U.S. patent application number 16/959142 was filed with the patent office on 2021-10-14 for compounds with antimicrobial activity.
The applicant listed for this patent is The Chinese University of Hong Kong, The Hong Kong Polytechnic University. Invention is credited to Cong MA, Xiao YANG.
Application Number | 20210317076 16/959142 |
Document ID | / |
Family ID | 1000005866207 |
Filed Date | 2021-10-14 |
United States Patent
Application |
20210317076 |
Kind Code |
A9 |
MA; Cong ; et al. |
October 14, 2021 |
COMPOUNDS WITH ANTIMICROBIAL ACTIVITY
Abstract
This invention relates to compounds of formula 1, 2 or 3
##STR00001## a pharmaceutically acceptable salt, or solvate
thereof, wherein X.sub.1, Y, R.sub.1, R.sub.2, R.sub.3, R.sub.4,
and R.sub.5 are as defined herein. The compounds are antimicrobial
agents that may be used to treat various bacterial and protozoal
infections and disorders related to such infections. The invention
also relates to pharmaceutical compositions containing the
compounds and to methods of treating bacterial and protozoal
infections by administering the compounds of formula 1, 2 or 3.
Inventors: |
MA; Cong; (Hong Kong,
CN) ; YANG; Xiao; (Hong Kong, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Hong Kong Polytechnic University
The Chinese University of Hong Kong |
Hong Kong
Hong Kong |
|
CN
CN |
|
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20200347010 A1 |
November 5, 2020 |
|
|
Family ID: |
1000005866207 |
Appl. No.: |
16/959142 |
Filed: |
January 8, 2019 |
PCT Filed: |
January 8, 2019 |
PCT NO: |
PCT/IB2019/050137 PCKC 00 |
371 Date: |
June 29, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62615418 |
Jan 9, 2018 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07D 231/20 20130101;
A61P 31/04 20180101; C07D 257/04 20130101; C07C 311/44 20130101;
C07C 251/86 20130101; C07C 255/61 20130101; C07C 255/59 20130101;
C07D 403/12 20130101; C07C 215/50 20130101; C07C 217/58 20130101;
C07D 249/12 20130101; C07C 255/53 20130101; C07D 231/42 20130101;
C07C 255/58 20130101; C07D 307/90 20130101; C07C 311/39 20130101;
C07C 251/24 20130101 |
International
Class: |
C07C 251/86 20060101
C07C251/86; C07C 251/24 20060101 C07C251/24; C07C 217/58 20060101
C07C217/58; C07C 255/59 20060101 C07C255/59; C07D 249/12 20060101
C07D249/12; C07D 231/20 20060101 C07D231/20; C07D 231/42 20060101
C07D231/42; C07D 403/12 20060101 C07D403/12; C07D 307/90 20060101
C07D307/90; A61P 31/04 20060101 A61P031/04; C07C 311/44 20060101
C07C311/44; C07C 215/50 20060101 C07C215/50; C07C 311/39 20060101
C07C311/39; C07C 255/61 20060101 C07C255/61; C07D 257/04 20060101
C07D257/04; C07C 255/58 20060101 C07C255/58; C07C 255/53 20060101
C07C255/53 |
Claims
1. A compound of formula 1, ##STR00170## a pharmaceutically
acceptable salt, or a solvate thereof, wherein: (1) X.sub.1 is
selected from the group consisting of --N.dbd.CH--, --CH.dbd.N--,
--CH.dbd.CH--, --NH--CH.sub.2--, --CH.sub.2--NH--,
--CH.sub.2--CH.sub.2--, --CH.sub.2--O--, --O--CH.sub.2--,
--CH.sub.2--S--, --S--CH.sub.2-- --S(.dbd.O)--CH.sub.2--,
S(.dbd.O)--NH--, --CH.sub.2--S(.dbd.O)--, --NH--S(.dbd.O)--,
--S(.dbd.O).sub.2--CH.sub.2--, --S(.dbd.O).sub.2--NH--,
--CH.sub.2--S(.dbd.O).sub.2--, --NH--S(.dbd.O).sub.2--,
--C(.dbd.O)--NH--, --NH--C(.dbd.O)--, and --C(.dbd.O)--; and (2)
Each of R.sub.1-R.sub.5 is independently selected from the group
consisting of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl,
carboxy, carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl,
amninosulfonyl, aminocarbonyl, cyano, tetrazolyl,
dimethylaminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyi,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo; or wherein said compound is
selected from the group consisting of: ##STR00171##
##STR00172##
2. The compound of claim 1, wherein said compound is selected from
the group consisting of: ##STR00173## ##STR00174## ##STR00175##
##STR00176## ##STR00177## ##STR00178## ##STR00179## ##STR00180##
##STR00181## ##STR00182## ##STR00183## ##STR00184## ##STR00185##
##STR00186## ##STR00187## ##STR00188## ##STR00189## ##STR00190##
##STR00191## ##STR00192## ##STR00193## ##STR00194## ##STR00195##
##STR00196##
3. A pharmaceutical composition for treatment or prevention of
bacterial or protozoal infections, comprising the compound of claim
1.
4. The pharmaceutical composition of claim 3, wherein said
pharmaceutical composition is in the form of tablets, capsules,
lozenges, troches, hard candies, powders, sprays, creams, salves,
suppositories, jellies, gels, pastes, lotions, ointments, aqueous
suspensions, injectable solutions, elixirs, or syrups.
5. The pharmaceutical composition of claim 3, wherein said
pharmaceutical composition comprises 5% to 70% by weight of said
compound.
6. The pharmaceutical composition of claim 3, wherein said
bacterial or protozoal infections are caused by microorganism
selected from the group consisting of Enterococcus faecalis,
Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter
baumannii, Pseudomonas aeruginosa, Enterobacter cloacae,
Escherichia coli, and Streptococcus pneumoniae.
7. A method to inhibit NusB-NusE interaction in a microorganism,
comprising the step of contacting the compound of claim 1 with said
microorganism.
8. The method of claim 7, wherein said NusB is selected from NusB
E81, NusB Y18 and NusB E75, and NusE is selected from NusE H15,
NusE D19 and NusE R16.
9. The method of claim 7, wherein said microorganism is selected
from the group consisting of Enterococcus faecalis, Staphylococcus
aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas
aeruginosa, Enterobacter cloacae, Escherichia coli, and
Streptococcus pneuroniae.
10. A method of treating or preventing bacterial or protozoal
infections in a subject, comprising a step of administering a
therapeutically effective amount of the compound of claim 1 to said
subject.
11. The method of claim 10, wherein said compound is administered
through an oral, parenteral, topical, or rectal route.
12. The method of claim 10, wherein said microorganism is selected
from the group consisting of Enterococcus faecalis, Staphylococcus
aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas
aeruginosa, Enterobacter cloacae, Escherichia coli, and
Streptococcus pneumoniae.
13. The method of claim 10, wherein said NusB is selected from NusB
E81, NusB Y18 and NusB E75, and NusE is selected from NusE H15 NusE
D19 and NusE R16.
14. A compound of formula 2, ##STR00197## a pharmaceutically
acceptable salt, or a solvate thereof, wherein: (1) X.sub.1 is
selected from the group consisting of --N.dbd.CH--, --CH.dbd.N--,
--CH.dbd.CH--, --NH--CH.sub.2--, --CH.sub.2--NH--,
--CH.sub.2--CH.sub.2--, --CH.sub.2--O--, --O--CH.sub.2--,
--CH.sub.2--S--, --S--CH.sub.2--, --S(.dbd.O)--CH.sub.2--,
--S(.dbd.O)--NH--, --CH.sub.2--S(.dbd.O)--, --NH--S(.dbd.O)--,
--S(.dbd.O).sub.2--CH.sub.2--, --S(.dbd.O).sub.2--NH--,
--CH.sub.2--S(.dbd.O).sub.2--, --NH--S(.dbd.O).sub.2--,
--C(.dbd.O)--NH--, --NH--C(.dbd.O)--, and --C(.dbd.O)--; and (2)
Each of R.sub.1-R.sub.5 is independently selected from the group
consisting of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl,
carboxy, carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl,
aminosulfonyl, aminocarbonyl, cyano, tetrazolyl,
dimethylaminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyl,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo.
15. The compound of claim 14 wherein said compound is selected from
the group consisting of: ##STR00198##
16. A compound of formula ##STR00199## a pharmaceutically
acceptable salt, or a solvate thereof, wherein: (1) each of X.sub.1
and Y is independently selected from the group consisting of
--NH--, --CH.sub.2--, --O--, and --S--; and (2) each of
R.sub.1-R.sub.5 is independently selected from the group consisting
of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl, carboxy,
carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl,
aminosulfonyl, aminocarbonyl, cyano, tetrazolyl,
dimethylaminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyl,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo.
17. The compound of claim 16, wherein said compound is ##STR00200##
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 62/615,418, filed Jan. 9, 2018. The entire contents
and disclosures of the preceding application are incorporated by
reference into this application.
[0002] Throughout this application, various publications are cited.
The disclosures of these publications in their entireties are
hereby incorporated by reference into this application to more
fully describe the state of the art to which this invention
pertains.
FIELD OF THE INVENTION
[0003] This invention relates to compounds having antimicrobial
activity.
BACKGROUND OF THE INVENTION
[0004] Infections caused by the Gram-positive pathogen methicillin
resistant Staphylococcus aureus (MRSA) have become one of the most
serious public health concerns worldwide..sup.1 The pharmaceutical
arsenal available to control MRSA is limited to vancomycin,
daptomycin, and linezolid,.sup.2 for which resistance has already
evolved..sup.3 Therefore, there is an urgent need to validate a new
antibiotic target, to develop novel antimicrobials with potent and
specific activities to combat MRSA-associated infections.
[0005] In bacterial cells, rRNA comprises up to 80% of total RNA
and transcription of rRNA has been shown to positively correlate
with bacterial growth rate to meet the demand for protein
synthesis..sup.4 Although rRNA synthesis is one of the most
fundamental requirements for living cells, there is a noticeable
discrepancy in this process. In eukaryotic cells, the ribosonmal
genes are transcribed by different types of RNA polymerases,
namely, RNA Pol I, Pol II and Pol III..sup.5 On the other hand,
there is only one RNA polymerase in bacteria, which is associated
with a number of elongation factors for forming so-called "rRNA
antitermination complexes", which ensure efficient transcription of
the rRNA genes..sup.6
[0006] NusB and NusE (also known as the ribosomal protein S10 of
the 30S ribosomal subunit) are highly conserved essential small
transcription factors involved in the formation of rRNA
antitermination complexes..sup.7 The protein-protein interaction
between NusB and NusE represents the first regulatory step in rRNA
transcription antitermination complex assembly..sup.8 Once a
NusB-NusE heterodimer forms, it interacts with a region of the rRNA
leader sequence called boxA..sup.9 Following binding of the
NusB-NusE-boxA complex to RNA polymerase, other factors (such as
NusA, NusG, and others) will be recruited, among which only NusG
has a eukaryotic homologue..sup.10
[0007] Because NusB and NusE are essential for bacterial cell
viability,.sup.11 this invention provides compounds for disruption
of NusB-NusE heterodimer formation to result in reduced rates of
rRNA synthesis and bacterial cell proliferation.
SUMMARY OF THE INVENTION
[0008] The present invention provides compounds with antimicrobial
activity. In one embodiment, this invention provides a compound of
formula 1 or a pharmaceutically acceptable salt, prodrug, or
solvate thereof:
##STR00002##
wherein: [0009] (1) X.sub.1 is selected from the group consisting
of --N.dbd.C--, --CH.dbd.N--, --CH.dbd.CH--, --NH--CH--,
CH.sub.2--NH--, --CH.sub.2--CH.sub.2--, --CH.sub.2--O--,
--O--CH.sub.2--, --CH.sub.2--S--, --S--CH.sub.2--,
--S(.dbd.O)--CH.sub.2--, --S(.dbd.O)--N--, --CH.sub.2--S(.dbd.O)--,
--NH--S(.dbd.O)--, --S(.dbd.O).sub.2--CH.sub.2--,
--S(.dbd.O).sub.2--NH--, --CH.sub.2--S(.dbd.O).sub.2--,
--NH--S(.dbd.O).sub.2--, --C(.dbd.O)--NH--, --NH--C(.dbd.O)--, and
--C(.dbd.O)--; and [0010] (2) Each of R.sub.1-R.sub.5 is
independently selected from the group consisting of hydrogen,
hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl
hydroxymethyl, methoxy, methoxycarbonyl, aminosulfonyl,
aminocarbonyl, cyano, tetrazolyl,
dimethylaminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyl,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo.
[0011] In one embodiment, this invention provides a compound of
formula 2 or a pharmaceutically acceptable salt, prodrug or solvate
thereof:
##STR00003##
wherein: [0012] (1) X.sub.1 is selected from the group consisting
of --N.dbd.CH--, --CH.dbd.N--, --CH.dbd.CH--, --NH--CH--,
--CH.sub.2--NH--, --CH.sub.2--CH.sub.2--, --CH.sub.2--O--,
--O--CH.sub.2--, --CH.sub.2--S--, --S--CH.sub.2--,
S(.dbd.O)--CH.sub.2--, --S(.dbd.O)--NH--, --CH.sub.2--S(.dbd.O)--,
--NH--S(.dbd.O)--, --S(.dbd.O).sub.2--CH.sub.2--,
--S(.dbd.O).sub.2--NH--, --CH.sub.2--S(.dbd.O).sub.2--,
--NH--S(.dbd.O).sub.2--, --C(.dbd.O)--NH--, --NH--C(.dbd.O)--, and
--C(.dbd.O)-- and [0013] (2) Each of R.sub.1-R.sub.5 is
independently selected from the group consisting of hydrogen,
hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl
hydroxymethyl, methoxy, methoxycarbonyl, aminosulfonyl,
aminocarbonyl, cyano, tetrazolyl,
dimethylaminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyl,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo.
[0014] In one embodiment, this invention provides a compound of
formula 3 or a pharmaceutically acceptable salt, prodrug, or
solvate thereof:
##STR00004##
a pharmaceutically acceptable salt, or a solvate thereof, wherein:
[0015] (1) X.sub.1 or Y is selected from the group consisting of
--NH--, --CH.sub.2--, --O--, and --S--; and [0016] (2) each of
R.sub.1-R.sub.5 is independently selected from the group consisting
of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl, carboxy,
carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl,
aminosulfonyl, aminocarbonyl, cyano, tetrazolyl,
dimethylaminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyl,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo.
[0017] In one embodiment, this invention provides a pharmaceutical
composition for the treatment of a bacterial infection or a
protozoal infection in mammal, fish, or bird, which comprises a
therapeutically effective amount of a compound of formula 1, 2 or 3
with a pharmaceutically acceptable carrier.
[0018] In one embodiment, this invention provides a method of
treating a bacterial infection or a protozoal infection in a
mammal, fish, or bird that comprises administering to said mammal,
fish or bird a therapeutically effective amount of a compound of
formula 1, 2 or 3.
[0019] In one embodiment, this invention provides a method for
preparing the compound of formula 1, 2, or 3.
Definitions & Abbreviations
[0020] The following terms shall be used to describe the present
invention. In the absence of a specific definition set forth
herein, the terms used to describe the present invention shall be
given their common meaning as understood by those of ordinary skill
in the art.
[0021] As used herein, unless otherwise indicated, the term
"treating" means reversing, alleviating, inhibiting the progress
of, or preventing the disorder or condition to which such term
applies, or one or more symptoms of such disorder or condition. The
term "treatment", as used herein, refers to the act of treating, as
"treating" is defined immediately above.
[0022] As used herein, unless otherwise indicated, the terms or
phrases "bacterial infection(s)", "protozoal infection(s)", and
"disorders related to bacterial infections or protozoal infections"
include the following: pneumonia, otitis media, sinusitus,
bronchitis, tonsillitis, and mastoiditis related to infection by
Streptococcus pneumoniae, Haemophilus influenzae, Moraxella
catarrhalis, Staphylococcus aureus, Enterococcus faecalis, E.
faecium, E. casselflavus, S. epidermidis, S. haemolvticus, or
Peptostreptococcus spp.; pharyngitis, rheumatic fever, and
glomerulonephritis related to infection by Streptococcus pyogenes,
Groups C and G streptococci, Corynebacterium diphtheriae, or
Actinobacillus haemolyticum; respiratory tract infections related
to infection by Mycoplasma pneurnoniae, Legionella pneumophila,
Streptococcus pneumoniae, Haemophilus influenzae, or Chlamydia
pneumoniae; blood and tissue infections, including endocarditis and
osteomyelitis, caused by S. aureus, S. haemolyticus, E. faecalis,
E. faecium, E. durans, including strains resistant to known
antibacterials such as, but not limited to, beta-lactams,
vancomycin, aminoglycosides, quinolones, chloramphenicol,
tetracylines and nacrolides; uncomplicated skin and soft tissue
infections and abscesses, and puerperal fever related to infection
by Staphylococcus aureus, coagulase-negative staphylococci (i.e.,
S. epidermidis, S. hemolyticus, etc.), Streptococcus pyogenes,
Streptococcus agalactiae, Streptococcal groups C-F (minute-colony
streptococci), viridans streptococci, Corynebacterium minutissimum,
Clostridium spp., or Bartonella henselae; uncomplicated acute
urinary tract infections related to infection by Staphylococcus
aureus, coagulase-negative staphylococcal species, or Enterococcus
spp.; urethritis and cervicitis; sexually transmitted diseases
related to infection by Chlamydia trachomatis, Haemophilus ducreyi,
Treponema pallidum, Ureaplasma urealyticum, or Neiserria
gonorrheae; toxin diseases related to infection by S. aureus (food
poisoning and toxic shock syndrome), or Groups A, B, and C
streptococci ulcers related to infection by Helicobacter pylori;
systemic febrile syndromes related to infection by Borrelia
recurrentis; Lyme disease related to infection by Borrelia
burgdorferi; conjunctivitis, keratitis, and dacrocvstitis related
to infection by Chlamydia trachomatis, Neisseria gonorrhoeae, S.
aureus, S. pneumoniae, S. pyogenes, H. influenzae, or Listeria
spp.; disseminated Mycobacterium avium complex (MAC) disease
related to infection by Mycobacterium avium, or Mycobacterium
intracellulare; infections caused by Mycobacterium tuberculosis, M.
leprae, M. paratuberculosis, M. kansasii, or M. chelonei;
gastroenteritis related to infection by Campylobacter jejuni;
intestinal protozoa related to infection by Cryptosporidium spp.;
odontogenic infection related to infection by Viridans
streptococci; persistent cough related to infection by Bordetella
pertussis; gas gangrene related to infection by Clostridium
perfringens or Bacteroides spp.; and atherosclerosis or
cardiovascular disease related to infection by Helicobacter pylon
or Chlamydia pneumoniae. Bacterial infections and protozoal
infections, and disorders related to such infections, which may be
treated or prevented in animals include the following: bovine
respiratory disease related to infection by P. haemolytica, P
multocida, Mycoplasma bovis, or Bordetella spp.; cow enteric
disease related to infection by E. coli or protozoa (i.e.,
coccidia, cryptosporidia, etc.); dairy cow mastitis related to
infection by S. aureus, Strep. uberis, Streptococcus agalactiae,
Streptococcus dysgalactiae, Klebsiella spp., Corynebacterium, or
Enterococcus spp.; swine respiratory disease related to infection
by A. pleuro, P. multocida, or Mycoplasma spp.; swine enteric
disease related to infection by E. coli, Lawsonia intracellulanis,
Salmonella, or Serpulina hyodysinteniae; cow footrot related to
infection by Fusobacterium spp.; cow metritis related to infection
by E coil; cow hairy warts related to infection by Fusobacterium
necrophorum or Bacteroides nodosus; cow pink-eye related to
infection by Moraxella bovis; cow premature abortion related to
infection by protozoa (i.e. neosporium); urinary tract infection in
dogs and cats related to infection by E. coli; skin and soft tissue
infections in dogs and cats related to infection by S. epidermidis,
S. internedius, coagulase neg. Staphylococcus or P. multocida; and
dental or mouth infections in dogs and cats related to infection by
Alcaigenes spp., Bacteroides spp., Clostridium spp., Enterobacter
spp., Eubacterium, Peptostreptococcus, Porphyromonas, or
Prevotella. Other bacterial infections and protozoal infections,
and disorders related to such infections, which may be treated or
prevented in accord with the method of the present invention are
referred to in J. P Sanford et al., "The Sanford Guide To
Antimicrobial Therapy," 26 th Edition, (Antimicrobial Therapy,
Inc., 1996).
[0023] As used herein, unless otherwise indicated, the term "halo"
includes fluoro, chloro, bromo or iodo. Preferred halo groups are
fluoro, chloro and bromo.
[0024] As used herein, unless otherwise indicated, the term "alkyl"
includes saturated monovalent hydrocarbon radicals having cyclic,
straight and/or branched moieties. It is to be understood that to
include cyclic moieties, the alkyl group must include at least 3
carbon atoms.
[0025] As used herein, unless otherwise indicated, the term
"alkenyl", as used herein, unless otherwise indicated, includes
alkyl groups as defined above having at least one carbon-carbon
double bond at some point in the alkyl chain.
[0026] As used herein, unless otherwise indicated, the term
"alkynyl", as used herein, unless otherwise indicated, includes
alkyl groups as defined above having at least one carbon-carbon
triple bond at some point in the alkyl chain.
[0027] As used herein, unless otherwise indicated, the term "aryl"
includes an organic radical derived from an aromatic hydrocarbon by
removal of one hydrogen, such as phenyl or naphthyl.
[0028] As used herein, unless otherwise indicated, the term "4 to
10 membered heterocyclic" includes aromatic and non-aromatic
heterocyclic groups containing one or more heteroatoms each
selected from O, S and N, wherein each heterocyclic group has from
4 to 10 atoms in its ring system. Non-aromatic heterocyclic groups
include groups having only 4 atoms in their ring system, but
aromatic heterocyclic groups must have at least 5 atoms in their
ring system. The heterocyclic groups include benzo-fused ring
systems and ring systems substituted with one or more oxo moieties.
An example of a 4 membered heterocyclic group is azetidinyl
(derived from azetidine). An example of a 5 membered heterocyclic
group is thiazolyl and an example of a 10 membered heterocyclic
group is quinolinyl. Examples of non-aromatic heterocyclic groups
are pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl,
tetrahydropyranyl, tetrahydrothiopyranyl, piperidino, morpholino,
thiomorpholino, thioxanyl, piperazinyl, azetidinyl, oxetanyl
thietanyl, homopiperidinyl, oxepanyl, thiepanyl, oxazepinyl,
diazepinyl, thiazepinyl, 1,2,3,6-tetrahydropyridinyl, 2-pyrrolinyl,
3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl,
1,3-dioxolanyl, pyrazolinyl, dithianyl, dithiolanyl,
dihydropyranyl, dihydrothienyl, dihydrofuranyl, pyrazolidinyl,
imidazolinyl, imidazolidinyl, 3-azabicyclo[3.1.0]hexanyl,
3-azabicyclo[4.1.0]heptanyl, 3H-indolyl and quinolizinyl. Examples
of aromatic heterocyclic groups are pyridinyl, imidazolyl,
pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl,
thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl,
quinolinyl, isoquinolinyl, indolyl, benzimidazolyl, benzofuranyl,
cinnolinyl, indazolyl, indolizinyl, phthalazinyl, pyridazinyl,
triazinyl, isoindolyl, pteridinyl purinyl, oxadiazolyl,
thiadiazolyl, furazanyl, benzofurazanyl. benzothiophenyl,
benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl,
naphthyridinyl, and furopyridinyl. The foregoing groups, as derived
from the compounds listed above, may be C-attached or N-attached
where such is possible. For instance, a group derived from pyrrole
may be pyrrol-1-yl (N-attached) or pyrrol-3-yl (C-attached).
[0029] As used herein, unless otherwise indicated, the phrase
"pharmaceutically acceptable salt(s)" includes salts of acidic or
basic groups which may be present in the compounds of formula 1, 2
or 3. The compounds of formula 1, 2 or 3 that are basic in nature
are capable of forming a wide variety of salts with various
inorganic and organic acids. The acids that may be used to prepare
pharmaceutically acceptable acid addition salts of such basic
compounds of formula 1, 2 or 3 are those that form non-toxic acid
addition salts, i.e., salts containing pharmacologically acceptable
anions, such as the acetate, benzenesulfonate, benzoate,
bicarbonate, bisulfate, bitartrate, borate, bromide, calcium
edetate, camsylate, carbonate, chloride, clavulanate, citrate,
dihydrochloride, edetate, edislyate, estolate, esylate,
ethylsuccinate, fumarate, gluceptate, gluconate, glutamate,
glycollylarsanilate, hexylresorcinate, hydrabamine, hydrobromide,
hydrochloride, iodide, isothionate, lactate, lactobionate, laurate,
malate, maleate, mandelate, mesylate, methylsulfate, mucate,
napsylate, nitrate, oleate, oxalate, pamoate (embonate), palmitate,
pantothenate, phosphate/diphosphate, polygalacturonate, salicylate,
stearate, subacetate, succinate, tannate, tartrate, teoclate,
tosylate, triethiodide, and valerate salts.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1A. Model of the bacterial rRNA transcription
complex.
[0031] FIG. 1B. NusB-NusE interface.
[0032] FIG. 2A. Pharmacophore model with MC4 docked in.
[0033] FIG. 2B. Chemical structure of
(E)-2-{[3-ethynylphenyl)imino]methyl}-4-nitrophenol (MC4).
[0034] FIG. 3. Antimicrobial activity of MC4 against selected
pathogenic bacteria. Abbreviations: MIC, minimum inhibitory
concentration; MBC, minimum bactericidal concentration; ND, not
determined.
[0035] FIG. 4. Effects of MC4, rifampicin (Rif), and oxacillin
(Oxa) at one-quarter minimum inhibitory concentrations (MICs) on
DNA, rRA (16S+23S), and protein production in S. aureus 25923
cells.
[0036] FIG. 5. Partial sequence alignments of NusB and NusE. Aaeo:
Aquifex aeolicus; Bsub: Bacillus subtilis; Ecol: Escherichia coli;
Hinf: Haemophilus influenzae; Hpyl: Helicobacter pylori; Paer:
Pseudomonas aeruginosa; Mtub: Mycobacterium tuberculosis; Saur:
Staphylococcus aureus; Spne: Streptococcus pneumoniae; Arrow
indicates residues involved in NusB-E interaction.
[0037] FIG. 6. Seven compounds short listed from in silico
screening. MC1,
N-{4-[2-(2-nitrobenzoyl)carbohydrazonoyl]phenyl}acetamide (CAS no.
679423-05-3) MC2,
3-({4-[(1,5-dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazol-4-yl)sulfamoyl-
]phenyl}carbamoyl)propanoic acid (CAS no. 253605-53-7); MC3,
3-[3-(3-hydroxy-4H-pyrazol-4-yl)propyl]-1-(4-methoxyphenyl)thiourea
(CAS no. 656222-98-9); MC4,
(E)-2-[[(3-ethynylphenyl)imino]methyl]-4-nitrophenol (CAS no.
219140-31-5); MC5,
(E)-{amino[3-({[4-methyl-5-(trifluoromethyl)-4H-1,2,4-triazol-3-yl]sulfan-
yl}methyl)phenyl]methylidene}amino N-(4-chlorophenyl)carbamate (CAS
no. 882256-39-5); MC6,
N-(4-{[2-(2,4-dichlorophenoxy)phenyl]sulfamoyl}phenyl)-3,4-dimethoxybenze-
ne-1-sulfonamide (CAS no. 312324-35-9); MC7, methyl
4-[(1E)-[(E)-2-{[4-(methoxycarbonyl)-2,5-dimethyl-1H-pyrrol-3-yl]methylid-
ene}hydrazin-1-ylidene]methyl]-2,5-dimethyl-1H-pyrrole-3-carboxylate
(CAS no. 883037-11-4).
[0038] FIG. 7. Ten analogues of MC4. MC4-1,
2-nitro-6-[(E)-(phenylimino)methyl]phenol (CAS no. 243981-87-5);
MC42,
2-{1[(1E)-(2-hydroxy-3-nitrophenyl)methylene]amino}-4-methylphenol
(CAS no. 321726-90-3); MC4-3,
1-(3-{[(1E)-(2-hydroxy-5-nitrophenyl)methylene]amino}phenyl)ethanone
(CAS no. 316133-49-0); MC4-4, 4-nitro-2-[(phenylimino)methyl]phenol
(CAS no. 15667-99-9); MC4-5,
2-{(E)-[(3-methylphenyl)imino]methyl}-4-nitrophenol (CAS no.
303058-73-3); MC4-6,
2-{(E)-[(4-hydroxyphenyl)imino]methyl}-4-nitrophenol (CAS no.
1081780-22-4); MC4-7,
2-{(E)-[(4-chlorophenyl)imino]methyl}-4-nitrophenol (CAS no.
303215-49-8); MC4-8,
2-{(E)[(3-hydroxyphenyl)imino]methyl}-4-nitrophenol (CAS no.
303215-19-2).
[0039] FIGS. 8A-8D. Isothermal titration calorimetry assay using
MC4 and B. subtilis NusB wild type protein (FIG. 8A) and variants
Y18A, D76A, D81A (FIG. 8B-8D, respectively), wherein
N=0.988.+-.0.076, Kd=1.45.+-.0.55 .mu.M, .DELTA.H=-7141.+-.939.8
cal/mol, and .DELTA.S=-1.81 cal/mol/deg.
[0040] FIG. 9 shows the minimum inhibitory concentration of MC4
analogues on various microorganisms.
DETAILED DESCRIPTION OF THE INVENTION
[0041] The following description of certain embodiment(s) is merely
exemplary in nature and is in no way intended to limit the scope of
the invention, its applications, or uses.
[0042] The present invention relates to compounds of formula 1, 2
or 3 having anti-bacterial activity. In one embodiment, those
compounds of the formula 1, 2 or 3 that are acidic in nature are
capable of forming base salts with various pharmacologically
acceptable cations. Examples of such salts include the alkali metal
or alkaline earth metal salts and particularly, the sodium and
potassium salts.
[0043] In one embodiment, certain compounds of formula 1, 2 or 3
may have asymmetric centers and therefore exist in different
enantiomeric forms. This invention relates to the use of all
optical isomers and stereoisomers of the compounds of formula 1, 2
or 3 and mixtures thereof. In particular, the invention includes
both the E and Z isomers of the compound.
[0044] In one embodiment, the invention includes tautomers of the
compounds of formula 1, 2 or 3.
[0045] In one embodiment, the present invention also includes
isotopically-labelled compounds, and the pharmaceutically
acceptable salts thereof, which are identical to those recited in
formula 1, 2 or 3, but for the fact that one or more atoms are
replaced by an atom having anatomic mass or mass number different
from the atomic mass or mass number usually found in nature.
Examples of isotopes that can be incorporated into compounds of the
invention include isotopes of hydrogen, carbon, nitrogen, oxygen,
phosphorous, fluorine and chlorine, such as 2H, 3H, 13C, 14C, 15N,
180, 170, 35S, 18F, and 36C, respectively. Compounds of the present
invention, prodrugs thereof, and pharmaceutically acceptable salts
of said compounds or of said prodrugs which contain the
aforementioned isotopes and/or other isotopes of other atoms are
within the scope of this invention. Certain isotopically-labelled
compounds of the present invention, for example those into which
radioactive isotopes such as 3H and 14C are incorporated, are
useful in drug and/or substrate tissue distribution assays.
Tritiated, i.e, 3H, and carbon-14, i.e., 14C, isotopes are
particularly preferred for their ease of preparation and
detectability. Further, substitution with heavier isotopes such as
deuterium, i.e., 21-1, can afford certain therapeutic advantages
resulting from greater metabolic stability, for example increased
in vivo half-life or reduced dosage requirements and, hence may be
preferred in some circumstances. Isotopically labelled compounds of
formula 1, 2 or 3 of this invention and prodrugs thereof can
generally be prepared by carrying out the procedures disclosed in
the Schemes and/or in the Examples and Preparations below, by
substituting a readily available isotopically labelled reagent for
a non-isotopically labelled reagent.
[0046] In one embodiment, this invention also encompasses
pharmaceutical compositions containing, and methods of treating
bacterial infections through administering, prodrugs of compounds
of the formula 1, 2 or 3. Compounds of formula 1, 2 or 3 having
free amino, amido, hydroxy or carboxylic groups can be converted
into prodrugs. Prodrugs include compounds wherein an amino acid
residue, or a polypeptide chain of two or more (e.g., two, three or
four) amino acid residues is covalently joined through an amide or
ester bond to a free amino, hydroxy or carboxylic acid group of
compounds of formula 1, 2 or 3. The amino acid residues include but
are not limited to the 20 naturally occurring amino acids commonly
designated by three letter symbols and also includes
4-hydroxyproline, hydroxylysine, demosine, isodemosine,
3-methylhistidine, norvalin, beta-alanine, gamma-aminobutyric acid,
citrulline homocysteine, homoserine, omithine and methionine
sulfone. Additional types of prodrugs are also encompassed. For
instance, free carboxyl groups can be derivatized as amides or
alkyl esters. Free hydroxy groups may be derivatized using groups
including but not limited to hemisuccinates, phosphate esters,
dimethylaminoacetates, and phosphoryloxymethyloxycarbonyls, as
outlined in Advanced Drug Delivery Reviews, 1996, 19, 115.
Carbamate prodrugs of hydroxy and amino groups are also included,
as are carbonate prodrugs, sulfonate esters and sulfate esters of
hydroxy groups. Derivatization of hydroxy groups as (acyloxy)methyl
and (acyloxy)ethyl ethers wherein the acyl group may be an alkyl
ester, optionally substituted with groups including but not limited
to ether, amine and carboxylic acid functionalities, or where the
acyl group is an amino acid ester as described above, are also
encompassed. Prodrugs of this type are described in J. Med. Chem.
1996, 39, 10. Free amines can also be derivatized as amides,
sulfonamides or phosphonamides. All of these prodrug moieties may
incorporate groups including but not limited to ether, amine and
carboxylic acid functionalities.
[0047] In one embodiment, the compounds of the present invention
may have asymmetric carbon atoms. Diastereomeric mixtures can be
separated into their individual diastereomers on the basis of their
physical chemical differences by methods known to those skilled in
the art, for example, by chromatography or fractional
crystallization. Enantiomers can be separated by converting the
enantiomeric mixtures into a diastereomeric mixture by reaction
with an appropriate optically active compound (e.g., alcohol),
separating the diastereomers and converting (e.g., hydrolyzing) the
individual diastereomers to the corresponding pure enantiomers. All
such isomers, including diastereomeric mixtures and pure
enantiomers, are considered as part of the invention.
[0048] Any compounds of formula 1, 2 or 3 that are basic in nature
are capable of forming a wide variety of salts with various
inorganic and organic acids.
[0049] Any compounds of the formula 1, 2 or 3 that are acidic in
nature are capable of forming base salts with various
pharmacologically acceptable cations. Examples of such salts
include the alkali metal or alkaline-earth metal salts and
particularly, the sodium and potassium salts. These salts may be
prepared by conventional techniques. The chemical bases which are
used as reagents to prepare the pharmaceutically acceptable base
salts of this invention are those which form non-toxic base salts
with any acidic compounds of formula 1, 2 or 3. Such non-toxic base
salts include those derived from such pharmacologically acceptable
cations as sodium, potassium calcium and magnesium, etc. These
salts can be prepared by treating the corresponding acidic
compounds with an aqueous solution containing the desired
pharmacologically acceptable cations, and then evaporating the
resulting solution to dryness, preferably under reduced pressure.
Alternatively, they may also be prepared by mixing lower alkanolic
solutions of the acidic compounds and the desired alkali metal
alkoxide together, and then evaporating the resulting solution to
dryness in the same manner as before. In either case,
stoichiometric quantities of reagents are preferably employed in
order to ensure completeness of reaction and maximum yields of the
desired final product.
[0050] In one embodiment, the compounds of formula 1, 2 or 3, and
the pharmaceutically acceptable salts and solvates thereof
(hereinafter "the active compounds"), may be administered through
oral, parenteral, topical, or rectal routes in the treatment or
prevention of bacterial or protozoal infections. Variations may
nevertheless occur depending upon the species of mammal, fish or
bird being treated and its individual response to said medicament,
as well as on the type of pharmaceutical formulation chosen and the
time period and interval at which such administration is carried
out.
[0051] In one embodiment, the active compounds may be administered
alone or in combination with pharmaceutically acceptable carriers
or diluents by the routes previously indicated, and such
administration may be carried out in single or multiple doses. More
particularly, the active compounds may be administered in a wide
variety of different dosage forms, i.e., they may be combined with
various pharmaceutically acceptable inert carriers in the form of
tablets, capsules, lozenges, troches, hard candies, powders,
sprays, creams, salves, suppositories, jellies, gels, pastes,
lotions, ointments, aqueous suspensions, injectable solutions,
elixirs, syrups, and the like. Such carriers include solid diluents
or fillers, sterile aqueous media and various non-toxic organic
solvents, etc. Moreover, oral pharmaceutical compositions can be
suitably sweetened and/or flavored. In general, the active
compounds are present in such dosage forms at concentration levels
ranging from about 5.0% to about 70% by weight.
[0052] In one embodiment, for oral administration, tablets
containing various excipients such as microcrystalline cellulose,
sodium citrate, calcium carbonate, dicalcium phosphate and glycine
may be employed along with various disintegrants such as starch
(and preferably corn, potato, or tapioca starch), alginic acid and
certain complex silicates, together with granulation binders like
polyvinylpyrrolidone, sucrose, gelatin and acacia. Additionally,
lubricating agents such as magnesium stearate, sodium lauryl
sulfate and talc are often very useful for tabletting purposes
Solid compositions of a similar type may also be employed as
fillers in gelatin capsules; preferred materials in this connection
also include lactose or milk sugar as well as high molecular weight
polyethylene glycols. When aqueous suspensions and/or elixirs are
desired for oral administration, the active compound may be
combined with various sweetening or flavoring agents, coloring
matter or dyes, and, if so desired, emulsifying and/or suspending
agents as well, together with such diluents as water, ethanol,
propylene glycol, glycerin and various like combinations
thereof.
[0053] In one embodiment, for parenteral administration, solutions
of an active compound in either sesame or peanut oil or in aqueous
propylene glycol may be employed. The aqueous solutions should be
suitably buffered (preferably pH greater than 8) if necessary and
the liquid diluent first rendered isotonic. These aqueous solutions
are suitable for intravenous injection purposes. The oily solutions
are suitable for intraarticular, intramuscular and subcutaneous
injection purposes. The preparation of all these solutions under
sterile conditions is readily accomplished by standard
pharmaceutical techniques will known to those skilled in the
art.
[0054] In another embodiment, it is also possible to administer the
active compounds of the present invention topically and this may be
done by way of creams, jellies, gels, pastes, patches, ointments
and the like, in accordance with standard pharmaceutical
practice.
[0055] In one embodiment, for administration to animals other than
humans, such as cattle or domestic animals, the active compounds
may be administered in the feed of the animals or orally as a
drench composition.
[0056] In one embodiment, the active compounds may also be
administered in the form of liposome delivery systems, such as
small unilamellar vesicles, large unilamellar vesicles and
multilamellar vesicles. Liposomes can be formed from a variety of
phospholipids, such as cholesterol, stearylamine or
phosphatidylcholines.
[0057] In one embodiment, the active compounds may also be coupled
with soluble polymers as targetable drug carriers. Such polymers
can include polyvinylpyrrolidone, pyran copolymer,
polyhydroxypropylmethacrylamide phenyl,
polyhydroxyethylaspartamide-phenol, or polyethyleneoxide-polylysine
substituted with palmitoyl residues. Furthermore, the active
compounds may be coupled to a class of biodegradable polymers
useful in achieving controlled release of a drug, for example,
polylactic acid, polyglycolic acid, copolymers of polylactic and
polyglycolic acid, polyepsilon caprolactone, polyhydroxy butyric
acid, polyorthoesters, polyacetals, polydihydropyrans,
polycyanoacrylates and cross-linked or amphipathic block copolymers
of hydrogels.
[0058] In one embodiment, the present invention provides a compound
of formula 1,
##STR00005## [0059] a pharmaceutically acceptable salt, or a
solvate thereof wherein: [0060] (1) X.sub.1 is selected from the
group consisting of --N.dbd.CH--, CH.dbd.N--, CH.dbd.CH--,
--NH--CH.sub.2--, --CH.sub.2--NH--, --CH.sub.2--CH.sub.2--,
--CH.sub.2--O--, --O--CH.sub.2--, --CH.sub.2--S--, --S--CH.sub.2--,
--S(.dbd.O)--CH.sub.2--, --S(.dbd.O)--NH--, --CH--S(.dbd.O)--,
--NH--S(.dbd.O)--, S(.dbd.O).sub.2--CH.sub.2--,
--S(.dbd.O).sub.2--NH--, --CH.sub.2--S(.dbd.O)--,
--NH--S(.dbd.O).sub.2--, --C(.dbd.O)--NH--, --NH--C(.dbd.O)--, and
--C(.dbd.O)--; and [0061] (2) Each of R.sub.1-R.sub.5 is
independently selected from the group consisting of hydrogen,
hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl
hydroxymethyl, methoxy, methoxycarbonyl, aminosulfonyl,
aminocarbonyl, cyano, tetrazolyl,
dimethylaminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyl,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo.
[0062] In one embodiment, the present invention provides a compound
including but not limited to:
##STR00006## ##STR00007##
[0063] In one embodiment, the present invention provides a compound
including but not limited to:
##STR00008## ##STR00009## ##STR00010## ##STR00011## ##STR00012##
##STR00013## ##STR00014## ##STR00015## ##STR00016## ##STR00017##
##STR00018## ##STR00019## ##STR00020## ##STR00021## ##STR00022##
##STR00023## ##STR00024## ##STR00025## ##STR00026## ##STR00027##
##STR00028## ##STR00029## ##STR00030## ##STR00031##
[0064] In one embodiment the present invention provides a
pharmaceutical composition for treatment or prevention of bacterial
or protozoal infections, comprising the compound.
[0065] In one embodiment, the composition is in the form of
tablets, capsules, lozenges, troches, hard candies, powders,
sprays, creams, salves, suppositories, jellies, gels, pastes,
lotions, ointments, aqueous suspensions, injectable solutions,
elixirs, or syrups.
[0066] In one embodiment, the pharmaceutical composition comprises
5% to 70% by weight of the compound.
[0067] In one embodiment, the bacterial or protozoal infections are
caused by microorganism selected from the group consisting of
Enterococcus faecalis, Staphylococcus aureus, Klebsiella
pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa,
Enterobacter cloacae, Escherichia coli, and Streptococcus
pneumoniae.
[0068] In one embodiment, the present invention provides a method
to inhibit NusB-NusE interaction in a microorganism, comprising the
step of contacting the compound with said microorganism.
[0069] In one embodiment, the NusB is selected from NusB E81, NusB
Y18 and NusB E75, and NusE is selected from NusE H15, NusE D19, and
NusE R16.
[0070] In one embodiment, the microorganism is selected from the
group consisting of Enterococcus faecalis, Staphylococcus aureus,
Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas
aeruginosa, Enterobacter cloacae, Escherichia coli, and
Streptococcus pneumoniae.
[0071] In one embodiment, the present invention provides a method
of treating or preventing bacterial or protozoal infections in a
subject, comprising a step of administering a therapeutically
effective amount of the compound to said subject.
[0072] In one embodiment, the compound is administered through an
oral, parenteral, topical, or rectal route.
[0073] In one embodiment, the microorganism is selected from the
group consisting of Enterococcus faecalis, Staphylococcus aureus,
Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas
aeruginosa, Enterobacter cloacae, Escherichia coli, and
Streptococcus pneumoniae.
[0074] In one embodiment, the NusB is selected from NusB E81, NusB
Y18 and NusB E75, and NusE is selected from NusE 1-15, NusE D19 and
NusE R16.
[0075] In one embodiment, the present invention provides a compound
of formula 2,
##STR00032## [0076] a pharmaceutically acceptable salt, or a
solvate thereof, wherein [0077] (1) X.sub.1 is selected from the
group consisting of --N.dbd.CH--, --CH.dbd.N--, --CH.dbd.CH--,
--NH--CH.sub.2--, --CH.sub.2--NH--, --CH.sub.2--CH.sub.2--,
--CH.sub.2--O--, --H--, --CH.sub.2--S--, --S--CH.sub.2--,
--S(.dbd.O)--CH.sub.2--, --S(.dbd.O)--NH--,
--CH.sub.2--S(.dbd.O)--, --NH--S(.dbd.O)--,
--S(.dbd.O).sub.2--CH.sub.2--, --S(.dbd.O).sub.2--NH--,
--CH.sub.2--S(.dbd.O).sub.2--, --NH--S(.dbd.O).sub.2--,
--C(.dbd.O)--NH--, --NH--C(.dbd.O)--, and --C(.dbd.O)--; and [0078]
(2) Each of R.sub.1-R.sub.3 is independently selected from the
group consisting of hydrogen, hydroxy, nitro, acetyl, methyl,
ethynyl, carboxy, carboxymethyl hydroxymethyl, methoxy,
methoxycarbonyl, aminosulfonyl, aminocarbonyl, cyano, tetrazolyl,
dimethylaiminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyl,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo.
[0079] In one embodiment, the compound is selected from the group
consisting of:
##STR00033##
[0080] In one embodiment, the present invention provides a compound
of formula 3,
##STR00034##
a pharmaceutically acceptable salt, or a solvate thereof, wherein:
[0081] (1) each of X.sub.1 and Y is independently selected from the
group consisting of --NH--, --CH.sub.2--O--, and --S--; and [0082]
(2) each of R.sub.1-R.sub.5 is independently selected from the
group consisting of hydrogen, hydroxy, nitro, acetyl, methyl,
ethynyl, carboxy, carboxymethyl hydroxymethyl, methoxy,
methoxycarbonyl, aminosulfonyl, aminocarbonyl, cyano, tetrazolyl,
dimethylaminosulfonylaminocarbonyl, cyanomethyl,
acetylaminosulfonyl, methoxyaminocarbonyl,
methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo,
phenyl, trifluoromethyl and benzo.
[0083] In one embodiment, the compound is
##STR00035##
EXAMPLE 1
[0084] Previously, by rational design and pharmacophore-based
virtual screening, small chemical molecule inhibitors with
antimicrobial activities were identified, targeting the interaction
between bacterial RNA polymerase and the essential housekeeping
transcription initiation factor .sigma...sup.12 Using a similar
approach, an inhibitor against bacterial rRNA synthesis that has
antimicrobial activities against S. aureus strains, including MRSA,
was identified.
[0085] A bacterial rRNA transcription complex was modeled on the
basis of the crystal structure of the RNA polymerase elongation
complex.sup.13 with a suite of Nus transcription factors NusA,
NusB, NusE, and NusG (FIG. 1A). NusG binds to the central cleft of
RNA polymerase via its N-terminal domain,.sup.14 and its Cterminal
domain interacts with NusE,.sup.15 which anchors the NusB-NusE-boxA
subcomplex to the downstream face of RNA polymerase (FIG. 1A). NusA
binds to RNA polymerase near the RNA exit channel (FIG. 1A),.sup.16
consistent with its binding to rRNA just downstream of the boxA
sequence..sup.17 The interaction between RNA polymerase-Nus factors
and rRNA results in a constrained loop, facilitating rapid and
proper folding of the emerging transcript, which is consistent with
previous biochemical observations that the RNA polymerase-Nus
factor complex would play the role of a chaperone in rRNA
synthesis..sup.18 This assembly also has possible roles in
preventing the termination factor Rho from accessing the rRNA
transcript,.sup.19 ensuring complete transcription of the
relatively large rRNA operons during rapid bacterial cell growth.
Recently reported structural information about the phage protein
.lamda.N-dependent transcription antitermination complex also was
similar to that of the rRNA transcription complex model used in
this invention..sup.20
[0086] Examination of the published crystal structures of the
Escherichia coli NusB-NusE heterodimer [Protein Data Bank (PDB)
entry 3D3B] (FIG. 1B).sup.21 reveals that NusE contains only 18%
.alpha.-helix and binds with NusB mainly via interactions with
helix 2 (FIG. 1B)..sup.22 The hydrogen bonding interactions occur
between NusB E81 and NusE H15, NusB Y18 and NusE D19, and NusB E75
and NusE. R16 (FIG. 1B, expanded view; E. coli amino acid residue
numbering), which are highly conserved across prokaryotes (FIG. 5,
arrows). Additionally, a nuclear magnetic resonance study of the
Aquifex aeolicus NusB-NusE interaction also confirmed similar
interactions exist in solution..sup.23
[0087] The structural information about the NusB-NusE heterodimer
co-crystal (PDB entry 3D3B).sup.22 was used to develop a
pharmacophore model (FIG. 2A). The pharmacophore model comprised
two hydrogen donors (pink), one acceptor (green) to mimic the major
hydrogen bonds between NusB and NusE as mentioned above, and one
conserved hydrophobic interaction (cyan, FIG. 2A) between E. coli
residues NusB L22 and NusE V26. In addition to the interactions, a
series of exclusion zones (gray) were added to minimize steric
clashes within the shallow pocket that forms the binding site on
NusB. The final pharmacophore model was then created using Biovia
DS4.5 to map on all the features required..sup.24 As the
pharmacophore model was designed on the basis of the properties of
the important amino acid residues on the NusE protein responsible
for binding to NusB, theoretically, the ideal small molecules
capable of docking into this pharmacophore model should be able to
bind to NusB and demonstrate inhibitory activity against the
NusB-NusE interaction accordingly.
[0088] On the basis of the pharmacophore model, an in silico screen
was performed using a virtual compound library constructed by
combining the mini-Maybridge library and the Enamine antibacterial
library..sup.25 The top 50 hits from the initial virtual screen
were re-mapped against the pharmacophore model and the
energy-minimized conformations of compounds visually inspected. The
compounds that poorly fit into the pharmacophore were removed. As a
result, seven compounds (FIG. 6) were initially short-listed for
wet-laboratory testing.
[0089] The antimicrobial activity of the seven compounds against
community-acquired MRSA strain USA300 were first screened. Of the
analogues evaluated, MC4 (FIG. 2B) was found to demonstrate growth
inhibition effects with a minimum inhibitory concentration (MIC) of
64 .mu.g/mL (FIG. 3). With a molecular weight of 266.3, MC4 has
been reported to be of use only to form a metal complex dye in
optical layers for optical data recording..sup.26 The antimicrobial
activities of MC4 against a panel of representative strains of
pathogens were then tested. MC4 demonstrated preferred
antimicrobial activity against S. aureus strains, including MRSA,
over other pathogens tested, with MICs as low as 8 .mu.g/mL against
control strain S. aureus 25923 and 16 g/mL against healthcare
acquired MRSA ST239 (FIG. 3). Additionally, MC4 did not show
significant cytotoxicity against mammalian cell lines compared to
5-fluorouracil (Table 1).
[0090] The level of macromolecules in S. aureus ATCC 25923 cells
during exponential growth due to MC4 treatment were analyzed. MC4,
rifampicin, and oxacillin were added at a one-quarter MIC level,
which did not interfere with the rate of growth of S. aureus ATCC
25923 cells. As shown in FIG. 4, none of the treatment affected the
DNA level, as previewed by the mode of action. In the control
cells, the level of major rRNA (16S+23S) was around 78% of total
RNA (FIG. 4)..sup.4 Rifampicin resulted in reduction in the rRNA
level consistent with previous observations (FIG. 4)..sup.27 MC4
showed a significant reduction in the rRNA level, which was lower
than that of rifampicin treated cells (FIG. 4). Furthermore, MC4
treatment led to a significant reduction in the protein level,
while rifampicin did not show this effect, probably as a result of
a decreased level of ribosome production, affecting the protein
synthesis ability. Oxacillin-treated cells displayed rRNA and
protein production levels slightly higher than those of control
cells.
[0091] Finally, to establish MC4's mode of action at the molecular
level, an enzyme-linked immunosorbant assay-based inhibitory assay
was performed to assess the in vitro inhibition of NusB-NusE
heterodimer formation by MC4..sup.24 Purified NusB was used to coat
the 96-well plate, and GST-tagged NusE was used as the probe. MC4
showed positive inhibition of the NusB-NusE interaction with an
IC50 of .about.34.7.+-.0.13 .mu.M. By further testing a series of
MC4 analogues (FIG. 7), it was found that three functional groups
on the molecule targeting interactions between NusB E81 and NusE
H15, NusB Y18 and NusE D19, and NusB E75 and NusE R16 were
compulsory for inhibiting NusB-NusE binding, as predicted by
FitScore of Biovia DS4.5 (Table 3). With the change in the phenyl
acetylene group to phenols, the IC50 values of the corresponding
MC4 analogues increased, while deletion of this terminal triple
bond or replacing by methyl or chloride caused a reduced IC50. When
p-nitrophenol was modified to o-nitrophenol, the IC50 values
increased, probably because of the involvement of the phenol group
in the binding interaction with NusB Y81 (Table 3). These results
confirmed the pharmacophore model used in this invention and
demonstrated that the reactivity of imine and p-nitrophenol did not
contribute to the activity of MC4.
[0092] The interaction between MC4 and NusB was also biophysically
quantified. A previous report demonstrated that NusB bound to NusE
in a 1:1 ratio with a Kd of .about.1 .mu.M as determined by
isothermal titration calorimetry (ITC)..sup.21 In similar
experiments, it was found that MC4 bound specifically to NusB (FIG.
8A) with a one-site binding mode with a Kd of 1.45.+-.0.55 .mu.M.
Binding of MC4 to NusE could not be detected by ITC (not shown), or
between MC4 and NusB variants (Y18A, D76A, and D81A) with the three
amino acid residues responsible for NusE binding altered to alanine
(FIG. 8B-D). These results together suggest the inhibition of
NusB-NusE heterodimer formation is achieved via specific
interaction between MC4 and NusB as designed. Further experiments
will be performed to resolve the structure of NusB in complex with
MC4 for target validation, as well as structure-based lead
optimization.
[0093] The potential impact of untreatable antibiotic-resistant
infections on society is profound, and there is an urgent need to
identify new drug targets..sup.28 Traditionally, the bacterial
ribosome itself (both 30S and 50S subunits) has been one of the
most commonly exploited targets for antibiotics inhibiting protein
synthesis..sup.29 Recent drug discovery research had validated the
finding that inhibition of rescuing stalled ribosomes at the end of
mRNAs resulted in antibacterial activity..sup.30 Given the ribosome
is positively related to fast growth/proliferation and the large
difference between eukaryotic and prokaryotic rRNA transcription
machinery, it is tempting to hypothesize inhibition of rRNA
synthesis would be expected to have a major impact on cell growth
and/or viability. This hypothesis is strengthened by recent
findings showing that many anticancer drugs inhibit rRNA synthesis
or maturation..sup.31
[0094] In this work, pharmacophore-based in silico screening
followed by biological confirmation was used for identifying a
potential new antibiotic lead. An essential interaction between
transcription factors NusB and NusE that is required for the
formation of highly processive complexes used for the synthesis of
rRNA within bacterial cells was targeted. One of the short-listed
compounds (MC4) showed specific activity against S. aureus strains,
including MRSA, without significant toxicity to mammalian cell
lines. This compound is like the first designed to target bacterial
rRNA synthesis that has antimicrobial activities. The detailed
effect of MC4 in rRNA transcription/processing, ribosome
biogenesis, and S. aureus virulence is currently under
investigation. Although MC4 has been shown to specifically inhibit
NusB-NusE interaction at the molecular level, any potential
off-target effect on bacterial cells remains to be elucidated.
Because NusB and NusE are highly conserved in bacteria, the reason
that MC4 has preferred antimicrobial activity against S. aureus
over other pathogens needs to be further investigated.
[0095] An essential protein-protein interaction between
transcription factors in the bacterial rRNA synthesis machinery as
a novel antimicrobial target was validated. Other important
protein-protein interactions involved in bacterial rRNA
transcription, e.g., between NusE and NusG, the NusE-RNA polymerase
complex might also have the potential as novel antimicrobial
targets..sup.32 This work paves the way for the structural
optimization of MC4, and potentially other compounds from more
comprehensive screens, for development as prospective new
antimicrobial lead molecules targeting bacterial rRNA
synthesis.
Materials and Methods
[0096] Bacterial Strains and Chemicals. The following bacterial
strains were used in this study for the microdilution assay:
Enterococcus faecalis ATCC 29212, Klebsiella pneumonia ATCC 700603,
Acinetobacter baumannii ATCC 19606, Pseudomonas aeruginosa PA01,
Enterobacter cloacae ATCC 13047, E. coli ATCC 25922, Proteus
vulgaris ATCC 6380, and S. aureus USA300, ATCC 25923, ATCC 29213,
ST22, ST30, ST45, ST59, ST239, JE-2, BAA44. E. coli strain DH5a
(Gibco BRL) was used in this study for cloning and BL21 (DE3)
pLysS.sup.23 was used for protein overproduction. 5-fluorouracil,
rifampicin and other antibiotics used in the microdilution assay
were purchased from SigmaAldrich. Compounds MC1-7 were purchased
from MolPort.
[0097] Molecular modeling. The antitermination complex model was
constructed by consolidating a number of published crystal
structures, including the Thermus thermophilus transcription
elongation complex (PDB: 2O5I),.sup.34 E. coli RNA polymerase-NusG
complex (PDB: 5 tbz),.sup.35 Aquifex aeolicus NusB-E in complex
with boxA RNA (PDB: 3R2C), Mycobacterium tuberculosis NusA
C-terminal domain-RNA complex (PDB: 2ASB);.sup.37 as well as the
NMR solution structure of E. coli NusE:NusG-CTD complex (PDB:
2KVQ),.sup.38 and B. subtilis NusA N-terminal domain (PDB:
2MT4)..sup.39 Structure matching was performed using the MatchMaker
function of UCSF Chimera..sup.40 Images were generated with UCSF
Chimera.
[0098] Pharmacophore design and virtual screening were performed as
described previously..sup.41
[0099] Antibacterial activity test. Microdilution assay was
performed according to the Clinical & Laboratory Standards
Institute recommendations..sup.42 Serial 2-fold dilutions of the
tested compounds and antibiotic controls were made from 256
.mu.g/ml to 0.5 .mu.g/ml. DMSO was included as a negative
control.
[0100] Cytotoxicity assay was performed as detailed
previously.sup.43 except A549 lung carcinoma and HaCaT immortalized
human keratinocytes were used in this study.
[0101] DNA, protein and rRNA quantitation. MC4, oxacillin and
rifampicin at 1/4 MIC level were added to S. aureus strain ATCC
25923 in LB medium at early log phase (OD595=0.2), which was then
grown to mid-log phase (OD595==0.5). For DNA and protein
quantitation, 1 ml cells were harvested and treated with 10 mg/ml
lysozyme+0.5 mg/ml lysostaphin at RT for 1 hr before centrifugation
at 13000 g/min for 3 min. The supernatant was discarded and cells
lysed with 600 .mu.l Nuclei Lysis Solution (Promega/Genomic DNA
Purification Kit) for 5 min, followed by gentle sonication. The
amount of DNA was quantified with Qubit dsDNA BR (broad range) and
protein quantified with NanoOrange.TM. Protein Quantitation Kit
(ThermoFisher). For rRNA quantitation, 1 ml culture was collected
and treated with RNAProtect (Qiagen), before total RNA was
extracted with an RNeasv Mini Kit (Qiagen). DNase I treatment was
performed with a TURBO DNA-free Kit (ThermoFisher). The extracted
RNA was subjected to Agilent 2100 analysis, and the level of major
rRNA (the sum of 16S+23S rRNA) as percentage of total RNA. The
values were compared across each treatment group. All experiments
were repeated three times.
[0102] Plasmid Construction. All of the cloning steps were carried
out in E. coli DH5.alpha.. The plasmids used and constructed in
this work were confirmed by DNA sequencing, and are listed in Table
2. B. subtilis nusB was amplified using primers
5'-AAAGGAGATCTAGACATIAAAGAAGA-3' (SEQ ID NO: 1) and
5'TTTTCTGGTACCCTAKIfTCCC-3' (SEQ ID NO: 2) from purified B.
subtilis chromosomal DNA. The nusB mutants were made by PCR
splicing.sup.44 using mutant primers
5'-CTTTGCAGGCACIAgcTCAAATTGATGTC-3' (SEQ ID NO: 3) and
5'GACACAfiTTGAgcTAGTGCCTGCAAAG-3' (F15A) (SEQ ID NO: 4),
5'-GAATTGGAAGCTCGATgcGATTGCCAATG-3' (SEQ ID NO: 5) and
5'-CKfTGGCAkCgc-FCGAGCTTCCAATTC-3' (R70A) (SEQ ID NO: 6), and
5'GATTGCCAATGTTGcCCGTGCGATTTTOC-3' (SEQ ID NO: 7) and
5'-GCAAAkFCGCACGGgCAACATGGCAC-3' (D75A) (SEQ ID NO: 8). The
amplicons were cut with XbaI and Acc65I and inserted into similarly
cut pETMCSIII (Table 2) to produce pNG130, pNG1178, pNGi79, and
pNl1180 respectively (Table 2). B. subtilis nusE was amplified
using primers 5'-AAGGAGGGTCTAGAATGGCAAAAC-3' (SEQ ID NO: 9) and
5'CTATATTTTAGGTACCAAGTTTAfTT-3' (SEQ ID NO: 10) from B. subtilis
chromosomal DNA and ligated into the NdeI and Acc65I sites of
pNG651 to give pNG896 (Table 2).
[0103] Protein overproduction and purification. B. subtilis NusB
(wild type and mutant) and NusE-GST were overproduced from plasmids
(Table 2) and purified using a similar approach to that described
previously..sup.45 Purified proteins were dialyzed into 20 mM
KH2PO4, 150 mM NaCl, 30% glycerol, pH 7.8 and stored at 80.degree.
C.
[0104] ELISA-based assays. These assays were performed as described
previously,.sup.41 except NusB was used to coat the NUNC
MaxiSorp.TM. 96-well plates and GST-tagged NusE used as the
probe.
[0105] Isothermal calorimetric titration (ITC). ITC experiments
were performed as described previously..sup.41 For compound
testing, a 50 mM stock made up in DMSO was diluted to 500 .mu.M in
ITC buffer (50 mM KH2PO4, 150 mM NaCl, pH 7.4). All proteins were
dialysed into ITC buffer and were supplemented with the same
concentration of DMSO (1% v/v) to minimize buffer miss-match. MC4
was then titrated against 50 .mu.M NusB wild type and mutants as
described previously.sup.41 using 1% DMSO in ITC buffer as the
negative control.
TABLE-US-00001 TABLE I Cytotoxicity (CC50) of MC4 against human
cell lines. Cell line A549 lung HaCaT immortalized Treatment
carcinoma human keratinocytes 5-fluorouracil 5.62 .+-. 0.002 nM
<1 nM MC4 183.33 .+-. 7.71 .mu.M 695.15 .+-. 5.95 .mu.M
TABLE-US-00002 TABLE 2 Strains and plasmids used and created in
this study. Plasmids Genotype Source/Construction Vectors for
cloning pETMCSIII bla P.phi..sub.10-6xHis-T.phi. [46] pNG651 bla
P.phi..sub.10-3CGST-T.phi. [47] Vectors for protein overproduction
pNG130 bla P.phi..sub.10-6His-nusB-T.phi. This work. nusB cloned
into XbaI and Acc65I cut pETMCSIII pNG134 bla
P.phi..sub.10-6His-nusE-T.phi. This work. nusE cloned into XbaI and
Acc65I cut pETMC Siff pNG896 bla P.phi..sub.10-nusE-3CGST-T.phi.
This work. nusE cloned into NdeI and Acc65I cut pNG651 pNG1178 Bla
P.phi..sub.10-6xHis-nusB.sub.(F15A)-T.phi. This work.
nusB.sub.(F15A) cloned into XbaI and Acc65I cut pETMCSIII pNG1179
blaP.phi..sub.10-6xHis-nusB.sub.(R70A)-T.phi. This work.
nusB.sub.(R70A) cloned into XbaI and Acc65I cut pETMCSIII pNG1180
bla P.phi..sub.10- 6xHis-nusB.sub.(D75A)-T.phi. This work.
nusB.sub.(D75A) cloned into XbaI and Acc65I cut pETMCSIII
bla, cat, ampicillin and chloramphenicol resistance gene;
P.phi..sub.10, phage T7 promoter; P.sub.xyl, xylose inducible
promoter, T.sub..PHI., T7 transcription terminator; 3C, the
recognition sequence of 3C protease; GFP green florescence protein;
GST, Glutathione S-transferase; PKA, protein kinase A recognition
site.
TABLE-US-00003 TABLE 3 Comparison of MC4 and analogues in predicted
properties and IC.sub.50. IC50 (.mu.M) FitScore.sup.a AlogP.sup.a
PSA-2D.sup.a(.ANG.) MC4 34.7 .+-. 0.13 2.638 4.206 74.961 MC4-1
14.4 .+-. 2.59 NA.sup.b 3.078 74.961 MC4-2 38.2 .+-. 8.78 NA.sup.b
2.818 92.262 MC4-3 5.94 .times. 10.sup.-3 .+-. 1.80 NA.sup.b 3.323
95.777 MC4-4 147 .+-. 17.9 NA.sup.b 3.078 74.961 MC4-5 971 .+-.
11.6 NA.sup.b 3.565 74.961 MC4-6 8.15 .times. 10.sup.-3 .+-. 1.68
2.569 2.836 95.777 MC4-7 1639 .+-. 12.7 NA.sup.b 3.743 74.961 MC4-8
6.92 .times. 10.sup.-3 .+-. 0.68 2.460 2.836 95.777 .sup.aBiovia
DS4.5 calculation; .sup.bNo FitScore provided by the software
EXAMPLE 2
Mc4 Analogues
[0106] The structures of further MC4 analogues are presented below
with their minimum inhibitory concentrations on 9 microorganisms
are shown in FIG. 9 (EFAE 19433: Enterococcus faecalis ATCC
19433:SAUR 25923: Staphylococcus aureus ATCC 25923; SAUR 29213;
Staphylococcus aureus ATCC 29213; KPNE 700603: Klebsiella
pneumoniae ATCC 700603; ABAU 19606: Acinetobacter baumannii ATCC
19606; PAER 27853: Pseudomonas aeruginosa AFCC 27853; ECLO 13047:
Enterobacter cloacae ATCC 13047; ECOL 25922: Escherichia coli ATCC
25922; SPNE 49619: Streptococcus pneumoniae ATCC 49619).
[0107] The antimicrobial activity of the compounds was determined
by broth microdilution according to the CLSI guidelines (1). The
test medium was cation-adjusted Mueller-Hinton broth (MH). Serial
two-fold dilutions were performed for the tested chemicals starting
from 256 .mu.g/ml to 0.0625 .mu.g/ml, and the bacterial cell
inoculum was adjusted to approximately 5.times.105 CFU per ml.
Results were taken after 20 h of incubation at 37.degree. C. MIC
was defined as the lowest concentration of antibiotic with no
visible growth. Experiments were performed in duplicates.
TABLE-US-00004 No. Structure Formula Mol. Wt MC4-1 ##STR00036##
C.sub.13H.sub.10N.sub.2O.sub.3 242.23 MC4-2 ##STR00037##
C.sub.15H.sub.12N.sub.2O.sub.4 284.27 MC4-3 ##STR00038##
C.sub.14H.sub.12N.sub.2O.sub.4 272.26 MC4-11 ##STR00039##
C.sub.15H.sub.10N.sub.2O.sub.3 266.26 MC4-12 ##STR00040##
C.sub.14H.sub.10N.sub.2O.sub.5 286.24 MC4-13 ##STR00041##
C.sub.15H.sub.12N.sub.2O.sub.5 300.27 MC4-14 ##STR00042##
C.sub.14H.sub.12N.sub.2O.sub.4 272.26 MC4-15 ##STR00043##
C.sub.16H.sub.13NO.sub.2 251.29 MC4-16 ##STR00044##
C.sub.17H.sub.12N.sub.2O.sub.3 292.29 MC4-17 ##STR00045##
C.sub.17H.sub.13NO.sub.3 279.30 MC4-18 ##STR00046##
C.sub.15H.sub.10FNO 239.25 MC4-19 ##STR00047##
C.sub.15H.sub.12N.sub.2O.sub.3 268.27 MC4-20 ##STR00048##
C.sub.13H.sub.11N.sub.3O.sub.5S 321.31 MC4-21 ##STR00049##
C.sub.14H.sub.11N.sub.3O.sub.4 285.26 MC4-22 ##STR00050##
C.sub.14H.sub.9N.sub.3O.sub.3 267.24 MC4-23 ##STR00051##
C.sub.14H.sub.10N.sub.6O.sub.3 310.27 MC4-24 ##STR00052##
C.sub.17H.sub.12N.sub.2O 260.30 MC4-25 ##STR00053##
C.sub.16H.sub.16N.sub.4O.sub.6S 392.39 MC4-26 ##STR00054##
C.sub.15H.sub.11N.sub.3O.sub.3 281.27 MC4-27 ##STR00055##
C.sub.15H.sub.13N.sub.3O.sub.6S 363.34 MC4-28 ##STR00056##
C.sub.15H.sub.13N.sub.3O.sub.5 315.29 MC4-29 ##STR00057##
C.sub.14H.sub.14N.sub.2O.sub.4 274.28 MC4-30 ##STR00058##
C.sub.14H.sub.12N.sub.2O.sub.5 288.26 MC4-31 ##STR00059##
C.sub.15H.sub.14N.sub.2O.sub.5 302.29 MC4-32 ##STR00060##
C.sub.16H.sub.15NO.sub.2 253.30 MC4-33 ##STR00061##
C.sub.17H.sub.15NO.sub.3 281.31 MC4-34 ##STR00062##
C.sub.15H.sub.12FNO 241.27 MC4-35 ##STR00063##
C.sub.13H.sub.13N.sub.3O.sub.5S 323.32 MC4-36 ##STR00064##
C.sub.14H.sub.13N.sub.3O.sub.4 287.28 MC4-37 ##STR00065##
C.sub.14H.sub.11N.sub.3O.sub.3 269.26 MC4-38 ##STR00066##
C.sub.15H.sub.13N.sub.3O.sub.3 283.29 MC4-39 ##STR00067##
C.sub.14H.sub.12N.sub.6O.sub.3 312.29 MC4-40 ##STR00068##
C.sub.15H.sub.13N.sub.3O.sub.6S 363.34 MC4-41 ##STR00069##
C.sub.15H.sub.15N.sub.3O.sub.6S 365.36 MC4-42 ##STR00070##
C.sub.16H.sub.18N.sub.4O.sub.6S 394.40 MC4-43 ##STR00071##
C.sub.15H.sub.15N.sub.3O.sub.5 317.30 MC4-44 ##STR00072##
C.sub.17H.sub.14N.sub.2O 262.31 MC4-45 ##STR00073##
C.sub.16H.sub.11NO.sub.2 249.27 MC4-46 ##STR00074##
C.sub.14H.sub.12N.sub.2O.sub.4 272.26 MC4-47 ##STR00075##
C.sub.17H.sub.18N.sub.2O.sub.3 298.34 MC4-48 ##STR00076##
C.sub.14H.sub.14N.sub.2O.sub.3 258.28 MC4-49 ##STR00077##
C.sub.13H.sub.12N.sub.2O.sub.3 244.25 MC4-50 ##STR00078##
C.sub.13H.sub.9ClN.sub.2O.sub.3 276.68 MC4-51 ##STR00079##
C.sub.15H.sub.12N.sub.2O.sub.5 300.27 MC4-52 ##STR00080##
C.sub.14H.sub.12N.sub.2O.sub.4 272.26 MC4-53 ##STR00081##
C.sub.14H.sub.12N.sub.2O.sub.3 256.26 MC4-54 ##STR00082##
C.sub.14H.sub.14N.sub.2O.sub.3 258.28 MC4-55 ##STR00083##
C.sub.15H.sub.11NO 221.26 MC4-56 ##STR00084##
C.sub.13H.sub.9ClN.sub.2O.sub.3 276.68 MC4-57 ##STR00085##
C.sub.14H.sub.12N.sub.2O.sub.3 256.26 MC4-58 ##STR00086##
C.sub.13H.sub.10N.sub.2O.sub.4 258.23 MC4-59 ##STR00087##
C.sub.13H.sub.11ClN.sub.2O.sub.3 278.69 MC4-60 ##STR00088##
C.sub.14H.sub.14N.sub.2O.sub.4 274.28 MC4-61 ##STR00089##
C.sub.17H.sub.20N.sub.2O.sub.3 300.36 MC4-62 ##STR00090##
C.sub.15H.sub.14N.sub.2O.sub.5 302.29 MC4-63 ##STR00091##
C.sub.14H.sub.12N.sub.2O.sub.4 272.26 MC4-64 ##STR00092##
C.sub.17H.sub.18N.sub.2O.sub.3 298.34 MC4-65 ##STR00093##
C.sub.15H.sub.12N.sub.2O.sub.5 300.27 MC4-66 ##STR00094##
C.sub.14H.sub.9N.sub.3O.sub.3 267.24 MC4-67 ##STR00095##
C.sub.13H.sub.12N.sub.2O.sub.4 260.25 MC4-68 ##STR00096##
C.sub.14H.sub.14N.sub.2O.sub.3 258.28 MC4-69 ##STR00097##
C.sub.15H.sub.10N.sub.2O.sub.2 250.26 MC4-70 ##STR00098##
C.sub.15H.sub.9BrN.sub.2O.sub.3 345.15 MC4-71 ##STR00099##
C.sub.15H.sub.13NO 223.28 MC4-72 ##STR00100##
C.sub.13H.sub.11ClN.sub.2O.sub.3 278.69 MC4-73 ##STR00101##
C.sub.19H.sub.14N.sub.2O.sub.3 318.33 MC4-74 ##STR00102##
C.sub.15H.sub.9Cl.sub.2NO 290.14 MC4-75 ##STR00103##
C.sub.15H.sub.10N.sub.2O.sub.3 266.26 MC4-76 ##STR00104##
C.sub.15H.sub.10N.sub.2O.sub.3 266.26 MC4-77 ##STR00105##
C.sub.15H.sub.14N.sub.2O.sub.5 302.29 MC4-78 ##STR00106##
C.sub.14H.sub.11N.sub.3O.sub.3 269.26 MC4-79 ##STR00107##
C.sub.13H.sub.12N.sub.2O.sub.4 260.25 MC4-80 ##STR00108##
C.sub.15H.sub.10N.sub.2O.sub.4 282.26 MC4-81 ##STR00109##
C.sub.14H.sub.14N.sub.2O.sub.4 274.28 MC4-82 ##STR00110##
C.sub.14H.sub.12N.sub.2O.sub.4 272.26 MC4-83 ##STR00111##
C.sub.17H.sub.18N.sub.2O.sub.3 298.34 MC4-84 ##STR00112##
C.sub.17H.sub.20N.sub.2O.sub.3 300.36 MC4-85 ##STR00113##
C.sub.15H.sub.12N.sub.2O.sub.5 300.27 MC4-86 ##STR00114##
C.sub.15H.sub.11BrN.sub.2O.sub.3 347.17 MC4-87 ##STR00115##
C.sub.14H.sub.9N.sub.3O.sub.3 267.24 MC4-88 ##STR00116##
C.sub.19H.sub.16N.sub.2O.sub.3 320.35 MC4-89 ##STR00117##
C.sub.17H.sub.20N.sub.2O.sub.3 300.36 MC4-90 ##STR00118##
C.sub.15H.sub.10N.sub.2O.sub.3 266.26 MC4-91 ##STR00119##
C.sub.14H.sub.14N.sub.2O.sub.4 274.28 MC4-92 ##STR00120##
C.sub.15H.sub.11Cl.sub.2NO 292.16 MC4-93 ##STR00121##
C.sub.15H.sub.12N.sub.2O.sub.3 268.27 MC4-94 ##STR00122##
C.sub.15H.sub.12N.sub.2O.sub.2 252.27 MC4-95 ##STR00123##
C.sub.15H.sub.14N.sub.2O.sub.5 302.29 MC4-96 ##STR00124##
C.sub.14H.sub.13NO.sub.2 227.26 MC4-97 ##STR00125##
C.sub.13H.sub.9NO.sub.4 243.22 MC4-98 ##STR00126##
C.sub.14H.sub.12N.sub.2O.sub.3 256.26 MC4-99 ##STR00127##
C.sub.14H.sub.11NO.sub.3 241.25 MC4-100 ##STR00128##
C.sub.14H.sub.11N.sub.3O.sub.3 269.26 MC4-101 ##STR00129##
C.sub.17H.sub.17BrN.sub.2O.sub.3 377.24 MC4-102 ##STR00130##
C.sub.17H.sub.17C.sub.12NO 322.23 MC4-103 ##STR00131##
C.sub.17H.sub.19BrN.sub.2O.sub.3 379.25 MC4-104 ##STR00132##
C.sub.17H.sub.19Cl.sub.2NO 324.25 MC4-105 ##STR00133##
C.sub.14H.sub.9F.sub.3N.sub.2O.sub.3 310.23 MC4-106 ##STR00134##
C.sub.14H.sub.9F.sub.3N.sub.2O.sub.3 310.23 MC4-107 ##STR00135##
C.sub.14H.sub.11F.sub.3N.sub.2O.sub.3 312.25 MC4-108 ##STR00136##
C.sub.14H.sub.11F.sub.3N.sub.2O.sub.3 312.25 MC4-109 ##STR00137##
C.sub.14H.sub.9F.sub.3N.sub.2O.sub.3 310.23 MC4-110 ##STR00138##
C.sub.13H.sub.9FN.sub.2O.sub.3 260.22 MC4-111 ##STR00139##
C.sub.13H.sub.9FN.sub.2O.sub.3 260.22 MC4-112 ##STR00140##
C.sub.13H.sub.11FN.sub.2O.sub.3 262.24 MC4-113 ##STR00141##
C.sub.13H.sub.11FN.sub.2O.sub.3 262.24 MC4-114 ##STR00142##
C.sub.13H.sub.9FN.sub.2O.sub.3 260.22 MC4-115 ##STR00143##
C.sub.13H.sub.11FN.sub.2O.sub.3 262.24 MC4-116 ##STR00144##
C.sub.14H.sub.11F.sub.3N.sub.2O.sub.3 312.25 MC4-117 ##STR00145##
C.sub.17H.sub.12N.sub.2O.sub.3 292.29 MC4-118 ##STR00146##
C.sub.13H.sub.16N.sub.2O.sub.3 248.28 MC4-119 ##STR00147##
C.sub.17H.sub.14N.sub.2O.sub.3 294.31 MC4-120 ##STR00148##
C.sub.13H.sub.18N.sub.2O.sub.3 250.30 MC4-121 ##STR00149##
C.sub.19H.sub.14N.sub.2O.sub.3 318.33 MC4-122 ##STR00150##
C.sub.19H.sub.14N.sub.2O.sub.3 318.33 MC4-123 ##STR00151##
C.sub.19H.sub.16N.sub.2O.sub.3 320.35 MC4-124 ##STR00152##
C.sub.19H.sub.16N.sub.2O.sub.3 320.35 MC4-125 ##STR00153##
C.sub.13H.sub.9ClN.sub.2O.sub.3 276.68 MC4-126 ##STR00154##
C.sub.13H.sub.10N.sub.2O.sub.4 258.23 MC4-127 ##STR00155##
C.sub.13H.sub.11ClN.sub.2O.sub.3 278.69 MC4-128 ##STR00156##
C.sub.15H.sub.10N.sub.2O.sub.3 266.26 MC4-129 ##STR00157##
C.sub.16H.sub.12N.sub.2O.sub.3 280.28 MC4-131 ##STR00158##
C.sub.15H.sub.10N.sub.2O.sub.3 266.26 MC4-132 ##STR00159##
C.sub.16H.sub.14N.sub.2O.sub.3 282.30
MC4-133 ##STR00160## C.sub.15H.sub.12N.sub.2O.sub.3 268.27 MC4-134
##STR00161## C.sub.14H.sub.10ClNO.sub.3 275.69 MC4-135 ##STR00162##
C.sub.14H.sub.10ClNO.sub.3 275.69 MC4-136 ##STR00163##
C.sub.16H.sub.10N.sub.2O 246.27 MC4-137 ##STR00164##
C.sub.15H.sub.13NO.sub.4 271.27 MC4-138 ##STR00165##
C.sub.16H.sub.12N.sub.2O 248.29 MC4-139 ##STR00166##
C.sub.16H.sub.13NO.sub.5 299.28 MC4-140 ##STR00167##
C.sub.15H.sub.13NO.sub.4 271.27 MC4-141 ##STR00168##
C.sub.16H.sub.13NO.sub.5 299.28 MC4-142 ##STR00169##
C.sub.15H.sub.10N.sub.2O.sub.3 266.26
REFERENCES
[0108] (1)(a) Jean, S. S., and Hsueh, P. R. (2011) Int. J.
Antimicrob. Agents 37, 291-295. (b) Frieden, T. R. (2013) N. Engl.
J. Med. 368, 1857-1859. [0109] (2) Chambers, H. F., and Deleo, F.
R. (2009) Nat. Rev. Microbiol. 7, 629-641. [0110] (3) (a) Gardete,
S., and Tomasz, A. (2014) J. Clin. Invest. 124, 2836-2840. (b)
Nannini, E., Murray, B. E., and Arias, C. A. (2010) Curr. Opin.
Pharmacol. 10, 516-521. [0111] (4) Jin, D. J., Cagliero, C., and
Zhou, Y N. (2012) FEMS MicrobioLRev. 36, 269-287. [0112] (5)
Viktorovskaya, V., and Schneider, D. A. (2015) Gene 556, 19-26.
[0113] (6) Santangelo, T. J., and Artsimovitch, 1. (2011) Nat. Rev.
Microbiol. 9, 319-329. [0114] (7) Richardson, J. P., and
Greenblatt, J. (1996) in Escherichia coli and Salmonella: Cellular
and molecular biology, 2nd ed., pp 822-848, American Society for
Microbiology, Washington, DC. [0115] (8) Greive, S. J., Lins, A.
F., and von Hippel, P. H. (2005) J. Biol. Chem. 280, 36397-36408.
[0116] (9) (a) Nodwell, J. R., and Greenblatt, J. (1993) Cell 72,
261-268. (b) Burmann, B. M., Luo, X., Rosch, P., Wahl, M. C., and
Gottesman, M. E. (2010) Nucleic Acids Res. 38, 314-326. [0117] (10)
Werner, F., and Grohmann, D. (2011) Nat. Rev. Microbiol. 9, 85-98.
[0118] (11) (a) Kato, J., and Hashimoto, M. (2007) Mol. Syst. Biol.
3, 132. (b) Bubunenko, M., Baker, T., and Court, D. L. (2007) J.
Bacteriol. 189, 2844-2853. [0119] (12) (a) Ma, C., Yang, X.,
Kandemir, H., Mielczarek, M., Johnston, E. B., Griffith, R., Kumar,
N., and Lewis, P. J. (2013) ACS Chem. Biol. 8, 1972-1980. (b) Ma,
C., Yang, X., and Lewis, P. J. (2016) ACS Infect. Dis. 2, 39-46.
[0120] (13) Vassylyev, D. G., Vassylyeva, M. N., Perederina, A.,
Tahirov, T. H., and Artsimovitch, I. (2007) Nature 448, 157-162.
[0121] (14) Liu, B., and Steitz, T. A. (2017) Nucleic Acids Res.
45, 968-974. [0122] (15) Burmann, B. M., Schweimer, K., Luo, X.,
Wahl, M. C., Stitt, B. L., Gottesman. M. E., and Rosch, P. (2010)
Science 328, 501-504. [0123] (16) Yang, X., Molimau, S., Doherty,
G. P., Johnston, E. B., Marles-Wright, J., Rothnagel, R.,
Hankarner, B., Lewis, R. J., and Lewis, P. J. (2009) EMBO Rep. 10,
997-1002. [0124] (17) (a) Beuth, B., Pennell, S., Arnvig, K. B.,
Martin, S. R., and Taylor, I. A. (2005) EMBO J. 24, 3576-3587. (b)
Prasch, S., Jurk, M., Washburn, R. S., Gottesman, M. E., W{hacek
over (o)}hrl, B. M, and R sch, P. (2009) Nucleic Acids Res. 37,
4736-4742. [0125] (18) (a) Bubunenko, M., Court, D. L., Al Refaii,
A., Saxena, S., Korepanov, A., Friedman, D. I., Gottesman, M. E.,
and Alix, J. H. (2013) Mol. Microbiol. 87, 382-393. (b) Wong, T.,
Sosnick, T. R., and Pan, T. (2005) Biochemistry 44, 7535-7542.
[0126] (19) Anderson, A. C. (2003) Chem. Biol. 10, 787-797. [0127]
(20) Said, N., Krupp, F., Anedchenko, E., Santos, K. F., Dybkov,
O., Huang, Y. H., Lee, C. T., Loll, B., Behrmann, E., Bnrger, J.,
Mielke, T, Loerke, J., Urlaub, H., Spahn, C. M. T, Weber, G., and
Wahl, M. C. (2017) Nat. Microbiol. 2, 17062. [0128] (21) Das, R.,
Loss, S., Li, J., Waugh, D. S., Tarasov, S. Wingfield, P. T., Byrd,
R. A., and ltieri, A. S. (2008) J. Mol. Bi ol. 376, 705-720. [0129]
(22) Luo, X., Hsiao, H. H., Bubunenko, M., Weber, G., Court, D. L.,
Gottesman, M. E., Urlaub, H., and Wahl, M. C. (2008) Mol. Cell
31791-802. [0130] (23) Stagno, J. R., Altieri, A. S., Bubunenko,
M., Tarasov, S. G., Li, J., Court, D. L., Byrd, R. A., and Ji, X.
(2011) Nucleic Acids Res. 39, 7803-7815. [0131] (24) Yang, X., Ma,
C., and Lewis, P. J. (2015) Methods 86, 45-50. [0132] (25)
Lipinski, C. A., Lombardo, F., Dominy B. W., and Feeney, P. J.
(2001) Adv. Drug Delivery Rev. 46, 3-26. [0133] (26) (a) Luecke,
L., Weiss A., Graciet, J.-C., Steffanut, P., Klein, C., and Winter,
M. A. (2008) Eur. Pat. Appl. EP 1930378. (b) Luecke, L., Weiss A.,
Graciet, J.-C., Steffanut, P., Klein, C., and Winter, M. A. (2008)
Fur. Pat. Appl. EP 1925643. [0134] (27) (a) Cangelosi, G. A., and
Brabant, W. H. (1997) J. Bacteriol. 179, 4457-4463. (b) Halford,
C., Gonzalez, R., Campuzano, S., Hu. B., Babbitt, J. T., Liu, J.,
Wang, J., Churchill, B. M., and Haake, D. A. (2013) Antirnicrob.
Agents Chemother. 57, 936-943. [0135] (28) O'Neil, J. (2014)
Antimicrobial resistance: Tackling a crisis for the health and
wealth of nations, Wellcome Trust and HM Government, London. [0136]
(29) Chellat, M. F., Ragu , L., and Riedl, R. (2016) Angew. Chem.,
Int. Ed. 55, 6600-6626. [0137] (30) Goralski, T. D., Dewan, K. K.,
Alumasa, J. N., Avanzato, V. Place, D. E., Markley, R. L., Katkere,
B., Rabadi, S. M., Bakshi, C. S., Keiler, K. C., and
Kirirnanjeswara, G. S. (2016) Antimicrob. Agents Chemother. 60,
3276-3282. [0138] (31) Brighenti, E., Trere, D., and Derenzini, M.
(2015) Oncotarget 6, 38617-38627. [0139] (32) Ma, C., Yang, X., and
Lewis, P. J. (2016) Microbiol. Mol. Biol. Rev. 80, 139-160. [0140]
(33) Studier, F. W.; Moffatt, B A. (1986). Mol. Biol. 189, 113-130.
[0141] (34) Vassylyev, D. G.; Vassylyeva, M. N.; Perederina. A.;
Tahirov, T. H.: Artsimovitch, I. (2007) Nature 448, 157-162. [0142]
(35) Liu, B.; Steitz, T. A. (2017)Nucleic Acids Res. 45, 968-974.
[0143] (36) Stagno, J. R.; Altieri, A. S.; Bubunenko, M.; Tarasov,
S. G.; Li, J.; Court, D. L.; Byrd R. A.; Ji, X. (2011) Nucleic
Acids Res. 39, 7803-7815. [0144] (37) Beuth, B.; Pennell, S.;
Arnvig, K. B.; Martin S. R.; Taylor, I. A. (2005) EMBO J. 24,
3576-3587. [0145] (38) Burmann, B. M.; Schweimer, K.; Luo, X.;
Wahl, M. C.; Stitt, B. L.; Gottesman. M. E. Rosch, P. (2010)
Science 328, 501-504. [0146] (39) Ma, C.; Mobli, M.; Yang, X.;
Keller, A. N.; King G. F.; Lewis, P. J. (2015) Nucleic Acids Res.
43, 2829-2840. [0147] (40) Pettersen, E. F.; Goddard, T. D.; Huang,
C. C.; Couch, G. S.; Greenblatt, D. M.; Meng E. C.; Ferrin, T E.
(2004) J. Comput. Chem. 25, 1605-1612. [0148] (41) Yang, X.; Ma C.;
Lewis, P. J. (2015) Methods 86, 45-50. [0149] (42) CLSI, Clinical
and Laboratory Standards Institute. (2015) Performance Standards
for Antimicrobial Susceptibility Testing, Twenty-Fifth
Informational Supplement (M100S25). [0150] (43) Bi, Y; Yang, X.;
Zhang, T.; Lii, Z.; Zhang, X.; Lu, J.; Cheng, K. Xu, J.; Wang, H.;
Lv, G.; Lewis, P. J.; Meng Q.; Ma, C. (2015) Eur J Med Chem. 101,
71-80 [0151] (44) Heckman K. L.; Pease, L. R. (2007) Nat. Protoc.
2, 924-932. [0152] (45) Ma, C.; Yang, X.; Lewis, P. J. (2016)ACS
Infect. Dis. 2, 39-46. [0153] (46) Neylon, C.; Brown, S. E.;
Kralicek, A. V.; Miles, C. S.: Love, C. A.; Dixon, N. E. (2000)
Biochemistry 39, 11989-11999. [0154] (47) Ma, C.; Yang, X.;
Kandemir, H.; Mielczarek, M.; Johnston, E. B.; Griffith, R.; Kumar,
N.; Lewis, P. J. (2013) ACS Chem. Biol. 8, 1972-1980.
Sequence CWU 1
1
10126DNAArtificial SequencePrimer for B. subtilis nusB 1aaaggagatc
tagacatgaa agaaga 26223DNAArtificial SequencePrimer for B. subtilis
nusB 2ttttctggta ccctatgatt ccc 23329DNAArtificial SequencePrimer
for nusB mutants 3ctttgcaggc actagctcaa attgatgtc
29429DNAArtificial SequencePrimer for nusB mutants 4gacatcaatt
tgagctagtg cctgcaaag 29529DNAArtificial SequencePrimer for nusB
mutants 5gaattggaag ctcgatgcga ttgccaatg 29629DNAArtificial
SequencePrimer for nusB mutants 6cattggcaat cgcatcgagc ttccaattc
29729DNAArtificial SequencePrimer for nusB mutants 7gattgccaat
gttgcccgtg cgattttgc 29829DNAArtificial SequencePrimer for nusB
mutants 8gcaaaatcgc acgggcaaca ttggcaatc 29924DNAArtificial
SequencePrimer for B. subtilis nusE 9aaggagggtc tagaatggca aaac
241027DNAArtificial SequencePrimer for B. subtilis nusE
10ctatatttta ggtaccaagt ttaattt 27
* * * * *