U.S. patent application number 17/358333 was filed with the patent office on 2021-10-21 for use of akkermansia for treating metabolic disorders.
The applicant listed for this patent is UNIVERSITE CATHOLIQUE DE LOUVAIN, WAGENINGEN UNIVERSITEIT. Invention is credited to Clara BELZER, Patrice CANI, Willem DE VOS, Amandine EVERARD.
Application Number | 20210322489 17/358333 |
Document ID | / |
Family ID | 1000005681668 |
Filed Date | 2021-10-21 |
United States Patent
Application |
20210322489 |
Kind Code |
A1 |
CANI; Patrice ; et
al. |
October 21, 2021 |
USE OF AKKERMANSIA FOR TREATING METABOLIC DISORDERS
Abstract
The present invention relates to Akkermansia muciniphila or
fragments thereof for treating a metabolic disorder in a subject in
need thereof. The present invention also relates to a composition,
a pharmaceutical composition and a medicament comprising
Akkermansia muciniphila or fragments thereof for treating a
metabolic disorder. The present invention also relates to the use
of Akkermansia muciniphila or fragments thereof for promoting
weight loss in a subject in need thereof.
Inventors: |
CANI; Patrice; (Bruxelles,
BE) ; EVERARD; Amandine; (Ottignies, BE) ;
BELZER; Clara; (Wageningen, NL) ; DE VOS; Willem;
(Ede, NL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITE CATHOLIQUE DE LOUVAIN
WAGENINGEN UNIVERSITEIT |
Louvain la Neuve
Wageningen |
|
BE
NL |
|
|
Family ID: |
1000005681668 |
Appl. No.: |
17/358333 |
Filed: |
June 25, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14443829 |
May 19, 2015 |
|
|
|
PCT/EP2013/073972 |
Nov 15, 2013 |
|
|
|
17358333 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 35/74 20130101;
A61K 35/741 20130101; A61K 9/0053 20130101; Y02A 50/30
20180101 |
International
Class: |
A61K 35/74 20060101
A61K035/74; A61K 35/741 20060101 A61K035/741; A61K 9/00 20060101
A61K009/00 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 19, 2012 |
EP |
PCT/EP2012/073011 |
Claims
1. A method for treating cancer in a subject in need thereof, the
method comprising administering Akkermansia muciniphila or
fragments thereof to the subject.
2-5. (canceled)
6. The method of claim 1, wherein viable cells of Akkermansia
muciniphila are administered to the subject in need thereof.
7. The method of claim 1, wherein the Akkermansia muciniphila is
orally administered.
8. The method of claim 1, wherein an amount of Akkermansia
muciniphila ranging from about 1.10.sup.4 to about 1.10.sup.12 cfu,
from about 1.10.sup.5 to about 1.10.sup.11 cfu, or from about
1.10.sup.6 to about 1.10.sup.10 cfu is administered to the
subject.
9. The method of claim 1, wherein the Akkermansia muciniphila is
administered at least three times a week.
10. The method of claim 1, wherein the Akkermansia muciniphila is
co-administered with another probiotic strain and/or with one or
more prebiotics.
11. The method of claim 1, wherein the Akkermansia muciniphila is
administered as a composition in association with an excipient.
12. The method of claim 11, wherein said composition is a
nutritional composition.
13. The method of claim 11, wherein said composition is orally
administered.
14. The method of claim 1, wherein the Akkermansia muciniphila is
administered as a pharmaceutical composition comprising a
pharmaceutically acceptable vehicle.
15-17. (canceled)
18. A method for treating cancer in a subject in need thereof, the
method comprising orally administering a composition comprising a
therapeutically effective amount of bacteria comprising
substantially purified Akkermansia to the subject, wherein the
substantially purified Akkermansia comprises at least 50% of a
strain of Akkermansia.
19. The method of claim 18, wherein the substantially purified
Akkermansia is co-administered with another probiotic strain and/or
with one or more prebiotics.
20. The method of claim 18, wherein the bacteria comprise a mixture
of bacterial strains in which at least 50% of the bacterial strains
in the composition are Verrucomicrobia, Bacteroidetes, Firmicutes,
or Proteobacteria.
21. The method of claim 19, wherein the one or more prebiotics
comprises a fructooligosaccharide, a glucooligosaccharide, a
xylooligosaccharide, a galactooligosaccharide, an arabinoxylan, an
arabinogalactan, a galactomannan, a polydextrose, an oligofructose,
an inulin, a derivative thereof, or a combination thereof.
22. The method of claim 18, wherein the composition further
comprises a coating, wherein the coating does not begin to degrade
until after it exits a stomach of the subject.
23. The method of claim 18, wherein the relative abundance of the
Akkermansia strain in the subject is increased by at least 5%.
24. The method of claim 18, wherein the Akkermansia is
lyophilized.
25. The method of claim 18, wherein the composition is administered
in one or more doses per day.
26. The method of claim 18, wherein the composition is administered
at a dose of from about 0.001 to about 100 mg/kg body weight of the
subject, about 0.01 to about 50 mg/kg body weight of the subject,
or about 0.05 to about 10 mg/kg body weight of the subject.
27. A method for treating cancer in a subject in need thereof, the
method comprising administering a pharmaceutical composition
comprising: a therapeutically effective amount of a substantially
purified Akkermansia, wherein the substantially purified
Akkermansia comprises at least 50% of a strain of Akkermansia; a
prebiotic; and a pharmaceutically acceptable carrier, wherein the
pharmaceutical composition is formulated for oral delivery and
encapsulated by a coating, and wherein the coating does not fully
degrade until after it exits the stomach of a subject.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Nonprovisional
patent application Ser. No. 14/443,829, filed May 19, 2015, which
is a 35 U.S.C. .sctn. 371 U.S. national stage entry of
International Patent Application No. PCT/EP2013/073972, filed Nov.
15, 2013, which claims priority to PCT/EP2012/073011, filed Nov.
19, 2012.
FIELD OF INVENTION
[0002] The present invention relates to the treatment of metabolic
disorders, such as, for example, metabolic disorders related to
overweight and obesity, such as, for example, Diabetes Mellitus or
high cholesterol. The present invention more specifically relates
to a composition comprising Akkermansia spp or fragments thereof
for treating a metabolic disorder.
BACKGROUND OF INVENTION
[0003] Obesity is a worldwide problem, with an estimated number of
obese adults of about 250 million. This epidemic of obesity is
correlated with a great increase in the prevalence of
obesity-related disorders, such as, for example, Diabetes,
hypertension, cardiac pathologies and liver diseases. Due to these
highly disabling pathologies, obesity is currently considered in
western countries as one of the most important public health
problem. There is thus a real need of compositions and methods for
treating or preventing obesity and/or obesity-related
disorders.
[0004] Obesity and obesity-related diseases are associated with (i)
metabolic dysfunctions (with an impact on glucose homeostasis and
lipid metabolism for example); (ii) low grade inflammatory state
associated to higher blood lipopolysaccharides (LPS) levels (also
referred as metabolic endotoxemia); and (iii) impaired gut barrier
function (i.e. increased gut permeability). In order to treat
obesity, impact on at least one, preferably 2 and more preferably 3
of these 3 factors is thus needed.
[0005] The human gut is colonized by a diverse, complex and dynamic
community of microbes representing over 1000 different species,
which continuously interact with the host (Zoetendal,
Rajilic-Stojanovic and de Vos, Gut 2008, 57: 1605-1615). The
homeostasis of the gut microbiota is dependent on host
characteristics (age, gender, genetic background . . . ) and
environmental conditions (stress, drugs, gastrointestinal surgery,
infectious and toxic agents . . . ), but also on the day-to-day
dietary changes. Growing evidences support the role of gut
microbiota in the development of obesity and related disorders
(Delzenne & Cani, Annu. Rev. Nutr. 2011, 31: 15-31).
[0006] Therefore, treatment with products that target the gut
microbiota appeared as promising therapeutic tools for treating
obesity and related disorders. These products may consist of living
microbes, such as in the case of most probiotics, or contain dead
microbes or fragments thereof. In addition, these products may
comprise substrates that are used by the gut microbiota, such as in
the case of prebiotics, or contain compounds that change the
balance of the intestinal microbiota, such as specific
antimicrobial compounds.
[0007] For example, WO 2008/076696 describes the gut microbiota as
a therapeutic target for treating obesity and related disorders. WO
2008/076696 specifically describes methods for altering the
abundance of Bacteroides and/or Firmicutes in the gut of a subject,
by administering antibiotics and/or probiotics to the subject.
[0008] Moreover, EP 2 030 623 relates to the prevention and/or
treatment of metabolic disorders, such as, for example, obesity
related disorders, by regulating the amount of Enterobacteria in
the gut. EP 2 030 623 discloses reducing the amount of
Enterobacteria in the gut by administering probiotic bacteria, such
as, for example, Bifidobacterium, Lactococcus, Streptococcus,
Enterococcus or Lactobacillus.
[0009] Furthermore, the Applicant described that the gut microbiota
is modified in prebiotic-treated obese mice (Everard et al.,
Diabetes, 2011 November;60(11):2775-86). Moreover, prebiotics (1)
improve glucose and lipid metabolisms in obese mice, (2) reduce
plasma LPS and improve gut barrier function (e.g. reduction of
inflammation) in obese mice, (3) induce an increased
enteroendocrine L-cell number in obese mice, and (4) improve leptin
sensitivity and glucose homeostasy in diet-induced obese and
diabetic mice.
[0010] Among the modification induced by prebiotic treatment of
obese mice is a considerable alteration of the gut microbiota
composition, characterized by (i) a decreased abundance of
Bacteroidetes, Lactobacillus spp and bacteria of the
Bacteroides-Prevotella group; and (ii) an increased abundance of
Bifidobacterium spp., of bacteria of the E. rectale/C. coccoides
group and of Akkermansia muciniphila, belonging to the
Verrucomicrobia. A. muciniphila, a bacteria firstly identified in
2004 by the Applicant, represents approximately 1 to 3% of the
total microbiota of healthy adults (Derrien et al, International
Journal of Systematic and Evolutionary Microbiology, 2004,
54:1469-1476; Derrien et al Applied Environmental Microbiology
2008, 74, 1646-1648.).
[0011] Indirect evidences suggested a relationship between the
abundance of A. muciniphila and intestinal dysfunctions or
obesity-related disorders. For example, WO 2011/107481 describes
that the absence of Akkermansia muciniphila in the gut of a
subject, combined with the presence of Bacteroides capillosus and
Clostridium leptum indicates that this subject is suffering from
ulcerative colitis. Moreover, Hansen and colleagues showed that the
administration of an antibiotic, Vancomycin, to neonatal NOD mice
(the NOD mouse model is a model for Diabetes) suppresses clinical
onset of Diabetes and propagates Akkermansia muciniphila (Hansen et
al., Diabetologia, 2012 August;55(8):2285-94). However, this may be
an indirect effect due to the insensitivity of intestinal
Akkermansia spp. to the used antibiotic.
[0012] These results thus showed that the complete composition of
the gut microbiota is modified following the administration of
prebiotic in mice. More specifically, no evidence suggested a
specific role of one bacterial species, such as, for example,
Akkermansia muciniphila, in the beneficial response to prebiotics
administration. Moreover, to the Applicant knowledge, no beneficial
effect of the direct administration of Akkermansia muciniphila has
never been described, nor suggested.
[0013] Here, the Applicant surprisingly showed that repeated
administration of Akkermansia muciniphila alone impacts the three
underlying dysfunctions associated with obesity and related
disorders, i.e. metabolic dysfunctions, low grade inflammatory
state associated to higher blood lipopolysaccharides (LPS) levels
and impaired gut barrier function. The present invention thus
relates to the use of Akkermansia muciniphila or fragments thereof
for treating obesity and related disorders.
SUMMARY
[0014] The present invention thus relates to Akkermansia
muciniphila or fragments thereof for treating, or for use in
treating, a metabolic disorder in a subject in need thereof. In one
embodiment of the invention, said metabolic disorder is obesity. In
another embodiment of the invention, said metabolic disorder is
selected from the group comprising metabolic syndrome,
insulin-deficiency or insulin-resistance related disorders,
Diabetes Mellitus (such as, for example, Type 2 Diabetes), glucose
intolerance, abnormal lipid metabolism, atherosclerosis,
hypertension, cardiac pathology, stroke, non-alcoholic fatty liver
disease, hyperglycemia, hepatic steatosis, dyslipidemia,
dysfunction of the immune system associated with overweight and
obesity, cardiovascular diseases, high cholesterol, elevated
triglycerides, asthma, sleep apnea, osteoarthritis,
neuro-degeneration, gallbladder disease, syndrome X, inflammatory
and immune disorders, atherogenic dyslipidemia and cancer.
[0015] The present invention also relates to Akkermansia
muciniphila or fragments thereof for increasing energy expenditure
of a subject, preferably without impacting the food intake of said
subject. The present invention also relates to Akkermansia
muciniphila or fragments thereof for increasing satiety in a
subject.
[0016] In one embodiment of the invention, viable cells of
Akkermansia muciniphila are administered to the subject in need
thereof.
[0017] In one embodiment of the invention, Akkermansia muciniphila
is orally administered.
[0018] In one embodiment of the invention, an amount of Akkermansia
muciniphila ranging from about 1.10.sup.2 to about 1.10.sup.15 cfu,
preferably from about 1.10.sup.4 to about 1.10.sup.12 cfu, more
preferably from about 1.10.sup.5 to about 1.10.sup.10 cfu, and even
more preferably from about 1.10.sup.6 to about 1.10.sup.9 cfu is
administered to the subject. In another embodiment of the
invention, an amount of Akkermansia muciniphila ranging from about
1.10.sup.4 to about 1.10.sup.12 cfu, more preferably from about
1.10.sup.5 to about 1.10.sup.11 cfu, and even more preferably from
about 1.10.sup.6 to about 1.10.sup.10 cfu is administered to the
subject.
[0019] In one embodiment of the invention, Akkermansia muciniphila
is administered at least once a day. In one embodiment of the
invention, Akkermansia muciniphila is administered at least three
times a week. In another embodiment of the invention, Akkermansia
muciniphila is administered at least once a week.
[0020] In one embodiment of the invention, Akkermansia muciniphila
is co-administered with another probiotic strain and/or with one or
more prebiotics.
[0021] Another object of the invention is a composition for
treating, or for use in treating, a metabolic disorder, or for
increasing energy expenditure or for increasing satiety in a
subject comprising Akkermansia muciniphila or fragments thereof as
described hereinabove in association with an excipient. In one
embodiment, said composition is a nutritional composition. In one
embodiment of the invention, said composition is orally
administered.
[0022] The present invention also relates to a pharmaceutical
composition for treating, or for use in treating, a metabolic
disorder or for increasing energy expenditure or for increasing
satiety in a subject comprising Akkermansia muciniphila or
fragments thereof as hereinabove described in association with a
pharmaceutically acceptable vehicle.
[0023] Another object of the present invention is a medicament for
treating, or for use in treating, a metabolic disorder or for
increasing energy expenditure or for increasing satiety in a
subject comprising Akkermansia muciniphila or fragments thereof as
hereinabove described.
[0024] Another object of the present invention is the use of
Akkermansia muciniphila or fragments thereof for promoting weight
loss in a subject in need thereof.
[0025] The present invention also relates to a cosmetic composition
comprising Akkermansia muciniphila or fragments thereof for
promoting weight loss in a subject in need thereof.
Definitions
[0026] In the present invention, the following terms have the
following meanings: [0027] "Treatment" means preventing (i.e.
keeping from happening), reducing or alleviating at least one
adverse effect or symptom of a disease, disorder or condition. This
term thus refers to both therapeutic treatment and prophylactic or
preventative measures;
[0028] wherein the object is to prevent or slow down (lessen) the
targeted pathologic condition or disorder. In one embodiment of the
invention, those in need of treatment include those already with
the disorder as well as those prone to have the disorder or those
in whom the disorder is to be prevented. [0029] "Effective amount"
refers to level or amount of agent that is aimed at, without
causing significant negative or adverse side effects to the target,
(1) delaying or preventing the onset of a metabolic disorder; (2)
slowing down or stopping the progression, aggravation, or
deterioration of one or more symptoms of the metabolic disorder;
(3) bringing about ameliorations of the symptoms of the metabolic
disorder; (4) reducing the severity or incidence of the metabolic
disorder; (5) curing the metabolic disorder; or (6) restoring the
normal amount and/or proportion of Akkermansia muciniphila in the
gut of the subject to be treated. An effective amount may be
administered prior to the onset of a metabolic disorder, for a
prophylactic or preventive action. Alternatively or additionally,
the effective amount may be administered after initiation of the
metabolic disorder, for a therapeutic action. [0030] "Akkermansia
muciniphila" refers to the strictly anaerobic mucin-degrading
bacteria identified by Derrien (Derrien et al, International
Journal of Systematic and Evolutionary Microbiology, 2004,
54:1469-1476). Cells are oval-shaped, non-motile and stain
Gram-negative. Akkermansia muciniphila may also be referred as
Akkermansia spp. or Akkermansia-like bacteria. It belongs to the
Chlamydiae/Verrucomicrobia group; Verrucomicrobia phylum. If the
taxonomy should change, the skilled artisan would know how to adapt
the changes in the taxonomy to deduce the strains that could be
used in the present invention. Moreover, the complete genome of
Akkermansia muciniphila has been determined by the Applicant (van
Passel et al, PLoS One 6, 2011: e16876). It is generally accepted
that strains with a genome similarity of about 70% can be
considered as the same species. [0031] "Probiotics" refers to
microbial cell preparations (such as, for example, living microbial
cells) or components of microbial cells which, when administered in
an effective amount, provide a beneficial effect on the health or
well-being of a subject. By definition, all probiotics have a
proven non-pathogenic character. In one embodiment, these health
benefits are associated with improving the balance of human or
animal microbiota in the gastro-intestinal tract, and/or restoring
normal microbiota. [0032] "Prebiotic" refers to a substance, such
as, for example, a food substance, which may not be digested by
humans, but which may be used by bacteria of the gut microbiota and
which is intended to promote the growth of probiotic bacteria in
the intestine. [0033] "Overweight" refers to a subject situation
wherein said subject has a Body Mass Index (BMI) ranging from 25 to
30. As used herein, BMI is defined as the individual's body mass
(in kg) divided by the square of his/her height (in meter).
"Obesity" refers to a subject situation wherein said subject has a
BMI superior or equal to 30. [0034] "Subject" refers to an animal,
preferably a mammal, more preferably a human. In one embodiment,
the subject is a male. In another embodiment, the subject is a
female. In one embodiment of the invention, a subject may also
refer to a pet, such as, for example, a dog, a cat, a guinea pig, a
hamster, a rat, a mouse, a ferret, a rabbit and the like. [0035]
"About" preceding a figure means plus or less 20%, preferably 10%
of the value of said figure. [0036] "Fragment" may refer to
cellular components, metabolites, secreted molecules and compounds
resulting from the metabolism of Akkermansia muciniphila and the
like. Fragments may be obtained, for example, by recovering the
supernatant of a culture of Akkermansia muciniphila or by
extracting cell components or cell fractions, metabolites or
secreted compounds from a culture of Akkermansia muciniphila. The
term fragment may also refer to a degradation product. A fragment
may correspond to a component in the isolated form or to any
mixture of one or more components derived from Akkermansia
muciniphila. In one embodiment, a fragment may correspond to one or
more of such a components present in Akkermansia muciniphila that
is produced in another way, such as using recombinant DNA
technology, in a microbial host or in any other (bio)synthetic
process. [0037] "Metabolic disorder" refers to disorders, diseases
and conditions caused or characterized by abnormal weight gain,
energy use or consumption, altered responses to ingested or
endogenous nutrients, energy sources, hormones or other signaling
molecules within the body or altered metabolism of carbohydrates,
lipids, proteins, nucleic acids or a combination thereof. A
metabolic disorder may be associated with either a deficiency or an
excess in a metabolic pathway resulting in an imbalance in
metabolism of carbohydrates, lipids, proteins and/or nucleic acids.
Examples of metabolic disorders include, but are not limited to,
metabolic syndrome, insulin-deficiency or insulin-resistance
related disorders, Diabetes Mellitus (such as, for example, Type 2
Diabetes), glucose intolerance, abnormal lipid metabolism,
atherosclerosis, hypertension, cardiac pathology, stroke,
non-alcoholic fatty liver disease, hyperglycemia, hepatic
steatosis, dyslipidemia, dysfunction of the immune system
associated with overweight and obesity, cardiovascular diseases,
high cholesterol, elevated triglycerides, asthma, sleep apnea,
osteoarthritis, neuro-degeneration, gallbladder disease, syndrome
X, inflammatory and immune disorders, atherogenic dyslipidemia and
cancer.
DETAILED DESCRIPTION
[0038] This invention relates to Akkermansia muciniphila or a
fragment thereof for treating, or for use in treating, metabolic
disorders in a subject in need thereof.
[0039] As used herein, a metabolic disorder is a disorder related
to an altered metabolic homeostasis, such as, for example, an
altered glycidic or lipidic homeostasis.
[0040] In one embodiment of the invention, said metabolic disorder
is obesity.
[0041] Examples of other metabolic disorders include, but are not
limited to, metabolic syndrome, insulin-deficiency or
insulin-resistance related disorders, Diabetes Mellitus (such as,
for example, Type 2 Diabetes), glucose intolerance, abnormal lipid
metabolism, atherosclerosis, hypertension, cardiac pathology,
stroke, non-alcoholic fatty liver disease, hyperglycemia, hepatic
steatosis, dyslipidemia, dysfunction of the immune system
associated with overweight and obesity, cardiovascular diseases,
high cholesterol, elevated triglycerides, asthma, sleep apnea,
osteoarthritis, neuro-degeneration, gallbladder disease, syndrome
X, inflammatory and immune disorders, atherogenic dyslipidemia and
cancer.
[0042] In another embodiment, said metabolic disorder is an
overweight and/or obesity related metabolic disorder, i.e. a
metabolic disorder that may be associated to or caused by
overweight and/or obesity. Examples of overweight and/or obesity
related metabolic disorder include, but are not limited to
metabolic syndrome, insulin-deficiency or insulin-resistance
related disorders, Diabetes Mellitus (such as, for example, Type 2
Diabetes), glucose intolerance, abnormal lipid metabolism,
atherosclerosis, hypertension, cardiac pathology, stroke,
non-alcoholic fatty liver disease, hyperglycemia, hepatic
steatosis, dyslipidemia, dysfunction of the immune system
associated with overweight and obesity, cardiovascular diseases,
high cholesterol, elevated triglycerides, asthma, sleep apnea,
osteoarthritis, neuro-degeneration, gallbladder disease, syndrome
X, inflammatory and immune disorders, atherogenic dyslipidemia and
cancer.
[0043] In one embodiment, said metabolic disorder is Diabetes
Mellitus, preferably Type 2 Diabetes. In another embodiment, said
metabolic disorder is hypercholesterolemia (also known as high
cholesterol). In one embodiment, hypercholesterolemia corresponds
to a plasma cholesterol concentration superior or equal to 2 g/L or
5 mmol/L. In another embodiment, hypercholesterolemia corresponds
to a ratio plasma concentration of total cholesterol: plasma
concentration of HDL (high density lipoprotein cholesterol)
superior or equal to 4.5:1, preferably 5:1.
[0044] In one embodiment of the invention, living strains of
Akkermansia muciniphila are used in the present invention,
preferably the living strains are derived from cells in stationary
phase of growth.
[0045] In one embodiment of the invention, Akkermansia muciniphila
may be in the form of viable cells. In another embodiment of the
invention, Akkermansia muciniphila may be in the form of non-viable
cells.
[0046] In one embodiment, metabolically active Akkermansia
muciniphila cells are used in the present invention. In one
embodiment, strains of Akkermansia muciniphila are not
metabolically inactivated, wherein metabolic inactivation may
result, for example, from autoclave treatment.
[0047] In one embodiment, Akkermansia muciniphila or fragment
thereof is substantially purified. As used herein, the term
"substantially purified" means that Akkermansia muciniphila or
fragment thereof is comprised in a sample wherein it represents at
least about 50%, preferably at least about 60, 70, 80, 85, 90, 95,
99% or more of the bacterial strains or fragment thereof of said
sample.
[0048] The present invention also relate to a composition
comprising an effective amount of Akkermansia muciniphila or a
fragment thereof for treating, or for use in treating, a metabolic
disorder.
[0049] In one embodiment of the invention, the effective amount of
Akkermansia muciniphila corresponds to the amount of the bacteria
sufficient for restoring a normal amount and/or proportion of
Akkermansia muciniphila within the gut of the subject. Indeed, the
Applicant showed that the gut of obese or overweight subject is
depleted in Akkermansia muciniphila (see Examples). In one
embodiment of the invention, the normal amount and/or proportion of
Akkermansia muciniphila corresponds to the amount, and/or to the
proportion of Akkermansia muciniphila present in the gut of a
healthy subject.
[0050] As used herein, the term "healthy subject" is used to define
a subject which is not affected by the disease to be treated. For
example, if Akkermansia muciniphila or a fragment thereof is used
for treating obesity, the healthy subject is not affected by
obesity. Preferably, the healthy subject shares common
characteristics with the subject to be treated, such as, for
example, same gender, age, sex, diet, drugs intake or
geolocation.
[0051] In one embodiment of the invention, the normal proportion of
Akkermansia muciniphila in the gut ranges from about 0.1% to about
10% (in number of Akkermansia muciniphila cells to the total number
of bacteria cells of the gut), preferably from about 0.3% to about
5%, more preferably from about 1% to about 3%.
[0052] In one embodiment of the invention, the effective amount of
Akkermansia muciniphila ranges from about 1.10.sup.2 to about
1.10.sup.15 cfu, preferably from about 1.10.sup.4 to about
1.10.sup.12 cfu, more preferably from about 1.10.sup.5 to about
1.10.sup.10 cfu, and even more preferably from about 1.10.sup.6 to
about 1.10.sup.9 cfu, wherein cfu stands for "colony forming
unit".
[0053] In another embodiment of the invention, the effective amount
of Akkermansia muciniphila ranges from about 1.10.sup.6 to about
1.10.sup.10 cfu, preferably from about 1.10.sup.8 to about
1.10.sup.10 cfu, more preferably from about 1.10.sup.9 to about
1.10.sup.10 cfu.
[0054] In another embodiment of the invention, the effective amount
of Akkermansia muciniphila ranges from about 1.10.sup.6 to about
1.10.sup.10 cfu, preferably from about 1.10.sup.6 to about
1.10.sup.9 cfu, more preferably from about 1.10.sup.8 to about
1.10.sup.9 cfu.
[0055] In one embodiment of the invention, the effective amount of
a fragment of Akkermansia muciniphila ranges from fragments derived
from about 1.10.sup.2 to about 1.10.sup.15 cfu, preferably from
about 1.10.sup.4 to about 1.10.sup.12 cfu, more preferably from
about 1.10.sup.5 to about 1.10.sup.10 cfu, and even more preferably
from about 1.10.sup.6 to about 1.10.sup.9 cfu, wherein cfu stands
for "colony forming unit". In another embodiment of the invention,
the effective amount of a fragment of Akkermansia muciniphila
ranges from fragments derived from about 1.10.sup.6 to about
1.10.sup.10 cfu, preferably from about 1.10.sup.8 to about
1.10.sup.10 cfu, more preferably from about 1.10.sup.9 to about
1.10.sup.10 cfu. In another embodiment of the invention, the
effective amount of a fragment of Akkermansia muciniphila ranges
from fragments derived from about 1.10.sup.6 to about 1.10.sup.10
cfu, preferably from about 1.10.sup.6 to about 1.10.sup.9 cfu, more
preferably from about 1.10.sup.8 to about 1.10.sup.9 cfu.
[0056] In one embodiment of the invention, the composition of the
invention comprises an amount of Akkermansia muciniphila ranging
from about 1.10.sup.2 to about 1.10.sup.15 cfu/g of the
composition, preferably from about 1.10.sup.4 to about 1.10.sup.12
cfu/g of the composition, more preferably from about 1.10.sup.5 to
about 1.10.sup.10 cfu/g of the composition and even more preferably
from about 1.10.sup.6 to about 1.10.sup.9 cfu/g of the composition.
In one embodiment of the invention, the composition of the
invention comprises an amount of Akkermansia muciniphila ranging
from about 1.10.sup.2 to about 1.10.sup.15 cfu/mL of the
composition, preferably from about 1.10.sup.4 to about 1.10.sup.12
cfu/mL of the composition, more preferably from about 1.10.sup.5 to
about 1.10.sup.10 cfu/mL of the composition and even more
preferably from about 1.10.sup.6 to about 1.10.sup.9 cfu/mL of the
composition. In another embodiment of the invention, the
composition of the invention comprises an amount of Akkermansia
muciniphila ranging from about 1.10.sup.6 to about 1.10.sup.10
cfu/g or cfu/mL of the composition, preferably from about
1.10.sup.8 to about 1.10.sup.10 cfu/g or cfu/mL, more preferably
from about 1.10.sup.9 to about 1.10.sup.10 cfu/g or cfu/mL. In
another embodiment of the invention, the composition of the
invention comprises an amount of Akkermansia muciniphila ranging
from about 1.10.sup.6 to about 1.10.sup.10 cfu/g or cfu/mL of the
composition, preferably from about 1.10.sup.6 to about 1.10.sup.9
cfu/g or cfu/mL, more preferably from about 1.10.sup.8 to about
1.10.sup.9 cfu/g or cfu/mL.
[0057] In one embodiment of the invention, the composition of the
invention comprises an amount of fragments of Akkermansia
muciniphila ranging from fragments derived from about 1.10.sup.2 to
about 1.10.sup.15 cfu/g or mL of the composition, preferably from
about 1.10.sup.4 to about 1.10.sup.12 cfu/g or mL of the
composition, more preferably from about 1.10.sup.5 to about
1.10.sup.10 cfu/g or mL of the composition and even more preferably
from about 1.10.sup.6 to about 1.10.sup.9 cfu/g or mL of the
composition. In another embodiment of the invention, the
composition of the invention comprises an amount of fragments of
Akkermansia muciniphila ranging from fragments derived from about
1.10.sup.6 to about 1.10.sup.10 cfu/g or cfu/mL of the composition,
preferably from about 1.10.sup.8 to about 1.10.sup.10 cfu/g or
cfu/mL, more preferably from about 1.10.sup.9 to about 1.10.sup.10
cfu/g or cfu/mL. In another embodiment of the invention, the
composition of the invention comprises an amount of fragments of
Akkermansia muciniphila ranging from fragments derived from about
1.10.sup.6 to about 1.10.sup.10 cfu/g or cfu/mL of the composition,
preferably from about 1.10.sup.6 to about 1.10.sup.9 cfu/g or
cfu/mL, more preferably from about 1.10.sup.8 to about 1.10.sup.9
cfu/g or cfu/mL.
[0058] The present invention also relates to a pharmaceutical
composition comprising an effective amount of Akkermansia
muciniphila or a fragment thereof and at least one pharmaceutically
acceptable excipient. In one embodiment of the invention, the
pharmaceutical composition of the invention is for treating a
metabolic disorder. In another embodiment of the invention, the
pharmaceutical composition is for restoring a normal proportion of
Akkermansia muciniphila in the gut of a subject in need
thereof.
[0059] As used herein the term "pharmaceutically acceptable
excipient" refers to an excipient that does not produce an adverse,
allergic or other untoward reaction when administered to an animal,
preferably a human. It may include any and all solvents, dispersion
media, coatings, isotonic and absorption delaying agents and the
like. For human administration, preparations should meet sterility,
pyrogenicity, general safety and purity standards as required by
FDA Office of Biologics standards.
[0060] The present invention also relates to a medicament
comprising an effective amount of Akkermansia muciniphila or a
fragment thereof. In one embodiment of the invention, the
medicament of the invention is for treating a metabolic disorder.
In another embodiment of the invention, the medicament is for
restoring a normal proportion of Akkermansia muciniphila in the gut
of a subject in need thereof.
[0061] The present invention also relates to a method for treating
a metabolic disorder in a subject in need thereof, wherein said
method comprises administering an effective amount of Akkermansia
muciniphila or a fragment thereof to the subject.
[0062] Another object of the invention is a method for restoring a
normal proportion of Akkermansia muciniphila in the gut of a
subject in need thereof, wherein said method comprises
administering an effective amount of Akkermansia muciniphila or a
fragment thereof to the subject.
[0063] In one embodiment, the method of the invention comprises
administering an effective amount of the composition, of the
pharmaceutical composition or of the medicament of the invention to
the subject.
[0064] In one embodiment of the invention, Akkermansia muciniphila
or a fragment thereof, or the composition, pharmaceutical
composition or medicament is administered at least once a week,
preferably at least twice a week, more preferably at least three
times a week, and even more preferably three times a week. In
another embodiment, Akkermansia muciniphila or a fragment thereof,
or the composition, pharmaceutical composition or medicament is
administered at least once a day, and preferably at least twice a
day.
[0065] In one embodiment, Akkermansia muciniphila or a fragment
thereof, or the composition, pharmaceutical composition or
medicament of the invention is administered during 1 week,
preferably during 2, 3, 4, 5, 6, 7 or 8 weeks or more.
[0066] In one embodiment, Akkermansia muciniphila or a fragment
thereof, or the composition, pharmaceutical composition or
medicament of the invention is administered for a period that lasts
until the desired outcome is achieved (e.g. weight loss, metabolic
disorder treatment, decrease of cholesterol plasma level . . .
).
[0067] In one embodiment, the administration of Akkermansia
muciniphila or a fragment thereof, or the composition,
pharmaceutical composition or medicament of the invention is
permanent, i.e. is not limited in time.
[0068] In one embodiment of the invention, the daily amount of
Akkermansia muciniphila administered per day ranges from 1.10.sup.2
to about 1.10.sup.15 cfu/day, preferably from about 1.10.sup.4 to
about 1.10.sup.12 cfu/day, more preferably from about 1.10.sup.5 to
about 1.10.sup.10 cfu/day and even more preferably from about
1.10.sup.6 to about 1.10.sup.9 cfu/day.
[0069] In another embodiment of the invention, the daily amount of
Akkermansia muciniphila administered per day ranges from 1.10.sup.6
to about 1.10.sup.10 cfu/day, preferably from about 1.10.sup.8 to
about 1.10.sup.10 cfu/day, more preferably from about 1.10.sup.9 to
about 1.10.sup.10 cfu/day.
[0070] In another embodiment of the invention, the daily amount of
Akkermansia muciniphila administered per day ranges from 1.10.sup.6
to about 1.10.sup.10 cfu/day, preferably from about 1.10.sup.6 to
about 1.10.sup.9 cfu/day, more preferably from about 1.10.sup.8 to
about 1.10.sup.9 cfu/day.
[0071] In one embodiment of the invention, the daily amount of
fragments of Akkermansia muciniphila administered per day ranges
from fragments derived from 1.10.sup.2 to about 1.10.sup.15
cfu/day, preferably from about 1.10.sup.4 to about 1.10.sup.12
cfu/day, more preferably from about 1.10.sup.5 to about 1.10.sup.10
cfu/day and even more preferably from about 1.10.sup.6 to about
1.10.sup.9 cfu/day. In another embodiment of the invention, the
daily amount of fragments of Akkermansia muciniphila administered
per day ranges from fragments derived from 1.10.sup.6 to about
1.10.sup.10 cfu/day, preferably from about 1.10.sup.8 to about
1.10.sup.10 cfu/day, more preferably from about 1.10.sup.9 to about
1.10.sup.10 cfu/day. In another embodiment of the invention, the
daily amount of fragments of Akkermansia muciniphila administered
per day ranges from fragments derived from 1.10.sup.6 to about
1.10.sup.10 cfu/day, preferably from about 1.10.sup.6 to about
1.10.sup.9 cfu/day, more preferably from about 1.10.sup.8 to about
1.10.sup.9 cfu/day.
[0072] In one embodiment of the invention, the subject is
overweight. In another embodiment, the subject is obese.
[0073] In one embodiment of the invention, the subject is diagnosed
with a metabolic disorder, such as, for example, with an overweight
and/or obesity related metabolic disorder.
[0074] In another embodiment, the subject is at risk of developing
a metabolic disorder, such as, for example, an overweight and/or
obesity related metabolic disorder. In one embodiment, said risk is
related to the fact that the subject is overweight or obese. In
another embodiment, said risk corresponds to a predisposition, such
as, for example, a familial predisposition to a metabolic disorder,
such as, for example, to an overweight and/or obesity related
metabolic disorder.
[0075] In one embodiment of the invention, the subject presents a
deregulation of the gut microbiota composition. Preferably, the gut
microbiota of said subject is depleted in Akkermansia muciniphila
strains. In one embodiment, the proportion of Akkermansia
muciniphila in the gut of the subject is inferior to 1%, preferably
inferior to 0.5%, more preferably inferior to 0.1%, in number of
Akkermansia muciniphila cells to the total number of bacterial
cells in the gut.
[0076] The present invention also relates to the cosmetic use of
Akkermansia muciniphila or a fragment thereof for promoting weight
loss in a subject.
[0077] Another object of the invention is thus a cosmetic
composition comprising a cosmetically effective amount of
Akkermansia muciniphila or a fragment thereof, and the use thereof
for promoting weight loss in a subject. As used herein, a
"cosmetically effective amount" refers to the amount of a cosmetic
composition necessary and sufficient for promoting a cosmetic
effect, such as, for example, for inducing weight loss in a
subject.
[0078] The present invention also relates to a method for promoting
weight loss in a subject in need thereof, wherein said method
comprises administering a cosmetically effective amount of
Akkermansia muciniphila or a fragment thereof to said subject.
[0079] In one embodiment, the method of the invention comprises
administering a cosmetically effective amount of the composition or
of the cosmetic composition of the invention to the subject.
[0080] In one embodiment of the invention, the cosmetically
effective amount of Akkermansia muciniphila ranges from about
1.10.sup.2 to about 1.10.sup.15 cfu, preferably from about
1.10.sup.4 to about 1.10.sup.12 cfu, more preferably from about
1.10.sup.5 to about 1.10.sup.10 cfu and even more preferably from
about 1.10.sup.6 to about 1.10.sup.9 cfu. In another embodiment of
the invention, the cosmetically effective amount of Akkermansia
muciniphila ranges from about 1.10.sup.6 to about 1.10.sup.10 cfu,
preferably from about 1.10.sup.8 to about 1.10.sup.10 cfu, more
preferably from about 1.10.sup.9 to about 1.10.sup.10 cfu. In
another embodiment of the invention, the cosmetically effective
amount of Akkermansia muciniphila ranges from about 1.10.sup.6 to
about 1.10.sup.10 cfu, preferably from about 1.10.sup.6 to about
1.10.sup.9 cfu, more preferably from about 1.10.sup.8 to about
1.10.sup.9 cfu.
[0081] In one embodiment of the invention, the cosmetically
effective amount of fragments of Akkermansia muciniphila ranges
from fragments derived from about 1.10.sup.2 to about 1.10.sup.15
cfu, preferably from about 1.10.sup.4 to about 1.10.sup.12 cfu,
more preferably from about 1.10.sup.5 to about 1.10.sup.10 cfu and
even more preferably from about 1.10.sup.6 to about 1.10.sup.9 cfu.
In another embodiment of the invention, the cosmetically effective
amount of fragments of Akkermansia muciniphila ranges from
fragments derived from about 1.10.sup.6 to about 1.10.sup.10 cfu,
preferably from about 1.10.sup.8 to about 1.10.sup.10 cfu, more
preferably from about 1.10.sup.9 to about 1.10.sup.10 cfu. In
another embodiment of the invention, the cosmetically effective
amount of fragments of Akkermansia muciniphila ranges from
fragments derived from about 1.10.sup.6 to about 1.10.sup.10 cfu,
preferably from about 1.10.sup.6 to about 1.10.sup.9 cfu, more
preferably from about 1.10.sup.8 to about 1.10.sup.9 cfu.
[0082] In one embodiment of the invention, Akkermansia muciniphila
or a fragment thereof, or the composition or cosmetic composition
is administered at least once a week, preferably at least twice a
week, more preferably at least three times a week, and even more
preferably three times a week. In another embodiment, Akkermansia
muciniphila or a fragment thereof, or the composition or cosmetic
composition is administered at least once a day, and preferably at
least twice a day.
[0083] In one embodiment, Akkermansia muciniphila or a fragment
thereof, or the composition or cosmetic composition of the
invention is administered during 1 week, preferably 2, 3, 4, 5, 6,
7 or 8 weeks or more.
[0084] In one embodiment, Akkermansia muciniphila or a fragment
thereof, or the composition or cosmetic composition of the
invention is administered for a period that lasts until the desired
outcome is achieved (e.g. weight loss . . . ).
[0085] In one embodiment, the administration of Akkermansia
muciniphila or a fragment thereof, or the composition or cosmetic
composition of the invention is permanent, i.e. is not limited in
time.
[0086] In one embodiment of the invention, the daily amount of
Akkermansia muciniphila administered per day ranges from 1.10.sup.2
to about 1.10.sup.15 cfu/day, preferably from about 1.10.sup.5 to
about 1.10.sup.12 cfu/day, more preferably from about 1.10.sup.8 to
about 1.10.sup.10 cfu/day, and even more preferably from about
1.10.sup.9 to about 1.10.sup.10 cfu/day. In another embodiment of
the invention, the daily amount of Akkermansia muciniphila
administered per day ranges from 1.10.sup.6 to about 1.10.sup.10
cfu/day, preferably from about 1.10.sup.8 to about 1.10.sup.10
cfu/day, more preferably from about 1.10.sup.9 to about 1.10.sup.10
cfu/day. In another embodiment of the invention, the daily amount
of Akkermansia muciniphila administered per day ranges from
1.10.sup.6 to about 1.10.sup.10 cfu/day, preferably from about
1.10.sup.6 to about 1.10.sup.9 cfu/day, more preferably from about
1.10.sup.8 to about 1.10.sup.9 cfu/day.
[0087] In one embodiment of the invention, the daily amount of
fragments of Akkermansia muciniphila administered per day ranges
from fragments derived from about 1.10.sup.2 to about 1.10.sup.15
cfu/day, preferably from about 1.10.sup.5 to about 1.10.sup.12
cfu/day, more preferably from about 1.10.sup.8 to about 1.10.sup.10
cfu/day, and even more preferably from about 1.10.sup.9 to about
1.10.sup.10 cfu/day. In another embodiment of the invention, the
daily amount of fragments of Akkermansia muciniphila administered
per day ranges from fragments derived from about 1.10.sup.6 to
about 1.10.sup.10 cfu/day, preferably from about 1.10.sup.8 to
about 1.10.sup.10 cfu/day, more preferably from about 1.10.sup.9 to
about 1.10.sup.10 cfu/day. In another embodiment of the invention,
the daily amount of fragments of Akkermansia muciniphila
administered per day ranges from fragments derived from about
1.10.sup.6 to about 1.10.sup.10 cfu/day, preferably from about
1.10.sup.6 to about 1.10.sup.9 cfu/day, more preferably from about
1.10.sup.8 to about 1.10.sup.9 cfu/day.
[0088] In one embodiment, said subject is not an obese subject. In
another embodiment, said subject is overweight.
[0089] In one embodiment of the invention, the composition, the
pharmaceutical composition, the cosmetic composition or the
medicament further comprises additional probiotic strains or
species, such as, for example, bacterial probiotic strains or
species; prokaryotes probiotics other than bacteria; or fungal
strains or species, preferably yeast strains or species. In one
embodiment, said additional probiotic strains or species are
selected from those naturally present in the gut of the subject,
preferably in the human gut, more preferably in the gut of healthy
human subjects.
[0090] Examples of bacterial probiotic strains or species that may
be used in the present invention include, but are not limited to
Lactobacillus, Lactococcus, Bifidobacterium, Veillonella, Desemzia,
Coprococcus, Collinsella, Citrobacter, Turicibacter, Sutterella,
Subdoligranulum, Streptococcus, Sporobacter, Sporacetigenium,
Ruminococcus, Roseburia, Proteus, Propionobacterium, Leuconostoc,
Weissella, Pediococcus, Streptococcus, Prevotella, Parabacteroides,
Papillibacter, Oscillospira, Melissococcus, Dorea, Dialister,
Clostridium, Cedecea, Catenibacterium, Butyrivibrio, Buttiauxella,
Bulleidia, Bilophila, Bacteroides, Anaerovorax, Anaerostopes,
Anaerofilum, Enterobacteriaceae, Fermicutes, Atopobium, Alistipes,
Acinetobacter, Slackie, Shigella, Shewanella, Serratia, Mahella,
Lachnospira, Klebsiella, Idiomarina, Fusobacterium,
Faecalibacterium, Eubacterium, Enterococcus, Enterobacter,
Eggerthella.
[0091] Examples of prokaryote strains or species that may be used
in the present invention include, but are not limited to Archaea,
Firmicutes, Bacteroidetes (such as, for example, Anistipes,
Bacteroides ovatus, Bacteroides splachnicus, Bacteroides stercoris,
Parabacteroides, Prevotella ruminicola, Porphyromondaceae, and
related genus), Proteobacteria, Betaproteobacteria (such as, for
example, Aquabacterium and Burkholderia), Gammaproteobacteria (such
as, for example, Xanthomonadaceae), Actinobacteria (such as, for
example, Actinomycetaceae and Atopobium), Fusobacteria,
Methanobacteria, Spirochaetes, Fibrobacters, Deferribacteres,
Deinococcus, Therms, Cyanobacteria, Methanobrevibacteria,
Peptostreptococcus, Ruminococcus, Coprococcus, Subdolingranulum,
Dorea, Bulleidia, Anaerofustis, Gemella, Roseburia, Dialister,
Anaerotruncus, Staphylococcus, Micrococcus, Propionobacteria,
Enterobacteriaceae, Faecalibacteria, Bacteroides, Parabacteroides,
Prevotella, Eubacterium, Bacilli (such as, for example,
Lactobacillus salivarius and related species, Aerococcus,
Granulicatella, Streptococcus bovis and related genus and
Streptococcus intermedius and related genus), Clostridium (such as,
for example, Eubacterium hallii, Eubacterium limosum and related
genus) and Butyrivibrio.
[0092] Examples of fungal probiotic strains or species, preferably
yeast probiotic strains or species that may be used in the present
invention include, but are not limited Ascomycetes, Zygomycetes and
Deuteromycetes, preferably from the groups Aspergillus, Torulopsis,
Zygosaccharomyces, Hansenula, Candida, Saccharomyces, Clavispora,
Bretanomyces, Pichia, Amylomyces, Zygosaccharomyces, Endomycess,
Hyphopichia, Zygosaccharomyces, Kluyveromyces, Mucor, Rhizopus,
Yarrowia, Endomyces,
[0093] Debaryomyces, and/or Penicillium.
[0094] The Applicant herein shows that the beneficial effects
observed after Akkermansia muciniphila administration are specific
of this bacterial strain. Indeed, it is shown in the Examples that
the administration of Lactobacillus plantarum WCSF-1 does not have
the same beneficial effects.
[0095] In one embodiment of the invention, the composition, the
pharmaceutical composition, the cosmetic composition or the
medicament does not comprise the bacterial strains
Lactobacillus-Enterococcus, Bacteroides and/or Atopobium.
[0096] In one embodiment of the invention, the only one microbial
strain or species, preferably bacterial strain or species,
comprised in the composition, pharmaceutical composition, cosmetic
composition or medicament is Akkermansia muciniphila.
[0097] In one embodiment of the invention, the composition,
pharmaceutical composition, cosmetic composition or medicament
consists of Akkermansia muciniphila.
[0098] In another embodiment of the invention, the composition,
pharmaceutical composition, cosmetic composition or medicament
consists essentially of Akkermansia muciniphila, wherein
"consisting essentially of" herein means that Akkermansia
muciniphila is the only microbial strain or species, preferably the
only bacterial strain or species comprised in the composition,
pharmaceutical composition, cosmetic composition or medicament.
[0099] In one embodiment of the invention, Akkermansia muciniphila
or a fragment thereof activates or inhibits the growth and/or
biological activity of other bacterial strain(s) or species of the
gut microbiota.
[0100] In one embodiment of the invention, the composition, the
pharmaceutical composition, the cosmetic composition or the
medicament further comprises a prebiotic.
[0101] Examples of prebiotics that may be used in the present
invention include, but are not limited to, inulin and inulin-type
fructans, oligofructose, xylose, arabinose, arabinoxylan, ribose,
galactose, rhamnose, cellobiose, fructose, lactose, salicin,
sucrose, glucose, esculin, tween 80, trehalose, maltose, mannose,
mellibiose, mucus or mucins, raffinose, fructooligosaccharides,
galacto-oligosaccharides, amino acids, alcohols, and any
combinations thereof.
[0102] Other non-limiting examples of prebiotics include
water-soluble cellulose derivatives, water-insoluble cellulose
derivatives, unprocessed oatmeal, metamucil, all-bran, and any
combinations thereof.
[0103] Examples of water-soluble cellulose derivatives include, but
are not limited to, methylcellulose, methyl ethyl cellulose,
hydroxyethyl cellulose, ethyl hydroxyethyl cellulose, cationic
hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxyethyl
methylcellulose, hydroxypropyl methylcellulose, and carboxymethyl
cellulose.
[0104] Akkermansia muciniphila or a fragment thereof or the
composition, pharmaceutical composition, cosmetic composition or
medicament of the invention may be administered by several routes
of administration. Examples of adapted routes of administration
include, but are not limited to, oral administration, rectal
administration, administration via esophagogastroduodenoscopy,
administration via colonoscopy, administration using a nasogastric
or orogastric tube and the like.
[0105] According to an embodiment, Akkermansia muciniphila or a
fragment thereof or the composition, pharmaceutical composition,
cosmetic composition or medicament of the invention is in a form
adapted to oral administration. According to a first embodiment,
the form adapted to oral administration is a solid form selected
from the group comprising tablets, pills, capsules, soft gelatin
capsules, sugarcoated pills, orodispersing/orodispersing tablets,
effervescent tablets or other solids. According to a second
embodiment, the form adapted to oral administration is a liquid
form, such as, for example, a drinkable solution, liposomal forms
and the like.
[0106] In one embodiment, the composition, pharmaceutical
composition, cosmetic composition or medicament of the invention
further comprises excipients, diluent and/or carriers selected with
regard to the intended route of administration. Examples of
excipients, diluent and/or carriers include, but are not limited
to, water, phosphate buffer saline, anaerobic phosphate buffer
saline, sodium bicarbonate, juice, milk, yogurt, infant formula,
dairy product, coloring agents, such as, for example, titane
dioxide (E171), iron dioxide (E172) and brilliant black BN (E151);
flavoring agents; thickeners, such as, for example, glycerol
monostearate; sweeteners; coating agents, such as, for example,
refined colza oil, soya oil, peanut oil, soya lecithin or fish
gelatin; diluting agents, such as, for example, lactose,
monohydrated lactose or starch; binding agents, such as, for
example, povidone, pregelatinized starch, gums, saccharose,
polyethylene glycol (PEG) 4000 or PEG 6000; disintegrating agents,
such as, for example, microcrystalline cellulose or sodium
carboxymethyl starch, such as, for example, sodium carboxymethyl
starch type A; lubricant agents, such as, for example, magnesium
stearate; flow agent, such as, for example, colloidal anhydrous
silica, etc . . . .
[0107] In one embodiment of the invention, the composition,
pharmaceutical composition, cosmetic composition or medicament is
in the form of a nutritional composition, i.e. comprises liquid or
solid food, feed or drinking water. In one embodiment of the
invention, the composition, pharmaceutical composition, cosmetic
composition or medicament is a food product, such as, for example,
dairy products, dairy drinks, yogurt, fruit or vegetable juice or
concentrate thereof, powders, malt or soy or cereal based
beverages, breakfast cereal such as muesli flakes, fruit and
vegetable juice powders, cereal and/or chocolate bars,
confectionary, spreads, flours, milk, smoothies, confectionary,
milk product, milk powder, reconstituted milk, cultured milk,
yoghurt, drinking yoghurt, set yoghurt, drink, dairy drink, milk
drink, chocolate, gels, ice creams, cereals, reconstituted fruit
products, snack bars, food bars, muesli bars, spreads, sauces,
dips, dairy products including yoghurts and cheeses, drinks
including dairy and non-dairy based drinks, sports supplements
including dairy and non-dairy based sports supplements.
[0108] In one embodiment of the invention, the composition,
pharmaceutical composition, cosmetic composition or medicament is
in the form of a food additive, drink additive, dietary supplement,
nutritional product, medical food or nutraceutical composition.
[0109] Akkermansia muciniphila is a strictly anaerobic bacterium.
Therefore, in the embodiment where viable or living strains are
used, prolonged contact with oxygen should be avoided. Examples of
means for avoiding prolonged contact with oxygen include, but are
not limited to, freeze of the bacterial cells or packaging in a
sealed container and the like.
[0110] The Applicant herein showed that obesity and related
disorders are associated with an increased gut permeability and
with impaired mucus production, epithelium barrier, immune system
and/or antibacterial compounds production by the subject; and that
the administration of A. muciniphila may restore these
parameters.
[0111] Therefore, the present invention also relates to Akkermansia
muciniphila or a fragment thereof for decreasing gut permeability
and/or for restoring impaired mucus production and/or for restoring
epithelium barrier and/or for restoring immune system and/or for
decreasing the production of antibacterial compounds. Another
object of the invention is a method for decreasing gut permeability
and/or for restoring impaired mucus production and/or for restoring
epithelium barrier and/or for restoring immune system and/or for
decreasing the production of antibacterial compounds in a subject
in need thereof, comprising administering an effective or
cosmetically effective amount of Akkermansia muciniphila or a
fragment thereof to a subject in need thereof.
[0112] The Applicant surprisingly showed that the administration of
A. muciniphila controls gut barrier by regulating mucus layer
thickness and the production of colon antimicrobial peptides (such
as, for example, RegIIIgamma). In addition, they also showed that
A. muciniphila regulates the production of acylglycerols that
belongs to the endocannabinoids family involved in the control of
inflammation, gut barrier and gut peptides secretion (GLP-1 and
GLP-2). GLP-1 and GLP-2 are involved in a great variety of
functions, including improving insulin signalling, decreasing
inflammation, and promoting satiety.
[0113] Therefore, the present invention also relates to Akkermansia
muciniphila or a fragment thereof for controlling gut barrier
function, and to a method for controlling gut barrier function
comprising administering an effective or cosmetically effective
amount of Akkermansia muciniphila or a fragment thereof to a
subject in need thereof. In one embodiment, Akkermansia muciniphila
or a fragment thereof regulates mucus layer thickness (which may be
decreased in obesity or other metabolic disorders). In another
embodiment, the administration of Akkermansia muciniphila or a
fragment thereof induces the production of colon antimicrobial
peptides, such as, for example, RegIIIgamma. In another embodiment,
the administration of Akkermansia muciniphila or a fragment thereof
induces the production of compounds of the endocannabinoids family,
such as, for example, acylglycerols selected from the group
comprising 2-oleoylglycerol, 2-palmitoylglycerol and
2-arachidonoylglycerol. In another embodiment, the administration
of Akkermansia muciniphila or a fragment thereof regulates mucus
turnover.
[0114] Another object of the invention concerns Akkermansia
muciniphila or a fragment thereof for use in treating metabolic
dysfunction associated with or caused by a metabolic disorder.
Still another object of the invention is thus a method for treating
metabolic dysfunction associated with or caused by a metabolic
disorder in a subject in need thereof, comprising administering an
effective amount or a cosmetically effective amount of Akkermansia
muciniphila or a fragment thereof to a subject in need thereof.
[0115] The Applicant also showed that the administration of
Akkermansia muciniphila controls fat storage and adipose tissue
metabolism. Therefore, another object of the invention concerns
Akkermansia muciniphila or a fragment thereof for use in
controlling fat storage and adipose tissue metabolism. Another
object of the invention is also a method for controlling fat
storage and adipose tissue metabolism comprising administering an
effective amount or a cosmetically effective amount of Akkermansia
muciniphila or a fragment thereof to a subject in need thereof. In
one embodiment, said control does not involve any change in food
intakes. In one embodiment of the invention, administration of
Akkermansia muciniphila or a fragment thereof abolishes metabolic
endotoxemia. In another embodiment, administration of Akkermansia
muciniphila or a fragment thereof lowers fat mass. In another
embodiment, administration of Akkermansia muciniphila or a fragment
thereof increases mRNA expression of adipocyte differentiation and
lipid oxidation, preferably without affecting lipogenesis.
[0116] The Applicant also showed that the administration of
Akkermansia muciniphila regulates adipose tissue metabolism and
glucose homeostasis. The present invention thus relates to
Akkermansia muciniphila or a fragment thereof for use in the
regulation of adipose tissue metabolism and glucose homeostasis;
and to a method for regulating adipose tissue metabolism and
glucose homeostasis comprising administering an effective amount or
a cosmetically effective amount of Akkermansia muciniphila or a
fragment thereof to a subject in need thereof. In one embodiment of
the invention, the administration of Akkermansia muciniphila or a
fragment thereof reverses diet-induced fasting hyperglycemia. In
another embodiment, the administration of Akkermansia muciniphila
or a fragment thereof induces a reduction of at least 10%,
preferably of at least 30%, more preferably of at least 40% of
hepatic glucose-6-phosphatase expression. In another embodiment,
the administration of Akkermansia muciniphila or a fragment thereof
induces a reduction of the insulin-resistance index. In one
embodiment, said reduction of the insulin-resistance index is of at
least 5%, preferably of at least 10%, more preferably of at least
15%.
[0117] Moreover, the Applicant showed that the administration of
Akkermansia muciniphila leads to the normalization of adipose
tissue CD11c subpopulation of macrophages. The amount of cells of
this population of macrophages is increased in metabolic disorders
such as, for example, obesity and Type 2 Diabetes, and is a
hallmark of inflammation related to these metabolic disorders.
Therefore, the present invention also relates to Akkermansia
muciniphila or a fragment thereof for treating inflammation,
preferably low grade inflammation, associated with or caused by
metabolic disorders; and to a method for treating inflammation
related to metabolic disorders comprising administering an
effective amount or a cosmetically effective amount of Akkermansia
muciniphila or a fragment thereof to a subject in need thereof. In
one embodiment of the invention, the administration of Akkermansia
muciniphila or a fragment thereof decreases the amount of CD11c
macrophages in the adipose tissue.
[0118] Finally, the Applicant showed that the administration of
Akkermansia muciniphila decreases plasma cholesterol in high-fat
diet fed mice. Therefore, the present invention also relates to
Akkermansia muciniphila or a fragment thereof for decreasing plasma
cholesterol; and to a method for decreasing plasma cholesterol
comprising administering an effective amount or a cosmetically
effective amount of Akkermansia muciniphila or a fragment thereof
to a subject in need thereof.
[0119] In one embodiment of the invention, the administration of
Akkermansia muciniphila or a fragment thereof to a subject has no
impact on food intake of said subject.
[0120] In one embodiment of the invention, the administration of
Akkermansia muciniphila or a fragment thereof to a subject
increases energy expenditure of said subject, preferably without
impacting the food intake of said subject.
[0121] The present invention thus also relates to a method of
increasing energy expenditure of a subject, comprising
administering Akkermansia muciniphila or a fragment thereof, or a
composition, pharmaceutical composition, cosmetic composition or
medicament of the invention to the subject, preferably in a
therapeutically or cosmetically effective amount. Preferably, the
method of the invention does not comprise or further comprise
modulating the food intake of said subject. In one embodiment of
the invention, the method of the invention increases energy
expenditure, thereby inducing durable weight loss in the subject,
and thereby treating metabolic disorders in said subject, such as,
for example, obesity related metabolic disorders.
[0122] In one embodiment, the administration of Akkermansia
muciniphila or a fragment thereof to a subject increases satiety in
said subject. Consequently, according to this embodiment, the
method of the invention increases satiety in a subject, thereby
inducing durable weight loss in the subject, and thereby treating
metabolic disorders in said subject, such as, for example, obesity
related metabolic disorders.
BRIEF DESCRIPTION OF THE DRAWINGS
[0123] FIGS. 1A-1D are a combination of graphs showing that
Akkermansia muciniphila abundance is decreased in obese and
diabetic mice, whereas prebiotic treatment restores it to basal
levels and improves metabolic endotoxemia and related disorders.
(FIG. 1A) Akkermansia muciniphila abundance (Log.sub.10 of
bacteria/g of cecal content) measured in the cecal content of
leptin-deficient (ob-ob) obese mice (n=5) and their lean
littermates (lean) (n=5). (FIG. 1B) Akkermansia muciniphila
abundance (Log.sub.10 of bacteria/g of cecal content) measured in
the cecal content of obese mice fed a normal chow diet (ob-CT) or
treated with prebiotics (ob-Pre) for 5-weeks (n=10). (FIG. 1C)
Akkermansia muciniphila abundance (Log.sub.10 of bacteria per g of
cecal content) measured in the cecal content of control diet-fed
mice (CT) or CT diet-fed mice treated with prebiotics (CT-Pre)
added in tap water and HF diet-fed mice (HF) or HF diet-fed mice
treated with prebiotics (HF-Pre) added in tap water for 8-weeks
(n=10). (FIG. 1D) Portal vein serum LPS levels (n=7-9). (FIG. 1E)
Adipose tissue macrophages infiltration marker CD11c mRNA (n=10).
(FIG. 1F) Pearson's correlation between log values of portal vein
LPS levels and Akkermansia muciniphila abundance (Log.sub.10 of
bacteria per g of cecal content), inset indicates Pearson's
correlation coefficient (r) and the corresponding P value. (FIG.
1G) Total fat mass gain measured by time-domain nuclear magnetic
resonance (n=10). Data in FIGS. 1A-1C are shown as boxplots.
*P<0.05, by two-tailed student t-test. Data in c-g have been
obtained in the same group of mice. Data in FIGS. 1D, 1E, and 1G
are shown as mean.+-.s.e.m. Data with different superscript letters
are significantly different (P<0.05), according to the post-hoc
ANOVA one-way statistical analysis.
[0124] FIGS. 2A-2F are a combination of graphs and pictures showing
that Akkermansia muciniphila changes gut microbiota composition,
counteracts diet-induced gut barrier dysfunction, changes
intestinal level of endocannabinoids and improves metabolic
disorders in diet-induced obese mice. Mice were treated by daily
oral gavage with Akkermansia muciniphila (2.10.sup.8 bacterial
cells suspended in 200 .mu.l sterile anaerobic phosphate buffer
saline (PBS)) and fed a control diet (CT-Akk) or a HF-diet (HF-Akk)
compared to mice fed a control diet (CT) or a high-fat diet (HF)
and treated by daily oral gavage with an equivalent volume of
sterile anaerobic PBS for 4-weeks (n=10). (FIG. 2A) PCA analysis
based on MITChip phylogenetic fingerprints of the gut microbiota
from the cecal contents of control groups (CT and HF) and
Akkermansia muciniphila treated groups (CTA and HFA). (FIG. 2B)
Portal vein serum LPS levels (n=6-10). (FIG. 2C) Total fat mass
gain measured by time-domain nuclear magnetic resonance (n=10).
(FIG. 2D) Insulin resistance index was determined by multiplying
the area under the curve (from 0 min to 15 min) of both blood
glucose and plasma insulin obtained following an oral glucose load
(2 g of glucose per kg of body weight) performed after 4 weeks of
treatment (n=10). (FIG. 2E) Adipose tissue macrophages infiltration
marker CD11c mRNA (n=10). (FIG. 2F) Adipocyte differentiation
(CCAAT/enhancer--binding protein-.alpha., encoded by Cebpa),
lipogenesis (acetyl-CoA carboxylase, encoded by Acc1; fatty acid
synthase, encoded by Fasn) and lipid oxidation (carnitine
palmitoyltransferase-1, encoded by Cpt1; acyl-CoA-oxidase encoded
by Acox1; peroxisome proliferator-activated receptor gamma
coactivator, encoded by Pgcla; and peroxisome
proliferator-activated receptor alpha, encoded by Ppara) markers
mRNA expression were measured in the visceral fat depots
(mesenteric fat) (n=10). (FIG. 2G) Ileum 2-palmitoylglycerol
(2-PG), 2-oloeylglycerol (2-OG), 2-arachidonoylglycerol (2-AG)
(expressed as % of the control) (n=10). (FIG. 2H) Mucus layer
thickness measured by histological analyses following alcian blue
staining. Representative alcian blue images used for the mucus
layer thickness measurements, bars=40 .mu.m (n=7-8). (FIG. 2I)
Colon regenerating islet-derived 3-gamma (RegIII.gamma., encoded by
Reg3 g) mRNA expression (n=10). Data in FIG. 2A-2I have been
obtained in the same group of mice. Data in FIGS. 2B-2I are shown
as mean.+-.s.e.m. Data with different superscript letters are
significantly different (P<0.05), according to the post-hoc
ANOVA one-way statistical analysis.
[0125] FIGS. 3A-3C are a combination of graphs and pictures showing
that prebiotic-treated mice exhibited inverse relationship between
Akkermansia muciniphila and adipose tissue macrophage infiltration
or fat mass gain. (FIG. 3A) Pearson's correlation between adipose
tissue CD11c mRNA levels and Akkermansia muciniphila abundance
(Log.sub.10 of bacteria per g of cecal content) measured in the
cecal content of control diet-fed mice (CT) or CT diet-fed mice
treated with prebiotics (CT-Pre) added in tap water and HF diet-fed
mice (HF) or HF diet-fed mice treated with prebiotics (HF-Pre)
added in tap water for 8-weeks, inset indicates Pearson's
correlation coefficient (r) and the corresponding P value. (FIG.
3B) Subcutaneous, mesenteric and epididymal fat depots weight (g
per 100 g of body weight) (n=10). (FIG. 3C) Pearson's correlation
between adipose tissue mass gain and cecal content Akkermansia
muciniphila abundance (Log.sub.10 of bacteria per g of cecal
content), inset indicates Pearson's correlation coefficient (r) and
the corresponding P value. Data in FIGS. 3A-3C have been obtained
in the same group of mice, and are shown as mean.+-.s.e.m. Data
with different superscript letters are significantly different
(P<0.05), according to the post-hoc ANOVA one-way statistical
analysis.
[0126] FIGS. 4A-4B are a combination of graphs showing that daily
oral gavage with Akkermansia muciniphila increases cecal abundance
of these bacteria. Akkermansia muciniphila abundance expressed as
(FIG. 4A) % of total 16S RNA or (FIG. 4B) Log.sub.10 DNA copies
measured in mice treated by daily oral gavage with Akkermansia
muciniphila (2.10.sup.8 bacterial cells suspended in 200 .mu.l
sterile anaerobic phosphate buffer saline (PBS)) and fed a control
diet (CT-Akk) or a HF-diet (HF-Akk) compared to mice fed a control
diet (CT) or a high-fat diet (HF) and treated by daily oral gavage
with an equivalent volume of sterile anaerobic PBS for 4-weeks
(n=10).
[0127] FIGS. 5A-5D are a combination of graphs and pictures showing
that Akkermansia muciniphila treatment reduces fat mass without
affecting food intake. (FIG. 5A) Subcutaneous, mesenteric and
epididymal fat depots weight (g per 100 g of body weight) of mice
treated by daily oral gavage with Akkermansia muciniphila
(2.10.sup.8 bacterial cells suspended in 200 .mu.l sterile
anaerobic phosphate buffer saline (PBS)) and fed a control diet
(CT-Akk) or a HF-diet (HF-Akk) or mice fed a control diet (CT) or a
high-fat diet (HF) and treated by daily oral gavage with an
equivalent volume of sterile anaerobic PBS for 4-weeks (n=10).
(FIG. 5B) Cumulative food intake (g) over the 4-weeks of treatment.
(FIG. 5C) Final body weight (n=10). (FIG. 5D) Final fat and lean
mass expressed in percentage of final body weight and measured
using 7.5 MHz time-domain NMR (LF50 minispec; Bruker, n=10). Data
are shown as mean.+-.s.e.m. Data with different superscript letters
are significantly different (P<0.05), according to the post-hoc
ANOVA one-way statistical analysis.
[0128] FIGS. 6A-6B are a combination of graphs showing that
Akkermansia muciniphila treatment normalizes fasted glycaemia and
reduces fasted hepatic G6pc mRNA expression. (FIG. 6A) Fasted
glycaemia measured in mice treated by daily oral gavage with
Akkermansia muciniphila (2.10.sup.8 bacterial cells suspended in
200 .mu.l sterile anaerobic phosphate buffer saline (PBS)) and fed
a control diet (CT-Akk) or a HF-diet (HF-Akk) or mice fed a control
diet (CT) or a high-fat diet (HF) and treated by daily oral gavage
with an equivalent volume of sterile anaerobic PBS for 4-weeks
(n=10). (FIG. 6B) Glucose-6 phosphatase (encoded by G6pc) mRNA
expression levels measured in the liver at the end of the 4-weeks
period (n=10). Data are shown as mean.+-.s.e.m. Data with different
superscript letters are significantly different (P<0.05),
according to the post-hoc ANOVA one-way statistical analysis.
[0129] FIGS. 7A-7E is a combination of graphs showing that
Akkermansia muciniphila treatment has minor effects on
antibacterial peptides content in the ileum and IgA levels in the
faeces. Antibacterial peptides mRNA expression of (FIG. 7A)
Regenerating islet-derived 3-gamma (RegIII.gamma., encoded by
Reg3g), (FIG. 7B) Phospholipase A2 group IIA (encoded by Pla2g2a),
(FIG. 7C) .alpha.-defensins (encoded by Defa) and (FIG. 7D)
Lysozyme C (encoded by Lyz 1) measured in the ileum of mice treated
by daily oral gavage with Akkermansia muciniphila (2.10.sup.8
bacterial cells suspended in 200 .mu.l sterile anaerobic phosphate
buffer saline (PBS)) and fed a control diet (CT-Akk) or a HF-diet
(HF-Akk) or mice fed a control diet (CT) or a high-fat diet (HF)
and treated by daily oral gavage with an equivalent volume of
sterile anaerobic PBS for 4-weeks (n=10). (FIG. 7E) Fecal IgA
levels (.mu.g of feces). Data are shown as mean.+-.s.e.m. Data with
different superscript letters are significantly different
(P<0.05), according to the post-hoc ANOVA one-way statistical
analysis.
[0130] FIGS. 8A-8G are a combination of histograms, graphs and
images showing that heat-inactivated A. muciniphila did not
counteract metabolic endotoxemia, diet-induced obesity, oral
glucose intolerance, did not improve adipose tissue metabolism and
gut barrier function in diet-induced obese mice. Control mice were
fed a control (CT) or HF diet (HF) and treated with a daily oral
gavage containing sterile anaerobic PBS and glycerol for 4 weeks
daily. Treated mice received an oral gavage of alive A. muciniphila
(HF-Akk) or metabolically inactivated A. muciniphila (HF--K-Akk)
(2.10.sup.8 bacterial cells suspended in 200 .mu.l of sterile
anaerobic phosphate-buffered saline (PBS)) and fed a HF diet (n=8).
(FIG. 8A) Portal vein serum LPS levels (n=6-7). (FIG. 8B) Total fat
mass gain measured by time-domain nuclear magnetic resonance
(n=7-8). (FIG. 8C) Plasma glucose profile following 2 g/kg glucose
oral challenge in freely moving mice, and the histogram in (FIG.
8D) shows the mean area under the curve (AUC) measured between 0
and 120 min after glucose load (n=7-8). (FIG. 8E) mRNA expression
of markers of adipocyte differentiation (Cebpa), lipogenesis (Acc1;
Fasn) and lipid oxidation (Cpt1; Acox1; Pgc1a; and Ppara) was
measured in visceral fat depots (mesenteric fat) (n=8). (FIG. 8F)
Thickness of the mucus layer measured by histological analyses
following alcian blue staining (CT n=4, HF n=6, HF-Akk and HF-K-Akk
n=5). (FIG. 8G) Representative alcian blue images that were used
for mucus layer thickness measurements, bars=40 .mu.m. M=mucosa,
IM=inner mucus layer. Data are shown as means.+-.s.e.m. Data with
different superscript letters are significantly different
(P<0.05) according to post-hoc ANOVA one-way statistical
analysis.
[0131] FIGS. 9A-9B is a combination of histograms showing that
heat-inactivated A. muciniphila did not reduce subcutaneous,
mesenteric and epididymal fat mass and did not increase colon
antimicrobial peptides in mice on an HF diet. (FIG. 9A)
Subcutaneous, mesenteric and epididymal fat depot weights (g per
100 g body weight) measured in control mice fed a control (CT) or
HF diet (HF) and treated with a daily oral gavage containing
sterile anaerobic PBS and glycerol for 4 weeks daily. Treated mice
received an oral gavage of alive A. muciniphila (HF-Akk) or killed
A. muciniphila (HF--K-Akk) (2.10.sup.8 bacterial cells suspended in
200 .mu.l of sterile anaerobic PBS) and fed a HF diet (n=8). (FIG.
9B) mRNA expression of colon regenerating islet-derived 3-gamma
(RegMy, encoded by Reg3g) mRNA expression (n=8-18), data represents
the results from the two A. muciniphila studies. Data are shown as
means.+-.s.e.m. Data with different superscript letters are
significantly different (P<0.05) according to a post-hoc ANOVA
one-way statistical analysis.
[0132] FIGS. 10A-10C are a combination of histograms showing the
efficiency of a treatment with A. muciniphila 3 times a week during
8 weeks. (FIG. 10A) Body weight (g) measured in control mice fed a
control (CT) (n=8) or HF diet (HF) (n=10) and treated 3 times per
weeks by oral gavage with sterile anaerobic PBS containing glycerol
or A. muciniphila (HF-Akk) (n=10) for 8 weeks. (2.10.sup.8
bacterial cells suspended in 200 .mu.l of sterile anaerobic PBS).
(FIG. 8B) Subcutaneous fat mass. (FIG. 10C) Visceral adipose
tissues (mesenteric and epidydimal). Data are shown as
means.+-.s.e.m. Data with different superscript letters are
significantly different (P<0.05) according to a post-hoc ANOVA
one-way statistical analysis.
[0133] FIG. 11 is an histogram showing that A. muciniphila reduces
plasma cholesterol in mice fed a high-fat diet. (CT) Mice fed a
control diet; (Akk) Mice treated by daily oral gavage with
Akkermansia muciniphila (2.10.sup.8 bacterial cells suspended in
200 .mu.l sterile anaerobic phosphate buffer saline (PBS)) and fed
a control diet; (HF) Mice fed a high-fat diet; (HF-Akk) Mice
treated by daily oral gavage with Akkermansia muciniphila (10.sup.9
bacterial cells suspended in 200 .mu.l sterile anaerobic phosphate
buffer saline (PBS)) and fed a HF-diet.
[0134] FIGS. 12A-12E are a combination of histograms showing that
L. plantarum WCFS1 did not reduce fat mass and did not improve
adipose tissue metabolism and gut barrier function in diet-induced
obese mice. Control mice were fed a control (CT) or HF diet (HF)
and treated with a daily oral gavage containing sterile anaerobic
PBS and glycerol for 4 weeks. Treated mice received an oral gavage
of L. plantarum WCFS1 (HF-LP) (2.10.sup.8 bacterial cells suspended
in 200 .mu.L of sterile anaerobic PBS) and fed a HF diet (n=7-8).
(FIG. 12A) Final fat mass measured by time-domain NMR (n=7-8).
s.c., mesenteric and epididymal fat depot weights (g/100 g of body
weight) (n=7-8). (FIG. 12B) mRNA expression of markers of adipocyte
differentiation (Cebpa), lipogenesis (Acc1; Fasn) and lipid
oxidation (Cpt1; Acox1; Pgc1a; and Ppara) was measured in visceral
fat depots (mesenteric fat) (n=7-8). (FIG. 12C) Thickness of the
mucus layer measured by histological analyses after alcian blue
staining (n=4-6). (FIG. 12D) Portal vein serum LPS levels (n=6-7).
(FIG. 12E) mRNA expression of colon RegIII.gamma. (encoded by
Reg3g) mRNA expression (n=8-18). Data are shown as means.+-.s.e.m.
Data with different superscript letters are significantly different
(P<0.05) according to post hoc ANOVA one-way statistical
analysis.
EXAMPLES
[0135] The present invention is further illustrated by the
following examples.
[0136] Materials and Methods
Mice
[0137] ob/ob experiment: ob/ob versus lean study: Six-week-old
ob/ob (n=5/group) mice (C57BL/6 background, Jackson-Laboratory, Bar
Harbor, Me., USA) were housed in a controlled environment (12-h
daylight cycle, lights-off at 6-pm) in groups of two or three
mice/cage, with free access to food and water. The mice were fed a
control diet (A04, Villemoisson-sur-Orge, France) for 16 weeks.
Cecal content was harvested immersed in liquid nitrogen, and stored
at -80.degree. C., for further Akkermansia muciniphila
analysis.
[0138] ob/ob prebiotic study: Six-week-old ob/ob (n=10/group) mice
(C57BL/6 background, Jackson-Laboratory, Bar Harbor, Me., USA) were
housed in a controlled environment (12-h daylight cycle, lights-off
at 6-pm) in groups of two mice/cage, with free access to food and
water. The mice were fed a control diet (Ob-CT) (A04,
Villemoisson-sur-Orge, France) or a control diet supplemented with
prebiotics, such as oligofructose (Ob-Pre) (Orafti, Tienen,
Belgium) for 5-weeks as previously described (Everard et al.
Diabetes 60, 2775-2786 (2011)). This set of mice has been
previously characterized in Everard et al (Everard et al. Diabetes
60, 2775-2786 (2011)).
[0139] High-Fat prebiotic experiment: A set of 10-week-old C57BL/6J
mice (40 mice, n=10/group) (Charles River, Brussels, Belgium) were
housed in groups of five mice/cage, with free access to food and
water. The mice were fed a control diet (CT) (A04,
Villemoisson-sur-Orge, France) or a control diet and treated with
prebiotics, such as oligofructose (Orafti, Tienen, Belgium) (0.3
g/mouse/day) added in tap water (CT-Pre), or fed a high-fat diet
(HF) (60% fat and 20% carbohydrates (kcal/100 g), D12492, Research
diet, New Brunswick, N.J., USA) or a HF diet and treated with
oligofructose (0.3 g/mouse/day) added in tap water (HF-Pre).
Treatment continued for 8 weeks.
[0140] HFD Akkermansia muciniphila treatment: A set of 10-week-old
C57BL/6J mice (40 mice, n=10/group) (Charles River, Brussels,
Belgium) were housed in groups of 2 mice/cage, with free access to
food and water. The mice were fed a control diet (CT) (AIN93Mi;
Research diet, New Brunswick, N.J., USA) or a high-fat diet (HF)
(60% fat and 20% carbohydrates (kcal/100 g), D12492, Research diet,
New Brunswick, N.J., USA). Mice were treated with an oral
administration ofAkkermansia muciniphila by oral gavage at the dose
2.10.sup.8 cfu/0.2 ml suspended in sterile anaerobic phosphate
buffer saline (CT-Akk and HF-Akk) and control groups were treated
with an oral gavage of an equivalent volume of sterile anaerobic
phosphate buffer saline (CT and HF). Treatment continued for 4
weeks.
[0141] A. muciniphila Muc.sup.T (ATTC BAA-835) was grown
anaerobically in a mucin-based basal medium as previously described
(Derrien et al Int J Syst Evol Microbiol 54, 1469-1476 (2004)) and
then washed and suspended in anaerobic phosphate buffer saline,
including 25% (v/v) glycerol, to an end concentration of
1.10.sup.10 cfu/ml.
[0142] HFD Akkermansia muciniphila alive treatment vs heat-killed
and Lactobacillus platarum WCFS1: A set of 10-week-old C57BL/6J
mice (40 mice, n=8/group) (Charles River, Brussels, Belgium) were
housed in groups of 2 mice/cage, with free access to food and
water. The mice were fed a control diet (CT) (AIN93Mi; Research
diet, New Brunswick, N.J., USA) or a high-fat diet (HF) (60% fat
and 20% carbohydrates (kcal/100 g), D12492, Research diet, New
Brunswick, N.J., USA). Mice were treated daily with an oral
administration of Akkermansia muciniphila by oral gavage at the
dose 2.10.sup.8 cfu/0.2 ml suspended in sterile anaerobic phosphate
buffer saline A. muciniphila was heat-killed/inactivated by
autoclaving (15 min, 121.degree. C., 225 kPa). A viability check by
culturing on mucin-containing medium confirmed the absence of any
viable cells. Lactobacillus plantarum WCFS1 was grown anaerobically
in MRS medium (Difco Lactobacilli MRS broth; BD), washed,
concentrated, and manipulated an identical ways as the A.
muciniphila preparation. The two controls group (CT and HF) were
treated daily with an oral gavage of an equivalent volume of
sterile anaerobic PBS containing a similar end concentration of
glycerol (2.5%) (reduced with one drop of 100 mM titanium citrate)
as the treatment groups for 4 weeks.
[0143] Food and water intake were recorded once a week. Body
composition was assessed by using 7.5 MHz time domain-nuclear
magnetic resonance (TD-NMR) (LF50 minispec, Bruker, Rheinstetten,
Germany).
[0144] All mouse experiments were approved by and performed in
accordance with the guidelines of the local ethics committee.
Housing conditions were specified by the Belgian Law of Apr. 6,
2010, regarding the protection of laboratory animals (agreement
number LA1230314).
Tissue Sampling
[0145] The animals have been anesthetized with isoflurane
(Forene.RTM., Abbott, Queenborough, Kent, England) before
exsanguination and tissue sampling, then mice were killed by
cervical dislocation. Adipose depots (epididymal, subcutaneous and
mesenteric), liver were precisely dissected and weighed; the
addition of the three adipose tissues corresponds to the adiposity
index. The intestinal segments (ileum, cecum and colon), the cecal
content and the adipose tissues were immersed in liquid nitrogen,
and stored at -80.degree. C., for further analysis.
Mucus Layer Thickness
[0146] Proximal colon segments were immediately removed and fixed
in Carnoy's solution (ethanol-acetic acid-chloroform, 6/3/1 v/v/v)
for two hours at 4.degree. C. Then the samples were immersed in
ethanol 100% for 24 hours prior to processing for paraffin
embedding. Paraffin sections of 5 .mu.m were stained with alcian
blue. A minimum of 20 different measurements were made
perpendicular to the inner mucus layer per field by an investigator
blinded to the experimental groups. 5 to 19 randomly selected
fields were analyzed for each colon for a total of 2146
measurements by using an image analyzer (Motic-image Plus 2.0 ML,
Motic, China).
[0147] RNA Preparation and Real-Time qPCR Analysis
[0148] Total RNA was prepared from tissues using TriPure reagent
(Roche). Quantification and integrity analysis of total RNA was
performed by running 1 .mu.l of each sample on an Agilent 2100
Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent).
[0149] cDNA was prepared by reverse transcription of 1 .mu.g total
RNA using a Reverse Transcription System kit (Promega, Leiden, The
Netherlands). Real-time PCRs were performed with the
StepOnePlus.TM. real-time PCR system and software (Applied
Biosystems, Den Ijssel, The Netherlands) using Mesa Fast gPCR.TM.
(Eurogentec, Seraing, Belgium) for detection according to the
manufacturer's instructions. RPL19 was chosen as the housekeeping
gene. All samples were run in duplicate in a single 96-well
reaction plate, and data were analyzed according to the
2.sup.-.DELTA.CT method. The identity and purity of the amplified
product was checked through analysis of the melting curve carried
out at the end of amplification. Primer sequences for the targeted
mouse genes are presented in the Table 1 below.
TABLE-US-00001 Primers Sequence RPL-19 Forward
GAAGGTCAAAGGGAATGTGTTCA (SEQ ID NO: 1) Reverse CCTGTTGCTCACTTGT
(SEQ ID NO: 2) Reg3g Forward TTCCTGTCCTCCATGATCAAA (SEQ ID NO: 3)
Reverse CATCCACCTCTGTTGGGTTC (SEQ ID NO: 4) Lyz1 Forward
GCCAAGGTCTACAATCGTTGTGAGTTG (SEQ ID NO: 5) Reverse
CAGTCAGCCAGCTTGACACCACG (SEQ ID NO: 6) Pla2g2a Forward
AGGATTCCCCCAAGGATGCCAC (SEQ ID NO: 7) Reverse
CAGCCGTTTCTGACAGGAGTTCTGG (SEQ ID NO: 8) CD11cc Forward
ACGTCAGTACAAGGAGATGTTGGA (SEQ ID NO: 9) Reverse
ATCCTATTGCAGAATGCTTCTTTACC (SEQ ID NO: 10) Defa Forward
GGTGATCATCAGACCCCAGCATCAGT (SEQ ID NO: 11) Reverse
AAGAGACTAAAACTGAGGAGCAGC (SEQ ID NO: 12) Fasn Forward
TTCCAAGACGAAAATGATGC (SEQ ID NO: 13) Reverse AATTGTGGGATCAGGAGAGC
(SEQ ID NO: 14) Cpt1a Forward AGACCGTGAGGAACTCAAACCTAT (SEQ ID NO:
15) Reverse TGAAGAGTCGCTCCCACT (SEQ ID NO: 16) Pgc1a Forward
AGCCGTGACCACTGACAACGAG (SEQ ID NO: 17) Reverse
GCTGCATGGTTCTGAGTGCTAAG (SEQ ID NO: 18) Ppara Forward
CAACGGCGTCGAAGACAAA (SEQ ID NO: 19) Reverse TGACGGTCTCCACGGACAT
(SEQ ID NO: 20) Acox1 Forward CTATGGGATCAGCCAGAAAGG (SEQ ID NO: 21)
Reverse AGTCAAAGGCATCCACCAAAG (SEQ ID NO: 22) Acc1 Forward
TGTTGAGACGCTGGTTTGTAGAA (SEQ ID NO: 23) Reverse
GGTCCTTATTATTGTCCCAGACGTA (SEQ ID NO: 24) Cebpa Forward
GAGCCGAGATAAAGCCAAACA (SEQ ID NO: 25) Reverse GCGCAGGCGGTCATTG (SEQ
ID NO: 26) G6pc Forward AGGAAGGATGGAGGAAGGAA (SEQ ID NO: 27)
Reverse TGGAACCAGATGGGAAAGAG (SEQ ID NO: 28)
Insulin Resistance Index
[0150] Insulin resistance index was determined by multiplying the
area under the curve (0 min and 15 min) of both blood glucose and
plasma insulin obtained following an oral glucose load (2 g of
glucose per kg of body weight) performed after 4 weeks (A.
muciniphila study) of treatment. Food was removed two-hours after
the onset of the daylight cycle and mice were treated after
6-h-fasting period as previously described (Everard et al. Diabetes
60, 2775-2786 (2011)).
Biochemical Analyses
[0151] Portal vein blood LPS concentration was measured by using
Endosafe-MCS (Charles River Laboratories, Lyon, France) based on
the Limulus amaebocyte Lysate (LAL) kinetic chromogenic methodology
that measures color intensity directly related to the endotoxin
concentration in a sample. Serum were diluted 1/10 with endotoxin
free buffer to minimize interferences in the reaction (inhibition
or enhancement) and heated 15 min at 70.degree. C. Each sample was
diluted 1/70 or 1/100 with endotoxin-free LAL reagent water
(Charles River Laboratories) and treated in duplicate and two
spikes for each sample were included in the determination. All
samples have been validated for the recovery and the coefficient
variation. The lower limit of detection was 0.005 EU/ml. Plasma
insulin concentration was determined in 25 .mu.l of plasma using an
ELISA kit (Mercodia, Upssala, Sweden) according to the manufacturer
instructions.
[0152] Fecal IgA levels were determined using an ELISA kit
(E99-103, Bethyl Laboratories, Montgomery, Tex.). Freshly collected
feces were frozen at -80.degree. C. then diluted in 50 mM Tris, pH
7.4, 0.14M NaCl, 1% bovine serum albumin, 0.05% Tween 20. A 1/250
dilution was used to measure IgA by ELISA following the
manufacturer instructions.
DNA Isolation from Mouse Cecal Samples
[0153] The cecal content of mice collected post mortem was stored
at -80.degree. C. Metagenomic DNA was extracted from the cecal
content using a QIAamp-DNA stool mini-kit (Qiagen, Hilden, Germany)
according to manufacturer's instructions.
[0154] Measurement of Endocannabinoids Intestinal Levels
[0155] Ileum tissues were homogenised in CHCl.sub.3 (10 ml), and
deuterated standards were added. The extraction and the calibration
curves were generated as previously described (Muccioli et al, Mol
Syst Biol, 2010, 6, 392), and the data were normalised by tissue
sample weight.
qPCR: Primers and Conditions
[0156] The primers and probes used to detect Akkermansia
muciniphila were based on 16S rRNA gene sequences: F-Akkermansia
muciniphila CCTTGCGGTTGGCTTCAGAT (SEQ ID NO: 29), R-Akkermansia
muciniphila CAGCACGTGAAGGTGGGGAC (SEQ ID NO: 30). Detection was
achieved with StepOnePlus.TM. real-time PCR system and software
(Applied Biosystems, Den Ijssel, The Netherlands) using Mesa Fast
gPCR.TM. (Eurogentec, Seraing, Belgium) according to the
manufacturer's instructions Each assay was performed in duplicate
in the same run. The cycle threshold of each sample was then
compared to a standard curve (performed in triplicate) made by
diluting genomic DNA (five-fold serial dilution) (DSMZ,
Braunshweig, Germany). The data are expressed as Log of bacteria/g
of cecal content.
MITChip: PCR Primers and Conditions
[0157] DNA extracted from cecal contents was analyzed using the
Mouse Intestinal Tract Chip (MITChip), a phylogenetic microarray
consisting of 3,580 different oligonucleotides probes targeting two
hypervariable regions of the 16S rRNA gene (V1 and V6 regions).
Analysis of the MITChip were performed as previously described
(Everard et al. Diabetes 60, 2775-2786 (2011); Geurts et al. Front
Microbiol. 2, 149 (2011)). Briefly, Microbiota analysis was carried
out on level 2 corresponding to genus-like level. Multivariate
analysis was performed by representational difference analysis
(RDA) as implemented in the CANOCO 4.5 software package (Biometris,
Wageningen, The Netherlands) on average signal intensities for 99
bacterial groups (levels 2). All environmental variables were
transformed as log (1+X). A Monte-Carlo permutation test based on
999 random permutations was used to test the significance. P values
<0.05 were considered significant.
Measurement of Plasma Cholesterol
[0158] Plasma samples were assayed for cholesterol by measuring
cholesterol present after enzymatic hydrolysis of ester
cholesterol, using a commercial kit (DiaSys, Condom, France).
Statistical Analysis
[0159] Data are expressed as means .+-.s.e.m. Differences between
two groups were assessed using the unpaired two-tailed Student's
t-test. Data sets involving more than two groups were assessed by
ANOVA followed by Newman-Keuls post hoc tests. Correlations were
analyzed using Pearson's correlation. Data with different
superscript letters are significantly different P<0.05,
according to the post-hoc ANOVA statistical analysis. Data were
analyzed using GraphPad Prism version 5.00 for windows (GraphPad
Software, San Diego, Calif., USA). Results were considered
statistically significant when P<0.05.
Results
[0160] We found that abundance of A. muciniphila was 3300-fold
lower in leptin-deficient obese mice versus their lean littermates
(FIG. 1a). Consistently, we found a 100-fold decrease in high-fat
(HF)-fed mice (FIG. 1c). In both models, prebiotics completely
restore A. muciniphila count (FIG. 1b,c). In HF-fed mice,
prebiotics abolished metabolic endotoxemia (FIG. 1d), normalized
adipose tissue CD11c subpopulation of macrophages (FIG. 1e) and
lowered fat mass (FIG. 1g and FIG. 3b). These results were
significantly and inversely correlated with A. muciniphila (FIG. 1f
and FIG. 3a,c). Nevertheless, it remained to demonstrate whether
molecular mechanisms underlying the onset of these disorders rely
on the lack of A. muciniphila and in contrast if the improvement
after prebiotic treatment results from its higher abundance.
[0161] To address this question, A. muciniphila was orally
administered to control or HF-fed mice during four weeks, thereby
increasing A. muciniphila (FIG. 4a,b). By using a
phylogenetic-microarray (MITChip) (Everard et al. Diabetes 60,
2775-2786 (2011); Geurts et al. Front Microbiol. 2, 149 (2011)), we
found that both HF-diet and A. muciniphila colonization
significantly affected the complex relationship among bacteria
within the gut microbiota composition, as shown by principal
component analyses (PCA) (FIG. 2a) and supported by relative
changes of different taxa.
[0162] We found that A. muciniphila treatment normalized
diet-induced metabolic endotoxemia, adiposity and adipose tissue
CD11c marker (FIG. 2b,c,e and FIG. 5a), without any changes in food
intake (FIG. 5b). Moreover, A. muciniphila treatment reduced body
weight and improved body composition (i.e. fat mass/lean mass
ratio) (FIGS. 5c and 5d). Accordingly, we hypothesized that A.
muciniphila would impact on adipose tissue metabolism, and found
that under HF-diet, A. muciniphila increased mRNA expression of
markers of adipocyte differentiation and lipid oxidation without
affecting lipogenesis (FIG. 2f). Together, these data further
suggest that A. muciniphila controls fat storage and adipose tissue
metabolism.
[0163] We next discovered that colonization with A. muciniphila
completely reversed diet-induced fasting hyperglycemia, by a
mechanism associated with a 40% reduction of hepatic
glucose-6-phosphatase expression (FIG. 6a,b), thereby suggesting
reduced gluconeogenesis. Notably, the insulin-resistance index was
similarly reduced after treatment (FIG. 2d). Collectively, these
results suggest that A. muciniphila contributes to regulation of
adipose tissue metabolism and glucose homeostasis. One explanation
would be that A. muciniphila plays key roles at different levels of
the regulation of gut barrier function. Recent data suggest that
intestinal cells also contribute to the maintenance of gut barrier
by secreting antimicrobial peptides thereby shaping microbial
communities (Pott et al, EMBO Rep (2012)).
[0164] To further elucidate how A. muciniphila colonization affects
gut barrier function; we measured the expression of Paneth and
epithelial cells antibacterial markers in the ileum. We found that
A. muciniphila increased Reg3g (regenerating islet-derived 3-gamma,
RegIII.gamma.) expression under control diet, whereas this effect
was not observed in HF-fed mice (FIG. 7a). Pla2g2a, Defa expression
were similar between groups, whereas Lyz 1 expression tends to be
lower after bacteria administration (FIG. 7b,c,d). IgA are secreted
in intestinal lumen and are known to restrict mucosal bacterial
penetration (Vaishnava, S., et al. Science 334, 255-258 (2011)),
here we found that fecal IgA levels were not affected by the
treatments (FIG. 7e). Thereby, suggesting that A. muciniphila
controls gut barrier function by other mechanisms involving its
epithelial signalling (Derrien et al. Front Microbiol 2, 166
(2011)). We may not rule out that the endocannabinoid system plays
a crucial role in this context; since we found that A. muciniphila
treatment increased 2-oleoylglycerol, 2-palmitoylglycerol and
2-arachidonoylglycerol intestinal levels (FIG. 2g). Importantly,
2-oleoylglycerol has been shown to stimulate glucagon-like
peptide-1 (GLP-1) release from intestinal L-cells suggesting that
both GLP-1 and GLP-2 might improve gut barrier and glucose
homeostasis in this context (Hansen, et al. J Clin Endocrinol Metab
96, E1409-1417 (2011)). Moreover, 2-arachidonoylglycerol reduces
gut permeability and 2-palmitoylglycerol (Alhouayek et al FASEB J
25, 2711-2721 (2011); Ben-Shabat, et al. Eur.J.Pharmacol. 353,
23-31 (1998)) potentiates 2-arachidonoylglycerol anti-inflammatory
effects. Therefore, it is likely that the increased levels of these
three endocannabinoids observed after A. muciniphila colonization
constitutes a molecular event linking these metabolic features.
[0165] Recent evidences support that interactions between gut
microbiota and mucus layer are dynamic systems affecting the
biology of mucus barrier (Belzer et al, ISME J 6, 1449-1458 (2012);
Johansson et al, Proc Natl Acad Sci USA 108 Suppl 1, 4659-4665
(2011)). Thus we investigated the impact of A. muciniphila
colonization on the inner mucus layer thickness. Remarkably, we
found a 46% thinner mucus layer in HF-fed mice (FIG. 2h), whereas
A. muciniphila colonization counteracts this decrease (FIG. 2h).
Together these novel findings support the idea that the presence of
A. muciniphila within mucus layer is a crucial mechanism to control
mucus turnover (Belzer et al, ISME J 6, 1449-1458 (2012)). We next
examined whether A. muciniphila also affects Reg3g expression in
the colon epithelial cells. Strikingly, Reg3g expression was
reduced by about 50% under HF-diet. A. muciniphila completely
blunted this effect and even more increased Reg3g expression by
400% as compared to HF-fed mice (FIG. 2i). Thus this links the
colonization of the colon, but not ileum, by A. muciniphila with
the fundamental immune mechanism by which RegIII.gamma. promotes
host-bacterial mutualism and regulates the spatial relationships
between microbiota and host (Vaishnava, S., et al. Science 334,
255-258 (2011)). It is important to note that in germ-free mice A.
muciniphila induces gene expression in the colon rather than the
ileum (Derrien et al. Front Microbiol 2, 166 (2011)).
[0166] To further demonstrate whether A. muciniphila has to be
alive to exert its metabolic effects, we have compared the impact
of viable A. muciniphila administration (2.10.sup.8 bacterial cells
suspended in 200 .mu.l of sterile anaerobic phosphate-buffered
saline (PBS)) to heat-killed/inactivated A. muciniphila
(autoclaving, 15 minutes, 121.degree. C., 225 kPa). We found that
viable and metabolically active A. muciniphila counteracted
diet-induced metabolic endotoxemia, fat mass development and
altered adipose tissue metabolism (FIG. 8A, B, D and FIG. 9A) to a
similar extent as observed in the first set of experiments.
Importantly, these effects were not observed following the
administration of heat-inactivated A. muciniphila (FIG. 8A, B, D
and FIG. 9A). In addition, we found that metabolically active A.
muciniphila significantly reduced plasma glucose levels following
an oral glucose tolerance test (FIG. 8C), whereas heat-inactivated
A. muciniphila exhibited similar glucose intolerance than HF-fed
mice (FIG. 8C). Finally, we confirmed that metabolically active A.
muciniphila restored mucus layer thickness upon HF-diet whereas we
found that heat-inactivated A. muciniphila did not improve mucus
layer thickness as compared to HF (FIGS. 8E and F). It is worth
noting that we found 100-fold more metabolically active A.
muciniphila recovered from the cecal and colonic content of A.
muciniphila treated mice as compared to HF and heat-inactivated
bacteria group (HF-Akk: 9.5+/-1.02 Log.sub.10 cells/mg of content,
HF and HF-K-Akk: 6.8+/-0.51 Log.sub.10 cells/mg of content,
P=0.0059), thereby evidencing the viability of A. muciniphila after
oral administration.
[0167] These results thus confirm that that HF diet-induced obesity
is associated with changes in gut microbiota composition, however,
antimicrobial peptides in the ileum were not affected by the
treatments. In contrast, Reg3g expression in colon epithelial cells
was significantly reduced by approximately 50% in HF and
heat-inactivated A. muciniphila treated mice, whereas metabolically
active A. muciniphila treatment completely blunted this effect and
increased Reg3g expression upon HF diet (FIG. 9B).
[0168] We then wanted to test if A. muciniphila administration was
still efficient during a prolonged high-fat diet treatment (8
weeks) and if the administration of A. muciniphila 3 times a week
(instead of daily) was sufficient to protect against diet-induced
obesity. The preparations as well as the doses of A. muciniphila
were similar to those presented in the protocol using daily oral
gavage or metabolically inactivated A. muciniphila.
[0169] We found that A. muciniphila treatment reduces body weight
gain (FIG. 10A) by about 30% although mice were ingesting high-fat
diet without any fat lost in their feces and changes in food intake
behavior. This was also associated with a reduction of about 45% of
the adipose tissue weight (subcutaneous adipose tissue) (FIG. 10B)
and 35% decrease in visceral fat depots (mesenteric and epididymal)
(FIG. 10C). Thus, this set of data support the fact that A.
muciniphila administration remains efficient during a prolonged
treatment and the treatment is still efficient if A. muciniphila is
administered 3 times per week instead of daily.
[0170] In order to confirm that these results were specific of A.
muciniphila, we then treated HF-fed mice with a probiotic (i.e.
Lactobacillus plantarum WCFS1). We found that L. plantarum
administration did not change fat mass development, adipose tissue
metabolism, mucus layer thickness, colon Reg3g mRNA, and metabolic
endotoxemia (FIG. 12A-E).
[0171] Hypercholesterolemia is known as a key factor involved in
cardiovascular diseases. We therefore tested the effect of A.
muciniphila administration on plasma cholesterol of mice fed a
high-fat diet. As shown in FIG. 11, A. muciniphila treatment
significantly decreases (about 15%) plasma cholesterol, thereby
contributing with LPS and the other metabolic parameters to an
improved cardio-metabolic risk profile.
[0172] In summary, our findings not only provide substantial
insights into the intricate mechanisms by which A. muciniphila
regulates the crosstalk between the host and the gut microbiota,
but also provide a rationale for considering the development of a
treatment using this human mucus-colonizer for the prevention or
the treatment of obesity and associated metabolic disorders such
as, for example, hypercholesterolemia.
Sequence CWU 1
1
30123DNAArtificial Sequencesource1..23/mol_type="unassigned DNA"
/note="Primer RPL-19 Forward" /organism="Artificial Sequence"
1gaaggtcaaa gggaatgtgt tca 23216DNAArtificial
Sequencesource1..16/mol_type="unassigned DNA" /note="Primer RPL-19
Reverse" /organism="Artificial Sequence" 2cctgttgctc acttgt
16321DNAArtificial Sequencesource1..21/mol_type="unassigned DNA"
/note="Primer Reg3g Forward" /organism="Artificial Sequence"
3ttcctgtcct ccatgatcaa a 21420DNAArtificial
Sequencesource1..20/mol_type="unassigned DNA" /note="Primer Reg3g
Reverse" /organism="Artificial Sequence" 4catccacctc tgttgggttc
20527DNAArtificial Sequencesource1..27/mol_type="unassigned DNA"
/note="Primer Lyz1 Forward" /organism="Artificial Sequence"
5gccaaggtct acaatcgttg tgagttg 27623DNAArtificial
Sequencesource1..23/mol_type="unassigned DNA" /note="Primer Lyz1
Reverse" /organism="Artificial Sequence" 6cagtcagcca gcttgacacc acg
23722DNAArtificial Sequencesource1..22/mol_type="unassigned DNA"
/note="Primer Pla2g2a Forward" /organism="Artificial Sequence"
7aggattcccc caaggatgcc ac 22825DNAArtificial
Sequencesource1..25/mol_type="unassigned DNA" /note="Primer Pla2g2a
Reverse" /organism="Artificial Sequence" 8cagccgtttc tgacaggagt
tctgg 25924DNAArtificial Sequencesource1..24/mol_type="unassigned
DNA" /note="Primer CD11cc Forward" /organism="Artificial Sequence"
9acgtcagtac aaggagatgt tgga 241026DNAArtificial
Sequencesource1..26/mol_type="unassigned DNA" /note="Primer CD11cc
Reverse" /organism="Artificial Sequence" 10atcctattgc agaatgcttc
tttacc 261126DNAArtificial Sequencesource1..26/mol_type="unassigned
DNA" /note="Primer Defa Forward" /organism="Artificial Sequence"
11ggtgatcatc agaccccagc atcagt 261224DNAArtificial
Sequencesource1..24/mol_type="unassigned DNA" /note="Primer Defa
Reverse" /organism="Artificial Sequence" 12aagagactaa aactgaggag
cagc 241320DNAArtificial Sequencesource1..20/mol_type="unassigned
DNA" /note="Primer Fasn Forward" /organism="Artificial Sequence"
13ttccaagacg aaaatgatgc 201420DNAArtificial
Sequencesource1..20/mol_type="unassigned DNA" /note="Primer Fasn
Reverse" /organism="Artificial Sequence" 14aattgtggga tcaggagagc
201524DNAArtificial Sequencesource1..24/mol_type="unassigned DNA"
/note="Primer Cpt1a Forward" /organism="Artificial Sequence"
15agaccgtgag gaactcaaac ctat 241618DNAArtificial
Sequencesource1..18/mol_type="unassigned DNA" /note="Primer Cpt1a
Reverse" /organism="Artificial Sequence" 16tgaagagtcg ctcccact
181722DNAArtificial Sequencesource1..22/mol_type="unassigned DNA"
/note="Primer Pgc1a Forward" /organism="Artificial Sequence"
17agccgtgacc actgacaacg ag 221823DNAArtificial
Sequencesource1..23/mol_type="unassigned DNA" /note="Primer Pgc1a
Reverse" /organism="Artificial Sequence" 18gctgcatggt tctgagtgct
aag 231919DNAArtificial Sequencesource1..19/mol_type="unassigned
DNA" /note="Primer Ppara Forward" /organism="Artificial Sequence"
19caacggcgtc gaagacaaa 192019DNAArtificial
Sequencesource1..19/mol_type="unassigned DNA" /note="Primer Ppara
Reverse" /organism="Artificial Sequence" 20tgacggtctc cacggacat
192121DNAArtificial Sequencesource1..21/mol_type="unassigned DNA"
/note="Primer Acox1 Forward" /organism="Artificial Sequence"
21ctatgggatc agccagaaag g 212221DNAArtificial
Sequencesource1..21/mol_type="unassigned DNA" /note="Primer Acox1
Reverse" /organism="Artificial Sequence" 22agtcaaaggc atccaccaaa g
212323DNAArtificial Sequencesource1..23/mol_type="unassigned DNA"
/note="Primer Acc1 Forward" /organism="Artificial Sequence"
23tgttgagacg ctggtttgta gaa 232425DNAArtificial
Sequencesource1..25/mol_type="unassigned DNA" /note="Primer Acc1
Reverse" /organism="Artificial Sequence" 24ggtccttatt attgtcccag
acgta 252521DNAArtificial Sequencesource1..21/mol_type="unassigned
DNA" /note="Primer Cebpa Forward" /organism="Artificial Sequence"
25gagccgagat aaagccaaac a 212616DNAArtificial
Sequencesource1..16/mol_type="unassigned DNA" /note="Primer Cebpa
Reverse" /organism="Artificial Sequence" 26gcgcaggcgg tcattg
162720DNAArtificial Sequencesource1..20/mol_type="unassigned DNA"
/note="Primer G6pc Forward" /organism="Artificial Sequence"
27aggaaggatg gaggaaggaa 202820DNAArtificial
Sequencesource1..20/mol_type="unassigned DNA" /note="Primer G6pc
Reverse" /organism="Artificial Sequence" 28tggaaccaga tgggaaagag
202920DNAArtificial Sequencesource1..20/mol_type="unassigned DNA"
/note="Primer F-Akkermansia muciniphila" /organism="Artificial
Sequence" 29ccttgcggtt ggcttcagat 203020DNAArtificial
Sequencesource1..20/mol_type="unassigned DNA" /note="Primer
R-Akkermansia muciniphila" /organism="Artificial Sequence"
30cagcacgtga aggtggggac 20
* * * * *