U.S. patent application number 17/164025 was filed with the patent office on 2021-10-21 for methods and compositions for producing fatty alcohols.
This patent application is currently assigned to Genomatica, Inc.. The applicant listed for this patent is Genomatica, Inc.. Invention is credited to Vikranth ARLAGADDA, Zhihao HU.
Application Number | 20210324430 17/164025 |
Document ID | / |
Family ID | 1000005681482 |
Filed Date | 2021-10-21 |
United States Patent
Application |
20210324430 |
Kind Code |
A1 |
HU; Zhihao ; et al. |
October 21, 2021 |
Methods And Compositions For Producing Fatty Alcohols
Abstract
Methods and compositions, including nucleotide sequences, amino
acid sequences, and host cells, for producing fatty alcohols are
described.
Inventors: |
HU; Zhihao; (South San
Francisco, CA) ; ARLAGADDA; Vikranth; (South San
Francisco, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Genomatica, Inc. |
San Diego |
CA |
US |
|
|
Assignee: |
Genomatica, Inc.
San Diego
CA
|
Family ID: |
1000005681482 |
Appl. No.: |
17/164025 |
Filed: |
February 1, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15888222 |
Feb 5, 2018 |
10961553 |
|
|
17164025 |
|
|
|
|
14720240 |
May 22, 2015 |
9890401 |
|
|
15888222 |
|
|
|
|
13647185 |
Oct 8, 2012 |
9068201 |
|
|
14720240 |
|
|
|
|
12575430 |
Oct 7, 2009 |
8999686 |
|
|
13647185 |
|
|
|
|
61109131 |
Oct 28, 2008 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 9/0004 20130101;
A61K 31/045 20130101; B21D 51/2692 20130101; Y02A 50/30 20180101;
C12N 1/205 20210501; C12P 7/64 20130101; C12N 1/20 20130101; C12N
2502/99 20130101; C12R 2001/01 20210501; C12P 7/04 20130101; C12N
2501/71 20130101 |
International
Class: |
C12P 7/64 20060101
C12P007/64; C12N 1/20 20060101 C12N001/20; B21D 51/26 20060101
B21D051/26; C12P 7/04 20060101 C12P007/04 |
Claims
1. A host cell genetically engineered to express a gene encoding a
carboxylic acid reductase comprising an amino acid sequence having
at least about 80% sequence identity to the amino acid sequence of
SEQ ID NO:18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44,
46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78,
80, 82, 84, 86, 88, 90, 92, 264, 266, 268, 270, or 272, and a gene
encoding an alcohol dehydrogenase.
2. The host cell of claim 1, genetically engineered to express a
gene encoding a fatty acid synthase in the host cell.
3. The host cell of claim 2, wherein modifying the expression of a
gene encoding a fatty acid synthase comprises expressing a gene
encoding a thioesterase in the host cell.
4. (canceled)
5. The host cell of claim 1, wherein the alcohol dehydrogenase
comprises an amino acid sequence having at least 80% sequence
identity to the amino acid sequence of SEQ ID NO:94, 96, 98, 100,
102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126,
128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178,
180, 182, 184, 186, 188, 190, 192, or 194.
6. The host cell of claim 1, wherein the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell.
7. The host cell of claim 6, wherein the fatty acid degradation
enzyme is an acyl-CoA synthase.
8.-28. (canceled)
29. The host cell of claim 1, wherein the host cell is selected
from the group consisting of a mammalian cell, plant cell, insect
cell, yeast cell, fungus cell, filamentous fungi cell, and
bacterial cell.
30. (canceled)
31. The host cell of claim 1, wherein the host cell produces a
C.sub.6-C.sub.26 fatty alcohol.
32. The host cell of claim 31, wherein the fatty alcohol is a
C.sub.6, C.sub.8, C.sub.10, C.sub.12, C.sub.13, C.sub.14, C.sub.15,
C.sub.16, C.sub.17, or C.sub.18 fatty alcohol.
33. The host cell of claim 32, wherein the hydroxyl group is in the
primary (C.sub.1) position.
34. The host cell of claim 31, wherein the fatty alcohol is an
unsaturated fatty alcohol.
35. The host cell of claim 34, wherein the unsaturated fatty
alcohol is C10:1, C12:1, C14:1, C16:1, or C18:1.
36. The host cell of claim 35, wherein the fatty alcohol is
unsaturated at the omega-7 position.
37. The host cell of claim 34, wherein the unsaturated fatty
alcohol comprises a cis double bond.
38. The host cell of claim 31, wherein the fatty alcohol is a
saturated fatty alcohol.
39.-50. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/109,131, filed Oct. 28, 2008, the entire
contents of which are hereby incorporated by reference herein.
BACKGROUND OF THE INVENTION
[0002] Petroleum is a limited, natural resource found in the Earth
in liquid, gaseous, or solid forms. Petroleum is primarily composed
of hydrocarbons, which are comprised mainly of carbon and hydrogen.
It also contains significant amounts of other elements, such as,
nitrogen, oxygen, or sulfur, in different forms.
[0003] Petroleum is a valuable resource, but petroleum products are
developed at considerable costs, both financial and environmental.
First, sources of petroleum must be discovered. Petroleum
exploration is an expensive and risky venture. The cost of
exploring deep water wells can exceed $100 million. Moreover, there
is no guarantee that these wells will contain petroleum. It is
estimated that only 40% of drilled wells lead to productive wells
generating commercial hydrocarbons. In addition to the economic
cost, petroleum exploration carries a high environmental cost. For
example, offshore exploration disturbs the surrounding marine
environments.
[0004] After a productive well is discovered, the petroleum must be
extracted from the Earth at great expense. During primary recovery,
the natural pressure underground is sufficient to extract about 20%
of the petroleum in the well. As this natural pressure falls,
secondary recovery methods are employed, if economical. Generally,
secondary recovery involves increasing the well's pressure by, for
example, water injection, natural gas injection, or gas lift. Using
secondary recovery methods, an additional 5% to 15% of petroleum is
recovered. Once secondary recovery methods are exhausted, tertiary
recovery methods can be used, if economical. Tertiary methods
involve reducing the viscosity of the petroleum to make it easier
to extract. Using tertiary recovery methods, an additional 5% to
15% of petroleum is recovered. Hence, even under the best
circumstances, only 50% of the petroleum in a well can be
extracted. Petroleum extraction also carries an environmental cost.
For example, petroleum extraction can result in large seepages of
petroleum rising to the surface. Moreover, offshore drilling
involves dredging the seabed which disrupts or destroys the
surrounding marine environment.
[0005] Since petroleum deposits are not found uniformly throughout
the Earth, petroleum must be transported over great distances from
petroleum producing regions to petroleum consuming regions. In
addition to the shipping costs, there is also the environmental
risk of devastating oil spills.
[0006] In its natural form, crude petroleum extracted from the
Earth has few commercial uses. It is a mixture of hydrocarbons
(e.g., paraffins (or alkanes), olefins (or alkenes), alkynes,
napthenes (or cycloalkanes), aliphatic compounds, aromatic
compounds, etc.) of varying length and complexity. In addition,
crude petroleum contains other organic compounds (e.g., organic
compounds containing nitrogen, oxygen, sulfur, etc.) and impurities
(e.g., sulfur, salt, acid, metals, etc.).
[0007] Hence, crude petroleum must be refined and purified before
it can be used commercially. Due to its high energy density and its
easy transportability, most petroleum is refined into fuels, such
as transportation fuels (e.g., gasoline, diesel, aviation fuel,
etc.), heating oil, liquefied petroleum gas, etc.
[0008] Crude petroleum is also a primary source of raw materials
for producing petrochemicals. The two main classes of raw materials
derived from petroleum are short chain olefins (e.g., ethylene and
propylene) and aromatics (e.g., benzene and xylene isomers). These
raw materials are derived from longer chain hydrocarbons in crude
petroleum by cracking it at considerable expense using a variety of
methods, such as catalytic cracking, steam cracking, or catalytic
reforming. These raw materials are used to make petrochemicals,
which cannot be directly refined from crude petroleum, such as
monomers, solvents, detergents, or adhesives.
[0009] One example of a raw material derived from crude petroleum
is ethylene. Ethylene is used to produce petrochemicals, such as
polyethylene, ethanol, ethylene oxide, ethylene glycol, polyester,
glycol ether, ethoxylate, vinyl acetate, 1,2-dichloroethane,
trichloroethylene, tetrachloroethylene, vinyl chloride, and
polyvinyl chloride. An additional example of a raw material is
propylene, which is used to produce isopropyl alcohol,
acrylonitrile, polypropylene, propylene oxide, propylene glycol,
glycol ethers, butylene, isobutylene, 1,3-butadiene, synthetic
elastomers, polyolefins, alpha-olefins, fatty alcohols, acrylic
acid, acrylic polymers, allyl chloride, epichlorohydrin, and epoxy
resins.
[0010] These petrochemicals can then be used to make specialty
chemicals, such as plastics, resins, fibers, elastomers,
pharmaceuticals, lubricants, or gels. Particular specialty
chemicals that can be produced from petrochemical raw materials are
fatty acids, hydrocarbons (e.g., long chain, branched chain,
saturated, unsaturated, etc.), fatty alcohols, esters, fatty
aldehydes, ketones, lubricants, etc.
[0011] Fatty alcohols have many commercial uses. Worldwide annual
sales of fatty alcohols and their derivatives are in excess of US$1
billion. The shorter chain fatty alcohols are used in the cosmetic
and food industries as emulsifiers, emollients, and thickeners. Due
to their amphiphilic nature, fatty alcohols behave as nonionic
surfactants, which are useful in personal care and household
products, for example, detergents. In addition, fatty alcohols are
used in waxes, gums, resins, pharmaceutical salves and lotions,
lubricating oil additives, textile antistatic and finishing agents,
plasticizers, cosmetics, industrial solvents, and solvents for
fats.
[0012] Aldehydes are used to produce many specialty chemicals. For
example, aldehydes are used to produce polymers, resins (e.g.,
Bakelite), dyes, flavorings, plasticizers, perfumes,
pharmaceuticals, and other chemicals. Some are used as solvents,
preservatives, or disinfectants. Some natural and synthetic
compounds, such as vitamins and hormones, are aldehydes. In
addition, many sugars contain aldehyde groups.
[0013] Obtaining these specialty chemicals from crude petroleum
requires a significant financial investment as well as a great deal
of energy. It is also an inefficient process because frequently the
long chain hydrocarbons in crude petroleum are cracked to produce
smaller monomers. These monomers are then used as the raw material
to manufacture the more complex specialty chemicals.
[0014] In addition to the problems with exploring, extracting,
transporting, and refining petroleum, petroleum is a limited and
dwindling resource. One estimate of world petroleum consumption is
30 billion barrels per year. By some estimates, it is predicted
that at current production levels, the world's petroleum reserves
could be depleted before the year 2050.
[0015] Finally, the burning of petroleum based fuels releases
greenhouse gases (e.g., carbon dioxide) and other forms of air
pollution (e.g., carbon monoxide, sulfur dioxide, etc.). As the
world's demand for fuel increases, the emission of greenhouse gases
and other forms of air pollution also increases. The accumulation
of greenhouse gases in the atmosphere can lead to an increase
global warming. Hence, in addition to damaging the environment
locally (e.g., oil spills, dredging of marine environments, etc.),
burning petroleum also damages the environment globally.
[0016] Due to the inherent challenges posed by petroleum, there is
a need for a renewable petroleum source that does not need to be
explored, extracted, transported over long distances, or
substantially refined like petroleum. There is also a need for a
renewable petroleum source which can be produced economically
without creating the type of environmental damage produced by the
petroleum industry and the burning of petroleum based fuels. For
similar reasons, there is also a need for a renewable source of
chemicals which are typically derived from petroleum.
[0017] One method of producing renewable petroleum is by
engineering microorganisms to produce renewable petroleum products.
Some microorganisms have a natural ability to produce chemicals.
For example, yeast has been used for centuries to produce ethanol
(e.g., beer, wine, etc.). In recent years, through the development
of advanced biotechnologies, it is possible to metabolically
engineer an organism to produce bioproducts that were never
previously produced. Products, such as chemicals, derived from
these cellular activities are known as bioproducts. Fuels produced
these cellular activities are known as biofuels. Biofuels are a
renewable alternative fuel to petroleum based fuels. Biofuels can
be substituted for any petroleum based fuel (e.g., gasoline,
diesel, aviation fuel, heating oil, etc.). Biofuels can be derived
from renewable sources, such as plant matter, animal matter, or
even waste products. These renewable sources are collectively known
as biomass. One advantage of biofuels over petroleum based fuels is
that they do not require expensive and risky exploration or
extraction. In addition, biofuels can be locally produced. Hence,
they do not require transportation over long distances. Moreover,
biofuels can be made directly without the need for expensive and
energy intensive refining as is needed with refining crude
petroleum. In other circumstances, the biofuel may require a
limited and cost-effective level of refining. Furthermore, the use
of biofuels improves the environment by reducing the amount of
environmentally harmful emissions (e.g., green house gases, air
pollution, etc.) released during combustion. For example, biofuels
maintain a balanced carbon cycle because biofuels are produced from
biomass, a renewable, natural resource. While the burning of
biofuels will release carbon (e.g., as carbon dioxide), this carbon
will be recycled during the production of biomass (e.g., the
cultivation of crops), thereby balancing the carbon cycle unlike
petroleum based fuels.
[0018] For similar reasons, biologically derived chemicals offer
the same advantages as biofuels over petroleum based fuels.
Biologically derived chemicals are a renewable alternative to
petrochemicals. Biologically derived chemicals, such as
hydrocarbons (e.g., alkanes, alkenes, or alkynes), fatty alcohols,
esters, fatty acids, fatty aldehydes, and ketones are superior to
petrochemicals because they are produced directly without extensive
refining. Unlike petrochemicals, biologically derived chemicals do
not need to be refined like crude petroleum to recover raw
materials which must then be further processed to make more complex
petrochemicals. Biologically derived chemicals are directly
converted from biomass to the desired chemical product.
SUMMARY OF THE INVENTION
[0019] The invention is based, at least in part, on the
identification of genes that encode fatty aldehyde biosynthetic
polypeptides and fatty alcohol biosynthetic polypeptides, which can
be used to produce fatty aldehydes that can subsequently be
converted into fatty alcohols. Accordingly, in one aspect, the
invention features a method of making a fatty alcohol. The method
includes expressing in a host cell a gene encoding a fatty aldehyde
biosynthetic polypeptide comprising the amino acid sequence of SEQ
ID NO:18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46,
48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80,
82, 84, 86, 88, 90, 92, 264, 266, 268, 270, or 272, or a variant
thereof. In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0020] In some embodiments, the fatty aldehyde biosynthetic
polypeptide comprises the amino acid sequence of SEQ ID NO:18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88,
90, 92, 264, 266, 268, 270, or 272 with one or more amino acid
substitutions, additions, insertions, or deletions, and the
polypeptide has carboxylic acid reductase activity. In some
embodiments, the polypeptide has fatty acid reductase activity.
[0021] In some embodiments, the polypeptide comprises one or more
of the following conservative amino acid substitutions: replacement
of an aliphatic amino acid, such as alanine, valine, leucine, and
isoleucine, with another aliphatic amino acid; replacement of a
serine with a threonine; replacement of a threonine with a serine;
replacement of an acidic residue, such as aspartic acid and
glutamic acid, with another acidic residue; replacement of a
residue bearing an amide group, such as asparagine and glutamine,
with another residue bearing an amide group; exchange of a basic
residue, such as lysine and arginine, with another basic residue;
and replacement of an aromatic residue, such as phenylalanine and
tyrosine, with another aromatic residue. In some embodiments, the
polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30,
40, 50, 60, 70, 80, 90, 100, or more amino acid substitutions,
additions, insertions, or deletions. In some embodiments, the
polypeptide has carboxylic acid reductase activity. In some
embodiments, the polypeptide has fatty acid reductase activity.
[0022] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0023] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof.
[0024] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0025] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0026] In some embodiments, the polypeptide is from a bacterium, a
plant, an insect, a yeast, a fungus, or a mammal.
[0027] In certain embodiments, the polypeptide is from a mammalian
cell, plant cell, insect cell, yeast cell, fungus cell, filamentous
fungi cell, bacterial cell, or any other organism described herein.
In some embodiments, the bacterium is a Mycobacterium selected from
the group consisting of Mycobacterium smegmatis, Mycobacterium
abscessus, Mycobacterium avium, Mycobacterium bovis, Mycobacterium
tuberculosis, Mycobacterium leprae, Mycobacterium marinum, and
Mycobacterium ulcerans. In other embodiments, the bacterium is
Nocardia sp. NRRL 5646, Nocardia farcinica, Streptomyces griseus,
Salinispora arenicola, or Clavibacter michiganenesis.
[0028] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty aldehyde biosynthetic polypeptide.
[0029] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a gene encoding a fatty aldehyde biosynthetic polypeptide
comprising an amino acid sequence having at least about 70%, at
least about 75%, at least about 80%, at least about 85%, at least
about 90%, at least about 91%, at least about 92%, at least about
93%, at least about 94%, at least about 95%, at least about 96%, at
least about 97%, at least about 98%, or at least about 99% sequence
identity to the amino acid sequence of SEQ ID NO:18, 20, 22, 24,
26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58,
60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92,
264, 266, 268, 270, or 272. In some embodiments, the amino acid
sequence is the amino acid sequence of SEQ ID NO:18, 20, 22, 24,
26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58,
60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92,
264, 266, 268, 270, or 272.
[0030] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0031] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0032] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof
[0033] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0034] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0035] In some embodiments, the polypeptide is from a bacterium, a
plant, an insect, a yeast, a fungus, or a mammal.
[0036] In certain embodiments, the polypeptide is from a mammalian
cell, plant cell, insect cell, yeast cell, fungus cell, filamentous
fungi cell, bacterial cell, or any other organism described herein.
In some embodiments, the bacterium is a Mycobacterium selected from
the group consisting of Mycobacterium smegmatis, Mycobacterium
abscessus, Mycobacterium avium, Mycobacterium bovis, Mycobacterium
tuberculosis, Mycobacterium leprae, Mycobacterium marinum, and
Mycobacterium ulcerans. In other embodiments, the bacterium is
Nocardia sp. NRRL 5646, Nocardia farcinica, Streptomyces griseus,
Salinispora arenicola, or Clavibacter michiganenesis.
[0037] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty aldehyde biosynthetic polypeptide.
[0038] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a polynucleotide that hybridizes to a complement of the
nucleotide sequence of SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31,
33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65,
67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 263, 265, 267,
269, or 271, or to a fragment thereof, wherein the polynucleotide
encodes a polypeptide having carboxylic acid reductase activity. In
some embodiments, the polypeptide has fatty acid reductase
activity.
[0039] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0040] In some embodiments, the polynucleotide hybridizes under low
stringency, medium stringency, high stringency, or very high
stringency conditions, to a complement of the nucleotide sequence
of SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41,
43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75,
77, 79, 81, 83, 85, 87, 89, 91, 263, 265, 267, 269, or 271, or to a
fragment thereof.
[0041] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0042] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof.
[0043] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0044] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0045] In some embodiments, the polynucleotide is from a bacterium,
a plant, an insect, a yeast, a fungus, or a mammal.
[0046] In certain embodiments, the polypeptide is from a mammalian
cell, plant cell, insect cell, yeast cell, fungus cell, filamentous
fungi cell, bacterial cell, or any other organism described herein.
In some embodiments, the bacterium is a Mycobacterium selected from
the group consisting of Mycobacterium smegmatis, Mycobacterium
abscessus, Mycobacterium avium, Mycobacterium bovis, Mycobacterium
tuberculosis, Mycobacterium leprae, Mycobacterium marinum, and
Mycobacterium ulcerans. In other embodiments, the bacterium is
Nocardia sp. NRRL 5646, Nocardia farcinica, Streptomyces griseus,
Salinispora arenicola, or Clavibacter michiganenesis.
[0047] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty aldehyde biosynthetic polypeptide.
[0048] In another aspect, the invention features a method of
producing a fatty alcohol. The method comprises expressing in a
host cell a gene encoding a fatty aldehyde biosynthetic polypeptide
comprising the amino acid of SEQ ID NO:16, or a variant thereof. In
some embodiments, the method further includes isolating the fatty
alcohol from the host cell. In some embodiments, the fatty alcohol
is present in the extracellular environment. In certain
embodiments, the fatty alcohol is isolated from the extracellular
environment of the host cell. In some embodiments, the fatty
alcohol is secreted from the host cell. In alternative embodiments,
the fatty alcohol is transported into the extracellular
environment. In other embodiments, the fatty alcohol is passively
transported into the extracellular environment.
[0049] In some embodiments, the polypeptide comprises the amino
acid sequence of SEQ ID NO:16 with one or more amino acid
substitutions, additions, insertions, or deletions, wherein the
polypeptide has carboxylic acid reductase activity. In some
embodiments, the polypeptide has fatty acid reductase activity.
[0050] In some embodiments, the polypeptide comprises one or more
of the following conservative amino acid substitutions: replacement
of an aliphatic amino acid, such as alanine, valine, leucine, and
isoleucine, with another aliphatic amino acid; replacement of a
serine with a threonine; replacement of a threonine with a serine;
replacement of an acidic residue, such as aspartic acid and
glutamic acid, with another acidic residue; replacement of a
residue bearing an amide group, such as asparagine and glutamine,
with another residue bearing an amide group; exchange of a basic
residue, such as lysine and arginine, with another basic residue;
and replacement of an aromatic residue, such as phenylalanine and
tyrosine, with another aromatic residue. In some embodiments, the
polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30,
40, 50, 60, 70, 80, 90, 100, or more amino acid substitutions,
additions, insertions, or deletions. In some embodiments, the
polypeptide has carboxylic acid reductase activity. In some
embodiments, the polypeptide has fatty acid reductase activity.
[0051] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0052] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof
[0053] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0054] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0055] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty aldehyde biosynthetic polypeptide.
[0056] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a gene encoding a fatty aldehyde biosynthetic polypeptide
comprising an amino acid sequence having at least about 70%
sequence identity to the amino acid sequence of SEQ ID NO:16.
[0057] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In certain embodiments, the
fatty alcohol is isolated from the extracellular environment of the
host cell. In some embodiments, the fatty alcohol is secreted from
the host cell.
[0058] In some embodiments, the amino acid sequence has at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 91%, at least about 92%, at least about 93%, at
least about 94%, at least about 95%, at least about 96%, at least
about 97%, at least about 98%, or at least about 99% sequence
identity to the amino acid sequence of SEQ ID NO:16. In some
embodiments, the amino acid sequence is SEQ ID NO:16.
[0059] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0060] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof.
[0061] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0062] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0063] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty aldehyde biosynthetic polypeptide.
[0064] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a polynucleotide that hybridizes to a complement of the
nucleotide sequence of SEQ ID NO:15, or to a fragment thereof,
wherein the polynucleotide encodes a polypeptide having carboxylic
acid reductase activity. In some embodiments, the polypeptide has
fatty acid reductase activity.
[0065] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0066] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof.
[0067] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0068] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0069] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0070] In some embodiments, the polynucleotide hybridizes under low
stringency, medium stringency, high stringency, or very high
stringency conditions, to a complement of the nucleotide sequence
of SEQ ID NO:15, or to a fragment thereof.
[0071] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty aldehyde biosynthetic polypeptide.
[0072] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a recombinant vector comprising a fatty aldehyde biosynthetic
nucleotide sequence having at least about 70% sequence identity to
a nucleotide sequence listed in FIG. 8. In some embodiments, the
nucleotide sequence has at least about 75%, at least about 80%, at
least about 85%, at least about 90%, at least about 91%, at least
about 92%, at least about 93%, at least about 94%, at least about
95%, at least about 96%, at least about 97%, at least about 98%, or
at least about 99% sequence identity to the nucleotide sequence of
SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43,
45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77,
79, 81, 83, 85, 87, 89, 91, 263, 265, 267, 269, or 271. In some
embodiments, the nucleotide sequence is SEQ ID NO:17, 19, 21, 23,
25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57,
59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91,
263, 265, 267, 269, or 271.
[0073] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0074] In some embodiments, the recombinant vector further
comprises a promoter operably linked to the nucleotide sequence. In
certain embodiments, the promoter is a developmentally-regulated,
an organelle-specific, a tissue-specific, an inducible, a
constitutive, or a cell-specific promoter.
[0075] In other embodiments, the recombinant vector comprises at
least one sequence selected from the group consisting of (a) a
regulatory sequence operatively coupled to the nucleotide sequence;
(b) a selection marker operatively coupled to the nucleotide
sequence; (c) a marker sequence operatively coupled to the
nucleotide sequence; (d) a purification moiety operatively coupled
to the nucleotide sequence; (e) a secretion sequence operatively
coupled to the nucleotide sequence; and (f) a targeting sequence
operatively coupled to the nucleotide sequence.
[0076] In some embodiments, the recombinant vector is a
plasmid.
[0077] In some embodiments, the host cell expresses a polypeptide
encoded by the recombinant vector. In some embodiments, the
nucleotide sequence is stably incorporated into the genomic DNA of
the host cell, and the expression of the nucleotide sequence is
under the control of a regulated promoter region.
[0078] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0079] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof.
[0080] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0081] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0082] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for a fatty aldehyde biosynthetic polypeptide.
[0083] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a recombinant vector comprising a fatty aldehyde biosynthetic
nucleotide sequence having at least about 70% sequence identity to
the nucleotide sequence of SEQ ID NO:15.
[0084] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0085] In some embodiments, the nucleotide sequence has at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 91%, at least about 92%, at least about 93%, at
least about 94%, at least about 95%, at least about 96%, at least
about 97%, at least about 98%, or at least about 99% sequence
identity to the nucleotide sequence of SEQ ID NO:15. In some
embodiments, the nucleotide sequence is the nucleotide sequence of
SEQ ID NO:15.
[0086] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0087] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof.
[0088] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0089] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0090] In some embodiments, the recombinant vector further
comprises a promoter operably linked to the nucleotide sequence. In
certain embodiments, the promoter is a developmentally-regulated,
an organelle-specific, a tissue-specific, an inducible, a
constitutive, or a cell-specific promoter.
[0091] In other embodiments, the recombinant vector comprises at
least one sequence selected from the group consisting of (a) a
regulatory sequence operatively coupled to the nucleotide sequence;
(b) a selection marker operatively coupled to the nucleotide
sequence; (c) a marker sequence operatively coupled to the
nucleotide sequence; (d) a purification moiety operatively coupled
to the nucleotide sequence; (e) a secretion sequence operatively
coupled to the nucleotide sequence; and (f) a targeting sequence
operatively coupled to the nucleotide sequence.
[0092] In some embodiments, the recombinant vector is a
plasmid.
[0093] In some embodiments, the host cell expresses a polypeptide
encoded by the recombinant vector. In some embodiments, the
nucleotide sequence is stably incorporated into the genomic DNA of
the host cell, and the expression of the nucleotide sequence is
under the control of a regulated promoter region.
[0094] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for a fatty aldehyde biosynthetic polypeptide.
[0095] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a gene encoding a fatty aldehyde biosynthetic polypeptide
comprising (i) SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID
NO:10; (ii) SEQ ID NO: 11, SEQ ID NO:12, SEQ ID NO:13, or SEQ ID
NO:14; and/or (iii) SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, and SEQ
ID NO:11; wherein the polypeptide has carboxylic acid reductase
activity. In some embodiments, the polypeptide has fatty acid
reductase activity.
[0096] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0097] In some embodiments, the polypeptide is about 1,000 amino
acids to about 2,000 amino acids in length. In certain embodiments,
the polypeptide is about 1,000 amino acids in length, about 1,050
amino acids in length, about 1,100 amino acids in length, about
1,150 amino acids in length, about 1,200 amino acids in length,
about 1,250 amino acids in length, about 1,300 amino acids in
length, about 1,400 amino acids in length, about 1,500 amino acids
in length, about 1,600 amino acids in length, about 1,700 amino
acids in length, about 1,800 amino acids in length, about 1,900
amino acids in length, or about 2,000 amino acids in length. In
other embodiments, the polypeptide is up to about 2,000 amino acids
in length, up to about 1,900 amino acids in length, up to about
1,800 amino acids in length, up to about 1,700 amino acids in
length, up to about 1,600 amino acids in length, up to about 1,500
amino acids in length, up to about 1,400 amino acids in length, up
to about 1,300 amino acids in length, up to about 1,250 amino acids
in length, up to about 1,200 amino acids in length, up to about
1,150 amino acids in length, up to about 1,100 amino acids in
length, up to about 1,050 amino acids in length, or up to about
1,000 amino acids in length. In other embodiments, the polypeptide
is more than about 1,000 amino acids in length, more than about
1,050 amino acids in length, more than about 1,100 amino acids in
length, more than about 1,150 amino acids in length, more than
about 1,200 amino acids in length, more than about 1,250 amino
acids in length, more than about 1,300 amino acids in length, more
than about 1,400 amino acids in length, more than about 1,500 amino
acids in length, more than about 1,600 amino acids in length, more
than about 1,700 amino acids in length, more than about 1,800 amino
acids in length, more than about 1,900 amino acids in length, or
about 2,000 amino acids in length.
[0098] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0099] In some embodiments, the method further includes expressing
a gene encoding a fatty alcohol biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty alcohol
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194, or a
variant thereof.
[0100] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0101] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0102] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty aldehyde biosynthetic polypeptide.
[0103] In another aspect, the invention features a method of making
a fatty alcohol. The method includes expressing in a host cell a
gene encoding a fatty alcohol biosynthetic polypeptide comprising
the amino acid sequence of SEQ ID NO:94, 96, 98, 100, 102, 104,
106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130,
132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156,
158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, or 194, or a variant thereof. In some
embodiments, the method further includes isolating the fatty
alcohol from the host cell. In some embodiments, the fatty alcohol
is present in the extracellular environment. In certain
embodiments, the fatty alcohol is isolated from the extracellular
environment of the host cell. In some embodiments, the fatty
alcohol is secreted from the host cell. In alternative embodiments,
the fatty alcohol is transported into the extracellular
environment. In other embodiments, the fatty alcohol is passively
transported into the extracellular environment.
[0104] In some embodiments, the fatty alcohol biosynthetic
polypeptide comprises the amino acid sequence of SEQ ID NO:94, 96,
98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148,
150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174,
176, 178, 180, 182, 184, 186, 188, 190, 192, or 194 with one or
more amino acid substitutions, additions, insertions, or deletions,
and the polypeptide has alcohol dehydrogenase activity.
[0105] In some embodiments, the polypeptide comprises one or more
of the following conservative amino acid substitutions: replacement
of an aliphatic amino acid, such as alanine, valine, leucine, and
isoleucine, with another aliphatic amino acid; replacement of a
serine with a threonine; replacement of a threonine with a serine;
replacement of an acidic residue, such as aspartic acid and
glutamic acid, with another acidic residue; replacement of a
residue bearing an amide group, such as asparagine and glutamine,
with another residue bearing an amide group; exchange of a basic
residue, such as lysine and arginine, with another basic residue;
and replacement of an aromatic residue, such as phenylalanine and
tyrosine, with another aromatic residue. In some embodiments, the
polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30,
40, 50, 60, 70, 80, 90, 100, or more amino acid substitutions,
additions, insertions, or deletions. In some embodiments, the
polypeptide has alcohol dehydrogenase activity.
[0106] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0107] In some embodiments, the method further includes expressing
a gene encoding a fatty aldehyde biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty aldehyde
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46,
48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80,
82, 84, 86, 88, 90, 92, 264, 266, 268, 270, or 272, or a variant
thereof.
[0108] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0109] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA. In
other embodiments, the host cell is genetically engineered to
express an attenuated level of a ketoacyl-ACP synthase, such as an
enzyme encoded by fabB. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0110] In some embodiments, the polypeptide is from a bacterium, a
plant, an insect, a yeast, a fungus, or a mammal.
[0111] In certain embodiments, the polypeptide is from a bacterium.
In some embodiments, the bacterium is a Mycobacterium selected from
the group consisting of Mycobacterium smegmatis, Mycobacterium
abscessus, Mycobacterium avium, Mycobacterium bovis, Mycobacterium
tuberculosis, Mycobacterium leprae, Mycobacterium marinum, and
Mycobacterium ulcerans. In other embodiments, the bacterium is
Nocardia sp. NRRL 5646, Nocardia farcinica, Streptomyces griseus,
Salinispora arenicola, or Clavibacter michiganenesis.
[0112] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty alcohol biosynthetic polypeptide.
[0113] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a gene encoding a fatty alcohol biosynthetic polypeptide
comprising an amino acid sequence having at least about 70%, at
least about 75%, at least about 80%, at least about 85%, at least
about 90%, at least about 91%, at least about 92%, at least about
93%, at least about 94%, at least about 95%, at least about 96%, at
least about 97%, at least about 98%, or at least about 99% sequence
identity to the amino acid sequence of SEQ ID NO:94, 96, 98, 100,
102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126,
128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178,
180, 182, 184, 186, 188, 190, 192, or 194. In some embodiments, the
amino acid sequence is SEQ ID NO:94, 96, 98, 100, 102, 104, 106,
108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132,
134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158,
160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184,
186, 188, 190, 192, or 194.
[0114] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0115] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0116] In some embodiments, the method further includes expressing
a gene encoding a fatty aldehyde biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty aldehyde
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46,
48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80,
82, 84, 86, 88, 90, 92, 264, 266, 268, 270, or 272, or a variant
thereof.
[0117] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0118] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0119] In some embodiments, the polypeptide is from a bacterium, a
plant, an insect, a yeast, a fungus, or a mammal.
[0120] In certain embodiments, the polypeptide is from a mammalian
cell, plant cell, insect cell, yeast cell, fungus cell, filamentous
fungi cell, bacterial cell, or any other organism described herein.
In some embodiments, the bacterium is a Mycobacterium selected from
the group consisting of Mycobacterium smegmatis, Mycobacterium
abscessus, Mycobacterium avium, Mycobacterium bovis, Mycobacterium
tuberculosis, Mycobacterium leprae, Mycobacterium marinum, and
Mycobacterium ulcerans. In other embodiments, the bacterium is
Nocardia sp. NRRL 5646, Nocardia farcinica, Streptomyces griseus,
Salinispora arenicola, or Clavibacter michiganenesis.
[0121] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty alcohol biosynthetic polypeptide.
[0122] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a polynucleotide that hybridizes to a complement of the
nucleotide sequence of SEQ ID NO:93, 95, 97, 99, 101, 103, 105,
107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131,
133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157,
159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183,
185, 187, 189, 191, or 193, or to a fragment thereof, wherein the
polynucleotide encodes a polypeptide having alcohol dehydrogenase
activity.
[0123] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0124] In some embodiments, the polynucleotide hybridizes under low
stringency, medium stringency, high stringency, or very high
stringency conditions, to a complement of the nucleotide sequence
of SEQ ID NO:93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113,
115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139,
141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165,
167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, or
193, or to a fragment thereof.
[0125] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0126] In some embodiments, the method further includes expressing
a gene encoding a fatty aldehyde biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty aldehyde
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46,
48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80,
82, 84, 86, 88, 90, 92, 264, 266, 268, 270, or 272, or a variant
thereof.
[0127] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0128] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0129] In some embodiments, the polynucleotide is from a bacterium,
a plant, an insect, a yeast, a fungus, or a mammal.
[0130] In certain embodiments, the polypeptide is from a mammalian
cell, plant cell, insect cell, yeast cell, fungus cell, filamentous
fungi cell, bacterial cell, or any other organism described herein.
In some embodiments, the bacterium is a Mycobacterium selected from
the group consisting of Mycobacterium smegmatis, Mycobacterium
abscessus, Mycobacterium avium, Mycobacterium bovis, Mycobacterium
tuberculosis, Mycobacterium leprae, Mycobacterium marinum, and
Mycobacterium ulcerans. In other embodiments, the bacterium is
Nocardia sp. NRRL 5646, Nocardia farcinica, Streptomyces griseus,
Salinispora arenicola, or Clavibacter michiganenesis.
[0131] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for the fatty aldehyde biosynthetic polypeptide.
[0132] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes expressing in a host
cell a recombinant vector comprising a fatty alcohol biosynthetic
nucleotide sequence having at least about 70% sequence identity to
the nucleotide sequence of SEQ ID NO:93, 95, 97, 99, 101, 103, 105,
107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131,
133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157,
159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183,
185, 187, 189, 191, or 193. In some embodiments, the nucleotide
sequence has at least about 75%, at least about 80%, at least about
85%, at least about 90%, at least about 91%, at least about 92%, at
least about 93%, at least about 94%, at least about 95%, at least
about 96%, at least about 97%, at least about 98%, or at least
about 99% sequence identity to the nucleotide sequence of SEQ ID
NO:93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117,
119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143,
145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169,
171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, or 193. In
some embodiments, the nucleotide sequence is of SEQ ID NO:93, 95,
97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,
125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149,
151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175,
177, 179, 181, 183, 185, 187, 189, 191, or 193.
[0133] In some embodiments, the method further includes isolating
the fatty alcohol from the host cell. In some embodiments, the
fatty alcohol is present in the extracellular environment. In
certain embodiments, the fatty alcohol is isolated from the
extracellular environment of the host cell. In some embodiments,
the fatty alcohol is secreted from the host cell. In alternative
embodiments, the fatty alcohol is transported into the
extracellular environment. In other embodiments, the fatty alcohol
is passively transported into the extracellular environment.
[0134] In some embodiments, the recombinant vector further
comprises a promoter operably linked to the nucleotide sequence. In
certain embodiments, the promoter is a developmentally-regulated,
an organelle-specific, a tissue-specific, an inducible, a
constitutive, or a cell-specific promoter.
[0135] In other embodiments, the recombinant vector comprises at
least one sequence selected from the group consisting of (a) a
regulatory sequence operatively coupled to the nucleotide sequence;
(b) a selection marker operatively coupled to the nucleotide
sequence; (c) a marker sequence operatively coupled to the
nucleotide sequence; (d) a purification moiety operatively coupled
to the nucleotide sequence; (e) a secretion sequence operatively
coupled to the nucleotide sequence; and (f) a targeting sequence
operatively coupled to the nucleotide sequence.
[0136] In some embodiments, the recombinant vector is a
plasmid.
[0137] In some embodiments, the host cell expresses a polypeptide
encoded by the recombinant vector. In some embodiments, the
nucleotide sequence is stably incorporated into the genomic DNA of
the host cell, and the expression of the nucleotide sequence is
under the control of a regulated promoter region.
[0138] In some embodiments, the method further includes modifying
the expression of a gene encoding a fatty acid synthase in the host
cell. In certain embodiments, modifying the expression of a gene
encoding a fatty acid synthase includes expressing a gene encoding
a fatty acid synthase in the host cell and/or increasing the
expression or activity of an endogenous fatty acid synthase in the
host cell. In alternate embodiments, modifying the expression of a
gene encoding a fatty acid synthase includes attenuating a gene
encoding a fatty acid synthase in the host cell and/or decreasing
the expression or activity of an endogenous fatty acid synthase in
the host cell. In some embodiments, the fatty acid synthase is a
thioesterase. In particular embodiments, the thioesterase is
encoded by tesA, tesA without leader sequence, tesB, fatB, fatB2,
fatB3, fatA, or fatA1.
[0139] In some embodiments, the method further includes expressing
a gene encoding a fatty aldehyde biosynthetic polypeptide in the
host cell. In particular embodiments, the fatty aldehyde
biosynthetic polypeptide comprises the amino acid sequence of SEQ
ID NO:18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46,
48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80,
82, 84, 86, 88, 90, 92, 264, 266, 268, 270, or 272, or a variant
thereof.
[0140] In other embodiments, the host cell is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type host cell. In some
embodiments, the host cell is genetically engineered to express an
attenuated level of an acyl-CoA synthase relative to a wild type
host cell. In particular embodiments, the host cell expresses an
attenuated level of an acyl-CoA synthase encoded by fadD, fadK,
BH3103, yhfL, Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35,
fadDD22, faa3p or the gene encoding the protein ZP_01644857. In
certain embodiments, the genetically engineered host cell comprises
a knockout of one or more genes encoding a fatty acid degradation
enzyme, such as the aforementioned acyl-CoA synthase genes.
[0141] In yet other embodiments, the host cell is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the host cell
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the host cell is genetically engineered to express an
attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the host cell comprises a knockout of fabB or a gene
listed in FIG. 16. In yet other embodiments, the host cell is
genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0142] In some embodiments, the method further includes culturing
the host cell in the presence of at least one biological substrate
for a fatty alcohol biosynthetic polypeptide.
[0143] In any of the aspects of the invention described herein, the
host cell can be selected from the group consisting of a mammalian
cell, plant cell, insect cell, yeast cell, fungus cell, filamentous
fungi cell, and bacterial cell.
[0144] In some embodiments, the host cell is a Gram-positive
bacterial cell. In other embodiments, the host cell is a
Gram-negative bacterial cell.
[0145] In some embodiments, the host cell is selected from the
genus Escherichia, Bacillus, Lactobacillus, Rhodococcus,
Pseudomonas, Aspergillus, Trichoderma, Neurospora, Fusarium,
Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora,
Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium,
Saccharomyces, Stenotrophamonas, Schizosaccharomyces, Yarrowia, or
Streptomyces.
[0146] In certain embodiments, the host cell is a Bacillus lentus
cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a
Bacillus licheniformis cell, a Bacillus alkalophilus cell, a
Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus
pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii
cell, a Bacillus megaterium cell, a Bacillus subtilis cell, or a
Bacillus amyloliquefaciens cell.
[0147] In other embodiments, the host cell is a Trichoderma
koningii cell, a Trichoderma viride cell, a Trichoderma reesei
cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori
cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell,
an Aspergillus nidulans cell, an Aspergillus niger cell, an
Aspergillus oryzae cell, a Humicola insolens cell, a Humicola
lanuginose cell, a Rhodococcus opacus cell, a Rhizomucor miehei
cell, or a Mucor michei cell.
[0148] In yet other embodiments, the host cell is a Streptomyces
lividans cell or a Streptomyces murinus cell.
[0149] In yet other embodiments, the host cell is an Actinomycetes
cell.
[0150] In some embodiments, the host cell is a Saccharomyces
cerevisiae cell. In some embodiments, the host cell is a
Saccharomyces cerevisiae cell.
[0151] In particular embodiments, the host cell is a cell from an
eukaryotic plant, algae, cyanolacterium, green-sulfur bacterium,
green non-sulfur bacterium, purple sulfur bacterium, purple
non-sulfur bacterium, extremophile, yeast, fungus, engineered
organisms thereof, or a synthetic organism. In some embodiments,
the host cell is light dependent or fixes carbon. In some
embodiments, the host cell is light dependent or fixes carbon. In
some embodiments, the host cell has autotrophic activity. In some
embodiments, the host cell has photoautotrophic activity, such as
in the presence of light. In some embodiments, the host cell is
heterotrophic or mixotrophic in the absence of light. In certain
embodiments, the host cell is a cell from Avabidopsis thaliana,
Panicum virgatum, Miscanthus giganteus, Zea mays, Botryococcuse
braunii, Chlamydomonas reinhardtii, Dunaliela salina, Synechococcus
Sp. PCC 7002, Synechococcus Sp. PCC 7942, Synechocystis Sp. PCC
6803, Thermosynechococcus elongates BP-1, Chlorobium tepidum,
Chloroflexus auranticus, Chromatiumm vinosum, Rhodospirillum
rubrum, Rhodobacter capsulatus, Rhodopseudomonas palusris,
Clostridium ljungdahlii, Clostridium thermocellum, Penicillium
chrysogenum, Pichia pastoris, Saccharomyces cerevisiae,
Schizosaccharomyces pombe, Pseudomonas fluorescens, or Zymomonas
mobilis.
[0152] In other embodiments, the host cell is a CHO cell, a COS
cell, a VERO cell, a BHK cell, a HeLa cell, a Cv1 cell, an MDCK
cell, a 293 cell, a 3T3 cell, or a PC12 cell.
[0153] In yet other embodiments, the host cell is an E. coli cell.
In certain embodiments, the E. coli cell is a strain B, a strain C,
a strain K, or a strain W E. coli cell.
[0154] In another aspect, the invention features a method of
producing a fatty alcohol. The method includes contacting a
substrate with (i) a fatty alcohol biosynthetic polypeptide
comprising the amino acid sequence of SEQ ID NO:94, 96, 98, 100,
102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126,
128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178,
180, 182, 184, 186, 188, 190, 192, or 194, or a variant thereof, or
(ii) a fatty alcohol biosynthetic polypeptide encoded by a
nucleotide sequence having at least about 70% identity to the
nucleotide sequence of SEQ ID NO:93, 95, 97, 99, 101, 103, 105,
107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131,
133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157,
159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183,
185, 187, 189, 191, or 193, or a variant thereof. In some
embodiments, the method further includes purifying the fatty
alcohol.
[0155] In some embodiments, the fatty alcohol biosynthetic
polypeptide comprises the amino acid sequence of SEQ ID NO:94, 96,
98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148,
150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174,
176, 178, 180, 182, 184, 186, 188, 190, 192, or 194 with one or
more amino acid substitutions, additions, insertions, or deletions,
wherein the polypeptide has alcohol dehydrogenase activity.
[0156] In some embodiments, the polypeptide comprises one or more
of the following conservative amino acid substitutions: replacement
of an aliphatic amino acid, such as alanine, valine, leucine, and
isoleucine, with another aliphatic amino acid; replacement of a
serine with a threonine; replacement of a threonine with a serine;
replacement of an acidic residue, such as aspartic acid and
glutamic acid, with another acidic residue; replacement of a
residue bearing an amide group, such as asparagine and glutamine,
with another residue bearing an amide group; exchange of a basic
residue, such as lysine and arginine, with another basic residue;
and replacement of an aromatic residue, such as phenylalanine and
tyrosine, with another aromatic residue. In some embodiments, the
polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30,
40, 50, 60, 70, 80, 90, 100, or more amino acid substitutions,
additions, insertions, or deletions. In some embodiments, the
polypeptide has alcohol dehydrogenase activity.
[0157] In some embodiments, the polypeptide has an amino acid
sequence that is at least about 75%, at least about 80%, at least
about 85%, at least about 90%, at least about 91%, at least about
92%, at least about 93%, at least about 94%, at least about 95%, at
least about 96%, at least about 97%, at least about 98%, or at
least about 99% identical to the amino acid sequence of SEQ ID
NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170,
172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or 194. In
some embodiments, the polypeptide has the amino acid sequence of
SEQ ID NO:94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116,
118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142,
144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168,
170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, or
194.
[0158] In some embodiments, the nucleotide sequence has at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 91%, at least about 92%, at least about 93%, at
least about 94%, at least about 95%, at least about 96%, at least
about 97%, at least about 98%, or at least about 99% sequence
identity to the nucleotide sequence of SEQ ID NO:93, 95, 97, 99,
101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125,
127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151,
153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177,
179, 181, 183, 185, 187, 189, 191, or 193. In some embodiments, the
nucleotide sequence is SEQ ID NO:93, 95, 97, 99, 101, 103, 105,
107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131,
133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157,
159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183,
185, 187, 189, 191, or 193.
[0159] In any of the aspects of the invention described herein, the
methods can produce fatty alcohols comprising a C.sub.6-C.sub.26
fatty alcohol. In some embodiments, the fatty alcohol comprises a
C.sub.6, C.sub.7, C.sub.8, C.sub.9, C.sub.10, C.sub.11, C.sub.12,
C.sub.13, C.sub.14, C.sub.15, C.sub.16, C.sub.17, C.sub.18,
C.sub.19, C.sub.20, C.sub.21, C.sub.22, C.sub.23, C.sub.24,
C.sub.25, or a C.sub.26 fatty alcohol. In particular embodiments,
the fatty alcohol is a C.sub.6, C.sub.8, C.sub.10, C.sub.12,
C.sub.13, C.sub.14, C.sub.15, C.sub.16, C.sub.17, or C.sub.18 fatty
alcohol. In certain embodiments, the hydroxyl group of the fatty
alcohol is in the primary (C1) position.
[0160] In other embodiments, the fatty alcohol comprises a straight
chain fatty alcohol. In other embodiments, the fatty alcohol
comprises a branched chain fatty alcohol. In yet other embodiments,
the fatty alcohol comprises a cyclic moiety.
[0161] In some embodiments, the fatty alcohol is an unsaturated
fatty alcohol. In other embodiments, the fatty alcohol is a
monounsaturated fatty alcohol. In certain embodiments, the
unsaturated fatty alcohol is a C6:1, C7:1, C8:1, C9:1, C10:1,
C11:1, C12:1, C13:1, C14:1, C15:1, C16:1, C17:1, C18:1, C19:1,
C20:1, C21:1, C22:1, C23:1, C24:1, C25:1, or a C26:1 unsaturated
fatty alcohol. In yet other embodiments, the fatty alcohol is
unsaturated at the omega-7 position. In certain embodiments, the
unsaturated fatty alcohol comprises a cis double bond.
[0162] In yet other embodiments, the fatty alcohol is a saturated
fatty alcohol.
[0163] In any of the aspects of the invention described herein, a
substrate for a fatty aldehyde biosynthetic polypeptide can be a
fatty acid. In some embodiments, the fatty acid comprises a
C.sub.6-C.sub.26 fatty acid. In some embodiments, the fatty acid
comprises a C.sub.6, C.sub.7, C.sub.8, C.sub.9, C.sub.10, C.sub.11,
C.sub.12, C.sub.13, C.sub.14, C.sub.15, C.sub.16, C.sub.17,
C.sub.18, C.sub.19, C.sub.20, C.sub.21, C.sub.22, C.sub.23,
C.sub.24, C.sub.2u, or a C.sub.26 fatty acid. In particular
embodiments, the fatty acid is a C.sub.6, C.sub.8, C.sub.10,
C.sub.12, C.sub.13, C.sub.14, C.sub.15, C.sub.16, C.sub.17, or
C.sub.18 fatty acid.
[0164] In other embodiments, the fatty acid comprises a straight
chain fatty acid. In other embodiments, the fatty acid comprises a
branched chain fatty acid. In yet other embodiments, the fatty acid
comprises a cyclic moiety.
[0165] In some embodiments, the fatty acid is an unsaturated fatty
acid. In other embodiments, the fatty acid is a monounsaturated
fatty acid. In yet other embodiments, the fatty acid is a saturated
fatty acid.
[0166] In another aspect, the invention features a genetically
engineered microorganism comprising an exogenous control sequence
stably incorporated into the genomic DNA of the microorganism
upstream of a polynucleotide comprising a nucleotide sequence
having at least about 70% sequence identity to the nucleotide
sequence of SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37,
39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71,
73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103,
105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129,
131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155,
157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181,
183, 185, 187, 189, 191, 193, 263, 265, 267, 269, or 271, wherein
the microorganism produces an increased level of a fatty alcohol
relative to a wild-type microorganism.
[0167] In some embodiments, the nucleotide sequence has at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 91%, at least about 92%, at least about 93%, at
least about 94%, at least about 95%, at least about 96%, at least
about 97%, at least about 98%, or at least about 99% sequence
identity to the nucleotide sequence of SEQ ID NO:17, 19, 21, 23,
25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57,
59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91,
93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119,
121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145,
147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171,
173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 263, 265,
267, 269, or 271. In some embodiments, the nucleotide sequence is
SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43,
45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77,
79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107,
109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133,
135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159,
161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185,
187, 189, 191, 193, 263, 265, 267, 269, or 271.
[0168] In some embodiments, the polynucleotide is endogenous to the
microorganism.
[0169] In other embodiments, the microorganism is genetically
engineered to express a modified level of a gene encoding a fatty
acid synthase in the host cell. In certain embodiments, the
microorganism expresses a recombinant gene encoding a fatty acid
synthase or expresses an increased level of an endogenous fatty
acid synthase. In alternate embodiments, the microorganism
expresses an attenuated level of a gene encoding a fatty acid
synthase in the host cell and/or a decreased expression or activity
of an endogenous fatty acid synthase. In some embodiments, the
fatty acid synthase is a thioesterase. In particular embodiments,
the thioesterase is encoded by tesA, tesA without leader sequence,
tesB, fatB, fatB2, fatB3, fatA, or fatA1.
[0170] In other embodiments, the microorganism is genetically
engineered to express an attenuated level of a fatty acid
degradation enzyme relative to a wild type microorganism. In some
embodiments, the microorganism expresses an attenuated level of an
acyl-CoA synthase relative to a wild type microorganism. In
particular embodiments, the microorganism expresses an attenuated
level of an acyl-CoA synthase encoded by fadD, fadK, BH3103, yhfL,
Pfl-4354, EAV15023, fadD1, fadD2, RPC_4074, fadDD35, fadDD22, faa3p
or the gene encoding the protein ZP_01644857. In certain
embodiments, the microorganism comprises a knockout of one or more
genes encoding a fatty acid degradation enzyme, such as the
aforementioned acyl-CoA synthase genes.
[0171] In yet other embodiments, the microorganism is genetically
engineered to express an attenuated level of a
dehydratase/isomerase enzyme, such as an enzyme encoded by fabA or
by a gene listed in FIG. 15. In some embodiments, the microorganism
comprises a knockout of fabA or a gene listed in FIG. 15. In other
embodiments, the microorganism is genetically engineered to express
an attenuated level of a ketoacyl-ACP synthase, such as an enzyme
encoded by fabB or by a gene listed in FIG. 16. In certain
embodiments, the microorganism comprises a knockout of fabB or a
gene listed in FIG. 16. In yet other embodiments, the microorganism
is genetically engineered to express a modified level of a gene
encoding a desaturase enzyme, such as desA.
[0172] In some embodiments, the microorganism is a bacterium. In
certain embodiments, the bacterium is a Gram-negative or a
Gram-positive bacterium.
[0173] In some embodiments, the microorganism is a Mycobacterium
selected from the group consisting of Mycobacterium smegmatis,
Mycobacterium abscessus, Mycobacterium avium, Mycobacterium bovis,
Mycobacterium tuberculosis, Mycobacterium leprae, Mycobacterium
marinum, and Mycobacterium ulcerans.
[0174] In other embodiments, the microorganism is Nocardia sp. NRRL
5646, Nocardia farcinica, Streptomyces griseus, Salinispora
arenicola, or Clavibacter michiganenesis.
[0175] In another aspect, the invention features a fatty alcohol
produced by any of the methods or any of the microorganisms
described herein, or a surfactant comprising a fatty alcohol
produced by any of the methods or any of the microorganisms
described herein.
[0176] In some embodiments, the fatty alcohol has a .delta..sup.13C
of about -15.4 or greater. In certain embodiments, the fatty
alcohol has a .delta..sup.13C of about -15.4 to about -10.9, or of
about -13.92 to about -13.84.
[0177] In some embodiments, the fatty alcohol has an
f.sub.M.sup.14C of at least about 1.003. In certain embodiments,
the fatty alcohol has an f.sub.M.sup.14C of at least about 1.01 or
at least about 1.5. In some embodiments, the fatty alcohol has an
f.sub.M.sup.14C of about 1.111 to about 1.124.
[0178] In any of the aspects described herein, a fatty alcohol is
produced at a yield of about 25 mg/L, about 50 mg/L, about 75 mg/L,
about 100 mg/L, about 125 mg/L, about 150 mg/L, about 175 mg/L,
about 200 mg/L, about 225 mg/L, about 250 mg/L, about 275 mg/L,
about 300 mg/L, about 325 mg/L, about 350 mg/L, about 375 mg/L,
about 400 mg/L, about 425 mg/L, about 450 mg/L, about 475 mg/L,
about 500 mg/L, about 525 mg/L, about 550 mg/L, about 575 mg/L,
about 600 mg/L, about 625 mg/L, about 650 mg/L, about 675 mg/L,
about 700 mg/L, about 725 mg/L, about 750 mg/L, about 775 mg/L,
about 800 mg/L, about 825 mg/L, about 850 mg/L, about 875 mg/L,
about 900 mg/L, about 925 mg/L, about 950 mg/L, about 975 mg/L,
about 1000 g/L, about 1050 mg/L, about 1075 mg/L, about 1100 mg/L,
about 1125 mg/L, about 1150 mg/L, about 1175 mg/L, about 1200 mg/L,
about 1225 mg/L, about 1250 mg/L, about 1275 mg/L, about 1300 mg/L,
about 1325 mg/L, about 1350 mg/L, about 1375 mg/L, about 1400 mg/L,
about 1425 mg/L, about 1450 mg/L, about 1475 mg/L, about 1500 mg/L,
about 1525 mg/L, about 1550 mg/L, about 1575 mg/L, about 1600 mg/L,
about 1625 mg/L, about 1650 mg/L, about 1675 mg/L, about 1700 mg/L,
about 1725 mg/L, about 1750 mg/L, about 1775 mg/L, about 1800 mg/L,
about 1825 mg/L, about 1850 mg/L, about 1875 mg/L, about 1900 mg/L,
about 1925 mg/L, about 1950 mg/L, about 1975 mg/L, about 2000 mg/L,
or more.
[0179] In another aspect, the invention features a method of making
a fatty alcohol described herein. The method includes culturing a
host cell described herein in a medium having a low level of iron,
under conditions sufficient to produce a fatty alcohol, as
described herein. In particular embodiments, the medium contains
less than about 500 .mu.M iron, less than about 400 .mu.M iron,
less than about 300 .mu.M iron, less than about 200 .mu.M iron,
less than about 150 .mu.M iron, less than about 100 .mu.M iron,
less than about 90 .mu.M iron, less than about 80 .mu.M iron, less
than about 70 .mu.M iron, less than about 60 .mu.M iron, less than
about 50 .mu.M iron, less than about 40 .mu.M iron, less than about
30 .mu.M iron, less than about 20 .mu.M iron, less than about 10
.mu.M iron, or less than about 5 .mu.M iron. In certain
embodiments, the medium does not contain iron.
[0180] In any of the aspects described herein, a fatty alcohol is
produced in a host cell or a microorganism described herein from a
carbon source.
[0181] The following figures are presented for the purpose of
illustration only, and are not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
[0182] FIG. 1 is a graphic representation of fatty alcohols
produced by recombinant E. coli strains transformed with various
plasmids.
[0183] FIG. 2 is a graphic representation of two GC/MS traces of
organic compounds produced by recombinant E. coli strains
transformed with various plasmids.
[0184] FIG. 3 is a schematic of a new pathway for fatty alcohol
production.
[0185] FIG. 4 is a representation of a gel of PCR products from
MG1655 wild type cells, .DELTA.fadD::cm cells, and .DELTA.fadD
cells.
[0186] FIG. 5A is a GC/MS trace of fatty alcohol production in
MG1655(DE3, .DELTA.fadD)/pETDUet-1-tesA+ pHZ1.140B cells. FIG. 5B
is a GC/MS trace of fatty alcohol production in MG16655(DE3,
.DELTA.fadD, yjgB::kan)/pETDUet-1-tesA+ pHZ1.140B cells. FIG. 5C is
a GC/MS trace of fatty alcohol production in MG16655(DE3,
.DELTA.fadD, yjgB::kan)/pDF1+ pHZ1.140B cells. The arrows in FIG.
5A, FIG. 5B, and FIG. 5C indicate the absence of C12:0 fatty
aldehydes.
[0187] FIG. 6A is a listing of the nucleotide sequence and FIG. 6B
is the corresponding amino acid sequence of Nocardia sp. NRRL 5646
car gene.
[0188] FIG. 7A-7B is a listing of amino acid sequence motifs for
CAR homologs.
[0189] FIG. 8A-8UUU is a listing of nucleotide and amino acid
sequences of car homolog genes.
[0190] FIG. 9A-9P is a table identifying exemplary genes that can
be expressed, overexpressed, or attenuated to increase production
of particular substrates.
[0191] FIG. 10A-10Z is a listing of nucleotide and amino acid
sequences of alcohol dehydrogenase genes.
[0192] FIG. 11 is a graphic representation of fatty alcohol
production in various deletion mutants of E. coli.
[0193] FIG. 12 is a graphic representation of fatty alcohol
production in various deletion mutants of E. coli.
[0194] FIG. 13 is a GC/MS trace of saturated fatty alcohol
production in E. coli.
[0195] FIG. 14A is a graphic representation of fatty alcohol
production in various Hu9 culture media. FIG. 14B is a graphic
representation of fatty alcohol production in various Hu9 culture
media.
[0196] FIG. 15A-15G is a listing of nucleotide and amino acid
sequences of fabA related genes.
[0197] FIG. 16A-16J is a listing of nucleotide and amino acid
sequences of fabB related genes.
[0198] FIG. 17A-H is a listing of additional nucleotide and amino
acid sequences of the disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0199] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. All
publications, patent applications, patents, and other references
mentioned herein, including GenBank database sequences, are
incorporated by reference in their entirety. In case of conflict,
the present specification, including definitions, will control. In
addition, the materials, methods, and examples are illustrative
only and not intended to be limiting.
[0200] Other features and advantages of the invention will be
apparent from the following detailed description, and from the
claims.
Definitions
[0201] Throughout the specification, a reference may be made using
an abbreviated gene name or polypeptide name, but it is understood
that such an abbreviated gene or polypeptide name represents the
genus of genes or polypeptides. Such gene names include all genes
encoding the same polypeptide and homologous polypeptides having
the same physiological function. Polypeptide names include all
polypeptides that have the same activity (e.g., that catalyze the
same fundamental chemical reaction).
[0202] Unless otherwise indicated, the accession numbers referenced
herein are derived from the NCBI database (National Center for
Biotechnology Information) maintained by the National Institute of
Health, U.S.A. Unless otherwise indicated, the accession numbers
are as provided in the database as of October 2008.
[0203] EC numbers are established by the Nomenclature Committee of
the International Union of Biochemistry and Molecular Biology
(NC-IUBMB) (available at http://www.chem.qmul.ac.uk/iubmb/enzyme/).
The EC numbers referenced herein are derived from the KEGG Ligand
database, maintained by the Kyoto Encyclopedia of Genes and
Genomics, sponsored in part by the University of Tokyo. Unless
otherwise indicated, the EC numbers are as provided in the database
as of October 2008.
[0204] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0205] The term "about" is used herein to mean a value .+-.20% of a
given numerical value. Thus, "about 60%" means a value of between
60.+-.(20% of 60) (i.e., between 48 and 70).
[0206] As used herein, the term "alcohol dehydrogenase" (EC
1.1.1.*) is a peptide capable of catalyzing the conversion of a
fatty aldehyde to an alcohol (e.g., fatty alcohol). Additionally,
one of ordinary skill in the art will appreciate that some alcohol
dehydrogenases will catalyze other reactions as well. For example,
some alcohol dehydrogenases will accept other substrates in
addition to fatty aldehydes. Such non-specific alcohol
dehydrogenases are, therefore, also included in this definition.
Nucleic acid sequences encoding alcohol dehydrogenases are known in
the art, and such alcohol dehydrogenases are publicly available.
Exemplary GenBank Accession Numbers are provided in FIG. 9.
[0207] As used herein, the term "attenuate" means to weaken, reduce
or diminish. For example, a polypeptide can be attenuated by
modifying the polypeptide to reduce its activity (e.g., by
modifying a nucleotide sequence that encodes the polypeptide).
[0208] As used herein, the term "biodiesel" means a biofuel that
can be a substitute of diesel, which is derived from petroleum.
Biodiesel can be used in internal combustion diesel engines in
either a pure form, which is referred to as "neat" biodiesel, or as
a mixture in any concentration with petroleum-based diesel.
Biodiesel can include esters or hydrocarbons, such as alcohols.
[0209] As used therein, the term "biofuel" refers to any fuel
derived from biomass. Biofuels can be substituted for petroleum
based fuels. For example, biofuels are inclusive of transportation
fuels (e.g., gasoline, diesel, jet fuel, etc.), heating fuels, and
electricity-generating fuels. Biofuels are a renewable energy
source.
[0210] As used herein, the term "biomass" refers to any biological
material from which a carbon source is derived. In some instances,
a biomass is processed into a carbon source, which is suitable for
bioconversion. In other instances, the biomass may not require
further processing into a carbon source. The carbon source can be
converted into a biofuel. One exemplary source of biomass is plant
matter or vegetation. For example, corn, sugar cane, or switchgrass
can be used as biomass. Another non-limiting example of biomass is
metabolic wastes, such as animal matter, for example cow manure. In
addition, biomass may include algae and other marine plants.
Biomass also includes waste products from industry, agriculture,
forestry, and households. Examples of such waste products that can
be used as biomass are fermentation waste, ensilage, straw, lumber,
sewage, garbage, cellulosic urban waste, and food leftovers.
Biomass also includes sources of carbon, such as carbohydrates
(e.g., monosaccharides, disaccharides, or polysaccharides).
[0211] As used herein, the phrase "carbon source" refers to a
substrate or compound suitable to be used as a source of carbon for
prokaryotic or simple eukaryotic cell growth. Carbon sources can be
in various forms, including, but not limited to polymers,
carbohydrates, acids, alcohols, aldehydes, ketones, amino acids,
peptides, and gases (e.g., CO and CO.sub.2). These include, for
example, various monosaccharides, such as glucose, fructose,
mannose, and galactose; oligosaccharides, such as
fructo-oligosaccharide and galacto-oligosaccharide; polysaccharides
such as xylose and arabinose; disaccharides, such as sucrose,
maltose, and turanose; cellulosic material, such as methyl
cellulose and sodium carboxymethyl cellulose; saturated or
unsaturated fatty acid esters, such as succinate, lactate, and
acetate; alcohols, such as ethanol, methanol, and glycerol, or
mixtures thereof. The carbon source can also be a product of
photosynthesis, including, but not limited to, glucose. A preferred
carbon source is biomass. Another preferred carbon source is
glucose.
[0212] A nucleotide sequence is "complementary" to another
nucleotide sequence if each of the bases of the two sequences
matches (i.e., is capable of forming Watson Crick base pairs). The
term "complementary strand" is used herein interchangeably with the
term "complement". The complement of a nucleic acid strand can be
the complement of a coding strand or the complement of a non-coding
strand.
[0213] As used herein, a "cloud point lowering additive" is an
additive added to a composition to decrease or lower the cloud
point of a solution.
[0214] As used herein, the phrase "cloud point of a fluid" means
the temperature at which dissolved solids are no longer completely
soluble. Below this temperature, solids begin precipitating as a
second phase giving the fluid a cloudy appearance. In the petroleum
industry, cloud point refers to the temperature below which a
solidified material or other heavy hydrocarbon crystallizes in a
crude oil, refined oil, or fuel to form a cloudy appearance. The
presence of solidified materials influences the flowing behavior of
the fluid, the tendency of the fluid to clog fuel filters,
injectors, etc., the accumulation of solidified materials on cold
surfaces (e.g., a pipeline or heat exchanger fouling), and the
emulsion characteristics of the fluid with water.
[0215] As used herein, the term "conditions sufficient to allow
expression" means any conditions that allow a host cell to produce
a desired product, such as a polypeptide or fatty aldehyde
described herein. Suitable conditions include, for example,
fermentation conditions. Fermentation conditions can comprise many
parameters, such as temperature ranges, levels of aeration, and
media composition. Each of these conditions, individually and in
combination, allows the host cell to grow. Exemplary culture media
include broths or gels. Generally, the medium includes a carbon
source, such as glucose, fructose, cellulose, or the like, that can
be metabolized by a host cell directly. In addition, enzymes can be
used in the medium to facilitate the mobilization (e.g., the
depolymerization of starch or cellulose to fermentable sugars) and
subsequent metabolism of the carbon source.
[0216] To determine if conditions are sufficient to allow
expression, a host cell can be cultured, for example, for about 4,
8, 12, 24, 36, or 48 hours. During and/or after culturing, samples
can be obtained and analyzed to determine if the conditions allow
expression. For example, the host cells in the sample or the medium
in which the host cells were grown can be tested for the presence
of a desired product. When testing for the presence of a product,
assays, such as, but not limited to, TLC, HPLC, GC/FID, GC/MS,
LC/MS, MS, can be used.
[0217] It is understood that the polypeptides described herein may
have additional conservative or non-essential amino acid
substitutions, which do not have a substantial effect on the
polypeptide functions. Whether or not a particular substitution
will be tolerated (i.e., will not adversely affect desired
biological properties, such as carboxylic acid reductase activity)
can be determined as described in Bowie et al. Science (1990)
247:13061310. A "conservative amino acid substitution" is one in
which the amino acid residue is replaced with an amino acid residue
having a similar side chain. Families of amino acid residues having
similar side chains have been defined in the art. These families
include amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan), beta-branched side chains
(e.g., threonine, valine, isoleucine), and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0218] As used herein, "control element" means a transcriptional
control element. Control elements include promoters and enhancers.
The term "promoter element," "promoter," or "promoter sequence"
refers to a DNA sequence that functions as a switch that activates
the expression of a gene. If the gene is activated, it is said to
be transcribed or participating in transcription. Transcription
involves the synthesis of mRNA from the gene. A promoter,
therefore, serves as a transcriptional regulatory element and also
provides a site for initiation of transcription of the gene into
mRNA. Control elements interact specifically with cellular proteins
involved in transcription (Maniatis et al., Science 236:1237,
1987).
[0219] As used herein, the term "fatty acid" means a carboxylic
acid having the formula RCOOH. R represents an aliphatic group,
preferably an alkyl group. R can comprise between about 4 and about
22 carbon atoms. Fatty acids can be saturated, monounsaturated, or
polyunsaturated. In a preferred embodiment, the fatty acid is made
from a fatty acid biosynthetic pathway.
[0220] As used herein, the term "fatty acid biosynthetic pathway"
means a biosynthetic pathway that produces fatty acids. The fatty
acid biosynthetic pathway includes fatty acid synthases that can be
engineered, as described herein, to produce fatty acids, and in
some embodiments can be expressed with additional enzymes to
produce fatty acids having desired carbon chain
characteristics.
[0221] As used herein, the term "fatty acid degradation enzyme"
means an enzyme involved in the breakdown or conversion of a fatty
acid or fatty acid derivative into another product. A nonlimiting
example of a fatty acid degradation enzyme is an acyl-CoA synthase.
Additional examples of fatty acid degradation enzymes are described
herein.
[0222] As used herein, the term "fatty acid derivative" means
products made in part from the fatty acid biosynthetic pathway of
the production host organism. "Fatty acid derivative" also includes
products made in part from acyl-ACP or acyl-ACP derivatives. The
fatty acid biosynthetic pathway includes fatty acid synthase
enzymes which can be engineered as described herein to produce
fatty acid derivatives, and in some examples can be expressed with
additional enzymes to produce fatty acid derivatives having desired
carbon chain characteristics. Exemplary fatty acid derivatives
include for example, fatty acids, acyl-CoA, fatty aldehyde, short
and long chain alcohols, hydrocarbons, fatty alcohols, and esters
(e.g., waxes, fatty acid esters, or fatty esters).
[0223] As used herein, the term "fatty acid derivative enzyme"
means any enzyme that may be expressed or overexpressed in the
production of fatty acid derivatives. These enzymes may be part of
the fatty acid biosynthetic pathway. Non-limiting examples of fatty
acid derivative enzymes include fatty acid synthases,
thioesterases, acyl-CoA synthases, acyl-CoA reductases, alcohol
dehydrogenases, alcohol acyltransferases, fatty alcohol-forming
acyl-CoA reductases, fatty acid (carboxylic acid) reductases,
acyl-ACP reductases, fatty acid hydroxylases, acyl-CoA desaturases,
acyl-ACP desaturases, acyl-CoA oxidases, acyl-CoA dehydrogenases,
ester synthases, and alkane biosynthetic polypeptides, etc. Fatty
acid derivative enzymes can convert a substrate into a fatty acid
derivative. In some examples, the substrate may be a fatty acid
derivative that the fatty acid derivative enzyme converts into a
different fatty acid derivative.
[0224] As used herein, "fatty acid enzyme" means any enzyme
involved in fatty acid biosynthesis. Fatty acid enzymes can be
modified in host cells to produce fatty acids. Non-limiting
examples of fatty acid enzymes include fatty acid synthases and
thioesterases. Additional examples of fatty acid enzymes are
described herein.
[0225] As used herein, "fatty acid synthase" means any enzyme
involved in fatty acid biosynthesis. Fatty acid synthases can be
expressed or overexpressed in host cells to produce fatty acids. A
non-limiting example of a fatty acid synthase is a thioesterase.
Additional examples of fatty acid synthases are described
herein.
[0226] As used herein, "fatty aldehyde" means an aldehyde having
the formula RCHO characterized by an unsaturated carbonyl group
(C.dbd.O). In a preferred embodiment, the fatty aldehyde is any
aldehyde made from a fatty acid or fatty acid derivative. In one
embodiment, the R group is at least about 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons in
length.
[0227] R can be straight or branched chain. The branched chains may
have one or more points of branching. In addition, the branched
chains may include cyclic branches.
[0228] Furthermore, R can be saturated or unsaturated. If
unsaturated, the R can have one or more points of unsaturation.
[0229] In one embodiment, the fatty aldehyde is produced
biosynthetically.
[0230] Fatty aldehydes have many uses. For example, fatty aldehydes
can be used to produce many specialty chemicals. For example, fatty
aldehydes are used to produce polymers, resins, dyes, flavorings,
plasticizers, perfumes, pharmaceuticals, and other chemicals. Some
are used as solvents, preservatives, or disinfectants. Some natural
and synthetic compounds, such as vitamins and hormones, are
aldehydes.
[0231] The terms "fatty aldehyde biosynthetic polypeptide",
"carboxylic acid reductase", and "CAR" are used interchangeably
herein.
[0232] As used herein, "fatty alcohol" means an alcohol having the
formula ROH. In a preferred embodiment, the fatty alcohol is any
alcohol made from a fatty acid or fatty acid derivative. In one
embodiment, the R group is at least about 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons in length.
[0233] R can be straight or branched chain. The branched chains may
have one or more points of branching. In addition, the branched
chains may include cyclic branches.
[0234] Furthermore, R can be saturated or unsaturated. If
unsaturated, the R can have one or more points of unsaturation.
[0235] In one embodiment, the fatty alcohol is produced
biosynthetically.
[0236] Fatty alcohols have many uses. For example, fatty alcohols
can be used to produce many specialty chemicals. For example, fatty
alcohols are used as a biofuel; as solvents for fats, waxes, gums,
and resins; in pharmaceutical salves, emolients and lotions; as
lubricating-oil additives; in detergents and emulsifiers; as
textile antistatic and finishing agents; as plasticizers; as
nonionic surfactants; and in cosmetics, for examples as
thickeners.
[0237] As used herein, "fraction of modern carbon" or "f.sub.M" has
the same meaning as defined by National Institute of Standards and
Technology (NIST) Standard Reference Materials (SRMs) 4990B and
4990C, known as oxalic acids standards HOxI and HOxII,
respectively. The fundamental definition relates to 0.95 times the
.sup.14C/.sup.12C isotope ratio HOxI (referenced to AD 1950). This
is roughly equivalent to decay-corrected pre-Industrial Revolution
wood. For the current living biosphere (plant material), f.sub.M is
approximately 1.1.
[0238] "Gene knockout", as used herein, refers to a procedure by
which a gene encoding a target protein is modified or inactivated
so to reduce or eliminate the function of the intact protein.
Inactivation of the gene may be performed by general methods such
as mutagenesis by UV irradiation or treatment with
N-methyl-N'-nitro-N-nitrosoguanidine, site-directed mutagenesis,
homologous recombination, insertion-deletion mutagenesis, or
"Red-driven integration" (Datsenko et al., Proc. Natl. Acad. Sci.
USA, 97:6640-45, 2000). For example, in one embodiment, a construct
is introduced into a host cell, such that it is possible to select
for homologous recombination events in the host cell. One of skill
in the art can readily design a knock-out construct including both
positive and negative selection genes for efficiently selecting
transfected cells that undergo a homologous recombination event
with the construct. The alteration in the host cell may be
obtained, for example, by replacing through a single or double
crossover recombination a wild type DNA sequence by a DNA sequence
containing the alteration. For convenient selection of
transformants, the alteration may, for example, be a DNA sequence
encoding an antibiotic resistance marker or a gene complementing a
possible auxotrophy of the host cell. Mutations include, but are
not limited to, deletion-insertion mutations. An example of such an
alteration includes a gene disruption, i.e., a perturbation of a
gene such that the product that is normally produced from this gene
is not produced in a functional form. This could be due to a
complete deletion, a deletion and insertion of a selective marker,
an insertion of a selective marker, a frameshift mutation, an
in-frame deletion, or a point mutation that leads to premature
termination. In some instances, the entire mRNA for the gene is
absent. In other situations, the amount of mRNA produced
varies.
[0239] Calculations of "homology" between two sequences can be
performed as follows. The sequences are aligned for optimal
comparison purposes (e.g., gaps can be introduced in one or both of
a first and a second amino acid or nucleic acid sequence for
optimal alignment and non-homologous sequences can be disregarded
for comparison purposes). In a preferred embodiment, the length of
a reference sequence that is aligned for comparison purposes is at
least about 30%, preferably at least about 40%, more preferably at
least about 50%, even more preferably at least about 60%, and even
more preferably at least about 70%, at least about 80%, at least
about 90%, or about 100% of the length of the reference sequence.
The amino acid residues or nucleotides at corresponding amino acid
positions or nucleotide positions are then compared. When a
position in the first sequence is occupied by the same amino acid
residue or nucleotide as the corresponding position in the second
sequence, then the molecules are identical at that position (as
used herein, amino acid or nucleic acid "identity" is equivalent to
amino acid or nucleic acid "homology"). The percent identity
between the two sequences is a function of the number of identical
positions shared by the sequences, taking into account the number
of gaps and the length of each gap, which need to be introduced for
optimal alignment of the two sequences.
[0240] The comparison of sequences and determination of percent
homology between two sequences can be accomplished using a
mathematical algorithm. In a preferred embodiment, the percent
homology between two amino acid sequences is determined using the
Needleman and Wunsch (1970), J. Mol. Biol. 48:444453, algorithm
that has been incorporated into the GAP program in the GCG software
package, using either a Blossum 62 matrix or a PAM250 matrix, and a
gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1,
2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent
homology between two nucleotide sequences is determined using the
GAP program in the GCG software package, using a NWSgapdna.CMP
matrix and a gap weight of 40, 50, 60, 70, or 80 and a length
weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of
parameters (and the one that should be used if the practitioner is
uncertain about which parameters should be applied to determine if
a molecule is within a homology limitation of the claims) are a
Blossum 62 scoring matrix with a gap penalty of 12, a gap extend
penalty of 4, and a frameshift gap penalty of 5.
[0241] As used herein, a "host cell" is a cell used to produce a
product described herein (e.g., a fatty alcohol described herein).
A host cell can be modified to express or overexpress selected
genes or to have attenuated expression of selected genes.
Non-limiting examples of host cells include plant, animal, human,
bacteria, yeast, or filamentous fungi cells.
[0242] As used herein, the term "hybridizes under low stringency,
medium stringency, high stringency, or very high stringency
conditions" describes conditions for hybridization and washing.
Guidance for performing hybridization reactions can be found in
Current Protocols in Molecular Biology, John Wiley & Sons, N.Y.
(1989), 6.3.1-6.3.6. Aqueous and nonaqueous methods are described
in that reference and either method can be used. Specific
hybridization conditions referred to herein are as follows: 1) low
stringency hybridization conditions in 6.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C., followed by
two washes in 0.2.times.SSC, 0.1% SDS at least at 50.degree. C.
(the temperature of the washes can be increased to 55.degree. C.
for low stringency conditions); 2) medium stringency hybridization
conditions in 6.times.SSC at about 45.degree. C., followed by one
or more washes in 0.2.times.SSC, 0.1% SDS at 60.degree. C.; 3) high
stringency hybridization conditions in 6.times.SSC at about
45.degree. C., followed by one or more washes in 0.2..times.SSC,
0.1% SDS at 65.degree. C.; and preferably 4) very high stringency
hybridization conditions are 0.5M sodium phosphate, 7% SDS at
65.degree. C., followed by one or more washes at 0.2.times.SSC, 1%
SDS at 65.degree. C. Very high stringency conditions (4) are the
preferred conditions unless otherwise specified.
[0243] The term "isolated" as used herein with respect to nucleic
acids, such as DNA or RNA, refers to molecules separated from other
DNAs or RNAs, respectively, that are present in the natural source
of the nucleic acid. Moreover, by an "isolated nucleic acid" is
meant to include nucleic acid fragments, which are not naturally
occurring as fragments and would not be found in the natural state.
The term "isolated" is also used herein to refer to polypeptides,
which are isolated from other cellular proteins and is meant to
encompass both purified and recombinant polypeptides. The term
"isolated" as used herein also refers to a nucleic acid or peptide
that is substantially free of cellular material, viral material, or
culture medium when produced by recombinant DNA techniques. The
term "isolated" as used herein also refers to a nucleic acid or
peptide that is substantially free of chemical precursors or other
chemicals when chemically synthesized. The term "isolated", as used
herein with respect to products, such as fatty alcohols, refers to
products that are isolated from cellular components, cell culture
media, or chemical or synthetic precursors.
[0244] As used herein, the "level of expression of a gene in a
cell" refers to the level of mRNA, pre-mRNA nascent transcript(s),
transcript processing intermediates, mature mRNA(s), and
degradation products encoded by the gene in the cell.
[0245] As used herein, the term "microorganism" means prokaryotic
and eukaryotic microbial species from the domains Archaea, Bacteria
and Eucarya, the latter including yeast and filamentous fungi,
protozoa, algae, or higher Protista. The terms "microbial cells"
(i.e., cells from microbes) and "microbes" are used interchangeably
and refer to cells or small organisms that can only be seen with
the aid of a microscope.
[0246] As used herein, the term "nucleic acid" refers to
polynucleotides, such as deoxyribonucleic acid (DNA), and, where
appropriate, ribonucleic acid (RNA). The term should also be
understood to include, as equivalents, analogs of either RNA or DNA
made from nucleotide analogs, and, as applicable to the embodiment
being described, single (sense or antisense) and double-stranded
polynucleotides, ESTs, chromosomes, cDNAs, mRNAs, and rRNAs.
[0247] As used herein, the term "operably linked" means that
selected nucleotide sequence (e.g., encoding a polypeptide
described herein) is in proximity with a promoter to allow the
promoter to regulate expression of the selected DNA. In addition,
the promoter is located upstream of the selected nucleotide
sequence in terms of the direction of transcription and
translation. By "operably linked" is meant that a nucleotide
sequence and a regulatory sequence(s) are connected in such a way
as to permit gene expression when the appropriate molecules (e.g.,
transcriptional activator proteins) are bound to the regulatory
sequence(s).
[0248] The term "or" is used herein to mean, and is used
interchangeably with, the term "and/or," unless context clearly
indicates otherwise.
[0249] As used herein, "overexpress" means to express or cause to
be expressed a nucleic acid, polypeptide, or hydrocarbon in a cell
at a greater concentration than is normally expressed in a
corresponding wild-type cell. For example, a polypeptide can be
"overexpressed" in a recombinant host cell when the polypeptide is
present in a greater concentration in the recombinant host cell
compared to its concentration in a non-recombinant host cell of the
same species.
[0250] As used herein, "partition coefficient" or "P," is defined
as the equilibrium concentration of a compound in an organic phase
divided by the concentration at equilibrium in an aqueous phase
(e.g., fermentation broth). In one embodiment of a bi-phasic system
described herein, the organic phase is formed by the fatty aldehyde
during the production process. However, in some examples, an
organic phase can be provided, such as by providing a layer of
octane, to facilitate product separation. When describing a two
phase system, the partition characteristics of a compound can be
described as log P. For example, a compound with a log P of 1 would
partition 10:1 to the organic phase. A compound with a log P of -1
would partition 1:10 to the organic phase. By choosing an
appropriate fermentation broth and organic phase, a fatty aldehyde
with a high log P value can separate into the organic phase even at
very low concentrations in the fermentation vessel.
[0251] As used herein, the term "purify," "purified," or
"purification" means the removal or isolation of a molecule from
its environment by, for example, isolation or separation.
"Substantially purified" molecules are at least about 60% free,
preferably at least about 75% free, and more preferably at least
about 90% free from other components with which they are
associated. As used herein, these terms also refer to the removal
of contaminants from a sample. For example, the removal of
contaminants can result in an increase in the percentage of fatty
alcohol in a sample. For example, when fatty alcohols are produced
in a host cell, the fatty alcohols can be purified by the removal
of host cell proteins. After purification, the percentage of fatty
alcohols in the sample is increased.
[0252] The terms "purify," "purified," and "purification" do not
require absolute purity. They are relative terms. Thus, for
example, when fatty alcohols are produced in host cells, a purified
fatty alcohol is one that is substantially separated from other
cellular components (e.g., nucleic acids, polypeptides, lipids,
carbohydrates, or other hydrocarbons). In another example, a
purified fatty alcohol preparation is one in which the fatty
alcohol is substantially free from contaminants, such as those that
might be present following fermentation. In some embodiments, a
fatty alcohol is purified when at least about 50% by weight of a
sample is composed of the fatty alcohol. In other embodiments, a
fatty alcohol is purified when at least about 60%, 70%, 80%, 85%,
90%, 92%, 95%, 98%, or 99% or more by weight of a sample is
composed of the fatty alcohol.
[0253] As used herein, the term "recombinant polypeptide" refers to
a polypeptide that is produced by recombinant DNA techniques,
wherein generally DNA encoding the expressed protein or RNA is
inserted into a suitable expression vector and that is in turn used
to transform a host cell to produce the polypeptide or RNA.
[0254] As used herein, the term "substantially identical" (or
"substantially homologous") is used to refer to a first amino acid
or nucleotide sequence that contains a sufficient number of
identical or equivalent (e.g., with a similar side chain, e.g.,
conserved amino acid substitutions) amino acid residues or
nucleotides to a second amino acid or nucleotide sequence such that
the first and second amino acid or nucleotide sequences have
similar activities.
[0255] As used herein, the term "synthase" means an enzyme which
catalyzes a synthesis process. As used herein, the term synthase
includes synthases, synthetases, and ligases.
[0256] As used herein, the term "transfection" means the
introduction of a nucleic acid (e.g., via an expression vector)
into a recipient cell by nucleic acid-mediated gene transfer.
[0257] As used herein, "transformation" refers to a process in
which a cell's genotype is changed as a result of the cellular
uptake of exogenous DNA or RNA. This may result in the transformed
cell expressing a recombinant form of an RNA or polypeptide. In the
case of antisense expression from the transferred gene, the
expression of a naturally-occurring form of the polypeptide is
disrupted.
[0258] As used herein, a "transport protein" is a polypeptide that
facilitates the movement of one or more compounds in and/or out of
a cellular organelle and/or a cell.
[0259] As used herein, a "variant" of polypeptide X refers to a
polypeptide having the amino acid sequence of peptide X in which
one or more amino acid residues is altered. The variant may have
conservative changes or nonconservative changes. Guidance in
determining which amino acid residues may be substituted, inserted,
or deleted without affecting biological activity may be found using
computer programs well known in the art, for example, LASERGENE
software (DNASTAR).
[0260] The term "variant," when used in the context of a
polynucleotide sequence, may encompass a polynucleotide sequence
related to that of a gene or the coding sequence thereof. This
definition may also include, for example, "allelic," "splice,"
"species," or "polymorphic" variants. A splice variant may have
significant identity to a reference polynucleotide, but will
generally have a greater or fewer number of polynucleotides due to
alternative splicing of exons during mRNA processing. The
corresponding polypeptide may possess additional functional domains
or an absence of domains. Species variants are polynucleotide
sequences that vary from one species to another. The resulting
polypeptides generally will have significant amino acid identity
relative to each other. A polymorphic variant is a variation in the
polynucleotide sequence of a particular gene between individuals of
a given species.
[0261] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of useful vector is an episome (i.e., a
nucleic acid capable of extra-chromosomal replication). Useful
vectors are those capable of autonomous replication and/or
expression of nucleic acids to which they are linked. Vectors
capable of directing the expression of genes to which they are
operatively linked are referred to herein as "expression vectors".
In general, expression vectors of utility in recombinant DNA
techniques are often in the form of "plasmids," which refer
generally to circular double stranded DNA loops that, in their
vector form, are not bound to the chromosome. In the present
specification, "plasmid" and "vector" are used interchangeably, as
the plasmid is the most commonly used form of vector. However, also
included are such other forms of expression vectors that serve
equivalent functions and that become known in the art subsequently
hereto.
[0262] The invention is based, at least in part, on the discovery
of a new pathway for fatty alcohol biosynthesis in E. coli that
utilize, in part, genes that encode fatty aldehyde biosynthetic
polypeptides. The fatty alcohols can be produced by a biosynthetic
pathway depicted in FIG. 3. In this pathway, a fatty acid is first
activated by ATP and then reduced by a carboxylic acid reductase
(CAR)-like enzyme to generate a fatty aldehyde. The fatty aldehyde
can then be further reduced into a fatty alcohol by an alcohol
dehydrogenase(s), such as alrAadp1 or yjgB. As demonstrated herein,
yjgB may be the presumed alcohol dehydrogenase, whose substrates
includes fatty aldehydes, for example fatty aldehydes with carbon
chain lengths from C.sub.10 to C.sub.18.
Fatty Aldehyde Biosynthetic Genes, Fatty Alcohol Biosynthetic
Genes, and Variants
[0263] The methods described herein can be used to produce fatty
alcohols, for example, from fatty aldehydes. In some instances, a
fatty aldehyde is produced by expressing a fatty aldehyde
biosynthetic gene, for example, a carboxylic acid reductase gene
(car gene), having a nucleotide sequence listed in FIGS. 6 and 8,
as well as polynucleotide variants thereof. In some instances, the
fatty aldehyde biosynthetic gene encodes one or more of the amino
acid motifs depicted in FIG. 7. For example, the gene can encode a
polypeptide comprising SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and
SEQ ID NO:10; SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID
NO:14; and/or SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID
NO: 11. SEQ ID NO:7 includes a reductase domain; SEQ ID NO:8 and
SEQ ID NO:14 include a NADP binding domain; SEQ ID NO:9 includes a
phosphopantetheine attachment site; and SEQ ID NO:10 includes an
AMP binding domain.
[0264] In other instances, a fatty alcohol is produced by
expressing a fatty alcohol biosynthetic gene, for example, having a
nucleotide sequence listed in FIG. 10, or a variant thereof.
[0265] Variants can be naturally occurring or created in vitro. In
particular, such variants can be created using genetic engineering
techniques, such as site directed mutagenesis, random chemical
mutagenesis, Exonuclease III deletion procedures, or standard
cloning techniques. Alternatively, such variants, fragments,
analogs, or derivatives can be created using chemical synthesis or
modification procedures.
[0266] Methods of making variants are well known in the art. These
include procedures in which nucleic acid sequences obtained from
natural isolates are modified to generate nucleic acids that encode
polypeptides having characteristics that enhance their value in
industrial or laboratory applications. In such procedures, a large
number of variant sequences having one or more nucleotide
differences with respect to the sequence obtained from the natural
isolate are generated and characterized. Typically, these
nucleotide differences result in amino acid changes with respect to
the polypeptides encoded by the nucleic acids from the natural
isolates.
[0267] For example, variants can be created using error prone PCR
(see, e.g., Leung et al., Technique 1:11-15, 1989; and Caldwell et
al., PCR Methods Applic. 2:28-33, 1992). In error prone PCR, PCR is
performed under conditions where the copying fidelity of the DNA
polymerase is low, such that a high rate of point mutations is
obtained along the entire length of the PCR product. Briefly, in
such procedures, nucleic acids to be mutagenized (e.g., a fatty
aldehyde biosynthetic polynucleotide sequence), are mixed with PCR
primers, reaction buffer, MgCl.sub.2, MnCl.sub.2, Taq polymerase,
and an appropriate concentration of dNTPs for achieving a high rate
of point mutation along the entire length of the PCR product. For
example, the reaction can be performed using 20 fmoles of nucleic
acid to be mutagenized (e.g., a fatty aldehyde biosynthetic
polynucleotide sequence), 30 pmole of each PCR primer, a reaction
buffer comprising 50 mM KCl, 10 mM Tris HCl (pH 8.3), and 0.01%
gelatin, 7 mM MgCl.sub.2, 0.5 mM MnCl.sub.2, 5 units of Taq
polymerase, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, and 1 mM dTTP. PCR
can be performed for 30 cycles of 94.degree. C. for 1 min,
45.degree. C. for 1 min, and 72.degree. C. for 1 min. However, it
will be appreciated that these parameters can be varied as
appropriate. The mutagenized nucleic acids are then cloned into an
appropriate vector and the activities of the polypeptides encoded
by the mutagenized nucleic acids are evaluated.
[0268] Variants can also be created using oligonucleotide directed
mutagenesis to generate site-specific mutations in any cloned DNA
of interest. Oligonucleotide mutagenesis is described in, for
example, Reidhaar-Olson et al., Science 241:53-57, 1988. Briefly,
in such procedures a plurality of double stranded oligonucleotides
bearing one or more mutations to be introduced into the cloned DNA
are synthesized and inserted into the cloned DNA to be mutagenized
(e.g., a fatty aldehyde biosynthetic polynucleotide sequence).
Clones containing the mutagenized DNA are recovered, and the
activities of the polypeptides they encode are assessed.
[0269] Another method for generating variants is assembly PCR.
Assembly PCR involves the assembly of a PCR product from a mixture
of small DNA fragments. A large number of different PCR reactions
occur in parallel in the same vial, with the products of one
reaction priming the products of another reaction. Assembly PCR is
described in, for example, U.S. Pat. No. 5,965,408.
[0270] Still another method of generating variants is sexual PCR
mutagenesis. In sexual PCR mutagenesis, forced homologous
recombination occurs between DNA molecules of different, but highly
related, DNA sequence in vitro as a result of random fragmentation
of the DNA molecule based on sequence homology. This is followed by
fixation of the crossover by primer extension in a PCR reaction.
Sexual PCR mutagenesis is described in, for example, Stemmer, PNAS,
USA 91:10747-10751, 1994.
[0271] Variants can also be created by in vivo mutagenesis. In some
embodiments, random mutations in a nucleic acid sequence are
generated by propagating the sequence in a bacterial strain, such
as an E. coli strain, which carries mutations in one or more of the
DNA repair pathways. Such "mutator" strains have a higher random
mutation rate than that of a wild-type strain. Propagating a DNA
sequence (e.g., a fatty aldehyde biosynthetic polynucleotide
sequence) in one of these strains will eventually generate random
mutations within the DNA. Mutator strains suitable for use for in
vivo mutagenesis are described in, for example, PCT Publication No.
WO 91/16427.
[0272] Variants can also be generated using cassette mutagenesis.
In cassette mutagenesis, a small region of a double stranded DNA
molecule is replaced with a synthetic oligonucleotide "cassette"
that differs from the native sequence. The oligonucleotide often
contains a completely and/or partially randomized native
sequence.
[0273] Recursive ensemble mutagenesis can also be used to generate
variants. Recursive ensemble mutagenesis is an algorithm for
protein engineering (i.e., protein mutagenesis) developed to
produce diverse populations of phenotypically related mutants whose
members differ in amino acid sequence. This method uses a feedback
mechanism to control successive rounds of combinatorial cassette
mutagenesis. Recursive ensemble mutagenesis is described in, for
example, Arkin et al., PNAS, USA 89:7811-7815, 1992.
[0274] In some embodiments, variants are created using exponential
ensemble mutagenesis. Exponential ensemble mutagenesis is a process
for generating combinatorial libraries with a high percentage of
unique and functional mutants, wherein small groups of residues are
randomized in parallel to identify, at each altered position, amino
acids which lead to functional proteins. Exponential ensemble
mutagenesis is described in, for example, Delegrave et al.,
Biotech. Res. 11:1548-1552, 1993. Random and site-directed
mutagenesis are described in, for example, Arnold, Curr. Opin.
Biotech. 4:450-455, 1993.
[0275] In some embodiments, variants are created using shuffling
procedures wherein portions of a plurality of nucleic acids that
encode distinct polypeptides are fused together to create chimeric
nucleic acid sequences that encode chimeric polypeptides as
described in, for example, U.S. Pat. Nos. 5,965,408 and
5,939,250.
[0276] Polynucleotide variants also include nucleic acid analogs.
Nucleic acid analogs can be modified at the base moiety, sugar
moiety, or phosphate backbone to improve, for example, stability,
hybridization, or solubility of the nucleic acid. Modifications at
the base moiety include deoxyuridine for deoxythymidine and
5-methyl-2'-deoxycytidine or 5-bromo-2'-doxycytidine for
deoxycytidine. Modifications of the sugar moiety include
modification of the 2' hydroxyl of the ribose sugar to form
2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate
backbone can be modified to produce morpholino nucleic acids, in
which each base moiety is linked to a six-membered, morpholino
ring, or peptide nucleic acids, in which the deoxyphosphate
backbone is replaced by a pseudopeptide backbone and the four bases
are retained. (See, e.g., Summerton et al., Antisense Nucleic Acid
Drug Dev. (1997) 7:187-195; and Hyrup et al., Bioorgan. Med. Chem.
(1996) 4:5-23.) In addition, the deoxyphosphate backbone can be
replaced with, for example, a phosphorothioate or
phosphorodithioate backbone, a phosphoroamidite, or an alkyl
phosphotriester backbone.
[0277] Any polynucleotide sequence encoding a homolog listed in
FIGS. 6 and 8, or a variant thereof, can be used as a fatty
aldehyde biosynthetic polynucleotide in the methods described
herein. Any polynucleotide sequence listed in FIG. 10, or a
variant, can be used as a fatty alcohol biosynthetic polynucleotide
in the methods described herein.
Fatty Aldehyde Biosynthetic Polypeptides, Fatty Alcohol
Biosynthetic Polypeptide, and Variants
[0278] The methods described herein can also be used to produce
fatty alcohols, for example, from fatty aldehydes. In some
instances, the fatty aldehyde is produced by a fatty aldehyde
biosynthetic polypeptide having an amino acid sequence listed in
FIGS. 6 and 8, as well as polypeptide variants thereof. In some
instances, a fatty aldehyde biosynthetic polypeptide is one that
includes one or more of the amino acid motifs depicted in FIG. 7.
For example, the polypeptide can include the amino acid sequences
of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10. In
other situations, the polypeptide includes one or more of SEQ ID
NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14. In yet other
instances, the polypeptide includes the amino acid sequences of SEQ
ID NO:7, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11. SEQ ID NO:7
includes a reductase domain; SEQ ID NO:8 and SEQ ID NO:14 include a
NADP binding domain; SEQ ID NO:9 includes a phosphopantetheine
attachment site; and SEQ ID NO:10 includes an AMP binding
domain.
[0279] In other instances, the methods described herein can be used
to produce fatty alcohols using a fatty alcohol biosynthetic
polypeptide having an amino acid sequence listed in FIG. 10, as
well as polypeptide variants thereof.
[0280] Biosynthetic polypeptide variants can be variants in which
one or more amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid
residue). Such substituted amino acid residue may or may not be one
encoded by the genetic code.
[0281] Conservative substitutions are those that substitute a given
amino acid in a polypeptide by another amino acid of similar
characteristics. Typical conservative substitutions are the
following replacements: replacement of an aliphatic amino acid,
such as alanine, valine, leucine, and isoleucine, with another
aliphatic amino acid; replacement of a serine with a threonine or
vice versa; replacement of an acidic residue, such as aspartic acid
and glutamic acid, with another acidic residue; replacement of a
residue bearing an amide group, such as asparagine and glutamine,
with another residue bearing an amide group; exchange of a basic
residue, such as lysine and arginine, with another basic residue;
and replacement of an aromatic residue, such as phenylalanine and
tyrosine, with another aromatic residue.
[0282] Other polypeptide variants are those in which one or more
amino acid residues include a substituent group. Still other
polypeptide variants are those in which the polypeptide is
associated with another compound, such as a compound to increase
the half-life of the polypeptide (e.g., polyethylene glycol).
[0283] Additional polypeptide variants are those in which
additional amino acids are fused to the polypeptide, such as a
leader sequence, a secretory sequence, a proprotein sequence, or a
sequence which facilitates purification, enrichment, or
stabilization of the polypeptide.
[0284] In some instances, the polypeptide variants retain the same
biological function as a polypeptide having an amino acid sequence
listed in FIGS. 6 and 8 (e.g., retain fatty aldehyde biosynthetic
activity, such as carboxylic acid or fatty acid reductase
activity), or listed in FIG. 10 (e.g., retain fatty alcohol
biosynthetic activity, such as fatty alcohol dehydrogenase
activity) and have amino acid sequences substantially identical
thereto.
[0285] In other instances, the polypeptide variants have at least
about 50%, at least about 55%, at least about 60%, at least about
65%, at least about 70%, at least about 75%, at least about 80%, at
least about 85%, at least about 90%, at least about 95%, or more
than about 95% homology to an amino acid sequence listed in FIGS.
6, 8, and/or 10. In another embodiment, the polypeptide variants
include a fragment comprising at least about 5, 10, 15, 20, 25, 30,
35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.
[0286] The polypeptide variants or fragments thereof can be
obtained by isolating nucleic acids encoding them using techniques
described herein or by expressing synthetic nucleic acids encoding
them. Alternatively, polypeptide variants or fragments thereof can
be obtained through biochemical enrichment or purification
procedures. The sequence of polypeptide variants or fragments can
be determined by proteolytic digestion, gel electrophoresis, and/or
microsequencing. The sequence of the polypeptide variants or
fragments can then be compared to an amino acid sequence listed in
FIGS. 6, 8, and/or 10 using any of the programs described
herein.
[0287] The polypeptide variants and fragments thereof can be
assayed for fatty aldehyde-producing activity and/or fatty
alcohol-producing activity using routine methods. For example, the
polypeptide variants or fragment can be contacted with a substrate
(e.g., a fatty acid, a fatty acid derivative substrate, or other
substrate described herein) under conditions that allow the
polypeptide variant to function. A decrease in the level of the
substrate or an increase in the level of a fatty aldehyde can be
measured to determine fatty aldehyde-producing activity. A decrease
in the level of the substrate or an increase in the level of a
fatty alcohol can be measured to determine fatty alcohol-producing
activity.
Antibodies to Biosynthetic Polypeptides
[0288] The fatty aldehyde biosynthetic polypeptides described
herein can also be used to produce antibodies directed against
fatty aldehyde biosynthetic polypeptides. Such antibodies can be
used, for example, to detect the expression of a fatty aldehyde
biosynthetic polypeptide or fatty alcohol biosynthetic polypeptide
using methods known in the art. The antibody can be, for example, a
polyclonal antibody; a monoclonal antibody or antigen binding
fragment thereof; a modified antibody such as a chimeric antibody,
reshaped antibody, humanized antibody, or fragment thereof (e.g.,
Fab', Fab, F(ab').sub.2); or a biosynthetic antibody, for example,
a single chain antibody, single domain antibody (DAB), Fv, single
chain Fv (scFv), or the like.
[0289] Methods of making and using polyclonal and monoclonal
antibodies are described, for example, in Harlow et al., Using
Antibodies: A Laboratory Manual: Portable Protocol I. Cold Spring
Harbor Laboratory (Dec. 1, 1998). Methods for making modified
antibodies and antibody fragments (e.g., chimeric antibodies,
reshaped antibodies, humanized antibodies, or fragments thereof,
e.g., Fab', Fab, F(ab').sub.2 fragments); or biosynthetic
antibodies (e.g., single chain antibodies, single domain antibodies
(DABs), Fv, single chain Fv (scFv), and the like), are known in the
art and can be found, for example, in Zola, Monoclonal Antibodies:
Preparation and Use of Monoclonal Antibodies and Engineered
Antibody Derivatives, Springer Verlag (Dec. 15, 2000; 1st
edition).
Substrates
[0290] The compositions and methods described herein can be used to
produce fatty alcohols, for example, from fatty aldehydes, which
themselves can be produced from an appropriate substrate. While not
wishing to be bound by theory, it is believed that the fatty
aldehyde biosynthetic polypeptides described herein produce fatty
aldehydes from substrates via a reduction mechanism. In some
instances, the substrate is a fatty acid derivative (e.g., a fatty
acid), and a fatty aldehyde having particular branching patterns
and carbon chain length can be produced from a fatty acid
derivative having those characteristics that would result in a
particular fatty aldehyde. Through an additional reaction
mechanism, the fatty aldehyde can be converted into the desired
fatty alcohol (e.g., by a fatty alcohol biosynthetic polypeptide
described herein).
[0291] Accordingly, each step within a biosynthetic pathway that
leads to the production of a fatty acid derivative substrate can be
modified to produce or overproduce the substrate of interest. For
example, known genes involved in the fatty acid biosynthetic
pathway or the fatty aldehyde pathway can be expressed,
overexpressed, or attenuated in host cells to produce a desired
substrate (see, e.g., PCT/US08/058788). Exemplary genes are
provided in FIG. 9.
Synthesis of Substrates
[0292] Fatty acid synthase (FAS) is a group of polypeptides that
catalyze the initiation and elongation of acyl chains (Marrakchi et
al., Biochemical Society, 30:1050-1055, 2002). The acyl carrier
protein (ACP) along with the enzymes in the FAS pathway control the
length, degree of saturation, and branching of the fatty acid
derivatives produced. The fatty acid biosynthetic pathway involves
the precursors acetyl-CoA and malonyl-CoA. The steps in this
pathway are catalyzed by enzymes of the fatty acid biosynthesis
(fab) and acetyl-CoA carboxylase (acc) gene families (see, e.g.,
Heath et al., Prog. Lipid Res. 40(6):467-97 (2001)).
[0293] Host cells can be engineered to express fatty acid
derivative substrates by recombinantly expressing or overexpressing
one or more fatty acid synthase genes, such as acetyl-CoA and/or
malonyl-CoA synthase genes. For example, to increase acetyl-CoA
production, one or more of the following genes can be expressed in
a host cell: pdh (a multienzyme complex comprising aceEF (which
encodes the E1p dehydrogenase component, the E2p dihydrolipoamide
acyltransferase component of the pyruvate and 2-oxoglutarate
dehydrogenase complexes, and Ipd), panK, fabH, fabB, fabD, fabG,
acpP, andfabF. Exemplary GenBank accession numbers for these genes
are: pdh (BAB34380, AAC73227, AAC73226), panK (also known as CoA,
AAC76952), aceEF (AAC73227, AAC73226), fabH (AAC74175), fabB
(P0A953), fabD (AAC74176), fabG (AAC74177), acpP (AAC74178), fabF
(AAC74179). Additionally, the expression levels of fadE, gpsA,
IdhA, pflb, adhE, pta, poxB, ackA, and/or ackB can be attenuated or
knocked-out in an engineered host cell by transformation with
conditionally replicative or non-replicative plasmids containing
null or deletion mutations of the corresponding genes or by
substituting promoter or enhancer sequences. Exemplary GenBank
accession numbers for these genes are: fadE (AAC73325), gspA
(AAC76632), IdhA (AAC74462), pflb (AAC73989), adhE (AAC74323), pta
(AAC75357), poxB (AAC73958), ackA (AAC75356), and ackB (BAB81430).
The resulting host cells will have increased acetyl-CoA production
levels when grown in an appropriate environment.
[0294] Malonyl-CoA overexpression can be affected by introducing
accABCD (e.g., accession number AAC73296, EC 6.4.1.2) into a host
cell. Fatty acids can be further overexpressed in host cells by
introducing into the host cell a DNA sequence encoding a lipase
(e.g., accession numbers CAA89087, CAA98876).
[0295] In addition, inhibiting PlsB can lead to an increase in the
levels of long chain acyl-ACP, which will inhibit early steps in
the pathway (e.g., accABCD, fabH, and fabI). The plsB (e.g.,
accession number AAC77011) D311E mutation can be used to increase
the amount of available fatty acids.
[0296] In addition, a host cell can be engineered to overexpress a
sfa gene (suppressor of fabA, e.g., accession number AAN79592) to
increase production of monounsaturated fatty acids (Rock et al., J.
Bacteriology 178:5382-5387, 1996).
[0297] The chain length of a fatty acid derivative substrate can be
selected for by modifying the expression of selected thioesterases.
Thioesterase influences the chain length of fatty acids produced.
Hence, host cells can be engineered to express, overexpress, have
attenuated expression, or not to express one or more selected
thioesterases to increase the production of a preferred fatty acid
derivative substrate. For example, C.sub.10 fatty acids can be
produced by expressing a thioesterase that has a preference for
producing C.sub.10 fatty acids and attenuating thioesterases that
have a preference for producing fatty acids other than C.sub.10
fatty acids (e.g., a thioesterase which prefers to produce C.sub.14
fatty acids). This would result in a relatively homogeneous
population of fatty acids that have a carbon chain length of 10. In
other instances, C.sub.14 fatty acids can be produced by
attenuating endogenous thioesterases that produce non-C.sub.14
fatty acids and expressing the thioesterases that use C.sub.14-ACP.
In some situations, C.sub.12 fatty acids can be produced by
expressing thioesterases that use C.sub.12-ACP and attenuating
thioesterases that produce non-C.sub.12 fatty acids. Acetyl-CoA,
malonyl-CoA, and fatty acid overproduction can be verified using
methods known in the art, for example, by using radioactive
precursors, HPLC, or GC-MS subsequent to cell lysis. Non-limiting
examples of thioesterases that can be used in the methods described
herein are listed in Table 1.
TABLE-US-00001 TABLE 1 Thioesterases Accession Number Source
Organism Gene AAC73596 E. coli tesA without leader sequence
AAC73555 E. coli tesB Q41635, AAA34215 Umbellularia california fatB
AAC49269 Cuphea hookeriana fatB2 Q39513; AAC72881 Cuphea hookeriana
fatB3 Q39473, AAC49151 Cinnamonum camphorum fatB CAA85388
Arabidopsis thaliana fatB [M141T]* NP 189147; NP 193041 Arabidopsis
thaliana fatA CAC39106 Bradyrhiizobium japonicum fatA AAC72883
Cuphea hookeriana fatA AAL79361 Helianthus annus fatA1 *Mayer et
al., BMC Plant Biology 7: 1-11, 2007
[0298] In other instances, a fatty aldehyde biosynthetic
polypeptide, variant, or a fragment thereof, is expressed in a host
cell that contains a naturally occurring mutation that results in
an increased level of fatty acids in the host cell. In some
instances, the host cell is genetically engineered to increase the
level of fatty acids in the host cell relative to a corresponding
wild-type host cell. For example, the host cell can be genetically
engineered to express a reduced level of an acyl-CoA synthase
relative to a corresponding wild-type host cell. In one embodiment,
the level of expression of one or more genes (e.g., an acyl-CoA
synthase gene) is reduced by genetically engineering a "knock out"
host cell.
[0299] Any known acyl-CoA synthase gene can be reduced or knocked
out in a host cell. Non-limiting examples of acyl-CoA synthase
genes include fadD, fadK, BH3103, yhfL, Pfl-4354, EAV15023, fadD1,
fadD2, RPC_4074, fadDD35, fadDD22, faa3p or the gene encoding the
protein ZP_01644857. Specific examples of acyl-CoA synthase genes
include fadDD35 from M. tuberculosis H37Rv [NP_217021], fadDD22
from M. tuberculosis H37Rv [NP_217464], fadD from E. coli
[NP_416319], fadK from E. coli [YP_416216], fadD from Acinetobacter
sp. ADP1 [YP_045024], fadD from Haemophilus influenza RdkW20
[NP_438551], fadD from Rhodopseudomonas palustris Bis B18
[YP_533919], BH3101 from Bacillus halodurans C-125 [NP_243969],
Pfl-4354 from Pseudomonas fluorescens Pfo-1 [YP_350082], EAV15023
from Comamonas testosterone KF-1 [ZP_01520072], yhfL from B.
subtilis [NP_388908], fadD1 from P. aeruginosa PAO1 [NP_251989],
fadD1 from Ralstonia solanacearum GM11000 [NP_520978], fadD2 from
P. aeruginosa PAO1 [NP_251990], the gene encoding the protein
ZP_01644857 from Stenotrophomonas maltophilia R551-3, faa3p from
Saccharomyces cerevisiae [NP_012257], faa1p from Saccharomyces
cerevisiae [NP_014962], lcfA from Bacillus subtilis [CAA99571], or
those described in Shockey et al., Plant. Physiol. 129:1710-1722,
2002; Caviglia et al., J. Biol. Chem. 279:1163-1169, 2004; Knoll et
al., J. Biol. Chem. 269(23):16348-56, 1994; Johnson et al., J.
Biol. Chem. 269: 18037-18046, 1994; and Black et al., J. Biol Chem.
267: 25513-25520, 1992.
[0300] Formation of Branched Fatty Alcohols
[0301] Fatty alcohols can be produced from fatty aldehydes that
contain branch points by using branched fatty acid derivatives as
substrates for a fatty aldehyde biosynthetic polypeptide described
herein. For example, although E. coli naturally produces straight
chain fatty acids (sFAs), E. coli can be engineered to produce
branched chain fatty acids (brFAs) by introducing and expressing or
overexpressing genes that provide branched precursors in the E.
coli (e.g., bkd, ilv, icm, and fab gene families). Additionally, a
host cell can be engineered to express or overexpress genes
encoding proteins for the elongation of brFAs (e.g., ACP, FabF,
etc.) and/or to delete or attenuate the corresponding host cell
genes that normally lead to sFAs.
[0302] The first step in forming brFAs is the production of the
corresponding .alpha.-keto acids by a branched-chain amino acid
aminotransferase. Host cells may endogenously include genes
encoding such enzymes or such genes can be recombinantly
introduced. E. coli, for example, endogenously expresses such an
enzyme, IlvE (EC 2.6.1.42; GenBank accession YP_026247). In some
host cells, a heterologous branched-chain amino acid
aminotransferase may not be expressed. However, E. coli IlvE or any
other branched-chain amino acid aminotransferase (e.g., IlvE from
Lactococcus lactis (GenBank accession AAF34406), IlvE from
Pseudomonas putida (GenBank accession NP_745648), or IlvE from
Streptomyces coelicolor (GenBank accession NP_629657)), if not
endogenous, can be introduced.
[0303] In another embodiment, the production of .alpha.-keto acids
can be achieved by using the methods described in Atsumi et al.,
Nature 451:86-89, 2008. For example, 2-ketoisovalerate can be
produced by overexpressing the genes encoding IlvI, IlvH, IlvC, or
IlvD. In another example, 2-keto-3-methyl-valerate can be produced
by overexpressing the genes encoding IlvA and IlvI, IlvH (or AlsS
of Bacillus subtilis), IlvC, IvD, or their corresponding homologs.
In a further embodiment, 2-keto-4-methyl-pentanoate can be produced
by overexpressing the genes encoding IlvI, IlvH, IlvC, IvD and
LeuA, LeuB, LeuC, LeuD, or their corresponding homologs.
[0304] The second step is the oxidative decarboxylation of the
.alpha.-keto acids to the corresponding branched-chain acyl-CoA.
This reaction can be catalyzed by a branched-chain .alpha.-keto
acid dehydrogenase complex (bkd; EC 1.2.4.4.) (Denoya et al., J.
Bacteriol. 177:3504, 1995), which consists of E1.alpha./.beta.
(decarboxylase), E2 (dihydrolipoyl transacylase), and E3
(dihydrolipoyl dehydrogenase) subunits. These branched-chain
.alpha.-keto acid dehydrogenase complexes are similar to pyruvate
and .alpha.-ketoglutarate dehydrogenase complexes. Any
microorganism that possesses brFAs and/or grows on branched-chain
amino acids can be used as a source to isolate bkd genes for
expression in host cells, for example, E. coli. Furthermore, E.
coli has the E3 component as part of its pyruvate dehydrogenase
complex (lpd, EC 1.8.1.4, GenBank accession NP_414658). Thus, it
may be sufficient to express only the E1 .alpha./.beta. and E2 bkd
genes. Table 2 lists non-limiting examples of bkd genes from
several microorganisms that can be recombinantly introduced and
expressed in a host cell to provide branched-chain acyl-CoA
precursors.
TABLE-US-00002 TABLE 2 Bkd genes from selected microorganisms
Organism Gene GenBank Accession # Streptomyces coelicolor bkdA1
(E1.alpha.) NP_628006 bkdB1 (E1.beta.) NP_628005 bkdC1 (E2)
NP_638004 Streptomyces coelicolor bkdA2 (E1.alpha.) NP_733618 bkdB2
(E1.beta.) NP_628019 bkdC2 (E2) NP_628018 Streptomyces avermitilis
bkdA (E1a) BAC72074 bkdB (E1b) BAC72075 bkdC (E2) BAC72076
Streptomyces avermitilis bkdF (E1.alpha.) BAC72088 bkdG (E1.beta.)
BAC72089 bkdH (E2) BAC72090 Bacillus subtilis bkdAA (E1.alpha.)
NP_390288 bkdAB (E1.beta.) NP_390288 bkdB (E2) NP_390288
Pseudomonas putida bkdA1 (E1.alpha.) AAA65614 bkdA2 (E1.beta.)
AAA65615 bkdC (E2) AAA65617
[0305] In another example, isobutyryl-CoA can be made in a host
cell, for example in E. coli, through the coexpression of a
crotonyl-CoA reductase (Ccr, EC 1.6.5.5, 1.1.1.1) and
isobutyryl-CoA mutase (large subunit IcmA, EC 5.4.99.2; small
subunit IcmB, EC 5.4.99.2) (Han and Reynolds, J. Bacteriol.
179:5157, 1997). Crotonyl-CoA is an intermediate in fatty acid
biosynthesis in E. coli and other microorganisms. Non-limiting
examples of ccr and icm genes from selected microorganisms are
listed in Table 3.
TABLE-US-00003 TABLE 3 Ccr and icm genes from selected
microorganisms Organism Gene GenBank Accession # Streptomyces
coelicolor ccr NP_630556 icmA NP_629554 icmB NP_630904 Streptomyces
cinnamonensis ccr AAD53915 icmA AAC08713 icmB AJ246005
[0306] In addition to expression of the bkd genes, the initiation
of brFA biosynthesis utilizes .beta.-ketoacyl-acyl-carrier-protein
synthase III (FabH, EC 2.3.1.41) with specificity for branched
chain acyl-CoAs (Li et al., J. Bacteriol. 187:3795-3799, 2005).
Non-limiting examples of such FabH enzymes are listed in Table 4.
fabH genes that are involved in fatty acid biosynthesis of any
brFA-containing microorganism can be expressed in a host cell. The
Bkd and FabH enzymes from host cells that do not naturally make
brFA may not support brFA production. Therefore, bkd and fabH can
be expressed recombinantly. Vectors containing the bkd and fabH
genes can be inserted into such a host cell. Similarly, the
endogenous level of Bkd and FabH production may not be sufficient
to produce brFA. In this case, they can be overexpressed.
Additionally, other components of the fatty acid biosynthesis
pathway can be expressed or overexpressed, such as acyl carrier
proteins (ACPs) and .beta.-ketoacyl-acyl-carrier-protein synthase
II (fabF, EC 2.3.1.41) (non-limiting examples of candidates are
listed in Table 4). In addition to expressing these genes, some
genes in the endogenous fatty acid biosynthesis pathway can be
attenuated in the host cell (e.g., the E. coli genes fabH (GenBank
accession # NP_415609) and/or fabF (GenBank accession #
NP_415613)).
TABLE-US-00004 TABLE 4 FabH, ACP and fabF genes from selected
microorganisms with brFAs Organism Gene GenBank Accession #
Streptomyces coelicolor fabH1 NP_626634 acp NP_626635 fabF
NP_626636 Streptomyces avermitilis fabH3 NP_823466 fabC3 (acp)
NP_823467 fabF NP_823468 Bacillus subtilis fabH_A NP_389015 fabH_B
NP_388898 acp NP_389474 fabF NP_389016 Stenotrophomonas
SmalDRAFT_0818 (fabH) ZP_01643059 maltophilia SmalDRAFT_0821 (acp)
ZP_01643063 SmalDRAFT_0822 (fabF) ZP_01643064 Legionella
pneumophila fabH YP_123672 acp YP_123675 fabF YP_123676
[0307] Formation of Cyclic Fatty Alcohols
[0308] Cyclic fatty alcohols can be produced from cyclic fatty
aldehydes using cyclic fatty acid derivatives as substrates for a
fatty aldehyde biosynthetic polypeptide described herein. To
produce cyclic fatty acid derivative substrates, genes that provide
cyclic precursors (e.g., the ans, chc, and plm gene families) can
be introduced into the host cell and expressed to allow initiation
of fatty acid biosynthesis from cyclic precursors. For example, to
convert a host cell, such as E. coli, into one capable of
synthesizing .omega.-cyclic fatty acids (cyFA), a gene that
provides the cyclic precursor cyclohexylcarbonyl-CoA (CHC-CoA)
(Cropp et al., Nature Biotech. 18:980-983, 2000) can be introduced
and expressed in the host cell. Non-limiting examples of genes that
provide CHC-CoA in E. coli include: ansJ, ansK, ansL, chcA, and
ansM from the ansatrienin gene cluster of Streptomyces collinus
(Chen et al., Eur. J. Biochem. 261: 98-107, 1999) or plmJ, plmK,
plmL, chcA, and plmM from the phoslactomycin B gene cluster of
Streptomyces sp. HK803 (Palaniappan et al., J. Biol. Chem.
278:35552-35557, 2003) together with the chcB gene (Patton et al.,
Biochem. 39:7595-7604, 2000) from S. collinus, S. avermitilis, or
S. coelicolor (see Table 5). The genes listed in Table 4 can then
be expressed to allow initiation and elongation of .omega.-cyclic
fatty acids. Alternatively, the homologous genes can be isolated
from microorganisms that make cyFA and expressed in a host cell
(e.g., E. coli).
TABLE-US-00005 TABLE 5 Genes for the synthesis of CHC-CoA Organism
Gene GenBank Accession # Streptomyces collinus ansJK U72144* ansL
chcA ansM chcB AF268489 Streptomyces sp. HK803 pmlJK AAQ84158 pmlL
AAQ84159 chcA AAQ84160 pmlM AAQ84161 Streptomyces coelicolor
chcB/caiD NP_629292 Streptomyces avermitilis chcB/caiD NP_629292
*Only chcA is annotated in GenBank entry U72144, ansJKLM are
according to Chen et al. (Eur. J. Biochem. 261: 98-107, 1999).
[0309] The genes listed in Table 4 (fabH, acp, and fabF) allow
initiation and elongation of .omega.-cyclic fatty acids because
they have broad substrate specificity. If the coexpression of any
of these genes with the genes listed in Table 5 does not yield
cyFA, then fabH, acp, and/or fabF homologs from microorganisms that
make cyFAs (e.g., those listed in Table 6) can be isolated (e.g.,
by using degenerate PCR primers or heterologous DNA sequence
probes) and coexpressed.
TABLE-US-00006 TABLE 6 Non-limiting examples of microorganisms that
contain .omega.-cyclic fatty acids Organism Reference
Curtobacterium pusilium ATCC19096 Alicyclobacillus acidoterrestris
ATCC49025 Alicyclobacillus acidocaldarius ATCC27009
Alicyclobacillus cycloheptanicus * Moore, J. Org. Chem. 62: pp.
2173, 1997. * Uses cycloheptylcarbonyl-CoA and not
cyclohexylcarbonyl-CoA as precursor for cyFA biosynthesis.
[0310] Fatty Alcohol Saturation Levels
[0311] The degree of saturation in fatty acids (which can then be
converted into fatty aldehydes and then fatty alcohols as described
herein) can be controlled by regulating the degree of saturation of
fatty acid intermediates. For example, the sfa, gns, and fab
families of genes can be expressed, overexpressed, or expressed at
reduced levels, to control the saturation of fatty acids. FIG. 9
lists non-limiting examples of genes in these gene families that
may be used in the methods and host cells described herein.
[0312] For example, host cells can be engineered to produce
unsaturated fatty acids by engineering the production host to
overexpress fabB or by growing the production host at low
temperatures (e.g., less than 37.degree. C.). FabB has preference
to cis-.delta.3decenoyl-ACP and results in unsaturated fatty acid
production in E. coli. Overexpression of fabB results in the
production of a significant percentage of unsaturated fatty acids
(de Mendoza et al., J. Biol. Chem. 258:2098-2101, 1983). The gene
fabB may be inserted into and expressed in host cells not naturally
having the gene. These unsaturated fatty acids can then be used as
intermediates in host cells that are engineered to produce fatty
acid derivatives, such as fatty aldehydes.
[0313] In other instances, a repressor of fatty acid biosynthesis,
for example, fabR (GenBank accession NP_418398), can be deleted,
which will also result in increased unsaturated fatty acid
production in E. coli (Zhang et al., J. Biol. Chem. 277:15558,
2002). Similar deletions may be made in other host cells. A further
increase in unsaturated fatty acids may be achieved, for example,
by overexpressing fabM (trans-2, cis-3-decenoyl-ACP isomerase,
GenBank accession DAA05501) and controlled expression of fabK
(trans-2-enoyl-ACP reductase II, GenBank accession NP_357969) from
Streptococcus pneumoniae (Marrakchi et al., J. Biol. Chem. 277:
44809, 2002), while deleting E. coli fabI (trans-2-enoyl-ACP
reductase, GenBank accession NP_415804). In some examples, the
endogenous fabF gene can be attenuated, thus increasing the
percentage of palmitoleate (C16:1) produced.
[0314] In yet other examples, host cells can be engineered to
produce saturated fatty acids by reducing the expression of an sfa,
gns, and/or fab gene.
[0315] In some instances, a host cell can be engineered to express
an attenuated level of a dehydratase/isomerase and/or a
ketoacyl-ACP synthase. For example, a host cell can be engineered
to express a decreased level of fabA and/or fabB. In some
instances, the host cell can be grown in the presence of
unsaturated fatty acids. In other instances, the host cell can be
further engineered to express or overexpress a gene encoding a
desaturase enzyme. One nonlimiting example of a desaturase is B.
subtilis DesA (AF037430). Other genes encoding desaturase enzymes
are known in the art and can be used in the host cells and methods
described herein, such as desaturases that use acyl-ACP, such as
hexadecanoyl-ACP or octadecanoyl-ACP. The saturated fatty acids can
be used to produce fatty acid derivatives, such as fatty aldehydes,
and subsequently saturated fatty alcohols, as described herein.
Production of Fatty Alcohols
[0316] A fatty aldehyde described herein can be converted into a
fatty alcohol by an alcohol dehydrogenase. In some examples, a gene
encoding a fatty aldehyde biosynthetic polypeptide described herein
can be expressed in a host cell that expresses an endogenous
alcohol dehydrogenase capable of converting a fatty aldehyde
produced by the fatty aldehyde biosynthetic polypeptide into a
corresponding fatty alcohol. In other instances, a gene encoding a
fatty alcohol biosynthetic polypeptide described herein, such as an
amino acid sequence listed in FIG. 10 or a variant thereof, can be
expressed in a host cell. Exemplary fatty alcohol biosynthetic
genes include, but are not limited to, AlrA of Acenitobacter sp.
M-1 or AlrA homologs; and endogenous E. coli alcohol dehydrogenases
such as DkgA (NP_417485), DkgB (NP_414743), YjgB, (AAC77226), YdjL
(AAC74846), YdjJ (NP_416288), AdhP (NP_415995), YhdH (NP_417719),
YahK (NP_414859), YphC (AAC75598), and YqhD (Q46856). In other
instances, a gene encoding a fatty alcohol biosynthetic polypeptide
can be co-expressed in a host cell with a gene encoding a fatty
aldehyde biosynthetic polypeptide described herein.
Genetic Engineering of Host Cells to Produce Fatty Alcohols
[0317] Various host cells can be used to produce fatty alcohols, as
described herein. A host cell can be any prokaryotic or eukaryotic
cell. For example, a gene encoding a polypeptide described herein
(e.g., a fatty aldehyde biosynthetic polypeptide and/or a fatty
alcohol biosynthetic polypeptide) can be expressed in bacterial
cells (such as E. coli), insect cells, yeast, or mammalian cells
(such as Chinese hamster ovary cells (CHO) cells, COS cells, VERO
cells, BHK cells, HeLa cells, Cv1 cells, MDCK cells, 293 cells, 3T3
cells, or PC12 cells). Other exemplary host cells include cells
from the members of the genus Escherichia, Bacillus, Lactobacillus,
Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora,
Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor,
Myceliophtora, Penicillium, Phanerochaete, Pleurotus, Trametes,
Chrysosporium, Saccharomyces, Schizosaccharomyces, Yarrowia, or
Streptomyces. Yet other exemplary host cells can be a Bacillus
lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus
cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell,
a Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus
pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii
cell, a Bacillus megaterium cell, a Bacillus subtilis cell, a
Bacillus amyloliquefaciens cell, a Trichoderma koningii cell, a
Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma
longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus
fumigates cell, an Aspergillus foetidus cell, an Aspergillus
nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae
cell, a Humicola insolens cell, a Humicola lanuginose cell, a
Rhizomucor miehei cell, a Mucor michei cell, a Streptomyces
lividans cell, a Streptomyces murinus cell, or an Actinomycetes
cell. Other host cells are cyanobacterial host cells.
[0318] In a preferred embodiment, the host cell is an E. coli cell,
a Saccharomyces cerevisiae cell, or a Bacillus subtilis cell. In a
more preferred embodiment, the host cell is from E. coli strains B,
C, K, or W. Other suitable host cells are known to those skilled in
the art.
[0319] Additional host cells that can be used in the methods
described herein are described in WO2009/111513 and
WO2009/111672.
[0320] Various methods well known in the art can be used to
genetically engineer host cells to produce fatty alcohols. The
methods can include the use of vectors, preferably expression
vectors, containing a nucleic acid encoding a fatty aldehyde
biosynthetic polypeptide and/or a fatty alcohol biosynthetic
polypeptide described herein, polypeptide variant, or a fragment
thereof. Those skilled in the art will appreciate a variety of
viral vectors (for example, retroviral vectors, lentiviral vectors,
adenoviral vectors, and adeno-associated viral vectors) and
non-viral vectors can be used in the methods described herein.
[0321] The recombinant expression vectors described herein include
a nucleic acid described herein in a form suitable for expression
of the nucleic acid in a host cell. The recombinant expression
vectors can include one or more control sequences, selected on the
basis of the host cell to be used for expression. The control
sequence is operably linked to the nucleic acid sequence to be
expressed. Such control sequences are described, for example, in
Goeddel, Gene Expression Technology: Methods in Enzymology 185,
Academic Press, San Diego, Calif. (1990). Control sequences include
those that direct constitutive expression of a nucleotide sequence
in many types of host cells and those that direct expression of the
nucleotide sequence only in certain host cells (e.g.,
tissue-specific regulatory sequences). It will be appreciated by
those skilled in the art that the design of the expression vector
can depend on such factors as the choice of the host cell to be
transformed, the level of expression of protein desired, etc. The
expression vectors described herein can be introduced into host
cells to produce polypeptides, including fusion polypeptides,
encoded by the nucleic acids as described herein.
[0322] Recombinant expression vectors can be designed for
expression of a gene encoding a fatty aldehyde biosynthetic
polypeptide (or variant) and/or a gene encoding a fatty alcohol
biosynthetic polypeptide in prokaryotic or eukaryotic cells (e.g.,
bacterial cells, such as E. coli, insect cells (e.g., using
baculovirus expression vectors), yeast cells, or mammalian cells).
Suitable host cells are discussed further in Goeddel, Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990). Alternatively, the recombinant expression
vector can be transcribed and translated in vitro, for example, by
using T7 promoter regulatory sequences and T7 polymerase.
[0323] Expression of genes encoding polypeptides in prokaryotes,
for example, E. coli, is most often carried out with vectors
containing constitutive or inducible promoters directing the
expression of either fusion or non-fusion polypeptides. Fusion
vectors add a number of amino acids to a polypeptide encoded
therein, usually to the amino terminus of the recombinant
polypeptide. Such fusion vectors typically serve three purposes:
(1) to increase expression of the recombinant polypeptide; (2) to
increase the solubility of the recombinant polypeptide; and (3) to
aid in the purification of the recombinant polypeptide by acting as
a ligand in affinity purification. Often, in fusion expression
vectors, a proteolytic cleavage site is introduced at the junction
of the fusion moiety and the recombinant polypeptide. This enables
separation of the recombinant polypeptide from the fusion moiety
after purification of the fusion polypeptide. Examples of such
enzymes, and their cognate recognition sequences, include Factor
Xa, thrombin, and enterokinase. Exemplary fusion expression vectors
include pGEX (Pharmacia Biotech Inc; Smith et al., Gene (1988)
67:31-40), pMAL (New England Biolabs, Beverly, Mass.), and pRITS
(Pharmacia, Piscataway, N.J.), which fuse glutathione S-transferase
(GST), maltose E binding protein, or protein A, respectively, to
the target recombinant polypeptide.
[0324] Examples of inducible, non-fusion E. coli expression vectors
include pTrc (Amann et al., Gene (1988) 69:301-315) and pET 11d
(Studier et al., Gene Expression Technology: Methods in Enzymology
185, Academic Press, San Diego, Calif. (1990) 60-89). Target gene
expression from the pTrc vector relies on host RNA polymerase
transcription from a hybrid trp-lac fusion promoter. Target gene
expression from the pET 11d vector relies on transcription from a
T7 gn10-lac fusion promoter mediated by a coexpressed viral RNA
polymerase (T7 gn1). This viral polymerase is supplied by host
strains BL21(DE3) or HMS174(DE3) from a resident) prophage
harboring a T7 gn1 gene under the transcriptional control of the
lacUV 5 promoter.
[0325] One strategy to maximize recombinant polypeptide expression
is to express the polypeptide in a host cell with an impaired
capacity to proteolytically cleave the recombinant polypeptide (see
Gottesman, Gene Expression Technology: Methods in Enzymology 185,
Academic Press, San Diego, Calif. (1990) 119-128). Another strategy
is to alter the nucleic acid sequence to be inserted into an
expression vector so that the individual codons for each amino acid
are those preferentially utilized in the host cell (Wada et al.,
Nucleic Acids Res. (1992) 20:2111-2118). Such alteration of nucleic
acid sequences can be carried out by standard DNA synthesis
techniques.
[0326] In another embodiment, the host cell is a yeast cell. In
this embodiment, the expression vector is a yeast expression
vector. Examples of vectors for expression in yeast S. cerevisiae
include pYepSec1 (Baldari et al., EMBO J. (1987) 6:229-234), pMFa
(Kurjan et al., Cell (1982) 30:933-943), pJRY88 (Schultz et al.,
Gene (1987) 54:113-123), pYES2 (Invitrogen Corporation, San Diego,
Calif.), and picZ (Invitrogen Corp, San Diego, Calif.).
[0327] Alternatively, a polypeptide described herein can be
expressed in insect cells using baculovirus expression vectors.
Baculovirus vectors available for expression of proteins in
cultured insect cells (e.g., Sf9 cells) include, for example, the
pAc series (Smith et al., Mol. Cell Biol. (1983) 3:2156-2165) and
the pVL series (Lucklow et al., Virology (1989) 170:31-39).
[0328] In yet another embodiment, the nucleic acids described
herein can be expressed in mammalian cells using a mammalian
expression vector. Examples of mammalian expression vectors include
pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al.,
EMBO J. (1987) 6:187-195). When used in mammalian cells, the
expression vector's control functions can be provided by viral
regulatory elements. For example, commonly used promoters are
derived from polyoma, Adenovirus 2, cytomegalovirus, and Simian
Virus 40. Other suitable expression systems for both prokaryotic
and eukaryotic cells are described in chapters 16 and 17 of
Sambrook et al., eds., Molecular Cloning: A Laboratory Manual. 2nd,
ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989.
[0329] Vectors can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" refer
to a variety of art-recognized techniques for introducing foreign
nucleic acid (e.g., DNA) into a host cell, including calcium
phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting
host cells can be found in, for example, Sambrook et al.
(supra).
[0330] For stable transformation of bacterial cells, it is known
that, depending upon the expression vector and transformation
technique used, only a small fraction of cells will take-up and
replicate the expression vector. In order to identify and select
these transformants, a gene that encodes a selectable marker (e.g.,
resistance to antibiotics) can be introduced into the host cells
along with the gene of interest. Selectable markers include those
that confer resistance to drugs, such as ampicillin, kanamycin,
chloramphenicol, or tetracycline. Nucleic acids encoding a
selectable marker can be introduced into a host cell on the same
vector as that encoding a polypeptide described herein or can be
introduced on a separate vector. Cells stably transfected with the
introduced nucleic acid can be identified by drug selection (e.g.,
cells that have incorporated the selectable marker gene will
survive, while the other cells die).
[0331] For stable transfection of mammalian cells, it is known
that, depending upon the expression vector and transfection
technique used, only a small fraction of cells may integrate the
foreign DNA into their genome. In order to identify and select
these integrants, a gene that encodes a selectable marker (e.g.,
resistance to antibiotics) can be introduced into the host cells
along with the gene of interest. Preferred selectable markers
include those which confer resistance to drugs, such as G418,
hygromycin, and methotrexate. Nucleic acids encoding a selectable
marker can be introduced into a host cell on the same vector as
that encoding a polypeptide described herein or can be introduced
on a separate vector. Cells stably transfected with the introduced
nucleic acid can be identified by drug selection (e.g., cells that
have incorporated the selectable marker gene will survive, while
the other cells die).
Transport Proteins
[0332] Transport proteins can export polypeptides and organic
compounds (e.g., fatty alcohols) out of a host cell. Many transport
and efflux proteins serve to excrete a wide variety of compounds
and can be naturally modified to be selective for particular types
of hydrocarbons.
[0333] Non-limiting examples of suitable transport proteins are
ATP-Binding Cassette (ABC) transport proteins, efflux proteins, and
fatty acid transporter proteins (FATP). Additional non-limiting
examples of suitable transport proteins include the ABC transport
proteins from organisms such as Caenorhabditis elegans, Arabidopsis
thalania, Alkaligenes eutrophus, and Rhodococcus erythropolis.
Exemplary ABC transport proteins that can be used are listed in
FIG. 9 (e.g., CER5, AtMRP5, AmiS2, and AtPGP1). Host cells can also
be chosen for their endogenous ability to secrete organic
compounds. The efficiency of organic compound production and
secretion into the host cell environment (e.g., culture medium,
fermentation broth) can be expressed as a ratio of intracellular
product to extracellular product. In some examples, the ratio can
be about 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, or 1:5.
Fermentation
[0334] The production and isolation of fatty alcohols can be
enhanced by employing beneficial fermentation techniques. One
method for maximizing production while reducing costs is increasing
the percentage of the carbon source that is converted to
hydrocarbon products.
[0335] During normal cellular lifecycles, carbon is used in
cellular functions, such as producing lipids, saccharides,
proteins, organic acids, and nucleic acids. Reducing the amount of
carbon necessary for growth-related activities can increase the
efficiency of carbon source conversion to product. This can be
achieved by, for example, first growing host cells to a desired
density (for example, a density achieved at the peak of the log
phase of growth). At such a point, replication checkpoint genes can
be harnessed to stop the growth of cells. Specifically, quorum
sensing mechanisms (reviewed in Camilli et al., Science 311:1113,
2006; Venturi FEMS Microbio. Rev. 30:274-291, 2006; and Reading et
al., FEMS Microbiol. Lett. 254:1-11, 2006) can be used to activate
checkpoint genes, such as p53, p21, or other checkpoint genes.
[0336] Genes that can be activated to stop cell replication and
growth in E. coli include umuDC genes. The overexpression of umuDC
genes stops the progression from stationary phase to exponential
growth (Murli et al., J. of Bact. 182:1127, 2000). UmuC is a DNA
polymerase that can carry out translesion synthesis over non-coding
lesions--the mechanistic basis of most UV and chemical mutagenesis.
The umuDC gene products are involved in the process of translesion
synthesis and also serve as a DNA sequence damage checkpoint. The
umuDC gene products include UmuC, UmuD, umuD', UmuD'.sub.2C,
UmuD'.sub.2, and UmuD.sub.2. Simultaneously, product-producing
genes can be activated, thus minimizing the need for replication
and maintenance pathways to be used while a fatty aldehyde is being
made. Host cells can also be engineered to express umuC and umuD
from E. coli in pBAD24 under the prpBCDE promoter system through de
novo synthesis of this gene with the appropriate end-product
production genes.
[0337] The percentage of input carbons converted to fatty alcohols
can be a cost driver. The more efficient the process is (i.e., the
higher the percentage of input carbons converted to fatty
alcohols), the less expensive the process will be. For
oxygen-containing carbon sources (e.g., glucose and other
carbohydrate based sources), the oxygen must be released in the
form of carbon dioxide. For every 2 oxygen atoms released, a carbon
atom is also released leading to a maximal theoretical metabolic
efficiency of approximately 34% (w/w) (for fatty acid derived
products). This figure, however, changes for other organic
compounds and carbon sources. Typical efficiencies in the
literature are approximately less than 5%. Host cells engineered to
produce fatty alcohols can have greater than about 1, 3, 5, 10, 15,
20, 25, and 30% efficiency. In one example, host cells can exhibit
an efficiency of about 10% to about 25%. In other examples, such
host cells can exhibit an efficiency of about 25% to about 30%. In
other examples, host cells can exhibit greater than 30%
efficiency.
[0338] The host cell can be additionally engineered to express
recombinant cellulosomes, such as those described in PCT
application number PCT/US2007/003736. These cellulosomes can allow
the host cell to use cellulosic material as a carbon source. For
example, the host cell can be additionally engineered to express
invertases (EC 3.2.1.26) so that sucrose can be used as a carbon
source. Similarly, the host cell can be engineered using the
teachings described in U.S. Pat. Nos. 5,000,000; 5,028,539;
5,424,202; 5,482,846; and 5,602,030; so that the host cell can
assimilate carbon efficiently and use cellulosic materials as
carbon sources.
[0339] In one example, the fermentation chamber can enclose a
fermentation that is undergoing a continuous reduction. In this
instance, a stable reductive environment can be created. The
electron balance can be maintained by the release of carbon dioxide
(in gaseous form). Efforts to augment the NAD/H and NADP/H balance
can also facilitate in stabilizing the electron balance. The
availability of intracellular NADPH can also be enhanced by
engineering the host cell to express an NADH:NADPH
transhydrogenase. The expression of one or more NADH:NADPH
transhydrogenases converts the NADH produced in glycolysis to
NADPH, which can enhance the production of fatty alcohols.
[0340] For small scale production, the engineered host cells can be
grown in batches of, for example, about 100 mL, 500 mL, 1 L, 2 L, 5
L, or 10 L; fermented; and induced to express desired fatty
aldehyde biosynthetic genes and/or an alcohol dehydrogenase genes
based on the specific genes encoded in the appropriate plasmids.
For large scale production, the engineered host cells can be grown
in batches of about 10 L, 100 L, 1000 L, 10,000 L, 100,000 L,
1,000,000 L or larger; fermented; and induced to express desired
fatty aldehyde biosynthetic genes and/or alcohol dehydrogenase
genes based on the specific genes encoded in the appropriate
plasmids or incorporated into the host cell's genome.
[0341] For example, a suitable production host, such as E. coli
cells, harboring plasmids containing the desired genes or having
the genes integrated in its chromosome can be incubated in a
suitable reactor, for example a 1 L reactor, for 20 hours at
37.degree. C. in M9 medium supplemented with 2% glucose,
carbenicillin, and chloramphenicol. When the OD.sub.600 of the
culture reaches 0.9, the production host can be induced with IPTG
alcohol After incubation, the spent media can be extracted and the
organic phase can be examined for the presence of fatty alcohols
using GC-MS.
[0342] In some instances, after the first hour of induction,
aliquots of no more than about 10% of the total cell volume can be
removed each hour and allowed to sit without agitation to allow the
fatty alcohols to rise to the surface and undergo a spontaneous
phase separation or precipitation. The fatty alcohol component can
then be collected, and the aqueous phase returned to the reaction
chamber. The reaction chamber can be operated continuously. When
the OD.sub.600 drops below 0.6, the cells can be replaced with a
new batch grown from a seed culture.
Producing Fatty Alcohols Using Cell-Free Methods
[0343] In some methods described herein, a fatty alcohol can be
produced using a purified polypeptide (e.g., a fatty alcohol
biosynthetic polypeptide) described herein and a substrate (e.g.,
fatty aldehyde), produced, for example, by a method described
herein. For example, a host cell can be engineered to express a
fatty alcohol biosynthetic polypeptide or variant as described
herein. The host cell can be cultured under conditions suitable to
allow expression of the polypeptide. Cell free extracts can then be
generated using known methods. For example, the host cells can be
lysed using detergents or by sonication. The expressed polypeptides
can be purified using known methods. After obtaining the cell free
extracts, substrates described herein can be added to the cell free
extracts and maintained under conditions to allow conversion of the
substrates (e.g., fatty aldehydes) to fatty alcohols. The fatty
alcohols can then be separated and purified using known
techniques.
[0344] In some instances, a fatty aldehyde described herein can be
converted into a fatty alcohol by contacting the fatty aldehyde
with a fatty alcohol biosynthetic polypeptide listed in FIG. 10, or
a variant thereof.
Post-Production Processing
[0345] The fatty alcohols produced during fermentation can be
separated from the fermentation media. Any known technique for
separating fatty alcohols from aqueous media can be used. One
exemplary separation process is a two phase (bi-phasic) separation
process. This process involves fermenting the genetically
engineered host cells under conditions sufficient to produce a
fatty alcohols, allowing the fatty alcohol to collect in an organic
phase, and separating the organic phase from the aqueous
fermentation broth. This method can be practiced in both a batch
and continuous fermentation processes.
[0346] Bi-phasic separation uses the relative immiscibility of
fatty alcohols to facilitate separation. Immiscible refers to the
relative inability of a compound to dissolve in water and is
defined by the compound's partition coefficient. One of ordinary
skill in the art will appreciate that by choosing a fermentation
broth and organic phase, such that the fatty alcohol being produced
has a high log P value, the fatty alcohol can separate into the
organic phase, even at very low concentrations, in the fermentation
vessel.
[0347] The fatty alcohols produced by the methods described herein
can be relatively immiscible in the fermentation broth, as well as
in the cytoplasm. Therefore, the fatty alcohol can collect in an
organic phase either intracellularly or extracellularly. The
collection of the products in the organic phase can lessen the
impact of the fatty alcohol on cellular function and can allow the
host cell to produce more product.
[0348] The methods described herein can result in the production of
homogeneous compounds wherein at least about 60%, 70%, 80%, 90%, or
95% of the fatty alcohols produced will have carbon chain lengths
that vary by less than about 6 carbons, less than about 4 carbons,
or less than about 2 carbons. These compounds can also be produced
with a relatively uniform degree of saturation. These compounds can
be used directly as fuels, fuel additives, starting materials for
production of other chemical compounds (e.g., polymers,
surfactants, plastics, textiles, solvents, adhesives, etc.), or
personal care additives. These compounds can also be used as
feedstock for subsequent reactions, for example, hydrogenation,
catalytic cracking (e.g., via hydrogenation, pyrolisis, or both),
to make other products.
[0349] In some embodiments, the fatty alcohols produced using
methods described herein can contain between about 50% and about
90% carbon; or between about 5% and about 25% hydrogen. In other
embodiments, the fatty alcohols produced using methods described
herein can contain between about 65% and about 85% carbon; or
between about 10% and about 15% hydrogen.
Surfactant and Detergent Compositions and Bioproducts
[0350] The fatty alcohols described herein can be used as or
converted into a surfactant or detergent composition. One of
ordinary skill in the art will appreciate that, depending upon the
intended purpose of the surfactant or detergent, different fatty
alcohols can be produced and used. For example, when the fatty
alcohols described herein are used as a feedstock for surfactant or
detergent production, one of ordinary skill in the art will
appreciate that the characteristics of the fatty alcohol feedstock
will affect the characteristics of the surfactant or detergent
produced. Hence, the characteristics of the surfactant or detergent
product can be selected for by producing particular fatty alcohols
for use as a feedstock.
[0351] Bioproducts (e.g., fatty alcohols) comprising biologically
produced organic compounds, particularly fatty alcohols
biologically produced using the fatty acid biosynthetic pathway,
have not been produced from renewable sources and, as such, are new
compositions of matter. These new bioproducts can be distinguished
from organic compounds derived from petrochemical carbon on the
basis of dual carbon-isotopic fingerprinting or .sup.14C dating.
Additionally, the specific source of biosourced carbon (e.g.,
glucose vs. glycerol) can be determined by dual carbon-isotopic
fingerprinting (see, e.g., U.S. Pat. No. 7,169,588, which is herein
incorporated by reference).
[0352] The ability to distinguish bioproducts from petroleum based
organic compounds is beneficial in tracking these materials in
commerce. For example, organic compounds or chemicals comprising
both biologically based and petroleum based carbon isotope profiles
may be distinguished from organic compounds and chemicals made only
of petroleum based materials. Hence, the instant materials may be
followed in commerce on the basis of their unique carbon isotope
profile.
[0353] Bioproducts can be distinguished from petroleum based
organic compounds by comparing the stable carbon isotope ratio
(.sup.13C/.sup.12C) in each fuel. The .sup.13C/.sup.12C ratio in a
given bioproduct is a consequence of the .sup.13C/.sup.12C ratio in
atmospheric carbon dioxide at the time the carbon dioxide is fixed.
It also reflects the precise metabolic pathway. Regional variations
also occur. Petroleum, C.sub.3 plants (the broadleaf), C.sub.4
plants (the grasses), and marine carbonates all show significant
differences in .sup.13C/.sup.12C and the corresponding
.delta..sup.13C values. Furthermore, lipid matter of C.sub.3 and
C.sub.4 plants analyze differently than materials derived from the
carbohydrate components of the same plants as a consequence of the
metabolic pathway.
[0354] Within the precision of measurement, .sup.13C shows large
variations due to isotopic fractionation effects, the most
significant of which for bioproducts is the photosynthetic
mechanism. The major cause of differences in the carbon isotope
ratio in plants is closely associated with differences in the
pathway of photosynthetic carbon metabolism in the plants,
particularly the reaction occurring during the primary
carboxylation (i.e., the initial fixation of atmospheric CO.sub.2).
Two large classes of vegetation are those that incorporate the
"C.sub.3" (or Calvin-Benson) photosynthetic cycle and those that
incorporate the "C.sub.4" (or Hatch-Slack) photosynthetic
cycle.
[0355] In C.sub.3 plants, the primary CO.sub.2 fixation or
carboxylation reaction involves the enzyme ribulose-1,5-diphosphate
carboxylase, and the first stable product is a 3-carbon compound.
C.sub.3 plants, such as hardwoods and conifers, are dominant in the
temperate climate zones.
[0356] In C.sub.4 plants, an additional carboxylation reaction
involving another enzyme, phosphoenol-pyruvate carboxylase, is the
primary carboxylation reaction. The first stable carbon compound is
a 4-carbon acid that is subsequently decarboxylated. The CO.sub.2
thus released is refixed by the C.sub.3 cycle. Examples of C.sub.4
plants are tropical grasses, corn, and sugar cane.
[0357] Both C.sub.4 and C.sub.3 plants exhibit a range of
.sup.13C/.sup.12C isotopic ratios, but typical values are about -7
to about -13 per mil for C.sub.4 plants and about -19 to about -27
per mil for C.sub.3 plants (see, e.g., Stuiver et al., Radiocarbon
19:355, 1977). Coal and petroleum fall generally in this latter
range. The .sup.13C measurement scale was originally defined by a
zero set by Pee Dee Belemnite (PDB) limestone, where values are
given in parts per thousand deviations from this material. The
".delta..sup.13C" values are expressed in parts per thousand (per
mil), abbreviated, .Salinity., and are calculated as follows:
.delta..sup.13C(.Salinity.)=[(.sup.13C/.sup.12C).sub.sample-(.sup.13C/.s-
up.12C).sub.standard]/(.sup.13C/.sup.12C).sub.standard.times.1000
[0358] Since the PDB reference material (RM) has been exhausted, a
series of alternative RMs have been developed in cooperation with
the IAEA, USGS, NIST, and other selected international isotope
laboratories. Notations for the per mil deviations from PDB is
.delta..sup.13C. Measurements are made on CO.sub.2 by high
precision stable ratio mass spectrometry (IRMS) on molecular ions
of masses 44, 45, and 46.
[0359] The compositions described herein include bioproducts
produced by any of the methods described herein. Specifically, the
bioproduct can have a .delta..sup.13C of about -28 or greater,
about -27 or greater, -20 or greater, -18 or greater, -15 or
greater, -13 or greater, -10 or greater, or -8 or greater. For
example, the bioproduct can have a .delta..sup.13C of about -30 to
about -15, about -27 to about -19, about -25 to about -21, about
-15 to about -5, about -13 to about -7, or about -13 to about -10.
In other instances, the bioproduct can have a .delta..sup.13C of
about -10, -11, -12, or -12.3.
[0360] Bioproducts can also be distinguished from petroleum based
organic compounds by comparing the amount of .sup.14C in each
compound. Because .sup.14C has a nuclear half life of 5730 years,
petroleum based fuels containing "older" carbon can be
distinguished from bioproducts which contain "newer" carbon (see,
e.g., Currie, "Source Apportionment of Atmospheric Particles",
Characterization of Environmental Particles, J. Buffle and H. P.
van Leeuwen, Eds., 1 of Vol. I of the IUPAC Environmental
Analytical Chemistry Series (Lewis Publishers, Inc) (1992)
3-74).
[0361] The basic assumption in radiocarbon dating is that the
constancy of .sup.14C concentration in the atmosphere leads to the
constancy of .sup.14C in living organisms. However, because of
atmospheric nuclear testing since 1950 and the burning of fossil
fuel since 1850, .sup.14C has acquired a second, geochemical time
characteristic. Its concentration in atmospheric CO.sub.2, and
hence in the living biosphere, approximately doubled at the peak of
nuclear testing, in the mid-1960s. It has since been gradually
returning to the steady-state cosmogenic (atmospheric) baseline
isotope rate (.sup.14C/.sup.12C) of about 1.2.times.10.sup.-12,
with an approximate relaxation "half-life" of 7-10 years. (This
latter half-life must not be taken literally; rather, one must use
the detailed atmospheric nuclear input/decay function to trace the
variation of atmospheric and biospheric .sup.14C since the onset of
the nuclear age.)
[0362] It is this latter biospheric .sup.14C time characteristic
that holds out the promise of annual dating of recent biospheric
carbon. .sup.14C can be measured by accelerator mass spectrometry
(AMS), with results given in units of "fraction of modern carbon"
(f.sub.M). f.sub.M is defined by National Institute of Standards
and Technology (NIST) Standard Reference Materials (SRMs) 4990B and
4990C. As used herein, "fraction of modern carbon" or "f.sub.M" has
the same meaning as defined by National Institute of Standards and
Technology (NIST) Standard Reference Materials (SRMs) 4990B and
4990C, known as oxalic acids standards HOxI and HOxII,
respectively. The fundamental definition relates to 0.95 times the
.sup.14C/.sup.12C isotope ratio HOxI (referenced to AD 1950). This
is roughly equivalent to decay-corrected pre-Industrial Revolution
wood. For the current living biosphere (plant material), f.sub.M is
approximately 1.1.
[0363] The compositions described herein include bioproducts that
can have an f.sub.M .sup.14C of at least about 1. For example, the
bioproduct can have an f.sub.M .sup.14C of at least about 1.01, an
f.sub.M .sup.14C of about 1 to about 1.5, an f.sub.M .sup.14C of
about 1.04 to about 1.18, or an f.sub.M .sup.14C of about 1.111 to
about 1.124.
[0364] Another measurement of .sup.14C is known as the percent of
modern carbon, pMC. For an archaeologist or geologist using
.sup.14C dates, AD 1950 equals "zero years old". This also
represents 100 pMC. "Bomb carbon" in the atmosphere reached almost
twice the normal level in 1963 at the peak of thermo-nuclear
weapons. Its distribution within the atmosphere has been
approximated since its appearance, showing values that are greater
than 100 pMC for plants and animals living since AD 1950. It has
gradually decreased over time with today's value being near 107.5
pMC. This means that a fresh biomass material, such as corn, would
give a .sup.14C signature near 107.5 pMC. Petroleum based compounds
will have a pMC value of zero. Combining fossil carbon with present
day carbon will result in a dilution of the present day pMC
content. By presuming 107.5 pMC represents the .sup.14C content of
present day biomass materials and 0 pMC represents the .sup.14C
content of petroleum based products, the measured pMC value for
that material will reflect the proportions of the two component
types. For example, a material derived 100% from present day
soybeans would give a radiocarbon signature near 107.5 pMC. If that
material was diluted 50% with petroleum based products, it would
give a radiocarbon signature of approximately 54 pMC.
[0365] A biologically based carbon content is derived by assigning
"100%" equal to 107.5 pMC and "0%" equal to 0 pMC. For example, a
sample measuring 99 pMC will give an equivalent biologically based
carbon content of 93%. This value is referred to as the mean
biologically based carbon result and assumes all the components
within the analyzed material originated either from present day
biological material or petroleum based material.
[0366] A bioproduct described herein can have a pMC of at least
about 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100. In
other instances, a bioproduct described herein can have a pMC of
between about 50 and about 100; about 60 and about 100; about 70
and about 100; about 80 and about 100; about 85 and about 100;
about 87 and about 98; or about 90 and about 95. In yet other
instances, a bioproduct described herein can have a pMC of about
90, 91, 92, 93, 94, or 94.2.
[0367] Fuel additives are used to enhance the performance of a fuel
or engine. For example, fuel additives can be used to alter the
freezing/gelling point, cloud point, lubricity, viscosity,
oxidative stability, ignition quality, octane level, and/or flash
point. In the United States, all fuel additives must be registered
with Environmental Protection Agency. The names of fuel additives
and the companies that sell the fuel additives are publicly
available by contacting the EPA or by viewing the agency's website.
One of ordinary skill in the art will appreciate that the fatty
alcohol-based biofuels described herein can be mixed with one or
more fuel additives to impart a desired quality.
[0368] The fatty alcohol-based surfactants and/or detergents
described herein can be mixed with other surfactants and/or
detergents well known in the art.
[0369] In some examples, the mixture can include at least about
10%, 15%, 20%, 30%, 40%, 50%, or 60% by weight of the fatty
alcohol. In other examples, a surfactant or detergent composition
can be made that includes at least about 5%, 10%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 85%, 90% or 95% of a fatty alcohol that
includes a carbon chain that is 8, 10, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21 or 22 carbons in length. Such surfactant or detergent
compositions can additionally include at least one additive
selected from a surfactant; a microemulsion; at least about 5%,
10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% of
surfactant or detergent from nonmicrobial sources such as plant
oils or petroleum.
[0370] The invention is further illustrated by the following
examples. The examples are provided for illustrative purposes only.
They are not to be construed as limiting the scope or content of
the invention in any way.
EXAMPLES
Example 1
Identification of Carboxylic Acid Reductase (CAR) Homologs
[0371] The carboxylic acid reductase (CAR) from Nocardia sp. strain
NRRL 5646 can reduce carboxylic acids (e.g., fatty acids) into
their corresponding aldehydes without utilizing separate activating
enzymes, such as acyl-CoA synthases (Li et al., J. Bacteriol.
179:3482-3487, 1997; He et al., Appl. Environ. Microbiol.
70:1874-1881, 2004)).
[0372] A BLAST search using the NRRL 5646 CAR amino acid sequence
(Genpept accession AAR91681) (SEQ ID NO:16) as the query sequence
identified approximately 20 homologous sequences. Three homologs,
listed in Table 7, were evaluated for their ability to convert
fatty acids into fatty aldehydes in vivo when expressed in E.
coli.
[0373] At the nucleotide sequence level, carA (SEQ ID NO:19), carB
(SEQ ID NO:21), and fadD9 (SEQ ID NO:17) demonstrated 62.6%, 49.4%,
and 60.5% homology, respectively, to the car gene (AY495697) of
Nocardia sp. NRRL 5646 (SEQ ID NO:15). At the amino acid level,
CARA (SEQ ID NO:20), CARB (SEQ ID NO:22), and FadD9 (SEQ ID NO:18)
demonstrated 62.4%, 59.1% and 60.7% identity, respectively, to CAR
of Nocardia sp. NRRL 5646 (SEQ ID NO:16).
TABLE-US-00007 TABLE 7 CAR-like Protein and the corresponding
coding sequences. Genpept accession Locus_tag Annotation in GenBank
Gene name NP_217106 Rv 2590 Probable fatty-acid-CoA fadD9 ligase
(FadD9) ABK75684 MSMEG 2956 NAD dependent carA
epimerase/dehydratase family protein YP_889972.1 MSMEG 5739 NAD
dependent carB epimerase/dehydratase family protein
Example 2
Identification of Alcohol Dehydrogenase Genes
Reverse Engineering
[0374] E. coli contains at least one enzyme that catalyzes the
reversible oxidoreduction of fatty aldehydes and fatty alcohols
(i.e. fatty aldehyde reductase/alcohol dehydrogenase). Reverse
engineering was used to identify such fatty aldehyde
reducatases/fatty alcohol dehydrogenses in E. coli MG1655 cells
expressing the acyl-ACP reductase YP_400611 from Synechococcus
elongatus (Synpcc7942_1594) (SEQ ID NO:196). Four 3 mL LB cultures
were grown overnight at 37.degree. C., and 55 .mu.L of stationary
phase cultures were used to inoculate four independent 5.5 mL of
LB. Those 5.5 mL cultures were then grown to an OD.sub.600 of
0.8-1.0 and were then used to inoculate a corresponding number of 2
L baffled shakeflasks, each with 500 mL Hu-9 minimal media. 20 hrs
after induction the cells were pelleted at 4,000.times.g for 20
min. The cell pellet was resuspended in 30 mL of 100 mM phosphate
buffer at pH 7.2 with 1.times. Bacterial Protease Arrest (G
Biosciences). The cells were lysed in a french press at 15,000 psi
with two passes through the instrument. The cell debris was then
removed by centrifuging at 10,000.times.g for 20 mins. The cell
lysate was loaded onto two HiTrapQ columns (GE Healthcare)
connected in series. The following buffers were used to elute
proteins: (A) 50 mM Tris, pH 7.5 and (B) 50 mM Tris, pH 7.5 with 1
M NaCl. A gradient from 0% B to 100% B was run over 5 column
volumes at a flow rate of 3 mL/min while 4 mL fractions were
collected.
[0375] The fractions were assayed for alcohol dehydrogenase
activity by taking 190 .mu.L of a protein fraction and adding 5
.mu.L of a 20 mM NADPH (Sigma) solution and 5 .mu.L of a 20 mM
dodecanal (Fluka) solution in DMSO. The reactions were incubated at
37.degree. C. for 1 hr. They were then extracted with 100 .mu.L of
ethyl acetate and analyzed for dodecanol via GC/MS. Fractions
eluting around 350 mM NaCl contained alcohol dehydrogenase
activity.
[0376] Fractions containing alcohol dehydrogenase activity were
pooled and loaded onto a 1 mL ResourceQ column (GE Healthcare). The
same conditions used for the HiTrapQ column were used, except 0.5
mL fractions were collected. Protein fractions demonstrating
alcohol dehydrogenase activity were then pooled and concentrated
using Amicon (Milipore) protein concentrators (10,000 kDa cutoffs)
to a volume of 1 mL. The solution was then loaded onto a HiPrep 200
size exclusion column (GE Healthcare). A buffer solution containing
50 mM Tris, pH 7.5, and 150 mM NaCl was run through the column at a
rate of 0.3 mL per min. 2 mL fractions were collected. Two protein
fractions contained alcohol dehydrogenase activity. These two
fractions, plus fractions before and after these two fractions,
were loaded onto a polyacrylamide gel and stained with SimplySafe
Commassie stain (Invitrogen).
[0377] Comparing the bands in the active and inactive fractions,
one protein band appeared in the active fractions that was not seen
in the inactive fraction. This protein band was cut from gel and
submitted to the Stanford Mass Spectroscopy Facility for LC/MS/MS
protein sequencing. One of the proteins identified in this analysis
was YahK.
[0378] To verify that YahK was indeed an alcohol dehydrogenase,
yahK was knocked out in E. coli MG1655(DE3, .DELTA.fadD,
.DELTA.yjgB) (control strain) (described in Example 4). The yahK
knock-out strain MG1655(DE3, .DELTA.fadD, .DELTA.yjg,B .DELTA.yahK)
was constructed using the lamda red system (described in Example 4)
with the following primers:
TABLE-US-00008 yahK_F (SEQ ID NO: 197)
(CATATCAGGCGTTGCCAAATACACATAGCTAATCAGGAGTAAAC ACAATG) and yahK_R
(SEQ ID NO: 198) (AATCGCACACTAACAGACTGAAAAAATTAATAAATACCCTGTGG
TTTAAC).
This .DELTA.yahK strain and the control strain, both expressing the
acyl-ACP reductase YP_400611, were cultured under conditions
described above. Cell free lysates were made from both strains, and
each lysate was assayed for alcohol dehydrogenase activity as
discussed above.
[0379] The .DELTA.yahK strain did not convert dodecanal to
dodecanol, while the wild type strain had this activity. For
additional verification, each lysate was run on a HiTrapQ column as
described above. The wild type lysate had alcohol dehydrogenase
activity in fractions eluting around 350 mM NaCl, while the
.DELTA.yahK lysate had no alcohol dehydrogenase activity in this
region.
Bioinformatics
[0380] It was reasoned that possible alcohol dehydrogenases in E.
coli were members of four protein families: Zn-dependent alcohol
dehydrogenases (Pfam 00107 and 08240), Fe-dependent alcohol
dehydrogenases (Pfam 00465), aldo-keto reductases (Pfam 00248) and
short-chain dehydrogenases (Pfam 00106) (Pfam=protein family
according to "pfam.sanger.ac.uk"). Using the Pfam motifs, all
members of these four protein families in E. coli were identified
(listed in FIG. 10). From this list, the following 8 candidates
were chosen for experimental analysis: yahK, yjgB, adhP, dkgA,
dkgB, yhdH, ydjL, and yqhD.
[0381] To determine if these genes could reduce fatty aldehydes to
fatty alcohols, these 8 genes were cloned into a pET-Duet vector
along with E. coli `tesA. These genes were then transformed into E.
coli (DE3) MG1655 .DELTA.yjgB.DELTA.yahK cells. Next 3 mL overnight
starter cultures were grown in LB with carbenicillin (100 mg/L) at
37.degree. C. A control strain lacking a candidate alcohol
dehydrogenase was also included in the experiment. 1 mL of each
overnight culture was used to inoculate 50 mL of fresh LB with
carbenicillin. The cultures were shaken at 37.degree. C. until
reaching an OD.sub.600 of 0.8-1. The cultures were then transferred
to 18.degree. C., induced with 1 mM IPTG, and shaken overnight.
[0382] Cell free lysates were prepared by centrifuging the cultures
at 4,000.times.g for 20 mins. The cultures were then resuspended in
1 mL of Bugbuster (Novagen) and gently shaken at room temperature
for 5 min. The cell debris was removed by spinning at
15,000.times.g for 10 min. The resulting lysates were assayed for
alcohol dehydrogenase activity by mixing 88 .mu.L of lysate, 2
.mu.L of 40 mM cis-11-hexadecenal in DMSO, and 10 .mu.L of 20 mM
NADPH. The samples were incubated at 37.degree. C. for 30 min. and
were then extracted with 100 .mu.L of ethyl acetate. The extracts
were analyzed using GC/MS.
[0383] All proteins showed significantly better conversion of
cis-11-hexadecenal to cis-11-hexadecanol as compared with the `TesA
only control (see Table 8). These results were confirmed in assays
using dodecanal instead of cis-11-hexadecenal as the substrate (see
Table 8).
[0384] To investigate how these enzymes contribute to fatty alcohol
dehydrogenase activity in E. coli under production conditions,
first the yjgB yahK double knock-out strain in MG1655(DE3,
.DELTA.fadD) (described above) was tested by transforming it with a
plasmid expressing acyl-ACP reductase YP_400611 and analyzing fatty
aldehyde and fatty alcohol titers. The test strain also contained a
plasmid expressing a decarbonylase. This double knock-out mutant
showed slightly higher fatty aldehyde titers in several experiments
(see, e.g., FIG. 11), confirming that these two putative alcohol
dehydrogenases contribute to fatty alcohol dehydrogenase activity
in E. coli under production conditions (see also Example 4 for
similar results from a MG1655(DE3, .DELTA.fadD .DELTA.yjgB)
strain). Next, two additional genes, yncB and ydjA, were deleted in
the yjgB yahK double mutant. YdjA, which is not a member of the
four protein families mentioned above, demonstrated slightly
elevated fatty aldehyde levels (see FIG. 11), indicating that it
may also contribute to fatty alcohol dehydrogenase activity in E.
coli under production conditions.
[0385] Additionally, the active fatty alcohol dehydrogenases from
Table 8 were also deleted in MG1655 (DE3, .DELTA.fadD, .DELTA.yjg,B
.DELTA.yahK) and tested as described above. Several of these
deletion strains showed slightly elevated fatty aldehyde levels,
suggesting that these may also contribute to fatty alcohol
dehydrogenase activity in E. coli under production conditions (see
FIG. 12).
TABLE-US-00009 TABLE 8 Overexpression of putative fatty alcohol
dehydrogenase genes GC/MS Assay % conversion to NADPH assay
corresponding alcohol initial rate (slope) substrate dodecanal cis
11-hexadecenal cis 11-hexadecenal Overexpression: none 9 12 0.2
YjgB 54 89 24.8 YahK 47 87 28.3 AdhP 52 45 4.1 YdjL 51 23 0.14 YhdH
59 74 13.7 YqhD 55 23 7.3 yafB (dkgB) 52 65 9.4 YqhE (dkgA) 45 50
9.5
Example 3
Expression of CAR Homologs and Alcohol Dehydrogenase in E. coli
A. CAR Plasmid Construction
[0386] Three E. coli expression plasmids were constructed to
express the genes encoding the CAR homologs listed in Table 7.
First, fadD9 was amplified from genomic DNA of Mycobacterium
tuberculosis H37Rv (obtained from The University of British
Columbia, and Vancouver, BC Canada) using the primers fadD9F and
FadDR (see Table 9). The PCR product was first cloned into
PCR-blunt (Invitrogen) and then released as an NdeI-AvrII fragment.
The NdeI-AvrII fragment was then cloned between the NdeI and AvrII
sites of pACYCDuet-1 (Novogen) to generate pACYCDuet-1-fadD9.
[0387] The carA gene was amplified from the genomic DNA of
Mycobacterium smegmatis MC2155 (obtained from the ATCC (ATCC
23037D-5)) using primers CARMCaF and CARMCaR (see Table 9). The
carB gene was amplified from the genomic DNA of Mycobacterium
smegmatis MC2155 (obtained from the ATCC (ATCC 23037D-5)) using
primers CARMCbF and CARMCbR (see Table 9). Each PCR product was
first cloned into PCR-blunt and then released as an NdeI-AvrII
fragment. Each of the two fragments was then subcloned between the
NdeI and AvrII sites of pACYCDuet-1 (Novogen) to generate
pACYCDuet-1-carA and pACYCDuet-1-carB.
TABLE-US-00010 TABLE 9 Primers used to amplify genes encoding CAR
homologs fadD9F cat ATGTCGATCAACGATCAGCGACTGAC (SEQ ID NO: 1)
fadD9R cctagg TCACAGCAGCCCGAGCAGTC (SEQ ID NO: 2) CARMCaF cat
ATGACGATCGAAACGCG (SEQ ID NO: 3) CARMCaR cctagg
TTACAGCAATCCGAGCATCT (SEQ ID NO: 4) CARMCbF cat ATGACCAGCGATGTTCAC
(SEQ ID NO: 5) CARMCbR cctagg TCAGATCAGACCGAACTCACG (SEQ ID NO:
6)
B. Alcohol Dehydrogenase Plasmid Construction
[0388] The plasmid pETDuet-1-`tesA-yjgB carries `tesA and yjgB (a
putative alcohol dehydrogenase; GenBank accession number,
NP_418690; GenPept accession number AAC77226) from the E. coli K12
strain.
[0389] The gene yjgB (GenBank accession number, NP_418690) was
amplified from the genomic DNA of E. coli K-12 using the following
primers.
[0390] The yjgB insert was generated by PCR using the following
primers:
TABLE-US-00011 NcoI YjgB forward: (SEQ ID NO: 199)
aatccTGGCATCGATGATAAAAAGCTATGCCGCAAAAG HindIII YjgB reverse: (SEQ
ID NO: 200) ataaaagctTTCAAAAATCGGCTTTCAACACCACGCGG
The PCR product was then subcloned into the NcoI and HindIII sites
of pETDuet-1-`tesA to generate pETDuet-1-`tesA-yjgB.
[0391] The plasmid pETDuet-1-`tesA-alrAadp1 carries `tesA and
alrAadp1 (GenPept accession number CAG70248.1) from Acinetobacter
baylyi ADP1.
[0392] The gene alrAadp1 was amplified from the genomic DNA of
Acinetobacter baylyi ADP1 by a two-step PCR procedure. The first
set of PCR reactions eliminated an internal NcoI site at bp 632-636
with the following primer pairs:
TABLE-US-00012 ADP1 Alr mut1 reverse: (SEQ ID NO: 201)
5'-GACCACGTGATCGGCCCCCATAGCTTTGAGCTCATC ADP1 Alr1 mut1 forward:
(SEQ ID NO: 202) 5'-GATGAGCTCAAAGCTATGGGGGCCGATCACGTGGTC
The PCR products were then isolated, purified using the Qiagen gel
extraction kit, and used as inputs for a second PCR reaction with
the following primers to produce full-length AlrAadp1 with a
C.fwdarw.T mutation at position 633:
TABLE-US-00013 NcoI ADP1 Alr1 forward: (SEQ ID NO: 203)
5'-AATACCATGGCAACAACTAATGTGATTCATGCTTATGCTGCA HindIII ADP1 Alr1
reverse: (SEQ ID NO: 204)
5'-ATAAAAGCTTTTAAAAATCGGCTTTAAGTACAATCCGATAAC
The plasmid pETDuet-1-`tesA-alrAadp1 was prepared by inserting the
alrAadp1 gene (gene locus-tag="ACIAD3612"), a homolog of
Acinetobacter baylyi ADP1, into the NcoI and HindIII sites of
pETDuet-1-`tesA.
B. Evaluation of Fatty Aldehyde and Fatty Alcohol Production
[0393] In order to evaluate the affect of carboxylic acid
reductases and alcohol dehydrogenases on the production of fatty
alcohols, various combinations of the prepared plasmids were
transformed in the E. coli strain C41 (DE3, .DELTA.fadE) (described
in PCT/US08/058788).
[0394] For example, the plasmid pACYCDuet-1-carA, encoding the CAR
homolog carA, was co-transformed with pETDuet-1-`tesA-alrAadp1
(see, e.g., FIG. 1).
[0395] The plasmid pACYCDuet-1-carB, encoding the CAR homolog carB,
was co-transformed with pETDuet-1-`tesA. In addition,
pACYCDuet-1-carB was also separately co-transformed with
pETDuet-1-`tesA-yjgB and pETDuet-1-`tesA-alrAadp1. As a control,
pACYCDuet-1-carB was co-transformed with the empty vector pETDuet-1
(see, e.g., FIG. 1).
[0396] The plasmid pACYCDuet-1-fadD9, encoding the CAR homolog
fadD9, was co-transformed with pETDuet-1-`tesA. In addition,
pACYCDuet-1-fadD9 was also separately co-transformed with
pETDuet-1-`tesA-yjgB and pETDuet-1-`tesA-alrAadp1. As a control,
pACYCDuet-1-fadD9 was co-transformed with the empty vector
pETDuet-1 (see, e.g., FIG. 1).
[0397] As an additional control, pETDuet-1-`tesA-yjgB was
co-transformed with the empty vector pACYCDuet-1.
[0398] The E. coli transformants were grown in 3 mL of LB medium
supplemented with carbenicillin (100 mg/L) and chloramphenicol (34
mg/L) at 37.degree. C. After overnight growth, 15 .mu.L of culture
was transferred into 2 mL of fresh LB medium supplemented with
carbenicillin and chloramphenicol. After 3.5 hours of growth, 2 mL
of culture were transferred into a 125 mL flask containing 20 mL of
M9 medium with 2% glucose and with carbenicillin and
chloramphenicol. When the OD.sub.600 of the culture reached 0.9, 1
mM of IPTG was added to each flask. After 20 hours of growth at
37.degree. C., 20 mL of ethyl acetate (with 1% of acetic acid, v/v)
was added to each flask to extract the fatty alcohols produced
during the fermentation. The crude ethyl acetate extract was
directly analyzed with GC/MS as described herein.
[0399] The measured retention times were 6.79 minutes for
cis-5-dodecen-1-ol, 6.868 minutes for 1-dodecanol, 8.058 minutes
for cis-7-tetradecen-1-ol, 8.19 minutes for 1-tetradecanol, 9.208
minutes for cis-9-hexadecen-1-ol, 9.30 minutes for 1-hexadecanol,
and 10.209 minutes for cis-11-octadecen-1-ol.
[0400] The co-expression of the leaderless tesA and any of the
three car genes in E. coli resulted in high titers of fatty
alcohols and detectable fatty aldehyde production (FIGS. 1, 2, 5).
The expression of carA or carB with the leaderless tesA and
alrAadp1 resulted in fatty alcohol titers of greater than 700 mg/L
and reduced fatty aldehyde production. Likewise, fadD9 co-expressed
with the leaderless tesA and alrAadp1 produced over 300 mg/L of
fatty alcohol. When expressed without the leaderless tesA, neither
carB nor fadD9 produced more than 10 mg/L of fatty alcohols
(possibly resulting from the accumulation of free fatty acids in
the cell due to endogenous tesA). Taken together, this data
indicates that fatty acids are the substrates for these CAR
homologs and that overexpression of a thioesterase, such as `tesA
(to release fatty acids from acyl-ACP), achieves significant
production of fatty alcohols.
[0401] In one fermentation, E. coli strain C41 (DE3, .DELTA.fadE)
co-transformed with pACYCDuet-1-carB+ pETDuet-1-tesA produced an
average of 695 mg/L of fatty alcohols and 120 mg/L of fatty
aldehydes. The presence of large amounts of fatty aldehydes is
consistent with CAR being an aldehyde-generating, fatty acid
reductase (AFAR). This mechanism is different from
alcohol-generating fatty acyl-CoA reductases (FAR), represented by
JjFAR, and fatty acyl-CoA reductases, represented by Acr1.
[0402] The production of fatty alcohols from fatty aldehydes in the
E. coli strains described above may have been catalyzed by an
endogenous alcohol dehydrogenase(s). E. coli produces an alcohol
dehydrogenase(s) (e.g., yjgB) capable of converting fatty aldehydes
of various chain-length into fatty alcohols (Naccarato et al.,
Lipids 9: 419-428 (1974); Reiser et al., J. Bacteriol. 179:
2969-2975 (1997); Venkitasubramanian et al., J. Biol. Chem.
282:478-485 (2007)).
[0403] Therefore, alcohols dehydrogenases may also play a role in
the fatty alcohol biosynthetic pathway in addition to carboxylic
acid reductases. For example, expression of either yjgB or alrAadp1
with carB and the leaderless tesA significantly reduced the
accumulation of fatty aldehydes, compared to strains that did not
overexpress yjgB or alrAadp1 (FIG. 2).
[0404] Following the fermentations where pACYCDuet-1-carB was
transformed in E. coli strain C41 (DE3, .DELTA.fadE), a white,
round, disk-like deposit was observed at the bottom center of the
flasks used for fatty alcohol production with recombinant E. coli
strains. In contrast, no such deposits were observed at the bottom
of the control flasks that did not express car homologs. GC/MS
analysis of the deposit dissolved in ethyl acetate (with 1% of
acetic acid, v/v) revealed that the deposit was a fatty alcohol
deposit.
C. Types of Fatty Alcohols Produced by Different CAR Homologs
[0405] Depending upon the CAR homolog expressed in E. coli strain
C41 (DE3, .DELTA.fadE), different mixtures of fatty alcohols were
produced. Different compositions of fatty alcohols were observed
among the three CAR homologs evaluated (see Table 10). FadD9
produced more C.sub.12 fatty alcohols relative to other fatty
alcohols with carbon chain lengths greater than 12. Both CarA and
CarB produced a wider range in chain length of fatty alcohols than
was observed when expressing FadD9.
TABLE-US-00014 TABLE 10 Acyl-composition of fatty alcohols produced
by recombinant E. coli strains Expressed with TesA*
Acyl-composition of fatty alcohols (%) and AlrAadp1 C10:0 C12 C14:1
C14:0 C16:1 C16:0 C18:1 CarA trace 38 13 27 16 4 3 FadD9 trace 63
14 16 7 trace trace CarB trace 32 11 41 12 trace trace *the
leaderless TesA. C12, including C12:0 and C12:1 fatty alcohol.
D. Quantification and Identification of Fatty Alcohols
[0406] GC-MS was performed using an Agilent 5975B MSD system
equipped with a 30 m.times.0.25 mm (0.10 .mu.m film) DB-5 column.
The column temperature was 3 min isothermal at 100.degree. C. The
column was programmed to rise from 100.degree. C. to 320.degree. C.
at a rate of 20.degree. C./min. When the final temperature was
reached, the column remained isothermal for 5 minutes at
320.degree. C. The injection volume was 1 .mu.L. The carrier gas,
helium, was released at 1.3 mL/min. The mass spectrometer was
equipped with an electron impact ionization source. The ionization
source temperature was set at 300.degree. C.
[0407] Prior to quantification, various alcohols were identified
using two methods. First, the GC retention time of each compound
was compared to the retention time of a known standards, such as
cetyl alcohol, dodecanol, tetradecanol, octadecanol, and
cis-9-octadecenol. Second, identification of each compound was
confirmed by matching the compound's mass spectrum to a standard's
mass spectrum in the mass spectra library (e.g., C12:0, C12:1,
C13:0, C14:0, C14:1, C15:0. C16:0, C16:1, C17:0, C18:0 and C18:1
alcohols).
Example 4
Production of Fatty Alcohol by Heterologous Expression of CAR
Homologs in E. coli MG1655 (DE3, .DELTA.fadD)
[0408] Construction of fadD Deletion Strain
[0409] The fadD gene of E. coli MG1655 was deleted using the lambda
red system (Datsenko et al., 2000, Proc. Natl. Acad. Sci. USA. 97:
6640-6645) as follows: The chloramphenicol acetyltransferase gene
from pKD3 was amplified with the primers
TABLE-US-00015 fad1 (SEQ ID NO: 205)
(5'-TAACCGGCGTCTGACGACTGACTTAACGCTCAGGCTTTATTGTCCA
CTTTGTGTAGGCTGGAGCTGCTTCG-3'), and fad2 (SEQ ID NO: 206)
(5'-CATTTGGGGTTGCGATGACGACGAACACGCATTTTAGAGGTGAAGA
ATTGCATATGAATATCCTCCTTTAGTTCC-3').
This PCR product was electroporated into E. coli MG1655 (pKD46).
The cells were plated on L-chloramphenicol (30 .mu.g/mL)(L-Cm) and
grown overnight at 37.degree. C. Individual colonies were picked on
to another L-Cm plate and grown at 42.degree. C. These colonies
were then patched to L-Cm and L-carbenicillin (100 mg/mL) (L-Cb)
plates and grown at 37.degree. C. overnight. Colonies that were
Cm.sup.R and Cb.sup.S were evaluated further by PCR to ensure the
PCR product inserted at the correct site. PCR verification was
performed on colony lysates of these bacteria using the primers
fadF (5'-CGTCCGTGGTAATCATTTGG-3') (SEQ ID NO:207) and fadR
(5'-TCGCAACCTITTCGTTGG-3') (SEQ ID NO:208). Expected size of the
.DELTA.fadD::Cm deletion was about 1200 bp (FIG. 4). The
chloramphenicol resistance gene was eliminated using a FLP helper
plasmid as described in Datsenko et al., Proc. Natd. Acad. Sci. USA
97:6640-6645 (2000). PCR verification of the deletion was performed
with primers fadF and fadR (FIG. 4). The MG1655 .DELTA.fadD strain
was unable to grow on M9+oleate agar plates (oleate as carbon
source). It was also unable to grow in M9+oleate liquid media. The
growth defect was complemented by an E. coli fadD gene supplied in
trans (in pCL1920-Ptrc). Construction of MG1655(DE3, .DELTA.fadD)
Strain
[0410] To generate a T7-responsive strain, the .lamda.DE3
Lysogenization Kit (Novagen) was utilized, which is designed for
site-specific integration of .lamda.DE3 prophage into an E. coli
host chromosome, such that the lysogenized host can be used to
express target genes cloned in T7 expression vectors. .lamda.DE3 is
a recombinant phage carrying the cloned gene for T7 RNA polymerase
under lacUV5 control. Briefly, the host strain was cultured in LB
supplemented with 0.2% maltose, 10 mM MgSO.sub.4, and antibiotics
at 37.degree. C. to an OD.sub.600 of 0.5. Next, 10.sup.8 pfu
.lamda.DE3, 10.sup.8 pfu Helper Phage, and 10.sup.8 pfu Selection
Phage were incubated with 10 .mu.L host cells. The host/phage
mixture was incubated at 37.degree. C. for 20 min to allow phage to
adsorb to host. Finally, the mixture was pipeted onto an LB plate
supplemented with antibiotics. The mixture was spread evenly using
plating beads, and the plates were inverted plates and incubated at
37.degree. C. overnight.
[0411] .lamda.DE3 lysogen candidates were evaluated by their
ability to support the growth of the T7 Tester Phage. T7 Tester
Phage is a T7 phage deletion mutant that is completely defective
unless active T7 RNA polymerase is provided by the host cell. The
T7 Tester Phage makes very large plaques on authentic .lamda.DE3
lysogens in the presence of IPTG, while much smaller plaques are
observed in the absence of inducer. The relative size of the
plaques in the absence of IPTG is an indication of the basal level
expression of T7 RNA polymerase in the lysogen, and can vary widely
between different host cell backgrounds.
[0412] The following procedure was used to determine the presence
of DE3 lysogeny. First, candidate colonies were grown in LB
supplemented with 0.2% maltose, 10 mM MgSO.sub.4, and antibiotics
at 37.degree. C. to an OD.sub.600 of 0.5. An aliquot of T7 Tester
Phage was then diluted in 1.times. Phage Dilution Buffer to a titer
of 2.times.10.sup.3 pfu/mL. In duplicate tubes, 100 .mu.L host
cells were mixed with 100 .mu.L diluted phage. The host/phage
mixture was incubated at room temperature for 10 min to allow phage
to adsorb to host. Next, 3 mL of molten top agarose was added to
each tube containing host and phage. The contents of one duplicate
were plated onto an LB plate and the other duplicate onto an LB
plate supplemented with 0.4 mM IPTG
(isopropyl-b-thiogalactopyranoside) to evaluate induction of T7 RNA
polymerase. Plates were allowed to sit undisturbed for 5 min until
the top agarose hardened. The plates were then inverted at
30.degree. C. overnight.
Construction of MG1655(DE3, .DELTA.fadD, yjgB::Kan) Strain
[0413] The yjgB knockout strain, MG1655(DE3, .DELTA.fadD,
yjgB::kan), was constructed by using the following lambda red
system (Datsenko et al., Proc. Nal. Acad. Sci. USA 97:6640-6645
(2000)):
[0414] The kanamycin resistant gene from pKD13 was amplified with
the primers yjgBRn
(5'-GCGCCTCAGATCAGCGCTGCGAATGATTTTCAAAAATCGGCTTCAA
CACTGTAGGCTGGAGCTGCTTCG-3') (SEQ ID NO:209), and yjgBFn
(5'-CTGCCATGCTCTACACTTCCCAAACAACACCAGAGAAGGACCAAAAA
ATGATTCCGGGGATCCGTCGACC-3') (SEQ ID NO:210). The PCR product was
then electroporated into E. coli MG1655(DE3, .DELTA.fadD)/pKD46.
The cells were plated on kanamycin (50 pg/mL) (L-Kan) and grown
overnight at 37.degree. C. Individual colonies were picked on to
another L-Kan plate and grown at 42.degree. C. These colonies were
then patched to L-Kan and carbenicillin (100 mg/mL) (L-Cb) plates
and grown at 37.degree. C. overnight. Colonies that were kan.sup.R
and Cb.sup.S were evaluated further by PCR to ensure the PCR
product was inserted at the correct site. PCR verification was
performed on colony lysates of these bacteria using the primers BF
(5'-gtgctggcgataCGACAAAACA-3') (SEQ ID NO:211) and BR
(5'-CCCCGCCCTGCCATGCTCTACAC-3') (SEQ ID NO:212). The expected size
of the yjgB::kan knockout was about 1450 bp. Evaluation of FadD on
Fatty Alcohol Production Using MG1655(DE3, .DELTA.fadD) Strain
[0415] In Example 3, a fadE deletion strain was used for fatty
aldehyde and fatty alcohol production from `TesA, CAR homologs, and
endogenous alcohol dehydrogenase(s) in E. coli. To demonstrate that
CAR homologs used fatty acids instead of acyl-CoA as a substrate,
the gene encoding for acyl-CoA synthase in E. coli (fadD) was
deleted so that the fatty acids produced were not activated with
CoA. E. coli strain MG1655(DE3, .DELTA.fadD) was transformed with
pETDuet-1-`tesA and pACYCDuet-1-carB. The transformants were
evaluated for fatty alcohol production using the methods described
herein. These transformants produced about 360 mg/L of fatty
alcohols (dodecanol, dodecenol, tetredecanol, tetredecenol, cetyl,
hexadecenol, and octadecenol).
YjgB is an Alcohol Dehydrogenase
[0416] To confirm that YjgB was an alcohol dehydrogenase
responsible for converting fatty aldehydes into their corresponding
fatty alcohols, pETDuet-1-`tesA and pACYCDuet-1-fadD9 were
co-transformed into either MG1655(DE3, .DELTA.fadD) or MG1655(DE3,
.DELTA.fadD, yjgB::kan). At the same time, MG1655(DE3, .DELTA.fadD,
yjgB::kan) was transformed with both pETDuet-1-`tesA-yjgB and
pACYCDuet-1-fadD9.
[0417] The E. coli transformants were grown in 3 mL of LB medium
supplemented with carbenicillin (100 mg/L) and chloramphenicol (34
mg/L) at 37.degree. C. After overnight growth, 15 .mu.L of culture
was transferred into 2 mL of fresh LB medium supplemented with
carbenicillin and chloramphenicol. After 3.5 hrs of growth, 2 mL of
culture was transferred into a 125 mL flask containing 20 mL of M9
medium with 2% glucose, carbenicillin, and chloramphenicol. When
the OD.sub.600 of the culture reached 0.9, 1 mM of IPTG was added
to each flask. After 20 hrs of growth at 37.degree. C., 20 mL of
ethyl acetate (with 1% of acetic acid, v/v) was added to each flask
to extract the fatty alcohols produced during the fermentation. The
crude ethyl acetate extract was directly analyzed with GC/MS as
described herein.
[0418] The yjgB knockout strain resulted in significant
accumulation of dodecanal and a lower fatty alcohol titer (FIG. 5).
The expression of yjgB from plasmid pETDuet-1-`tesA-yjgB in the
yjgB knockout strain effectively removed the accumulation of
dodecanal (FIG. 5). The data shows that YjgB was involved in
converting dodecanal into dodecanol and that there may be other
alcohol dehydrogenase(s) present in E. coli to convert other
aldehydes into alcohols. Dodecanal accumulated in the yjgB knockout
strain, but it was not observed in either the wild-type strain
(MG1655(DE3, .DELTA.fadD)) or the yjgB knockout strain with the
yjgB expression plasmid. The arrows (in FIG. 5) indicate the GC
trace of dodecanal (C12:0 aldehyde).
Example 5
Production of Saturated Fatty Alcohols in E. coli
[0419] Fatty alcohols for commercial uses are saturated. However,
E. coli typically has a certain amount (about 20-25%) of
unsaturated fatty acids in its membrane to maintain fluidity. An E.
coli strain was engineered that was able to produce exclusively
saturated fatty acids in a medium not supplemented with unsaturated
fatty acid or cyclopropane-fatty acid and was able to produce
saturated fatty alcohols.
[0420] Two enzymes, a dehydratase/isomerase and a ketoacylsynthase
I (KASI), encoded by fabA and fabB, respectively, are involved in
unsaturated fatty acid biosynthesis. Usually, an E. coli strain
lacking either FabA or FabB does not survive without
supplementation of unsaturated fatty acids, such as oleate. To
overcome this, the fabB gene was knocked out of an E. coli host
strain, and the strain was able to grow without unsaturated fatty
acid supplementation by genetically engineering the cells to
express a recombinant desaturase gene (AF037430, encoding DesA)
from Bacillus subtilis. Although the first generation of the strain
expressing desA required oleate for normal growth, subsequent
plating of the strain on L Agar plates several times resulted in a
strain that did not require oleate for growth.
Materials
[0421] E. coli JWC280 cells (described in Campbell et al., Mol.
Microbiol. 47:793-805 (2003)) and E. coli GRT23 cells (described in
Morgan-Kiss et al., Arch. Microbiol. 190:427-437 (2008)) were
obtained from John Cronan.
Plasmid Construction
[0422] The desA gene (also referred to as .DELTA.5 des) was
amplified with primers delta5Fn and delta5Rn (listed in Table 11)
from the genomic DNA of Bacillus subtilis str. 168 and digested
with AvrII and EcoRI. The desA gene was then cloned into pET-21(a),
which had been linearized with AvrII-EcoRI, to produce
pET-21a-.DELTA.5. The desA gene was then removed as an NdeI-EcoRI
fragment from pET-21a-.DELTA.5 and inserted between the NdeI and
EcoRI sites of OP180, a pACYC derived plasmid carrying a trc
promoter. The resultant plasmid was named pACYC-.DELTA.5.
[0423] A desA_kan gene cassette was cloned between the AvrII-BamHI
sites of CDFDuet-1. A kan gene cassette was produced by EcoRI and
BamHI digestion of a PCR product that was amplified with primers
kanF and kanR (see Table 11) from pKD13 as the template (pKD13 was
obtained from The Coli Genetic Stock Center, Yale University, and
is described in Datsenko et al., Proc. Natl. Acad. Sci. USA
97:6640-6645 (2000)). The amplified desA gene (described above) was
digested with AvrII and EcoRI. The AvrII-EcoRI fragment of the desA
gene and the EcoRI-BamHI fragment of the kan gene were then
inserted between the AvrII-BamHI sites of pCDFDuet-1 (from EMD
Chemicals, Gibbstown, N.J.) to produce a plasmid that was named
pCDFDuet-1-.DELTA.5-kan.
[0424] A p84.17fabB.DELTA.5kan plasmid was constructed to replace
fabB with the desA_kan cassette by several subcloning steps. First,
a DNA fragment (L-fabB) flanking the upstream region of fabB was
amplified with primers fabBLF and fabBLR (see Table 11), and a DNA
fragment (R-fabB) flanking the downstream region of fabB was
amplified with primers fabBRF and fabBRR (see Table 11) from E.
coli MG1655 genomic DNA. Second, L-fabB was digested with XbaI and
BglII, and R-fabB was digested with NotI and BglII. The digested
L-fabB and R-fabB fragments were purified from agarose gel and were
ligated with XbaI-NotI linearized pKOV. The resultant plasmid was
designated pHZ1.186. Next, the desA_kan gene cassette was removed
from pCDFDuet-1-.DELTA.5-kan as an AvrII-BamHI fragment and was
inserted between the AvrII and BglII sites of pHZ1.186, resulting
in the desA_kan gene cassette being sandwiched by L-fabB and
R-fabB. Finally, the L-fabB-desA_kan-R-fabB fragment was amplified
with fabBLF and fabBRR (see Table 11) from pHZ1.186 and cloned into
the two PvuII sites of pMOD-4-MCS (Epicentre Biotechnologies,
Madison, Wis.). The final plasmid was designated p84.17fabB.
[0425] DNA spanning from about 1 kb upstream to about 1 kb
downstream of fabB::cm was amplified from the genome of GRT23 cells
using the primers fabBup and fabBdowm (see Table 11). The amplified
DNA fragment was then digested with PvuII and inserted between the
two PvuII sites of pMOD-4-MCS. The resulting plasmid was designated
p84.15.
[0426] The genes encoding a thioesterase (`TesA) and a fatty acid
reductase (CarB) were cloned as an operon, and the operon was
placed under the trc promoter and pCL1920 vector. The final plasmid
was named pCL-Ptrc-carB_`tesA (the sequence is listed in FIG. 17 as
SEQ ID NO:213).
TABLE-US-00016 TABLE 11 Primer sequences Primer ID Sequence
de1ta5Fn TTTT CCTAGG ATG ACT GAA CAA ACC A (SEQ ID NO: 214)
de1ta5Rn TTTT GAATTC TTA TCA TTG TGA AAG CCAGAA (SEQ ID NO: 215)
kanF TTTT GAATTC TGT AGG CTG GAG CTG CTTCG (SEQ ID NO: 216) kanR
ATTCCG GGG ATC CGT CGA CC (SEQ ID NO: 217) fabBLF TTTT CTA GAA ATA
GCG CCA GCG ACA (SEQ ID NO: 218) fabBLR TTTT AGA TCT TAG CCC TAG
GCC AGT AAT CAC TGC ACG (SEQ ID NO: 219) fabBRF TTTT AGA TCT AGC
TTC GGC TTC GGC G (SEQ ID NO: 220) fabBRR TTTT GCG GCC GCG CCC ATC
CTT TGC TGG C (SEQ ID NO: 221) fabBup ACG ACA AAT GCG CCG C (SEQ ID
NO: 222) fabBdown ATC CGC GCA ATA AAG C (SEQ ID NO: 223)
Strain Construction
[0427] An E. coli MG1655
(.DELTA.fadE.DELTA.fhu.DELTA.fabB::cm)/pACYC-.DELTA.5 strain was
constructed by transforming p84.15fabB into MG1655
(.DELTA.fadE.DELTA.fhuA)/pACYC-.DELTA.5. Plasmid p84.17fabB was
transformed into MG1655
(.DELTA.fadE.DELTA.fhu.DELTA.fabB::cm)/pACYC-.DELTA.5 to produce
MG1655 (.DELTA.fadE.DELTA.fhu.DELTA.fabB::desA_kan)/pACYC-.DELTA.5.
After each transformation, the transformant mix was plated onto L
agar plates supplemented with 1 mM IPTG and appropriate antibiotics
(17 mg/L of chloramphenicol or 50 mg/L of kanamycin).
[0428] MG1655
(.DELTA.fadE.DELTA.fhu.DELTA.fabB::desA_kan)/pACYC-.DELTA.5 grew
normally in L Broth supplemented with oleate (potassium salt, 50
mg/L). Cells were plated onto L agar plates supplemented with 50
mg/L of oleate and incubated at 37.degree. C. for 2 days. Colonies
were then patched onto L Agar plates, supplemented with 50 mg/L of
oleate and 100 mg/L of carbenicillin. One of the colonies, which
lost resistance to carbenicillin but retained kanamycin resistance,
was streaked onto an L agar plate supplemented with 50 mg/L of
kanamycin, but no oleate. One of the colonies was selected from the
plate and was designated ALC119A.
ALC119A with a Fatty Alcohol Pathway Produced Almost Exclusive
Saturated Fatty Alcohol
[0429] Plasmid pCL-Ptrc-carB_`tesA was transformed into the ACL119A
strain. Three transformants of ALC119A/pCL-Ptrc-carB_`tesA were
grown in 3 mL of L broth with 100 mg/L of spectinomycin in a
37.degree. C. shaker overnight. 15 .mu.L of the overnight culture
were transferred into 2 mL of fresh L broth with 100 mg/L of
spectinomycin and 2 .mu.L of 70% potassium oleate. The fresh
inoculation was placed in a 37.degree. C. shaker for about 3 hrs.
The 2 mL culture was then transferred into 20 mL of V9 medium (Hu-9
medium without ferric chloride) in a 125 mL baffle flask. When the
OD.sub.600 of the culture reached about 0.9, 1 mM of IPTG was added
to each flask. After 20 hrs of growth at 37.degree. C., 20 mL of
ethyl acetate (with 1% of acetic acid, v/v) was added to each flask
to extract the fatty alcohols produced during the fermentation. The
crude ethyl acetate extract was directly analyzed with GC/MS as
described in WO 2008/119082. Cetyl alcohol was used as a reference
for quantification of fatty alcohol.
[0430] As shown in FIG. 13, the ALC119A/pCL-Ptrc-carB_`tesA strain
produced almost exclusively saturated fatty alcohols, including
dodecanol, tetradecanol and hexadecanol.
Example 6
Production of Fatty Alcohols in the Cyanobacterium Synechococcus
sp. PCC7002
[0431] This example describes the use of photoautotrophic bacteria
to produce fatty alcohols from carbon dioxide (instead of glucose)
using the carB-`tesA-yahK pathway. First, a vector is constructed
for homologous recombination into the Synechococcus sp. PCC7002
plasmid pAQ1 (genbank accession NC_0050525) using 500 bp homologous
regions corresponding to positions 3301-3800 and 3801-4300 of pAQ1.
As a selectable marker, a spectinomycin resistance cassette
containing the aminoglycoside 3' adenylyltransferase, aad,
promoter, gene and terminator (from plasmid pCL1920), is added
between the homologous regions. For gene expression, the promoter
and ribosome binding site of aminoglycoside phosphotransferase, aph
(from plasmid pACYC177), is added followed by the unique cloning
sites NdeI and EcoRI for insertion of a heterologous gene or
operon. This complete integration cassette is constructed by gene
synthesis and cloned into pUC19 for maintenance and delivery. The
resulting plasmid, pLS9-7002, allows (i) cloning and expression of
a foreign gene, and (ii) delivery and stable in vivo integration
into Synechococcus sp. PCC7002 plasmid pAQ1.
[0432] The fatty alcohol pathway for expression in Synechococcus
sp. PCC7002 is constructed as follows. The carB-`tesA operon from
pCL-Ptrc-carB-`tesA (described in Example 4) is extended by adding
yahK downstream of `tesA and then cloning into the NdeI and EcoRI
sites of pLS9-7002 downstream of the aph promoter and ribosome
binding site. The resulting plasmid is transformed into
Synechococcus sp. PCC7002 as described by Stevens et al. (Proc.
Natl. Acad. Sci. U.S.A. 77:6052-6056 (1980)). Stable integrants are
selected for on ATCC 1047 medium supplemented with 15 pg/mL
spectinomycin. 1 L of ATCC 1047 medium contains 40 mg
MgSO.sub.4.times.7 H.sub.2O, 20 mg CaCl.sub.2.times.2 H.sub.2O, 750
mg NaNO.sub.3, 2 mg K.sub.2HPO.sub.4, 3.0 mg citric acid, 3.0 mg
ferric ammonium citrate, 0.5 mg EDTA, 20 mg Na.sub.2CO.sub.3, 2.86
mg H.sub.3BO.sub.3, 1.81 mg MnCl.sub.2, 0.22 mg ZnSO.sub.4, 0.04 mg
Na.sub.2MoO.sub.4, 0.08 mg CuSO.sub.4, 0.05 mg Co(NO.sub.3).sub.2,
0.02 mg vitamin B12, 10 g agar, and 750 mL sea water. Spectinomycin
resistant colonies are restreaked several times on ATCC medium 1047
with spectinomycin and tested for isogenic intergration of the
carB-`tesA-yahK operon by PCR with primers pAQ1-U
(atgtctgacaaggggtttgacccct) (SEQ ID NO:224) and pAQ1-D
(gcacatccttatccaattgctctag) (SEQ ID NO:225). Complete isogenic
carB-`tesA-yahK integrants are then grown in 50 mL liquid ATCC 1047
medium with spectinomycin in 500 mL shake flasks with appropriate
aeration and illumination at 30.degree. C. for five to seven days.
Culture aliquots are extracted at various time points with an equal
volume of ethyl acetate and the extracts are analyzed for fatty
alcohol production as described in Example 3. Fatty alcohols are
produced.
Example 7
Production of Fatty Alcohols in the Cyanobacterium Synechococcus
elongatus PCC7942
[0433] This example describes a second method of using
photoautotrophic bacteria to produce fatty alcohols from carbon
dioxide (instead of glucose) using the carB-`tesA-yahK pathway.
First, a vector is constructed for homologous recombination into
the Synechococcus elongatus PCC7942 genome (genbank accession
CP_000100) using 800 bp homologous regions corresponding to
positions 2577844-2578659 and 2578660-2579467 of CP_000100. This
chromosomal location is known as neutral site one (NS1) (Mackey et
al., Meth. Mol. Biol. 362:115-129 (2007)). As a selectable marker,
a spectinomycin resistance cassette containing the aminoglycoside
3' adenylyltransferase, aad, promoter, gene and terminator (from
plasmid pCL1920), is added between the homologous regions.
Additionally, the unique cloning sites NdeI and EcoRI are added for
insertion of a heterologous gene or operon. This integration
cassette is constructed by gene synthesis and cloned into pUC19 for
maintenance and delivery. The resulting plasmid, pLS9-7942_NS1,
allows (i) cloning and expression of a foreign gene and (ii)
delivery and stable in vivo integration into the Synechococcus
elongatus PCC7942 genome.
[0434] The complete carB-`tesA-yahK operon (described in Example
6), including its ptrc promoter and ribosome binding site, is
cloned into the NdeI or EcoRI site of pLS9-7942_NS1. The resulting
plasmid is transformed into S. elongatus PCC7942 as described by
Mackey et al., Meth. Mol. Biol. 362:115-129 (2007). Stable
integrants are selected for on BG-11 medium supplemented with 4
pg/mL spectinomycin. 1 L of BG-11 medium contains 75 mg
MgSO.sub.4.times.7 H.sub.2O, 36 mg CaCl.sub.2).times.2 H.sub.2O,
1.5 g NaNO.sub.3, 40 mg K.sub.2HPO.sub.4, 6.0 mg citric acid, 6.0
mg ferric ammonium citrate, 1.0 mg EDTA, 20 mg Na.sub.2CO.sub.3,
2.86 mg H.sub.3BO.sub.3, 1.81 mg MnCl.sub.2, 0.22 mg ZnSO.sub.4,
0.04 mg Na.sub.2MoO.sub.4, 0.08 mg CuSO.sub.4, 0.05 mg
Co(NO.sub.3).sub.2, and 10 g agar. Spectinomycin resistant colonies
are restreaked several times on BG-11 medium with spectinomycin and
tested for isogenic integration of the carB-`tesA-yahK operon by
PCR with primers NS1-U (gatcaaacaggtgcagcagcaactt) (SEQ ID NO:226)
and NS1-D (attcttgacaagcgatcgcggtcac) (SEQ ID NO:227). Complete
isogenic carB-`tesA-yahK integrants are then grown in 50 mL liquid
BG-11 medium with spectinomycin in 500 mL shake flasks with
appropriate aeration and illumination at 30.degree. C. up to seven
days. Culture aliquots are extracted at various time points with an
equal volume of ethyl acetate and the extracts are analyzed for
fatty alcohol production as described in Example 3. Fatty alcohols
are produced.
Example 8
Malonyl-CoA-Independent Production of Fatty Alcohols in E. coli
[0435] Certain protists such as Euglena gracilis are capable of
malonyl-CoA independent fatty acid biosynthesis. The biosynthetic
machinery for this pathway is located in the mitochondria and is
thought to reverse the direction of .beta.-oxidation by using
acetyl-CoA as priming as well as elongating substrates to produce
C.sub.8 to C.sub.18 fatty acids (Inui et al., Eur. J. Biochem.
142:121-126 (1984)). The enzymes involved are trans-2-enoyl-CoA
reductases (TER), which catalyze the irreversible reduction of
trans-2-enoyl-CoA to acyl-CoA and thereby drive the otherwise
reversible pathway in the reductive direction (while the opposite
is true for .beta.-oxidation, where the irreversible acyl-CoA
dehydrogenase, FadE, drives the reaction in the oxidative
direction). One TER gene from E. gracilis as well as other
eukaryotic and prokaryotic homologs are known (Hoffmeister et al.,
J. Biol. Chem. 280:4329-4338 (2005); Tucci et al., FEBS Lett.
581:1561-1566 (2007)). The only known TER enzyme from E. gracilis
has been shown in vitro to reduce trans-2-butenoyl-CoA (C4) and
trans-2-hexenoyl-CoA (C6) to the respective acyl-CoAs,
(longer-chain trans-2-enoyl-CoAs have not been tested). Currently,
very little is known about the other pathway enzymes in E.
gracilis.
[0436] A pathway that creates a flux exclusively from acetyl-CoA
precursors to acyl-CoA (as in Euglena gracilis mitochondria) can be
engineered in E. coli using different sets of enzymes with the
following four enzymatic activities: (i) non-decarboxylating,
condensing thiolase, (ii) 3-ketoacyl-CoA reductase (or
3-hydroxyacyl-CoA dehydrogenase), (iii) 3-hydroxyacyl-CoA hydratase
(or enoyl-CoA dehydratase) and (iv) trans-2-enoyl-CoA reductase.
All four enzymes can have sufficiently relaxed chain lengths
specificity to allow synthesis of acyl-CoAs with longer chain
length, e.g., C.sub.12 or C.sub.14.
[0437] A plasmid encoding all four activities is constructed as
follows. A synthetic operon of E. coli fadA (YP_026272) (shown in
FIG. 17 as SEQ ID NO:229) (non-decarboxylating thiolase) and fadB
(NP_418288) (shown in FIG. 17 as SEQ ID NO:231) (3-hydroxyacyl-CoA
dehydrogenase and enoyl-CoA dehydratase) and E. gracilis ter
(Q5EU90) (shown in FIG. 17 as SEQ ID NO:228) (trans-2-enoyl-CoA
reductase, codon optimized without its 5' sequence encoding a
transit peptide) is constructed and cloned downstream of a ptrc
promoter into a pACYC plasmid with a carbenicillin or
chloramphenicol resistance gene. Alternatively, instead of the E.
coli fadA and fadB genes, the E. coli fadI (NP_416844) (shown in
FIG. 17 as SEQ ID NO:223) and fadJ (NP_416843) (shown in FIG. 17 as
SEQ ID NO:235) genes (or the corresponding orthologs from other
organisms) are used. As an alternative to the E. gracilis ter gene,
the corresponding orthologs from other organisms or the E. coli
fabI (NP_415804) (shown in FIG. 17 as SEQ ID NO:237) gene are used.
Although FabI normally reduces trans-2-enoyl-ACPs, it is also
active with trans-2-enoyl-CoAs (Bergler et al., J. Biol. Chem.
269:5493-5496 (1993)).
[0438] The pACYC-ptrc_fadAB-ter plasmid or the
pACYC-ptrc_fadAB-fabI plasmid is cotransformed with the
pCL-ptrc_carB-`tesA plasmid (described in Example 4) into an E.
coli .DELTA.fadE strain. These strains are cultured, extracted and
analyzed for fatty alcohol production as described in Example 3.
The two different strains produce fatty alcohols with different
chain length distribution.
[0439] As these strains express `TesA, a portion of the fatty
alcohols produced are derived from malonyl-CoA dependent acyl-ACP
precursors. `TesA efficiently hydrolyzes acyl-ACPs when
overexpressed in E. coli, although it has higher specific activity
for acyl-CoAs as compared to acyl-ACPs. To increase the proportion
or exclusively produce fatty alcohols derived from the malonyl-CoA
independent pathway, alternative thioesterases that have lower
hydrolytic activity towards acyl-ACPs are used instead of `TesA.
One example is E. coli TesB (NP_414986), which prefers acyl-CoAs
over acyl-ACPs (Spencer et al., J. Biol. Chem. 253:5922-5926
(1978)) and when overexpressed in E. coli does not hydrolyze acyl
ACPs (Zheng et al., App. Environ. Microbiol. 70:3807-3813 (2004)).
In alternative methods, orthologs of TesA and TesB or thioesterases
from other protein families that hydrolyze acyl-CoAs with high
efficiency while hydrolyzing acyl-ACPs with low efficiency are
used.
[0440] In one method, a pCL-ptrc_carB-`tesB plasmid is constructed
as described in Example 4 by replacing the `tesA gene with the tesB
gene (NP_414986) (shown in FIG. 17 as SEQ ID NO:239). The plasmid
is cotransformed with the pACYC-ptrc_adAB-ter plasmid or the
pACYC-ptrc_fadAB-fabI plasmid into an E. coli .DELTA.fadE strain.
These strains are cultured, extracted and analyzed for fatty
alcohol production as described in Example 3.
[0441] In another method, the pCL-ptrc_carB-`tesA plasmid is
replaced with a pCL-ptrc_acr1 plasmid, which expresses the acyl-CoA
reductase Acr1 from Acinetobacter baylyi ADP1 (YP_047869) (shown in
FIG. 17 as SEQ ID NO:241). This reductase specifically reduces
acyl-CoAs but not acyl-ACPs to the corresponding fatty alcohols
(Reiser et al., J. Bacteriol. 179:2969-2975 (1997)). The plasmid is
cotransformed with the pACYC-ptrc_adAB-ter plasmid or the
pACYC-ptrc_fadAB-fabI plasmid into an E. coli .DELTA.fadE strain.
These strains are cultured, extracted and analyzed for fatty
alcohol production as described in Example 3. The strains produce
fatty alcohols independent of malonyl-CoA.
Example 9
Identification of Iron as an Inhibitor of Fatty Alcohol
Production
[0442] Hu9 medium is a known fermentation medium, which contains 6
g/L Na.sub.2HPO.sub.4, 3 g/L KH.sub.2PO.sub.4, 0.5 g/L NaCl, 1 g/L
NH.sub.4Cl, 0.1 mM CaCl.sub.2), 1 mM MgSO.sub.4, 15 g/L agar, 10 mM
glucose, 50 mg/L Uracil, and trace minerals containing 100 .mu.M
FeCl.sub.3, 500 .mu.M ZnCl.sub.2, 200 .mu.M Na.sub.2Mo.sub.4, 200
.mu.M CuSO.sub.4, 200 .mu.M H.sub.3BO.sub.3. However, it was
observed that the production of fatty alcohols was completely
reduced when recombinant E. coli strains, otherwise capable of
producing fatty alcohols, were grown in Hu9 medium. As described in
detail below, the inability of E. coli strains to produce fatty
alcohols in various incomplete Hu9 media was measured, and it was
found that the recombinant bacteria were incapable of producing
fatty alcohols when iron was present in the medium. However, the
addition of iron did not inhibit the growth of the bacteria.
[0443] In order to identify the component(s) involved in the
inhibition of fatty alcohol production, different versions of
incomplete Hu9 medium were made, some of which lacked a dispensable
ingredient, and then the production of fatty alcohol was
evaluated.
[0444] In the first step the following media were made: complete
Hu9 medium, incomplete Hu9 medium lacking uracil, and incomplete
Hu9 medium lacking trace elements. K6 cells (a recombinant
bacterial strain C41 (DE3, .DELTA.fadE) carrying pACYCDuet-1-carB,
encoding the CAR homolog carB and pETDuet-1-`tesA) were cultured in
2 mL of LB containing appropriate antibiotics. After reaching an OD
of 1.0, the 2 mL cultures were scaled up in 125 mL shake flasks
(containing one of the Hu9 media described above) to a volume 22
mL. The cultures were induced by adding IPTG to a final
concentration of 1 mM. After growing them for 20 hrs at 37.degree.
C., 22 mL of ethyl acetate (with 1% of acetic acid, v/v) was added
to each flask to extract the fatty alcohols produced during the
fermentation. The crude ethyl acetate extract was directly analyzed
with GC/MS and the total fatty alcohol titers were quantified.
[0445] As depicted in FIG. 14A, the fatty alcohol production was
inhibited to a great extent by the addition of trace elements as
compared to the addition of uracil to the incomplete Hu9 medium.
This indicated that the inhibitory component(s) was a part of trace
mineral solution.
[0446] In order to find out which trace element was responsible for
the fatty alcohol production inhibition, the following Hu9 media
were made: complete Hu9 medium; Hu9 lacking FeCl.sub.3; Hu9 lacking
ZnCl.sub.2; Hu9 lacking Na.sub.2Mo.sub.4; Hu9 lacking CuSO.sub.4;
and Hu9 lacking H.sub.3BO.sub.3. The fatty alcohol production of K6
cells grown in these different Hu9 media was evaluated using the
method described above.
[0447] As shown in FIG. 14B, fatty alcohol production was inhibited
mainly by the addition of iron to the medium. Thus, by eliminating
or reducing the presence of iron (e.g., ferric citrate, ferric
chloride, or ferrous sulfate) in the culture medium, fatty alcohols
can be produced.
OTHER EMBODIMENTS
[0448] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20210324430A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20210324430A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References