenosine (cladribine)); antiproliferative/antimitotic
agents including natural products such as vinca alkaloids
(vinblastine, vincristine, and vinorelbine), microtubule disruptors
such as taxane (paclitaxel, docetaxel), vincristine, vinblastine,
nocodazole, epothilones, and navelbine, epidipodophyllotoxins
(etoposide and teniposide), DNA damaging agents (actinomycin,
amsacrine, anthracyclines, bleomycin, busulfan, camptothecin,
carboplatin, chlorambucil, cisplatin, cyclophosphamide, cytoxan,
dactinomycin, daunorubicin, doxorubicin, epirubicin,
hexamethyhnelamineoxaliplatin, iphosphamide, melphalan,
merchlorehtamine, mitomycin, mitoxantrone, nitrosourea, plicamycin,
procarbazine, taxol, taxotere, teniposide,
triethylenethiophosphoramide and etoposide (VP16)); antibiotics
such as dactinomycin (actinomycin D), daunorubicin, doxorubicin
(adriamycin), idarubicin, anthracyclines, mitoxantrone, bleomycin,
plicamycin (mithramycin) and mitomycin; enzymes (L-asparaginase
which systemically metabolizes L-asparagine and deprives cells
which do not have the capacity to synthesize their own asparagine);
antiplatelet agents; antiproliferative/antimitotic alkylating
agents such as nitrogen mustards (mechlorethamine, cyclophosphamide
and analogs, melphalan, chlorambucil), ethylenimines and
methylmelamines (hexamethylmelamine and thiotepa), alkyl
sulfonates-busulfan, nitrosoureas (carmustine (BCNU) and analogs,
streptozocin), trazenes-dacarbazinine (DTIC);
antiproliferative/antimitotic antimetabolites such as folic acid
analogs (methotrexate); platinum coordination complexes (cisplatin,
carboplatin), procarbazine, hydroxyurea, mitotane,
aminoglutethimide; hormones, hormone analogs (estrogen, tamoxifen,
goserelin, bicalutamide, nilutamide) and aromatase inhibitors
(letrozole, anastrozole); anticoagulants (heparin, synthetic
heparin salts and other inhibitors of thrombin); fibrinolytic
agents (such as tissue plasminogen activator, streptokinase and
urokinase), aspirin, dipyridamole, ticlopidine, clopidogrel,
abciximab; antimigratory agents; antisecretory agents (breveldin);
immunosuppressives (cyclosporine, tacrolimus (FK-506), sirolimus
(rapamycin), azathioprine, mycophenolate mofetil); anti-angiogenic
compounds (e.g., TNP-470, genistein, bevacizumab) and growth factor
inhibitors (e.g., fibroblast growth factor (FGF) inhibitors);
angiotensin receptor blocker; nitric oxide donors; anti-sense
oligonucleotides; antibodies (trastuzumab); cell cycle inhibitors
and differentiation inducers (tretinoin); mTOR inhibitors,
topoisomerase inhibitors (doxorubicin (adriamycin), amsacrine,
camptothecin, daunorubicin, dactinomycin, eniposide, epirubicin,
etoposide, idarubicin, mitoxantrone, topotecan, and irinotecan),
corticosteroids (cortisone, dexamethasone, hydrocortisone,
methylprednisolone, prednisone, and prednisolone); growth factor
signal transduction kinase inhibitors; mitochondrial dysfunction
inducers and caspase activators; and chromatin disruptors.
[0279] In some embodiments, a therapeutic agent comprises an
immunotherapy. Cancer immunotherapy is the use of the immune system
to reject cancer. The main premise is stimulating the subject's
immune system to attack the tumor cells that are responsible for
the disease. This can be either through immunization of the
subject, in which case the subject's own immune system is rendered
to recognize tumor cells as targets to be destroyed, or through the
administration of therapeutics, such as antibodies, as drugs, in
which case the subject's immune system is recruited to destroy
tumor cells by the therapeutic agents. Cancer immunotherapy
includes an antibody-based therapy and cytokine-based therapy.
[0280] A number of therapeutic monoclonal antibodies have been
approved by the FDA for use in humans, and more are underway. The
FDA-approved monoclonal antibodies for cancer immunotherapy include
antibodies against CD52, CD33, CD20, ErbB2, vascular endothelial
growth factor and epidermal growth factor receptor. Examples of
monoclonal antibodies approved by the FDA for cancer therapy
include, without limitation: Rituximab (available as Rituxan.TM.),
Trastuzumab (available as Herceptin.TM.), Alemtuzumab (available as
Campath-IH.TM.), Cetuximab (available as Erbitux.TM.), Bevacizumab
(available as Avastin.TM.) Panitumumab (available as Vectibix.TM.),
Gemtuzumab ozogamicin (available as Mylotarg.TM.) Ibritumomab
tiuxetan (available as Zevalin.TM.), Tositumomab (available as
Bexxar.TM.) Ipilimumab (available as Yervoy.TM.), Ofatunumab
(available as Arzerra.TM.), Daclizumab (available as Zinbryta.TM.),
Nivolumab (available as Opdivo.TM.), and Pembrolizumab (available
as Keytruda.TM.). Examples of monoclonal antibodies currently
undergoing human clinical testing for cancer therapy in the United
States include, without limitation: WX-G250 (available as
Rencarex.TM.), Zanolimumab (available as HuMax-CD4), ch14.18,
Zalutumumab (available as HuMax-EGFr), Oregovomab (available as
B43.13, OvalRex.TM.), Edrecolomab (available as IGN-101,
Panorex.TM.), 131I-chTNT-I/B (available as Cotara.TM.), Pemtumomab
(available as R-1549, Theragyn.TM.), Lintuzumab (available as
SGN-33), Labetuzumab (available as hMN14, CEAcide.TM.), Catumaxomab
(available as Removab.TM.), CNTO 328 (available as cCLB8), 3F8,
177Lu-J591, Nimotuzumab, SGN-30, Ticilimumab (available as
CP-675206), Epratuzumab (available as hLL2, LymphoCide.TM.),
90Y-Epratuzumab, Galiximab (available as IDEC-114), MDX-060,
CT-011, CS-1008, SGN-40, Mapatumumab (available as TRM-I),
Apolizumab (available as HuID10, Remitogen.TM.) and Volociximab
(available as M200).
[0281] Cancer immunotherapy also includes a cytokine-based therapy.
The cytokine-based cancer therapy utilizes one or more cytokines
that modulate a subject's immune response. Non-limiting examples of
cytokines useful in cancer treatment include interferon-.alpha.
(IFN-.alpha.), interleukin-2 (IL-2), Granulocyte-macrophage
colony-stimulating factor (GM-CSF) and interleukin-12 (IL-12).
[0282] The B cell receptor ligand coupled to therapeutic agents, as
well as encoding nucleic acids or nucleic acid sets, vectors
comprising such, or host cells comprising the vectors, described
herein are useful for treating cancer, including B cell
malignancies, e.g. B cell lymphomas.
[0283] In some embodiments, more than one B cell receptor ligand
coupled to a therapeutic agent, or a combination of a B cell
receptor ligand coupled to a therapeutic agent and another suitable
therapeutic agent, may be administered to a subject in need of the
treatment. The B cell receptor ligand coupled to a therapeutic
agent can also be used in conjunction with other agents that serve
to enhance and/or complement the effectiveness of the agents.
[0284] Also contemplated herein are methods of treatment comprises
concomitantly administering CAR-expressing T-cells, wherein the CAR
comprises an antigen binding domain that specifically binds a
cancer-specific antigen in a cancer-specific manner; and a vaccine
comprising a polypeptide or a nucleic acid expressing the
cancer-specific antigen, or a cancer-specific fragment thereof. In
some embodiments, the cancer-specific antigen comprises a B cell
receptor and the antigen binding domain comprises a B cell receptor
ligand described herein. In some embodiments, the antigen binding
domain comprises a B cell receptor ligand described herein
identified by the methods described herein.
[0285] The terms "cancer-specific antigen" or "tumor antigen"
interchangeably refers to a molecule (typically a protein,
carbohydrate or lipid) that is expressed on the surface of a cancer
cell, either entirely or as a fragment (e.g., MHC/peptide), and
which is useful for the preferential targeting of a pharmacological
agent to the cancer cell. In some embodiments, the cancer-specific
antigen comprises a B cell receptor and the antigen binding domain
comprises a B cell receptor ligand described herein. In some
embodiments, the antigen binding domain comprises a B cell receptor
ligand described herein identified by the methods described herein.
In some embodiments, a tumor antigen is a marker expressed by both
normal cells and cancer cells, e.g., a lineage marker, e.g., CD19
on B cells. In some embodiments, a tumor antigen is a cell surface
molecule that is overexpressed in a cancer cell in comparison to a
normal cell, for instance, 1-fold over expression, 2-fold
overexpression, 3-fold overexpression or more in comparison to a
normal cell. In some embodiments, a tumor antigen comprises a
somatic mutation, e.g., is a cell surface molecule that is
inappropriately synthesized in the cancer cell, for instance, a
molecule that contains deletions, additions or mutations in
comparison to the molecule expressed on a normal cell. In some
embodiments, a cancer-specific antigen comprises a point mutation,
a splice-site mutation, a frameshift mutation, a read-through
mutation, or a gene-fusion mutation. In some embodiments, a
cancer-specific antigen comprises a mutation in EGFRvIII, PSCA,
BCMA, CD30, CEA, CD22, L1CAM, ROR1, ErbB, CD123, IL13Ra2,
Mesothelin, FR.alpha., VEGFR, c-Met, 5T4, CD44v6, B7-H4, CD133,
CD138, CD33, CD28, GPC3, EphA2, CD19, ACVR2B, anaplastic lymphoma
kinase (ALK), MYCN, BCR, HER2, NY-ESO1, MUC1, or MUC16. In some
embodiments, a tumor antigen will be expressed exclusively on the
cell surface of a cancer cell, entirely or as a fragment (e.g.,
MHC/peptide), and not synthesized or expressed on the surface of a
normal cell.
[0286] In some embodiments, the cancer-specific antigen binds a
cancer-specific antigen in a cancer-specific manner. In some
embodiments, when a the cancer-specific antigen binds a
cancer-specific antigen in a cancer-specific manner, the
cancer-specific antigen binds cancerous cells with 1.1.times.,
1.5.times., 2.times., 3.times., 4.times., 5.times., 6.times.,
7.times., 8.times., 9.times., 10.times., 20.times., 30.times.,
40.times., 50.times., 60.times., 70.times., 80.times., 90.times.,
100.times., 200.times., 300.times., 400.times., 500.times.,
600.times., 700.times., 800.times., 900.times., 1,000.times. or
more affinity than non-cancerous cells.
[0287] In some embodiments, the methods described herein comprise
identifying the cancer-specific antigen in a subject. In some
embodiments, identifying the cancer-specific antigen comprises
obtaining cancerous cells from a subject. In some embodiments, the
cancerous cells are obtained from a biopsy. In some embodiments,
the cancerous cells are in the blood of the subject.
[0288] In some embodiments, DNA from the cancerous cells is
extracted and sequenced. In some embodiments, the sequence of the
DNA, or of one or more genes is compared to the same sequence in
non-cancerous cells.
[0289] In some embodiments, RNA from the cancerous cells is
extracted and cDNA is synthesized. In some embodiments, the cDNA is
sequenced, In some embodiments, the sequence of the cDNA, or of one
or more genes is compared to the same sequence in non-cancerous
cells.
[0290] In some embodiments, identifying the cancer-specific antigen
comprises isolating and sequencing circulating cell free DNA of the
subject.
[0291] "Concomitantly" means administering two or more substances
to a subject in a manner that is correlated in time, preferably
sufficiently correlated in time so as to provide a modulation in an
immune response. In embodiments, concomitant administration may
occur through administration of two or more substances in the same
dosage form. In other embodiments, concomitant administration may
encompass administration of two or more substances in different
dosage forms, but within a specified period of time, preferably
within 1 month, more preferably within 1 week, still more
preferably within 1 day, and even more preferably within 1 hour.
The use of the term "concomitantly" does not restrict the order in
which the therapeutic agents are administered to a subject. A first
therapeutic agent, such as a CAR-T cell, can be administered prior
to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2
hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96
hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8
weeks, or 12 weeks before), simultaneously with, or subsequent to
(e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2
hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96
hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8
weeks, or 12 weeks after) the administration of a second
therapeutic agent, such as a vaccine described herein, to a
subject. Thus, a first agent can be administered separately,
sequentially or simultaneously with the second therapeutic agent.
In some embodiments, the concomitant administration occurs at least
two times, at least three times, at least four times, at least five
times, at least six times, at least seven times, at least eight
times, at least nine times, or at least ten times in the
subject.
[0292] In some embodiments, the CAR-expressing T cells are
administered before the vaccine. In some embodiments, the
CAR-expressing T cells are administered after the vaccine.
[0293] To practice the method disclosed herein, an effective amount
of the B cell receptor ligand coupled to a therapeutic agent, the
CARs, and the vaccines described herein can be administered to a
subject (e.g., a human) in need of the treatment via a suitable
route, such as intravenous administration, e.g., as a bolus or by
continuous infusion over a period of time, by intramuscular,
intraperitoneal, intracerebrospinal, subcutaneous, intra-articular,
intrasynovial, intrathecal, oral, inhalation or topical routes. In
some embodiments, vaccines described herein are administered
intratumorally. In some embodiments, CAR T-cells described herein
are administered intraveneously. Commercially available nebulizers
for liquid formulations, including jet nebulizers and ultrasonic
nebulizers are useful for administration. Liquid formulations can
be directly nebulized and lyophilized powder can be nebulized after
reconstitution. Alternatively, the B cell receptor ligand coupled
to a therapeutic agent, the CARs, and the vaccines as described
herein can be aerosolized using a fluorocarbon formulation and a
metered dose inhaler, or inhaled as a lyophilized and milled
powder.
[0294] The subject to be treated by the methods described herein
can be a mammal, more preferably a human. Mammals include, but are
not limited to, farm animals, sport animals, pets, primates,
horses, dogs, cats, mice and rats. A human subject who needs the
treatment may be a human patient having, at risk for, or suspected
of having a target disease/disorder, such as cancer. A subject
having a target disease or disorder can be identified by routine
medical examination, e.g., laboratory tests, organ functional
tests, CT scans, or ultrasounds. A subject suspected of having any
of such target disease/disorder might show one or more symptoms of
the disease/disorder. A subject at risk for the disease/disorder
can be a subject having one or more of the risk factors for that
disease/disorder.
[0295] The methods and compositions described herein may be used to
treat any disease or disorder associated with cancer. In some
embodiments, the cancer is a B cell malignancy. In some
embodiments, the cancer is a lymphoma. In some embodiments, the
cancer is selected from diffuse large B-cell lymphoma (DLBCL),
follicular lymphoma, marginal zone B-cell lymphoma (MZL) or
mucosa-associated lymphatic tissue lymphoma (MALT), chronic
lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), Burkitt's
lymphoma, lymphoplasmacytic lymphoma, nodal marginal zone B cell
lymphoma (NMZL), splenic marginal zone lymphoma (SMZL),
intravascular large B-cell lymphoma, primary effusion lymphoma,
lymphomatoid granulomatosis, primary central nervous system
lymphoma, ALK-positive large B-cell lymphoma, plasmablastic
lymphoma, large B-cell lymphoma arising in HHV8-associated
multicentric Castleman's disease, and B-cell lymphoma.
[0296] Other cancers include but are not limited to: Oral: buccal
cavity, lip, tongue, mouth, pharynx; Cardiac: sarcoma
(angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma),
myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: non-small
cell lung cancer (NSCLC), small cell lung cancer, bronchogenic
carcinoma (squamous cell or epidermoid, undifferentiated small
cell, undifferentiated large cell, adenocarcinoma), alveolar
(bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma,
chondromatous hamartoma, mesothelioma; Gastrointestinal: esophagus
(squamous cell carcinoma, larynx, adenocarcinoma, leiomyosarcoma,
lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas
(ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma,
carcinoid tumors, vipoma), small bowel or small intestines
(adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma,
leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel
or large intestines (adenocarcinoma, tubular adenoma, villous
adenoma, hamartoma, leiomyoma), rectal, colon, colon-rectum,
colorectal; Genitourinary tract: kidney (adenocarcinoma, Wilm's
tumor [nephroblastoma], lymphoma, leukemia), bladder and urethra
(squamous cell carcinoma, transitional cell carcinoma,
adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis
(seminoma, teratoma, embryonal carcinoma, teratocarcinoma,
choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma,
fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma
(hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma,
angiosarcoma, hepatocellular adenoma, hemangioma, biliary passages;
Bone: osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant
fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant
lymphoma (reticulum cell sarcoma), multiple myeloma, malignant
giant cell tumor chordoma, osteochronfroma (osteocartilaginous
exostoses), benign chondroma, chondroblastoma, chondromyxofibroma,
osteoid osteoma and giant cell tumors; Nervous system: skull
(osteoma, hemangioma, granuloma, xanthoma, osteitis deformans),
head and neck cancer, meninges (meningioma, meningiosarcoma,
gliomatosis), brain (astrocytoma, medulloblastoma, glioma,
ependymoma, germinoma [pinealoma], glioblastoma multiform,
oligodendroglioma, schwannoma, retinoblastoma, congenital tumors),
spinal cord neurofibroma, meningioma, glioma, sarcoma);
Gynecological: uterus (endometrial carcinoma), cervix (cervical
carcinoma, pre-tumor cervical dysplasia), ovaries (ovarian
carcinoma [serous cystadenocarcinoma, mucinous cystadenocarcinoma,
unclassified carcinoma], granulosa-thecal cell tumors,
Sertoll-Leydig cell tumors, dysgerminoma, malignant teratoma),
vulva (squamous cell carcinoma, intraepithelial carcinoma,
adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell
carcinoma, squamous cell carcinoma, botryoid sarcoma (embryonal
rhabdomyosarcoma), fallopian tubes (carcinoma), breast;
Hematologic: blood (myeloid leukemia [acute and chronic], acute
lymphoblastic leukemia, myeloproliferative diseases, multiple
myeloma, myelodysplastic syndrome), Hodgkin's disease,
non-Hodgkin's lymphoma [malignant lymphoma] hairy cell; lymphoid
disorders; Skin: malignant melanoma, basal cell carcinoma, squamous
cell carcinoma, Karposi's sarcoma, keratoacanthoma, moles
dysplastic nevi, lipoma, angioma, dermatofibroma, keloids,
psoriasis, Thyroid gland: papillary thyroid carcinoma, follicular
thyroid carcinoma; medullary thyroid carcinoma, multiple endocrine
neoplasia type 2A, multiple endocrine neoplasia type 2B, familial
medullary thyroid cancer, pheochromocytoma, paraganglioma; and
Adrenal glands: neuroblastoma.
[0297] As used herein, "an effective amount" refers to the amount
of each active agent required to confer therapeutic effect on the
subject, either alone or in combination with one or more other
active agents. In some embodiments, the therapeutic effect is
reduction in progression of cancer. Determination of whether an
amount of the B cell receptor ligand coupled to a therapeutic agent
described herein, or the CARs and the vaccines described herein
achieved the therapeutic effect would be evident to one of skill in
the art. Effective amounts vary, as recognized by those skilled in
the art, depending on the particular condition being treated, the
severity of the condition, the individual patient parameters
including age, physical condition, size, gender and weight, the
duration of the treatment, the nature of concurrent therapy (if
any), the specific route of administration and like factors within
the knowledge and expertise of the health practitioner. These
factors are well known to those of ordinary skill in the art and
can be addressed with no more than routine experimentation. It is
generally preferred that a maximum dose of the individual
components or combinations thereof be used, that is, the highest
safe dose according to sound medical judgment.
[0298] Empirical considerations, such as the half-life, generally
will contribute to the determination of the dosage. Frequency of
administration may be determined and adjusted over the course of
therapy, and is generally, but not necessarily, based on treatment
and/or suppression and/or amelioration and/or delay of a target
disease/disorder.
[0299] In one example, dosages may be determined empirically in
individuals who have been given one or more administration(s) of
the molecule. Individuals are given incremental dosages of the
molecule. To assess efficacy of the B cell receptor ligand coupled
to a therapeutic agent, or the CARs and the vaccines an indicator
of the disease/disorder can be followed.
[0300] For the purpose of the present disclosure, the appropriate
dosage will depend on the type and severity of the
disease/disorder, whether the B cell receptor ligand coupled to a
therapeutic agent or the CARs and the vaccines described herein is
administered for preventive or therapeutic purposes, previous
therapy, the patient's clinical history and response to the B cell
receptor ligand coupled to a therapeutic agent or the CARs and the
vaccines, and the discretion of the attending physician. Typically
the clinician will administer the B cell receptor ligand coupled to
a therapeutic agent or the CARs and the vaccines, until a dosage is
reached that achieves the desired result. In some embodiments, the
desired result is a decrease the severity of cancer. Methods of
determining whether a dosage resulted in the desired result would
be evident to one of skill in the art. Administration of one or
more B cell receptor ligands coupled to a therapeutic agents or the
CARs and the vaccines can be continuous or intermittent, depending,
for example, upon the recipient's physiological condition, whether
the purpose of the administration is therapeutic or prophylactic,
and other factors known to skilled practitioners. The
administration of a B cell receptor ligand coupled to a therapeutic
agent or the CARs and the vaccines may be essentially continuous
over a preselected period of time or may be in a series of spaced
dose, e.g., either before, during, or after developing a target
disease or disorder.
[0301] As used herein, the term "treating" refers to the
application or administration of a composition including one or
more active agents to a subject, who has a target disease or
disorder, a symptom of the disease/disorder, or a predisposition
toward the disease/disorder, with the purpose to cure, heal,
alleviate, relieve, alter, remedy, ameliorate, improve, or affect
the disorder, the symptom of the disease, or the predisposition
toward the disease or disorder.
[0302] Alleviating a target disease/disorder includes delaying the
development or progression of the disease, or reducing disease
severity. Alleviating the disease does not necessarily require
curative results. As used therein, "delaying" the development of a
target disease or disorder means to defer, hinder, slow, retard,
stabilize, and/or postpone progression of the disease. This delay
can be of varying lengths of time, depending on the history of the
disease and/or individuals being treated. A method that "delays" or
alleviates the development of a disease, or delays the onset of the
disease, is a method that reduces probability of developing one or
more symptoms of the disease in a given time frame and/or reduces
extent of the symptoms in a given time frame, when compared to not
using the method. Such comparisons are typically based on clinical
studies, using a number of subjects sufficient to give a
statistically significant result.
[0303] "Development" or "progression" of a disease means initial
manifestations and/or ensuing progression of the disease.
Development of the disease can be detectable and assessed using
standard clinical techniques as well known in the art. However,
development also refers to progression that may be undetectable.
For purpose of this disclosure, development or progression refers
to the biological course of the symptoms. "Development" includes
occurrence, recurrence, and onset. As used herein "onset" or
"occurrence" of a target disease or disorder includes initial onset
and/or recurrence.
[0304] The B cell receptor ligand coupled to a therapeutic agent or
the CARs and the vaccines described herein can be administered via
conventional routes, e.g., administered orally, parenterally, by
inhalation spray, topically, rectally, nasally, buccally, vaginally
or via an implanted reservoir. The term "parenteral" as used herein
includes subcutaneous, intracutaneous, intravenous, intramuscular,
intraarticular, intraarterial, intrasynovial, intrasternal,
intrathecal, intralesional, and intracranial injection or infusion
techniques. In addition, it can be administered to the subject via
injectable depot routes of administration such as using 1-, 3-, or
6-month depot injectable or biodegradable materials and methods. In
some examples, the pharmaceutical composition is administered
intraocularly or intravitreally.
[0305] In one embodiment, the B cell receptor ligand coupled to a
therapeutic agent or the CARs and the vaccines described herein is
administered via site-specific or targeted local delivery
techniques. Examples of site-specific or targeted local delivery
techniques include various implantable depot sources of the
antibody or local delivery catheters, such as infusion catheters,
an indwelling catheter, or a needle catheter, synthetic grafts,
adventitial wraps, shunts and stents or other implantable devices,
site specific carriers, direct injection, or direct application.
See, e.g., PCT Publication No. WO 00/53211 and U.S. Pat. No.
5,981,568.
[0306] Targeted delivery of therapeutic compositions containing an
antisense polynucleotide, expression vector, or subgenomic
polynucleotides can also be used. Receptor-mediated DNA delivery
techniques are described in, for example, Findeis et al., Trends
Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods
And Applications Of Direct Gene Transfer (J. A. Wolff, ed.) (1994);
Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol. Chem.
(1994) 269:542; Zenke et al., Proc. Natl. Acad. Sci. USA (1990)
87:3655; Wu et al., J. Biol. Chem. (1991) 266:338.
[0307] The therapeutic polynucleotides and polypeptides described
herein can be delivered using gene delivery vehicles. The gene
delivery vehicle can be of viral or non-viral origin (see
generally, Jolly, Cancer Gene Therapy (1994) 1:51; Kimura, Human
Gene Therapy (1994) 5:845; Connelly, Human Gene Therapy (1995)
1:185; and Kaplitt, Nature Genetics (1994) 6:148). Expression of
such coding sequences can be induced using endogenous mammalian or
heterologous promoters and/or enhancers. Expression of the coding
sequence can be either constitutive or regulated.
[0308] Viral-based vectors for delivery of a desired polynucleotide
and expression in a desired cell are well known in the art.
Exemplary viral-based vehicles include, but are not limited to,
recombinant retroviruses (see, e.g., PCT Publication Nos. WO
90/07936; WO 94/03622; WO 93/25698; WO 93/25234; WO 93/11230; WO
93/10218; WO 91/02805; U.S. Pat. Nos. 5,219,740 and 4,777,127; GB
Patent No. 2,200,651; and EP Patent No. 0 345 242),
alphavirus-based vectors (e.g., Sindbis virus vectors, Semliki
forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC
VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus
(ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532)), and
adeno-associated virus (AAV) vectors (see, e.g., PCT Publication
Nos. WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO
95/11984 and WO 95/00655). Administration of DNA linked to killed
adenovirus as described in Curiel, Hum. Gene Ther. (1992) 3:147 can
also be employed.
[0309] Non-viral delivery vehicles and methods can also be
employed, including, but not limited to, polycationic condensed DNA
linked or unlinked to killed adenovirus alone (see, e.g., Curiel,
Hum. Gene Ther. (1992) 3:147); ligand-linked DNA (see, e.g., Wu, J.
Biol. Chem. (1989) 264:16985); eukaryotic cell delivery vehicles
cells (see, e.g., U.S. Pat. No. 5,814,482; PCT Publication Nos. WO
95/07994; WO 96/17072; WO 95/30763; and WO 97/42338) and nucleic
charge neutralization or fusion with cell membranes. Naked DNA can
also be employed. Exemplary naked DNA introduction methods are
described in PCT Publication No. WO 90/11092 and U.S. Pat. No.
5,580,859. Liposomes that can act as gene delivery vehicles are
described in U.S. Pat. No. 5,422,120; PCT Publication Nos. WO
95/13796; WO 94/23697; WO 91/14445; and EP Patent No. 0524968.
Additional approaches are described in Philip, Mol. Cell. Biol.
(1994) 14:2411, and in Woffendin, Proc. Natl. Acad. Sci. (1994)
91:1581.
[0310] The particular dosage regimen, i.e., dose, timing and
repetition, used in the method described herein will depend on the
particular subject and that subject's medical history.
[0311] Treatment efficacy for a target disease/disorder can be
assessed by methods well-known in the art.
[0312] As used herein, the term "in combination" refers to the use
of more than one therapeutic agent. The use of the term "in
combination" does not restrict the order in which the therapeutic
agents are administered to a subject. A first therapeutic agent can
be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes,
45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours,
48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5
weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with,
or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45
minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48
hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5
weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a
second therapeutic agent. Thus, a first agent can be administered
separately, sequentially or simultaneously with the second
therapeutic agent.
[0313] In some embodiments, a CAR-T cell and a vaccine described
herein are administered in combination with a TLR9 agonist. In some
embodiments, the TLR9 agonist is a CpG oligonucleotide.
Vaccines
[0314] In some embodiments, CAR-expressing T-cells described herein
are administered with a vaccine. In some embodiments, the vaccine
comprises a polypeptide or a nucleic acid expressing a
cancer-specific antigen, or a cancer-specific fragment thereof, as
is described supra.
[0315] In some embodiments, the vaccine comprises a cancer-specific
fragment of a cancer-specific antigen.
[0316] In some embodiments, the cancer-specific fragment of the
cancer specific antigen is 1-1000 amino acids long, or 10-500 amino
acids long. In some embodiments, the cancer-specific fragment of
the cancer specific antigen is 10, 20, 30, 40, 50, 60, 70, 80, 90,
100, 200, 300, 400, or 500 or more amino acids long.
[0317] In some embodiments, the cancer-specific antigen, or a
cancer-specific fragment thereof comprises a somatic mutation as is
described supra, e.g., comprises a point mutation, a splice-site
mutation, a frameshift mutation, a read-through mutation, or a
gene-fusion mutation, and the polypeptide or nucleic acid
expressing the cancer-specific antigen, or cancer-specific fragment
thereof comprises the somatic mutation.
Peptide Vaccines
[0318] In some embodiments, the vaccine comprises a polypeptide
expressing a cancer-specific antigen, or a cancer-specific fragment
thereof.
[0319] In particular embodiments, the DNA that encodes for the
protein vaccine can be introduced into an expression vector, such
as a plasmid. Multiple cloning sites, which contain DNA sequences
that are recognized by restriction enzymes, can facilitate the
insertion of the protein vaccine DNA into the vector. In particular
embodiments, DNA constructs (such as expression vectors) that
encode the proteins of interest can be introduced into cells to
induce protein expression and the cells can be harvested to extract
the protein of interest. The DNA encoding the protein of interest
can be included in an expression vector that also contains
sequences that control gene expression, such as promoter sequences.
5' and 3' untranslated regions can be encoded upstream and
downstream of the protein coding sequence in order to enhance
expression. For example, a 5' untranslated leader sequence and a 3'
polyadenylation sequence can be used. In particular embodiments,
the DNA can be introduced into cells for protein expression by
heat-shock transformation. In particular embodiments, DNA can be
introduced into cells for protein expression by transfection,
electroporation, impalefection or hydrodynamic delivery. In
particular embodiments, the DNA used for protein expression can be
delivered in the form of a viral vector. In particular embodiments,
the protein of interest can be harvested from lysed cells, and
purified. Protein purification can be performed using
size-exclusion chromatography, or by a chromatography technique
that isolates the protein based on a protein-tag, such as a
6.times. histidine tag or a c-myc tag. The histidine tag can be
encoded adjacent to a sequence recognized and cleaved by a
protease, to facilitate removal of the histidine tag after protein
purification. An example of a protease that can be used to remove a
histidine tag from a protein is the human rhinovirus 3C
protease.
[0320] In some embodiments, the vaccine comprises two or more
polypeptides having overlapping sequences, each expressing a
fragment of the cancer-specific antigen.
[0321] In some embodiments, the polypeptide is conjugated to a
carrier protein, e.g., OVA, KLH, or BSA.
DNA Vaccines
[0322] In some embodiments, the vaccine comprises a nucleic acid
expressing a cancer-specific antigen, or a cancer-specific fragment
thereof.
[0323] In some embodiments, the nucleic acid is DNA. A DNA vaccine
may comprise an "expression vector" or "expression cassette," i.e.,
a nucleotide sequence which is capable of affecting expression of a
protein coding sequence in a host compatible with such sequences.
Expression cassettes include at least a promoter operably linked
with the polypeptide coding sequence; and, optionally, with other
sequences, e.g., transcription termination signals. Additional
factors necessary or helpful in effecting expression may also be
included, e.g., enhancers.
[0324] "Operably linked" means that the coding sequence is linked
to a regulatory sequence in a manner that allows expression of the
coding sequence. Known regulatory sequences are selected to direct
expression of the desired protein in an appropriate host cell.
Accordingly, the term "regulatory sequence" includes promoters,
enhancers and other expression control elements. Such regulatory
sequences are described in, for example, Goeddel, Gene Expression
Technology. Methods in Enzymology, vol. 185, Academic Press, San
Diego, Calif. (1990)).
[0325] A promoter region of a DNA or RNA molecule binds RNA
polymerase and promotes the transcription of an "operably linked"
nucleic acid sequence. As used herein, a "promoter sequence" is the
nucleotide sequence of the promoter which is found on that strand
of the DNA or RNA which is transcribed by the RNA polymerase. Two
sequences of a nucleic acid molecule, such as a promoter and a
coding sequence, are "operably linked" when they are linked to each
other in a manner which permits both sequences to be transcribed
onto the same RNA transcript or permits an RNA transcript begun in
one sequence to be extended into the second sequence. Thus, two
sequences, such as a promoter sequence and a coding sequence of DNA
or RNA are operably linked if transcription commencing in the
promoter sequence will produce an RNA transcript of the operably
linked coding sequence. In order to be "operably linked" it is not
necessary that two sequences be immediately adjacent to one another
in the linear sequence.
[0326] The preferred promoter sequences of the present invention
must be operable in mammalian cells and may be either eukaryotic or
viral promoters. Suitable promoters may be inducible, repressible
or constitutive. A "constitutive" promoter is one which is active
under most conditions encountered in the cell's environmental and
throughout development. An "inducible" promoter is one which is
under environmental or developmental regulation. A "tissue
specific" promoter is active in certain tissue types of an
organism. An example of a constitutive promoter is the viral
promoter MSV-LTR, which is efficient and active in a variety of
cell types, and, in contrast to most other promoters, has the same
enhancing activity in arrested and growing cells. Other preferred
viral promoters include that present in the CMV-LTR (from
cytomegalovirus) (Bashart, M. et al., Cell 41:521, 1985) or in the
RSV-LTR (from Rous sarcoma virus) (Gorman. C. M., Proc. Natl. Acad.
Sci. USA 79:6777, 1982). Also useful are the promoter of the mouse
metallothionein I gene (Hamer. D, et al., J. Mol. Appl. Gen.
1:273-88, 1982; the TK promoter of Herpes virus (McKnight. S, Cell
31:355-65, 1982): the SV40 early promoter (Benoist. C., et al.,
Nature 290:304-10, 1981): and the yeast gal4 gene promoter
(Johnston, S A et al., Proc. Natl. Acad. Sci. USA 79:6971-5, 1982);
Silver, P A. et al., Proc. Natl. Acad. Sci. (USA) 81:5951-5,
1984)). Other illustrative descriptions of transcriptional factor
association with promoter regions and the separate activation and
DNA binding of transcription factors include: Keegan et al., Nature
231:699, 1986: Fields et al., Nature 340:245, 1989; Jones, Cell
61:9, 1990; Lewin. Cell 61:1161, 1990: Ptashne et al., Nature
346:329, 1990; Adams et al., Cell 72:306, 1993.
[0327] The promoter region may further include an octamer region
which may also function as a tissue specific enhancer, by
interacting with certain proteins found in the specific tissue. The
enhancer domain of the DNA construct of the present invention is
one which is specific for the target cells to be transfected, or is
highly activated by cellular factors of such target cells. Examples
of vectors (plasmid or retrovirus) are disclosed, e.g., in
Roy-Burman et al., U.S. Pat. No. 5,112,767. For a general
discussion of enhancers and their actions in transcription, see.
Lewin, B M, Genes IV. Oxford University Press pp. 552-576, 1990 (or
later edition). Particularly useful are retroviral enhancers (e.g.,
viral LTR) that is preferably placed upstream from the promoter
with which it interacts to stimulate gene expression. For use with
retroviral vectors, the endogenous viral LTR may be rendered
enhancer-less and substituted with other desired enhancer sequences
which confer tissue specificity or other desirable properties such
as transcriptional efficiency.
[0328] Thus, expression cassettes include plasmids, recombinant
viruses, any form of a recombinant "naked DNA" vector, and the
like. A "vector" comprises a nucleic acid which can infect,
transfect, transiently or permanently transduce a cell. It will be
recognized that a vector can be a naked nucleic acid, or a nucleic
acid complexed with protein or lipid. The vector optionally
comprises viral or bacterial nucleic acids and/or proteins, and/or
membranes (e.g., a cell membrane, a viral lipid envelope, etc.).
Vectors include replicons (e.g., RNA replicons), bacteriophages) to
which fragments of DNA may be attached and become replicated.
Vectors thus include, but are not limited to RNA, autonomous
self-replicating circular or linear DNA or RNA, e.g., plasmids,
viruses, and the like (U.S. Pat. No. 5,217,879), and includes both
the expression and nonexpression plasmids. Where a recombinant cell
or culture is described as hosting an "expression vector" this
includes both extrachromosomal circular and linear DNA and DNA that
has been incorporated into the host chromosome(s). Where a vector
is being maintained by a host cell, the vector may either be stably
replicated by the cells during mitosis as an autonomous structure,
or is incorporated within the host's genome.
[0329] Exemplary virus vectors that may be used include recombinant
adenoviruses (Horowitz, M S, In: Virology. Fields, B N et al., eds.
Raven Press, NY, 1990, p. 1679; Berkner, K L. Biotechniques
6:616-29, 1988; Strauss. S E. In: The Adenoviruses, Ginsberg, H S,
ed., Plenum Press, N Y, 1984, chapter 11) and herpes simplex virus
(HSV). Advantages of adenovirus vectors for human gene delivery
include the fact that recombination is rare, no human malignancies
are known to be associated with such viruses, the adenovirus genome
is double stranded DNA which can be manipulated to accept foreign
genes of up to 7.5 kb in size, and live adenovirus is a safe human
vaccine organisms. Adeno-associated virus is also useful for human
therapy (Samulski. R J et al., EMBO J. 10:3941, 1991) according to
the present invention.
[0330] Another vector which can express the DNA molecule of the
present invention, and is useful in the present therapeutic setting
is vaccinia virus, which can be rendered non-replicating (U.S. Pat.
Nos. 5,225,336; 5.204,243; 5,155,020; 4,769,330; Fuerst, T R et
al., Proc. Natl. Acad. Sci. USA 86:2549-53, 1992; Chakrabarti, S et
al., Mol Cell Biol 5:3403-9, 1985). Descriptions of recombinant
vaccinia viruses and other viruses containing heterologous DNA and
their uses in immunization and DNA therapy are reviewed in: Moss,
B, Curr Opin Genet Dev 3:86-90.1993; Moss, B, Biotechnol,
20:345-62, 1992).
[0331] Other viral vectors that may be used include viral or
non-viral vectors, including adeno-associated virus vectors,
retrovirus vectors, lentivirus vectors, and plasmid vectors.
Exemplary types of viruses include HSV (herpes simplex virus), AAV
(adeno associated virus), HIV (human immunodeficiency virus), BIV
(bovine immunodeficiency virus), and MLV (murine leukemia
virus).
[0332] A DNA vaccine may also use a replicon, e.g., an RNA
replicon, a self-replicating RNA vector. Generally, RNA replicon
vaccines may be derived from alphavirus vectors, such as Sindbis
virus (Hariharan, M J et al., 1998. J Virol 72:950-8), Semliki
Forest virus (Berglund, P M et al., 1997. AIDS Res Hum Retroviruses
13:1487-95; Ying, H T et al., 1999. Nat Med 5:823-7) or Venezuelan
equine encephalitis virus (Pushko, P M et al., 1997. Virology
239:389-401). These self-replicating and self-limiting vaccines may
be administered as either (1) RNA or (2) DNA which is then
transcribed into RNA replicons in cells transfected in vitro or in
vivo (Berglund, P C et al., 1998. Nat Biotechnol 16:562-5; Leitner,
W W et al., 2000. Cancer Res 60:51-5). An exemplary Semliki Forest
virus is pSCA1 (DiCiommo, D P et al., J Biol Chem 1998;
273:18060-6).
[0333] In addition to naked DNA or viral vectors, engineered
bacteria may be used as vectors. A number of bacterial strains
including Salmonella, BCG and Listeria monocytogenes(LM) (Hoiseth
et al., Nature 291:238-9, 1981; Poirier, T P et al., J Exp Med
168:25-32, 1988); Sadoff. J C et al., Science 240:336-8, 1988;
Stover. C K et al., Nature 351:456-60, 1991; Aldovini, A et al.,
Nature 351:479-82, 1991). These organisms display two promising
characteristics for use as vaccine vectors: (1) enteric routes of
infection, providing the possibility of oral vaccine delivery; and
(2) infection of monocytes/macrophages thereby targeting antigens
to professional APCs.
[0334] In addition to virus-mediated gene transfer in vivo,
physical means well-known in the art can be used for direct
transfer of DNA, including administration of plasmid DNA (Wolff et
al., 1990, supra) and particle-bombardment mediated gene transfer
(Yang, N-S. et al., Proc Natl Acad Sci USA 87:9568, 1990; Williams.
R S et al., Proc Natl Acad Sci USA 88:2726, 1991; Zelenin, A V et
al., FEBS Lett 280:94, 1991; Zelenin, A V et al., FEBS Lett 244:65,
1989); Johnston, S A et al., In Vitro Cell Dev Biol 27:11, 1991).
Furthermore, electroporation, a well-known means to transfer genes
into cell in vitro, can be used to transfer DNA molecules according
to the present invention to tissues in vivo (Titomirov. A V et al.,
Biochim Biophys Acta 1088:131, 1991).
[0335] "Carrier mediated gene transfer" has also been described
(Wu, C H et al., J Biol Chem 264:16985, 1989; Wu, G Y et al., J
Biol Chem 263:14621, 1988; Soriano, P et al., Proc Nat. Acad Sci
USA 80:7128, 1983; Wang. C-Y et al., Pro. Natl Acad Sci USA
84:7851, 1982; Wilson, J M et al., J Biol Chem 267:963, 1992).
Preferred carriers are targeted liposomes (Nicolau, C et al., Proc
Natl Acad Sci USA 80:1068, 1983; Soriano et al., supra) such as
immunoliposomes, which can incorporate acylated mAbs into the lipid
bilayer (Wang et al., supra). Polycations such as
asialoglycoprotein/polylysine (Wu et al., 1989, supra) may be used,
where the conjugate includes a target tissue-recognizing molecule
(e.g., asialo-orosomucoid for liver) and a DNA binding compound to
bind to the DNA to be transfected without causing damage, such as
polylysine. This conjugate is then complexed with plasmid DNA of
the present invention.
[0336] Plasmid DNA used for transfection or microinjection may be
prepared using methods well-known in the art, for example using the
Qiagen procedure (Qiagen), followed by DNA purification using known
methods, such as the methods exemplified herein.
[0337] Such expression vectors may be used to transfect host cells
(in vitro, ex vivo or in vivo) for expression of the DNA and
production of the encoded proteins which include fusion proteins or
peptides. In one embodiment, a DNA vaccine is administered to or
contacted with a cell. e.g., a cell obtained from a subject (e.g.,
an antigen presenting cell), and administered to a subject, wherein
the subject is treated before, after or at the same time as the
cells are administered to the subject.
[0338] RNA Vaccines
[0339] In some embodiments, the vaccine comprises a nucleic acid
expressing a cancer-specific antigen, or a cancer-specific fragment
thereof, and the nucleic acid is RNA.
[0340] RNA vaccines, as provided herein, comprise at least one (one
or more) ribonucleic acid (RNA) polynucleotide having an open
reading frame encoding at least one cancer-specific antigen, or a
cancer-specific fragment thereof. The term "nucleic acid," in its
broadest sense, includes any compound and/or substance that
comprises a polymer of nucleotides. These polymers are referred to
as polynucleotides.
[0341] In some embodiments, polynucleotides of the present
disclosure function as messenger RNA (mRNA). "Messenger RNA" (mRNA)
refers to any polynucleotide that encodes a (at least one)
polypeptide (a naturally-occurring, non-naturally-occurring, or
modified polymer of amino acids) and can be translated to produce
the encoded polypeptide in vitro, in vivo, in situ or ex vivo.
[0342] The basic components of an mRNA molecule typically include
at least one coding region, a 5' untranslated region (UTR), a 3'
UTR, a 5' cap and a poly-A tail. Polynucleotides of the present
disclosure may function as mRNA but can be distinguished from
wild-type mRNA in their functional and/or structural design
features which serve to overcome existing problems of effective
polypeptide expression using nucleic-acid based therapeutics.
[0343] RNA (e.g., mRNA) vaccines of the present disclosure
comprise, in some embodiments, at least one ribonucleic acid (RNA)
polynucleotide having an open reading frame encoding at least one a
cancer-specific antigen, or a cancer-specific fragment thereof,
wherein said RNA comprises at least one chemical modification.
[0344] Polynucleotides (e.g., RNA polynucleotides, such as mRNA
polynucleotides), in some embodiments, comprise various (more than
one) different modifications. In some embodiments, a particular
region of a polynucleotide contains one, two or more (optionally
different) nucleoside or nucleotide modifications. In some
embodiments, a modified RNA polynucleotide (e.g., a modified mRNA
polynucleotide), introduced to a cell or organism, exhibits reduced
degradation in the cell or organism, respectively, relative to an
unmodified polynucleotide. In some embodiments, a modified RNA
polynucleotide (e.g., a modified mRNA polynucleotide), introduced
into a cell or organism, may exhibit reduced immunogenicity in the
cell or organism, respectively (e.g., a reduced innate
response).
[0345] Polynucleotides (e.g., RNA polynucleotides, such as mRNA
polynucleotides), in some embodiments, comprise non-natural
modified nucleotides that are introduced during synthesis or
post-synthesis of the polynucleotides to achieve desired functions
or properties. The modifications may be present on an
internucleotide linkages, purine or pyrimidine bases, or sugars.
The modification may be introduced with chemical synthesis or with
a polymerase enzyme at the terminal of a chain or anywhere else in
the chain. Any of the regions of a polynucleotide may be chemically
modified.
[0346] The present disclosure provides for modified nucleosides and
nucleotides of a polynucleotide (e.g., RNA polynucleotides, such as
mRNA polynucleotides). A "nucleoside" refers to a compound
containing a sugar molecule (e.g., a pentose or ribose) or a
derivative thereof in combination with an organic base (e.g., a
purine or pyrimidine) or a derivative thereof (also referred to
herein as "nucleobase"). A nucleotide" refers to a nucleoside,
including a phosphate group. Modified nucleotides may by
synthesized by any useful method, such as, for example, chemically,
enzymatically, or recombinantly, to include one or more modified or
non-natural nucleosides. Polynucleotides may comprise a region or
regions of linked nucleosides. Such regions may have variable
backbone linkages. The linkages may be standard phosphdioester
linkages, in which case the polynucleotides would comprise regions
of nucleotides.
[0347] Cancer vaccines of the present disclosure comprise at least
one RNA polynucleotide, such as a mRNA (e.g., modified mRNA). mRNA,
for example, is transcribed in vitro from template DNA, referred to
as an "in vitro transcription template." In some embodiments, an in
vitro transcription template encodes a 5' untranslated (UTR)
region, contains an open reading frame, and encodes a 3' UTR and a
polyA tail. The particular nucleic acid sequence composition and
length of an in vitro transcription template will depend on the
mRNA encoded by the template.
[0348] In some embodiments, a polynucleotide includes 200 to 3,000
nucleotides. For example, a polynucleotide may include 200 to 500,
200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500,
500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000,
1500 to 3000, or 2000 to 3000 nucleotides).
[0349] In other aspects, the invention relates to a method for
preparing an mRNA cancer vaccine by IVT methods. In vitro
transcription (IVT) methods permit template-directed synthesis of
RNA molecules of almost any sequence. The size of the RNA molecules
that can be synthesized using IVT methods range from short
oligonucleotides to long nucleic acid polymers of several thousand
bases. IVT methods permit synthesis of large quantities of RNA
transcript (e.g., from microgram to milligram quantities) (Beckert
et al., Synthesis of RNA by in vitro transcription, Methods Mol
Biol. 703:29-41(2011); Rio et al. RNA: A Laboratory Manual. Cold
Spring Harbor: Cold Spring Harbor Laboratory Press, 2011, 205-220;
Cooper, Geoffery M. The Cell: A Molecular Approach. 4th ed.
Washington D.C.: ASM Press, 2007.262-299). Generally, IVT utilizes
a DNA template featuring a promoter sequence upstream of a sequence
of interest. The promoter sequence is most commonly of
bacteriophage origin (ex, the T7, T3 or SP6 promoter sequence) but
many other promotor sequences can be tolerated including those
designed de novo. Transcription of the DNA template is typically
best achieved by using the RNA polymerase corresponding to the
specific bacteriophage promoter sequence. Exemplary RNA polymerases
include, but are not limited to T7 RNA polymerase, T3 RNA
polymerase, or SP6 RNA polymerase, among others. IVT is generally
initiated at a dsDNA but can proceed on a single strand.
Vaccine Compositions
[0350] In some embodiments, the vaccine minimally includes the
antigen.
[0351] To further achieve an effective vaccine according to this
disclosure, materials and methods can be employed to enhance
availability of the vaccine. One such method employs an
adjuvant.
[0352] The term "adjuvant" refers to material that enhances the
immune response to an antigen and is used herein in the customary
use of the term. The precise mode of action is not understood for
all adjuvants, but such lack of understanding does not prevent
their clinical use for a wide variety of vaccines, whether
protein-based or DNA-based. Traditionally, some adjuvants
physically trap antigen at the site of injection, enhancing antigen
presence at the site and slowing its release. This in turn prolongs
and/or increases the recruitment and activation of APCs, such as in
this case iDCs.
[0353] In particular embodiments a squalene-based adjuvant is used.
Squalene is part of the group of molecules known as triterpenes,
which are all hydrocarbons with 30 carbon molecules. Squalene can
be derived from certain plant sources, such as rice bran, wheat
germ, amaranth seeds, and olives, as well as from animal sources,
such as shark liver oil. In particular embodiments, the
squalene-based adjuvant is MF59.RTM., which is an oil-in-water
emulsion (Novartis, Basel, Switzerland; see Giudice, G D et al.
Clin Vaccine Immunol. 2006 Sep; 13(9):1010-3). An example of a
squalene-based adjuvant that is similar to MF59.RTM. but is
designed for preclinical research use is Addavax.TM. (InvivoGen,
San Diego, Calif.). MF59 has been FDA approved for use in an
influenza vaccine, and studies indicate that it is safe for use
during pregnancy (Tsai T, et al. Vaccine. 2010. 17:28(7):1877-80;
Heikkinen T, et al. Am J Obstet Gynecol. 2012.207(3):177). In
particular embodiments, squalene-based adjuvants can include
0.1%-20% (v/v) squalene oil. In particular embodiments,
squalene-based adjuvants can include 5%(v/v) squalene oil. In
particular embodiments, the squalene-based adjuvant is AS03, which
includes .alpha.-tocopherol, squalene, and polysorbate 80 in an
oil-in-water emulsion (GlaxoSmithKline; see Garcon N et al. Expert
Rev Vaccines. 2012 March; 11(3):349-66).
[0354] In particular embodiments, polyinosinic:polycytidilyic acid
(also referred to as poly(I:C) is used. Poly(I:C) is a synthetic
analog of double-stranded RNA that stimulates the immune system. In
particular embodiments, Poly-ICLC (Hiltinol) is used (Ammi R et al.
Pharmacol Ther. 2015 February; 146:120-31). In particular
embodiments, Poliu-IC12U (Ampligen) is used (Martins K A et al.
Expert Rev Vaccines. 2015 March; 14(3):447-59).
[0355] In particular embodiments the adjuvant alum can be used.
Alum refers to a family of salts that contain two sulfate groups, a
monovalent cation, and a trivalent metal, such as aluminum or
chromium. Alum is an FDA approved adjuvant. In particular
embodiments, vaccines can include alum in the amounts of 1-1000
ug/dose or 0.1 mg-10 mg/dose.
[0356] In particular embodiments, the adjuvant Vaxfectin.RTM.
(Vical, Inc., San Diego, Calif.) can be used. Vaxfectin.RTM. is a
cationic lipid based adjuvant that can be used for DNA or protein
vaccines.
[0357] Compositions for Administration. Vaccines of the disclosure
can be formulated into pharmaceutical compositions for
administration including a vaccine of the disclosure can be
formulated in a variety of forms, e.g., as a liquid, gel,
lyophilized, or as a compressed solid. The particular form will
depend upon the particular indication being treated and will be
apparent to one of ordinary skill in the art.
[0358] An example of a pharmaceutical composition is a solution
designed for parenteral administration. Although in many cases
pharmaceutical solution formulations are provided in liquid form,
appropriate for immediate use, such parenteral formulations can
also be provided in frozen or in lyophilized form. In the former
case, the composition must be thawed prior to use. The latter form
is often used to enhance the stability of the active compound
contained in the composition under a wider variety of storage
conditions, as it is recognized by those or ordinary skill in the
art that lyophilized preparations are generally more stable than
their liquid counterparts. Such lyophilized preparations are
reconstituted prior to use by the addition of one or more suitable
pharmaceutically acceptable diluents such as sterile water for
injection or sterile physiological saline solution.
[0359] Parenterals can be prepared for storage as lyophilized
formulations or aqueous solutions by mixing, as appropriate, the
composition having the desired degree of purity with one or more
pharmaceutically acceptable carriers, excipients or stabilizers
typically employed in the art (all of which are termed
"excipients"), for example buffering agents, stabilizing agents,
preservatives, isotonifiers, non-ionic detergents, antioxidants
and/or other miscellaneous additives.
[0360] Buffering agents help to maintain the pH in the range which
approximates physiological conditions. They are typically present
at a concentration ranging from 2 mM to 50 mM. Suitable buffering
agents for use with the present disclosure include both organic and
inorganic acids and salts thereof such as citrate buffers (e.g.,
monosodium citrate-disodium citrate mixture, citric acid-trisodium
citrate mixture, citric acid-monosodium citrate mixture, etc.),
succinate buffers (e.g., succinic acid-monosodium succinate
mixture, succinic acid-sodium hydroxide mixture, succinic
acid-disodium succinate mixture, etc.), tartrate buffers (e.g.,
tartaric acid-sodium tartrate mixture, tartaric acid-potassium
tartrate mixture, tartaric acid-sodium hydroxide mixture, etc.),
fumarate buffers (e.g., fumaric acid-monosodium fumarate mixture,
fumaric acid-disodium fumarate mixture, monosodium
fumarate-disodium fumarate mixture, etc.), gluconate buffers (e.g.,
gluconic acid-sodium glyconate mixture, gluconic acid-sodium
hydroxide mixture, gluconic acid-potassium glyuconate mixture,
etc.), oxalate buffer (e.g., oxalic acid-sodium oxalate mixture,
oxalic acid-sodium hydroxide mixture, oxalic acid-potassium oxalate
mixture, etc.), lactate buffers (e.g., lactic acid-sodium lactate
mixture, lactic acid-sodium hydroxide mixture, lactic
acid-potassium lactate mixture, etc.) and acetate buffers (e.g.,
acetic acid-sodium acetate mixture, acetic acid-sodium hydroxide
mixture, etc.). Additional possibilities are phosphate buffers,
histidine buffers and trimethylamine salts such as Tris.
[0361] Preservatives can be added to retard microbial growth, and
are typically added in amounts of 0.2%-1% (w/v). Suitable exemplary
preservatives for use with the present disclosure include phenol,
benzyl alcohol, meta-cresol, methyl paraben, propyl paraben,
octadecyldimethylbenzyl ammonium chloride, benzalkonium halides
(e.g., benzalkonium chloride, bromide or iodide), hexamethonium
chloride, alkyl parabens such as methyl or propyl paraben,
catechol, resorcinol, cyclohexanol and 3-pentanol.
[0362] Isotonicifiers can be added to ensure isotonicity of liquid
compositions and include polyhydric sugar alcohols, trihydric or
higher sugar alcohols, such as glycerin, erythritol, arabitol,
xylitol, sorbitol and mannitol. Polyhydric alcohols can be present
in an amount between 0.1% and 25% by weight, typically 1% to 5%,
taking into account the relative amounts of the other
ingredients.
[0363] Stabilizers refer to a broad category of excipients which
can range in function from a bulking agent to an additive which
solubilizes the vaccine or helps to prevent denaturation or
adherence to the container wall. Typical stabilizers can be
polyhydric sugar alcohols (enumerated above); amino acids such as
arginine, lysine, glycine, glutamine, asparagine, histidine,
alanine, ornithine, L-leucine, 2-phenylalanine, glutamic acid,
threonine, etc., organic sugars or sugar alcohols, such as lactose,
trehalose, stachyose, mannitol, sorbitol, xylitol, ribitol,
myoinisitol, galactitol, and glycerol; polyethylene glycol; amino
acid polymers; sulfur-containing reducing agents, such as urea,
glutathione, thioctic acid, sodium thioglycolate, thioglycerol,
alpha-monothioglycerol and sodium thiosulfate; low molecular weight
polypeptides (i.e., <10 residues); proteins such as human serum
albumin, bovine serum albumin, gelatin or immunoglobulins;
hydrophilic polymers such as polyvinylpyrrolidone; monosaccharides
such as xylose, mannose, fructose and glucose; disaccharides such
as lactose, maltose and sucrose; trisaccharides such as raffinose,
and polysaccharides such as dextran. Stabilizers are typically
present in the range of from 0.1 to 10,000 parts by weight based on
the vaccine composition. Additional miscellaneous excipients
include bulking agents or fillers (e.g., starch), chelating agents
(e.g., EDTA), antioxidants (e.g., ascorbic acid, methionine,
vitamin E) and cosolvents.
[0364] The vaccine composition can also be entrapped in
microcapsules prepared, for example, by coascervation techniques or
by interfacial polymerization, for example hydroxymethylcellulose,
gelatin or poly-(methylmethacylate) microcapsules, in colloidal
drug delivery systems (for example liposomes, albumin microspheres,
microemulsions, nano-particles and nanocapsules) or in
macroemulsions. Such techniques are disclosed in Remington's
Pharmaceutical Sciences.
[0365] Parenteral formulations to be used for in vivo
administration generally are sterile. This is readily accomplished,
for example, by filtration through sterile filtration
membranes.
[0366] Suitable examples of sustained-release vaccine compositions
include semi-permeable matrices of solid hydrophobic polymers
containing the composition, the matrices having a suitable form
such as a film or microcapsules. Examples of sustained-release
matrices include polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate) or poly(vinylalcohol)),
polylactides, copolymers of L-glutamic acid and ethyl-L-glutamate,
non-degradable ethylene-vinyl acetate, degradable lactic
acid-glycolic acid copolymers such as the PROLEASE.RTM. (Alkermes,
Inc., Waltham, Mass.) technology or LUPRON DEPOT.RTM. (injectable
microspheres composed of lactic acid-glycolic acid copolymer and
leuprolide acetate; Abbott Endocrine, Inc., Abbott Park, Ill.), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for long periods, such as up to or over 100 days,
certain hydrogels release compounds for shorter time periods.
EXAMPLES
Example 1
[0367] Reported herein is the development of a novel platform to
significantly enhance the efficacy and safety of Follicular
lymphoma treatment. Since lymphoma is a clonal malignancy of a
diversity system, every tumor has a different antibody on its cell
surface. Combinatorial autocrine-based selection is used to rapidly
identify specific ligands for these B cell receptors on the surface
of FL tumor cells. The selected ligands are used in a CAR-T format
for redirection of human CTLs. Essentially, the format is the
inverse of the usual CAR-T protocol. Instead of being a guide
molecule, the antibody itself is the target. Thus, these studies
raise the possibility of personalized treatment of lymphomas
utilizing a private antibody binding ligand that can be obtained in
few weeks.
[0368] Although a special case, the B cell receptor (BCR) on
lymphoma cells is the purest form of a tumor specific antigen (1).
This is because lymphoma is a tumor of one member of a diversity
system were each tumor expresses only one of 10.sup.8 different
antibody molecules (2). Thus, it's remarkable that antigens
selective for BCR's binding have not been more generally used for
therapy (3, 4). Probably, the reason is that the workflow to find a
selective antigen for each patient is not possible in most
therapeutic settings. Here we describe an autocrine-based format
that allows identification of peptide antigens selective for
individual BCR's with a speed compatible with their use in the
clinic. These selected antigens can be used as guide molecules for
CAR-T or other approaches such as radiotherapy. The main point is
that autocrine-based selections allow for the speed and specificity
that are required if personalized therapy of lymphoma is to be
realized.
Materials and Methods
Identification and Reconstitution of Lymphoma Cells BCR
[0369] Lymph nodes biopsies from patients with follicular lymphoma
diagnosis (FL) were kindly provided by N.N. Petrov Research
Institute of Oncology (St. Petersburg, Russia).
[0370] Immediately after surgery the biopsy sample was separated to
four equal slices, two of them were loaded into the RNAlater
reagent (Qiagen) and others were cryopreserved. Lymphoma cell
counts and expression of surface Ig is determined by flow
cytometry. Cell suspension aliquots containing approx. 250,000
cells were stained with monoclonal antibodies in 4 tubes: 1.
Isotype control; 2. CD45-FITC, CD20-PE, CD3-PC5, CD19-PE-Cy7; 3.
IgG-PE-Cy5, IgM-FITC, CD19-PECy7; and 4. kappa-FITC, lambda-PE,
CD19-PE-Cy7. Immunoglobulin expression was estimated on lymphocytes
as gated using SSC/FSC and CD19C. Monoclonal immunoglobulin
expression of either M or G heavy chain, either kappa or lymbda
light chain was detected. The RNAlater processed biopsy samples
were used for isolation of the total mRNA using RNAeasy Mini Kit
(Qiagen). Total cDNA was synthesized by reverse transcription using
a QuantiTect Reverse Transcription Kit (Qiagen). Variable region
genes of heavy and light Ig chains identified by flow cytometry
were amplified in separate reactions for each gene. Semi-nested PCR
using high-fidelity DNA-polymerase (Q5, NEB) with a set of family
specific V-gene forward primers and a C-gene specific reverse
primer was used (Table 1). First step PCR products were subjected
to heteroduplex analysis in polyacrylamide gel to discriminate
homoduplexes (monoclonal PCR products) from a smear of slowly
moving heteroduplexes (derived from polyclonal lymphocytes). DNA
fragments of the expected size are extracted and the DNA eluted.
Proximal reverse C-gene specific primer was used for the second
step amplification and sequencing. Identified variable fragments of
the follicular lymphoma BCRs were cloned as a scFv into the
lentiviral vector pLV2-Fc-MTA coding for a membrane-anchored human
antibody Fc fragment (S) (FIGS. 5B and 5C) (FL). Jurkat and Raji
cells were transduced with these viruses. Transduced Jurkat-FL and
Raji-FL were analyzed by FACS in order to select the cells carrying
the follicular lymphoma BCR, which were then used for autocrine
selections or animal experiments.
TABLE-US-00001 TABLE 1 List of primers for variable region genes of
heavy and light Ig chains amplification. Primer Sequence 5'-3'
Orientation L-VH1-start ATGGACTGGACCTGGAGGATC forward CT (SEQ ID
NO: 4) L-VH2-start ATGGACATACTTTGTTCCACG forward CTC (SEQ ID NO: 5)
L-VH3-start ATGGAGTTTGGGCTGAGCTGG forward (SEQ ID NO: 6)
L-VH4-start ATGAAACACCTGTGGTTCTTC forward CT (SEQ ID NO: 7)
L-VHS-start ATGGGGTCAACCGCCATCCTC forward (SEQ ID NO: 8)
L-VH6-start ATGTCTGTCTCCTTCCTCATC forward TTC (SEQ ID NO: 9) IgM-3'
CTCTCAGGACTGATGGGAAGC reverse C (SEQ ID NO: 10) distal IgM-clon
GGAGACGAGGGGGAAAAG reverse (SEQ ID NO: 11) proximal IgG-3'
GCCTGAGTTCCACGACACC reverse (SEQ ID NO: 12) distal IgG-clon
CAGGGGGAAGACCGATGG reverse (SEQ ID NO: 13) proximal V.kappa.1-clon
GACATCCAGATGACCCAGTCT forward CC (SEQ ID NO: 14) V.kappa.2-clon
GATATTGTGATGACCCAGACT forward CCA (SEQ ID NO: 15) V.kappa.3-clon
GAAATTGTGTTGACACAGTCT forward CCA (SEQ ID NO: 16) IGKC-3'
CCCCTGTTGAAGCTCTTTGT reverse (SEQ ID NO: 17) distal IGKC-clon
AGATGGCGGGAAGATGAAG reverse (SEQ ID NO: 18) proximal VL1_(51)_clon
CAGTCTGTGTTGACGCAGCCG forward CCCTC (SEQ ID NO: 19)
VL1_(36-47)_clon TCTGTGCTGACTCAGCCACCC forward TC (SEQ ID NO: 20)
VL1_(40)_clon CAGTCTGTCGTGACGCAGCCG forward CCCTC (SEQ ID NO: 21)
VL2-clon TCCGTGTCCGGGTCTCCTGGA forward CAGTC (SEQ ID NO: 22)
VL3-clon ACTCAGCCACCCTCGGTGTCA forward GTG (SEQ ID NO: 23) VL4-clon
TCCTCTGCCTCTGCTTCCCTG forward GGA (SEQ ID NO: 24) VL5-clon
CAGCCTGTGCTGACTCAGCC forward (SEQ ID NO: 25) IGLC-3'
GTGTGGCCTTGTTGGCTTG reverse (SEQ ID NO: 26) distal IGLC2-7_clon
CGAGGGGGCAGCCTTGGG reverse (SEQ ID NO: 27) proximal IGLC1_clon
AGTGACCGTGGGGTTGGCCTT reverse GGG (SEQ ID NO: 28) proximal
Construction of a CAR-Based Combinatorial Peptide Library
[0371] The DNA fragment coding for the 3rd generation chimeric
antigen T-cell receptor was synthesized (GeneCust) and cloned into
the pLV2 lentiviral vector (Clontech) under control of the EF1a
promoter. The arrangement of genes are in the order of: interleukin
2 signal peptide at the N terminus; IgG1 Fc spacer domain with
modified PELLGG and ISR motifs; GGGS linker; a CD28 trans-membrane
and intracellular region; intracellular domains of the OX-40 and
CD3zetta (FIGS. 5A and 5C). To construct the combinatorial
cyclopeptide library, randomized peptides in the format of
CX.sub.7C, (X=20 natural amino acids) were appended to the N
terminus of the Fc domain by PCR using oligonucleotides with
degenerate NNK codons. The diversity of the generated library was
estimated as 109 members. The lentiviral library of
CX.sub.7C-Fc-CAR was prepared by co-transfection of HEK293T cells
with the library plasmid and the packaging plasmids. Supernatants
containing virus were collected at 48 h post transfection. The
titer of lentivirus preparations was determined using Lenti-X p24
ELISAs (Clontech).
FACS-Based Sorting
[0372] Jurkat-FL1, Jurkat-FL2 and Jurkat-FL3 cells were transduced
with the lentiviral cyclopeptide-CAR library. Two days
post-infection, CD69-positive cells were sorted using a FACSAria
III (BD Biosciences). The peptides sequences were determined
directly from sorted cells by PCR of the genes that encode them and
were cloned into the lentiviral vector to construct libraries for
the next round of selection. Four iterative rounds of selection
were carried out.
Cells and Culturing Conditions
[0373] Cell lines were cultured in media supplemented with 10% FBS
(Gibco), 10 mM HEPES, 100 U/ml penicillin, 100 ug/ml streptomycin,
and 2 mM GlutaMAX (Gibco). The 293T lentiviral packaging cell line
(Clontech) and HEp-2 cell line were cultured in DMEM (Gibco). Human
HEp-2 (CCL-23), Jurkat (TIB-152) and Raji (CCL-86) cell lines were
obtained from the Institute of Cytology RAS culture collection (St.
Petersburg, Russia). The Jurkat, Jurkat-FL, Raji and Raji-FL cell
lines were cultured in RPMI (Gibco). Human peripheral blood
mononuclear cells (PBMCs) were isolated from the blood of healthy
donors by gradient density centrifugation on a Ficoll-Paque (GE
Healthcare), washed and then re-suspended in serum-free RPMI.
CD8.sup.+ T Cell Activation, Expansion and Transduction
[0374] Dynabeads CD8 Positive Isolation Kit (Life Technologies) was
utilized for isolation of CD8 T cells from human PBMCs. Human CD8 T
cells were activated with CD3/CD28 beads at a 1:1 ratio (Life
Technologies) in a complete RPMI media containing 40 IU/ml
recombinant IL-2 for 72 hours. Activated T cells were re-suspended
at concentration of 4 million cells per 3 ml of FL1-CAR, FL2-CAR,
FL3-CAR, CD19-CAR or Myc-Fc-CAR in lentiviral supernatant plus 1 ml
of fresh RPMI media with 40 IU/ml IL-2 and cultured in 6-well
plates. Plates were centrifuged at 1200.times.g for 90 minutes at
32.degree. C. and then incubated for 4 hours at 37.degree. C.
Second and third transductions were performed two more times.
Animal Experiments
[0375] All animal procedures were carried out in a strict
accordance with the recommendations for proper use and care of
laboratory animals (ECC Directive 86/609/EEC). The protocol was
approved by the Inter-Institute Bioethics Commission of the
Siberian Branch of the Russian Academy of Sciences (SB RAS). The
experiments were conducted in the Center for Genetic Resources of
Laboratory Animals at the Institute of Cytology and Genetics, SB
RAS. Six- to eight-week-old female NOD SCID
(CB17-Prkdc.sup.scid/NciCrl) mice with an average weight of 16-20 g
were used. Tumors were engrafted by inoculating of 5.times.10.sup.6
Raji-FL1 cells in 200 .mu.L 0.9% saline solution subcutaneously
into the left side of mice. Once tumors had reached a palpable
volume of at least 50 mm.sup.3, mice were randomly assigned to
experimental or control groups. Tumor-bearing mice were injected
intravenously (i.v.) with 3.times.10.sup.6FL1-CART, CD19-CART or
Myc-CART cells on day 17.sup.th post tumor inoculation. Tumor
volume was measured with calipers and estimated using the
ellipsoidal formula. Animals were sacrificed when the volume of the
tumor node reached 2 cm.sup.3. On the 38th day after tumor
inoculation (21st day post CART infusion), animals from each
experimental group were used for isolation of blood, spleen and
bone marrow cells. Erythrocytes were lysed with RBC lysis buffer
(0.15 M NH.sub.4Cl, 10 mM NaHCO.sub.3, 0.1 mM EDTA) and cells were
stained with antibodies specific for CD3 (for blood samples),
CD45RA and CCR7 and analyzed by Novocyte flow cytometer (ACEA
Biosciences). The tumors were fixed in 4% neutral buffered
formaldehyde for 2 weeks and processed for paraffin sectioning
utilizing standard protocols.
Biophotonic Tumor Imaging
[0376] Animals were injected intraperitonealy with 150 .mu.l (4.29
mg per mouse) of a freshly thawed aqueous solution of D-luciferin
potassium salt (GOLDBIO). After 10 minutes animals were sacrificed
and brain, lungs, heart, liver, spleen, kidneys, and tumors were
collected. Each organ was rinsed with PBS and bioluminescence
intensity was visualized utilizing an In-Vivo MS FX PRO Imaging
System (Carestream).
Histology and Immunohistochemistry
[0377] A macroscopic post-mortem analysis included examination of
the external surfaces, appearance of primary tumor nodes, thoracic
condition, abdominal and pelvic cavities with their associated
organs and tissues. For further histological evaluation, specimens
of tumor nodes from each animal were collected during autopsy and
fixed in 10% neutral-buffered formalin, dehydrated in ascending
ethanols and xylols, and embedded in HISTOMIX paraffin (BioVitrum).
Paraffin sections (5 .mu.m) were stained with hematoxylin and
eosin, microscopically examined and scanned. Tumor sections for
immunohistochemical (IHC) studies (3-4 .mu.m) were sliced on a
Microm HM 355S microtome (Thermo Fisher Scientific), and further
de-paraffinated and rehydrated; antigen retrieval was carried out
after exposure in a microwave oven at 700 W. The samples were
incubated with the CD8-specific antibodies (M3164, Spring
BioScience) according to the manufacture's protocol. Next, the
sections were incubated with secondary HRP-conjugated antibodies
(Spring Bioscience detection system), exposed to DAB substrate, and
stained with Mayer's hematoxylin. Images were obtained using a
Axiostar Plus microscope equipped with a Axiocam MRc5 digital
camera (Zeiss, Germany) at 10.times., 20.times. and 40.times.
magnifications. Gross examination of tumors included evaluation of
size of the tumor node, presence of a capsule, and presence of
necrosis and hemorrhages. Microscopic examination of tumors
included evaluation of histopathological changes in tumor tissue in
terms of necrosis and apoptosis, presence of mitoses and presence
of CD8-lymphocyte infiltration.
Statistics
[0378] The data obtained ex vivo (flow cytometry, cytotoxicity
test) were statistically processed using the Student's t-test
(two-tailed, unpaired). The tumor volume measurements were
statistically processed using one-way ANOVA (STATISTICA 10.0).
Survival curves were generated using the Kaplan-Meier method, and
statistical comparisons were performed using the log-rank
(Mantel-Cox) test. Significance was considered for
p.ltoreq.0.05.
Cytotoxicity Assays
[0379] The cytotoxicity and specificity of engineered T cells were
evaluated in a standard lactate dehydrogenase (LDH) release assay
(CytoTox 96.RTM. Non-Radioactive Cytotoxicity Assay, Promega)
following manufacturer's recommendations. Mock transduced,
CD19-CAR, FL1-CAR, FL2-CAR, FL3-CAR, or Myc-CAR T cells were
co-incubated for 6 hours together with 104 of the Raji-FL1,
Raji-FL2, Raji-FL3 or cells from the patient's biopsy in a complete
RPMI media supplemented with 40 U/ml of human IL-2. As negative
controls Raji cells or cells isolated from an irrelevant lymphoma
lymph node biopsy were used. All the experiments were performed in
triplicate.
Flow Cytometry Analysis
[0380] The following antibodies were used in this study; anti-human
CD3 FITC (Biolegend), anti-human CD8 PE (Biolegend), anti-human
CCR7 PE (Biolegend), anti-human CD45RA FITC (Biolegend), mouse
anti-human CD69 Alexa Fluor488 (Biolegend), anti-human B220 APC
(Biolegend). Chimeric FL-BCR expression was detected using
anti-human IgG1 PE antibody (SouthernBiotech) or synthetic
biotinylated cyclopeptides (GeneCust) and streptavidin conjugated
with FITC or PE (Thermo Fisher Scientific). The CAR molecules were
detected using goat cross-absorbed anti-human IgG antibody
conjugated with DyLight650 (Thermo Fisher Scientific). The CD19-CAR
(FMC63 clone) molecules were detected using biotinylated protein L
(Thermo Fisher Scientific) and streptavidin conjugated with FITC
(Thermo Fisher Scientific).
Identification of the Bcl-2 Translocation
[0381] Crude DNA extracts were prepared by proteinase K digestion
of follicular lymphoma lymph node biopsy sample. PCR amplification
was carried out using primer pairs comprising a consensus primer to
JH and one of the three different primers homological to sequences
in the mbr1, mcr2 or icr5 regions of bcl2 gene as described in
(14).
IFA
[0382] Self-reactivity of the lymphoma BCR was tested by indirect
immunofluorescence assay (IFA) on HEp-2 and HEL293T cells as
described in (15). Plasmid vector encoding recombinant myoferlin
(22443, Addgene) was transfected into the HEK293T cells with
Lipofectamine 2000 (Invitrogen) as per the manufacturer's
instructions. Recombinant Igs representing lymphoma BCR and
irrelevant human antibody were diluted in PBS with 2% BSA and used
at a concentration of 50 .mu.g/mL and incubated with cells for 1
hour. Detection of bound antibodies were accomplished by anti-human
Ig-PE using Nikon Eclipse Ti U microscope.
Results
Overall Workflow
[0383] The aim of these proof-of-concept experiments is to find an
antigen that selectively reacts with the BCR on the surface of the
lymphoma cell (FIG. 1). The central idea is that if the BCR can be
cloned and expressed on the surface of indicator cells also
expressing a very large array of peptides, the system becomes
autocrine and each cell becomes a selection system onto itself. If
the overall system is constructed such that the BCR signals when it
reacts with one of the co-expressed ligands, specific interactions
between the BCR and the ligand can be readily identified by FACS.
Importantly, the autocrine-based selection, as used here, selects
for functional interactions where antibody binding to the peptide
on the CAR activates the system.
Identification of the BCRs on Malignant B Cells
[0384] Lymph node biopsies from 3 patients with Follicular lymphoma
(FL) were used to determine the nucleotide sequence of the BCRs
from malignant cells. The central part of the tumor biopsy was
taken in order to reduce the abundance of BCR genes from
non-malignant cells. Total mRNA was used as a template in a reverse
transcription reaction with subsequent PCR amplification of Ig V
genes. Up to 95% percent of analyzed sequences were identical due
to the clonal nature of lymphomas. The selected Ig variable regions
were cloned into the pComb3X vector in a scFv format (S). Thus, the
ScFv fused with constant domain of antibody (Fc) is linked via a
flexible linker to a membrane-spanning domain of the
platelet-derived growth factor receptor (PDGFR) such that the
antibody molecules are integrated as dimers into the plasma
membrane with their binding sites facing the solvent (S) (FIGS. 5B
and 5C).
Autocrine-Based Selection of a Ligand for the BCR on the Malignant
Cells
[0385] An autocrine-based reporter system for direct selection of
ligands that are specific to the BCR on malignant cells (FIG. 2A)
was used. The method allows direct selection of a ligand that may
be used for tumor targeting. T cells infected with both the BCR and
combinatorial cyclopeptide library containing 10.sup.9 members were
used as the reporter system. Immortal Jurkat human T lymphocytes
were modified to simultaneously express the lymphoma BCR and a
randomized 7 amino acid cyclopeptide library. The cyclopeptide
library was fused with a chimeric antigen receptor containing
signaling domains (FIGS. 5A-5C). When the Ig fused with the PDGFR
membrane-spanning domain reacts with a peptide from the
cyclopeptide library, the signaling domains of the chimeric
antigenic receptor trigger a T cell activation cascade. Activated
T-cells start to express CD69 (early T-cell activation antigen) (6)
and thus may be easily detected utilizing specific
fluorescent-labeled antibodies.
[0386] First, the capacity of the reporter construction was
confirmed using a model system. A c-Myc epitope on CAR and the
variable domains of the anti-Myc antibody (9E10 clone) was used as
a model membrane bounded BCR. Jurkat cells expressing only
membrane-bound anti-Myc antibody without co-expression of Myc-CAR
showed no detectable activation. But, cells containing both
membrane-bound anti-Myc antibody and Myc-CAR were activated FIG.
2B).
[0387] The results from the Myc model system encouraged us to move
forward to the actual BCR from the patient with lymphoma. In order
to select peptide ligands of the reconstituted lymphoma BCRs,
several rounds of selection were performed, resulting in discovery
of the three cyclopeptides CILDLPKFC (FL1) (SEQ ID NO: 1),
CMPHWQNHC (FL2) (SEQ ID NO: 2) and CTTDQARKC (FL3) (SEQ ID NO: 3)
specific for three patient derived BCRs scFv. Individual selected
peptides-CAR fusions trigger a T cell activation cascade in Jurkat
cells when co-transduced by corresponding membrane tethered BCRs as
measured by CD69 membrane expression (FIG. 2C).
Specific Lytic Activity Against Lymphoma Cells
[0388] Next, it was tested whether T cells transduced with the
FL1-CAR, FL2-CAR and FL3-CAR constructs demonstrated killing
activity in vitro when incubated with the Raji lymphoma cell lines
transduced with the isolated follicular lymphoma B cell receptors
(FL-BCR). Surface expression of the functional BCR from the
malignant cells was confirmed by staining with a-Fc antibody and
biotinylated FL1, FL2 and FL3 peptides (FIG. 3A). These studies
confirmed that BCRs capable of binding to the peptides were present
on these cells.
[0389] To determine if CTLs expressing CAR-T were capable of
killing target cells, lentiviral vectors coding for the FL1-CAR,
FL2-CAR, FL3-CAR or CD19-CAR were used to transduce human CD8.sup.+
T cells. Activated human CD8.sup.+ T-cells baring peptide-CAR lysed
Raji cells expressing the corresponding BCRs from the lymphomas
(Raji-FL1, Raji-FL2 and Raji-FL3), as measured by LDH release (FIG.
3B). Notably, the specific cytotoxicity of the FL1-CAR, FL2-CAR and
FL3-CAR cells was comparable to the best-studied CD19 CAR-T cell
targeting CD19 antigen (FMC63-CAR). In contrast, minimum lysis was
observed when control CARs T cells were used. Also, no cell lysis
was observed in case of incubation of FL1-CAR, FL2-CAR and FL3-CAR
with unmodified Raji cells, suggesting high therapeutic potential
and safety of the BCR targeting CART (FIG. 6).
[0390] Next, cytotoxicity was estimated ex vivo of the FL1-CART
against cells from the patients 1 initial biopsy. More than 60% of
cells in biopsy sample are B-cells specific to the FL1 peptide
(FIG. 3C, bottom panels). Cells from a control biopsy sample
derived from another patient with follicular lymphoma (patient 4)
did not demonstrate any significant staining by FL1 peptide. The
CTL assay showed that FL1-CAR-T specifically lysed cells from the
biopsy sample, while Myc-CAR-T and Mock T cells did not have any
anti-tumor lytic activity (FIG. 3D).
FL1-CAR Redirected CTLs Suppress Lymphoma Cells In Vivo
[0391] The efficacy of FL1-CART was tested in a relevant model of
follicular lymphoma using immune-deficient NOD SCID
(CB17-Prkdc.sup.scid/NciCrl) mice engrafted with 5.times.10.sup.6
Raji cells expressing the FL1-BCR (Raji-FL1) (FIG. 4A). Lentiviral
vectors coding for FL1-CAR, Myc-CAR or CD19-CAR were used to
transduce CD3/CD28 bead-activated human CD8.sup.+ T cells resulting
in a high efficiency of gene transfer (FIG. 4B). Injection of
5.times.10.sup.6 FL1-CART or CD19-CART significantly suppressed the
tumor burden and improved survival in comparison with control group
treated by Myc-CART (FIGS. 4C and 4D, FIGS. 7A-7C). On the 37th day
100% mice from the control Myc-CART group were dead compared to 80%
alive animals in the FL1-CART and CD19-CART groups. Flow cytometry
was used to show that CAR-modified T cells persist in peripheral
blood 21 days post infusion, FL1-CAR-T and CD19-CAR-T cells were
present in significantly elevated amounts relative to Myc-CAR-T
cells (FIG. 4D insert). As expected, expansion of CD8.sup.+
CAR-expressing T cells was correlated with expression of surface
markers associated with effector phenotypes (FIG. 4E).
Interestingly, the population of FL1-CART in peripheral blood
generally consisted of an effector memory subset, while spleen and
bone marrow were expanded by a central memory subset of cells (FIG.
4F). These later cells are thought to be important for persistence
and sustained anti-tumor activity.
Discussion
[0392] As immunotherapy expands, a way to discover more tumor
antigens and their specific ligands is needed. At present the
"menu" of tumor antigens is limited (7-12). However in the case of
lymphomas the tumor antigen is already present as the BCR.
Moreover, the BCR is an antibody whose physiological role is to
bind to antigen. This property of the BCR greatly simplifies the
problem of searching for ligands that interact with the malignant
BCR. Herein a "forced proximity" autocrine approach (13) was used,
in which each reporter cell co-expresses one member of a large
peptide library on the cell surface together with the target BCR
where they are co-integrated into the membranes of a population of
reporter cells. Several rounds of autocrine-based selection allows
discovery of a specific peptide ligand for the BCR.
[0393] It was demonstrated that T cells modified by these peptides
fused with CAR efficiently eliminate tumor cells both, ex vivo and
in vivo as efficiently as the well-known CD19-targeted CAR.
[0394] One advantage of this approach to antigen selection is that
after the rounds of panning the selected peptide ligands are
already in a construct where they are fused to the chimeric antigen
receptor. This allows one to immediately generate therapeutic T
lymphocytes modified by tumor-specific CAR.
[0395] In essence the format reported here is the opposite of the
usual CART protocol. Usually in cells bearing the CAR-T
directionality is govern by antibody and target is a surface
peptide or protein of the tumor cell. Here the inverse is used in
that binding of the CAR-T is directed by the peptide and a target
is an antibody. Moreover, since the antibody molecule is part of a
huge diversity system, the target universe is basically unlimited.
This large target universe greatly simplifies the problem of
selecting ligands that are highly specific and tightly binding.
[0396] As more patients are studied, the selected peptide sequences
may be used to determine the proteins they are derived from and by
inference the driving force for the malignant transformation. In
this context, it is interesting the discovered peptide is
homologous to a region of Myoferlin and identical to regions of
surface proteins from Streptococcus mitis and Pneumocytis jirovecii
(FIGS. 8A-8E). Given that there is a suggestion that some lymphomas
such as MALT are driven by sustained exposure to an infectious
agent, the driving force for generation of lymphoid malignancies
will be investigated as more antigens that bind to the BCR are
unearthed. Finally, the ability to use sequences other than CD19 as
targets not only expands the choice in a therapeutic setting but
also my help when the CD19 is absent or down regulated as may occur
in many patients.
REFERENCES
[0397] 1. B. S. Kahl, D. T. Yang, Follicular lymphoma: evolving
therapeutic strategies. Blood 127, 2055-2063 (2016). [0398] 2. K.
Basso, R. Dalla-Favera, Germinal centres and B cell
lymphomagenesis. Nat Rev Immunol 15, 172-184 (2015). [0399] 3. J.
O. Armitage, R. D. Gascoyne, M. A. Lunning, F. Cavalli, Non-Hodgkin
lymphoma. Lancet, (2017). [0400] 4. V. Ribrag, S. Koscielny, J.
Bosq, T. Leguay, O. Casasnovas, L. Fornecker, C. Recher, H.
Ghesquieres, F. Morschhauser, S. Girault, S. Le Gouill, M.
Ojeda-Uribe, C. Mariette, J. Comillon, G. Cartron, V. Verge, C.
Chassagne-Cldment, H. Dombret, B. Coiffier, T. Lamy, H. Tilly, G.
Salles, Rituximab and dose-dense chemotherapy for adults with
Burkitt's lymphoma: a randomised, controlled, open-label, phase 3
trial. Lancet 387, 2402-2411 (2016). [0401] 5. J. Xie, H. Zhang, K.
Yea, R. A. Lerner, Autocrine signaling based selection of
combinatorial antibodies that transdifferentiate human stem cells.
Proc Natl Acad Sci USA 110, 8099-8104 (2013). [0402] 6. R. Testi,
J. H. Phillips, L. L. Lanier, T cell activation via Leu-23 (CD69).
J Immunol 143, 1123-1128 (1989). [0403] 7. E. R. Quinn et al., The
B-cell receptor of a hepatitis C virus (HCV)-associated non-Hodgkin
lymphoma binds the viral E2 envelope protein, implicating HCV in
lymphomagenesis. Blood 98, 3745-3749 (2001). [0404] 8. M. S.
Khodadoust, N. Olsson, L. E. Wagar, O. A. Haabeth, B. Chen, K.
Swaminathan, K. Rawson, C. L. Liu, D. Steiner, P. Lund, S. Rao, L.
Zhang, C. Marceau, H. Stehr, A. M. Newman, D. K. Czerwinski, V. E.
Carlton, M. Moorhead, M. Faham, H. E. Kohrt, J. Carette, M. R.
Green, M. M. Davis, R. Levy, J. E. Elias, A. A. Alizadeh, Antigen
presentation profiling reveals recognition of lymphoma
immunoglobulin neoantigens. Nature 543, 723-727 (2017). [0405] 9.
R. J. Bende, W. M. Aarts, R. G. Riedl, D. de Jong, S. T. Pals, C.
J. van Noesel, Among B cell non-Hodgkin's lymphomas, MALT lymphomas
express a unique antibody repertoire with frequent rheumatoid
factor reactivity. J Exp Med 201, 1229-1241 (2005). [0406] 10. V.
J. Craig, I. Arnold, C. Gerke, M. Q. Huynh, T. Wiindisch, A.
Neubauer, C. Renner, S. Falkow, A. MUller, Gastric MALT lymphoma B
cells express polyreactive, somatically mutated immunoglobulins.
Blood 115, 581-591 (2010). [0407] 11. A. A. Warsame, H. C. Aasheim,
K. Nustad, G. Troen, A. Tierens, V. Wang, U. Randen, H. P. Dong, S.
Heim, A. Brech, J. Delabie, Splenic marginal zone lymphoma with
VH1-02 gene rearrangement expresses poly- and self-reactive
antibodies with similar reactivity. Blood 118, 3331-3339 (2011).
[0408] 12. C. C. Chu, R. Catera, K. Hatzi, X. J. Yan, L. Zhang, X.
B. Wang, H. M. Fales, S. L. Allen, J. E. Kolitz, K. R. Rai, N.
Chiorazzi, Chronic lymphocytic leukemia antibodies with a common
stereotypic rearrangement recognize nonmuscle myosin heavy chain
IIA. Blood 112, 5122-5129 (2008). [0409] 13. H. Zhang, E.
Sturchler, J. Zhu, A. Nieto, P. A. Cistrone, J. Xie, L. He, K. Yea,
T. Jones, R. Turn, P. S. Di Stefano, P. R. Griffin, P. E. Dawson,
P. H. McDonald, R. A. Lerner, Autocrine selection of a GLP-1R
G-protein biased agonist with potent antidiabetic effects. Nat
Commun 6, 8918 (2015). [0410] 14. C. C. Yin, R. Luthra, Molecular
detection of t(14; 18)(q32;q21) in follicular lymphoma. Methods Mol
Biol 999, 203-209 (2013). [0411] 15. K. L. Sachen et al.,
Self-antigen recognition by follicular lymphoma B-cell
receptors.
[0412] Blood 120, 4182-4190 (2012).
Example 2
Follicular Lymphoma
[0413] Lymphoma biopsy samples and patient mononuclear cell
apheresis material were provided by N.N. Petrov Research Institute
of Oncology (St. Petersburg, Russia) from a patient with advanced
follicular lymphoma scheduled to receive high dose chemotherapy and
ASCT. CD34+ HSC were isolated from apheresis material using
anti-human CD34 microbeads and MACS cell separation technique as
per the manufacturer's protocol (Miltenyi Biotech). Cell purity
following MACS separation was >98% as determined by flow
cytometry following staining of the purified cells with
anti-CD34-PE conjugated (Miltenyi). The remaining mononuclear cell
fraction was used for isolation of CD8 T cells. Both CD34+ cells
and CD8 T cells were cryopreserved until use.
[0414] Fresh and viable samples of lymphoma tissue obtained through
biopsy were cut at 3-5 mm.sup.3 pieces and implanted subcutaneously
at multiple sites to four six week old female NOD SCID
(CB17-Prkdc.sup.scid/NciCrl) (Laboratory Animals at the Institute
of Cytology and Genetics, SB RAS).
Generation of Patient Specific Humanised Mice
[0415] Adult female NOD/SCID mice 5 weeks of age were acclimatized
for at least a 7-day period and were myeloablated by sublethal
whole body irradiation (325 rad) delivered by a Gammacell 40
Exactor (Best Theratronics). 18 mice were injected with
0.25.times.10.sup.6 purified CD34+ HSC cells per animal in a total
volume of 200 mkl of phosphate-buffered saline (PBS) via the tail
vein. All engrafted mice were housed under BL-2 conditions and
provided with autoclaved and water supplemented with Baytril
(enrofloxacin).
Analysis of Immune Reconstitution of Patient Specific Humanised
Mice
[0416] To measure the level of reconstitution with human immune
cells following stem cell transplant, mice were bled via the
mandibular route (cheek pouch) using a sterile lancet (Braintree
Scientific). Approximately .about.100 mkl of blood was collected
each time in K.sub.2EDTA coated BD microtainer capillary blood
collector tubes (Fisher Scientific).
[0417] The tubes were spun down at 500.times.g for 5 minutes for
separation of the plasma. The cell pellet was treated with ACK
lysis buffer to lyse RBC and washed extensively with MACS buffer
containing BSA (Miltenyi) to enrich for peripheral blood
mononuclear cells (PBMC).
[0418] Human PBMC, used as controls during flow cytometry analysis
(FACS), was purified from leukapheresis blood collars, following
standard Ficoll density gradient centrifugation techniques.
Immunophenotyping was performed by staining the mononuclear cells
with flurochrome conjugated antibodies specific for different human
immune cell surface markers (e.g., CD45, CD3, CD19, CD4, CD8, etc.)
followed by multi-colour flow cytometry using a LSRII Flow Cytometr
(Becton Dickinson, N.J.). Antibodies were obtained from
eBioscience, Biolegend or BD Biosciences. During FACS, cell gating
was done on viable lymphoid cells based on the forward and side
scatter profile and most analysis performed on cells within the
lymphoid gate.
[0419] A comparison between the percentages of human CD45+ and
endogenous mouse CD45+ was performed to measure the level of immune
reconstitution in mice. Background staining was determined using
the corresponding isotype controls or staining cells isolated from
unengrafted animals. Data was analyzed using the FlowJo software
version 7.6.5 (Tree Star).
[0420] The electrochemiluminiscent based MSD platform (Meso Scale
Discovery, Gaithersburg, Md.) was used to measure specific levels
of human IgM and IgG in the plasma of mice at specific time points
post transplantation. MSD 96-well High Bind Multi-Array plates were
coated with 5 mkl of either anti-human IgM or anti-human IgG Fc
(Bethyl Laboratories) at a concentration of 20 mkg/ml per well at
4.degree. C. overnight. Plates were blocked with PBS/2% fetal
bovine serum for 1 h followed by repeated washing with PBS/0.05%
Tween-20. Mouse plasma samples were tested at 1:50-1:100 dilutions
for human IgG levels and 1:500-1:1000 dilutions for human IgM
levels in a total volume of 20 .mu.l for each sample added per well
in duplicates. Following incubation and washing as described
earlier, 20 .mu.l goat anti-human Ig antibody with SULFO-Tag at a
concentration of 2 .mu.g/ml per well was used as the detection Ab
and plates incubated for 1 h at room temperature. Plates were
developed by adding the appropriate substrate and read on the MSD
Sector Imager 2400 according to the manufacturer's protocol. Human
IgM and IgG standards (Bethyl Labs) was used to obtain the standard
curve and human of Ig levels computed using GraphPad Prism program
version 5. The results are summarized in FIGS. 9-11.
[0421] Identification of the BCR on the malignant B cell is
specified in RU 2017134483. Autocrine-based selection of a ligand
for the BCR on the malignant cells is specified in RU 2017134483.
Lentiviral CAR T construct is specified in RU 2017134483.
CD8.sup.+ T Cell Activation, Expansion and Transduction
[0422] Dynabeads CD8 Positive Isolation Kit (Life Technologies) was
utilized for isolation of CD8 T cells from patient PBMCs fraction
collected by apheresis. Human CD8 T cells were activated with
CD3/CD28 beads at a 1:1 ratio (Life Technologies) in a complete
RPMI media containing 40 IU/ml recombinant IL-2 for 72 hours.
Activated T cells were re-suspended at concentration of 4 million
cells per 3 ml of FL1-CART in lentiviral supernatant plus 1 ml of
fresh RPMI media with 40 IU/ml IL-2 and cultured in 6-well plates.
Plates were centrifuged at 1200.times.g for 90 minutes at
32.degree. C. and then incubated for 4 hours at 37.degree. C.
Second and third transductions were performed two more times.
BCR Vaccination
[0423] In order to obtain the soluble form of patient follicular
lymphoma BCR as a full-size antibody, VH and VL were cloned into
the pFUSE antibody expression vectors (Invivogen) and produced
utilizing FreeStyle 293 Expression System (Thermo Fisher
Scientific). Protein was further purified and coupled to keyhole
limpet hemocyanin using 0.1% glutaraldehyde as described by Levy
(R. Levy. 1987 et al., Idiotype vaccination against murine B cell
lymphoma. Humoral and cellular responses elicited by tumor-derived
IgM and its molecular subunits. J Immunol. 139:2825). Human IgG
Isotype Control antibody (Invitrogen, cat 12000C) was conjugated to
keyhole limpet hemocyanin as used as the control vaccine. Mice were
immunized using subcutaneous injections with 0.1 ml with an
emulsion of equal parts Freund's complete adjuvant and KLH-IgG at
100 mkg/ml in PBS.
Animal Experiments
[0424] All animal procedures were carried out in a strict
accordance with the recommendations for proper use and care of
laboratory animals (ECC Directive 86/609/EEC. All mouse surgical
procedures and imaging were performed with the animals anesthetized
by intramuscular injection of a 0.02 ml solution of 50% ketamine,
38% xylazine, and 12% acepromazine maleate. Patient B Cell FL tumor
nodules were excised from female NOD SCID
(CB17-Prkdc.sup.scid/NcCrl) mice, tumor fragments without evidence
of necrosis were sliced to equal 3 mm.sup.3 pieces and transplanted
subcutaneously to sixteen NOD/SCID mice with reconstituted patient
immune system at 18 w age. Tumor volume was measured with calipers
and estimated using the formula a/6.times.(lengt
.times.width.times.height). Mice were divided into three
experimental groups treated as follows: [0425] Group 1:
3.times.10.sup.6 FL1-CART intravenously at day 10 after transplant
[0426] Group 2: KLH-patient BCR vaccine subcutaneously at days 1,
5, 15 after transplant [0427] Group 3: 3.times.10.sup.6 FL1-CART
intravenously at day 10 after transplant+KLH- patient BCR vaccine
subcutaneously at days 1, 5 and 15 after transplant [0428] Group 4:
3.times.10.sup.6 FL1-CART intravenously at day 10 after
transplant+KLH isotype control vaccine subcutaneously at days 1, 5
and 15 after transplant Animals were sacrificed at day 38 following
transplant. Tumor growth kinetics in experimental groups are
presented in FIG. 12.
[0429] Thus, the combination of intravenous FL1-CART therapy and
vaccination using the patient BCR vaccine results in synergistic
suppression of tumor growth. Opposite to that, the combination of
intravenous FL1-CART therapy with isotype control vaccine reduces
efficacy of FL1-CART therapy.
Flow Cytometry Analysis
[0430] On the 38th day after tumor inoculation (21st day post CART
infusion), animals from each experimental group were used for
isolation of blood. Erythrocytes were lysed with RBC lysis buffer
(0.15 M NH.sub.4Cl, 10 mM NaHCO.sub.3, 0.1 mM EDTA). Chimeric
FL-BCR expression was detected using synthetic ACILDLPKFCGGGS-Bio
(SEQ ID NO: 29) cyclopeptide (GeneCust) and streptavidin conjugated
with FITC (Thermo Fisher Scientific) and analyzed by Novocyte flow
cytometer (ACEA Biosciences).
[0431] The combination of intravenous FL1-CART therapy and
vaccination using patient BCR vaccine results in the highest levels
of FL1-CART cells in circulation while concomitant vaccination with
isotype control vaccine do not produce any synergy.
Meso-Scale Based Analysis of Specific Antibody Responses:
[0432] MSD analysis of the terminal plasma samples were performed
to measure antibody responses against the patient specific BCR and
IgG Isotype Control
[0433] Patient BCR antigen and Isotype Control antigens were coated
on high bind MSD 96-well plates at concentrations between 20-50
mkg/ml with 5 mkl added per well and incubated overnight at
4.degree. C. Plasma samples were tested at 1:80 dilution.
Sulfo-tagged Anti-human Ig was used as the detection antibody and
reaction developed using an electrochemiluminiscent (ECL) substrate
and read in a MSD Sector Imager 2400 (Meso Scale Discovery).
TABLE-US-00002 TABLE 2 Anti BCR and Isotype Control antibody
responses (MSD relative units) in immunized mice on day 38. Group 1
Group 2 Group 3 Group 4 BCR 700 .+-. 115 4700 .+-. 610 9700 .+-.
1550 1150 .+-. 175 IgG Isotype Control 690 .+-. 225 950 .+-. 170
1050 .+-. 135 3950 .+-. 375 MSD analysis of plasma reactivity to
the respective antigens were measured and compared.
Data is represented as mean+/-SEM. The combination of intravenous
FL1-CART therapy and vaccination using patient BCR vaccine results
in the highest levels of anti BCR reactivity versus BCR vaccine
alone.
[0434] The data above clearly confirm the finding of substantial
therapeutic synergy (tumor growth inhibition and level of
personalized cancer antigen directed CAR T cells and
immunoglobulins) between CAR T adoptive immunotherapy and
vaccination wherein both targets same personalized cancer
antigen.
NSCLC Harbouring EGFRvII Mutation
[0435] To further confirm the observations, a patient with advanced
NSCLC who was scheduled to undergo a cytoreductive surgery at
Advanced Surgery Department of Kirov Academy of Military Medicine
(St. Petersburg) and whose tumor tissue was positive for EGFRvIII
mutation as confirmed by ICH staining of biopsy material was
identified.
[0436] Epidermal growth factor receptor variant III (EGFRvIII) is
the result of a novel tumor-specific gene rearrangement that
produces a unique protein expressed in approximately 30% of
gliomas, and certain other cancers including lung, breast and
ovarian cancers. By deletion of a segment of the ligand-binding
domain, EGFRvIII bypasses the need of ligand. This deletion spans
exons 2-7, resulting in the introduction of a novel glycine residue
at the fusion junction. While this mutant cannot bind ligands, it
resides at the cell membrane and present a case of well-established
personalized cancer model antigen harbouring a tumor specific
mutation.
[0437] Two weeks prior to surgery patients were mobilized with 10
mkg/kg of GM-CSF (Neostim, Pharmsynthez) administered
subcutaneously once a day for 5 consecutive days. Mobilized
peripheral blood stem cells were collected on the Cobe Spectra
Apheresis system. Approximately 3-6 blood volumes were processed
during each daily collection, which lasted up to 11 hours. Patient
underwent two daily apheresis procedures to collect
2.times.10.sup.6 CD34+ cells per kg. CD34+ HSC were isolated from
apheresis material using anti-human CD34 microbeads and MACS cell
separation technique as per the manufacturer's protocol (Miltenyi
Biotech). Cell purity following MACS separation was >98% as
determined by flow cytometry following staining of the purified
cells with anti-CD34-PE conjugated (Miltenyi). The remaining
mononuclear cell fraction was used for isolation of CD8 T cells.
Both CD34+ cells and CD8 T cells were cryopreserved until use.
Fresh and viable samples of tumor tissue obtained during patient
surgery were cut at 3-5 mm.sup.3 pieces and implanted
subcutaneously at multiple sites to four six week old female NOD
SCID (CB17-Prkdc.sup.scid/NcrCrl) (Laboratory Animals at the
Institute of Cytology and Genetics, SB RAS).
Generation of Patient Specific Humanised Mice
[0438] Adult female NOD/SCID mice 5 weeks of age were acclimatized
for at least a 7-day period and were myeloablated by sublethal
whole body irradiation (325 rad) delivered by a Gammacell 40
Exactor (Best Theratronics). 18 mice were injected with
0.25.times.10.sup.6 purified CD34+ HSC cells per animal in a total
volume of 200 mkl of phosphate-buffered saline (PBS) via the tail
vein. All engrafted mice were housed under BL-2 conditions and
provided with autoclaved and water supplemented with Baytril
(enrofloxacin).
Analysis of Immune Reconstitution
[0439] Analysis of immune reconstitution was performed as described
above at 6, 12 and 18 wk. Data is presented in FIGS. 14-16.
CAR T Lentiviral Vector
[0440] A EGFRvIII targeting 139-scFv-based CAR vector was assembled
using scFv sequence from human anti-EGFRvIII antibody 131 to T-cell
signalling domains from CD28-41BB-CD3(as described by Rosenberg
(Steven A. Rosenberg et al., Recognition of Glioma Stem Cells by
Genetically Modified T Cells Targeting EGFRvIII and Development of
Adoptive Cell Therapy for Glioma, Hum Gene Ther. 2012 October;
23(10): 1043-1053.) DNA fragment coding for CD28-41BB-CD3.zeta. was
synthesized (GeneCust) and cloned into the pLV2 lentiviral vector
(Clontech) under control of the EF1a promoter. The arrangement of
genes is in the order of: IL2-signal sequence, 139-scFv, GGGS
linker; a CD28 trans-membrane and intracellular region;
intracellular domains of the OX-40 and CD3zetta. The lentiviruses
were prepared by co-transfection of HEK293T cells with the
pLV2-139-scFv-CD28-41BB-CD3zetta plasmid and the packaging plasmids
(2.sup.nd generation). Supernatants containing the virus were
collected at 48 h post transfection. The titer of lentivirus
preparations was determined using Lenti-X p24 ELISAs
(Clontech).
CD8.sup.+ T Cell Activation, Expansion and Transduction
[0441] Dynabeads CD8 Positive Isolation Kit (Life Technologies) was
utilized for isolation of CD8 T cells from patient PBMCs fraction
collected by apheresis. Human CD8 T cells were activated with
CD3/CD28 beads at a 1:1 ratio (Life Technologies) in a complete
RPMI media containing 40 IU/ml recombinant IL-2 for 72 hours.
Activated T cells were re-suspended at concentration of 4 million
cells per 3 ml of CD28-41BB-CD3.zeta.-CAR in lentiviral supernatant
plus 1 ml of fresh RPMI media with 40 IU/ml IL-2 and cultured in
6-well plates. Plates were centrifuged at 1200.times.g for 90
minutes at 32.degree. C. and then incubated for 4 hours at
37.degree. C. Second and third transductions were performed two
more times.
Vaccination
[0442] 14-amino acid peptide corresponding to the amino acid
sequence at the fusion junction (LEEKKGNYVVTDHC) (SEQ ID NO: 30),
was synthesized, purified, and coupled to keyhole limpet hemocyanin
as described by Bigner (Monoclonal Antibodies against EGFRvIII are
Tumor Specific and React with Breast and Lung Carcinomas and
Malignant Gliomas. Darell D. Bigner et al., Cancer Res. 1995 Jul.
15; 55(14):3140-8). LEEKKGNYVVTDHC (SEQ ID NO: 30) is an epitope
recognized by antibody 139, used for engineering of 139-scFv-based
CAR. Mice were immunized using subcutaneous injections with 0.1 ml
with an emulsion of equal parts Freund's complete adjuvant and
KLH-LEEK at 100 mkg/ml in PBS.
Animal Experiments
[0443] All animal procedures were carried out in a strict
accordance with the recommendations for proper use and care of
laboratory animals (ECC Directive 86/609/EEC. All mouse surgical
procedures and imaging were performed with the animals anesthetized
by intramuscular injection of a 0.02 ml solution of 50% ketamine,
38% xylazine, and 12% acepromazine maleate. Patient NSCLC tumor
nodules were excised from female NOD SCID
(CB17-Prkdc.sup.scid/NciCrl) mice, tumor fragments without evidence
of necrosis were sliced to equal 3 mm.sup.3 pieces and transplanted
subcutaneously to fifteen NOD/SCID mice with reconstituted patient
immune system at 18 w age. Tumor volume was measured with calipers
and estimated using the formula
.pi./6.times.(length.times.width.times.height). Mice were divided
into three experimental groups treated as follows: [0444] Group 1:
3.times.10.sup.6 CD28-41BB-CD3.zeta.-CART intravenously at day 10
after transplant [0445] Group 2: KLH-LEEK vaccine subcutaneously at
days 1,5,15 after transplant [0446] Group 3: 3.times.10.sup.6
CD28-41BB-CD3.zeta.-CART intravenously at day 10 after
transplant+KLH-LEEK vaccine subcutaneously at days 1, 5 and 15
after transplant Animals were sacrificed at day 38 following
transplant. Tumor growth kinetics in experimental groups is
presented in FIG. 18.
[0447] `The data confirm the finding of substantial therapeutic
synergy between CAR T adoptive immunotherapy and vaccination
wherein both targets same personalized cancer antigen.
Example 3
Method for Identification of B Cell Receptor Ligand by Phage
Display
[0448] As a general alternative to the Reporter Cells a
phage-displayed cyclopeptide library panning may be performed for
identification of the malignant BCR specific moiety. Commercially
available phage-peptide libraries such as New England Biolabs
Ph.D.-7 and Ph.D.-12 libraries may be utilized. For randomization
Ph.D..TM.-C7C Phage Display Cyclopeptide Library Kit uses NNK
coding moiety flanked by Cysteines shown in FIG. 19. Herein, we
provide modified NEB protocol for a malignant BCR specific peptides
identification. It is recommended to perform negative-selection
incubation during each round of panning.
Panning Procedure:
[0449] 1. Inoculate 10 ml of LB+Tet medium with ER2738, for use in
titering. If amplifying the eluted phage on the same day, also
inoculate 20 ml of LB medium in a 250-ml Erlenmeyer flask (do not
use a 50-ml conical tube) with ER2738. Incubate both cultures at
37.degree. C. with vigorous shaking. ER2738 is E. coli host strain
F' proA+B+ lacIq .DELTA.(lacZ)M15 zzf::Tn10(TetR)/fhuA2 glnV
.DELTA.(lac-proAB) thi-1 .DELTA.(hsdS-mcrB)5. [0450] 2. Transfer 50
.mu.l of a 50% aqueous suspension of affinity beads appropriate for
capture of the antibody to a microfuge tube. Add 1 ml of TBS+0.1%
Tween (TBST). Suspend the resin by tapping the tube. [0451] 3.
Pellet the resin by magnetic capture. Carefully pipette away and
discard the supernatant. [0452] 4. Suspend the resin in 1 ml of
blocking buffer (0.1 M NaHCO.sub.3(pH 8.6), 5 mg/ml BSA, 0.02% NaN3
(optional). Filter sterilize, store at 4.degree. C.). [0453] 5.
Incubate for 60 minutes at 4C, mixing occasionally. [0454] 6. In
the meantime, mix the 2.times.10.sup.9 phages with 2 mkg of a
negative-selection antibody to a final volume of 200 .mu.l with
TBST. [0455] 7. Incubate for 20 minutes at room temperature. [0456]
8. Following the blocking reaction in Step 4, pellet the resin as
in Step 3 and wash 4 times with 1 ml of TBST, pelleting the resin
each time. [0457] 9. Resuspend resing in 1 ml and aliquote to a two
separate tubes (500 mkl each). [0458] 10. Transfer the
phage-neg-antibody mixture to the first tube containing the washed
resin. Mix gently and incubate for 15 minutes at room temperature,
mixing occasionally. [0459] 11. Pellet the resin as in Step 3,
collect the supernatant. [0460] 12. Mix the supernatant with 2 mkg
of the malignant BCR antibody. [0461] 13. Incubate for 20 minutes
at room temperature. [0462] 14. Pellet the resin as in Step 3,
discard the supernatant, and wash 10 times with 1 ml of TBST,
pelleting the resin each time. [0463] 15. Elute the bound phage by
suspending the resin in 1 ml of Glycine Elution Buffer (0.2 M
Glycine-HCl, pH 2.2, 1 mg/ml BSA). [0464] 16. Incubate for 10
minutes at room temperature. [0465] 17. Pellet resin by
magnetization for 1 minute. [0466] 18. Carefully transfer the
supernatant to a new microfuge tube, taking care not to disturb the
pelleted resin. [0467] 19. Immediately neutralize the eluate with
150 .mu.l of 1 M Tris-HCl, pH 9.1. [0468] 20. Amplify the remaining
eluate by adding it to the 20 ml ER2738 culture from Step 1 (must
be early-log; no later) and incubating at 37.degree. C. with
vigorous shaking for 4.5 hours. [0469] 21. Transfer the culture to
a centrifuge tube and spin for 10 minutes at 12,000 g at 4.degree.
C. Transfer the supernatant to a fresh tube and re-spin (discard
the pellet). [0470] 22. Pipette the upper 80% of the supernatant to
a fresh tube and add to it 1/6 volume of 20% PEG/2.5 M NaCl. [0471]
23. Allow the phage to precipitate at 4.degree. C. for 2 hours or
overnight. [0472] 24. Spin the PEG precipitation at 12,000 g rpm
for 15 minutes at 4.degree. C. [0473] 25. Decant and discard the
supernatant, respin briefly, and remove the residual supernatant
with a pipette. [0474] 26. Suspend the pellet in 1 ml of TBS.
Transfer the suspension to a tube and spin for 5 minutes at
4.degree. C. to pellet residual cells. [0475] 27. Transfer the
supernatant to a fresh microcentrifuge tube and reprecipitate with
1/6 volume of 20% PEG/2.5 M NaCl. [0476] 28. Incubate for 15-60
minutes on ice. [0477] 29. Microcentrifuge at 14,000 rpm for 10
minutes at 4.degree. C. [0478] 30. Discard the supernatant, respin
briefly, and remove residual supernatant with a micropipet. [0479]
31. Suspend the pellet in 200 .mu.l of TBS. [0480] 32.
Microcentrifuge at 14,000 rpm for 1 minute to pellet any remaining
insoluble matter. [0481] 33. Transfer the supernatant to a fresh
tube. This is the amplified eluate. [0482] 34. Perform a second and
third rounds of panning.
Plaque Amplification for ELISA and Sequencing:
[0482] [0483] 1. Dilute an overnight culture of ER2738 1:100 in LB.
Dispense 1 ml of diluted culture into 96-well deepwell plates
(#260251, Thermo Scientific). For each antibody to be characterized
use 2 plates. [0484] 2. Stab a blue plaque from a phage plates.
[0485] 3. Use a microplate tape sealer to cover the plates. [0486]
4. Incubate the plates at 37.degree. C. with shaking for 4.5-5
hours. [0487] 5. Centrifuge plates at 250 g for 10 minutes at RT.
[0488] 6. Carefully collect 700 mkl of the supenatant and transfer
to a fresh plate. [0489] 7. This is the amplified phage stock and
can be stored at 4C for two days.
Phage ELISA Binding Assay:
[0489] [0490] 1. Coat ELISA plate wells with 100 .mu.l of 100
.mu.g/ml of malignant BCR antibody or negative-control antibody in
0.1 M NaHCO.sub.3, pH 8.6. [0491] 2. Incubate overnight at 4C.
[0492] 3. Wash each plate 5 times with TBST. [0493] 4. Block ELISA
plate wells by 5% Milk in PBST. [0494] 5. Incubate 1 hour at RT.
[0495] 6. Wash each plate 5 times with TBST. [0496] 7. In the
separate blocked plate, carry out fourfold serial dilutions of the
phage supernantant. [0497] 8. Using a multichannel pipettor,
transfer 100 .mu.l from each row of diluted phage to a row of
antibody-coated wells. [0498] 9. Incubate at RT for 2 hours with
agitation. [0499] 10. Wash each plate 5 times with TBST. [0500] 11.
Dilute HRP-conjugated anti-M13 monoclonal antibody (GE Healthcare.
#27-9421-01) in blocking buffer to the final dilution recommended
by the manufacturer. Add 200 .mu.l of diluted conjugate to each
well. [0501] 12. Incubate at RT for 1 hour with agitation. [0502]
13. Add 50 .mu.l of substrate solution to each well, and incubate
for 10-60 minutes at room temperature with gentle agitation. [0503]
14. Read the plates using a microplate reader set at 415 nm. For
each phage clone, compare the signals obtained with
negative-control and malignant BCR antibody.
Sequencing of Phage DNA:
[0503] [0504] 1. Transfer 500 .mu.l of the phage-containing
supernatant to a fresh microfuge tube. [0505] 2. Add 200 .mu.l of
20% PEG/2.5 M NaCl. Invert several times to mix, and let stand for
10-20 minutes at room temperature. [0506] 3. Microfuge at 14,000
rpm for 10 minutes at 4C and discard the supernatant. Phage pellet
may not be visible. [0507] 4. Re-spin briefly. Carefully pipet away
and discard any remaining supernatant. [0508] 5. Suspend the pellet
thoroughly in 100 .mu.l of Iodide Buffer by vigorously tapping the
tube. [0509] 6. Add 250 .mu.l of ethanol. [0510] 7. Incubate 10-20
minutes at room temperature. [0511] 8. Spin in a microfuge at
14,000 rpm for 10 minutes at 4C. [0512] 9. Discard the supernatant.
[0513] 10. Wash the pellet with 0.5 ml of ice-cold 70% ethanol.
[0514] 11. Suspend the pellet in 30 .mu.l of TE buffer. [0515] 12.
Use 5 .mu.l of the DNA in TE buffer as a template for sequencing.
[0516] 13. Use the reverse primer for DNA sequencing (GCA ATG CGA
TTG ATA CTC CC (SEQ ID NO: 41)).
[0517] Results of the panning are shown in the following tables.
For the display the full-size follicular lymphoma BCR in IgG1
format was used. Patent FL1 is as described in Example 1. Table 3
shows ELISA results for the binding of amplified phages resulting
from I-III rounds of panning against the BCR of patient FL1 with
the BCR of patients FL1 and FL5 at the phage concentrations shown.
Results are also shown in FIG. 20.
TABLE-US-00003 FL1 Ab FL5 Ab Phages amount FL1 Ab phage rounds FL1
Ab phage rounds mkl/well 1 2 3 1 2 3 5 0.1234 2.1417 2.6927 0.2405
0.2538 0.2753 2.50 0.0656 0.873 2.5545 0.122 0.1241 0.133 1.25
0.0577 0.2054 1.5719 0.093 0.1014 0.1127 0.63 0.0534 0.0868 0.5184
0.092 0.0948 0.0982 0.31 0.0523 0.056 0.1392 0.091 0.0901 0.1
Table 4 shows ELISA results for the binding of phages from
individual plaques after III rounds of panning against the BCR of
patient FL1 with the BCR of patient FL1.
TABLE-US-00004 1 2 3 4 5 6 7 8 9 10 11 12 A 0.063 2.024 1.313 1.305
1.132 0.683 0.908 0.718 0.142 0.379 0.225 0.098 B 0.054 0.053 0.117
0.073 1.013 0.068 1.135 0.436 0.1 0.062 0.537 0.695 C 1.015 0.054
0.495 0.743 0.639 0.456 0.076 0.213 0.061 0.728 0.626 0.639 D 0.055
0.783 0.808 0.522 0.754 0.43 0.513 0.443 0.499 0.27 0.147 0.519 E
1.444 0.682 0.564 0.592 0.08 0.42 0.519 0.088 0.111 0.368 0.316
0.055 F 0.871 0.371 0.627 0.604 0.491 0.159 0.371 0.128 0.316 0.241
0.12 0.647 G 0.794 0.909 0.573 0.453 0.484 0.435 0.136 0.379 0.598
0.517 0.525 0.501 H 0.079 1.229 0.205 0.415 1.459 0.36 0.231 0.12
0.075 0.522 0.409 0.091
Table 5 shows ELISA results for the binding of phages from
individual plaques after III rounds of panning against the BCR of
patient FL1 with the BCR of patient FL5.
TABLE-US-00005 1 2 3 4 5 6 7 8 9 10 11 12 A 0.081 0.076 0.056 0.074
0.108 0.073 0.088 0.124 0.088 0.063 0.064 0.074 B 0.059 0.066 0.077
0.102 0.117 0.063 0.079 0.067 0.097 0.062 0.093 0.211 C 0.121 0.085
0.091 0.161 0.074 0.091 0.058 0.091 0.059 0.068 0.093 0.204 D 0.073
0.123 0.097 0.088 0.098 0.101 0.083 0.08 0.071 0.066 0.064 0.196 E
0.067 0.134 0.101 0.068 0.067 0.086 0.092 0.067 0.058 0.141 0.095
0.061 F 0.082 0.276 0.118 0.109 0.064 0.08 0.059 0.059 0.065 0.118
0.068 0.092 G 0.179 0.188 0.106 0.129 0.087 0.143 0.063 0.106 0.108
0.106 0.227 0.127 H 0.102 0.083 0.118 0.15 0.133 0.076 0.08 0.13
0.06 0.119 0.117 0.149
[0518] The positive clones from Table 4 were amplified and
sequenced. The sequence, location on Table 4, and OD are shown
below in Table 6. The peptide identified as binding the BCR of
patient FL1 was also identified as a BCR ligand in Example 1 using
the autocrine signaling method.
TABLE-US-00006 TABLE 6 Sequence (SEQ ID NO: 42) Position OD 1
ILDLPKF C1 1.02 2 ILDLPKF E1 1.44 3 ILDLPKF A2 2.02 4 ILDLPKF H2
1.23 5 ILDLPKF A3 1.31 6 ILDLPKF A4 1.31 7 ILDLPKF A5 1.13 8
ILDLPKF B5 1.01 9 ILDLPKF H5 1.46 10 ILDLPKF B7 1.14
[0519] After the cyclopeptide specific for the FL1 patient's BCR
was identified, as shown in Table 6, the sequence was cloned into a
3-generation CAR lentiviral vector. Two complementary primers
coding for the selected cyclopeptide flaked by EcoRI and NheI
cloning sites were synthesized.
TABLE-US-00007 Primer FL1peptide FW (SEQ ID NO: 43)
TCACGAATTCGGCTTGTATTCTTGATTTGCCGAAGTTTTGCGGTGGAGGT TCGGCTAGC Primer
FL1peptide Rev (SEQ ID NO: 44)
GCTCGCTAGCCGAACCTCCACCGCAAAACTTCGGCAAATCAAGAATACA
[0520] After amplification the PCR product was cloned into the
pLV2-Fc-CAR vector at the EcoRI and NheI restriction sites.
OTHER EMBODIMENTS
[0521] All of the features disclosed in this specification may be
combined in any combination. Each feature disclosed in this
specification may be replaced by an alternative feature serving the
same, equivalent, or similar purpose. Thus, unless expressly stated
otherwise, each feature disclosed is only an example of a generic
series of equivalent or similar features.
[0522] From the above description, one skilled in the art can
easily ascertain the essential characteristics of the present
invention, and without departing from the spirit and scope thereof,
can make various changes and modifications of the invention to
adapt it to various usages and conditions. Thus, other embodiments
are also within the claims.
EQUIVALENTS
[0523] While several inventive embodiments have been described and
illustrated herein, those of ordinary skill in the art will readily
envision a variety of other means and/or structures for performing
the function and/or obtaining the results and/or one or more of the
advantages described herein, and each of such variations and/or
modifications is deemed to be within the scope of the inventive
embodiments described herein. More generally, those skilled in the
art will readily appreciate that all parameters, dimensions,
materials, and configurations described herein are meant to be
exemplary and that the actual parameters, dimensions, materials,
and/or configurations will depend upon the specific application or
applications for which the inventive teachings is/are used. Those
skilled in the art will recognize, or be able to ascertain using no
more than routine experimentation, many equivalents to the specific
inventive embodiments described herein. It is, therefore, to be
understood that the foregoing embodiments are presented by way of
example only and that, within the scope of the appended claims and
equivalents thereto, inventive embodiments may be practiced
otherwise than as specifically described and claimed. Inventive
embodiments of the present disclosure are directed to each
individual feature, system, article, material, kit, and/or method
described herein. In addition, any combination of two or more such
features, systems, articles, materials, kits, and/or methods, if
such features, systems, articles, materials, kits, and/or methods
are not mutually inconsistent, is included within the inventive
scope of the present disclosure.
[0524] All definitions, as defined and used herein, should be
understood to control over dictionary definitions, definitions in
documents incorporated by reference, and/or ordinary meanings of
the defined terms.
[0525] All references, patents and patent applications disclosed
herein are incorporated by reference with respect to the subject
matter for which each is cited, which in some cases may encompass
the entirety of the document.
[0526] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0527] The phrase "and/or," as used herein in the specification and
in the claims, should be understood to mean "either or both" of the
elements so conjoined, i.e., elements that are conjunctively
present in some cases and disjunctively present in other cases.
Multiple elements listed with "and/or" should be construed in the
same fashion, i.e., "one or more" of the elements so conjoined.
Other elements may optionally be present other than the elements
specifically identified by the "and/or" clause, whether related or
unrelated to those elements specifically identified. Thus, as a
non-limiting example, a reference to "A and/or B", when used in
conjunction with open-ended language such as "comprising" can
refer, in one embodiment, to A only (optionally including elements
other than B); in another embodiment, to B only (optionally
including elements other than A); in yet another embodiment, to
both A and B (optionally including other elements); etc.
[0528] As used herein in the specification and in the claims, "or"
should be understood to have the same meaning as "and/or" as
defined above. For example, when separating items in a list, "or"
or "and/or" shall be interpreted as being inclusive, i.e., the
inclusion of at least one, but also including more than one, of a
number or list of elements, and, optionally, additional unlisted
items. Only terms clearly indicated to the contrary, such as "only
one of" or "exactly one of," or, when used in the claims,
"consisting of," will refer to the inclusion of exactly one element
of a number or list of elements. In general, the term "or" as used
herein shall only be interpreted as indicating exclusive
alternatives (i.e. "one or the other but not both") when preceded
by terms of exclusivity, such as "either," "one of," "only one of,"
or "exactly one of." "Consisting essentially of," when used in the
claims, shall have its ordinary meaning as used in the field of
patent law.
[0529] As used herein in the specification and in the claims, the
phrase "at least one," in reference to a list of one or more
elements, should be understood to mean at least one element
selected from any one or more of the elements in the list of
elements, but not necessarily including at least one of each and
every element specifically listed within the list of elements and
not excluding any combinations of elements in the list of elements.
This definition also allows that elements may optionally be present
other than the elements specifically identified within the list of
elements to which the phrase "at least one" refers, whether related
or unrelated to those elements specifically identified. Thus, as a
non-limiting example, "at least one of A and B" (or, equivalently,
"at least one of A or B," or, equivalently "at least one of A
and/or B") can refer, in one embodiment, to at least one,
optionally including more than one, A, with no B present (and
optionally including elements other than B); in another embodiment,
to at least one, optionally including more than one, B, with no A
present (and optionally including elements other than A); in yet
another embodiment, to at least one, optionally including more than
one, A, and at least one, optionally including more than one, B
(and optionally including other elements); etc.
[0530] It should also be understood that, unless clearly indicated
to the contrary, in any methods claimed herein that include more
than one step or act, the order of the steps or acts of the method
is not necessarily limited to the order in which the steps or acts
of the method are recited.
Sequence CWU 1
1
4419PRTArtificial SequenceSynthetic polypeptide 1Cys Ile Leu Asp
Leu Pro Lys Phe Cys1 529PRTArtificial SequenceSynthetic polypeptide
2Cys Met Pro His Trp Gln Asn His Cys1 539PRTArtificial
SequenceSynthetic polypeptide 3Cys Thr Thr Asp Gln Ala Arg Lys Cys1
5423DNAArtificial SequenceSynthetic polynucleotide 4atggactgga
cctggaggat cct 23524DNAArtificial SequenceSynthetic polynucleotide
5atggacatac tttgttccac gctc 24621DNAArtificial SequenceSynthetic
polynucleotide 6atggagtttg ggctgagctg g 21723DNAArtificial
SequenceSynthetic polynucleotide 7atgaaacacc tgtggttctt cct
23821DNAArtificial SequenceSynthetic polynucleotide 8atggggtcaa
ccgccatcct c 21924DNAArtificial SequenceSynthetic polynucleotide
9atgtctgtct ccttcctcat cttc 241022DNAArtificial SequenceSynthetic
polynucleotide 10ctctcaggac tgatgggaag cc 221118DNAArtificial
SequenceSynthetic polynucleotide 11ggagacgagg gggaaaag
181219DNAArtificial SequenceSynthetic polynucleotide 12gcctgagttc
cacgacacc 191318DNAArtificial SequenceSynthetic polynucleotide
13cagggggaag accgatgg 181423DNAArtificial SequenceSynthetic
polynucleotide 14gacatccaga tgacccagtc tcc 231524DNAArtificial
SequenceSynthetic polynucleotide 15gatattgtga tgacccagac tcca
241624DNAArtificial SequenceSynthetic polynucleotide 16gaaattgtgt
tgacacagtc tcca 241720DNAArtificial SequenceSynthetic
polynucleotide 17cccctgttga agctctttgt 201819DNAArtificial
SequenceSynthetic polynucleotide 18agatggcggg aagatgaag
191926DNAArtificial SequenceSynthetic polynucleotide 19cagtctgtgt
tgacgcagcc gccctc 262023DNAArtificial SequenceSynthetic
polynucleotide 20tctgtgctga ctcagccacc ctc 232126DNAArtificial
SequenceSynthetic polynucleotide 21cagtctgtcg tgacgcagcc gccctc
262226DNAArtificial SequenceSynthetic polynucleotide 22tccgtgtccg
ggtctcctgg acagtc 262324DNAArtificial SequenceSynthetic
polynucleotide 23actcagccac cctcggtgtc agtg 242424DNAArtificial
SequenceSynthetic polynucleotide 24tcctctgcct ctgcttccct ggga
242520DNAArtificial SequenceSynthetic polynucleotide 25cagcctgtgc
tgactcagcc 202619DNAArtificial SequenceSynthetic polynucleotide
26gtgtggcctt gttggcttg 192718DNAArtificial SequenceSynthetic
polynucleotide 27cgagggggca gccttggg 182824DNAArtificial
SequenceSynthetic polynucleotide 28agtgaccgtg gggttggcct tggg
242914PRTArtificial SequenceSynthetic polypeptide 29Ala Cys Ile Leu
Asp Leu Pro Lys Phe Cys Gly Gly Gly Ser1 5 103014PRTArtificial
SequenceSynthetic polypeptide 30Leu Glu Glu Lys Lys Gly Asn Tyr Val
Val Thr Asp His Cys1 5 10319PRTArtificial SequenceSynthetic
polypeptide 31Cys Ile Leu Asp Leu Pro Lys Phe Cys1
53227PRTArtificial SequenceSynthetic polypeptide 32Thr Gly Thr Ala
Thr Thr Cys Thr Thr Gly Ala Thr Thr Thr Gly Cys1 5 10 15Cys Gly Ala
Ala Gly Thr Thr Thr Thr Gly Cys 20 2533501PRTArtificial
SequenceSynthetic polypeptidemisc_feature(23)..(29)Xaa can be any
naturally occurring amino acid 33Met Tyr Arg Met Gln Leu Leu Ser
Cys Ile Ala Leu Ser Leu Ala Leu1 5 10 15Val Thr Asn Ser Ala Cys Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Cys Gly Gly 20 25 30Gly Ser Ala Ser Glu Pro
Lys Ser Cys Asp Lys Thr His Thr Cys Pro 35 40 45Pro Cys Pro Ala Pro
Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro 50 55 60Pro Lys Pro Lys
Asp Thr Leu Met Ile Ala Arg Thr Pro Glu Val Thr65 70 75 80Cys Val
Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn 85 90 95Trp
Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg 100 105
110Glu Glu Gln Tyr Gln Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val
115 120 125Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys
Val Ser 130 135 140Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile
Ser Lys Ala Lys145 150 155 160Gly Gln Pro Arg Glu Pro Gln Val Tyr
Thr Leu Pro Pro Ser Arg Asp 165 170 175Glu Leu Thr Lys Asn Gln Val
Ser Leu Thr Cys Leu Val Lys Gly Phe 180 185 190Tyr Pro Ser Asp Ile
Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 195 200 205Asn Asn Tyr
Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 210 215 220Phe
Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly225 230
235 240Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His
Tyr 245 250 255Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Gly Ser
Thr Ser Gly 260 265 270Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr
Lys Gly Phe Trp Val 275 280 285Leu Val Val Val Gly Gly Val Leu Ala
Cys Tyr Ser Leu Leu Val Thr 290 295 300Val Ala Phe Ile Ile Phe Trp
Val Arg Ser Lys Arg Ser Arg Leu Leu305 310 315 320His Ser Asp Tyr
Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg 325 330 335Lys His
Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg 340 345
350Ser Arg Asp Gln Arg Leu Pro Pro Asp Ala His Lys Pro Pro Gly Gly
355 360 365Gly Ser Phe Arg Thr Pro Ile Gln Glu Glu Gln Ala Asp Ala
His Ser 370 375 380Thr Leu Ala Lys Ile Arg Val Lys Phe Ser Arg Ser
Ala Asp Ala Pro385 390 395 400Ala Tyr Gln Gln Gly Gln Asn Gln Leu
Tyr Asn Glu Leu Asn Leu Gly 405 410 415Arg Arg Glu Glu Tyr Asp Val
Leu Asp Lys Arg Arg Gly Arg Asp Pro 420 425 430Glu Met Gly Gly Lys
Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr 435 440 445Asn Glu Leu
Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly 450 455 460Met
Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln465 470
475 480Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met
Gln 485 490 495Ala Leu Pro Pro Arg 50034607PRTArtificial
SequenceSynthetic polypeptide 34Met Tyr Arg Met Gln Leu Leu Ser Cys
Ile Ala Leu Ser Leu Ala Leu1 5 10 15Val Thr Asn Ser Ala Ala Gln Pro
Ala Ile Ser Arg Glu Val Gln Leu 20 25 30Val Glu Ser Gly Gly Asp Leu
Val Gln Pro Gly Gly Ser Leu Arg Leu 35 40 45Ser Cys Val Ala Ser Gly
Phe Asn Phe Ser Asn Phe Thr Met Asn Trp 50 55 60Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Leu Ser Asn Ile Ser65 70 75 80Arg Asn Gly
Ser Asp Lys Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe 85 90 95Asn Ile
Ser Arg Asp Asn Gly Asn Asn Ser Leu Tyr Leu Gln Met Asn 100 105
110Arg Leu Lys Asp Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asn Arg
115 120 125Ser Asp Ser Gly Ser Asn Gln Arg Phe Phe Asp Tyr Trp Gly
Gln Gly 130 135 140Thr Leu Val Thr Val Ser Ser Ala Ser Leu Gly Gly
Gly Gly Ser Gly145 150 155 160Gly Gly Gly Ser Gly Gly Gly Gly Ser
Thr Ser Tyr Glu Leu Met Gln 165 170 175Pro Pro Ser Val Ser Val Ser
Pro Gly Gln Thr Ala Ser Ile Thr Cys 180 185 190Ser Gly Asp Lys Leu
Gly Asp Lys Tyr Val Ser Trp Tyr Gln Gln Lys 195 200 205Ala Gly Gln
Pro Leu Leu Leu Val Ile Tyr Gln Asp Asp Val Arg Pro 210 215 220Ser
Gly Ile Thr Glu Arg Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala225 230
235 240Thr Leu Thr Ile Ser Gly Ala Gln Ala Met Asp Glu Ala Asp Tyr
Phe 245 250 255Cys Gln Ala Trp Asp Ser Asn Ile Tyr Val Phe Gly Ser
Gly Thr Lys 260 265 270Val Thr Val Leu Gly Gly Ala Leu Gly Leu Gly
Gly Leu Ala Ser Glu 275 280 285Pro Lys Ser Cys Asp Lys Thr His Thr
Cys Pro Pro Cys Pro Ala Pro 290 295 300Glu Leu Leu Gly Gly Pro Ser
Val Phe Leu Phe Pro Pro Lys Pro Lys305 310 315 320Asp Thr Leu Met
Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 325 330 335Asp Val
Ser His Glu Asp Pro Glu Val Lys Phe Asn Tyr Trp Tyr Val 340 345
350Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln
355 360 365Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu
His Gln 370 375 380Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val
Ser Asn Lys Ala385 390 395 400Leu Pro Ala Pro Ile Glu Lys Thr Ile
Ser Lys Ala Lys Gly Gln Pro 405 410 415Arg Glu Pro Gln Val Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr 420 425 430Lys Asn Gln Val Ser
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 435 440 445Asp Ile Ala
Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 450 455 460Lys
Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr465 470
475 480Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe 485 490 495Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr
Thr Gln Lys 500 505 510Ser Leu Ser Leu Ser Pro Gly Lys Gly Ser Thr
Ser Gly Ser Gly Lys 515 520 525Pro Gly Ser Gly Glu Gly Ser Thr Lys
Gly Glu Asn Leu Tyr Phe Gln 530 535 540Gly Asp Leu Asn Ala Val Gly
Gln Asp Thr Ala Val Gly Gln Asp Thr545 550 555 560Gln Glu Val Ile
Val Val Pro His Ser Leu Pro Phe Lys Val Val Val 565 570 575Ile Ser
Ala Ile Leu Ala Leu Val Val Leu Thr Ile Ile Ser Leu Ile 580 585
590Ile Leu Ile Met Leu Trp Gln Lys Lys Pro Arg Ile Gly Ile Arg 595
600 6053528PRTHomo Sapiens 35Gly Lys Gly Arg Asp Glu Pro Asn Met
Asn Pro Lys Leu Asp Leu Pro1 5 10 15Asn Arg Pro Glu Thr Ser Phe Leu
Trp Phe Thr Asn 20 253628PRTStreptococcus mitis 36Lys Gln Ser Lys
Ile Val Ser Val Val Pro Asn Ile Leu Asp Leu Pro1 5 10 15Lys Phe Glu
Gly Thr Thr Glu Trp Ile Asp Val Asn 20 253728PRTPneumocystis
jirovecii 37Tyr Ser Ser Ile Asp Ser Ile Phe Tyr Glu Gly Ile Leu Asp
Leu Pro1 5 10 15Lys Phe Arg Tyr Phe Ile Ser Gly Lys Asp Ile Ser 20
253839DNAArtificial SequenceSynthetic
polynucleotidemisc_feature(7)..(8)n is a, c, g, t or
umisc_feature(9)..(9)k is g or tmisc_feature(10)..(11)n is a, c, g,
t or umisc_feature(12)..(12)k is g or tmisc_feature(13)..(14)n is
a, c, g, t or umisc_feature(15)..(15)k is g or
tmisc_feature(16)..(17)n is a, c, g, t or umisc_feature(18)..(18)k
is g or tmisc_feature(19)..(20)n is a, c, g, t or
umisc_feature(21)..(21)k is g or tmisc_feature(22)..(23)n is a, c,
g, t or umisc_feature(24)..(24)k is g or tmisc_feature(25)..(26)n
is a, c, g, t or umisc_feature(27)..(27)k is g or t 38gcttgtnnkn
nknnknnknn knnknnktgc ggtggaggt 393939DNAArtificial
SequenceSynthetic polynucleotidemisc_feature(7)..(8)n is a, c, g, t
or umisc_feature(9)..(9)m is a or cmisc_feature(10)..(11)n is a, c,
g, t or umisc_feature(12)..(12)m is a or cmisc_feature(13)..(14)n
is a, c, g, t or umisc_feature(15)..(15)m is a or
cmisc_feature(16)..(17)n is a, c, g, t or umisc_feature(18)..(18)m
is a or cmisc_feature(19)..(20)n is a, c, g, t or
umisc_feature(21)..(21)m is a or cmisc_feature(22)..(23)n is a, c,
g, t or umisc_feature(24)..(24)m is a or cmisc_feature(25)..(26)n
is a, c, g, t or umisc_feature(27)..(27)m is a or c 39cgaacannmn
nmnnmnnmnn mnnmnnmacg ccacctcca 394013PRTArtificial
SequenceSynthetic polypeptidemisc_feature(3)..(9)Xaa can be any
naturally occurring amino acid 40Ala Cys Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Cys Gly Gly Gly1 5 104120DNAArtificial SequenceSynthetic
polynucleotide 41gcaatgcgat tgatactccc 20427PRTArtificial
SequenceSynthetic polypeptide 42Ile Leu Asp Leu Pro Lys Phe1
54359DNAArtificial SequenceSynthetic polynucleotide 43tcacgaattc
ggcttgtatt cttgatttgc cgaagttttg cggtggaggt tcggctagc
594449DNAArtificial SequenceSynthetic polynucleotide 44gctcgctagc
cgaacctcca ccgcaaaact tcggcaaatc aagaataca 49
* * * * *
References