U.S. patent application number 17/316758 was filed with the patent office on 2021-10-21 for mutagenesis method using polyethylene glycol mediated introduction of mutagenic nucleobases into plant protoplasts.
This patent application is currently assigned to Keygene N.V.. The applicant listed for this patent is Keygene N.V.. Invention is credited to Paul BUNDOCK, Michiel Theodoor Jan DE BOTH, Frank LHUISSIER.
Application Number | 20210324393 17/316758 |
Document ID | / |
Family ID | 1000005682128 |
Filed Date | 2021-10-21 |
United States Patent
Application |
20210324393 |
Kind Code |
A1 |
BUNDOCK; Paul ; et
al. |
October 21, 2021 |
Mutagenesis method using polyethylene glycol mediated introduction
of mutagenic nucleobases into plant protoplasts
Abstract
Method for targeted alteration of a duplex acceptor DNA sequence
in a plant cell protoplast, comprising combining the duplex
acceptor DNA sequence with a donor mutagenic nucleobase, wherein
the duplex acceptor DNA sequence contains a first DNA sequence and
a second DNA sequence which is the complement of the first DNA
sequence and wherein the donor mutagenic nucleobase comprises at
least one mismatch with respect to the duplex acceptor DNA sequence
to be altered, preferably with respect to the first DNA sequence,
wherein the method further comprises a step of introducing the
donor mutagenic nucleobase into the cell protoplasts using
polyethylene glycol (PEG) mediated transformation and the use of
PEG protoplast transformation for enhancing the rate of targeted
mutagenesis.
Inventors: |
BUNDOCK; Paul; (Wageningen,
NL) ; DE BOTH; Michiel Theodoor Jan; (Wageningen,
NL) ; LHUISSIER; Frank; (Wageningen, NL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Keygene N.V. |
Wageningen |
|
NL |
|
|
Assignee: |
Keygene N.V.
Wageningen
NL
|
Family ID: |
1000005682128 |
Appl. No.: |
17/316758 |
Filed: |
May 11, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15084935 |
Mar 30, 2016 |
11008579 |
|
|
17316758 |
|
|
|
|
13551143 |
Jul 17, 2012 |
9365860 |
|
|
15084935 |
|
|
|
|
12809384 |
Jun 30, 2010 |
|
|
|
PCT/NL2007/000326 |
Dec 21, 2007 |
|
|
|
13551143 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/8213 20130101;
C12N 15/8206 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Claims
1. A composition comprising polyethylene glycol and a synthetic
single-stranded nucleobase having a length of between 10-60
nucleotides, wherein the nucleobase comprises a sequence
complementary to a target sequence in the plant genome.
2. The composition of claim 1, further comprising one or more plant
protoplasts.
3. The composition of claim 1, wherein the nucleobase is a
single-stranded DNA nucleobase.
4. The composition of claim 1, wherein the single-stranded
nucleobase comprises one or more modified nucleotides.
5. The composition of claim 1, wherein the nucleobase comprises a
mismatch with respect to the target sequence in the plant
genome.
6. The composition of claim 1, wherein the single-stranded
nucleobase is conjugated to a protein.
7. The composition of claim 1, wherein the single-stranded
nucleobase is chemically modified for protection against nuclease
degradation.
8. The composition of claim 4, wherein the single-stranded
nucleobase comprises one or more Locked Nucleic Acid (LNA)
substitutions.
9. The composition of claim 5, wherein the single-stranded
nucleobase comprises one or more LNA substitutions that are at
least one nucleotide removed from the mismatch.
10. The composition of claim 9, wherein the single-stranded
nucleobase comprises two LNAs located at least one nucleotide
removed from either side of the mismatch.
11. The composition of claim 8, wherein the LNA substitutions are
at least 3 nucleotides removed from the 5' and 3' ends of the
single-stranded nucleobase.
12. The composition of claim 8, wherein the LNA substitutions are
at least 4 nucleotides removed from the 5' and 3' ends of the
single-stranded nucleobase.
13. The composition of claim 8, wherein the LNA substitutions are
at least 5 nucleotides removed from the 5' and 3' ends of the
single-stranded nucleobase.
14. The composition of claim 4, wherein the single-stranded
nucleobase comprises one or more propyne substitutions.
15. The composition of claim 4, wherein the single-stranded
nucleobase comprises a phosphorothioate linkage.
16. The composition of claim 4, wherein the single-stranded
nucleobase comprises a 2'-O-methyl analog.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a method for the specific
and selective alteration of a nucleotide sequence at a specific
site of the DNA in a target cell by the introduction into the cell
of a single stranded DNA oligonucleotide mutagenic nucleobase. More
in particular, the invention relates to a process of targeted
mutagenesis by the introduction of a mutagenic nucleobase into
plant protoplasts using polyethylene glycol (PEG). The invention
further relates to kits containing a mutagenic nucleobase and PEG.
The invention also relates to the use of PEG for enhancing targeted
mutagenesis.
BACKGROUND OF THE INVENTION
[0002] The process of deliberately creating changes in the genetic
material of living cells has the goal of modifying one or more
genetically encoded biological properties of that cell, or of the
organism of which the cell forms part or into which it can
regenerate. These changes can take the form of deletion of parts of
the genetic material, addition of exogenous genetic material, or
changes in the existing nucleotide sequence of the genetic
material. Methods of altering the genetic material of eukaryotic
organisms have been known for over 20 years, and have found
widespread application in plant, human and animal cells and
micro-organisms for improvements in the fields of agriculture,
human health, food quality and environmental protection. The most
common methods consist of adding exogenous DNA fragments to the
genome of a cell, which will then confer a new property to that
cell or its organism over and above the properties encoded by
already existing genes (including applications in which the
expression of existing genes will thereby be suppressed). Although
many such examples are effective in obtaining the desired
properties, these methods are nevertheless not very precise,
because there is no control over the genomic positions in which the
exogenous DNA fragments are inserted (and hence over the ultimate
levels of expression), and because the desired effect will have to
manifest itself over the natural properties encoded by the original
and well-balanced genome. On the contrary, methods of targeted
mutagenesis that will result in the addition, deletion or
conversion of nucleotides in predefined genomic loci will allow the
precise modification of existing genes. In addition, due to the
precise nature of targeted mutagenesis, its is expected that novel
plant lines obtained in this way will be more readily accepted by
consumers.
[0003] Targeted mutagenesis is a site-directed mutagenesis method
that is based on the delivery into the eukaryotic cell nucleus of
synthetic mutagenic nucleobases (molecules consisting of short
stretches of nucleotide-like moieties that resemble DNA in their
Watson-Crick basepairing properties, but may be chemically
different from DNA) (Alexeev and Yoon, Nature Biotechnol. 16: 1343,
1998; Rice, Nature Biotechnol. 19: 321, 2001; Kmiec, J. Clin.
Invest. 112: 632, 2003). Once introduced into the cell, such
mutagenic nucleobases basepair with the complementary sequence at
the target locus. By deliberately designing a mismatch in the
nucleobase, the mismatch may a nucleotide conversion at the
corresponding position in the target genomic sequence. This method
allows the conversion of single or at most a few nucleotides in
endogenous loci, but may be applied to create stop codons in
existing loci, resulting in a disruption of their function, or to
create codon changes, resulting in genes encoding proteins with
altered amino acid composition (protein engineering).
[0004] Targeted mutagenesis has been described in plant, animal and
yeast cells. Two different classes of synthetic mutagenic
nucleobases have been used in these studies, the chimeric DNA:RNA
nucleobases or single stranded nucleobases.
[0005] The chimeric DNA:RNA nucleobases (chimeras) are self
complementary molecules consisting of a 25 bp DNA only region and a
25 bp complementary sequence made up of 5 bp of core region of DNA
flanked on either side by 10 bp of 2'-O-methylated RNA that are
thought to aid stability of the chimera in the cell. The 5 bp core
region includes in its centre an engineered mismatch with the
nucleotide to be altered in the genomic target DNA sequence. Both
these regions are linked by 4 bp thymidine hairpins. Upon
introduction into the cell the chimera is thought form a double
D-loop with its target sequence and a mismatch is formed between
the chimera and the target nucleotide. This mismatch is then
resolved by endogenous cellular DNA repair proteins by conversion
of the genomic nucleotide. The first examples of targeted
mutagenesis using chimeras came from animal cells (reviewed in
Igoucheva et al. 2001 Gene Therapy 8, 391-399) and were then also
later used to achieve targeted mutagenesis in plant cells (Beetham
et al. 1999 Proc. Natl. Acad. Sci. USA 96: 8774-8778; Zhu et al.
1999 Proc. Natl. Acad. Sci. USA 96, 8768-8773; Zhu et al. 2000
Nature Biotech. 18, 555-558; Kochevenko et al. 2003 Plant Phys.
132: 174-184; Okuzaki et al. 2004 Plant Cell Rep. 22: 509-512).
Unlike human cells, a plant cell in which a targeted mutagenesis
event has occurred can be regenerated into an intact plant and the
mutation transferred to the next generation, making it an ideal
tool for both research and commercial mutagenesis of important food
crops. However, extensive research by many laboratories has shown
that the targeted mutagenesis frequency using chimeras is quite low
and variable, or not even detectable (Ruiter et al. 2003 Plant Mol.
Biol. 53, 715-729, Van der Steege et al. (2001) Nature Biotech. 19:
305-306), and depended on such factors as the transcriptional
status of the target, the position of the cell in the cell cycle,
the sequence of the target and the quality of the chimeras, which
are difficult to synthesize. Due to the relatively low frequency of
targeted mutagenesis with the methods known in the art, such events
can only be detected when alteration of a single nucleotide of the
genomic target results in a dominant selectable phenotype. In plant
cells specific point mutations were introduced into the open
reading frame of the acetolactate synthase (ALS, in maize AHAS)
gene which catalyzes the initial step common to the synthesis of
the branched chain amino acids leucine, isoleucine and valine. In
tobacco, single nucleotide alterations are sufficient to produce
the codon conversions P194Q or W571 L. The ALS protein produced
after either of these codon conversions is insensitive to
inhibition by the sulfonylurea class of herbicides, thus providing
a method of selection for single nucleotide conversions at a
chromosomal locus.
[0006] Due to the difficulties of working with chimeras, more
reliable alternative oligonucleotide designs have been sought.
Several laboratories have investigated the ability of single
stranded (ss) nucleobases to perform targeted mutagenesis. These
have been found to give more reproducible results, be simpler to
synthesize, and can also include modified nucleotides to improve
the performance of the mutagenic nucleobase in the cell (Liu et al.
2002 Nucl. Acids Res. 30: 2742-2750; review, Parekh-Olmedo et al.
2005 Gene Therapy 12: 639-646; Dong et al. 2006 Plant Cell Rep. 25:
457-65; De Piedoue et al. 2007 Oligonucleotides 27: 258-263).
[0007] Targeted mutagenesis has been described in a variety of
patent applications of Kmiec, inter alia in WO0173002, WO03/027265,
WO01/87914, WO99/58702, WO97/48714, WO02/10364. In WO 01/73002 it
is contemplated that the low efficiency of gene alteration obtained
using unmodified nucleobases is largely believed to be the result
of their degradation by nucleases present in the reaction mixture
or the target cell. To remedy this problem, it is proposed to
incorporate modified nucleotides that render the resulting
nucleobases resistant against nucleases. Typical examples of such
modified nucleotides include phosphorothioate linkages or
2'-O-methyl-analogs. These modifications are preferably located at
the ends of the nucleobase, leaving a central unmodified domain
surrounding the targeted base. In support of this, patent
application WO 02/26967 shows that certain modified nucleotides
increasing the intracellular lifetime of the nucleobase enhance the
efficiency of targeted mutagenesis in an in vitro test system and
also at a mammalian chromosomal target. Not only the nuclease
resistance, but also the binding affinity of an ss mutagenic
nucleobase to its complementary target DNA has the potential to
enhance the frequency of targeted mutagenesis dramatically. A ss
nucleobase containing modified nucleotides that enhance its binding
affinity may more efficiently find its complementary target in a
complex genome and/or remain bound to its target for longer and be
less likely to be removed by proteins regulating DNA transcription
and replication. An in vitro targeted mutagenesis assay has been
used to test many modified nucleotides to improve the efficiency of
the mutagenesis process. Locked nucleic acids (LNA) and C5-propyne
pyrimidines have modifications of the sugar moiety and base
respectively that stabilize duplex formation and raise the melting
temperature of the duplex. When these modified nucleotides are
incorporated on an ss nucleobase, they enhance the efficiency of
targeted mutagenesis up to 13 fold above that obtained using an
unmodified nucleobase of the same sequence. See in his respect
WO2007073166 and WO2007073170 in the name of the present
applicants.
[0008] The present inventors have set out to improve the frequency
of targeted mutagenesis in plant cells by optimizing the method
used to introduce the mutagenic nucleobases into plant cells. The
most widely used method for transformation of plant cells,
Agrobacterium mediated transformation, transfers a section of its
tumour inducing (Ti) plasmid, the so-called T-DNA, to plant cells
where it efficiently integrates into the plant genome at a random
position. The T-DNA is flanked at either end by "border" sequences
of up to 22 bps derived from the Ti plasmid which share no homology
with the target sequence. Given the short length of the ss
mutagenic nucleobases used for targeted mutagenesis, the border
sequences would interfere with the process. Thus, targeted
mutagenesis can only be achieved in plant cells through direct DNA
transfer using chemical or physical methods.
[0009] In the literature, several such direct DNA transfer
techniques have been reported and include electroporation,
polyethylene glycol (PEG) treatment of protoplasts, biolistic
bombardment of plant callus material and microinjection of DNA into
individual protoplasts or tissue. The art provides no indication as
regards a preferred method for the transfer of ss nucleobases for
targeted mutagenesis, in particular for DNA transfer to plants or
plant protoplasts.
[0010] In order to achieve as high a targeted mutagenesis
efficiency in plants as possible, the present inventors in the
course of their investigations have identified four factors that
are to be optimized. First, the mutagenic nucleobase is preferably
introduced with a high transformation efficiency, i.e. introduced
into as many plant cells as possible. Second, the treatment is
preferably not lethal to most of the cells, ensuring that as many
cells as possible that are transformed also survive the
transformation procedure (survival efficiency). Thirdly, the
transformation method is preferably not detrimental to the
subsequent divisions of the transformed plant cells to form
microcalli (regeneration/plating efficiency) and finally it is
preferably possible to identify individual regenerated plants
derived from targeted mutagenesis events without application of a
selection (identification efficiency). Most methods for
transformation of DNA to individual plant cells use protoplasts,
derived directly from leaves (mesophyll protoplasts) or from cell
suspensions (reviewed in Sheen, J. (2001) Plant Phys. 127:
1466-1475). Protoplasts can be used for transient expression
studies, in which case gene expression or protein localization can
be assessed shortly after transformation, or for production of
stably transformed plants when the protoplasts are grown on medium
to promote callus formation and organogenesis.
[0011] Transformation of plant protoplasts using electroporation
has been previously reported (Fromm et al. (1985) Proc. Natl. Acad.
Sci. USA 82: 5824-5828; Nishiguchi et al. (1986) Plant Cell Rep. 5:
57-60; Ou-Lee et al. (1986) Proc. Natl. Acad. Sci. USA 83:
6815-6819; Hauptmann et al. (1987) Plant Cell Rep. 6: 265-270;
Jones et al. (1989) Plant Mol. Biol. 13: 503-511). Generally, the
field strength (V/cm) giving the highest transformation efficiency
results in <50% of protoplast survival (Jones et al. (1989)
Plant Mol. Biol. 13: 503-511). In tobacco electroporation studies
we have found that only approximately 10% of the total tobacco
protoplasts in the sample are transformed with a plasmid expressing
GFP and this relatively low transformation efficiency has also been
observed after electroporation of Arabidopsis protoplasts (Miao et
al. (2007) Nature Protocols 10: 2348-2353). In general, the optimal
electroporation conditions must be determined empirically for each
plant species and these can also vary according to the type of
electroporation machine and the method and buffers used for
protoplast isolation. While electroporation has been successfully
applied to many plant species, it remains a difficult technique
with several serious limitations (as discussed in:
http://genetics.mgh.harvard.edu/sheenweb/faq.html), in particular
in terms of reproducibility. Hence electroporation is less
desirable for enhancing the overall efficiency for TNE of targeted
mutagenesis.
[0012] Direct gene transfer using biolistic delivery has been very
successful in generating transgenic crop plants and is routinely
used for the stable integration of transgenes. Cell suspensions are
transferred to solid medium for callus induction and this material
is bombarded by gold particles driven by a high pressure gas
source. It has been reported that the transformation frequencies
are low, .about.0.01% of the total cells are transformed. Due to
the low transformation efficiency, the survival of the transformed
cells is difficult to assess. In contrast, the regeneration
efficiency after bombardment is likely to be high due to the
strongly dividing material that is treated. However, as TNE will
occur in a single cell of a single callus, such an event will be
easily lost if it is not selected for or, alternatively,
regenerated plants will be chimeric for the targeted mutagenesis
event. Thus, bombardment is not practical for performing targeted
mutagenesis at non-selectable loci. In contrast, it is possible to
recover targeted mutagenesis events using protoplasts as each
microcallus is derived from a single protoplast.
[0013] Induced single nucleotide conversions by chimeras at ALS
have demonstrated that targeted mutagenesis can be detected in
tobacco, maize and rice cells. Bombardment has been used for
tobacco (Beetham et al. 1999 Proc. Natl. Acad. Sci. USA 96:
8774-8778; Kochevenko et al. 2003 Plant Phys. 132: 174-184), maize
(Zhu et al. 1999 Proc. Natl. Acad. Sci. USA 96, 8768-8773) and rice
(Okuzaki et al. 2004 Plant Cell Rep. 22: 509-512). Beetham et al.
(1999) reported that the frequency of herbicide resistance after
direct transfer of chimeras increased 20 fold compared to the
background mutation rate (assumed to be 10.sup.-7 to 10.sup.-8).
Kochevenko et al. have also used electroporation to perform
targeted mutagenesis experiments in tobacco mesophyll protoplasts.
The present inventors were able to obtain herbicide resistant
tobacco callus at a frequency of 0.0001%, comparable to the
frequency obtained by Beetham et al. This suggests that when
dealing with the same plant species and the same target nucleotide
that in this case the direct DNA delivery method does not have a
large impact on the targeted mutagenesis efficiency, which remains
at an undesirable low level. However, Ruiter et al. (2003 Plant
Mol. Biol. 53, 715-729) performed both bombardment and
electroporation experiments in both tobacco and oil seed rape, and
could not detect any effect of the chimeras.
[0014] Bombardment of both maize and rice callus has been reported
at an efficiency of 0.01% of the cells that are transformed (Zhu et
al. (1999) Proc. Natl. Acad. Sci. USA 96, 8768-8773; Okuzaki et al.
(2004 (Plant Cell Rep. 22: 509-512). However, this is only feasible
at selectable loci.
PEG-mediated protoplast transformation in itself has been known
already since 1985. The first method for protoplast transformation
utilized PEG (Krens et al. (1982) Nature 296: 72-74; Potyrykus et
al. (1985) Plant Mol. Biol. Rep. 3:117-128; Negrutiu et al. (1987)
Plant Mol. Biol. 8: 363-373). The technique is applicable to
protoplasts from many different plants (Rasmussen et al. (1993)
Plant Sci. 89: 199-207). PEG is thought to stimulate transformation
by precipitating the DNA, in the presence of divalent cations, onto
the surface of the protoplasts from where it then becomes
internalized (Maas & Werr (1989) Plant Cell Rep. 8: 148-151).
PEG transformation is the method of choice for transformation of
Arabidopsis protoplasts
(http://genetics.mqh.harvard.edu/sheenweb/fag.hmtl) (Mathur et al.
Methods in molecular biology, vol. 82, 267-276) and conforms well
to the four requirements defined for a transformation method for
efficient TNE. When tobacco protoplasts are treated with PEG, a
biotin-labelled ss oligonucleotide can be detected in all cells
examined. Survival, as assessed by vital staining using fluorescein
diacetate, is >90% after PEG treatment. Not all protoplasts
retain the ability to divide and form microcalli. In a typical
isolation of non-treated tobacco protoplasts, approximately 25%
form microcalli. PEG treatment does have a slight impact on
regeneration efficiency, which drops to approximately 10%, but this
is not dramatic compared to other transformation methods. None of
the above describe prior art has contemplated the use of PEG
transformation for site-directed mutagenesis, in particular
TNE.
[0015] The present inventors have set out to improve the method of
direct DNA transfer to obtain efficient targeted mutagenesis in
plant cells. The present inventors have found that from amongst the
transformation technologies as described herein elsewhere, PEG
protoplast transformation enhances the overall targeted mutagenesis
efficiency significantly compared to electroporation and
biolistics. This is surprising, as the technologies for targeted
mutagenesis in plants to date appeared to favour electroporation
with the associated low efficiencies. Furthermore most improvements
in the technology were directed at improving the mutagenic
nucleobases and not in the delivery system for delivering the
mutagenic nucleobase to the genomic target DNA.
[0016] For sake of comparison, the present inventors used ss
mutagenic nucleobase designed to produce a P194Q conversion at the
ALS locus leading to herbicide resistance. Identical ss mutagenic
nucleobases were introduced into tobacco mesophyll protoplasts
using either PEG mediated transformation or electroporation and
herbicide resistant cells were selected using identical selection
conditions. Thus the present inventors have found that PEG-mediated
transformation of plant cells is the most efficient method to
perform targeted mutagenesis in plant cells compared to known
methods of transformation.
[0017] In one aspect the invention pertains to a method for
targeted alteration of a duplex acceptor DNA sequence in a plant
cell protoplast, comprising combining the duplex acceptor DNA
sequence with a ss mutagenic nucleobase, wherein the duplex
acceptor DNA sequence contains a first DNA sequence and a second
DNA sequence which is the complement of the first DNA sequence and
wherein the donor ss mutagenic nucleobase comprises at least one
mismatch with respect to the duplex acceptor DNA sequence to be
altered, preferably with respect to the first DNA sequence, wherein
the method further comprises a step of introducing the ss mutagenic
nucleobase into the cell protoplasts using polyethylene glycol
(PEG) mediated transformation.
[0018] The ss mutagenic nucleobase is brought into contact with
protoplasts of the plant to be transformed using a PEG
transformation based technology. The PEG mediated transformation
technology in itself is widely known and were necessary, small
amendments to particular protocols can be made by the skilled man
without departing from the gist of the present invention.
[0019] The ss mutagenic nucleobase used in the present invention
have a length that is in line with other (chimeric) ss mutagenic
nucleobase used in targeted mutagenesis, i.e. typically between
10-60 nucleotides, preferably 20-55 nucleotides, more preferably
25-50 nucleotides. In certain embodiments of the invention, the ss
mutagenic nucleobase used in the present invention the can be
modified, for instance by LNA and/or propynyl modifications as
described in applicant's WO2007073166 and WO2007073170. Thus in
certain embodiments, the ss mutagenic nucleobase contains at least
one LNA located at a position that is from the targeted mismatch
and preferably two LNAs located at least one nucleotide removed
from either side of the mismatch and. Furthermore, these LNAs are
at least 3, 4 or 5 nucleotides removed form the 5' and/or 3'ends of
the ss mutagenic nucleobase. In certain embodiments, the ss
mutagenic nucleobase can comprise one or more propyne
substitutions, essentially as described in WO2007073166 and
WO2007073170. In certain embodiments, the donor ss mutagenic
nucleobase may be conjugated to protein such as a nuclear
localisation signal. In this embodiment, the oligonucleotide used
in the present invention is coupled via conventional (linker)
technology to a nuclear localisation signal such as the known (NLS)
peptide of the SV40 large T antigen, GATA transcription factor 11,
DNA repair helicase XBP1, Light mediated protein DET1, ERF
transcription factor, PR-related transcript activator PTI6 and
nuclear coiled protein, essentially as described in applicants
co-pending application PCT/NL2007/000279. The
oligonucleotide-nuclear localisation signal conjugate can be used
in the PEG-based transformation methodology described herein.
[0020] The alteration produced by the method of the present
invention is a deletion, a substitution or an insertion of at least
one nucleotide. Preferably the alteration is a substitution. More
nucleotides may be altered in one oligonucleotide, but it is
expected that efficiency will diminish, hence there is a preference
for altering one nucleotide.
[0021] The target DNA (or duplex acceptor DNA) can be from any
source, but preferably the target DNA is from a plant. Preferably
the target DNA is from genomic DNA, linear DNA, artificial
chromosomes, nuclear chromosomal DNA, organelle chromosomal DNA,
episomal DNA. The method according to the invention can be used for
altering a cell, correcting a mutation by restoration to wild type,
inducing a mutation, inactivating an enzyme by disruption of coding
region, modifying bioactivity of an enzyme by altering coding
region, modifying a protein by disrupting the coding region.
[0022] In one aspect the invention relates to the use of PEG
mediated transformation for enhancing the efficiency of targeted
mutagenesis in plant protoplasts.
[0023] Without being bound by theory, it is thought that the use of
PEG mediated transformation precipitates the DNA on the cell
membrane of the protoplast. The precipitated DNA is encapsulated by
the cell membrane and introduced into the protoplast in a shielded
form. The protoplast will, in the course of its normal cell cycle,
directly after its formation by removal of the cell wall, start its
normal cell wall regeneration process. The cell division typically
starts later (from several hours up to a few days). The targeted
nucleotide exchange generally takes place during the cell division,
using the cell's repair mechanism. In the time period between the
introduction of the donor DNA in the protoplast and the start of
the cell division, the donor DNA is prone to attack form the cells
defence mechanism such as exonucleases and is likely to be
degenerated and hence become ineffective for TNE. With the use of
PEG-mediated transformation technology, the donor DNA is
encapsulated via endocytosis and is in this way at least
temporarily shielded from the degenerative action of endonucleases.
When the DNA is released from its encapsulated form, it has an
increased chance of being present at or around the moment of the
cell division, during which the DNA (i.e. the ss mutagenic
nucleobase) is available to find its complement in the DNA of the
acceptor cell and exchange the nucleotide as in common targeted
mutagenesis mechanisms.
EXAMPLES
Comparison of Targeted Mutagenesis Frequencies Using Either PEG
Mediated Transformation or Electroporation
Protoplast Isolation
[0024] In vitro shoot cultures of Nicotiana tabacum cv Petit Havana
line SR1 are maintained on MS20 medium with 0.8% Difco agar in high
glass jars at 16/8 h photoperiod of 2000 lux at 25.degree. C. and
60-70% RH. MS20 medium is basic Murashige and Skoog's medium
(Murashige, T. and Skoog, F., Physiologia Plantarum, 15: 473-497,
1962) containing 2% (w/v) sucrose, no added hormones and 0.8% Difco
agar. Fully expanded leaves of 3-6 week old shoot cultures are
harvested. The leaves are sliced into 1 mm thin strips, which are
then transferred to large (100 mm.times.100 mm) Petri dishes
containing 45 ml MDE basal medium for a preplasmolysis treatment of
30 min. MDE basal medium contained 0.25 g KCl, 1.0 g
MgSO.sub.4.7H.sub.2O, 0.136 g of KH.sub.2PO.sub.4, 2.5 g
polyvinylpyrrolidone (MW 10,000), 6 mg naphthalene acetic acid and
2 mg 6-benzylaminopurine in a total volume of 900 ml. The
osmolality of the solution is adjusted to 600 mOsmkg.sup.-1 with
sorbitol, the pH to 5.7. 5 mL of enzyme stock SR1 are then added.
The enzyme stock consists of 750 mg Cellulase Onozuka R10, 500 mg
driselase and 250 mg macerozyme R10 per 100 ml, filtered over
Whatman paper and filter-sterilized. Digestion is allowed to
proceed overnight in the dark at 25.degree. C. The digested leaves
are filtered through 50 .mu.m nylon sieves into a sterile beaker.
An equal volume of cold KCl wash medium is used to wash the sieve
and pooled with the protoplast suspension. KCl wash medium
consisted of 2.0 g CaCl.sub.2.2H.sub.2O per liter and a sufficient
quantity of KCl to bring the osmolality to 540 mOsm.kg.sup.-1. The
suspension is transferred to 10 mL tubes and protoplasts are
pelleted for 10 min at 85.times.g at 4.degree. C. The supernatant
is discarded and the protoplast pellets carefully resuspended into
5 mL cold MLm wash medium, which is the macro-nutrients of MS
medium (Murashige, T. and Skoog, F., Physiologia Plantarum, 15:
473-497, 1962) at half the normal concentration, 2.2 g of
CaCl.sub.2.2H.sub.2O per liter and a quantity of mannitol to bring
the osmolality to 540 mOsm.kg.sup.-1. The content of 2 tubes is
combined and centrifuged for 10 min at 85.times.g at 4.degree. C.
The supernatant is discarded and the protoplast pellets carefully
resuspended into 5 mL cold MLs wash medium which is MLm medium with
mannitol replaced by sucrose.
[0025] The content of 2 tubes is pooled and 1 mL of KCl wash medium
added above the sucrose solution care being taken not to disturb
the lower phase. Protoplasts are centrifuged for 10 min at
85.times.g at 4.degree. C. The interphase between the sucrose and
the KCl solutions containing the live protoplasts is carefully
collected. An equal volume of KCl wash medium is added and
carefully mixed. The protoplast density is measured with a
haemocytometer.
PEG Transformation
[0026] The protoplast suspension is centrifuged at 85.times.g for
10 minutes at 5.degree. C. The supernatant is discarded and the
protoplast pellet resuspended to a final concentration of
10.sup.6.mL.sup.-1 in KCl wash medium. In a 10 mL tube, 250 .mu.L
of protoplast suspension, 1.6 nmoles of ss mutagenic nucleobase and
250 .mu.l of PEG solution are gently but thoroughly mixed. After 20
min. incubation at room temperature, 5 mL cold 0.275 M
Ca(NO.sub.3).sub.2 are added dropwise. The protoplast suspension is
centrifuged for 10 min at 85.times.g at 4.degree. C. The
supernatant is discarded and the protoplast pellet carefully
resuspended in 1.25 mL T.sub.0 culture medium supplemented with 50
.mu.gmL.sup.-1 cefotaxime and 50 .mu.gmL.sup.-1 vancomycin. ss
mutagenic nucleobase culture medium contained (per liter, pH 5.7)
950 mg KNO.sub.3, 825 mg NH.sub.4NO.sub.3, 220 mg
CaCl.sub.2.2H.sub.2O, 185 mg MgSO.sub.4.7H.sub.2O, 85 mg
KH.sub.2PO.sub.4, 27.85 mg FeSO.sub.4.7H.sub.2O, 37.25 mg
Na.sub.2EDTA.2H.sub.2O, the micro-nutrients according to Heller's
medium (Heller, R., Ann Sci Nat Bot Biol Veg 14: 1-223, 1953),
vitamins according to Morel and Wetmore's medium (Morel, G. and R.
H. Wetmore, Amer. J. Bot. 38: 138-40, 1951), 2% (w/v) sucrose, 3 mg
naphthalene acetic acid, 1 mg 6-benzylaminopurine and a quantity of
mannitol to bring the osmolality to 540 mOsm.kg.sup.-1. The
suspension is transferred to a 35 mm Petri dish. An equal volume of
T.sub.0 agarose medium is added and gently mixed. Samples are
incubated at 25.degree. C. in the dark and further cultivated as
described below.
Electroporation
[0027] The protoplasts are centrifuged at 85.times.g for 10 minutes
at 5.degree. C. The supernatant is discarded and the pellet
resuspended in ice-cold electroporation buffer consisting of 10 mM
HEPES, 80 mM NaCl, 0.04 mM CaCl.sub.2), 0.4M mannitol, pH 5.7
adjusted to 540 mOsmKg.sup.-1 with mannitol to a final
concentration of 10.sup.6 mL.sup.-1. Protoplasts are kept on ice
throughout the entire procedure. To a 0.4 cm wide electroporation
cuvette, 4.5 nmoles ss mutagenic nucleobase and 700 .mu.L of
protoplast suspension are added. A single exponential decay pulse
is delivered to the cell suspension using a Biorad GenePulser XCell
electroporation system equipped with a PC and CE module according
to the following parameters:
TABLE-US-00001 Field strength 500 V.cm-1 Capacitance 950 .mu.F
[0028] Under these conditions, the sample resistance is
approximately 30 ohms and the resulting time constant approximately
30 ms. These parameters were selected as the parameters giving the
highest level of transient expression of GFP in tobacco
protoplasts, 24 hrs after electroporation. After pulsing,
protoplasts are allowed to recover in the cuvette at room
temperature for 30 min. The protoplasts are then recovered in 1 mL
T.sub.0 culture medium and transferred to a 10 mL tube. The cuvette
is washed with an additional 5 mL T.sub.0 culture medium which is
pooled with the protoplast suspension. After thorough but gentle
mixing, 50 .mu.gmL.sup.-1 cefotaxime and 50 .mu.gmL.sup.-1
vancomycin are added, and 1.25 mL of the protoplast suspension is
transferred to a 35 mm Petri dish. An equal volume of T.sub.0
agarose medium is added and the mixture is gently homogenized.
Samples are incubated at 25.degree. C. in the dark and further
cultivated as described below.
[0029] Protoplast Cultivation
[0030] After 10 days of cultivation, the agarose slab is cut into 6
equal parts and transferred to a Petri dish containing 22.5 mL
MAP1AO medium supplemented with 20 nM chlorsulfuron. This medium
consisted of (per liter, pH 5.7) 950 mg KNO.sub.3, 825 mg
NH.sub.4NO.sub.3, 220 mg CaCl.sub.2.2H.sub.2O, 185 mg
MgSO.sub.4.7H.sub.2O, 85 mg KH.sub.2PO.sub.4, 27.85 mg
FeSO.sub.4.7H.sub.2O, 37.25 mg Na.sub.2EDTA.2H.sub.2O, the
micro-nutrients according to Murashige and Skoog's medium
(Murashige, T. and Skoog, F., Physiologia Plantarum, 15: 473-497,
1962) at one tenth of the original concentration, vitamins
according to Morel and Wetmore's medium (Morel, G. and R. H.
Wetmore, Amer. J. Bot. 38: 138-40, 1951), 6 mg pyruvate, 12 mg each
of malic acid, fumaric acid and citric acid, 3% (w/v) sucrose, 6%
(w/v) mannitol, 0.03 mg naphthalene acetic acid and 0.1 mg
6-benzylaminopurine. Samples are incubated at 25.degree. C. in low
light for 6-8 weeks. Growing calli are then transferred to MAP1
medium and allowed to develop for another 2-3 weeks. MAP.sub.1
medium has the same composition as MAP.sub.1AO medium, with however
3% (w/v) mannitol instead of 6%, and 46.2 mgl.sup.-1 histidine (pH
5.7). It was solidified with 0.8% (w/v) Difco agar. Calli are then
transferred to RP medium using sterile forceps. RP medium consisted
of (per liter, pH 5.7) 273 mg KNO.sub.3, 416 mg
Ca(NO.sub.3).sub.2.4H.sub.2O, 392 mg Mg(NO.sub.3).sub.2.6H.sub.2O,
57 mg MgSO.sub.4.7H.sub.2O, 233 mg (NH.sub.4).sub.2SO.sub.4, 271 mg
KH.sub.2PO.sub.4, 27.85 mg FeSO.sub.4.7H.sub.2O, 37.25 mg
Na.sub.2EDTA.2H.sub.2O, the micro-nutrients according to Murashige
and Skoog's medium at one fifth of the published concentration,
vitamins according to Morel and Wetmore's medium (Morel, G. and R.
H. Wetmore, Amer. J. Bot. 38: 138-40, 1951), 0.05% (w/v) sucrose,
1.8% (w/v) mannitol, 0.25 mg zeatin and 41 nM chlorsulfuron, and is
solidified with 0.8% (w/v) Difco agar. Mature shoots are
transferred to rooting medium after 2-3 weeks.
Ss Mutagenic Nucleobases
[0031] All ss mutagenic nucleobase were synthesized by Eurogentec
(Seraing, Belgium), purified by reverse phase HPLC and resuspended
into sterile milliQ water. Prior to use, ss mutagenic nucleobase
were heated up to 95.degree. C. for 5 min. ss mutagenic nucleobase
06Q262 was designed to introduce a single mismatch (nucleotide
underlined) in the tobacco ALS gene (accession number X07644) at
codon position P194 which would result in a CCA to CAA (P194Q)
conversion. The 06Q261 ss mutagenic nucleobase is the exact match
to the tobacco ALS gene sequence and serves as negative control.
The 06Q263 ss mutagenic nucleobase consists of a random combination
of 40 nucleotides and serves as negative control.
TABLE-US-00002 06Q261 [SEQ ID 1] 5'
TCAGTACCTATCATCCTACGTTGCACTTGACCTGTTATAG 06Q262 [SEQ ID 2] 5'
TCAGTACCTATCATCCTACGTTGCACTTGACCTGTTATAG 06Q263 [SEQ ID 3] 5'
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
Protoplast Survival Per Treatment
[0032] Protoplast survival after both PEG transformation and
electroporation is assessed by esterase activity using the
fluorescent vital dye fluorescein diacetate (FDA), 24 hrs after
transformation. Two .mu.L of a 5 mgmL.sup.-1 stock FDA in acetone
are added to 1 mL of transformed protoplasts. The proportion of
fluorescing protoplasts in the entire population is counted with a
haemocytometer. Observations are carried out with a Nikon Eclipse
E600 upright epifluorescence microscope equipped with a GFP LP
(EX480/40, DM505, BA510) filter set. Excitation is provided by a
100W super high pressure mercury lamp. Images are acquired using a
DS-2MBWc CCD camera connected to a DS-U1 controller attached to a
PC running the NIS Element image acquisition/analysis software.
Results
[0033] A summary of the transformation results using both PEG
transformation and electroporation is presented in table 1. Using
PEG transformation the protoplast survival rate is significantly
higher compared to electroporation. The nature of electroporation
itself is more detrimental to protoplasts survival than PEG
transformation, resulting in a much higher recovery/survival rate
as well as a higher targeted mutagenesis efficiency. The targeted
mutagenesis efficiency is scored after incubation of the
protoplasts in the presence of chlorsulfuron.
TABLE-US-00003 TABLE 1 Comparison of PEG transformation and
electroporation with respect to protoplast survival rates.
Mutagenic PEG treatment Electroporation nucleobase Survival** (%)
Survival** (%) 06Q261 83.5 .+-. 1.8 65.9 .+-. 2.2 06Q262 82.6 .+-.
2.1 66.3 .+-. 2.6 06Q263 83.8 .+-. 2.6 64.7 .+-. 3.1
* expressed as the percentage of fluorescing protoplasts after FDA
staining in the recovered population of protoplasts.
[0034] Results are the average of 3 independent replicates
.+-.SD.
PCR Amplification of ALS and Sequencing
[0035] DNA is isolated from chlorsulfuron resistant tobacco
microcolonies using the DNeasy kit (Qiagen), and used as a template
in a PCR reaction. Conversions of the targeted codons in the
tobacco ALS gene are detected using the primers
5'GGTCAAGTGCCACGTAGGAT [SEQ ID 4] & 5'GGGTGCTTCACTTTCTGCTC [SEQ
ID 5] that amplify a 776 bp fragment of this gene, including codon
194. Nucleotide conversion in the herbicide resistant tobacco
callus is confirmed by cloning the PCR products into pCR2.1::TOPO
(Invitrogen) and sequencing individual plasmids. Tobacco contains 2
alleles of ALS (SurA and SurB). Nucleotide conversion at the P194
codon of either of these loci is sufficient to confer resistance to
chlorsulfuron. As tobacco is an allotetraploid species, there are
eight possible targets in tobacco at which THE may have occurred.
In line with this, it was necessary to sequence >10 plasmid
clones containing the PCR product to detect one with a CCA to CAA
conversion. This suggests that in each resistant callus only 1 out
of the 8 ALS alleles had undergone a targeted mutagenesis mediated
nucleotide conversion. For all the calli produced in this study, we
observed the expected CCA to CAA nucleotide conversion.
Sequence CWU 1
1
5140DNAArtificial SequenceOligonucleotide for Targeted Nucleotide
exchange 1tcagtaccta tcatcctacg ttgcacttga cctgttatag
40240DNAArtificial Sequenceoligonucletide for targeted nucleotide
exchange 2tcagtaccta tcatcctacg ttgcacttga cctgttatag
40340DNAArtificial Sequenceoligonucleotide for targeted nucleotide
exchange 3atcgatcgat cgatcgatcg atcgatcgat cgatcgatcg
40420DNAArtificial Sequenceprimer 4ggtcaagtgc cacgtaggat
20520DNAArtificial Sequenceprimer 5gggtgcttca ctttctgctc 20
* * * * *
References