U.S. patent application number 17/319362 was filed with the patent office on 2021-10-14 for method for producing selenoneine.
This patent application is currently assigned to KIKKOMAN CORPORATION. The applicant listed for this patent is KIKKOMAN CORPORATION. Invention is credited to Seiichi HARA, Keiichi ICHIKAWA, Keiko KUROSAWA, Yasutomo SHINOHARA, Michiaki YAMASHITA, Yumiko YAMASHITA.
Application Number | 20210317463 17/319362 |
Document ID | / |
Family ID | 1000005678796 |
Filed Date | 2021-10-14 |
United States Patent
Application |
20210317463 |
Kind Code |
A1 |
ICHIKAWA; Keiichi ; et
al. |
October 14, 2021 |
METHOD FOR PRODUCING SELENONEINE
Abstract
The purpose of the present invention is to provide a method for
producing selenoneine that allows production of selenoneine at
higher yields as compared with a conventional technology, and,
therefore, enables selenoneine production on an industrial scale.
This purpose can be achieved by a method for producing selenoneine,
comprising the step of applying histidine and a selenium compound
to a transformant that has a gene encoding an enzyme of (1) below
introduced therein and that can overexpress the introduced gene, to
obtain selenoneine. (1) An enzyme that catalyzes a reaction in
which hercynylselenocysteine is produced from histidine and
selenocysteine in the presence of S-adenosylmethionine and iron
(II).
Inventors: |
ICHIKAWA; Keiichi;
(Noda-shi, JP) ; SHINOHARA; Yasutomo; (Noda-shi,
JP) ; HARA; Seiichi; (Noda-shi, JP) ;
KUROSAWA; Keiko; (Noda-shi, JP) ; YAMASHITA;
Yumiko; (Yokohama-shi, JP) ; YAMASHITA; Michiaki;
(Yokohama-shi, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
KIKKOMAN CORPORATION |
Noda-shi |
|
JP |
|
|
Assignee: |
KIKKOMAN CORPORATION
Noda-shi
JP
|
Family ID: |
1000005678796 |
Appl. No.: |
17/319362 |
Filed: |
May 13, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15750792 |
Feb 6, 2018 |
11028400 |
|
|
PCT/JP2016/068128 |
Jun 17, 2016 |
|
|
|
17319362 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12P 17/10 20130101;
C12N 15/09 20130101; C12R 2001/685 20210501; C12N 9/88 20130101;
C12R 2001/69 20210501; C12N 15/63 20130101; C12N 1/145 20210501;
C12R 2001/66 20210501; C12N 9/0071 20130101; C12N 1/14 20130101;
C12R 2001/665 20210501 |
International
Class: |
C12N 15/63 20060101
C12N015/63; C12N 15/09 20060101 C12N015/09; C12N 9/02 20060101
C12N009/02; C12N 9/88 20060101 C12N009/88; C12N 1/14 20060101
C12N001/14; C12P 17/10 20060101 C12P017/10 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 7, 2015 |
JP |
2015-157443 |
Claims
1. A method for producing selenoneine, comprising the step of
applying histidine and a selenium compound other than selenocystine
to a transformant by using as a host organism microorganisms of
genus Aspergillus that has a gene encoding an enzyme of (1)
introduced therein as foreign gene and that can overexpress the
introduced gene to obtain selenoneine, wherein the enzyme of (1)
catalyzes a reaction in which hercynylselenocysteine of formula [I]
is produced from histidine and selenocysteine in the presence of
S-adenosylmethionine and iron (II), wherein the gene encoding the
enzyme of (1) has the nucleotide sequence at least 90% identity to
the nucleotide sequence of SEQ ID NO: 1 or 23, or the enzyme of (1)
has the amino acid sequence at least 90% identity to the amino acid
sequence of SEQ ID NO: 4 or 24, and wherein formula [I] is:
##STR00006##
2. The method according to claim 1, wherein the selenium compound
comprise at least one selenium compound selected from the group
consisting of selenocysteine, selenomethionine,
Se-(methyl)seleno-L-cysteine, selenopeptides, selenoproteins and
salts thereof and selenium yeast, and/or the selenium compound
comprises at least one selenium compound selected from the group
consisting of selenic acid, selenous acid, selenium chloride,
selenium, selenides, selenium sulfide, dimethylselenium,
selentophosphate, selenium dioxide, and salts thereof.
3. The method according to claim 1, wherein the transformant is a
transformant that further has a gene encoding an enzyme of (2)
introduced therein and that can overexpress the introduced gene,
wherein the enzyme of (2) catalyzes a reaction in which selenoneine
is produced from hercynylselenocysteine of formula [I] using
pyridoxal 5'-phosphate as a coenzyme, wherein formula [I] is:
##STR00007##
4. The method according to claim 1, wherein the transformant is
produced by using as a host organism a microorganism that expresses
at least one enzyme selected from the group consisting of selenic
acid reductase, selenocysteine lyase, and serine dehydratase.
5. The method according to claim 1, wherein the transformant is
produced by using as a host organism a microorganism of the genus
Aspergillus selected from the group consisting of Aspergillus
sojae, Aspergillus oryzae, Aspergillus niger, Aspergillus tamarii,
Aspergillus awamori, Aspergillus usamii, Aspergillus kawachii, and
Aspergillus saitoi.
6. The method according to claim 1, wherein the transformant is a
transformant in which the expression of the gene encoding the
enzyme of (1) is enhanced to increase the amount of selenoneine as
compared to the host organism.
7. The method according to claim 1, wherein the transformant is a
transformant in which the expression of the gene encoding the
enzyme of (1) is enhanced so that the amount of selenoneine
produced when the transformant is cultured in a
selenocystine-containing medium suitable for the growth of the host
organism at 30.degree. C. for 5 days is not less than 10 .mu.g per
gram of wet cell mass.
8. The method according to claim 1, wherein the gene encoding the
enzyme of (2) has the nucleotide sequence at least 90% identity to
the nucleotide sequence of SEQ ID NO: 2 or 3, or the enzyme of (2)
has the amino acid sequence at least 90% identity to the amino acid
sequence of SEQ ID NO: 5 or 6.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a divisional of U.S. application
Ser. No. 15/750,792 filed Feb. 6, 2018, which is the national phase
of PCT International Application PCT/JP2016/068128 filed on Jun.
17, 2016, which claims the benefit of priority to Japanese Patent
Application No. 2015-157443 filed on Aug. 7, 2015, the disclosure
of each of which (including Sequence Listings) is incorporated
herein by reference in its entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing
submitted in ASCII format via EFS-Web on May 13, 2021, and is
hereby incorporated by reference in its entirety. Said ASCII copy
is named 2018-02-06_SequenceListing_6134-0124PUS1.txt, and is
59,784 bytes in size.
TECHNICAL FIELD
[0003] The present invention relates to a method for producing
selenoneine. In particular, the present invention relates to a
method for producing selenoneine using a microorganism having the
ability to produce selenoneine.
BACKGROUND ART
[0004] Selenium (Se) is an element belonging to the group 16 of the
periodic table. In other words, it is one of the elements of the
oxygen family (chalcogen elements). Selenium is a trace element
essential to humans. Selenium forms part of enzymes and proteins in
living bodies and plays an important role in antioxidant responses.
Since selenium is abundant in algae, fish and shellfish, meat, egg
yolk and the like, it can be ingested through food products
containing these selenium sources.
[0005] In animal species, for example, glutathione peroxidase and
other selenium-containing enzymes that contain selenocysteine and
selenomethionine as constituent amino acids are known. The presence
of selenoproteins is also reported in many algae and plant
species.
[0006] Selenium deficiency can cause cell damage due to peroxides
that can result in the onset of various diseases, including
cardiomyopathy (Keshan disease), Kashin-Beck disease
(osteochondroarthrosis deformans), coronary artery diseases such as
angina pectoris and myocardial infarction, and cardiovascular
diseases. In addition, selenium deficiency has been reported to
induce muscle pain, dry skin, hepatic necrosis, as well as
increased risk of cancers, including lung cancer, bowel cancer,
prosthetic cancer, rectal cancer, breast cancer and leukemia.
[0007] On the other hand, selenium has toxicity and is harmful. For
example, selenium exhibits increased toxicity in the form of
selenium oxyanion. When ingested in excessive amounts, selenium is
known to induce deformed nails and alopecia, gastrointestinal
injury, neurological disorders, myocardial infarction, acute
dyspnea, renal failure and other disorders. Ministry of Health,
Labour and Welfare of Japan provides the standard for ingestion of
selenium in meals, which defines, for example, the estimated
average required amount of 25 (20) .mu.g/day, the recommended
amount of 30 (25) .mu.g/day, and the maximum amount of 460 (350)
.mu.g/day for males (females) aged 30 to 49 (See, Non-Patent
Document 1, which is incorporated herein by reference in its
entirety).
[0008] Currently, supplements containing an inorganic selenium such
as selenous acid (inorganic selenium compound) or an organic
selenium such as selenomethionine (organic selenium compound) are
used in the prevention or treatment of diseases associated with
selenium deficiency. Selenium-rich yeast obtained by culturing
yeast in a medium containing an inorganic selenium compound is also
used as a type of organic selenium compounds.
[0009] Another type of organic selenium compounds is selenoneine, a
compound known to have antioxidant activity in living bodies and
the ability to promote cell growth (See, Patent Document 1, which
is incorporated herein by reference in its entirety). Selenoneine
is a selenium analog obtained by replacing the SH group of
ergothioneine with SeH group and has an antioxidant activity 1,000
times higher than ergothioneine (See, Non-Patent Document 3, which
is incorporated herein by reference in its entirety).
[0010] Known methods for producing selenoneine include extraction
of selenoneine from organs or blood of animals (See, Patent
Document 1 below, which is incorporated herein by reference in its
entirety), and use of fission yeast Schizosaccharomyces pombe
transfected with genes involved in ergothioneine biosynthesis (See,
Non-Patent Document 2, which is incorporated herein by reference in
its entirety).
CITATION LIST
Patent Document
[0011] Patent Document 1: JP5669056
Non-Patent Document
[0012] Non-Patent Document 1: 2015 edition of Report of Committee
for Determining Standard for Ingestion in Meals for Japanese;
Ministry of Health, Labour and Welfare of Japan; Mar. 28, 2014
(www.mhlw.go.jp/file/05-Shingikai-10901000-Kenkoukyoku-Soumuka/0000042638-
.pdf).
[0013] Non-Patent Document 2: PLoS One 2014 May 14; 9(5):
e97774
[0014] Non-Patent Document 3: J. Biol. Chem.; 2010 18134-8
SUMMARY OF INVENTION
Technical Problem
[0015] According to the method described in Patent Document 1,
selenoneine is extracted from the guts or blood of fish. However,
since selenoneine is scarce in fish guts or blood, large amounts of
fish are required to obtain large amounts of selenoneine.
[0016] On the other hand, Non-Patent Document 2 describes in vivo
synthesis of selenoneine using Schizosaccharomyces pombe
transformant transformed to overexpress gene SPBC1604.01 encoding
an enzyme known as Egt1 that catalyzes a reaction in which
hercynyl-selenocysteine is produced from histidine and
selenocysteine. However, only very small amounts of selenoneine can
be obtained using the Schizosaccharomyces pombe transformant as
described in Non-Patent Document 2.
[0017] Accordingly, it is an objective of the present invention to
provide a method for producing selenoneine that allows production
of selenoneine at higher yields as compared to the method using the
Schizosaccharomyces pombe transformant as described in Non-Patent
Document 2 in order to enable industrial-scale production of
selenoneine.
Solution to Problem
[0018] In the course of extensive studies to find solutions to the
above-described problems, the present inventors have succeeded in
identifying, from the fungus Aspergillus sojae, a gene AsEgtA
encoding an enzyme that catalyzes a reaction in which selenoneine
is produced from histidine and a selenium compound.
[0019] The present inventors have also constructed a DNA construct
for overexpressing AsEgtA protein and used it to transform
Aspergillus sojae to successfully produce Aspergillus sojae
transformant that can overexpress the AsEgtA protein. Similarly,
the present inventors have identified the gene AoEgtA from
Aspergillus oryzae that has a high homology with the gene AsEgtA
and used it to successfully produce Aspergillus oryzae transformant
capable of overexpressing the AoEgtA protein.
[0020] Surprisingly, the resulting transformant was capable of
producing selenoneine not only from organic selenium compounds such
as selenocystine, but also from inorganic selenium compounds such
as selenous acid. Moreover, the amount of selenoneine produced by
the Aspergillus oryzae transformant was significantly greater than
the amount produced by Schizosaccharomyces pombe transformant as
described in Non-Patent Document 2.
[0021] More surprisingly, the present inventors have found out that
the above-described transformant explicitly exhibits higher
resistance to selenium compounds as compared to the wild-type
strain even in the presence of a toxic concentration of selenium
compound. Also, the above-described transformant can be cultured
using the standard technique and their growth rate is comparable to
that of the wild-type strain. These observations suggest that the
above-described transformant may be used to produce selenoneine at
large scale. It is these successful examples and findings that
ultimately led to the completion of the present invention.
[0022] According to one embodiment of the present invention, there
is provided a method for producing selenoneine, the method
comprising the step of applying histidine and a selenium compound
to a transformant that has a gene encoding an enzyme of (1) below
introduced therein and that can overexpress the introduced gene, to
obtain selenoneine.
(1) An enzyme that catalyzes a reaction in which
hercynylselenocysteine shown in the formula [I] below is produced
from histidine and selenocysteine in the presence of
S-adenosylmethionine and iron (II):
##STR00001##
[0023] Preferably, the selenium compound is at least one selenium
compound selected from the group consisting of organic selenium
compounds and inorganic selenium compounds, and salts thereof.
[0024] Preferably, the organic selenium compounds and salts thereof
comprise at least one selenium compound selected from the group
consisting of selenocysteine, selenocystine, selenomethionine,
Se-(methyl)seleno-L-cysteine, selenopeptides, selenoproteins and
salts thereof and selenium yeast, and the inorganic selenium
compound and salts thereof comprise at least one selenium compound
selected from the group consisting of selenic acid, selenous acid,
selenium chloride, selenium, selenium sulfide, dimethylselenium,
selenophosphate, selenium dioxide and salts thereof.
[0025] Preferably, the transformant is a transformant that further
has a gene encoding an enzyme of (2) below introduced therein and
that can overexpress the introduced gene.
(2) An enzyme that catalyzes a reaction in which selenoneine is
produced from hercynylselenocysteine shown in the formula [I] below
using pyridoxal 5'-phosphate as a coenzyme:
##STR00002##
[0026] Preferably, the transformant is produced by using as a host
organism a microorganism that expresses at least one enzyme
selected from the group consisting of selenic acid reductase,
selenocysteine lyase, and serine dehydratase.
[0027] Preferably, the transformant is produced by using as a host
organism at least one microorganism selected from the group
consisting of microorganisms of genus Aspergillus, genus
Escherichia, genus Trichoderma, genus Fusarium, genus Penicillium,
genus Rhizopus, and genus Neurospora.
[0028] Preferably, the microorganism of the genus Aspergillus is a
microorganism selected from the group consisting of Aspergillus
sojae, Aspergillus oryzae, Aspergillus niger, Aspergillus tamarii,
Aspergillus awamori, Aspergillus usamii, Aspergillus kawachii, and
Aspergillus saitoi.
[0029] Preferably, the transformant is produced by using E. coli as
a host organism.
[0030] Preferably, the transformant is a transformant in which the
expression of the gene encoding the enzyme of (1) is enhanced to
increase the amount of selenoneine as compared to the host
organism.
[0031] Preferably, the transformant is a transformant in which the
expression of the gene encoding the enzyme of (1) is enhanced so
that the amount of selenoneine produced when the transformant is
cultured in a selenocystine-containing medium suitable for the
growth of the host organism at 30.degree. C. for 5 days is
preferably not less than 10 .mu.g per gram of wet cell mass, more
preferably not less than 20 .mu.g per gram of wet cell mass, even
more preferably not less than 40 .mu.g per gram of wet cell mass,
and still more preferably not less than 100 .mu.g per gram of wet
cell mass.
[0032] Preferably, the gene encoding the enzyme of (1) is a gene
selected from the group consisting of a gene having a base sequence
of SEQ ID NO: 1, and a gene having a base sequence of SEQ ID NO: 23
in the sequence listing, or the enzyme (1) is an enzyme selected
from the group consisting of an enzyme having an amino acid
sequence of SEQ ID NO: 4, and an enzyme having an amino acid
sequence of SEQ ID NO: 24 in the sequence listing.
[0033] Preferably, the gene encoding the enzyme of (2) is a gene
selected from the group consisting of a gene having a base sequence
of SEQ ID NO: 2, and a gene having a base sequence of SEQ ID NO: 3
in the sequence listing, or the enzyme (2) is an enzyme selected
from the group consisting of an enzyme having an amino acid
sequence of SEQ ID NO: 5, and an enzyme having an amino acid
sequence of SEQ ID NO: 6 in the sequence listing.
[0034] As a further embodiment of the present invention, it has
been found that certain fungi, including those of genus
Aspergillus, such as Aspergillus sojae, can be used to produce
selenoneine from organic selenium compounds such as selenocystine
and inorganic selenium compounds such as selenous acid while the
amount of selenoneine produced is less than the amount produced by
the production method using the above-described transformant.
Specifically, according to another embodiment of the present
invention, there is provided a method for producing selenoneine,
the method comprising the step of applying histidine and a selenium
compound to a fungus, including those of genus Aspergillus, such as
Aspergillus sojae, having a gene encoding the enzyme of (1) on its
genome DNA in order to obtain selenoneine.
Advantageous Effects of Invention
[0035] According to the production method or the transformant,
which serves as one embodiment of the present invention,
selenoneine can be produced at high yields under conditions for
culturing standard host organisms. As a consequence, the production
method or the transformant serving as one embodiment of the present
invention allows industrial-scale production of selenoneine.
BRIEF DESCRIPTION OF DRAWINGS
[0036] FIG. 1 shows the results of LC-MS analysis showing the peaks
corresponding to selenoneine for selenium extracts prepared from
cultures obtained by culturing a control strain and a transformed
Aspergillus sojae ("(AsEgtA+AsEgtC) transformant") in a
selenocystine-supplemented DPY liquid medium as described in
Examples.
[0037] FIG. 2 shows the results of LC-MS analysis showing the peaks
corresponding to ergothioneine for selenium extracts prepared from
cultures obtained by culturing a control strain and a transformed
Aspergillus sojae ("(AsEgtA+AsEgtC) transformant") in a
selenocystine-supplemented DPY liquid medium as described in
Examples.
[0038] FIG. 3 is an enlarged MS spectrum showing the peaks of the
results of LC-MS analysis in FIG. 1 near 31-min retention time.
[0039] FIG. 4 shows calculated values for the ion distribution of
selenoneine estimated from the relative isotopic abundance.
[0040] FIG. 5 shows the results of LC-MS analysis showing the peaks
corresponding to selenoneine for selenium extracts prepared from
cultures obtained by culturing a transformed Aspergillus sojae in a
DPY liquid medium ("DPY"), a selenocystine-supplemented DPY liquid
medium ("DPY+selenocystine"), or a selenous acid-supplemented DPY
liquid medium ("DPY+selenous acid"), as described in Examples.
[0041] FIG. 6 shows the results of LC-MS analysis showing the peaks
corresponding to selenoneine for selenium extracts prepared from
cultures obtained by culturing a control strain and a transformed
Aspergillus oryzae ("AoEgtA transformant") in a
selenocystine-supplemented DPY liquid medium as described in
Examples.
[0042] FIG. 7 shows the results of evaluation of toxicity of
selenocystine against a control strain ("NBRC4239 strain") and a
transformed Aspergillus sojae ("(AsEgtA+AsEgtC) transformant") as
described in Examples.
[0043] FIG. 8 shows the results of evaluation of toxicity of
selenous acid against a control strain ("NBRC4239 strain") and a
transformed Aspergillus sojae ("(AsEgtA+AsEgtC) transformant") as
described in Examples.
[0044] FIG. 9 is a photographic representation of SDS-PAGE
performed with the total protein extracted from transformants and
control strain as described in Examples. Lane 1 corresponds to the
total protein derived from the control strain, Lane 2 corresponds
to the total protein derived from the AsEgtA transformant, Lane 3
corresponds to the total protein derived from the AsEgtB
transformant, Lane 4 corresponds to the total protein derived from
the AsEgtC transformant, Lane 5 corresponds to the total protein
derived from the (AsEgtA+AsEgtB) transformant, and Lane 6
corresponds to the total protein derived from the (AsEgtA+AsEgtC)
transformant.
DESCRIPTION OF EMBODIMENTS
[0045] A production method and a transformant, which provides one
embodiment of the present invention, will now be described in
details.
(General Description of the Production Method)
[0046] One embodiment of the production method includes the step of
applying histidine and a selenium compound to a transformant that
has a gene encoding an enzyme of (1) below (referred to as enzyme
(1), hereinafter) introduced therein and that can overexpress the
introduced gene, to obtain selenoneine. As used herein, the
selenium compound includes, in addition to selenium compounds
themselves, salts, complexes, crosslinked products and derivatives
of selenium compounds.
(1) An enzyme that catalyzes a reaction in which
hercynylselenocysteine shown in the formula [I] below is produced
from histidine and selenocysteine in the presence of
S-adenosylmethionine and iron (II):
##STR00003##
[0047] The transformant for use in one embodiment of the production
method can overexpress the gene encoding the enzyme (1) introduced
as a foreign gene to ultimately produce selenoneine from histidine
and a selenium compound. The gene encoding the enzyme (1) to be
overexpressed maybe one or two or more genes.
[0048] Without wishing to be bound by any theory or presumption,
the reaction in which hercynylselenocysteine is produced from
histidine and selenocysteine, which is one proposed mechanism of
the biosynthesis of selenoneine in fungi, can be schematically
represented by the formula (II) below:
##STR00004##
wherein SAM represents 5-adenosylmethionine.
[0049] The enzyme (1) corresponds to egtA in the formula (II).
[0050] The transformant for use in one embodiment of the production
method is preferably a transformant that further has a gene
encoding an enzyme of (2) below (referred to as enzyme (2),
hereinafter) introduced therein and that can overexpress the
introduced gene.
(2) An enzyme that catalyzes a reaction in which selenoneine is
produced from hercynylselenocysteine shown in the formula [I] above
using pyridoxal 5'-phosphate as a coenzyme.
[0051] It is believed that the transformant for use in one
embodiment of the production method can overexpress the gene
encoding the enzyme (2), which is introduced as a foreign gene, to
effectively produce selenoneine from a selenoneine precursor such
as hercynylselenocysteine. However, the gene encoding the enzyme
(2) may not necessarily be introduced as long as the host organism
expresses the enzyme (2) at sufficient levels. The gene encoding
the enzyme (2) to be overexpressed may be one or two or more
genes.
[0052] The transformants for use in one embodiment of the present
invention are generally divided into two categories: those that
overexpress the gene encoding the enzyme (1) but not the gene
encoding the enzyme (2), and those that overexpress both the gene
encoding the enzyme (1) and the gene encoding the enzyme (2).
(Enzymological Properties of Enzymes (1) and (2))
[0053] As shown in the formula [II] above, the enzyme (1) has an
activity to catalyze the reaction in which histidine is converted
to hercynine with a trimethylated NH.sub.2 group in an
S-adenosylmethionine (SAM)-dependent manner (which is referred to
as "first activity," hereinafter). The enzyme (1) also has an
activity to catalyze the reaction in which hercynylselenocysteine
is produced from hercynine and selenocysteine in the presence of
iron (II) (which is referred to as "second activity," hereinafter).
As a result of the first and the second activities, the enzyme (1)
can produce selenoneine from histidine and selenocysteine in the
presence of S-adenosylmethionine and iron (II).
[0054] The enzyme (2) has an activity to catalyze the reaction in
which selenoneine is produced from hercynylselenocysteine using
pyridoxal 5'-phosphate (PLP) as a coenzyme(which is referred to as
"third activity," hereinafter).
[0055] The transformant for use in one embodiment of the production
method can express a gene or genes encoding the enzyme (1) or the
enzymes (1) and (2) such that it can ultimately produce selenoneine
from organic selenium compounds such as histidine and
selenocysteine under conditions under which the respective enzymes
are activated. More surprisingly, the transformant can produce
selenoneine not only from organic selenium compounds, but also from
inorganic selenium compounds such as selenous acid.
[0056] It should be noted that the enzyme (1) and the enzyme (2)
may be used in the biosynthesis of ergothioneine. One proposed
mechanism of the proposed biosynthesis of ergothioneine in fungi is
represented by the formula [III] below:
##STR00005##
wherein SAM represents S-adenosylmethionine and PLP represents
pyridoxal 5'-phosphate.
[0057] The enzyme (1) corresponds to egtA in the formula [III]
while the enzyme (2) corresponds to egtB and/or egtC in the formula
[III].
(The Structural Properties of Enzymes (1) and (2))
[0058] The enzyme (1) may be any enzyme that has the
above-described enzymological properties; that is, any enzyme that
has an activity to catalyze the reaction in which
hercynylselenocysteine is produced from histidine and
selenocysteine in the presence of S-adenosylmethionine and iron
(II), and is not particularly limited by its structural properties,
such as amino acid sequence, entire or partial conformation and
molecular weight; biochemical properties, such as optimum pH,
optimum temperature and deactivation conditions; the organisms from
which it originates; or other conditions. However, the enzyme (1)
preferably contains conserved domains well-conserved among enzymes
with the first and/or second activities so that it exhibits the
first and the second activities.
[0059] Examples of the conserved domain that, has the first
activity include conserved domains of SAM-dependent
methyltransferase, specific examples of which are SAM-dependent
methyltransferase domains containing the DUF2260 domain. Examples
of the conserved domain that has the second activity include
conserved domains of sulfatase, specific examples of which are
formylglycine-generating enzyme (FGE)-sulfatase domains. In order
for the enzyme to exhibit the first and the second activities, the
above-described domains may not necessarily be connected in tandem;
for example, nonconserved regions may be present within the
domains. The enzyme (1) preferably contains a DinB_2 domain between
the conserved domain of SAM-dependent methyltransferase and the
conserved domain of sulfatase. If present, the DinB_2 domain
preferably contains HX.sub.3HXE, an iron-binding motif.
[0060] For example, one embodiment of the enzyme (I) has a
structure that contains a conserved domain of SAM-dependent
methyltransferase, a DinB_2 domain, and a conserved domain of
sulfatase. Another embodiment of the enzvme (1) has a structure
that contains a SAM-dependent methyltransferase domain containing
DUF2260 domain, a DinB_2 domain containing HX.sub.3HXE, and an
FGE-sulfatase domain.
[0061] One preferred embodiment of the enzyme (1) is one that has
30% or higher, preferably 40% or higher, more preferably 45% or
higher, further more preferably 60% or higher, in particular
preferably 70% or higher sequence identity to NCU04343 described,
in Non-Patent Document 2. As used herein, the term "sequence
identity" refers to the identity between the two sequences aligned
to each other and does not refer to the similarity between the two
sequences. Specific examples of the enzyme (1) include, but are not
limited to, proteins assigned the following accession numbers (the
numbers in the parentheses indicate sequence identities obtained by
Blastp using a AsEgtA protein of SEQ ID NO: 4 as a query sequence):
[0062] XP_00172739.1 (97%), XP_002375556.1 (97%), XP_001211614.1
(74%), GAA90479.1 (75%), XP_001261027.1 (72%), XP_001275843.1
(72%), EDP55069.1 (72%) XP_755900.1 (72%), EHA24811.1 (74%),
XP_001397117.2 (73%), EYE96655.1 (72%), CAK42541.1 (71%),
XP_680889.1 (69%), EPS32723.1 (66), GAD91762.1 (63%), EKV06018.1
(63%), XP_002487159.1 (61%), XP_002145387.1 (61%), CDM31097.1
(62%), XP_002623045.1 (57%), EQL36096.1 (57%), EEQ91012.1 (57%),
XP_002794316.1 (57%), XP_002540839.1 (57%), XP_001246505.1 (57%),
XP_003066681.1 (56%), EFW18329.1 (56%), EEH06820.1 (56%),
XP_003172803.1 (55%), EGE82230.1 (56), EGD95426.1 (54%), EZF30391.1
(54%), EHY53149.1 (53%), XP_002844140.1 (54%), XP_003237555.1
(54%), EXJ78765.1 (52%), XP_001543980.1 (53%), EXJ84167.1 (53%),
EXJ76804.1 (51%), ETI21425.1 (52%), EXJ55868.1 (52%), EKG13377.1
(51%), XP_003836988.1 (51%), EON60831.1 (50%), EGE08446.1 (52%),
EMD86163.1 (51%), EUN21814.1 (51%) EMD69895.1 (50%), EME40669.1
(52%), EUC45427.1 (51%), EEH18365.1 (52%), XP_001939537.1 (51%),
EUC28327.1 (50%), XP_003296645.1 (50%), EER38486.1 (54%),
XP_007587632.1 (50%), EOA87110.1 (50%), EEH47303.1 (54%) EMC91772.1
(51%), EJT79063.1 (50%), XP_007289878.1 (51%) EMF09308.1 (50%),
XP_007274188.1 (49%), XP_003849540.1 (51%), ENH83409.1 (50%),
EQB47754.1 (48%), XP_006693510.1 (51%), ETN41916.1 (50%),
XP_003711933.1 (49%), EWG46299.1 (50%), EGU87412.1 (49%),
ESZ95365.1 (48%), EGC47631.1 (52%), EXM31381.1 (49%), eXL83373.1
(49%) XP_385823.1 (50%), EMT70054.1 (50%), EXK95313.1 (49%),
CCT71860.1 (50%), EXM04867.1 (49%), EXA38531.1 (49%), EWZ34577.1
(49%), EWY87102.1 (49%), ENH70585.1 (49%), EYB29661.1 (50%),
EXK37219.1 (49%), EWZ95323.1 (49%), EGY20613.1 (49%), EME78671.1
(50%), EKJ73623.1 (50%), EFQ30701.1 (48%), EPE09977.1 (48%),
EXV06624.1 (49%), ERS99852.1 (49%), EGO59462.1 (49%),
XP_003348780.1 (48%), EFY99927.1 (49%), XP_007594915.1 (47%),
XP_003660752.1 (49%), EAA27088.3 (49%), ERF68279.1 (49%),
EFX04429.1 (50%), ETR98676.1 (49%), EFY84340.1 (48%),
XP_006968620.1 (48%), XP_00304884.1 (49%), EHK20832.1 (49%),
EPE24413.1 (49%), EJP62962.1 (49%), ETS83740.1 (48%), EHK45989.1
(49%), ELQ64904.1 (47%), XP_006672555.1 (48%), ELQ40007.1 (46%),
EXL83375.1 (50%), EXK95315.1 (50%), CCE33591.1 (48%), EXM04869.1
(51%), EXA38533.1 (50%), EWZ95325.1 (50%), EXK37221.1 (50%),
EWZ34579.1 (50%), EWY87104.1 (50%), CCX31754.1 (47%), XP_956324.2
(46%), and XP_956324.2 (46%). Of the above-listed proteins, the
protein with accession number XP_001727309.1 (97%) is a protein
having an amino acid sequence of SEQ ID NO: 24. Also, it is
confirmed that the protein with accession number XP_001397117.2
(73%), is a protein that is expressed and that has the
above-mentioned first and second activities in Aspergillus sojae,
yet being derived from Aspergillus niger. These results suggest
that methyltransferases (or putative methyltransferases or
hypothetical proteins) having an amino acid sequence with 40% or
higher, preferably 50% or higher, more preferably 70% or higher
sequence identity to the amino acid sequence of the AsEgtA protein
may be used as the enzyme (1).
[0063] The enzyme (2) may also be any enzyme that has the
above-described enzymological properties; that is, any enzyme that
has the PLP-binding cysteine desulfurase activity such that it can
catalyze the reaction in which selenoneine is produced from
hercynylselenocysteine, and is not particularly limited by its
structural properties, biochemical properties, the organisms from
which it originates, or other conditions. However, since the enzyme
(2) has the third activity, it is preferred that the enzyme
contains conserved domains well-conserved among enzymes with the
third activity.
[0064] Examples of the conserved domain that has the third activity
contain conserved domains of PLP-binding cysteine desulfurases. The
enzyme (2) may include at least two types of structurally different
enzymes: those containing a PLP-binding cysteine desulfurase domain
with approximately 75% sequence identity to NCU04636 described in
document by BELLO M H et al. (BELLO M H et al., Fungal Genet Biol.
2012 February; 49(2):160-72; the entire disclosure of which is
incorporated herein by reference) and those containing a
PLP-binding cysteine desulfurase domain with approximately 44%
sequence identity to NCU11365 described in Non-Patent Document 2.
The enzyme (2) may comprise one of the two types or both.
(Amino Acid Sequences of Enzymes (1) and (2))
[0065] The enzymes (1) and (2) may have any amino acid sequence as
long as the resulting enzyme has the above-described enzyrnological
properties, or preferably, the above-described enzymological
properties and structural properties. For example, one embodiment
of the enzyme (1) having the above-described enzymological and
structural properties includes the amino acid sequence of SEQ ID
NO: 4, and one embodiment of the enzyme (2) having the
above-described enzymological and structural properties includes
the amino acid sequences of SEQ ID NOs: 5 and 6. The enzymes having
an amino acid sequence of SEQ ID NOs: 4 to 6 each originate from
Aspergillus sojae and are named by the present inventors as AsEgtA,
AsEgtB, and AsEgtC proteins, respectively. The base sequences of
the genes encoding these enzymes are given in SEQ ID NOs: 1 to
3.
[0066] Likewise, one embodiment of the enzyme (1) having the
above-described enzymological and structural properties includes
the amino acid sequence of SEQ ID NO: 24, The enzyme having an
amino acid sequence of SEQ ID NO: 24 originates from Aspergillus
oryzae and is named by the present inventors as AoEgtA protein. The
base sequence of the gene encoding the enzyme is given in SEQ ID
NO: 23.
[0067] The AsEgtA, AsEgtB and AsEgtC proteins are encoded by genes
encoding these enzymes present on the chromosomal DNA of
Aspergillus sojae. The AoEgtA protein is encoded by gene encoding
the enzyme present, on the chromosomal DNA of Aspergillus oryzae.
The genes present on the chromosomal DNA of the organisms of origin
and the proteins and the enzymes encoded by such genes may be
referred to as "wild-type genes," "wild-type proteins" and
"wild-type enzymes," herein.
[0068] The amino acid sequence of the enzymes (1) and (2) may be
any amino acid sequence resulting from deletion, substitution,
addition or other modification of one to several amino acids in the
amino acid sequence of the wild type enzyme as long as the
resulting enzyme, has the above-described enzymological properties.
As used herein, the range specified by the phrase "one to several"
as in "deletion, substitution or addition of one to several amino
acids" in the amino acid sequence is not particularly limited but
specifically refers to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, or 20 amino acids, preferably 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10 or so amino acids, more preferably 1, 2, 3, 4,
or 5 or so amino acids. As used herein, the term "deletion of amino
acids" means that amino acid residues are lost or eliminated from
the sequence. The term "substitution of amino acids" means that
amino acid residues are replaced with other amino acid residues.
The term "addition of amino acids" means that new amino acid
residues are added to the sequence by inserting them into the
sequence.
[0069] Specific embodiments of "deletion, substitution or addition
of one to several amino acids" include embodiments in which one to
several amino acids are replaced with other chemically similar
amino acids. For example, a hydrophobic amino acid may be
substituted with another hydrophobic amino acid, or a polar amino
acid may be substituted with another polar amino acid having the
same charge. Such chemically similar amino acids are known in the
art for each amino acid. Specific examples of non-polar
(hydrophobic) amino acids include alanine, valine, isoleucine,
leucine, proline, tryptophan, phenylalanine, and methionine.
Examples of polar (neutral) amino acids include glycine, serine,
threonine, tyrosine, glutamine, aspargine, and cysteine. Examples
of positively charged basic amino acids include arginine,
histidine, and lysine. Examples of negatively charged acidic amino
acids include asparatic acid, and glutamic acid.
[0070] Examples of the amino acid sequences resulting from
deletion, substitution, addition or other modification of one to
several amino acids in the amino acid sequence of the wild-type
enzyme include amino acid sequences having a particular percentage
or higher sequence identity to the amino acid sequence of the
wild-type enzyme, such as amino acid sequences having 80% or
higher, preferably 85% or higher, more preferably 90% or higher,
91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or
higher, 96% or higher, 97% or higher, 98% or higher, or 99% or
higher, still more preferably 99.5% or higher sequence identity to
the amino acid sequence of the wild-type enzyme.
(Genes Encoding Enzymes (1) and (2))
[0071] The genes encoding the enzymes (1) and (2) may have any base
sequence as long as such a base sequence encodes an amino acid
sequence of an enzyme that has the above-described enzymological
properties, or preferably, the above-described enzymological
properties and structural properties. The genes encoding the
enzymes (1) and (2) are overexpressed in the transformant to
produce the enzyme (1) and (2). As used herein, the term
"expression of a gene" means that the enzyme encoded by a gene is
produced via transcription and translation in a form that exhibits
its inherent catalytic activities. As used herein, the term
"overexpression of a gene" means that the protein (enzyme) encoded
by an inserted gene is produced at a level exceeding the normal
expression level of the protein in the host organism.
[0072] The genes encoding the enzymes (1) and (2) may be a gene
that can produce the enzymes (1) and (2) via splicing after the
gene introduced into the host organism is transcribed, or
alternatively, it may be a gene that can produce enzymes (1) and
(2) without requiring splicing after the transcription of the
gene.
[0073] The genes encoding the enzymes (1) and (2) may not be
completely identical to the inherent gene (i.e., wild-type gene) of
the organism of origin: it may be any DNA fragment with a base
sequence that hybridizes to the base sequence complementary to the
base sequence of the wild-type gene under stringent conditions as
long as the gene encodes an enzyme having at least the
above-described enzymological properties.
[0074] As used herein, "the base sequence that hybridizes under
stringent conditions" refers to a DNA base sequence obtained by
colony hybridization, plaque hybridization, southern blot
hybridization and other suitable hybridization techniques using a
DNA fragment having the base sequence of the wild-type gene as a
probe.
[0075] As used herein, the term "stringent condition" refers to a
condition under which the signals from specific hybrids can be
clearly distinguished from the signals from non-specific hybrids
and may vary depending on the hybridization system used, type of
the probe, and the sequence and its length. Such conditions may be
determined by varying the hybridization temperature or by varying
the washing temperature and the salt concentration. For example, if
even the signals from non-specific hybrids are strongly detected,
the specificity can be increased by increasing the temperature for
the hybridization and the washing temperature and if necessary, by
decreasing the salt concentration for the washing. In contrast, if
even the signals from specific hybrids are not detected, the
hybrids may be stabilized by decreasing the temperature for the
hybridization and the washing and if necessary, by increasing the
salt concentration for the washing.
[0076] A specific example of the stringent condition involves using
a DNA probe as a probe and carrying out the hybridization overnight
(approximately 8 to 16 hours) using 5.times.SSC, 1.0(w/v) %
blocking reagent for nucleic acid hybridization (Boehringer
Mannheim), 0.1(w/v) % N-lauroylsarcosine, and 0.02(w/v) % SDS. The
washing may be performed twice for 15 min each, using 0.1 to
0.5.times.SSC and 0.1(w/v) % SDS, preferably 0.1.times.SSC and
0.1(w/v) % SDS. The temperature to carry out the hybridization and
the washing is 65.degree. C. or higher, preferably 68.degree. C. or
higher.
[0077] Examples of the DNA having a base sequence that hybridizes
under stringent conditions include DNA having the base sequence of
the wild-type gene originating from a colony or plaque; DNA
obtained by carrying out hybridization under stringent conditions
using a filter on which fragments of the DNA are immobilized; and
DNA identified by carrying out hybridization at 40 to 75.degree. C.
in the presence of 0.5 to 2.0 M NaCl, preferably at 65.degree. C.
in the presence of 0.7 to 1.0 M NaCl, and subsequently washing the
filter at 65.degree. C. using 0.1 to 1.times.SSC solution (a
1.times.SSC solution contains 150 mM sodium chloride and 15 mM
sodium citrate). The preparation of the probe and the hybridization
can be performed according to the procedures described in textbooks
such as Molecular Cloning: A laboratory Manual, 2nd-Ed., Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989, Current
Protocols in Molecular Biology, Supplement 1-38, John Wiley &
Sons, 1987-1997 (These literature will be referred to as reference
literature, hereinafter. The entire disclosure of reference
literature is incorporated herein by reference). Those skilled in
the art would adequately determine the conditions for obtaining DNA
having a base sequence that hybridizes to the base sequence
complementary to the base sequence of the wild-type gene under
stringent conditions by considering, in addition to the
above-mentioned conditions such as the salt concentration of
buffers and the temperature, other conditions such as the probe
concentrations, probe lengths, and the reaction time.
[0078] Examples of the DNA having a base sequence that hybridizes
under stringent conditions include a DNA having a particular
percentage or higher sequence identity to the base sequence of the
DNA used as a probe having the base sequence of the wild-type gene,
such as DNA having 80% or higher, preferably 85% or higher, more
preferably 90% or higher, 91% or higher, 92% or higher, 93% or
higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher,
98% or higher, or 99% or higher, still more preferably 99.5% or
higher sequence identity to the base sequence of the wild-type
gene.
[0079] Examples of the base sequence that hybridizes to a base
sequence complimentary to the base sequence of the wild-type gene
under stringent conditions include base sequences resulting from
deletion, substitution, addition or other modification of from 1 to
several, preferably from 1 to 50, more preferably from 1 to 30.
even more preferably from 1 to 20, still even more preferably 1, 2,
3, 4, 5, 6, 7, 8, 9 or 10 bases in the base sequence of the
wild-type gene. As used herein, the term "deletion of a base" means
that a base is lost or eliminated from the sequence. The term
"substitution of a base" means that a base is replaced another
base. The term "addition of a base" means that a new base is added
to the sequence by inserting it into the sequence.
[0080] While the enzyme encoded by a base sequence that hybridizes
to a base sequence complementary to the base sequence of the
wild-type gene under stringent conditions should be an enzyme
having an amino acid sequence resulting from deletion,
substitution, addition or other modification of 1 to several amino
acids in the amino acid sequence of the enzyme encoded by the base
sequence of the wild-type gene, it has the same enzymatic
activities as the enzyme encoded by the base sequence of the
wild-type gene.
(Means for Calculating Sequence Identity)
[0081] While the sequence identity between base sequences or amino
acid sequences may be determined by any method, it can be
determined by using a commonly known method, whereby a wild-type
gene or an amino acid sequence of an enzyme encoded by the
wild-type gene is aligned with a base sequence or amino acid
sequence of interest and the percent match between the two
sequences is calculated using a program.
[0082] The algorithm of Karlin and Altschul is a known program for
calculating the percent, match between two amino acid sequences or
base sequences (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990;
Proc. Natl. Acad. Sci. USA90:5873-5877, 1993). Using this
algorithm, Altschul et al. developed the BLAST program (J. Mol.
Biol. 215: 403-410, 1990). The Gapped BLAST program, which can
determine the sequence identity in a more sensitive way than the
BLAST, is also known (Nucleic Acids Res. 25: 3389-3402, 1997).
Using the above-described programs, one skilled in the art can
search in a database for a sequence with a high sequence identity
to a given sequence. These programs are available on the website of
U.S. National Center for Biotechnology Information
(http::/blast.ncbi.nlm.nih.gov/Blast.egi).
[0083] While the above-described methods are commonly used in the
search of sequences with certain sequence identities from a
database, Genetyx network model. version 12.0.1 (Genetyx
corporation) may also be used in a homology analysis to determine
the sequence identity of individual sequences. This method is based
on the Lipman-Pearson method (Science 227:1435-1441, 1985). When
analyzing the sequence identity of base sequences, regions encoding
proteins (CDS or ORF) are used when possible.
(Origins of Genes Encoding Enzymes (1) and (2))
[0084] The genes encoding the enzymes (1) and (2) are, for example,
derived from species having the ability to produce selenoneine or
the ability to produce ergothioneine. or species expressing the
enzymes (1) and (2). Examples of the organisms of origin from which
the genes encoding the enzymes (1) and (2) are derived include
microorganisms. Of various microorganisms, filamentous fungi are
preferred since many of their species are known to have the ability
to produce ergothioneine. Examples of the filamentous fungi include
fungi of the genus Aspergillus. Specific examples include
Aspergillus sojae, Aspergillus oryzae, Aspergillus niger,
Aspergillus tamarii, Aspergillus awamori, Aspergillus usamii,
Aspergillus kawachii, and Aspergillus saitoi.
[0085] Aspergillus sojae, Aspergillus oryzae, Aspergillus niger,
Aspergillus tamarii, Aspergillus awamori, Aspergillus usamii,
Aspergillus kawachii, and Aspergillus saitoi listed above as
specific examples of the filamentous fungi of the genus Aspergillus
have long been used in the production of miso paste, soy sauce,
Japanese sake, shochu liquor and other fermented products, as well
as in the production of citric acid and enzymes such as amylases.
Their high enzyme productivity and high reliability for the safety,
backed by long history of use, make these microorganisms useful in
industrial applications.
[0086] As described above, while the organisms of origin from which
the enzymes (1) and (2) are derived are not particularly limited,
the enzymes (1) and (2) expressed in the transformant might not be
deactivated by the growth conditions of the host organisms or the
enzymes might show their respective activities. For this reason, it
is preferred that the organism of origin from which the genes
encoding the enzymes (1) and (2) are derived be a microorganism
that grows under conditions similar to the growth conditions of a
host organism to be transformed by the insertion of the genes
encoding the enzymes (1) and (2).
(Cloning of Genes Encoding Enzymes (1) and (2) Lasing Genetic
Engineering Technique)
[0087] The genes encoding the enzymes (1) and (2) can be inserted
into various suitable known vectors. The resulting vector can then
be introduced into a suitable known host organism to create a
transformant in which the recombinant vector (recombinant DNA)
containing the genes encoding enzymes (1) and (2) has been
introduced. A person skilled in the art can appropriately select a
suitable method for obtaining the genes encoding the enzymes (1)
and (2). a method for obtaining the gene sequence encoding the
enzymes (1) and (2) and the amino acid sequence information of the
enzymes (1) and (2), as well as a method for creating different
vectors and a method for creating transformants. The terms
"transformation" and "transformant" as used herein encompass
transduction and transductants, respectively. One non-limiting
example of cloning of the genes encoding the enzymes (1) and (2)
will be described below.
[0088] Cloning of the genes encoding the enzymes (1) and (2) may
suitably use commonly used gene cloning techniques. For example,
using a standard technique such as the technique described in the
reference literature, the chromosomal DNA and mRNA can be extracted
from microorganisms and various cells capable of producing the
enzymes (1) and (2). The extracted mRNA can he used as a template
to synthesize cDNA. The resulting chromosomal DNA and cDNA may be
used to construct a I thrary of chromosomal DNA or cDNA.
[0089] For example, genes encoding the enzymes (1) and (2) can be
obtained by cloning from the chromosomal DNA or cDNA derived from
microorganisms having the genes, which serves as a template. The
organisms of origin from which the genes encoding the enzymes (1)
and (2) are derived are as described above; specific examples
include Aspergillus sojae NBRC4239 strain and Aspergillus oryzae
RIB40 strain. For example, the Aspergillus sojae NBRC4239 strain is
cultured and the resulting cells are dehydrated and physically
triturated using a mortar while chilled in liquid nitrogen to form
fine powder-like cell debris, from which a fraction containing
chromosomal DNA is extracted using a standard technique. A
commercially available DNA extraction kit such as DNeasy Plant Mini
Kit (Qiagen) can be used to extract the chromosomal DNA.
[0090] Subsequently, a polymerase chain reaction (referred to as
PCR, hereinafter) was conducted using the chromosomal DNA as a
template along with synthetic primers complementary to the
sequences at the 5' and 3' ends. The primers are not particularly
limited as long as they can amplify DNA fragments containing the
gene. Examples of the primers include primers shown in. SEQ ID NOs:
17 to 22 designed based on the genome sequence of Aspergillus
sojae. These primers can amplify the full length of the target gene
and can therefore eliminate the need for RACE. Alternatively, DNA
sequences containing fragments of the target gene may be amplified
using suitable PCR techniques such as 5' RACE and 3' RACE and these
sequences are subsequently ligated to obtain a DNA segment
containing the full length target gene.
[0091] The method for obtaining the genes encoding the enzymes (1)
and (2) is not particularly limited; for example, rather than using
genetic engineering techniques, the genes encoding the enzymes) and
(2) may be constructed by chemical synthesis.
[0092] For example, the base sequences of the amplification
products amplified by PCR and the chemically synthesized genes may
be determined as follows. First, the DNA segment to be sequenced is
inserted into a suitable vector according to the standard technique
to prepare a recombinant DNA. For cloning into a vector, a
commercially available kit, such as TA Cloning Kit (Invitrogen);
commercially available plasmid vector DNA, such as pUC119 (Takara
Bio), pUC18 (Takara Bio), pBR322 (Takara Bio), pBluescript
SK+(Stratagene), and pYES2/CT (Invitrogen); and commercially
available bacteriophage vector DNA, such as .lamda.EMBL3
(Stratagene), may be used. The recombinant DNA is then used to
transform host organisms, such as Escherichia coli, preferably E.
coli JM109 strain (Takara Bio) and E. coli DH5.alpha. strain
(Takara Bio). The recombinant DNA present in the transformant is
then purified using a purification kit such as QIAGEN Plasmid Mini
Kit (Qiagen).
[0093] The base sequences of genes inserted in the recombinant DNA
are then determined by the dideoxy sequencing technique (Methods in
Enzymology. 101, 20-78, 1983). The sequence analyzer used to
determine the base sequence is not particularly limited; for
example. Li-COR MODEL 4200L sequencer (Aloka), 370DNA sequencing
system (Perkin Elmer), CEQ2000XL DNA analysis system (Beckman) may
be used. The determined base sequences may then be used estimate
the amino acid sequence of the translated proteins, thus, the
enzymes (1). and (2).
(Construction of a Recombinant Vector Containing Genes Encoding
Enzymes (1) and (2))
[0094] Recombinant vectors containing the genes encoding the
enzymes (1) and (2) (recombinant DNA) can be constructed by
connecting a PCR, amplification product containing any of the genes
encoding the enzymes (1) and (2) with any of various vectors in
such a manner that the recombinant vector can express the genes
encoding the enzymes (1) and (2). For example, such a recombinant
vector may be constructed by excising a DNA fragment containing any
of the genes encoding the enzymes (1) and (2) with appropriate
restriction enzyme and ligating the DNA fragment into a plasmid cut
with appropriate restriction enzyme. The recombinant vector may
also be obtained by connecting a DNA fragment containing the gene
and having sequences homologous to a plasmid attached to the both
ends with a DNA fragment derived from the plasmid amplified by
inverse PCR using a commercially available recombinant vector
preparation kit such as In-Fusion HD Cloning Kit (Clontech).
(Method for Creating a Transformant)
[0095] The method for creating a transformant for use in one
embodiment of the production method is not particularly limited;
for example, a gene(s) encoding the enzyme (1) or the enzymes (1)
and (2) may be inserted in the host organisms according to a
standard method in such a manner that the enzymes are expressed in
the host organisms. Specifically, a DNA construct in which any of
the genes encoding the enzymes (1) and (2) has been inserted
between an expression-inducing promoter and a terminator is
constructed. Subsequently, a host organism is transformed with only
the DNA construct containing the gene encoding the enzyme (1) or
with both the DNA construct containing the gene encoding the enzyme
(1) and the DNA construct containing the gene encoding the enzyme
(2) to obtain a transformant that overexpresses only the gene
encoding the enzyme (1) or both the gene encoding the enzyme (1)
and the gene encoding the enzyme (2). In the present specification,
DNA fragments comprising an expression-inducing promoter--a gene
encoding the enzyme (1) or (2)--a terminator and recombinant
vectors containing the DNA fragment that are prepared to transform
the host organism are collectively referred to as "DNA
constructs."
[0096] The method for introducing the gene encoding the enzyme (1)
or the enzymes (1) and (2) in a host organism in such a manner that
the enzymes are expressed in the host organism is not particularly
limited; for example, the gene may be directly introduced into the
chromosome of the host organism by making use of homologous
recombination, or the gene may be connected to a plasmid vector,
which in turn is introduced into the host organism.
[0097] In the method that makes use of homologous recombination, a
DNA construct may be connected between sequences homologous to the
upstream region and the downstream region of a recombination site
on a chromosome and inserted into the genome of the host organism.
As a result of this self-cloning, a transformant can be obtained in
which the gene is overexpressed under control of a high expression
promoter in the DNA construct. The high expression promoter may be
any high expression promoter, including, for example, a promoter
region of translation elongation factor TEF1 gene (tef1), a
promoter region of .alpha.-amylase gene (amy), a promoter region of
alkaline protease gene (alp), and other suitable promoters.
[0098] In the method that makes use of a vector, a DNA construct is
integrated into a plasmid vector used to transform host
microorganisms using a standard method and a corresponding host
organism can be transformed with the plasmid vector according to a
standard method.
[0099] A suitable vector--host system may be any system that allows
the production of the enzyme (1) or the enzymes (1) and (2) in the
host organisms, including, for example, a system based on pUC19 and
a filamentous fungus, and a system based on pSTA14 (Mol. Gen.
Genet. 218, 99-104, 1989) and a filamentous fungus.
[0100] While the DNA construct is preferably introduced into the
chromosome of the host organisms, it may be used without
introducing into the chromosome by integrating into a
self-replicating vector (Ozeki et al. Biosci. Biotechnol. Biochem.
59, 1133 (1995)).
[0101] The DNA construct may contain a marker gene that allows the
selection of transformed cells. Examples of the marker gene
include, but are not limited to, genes compensating for the
nutritional requirements of the host organisms, such as pyrG, niaD
and adeA; and drug-resistant genes such as those against
pyrithiamine, hygromycin B and oligomycin. Also, the DNA construct
preferably contains a promoter, a terminator and other regulatory
sequences (such as enhancer and polyadenylated sequences) that
enable the overexpression of the genes encoding the enzyme (1) or
the enzymes (1) and (2) in the host organisms. The promoter may be
any suitable expression-inducing promoter or constitutive promoter,
including, for example, tef1 promoter, alp promoter, and amy
promoter. The terminator may also be any terminator, including, for
example, alp terminator, amy terminator, and tef1 terminator.
[0102] The regulatory sequences for the genes encoding the enzymes
(1) or (2) in the DNA construct are not necessarily required if the
DNA fragments containing the genes encoding the enzymes (1) or (2)
contain sequences having expression regulatory functions. Also,
when transformation is performed by the cotransformation method,
the DNA construct may not contain any marker genes.
[0103] Purification tags may be added to the DNA construct. For
example, a suitable linker sequence may be added to the upstream or
downstream of the gene encoding the enzymes (1) or (2) and six or
more codons of histidine-encoding base sequences may be added to
the linker to enable the purification on a nickel column.
[0104] One embodiment of the DNA construct is, for example, a DNA
construct in which a tef1 gene promoter, a gene encoding the
enzymes (1) or (2), an alp gene terminator and a pyrG marker gene
are connected to the In-Fusion cloning Site located in the multiple
cloning site of pUC19.
[0105] Any properly selected method known to those skilled in the
art may be used for transformation into filamentous fungi; for
example, the protoplast PEG technique in which protoplasts of a
host organism are prepared and polyethylene glycol and calcium
chloride are added may be used (See, for example, Mol. Gen. Genet.
218, 99-104, 1989, Japanese Unexamined Patent Application
Publication No. 2007-222055). The culture medium to regenerate the
transformant is properly selected depending on the host organism
and the transformation marker gene used. For example, when
Aspergillus sojae is used as the host organism and pyrG gene is
used as the transformation marker gene, the transformant can be
regenerated in a Czapek-Dox minimal medium (Difco) containing 0.5%
agar and 1.2M sorbitol.
[0106] Alternatively, in order to obtain the transformant for use
in one embodiment of the production method, the endogenous promoter
for the gene(s) encoding the enzyme (1) or the enzymes (1) and (2)
present on the chromosome of the host organism may be substituted
with a high expression promoter such as tef1 by homologous
recombination. Again, a transformation marker gene such as pyrG is
preferably inserted in addition to the high expression promoter.
For example, a transformation cassette consisting of the upstream
region of the gene encoding the enzyme (1) or (2)--a transformation
marker gene--a high expression promoter--all or a part of the gene
encoding the enzyme (1) or (2) described in Example 1 and FIG. 1 of
Japanese Unexamined Patent Application Publication No.2011-239681
may be used for this purpose. In this case, the upstream region of
the gene encoding the enzyme (1) or (2) and all or a part of the
gene encoding the enzyme (1) or (2) are used in homologous
recombination. The all or a part of the gene encoding the enzyme
(1) or (2) may include a region of the gene extending from the
start codon to somewhere down the length of the gene. A suitable
length of the region is preferably 0.5 kb or longer for homologous
recombination.
[0107] In order to confirm that the transformant has successfully
been created, the transformant may be cultured under a condition
that induces the enzymatic activities of the enzyme (1) or the
enzymes (1) and (2) and subsequently the resulting culture may be
examined for the presence of selenoneine or alternatively, a
comparison may be made to determine if the amount of selenoneine
present in the resulting culture is greater than the amount of
selenoneine present in a culture of the host organism cultured
under the same condition.
[0108] Alternatively, the confirmation of successful creation of
the transformant for use in one embodiment of the production method
may be achieved by extracting the chromosomal DNA from the
transformant, and performing a PCR using the chromosomal DNA as a
template to detect the presence of any PCR product that can be
amplified if the transformation has occurred.
[0109] For example, a PCR can be performed using a combination of a
forward primer for the base sequence of the promoter used and a
reverse primer for the base sequence of the transformation marker
gene and whether the product having an expected length is produced
is determined.
[0110] When the transformation is carried out by homologous
recombination, it is preferred to perform a PCR using a forward
primer located upstream of the upstream homologous region used and
a reverse primer located downstream of the downstream homologous
region used and then determine whether the product having a length
expected when the homologous recombination has occurred is
produced.
(Host Organism)
[0111] The host organism may be any microorganism that can produce
the enzyme (1) or the enzymes (1) and (2) when transformed by a DNA
construct containing the gene encoding the enzyme (1) or DNA
constructs containing the genes encoding the enzymes (1) and (2),
respectively. Examples include, but are not limited to,
microorganisms in which selenium can be metabolized in view of the
toxicity of the selenium compound, preferably microorganisms that
can express selenic acid reductase (EC1.97.1.9), selenocysteine
lyase (EC4.4.1.16), serine dehydratase (EC4.3.1.17) or two or more
of those enzymes, more preferably filamentous fungi such as the
genus Aspergillus, the genus Escherichia, the genus Trichoderma,
the genus Fusarium, the genus Penicillium, the genus Rhizopus, and
the genus Neurospora, photosynthetic microorganism and probiotic
microorganism.
[0112] For example, it is known that microorganisms such as the
genus Acinetobacter, the genus Aeromonas, the genus Arthrobacter,
the genus Bacillus, the genus Candida, the genus Cephalosporium,
the genus Citrobacter, the genus Corynebacterium, the genus
Flavobacterium, the genus Fusarium, the genus Micrococcus, the
genus Neurospora, the genus Penicillium, the genus Pseudomonas, the
genus Salmonella, the genus Scopulariopsis, the genus Selenomonas
have an oxidation or reducing ability for selenium compound (refer
to D. T. Maiers et al., APPLIED AND ENVIRONMENTAL MICROBIOLOGY,
October 1988, p.2591-2593). Especially, selenate reductase or the
gene, encoding the enzyme is found from Thauera selenatis,
Escherichia coli, Enterobacter cloacae and Bacillus
selenatarsenatis (refer to SAKAGUCHI Toshifumi, "selenium oxyanion
reductase and its gene", Biomedlca, 2012. Vol.3, p.133). Also, it
is known that Alcaligenes viscolactis, Escherichia freundii,
Corynebacterium pseuclocliphtheriticum, Pseudomonas alkanolytica,
Brevibacterium leucinophagum, Escherichia coli, Erwinia carotovora,
Serratia marcescens, Alcaligenes bookeri, Aspergillus ficuum,
Aspergillus sojae, Absidia corymbifera, Neurospora crassa,
Penicillium expansum, Saccharomyces cerevisiae, Kluyveromyces
fragilis, Candida albicans, Hansenula beckii and Schwanniomyces
occidentalis have a selenocysteine lyase activity or a possibility
of said activity (refer to PATRICK CHOCAT et al., JOURNAL OF
BACTERIOLOGY, October 1983, p. 455-457). Thus, those microorganisms
can be used as host organisms. Also, beyond those microorganisms,
any other microorganisms having the reinforced selenium metabolism
gene or the expression of the heterologous gene can be used as host
organisms. Further, it may be possible that the microorganism can
be used as the organism of origin from which the gene encoding the
enzymes (1) or (2) are derived.
[0113] Among them, the host organism is more preferably any of the
microorganisms of filamentous fungi in which the production of
ergothioneine is detected and filamentous fungi that have genes
encoding the enzymes (1) and (2) on their genomic DNA. Specific
examples of the filamentous fungi include filamentous fungi
described in Donald et al. document (Donald B. Melville et al, J.
Biol. Chem. 1956, 223:9-17, the entire disclosure of which is
incorporated herein by reference) and Dorothy et al. document
(Dorothy S. Genghof, J. Bacteriology, August 1970, p. 475-478,the
entire disclosure of which is incorporated herein by reference),
such as filamentous fungi belonging to the genus Aspergillus, the
genus Neurospora, the genus Penicillium, the genus Fusarium, the
genus Trichoderma, and the genus Mucor. Examples of the filamentous
fungi that have genes encoding the enzymes (1) and (2) on their
genomic DNA include filamentous fungi belonging to the genus
Neosartorya, the genus Byssochlamys, the genus Talaromyces, the
genus Ajellomyces, the genus Paracoccidioides, the genus
Uncinocarpus, the genus Coccidioides, the genus Arthroderma, the
genus Trichophyton, the genus Exophiala, the genus Capronia, the
genus Cladophialophora, the genus Macrophomina, the genus
Leptosphaeria, the genus Bipolaris, the genus Dothistroma, the
genus Pyrenophora, the genus Neofusicoccum, the genus Setosphaeria,
the genus Baudoinia, the genus Gaeumannomyces, the genus
Marssonina, the genus Sphaerulina, the genus Sclerotinia, the genus
Magnaporthe, the genus Verticillium, the genus Pseudocercospora,
the genus Colletotrichum, the genus Ophiostoma, the genus
Metarhizium, the genus Sporothrix, and the genus Sordaria.
[0114] Of these filamentous fungi, in terms of the safety and easy
culturing, the host filamentous fungus is preferably any of the
microorganisms of the genus Aspergillus listed above as the
organisms of origin from which the genes encoding the enzymes (1)
and (2) are derived, including Aspergillus sojae, Aspergillus
oryzae, Aspergillus niger, Aspergillus tamarii, Aspergillus
awamori, Aspergillus usamii, Aspergillus kawachii, and Aspergillus
saitoi.
(Specific Examples of Genes Encoding Enzymes (1) and (2))
[0115] Examples of the gene encoding the enzyme (1) derived from
the Aspergillus sojae NBRC4239 strain include a gene AsEgtA, which
will be described in Examples below. Examples of the gene encoding
the enzyme (2) derived from the Aspergillus sojae NBRC4239 strain
include genes AsEgtB and AsEgtC, which will be also described in
Examples below. The base sequences of the genes AsEgtA, AsEgtB and
AsEgtC are shown in SEQ ID NOs: 1 to 3 in the sequence listing,
respectively. Further, the amino acid sequences of the AsEgtA,
AsEgtB and AsEgtC proteins are shown in SEQ ID NOs: 4 to 6 in the
sequence listing, respectively.
[0116] Examples of the gene encoding the enzyme (1) derived from
the Aspergillus oryzae RIB40 strain include a gene AoEgtA, which
will be described in Examples below. The base sequence of the gene
AoEgtA is shown in SEQ ID NO: 23 in the sequence listing. Further,
the amino acid sequence of the AoEgtA protein is shown in SEQ ID
NO: 24 in the sequence listing.
[0117] Genes encoding the enzymes (1) and (2) may be obtained from
microorganisms other than those of Aspergillus sojae and
Aspergillus oryzae by any suitable method. For example, a homology
search by BLAST may be conducted on the genomic DNA of
microorganisms other than those of Aspergillus sojae and
Aspergillus oryzae based on the base sequences of the genes AsEgtA,
AsEgtB, AsEgtC and AoEgtA (SEQ ID NOs: 1 to 3 and 23) and the amino
acid sequences of the AsEgtA, AsEgtB, AsEgtC and AoEgtA proteins
(SEQ ID NOs: 4 to 6 and 24), to identify genes having a base
sequence with a high sequence identity to the base sequences of the
genes AsEgtA, AsEgtB, AsEgtC and AoEgtA. Alternatively, genes
encoding the enzymes (1) and (2) may be obtained by identifying
proteins having a high sequence identity to the AsEgtA, AsEgtB,
AsEgtC and AoEgtA proteins from the total protein of microorganisms
other than those of Aspergillus sojae and Aspergillus oryzae and
identifying the genes encoding these proteins. Whether the
resulting genes are equivalent to the genes encoding the enzymes
(1) and (2) can be determined by transforming the organism of
origin as the host organism with the obtained gene and determining
if selenoneine is produced or determining if the production of
selenoneine is enhanced compared to the host organisms.
[0118] Since Aspergillus sojae, Aspergillus oryzae and Aspergillus
niger grow under similar conditions, it may be possible to insert
the genes of the respective fungi into one another to mutually
transform the respective fungi. For example, a gene(s) encoding the
enzyme (1) or the enzymes (1) and (2) derived from Aspergillus
sojae may be introduced into the host organism of Aspergillus
oryzae or Aspergillus niger to transform them. In order to ensure
that the enzyme (1) or the enzymes (1) and (2) have the desired
enzymatic activity, it is preferred that the organism of origin
from which the genes encoding the enzyme (1) or the enzymes (1) and
(2) are derived and the host organism are identical. For example, a
gene(s) encoding the enzyme (1) or the enzymes (1) and (2) derived
from Aspergillus sojae may be introduced into the same Aspergillus
sojae.
[0119] The genes encoding the enzymes (1) and (2) may be genes
optimized for their codons, secondary structures, and GC contents
based on the amino acid sequence of the genes encoding the enzymes
(1) and (2) derived from Aspergillus sojae. Specific examples of
such genes include EcEgtA (SEQ ID NO: 27) and EcEgtC (SEQ ID NO:
28) synthesized for expression in E. coli.
(One Embodiment of Transformant)
[0120] One embodiment of the transformant for use in one embodiment
of the production method is an Aspergillus sojae transformant
obtained by introducing a gene AsEgtA into Aspergillus sojae for
overexpression of AsEgtA protein. Another embodiment of the
transformant is Aspergillus oryzae transformant obtained by
introducing a gene AoEgtA into Aspergillus oryzae for
overexpression of AoEgtA protein. Such Aspergillus sojae and
Aspergillus oryzae transformants are designed to overexpress the
AsEgtA and AoEgtA proteins and are capable of producing selenoneine
at detectable or higher levels while the respective host organisms
can produce little or no selenoneine. In addition, the Aspergillus
sojae and Aspergillus oryzae transformants can produce selenoneine
not only from organic selenium compounds such as selenocysteine and
selenocystine, but also from inorganic selenium compounds such as
selenous acid, as will be described later in Examples. Accordingly,
one embodiment of the transformant is preferably a transformant in
which the expression of the gene or genes encoding the enzyme (1)
or the enzymes (1) and (2) is enhanced such that the amount of
selenoneine is increased as compared to the host organism. Also,
one embodiment of the transformant is more preferably a
transformant in which the expression of the genes encoding the
enzymes (1) and (2) is enhanced such that the amount of selenoneine
is increased as compared to transformants in which the expression
of the gene encoding the enzyme (1) is enhanced.
[0121] As will be described later in Examples, when the Aspergillus
sojae transformant transformed to overexpress the AsEgtA protein
was cultured in DPY medium suitable for the growth of the host
Aspergillus sojae at 30.degree. C. for 4 to 5 days, 15.8 .mu.g of
selenoneine was obtained per gram of wet cell mass when selenous
acid was used and 207.9 .mu.g of selenoneine was obtained per gram
of wet cell mass when selenocystine was used. Accordingly, one
embodiment of the transformant is a transformant in which the
expression of the gene or genes encoding the enzyme (1) or the
enzymes (1) and (2) is enhanced such that when the transformant is
cultured at 30.degree. C. for 5 days in a selenium
compound-containing culture medium suitable for the growth of the
host organism, the amount of selenoneine produced is for example 5
.mu.g or more, preferably 10 .mu.g or more, more preferably 20
.mu.g or more, and still more preferably 40 .mu.g or more per gram
of wet cell mass. One embodiment of the transformant is a
transformant in which the expression of the gene or genes encoding
the enzyme (1) or the enzymes (1) and (2) is enhanced such that
when the transformant is cultured at 30.degree. C. for 5 days in a
selenous acid-containing culture medium suitable for the growth of
the host organism, the amount of selenoneine produced is for
example 5 .mu.g or more, preferably 6 .mu.g or more, more
preferably 10 .mu.g or more, and still more preferably 15 .mu.g or
more per gram of wet cell mass. One embodiment of the transformant
is a transformant in which the expression of the gene or genes
encoding the enzyme (1) or the enzymes (1) and (2) is enhanced such
that when the transformant is cultured at 30.degree. C. for 5 days
in a selenocystine-containing culture medium suitable for the
growth of the host organism, the amount of selenoneine produced is
for example 10 .mu.g or more, preferably 20 .mu.g or more, more
preferably 40 .mu.g or more, even more preferably 100 .mu.g or
more, and yet more preferably 200 .mu.g or more per gram of wet
cell mass.
[0122] The transformant for use in one embodiment of the production
method may produce, along with the enzymes (1) and (2) expressed by
the introduced gene encoding the enzymes (1) and (2), wild-type
enzymes (1) and (2) that have the same or different structural
properties from the enzymes (1) and (2) and that are expressed by
the endogenous genes of the host organism encoding the enzymes (1)
and (2). Consequently, the transformant for use in one embodiment
of the production method can produce selenoneine even if the gene
encoding the enzyme (2) is not introduced.
[0123] The transformant for use in one embodiment of the production
method includes a transformed archaebacterium or a transformed
bacterium that has the genes encoding the enzymes (1) and (2)
introduced therein and that overexpresses the introduced genes.
Non-limiting examples of the transformed bacteria include
transformed E. coli transfected with a plasmid vector containing
EcEgtA or EcEgtA and EcEgtC.
[0124] (Production Method)
[0125] One embodiment of the production method is a method for
producing selenoneine comprising the step of applying histidine and
a selenium compound to a transformant that has the gene or genes
encoding the enzyme (1) or the enzymes (1) and (2) introduced
therein and that can overexpress the introduced genes, to obtain
selenoneine.
[0126] The method for applying histidine and a selenium compound to
the transformant is not particularly limited and may be any method
that can expose the transformant to histidine and the selenium
compound to allow the enzymes of the transformant to produce
selenoneine. For example, the transformant may be cultured in a
culture medium containing histidine and selenium compound and
optimized for the growth of the transformant under culture
conditions suitable for the transformant so as to produce
selenoneine. The culture method is not particularly limited; for
example, the solid culture or liquid culture technique performed
under aerated or non-aerated condition may be employed. The amount
of the selenium compound added is not particularly limited as long
as the growth of the transformant is not inhibited. For example,
the selenium compound may be present at sufficiently low levels
relative to the cell concentration at the initial stage of
culturing. Specifically, it is added at a concentration of 1 mM or
less, preferably 0.1 mM or less, and more preferably 0.05 mM or
less. When it is desired to obtain large amounts of selenoneine,
the amount of the selenium compound added may be increased during
the course of culture or as the cell concentration increases. For
example, additional amounts of the selenium compound at a
concentration of 0.001 to 10 mM, preferably 0.005 to 5 mM, may be
added to the culture medium 1 to 24 hours, preferably 3 to 22 hours
after the start of culture.
[0127] The culture medium may be any standard culture medium
designed for culturing host organism and may be either a synthetic
or natural culture medium that contains a carbon source, a nitrogen
source, inorganic materials, and other nutrients at an appropriate
ratio. When the host organism is a microorganism of the genus
Aspergillus, the DPY medium as described in Examples below may be
used, although not particularly limited. It is preferred, however,
that the medium contain, as a component, iron (II) required for the
activation of the enzyme (1). While iron (II) may be added to the
medium in the form of a compound, it may also be added as a
mineral-containing material.
[0128] The selenium compound is not particularly limited as long as
it contains selenium as a constituent element. For example, it may
be an organic or inorganic selenium compound or a salt thereof.
Examples of organic selenium compounds and salts thereof include
selenocysteine, selenocystine, selenomethionine,
Se-(methyl)seleno-L-cysteine, selenopeptides, selenoproteins and
salts thereof and selenium yeast. Examples of inorganic selenium
compounds and salts thereof include selenic acid, selenous acid,
selenium chloride, selenium, selenides, selenium sulfide,
dimethylselenium, selenophosphate, selenium dioxide and salts
thereof. Alternatively, the selenium compound may be an organic
material containing an organic or inorganic selenium compound or a
salt thereof. Examples of such organic materials include, but are
not limited to, bonito fish (processed products and dried bonito),
mustard (powdered mustard, grain mustard and mustard paste), pork
(kidney, liver, and raw meat), beef (kidney, raw meat), anglerfish
(liver, raw meat), codfish (cod roe, raw meat), bluefin tuna (red
meat, raw meat), flatfish (raw meat), bonito fish (those caught in
the fall season, raw meat), snow crabs (raw meat), sunflower seeds
(fried, flavored), horse mackerel (grilled), tilefish (raw meat),
granular seasoning, yellow fin tuna (raw meat), albacore (raw
meat), oyster (boiled), and other food products known to be a rich
source of selenium. The selenium compound may be one of or a
combination of two or more of these materials.
[0129] More preferably, the selenium compound is selenocysteine or
selenocystine. While selenocysteine and selenocystine may be
obtained by any suitable manner, selenocysteine for example may be
produced with reference to JP 2001-61489 A.
[0130] The transformant for use in one embodiment of the production
method may be any of the above-described transformants. For
example, when an organic selenium compound such as selenocysteine
and selenocystine is used as the selenium compound, the
transformant may be a transformant that has the genes encoding the
enzymes (1) and (2) introduced therein and that can overexpress the
introduced genes. When an inorganic selenium compound such as
selenous acid is used as the selenium compound, the transformant
may be a transformant that has the gene encoding the enzyme (1)
introduced therein and that can overexpress the introduced
gene.
[0131] The culture condition of the transformant may be any culture
condition of the host organism commonly known to those skilled in
the art; for example, when the host organism is a filamentous
fungus, the initial pH of the culture medium may be conditioned to
5 to 10 and the culture temperature to 20 to 40.degree. C., and the
culture time may be properly selected and may vary from several
hours to several days, preferably from 1 to 7 days, and more
preferably from 2 to 4 days. The culture means is not particularly
limited; for example, an aerated, agitated, submerged culture, a
shake culture, a static culture or other suitable culture
techniques may be employed with the culture condition preferably
adjusted so that sufficient amounts of dissolved oxygen are
present. One example of the culture medium and culture condition
for culturing microorganisms of the genus Aspergillus includes a
shake culture in which the fungus is cultured at 30.degree. C.
under shaking at 160 rpm over 3 to 5 days in a DPY medium as
described in Examples below.
[0132] The method for extracting selenoneine from the culture after
completion of the culture is not particularly limited. For
extraction purposes, the fungal cells collected from the culture by
filtration, centrifugation or other manipulation may be used
without further processing, or alternatively, the fungal cells
dried or, if desired, triturated after collection may be used. The
method for drying fungal cells is not particularly limited; for
example, lyophilization, drying in the sun, hot-air drying, vacuum
drying, aeration drying, drying under reduced pressure or other
suitable drying techniques may be used.
[0133] The solvent used for extraction may be any solvent that can
dissolve selenoneine, including, for example, organic solvents,
such as methanol, ethanol, isopropanol and acetone;
water-containing organic solvents composed of these organic
solvents and water mixed together; and water, warm water and hot
water. After addition of the solvent, selenoneine is extracted
while the cells are triturated as necessary. The temperature of the
extraction solvent may be set to from room temperature to
100.degree. C.
[0134] In one embodiment of the extraction method of selenoneine,
the fungal cells collected from the culture are washed with water
and added to water to prepare a suspension. The resulting
suspension is then subjected to a heat treatment such as at
100.degree. C. for 15 minutes and then centrifuged to collect the
supernatant. Subsequently, the collected supernatant is filtered to
remove impurities.
[0135] Alternatively, the heated suspension may be directly
filtered without centrifugation.
[0136] Instead of the heat treatment described above, the cells may
be subjected to cell destruction processes that break cells using
cell destruction means such as an ultrasonicator, a French press, a
DYNO-MILL, and a mortar; processes for lysing the fungal cell walls
with Yatalase and other cell wall-lysing enzymes; or processes for
lysing the fungal cells with a surfactant such as SDS and Triton
X-100. These processes may be used either individually or in
combination.
[0137] In order to purify selenoneine, the resulting extract can be
subjected to various purification processes including
centrifugation, filtration, ultrafiltration, gel filtration,
separation by solubility difference, solvent extraction,
chromatography (adsorption chromatography, hydrophobic interaction
chromatography, cation exchange chromatography, anion exchange
chromatography, and reversed-phase chromatography),
crystallization, active carbon treatment, membrane treatment, and
other purification processes.
[0138] The qualitative or quantitative analysis technique of
selenoneine is not particularly limited; the analysis may be
conducted by, for example, LC-MS or LC-ICP-MS. A person skilled in
the art would properly select the conditions for the analysis; for
example, the analysis may be performed using the conditions
described in Examples below.
[0139] According to one embodiment of the production method,
selenoneine can be obtained at high yields. For example, FIG. S6
and FIG. 3B of Non-Patent Document 2 indicates the amount of
ergothioneine produced after culturing in a selenium-free culture
medium and also indicates the peak ratio of ergothioneine and
selenoneine as a result of culturing in a selenium-containing
culture medium. Considering these results together, the amount of
selenoneine produced is estimated to be about 0.047 .mu.g/ml. In
comparison, the amount of selenoneine produced in one embodiment of
the production method is calculated to be 14.56 .mu.g/ml from the
determined value of 6.46 .mu.g-Se/ml (amount of selenium alone), as
will be later described in Examples. This suggests that according
to one embodiment of the production method, the production of
selenoneine can be increased more than 100-fold as compared to the
production method described in Non-Patent Document 2, providing a
significant advantage.
[0140] In one embodiment of the production method, various other
steps or manipulations may be performed before, after, or during
the above-described step as long as the objectives of the present
invention can be achieved.
[0141] Another embodiment of the production method is a production
method that uses, rather than the transformant, a microorganism
that has a gene or genes encoding the enzyme (1) or the enzymes (1)
and (2) on its genomic DNA. For example, another embodiment of the
production method is a method for producing selenoneine, the method
comprising the step of applying histidine and a selenium compound
to a fungus, including those of genus Aspergillus, such as
Aspergillus oryzae, having a gene or genes encoding the enzyme (1)
or the enzymes (1) and (2) on its genome DNA, to obtain
selenoneine.
[0142] In one embodiment of the production method, selenoneine, the
intended product, can cause growth inhibition or production
inhibition in the microorganism used. Such grow inhibition or
production inhibition in the microorganism may be avoided by adding
an oxidizing agent such as copper ions to the culture medium to
cause the produced selenoneine to dimerize (by formation of Se--Se
linkage). Thus, in one embodiment of the production method, it is
preferred that oxidizing agents such as copper ions are present
during application of histidine and selenium compound to the
microorganism.
(Applications of Selenoneine)
[0143] Having advantageous characteristics of being a functional
biological material with various physiological activities, as well
as being a heat-resistant, water-soluble material, the selenoneine
obtained by the production method or the transformant to serve as
one embodiment of the present invention is useful as general food
and beverage products, functional food and beverage products, food
and beverage products with function claims, food and beverage
products for specified health use, food and beverage products with
nutrient function claims, food and beverage products with health
function claims, food and beverage products for special uses,
nutritional supplement food and beverage products, health-promoting
food and beverage products, supplements, beauty food and beverage
products, cosmetic products, pharmaceutical products,
quasi-pharmaceutical products, animal feeds, and raw-materials for
producing these products.
[0144] Specifically, selenoneine is known to have antioxidant
activity that is 1,000 times as high as that of it's thio analog,
ergothioneine. For this reason, selenoneine can be useful as a
biological antioxidant that exhibits the ability to capture
hydroxyl radicals, the ability to suppress autoxidation of the hem
iron, and other antioxidant activities. Examples of specific
products containing selenoneine include, but are not limited to,
supplements that can substitute selenous acid and selenomethionine,
prophylactic or therapeutic agents for cancers and
lifestyle-related diseases such as ischemic heart diseases, and
antidotes for methyl mercury.
[0145] The present invention will now be described in further
detail with reference to the following Examples, which are not
intended to limit the present invention. The present invention may
take various forms to the extent that the objectives of the present
invention are achieved.
EXAMPLES
Example 1
Preparation of DNA Constructs with an Inserted Gene AsEgtA, AsEgtB
or AsEgtC
(1) Searching of Genes of Interest
[0146] NCU04343 and NCU11365 are among the enzymes known to be
involved in the biosynthesis of ergothioneine in Neurospora crassa
(See, Non-Patent Documents 3 and 4). Non-Patent Document 3 also
suggests the possible involvement of NCU04636 in the biosynthesis
of ergothioneine. Given that, using genes encoding the three
enzymes of Neurospora crassa as query sequences, domains with a
relatively high sequence identity to the genes encoding each of
NCU04343, NCU04636 and NCU11365 were searched based on the genome
sequence of the NBRC4239 strain of Aspergillus sojae. The search
was conducted using a BLAST program (tblastn) and the genome
sequence of the NBRC4239 strain of Aspergillus sojae
(DDBJ/EMBL/GenBank DNA databases, Accession numbers for the 65
scaffold sequences; DF093557-DF093585, DNA RESEARCH 18, 165-176,
2011).
[0147] As a result, a gene sho in SEQ ID NO: 1 was found as a
sequence domain with a relatively high sequence identity to
NCU04343. This gene was named as AsEgtA gene (SEQ ID NO: 1),
indicating an egtA gene originating from Aspergillus sojae. Also, a
gene shown in SEQ ID NO: 2 was found as a sequence domain with a
relatively high sequence identity to NCU04636 and was named as
AsEgtB gene (SEQ ID NO: 2). Further, a gene shown in SEQ ID NO: 3
was found as a sequence domain with a relatively high sequence
identity to NCU11365 and was named as AsEgtC gene (SEQ ID NO:
3).
[0148] A comparison of the sequence identity on the amino acid
level was performed using a gene information processing software
Genetyx network model, version 12.0.1 (Genetyx) and indicated the
sequence identities of the AsEgtA protein (SEQ ID NO: 4), the
AsEgtB protein (SEQ ID NO: 5) and the AsEgtC protein (SEQ II) NO:
6) to NCU04343, NCU04636 and NCU11365 were 46%, 75% and 44%,
respectively. Also, the sequence identity of AsEgtC protein, to
SPBC660.12c, are ortholog of NCU11365 in Schizosaccharomyces pombe,
was found to be 27%. These results suggest that the base sequences
and the amino acid sequences of AsEgtA, AsEgtB and AsEgtC may be
used to search for the egtA, egtB and egtC genes of other
microorganisms of the genus Aspergillus.
(2) Extraction of Chromosomal DNA of Aspergillus sojae NBRC4239
Strain
[0149] In a 150 ml Erlenmeyer flask, 30 mL of a polypeptone-dextrin
medium (1 (w/v) % polypeptone, 2 (w/v) % dextrin, 0.5 (w/v) %
KH.sub.2PO.sub.4, 0.1 (w/v) % NaNO.sub.3, 0.05 (w/v) %
MgSO.sub.47H.sub.2O, 0.1 (w/v) % casamino acid; pH 6.0) was
prepared with distilled water. The medium was inoculated with the
conidia of Aspergillus sojae NBRC4239 strain and was subjected to
shake culture overnight at 30.degree. C. The cells were collected
from the resulting culture broth by filtration and were placed
between sheets of paper towel to remove moisture. The cells were
then triturated using a liquid nitrogen-chilled mortar and pestle
while being chilled in liquid nitrogen. Using DNeasy Plant Mini Kit
(Qiagen), the chromosomal DNA was extracted from the resulting
triturated cells.
(3) Preparation of a Construct Plasmid
[0150] The following elements were integrated into plasmid pUC19 to
make a plasmid for making a construct (construct plasmid): Ptef. a
promoter sequence of translation elongation factor gene tef1 (a 748
bp upstream region of tef1 gene; SEQ ID NO: 7); Talp, a terminator
sequence of alkaline protease gene alp (a 800 bp downstream region
of alp gene; SEQ ID NO: 8); and pyrG, a transformation marker gene
that compensates for the requirement for uridine (1838 bp including
a 407 bp upstream region, a 896 bp coding region and a 535 bp
downstream region; SEQ ID NO: 9). Specifically, the plasmid was
prepared in the following manner.
[0151] Ptef, Talp and pyrG were amplified by PCR using chromosomal
DNA of Aspergillus sojae NBRC4239 strain obtained above to serve as
a template DNA, KOD-Plus-DNA Polymerase (Toyobo) to serve as PCR
enzyme, the reagents provided with the enzyme to serve as reaction
reagents, and Mastercycler gradient (Eppendolf) to serve as a PCR
device. The PCR was performed according to the protocol provided
with the enzyme. Printers used to amplify Ptef, Talp and pyrG and
the PCR conditions are shown in Tables 1 to 3 below. Of the
sequences shown in the tables, the sequences shown in lower case
are added sequences that serve to connect the amplified fragments
of Ptef, Talp and pyrG in this order and further connect them to
pUC19. The amplified DNA fragments were separated in 1 (w/v) %
agarose gel and purified using QIAquick Gel Extraction Kit
(Qiagen).
TABLE-US-00001 TABLE 1 Amplified target region Pref Forward primer
Ptef1_-748R_pUC SEQ ID NO: 10 cggtacccggggatcTGTGGACCAGACAGGCGCC
ACTC Reverse primer Ptef1_-1R_Talp SEQ ID NO: 11
atgtactcctggtacTTTGAAGGTGGTGCGAACT TTGTAG PCR condition 2 min. at
94.degree. C. (15 sec. at 94.degree. C., 30 sec. at 62.degree. C.,
1 min. at 68.degree. C.) .times. 25 cycles
TABLE-US-00002 TABLE 2 Amplified target region Talp Forward primer
Talp_1F SEQ ID NO: 12 GTACCAGGAGTACATTGGAGAGTTCTAC Reverse primer
Talp_800R SEQ ID NO: 13 CCGATCCAACCACCCGGCTATCG PCR condition 2
min. at 94.degree. C. (15 sec. at 94.degree. C., 30 sec. at
62.degree. C., 1 min. at 68.degree. C.) .times. 25 cycles
TABLE-US-00003 TABLE 3 Amplified target region pyrG Forward primer
PyrG_-407_F_Talp SEQ ID NO: 14 gggtggttggatcggTTGGGCTTATTGCTATGT
CCCTGAAAGG Reverse primer PyrG_1431R_pUC SEQ ID NO: 15
cgactctagaggatcCCGCACCTCAGAAGAAAA GGATGA PCR condition 2 min. at
94.degree. C. (15 sec at 94.degree. C., 30 sec. at 62.degree. C., 2
min. at 68.degree. C.) .times. 25 cycles
[0152] pUC19 used was pUC19 linearized Vector provided with
In-Fusion HD Cloning Kit (Clontech). Using In-Fusion HD Cloning Kit
described above, the amplified Ptef. Talp and pyrG were ligated
into pUC19 at In-Fusion Cloning Site located in the multiple
cloning site according to the protocols provided with the kit, to
obtain a construct plasmid.
[0153] The resulting construct plasmid was used to transform
competent cells ECOS Competent E. coli JM109 (Nippon Gene) in
accordance with the manufacturer's instructions to obtain
transformed E. coli.
[0154] The resulting transformed E. coli was then subjected to
shake culture overnight at 37.degree. C. in a LB liquid medium
containing 50 .mu.g/ml ampicillin. After the culture period, the
culture solution was centrifuged to collect cells, Using FastGene
Plasmid Mini Kit (Nippon Genetics), plasmid DNA was extracted from
the collected cells according to the protocols provided with the
kit.
(4) Preparation of a Construct for Inserting a Gene of Interest
[0155] A DNA construct consisting of genes of interest AsEgtA,
AsEgtB or AsEgtC connected between Ptet and Talp of a construct
plasmid was prepared as follows.
[0156] An inverse PCR was performed using the construct plasmid
obtained above to serve as a template DNA, KOD-Plus-DNA Polymerase
(Toyobo) to serve as PCR enzyme, the reagents provided with the
enzyme to serve as reaction reagents, and Mastercycler gradient
(Eppendolf) to serve as a PCR device. The inverse PCR was performed
according to the protocol provided with the enzyme to obtain a
vector fragment of the construct plasmid. Primers and the PCR
conditions used are shown in Table 4 below. The amplified vector
fragments were separated in 1 (w/v) % agarose gel and purified
using QIAquick Gel Extractiom Kit (Qiagen).
TABLE-US-00004 TABLE 4 Amplified target region Construct plasmid
Forward primer Ptef_-1R SEQ ID NO: 16 TTTGAAGGTGGTGCGAACTTTGTAG
Reverse primer Talp_1F (above described) SEQ ID NO: 12
GTACCAGGAGTACATTGGAGAGTTCTAC PCR condition 2 min. at 94.degree. C.
(10 sec. at 98.degree. C., 30 sec. at 65.degree. C., 6 min. at
68.degree. C.) .times. 20 cycles
[0157] To amplify the genes AsEgtA (SEQ ID NO: 1). AsEgtB (SEQ ID
NO: 2), and AsEgtC (SEQ ID NO: 3) derived from Aspergillus sojae, a
PCR was performed using the chromosomal DNA of Aspergillus sojae
NBRC4239 strain obtained above to serve as a template DNA,
KOD-Plus-DNA Polymerase (Toyobo) to serve as PCR enzyme, the
reagents provided with the enzyme to serve as reaction reagents,
and Mastercycler gradient (Eppendolf) to serve as a PCR device. The
PCR was performed according to the protocol provided with the
enzyme. Primers used to amplify AsEgtA, AsEgtB and AsEgtC and the
PCR conditions are shown in Tables 5 to 7 below. Of the sequences
shown in the tables, the sequences shown in lower case are added
sequences that serve to connect the amplified fragments to the
construct plasmid (between Ptef and Talp). The amplified DNA
fragments were separated in 1 (w/v) % agarose gel and purified
using QIAquick Gel Extraction Kit (Qiagen).
TABLE-US-00005 TABLE 5 Amplified target region AsEgtA Forward
primer EgtA_1F_Ptef SEQ ID NO: 17
cgcaccaccttcaaaATGTCACCTTTGGCTCTCT CTCC Reverse primer
EgtA_2925R_Talp SEQ ID NO: 18 atgtactcctggtacCTAAAGATCCCGCACCAGG
CGT PCR condition 2 min. at 94.degree. C. (15 sec. at 94.degree.
C., 30 sec. at 62.degree. C., 3 min. at 68.degree. C.) .times. 25
cycles
[0158] [Table 6]
TABLE-US-00006 TABLE 6 Amplified target region AsEgtB Forward
primer EgtB_1F_Ptef SEQ ID NO: 19
cgcaccaccttcaaaATGTCTAATGTTACCCAATC AGCCTTGAG Reverse primer
EgtB_1770R_Talp SEQ ID NO: 20 atgtactcctggtacTTAATGTTGACTCCATTCGA
TCGTGTTCAG PCR condition 2 min. at 94.degree. C. (15 sec. at
94.degree. C., 30 sec. at 62.degree. C., 2 min. at 68.degree. C.)
.times. 25 cycles
TABLE-US-00007 TABLE 7 Amplified target region AsEgtC Forward
primer EgtC_1F_Ptef SEQ ID NO: 21 cgcaccaccttcaaaATGACCACTCCCTTCG
GAGCT Reverse primer EgtC_1529R_Talp SEQ ID NO: 22
atgtactcctggtacTCAAAGCTTCGCAGAA GAAACCCCAACC PCR condition 2 min.
at 94.degree. C. (15 sec. at 94.degree. C., 30 sec. at 62.degree.
C., 2 min at 68.degree. C.) .times. 25 cycles
[0159] The vector fragments amplified as described above and
AsEgtA, AsEgtB or AsEgtC were connected using In-Fusion HD Cloning
Kit according to the protocol provided with the kit to obtain a DNA
construct for inserting a gene of interest in which AsEgtA, AsEgtB
or AsEgtC has been inserted. The so-obtained DNA construct consists
of a DNA fragment derived from pUC19, DNA fragment of Ptef, a DNA
fragment of AsEgtA, AsEgtB or AsEgtC, a DNA fragment of Talp, a DNA
fragment of pyrG, and a DNA fragment derived from pUC19 that are
connected in series in the direction from the 5' end to the 3' end.
In other words, three different DNA constructs in which the
sequence Ptef-AsEgtA, AsEgtB or AsEgtC-Talp-pyrG was connected
sequentially into the MCS of pUC19 were obtained.
[0160] The resulting DNA constructs were used to transform
competent cells EGOS Competent E. coli JM109 (Nippon Gene) in
accordance with the manufacturer's instructions to obtain
transformed E. coli.
[0161] The resulting transformed E. coli was then subjected to
shake culture overnight at 37.degree. C. in an LB liquid medium
containing 50 .mu.g/ml ampicillin. After the culture period, the
culture solution was centrifuged to collect cells. Using FastGene
Plasmid Mini Kit (Nippon Genetics), the plasmid DNA was extracted
from the collected cells according to the protocols provided with
the kit.
[0162] The base sequence of each DNA, inserted in the extracted
plasmid DNA was determined to confirm that a DNA construct in which
AsEgtA, AsEgtB or AsEgtC had been inserted was obtained.
Example 2
Preparation of Transformed Aspergillus sojae (1)
[0163] (1) pyrG-disrupted strain derived from Aspergillus sojae
NBRC4239 strain.
[0164] Each DNA construct was precipitated with ethanol and
dissolved in TE to form a DNA solution with a desired
concentration. The DNA solution was then used to transform a
pyrG-disrupted strain derived from the Aspergillus sojae NBRC4239
strain (i.e., the strain from which a 48 bp upstream region of the
pyrG gene, a 896 by coding region, and a 240 hp downstream region
of the pyrG gene have been deleted).
(2) Transformation of pyrG-Disrupted Strain Derived from the
Aspergillus sojae NBRC4239 Strain
[0165] In a 500 ml Erlenmeyer flask, conidia of the pyrG-disrupted
strain derived from the Aspergillus sojae NBRC4239 strain were
inoculated into 100 ml of a polypeptone dextrin liquid medium
containing 20 mM uridine and the inoculated medium was subjected to
drake culture at 30.degree. C. for about 20 hours. Subsequently,
the cells were collected. Protoplasts were prepared from the
collected cells. The resulting protoplasts were then transformed
with 20 .mu.g of the DNA construct for inserting a gene of interest
using the protoplast PEG technique and the protoplasts were
incubated at 30.degree. C. for 5 days or more in a Czapek-Dox
minimal medium Difco; pH 6) containing 0.5 (w/v) % agar and 1.2 M
sorbitol to obtain transformed Aspergillus sojae as the cells
having the ability to form colonies.
[0166] Since pyrG, a gene that compensates for the requirement for
uridine, had been introduced into the transformed Aspergillus
sojae, the transformants were able to grow in the uridine-free
medium and were selected as strains having the introduced target
gene.
Example 3
Preparation of DNA Constructs with Inserted Gene AoEgtA
(1) Search for Proteins of Interest
[0167] Using the amino acid sequences of the AsEgtA protein of
Aspergillus sojae as query sequences, proteins with high sequence
identities were searched from the total protein of Aspergillus
oryzae RIB40 strain. DOGAN
(www.bio.nite.go.jp/dogan/project/view/AO) was used for the
search.
[0168] As a result, AO090012000265 was identified as a protein with
a relatively high sequence identity to the amino acid sequence of
AsEgtA. AO090012000265 is described in Table 2 of Non-Patent
Document No. 5 as a protein similar to Egt1 of S. pombe.
AO090012000265 had a 97% sequence identity to the AsEgtA. The gene
encoding AO090012000265 was designated as AoEgtA gene, indicating
an egtA gene originating from Aspergillus oryzae. The amino acid
sequence of AoEgtA protein is given in SEQ ID NO: 24.
(2) Extraction of Chromosomal DNA of Aspergillus oryzae RIB40
Strain
[0169] The same procedure was followed as in Example 1-(2), except
that the conidia of Aspergillus oryzae RIB40 strain were used.
(3) Preparation of a Construct Plasmid
[0170] The vector fragments prepared in Example 1-(3) were
used.
(4) Preparation of a Construct for Inserting a Gene of Interest
[0171] The same procedure was followed as in Example 1-(4) above,
except that the gene of interest is the AoEgtA and the chromosomal
DNA of Aspergillus oryzae RIB40 strain obtained above was used as a
template DNA. Primers used to amplify AoEgtA and the PCR conditions
are shown in Table 8 below.
TABLE-US-00008 TABLE 8 Amplified target region AoEgtA Forward
primer AoEgtA_1F_Ptef SEQ ID NO: 25
cgcaccaccttcaaaATGTCACCGTTGGCTCT TTCTCC Reverse primer
AoEgtA_2917R_Talp SEQ ID NO: 26 atgtactcctggtacCTAAAGATCCCGCACTA
GGCGTG PCR condition 2 min. at 94.degree. C. (15 sec. at 94.degree.
C., 30 sec. at 62.degree. C., 3 min. at 68.degree. C.) .times. 25
cycles
[0172] Similar to Examples 1-(4) above, the base sequence of DNA
inserted in the extracted plasmid DNA was determined to confirm
that DNA constructs in which the AoEgtA had been inserted were
obtained.
Example 4
Preparation of Transformed Aspergillus oryzae
[0173] The same procedure was followed as in Example 2-(1) and (2)
above, except that a pyrG-disrupted strain derived from Aspergillus
oryzae RIB40 strain as described in JP 2013-034416 A was
transformed.
Example 5
Production of Selenoneine using Transformed Aspergillus sojae
[0174] Aspergillus sojae NRBC4239 strain to serve as control and
transformed Aspergillus sojae transformed with genes AsEgtA and
AsEgtC were compared for their respective abilities to produce
selenoneine in the following manner.
[0175] In a 200 mL Erlenmeyer flask, conidia of each of the fungal
strains were inoculated into 40 ml of a selenocystine-supplemented
DPY liquid medium (0.1 (w/v) % histidine, 1 mM selenocystine, 1
(w/v) % polypeptone, 2 (w/v) % dextrin, 0.5 (w/v) % yeast extract,
0.5 (w/v) % KH.sub.2PO.sub.4, 0.05 (w/v) % MgSO.sub.47H.sub.2O,
0.00017% FeSO.sub.4; pH not adjusted) and the inoculated medium was
subjected to shake culture at 160 rpm at 30.degree. C. for 5 days.
After the culture period, the cells were collected from the culture
on Miracloth (Calbiochem). The collected cells were washed with 40
ml distilled water and were pressed between sheets of paper towel
to remove moisture, thus giving wet cells. 8 ml water was then
added and agitated to suspend the cells and form a cell suspension.
The resulting cell suspension was subjected to a heat treatment at
100.degree. C. for 15 min. Following the heat treatment, the
suspension was centrifuged to collect the extracellular fluid as
the supernatant, which in turn was filtered through a 0.45 .sub.ium
filter to obtain a selenoneine extract.
[0176] The resulting selenoneine extract was subjected to LC-MS
analysis under the following conditions. [0177] [Conditions for
LC-MS] [0178] LC apparatus; Agilent 1100 series (Agilent) [0179]
Mass spectrometer; QSTAR Elite (AB Sciex) [0180] Column; COSMOSIL
HILIC (4.6.times.250 mm) [0181] Eluent; acetonitrile+0.1% formic
acid: water+0.1% formic acid=75: 25 (v/v) [0182] Flow rate; 250
.mu.l/ml [0183] Detection; ESI positive [0184] Injection; 10 .mu.l
[0185] Temperature; room temperature
[0186] The results of LC-MS analysis at m/z 278 corresponding to
the protonated ions of selenoneine are shown in FIG. 1 for the
Aspergillus sojae NBRC4239 strain and the transformed Aspergillus
sojae transformed with AsEgtA and AsEgtC. As shown, the peak is
very small for the Aspergillus sojae NBRC4239 strain, whereas it is
clearly detected for the transformed Aspergillus sojae transformed
with the genes AsEgtA and AsEgtC.
[0187] The results of LC-MS analysis at m/z 230 corresponding to
the protonated ions of ergothioneine are shown in FIG. 2. As shown,
the peak corresponding to ergothioneine is slightly detected for
the Aspergillus sojae NBRC4239 strain, whereas the peak
corresponding to ergothioneine is clearly detected for the
transformed Aspergillus sojae transformed with the genes AsEgtA and
AsEgtC.
Example 6
Confirmation of Selenoneine Production
[0188] FIG. 3 shows the enlarged MS spectrum of the peak at m/z 278
shown in FIG. 1 detected near 31-min retention time. The calculated
values for the ion distribution of selenoneine estimated from the
relative isotopic abundance are also shown in FIG. 4. That the
measured values for the ion distributions showed a general match
indicates that the peak is selenoneine, thus demonstrating
production of selenoneine by the transformed Aspergillus sojae
transformed with the genes AsEgtA and AsEgtC.
Example 7
Production of Selenoneine using Transformed Aspergillus sojae
(1)
[0189] In a 200 mL Erlenmeyer flask, conidia of the transformed
Aspergillus sojae transformed with the genes AsEgtA and AsEgtC were
inoculated into each of 40 ml of a DPY liquid medium; 40 ml of a
selenous acid-supplemented DPY liquid medium (1 mM selenous acid,
0.1 (w/v) % histidine, 1 (w/v) % polypeptone, 2 (w/v) % dextrin,
0.5 (w/v) % yeast extract, 0.5 (w/v) % KH.sub.2PO.sub.4, 0.05 (w/v)
% MgSO.sub.47H.sub.2O, 0.00017% FeSO.sub.4; pH not adjusted); or 40
ml of a selenocystine-supplemented DPY liquid medium, and the
inoculated medium was subjected to shake culture at 160 rpm at
30.degree. C. for 5 days. After the culture period, the cells were
collected from the culture on Miracloth (Calbiochem). The collected
cells were washed with 40 ml distilled water and were pressed
between sheets of paper towel to remove moisture, thus giving 2.28
g (selenocystine-supplemented DPY liquid medium) and 1.89 g
(selenous acid-supplemented DPY liquid medium) of wet cells. 8 ml
water was then added and agitated to suspend the cells and form a
cell suspension. The resulting cell suspension was subjected to a
heat treatment at 100.degree. C. for 15 min. Following the heat
treatment, the suspension was centrifuged to collect the
extracellular fluid as the supernatant, which in turn was filtered
through a 0.45 .mu.m filter to obtain a selenoneine extract.
[0190] Each of the resulting selenoneine extracts was subjected to
LC-MS analysis under the above-described conditions to determine
the presence of selenoneine.
[0191] Selenoneine and total selenium were quantified by LC-ICP-MS
according to the conditions described in the article by Yamashita
et al. (THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 285, No. 24, pp.
18134-18138, Jun. 11, 2010, "EXPERIMENTAL PROCEDURES", "Selenium
Determination", the entire disclosure of which is incorporated
herein by reference).
[0192] The results of LC-MS analysis at m/z 278 corresponding to
selenoneine are shown in FIG. 5. Selenoneine was detected in the
presence of selenocystine or selenous acid, but not in the DPY
liquid medium alone. This confirms that selenoneine can be produced
by using the transformed Aspergillus sojae in the presence of the
selenium compound in the culture medium.
[0193] The selenoneine contents (selenium equivalents) of the
selenoneine extracts were analyzed as described above and were
determined to be 16.3 .mu.g-Se/g of extract for the
selenocystine-supplemented liquid medium and 4.6 .mu.g-Se/g of
extract for the selenous acid-supplemented liquid medium,
respectively. The total selenium contents in the selenoneine
extracts were measured by DAN fluorometry and were determined to be
20.8 .mu.g/g of extract for the selenocystine-supplemented liquid
medium and 8.1 .mu.g/g of extract for the selenous
acid-supplemented liquid medium, respectively. The amounts of
selenoneine produced per gram of wet cell mass were determined to
be 128.93 .mu.g/g of wet cell mass for the
selenocystine-supplemented liquid medium and 43.89 .mu.g/g of wet
cell mass for the selenous acid-supplemented liquid medium,
respectively. These results indicate that considerable amounts of
selenoneine can be obtained by using the transformed Aspergillus
sojae in the presence selenocystine or selenous acid. DAN
fluorometry is a technique involving wet heat digestion with a
mixture of nitric acid/perchlorie acid, followed by reaction with
2,3-diaminonaphthalene (DAN). The fluorescence of the
4,5-Benzopiaselenol (Se-DAN) resulting from complexing with Se (IV)
is then utilized to determine Se. The procedure was performed with
reference to J. H. Watkinson, Anal. Chem, 38 (1) 92-97 (1966), the
entire disclosure of which is incorporated herein by
reference).
Example 8
Production of Selenoneine using Transformed Aspergillus sojae
(2)
[0194] The procedure was performed in the same manner as in Example
7 above, except that conidia of Aspergillus sojae NBRC4239 strain;
transformed Aspergillus sojae transformed with the gene AsEgtA;
transformed Aspergillus sojae transformed with the gene AsEgtA and
AsEgtB; and transformed Aspergillus sojae transformed with the gene
AsEgtA and AsEgtC were inoculated, and shake culture was conducted
at 160 rpm at 30.degree. C. for 4 days. The results were summarized
in Tables 9 and 10.
TABLE-US-00009 TABLE 9 Selenoneine amount Selenoneine Wet cell
concentration - weight Extract Total Extract equivalents (Selenium
extract equivalents (.mu.g/g - Selenium equivalents) Wet cell
volume (.mu.g/ml - wet cell Introduced gene compound (mg-Se/L)
weight (g) (ml) extract) weight) AsEgtA selenocystine 25 2.17 8
56.4 207.9 AsEgtA + AsEgtB selenocystine 19.1 2.09 8 43.1 165
AsEgtA + AsEgtC selenocystine 18.6 2.3 8 41.9 145.7 AsEgtA selenous
acid 2.1 2.37 8 4.7 15.8 AsEgtA + AsEgtB selenous acid 1.3 2.58 8
2.9 9 AsEgtA + AsEgtC selenous acid 1 2.78 8 2.3 6.6
TABLE-US-00010 TABLE 10 Total Selenoneine Wet Total concentration -
cell extract Selenium Extract weight volume Introduced gene
compound (mg/kg) (g) (ml) AsEgtA selenocystine 36.2 2.17 8 AsEgtA +
AsEgtB selenocystine 30.2 2.09 8 AsEgtA + AsEgtC selenocystine 34.6
2.3 8 AsEgtA selenous acid 5.7 2.37 8 AsEgtA + AsEgtB selenous acid
4.1 2.58 8 AsEgtA + AsEgtC selenous acid 4.1 2.78 8
[0195] These results indicate that considerable amounts of
selenoneine can be obtained by using the transformed Aspergillus
sojae in the presence selenocystine or selenous acid. Surprisingly,
the transformed Aspergillus sojae transformed with the gene AsEgtA
resulted in a greater amount of selenocysteine and a greater total
selenium content than did either of the transformed Aspergillus
sojae transformed with the gene AsEgtA and AsEgtB or the
transformed Aspergillus sojae transformed with the gene AsEgtA and
AsEgtC.
Example 9
Production of Selenoneine using Transformed Aspergillus oryzae
[0196] Aspergillus oryzae RIB40 strain to serve as control and
transformed Aspergillus oryzae transformed with genes AoEgtA were
compared for their respective abilities to produce selenoneine in
the following manner.
[0197] In a 200 mL Erlenmeyer flask, conidia of each fungal strain
were inoculated into 40 ml of a selenocystine-supplemented DPY
liquid medium, and the inoculated medium was subjected to shake
culture at 160 rpm at 30.degree. C. for 4 days. After the culture
period, the cells were collected from the culture on Miracloth
(Calbiochem). The collected cells were washed with 40 ml distilled
water and were pressed between sheets of paper towel to remove
moisture, thus giving 1.84 g of wet cell mass. 8 ml water was then
added and agitated to suspend the cells and form a cell suspension.
The resulting cell suspension was subjected to a heat treatment at
100.degree. C. for 15 min. Following the heat treatment, the
suspension was centrifuged to collect the extracellular fluid as
the supernatant, which in turn was filtered through a 0.45 .mu.m
filter to obtain a selenoneine extract.
[0198] Each of the resulting selenoneine extracts was subjected to
LC-MS analysis under the above-described conditions to determine
the presence of selenoneine. Selenoneine was quantified by
LC-ICP-MS according to the conditions described in the article by
Yamashita et al.
[0199] The results of LC-MS analysis at m/z 278 corresponding to
selenoneine are shown in FIG. 6. Selenoneine was detected as a
slightly larger peak for the control strain of Aspergillus oryzae
than for the Aspergillus sojae NBRC4239 strain. In comparison, the
peak of selenoneine was clearly detected in the transformant
transformed with the gene AoEgtA near 31.5-min retention time.
These results indicate that considerable amounts of selenoneine can
be obtained by using the transformed Aspergillus oryzae.
[0200] The selenoneine content (selenium equivalents) of the
selenoneine extract was analyzed as described above and was
determined to be 32.3 .mu.g-Se/g of extract for the transformed
Aspergillus oryzae. The amount of selenoneine produced per gram of
wet cell mass was determined to be 316.58 .mu.g/g of wet cell mass.
The total selenium content in the selenoneine extract was measured
by DAN fluorometry and was determined to be 39.1 .mu.g-Se/g of
extract.
Example 10
Toxicity of Selenium Compounds
[0201] 0 mM, 0.1 mM, 0.3 mM or 1.0 mM selenocystine or selenous
acid was added to a DPY liquid medium. To each of these media,
conidia of Aspergillus sojae NBRC4239 strain to serve as control
and transformed Aspergillus sojae transformed with the genes AsEgtA
and AsEgtC were inoculated, and the inoculated media were subjected
to shake culture at 160 rpm at 30.degree. C. for 4 days. After the
culture period, the cells were collected from the culture on
Miracloth (Calbiochem). The collected cells were washed with 40 ml
distilled water and were pressed between sheets of paper towel to
remove moisture. The wet cells were weighed.
[0202] The relative wet cell weight of the transformant relative to
the control is shown in FIGS. 7 and 8 for each concentration of the
selenium compound. As can be seen from FIGS. 7 and 8, the
transformant showed resistance to each of the selenium
compounds.
Example 11
Confirmation of Transformed Aspergillus sojae
[0203] In a test tube, conidia of each of the Aspergillus sojae
NBRC4239 strain to serve as control; the transformed Aspergillus
sojae transformed with one of the genes AsEgtA, AsEgtB and AsEgtC;
and the transformed Aspergillus sojae transformed with the gene
AsEgtA and the gene AsEgtB or AsEgtC were inoculated to 10 ml of a
DPY liquid medium and the inoculated medium was subjected to shake
culture at 30.degree. C. for 3 days. Subsequently, the cells were
collected. The collected cells were triturated in a bead cell
disrupter (MS-100R; Tomy Digital Biology) under a chilled condition
to give triturated cell powder, which in turn was suspended in a
0.1 (w/v) % aqueous SDS solution to form a SDS suspension. To the
resulting SDS suspension, a one-quarter volume of sample buffer
(Lane Marker Reducing Sample Buffer, ImmunoPure (5.times.); Thermo
Fisher Scientific) was added and the mixture was stirred. The
mixture was then subjected to a heat treatment at 98.degree. C. for
3 min. Following the heat treatment, the mixture was centrifuged
and the supernatant was collected. The supernatant in an amount
equivalent to 0.2 mg cell was then applied to an acrylamide gel and
electrophoresed to perform an SDS-PAGE. The results are shown in
FIG. 9.
[0204] As can be seen from FIG. 9, the AsEgtA protein appeared as
two bands at approximately 90 kDa in SDS-PAGE while its expected
molecular weight estimated from the amino acid sequence was 95.7
kDa. Similarly, the AsEgtB protein appeared as a band at little
less than 50 kDa while its expected molecular weight estimated from
the amino acid sequence was 56.4 kDa. Also, the AsEgtC protein
appeared as a band at 50 kDa while its expected molecular weight
estimated from the amino acid sequence was 51.2 kDa.
[0205] As can be seen from FIG. 9, the control strain expressed
little amount of each of the AsEgtA protein, the AsEgtB protein and
the AsEgtC protein whereas the (AsEgtA+AsEgtB) transformant and the
(AsEgtA+AsEgtC) transformant expressed the AsEgtA protein and
either the AsEgtB protein or the AsEgtC protein. Also, the AsEgtA
transformant, the AsEgtB transformant and the AsEgtC transformant
expressed the AsEgtA protein, the AsEgtB protein and the AsEgtC
protein, respectively.
Example 12
Preparation of Transformed E. coli
[0206] The gene sequences of AsEgtA and AsEgtC genes were optimized
for expression in E. coli based on the amino acid sequences of the
AsEgtA and AsEgtC proteins in terms of the codon, secondary
structure and GC content. The EcoRV recognition sequence (GATATC)
and the SpeI recognition sequence (ACTAGT) were attached to the
upstream and the downstream of the respective genes to obtain
EcEgtA (SEQ ID NO:27) and EcEgtC(SEQ ID NO:28), respectively.
[0207] Meanwhile, pUTE120K' was constructed as an expression
vector. Specifically, pUTE100K' described in JP 06-292584 A was
digested with NheI and HpaI to remove the lac promoter. Next, the
Tac promoter region of pKK223-3 (GE) with the NheI site attached to
the 3' end and the EcoRV site attached to the 5' end was PCR
amplified and purified. The amplified promoter was digested with
NheI and inserted into the site where the lac promoter was
originally located in pUTE100K' to construct pUTE120K'.
[0208] pUTE120K' was then digested with restriction enzymes EcoRV
and SpeI. Subsequently, EcEgtA or EcEgtC was ligated to construct
plasmids pUTE120K'-EcEgtA and pUTE120K'-EcEgtC having EcEgtA or
EcEgtC inserted therein.
[0209] E. coli transformed with the construct plasmids were
cultured and the plasmids pUTE120K'-EcEgtA and pUTE120K'-EcEgtC
were purified. Next, pUTE120K'-EcEgtC was digested with restriction
enzymes BamHI and SpeI to excise a fragment containing the gene
EcEgtC. This fragment was purified. Meanwhile, pUTE120K'-EcEgtA was
digested with restriction enzymes BamHI and NheI and the fragment
containing the gene EcEgtC obtained above was inserted to construct
a plasmid pUTE120K'-EcEgtA-EcEgtC. This plasmid was used to
transform E. coli JM109 strain to create a transformed E. coli.
[0210] When the transformed E. coli is cultured at 25.degree. C.
for 16 hours in a TY medium (1 (w/v) % Bacto Tryptone, 0.5 (w/v) %
Bacto Yeast Extract, 0.5 (w/v) % NaCl, pH7.0) containing 1 mM
selenocystine or 1 mM selenous acid and 0.1 mM
isopropyl-.beta.-D-thiogalactopyranoside (IPTG), selenoneine is
detected both in the entire culture and in the hot water extract of
the collected cells.
Example 13
Preparation of DNA Constructs with Inserted Gene AnEgtA
(1) Search for Proteins of Interest
[0211] Using the amino acid sequence of the AsEgtA protein of
Aspergillus sojae as a query sequence, proteins with a high
sequence identity were searched from the data base Non-redundant
protein sequences (nr). Blastp
(blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp& PAGE
TYPE=BlastSearch &LINK_LOC=blasthome) was used for the
search.
[0212] Of the proteins found to have a high sequence identity to
the amino acid sequence of the AsEgtA protein, XP_001397117.2 (SEQ
ID NO: 30) was found to be a homologous protein of the Aspergillus
niger CBS 513.88 strain. XP_001397117.2 had a 73% sequence identity
to the AsEgtA protein. A gene encoding XP_001397117.2 was
identified from the genomic DNA of Aspergillus niger and named as a
gene AnEgtA (SEQ ID NO: 29), meaning egtA gene derived from
Aspergillus niger.
(2) Extraction of chromosomal DNA of Aspergillus niger IAM2533
strain
[0213] The same procedure was followed as in Example 1-(2), except
that the conidia of Aspergillus niger IAM2533 strain were used.
(3) Preparation of a Construct Plasmid
[0214] The vector fragments prepared in Example 1-(3) were
used.
(4) Preparation of a Construct for Inserting a Gene of Interest
[0215] The same procedure was followed as in Example 1-(4) above,
except that the gene of interest is the AnEgtA and the chromosomal
DNA of Aspergillus niger IAM2533 strain obtained above was used as
a template DNA. Primers used to amplify AnEgtA gene and the PCR
conditions are shown in Table 11 below.
TABLE-US-00011 TABLE 11 Amplified target region AnEgtA Forward
primer AnEgtA_1F_Ptef SEQ ID NO: 31
cgcaccaccttcaaaATGTCACCCTTATGTCCGGT CGTCAAG Reverse primer
AnEgtA_2890R_Talp SEQ ID NO: 32 atgtactcctggtacTCAGACATCCCGCACCAGCC
PCR condition 2 min. at 94.degree. C. (15 sec. at 94.degree. C., 30
sec. at 62.degree. C., 3 min. at 68.degree. C.) .times. 25
cycles
[0216] Similar to Example 1-(4) above, the base sequence of DNA
inserted in the extracted plasmid DNA was determined to confirm
that DNA constructs in which the gene AnEgtA had been inserted were
obtained.
[0217] The sequence of the cloned gene AnEgtA was confirmed and
found to match with the sequence of a putative gene (ANI_1_792134)
of the A. niger CBS 513.88 strain (the corresponding amino acid
sequence is XP_001397117.2). The genome information of this gene is
disclosed.
Example 14
Preparation of Transformed Aspergillus sojae (2)
[0218] The same procedure was followed as in Examples 2-(1) and
(2), except that a DNA construct in which the gene AnEgtA had been
inserted was used.
Example 15
Production of Selenoneine using Transformed Aspergillus sojae
(3)
[0219] The same procedure was followed as in Example 7 above,
except that the conidia of Aspergillus sojae NBRC4239 strain to
serve as control and transformed Aspergillus sojae transformed with
the gene AnEgtA were inoculated. The resulting selenoneine extract
and the culture supernatant obtained from the culture after the
main culture (filtered through 0.45 .mu.m filter) were analyzed by
LC-ICP-MS using the conditions described in the article by
Yamashita et al. to quantify selenoneine, The results of the
comparison of selenoneine production between the control strain and
the transformed Aspergillus sojae are shown in Table 12.
TABLE-US-00012 TABLE 12 Selenoneine Selenoneine Selenoneine (mg/L -
Selenium (mg-Se/kg - (mg/L - Culture Strain compound Extract)
Extract) solution) AnEgtA selenocystine 2.9 10.2 2.00 transformant
Control selenocystine 0.1 0.35 0.07 strain AnEgtA selenous acid 0.2
0.70 0.14 transformant Control selenous acid 0.1 0.35 0.07
strain
[0220] As can be seen from Table 12, similar to the transformed
Aspergillus sojae transformed with the gene AsEgtA, the transformed
Aspergillus sojae transformed with the gene AnEgtA showed increased
selenoneine production as compared to the non-transformed control
strain for each substrate both in the extract and in the culture
solution. These results indicate that the transformed Aspergillus
sojae transformed with a heterologous gene AnEgtA derived from a
different organism of origin can also achieve efficient production
of selenoneine.
Example 16
Production of Selenoneine using Transformed E. coli
[0221] As shown in Table 13 below, the control E. coli in which the
expression vector pUTE120K' had been introduced; the transformed E.
coli transformed with the gene EcEgtA or EcEgtC; and the
transformed E. coli transformed with the gene EcEgtA and the gene
EcEgtC were compared for their ability to produce selenoneine in
the following manner.
TABLE-US-00013 TABLE 13 Introduced gene Strain pUTE120K' Control
strain EcEgtA EcEgtA Transformant EcEgtC EcEgtC Transformant
EcEgtA, EcEgtC (EcEgtA + EcEgtC) Transformant
[0222] In a 19 ml test tube, each of the bacterial strains shown in
Table 13 was inoculated into 2.5 ml of a TY medium. The inoculated
medium was then seed-cultured at 37.degree. C. for 16 hours while
agitated at 180 rpm. In a 19 ml test tube, 20 .mu.l of the seed
culture was inoculated into 2.5 ml of a TY medium containing
ampicillin and 0.5 mM IPTG. The inoculated medium was then
main-cultured at 25.degree. C. for 20.5 hours while agitated at 180
rpm. Three different lines of TY medium were prepared for the main
culture: a TY medium containing 0.1 mM selenocystine (TY++), a TY
medium containing 0.01 mM selenocystine (TY+), and a TY medium to
which selenocystine was added to 0.01 mM six hours after the start
of culture (TY+.smallcircle.).
[0223] Meanwhile, in a 19 ml test tube, 20 .mu.l of the seed
culture was inoculated into 0.6 ml of a TY medium containing
ampicillin and 0.5 mM IPTG. The inoculated medium was then
main-cultured at 25.degree. C. for 25 hours while agitated at 180
rpm. After the addition of selenocystine to 0.01 mM, 10 p,1 of 2.5
mM selenocystine was added 20.5 hours after the start of culture
and the culturing was continued for additional 4.5 hours
(TY+++).
[0224] After the culture period, the culture was centrifuged
(12,000 rpm, 4.degree. C., 10 min) and the cells were collected as
precipitate. To cells obtained from 1 ml of the cultures of TY+++,
TY+ and TY+.smallcircle., and to cells obtained from 0.6 ml of the
culture of TY+++, 0.2 ml water was added to form cell suspensions.
The resulting cell suspensions were subjected to a heat treatment
at 98.degree. C. for 10 min. Following the heat treatment, each
suspension was centrifuged to collect the extracellular fluid as
the supernatant, which in turn was filtered through a 0.45 .mu.m
filter to obtain a selenoneine extract.
[0225] The amounts of selenoneine were determined in the resulting
selenoneine extracts and culture supernatants obtained from the
cultures after main culture (filtered through 0.45 .mu.m filter) by
LC-MS/MS using the conditions given below. The determined amounts
of selenoneine are shown in Table 14. [0226] LC apparatus; ACQUITY
UPLC (Waters) [0227] Mass spectrometer; Micromass Quattro micro API
(Waters) [0228] Column; COSMOSIL 2.5HILIC (3.0.times.100 mm) [0229]
Eluent; acetonitrile+0.1% formic acid: water+0.1% formic acid=80:20
(v/v) [0230] Flow rate; 500 .mu.l/ml [0231] Detection; ESI positive
[0232] Injection; 2 .mu.l [0233] Temperature; 40.degree. C. [0234]
Quantification method; Calibration curve method using selenoneine
samples (products of Aspergillus oryzae)
TABLE-US-00014 [0234] TABLE 14 Selenoneine Concen- Selenoneine mg/L
- Culture tration mg/L - Culture Strain line ratio Extract solution
EcEgtA transformant TY++ 5 nd nd EcEgtC transformant TY++ 5 nd nd
(EcEgtA + EcEgtC) TY++ 5 0.12 0.02 transformant Control strain TY++
5 nd nd EcEgtA transformant TY+ 5 0.67 0.13 EcEgtC transformant TY+
5 nd nd (EcEgtA + EcEgtC) TY+ 5 0.92 0.18 transformant Control
strain TY+ 5 nd nd EcEgtA transformant TY+.smallcircle. 5 0.65 0.13
EcEgtC transformant TY+.smallcircle. 5 nd nd (EcEgtA + EcEgtC)
TY+.smallcircle. 5 0.96 0.19 transformant Control strain
TY+.smallcircle. 5 nd nd EcEgtA transformant TY+++ 3 0.86 0.29
EcEgtC transformant TY+++ 3 nd nd (EcEgtA + EcEgtC) TY+++ 3 1.60
0.53 transformant Control strain TY+++ 3 nd nd
[0235] As can be seen from FIG. 14, in any of the culture lines,
selenoneine was not detected in the control strain and in the
EcEgtC transformant, whether in the culture supernatant or in the
selenoneine extract. This suggests that the control strain and the
EcEgtC transformant each have little or no ability to produce
selenoneine.
[0236] In comparison, the EcEgtA transformant and the
(EcEgtA+EcEgtC) transformant both exhibited an ability to produce
selenoneine. In addition, the amount of selenoneine produced by the
(EcEgtA+EcEgtC) transformant was higher than that of the EcEgtA
transformant and the difference between the two transformants was
more significant in the culture supernatants. The comparison of
effects of selenocystine addition to the culture medium indicates
that both the EcEgtA transformant and the (EcEgtA+EcEgtC)
transformant showed increased selemmeine production when
selenocystine was added after sufficient time has elapsed after the
start of culture. The TY++ lines resulted in low selenoneine levels
since the high concentration of selenocystine present during the
initial stage of culture caused growth inhibition. This suggests
that during the initial stage of culture, selenocystine may
preferably be added in sufficiently small amounts relative to the
cell concentration and may preferably be increased over the course
of culture or as the cell concentration increases.
[0237] These results indicate that the (EcEgtA+EcEgtC) transformant
has an enhanced selenoneine production capability that is increased
multiplicatively, rather than additively, from that of the EcEgtA
transformant since the EcEgtA transformant showed high selenoneine
production whereas the EcEgtC transformant showed no production of
selenoneine.
Example 17
Production of Selenoneine using Transformant Aspergillus sojae in
Selenium Yeast Medium
[0238] In a 200 mL Erlenmeyer flask, conidia of the transformed
Aspergillus sojae transformed with the gene AsEgtA were inoculated
into 40 ml of a selenium yeast liquid medium (1.5 (w/v) % selenium
yeast, 2 (w/v) % dextrin, 0.5 (w/v) % KH.sub.2PO.sub.4, 0.05 (w/v)
% MgSO.sub.47H.sub.2O; pH not adjusted), and the inoculated medium
was subjected to shake culture at 160 rpm at 30.degree. C. for 5
days.
[0239] After the culture period, the cells were collected from the
culture on Miracloth (Calbiochem). The collected cells were washed
with 40 ml distilled water and 8 ml water was then added and
agitated to suspend the cells and form a cell suspension. The
resulting cell suspension was subjected to a heat treatment at
100.degree. C. for 15 min. Following the heat treatment, each
suspension was centrifuged to collect the extracellular fluid as
the supernatant, which in turn was filtered through a 0.45 .mu.m
filter to obtain a selenoneine extract.
[0240] The amount of selenoneine was determined by LC-MS/MS in the
resulting selenoneine extract and the medium not inoculated with
the production strain. The determined amounts of selenoneine are
shown in Table 15. It was confirmed that the transformed
Aspergillus sojae can utilize selenium in selenium yeast to produce
selenoneine.
TABLE-US-00015 TABLE 15 Selenoneine (ppm) selenium yeast medium
n.d. Extract 3.39 ppm
Example 18
Production of Selenoneine using Transformant Aspergillus sojae in
Tuna/Bonito Extract Medium (Bacterio-N-KN)
[0241] In a 200 mL Erlenmeyer flask, conidia of the transformed
Aspergillus sojae transformed with the gene AsEgtA were inoculated
into 40 ml of a tuna/bonito extract medium (2.0 (w/v) %
Bacterio-N-KN (Maruha Nichiro), 2 (w/v) % dextrin, 0.5 (w/v) %
KH.sub.2PO.sub.4, 0.05 (w/v) % MgSO.sub.47H.sub.2O; pH not
adjusted), and the inoculated medium was subjected to shake culture
at 160 rpm at 30.degree. C. for 5 days.
[0242] After the culture period, the cells were collected from the
culture on Miracloth (Calbiochem). The collected cells were washed
with 40 ml distilled water and 4 ml water was then added and
agitated to suspend the cells and form a cell suspension. The
resulting cell suspension was subjected to a heat treatment at
100.degree. C. for 15 min. Following the heat treatment, each
suspension was centrifuged to collect the extracellular fluid as
the supernatant, which in turn was filtered through a 0.45 .mu.m
filter to obtain a selenoneine extract.
[0243] The amount of selenoneine was determined by LC-MS/MS in the
resulting selenoneine extract and the medium not inoculated with
the production strain. The determined amounts of selenoneine are
shown in Table 16. It was confirmed that the transformed
Aspergillus sojae can utilize selenium in a tuna/bonito extract to
produce selenoneine.
TABLE-US-00016 TABLE 16 Selenoneine (ppm) tuna/bonito liquid medium
n.d. Extract 0.345 ppm
INDUSTRIAL APPLICABILITY
[0244] The production method and the transformant to serve as one
embodiment of the present invention can be used to produce
selenoneine, which is said to have antioxidative activity 1,000
times as high as that of ergothioneine. Accordingly, the present
invention is useful in the industrial-scale production of raw
materials used to produce cosmetics and supplements with
antioxidative activity.
[0245] [Sequence Listing]
Sequence CWU 1
1
3212925DNAAspergillus sojae 1atgtcacctt tggctctctc tcctaagacc
gttgacattg tcaacatctt tcagaatgat 60gtggagttct ccctcgtaaa tgagatccat
aagggtatta gtcctcccgc tggcgttagg 120aagtcaatgc caacgatgct
tctttacgat gccaatggcc tcaagctttt tgagaacatc 180acctatgtga
aggagtatta tctaacaaat gcggaaattg aggtcttgga gacaaattcc
240aggaggatag ttgaacggat tccagacaat gcgcaactgc ttgaattagg
tagcgggtgc 300gtcatccttc caaatcaaat cgtaaccttt caggctgcgt
agcgtatcat taccgttctc 360cggttttaac cgccttttag gaatcttcgg
aaaattgaga ttctgctacg ggagtttgag 420cgcgtgggaa agcgcgtgga
ttattatgcc ctggacctgt ctctatcaga actgcagcgc 480acattcgcag
aggtgtccat tgatgattac acacacgttg gcctccatgg tctccatgga
540acctacgatg atgccgtcac ttggcttaac agccccgaaa acaggaagcg
gcccacggtg 600atcatgtcta tgggttcctc tttagggaac tttgaccgtc
ccggcgcagc aaagtttctc 660tcgcagtatg ctagccttct tggtccatcc
gatatgatga tcattggtct ggatggctgc 720aaggacccgg gcaaagtata
cagggcatac aatgattcag aaggtgttac acggcagttc 780tacgagaacg
gactagtgca tgcaaatgtt gttcttggat acgaagcctt caaatctgat
840gagtgggaag tagtgactga ctacgatacc gtggagggac gacactgggc
agcctactca 900cccaagaagg acgtcactat caacggggtc cttcttaaga
agggtgagaa acttttcttt 960gaagaggcgt acaagtacgg accagaggaa
cgcgatcaac tgtggcgtga tgccaagtta 1020attcagtcta cggaaatggg
caatgggtct gacgattacc gtgagtagca aatggctgcc 1080tcatttcaat
agacgtgtat gctgactctg gcttttcgca aaatagatct ccatcttctg
1140acatcggcta ccctcaacct ccccacgtct ccctctcaat atgcagctca
tcctataccc 1200agctttgaag aatggcagtc cctgtggaca gcatgggata
atgctacaaa ggctatggtc 1260cctcgcgagg agcttctgtc aaagccgatc
aagctacgga actctttgat cttctatctg 1320ggacacattc ctacattctt
gggttagtct acatggctta ctattcccaa cacatagctt 1380gatgctaatt
atgcaaacag acatccatct gacccgagcc ctgcgcggaa aattaacaga
1440gccaaagtct tataaactaa ttttcgaacg tgggattgat cctgatgtag
atgaccccga 1500gaagtgccac tcccatagcg agatcccaga cgagtggcca
gctcttgatg acattctaga 1560ctaccaagag cgagtcagaa gcagagttag
atccatctac caaatcgagg gccttgcaga 1620gaacagaatc ctgggtgagg
cgctttggat tggatttgag cacgaagtga tgcacctcga 1680gacattcctg
tacatgttga tccagagcga aaggatactt cccccgcccg ccactgagcg
1740gccggacttc aaaaaactgt atcaagaagc tcggagaagc atgaaagcaa
atgagtggtt 1800ctctgttcct gaacagacac ttactattgg ccttgatggt
gctgatacca acgacgtacc 1860cccaacgacc tatgggtggg acaatgagaa
acctgcgaga acagtcacgg ttccagcatt 1920tgaggcgcag ggcaggccca
tcaccaatgg tgagtacgcc aagtacttgc aagcgaatca 1980gtcgcgcaga
aggccagcat catgggtcct gacccattcg gatgaagact acgccatacc
2040tatggcggtc aacggaagca gtgtcggggc tacgcaggac tttatgtcca
actttgctgt 2100ccgtacggtc ttcggcccag ttccacttga atttgctcag
gactggcctg tgatggcgtc 2160atatgatgaa ttagctgaat acgccgaatg
ggtgggttgc aggatcccaa ccttcgaaga 2220gacaaggagt atctatctgc
actcagcgct attgaaggaa agaggtggcg tgaatcataa 2280tggggagccc
aacggccata ggttagtgca gcctcattat aacaccacat tcgggattaa
2340gctgagctaa cggctgtcag tttgaacggc gatctgaatg gggtgaatgg
aaatggttac 2400tcgaagatca acccaggcaa acctcgtaag ccggatcacc
agcctgtaca atatccttcc 2460cgagacgccc tgccagtgtt ccttgatctg
cacggtctca acgtcgggtt caagcactgg 2520caccccaccc cagttatcca
gaacggcgat cgactcgccg gtcagggtga actgggaggc 2580gcatgggagt
ggactagcac gccattagcg ccacacgatg gctttaaagc catggagatc
2640tacccgggat acacctgtaa gtaccagtcc cgttatcggg taccctctaa
aagtctatca 2700ttacatacta attccgcaca gccgatttct tcgacggtaa
acataatatc atcctgggtg 2760gttcttgggc tactcatccc cgcgtcgctg
ggcgtaccac tttgtaagtt taccggtata 2820gaactcgggg cactataaga
tgctgacatc acctctagcg tcaattggta ccagcacaac 2880tatccttaca
cctgggcagg agcacgcctg gtgcgggatc tttag 292521770DNAAspergillus
sojae 2atgtctaatg ttacccaatc agccttgaga caggcaactc gcgcctacgc
tcgccgactg 60ccatcgacgc agcatggctc cttcgcttcc gcccttccca gacgggcgct
cgccactcca 120tacagacggt tctatgtctc cgaaactaag gctggaaatg
ctcaggtttc ggtagatacc 180gctatgaagc aggagcagaa ggaattcatg
aaacaaactg gggtgcagcc gcagaaggtg 240gagctcccta gttctggtgt
ttccggcgat gcctcgatga gcccgtctgc cggcatcctc 300aagcaggcca
ctgtcatgga ccaaggaacg cgaccgatct atctcgatat gcaggccaca
360accccaacgg atccccgtgt tctcgacgcc atgctcccct tcttgaccgg
aatttacggc 420aaccctcatt cgagaaccca tgcatacggt tgggagtcag
aaaaggcagt cgagcaatcc 480cgagagcata tcgccaagct gatcggcgcg
gacccgaaag agatcatctt cactagcggt 540gctactgaga gtaacaacat
gagcattaag ggtgtggcga ggttttttgg gcgctccggc 600aaaaaaaacc
acatcatcac aacgcagacc gagcacaagt gtgttcttga cagctgtcgg
660catcttcagg atgagggcta cgaggttacg tatctccccg tgcagaacaa
cggcttgatt 720cggatggaag acctcgaggc cgccattcgc cctgaaacgg
ccctggtcag catcatggcc 780gtcaacaatg agatcggtgt tatccagccc
ctggaacaga ttggaaagtt gtgccgctcc 840aagaagattt tcttccacac
ggacgctgca caggccgtgg gaaagatccc gttggatgtg 900aataaattga
atattgattt gatgtctatt tcgagccaca agatttacgg ccccaagggt
960attggagctt gctatgtcag acgtcgtccc agggttcgcc ttgaccctct
cattactgga 1020ggtggacagg agcgaggcct gcgcagtggt actcttgctc
ctcatctggt cgttgggttc 1080ggtgaggcct gccggatcgc cgcccaagat
atggaggtac gttctatttt tcttttgttt 1140ctgcttactt gcaatccctt
ttctattttc cgatgattat atactgcaaa tatggatttc 1200cgagaccggt
gggggtagct gcacgcctaa cgcgtgaccc atgggcctat gacgtctcag
1260caggggtgat gagttgacta ttgctttgtt tgccttgttt gcctcatgcg
gctatgcgtc 1320agtggacatc gctaatcgag ttggcagtat gacaccaagc
acattgatcg tttgtccaag 1380cgcctgaccg acgggctcct atccatggag
cacacacacc tcaacggaga ccctgaacat 1440cactacccgg gatgtgtcaa
tgtctccttt gcctacatcg aaggagagtc tctcctgatg 1500gccttgaaag
acattgctct gtcgtcgggt agtgcctgta cctctgcgtc attggagccc
1560agctacgtcc ttcgtgcctt gggtagcagt gacgagagcg cccatagcag
tatccggttt 1620ggaattggac gattcacttc ggatagcgaa attgactacg
tgctgaaggc ggtacaggac 1680cgcgttcatt tcctacgcga gctgagcccc
ttgtgggaat tggtgcagga aggtatcgac 1740ctgaacacga tcgaatggag
tcaacattaa 177031529DNAAspergillus sojae 3atgaccactc ccttcggagc
tcccatgaga gagcacttcc tctttgacac caacttcaaa 60aacctcaacc atggtatagt
atcctactcc agtaacaagt accaacatta gctaactata 120aaccaggctc
cttcggcaca tacccccgtg ccgtccagac agtcctccgc caacaccaac
180actccgccga ggcccgtcca gacctcttct accgcatcac ccgcggccaa
ggcatcgacg 240gatcgcgccg catcgtagcc aacctgctca acatccccgt
caacgaatgt gtcttcgtca 300agaacgcaac cacgggggtc gccaccgtgc
tccgtaatct agtcttccag aagggagacg 360cagtcgtgta cttcgacact
atctatggcg ctgtggagaa gaatgtacac tctattatgg 420aggctagtcc
tgtgactact cgaaaggttg agtgtgcgtt acccgttagc catgaggacc
480tggtgaaacg gttcagggat gtcgtgagtc gtgcaagagg ggaagggctg
catgtgaaag 540ttgcggtgtt tgacaccatc gtcagtgtgc ctggggtcag
gttcccgttc gagaccttgg 600taggggtctg tcgggaggag ggtatactca
gtcttatcga tggggcgcat ggtattggac 660atataccgtt ggatttgggg
actttgaggc cggatttctt tactagtaac ctgcataagt 720atgttccttt
cccctttctt tctttctttc gtttgattac tgtgtgagga tcttgtatgc
780tgatatagag caaaaaaaaa agatggctat tcgtcccccg cggctgcgca
gttctccacg 840tcccactccg caaccaacat ctcatccgca ccacattccc
aacctcatgg ggatacatcc 900cccctccctc atccggggag ataaccccca
ccgccacgca gggtaaatcc gccttcgaat 960atctcttcga acacatctcc
acaaccgacg acacgccctg gctatgcgtc cccgccgcca 1020tgaaattccg
aactgaagtc tgcggcggcg aagaccgcat ctacgcttac ctggagaccc
1080tagcccgcga ggccggggat atcgttgccc gcgccctcgg gacggaagtc
atgcaggagc 1140ccgggttgaa ggagggagag gtgagtcagc ttaggaggtg
tgggatggct actgtgcggt 1200tgccgattgc tgtgacttct tcttcttctt
ctgattctgg gtctggtaat ggtgggggtg 1260ctgttatgag ggtgcagggt
gaggatggga gttcgtattt gcgaatccag acgtctttgg 1320tggggactgt
gagtaattgg tttcgggata cgttgtttga taagtacgag acgtttgtgc
1380cggtgttcca gcatgggggg tggttgtgga cgagactcag tgcgcaggtt
tatttggaga 1440agggggattt tgagtggttg gggggtgttt tgagggagtg
ttgtgagagg gttgagaggg 1500aggttggggt ttcttctgcg aagctttga
15294845PRTAspergillus sojae 4Met Ser Pro Leu Ala Leu Ser Pro Lys
Thr Val Asp Ile Val Asn Ile1 5 10 15Phe Gln Asn Asp Val Glu Phe Ser
Leu Val Asn Glu Ile His Lys Gly 20 25 30Ile Ser Pro Pro Ala Gly Val
Arg Lys Ser Met Pro Thr Met Leu Leu 35 40 45Tyr Asp Ala Asn Gly Leu
Lys Leu Phe Glu Asn Ile Thr Tyr Val Lys 50 55 60Glu Tyr Tyr Leu Thr
Asn Ala Glu Ile Glu Val Leu Glu Thr Asn Ser65 70 75 80Arg Arg Ile
Val Glu Arg Ile Pro Asp Asn Ala Gln Leu Leu Glu Leu 85 90 95Gly Ser
Gly Asn Leu Arg Lys Ile Glu Ile Leu Leu Arg Glu Phe Glu 100 105
110Arg Val Gly Lys Arg Val Asp Tyr Tyr Ala Leu Asp Leu Ser Leu Ser
115 120 125Glu Leu Gln Arg Thr Phe Ala Glu Val Ser Ile Asp Asp Tyr
Thr His 130 135 140Val Gly Leu His Gly Leu His Gly Thr Tyr Asp Asp
Ala Val Thr Trp145 150 155 160Leu Asn Ser Pro Glu Asn Arg Lys Arg
Pro Thr Val Ile Met Ser Met 165 170 175Gly Ser Ser Leu Gly Asn Phe
Asp Arg Pro Gly Ala Ala Lys Phe Leu 180 185 190Ser Gln Tyr Ala Ser
Leu Leu Gly Pro Ser Asp Met Met Ile Ile Gly 195 200 205Leu Asp Gly
Cys Lys Asp Pro Gly Lys Val Tyr Arg Ala Tyr Asn Asp 210 215 220Ser
Glu Gly Val Thr Arg Gln Phe Tyr Glu Asn Gly Leu Val His Ala225 230
235 240Asn Val Val Leu Gly Tyr Glu Ala Phe Lys Ser Asp Glu Trp Glu
Val 245 250 255Val Thr Asp Tyr Asp Thr Val Glu Gly Arg His Trp Ala
Ala Tyr Ser 260 265 270Pro Lys Lys Asp Val Thr Ile Asn Gly Val Leu
Leu Lys Lys Gly Glu 275 280 285Lys Leu Phe Phe Glu Glu Ala Tyr Lys
Tyr Gly Pro Glu Glu Arg Asp 290 295 300Gln Leu Trp Arg Asp Ala Lys
Leu Ile Gln Ser Thr Glu Met Gly Asn305 310 315 320Gly Ser Asp Asp
Tyr His Leu His Leu Leu Thr Ser Ala Thr Leu Asn 325 330 335Leu Pro
Thr Ser Pro Ser Gln Tyr Ala Ala His Pro Ile Pro Ser Phe 340 345
350Glu Glu Trp Gln Ser Leu Trp Thr Ala Trp Asp Asn Ala Thr Lys Ala
355 360 365Met Val Pro Arg Glu Glu Leu Leu Ser Lys Pro Ile Lys Leu
Arg Asn 370 375 380Ser Leu Ile Phe Tyr Leu Gly His Ile Pro Thr Phe
Leu Asp Ile His385 390 395 400Leu Thr Arg Ala Leu Arg Gly Lys Leu
Thr Glu Pro Lys Ser Tyr Lys 405 410 415Leu Ile Phe Glu Arg Gly Ile
Asp Pro Asp Val Asp Asp Pro Glu Lys 420 425 430Cys His Ser His Ser
Glu Ile Pro Asp Glu Trp Pro Ala Leu Asp Asp 435 440 445Ile Leu Asp
Tyr Gln Glu Arg Val Arg Ser Arg Val Arg Ser Ile Tyr 450 455 460Gln
Ile Glu Gly Leu Ala Glu Asn Arg Ile Leu Gly Glu Ala Leu Trp465 470
475 480Ile Gly Phe Glu His Glu Val Met His Leu Glu Thr Phe Leu Tyr
Met 485 490 495Leu Ile Gln Ser Glu Arg Ile Leu Pro Pro Pro Ala Thr
Glu Arg Pro 500 505 510Asp Phe Lys Lys Leu Tyr Gln Glu Ala Arg Arg
Ser Met Lys Ala Asn 515 520 525Glu Trp Phe Ser Val Pro Glu Gln Thr
Leu Thr Ile Gly Leu Asp Gly 530 535 540Ala Asp Thr Asn Asp Val Pro
Pro Thr Thr Tyr Gly Trp Asp Asn Glu545 550 555 560Lys Pro Ala Arg
Thr Val Thr Val Pro Ala Phe Glu Ala Gln Gly Arg 565 570 575Pro Ile
Thr Asn Gly Glu Tyr Ala Lys Tyr Leu Gln Ala Asn Gln Ser 580 585
590Arg Arg Arg Pro Ala Ser Trp Val Leu Thr His Ser Asp Glu Asp Tyr
595 600 605Ala Ile Pro Met Ala Val Asn Gly Ser Ser Val Gly Ala Thr
Gln Asp 610 615 620Phe Met Ser Asn Phe Ala Val Arg Thr Val Phe Gly
Pro Val Pro Leu625 630 635 640Glu Phe Ala Gln Asp Trp Pro Val Met
Ala Ser Tyr Asp Glu Leu Ala 645 650 655Glu Tyr Ala Glu Trp Val Gly
Cys Arg Ile Pro Thr Phe Glu Glu Thr 660 665 670Arg Ser Ile Tyr Leu
His Ser Ala Leu Leu Lys Glu Arg Gly Gly Val 675 680 685Asn His Asn
Gly Glu Pro Asn Gly His Ser Leu Asn Gly Asp Leu Asn 690 695 700Gly
Val Asn Gly Asn Gly Tyr Ser Lys Ile Asn Pro Gly Lys Pro Arg705 710
715 720Lys Pro Asp His Gln Pro Val Gln Tyr Pro Ser Arg Asp Ala Leu
Pro 725 730 735Val Phe Leu Asp Leu His Gly Leu Asn Val Gly Phe Lys
His Trp His 740 745 750Pro Thr Pro Val Ile Gln Asn Gly Asp Arg Leu
Ala Gly Gln Gly Glu 755 760 765Leu Gly Gly Ala Trp Glu Trp Thr Ser
Thr Pro Leu Ala Pro His Asp 770 775 780Gly Phe Lys Ala Met Glu Ile
Tyr Pro Gly Tyr Thr Ser Asp Phe Phe785 790 795 800Asp Gly Lys His
Asn Ile Ile Leu Gly Gly Ser Trp Ala Thr His Pro 805 810 815Arg Val
Ala Gly Arg Thr Thr Phe Val Asn Trp Tyr Gln His Asn Tyr 820 825
830Pro Tyr Thr Trp Ala Gly Ala Arg Leu Val Arg Asp Leu 835 840
8455512PRTAspergillus sojae 5Met Ser Asn Val Thr Gln Ser Ala Leu
Arg Gln Ala Thr Arg Ala Tyr1 5 10 15Ala Arg Arg Leu Pro Ser Thr Gln
His Gly Ser Phe Ala Ser Ala Leu 20 25 30Pro Arg Arg Ala Leu Ala Thr
Pro Tyr Arg Arg Phe Tyr Val Ser Glu 35 40 45Thr Lys Ala Gly Asn Ala
Gln Val Ser Val Asp Thr Ala Met Lys Gln 50 55 60Glu Gln Lys Glu Phe
Met Lys Gln Thr Gly Val Gln Pro Gln Lys Val65 70 75 80Glu Leu Pro
Ser Ser Gly Val Ser Gly Asp Ala Ser Met Ser Pro Ser 85 90 95Ala Gly
Ile Leu Lys Gln Ala Thr Val Met Asp Gln Gly Thr Arg Pro 100 105
110Ile Tyr Leu Asp Met Gln Ala Thr Thr Pro Thr Asp Pro Arg Val Leu
115 120 125Asp Ala Met Leu Pro Phe Leu Thr Gly Ile Tyr Gly Asn Pro
His Ser 130 135 140Arg Thr His Ala Tyr Gly Trp Glu Ser Glu Lys Ala
Val Glu Gln Ser145 150 155 160Arg Glu His Ile Ala Lys Leu Ile Gly
Ala Asp Pro Lys Glu Ile Ile 165 170 175Phe Thr Ser Gly Ala Thr Glu
Ser Asn Asn Met Ser Ile Lys Gly Val 180 185 190Ala Arg Phe Phe Gly
Arg Ser Gly Lys Lys Asn His Ile Ile Thr Thr 195 200 205Gln Thr Glu
His Lys Cys Val Leu Asp Ser Cys Arg His Leu Gln Asp 210 215 220Glu
Gly Tyr Glu Val Thr Tyr Leu Pro Val Gln Asn Asn Gly Leu Ile225 230
235 240Arg Met Glu Asp Leu Glu Ala Ala Ile Arg Pro Glu Thr Ala Leu
Val 245 250 255Ser Ile Met Ala Val Asn Asn Glu Ile Gly Val Ile Gln
Pro Leu Glu 260 265 270Gln Ile Gly Lys Leu Cys Arg Ser Lys Lys Ile
Phe Phe His Thr Asp 275 280 285Ala Ala Gln Ala Val Gly Lys Ile Pro
Leu Asp Val Asn Lys Leu Asn 290 295 300Ile Asp Leu Met Ser Ile Ser
Ser His Lys Ile Tyr Gly Pro Lys Gly305 310 315 320Ile Gly Ala Cys
Tyr Val Arg Arg Arg Pro Arg Val Arg Leu Asp Pro 325 330 335Leu Ile
Thr Gly Gly Gly Gln Glu Arg Gly Leu Arg Ser Gly Thr Leu 340 345
350Ala Pro His Leu Val Val Gly Phe Gly Glu Ala Cys Arg Ile Ala Ala
355 360 365Gln Asp Met Glu Tyr Asp Thr Lys His Ile Asp Arg Leu Ser
Lys Arg 370 375 380Leu Thr Asp Gly Leu Leu Ser Met Glu His Thr His
Leu Asn Gly Asp385 390 395 400Pro Glu His His Tyr Pro Gly Cys Val
Asn Val Ser Phe Ala Tyr Ile 405 410 415Glu Gly Glu Ser Leu Leu Met
Ala Leu Lys Asp Ile Ala Leu Ser Ser 420 425 430Gly Ser Ala Cys Thr
Ser Ala Ser Leu Glu Pro Ser Tyr Val Leu Arg 435 440 445Ala Leu Gly
Ser Ser Asp Glu Ser Ala His Ser Ser Ile Arg Phe Gly 450 455 460Ile
Gly Arg Phe Thr Ser Asp Ser Glu Ile Asp Tyr Val Leu Lys Ala465 470
475 480Val Gln Asp Arg Val His Phe Leu Arg Glu Leu Ser Pro Leu Trp
Glu 485 490 495Leu Val Gln Glu Gly Ile Asp Leu Asn Thr Ile Glu Trp
Ser Gln His 500 505 5106463PRTAspergillus sojae 6Met Thr Thr Pro
Phe Gly Ala Pro Met Arg Glu His Phe Leu Phe Asp1 5 10 15Thr Asn Phe
Lys Asn Leu Asn His Gly Ser Phe Gly Thr Tyr Pro Arg 20 25 30Ala Val
Gln Thr Val Leu Arg Gln His Gln His Ser Ala Glu Ala Arg 35 40 45Pro
Asp Leu Phe Tyr Arg Ile Thr Arg Gly Gln Gly Ile Asp Gly
Ser 50 55 60Arg Arg Ile Val Ala Asn Leu Leu Asn Ile Pro Val Asn Glu
Cys Val65 70 75 80Phe Val Lys Asn Ala Thr Thr Gly Val Ala Thr Val
Leu Arg Asn Leu 85 90 95Val Phe Gln Lys Gly Asp Ala Val Val Tyr Phe
Asp Thr Ile Tyr Gly 100 105 110Ala Val Glu Lys Asn Val His Ser Ile
Met Glu Ala Ser Pro Val Thr 115 120 125Thr Arg Lys Val Glu Cys Ala
Leu Pro Val Ser His Glu Asp Leu Val 130 135 140Lys Arg Phe Arg Asp
Val Val Ser Arg Ala Arg Gly Glu Gly Leu His145 150 155 160Val Lys
Val Ala Val Phe Asp Thr Ile Val Ser Val Pro Gly Val Arg 165 170
175Phe Pro Phe Glu Thr Leu Val Gly Val Cys Arg Glu Glu Gly Ile Leu
180 185 190Ser Leu Ile Asp Gly Ala His Gly Ile Gly His Ile Pro Leu
Asp Leu 195 200 205Gly Thr Leu Arg Pro Asp Phe Phe Thr Ser Asn Leu
His Lys Trp Leu 210 215 220Phe Val Pro Arg Gly Cys Ala Val Leu His
Val Pro Leu Arg Asn Gln225 230 235 240His Leu Ile Arg Thr Thr Phe
Pro Thr Ser Trp Gly Tyr Ile Pro Pro 245 250 255Pro Ser Ser Gly Glu
Ile Thr Pro Thr Ala Thr Gln Gly Lys Ser Ala 260 265 270Phe Glu Tyr
Leu Phe Glu His Ile Ser Thr Thr Asp Asp Thr Pro Trp 275 280 285Leu
Cys Val Pro Ala Ala Met Lys Phe Arg Thr Glu Val Cys Gly Gly 290 295
300Glu Asp Arg Ile Tyr Ala Tyr Leu Glu Thr Leu Ala Arg Glu Ala
Gly305 310 315 320Asp Ile Val Ala Arg Ala Leu Gly Thr Glu Val Met
Gln Glu Pro Gly 325 330 335Leu Lys Glu Gly Glu Val Ser Gln Leu Arg
Arg Cys Gly Met Ala Thr 340 345 350Val Arg Leu Pro Ile Ala Val Thr
Ser Ser Ser Ser Ser Asp Ser Gly 355 360 365Ser Gly Asn Gly Gly Gly
Ala Val Met Arg Val Gln Gly Glu Asp Gly 370 375 380Ser Ser Tyr Leu
Arg Ile Gln Thr Ser Leu Val Gly Thr Val Ser Asn385 390 395 400Trp
Phe Arg Asp Thr Leu Phe Asp Lys Tyr Glu Thr Phe Val Pro Val 405 410
415Phe Gln His Gly Gly Trp Leu Trp Thr Arg Leu Ser Ala Gln Val Tyr
420 425 430Leu Glu Lys Gly Asp Phe Glu Trp Leu Gly Gly Val Leu Arg
Glu Cys 435 440 445Cys Glu Arg Val Glu Arg Glu Val Gly Val Ser Ser
Ala Lys Leu 450 455 4607748DNAAspergillus sojae 7tgtggaccag
acaggcgcca ctcggccggg ccacaactgc ttgggttttg accgggagcg 60gaccaattaa
ggactcgaac gaccgcgggg ttcaaatgca aacaagtaca acacgcagca
120aacgaagcag cccaccactg cgttgatgcc cagtttgtct gtccgaaatc
caccggaaag 180gtggaaacat actatgtaac aatcagaggg aagaaaaatt
ttttatcgac gaggcaggat 240agtgactgat ggtggggtca tggtcgggtc
tccgagcgaa agagaaccaa ggaaacaaga 300tcaacgaggt tggtgtaccc
aaaaggccgc agcaacaaga gtcatcgccc aaaagtcaac 360agtctggaag
agactccgcc gtgcagattc tgcgtcggtc ccgcacatgc gtggtggggg
420cattacccct ccatgtccaa tgataagggc ggcggtcgag ggcttaagcc
cgcccactaa 480ttcgccttct cgcttgcccc tccatataag gattcccctc
cttcccctcc cacaactttt 540ttcctctttc tctcttcgtc cgcatcagta
cgtatatctt tcccccctac ctctttctca 600ctcttcctcg attcattcca
ctcttctcct tactgacatc tgttttgctc agtacctcta 660cgcgatcagc
cgtagtatct gagcaagctt ttttacagaa tctttctagt atcttacaaa
720gaactacaaa gttcgcacca ccttcaaa 7488800DNAAspergillus sojae
8gtaccaggag tacattggag agttctacca ttgttgctgg aatacaatga tgattagaaa
60ccgaagagtg ttatgattcg gacggatata cgcatggcac gcatacagcg tgatacatag
120gctgtttgct caagaattag gattttatct gaatccatgt acagagttta
cttatgttag 180tagtcaatga aatcttggct ttctaatttt gtccgatcta
caaggggtag tcgatcacag 240aacgaactag atgtgcaggg aacgatgatc
acccgctctt agcaagacct ctagtagttt 300tcgaccatag ctttaacgcg
aatcatgacc ctactatttt ctagattgca gaccaagtca 360catgacaatg
tcctctttga agtaggatca gtagctgatt agattccggg aaatgaatta
420gggctggcgt tccaactact ggggagtgcc gatgttgctg tatgaaagat
agtaagatta 480ctagtgcaca gctgtagtaa ttatttactc tagattatat
attccaaata ataagtaatc 540taagatagta gacagtccta tgatatagct
ccgggttcga agtcggcaaa agatatgcaa 600tcacctgtcg ggatgatata
tgtatatctg aaataccgac atcaaccatc cagtcggatc 660agctaaacga
agtatcactt ctttcgccac tgccaatcac tacttctatt aaagttcatg
720ttacagtata agccacaaga cttatctcca gaactaactt gtgcatagga
gctctgccga 780tagccgggtg gttggatcgg 80091838DNAAspergillus sojae
9ttgggcttat tgctatgtcc ctgaaaggat atcaaaagca ggcaaaaagc caggcataac
60cccgcgcgga tggtacccta aggataagcc ctaatcttat ctacatgtga ctgcgtcgat
120gtgtttggtc caaatgaggc atgtggctca ccccacaggc ggagaaacgt
gtggctagtg 180catgacggtc ccctccatag attcaattta atttttcgcg
gcaattgtcg tgcagtttgt 240atctaccgtt cattctacat attaagggtt
agtaattgga catcctgatt actttgtcta 300attactgaaa actcgaagta
ctaacctact aaataagtca gtttcaacca ctaagtactc 360atttatacaa
tagttgcaga accccgcgct acccctccat tgccaacatg tcttccaagt
420cgcaattgac ctacagcgca cgcgctagca agcaccccaa tgcgctcgtg
aagaagctct 480tcgaggttgc cgaggccaag aaaaccaatg tcaccgtttc
cgccgacgtg acaaccacca 540aagagctgct ggatttggct gaccgtatgc
gcaccgggga tgccacttac atatgatcta 600gtaatggtta atggtggaat
atataacagg actcggtccg tacattgccg tgatcaaaac 660tcacatcgat
atcctctccg atttcagcga agagaccatc atcggtctga aggcccttgc
720agagaagcac aatttcctca tcttcgaaga tcgcaagttc atcgatatcg
gaaacacagt 780ccaaaagcag taccatggcg gcactctgcg catctctgag
tgggcccaca tcatcaactg 840cagtattctg cccggtgagg gtatcgtcga
ggctctggcc cagactgctt cggccgagga 900cttcccctat ggctctgaga
ggggcctttt gatccttgcg gagatgacat ccaagggatc 960tttggctacc
ggtcaatata ctacttcttc tgttgactat gcccggaagt ataagaagtt
1020tgtgatggga ttcgtctcga cgcgtcacct gggcgaggtt cagtctgaag
ttagctcgcc 1080ttcggaggag gaggatttcg tcgtcttcac gacaggtgtc
aacctctcct cgaagggaga 1140caaactggga cagcaatacc agactcctga
gtctgctgtt ggacgcggtg ccgactttat 1200cattgctggt cgtggaattt
atgctgctcc tgatcccgtg gaggcagcga agcggtacca 1260gaaagaggga
tgggatgcat accagaagcg tgttggtgcg caataagtag tggtgaatac
1320gtgctctttt tatggcagta tatcgcaagt atgatgcgat tcataaattc
agcagtcgaa 1380ttctacgaga gaacgatgct aagagatacc ctctctatat
gaataatatg cctgcctcga 1440gatatggaca tattcaagat cagagttaag
ggtcatgttt caaaatcaca ccaatctcca 1500acatagacga gaatttttac
cggattgtct gaaggtgcag ctggagattg gtctattttc 1560taagagtggg
gtatcactaa tgtacagtcg gtcactatcg tacaaacaat cacaattata
1620tacaagattt cccatcaccc cttactctaa catggcactt ttatccatcg
agtccgagcc 1680tagccaccat ttggtgcttt cgtagagacc aaagtataac
cctgatccga cagcggccat 1740aaacgtgttg atagcacacc ctcggaatag
tcctctcggg ccatctgttc gtataatctc 1800ccgtacggta ttgatcatcc
ttttcttctg aggtgcgg 18381038DNAArtificial sequencePrimer
10cggtacccgg ggatctgtgg accagacagg cgccactc 381140DNAArtificial
sequencePrimer 11atgtactcct ggtactttga aggtggtgcg aactttgtag
401228DNAArtificial sequencePrimer 12gtaccaggag tacattggag agttctac
281323DNAArtificial sequencePrimer 13ccgatccaac cacccggcta tcg
231443DNAArtificial sequencePrimer 14gggtggttgg atcggttggg
cttattgcta tgtccctgaa agg 431539DNAArtificial sequencePrimer
15cgactctaga ggatcccgca cctcagaaga aaaggatga 391625DNAArtificial
sequencePrimer 16tttgaaggtg gtgcgaactt tgtag 251738DNAArtificial
sequencePrimer 17cgcaccacct tcaaaatgtc acctttggct ctctctcc
381837DNAArtificial sequencePrimer 18atgtactcct ggtacctaaa
gatcccgcac caggcgt 371944DNAArtificial sequencePrimer 19cgcaccacct
tcaaaatgtc taatgttacc caatcagcct tgag 442045DNAArtificial
sequencePrimer 20atgtactcct ggtacttaat gttgactcca ttcgatcgtg ttcag
452136DNAArtificial sequencePrimer 21cgcaccacct tcaaaatgac
cactcccttc ggagct 362243DNAArtificial sequencePrimer 22atgtactcct
ggtactcaaa gcttcgcaga agaaacccca acc 43232917DNAAspergillus oryzae
23atgtcaccgt tggctctttc tcctaagacc gttgacattg tcaacatctt tcagaatgac
60gtggagttct ccctcgtaaa tgagatccat aagggcatta gtcctcccgc tggcgttagg
120aagtcaatgc caacgatgct tctttacgat gccaatggcc tcaagctttt
tgagaaaatc 180acctatgtga aggagtatta tctaacaaat gcggaaatcg
aggtcttgga gacaaattcc 240aggaggatag ttgaacggat tccagacaat
gcgcaactgc ttgaattagg tagcgggtgc 300gtcatccttc caaatcaaat
cgtaaccttt caggctgcgt agcgtatcat taccgttctc 360cggttttaac
cgccttttag gaatcttcgg aaaattgaga ttctgctacg ggagtttgag
420cgcgtgggaa agcgcgtgga ttattatgcc cttgacctgt ctctatcaga
actgcagcgc 480acattcgcag aggtgtccat tgatgattac acacacgttg
gcctccatgg tctccatgga 540acctacgacg atgccgtcac ttggcttaac
agccccgaaa acaggaagcg gcccacggtg 600atcatgtcta tgggttcctc
tttagggaac tttgaccgtc ctggcgcagc aaagtttctc 660tcgcagtatg
ctagccttct tggtccatcc gatatgatga tcattggtct ggatggctgc
720aaggacccgg gcaaagtata cagggcatac aatgattcag aaggtgttac
acggcagttc 780tatgagaacg gactagtgca tgcaaatgtt gttcttggat
acgaagcctt caaacctgat 840gagtgggaag tagtgactga ctacgatgcc
gtggagggac gacactgggc agcctactca 900cccaggaggg acgtcactat
caacggggtc cttcttaaga agggggagaa actcttcttt 960gaagaggcgt
acaagtacgg accagaggaa cgcgatcaac tgtggcgtga tgccaagtta
1020ctccagtcta cggaagtggg caatgggtct gacgattacc gtgagtagca
aatggctgcc 1080tcatttcagt agacgtgtat gctaaatctg gcttttcgca
aaatagatct ccatcttctg 1140acatccgctg ccctcaacct ccccacgtct
ccctctcaat atgcagctca tcctataccc 1200agctttgaag aatggcagtc
cctgtggaca gcatgggata atgctacaaa ggctatggtc 1260cctcgcgagg
agcttctgtc aaagccgatc aagctacgga actctttaat cttctatctg
1320gggcacattc ctacattctt gggttagtct acatggctta ctattcccaa
cacataactt 1380gatgctaatt atgcaaacag acatccatct gacccgagcc
ctgcgcggaa aactgacaga 1440gccaaagtct tataaactaa ttttcgaacg
tgggattgat cctgatgtag atgaccccca 1500gaagtgccac tcccatagcg
agatcccaga cgagtggcca gctcttgatg acattctaga 1560ctaccaagag
cgagtcagaa gcagagttag atccatctac cagatcgagg gccttgcaga
1620aaacagaatc ctgggtgagg cgctttggat tggatttgag cacgaagtga
tgcacctcga 1680gacattcctg tacatgttga tccagagcga aaggatactt
cccccgcccg ccactgaacg 1740gccggacttc aaaaaactgt accaagacgc
tcggagaagc atgaaaacaa atgagtggtt 1800ctccgttcct gaacagacac
ttactattgg ccttgatggt gctgatacca acgacgtacc 1860cccaacgacc
tatgggtggg acaatgagaa acctgcgaga acagtgacgg ttccagcatt
1920tgaggcgcag ggcaggccca tcaccaatgg tgagtacgcc aagtacttgc
aagcgaatca 1980gtcgcgcaga aggccagcat catgggtcct gacccattcg
gatgaaaact accccatacc 2040tatggccgtc aacggaagca gtgtcggggc
tacgcaggac tttatgtcca actttgctgt 2100ccgtactgtc ttcggcccag
ttccacttga atttgctcag gactggcctg tgatggcgtc 2160atatgatgaa
ttagccgaat atgccgaatg ggtgggttgc agaatcccaa ccttcgaaga
2220gacaaggagt atctatctgc actcagcgct actgaaggaa agaggtggcg
taaatcataa 2280tggggagccc aatggccata ggttagtgca gcctcattat
aacgccacat tccggggatt 2340gagctgagct aacggctttc agtgtgaacg
gctatctgaa cgggatgaat ggaaatagct 2400actcgaagat caacccaggc
aaacctcgta cgccggacca ccagcctgta caatatcctt 2460cccgggacgc
cttgccagtg ttccttgatc tggacggtct caacgtcggg ttcaagcact
2520ggcaccccac cccagttatc cagaacggcg atcgactcgc cggtcagggt
gaactgggag 2580gcgcatggga gtggactagc acgccattag cgccacacga
tggctttaaa gccatggaga 2640tctacccggg atacacctgt aagtaccagt
cccgttatcg ggtaccctct cattacatac 2700taattccgca cagccgattt
cttcgacggt aaacataaca tcatcctggg tggttcttgg 2760gctactcatc
cccgcgttgc tgggcgtacc actttgtaag tttaccggta tagaacccgg
2820ggcactataa gatgctgaca acacctctag cgtcaattgg taccagcaca
actatcctta 2880cacctgggca ggagcacgcc tagtgcggga tctttag
291724845PRTAspergillus oryzae 24Met Ser Pro Leu Ala Leu Ser Pro
Lys Thr Val Asp Ile Val Asn Ile1 5 10 15Phe Gln Asn Asp Val Glu Phe
Ser Leu Val Asn Glu Ile His Lys Gly 20 25 30Ile Ser Pro Pro Ala Gly
Val Arg Lys Ser Met Pro Thr Met Leu Leu 35 40 45Tyr Asp Ala Asn Gly
Leu Lys Leu Phe Glu Lys Ile Thr Tyr Val Lys 50 55 60Glu Tyr Tyr Leu
Thr Asn Ala Glu Ile Glu Val Leu Glu Thr Asn Ser65 70 75 80Arg Arg
Ile Val Glu Arg Ile Pro Asp Asn Ala Gln Leu Leu Glu Leu 85 90 95Gly
Ser Gly Asn Leu Arg Lys Ile Glu Ile Leu Leu Arg Glu Phe Glu 100 105
110Arg Val Gly Lys Arg Val Asp Tyr Tyr Ala Leu Asp Leu Ser Leu Ser
115 120 125Glu Leu Gln Arg Thr Phe Ala Glu Val Ser Ile Asp Asp Tyr
Thr His 130 135 140Val Gly Leu His Gly Leu His Gly Thr Tyr Asp Asp
Ala Val Thr Trp145 150 155 160Leu Asn Ser Pro Glu Asn Arg Lys Arg
Pro Thr Val Ile Met Ser Met 165 170 175Gly Ser Ser Leu Gly Asn Phe
Asp Arg Pro Gly Ala Ala Lys Phe Leu 180 185 190Ser Gln Tyr Ala Ser
Leu Leu Gly Pro Ser Asp Met Met Ile Ile Gly 195 200 205Leu Asp Gly
Cys Lys Asp Pro Gly Lys Val Tyr Arg Ala Tyr Asn Asp 210 215 220Ser
Glu Gly Val Thr Arg Gln Phe Tyr Glu Asn Gly Leu Val His Ala225 230
235 240Asn Val Val Leu Gly Tyr Glu Ala Phe Lys Pro Asp Glu Trp Glu
Val 245 250 255Val Thr Asp Tyr Asp Ala Val Glu Gly Arg His Trp Ala
Ala Tyr Ser 260 265 270Pro Arg Arg Asp Val Thr Ile Asn Gly Val Leu
Leu Lys Lys Gly Glu 275 280 285Lys Leu Phe Phe Glu Glu Ala Tyr Lys
Tyr Gly Pro Glu Glu Arg Asp 290 295 300Gln Leu Trp Arg Asp Ala Lys
Leu Leu Gln Ser Thr Glu Val Gly Asn305 310 315 320Gly Ser Asp Asp
Tyr His Leu His Leu Leu Thr Ser Ala Ala Leu Asn 325 330 335Leu Pro
Thr Ser Pro Ser Gln Tyr Ala Ala His Pro Ile Pro Ser Phe 340 345
350Glu Glu Trp Gln Ser Leu Trp Thr Ala Trp Asp Asn Ala Thr Lys Ala
355 360 365Met Val Pro Arg Glu Glu Leu Leu Ser Lys Pro Ile Lys Leu
Arg Asn 370 375 380Ser Leu Ile Phe Tyr Leu Gly His Ile Pro Thr Phe
Leu Asp Ile His385 390 395 400Leu Thr Arg Ala Leu Arg Gly Lys Leu
Thr Glu Pro Lys Ser Tyr Lys 405 410 415Leu Ile Phe Glu Arg Gly Ile
Asp Pro Asp Val Asp Asp Pro Gln Lys 420 425 430Cys His Ser His Ser
Glu Ile Pro Asp Glu Trp Pro Ala Leu Asp Asp 435 440 445Ile Leu Asp
Tyr Gln Glu Arg Val Arg Ser Arg Val Arg Ser Ile Tyr 450 455 460Gln
Ile Glu Gly Leu Ala Glu Asn Arg Ile Leu Gly Glu Ala Leu Trp465 470
475 480Ile Gly Phe Glu His Glu Val Met His Leu Glu Thr Phe Leu Tyr
Met 485 490 495Leu Ile Gln Ser Glu Arg Ile Leu Pro Pro Pro Ala Thr
Glu Arg Pro 500 505 510Asp Phe Lys Lys Leu Tyr Gln Asp Ala Arg Arg
Ser Met Lys Thr Asn 515 520 525Glu Trp Phe Ser Val Pro Glu Gln Thr
Leu Thr Ile Gly Leu Asp Gly 530 535 540Ala Asp Thr Asn Asp Val Pro
Pro Thr Thr Tyr Gly Trp Asp Asn Glu545 550 555 560Lys Pro Ala Arg
Thr Val Thr Val Pro Ala Phe Glu Ala Gln Gly Arg 565 570 575Pro Ile
Thr Asn Gly Glu Tyr Ala Lys Tyr Leu Gln Ala Asn Gln Ser 580 585
590Arg Arg Arg Pro Ala Ser Trp Val Leu Thr His Ser Asp Glu Asn Tyr
595 600 605Pro Ile Pro Met Ala Val Asn Gly Ser Ser Val Gly Ala Thr
Gln Asp 610 615 620Phe Met Ser Asn Phe Ala Val Arg Thr Val Phe Gly
Pro Val Pro Leu625 630 635 640Glu Phe Ala Gln Asp Trp Pro Val Met
Ala Ser Tyr Asp Glu Leu Ala 645 650 655Glu Tyr Ala Glu Trp Val Gly
Cys Arg Ile Pro Thr Phe Glu Glu Thr 660 665 670Arg Ser Ile Tyr Leu
His Ser Ala Leu Leu Lys Glu Arg Gly Gly Val 675 680 685Asn His Asn
Gly Glu Pro Asn Gly His Ser Val Asn Gly Tyr Leu Asn 690 695 700Gly
Met Asn Gly Asn Ser Tyr Ser Lys Ile Asn Pro Gly Lys Pro Arg705 710
715 720Thr Pro Asp His Gln Pro Val Gln Tyr Pro Ser Arg Asp Ala Leu
Pro 725 730 735Val Phe Leu Asp Leu Asp Gly Leu Asn Val Gly Phe Lys
His Trp His 740 745 750Pro Thr Pro Val Ile Gln Asn Gly Asp Arg Leu
Ala Gly Gln Gly Glu 755 760 765Leu Gly Gly Ala Trp Glu Trp Thr Ser
Thr Pro Leu Ala Pro His Asp 770 775 780Gly Phe Lys Ala Met Glu Ile
Tyr Pro Gly Tyr Thr Ser Asp Phe Phe785 790 795
800Asp Gly Lys His Asn Ile Ile Leu Gly Gly Ser Trp Ala Thr His Pro
805 810 815Arg Val Ala Gly Arg Thr Thr Phe Val Asn Trp Tyr Gln His
Asn Tyr 820 825 830Pro Tyr Thr Trp Ala Gly Ala Arg Leu Val Arg Asp
Leu 835 840 8452538DNAArtificial sequencePrimer 25cgcaccacct
tcaaaatgtc accgttggct ctttctcc 382638DNAArtificial sequencePrimer
26atgtactcct ggtacctaaa gatcccgcac taggcgtg 38272550DNAArtificial
sequenceSynthesized gene 27gatatcatga gcccgctggc gctgagcccg
aagaccgtgg acattgtgaa catttttcag 60aacgacgtgg agtttagcct ggtgaacgag
attcataaag gcatcagccc gccggcgggt 120gttcgtaaaa gcatgccgac
catgctgctg tacgatgcga acggtctgaa gctgttcgaa 180aacattacct
atgtgaaaga gtactatctg accaacgcgg agatcgaagt gctggaaacc
240aacagccgtc gtatcgttga gcgtattccg gacaacgcgc agctgctgga
actgggtagc 300ggcaacctgc gtaagatcga gattctgctg cgtgagttcg
aacgtgtggg caaacgtgtt 360gattactatg cgctggacct gagcctgagc
gaactgcaac gtacctttgc ggaagtgagc 420attgacgatt acacccacgt
tggtctgcac ggcctgcacg gtacctatga cgatgcggtt 480acctggctga
acagcccgga aaaccgtaag cgtccgaccg tgatcatgag catgggcagc
540agcctgggta acttcgatcg tccgggtgcg gcgaaatttc tgagccaata
tgcgagcctg 600ctgggtccga gcgacatgat gatcattggc ctggatggtt
gcaaggaccc gggtaaagtg 660taccgtgcgt ataacgacag cgaaggcgtt
acccgtcaat tctacgagaa cggtctggtg 720cacgcgaacg tggttctggg
ctatgaagcg tttaagagcg atgagtggga agtggttacc 780gactacgata
ccgttgaggg tcgtcactgg gcggcgtata gcccgaagaa agacgtgacc
840attaacggcg ttctgctgaa gaaaggtgaa aagctgttct ttgaggaagc
gtacaaatat 900ggcccggagg aacgtgatca gctgtggcgt gacgcgaagc
tgatccaaag caccgagatg 960ggtaacggca gcgacgatta ccacctgcac
ctgctgacca gcgcgaccct gaacctgccg 1020accagcccga gccagtatgc
ggcgcacccg attccgagct tcgaggaatg gcaaagcctg 1080tggaccgcgt
gggataacgc gaccaaagcg atggttccgc gtgaggaact gctgagcaag
1140ccgatcaaac tgcgtaacag cctgatcttc tacctgggtc acattccgac
ctttctggac 1200atccacctga cccgtgcgct gcgtggcaag ctgaccgaac
cgaagagcta taaactgatc 1260tttgagcgtg gcattgaccc ggatgtggac
gatccggaaa aatgccacag ccacagcgaa 1320attccggatg agtggccggc
gctggacgac atcctggact accaggagcg tgtgcgtagc 1380cgtgttcgta
gcatctatca aattgaaggt ctggcggaga accgtattct gggcgaagcg
1440ctgtggatcg gtttcgagca cgaagtgatg cacctggaga cctttctgta
catgctgatt 1500caaagcgaac gtatcctgcc gccgccggcg accgagcgtc
cggatttcaa gaaactgtat 1560caggaagcgc gtcgtagcat gaaggcgaac
gaatggttta gcgttccgga gcaaaccctg 1620accatcggcc tggacggtgc
ggataccaac gacgtgccgc cgaccaccta cggttgggac 1680aacgaaaaac
cggcgcgtac cgttaccgtt ccggcgtttg aagcgcaggg tcgtccgatt
1740accaacggcg agtacgcgaa atatctgcag gcgaaccaaa gccgtcgtcg
tccggcgagc 1800tgggttctga cccacagcga cgaagattac gcgatcccga
tggcggtgaa cggcagcagc 1860gttggtgcga cccaggactt catgagcaac
tttgcggtgc gtaccgtttt cggtccggtt 1920ccgctggagt ttgcgcaaga
ttggccggtg atggcgagct acgacgagct ggcggaatat 1980gcggagtggg
tgggctgccg tattccgacc ttcgaggaaa cccgtagcat ctacctgcac
2040agcgcgctgc tgaaggaacg tggtggcgtt aaccacaacg gcgagccgaa
cggtcacagc 2100ctgaacggcg atctgaacgg tgtgaacggt aacggctaca
gcaaaatcaa cccgggcaag 2160ccgcgtaaac cggaccacca gccggttcaa
tatccgagcc gtgatgcgct gccggtgttc 2220ctggacctgc acggtctgaa
cgttggtttt aaacactggc acccgacccc ggtgattcag 2280aacggtgatc
gtctggcggg tcaaggtgaa ctgggtggcg cgtgggagtg gaccagcacc
2340ccgctggcgc cgcacgacgg cttcaaggcg atggagatct acccgggcta
taccagcgat 2400ttctttgacg gtaaacacaa catcattctg ggtggcagct
gggcgaccca cccgcgtgtg 2460gcgggtcgta ccacctttgt taactggtat
caacacaatt atccgtacac ctgggcgggt 2520gcgcgtctgg ttcgtgacct
gtaaactagt 2550281404DNAArtificial sequenceSynthesized gene
28gatatcatga ccacgccgtt tggtgcgccg atgcgtgaac attttctgtt cgataccaac
60ttcaaaaacc tgaatcacgg ttccttcggc acgtatccgc gtgcggtcca gaccgtgctg
120cgtcagcatc aacactcagc agaagctcgc ccggacctgt tttatcgtat
tacccgcggt 180caaggcatcg acggttctcg tcgcattgtc gcgaacctgc
tgaatatccc ggtgaacgaa 240tgcgttttcg tcaaaaatgc caccacgggc
gttgcaaccg tcctgcgtaa cctggtgttt 300cagaaaggtg atgcagtggt
ttatttcgac accatctacg gcgctgtgga gaaaaacgtt 360cattctatta
tggaagcaag tccggtcacc acgcgcaaag tggaatgtgc tctgccggtt
420tctcatgaag atctggtcaa acgttttcgc gacgtcgtga gtcgtgcgcg
cggtgaaggc 480ctgcacgtga aagttgccgt cttcgatacg attgtgtcgg
ttccgggcgt tcgttttccg 540ttcgaaaccc tggtcggtgt gtgccgcgaa
gaaggcattc tgagcctgat cgatggtgcg 600catggtattg gccacattcc
gctggatctg ggtaccctgc gtccggactt tttcacctct 660aacctgcata
aatggctgtt tgtgccgcgc ggttgtgccg tgctgcatgt tccgctgcgt
720aatcagcacc tgatccgcac cacgttcccg accagttggg gttatattcc
gccgccgagc 780tctggcgaaa ttaccccgac ggcaacccag ggcaaatcgg
cttttgaata cctgttcgaa 840cacattagca ccacggatga tacgccgtgg
ctgtgtgttc cggccgcaat gaaatttcgt 900accgaagtgt gtggcggtga
agatcgcatc tatgcatacc tggaaacgct ggcacgtgaa 960gctggtgaca
ttgttgcccg tgcactgggt accgaagtga tgcaggaacc gggtctgaaa
1020gaaggcgaag ttagccaact gcgtcgctgc ggtatggcca ccgtgcgtct
gccgatcgcc 1080gttaccagtt cctcatcgag cgatagcggt agcggtaatg
gcggtggcgc cgtcatgcgt 1140gtgcagggtg aagacggctc tagttatctg
cgcattcaaa cgtccctggt tggcaccgtc 1200tcaaattggt ttcgcgatac
gctgttcgac aaatatgaaa cctttgttcc ggtcttccag 1260catggtggct
ggctgtggac ccgtctgtcc gcacaagtgt acctggaaaa gggtgatttt
1320gaatggctgg gtggcgttct gcgcgaatgc tgtgaacgtg tggaacgcga
agtgggcgtt 1380tcctcagcta aactgtaaac tagt 1404292890DNAAspergillus
niger 29atgtcaccct tatgtccggt cgtcaagggc gttgacatcg tcgatatccg
tcaaaatgac 60gtggagtttt ccctggtaaa tgatatccag cgaggtatag atcctccggc
aggaacttgc 120cgatccatgc ccacaatgct tctttacgat gctcaggggc
tcaagctgtt cgaggacatt 180acgtacctgg aggaatacta tctcacaaat
gcggagattg acgttctacg gacacatgcg 240aagaggattg ttgaacgcat
cccggacaat gcgcaattac tggaactagg cagtgggtgc 300gtcttccttc
cgcttggagc atgtatagag tatagggtac agacacggga ttctaacata
360cggtagcaat ctgcgcaaga ttgagatcct tctccaggaa ttcgaagcag
cgagcaaaaa 420agtggactac tatgccttgg atctgtcgct ctcagagttg
gagcgcacat tctcggaagt 480gtccctcgat caatatcaat atgtcaagct
ccacggcctg catggcacgt acgacgacgc 540cctcacctgg ctagaaaacc
ccgcgaatcg aaaggtccca acggtgatca tgtcaatggg 600ctcgtcgata
ggaaattttg atcgtcctgc agcggcaaaa ttcttgtcgc aatttgccag
660gctcttaggg ccgtcggatt tgatggtgct cggtttggat agttgcacgg
actcggataa 720agtgtacaag gcatacaatg attccaaggg tatcacacgg
cagttctacg agaacgggtt 780gttgcatgcg aacgctgtgc ttggatacga
agcattcaaa ctcgatgaat gggatatcgt 840gacggagtac gataacgtcg
aagggcggca ccaggcgttc tacgcgccaa accgggacgt 900gactataaac
ggggtactac ttcagaaagg cgagaagcta atttttgagg aggcattcaa
960atatgatccc gagcagtgcg atcagctctg gcatgatgcg ggtttaattg
aggacgctga 1020gtttggcaat gagtctgggg attaccgtat gtcatccttt
ggcaatgtgc tactctgcat 1080gtcatgttgc actgcattgt gtaaaaacat
gttacaccag ttgagaccat catactaaca 1140taatctgtcg agcagttatc
cacgtgctct cttcggcttc tctcaacttt tcaacgagac 1200catcacagta
tgcggctcaa tctattccga gctttgagga attccagtca ctgtggacag
1260catgggacat tgtcaccaag gccatggttc ctagagagga acttctttcg
aagccaatca 1320aattgcgcaa tgcattaatc ttctacctcg gtcacatacc
tacgtttctc ggtcagtgtt 1380ctgcttggct atttgtggag tgcaagtata
ggggtcagca tattgacaag cgcagatgtt 1440catttgaccc gagcattggg
cgaaaagcca acgcacccca agtcatatcg actcattttc 1500gaacgcggaa
tcgaccccga tgtggatgac cccgaaaagt gccattctca cagcgagatt
1560ccagacgaat ggcctgccct tggagacatc ttggactacc aagtgcgggt
tcgaagtagg 1620gtgaggtcca tttttcagaa gcataatgtg gctgagaata
gggtgcttgg tgaagcactc 1680tggatcgggt ttgagcatga agccatgcat
ctggaaacgt tcctttacat gcttatccag 1740agtgaaagaa cacttccgcc
ccccgccgtt ccgcgccccg attttaggaa gtttttccac 1800gatgcccggc
aagagtcaag accaaacgag tggttttcga ttcccgagaa gacgctttcg
1860gttggattac atgatgatgg acattcagtt cctcgtgact cttttggctg
ggacaacgaa 1920aagccccaga gaaagataac cgttaaagca ttcgaagctc
aagcgcgacc aataacaaat 1980ggagagtacg cgaagtatct acaggcgaat
cagctgcccc agaagccaga gtcctgggtc 2040ttgatcaagc ccgagacgta
cccgacttgc aatggtgtca gtcaagacgg tagctacgct 2100acgaatgaat
tcatggcaca ctttgccgtt cgcactgtgt ttggctccgt cccgctcgag
2160ctagcccagg actggccggt tatcgcgtcg tacgatgaat tggccaagta
tgccaagtgg 2220gtggactgca ggataccaac cttcgaagag gcaaagagta
tctacgcgca tgcagctcgg 2280ctgaaggaaa ctagccacgg cctgaacggt
cacaggtaag cataccgctt ccactagatg 2340cacaggactt actgtcatag
tgaaacgaac ggagtcaacg ggcacgaaca tagcgagacc 2400aaccccctac
ggcctcgcac cccggaccac caaccggtac agcacccttc gcaagaatct
2460ctgccggtgt ttgttgagct cgacaattgc aacgtcggct tcaaacactg
gcaccctacc 2520ccggtcatcc agaacggcga ccgactcgcc ggtcatggag
agctgggagg cgtctgggag 2580tggacgagca cggaacttgc accccacgaa
gggttcgagg ccatgcaaat ctaccccgga 2640tatacatgta agcttgctgt
gtgagatata tgaacacaag ctaactgaga acagccgact 2700tcttcgacgg
aaaacacaat atcatcctcg gagggtcatg ggcgacgcat ccacggatcg
2760ccggccgcac taccttgtaa gtccgtatgc aagactagcg ggttcatgag
ctaatctgtt 2820cagtgtcaat tggtaccagc ggaactaccc atacccctgg
gctggtgccc ggctggtgcg 2880ggatgtctga 289030835PRTAspergillus niger
30Met Ser Pro Leu Cys Pro Val Val Lys Gly Val Asp Ile Val Asp Ile1
5 10 15Arg Gln Asn Asp Val Glu Phe Ser Leu Val Asn Asp Ile Gln Arg
Gly 20 25 30Ile Asp Pro Pro Ala Gly Thr Cys Arg Ser Met Pro Thr Met
Leu Leu 35 40 45Tyr Asp Ala Gln Gly Leu Lys Leu Phe Glu Asp Ile Thr
Tyr Leu Glu 50 55 60Glu Tyr Tyr Leu Thr Asn Ala Glu Ile Asp Val Leu
Arg Thr His Ala65 70 75 80Lys Arg Ile Val Glu Arg Ile Pro Asp Asn
Ala Gln Leu Leu Glu Leu 85 90 95Gly Ser Gly Asn Leu Arg Lys Ile Glu
Ile Leu Leu Gln Glu Phe Glu 100 105 110Ala Ala Ser Lys Lys Val Asp
Tyr Tyr Ala Leu Asp Leu Ser Leu Ser 115 120 125Glu Leu Glu Arg Thr
Phe Ser Glu Val Ser Leu Asp Gln Tyr Gln Tyr 130 135 140Val Lys Leu
His Gly Leu His Gly Thr Tyr Asp Asp Ala Leu Thr Trp145 150 155
160Leu Glu Asn Pro Ala Asn Arg Lys Val Pro Thr Val Ile Met Ser Met
165 170 175Gly Ser Ser Ile Gly Asn Phe Asp Arg Pro Ala Ala Ala Lys
Phe Leu 180 185 190Ser Gln Phe Ala Arg Leu Leu Gly Pro Ser Asp Leu
Met Val Leu Gly 195 200 205Leu Asp Ser Cys Thr Asp Ser Asp Lys Val
Tyr Lys Ala Tyr Asn Asp 210 215 220Ser Lys Gly Ile Thr Arg Gln Phe
Tyr Glu Asn Gly Leu Leu His Ala225 230 235 240Asn Ala Val Leu Gly
Tyr Glu Ala Phe Lys Leu Asp Glu Trp Asp Ile 245 250 255Val Thr Glu
Tyr Asp Asn Val Glu Gly Arg His Gln Ala Phe Tyr Ala 260 265 270Pro
Asn Arg Asp Val Thr Ile Asn Gly Val Leu Leu Gln Lys Gly Glu 275 280
285Lys Leu Ile Phe Glu Glu Ala Phe Lys Tyr Asp Pro Glu Gln Cys Asp
290 295 300Gln Leu Trp His Asp Ala Gly Leu Ile Glu Asp Ala Glu Phe
Gly Asn305 310 315 320Glu Ser Gly Asp Tyr Leu Ile His Val Leu Ser
Ser Ala Ser Leu Asn 325 330 335Phe Ser Thr Arg Pro Ser Gln Tyr Ala
Ala Gln Ser Ile Pro Ser Phe 340 345 350Glu Glu Phe Gln Ser Leu Trp
Thr Ala Trp Asp Ile Val Thr Lys Ala 355 360 365Met Val Pro Arg Glu
Glu Leu Leu Ser Lys Pro Ile Lys Leu Arg Asn 370 375 380Ala Leu Ile
Phe Tyr Leu Gly His Ile Pro Thr Phe Leu Asp Val His385 390 395
400Leu Thr Arg Ala Leu Gly Glu Lys Pro Thr His Pro Lys Ser Tyr Arg
405 410 415Leu Ile Phe Glu Arg Gly Ile Asp Pro Asp Val Asp Asp Pro
Glu Lys 420 425 430Cys His Ser His Ser Glu Ile Pro Asp Glu Trp Pro
Ala Leu Gly Asp 435 440 445Ile Leu Asp Tyr Gln Val Arg Val Arg Ser
Arg Val Arg Ser Ile Phe 450 455 460Gln Lys His Asn Val Ala Glu Asn
Arg Val Leu Gly Glu Ala Leu Trp465 470 475 480Ile Gly Phe Glu His
Glu Ala Met His Leu Glu Thr Phe Leu Tyr Met 485 490 495Leu Ile Gln
Ser Glu Arg Thr Leu Pro Pro Pro Ala Val Pro Arg Pro 500 505 510Asp
Phe Arg Lys Phe Phe His Asp Ala Arg Gln Glu Ser Arg Pro Asn 515 520
525Glu Trp Phe Ser Ile Pro Glu Lys Thr Leu Ser Val Gly Leu His Asp
530 535 540Asp Gly His Ser Val Pro Arg Asp Ser Phe Gly Trp Asp Asn
Glu Lys545 550 555 560Pro Gln Arg Lys Ile Thr Val Lys Ala Phe Glu
Ala Gln Ala Arg Pro 565 570 575Ile Thr Asn Gly Glu Tyr Ala Lys Tyr
Leu Gln Ala Asn Gln Leu Pro 580 585 590Gln Lys Pro Glu Ser Trp Val
Leu Ile Lys Pro Glu Thr Tyr Pro Thr 595 600 605Cys Asn Gly Val Ser
Gln Asp Gly Ser Tyr Ala Thr Asn Glu Phe Met 610 615 620Ala His Phe
Ala Val Arg Thr Val Phe Gly Ser Val Pro Leu Glu Leu625 630 635
640Ala Gln Asp Trp Pro Val Ile Ala Ser Tyr Asp Glu Leu Ala Lys Tyr
645 650 655Ala Lys Trp Val Asp Cys Arg Ile Pro Thr Phe Glu Glu Ala
Lys Ser 660 665 670Ile Tyr Ala His Ala Ala Arg Leu Lys Glu Thr Ser
His Gly Leu Asn 675 680 685Gly His Ser Glu Thr Asn Gly Val Asn Gly
His Glu His Ser Glu Thr 690 695 700Asn Pro Leu Arg Pro Arg Thr Pro
Asp His Gln Pro Val Gln His Pro705 710 715 720Ser Gln Glu Ser Leu
Pro Val Phe Val Glu Leu Asp Asn Cys Asn Val 725 730 735Gly Phe Lys
His Trp His Pro Thr Pro Val Ile Gln Asn Gly Asp Arg 740 745 750Leu
Ala Gly His Gly Glu Leu Gly Gly Val Trp Glu Trp Thr Ser Thr 755 760
765Glu Leu Ala Pro His Glu Gly Phe Glu Ala Met Gln Ile Tyr Pro Gly
770 775 780Tyr Thr Ser Asp Phe Phe Asp Gly Lys His Asn Ile Ile Leu
Gly Gly785 790 795 800Ser Trp Ala Thr His Pro Arg Ile Ala Gly Arg
Thr Thr Phe Val Asn 805 810 815Trp Tyr Gln Arg Asn Tyr Pro Tyr Pro
Trp Ala Gly Ala Arg Leu Val 820 825 830Arg Asp Val
8353142DNAArtificial sequencePrimer 31cgcaccacct tcaaaatgtc
acccttatgt ccggtcgtca ag 423235DNAArtificial sequencePrimer
32atgtactcct ggtactcaga catcccgcac cagcc 35
* * * * *