U.S. patent application number 17/224819 was filed with the patent office on 2021-10-28 for genetically stable live attenuated respiratory syncytial virus vaccine and its production.
This patent application is currently assigned to The United States of America, as represented by the Secretary, Department of Health and Human Servic. The applicant listed for this patent is The United States of America, as represented by the Secretary, Department of Health and Human Servic, The United States of America, as represented by the Secretary, Department of Health and Human Servic. Invention is credited to Ursula J. Buchholz, Peter L. Collins, Cindy L. Luongo, Brian R. Murphy.
Application Number | 20210330782 17/224819 |
Document ID | / |
Family ID | 1000005697335 |
Filed Date | 2021-10-28 |
United States Patent
Application |
20210330782 |
Kind Code |
A1 |
Collins; Peter L. ; et
al. |
October 28, 2021 |
GENETICALLY STABLE LIVE ATTENUATED RESPIRATORY SYNCYTIAL VIRUS
VACCINE AND ITS PRODUCTION
Abstract
Provided herein are recombinant respiratory syncytial viruses
that contain mutations that make the disclosed viruses attractive
vaccine candidates. The viruses disclosed contain attenuating
mutations designed to have increased genetic and phenotypic
stability. Desired combinations of these mutations can be made to
achieve desired levels of attenation. Exemplary vaccine candidates
are described. Also provided are polynucleotides capable of
encoding the described viruses, as wells as methods for producing
the viruses and methods of use.
Inventors: |
Collins; Peter L.; (Silver
Spring, MD) ; Luongo; Cindy L.; (Bethesda, MD)
; Buchholz; Ursula J.; (Silver Spring, MD) ;
Murphy; Brian R.; (Bethesda, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The United States of America, as represented by the Secretary,
Department of Health and Human Servic |
Bethesda |
MD |
US |
|
|
Assignee: |
The United States of America, as
represented by the Secretary, Department of Health and Human
Servic
Bethesda
MD
|
Family ID: |
1000005697335 |
Appl. No.: |
17/224819 |
Filed: |
April 7, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16425725 |
May 29, 2019 |
10980872 |
|
|
17224819 |
|
|
|
|
15455438 |
Mar 10, 2017 |
10307476 |
|
|
16425725 |
|
|
|
|
14394226 |
Oct 13, 2014 |
9624475 |
|
|
PCT/US2013/030836 |
Mar 13, 2013 |
|
|
|
15455438 |
|
|
|
|
61624010 |
Apr 13, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2760/18562
20130101; A61K 2039/5254 20130101; C12N 2760/18522 20130101; C12N
2760/18521 20130101; A61K 39/12 20130101; C12N 7/00 20130101; A61K
39/155 20130101; C12N 2760/18534 20130101; C07K 14/005
20130101 |
International
Class: |
A61K 39/155 20060101
A61K039/155; A61K 39/12 20060101 A61K039/12; C07K 14/005 20060101
C07K014/005; C12N 7/00 20060101 C12N007/00 |
Claims
1. A vaccine, comprising an immunologically effective amount of a
recombinant infectious respiratory syncytial virus comprising a
large polymerase protein (L), phosphoprotein (P), nucleocapsid
protein (N) and a M2-1 protein and a genome or antigenome having a
deletion of the codon that encodes the serine at position 1313, or
a corresponding position, of the L protein, and optionally
comprises nonstructural protein 1 (NS1), nonstructural protein 2
(NS2), glycoprotein (G), fusion protein (F), matrix protein (M),
M2-2 protein, and small hydrophobic protein (SH).
2. The vaccine of claim 1, wherein the virus is attenuated.
3. The vaccine of claim 1, wherein the viral genome or antigenome
further comprises a mutation of the codon that encodes the tyrosine
at position 1321, or a corresponding position, of the L
protein.
4. The vaccine of claim 1, wherein the viral genome or antigenome
further comprises a deletion of the NS2 gene.
5. The vaccine of claim 1, wherein the viral genome or antigenome
further comprises one or more of the following mutations: the L
protein mutation of 1321K, 1321E, 1321P, 1321G, 1321K(AAA),
1321E(GAA), 1321P(CCT), 1321G(GGA), or 1321G(GGT); the L protein
mutation Q831L; V267I in the N protein, E218A in the F protein,
T523 I in the F protein, C319Y in the L protein, and H1690Y in the
L protein; a T to C substitution at the ninth nucleotide position
of the gene-start signal of the M2 gene, which corresponds to
nucleotide 7606 of a positive sense complement of the genome of RSV
strain A2; and deletion of the SH gene.
6. The vaccine of claim 1, wherein the viral genome or antigenome
further comprises: a mutation of the codon that encodes the
tyrosine at position 1321, or a corresponding position, of the L
protein, wherein the mutation of the codon is an AAA mutation.
7. The vaccine of claim 1, wherein the viral genome or antigenome
further comprises: a mutation of the codon that encodes the
tyrosine at position 1321, or a corresponding position, of the L
protein, wherein the mutation of the codon is an AAA mutation;
V267I in the N protein, E218A and T523I in the F protein, and C319Y
and H1690Y in the L protein; and a deletion of the SH gene.
8. The vaccine of claim 1, wherein the viral genome or antigenome
further comprises a mutation of amino acid sequence residue 1314,
or a corresponding position, of the L protein, wherein the mutation
of L protein amino acid sequence residue 1314 is an amino acid
substitution of leucine for isoleucine.
9. The vaccine of claim 8, wherein the mutation of L protein amino
acid sequence residue 1314 is encoded by the codon CTG.
10. The vaccine of claim 8, wherein the virus is attenuated.
11. The vaccine of claim 8, wherein the viral genome or antigenome
further comprises a mutation of the codon that encodes a tyrosine
at position 1321, or a corresponding position, of the L
protein.
12. The vaccine of claim 8, wherein the viral genome or antigenome
further comprises a deletion of the NS2 gene.
13. The vaccine of claim 8, wherein the viral genome or antigenome
further comprises one or more of the following mutations: the L
protein mutation of 1321K, 1321E, 1321P, 1321G, 1321K(AAA),
1321E(GAA), 1321P(CCT), 1321G(GGA), or 1321G(GGT); the L protein
mutation Q831L; V2671 in the N protein, E218A in the F protein,
T5231 in the F protein, C319Y in the L protein, and H1690Y in the L
protein; a T to C substitution at the ninth nucleotide position of
the gene-start signal of the M2 gene, which corresponds to
nucleotide 7606 of a positive sense complement of the genome of RSV
strain A2; and deletion of the SH gene.
14. A method of producing an immune response to a viral protein,
comprising administering the vaccine of claim 1 to an animal.
15. The method of claim 14, wherein the vaccine is administered via
injection, aerosol delivery, nasal spray, nasal droplets, oral
inoculation, or topical application.
16. The method of claim 14, wherein the animal is a mammal.
17. The method of claim 16, wherein the mammal is a human.
18. A vaccine comprising an effective amount of a recombinant
infectious respiratory syncytial virus comprising a large
polymerase protein (L), phosphoprotein (P), nucleocapsid protein
(N), a M2-1 protein nonstructural protein 1 (NS1), a glycoprotein
(G), a fusion protein (F), a matrix protein (M), a M2-2 protein,
and a small hydrophobic protein (SH), and a genome or antigenome
having: a deletion of the codon that encodes the serine at position
1313, or a corresponding position, of the L protein, a mutation of
amino acid sequence residue 1314, or a corresponding position, of
the L protein, wherein the mutation of L protein amino acid
sequence residue 1314 is an amino acid substitution of leucine for
isoleucine, wherein the leucine is encoded by a codon set forth as
CTG; and a deletion of the NS2 gene.
19. A method of producing an immune response to a viral protein,
comprising administering the vaccine of claim 18 to an animal.
20. The method of claim 19, wherein the vaccine is administered via
injection, aerosol delivery, nasal spray, nasal droplets, oral
inoculation, or topical application.
21. The method of claim 19, wherein the animal is a mammal.
22. The method of claim 21, wherein the mammal is a human.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/425,725, filed May 29, 2019, which is a
continuation of U.S. application Ser. No. 15/455,438, filed Mar.
10, 2017, issued as U.S. Pat. No. 10,307,476 on Jun. 4, 2019, which
is a divisional of U.S. application Ser. No. 14/394,226, filed Oct.
13, 2014, issued as U.S. Pat. No. 9,624,475 on Apr. 18, 2017, which
is the National Stage of International Application No.
PCT/US2013/030836, filed Mar. 13, 2013, which in turn claims the
benefit of U.S. Provisional Application No. 61/624,010, filed Apr.
13, 2012, the contents of each of these applications is
specifically incorporated by reference herein in their
entirety.
TECHNICAL FIELD
[0002] The subject matter disclosed herein relates to
paramyxoviruses, in particular, respiratory syncytial virus and
attenuated, mutant strains thereof.
BACKGROUND
[0003] Human respiratory syncytial virus (RSV) infects nearly
everyone worldwide early in life and is responsible for
considerable mortality and morbidity. In the United States alone,
RSV is responsible for 75,000-125,000 hospitalizations yearly, and
worldwide conservative estimates conclude that RSV is responsible
for 64 million pediatric infections and 160,000 pediatric deaths.
Another unusual feature of RSV is that severe infection in infancy
can be followed by years of airway dysfunction, including a
predisposition to airway reactivity. RSV infection exacerbates
asthma and may be involved in initiating asthma.
[0004] RSV is a member of the Paramyxoviridae family and, as such,
is an enveloped virus that replicates in the cytoplasm and matures
by budding through the host cell plasma membrane. The genome of RSV
is a single, negative-sense strand of RNA of 15.2 kilobases that is
transcribed by the viral polymerase into 10 mRNAs by a sequential
stop-start mechanism that initiates at a single viral promoter at
the 3' end of the genome. Each mRNA encodes a single major protein,
with the exception of the M2 mRNA, which has two overlapping open
reading frames that encode two separate proteins. The 11 RSV
proteins are: the RNA-binding nucleocapsid protein (N), the
phosphoprotein (P), the large polymerase protein (L), the
attachment glycoprotein (G), the fusion protein (F), the small
hydrophobic (SH) surface glycoprotein, the internal matrix protein
(M), the two nonstructural proteins NS1 and NS2, and the M2-1 and
M2-2 proteins encoded by the M2 mRNA. The RSV gene order is:
3'-NS1-NS2-N-P-M-SH-G-F-M2-L. Each gene is flanked by short
transcription signals called the gene-start (GS) signal, present on
the upstream end of the gene and involved in initiating
transcription of the respective gene, and the gene-end (GE) signal,
present at the downstream end of the gene and involved in directing
synthesis of a polyA tail followed by release of the mRNA.
[0005] The development of live-attenuated vaccines has been in
progress since the 1960's but has been complicated by a number of
factors. For example, RSV grows only to moderate titers in cell
culture and is often present in long filaments that are difficult
to purify and can readily lose infectivity during handling. Another
problem is that the magnitude of the protective immune response is
roughly proportional to the extent of virus replication (and
antigen production). Thus, attenuation is accompanied by a
reduction in immunogenicity, and it is essential to identify a
level of replication that is well tolerated yet satisfactorily
immunogenic. These studies can only be done in humans, because RSV
does not replicate efficiently in most experimental animals, such
as rodents and monkeys. Chimpanzees are more permissive but usually
are not readily available. Another obstacle is the difficulty in
developing attenuating mutations. Another obstacle is genetic
instability that is characteristic of RNA viruses, whereby
attenuating mutations can revert to the wild-type assignment or to
an alternative assignment that confers a non-attenuated
phenotype.
[0006] Until recently, RSV vaccine candidates were developed by
conventional biological means. These previous biologically-derived
candidates were either under-attenuated or over-attenuated, and
genetic instability was observed in some cases.
SUMMARY
[0007] Disclosed herein are particular mutations useful, either
individually or in combinations that may include other known
mutations, in producing recombinant, attenuated strains of
respiratory syncytial virus that have improved genetic and
phenotypic stability, which are useful features for live vaccine
viruses. For example, recombinant RSV strains of the invention
provide a level of attenuation that was similar to that of a
promising experimental live-attenuated RSV vaccine that was
well-tolerated and immunogenic in young infants (Karron et al JID
191:1093-104, 2005); however, the present vaccines exhibited
increased genetic stability. This can involve the use of an
alternate amino acid assignment at specified positions, or of a
different codon encoding the same amino acid assignment. In some
aspects, the recombinant viruses disclosed herein include a
mutation in the codon encoding amino acid residue 1321 of the RSV L
protein (the 1321 codon), a position that was previously found to
be unstable in attenuated RSV evaluated in clinical trials (Karron
et al JID 191:1093-104, 2005). Certain substitutions imparted
increased stability at residue 1321. Unexpectedly, this was
associated with increased instability at a novel site, namely L
amino acid residue 1313. Thus, in some aspects, the recombinant
viruses disclosed herein include alternative codons encoding amino
acid residue 1313 of the RSV L protein (the 1313 codon). Used in
combination, certain codons at positions 1321 and 1313 imparted
increased genetic and phenotypic stability to both sites. In some
embodiments disclosed herein the 1313 codon may be deleted
altogether to create a deletion mutant strain (e.g. RSV
.DELTA.1313). Specific attenuated recombinant viruses are described
that bear desired combinations of mutations including ones at
codons 1321, 1313, and 1314 of the L protein, in combination with
other point mutations and/or gene-deletion mutations. Other
recombinant viruses include RSV having a mutation in one or more of
the codons that encode amino acid residues 1744-1764, including a
number of codon deletions involving 1 or 2 or several contiguous
amino acids from this region, or as many as 13, 14, or 21
contiguous amino acids. Further, disclosed herein are recombinant
RSVs having a mutation or deletion of the codon encoding the amino
acid residue at position 1316 of the RSV L protein. Also described
is recombinant virus bearing deletion of position 1314 in the L
protein. The recombinant respiratory syncytial virus particles
disclosed herein can comprise a genome that encodes nonstructural
protein 1 (NS1), nonstructural protein 2 (NS2), nucleocapsid
protein (N), phosphoprotein (P), matrix protein (M), small
hydrophobic protein (SH), glycoprotein (G), fusion protein (F),
protein M2-1, protein M2-2, and a mutated large polymerase protein
(L); however, those skilled in the art will understand that not all
of these proteins, or genes corresponding thereto, need be included
for an RSV to be infectious.
[0008] Disclosed herein are recombinant RSVs having a mutation in
the codon encoding amino acid residue 1321 of the RSV L protein.
The 1321 codon can be mutated to cause the amino acid corresponding
to the tyrosine at position 1321 of the RSV L protein to be any
naturally occurring amino acid other that asparagine (N). In some
embodiments, the 1321 codon can be mutated to cause the amino acid
corresponding to the tyrosine at position 1321 of the RSV L protein
to be alanine. In some embodiments, the 1321 codon can be mutated
to cause the amino acid corresponding to the tyrosine at position
1321 of the RSV L protein to be aspartic acid. In some embodiments,
the 1321 codon can be mutated to cause the amino acid corresponding
to the tyrosine at position 1321 of the RSV L protein to be
cysteine. In some embodiments, the 1321 codon can be mutated to
cause the amino acid corresponding to the tyrosine at position 1321
of the RSV L protein to be glutamic acid. In some embodiments, the
1321 codon can be mutated to cause the amino acid corresponding to
the tyrosine at position 1321 of the RSV L protein to be glutamine.
In some embodiments, the 1321 codon can be mutated to cause the
amino acid corresponding to the tyrosine at position 1321 of the
RSV L protein to be glycine. In some embodiments, the 1321 codon
can be mutated to cause the amino acid corresponding to the
tyrosine at position 1321 of the RSV L protein to be histidine. In
some embodiments, the 1321 codon can be mutated to cause the amino
acid corresponding to the tyrosine at position 1321 of the RSV L
protein to be isoleucine. In some embodiments, the 1321 codon can
be mutated to cause the amino acid corresponding to the tyrosine at
position 1321 of the RSV L protein to be leucine. In some
embodiments, the 1321 codon can be mutated to cause the amino acid
corresponding to the tyrosine at position 1321 of the RSV L protein
to be lysine. In some embodiments, the 1321 codon can be mutated to
cause the amino acid corresponding to the tyrosine at position 1321
of the RSV L protein to be methionine. In some embodiments, the
1321 codon can be mutated to cause the amino acid corresponding to
the tyrosine at position 1321 of the RSV L protein to be
phenlyalanine. In some embodiments, the 1321 codon can be mutated
to cause the amino acid corresponding to the tyrosine at position
1321 of the RSV L protein to be proline. In some embodiments, the
1321 codon can be mutated to cause the amino acid corresponding to
the tyrosine at position 1321 of the RSV L protein to be serine. In
some embodiments, the 1321 codon can be mutated to cause the amino
acid corresponding to the tyrosine at position 1321 of the RSV L
protein to be threonine. In some embodiments, the 1321 codon can be
mutated to cause the amino acid corresponding to the tyrosine at
position 1321 of the RSV L protein to be tryptophan. In some
embodiments, the 1321 codon can be mutated to cause the amino acid
corresponding to the tyrosine at position 1321 of the RSV L protein
to be tyrosine. In some embodiments, the 1321 codon can be mutated
to cause the amino acid corresponding to the tyrosine at position
1321 of the RSV L protein to be valine. Furthermore, the 1321 codon
can be mutated to cause the amino acid corresponding to the
tyrosine at position 1321 of the RSV L protein to be any
non-naturally occurring amino acid. In addition, it is contemplated
that the disclosed recombinant RSVs having a mutated 1321 codon may
also include additional mutations including, but not limited to,
mutations including cold passage ("cp") mutations, temperature
sensitive ("ts") mutations, and deletion of part or all of one or
more genes. The recombinant RSVs modified at codon 1321 may exhibit
temperature sensitive growth characteristics or attenuated
replication in vivo or in vitro. Additionally the described viruses
may exhibit both temperature sensitive growth characteristics and
attenuated replication in vivo or in vitro. In view of the
degeneracy of the genetic code, it should be understood by those
skilled in the art that the 1321 codon can be mutated at any or all
of the three nucleotide positions making up the codon to encode any
of the substituted amino acid residues described herein.
Furthermore, a strategy whereby more than one such nucleotides of
the codon is altered in order to produce a mutated amino acid
residue at position 1321 of the RSV L protein can be employed in
order to stabilize the mutation and reduce the likelihood that the
altered 1321 codon will revert to its original amino acid
assignment or undergo a further mutation, by natural mutation
processes, to an undesirable amino acid residue. It should also be
noted that many of the codons specifically described herein are
referred to using DNA base pairs as they would appear in a
positive-sense orientation; however, it should be apparent that to
one skilled in the art that corresponding mutations, alterations,
or modifications could be made in an analogous manner for
negative-sense DNA codons, or positive or negative-sense RNA
codons.
[0009] Disclosed herein are recombinant RSVs having a mutation in
the codon encoding amino acid residue 1313 of the RSV L protein.
The 1313 codon can be mutated to cause the amino acid corresponding
to the serine at position 1313 of the RSV L protein to be a serine
residue encoded by a different codon. In some embodiments described
herein, the naturally occurring serine codon may be changed from
AGC to AGT. In some embodiments described herein, the naturally
occurring serine codon may be changed from AGC to TCT. In some
embodiments described herein, the naturally occurring serine codon
may be changed from AGC to TCC. In some embodiments described
herein, the naturally occurring serine codon may be changed from
AGC to TCA. In some embodiments described herein, the naturally
occurring serine codon may be changed from AGC to TCG.
Alternatively, the 1313 codon can be mutated to cause the amino
acid corresponding to the serine at position 1313 of the RSV L
protein to be a different amino acid. For example, in some
embodiments, the 1313 codon is mutated to encode cysteine. In this
instance, the encoded cysteine residue can be encoded by any
corresponding codon (e.g., TGT or TGC). In some embodiments
described herein, the 1313 codon is deleted entirely to produce an
RSV that has, or can encode, an L protein having at least one fewer
amino acid that the wild-type L protein. The recombinant RSVs
modified at codon 1313 may exhibit temperature sensitive growth
characteristics or attenuated replication in vivo or in vitro.
Additionally the described recombinant viruses may exhibit both
temperature sensitive growth characteristics and attenuated
replication in vivo or in vitro. In view of the degeneracy of the
genetic code, it should be understood by those skilled in the art
that the 1313 codon can be mutated at any or all of the three
nucleotide positions making up the codon to encode any of the
substituted amino acid residues described herein. Furthermore, a
strategy whereby more than one such nucleotides of the codon is
altered in order to produce a mutated amino acid residue at
position 1313 of the RSV L protein can be employed in order to
stabilize the mutation and prevent the altered 1313 codon from
reverting or undergoing a further mutation, by natural mutation
processes, to an undesirable amino acid residue. It should also be
noted that many of the codons specifically described herein are
referred to using DNA base pairs as they would appear in a
positive-sense orientation; however, it should be apparent that to
one skilled in the art that corresponding mutations, alterations,
or modifications could be made in an analogous manner for
negative-sense DNA codons, or positive or negative-sense RNA
codons.
[0010] Another RSV mutation described herein occurs at amino acid
residue 649 of the RSV L protein. In some embodiments, the codon
encoding glutamic acid at position 649 of the RSV L protein is
mutated to cause a different amino acid to be encoded at this
position. In some embodiments, the codon is mutated to encode an
amino acid with a charged side chain. In one embodiment, the codon
is mutated to encode aspartic acid at position 649 of the RSV L
protein. Based on this disclosure, those skilled in the art will
readily understand that a mutation at position 649 of the L protein
may be combined with any number of RSV mutant strains in order to
enhance the attenuation or stability of the virus. For example,
E649D may be combined with a mutation at position 1321 of the L
protein, a mutation at position 1313 of the L protein, or may be
used with mutations at both positions 1321 and 1313. In one
embodiment, the mutation E649D may be combined with the mutations
1321K(AAA) and S1313(TCA) to give rise to RSV strain
1321K(AAA)/S1313(TCA)+E649D. As used herein, amino acids are
referred to according to their standard one-letter or three-letter
abbreviations, as is well known in the art: Alanine, Ala, A;
Arginine, Arg, R; Asparagine, Asn, N; Aspartate, Asp, D; Cysteine,
Cys, C; Glutamate, Glu, E; Glutamine, Gln, Q; Glycine, Gly, G;
Histidine, His, H; Isoleucine, Ile, I; Leucine, Leu, L; Lysine, K;
Methionine, Met, M; Phenylalanine, Phe, F; Proline, Pro, P; Serine,
Ser, S; Threonine, Thr, T; Trpytophan, Trp, W; Tyrosine, Tyr, Y;
Valine, Val, V.
[0011] Another attenuating RSV mutation described herein occurs at
amino acid residue 874 of the RSV L protein. Accordingly, provided
in this disclosure are recombinant RSVs having a L protein, a P
protein, a N protein, a M2-1 protein, and a genome or antigenome
with a mutation or a deletion of the codon encoding glutamine at a
position corresponding to position 874 of the L protein. In some
embodiments the genome or antigenome of such RSVs optionally encode
a NS1 protein, a NS2 protein, a G protein, a F protein, M protein
and an SH protein. In some embodiments, the codon encoding
glutamine at position 874 of the RSV L protein is mutated to cause
a different amino acid to be encoded at this position. In some
embodiments, the codon is mutated to encode an amino acid with a
charged side chain. In one embodiment, the codon is mutated to
encode histidine at position 874 of the RSV L protein. Based on
this disclosure, those skilled in the art will readily understand
that a mutation at position 874 of the L protein may be combined
with any number of previously described RSV mutant strains in order
to enhance the attenuation or stability of the virus. For example,
Q874H may be combined with a mutation at position 1321 of the L
protein, a mutation at position 1313 of the L protein, or may be
used with mutations at both positions 1321 and 1313. In one
embodiment, the mutation Q874H may be combined with the mutations
1321K(AAA) and S1313(TCA) to give rise to RSV strain
1321K(AAA)/S1313(TCA)+Q874H.
[0012] Also described herein are recombinant RSVs having a mutated
1313 codon and a mutated 1321 codon. In some embodiments, the 1313
codon is changed to a encode serine using a different codon thereby
making it less likely that a virus also bearing a 1321 mutation
will undergo a serine to cystine mutation at position 1313. In some
embodiments the 1313 codon may be changed from AGC to AGT. In some
embodiments described herein, the naturally occurring serine codon
may be changed from AGC to TCT. In some embodiments described
herein, the naturally occurring serine codon may be changed from
AGC to TCC. In some embodiments described herein, the naturally
occurring serine codon may be changed from AGC to TCA. In some
embodiments described herein, the naturally occurring serine codon
may be changed from AGC to TCG.
[0013] Also provided are isolated infectious respiratory syncytial
virus particles comprising a genome that encodes nonstructural
protein 1 (NS1), nonstructural protein 2 (NS2), nucleocapsid
protein (N), phosphoprotein (P), matrix protein (M), small
hydrophobic protein (SH), glycoprotein (G), fusion protein (F),
protein M2-1, protein M2-2, and large polymerase protein (L) with a
mutation of at least one of the nucleotides of the codon that
encodes amino acid 1321 of the L protein. Mutant virus strains of
this sort may comprise nucleotide sequence alterations that result
in a coding change at amino acid 1321 of the L protein such that
the encoded amino acid is a lysine (K) or a glycine (G). In other
embodiments described herein, one or more of the NS1, NS2, N, P, M,
SH, G, F, M2-1, M2-2 proteins can be altered so as to prevent its
expression. For example, the alteration could include deleting the
gene in whole or in part, altering the gene via the insertion of a
stop codon, removing the gene start sequence for the gene, or any
other of a variety of such strategies known in the art.
[0014] The individual mutations provided herein are capable of
being combined with other mutations, or used in conjunction with
other mutagenesis strategies, to create attenuated viruses. In some
embodiments, the genome, or corresponding antigenome, of the
isolated infectious respiratory syncytial viruses described herein
can be manipulated to encode a heterologous gene. For example, the
heterologous gene could be a corresponding gene from a related
virus, such as parainfluenza virus (PIV), including bovine, mouse,
or human PIV subtypes, or metapneumovirus (MPV), such as human MPV,
or a heterologous strain of RSV, such as from the heterologous B
subgroup, that replaces the gene encoding nonstructural protein 1
(NS1), nonstructural protein 2 (NS2), nucleocapsid protein (N),
phosphoprotein (P), matrix protein (M), small hydrophobic protein
(SH), glycoprotein (G), fusion protein (F), protein M2-1 or protein
M2-2. In addition, a heterologous gene could be added to the
genome, so as not to necessitate the removal of any endogenous RSV
genes. In related embodiments, a heterologous gene can encode an
immunomodulatory protein, such as a cytokine.
[0015] Also provided herein are methods and compositions related to
expressing the disclosed viruses. For example, isolated
polynucleotides that include a nucleic acid sequence encoding the
genome or antigenome of the described viruses are disclosed. Such
polynucleotides can be in the form of a vector, a linear segment of
DNA or RNA, and can be in a positive or negative-sense orientation.
The polynucleotides disclosed herein can be used to produce the
viruses described via cellular expression through either viral or
plasmid-driven expression systems that are known in the art. In one
embodiment, plasmids encoding a viral genome or antigenome may be
expressed in a cell along with other plasmids that express viral
accessory proteins necessary for production of recombinant RSV.
[0016] Methods for producing an immune response to a protein in an
animal are also described herein. Typically, such methods will be
used to produce an immune response in mammals, including, but not
limited to, mice, cotton rats, non-human primates, or humans. In
some aspects, the disclosed recombinant, attenuated viruses can be
administered to an individual in need of protection from infection
by a virus, such as RSV, PIV, or MPV. In this regard, the viruses
disclosed herein can be used as a vaccine. In another embodiment,
the viruses provided herein could also be used to deliver nonviral
proteins (e.g., a cytokine) to a mammal.
[0017] Described herein are methods for enhancing the genetic
stability of, and identifying the genetic basis of phenotypic
reversion of, attenuated virus strains. The provided methods
consist of obtaining or identifying an attenuated, or mutant, virus
strain; culturing the virus in the presence of a selection
condition that is less restrictive to a wild-type strain of the
virus, relative to an attenuated, or mutated, strain; identifying
mutated strains of the attenuated virus that exhibit reduced
attenuation under the restrictive conditions than would an
non-mutated attenuated virus; and assessing the genome of the
mutated strain of the attenuated virus to identify the genetic
basis for the reduced attenuation exhibited by the strain. Upon
identifying the genetic alteration giving rise to reduced
attenuation of the virus, mutations can be made in the genetic
sequence of the attenuated virus strain to prevent the mutation
conferring reduced attenuation from arising. The provided methods
are applicable to any attenuated virus capable of evolving to
become less attenuated due to genetic mutation when cultured under
selective conditions. For exemplary purposes, the method is
described in the context of RSV herein; however, those skilled in
the art will readily understand that it may be applied
generally.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIGS. 1A-1F. Growth of mutant RSVs in vitro at increasing
restrictive temperatures in a "temperature stress test" designed to
assess phenotypic and genetic stability, based on a general method
published in earlier work (McAuliffe, et al., J. Virol. 78:2029-36
(2004). (FIG. 1A) 10 independent aliquots of the virus 1321N(AAT)
RSV were serially passed at increasingly restrictive temperature as
follows: two passages at 35.degree. C.; two at 36.degree. C.; two
at 37.degree. C., for a total of 6 passages (solid lines)). For
each passage, 1 ml (out of a total of 5 ml) of the supernatant was
used to inoculate the next passage. In parallel, two independent
replicas were passaged for 6 passages at 32.degree. C.
(non-restrictive temperature), serving as controls (dotted lines).
For each passage, aliquots were frozen for titration and sequence
analysis. Virus titers of the mutants at the different passage
levels are shown, with the passage temperatures indicated. Virus
titer was determined by plaque assay at the permissive temperature
(32.degree. C.). Passage number 0 represents the input virus. FIGS.
1B, 1C, 1D, 1E, and 1F show results with the following RSV mutants:
1321E(GAA), 1321K(AAA), 1321G(GGT), 1321G(GGA), and 1321P(CCT).
Nomenclature: Note that the viruses are named according to the
amino acid assignment and codon at L protein amino acid position
1321. Specifically, the number 1321 specifies the amino acid
position; the letter to the right of the number (e.g., G in 1321G)
specifies the amino acid assignment using the single letter code,
and its placement to the right of the number indicates it is a
non-wild-type assignment, and the codon for this mutant assignment
is indicated to the right, e.g., (GAA) in 1321G(GAA). All of these
viruses were based on the wild-type (wt) recombiant D46/6120
backbone that is described in the description of FIG. 2.
[0019] FIG. 2. Selected mutations involving L protein amino acid
sequence positions 1313 and 1321 of RSV strain A2, numbered
according to the complete sequence of the wild-type ("wt") human
RSV strain A2 that is represented by Genbank accession number
M74568. All of these viruses were constructed using the recombinant
wt D46/6120 backbone, which differs from the full length
recombinant wt parent by the deletion of 112 nucleotides from the
downstream nontranslated region of the SH gene, and also contains
the introduction of five translationally silent nucleotide changes
into the downstream end of the SH open reading frame (Bukreyev, et
al. J. Virol., 75:12128-12140, 2001). The nucleotide sequence and
amino acid coding assignments for the region of the L gene
encompassing nucleotides 12422-12466 are shown at the top.
Nucleotide numbering is shown at the top, amino acid sequence
position numbers of the L protein are indicated at the bottom. The
wt sequence is shown at the top; assignments in subsequent mutants
that are identical to wt are shown as dots. Amino acid
substitutions relative to wt are highlighted in grey. This Figure
illustrates a series of virus pairs in which the first of each pair
has the wt assignment of S at position 1313, and the second has a
putative compensatory mutation C at position 1313, and both viruses
of the pair have the same assignment at position 1321 that changes
from pair to pair.
[0020] Nomenclature: The viruses in this Figure are named (listed
at the left) according to the amino acid assignment at position
1321 followed by the assignment at 1313. Wild-type assignments have
the single letter amino acid code to the left of the number. Mutant
assignments have the single letter amino acid code to the right of
the number with the codon specified in parentheses. If more than
one mutant codon is acceptable, a codon might not be specified. The
general nomenclature noted here and in FIG. 1 is used throughout
(except where noted) and of necessity is descriptive rather than
rigidly limiting.
[0021] The following SEQ ID NOs. are associated with this figure:
SEQ ID NO: 1 (nucleotides 12422-12466 of wt human RSV A2 strain
(GenBank accession number M74568), SEQ ID NO: 2 (nucleotides
12422-12466 of RSV mutant Y1321/1313C), SEQ ID NO: 3 (nucleotides
12422-12466 of RSV mutant 1321E(GAA)/S1313), SEQ ID NO: 4
(nucleotides 12422-12466 of RSV mutant 1321E(GAA)/1313C), SEQ ID
NO: 5 (nucleotides 12422-12466 of RSV mutant 1321K(AAA)/S1313), SEQ
ID NO: 6 (nucleotides 12422-12466 of RSV mutant 1321K(AAA)/1313C),
SEQ ID NO: 7 (nucleotides 12422-12466 of RSV mutant
1321G(GGA)/S1313), SEQ ID NO: 8 (nucleotides 12422-12466 of RSV
mutant 1321G(GGA)/1313C), SEQ ID NO: 9 (nucleotides 12422-12466 of
RSV mutant 1321G(GGT)/S1313), SEQ ID NO: 10 (nucleotides
12422-12466 of RSV mutant 1321G(GGT)/1313C), SEQ ID NO: 11(amino
acids 1309-1323 of the L protein of wt human RSV A2 strain), SEQ ID
NO: 12 (amino acids 1309-1323 of the L protein of RSV mutant
Y1321/1313C), SEQ ID NO: 13 (amino acids 1309-1323 of the L protein
of RSV mutant 1321E(GAA)/S1313), SEQ ID NO: 14 (amino acids
1309-1323 of the L protein of RSV mutant 1321E(GAA)/1313C), SEQ ID
NO: 15 (amino acids 1309-1323 of the L protein of RSV mutant
1321K(AAA)/S1313), SEQ ID NO: 16 (amino acids 1309-1323 of the L
protein of RSV mutant 1321K(AAA)/1313C), SEQ ID NO: 17 (amino acids
1309-1323 of the L protein of RSV mutant 1321G(GGA)/S1313), SEQ ID
NO: 18 (amino acids 1309-1323 of the L protein of RSV mutant
1321G(GGA)/1313C), SEQ ID NO: 17 (amino acids 1309-1323 of the L
protein of RSV mutant 1321G(GGT)/S1313), SEQ ID NO: 18 (amino acids
1309-1323 of the L protein of RSV mutant 1321G(GGT)/1313C). It
should be noted that SEQ ID NOs. 17 is listed twice, because the
same amino acid sequence is encoded by the polynucleotides for SEQ
ID NOs. 7 and 9. SEQ ID NOs. 18 is listed twice, because the same
amino acid sequence is encoded by the polynucleotides for SEQ ID
NOs. 8 and 10.
[0022] FIGS. 3A and 3B. Stabilization of L protein amino acid
sequence positions 1321 and 1313. FIG. 3A. Sequences of the
relevant portions of the L gene and protein of wt RSV are shown at
the top (nucleotide residues 12428-12463 of SEQ ID NO: 1 and amino
acid residues 1311-1322 of SEQ ID NO: 11), followed by those of a
mutant RSV with an alternative codon and amino acid assignment at
1321, namely K(AAA), and an alternative codon for the wt assignment
at 1313, namely S1313(TCA), designed to confer increased stability
(nucleotide residues 12428-12463 of SEQ ID NO: 19 and amino acid
residues 1311-1322 of SEQ ID NO: 15). These viruses are based on wt
recombinant RSV 6120. FIG. 3B. An abbreviated temperature stress
test was performed for virus 1321K(AAA)/S1313(TCA). Ten replicas
were passaged twice at 37.degree. C., and twice at 38.degree. C.,
for a total of four passages (solid lines). Two replicas were
passaged as "non-stressed" controls at the permissive temperature
of 32.degree. C. for four passages (dotted lines). Virus titers of
the mutants at different passage levels are shown, as detailed
above. The substantial decrease in titer for the independent
parallel cultures of the mutant "stabilized" virus at the
restrictive temperatures (solid lines) compared to the permissive
temperature of 32.degree. C. (dotted lines) indicates that there
was a substantial restriction of growth in all cultures at the
restrictive temperature, consistent with genetic and phenotypic
stability of the attenuated phenotype.
[0023] Nomenclature: note that, when the amino acid assignment
remains wt, but the codon is changed, the amino acid is indicated
to the left and the codon to the right, e.g., S1313(TCA). The
general nomenclature noted here and in FIGS. 1 and 2 is used
throughout (except where noted) and of necessity is descriptive
rather than rigidly limiting.
[0024] FIGS. 4A and 4B. Deletion of L gene codon 1313. FIG. 4A.
Sequences of the relevant portions of the L gene and protein of wt
RSV are shown at the top (SEQ ID NO: 1 and SEQ ID NO: 11), followed
by those of a mutant RSV with deletion of codon 1313 (nucleotide
residues of SEQ ID NO: 20 and amino acid residues of SEQ ID NO:
21). These viruses are based on recombinant wt RSV 6120 described
in the description to FIG. 2. FIG. 4B. An abbreviated temperature
stress test was performed for virus .DELTA.1313. Ten replicate
cultures were passaged twice at 37.degree. C., and twice at
38.degree. C., for a total of four passages (solid lines). Two
replicate cultures were passaged at the permissive temperature of
32.degree. C. for four passages (dotted lines). Virus titers of the
mutants at different passage levels are shown, as detailed above.
The substantial decrease in titer for the independent parallel
cultures of the .DELTA.1313 mutant at restrictive temperatures
(solid lines) compared to the permissive temperature of 32.degree.
C. (dotted lines) indicates that there was a substantial
restriction of growth in all cultures at the restrictive
temperature, consistent with the .DELTA.1313 virus having an
attenuated phenotype at restrictive temperatures, and this
attenuated phenotype having genetic and phenotypic stability.
[0025] Nomenclature: The virus with deletion of codon 1313 is
designated .DELTA.1313 with no reference to position 1321 (which
remains wt). The general nomenclature noted here and in FIGS. 1, 2,
and 3 is used throughout (except where noted) and of necessity is
descriptive rather than rigidly limiting.
[0026] FIG. 5. A depiction of the gene maps of five examples of
attenuated recombinant RSVs bearing the .DELTA.1313 mutation in
combination with various other mutations. Note that some of the
mutations involved are derived from previously described attenuated
mutants such as the rA2cp248/404/1030.DELTA.SH virus that was
previously constructed and one version of which has been evaluated
in clinical studies (Karron et al, JID 191:1093-1104, 2005)(see the
description of FIG. 10 for an explanation). Note that these
mutations use a separate nomenclature: the numbers 404 and 1030
refer to biological clones from the original mutagenesis
experiments and not to sequence positions. The mutation set noted
as "cp" comprises the following 5 amino acid substitutions: V267I
in the N protein, E218A and T523I in the F protein, and C319Y and
H1690Y in the L protein (Whitehead et al J Virol 72:4467-4471,
1998). The "404" mutation involves a nucleotide substitution in an
RNA signal and was as described (Whitehead et al Virology
247:232-239, 1998; Whitehead et al, J Virol 73:871-877, 1999).
Specifically, this involves a T to C substition at the ninth
nucleotide position of the gene-start signal of the M2 gene,
corresponding to nucleotide 7606 in RSV strain A2 (relative to a
positive sense genome). .DELTA.SH refers to deletion of the SH gene
(Bukreyev et al J Virol 71:8973, 1997; Karron et al JID
191:1093-1104, 2005; Whitehead et al J Virol 73:3438-3442, 1999),
and in this case involved nucleotides 4210-4628, and joined the
last nucleotide of the M gene-end signal to the first nucleotide of
the SH-G intergenic region. .DELTA.NS2 refers to deletion of the
NS2 gene, involving deletion of nucleotides 577-1098, joining the
gene-end signal of the NS1 gene to the NS2-N intergenic region. The
cps-3 virus was based on full-length recombinant wt RSV (nucleotide
length 15,223 prior to the SH and 1313 deletions), and the other
viruses were based on recombinant wt 6120. Typical viral titers and
shut off temperatures also are shown: the shut off temperature
(Ts.sub.H) is defined as the lowest restrictive temperature at
which the reduction compared to 32.degree. C. is 100-fold or
greater than that observed for wt RSV at the two temperatures.
[0027] FIG. 6. Temperature stress test of a virus bearing an
alternative amino acid assignment at L protein codon 1321, namely
K(AAA), plus the deletion of codon 1313. Ten replicate cultures
were passaged twice at 34.degree. C., twice at 35.degree. C., and
twice at 36.degree. C., for a total of six passages (solid lines).
Note that 35-36.degree. C. appeared to be restrictive for this
virus (its T.sub.SH is 36.degree. C., FIG. 5 and Table 9). Two
replicate cultures were passaged at the permissive temperature of
32.degree. C. for six passages (dotted lines). Virus titers of the
mutants at different passage levels are shown, as detailed above.
The substantial decrease in titer for the independent parallel
cultures of the mutant virus at the restrictive temperatures (solid
lines) compared to the permissive temperature of 32.degree. C.
(dotted lines) indicates that there was a substantial restriction
of growth in all cultures at 35-36.degree. C., consistent with
genetic and phenotypic stability of the attenuated virus.
[0028] FIG. 7. Temperature stress test of the
.DELTA.NS2/.DELTA.1313 virus, which bears the deletion of the NS2
gene and deletion of codon 1313 in the L gene (see FIG. 5 for a
gene map). A. Ten replicate cultures were passaged twice at each of
the following temperatures: 35.degree. C., 36.degree. C.,
37.degree. C., 38.degree. C., 39.degree. C., and 40.degree. C., for
a total of twelve passages (solid lines). Two replicate cultures
were passaged at the permissive temperature of 32.degree. C. for
twelve passages (dotted lines). Virus titers of the mutants at
different passage levels are shown, as detailed above. B. Sequence
analysis of viral populations following the tenth passage showed
that all of the populations from the restrictive passages contained
an isoleucine-to-threonine substitution at L amino acid sequence
position 1314, as shown. The sequences shown, from top to bottom,
are: amino acids 1311-1315 of SEQ ID NO: 11 and nucleotides
12428-12442 of SEQ ID NO: 1, both of wt RSV; amino acids 1311-1315
of SEQ ID NO: 22 and nucleotides 12428-12442 of SEQ ID NO: 23, both
of .DELTA.NS2/.DELTA.1313 passaged at permissive temperature (i.e.,
not containing the 1314T mutation); amino acids 1311-1315 of SEQ ID
NO: 24 and nucleotides 12428-12442 of SEQ ID NO: 25, both of
.DELTA.NS2/.DELTA.1313/1314T, the mutant that emerged during
passage of .DELTA.NS2/.DELTA.1313 at elevated temperatures.
[0029] FIG. 8. Nucleotide and amino acid sequences of wt RSV and
mutant RSVs illustrating substitutions and deletions that were
introduced at amino acid sequence positions 1313, 1314, 1316, and
1320 of the L protein. The provided sequences show either the wt or
corresponding mutated sequences for nucleotides 12428-12457 or
amino acids 1311-1320 of the RSV L protein. Note that this set of
mutations and deletions was introducted in parallel into two
different backbones: a backbone that otherwise was wt 6120 (shown
in this Figure) and a second 6120-based backbone that contained the
deletion of the NS2 gene.
[0030] FIGS. 9A and 9B. Gene map and temperature stress test of the
.DELTA.NS2/.DELTA.1313/1314L(CTG) virus, which bears the deletion
of the NS2 gene, the deletion of codon 1313 in the L gene, and the
1314L(CTG) substitution in the L gene. FIG. 9A. A depiction of the
gene map of the .DELTA.NS2/.DELTA.1313/1314L(CTG) virus. FIG. 9B.
Temperature stress test. Ten replicate cultures were passaged twice
at each of the following temperatures: 36.degree. C., 37.degree.
C., 38.degree. C., and 39.degree. C., and once at 40.degree. C. for
a total of nine passages (solid lines). Two replicate cultures were
passaged at the permissive temperature of 32.degree. C. for the
same number of passages (dotted lines). Virus titers of the mutants
at different passage levels are shown, as detailed above.
[0031] FIG. 10. A depiction of the gene maps of wt RSV (top line)
and several attenuated derivatives. The virus
rA2cp248/404/1030.DELTA.SH is a vaccine candidate that was designed
by reverse genetics and recovered from cDNA. One version of this
virus, referred to herein as "cp248/404/1030.DELTA.SH version 2,"
is being evaluated in clinical studies (ClinicalTrials.gov
Identifier NCT00767416). The other vaccine candidate viruses that
are shown have changes in specific codons (circled) designed for
increased genetic and phenotypic stability. Note that these viruses
use a separate nomenclature for mutations: the numbers 248, 404,
and 1030 refer to biological clones from the original mutagenesis
experiments and not to sequence positions. The mutations noted as
"cp" (cold passage) comprise the following 5 amino acid
substitutions: V267I in N, E218A and T523I in F, and C319Y and
H1690Y in L (Whitehead et al., J. Virol. 72:4467-4471, 1998). The
"248" and "1030" loci are indicated. The "404" mutation involves a
T to C substition at nucleotide 7606, which involves the gene-start
signal for the M2 gene (Whitehead et al., Virology 247:232-239,
1998; Whitehead et al., J. Virol., 73:871-877, 1999). .DELTA.SH
refers to deletion of the SH gene (Bukreyev et al., J. Virol.,
71:8973, 1997; Karron et al., JID 191:1093-1104, 2005; Whitehead et
al., J. Virol. 73:3438-3442, 1999), which in this case involved
nucleotides 4210-4628, and joined the last nucleotide of the M
gene-end signal to the first nucleotide of the SH-G intergenic
region. Each of these viruses is based on full-length recombinant
wt RSV (nucleotide length 15,223 prior to any deletions). Typical
viral titers and shut off temperatures also are shown: the shut off
temperature (T.sub.SH) is defined as the lowest restrictive
temperature at which the reduction compared to 32.degree. C. is
100-fold or greater than that observed for wt RSV at the two
temperatures.
[0032] Note that another version of the rA2cp248/404/1030.DELTA.SH
cDNA had previously been constructed, and virus was recovered
(Karron et al., JID 191:1093-1104, 2005). This version of the cDNA
and its encoded virus are referred to herein as
"cp248/404/1030.DELTA.SH version 1." This version was previously
evaluated in RSV-naive young infants (Karron et al., JID
191:1093-1104, 2005), and was well-tolerated, moderately
immunogenic, and protective against a second vaccine dose. Both
versions of rA2cp248/404/1030.DELTA.SH contain the cp, 248, 404,
1030, and .DELTA.SH mutations, and no differences have been
identified between the two versions with regard to virus
replication, is and attenuation phenotypes, or other biological
properties. The two versions differ by multiple point mutations
throughout the genome that mostly are silent at the amino acid
level and are considered inconsequential. These include differences
due to naturally occurring variability in wt virus and in some
cases due to the presence or absence of added restriction sites or
sequence tags. As another difference, the "248" mutation (Q831L) is
specified by the codon TTA in cp248/404/10030.DELTA.SH version 2
and CTG in cp248/404/1030.DELTA.SH version 1. In general, the two
versions of rA2cp248/404/1030.DELTA.SH appear to have similar
properties of growth, temperature sensitivity, and attenuation. The
diagram and data shown here represent cp248/404/10030.DELTA.SH
version 2. The derivatives cps-1, cps-4, cps-2, and cps-3 were
derived from cp248/404/10030.DELTA.SH version 2.
[0033] FIG. 11. Schematic representation of various domains in the
RSV L protein and various deletion mutations involving amino acid
residues 1744-1764. The domains have been described elsewhere (Poch
et al EMBO J 8:3867-74, 1989; J Gen Virol 71:1153-62, 1990). Each
mutation is named by the amino acid residue(s) in the L protein
that was deleted. Viruses that involve deletion of 2-4 codons are
named using the L protein amino acid position of the first residue
that is deleted, followed by the A symbol, followed by the specific
continguous residues that were deleted (e.g., 1754.DELTA.SSAM
involves deletion of residues 1754-1757, which have the identities
SSAM). For deletions larger than 4 residues, the number of
contiguous deleted residues is indicated followed by "aa" (e.g.,
1752A13aa involves a deletion of 13 amino acid (aa) residues
beginning with 1752 and ending 1764). SEQ ID NOs are provided for
each listed sequence (SEQ ID NO: 36 represents the wild-type RSV A2
strain sequence for amino acids 1744-1764 of the L protein).
SEQUENCE LISTING
[0034] The Sequence Listing is submitted as an ASCII text file in
the form of the file named "Sequence.txt" (.about.36 kb), which was
created on Jan. 13, 2021, which is incorporated by reference
herein.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Attenuating and Stabilizing Mutations of RSV
[0035] Provided herein are recombinant RSVs suitable for vaccine
use in humans. Attenuated RSVs described herein are produced by
introducing and/or combining specific attenuating mutations into
incompletely attenuated strains of RSV, such as a temperature
sensitive (ts) or cold-passaged (cp) RSV, or into wild-type virus,
e.g. RSV strain A2. As used herein, the term "temperature
sensitive" refers to the property of reduced replication compared
to wild-type virus at temperatures at which the wild-type virus
normally replicates. For example, wild-type RSV replicates
efficiently within the range of 32.degree. C. to 40.degree. C.,
whereas a temperature-sensitive mutant would be restricted in
replication at the higher temperatures within this range, but could
be propagated efficiently at 32.degree. C., which is called the
"permissive temperature." These viruses can be made using
recombinant methods useful in identifying attenuated RSV strains.
Once identified, the attenuating mutations can be introduced into
biologically-derived strains, used to further attenuate or
stabilize existing attenuated RSV strains, or attenuated RSV
strains may be designed de novo.
[0036] The term "wild-type" as used herein refers to a viral
phenotype that is consistent with efficient replication in a
suitable permissive human host, and that may induce disease in a
susceptible human host (for example, an RSV-naive infant). The
prototype A2 strain, represented by Genbank accession number M74568
but not strictly limited to that sequence, is considered to be an
example of a wild-type strain. Derivative viruses that contain
mutations that are presumed to not significantly reduce replication
or disease in vivo also have the "wild-type" phenotype. In
contrast, viral derivatives that exhibit reductions in replication
of approximatelyl0-fold, 100-fold, or more in vivo may be
considered to be "restricted". Generally, restricted replication in
vivo in a susceptible host is associated with reduced disease, or
"attenuation." Thus, infection of a susceptible host with an
"attenuated" virus results in reduced disease in that host, as
compared to a wild-type strain.
[0037] The term "stable" in the context of virus stability refers
to the decreased likelihood that a genetic change will occur in the
genome of a virus that results in a change to the phenotype of the
virus. As described herein, a virus with increased stability can be
produced by altering one or more polynucleotide residues of the
viral genome, which may or may not result in an amino acid change
for an encoded protein, to reduce the likelihood of the virus
undergoing a genetic change that may alter the phenotype of the
virus.
[0038] Recombinant infectious respiratory syncytial viruses having
a large polymerase protein, phosphoprotein, nucleocapsid protein
and a M2-1 protein and a genome or antigenome having a mutation in
the codon that encodes the tyrosine at position 1321, or a
corresponding position, of the L protein that causes an amino acid
other than tyrosine or asparagine to be encoded at position 1321,
or a corresponding position, of the L protein are described herein.
These viruses may optionally include a nonstructural protein 1, a
nonstructural protein 2, a glycoprotein, a fusion protein, matrix
protein, M2-2 protein, and a small hydrophobic protein.
Accordingly, the corresponding virus genome or antigenome may
optionally include these proteins either individually or in
combination with one another. In some embodiments the viruses
disclosed herein are attenuated. Given that a variety of RSV
strains exist (e.g., RSV A2, RSV B, RSV Long), those skilled in the
art will appreciate that certain strains of RSV may have nucleotide
or amino acid insertions or deletions that alter the position of a
given residue, relative to the numbering used this disclosure,
which is based on the sequence of the biologically derived
wild-type RSV A2 strain (GenBank accession number M74568). For
example, if the L protein of a heterologous RSV strain had, in
comparison with strain A2, two additional amino acids in the
upstream end of the L protein, this would cause the amino acid
numbering of downstream residues relative to strain A2 to increase
by an increment of two. However, because these strains share a
large degree of sequence identity, those skilled in the art would
be able to determine the location of corresponding sequences by
simply aligning the nucleotide or amino acid sequence of the A2
reference strain with that of the strain in question. Therefore, it
should be understood that the amino acid and nucleotide positions
described herein, though specifically enumerated in the context of
this disclosure, can correspond to other positions when a sequence
shift has occurred or due to sequence variation between virus
strains. In the comparison of a protein, or protein segment, or
gene, or genome, or genome segment between two or more related
viruses, a "corresponding" amino acid or nucleotide residue is one
that is thought to be exactly or approximately equivalent in
function in the different species.
[0039] The recombinant infectious respiratory syncytial virus
disclosed herein can have a variety of mutations at position 1321,
or a position corresponding thereto, such that the codon encoding
this residue is modified to encode a different amino acid. In some
embodiments, the tyrosine residue found at position 1321 will be
substituted with a different amino acid, such as glutamic acid,
lysine, glycine, proline, threonine, cysteine, glutamine, valine,
or alanine. In one embodiment, the recombinant infectious
respiratory syncytial viruses described can be mutated at the codon
associated with position 1321 of the L protein to have a codon
sequence of GAA to encode glutamic acid. In one embodiment, the
recombinant infectious respiratory syncytial viruses described can
be mutated at the codon associated with position 1321 of the L
protein to have a codon sequence of GAG to encode glutamic acid. In
one embodiment, the recombinant infectious respiratory syncytial
viruses described can be mutated at the codon associated with
position 1321 of the L protein to have a codon sequence of AAA to
encode lysine. In one embodiment, the recombinant infectious
respiratory syncytial viruses described can be mutated at the codon
associated with position 1321 of the L protein to have a codon
sequence of GGA to encode glycine. In one embodiment, the
recombinant infectious respiratory syncytial viruses described can
be mutated at the codon associated with position 1321 of the L
protein to have a codon sequence of GGC to encode glycine. In one
embodiment, the recombinant infectious respiratory syncytial
viruses described can be mutated at the codon associated with
position 1321 of the L protein to have a codon sequence of GGT to
encode glycine. In one embodiment, the recombinant infectious
respiratory syncytial viruses described can be mutated at the codon
associated with position 1321 of the L protein to have a codon
sequence of CCT to encode proline. The specific codon combinations
recited herein are provided to exemplify certain aspects of the
invention; however, those skilled in the art will understand that,
due to the degenerate nature of the genetic code, a number of
codons may be used to encode the amino acids described herein. In
some embodiments, the codons described herein may be mutated by
making one nucleotide change in a codon. In other embodiments, the
codons described herein may be mutated by making two nucleotide
changes in a codon. In still another embodiment, the codons
described herein may be mutated by making three nucleotide changes
in a codon. Furthermore, based on this disclosure, those skilled in
the art will readily understand that a mutation at position 1321
may be combined with any number of previously described RSV mutant
strains in order to enhance the attenuation or stability of the
virus. In addition, a mutation at position 1321 may be combined
with any number of previously described individual RSV mutations or
deletions to produce a new, attenuated virus. For example a
mutation at position 1321 of the L protein may also be combined
with other RSV mutations such as deletion of the NS2 gene
(.DELTA.NS2); cp mutations such as V267I in the N protein, E218A
and T523I in the F protein, and C319Y and H1690Y in the L protein;
mutation of residue 831 in the L protein, such as Q831L; and
deletion of the SH gene (.DELTA.SH).
[0040] Also provided herein are RSVs that have a mutation in the
codon encoding serine at position 1313, or a corresponding
position, of the L protein, such that a different serine codon is
present. For example, rather than serine 1313 being encoded by the
codon AGC, a different codon, such as TCA, could be used to encode
serine. A mutation of this sort could serve to stabilize the codon
from spontaneous mutation. Because RSV polymerase is error prone to
some degree, undesirable mutations can arise. In some instances it
is desirable to decrease the likelihood of this possibility by
modifying a codon such that it is less amenable to certain
mutations. As will be described herein, the serine codon TCA is
less likely than AGC to be mutated to the codon TGC, which encodes
cysteine, because only one nucleotide alteration (A to T) needs to
occur when the AGC codon is present. Thus, the TCA codon decreases
the likelihood of this mutation arising. In some embodiments, the
codons described herein may be mutated by making one nucleotide
change in a codon, such as the codon encoding serine at position
1313 of the L protein. In other embodiments, the codons described
herein may be mutated by making two nucleotide changes in a codon,
such as the codon encoding serine at position 1313 of the L
protein. In still another embodiment, the codons described herein
may be mutated by making three nucleotide changes in a codon, such
as the codon encoding serine at position 1313 of the L protein.
These strategies can apply more broadly to the mutations described
herein and should not be considered to be limited to the
embodiments described in this paragraph. Furthermore, based on this
disclosure, those skilled in the art will readily understand that a
mutation at position 1313 may be combined with any number of
previously described RSV mutant strains in order to enhance the
attenuation or stability of the virus. In addition, a mutation at
position 1313 may be combined with any number of previously
described individual RSV mutations or deletions to produce a new,
attenuated virus.
[0041] In some aspects described herein, the amino acid residue at
position 1313 of the RSV L protein, or a corresponding position,
may be deleted (.DELTA.1313) by eliminating the three nucleotides
making up the codon that encodes the amino acid. In some
embodiments, recombinant RSVs having a deletion at position 1313
will exhibit desirable characteristics such as increased
attenuation or a decreased likelihood of reverting to a less
attenuated state. Recombinant RSVs having the .DELTA.1313 deletion
exibited a temperature-sensitive attenuation phenotype that is
genetically stable. In another embodiment, presence of the
.DELTA.1313 deletion in a recombinant RSV does not reduce virus
replication at a permissive temperature, which is important for
vaccine manufacture. As described herein, these attributes
associated with the .DELTA.1313 mutation were unexpected because
deletion mutants involving one or a few codons typically are
nonviable or reduce replication so as to be unacceptable for
vaccine manufacture. This particular .DELTA.1313 deletion mutation
was particularly unexpected since, as described herein, a previous
mutation involving this position had the opposite effect of
reducing temperature sensitivy and attenuation in an attenuated
background. This mutation can be used individually to create a
recombinant RSV. In other embodiments, the .DELTA.1313 mutation may
be used in combination with other mutations or deletions to create
a recombinant RSV.
[0042] As described herein, RSV may have an L protein mutated at
positions 1313 and 1321. In some embodiments such viruses may be
RSV 1321K/S1313(TCA), RSV 1321E/S1313(TCA), RSV 1321P/S1313(TCA),
or RSV 1321G/S1313(TCA). In some embodiements the lysine residue in
RSV 1321K/S1313(TCA) is encoded by the nucleotides AAA to produce
RSV 1321K(AAA)/S1313(TCA). In some embodiements the glycine residue
in RSV 1321G/S1313(TCA) is encodied by the nucleotides GGA to
produce RSV 1321G(GGA)/S1313(TCA). In some embodiments, residue
1313 will be mutated to be encoded by a codon having the sequence
TCA, which may be combined with any of the mutations at position
1321 described herein. In other embodiments, residue 1313 is
mutated to be encoded by a sequence other than TCA. The mutations
at positions 1313 and 1321 of the L protein may also be combined
with other RSV mutations such as deletion of the NS2 gene
(.DELTA.NS2); cp mutations such as V267I in the N protein, E218A
and T523I in the F protein, and C319Y and H1690Y in the L protein;
mutation of residue 831 in the L protein, such as Q831L; and
deletion of the SH gene (.DELTA.SH). In one embodiment these
mutations may be combined to produce RSV
.DELTA.NS2/1321K(AAA)/S1313(TCA). In another embodiment these
mutations may be combined to produce RSV
.DELTA.NS2/1321K(AAA)/S1313(TCA)/cp/.DELTA.SH. In one embodiment
these mutations may be combined to produce RSV
1321K(AAA)/.DELTA.1313. In another embodiment these mutations may
be combined to produce RSV 1321K(AAA)/.DELTA.1313/cp/.DELTA.SH. In
another embodiment these mutations may be combined to produce RSV
1321K(AAA)/S1313(TCA)/831L(TTG).
[0043] Also described are recombinant infectious RSVs with an L
protein, a P protein, an N protein, an M2-1 protein, and a genome
or antigenome having a deletion of the codon that encodes the
serine at position 1313 (A 1313), or a corresponding position, of
the L protein. In addition, the described RSV may have a NS1
protein, a NS2 protein, a M2-2 protein, a G protein, a F protein, M
protein and a SH protein. In some embodiments described herein, RSV
may be mutated at residue 1321 of the L protein and also have a
deletion of residue 1313 of the L protein. In one embodiment, such
a virus is RSV Y1321/.DELTA.1313. Another such virus could be RSV
1321K/.DELTA.1313, for example, RSV 1321K(AAA)/.DELTA.1313. In
another embodiment, residue 1313 could be deleted to form RSV
1321G/.DELTA.1313, for example, RSV 1321G(GGT)/.DELTA.1313. In
another embodiment, residue 1313 could be deleted to form RSV
1321P/.DELTA.1313. And in still another embodiment, residue 1313
could be deleted to form RSV 1321E/.DELTA.1313. The mutation of the
RSV L protein at position 1313 can also be combined with other RSV
mutations to yield a recombinant RSV that has increased attenuation
or a decreased likelihood of reverting to a less attenuated state.
For example, the 1313 mutation may also be combined with other RSV
mutations such as deletion of the NS2 gene (.DELTA.NS2); cp
mutations such as V267I in the N protein, E218A and T523I in the F
protein, and C319Y and H1690Y in the L protein; mutation of residue
831 in the L protein, such as Q831L; and deletion of the SH gene
(.DELTA.SH). One such embodiment is a cpRSV that has the gene
encoding its SH protein deleted and also has residue 1313 of the L
protein deleted (cp/.DELTA.SH/.DELTA.1313). In another embodiment
the .DELTA.1313 mutation is combined with only the
previously-described "404" mutation in the gene-start signal of the
M2 gene (Whitehead et al, J. Virol. 247:232-239, 1998) to form a
mutant virus (404/.DELTA.1313). Similar such combinations, such as
RSV .DELTA.NS2/.DELTA.1313, are also described herein. Furthermore,
based on this disclosure, those skilled in the art will readily
understand that the .DELTA.1313 mutation may be combined with any
number of previously described RSV mutant strains in order to
enhance the attenuation or stability of the virus.
[0044] Described herein are also recombinant RSVs having a L
protein, a P protein, a N protein, a M2-1 protein, and a genome or
antigenome having a mutation or a deletion of at least one codon
encoding an amino acid among residues 1744-1764 of the L protein.
In some embodiments the genome or antigenome of such RSVs
optionally encode a NS1 protein, a NS2 protein, a M2-2 protein, a G
protein, a F protein, M protein and a SH protein. In some
embodiments, only one residue in the 1744-1764 span of the L
protein will be mutated or deleted; however, in other embodiments
several or all of these residues will be mutated or deleted. Some
particular RSVs exemplified herein are RSV 1754AS, RSV 1756AA, RSV
1753.DELTA.KS, RSV 1754.DELTA.SS, RSV 1755.DELTA.SA, RSV
1753.DELTA.KSSA, RSV 1754.DELTA.SSAM, RSV 1752.DELTA.6aa, RSV
1749.DELTA.9aa, RSV 1744.DELTA.13aa, RSV 1744.DELTA.14aa, and RSV
1744.DELTA.21aa. Furthermore, based on this disclosure, those
skilled in the art will readily understand that a mutation among
residues 1744-1764 of the L protein may be combined with any number
of previously described RSV mutant strains in order to enhance the
attenuation or stability of the virus. In addition, a mutation
among residues 1744-1764 of the L protein may be combined with any
number of previously described individual RSV mutations or
deletions to produce a new, attenuated virus. For example, a
mutation among residues 1744-1764 of the L protein may also be
combined with other RSV mutations such as deletion of the NS2 gene
(.DELTA.NS2); cp mutations such as V267I in the N protein, E218A
and T523I in the F protein, and C319Y and H1690Y in the L protein;
mutation of residue 831 in the L protein, such as Q831L; and
deletion of the SH gene (.DELTA.SH).
[0045] Provided herein are recombinant RSVs having a L protein, a P
protein, a N protein, a M2-1 protein, and a genome or antigenome
with a mutation or a deletion of the codon encoding the isoleucine
amino acid residue corresponding to position 1314 of the L protein.
In some embodiments, mutation of amino acid residue 1314 of the RSV
L protein increases the stability of additional mutations in
recombinant RSVs, which include, but are not limited to, mutations
at codons 1313 and 1321 of the L protein. Accordinly, described
herein are rembinant RSVs that include a mutation and position 1313
and 1314. In some embodiments, the mutation at position 1313 is a
deletion, while the mutation at position 1314 is an amino acid
change. In some embodiments, the mutation at position 1313 is a
deletion, while the mutation at position 1314 is an amino acid
change from isoleucine to leucine. In some embodiments, the
mutation at position 1313 is a deletion, while the mutation at
position 1314 is an amino acid change from isoleucine to leucine in
which leucine is encoded by the codon "CTG". In some embodiments
the genome or antigenome of such RSVs optionally encodes an NS1
protein, NS2 protein, M2-2 protein, G protein, F protein, M protein
and an SH protein. In some embodiments, the codon encoding amino
acid residue 1314 of the RSV L protein will be modified to cause an
amino acid other than isoleucine to be encoded at position 1314.
For example, the codon encoding isoleucine may be mutated to encode
leucine. In one such embodiment, the leucine residue substituted at
position 1314 is encoded by the codon "CTG". In some embodiments,
the codon encoding isoleucine at position 1314 of the RSV L protein
is deleted, so that no amino acid is encoded at position 1314 and
the position is occupied by the amino acid residue that would
otherwise occur at position 1315. In some embodiments, an RSV
having a deletion of amino acid 1314 of the wt L protein (41314)
may have a lower T.sub.SH than its parental RSV strain. In
addition, a virus with this deletion may exhibit significant
attenuation, relative to its parent strain. In addition, this virus
may have a genetic resistance to phenotypic reversion, and, thus be
considered a desirable vaccine candidate as is, or may be combined
with other mutations to give rise to a new virus strain. In some
embodiments, an RSV having a mutation of amino acid 1314 of the wt
L protein (e.g., 1314L) may have a lower T.sub.SH than its parental
RSV strain. In some embodiments, the 1314L mutation is encoded by a
codon having the nucleotide sequence "CTG". In addition, a virus
with this mutation may exhibit significant attenuation, relative to
its parent strain. In addition, this virus may have, or confer, a
genetic resistance to phenotypic reversion, and, thus be considered
a desirable vaccine candidate as is, or may be combined with other
mutations to give rise to a new virus strain. Furthermore, based on
this disclosure, those skilled in the art will readily understand
that a mutation at position 1314 of the RSV L protein may be
combined with any number of previously described RSV mutant strains
in order to enhance the attenuation or stability of the virus. In
addition, a mutation at position 1314 of the RSV L protein may be
combined with any number of previously described individual RSV
mutations or deletions to produce a new, attenuated virus. For
example, this mutation may be combined with an existing attenuated
virus to form RSV .DELTA.NS2/.DELTA.1313/1314L(CTG), RSV
.DELTA.1313/1314L(CTG), or RSV .DELTA.NS2/.DELTA.1314.
[0046] Provided herein are recombinant RSVs having a L protein, a P
protein, a N protein, a M2-1 protein, and a genome or antigenome
with a mutation or a deletion of the codon encoding the isoleucine
amino acid residue corresponding to position 1316 of the L protein.
In some embodiments the genome or antigenome of such RSVs
optionally encode a NS1 protein, a NS2 protein, a M2-2 protein, a G
protein, a F protein, M protein and a SH protein. In some
embodiments, the codon encoding isoleucine at position 1316 of the
RSV L protein is deleted, so that no amino acid is encoded and the
position is occupied by the amino acid residue that would otherwise
occur at position 1317. In addition, a virus with this mutation may
exhibit significant attenuation, relative to its parent strain and
may have, or confer, genetic resistance to phenotypic reversion,
and, thus be considered a desirable vaccine candidate as is, or may
be combined with other mutations to give rise to a new virus
strain. For example, a mutation at position 1316 of the L protein
may also be combined with other RSV mutations such as deletion of
the NS2 gene (.DELTA.NS2); cp mutations such as V267I in the N
protein, E218A and T523I in the F protein, and C319Y and H1690Y in
the L protein; mutation of residue 831 in the L protein, such as
Q831L; and deletion of the SH gene (.DELTA.SH). In one embodiment
this mutation may be combined with an existing attenuated virus to
form RSV .DELTA.NS2/.DELTA.1316.
[0047] Another attenuating RSV mutation described herein occurs at
amino acid residue 649 of the RSV L protein. Accordingly, provided
in this disclosure are recombinant RSVs having a L protein, a P
protein, a N protein, a M2-1 protein, and a genome or antigenome
with a mutation or a deletion of the codon encoding glutamic acid
at a position corresponding to position 649 of the L protein. In
some embodiments the genome or antigenome of such RSVs optionally
encode a NS1 protein, a NS2 protein, a M2-2 protein, a G protein, a
F protein, M protein and a SH protein. In some embodiments, the
codon encoding glutamic acid at position 649 of the RSV L protein
is mutated to cause a different amino acid to be encoded at this
position. In some embodiments, the codon is mutated to encode an
amino acid with a charged side chain. In one embodiment, the codon
is mutated to encode aspartic acid at position 649 of the RSV L
protein. Based on this disclosure, those skilled in the art will
readily understand that a mutation at position 649 of the L protein
may be combined with any number of previously described RSV mutant
strains in order to enhance the attenuation or stability of the
virus, or may be combined with previously characterized individual
RSV mutations or deletions to produce a new virus. For example, a
mutation at position 649 of the L protein may also be combined with
other RSV mutations such as deletion of the NS2 gene (.DELTA.NS2);
cp mutations such as V267I in the N protein, E218A and T523I in the
F protein, and C319Y and H1690Y in the L protein; mutation of
residue 831 in the L protein, such as Q831L; and deletion of the SH
gene (.DELTA.SH). For example, E649D may be combined with a
mutation at position 1321 of the L protein, a mutation at position
1313 of the L protein, or may be used with mutations at both
positions 1321 and 1313. In one embodiment, the mutation E649D may
be combined with the mutations 1321K(AAA) and S1313(TCA) to give
rise to RSV strain 1321K(AAA)/S1313(TCA)+E649D.
[0048] Another attenuating RSV mutation described herein occurs at
amino acid residue 874 of the RSV L protein. Accordingly, provided
in this disclosure are recombinant RSVs having an L protein, a P
protein, an N protein, a M2-1 protein, and a genome or antigenome
with a mutation or a deletion of the codon encoding glutamine at a
position corresponding to position 874 of the L protein. In some
embodiments the genome or antigenome of such RSVs optionally encode
a NS1 protein, a NS2 protein, a M2-2 protein, a G protein, an F
protein, M protein and a SH protein. In some embodiments, the codon
encoding glutamine at position 874 of the RSV L protein is mutated
to cause a different amino acid to be encoded at this position. In
some embodiments, the codon is mutated to encode an amino acid with
a charged side chain. In one embodiment, the codon is mutated to
encode histidine at position 874 of the RSV L protein. Based on
this disclosure, those skilled in the art will readily understand
that a mutation at position 874 of the L protein may be combined
with any number of previously described RSV mutant strains in order
to enhance the attenuation or stability of the virus, or may be
combined with previously characterized individual RSV mutations or
deletions to produce a new virus. For example, a mutation at
position 874 of the L protein may also be combined with other RSV
mutations such as deletion of the NS2 gene (.DELTA.NS2); cp
mutations such as V267I in the N protein, E218A and T523I in the F
protein, and C319Y and H1690Y in the L protein; mutation of residue
831 in the L protein, such as Q831L; and deletion of the SH gene
(.DELTA.SH). Furthermore, Q874H may be combined with a mutation at
position 1321 of the L protein, a mutation at position 1313 of the
L protein, or may be used with mutations at both positions 1321 and
1313. In one embodiment, the mutation Q874H may be combined with
the mutations 1321K(AAA) and S1313(TCA) to give rise to RSV strain
1321K(AAA)/S1313(TCA)+Q874H.
[0049] With regard to sequence numbering of nucleotide and amino
acid sequence positions for the described viruses, a convention was
used whereby each nucleotide or amino acid residue in a given viral
sequence retained the sequence position number that it has in the
original 15,222-nucleotide biological wt strain A2 virus (Genbank
accession number M74568), irrespective of any modifications. Thus,
although a number of genomes contain deletions and/or insertions
that cause changes in nucleotide length, and in some cases amino
acid length, the numbering of all of the other residues (nucleotide
or amino acid) in the genome and encoded proteins remains
unchanged. It also is recognized that, even without the expedient
of this convention, one skilled in the art can readily identify
corresponding sequence positions between viral genomes or proteins
that might differ in length, guided by sequence alignments as well
as the positions of open reading frames, well-known RNA features
such as gene-start and gene-end signals, and amino acid sequence
features.
[0050] The full-length recombinant RSV wt backbone was described
previously (Collins et al PNAS 92:11563-11567), and it is well
recognized that the viral genome can readily accommodate numerous
incidental modifications such as the insertion of restriction
enzyme cleavage sites or point mutations due to naturally occurring
sequence variation (Collins et al PNAS 92:11563-11567; Whitehead et
al J Virol 72:4467-4471). In many cases, the recombinant wt RSV
that was used is a version called D46/D6120 (or 6120) that differs
from the full length recombinant wt parent by the deletion of 112
nucleotides from the downstream nontranslated region of the SH
gene, and also contains the introduction of five translationally
silent nucleotide changes into the downstream end of the SH open
reading frame (Bukreyev et al J Virol 75:12128-12140, 2001). This
deletion and these silent [at the amino acid level] changes were
made to stabilize the cDNA during propagation in bacteria.
Importantly, they did not detectably affect in the viral phenotype
in cell culture or in mice, and thus the 6120 virus is considered
to be a wt virus.
Recombinant RSV mutants
[0051] A number of attenuated RSV strains as candidate vaccines for
intranasal administration have been developed using multiple rounds
of chemical mutagenesis to introduce multiple mutations into a
virus which had already been attenuated during cold-passage (e.g.,
Connors et al., Virology 208: 478-484 (1995); Crowe et al., Vaccine
12: 691-699 (1994); and Crowe et al., Vaccine 12: 783-790 (1994)).
Evaluation in rodents, chimpanzees, adults and infants indicate
that certain of these candidate vaccine strains are relatively
stable genetically, are highly immunogenic, and may be
satisfactorily attenuated. However, further studies indicated that
genetic instability can occur and can be substantial (Karron et al,
JID 191:1093-1104; Lin et al Virus Research 115:9-15, 2006).
Nucleotide sequence analysis of some of these attenuated viruses
identified nucleotide and amino acid changes, and the introduction
of these changes individually and in combination into wild type
recombinant virus identified a number of attenuating mutations. The
identification of attenuating mutations also made it possible to
monitor the stability of specific mutations in vaccine candidates.
The present disclosure provides means of increasing the stability
of attenuating mutations and phenotypes. Consistent with this
understanding, disclosed herein are additional mutations at both
the nucleotide and amino acid levels that also produce attenuated
viruses but have increased stability. The mutations identified
herein can thus be introduced as desired, singly or in combination,
to calibrate a vaccine virus to an appropriate level of
attenuation, immunogenicity, genetic resistance to reversion from
an attenuated phenotype, etc., as desired. In some embodiments, the
described mutations may be used to modify a wildtype strain of RSV
to create a new vaccine virus. In other embodiments, the described
mutations may be used to modify a previously attenuated strain of
RSV to create a new vaccine virus by augmenting an existing vaccine
stain of RSV.
[0052] In some embodiments the mutated RSVs described herein may be
temperature sensitive (ts), such that viral replication is reduced,
relative to wild-type RSV (or other RSV), at increased
temperatures. The level of temperature sensitivity of replication
in an exemplary attenuated RSV of the invention is determined by
comparing its replication at a permissive temperature with that at
several restrictive temperatures. The lowest temperature at which
the replication of the virus is reduced 100-fold or more in
comparison with its replication at the permissive temperature is
termed the shutoff temperature. In experimental animals and humans,
both the replication and virulence of RSV correlate with the
mutant's shutoff temperature. Replication of mutants with a shutoff
temperature of 39.degree. C. is moderately restricted, whereas
mutants with a shutoff of 38.degree. C. replicate less well and
symptoms of illness are mainly restricted to the upper respiratory
tract. A virus with a shutoff temperature of 35 to 37.degree. C.
will typically be fully attenuated in humans. Thus, the attenuated
RSV of the invention which is ts will have a shutoff temperature in
the range of about 35 to 39.degree. C., and preferably from 35 to
38.degree. C. The addition of a ts mutation to a partially
attenuated strain produces multiply attenuated virus and may be
useful in the production of a vaccine. Accordingly, the amino acid
mutations and deletions described herein may be incorporated into
an exiting RSV strain known to be temperature sensitive in order to
produce a new virus strain that is further attenuated or less
likely to revert to a less attenuated form.
[0053] In addition to RSVs having the particular mutations, and the
combinations of those mutations, described herein, the disclosed
viruses may be modified further as would be appreciated by those
skilled in the art. For example, the described RSVs may have one or
more of its proteins deleted. For example, any of the NS1, NS2, SH,
G, or M2-2 proteins could be mutated or deleted. Alternatively, a
heterologous gene from a different organism could be added to the
genome or antigenome so that the described RSV expressed or
incorporated that protein upon infecting a cell and replicating.
Furthermore, those skilled in the art will appreciate that
previously defined mutations known to have an effect on RSV may be
combined with one or more of any of the mutations described herein
to produce an RSV with desirable attenuation or stability
characteristics.
[0054] The specific mutations which have been introduced into RSV
are identified by sequence analysis and comparison to the parental
background, e.g., a cpRSV derivative or wt background. In one
embodiment, the rA2cp248/404/1030.DELTA.SH virus could be
recombinantly modified to have an N.fwdarw.G amino acid change at
residue 1321 of the L protein. In one embodiment, the
rA2cp248/404/1030.DELTA.SH virus could be recombinantly modified to
have a N.fwdarw.E amino acid change at residue 1321 of the L
protein. In another embodiment, the rA2cp248/404/1030.DELTA.SH
virus could be recombinantly modified to have a N.fwdarw.P amino
acid change at residue 1321 of the L protein. And in yet another
embodiment, the rA2cp248/404/1030.DELTA.SH virus could be
recombinantly modified to have a N.fwdarw.K amino acid change at
residue 1321 of the L protein. In one such embodiment, a change of
this nature could be produced by altering the nucleic acid sequence
of the L protein such that the codon encoding the amino acid at
residue 1321 is GGT (encoding glycine) rather than AAT (encoding
asparagine). In another embodiment, amino acid residue 1313 of the
L protein could be changed to a lysine, such as by introduction of
the codon AAA. In yet another embodiment, the genome or antigenome
of the rA2cp248/404/1030.DELTA.SH virus could be altered to have a
mutation at amino acid residue 1313 of the L protein. For example,
residue 1313, which is a serine in the wt sequence, could be
changed to a cysteine. Alternatively, in another embodiment, the
codon encoding S1313 in the wt RSV genome could be deleted
completely; producing an amino acid deletion mutant RSV. As
exemplified herein, mutations of this sort have phenotypic
characteristics consistent with that of an attenuated virus;
therefore, it may be desirable to use them singly, or,
alternatively, in combination with other mutations known to confer
an attenuated phenotype. For example, the RSV strain
rA2cp248/404/1030.DELTA.SH, or another existing attenuated RSV
strain, could be modified using a combination of the individual
mutations and deletions described at positions 1321 and 1313 of the
L protein. The provided description of these new mutations and
their use in making recombinant alterations of existing attenuated
RSV strains would render such combinations apparent to those of
skill in the art.
[0055] In some embodiments, the mutations described herein, when
used either alone or in combination with another mutation, can
provide for different levels of virus attenuation, providing the
ability to adjust the balance between attenuation and
immunogenicity, and can provide a more stable genotype than that of
the parental virus. In one such embodiment, an RSV having a
deletion of amino acid 1313 of the wt L protein (.DELTA.1313) may
have a lower T.sub.SH than its parental RSV strain. In addition, a
virus with this mutation may exhibit significant attenuation,
relative to its parent strain. In addition, this virus may have a
genetic resistance to phenotypic reversion, and, thus be considered
a desirable vaccine candidate as is, or may be combined with other
mutations to give rise to a new virus strain. In this regard there
are numerous attenuating mutations known, either in combination or
individually, to exist for RSV, such as (i) those characterized for
cptsRSV 248, cptsRSV 530, cptsRSV 248/404, cptsRSV 530/1009,
cpts248/955, cpts530/1030, or (ii) deletion of part or all of the
NS1, NS2, SH, or G genes or the M2-2 open reading frame, or (iii)
replacement of human RSV genes with those from relative related
animal-specific paramyxovirus such as bovine RSV to introduce host
range restriction, or (iv) attenuation introduced by rearranging or
adding genes in the RSV genome, as well as other means of
attenuation disclosed herein, see for example: Crowe J E et al.,
Vaccine, 1994 June; 12(8):691-9; Crowe J E et al., Vaccine, 1994
July; 12(9):783-90; Hsu K H, Vaccine, 1995 April; 13(5):509-15;
Connors M, et al., Virology, 1995 Apr. 20; 208(2):478-84; Crowe J E
et al., Virus Genes, 1996; 13(3):269-73; Firestone C Y, et al.,
Virology, 1996 Nov. 15; 225(2):419-22; Juhasz K, et al., J. Virol.,
1997 August; 71(8):5814-9; Whitehead S S, et al., J. Virol. 1999
Feburary; 73(2):871-7; Bukreyev A, et al., J Virol. 1997 December;
71(12):8973-82; Whitehead S S, et al., J Virol. 1998 May;
72(5):4467-71; Whitehead S S, et al., Virology. 1998 Aug.1;
247(2):232-9; Bukreyev A, et al., Proc Natl Acad Sci USA. 1999 Mar.
2; 96(5):2367-72; Whitehead S S, et al., J Virol. 1999 April;
73(4):3438-42; Juhasz K, et al., Vaccine. 1999 Mar. 17;
17(11-12):1416-24; Whitehead S S, et al., J Virol. 1999 December;
73(12):9773-80; Buchholz U J, et al., J Virol. 2000 February;
74(3):1187-99; Teng M N, J Virol. 2000 October; 74(19):9317-21;
Krempl C, et a., J Virol. 2002 December; 76(23):11931-42; and Teng
M N, et al.,Virology. 2001 Oct. 25; 289(2):283-96.
[0056] Thus, in addition to, or in combination with, attenuating
mutations adopted from biologically derived RSV mutants, the
present invention also provides entirely new methods for
identifying novel sites in the RSV genome that are commonly mutated
to allow for reversion of an attenuated virus strain. In accordance
with this aspect of the invention, those skilled in the art will
appreciate that attenuated RSV, or other paramyxovirus, strains can
now be assessed as described herein to identify amino acid changes
that allow attenuated strains to revert, or evolve to have
decreased attenuation. Once identified, these amino acid residues
can be themselves altered, or deleted, to provide for creation of a
more stable attenuated virus.
[0057] Accordingly, provided herein are methods for enhancing the
genetic stability of, and identifying the genetic basis of
phenotypic reversion of, attenuated virus strains. The provided
methods consist of obtaining or identifying an attenuated, or
mutant, virus strain; culturing the virus in the presence of a
selection condition that is less restrictive to a wild-type strain
of the virus, relative to an attenuated, or mutated, strain;
identifying mutated strains of the attenuated virus that exhibit
reduced attenuation under the restrictive conditions than would an
non-mutated attenuated virus; and assessing the genome of the
mutated strain of the attenuated virus to identify the genetic
basis for the reduced attenuation exhibited by the strain. Upon
identifying the genetic alteration giving rise to reduced
attenuation of the virus, mutations can be made in the genetic
sequence of the attenuated virus strain to prevent the mutation
conferring reduced attenuation from arising. The provided methods
are applicable to any attenuated virus capable of evolving to
become less attenuated due to genetic mutation when cultured under
selective conditions. For exemplary purposes, the method is
described in the context of RSV herein; however, those skilled in
the art will readily understand that it may be applied
generally.
[0058] Desired modifications of infectious recombinant RSV are
typically selected to specify a desired phenotypic change, e.g., a
change in viral growth, temperature sensitivity, ability to elicit
a host immune response, attenuation, etc. As will be appreciated by
those of ordinary skill in the art, these changes can be brought
about by, e.g., mutagenesis of a parent RSV clone to ablate,
introduce or rearrange a specific gene(s) or gene region(s) (e.g.,
a gene segment that encodes a protein structural domain, such as a
cytoplasmic, transmembrane or extracellular domain, an immunogenic
epitope, binding region, active site, etc.). Genes of interest in
this regard include all of the genes of the RSV genome:
3'-NS1-NS2-N-P-M-SH-G-F-M2-L-5', as well as heterologous genes from
other RSV, other viruses and a variety of other non-RSV sources as
indicated herein. It will also be understood that modifications
which simply alter or ablate expression of a selected gene can be
used to further modify the virus strains described herein, e.g., by
introducing a termination codon within a selected RSV coding
sequence; changing the position of an RSV gene relative to an
operably linked promoter; introducing an upstream start codon to
alter rates of expression; modifying (e.g., by changing position,
altering an existing sequence, or substituting an existing sequence
with a heterologous sequence) GS and/or GE transcription signals to
alter phenotype (e.g., growth, temperature restrictions on
transcription, etc.); and various other deletions, substitutions,
additions and rearrangements that specify quantitative or
qualitative changes in viral replication, transcription of selected
gene(s), or translation of selected protein(s).
[0059] In one aspect of the invention, a selected gene segment,
such as one encoding a selected protein or protein region (e.g., a
cytoplasmic tail, transmembrane domain or ectodomain, an epitopic
site or region, a binding site or region, an active site or region
containing an active site, etc.) from one RSV, can be substituted
for a counterpart gene segment from the same or different RSV or
other source, to yield novel recombinants having desired phenotypic
changes compared to wild-type or parent RSV strains. For example,
recombinants of this type may express a chimeric protein having a
cytoplasmic tail and/or transmembrane domain of one RSV fused to an
ectodomain of another RSV. Other exemplary recombinants of this
type express duplicate protein regions, such as duplicate
immunogenic regions. As used herein, "counterpart" genes, gene
segments, proteins or protein regions, are typically from
heterologous sources (e.g., from different RSV genes, or
representing the same (i.e., homologous or allelic) gene or gene
segment in different RSV strains). Typical counterparts selected in
this context share gross structural features, e.g., each
counterpart may encode a comparable structural "domain," such as a
cytoplasmic domain, transmembrane domain, ectodomain, binding site
or region, epitopic site or region, etc. Counterpart domains and
their encoding gene segments embrace an assemblage of species
having a range of size and amino acid (or nucleotide) sequence
variations, which range is defined by a common biological activity
among the domain or gene segment variants. For example, two
selected protein domains encoded by counterpart gene segments
within the invention may share substantially the same qualitative
activity, such as providing a membrane spanning function, a
specific binding activity, an immunological recognition site, etc.
More typically, a specific biological activity shared between
counterparts, e.g., between selected protein segments or proteins,
will be substantially similar in quantitative terms, i.e., they
will not vary in respective quantitative activity profiles by more
than 30%, preferably by no more than 20%, more preferably by no
more than 5-10%.
[0060] In alternative aspects of the invention, the infectious RSV
produced from a cDNA-expressed genome or antigenome can be any of
the RSV or RSV-like strains, e.g., human, bovine, murine, etc., or
of any pneumovirus or metapneumovirus, e.g., pneumonia virus of
mice or avian metapneumovirus. To engender a protective immune
response, the RSV strain may be one which is endogenous to the
subject being immunized, such as human RSV being used to immunize
humans. The genome or antigenome of endogenous RSV can be modified,
however, to express RSV genes or gene segments from a combination
of different sources, e.g., a combination of genes or gene segments
from different RSV species, subgroups, or strains, or from an RSV
and another respiratory pathogen such as human parainfluenza virus
(PIV) (see, e.g., Hoffman et al., J. Virol. 71:4272-4277 (1997);
Durbin et al., Virology 235(2):323-32 (1997); Murphy et al., U.S.
Patent Application Ser. No. 60/047,575, filed May 23, 1997, and the
following plasmids for producing infectious PIV clones: p3/7(131)
(ATCC 97990); p3/7(131)2G (ATCC 97889); and p218(131) (ATCC 97991);
each deposited Apr. 18, 1997 under the terms of the Budapest Treaty
with the American Type Culture Collection (ATCC) of 10801
University Blvd., Manassas, Va. 20110-2209, USA., and granted the
above identified accession numbers.
[0061] In certain embodiments of the invention, recombinant RSV are
provided wherein individual internal genes of a human RSV are
replaced with, e.g., a bovine or other RSV counterpart, or with a
counterpart or foreign gene from another respiratory pathogen such
as PIV. Substitutions, deletions, etc. of RSV genes or gene
segments in this context can include part or all of one or more of
the NS1, NS2, N, P, M, SH, and L genes, or the M2-1 and M2-2 open
reading frames, or non-immunogenic parts of the G and F genes.
Also, human RSV cis-acting sequences, such as promoter or
transcription signals, can be replaced with, e.g., their bovine RSV
counterpart. Reciprocally, means are provided to generate live
attenuated bovine RSV by inserting human attenuating genes or
cis-acting sequences into a bovine RSV genome or antigenome
background.
[0062] Thus, infectious recombinant RSV intended for administration
to humans can be a human RSV that has been modified to contain
genes from, e.g., a bovine RSV or a PIV, such as for the purpose of
attenuation. For example, by inserting a gene or gene segment from
PIV, a bivalent vaccine to both PIV and RSV is provided.
Alternatively, a heterologous RSV species, subgroup or strain, or a
distinct respiratory pathogen such as PIV, may be modified, e.g.,
to contain genes that encode epitopes or proteins which elicit
protection against human RSV infection. For example, the human RSV
glycoprotein genes can be substituted for the bovine glycoprotein
genes such that the resulting bovine RSV, which now bears the human
RSV surface glycoproteins and would retain a restricted ability to
replicate in a human host due to the remaining bovine genetic
background, elicits a protective immune response in humans against
human RSV strains.
[0063] The ability to analyze and incorporate other types of
attenuating mutations into infectious RSV for vaccine development
extends to a broad assemblage of targeted changes in RSV clones.
For example, deletion of the SH gene yields a recombinant RSV
having novel phenotypic characteristics, including enhanced growth
in cell culture and reduced replication in vivo. In the present
invention, an SH gene deletion (or any other selected,
non-essential gene or gene segment deletion), is combined in a
recombinant RSV with one or more additional mutations specifying an
attenuated phenotype, e.g., a point mutation adopted from a
biologically derived attenuated RSV mutant. In exemplary
embodiments, the SH, or NS2, or NS1 gene, or M2-2 open reading
frame, is deleted in combination with one or more cp and/or is
mutations adopted from cpts248/404, cpts530/1009, cpts530/1030,
rA2cp248/404/1030.DELTA.SH, .DELTA.1313 or another selected mutant
RSV strain, to yield a recombinant RSV having increased yield of
virus, enhanced attenuation, and increased genetic or phenotypic
stability, due to the combined effects of the different mutations.
In this regard, any RSV gene which is not essential for growth, for
example the SH, G, NS1, and NS2 genes, or M2-2 open reading frame,
can be ablated or otherwise modified to yield desired effects on
virulence, pathogenesis, immunogenicity and other phenotypic
characters. For example, ablation by deletion of a non-essential
gene such as SH results in enhanced viral growth in culture.
Without wishing to be bound by theory, this effect is likely due in
part to a reduced nucleotide length of the viral genome. In the
case of one exemplary SH-deletion clone, the modified viral genome
is 14,825 nt long, 398 nucleotides less than wild type. By
engineering similar mutations that decrease genome size, e.g., in
other coding or noncoding regions elsewhere in the RSV genome, such
as in the P, M, F and M2 genes, the invention provides several
readily obtainable methods and materials for improving RSV
growth.
[0064] In addition, a variety of other genetic alterations can be
produced in a recombinant RSV genome or antigenome for
incorporation into infectious recombinant RSV, alone or together
with one or more attenuating point mutations adopted from a
biologically derived mutant RSV. As used herein, "heterologuous
genes" refers to genes taken from different RSV strains or types or
non-RSV sources. These heterologous genes can be inserted in whole
or in part, the order of genes changed, gene overlap removed, the
RSV genome promoter replaced with its antigenome counterpart,
portions of genes removed or substituted, and even entire genes
deleted. Different or additional modifications in the sequence can
be made to facilitate manipulations, such as the insertion of
unique restriction sites in various intergenic regions (e.g., a
unique Stul site between the G and F genes) or elsewhere.
Nontranslated gene sequences can be removed to increase capacity
for inserting foreign sequences.
[0065] Deletions, insertions, substitutions and other mutations
involving changes of whole viral genes or gene segments in
recombinant RSV of the invention yield highly stable vaccine
candidates, which are particularly important in the case of immuno
suppressed individuals. Many of these mutations will result in
attenuation of resultant vaccine strains, whereas others will
specify different types of desired phenotypic changes. For example,
certain viral genes are known which encode proteins that
specifically interfere with host immunity (see, e.g., Kato et al.,
EMBO. J. 16:578-87 (1997). Ablation of such genes in vaccine
viruses is expected to reduce virulence and pathogenesis and/or
improve immunogenicity.
[0066] Other mutations within RSV of the present invention involve
replacement of the 3' end of genome with its counterpart from
antigenome, which is associated with changes in RNA replication and
transcription. In addition, the intergenic regions (Collins et al.,
Proc. Natl. Acad. Sci. USA 83:4594-4598 (1986)) can be shortened or
lengthened or changed in sequence content, and the
naturally-occurring gene overlap (Collins et al., Proc. Natl. Acad.
Sci. USA 84:5134-5138 (1987)) can be removed or changed to a
different intergenic region by the methods described herein.
[0067] In another embodiment, a sequence surrounding a
translational start site (preferably including a nucleotide in the
-3 position) of a selected RSV gene is modified, alone or in
combination with introduction of an upstream start codon, to
modulate RSV gene expression by specifying up- or down-regulation
of translation.
[0068] Alternatively, or in combination with other RSV
modifications disclosed herein, RSV gene expression can be
modulated by altering a transcriptional GS signal of a selected
gene(s) of the virus. In one exemplary embodiment, the GS signal of
NS2 is modified to include a defined mutation to superimpose a is
restriction on viral replication.
[0069] Yet additional RSV clones within the invention incorporate
modifications to a transcriptional GE signal. For example, RSV
clones are provided which substitute or mutate the GE signal of the
NS1 and NS2 genes for that of the N gene, resulting in decreased
levels of readthrough mRNAs and increased expression of proteins
from downstream genes. The resulting recombinant virus exhibits
increased growth kinetics and increased plaque size, providing but
one example of alteration of RSV growth properties by modification
of a cis-acting regulatory element in the RSV genome.
[0070] In another embodiment, expression of the G protein is
increased by modification of the G mRNA. The G protein is expressed
as both a membrane bound and a secreted form, the latter form being
expressed by translational initiation at a start site within the G
gene translational open reading frame. The secreted form can
account for as much as one-half of the expressed G protein.
Ablation of the internal start site (e.g., by sequence alteration,
deletion, etc.), alone or together with altering the sequence
context of the upstream start site yields desired changes in G
protein expression. Ablation of the secreted form of the G protein
also will improve the quality of the host immune response to
exemplary, recombinant RSV, because the soluble form of the G
protein is thought to act as a "decoy" to trap neutralizing
antibodies. Also, soluble G protein has been implicated in enhanced
immunopathology due to its preferential stimulation of a Th2-biased
response.
[0071] In alternative embodiments, levels of RSV gene expression
are modified at the level of transcription. In one aspect, the
position of a selected gene in the RSV gene map can be changed to a
more promoter-proximal or promotor-distal position, whereby the
gene will be expressed more or less efficiently, respectively.
According to this aspect, modulation of expression for specific
genes can be achieved yielding reductions or increases of gene
expression from two-fold, more typically four-fold, up to ten-fold
or more compared to wild-type levels. In one example, the NS2 gene
(second in order in the RSV gene map) is substituted in position
for the SH gene (sixth in order), yielding a predicted decrease in
expression of NS2. Increased expression of selected RSV genes due
to positional changes can be achieved up to 10-fold, 30-fold,
50-fold, 100-fold or more, often attended by a commensurate
decrease in expression levels for reciprocally, positionally
substituted genes.
[0072] In other exemplary embodiments, the F and G genes are
transpositioned singly or together to a more promoter-proximal or
promoter-distal site within the (recombinant) RSV gene map to
achieve higher or lower levels of gene expression, respectively.
These and other transpositioning changes yield novel RSV clones
having attenuated phenotypes, for example due to decreased
expression of selected viral proteins involved in RNA
replication.
[0073] In yet other embodiments, RSV useful in a vaccine
formulation can be conveniently modified to accommodate antigenic
drift in circulating virus. Typically the modification will be in
the G and/or F proteins. The entire G or F gene, or the segments
encoding particular immunogenic regions thereof, is incorporated
into the RSV genome or antigenome cDNA by replacement of the
corresponding region in the infectious clone or by adding one or
more copies of the gene such that several antigenic forms are
represented. Progeny virus produced from the modified RSV cDNA are
then used in vaccination protocols against the emerging strains.
Further, inclusion of the G protein gene of RSV subgroup B as a
gene addition will broaden the response to cover a wider spectrum
of the relatively diverse subgroup A and B strains present in the
human population.
[0074] An infectious RSV clone of the invention can also be
engineered according to the methods and compositions disclosed
herein to enhance its immunogenicity and induce a level of
protection greater than that provided by infection with a wild-type
RSV or an incompletely attenuated parental virus or clone. For
example, an immunogenic epitope from a heterologous RSV strain or
type, or from a non-RSV source such as PIV, can be added by
appropriate nucleotide changes in the polynucleotide sequence
encoding the RSV genome or antigenome. Recombinant RSV can also be
engineered to identify and ablate (e.g., by amino acid insertion,
substitution or deletion) epitopes associated with undesirable
immunopathologic reactions. In other embodiments, an additional
gene is inserted into or proximate to the RSV genome or antigenome
which is under the control of an independent set of transcription
signals. Genes of interest include, but are not limited to, those
encoding cytokines (e.g., IL-2 through IL-15, especially IL-2, IL-6
and IL-12, etc.), gamma-interferon, and include those encoding
cytokines (e.g., IL-2 through IL-15, especially IL-2, IL-6 and
IL-12, etc.), gamma-interferon, and proteins rich in T helper cell
epitopes. The additional protein can be expressed either as a
separate protein or as a chimera engineered from a second copy of
one of the RSV proteins, such as SH. This provides the ability to
modify and improve the immune response against RSV both
quantitatively and qualitatively.
[0075] In another aspect of the invention the recombinant RSV can
be employed as a vector for protective antigens of other
respiratory tract pathogens, such as PIV, e.g., by incorporating
sequences encoding those protective antigens from PIV into the RSV
genome or antigenome used to produce infectious vaccine virus, as
described herein. In alternate embodiments, a modified RSV is
provided which comprises a chimera of a RSV genomic or antigenomic
sequence and at least one PIV sequence, for example a
polynucleotide containing sequences from both RSV and PIV1, PIV2,
PIV3 or bovine PIV. For example, individual genes of RSV may be
replaced with counterpart genes from human PIV, such as the HN
and/or F glycoprotein genes of PIV1, PIV2, or PIV3. Alternatively,
a selected, heterologous gene segment, such as a cytoplasmic tail,
transmembrane domain or ectodomain of HN or F of HPIV1, HPIV2, or
HPIV3 can be substituted for a counterpart gene segment in, e.g.,
the same gene in an RSV clone, within a different gene in the RSV
clone, or into a non-coding sequence of the RSV genome or
antigenome. In one embodiment, a gene segment from HN or F of HPIV3
is substituted for a counterpart gene segment in RSV type A, to
yield constructs encoding chimeric proteins, e.g. fusion proteins
having a cytoplasmic tail and/or transmembrane domain of RSV fused
to an ectodomain of RSV to yield a novel attenuated virus, and/or a
multivalent vaccine immunogenic against both PIV and RSV.
[0076] In addition to the above described modifications to
recombinant RSV, different or additional modifications in RSV
clones can be made to facilitate manipulations, such as the
insertion of unique restriction sites in various intergenic regions
(e.g., a unique Stul site between the G and F genes) or elsewhere.
Nontranslated gene sequences can be removed to increase capacity
for inserting foreign sequences.
[0077] Introduction of the foregoing, defined mutations into an
infectious RSV clone can be achieved by a variety of well-known
methods. By "infectious clone" is meant cDNA or its product,
synthetic or otherwise, which can be transcribed into genomic or
antigenomic RNA capable of producing an infectious virus . The term
"infectious" refers to a virus or viral structure that is capable
of replicating in a cultured cell or animal or human host to
produce progeny virus or viral structures capable of the same
activity. Thus, defined mutations can be introduced by conventional
techniques (e.g., site-directed mutagenesis) into a cDNA copy of
the genome or antigenome. The use of antigenome or genome cDNA
subfragments to assemble a complete antigenome or genome cDNA is
well-known by those of ordinary skill in the art and has the
advantage that each region can be manipulated separately (smaller
cDNAs are easier to manipulate than large ones) and then readily
assembled into a complete cDNA. Thus, the complete antigenome or
genome cDNA, or any subfragment thereof, can be used as template
for oligonucleotide-directed mutagenesis. A mutated subfragment can
then be assembled into the complete antigenome or genome cDNA.
Mutations can vary from single nucleotide changes to replacement of
large cDNA pieces containing one or more genes or genome
regions.
[0078] The ability to introduce defined mutations into infectious
RSV has many applications, including the analyses of RSV molecular
biology and pathogenesis. For example, the functions of the RSV
proteins, including the NS1, NS2, SH, M2-1 and M2-2 proteins, can
be investigated and manipulated by introducing mutations which
ablate or reduce their level of expression, or which yield mutant
protein. In one embodiment, RSV virus can be constructed so that
expression of a viral gene, such as the SH gene, is ablated by
deletion of the mRNA coding sequence and flanking transcription
signals. These deletions are highly stable against genetic
reversion, rendering the RSV clones derived therefrom particularly
useful as vaccine agents.
Methods of Producing Recombinant RSV
[0079] The ability to produce infectious RSV from cDNA permits the
introduction of specific engineered changes, including site
specific attenuating mutations, gene deletion, gene start sequecen
deletion or modification, and a broad spectrum of other recombinant
changes, into the genome of a recombinant virus to produce an
attenuated virus and, in some embodiments, effective RSV vaccine
strains. Such engineered changes may, or may not, be based on
biological mutations identified in other virus strains.
[0080] Described herein are infectious RSVs produced by recombinant
methods, e.g., from cDNA. In one embodiment, infectious RSV is
produced by the intracellular coexpression of a cDNA that encodes
the RSV genomic RNA, together with those viral proteins necessary
to generate a transcribing, replicating nucleocapsid, such as one
or more sequences that encode major nucleocapsid (N) protein,
nucleocapsid phosphoprotein (P), large (L) polymerase protein, and
a transcriptional elongation factor M2-1 protein. Plasmids encoding
other RSV, such as nonstructural protein 1 (NS1), nonstructural
protein 2 (NS2), matrix protein (M), small hydrophobic protein
(SH), glycoprotein (G), fusion protein (F), and protein M2-2, may
also be included with these essential proteins. Accordingly, also
described herein are isolated polynucleotides that encode the
described mutated viruses, make up the described genomes or
antigenomes, express the described genomes or antigenomes, or
encode various proteins useful for making recombinant RSV in vitro.
These polynucleotides can be included within or expressed by
vectors in order to produce a recombinant RSV. Accordingly, cells
transfected with the isolated polynucleotides or vectors are also
within the scope of the invention and are exemplified herein. In
addition, a number of methods relating to the described RSVs are
also disclosed. For example, methods of producing the recombinant
RSVs described herein are disclosed; as are methods producing an
immune response to a viral protein in an animal, mammal or
human.
[0081] The invention permits incorporation of biologically derived
mutations, along with a broad range of other desired changes, into
recombinant RSV vaccine strains. For example, the capability of
producing virus from cDNA allows for incorporation of mutations
occurring in attenuated RSV vaccine candidates to be introduced,
individually or in various selected combinations, into a
full-length cDNA clone, and the phenotypes of rescued recombinant
viruses containing the introduced mutations to be readily
determined. In exemplary embodiments, amino acid changes identified
in attenuated, biologically-derived viruses, for example in a
cold-passaged RSV (cpRSV), or in a further attenuated strain
derived therefrom, such as a temperature-sensitive derivative of
cpRSV (cptsRSV), are incorporated within recombinant RSV clones.
These changes from a wild-type or biologically derived mutant RSV
sequence specify desired characteristics in the resultant clones,
e.g., an attenuated or further attenuated phenotype compared to a
wild-type or incompletely attenuated parental RSV phenotype. In
this regard, disclosed herein are novel RSV mutations that can be
combined, either individually or in combination with one another,
with preexisting attenuated RSV strains to produce viruses having
desired characteristics, such as increased attenuation or enhanced
genetic (and thereby phenotypic) stability in vitro and in
vivo.
[0082] In addition to single and multiple point mutations and
site-specific mutations, changes to recombinant RSV disclosed
herein include deletions, insertions, substitutions or
rearrangements of whole genes or gene segments. These mutations can
affect small numbers of bases (e.g., from 15-30 bases, up to 35-50
bases or more), or large blocks of nucleotides (e.g., 50-100,
100-300, 300-500, 500-1,000 bases) depending upon the nature of the
change (i.e., a small number of bases may be changed to insert or
ablate an immunogenic epitope or change a small gene segment or
delete one or more codons for purposes of attenuation, whereas
large block(s) of bases are involved when genes or large gene
segments are added, substituted, deleted or rearranged. These
alterations will be understood by those of skill in the art based
on prior work done with either RSV or related viruses. Viruses
having block mutations of this sort can also be combined with the
novel RSV mutations described herein, either individually or in
combination with one another, to produce viruses having desired
characteristics, such as increased attenuation or enhanced genetic
(and thereby phenotypic) stability in vitro and in vivo.
[0083] In additional aspects, the invention provides for
supplementation of mutations adopted from biologically derived RSV,
e.g., cp and is mutations, many of which occur in the L gene, with
additional types of mutations involving the same or different genes
or RNA signals in a recombinant RSV clone. RSV encodes ten mRNAs
and eleven proteins. Three of these are transmembrane surface
proteins, namely the attachment G protein, fusion F protein
involved in penetration, and small hydrophobic SH protein. While
specific functions may be assigned to single proteins, it is
recognized that these assignments are provisional and descriptive.
G and F are the major viral neutralization and protective antigens.
Four additional proteins are associated with the viral
nucleocapsid, namely the RNA binding protein N, the phosphoprotein
P, the large polymerase protein L, and the transcription elongation
factor M2-1. The matrix M protein is part of the inner virion and
probably mediates association between the nucleocapsid and the
envelope. Finally, there are two nonstructural proteins, NS1 and
NS2, of unknown function. These proteins can be selectively altered
in terms of its expression level, or can be added, deleted,
substituted or rearranged, in whole or in part, alone or in
combination with other desired modifications, in a recombinant RSV
to obtain novel infectious RSV clones. In addition, the RNA genome
contains cis-acting signals, including but not limited to the
leader and trailer regions as well as the transcription gene-start
(GS) and gene-end (GE) signals that border each gene. These signals
help control encapsidation, transcription, and replication, and may
have other roles as well. These signals can be selectively altered
to obtain novel RSV clones.
[0084] Provided herein are specific amino acid changes that may be
used to give rise to desirable mutations of the RSV L protein.
Those of skill in the art will be readily able to determine the
alterations of the codon encoding the described amino acid, as the
possible codons that may give rise to a particular amino acid
sequence are well known in the art. In some embodiments, particular
codon usage is preferred to impart the substitution of a particular
amino acid residue at a particular location in the L protein (e.g.,
1321K(AAA), 1321E(GAA), and 1313C(TGC) to name a few). In these
instances, the particular codon usage is provided herein. That the
entire L protein nucleotide sequence, or even partial flanking
sequence, may not be provided will not hinder those of ordinary
skill in the art from understanding where the codon change should
be made, as the changes are provided relative to the
biologically-derived, wild-type sequence of RSV A2 strain, the
sequence of which is readily available to the public (e.g., GenBank
accession number M74568).
[0085] The invention also provides methods for producing an
infectious RSV from one or more isolated polynucleotides, e.g., one
or more cDNAs. According to the present invention cDNA encoding a
RSV genome or antigenome is constructed for intracellular or in
vitro coexpression with the necessary viral proteins to form
infectious RSV. By "RSV antigenome" is meant an isolated
positive-sense polynucleotide molecule which serves as the template
for the synthesis of progeny RSV genome. Preferably a cDNA is
constructed which is a positive-sense version of the RSV genome,
corresponding to the replicative intermediate RNA, or antigenome,
so as to minimize the possibility of hybridizing with
positive-sense transcripts of the complementing sequences that
encode proteins necessary to generate a transcribing, replicating
nucleocapsid, i.e., sequences that encode N, P, L and M2-1
protein.
[0086] A native RSV genome typically comprises a negative-sense
polynucleotide molecule which, through complementary viral mRNAs,
encodes eleven species of viral proteins, i.e., the nonstructural
proteins NS1 and NS2, N, P, matrix (M), small hydrophobic (SH),
glycoprotein (G), fusion (F), M2-1, M2-2, and L, substantially as
described in Mink et al., Virology 185: 615-624 (1991), Stec et
al., Virology 183: 273-287 (1991), and Connors et al., Virol.
208:478-484 (1995). For purposes of the present invention the
genome or antigenome of the recombinant RSV of the invention need
only contain those genes or portions thereof necessary to render
the viral or subviral particles encoded thereby infectious.
Further, the genes or portions thereof may be provided by more than
one polynucleotide molecule, i.e., a gene may be provided by
complementation or the like from a separate nucleotide
molecule.
[0087] By recombinant RSV is meant a RSV or RSV-like viral or
subviral particle derived directly or indirectly from a recombinant
expression system or propagated from virus or subviral particles
produced therefrom. The recombinant expression system will employ a
recombinant expression vector which comprises an operably linked
transcriptional unit comprising an assembly of at least a genetic
element or elements having a regulatory role in RSV gene
expression, for example, a promoter, a structural or coding
sequence which is transcribed into RSV RNA, and appropriate
transcription initiation and termination sequences.
[0088] To produce infectious RSV from cDNA-expressed genome or
antigenome, the genome or antigenome is coexpressed with those RSV
proteins necessary to (i) produce a nucleocapsid capable of RNA
replication, and (ii) render progeny nucleocapsids competent for
both RNA replication and transcription. Transcription by the genome
nucleocapsid provides the other RSV proteins and initiates a
productive infection. Additional RSV proteins needed for a
productive infection can also be supplied by coexpression.
[0089] Alternative means to construct cDNA encoding the genome or
antigenome include by reverse transcription-PCR using improved PCR
conditions (e.g., as described in Cheng et al., Proc. Natl. Acad.
Sci. USA 91:5695-5699 (1994); Samal et al., J. Virol 70:5075-5082
(1996)) to reduce the number of subunit cDNA components to as few
as one or two pieces. In other embodiments, different promoters can
be used (e.g., T3, SP6) or different ribozymes (e.g., that of
hepatitis delta virus). Different DNA vectors (e.g., cosmids) can
be used for propagation to better accommodate the large size genome
or antigenome.
[0090] The N, P, L and M2-1 proteins are encoded by one or more
expression vectors which can be the same or separate from that
which encodes the genome or antigenome, and various combinations
thereof. Additional proteins may be included as desired, encoded by
its own vector or by a vector encoding a N, P, L, or M2-1 protein
or the complete genome or antigenome. Expression of the genome or
antigenome and proteins from transfected plasmids can be achieved,
for example, by each cDNA being under the control of a promoter for
T7 RNA polymerase, which in turn is supplied by infection,
transfection or transduction with an expression system for the T7
RNA polymerase, e.g., a vaccinia virus MVA strain recombinant which
expresses the T7 RNA polymerase (Wyatt et al., Virology,
210:202-205 (1995)). The viral proteins, and/or T7 RNA polymerase,
can also be provided from transformed mammalian cells, or by
transfection of preformed mRNA or protein.
[0091] Alternatively, synthesis of antigenome or genome can be done
in vitro (cell-free) in a combined transcription-translation
reaction, followed by transfection into cells. Or, antigenome or
genome RNA can be synthesized in vitro and transfected into cells
expressing RSV proteins.
Uses of RSV Mutant Viruses
[0092] To select candidate vaccine viruses from the host of
recombinant RSV strains provided herein, the criteria of viability,
efficient replication in vitro, attenuation in vivo,
immunogenicity, and phenotypic stability are determined according
to well known methods. Viruses which will be most desired in
vaccines of the invention must maintain viability, must replicate
sufficiently in vitro well under permissive conditions to make
vaccine manufacture possible, must have a stable attenuation
phenotype, must exhibit replication in an immunized host (albeit at
lower levels), and must effectively elicit production of an immune
response in a vaccine sufficient to confer protection against
serious disease caused by subsequent infection from wild-type
virus. Clearly, the heretofore known and reported RS virus mutants
do not meet all of these criteria. Indeed, contrary to expectations
based on the results reported for known attenuated RSV, viruses of
the invention are not only viable and more attenuated then previous
mutants, but are more stable genetically in vivo than those
previously studied mutants.
[0093] To propagate a RSV virus for vaccine use and other purposes,
a number of cell lines which allow for RSV growth may be used. RSV
grows in a variety of human and animal cells. Preferred cell lines
for propagating attenuated RS virus for vaccine use include
DBS-FRhL-2, MRC-5, and Vero cells. Highest virus yields are usually
achieved with epithelial cell lines such as Vero cells. Cells are
typically inoculated with virus at a multiplicity of infection
ranging from about 0.001 to 1.0, or more, and are cultivated under
conditions permissive for replication of the virus, e.g., at about
30-37.degree. C. and for about 3-10 days, or as long as necessary
for virus to reach an adequate titer. Temperature-sensitive viruses
often are grown using 32.degree. C. as the "permissive
temperature." Virus is removed from cell culture and separated from
cellular components, typically by well known clarification
procedures, e.g., centrifugation, and may be further purified as
desired using procedures well known to those skilled in the
art.
[0094] RSV which has been attenuated as described herein can be
tested in various well known and generally accepted in vitro and in
vivo models to confirm adequate attenuation, resistance to
phenotypic reversion, and immunogenicity for vaccine use. In in
vitro assays, the modified virus, which can be a multiply
attenuated, biologically derived or recombinant RSV, is tested for
temperature sensitivity of virus replication or "ts phenotype," and
for the small plaque phenotype. Modified viruses are further tested
in animal models of RSV infection. A variety of animal models
(e.g., murine, cotton rat, and primate) have been described and are
known to those skilled in the art.
[0095] In accordance with the foregoing description and based on
the Examples below, the invention also provides isolated,
infectious RSV compositions for vaccine use. The attenuated virus
which is a component of a vaccine is in an isolated and typically
purified form. By isolated is meant to refer to RSV which is in
other than a native environment of a wild-type virus, such as the
nasopharynx of an infected individual. More generally, isolated is
meant to include the attenuated virus as a component of a cell
culture or other artificial medium. For example, attenuated RSV of
the invention may be produced by an infected cell culture,
separated from the cell culture and added to a stabilizer which
contains other non-naturally occurring RSVs.
[0096] RSV vaccines of the invention contain as an active
ingredient an immunogenically effective amount of RSV produced as
described herein. Biologically derived or recombinant RSV can be
used directly in vaccine formulations. The biologically derived or
recombinantly modified virus may be introduced into a host with a
physiologically acceptable carrier and/or adjuvant. Useful carriers
are well known in the art, and include, e.g., water, buffered
water, 0.4% saline, 0.3% glycine, hyaluronic acid and the like. The
resulting aqueous solutions may be packaged for use as is, or
lyophilized, the lyophilized preparation being combined with a
sterile solution prior to administration, as mentioned above. The
compositions may contain pharmaceutically acceptable auxiliary
substances as required to approximate physiological conditions,
which include, but are not limited to, pH adjusting and buffering
agents, tonicity adjusting agents, wetting agents and the like, for
example, sodium acetate, sodium lactate, sodium chloride, potassium
chloride, calcium chloride, sucrose, magnesium sulfate, phosphate
buffers, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)
buffer, sorbitan monolaurate, and triethanolamine oleate.
Acceptable adjuvants include incomplete Freund's adjuvant, aluminum
phosphate, aluminum hydroxide, or alum, which are materials well
known in the art. Preferred adjuvants also include Stimulon.TM.
QS-21 (Aquila Biopharmaceuticals, Inc., Worchester, Mass.), MPL.TM.
(3-0-deacylated monophosphoryl lipid A; RIBI ImmunoChem Research,
Inc., Hamilton, Mont.), and interleukin-12 (Genetics Institute,
Cambridge, Mass.).
[0097] Upon immunization with a RSV vaccine composition as
described herein, via injection, aerosol, droplet, oral, topical or
other route, the immune system of the host responds to the vaccine
by producing antibodies specific for RSV virus proteins, e.g., F
and G glycoproteins. As a result of the vaccination the host
becomes at least partially or completely immune to RSV infection,
or resistant to developing moderate or severe RSV disease,
particularly of the lower respiratory tract.
[0098] The host to which the vaccine is administered can be any
mammal susceptible to infection by RSV or a closely related virus
and capable of generating a protective immune response to antigens
of the vaccinizing strain. Thus, suitable hosts include humans,
non-human primates, bovine, equine, swine, ovine, caprine,
lagamorph, rodents, such as mice or cotton rats, etc. Accordingly,
the invention provides methods for creating vaccines for a variety
of human and veterinary uses.
[0099] The vaccine compositions containing the attenuated RSV of
the invention are administered to a subject susceptible to or
otherwise at risk of RS virus infection in an "immunogenically
effective dose" which is sufficient to induce or enhance the
individual's immune response capabilities against RSV. An RSV
vaccine composision may be administered to a subject via injection,
aerosol delivery, nasal spray, nasal droplets, oral inoculation, or
topical application. In the case of human subjects, the attenuated
virus of the invention is administered according to well
established human RSV vaccine protocols (Karron et al JID
191:1093-104, 2005). Briefly, adults or children are inoculated
intranasally via droplet with an immunogenically effective dose of
RSV vaccine, typically in a volume of 0.5 ml of a physiologically
acceptable diluent or carrier. This has the advantage of simplicity
and safety compared to parenteral immunization with a
non-replicating vaccine. It also provides direct stimulation of
local respiratory tract immunity, which plays a major role in
resistance to RSV. Further, this mode of vaccination effectively
bypasses the immunosuppressive effects of RSV-specific
maternally-derived serum antibodies, which typically are found in
the very young. Also, while the parenteral administration of RSV
antigens can sometimes be associated with immunopathologic
complications, this has never been observed with a live virus.
[0100] In all subjects, the precise amount of RSV vaccine
administered and the timing and repetition of administration will
be determined by various factors, including the patient's state of
health and weight, the mode of administration, the nature of the
formulation, etc. Dosages will generally range from about 10.sup.3
to about 10.sup.6 plaque forming units ("PFU") or more of virus per
patient, more commonly from about 10.sup.4 to 10.sup.5 PFU virus
per patient. In one embodiment, about 10.sup.5 to 10.sup.6 PFU per
patient could be administered during infancy, such as between 1 and
6 months of age, and one or more additional booster doses could be
given 2-6 months or more later. In another embodiment, young
infants could be given a dose of about 10.sup.5 to 10.sup.6 PFU per
patient at approximately 2, 4, and 6 months of age, which is the
recommended time of administration of a number of of other
childhood vaccines. In yet another embodiment, an additional
booster dose could be administered at approximately 10-15 months of
age. In any event, the vaccine formulations should provide a
quantity of attenuated RSV of the invention sufficient to
effectively stimulate or induce an anti-RSV immune response (an
"effective amount"). The resulting immune response can be
characterized by a variety of methods. These include taking samples
of nasal washes or sera for analysis of RSV-specific antibodies,
which can be detected by tests including, but not limited to,
complement fixation, plaque neutralization, enzyme-linked
immunosorbent assay, luciferase-immunoprecipitation assay, and flow
cytometry. In addition, immune responses can be detected by assay
of cytokines in nasal washes or sera, ELISPOT of immune cells from
either source, quantitative RT-PCR or microarray analysis of nasal
wash or serum samples, and restimulation of immune cells from nasal
washes or serum by re-exposure to viral antigen in vitro and
analysis for the production or display of cytokines, surface
markers, or other immune correlates meaures by flow cytometry or
for cytotoxic activity against indicator target cells displaying
RSV antigens. In this regard, individuals are also monitored for
signs and symptoms of upper respiratory illness. As with
administration to chimpanzees, the attenuated virus of the vaccine
grows in the nasopharynx of vaccinees at levels approximately
10-fold or more lower than wild-type virus, or approximately
10-fold or more lower when compared to levels of incompletely
attenuated RSV.
[0101] In some embodiments, neonates and infants are given multiple
doses of RSV vaccine to elicit sufficient levels of immunity.
Administration may begin within the first month of life, and at
intervals throughout childhood, such as at two months, four months,
six months, one year and two years, as necessary to maintain
sufficient levels of protection against natural RSV infection. In
other embodiments, adults who are particularly susceptible to
repeated or serious RSV infection, such as, for example, health
care workers, day care workers, family members of young children,
the elderly, individuals with compromised cardiopulmonary function,
are given multiple doses of RSV vaccine to establish and/or
maintain protective immune responses. Levels of induced immunity
can be monitored by measuring amounts of neutralizing secretory and
serum antibodies, and dosages adjusted or vaccinations repeated as
necessary to maintain desired levels of protection. Further,
different vaccine viruses may be indicated for administration to
different recipient groups. For example, an engineered RSV strain
expressing a cytokine or an additional protein rich in T cell
epitopes may be particularly advantageous for adults rather than
for infants. Vaccines produced in accordance with the present
invention can be combined with viruses of the other subgroup or
strains of RSV to achieve protection against multiple RSV subgroups
or strains, or selected gene segments encoding, e.g., protective
epitopes of these strains can be engineered into one RSV clone as
described herein. In such embodiments, the different viruses can be
in admixture and administered simultaneously or present in separate
preparations and administered separately. For example, as the F
glycoproteins of the two RSV subgroups differ by only about 11% in
amino acid sequence, this similarity is the basis for a
cross-protective immune response as observed in animals immunized
with RSV or F antigen and challenged with a heterologous strain.
Thus, immunization with one strain may protect against different
strains of the same or different subgroup.
[0102] The vaccines of the invention elicit production of an immune
response that may be protective against, or reduce the magnitude of
serious lower respiratory tract disease, such as pneumonia and
bronchiolitis when the individual is subsequently infected with
wild-type RSV. While the naturally circulating virus is still
capable of causing infection, particularly in the upper respiratory
tract, there is a very greatly reduced possibility of rhinitis as a
result of the vaccination and possible boosting of resistance by
subsequent infection by wild-type virus. Following vaccination,
there may be detectable levels of host engendered serum and, in
some instances, secretory antibodies which are capable of
neutralizing homologous (of the same subgroup) wild-type virus in
vitro and in vivo. In many instances the host antibodies will also
neutralize wild-type virus of a different, non-vaccine
subgroup.
[0103] The level of attenuation of vaccine virus may be determined
by, for example, quantifying the amount of virus present in the
respiratory tract of an immunized host and comparing the amount to
that produced by wild-type RSV or other attenuated RS viruses which
have been evaluated as candidate vaccine strains. For example, the
attenuated virus of the invention will have a greater degree of
restriction of replication in the upper respiratory tract of a
highly susceptible host, such as a chimpanzee, compared to the
levels of replication of wild-type virus, e.g., 10- to 1000-fold
less. In order to further reduce the development of rhinorrhea,
which is associated with the replication of virus in the upper
respiratory tract, an ideal vaccine candidate virus should exhibit
a restricted level of replication in both the upper and lower
respiratory tract. However, the attenuated viruses of the invention
must be sufficiently infectious and immunogenic in humans to confer
protection in vaccinated individuals. Methods for determining
levels of RS virus in the nasopharynx of an infected host are well
known in the literature. Specimens are obtained by aspiration or
washing out of nasopharyngeal secretions and virus quantified in
tissue culture or other by laboratory procedure. See, for example,
Belshe et al., J. Med. Virology 1:157-162 (1977), Friedewald et
al., J. Amer. Med. Assoc. 204:690-694 (1968); Gharpure et al., J.
Virol. 3:414-421 (1969); and Wright et al., Arch. Ges. Virusforsch.
41:238-247 (1973). The virus can conveniently be measured in the
nasopharynx of host animals, such as chimpanzees.
[0104] The following examples are provided by way of illustration,
not limitation.
EXAMPLE 1
Attempts to Generate Deletion Mutants in RSV
[0105] Phenotypic stability is an important feature of a
live-attenuated vaccine. Mutations based on nucleotide substitution
are prone to reversion in RNA viruses due to the inherently high
mutation rate of these viruses. In a few isolated cases, increased
stability of mutant phenotypes based on amino acid substitution has
been achieved by deletion of one or more codons, since deletions
often are more refractory to reversion than are substitutions. For
example, a promising recombinantly derived HPIV2 live vaccine
candidate contains deletion of codons 1724 -1725 in the L
polymerase protein (Nolan et al Vaccine 25:6409-6422, 2007). Also,
vaccine candidates of HPIV1 have been developed involving deletion
involving codons 168-170 of the C protein and codons 1710-1711 of
the L protein (Bartlett et al Virology J 4:67, 2007). In each case,
the site of deletion was guided by the previous identification of
biologically-derived attenuating point mutations at that site in
related viruses. However, these few recombinant examples
notwithstanding, deletion mutations involving amino acids are very
rare in viable biologically-derived mutants compared to the
frequent occurrence of substitutions, supporting the idea that
deletions are less well tolerated than substitutions. Therefore,
they are not readily generated, and their recovery is
unpredictable. Even when it is possible to isolate a deletion
mutant, that virus must retain a high degree of replicative fitness
under permissive conditions to be useful in a live vaccine, given
the need to achieve satisfactory virus titers for vaccine
manufacture.
[0106] Attempts were made to introduce small deletion mutations
into RSV in order to identify stable attenuating mutations.
Initially, these efforts focused mainly on several amino acid
substitution mutations that were previously identified in
biologically-derived RSV mutants and had been confirmed in
recombinant virus to individually confer is and attenuation
phenotypes. Deletions were attempted at these sites with the
expectation that, since these sites have been shown to accommodate
amino acid substitutions without reducing replication at permissive
temperatures, these regions would be particularly tolerant of
mutation. This same strategy had led to the successful
identification of the recombinant deletion mutations described
above for HPIV1 and HPIV2. RSV mutants were prepared that included
mutations at the following sites in the L protein: F521L ("530"
mutation), Q831L ("248" mutation), M1169V ("1009" mutation), and
Y1321N ("1030" mutation). In addition, an attenuating point
mutation (I1103V in the L protein) that had been identified in
bovine PIV3 (BPIV3) (Haller et al Virology 288:342-350 2001) was
also included. For the mutation from BPIV3, the amino acid sequence
of the BPIV3 L protein was aligned with that of RSV in order to
identity the corresponding site in RSV L, which was identified as
RSV L position 1165. Unexpectedly, however, it was found that
deletion of each of these codons individually resulted in a failure
to recover infectious virus in four independent attempts each,
under conditions where the attenuating amino acid substitution
could be recovered in parallel as a control in each of the four
attempts to show that the conditions were favorable to recovery
(Table 1). In each case, the L gene of the antigenic cDNA
(representing 43% of the viral genome) was completely sequenced and
confirmed to be correct. Attempts were also made to recover
mutations involving deletion of one or more nearby codons (Table
1). For example, with regard to the "530" mutation at position 521,
attempts also were made to recover a mutation involving position
522. With regard to the "248" mutation at position 831, attempts
also were made to delete both codons 830 and 831, as well as codons
831 and 832. With regard to the BPIV3 I1103V mutation, attempts
also were made to delete position 1164. With regard to the "1009"
mutation at position 1169, deletions at positions 1170, 1172, 1176,
1178 also were attempted. With regard to the "1030" mutation at
position 1321, attempts also were made to delete positions 1320
plus 1321, and 1321 plus 1322, and 1320 alone. However, none of
these various additional deletions in the L protein could be
recovered in infectious virus in multiple attempts with two
exceptions. The first exception was that virus was recovered from
the AR1170 mutant in 1 of 4 attempts. However, sequence analysis
showed that this virus had acquired a 3-nucleotide insertion of AAA
at the point of deletion, replacing the deletion of arginine with a
lysine residue. Thus, it was not a true recovery of a deletion
mutation. As the second exception, virus was recovered from the
AN1172 mutant in 1 of 4 attempts. However, sequence analysis showed
that this virus had acquired a 3-nucleotide insert of AAA at the
point of deletion, replacing the deletion of asparagine with a
lysine residue. Thus, this also was not a true recovery of a
deletion mutation.
[0107] As will be described in Example 5, these studies also
identified two attenuating mutations, E649D and Q874H, that
spontaneously appeared during passage of an attenuated virus in
cell culture in an attempt to evaluate its genetic stability. The
identification of these two spontaneous mutations suggested that
these sites, and ones nearby, might be amenable for single-codon
deletion mutations. Therefore, attempts were made to recover
viruses bearing single-codon deletions at positions 646, 649, 653,
874, 850, 857, 858, 872, 875, 876, 879, and 882. However, none of
these could be recovered (data not shown).
[0108] Taken together, these results showed that the recovery of
codon-deletion mutants was not readily achieved even at sites
previously shown to accommodate amino acid substitutions in RSV,
nor at a site identified by amino acid sequence alignment as
corresponding to a substitution mutation at position 1103 in BPIV3.
Recovery also was not possible at nearby sites. Thus, deletion of
one or more codons in the RSV L polymerase protein frequently
resulted in an inability to recover the virus, presumably due to a
lethal effect of the deletion. In the two cases that could be
recovered, the RSV polymerase apparently inserted three adenosine
residues at the point of deletion to create a lysine codon, showing
that the codon-deletion mutations that appeared to be recoverable
in this Example in fact were not stable.
TABLE-US-00001 TABLE 1 Unsuccessful attempts to recover additional
mutations involving deletion (.DELTA.) of one or two codons in the
RSV L protein. Number of Recovery Amino Acid.sup.a codons RSV
nt.sup.b attempts Recovery Additional information F521L .sup.c,d
TTC to CTA 10058-60 4 4/4 RSV "530" mutation .DELTA.F521.sup.d TTC
10058-60 4 0/4 .DELTA.Y522 TAT 10061-3 4 0/4 Q831L .sup.c, e CAA to
CTA 10988-90 4 4/4 RSV "248" mutation .DELTA.Q 831 .sup.e CAA
10988-90 4 0/4 .DELTA.QA CAA GCA 10988-93 4 0/4 831 + 832 .DELTA.AQ
GCT CAA 10985-90 4 0/4 830 + 831 .DELTA.R1164 AGA 11987-9 4 0/4
.DELTA.A1165 .sup.f GCC 11990-2 4 0/4 Corresponds to position of
BPIV3 I1103V .DELTA.M1169 .sup.g ATG 12002-4 4 0/4 Position of RSV
"1009" deletion .DELTA.R1170 AGG 12005-7 4 1/4 Sequence analysis
revealed a 3 nt insertion (codon AAA), resulting in R1170K mutation
.DELTA.N1172 AAC 12011-3 4 1/4 Sequence analysis revealed a 3 nt
insertion (codon AAA), resulting in N1172K mutation .DELTA.L1176
CTT 12023-5 3 0/3 .DELTA.R1178 AGG 12029-31 4 0/4 Y1321N .sup.c, h
TAT to AAT 12458-60 6 6/6 RSV "1030" mutation .DELTA.Y1321 .sup.h
TAT 12458-60 6 0/6 .DELTA.TY ACA TAT 12455-60 6 0/6 1320 + 1321
.DELTA.YE TAT GAA 12458-63 4 0/4 1321+1322 .DELTA.T1320 ACA 12455-7
4 0/4 .sup.aAmino acid position of the RSV L ORF (Genbank Accession
number M74568). Note that these mutants were constructed in the
recombinant wt RSV 6120 backbone (see the Description of FIG. 2 for
an explanation). .sup.bGenome positions according to the complete
unmodified sequence of biologically-derived wt RSV strain A2
(Genbank Accession Number M74568). .sup.c Substitution mutation as
a positive control for recovery. .sup.dsite of "530" mutation.
.sup.e site of "248" mutation. .sup.f site of BPIV3 I1103V
mutation. .sup.g site of "1009" mutation. .sup.h site of "1030"
mutation.
EXAMPLE 2
Recovery and Sequence Analysis of Recombinant RSVs with
Substitutions at Amino Acid 1321 of the L Protein
[0109] As shown in Table 1, it was not possible to recover
codon-deletion mutations at or near the sites of major attenuating
point substitution mutations that were previously identified for
RSV and are present in current vaccine candidates. Therefore, it
was investigated whether it would be possible to identify
alternative codons or amino acid assignments that might be
recoverable in virus and might provide improved stability. This was
investigated with the RSV "1030" mutation (this designation refers
to a biological clone from the original mutagenesis experiments and
not to a sequence position), which occurs at amino acid position
1321 in the L polymerase protein. The wt assignment at this
position is tyrosine (TAT), and the ts, attenuating mutation is
asparagine (AAT), which differs by a single nucleotide
(underlined). This mutation also can be described as Y1321N, or
1321N (single letter code for the wt and mutant amino acid
assignments to the left and right, respectively). This nomenclature
is used throughout this document except where noted, but of
necessity is descriptive rather rigidly limiting. This mutation was
previously observed to be unstable in a live attenuated RSV vaccine
candidate rA2cp248/404/1030/.DELTA.SH that was evaluated in young
infants (Karron et al. JID 191:1093-1104, 2005). Note that "rA2"
refers to "recombinant RSV strain A2". In the Examples, this prefix
is sometimes added to virus names, but in most case is omitted.
[0110] In an attempt to stabilize this mutation, the mutant
asparagine (AAT) assignment at L amino acid position 1321 was
substituted with an alternate codon or alternate amino acid
assignment that might be more stable against reversion to an
assignment conferring a wt-like phenotype. Substitutions of amino
acids also might have other desirable qualities, such as increased
or decreased ts or attenuation phenotypes, which might be useful
for vaccine development. Therefore, a panel of recombinant RSV was
constructed containing the wt tyrosine assignment or each of the
other 19 amino acid substitutions at position 1321. This provided a
panel of RSV substitution mutants that could be further assessed
for stability, attenuation, and growth characteristics desirable
for a vaccine candidate.
[0111] As shown in Table 2, 19 of the 20 possible amino acid
substitutions at position 1321 yielded recoverable virus. The only
virus that was not recovered contained a Y1321R substitution: this
virus was not recovered in five independent transfections and was
thus considered to be nonviable. This probably was not due to an
adventitious mutation in the antigenomic cDNA, since construction
of each of the mutants involved transferring a 4013-nt fragment of
the L gene bearing the region of position 1321 into a preparation
of full-length antigenomic cDNA that yielded viable virus with
other 1321 amino acid assignments, and it is generally recognized
that cloning in bacteria has a low error rate. Furthermore, the L
gene of this antigenomic cDNA (representing 43% of the genome) was
sequenced completely and confirmed to be correct. Also, two
independent antigenomic cDNAs were assayed for recovery, both with
negative results. Each viral genome from the 19 viable viruses was
completely sequenced from uncloned RT-PCR products to confirm its
integrity. For several of the recovered viruses, inserts of one (or
in one case three) adenosine residues were discovered (Table 2).
Since these were not present in the original cDNA, they represent
adventitious mutations acquired during passage, which frequently
occur for RNA viruses. In several cases, adenosine residues
occurred in the GE signal of the G or N gene, and specifically
occurred in the tract of adenosine residues that constitute the end
of the GE signal and directs the viral polymerase to produce the
mRNA polyA tail during viral gene transcription. In one virus, an
insertion of one adenosine residue occurred in the downstream
non-translated region of the L gene, and in another virus an
insertion of one adenosine occurred in a run of adenosine residues
at the end of the leader region. The insertion of additional
adenosine residues such as these into GE signals or other
non-translated regions during RSV growth in cell culture is not
unusual and was considered to be insignificant. These results
indicated that many alternative residues could be accommodated at
position 1321, some of which yielded viruses that may have
characteristics different than those observed for the original
biologically-derived RSV 1030 mutant (Y1321N).
TABLE-US-00002 TABLE 2 Recovery and sequence analysis of
recombinant RSVs with substitutions at amino acid 1321 of the L
protein.sup.a Mutation 1321 codon Recovery Adventitious
mutations.sup.b Y1321.sup.c TAT + Insertion of a single A residue
in a run of A nt at 15019 between the L stop codon and L GE signal
1321N.sup.c AAT + 1321G GGT + 1321A GCT + 1321S TCT + 1321T ACT +
1321C TCT + Insertion of 3 A residues in a run of A nt (nt 5595) in
the G GE signal 1321V GTT + 1321L TTA + 1321I ATT + 1321M ATG +
1321P CCT + 1321F TTT + Insertion of a single A nt into a run of A
residues at the end of the leader region (nt 44); insertion of a
single A residue in a run of A nt (nt 5595) in the G GE signal
1321W TGG + Insertion of an A residue in a run of A nt (nt 2328) in
the N GE signal 1321D GAT + 1321E GAA + 1321Q CAG + 1321H CAT +
1321K AAA + 1321R CGT No .sup.aGenome positions according to the
complete unmodified sequence of biologically-derived wt RSV strain
A2 (Genbank accession number M74568). Note that these mutants were
constructed in the recombinant wt RSV 6120 backbone (see the
Description of FIG. 2 for an explanation). .sup.bGE: gene-end
transcription signal. .sup.cY is the wild-type (wt) assignment at
position 1321. N is the mutant assignment in the original
biologically-derived "1030" virus.
EXAMPLE 3
Characterization of RSVs with Substitutions at Amino Acid 1321 of
the L Protein
[0112] Each of the mutant viruses that was recovered was assessed
for the ability to replicate in vitro at a range of temperatures
(32.degree. C.-40.degree. C.) at which wt RSV is permissive for
replication in order to identify possible ts phenotypes (Table 3).
In addition, the mutants were evaluated for the ability to
replicate in the nasal turbinates and lungs of mice, to identify
possible attenuation phenotypes (Table 3). The mouse is an
extensively used in vivo model for RSV replication that, like
humans, has a 37.degree. C. body temperature and thus can be used
to evaluate ts mutants. The mouse is not as permissive as the human
for RSV replication and thus does not predict the level of
replication in humans, but it does provide a means to compare the
relative replication efficiencies of RSV mutants. Ten-week old mice
were inoculated intranasally with 10.sup.6 PFU of each the viruses.
Four days after infection, the animals were sacrificed and the
nasal turbinates and lungs were harvested and processed to quantify
virus titer by plaque assay (Table 3). As shown in Table 3, the
original Y1321N mutation confers an in vitro shut-off temperature
of 38.degree. C. (the shut off temperature (T.sub.SH) is defined as
the lowest restrictive temperature at which the reduction compared
to the permissive temperature of 32.degree. C. is 100-fold or
greater than that observed for wt RSV at the two temperatures).
This is consistent with previous results (Whitehead, et al., J.
Virol 73:871-7 (1999)). The results from the mouse study showed
that the Y1321N mutation resulted in a log10 reduction in titer of
1.1 and 0.6 in the lungs and nasal turbinates, respectively,
compared to wild-type virus (Table 3, the wild-type virus is called
Y1321 in this Table).
[0113] Of the 18 other mutant viruses tested, 17 had a shut-off
temperature lower than that of wild-type virus (Y1321). In
addition, 9 of these mutant viruses (1321D, 1321E, 1321P, 1321K,
1321G, 1321T, 1321C, 1321Q, 1321V) exhibited a substantial degree
of temperature sensitivity, with shut-off temperatures of
35-38.degree. C., compared to 38.degree. C. for the original "1030"
mutation (Table 3). When evaluated in mice, several viruses were
found to be attenuated, relative to the wild-type virus, with a few
of these viruses, such as 1321E, 1321P, 1321K, 1321G, exhibiting
attenuation similar to or greater than the original RSV 1030 mutant
(1321N). Virus 1321D, which was the most is of the viruses, could
not be recovered from the mice and thus likely was over-attenuated.
A number of other viruses, such as 1321L, 1321F, 1321W, and 1321H,
exhibited only a modest amount of temperature sensitivity and
little or no attenuation, and 1321M was neither temperature
sensitive nor attenuated, although it did form microplaques at
39.degree. C. and thus may be slightly more attenuated than the wt
virus. Comparison of the chemical structures of the amino acids
that were associated with attenuation or a lack of attenuation did
not reveal any consistent patterns that might have been used to
predict the effects of these substitutions (not shown).
TABLE-US-00003 TABLE 3 Characterization of the temperature
sensitivity and attenuation phenotypes of recombinant RSVs with
substitutions at amino acid sequence position 1321 of the L protein
Replication in mice.sup.b Titer (log.sub.10 PFU/g .+-. SE) Mean
log.sub.10 reduction.sup.c Virus titer (PFU per mL) at indicated
temperature (.degree. C.).sup.a Nasal Nasal Virus 32 35 36 37 38 39
40 T.sub.SH .sup.d turbinates Lung turbinates Lung Y1321wt 7.8 7.8
7.8 7.8 7.8 7.9 7.7 >40 4.6 .+-. 0.1 4.2 .+-. 0.1 1321N .sup.e
7.7 7.8 7.6 7.4* <1 <1 <1 38 3.5 .+-. 0.1.sup.g 3.6 .+-.
0.0.sup.g 1.1 0.6 1321D 6.1* 3.4 3.5 3.3 3.3 3.1 3.2 35 n.d..sup.h
n.d. 1321E 7.5 7.2* 6.3* 3.5* <1 <1 <1 37 1.9 .+-.
01.sup.g 1.7 .+-. 0.0.sup.g 2.7 2.5 1321P 7.7 7.8 7.7 4.5 <1
<1 <1 37 3.6 .+-. 0.1.sup.g 2.8 .+-. 0.0.sup.g 1.0 1.4 1321K
7.5 7.5 7.4 7.3* <1 <1 <1 38 4.0 .+-. 0.1.sup.g 2.7 .+-.
0.2.sup.g 0.6 1.5 1321G 7.5 7.4 7.3 6.9 <1 <1 <1 38 3.7
.+-. 0.1.sup.g 3.5 .+-. 0.1.sup.g 0.9 0.7 1321T 7.6 7.6 7.6 7.5*
<1 <1 <1 38 4.0 .+-. 0.1.sup.g 3.8 .+-. 0.0 0.6 0.4 1321C
7.9 8.0 8.0 7.8 <1 <1 <1 38 3.9 .+-. 0.5 3.9 .+-. 0.1 0.7
0.3 1321Q 7.6 7.7 7.6 7.5 <1 <1 <1 38 4.4 .+-. 0.1 3.7
.+-. 0.1 0.2 0.5 1321V 7.9 7.9 7.9 7.8* .sup. 4.9.sup.# <1 <1
38 4.4 .+-. 0.1 3.9 .+-. 0.1 0.2 0.3 1321A 7.2 7.3 7.2 7.0 6.1*
<1 <1 39 4.2 .+-. 0.0 3.7 .+-. 0.1 0.4 0.5 1321S 7.9 7.9 7.8
7.7 6.6* <1 <1 39 4.2 .+-. 0.1 3.9 .+-. 0.1 0.4 0.3 1321I 7.5
7.5 7.5 7.4 7.1* 5.1* <1 39 4.1 .+-. 0.2 3.8 .+-. 0.1 0.5 0.4
1321L 7.5 7.5 7.5 7.4 7.4 7.2* <1 40 4.4 .+-. 0.1 4.4 .+-. 0.0
0.2 none 1321F 7.5 7.5 7.6 7.4 7.3* .sup. 6.7.sup.# <1 40 4.3
.+-. 0.1 4.1 .+-. 0.1 0.3 0.1 1321W 7.7 7.7 7.6 7.7 7.5* .sup.
6.1.sup.# <1 40 4.2 .+-. 0.1 4.3 .+-. 0.1 0.4 none 1321H 7.9 6.9
6.9 6.9 6.7 6.1* <1 40 4.5 .+-. 0.1 4.3 .+-. 0.0 0.1 none 1321M
7.8 7.9 7.9 7.8 7.7 .sup. 7.1.sup.# .sup. 6.3.sup.# >40 4.7 .+-.
0.0 4.4 .+-. 0.1 none none .sup.aThe ts phenotype for each virus
was evaluated by plaque assay on HEp2 cells at the indicated
temperatures. *small plaques, .sup.#micro plaques. For viruses with
the ts phenotype, values indicating the shut-off temperature are
marked (bold, underlined). The shut off temperature is defined in
footnote d below. .sup.b10-week-old mice in groups of five were
inoculated intranasally with 10.sup.6 PFU of the indicated virus.
Nasal turbinates and lungs were harvested on day 4, and virus
titers were determined by plaque assay. SE: Standard error.
.sup.cReduction in mean titer compared to 1321Y (wt) virus. .sup.d
Shut off temperature (T.sub.SH) is defined as the lowest
restrictive temperature at which the reduction compared to
32.degree. C. is 100-fold or greater than that observed for wt RSV
at the two temperatures. The ts phenotype is defined as having a
shut off temperature of 40.degree. C or less (bold, underlined).
.sup.e Original "1030" amino acid assignment. .sup.gStatistically
significant (P .ltoreq. 0.05, underlined) difference compared to wt
1321Y control virus. .sup.hn.d., not detectable.
EXAMPLE 4
Stability of Codons Encoding Attenuating Amino Acid Residues
[0114] Pursuant to identifying a more stable attenuating mutation
at position 1321 in the L protein, attention was focused on the
amino acid assignments in Table 3 that specified a level of
temperature sensitivity and attenuation similar to or exceeding
that of the original 1321N mutant. These included the E, P, K, and
G mutants. As shown in Table 4, all of the possible codons for
these amino acids were examined (using the genetic code as
reference) to enumerate all of the possible amino acid coding
changes that could be created by all possible single nucleotide
substitutions at each of the three codon positions. Note that this
is a "paper" exercise in which all of the theoretical coding
changes were enumerated. These possible amino acids were then
identified as "wild-type-like", or "intermediate", or "attenuated"
based on the information on their level of temperature sensitivity
and attenuation in Table 3. Specifically, the "wild-type-like"
assignments (Y, S, L, F, W, H, and M) were ones that replicated in
mice to a level approaching that of the wild type assignment: i.e.,
the titers in both the nasal turbinates and lungs were reduced
.ltoreq.0.4 log 10 each and the T.sub.SH was .gtoreq.39.degree. C.
(Table 3). These assignments would not be desirable because
mutations that yielded these amino acids would confer substantial
loss of attenuation. A second group of residues was considered to
be attenuated because these residues were associated with the
greatest observed decreases in viral replication. Specifically,
residues (N, D, E, P, K, G, and R) either had viral titers that
were reduced .gtoreq.0.9 log 10 in either the lungs or nasal
turbinates, or were non-viable (i.e. the R assignment) and thus
would not yield phenotypic reversion (Table 3). The remaining
residues (T, C, Q, V, A, and I) were "intermediate", and
represented a partial shift towards reversion, but remained
partially attenuated. The goal was to identify one or more codons
that specified an attenuating amino acid and that could not be
changed by any single nucleotide substitution to an amino acid
specifying a wild-type-like phenotype, and preferably would have a
minimum number of possible changes to an amino acid specifying an
intermediate phenotype. As shown in Table 4, a number of the codons
that were examined had at least one possible change that would
yield a wild-type-like phenotype. However, several codons were
identified that could not yield a wild-type-like assignment with a
single nucleotide substitution, namely: the E(GAA), E(GAG), K(AAA),
and G(GGA) codons. While these examples [E(GAA), E(GAG), K(AAA),
and G(GGA)] may represent the most promising examples, other codons
also appear to provide superior alternatives to the wt assignment.
For example, while the original "1030" mutant assignment of N(AAT
or AAC) had three possible substitutions leading to a wt-like
assignment, alternatives such as G(GGG, GGT, or GGC) had only one
possible substitution each leading to a wt-like assignment.
TABLE-US-00004 TABLE 4 Theoretical outcomes of all possible single
nucleotide substitutions in all possible codons of selected amino
acid assignments.sup.a Effect of nt point mutation (N to indicated
Number of nt) on amino acid assignment phenotypic Amino Posi-
reversions acid Codon tion.sup.d T C A G Intermed Wt N AAT.sup.b,c
.sup. NAY.sup.d Y.sup.e H.sup.e N D 2 3 or ANY I T N S AAC.sup.c
AAN N N K K P CCT.sup.c NCY S P T A 2 3 or CNY L P H.sup.e R
CCC.sup.c CCN P P P P P CCA.sup.c NCR.sup.d S P T A 3 2 or CNR L P
Q R CCG.sup.c CCN P P P P G GGG NGG W R R G 2 1 GNG V A E G GGN G G
G G G GGT.sup.c NGY C R S G 3 1 or GNY V A D G GGC.sup.c GGN G G G
G K AAG NAG stop Q K E 2 1 ANG M T K R AAN N N K K E GAA GAR stop Q
K E 3 or GNR V A E G GAG.sup.c GAN D D E E K AAA NAA stop Q K E 3
ANA I T K R AAN N N K K G GGA NGA stop R R G 2 GNA V A E G GGN G G
G G .sup.aThe first and second columns at the left indicate the
amino acid assignment (column 1) and specific codons (column 2)
being analyzed. As shown in column 3, each codon is analyzed for
substitutions at codon positions 1, 2, and 3 (nucleotide position
in the codon where substitution occurs is indicated with N). The
next four columns show the amino acid assignments resulting from T,
C, A, and G substitutions at this position. Amino acids that confer
an intermediate attenuation phenotype are italicized. Ones that
confer a wt-like phenotype are in bold and underlined. .sup.bAAT:
codon present in the rA2cp248/404/1030.DELTA.SH virus that was
evaluated in clinical trials (Karron et al, JID 191: 1093-1104,
2005). .sup.cThese codons yield the same outcomes. .sup.dY denotes
C or T; R denotes G or A. .sup.e Amino acid conferring an upward
shift in shut-off temperature detected in samples from clinical
trials (Karron et al, JID 191: 1093-1104, 2005).
[0115] Experiments were conducted to assess the stability of these
codons during replication in vitro. This involved "temperature
stress tests", in which the virus bearing the mutation of interest
was passaged multiple times at increasing temperature in order to
provide a selective advantage for any revertants that might occur,
allowing these revertants to selectively amplify and be detected.
The viruses for comparison included the original 1321N(AAT)
mutation as well as the 1321E(GAA), 1321K(AAA), 1321G(GGT),
1321G(GGA), and 1321P(CCT) mutations. Only one of the two 1321E
codons was evaluated since both had the same predicted outcomes
(Table 4). Ten independent aliquots of each virus were serially
passaged two times each at 35.degree. C., 36.degree. C., and
37.degree. C., for a total of six passages (FIG. 1). As controls,
two independent aliquots of each virus were serially passaged 6
times at the permissive temperature of 32.degree. C. (FIG. 1,
dotted lines). Aliquots of each passage level were titrated by
plaque assay at 32.degree. C. to detect changes in yield that might
be indicative of changes in the ts phenotype, as an indirect assay
of attenuation. Titration analysis indicated that all lineages
replicated at 36.degree. C. and 37.degree. C. (FIG. 1), with no
restriction due to the ts phenotype. This result alone did not
provide clear information on the stability of the ts mutations.
However, sequence analysis of a 249-nt region of the L gene
spanning the "1030" mutation of viruses from passage 6 was
performed in order to directly investigate the stability of the ts
mutation (Table 5). For the 1321N(AAT) virus, for example,
sub-populations with reversions to wt (Y) were detected in 9 out of
10 lineages (flasks), and one of these had mixed subpopulations
encoding N, Y, and H at codon 1321. Reversion to Y, or change to H,
also had been observed in isolates from vaccinees in clinical
trials that received an experimental vaccine containing the "1030"
mutation, and these changes were associated with an upward shift in
temperature sensitivity indicative of a partial loss of attenuation
(Karron, J. Infect. Dis 191:1093-104, 2005). This showed
concordance between our in vitro assay and results from clinical
trials in infants and children. In contrast, neither of the two
glycine codons, GGT or GGA, had a change at position 1321. Thus,
both codons were identified as providing increased stability.
However, each contained a second-site mutation at codon 51313 in
50% and 90% of the lineages, respectively, resulting in a change to
cysteine. Another tested virus, 1321K(AAA), also had no detectable
change at position 1321 (and thus was stabilized), but had the
second site mutation S1313C in 90% of the cultures. The other
tested mutants, E(GAA) and P(CCT), had changes at position 1321 in
some flasks. All of the changes at position 1321 in virus
1321E(GAA) involved changes to valine or alanine (Table 5), which
had "intermediate" attenuated phenotypes (Table 3), whereas all of
the changes at position 1321 in virus 1321P(CCT) involved changes
to leucine, or histidine (Table 5), which had wt-like phenotypes
(Table 3). Thus, the 1321E(GAA) assignment was stable against
reversion to wt-like assignments, and the 1321P(CTT) was more
stable than the wt 1321N(AAT) assignment. However, both the
1321E(GAA) and 1321P(CCT) viruses had the second site mutation
S1313C in nearly all of the cultures. For all of the viruses with
changes at codon 1313, the change involved an AGC to TGC point
mutation (underlined), resulting in a serine-to-cysteine (S1313C)
amino acid change. Thus, the "stress test" evaluation provided
presumptive evidence of increased genetic stability at position
1321 with the G(GGA), G(GGT), and K(AAA) mutations, and to a lesser
extent with the E(GAA) and P(CCT) mutations. However, the presence
of the S1313C mutation suggested that it might be a compensatory
second-site mutation that could be solely responsible for the
ability of the viruses with no change at position 1321 to replicate
efficiently at 35-37.degree. C.
TABLE-US-00005 TABLE 5 Observed stability of the various codons
encoding amino acid 1321 and occurrence of a potential compensatory
1313C mutation of the L protein during passage at restrictive
temperatures.sup.a % cultures with re- Compensatory mutation at
vertants or Codon 1321 1313 [wt assignment compen- Revertant
S(AGC)] satory codon Amino Codon Amino Virus mutation.sup.b
observed.sup.c Acid.sup.d observed.sup.c acid.sup.d N (AAT).sup.e
80 [A/T]AT N:Y 10 [A/T/ N:Y:H C]AT G (GGA) 90 [A/T]GC S:C G (GGT)
50 [A/T]GC S:C K (AAA) 90 [A/T]GC S:C E (GAA) 40 TGC C 40 [A/T]GC
S:C 10 G[A/T]A E:V [A/T]GC S:C 10 G[A/T/ E:V:A [A/T]GC S:C C]A P
(CCT) 10 [A/T]GC S:C 50 C[C/T]T P:L [A/T]GC S:C 20 C[C/A/ P:L:H
[A/T]GC S:C T]T 10 CTT L [A/T]GC S:C 10 C[A/T]T L:H .sup.aTen
replicate 25 cm.sup.2 flasks of HEp-2 cells were infected with the
indicated 1321 mutant at an MOI of 0.1 PFU/cell at 35.degree. C.
Virus was harvested between 5 and 7 days post-infection, serially
passaged once more at 35.degree. C., and twice each at 36.degree.
C. and 37.degree. C., for a total of six passages, each by
transferring 1 ml (out of a total of 5 ml) of supernatant to a
fresh 25 cm.sup.2 flask of HEp-2 cells. In parallel, two control
flasks per mutant were passaged six times at the permissive
temperature of 32.degree. C. For each passage, aliquots were frozen
for titration. Genotype analysis was done after the 6th passage by
sequencing of a 249 nt region of the RSV L gene (RSV nt
12261-12511; Genbank accession number M74568). No mutations were
detected in the 32.degree. C. controls (not shown). .sup.b% of
cultures with detectable revertant mutations at codon 1321and/or
compensatory mutations at codon S1313. .sup.cObserved codon
sequence: mixtures are indicated in bracket. Nt changes are
underlined. .sup.dAmino acid coding: Colon indicates a mixed
population of the specified amino acids. Amino acid changes are
underlined. .sup.eCodon present in the rA2cp248/404/1030.DELTA.SH
virus evaluated in clinical trials (Karron et al, JID 191:
1093-1104 2005).
[0116] Studies were carried out to determine whether the S1313C
mutation indeed was a compensatory mutation: in other words, to
determine whether it reduced the is and attenuation phenotypes
conferred by the attenuating assignments at 1321. To do this,
recombinant viruses were constructed in which each assignment
(wild-type tyrosine or the substitutions glycine, glutamic acid,
and lysine) at position 1321 was combined with either serine (the
wt assignment) or cysteine (the proposed compensatory mutation) at
codon 1313 (FIG. 2). In the case of glycine at codon 1321, two
different codons were evaluated (GGA and GGT). All of these viruses
were recovered, amplified, and sequenced in their entirety and were
to shown to be free of adventitious mutations with the exception of
a single A insert in the downstream end of the noncoding region of
the L gene in mutant 1321K(AAA)/1313C, which was deemed
inconsequential (not shown).
[0117] As shown in Table 6, the Y1321/S1313 virus (i.e., wt
assignments at each position) had a T.sub.SH of >40.degree. C.,
consistent with this being a fully wt virus. The introduction of
the 1313C assignment into the wt background (Y1321/1313C) did not
result in a lower T.sub.SH, showing that the introduction of the
1313 serine-to-cysteine mutation in the wt background does not
affect temperature sensitivity. In addition, evaluation of the
attenuation phenotype in mice showed that this virus remained fully
wt (Table 6). For both of the glycine codons that were evaluated,
combination with the wt S1313 assignment yielded virus with a
T.sub.SH of 38.degree. C., consistent with the previous results in
Table 3; attenuation in mice was confirmed for the codon GGT (Table
6). However, when the 1313C assignment was combined with either
glycine codon, the T.sub.SH was increased by 2.degree. C., compared
to the sister virus with the wt serine assignment at codon 1313. In
addition, each of these viruses replicated in mice with an
efficiency that was indistinguishable from that of the wt parent
(Table 6). This shows that, in combination with the attenuating
1321G assignment, the 1313C assignment clearly had a compensatory
effect, eliminating to a large extent the ts and attenuation
phenotypes specified by the 1321G assignment. Similar results were
observed when the 1313C assignment was introduced in the context of
the 1321E and 1321K mutations: in each case, the T.sub.SH was
increased by 2.degree. C., compared to the sister virus with the wt
serine assignment at codon 1313, and the restriction on replication
in mice was largely ablated (Table 6). This showed that the 1313C
mutation indeed compensated for, and largely eliminated, the ts and
attenuation phenotypes of mutations at position 1321.
TABLE-US-00006 TABLE 6 Demonstration that the S1313C mutation in
the RSV L protein is a compensatory mutation, and evaluation of
viruses in which the S1313 codon has been silently changed from AGC
to TCA or in which the 1313 codon has been deleted. Replication in
mice.sup.b Mean log.sub.10 Titer (log.sub.10 PFU/g .+-. SE)
reduction.sup.c Virus titer (PFU per mL) at indicated temperature
(.degree. C.) .sup.a Nasal Nasal Virus 32 35 36 37 38 39 40
T.sub.SH .sup.d .DELTA. T.sub.SH.sup.e turbinates Lung turbinates
Lung Y1321/S1313.sup.f 7.8 7.8 7.7 7.6 7.6 7.6 7.2 >40 4.2 .+-.
0.1 4.6 .+-. 0.1 Y1321/1313C.sup.g 8.4 8.4 8.3 8.2 8.2 8.1 7.9
>40 0 4.4 .+-. 0.1 4.7 .+-. 0.0 1321G(GGA)/S1313 7.7 7.7 7.6 7.1
<1 <1 <1 38 n.d..sup.i n.d..sup.i n.d..sup.i n.d..sup.i
1321G(GGA)/1313C.sup.g 8.1 8.1 8.2 8.0 7.7 6.6 <1 40 +2 4.2 .+-.
0.1 4.3 .+-. 0.1 0.3 1321G(GGT)/S1313 7.5 7.5 7.3 6.9 <1 <1
<1 38 3.6 .+-. 0.1 .sup. 3.1 .+-. 0.2*.sup.h 0.6 1.5
1321G(GGT)/1313C.sup.g 8.3 8.2 8.1 8.1 7.8 6.4 <1 40 +2 4.3 .+-.
0.2 4.5 .+-. 0.1 0.1 1321K(AAA)/S1313 7.7 7.6 7.5 7.3 <1 <1
<1 38 3.8 .+-. 0.1 .sup. 2.8 .+-. 0.2*.sup.h 0.4 1.8
1321K(AAA)/1313C.sup.g 8.2 8.2 8.0 8.1 7.8 7.2 <1 40 +2 4.2 .+-.
0.2 4.5 .+-. 0.1 0.1 1321E(GAA)/S1313 7.6 7.4 6.3 3.5 <1 <1
<1 37 .sup. 2.0 .+-. 0.0*.sup.h 1.8 .+-. 0.1***.sup.h 2.2 2.8
1321E(GAA)/1313C.sup.g 8.2 8.1 8.1 7.8 7.2 <1 <1 39 +2 4.3
.+-. 0.0 4.2 .+-. 0.1 0.4 1321K(AAA)/S1313 8.4 8.3 8.2 7.2 <1
<1 <1 38 0 nd.sup.i nd.sup.i (TCA) .DELTA.1313.quadrature.
7.8 7.5 6.8 <1 <1 <1 <1 37 -3 .sup. 2.5 .+-. 0.2*.sup.h
2.4 .+-. 0.1***.sup.h 1.7 2.2 .sup.a The ts phenotype for each
virus was evaluated by plaque assay on HEp-2 cells at the indicated
temperatures. For viruses with the ts phenotype, values indicating
the shut-off temperature are marked (bold, underlined). The shut
off temperature is defined in footnote d below. .sup.b10-week-old
mice in groups of five were inoculated intranasally with 10.sup.6
PFU of the indicated virus. Nasal turbinates and lungs were
harvested on day 4, and virus titers were determined by plaque
assay. The limit of detection was 2 log.sub.10 PFU per g for nasal
turbinates, and 1.7 log.sub.10 PFU per g for lungs; SE: Standard
error. .sup.cReduction in mean titer compared to the wt virus
(Y1321/S1313) of the same experiment. .sup.d Shut off temperature
(T.sub.SH) is defined as the lowest restrictive temperature at
which the reduction compared to 32.degree. C. is 100-fold or
greater than that observed for wt RSV at the two temperatures. The
ts phenotype is defined as having a shut off temperature of
40.degree. C or less (bold, underlined). .sup.e.DELTA.T.sub.SH,
Difference (.degree. C.) in shutoff temperature between the
indicated 1321 mutant bearing the original S1313 assigment versus
the same 1321 mutant bearing the 1313C mutation. .sup.fWild-type
amino acid assignments at positions 1321 and 1313: thus, this virus
is wild-type. Note that all of the viruses in this Table were
constructed in the recombinant wt RSV 6120 backbone (see the
Description of FIG. 2 for an explanation). .sup.gSecond site
compensatory mutation 1313C. .sup.hStatistically significant
difference compared to the wt RSV (one way ANOVA, Kruskal-Wallis
test with Dunn's post-hoc test, ***P .ltoreq. 0.001, *P .ltoreq.
0.001 underlined). .sup.i n.d. = not done.
EXAMPLE 5
Stabilization of the Attenuating Assignment at L Protein Amino Acid
Position 1321 and Wild Type Assignment at Position 1313
[0118] An additional mutant virus (1321K(AAA)/S1313(TCA)) was
engineered to have the serine at position 1313 encoded by the codon
TCA, rather than the AGC codon of the wt virus (FIG. 3A). This was
done on the premise that the TCA codon would not be as likely to
undergo a S1313C mutation since two bases would have to undergo
mutation to encode a cysteine residue, rather than one as in the
case of the AGC codon. This premise, that increasing the number of
nucleotide changes necessary for reversion provides increased
stability, had already been validated in this invention by the
results of the analysis of various codons at position 1321 (e.g.,
see Tables 4 and 5). The 1321K(AAA)/S1313(TCA) virus retained the
ts phenotype, with a T.sub.SH of 38.degree. C. (Table 6) or
39.degree. C. (Table 8). This virus was tested for phenotypic
stability in an abbreviated version of the temperature stress test
described above. In this test (FIG. 3B), only 4 consecutive
passages were performed, namely two passages at 37.degree. C.,
followed by two passages at 38.degree. C., the latter being a
restrictive temperature for the 1321K(AAA)/S1313(TCA) virus. To
confirm that this abbreviated assay provided a stringent test of
stability, this analysis also included the mutant virus
1321E(GAA)/1313C(TGC), which contained the alternative assignment
1321E(GAA). Sequence analysis showed that 80% of the cultures of
the 1321E(GAA)/1313C(TGC) virus exhibited mutations at codon 1321,
yielding amino acid substitutions of valine, lysine, and alanine
(Table 7), which is consistent with the predictions in Table 4.
These substitution assignments were either attenuating (lysine) or
intermediate in attenuation phenotype (valine and alanine), and
thus showed that the 1321E(GAA) assignment conferred substantial
stability against reversion to a wt-like assignment. This also
confirmed the effectiveness of the abbreviated stability assay.
Importantly, the 1321K(AAA)/S1313(TCA) virus retained the ts
phenotype in this in vitro stress test, as evidenced by the
substantially reduced titer compared to the control cultures
passaged at the permissive temperature of 32.degree. C. (FIG. 3B).
Nucleotide sequencing of the vicinity of the 1321 locus also showed
that there was no reversion or mutation at positions 1313 or 1 321
when assessed by nucleotide sequencing (Table 7). This indicated
that the 1321 and 1313 codons indeed had both been stabilized.
[0119] To investigate this further, the L gene was completely
sequenced from a number of the replicate cultures from the
temperature stress test shown in FIG. 3B. This identified two amino
acid changes in the L protein that were found individually, but not
together, in a number of cultures, namely E649D and Q874H. It was
possible that these might be compensatory mutations that might
mitigate the attenuating effect of the 1321K(AAA)/S1313(TCA)
mutation. To evaluate this possibility, viruses were constructed in
which each of these mutations was placed in the backbone of wt RSV
or the 1321K(AAA)/S1313(TCA) virus. These mutant viruses were
recovered, the presence of the appropriate mutations confirmed by
sequence analysis, and their ts and attenuation phenotypes
determined (Table 8). When placed in the wt RSV backbone, the E649D
mutation did not result in a ts phenotype, but it conferred 1.6 and
1.5 log 10 decreases in replication in the upper and lower
respiratory tract of mice (Table 8). This identified the E649
mutation as a non-ts attenuating mutation. More importantly, when
placed in the 1321K(AAA)/S1313(TCA) backbone, the E649D mutation
did not mitigate either the ts or the attenuation phenotype, and
thus did not appear to be a compensatory mutation. Similar findings
were made with the Q874H mutation. In the wt RSV backbone, the
Q874H mutation did not confer the ts phenotype, but it conferred a
.gtoreq.2.1 and 2.8 log 10 reduction in viral titer in the upper
and lower respiratory tract of mice (Table 8). When placed in the
1321K(AAA)/S1313(TCA) background, it caused a slight upward shift
in T.sub.SH, but, more importantly, it did not mitigate the
attenuation phenotype. Thus, it too was not a compensatory
mutation. The identification of these two mutations in the
1321K(AAA)/S1313(TCA) virus during the temperature stress test
illustrates the well known potential of RNA viruses to accumulate
mutations. However, the finding that neither of these two mutations
was compensatory is further evidence of the stability of the
1321K(AAA)/S1313(TCA) backbone. Thus, no potential reversions,
mutations, or compensatory changes were detected in the
1321K(AAA)/S1313(TCA) virus following the stress test. Importantly,
this identifies a stabilized version of the "1030" mutation. Since
the G(GGA), G(GGT), E(GAA), and P(CCT) mutations also exhibited
complete stability [G(GGA) and G(GGT)] or improved stability
[E(GAA) and P(CCT)] during the stress test summarized in Table 5,
but exhibited the S1313C compensatory mutation, it should now be
possible to stabilize position 1313 in each of these mutants by the
S1313(TCA) assignment.
[0120] In addition, the finding that mutations E649D and Q874H are
non-ts and attenuating identifies two more attenuating loci that
can be used to construct vaccine viruses. Non-ts attenuating
mutations are less common than are ts attenuating mutations, and
are valuable since the combination of ts and non-ts attenuating
mutations has been suggested to confer increased stability compared
to ts attenuating mutations alone (Hall et al Virus Res 22:173-184,
1992).
[0121] In summary, these experiments identified the methods and
means to achieve increased genetic and phenotypic stability, and
identified specific alternative codons and amino acids at position
1321 that have increased genetic and phenotypic stability,
especially when used in conjunction with a selected codon at
position 1313.
TABLE-US-00007 TABLE 7 Stability of the assignments at L protein
amino acid assignment 1321 and 1313 in the mutant 1321K(AAA)/
1313(TCA) during passage at restrictive temperature.sup.a %
cultures Codon 1321 with codon Revertant Codon 1313 1321 codon
Amino Codon Amino Virus.sup.b revertants.sup.c observed.sup.d
Acid.sup.e observed.sup.d acid.sup.e 1321E(GAA)/ 50 G[A/T]A E:V TGC
C 1313C (TGC) .sup.f 20 [G/A]AA E:K TGC C 10 G[A/T/ E:V:A TGC C C]A
1321K(AAA)/ 0 TCA S S1313(TCA) .sup.aTen replicate 25 cm.sup.2
flasks of HEp-2 cells were infected with the indicated 831L mutant
at an MOI of 0.1 PFU/cell at 37.degree. C. Virus was harvested
between 5 and 7 days post-infection, serially passaged again at
37.degree. C., and serially passaged twice at 38.degree. C., for a
total of four passages, each by transferring 1 ml (out of a total
of 5 ml) of supernatant to a fresh 25 cm.sup.2 flask of HEp-2
cells. In parallel, two control flasks per mutant were passaged
four times at the permissive temperature of 32.degree. C. For each
passage, aliquots were frozen for titration and genotype analysis.
Genotype analysis was done after the 4th passage by sequencing of a
249 nt region of the RSV L gene (RSV nt 12261-12511; Genbank
accession number M74568). No mutations were detected in the
32.degree. C. controls (not shown). .sup.bAmino acid assignments of
codons 1321 and 1313 are indicated in single-letter code. The codon
sequence is shown in parentheses. .sup.c% of cultures with
detectable revertants. .sup.dObserved codon sequence: mixtures are
indicated in bracket. Nt changes are underlined. .sup.eAmino acid
coding: colon indicates a mixed population of the specified amino
acids. Amino acid changes are underlined. .sup.f Control to show
that the abbreviated stress test sensitively detects
instability.
TABLE-US-00008 TABLE 8 Effect of L protein mutations E649 and Q874
on the temperature sensitivity and attenuation phenotypes of wt RSV
and the mutant RSV 1321(AAA)/S1313(TCA) Replication in mice.sup.b
Mean log.sub.10 Titer (log.sub.10 PFU/g .+-. SE) reduction.sup.c
Virus titer (PFU per mL) at indicated temperature (.degree.
C.).sup.a Nasal Nasal Virus Exp #.sup.d 32 35 36 37 38 39 40
T.sub.SH .sup.e .DELTA.T.sub.SH.sup.f turbinates Lung turbinates
Lung rA2 (wt) 1 7.7 7.7 7.7 7.6 7.6 7.6 7.1 >40 4.0 .+-. 0.1
(10/10) 4.5 .+-. 0.0 (10/10) 2 7.7 7.7 7.6 7.6 7.5 7.6 7.4 >40
1321K(AAA)/S1313 2 8.1 8.2 8.1 8.1 7.4.sup.# .sup. 5.3.sup.# .sup.
3.4.sup.# 39 3.1 .+-. 0.1 (5/5) 3.9 .+-. 0.1 (5/5) 0.9 0.6 (TCA)
1321K(AAA)/S1313 1 7.2 7.1 7.1 6.8 6.1.sup.# <1 <1 39 2.8
.+-. 0.1 (5/5) 3.0 .+-. 0.1 (5/5) 1.2 1.5 (TCA) + E649D 2 7.0 7.0
7.0 6.8 6.6 .sup. 5.7.sup.# <1 40 E649D.sup.g 1 7.0 7.0 7.0 6.9
6.8 6.8 6.5 >40 1 2.4 .+-. 0.2 (5/5) 3.0 .+-. 0.2 (5/5) 1.6 1.5
1321K(AAA)/S1313 1 7.2 7.1 7.0 7.0 6.8 6.4 .sup. 4.5.sup.# 40 .sup.
2.0 .+-. 0.1 (5/5) .sup.h 2.3 .+-. 0.1 (5/5) 2.0 2.3 (TCA) + Q874H
2 6.8 6.7 6.8 6.7 6.5 6.3 .sup. 5.7.sup.# >40 Q874H.sup.g 1 6.4
6.6 6.4 6.3 6.4 6.2 6.0 >40 0-1 .ltoreq.1.9 (0/5) .sup.h .sup.
1.7 .+-. 0.0 (1/5) .sup.h .gtoreq.2.1 2.8 .sup.aThe ts phenotype
for each virus was evaluated by plaque assay on HEp-2 cells at the
indicated temperatures. For viruses with a ts phenotype, the
shut-off temperatures are marked (bold, underlined). See footnote e
for the definition of shut-off temperature. .sup.#micro plaque
phenotype. .sup.b5-week-old mice in groups of five (or ten for wt
rA2) were inoculated intranasally with 10.sup.6 PFU of the
indicated virus. Nasal turbinates and lungs were harvested on day
4, and virus titers were determined by plaque assay. The limit of
detection was 1.9 log.sub.10 PFU per g for nasal turbinates, and
1.7 log.sub.10 PFU per g for lungs; SE: Standard error. All of the
data on replication in mice were from the same experiment (expt.
#1). .sup.cReduction in mean titer compared to the wt virus (wt
rA2). .sup.dShut off temperature experiment number; two independent
plaque assay experiments (#1 and #2) were performed to evaluate the
ts phenotype. .sup.e Shut off temperature (T.sub.SH) is defined as
the lowest restrictive temperature at which the reduction compared
to 32.degree. C. is 100-fold or greater than that observed for wt
RSV at the two temperatures. The ts phenotype is defined as having
a shut off temperature of 40.degree. C. or less (bold, underlined).
.sup.f.DELTA.T.sub.SH, Difference (.degree. C.) in shutoff
temperature between a given viral backbone bearing the original
E649 or Q874 codon assigment versus the 649D or 874H mutation.
.sup.gIn the wt backbone. Note that the mutants in this Table were
constructed in the recombinant wt RSV 6120 backbone (see the
Description of FIG. 2 for an explanation). .sup.h Statistically
significant difference compared to wt RSV (one way ANOVA,
Kruskal-Wallis test with Dunn's post-hoc test, P .ltoreq. 0.001,
underlined).
EXAMPLE 6
Deletion of Codon 1313 Yields a Temperature-Sensitive, Attenuated
Mutant
[0122] In evaluating the second-site compensatory effects of the
1313C mutation, another virus was designed in which the 1313 codon
was deleted altogether from the wt RSV backbone (thus, in this
virus, the assignment at position 1321 remained unchanged as the wt
assignment of tyrosine) (FIG. 4A). This was done with little
expectation of success, since deletion of a residue is a more
drastic change than a substitution and is less likely to result in
a viable virus, as is generally known and was already shown (Table
1). The goal in making this deletion was to prevent compensation of
the ts attenuating mutation at position 1321. As a first step,
however, the mutation was introduced into the wt background with
the idea that this approach would be the most likely to yield
recoverable virus.
[0123] Surprisingly, the virus deletion mutant, .DELTA.1313, could
be recovered. More surprisingly, when grown at 32.degree. C., the
.DELTA.1313 virus reached titers of about 7.8 login PFU per ml,
similar to that of wt RSV (Table 6). The genome of the recovered
.DELTA.1313 virus was sequenced in its entirety, and was to shown
to be free of adventitious mutations (not shown). It was surprising
to find that the .DELTA.1313 virus was temperature-sensitive, with
a T.sub.SH of 37.degree. C. (Table 6). This was a surprise because,
whereas the serine-to-cysteine amino acid substitution at position
1313 reduced the level of temperature sensitivity, the deletion of
codon 1313 had the opposite effect, and increased the level of
temperature sensitivity. In addition, the .DELTA.1313 virus showed
significantly reduced replication in the upper and lower
respiratory tract of mice (Table 6). Compared to wt virus, titers
were reduced by about 50-fold in the upper, and 160-fold in the
lower respiratory tract (Table 6). This also was an unexpected
finding, since the spontaneous mutation at position 1313 had had
the opposite effect, namely to increase the ability of virus with
an attenuating mutation at 1321 to replicate in the upper and lower
respiratory tract of mice. (Also, as shown below, the combination
of the .DELTA.1313 mutation with an attenuating mutation at
position 1321 or elsewhere increased rather than decreased the ts
and attenuation phenotypes, e.g. Table 9.)
[0124] The .DELTA.1313 virus was tested for phenotypic stability in
an in vitro stress test (FIG. 4B). Replication of the .DELTA.1313
virus was strongly inhibited at increasing temperatures and, by
passage 4, titers of all of the 10 independent lineages were at or
just above the detection limit. Thus, the .DELTA.1313 virus had a
genetically stable temperature sensitive phenotype. Sequence
analysis was not performed because the low level of viral
replication produced insufficient RNA for analysis.
[0125] Taken together, the S1313 deletion had phenotypic
consequences that are desirable for live attenuated RSV vaccine
candidates. It conferred in vitro temperature sensitivity and in
vivo attenuation to wt RSV. At the permissive temperature of
32.degree. C., replication of the .DELTA.1313 virus was
indistinguishable from that of wt RSV in a side-by-side comparison
(not shown), which is important since efficient growth is necessary
for vaccine manufacture. Theoretical chances for genetic reversion
usually are much lower for a deletion mutation compared to a point
mutation, since a multiple of 3 nt must be inserted to maintain the
translational reading frame. Although this can sometimes occur
(Table 1), it seems to depend on the sequence context and appears
to occur with specific mutations and not with others. The S1313
deletion was phenotypically stable in a temperature stress test,
indicating that reversion did not readily occur. These findings are
unanticipated and novel for the following reasons: (i) deletion
mutations involving one or a few codons are rarely reported because
they typically are nonviable or debilitating, (ii) this particular
deletion mutation did not reduce replication at 32.degree. C.,
fulfilling the need for efficient growth for vaccine manufacture,
and (iii) the effect of this mutation was to confer
temperature-sensitivity and attenuation, in contrast to previous
mutations involving codon 1313, which had the opposite effect of
decreasing temperature-sensitivity and attenuation.
[0126] The .DELTA.1313 deletion mutation is now available to use on
its own or in combination with other attenuating mutations to
create live-attenuated RSV vaccines that will be phenotypically
stable and thus will have increased safety and utility.
EXAMPLE 7
New Attenuated Viruses Designed with Stabilized Mutations including
Deletion of Codon 1313
[0127] Identification of the .DELTA.1313 deletion, and
identification of methods to stabilize the "1030" mutation, both of
this invention, provided new ways to construct improved vaccine
candidate viruses. A number of examples are shown in FIG. 5. Each
of these viruses were recovered successfully from cDNA, and their
growth properties--important for vaccine manufacture--and
temperature senstivity phenotype--an indirect marker of
attenuation--were evaluated in vitro.
[0128] The first example at the top of FIG. 5 is cps-3 or
cp/.DELTA.SH/.DELTA.1313. This virus combined the .DELTA.1313
mutation of this invention with the previously described "cp"
mutations and with the previously described .DELTA.SH mutation. The
mutations noted as "cp" comprise a set of five amino acid
substitutions that were originally identified in a cold-passaged
mutant and which specify an attenuation phenotype: V267I in N,
E218A and T523I in F, and C319Y and H1690Y in L (Whitehead et al J
Virol 72:4467-4471, 1998). The present .DELTA.SH deletion involved
nucleotides 4210-4628, and joined the last nucleotide of the M
gene-end signal to the first nucleotide of the SH-G intergenic
region. However, it is well appreciated by those skilled in the art
that the beginning and end of a deletion in non-coding flanking
sequence have flexibility in spacing provided the deletion does not
affect cis-acting signals of adjacent genes. Thus a gene deletion
can, for example, begin and end at various points within noncoding
sequence that flanks each gene, and indeed it was previously
described SH deletions involving several different beginning and
end positions (Bukreyev et al J Virol 71:8973, 1997; Karron et al
JID 191:1093-1104, 2005; Whitehead et al J Virol 73:3438-3442,
1999). The SH gene encodes a small hydrophobic surface protein
whose function is unclear, but this protein does not appear to be a
significant neutralization antigen. This cps-3 virus was readily
recovered and, in this particular preparation, replicated in cell
culture to a titer of 1.9.times.10.sup.7 PFU/ml (FIG. 5). Further
analysis showed that this virus has a T.sub.SH of 36-37.degree. C.
and exhibited a reduction in titer of 2.1 and 2.6 log 10 in the
upper and lower respiratory tract, respectively, of mice (Table
9).
[0129] The second virus in FIG. 5, 404/.DELTA.1313, combines the
.DELTA.1313 deletion with the previously-described "404" mutation
in the gene-start signal of the M2 gene (Whitehead et al, J. Virol.
247:232-239, 1998). This vaccine candidate replicated in cell
culture to a titer of 3.3.times.10.sup.6 PFU/ml in the experiment
shown in FIG. 5. Further analysis (Table 9, and data not shown)
showed that it has a T.sub.SH of 36-37.degree. C. and exhibited a
reduction in titer of >2.1 and >2.8 in the upper and lower
respiratory tract of mice.
[0130] The third virus in FIG. 5, 1321K(AAA)/.DELTA.1313, combines
the .DELTA.1313 deletion with the "stabilized" 1030 mutation
involving K(AAA) at position 1321, both of this invention. This
vaccine candidate replicated in cell culture to a titer of
1.7.times.10.sup.7 PFU/ml (FIG. 5) and had a TSH of 36.degree. C.
in the experiment shown in Table 9. This virus was subjected to an
in vitro stress test consisting of two passages at 34.degree. C.,
two passages at 35.degree. C., and two passages at 36.degree. C.,
at which point virus was barely detectable (FIG. 6). The level of
virus was insufficient for sequence analysis, but the lack of
significant replication was indicative of a lack of significant
reversion.
[0131] The fourth virus in FIG. 5, 1321G(GGT)/.DELTA.1313, combined
the .DELTA.1313 deletion with an alternative "stabilized" 1030
mutation of this invention, namely 1321G(GGT)(see Table 5 for
stress test stability data). This virus replicated in cell culture
to a titer of 1.5.times.10.sup.7 PFU/ml (FIG. 5) and had a T.sub.SH
of 35.degree. C. in the experiment shown in Table 9.
[0132] The fifth virus in FIG. 5, .DELTA.NS2/.DELTA.1313, combined
the .DELTA.1313 deletion of this invention with the previously
described .DELTA.NS2 deletion (Whitehead et al J Virol
73:3438-3442, 1999; Wright et al JID 193:573-581, 2006)). The NS2
gene encodes an NS2 protein that functions to inhibit the host
interferon response (Spann et al J Virol. 79:5353-5362, 2005). This
vaccine candidate replicated in cell culture to a titer of
1.1.times.10.sup.7 PFU/ml in the experiment shown in FIG. 5.
Further analysis (Table 9) showed that it has a T.sub.SH of
38.degree. C. and exhibited a reduction in titer of >2.1 and
>2.8 in the upper and lower respiratory tract of mice. This
virus was subjected to an in vitro stress test consisting of two
passages each at 35.degree., 36.degree., 37.degree., 38.degree.,
39.degree., and 40.degree. C. (FIG. 7). The observation that a
substantial level of replication occurred at the restrictive
temperatures, namely 38.degree., 39.degree., and 40.degree. C.,
suggested that reversion or compensatory mutations had occurred.
Indeed, sequence analysis identified a mutation I1314T in the L
protein, which thus was a potential compensatory mutation (FIG.
7).
[0133] Studies were carried out to determine whether this 1314T
mutation indeed was a compensatory mutation: in other words,
whether it reduced the ts phenotype (and accompanying attenuation
phenotype) conferred by the deletion of codon 1313. Thus, versions
of the .DELTA.1313 virus were compared that contained either the wt
isoleucine or mutant threonine at position 1314 (Table 10). In
addition, as described above, it was found that the serine at
position 1313 had frequently mutated to cysteine. Cysteine,
threonine and serine have nucleophilic properties. Thus, it was
hypothesized that phenotypic reversion is dependent on the
availability of a nucleophilic residue in this region. Therefore, a
version of .DELTA.1313 also was constructed that contained the
mutant assignment of L(CTG) at codon 1314. Leucine was chosen
because it has similar properties to those of the natural
assignment isoleucine, and it is therefore unlikely to result in a
phenotypic change. The codon CTG was selected because there is no
single nucleotide change that can result in a nucleophilic amino
acid (S, T, C). The mutations at positions 1313 and 1314 are
illustrated in FIG. 8. Also, a parallel set of mutants was made in
the .DELTA.NS2/.DELTA.1313 backbone, specifically:
.DELTA.NS2/.DELTA.1313 bearing the wt assignment of I1314, and
.DELTA.NS2/.DELTA.1313/1314T and .DELTA.NS2/.DELTA.1313/1314L(CTG)
bearing the mutant assignments of 1314T or 1314L (Table 10). The
.DELTA.NS2/.DELTA.1313/1314T and .DELTA.NS2/.DELTA.1313/1314L(CTG)
viruses were sequenced in their entirety and were to shown to be
free of adventitious mutations.
[0134] As shown in Table 10, wt RSV had a T.sub.SH of
>40.degree. C., consistent with this being a fully wt virus. The
introduction of the .DELTA.1313 mutation into this wt background
resulted in a T.sub.SH of 37.degree. C. Combination of the 1314T
mutation with .DELTA.1313 increased the T.sub.SH by 2.degree. C. A
similar observation was made when virus bearing the .DELTA.1313 and
.DELTA.NS2 deletions was compared to a version containing in
addition the 1314T mutation. In this virus, the 1314T mutation
increased the T.sub.SH by 1.degree. C. This shows that, in
combination with the attenuating .DELTA.1313 mutation, the 1314T
mutation clearly has a compensatory effect, eliminating to a large
extent the ts phenotype specified by the .DELTA.1313 deletion. The
introduction of the alternative 1314L(CTG) mutation into either the
.DELTA.1313 or .DELTA.NS2/.DELTA.1313 backbones had no effect on
the ts phenotypes of either backbone viruses (Table 10). The
.DELTA.NS2/.DELTA.1313/1314L(CTG) virus was subjected to a
temperature stress test involving 2 passages each at 36.degree.,
37.degree., 38.degree. C., and 39.degree. C. and once at 40.degree.
C. (FIG. 9). The reduction in titer for most of the cultures at the
higher temperatures indicated that the virus retained its
temperature-sensitivity. Sequence analysis of virus following the
second passage at 37.degree. C. confirmed an absence of mutations
(not shown). Importantly, this identifies the
.DELTA.NS2/.DELTA.1313/1314L(CTG) virus as an attenuated,
stabilized vaccine candidate.
[0135] In another approach, amino acid 11314 was deleted in both
the wt and .DELTA.NS2 backbones, and in additional viruses deletion
was made instead of the nearby nucleophilic amino acid T1316 or
T1320 (FIG. 8, Table 10). This was done with little expectation of
success, since deletion of a residue is a more drastic change than
a substitution and is less likely to result in a viable virus, as
is generally known and as was shown in Table 1 above.
[0136] Surprisingly, the .DELTA.1314 and .DELTA.1316 mutations
could be recovered in both viral backbones (i.e., wt and
.DELTA.NS2), but the .DELTA.1320 deletion mutant could not be
recovered in either backbone. In either backbone, the .DELTA.1316
mutations conferred a slight ts phenotype (40.degree. C. in either
backbone), while the .DELTA.1316 mutation conferred a somewhat
greater shift (36.degree. C. and 37.degree. C. in the wt and
.DELTA.NS2 backbones, respectively) (Table 10). This identified
.DELTA.1314 and .DELTA.1316 as two new codon-deletion mutations
that could be included in vaccine viruses, and identified the
.DELTA.NS2/.DELTA.1316 virus in particular as a candidate
attenuated virus.
TABLE-US-00009 TABLE 9 Temperature sensitivity and attenuation
phenotypes of new vaccine candidate viruses bearing the .DELTA.1313
deletion combined with other mutations. Replication in mice.sup.b
Titer (log.sub.10 Virus titer (PFU per mL) at indicated temperature
(.degree. C.) .sup.a PFU/g .+-. SE) Virus Exp # .sup.d 32 35 36 37
38 39 40 T.sub.SH .sup.e T.sub.SP .sup.f Exp # .sup.g rA2 (wt) 1
8.1 8.1 8.1 8.1 8.0 8.0 7.9 >40 >40 1 2 7.7 7.7 7.7 7.6 7.6
7.6 7.1 >40 >40 2 3 7.7 7.7 7.6 7.6 7.5 7.6 7.4 >40 >40
.DELTA.1313 1a.sup.h 8.3 8.0 6.6 <1 <1 <1 <1 37 36 2
1b.sup.h 8.2 7.9 6.8 <1 <1 <1 <1 37 36 Cps-3: 2 6.3 5.4
2.7 2.5 2.4 <1 <1 36 1 cp/.DELTA.SH.DELTA./1313 .sup.i 3 6.3
5.6 5.1 3.5 2.2 2.3 <1 37 36 .DELTA.NS2/.DELTA.1313 .sup.i 1 7.1
6.9 6.7 6.0 <1 <1 <1 38 37 1 404/.DELTA.1313 .sup.i 2 5.4
3.7 2.2 <1 <1 <1 <1 36 36 1 3 5.3 4.6 3.7 <1 <1
<1 <1 37 36 1321N(AAT) .sup.j 1 8.1 8.0 7.9 7.1 <1 <1
<1 38 1321N(AAT)/ 1 6.2 <1 <1 <1 <1 <1 <1 35
.DELTA.1313 1321K(AAA) 1 7.8 7.8 7.8 7.4 <1 <1 <1 38 37
1321K(AAA)/ 1 7.4 5.8 <1 <1 <1 <1 <1 36 35
.DELTA.1313 .sup.i 1321G(GGT) 1 7.8 7.7 7.7 7.5 <1 <1 <1
38 1321G(GGT)/ 1 7.2 <1 <1 <1 <1 <1 <1 35
.DELTA.1313 .sup.i Replication in mice.sup.b Mean log.sub.10
reduction.sup.c Titer (log.sub.10 PFU/g .+-. SE) Nasal Virus Exp #
.sup.d Nasal turbinates Lung turbinates Lung rA2 (wt) 1 4.0 .+-.
0.1 (10/10) 4.5 .+-. 0.0 (10/10) 2 4.2 .+-. 0.1 (5/5) 4.6 .+-. 0.1
(5/5) 3 .DELTA.1313 1a.sup.h 2.5 .+-. 0.2 (8/10) 2.4 .+-. 0.1
(10/10) 1.7 2.2 1b.sup.h Cps-3: 2 1.9 .+-. 0.0 (1/5) 1.9 .+-. 0.1
(4/5) 2.1 2.6 cp/.DELTA.SH.DELTA./1313 .sup.i 3
.DELTA.NS2/.DELTA.1313 .sup.i 1 .ltoreq.1.9 (0/5) .ltoreq.1.7 (0/5)
>2.1 >2.8 404/.DELTA.1313 .sup.i 2 .ltoreq.1.9 (0/5)
.ltoreq.1.7 (0/5) >2.1 >2.8 3 1321N(AAT) .sup.j 1 .sup. nd
.sup.1 nd 1321N(AAT)/ 1 nd nd .DELTA.1313 1321K(AAA) 1 nd nd
1321K(AAA)/ 1 nd nd .DELTA.1313 .sup.i 1321G(GGT) 1 nd nd
1321G(GGT)/ 1 nd nd .DELTA.1313 .sup.i .sup.a The ts phenotype for
each virus was evaluated by plaque assay on HEp-2 cells at the
indicated temperatures. For viruses with a ts phenotype, the
shut-off temperatures are marked (underlined). See footnote e for
definition of shut-off temperature. .sup.b5-week-old mice in groups
of five (or ten for wt rA2) in were inoculated intranasally with
10.sup.6 PFU of the indicated virus. Nasal turbinates and lungs
were harvested on day 4, and virus titers were determined by plaque
assay. The limit of detection is 1.9 log.sub.10 PFU per g for nasal
turbinates, and 1.7 log.sub.10 PFU per g for lungs; SE: Standard
error. Values in parentheses are: (number shedding/number
infected). .sup.cReduction in mean titer compared to the wt virus
(rA2 (wt)) of the same experiment. .sup.d Shut off temperature
experiment number. .sup.e Shut off temperature (T.sub.SH,
underlined) is defined as the lowest restrictive temperature at
which the reduction compared to 32.degree. C. is 100-fold or
greater than that observed for wt RSV at the two temperatures. The
ts phenotype is defined as having a shut off temperature of
40.degree. C. or less. .sup.f T.sub.SP, Small plaque temperature is
defined as the lowest restrictive temperature at which the
small-plaque phenotype is observed. .sup.g Mouse study experiment
number. .sup.hTwo independent dilution series in the same
experiment. .sup.i Schematic representation shown in FIG. 5. .sup.j
N(AAT) is the original 1030 mutation, included for comparison. Note
that all of the mutants in this Table were constructed in the
recombinant wt RSV 6120 backbone (see the Description of FIG. 2 for
an explanation). .sup.k nd, not determined in this study.
TABLE-US-00010 TABLE 10 Analysis of the temperature sensitivity
phenotypes of the .DELTA.1313 virus and .DELTA.NS2/.DELTA.1313
virus, each bearing amino acid substitutions or deletions involving
L protein amino acid residues 1314, 1316, and 1320 Virus titer (PFU
per mL) at indicated temperature (.degree. C.) .sup.a Virus 32 35
36 37 38 39 40 T.sub.SH .sup.b .DELTA. T.sub.SH.sup.c T.sub.SP
.sup.d Assayed on HEp-2 cells: wt rA2 7.7 7.7 7.7 7.8 7.7 7.7 7.6
>40 .DELTA.1313 7.8 7.6 6.7 <1 <1 <1 <1 37 35
.DELTA.1313/1314T 7.6 7.4 7.6 7.4 6.7 <1 <1 39 +2 37
.DELTA.1313/1314L(CTG) 7.0 6.7 6.2 <1 <1 <1 <1 37 36
.DELTA.1314 6.9 7.0 7.0 6.9 6.7 5.4 <1 40 38 .DELTA.1316 5.8 4.6
<1 <1 <1 <1 <1 36 Assayed on Vero cells: wt rA2 8.0
8.0 7.9 7.9 7.8 7.6 7.5 >40 .DELTA.NS2/.DELTA.1313 7.1 6.9 6.6
6.3 5.1 <1 <1 39 32 .DELTA.NS2/.DELTA.1313/1314T 7.1 7.1 7.0
6.9 6.7 5.9 4.1 40 +1 32 .DELTA.NS2/.DELTA.1313/1314L(CTG) 7.5 7.3
7.0 6.7 5.7 1.7 <1 39 37 .DELTA.NS2/.DELTA.1314 6.4 6.5 6.4 6.3
6.0 5.7 4.4 40 32 .DELTA.NS2/.DELTA.1316 6.8 6.1 5.4 3.7 1.7 <1
<1 37 32 .sup.a The ts phenotype for each virus was evaluated by
plaque assay on HEp-2 cells (top) or Vero cells (bottom) at the
indicated temperatures. Vero cells were used for the .DELTA.NS2
viruses because loss of expression of NS2 renders RSV more
sensitive to type I interferon, which is not made by Vero cells.
Note that all of the mutants in this Table were constructed in the
recombinant wt RSV 6120 backbone (see the Description of FIG. 2 for
an explanation). .sup.b Shut off temperature (T.sub.SH, underlined)
is defined as the lowest restrictive temperature at which the
reduction compared to 32.degree. C. is 100-fold or greater than
that observed for wt RSV at the two temperatures. The ts phenotype
is defined as having a shut off temperature of 40.degree. C. or
less. .sup.c.DELTA.T.sub.SH, Difference (.degree. C.) in shutoff
temperature between a specific .DELTA.1313 or
.DELTA.NS2/.DELTA.1313 mutant with original I1314 assignment and
same .DELTA.1313 or .DELTA.NS2/.DELTA.1313 mutant with the added
1314T mutation. .sup.d T.sub.SP, Small plaque temperature is
defined as the lowest restrictive temperature at which the
small-plaque phenotype is observed. Temperatures at which small
plaques were observed are in bold.
EXAMPLE 8
Additional New Attenuated Viruses Designed with Stabilized
Mutations
[0137] As already noted, an RSV vaccine candidate called
rA2cp248/404/1030.DELTA.SH ("cp248/404/1030.DELTA.SH version 1")
was previously designed by reverse genetics and evaluated in
RSV-naive young infants (Karron et al JID 191:1093-1104, 2005).
This vaccine virus was well tolerated and was moderately
immunogenic in young infants, and was protective against a second
vaccine dose (Karron et al JID 191:1093-1104, 2005). However, in
this previous study, analysis of vaccine virus that was shed from
vaccinees provided evidence of revertant and mutant virus in
one-third of the nasal wash samples. Reversion and mutation
involved either the "248" or "1030" mutation, with the incidence
being more frequent with the "1030" mutation (Karron et al JID
191:1093-1104, 2005). A second version of the
rA2cp248/404/1030.DELTA.SH ("cp248/404/1030.DELTA.SH version 2")
cDNA also had been constructed, and virus recovered from this
second version is presently being evaluated in clinical studies
(ClinicalTrials.gov Identifier NCT00767416). Both versions
contained the cp, 248, 404, 1030, and .DELTA.SH mutations, and no
differences have been identified between the two versions with
regard to virus replication, is and attenuation phenotypes, or
other biological properties. The two versions differed by multiple
point mutations throughout the genome that mostly are silent at the
amino acid level and are considered inconsequential. These include
differences due to naturally occurring variability in wt virus and
in some cases due to the presence or absence of added restriction
sites or sequence tags. As another difference, the "248" mutation
(Q831L) is specified by the codon TTA in cp248/404/1030.DELTA.SH
version 2 and CTG in cp248/404/1030.DELTA.SH version 1. Both of
these codons readily reverted during an in vitro temperature stress
test (Luongo et al Vaccine 27:5667-5676, 2009). Based on available
data, the two versions of rA2cp248/404/1030.DELTA.SH appear to have
similar properties of growth, temperature sensitivity, and
attenuation.
[0138] Using the information of this invention, a derivative of
cp248/404/1030.DELTA.SH version 2 was constructed in which the
"1030" mutation involving 1321N(AAT) was replaced by 1321K(AAA),
and the potential second site mutation site S1313(AGC) was replaced
by S1313(TCA): this virus is designated cps-1 in FIG. 10 and Table
11. A derivative of cp248/404/1030.DELTA.SH version 2 also was
constructed in which the "248" mutation 831L(TTA) was replaced by
the codon 831L(TTG), which had been previously shown to confer
increased stability (Luongo et al Vaccine 27, 5667-5676, 2009);
this virus is called cps-4 in FIG. 10 and Table 11. In addition, a
derivative of cp248/404/1030.DELTA.SH version 2 containing
1321K(AAA), S1313(TCA), and 831L(TTG), was constructed, which is
called cps-2 and is represented in FIG. 10 and Table 11. Each of
these viruses was readily recovered and readily replicated to
titers in excess of 10.sup.7 plaque forming units per ml, as
summarized in FIG. 10. Also, each of these maintained a is
phenotype, with a shut-off temperature of 35-36.degree. C. (FIG. 10
and Table 11). Each of these maintained an attenuation phenotype in
mice (Table 11). These represent additional improved vaccine
candidates, and illustrate the potential for making yet additional
new combinations.
[0139] To directly evaluate the possibility of increased genetic
stability of the cps-2 virus, it was subjected to an in vitro
stress test in parallel with the cp248/404/1030.DELTA.SH version 1
virus from the study of Karron et al (Karron et al JID
191:1093-1104, 2005), which had exhibited genetic instability. The
two viruses were each passaged in ten parallel cultures for two
passages each at 33.degree., 34.degree., 35.degree., 36.degree.,
and 37.degree. C. Note that for these viruses, temperatures of
36.degree. C. and higher are restrictive. Following the final
passage, the genome regions containing the 248 and 1030 mutations
were subjected to sequence analysis (Table 12). This analysis
showed that the 248 mutation (L protein mutation 831L) sustained
mutations in each virus, reverting to the wt assignment of
glutamine in 9 out of 10 cultures in the case of the
cp248/404/1030.DELTA.SH version 1 virus and changing to serine in 6
out of 10 cultures in the case of cps-2. It was not surprising to
find reversion at this position in both viruses, since it was
previously shown that the 248 mutation could not be strongly
stabilized (Luongo et al Vaccine 27:5667-5676), and since the
stress test involved four passages at restrictive temperatures.
Overall, the frequency of reversion at the 248 site was 90% with
the cp248/404/1030.DELTA.SH version 1 virus and 60% with cps-2.
With regard to the "1030" mutation (L protein amino acid position
1321), the sequence analysis showed that this mutation in the
original cp248/404/1030/.DELTA.SH virus (i.e., not stabilized)
completely reverted to the wt assignment of tyrosine, while nine of
the ten cultures of cps-2 at the restrictive temperatures retained
the attenuating assignment of lysine. In the remaining culture, 30%
of the culture appeared to have the assignment of arginine.
However, virus containing arginine at this position was shown to be
nonviable (Table 2). Thus, it may be that this mutant virus was
able to replicate in the stress test because this in vitro
infection occurred at relatively high MOI, conditions under which
it is known that a defective virus can be replicated due to
complementation by co-infecting functional virus. Thus, the virus
with arginine at this position likely is defective and would not be
pathogenic. The assignment at position 1313 at cps-2 also was
confirmed to be completely stable during passage, and no other
adventitious mutations were observed. In conclusion, therefore,
these data showed that (i) the 248 mutation was moderately
stabilized, with a reduced frequency of detection of revertants,
and (ii) the 1030 mutation was completely stabilized against the
generation of viable revertants by the alternative amino acids
identified in this invention. This is particularly significant
because the 1030 mutation exhibited a several-fold higher level of
reversion in the previous clinical trial (Karron et al JID
191:1093-1104, 2005), and thus this invention has succeeded in
providing a version of this virus with substantially increased
genetic stability.
TABLE-US-00011 TABLE 11 Temperature sensitivity and attenuation
phenotypes of the previously evaluated vaccine candidate
cp248/404/1030.DELTA.SH (version 1) and derivatives containing
alternative codons at the "1030" and "248" loci Replication in
mice.sup.b Titer (log.sub.10 PFU/g .+-. SE) Mean log.sub.10
reduction.sup.c Virus titer (PFU per mL) at indicated temperature
(.degree. C.) .sup.a Nasal Nasal Virus Repl .sup.d 32 35 36 37 38
39 40 T.sub.SH .sup.e T.sub.SP .sup.f turbinates Lung turbinates
Lung rA2 (wt) A 7.7 7.7 7.7 7.6 7.6 7.6 7.1 >40 >40 4.0 .+-.
0.1 (10/10) 4.5 .+-. 0.0 (10/10) B 7.7 7.7 7.6 7.6 7.5 7.6 7.4
>40 >40 cp248/404/ A 6.7 6.3 4.7 3.4 2.0 <1 <1 36 35
.ltoreq.1.9 (0/10) .ltoreq.1.7 (0/10) >2.1 >2.8 1030.DELTA.SH
(version 1).sup.g,h cps-1.sup.h A 6.0 4.3 <1 <1 <1 <1
<1 36 35 .ltoreq.1.9 (0/5) .ltoreq.1.7 (0/5) >2.1 >2.8 B
5.9 5.3 3.7 2.2 <1 <1 <1 36 35 cps-4.sup.h A 6.2 3.4 2.0
<1 <1 <1 <1 35 36 .ltoreq.1.9 (0/5) .ltoreq.1.7 (0/5)
>2.1 >2.8 B 6.2 5.2 3.4 <1 <1 <1 <1 36 35
cps-2.sup.h A 5.8 4.0 <1 <1 <1 <1 <1 36 35
.ltoreq.1.9 (0/5) .ltoreq.1.7 (0/5) >2.1 >2.8 B 5.7 5.1 3.7
<1 <1 <1 <1 36 36 .sup.a The ts phenotype for each
virus was evaluated by plaque assay on HEp-2 cells at the indicated
temperatures. For viruses with the ts phenotype, the shut-off
temperatures are are marked (bold, underlined). See footnote e for
the definition of shut-off temperature. .sup.b5-week-old mice in
groups of five (or ten for wt rA2 and cps5) were inoculated
intranasally with 10.sup.6 PFU of the indicated virus. Nasal
turbinates and lungs were harvested on day 4, and virus titers were
determined by plaque assay. The limit of detection is 1.9
log.sub.10 PFU per g for nasal turbinates, and 1.7 log.sub.10 PFU
per g for lungs; SE: Standard error. The data on replication in
mice were from the same experiment. .sup.cReduction in mean titer
compared to the wt virus (rA2 (wt)) of the same experiment. .sup.d
A and B represent duplicate dilution series of the same virus that
were examined in parallel in the same experiment. Differences
between these replicas (Repl) illustrate the variability that is
inherent in these biological experiments. .sup.e Shut off
temperature (T.sub.SH, bold, underlined) is defined as the lowest
restrictive temperature at which the reduction compared to
32.degree. C. is 100-fold or greater than that observed for wt RSV
at the two temperatures. The ts phenotype is defined as having a
shut off temperature of 40.degree. C or less. .sup.f T.sub.SP,
Small plaque temperature is defined as the lowest restrictive
temperature at which the small-plaque phenotype is observed.
.sup.gAs noted in the text and the legend to FIG. 10, two
cp248/404/1030.DELTA.SH cDNAs have been constructed that share the
same attenuating mutations (although they differ in the codon of
the "248" mutation 831L) and differ by a number of incidental
mutations. The virus used here is version 1 that had previously
been analyzed in clinical studies by Karron et al (Karron et al JID
191: 1093-1104, 2005). The other mutants in this Table were
constructed in the cp248/404/1030.DELTA.SH version 2 backbone.
.sup.hSee FIG. 10 for a diagram of the viral genome, although the
version of cp248/404/1030.DELTA.SH that is shown in FIG. 10 is
version 2 and thus has CTG rather than TTA as the codon for
mutation 831L.
TABLE-US-00012 TABLE 12 Stability of L protein codons 831 and 1321
in cp248/404/1030/.DELTA.SH (version 1) and cps-2 during passage at
restrictive temperatures.sup.a Codon 831L Codon 1321 Reversion
Reversion Original codon (Estimated Original Codon rate % cultures
present in virus Revertant average % of present in virus Revertant
(Estimated with codon Amino codon Amino population .+-. Amino Codon
Amino average % of Virus revertants.sup.b Codon acid observed.sup.c
Acid.sup.d SD) .sup.e Codon acid observed.sup.c acid.sup.d
population) .sup.e cp248/404/ 70 CTG L C[T/A]G L:Q 47 .+-. 15 AAT N
[A/T]AT Y 64 .+-. 22 1030.DELTA.SH 10 CAG Q 100 [A/T]AT Y 10
(version 1) .sup.f 10 CAG Q 100 0 10 0 TAT Y 100 cps-2 40 TTG L TCG
S 100 AAA .sup. K.sup.g 0 10 TCG S 100 A[A/G]A .sup. R.sup.h 30 10
T[T/C]G L:S 70 0 .sup.aTen replicate 25 cm.sup.2 flasks of HEp-2
cells were infected with the indicated virus at an MOI of 0.1
PFU/cell at 33.degree. C. Virus was harvested between 5 and 7 days
post-infection, serially passaged again at 33.degree. C., and
serially passaged twice at 34.degree. C., 35.degree. C., 36.degree.
C., and 37.degree. C., for a total of ten passages, each by
transferring 1 ml (out of a total of 5 ml) of supernatant to a
fresh 25 cm.sup.2 flask of HEp-2 cells. In parallel, two control
flasks per mutant were passaged ten times at the permissive
temperature of 32.degree. C. For each passage, aliquots were frozen
for titration and genotype analysis. Genotype analysis was done
after the 10th passage from a 2921 bp PCR fragment of the RSV
genome (nt 12271-15191; Genbank accession number M74568) which was
partially sequenced. No mutations were detected in the 32.degree.
C. controls (not shown). .sup.b% of cultures with detectable
revertants. .sup.cObserved codon sequence: mixtures are indicated
in bracket. Nt changes are underlined. .sup.dAmino acid coding:
Colon indicates a mixed population of the specified amino acids.
Amino acid changes are underlined. .sup.e In cultures with mixed
populations, % of subpopulations with reversions were estimated
from sequencing chromatograms. Averages and standard deviation SD
from cultures with mixed populations are shown. .sup.f As noted in
the text, two mutant cp248/404/1030.DELTA.SH cDNAs have been
constructed that share the same attenuating mutations (except for a
silent codon difference at the "248" mutation, as noted elsewhere)
and differ by a number of incidental mutations. The virus used here
is version 1 that had previously been analyzed in clinical studies
by Karron et al (Karron et al JID 191: 1093-1104, 2005). .sup.gThe
stabilized codon 1321K (AAA) was used together with codon
S1313(TCA); this latter site was completely stable (not shown).
.sup.hThis assignment yields non-viable virus, as shown in Table 2,
and its presence here presumably depends on complementation by
non-defective virus during this in vitro infection.
EXAMPLE 9
Viable Deletion Mutants in the Vicinity of Amino Acid Position
1754
[0140] Despite the poor success rate in recovering RSV bearing
codon deletions, an attempt was made to design another deletion
mutation. In this case, deletion was made of codon 1754 (encoding a
serine residue) in the RSV L protein (FIG. 11). Surprisingly, this
mutant RSV (1754.DELTA.S) was able to be recovered (Table 13).
Further analysis showed that this mutant was not significantly
inhibited in plaque formation at elevated temperatures, but had a
small plaque phenotype at 38.degree. C. or higher (Table 13). Also,
the replication of the .DELTA.1754 virus in mice was somewhat
reduced, although the reduction was not significant compared to wt
virus (Table 13).
[0141] Attempts were then made to recover additional mutations in
this region, including single-amino acid mutations (1756.DELTA.A),
or bearing a deletion of two contiguous amino acids (1753.DELTA.KS,
1754.DELTA.SS, 1755.DELTA.SA, see Table 13, footnote d for
nomenclature), or four contiguous amino acids (1753.DELTA.KSSA,
1754.DELTA.SSAM), or between six and 21 contiguous amino acids
(1752.DELTA.6aa, 1749.DELTA.9aa, 1752.DELTA.13aa, 1744.DELTA.14aa,
and 1744.DELTA.21aa, FIG. 11 and Table 13). Analysis of the viruses
in a ts assay showed that none of these was ts with regard to
plaque reduction, but that nine of the twelve mutants had reduced
plaque sizes at temperatures ranging from 37.degree. C. to
40.degree. C. (indicated in bold in Table 13). When evaluated for
replication in the upper and lower respiratory tract of mice, all
of the mutants replicated to titers that were lower than those of
wt RSV, and for seven of the viruses the reduction compared to wt
RSV was significant. Thus, this series of mutations provides a
range of values with regard to the magnitude of attenuation, and
the level of attenuation of a recombinant RSV vaccine can thus be
adjusted by inclusion of a mutation in this region with a lesser or
greater attenuating effect, as desired.
TABLE-US-00013 TABLE 13 Temperature sensitivity and attenuation
phenotypes of RSV bearing short amino acid deletions in the
vicinity of amino acid sequence positions 1744-1764 in the L
protein Replication in mice.sup.b Mean log.sub.10 Titer (log.sub.10
PFU/g .+-. SE) reduction.sup.c Virus titer (PFU per mL) at
indicated temperature (.degree. C.) .sup.a Nasal Nasal Virus.sup.d
32 35 36 37 38 39 40 T.sub.SH .sup.e T.sub.SP .sup.f turbinates
Lung turbinates Lung Wt 8.2 8.1 8.1 8.2 8.1 8.0 7.8 >40 >40
3.4 .+-. 01 3.4 .+-. 0.1 1754.DELTA.S 7.2 7.3 7.3 7.2 7.3 7.0 6.9
>40 38 2.2 .+-. 0.3 3.2 .+-. 0.2 1.2 0.2 1756.DELTA.A 7.5 7.3
7.5 7.5 7.3 7.4 7.2 >40 39 2.6 .+-. 0.2 3.3 .+-. 0.2 0.7 0.1
1753.DELTA.KS 6.5 6.6 6.6 6.5 6.4 6.2 6.0 >40 39 1.9 .+-.
0.2***.sup.g 2.5 .+-. 0.5 1.5 0.9 1754.DELTA.SS 6.2 6.3 6.2 6.3 5.9
5.8 5.3 >40 37 .sup. 2.0 .+-. 0.3**.sup.g 2.9 .+-. 0.1 1.4 0.5
1755.DELTA.SA 6.4 6.2 6.2 6.1 6.1 6.0 5.6 >40 39 .sup. 1.9 .+-.
0.2**.sup.g .sup. 2.7 .+-. 0.2*.sup.g 1.5 0.7 1753.DELTA.KSSA 6.8
6.9 6.7 6.7 6.7 6.6 6.3 >40 39 2.5 .+-. 0.2 3.3 .+-. 0.1 0.9 0.1
1754.DELTA.SSAM 6.4 6.2 6.2 6.2 5.9 5.7 5.1 >40 37 1.5 .+-.
0.3***.sup.g 3.2 .+-. 0.2 1.9 0.2 1752.DELTA.6aa 6.6 6.6 6.6 6.7
6.6 6.4 6.2 >40 39 2.4 .+-. 0.1 3.0 .+-. 0.1 1.0 0.4
1749.DELTA.9aa 7.7 7.6 7.6 7.6 7.6 7.5 7.3 >40 >40 .sup. 2.0
.+-. 0.3**.sup.g 3.4 .+-. 0.2 1.4 1752.DELTA.13aa 6.9 6.8 6.9 6.7
6.7 6.5 6.2 >40 >40 .sup. 1.6 .+-. 0.4**.sup.g .sup. 2.5 .+-.
0.1**.sup.g 1.8 0.9 1744.DELTA.14aa 7.4 7.5 7.4 7.5 7.3 7.3 7.1
>40 >40 2.6 .+-. 0.1 3.2 .+-. 0.1 0.8 0.2 1744.DELTA.21aa 6.7
6.7 6.7 6.7 6.6 6.4 6.3 >40 39 1.7 .+-. 0.3***.sup.g 2.0 .+-.
0.3***.sup.g 1.7 1.4 .sup.a The ts phenotype for each virus was
evaluated by plaque assay on HEp-2 cells at the indicated
temperatures. .sup.b10-week-old mice in groups of five were
inoculated intranasally with 10.sup.6 PFU of the indicated virus.
Nasal turbinates and lungs were harvested on day 4, and virus
titers were determined by plaque assay. The limit of detection is 2
log.sub.10 PFU per g for nasal turbinates, and 1.7 log.sub.10 PFU
per g for lungs; SE: Standard error. .sup.cReduction in mean titer
compared to the wt virus (rA2) of the same experiment.
.sup.dViruses are named by the amino acid residue in the L protein
that was deleted. Viruses that involve deletion of 2-4 residues are
named using the L protein amino acid position of the first residue
that is deleted, followed by the .DELTA. symbol, followed by the
specific continguous residues that were deleted (e.g.,
1754.DELTA.SSAM involves deletion of residues 1754-1757, which have
the identities SSAM). For deletions larger than 4 residues, the
number of contiguous deleted residues is indicated (e.g.,
1752.DELTA.13aa involves a deletion of 13 residues beginning with
1752 and ending 1764). All of the mutants in this Table were
constructed in the recombinant wt RSV 6120 backbone (see the
Description of FIG. 2 for an explanation). .sup.e Shut off
temperature (T.sub.SH) is defined as the lowest restrictive
temperature at which the reduction compared to 32.degree. C. is
100-fold or greater than that observed for wt RSV at the two
temperatures. The ts phenotype is defined as having a shut off
temperature of 40.degree. C. or less. None of these viruses were
ts. .sup.f T.sub.SP, Small plaque temperature is defined as the
lowest restrictive temperature at which the small-plaque phenotype
was observed. Temperatures giving small plaques are indicated in
bold. .sup.gStatistically significant difference compared to the wt
control virus (one way ANOVA, Kruskal-Wallis test with Dunn's
post-hoc test, ***P .ltoreq. 0.001, *P .ltoreq. 0.001
underlined).
EXAMPLE 10
Evaluation of the Attenuation Phenotypes of New Vaccine Candidates
in Experimental Animals
[0142] The level of attenuation is a critical parameter for a
vaccine. In the case of RSV, it is generally recognized that the
level of disease or reactogenicity is related to the level of viral
replication (Collins and Melero Virus Res 2011, 162:80-99). It was
therefore sought to evaluate the level of replication in
experimental animals of selected vaccine candidates bearing
deletion mutations of this invention. As noted, the mouse model is
commonly used to evaluate the replication of RSV variants. However,
preliminary studies indicated that the cp248/404/1030.DELTA.SH
version 2 virus replicated sporadically and at very low levels in
mice due to its high level of attenuation (data not shown). This
was true even in mice with genetic immunodeficiencies, including
SCID (severe combined immunodeficiency), SCID beige, and nude mice
(not shown). In these immunodeficient strains, wt RSV replicates to
a higher level and for a longer period of time compared to
non-immunodeficient mice (results not shown, and Zhou et al. Med.
Microbiol. Immunol., 2008 197:345-51), and it was hoped that this
increased permissiveness in the immunodeficient strains would
provide a higher degree of sensitivity to highly attenuated
viruses. However, this was not the case.
[0143] Therefore, selected viruses were evaluated in juvenile
chimpanzees, which among experimental animals evaluated to date is
the most permissive for RSV replication and which has the same body
temperature as humans, which is critical for evaluation of viruses
with a temperature-sensitive phenotype. It was confirmed that the
animals were RSV-seronegative (except for one animal, A9A011, as
noted below). Animals were infected by combined intranasal and
intratracheal inoculations of 10.sup.6 PFU per site, and virus
shedding in the respiratory tract was evaluated by taking nasal
washes daily for 12 days post-infection, bronchioalveolar lavages
(BAL) on days 2, 4, 6, and 8, and tracheal lavages on day 10 and
12. Virus titers were determined by plaque assay on Vero cells at
32.degree. C. There were two or three animals in each group,
depending on the virus (Tables 14 and 15): unfortunately, one
drawback of the chimpanzee model is the limited number of available
animals. Three viruses were evaluated: cp248/404/1030.DELTA.SH
version 2 (which served as a comparator, since
cp248/404/1030.DELTA.SH version 1 was well-tolerated in 1- to
2-month old infants, Karron et al, JID 191:1093-1104, 2005), cps2
(i.e., a virus with a complement of mutations similar to those of
cp248/404/1030.DELTA.SH version 2, but with the1030 mutation in
particular designed for increased stability by the methods of this
invention, see FIGS. 10), and .DELTA.NS2/.DELTA.1313/1314L(CTG)
(which also contains stabilized mutations of this invention, see
FIG. 9). The nasal wash data are presented in Table 14, and the BAL
and tracheal lavage data are presented in Table 15. This showed
that cp248/404/1030.DELTA.SH version 2 replicated at a low level
over 8-9 days, with virus being detected primarily in the nasal
washes. This is consistent with cp248/404/1030.DELTA.SH version 2
being a highly attenuated virus, based on our previous analysis of
multiple viruses in the chimpanzee model (Whitehead et al J Virol
1998, 72:4467-4471; Whitehead et al J Virol 1999, 73:3438-3442;
Teng et al J Virol 2000, 74:9317-9321). Importantly, the cps-2 and
.DELTA.NS2/.DELTA.1313/1324L viruses also were highly attenuated,
comparable to cp248/404/1030.DELTA.SH version 2. Note that one of
the three animals (animal A9A011) in the group inoculated with the
last virus was found to have pre-existing antibodies to RSV, and no
vaccine virus shedding was observed, presumably due to inhibition.
This animal was excluded from analysis. Importantly, these findings
indicate that the cps-2 and .DELTA.NS2/.DELTA.1313/1324L viruses
are suitable to be manufactured as clinical trial material for
evaluation as candidate RSV vaccines.
TABLE-US-00014 TABLE 14 Viral Titers of Nasal Wash Samples from
Chimpanzees Inoculated with the RSV Vaccine Candidates
cp248/404/1030.DELTA.SH version 2 (abbreviated as "Version 2"),
cps-2, or .DELTA.NS2/.DELTA.1313/1314L .sup.a RSV Peak Sum of
Vaccine Chimp NW virus titer (log.sub.10PFU/mL) on indicated
days.sup.b Duration of virus daily candidate ID 1 2 3 4 5 6 7 8 9
10 12 Shedding.sup.c titer titers .sup.d Version A8A007 -- 1.5 --
1.8 -- 1.8 1.8 2.6 1.5 1.0 -- 9 2.6 15.5 2 A8A008 -- 1.9 1.9 2.4
2.7 2.8 2.6 2.9 2.4 -- -- 8 2.9 22.5 Mean: 8.5 2.7 19.0 cps-2
A8A009 -- 1.0 2.3 -- -- 2.2 2.0 2.8 2.3 1.0 -- 9 2.8 17.2 A9A002 --
-- 1.5 2.2 3.3 2.8 3.3 3.3 1.7 1.5 -- 8 3.3 22.4 4X0533 -- -- 1.0
2.2 3.7 2.4 4.6 2.6 1.6 1.0 -- 8 4.6 21.9 Mean: 8.3 3.6 20.5
.DELTA.NS2/ A5A006 -- 1.0 1.0 2.3 2.0 1.8 2.0 1.8 -- -- -- 1 2.3
15.3 .DELTA.1313/ A6A014 -- -- -- 1.0 1.9 1.3 1.7 2.0 -- -- -- 5
2.0 12.8 1314L A9A011.sup.e -- -- -- -- -- -- -- -- -- -- -- [0]
[1.0] [8.7] Mean: 6.0 2.1 14.1 .sup.a Chimpanzees were inoculated
by the combined intranasal and intratracheal routes with 10.sup.6
PFU of the indicated virus in a 1 mL inoculum per site (total dose
= 2 .times. 10.sup.6 PFU per animal). .sup.bNasal wash was
performed with 3 mL of Lactated Ringer's solution per nostril.
Virus titrations were performed on Vero cells at 32.degree. C. The
lower limit of detection was 1.0 log.sub.10 PFU/mL of nasal wash
solution. Samples with no detectable virus are represented as "--".
Peak titers for each animal are underlined. .sup.cThe period of
days from the first to the last day on which virus was detected,
including negative days (if any) in between. .sup.d The sum of
daily titers is used as an estimate for the magnitude of shedding
(area under the curve). A value of 0.7 was used for samples with no
detectable virus. .sup.eChimpanzee A9A011 had a pre-existing low
RSV neutralizing antibody titer. Results from this animal were not
used for calculations of mean values.
TABLE-US-00015 TABLE 15 Viral Titers of Bronchoalveolar and
Tracheal Lavage Samples from Chimpanzees Inoculated with the RSV
Vaccine Candidates cp248/404/1030.DELTA.SH version 2 (abbreviated
as "Version 2"), cps-2, or .DELTA.NS2/.DELTA.1313/1314L .sup.a
Bronchoalveolar/Tracheal Lavage Sum RSV virus titer
(log.sub.10PFU/mL) on indicated Peak of Vaccine Chimp days.sup.b
Duration of virus daily candidate ID 2 4 6 8 10 12 Shedding.sup.c
titer titers .sup.d Version A8A007 2.7 -- -- -- -- -- 1 2.7 6.2 2
A8A008 -- -- -- -- -- -- 0 1.0 4.2 Mean: 0.5 1.8 5.2 cps-2 A8A009
-- -- -- -- -- -- 0 1.0 4.2 A9A002 -- 1.9 3.7 -- -- -- 3 3.7 8.4
4X0533 -- 1.0 -- 1.6 -- -- 5 1.6 5.4 Mean: 4.0 2.1 6.0 .DELTA.NS2/
A5A006 1.8 2.9 2.3 -- -- -- 5 2.9 9.1 .DELTA.1313/ A6A014 1.7 3.3
2.9 2.8 -- -- 7 3.3 12.1 1314L A9A011.sup.e -- -- -- -- -- -- [0]
[1.0] [4.2] Mean: 6.0 3.1 10.6 .sup.a Chimpanzees were inoculated
by the combined intranasal and intratracheal routes with 10.sup.6
PFU of the indicated virus in a 1 mL inoculum per site (total dose
= 2 .times. 10.sup.6 PFU per animal). .sup.bOn days 2, 4, 6, and 8,
bronchoalveolar lavage was performed with 6 mL of PBS; on days 10
and 12, tracheal lavage was done using 3 mL of PBS per animal.
Virus titrations were performed on Vero cells at 32.degree. C. The
lower limit of detection was 1.0 log.sub.10 PFU/mL of lavage
solution. Samples with no detectable virus are represented as "--".
Peak titers for each animal are underlined. .sup.c The period of
days from the first to the last day on which virus was detected,
including negative days (if any) in between. .sup.d The sum of
daily titers is used as an estimate for the magnitude of shedding
(area under the curve). A value of 0.7 was used for samples with no
detectable virus. .sup.eChimpanzee A9A011 had a pre-existing low
RSV neutralizing antibody titer. Results from this animal were not
used for calculations of mean values.
General Methods
[0144] The following methods were used in the experiments described
in the prior examples unless otherwise specified. These methods, in
some cases, describe only one of a variety of ways by which
experiments similar to those described above could be carried out,
such alternative methods would be apparent to those of ordinary
skill in the art.
[0145] Cells. HEp-2 cells (ATCC CCL23) were maintained in Opti-MEM
I (Gibco-Invitrogen, Carlsbad, Calif.) supplemented with 5% fetal
bovine serum (FBS) (HyClone, Logan, Utah) and 1 mM L-glutamine
(Gibco-Invitrogen). BSR T7/5 cells are baby hamster kidney 21
(BHK-21) cells that constitutively express T7 RNA polymerase
(Buchholz, et al., J. Virol 73:251-9 (1999)). These cells are
maintained in Glasgow minimal essential medium (GMEM)
(Gibco-Invitrogen) supplemented with 2 mM L-glutamine, 2% MEM amino
acids (Gibco-Invitrogen), and 10% FBS. Every other passage, the
media was supplemented with 2% geneticin (Gibco-Invitrogen) to
select for cells that retain the T7 polymerase construct.
[0146] Virus growth and titration. RSV strains were propagated in
HEp-2 cells at 32.degree. C. in media containing 2% FBS, 250
Units/mL of penicillin and 250 .mu.g/mL of streptomycin
(Gibco-Invitrogen). Virus stocks were generated by scraping
infected cells into media followed by three rounds of
freeze-thawing of cell pellets or by vortexing, clarification of
the supernatant by centrifugation, and addition of 10.times. SPG
(2.18 M sucrose, 0.038 M KH.sub.2PO.sub.4, 0.072 M
K.sub.2HPO.sub.4, 0.06 M L-glutamine at pH 7.1) to a final
concentration of 1.times.. Virus aliquots were snap frozen and
stored at -80.degree. C. Virus titers were determined by plaque
assay on HEp-2 or Vero cells under 0.8% methylcellulose overlay.
After 5-day incubation at 32.degree. C., plates were fixed with 80%
cold methanol, and plaques were visualized by immunostaining with a
cocktail of three HRSV specific monoclonal antibodies (Murphy, et
al., Vaccine 8:497-502 (1990)).
[0147] Construction of recombinant RSV mutants. The recombinant RSV
mutants were constructed using a reverse genetics system based on
strain A2 (Collins, P. L., et al., Proc Natl Acad Sci U S A
92:11563-7 (1995)). The full-length RSV antigenome cDNA was
modified previously by deleting a 112-nt region from the downstream
noncoding region of the SH gene and silently modifying the last few
codons of the SH open reading frame (ORF), resulting in antigenome
cDNA D46/6120. These changes were made to improve stability of the
cDNA during growth in E. coli and had no effect on the efficiency
of virus replication in vitro or in mice (Bukreyev, et al., J.
Virol 75:12128-40 (2001)). Although the D46/6120 cDNA contains a
deletion, for simplicity the numbering of sequence positions in the
present manuscript is based on the complete sequence of
biologically-derived strain A2 (Genbank accession number
M74568).
[0148] Mutant cDNAs were constructed by well known methods using
restriction enzymes to subclone fragments for manipulation, which
were then replaced into the original or another mutant backbone.
For example, a set of full-length cDNAs representing amino acid
assignments N, K, or G for codon 1321 of the RSV L protein (nt
12,458-60) was generated, as well as a full-length cDNA containing
a deletion near position 1321 (described above). A 4267 bp fragment
containing the 3' end of the L gene and trailer region (restriction
site XbaI to trailer end, RSV A2 nt 11,210 to 15,222; Genbank
accession number M74568) was subcloned into pBluescript, using the
Xbal site contained in the RSV L gene and an Fspl restriction site
in the antigenome plasmid, 254 bp downstream of the RSV trailer
end. Small deletions and the targeted mutations of codon 1321 and
codon 1313 were introduced in a by site directed mutaganesis using
the QuikChange mutagenesis kit (Stratagene) as recommended by the
supplier. The sequence of a 3,195 bp fragment was confirmed, and it
was inserted into the RSV D46/6120 antigenome cDNA plasmid, using
the Pm1I restriction site located in the L gene (nt 12,254; Genbank
accession number M74568), and an MluI site present in the plasmid,
225 bp downstream of the RSV trailer end. Other restriction sites
in L or elsewhere also were used, such as Xbal and Sall sites. This
methodology is well known to one skilled in the arts, and one can
readily identify various combinations of enzymes and fragments that
can be used to create desired constructs.
[0149] Generation of recombinant RSV viruses from cDNA. BSR T7/5
cells were grown to 95% confluency in 6-well plates. Before
transfection, cells were washed twice with GMEM containing 3% FBS,
1 mM L-glutamine, and 2% MEM amino acids prior to the addition of 2
ml of media per well. Cells were transfected using Lipofectamine
2000 and a plasmid mixture containing 5 .mu.g of full-length
plasmid, 2 .mu.g each of pTM1-N and pTM1-P, and 1 .mu.g each of
pTM1-M2-1 and pTM1-L (J. Virol 73:251-9 and Proc. Natl. Acad. Sci.
92:11563-7). Transfected cells were incubated overnight at
37.degree. C. To increase the frequency of virus recovery, some
plates were then heat-shocked at 43.degree. C., 3% CO.sub.2 for 3
hours (Witko, S. E., et al., J. Virol. Methods 135:91-101 (2006)).
All plates were incubated at 32.degree. C. for at least 24 h. The
BSR T7/5 cells were harvested by scraping into media, added to
subconfluent monolayers of HEp-2 cells, and incubated at 32.degree.
C. Virus was harvested between 11 and 14 days post-transfection and
titers were determined by plaque assay. Viruses were passaged twice
prior to the isolation of RNA from infected cells and the complete
sequence of each viral genome was determined from infected-cell RNA
by RT-PCR and direct sequence analysis. The only sequences that
were not directly confirmed for each genome were the positions of
the outer-most primers, namely nt 1-29 and 15,191-15,222.
[0150] Evaluation of the ts phenotype. The ts phenotype for each of
the rRSV viruses was evaluated by efficiency of plaque formation at
32.degree., 35.degree., 36.degree., 37.degree., 38.degree.,
39.degree., and 40.degree. C. Plaque assays were done on HEp-2
cells, in duplicate, and incubated in sealed caskets at various
temperatures in temperature controlled waterbaths as previously
described (Crowe, J. E., Jr., et al., Vaccine 11:1395-404
(1993)).
[0151] Evaluation of the attenuation phenotype. Virus replication
was evaluated in the upper and lower respiratory tracts of mice as
described (Whitehead, et al., Virology 247:232-9 (1998)). Briefly,
10-week-old female BALB/c mice in groups of five were inoculated
intranasally under methoxyflurane anesthesia on day 0 with 10.sup.6
PFU of rRSV. On day 4, mice were sacrificed by carbon dioxide
inhalation. Nasal turbinates and lung tissue were harvested and
homogenized separately in L-15 medium containing 1.times. SPG, 2%
L-glutamine, 0.06 mg/ml ciprofloxacin, 0.06 mg/ml clindamycin
phosphate, 0.05 mg/ml gentamycin, and 0.0025 mg/ml amphotericin B.
Virus titers were determined in duplicate on HEp-2 cells incubated
at 32.degree. C.
TABLE-US-00016 RSV A2 sequence (Genbank accession number M74568)
(SEQ ID NO: 48) acgcgaaaaaatgcgtacaacaaacttgcataaaccaaaaaaatggggcaa
ataagaatttgataagtaccacttaaatttaactcccttggttagagatgg
gcagcaattcattgagtatgataaaagttagattacaaaatttgtttgaca
atgatgaagtagcattgttaaaaataacatgctatactgataaattaatac
atttaactaacgctttggctaaggcagtgatacatacaatcaaattgaatg
gcattgtgtttgtgcatgttattacaagtagtgatatttgccctaataata
atattgtagtaaaatccaatttcacaacaatgccagtactacaaaatggag
gttatatatgggaaatgatggaattaacacattgctctcaacctaatggtc
tactagatgacaattgtgaaattaaattctccaaaaaactaagtgattcaa
caatgaccaattatatgaatcaattatctgaattacttggatttgatctta
atccataaattataattaatatcaactagcaaatcaatgtcactaacacca
ttagttaatataaaacttaacagaagacaaaaatggggcaaataaatcaat
tcagccaacccaaccatggacacaacccacaatgataatacaccacaaaga
ctgatgatcacagacatgagaccgttgtcacttgagaccataataacatca
ctaaccagagacatcataacacacaaatttatatacttgataaatcatgaa
tgcatagtgagaaaacttgatgaaaaacaggccacatttacattcctggtc
aactatgaaatgaaactattacacaaagtaggaagcactaaatataaaaaa
tatactgaatacaacacaaaatatggcactttccctatgccaatattcatc
aatcatgatgggttcttagaatgcattggcattaagcctacaaagcatact
cccataatatacaagtatgatctcaatccataaatttcaacacaatattca
cacaatctaaaacaacaactctatgcataactatactccatagtccagatg
gagcctgaaaattatagtaatttaaaattaaggagagatataagatagaag
atggggcaaatacaaagatggctcttagcaaagtcaagttgaatgatacac
tcaacaaagatcaacttctgtcatccagcaaatacaccatccaacggagca
caggagatagtattgatactcctaattatgatgtgcagaaacacatcaata
agttatgtggcatgttattaatcacagaagatgctaatcataaattcactg
ggttaataggtatgttatatgcgatgtctaggttaggaagagaagacacca
taaaaatactcagagatgcgggatatcatgtaaaagcaaatggagtagatg
taacaacacatcgtcaagacattaatggaaaagaaatgaaatttgaagtgt
taacattggcaagcttaacaactgaaattcaaatcaacattgagatagaat
ctagaaaatcctacaaaaaaatgctaaaagaaatgggagaggtagctccag
aatacaggcatgactctcctgattgtgggatgataatattatgtatagcag
cattagtaataactaaattagcagcaggggacagatctggtcttacagccg
tgattaggagagctaataatgtcctaaaaaatgaaatgaaacgttacaaag
gcttactacccaaggacatagccaacagcttctatgaagtgtttgaaaaac
atccccactttatagatgtttttgttcattttggtatagcacaatcttcta
ccagaggtggcagtagagttgaagggatttttgcaggattgtttatgaatg
cctatggtgcagggcaagtgatgttacggtggggagtcttagcaaaatcag
ttaaaaatattatgttaggacatgctagtgtgcaagcagaaatggaacaag
ttgttgaggtttatgaatatgcccaaaaattgggtggtgaagcaggattct
accatatattgaacaacccaaaagcatcattattatctttgactcaatttc
ctcacttctccagtgtagtattaggcaatgctgctggcctaggcataatgg
gagagtacagaggtacaccgaggaatcaagatctatatgatgcagcaaagg
catatgctgaacaactcaaagaaaatggtgtgattaactacagtgtactag
acttgacagcagaagaactagaggctatcaaacatcagcttaatccaaaag
ataatgatgtagagctttgagttaataaaaaatggggcaaataaatcatca
tggaaaagtttgctcctgaattccatggagaagatgcaaacaacagggcta
ctaaattcctagaatcaataaagggcaaattcacatcacccaaagatccca
agaaaaaagatagtatcatatctgtcaactcaatagatatagaagtaacca
aagaaagccctataacatcaaattcaactattatcaacccaacaaatgaga
cagatgatactgcagggaacaagcccaattatcaaagaaaacctctagtaa
gtttcaaagaagaccctacaccaagtgataatcccttttctaaactataca
aagaaaccatagaaacatttgataacaatgaagaagaatccagctattcat
acgaagaaataaatgatcagacaaacgataatataacagcaagattagata
ggattgatgaaaaattaagtgaaatactaggaatgcttcacacattagtag
tggcaagtgcaggacctacatctgctcgggatggtataagagatgccatga
ttggtttaagagaagaaatgatagaaaaaatcagaactgaagcattaatga
ccaatgacagattagaagctatggcaagactcaggaatgaggaaagtgaaa
agatggcaaaagacacatcagatgaagtgtctctcaatccaacatcagaga
aattgaacaacctattggaagggaatgatagtgacaatgatctatcacttg
aagatttctgattagttaccactcttcacatcaacacacaataccaacaga
agaccaacaaactaaccaacccaatcatccaaccaaacatccatccgccaa
tcagccaaacagccaacaaaacaaccagccaatccaaaactaaccacccgg
aaaaaatctataatatagttacaaaaaaaggaaagggtggggcaaatatgg
aaacatacgtgaacaagcttcacgaaggctccacatacacagctgctgttc
aatacaatgtcttagaaaaagacgatgaccctgcatcacttacaatatggg
tgcccatgttccaatcatctatgccagcagatttacttataaaagaactag
ctaatgtcaacatactagtgaaacaaatatccacacccaagggaccttcac
taagagtcatgataaactcaagaagtgcagtgctagcacaaatgcccagca
aatttaccatatgcgctaatgtgtccttggatgaaagaagcaaactagcat
atgatgtaaccacaccctgtgaaatcaaggcatgtagtctaacatgcctaa
aatcaaaaaatatgttgactacagttaaagatctcactatgaagacactca
accctacacatgatattattgctttatgtgaatttgaaaacatagtaa
Sequence CWU 1
1
48145DNAHuman respiratory syncytial virusCDS(1)..(45) 1atg gaa gaa
ctc agc ata gga acc ctt ggg tta aca tat gaa aag 45Met Glu Glu Leu
Ser Ile Gly Thr Leu Gly Leu Thr Tyr Glu Lys1 5 10 15245DNAHuman
respiratory syncytial virusCDS(1)..(45) 2atg gaa gaa ctc tgc ata
gga acc ctt ggg tta aca tat gaa aag 45Met Glu Glu Leu Cys Ile Gly
Thr Leu Gly Leu Thr Tyr Glu Lys1 5 10 15345DNAHuman respiratory
syncytial virusCDS(1)..(45) 3atg gaa gaa ctc agc ata gga acc ctt
ggg tta aca gaa gaa aag 45Met Glu Glu Leu Ser Ile Gly Thr Leu Gly
Leu Thr Glu Glu Lys1 5 10 15445DNAHuman respiratory syncytial
virusCDS(1)..(45) 4atg gaa gaa ctc tgc ata gga acc ctt ggg tta aca
gaa gaa aag 45Met Glu Glu Leu Cys Ile Gly Thr Leu Gly Leu Thr Glu
Glu Lys1 5 10 15545DNAHuman respiratory syncytial virusCDS(1)..(45)
5atg gaa gaa ctc agc ata gga acc ctt ggg tta aca aaa gaa aag 45Met
Glu Glu Leu Ser Ile Gly Thr Leu Gly Leu Thr Lys Glu Lys1 5 10
15645DNAHuman respiratory syncytial virusCDS(1)..(45) 6atg gaa gaa
ctc tgc ata gga acc ctt ggg tta aca aaa gaa aag 45Met Glu Glu Leu
Cys Ile Gly Thr Leu Gly Leu Thr Lys Glu Lys1 5 10 15745DNAHuman
respiratory syncytial virusCDS(1)..(45) 7atg gaa gaa ctc agc ata
gga acc ctt ggg tta aca gga gaa aag 45Met Glu Glu Leu Ser Ile Gly
Thr Leu Gly Leu Thr Gly Glu Lys1 5 10 15845DNAHuman respiratory
syncytial virusCDS(1)..(45) 8atg gaa gaa ctc tgc ata gga acc ctt
ggg tta aca gga gaa aag 45Met Glu Glu Leu Cys Ile Gly Thr Leu Gly
Leu Thr Gly Glu Lys1 5 10 15945DNAHuman respiratory syncytial
virusCDS(1)..(45) 9atg gaa gaa ctc agc ata gga acc ctt ggg tta aca
ggt gaa aag 45Met Glu Glu Leu Ser Ile Gly Thr Leu Gly Leu Thr Gly
Glu Lys1 5 10 151045DNAHuman respiratory syncytial
virusCDS(1)..(45) 10atg gaa gaa ctc tgc ata gga acc ctt ggg tta aca
ggt gaa aag 45Met Glu Glu Leu Cys Ile Gly Thr Leu Gly Leu Thr Gly
Glu Lys1 5 10 151115PRTHuman respiratory syncytial virus 11Met Glu
Glu Leu Ser Ile Gly Thr Leu Gly Leu Thr Tyr Glu Lys1 5 10
151215PRTHuman respiratory syncytial virus 12Met Glu Glu Leu Cys
Ile Gly Thr Leu Gly Leu Thr Tyr Glu Lys1 5 10 151315PRTHuman
respiratory syncytial virus 13Met Glu Glu Leu Ser Ile Gly Thr Leu
Gly Leu Thr Glu Glu Lys1 5 10 151415PRTHuman respiratory syncytial
virus 14Met Glu Glu Leu Cys Ile Gly Thr Leu Gly Leu Thr Glu Glu
Lys1 5 10 151515PRTHuman respiratory syncytial virus 15Met Glu Glu
Leu Ser Ile Gly Thr Leu Gly Leu Thr Lys Glu Lys1 5 10
151615PRTHuman respiratory syncytial virus 16Met Glu Glu Leu Cys
Ile Gly Thr Leu Gly Leu Thr Lys Glu Lys1 5 10 151715PRTHuman
respiratory syncytial virus 17Met Glu Glu Leu Ser Ile Gly Thr Leu
Gly Leu Thr Gly Glu Lys1 5 10 151815PRTHuman respiratory syncytial
virus 18Met Glu Glu Leu Cys Ile Gly Thr Leu Gly Leu Thr Gly Glu
Lys1 5 10 151936DNAHuman respiratory syncytial virusCDS(1)..(36)
19gaa ctc tca ata gga acc ctt ggg tta aca aaa gaa 36Glu Leu Ser Ile
Gly Thr Leu Gly Leu Thr Lys Glu1 5 102042DNAHuman respiratory
syncytial virusCDS(1)..(42) 20atg gaa gaa ctc ata gga acc ctt ggg
tta aca tat gaa aag 42Met Glu Glu Leu Ile Gly Thr Leu Gly Leu Thr
Tyr Glu Lys1 5 102114PRTHuman respiratory syncytial virus 21Met Glu
Glu Leu Ile Gly Thr Leu Gly Leu Thr Tyr Glu Lys1 5 10224PRTHuman
respiratory syncytial virus 22Glu Leu Ile Gly12312DNAHuman
respiratory syncytial virusCDS(1)..(12) 23gaa ctc ata gga 12Glu Leu
Ile Gly1244PRTHuman respiratory syncytial virus 24Glu Leu Thr
Gly12512DNAHuman respiratory syncytial virusCDS(1)..(12) 25gaa ctc
aca gga 12Glu Leu Thr Gly1269PRTHuman respiratory syncytial virus
26Glu Leu Thr Gly Thr Leu Gly Leu Thr1 52727DNAHuman respiratory
syncytial virusCDS(1)..(27) 27gaa ctc aca gga acc ctt ggg tta aca
27Glu Leu Thr Gly Thr Leu Gly Leu Thr1 5289PRTHuman respiratory
syncytial virus 28Glu Leu Leu Gly Thr Leu Gly Leu Thr1
52927DNAHuman respiratory syncytial virusCDS(1)..(27) 29gaa ctc ctg
gga acc ctt ggg tta aca 27Glu Leu Leu Gly Thr Leu Gly Leu Thr1
5309PRTHuman respiratory syncytial virus 30Glu Leu Ser Gly Thr Leu
Gly Leu Thr1 53127DNAHuman respiratory syncytial virusCDS(1)..(27)
31gaa ctc agc gga acc ctt ggg tta aca 27Glu Leu Ser Gly Thr Leu Gly
Leu Thr1 5329PRTHuman respiratory syncytial virus 32Glu Leu Ser Ile
Gly Leu Gly Leu Thr1 53327DNAHuman respiratory syncytial
virusCDS(1)..(27) 33gaa ctc agc ata gga ctt ggg tta aca 27Glu Leu
Ser Ile Gly Leu Gly Leu Thr1 5349PRTHuman respiratory syncytial
virus 34Glu Leu Ser Ile Gly Thr Leu Gly Leu1 53527DNAHuman
respiratory syncytial virusCDS(1)..(27) 35gaa ctc agc ata gga acc
ctt ggg tta 27Glu Leu Ser Ile Gly Thr Leu Gly Leu1 53621PRTHuman
respiratory syncytial virus 36Pro Leu Leu Ser Asn Lys Lys Leu Ile
Lys Ser Ser Ala Met Ile Arg1 5 10 15Thr Asn Tyr Ser Lys
203720PRTHuman respiratory syncytial virus 37Pro Leu Leu Ser Asn
Lys Lys Leu Ile Lys Ser Ala Met Ile Arg Thr1 5 10 15Asn Tyr Ser Lys
203820PRTHuman respiratory syncytial virus 38Pro Leu Leu Ser Asn
Lys Lys Leu Ile Lys Ser Ser Met Ile Arg Thr1 5 10 15Asn Tyr Ser Lys
203919PRTHuman respiratory syncytial virus 39Pro Leu Leu Ser Asn
Lys Lys Leu Ile Ser Ala Met Ile Arg Thr Asn1 5 10 15Tyr Ser
Lys4019PRTHuman respiratory syncytial virus 40Pro Leu Leu Ser Asn
Lys Lys Leu Ile Lys Ala Met Ile Arg Thr Asn1 5 10 15Tyr Ser
Lys4119PRTHuman respiratory syncytial virus 41Pro Leu Leu Ser Asn
Lys Lys Leu Ile Lys Ser Met Ile Arg Thr Asn1 5 10 15Tyr Ser
Lys4217PRTHuman respiratory syncytial virus 42Pro Leu Leu Ser Asn
Lys Lys Leu Ile Met Ile Arg Thr Asn Tyr Ser1 5 10 15Lys4317PRTHuman
respiratory syncytial virus 43Pro Leu Leu Ser Asn Lys Lys Leu Ile
Lys Ile Arg Thr Asn Tyr Ser1 5 10 15Lys4415PRTHuman respiratory
syncytial virus 44Pro Leu Leu Ser Asn Lys Lys Leu Ile Arg Thr Asn
Tyr Ser Lys1 5 10 154512PRTHuman respiratory syncytial virus 45Pro
Leu Leu Ser Asn Ile Arg Thr Asn Tyr Ser Lys1 5 10468PRTHuman
respiratory syncytial virus 46Pro Leu Leu Ser Asn Lys Lys Leu1
5477PRTHuman respiratory syncytial virus 47Ile Arg Thr Asn Tyr Ser
Lys1 54815222DNAHuman respiratory syncytial virus 48acgcgaaaaa
atgcgtacaa caaacttgca taaaccaaaa aaatggggca aataagaatt 60tgataagtac
cacttaaatt taactccctt ggttagagat gggcagcaat tcattgagta
120tgataaaagt tagattacaa aatttgtttg acaatgatga agtagcattg
ttaaaaataa 180catgctatac tgataaatta atacatttaa ctaacgcttt
ggctaaggca gtgatacata 240caatcaaatt gaatggcatt gtgtttgtgc
atgttattac aagtagtgat atttgcccta 300ataataatat tgtagtaaaa
tccaatttca caacaatgcc agtactacaa aatggaggtt 360atatatggga
aatgatggaa ttaacacatt gctctcaacc taatggtcta ctagatgaca
420attgtgaaat taaattctcc aaaaaactaa gtgattcaac aatgaccaat
tatatgaatc 480aattatctga attacttgga tttgatctta atccataaat
tataattaat atcaactagc 540aaatcaatgt cactaacacc attagttaat
ataaaactta acagaagaca aaaatggggc 600aaataaatca attcagccaa
cccaaccatg gacacaaccc acaatgataa tacaccacaa 660agactgatga
tcacagacat gagaccgttg tcacttgaga ccataataac atcactaacc
720agagacatca taacacacaa atttatatac ttgataaatc atgaatgcat
agtgagaaaa 780cttgatgaaa aacaggccac atttacattc ctggtcaact
atgaaatgaa actattacac 840aaagtaggaa gcactaaata taaaaaatat
actgaataca acacaaaata tggcactttc 900cctatgccaa tattcatcaa
tcatgatggg ttcttagaat gcattggcat taagcctaca 960aagcatactc
ccataatata caagtatgat ctcaatccat aaatttcaac acaatattca
1020cacaatctaa aacaacaact ctatgcataa ctatactcca tagtccagat
ggagcctgaa 1080aattatagta atttaaaatt aaggagagat ataagataga
agatggggca aatacaaaga 1140tggctcttag caaagtcaag ttgaatgata
cactcaacaa agatcaactt ctgtcatcca 1200gcaaatacac catccaacgg
agcacaggag atagtattga tactcctaat tatgatgtgc 1260agaaacacat
caataagtta tgtggcatgt tattaatcac agaagatgct aatcataaat
1320tcactgggtt aataggtatg ttatatgcga tgtctaggtt aggaagagaa
gacaccataa 1380aaatactcag agatgcggga tatcatgtaa aagcaaatgg
agtagatgta acaacacatc 1440gtcaagacat taatggaaaa gaaatgaaat
ttgaagtgtt aacattggca agcttaacaa 1500ctgaaattca aatcaacatt
gagatagaat ctagaaaatc ctacaaaaaa atgctaaaag 1560aaatgggaga
ggtagctcca gaatacaggc atgactctcc tgattgtggg atgataatat
1620tatgtatagc agcattagta ataactaaat tagcagcagg ggacagatct
ggtcttacag 1680ccgtgattag gagagctaat aatgtcctaa aaaatgaaat
gaaacgttac aaaggcttac 1740tacccaagga catagccaac agcttctatg
aagtgtttga aaaacatccc cactttatag 1800atgtttttgt tcattttggt
atagcacaat cttctaccag aggtggcagt agagttgaag 1860ggatttttgc
aggattgttt atgaatgcct atggtgcagg gcaagtgatg ttacggtggg
1920gagtcttagc aaaatcagtt aaaaatatta tgttaggaca tgctagtgtg
caagcagaaa 1980tggaacaagt tgttgaggtt tatgaatatg cccaaaaatt
gggtggtgaa gcaggattct 2040accatatatt gaacaaccca aaagcatcat
tattatcttt gactcaattt cctcacttct 2100ccagtgtagt attaggcaat
gctgctggcc taggcataat gggagagtac agaggtacac 2160cgaggaatca
agatctatat gatgcagcaa aggcatatgc tgaacaactc aaagaaaatg
2220gtgtgattaa ctacagtgta ctagacttga cagcagaaga actagaggct
atcaaacatc 2280agcttaatcc aaaagataat gatgtagagc tttgagttaa
taaaaaatgg ggcaaataaa 2340tcatcatgga aaagtttgct cctgaattcc
atggagaaga tgcaaacaac agggctacta 2400aattcctaga atcaataaag
ggcaaattca catcacccaa agatcccaag aaaaaagata 2460gtatcatatc
tgtcaactca atagatatag aagtaaccaa agaaagccct ataacatcaa
2520attcaactat tatcaaccca acaaatgaga cagatgatac tgcagggaac
aagcccaatt 2580atcaaagaaa acctctagta agtttcaaag aagaccctac
accaagtgat aatccctttt 2640ctaaactata caaagaaacc atagaaacat
ttgataacaa tgaagaagaa tccagctatt 2700catacgaaga aataaatgat
cagacaaacg ataatataac agcaagatta gataggattg 2760atgaaaaatt
aagtgaaata ctaggaatgc ttcacacatt agtagtggca agtgcaggac
2820ctacatctgc tcgggatggt ataagagatg ccatgattgg tttaagagaa
gaaatgatag 2880aaaaaatcag aactgaagca ttaatgacca atgacagatt
agaagctatg gcaagactca 2940ggaatgagga aagtgaaaag atggcaaaag
acacatcaga tgaagtgtct ctcaatccaa 3000catcagagaa attgaacaac
ctattggaag ggaatgatag tgacaatgat ctatcacttg 3060aagatttctg
attagttacc actcttcaca tcaacacaca ataccaacag aagaccaaca
3120aactaaccaa cccaatcatc caaccaaaca tccatccgcc aatcagccaa
acagccaaca 3180aaacaaccag ccaatccaaa actaaccacc cggaaaaaat
ctataatata gttacaaaaa 3240aaggaaaggg tggggcaaat atggaaacat
acgtgaacaa gcttcacgaa ggctccacat 3300acacagctgc tgttcaatac
aatgtcttag aaaaagacga tgaccctgca tcacttacaa 3360tatgggtgcc
catgttccaa tcatctatgc cagcagattt acttataaaa gaactagcta
3420atgtcaacat actagtgaaa caaatatcca cacccaaggg accttcacta
agagtcatga 3480taaactcaag aagtgcagtg ctagcacaaa tgcccagcaa
atttaccata tgcgctaatg 3540tgtccttgga tgaaagaagc aaactagcat
atgatgtaac cacaccctgt gaaatcaagg 3600catgtagtct aacatgccta
aaatcaaaaa atatgttgac tacagttaaa gatctcacta 3660tgaagacact
caaccctaca catgatatta ttgctttatg tgaatttgaa aacatagtaa
3720catcaaaaaa agtcataata ccaacatacc taagatccat cagtgtcaga
aataaagatc 3780tgaacacact tgaaaatata acaaccactg aattcaaaaa
tgctatcaca aatgcaaaaa 3840tcatccctta ctcaggatta ctattagtca
tcacagtgac tgacaacaaa ggagcattca 3900aatacataaa gccacaaagt
caattcatag tagatcttgg agcttaccta gaaaaagaaa 3960gtatatatta
tgttaccaca aattggaagc acacagctac acgatttgca atcaaaccca
4020tggaagatta acctttttcc tctacatcag tgtgttaatt catacaaact
ttctacctac 4080attcttcact tcaccatcac aatcacaaac actctgtggt
tcaaccaatc aaacaaaact 4140tatctgaagt cccagatcat cccaagtcat
tgtttatcag atctagtact caaataagtt 4200aataaaaaat atacacatgg
ggcaaataat cattggagga aatccaacta atcacaatat 4260ctgttaacat
agacaagtcc acacaccata cagaatcaac caatggaaaa tacatccata
4320acaatagaat tctcaagcaa attctggcct tactttacac taatacacat
gatcacaaca 4380ataatctctt tgctaatcat aatctccatc atgattgcaa
tactaaacaa actttgtgaa 4440tataacgtat tccataacaa aacctttgag
ttaccaagag ctcgagtcaa cacatagcat 4500tcatcaatcc aacagcccaa
aacagtaacc ttgcatttaa aaatgaacaa cccctacctc 4560tttacaacac
ctcattaaca tcccaccatg caaaccacta tccatactat aaagtagtta
4620attaaaaata gtcataacaa tgaactagga tatcaagact aacaataaca
ttggggcaaa 4680tgcaaacatg tccaaaaaca aggaccaacg caccgctaag
acattagaaa ggacctggga 4740cactctcaat catttattat tcatatcatc
gtgcttatat aagttaaatc ttaaatctgt 4800agcacaaatc acattatcca
ttctggcaat gataatctca acttcactta taattgcagc 4860catcatattc
atagcctcgg caaaccacaa agtcacacca acaactgcaa tcatacaaga
4920tgcaacaagc cagatcaaga acacaacccc aacatacctc acccagaatc
ctcagcttgg 4980aatcagtccc tctaatccgt ctgaaattac atcacaaatc
accaccatac tagcttcaac 5040aacaccagga gtcaagtcaa ccctgcaatc
cacaacagtc aagaccaaaa acacaacaac 5100aactcaaaca caacccagca
agcccaccac aaaacaacgc caaaacaaac caccaagcaa 5160acccaataat
gattttcact ttgaagtgtt caactttgta ccctgcagca tatgcagcaa
5220caatccaacc tgctgggcta tctgcaaaag aataccaaac aaaaaaccag
gaaagaaaac 5280cactaccaag cccacaaaaa aaccaaccct caagacaacc
aaaaaagatc ccaaacctca 5340aaccactaaa tcaaaggaag tacccaccac
caagcccaca gaagagccaa ccatcaacac 5400caccaaaaca aacatcataa
ctacactact cacctccaac accacaggaa atccagaact 5460cacaagtcaa
atggaaacct tccactcaac ttcctccgaa ggcaatccaa gcccttctca
5520agtctctaca acatccgagt acccatcaca accttcatct ccacccaaca
caccacgcca 5580gtagttactt aaaaacatat tatcacaaaa agccatgacc
aacttaaaca gaatcaaaat 5640aaactctggg gcaaataaca atggagttgc
taatcctcaa agcaaatgca attaccacaa 5700tcctcactgc agtcacattt
tgttttgctt ctggtcaaaa catcactgaa gaattttatc 5760aatcaacatg
cagtgcagtt agcaaaggct atcttagtgc tctgagaact ggttggtata
5820ccagtgttat aactatagaa ttaagtaata tcaaggaaaa taagtgtaat
ggaacagatg 5880ctaaggtaaa attgataaaa caagaattag ataaatataa
aaatgctgta acagaattgc 5940agttgctcat gcaaagcaca ccaccaacaa
acaatcgagc cagaagagaa ctaccaaggt 6000ttatgaatta tacactcaac
aatgccaaaa aaaccaatgt aacattaagc aagaaaagga 6060aaagaagatt
tcttgttttt ttgttaggtg ttggatctgc aatcgccagt ggcgttgctg
6120tatctaaggt cctgcaccta gaaggggaag tgaacaagat caaaagtgct
ctactatcca 6180caaacaaggc tctagtcagc ttatcaaatg gagttagtgt
cttaaccagc aaagtgttag 6240acctcaaaaa ctatatagat aaacaattgt
tacctattgt gaacaagcaa agctgcagca 6300tatcaaatat agaaactgtg
atagagttcc aacaaaagaa caacagacta ctagagatta 6360ccagggaatt
tagtgttaat gcaggtgtaa ctacacctgt aagcacttac atgttaacta
6420atagtgaatt attgtcatta atcaatgata tgcctataac aaatgatcag
aaaaagttaa 6480tgtccaacaa tgttcaaata gttagacagc aaagttactc
tatcatgtcc ataataaaag 6540aggaagtctt agcatatgta gtacaattac
cactatatgg tgttatagat acaccctgtt 6600ggaaactaca cacatcccct
ctatgtacaa ccaacacaaa agaagggtcc aacatctgtt 6660taacaagaac
tgacagagga tggtactgtg acaatgcagg atcagtatct ttcttcccac
6720aagctgaaac atgtaaagtt caatcaaatc gagtattttg tgacacaatg
aacagtttaa 6780cattaccaag tgaaataaat ctctgcaatg ttgacatatt
caaccccaaa tatgattgta 6840aaattatgac ttcaaaaaca gatgtaagca
gctccgttat cacatctcta ggagccattg 6900tgtcatgcta tggcaaaact
aaatgtacag catccaataa aaatcgtgga atcataaaga 6960cattttctaa
cgggtgcgat tatgtatcaa ataaagggat ggacactgtg tctgtaggta
7020acacattata ttatgtaaat aagcaagaag gtaaaagtct ctatgtaaaa
ggtgaaccaa 7080taataaattt ctatgaccca ttagtattcc cctctgatga
atttgatgca tcaatatctc 7140aagtcaacga gaagattaac cagagcctag
catttattcg taaatccgat gaattattac 7200ataatgtaaa tgctggtaaa
tccaccacaa atatcatgat aactactata attatagtga 7260ttatagtaat
attgttatca ttaattgctg ttggactgct cttatactgt aaggccagaa
7320gcacaccagt cacactaagc aaagatcaac tgagtggtat aaataatatt
gcatttagta 7380actaaataaa aatagcacct aatcatgttc ttacaatggt
ttactatctg ctcatagaca 7440acccatctgt cattggattt tcttaaaatc
tgaacttcat cgaaactctc atctataaac 7500catctcactt acactattta
agtagattcc tagtttatag ttatataaaa cacaattgaa 7560tgccagatta
acttaccatc tgtaaaaatg aaaactgggg caaatatgtc acgaaggaat
7620ccttgcaaat ttgaaattcg aggtcattgc ttaaatggta agaggtgtca
ttttagtcat 7680aattattttg aatggccacc ccatgcactg cttgtaagac
aaaactttat gttaaacaga 7740atacttaagt ctatggataa aagtatagat
accttatcag aaataagtgg agctgcagag 7800ttggacagaa cagaagagta
tgctcttggt gtagttggag tgctagagag ttatatagga 7860tcaataaaca
atataactaa acaatcagca tgtgttgcca tgagcaaact cctcactgaa
7920ctcaatagtg atgatatcaa aaagctgagg gacaatgaag agctaaattc
acccaagata 7980agagtgtaca atactgtcat atcatatatt gaaagcaaca
ggaaaaacaa taaacaaact 8040atccatctgt taaaaagatt gccagcagac
gtattgaaga aaaccatcaa aaacacattg 8100gatatccata agagcataac
catcaacaac ccaaaagaat caactgttag tgatacaaat 8160gaccatgcca
aaaataatga tactacctga caaatatcct tgtagtataa cttccatact
8220aataacaagt agatgtagag ttactatgta taatcaaaag aacacactat
atttcaatca
8280aaacaaccca aataaccata tgtactcacc gaatcaaaca ttcaatgaaa
tccattggac 8340ctctcaagaa ttgattgaca caattcaaat ttttctacaa
catctaggta ttattgagga 8400tatatataca atatatatat tagtgtcata
acactcaatt ctaacactca ccacatcgtt 8460acattattaa ttcaaacaat
tcaagttgtg ggacaaaatg gatcccatta ttaatggaaa 8520ttctgctaat
gtttatctaa ccgatagtta tttaaaaggt gttatctctt tctcagagtg
8580taatgcttta ggaagttaca tattcaatgg tccttatctc aaaaatgatt
ataccaactt 8640aattagtaga caaaatccat taatagaaca catgaatcta
aagaaactaa atataacaca 8700gtccttaata tctaagtatc ataaaggtga
aataaaatta gaagaaccta cttattttca 8760gtcattactt atgacataca
agagtatgac ctcgtcagaa cagattgcta ccactaattt 8820acttaaaaag
ataataagaa gagctataga aataagtgat gtcaaagtct atgctatatt
8880gaataaacta gggcttaaag aaaaggacaa gattaaatcc aacaatggac
aagatgaaga 8940caactcagtt attacgacca taatcaaaga tgatatactt
tcagctgtta aagataatca 9000atctcatctt aaagcagaca aaaatcactc
tacaaaacaa aaagacacaa tcaaaacaac 9060actcttgaag aaattgatgt
gttcaatgca acatcctcca tcatggttaa tacattggtt 9120taacttatac
acaaaattaa acaacatatt aacacagtat cgatcaaatg aggtaaaaaa
9180ccatgggttt acattgatag ataatcaaac tcttagtgga tttcaattta
ttttgaacca 9240atatggttgt atagtttatc ataaggaact caaaagaatt
actgtgacaa cctataatca 9300attcttgaca tggaaagata ttagccttag
tagattaaat gtttgtttaa ttacatggat 9360tagtaactgc ttgaacacat
taaataaaag cttaggctta agatgcggat tcaataatgt 9420tatcttgaca
caactattcc tttatggaga ttgtatacta aagctatttc acaatgaggg
9480gttctacata ataaaagagg tagagggatt tattatgtct ctaattttaa
atataacaga 9540agaagatcaa ttcagaaaac gattttataa tagtatgctc
aacaacatca cagatgctgc 9600taataaagct cagaaaaatc tgctatcaag
agtatgtcat acattattag ataagacagt 9660gtccgataat ataataaatg
gcagatggat aattctatta agtaagttcc ttaaattaat 9720taagcttgca
ggtgacaata accttaacaa tctgagtgaa ctatattttt tgttcagaat
9780atttggacac ccaatggtag atgaaagaca agccatggat gctgttaaaa
ttaattgcaa 9840tgagaccaaa ttttacttgt taagcagtct gagtatgtta
agaggtgcct ttatatatag 9900aattataaaa gggtttgtaa ataattacaa
cagatggcct actttaagaa atgctattgt 9960tttaccctta agatggttaa
cttactataa actaaacact tatccttctt tgttggaact 10020tacagaaaga
gatttgattg tgttatcagg actacgtttc tatcgtgagt ttcggttgcc
10080taaaaaagtg gatcttgaaa tgattataaa tgataaagct atatcacctc
ctaaaaattt 10140gatatggact agtttcccta gaaattacat gccatcacac
atacaaaact atatagaaca 10200tgaaaaatta aaattttccg agagtgataa
atcaagaaga gtattagagt attatttaag 10260agataacaaa ttcaatgaat
gtgatttata caactgtgta gttaatcaaa gttatctcaa 10320caaccctaat
catgtggtat cattgacagg caaagaaaga gaactcagtg taggtagaat
10380gtttgcaatg caaccgggaa tgttcagaca ggttcaaata ttggcagaga
aaatgatagc 10440tgaaaacatt ttacaattct ttcctgaaag tcttacaaga
tatggtgatc tagaactaca 10500aaaaatatta gaattgaaag caggaataag
taacaaatca aatcgctaca atgataatta 10560caacaattac attagtaagt
gctctatcat cacagatctc agcaaattca atcaagcatt 10620tcgatatgaa
acgtcatgta tttgtagtga tgtgctggat gaactgcatg gtgtacaatc
10680tctattttcc tggttacatt taactattcc tcatgtcaca ataatatgca
catataggca 10740tgcacccccc tatataggag atcatattgt agatcttaac
aatgtagatg aacaaagtgg 10800attatataga tatcacatgg gtggcatcga
agggtggtgt caaaaactgt ggaccataga 10860agctatatca ctattggatc
taatatctct caaagggaaa ttctcaatta ctgctttaat 10920taatggtgac
aatcaatcaa tagatataag caaaccaatc agactcatgg aaggtcaaac
10980tcatgctcaa gcagattatt tgctagcatt aaatagcctt aaattactgt
ataaagagta 11040tgcaggcata ggccacaaat taaaaggaac tgagacttat
atatcacgag atatgcaatt 11100tatgagtaaa acaattcaac ataacggtgt
atattaccca gctagtataa agaaagtcct 11160aagagtggga ccgtggataa
acactatact tgatgatttc aaagtgagtc tagaatctat 11220aggtagtttg
acacaagaat tagaatatag aggtgaaagt ctattatgca gtttaatatt
11280tagaaatgta tggttatata atcagattgc tctacaatta aaaaatcatg
cattatgtaa 11340caataaacta tatttggaca tattaaaggt tctgaaacac
ttaaaaacct tttttaatct 11400tgataatatt gatacagcat taacattgta
tatgaattta cccatgttat ttggtggtgg 11460tgatcccaac ttgttatatc
gaagtttcta tagaagaact cctgacttcc tcacagaggc 11520tatagttcac
tctgtgttca tacttagtta ttatacaaac catgacttaa aagataaact
11580tcaagatctg tcagatgata gattgaataa gttcttaaca tgcataatca
cgtttgacaa 11640aaaccctaat gctgaattcg taacattgat gagagatcct
caagctttag ggtctgagag 11700acaagctaaa attactagcg aaatcaatag
actggcagtt acagaggttt tgagtacagc 11760tccaaacaaa atattctcca
aaagtgcaca acattatact actacagaga tagatctaaa 11820tgatattatg
caaaatatag aacctacata tcctcatggg ctaagagttg tttatgaaag
11880tttacccttt tataaagcag agaaaatagt aaatcttata tcaggtacaa
aatctataac 11940taacatactg gaaaaaactt ctgccataga cttaacagat
attgatagag ccactgagat 12000gatgaggaaa aacataactt tgcttataag
gatacttcca ttggattgta acagagataa 12060aagagagata ttgagtatgg
aaaacctaag tattactgaa ttaagcaaat atgttaggga 12120aagatcttgg
tctttatcca atatagttgg tgttacatca cccagtatca tgtatacaat
12180ggacatcaaa tatactacaa gcactatatc tagtggcata attatagaga
aatataatgt 12240taacagttta acacgtggtg agagaggacc cactaaacca
tgggttggtt catctacaca 12300agagaaaaaa acaatgccag tttataatag
acaagtctta accaaaaaac agagagatca 12360aatagatcta ttagcaaaat
tggattgggt gtatgcatct atagataaca aggatgaatt 12420catggaagaa
ctcagcatag gaacccttgg gttaacatat gaaaaggcca agaaattatt
12480tccacaatat ttaagtgtca attatttgca tcgccttaca gtcagtagta
gaccatgtga 12540attccctgca tcaataccag cttatagaac aacaaattat
cactttgaca ctagccctat 12600taatcgcata ttaacagaaa agtatggtga
tgaagatatt gacatagtat tccaaaactg 12660tataagcttt ggccttagtt
taatgtcagt agtagaacaa tttactaatg tatgtcctaa 12720cagaattatt
ctcataccta agcttaatga gatacatttg atgaaacctc ccatattcac
12780aggtgatgtt gatattcaca agttaaaaca agtgatacaa aaacagcata
tgtttttacc 12840agacaaaata agtttgactc aatatgtgga attattctta
agtaataaaa cactcaaatc 12900tggatctcat gttaattcta atttaatatt
ggcacataaa atatctgact attttcataa 12960tacttacatt ttaagtacta
atttagctgg acattggatt ctgattatac aacttatgaa 13020agattctaaa
ggtatttttg aaaaagattg gggagaggga tatataactg atcatatgtt
13080tattaatttg aaagttttct tcaatgctta taagacctat ctcttgtgtt
ttcataaagg 13140ttatggcaaa gcaaagctgg agtgtgatat gaacacttca
gatcttctat gtgtattgga 13200attaatagac agtagttatt ggaagtctat
gtctaaggta tttttagaac aaaaagttat 13260caaatacatt cttagccaag
atgcaagttt acatagagta aaaggatgtc atagcttcaa 13320attatggttt
cttaaacgtc ttaatgtagc agaattcaca gtttgccctt gggttgttaa
13380catagattat catccaacac atatgaaagc aatattaact tatatagatc
ttgttagaat 13440gggattgata aatatagata gaatacacat taaaaataaa
cacaaattca atgatgaatt 13500ttatacttct aatctcttct acattaatta
taacttctca gataatactc atctattaac 13560taaacatata aggattgcta
attctgaatt agaaaataat tacaacaaat tatatcatcc 13620tacaccagaa
accctagaga atatactagc caatccgatt aaaagtaatg acaaaaagac
13680actgaatgac tattgtatag gtaaaaatgt tgactcaata atgttaccat
tgttatctaa 13740taagaagctt attaaatcgt ctgcaatgat tagaaccaat
tacagcaaac aagatttgta 13800taatttattc cctatggttg tgattgatag
aattatagat cattcaggca atacagccaa 13860atccaaccaa ctttacacta
ctacttccca ccaaatatct ttagtgcaca atagcacatc 13920actttactgc
atgcttcctt ggcatcatat taatagattc aattttgtat ttagttctac
13980aggttgtaaa attagtatag agtatatttt aaaagatctt aaaattaaag
atcccaattg 14040tatagcattc ataggtgaag gagcagggaa tttattattg
cgtacagtag tggaacttca 14100tcctgacata agatatattt acagaagtct
gaaagattgc aatgatcata gtttacctat 14160tgagttttta aggctgtaca
atggacatat caacattgat tatggtgaaa atttgaccat 14220tcctgctaca
gatgcaacca acaacattca ttggtcttat ttacatataa agtttgctga
14280acctatcagt ctttttgtct gtgatgccga attgtctgta acagtcaact
ggagtaaaat 14340tataatagaa tggagcaagc atgtaagaaa gtgcaagtac
tgttcctcag ttaataaatg 14400tatgttaata gtaaaatatc atgctcaaga
tgatattgat ttcaaattag acaatataac 14460tatattaaaa acttatgtat
gcttaggcag taagttaaag ggatcggagg tttacttagt 14520ccttacaata
ggtcctgcga atatattccc agtatttaat gtagtacaaa atgctaaatt
14580gatactatca agaaccaaaa atttcatcat gcctaagaaa gctgataaag
agtctattga 14640tgcaaatatt aaaagtttga taccctttct ttgttaccct
ataacaaaaa aaggaattaa 14700tactgcattg tcaaaactaa agagtgttgt
tagtggagat atactatcat attctatagc 14760tggacgtaat gaagttttca
gcaataaact tataaatcat aagcatatga acatcttaaa 14820atggttcaat
catgttttaa atttcagatc aacagaacta aactataacc atttatatat
14880ggtagaatct acatatcctt acctaagtga attgttaaac agcttgacaa
ccaatgaact 14940taaaaaactg attaaaatca caggtagtct gttatacaac
tttcataatg aataatgaat 15000aaagatctta taataaaaat tcccatagct
atacactaac actgtattca attatagtta 15060ttaaaaatta aaaatcatat
aattttttaa ataactttta gtgaactaat cctaaagtta 15120tcattttaat
cttggaggaa taaatttaaa ccctaatcta attggtttat atgtgtatta
15180actaaattac gagatattag tttttgacac tttttttctc gt 15222
* * * * *