U.S. patent application number 17/324253 was filed with the patent office on 2021-09-09 for safe sequencing system.
The applicant listed for this patent is The Johns Hopkins University. Invention is credited to Isaac A. Kinde, Kenneth W. Kinzler, Nickolas Papadopoulos, Bert Vogelstein.
Application Number | 20210277467 17/324253 |
Document ID | / |
Family ID | 1000005594916 |
Filed Date | 2021-09-09 |
United States Patent
Application |
20210277467 |
Kind Code |
A1 |
Vogelstein; Bert ; et
al. |
September 9, 2021 |
SAFE SEQUENCING SYSTEM
Abstract
The identification of mutations that are present in a small
fraction of DNA templates is essential for progress in several
areas of biomedical research. Though massively parallel sequencing
instruments are in principle well-suited to this task, the error
rates in such instruments are generally too high to allow confident
identification of rare variants. We here describe an approach that
can substantially increase the sensitivity of massively parallel
sequencing instruments for this purpose. One example of this
approach, called "Safe-SeqS" for (Safe-Sequencing System) includes
(i) assignment of a unique identifier (UID) to each template
molecule; (ii) amplification of each uniquely tagged template
molecule to create UID-families; and (iii) redundant sequencing of
the amplification products. PCR fragments with the same UID are
truly mutant ("super-mutants") if .gtoreq.95% of them contain the
identical mutation. We illustrate the utility of this approach for
determining the fidelity of a polymerase, the accuracy of
oligonucleotides synthesized in vitro, and the prevalence of
mutations in the nuclear and mitochondrial genomes of normal
cells.
Inventors: |
Vogelstein; Bert;
(Baltimore, MD) ; Kinzler; Kenneth W.; (Baltimore,
MD) ; Papadopoulos; Nickolas; (Towson, MD) ;
Kinde; Isaac A.; (Beaumont, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Johns Hopkins University |
Baltimore |
MD |
US |
|
|
Family ID: |
1000005594916 |
Appl. No.: |
17/324253 |
Filed: |
May 19, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16417817 |
May 21, 2019 |
|
|
|
17324253 |
|
|
|
|
15090773 |
Apr 5, 2016 |
|
|
|
16417817 |
|
|
|
|
14814030 |
Jul 30, 2015 |
9487829 |
|
|
15090773 |
|
|
|
|
14111715 |
Apr 29, 2014 |
9476095 |
|
|
PCT/US2012/033207 |
Apr 12, 2012 |
|
|
|
14814030 |
|
|
|
|
61484482 |
May 10, 2011 |
|
|
|
61476150 |
Apr 15, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2525/191 20130101;
C12Q 1/6874 20130101; C12Q 1/6869 20130101; C12Q 1/6806 20130101;
C12Q 2600/158 20130101; C12Q 2525/179 20130101; C12Q 2563/179
20130101; C12Q 1/6876 20130101 |
International
Class: |
C12Q 1/6874 20060101
C12Q001/6874; C12Q 1/6869 20060101 C12Q001/6869; C12Q 1/6876
20060101 C12Q001/6876; C12Q 1/6806 20060101 C12Q001/6806 |
Goverment Interests
GOVERNMENT SUPPORT CLAUSE
[0002] This invention was made with government support under grant
number CA062924, CA057345, CA043460, HHSN261004433009C awarded by
the National Institutes of Health. The government has certain
rights in the invention.
Claims
1. (canceled)
2. A method for identifying a mutation in both strands of a double
stranded DNA analyte molecule comprising: a) attaching a unique
identifier nucleic acid sequence (UID) to a first end of each
strand of a double stranded DNA analyte molecule to form two
uniquely identified analyte single-stranded DNA fragments; b)
amplifying both uniquely identified analyte single stranded DNA
fragments to form two UID families each comprising a plurality of
members; c) redundantly sequencing said plurality of members from
each of said two UID families, wherein said redundantly sequencing
comprises generating sequencing reads from each of said plurality
of members in each of said two UID families; d) grouping said
sequencing reads from each of said two UID families based on their
UIDs; and e) identifying a mutation in both strands of said double
stranded DNA analyte molecule when greater than 95% of said
sequencing reads from both of said two UID families share an
identical mutation.
3. The method of claim 2, wherein said nucleotide sequencing reads
are at least 31 bases in length.
4. The method of claim 2, wherein said nucleotide sequencing reads
are at least 73 bases in length.
5. The method of claim 2, wherein said nucleotide sequencing reads
are between 36 and 73 bases in length.
6. The method of claim 2, wherein said at least 95% is at least
97%.
7. The method of claim 2, wherein said plurality of members in each
of said two UID families comprises at least 5 members.
8. The method of claim 2, wherein said plurality of members in each
of said two UID families comprises at least 10 members.
9. The method of claim 2, wherein said attaching is performed by
ligation.
10. The method of claim 2, wherein said attaching is performed by
polymerase chain reaction.
11. The method of claim 2, wherein prior to said amplifying, the
double stranded DNA analyte molecule is treated with bisulfite to
convert unmethylated cytosine bases to uracil.
Description
CLAIM OF PRIORITY
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/417,817, filed on May 21, 2019, which is a
continuation of U.S. patent application Ser. No. 15/090,773, filed
on Apr. 5, 2016, which is a divisional application of Ser. No.
14/814,030 filed Jul. 30, 2015, which is a divisional of Ser. No.
14/111,715 filed Apr. 29, 2014, which is a 371 International
Application of PCT/US2012/033207 filed Apr. 12, 2012, which claims
priority to U.S. Provisional Application No. 61/484,482 filed May
10, 2011 and U.S. Provisional Application No. 61/476,150 filed on
Apr. 15, 2011, the entire contents of each of which are hereby
incorporated by reference.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on May 18, 2021, is named "44807-0017007_Sequence-Listing" and is
16,384 bytes in size.
TECHNICAL FIELD OF THE INVENTION
[0004] This invention is related to the area of nucleic acid
sequencing. In particular, it relates to manipulative and analytic
steps for analyzing and verifying the products of low frequency
events.
BACKGROUND OF THE INVENTION
[0005] Genetic mutations underlie many aspects of life and
death--through evolution and disease, respectively. Accordingly,
their measurement is critical to several fields of research. Luria
and Delbruck's classic fluctuation analysis is a prototypic example
of the insights into biological processes that can be gained simply
by counting the number of mutations in carefully controlled
experiments (1). Counting de novo mutations in humans, not present
in their parents, have similarly led to new insights into the rate
at which our species can evolve (2, 3). Similarly, counting genetic
or epigenetic changes in tumors can inform fundamental issues in
cancer biology (4). Mutations lie at the core of current problems
in managing patients with viral diseases such as AIDS and hepatitis
by virtue of the drug-resistance they can cause (5, 6). Detection
of such mutations, particularly at a stage prior to their becoming
dominant in the population, will likely be essential to optimize
therapy. Detection of donor DNA in the blood of organ transplant
patients is an important indicator of graft rejection and detection
of fetal DNA in maternal plasma can be used for prenatal diagnosis
in a non-invasive fashion (7, 8). In neoplastic diseases, which are
all driven by somatic mutations, the applications of rare mutant
detection are manifold; they can be used to help identify residual
disease at surgical margins or in lymph nodes, to follow the course
of therapy when assessed in plasma, and perhaps to identify
patients with early, surgically curable disease when evaluated in
stool, sputum, plasma, and other bodily fluids (9-11).
[0006] These examples highlight the importance of identifying rare
mutations for both basic and clinical research. Accordingly,
innovative ways to assess them have been devised over the years.
The first methods involved biologic assays based on prototrophy,
resistance to viral infection or drugs, or biochemical assays (1,
12-18). Molecular cloning and sequencing provided a new dimension
to the field, as it allowed the type of mutation, rather than
simply its presence, to be identified (19-24). Some of the most
powerful of these newer methods are based on Digital PCR, in which
individual molecules are assessed one-by-one (25). Digital PCR is
conceptually identical to the analysis of individual clones of
bacteria, cells, or virus, but is performed entirely in vitro with
defined, inanimate reagents. Several implementations of Digital PCR
have been described, including the analysis of molecules arrayed in
multi-well plates, in polonies, in microfluidic devices, and in
water-in-oil emulsions (25-30). In each of these technologies,
mutant templates are identified through their binding to
oligonucleotides specific for the potentially mutant base.
[0007] Massively parallel sequencing represents a particularly
powerful form of Digital PCR in that hundreds of millions of
template molecules can be analyzed one-by-one. It has the advantage
over conventional Digital PCR methods in that multiple bases can be
queried sequentially and easily in an automated fashion. However,
massively parallel sequencing cannot generally be used to detect
rare variants because of the high error rate associated with the
sequencing process. For example, with the commonly used Illumina
sequencing instruments, this error rate varies from .about.1%(31,
32) to .about.0.05% (33, 34), depending on factors such as the read
length (35), use of improved base calling algorithms (36-38) and
the type of variants detected (39). Some of these errors presumably
result from mutations introduced during template preparation,
during the pre-amplification steps required for library preparation
and during further solid-phase amplification on the instrument
itself. Other errors are due to base mis-incorporation during
sequencing and base-calling errors. Advances in base-calling can
enhance confidence (e.g., (36-39)), but instrument-based errors are
still limiting, particularly in clinical samples wherein the
mutation prevalence can be 0.01% or less (11). In the work
described below, we show how templates can be prepared and the
sequencing data obtained from them can be more reliably
interpreted, so that relatively rare mutations can be identified
with commercially available instruments.
[0008] There is a continuing need in the art to improve the
sensitivity and accuracy of sequence determinations for
investigative, clinical, forensic, and genealogical purposes.
SUMMARY OF THE INVENTION
[0009] According to one aspect of the invention a method analyzes
nucleic acid sequences. A unique identifier (UID) nucleic acid
sequence is attached to a first end of each of a plurality of
analyte nucleic acid fragments to form uniquely identified analyte
nucleic acid fragments. Nucleotide sequence of a uniquely
identified analyte nucleic acid fragment is redundantly determined,
wherein determined nucleotide sequences which share a UID form a
family of members. A nucleotide sequence is identified as
accurately representing an analyte nucleic acid fragment when at
least 1% of members of the family contain the sequence.
[0010] According to another aspect of the invention a method
analyzes nucleic acid sequences. A unique identifier sequence (UID)
is attached to a first end of each of a plurality of analyte DNA
fragments using at least two cycles of amplification with first and
second primers to form uniquely identified analyte DNA fragments.
The UIDs are in excess of the analyte DNA fragments during
amplification. The first primers comprise a first segment
complementary to a desired amplicon; a second segment containing
the UID; and a third segment containing a universal priming site
for subsequent amplification. The second primers comprise a
universal priming site for subsequent amplification. Each cycle of
amplification attaches one universal priming site to a strand. The
uniquely identified analyte DNA fragments are amplified to form a
family of uniquely identified analyte DNA fragments from each
uniquely identified analyte DNA fragment. Nucleotide sequences of a
plurality of members of the family are determined.
[0011] Another aspect of the invention is a method to analyze DNA
using endogenous unique identifier sequences (UIDs). Fragmented
analyte DNA is obtained comprising fragments of 30 to 2000 bases,
inclusive. Each end of a fragment forms an endogenous UID for the
fragment. Adapter oligonucleotides are attached to ends of the
fragments to form adapted fragments. Fragments representing one or
more selected genes are optionally enriched by means of capturing a
subset of the fragments using capture oligonucleotides
complementary to selected genes in the analyte DNA or by amplifying
fragments complementary to selected genes. The adapted fragments
are amplified using primers complementary to the adapter
oligonucleotides to form families of adapted fragments. Nucleotide
sequence is determined of a plurality of members of a family.
Nucleotide sequences of the plurality of members of the family are
compared. A nucleotide sequence is identified as accurately
representing an analyte DNA fragment when at least a 1% of members
of the family contain the sequence.
[0012] Still another aspect of the invention is a composition
comprising population of primer pairs, wherein each pair comprises
a first and second primer for amplifying and identifying a gene or
gene portion. The first primer comprises a first portion of
10.sup.-100 nucleotides complementary to the gene or gene portion
and a second portion of 10 to 100 nucleotides comprising a site for
hybridization to a third primer. The second primer comprises a
first portion of 10.sup.-100 nucleotides complementary to the gene
or gene portion and a second portion of 10 to 100 nucleotides
comprising a site for hybridization to a fourth primer. Interposed
between the first portion and the second portion of the second
primer is a third portion consisting of 2 to 4000 nucleotides
forming a unique identifier (UID). The unique identifiers in the
population have at least 4 different sequences. The first and
second primers are complementary to opposite strands of the gene or
gene portion. A kit may comprise the population of primers and the
third and fourth primers complementary to the second portions of
each of the first and second primers.
[0013] These and other embodiments which will be apparent to those
of skill in the art upon reading the specification provide the art
with tools and methods for sensitively and accurately determining
nucleic acid features or sequences.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1. Essential Elements of Safe-SeqS. In the first step,
each fragment to be analyzed is assigned a unique identification
(UID) sequence (metal hatch or stippled bars). In the second step,
the uniquely tagged fragments are amplified, producing
UID-families, each member of which has the same UID. A super-mutant
is defined as a UID-family in which .gtoreq.95% of family members
have the same mutation.
[0015] FIG. 2. Safe-SeqS with Endogenous UIDs Plus Capture. The
sequences of the ends of each fragment produced by random shearing
(variously shaded bars) serve as the unique identifiers (UIDs).
These fragments are ligated to adapters (earth hatched and cross
hatched bars) so they can subsequently be amplified by PCR. One
uniquely identifiable fragment is produced from each strand of the
double-stranded template; only one strand is shown. Fragments of
interest are captured on a solid phase containing oligonucleotides
complementary to the sequences of interest. Following PCR
amplification to produce UID-families with primers containing 5'
"grafting" sequences (adhesive filled and light stippled bars),
sequencing is performed and super-mutants are defined as in FIG.
1.
[0016] FIG. 3. Safe-SeqS with Exogenous UIDs. DNA (sheared or
unsheared) is amplified with a set of gene-specific primers. One of
the primers has a random DNA sequence (e.g., a set of 14 N's) that
forms the unique identifier (UID; variously shaded bars), located
5' to its gene-specific sequence, and both have sequences that
permit universal amplification in the next step (earth hatched and
cross hatched bars). Two UID assignment cycles produce two
fragments--each with a different UID--from each double-stranded
template molecule, as shown. Subsequent PCR with universal primers,
which also contain "grafting" sequences (adhesive filled and light
stippled bars), produces UID-families which are directly sequenced.
Super-mutants are defined as in the legend to FIG. 1.
[0017] FIGS. 4A-4B. Single Base Substitutions Identified by
Conventional and Safe-SeqS Analysis. The exogenous UID strategy
depicted in FIG. 3 was used to produce PCR fragments from the
CTNNB1 gene of three normal, unrelated individuals. Each position
represents one of 87 possible single base substitutions (3 possible
substitutions/base.times.29 bases analyzed). These fragments were
sequenced on an Illumina GA Ix instrument and analyzed in the
conventional manner (FIG. 4A) or with Safe-SeqS (FIG. 4B).
Safe-SeqS results are displayed on the same scale as conventional
analysis for direct comparison; the inset is a magnified view. Note
that most of the variants identified by conventional analysis are
likely to represent sequencing errors, as indicated by their high
frequency relative to Safe-SeqS and their consistency among
unrelated samples.
[0018] FIG. 5. Safe-SeqS with endogenous UIDs plus inverse PCR. The
sequence of the ends of each fragment produced by random shearing
serve as unique identifiers (UIDs; variously shaded bars). These
fragments are ligated to adapters (earth hatched and cross hatched
bars) as in a standard Illumina library preparation. One uniquely
tagged fragment is produced from each strand of the double-stranded
template; only one strand is shown. Following circularization with
a ligase, inverse PCR is performed with gene-specific primers that
also contain 5' "grafting" sequences (adhesive filled and lightly
stippled bars). This PCR produces UID-families which are directly
sequenced. Super-mutants are defined as in FIG. 1.
[0019] FIG. 6A-6B. Single base substitutions position vs. error
frequency in oligonucleotides synthesized with phosphoramidites and
Phusion. A representative portion of the same 31-base DNA fragment
synthesized with phosphoramidites (FIG. 6A) or Phusion polymerase
(FIG. 6B) was analyzed by Safe-SeqS. The means and standard
deviations for seven independent experiments of each type are
plotted. There was an average of 1,721.+-.383 and 196.+-.143 SBS
super-mutants identified in the phosphoramidite-synthesized and
Phusion-generated fragments, respectively. The y-axis indicates the
fraction of the total errors at the indicated position. Note that
the errors in the phosphoramidite-synthesized DNA fragment were
consistent among the seven replicates, as would be expected if the
errors were systematically introduced during the synthesis itself.
In contrast, the errors in the Phusion-generated fragments appeared
to be heterogeneous among samples, as expected from a stochastic
process (Luria and Delbruck, Genetics 28: 491-511, 1943).
[0020] FIG. 7. UID-family member distribution. The exogenous UID
strategy depicted in FIG. 3 was used to produce PCR fragments from
a region of CTNNB1 from three normal, unrelated individuals (Table
2B); a representative example of the UID-families with .ltoreq.300
members (99% of total UID-families) generated from one individual
is shown. The y-axis indicates the number of different UID-families
that contained the number of family members shown on the
x-axis.
DETAILED DESCRIPTION OF THE INVENTION
[0021] The inventors have developed an approach, called "Safe-SeqS"
(from Safe-Sequencing System). In one embodiment it involves two
basic steps (FIG. 1). The first is the assignment of a Unique
Identifier (UID) to each nucleic acid template molecule to be
analyzed. The second is the amplification of each uniquely tagged
template, so that many daughter molecules with the identical
sequence are generated (defined as a UID-family). If a mutation
pre-existed in the template molecule used for amplification, that
mutation should be present in a certain proportion, or even all, of
daughter molecules containing that UID (barring any subsequent
replication or sequencing errors). A UID-family in which every
family member (or a certain predetermined proportion) has an
identical mutation is called a "super-mutant." Mutations not
occurring in the original templates, such as those occurring during
the amplification steps or through errors in base-calling, should
not give rise to super-mutants, i.e., will not be present at the
pre-determined frequency in a UID family. In other embodiments,
amplification is not necessary.
[0022] The approach can be employed for any purpose where a very
high level of accuracy and sensitivity is required from sequence
data. As shown below, the approach can be used to assess the
fidelity of a polymerase, the accuracy of in vitro synthesized
nucleic acid synthesis, and the prevalence of mutations in nuclear
or mitochondrial nucleic acids of normal cells. The approach may be
used to detect and/or quantify mosaicsm and somatic mutations.
Fragments of nucleic acids may be obtained using a random fragment
forming technique such as mechanical shearing, sonicating, or
subjecting nucleic acids to other physical or chemical stresses.
Fragments may not be strictly random, as some sites may be more
susceptible to stresses than others. Endonucleases that randomly or
specifically fragment may also be used to generate fragments. Size
of fragments may vary, but desirably will be in ranges between 30
and 5,000 basepairs, between 100 and 2,000, between 150 and 1,000,
or within ranges with different combinations of these endpoints.
Nucleic acids may be, for example, RNA or DNA. Modified forms of
RNA or DNA may also be used.
[0023] Attachment of an exogenous UID to an analyte nucleic acids
fragment may be performed by any means known in the art, including
enzymatic, chemical, or biologic. One means employs a polymerase
chain reaction. Another means employs a ligase enzyme. The enzyme
may be mammalian or bacterial, for example. Ends of fragments may
be repaired prior to joining using other enzymes such as Klenow
Fragment of T4 DNA Polymerase. Other enzymes which may be used for
attaching are other polymerase enzymes. An UID may be added to one
or both ends of the fragments. A UID may be contained within a
nucleic acid molecule that contains other regions for other
intended functionality. For example, a universal priming site may
be added to permit later amplification. Another additional site may
be a region of complementarity to a particular region or gene in
the analyte nucleic acids. A UID may be from 2 to 4,000, from 100
to 1000, from 4 to 400, bases in length, for example.
[0024] UIDs may be made using random addition of nucleotides to
form a short sequence to be used as an identifier. At each position
of addition, a selection from one of four deoxyribonucleotides may
be used. Alternatively a selection from one of three, two, or one
deoxyribonucleotides may be used. Thus the UID may be fully random,
somewhat random, or non-random in certain positions. Another manner
of making UIDs utilizes pre-determined nucleotides assembled on a
chip. In this manner of making, complexity is attained in a planned
manner. It may be advantageous to attach a UID to each end of a
fragment, increasing the complexity of the UID population on
fragments.
[0025] A cycle of polymerase chain reaction for adding exogenous
UID refers to the thermal denaturation of a double stranded
molecule, the hybridization of a first primer to a resulting single
strand, the extension of the primer to form a new second strand
hybridized to the original single strand. A second cycle refers to
the denaturation of the new second strand from the original single
strand, the hybridization of a second primer to the new second
strand, and the extension of the second primer to form a new third
strand, hybridized to the new second strand. Multiple cycles may be
required to increase efficiency, for example, when analyte is
dilute or inhibitors are present.
[0026] In the case of endogenous UIDs, adapters can be added to the
ends of fragments by ligation. Complexity of the analyte fragments
can be decreased by a capture step, either on a solid phase or in
liquid step. Typically the capture step will employ hybridization
to probes representing a gene or set of genes of interest. If on a
solid phase, non-binding fragments are separated from binding
fragments. Suitable solid phases known in the art include filters,
membranes, beads, columns, etc. If in a liquid phase, a capture
reagent can be added which binds to the probes, for example through
a biotin-avidin type interaction. After capture, desired fragments
can be eluted for further processing. The order of adding adapters
and capturing is not critical. Another means of reducing the
complexity of the analyte fragments involves amplification of one
or more specific genes or regions. One way to accomplish this is to
use inverse PCR. Primers can be used which are gene-specific, thus
enriching while forming libraries. Optionally, the gene-specific
primers can contain grafting sequences for subsequent attachment to
a massively parallel sequencing platform.
[0027] Because endogenous UIDs provide a limited number of unique
possibilities, depending on the fragment size and sequencing read
length, combinations of both endogenous and exogenous UIDs can be
used. Introducing additional sequences when amplifying would
increase the available UIDs and thereby increase sensitivity. For
example, before amplification, the template can be split into 96
wells, and 96 different primers could be used during the
amplification. This would effectively increase the available UIDs
96-fold, because up to 96 templates with the same endogenous UID
could be distinguished. This technique can also be used with
exogenous UIDs, so that each well's primers adds a unique,
well-specific sequence to the amplification products. This can
improve the specificity of detection of rare templates.
[0028] Amplification of fragments containing a UID can be performed
according to known techniques to generate families of fragments.
Polymerase chain reaction can be used. Other amplification methods
can also be used, as is convenient. Inverse PCR may be used, as can
rolling circle amplification. Amplification of fragments typically
is done using primers that are complementary to priming sites that
are attached to the fragments at the same time as the UIDs. The
priming sites are distal to the UIDs, so that amplification
includes the UIDs. Amplification forms a family of fragments, each
member of the family sharing the same UID. Because the diversity of
UIDs is greatly in excess of the diversity of the fragments, each
family should derive from a single fragment molecule in the
analyte. Primers used for the amplification may be chemically
modified to render them more resistant to exonucleases. One such
modification is the use of phosphorothioate linkages between one or
more 3' nucleotides. Another employs boranophosphates.
[0029] Family members are sequenced and compared to identify any
divergencies within a family. Sequencing is preferably performed on
a massively parallel sequencing platform, many of which are
commercially available. If the sequencing platform requires a
sequence for "grafting," i.e., attachment to the sequencing device,
such a sequence can be added during addition of UIDs or adapters or
separately. A grafting sequence may be part of a UID primer, a
universal primer, a gene target-specific primer, the amplification
primers used for making a family, or separate. Redundant sequencing
refers to the sequencing of a plurality of members of a single
family.
[0030] A threshold can be set for identifying a mutation in an
analyte. If the "mutation" appears in all members of a family, then
it derives from the analyte. If it appears in less than all
members, then it may have been introduced during the analysis.
Thresholds for calling a mutation may be set, for example, at 1%,
5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, or
100%. Thresholds will be set based on the number of members of a
family that are sequenced and the particular purpose and
situation.
[0031] In some embodiments, prior to amplification, the analyte DNA
is treated with bisulfite to convert unmethylated cytosine bases to
uracil. In some embodiments the number of families representing a
first analyte DNA fragment is compared to number of families
representing a second analyte DNA fragment to determine a relative
concentration of a first analyte DNA fragment to a second analyte
DNA fragment in the plurality of analyte DNA fragments.
[0032] Populations of primer pairs are used to attach exogenous
UIDs. The first primer comprises a first portion of 10.sup.-100
nucleotides complementary to the gene or gene portion and a second
portion of 10 to 100 nucleotides comprising a site for
hybridization to a third primer. The second primer comprises a
first portion of 10.sup.-100 nucleotides complementary to the gene
or gene portion and a second portion of 10 to 100 nucleotides
comprising a site for hybridization to a fourth primer. Interposed
between the first portion and the second portion of the second
primer is a third portion consisting of 2 to 4,000 nucleotides
forming a unique identifier (UID). The unique identifiers in the
population have at least 4, at least 16, at least 64, at least 256,
at least 1,024, at least 4,096, at least 16,384, at least 65,536,
at least 262,144, at least 1,048,576, at least 4,194,304, at least
16,777,216, or at least 67,108,864 different sequences. The first
and second primers are complementary to opposite strands of the
gene or gene portion. A kit can be made containing both the primers
for attaching exogenous UIDs as well as amplification primers,
i.e., the third and fourth primers complementary to the second
portions of each of the first and second primers. The third and
fourth primers can optionally contain additional grafting or
indexing sequences. The UID may comprise randomly selected
sequences, pre-defined nucleotide sequences, or both randomly
selected sequences and pre-defined nucleotides. If both, these can
be joined together in blocks or interspersed.
[0033] The methods of analysis can be used to quantitate as well as
to determine a sequence. For example, the relative abundance of two
analyte DNA fragments may be compared. The results described below
in the examples demonstrate that the Safe-SeqS approach can
substantially improve the accuracy of massively parallel sequencing
(Tables 1 and 2). It can be implemented through either endogenous
or exogenously introduced UIDs and can be applied to virtually any
sample preparation workflow or sequencing platform. As demonstrated
here, the approach can easily be used to identify rare mutants in a
population of DNA templates, to measure polymerase error rates, and
to judge the reliability of oligonucleotide syntheses. One of the
advantages of the strategy is that it yields the number of
templates analyzed as well as the fraction of templates containing
variant bases. Previously described in vitro methods for the
detection of small numbers of template molecules (e.g., (29, 50))
allow the fraction of mutant templates to be determined but cannot
determine the number of mutant and normal templates in the original
sample.
[0034] It is of interest to compare Safe-SeqS to other approaches
for reducing errors in next-generation sequencing. As mentioned
above, in the background of the invention, sophisticated algorithms
to increase the accuracy of base-calling have been developed (e.g.,
(36-39)). These can certainly reduce false positive calls, but
their sensitivity is still limited by artifactual mutations
occurring during the PCR steps required for library preparation as
well as by (a reduced number of) base-calling errors. For example,
the algorithm employed in the current study used very stringent
criteria for base-calling and was applied to short read-lengths,
but was still unable to reduce the error rate to less than an
average of 2.0.times.10.sup.-4 errors/bp. This error frequency is
at least as low as those reported with other algorithms. To improve
sensitivity further, these base-calling improvements can be used
together with Safe-SeqS. Travers et al. have described another
powerful strategy for reducing errors (51). With this technology,
both strands of each template molecule are sequenced redundantly
after a number of preparative enzymatic steps. However, this
approach can only be performed on a specific instrument. Moreover,
for many clinical applications, there are relatively few template
molecules in the initial sample and evaluation of nearly all of
them is required to obtain the requisite sensitivity. The approach
described here with exogenously introduced UIDs (FIG. 3) fulfills
this requirement by coupling the UID assignment step with a
subsequent amplification in which few molecules are lost. Our
endogenous UID approaches (FIG. 2 and FIG. 5) and the one described
by Travers et al. are not ideally suited for this purpose because
of the inevitable losses of template molecules during the ligation
and other preparative steps.
[0035] How do we know that the mutations identified by conventional
analyses in the current study represent artifacts rather than true
mutations in the original templates? Strong evidence supporting
this is provided by the observation that the mutation prevalence in
all but one experiment was similar--2.0.times.10.sup.-4 to
2.4.times.10.sup.-4 mutations/bp (Tables 1 and 2). The exception
was the experiment with oligonucleotides synthesized from
phosphoramidites, in which the error of the synthetic process was
apparently higher than the error rate of conventional Illumina
analysis when used with stringent base-calling criteria. In
contrast, the mutation prevalence of Safe-SeqS varied much more,
from 0.0 to 1.4.times.10.sup.-5 mutations/bp, depending on the
template and experiment. Moreover, the mutation prevalence measured
by Safe-SeqS in the most controlled experiment, in which polymerase
fidelity was measured (Table 2A), was almost identical to that
predicted from previous experiments in which polymerase fidelity
was measured by biological assays. Our measurements of mutation
prevalence in the DNA from normal cells are consistent with some
previous experimental data. However, estimates of these prevalences
vary widely and may depend on cell type and sequence analyzed (see
SI text). We therefore cannot be certain that the few mutations
revealed by Safe-SeqS represented errors occurring during the
sequencing process rather than true mutations present in the
original DNA templates. Potential sources of error in the Safe-SeqS
process are described in the SI text.
[0036] Another potential application of Safe-SeqS is the
minimization of PCR contamination, a serious problem for clinical
laboratories. With endogenous or exogenous UID assignment, the UIDs
of mutant templates can simply be compared to those identified in
prior experiments; the probability that the same mutation from two
independent samples would have the same UID in different
experiments is negligible when mutations are infrequent.
Additionally, with exogenous UIDs, a control experiment with the
same template but without the UID assigning PCR cycles (FIG. 3) can
ensure that no DNA contamination is present in that template
preparation; no template should be amplified in the absence of UID
assignment cycles and thus no PCR product of the proper size should
be observed.
[0037] Like all techniques, Safe-SeqS has limitations. For example,
we have demonstrated that the exogenous UIDs strategy can be used
to analyze a single amplicon in depth. This technology may not be
applicable to situations wherein multiple amplicons must be
analyzed from a sample containing a limited number of templates.
Multiplexing in the UID assignment cycles (FIG. 3) may provide a
solution to this challenge. A second limitation is that the
efficiency of amplification in the UID assignment cycles is
critical for the success of the method. Clinical samples may
contain inhibitors that reduce the efficiency of this step. This
problem can presumably be overcome by performing more than two
cycles in the UID assignment PCR step (FIG. 3), though this would
complicate the determination of the number of templates analyzed.
The specificity of Safe-SeqS is currently limited by the fidelity
of the polymerase used in the UID assignment PCR step, i.e.,
8.8.times.10.sup.-7 mutations/bp in its current implementation with
two cycles. Increasing the number of cycles in the UID assignment
PCR step to five would decrease the overall specificity to
.about.2.times.10.sup.-6 mutations/bp. However, this specificity
can be increased by requiring more than one super-mutant for
mutation identification--the probability of introducing the same
artifactual mutation twice or three times would be exceedingly low
([2.times.10.sup.-6].sup.2 or [2.times.10.sup.-6].sup.3,
respectively). In sum, there are several simple ways to perform
Safe-SeqS variations and analysis variations to realize the needs
of specific experiments.
[0038] Luria and Delbruck, in their classic paper in 1943, wrote
that their "prediction cannot be verified directly, because what we
observe, when we count the number of resistant bacteria in a
culture, is not the number of mutations which have occurred but the
number of resistant bacteria which have arisen by multiplication of
those which mutated, the amount of multiplication depending on how
far back the mutation occurred." The Safe-SeqS procedure described
here can verify such predictions because the number as well as the
time of occurrence of each mutation can be estimated from the data,
as noted in the experiments on polymerase fidelity. In addition to
templates generated by polymerases in vitro, the same approach can
be applied to DNA from bacteria, viruses, and mammalian cells. We
therefore expect that this strategy will provide definitive answers
to a variety of important biomedical questions.
[0039] The above disclosure generally describes the present
invention. All references disclosed herein are expressly
incorporated by reference. A more complete understanding can be
obtained by reference to the following specific examples which are
provided herein for purposes of illustration only, and are not
intended to limit the scope of the invention.
Example 1--Endogenous UIDs
[0040] UIDs, sometimes called barcodes or indexes, can be assigned
to nucleic acid fragments in many ways. These include the
introduction of exogenous sequences through PCR (40,41) or ligation
(42, 43). Even more simply, randomly sheared genomic DNA inherently
contains UIDs consisting of the sequences of the two ends of each
sheared fragment (FIG. 2 and FIG. 5). Paired-end sequencing of
these fragments yields UID-families that can be analyzed as
described above. To employ such endogenous UIDs in Safe-SeqS, we
used two separate approaches: one designed to evaluate many genes
simultaneously and the other designed to evaluate a single gene
fragment in depth (FIG. 2 and FIG. 5, respectively).
[0041] For the evaluation of multiple genes, we ligated standard
Illumina sequencing adapters to the ends of sheared DNA fragments
to produce a standard sequencing library, then captured genes of
interest on a solid phase (44). In this experiment, a library made
from the DNA of .about.15,000 normal cells was used, and 2,594 bp
from six genes were targeted for capture. After excluding known
single nucleotide polymorphisms, 25,563 apparent mutations,
corresponding to 2.4.times.10.sup.-4.+-.mutations/bp, were also
identified (Table 1). Based on previous analyses of mutation rates
in human cells, at least 90% of these apparent mutations were
likely to represent mutations introduced during template and
library preparation or base-calling errors. Note that the error
rate determined here (2.4.times.10.sup.-4 mutations/bp) is
considerably lower than usually reported in experiments using the
Illumina instrument because we used very stringent criteria for
base calling.
TABLE-US-00001 TABLE 1 Safe-SeqS with Endogenous UIDs Capture
Inverse PCR Conventional Analysis High quality bp 106,958,863
1,041,346,645 Mean high quality bp read depth 38,620.times.
2,085,600.times. Mutations identified 25,563 234,352 Mutations/bp
2.4E-04 2.3E-04 Safe-SeqS Analysis High quality bp 106,958,863
1,041,346,645 Mean high quality bp read depth 38,620.times.
2,085,600.times. UID-families 69,505 1,057 Average # of
members/UID-family 40 21,688 Median # of members/UID-family 19 4
Super-mutants identified 8 0 Super-mutants/bp 3.5E-06 0.0
[0042] With Safe-SeqS analysis of the same data, we determined that
69,505 original template molecules were assessed in this experiment
(i.e., 69,505 UID-families, with an average of 40 members per
family, were identified, Table 1). All of the polymorphic variants
identified by conventional analysis were also identified by
Safe-SeqS. However, only 8 super-mutants were observed among these
families, corresponding to 3.5.times.10.sup.-6 mutations/bp. Thus
Safe-SeqS decreased the presumptive sequencing errors by at least
70-fold.
[0043] Safe-SeqS analysis can also determine which strand of a
template is mutated, thus an additional criteria for calling
mutations could require that the mutation appears in only one or in
both strands of the originally double stranded template. Massively
parallel sequencers are able to obtain sequence information from
both ends of a template in two sequential reads. (This type of
sequencing experiment is called a "paired end" run on the Illumina
platform, but similar experiments can be done on other sequencing
platforms where they may be called by another name.) The two
strands of a double stranded template can be differentiated by the
observed orientation of the sequences and the order in which they
appear when sequence information is obtained from both ends. For
example, a UID strand pair could consist of the following two
groups of sequences when each end of a template is sequenced in
sequential reads: 1) A sequence in the sense orientation that
begins at position 100 of chromosome 2 in the first read followed
by a sequence in the antisense orientation that begins at position
400 of chromosome 2 in the second read; and 2) A sequence in the
antisense orientation that begins at position 400 of chromosome 2
in the first read followed by a sequence in the sense orientation
that begins at position 100 of chromosome 2 in the second read. In
the capture experiment described above, 42,222 of 69,505 UIDs
(representing 21,111 original double stranded molecules) in the
region of interest represented UID strand pairs. These 42,222 UIDs
encompassed 1,417,838 bases in the region of interest. When
allowing a mutation to only occur within UID strand pairs (whether
in one or both strands), two super-mutants were observed, yielding
a mutation rate of 1.4.times.10.sup.-6 super-mutants/bp. When
requiring that a mutation occur in only one strand of a UID strand
pair, only one super-mutant was observed, yielding a mutation rate
of 7.1.times.10.sup.-7 super-mutants/bp. When requiring that a
mutation occur in both strands of a UID strand pair, only one
super-mutant was observed, yielding a mutation rate of
7.1.times.10.sup.-7 super-mutants/bp. Thus, requiring that
mutations occur in only one or in both strands of templates can
further increase the specificity of Safe-SeqS.
[0044] A strategy employing endogenous UIDs was also used to reduce
false positive mutations upon deep sequencing of a single region of
interest. In this case, a library prepared as described above from
.about.1,750 normal cells was used as template for inverse PCR
employing primers complementary to a gene of interest, so the PCR
products could be directly used for sequencing (FIG. 5). With
conventional analysis, an average of 2.3.times.10.sup.-4
mutations/bp were observed, similar to that observed in the capture
experiment (Table 1). Given that only 1,057 independent molecules
from normal cells were assessed in this experiment, as determined
through Safe-SeqS analysis, all mutations observed with
conventional analysis likely represented false positives (Table 1).
With Safe-SeqS analysis of the same data, no super-mutants were
identified at any position.
Example 2--Exogenous UIDs
[0045] Though the results described above show that Safe-SeqS can
increase the reliability of massively parallel sequencing, the
number of different molecules that can be examined using endogenous
UIDs is limited. For fragments sheared to an average size of 150 bp
(range 125-175), 36 base paired-end sequencing can evaluate a
maximum of .about.7,200 different molecules containing a specific
mutation (2 reads.times.2 orientations.times.36 bases/read.times.50
base variation on either end of the fragment). In practice, the
actual number of UIDs is smaller because the shearing process is
not entirely random.
[0046] To make more efficient use of the original templates, we
developed a Safe-SeqS strategy that employed a minimum number of
enzymatic steps. This strategy also permitted the use of degraded
or damaged DNA, such as found in clinical specimens or after
bisulfite-treatment for the examination of cytosine methylation
(45). As depicted in FIG. 3, this strategy employs two sets of PCR
primers. The first set is synthesized with standard phosphoramidite
precursors and contained sequences complementary to the gene of
interest on the 3' end and different tails at the 5' ends of both
the forward and reverse primers. The different tails allowed
universal amplification in the next step. Finally, there was a
stretch of 12 to 14 random nucleotides between the tail and the
sequence-specific nucleotides in the forward primer (40). The
random nucleotides form the UIDs. An equivalent way to assign UIDs
to fragments, not used in this study, would employ 10,000 forward
primers and 10,000 reverse primers synthesized on a microarray.
Each of these 20,000 primers would have gene-specific primers at
their 3'-ends and one of 10,000 specific, predetermined,
non-overlapping UID sequences at their 5'-ends, allowing for
10.sup.8 (i.e., [10.sup.4].sup.2) possible UID combinations. In
either case, two cycles of PCR are performed with the primers and a
high-fidelity polymerase, producing a uniquely tagged,
double-stranded DNA fragment from each of the two strands of each
original template molecule (FIG. 3). The residual, unused UID
assignment primers are removed by digestion with a single-strand
specific exonuclease, without further purification, and two new
primers are added. Alternatively or in addition to such digestion,
one can use a silica column that selectively retains larger-sized
fragments or one can use solid phase reversible immobilization
(SPRI) beads under conditions that selectively retain larger
fragments to eliminate smaller, non-specific, amplification
artifacts. This purification may potentially help in reducing
primer-dimer accumulation in later steps. The new primers,
complementary to the tails introduced in the UID assignment cycles,
contain grafting sequences at their 5' ends, permitting solid-phase
amplification on the Illumina instrument, and phosphorothioate
residues at their 3' ends to make them resistant to any remaining
exonuclease. Following 25 additional cycles of PCR, the products
are loaded on the Illumina instrument. As shown below, this
strategy allowed us to evaluate the majority of input fragments and
was used for several illustrative experiments.
Example 3--Analysis of DNA Polymerase Fidelity
[0047] Measurement of the error rates of DNA polymerases is
essential for their characterization and dictates the situations in
which these enzymes can be used. We chose to measure the error rate
of Phusion polymerase, as this polymerase has one of the lowest
reported error frequencies of any commercially available enzyme and
therefore poses a particular challenge for an in vitro-based
approach. We first amplified a single human DNA template molecule,
comprising a segment of an arbitrarily chosen human gene, through
19 rounds of PCR. The PCR products from these amplifications, in
their entirety, were used as templates for Safe-SeqS as described
in FIG. 3. In seven independent experiments of this type, the
number of UID-families identified by sequencing was
624,678.+-.421,274, which is consistent with an amplification
efficiency of 92.+-.9.6% per round of PCR.
[0048] The error rate of Phusion polymerase, estimated through
cloning of PCR products encoding .beta.-galactosidase in plasmid
vectors and transformation into bacteria, is reported by the
manufacturer to be 4.4.times.10.sup.-7 errors/bp/PCR cycle. Even
with very high stringency base-calling, conventional analysis of
the Illumina sequencing data revealed an apparent error rate of
9.1.times.10.sup.-6 errors/bp/PCR cycle, more than an order of
magnitude higher than the reported Phusion polymerase error rate
(Table 2A). In contrast, Safe-SeqS of the same data revealed an
error rate of 4.5.times.10.sup.-7 errors/bp/PCR cycle, nearly
identical to that measured for Phusion polymerase in biological
assays (Table 2A). The vast majority (>99%) of these errors were
single base substitutions (Table 3A), consistent with previous data
on the mutation spectra created by other prokaryotic DNA
polymerases (15, 46, 47).
TABLE-US-00002 TABLE 2A-2C Safe-SeqS with Exogenous UIDs Standard
Mean Deviation 2A. Polymerase Fidelity Conventional analysis of 7
replicates High quality bp 996,855,791 64,030,757 Total mutations
identified 198,638 22,515 Mutations/bp 2.0E-04 1.7E-05 Calculated
Phusion Error Rate 9.1E-06 7.7E-07 (errors/bp/cycle) Safe-SeqS
analysis of 7 replicates High quality bp 996,855,791 64,030,757
UID-families 624,678 421,274 Members/UID-family 107 122 Total
super-mutants identified 197 143 Super-mutants/bp 9.9E-06 2.3E-06
Calculated Phusion Error Rate 4.5E-07 1.0E-07 (errors/bp/cycle) 2B.
CTNNB1 mutations in DNA from normal human cells Conventional
analysis of 3 individuals High quality bp 559,334,774 66,600,749
Total mutations identified 118,488 11,357 Mutations/bp 2.1E-04
1.6E-05 Safe-SeqS analysis of 3 individuals High quality bp
559,334,774 66,600,749 UID-families 374,553 263,105
Members/UID-family 68 38 Total super-mutants identified 99 78
Super-mutants/bp 9.0E-06 3.1E-06 2C. Mitochondrial mutations in DNA
from normal human cells Conventional analysis of 7 individuals High
quality bp 147,673,456 54,308,546 Total mutations identified 30,599
12,970 Mutations/bp 2.1E-04 9.4E-05 Safe-SeqS analysis of 7
individuals High quality bp 147,673,456 54,308,546 UID-families
515,600 89,985 Members/UID-family 15 6 Total super-mutants
identified 135 61 Super-mutants/bp 1.4E-05 6.8E-06
TABLE-US-00003 TABLE 3A-C Fraction of Single Base Substitutions,
Insertions, and Deletions with Exogenous UIDs Standard Mean
Deviation 3A. Polymerase Fidelity Conventional analysis of 7
replicates Total mutations identified 198,638 22,515 Fraction of
mutations represented by 99% 0% single base substitutions Fraction
of mutations represented by deletions 1% 0% Fraction of mutations
represented by insertions 0% 0% Safe-SeqS analysis of 7 replicates
Total super-mutants identified 197 143 Fraction of super-mutants
represented by 99% 2% single base substitutions Fraction of
super-mutants 1% 2% represented by deletions Fraction of
super-mutants 0% 0% represented by insertions 3B. CTNNB1 mutations
in DNA from normal human cells Conventional analysis of 3
individuals Total mutations identified 118,488 11,357 Fraction of
mutations represented by 97% 0% single base substitutions Fraction
of mutations represented by deletions 3% 0% Fraction of mutations
represented by insertions 0% 0% Safe-SeqS analysis of 3 individuals
Total super-mutants identified 99 78 Fraction of super-mutants
represented by 100% 1% single base substitutions Fraction of
super-mutants 0% 1% represented by deletions Fraction of
super-mutants 0% 0% represented by insertions 3C. Mitochondrial
mutations in DNA from normal human cells Conventional analysis of 7
individuals Total mutations identified 30,599 12,970 Fraction of
mutations represented by 98% 1% single base substitutions Fraction
of mutations represented by deletions 2% 1% Fraction of mutations
represented by insertions 0% 0% Safe-SeqS analysis of 7 individuals
Total super-mutants identified 135 61 Fraction of super-mutants
represented by 99% 1% single base substitutions Fraction of
super-mutants 1% 1% represented by deletions Fraction of
super-mutants 0% 0% represented by insertions
[0049] Safe-SeqS also allowed a determination of the total number
of distinct mutational events and an estimation of PCR cycle in
which the mutation occurred. There were 19 cycles of PCR performed
in wells containing a single template molecule in these
experiments. If a polymerase error occurred in cycle 19, there
would be only one super-mutant produced (from the strand containing
the mutation). If the error occurred in cycle 18 there should be
two super-mutants (derived from the mutant strands produced in
cycle 19), etc. Accordingly, the cycle in which the error occurred
is related to the number of super-mutants containing that error.
The data from seven independent experiments demonstrate a
relatively consistent number of observed total polymerase errors
(2.2.+-.1.1.times.10.sup.-6 distinct mutations/bp), in good
agreement with the expected number of observations from simulations
(1.5.+-.0.21.times.10.sup.-6 distinct mutations/bp). The data also
show a highly variable timing of occurrence of polymerase errors
among experiments (Table 4), as predicted from classic fluctuation
analysis (1). This kind of information is difficult to derive using
conventional analysis of the same next-generation sequencing data,
in part because of the prohibitively high apparent mutation rate
noted above.
TABLE-US-00004 TABLE 4A-4G Observed and Expected Number of Errors
Generated by Phusion Polymerase Expected Observed (mean .+-. SD) *
4A. Experiment 1 Mutations represented by 1 super-mutant 10 19 .+-.
3.7 Mutations represented by 2 super-mutants 8 5.8 .+-. 2.3
Mutations represented by 3 super-mutants 4 1.3 .+-. 1.1 Mutations
represented by 4 super-mutants 4 1.8 .+-. 1.3 Mutations represented
by 5 super-mutants 2 0.61 .+-. 0.75 Mutations represented by 6
super-mutants 2 0.22 .+-. 0.44 Mutations represented by 7
super-mutants 0 0.01 .+-. 0.10 Mutations represented by 8
super-mutants 0 0.87 .+-. 0.86 Mutations represented by 9
super-mutants 2 0.28 .+-. 0.51 Mutations represented by 10
super-mutants 0 0.14 .+-. 0.38 Mutations represented by >10
super-mutants 3 1.5 .+-. 2.7 Distinct mutations 35 32 .+-. 4.2 4B.
Experiment 2 Mutations represented by 1 super-mutant 19 23 .+-. 4.1
Mutations represented by 2 super-mutants 5 9.5 .+-. 2.8 Mutations
represented by 3 super-mutants 4 2.7 .+-. 1.6 Mutations represented
by 4 super-mutants 7 2.7 .+-. 1.7 Mutations represented by 5
super-mutants 2 0.88 .+-. 0.94 Mutations represented by 6
super-mutants 1 0.40 .+-. 0.60 Mutations represented by 7
super-mutants 3 0.16 .+-. 0.42 Mutations represented by 8
super-mutants 1 0.99 .+-. 1.0 Mutations represented by 9
super-mutants 1 0.39 .+-. 0.68 Mutations represented by 10
super-mutants 0 0.17 .+-. 0.43 Mutations represented by >10
super-mutants 9 1.8 .+-. 3.4 Distinct mutations 52 43 .+-. 5.1 4C.
Experiment 3 Mutations represented by 1 super-mutant 7 17 .+-. 3.4
Mutations represented by 2 super-mutants 9 5.4 .+-. 2.0 Mutations
represented by 3 super-mutants 4 1.2 .+-. 1.1 Mutations represented
by 4 super-mutants 4 1.7 .+-. 1.4 Mutations represented by 5
super-mutants 2 0.50 .+-. 0.70 Mutations represented by 6
super-mutants 0 0.17 .+-. 0.45 Mutations represented by 7
super-mutants 1 0.03 .+-. 0.17 Mutations represented by 8
super-mutants 0 0.59 .+-. 0.74 Mutations represented by 9
super-mutants 0 0.24 .+-. 0.50 Mutations represented by 10
super-mutants 1 0.07 .+-. 0.29 Mutations represented by >10
super-mutants 5 1.5 .+-. 2.6 Distinct mutations 33 28 .+-. 3.7 4D.
Experiment 4 Mutations represented by 1 super-mutant 7 15 .+-. 3.7
Mutations represented by 2 super-mutants 8 4.1 .+-. 1.7 Mutations
represented by 3 super-mutants 2 0.70 .+-. 0.74 Mutations
represented by 4 super-mutants 1 1.5 .+-. 1.3 Mutations represented
by 5 super-mutants 3 0.21 .+-. 0.52 Mutations represented by 6
super-mutants 2 0.08 .+-. 0.27 Mutations represented by 7
super-mutants 1 0.0 .+-. 0.0 Mutations represented by 8
super-mutants 2 0.65 .+-. 0.77 Mutations represented by 9
super-mutants 2 0.17 .+-. 0.43 Mutations represented by 10
super-mutants 0 0.05 .+-. 0.22 Mutations represented by >10
super-mutants 1 0.92 .+-. 2.1 Distinct mutations 29 23 .+-. 3.2 4E.
Experiment 5 Mutations represented by 1 super-mutant 9 23 .+-. 4.1
Mutations represented by 2 super-mutants 6 9.5 .+-. 2.8 Mutations
represented by 3 super-mutants 5 2.7 .+-. 1.6 Mutations represented
by 4 super-mutants 3 2.7 .+-. 1.7 Mutations represented by 5
super-mutants 6 0.88 .+-. 0.94 Mutations represented by 6
super-mutants 2 0.40 .+-. 0.60 Mutations represented by 7
super-mutants 1 0.16 .+-. 0.42 Mutations represented by 8
super-mutants 2 0.99 .+-. 1.0 Mutations represented by 9
super-mutants 2 0.39 .+-. 0.68 Mutations represented by 10
super-mutants 3 0.17 .+-. 0.43 Mutations represented by >10
super-mutants 7 1.8 .+-. 3.4 Distinct mutations 46 43 .+-. 5.1 4F.
Experiment 6 Mutations represented by 1 super-mutant 4 6.7 .+-. 2.8
Mutations represented by 2 super-mutants 7 1.5 .+-. 1.2 Mutations
represented by 3 super-mutants 1 0.10 .+-. 0.33 Mutations
represented by 4 super-mutants 2 0.60 .+-. 0.82 Mutations
represented by 5 super-mutants 0 0.07 .+-. 0.26 Mutations
represented by 6 super-mutants 0 0.01 .+-. 0.10 Mutations
represented by 7 super-mutants 1 0.0 .+-. 0.0 Mutations represented
by 8 super-mutants 1 0.39 .+-. 0.60 Mutations represented by 9
super-mutants 0 0.01 .+-. 0.10 Mutations represented by 10
super-mutants 0 0.0 .+-. 0.0 Mutations represented by >10
super-mutants 2 0.50 .+-. 1.1 Distinct mutations 18 9.9 .+-. 1.4
4G. Experiment 7 Mutations represented by 1 super-mutant 8 2.9 .+-.
1.6 Mutations represented by 2 super-mutants 2 0.61 .+-. 0.79
Mutations represented by 3 super-mutants 0 0.04 .+-. 0.24 Mutations
represented by 4 super-mutants 0 0.41 .+-. 0.59 Mutations
represented by 5 super-mutants 1 0.01 .+-. 0.10 Mutations
represented by 6 super-mutants 0 0.0 .+-. 0.0 Mutations represented
by 7 super-mutants 0 0.0 .+-. 0.0 Mutations represented by 8
super-mutants 0 0.14 .+-. 0.35 Mutations represented by 9
super-mutants 0 0.01 .+-. 0.10 Mutations represented by 10
super-mutants 0 0.0 .+-. 0.0 Mutations represented by >10
super-mutants 0 0.32 .+-. 0.93 Distinct mutations 11 4.5 .+-. 0.62
* See SI Text for details of the simulations
Example 4--Analysis of Oligonucleotide Composition
[0050] A small number of mistakes during the synthesis of
oligonucleotides from phoshoramidite precursors are tolerable for
most applications, such as routine PCR or cloning. However, for
synthetic biology, wherein many oligonucleotides must be joined
together, such mistakes present a major obstacle to success. Clever
strategies for making the gene construction process more efficient
have been devised (48, 49), but all such strategies would benefit
from more accurate synthesis of the oligonucleotides themselves.
Determining the number of errors in synthesized oligonucleotides is
difficult because the fraction of oligonucleotides containing
errors can be lower than the sensitivity of conventional
next-generation sequencing analyses.
[0051] To determine whether Safe-SeqS could be used for this
determination, we used standard phosphoramidite chemistry to
synthesize an oligonucleotide containing 31 bases that were
designed to be identical to that analyzed in the polymerase
fidelity experiment described above. In the synthetic
oligonucleotide, the 31 bases were surrounded by sequences
complementary to primers that could be used for the UID assignment
steps of Safe-SeqS (FIG. 3). By performing Safe-SeqS on
.about.300,000 oligonucleotides, we found that there were
8.9.+-.0.28.times.10.sup.-4 super-mutants/bp and that these errors
occurred throughout the oligonucleotides (FIG. 6A). The
oligonucleotides contained a large number of insertion and deletion
errors, representing 8.2.+-.0.63% and 25.+-.1.5% of the total
super-mutants, respectively. Importantly, both the position and
nature of the errors were highly reproducible among seven
independent replicates of this experiment performed on the same
batch of oligonucleotides (FIG. 6A). This nature and distribution
of errors had little in common with that of the errors produced by
Phusion polymerase (FIG. 6B and Table 5), which were distributed in
the expected stochastic pattern among replicate experiments. The
number of errors in the oligonucleotides synthesized with
phosphoramidites was .about.60 times higher than in the equivalent
products synthesized by Phusion polymerase. These data, in toto,
indicate that the vast majority of errors in the former were
generated during their synthesis rather than during the Safe-SeqS
procedure.
TABLE-US-00005 TABLE 5 Phosphoramidite- vs Phusion-Synthesized DNA:
Transitions vs Transversions Comparison Standard Exp. 1 Exp. 2 Exp.
3 Exp. 4 Exp. 5 Exp. 6 Exp. 7 Average Deviation Phosphoramidites
Transition super-mutants: 496 509 471 396 323 273 470 420 92
Transversion super-mutants: 1494 1499 1521 1154 944 907 1626 1306
298 p-value* 3.4E-05 Phusion Transition super-mutants: 63 275 127 5
87 182 103 120 87 Transversion super-mutants: 14 124 77 12 57 191
63 77 63 p-value* 0.08 *p-values were calculated using a two-tailed
paired t-test
[0052] Does Safe-SeqS preserve the ratio of mutant:normal sequences
in the original templates? To address this question, we synthesized
two 31-base oligonucleotides of identical sequence with the
exception of nt 15 (50:50 C/G instead of T) and mixed them at
nominal mutant/normal fractions of 3.3% and 0.33%. Through
Safe-SeqS analysis of the oligonucleotide mixtures, we found that
the ratios were 2.8% and 0.27%, respectively. We conclude that the
UID assignment and amplification procedures used in Safe-SeqS do
not greatly alter the proportion of variant sequences and thereby
provide a reliable estimate of that proportion when unknown. This
conclusion is also supported by the reproducibility of variant
fractions when analyzed in independent Safe-SeqS experiments (FIG.
6A).
Example--5 Analysis of DNA Sequences from Normal Human Cells
[0053] The exogenous UID strategy (FIG. 3) was then used to
determine the prevalence of rare mutations in a small region of the
CTNNB1 gene from .about.100,000 normal human cells from three
unrelated individuals. Through comparison with the number of
UID-families obtained in the Safe-SeqS experiments (Table 2B), we
calculated that the majority (78.+-.9.8%) of the input fragments
were converted into UID-families. There was an average of 68
members/UID-family, easily fulfilling the required redundancy for
Safe-SeqS (FIG. 7). Conventional analysis of the Illumina
sequencing data revealed an average of 118,488.+-.11,357 mutations
among the .about.560 Mb of sequence analyzed per sample,
corresponding to an apparent mutation prevalence of
2.1.+-.0.16.times.10.sup.-4 mutations/bp (Table 2B). Only an
average of 99.+-.78 super-mutants were observed in the Safe-SeqS
analysis. The vast majority (>99%) of super-mutants were single
base substitutions and the calculated mutation rate was
9.0.+-.3.1.times.10.sup.-6 mutations/bp (Table 3B). Safe-SeqS
thereby reduced the apparent frequency of mutations in genomic DNA
by at least 24-fold (FIG. 4).
[0054] One possible strategy to increase the specificity of
Safe-SeqS is to perform the library amplification (and possibly the
UID assignment cycles) in multiple wells. This can be accomplished
in as few as 2 or as many as 384 wells using standard PCR plates,
or scaled up to many more wells when using a microfluidic device
(thousands to millions). When performed this way, indexing
sequences can be introduced into the templates that are unique to
the wells in which the template is amplified. Rare mutations, thus,
should give rise to two super-mutants (i.e., one from each strand),
both with the same well index sequence. When performing Safe-SeqS
with exogenous UIDs on the CTNNB1 templates described above and
diluted into 10 wells (each well yielding templates amplified with
a different index sequence), the mutation rate was further reduced
from 9.0.+-.3.1.times.10.sup.-6 to 3.7.+-.1.2.times.10.sup.-6
super-mutants/bp. Thus, analyzing templates in multiple
compartments--in a manner that yields differentially encoded
templates based on the compartment in which templates were
amplified--may be an additional strategy to increase the
specificity of Safe-SeqS.
Example 6--Analysis of DNA Sequences from Mitochondrial DNA
[0055] We applied the identical strategy to a short segment of
mitochondrial DNA in .about.1,000 cells from each of seven
unrelated individuals. Conventional analysis of the Illumina
sequencing libraries produced with the Safe-SeqS procedure (FIG. 3)
revealed an average of 30,599.+-.12,970 mutations among the
.about.150 Mb of sequence analyzed per sample, corresponding to an
apparent mutation prevalence of 2.1.+-.0.94.times.10.sup.-4
mutations/bp (Table 2C). Only 135.+-.61 super-mutants were observed
in the Safe-SeqS analysis. As with the CTNNB1 gene, the vast
majority of mutations were single base substitutions, though
occasional single base deletions were also observed (Table 3C). The
calculated mutation rate in the analyzed segment of mtDNA was
1.4.+-.0.68.times.10.sup.5 mutations/bp (Table 2C). Thus, Safe-SeqS
thereby reduced the apparent frequency of mutations in genomic DNA
by at least 15-fold.
Example 7--Materials and Methods
[0056] Endogenous UIDs. Genomic DNA from human pancreas or cultured
lymphoblastoid cells was prepared using Qiagen kits. The pancreas
DNA was used for the capture experiment and the lymphoblastoid
cells were used for the inverse PCR experiment. DNA was quantified
by optical absorbance and with qPCR. DNA was fragmented to an
average size of .about.200 bp by acoustic shearing (Covaris), then
end-repaired, A-tailed, and ligated to Y-shaped adapters according
to standard Illumina protocols. The ends of each template molecule
provide endogenous UIDs corresponding to their chromosomal
positions. After PCR-mediated amplification of the libraries with
primer sequences within the adapters, DNA was captured (1) with a
filter containing 2,594 nt corresponding to six cancer genes. After
capture, 18 cycles of PCR were performed to ensure sufficient
amounts of template for sequencing on an Illumina GA IIx
instrument.
[0057] For the inverse PCR experiments (FIG. 5), we ligated custom
adapters (IDT, Table 6) instead of standard Y-shaped Illumina
adapters to sheared cellular DNA. These adapters retained the
region complementary to the universal sequencing primer but lacked
the grafting sequences required for hybridization to the Illumina
GA IIx flow cell. The ligated DNA was diluted into 96 wells and the
DNA in each column of 8 wells was amplified with a unique forward
primer containing one of 12 index sequences at its 5' end plus a
standard reverse primer (Table 6). Amplifications were performed
using Phusion HotStart I (NEB) in 50 uL reactions containing
1.times. Phusion HF buffer, 0.5 mM dNTPs, 0.5 uM each forward and
reverse primer (both 5'-phosphorylated), and 1U of Phusion
polymerase. The following cycling conditions were used: one cycle
of 98.degree. C. for 30 s; and 16 cycles of 98.degree. C. for 10 s,
65.degree. C. for 30 s, and 72.degree. C. for 30 s. All 96
reactions were pooled and then purified using a Qiagen MinElute PCR
Purification Kit (cat. no. 28004) and a QIAquick Gel Extraction kit
(cat. no. 28704). To prepare the circular templates necessary for
inverse PCR, DNA was diluted to .about.1 ng/uL and ligated with T4
DNA Ligase (Enzymatics) for 30 min at room temperature in a 600 uL
reaction containing 1.times.T4 DNA Ligation Buffer and 18,000U of
T4 DNA Ligase. The ligation reaction was purified using a Qiagen
MinElute kit. Inverse PCR was performed using Phusion Hot Start I
on 90 ng of circular template distributed in twelve 50 uL
reactions, each containing 1.times. Phusion HF Buffer, 0.25 mM
dNTPs, 0.5 uM each of KRAS forward and reverse primers (Table 6)
and 1U of Phusion polymerase. The KRAS-specific primers both
contained grafting sequences for hybridization to the Illumina GA
Ix flow cell (Table 6). The following cycling conditions were used:
one cycle of 98.degree. C. for 2 min; and 37 cycles of 98.degree.
C. for 10 s, 61.degree. C. for 15 s, and 72.degree. C. for 10 s.
The final purification was performed with a NucleoSpin Extract II
kit (Macherey-Nagel) and eluted in 20 uL NE Buffer. The resulting
DNA fragments contained UIDs composed of three sequences: two
endogenous ones, represented by the two ends of the original
sheared fragments plus the exogenous sequence introduced during the
indexing amplification. As 12 exogenous sequences were used, this
increased the number of distinct UIDs by 12-fold over that obtained
without exogenous UIDs. This number could easily be increased by
using a greater number of distinct primers.
TABLE-US-00006 TABLE 6 Oligonucleotides Used Font Legend: Symbol
Legend: REGION COMPLEMENTARY TO TEMPLATES /5Phos/ = 5' Phosphate
TEMPLATE-SPECIFIC UID SEQUENCE * = Phosphorothioate linkage
UNIVERSAL SEQUENCE EXPERIMENT-SPECIFIC INDEX SEQUENCE ILLUMINA
GRAFTING PRIMERS (FOR HYBRIDIZATION TO FLOW CELL) Endogenous UIDs
Capture Sequence (SEQ ID NO: 1-81, respectively) Adapter-strand 1
/5Phos/GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG Adapter-strand 2
ACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole Genome Amplification-for
AATGATACGGCGACCACCGAGATCTACACACACTCTTTCCCTACACGACGCTCTT CCGAT*C*T
Whole Genome Amplification-rev
CAAGCAGAAGACGGCATACGAGATCTCGGCATTCCTGCTGAACCGCTCTTCCGAT *C*T
Post-Capture Amplification-for
AATGATACGGCGACCACCGAGATCTACACACACTCTTTCCCTACACGACGCTCTT CCGAT*C*T
Post-Capture Amplification-rev
CAAGCAGAAGACGGCATACGAGATCTCGGCATTCCTGCTGAACCGCTCTTCCGAT *C*T
Sequencing Primer, Read 1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT
(Illumina; SanDiego, CA) Sequencing Primer, Read 2
CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT (Illumina; SanDiego, CA) Inverse
PCR Adapter-strand 1 /5Phos/GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
Adapter-strand 2 ACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole Genome
Amplification-for-1 CGTGATACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole
Genome Amplification-for-2
ACATCGACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole Genome
Amplification-for-3 GCCTAAACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole
Genome Amplification-for-4
/TGGTCAACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole Genome
Amplification-for-5 CACTGTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole
Genome Amplification-for-6
ATTGGCACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole Genome
Amplification-for-7 GATCTGACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole
Genome Amplification-for-8
TCAAGTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole Genome
Amplification-for-9 CTGATCACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole
Genome Amplification-for-10
AAGCTAACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole Genome
Amplification-for-11 GTAGCCACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T
Whole Genome Amplification-for-I2
TACAAGACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T Whole Genome
Amplification-rev /5Phos/CTCGGCATTCCTGCTGAACCGCTCTTCCGAT*C*T
Inverse PCR-antisense
AATGATACGGCGACCACCGAGATCTACACCAGCAGGCCTTATAATAAAAATAATGA Inverse
PCR-for CAAGCAGAAGACGGCATACGAGATTGACTGAATATAAACTTGTGGTAGTTG
Sequencing Primer 1 (to read ACACTCTTTCCCTACACGACGCTCTTCCGATCT
internal sequences) Sequencing Primer 2 (to read
CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT internal sequences) Index Primer
1 (to read experiment CGGAAGAGCGTCGTGTAGGGAAAGAGTGT indexes) Index
Primer 2 (to read experiment CGGAAGAGCGGTTCAGCAGGAATGCCGAG indexes)
Exogenous UIDs Polymerase Fidelity Digital PCR Amplification-for
GGTTACAGGCTCATGATGTAACC Digital PCR Amplification-rev
GATACCAGCTTGGTAATGGCA UID Assignment Amplification-for
CGACGTAAAACGACGGCCAGT GGTTACAGGCTCATGATGTAACC UID Assignment
Amplification-rev CACACAGGAAACAGCTATGACCATGGATACCAGCTTGGTAATGGCA
Library Amplification-for-1
AATGATACGGCGACCACCGAGATCTACACCGTGATCGACGTAAAACGACGGCCA *G*T Library
Amplification-for-2
AATGATACGGCGACCACCGAGATCTACACACATCGCGACGTAAAACGACGGCCA *G*T Library
Amplification for-3
AATGATACGGCGACCACCGAGATCTACACGCCTAACGACGTAAAACGACGGCCA *G*T Library
Amplification-for-4
AATGATACGGCGACCACCGAGATCTACACTGGTCACGACGTAAAACGACGGCCA *G*T Library
Amplification-for-5
AATGATACGGCGACCACCGAGATCTACACCACTGTCGACGTAAAACGACGGCCA *G*T Library
Amplification for-6
AATGATACGGCGACCACCGAGATCTACACATTGGCCGACGTAAAACGACGGCCA *G*T Library
Amplification-for-7
AATGATACGGCGACCACCGAGATCTACACGATCTGCGACGTAAAACGACGGCCA *G*T Library
Amplification-for-8
AATGATACGGCGACCACCGAGATCTACACTCAAGTCGACGTAAAACGACGGCCA *G*T Library
Amplification for-9
AATGATACGGCGACCACCGAGATCTACACCTGATCCGACGTAAAACGACGGCCA *G*T Library
Amplification-for-10
AATGATACGGCGACCACCGAGATCTACACAAGCTACGACGTAAAACGACGGCCA *G*T Library
Amplification-rev
CAAGCAGAAGACGGCATACGAGATCACACAGGAAACAGCTATGACCA*T*G Sequencing
Primer (to read UID CGACGTAAAACGACGGCCAGT and internal sequences)
Index Primer (to read experiment ACTGGCCGTCGTTTTACGTCG indexes)
CTNNB1 mutations in DNA from normal human cells UID Assignment
Amplification-for CGACGTAAAACGACGGCCAGT GCAGCAACAGTCTTACCTGGA CT
UID Assignment Amplification-rev
CACACAGGAAACAGCTATGACCATGTCCACATCCTCTTCCTCAGGATT Library
Amplification-for
AATGATACGGCGACCACCGAGATCTACACCGACGTAAAACGACGGCCA*G*T Library
Amplification-rev-1 ATCACGCACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-2
CAAGCAGAAGACGGCATACGAGATCGATGTCACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-3
CAAGCAGAAGACGGCATACGAGATTGACCACACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-4
CAAGCAGAAGACGGCATACGAGATGCCAATCACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-5
CAAGCAGAAGACGGCATACGAGATCAGATCCACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-6
CAAGCAGAAGACGGCATACGAGATACTTGACACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-7
CAAGCAGAAGACGGCATACGAGATGATCAGCACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-8
CAAGCAGAAGACGGCATACGAGATTAGCTTCACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-9
CAAGCAGAAGACGGCATACGAGATGGCTACCACACAGGAAACAGCTATGACCA* T*G Library
Amplification-rev-10
CAAGCAGAAGACGGCATACGAGATCTTGTACACACAGGAAACAGCTATGACCA* T*G
Sequencing Primer (to read UID CGACGTAAAACGACGGCCAGT and internal
sequences) Index Primer (to read experiment
CATGGTCATAGCTGTTTCCTGTGTG indexes) Mitochondrial mutations in DNA
from normal human cells UID Assignment Amplification-for
CGACGTAAAACGACGGCCAGT TTACCGAGAAAGCTCACAAGA A UID Assignment
Amplification-rev CACACAGGAAACAGCTATGACCATGATGCTAAGGCGAGGATGAAA
Library Amplification-for-1
AATGATACGGCGACCACCGAGATCTACACACATCGCGACGTAAAACGACGGCCA *G*T Library
Amplification-for-2
AATGATACGGCGACCACCGAGATCTACACGCCTAACGACGTAAAACGACGGCCA *G*T Library
Amplification-for-3
AATGATACGGCGACCACCGAGATCTACACTGGTCACGACGTAAAACGACGGCCA *G*T Library
Amplification-for-4
AATGATACGGCGACCACCGAGATCTACACATTGGCCGACGTAAAACGACGGCCA *G*T Library
Amplification-for-5
AATGATACGGCGACCACCGAGATCTACACGATCTGCGACGTAAAACGACGGCCA *G*T Library
Amplification-for-6
AATGATACGGCGACCACCGAGATCTACACTCAAGTCGACGTAAAACGACGGCCA *G*T Library
Amplification-for-7
AATGATACGGCGACCACCGAGATCTACACCTGATCCGACGTAAAACGACGGCCA *G*T Library
Amplification-rev
CAAGCAGAAGACGGCATACGAGATCACACAGGAAACAGCTATGACCA*T*G Sequencing
Primer 1 (to read UIDs) CGACGTAAAACGACGGCCAGT Sequencing Primer 2
(to read CCTAATTCCCCCCATCCTTAC internal sequences) Index Primer (to
read experiment ACTGGCCGTCGTTTTACGTCG indexes) Analysis of
Phosphoramidite Oligonucleotide Composition Synthesized template,
wt GGTTACAGGCTCATGATGTAACCTCTGTGTCTTGGTGTAACTTTAAAACATATTTTTGCCAT
TACCAAGCTGGTATC Synthesized template, mut
GGTTACAGGCTCATGATGTAACCTCTGTGTCTTGGTGSAACTTTAAAACATATTTTTGCCAT (S =
50/50 mix of C and G) TACCAAGCTGGTATC UID Assignment
Amplification-for ACACTCTTTCCCTACACGACGCTC GGTGAGTCTGTGCAGGCAT UID
Assignment Amplification-rev
CTCGAGCACTGTCCTGACTGAGACGATACCAGCTTGGTAATGGCCA Library
Amplification-for
AATGATACGGCGACCACCGAGATCTACACCGTGATACACTCTTTCCCTACACGAC GC*T*C
Library Amplification-rev
CAAGCAGAAGACGGCATACGAGATCTCGAGCACTGTCCTGACTGAG*A*C Sequencing
Primer (to read UID ACACTCTTTCCCTACACGACGCTC and internal
sequences)
[0058] Exogenous UIDs. Genomic DNA from normal human colonic
mucosae or blood lymphocytes was prepared using Qiagen kits. The
DNA from colonic mucosae was used for the experiments on CTNNB1 and
mitochondrial DNA, while the lymphocyte DNA was used for the
experiments on CTNNB1 and on polymerase fidelity. DNA was
quantified with Digital PCR (2) using primers that amplified
single-copy genes from human cells (Analysis of Polymerase Fidelity
and CTNNB1), qPCR (mitochondrial DNA), or by optical absorbance
(oligonucleotides). Each strand of each template molecule was
encoded with a 12 or 14 base UID using two cycles of
amplicon-specific PCR, as described in the text and FIG. 3. The
amplicon-specific primers both contained universal tag sequences at
their 5' ends for a later amplification step. The UIDs constituted
12 or 14 random nucleotide sequences appended to the 5' end of the
forward amplicon-specific primers (Table 6). These primers can
generate 16.8 and 268 million distinct UIDs, respectively. It is
important that the number of distinct UIDs greatly exceed the
number of original template molecules to minimize the probability
that two different original templates acquired the same UID. The
UID assignment PCR cycles included Phusion Hot Start II (NEB) in a
45 uL reaction containing 1.times. Phusion HF buffer, 0.25 mM
dNTPs, 0.5 uM each forward (containing 12-14 Ns) and reverse
primers, and 2U of Phusion polymerase. To keep the final template
concentrations <1.5 ng/uL, multiple wells were used to create
some libraries. The following cycling conditions were employed: one
incubation of 98.degree. C. for 30 s (to activate the Phusion Hot
Start II); and two cycles of 98.degree. C. for 10 s, 61.degree. C.
for 120 s, and 72.degree. C. for 10 s. To ensure complete removal
of the first round primers, each well was digested with 60U of a
single strand DNA specific nuclease (Exonuclease-I; Enzymatics) at
37.degree. C. for 1 hr. After a 5 min heat-inactivation at
98.degree. C., primers complementary to the introduced universal
tags (Table 6) were added to a final concentration of 0.5 uM each.
These primers contained two terminal phosphorothioates to make them
resistant to any residual Exonuclease-I activity. They also
contained 5' grafting sequences necessary for hybridization to the
Illumina GA Ix flow cell. Finally, they contained an index sequence
between the grafting sequence and the universal tag sequence. This
index sequence enables the PCR products from multiple different
individuals to be simultaneously analyzed in the same flow cell
compartment of the sequencer. The following cycling conditions were
used for the subsequent 25 cycles of PCR: 98.degree. C. for 10 s
and 72.degree. C. for 15 s. No intermediate purification steps were
performed in an effort to reduce the losses of template
molecules.
[0059] After the second round of amplification, wells were
consolidated and purified using a Qiagen QIAquick PCR Purification
Kit (cat. no. 28104) and eluted in 50 uL EB Buffer (Qiagen).
Fragments of the expected size were purified after agarose (mtDNA
libraries) or polyacrylamide (all other libraries) gel
electrophoresis. For agarose gel purification, the eight 6-uL
aliquots were loaded into wells of a 2% Size Select Gel
(Invitrogen) and bands of the expected size were collected in EB
Buffer as specified by the manufacturer. For polyacrylamide gel
purification, ten 5-uL aliquots were loaded into wells of a 10% TBE
Polyacrylamide Gel (Invitrogen). Gel slices containing the
fragments of interest were excised, crushed, and eluted essentially
as described (3).
[0060] Analysis of Phusion polymerase fidelity. Amplification of a
fragment of human genomic DNA within the BMX (RefSeq Accession
NM_203281.2) gene was first performed using the PCR conditions
described above. The template was diluted so that an average of one
template molecule was present in every 10 wells of a 96-well PCR
plate. Fifty uL PCR reactions were then performed in 1.times.
Phusion HF buffer, 0.25 mM dNTPs, 0.5 uM each forward and reverse
primers (Table 6), and 2U of Phusion polymerase. The cycling
conditions were one cycle of 98.degree. C. for 30 s; and 19 cycles
of 98.degree. C. for 10 s, 61.degree. C. for 120 s, and 72.degree.
C. for 10 s. The primers were removed by digestion with 60U of
Exonuclease-I at 37.degree. C. for 1 hr followed by a 5 min
heat-inactivation at 98.degree. C. No purification of the PCR
product was performed, either before or after Exonuclease-I
digestion. The entire contents of each well were then used as
templates for the exogenous UIDs strategy described above.
[0061] Sequencing. Sequencing of all the libraries described above
was performed using an Illumina GA Ix instrument as specified by
the manufacturer. The total length of the reads used for each
experiment varied from 36 to 73 bases. Base-calling and sequence
alignment was performed with the Eland pipeline (Illumina). Only
high quality reads meeting the following criteria were used for
subsequent analysis: (i) the first 25 bases passed the standard
Illumina chastity filter; (ii) every base in the read had a quality
score .gtoreq.20; and (iii).ltoreq.3 mismatches to expected
sequences. For the exogenous UID libraries, we additionally
required the UIDs to have a quality score .gtoreq.30. We noticed a
relatively high frequency of errors at the ends of the reads in the
endogenous UID libraries prepared with the standard Illumina
protocol, presumably introduced during shearing or end-repair, so
the first and last three bases of these tags were excluded from
analysis.
[0062] Safe-SeqS analysis. High quality reads were grouped into
UID-families based on their endogenous or exogenous UIDs. Only
UID-families with two or more members were considered. Such
UID-families included the vast majority (.gtoreq.99%) of the
sequencing reads. To ensure that the same data was used for both
conventional and Safe-SeqS analysis, we also excluded UID-families
containing only one member from conventional analysis. Furthermore,
we only identified a base as "mutant" in conventional sequencing
analysis if the same variant was identified in at least two members
of at least one UID-family (i.e., two mutations) when comparing
conventional analysis to that of Safe-SeqS with exogenous UIDs. For
comparison with Safe-SeqS with endogenous UIDs, we required at
least two members of each of two UID-families (i.e., four
mutations) to identify a position as "mutant" in conventional
analysis. With either endogenous or exogenous UIDs, a super-mutant
was defined as a UID-family in which .gtoreq.95% of members shared
the identical mutation. Thus, UID-families with <20 members had
to be 100% identical at the mutant position, while a 5% combined
replication and sequencing error rate was permitted in UID-families
with more members. To determine polymerase fidelity using
Safe-SeqS, and to compare the results with previous analyses of
Phusion polymerase fidelity, it was necessary to realize that the
previous analyses would only detect mutations present in both
strands of the PCR products (4). This would be equivalent to
analyzing PCR products generated with one less cycle with
Safe-SeqS, and the appropriate correction was made in Table 2A.
Unless otherwise specified, all values listed in the text and
Tables represent means and standard deviations.
Example 8--Error-Generating Processes
[0063] Apparent mutations, defined as any base call that varies
from the expected base at a defined position, can result from a
variety of processes: [0064] 1. Mutations present in the template
DNA. For templates derived from normal human cells, these include
mutations that were present in the zygote, occurred later during
embryonic and adult development, or were present in a contaminant
inadvertently introduced into the sample. These mutations are
expected to be present in both strands of the relevant templates.
If the mutation occurred only in the last cell-cycle of a cell
whose DNA was used as template, the mutation would be present in
only one strand of the template. [0065] 2. Chemically-modified
bases present in the templates. It has been estimated that there
are many thousands of oxidized bases present in every human cell
(5). When such DNA is amplified by Phusion polymerase, an apparent
mutation in one strand may result. [0066] 3. Errors introduced
during the shearing process required to generate small fragments
for sequencing. Acoustic shearing generates short-lived, high
temperatures that can damage DNA. [0067] 4. Errors introduced
during end-repair of the sheared fragments. The source of these
errors can be polymerase infidelity or through incorporation of
chemically-modified bases in the dNTPs used for polymerization.
[0068] 5. Errors introduced by other enzymatic steps, particularly
if the enzymes are impure and contaminated with nucleases,
polymerases, or ligases. [0069] 6. Errors introduced during PCR
amplification to prepare the libraries for capturing or for inverse
PCR. [0070] 7. Errors during PCR after capturing or during inverse
PCR amplification. [0071] 8. Errors introduced into the UID
assignment cycles of Safe-SeqS (FIG. 3). [0072] 9. Errors
introduced into the library amplification cycles of Safe-SeqS
performed with exogenous UIDs. Note that if UID assignment primers
from process #8 are not completely removed, they could potentially
amplify DNA fragments containing errors introduced during these
cycles, creating a new super-mutant. [0073] 10. Errors introduced
into the first bridge-PCR cycle on the Illumina flow cell. If
amplification is inefficient, an error introduced into the second
bridge-PCR cycle could also result in a cluster containing a
mutation in most of its component molecules. [0074] 11. Errors in
base-calling.
Example 9--Achieving Accuracy with Safe-SeqS
[0075] With conventional sequencing-by-synthesis approaches, all
the error-producing processes described above are relevant,
resulting in a relatively high number of false-positive mutation
calls (Tables 1 and 2). Safe-SeqS minimizes the number of
false-positive mutation calls in several ways. Safe-SeqS with
exogenous UIDs results in the fewest false-positive mutation calls
because it requires the fewest enzymatic steps. With exogenous
UIDs, error-generating processes #3 to #7 are completely eliminated
because these steps aren't performed. Safe-SeqS with exogenous UIDs
also drastically reduces errors resulting from error-generating
processes #10 and #11 because of the way the data is analyzed.
[0076] After Safe-SeqS with exogenous UIDs, the only false-positive
errors remaining should be those introduced during the UID
assignment PCR cycles (error-generating process #8) or residual
UID-containing primers during the library amplification cycles
(error-generating process #9). The errors from error-generating
process #8 can theoretically be eliminated by requiring at least
two super-mutants to identify a position as "mutant." This
requirement is reasonable because every pre-existing mutation in a
double stranded DNA template should give rise to two super-mutants,
one from each strand. Furthermore, this requirement would eliminate
error-generating process #2 (damaged bases in the original
templates) because such bases, when copied, should give rise to
only one super-mutant. Finally, errors generated during the library
amplification cycles (process #9) will not be amplified by residual
UID-containing primers if those primers are completely removed,
such as performed here with excess Exonuclease-I.
[0077] With endogenous UIDs, the mistakes introduced by processes
#10 and #11 are drastically reduced because of the way in which the
data is analyzed (as with exogenous UIDs). Errors introduced in
processes #2 to #7 can be minimized by requiring that a mutation be
observed in at least two UID-families, for the reasons stated in
the paragraph above. With this requirement, few false-positive
mutations, in theory, should be identified.
[0078] In practice, the situation is complicated by the fact that
the various amplifications are not perfect, so every strand of
every original template molecule is not recovered as a UID-family.
This efficiency can vary from sample to sample, depending in part
on the concentration of inhibitors present in clinical samples.
Moreover, with exogenous UIDs, a polymerase error during the
library amplification step can create a new UID-family that wasn't
represented in the UID assignment step. If this error occurred in a
mutant template, an additional, artificial super-mutant would be
created.
[0079] These factors can be managed by incorporating various
additional criteria into the analyses. For example, one might
require UID-families to contain more than two, five or ten members.
Another requirement could be that the exogenous UIDs of
super-mutants not be related to any other UID in the library by a
one-base difference. This would eliminate artificial super-mutants
generated during the library amplification steps (noted in above
paragraph). We routinely instituted this requirement in our
Safe-SeqS analyses, but it made little difference (<1%) in the
number of super-mutants identified. Specificity for mutations can
be further increased by requiring more than one super-mutant to
identify a position as "mutant," as described above for endogenous
UIDs. When requiring multiple super-mutants, the specificity can be
even further increased by requiring that each strand of the
original double stranded template contain the mutation or, when
libraries are amplified using multiple wells, that rare mutations
share an introduced sequence that identifies the well in which the
mutations (i.e., one from each strand) were amplified. Such
decisions involve the usual trade-off between specificity and
sensitivity. In our experiments with exogenous UIDs (Table 2), we
required only one super-mutant to identify a position as "mutant"
and included all UID-families with more than one member. As
endogenous UIDs was associated with more error-generating processes
than with exogenous UIDs, we required two super-mutants to identify
a position as mutant in the experiments reported in Table 1 and
also included all UID-families with more than one member.
Example 10--Mutation Prevalences in Normal Human Tissues
[0080] The experiments reported in Tables 1 and 2, in which
>10,000 templates were assessed, show that mutations are present
in the nuclear DNA of normal human cells at a frequency of
3.5.times.10.sup.-6 to 9.0.times.10.sup.-6 mutants/bp depending on
the region analyzed. It is impossible to determine whether this low
level represents genuine mutations present in the original
templates or the sum of genuine mutations plus artifactual
mutations from the error-generating processes described above.
Mutation prevalences in human cells have not been widely
investigated, in part because they are so infrequent. However,
several clever techniques to identify rare mutants have been
devised and can in principle be used for comparison. Unfortunately,
estimates of human mutation prevalences vary widely, ranging from
as many as 10.sup.-5 mutants/bp to as many as 10.sup.-8 mutants/bp
(6-12). In several of these studies, the estimates are complicated
by the lack of data on the nature of the actual mutations--they
could in some cases be caused by losses of whole chromosomes, in
others by missense mutations, and in others mainly by nonsense
mutations or small insertions or deletions. Additionally, these
studies used various sources of normal cells and examined different
genes, making direct comparisons difficult. Estimates of the
prevalences and rates of mitochondrial DNA mutations similarly vary
(13-19). It will be of interest in future work to analyze the same
DNA templates and genes with various technologies to determine the
basis for these different estimates.
[0081] But let us assume that all of the mutations identified with
Safe-SeqS represent genuine mutations present in the original DNA
templates from normal cells. What does this tell us about the
number of generations though which these cells have proceeded since
the organism was conceived? There is a simple relationship between
mutation rate and mutation prevalence: the mutation prevalence
equals the product of the mutation rate and the number of
generations that the cell has gone through since conception. The
somatic mutation rate has been determined in previous studies to be
.about.10.sup.-9 mutants/bp/generation, though this estimate also
varies from study to study for reasons related to those mentioned
above with respect to mutation prevalence. Combining this
literature-derived estimate of mutation rate with our estimates of
mutation prevalence suggests that the normal cells analyzed
(lymphocytes, lymphoblastoid cell lines or colonic mucosae) had
proceeded through 3,500 to 8,900 generations, representing cells
dividing every 3 to 7 days for the individuals examined in this
study (average age 65 years).
Example 11--Computer Simulation of Polymerase-Introduced Errors
[0082] The timing of mutations introduced by polymerases greatly
alters the final number of mutations observed (20). For example,
two mutations would differ in prevalence by .about.64-fold if
introduced 6 cycles apart (2.sup.6). Because polymerases introduce
mutations in a stochastic manner, a simple Monte Carlo method was
employed for the simulations. In these simulations, we used the
manufacturer's estimate of the Phusion polymerase error rate with
an appropriate adjustment for ability of Safe-SeqS to detect
mutations in only one strand (4). Note that errors introduced in
cycle 19, as well as in the two UID assignment cycles, would result
in changes in only one strand of the duplex--i.e., result in one
super-mutant rather than two. In each experiment, we assumed that
there was a constant efficiency of amplification given by the total
number of templates obtained at the end of the experiment (i.e., if
the number of UID-families was N, then we assumed that the number
of templates increased by a factor of N/2.sup.19 in each cycle).
One-thousand simulations were performed for each of seven
experiments, and the results reported in Table 4.
REFERENCES (FOR EXAMPLES 8-11 ONLY)
[0083] 1. Herman D S, et al. (2009) Filter-based hybridization
capture of subgenomes enables resequencing and copy-number
detection. Nat Methods 6:507-510. [0084] 2. Vogelstein B &
Kinzler K W (1999) Digital PCR. Proc Natl Acad Sci USA
96:9236-9241. [0085] 3. Chory J & Pollard J D, Jr. (2001)
Separation of small DNA fragments by conventional gel
electrophoresis. Curr Protoc Mol Biol Chapter 2:Unit 2 7. [0086] 4.
Barnes W M (1992) The fidelity of Taq polymerase catalyzing PCR is
improved by an N-terminal deletion. Gene 112:29-35. [0087] 5.
Collins A R (1999) Oxidative DNA damage, antioxidants, and cancer.
Bioessays 21:238-246. [0088] 6. Morley A A, Cox S, & Holliday R
(1982) Human lymphocytes resistant to 6-thioguanine increase with
age. Mech Ageing Dev 19:21-26. [0089] 7. Trainor K J, et al. (1984)
Mutation frequency in human lymphocytes increases with age. Mech
Ageing Dev 27:83-86. [0090] 8. Grist S A, McCarron M, Kutlaca A,
Turner D R, & Morley A A (1992) In vivo human somatic mutation:
frequency and spectrum with age. Mutat Res 266:189-196. [0091] 9.
Williams G T, Geraghty J M, Campbell F, Appleton M A, &
Williams E D (1995)Normal colonic mucosa in hereditary
non-polyposis colorectal cancer shows no generalised increase in
somatic mutation. Br J Cancer 71:1077-1080. [0092] 10. Campbell F,
Appleton M A, Shields C J, & Williams G T (1998) No difference
in stem cell somatic mutation between the background mucosa of
right- and left-sided sporadic colorectal carcinomas. J Pathol
186:31-35. [0093] 11. Araten D J, Nafa K, Pakdeesuwan K, &
Luzzatto L (1999) Clonal populations of hematopoietic cells with
paroxysmal nocturnal hemoglobinuria genotype and phenotype are
present in normal individuals. Proc Natl Acad Sci USA 96:5209-5214.
[0094] 12. Araten D J, et al. (2005) A quantitative measurement of
the human somatic mutation rate. Cancer Res 65:8111-8117. [0095]
13. Monnat R J, Jr. & Loeb L A (1985) Nucleotide sequence
preservation of human mitochondrial DNA. Proc Natl Acad Sci USA
82:2895-2899. [0096] 14. Bodenteich A, Mitchell L G, & Merril C
R (1991) A lifetime of retinal light exposure does not appear to
increase mitochondrial mutations. Gene 108:305-309. [0097] 15.
Howell N, Kubacka I, & Mackey D A (1996) How rapidly does the
human mitochondrial genome evolve? Am J Hum Genet 59:501-509.
[0098] 16. Khrapko K, et al. (1997) Mitochondrial mutational
spectra in human cells and tissues. Proc Natl Acad Sci USA
94:13798-13803. [0099] 17. Heyer E, et al. (2001) Phylogenetic and
familial estimates of mitochondrial substitution rates: study of
control region mutations in deep-rooting pedigrees. Am J Hum Genet
69:1113-1126. [0100] 18. Howell N, et al. (2003) The pedigree rate
of sequence divergence in the human mitochondrial genome: there is
a difference between phylogenetic and pedigree rates. Am J Hum
Genet 72:659-670. [0101] 19. Taylor R W, et al. (2003)
Mitochondrial DNA mutations in human colonic crypt stem cells. J
Clin Invest 112:1351-1360. [0102] 20. Luria S E & Delbruck M
(1943) Mutations of Bacteria from Virus Sensitivity to Virus
Resistance. Genetics 28:491-511.
REFERENCES (FOR ALL EXCEPT EXAMPLES 8-11)
[0103] The disclosure of each reference cited is expressly
incorporated herein. [0104] 1. Luria S E & Delbruck M (1943)
Mutations of Bacteria from Virus Sensitivity to Virus Resistance.
Genetics 28:491-511. [0105] 2. Roach J C, et al. (2010) Analysis of
genetic inheritance in a family quartet by whole-genome sequencing.
Science 328:636-639. [0106] 3. Durbin R M, et al. (2010) A map of
human genome variation from population-scale sequencing. Nature
467:1061-1073. [0107] 4. Shibata D (2011) Mutation and epigenetic
molecular clocks in cancer. Carcinogenesis 32:123-128. [0108] 5.
McMahon M A, et al. (2007) The HBV drug entecavir--effects on HIV-1
replication and resistance. N Engl J Med 356:2614-2621. [0109] 6.
Eastman P S, et al. (1998) Maternal viral genotypic zidovudine
resistance and infrequent failure of zidovudine therapy to prevent
perinatal transmission of human immunodeficiency virus type 1 in
pediatric AIDS Clinical Trials Group Protocol 076. J Infect Dis
177:557-564. [0110] 7. Chiu R W, et al. (2008) Noninvasive prenatal
diagnosis of fetal chromosomal aneuploidy by massively parallel
genomic sequencing of DNA in maternal plasma. Proc Natl Acad Sci
USA 105:20458-20463. [0111] 8. Fan H C, Blumenfeld Y J, Chitkara U,
Hudgins L, & Quake S R (2008) Noninvasive diagnosis of fetal
aneuploidy by shotgun sequencing DNA from maternal blood. Proc Natl
Acad Sci USA 105:16266-16271. [0112] 9. Hoque M O, et al. (2003)
High-throughput molecular analysis of urine sediment for the
detection of bladder cancer by high-density single-nucleotide
polymorphism array. Cancer Res 63:5723-5726. [0113] 10. Thunnissen
F B (2003) Sputum examination for early detection of lung cancer. J
Clin Pathol 56:805-810. [0114] 11. Diehl F, et al. (2008) Analysis
of mutations in DNA isolated from plasma and stool of colorectal
cancer patients. Gastroenterology 135:489-498. [0115] 12. Barnes W
M (1992) The fidelity of Taq polymerase catalyzing PCR is improved
by an N-terminal deletion. Gene 112:29-35. [0116] 13. Araten D J,
et al. (2005) A quantitative measurement of the human somatic
mutation rate. Cancer Res 65:8111-8117. [0117] 14. Campbell F,
Appleton M A, Shields C J, & Williams G T (1998) No difference
in stem cell somatic mutation between the background mucosa of
right- and left-sided sporadic colorectal carcinomas. J Pathol
186:31-35. [0118] 15. Tindall K R & Kunkel T A (1988) Fidelity
of DNA synthesis by the Thermus aquaticus DNA polymerase.
Biochemistry 27:6008-6013. [0119] 16. Kunkel T A (1985) The
mutational specificity of DNA polymerase-beta during in vitro DNA
synthesis. Production of frameshift, base substitution, and
deletion mutations. J Biol Chem 260:5787-5796. [0120] 17. van
Dongen J J & Wolvers-Tettero I L (1991) Analysis of
immunoglobulin and T cell receptor genes. Part II: Possibilities
and limitations in the diagnosis and management of
lymphoproliferative diseases and related disorders. Clin Chim Acta
198:93-174. [0121] 18. Grist S A, McCarron M, Kutlaca A, Turner D
R, & Morley A A (1992) In vivo human somatic mutation:
frequency and spectrum with age. Mutat Res 266:189-196. [0122] 19.
Liu Q & Sommer S S (2004) Detection of extremely rare alleles
by bidirectional pyrophosphorolysis-activated polymerization
allele-specific amplification (Bi-PAP-A): measurement of mutation
load in mammalian tissues. Biotechniques 36:156-166. [0123] 20.
Monnat R J, Jr. & Loeb L A (1985) Nucleotide sequence
preservation of human mitochondrial DNA. Proc Natl Acad Sci USA
82:2895-2899. [0124] 21. Shi C, et al. (2004) LigAmp for sensitive
detection of single-nucleotide differences. Nat Methods 1:141-147.
[0125] 22. Keohavong P & Thilly W G (1989) Fidelity of DNA
polymerases in DNA amplification. Proc Natl Acad Sci USA
86:9253-9257. [0126] 23. Sidransky D, et al. (1991) Identification
of p53 gene mutations in bladder cancers and urine samples. Science
252:706-709. [0127] 24. Bielas J H & Loeb L A (2005)
Quantification of random genomic mutations. Nat Methods 2:285-290.
[0128] 25. Vogelstein B & Kinzler K W (1999) Digital PCR. Proc
Natl Acad Sci USA 96:9236-9241. [0129] 26. Mitra R D, et al. (2003)
Digital genotyping and haplotyping with polymerase colonies. Proc
Natl Acad Sci USA 100:5926-5931. [0130] 27. Chetverina H V, Samatov
T R, Ugarov V I, & Chetverin A B (2002) Molecular colony
diagnostics: detection and quantitation of viral nucleic acids by
in-gel PCR. Biotechniques 33:150-152, 154, 156. [0131] 28.
Zimmermann B G, et al. (2008) Digital PCR: a powerful new tool for
noninvasive prenatal diagnosis? Prenat Diagn 28:1087-1093. [0132]
29. Dressman D, Yan H, Traverso G, Kinzler K W, & Vogelstein B
(2003) Transforming single DNA molecules into fluorescent magnetic
particles for detection and enumeration of genetic variations. Proc
Natl Acad Sci USA 100:8817-8822. [0133] 30. Ottesen E A, Hong J W,
Quake S R, & Leadbetter J R (2006) Microfluidic digital PCR
enables multigene analysis of individual environmental bacteria.
Science 314:1464-1467. [0134] 31. Quail M A, et al. (2008) A large
genome center's improvements to the Illumina sequencing system. Nat
Methods 5:1005-1010. [0135] 32. Nazarian R, et al. (2010) Melanomas
acquire resistance to B-RAF(V600E) inhibition by RTK or N-RAS
upregulation. Nature 468:973-977. [0136] 33. He Y, et al. (2010)
Heteroplasmic mitochondrial DNA mutations in normal and tumour
cells. Nature 464:610-614. [0137] 34. Gore A, et al. (2011) Somatic
coding mutations in human induced pluripotent stem cells. Nature
471:63-67. [0138] 35. Dohm J C, Lottaz C, Borodina T, &
Himmelbauer H (2008) Substantial biases inultra-short read data
sets from high-throughput DNA sequencing. Nucleic Acids Res
36:e105. [0139] 36. Erlich Y, Mitra P P, delaBastide M, McCombie W
R, & Hannon G J (2008) Alta-Cyclic: a self-optimizing base
caller for next-generation sequencing. Nat Methods 5:679-682.
[0140] 37. Rougemont J, et al. (2008) Probabilistic base calling of
Solexa sequencing data. BMC Bioinformatics 9:431. [0141] 38. Druley
T E, et al. (2009) Quantification of rare allelic variants from
pooled genomic DNA. Nat Methods 6:263-265. [0142] 39. Vallania F L,
et al. (2010) High-throughput discovery of rare insertions and
deletions in large cohorts. Genome Res 20:1711-1718. [0143] 40.
McCloskey M L, Stoger R, Hansen R S, & Laird C D (2007)
Encoding PCR products with batch-stamps and barcodes. Biochem Genet
45:761-767. [0144] 41. Parameswaran P, et al. (2007) A
pyrosequencing-tailored nucleotide barcode design unveils
opportunities for large-scale sample multiplexing. Nucleic Acids
Res 35:e130. [0145] 42. Craig D W, et al. (2008) Identification of
genetic variants using bar-coded multiplexed sequencing. Nat
Methods 5:887-893. [0146] 43. Miner B E, Stoger R J, Burden A F,
Laird C D, & Hansen R S (2004) Molecular barcodes detect
redundancy and contamination in hairpin-bisulfite PCR. Nucleic
Acids Res 32:e135. [0147] 44. Herman D S, et al. (2009)
Filter-based hybridization capture of subgenomes enables
resequencing and copy-number detection. Nat Methods 6:507-510.
[0148] 45. Jones P A & Baylin S B (2007) The epigenomics of
cancer. Cell 128:683-692. [0149] 46. de Boer J G & Ripley L S
(1988) An in vitro assay for frameshift mutations: hotspots for
deletions of 1 bp by Klenow-fragment polymerase share a consensus
DNA sequence. Genetics 118:181-191. [0150] 47. Eckert K A &
Kunkel T A (1990) High fidelity DNA synthesis by the Thermus
aquaticus DNA polymerase. Nucleic Acids Res 18:3739-3744. [0151]
48. Kosuri S, et al. (2010) Scalable gene synthesis by selective
amplification of DNA pools from high-fidelity microchips. Nat
Biotechnol 28:1295-1299. [0152] 49. Matzas M, et al. (2010)
High-fidelity gene synthesis by retrieval of sequence-verified DNA
identified using high-throughput pyrosequencing. Nat Bio technol
28:1291-1294. [0153] 50. Li J, et al. (2008) Replacing PCR with
COLD-PCR enriches variant DNA sequences and redefines the
sensitivity of genetic testing. Nat Med 14:579-584. [0154] 51. Eid
J, et al. (2009) Real-time DNA sequencing from single polymerase
molecules. Science 323:133-138.
Sequence CWU 1
1
81132DNAArtificial SequencePrimers and adapters 1gatcggaaga
gcggttcagc aggaatgccg ag 32233DNAArtificial SequencePrimers and
adapters 2acactctttc cctacacgac gctcttccga tct 33362DNAArtificial
SequencePrimers and adapters 3aatgatacgg cgaccaccga gatctacaca
cactctttcc ctacacgacg ctcttccgat 60ct 62457DNAArtificial
SequencePrimers and adapters 4caagcagaag acggcatacg agatctcggc
attcctgctg aaccgctctt ccgatct 57562DNAArtificial SequencePrimers
and adapters 5aatgatacgg cgaccaccga gatctacaca cactctttcc
ctacacgacg ctcttccgat 60ct 62657DNAArtificial SequencePrimers and
adapters 6caagcagaag acggcatacg agatctcggc attcctgctg aaccgctctt
ccgatct 57733DNAArtificial SequencePrimers and adapters 7acactctttc
cctacacgac gctcttccga tct 33833DNAArtificial SequencePrimers and
adapters 8ctcggcattc ctgctgaacc gctcttccga tct 33932DNAArtificial
SequencePrimers and adapters 9gatcggaaga gcggttcagc aggaatgccg ag
321033DNAArtificial SequencePrimers and adapters 10acactctttc
cctacacgac gctcttccga tct 331139DNAArtificial SequencePrimers and
adapters 11cgtgatacac tctttcccta cacgacgctc ttccgatct
391239DNAArtificial SequencePrimers and adapters 12acatcgacac
tctttcccta cacgacgctc ttccgatct 391339DNAArtificial SequencePrimers
and adapters 13gcctaaacac tctttcccta cacgacgctc ttccgatct
391439DNAArtificial SequencePrimers and adapters 14tggtcaacac
tctttcccta cacgacgctc ttccgatct 391539DNAArtificial SequencePrimers
and adapters 15cactgtacac tctttcccta cacgacgctc ttccgatct
391639DNAArtificial SequencePrimers and adapters 16attggcacac
tctttcccta cacgacgctc ttccgatct 391739DNAArtificial SequencePrimers
and adapters 17gatctgacac tctttcccta cacgacgctc ttccgatct
391839DNAArtificial SequencePrimers and adapters 18tcaagtacac
tctttcccta cacgacgctc ttccgatct 391939DNAArtificial SequencePrimers
and adapters 19ctgatcacac tctttcccta cacgacgctc ttccgatct
392039DNAArtificial SequencePrimers and adapters 20aagctaacac
tctttcccta cacgacgctc ttccgatct 392139DNAArtificial SequencePrimers
and adapters 21gtagccacac tctttcccta cacgacgctc ttccgatct
392239DNAArtificial SequencePrimers and adapters 22tacaagacac
tctttcccta cacgacgctc ttccgatct 392333DNAArtificial SequencePrimers
and adapters 23ctcggcattc ctgctgaacc gctcttccga tct
332456DNAArtificial SequencePrimers and adapters 24aatgatacgg
cgaccaccga gatctacacc agcaggcctt ataataaaaa taatga
562551DNAArtificial SequencePrimers and adapters 25caagcagaag
acggcatacg agattgactg aatataaact tgtggtagtt g 512633DNAArtificial
SequencePrimers and adapters 26acactctttc cctacacgac gctcttccga tct
332733DNAArtificial SequencePrimers and adapters 27ctcggcattc
ctgctgaacc gctcttccga tct 332829DNAArtificial SequencePrimers and
adapters 28cggaagagcg tcgtgtaggg aaagagtgt 292929DNAArtificial
SequencePrimers and adapters 29cggaagagcg gttcagcagg aatgccgag
293023DNAArtificial SequencePrimers and adapters 30ggttacaggc
tcatgatgta acc 233121DNAArtificial SequencePrimers and adapters
31gataccagct tggtaatggc a 213256DNAArtificial SequencePrimers and
adaptersmisc_feature(22)..(33)n = A,T,C or G 32cgacgtaaaa
cgacggccag tnnnnnnnnn nnnggttaca ggctcatgat gtaacc
563346DNAArtificial SequencePrimers and adapters 33cacacaggaa
acagctatga ccatggatac cagcttggta atggca 463456DNAArtificial
SequencePrimers and adapters 34aatgatacgg cgaccaccga gatctacacc
gtgatcgacg taaaacgacg gccagt 563556DNAArtificial SequencePrimers
and adapters 35aatgatacgg cgaccaccga gatctacaca catcgcgacg
taaaacgacg gccagt 563656DNAArtificial SequencePrimers and adapters
36aatgatacgg cgaccaccga gatctacacg cctaacgacg taaaacgacg gccagt
563756DNAArtificial SequencePrimers and adapters 37aatgatacgg
cgaccaccga gatctacact ggtcacgacg taaaacgacg gccagt
563856DNAArtificial SequencePrimers and adapters 38aatgatacgg
cgaccaccga gatctacacc actgtcgacg taaaacgacg gccagt
563956DNAArtificial SequencePrimers and adapters 39aatgatacgg
cgaccaccga gatctacaca ttggccgacg taaaacgacg gccagt
564056DNAArtificial SequencePrimers and adapters 40aatgatacgg
cgaccaccga gatctacacg atctgcgacg taaaacgacg gccagt
564156DNAArtificial SequencePrimers and adapters 41aatgatacgg
cgaccaccga gatctacact caagtcgacg taaaacgacg gccagt
564256DNAArtificial SequencePrimers and adapters 42aatgatacgg
cgaccaccga gatctacacc tgatccgacg taaaacgacg gccagt
564356DNAArtificial SequencePrimers and adapters 43aatgatacgg
cgaccaccga gatctacaca agctacgacg taaaacgacg gccagt
564449DNAArtificial SequencePrimers and adapters 44caagcagaag
acggcatacg agatcacaca ggaaacagct atgaccatg 494521DNAArtificial
SequencePrimers and adapters 45cgacgtaaaa cgacggccag t
214621DNAArtificial SequencePrimers and adapters 46actggccgtc
gttttacgtc g 214758DNAArtificial SequencePrimers and
adaptersmisc_feature(22)..(35)n = A,T,C or G 47cgacgtaaaa
cgacggccag tnnnnnnnnn nnnnngcagc aacagtctta cctggact
584848DNAArtificial SequencePrimers and adapters 48cacacaggaa
acagctatga ccatgtccac atcctcttcc tcaggatt 484950DNAArtificial
SequencePrimers and adapters 49aatgatacgg cgaccaccga gatctacacc
gacgtaaaac gacggccagt 505055DNAArtificial SequencePrimers and
adapters 50caagcagaag acggcatacg agatatcacg cacacaggaa acagctatga
ccatg 555155DNAArtificial SequencePrimers and adapters 51caagcagaag
acggcatacg agatcgatgt cacacaggaa acagctatga ccatg
555255DNAArtificial SequencePrimers and adapters 52caagcagaag
acggcatacg agattgacca cacacaggaa acagctatga ccatg
555355DNAArtificial SequencePrimers and adapters 53caagcagaag
acggcatacg agatgccaat cacacaggaa acagctatga ccatg
555455DNAArtificial SequencePrimers and adapters 54caagcagaag
acggcatacg agatcagatc cacacaggaa acagctatga ccatg
555555DNAArtificial SequencePrimers and adapters 55caagcagaag
acggcatacg agatacttga cacacaggaa acagctatga ccatg
555655DNAArtificial SequencePrimers and adapters 56caagcagaag
acggcatacg agatgatcag cacacaggaa acagctatga ccatg
555755DNAArtificial SequencePrimers and adapters 57caagcagaag
acggcatacg agattagctt cacacaggaa acagctatga ccatg
555855DNAArtificial SequencePrimers and adapters 58caagcagaag
acggcatacg agatggctac cacacaggaa acagctatga ccatg
555955DNAArtificial SequencePrimers and adapters 59caagcagaag
acggcatacg agatcttgta cacacaggaa acagctatga ccatg
556021DNAArtificial SequencePrimers and adapters 60cgacgtaaaa
cgacggccag t 216125DNAArtificial SequencePrimers and adapters
61catggtcata gctgtttcct gtgtg 256257DNAArtificial SequencePrimers
and adaptersmisc_feature(22)..(35)n = A,T,C or G 62cgacgtaaaa
cgacggccag tnnnnnnnnn nnnnnttacc gagaaagctc acaagaa
576345DNAArtificial SequencePrimers and adapters 63cacacaggaa
acagctatga ccatgatgct aaggcgagga tgaaa 456456DNAArtificial
SequencePrimers and adapters 64aatgatacgg cgaccaccga gatctacaca
catcgcgacg taaaacgacg gccagt 566556DNAArtificial SequencePrimers
and adapters 65aatgatacgg cgaccaccga gatctacacg cctaacgacg
taaaacgacg gccagt 566656DNAArtificial SequencePrimers and adapters
66aatgatacgg cgaccaccga gatctacact ggtcacgacg taaaacgacg gccagt
566756DNAArtificial SequencePrimers and adapters 67aatgatacgg
cgaccaccga gatctacaca ttggccgacg taaaacgacg gccagt
566856DNAArtificial SequencePrimers and adapters 68aatgatacgg
cgaccaccga gatctacacg atctgcgacg taaaacgacg gccagt
566956DNAArtificial SequencePrimers and adapters 69aatgatacgg
cgaccaccga gatctacact caagtcgacg taaaacgacg gccagt
567056DNAArtificial SequencePrimers and adapters 70aatgatacgg
cgaccaccga gatctacacc tgatccgacg taaaacgacg gccagt
567149DNAArtificial SequencePrimers and adapters 71caagcagaag
acggcatacg agatcacaca ggaaacagct atgaccatg 497221DNAArtificial
SequencePrimers and adapters 72cgacgtaaaa cgacggccag t
217321DNAArtificial SequencePrimers and adapters 73cctaattccc
cccatcctta c 217421DNAArtificial SequencePrimers and adapters
74actggccgtc gttttacgtc g 217577DNAArtificial SequencePrimers and
adapters 75ggttacaggc tcatgatgta acctctgtgt cttggtgtaa ctttaaaaca
tatttttgcc 60attaccaagc tggtatc 777677DNAArtificial SequencePrimers
and adapters 76ggttacaggc tcatgatgta acctctgtgt cttggtgsaa
ctttaaaaca tatttttgcc 60attaccaagc tggtatc 777755DNAArtificial
SequencePrimers and adaptersmisc_feature(25)..(36)n = A,T,C or G
77acactctttc cctacacgac gctcnnnnnn nnnnnnggtg agtctgtgca ggcat
557845DNAArtificial SequencePrimers and adapters 78ctcgagcact
gtcctgactg agacgatacc agcttggtaa tggca 457959DNAArtificial
SequencePrimers and adapters 79aatgatacgg cgaccaccga gatctacacc
gtgatacact ctttccctac acgacgctc 598048DNAArtificial SequencePrimers
and adapters 80caagcagaag acggcatacg agatctcgag cactgtcctg actgagac
488124DNAArtificial SequencePrimers and adapters 81acactctttc
cctacacgac gctc 24
* * * * *