U.S. patent application number 17/241603 was filed with the patent office on 2021-08-26 for immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof.
This patent application is currently assigned to Pfizer Inc.. The applicant listed for this patent is Pfizer Inc.. Invention is credited to Raul Enrique Isturiz, Luis Pascual Jodar Martin-Montalvo, Ralf Rene Reinert, Wendy Jo Watson.
Application Number | 20210260177 17/241603 |
Document ID | / |
Family ID | 1000005583490 |
Filed Date | 2021-08-26 |
United States Patent
Application |
20210260177 |
Kind Code |
A1 |
Watson; Wendy Jo ; et
al. |
August 26, 2021 |
IMMUNOGENIC COMPOSITIONS COMPRISING CONJUGATED CAPSULAR SACCHARIDE
ANTIGENS, KITS COMPRISING THE SAME AND USES THEREOF
Abstract
The present invention relates to new immunogenic compositions
comprising conjugated Streptococcus pneumoniae capsular saccharide
antigens (glycoconjugates), kits comprising said immunogenic
compositions and uses thereof. Immunogenic compositions of the
present invention will typically comprise at least one
glycoconjugate from a S. pneumoniae serotype not found in
PREVNAR.RTM., SYNFLORIX.RTM. and/or PREVNAR 13.RTM.. The invention
also relates to vaccination of human subjects, in particular
infants and elderly, against pneumoccocal infections using said
novel immunogenic compositions.
Inventors: |
Watson; Wendy Jo; (Blue
Bell, PA) ; Jodar Martin-Montalvo; Luis Pascual;
(Villanova, PA) ; Isturiz; Raul Enrique;
(Norristown, PA) ; Reinert; Ralf Rene; (Bad Soden
am Taunus, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Pfizer Inc. |
New York |
NY |
US |
|
|
Assignee: |
Pfizer Inc.
New York
NY
|
Family ID: |
1000005583490 |
Appl. No.: |
17/241603 |
Filed: |
April 27, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16140934 |
Sep 25, 2018 |
11020469 |
|
|
17241603 |
|
|
|
|
15214693 |
Jul 20, 2016 |
10124050 |
|
|
16140934 |
|
|
|
|
62194965 |
Jul 21, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/70 20130101;
A61K 2039/55 20130101; A61K 39/385 20130101; A61K 47/6415 20170801;
A61K 2039/6068 20130101; C08H 1/00 20130101; A61K 47/646 20170801;
A61K 39/092 20130101; C08B 37/006 20130101; A61K 2039/545 20130101;
A61K 2039/6037 20130101 |
International
Class: |
A61K 39/09 20060101
A61K039/09; A61K 39/385 20060101 A61K039/385; A61K 47/64 20060101
A61K047/64; C08B 37/00 20060101 C08B037/00; C08H 1/00 20060101
C08H001/00 |
Claims
1. A kit comprising: (a) a first immunogenic composition comprising
at least one glycoconjugate selected from the group consisting of a
glycoconjugate from Streptococcus pneumoniae serotype 15B, a
glycoconjugate from S. pneumoniae serotype 22F, a glycoconjugate
from S. pneumoniae serotype 33F, a glycoconjugate from S.
pneumoniae serotype 12F, a glycoconjugate from S. pneumoniae
serotype 10A, a glycoconjugate from S. pneumoniae serotype 11A and
a glycoconjugate from S. pneumoniae serotype 8, wherein said
composition is a 1, 2, 3, 4, 5, 6 or 7-valent pneumococcal
conjugate composition; and (b) a second immunogenic composition
comprising at least one glycoconjugate from an S. pneumoniae
serotype selected from the group consisting of serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F for simultaneous,
concurrent, concomitant or sequential administration of the first
and second immunogenic compositions.
2. The kit of claim 1, wherein said first immunogenic composition
comprises a glycoconjugate from S. pneumoniae serotype 15B, a
glycoconjugate from S. pneumoniae serotype 22F, a glycoconjugate
from S. pneumoniae serotype 33F, a glycoconjugate from S.
pneumoniae serotype 12F, a glycoconjugate from S. pneumoniae
serotype 10A, a glycoconjugate from S. pneumoniae serotype 11A and
a glycoconjugate from S. pneumoniae serotype 8, and wherein said
composition is a 7-valent pneumococcal conjugate composition.
3. The kit of claim 1, wherein said at least one glycoconjugate of
said first immunogenic composition is individually conjugated to
CRM.sub.197.
4. The kit of claim 1, wherein said first immunogenic composition
further comprises an adjuvant.
5. The kit of claim 1, wherein said second immunogenic composition
comprises glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V,
14, 18C, 19F and 23F.
6. The kit of claim 5, wherein said glycoconjugates from S.
pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are conjugated
to CRM.sub.197.
7. The kit of claim 1, wherein said second immunogenic composition
comprises glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B,
7F, 9V, 14, 18C, 19F and 23F.
8. The kit of claim 7, wherein said glycoconjugates from S.
pneumoniae serotypes 1, 5 and 7F are conjugated to CRM.sub.197.
9. The kit of claim 7, wherein said glycoconjugate from S.
pneumoniae serotype 18C is conjugated to tetanus toxoid (TT).
10. The kit of claim 7, wherein said glycoconjugate from S.
pneumoniae serotype 19F is conjugated to diphtheria toxoid
(DT).
11. The kit of claim 7, wherein said glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and 23F are
individually conjugated to Haemophilus influenzae protein D
(PD).
12. The kit of claim 7, wherein said glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F are
individually conjugated to PD, said glycoconjugate from S.
pneumoniae serotype 18C is conjugated to TT and said glycoconjugate
from S. pneumoniae serotype 19F is conjugated to DT.
13. The kit of claim 1, wherein said second immunogenic composition
comprises glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5,
6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F.
14. The kit of claim 13, wherein said glycoconjugates from S.
pneumoniae serotypes 3, 6A and 19A are conjugated to
CRM.sub.197.
15. The kit of claim 13, wherein said glycoconjugates from S.
pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F
and 23F are conjugated to CRM.sub.197.
16. The kit of claim 1, wherein said second immunogenic composition
is a 7, 8, 9, 10, 11, 12, 13, 14 or 15-valent pneumococcal
conjugate composition.
17. The kit of claim 1, wherein said second immunogenic composition
is a 13-valent pneumococcal conjugate composition consisting of
glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F and 23F individually conjugated to
CRM.sub.197.
18. The kit of claim 1, wherein said second immunogenic composition
further comprises an adjuvant.
19. The kit of claim 1, wherein the first and second immunogenic
compositions are administered simultaneously.
20. The kit of claim 1, wherein a schedule of vaccination for said
simultaneous administration is a multiple dose schedule.
21. The kit of claim 20, wherein said multiple dose schedule
comprises at least one dose in the first year of age followed by at
least one toddler dose.
22. The kit of claim 1, wherein the first and second immunogenic
compositions are administered concomitanly.
23. The kit of claim 1, wherein a schedule of vaccination for said
concomitant administration is a multiple dose schedule.
24. The kit of claim 22, wherein said multiple dose schedule
comprises at least one dose in the first year of age followed by at
least one toddler dose.
25. The kit of claim 1, wherein the first and second immunogenic
compositions are administered concurrently.
26. The kit of claim 1, wherein a schedule of vaccination for said
concurrent administration is a multiple dose schedule.
27. The kit of claim 26, wherein said multiple dose schedule
comprises at least one dose in the first year of age followed by at
least one toddler dose.
28. The kit of claim 1, wherein the first and second immunogenic
compositions are administered sequentially.
29. The kit of claim 28, wherein a schedule of vaccination for said
sequential administration comprises a series of 2, 3, 4, 5, 6, 7 or
8 doses.
30. The kit of claim 28, wherein a schedule of vaccination
comprises the sequential administration of: (a) the first
immunogenic composition and (b) concomitant or concurrent
administration of the first immunogenic composition with the second
immunogenic composition.
31. The kit of claim 28, wherein a schedule of vaccination
comprises the sequential administration of: (a) the second
immunogenic composition and (b) concomitant or concurrent
administration of the first immunogenic composition with the second
immunogenic composition.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Continuation application of U.S. Ser.
No. 16/140,934 (allowed), filed Sep. 25, 2018, which is a
Continuation application of U.S. Ser. No. 15/214,693, filed on Jul.
20, 2016, now U.S. Pat. No. 10,124,050, which claims the benefit
under 35 U.S.C. .sctn. 119(e) of U.S. Provisional Application Ser.
No. 62/194,965, filed Jul. 21, 2015, both of which are incorporated
by reference in their entirety.
REFERENCE TO SEQUENCE LISTING
[0002] This application is being filed electronically via EFS-Web
and includes an electronically submitted sequence listing in .txt
format. The .txt file contains a sequence listing entitled
"PC72217C_ST25.txt", created on Apr. 27, 2021 and having a size of
9 KB. The sequence listing contained in this .txt file is part of
the specification and is herein incorporated by reference in its
entirety.
FIELD OF THE INVENTION
[0003] The present invention relates to new immunogenic
compositions comprising conjugated capsular saccharide antigens
(glycoconjugates), kits comprising said immunogenic compositions
and uses thereof. Immunogenic compositions of the present invention
will typically comprise glycoconjugates, wherein the saccharides
are derived from serotypes of Streptococcus pneumoniae. The
invention also relates to vaccination of human subjects, in
particular infants and elderly, against pneumoccocal infections
using said novel immunogenic compositions and kits.
BACKGROUND OF THE INVENTION
[0004] Infections caused by pneumococci are a major cause of
morbidity and mortality all over the world. Pneumonia, febrile
bacteraemia and meningitis are the most common manifestations of
invasive pneumococcal disease, whereas bacterial spread within the
respiratory tract may result in middle-ear infection, sinusitis or
recurrent bronchitis. Compared with invasive disease, the
non-invasive manifestations are usually less severe, but
considerably more common.
[0005] In Europe and the United States, pneumococcal pneumonia is
the most common community-acquired bacterial pneumonia, estimated
to affect approximately 100 per 100,000 adults each year. The
corresponding figures for febrile bacteraemia and meningitis are
15-19 per 100 000 and 1-2 per 100,000, respectively. The risk for
one or more of these manifestations is much higher in infants and
elderly people, as well as immune compromised persons of any age.
Even in economically developed regions, invasive pneumococcal
disease carries high mortality; for adults with pneumococcal
pneumonia the mortality rate averages 10%-20%, whilst it may exceed
50% in the high-risk groups. Pneumonia is by far the most common
cause of pneumococcal death worldwide.
[0006] The etiological agent of pneumococcal diseases,
Streptococcus pneumoniae (pneumococcus), is a Gram-positive
encapsulated coccus, surrounded by a polysaccharide capsule.
Differences in the composition of this capsule permit serological
differentiation between about 91 capsular types, some of which are
frequently associated with pneumococcal disease, others rarely.
Invasive pneumococcal infections include pneumonia, meningitis and
febrile bacteremia; among the common non-invasive manifestations
are otitis media, sinusitis and bronchitis.
[0007] Pneumococcal conjugate vaccines (PCVs) are pneumococcal
vaccines used to protect against disease caused by S. pneumoniae
(pneumococcus). There are currently three PCV vaccines available on
the global market: PREVNAR.RTM. (PREVENAR.RTM. in some countries)
(heptavalent vaccine), SYNFLORIX.RTM. (a decavalent vaccine) and
PREVNAR 13.RTM. (PREVENAR 13.RTM. in some countries) (tridecavalent
vaccine).
[0008] The recent development of widespread microbial resistance to
essential antibiotics and the increasing number of
immunocompromised persons underline the need for pneumococcal
vaccines with even broader protection.
[0009] In particular, there is a need to address remaining unmet
medical need for coverage of pneumococcal disease due to serotypes
not found in PREVNAR 13.RTM. and potential for emergence of non
PREVNAR 13.RTM. serotypes. The specific serotypes causing disease
beyond the 13 in PREVNAR 13.RTM. vary by region, population, and
may change over time due to acquisition of antibiotic resistance,
pneumococcal vaccine introduction and secular trends of unknown
origin. There is a need for immunogenic compositions that can be
used to induce an immune response against additional Streptococcus
pneumoniae serotypes in humans and in particular in children less
than 2 years old.
[0010] An object of the new immunogenic compositions of the present
invention is to provide for appropriate protection against S.
pneumoniae serotypes not found in PREVNAR 13.RTM.. In one aspect,
an object of the immunogenic compositions of the present invention
is to provide for appropriate protection against S. pneumoniae
serotypes not found in PREVNAR.RTM. (heptavalent vaccine),
SYNFLORIX.RTM. and/or PREVNAR 13.RTM. while maintaining an immune
response against serotypes currently covered by said vaccines. The
phenomenon of antigenic competition (or interference) complicates
the development of multi-valent vaccines. Antigenic interference
refers to the observation that administering multiple antigens can
result in a diminished response to certain antigens relative to the
immune response observed when such antigens are administered
individually. Its occurrence when making new combinations of
antigens is unpredictable. An object of the immunogenic
compositions, kits and schedules of administration of the present
invention is to provide for appropriate protection against S.
pneumoniae serotypes not found in PREVNAR 13.RTM. while maintaining
an immune response against serotypes currently covered by said
vaccine and minimizing the risk of immune interference.
SUMMARY OF THE INVENTION
[0011] To meet these and other needs, the present invention relates
to novel immunogenic compositions, kits comprising the same and
uses thereof. The following clauses describe some aspects and
embodiments of the invention.
[0012] One aspect of the invention relates to an immunogenic
composition comprising at least one glycoconjugate selected from
the group consisting of a glycoconjugate from S. pneumoniae
serotype 15B, a glycoconjugate from S. pneumoniae serotype 22F, a
glycoconjugate from S. pneumoniae serotype 33F, a glycoconjugate
from S. pneumoniae serotype 12F, a glycoconjugate from S.
pneumoniae serotype 10A, a glycoconjugate from S. pneumoniae
serotype 11A and a glycoconjugate from S. pneumoniae serotype 8,
wherein said composition is a 1, 2, 3, 4, 5, 6 or 7-valent
pneumococcal conjugate composition.
[0013] In an aspect the invention provides a kit comprising: (a) a
first immunogenic composition comprising said immunogenic
composition; and (b) a second immunogenic composition comprising at
least one glycoconjugate from a Streptococcus pneumoniae serotype
selected from the group consisting of serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F.
[0014] In another aspect, the invention provides said immunogenic
composition for simultaneous, concurrent, concomitant or sequential
administration.
[0015] One aspect of the invention provides for said immunogenic
composition for use in a vaccination schedule. In one embodiment,
the vaccination schedule is a single dose schedule. In another
embodiment, the vaccination schedule is a multiple dose
schedule.
[0016] In an aspect, said kit is for simultaneous, concurrent,
concomitant or sequential administration of the first and second
immunogenic compositions.
[0017] Another aspect of the invention provides for said
immunogenic composition or said kit for use as a medicament.
[0018] In one aspect of the invention, said immunogenic composition
or said kit is for use as a vaccine.
[0019] In another aspect of the invention provides for said
immunogenic composition or said kit for use in a method for
preventing, treating or ameliorating a bacterial infection, disease
or condition in a subject.
[0020] Another aspect of the invention, said immunogenic
composition or said kit is for use in a method for preventing a
bacterial infection, disease or condition in a subject.
[0021] One aspect of the invention provides for said immunogenic
composition or said kit for use in a method to protect or treat a
human susceptible to pneumococcal infection, by means of
administering said immunogenic compositions via a systemic or
mucosal route.
FIGURES
[0022] FIG. 1 shows a repeating polysaccharide structure of S.
pneumoniae serotype 8 (Pn-8) capsular polysaccharide.
[0023] FIG. 2 shows a repeating polysaccharide structure of S.
pneumoniae serotype 10A (Pn-10A) capsular polysaccharide.
[0024] FIG. 3 shows a repeating polysaccharide structure of S.
pneumoniae serotype 11A (Pn-11A) capsular polysaccharide.
[0025] FIG. 4 shows a repeating polysaccharide structure of S.
pneumoniae serotype 12F (Pn-12F) capsular polysaccharide.
[0026] FIG. 5 shows a repeating polysaccharide structure of S.
pneumoniae serotype 15B (Pn-15B) capsular polysaccharide.
[0027] FIG. 6 shows a repeating polysaccharide structure of S.
pneumoniae serotype 22F (Pn-22F) capsular polysaccharide.
[0028] FIG. 7 shows a repeating polysaccharide structure of S.
pneumoniae serotype 33F (Pn-33F) capsular polysaccharide.
[0029] FIG. 8 shows a representative process flow diagram for the
activation (A) and conjugation (B) processes which can be used in
the preparation of Pn-33F glycoconjugate.
[0030] FIG. 9 shows the effect on DO by varying amount of NCS in
the TEMPO/NCS oxidation reaction.
[0031] FIG. 10 shows evaluation of Pn-12F glycoconjugates
stability.
[0032] FIG. 11 Cross-Functional OPA Responses. A subset of 59 sera
from adults vaccinated with a 13 valent Pneumococcal Conjugate
Vaccine (US Study 6115A1-004; ClinicalTrials.gov Identifier:
NCT00427895) was assessed in OPAs for the presence of functional
antibodies against serotypes 9V, 9A, 9L, and 9N. The percent of
samples with OPA positive titer (i.e., .gtoreq.1:8) is indicated
above each group. Geometric mean titers (GMT) are listed in the x
axis below each group.
[0033] FIG. 12 Cross-Functional OPA Responses of Sixty-six Matched
pre/post Sera. A subset of 66 matched pre- and post-vaccinated
serum panel from adults vaccinated with a 13 valent Pneumococcal
Conjugate Vaccine (study 6115A1-3005; ClinicalTrials.gov
Identifier: NCT00546572) were assessed in OPAs for the presence of
functional antibodies against serotypes 9V, 9A, 9L, and 9N. The
percent of samples with OPA positive titer (i.e., .gtoreq.1:8) is
indicated above each group. Geometric mean titers (GMT) are listed
in the x axis below each group.
[0034] FIG. 13 Reverse cumulative distribution curves (RCDC) of pre
and post Immunization-pneumococcal serotype 9V (Pn9V). Reverse
cumulative distribution curves of OPA titers to serotype 9V from a
matched pre- and post-vaccination serum panel (N=66) vaccinated
with a 13 valent Pneumococcal Conjugate Vaccine (study 6115A1-3005;
ClinicalTrials.gov Identifier: NCT00546572). The plots represent
the percent of sera with OPA positive titer (i.e.,
.gtoreq.1:8).
[0035] FIG. 14 Reverse cumulative distribution curves (RCDC) of pre
and post Immunization-pneumococcal serotype 9A (Pn9A). Reverse
cumulative distribution curves of OPA titers to serotype 9A from a
matched pre- and post-vaccination serum panel (N=66) vaccinated
with a 13 valent Pneumococcal Conjugate Vaccine (study 6115A1-3005,
ClinicalTrials.gov Identifier: NCT00546572). The plots represent
the percent of sera with OPA positive titer (i.e.,
.gtoreq.1:8).
[0036] FIG. 15 Reverse cumulative distribution curves (RCDC) of pre
and post Immunization-pneumococcal serotype 9L (Pn9L). Reverse
cumulative distribution curves of OPA titers to serotype 9L from a
matched pre- and post-vaccination serum panel (N=66) vaccinated
with with a 13 valent Pneumococcal Conjugate Vaccine (study
6115A1-3005, ClinicalTrials.gov Identifier: NCT00546572). The plots
represent the percent of sera with OPA positive titer (i.e.,
.gtoreq.1:8).
[0037] FIG. 16 Reverse cumulative distribution curves (RCDC) of pre
and post Immunization-pneumococcal serotype 9N (Pn9N). Reverse
cumulative distribution curves of OPA titers to serotype 9N from a
matched pre- and post-vaccination serum panel (N=66) vaccinated
with with a 13 valent Pneumococcal Conjugate Vaccine (study
6115A1-3005, ClinicalTrials.gov Identifier: NCT00546572). The plots
represent the percent of sera with OPA positive titer (i.e.,
1:8).
1. GLYCOCONJUGATES OF THE INVENTION
[0038] Immunogenic compositions of the present invention will
typically comprise conjugated capsular saccharide antigens (also
named glycoconjugates), wherein the saccharides are derived from
serotypes of S. pneumoniae.
[0039] If the protein carrier is the same for 2 or more saccharides
in the composition, the saccharides could be conjugated to the same
molecule of the protein carrier (carrier molecules having 2 or more
different saccharides conjugated to it) [see for instance
WO2004/083251].
[0040] In a preferred embodiment though, the saccharides are each
individually conjugated to different molecules of the protein
carrier (each molecule of protein carrier only having one type of
saccharide conjugated to it). In said embodiment, the capsular
saccharides are said to be individually conjugated to the carrier
protein.
[0041] For the purposes of the invention the term `glycoconjugate`
indicates a capsular saccharide linked covalently to a carrier
protein. In one embodiment a capsular saccharide is linked directly
to a carrier protein. In a second embodiment a bacterial saccharide
is linked to a protein through a spacer/linker.
[0042] 1.1 Carrier Protein of the Invention
[0043] A component of the glycoconjugate of the invention is a
carrier protein to which the saccharide is conjugated. The terms
"protein carrier" or "carrier protein" or "carrier" may be used
interchangeably herein. Carrier proteins should be amenable to
standard conjugation procedures.
[0044] In a preferred embodiment, the carrier protein of the
glycoconjugates is selected in the group consisting of: DT
(Diphtheria toxin), TT (tetanus toxid) or fragment C of TT,
CRM.sub.197 (a nontoxic but antigenically identical variant of
diphtheria toxin), other DT mutants (such as CRM176, CRM228, CRM45
(Uchida et al. (1973) J. Biol. Chem. 218:3838-3844), CRM9, CRM102,
CRM103 or CRM107, and other mutations described by Nicholls and
Youle in Genetically Engineered Toxins, Ed: Frankel, Maecel Dekker
Inc. (1992); deletion or mutation of Glu-148 to Asp, Gln or Ser
and/or Ala 158 to Gly and other mutations disclosed in U.S. Pat.
Nos. 4,709,017 and 4,950,740; mutation of at least one or more
residues Lys 516, Lys 526, Phe 530 and/or Lys 534 and other
mutations disclosed in U.S. Pat. Nos. 5,917,017 and 6,455,673; or
fragment disclosed in U.S. Pat. No. 5,843,711, pneumococcal
pneumolysin (ply) (Kuo et al. (1995) Infect Immun 63:2706-2713)
including ply detoxified in some fashion, for example dPLY-GMBS (WO
2004/081515, WO 2006/032499) or dPLY-formol, PhtX, including PhtA,
PhtB, PhtD, PhtE (sequences of PhtA, PhtB, PhtD or PhtE are
disclosed in WO 00/37105 and WO 00/39299) and fusions of Pht
proteins, for example PhtDE fusions, PhtBE fusions, Pht A-E (WO
01/98334, WO 03/054007, WO 2009/000826), OMPC (meningococcal outer
membrane protein), which is usually extracted from Neisseria
meningitidis serogroup B (EP0372501), PorB (from N. meningitidis),
PD (Haemophilus influenzae protein D; see, e.g., EP0594610 B), or
immunologically functional equivalents thereof, synthetic peptides
(EP0378881, EP0427347), heat shock proteins (WO 93/17712, WO
94/03208), pertussis proteins (WO 98/58668, EP0471177), cytokines,
lymphokines, growth factors or hormones (WO 91/01146), artificial
proteins comprising multiple human CD4+ T cell epitopes from
various pathogen derived antigens (Falugi et al. (2001) Eur J
Immunol 31:3816-3824) such as N19 protein (Baraldoi et al. (2004)
Infect Immun 72:4884-4887) pneumococcal surface protein PspA (WO
02/091998), iron uptake proteins (WO 01/72337), toxin A or B of
Clostridium difficile (WO 00/61761), transferrin binding proteins,
pneumococcal adhesion protein (PsaA), recombinant Pseudomonas
aeruginosa exotoxin A (in particular non-toxic mutants thereof
(such as exotoxin A bearing a substitution at glutamic acid 553
(Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other
proteins, such as ovalbumin, keyhole limpet hemocyanin (KLH),
bovine serum albumin (BSA) or purified protein derivative of
tuberculin (PPD) also can be used as carrier proteins. Other
suitable carrier proteins include inactivated bacterial toxins such
as cholera toxoid (e.g., as described in WO 2004/083251),
Escherichia coli LT, E. coli ST, and exotoxin A from P.
aeruginosa.
[0045] In a preferred embodiment, the carrier protein of the
glycoconjugates is independently selected from the group consisting
of TT, DT, DT mutants (such as CRM.sub.197), H. influenzae protein
D, PhtX, PhtD, PhtDE fusions (particularly those described in WO
01/98334 and WO 03/054007), detoxified pneumolysin, PorB, N19
protein, PspA, OMPC, toxin A or B of C. difficile and PsaA.
[0046] In an embodiment, the carrier protein of the glycoconjugates
of the invention is DT (Diphtheria toxoid). In another embodiment,
the carrier protein of the glycoconjugates of the invention is TT
(tetanus toxid).
[0047] In another embodiment, the carrier protein of the
glycoconjugates of the invention is PD (H. influenzae protein D;
see, e.g., EP0594610 B).
[0048] In a preferred embodiment, the capsular saccharides of the
invention are conjugated to CRM.sub.197 protein. The CRM.sub.197
protein is a nontoxic form of diphtheria toxin but is
immunologically indistinguishable from the diphtheria toxin.
CRM.sub.197 is produced by Corynebacterium diphtheriae infected by
the nontoxigenic phage .beta.197.sup.lox- created by
nitrosoguanidine mutagenesis of the toxigenic corynephage beta
(Uchida et al. (1971) Nature New Biology 233:8-11). The CRM.sub.197
protein has the same molecular weight as the diphtheria toxin but
differs therefrom by a single base change (guanine to adenine) in
the structural gene. This single base change causes an amino acid
substitution (glutamic acid for glycine) in the mature protein and
eliminates the toxic properties of diphtheria toxin. The
CRM.sub.197 protein is a safe and effective T-cell dependent
carrier for saccharides. Further details about CRM.sub.197 and
production thereof can be found, e.g., in U.S. Pat. No.
5,614,382.
[0049] In an embodiment, the capsular saccharides of the invention
are conjugated to CRM.sub.197 protein or the A chain of CRM.sub.197
(see CN103495161). In an embodiment, the capsular saccharides of
the invention are conjugated the A chain of CRM.sub.197 obtained
via expression by genetically recombinant E. coli (see
CN103495161). In an embodiment, the capsular saccharides of the
invention are all conjugated to CRM.sub.197. In an embodiment, the
capsular saccharides of the invention are all conjugated to the A
chain of CRM.sub.197.
[0050] Accordingly, in frequent embodiments, the glycoconjugates of
the invention comprise CRM.sub.197 as the carrier protein, wherein
the capsular polysaccharide is covalently linked to
CRM.sub.197.
[0051] 1.2 Capsular Saccharide of the Invention
[0052] The term "saccharide" throughout this specification may
indicate polysaccharide or oligosaccharide and includes both. In
frequent embodiments, the saccharide is a polysaccharide, in
particular a S. pneumoniae capsular polysaccharide.
[0053] Capsular polysaccharides are prepared by standard techniques
known to those of ordinary skill in the art.
[0054] In the present invention, capsular polysaccharides may be
prepared, e.g., from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A,
11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F of S.
pneumoniae. Typically capsular polysaccharides are produced by
growing each S. pneumoniae serotype in a medium (e.g. in a
soy-based medium), the polysaccharides are then prepared from the
bacteria culture. Bacterial strains of S. pneumoniae used to make
the respective polysaccharides that are used in the glycoconjugates
of the invention may be obtained from established culture
collections or clinical specimens.
[0055] The population of the organism (each S. pneumoniae serotype)
is often scaled up from a seed vial to seed bottles and passaged
through one or more seed fermentors of increasing volume until
production scale fermentation volumes are reached. At the end of
the growth cycle the cells are lysed and the lysate broth is then
harvested for downstream (purification) processing (see for example
WO 2006/110381, WO 2008/118752, and U.S. Patent App. Pub. Nos.
2006/0228380, 2006/0228381, 2008/0102498 and 2008/0286838).
[0056] The individual polysaccharides are typically purified
through centrifugation, precipitation, ultra-filtration, and/or
column chromatography (see for example WO 2006/110352 and WO
2008/118752).
[0057] Purified polysaccharides may be activated (e.g., chemically
activated) to make them capable of reacting (e.g., with the eTEC
spacer) and then incorporated into glycoconjugates of the
invention, as further described herein.
[0058] S. pneumoniae capsular polysaccharides comprise repeating
oligosaccharide units which may contain up to 8 sugar residues.
[0059] In an embodiment, capsular saccharide of the invention may
be one oligosaccharide unit or a shorter than native length
saccharide chain of repeating oligosaccharide units. In an
embodiment, capsular saccharide of the invention is one repeating
oligosaccharide unit of the relevant serotype.
[0060] In an embodiment, capsular saccharide of the invention may
be oligosaccharides. Oligosaccharides have a low number of repeat
units (typically 5-15 repeat units) and are typically derived
synthetically or by hydrolysis of polysaccharides.
[0061] Preferably though, all of the capsular saccharides of the
present invention and in the immunogenic compositions of the
present invention are polysaccharides. High molecular weight
capsular polysaccharides are able to induce certain antibody immune
responses due to the epitopes present on the antigenic surface. The
isolation and purification of high molecular weight capsular
polysaccharides is preferably contemplated for use in the
conjugates, compositions and methods of the present invention.
[0062] In some embodiments, the purified polysaccharides before
conjugation have a molecular weight of between 10 kDa and 4,000
kDa. In other such embodiments, the polysaccharide has a molecular
weight of between 50 kDa and 4,000 kDa. In further such
embodiments, the polysaccharide has a molecular weight of between
50 kDa and 3,500 kDa; between 50 kDa and 3,000 kDa; between 50 kDa
and 2,500 kDa; between 50 kDa and 2,000 kDa; between 50 kDa and
1,750 kDa; between 50 kDa and 1,500 kDa; between 50 kDa and 1,250
kDa; between 50 kDa and 1,000 kDa; between 50 kDa and 750 kDa;
between 50 kDa and 500 kDa; between 100 kDa and 4,000 kDa; between
100 kDa and 3,500 kDa; 100 kDa and 3,000 kDa; 100 kDa and 2,500
kDa; 100 kDa and 2,250 kDa; between 100 kDa and 2,000 kDa; between
100 kDa and 1,750 kDa; between 100 kDa and 1,500 kDa; between 100
kDa and 1,250 kDa; between 100 kDa and 1,000 kDa; between 100 kDa
and 750 kDa; between 100 kDa and 500 kDa; between 200 kDa and 4,000
kDa; between 200 kDa and 3,500 kDa; between 200 kDa and 3,000 kDa;
between 200 kDa and 2,500 kDa; between 200 kDa and 2,250 kDa;
between 200 kDa and 2,000 kDa; between 200 kDa and 1,750 kDa;
between 200 kDa and 1,500 kDa; between 200 kDa and 1,250 kDa;
between 200 kDa and 1,000 kDa; between 200 kDa and 750 kDa; or
between 200 kDa and 500 kDa. Any whole number integer within any of
the above ranges is contemplated as an embodiment of the
disclosure.
[0063] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described herein,
polysaccharide can be subjected to sizing techniques before
conjugation. Mechanical or chemical sizing maybe employed. Chemical
hydrolysis maybe conducted using acetic acid. Mechanical sizing
maybe conducted using High Pressure Homogenization Shearing. The
molecular weight ranges mentioned above refer to purified
polysaccharides before conjugation (e.g., before activation).
[0064] In a preferred embodiment the purified polysaccharides, are
capsular polysaccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8,
9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F or 33F of S.
pneumoniae, wherein the capsular polysaccharide has a molecular
weight falling within one of the molecular weight ranges as
described here above.
[0065] As used herein, the term "molecular weight" of
polysaccharide or of carrier protein-polysaccharide conjugate
refers to molecular weight calculated by size exclusion
chromatography (SEC) combined with multiangle laser light
scattering detector (MALLS).
[0066] In some embodiments, the pneumococcal saccharides from
serotypes 9V, 18C, 11A, 15B, 22F and/or 33F of the invention are
O-acetylated. In some embodiments, the pneumococcal saccharides
from serotypes 9V, 11A, 15B, 22F and/or 33F of the invention are
O-acetylated.
[0067] The purified polysaccharides described herein are chemically
activated to make the saccharides capable of reacting with the
carrier protein. These pneumococcal conjugates are prepared by
separate processes and formulated into a single dosage formulation
as described below.
[0068] 1.2.1 Pneumococcal Polysaccharide from S. pneumoniae
Serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F
[0069] Capsular saccharides from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F may be prepared by
standard techniques known to those of ordinary skill in the art
(see for example WO 2006/110381). Capsular polysaccharides can be
produced by growing each S. pneumoniae serotype in a medium; at the
end of the growth cycle the cells are lysed and the lysate broth is
then harvested for downstream (purification) processing. The
individual polysaccharides are typically purified through
centrifugation, precipitation, ultra-filtration, and/or column
chromatography (see for example WO 2006/110352 and WO 2008/118752).
Purified polysaccharides may be further processed as further
described herein to prepare glycoconjugates of the invention. In
some embodiments, the purified polysaccharides from S. pneumoniae
serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and/or 23F
before conjugation have a molecular weight of between 10 kDa and
4,000 kDa. In other such embodiments, the polysaccharide has a
molecular weight of between 50 kDa and 4,000 kDa; between 50 kDa
and 3,000 kDa or between 50 kDa and 2,000 kDa. In further such
embodiments, the polysaccharide has a molecular weight of between
between 50 kDa and 3,500 kDa; between 50 kDa and 3,000 kDa; between
50 kDa and 2,500 kDa; between 50 kDa and 2,000 kDa; 50 kDa and
1,750 kDa; between 50 kDa and 1,500 kDa; between 50 kDa and 1,250
kDa; between 50 kDa and 1,000 kDa; between 50 kDa and 750 kDa;
between 50 kDa and 500 kDa; between 100 kDa and 4,000 kDa; between
100 kDa and 3,500 kDa; between 100 kDa and 3,000 kDa; between 100
kDa and 2,500 kDa; between 100 kDa and 2,000 kDa; between 100 kDa
and 1,750 kDa; between 100 kDa and 1,500 kDa; between 100 kDa and
1,250 kDa; between 100 kDa and 1,000 kDa; between 100 kDa and 750
kDa; between 100 kDa and 500 kDa; between 200 kDa and 4,000 kDa;
between 200 kDa and 3,500 kDa; between 200 kDa and 3,000 kDa;
between 200 kDa and 2,500 kDa; between 200 kDa and 2,000 kDa;
between 200 kDa and 1,750 kDa; between 200 kDa and 1,500 kDa;
between 200 kDa and 1,250 kDa; between 200 kDa and 1,000 kDa;
between 200 kDa and 750 kDa; or between 200 kDa and 500 kDa. Any
whole number integer within any of the above ranges is contemplated
as an embodiment of the disclosure.
[0070] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described herein,
polysaccharide can be subjected to sizing techniques before
conjugation. The molecular weight ranges mentioned above refer to
purified polysaccharides before conjugation (e.g., before
activation) after an eventual sizing step.
[0071] In some embodiments, the pneumococcal saccharides from
serotypes 9V and/or 18C of the invention are O-acetylated. In some
embodiments, the pneumococcal saccharide from serotype 9V of the
invention is O-acetylated and the pneumococcal saccharide from
serotype 18C of the invention is de-O-acetylated.
[0072] 1.2.2 Pneumococcal Polysaccharide Serotype 8
[0073] The polysaccharide repeating unit of serotype 8 consists of
a linear tetrasaccharide unit with one glucuronic acid (GlcpA), two
glucopyranoses (Glcp) and one galactopyranose (Galp) (Jones et al.
(1957) The Journal of the American Chemical Society.
79(11):2787-2793). All four monosaccharides are linked via
1,4-linkages as shown at FIG. 1.
[0074] Serotype 8 saccharides can be obtained directly from
bacteria using isolation procedures known to one of ordinary skill
in the art (see for example methods disclosed in U.S. Patent App.
Pub. Nos. 2006/0228380, 2006/0228381, 2007/0184071, 2007/0184072,
2007/0231340, and 2008/0102498 and WO 2008/118752). In addition,
they can be produced using synthetic protocols.
[0075] Serotype 8 S. pneumoniae strains may be obtained from
established culture collections (such as for example the
Streptococcal Reference Laboratory (Centers for Disease Control and
Prevention, Atlanta, Ga.)) or clinical specimens.
[0076] In some embodiments, the purified polysaccharides from S.
pneumoniae serotype 8 before conjugation have a molecular weight of
between 10 kDa and 2,000 kDa. In one embodiment, the capsular
polysaccharide has a molecular weight of between 50 kDa and 1,000
kDa. In another embodiment, the capsular polysaccharide has a
molecular weight of between 70 kDa and 900 kDa. In another
embodiment, the capsular polysaccharide has a molecular weight of
between 100 kDa and 800 kDa.
[0077] In further embodiments, the capsular polysaccharide has a
molecular weight of 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa
to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400
kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa;
250 kDa to 600; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to
350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400
kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired
molecular weight ranges. Any whole number integer within any of the
above ranges is contemplated as an embodiment of the
disclosure.
[0078] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described herein,
polysaccharide can be subjected to sizing techniques before
conjugation. The molecular weight ranges mentioned above refer to
purified polysaccharides before conjugation (e.g., before
activation) after an eventual sizing step.
[0079] 1.2.3 Pneumococcal Polysaccharide Serotype 10A
[0080] The polysaccharide repeating unit of serotype 10A consists
of a branched hexasaccharide repeat unit with two galactofuranoses
(Gal.sub.f), three galactopyranoses (Gal.sub.p), one
N-acetylgalactosamine (Gal.sub.pNAc) and a backbone phosphoribitol
(Jones, C. (2005) Carbohydrate Research 269(1):175-181). There are
two branching monosaccharides at the .beta.-GalpNAc moiety (a
.beta.-3-Galp and a .beta.-6-Galf) as shown at FIG. 2.
[0081] Serotype 10A saccharides can be obtained directly from
bacteria using isolation procedures known to one of ordinary skill
in the art (see for example methods disclosed in U.S. Patent App.
Pub. Nos. 2006/0228380, 2006/0228381, 2007/0184071, 2007/0184072,
2007/0231340, and 2008/0102498 and WO 2008/118752). In addition,
they can be produced using synthetic protocols.
[0082] Serotype 10A S. pneumoniae strains may be obtained from
established culture collections (such as for example the
Streptococcal Reference Laboratory (Centers for Disease Control and
Prevention, Atlanta, Ga.)) or clinical specimens.
[0083] In some embodiments, the purified polysaccharides from S.
pneumoniae serotype 10A before conjugation have a molecular weight
of between 10 kDa and 2,000 kDa. In one embodiment, the capsular
polysaccharide has a molecular weight of between 50 kDa and 1,000
kDa. In another embodiment, the capsular polysaccharide has a
molecular weight of between 70 kDa and 900 kDa. In another
embodiment, the capsular polysaccharide has a molecular weight of
between 100 kDa and 800 kDa.
[0084] In further embodiments, the capsular polysaccharide has a
molecular weight of 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa
to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400
kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa;
250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa
to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400
kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired
molecular weight ranges. Any whole number integer within any of the
above ranges is contemplated as an embodiment of the
disclosure.
[0085] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described herein,
polysaccharide can be subjected to sizing techniques before
conjugation. The molecular weight ranges mentioned above refer to
purified polysaccharides before conjugation (e.g., before
activation) after an eventual sizing step.
[0086] 1.2.4 Pneumococcal Polysaccharide Serotype 11A
[0087] The polysaccharide repeating unit of serotype 11A consists
of a linear tetrasaccharide backbone (two galactopyranoses
(Gal.sub.p) and two glucopyranose (Glc.sub.p)) and a pendent
phosphoglycerol (Richards et al. (1988) Adv. Exp. Med. Biol.
228:595-597), as shown at FIG. 3. The polysaccharide is
O-acetylated at multiple locations and, based on the reported data
in the literature (Calix et al. (2011) J Bacteriol.
193(19):5271-5278), the total amount of O-acetylation in 11A
polysaccharide is about 2.6 O-acetyl groups per polysaccharide
repeat unit.
[0088] Serotype 11A saccharides can be obtained directly from
bacteria using isolation procedures known to one of ordinary skill
in the art (see for example methods disclosed in U.S. Patent App.
Pub. Nos. 2006/0228380, 2006/0228381, 2007/0184071, 2007/0184072,
2007/0231340, and 2008/0102498 and WO 2008/118752). In addition,
they can be produced using synthetic protocols.
[0089] Serotype 11A S. pneumoniae strains may be obtained from
established culture collections (such as for example the
Streptococcal Reference Laboratory (Centers for Disease Control and
Prevention, Atlanta, Ga.)) or clinical specimens.
[0090] The isolated serotype 11A capsular polysaccharide obtained
by purification of serotype 11A polysaccharide from the S.
pneumoniae lysate and optionally sizing of the purified
polysaccharide may be characterized by different attributes
including, for example, the molecular weight (MW) and the mM of
acetate per mM of said serotype 11A capsular polysaccharide.
[0091] In some embodiments, the purified polysaccharides from S.
pneumoniae serotype 11A before conjugation have a molecular weight
of between 10 kDa and 2,000 kDa. In one embodiment, the capsular
polysaccharide has a molecular weight of between 50 kDa and 1,000
kDa. In another embodiment, the capsular polysaccharide has a
molecular weight of between 70 kDa and 900 kDa. In another
embodiment, the capsular polysaccharide has a molecular weight of
between 100 kDa and 800 kDa.
[0092] In further embodiments, the capsular polysaccharide has a
molecular weight of 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa
to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 150 kDa to 600
kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa;
150 kDa to 200 kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa
to 400 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400
kDa; 250 kDa to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa;
300 kDa to 400 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and
similar desired molecular weight ranges. Any whole number integer
within any of the above ranges is contemplated as an embodiment of
the disclosure.
[0093] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described herein,
polysaccharide can be subjected to sizing techniques before
conjugation. The molecular weight ranges mentioned above refer to
purified polysaccharides before conjugation (e.g., before
activation) after an eventual sizing step.
[0094] In an embodiment, the size of the purified serotype 11A
polysaccharide is reduced by high pressure homogenization. High
pressure homogenization achieves high shear rates by pumping the
process stream through a flow path with sufficiently small
dimensions. The shear rate is increased by using a larger applied
homogenization pressure, and exposure time can be increased by
recirculating the feed stream through the homogenizer.
[0095] The high pressure homogenization process is particularly
appropriate for reducing the size of the purified serotype 11A
polysaccharide while preserving the structural features of the
polysaccharide, such as the presence of O-acetyl groups.
[0096] The presence of O-acetyl in a purified, isolated or
activated serotype 11A capsular polysaccharide or in a serotype 11A
polysaccharide-carrier protein conjugate is expressed as the number
of mM of acetate per mM of said polysaccharide or as the number of
O-acetyl group per polysaccharide repeating unit.
[0097] In a preferred embodiment, the purified polysaccharides from
S. pneumoniae serotype 11A has at least 0.2, 0.4, 0.6, 0.8, 1.0,
1.2, 1.4 or 1.6 .mu.mol acetate per .mu.mol of said serotype 11A
capsular polysaccharide.
[0098] 1.2.5 Pneumococcal Polysaccharide Serotype 12F
[0099] The polysaccharide repeating unit of serotype 12F consists
of a linear trisaccharide backbone (one N-acetylfucosamine
(Fuc.sub.pNAc), one N-acetylgalactosamine (Gal.sub.pNAc) and one
N-acetylmannuronic acid (Man.sub.pNAcA)) with two branches: a
pendant .alpha.-galactopyranose (Gal.sub.p) linked at C3 of
Fuc.sub.pNAc and an
.alpha.-Glc.sub.p-(1.fwdarw.2)-.alpha.-Glc.sub.p disaccharide
branch linked at C3 of Man.sub.pNAcA (Leontein et al. (1983)
Carbohydrate Research 114(2):257-266.) as shown at FIG. 4.
[0100] Serotype 12F Streptococcus pneumoniae strains may be
obtained from established culture collections (such as for example
the Streptococcal Reference Laboratory (Centers for Disease Control
and Prevention, Atlanta, Ga.)) or clinical specimens.
[0101] Capsular saccharides from S. pneumoniae serotype 12F are
prepared by standard techniques known to those of ordinary skill in
the art. Typically capsular polysaccharides are produced by growing
each S. pneumoniae serotype in a medium (e.g., in a soy-based
medium), the polysaccharides are then prepared from the bacteria
culture. The population of the organism (S. pneumoniae serotype
12F) is often scaled up from a seed vial to seed bottles and
passaged through one or more seed fermentors of increasing volume
until production scale fermentation volumes are reached. At the end
of the growth cycle the cells are lysed and the lysate broth is
then harvested for downstream (purification) processing (see for
example WO 2006/110381 and WO 2008/118752, U.S. Patent App. Pub.
Nos. 2006/0228380, 2006/0228381, 2008/0102498 and US2008/0286838).
The polysaccharides are typically purified through centrifugation,
precipitation, ultra-filtration, and/or column chromatography (see
for example WO 2006/110352 and WO 2008/118752).
[0102] Purified polysaccharides from serotype 12F may be activated
(e.g., chemically activated) to make them capable of reacting and
then incorporated into glycoconjugates of the invention, as further
described herein.
[0103] In some embodiments, the purified polysaccharides from S.
pneumoniae serotype 12F before conjugation have a molecular weight
of between 10 kDa and 2,000 kDa. In one embodiment, the capsular
polysaccharide has a molecular weight of between 50 kDa and 1,000
kDa. In another embodiment, the capsular polysaccharide has a
molecular weight of between 50 kDa and 300 kDa. In another
embodiment, the capsular polysaccharide has a molecular weight of
between 70 kDa and 300 kDa. In further embodiments, the capsular
polysaccharide has a molecular weight of 90 kDa to 250 kDa; 90 kDa
to 150 kDa; 90 kDa to 120 kDa; 80 kDa to 120 kDa; 70 kDa to 100
kDa; 70 kDa to 110 kDa; 70 kDa to 120 kDa; 70 kDa to 130 kDa; 70
kDa to 140 kDa; 70 kDa to 150 kDa; 70 kDa to 160 kDa; 80 kDa to 110
kDa; 80 kDa to 120 kDa; 80 kDa to 130 kDa; 80 kDa to 140 kDa; 80
kDa to 150 kDa; 80 kDa to 160 kDa; 90 kDa to 110 kDa; 90 kDa to 120
kDa; 90 kDa to 130 kDa; 90 kDa to 140 kDa; 90 kDa to 150 kDa; 90
kDa to 160 kDa; 100 kDa to 120 kDa; 100 kDa to 130 kDa; 100 kDa to
140 kDa; 100 kDa to 150 kDa; 100 kDa to 160 kDa; and similar
desired molecular weight ranges. Any whole number integer within
any of the above ranges is contemplated as an embodiment of the
disclosure.
[0104] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described herein,
polysaccharide can be subjected to sizing techniques before
conjugation. The molecular weight ranges mentioned above refer to
purified polysaccharides before conjugation (e.g., before
activation) after an eventual sizing step.
[0105] 1.2.6 Pneumococcal Polysaccharide Serotype 15B
[0106] As shown at FIG. 5, the polysaccharide repeating unit of
serotype 15B consists of a branched trisaccharide backbone (one
N-acetylglucosamine (Glc.sub.pNAc), one galactopyranose (Gal.sub.p)
and one glucopyranose (Glc.sub.p)) with an
.alpha.Gal.sub.p-.beta.Gal.sub.p disaccharide branch linked to the
C4 hydroxyl group of Glc.sub.pNAc. The phosphoglycerol is linked to
the C3 hydroxyl group of the .beta.Gal.sub.p residue in the
disaccharide branch (Jones et al. (2005) Carbohydrate Research
340(3):403-409). Capsular polysaccharide from serotype 15C serotype
has the identical backbone structure as serotype 15B but lacks the
O-acetylation.
[0107] Serotype 15B polysaccharides can be obtained directly from
bacteria using isolation procedures known to one of ordinary skill
in the art (see for example methods disclosed in U.S. Patent App.
Pub. Nos. 2006/0228380, 2006/0228381, 2007/0184071, 2007/0184072,
2007/0231340, and 2008/0102498 and WO 2008/118752). They can also
be produced using synthetic protocols known to the man skilled in
the art.
[0108] Serotype 15B S. pneumoniae strains may be obtained from
established culture collections (such as for example the American
Type Culture Collection (ATCC, Manassas, Va. USA) (e.g., deposit
strain No. ATCC10354) or the Streptococcal Reference Laboratory
(Centers for Disease Control and Prevention, Atlanta, Ga. USA)) or
from clinical specimens.
[0109] The bacterial cells are grown in a medium, preferably in a
soy based medium. Following fermentation of bacterial cells that
produce S. pneumoniae serotype 15B capsular polysaccharides, the
bacterial cells are lysed to produce a cell lysate. The serotype
15B polysaccharide may then be isolated from the cell lysate using
purification techniques known in the art, including the use of
centrifugation, depth filtration, precipitation, ultra-filtration,
treatment with activate carbon, diafiltration and/or column
chromatography (see, for example, U.S. Patent App. Pub. Nos.
2006/0228380, 2006/0228381, 2007/0184071, 2007/0184072,
2007/0231340, and 2008/0102498 and WO 2008/118752). The purified
serotype 15B capsular polysaccharide can then be used for the
preparation of immunogenic conjugates.
[0110] The isolated serotype 15B capsular polysaccharide obtained
by purification of serotype 15B polysaccharide from the S.
pneumoniae lysate and optionally sizing of the purified
polysaccharide can be characterized by different parameters
including, for example, the molecular weight (MW), the mM of
acetate per mM of said serotype 15B capsular polysaccharide and the
mM of glycerol per mM of said serotype 15B capsular
polysaccharide.
[0111] Preferably, in order to generate 15B conjugates with
advantageous filterability characteristics and/or yields, sizing of
the polysaccharide to a target molecular weight range is performed
prior to the conjugation to a carrier protein. Advantageously, the
size of the purified serotype 15B polysaccharide is reduced while
preserving critical features of the structure of the polysaccharide
such as for example the presence of O-acetyl groups. Preferably,
the size of the purified serotype 15B polysaccharide is reduced by
mechanical homogenization.
[0112] In a preferred embodiment, the size of the purified serotype
15B polysaccharide is reduced by high pressure homogenization. High
pressure homogenization achieves high shear rates by pumping the
process stream through a flow path with sufficiently small
dimensions. The shear rate is increased by using a larger applied
homogenization pressure, and exposure time can be increased by
recirculating the feed stream through the homogenizer.
[0113] The high pressure homogenization process is particularly
appropriate for reducing the size of the purified serotype 15B
polysaccharide while preserving the structural features of the
polysaccharide, such as the presence of O-acetyl groups.
[0114] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 5 kDa and
500 kDa, between 50 kDa and 500 kDa, between 50 kDa and 450 kDa,
between 100 kDa and 400 kDa, and between 100 kDa and 350 kDa. In a
preferred embodiment, the isolated serotype 15B capsular
polysaccharide has a molecular weight between 100 kDa and 350 kDa.
In a preferred embodiment, the isolated serotype 15B capsular
polysaccharide has a molecular weight between 100 kDa and 300 kDa.
In a preferred embodiment, the isolated serotype 15B capsular
polysaccharide has a molecular weight between 150 kDa and 300 kDa.
In a preferred embodiment, the isolated serotype 15B capsular
polysaccharide has a molecular weight between 150 kDa and 350 kDa.
In further embodiments, the capsular polysaccharide has a molecular
weight of 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300
kDa; 100 kDa to 200 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa;
150 kDa to 300 kDa; 150 kDa to 200 kDa; 200 kDa to 500 kDa; 200 kDa
to 400 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350
kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; and similar desired
molecular weight ranges. Any whole number integer within any of the
above ranges is contemplated as an embodiment of the
disclosure.
[0115] Serotype 15B polysaccharide is O-acetylated and the total
amount of O-acetylation is approximately 0.8-0.9 O-acetyl groups
per polysaccharide repeating unit. The degree of O-acetylation of
the polysaccharide can be determined by any method known in the
art, for example, by proton NMR (see for example Lemercinier et al.
(1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J.
Pharmaceutical and Biomedical Analysis 30:1233-1247; WO 2005/033148
and WO 00/56357). Another commonly used method is described in
Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the
presence of O-acetyl groups is determined by ion-HPLC analysis.
[0116] The presence of O-acetyl in a purified, isolated or
activated serotype 15B capsular polysaccharide or in a serotype 15B
polysaccharide-carrier protein conjugate is expressed as the number
of mM of acetate per mM of said polysaccharide or as the number of
O-acetyl group per polysaccharide repeating unit.
[0117] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5,
0.6, 0.7 or 0.8 mM acetate per mM of said serotype 15B capsular
polysaccharide. In a preferred embodiment, the isolated serotype
15B capsular polysaccharide comprises at least 0.5, 0.6 or 0.7 mM
acetate per mM of said serotype 15B capsular polysaccharide. In a
preferred embodiment, the isolated serotype 15B capsular
polysaccharide comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide. In a preferred embodiment,
the isolated serotype 15B capsular polysaccharide comprises at
least 0.7 mM acetate per mM of said serotype 15B capsular
polysaccharide.
[0118] The presence of glycerolphosphate side chains is determined
by measurement of glycerol using high performance anion exchange
chromatography with pulsed amperometric detection (HPAEC-PAD) after
its release by treatment of the polysaccharide with hydrofluoric
acid (HF). The presence of glycerol in a purified, isolated or
activated serotype 15B polysaccharide or in a serotype 15B
polysaccharide-carrier protein conjugate is expressed as the number
of mM of glycerol per mM of serotype 15B polysaccharide.
[0119] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5,
0.6, 0.7 or 0.8 mM glycerol per mM of said serotype 15B capsular
polysaccharide. In a preferred embodiment, the isolated serotype
15B capsular polysaccharide comprises at least 0.5, 0.6 or 0.7 mM
glycerol per mM of said serotype 15B capsular polysaccharide. In a
preferred embodiment, the isolated serotype 15B capsular
polysaccharide comprises at least 0.6 mM glycerol per mM of said
serotype 15B capsular polysaccharide. In a preferred embodiment,
the isolated serotype 15B capsular polysaccharide comprises at
least 0.7 mM glycerol per mM of said serotype 15B capsular
polysaccharide.
[0120] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 100 kDa and
350 kDa and comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide.
[0121] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 100 kDa and
350 kDa and comprises at least 0.6 mM glycerol per mM of said
serotype 15B capsular polysaccharide.
[0122] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 150 kDa and
300 kDa and comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide.
[0123] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 150 kDa and
300 kDa and comprises at least 0.6 mM glycerol per mM of said
serotype 15B capsular polysaccharide.
[0124] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 150 kDa and
350 kDa and comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide.
[0125] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 150 kDa and
350 kDa and comprises at least 0.6 mM glycerol per mM of said
serotype 15B capsular polysaccharide.
[0126] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide comprises at least 0.6 mM acetate per mM of
said serotype 15B capsular polysaccharide and at least 0.6 mM
glycerol per mM of said serotype 15B capsular polysaccharide.
[0127] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 100 kDa and
350 kDa and comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide and at least 0.6 mM glycerol
per mM of said serotype 15B capsular polysaccharide.
[0128] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 150 kDa and
300 kDa and comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide and at least 0.6 mM glycerol
per mM of said serotype 15B capsular polysaccharide.
[0129] In a preferred embodiment, the isolated serotype 15B
capsular polysaccharide has a molecular weight between 150 kDa and
350 kDa and comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide and at least 0.6 mM glycerol
per mM of said serotype 15B capsular polysaccharide.
[0130] 1.2.7 Pneumococcal Polysaccharide Serotype 22F
[0131] As shown at FIG. 6, the polysaccharide repeating unit of
serotype 22F consists of a branched pentasaccharide backbone (one
glucuronic acid (Glc.sub.pA), one glucopyranose (Glc.sub.p), one
galactofuranose (Galt) and two rhamnopyranoses (Rha.sub.p)) with a
.alpha.Glc.sub.p branch linked to the C3 hydroxyl group of
.beta.Rha.sub.p (Richards et al. (1989) Canadian Journal of
Chemistry 67(6):1038-1050). Approximately 80% of the C2 hydroxyl
groups of the .beta.Rha.sub.p residue in the polysaccharide
repeating unit are O-acetylated.
[0132] Serotype 22F polysaccharides can be obtained directly from
bacteria using isolation procedures known to one of ordinary skill
in the art (see for example methods disclosed in U.S. Patent App.
Pub. Nos. 2006/0228380, 2006/0228381, 2007/0184071, 2007/0184072,
2007/0231340, and 2008/0102498 and WO 2008/118752). In addition,
they can be produced using synthetic protocols.
[0133] Serotype 22F S. pneumoniae strains may be obtained from
established culture collections (such as for example the
Streptococcal Reference Laboratory (Centers for Disease Control and
Prevention, Atlanta, Ga.)) or clinical specimens.
[0134] The isolated serotype 22F capsular polysaccharide obtained
by purification of serotype 22F polysaccharide from the S.
pneumoniae lysate and optionally sizing of the purified
polysaccharide can be characterized by different parameters
including, for example, the molecular weight (MW) and the mM of
acetate per mM of said serotype 22F capsular polysaccharide.
[0135] Preferably, in order to generate serotype 22F conjugates
with advantageous filterability characteristics and/or yields,
sizing of the polysaccharide to a target molecular weight range is
performed prior to the conjugation to a carrier protein.
Advantageously, the size of the purified serotype 22F
polysaccharide is reduced while preserving critical features of the
structure of the polysaccharide such as for example the presence of
O-acetyl group. Preferably, the size of the purified serotype 22F
polysaccharide is reduced by mechanical homogenization.
[0136] In a preferred embodiment, the size of the purified
polysaccharide is reduced by high pressure homogenization. High
pressure homogenization achieves high shear rates by pumping the
process stream through a flow path with sufficiently small
dimensions. The shear rate is increased by using a larger applied
homogenization pressure, and exposure time can be increased by
recirculating the feed stream through the homogenizer.
[0137] The high pressure homogenization process is particularly
appropriate for reducing the size of the purified serotype 22F
polysaccharide while preserving the structural features of the
polysaccharide, such as the presence of O-acetyl groups.
[0138] In some embodiments, the purified polysaccharides from S.
pneumoniae serotype 22F before conjugation have a molecular weight
of between 10 kDa and 2,000 kDa. In one embodiment, the capsular
polysaccharide has a molecular weight of between 50 kDa and 1,000
kDa. In another embodiment, the capsular polysaccharide has a
molecular weight of between 70 kDa to 900 kDa. In another
embodiment, the capsular polysaccharide has a molecular weight of
between 100 kDa to 800 kDa. In another embodiment, the capsular
polysaccharide has a molecular weight of between 200 kDa to 600
kDa. In another embodiment, the capsular polysaccharide has a
molecular weight of between 400 kDa to 700 kDa.
[0139] In further embodiments, the capsular polysaccharide has a
molecular weight of 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100
kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to
500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000
kDa; 150 kDa to 900 kDa; 150 kDa to 800 kDa; 150 kDa to 700 kDa;
150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa
to 300 kDa; 200 kDa to 1,000 kDa; 200 kDa to 900 kDa; 200 kDa to
800 kDa; 200 kDa to 700 kDa; 200 kDa to 600 kDa; 200 kDa to 500
kDa; 200 kDa to 400 kDa; 200 kDa to 300 kDa; 250 kDa to 1,000 kDa;
250 kDa to 900 kDa; 250 kDa to 800 kDa; 250 kDa to 700 kDa; 250 kDa
to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350
kDa; 300 kDa to 1,000 kDa; 300 kDa to 900 kDa; 300 kDa to 800 kDa;
300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa
to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900 kDa; 400 kDa to
800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa; 500 kDa to 600
kDa; and similar desired molecular weight ranges. Any whole number
integer within any of the above ranges is contemplated as an
embodiment of the disclosure.
[0140] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described
hereabove, 22F polysaccharide can be subjected to sizing techniques
before conjugation. The molecular weight ranges mentioned above
refer to purified polysaccharides before conjugation (e.g., before
activation) after an eventual sizing step.
[0141] The degree of O-acetylation of the polysaccharide can be
determined by any method known in the art, for example, by proton
NMR (Lemercinier et al. (1996) Carbohydrate Research 296:83-96;
Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis
30:1233-1247; WO 2005/033148 and WO 00/56357). Another commonly
used method is described in Hestrin, S. (1949) J. Biol. Chem.
180:249-261. Preferably, the presence of O-acetyl groups is
determined by ion-HPLC analysis.
[0142] The presence of O-acetyl in a purified, isolated or
activated serotype 22F capsular polysaccharide or in a serotype 22F
polysaccharide-carrier protein conjugate is expressed as the number
of mM of acetate per mM of said polysaccharide or as the number of
O-acetyl group per polysaccharide repeating unit.
[0143] In a preferred embodiment, the purified polysaccharides from
S. pneumoniae serotype 22F has at least 0.2, 0.4, 0.6, 0.8, 1.0,
1.2, 1.4 or 1.6, .mu.mol acetate per .mu.mol of said serotype 22F
capsular polysaccharide.
[0144] 1.2.8 Pneumococcal Polysaccharide Serotype 33F As shown at
FIG. 7, the polysaccharide repeating unit of serotype 33F consists
of a branched pentasaccharide backbone (two galactopyranoses
(Gal.sub.p), two galactofuranoses (Galt) and one glucopyranose
(Glc.sub.p) with a terminal .alpha.Gal.sub.p linked to the C2
hydroxyl group of .alpha.Gal.sub.p residue within the backbone
(Lemercinier et al. (2006) Carbohydrate Research 341(1):68-74.). It
has been reported in the literature that the C2 hydroxyl group of
the backbone 3-.beta.-Gal.sub.f residue is O-acetylated.
[0145] Serotype 33F polysaccharides can be obtained directly from
bacteria using isolation procedures known to one of ordinary skill
in the art (see for example methods disclosed in U.S. Patent App.
Pub. Nos. 2006/0228380, 2006/0228381, 2007/0184071, 2007/0184072,
2007/0231340, and 2008/0102498 and WO 2008/118752). In addition,
they can be produced using synthetic protocols.
[0146] Serotype 33F S. pneumoniae strains may be obtained from
established culture collections (such as for example the
Streptococcal Reference Laboratory (Centers for Disease Control and
Prevention, Atlanta, Ga.)) or clinical specimens.
[0147] Purified polysaccharides from serotype 33F may be activated
(e.g., chemically activated) to make them capable of reacting and
then incorporated into glycoconjugates of the invention, as further
described herein.
[0148] The isolated serotype 33F capsular polysaccharide obtained
by purification of serotype 33F polysaccharide from the S.
pneumoniae lysate and optionally sizing of the purified
polysaccharide can be characterized by different parameters
including, for example, the molecular weight and the mM of acetate
per mM of said serotype 33F capsular polysaccharide.
[0149] In some embodiments, the purified polysaccharides from S.
pneumoniae serotype 33F before conjugation have a molecular weight
of between between 10 kDa and 2,000 kDa. In other such embodiments,
the saccharide has a molecular weight of between 50 kDa and 2,000
kDa. In further such embodiments, the saccharide has a molecular
weight of between 50 kDa and 1,750 kDa; between 50 kDa and 1,500
kDa; between 50 kDa and 1,250 kDa; between 50 kDa and 1,000 kDa;
between 50 kDa and 750 kDa; between 50 kDa and 500 kDa; between 100
kDa and 2,000 kDa; between 100 kDa and 1,750 kDa; between 100 kDa
and 1,500 kDa; between 100 kDa and 1,250 kDa; between 100 kDa and
1,000 kDa; between 100 kDa and 750 kDa; between 100 kDa and 500
kDa; between 200 kDa and 2,000 kDa; between 200 kDa and 1,750 kDa;
between 200 kDa and 1,500 kDa; between 200 kDa and 1,250 kDa;
between 200 kDa and 1,000 kDa; between 200 kDa and 750 kDa; or
between 200 kDa and 500 kDa. Any whole number integer within any of
the above ranges is contemplated as an embodiment of the
disclosure.
[0150] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described herein,
polysaccharide can be subjected to sizing techniques before
conjugation. The molecular weight ranges mentioned above refer to
purified polysaccharides before conjugation (e.g., before
activation) after an eventual sizing step.
[0151] The presence of O-acetyl in a purified, isolated or
activated serotype 33F capsular polysaccharide or in a serotype 33F
polysaccharide-carrier protein conjugate is expressed as the number
of mM of acetate per mM of said polysaccharide or as the number of
O-acetyl group per polysaccharide repeating unit.
[0152] In a preferred embodiment, the purified polysaccharides from
S. pneumoniae serotype 33F has at least 0.2, 0.4, 0.6, 0.8, 1.0,
1.2, 1.4 or 1.6, .mu.mol acetate per .mu.mol of said serotype 33F
capsular polysaccharide.
[0153] 1.3 Glycoconjugates of the Invention
[0154] The purified saccharides are chemically activated to make
the saccharides (i.e., activated saccharides) capable of reacting
with the carrier protein. Once activated, each capsular saccharide
is separately conjugated to a carrier protein to form a
glycoconjugate. In one embodiment, each capsular saccharide is
conjugated to the same carrier protein. The chemical activation of
the saccharides and subsequent conjugation to the carrier protein
can be achieved by the activation and conjugation methods disclosed
herein.
[0155] 1.3.1 Glycoconjugates from S. pneumoniae Serotype 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F
[0156] Capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F and 23F of S. pneumoniae are prepared by
standard techniques known to those of ordinary skill in the art
(see for example WO 2006/110381, WO 2008/118752, WO 2006/110352,
and U.S. Patent App. Pub. Nos. 2006/0228380, 2006/0228381,
2008/0102498 and 2008/0286838).
[0157] In an embodiment, the polysaccharides are activated with
1-cyano-4-dimethylamino pyridinium tetrafluoroborate (CDAP) to form
a cyanate ester. The activated polysaccharide is then coupled
directly or via a spacer (linker) group to an amino group on the
carrier protein (preferably CRM.sub.197). For example, the spacer
could be cystamine or cysteamine to give a thiolated polysaccharide
which could be coupled to the carrier via a thioether linkage
obtained after reaction with a maleimide-activated carrier protein
(for example using N-[.gamma.-maleimidobutyrloxy]succinimide ester
(GMBS)) or a haloacetylated carrier protein (for example using
iodoacetimide, N-succinimidyl bromoacetate (SBA; SIB),
N-succinimidyl(4-iodoacetyl)aminobenzoate (SIAB),
sulfosuccinimidyl(4-iodoacetyl)aminobenzoate (sulfo-SIAB),
N-succinimidyl iodoacetate (SIA) or succinimidyl
3-[bromoacetamido]proprionate (SBAP)). Preferably, the cyanate
ester (optionally made by CDAP chemistry) is coupled with hexane
diamine or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein (e.g., CRM.sub.197)
using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl
group on the protein carrier. Such conjugates are described for
example in WO 93/15760, WO 95/08348 and WO 96/129094.
[0158] Other suitable techniques for conjugation use carbodiimides,
hydrazides, active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with
1,1'-carbonyldiimidazole (CDI) (see Bethell et al. (1979) J. Biol.
Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr.
218:509-518) followed by reaction with a protein to form a
carbamate linkage. This may involve reduction of the anomeric
terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein.
[0159] In an preferred embodiment, at least one of capsular
polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C,
19A, 19F and 23F of S. pneumoniae is conjugated to the carrier
protein by reductive amination (such as described in U.S. Patent
Appl. Pub. Nos. 2006/0228380, 2007/0231340, 2007/0184071 and
2007/0184072, WO 2006/110381, WO 2008/079653, and WO 2008/143709).
In a preferred embodiment, the capsular polysaccharides from
serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F of
S. pneumoniae are all conjugated to the carrier protein by
reductive amination.
[0160] Reductive amination involves two steps: (1) oxidation of the
polysaccharide and (2) reduction of the activated polysaccharide
and a carrier protein to form a conjugate. Before oxidation, the
polysaccharide is optionally hydrolyzed. Mechanical or chemical
hydrolysis may be employed. Chemical hydrolysis may be conducted
using acetic acid. The oxidation step may involve reaction with
periodate. For the purpose of the present invention, the term
"periodate" includes both periodate and periodic acid; the term
also includes both metaperiodate (IO.sub.4.sup.-) and
orthoperiodate (IO.sub.6.sup.5-) and the various salts of periodate
(e.g., sodium periodate and potassium periodate).
[0161] In an embodiment the capsular polysaccharide from serotype
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F or 23F of S.
pneumoniae is oxidized in the presence of metaperiodate, preferably
in the presence of sodium periodate (NalO.sub.4). In another
embodiment the capsular polysaccharides from serotypes 1, 3, 4, 5,
6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F of S. pneumoniae is
oxydized in the presence of orthoperiodate, preferably in the
presence of periodic acid.
[0162] Following the oxidation step of the polysaccharide, the
polysaccharide is said to be activated and is referred to as
"activated polysaccharide" here below. The activated polysaccharide
and the carrier protein may be lyophilised (freeze-dried), either
independently (discrete lyophilization) or together
(co-lyophilized). In one embodiment the activated polysaccharide
and the carrier protein are co-lyophilized. In another embodiment
the activated polysaccharide and the carrier protein are
lyophilized independently.
[0163] In one embodiment the lyophilization takes place in the
presence of a non-reducing sugar, possible non-reducing sugars
include sucrose, trehalose, raffinose, stachyose, melezitose,
dextran, mannitol, lactitol and palatinit.
[0164] The second step of the conjugation process is the reduction
of the activated polysaccharide and a carrier protein to form a
conjugate (so-called reductive amination), using a reducing agent.
Reducing agents which are suitable include the cyanoborohydrides,
such as sodium cyanoborohydride, borane-pyridine, or borohydride
exchange resin. In one embodiment the reducing agent is sodium
cyanoborohydride.
[0165] In an embodiment, the reduction reaction is carried out in
aqueous solvent, in another embodiment the reaction is carried out
in aprotic solvent. In an embodiment, the reduction reaction is
carried out in DMSO (dimethylsulfoxide) or in DMF
(dimethylformamide) solvent. The DMSO or DMF solvent may be used to
reconstitute the activated polysaccharide and carrier protein which
has been lyophilized.
[0166] At the end of the reduction reaction, there may be unreacted
aldehyde groups remaining in the conjugates, these may be capped
using a suitable capping agent. In one embodiment this capping
agent is sodium borohydride (NaBH.sub.4). Following the conjugation
(the reduction reaction and optionally the capping), the
glycoconjugates may be purified. The glycoconjugates maybe purified
by diafiltration and/or ion exchange chromatography and/or size
exclusion chromatography. In an embodiment, the glycoconjugates are
purified by diafiltration or ion exchange chromatography or size
exclusion chromatography. In one embodiment the glycoconjugates are
sterile filtered.
[0167] In some embodiments, the glycoconjugate from S. pneumoniae
serotypes 9V and/or 18C comprise a saccharide which has a degree of
O-acetylation of between 10% and 100%, between 20% and 100%,
between 30% and 100%, between 40% and 100%, between 50% and 100%,
between 60% and 100%, between 70% and 100%, between 75% and 100%,
between 80% and 100%, between 90% and 100%, between 50% and 90%,
between 60% and 90%, between 70% and 90% or between 80% and 90%. In
other embodiments, the degree of O-acetylation is .gtoreq.10%,
.gtoreq.20%, .gtoreq.30%, .gtoreq.40%, .gtoreq.50%, .gtoreq.60%,
.gtoreq.70%, .gtoreq.80%, or .gtoreq.90%, or about 100%.
[0168] In some embodiments, the glycoconjugate from S. pneumoniae
serotypes 9V and/or 18C of the invention are O-acetylated. In some
embodiments, the glycoconjugate from S. pneumoniae serotype 9V is
O-acetylated and the glycoconjugate from S. pneumoniae serotype 18C
is de-O-acetylated.
[0169] 1.3.2 Glycoconjugates from S. pneumoniae Serotype 22F
[0170] In an embodiment, the serotype 22F glycoconjugates are
obtained by activating polysaccharide with 1-cyano-4-dimethylamino
pyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The
activated polysaccharide may be coupled directly or via a spacer
(linker) group to an amino group on the carrier protein. For
example, the spacer could be cystamine or cysteamine to give a
thiolated polysaccharide which could be coupled to the carrier via
a thioether linkage obtained after reaction with a
maleimide-activated carrier protein (for example using GMBS) or a
haloacetylated carrier protein (for example using iodoacetimide,
SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester
(optionally made by CDAP chemistry) is coupled with hexane diamine
or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein using carbodiimide
(e.g., EDAC or EDC) chemistry via a carboxyl group on the protein
carrier. Such conjugates are described for example in WO 93/15760,
WO 95/08348 and WO 96/129094.
[0171] Other suitable techniques use carbodiimides, hydrazides,
active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (see
Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein.
[0172] In preferred embodiments, the serotype 22F glycoconjugates
of the invention are prepared using reductive amination. Reductive
amination involves two steps: (1) oxidation of the polysaccharide
to generate aldehyde functionalities from vicinal diols in
individual hexasaccharide unit and (2) reduction of the activated
polysaccharide and a carrier protein (e.g., CRM.sub.197) to form a
conjugate.
[0173] Preferably, before oxidation, sizing of the serotype 22F
polysaccharide to a target molecular weight (MW) range is
performed. Advantageously, the size of the purified serotype 22F
polysaccharide is reduced while preserving critical features of the
structure of the polysaccharide such as for example the presence of
O-acetyl groups. Preferably, the size of the purified serotype 22F
polysaccharide is reduced by mechanical homogenization (see section
1.2.7 above).
[0174] In an embodiment, serotype polysaccharide is activated
(oxidized) by a process comprising the step of:
[0175] (a) reacting isolated serotype 22F polysaccharide with an
oxidizing agent; and
[0176] (b) quenching the oxidation reaction by addition of a
quenching agent resulting in an activated serotype 22F
polysaccharide.
[0177] In a preferred embodiment, the oxidizing agent is periodate.
For the purpose of the present invention, the term "periodate"
includes both periodate and periodic acid; the term also includes
both metaperiodate (IO.sub.4.sup.-) and orthoperiodate
(IO.sub.6.sup.5-) and the various salts of periodate (e.g., sodium
periodate and potassium periodate). In a preferred embodiment, the
oxidizing agent is sodium periodate. In a preferred embodiment, the
periodate used for the oxidation of serotype 22F polysaccharide is
metaperiodate. In a preferred embodiment the periodate used for the
oxidation of serotype 22F polysaccharide is sodium
metaperiodate.
[0178] In one embodiment, the quenching agent is selected from
vicinal diols, 1,2-aminoalcohols, amino acids, glutathione,
sulfite, bisulfate, dithionite, metabisulfite, thiosulfate,
phosphites, hypophosphites or phosphorous acid.
[0179] In one embodiment, the quenching agent is a
1,2-aminoalcohols of formula (I):
##STR00001##
[0180] wherein R.sup.1 is selected from H, methyl, ethyl, propyl or
isopropyl.
[0181] In one embodiment, the quenching agent is selected from
sodium and potassium salts of sulfite, bisulfate, dithionite,
metabisulfite, thiosulfate, phosphites, hypophosphites or
phosphorous acid.
[0182] In one embodiment, the quenching agent is an amino acid. In
such embodiments, said amino acid may be selected from serine,
threonine, cysteine, cystine, methionine, proline, hydroxyproline,
tryptophan, tyrosine, and histidine.
[0183] In one embodiment, the quenching agent is a sulfite such as
bisulfate, dithionite, metabisulfite, thiosulfate.
[0184] In one embodiment, the quenching agent is a compound
comprising two vicinal hydroxyl groups (vicinal diols), i.e., two
hydroxyl groups covalently linked to two adjacent carbon atoms.
[0185] Preferably, the quenching agent is a compound of formula
(II):
##STR00002##
[0186] wherein R.sup.1 and R.sup.2 are each independently selected
from H, methyl, ethyl, propyl or isopropyl.
[0187] In a preferred embodiment, the quenching agent is glycerol,
ethylene glycol, propan-1,2-diol, butan-1,2-diol or butan-2,3-diol,
or ascorbic acid. In a preferred embodiment, the quenching agent is
butan-2,3-diol.
[0188] In a preferred embodiment, the isolated serotype 22F
polysaccharide is activated by a process comprising the step
of:
[0189] (a) reacting isolated serotype 22F polysaccharide with
periodate; and
[0190] (b) quenching the oxidation reaction by addition of
butan-2,3-diol resulting in an activated serotype 22F
polysaccharide.
[0191] Following the oxidation step of the polysaccharide, the
polysaccharide is said to be activated and is referred to as
"activated polysaccharide" here below.
[0192] In a preferred embodiment, the activated serotype 22F
polysaccharide is purified. The activated serotype 22F
polysaccharide is purified according to methods known to the man
skilled in the art such as gel permeation chromatography (GPC),
dialysis or ultrafiltration/diafiltration. For example, the
activated 22F polysaccharide is purified by concentration and
diafiltration using an ultrafiltration device.
[0193] In a preferred embodiment the degree of oxidation of the
activated serotype 22F polysaccharide is between 2 and 30, between
2 and 25, between 2 and 20, between 2 and 15, between 2 and 10,
between 2 and 5, between 5 and 30, between 5 and 25, between 5 and
20, between 5 and 15, between 5 and 10, between 10 and 30, between
10 and 25, between 10 and 20, between 10 and 15, between 15 and 30,
between 15 and 25, between 15 and 20, between 20 to 30, or between
20 to 25. In a preferred embodiment the degree of oxidation of the
activated serotype 22F polysaccharide is between 2 and 10, between
4 and 8, between 4 and 6, between 6 and 8, between 6 and 12,
between 8 and 14, between 9 and 11, between 10 and 16, between 12
and 16, between 14 and 18, between 16 and 20, between 16 and 18,
between 18 and 22, or between 18 and 20.
[0194] In a preferred embodiment, the activated serotype 22F
polysaccharide has a molecular weight between 25 kDa and 1,000 kDa,
between 100 kDa and 1,000 kDa, between 300 kDa and 800 kDa, between
300 kDa and 700 kDa, between 300 kDa and 600 kDa, between 400 kDa
and 1,000 kDa, between 400 kDa and 800 kDa, between 400 kDa and 700
kDa or between 400 kDa and 600 kDa. In an embodiment, the activated
serotype 22F polysaccharide has a molecular weight between 300 kDa
and 800 kDa. In an embodiment, the activated serotype 22F
polysaccharide has a molecular weight between 400 kDa and 600 kDa.
In a preferred embodiment, the activated serotype 22F
polysaccharide has a molecular weight between 400 kda and 600 kDa
and a degree of oxidation between 10 and 25, between 10 and 20,
between 12 and 20 or between 14 and 18. In a preferred embodiment,
the activated serotype 22F polysaccharide has a molecular weight
between 400 kDa and 600 kDa and a degree of oxidation between 10
and 20.
[0195] In a preferred embodiment, the activated serotype 22F
polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 or
0.7 or about 0.8 mM acetate per mM serotype 22F polysaccharide. In
a preferred embodiment, the activated serotype 22F polysaccharide
comprises at least 0.5, 0.6 or 0.7 mM acetate per mM serotype 22F
polysaccharide. In a preferred embodiment, the activated serotype
22F polysaccharide comprises at least 0.6 mM acetate per mM
serotype 22F polysaccharide. In a preferred embodiment, the
activated serotype 22F polysaccharide comprises at least 0.7 mM
acetate per mM serotype 22F polysaccharide.
[0196] In a preferred embodiment, the activated serotype 22F
polysaccharide has a molecular weight between 400 kDa and 800 kDa
and comprises at least 0.6 mM acetate per mM serotype 22F
polysaccharide.
[0197] In a preferred embodiment, the activated serotype 22F
polysaccharide has a molecular weight between 400 kDa and 800 kDa,
a degree of oxidation between 12 and 20 and comprises at least 0.6
mM acetate per mM serotype 22F polysaccharide.
[0198] The activated polysaccharide and/or the carrier protein may
be lyophilised (freeze-dried), either independently (discrete
lyophilization) or together (co-lyophilized).
[0199] In an embodiment, the activated serotype 22F polysaccharide
is lyophilized, optionally in the presence of saccharide. In a
preferred embodiment, the saccharide is selected from sucrose,
trehalose, raffinose, stachyose, melezitose, dextran, mannitol,
lactitol and palatinit. In a preferred embodiment, the saccharide
is sucrose. In one embodiment, the lyophilized activated
polysaccharide is then compounded with a solution comprising the
carrier protein.
[0200] In another embodiment the activated polysaccharide and the
carrier protein are co-lyophilised. In such embodiments, the
activated serotype 22F polysaccharide is compounded with the
carrier protein and lyophilized optionally in the presence of a
saccharide. In a preferred embodiment, the saccharide is selected
from sucrose, trehalose, raffinose, stachyose, melezitose, dextran,
mannitol, lactitol and palatinit. In a preferred embodiment, the
saccharide is sucrose. The co-lyophilized polysaccharide and
carrier protein can then be resuspended in solution and reacted
with a reducing agent.
[0201] The second step of the conjugation process is the reduction
of the activated polysaccharide and a carrier protein to form a
conjugate (reductive amination), using a reducing agent.
[0202] The activated serotype 22F polysaccharide can be conjugated
to a carrier protein by a process comprising the step of:
[0203] (c) compounding the activated serotype 22F polysaccharide
with a carrier protein; and
[0204] (d) reacting the compounded activated serotype 22F
polysaccharide and carrier protein with a reducing agent to form a
serotype 22F polysaccharide-carrier protein conjugate.
[0205] In an embodiment, the reduction reaction is carried out in
aqueous solvent. In another embodiment the reaction is carried out
in aprotic solvent. In an embodiment, the reduction reaction is
carried out in DMSO (dimethylsulfoxide) or in DMF
(dimethylformamide)) solvent. The DMSO or DMF solvent may be used
to reconstitute the activated polysaccharide and carrier protein
which has been lyophilised.
[0206] The conjugation of activated serotype 22F polysaccharide
with a protein carrier by reductive amination in dimethylsulfoxide
(DMSO) is suitable to preserve the O-acetyl content of the
polysaccharide as compared, for example, to reductive amination in
aqueous phase where the level of O-acetylation of the
polysaccharide may be significantly reduced. Therefore in a
preferred embodiment, step (c) and step (d) are carried out in
DMSO.
[0207] In an embodiment, the reducing agent is sodium
cyanoborohydride, sodium triacetoxyborohydride, sodium or zinc
borohydride in the presence of Bronsted or Lewis acids, amine
boranes such as pyridine borane, 2-Picoline Borane,
2,6-diborane-methanol, dimethylamine-borane,
t-BuMe.sup.iPrN-BH.sub.3, benzylamine-BH.sub.3 or
5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment,
the reducing agent is sodium cyanoborohydride.
[0208] At the end of the reduction reaction, there may be unreacted
aldehyde groups remaining in the conjugates, these may be capped
using a suitable capping agent. In one embodiment this capping
agent is sodium borohydride (NaBH.sub.4).
[0209] Following conjugation of serotype 22F polysaccharide to the
carrier protein, the glycoconjugate can be purified (enriched with
respect to the amount of polysaccharide-protein conjugate) by a
variety of techniques known to the skilled person. These techniques
include dialysis, concentration/diafiltration operations,
tangential flow filtration precipitation/elution, column
chromatography (DEAE or hydrophobic interaction chromatography),
and depth filtration.
[0210] In some embodiments, the serotype 22F glycoconjugates of the
present invention comprise a saccharide having a molecular weight
of between 10 kDa and 2,000 kDa. In other such embodiments, the
saccharide has a molecular weight of between 50 kDa and 1,000 kDa.
In other such embodiments, the saccharide has a molecular weight of
between 70 kDa and 900 kDa. In other such embodiments, the
saccharide has a molecular weight of between 100 kDa and 800 kDa.
In other such embodiments, the saccharide has a molecular weight of
between 200 kDa and 600 kDa. In further such embodiments, the
saccharide has a molecular weight of 100 kDa to 1,000 kDa; 100 kDa
to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600
kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa;
150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 150 kDa to 800 kDa; 150
kDa to 700 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to
400 kDa; 150 kDa to 300 kDa; 200 kDa to 1,000 kDa; 200 kDa to 900
kDa; 200 kDa to 800 kDa; 200 kDa to 700 kDa; 200 kDa to 600 kDa;
200 kDa to 500 kDa; 200 kDa to 400 kDa; 200 kDa to 300 kDa; 250 kDa
to 1,000 kDa; 250 kDa to 900 kDa; 250 kDa to 800 kDa; 250 kDa to
700 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400
kDa; 250 kDa to 350 kDa; 300 kDa to 1000 kDa; 300 kDa to 900 kDa;
300 kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa
to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to
900 kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600
kDa; 500 kDa to 600 kDa. Any whole number integer within any of the
above ranges is contemplated as an embodiment of the disclosure. In
some such embodiments, the serotype 22F glycoconjugates are
prepared using reductive amination. In some embodiments, the
serotype 22F glycoconjugate of the invention has a molecular weight
of between 400 kDa and 15,000 kDa; between 500 kDa and 10,000 kDa;
between 2,000 kDa and 10,000 kDa; between 3,000 kDa and 8,000 kDa;
or between 3,000 kDa and 5,000 kDa. In other embodiments, the
serotype 22F glycoconjugate has a molecular weight of between 500
kDa and 10,000 kDa. In other embodiments, the serotype 22F
glycoconjugate has a molecular weight of between 1,000 kDa and
8,000 kDa. In still other embodiments, the serotype 22F
glycoconjugate has a molecular weight of between 2,000 kDa and
8,000 kDa or between 3,000 kDa and 7,000 kDa. In further
embodiments, the serotype 22F glycoconjugate of the invention has a
molecular weight of between 200 kDa and 20,000 kDa; between 200 kDa
and 15,000 kDa; between 200 kDa and 10,000 kDa; between 200 kDa and
7,500 kDa; between 200 kDa and 5,000 kDa; between 200 kDa and 3,000
kDa; between 200 kDa and 1,000 kDa; between 500 kDa and 20,000 kDa;
between 500 kDa and 15,000 kDa; between 500 kDa and 12,500 kDa;
between 500 kDa and 10,000 kDa; between 500 kDa and 7,500 kDa;
between 500 kDa and 6,000 kDa; between 500 kDa and 5,000 kDa;
between 500 kDa and 4,000 kDa; between 500 kDa and 3,000 kDa;
between 500 kDa and 2,000 kDa; between 500 kDa and 1,500 kDa;
between 500 kDa and 1,000 kDa; between 750 kDa and 20,000 kDa;
between 750 kDa and 15,000 kDa; between 750 kDa and 12,500 kDa;
between 750 kDa and 10,000 kDa; between 750 kDa and 7,500 kDa;
between 750 kDa and 6,000 kDa; between 750 kDa and 5,000 kDa;
between 750 kDa and 4,000 kDa; between 750 kDa and 3,000 kDa;
between 750 kDa and 2,000 kDa; between 750 kDa and 1,500 kDa;
between 1,000 kDa and 15,000 kDa; between 1,000 kDa and 12,500 kDa;
between 1,000 kDa and 10,000 kDa; between 1,000 kDa and 7,500 kDa;
between 1,000 kDa and 6,000 kDa; between 1,000 kDa and 5,000 kDa;
between 1,000 kDa and 4,000 kDa; between 1,000 kDa and 2,500 kDa;
between 2,000 kDa and 15,000 kDa; between 2,000 kDa and 12,500 kDa;
between 2,000 kDa and 10,000 kDa; between 2,000 kDa and 7,500 kDa;
between 2,000 kDa and 6,000 kDa; between 2,000 kDa and 5,000 kDa;
between 2,000 kDa and 4,000 kDa; or between 2,000 kDa and 3,000
kDa.
[0211] In further embodiments, the serotype 22F glycoconjugate of
the invention has a molecular weight of between 3,000 kDa and
20,000 kDa; between 3,000 kDa and 15,000 kDa; between 3,000 kDa and
10,000 kDa; between 3,000 kDa and 7,500 kDa; between 3,000 kDa and
5,000 kDa; between 4,000 kDa and 20,000 kDa; between 4,000 kDa and
15,000 kDa; between 4,000 kDa and 12,500 kDa; between 4,000 kDa and
10,000 kDa; between 4,000 kDa and 7,500 kDa; between 4,000 kDa and
6,000 kDa; or between 4,000 kDa and 5,000 kDa.
[0212] In further embodiments, the serotype 22F glycoconjugate of
the invention has a molecular weight of between 5,000 kDa and
20,000 kDa; between 5,000 kDa and 15,000 kDa; between 5,000 kDa and
10,000 kDa; between 5,000 kDa and 7,500 kDa; between 6,000 kDa and
20,000 kDa; between 6,000 kDa and 15,000 kDa; between 6,000 kDa and
12,500 kDa; between 6,000 kDa and 10,000 kDa or between 6,000 kDa
and 7,500 kDa. The molecular weight of the glycoconjugate is
measured by SEC-MALLS. Any whole number integer within any of the
above ranges is contemplated as an embodiment of the
disclosure.
[0213] In a preferred embodiment, the serotype 22F glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 or
0.7 or about 0.8 mM acetate per mM serotype 22F polysaccharide. In
a preferred embodiment, the glycoconjugate comprises at least 0.5,
0.6 or 0.7 mM acetate per mM serotype 22F polysaccharide. In a
preferred embodiment, the glycoconjugate comprises at least 0.6 mM
acetate per mM serotype 22F polysaccharide. In a preferred
embodiment, the glycoconjugate comprises at least 0.7 mM acetate
per mM serotype 22F polysaccharide.
[0214] In a preferred embodiment, the ratio of mM acetate per mM
serotype 22F polysaccharide in the glycoconjugate to mM acetate per
mM serotype 22F polysaccharide in the isolated polysaccharide is at
least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred
embodiment, the ratio of mM acetate per mM serotype 22F
polysaccharide in the glycoconjugate to mM acetate per mM serotype
22F polysaccharide in the isolated polysaccharide is at least 0.7.
In a preferred embodiment, the ratio of mM acetate per mM serotype
22F polysaccharide in the glycoconjugate to mM acetate per mM
serotype 22F polysaccharide in the isolated polysaccharide is at
least 0.9.
[0215] In a preferred embodiment, the ratio of mM acetate per mM
serotype 22F polysaccharide in the glycoconjugate to mM acetate per
mM serotype 22F polysaccharide in the activated polysaccharide is
at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a
preferred embodiment, the ratio of mM acetate per mM serotype 22F
polysaccharide in the glycoconjugate to mM acetate per mM serotype
22F polysaccharide in the activated polysaccharide is at least 0.7.
In a preferred embodiment, the ratio of mM acetate per mM serotype
22F polysaccharide in the glycoconjugate to mM acetate per mM
serotype 22F polysaccharide in the activated polysaccharide is at
least 0.9.
[0216] Another way to characterize the serotype 22F glycoconjugates
of the invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide which can be characterized as a range of conjugated
lysines (degree of conjugation). The evidence for lysine
modification of the carrier protein, due to covalent linkages to
the polysaccharides, can be obtained by amino acid analysis using
routine methods known to those of skill in the art. Conjugation
results in a reduction in the number of lysine residues recovered
compared to the CRM.sub.197 protein starting material used to
generate the conjugate materials. In a preferred embodiment, the
degree of conjugation of the serotype 22F glycoconjugate of the
invention is between 2 and 15, between 2 and 13, between 2 and 10,
between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4,
between 3 and 15, between 3 and 13, between 3 and 10, between 3 and
8, between 3 and 6, between 3 and 5, between 3 and 4, between 5 and
15, between 5 and 10, between 8 and 15, between 8 and 12, between
10 and 15 or between 10 and 12. In an embodiment, the degree of
conjugation of the serotype 22F glycoconjugate of the invention is
about 2, about 3, about 4, about 5, about 6, about 7, about 8,
about 9, about 10, about 11, about 12, about 13, about 14 or about
15. In a preferred embodiment, the degree of conjugation of the
serotype 22F glycoconjugate of the invention is between 4 and 7. In
some such embodiments, the carrier protein is CRM.sub.197.
[0217] The serotype 22F glycoconjugates of the invention may also
be characterized by the ratio (weight/weight) of saccharide to
carrier protein. In some embodiments, the ratio of serotype 22F
polysaccharide to carrier protein in the glycoconjugate (w/w) is
between 0.5 and 3.0 (e.g., about 0.5, about 0.6, about 0.7, about
0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about
1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about
2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about
2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In other
embodiments, the saccharide to carrier protein ratio (w/w) is
between 0.5 and 2.0, between 0.5 and 1.5, between 0.8 and 1.2,
between 0.5 and 1.0, between 1.0 and 1.5 or between 1.0 and 2.0. In
further embodiments, the saccharide to carrier protein ratio (w/w)
is between 0.8 and 1.2. In a preferred embodiment, the ratio of
serotype 22F capsular polysaccharide to carrier protein in the
conjugate is between 0.9 and 1.1. In some such embodiments, the
carrier protein is CRM.sub.197.
[0218] The serotype 22F glycoconjugates and immunogenic
compositions of the invention may contain free saccharide that is
not covalently conjugated to the carrier protein, but is
nevertheless present in the glycoconjugate composition. The free
saccharide may be noncovalently associated with (i.e.,
noncovalently bound to, adsorbed to, or entrapped in or with) the
glycoconjugate.
[0219] In a preferred embodiment, the serotype 22F glycoconjugate
comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15%
of free serotype 22F polysaccharide compared to the total amount of
serotype 22F polysaccharide. In a preferred embodiment the serotype
22F glycoconjugate comprises less than about 40% of free serotype
22F polysaccharide compared to the total amount of serotype 22F
polysaccharide. In a preferred embodiment the serotype 22F
glycoconjugate comprises less than about 25% of free serotype 22F
polysaccharide compared to the total amount of serotype 22F
polysaccharide. In a preferred embodiment the serotype 22F
glycoconjugate comprises less than about 20% of free serotype 22F
polysaccharide compared to the total amount of serotype 22F
polysaccharide. In a preferred embodiment the serotype 22F
glycoconjugate comprises less than about 15% of free serotype 22F
polysaccharide compared to the total amount of serotype 22F
polysaccharide.
[0220] The serotype 22F glycoconjugates may also be characterized
by their molecular size distribution (K.sub.d). Size exclusion
chromatography media (CL-4B) can be used to determine the relative
molecular size distribution of the conjugate. Size Exclusion
Chromatography (SEC) is used in gravity fed columns to profile the
molecular size distribution of conjugates. Large molecules excluded
from the pores in the media elute more quickly than small
molecules. Fraction collectors are used to collect the column
eluate. The fractions are tested colorimetrically by saccharide
assay. For the determination of K.sub.d, Columns are calibrated to
establish the fraction at which molecules are fully excluded
(V.sub.0), (K.sub.d=0), and the fraction representing the maximum
retention (V.sub.i), (K.sub.d=1). The fraction at which a specified
sample attribute is reached (V.sub.e), is related to K.sub.d by the
expression, K.sub.d=(V.sub.e-V.sub.0)/(V.sub.i-V.sub.0).
[0221] In a preferred embodiment, at least 30% of the serotype 22F
glycoconjugate has a K.sub.d below or equal to 0.3 in a CL-4B
column. In a preferred embodiment, at least 40% of the
glycoconjugate has a K.sub.d below or equal to 0.3 in a CL-4B
column. In a preferred embodiment, at least 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, or 85% of the serotype 22F glycoconjugate has a
K.sub.d below or equal to 0.3 in a CL-4B column. In a preferred
embodiment, at least 60% of the serotype 22F glycoconjugate has a
K.sub.d below or equal to 0.3 in a CL-4B column. In a preferred
embodiment, between 50% and 80% of the serotype 22F glycoconjugate
has a K.sub.d below or equal to 0.3 in a CL-4B column. In a
preferred embodiment, between 65% and 80% of the serotype 22F
glycoconjugate has a K.sub.d below or equal to 0.3 in a CL-4B
column.
[0222] 1.3.3 Glycoconjugates from S. pneumoniae Serotype 33F
[0223] In an embodiment, the serotype 33F glycoconjugates are
obtained by activating polysaccharide with 1-cyano-4-dimethylamino
pyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The
activated polysaccharide may be coupled directly or via a spacer
(linker) group to an amino group on the carrier protein. For
example, the spacer could be cystamine or cysteamine to give a
thiolated polysaccharide which could be coupled to the carrier via
a thioether linkage obtained after reaction with a
maleimide-activated carrier protein (for example using GMBS) or a
haloacetylated carrier protein (for example using iodoacetimide,
SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester
(optionally made by CDAP chemistry) is coupled with hexane diamine
or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein using carbodiimide
(e.g., EDAC or EDC) chemistry via a carboxyl group on the protein
carrier. Such conjugates are described for example in WO 93/15760,
WO 95/08348 and WO 96/129094.
[0224] Other suitable techniques use carbodiimides, hydrazides,
active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (see
Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein.
[0225] In certain embodiments, the serotype 33F glycoconjugates of
the invention are prepared using reductive amination. In such
embodiment, the serotype 33F glycoconjugates of the invention maybe
prepared using reductive amination in aqueous phase (RAC/aqueous).
Reductive amination in aqueous phase has been successfully applied
to produce pneumococcal conjugate vaccine (see, e.g., WO
2006/110381). Preferably though, when using reductive amination,
the serotype 33F glycoconjugates are prepared via reductive
amination in DMSO (RAC/DMSO). In view of the challenges associated
with the preservation of O-acetyl functionality using RAC/aqueous
process, reductive amination in DMSO is preferred. RAC/DMSO has
been successfully applied to produce pneumococcal conjugate vaccine
(see, e.g., WO 2006/110381).
[0226] In preferred embodiments, the serotype 33F glycoconjugates
of the invention are prepared using eTEC conjugation (hereinafter
"serotype 33F eTEC linked glycoconjugates"), such as described at
Examples 1, 2 and 3 and in WO 2014/027302. Said 33F glycoconjugates
comprise a saccharide covalently conjugated to a carrier protein
through one or more eTEC spacers, wherein the saccharide is
covalently conjugated to the eTEC spacer through a carbamate
linkage, and wherein the carrier protein is covalently conjugated
to the eTEC spacer through an amide linkage. The eTEC linked
glycoconjugates of the invention may be represented by the general
formula (III):
##STR00003##
[0227] wherein the atoms that comprise the eTEC spacer are
contained in the central box.
[0228] The eTEC spacer includes seven linear atoms (i.e.,
--C(O)NH(CH.sub.2).sub.2SCH.sub.2C(O)--) and provides stable
thioether and amide bonds between the saccharide and carrier
protein. Synthesis of the eTEC linked glycoconjugate involves
reaction of an activated hydroxyl group of the saccharide with the
amino group of a thioalkylamine reagent, e.g., cystamine or
cysteinamine or a salt thereof, forming a carbamate linkage to the
saccharide to provide a thiolated saccharide. Generation of one or
more free sulfhydryl groups is accomplished by reaction with a
reducing agent to provide an activated thiolated saccharide.
Reaction of the free sulfhydryl groups of the activated thiolated
saccharide with an activated carrier protein having one or more
.alpha.-haloacetamide groups on amine containing residues generates
a thioether bond to form the conjugate, wherein the carrier protein
is attached to the eTEC spacer through an amide bond.
[0229] In serotype 33F glycoconjugates of the invention, the
saccharide may be a polysaccharide or an oligosaccharide. The
carrier protein may be selected from any suitable carrier as
described herein or known to those of skill in the art. In frequent
embodiments, the saccharide is a polysaccharide. In some such
embodiments, the carrier protein is CRM.sub.197. In some such
embodiments, the eTEC linked glycoconjugate comprises a S.
pneumoniae serotype 33F capsular polysaccharide.
[0230] In particularly preferred embodiments, the eTEC linked
glycoconjugate comprises a Pn-33F capsular polysaccharide, which is
covalently conjugated to CRM.sub.197 through an eTEC spacer
(serotype 33F eTEC linked glycoconjugates).
[0231] In some embodiments, the serotype 33F glycoconjugates of the
present invention comprise a saccharide having a molecular weight
of between 10 kDa and 2,000 kDa. In other such embodiments, the
saccharide has a molecular weight of between 50 kDa and 2,000 kDa.
In further such embodiments, the saccharide has a molecular weight
of between 50 kDa and 1,750 kDa; between 50 kDa and 1,500 kDa;
between 50 kDa and 1,250 kDa; between 50 kDa and 1,000 kDa; between
50 kDa and 750 kDa; between 50 kDa and 500 kDa; between 100 kDa and
2,000 kDa; between 100 kDa and 1,750 kDa; between 100 kDa and 1,500
kDa; between 100 kDa and 1,250 kDa; between 100 kDa and 1,000 kDa;
between 100 kDa and 750 kDa; between 100 kDa and 500 kDa; between
200 kDa and 2,000 kDa; between 200 kDa and 1,750 kDa; between 200
kDa and 1,500 kDa; between 200 kDa and 1,250 kDa; between 200 kDa
and 1,000 kDa; between 200 kDa and 750 kDa; or between 200 kDa and
500 kDa. Any whole number integer within any of the above ranges is
contemplated as an embodiment of the disclosure.
[0232] In some embodiments, the serotype 33F glycoconjugate of the
invention has a molecular weight of between 50 kDa and 20,000 kDa.
In other embodiments, the serotype 33F glycoconjugate has a
molecular weight of between 500 kDa and 10,000 kDa. In other
embodiments, the serotype 33F glycoconjugate has a molecular weight
of between 200 kDa and 10,000 kDa. In still other embodiments, the
serotype 33F glycoconjugate has a molecular weight of between 1,000
kDa and 3,000 kDa.
[0233] In further embodiments, the serotype 33F glycoconjugate of
the invention has a molecular weight of between 200 kDa and 20,000
kDa; between 200 kDa and 15,000 kDa; between 200 kDa and 10,000
kDa; between 200 kDa and 7,500 kDa; between 200 kDa and 5,000 kDa;
between 200 kDa and 3,000 kDa; between 200 kDa and 1,000 kDa;
between 500 kDa and 20,000 kDa; between 500 kDa and 15,000 kDa;
between 500 kDa and 12,500 kDa; between 500 kDa and 10,000 kDa;
between 500 kDa and 7,500 kDa; between 500 kDa and 6,000 kDa;
between 500 kDa and 5,000 kDa; between 500 kDa and 4,000 kDa;
between 500 kDa and 3,000 kDa; between 500 kDa and 2,000 kDa;
between 500 kDa and 1,500 kDa; between 500 kDa and 1,000 kDa;
between 750 kDa and 20,000 kDa; between 750 kDa and 15,000 kDa;
between 750 kDa and 12,500 kDa; between 750 kDa and 10,000 kDa;
between 750 kDa and 7,500 kDa; between 750 kDa and 6,000 kDa;
between 750 kDa and 5,000 kDa; between 750 kDa and 4,000 kDa;
between 750 kDa and 3,000 kDa; between 750 kDa and 2,000 kDa;
between 750 kDa and 1,500 kDa; between 1,000 kDa and 15,000 kDa;
between 1,000 kDa and 12,500 kDa; between 1,000 kDa and 10,000 kDa;
between 1,000 kDa and 7,500 kDa; between 1,000 kDa and 6,000 kDa;
between 1,000 kDa and 5,000 kDa; between 1,000 kDa and 4,000 kDa;
between 1,000 kDa and 2,500 kDa; between 2,000 kDa and 15,000 kDa;
between 2,000 kDa and 12,500 kDa; between 2,000 kDa and 10,000 kDa;
between 2,000 kDa and 7,500 kDa; between 2,000 kDa and 6,000 kDa;
between 2,000 kDa and 5,000 kDa; between 2,000 kDa and 4,000 kDa;
between 2,000 kDa and 3,000 kDa; between 3,000 kDa and 20,000 kDa;
between 3,000 kDa and 15,000 kDa; between 3,000 kDa and 12,500 kDa;
between 3,000 kDa and 10,000 kDa; between 3,000 kDa and 9,000 kDa;
between 3,000 kDa and 8,000 kDa; between 3,000 kDa and 7,000 kDa;
between 3,000 kDa and 6,000 kDa; between 3,000 kDa and 5,000 kDa or
between 3,000 kDa and 4,000 kDa. Any whole number integer within
any of the above ranges is contemplated as an embodiment of the
disclosure.
[0234] Another way to characterize the serotype 33F glycoconjugates
of the invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide, which can be characterized as a range of conjugated
lysines (degree of conjugation).
[0235] In a preferred embodiment, the degree of conjugation of the
serotype 33F glycoconjugate of the invention is between 2 and 20,
between 4 and 16, between 2 and 15, between 2 and 13, between 2 and
10, between 2 and 8, between 2 and 6, between 2 and 5, between 2
and 4, between 3 and 15, between 3 and 13, between 3 and 10,
between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4,
between 5 and 15, between 5 and 10, between 8 and 15, between 8 and
12, between 10 and 15 or between 10 and 12. In an embodiment, the
degree of conjugation of the serotype 33F glycoconjugate of the
invention is about 2, about 3, about 4, about 5, about 6, about 7,
about 8, about 9, about 10, about 11, about 12, about 13, about 14,
about 15, about 16, about 17, about 18, about 19 or about 20. In a
preferred embodiment, the degree of conjugation of the serotype 33F
glycoconjugate of the invention is between 4 and 16. In some such
embodiments, the carrier protein is CRM.sub.197.
[0236] In a preferred embodiment, the carrier protein comprises
CRM.sub.197, which contains 39 lysine residues. In some such
embodiments, the CRM.sub.197 may comprise 4 to 16 lysine residues
out of 39 covalently linked to the saccharide. Another way to
express this parameter is that about 10% to about 41% of
CRM.sub.197 lysines are covalently linked to the saccharide. In
another such embodiment, the CRM.sub.197 may comprise 2 to 20
lysine residues out of 39 covalently linked to the saccharide.
Another way to express this parameter is that about 5% to about 50%
of CRM.sub.197 lysines are covalently linked to the saccharide. In
some embodiments, the CRM.sub.197 may comprise about 4, about 5,
about 6, about 7, about 8, about 9, about 10, about 11, about 12,
about 13, about 14, about 15, or about 16 lysine residues out of 39
covalently linked to the saccharide.
[0237] In frequent embodiments, the carrier protein is covalently
conjugated to an eTEC spacer through an amide linkage to one or
more .epsilon.-amino groups of lysine residues on the carrier
protein. In some such embodiments, the carrier protein comprises 2
to 20 lysine residues covalently conjugated to the saccharide. In
other such embodiments, the carrier protein comprises 4 to 16
lysine residues covalently conjugated to the saccharide.
[0238] The serotype 33F glycoconjugates of the invention may also
be characterized by the ratio (weight/weight) of saccharide to
carrier protein. In some embodiments, the saccharide to carrier
protein ratio (w/w) is between 0.2 and 4.0 (e.g., about 0.2, about
0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about
0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about
1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about
2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about
2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about
3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about
3.9 or about 4.0). In other embodiments, the saccharide to carrier
protein ratio (w/w) is between 1.0 and 2.5. In further embodiments,
the saccharide to carrier protein ratio (w/w) is between 0.4 and
1.7. In some such embodiments, the carrier protein is
CRM.sub.197.
[0239] The frequency of attachment of the saccharide chain to a
lysine on the carrier protein is another parameter for
characterizing the serotype 33F glycoconjugates of the invention.
For example, in some embodiments, at least one covalent linkage
between the carrier protein and the polysaccharide occurs for every
4 saccharide repeat units of the polysaccharide. In another
embodiment, the covalent linkage between the carrier protein and
the polysaccharide occurs at least once in every 10 saccharide
repeat units of the polysaccharide. In another embodiment, the
covalent linkage between the carrier protein and the polysaccharide
occurs at least once in every 15 saccharide repeat units of the
polysaccharide. In a further embodiment, the covalent linkage
between the carrier protein and the polysaccharide occurs at least
once in every 25 saccharide repeat units of the polysaccharide.
[0240] In frequent embodiments, the carrier protein is CRM.sub.197
and the covalent linkage via an eTEC spacer between the CRM.sub.197
and the polysaccharide occurs at least once in every 4, 10, 15 or
25 saccharide repeat units of the polysaccharide.
[0241] In other embodiments, the conjugate comprises at least one
covalent linkage between the carrier protein and saccharide for
every 5 to 10 saccharide repeat units; every 2 to 7 saccharide
repeat units; every 3 to 8 saccharide repeat units; every 4 to 9
saccharide repeat units; every 6 to 11 saccharide repeat units;
every 7 to 12 saccharide repeat units; every 8 to 13 saccharide
repeat units; every 9 to 14 saccharide repeat units; every 10 to 15
saccharide repeat units; every 2 to 6 saccharide repeat units,
every 3 to 7 saccharide repeat units; every 4 to 8 saccharide
repeat units; every 6 to 10 saccharide repeat units; every 7 to 11
saccharide repeat units; every 8 to 12 saccharide repeat units;
every 9 to 13 saccharide repeat units; every 10 to 14 saccharide
repeat units; every 10 to 20 saccharide repeat units; every 4 to 25
saccharide repeat units or every 2 to 25 saccharide repeat units.
In frequent embodiments, the carrier protein is CRM.sub.197.
[0242] In another embodiment, at least one linkage between carrier
protein and saccharide occurs for every 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25
saccharide repeat units of the polysaccharide. In an embodiment,
the carrier protein is CRM.sub.197. Any whole number integer within
any of the above ranges is contemplated as an embodiment of the
disclosure.
[0243] An important consideration during conjugation is the
development of conditions that permit the retention of potentially
sensitive non-saccharide substituent functional groups of the
individual components, such as O-Acyl, phosphate or glycerol
phosphate side chains that may form part of the saccharide
epitope.
[0244] In one embodiment, the serotype 33F glycoconjugates of the
invention comprise a saccharide which has a degree of O-acetylation
between 10% and 100%. In some such embodiments, the saccharide has
a degree of O-acetylation between 50% and 100%. In other such
embodiments, the saccharide has a degree of O-acetylation between
75% and 100%. In further embodiments, the saccharide has a degree
of O-acetylation greater than or equal to 70% (70%).
[0245] In a preferred embodiment, the serotype 33F glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7 or 0.8 mM acetate per mM serotype 33F capsular polysaccharide.
In a preferred embodiment, the glycoconjugate comprises at least
0.5, 0.6 or 0.7 mM acetate per mM serotype 33F capsular
polysaccharide. In a preferred embodiment, the glycoconjugate
comprises at least 0.6 mM acetate per mM serotype 33F capsular
polysaccharide. In a preferred embodiment, the glycoconjugate
comprises at least 0.7 mM acetate per mM serotype 33F capsular
polysaccharide. In a preferred embodiment, the presence of O-acetyl
groups is determined by ion-HPLC analysis.
[0246] In a preferred embodiment, the ratio of mM acetate per mM
serotype 33F polysaccharide in the glycoconjugate to mM acetate per
mM serotype 33F polysaccharide in the isolated polysaccharide is at
least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred
embodiment, the ratio of mM acetate per mM serotype 33F
polysaccharide in the glycoconjugate to mM acetate per mM serotype
33F polysaccharide in the isolated polysaccharide is at least 0.7.
In a preferred embodiment, the ratio of mM acetate per mM serotype
33F polysaccharide in the glycoconjugate to mM acetate per mM
serotype 33F polysaccharide in the isolated polysaccharide is at
least 0.9.
[0247] In a preferred embodiment, the ratio of mM acetate per mM
serotype 33F polysaccharide in the glycoconjugate to mM acetate per
mM serotype 33F polysaccharide in the activated polysaccharide is
at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a
preferred embodiment, the ratio of mM acetate per mM serotype 33F
polysaccharide in the glycoconjugate to mM acetate per mM serotype
33F polysaccharide in the activated polysaccharide is at least 0.7.
In a preferred embodiment, the ratio of mM acetate per mM serotype
33F polysaccharide in the glycoconjugate to mM acetate per mM
serotype 33F polysaccharide in the activated polysaccharide is at
least 0.9.
[0248] The serotype 33F glycoconjugates and immunogenic
compositions of the invention may contain free saccharide that is
not covalently conjugated to the carrier protein, but is
nevertheless present in the glycoconjugate composition. The free
saccharide may be noncovalently associated with (i.e.,
noncovalently bound to, adsorbed to, or entrapped in or with) the
glycoconjugate.
[0249] In some embodiments, the serotype 33F glycoconjugates of the
invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%,
20%, 15%, 10% or 5% of free serotype 33F polysaccharide compared to
the total amount of serotype 33F polysaccharide.
[0250] Preferably, the serotype 33F glycoconjugate comprises less
than 15% free saccharide, more preferably less than 10% free
saccharide, and still more preferably, less than 5% of free
saccharide. In a preferred embodiment the serotype 33F
glycoconjugate comprises less than about 25% of free serotype 33F
polysaccharide compared to the total amount of serotype 33F
polysaccharide. In a preferred embodiment the serotype 33F
glycoconjugate comprises less than about 20% of free serotype 33F
polysaccharide compared to the total amount of serotype 33F
polysaccharide. In a preferred embodiment the serotype 33F
glycoconjugate comprises less than about 15% of free serotype 33F
polysaccharide compared to the total amount of serotype 33F
polysaccharide.
[0251] In certain preferred embodiments, the invention provides a
serotype 33F glycoconjugate having one or more of the following
features alone or in combination: the polysaccharide has a
molecular weight of between 50 kDa and 2,000 kDa; the
glycoconjugate has a molecular weight of between 500 kDa to 10,000
KDa; the carrier protein comprises 2 to 20 lysine residues
covalently linked to the saccharide; the saccharide to carrier
protein ratio (w/w) is between 0.2 and 4.0; the glycoconjugate
comprises at least one covalent linkage between the carrier protein
and the polysaccharide for every 4, 10, 15 or 25 saccharide repeat
units of the polysaccharide; the saccharide has a degree of
O-acetylation between 75% and 100%; the conjugate comprises less
than about 15% free polysaccharide relative to total
polysaccharide; the carrier protein is CRM.sub.197.
[0252] The serotype 33F glycoconjugates may also be characterized
by their molecular size distribution (K.sub.d). Size exclusion
chromatography media (CL-4B) can be used to determine the relative
molecular size distribution of the conjugate, as mentioned
above.
[0253] In an embodiment, at least 15% of the serotype 33F
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In an embodiment, at least 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 60%, 70%, 80% or 90% of the serotype 33F
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column.
[0254] In a preferred embodiment, at least 35% of the serotype 33F
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In preferred embodiments, at least 40%, 45%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 33F
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 60% of
the serotype 33F glycoconjugates of the invention have a K.sub.d
below or equal to 0.3 in a CL-4B column. In a preferred embodiment,
at least 70% of the serotype 33F glycoconjugates of the invention
have a K.sub.d below or equal to 0.3 in a CL-4B column.
[0255] In a preferred embodiment, between 40% and 90% of the
serotype 33F glycoconjugates have a K.sub.d below or equal to 0.3
in a CL-4B column. In a preferred embodiment, between 50% and 90%
of the serotype 33F glycoconjugates have a K.sub.d below or equal
to 0.3 in a CL-4B column. In a preferred embodiment, between 65%
and 80% of the serotype 33F glycoconjugates have a K.sub.d below or
equal to 0.3 in a CL-4B column.
[0256] 1.3.4 Glycoconjugates from S. pneumoniae Serotype 15B
[0257] In an embodiment, the serotype 15B glycoconjugates are
obtained by activating polysaccharide with 1-cyano-4-dimethylamino
pyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The
activated polysaccharide may be coupled directly or via a spacer
(linker) group to an amino group on the carrier protein. For
example, the spacer could be cystamine or cysteamine to give a
thiolated polysaccharide which could be coupled to the carrier via
a thioether linkage obtained after reaction with a
maleimide-activated carrier protein (for example using GMBS) or a
haloacetylated carrier protein (for example using iodoacetimide,
SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester
(optionally made by CDAP chemistry) is coupled with hexane diamine
or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein using carbodiimide
(e.g., EDAC or EDC) chemistry via a carboxyl group on the protein
carrier. Such conjugates are described for example in WO 93/15760,
WO 95/08348 and WO 96/129094.
[0258] Other suitable techniques use carbodiimides, hydrazides,
active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (see
Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein.
[0259] In preferred embodiments, the serotype 15B glycoconjugates
of the invention are prepared using reductive amination. Reductive
amination involves two steps: (1) oxidation of the polysaccharide
to generate aldehyde functionalities from vicinal diols in
individual hexasaccharide unit and (2) reduction of the activated
polysaccharide and a carrier protein to form a conjugate.
[0260] Preferably, before oxidation, sizing of the serotype 15B
polysaccharide to a target molecular weight (MW) range is
performed. Advantageously, the size of the purified serotype 15B
polysaccharide is reduced while preserving critical features of the
structure of the polysaccharide such as for example the presence of
O-acetyl groups. Preferably, the size of the purified serotype 15B
polysaccharide is reduced by mechanical homogenization (see section
1.2.6 above).
[0261] The oxidation step may involve reaction with periodate. For
the purpose of the present invention, the term "periodate" includes
both periodate and periodic acid; the term also includes both
metaperiodate (IO.sub.4.sup.-) and orthoperiodate (IO.sub.6.sup.5-)
and the various salts of periodate (e.g., sodium periodate and
potassium periodate). In a preferred embodiment the periodate used
for the oxidation of serotype 15B capsular polysaccharide is
metaperiodate. In a preferred embodiment the periodate used for the
oxidation of serotype 15B capsular polysaccharide is sodium
metaperiodate.
[0262] In a preferred embodiment, the polysaccharide is reacted
with 0.01 to 10.0, 0.05 to 5.0, 0.1 to 1.0, 0.5 to 1.0, 0.7 to 0.8,
0.05 to 0.5, 0.1 to 0.3 molar equivalents of oxidizing agent. In a
preferred embodiment, the polysaccharide is reacted with about 0.1,
0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7,
0.75, 0.8, 0.85, 0.9, 0.95 molar equivalents of oxidizing agent. In
a preferred embodiment, the polysaccharide is reacted with about
0.15 molar equivalents of oxidizing agent. In a preferred
embodiment, the polysaccharide is reacted with about 0.25 molar
equivalents of oxidizing agent. In a preferred embodiment, the
polysaccharide is reacted with about 0.5 molar equivalents of
oxidizing agent. In a preferred embodiment, the polysaccharide is
reacted with about 0.6 molar equivalents of oxidizing agent. In a
preferred embodiment, the polysaccharide is reacted with about 0.7
molar equivalents of oxidizing agent.
[0263] In a preferred embodiment, the duration of the reaction is
between 1 hour and 50 hours, between 10 hours and 30 hours, between
15 hours and 20 hours, between 15 hours and 17 hours or about 16
hours.
[0264] In a preferred embodiment, the temperature of the reaction
is maintained between 15.degree. C. and 45.degree. C., between
15.degree. C. and 30.degree. C., between 20.degree. C. and
25.degree. C. In a preferred embodiment, the temperature of the
reaction is maintained at about 23.degree. C.
[0265] In a preferred embodiment, the oxidation reaction is carried
out in a buffer selected from sodium phosphate, potassium
phosphate, 2-(N-morpholino)ethanesulfonic acid (MES) or Bis-Tris.
In a preferred embodiment, the buffer is potassium phosphate.
[0266] In a preferred embodiment, the buffer has a concentration of
between 1 mM and 500 mM, between 1 mM and 300 mM, or between 50 mM
and 200 mM. In a preferred embodiment the buffer has a
concentration of about 100 mM.
[0267] In a preferred embodiment, the oxidation reaction is carried
out at a pH between 4.0 and 8.0, between 5.0 and 7.0, or between
5.5 and 6.5. In a preferred embodiment, the pH is about 6.0.
[0268] In preferred embodiment, the activated serotype 15B capsular
polysaccharide is obtained by reacting 0.5 mg/mL to 5 mg/mL of
isolated serotype 15B capsular polysaccharide with 0.2 to 0.3 molar
equivalents of periodate at a temperature between 20.degree. C. and
25.degree. C.
[0269] In a preferred embodiment, the activated serotype 15B
capsular polysaccharide is purified. The activated serotype 15B
capsular polysaccharide is purified according to methods known to
the man skilled in the art, such as gel permeation chromatography
(GPC), dialysis or ultrafiltration/diafiltration. For example, the
activated capsular polysaccharide is purified by concentration and
diafiltration using an ultrafiltration device. In a preferred
embodiment, the degree of oxidation of the activated serotype 15B
capsular polysaccharide is between 2 and 20, between 2 and 15,
between 2 and 10, between 2 and 5, between 5 and 20, between 5 and
15, between 5 and 10, between 10 and 20, between 10 and 15, or
between 15 and 20. In a preferred embodiment the degree of
oxidation of the activated serotype 15B capsular polysaccharide is
between 2 and 10, between 4 and 8, between 4 and 6, between 6 and
8, between 6 and 12, between 8 and 12, between 9 and 11, between 10
and 16, between 12 and 16, between 14 and 18, between 16 and 20,
between 16 and 18, or between 18 and 20.
[0270] In a preferred embodiment, the activated serotype 15B
capsular polysaccharide has a molecular weight between 5 kDa and
500 kDa, between 50 kDa and 500 kDa, between 50 kDa and 450 kDa,
between 100 kDa and 400 kDa, between 100 kDa and 350 kDa. In a
preferred embodiment, the activated serotype 15B capsular
polysaccharide has a molecular weight between 100 kDa and 350 kDa.
In a preferred embodiment, the activated serotype 15B capsular
polysaccharide has a molecular weight between 100 kDa and 300 kDa.
In a preferred embodiment, the activated serotype 15B capsular
polysaccharide has a molecular weight between 100 kDa and 250
kDa.
[0271] In a preferred embodiment, the activated serotype 15B
capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5,
0.6, 0.7 or 0.8 mM acetate per mM of said serotype 15B capsular
polysaccharide. In a preferred embodiment, the activated serotype
15B capsular polysaccharide comprises at least 0.5, 0.6 or 0.7 mM
acetate per mM of said serotype 15B capsular polysaccharide. In a
preferred embodiment, the activated serotype 15B capsular
polysaccharide comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide. In a preferred embodiment,
the activated serotype 15B capsular polysaccharide comprises at
least 0.7 mM acetate per mM of said serotype 15B capsular
polysaccharide.
[0272] In a preferred embodiment, the activated serotype 15B
capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5,
0.6, 0.7 or 0.8 mM glycerol per mM of said serotype 15B capsular
polysaccharide. In a preferred embodiment, the activated serotype
15B capsular polysaccharide comprises at least 0.5, 0.6 or 0.7 mM
glycerol per mM of said serotype 15B capsular polysaccharide. In a
preferred embodiment, the activated serotype 15B capsular
polysaccharide comprises at least 0.6 mM glycerol per mM of said
serotype 15B capsular polysaccharide. In a preferred embodiment,
the activated serotype 15B capsular polysaccharide comprises at
least 0.7 mM glycerol per mM of said serotype 15B capsular
polysaccharide.
[0273] In a preferred embodiment, the activated serotype 15B
capsular polysaccharide has a molecular weight between 100 kDa and
250 kDa and comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide.
[0274] In a preferred embodiment, the activated serotype 15B
capsular polysaccharide has a molecular weight between 100 kDa and
250 kDa and comprises at least 0.6 mM glycerol per mM of said
serotype 15B capsular polysaccharide.
[0275] In a preferred embodiment, the activated serotype 15B
capsular polysaccharide comprises at least 0.6 mM acetate per mM of
said serotype 15B capsular polysaccharide and at least 0.6 mM
glycerol per mM of said serotype 15B capsular polysaccharide.
[0276] In a preferred embodiment, the activated serotype 15B
capsular polysaccharide has a molecular weight between 100 kDa and
250 kDa and comprises at least 0.6 mM acetate per mM of said
serotype 15B capsular polysaccharide and at least 0.6 mM glycerol
per mM of said serotype 15B capsular polysaccharide.
[0277] In an embodiment, the activated serotype 15B capsular
polysaccharide is lyophilized, optionally in the presence of
saccharide. In a preferred embodiment, the saccharide is selected
from sucrose, trehalose, raffinose, stachyose, melezitose, dextran,
mannitol, lactitol and palatinit. In a preferred embodiment, the
saccharide is sucrose. The lyophilized activated capsular
polysaccharide can then be compounded with a solution comprising
the carrier protein.
[0278] In another embodiment, the activated serotype 15B capsular
polysaccharide is compounded with the carrier protein and
lyophilized optionally in the presence of a saccharide. In a
preferred embodiment, the saccharide is selected from sucrose,
trehalose, raffinose, stachyose, melezitose, dextran, mannitol,
lactitol and palatinit. In a preferred embodiment, the saccharide
is sucrose. The co-lyophilized polysaccharide and carrier protein
can then be resuspended in solution and reacted with a reducing
agent.
[0279] The activated serotype 15B capsular polysaccharide can be
conjugated to a carrier protein by a process comprising the step
of:
[0280] (a) compounding the activated serotype 15B capsular
polysaccharide with a carrier protein, and
[0281] (b) reacting the compounded activated serotype 15B capsular
polysaccharide and carrier protein with a reducing agent to form a
serotype 15B capsular polysaccharide-carrier protein conjugate.
[0282] The conjugation of activated serotype 15B capsular
polysaccharide with a protein carrier by reductive amination in
dimethylsulfoxide (DMSO) is suitable to preserve the O-acetyl
content of the polysaccharide as compared for example to reductive
amination in aqueous solution where the level of O-acetylation of
the polysaccharide is significantly reduced. In a preferred
embodiment, step (a) and step (b) are carried out in DMSO.
[0283] In a preferred embodiment, step (a) comprises dissolving
lyophilized serotype 15B capsular polysaccharide in a solution
comprising a carrier protein and DMSO. In a preferred embodiment,
step (a) comprises dissolving co-lyophilized serotype 15B capsular
polysaccharide and carrier protein in DMSO.
[0284] When steps (a) and (b) are carried out in aqueous solution,
steps (a) and (b) are carried out in a buffer, preferably selected
from PBS, MES, HEPES, Bis-tris, ADA, PIPES, MOPSO, BES, MOPS,
DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bicine or HEPB, at a pH
between 6.0 and 8.5, between 7.0 and 8.0 or between 7.0 and 7.5. In
a preferred embodiment the buffer is PBS. In a preferred embodiment
the pH is about 7.3.
[0285] In a preferred embodiment, the concentration of activated
serotype 15B capsular polysaccharide in step (b) is between 0.1
mg/mL and 10 mg/mL, between 0.5 mg/mL and 5 mg/mL, or between 0.5
mg/mL and 2 mg/mL. In a preferred embodiment, the concentration of
activated serotype 15B capsular polysaccharide in step (b) is about
0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3,
1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6,
2.7, 2.8, 2.9 or 3.0 mg/mL.
[0286] In a preferred embodiment the initial input ratio (weight by
weight) of activated serotype 15B capsular polysaccharide to
carrier protein is between 5:1 and 0.1:1, between 2:1 and 0.1:1,
between 2:1 and 1:1, between 1.5:1 and 1:1, between 0.1:1 and 1:1,
between 0.3:1 and 1:1, or between 0.6:1 and 1:1.
[0287] In a preferred embodiment the initial input ratio of
activated serotype 15B capsular polysaccharide to carrier protein
is about 0.6:1 to 1:1. In another preferred embodiment the initial
input ratio of activated serotype 15B capsular polysaccharide to
carrier protein is about 0.6:1 to 1.5:1. Such initial input ratio
is particularly suitable to obtain low levels of free
polysaccharide in the glycoconjugate.
[0288] In a preferred embodiment the initial input ratio of
activated serotype 15B capsular polysaccharide to carrier protein
is about 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1,
1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1 or 2:1.
[0289] In an embodiment, the reducing agent is sodium
cyanoborohydride, sodium triacetoxyborohydride, sodium or zinc
borohydride in the presence of Bronsted or Lewis acids, amine
boranes such as pyridine borane, 2-Picoline Borane,
2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3,
benzylamine-BH3 or 5-ethyl-2-methylpyridine borane (PEMB). In a
preferred embodiment, the reducing agent is sodium
cyanoborohydride. In a preferred embodiment, the reducing agent is
sodium 2-Picoline Borane.
[0290] In a preferred embodiment, the quantity of reducing agent
used in step (b) is between about 0.1 and 10.0 molar equivalents,
between 0.5 and 5.0 molar equivalents, or between 1.0 and 2.0 molar
equivalents. In a preferred embodiment, the quantity of reducing
agent used in step (b) is about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6,
1.7, 1.8, 1.9 or 2.0 molar equivalents.
[0291] In a preferred embodiment, the duration of step (b) is
between 1 hour and 60 hours, between 10 hours and 50 hours, between
40 hours and 50 hours, or between 42 hours and 46 hours. In a
preferred embodiment, the duration of step (b) is about 44
hours.
[0292] In a preferred embodiment, the temperature of the reaction
in step (b) is maintained between 10.degree. C. and 40.degree. C.,
between 15.degree. C. and 30.degree. C. or between 20.degree. C.
and 26.degree. C. In a preferred embodiment, the temperature of the
reaction in step (b) is maintained at about 23.degree. C.
[0293] In a preferred embodiment, the process for the preparation
of a glycoconjugate comprising S. pneumoniae serotype 15B capsular
polysaccharide covalently linked to a carrier protein further
comprises a step (step (c)) of capping unreacted aldehyde
(quenching) by addition of NaBH.sub.4.
[0294] In a preferred embodiment, the quantity of NaBH.sub.4 used
in step (c) is between 0.1 and 10 molar equivalents, between 0.5
and 5.0 molar equivalents or between 1.0 and 3.0 molar equivalents.
In a preferred embodiment, the quantity of NaBH.sub.4 used in step
(c) is about 2.0 molar equivalents.
[0295] In a preferred embodiment, the duration of step (c) is
between 0.1 hours and 10 hours, 0.5 hours and 5 hours, or between 2
hours and 4 hours. In a preferred embodiment, the duration of step
(c) is about 3 hours.
[0296] In a preferred embodiment, the temperature of the reaction
in step (c) is maintained between 15.degree. C. and 45.degree. C.,
between 15.degree. C. and 30.degree. C. or between 20.degree. C.
and 26.degree. C. In a preferred embodiment, the temperature of the
reaction in step (c) is maintained at about 23.degree. C.
[0297] In a preferred embodiment the yield of the conjugation step
is greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90%. In a
preferred embodiment the yield of the conjugation step (step b) is
greater than 60%. In a preferred embodiment the yield of the
conjugation step (step b) is greater than 70%. The yield is the
amount of serotype 15B polysaccharide in the
conjugate.times.100)/amount of activated polysaccharide used in the
conjugation step.
[0298] In a preferred embodiment, the process for the preparation
of a glycoconjugate comprising S. pneumoniae serotype 15B capsular
polysaccharide covalently linked to a carrier protein comprises the
steps of:
[0299] (a) sizing purified serotype 15B polysaccharide by high
pressure homogenization;
[0300] (b) reacting the sized serotype 15B polysaccharide with an
oxidizing agent;
[0301] (c) compounding the activated serotype 15B polysaccharide
with a carrier protein;
[0302] (d) reacting the compounded activated serotype 15B
polysaccharide and carrier protein with a reducing agent to form a
serotype 15B polysaccharide-carrier protein conjugate; and
[0303] (e) capping unreacted aldehyde (quenching) by addition of
NaBH.sub.4.
[0304] In a preferred embodiment the yield of the conjugation step
(step d) of the above process is greater than 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85% or 90%. In a preferred embodiment the yield of
the conjugation step (step d) is greater than 60%. In a preferred
embodiment the yield of the conjugation step (step d) is greater
than 70%. The yield is the amount of serotype 15B polysaccharide in
the conjugate.times.100)/amount of activated polysaccharide used in
the conjugation step.
[0305] After conjugation of the serotype 15B capsular
polysaccharide to the carrier protein, the polysaccharide-protein
conjugate can be purified (enriched with respect to the amount of
polysaccharide-protein conjugate) by a variety of techniques known
to the skilled person. These techniques include dialysis,
concentration/diafiltration operations, tangential flow filtration,
precipitation/elution, column chromatography (DEAE or hydrophobic
interaction chromatography), and depth filtration.
[0306] In an embodiment the carrier protein is as defined at
section 1.1. In an embodiment the carrier protein is selected in
the group consisting of: DT (Diphtheria toxin), TT (tetanus toxid),
CRM.sub.197, other DT mutants, PD (Haemophilus influenzae protein
D), or immunologically functional equivalents thereof. In an
embodiment the carrier protein is CRM.sub.197.
[0307] In some embodiments, the serotype 15B glycoconjugates of the
present invention are conjugated to the carrier protein (e.g.,
CRM.sub.197) and comprise a saccharide having a molecular weight of
between 5 kDa and 1,500 kDa. In other such embodiments, the
saccharide has a molecular weight of between 10 kDa and 1,500 kDa.
In further such embodiments, the saccharide has a molecular weight
of between 50 kDa and 1,500 kDa; between 50 kDa and 1,250 kDa;
between 50 kDa and 1,000 kDa; between 50 kDa and 750 kDa; between
50 kDa and 500 kDa; between 50 kDa and 250 kDa; between 100 kDa and
1,500 kDa; between 100 kDa and 1,250 kDa; between 100 kDa and 1,000
kDa; between 100 kDa and 750 kDa; between 100 kDa and 500 kDa;
between 100 kDa and 250 kDa; between 200 kDa and 1,500 kDa; between
200 kDa and 1,250 kDa; between 200 kDa and 1,000 kDa; between 200
kDa and 750 kDa; or between 200 kDa and 500 kDa; or between 200 kDa
and 400 kDa. Any whole number integer within any of the above
ranges is contemplated as an embodiment of the disclosure. In some
embodiments, the serotype 15B glycoconjugate of the invention has a
molecular weight of between 50 kDa and 20,000 kDa. In some
embodiments, the serotype 15B glycoconjugate of the invention has a
molecular weight of between 1,000 kDa and 20,000 kDa In a preferred
embodiment, the serotype 15B glycoconjugate of the invention has a
molecular weight between 3,000 kDa and 20,000 kDa, between 5,000
kDa and 10,000 kDa, between 5,000 kDa and 20,000 kDa, between 8,000
kDa and 20,000 kDa, between 8,000 kDa and 16,000 kDa or between
10,000 kDa and 16,000 kDa.
[0308] In further embodiments, the serotype 15B glycoconjugate of
the invention has a molecular weight of about 1,000 kDa, about
1,500 kDa, about 2,000 kDa, about 2,500 kDa, about 3,000 kDa, about
3,500 kDa, about 4,000 kDa, about 4,500 kDa, about 5,000 kDa, about
5,500 kDa, about 6,000 kDa, about 6,500 kDa, about 7,000 kDa, about
7,500 kDa, about 8,000 kDa, about 8,500 kDa, about 9,000 kDa, about
9,500 kDa about 10,000 kDa, about 10,500 kDa, about 11,000 kDa,
about 11,500 kDa, about 12,000 kDa, about 12,500 kDa, about 13,000
kDa, about 13,500 kDa, about 14,000 kDa, about 14,500 kDa, about
15,000 kDa, about 15,500 kDa, about 16,000 kDa, about 16,500 kDa,
about 17,000 kDa, about 17,500 kDa, about 18,000 kDa, about 18,500
kDa about 19,000 kDa, about 19,500 kDa or about 20,000 kDa.
[0309] In further embodiments, the serotype 15B glycoconjugate of
the invention has a molecular weight of between 1,000 kDa and
20,000 kDa; between 1,000 kDa and 15,000 kDa; between 1,000 kDa and
10,000 kDa; between 1,000 kDa and 7,500 kDa; between 1,000 kDa and
5,000 kDa; between 1,000 kDa and 4,000 kDa; between 1,000 kDa and
3,000 kDa; between 2,000 kDa and 20,000 kDa; between 2,000 kDa and
15,000 kDa; between 2,000 kDa and 12,500 kDa; between 2,000 kDa and
10,000 kDa; between 2,000 kDa and 7,500 kDa; between 2,000 kDa and
6,000 kDa; between 2,000 kDa and 5,000 kDa; between 2,000 kDa and
4,000 kDa; or between 2,000 kDa and 3,000 kDa.
[0310] In further embodiments, the serotype 15B glycoconjugate of
the invention has a molecular weight of between 3,000 kDa and
20,000 kDa; between 3,000 kDa and 15,000 kDa; between 3,000 kDa and
10,000 kDa; between 3,000 kDa and 7,500 kDa; between 3,000 kDa and
5,000 kDa; between 3,000 kDa and 4,000 kDa; between 4,000 kDa and
20,000 kDa; between 4,000 kDa and 15,000 kDa; between 4,000 kDa and
12,500 kDa; between 4,000 kDa and 10,000 kDa; between 4,000 kDa and
7,500 kDa; between 4,000 kDa and 6,000 kDa or between 4,000 kDa and
5,000 kDa. In further embodiments, the serotype 15B glycoconjugate
of the invention has a molecular weight of between 5,000 kDa and
20,000 kDa; between 5,000 kDa and 15,000 kDa; between 5,000 kDa and
10,000 kDa; between 5,000 kDa and 7,500 kDa; between 6,000 kDa and
20,000 kDa; between 6,000 kDa and 15,000 kDa; between 6,000 kDa and
12,500 kDa; between 6,000 kDa and 10,000 kDa or between 6,000 kDa
and 7,500 kDa.
[0311] The molecular weight of the glycoconjugate is measured by
SEC-MALLS. Any whole number integer within any of the above ranges
is contemplated as an embodiment of the disclosure. In an
embodiment, said serotype 15B glycoconjugates are prepared using
reductive amination.
[0312] The serotype 15B glycoconjugates of the invention may also
be characterized by the ratio (weight/weight) of saccharide to
carrier protein. In a preferred embodiment, the ratio (weight by
weight) of serotype 15B capsular polysaccharide to carrier protein
in the conjugate is between 0.5 and 3.0 (e.g., about 0.5, about
0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about
1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about
1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about
2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9 or about
3.0). In a preferred embodiment, the ratio of serotype 15B capsular
polysaccharide to carrier protein in the conjugate is between 0.4
and 2. In a preferred embodiment, the ratio of serotype 15B
capsular polysaccharide to carrier protein in the conjugate is
between 0.5 and 2.0, 0.5 and 1.5, 0.5 and 1.0, 1.0 and 1.5, 1.0 and
2.0. In a preferred embodiment, the ratio of serotype 15B capsular
polysaccharide to carrier protein in the conjugate is between 0.7
and 0.9. The serotype 15B glycoconjugates and immunogenic
compositions of the invention may contain free saccharide that is
not covalently conjugated to the carrier protein, but is
nevertheless present in the glycoconjugate composition. The free
saccharide may be noncovalently associated with (i.e.,
noncovalently bound to, adsorbed to, or entrapped in or with) the
glycoconjugate.
[0313] In a preferred embodiment, the serotype 15B glycoconjugate
of the invention comprises less than about 50%, 45%, 40%, 35%, 30%,
25%, 20% or 15% of free serotype 15B capsular polysaccharide
compared to the total amount of serotype 15B capsular
polysaccharide. In a preferred embodiment the serotype 15B
glycoconjugate of the invention comprises less than about 25% of
free serotype 15B capsular polysaccharide compared to the total
amount of serotype 15B capsular polysaccharide. In a preferred
embodiment the serotype 15B glycoconjugate of the invention
comprises less than about 20% of free serotype 15B capsular
polysaccharide compared to the total amount of serotype 15B
capsular polysaccharide. In a preferred embodiment the serotype 15B
glycoconjugates of the invention comprises less than about 15% of
free serotype 15B capsular polysaccharide compared to the total
amount of serotype 15B capsular polysaccharide.
[0314] The serotype 15B glycoconjugates may also be characterized
by their molecular size distribution (K.sub.d). Size exclusion
chromatography media (CL-4B) can be used to determine the relative
molecular size distribution of the conjugate, as mentioned
above.
[0315] In a preferred embodiment, at least 20% of the serotype 15B
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 30% of
the immunogenic conjugate has a K.sub.d below or equal to 0.3 in a
CL-4B column. In a preferred embodiment, at least 40% of the
serotype 15B glycoconjugates of the invention have a K.sub.d below
or equal to 0.3 in a CL-4B column. In a preferred embodiment, at
least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the
serotype 15 glycoconjugates of the invention have a K.sub.d below
or equal to 0.3 in a CL-4B column. In a preferred embodiment, at
least 60% of the serotype 15B glycoconjugates of the invention have
a K.sub.d below or equal to 0.3 in a CL-4B column. In a preferred
embodiment, at least 70% of the serotype 15B glycoconjugates of the
invention have a K.sub.d below or equal to 0.3 in a CL-4B
column.
[0316] In a preferred embodiment, between 40% and 90% of the
serotype 15B glycoconjugates have a K.sub.d below or equal to 0.3
in a CL-4B column. In a preferred embodiment, between 50% and 90%
of the serotype 15B glycoconjugates have a K.sub.d below or equal
to 0.3 in a CL-4B column. In a preferred embodiment, between 65%
and 80% of the serotype 15B glycoconjugates have a K.sub.d below or
equal to 0.3 in a CL-4B column.
[0317] In a preferred embodiment, the serotype 15B glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7 or 0.8 mM acetate per mM serotype 15B capsular polysaccharide.
In a preferred embodiment, the glycoconjugate comprises at least
0.5, 0.6 or 0.7 mM acetate per mM serotype 15B capsular
polysaccharide. In a preferred embodiment, the glycoconjugate
comprises at least 0.6 mM acetate per mM serotype 15B capsular
polysaccharide. In a preferred embodiment, the glycoconjugate
comprises at least 0.7 mM acetate per mM serotype 15B capsular
polysaccharide. In a preferred embodiment, the presence of O-acetyl
groups is determined by ion-HPLC analysis.
[0318] In a preferred embodiment, the ratio of mM acetate per mM
serotype 15B capsular polysaccharide in the serotype 15B
glycoconjugate to mM acetate per mM serotype 15B capsular
polysaccharide in the isolated polysaccharide is at least 0.6,
0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred
embodiment, the ratio of mM acetate per mM serotype 15B capsular
polysaccharide in the serotype 15B glycoconjugate to mM acetate per
mM serotype 15B capsular polysaccharide in the isolated
polysaccharide is at least 0.7. In a preferred embodiment, the
ratio of mM acetate per mM serotype 15B capsular polysaccharide in
the serotype 15B glycoconjugate to mM acetate per mM serotype 15B
capsular polysaccharide in the isolated polysaccharide is at least
0.9. In a preferred embodiment, the presence of O-acetyl groups is
determined by ion-HPLC analysis.
[0319] In a preferred embodiment, the ratio of mM acetate per mM
serotype 15B capsular polysaccharide in the serotype 15B
glycoconjugate to mM acetate per mM serotype 15B capsular
polysaccharide in the activated polysaccharide is at least 0.6,
0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred
embodiment, the ratio of mM acetate per mM serotype 15B capsular
polysaccharide in the serotype 15B glycoconjugate to mM acetate per
mM serotype 15B capsular polysaccharide in the activated
polysaccharide is at least 0.7. In a preferred embodiment, the
ratio of mM acetate per mM serotype 15B capsular polysaccharide in
the serotype 15B glycoconjugate to mM acetate per mM serotype 15B
capsular polysaccharide in the activated polysaccharide is at least
0.9. In a preferred embodiment, the presence of O-acetyl groups is
determined by ion-HPLC analysis.
[0320] In a preferred embodiment, the serotype 15B glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7 or 0.8 mM glycerol per mM serotype 15B capsular polysaccharide.
In a preferred embodiment, the serotype 15B glycoconjugate of the
invention comprises at least 0.5, 0.6 or 0.7 mM glycerol per mM
serotype 15B capsular polysaccharide. In a preferred embodiment,
the serotype 15B glycoconjugate of the invention comprises at least
0.6 mM glycerol per mM serotype 15B capsular polysaccharide. In a
preferred embodiment, the serotype 15B glycoconjugate of the
invention comprises at least 0.7 mM glycerol per mM serotype 15B
capsular polysaccharide.
[0321] Another way to characterize the serotype 15B glycoconjugates
of the invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide which can be characterized as a range of conjugated
lysines (degree of conjugation). The evidence for lysine
modification of the carrier protein, due to covalent linkages to
the polysaccharides, can be obtained by amino acid analysis using
routine methods known to those of skill in the art. Conjugation
results in a reduction in the number of lysine residues recovered
compared to the CRM.sub.197 protein starting material used to
generate the conjugate materials.
[0322] In a preferred embodiment, the degree of conjugation of the
serotype 15B glycoconjugate of the invention is between 2 and 15,
between 2 and 13, between 2 and 10, between 2 and 8, between 2 and
6, between 2 and 5, between 2 and 4, between 3 and 15, between 3
and 13, between 3 and 10, between 3 and 8, between 3 and 6, between
3 and 5, between 3 and 4, between 5 and 15, between 5 and 10,
between 8 and 15, between 8 and 12, between 10 and 15 or between 10
and 12. In an embodiment, the degree of conjugation of the serotype
15B glycoconjugate of the invention is about 2, about 3, about 4,
about 5, about 6, about 7, about 8, about 9, about 10, about 11,
about 12, about 13, about 14 or about 15. In a preferred
embodiment, the degree of conjugation of the serotype 15B
glycoconjugate of the invention is between 2 and 5.
[0323] 1.3.5 Glycoconjugates from S. pneumoniae Serotype 12F
[0324] In the glycoconjugates from S. pneumoniae serotype 12F of
the present invention, the saccharide is selected from the group
consisting of a polysaccharide and an oligosaccharide, and the
carrier protein is selected from any suitable carrier as described
herein or known to those of skill in the art. In some preferred
embodiments, the saccharide is a polysaccharide from S. pneumoniae
serotype 12F.
[0325] In an embodiment, glycoconjugates from S. pneumoniae
serotype 12F are prepared using CDAP. The polysaccharides are
activated with 1-cyano-4-dimethylamino pyridinium tetrafluoroborate
(CDAP) to form a cyanate ester. The activated polysaccharide is
then coupled directly or via a spacer (linker) group to an amino
group on the carrier protein (preferably CRM.sub.197). For example,
the spacer could be cystamine or cysteamine to give a thiolated
polysaccharide which could be coupled to the carrier via a
thioether linkage obtained after reaction with a
maleimide-activated carrier protein (for example using GMBS) or a
haloacetylated carrier protein (for example using iodoacetimide,
SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester
(optionally made by CDAP chemistry) is coupled with hexane diamine
or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein (e.g., CRM.sub.197)
using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl
group on the protein carrier.
[0326] Other techniques for conjugation use carbodiimides,
hydrazides, active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (see
Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein.
[0327] In an embodiment, capsular polysaccharides from serotypes
12F S. pneumoniae are conjugated to the carrier protein by
reductive amination. Reductive amination involves two steps: (1)
oxidation of the polysaccharide to generate aldehyde
functionalities from vicinal diols in individual hexasaccharide
unit and (2) reduction of the activated polysaccharide and a
carrier protein to form a conjugate.
[0328] Before oxidation, the serotype 12F polysaccharide is
optionally hydrolized (sized). Mechanical or chemical hydrolysis
maybe employed. Chemical hydrolysis maybe conducted using acetic
acid.
[0329] In an embodiment, the oxidizing agent is periodate. The term
"periodate" includes both periodate and periodic acid (see
below).
[0330] In a preferred embodiment, the oxidizing agent is
2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical and
N-Chlorosuccinimide (NCS) as the cooxidant. In such embodiment, the
glycoconjugates from S. pneumoniae serotype 12F are prepared using
2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical to
oxidize primary alcohols of the saccharide to aldehydes using
N-Chlorosuccinimide (NCS) as the cooxidant (hereinafter "TEMPO/NCS
oxidation"), such as described at Example 7 and in WO 2014/097099.
Therefore in one aspect, the glycoconjugates from S. pneumoniae
serotype 12F are obtainable by a method comprising the steps of: a)
reacting a 12F saccharide with 2,2,6,6-tetramethyl-1-piperidinyloxy
(TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to
produce an activated saccharide; and b) reacting the activated
saccharide with a carrier protein comprising one or more amine
groups (hereinafter "TEMPO/NCS-reductive amination"). In one
aspect, the glycoconjugates from S. pneumoniae serotype 12F are
obtained by said method. In an embodiment, the degree of oxidation
of the activated 12F saccharide ranges from 1 to 50, from 1 to 40,
from 1 to 30, from 1 to 20, from 1 to 10, from 1 to 5, from 3 to
40, from 3 to 30, from 3 to 20, from 3 to 10, from 4 to 40, from 4
to 30, from 4 to 20, from 4 to 10, from 5 to 30, from 5 to 25, from
5 to 20, from 5 to 10, from 6 to 50, from 6 to 40, from 6 to 30,
from 6 to 20, from 6 to 15, from 6 to 14, from 6 to 13, from 6 to
12, from 6 to 11, from 6 to 10, from 7 to 40, from 7 to 30, from 7
to 20, from 7 to 15, from 7 to 14, from 7 to 13, from 7 to 12, from
7 to 11, from 7 to 10, from 8 to 40, from 8 to 30, from 8 to 20,
from 8 to 15, from 8 to 14, from 8 to 13, from 8 to 12, from 8 to
11, from 8 to 10, from 9 to 40, from 9 to 30, from 9 to 20, from 9
to 15, from 10 to 40, from 10 to 30, from 10 to 20, or from 10 to
15. In a further aspect, the degree of oxidation of the activated
saccharide is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, or 40. Preferably, the carrier protein
is CRM.sub.197.
[0331] In an embodiment, prior to step a), the 12F saccharide is
hydrolyzed to a molecular weight ranging from 100 kDa to 400 kDa.
For example, in one aspect, the molecular weight ranges from 100
kDa to 350 kDa, from 100 kDa to 300 kDa, from 100 kDa to 250 kDa,
from 100 kDa to 200 kDa, from 100 kDa to 150 kDa, from 200 kDa to
400 kDa, from 200 kDa to 350 kDa, from 200 kDa to 300 kDa, from 200
kDa to 250 kDa, from 300 kda to 400 kDa, or from 300 kDa to 350
kDa.
[0332] In a further aspect, the method further comprises the step
of purifying the activated polysaccharide prior to step b). In a
further aspect, the methods further comprise the step of adding a
reducing agent following step b). In one aspect, the reducing agent
is NaCNBH.sub.3. In a further aspect, the methods further comprise
the step of adding NaBH.sub.4 following the addition of
NaCNBH.sub.3. In a further aspect, the method comprises a
purification step following the addition of NaBH.sub.4.
[0333] In another aspect, the present disclosure provides a
glycoconjugate from S. pneumoniae serotype 12F produced, or
obtainable by any of the methods disclosed hereabove. For example,
in one aspect the present disclosure provides a glycoconguate from
S. pneumoniae serotype 12F comprising a saccharide conjugated to a
carrier protein that is produced or obtainable by the method
comprising the steps of: a) reacting a saccharide with
2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and
N-chlorosuccinimide (NCS) in an aqueous solvent to produce an
activated saccharide; and b) reacting the activated saccharide with
a carrier protein comprising one or more amine groups.
[0334] In one embodiment, the glycoconjugate from S. pneumoniae
serotype 12F of the present invention has a molecular weight of
between about 50 kDa and about 20,000 kDa. In another embodiment,
the glycoconjugate has a molecular weight of between about 200 kDa
and about 10,000 kDa. In another embodiment, the glycoconjugate
from S. pneumoniae serotype 12F has a molecular weight of between
about 500 kDa and about 5,000 kDa. In one embodiment, the
glycoconjugate from S. pneumoniae serotype 12F has a molecular
weight of between about 1,000 kDa and about 3,000 kDa. In other
embodiments the glycoconjugate from S. pneumoniae serotype 12F has
a molecular weight of between about 600 kDa and about 2,800 kDa;
between about 700 kDa and about 2,700 kDa; between about 1,000 kDa
and about 2,000 kDa; between about 1,800 kDa and about 2,500 kDa;
between about 1,100 kDa and about 2,200 kDa; between about 1,900
kDa and about 2,700 kDa; between about 1,200 kDa and about 2,400
kDa; between about 1,700 kDa and about 2,600 kDa; between about
1,300 kDa and about 2,600 kDa; between about 1,600 kDa and about
3,000 kDa.
[0335] In further embodiments, the serotype 12F glycoconjugate of
the invention has a molecular weight of between 1,000 kDa and
20,000 kDa; between 1,000 kDa and 15,000 kDa; between 1,000 kDa and
10,000 kDa; between 1,000 kDa and 7,500 kDa; between 1,000 kDa and
5,000 kDa; between 1,000 kDa and 4,000 kDa; between 1,000 kDa and
3,000 kDa; between 2,000 kDa and 20,000 kDa; between 2,000 kDa and
15,000 kDa; between 2,000 kDa and 12,500 kDa; between 2,000 kDa and
10,000 kDa; between 2,000 kDa and 7,500 kDa; between 2,000 kDa and
6,000 kDa; between 2,000 kDa and 5,000 kDa; between 2,000 kDa and
4,000 kDa; or between 2,000 kDa and 3,000 kDa. Any whole number
integer within any of the above ranges is contemplated as an
embodiment of the disclosure. In some such embodiments, the carrier
protein is CRM.sub.197. In some such embodiments, the serotype 12F
glycoconjugate is conjugated to the carrier protein by
TEMPO/NCS-reductive amination.
[0336] Another way to characterize the serotype 12F glycoconjugates
of the invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide, which can be characterized as a range of conjugated
lysines (degree of conjugation).
[0337] In a preferred embodiment, the degree of conjugation of the
serotype 12F glycoconjugate of the invention is between 2 and 20,
between 4 and 16, between 4 and 15, between 2 and 15, between 2 and
13, between 2 and 10, between 2 and 8, between 2 and 6, between 2
and 5, between 2 and 4, between 3 and 15, between 3 and 13, between
3 and 10, between 3 and 8, between 3 and 6, between 3 and 5,
between 3 and 4, between 5 and 15, between 5 and 10, between 8 and
15, between 8 and 12, between 10 and 15 or between 10 and 12. In an
embodiment, the degree of conjugation of the serotype 12F
glycoconjugate of the invention is about 2, about 3, about 4, about
5, about 6, about 7, about 8, about 9, about 10, about 11, about
12, about 13, about 14, about 15, about 16, about 17, about 18,
about 19 or about 20.
[0338] The number of lysine residues in the carrier protein
conjugated to the saccharide may also be expressed as a molar
ratio. For example, in a glycoconjugate where 4 to 15 lysine
residues of CRM.sub.197 are covalently linked to the saccharide,
the molar ratio of conjugated lysines to CRM.sub.197 in the
glycoconjugate is between about 10:1 to about 40:1. In an
immunogenic composition where 2 to 20 lysine residues of
CRM.sub.197 are covalently linked to the saccharide, the molar
ratio of conjugated lysines to CRM.sub.197 in the glycoconjugate is
between about 5:1 and about 50:1. In one embodiment, in the
glycoconjugate from S. pneumoniae serotype 12F of the present
invention the molar ratio of conjugated lysines to carrier protein
is from about 10:1 to about 25:1. In some such embodiments, the
carrier protein is CRM.sub.197. In some embodiments, the
CRM.sub.197 may comprise about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, or 16 lysine residues out of 39 covalently linked to the
saccharide. In some such embodiments, the serotype 12F
glycoconjugate is conjugated to the carrier protein by
TEMPO/NCS-reductive amination. In one embodiment, the saccharide to
carrier protein ratio (w/w) is between 0.2 and 4.0 in the
glycoconjugate from S. pneumoniae serotype 12F (e.g., about 0.2,
about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8,
about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4,
about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0,
about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6,
about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2,
about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8,
about 3.9 or about 4.0). In another embodiment, the saccharide to
carrier protein ratio (w/w) is between 1.1 and 1.7 in the
glycoconjugate from S. pneumoniae serotype 12F. In other
embodiments, the saccharide to carrier protein ratio (w/w) is
between 0.8 and 1.8 (e.g., about 0.8, about 0.9, about 1.0, about
1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about
1.7 or about 1.8). In some such embodiments, the carrier protein is
CRM.sub.197. In some such embodiments, the carrier protein is
CRM.sub.197. In some such embodiments, the serotype 12F
glycoconjugate is conjugated to the carrier protein by
TEMPO/NCS-reductive amination.
[0339] The frequency of attachment of the saccharide chain to a
lysine on the carrier protein is another parameter for
characterizing the serotype 12F glycoconjugates of the disclosure.
For example, in one embodiment, there is at least one covalent
linkage between the carrier protein and the polysaccharide for
every 100 saccharide repeat units of the polysaccharide. In one
embodiment, there is at least one covalent linkage between the
carrier protein and the polysaccharide for every 50 saccharide
repeat units of the polysaccharide. In one embodiment, there is at
least one covalent linkage between the carrier protein and the
polysaccharide for every 25 saccharide repeat units of the
polysaccharide. In another embodiment, the covalent linkage between
the carrier protein and the polysaccharide occurs at least once in
every 4 saccharide repeat units of the polysaccharide. In another
embodiment, the covalent linkage between the carrier protein and
the polysaccharide occurs at least once in every 10 saccharide
repeat units of the polysaccharide. In a further embodiment, the
covalent linkage between the carrier protein and the polysaccharide
occurs at least once in every 15 saccharide repeat units of the
polysaccharide. In frequent embodiments, the carrier protein is
CRM.sub.197 and the covalent linkage between the CRM.sub.197 and
the polysaccharide occurs at least once in every 4, 10, 15 or 25
saccharide repeat units of the polysaccharide.
[0340] In other embodiments, the conjugate comprises at least one
covalent linkage between the carrier protein and saccharide for
every 5 to 10 saccharide repeat units; every 2 to 7 saccharide
repeat units; every 3 to 8 saccharide repeat units; every 4 to 9
saccharide repeat units; every 6 to 11 saccharide repeat units;
every 7 to 12 saccharide repeat units; every 8 to 13 saccharide
repeat units; every 9 to 14 saccharide repeat units; every 10 to 15
saccharide repeat units; every 2 to 6 saccharide repeat units,
every 3 to 7 saccharide repeat units; every 4 to 8 saccharide
repeat units; every 6 to 10 saccharide repeat units; every 7 to 11
saccharide repeat units; every 8 to 12 saccharide repeat units;
every 9 to 13 saccharide repeat units; every 10 to 14 saccharide
repeat units; every 10 to 20 saccharide repeat units; every 4 to 25
saccharide repeat units or every 2 to 25 saccharide repeat units.
In frequent embodiments, the carrier protein is CRM.sub.197.
[0341] In another embodiment, at least one linkage between
CRM.sub.197 and saccharide occurs for every 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25
saccharide repeat units of the polysaccharide. In some such
embodiments, the serotype 12F glycoconjugate is conjugated to the
carrier protein by TEMPO/NCS-reductive amination.
[0342] In one embodiment, the glycoconjugate from S. pneumoniae
serotype 12F of the invention comprises at least one covalent
linkage between the carrier protein and the polysaccharide for
every 25 saccharide repeat units of the polysaccharide. In another
embodiment, the covalent linkage between the carrier protein and
the polysaccharide occurs at least once in every 4 saccharide
repeat units of the polysaccharide. In another embodiment, the
covalent linkage between the carrier protein and the polysaccharide
occurs at least once in every 10 saccharide repeat units of the
polysaccharide. In a further embodiment, the covalent linkage
between the carrier protein and the polysaccharide occurs at least
once in every 15 saccharide repeat units of the polysaccharide. In
some such embodiments, the serotype 12F glycoconjugate is
conjugated to the carrier protein by TEMPO/NCS-reductive
amination.
[0343] The serotype 12F glycoconjugates and immunogenic
compositions of the invention may contain free saccharide that is
not covalently conjugated to the carrier protein, but is
nevertheless present in the glycoconjugate composition. The free
saccharide may be noncovalently associated with (i.e.,
noncovalently bound to, adsorbed to, or entrapped in or with) the
glycoconjugate.
[0344] In some embodiments, the serotype 12F glycoconjugates of the
invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%,
20%, 15%, 10% or 5% of free serotype 12F polysaccharide compared to
the total amount of serotype 12F polysaccharide. In one embodiment,
the glycoconjugate from S. pneumoniae serotype 12F comprises less
than about 50% of free serotype 12F polysaccharide compared to the
total amount of serotype 12F polysaccharide. In one embodiment, the
glycoconjugate from S. pneumoniae serotype 12F comprises less than
about 45% of free serotype 12F polysaccharide compared to the total
amount of serotype 12F polysaccharide. In another embodiment, the
glycoconjugate comprises less than about 30% of free serotype 12F
polysaccharide compared to the total amount of serotype 12F
polysaccharide. In another embodiment, the glycoconjugate from S.
pneumoniae serotype 12F comprises less than about 20% of free
serotype 12F polysaccharide compared to the total amount of
serotype 12F polysaccharide. In a further embodiment, the
glycoconjugate comprises less than about 10% of free serotype 12F
polysaccharide compared to the total amount of serotype 12F
polysaccharide. In another embodiment, the glycoconjugate from S.
pneumoniae serotype 12F comprises less than about 5% of free
serotype 12F polysaccharide compared to the total amount of
serotype 12F polysaccharide. In some such embodiments, the serotype
12F glycoconjugate is conjugated to the carrier protein by
TEMPO/NCS-reductive amination.
[0345] In some embodiments, the serotype 12F glycoconjugate of the
present invention comprises a saccharide having a molecular weight
of between 10 kDa and 2,000 kDa. In other such embodiments, the
saccharide has a molecular weight of between 50 kDa and 2,000 kDa.
In further such embodiments, the saccharide has a molecular weight
of between 50 kDa and 1,750 kDa; between 50 kDa and 1,500 kDa;
between 50 kDa and 1,250 kDa; between 50 kDa and 1,000 kDa; between
50 kDa and 750 kDa; between 50 kDa and 500 kDa; between 100 kDa and
2,000 kDa; between 100 kDa and 1,750 kDa; between 100 kDa and 1,500
kDa; between 100 kDa and 1,250 kDa; between 100 kDa and 1,000 kDa;
between 100 kDa and 750 kDa; between 100 kDa and 500 kDa; between
200 kDa and 2,000 kDa; between 200 kDa and 1,750 kDa; between 200
kDa and 1,500 kDa; between 200 kDa and 1,250 kDa; between 200 kDa
and 1,000 kDa; between 200 kDa and 750 kDa; or between 200 kDa and
500 kDa; or between 200 kDa and 400 kDa.
[0346] In some such embodiments, the serotype 12F glycoconjugate is
conjugated to the carrier protein by TEMPO/NCS-reductive
amination.
[0347] The serotype 12F glycoconjugates may also be characterized
by their molecular size distribution (K.sub.d). Size exclusion
chromatography media (CL-4B) can be used to determine the relative
molecular size distribution of the conjugate, as mentioned
above.
[0348] In a preferred embodiment, at least 35% of the serotype 12F
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 12F
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 60% of
the serotype 12F glycoconjugates of the invention have a K.sub.d
below or equal to 0.3 in a CL-4B column. In a preferred embodiment,
at least 70% of the serotype 12F glycoconjugates of the invention
have a K.sub.d below or equal to 0.3 in a CL-4B column.
[0349] In a preferred embodiment, between 40% and 90% of the
serotype 12F glycoconjugates have a K.sub.d below or equal to 0.3
in a CL-4B column. In a preferred embodiment, between 50% and 90%
of the serotype 12F glycoconjugates have a K.sub.d below or equal
to 0.3 in a CL-4B column. In a preferred embodiment, between 65%
and 80% of the serotype 12F glycoconjugates have a K.sub.d below or
equal to 0.3 in a CL-4B column.
[0350] 1.3.6 Glycoconjugates from S. pneumoniae Serotype 10A
[0351] In an embodiment, the serotype 10A glycoconjugates are
obtained by activating polysaccharide with 1-cyano-4-dimethylamino
pyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The
activated polysaccharide may be coupled directly or via a spacer
(linker) group to an amino group on the carrier protein. For
example, the spacer could be cystamine or cysteamine to give a
thiolated polysaccharide which could be coupled to the carrier via
a thioether linkage obtained after reaction with a
maleimide-activated carrier protein (for example using GMBS) or a
haloacetylated carrier protein (for example using iodoacetimide,
SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester
(optionally made by CDAP chemistry) is coupled with hexane diamine
or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein using carbodiimide
(e.g., EDAC or EDC) chemistry via a carboxyl group on the protein
carrier. Such conjugates are described for example in WO 93/15760,
WO 95/08348 and WO 96/129094.
[0352] Other suitable techniques use carbodiimides, hydrazides,
active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (See
Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein.
[0353] In preferred embodiments, the serotype 10A glycoconjugates
of the invention are prepared using reductive amination. Reductive
amination involves two steps: (1) oxidation of the polysaccharide
to generate aldehyde functionalities from vicinal diols in
individual hexasaccharide unit and (2) reduction of the activated
polysaccharide and a carrier protein to form a conjugate.
[0354] Before oxidation, the serotype 10A polysaccharide is
optionally hydrolized (sized). Mechanical or chemical hydrolysis
maybe employed. Chemical hydrolysis maybe conducted using acetic
acid.
[0355] In an embodiment, serotype polysaccharide is activated
(oxidized) by a process comprising the step of:
[0356] (a) reacting isolated serotype 10A polysaccharide with an
oxidizing agent; and
[0357] (b) quenching the oxidation reaction by addition of a
quenching agent resulting in an activated serotype 10A
polysaccharide.
[0358] In a preferred embodiment, the oxidizing agent is periodate.
For the purpose of the present invention, the term "periodate"
includes both periodate and periodic acid, the term also includes
both metaperiodate (IO.sub.4.sup.-) and orthoperiodate
(IO.sub.6.sup.5-) and the various salts of periodate (e.g., sodium
periodate and potassium periodate). In a preferred embodiment, the
oxidizing agent is sodium periodate. In a preferred embodiment, the
periodate used for the oxidation of serotype 10A polysaccharide is
metaperiodate. In a preferred embodiment the periodate used for the
oxidation of serotype 10A polysaccharide is sodium
metaperiodate.
[0359] In one embodiment, the quenching agent is selected from
vicinal diols, 1,2-aminoalcohols, amino acids, glutathione,
sulfite, bisulfate, dithionite, metabisulfite, thiosulfate,
phosphites, hypophosphites or phosphorous acid.
[0360] In one embodiment, the quenching agent is a
1,2-aminoalcohols of formula (I):
##STR00004##
[0361] wherein R.sup.1 is selected from H, methyl, ethyl, propyl or
isopropyl.
[0362] In one embodiment, the quenching agent is selected from
sodium and potassium salts of sulfite, bisulfate, dithionite,
metabisulfite, thiosulfate, phosphites, hypophosphites or
phosphorous acid.
[0363] In one embodiment, the quenching agent is an amino acid. In
such embodiments, said amino acid may be selected from serine,
threonine, cysteine, cystine, methionine, proline, hydroxyproline,
tryptophan, tyrosine, and histidine.
[0364] In one embodiment, the quenching agent is a sulfite such as
bisulfate, dithionite, metabisulfite, thiosulfate.
[0365] In one embodiment, the quenching agent is a compound
comprising two vicinal hydroxyl groups (vicinal diols), i.e., two
hydroxyl groups covalently linked to two adjacent carbon atoms.
[0366] Preferably, the quenching agent is a compound of formula
(II):
##STR00005##
[0367] wherein R.sup.1 and R.sup.2 are each independently selected
from H, methyl, ethyl, propyl or isopropyl.
[0368] In a preferred embodiment, the quenching agent is glycerol,
ethylene glycol, propan-1,2-diol, butan-1,2-diol or butan-2,3-diol,
ascorbic acid. In a preferred embodiment, the quenching agent is
butan-2,3-diol.
[0369] In preferred embodiment, the isolated serotype 10A
polysaccharide is activated by a process comprising the step
of:
[0370] (a) reacting isolated serotype 10A polysaccharide with
periodate; and
[0371] (b) quenching the oxidation reaction by addition of
butan-2,3-diol resulting in an activated serotype 10A
polysaccharide.
[0372] Following the oxidation step of the polysaccharide, the
polysaccharide is said to be activated and is referred to an
"activated polysaccharide" hereinafter.
[0373] In a preferred embodiment, the activated serotype 10A
polysaccharide is purified. The activated serotype 10A
polysaccharide is purified according to methods known to the man
skilled in the art, such as gel permeation chromatography (GPC),
dialysis or ultrafiltration/diafiltration. For example, the
activated 10A polysaccharide is purified by concentration and
diafiltration using an ultrafiltration device.
[0374] In a preferred embodiment the degree of oxidation of the
activated serotype 10A polysaccharide is between 2 and 30, between
2 and 25, between 2 and 20, between 2 and 15, between 2 and 10,
between 2 and 5, between 5 and 30, between 5 and 25, between 5 and
20, between 5 and 15, between 5 and 10, between 10 and 30, between
10 and 25, between 10 and 20, between 10 and 15, between 15 and 30,
between 15 and 25, between 15 and 20, between 20 to 30, or between
20 to 25. In a preferred embodiment the degree of oxidation of the
activated serotype 10A polysaccharide is between 2 and 10, between
4 and 8, between 4 and 6, between 6 and 8, between 6 and 12,
between 8 and 14, between 9 and 11, between 10 and 16, between 12
and 16, between 14 and 18, between 16 and 20, between 16 and 18,
between 18 and 22, or between 18 and 20.
[0375] In a preferred embodiment, the activated serotype 10A
polysaccharide has a molecular weight between 50 kDa and 400 kDa,
between 50 kDa and 350 kDa, between 50 kDa and 300 kDa, between 50
kDa and 250 kDa, between 50 kDa and 200 kDa, between 100 kDa and
300 kDa, between 100 kDa and 250 kDa or between 100 kDa and 200
kDa. In a preferred embodiment, the activated serotype 10A
polysaccharide has a molecular weight between 50 kDa and 300 kDa.
In a preferred embodiment, the activated serotype 10A
polysaccharide has a molecular weight between 100 kDa and 200 kDa.
In a preferred embodiment, the activated serotype 10A
polysaccharide has a molecular weight between 100 kDa and 200 kDa
and a degree of oxidation between 5 and 20, between 5 and 15,
between 8 and 14, between 8 and 12 or between 9 and 11. In a
preferred embodiment, the activated serotype 10A polysaccharide has
a molecular weight between 100 kDa and 200 kDa and a degree of
oxidation between 9 and 11.
[0376] The activated polysaccharide and/or the carrier protein may
be lyophilised (freeze-dried), either independently (discrete
lyophilization) or together (co-lyophilized).
[0377] In an embodiment, the activated serotype 10A polysaccharide
is lyophilized, optionally in the presence of saccharide. In a
preferred embodiment, the saccharide is selected from sucrose,
trehalose, raffinose, stachyose, melezitose, dextran, mannitol,
lactitol and palatinit. In a preferred embodiment, the saccharide
is sucrose. In one embodiment, the lyophilized activated
polysaccharide is then compounded with a solution comprising the
carrier protein.
[0378] In another embodiment the activated polysaccharide and the
carrier protein are co-lyophilised. In such embodiments, the
activated serotype 10A polysaccharide is compounded with the
carrier protein and lyophilized optionally in the presence of a
saccharide. In a preferred embodiment, the saccharide is selected
from sucrose, trehalose, raffinose, stachyose, melezitose, dextran,
mannitol, lactitol and palatinit. In a preferred embodiment, the
saccharide is sucrose. The co-lyophilized polysaccharide and
carrier protein can then be resuspended in solution and reacted
with a reducing agent.
[0379] The second step of the conjugation process is the reduction
of the activated polysaccharide and a carrier protein to form a
conjugate (reductive amination), using a reducing agent.
[0380] The activated serotype 10A polysaccharide can be conjugated
to a carrier protein by a process comprising the step of:
[0381] (c) compounding the activated serotype 10A polysaccharide
with a carrier protein; and
[0382] (d) reacting the compounded activated serotype 10A
polysaccharide and carrier protein with a reducing agent to form a
serotype 10A polysaccharide-carrier protein conjugate.
[0383] In an embodiment, the reduction reaction is carried out in
aqueous solvent, in another embodiment the reaction is carried out
in aprotic solvent. In an embodiment, the reduction reaction is
carried out in DMSO (dimethylsulfoxide) or in DMF
(dimethylformamide) solvent. The DMSO or DMF solvent may be used to
reconstitute the activated polysaccharide and carrier protein which
has been lyophilised.
[0384] In an embodiment, the reducing agent is sodium
cyanoborohydride, sodium triacetoxyborohydride, sodium or zinc
borohydride in the presence of Bronsted or Lewis acids, amine
boranes such as pyridine borane, 2-Picoline Borane,
2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3,
benzylamine-BH3 or 5-ethyl-2-methylpyridine borane (PEMB). In a
preferred embodiment, the reducing agent is sodium
cyanoborohydride.
[0385] At the end of the reduction reaction, there may be unreacted
aldehyde groups remaining in the conjugates, these may be capped
using a suitable capping agent. In one embodiment this capping
agent is sodium borohydride (NaBH.sub.4).
[0386] Following conjugation of serotype 10A polysaccharide to the
carrier protein, the glycoconjugate can be purified (enriched with
respect to the amount of polysaccharide-protein conjugate) by a
variety of techniques known to the skilled person. These techniques
include dialysis, concentration/diafiltration operations,
tangential flow filtration precipitation/elution, column
chromatography (DEAE or hydrophobic interaction chromatography),
and depth filtration.
[0387] In some embodiments, the serotype 10A glycoconjugates of the
present invention comprise a saccharide having a molecular weight
of between 10 kDa and 2,000 kDa. In other such embodiments, the
saccharide has a molecular weight of between 50 kDa and 2,000 kDa.
In further such embodiments, the saccharide has a molecular weight
of between 50 kDa and 1,750 kDa; between 50 kDa and 1,500 kDa;
between 50 kDa and 1,250 kDa; between 50 kDa and 1,000 kDa; between
50 kDa and 750 kDa; between 50 kDa and 500 kDa; between 100 kDa and
2,000 kDa; between 100 kDa and 1,750 kDa; between 100 kDa and 1,500
kDa; between 100 kDa and 1,250 kDa; between 100 kDa and 1,000 kDa;
between 100 kDa and 750 kDa; between 100 kDa and 500 kDa; between
200 kDa and 2,000 kDa; between 200 kDa and 1,750 kDa; between 200
kDa and 1,500 kDa; between 200 kDa and 1,250 kDa; between 200 kDa
and 1,000 kDa; between 200 kDa and 750 kDa; or between 200 kDa and
500 kDa; or between 200 kDa and 400 kDa. In some such embodiments,
the serotype 10A glycoconjugates are prepared using reductive
amination.
[0388] In some embodiments, the serotype 10A glycoconjugate of the
invention has a molecular weight of between 50 kDa and 20,000 kDa.
In other embodiments, the serotype 10A glycoconjugate has a
molecular weight of between 50 kDa and 15,000 kDa. In other
embodiments, the serotype 10A glycoconjugate has a molecular weight
of between 500 kDa and 15,000 kDa, between 500 kDa and 10,000 kDa;
between 2,000 kDa and 10,000 kDa; or between 3,000 kDa and 8,000
kDa. In other embodiments, the serotype 10A glycoconjugate has a
molecular weight of between 1,000 kDa and 10,000 kDa. In other
embodiments, the serotype 10A glycoconjugate has a molecular weight
of between 1,000 kDa and 8,000 kDa. In still other embodiments, the
the serotype 10A glycoconjugate has a molecular weight of between
2,000 kDa and 8,000 kDa or between 3,000 kDa and 7,000 kDa. In
further embodiments, the serotype 10A glycoconjugate of the
invention has a molecular weight of between 200 kDa and 20,000 kDa;
between 200 kDa and 15,000 kDa; between 200 kDa and 10,000 kDa;
between 200 kDa and 7,500 kDa; between 200 kDa and 5,000 kDa;
between 200 kDa and 3,000 kDa; between 200 kDa and 1,000 kDa;
between 500 kDa and 20,000 kDa; between 500 kDa and 15,000 kDa;
between 500 kDa and 12,500 kDa; between 500 kDa and 10,000 kDa;
between 500 kDa and 7,500 kDa; between 500 kDa and 6,000 kDa;
between 500 kDa and 5,000 kDa; between 500 kDa and 4,000 kDa;
between 500 kDa and 3,000 kDa; between 500 kDa and 2,000 kDa;
between 500 kDa and 1,500 kDa; between 500 kDa and 1,000 kDa;
between 750 kDa and 20,000 kDa; between 750 kDa and 15,000 kDa;
between 750 kDa and 12,500 kDa; between 750 kDa and 10,000 kDa;
between 750 kDa and 7,500 kDa; between 750 kDa and 6,000 kDa;
between 750 kDa and 5,000 kDa; between 750 kDa and 4,000 kDa;
between 750 kDa and 3,000 kDa; between 750 kDa and 2,000 kDa;
between 750 kDa and 1,500 kDa; between 1,000 kDa and 15,000 kDa;
between 1,000 kDa and 12,500 kDa; between 1,000 kDa and 10,000 kDa;
between 1,000 kDa and 7,500 kDa; between 1,000 kDa and 6,000 kDa;
between 1,000 kDa and 5,000 kDa; between 1,000 kDa and 4,000 kDa;
between 1,000 kDa and 2,500 kDa; between 2,000 kDa and 15,000 kDa;
between 2,000 kDa and 12,500 kDa; between 2,000 kDa and 10,000 kDa;
between 2,000 kDa and 7,500 kDa; between 2,000 kDa and 6,000 kDa;
between 2,000 kDa and 5,000 kDa; between 2,000 kDa and 4,000 kDa;
or between 2,000 kDa and 3,000 kDa.
[0389] In further embodiments, the serotype 10A glycoconjugate of
the invention has a molecular weight of between 3,000 kDa and
20,000 kDa; between 3,000 kDa and 15,000 kDa; between 3,000 kDa and
10,000 kDa; between 3,000 kDa and 7,500 kDa; between 3,000 kDa and
5,000 kDa; between 4,000 kDa and 20,000 kDa; between 4,000 kDa and
15,000 kDa; between 4,000 kDa and 12,500 kDa; between 4,000 kDa and
10,000 kDa; between 4,000 kDa and 7,500 kDa; between 4,000 kDa and
6,000 kDa; or between 4,000 kDa and 5,000 kDa. In further
embodiments, the serotype 10A glycoconjugate of the invention has a
molecular weight of between 5,000 kDa and 20,000 kDa; between 5,000
kDa and 15,000 kDa; between 5,000 kDa and 10,000 kDa or between
5,000 kDa and 7,500 kDa. In further embodiments, the serotype 10A
glycoconjugate of the invention has a molecular weight of between
6,000 kDa and 20,000 kDa; between 6,000 kDa and 15,000 kDa; between
6,000 kDa and 10,000 kDa or between 6,000 kDa and 7,500 kDa. In
further embodiments, the serotype 10A glycoconjugate of the
invention has a molecular weight of between 7,000 kDa and 20,000
kDa; between 7,000 kDa and 15,000 kDa; between 7,000 kDa and 10,000
kDa or between 7,000 kDa and 8,000 kDa. In further embodiments, the
serotype 10A glycoconjugate of the invention has a molecular weight
of between 8,000 kDa and 20,000 kDa; between 8,000 kDa and 15,000
kDa; or between 8,000 kDa and 10,000 kDa.
[0390] Any whole number integer within any of the above ranges is
contemplated as an embodiment of the disclosure. The molecular
weight of the glycoconjugate is measured by SEC-MALLS.
[0391] Another way to characterize the serotype 10A glycoconjugates
of the invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide which can be characterized as a range of conjugated
lysines (degree of conjugation). The evidence for lysine
modification of the carrier protein, due to covalent linkages to
the polysaccharides, can be obtained by amino acid analysis using
routine methods known to those of skill in the art. Conjugation
results in a reduction in the number of lysine residues recovered
compared to the CRM.sub.197 protein starting material used to
generate the conjugate materials.
[0392] In a preferred embodiment, the degree of conjugation of the
serotype 10A glycoconjugate is between 2 and 15, between 2 and 13,
between 2 and 10, between 2 and 8, between 2 and 6, between 2 and
5, between 2 and 4, between 3 and 15, between 3 and 13, between 3
and 10, between 3 and 8, between 3 and 6, between 3 and 5, between
3 and 4, between 5 and 15, between 5 an 10, between 8 and 15,
between 8 and 12, between 10 and 15 or between 10 and 12. In a
preferred embodiment, the degree of conjugation of the serotype 10A
glycoconjugate is between 6 and 8. In a preferred embodiment, the
carrier protein is CRM 197
[0393] The serotype 10A glycoconjugates of the invention may also
be characterized by the ratio (weight/weight) of saccharide to
carrier protein. In some embodiments, the saccharide to carrier
protein ratio (w/w) is between 0.5 and 3.0 (e.g., about 0.5, about
0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about
1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about
1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about
2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9 or about
3.0). In a preferred embodiment, the ratio of serotype 10A
saccharide to carrier protein in the conjugate is between 0.5 and
2.0, 0.5 and 1.5, 0.5 and 1.0, 1.0 and 1.5 or 1.0 and 2.0. In a
preferred embodiment, the ratio of serotype 10A polysaccharide to
carrier protein in the conjugate is between 0.8 and 1.4. In a
preferred embodiment, the ratio of serotype 10A capsular
polysaccharide to carrier protein in the conjugate is between 0.8
and 1.2 (e.g., about 0.8, about 0.9 about 1.0, about 1.1, or about
1.2). In some such embodiments, the carrier protein is
CRM.sub.197.
[0394] The serotype 10A glycoconjugates and immunogenic
compositions of the invention may contain free saccharide that is
not covalently conjugated to the carrier protein, but is
nevertheless present in the glycoconjugate composition. The free
saccharide may be noncovalently associated with (i.e.,
noncovalently bound to, adsorbed to, or entrapped in or with) the
glycoconjugate.
[0395] In some embodiments, the serotype 10A glycoconjugates of the
invention comprise less than about 50% free saccharide, less than
about 45% free saccharide, less than about 40% free saccharide,
less than about 35% free saccharide, less than about 30% free
saccharide, less than about 25% free saccharide, less than about
20% free saccharide, less than about 15% free saccharide, less than
about 10% free saccharide, or less than about 5% free saccharide
relative to the total amount of 10A saccharide. Preferably, the
serotype 10A glycoconjugate comprises less than 15% free
saccharide, more preferably less than 10% free saccharide, and
still more preferably, less than 5% of free saccharide. The
serotype 10A glycoconjugates may also be characterized by their
molecular size distribution (K.sub.d). Size exclusion
chromatography media (CL-4B) can be used to determine the relative
molecular size distribution of the conjugate, as mentioned
above.
[0396] In a preferred embodiment, at least 30% of the serotype 10A
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 40% of
the serotype 10A glycoconjugates of the invention have a K.sub.d
below or equal to 0.3 in a CL-4B column. In a preferred embodiment,
at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the
serotype 10A glycoconjugates of the invention have a K.sub.d below
or equal to 0.3 in a CL-4B column. In a preferred embodiment, at
least 60% of the serotype 10A glycoconjugates have a K.sub.d below
or equal to 0.3 in a CL-4B column. In a preferred embodiment,
between 50% and 80% of the serotype 10A glycoconjugates of the
invention have a K.sub.d below or equal to 0.3 in a CL-4B
column.
[0397] 1.3.7 Glycoconjugates from S. pneumoniae Serotype 11A
[0398] In an embodiment, the serotype 11A glycoconjugates are
obtained by activating polysaccharide with 1-cyano-4-dimethylamino
pyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The
activated polysaccharide may be coupled directly or via a spacer
(linker) group to an amino group on the carrier protein. For
example, the spacer could be cystamine or cysteamine to give a
thiolated polysaccharide which could be coupled to the carrier via
a thioether linkage obtained after reaction with a
maleimide-activated carrier protein (for example using GMBS) or a
haloacetylated carrier protein (for example using iodoacetimide,
SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester
(optionally made by CDAP chemistry) is coupled with hexane diamine
or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein using carbodiimide
(e.g., EDAC or EDC) chemistry via a carboxyl group on the protein
carrier. Such conjugates are described for example in WO 93/15760,
WO 95/08348 and WO 96/129094.
[0399] Other suitable techniques use carbodiimides, hydrazides,
active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (see
Bethell et al. (1979). Biol. Chem. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein.
[0400] In preferred embodiments, the serotype 11A glycoconjugates
of the invention are prepared using reductive amination. Reductive
amination involves two steps: (1) oxidation of the polysaccharide
to generate aldehyde functionalities from vicinal diols in
individual hexasaccharide unit and (2) reduction of the activated
polysaccharide and a carrier protein to form a conjugate.
[0401] Before oxidation, the serotype 11A polysaccharide is
optionally hydrolized to reduce its viscosity. Mechanical or
chemical hydrolysis maybe employed. Chemical hydrolysis maybe
conducted using acetic acid. Mechanical sizing maybe conducted
using High Pressure Homogenization Shearing.
[0402] The oxidation step may involve reaction with periodate. For
the purpose of the present invention, the term "periodate" includes
both periodate and periodic acid; the term also includes both
metaperiodate (IO.sub.4.sup.-) and orthoperiodate (IO.sub.6.sup.5-)
and the various salts of periodate (e.g., sodium periodate and
potassium periodate). In an embodiment the capsular
polysaccharidefrom serotype 11A of S. pneumoniae is oxydized in the
presence of metaperiodate, preferably in the presence of sodium
periodate (NalO4). In another embodiment the capsular
polysaccharide from serotype 11A is oxydized in the presence of
orthoperiodate, preferably in the presence of periodic acid.
[0403] Following the oxidation step of the polysaccharide, the
polysaccharide is said to be activated and is referred to as
"activated polysaccharide" here below. The activated polysaccharide
maybe purified and lyophilised (freeze-dried).
[0404] The activated polysaccharide and the carrier protein may be
lyophilized (freeze-dried), either independently (discrete
lyophilization) or together (co-lyophilized). In one embodiment the
activated polysaccharide and the carrier protein are
co-lyophilized. In another embodiment the activated polysaccharide
and the carrier protein are lyophilized independently.
[0405] In one embodiment the lyophilization takes place in the
presence of a non-reducing sugar, possible non-reducing sugars
include sucrose, trehalose, raffinose, stachyose, melezitose,
dextran, mannitol, lactitol and palatinit.
[0406] The second step of the conjugation process is the reduction
of the activated polysaccharide and a carrier protein to form a
conjugate (reductive amination), using a reducing agent. Reducing
agents which are suitable include the cyanoborohydrides, such as
sodium cyanoborohydride, borane-pyridine, or borohydride exchange
resin. In one embodiment the reducing agent is sodium
cyanoborohydride.
[0407] In an embodiment, the reduction reaction is carried out in
aqueous solvent, in another embodiment the reaction is carried out
in aprotic solvent. In an embodiment, the reduction reaction is
carried out in DMSO (dimethylsulfoxide) or in DMF
(dimethylformamide) solvent. The DMSO or DMF solvent may be used to
reconstitute the activated polysaccharide and carrier protein which
has been lyophilised.
[0408] In one embodiment between 0.1 and 3.0, between 0.15 and 2.0,
between 0.2 and 2.0, or between 0.5 and 1.5 molar equivalents of
sodium cyanoborohydride is used in the reduction reaction. In one
embodiment about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1,
1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4,
2.5, 2.6, 2.7, 2.8, 2.9 or 3.0 molar equivalents of sodium
cyanoborohydride is used in the reduction reaction.
[0409] In one embodiment the reducing agent is sodium
triacetoxyborohydride. In a further embodiment between 1.0 and 6.0
molar equivalents, between 2.0 and 5.0 molar equivalents or about
3.0 molar equivalents of sodium triacetoxyborohydride is used in
the reduction reaction.
[0410] At the end of the reduction reaction, there may be unreacted
aldehyde groups remaining in the conjugates. These may be capped
using a suitable capping agent. In one embodiment this capping
agent is sodium borohydride (NaBH.sub.4). In an embodiment capping
is achieved by mixing the reduction reaction with between 0.5 and
5.0 molar equivalents of NaBH4, for example about 1.0, 1.5, 2.0,
2.5 or 3.0 molar equivalents of NaBH.sub.4.
[0411] Following the conjugation (the reduction reaction and
optionally the capping), the glycoconjugates may be purified. The
glycoconjugates may be purified by diafiltration and/or ion
exchange chromatography and/or size exclusion chromatography. In an
embodiment, the glycoconjugates are purified by diafiltration or
ion exchange chromatography or size exclusion chromatography.
[0412] In one embodiment the glycoconjugates are sterile
filtered.
[0413] In some embodiments, the serotype 11A glycoconjugates of the
present invention are conjugated to the carrier protein (e.g.,
CRM.sub.197) and comprise a saccharide having a molecular weight of
between 10 kDa and 2,000 kDa. In other such embodiments, the
saccharide has a molecular weight of between 50 kDa and 2,000 kDa.
In further such embodiments, the saccharide has a molecular weight
of between 50 kDa and 1,750 kDa; between 50 kDa and 1,500 kDa;
between 50 kDa and 1,250 kDa; between 50 kDa and 1,000 kDa; between
50 kDa and 750 kDa; between 50 kDa and 500 kDa; between 50 kDa and
400 kDa; between 50 kDa and 300 kDa; between 50 kDa and 200 kDa;
between 50 kDa and 100 kDa; between 100 kDa and 2,000 kDa; between
100 kDa and 1,750 kDa; between 100 kDa and 1,500 kDa; between 100
kDa and 1,250 kDa; between 100 kDa and 1,000 kDa; between 100 kDa
and 750 kDa; between 100 kDa and 500 kDa; between 100 kDa and 400
kDa between; 100 kDa and 300 kDa; between 100 kDa and 200 kDa;
between 200 kDa and 2,000 kDa; between 200 kDa and 1,750 kDa;
between 200 kDa and 1,500 kDa; between 200 kDa and 1,250 kDa;
between 200 kDa and 1,000 kDa; between 200 kDa and 750 kDa; or
between 200 kDa and 500 kDa; between 200 kDa and 400 kDa or between
200 kDa and 300 kDa.
[0414] In some embodiments, the serotype 11A glycoconjugate of the
invention has a molecular weight of between 50 kDa and 20,000 kDa.
In other embodiments, the serotype 11A glycoconjugate has a
molecular weight of between 50 kDa and 15,000 kDa. In other
embodiments, the serotype 11A glycoconjugate has a molecular weight
of between 500 kDa and 10,000 kDa. In other embodiments, the
serotype 11A glycoconjugate has a molecular weight of between 200
kDa and 10,000 kDa. In still other embodiments, the serotype 11A
glycoconjugate has a molecular weight of between 1,000 kDa and
8,000 kDa or between 2,000 kDa and 8,000 kDa.
[0415] In further embodiments, the serotype 11A glycoconjugate of
the invention has a molecular weight of between 200 kDa and 20,000
kDa; between 200 kDa and 17,500 kDa; between 200 kDa and 15,000
kDa; between 200 kDa and 10,000 kDa; between 200 kDa and 7,500 kDa;
between 200 kDa and 5,000 kDa; between 200 kDa and 3,000 kDa;
between 200 kDa and 2,000 kDa; between 200 kDa and 1,000 kDa;
between 500 kDa and 20,000 kDa; between 500 kDa and 17,500 kDa;
between 500 kDa and 15,000 kDa; between 500 kDa and 12,500 kDa;
between 500 kDa and 10,000 kDa; between 500 kDa and 7,500 kDa;
between 500 kDa and 6,000 kDa; between 500 kDa and 5,000 kDa;
between 500 kDa and 4,000 kDa; between 500 kDa and 3,000 kDa;
between 500 kDa and 2,000 kDa; between 500 kDa and 1,500 kDa;
between 500 kDa and 1,000 kDa; between 700 kDa and 20,000 kDa;
between 700 kDa and 17,500 kDa; between 700 kDa and 15,000 kDa;
between 700 kDa and 12,500 kDa; between 700 kDa and 10,000 kDa;
between 700 kDa and 7,500 kDa; between 700 kDa and 6,000 kDa;
between 700 kDa and 5,000 kDa; between 700 kDa and 4,500 kDa;
between 700 kDa and 4,000 kDa; between 700 kDa and 3,500 kDa;
between 700 kDa and 3,000 kDa; between 700 kDa and 2,000 kDa;
between 700 kDa and 1,500 kDa; between 1,000 kDa and 20,000 kDa;
between 1,000 kDa and 17,500 kDa; between 1,000 kDa and 15,000 kDa;
between 1,000 kDa and 12,500 kDa; between 1,000 kDa and 10,000 kDa;
between 1,000 kDa and 7,500 kDa; between 1,000 kDa and 6,000 kDa;
between 1,000 kDa and 5,000 kDa; between 1,000 kDa and 4,000 kDa;
between 1,000 kDa and 2,500 kDa; between 2,000 kDa and 20,000 kDa;
between 2,000 kDa and 17,500 kDa; between 2,000 kDa and 15,000 kDa;
between 2,000 kDa and 12,500 kDa; between 2,000 kDa and 10,000 kDa;
between 2,000 kDa and 7,500 kDa; between 2,000 kDa and 6,000 kDa;
between 2,000 kDa and 5,000 kDa; between 2,000 kDa and 4,000 kDa;
or between 2,000 kDa and 3,000 kDa.
[0416] In further embodiments, the serotype 11A glycoconjugate of
the invention has a molecular weight of between 3,000 kDa and
20,000 kDa; between 3,000 kDa and 17,500 kDa; between 3,000 kDa and
15,000 kDa; between 3,000 kDa and 10,000 kDa; between 3,000 kDa and
7,500 kDa; between 3,000 kDa and 5,000 kDa; between 4,000 kDa and
20,000 kDa; between 4,000 kDa and 17,500 kDa; between 4,000 kDa and
15,000 kDa; between 4,000 kDa and 12,500 kDa; between 4,000 kDa and
10,000 kDa; between 4,000 kDa and 7,500 kDa; between 4,000 kDa and
6,000 kDa; or between 4,000 kDa and 5,000 kDa. In further
embodiments, the serotype 11A glycoconjugate of the invention has a
molecular weight of between 5,000 kDa and 20,000 kDa; between 5,000
kDa and 17,500 kDa; between 5,000 kDa and 15,000 kDa; between 5,000
kDa and 10,000 kDa or between 5,000 kDa and 7,500 kDa.
[0417] In an embodiment, said serotype 11A glycoconjugates are
prepared using reductive amination.
[0418] In a preferred embodiment, the serotype 11A glycoconjugate
of the invention comprises at least 0.3, 0.5, 0.6, 1.0, 1.4, 1.8,
2.2, 2.6, 3.0, 3.4, 3.8, 4.2, 4.6 or 5.0 mM acetate per mM serotype
11A polysaccharide. In a preferred embodiment, the serotype 11A
glycoconjugate comprises at least 1.8, 2.2 or 2.6 mM acetate per mM
serotype 11A polysaccharide. In an embodiment, the glycoconjugate
comprises at least 0.6 mM acetate per mM serotype 11A
polysaccharide. In a preferred embodiment, the serotype 11A
glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4,
1.8, 2.2, 2.6, 3.0, 3.4, 3.8, 4.2 or 4.6 mM acetate per mM serotype
11A polysaccharide and less than about 5.0 mM acetate per mM
serotype 11A polysaccharide. In an embodiment, the serotype 11A
glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4,
1.8, 2.2, 2.6, or 3.0 mM acetate per mM serotype 11A polysaccharide
and less than about 3.4 mM acetate per mM serotype 11A
polysaccharide. In an embodiment, the serotype 11A glycoconjugate
of the invention comprises at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6,
or about 3.0 mM acetate per mM serotype 11A polysaccharide and less
than about 3.3 mM acetate per mM serotype 11A polysaccharide. Any
of the above number is contemplated as an embodiment of the
disclosure.
[0419] In a preferred embodiment, the ratio of mM acetate per mM
serotype 11A capsular polysaccharide in the serotype 11A
glycoconjugate to mM acetate per mM serotype 11A capsular
polysaccharide in the isolated polysaccharide is at least 0.6,
0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred
embodiment, the ratio of mM acetate per mM serotype 11A capsular
polysaccharide in the serotype 11A glycoconjugate to mM acetate per
mM serotype 11A capsular polysaccharide in the isolated
polysaccharide is at least 0.7. In a preferred embodiment, the
ratio of mM acetate per mM serotype 11A capsular polysaccharide in
the serotype 11A glycoconjugate to mM acetate per mM serotype 11A
capsular polysaccharide in the isolated polysaccharide is at least
0.9. In a preferred embodiment, the presence of O-acetyl groups is
determined by ion-HPLC analysis.
[0420] In a preferred embodiment, the ratio of mM acetate per mM
serotype 11A capsular polysaccharide in the serotype 11A
glycoconjugate to mM acetate per mM serotype 11A capsular
polysaccharide in the activated polysaccharide is at least 0.6,
0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred
embodiment, the ratio of mM acetate per mM serotype 11A capsular
polysaccharide in the serotype 11A glycoconjugate to mM acetate per
mM serotype 11A capsular polysaccharide in the activated
polysaccharide is at least 0.7. In a preferred embodiment, the
ratio of mM acetate per mM serotype 11A capsular polysaccharide in
the serotype 11A glycoconjugate to mM acetate per mM serotype 11A
capsular polysaccharide in the activated polysaccharide is at least
0.9. In a preferred embodiment, the presence of O-acetyl groups is
determined by ion-HPLC analysis.
[0421] In a preferred embodiment, the serotype 11A glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7, 0.8, 0.9 or 1.0 mM glycerol per mM serotype 11A
polysaccharide. In a preferred embodiment, the serotype 11A
glycoconjugate comprises at least 0.2, 0.3 or 0.4 mM glycerol per
mM serotype 11A polysaccharide. In a preferred embodiment, the
serotype 11A glycoconjugate of the invention comprises at least
0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or 0.9 mM glycerol per mM
serotype 11A polysaccharide and less than about 1.0 mM glycerol per
mM serotype 11A polysaccharide. In a preferred embodiment, the
serotype 11A glycoconjugate of the invention comprises at least
0.3, 0.4, 0.5, 0.6, or 0.7 mM glycerol per mM serotype 11A
polysaccharide and less than about 0.8 mM glycerol per mM serotype
11A polysaccharide. Any of the above number is contemplated as an
embodiment of the disclosure.
[0422] Another way to characterize the serotype 11A glycoconjugates
of the invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide which can be characterized as a range of conjugated
lysines (degree of conjugation).
[0423] The evidence for lysine modification of the carrier protein,
due to covalent linkages to the polysaccharides, can be obtained by
amino acid analysis using routine methods known to those of skill
in the art. Conjugation results in a reduction in the number of
lysine residues recovered compared to the CRM.sub.197 protein
starting material used to generate the conjugate materials.
[0424] In a preferred embodiment, the degree of conjugation of the
serotype 11A glycoconjugate of the invention is between 1 and 15,
between 1 and 13, between 1 and 10, between 1 and 8, between 1 and
6, between 1 and 5, between 1 and 4, between 2 and 15, between 2
and 13, between 2 and 10, between 2 and 8, between 2 and 6, between
2 and 5, between 2 and 4, between 5 and 15, between 5 and 10,
between 8 and 15, between 8 and 12, between 10 and 15 or between 10
and 12. In an embodiment, the degree of conjugation of the serotype
11A glycoconjugate of the invention is about 1, about 2, about 3,
about 4, about 5, about 6, about 7, about 8, about 9, about 10,
about 11, about 12, about 13, about 14 or about 15. In a preferred
embodiment, the degree of conjugation of the serotype 11A
glycoconjugate of the invention is between 1 and 6 or between 2 and
5.
[0425] In some such embodiments, the carrier protein is
CRM.sub.197.
[0426] The serotype 11A glycoconjugates of the invention may also
be characterized by the ratio (weight/weight) of saccharide to
carrier protein. In some embodiments, the saccharide to carrier
protein ratio (w/w) is between 0.2 and 4.0 (e.g., about 0.2, about
0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about
0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about
1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about
2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about
2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about
3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about
3.9 or about 4.0). In other embodiments, the saccharide to carrier
protein ratio (w/w) is between 0.7 and 2.5, between 0.8 and 2.0,
between 0.7 and 2.0, between 0.8 and 1.5, between 0.7 and 1.5, 0.7
and 1.4, between 0.8 and 1.4, between 0.7 and 1.45 or between 0.8
and 1.45. In further embodiments, the saccharide to carrier protein
ratio (w/w) is between 0.8 and 1.6 (e.g., about 0.8, about 0.9
about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5 or
about 1.6). In some such embodiments, the carrier protein is
CRM.sub.197. In an embodiment, said serotype 11A glycoconjugates
are prepared using reductive amination.
[0427] The serotype 11A glycoconjugates and immunogenic
compositions of the invention may contain free saccharide that is
not covalently conjugated to the carrier protein, but is
nevertheless present in the glycoconjugate composition. The free
saccharide may be noncovalently associated with (i.e.,
noncovalently bound to, adsorbed to, or entrapped in or with) the
glycoconjugate.
[0428] In some embodiments, the serotype 11A glycoconjugates of the
invention comprise less than about 50% of free serotype 11A
capsular polysaccharide compared to the total amount of serotype
11A capsular polysaccharide, less than about 45% free saccharide,
less than about 40% free saccharide, less than about 35% free
saccharide, less than about 30% free saccharide, less than about
25% free saccharide, less than about 20% free saccharide, less than
about 15% free saccharide, less than about 10% free saccharide, or
less than about 5% of free serotype 11A capsular polysaccharide
compared to the total amount of serotype 11A capsular
polysaccharide. Preferably, the serotype 11A glycoconjugate
comprises less than 15% free saccharide, more preferably less than
10% free saccharide, and still more preferably, less than 5% of
free saccharide. The serotype 11A glycoconjugates may also be
characterized by their molecular size distribution (K.sub.d). Size
exclusion chromatography media (CL-4B) can be used to determine the
relative molecular size distribution of the conjugate, as mentioned
above.
[0429] In a preferred embodiment, at least 30% of the serotype 11A
glycoconjugates of the invention has a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 11A
glycoconjugates of the invention has a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 60% of
the serotype 11A glycoconjugates of the invention has a K.sub.d
below or equal to 0.3 in a CL-4B column. In a preferred embodiment,
at least 65% of the serotype 11A glycoconjugates of the invention
has a K.sub.d below or equal to 0.3 in a CL-4B column.
[0430] 1.3.8 Glycoconjugates from S. pneumoniae Serotype 8
[0431] In an embodiment, the serotype 8 glycoconjugates are
obtained by activating polysaccharide with 1-cyano-4-dimethylamino
pyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The
activated polysaccharide may be coupled directly or via a spacer
(linker) group to an amino group on the carrier protein. For
example, the spacer could be cystamine or cysteamine to give a
thiolated polysaccharide which could be coupled to the carrier via
a thioether linkage obtained after reaction with a
maleimide-activated carrier protein (for example using GMBS) or a
haloacetylated carrier protein (for example using iodoacetimide,
SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester
(optionally made by CDAP chemistry) is coupled with hexane diamine
or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein using carbodiimide
(e.g., EDAC or EDC) chemistry via a carboxyl group on the protein
carrier. Such conjugates are described for example in WO 93/15760,
WO 95/08348 and WO 96/129094.
[0432] Other suitable techniques use carbodiimides, hydrazides,
active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (see
Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein.
[0433] In preferred embodiments, the serotype 8 glycoconjugates of
the invention are prepared using reductive amination. Reductive
amination involves two steps: (1) oxidation of the polysaccharide
to generate aldehyde functionalities from vicinal diols in
individual hexasaccharide unit and (2) reduction of the activated
polysaccharide and a carrier protein to form a conjugate.
[0434] Before oxidation, the serotype 8 polysaccharide is
optionally hydrolized to reduce its viscosity. Mechanical or
chemical hydrolysis maybe employed. Chemical hydrolysis maybe
conducted using acetic acid.
[0435] The oxidation step may involve reaction with periodate. For
the purpose of the present invention, the term "periodate" includes
both periodate and periodic acid; the term also includes both
metaperiodate (IO.sub.4.sup.-) and orthoperiodate (IO.sub.6.sup.5-)
and the various salts of periodate (e.g., sodium periodate and
potassium periodate). In an embodiment the capsular polysaccharide
from serotype 8 of S. pneumoniae is oxydized in the presence of
metaperiodate, preferably in the presence of sodium periodate
(NalO.sub.4). In another embodiment the capsular polysaccharide
from serotype 8 is oxydized in the presence of orthoperiodate,
preferably in the presence of periodic acid.
[0436] Following the oxidation step of the polysaccharide, the
polysaccharide is said to be activated and is referred to as
"activated polysaccharide" here below. The activated polysaccharide
maybe purified and lyophilised (freeze-dried).
[0437] The activated polysaccharide and the carrier protein may be
lyophilised (freeze-dried), either independently (discrete
lyophilization) or together (co-lyophilized). In one embodiment the
activated polysaccharide and the carrier protein are
co-lyophilised. In another embodiment the activated polysaccharide
and the carrier protein are lyophilised independently.
[0438] In one embodiment the lyophilisation takes place in the
presence of a non-reducing sugar, possible non-reducing sugars
include sucrose, trehalose, raffinose, stachyose, melezitose,
dextran, mannitol, lactitol and palatinit.
[0439] The second step of the conjugation process is the reduction
of the activated polysaccharide and a carrier protein to form a
conjugate (reductive amination), using a reducing agent. Reducing
agents which are suitable include the cyanoborohydrides, such as
sodium cyanoborohydride, borane-pyridine, or borohydride exchange
resin. In one embodiment the reducing agent is sodium
cyanoborohydride.
[0440] In an embodiment, the reduction reaction is carried out in
aqueous solvent, in another embodiment the reaction is carried out
in aprotic solvent. In an embodiment, the reduction reaction is
carried out in DMSO (dimethylsulfoxide) or in DMF
(dimethylformamide) solvent. The DMSO or DMF solvent may be used to
reconstitute the activated polysaccharide and carrier protein which
has been lyophilised.
[0441] In one embodiment between 0.1 and 3.0, between 0.15 and 2.0,
between 0.2 and 1.0, or between 0.25 and 0.5 molar equivalents of
sodium cyanoborohydride is used in the reduction reaction. In one
embodiment about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1,
1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4,
2.5, 2.6, 2.7, 2.8, 2.9 or 3.0 molar equivalents of sodium
cyanoborohydride is used in the reduction reaction.
[0442] In one embodiment the reducing agent is sodium
triacetoxyborohydride. In a further embodiment between 1.0 and 6.0
molar equivalents, between 2.0 and 5.0 molar equivalents or about
3.0 molar equivalents of sodium triacetoxyborohydride is used in
the reduction reaction.
[0443] At the end of the reduction reaction, there may be unreacted
aldehyde groups remaining in the conjugates, these may be capped
using a suitable capping agent. In one embodiment this capping
agent is sodium borohydride (NaBH.sub.4). In an embodiment capping
is achieved by mixing the reduction reaction with between 0.5 and
5.0 molar equivalents of NaBH.sub.4, for example about 1.0, 1.5,
2.0, 2.5 or 3.0 molar equivalents of NaBH.sub.4.
[0444] Following the conjugation (the reduction reaction and
optionally the capping), the glycoconjugates may be purified. The
glycoconjugates maybe purified by diafiltration and/or ion exchange
chromatography and/or size exclusion chromatography. In an
embodiment, the glycoconjugates are purified by diafiltration or
ion exchange chromatography or size exclusion chromatography.
[0445] In one embodiment the glycoconjugates are sterile
filtered.
[0446] In some embodiments, the serotype 8 glycoconjugates of the
present invention are conjugated to the carrier protein (e.g.,
CRM.sub.197) and comprise a saccharide having a molecular weight of
between 10 kDa and 2,000 kDa. In other such embodiments, the
saccharide has a molecular weight of between 50 kDa and 2,000 kDa.
In further such embodiments, the saccharide has a molecular weight
of between 50 kDa and 1,750 kDa; between 50 kDa and 1,500 kDa;
between 50 kDa and 1,250 kDa; between 50 kDa and 1,000 kDa; between
50 kDa and 750 kDa; between 50 kDa and 500 kDa; between 100 kDa and
2,000 kDa; between 100 kDa and 1,750 kDa; between 100 kDa and 1,500
kDa; between 100 kDa and 1,250 kDa; between 100 kDa and 1,000 kDa;
between 100 kDa and 750 kDa; between 100 kDa and 500 kDa; between
200 kDa and 2,000 kDa; between 200 kDa and 1,750 kDa; between 200
kDa and 1,500 kDa; between 200 kDa and 1,250 kDa; between 200 kDa
and 1,000 kDa; between 200 kDa and 750 kDa; or between 200 kDa and
500 kDa; or between 200 kDa and 400 kDa. In an embodiment, said
serotype 8 glycoconjugates are prepared using reductive
amination.
[0447] In some embodiments, the serotype 8 glycoconjugate of the
invention has a molecular weight of between 50 kDa and 20,000 kDa.
In other embodiments, the serotype 8 glycoconjugate has a molecular
weight of between 50 kDa and 15,000 kDa. In other embodiments, the
serotype 8 glycoconjugate has a molecular weight of between 500 kDa
and 10,000 kDa. In other embodiments, the serotype 8 glycoconjugate
has a molecular weight of between 200 kDa and 10,000 kDa. In still
other embodiments, the the serotype 8 glycoconjugate has a
molecular weight of between 1,000 kDa and 8,000 kDa or between
2,000 kDa and 8,000 kDa.
[0448] In further embodiments, the serotype 8 glycoconjugate of the
invention has a molecular weight of between 200 kDa and 20,000 kDa;
between 200 kDa and 15,000 kDa; between 200 kDa and 10,000 kDa;
between 200 kDa and 7,500 kDa; between 200 kDa and 5,000 kDa;
between 200 kDa and 3,000 kDa; between 200 kDa and 1,000 kDa;
between 500 kDa and 20,000 kDa; between 500 kDa and 15,000 kDa;
between 500 kDa and 12,500 kDa; between 500 kDa and 10,000 kDa;
between 500 kDa and 7,500 kDa; between 500 kDa and 6,000 kDa;
between 500 kDa and 5,000 kDa; between 500 kDa and 4,000 kDa;
between 500 kDa and 3,000 kDa; between 500 kDa and 2,000 kDa;
between 500 kDa and 1,500 kDa; between 500 kDa and 1,000 kDa;
between 750 kDa and 20,000 kDa; between 750 kDa and 15,000 kDa;
between 750 kDa and 12,500 kDa; between 750 kDa and 10,000 kDa;
between 750 kDa and 7,500 kDa; between 750 kDa and 6,000 kDa;
between 750 kDa and 5,000 kDa; between 750 kDa and 4,000 kDa;
between 750 kDa and 3,000 kDa; between 750 kDa and 2,000 kDa;
between 750 kDa and 1,500 kDa; between 1,000 kDa and 15,000 kDa;
between 1,000 kDa and 12,500 kDa; between 1,000 kDa and 10,000 kDa;
between 1,000 kDa and 7,500 kDa; between 1,000 kDa and 6,000 kDa;
between 1,000 kDa and 5,000 kDa; between 1,000 kDa and 4,000 kDa;
between 1,000 kDa and 2,500 kDa; between 2,000 kDa and 15,000 kDa;
between 2,000 kDa and 12,500 kDa; between 2,000 kDa and 10,000 kDa;
between 2,000 kDa and 7,500 kDa; between 2,000 kDa and 6,000 kDa;
between 2,000 kDa and 5,000 kDa; between 2,000 kDa and 4,000 kDa;
or between 2,000 kDa and 3,000 kDa.
[0449] In further embodiments, the serotype 8 glycoconjugate of the
invention has a molecular weight of between 3,000 kDa and 20,000
kDa; between 3,000 kDa and 15,000 kDa; between 3,000 kDa and 10,000
kDa; between 3,000 kDa and 7,500 kDa; between 3,000 kDa and 5,000
kDa; between 4,000 kDa and 20,000 kDa; between 4,000 kDa and 15,000
kDa; between 4,000 kDa and 12,500 kDa; between 4,000 kDa and 10,000
kDa; between 4,000 kDa and 7,500 kDa; between 4,000 kDa and 6,000
kDa; or between 4,000 kDa and 5,000 kDa. In further embodiments,
the serotype 8 glycoconjugate of the invention has a molecular
weight of between 5,000 kDa and 20,000 kDa; between 5,000 kDa and
15,000 kDa; between 5,000 kDa and 10,000 kDa or between 5,000 kDa
and 7,500 kDa. In further embodiments, the serotype 8
glycoconjugate of the invention has a molecular weight of between
6,000 kDa and 20,000 kDa; between 6,000 kDa and 15,000 kDa; between
6,000 kDa and 10,000 kDa or between 6,000 kDa and 7,500 kDa.
[0450] In further embodiments, the serotype 8 glycoconjugate of the
invention has a molecular weight of between 7,000 kDa and 20,000
kDa; between 7,000 kDa and 15,000 kDa; between 7,000 kDa and 10,000
kDa or between 7,000 kDa and 8,000 kDa. In further embodiments, the
serotype 8 glycoconjugate of the invention has a molecular weight
of between 8,000 kDa and 20,000 kDa; between 8,000 kDa and 15,000
kDa; or between 8,000 kDa and 10,000 kDa.
[0451] In an embodiment, said serotype 8 glycoconjugates are
prepared using reductive amination.
[0452] Another way to characterize the serotype 8 glycoconjugates
of the invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide which can be characterized as a range of conjugated
lysines (degree of conjugation).
[0453] The evidence for lysine modification of the carrier protein,
due to covalent linkages to the polysaccharides, can be obtained by
amino acid analysis using routine methods known to those of skill
in the art. In frequent embodiments, the carrier protein is
covalently conjugated to activated polysaccharide through an amine
linkage to one or more .epsilon.-amino groups of lysine residues on
the carrier protein. In some such embodiments, the carrier protein
comprises 2 to 20 lysine residues covalently conjugated to the
saccharide. In other such embodiments, the carrier protein
comprises 4 to 16 or 6 to 14 lysine residues covalently conjugated
to the saccharide.
[0454] In a preferred embodiment, the degree of conjugation of the
serotype 8 glycoconjugate of the invention is between 2 and 20,
between 2 and 15, between 2 and 13, between 2 and 10, between 2 and
8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and
15, between 3 and 13, between 3 and 10, between 3 and 8, between 3
and 6, between 3 and 5, between 3 and 4, between 5 and 15, between
5 and 10, between 8 and 15, between 8 and 12, between 10 and 15 or
between 10 and 12. In an embodiment, the degree of conjugation of
the serotype 8 glycoconjugate of the invention is about 2, about 3,
about 4, about 5, about 6, about 7, about 8, about 9, about 10,
about 11, about 12, about 13, about 14 or about 15. In a preferred
embodiment, the degree of conjugation of the serotype 8
glycoconjugate of the invention is between 4 and 16 or between 6
and 14.
[0455] In some such embodiments, the carrier protein is
CRM.sub.197.
[0456] In a preferred embodiment, the carrier protein comprises
CRM.sub.197, which contains 39 lysine residues. In some such
embodiments, the CRM.sub.197 may comprise between 4 and 16 or
between 6 and 14 lysine residues out of 39 covalently linked to the
saccharide. Another way to express this parameter is that about 10%
to about 41% or about 15% to about 36% of CRM.sub.197 lysines are
covalently linked to the saccharide. In another such embodiment,
the CRM.sub.197 may comprise 2 to 20 lysine residues out of 39
covalently linked to the saccharide. Another way to express this
parameter is that about 5% to about 50% of CRM.sub.197 lysines are
covalently linked to the saccharide. In some such embodiments, the
CRM.sub.197 may comprise about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, or 16 lysine residues out of 39 covalently linked to the
saccharide.
[0457] The serotype 8 glycoconjugates of the invention may also be
characterized by the ratio (weight/weight) of saccharide to carrier
protein. In some embodiments, the saccharide to carrier protein
ratio (w/w) is between 0.2 and 4.0 (e.g., about 0.2, about 0.3,
about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9,
about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5,
about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1,
about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7,
about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3,
about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9 or
about 4.0). In other embodiments, the saccharide to carrier protein
ratio (w/w) is between 0.7 and 2.5. In further embodiments, the
saccharide to carrier protein ratio (w/w) is between 0.8 and 1.5
(e.g., about 0.8, about 0.9 about 1.0, about 1.1, about 1.2, about
1.3, about 1.4 or about 1.5). In some such embodiments, the carrier
protein is CRM.sub.197. In an embodiment, said serotype 8
glycoconjugates are prepared using reductive amination.
[0458] The serotype 8 glycoconjugates and immunogenic compositions
of the invention may contain free saccharide that is not covalently
conjugated to the carrier protein, but is nevertheless present in
the glycoconjugate composition. The free saccharide may be
noncovalently associated with (i.e., noncovalently bound to,
adsorbed to, or entrapped in or with) the glycoconjugate.
[0459] In some embodiments, the serotype 8 glycoconjugates of the
invention comprise less than about 50% free saccharide, less than
about 45% free saccharide, less than about 40% free saccharide,
less than about 35% free saccharide, less than about 30% free
saccharide, less than about 25% free saccharide, less than about
20% free saccharide, less than about 15% free saccharide, less than
about 10% free saccharide, or less than about 5% free saccharide
relative to the total amount of serotype 8 saccharide.
[0460] Preferably, the serotype 8 glycoconjugate comprises less
than 15% free saccharide, more preferably less than 10% free
saccharide, and still more preferably, less than 5% of free
saccharide.
[0461] The serotype 8 glycoconjugates may also be characterized by
their molecular size distribution (K.sub.d). Size exclusion
chromatography media (CL-4B) can be used to determine the relative
molecular size distribution of the conjugate. Size Exclusion
Chromatography (SEC) is used in gravity fed columns to profile the
molecular size distribution of conjugates. Large molecules excluded
from the pores in the media elute more quickly than small
molecules. Fraction collectors are used to collect the column
eluate. The fractions are tested colorimetrically by saccharide
assay. For the determination of K.sub.d, columns are calibrated to
establish the fraction at which molecules are fully excluded
(V.sub.0), (K.sub.d=0), and the fraction representing the maximum
retention (V.sub.i), (K.sub.d=1). The fraction at which a specified
sample attribute is reached (V.sub.e), is related to K.sub.d by the
expression, K.sub.d=(V.sub.e-V.sub.0)/(V.sub.i-V.sub.0).
[0462] In a preferred embodiment, at least 40% of the serotype 8
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the
serotype 8 glycoconjugates of the invention have a K.sub.d below or
equal to 0.3 in a CL-4B column. In a preferred embodiment, at least
60% of the serotype 8 glycoconjugates of the invention have a
K.sub.d below or equal to 0.3 in a CL-4B column. In a preferred
embodiment, at least 70% of the serotype 8 glycoconjugates of the
invention have a K.sub.d below or equal to 0.3 in a CL-4B
column.
[0463] In a preferred embodiment, between 40% and 90% of the
serotype 8 glycoconjugates have a K.sub.d below or equal to 0.3 in
a CL-4B column. In a preferred embodiment, between 50% and 90% of
the serotype 8 glycoconjugates have a K.sub.d below or equal to 0.3
in a CL-4B column. In a preferred embodiment, between 65% and 80%
of the serotype 8 glycoconjugates have a K.sub.d below or equal to
0.3 in a CL-4B column.
2. IMMUNOGENIC COMPOSITIONS OF THE PRESENT INVENTION
[0464] In an embodiment, the number of S. pneumoniae capsular
saccharides of the immunogenic composition can range from 1
serotype (or "v", valence) to 7 different serotypes (7v). In one
embodiment there is 1 serotype. In one embodiment there are 2
different serotypes. In one embodiment there are 3 different
serotypes. In one embodiment there are 4 different serotypes. In
one embodiment there are 5 different serotypes. In one embodiment
there are 6 different serotypes. In one embodiment there are 7
different serotypes. The capsular saccharides are conjugated to a
carrier protein to form glycoconjugates as described here
above.
[0465] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate selected from the
group consisting of a glycoconjugate from S. pneumoniae serotype
15B (such as the glycoconjugates of section 1.3.4 above), a
glycoconjugate from S. pneumoniae serotype 22F (such as the
glycoconjugates of section 1.3.2 above), a glycoconjugate from S.
pneumoniae serotype 33F (such as the glycoconjugates of section
1.3.3 above), a glycoconjugate from S. pneumoniae serotype 12F
(such as the glycoconjugates of section 1.3.5 above), a
glycoconjugate from S. pneumoniae serotype 10A (such as the
glycoconjugates of section 1.3.6 above), a glycoconjugate from S.
pneumoniae serotype 11A (such as the glycoconjugates of section
1.3.7 above) and a glycoconjugate from S. pneumoniae serotype 8
(such as the glycoconjugates of section 1.3.8 above).
[0466] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate from S. pneumoniae
serotype 15B, such as the glycoconjugate of section 1.3.4 above. In
an embodiment the immunogenic composition of the invention
comprises at least one glycoconjugate from S. pneumoniae serotype
22F, such as the ones disclosed at section 1.3.2 above. In an
embodiment the immunogenic composition of the invention comprises
at least one glycoconjugate from S. pneumoniae serotype 33F such as
the ones disclosed at section 1.3.3 above. In an embodiment the
immunogenic composition of the invention comprises at least one
glycoconjugate from S. pneumoniae serotype 12F such as the ones
disclosed at section 1.3.5 above. In an embodiment the immunogenic
composition of the invention comprises at least one glycoconjugate
from S. pneumoniae serotype 10A such as the ones disclosed at
section 1.3.6 above. In an embodiment the immunogenic composition
of the invention comprises at least one glycoconjugate from S.
pneumoniae serotype 11A such as the ones disclosed at section 1.3.7
above. In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate from S. pneumoniae
serotype 8 such as the ones disclosed at section 1.3.8 above.
[0467] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the two
S. pneumoniae serotypes selected from the group consisting of: 15B
and 22F, 15B and 33F, 15B and 12F, 15B and 10A, 15B and 11A, 15B
and 8, 22F and 33F, 22F and 12F, 22F and 10A, 22F and 11A, 22F and
8, 33F and 12F, 33F and 10A, 33F and 11A, 33F and 8, 12F and 10A,
12F and 11A, 12F and 8, 10A and 11A, 10A and 8, and 11A and 8.
[0468] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
three following S. pneumoniae serotypes:
[0469] 15B and 22F and 33F,
[0470] 15B and 22F and 12F,
[0471] 15B and 22F and 10A,
[0472] 15B and 22F and 11A,
[0473] 15B and 22F and 8,
[0474] 15B and 33F and 12F,
[0475] 15B and 33F and 10A,
[0476] 15B and 33F and 11A,
[0477] 15B and 33F and 8,
[0478] 15B and 12F and 10A,
[0479] 15B and 12F and 11A,
[0480] 15B and 12F and 8,
[0481] 15B and 10A and 11A,
[0482] 15B and 10A and 8,
[0483] 15B and 11A and 8,
[0484] 22F and 33F and 12F,
[0485] 22F and 33F and 10A,
[0486] 22F and 33F and 11A,
[0487] 22F and 33F and 8,
[0488] 22F and 12F and 10A,
[0489] 22F and 12F and 11A,
[0490] 22F and 12F and 8,
[0491] 22F and 10A and 11A,
[0492] 22F and 10A and 8,
[0493] 22F and 11A and 8,
[0494] 33F and 12F and 10A,
[0495] 33F and 12F and 11A,
[0496] 33F and 12F and 8,
[0497] 33F and 10A and 11A,
[0498] 33F and 10A and 8,
[0499] 33F and 11A and 8,
[0500] 12F and 10A and 11A,
[0501] 12F and 10A and 8,
[0502] 12F and 11A and 8, or
[0503] 10A and 11A and 8.
[0504] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the four
following S. pneumoniae serotypes:
[0505] 15B and 22F and 33F and 12F,
[0506] 15B and 22F and 33F and 10A,
[0507] 15B and 22F and 33F and 11A,
[0508] 15B and 22F and 33F and 8,
[0509] 15B and 22F and 12F and 10A,
[0510] 15B and 22F and 12F and 11A,
[0511] 15B and 22F and 12F and 8,
[0512] 15B and 22F and 10A and 11A,
[0513] 15B and 22F and 10A and 8,
[0514] 15B and 22F and 11A and 8,
[0515] 15B and 33F and 12F and 10A,
[0516] 15B and 33F and 12F and 11A,
[0517] 15B and 33F and 12F and 8,
[0518] 15B and 33F and 10A and 11A,
[0519] 15B and 33F and 10A and 8,
[0520] 15B and 33F and 11A and 8,
[0521] 15B and 12F and 10A and 11A,
[0522] 15B and 12F and 10A and 8,
[0523] 15B and 12F and 11A and 8,
[0524] 15B and 10A and 11A and 8,
[0525] 22F and 33F and 12F and 10A,
[0526] 22F and 33F and 12F and 11A,
[0527] 22F and 33F and 12F and 8,
[0528] 22F and 33F and 10A and 11A,
[0529] 22F and 33F and 10A and 8,
[0530] 22F and 33F and 11A and 8,
[0531] 22F and 12F and 10A and 11A,
[0532] 22F and 12F and 10A and 8,
[0533] 22F and 12F and 11A and 8,
[0534] 22F and 10A and 11A and 8,
[0535] 33F and 12F and 10A and 11A,
[0536] 33F and 12F and 10A and 8,
[0537] 33F and 12F and 11A and 8,
[0538] 33F and 10A and 11A and 8 or
[0539] 12F and 10A and 11A and 8.
[0540] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the five
following S. pneumoniae serotypes:
[0541] 15B and 22F and 33F and 12F and 10A,
[0542] 15B and 22F and 33F and 12F and 11A,
[0543] 15B and 22F and 33F and 12F and 8,
[0544] 15B and 22F and 33F and 10A and 11A,
[0545] 15B and 22F and 33F and 10A and 8,
[0546] 15B and 22F and 33F and 11A and 8,
[0547] 15B and 22F and 12F and 10A and 11A,
[0548] 15B and 22F and 12F and 10A and 8,
[0549] 15B and 22F and 12F and 11A and 8,
[0550] 15B and 22F and 10A and 11A and 8,
[0551] 15B and 33F and 12F and 10A and 11A,
[0552] 15B and 33F and 12F and 10A and 8,
[0553] 15B and 33F and 12F and 11A and 8,
[0554] 15B and 33F and 10A and 11A and 8,
[0555] 15B and 12F and 10A and 11A and 8,
[0556] 22F and 33F and 12F and 10A and 11A,
[0557] 22F and 33F and 12F and 10A and 8,
[0558] 22F and 33F and 12F and 11A and 8,
[0559] 22F and 33F and 10A and 11A and 8,
[0560] 22F and 12F and 10A and 11A and 8 or
[0561] 33F and 12F and 10A and 11A and 8.
[0562] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the six
following S. pneumoniae serotypes:
[0563] 15B and 22F and 33F and 12F and 10A and 11A,
[0564] 15B and 22F and 33F and 12F and 10A and 8,
[0565] 15B and 22F and 33F and 12F and 11A and 8,
[0566] 15B and 22F and 33F and 10A and 11A and 8,
[0567] 15B and 22F and 12F and 10A and 11A and 8,
[0568] 15B and 33F and 12F and 10A and 11A and 8 or
[0569] 22F and 33F and 12F and 10A and 11A and 8.
[0570] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
seven following S. pneumoniae serotypes: 15B and 22F and 33F and
12F and 10A and 11A and 8.
[0571] In an embodiment the glycoconjugates from S. pneumoniae
serotypes 15B, 22F, 33F, 12F, 10A, 11A and/or 8 of any of the
immunogenic composition defined in this section are as disclosed at
sections 1.3.2 to 1.3.8 above.
[0572] Preferably, all the glycoconjugates of the above immunogenic
compositions are individually conjugated to the carrier
protein.
[0573] In an embodiment of any of the above immunogenic
compositions, the glycoconjugates from S. pneumoniae serotype 22F
is conjugated to CRM197. In an embodiment of any of the above
immunogenic compositions, the glycoconjugates from S. pneumoniae
serotype 33F is conjugated to CRM.sub.197. In an embodiment of any
of the above immunogenic compositions, the glycoconjugates from S.
pneumoniae serotype 15B is conjugated to CRM.sub.197. In an
embodiment of any of the above immunogenic compositions, the
glycoconjugates from S. pneumoniae serotype 12F is conjugated to
CRM197. In an embodiment of any of the above immunogenic
compositions, the glycoconjugates from S. pneumoniae serotype 10A
is conjugated to CRM.sub.197. In an embodiment of any of the above
immunogenic compositions, the glycoconjugates from S. pneumoniae
serotype 11A is conjugated to CRM.sub.197. In an embodiment of any
of the above immunogenic compositions, the glycoconjugates from S.
pneumoniae serotype 8 is conjugated to CRM.sub.197.
[0574] In an embodiment of any of the above immunogenic
compositions, the glycoconjugates from S. pneumoniae are all
individually conjugated to CRM.sub.197.
[0575] In another embodiment of any of the above immunogenic
compositions, the glycoconjugates from S. pneumoniae are all
individually conjugated to PD. In another embodiment, the
glycoconjugates from S. pneumoniae are all individually conjugated
to TT. In yet another embodiment, the glycoconjugates from S.
pneumoniae are all individually conjugated to DT.
[0576] In another embodiment of any of the above immunogenic
compositions, the glycoconjugates from S. pneumoniae serotype 22F,
33F, 15B, 12F, 10A, 11A, and/or 8 is/are individually conjugated to
DT. In another embodiment, the glycoconjugates from S. pneumoniae
serotype 22F, 33F, 15B, 12F, 10A, 11A, and/or 8 is/are individually
conjugated to TT. In another embodiment, the glycoconjugates from
S. pneumoniae serotype 22F, 33F, 15B, 12F, 10A, 11A, and/or 8
is/are individually conjugated to PD.
[0577] In another embodiment of any of the above immunogenic
compositions, at least one of the glycoconjugates is individually
conjugated to DT and the other glycoconjugate(s) from S. pneumoniae
is/are individually conjugated to TT. In another embodiment, at
least one of the glycoconjugates is individually conjugated to TT
and the other glycoconjugate(s) is/are individually conjugated to
DT. In another embodiment, at least one of the glycoconjugates is
individually conjugated to PD and the other glycoconjugate(s)
is/are individually conjugated to DT. In another embodiment, at
least one of the glycoconjugates is individually conjugated to PD
and the other glycoconjugate(s) is/are individually conjugated to
TT. In another embodiment, at least one of the glycoconjugates is
individually conjugated to TT and the other glycoconjugate(s)
is/are individually conjugated to PD. In another embodiment, at
least one of the glycoconjugates is individually conjugated to DT
and the other glycoconjugate(s) is/are individually conjugated to
PD.
[0578] In another embodiment of any of the above immunogenic
compositions, at least one of the glycoconjugates is individually
conjugated to CRM.sub.197 and the other glycoconjugate(s) from S.
pneumoniae is/are individually conjugated to DT. In another
embodiment, at least one of the glycoconjugates is individually
conjugated to CRM.sub.197 and the other glycoconjugate(s) is/are
individually conjugated to TT. In another embodiment, at least one
of the glycoconjugates is individually conjugated to CRM.sub.197
and the other glycoconjugate(s) is/are individually conjugated to
PD. In another embodiment, at least one of the glycoconjugates is
individually conjugated to DT and the other glycoconjugate(s)
is/are individually conjugated to CRM.sub.197. In another
embodiment, at least one of the glycoconjugates is individually
conjugated to TT and the other glycoconjugate(s) is/are
individually conjugated to CRM.sub.197. In another embodiment, at
least one of the glycoconjugates is individually conjugated to PD
and the other glycoconjugate(s) is/are individually conjugated to
CRM.sub.197.
[0579] In an embodiment the above immunogenic compositions comprise
from 1 to 7 different serotypes of S. pneumoniae. In one embodiment
the above immunogenic composition is a 1, 2, 3, 4, 5, 6 or 7-valent
pneumococcal conjugate composition. In one embodiment the above
immunogenic composition is a 6-valent pneumococcal conjugate
composition. In one embodiment the above immunogenic composition is
a 7-valent pneumococcal conjugate composition.
[0580] 1. In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate from S. pneumoniae
serotype 15B, such as the glycoconjugates of section 1.3.4
above.
[0581] 2. In another embodiment the immunogenic composition of the
invention comprises in addition to point 1 above, at least one
glycoconjugate from S. pneumoniae serotype 22F, such as the ones
disclosed at section 1.3.2 above.
[0582] 3. In another embodiment the immunogenic composition of the
invention comprises in addition to point 1 or 2 above, at least one
glycoconjugate from S. pneumoniae serotype 33F such as the ones
disclosed at section 1.3.3 above.
[0583] 4. In another embodiment the immunogenic composition of the
invention comprises in addition to point 1, 2 or 3 above, at least
one glycoconjugate from S. pneumoniae serotype 12F such as the ones
disclosed at section 1.3.5 above.
[0584] 5. In another embodiment the immunogenic composition of the
invention comprises in addition to point 1, 2, 3 or 4 above, at
least one glycoconjugate from S. pneumoniae serotype 10A such as
the ones disclosed at section 1.3.6 above.
[0585] 6. In another embodiment the immunogenic composition of the
invention comprises in addition to point 1, 2, 3, 4 or 5 above, at
least one glycoconjugate from S. pneumoniae serotype 11A such as
the ones disclosed at section 1.3.7 above.
[0586] 7. In another embodiment the immunogenic composition of the
invention comprises in addition to point 1, 2, 3, 4, 5 or 6 above,
at least one glycoconjugate from S. pneumoniae serotype 8 such as
the ones disclosed at section 1.3.8 above.
[0587] In an embodiment, the immunogenic composition of the
invention comprises conjugated S. pneumoniae saccharides from
serotypes 8, 10A, 11A, 12F, 15B, 22F and 33F.
[0588] In an embodiment, the glycoconjugates of the immunogenic
composition of the invention consist of glycoconjugates from S.
pneumoniae serotypes 8, 10A, 11A, 12F, 15B, 22F and 33F.
[0589] Preferably, all the glycoconjugates of the immunogenic
composition of the invention (e.g., of any of points 1 to 7 above)
are individually conjugated to the carrier protein.
[0590] In an embodiment of any of points 1 to 7 above, the
glycoconjugate from S. pneumoniae serotype 22F is conjugated to
CRM.sub.197. In an embodiment of any of points 2 to 7 above, the
glycoconjugate from S. pneumoniae serotype 33F is conjugated to
CRM.sub.197. In an embodiment of any of points 3 to 7 above, the
glycoconjugate from S. pneumoniae serotype 15B is conjugated to
CRM197. In an embodiment of any of points 4 to 7 above, the
glycoconjugate from S. pneumoniae serotype 12F is conjugated to
CRM.sub.197. In an embodiment of any of points 5 to 7 above, the
glycoconjugate from S. pneumoniae serotype 10A is conjugated to
CRM.sub.197. In an embodiment of any of points 6 to 7 above, the
glycoconjugate from S. pneumoniae serotype 11A is conjugated to
CRM.sub.197. In an embodiment of point 7 above, the glycoconjugate
from S. pneumoniae serotype 8 is conjugated to CRM.sub.197.
[0591] In an embodiment, the glycoconjugates of the immunogenic
composition of points 1 to 7 above are individually conjugated to
CRM.sub.197.
[0592] In an embodiment, the glycoconjugates of the immunogenic
composition of points 1 to 7 above are individually conjugated to
PD. In an embodiment, the glycoconjugates of the immunogenic
composition of points 1 to 7 above are individually conjugated to
TT. In an embodiment, the glycoconjugates of the immunogenic
composition of points 1 to 7 above are individually conjugated to
DT.
[0593] In an embodiment, at least one of the glycoconjugates of the
immunogenic composition of points 1 to 7 above is individually
conjugated to DT and the other glycoconjugate(s) from S. pneumoniae
is/are individually conjugated to TT. In another embodiment, at
least one of the glycoconjugates of the immunogenic composition of
points 1 to 7 above is individually conjugated to TT and the other
glycoconjugate(s) is/are individually conjugated to DT. In another
embodiment, at least one of the glycoconjugates of the immunogenic
composition of points 1 to 7 above is individually conjugated to PD
and the other glycoconjugate(s) is/are individually conjugated to
DT. In another embodiment, at least one of the glycoconjugates of
the immunogenic composition of points 1 to 7 above is individually
conjugated to PD and the other glycoconjugate(s) is/are
individually conjugated to TT. In another embodiment, at least one
of the glycoconjugates of the immunogenic composition of points 1
to 7 above is individually conjugated to TT and the other
glycoconjugate(s) is/are individually conjugated to PD. In another
embodiment, at least one of the glycoconjugates of the immunogenic
composition of points 1 to 7 above is individually conjugated to DT
and the other glycoconjugate(s) is/are individually conjugated to
PD.
[0594] In another embodiment, at least one of the glycoconjugates
of the immunogenic composition of points 1 to 7 above is
individually conjugated to CRM.sub.197 and the other
glycoconjugate(s) from S. pneumoniae is/are individually conjugated
to DT. In another embodiment, at least one of the glycoconjugates
of the immunogenic composition of points 1 to 7 above is
individually conjugated to CRM.sub.197 and the other
glycoconjugate(s) is/are individually conjugated to TT. In another
embodiment, at least one of the glycoconjugates of the immunogenic
composition of points 1 to 7 above is individually conjugated to
CRM.sub.197 and the other glycoconjugate(s) is/are individually
conjugated to PD. In another embodiment, at least one of the
glycoconjugates of the immunogenic composition of points 1 to 7
above is individually conjugated to DT and the other
glycoconjugate(s) is/are individually conjugated to CRM.sub.197. In
another embodiment, at least one of the glycoconjugates of the
immunogenic composition of points 1 to 7 above is individually
conjugated to TT and the other glycoconjugate(s) is/are
individually conjugated to CRM.sub.197. In another embodiment, at
least one of the glycoconjugates of the immunogenic composition of
points 1 to 7 above is individually conjugated to PD and the other
glycoconjugate(s) is/are individually conjugated to
CRM.sub.197.
[0595] In an embodiment the above immunogenic composition is a 1,
2, 3, 4, 5, 6 or 7-valent pneumococcal conjugate composition. In
one embodiment the above immunogenic composition is a 6-valent
pneumococcal conjugate composition. In one embodiment the above
immunogenic composition is a 7-valent pneumococcal conjugate
composition.
[0596] After conjugation of the capsular polysaccharide to the
carrier protein, the glycoconjugates are purified (enriched with
respect to the amount of polysaccharide-protein conjugate) by a
variety of techniques. These techniques include
concentration/diafiltration operations, precipitation/elution,
column chromatography, and depth filtration (see for example U.S.
Patent App. Pub. No. 2007/0184072 or WO 2008/079653). After the
individual glycoconjugates are purified, they are compounded to
formulate the immunogenic composition of the present invention.
[0597] In an embodiment the dosage of the above immunogenic
composition is as disclosed at section 5 below.
[0598] In an embodiment the above immunogenic compositions further
comprise antigen(s) from other pathogens, particularly from
bacteria and/or viruses such as disclosed at section 6 below.
[0599] In an embodiment the above immunogenic compositions further
comprise one or more adjuvants as disclosed at section 6 below.
[0600] In an embodiment the above immunogenic compositions are
formulated as disclosed at section 8 below.
3. IMMUNOGENIC COMPOSITIONS WHICH MAY BE USED IN COMBINATION WITH
THE IMMUNOGENIC COMPOSITIONS OF THE PRESENT INVENTION
[0601] In an embodiment, the immunogenic compositions of the
invention (such as any of the ones of section 2 above) are used in
combination with a second immunogenic composition.
[0602] In an embodiment, said second immunogenic composition
comprises at least one glycoconjugate from a Streptococcus
pneumoniae serotype selected from the group consisting of serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and
33F.
[0603] In an embodiment, said second immunogenic composition
comprises at least one glycoconjugate from a Streptococcus
pneumoniae serotype selected from the group consisting of serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F.
[0604] 1. In an embodiment said second immunogenic composition
comprises at least one glycoconjugate from S. pneumoniae serotypes
4, 6B, 9V, 14, 18C, 19F and 23F (such as the glycoconjugates of
section 1.3.1 above).
[0605] 2. In another embodiment said second immunogenic composition
comprises in addition to point 1 above, at least one glycoconjugate
from S. pneumoniae serotypes 1, 5 and 7F (such as the
glycoconjugates of section 1.3.1 above).
[0606] 3. In another embodiment said second immunogenic composition
comprises in addition to point 1 or 2 above, at least one
glycoconjugate from S. pneumoniae serotypes 6A and 19A (such as the
glycoconjugates of section 1.3.1 above).
[0607] 4. In another embodiment said second immunogenic composition
comprises in addition to point 1, 2 or 3 above, at least one
glycoconjugate from S. pneumoniae serotype 3 (such as the
glycoconjugates of section 1.3.1 above).
[0608] 5. In another embodiment said second immunogenic composition
comprises in addition to point 1, 2, 3 or 4 above, at least one
glycoconjugate from S. pneumoniae serotype 22F, such as the ones
disclosed at section 1.3.2 above.
[0609] 6. In another embodiment said second immunogenic composition
comprises in addition to point 1, 2, 3, 4 or 5 above, at least one
glycoconjugate from S. pneumoniae serotype 33F such as the ones
disclosed at section 1.3.3 above.
[0610] Preferably, all the glycoconjugates of the above second
immunogenic compositions are individually conjugated to the carrier
protein.
[0611] In an embodiment of any of the above second immunogenic
compositions, the glycoconjugates from S. pneumoniae serotypes 4,
6B, 9V, 14, 18C, 19F and 23F are conjugated to CRM.sub.197. In an
embodiment of any of the above second immunogenic compositions, the
glycoconjugates from S. pneumoniae serotypes 1, 5 and 7F are
conjugated to CRM.sub.197. In an embodiment of any of the above
second immunogenic compositions, the glycoconjugates from S.
pneumoniae serotypes 6A and 19A are conjugated to CRM.sub.197. In
an embodiment of any of the above second immunogenic compositions,
the glycoconjugates from S. pneumoniae serotype 3 is conjugated to
CRM.sub.197. In an embodiment of any of the above second
immunogenic compositions, the glycoconjugates from S. pneumoniae
serotype 22F is conjugated to CRM.sub.197. In an embodiment of any
of the above second immunogenic compositions, the glycoconjugates
from S. pneumoniae serotype 33F is conjugated to CRM.sub.197.
[0612] In an embodiment, the glycoconjugates of any of the above
second immunogenic compositions are all individually conjugated to
CRM.sub.197.
[0613] In an embodiment, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of any of the above
second immunogenic compositions are individually conjugated to
PD.
[0614] In an embodiment, the glycoconjugate from S. pneumoniae
serotype 18C of any of the above second immunogenic compositions is
conjugated to TT.
[0615] In an embodiment, the glycoconjugate from S. pneumoniae
serotype 19F of any of the above second immunogenic compositions is
conjugated to DT.
[0616] In an embodiment, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of any of the above
second immunogenic compositions are individually conjugated to PD,
the glycoconjugate from S. pneumoniae serotype 18C is conjugated to
TT and the glycoconjugate from S. pneumoniae serotype 19F is
conjugated to DT.
[0617] In an embodiment, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of any of the above
second immunogenic compositions are individually conjugated to PD,
the glycoconjugate from S. pneumoniae serotype 18C is conjugated to
TT, the glycoconjugate from S. pneumoniae serotype 19F is
conjugated to DT, the glycoconjugate from S. pneumoniae serotype
22F is conjugated to CRM.sub.197 and the glycoconjugate from S.
pneumoniae serotype 33F is conjugated to CRM.sub.197.
[0618] In an embodiment the above second immunogenic compositions
comprise from 7 to 15 different serotypes of S. pneumoniae. In one
embodiment the above second immunogenic compositions comprise
glycoconjugates from 7, 8, 9, 10, 11, 12, 13, 14 or 15 different
serotypes. In one embodiment the above second immunogenic
compositions comprise glycoconjugates from 10 to 15 different
serotypes. In an embodiment the above second immunogenic
composition is a 7, 8, 9, 10, 11, 12, 13, 14 or 15-valent
pneumococcal conjugate composition. In an embodiment the above
second immunogenic composition is a 10-valent pneumococcal
conjugate composition. In an embodiment the above second
immunogenic composition is an 11-valent pneumococcal conjugate
composition. In an embodiment the above second immunogenic
composition is a 12-valent pneumococcal conjugate composition. In
an embodiment the above second immunogenic composition is a
13-valent pneumococcal conjugate composition. In an embodiment the
above second immunogenic composition is a 14-valent pneumococcal
conjugate composition. In an embodiment the above second
immunogenic composition is a 15-valent pneumococcal conjugate
composition.
[0619] In an embodiment, the above second immunogenic composition
is a 7-valent pneumococcal conjugate composition wherein said 7
conjugates consists of 7 glycoconjugates from S. pneumoniae
serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated
to CRM.sub.197.
[0620] In an embodiment, the above second immunogenic composition
is a 10-valent pneumococcal conjugate composition wherein said 10
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT and
glycoconjugate from S. pneumoniae serotype 19F conjugated to
DT.
[0621] In an embodiment, the above second immunogenic composition
is an 11-valent pneumococcal conjugate composition wherein said 11
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT and
glycoconjugate from S. pneumoniae serotype 22F conjugated to
CRM.sub.197.
[0622] In an embodiment, the above second immunogenic composition
is an 11-valent pneumococcal conjugate composition wherein said 11
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT and
glycoconjugate from S. pneumoniae serotype 33F conjugated to
CRM.sub.197.
[0623] In an embodiment, the above second immunogenic composition
is a 12-valent pneumococcal conjugate composition wherein said 12
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT,
glycoconjugate from S. pneumoniae serotype 22F conjugated to
CRM.sub.197 and glycoconjugate from S. pneumoniae serotype 33F
conjugated to CRM.sub.197.
[0624] In an embodiment, the above second immunogenic composition
is a 13-valent pneumococcal conjugate composition wherein said 13
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F individually
conjugated to CRM.sub.197.
[0625] In an embodiment, the above second immunogenic composition
is a 14-valent pneumococcal conjugate composition wherein said 14
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 22F
individually conjugated to CRM.sub.197.
[0626] In an embodiment, the above second immunogenic composition
is a 14-valent pneumococcal conjugate composition wherein said 14
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 33F
individually conjugated to CRM.sub.197.
[0627] In an embodiment, the above second immunogenic composition
is a 15-valent pneumococcal conjugate composition wherein said 15
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F
individually conjugated to CRM.sub.197.
[0628] In an embodiment the dosage of the above second immunogenic
is as disclosed at section 5 below.
[0629] In an embodiment the above second immunogenic compositions
further comprise antigen(s) from other pathogen(s), particularly
from bacteria and/or viruses such as disclosed at section 6
below.
[0630] In an embodiment the above second immunogenic compositions
further comprise one or more adjuvants as disclosed at section 7
below.
[0631] In an embodiment the above second immunogenic compositions
are formulated as disclosed at section 8 below.
[0632] In an embodiment, the immunogenic compositions of the
invention (such as any of the ones of section 2 above) are used in
combination with PREVNAR.RTM. (PREVENAR.RTM. in some countries)
(heptavalent vaccine), SYNFLORIX.RTM. (a decavalent vaccine) and/or
PREVNAR 13.RTM. (PREVENAR 13.RTM. in some countries) (tridecavalent
vaccine).
4. KIT OF THE PRESENT INVENTION
[0633] In an aspect, the invention provides a kit comprising: (a) a
first immunogenic composition, as defined at section 2 above; and
(b) a second immunogenic composition comprising at least one
glycoconjugate from a Streptococcus pneumoniae serotype selected
from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F,
22F and 33F.
[0634] In an aspect, the invention provides a kit comprising: (a) a
first immunogenic composition, as defined at section 2 above; and
(b) a second immunogenic composition comprising at least one
glycoconjugate from a Streptococcus pneumoniae serotype selected
from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and
23F.
[0635] In an aspect, the invention provides a kit comprising: (a) a
first immunogenic composition, as defined at section 2 above; and
(b) a second immunogenic composition as defined at section 3
above.
[0636] 1. In an embodiment the second immunogenic composition of
the kit (part (b) of the kit) comprises glycoconjugates from S.
pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F (such as the
glycoconjugates of section 1.3.1 above).
[0637] 2. In another embodiment said second immunogenic composition
comprises in addition to point 1 above, at least one glycoconjugate
from S. pneumoniae serotypes 1, 5 and 7F (such as the
glycoconjugates of section 1.3.1 above).
[0638] 3. In another embodiment said second immunogenic composition
comprises in addition to point 1 or 2 above, at least one
glycoconjugate from S. pneumoniae serotypes 6A and 19A (such as the
glycoconjugates of section 1.3.1 above).
[0639] 4. In another embodiment said second immunogenic composition
comprises in addition to point 1, 2 or 3 above, at least one
glycoconjugate from S. pneumoniae serotype 3 (such as the
glycoconjugates of section 1.3.1 above).
[0640] 5. In another embodiment said second immunogenic composition
comprises in addition to point 1, 2, 3 or 4 above, at least one
glycoconjugate from S. pneumoniae serotype 22F, such as the ones
disclosed at section 1.3.2 above.
[0641] 6. In another embodiment said second immunogenic composition
comprises in addition to point 1, 2, 3, 4 or 5 above, at least one
glycoconjugate from S. pneumoniae serotype 33F such as the ones
disclosed at section 1.3.3 above.
[0642] In an embodiment the second immunogenic composition of the
kit (part (b) of the kit) comprises glycoconjugates from S.
pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F (such as the
glycoconjugates of section 1.3.1 above).
[0643] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 4, 5,
6B, 7F, 9V, 14, 18C, 19F and 23F (such as the glycoconjugates of
section 1.3.1 above).
[0644] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 4, 5,
6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F (such as the
glycoconjugates of section 1.3.1 above).
[0645] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F (such as the
glycoconjugates of section 1.3.1 above).
[0646] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 4, 5,
6B, 7F, 9V, 14, 18C, 19F, 23F and 22F (such as the glycoconjugates
of section 1.3.1 and 1.3.2 above).
[0647] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 4, 5,
6B, 7F, 9V, 14, 18C, 19F, 23F and 33F (such as the glycoconjugates
of sections 1.3.1 and 1.3.3 above).
[0648] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 4, 5,
6B, 7F, 9V, 14, 18C, 19F, 23F, 22F and 33F (such as the
glycoconjugates of section 1.3.1, 1.3.2 and 1.3.3 above).
[0649] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 22F (such as the
glycoconjugates of sections 1.3.1 and 1.3.2 above).
[0650] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 33F (such as the
glycoconjugates of sections 1.3.1 and 1.3.3 above).
[0651] In an embodiment the second immunogenic composition of the
kit comprises glycoconjugates from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F (such as the
glycoconjugates of sections 1.3.1, 1.3.2 and 1.3.3 above).
[0652] Preferably, all the glycoconjugates of the second
immunogenic composition of the kit are individually conjugated to
the carrier protein.
[0653] In an embodiment of any of the above kits, the
glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C,
19F and 23F are conjugated to CRM.sub.197. In an embodiment of any
of the above kits, the glycoconjugates from S. pneumoniae serotypes
1, 5 and 7F are conjugated to CRM.sub.197. In an embodiment of any
of the above kits, the glycoconjugates from S. pneumoniae serotypes
6A and 19A are conjugated to CRM.sub.197. In an embodiment of any
of the above kits, the glycoconjugates from S. pneumoniae serotype
3 is conjugated to CRM.sub.197.
[0654] In an embodiment, the glycoconjugates of any of the above
kits are all individually conjugated to CRM.sub.197.
[0655] In another embodiment, the glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of any of
the above kits are individually conjugated to PD.
[0656] In an embodiment, the glycoconjugate from S. pneumoniae
serotype 18C of any of the above kits is conjugated to TT.
[0657] In an embodiment, the glycoconjugate from S. pneumoniae
serotype 19F of any of the above kits is conjugated to DT.
[0658] In an embodiment, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of any of the above
kits are individually conjugated to PD, the glycoconjugate from S.
pneumoniae serotype 18C is conjugated to TT and the glycoconjugate
from S. pneumoniae serotype 19F is conjugated to DT.
[0659] In an embodiment, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of any of the above
kits are individually conjugated to PD, the glycoconjugate from S.
pneumoniae serotype 18C is conjugated to TT, the glycoconjugate
from S. pneumoniae serotype 19F is conjugated to DT, the
glycoconjugate from S. pneumoniae serotype 22F is conjugated to
CRM.sub.197 and the glycoconjugate from S. pneumoniae serotype 33F
is conjugated to CRM.sub.197.
[0660] In an embodiment the above second immunogenic compositions
comprise from 7 to 15 different serotypes of S. pneumoniae. In one
embodiment the above second immunogenic compositions comprise
glycoconjugates from 7, 8, 9, 10, 11, 12, 13, 14 or 15 different
serotypes. In one embodiment the above second immunogenic
compositions comprise glycoconjugates from 10 to 15 different
serotypes. In an embodiment the above second immunogenic
composition is a 7, 8, 9, 10, 11, 12, 13, 14 or 15-valent
pneumococcal conjugate composition. In an embodiment the above
second immunogenic composition is a 10-valent pneumococcal
conjugate composition. In an embodiment the above second
immunogenic composition is an 11-valent pneumococcal conjugate
composition. In an embodiment the above second immunogenic
composition is a 12-valent pneumococcal conjugate composition. In
an embodiment the above second immunogenic composition is a
13-valent pneumococcal conjugate composition. In an embodiment the
above second immunogenic composition is a 14-valent pneumococcal
conjugate composition. In an embodiment the above second
immunogenic composition is a 15-valent pneumococcal conjugate
composition.
[0661] In an embodiment, the above second immunogenic composition
is a 7-valent pneumococcal conjugate composition wherein said 7
conjugates consists of 7 glycoconjugates from S. pneumoniae
serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated
to CRM.sub.197.
[0662] In an embodiment, the above second immunogenic composition
is a 10-valent pneumococcal conjugate composition wherein said 10
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT and
glycoconjugate from S. pneumoniae serotype 19F conjugated to
DT.
[0663] In an embodiment, the above second immunogenic composition
is an 11-valent pneumococcal conjugate composition wherein said 11
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT and
glycoconjugate from S. pneumoniae serotype 22F conjugated to
CRM.sub.197.
[0664] In an embodiment, the above second immunogenic composition
is an 11-valent pneumococcal conjugate composition wherein said 11
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT and
glycoconjugate from S. pneumoniae serotype 33F conjugated to
CRM.sub.197.
[0665] In an embodiment, the above second immunogenic composition
is a 12-valent pneumococcal conjugate composition wherein said 12
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT,
glycoconjugate from S. pneumoniae serotype 22F conjugated to
CRM.sub.197 and glycoconjugate from S. pneumoniae serotype 33F
conjugated to CRM.sub.197.
[0666] In an embodiment, the above second immunogenic composition
is a 13-valent pneumococcal conjugate composition wherein said 13
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F individually
conjugated to CRM.sub.197.
[0667] In an embodiment, the above second immunogenic composition
is a 14-valent pneumococcal conjugate composition wherein said 14
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 22F
individually conjugated to CRM.sub.197.
[0668] In an embodiment, the above second immunogenic composition
is a 14-valent pneumococcal conjugate composition wherein said 14
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 33F
individually conjugated to CRM.sub.197.
[0669] In an embodiment, the above second immunogenic composition
is a 15-valent pneumococcal conjugate composition wherein said 15
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F
individually conjugated to CRM.sub.197.
[0670] In an embodiment the dosage of above second immunogenic is
as disclosed at section 5 below.
[0671] In an embodiment the above second immunogenic compositions
further comprise antigens from other pathogens, particularly from
bacteria and/or viruses such as disclosed at section 6 below.
[0672] In an embodiment the above second immunogenic compositions
further comprise one or more adjuvants as disclosed at section 7
below.
[0673] In an embodiment the above second immunogenic compositions
are formulated as disclosed at section 8 below.
[0674] In an embodiment, the immunogenic compositions of the
invention (such as any of the ones of section 2 above) are used in
combination with PREVNAR.RTM. (PREVENAR.RTM. in some countries)
(heptavalent vaccine), SYNFLORIX.RTM. (a decavalent vaccine) and/or
PREVNAR 13.RTM. (PREVENAR 13.RTM. in some countries) (tridecavalent
vaccine).
[0675] In an aspect of the present invention, the kit takes the
form of two containers. Therefore, in one embodiment of the present
invention each of the immunogenic compositions of the kit (i.e.,
the first immunogenic composition and the second immunogenic
composition) is comprised in a separate container.
[0676] In one embodiment, the first immunogenic composition of the
kit (part (a) of the kit) is comprised in a container selected from
the group consisting of a vial, a syringe, a flask, a fermentor, a
bioreactor, a bag, a jar, an ampoule, a cartridge and a disposable
pen. In certain embodiments, the container is siliconized.
[0677] In one embodiment, the second immunogenic composition of the
kit (part (b) of the kit) is comprised in a container selected from
the group consisting of a vial, a syringe, a flask, a fermentor, a
bioreactor, a bag, a jar, an ampoule, a cartridge and a disposable
pen. In certain embodiments, the container is siliconized.
[0678] In an embodiment, the container is made of glass, metals
(e.g., steel, stainless steel, aluminum, etc.) and/or polymers
(e.g., thermoplastics, elastomers, thermoplastic-elastomers). In an
embodiment, the container is made of glass.
[0679] In one embodiment, the first and second immunogenic
compositions of the kit are comprised in a syringe or a disposable
pen. In one embodiment, the first and second immunogenic
compositions of the kit are comprised in a syringe. In certain
embodiments, the syringes are siliconized. In certain embodiments,
the siliconized syringes are made of glass.
[0680] In an embodiment, the first and second immunogenic
compositions of the kit are mixed extemporaneously for simultaneous
administration.
[0681] In an embodiment, the first and second immunogenic
compositions are in liquid form, preferably contained in two
containers. In one embodiment, the first and second containers are
separate chambers in a dual-chamber syringe such that, when
actuated, liquid in the first container is introduced into the
second container. The resulting mixture can then exit the syringe.
The two immunogenic compositions are kept separate until ready for
mixing.
[0682] In an embodiment, the first and/or second immunogenic
composition of the kit is/are in lyophilized form.
[0683] In an embodiment, the first immunogenic composition of the
kit is in lyophilized form and the second immunogenic composition
is in liquid form. In another embodiment, the second immunogenic
composition of the kit is in lyophilized form and the first
immunogenic composition is in liquid form. In said embodiments, the
lyophilised immunogenic composition can be reconstituted
extemporaneously with the liquid immunogenic composition for
simultaneous administration of both immunogenic compositions.
[0684] In said embodiments, the kit contains two containers, one
container includes liquid material for reconstitution and the
second container includes lyophilised material. In one embodiment
the second container is hermetically sealed. In an embodiment, the
liquid material is introduced into the second container via a first
needle, thereby reconstituting the lyophilised material into a
liquid form. The resulting mixture is then withdrawn, into a
container (such as a syringe), for administration to a patient. In
one embodiment the withdrawal step is via the first needle. In
another embodiment, the withdrawal step is via a second needle. In
an embodiment, the needle used for the withdrawal step is the same
needle that is used for patient injection. In another embodiment,
the needle used for the withdrawal step is different from the
needle used for patient injection.
[0685] In one embodiment, the second container is a vial. In a
further embodiment the first and second containers are separate
chambers in a dual-chamber syringe such that, when actuated, the
liquid material is introduced from the first container into the
second container. The resulting mixture exits the syringe in liquid
form. In a preferred embodiment, the lyophilised and liquid
materials are kept separate until ready for mixing.
[0686] In an embodiment, the kit comprises a ready-filled syringe
and a vial. In one embodiment the syringe comprises a single dose
of the first immunogenic composition and the vial comprises a
single dose of the second immunogenic composition. In an embodiment
the syringe comprises a single dose of the second immunogenic
composition and the vial comprises a single dose of the first
immunogenic composition. In another embodiment, the syringe and the
vial comprise multiple doses.
5. DOSAGE OF THE IMMUNOGENIC COMPOSITIONS
[0687] The amount of glycoconjugate(s) in each dose is selected as
an amount which induces an immunoprotective response without
significant, adverse side effects in typical vaccines. Such amount
will vary depending upon which specific immunogen is employed and
how it is presented.
[0688] 5.1 Glycoconjugate Amount
[0689] The amount of a particular glycoconjugate in an immunogenic
composition can be calculated based on total polysaccharide for
that conjugate (conjugated and non-conjugated). For example, a
glycoconjugate with 20% free polysaccharide has about 80 .mu.g of
conjugated polysaccharide and about 20 .mu.g of nonconjugated
polysaccharide in a 100 .mu.g polysaccharide dose. The amount of
glycoconjugate can vary depending upon the pneumococcal serotype.
The saccharide concentration can be determined by the uronic acid
assay.
[0690] The "immunogenic amount" of the different polysaccharide
components in the immunogenic composition, may diverge and each may
comprise about 1 .mu.g, about 2 .mu.g, about 3 .mu.g, about 4
.mu.g, about 5 .mu.g, about 6 .mu.g, about 7 .mu.g, about 8 .mu.g,
about 9 .mu.g, about 10 .mu.g, about 15 .mu.g, about 20 .mu.g,
about 30 .mu.g, about 40 .mu.g, about 50 .mu.g, about 60 .mu.g,
about 70 .mu.g, about 80 .mu.g, about 90 .mu.g, or about 100 .mu.g
of any particular polysaccharide antigen.
[0691] Generally, each dose comprises 0.1 .mu.g to 100 .mu.g of
polysaccharide for a given serotype, particularly 0.5 .mu.g to 20
.mu.g, more particularly 1.0 .mu.g to 10 .mu.g, and even more more
particularly 2.0 .mu.g to 5.0 .mu.g. Any whole number integer
within any of the above ranges is contemplated as an embodiment of
the disclosure.
[0692] In an embodiment, each dose comprises about 1.0 .mu.g, about
1.2 .mu.g, about 1.4 .mu.g, about 1.6 .mu.g, about 1.8 .mu.g, about
2.0 .mu.g, about 2.2 .mu.g, about 2.4 .mu.g, about 2.6 .mu.g, about
2.8 .mu.g, about 3.0 .mu.g, about 3.2 .mu.g, about 3.4 .mu.g, about
3.6 .mu.g, about 3.8 .mu.g, about 4.0 .mu.g, about 4.2 .mu.g, about
4.4 .mu.g, about 4.6 .mu.g, about 4.8 .mu.g, about 5.0 .mu.g, about
5.2 .mu.g, about 5.4 .mu.g, about 5.6 .mu.g, about 5.8 .mu.g or
about 6.0 .mu.g of polysaccharide for each particular
glycoconjugate.
[0693] In an embodiment, each dose comprises about 1.1 .mu.g, about
1.2 .mu.g, about 1.3 .mu.g, about 1.4 .mu.g, about 1.5 .mu.g, about
1.6 .mu.g, about 1.7 .mu.g, about 1.8 .mu.g, about 1.9 .mu.g, about
2.0 .mu.g, about 2.1 .mu.g, about 2.2 .mu.g, about 2.3 .mu.g, about
2.4 .mu.g, about 2.5 .mu.g, about 2.6 .mu.g, about 2.7 .mu.g, about
2.8 .mu.g, about 2.9 .mu.g, or about 3.0 .mu.g .mu.g of
polysaccharide for glycoconjugates from S. pneumoniae serotype 1,
3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F,
23F and/or 33F.
[0694] In an embodiment, each dose will comprise about 1.1 .mu.g,
about 1.2 .mu.g, about 1.3 .mu.g, about 1.4 .mu.g, about 1.5 .mu.g,
about 1.6 .mu.g, about 1.7 .mu.g, about 1.8 .mu.g, about 1.9 .mu.g,
about 2.0 .mu.g, about 2.1 .mu.g, about 2.2 .mu.g, about 2.3 .mu.g,
about 2.4 .mu.g, about 2.5 .mu.g, about 2.6 .mu.g, about 2.7 .mu.g,
about 2.8 .mu.g, about 2.9 .mu.g, or about 3.0 .mu.g .mu.g of
polysaccharide for glycoconjugates from S. pneumoniae serotype 8,
10A, 11A, 12F, 15B, 22F and 33F.
[0695] In an embodiment, each dose comprises about 2.0 .mu.g, about
2.2 .mu.g, about 2.4 .mu.g, about 2.6 .mu.g, about 2.8 .mu.g, about
3.0 .mu.g, about 3.2 .mu.g, about 3.4 .mu.g, about 3.6 .mu.g, about
3.8 .mu.g, about 4.0 .mu.g, about 4.2 .mu.g, about 4.4 .mu.g, about
4.6 .mu.g, about 4.8 .mu.g, about 5.0, about 5.2 .mu.g, about 5.4
.mu.g, about 5.6 .mu.g, about 5.8 .mu.g or about 6.0 .mu.g of
polysaccharide for glycoconjugates from S. pneumoniae serotype
6B.
[0696] In an embodiment, each dose comprise about 1.5 .mu.g to
about 3.0 .mu.g of polysaccharide for each glycoconjugate from S.
pneumoniae serotype 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14,
15B, 18C, 19A, 19F, 22F, 23F and/or 33F, and about 3.0 .mu.g to
about 6.0 .mu.g of polysaccharide for glycoconjugate from S.
pneumoniae serotype 6B.
[0697] In an embodiment, each dose comprises about 2.0 .mu.g to
about 2.5 .mu.g of polysaccharide for each glycoconjugate from S.
pneumoniae serotype 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14,
15B, 18C, 19A, 19F, 22F, 23F and/or 33F, and about 4.0 .mu.g to
about 4.8 .mu.g of polysaccharide for glycoconjugate from S.
pneumoniae serotype 6B.
[0698] In an embodiment, each dose comprises about 2.2 .mu.g of
polysaccharide from each glycoconjugate from S. pneumoniae serotype
1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F,
22F, 23F and/or 33F, and about 4.4 .mu.g of polysaccharide for
glycoconjugate from S. pneumoniae serotype 6B.
[0699] In an embodiment, each dose comprises about 1.5 .mu.g to
about 3.0 .mu.g of polysaccharide for each glycoconjugate from S.
pneumoniae serotype 8, 10A, 11A, 12F, 15B, 22F and 33F
[0700] In an embodiment, each dose comprises about 2.0 .mu.g to
about 2.5 .mu.g of polysaccharide for each glycoconjugate from S.
pneumoniae serotype 8, 10A, 11A, 12F, 15B, 22F and 33F.
[0701] In an embodiment, each dose comprises about 2.2 .mu.g of
polysaccharide from each glycoconjugate from S. pneumoniae serotype
8, 10A, 11A, 12F, 15B, 22F and 33F.
[0702] 5.2 Carrier Amount
[0703] Generally, each dose of an immunogenic composition of the
invention comprises 1 .mu.g to 150 .mu.g of carrier protein,
particularly 10 .mu.g to 100 .mu.g of carrier protein, more
particularly 15 .mu.g to 50 .mu.g of carrier protein, and even more
particularly 16 .mu.g to 40 .mu.g of carrier protein. In an
embodiment, said carrier protein is CRM.sub.197.
[0704] In an embodiment, each dose comprises about 1 .mu.g, about 2
.mu.g, about 3 .mu.g, about 4 .mu.g, about 5 .mu.g, about 6 .mu.g,
about 7 .mu.g, about 8 .mu.g, about 9 .mu.g, about 10 .mu.g, about
11 .mu.g, about 12 .mu.g, about 13 .mu.g, about 14 .mu.g, about 15
.mu.g, about 16 .mu.g, about 17 .mu.g, about 18 .mu.g, about 19
.mu.g, about 20 .mu.g, about 21 .mu.g, about 22 .mu.g, about 23
.mu.g, about 24 .mu.g, about 25 .mu.g, about 26 .mu.g, about 27
.mu.g, about 28 .mu.g, about 29 .mu.g, about 30 .mu.g, about 31
.mu.g, about 32 .mu.g, about 33 .mu.g, about 34 .mu.g, about 35
.mu.g, about 36 .mu.g, about 37 .mu.g, about 38 .mu.g, about 39
.mu.g, about 40 .mu.g, about 41 .mu.g, about 42 .mu.g, about 43
.mu.g, about 44 .mu.g, about 45 .mu.g, about 46 .mu.g, about 47
.mu.g, about 48 .mu.g, about 49 .mu.g, about 50 .mu.g, about 51
.mu.g, about 52 .mu.g, about 53 .mu.g, about 54 .mu.g, about 55
.mu.g, about 56 .mu.g, about 57 .mu.g, about 58 .mu.g, about 59
.mu.g, about 60 .mu.g, about 61 .mu.g, about 62 .mu.g, about 63
.mu.g, about 64 .mu.g, about 65 .mu.g, about 66 .mu.g, about 67
.mu.g, about 68 .mu.g, about 69 .mu.g, about 70 .mu.g, about 71
.mu.g, about 72 .mu.g, about 73 .mu.g, about 74 .mu.g or about 75
.mu.g of carrier protein. In an embodiment, said carrier protein is
CRM.sub.197.
[0705] In an embodiment, each dose comprises about about 10 .mu.g,
about 11 .mu.g, about 12 .mu.g, about 13 .mu.g, about 14 .mu.g,
about 15 .mu.g, about 16 .mu.g, about 17 .mu.g, about 18 .mu.g,
about 19 .mu.g, about 20 .mu.g, about 21 .mu.g, about 22 .mu.g,
about 23 .mu.g, about 24 .mu.g, about 25 .mu.g, about 26 .mu.g,
about 27 .mu.g, about 28 .mu.g, about 29 .mu.g, or about 30 .mu.g
of carrier protein. In an embodiment, said carrier protein is
CRM.sub.197.
6. FURTHER ANTIGENS
[0706] Immunogenic compositions disclosed herein comprise
conjugated S. pneumoniae saccharide antigen(s) (glycoconjugate(s)).
They may also further include at least one antigen from other
pathogens, particularly from bacteria and/or viruses.
[0707] In an embodiment, the immunogenic composition disclosed
herein further comprises at least one antigen selected from the
group consisting of a diphtheria toxoid (D), a tetanus toxoid (T),
a pertussis antigen (P), an acellular pertussis antigen (Pa), a
hepatitis B virus (HBV) surface antigen (HBsAg), a hepatitis A
virus (HAV) antigen, a conjugated Haemophilus influenzae type b
capsular saccharide (Hib), and inactivated poliovirus vaccine
(IPV).
[0708] In an embodiment, the immunogenic compositions disclosed
herein comprise D-T-Pa. In an embodiment, the immunogenic
compositions disclosed herein comprise D-T-Pa-Hib, D-T-Pa-IPV or
D-T-Pa-HBsAg. In an embodiment, the immunogenic compositions
disclosed herein comprise D-T-Pa-HBsAg-IPV or D-T-Pa-HBsAg-Hib. In
an embodiment, the immunogenic compositions disclosed herein
comprise D-T-Pa-HBsAg-IPV-Hib.
[0709] Pertussis antigens: Bordetella pertussis causes whooping
cough. Pertussis antigens in vaccines are either cellular (whole
cell, in the form of inactivated B. pertussis cells) or acellular.
Preparation of cellular pertussis antigens is well documented
(e.g., it may be obtained by heat inactivation of phase I culture
of B. pertussis). Preferably, however, the invention uses acellular
antigens. Where acellular antigens are used, it is preferred to use
one, two or (preferably) three of the following antigens: (1)
detoxified pertussis toxin (pertussis toxoid, or PT); (2)
filamentous hemagglutinin (FHA); (3) pertactin (also known as the
69 kiloDalton outer membrane protein). FHA and pertactin may be
treated with formaldehyde prior to use according to the invention.
PT is preferably detoxified by treatment with formaldehyde and/or
glutaraldehyde. Acellular pertussis antigens are preferably
adsorbed onto one or more aluminum salt adjuvants. As an
alternative, they may be added in an unadsorbed state. Where
pertactin is added, it is preferably already adsorbed onto an
aluminum hydroxide adjuvant. PT and FHA may be adsorbed onto an
aluminum hydroxide adjuvant or an aluminum phosphate. Adsorption of
all of PT, FHA and pertactin to aluminum hydroxide is most
preferred.
[0710] Inactivated poliovirus vaccine: Poliovirus causes
poliomyelitis. Rather than use oral poliovirus vaccine, preferred
embodiments of the invention use IPV. Prior to administration to
patients, polioviruses must be inactivated, and this can be
achieved by treatment with formaldehyde. Poliomyelitis can be
caused by one of three types of poliovirus. The three types are
similar and cause identical symptoms, but they are antigenically
different and infection by one type does not protect against
infection by others. It is therefore preferred to use three
poliovirus antigens in the invention: poliovirus Type 1 (e.g.,
Mahoney strain), poliovirus Type 2 (e.g., MEF-1 strain), and
poliovirus Type 3 (e.g., Saukett strain). The viruses are
preferably grown, purified and inactivated individually, and are
then combined to give a bulk trivalent mixture for use with the
invention.
[0711] Diphtheria toxoid: Corynebacterium diphtheriae causes
diphtheria. Diphtheria toxin can be treated (e.g., using formalin
or formaldehyde) to remove toxicity while retaining the ability to
induce specific anti-toxin antibodies after injection. These
diphtheria toxoids are used in diphtheria vaccines. Preferred
diphtheria toxoids are those prepared by formaldehyde treatment.
The diphtheria toxoid can be obtained by growing C. diphtheriae in
growth medium, followed by formaldehyde treatment, ultrafiltration
and precipitation. The toxoided material may then be treated by a
process comprising sterile filtration and/or dialysis. The
diphtheria toxoid is preferably adsorbed onto an aluminum hydroxide
adjuvant.
[0712] Tetanus toxoid: Clostridium tetani causes tetanus. Tetanus
toxin can be treated to give a protective toxoid. The toxoids are
used in tetanus vaccines. Preferred tetanus toxoids are those
prepared by formaldehyde treatment. The tetanus toxoid can be
obtained by growing C. tetani in growth medium, followed by
formaldehyde treatment, ultrafiltration and precipitation. The
material may then be treated by a process comprising sterile
filtration and/or dialysis.
[0713] Hepatitis A virus antigens: Hepatitis A virus (HAV) is one
of the known agents which causes viral hepatitis. A preferred HAV
component is based on inactivated virus, and inactivation can be
achieved by formalin treatment.
[0714] Hepatitis B virus (HBV) is one of the known agents which
causes viral hepatitis. The major component of the capsid is a
protein known as HBV surface antigen or, more commonly, HBsAg,
which is typically a 226-amino acid polypeptide with a molecular
weight of -24 kDa. All existing hepatitis B vaccines contain HBsAg,
and when this antigen is administered to a normal vaccinee, it
stimulates the production of anti-HBsAg antibodies which protect
against HBV infection.
[0715] For vaccine manufacture, HBsAg has been made in two ways:
purification of the antigen in particulate form from the plasma of
chronic hepatitis B carriers or expression of the protein by
recombinant DNA methods (e.g., recombinant expression in yeast
cells).
[0716] Unlike native HBsAg (i.e., as in the plasma-purified
product), yeast-expressed HBsAg is generally non-glycosylated, and
this is the most preferred form of HBsAg for use with the
invention.
[0717] Conjugated Haemophilus influenzae type b antigens:
Haemophilus influenzae type b (Hib) causes bacterial meningitis.
Hib vaccines are typically based on the capsular saccharide
antigen, the preparation of which is well documented. The Hib
saccharide can be conjugated to a carrier protein in order to
enhance its immunogenicity, especially in children. Typical carrier
proteins are tetanus toxoid, diphtheria toxoid, CRM.sub.197, H.
influenzae protein D, and an outer membrane protein complex from
serogroup B meningococcus. The saccharide moiety of the conjugate
may comprise full-length polyribosylribitol phosphate (PRP) as
prepared from Hib bacteria, and/or fragments of full-length PRP.
Hib conjugates may or may not be adsorbed to an aluminum salt
adjuvant.
[0718] In an embodiment the immunogenic compositions disclosed
herein further include a conjugated N. meningitidis serogroup Y
capsular saccharide (MenY), and/or a conjugated N. meningitidis
serogroup C capsular saccharide (MenC).
[0719] In an embodiment the immunogenic compositions disclosed
herein further include a conjugated N. meningitidis serogroup A
capsular saccharide (MenA), a conjugated N. meningitidis serogroup
W135 capsular saccharide (MenW135), a conjugated N. meningitidis
serogroup Y capsular saccharide (MenY), and/or a conjugated N.
meningitidis serogroup C capsular saccharide (MenC).
[0720] In an embodiment the immunogenic compositions disclosed
herein further include a conjugated N. meningitidis serogroup W135
capsular saccharide (MenW135), a conjugated N. meningitidis
serogroup Y capsular saccharide (MenY), and/or a conjugated N.
meningitidis serogroup C capsular saccharide (MenC).
[0721] An aspect of the invention provides a kit as defined at
section 4 above wherein any of the above further antigen(s) is part
of the first immunogenic composition (part (a) of the kit). An
aspect of the invention provides a kit as defined at section 4
above wherein any of the above further antigen(s) is part of the
second immunogenic composition (part (b) of the kit).
[0722] An aspect of the invention provides a kit as defined at
section 4 above wherein any of the above further antigen(s) is part
of the first immunogenic composition (part (a) of the kit) and any
of the above further antigen(s) is part of the second immunogenic
composition (part (b) of the kit).
7. ADJUVANT(S)
[0723] In some embodiments, the immunogenic compositions disclosed
herein may further comprise at least one, two or three adjuvants.
The term "adjuvant" refers to a compound or mixture that enhances
the immune response to an antigen. Antigens may act primarily as a
delivery system, primarily as an immune modulator or have strong
features of both. Suitable adjuvants include those suitable for use
in mammals, including humans.
[0724] Examples of known suitable delivery-system type adjuvants
that can be used in humans include, but are not limited to, alum
(e.g., aluminum phosphate, aluminum sulfate or aluminum hydroxide),
calcium phosphate, liposomes, oil-in-water emulsions such as MF59
(4.3% w/v squalene, 0.5% w/v polysorbate 80 (TWEEN.RTM. 80), 0.5%
w/v sorbitan trioleate (Span 85)), water-in-oil emulsions such as
MONTANIDE.TM., and poly(D,L-lactide-co-glycolide) (PLG)
microparticles or nanoparticles.
[0725] In an embodiment, the immunogenic compositions disclosed
herein comprise aluminum salts (alum) as adjuvant (e.g., aluminum
phosphate, aluminum sulfate or aluminum hydroxide). In a preferred
embodiment, the immunogenic compositions disclosed herein comprise
aluminum phosphate or aluminum hydroxide as adjuvant. In an
embodiment, the immunogenic compositions disclosed herein comprise
from 0.1 mg/mL to 1 mg/mL or from 0.2 mg/mL to 0.3 mg/mL of
elemental aluminum in the form of aluminum phosphate. In an
embodiment, the immunogenic compositions disclosed herein comprise
about 0.25 mg/mL of elemental aluminum in the form of aluminum
phosphate.
[0726] Examples of known suitable immune modulatory type adjuvants
that can be used in humans include, but are not limited to, saponin
extracts from the bark of the Aquilla tree (QS21, QUILA.RTM.), TLR4
agonists such as MPL (Monophosphoryl Lipid A), 3DMPL
(3-O-deacylated MPL) or GLA-AQ, LT/CT mutants, cytokines such as
the various interleukins (e.g., IL-2, IL-12) or GM-CSF, and the
like.
[0727] Examples of known suitable immune modulatory type adjuvants
with both delivery and immune modulatory features that can be used
in humans include, but are not limited to, ISCOMS (see, e.g.,
Sjolander et al. (1998) J. Leukocyte Biol. 64:713; WO 90/03184, WO
96/11711, WO 00/48630, WO 98/36772, WO 00/41720, WO 2006/134423 and
WO 2007/026190) or GLA-EM which is a combination of a TLR4 agonist
and an oil-in-water emulsion.
[0728] For veterinary applications including but not limited to
animal experimentation, one can use Complete Freund's Adjuvant
(CFA), Freund's Incomplete Adjuvant (IFA), EMULSIGEN.RTM.,
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP),
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred
to as nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dip-
almitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A,
referred to as MTP-PE), and RIBI.TM., which contains three
components extracted from bacteria, monophosphoryl lipid A,
trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2%
squalene/TWEEN.RTM. 80 emulsion.
[0729] Further exemplary adjuvants to enhance effectiveness of the
pneumococcal vaccines as disclosed herein include, but are not
limited to: (1) oil-in-water emulsion formulations (with or without
other specific immunostimulating agents such as muramyl peptides
(see below) or bacterial cell wall components), such as for example
(a) SAF, containing 10% Squalane, 0.4% TWEEN.RTM. 80, 5%
pluronic-blocked polymer L121, and thr-MDP either microfluidized
into a submicron emulsion or vortexed to generate a larger particle
size emulsion, and (b) RIBI.TM. adjuvant system (RAS), (Ribi
Immunochem, Hamilton, Mont.) containing 2% Squalene, 0.2%
TWEEN.RTM. 80, and one or more bacterial cell wall components such
as monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell
wall skeleton (CWS), preferably MPL+CWS (DETOX.TM.); (2) saponin
adjuvants, such as QS21, STIMULON.TM. (Cambridge Bioscience,
Worcester, Mass.), ABISCO.RTM. (Isconova, Sweden), or
ISCOMATRIX.RTM. (Commonwealth Serum Laboratories, Australia), may
be used or particles generated therefrom such as ISCOMs
(immunostimulating complexes), which ISCOMS may be devoid of
additional detergent (e.g., WO 00/07621); (3) Complete Freund's
Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA); (4)
cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5,
IL-6, IL-7, IL-12 (e.g., WO 99/44636)), interferons (e.g., gamma
interferon), macrophage colony stimulating factor (M-CSF), tumor
necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or
3-O-deacylated MPL (3dMPL) (see, e.g., GB-2220221, EP0689454),
optionally in the substantial absence of alum when used with
pneumococcal saccharides (see, e.g., WO 00/56358); (6) combinations
of 3dMPL with, for example, QS21 and/or oil-in-water emulsions
(see, e.g., EP0835318, EP0735898, EP0761231); (7) a polyoxyethylene
ether or a polyoxyethylene ester (see, e.g., WO 99/52549); (8) a
polyoxyethylene sorbitan ester surfactant in combination with an
octoxynol (e.g., WO 01/21207) or a polyoxyethylene alkyl ether or
ester surfactant in combination with at least one additional
non-ionic surfactant such as an octoxynol (e.g., WO 01/21152); (9)
a saponin and an immunostimulatory oligonucleotide (e.g., a CpG
oligonucleotide) (e.g., WO 00/62800); (10) an immunostimulant and a
particle of metal salt (see, e.g., WO 00/23105); (11) a saponin and
an oil-in-water emulsion (e.g., WO 99/11241); (12) a saponin (e.g.,
QS21)+3dMPL+IM2 (optionally+a sterol) (e.g., WO 98/57659); (13)
other substances that act as immunostimulating agents to enhance
the efficacy of the composition. Muramyl peptides include
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25
acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutarninyl-L-alanine-2-(1'-2'-dipalmitoyl--
sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), etc.
[0730] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise a CpG Oligonucleotide as
adjuvant. A CpG oligonucleotide as used herein refers to an
immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and
accordingly these terms are used interchangeably unless otherwise
indicated. Immunostimulatory CpG oligodeoxynucleotides contain one
or more immunostimulatory CpG motifs that are unmethylated
cytosine-guanine dinucleotides, optionally within certain preferred
base contexts. The methylation status of the CpG immunostimulatory
motif generally refers to the cytosine residue in the dinucleotide.
An immunostimulatory oligonucleotide containing at least one
unmethylated CpG dinucleotide is an oligonucleotide which contains
a 5' unmethylated cytosine linked by a phosphate bond to a 3'
guanine, and which activates the immune system through binding to
Toll-like receptor 9 (TLR-9). In another embodiment the
immunostimulatory oligonucleotide may contain one or more
methylated CpG dinucleotides, which will activate the immune system
through TLR9 but not as strongly as if the CpG motif(s) was/were
unmethylated. CpG immunostimulatory oligonucleotides may comprise
one or more palindromes that in turn may encompass the CpG
dinucleotide. CpG oligonucleotides have been described in a number
of issued patents, published patent applications, and other
publications, including U.S. Pat. Nos. 6,194,388; 6,207,646;
6,214,806; 6,218,371; 6,239,116; and 6,339,068.
[0731] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise any of the CpG
Oligonucleotide described at page 3, line 22, to page 12, line 36,
of WO 2010/125480.
[0732] Different classes of CpG immunostimulatory oligonucleotides
have been identified. These are referred to as A, B, C and P class,
and are described in greater detail at page 3, line 22, to page 12,
line 36, of WO 2010/125480. Methods of the invention embrace the
use of these different classes of CpG immunostimulatory
oligonucleotides.
[0733] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise an A class CpG
oligonucleotide. Preferably, the "A class" CpG oligonucleotide of
the invention has the following nucleic acid sequence: 5'
GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples
of A-Class oligonucleotides include: 5'
G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO: 2);
wherein "*" refers to a phosphorothioate bond and "_" refers to a
phosphodiester bond.
[0734] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise a B class CpG
Oligonucleotide. In one embodiment, the CpG oligonucleotide for use
in the present invention is a B class CpG oligonucleotide
represented by at least the formula:
[0735] 5' X.sub.1X.sub.2CGX.sub.3X.sub.4 3', wherein X1, X2, X3,
and X4 are nucleotides. In one embodiment, X.sub.2 is adenine,
guanine, or thymine. In another embodiment, X.sub.3 is cytosine,
adenine, or thymine.
[0736] The B class CpG oligonucleotide sequences of the invention
are those broadly described above as well as disclosed in WO
96/02555, WO 98/18810 and U.S. Pat. Nos. 6,194,388; 6,207,646;
6,214,806; 6,218,371; 6,239,116 and 6,339,068. Exemplary sequences
include but are not limited to those disclosed in these latter
applications and patents.
[0737] In an embodiment, the "B class" CpG oligonucleotide of the
invention has the following nucleic acid sequence:
TABLE-US-00001 (SEQ ID NO: 3) 5' TCGTCGTTTTTCGGTGCTTTT 3', or (SEQ
ID NO: 4) 5' TCGTCGTTTTTCGGTCGTTTT 3', or (SEQ ID NO: 5) 5'
TCGTCGTTTTGTCGTTTTGTCGTT 3', or (SEQ ID NO: 6) 5'
TCGTCGTTTCGTCGTTTTGTCGTT 3', or (SEQ ID NO: 7) 5'
TCGTCGTTTTGTCGTTTTTTTCGA 3'.
[0738] In any of these sequences, all of the linkages may be all
phosphorothioate bonds. In another embodiment, in any of these
sequences, one or more of the linkages may be phosphodiester,
preferably between the "C" and the "G" of the CpG motif making a
semi-soft CpG oligonucleotide. In any of these sequences, an
ethyl-uridine or a halogen may substitute for the 5' T; examples of
halogen substitutions include but are not limited to bromo-uridine
or iodo-uridine substitutions.
[0739] Some non-limiting examples of B-Class oligonucleotides
include:
TABLE-US-00002 (SEQ ID NO: 8) 5'
T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3', or (SEQ ID NO: 9) 5'
T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3', or (SEQ ID NO: 10) 5'
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3', or (SEQ ID NO:
11) 5' T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3', or (SEQ
ID NO: 12) 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A
3'.
[0740] wherein "*" refers to a phosphorothioate bond.
[0741] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise a C class CpG
Oligonucleotide. In an embodiment, the "C class" CpG
oligonucleotides of the invention have the following nucleic acid
sequence:
TABLE-US-00003 (SEQ ID NO: 13) 5' TCGCGTCGTTCGGCGCGCGCCG 3', or
(SEQ ID NO: 14) 5' TCGTCGACGTTCGGCGCGCGCCG 3', or (SEQ ID NO: 15)
5' TCGGACGTTCGGCGCGCGCCG 3', or (SEQ ID NO: 16) 5'
TCGGACGTTCGGCGCGCCG 3', or (SEQ ID NO: 17) 5' TCGCGTCGTTCGGCGCGCCG
3', or (SEQ ID NO: 18) 5' TCGACGTTCGGCGCGCGCCG 3', or (SEQ ID NO:
19) 5' TCGACGTTCGGCGCGCCG 3', or (SEQ ID NO: 20) 5'
TCGCGTCGTTCGGCGCCG 3', or (SEQ ID NO: 21) 5' TCGCGACGTTCGGCGCGCGCCG
3', or (SEQ ID NO: 22) 5' TCGTCGTTTTCGGCGCGCGCCG 3', or (SEQ ID NO:
23) 5' TCGTCGTTTTCGGCGGCCGCCG 3', or (SEQ ID NO: 24) 5'
TCGTCGTTTTACGGCGCCGTGCCG 3', or (SEQ ID NO: 25) 5'
TCGTCGTTTTCGGCGCGCGCCGT 3'.
[0742] In any of these sequences, all of the linkages may be all
phosphorothioate bonds. In another embodiment, in any of these
sequences, one or more of the linkages may be phosphodiester,
preferably between the "C" and the "G" of the CpG motif making a
semi-soft CpG oligonucleotide.
[0743] Some non-limiting examples of C-Class oligonucleotides
include:
TABLE-US-00004 (SEQ ID NO: 26) 5'
T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO: 27)
5' T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO:
28) 5' T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO:
29) 5' T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3', or (SEQ ID NO: 30)
5' T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3', or (SEQ ID NO: 31)
5' T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO: 32)
5' T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3', or (SEQ ID NO: 33) 5'
T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G 3', or (SEQ ID NO: 34) 5'
T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO: 35)
5' T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G 3', or (SEQ ID NO:
36) 5' T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G 3', or (SEQ ID
NO: 37) 5' T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G 3', or
(SEQ ID NO: 38) 5' T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T
3'
[0744] wherein "*" refers to a phosphorothioate bond and "_" refers
to a phosphodiester bond. In any of these sequences, an
ethyl-uridine or a halogen may substitute for the 5' T; examples of
halogen substitutions include but are not limited to bromo-uridine
or iodo-uridine substitutions.
[0745] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise a P class CpG
Oligonucleotide. In an embodiment, the CpG oligonucleotide for use
in the present invention is a P class CpG oligonucleotide
containing a 5' TLR activation domain and at least two palindromic
regions, one palindromic region being a 5' palindromic region of at
least 6 nucleotides in length and connected to a 3' palindromic
region of at least 8 nucleotides in length either directly or
through a spacer, wherein the oligonucleotide includes at least one
YpR dinucleotide. In an embodiment, said oligonucleotide is not
T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G (SEQ ID NO: 27). In
one embodiment the P class CpG oligonucleotide includes at least
one unmethylated CpG dinucleotide. In another embodiment the TLR
activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG,
UUCG, UUUCG, TTT, or TTTT. In yet another embodiment the TLR
activation domain is within the 5' palindromic region. In another
embodiment the TLR activation domain is immediately 5' to the 5'
palindromic region. In an embodiment, the "P class" CpG
oligonucleotides of the invention have the following nucleic acid
sequence:
TABLE-US-00005 (SEQ ID NO: 39) 5' TCGTCGACGATCGGCGCGCGCCG 3'.
[0746] In said sequences, all of the linkages may be all
phosphorothioate bonds. In another embodiment, one or more of the
linkages may be phosphodiester, preferably between the "C" and the
"G" of the CpG motif making a semi-soft CpG oligonucleotide. In any
of these sequences, an ethyl-uridine or a halogen may substitute
for the 5' T; examples of halogen substitutions include but are not
limited to bromo-uridine or iodo-uridine substitutions.
[0747] A non-limiting example of P-Class oligonucleotides
include:
TABLE-US-00006 (SEQ ID NO: 40) 5'
T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G* C*C*G 3'
[0748] wherein "*" refers to a phosphorothioate bond and "_" refers
to a phosphodiester bond.
[0749] In one embodiment the oligonucleotide includes at least one
phosphorothioate linkage. In another embodiment all internucleotide
linkages of the oligonucleotide are phosphorothioate linkages. In
another embodiment the oligonucleotide includes at least one
phosphodiester-like linkage. In another embodiment the
phosphodiester-like linkage is a phosphodiester linkage. In another
embodiment a lipophilic group is conjugated to the oligonucleotide.
In one embodiment the lipophilic group is cholesterol.
[0750] In an embodiment, all the internucleotide linkages of the
CpG oligonucleotides disclosed herein are phosphodiester bonds
("soft" oligonucleotides, as described in WO 2007/026190). In
another embodiment, CpG oligonucleotides of the invention are
rendered resistant to degradation (e.g., are stabilized). A
"stabilized oligonucleotide" refers to an oligonucleotide that is
relatively resistant to in vivo degradation (e.g., via an exo- or
endo-nuclease). Nucleic acid stabilization can be accomplished via
backbone modifications. Oligonucleotides having phosphorothioate
linkages provide maximal activity and protect the oligonucleotide
from degradation by intracellular exo- and endo-nucleases.
[0751] The immunostimulatory oligonucleotides may have a chimeric
backbone, which have combinations of phosphodiester and
phosphorothioate linkages. For purposes of the instant invention, a
chimeric backbone refers to a partially stabilized backbone,
wherein at least one internucleotide linkage is phosphodiester or
phosphodiester-like, and wherein at least one other internucleotide
linkage is a stabilized internucleotide linkage, wherein the at
least one phosphodiester or phosphodiester-like linkage and the at
least one stabilized linkage are different. When the phosphodiester
linkage is preferentially located within the CpG motif such
molecules are called "semi-soft" as described in WO
2007/026190.
[0752] Other modified oligonucleotides include combinations of
phosphodiester, phosphorothioate, methylphosphonate,
methylphosphorothioate, phosphorodithioate, and/or p-ethoxy
linkages.
[0753] Mixed backbone modified ODN may be synthesized as described
in WO 2007/026190. The size of the CpG oligonucleotide (i.e., the
number of nucleotide residues along the length of the
oligonucleotide) also may contribute to the stimulatory activity of
the oligonucleotide. For facilitating uptake into cells, CpG
oligonucleotide of the invention preferably have a minimum length
of 6 nucleotide residues. Oligonucleotides of any size greater than
6 nucleotides (even many kb long) are capable of inducing an immune
response if sufficient immunostimulatory motifs are present,
because larger oligonucleotides are degraded inside cells. In
certain embodiments, the CpG oligonucleotides are 6 to 100
nucleotides long, preferentially 8 to 30 nucleotides long. In
important embodiments, nucleic acids and oligonucleotides of the
invention are not plasmids or expression vectors.
[0754] In an embodiment, the CpG oligonucleotide disclosed herein
comprise substitutions or modifications, such as in the bases
and/or sugars as described at paragraphs 134 to 147 of WO
2007/026190.
[0755] In an embodiment, the CpG oligonucleotide of the present
invention is chemically modified. Examples of chemical
modifications are known to the skilled person and are described,
for example in Uhlmann et al. (1990) Chem. Rev. 90:543; S. Agrawal,
Ed., Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu.
Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker et al. (1995)
Mod. Synth. Methods 7:331-417. An oligonucleotide according to the
invention may have one or more modifications, wherein each
modification is located at a particular phosphodiester
internucleoside bridge and/or at a particular .beta.-D-ribose unit
and/or at a particular natural nucleoside base position in
comparison to an oligonucleotide of the same sequence which is
composed of natural DNA or RNA.
[0756] In some embodiments of the invention, CpG-containing nucleic
acids might be simply mixed with immunogenic carriers according to
methods known to those skilled in the art (see, e.g., WO
03/024480).
[0757] In a particular embodiment of the present invention, any of
the immunogenic compositions disclosed herein comprise from 2 .mu.g
to 100 mg of CpG oligonucleotide, preferably from 0.1 mg to 50 mg
CpG oligonucleotide, preferably from 0.2 mg to 10 mg CpG
oligonucleotide, preferably from 0.3 mg to 5 mg CpG
oligonucleotide, preferably from 0.3 mg to 5 mg CpG
oligonucleotide, even more preferably from 0.5 to 2 mg CpG
oligonucleotide, even more preferably from 0.75 to 1.5 mg CpG
oligonucleotide. In a preferred embodiment, any of the immunogenic
composition disclosed herein comprises about 1 mg CpG
oligonucleotide.
[0758] In an embodiment, the immunogenic composition of the
invention (such as defined at section 2 above), comprises an
adjuvant as defined above, preferably an aluminum salt (alum)
(e.g., aluminum phosphate, aluminum sulfate or aluminum hydroxide).
In an embodiment, the immunogenic composition of the invention
comprise aluminum phosphate or aluminum hydroxide as adjuvant.
[0759] In an embodiment, the immunogenic composition which may be
used in combination with the immunogenic composition of the
invention (such as defined at section 3 above), comprises an
adjuvant as defined above, preferably an aluminum salt (alum)
(e.g., aluminum phosphate, aluminum sulfate or aluminum hydroxide).
In an embodiment, said immunogenic compostions comprise aluminum
phosphate or aluminum hydroxide as adjuvant.
[0760] An aspect of the invention provides a kit as defined at
section 4 above wherein only the first immunogenic composition
(part (a) of the kit) comprises an adjuvant as defined above.
[0761] An aspect of the invention provides a kit as defined at
section 4 above wherein only the second immunogenic composition
(part (b) of the kit) comprises an adjuvant as defined above.
[0762] An aspect of the invention provides a kit as defined at
section 4 above wherein both immunogenic compositions (part (a) and
(b) of the kit) comprise an adjuvant as defined above.
[0763] An aspect of the invention provides a kit as defined at
section 4 above wherein both immunogenic compositions (part (a) and
(b) of the kit) comprise an adjuvant selected from the group
consisting of aluminum phosphate, aluminum sulfate and aluminum
hydroxide.
[0764] An aspect of the invention provides a kit as defined at
section 4 above wherein both immunogenic compositions (part (a) and
(b) of the kit) comprise aluminum phosphate as adjuvant.
[0765] An aspect of the invention provides a kit as defined at
section 4 above wherein both immunogenic compositions (part (a) and
(b) of the kit) comprise aluminium hydroxide as adjuvant.
[0766] An aspect of the invention provides a kit as defined at
section 4 above wherein both immunogenic compositions (part (a) and
(b) of the kit) comprise aluminium sulfate as adjuvant.
8. FORMULATION
[0767] The immunogenic compositions disclosed herein may be
formulated in liquid form (i.e., solutions or suspensions) or in a
lyophilized form. Liquid formulations may advantageously be
administered directly from their packaged form and are thus ideal
for injection without the need for reconstitution in aqueous medium
as otherwise required for lyophilized compositions.
[0768] Formulation of the immunogenic composition disclosed herein
can be accomplished using art-recognized methods. For instance, the
individual pneumococcal conjugates can be formulated with a
physiologically acceptable vehicle to prepare the composition.
Examples of such vehicles include, but are not limited to, water,
buffered saline, polyols (e.g., glycerol, propylene glycol, liquid
polyethylene glycol) and dextrose solutions.
[0769] The present disclosure provides an immunogenic composition
comprising any combination of glycoconjugates disclosed herein and
a pharmaceutically acceptable excipient, carrier, or diluent.
[0770] In an embodiment, the immunogenic composition disclosed
herein is in liquid form, preferably in aqueous liquid form.
[0771] Immunogenic compositions of the disclosure may comprise one
or more of a buffer, a salt, a divalent cation, a non-ionic
detergent, a cryoprotectant such as a sugar, and an anti-oxidant
such as a free radical scavenger or chelating agent, or any
combinations thereof.
[0772] In an embodiment, the immunogenic compositions disclosed
herein comprise a buffer. In an embodiment, said buffer has a pKa
of about 3.5 to about 7.5. In some embodiments, the buffer is
phosphate, succinate, histidine or citrate. In certain embodiments,
the buffer is succinate at a final concentration of 1 mM to 10 mM.
In one particular embodiment, the final concentration of the
succinate buffer is about 5 mM.
[0773] In an embodiment, the immunogenic compositions disclosed
herein comprise a salt. In some embodiments, the salt is selected
from the groups consisting of magnesium chloride, potassium
chloride, sodium chloride and a combination thereof. In one
particular embodiment, the salt is sodium chloride. In one
particular embodiment, the immunogenic compositions disclosed
herein comprise sodium chloride at 150 mM.
[0774] In an embodiment, the immunogenic compositions disclosed
herein comprise a surfactant. In an embodiment, the surfactant is
selected from the group consisting of polysorbate 20 (TWEEN.TM.20),
polysorbate 40 (TWEEN.TM.40), polysorbate 60 (TWEEN.TM. 60),
polysorbate 65 (TWEEN.TM. 65), polysorbate 80 (TWEEN.TM. 80),
polysorbate 85 (TWEEN.TM.85), TRITON.TM. N-101, TRITON.TM. X-100,
oxtoxynol 40, nonoxynol-9, triethanolamine, triethanolamine
polypeptide oleate, polyoxyethylene-660 hydroxystearate (PEG-15,
Solutol H 15), polyoxyethylene-35-ricinoleate (CREMOPHOR.RTM. EL),
soy lecithin and a poloxamer. In one particular embodiment, the
surfactant is polysorbate 80. In some said embodiment, the final
concentration of polysorbate 80 in the formulation is at least
0.0001% to 10% polysorbate 80 weight to weight (w/w). In some said
embodiments, the final concentration of polysorbate 80 in the
formulation is at least 0.001% to 1% polysorbate 80 weight to
weight (w/w). In some said embodiments, the final concentration of
polysorbate 80 in the formulation is at least 0.01% to 1%
polysorbate 80 weight to weight (w/w). In other embodiments, the
final concentration of polysorbate 80 in the formulation is 0.01%,
0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09% or 0.1%
polysorbate 80 (w/w). In another embodiment, the final
concentration of the polysorbate 80 in the formulation is 1%
polysorbate 80 (w/w).
[0775] In certain embodiments, the immunogenic composition
disclosed herein has a pH of 5.5 to 7.5, more preferably a pH of
5.6 to 7.0, even more preferably a pH of 5.8 to 6.0. In one
embodiment, the present invention provides a container filled with
any of the immunogenic compositions disclosed herein. In one
embodiment, the container is selected from the group consisting of
a vial, a syringe, a flask, a fermentor, a bioreactor, a bag, a
jar, an ampoule, a cartridge and a disposable pen. In certain
embodiments, the container is siliconized.
[0776] In an embodiment, the container of the present invention is
made of glass, metals (e.g., steel, stainless steel, aluminum,
etc.) and/or polymers (e.g., thermoplastics, elastomers,
thermoplastic-elastomers). In an embodiment, the container of the
present invention is made of glass.
[0777] In one embodiment, the present invention provides a syringe
filled with any of the immunogenic compositions disclosed herein.
In certain embodiments, the syringe is siliconized and/or is made
of glass.
[0778] A typical dose of the immunogenic composition disclosed
herein for injection has a volume of 0.1 mL to 2 mL, more
preferably 0.2 mL to 1 mL, even more preferably a volume of about
0.5 mL.
[0779] Therefore the container or syringe as defined above is filed
with a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL,
even more preferably a volume of about 0.5 mL of any of the
immunogenic compositions defined herein.
[0780] In an embodiment, the immunogenic composition of the
invention (such as defined at section 2 above) is formulated as
disclosed above.
[0781] In an embodiment, the immunogenic composition which may be
used in combination with the immunogenic composition of the
invention (such as defined at section 3 above) is formulated as
disclosed above.
[0782] An aspect of the invention provides a kit as defined at
section 4 above wherein both immunogenic compositions (part (a) and
(b) of the kit) are formulated as described above.
[0783] An aspect of the invention provides a kit as defined at
section 4 above wherein both immunogenic compositions (part (a) and
(b) of the kit) are formulated in liquid form.
[0784] An aspect of the invention provides a kit as defined at
section 4 above wherein both immunogenic compositions (part (a) and
(b) of the kit) are formulated in lyophilized form.
[0785] An aspect of the invention provides a kit as defined at
section 4 above wherein the first immunogenic composition (part (a)
of the kit) is in liquid form and the second immunogenic
composition (part (b) of the kit) is in lyophilized form.
[0786] An aspect of the invention provides a kit as defined at
section 4 above wherein the first immunogenic composition (part (a)
of the kit) is in lyophilized form and the second immunogenic
composition (part (b) of the kit) is in liquid form.
9. USES OF THE IMMUNOGENIC COMPOSITIONS AND KITS OF THE
INVENTION
[0787] In an embodiment, the immunogenic compositions and kits
disclosed herein are for use as a medicament.
[0788] The immunogenic compositions and kits described herein may
be used in various therapeutic or prophylactic methods for
preventing, treating or ameliorating a bacterial infection, disease
or condition in a subject. In particular, immunogenic compositions
and kits described herein may be used to prevent, treat or
ameliorate a S. pneumoniae infection, disease or condition in a
subject.
[0789] Thus in one aspect, the invention provides a method of
preventing, treating or ameliorating an infection, disease or
condition associated with S. pneumoniae in a subject, comprising
administering to the subject an immunologically effective amount of
an immunogenic composition of described herein.
[0790] In some such embodiments, the infection, disease or
condition is selected from the group consisting of pneumonia,
sinusitis, otitis media, acute otitis media, meningitis,
bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis,
septic arthritis, endocarditis, peritonitis, pericarditis,
mastoiditis, cellulitis, soft tissue infection and brain
abscess.
[0791] In an embodiment, the invention provides a method of
inducing an immune response to S. pneumoniae in a subject
comprising administering to the subject an immunologically
effective amount of an immunogenic composition of the invention
[0792] In an embodiment, the immunogenic compositions and kits
disclosed herein are for use as a vaccine. In such embodiments the
immunogenic compositions and kits described herein may be used to
prevent a S. pneumoniae infection in a subject. Thus in one aspect,
the invention provides a method of preventing an infection by S.
pneumoniae in a subject comprising administering to the subject an
immunologically effective amount of an immunogenic composition of
the invention. In some such embodiments, the infection is selected
from the group consisting of pneumonia, sinusitis, otitis media,
acute otitis media, meningitis, bacteremia, sepsis, pleural
empyema, conjunctivitis, osteomyelitis, septic arthritis,
endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis,
soft tissue infection and brain abscess. In one aspect, the subject
to be vaccinated is a mammal, such as a human, cat, sheep, pig,
horse, bovine or dog.
[0793] In one aspect, the immunogenic compositions and kits
disclosed herein are for use in a method of preventing, treating or
ameliorating an infection, disease or condition associated with S.
pneumoniae in a subject. In some such embodiments, the infection,
disease or condition is selected from the group consisting of
pneumonia, sinusitis, otitis media, acute otitis media, meningitis,
bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis,
septic arthritis, endocarditis, peritonitis, pericarditis,
mastoiditis, cellulitis, soft tissue infection and brain
abscess.
[0794] In an embodiment, the immunogenic compositions and kits
disclosed herein are for use as a vaccine. In such embodiments the
immunogenic compositions and kits described herein may be used to
prevent a S. pneumoniae infection in a subject. Thus in one aspect,
the immunogenic compositions and kits disclosed herein are for use
in a method of preventing, an infection by S. pneumoniae in a
subject. In some such embodiments, the infection is selected from
the group consisting of pneumonia, sinusitis, otitis media, acute
otitis media, meningitis, bacteremia, sepsis, pleural empyema,
conjunctivitis, osteomyelitis, septic arthritis, endocarditis,
peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue
infection and brain abscess. In one aspect, the subject to be
vaccinated is a mammal, such as a human, cat, sheep, pig, horse,
bovine or dog.
[0795] The immunogenic compositions and kits of the present
invention can be used to protect or treat a human susceptible to
pneumococcal infection, by means of administering the immunogenic
compositions via a systemic or mucosal route. In an embodiment, the
immunogenic compositions disclosed herein are administered by
intramuscular, intraperitoneal, intradermal or subcutaneous routes.
In an embodiment, the immunogenic compositions disclosed herein are
administered by intramuscular, intraperitoneal, intradermal or
subcutaneous injection. In an embodiment, the immunogenic
compositions disclosed herein are administered by intramuscular or
subcutaneous injection.
[0796] In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above), when administered to a subject, are able to induce
the formation of antibodies capable of binding to S. pneumonia
serotype 15B, 15A and/or 15C as measured by a standard ELISA assay.
In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above), when administered to a subject, are able to induce
the formation of antibodies capable of binding to S. pneumonia
serotype 15B and 15C as measured by a standard ELISA assay.
[0797] In the ELISA (Enzyme-linked Immunosorbent Assay) method,
antibodies from the sera of vaccinated subjects are incubated with
polysaccharides which have been adsorbed to a solid support. The
bound antibodies are detected using enzyme-conjugated secondary
detection antibodies.
[0798] In an embodiment said standard ELISA assay is the
standardized (WHO) ELISA assay as defined by the WHO in the
`Training manual for Enzyme linked immunosorbent assay for the
quantitation of Streptococcus pneumoniae serotype specific IgG (Pn
PS ELISA).` (accessible at http://www.vaccine.uab.edu/ELISA
%20protocol.pdf; last accessed on Mar. 31, 2014).
[0799] The ELISA measures type specific IgG anti-S. pneumoniae
capsular polysaccharide (PS) antibodies present in human serum.
When dilutions of human sera are added to type-specific capsular
PS-coated microtiter plates, antibodies specific for that capsular
PS bind to the microtiter plates. The antibodies bound to the
plates are detected using a goat anti-human IgG alkaline
phosphatase-labeled antibody followed by a p-nitrophenyl phosphate
substrate. The optical density of the colored end product is
proportional to the amount of anticapsular PS antibody present in
the serum.
[0800] In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above) is able to elicit IgG antibodies in human which are
capable of binding S. pneumoniae serotype 15B polysaccharide at a
concentration of at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4 or 0.5
.mu.g/ml as determined by ELISA assay.
[0801] In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above) is able to elicit IgG antibodies in human which are
capable of binding S. pneumoniae serotype 15C polysaccharide at a
concentration of at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4 or 0.5
.mu.g/ml as determined by ELISA assay.
[0802] In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above) is able to elicit IgG antibodies in human which are
capable of binding S. pneumoniae serotypes 15B and 15C
polysaccharide at a concentration of at least 0.05, 0.1, 0.2, 0.3,
0.35, 0.4 or 0.5 .mu.g/ml as determined by ELISA assay.
[0803] In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above), when administered to a subject, are able to induce
the formation of antibodies capable of killing S. pneumonia
serotype 15B in an opsonophagocytosis assay as disclosed herein
(such as the OPA assay of Example 12).
[0804] In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above), when tested in an OPA assay as disclosed herein (such
as the OPA assay of Example 12), has an OPA titer greater than the
OPA titer obtained with an unconjugated native S. pneumonia
serotype 15B capsular polysaccharide.
[0805] In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above), when administered to a subject, are able to induce
the formation of antibodies capable of killing S. pneumonia
serotype 15C in an opsonophagocytosis assay as disclosed herein
(such as the OPA assay of Example 12). In an embodiment, the
immunogenic composition of the present disclosure comprising at
least one glycoconjugate from S. pneumoniae serotype 15B (such as
the glycoconjugates of section 1.3.4 above), when tested in an OPA
assay as disclosed herein (such as the OPA assay of Example 12),
has an OPA titer greater than the OPA titer obtained with an
unconjugated native S. pneumonia serotype 15B capsular
polysaccharide.
[0806] The pneumococcal opsonophagocytic assay (OPA), which
measures killing of S. pneumoniae cells by phagocytic effector
cells in the presence of functional antibody and complement, is
considered to be an important surrogate for evaluating the
effectiveness of pneumococcal vaccines.
[0807] Opsonophagocytic assay (OPA) can be conducted by incubating
together a mixture of Streptococcus pneumoniae cells, a heat
inactivated human serum to be tested, differentiated HL-60 cells
(phagocytes) and an exogenous complement source (e.g. baby rabbit
complement). Opsonophagocytosis proceeds during incubation and
bacterial cells that are coated with antibody and complement are
killed upon opsonophagocytosis. Colony forming units (cfu) of
surviving bacteria that escape from opsonophagocytosis are
determined by plating the assay mixture. The OPA titer is defined
as the reciprocal dilution that results in a 50% reduction in
bacterial count over control wells without test serum. The OPA
titer is interpolated from the two dilutions that encompass this
50% killing cut-off.
[0808] An endpoint titer of 1:8 or greater is considered a positive
result in these killing type OPA. In an embodiment, the immunogenic
composition of the present disclosure comprising at least one
glycoconjugate from S. pneumoniae serotype 15B (such as the
glycoconjugates of section 1.3.4 above), is able to elicit a titer
of at least 1:8 against S. pneumoniae serotype 15B in at least 50%
of the subjects as determined by opsonophagocytic killing assay
(OPA). In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above) is able to elicit a titer of at least 1:8 against S.
pneumoniae serotype 15B in at least 60%, 70%, 80%, 90%, or at least
93% of the subjects as determined by opsonophagocytic killing assay
(OPA).
[0809] In an embodiment, the immunogenic composition of the present
disclosure comprising at least one glycoconjugate from S.
pneumoniae serotype 15B (such as the glycoconjugates of section
1.3.4 above) is able to elicit a titer of at least 1:8 against S.
pneumoniae serotype 15C in at least 50% of the subjects as
determined by opsonophagocytic killing assay (OPA). In an
embodiment, the immunogenic composition of the present disclosure
comprising at least one glycoconjugate from S. pneumoniae serotype
15B (such as the glycoconjugates of section 1.3.4 above) is able to
elicit a titer of at least 1:8 against S. pneumoniae serotype 15C
in at least 60%, 70%, 80%, 90%, or at least 95% of the subjects as
determined by opsonophagocytic killing assay (OPA).
[0810] In a further aspect, the present disclosure provides a
method of treating or preventing a S. pneumoniae infection, disease
or condition associated with S. pneumoniae serotype 15A, 15B and/or
15C in a subject, the method comprising the step of administering a
therapeutically or prophylactically effective amount of any of the
immunogenic compositions of the present disclosure comprising at
least one glycoconjugate from S. pneumoniae serotype 15B (such as
the glycoconjugates of section 1.3.4 above). In an embodiment, the
immunogenic composition of the present disclosure comprising at
least one glycoconjugate from S. pneumoniae serotype 15B (such as
the glycoconjugates of section 1.3.4 above), when administered to a
subject, induces the formation of antibodies capable of binding to
S. pneumoniae serotype 15B, 15A and/or 15C. In an embodiment, the
immunogenic composition of the present disclosure comprising at
least one glycoconjugate from S. pneumoniae serotype 15B (such as
the glycoconjugates of section 1.3.4 above), when administered to a
subject, induces the formation of antibodies capable of killing S.
pneumoniae serotype 15B, 15C and/or 15A in an opsonophagocytosis
assay as disclosed herein (such as the OPA assay of Example 12).
One embodiment of the disclosure provides a method of protecting a
subject against an infection with S. pneumoniae serotype 15C, or a
method of preventing infection with S. pneumoniae serotype 15C, or
a method of reducing the severity of or delaying the onset of at
least one symptom associated with an infection caused by S.
pneumoniae serotype 15C, the methods comprising administering to a
subject an immunogenic amount of any of the immunogenic composition
of the present disclosure comprising at least one glycoconjugate
from S. pneumoniae serotype 15B (such as the glycoconjugates of
section 1.3.4 above). One embodiment of the disclosure provides a
method of treating or preventing a S. pneumoniae infection, disease
or condition associated with S. pneumoniae serotype 15A, 15B and/or
15C (preferably 15B and/or 15C, more preferably 15B) in a subject,
the method comprising the step of administering a therapeutically
or prophylactically effective amount of any of the immunogenic
composition of the present disclosure comprising at least one
glycoconjugate from S. pneumoniae serotype 15B (such as the
glycoconjugates of section 1.3.4 above) to the subject. Another
embodiment provides a method of treating or preventing a S.
pneumoniae infection, disease or condition associated with a S.
pneumoniae serotype 15A, 15B and/or 15C (preferably 15B and/or 15C,
more preferably 15B) in a subject, the method comprising generating
a polyclonal or monoclonal antibody preparation from any of the
immunogenic composition of the present disclosure comprising at
least one glycoconjugate from S. pneumoniae serotype 15B (such as
the glycoconjugates of section 1.3.4 above), and using said
antibody preparation to confer passive immunity to the subject.
[0811] In one embodiment, the disclosure relates to the use of any
of the immunogenic composition of the present disclosure comprising
at least one glycoconjugate from S. pneumoniae serotype 15B (such
as the glycoconjugates of section 1.3.4 above) for the manufacture
of a medicament for protecting a subject against an infection with
S. pneumoniae, and/or preventing infection with S. pneumoniae,
and/or reducing the severity of or delaying the onset of at least
one symptom associated with an infection caused by S. pneumoniae,
and/or protecting a subject against an infection with S. pneumoniae
serotype 15A, 15B and/or 15C (preferably 15B and/or 15C, more
preferably 15B) and/or preventing infection with S. pneumoniae
serotype 15A, 15B and/or 15C (preferably 15B and/or 15C, more
preferably 15B), and/or reducing the severity of or delaying the
onset of at least one symptom associated with an infection caused
by S. pneumoniae serotype 15A, 15B and/or 15C (preferably 15B
and/or 15C, more preferably 15B).
[0812] In one embodiment, the disclosure relates to the use of any
of the immunogenic composition of the present disclosure comprising
at least one glycoconjugate from S. pneumoniae serotype 15B (such
as the glycoconjugates of section 1.3.4 above) for protecting a
subject against an infection with S. pneumoniae, and/or preventing
infection with S. pneumoniae, and/or reducing the severity of or
delaying the onset of at least one symptom associated with an
infection caused by S. pneumoniae, and/or protecting a subject
against an infection with S. pneumoniae serotype 15A, 15B and/or
15C (preferably 15B and/or 15C, more preferably 15B) and/or
preventing infection with S. pneumoniae serotype 15A, 15B and/or
15C (preferably 15B and/or 15C, more preferably 15B), and/or
reducing the severity of or delaying the onset of at least one
symptom associated with an infection caused by S. pneumoniae
serotype 15A, 15B and/or 15C (preferably 15B and/or 15C, more
preferably 15B).
10. SUBJECT TO BE TREATED WITH THE IMMUNOGENIC COMPOSITIONS AND
KITS OF THE INVENTION
[0813] As disclosed herein, the immunogenic compositions and kits
described herein may be used in various therapeutic or prophylactic
methods for preventing, treating or ameliorating a bacterial
infection, disease or condition in a subject.
[0814] In a preferred embodiment, said subject is a human. In a
most preferred embodiment, said subject is a newborn (i.e., under
three months of age), an infant (i.e., from 3 months to one year of
age) or a toddler (i.e., from one year to four years of age).
[0815] In an embodiment, the immunogenic compositions and kits
disclosed herein are for use as a vaccine.
[0816] In such embodiment, the subject to be vaccinated may be less
than 1 year of age. For example, the subject to be vaccinated can
be about 1, about 2, about 3, about 4, about 5, about 6, about 7,
about 8, about 9, about 10, about 11 or about 12 months of age. In
an embodiment, the subject to be vaccinated is about 2, about 4 or
about 6 months of age. In another embodiment, the subject to be
vaccinated is less than 2 years of age. For example the subject to
be vaccinated can be about 12 to about 15 months of age. In some
cases, as little as one dose of the immunogenic composition
according to the invention is needed, but under some circumstances,
a second, third or fourth dose may be given (see section 11
below).
[0817] In an embodiment of the present invention, the subject to be
vaccinated is a human adult 50 years of age or older, more
preferably a human adult 55 years of age or older. In an
embodiment, the subject to be vaccinated is a human adult 65 years
of age or older, 70 years of age or older, 75 years of age or older
or 80 years of age or older.
[0818] In an embodiment the subject to be vaccinated is an
immunocompromised individual, in particular a human. An
immunocompromised individual is generally defined as a person who
exhibits an attenuated or reduced ability to mount a normal humoral
or cellular defense to challenge by infectious agents.
[0819] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from a disease
or condition that impairs the immune system and results in an
antibody response that is insufficient to protect against or treat
pneumococcal disease.
[0820] In an embodiment, said disease is a primary immunodeficiency
disorder. Preferably, said primary immunodeficiency disorder is
selected from the group consisting of: combined T- and B-cell
immunodeficiencies, antibody deficiencies, well-defined syndromes,
immune dysregulation diseases, phagocyte disorders, innate immunity
deficiencies, autoinflammatory disorders, and complement
deficiencies. In an embodiment, said primary immunodeficiency
disorder is selected from the one disclosed on page 24, line 11, to
page 25, line 19, of WO 2010/125480.
[0821] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from a disease
selected from the group consisting of: HIV-infection, acquired
immunodeficiency syndrome (AIDS), cancer, chronic heart or lung
disorders, congestive heart failure, diabetes mellitus, chronic
liver disease, alcoholism, cirrhosis, spinal fluid leaks,
cardiomyopathy, chronic bronchitis, emphysema, chronic obstructive
pulmonary disease (COPD), spleen dysfunction (such as sickle cell
disease), lack of spleen function (asplenia), blood malignancy,
leukemia, multiple myeloma, Hodgkin's disease, lymphoma, kidney
failure, nephrotic syndrome and asthma.
[0822] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from
malnutrition.
[0823] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is taking a drug or
treatment that lowers the body's resistance to infection. In an
embodiment, said drug is selected from the one disclosed on page
26, line 33, to page 26, line 4, of WO 2010/125480.
[0824] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is a smoker.
[0825] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated has a white blood cell
count (leukocyte count) below 5.times.10.sup.9 cells per liter, or
below 4.times.10.sup.9 cells per liter, or below 3.times.10.sup.9
cells per liter, or below 2.times.10.sup.9 cells per liter, or
below 1.times.10.sup.9 cells per liter, or below 0.5.times.10.sup.9
cells per liter, or below 0.3.times.10.sup.9 cells per liter, or
below 0.1.times.10.sup.9 cells per liter.
[0826] White blood cell count (leukocyte count): The number of
white blood cells (WBC) in the blood. The WBC is usually measured
as part of the CBC (complete blood count). White blood cells are
the infection-fighting cells in the blood and are distinct from the
red (oxygen-carrying) blood cells known as erythrocytes. There are
different types of white blood cells, including neutrophils
(polymorphonuclear leukocytes; PMN), band cells (slightly immature
neutrophils), T-type lymphocytes (T-cells), B-type lymphocytes
(B-cells), monocytes, eosinophils, and basophils. All the types of
white blood cells are reflected in the white blood cell count. The
normal range for the white blood cell count is usually between
4,300 and 10,800 cells per cubic millimeter of blood. This can also
be referred to as the leukocyte count and can be expressed in
international units as 4.3-10.8.times.10.sup.9 cells per liter.
[0827] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from
neutropenia. In a particular embodiment of the present invention,
the immunocompromised subject to be vaccinated has a neutrophil
count below 2.times.10.sup.9 cells per liter, or below
1.times.10.sup.9 cells per liter, or below 0.5.times.10.sup.9 cells
per liter, or below 0.1.times.10.sup.9 cells per liter, or below
0.05.times.10.sup.9 cells per liter.
[0828] A low white blood cell count or "neutropenia" is a condition
characterized by abnormally low levels of neutrophils in the
circulating blood. Neutrophils are a specific kind of white blood
cell that help to prevent and fight infections. The most common
reason that cancer patients experience neutropenia is as a side
effect of chemotherapy. Chemotherapy-induced neutropenia increases
a patient's risk of infection and disrupts cancer treatment.
[0829] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated has a CD4+ cell count
below 500/mm.sup.3, or CD4+ cell count below 300/mm.sup.3, or CD4+
cell count below 200/mm.sup.3, CD4+ cell count below 100/mm.sup.3,
CD4+ cell count below 75/mm.sup.3, or CD4+ cell count below
50/mm.sup.3.
[0830] CD4 cell tests are normally reported as the number of cells
in mm.sup.3. Normal CD4 counts are between 500 and 1,600, and CD8
counts are between 375 and 1,100. CD4 counts drop dramatically in
people with HIV.
[0831] In an embodiment of the invention, any of the
immunocompromised subjects disclosed herein is a human male or a
human female.
11. IMMUNIZATION SCHEDULE
[0832] In some cases, as little as one dose of the immunogenic
composition according to the invention is needed, but under some
circumstances, such as conditions of greater immune deficiency or
immune immaturity, a second, third or fourth dose may be given.
Following an initial vaccination, subjects can receive one or
several booster immunizations adequately spaced.
[0833] In an embodiment, the schedule of vaccination of the
immunogenic composition according to the invention is a single
dose. In a particular embodiment, said single dose schedule is for
healthy persons being at least 2 years of age.
[0834] In an embodiment, the schedule of vaccination of the
immunogenic composition according to the invention is a multiple
dose schedule. A multiple dose schedule is frequently used in
conditions such as immune deficiency (such as human elderly or
human immunocompromised individuals) or immune immaturity (such as
human newborns (i.e., under three months of age), infants (i.e.,
from 3 months to one year of age) or toddlers (i.e., from one year
to four years of age)). In a particular embodiment, said multiple
dose schedule consists of a series of 2 doses separated by an
interval of about 1 month to about 12 months. In a particular
embodiment, said multiple dose schedule consists of a series of 2
doses separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11 or 12 months. In a particular embodiment, said multiple dose
schedule consists of a series of 2 doses separated by an interval
of about 1 month to about 6 months. In a particular embodiment,
said multiple dose schedule consists of a series of 2 doses
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In a
particular embodiment, said multiple dose schedule consists of a
series of 2 doses separated by an interval of about 1 month, or a
series of 2 doses separated by an interval of about 2 months.
[0835] In another embodiment, said multiple dose schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month to about 12 months.
[0836] In a particular embodiment, said multiple dose schedule
consists of a series of 3 doses wherein each dose is separated by
an interval of about 1 month to about 6 months. In a particular
embodiment, said multiple dose schedule consists of a series of 3
doses wherein each dose is separated by an interval of about 1, 2,
3, 4, 5 or 6 months. In a particular embodiment, said multiple dose
schedule consists of a series of 3 doses wherein each dose is
separated by an interval of about 1 month, or a series of 3 doses
wherein each dose is separated by an interval of about 2
months.
[0837] In another embodiment, said multiple dose schedule consists
of a series of 4 doses wherein each dose is separated by an
interval of about 1 month to about 12 months.
[0838] In a particular embodiment, said multiple dose schedule
consists of a series of 4 doses wherein each dose is separated by
an interval of about 1 month to about 6 months. In a particular
embodiment, said multiple dose schedule consists of a series of 4
doses wherein each dose is separated by an interval of about 1, 2,
3, 4, 5 or 6 months. In a particular embodiment, said multiple dose
schedule consists of a series of 4 doses wherein each dose is
separated by an interval of about 1 month, or a series of 4 doses
wherein each dose is separated by an interval of about 2
months.
[0839] In another embodiment, said multiple dose schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month to about 4 months followed by a fourth
dose about 10 months to about 13 months after the first dose. In
another embodiment, said multiple dose schedule consists of a
series of 3 doses wherein each dose is separated by an interval of
about 1, 2, 3 or 4 months followed by a fourth dose about 10 months
to about 13 months after the first dose. In another embodiment,
said multiple dose schedule consists of a series of 3 doses wherein
each dose is separated by an interval of about 1 month to about 2
months followed by a fourth dose about 10 months to about 13 months
after the first dose. In another embodiment, said multiple dose
schedule consists of a series of 3 doses wherein each dose is
separated by an interval of about 1 month followed by a fourth dose
about 10 months to about 13 months after the first dose, or a
series of 3 doses wherein each dose is separated by an interval of
about 2 months followed by a fourth dose about 10 months to about
13 months after the first dose.
[0840] In an embodiment, the multiple dose schedule consists of at
least one dose (e.g., 1, 2 or 3 doses) in the first year of age
followed by at least one toddler dose.
[0841] In an embodiment, the multiple dose schedule consists of a
series of 2 or 3 doses wherein each dose is separated by an
interval of about 1 month to about 2 months (for example 28-56 days
between doses), starting at 2 months of age, and followed by a
toddler dose at 12-18 months of age. In an embodiment, said
multiple dose schedule consists of a series of 3 doses wherein each
dose is separated by an interval of about 1 month to about 2 months
(for example 28-56 days between doses), starting at 2 months of
age, and followed by a toddler dose at 12-15 months of age. In
another embodiment, said multiple dose schedule consists of a
series of 2 doses separated by an interval of about 2 months,
starting at 2 months of age, and followed by a toddler dose at
12-18 months of age.
[0842] In an embodiment, the multiple dose schedule consists of a
4-dose series of vaccine at 2, 4, 6, and 12-15 months of age.
[0843] In an embodiment, a prime dose is given at day 0 and one or
more booster doses are given at intervals that range from about 2
to about 24 weeks between doses, preferably with a dosing interval
of 4-8 weeks.
[0844] In an embodiment, a prime dose is given at day 0 and a boost
is given about 3 months later.
[0845] In another embodiment, said multiple dose schedule consists
of a series of 5 doses wherein each dose is separated by an
interval of about 1 month to about 12 months.
[0846] In a particular embodiment, said multiple dose schedule
consists of a series of 5 doses wherein each dose is separated by
an interval of about 1 month to about 6 months. In a particular
embodiment, said multiple dose schedule consists of a series of 5
doses wherein each dose is separated by an interval of about 1, 2,
3, 4, 5 or 6 months. In a particular embodiment, said multiple dose
schedule consists of a series of 5 doses wherein each dose is
separated by an interval of about 1 month, or a series of 5 doses
wherein each dose is separated by an interval of about 2
months.
[0847] In another embodiment, said multiple dose schedule consists
of a series of 6, 7 or 8 doses wherein each dose is separated by an
interval of about 1 month to about 12 months. In a particular
embodiment, said multiple dose schedule consists of a series of 6,
7 or 8 doses wherein each dose is separated by an interval of about
1 month to about 6 months. In a particular embodiment, said
multiple dose schedule consists of a series of 6, 7 or 8 doses
wherein each dose is separated by an interval of about 1, 2, 3, 4,
5 or 6 months. In a particular embodiment, said multiple dose
schedule consists of a series of 6, 7 or 8 doses wherein each dose
is separated by an interval of about 1 month. In a particular
embodiment, said multiple dose schedule consists of a series of 6,
7 or 8 doses wherein each dose is separated by an interval of about
2 months.
[0848] An aspect of the invention pertains to any immunogenic
composition of the invention for simultaneous, concurrent,
concomitant or sequential administration with a second immunogenic
composition. An aspect of the invention pertains to any kit
disclosed herein for simultaneous, concurrent, concomitant or
sequential administration.
[0849] By "simultaneous administration" is meant the administration
of therapeutically effective doses of a first and a second
immunogenic compositions in a single unit dosage form.
[0850] By "concurrent administration" is meant the administration
of therapeutically effective doses of a first and a second
immunogenic compositions through the same access site, but in
separate unit dosage forms, within a short period of one another.
Concurrent administration is essentially administering the two
immunogenic compositions at about the same time but in separate
dosage forms, through the same access site. The concurrent
administration of the first and the second immunogenic compositions
often occurs during the same physician office visit.
[0851] By "concomitant administration" is meant the administration
of therapeutically effective doses of a first and a second
immunogenic compositions, in separate unit dosage forms within a
short period of one another at different anatomic sites.
Concomitant administration is essentially administering the two
immunogenic compositions at about the same time but in separate
dosage forms and at different anatomic sites. The concomitant
administration of the first and second immunogenic compositions
often occurs during the same physician office visit.
[0852] By "sequential administration" is meant the administration
of a therapeutically effective dose of a first or a second
immunogenic composition alone, followed by the administration of a
therapeutically effective dose of the remaining immunogenic
composition after an interval of at least about 1 month. For
instance in one embodiment, the first immunogenic composition is
administered in a single dosage form, and then after an interval of
at least about 1 month, the second immunogenic composition is
administered in a separate single dosage form. In an alternative
embodiment, the second immunogenic composition is administered in a
single dosage form, and then after an interval of at least about 1
month, the first immunogenic composition is administered in a
separate single dosage form. The sequential administration of the
first and second immunogenic compositions often occurs at different
physician office visits.
[0853] In an aspect of the present invention, a first immunogenic
composition according to the invention (such as the ones of section
2 above) is administered simultaneously, concurrently,
concomitantly or sequentially with a second immunogenic
composition. In an embodiment said second immunogenic composition
is any of the immunogenic compositions disclosed at section 3
above.
[0854] Therefore, an aspect of the present invention pertains to a
first immunogenic composition according to the invention (such as
the ones of section 2 above) for simultaneous, concurrent,
concomitant or sequential use with a second immunogenic
composition. In an embodiment said second immunogenic composition
is any of the immunogenic compositions disclosed at section 3
above.
[0855] In some cases, as little as one dose of each of the
immunogenic compositions is needed, but under some circumstances, a
second, third or fourth dose of one or each of the immunogenic
composition may be given. Following an initial vaccination,
subjects can receive one or several booster immunizations
adequately spaced.
[0856] In an embodiment, the present invention pertains to a first
immunogenic composition according to the invention (such as the
ones of section 2 above) for simultaneous administration with a
second immunogenic composition. In an embodiment said second
immunogenic composition is any of the immunogenic compositions
disclosed at section 3 above.
[0857] In an embodiment, the schedule of vaccination of said
simultaneous administration is a single dose. In a particular
embodiment, said single dose schedule is for healthy persons being
at least 2 years of age.
[0858] In an embodiment, the schedule of vaccination of said
simultaneous administration is a multiple dose schedule. In a
particular embodiment, said multiple dose schedule consists of a
series of 2 doses separated by an interval of about 1 month to
about 12 months. In a particular embodiment, said multiple dose
schedule consists of a series of 2 doses separated by an interval
of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months. In a
particular embodiment, said multiple dose schedule consists of a
series of 2 doses separated by an interval of about 1 month to
about 6 months. In a particular embodiment, said multiple dose
schedule consists of a series of 2 doses separated by an interval
of about 1, 2, 3, 4, 5 or 6 months. In a particular embodiment,
said multiple dose schedule consists of a series of 2 doses
separated by an interval of about 1 month, or a series of 2 doses
separated by an interval of about 2 months.
[0859] In another embodiment, said multiple dose schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month to about 12 months. In a particular
embodiment, said multiple dose schedule consists of a series of 3
doses wherein each dose is separated by an interval of about 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months. In a particular
embodiment, said multiple dose schedule consists of a series of 3
doses wherein each dose is separated by an interval of about 1
month to about 6 months. In a particular embodiment, said multiple
dose schedule consists of a series of 3 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5 or 6 months.
[0860] In another embodiment, said multiple dose schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month, or a series of 3 doses wherein each dose
is separated by an interval of about 2 months.
[0861] In a particular embodiment, said multiple dose schedule
consists of a series of 4 doses separated by an interval of about 1
month to about 12 months. In a particular embodiment, said multiple
dose schedule consists of a series of 4 doses separated by an
interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months.
In a particular embodiment, said multiple dose schedule consists of
a series of 4 doses separated by an interval of about 1 month to
about 6 months. In a particular embodiment, said multiple dose
schedule consists of a series of 4 doses separated by an interval
of about 1, 2, 3, 4, 5 or 6 months. In a particular embodiment,
said multiple dose schedule consists of a series of 4 doses
separated by an interval of about 1 month, or a series of 4 doses
separated by an interval of about 2 months.
[0862] In another embodiment, said multiple dose schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month to about 4 months followed by a fourth
dose about 10 months to about 13 months after the first dose. In
another embodiment, said multiple dose schedule consists of a
series of 3 doses wherein each dose is separated by an interval of
about 1, 2, 3 or 4 months followed by a fourth dose about 10 months
to about 13 months after the first dose. In another embodiment,
said multiple dose schedule consists of a series of 3 doses wherein
each dose is separated by an interval of about 1 month to about 2
months followed by a fourth dose about 10 months to about 13 months
after the first dose. In another embodiment, said multiple dose
schedule consists of a series of 3 doses wherein each dose is
separated by an interval of about 1 month followed by a fourth dose
about 10 months to about 13 months after the first dose, or a
series of 3 doses wherein each dose is separated by an interval of
about 2 months followed by a fourth dose about 10 months to about
13 months after the first dose.
[0863] In an embodiment, the multiple dose schedule consists of at
least one dose (e.g., 1, 2 or 3 doses) in the first year of age
followed by at least one toddler dose.
[0864] In an embodiment, the multiple dose schedule consists of a
series of 2 or 3 doses wherein each dose is separated by an
interval of about 1 month to about 2 months (for example 28-56 days
between doses), starting at 2 months of age, and followed by a
toddler dose at 12-18 months of age. In an embodiment, said
multiple dose schedule consists of a series of 3 doses wherein each
dose is separated by an interval of about 1 month to about 2 months
(for example 28-56 days between doses), starting at 2 months of
age, and followed by a toddler dose at 12-15 months of age. In
another embodiment, said multiple dose schedule consists of a
series of 2 doses separated by an interval of about 2 months,
starting at 2 months of age, and followed by a toddler dose at
12-18 months of age.
[0865] In an embodiment, the multiple dose schedule consists of a
4-dose series of vaccine administered at 2, 4, 6, and 12-15 months
of age.
[0866] In an embodiment, a prime dose is given at day 0 and one or
more booster doses are given at intervals that range from about 2
to about 24 weeks between doses, preferably with a dosing interval
of 4-8 weeks.
[0867] In an embodiment, a prime dose is given at day 0 and a
booster dose is given about 3 months later.
[0868] In a particular embodiment, said multiple dose schedule
consists of a series of 5, 6, 7 or 8 doses separated by an interval
of about 1 month to about 12 months. In a particular embodiment,
said multiple dose schedule consists of a series of 5, 6, 7 or 8
doses separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11 or 12 months. In a particular embodiment, said multiple dose
schedule consists of a series of 5, 6, 7 or 8 doses separated by an
interval of about 1 month to about 6 months. In a particular
embodiment, said multiple dose schedule consists of a series of 5,
6, 7 or 8 doses separated by an interval of about 1, 2, 3, 4, 5 or
6 months. In a particular embodiment, said multiple dose schedule
consists of a series of 5, 6, 7 or 8 doses separated by an interval
of about 1 month, or a series of 5, 6, 7 or 8 doses separated by an
interval of about 2 months.
[0869] In an embodiment, the present invention pertains to a first
immunogenic composition according to the invention (such as the
ones of section 2 above) for concomitant administration with a
second immunogenic composition. In an embodiment said second
immunogenic composition is any of the immunogenic compositions
disclosed at section 3 above.
[0870] In an embodiment, the schedule of vaccination of said
concomitant administration is a single dose (the administration of
the first and second immunogenic composition, though in separate
unit dosage forms, is considered as a single dose for purposes of
defining the immunization schedule). In a particular embodiment,
said single dose schedule is for healthy persons being at least 2
years of age.
[0871] In an embodiment, the schedule of vaccination of said
concomitant administration is a multiple dose schedule (the
administration of the first and second immunogenic composition,
though in separate unit dosage forms, is considered as a single
dose for purposes of defining the immunization schedule). In a
particular embodiment, said multiple dose schedule consists of a
series of 2 doses separated by an interval of about 1 month to
about 12 months. In a particular embodiment, said schedule consists
of a series of 2 doses separated by an interval of about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11 or 12 months. In a particular embodiment,
said schedule consists of a series of 2 doses separated by an
interval of about 1 month to about 6 months. In a particular
embodiment, said schedule consists of a series of 2 doses separated
by an interval of about 1, 2, 3, 4, 5 or 6 months. In a particular
embodiment, said schedule consists of a series of 2 doses separated
by an interval of about 1 month, or a series of 2 doses separated
by an interval of about 2 months.
[0872] In another embodiment, said multiple dose schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month to about 12 months. In a particular
embodiment, said schedule consists of a series of 3 doses wherein
each dose is separated by an interval of about 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11 or 12 months. In a particular embodiment, said
schedule consists of a series of 3 doses wherein each dose is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 3
doses wherein each dose is separated by an interval of about 1, 2,
3, 4, 5 or 6 months. In another embodiment, said schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month, or a series of 3 doses wherein each dose
is separated by an interval of about 2 months.
[0873] In a particular embodiment, said multiple dose schedule
consists of a series of 4 doses separated by an interval of about 1
month to about 12 months. In a particular embodiment, said multiple
dose schedule consists of a series of 4 doses separated by an
interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months.
In a particular embodiment, said multiple dose schedule consists of
a series of 4 doses separated by an interval of about 1 month to
about 6 months. In a particular embodiment, said multiple dose
schedule consists of a series of 4 doses separated by an interval
of about 1, 2, 3, 4, 5 or 6 months. In a particular embodiment,
said multiple dose schedule consists of a series of 4 doses
separated by an interval of about 1 month, or a series of 4 doses
separated by an interval of about 2 months.
[0874] In another embodiment, said multiple dose schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month to about 4 months followed by a fourth
dose about 10 months to about 13 months after the first dose. In
another embodiment, said schedule consists of a series of 3 doses
wherein each dose is separated by an interval of about 1, 2, 3 or 4
months followed by a fourth dose about 10 months to about 13 months
after the first dose. In another embodiment, said schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month to about 2 months followed by a fourth
dose about 10 months to about 13 months after the first dose. In
another embodiment, said schedule consists of a series of 3 doses
wherein each dose is separated by an interval of about 1 month
followed by a fourth dose about 10 months to about 13 months after
the first dose, or a series of 3 doses wherein each dose is
separated by an interval of about 2 months followed by a fourth
dose about 10 months to about 13 months after the first dose.
[0875] In an embodiment, the multiple dose schedule consists of at
least one dose (e.g., 1, 2 or 3 doses) in the first year of age
followed by at least one toddler dose.
[0876] In an embodiment, the multiple dose schedule consists of a
series of 2 or 3 doses wherein each dose is separated by an
interval of about 1 month to about 2 months (for example 28-56 days
between doses), starting at 2 months of age, and followed by a
toddler dose at 12-18 months of age. In an embodiment, said
schedule consists of a series of 3 doses wherein each dose is
separated by an interval of about 1 month to about 2 months (for
example 28-56 days between doses), starting at 2 months of age, and
followed by a toddler dose at 12-15 months of age. In another
embodiment, said schedule consists of a series of 2 doses separated
by an interval of about 2 months, starting at 2 months of age, and
followed by a toddler dose at 12-18 months of age.
[0877] In an embodiment, the multiple dose schedule consists of a
4-dose series of vaccine administered at 2, 4, 6, and 12-15 months
of age.
[0878] In an embodiment, a prime dose is given at day 0 and one or
more booster doses are given at intervals that range from about 2
to about 24 weeks, preferably with a dosing interval of 4-8
weeks.
[0879] In an embodiment, a prime dose is given at day 0 and a boost
is given about 3 months later.
[0880] In a particular embodiment, said multiple dose schedule
consists of a series of 5, 6, 7 or 8 doses separated by an interval
of about 1 month to about 12 months. In a particular embodiment,
said multiple dose schedule consists of a series of 5, 6, 7 or 8
doses separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11 or 12 months. In a particular embodiment, said multiple dose
schedule consists of a series of 5, 6, 7 or 8 doses separated by an
interval of about 1 month to about 6 months. In a particular
embodiment, said multiple dose schedule consists of a series of 5,
6, 7 or 8 doses separated by an interval of about 1, 2, 3, 4, 5 or
6 months. In a particular embodiment, said multiple dose schedule
consists of a series of 5, 6, 7 or 8 doses separated by an interval
of about 1 month, or a series of 5, 6, 7 or 8 doses separated by an
interval of about 2 months.
[0881] In another embodiment, the present invention pertains to a
first immunogenic composition according to the invention (such as
the ones of section 2 above) for concurrent administration with a
second immunogenic composition. In an embodiment said second
immunogenic composition is any of the immunogenic compositions
disclosed at section 3 above.
[0882] In an embodiment, the schedule of vaccination of said
concurrent administration is a single dose (the administration of
the first and second immunogenic composition, though in separate
unit dosage forms, is considered as a single dose for purposes of
defining the immunization schedule). In a particular embodiment,
said single dose schedule is for healthy persons being at least 2
years of age.
[0883] In an embodiment, the schedule of vaccination of said
concurrent administration is a multiple dose schedule, in
particular any of the multiple schedules disclosed above for a
concomitant administration.
[0884] In an embodiment, the present invention pertains to a first
immunogenic composition according to the invention (such as the
ones of section 2 above) for sequential administration with a
second immunogenic composition. In an embodiment said second
immunogenic composition is any of the immunogenic compositions
disclosed at section 3 above.
[0885] In an embodiment, the first immunogenic composition
according to the invention is administered first and the second
immunogenic composition is administered second. In another
embodiment, the second immunogenic composition is administered
first and the first immunogenic composition according to the
invention is administered second.
[0886] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 2, 3, 4, 5, 6, 7
or 8 doses.
[0887] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 2, 3 or 4
doses
[0888] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 2 doses. In an
embodiment, the schedule of vaccination of said sequential
administration consists of a series of 2 doses separated by an
interval of about 1 month to about 12 months. In a particular
embodiment, said multiple dose schedule consists of a series of 2
doses separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11 or 12 months. In a particular embodiment, said multiple dose
schedule consists of a series of 2 doses separated by an interval
of about 1 month to about 6 months. In a particular embodiment,
said multiple dose schedule consists of a series of 2 doses
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In a
particular embodiment, said multiple dose schedule consists of a
series of 2 doses separated by an interval of about 1 month, or a
series of 2 doses separated by an interval of about 2 months.
[0889] In an embodiment of said 2-dose schedule, the first
immunogenic composition according to the invention is administered
first and the second immunogenic composition is administered
second. In another embodiment, the second immunogenic composition
is administered first and the first immunogenic composition
according to the invention is administered second.
[0890] In an embodiment of said 2-dose schedule, the first and
second doses are administered in the first year of age. In an
embodiment of said 2-dose schedules, the first dose is administered
in the first year of age and the second dose is a toddler dose. In
an embodiment, said toddler dose is administered at 12-18 months of
age. In an embodiment, said toddler dose is administered at 12-15
months of age.
[0891] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 3 doses. In a
particular embodiment, said schedule consists of a series of 3
doses wherein each dose is separated by an interval of about 1 to
about 12 months. In a particular embodiment, said schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months.
In a particular embodiment, said schedule consists of a series of 3
doses wherein each dose is separated by an interval of about 1
month to about 6 months. In a particular embodiment, said schedule
consists of a series of 3 doses wherein each dose is separated by
an interval of about 1, 2, 3, 4, 5 or 6 months. In a particular
embodiment, said schedule consists of a series of 3 doses wherein
each dose is separated by an interval of about 1 to about 2 months.
In another embodiment, said schedule consists of a series of 3
doses wherein each dose is separated by an interval of about 1
month, or a series of 3 doses wherein each dose is separated by an
interval of about 2 months.
[0892] In an embodiment of said 3-dose schedule, the first and
second doses are administered in the first year of age and the
third dose is a toddler dose. In an embodiment, the first and
second doses are separated by an interval of about 1 month to about
2 months (for example 28-56 days between doses), starting at 2
months of age, and the third dose is a toddler dose at 12-18 months
of age. In an embodiment, the first and second doses are separated
by an interval of about 1 month to about 2 months (for example
28-56 days between doses), starting at 2 months of age, and the
third dose is a toddler dose at 12-15 months of age.
[0893] In an embodiment of said 3-dose schedule, the first
immunogenic composition according to the invention is administered
as the first two doses and the second immunogenic composition is
administered as the third dose.
[0894] In another embodiment of said 3-dose schedule, the second
immunogenic composition is administered as the first two doses and
the first immunogenic composition according to the invention is
administered as the third dose.
[0895] In another embodiment of said 3-dose schedule, the first
immunogenic composition according to the invention is administered
as the first dose, the second immunogenic composition is
administered as the second dose and the first immunogenic
composition according to the invention is administered as the third
dose.
[0896] In yet another embodiment of said 3-dose schedule, the
second immunogenic composition is administered as the first dose,
the first immunogenic composition according to the invention is
administered as the second dose and the second immunogenic
composition is administered as the third dose.
[0897] In yet another embodiment of said 3-dose schedule, the first
immunogenic composition according to the invention is administered
as the first dose and the second immunogenic composition is
administered as the second and third doses.
[0898] In another embodiment of said 3-dose schedule, the second
immunogenic composition is administered as the first dose and the
first immunogenic composition according to the invention is
administered as the second and third doses.
[0899] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 4 doses.
[0900] In a particular embodiment, said schedule consists of a
series of 4 doses wherein each dose is separated by an interval of
about 1 to about 12 months. In a particular embodiment, said
schedule consists of a series of 4 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 4 doses wherein each dose is separated by an interval
of about 1 month to about 6 months. In a particular embodiment,
said schedule consists of a series of 4 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In a
particular embodiment, said schedule consists of a series of 4
doses wherein each dose is separated by an interval of about 1 to
about 2 months. In another embodiment, said schedule consists of a
series of 4 doses wherein each dose is separated by an interval of
about 1 month, or a series of 4 doses wherein each dose is
separated by an interval of about 2 months.
[0901] In an embodiment of said 4-dose schedule, said schedule
consists of a series of 3 doses wherein each dose is separated by
an interval of about 1 month to about 4 months followed by a fourth
dose about 10 months to about 13 months after the first dose. In
another embodiment, said schedule consists of a series of 3 doses
wherein each dose is separated by an interval of about 1, 2, 3 or 4
months followed by a fourth dose about 10 months to about 13 months
after the first dose. In another embodiment, said schedule consists
of a series of 3 doses wherein each dose is separated by an
interval of about 1 month to about 2 months followed by a fourth
dose about 10 months to about 13 months after the first dose. In
another embodiment, said schedule consists of a series of 3 doses
wherein each dose is separated by an interval of about 1 month
followed by a fourth dose about 10 months to about 13 months after
the first dose, or a series of 3 doses wherein each dose is
separated by an interval of about 2 months followed by a fourth
dose about 10 months to about 13 months after the first dose.
[0902] In another embodiment, said schedule consists of a series of
2 doses wherein each dose is separated by an interval of about 1
month to about 2 months followed by a third dose about 10 months to
about 13 months after the first dose and a fourth dose about 1
month to about 2 months after the third dose.
[0903] In an embodiment of said 4-dose schedule the first and
second doses are administered in the first year of age and the
third and fourth doses are a toddler dose.
[0904] In an embodiment of said 4-dose schedule the first, second
and third doses are administered in the first year of age and the
fourth dose is a toddler dose.
[0905] In an embodiment, said 4-dose schedule consists of a series
of 3 doses wherein each dose is separated by an interval of about 1
month to about 2 months (for example 28-56 days between doses),
starting at 2 months of age, followed by a toddler dose at 12-18
months of age. In an embodiment, said schedule consists of a series
of 3 doses wherein each dose is separated by an interval of about 1
month to about 2 months (for example 28-56 days between doses),
starting at 2 months of age, followed by a toddler dose at 12-15
months of age.
[0906] In an embodiment, the multiple dose schedule consists of a
4-dose series of vaccine at 2, 4, 6, and 12-15 months of age.
[0907] In an embodiment of said 4-dose schedule, the first
immunogenic composition according to the invention is administered
as the first three doses and the second immunogenic composition is
administered as the fourth dose.
[0908] In another embodiment of said 4-dose schedule, the second
immunogenic composition is administered as the first three doses
and the first immunogenic composition according to the invention is
administered as the fourth dose.
[0909] In another embodiment of said 4-dose schedule, the first
immunogenic composition according to the invention is administered
as the first and second doses and the second immunogenic
composition is administered as the third and fourth doses.
[0910] In another embodiment of said 4-dose schedule, the second
immunogenic composition is administered as the first and second
doses and the first immunogenic composition according to the
invention is administered as the third and fourth doses.
[0911] In another embodiment of said 4-dose schedule, the first
immunogenic composition according to the invention is administered
as the first and second doses, the second immunogenic composition
is administered as the third dose and the first immunogenic
composition according to the invention is administered as the
fourth dose.
[0912] In another embodiment of said 4-dose schedule, the second
immunogenic composition is administered as the first and second
doses, the first immunogenic composition according to the invention
is administered as the third dose and the second immunogenic
composition is administered as the fourth dose.
[0913] In another embodiment of said 4-dose schedule, the first
immunogenic composition according to the invention is administered
as the first dose and the second immunogenic composition is
administered as the second, third and fourth doses.
[0914] In another embodiment of said 4-dose schedule, the second
immunogenic composition is administered as the first dose and the
first immunogenic composition according to the invention is
administered as the second, third and fourth doses.
[0915] In another embodiment of said 4-dose schedule, the first
immunogenic composition according to the invention is administered
as the first dose, the second immunogenic composition is
administered as the second dose, the first immunogenic composition
according to the invention is administered as the third dose and
the second immunogenic composition is administered as the fourth
dose.
[0916] In another embodiment of said 4-dose schedule, the second
immunogenic composition is administered as the first dose, the
first immunogenic composition according to the invention is
administered as the second dose, the second immunogenic composition
is administered as the third dose and the first immunogenic
composition according to the invention is administered as the
fourth dose.
[0917] In another embodiment of said 4-dose schedule, the first
immunogenic composition according to the invention is administered
as the first dose, the second immunogenic composition is
administered as the second dose and the first immunogenic
composition according to the invention is administered as the third
and fourth doses.
[0918] In another embodiment of said 4-dose schedule, the second
immunogenic composition is administered as the first dose, the
first immunogenic composition according to the invention is
administered as the second dose and the second immunogenic
composition is administered as the third and fourth doses.
[0919] In another embodiment of said 4-dose schedule, the first
immunogenic composition according to the invention is administered
as the first dose, the second immunogenic composition is
administered as the second and third doses and the first
immunogenic composition according to the invention is administered
as the fourth dose.
[0920] In another embodiment of said 4-dose schedule, the second
immunogenic composition is administered as the first dose, the
first immunogenic composition according to the invention is
administered as the second and third doses and the second
immunogenic composition is administered as the fourth dose.
[0921] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 5 doses.
[0922] In a particular embodiment, said schedule consists of a
series of 5 doses wherein each dose is separated by an interval of
about 1 to about 12 months. In a particular embodiment, said
schedule consists of a series of 5 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 5 doses wherein each dose is separated by an interval
of about 1 month to about 6 months. In a particular embodiment,
said schedule consists of a series of 5 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In a
particular embodiment, said schedule consists of a series of 5
doses wherein each dose is separated by an interval of about 1 to
about 2 months. In another embodiment, said schedule consists of a
series of 5 doses wherein each dose is separated by an interval of
about 1 month, or a series of 5 doses wherein each dose is
separated by an interval of about 2 months.
[0923] In an embodiment said 5-dose schedule consists of a series
of 4 doses wherein each dose is separated by an interval of about 1
month to about 3 months followed by a fifth dose about 10 months to
about 13 months after the first dose. In another embodiment, said
schedule consists of a series of 4 doses wherein each dose is
separated by an interval of about 1 month to about 2 months
followed by a fifth dose about 10 months to about 13 months after
the first dose. In another embodiment, said schedule consists of a
series of 4 doses wherein each dose is separated by an interval of
about 1 month followed by a fifth dose about 10 months to about 13
months after the first dose, or a series of 4 doses wherein each
dose is separated by an interval of about 2 months followed by a
fifth dose about 10 months to about 13 months after the first
dose.
[0924] In another embodiment, said schedule consists of a series of
3 doses wherein each dose is separated by an interval of about 1
month to about 2 months followed by a fourth dose about 10 months
to about 13 months after the first dose and a fifth dose about 1
month to about 2 months after the fourth dose.
[0925] In an embodiment of said 5-doses schedule the first, second
and third doses are administered in the first year of age and the
fourth and fifth doses are a toddler dose.
[0926] In an embodiment of said 5-doses schedule, the first,
second, third and fourth doses are administered in the first year
of age and the fifth dose is a toddler dose. In an embodiment, said
5-doses schedule consists of a series of 4 doses wherein each dose
is separated by an interval of about 1 month to about 2 months (for
example 28-56 days between doses), starting at 2 months of age, and
followed by a toddler dose at 12-18 months of age. In an
embodiment, said schedule consists of a series of 4 doses wherein
each dose is separated by an interval of about 1 month to about 2
months (for example 28-56 days between doses), starting at 2 months
of age, and followed by a toddler dose at 12-15 months of age.
[0927] In an embodiment of said 5-doses schedule, the first
immunogenic composition according to the invention (such as the
ones of section 2 above, designated 1.sup.st IC in the below table)
and the second immunogenic composition (such as disclosed at
section 3 above, designated 2.sup.nd IC in the below table) are
administered in the following order:
TABLE-US-00007 Schedule Dose number 1 2 3 4 5 1 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 3 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 4 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 5 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 6 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 7 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 8 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 9 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 10 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 11 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 12 2.sup.nd IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 13 2.sup.nd IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 14 2.sup.nd IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 15 2.sup.nd IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 16 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 17 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 18 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 19 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 20 1.sup.st IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 21 1.sup.st IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 22 1.sup.st IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 23 1.sup.st IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 24 1.sup.st IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 25 1.sup.st IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 26 1.sup.st IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 27 1.sup.st IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 28 1.sup.st IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 29 1.sup.st IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 30 1.sup.st IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
[0928] The above table provide the order of administration of the
first and second immunogenic composition (designated 1.sup.st IC
and 2.sup.nd IC respectively) for the different doses, for example
schedule number 1 is to be read as: in embodiment of said 5-dose
schedule, the second immunogenic composition is administered as the
first, second, third and fourth doses and the first immunogenic
composition according to the invention is administered as the fifth
dose.
[0929] In a preferred embodiment, the order of administration of
the first and second immunogenic composition is according to
schedule 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, 19,
20 or 21.
[0930] In an embodiment, the schedule of vaccination of said
sequential dose consists of a series of 6 doses.
[0931] In a particular embodiment, said schedule consists of a
series of 6 doses wherein each dose is separated by an interval of
about 1 to about 12 months. In a particular embodiment, said
schedule consists of a series of 6 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 6 doses wherein each dose is separated by an interval
of about 1 month to about 6 months. In a particular embodiment,
said schedule consists of a series of 6 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In a
particular embodiment, said schedule consists of a series of 6
doses wherein each dose is separated by an interval of about 1 to
about 2 months. In another embodiment, said schedule consists of a
series of 6 doses wherein each dose is separated by an interval of
about 1 month, or a series of 6 doses wherein each dose is
separated by an interval of about 2 months.
[0932] In an embodiment said 6-dose schedule consists of a series
of 5 doses wherein each dose is separated by an interval of about 1
month to about 2 months followed by a sixth dose about 10 months to
about 13 months after the first dose. In another embodiment, said
schedule consists of a series of 5 doses wherein each dose is
separated by an interval of about 1 month followed by a sixth dose
about 10 months to about 13 months after the first dose, or a
series of 5 doses wherein each dose is separated by an interval of
about 2 months followed by a sixth dose about 10 months to about 13
months after the first dose.
[0933] In an embodiment of said 6-doses schedule, the first,
second, third, fourth and fifth doses are administered in the first
year of age and the sixth dose is a toddler dose. In an embodiment,
said 6-doses schedule consists of a series of 5 doses wherein each
dose is separated by an interval of about 1 month to about 2 months
(for example 28-56 days between doses), starting at 2 months of
age, and followed by a toddler dose at 12-18 months of age. In an
embodiment, said schedule consists of a series of 5 doses wherein
each dose is separated by an interval of about 1 month to about 2
months (for example 28-56 days between doses), starting at 2 months
of age, and followed by a toddler dose at 12-15 months of age.
[0934] In an embodiment of said 6-doses schedule, the first
immunogenic composition according to the invention (such as the
ones of section 2 above) and the second immunogenic composition
(such as disclosed at section 3 above) are administered in the
order according to the any of the 30 schedules provided for the
5-doses schedule (see above table, schedule 1 to 30), followed by a
sixth dose. In an embodiment, the first immunogenic composition
according to the invention is administered as the sixth dose. In
another embodiment, the second immunogenic composition is
administered as the sixth dose.
[0935] In an embodiment, the schedule of vaccination of said
sequential dose consists of a series of 7 doses.
[0936] In a particular embodiment, said schedule consists of a
series of 7 doses wherein each dose is separated by an interval of
about 1 to about 12 months. In a particular embodiment, said
schedule consists of a series of 7 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 7 doses wherein each dose is separated by an interval
of about 1 month to about 6 months. In a particular embodiment,
said schedule consists of a series of 7 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In a
particular embodiment, said schedule consists of a series of 7
doses wherein each dose is separated by an interval of about 1 to
about 2 months. In another embodiment, said schedule consists of a
series of 7 doses wherein each dose is separated by an interval of
about 1 month, or a series of 7 doses wherein each dose is
separated by an interval of about 2 months.
[0937] In an embodiment said 7-dose schedule consists of a series
of 6 doses wherein each dose is separated by an interval of about 1
month followed by a seventh dose about 10 months to about 13 months
after the first dose.
[0938] In an embodiment of said 7-doses schedule, the first,
second, third, fourth, fifth and sixth doses are administered in
the first year of age and the seventh dose is a toddler dose. In an
embodiment, said 7-dose schedule consists of a series of 6 doses
wherein each dose is separated by an interval of about 1 month (for
example 28-40 days between doses), starting at 2 months of age, and
followed by a toddler dose at 12-18 months of age. In an
embodiment, said schedule consists of a series of 6 doses wherein
each dose is separated by an interval of about 1 month (for example
28-40 days between doses), starting at 2 months of age, and
followed by a toddler dose at 12-15 months of age.
[0939] In an embodiment of said 7-doses schedule, the first
immunogenic composition according to the invention (such as the
ones of section 2 above) and the second immunogenic composition
(such as disclosed at section 3 above) are administered in the
order according to the any of the schedules provided for the
6-doses schedule (see above), followed by a seventh dose. In an
embodiment, the first immunogenic composition according to the
invention is administered as the seventh dose. In another
embodiment, the second immunogenic composition is administered as
the seventh dose.
[0940] In an embodiment, the schedule of vaccination of said
sequential dose consists of a series of 8 doses.
[0941] In a particular embodiment, said schedule consists of a
series of 8 doses wherein each dose is separated by an interval of
about 1 to about 12 months. In a particular embodiment, said
schedule consists of a series of 8 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 8 doses wherein each dose is separated by an interval
of about 1 month to about 6 months. In a particular embodiment,
said schedule consists of a series of 8 doses wherein each dose is
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In a
particular embodiment, said schedule consists of a series of 8
doses wherein each dose is separated by an interval of about 1 to
about 2 months. In another embodiment, said schedule consists of a
series of 8 doses wherein each dose is separated by an interval of
about 1 month, or a series of 8 doses wherein each dose is
separated by an interval of about 2 months.
[0942] In an embodiment said 8-dose schedule consists of a series
of 7 doses wherein each dose is separated by an interval of about 1
month followed by an eighth dose about 10 months to about 13 months
after the first dose.
[0943] In an embodiment of said 8-doses schedule, the first,
second, third, fourth, fifth, sixth and seventh doses are
administered in the first year of age and the eighth dose is a
toddler dose. In an embodiment, said 8-dose schedule consists of a
series of 7 doses wherein each dose is separated by an interval of
about 1 month (for example 28-40 days between doses), starting at 2
months of age, and followed by a toddler dose at 12-18 months of
age. In an embodiment, said schedule consists of a series of 7
doses wherein each dose is separated by an interval of about 1
month (for example 28-40 days between doses), starting at 2 months
of age, and followed by a toddler dose at 12-15 months of age.
[0944] In an embodiment of said 8-doses schedule, the first
immunogenic composition according to the invention (such as the
ones of section 2 above) and the second immunogenic composition
(such as disclosed at section 3 above) are administered in the
order according to the any of the schedules provided for the
7-doses schedule (see above), followed by a eighth dose. In an
embodiment, the first immunogenic composition according to the
invention is administered as the eighth dose. In another
embodiment, the second immunogenic composition is administered as
the eighth dose.
[0945] In an embodiment, the present invention pertains to the
sequential administration of: [0946] (a) a first immunogenic
composition according to the invention (such as the ones of section
2 above) and [0947] (b) the concomitant administration of the first
immunogenic composition according to the invention (such as the
ones of section 2 above) with a second immunogenic composition.
[0948] In an embodiment said second immunogenic composition is any
of the immunogenic compositions disclosed at section 3 above.
[0949] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 2
administrations. In an embodiment, the schedule of vaccination
consists of a series of 2 administrations separated by an interval
of about 1 month to about 12 months. In a particular embodiment,
said schedule consists of a series of 2 administrations separated
by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12
months. In a particular embodiment, said schedule consists of a
series of 2 administrations separated by an interval of about 1
month to about 6 months. In a particular embodiment, said schedule
consists of a series of 2 administrations separated by an interval
of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, the schedule
of vaccination consists of a series of 2 administrations separated
by an interval of about 1 month to about 2 months. In a particular
embodiment, said schedule consists of a series of 2 administrations
separated by an interval of about 1 month, or a series of 2
administrations separated by an interval of about 2 months.
[0950] In an embodiment of said schedule, a first immunogenic
composition according to the invention is administered first and
the concomitant administration of the first immunogenic composition
according to the invention with a second immunogenic composition is
administered second. In another embodiment, the concomitant
administration of a first immunogenic composition according to the
invention with a second immunogenic composition is administered
first and the first immunogenic composition according to the
invention is administered second.
[0951] In an embodiment of said 2-administrations schedule, the
first and second administrations are administered in the first year
of age. In an embodiment of said 2-administrations schedule, the
first administration is administered in the first year of age and
the second administration is a toddler administration. In an
embodiment, said toddler administration is administered at 12-18
months of age. In an embodiment, said toddler administration is
administered at 12-15 months of age.
[0952] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 3
administrations. In an embodiment, said schedule consists of a
series of 3 administrations separated by an interval of about 1
month to about 12 months. In a particular embodiment, said schedule
consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11 or 12 months. In a particular embodiment, said
schedule consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1 month to
about 6 months. In a particular embodiment, said schedule consists
of a series of 3 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In an
embodiment, said schedule consists of a series of 3 administrations
separated by an interval of about 1 month to about 2 months. In
another embodiment, said schedule consists of a series of 3
administrations wherein each administration is separated by an
interval of about 1 month, or a series of 3 administrations wherein
each administration is separated by an interval of about 2
months.
[0953] In an embodiment of said 3-administrations schedule, the
first and second administrations are administered in the first year
of age and the third administration is a toddler administration. In
an embodiment, the first and second administrations are separated
by an interval of about 1 month to about 2 months (for example
28-56 days between administrations), starting at 2 months of age,
and the third administration is a toddler administration at 12-18
months of age. In an embodiment, the first and second
administrations are separated by an interval of about 1 month to
about 2 months (for example 28-56 days between administrations),
starting at 2 months of age, and the third administration is a
toddler administration at 12-15 months of age.
[0954] In an embodiment of said 3-administrations schedule, the
first immunogenic composition according to the invention is
administered at the first and second administrations and the
concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the third administration.
[0955] In another embodiment of said 3-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first and second administrations and the
first immunogenic composition according to the invention is
administered at the third administration.
[0956] In another embodiment of said 3-administrations schedule,
the first immunogenic composition according to the invention is
administered at the first administration, the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition is
administered at the second administration and the first immunogenic
composition according to the invention is administered at the third
administration.
[0957] In yet another embodiment of said 3-administrations
schedule, the concomitant administration of the first immunogenic
composition according to the invention with the second immunogenic
composition is administered at the first administration, the first
immunogenic composition according to the invention is administered
at the second administration and the concomitant administration of
the first immunogenic composition according to the invention with
the second immunogenic composition is administered at the third
administration.
[0958] In yet another embodiment of said 3-administrations
schedule, the first immunogenic composition according to the
invention is administered at the first administration and the
concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the second and third administrations.
[0959] In another embodiment of said 3-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first administration and the first
immunogenic composition according to the invention is administered
at the second and third administrations.
[0960] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 4
administrations.
[0961] In an embodiment, said schedule consists of a series of 4
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 4 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 4 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 4
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 4 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 4 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 4 administrations wherein each administration is
separated by an interval of about 2 months.
[0962] In an embodiment of said 4-administrations schedule, said
schedule consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1 month to
about 4 months followed by a fourth administration about 10 months
to about 13 months after the first administration. In another
embodiment, said schedule consists of a series of 3 administrations
wherein each administration is separated by an interval of about 1,
2, 3 or 4 months followed by a fourth administration about 10
months to about 13 months after the first administration. In
another embodiment, said schedule consists of a series of 3
administrations wherein each administration is separated by an
interval of about 1 month to about 2 months followed by a fourth
administration about 10 months to about 13 months after the first
administration. In another embodiment, said schedule consists of a
series of 3 administrations wherein each administration is
separated by an interval of about 1 month followed by a fourth
administration about 10 months to about 13 months after the first
administration, or a series of 3 administrations wherein each
administration is separated by an interval of about 2 months
followed by a fourth administration about 10 months to about 13
months after the first administration.
[0963] In an embodiment of said 4-administrations schedule, the
first, second and third administrations are administered in the
first year of age and the fourth administration is a toddler
administration. In an embodiment, said 4-administrations schedule
consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1 month to
about 2 months (for example 28-56 days between administrations),
starting at 2 months of age, and followed by a toddler
administration at 12-18 months of age. In an embodiment, said
schedule consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1 month to
about 2 months (for example 28-56 days between administrations),
starting at 2 months of age, and followed by a toddler
administration at 12-15 months of age.
[0964] In an embodiment, said 4-administrations schedule consists
of a series of administrations at 2, 4, 6, and 12-15 months of
age.
[0965] In an embodiment of said 4-administrations schedule, the
first immunogenic composition according to the invention is
administered at the first, second and third administrations and the
concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the fourth administration.
[0966] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first, second and third administrations and
the first immunogenic composition according to the invention is
administered at the fourth administration.
[0967] In another embodiment of said 4-administrations schedule,
the first immunogenic composition according to the invention is
administered at the first and second administrations and the
concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the third and fourth administrations.
[0968] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first and second administrations and the
first immunogenic composition according to the invention is
administered at the third and fourth administrations.
[0969] In another embodiment of said 4-administrations schedule,
the first immunogenic composition according to the invention is
administered at the first and second administrations, the
concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the third administration and the first
immunogenic composition according to the invention is administered
at the fourth administration.
[0970] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first and second administrations, the first
immunogenic composition according to the invention is administered
at the third administration and the concomitant administration of
the first immunogenic composition according to the invention with
the second immunogenic composition is administered at the fourth
administration.
[0971] In another embodiment of said 4-administrations schedule,
the first immunogenic composition according to the invention is
administered at the first administration and the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition is
administered at the second, third and fourth administrations.
[0972] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first administration and the first
immunogenic composition according to the invention is administered
at the second, third and fourth administration.
[0973] In another embodiment of said 4-administrations schedule,
the first immunogenic composition according to the invention is
administered at the first administration, the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition is
administered at the second administration, the first immunogenic
composition according to the invention is administered at the third
administration and the concomitant administration of the first
immunogenic composition according to the invention with the second
immunogenic composition is administered at the fourth
administration.
[0974] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first administration, the first immunogenic
composition according to the invention is administered at the
second administration, the concomitant administration of the first
immunogenic composition according to the invention with the second
immunogenic composition is administered at the third administration
and the first immunogenic composition according to the invention is
administered at the fourth administration.
[0975] In another embodiment of said 4-administrations schedule,
the first immunogenic composition according to the invention is
administered at the first administration, the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition is
administered at the second administration and the first immunogenic
composition according to the invention is administered at the third
and fourth administrations.
[0976] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first administration, the first immunogenic
composition according to the invention is administered at the
second administration and the concomitant administration of the
first immunogenic composition according to the invention with the
second immunogenic composition is administered at the third and
fourth administrations.
[0977] In another embodiment of said 4-administrations schedule,
the first immunogenic composition according to the invention is
administered at the first administration, the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition is
administered at the second and third administrations and the first
immunogenic composition according to the invention is administered
at the fourth administration.
[0978] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
is administered at the first administration, the first immunogenic
composition according to the invention is administered at the
second and third administrations and the concomitant administration
of the first immunogenic composition according to the invention
with the second immunogenic composition is administered at the
fourth administration.
[0979] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 5
administrations.
[0980] In an embodiment, said schedule consists of a series of 5
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 5 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 5 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 5
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 5 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 5 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 5 administrations wherein each administration is
separated by an interval of about 2 months.
[0981] In an embodiment said schedule consists of a series of 4
administrations wherein each dose is separated by an interval of
about 1 month to about 3 months followed by a fifth administration
about 10 months to about 13 months after the first administration.
In another embodiment, said schedule consists of a series of 4
administrations wherein each administration is separated by an
interval of about 1 month to about 2 months followed by a fifth
administration about 10 months to about 13 months after the first
dose. In another embodiment, said schedule consists of a series of
4 administrations wherein each dose is separated by an interval of
about 1 month followed by a fifth administration about 10 months to
about 13 months after the first administration, or a series of 4
administrations wherein each administration is separated by an
interval of about 2 months followed by a fifth administration about
10 months to about 13 months after the first administration.
[0982] In an embodiment of said 5-administrations schedule, the
first, second, third and fourth administrations are administered in
the first year of age and the fifth administration is a toddler
dose. In an embodiment, said 5-administrations schedule consists of
a series of 4 administrations wherein each administration is
separated by an interval of about 1 month to about 2 months (for
example 28-56 days between doses), starting at 2 months of age, and
followed by a toddler administration at 12-18 months of age. In an
embodiment, said schedule consists of a series of 4 administrations
wherein each administrations is separated by an interval of about 1
month to about 2 months (for example 28-56 days between doses),
starting at 2 months of age, and followed by a toddler
administration at 12-15 months of age.
[0983] In an embodiment of said 5-administrations schedule, the
first immunogenic composition according to the invention
(designated 1.sup.st IC in the below table) and the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition (designated
1.sup.st IC/2.sup.nd IC in the below table A) are administered in
the following order:
TABLE-US-00008 TABLE A Schedule Dose number 1 2 3 4 5 1 1st IC/2nd
IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 2 1st
IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 3
1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 4
1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC
5 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC
6 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 7
1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC 8
1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC
9 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC
10 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd
IC 11 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1.sup.st
IC 12 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1st
IC/2nd IC 13 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC
1.sup.st IC 14 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
1st IC/2nd IC 15 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 16 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd
IC 1st IC/2nd IC 17 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1st
IC/2nd IC 1.sup.st IC 18 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC
1.sup.st IC 1st IC/2nd IC 19 1.sup.st IC 1st IC/2nd IC 1st IC/2nd
IC 1.sup.st IC 1.sup.st IC 20 1.sup.st IC 1st IC/2nd IC 1.sup.st IC
1st IC/2nd IC 1st IC/2nd IC 21 1.sup.st IC 1st IC/2nd IC 1.sup.st
IC 1st IC/2nd IC 1.sup.st IC 22 1.sup.st IC 1st IC/2nd IC 1.sup.st
IC 1.sup.st IC 1st IC/2nd IC 23 1.sup.st IC 1st IC/2nd IC 1.sup.st
IC 1.sup.st IC 1.sup.st IC 24 1.sup.st IC 1.sup.st IC 1st IC/2nd IC
1st IC/2nd IC 1st IC/2nd IC 25 1.sup.st IC 1.sup.st IC 1st IC/2nd
IC 1st IC/2nd IC 1.sup.st IC 26 1.sup.st IC 1.sup.st IC 1st IC/2nd
IC 1.sup.st IC 1st IC/2nd IC 27 1.sup.st IC 1.sup.st IC 1st IC/2nd
IC 1.sup.st IC 1.sup.st IC 28 1.sup.st IC 1.sup.st IC 1.sup.st IC
1st IC/2nd IC 1st IC/2nd IC 29 1.sup.st IC 1.sup.st IC 1.sup.st IC
1st IC/2nd IC 1.sup.st IC 30 1.sup.st IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 1st IC/2nd IC
[0984] The above table provide the order of administration of the
first immunogenic composition according to the invention
(designated 1.sup.st IC in the below table) and the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition (designated
1.sup.st IC/2.sup.nd IC in the below table) for the different
doses, for example schedule number 1 is to be read as: in
embodiment of said 5-administrations schedule, the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition is
administered as the first, second, third and fourth doses and the
first immunogenic composition according to the invention is
administered as the fifth dose.
[0985] In a preferred embodiment, the order of administration is
according to schedule 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 16, 17, 18, 19, 20, 22 or 23.
[0986] In an embodiment, the schedule of vaccination of said
sequential dose consists of a series of 6 administrations.
[0987] In an embodiment, said schedule consists of a series of 6
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 6 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 6 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 6
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 6 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 6 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 6 administrations wherein each administration is
separated by an interval of about 2 months.
[0988] In an embodiment said 6-administrations schedule consists of
a series of 5 administrations wherein each administration is
separated by an interval of about 1 month to about 2 months
followed by a sixth administration about 10 months to about 13
months after the first administration. In another embodiment, said
schedule consists of a series of 5 administrations wherein each
administration is separated by an interval of about 1 month
followed by a sixth administration about 10 months to about 13
months after the first administration, or a series of 5
administrations wherein each administration is separated by an
interval of about 2 months followed by a sixth administration about
10 months to about 13 months after the first administration.
[0989] In an embodiment of said 6-administrations schedule, the
first, second, third, fourth and fifth administrations are
administered in the first year of age and the sixth administration
is a toddler administration. In an embodiment, said
6-administrations schedule consists of a series of 5
administrations wherein each administration is separated by an
interval of about 1 month to about 2 months (for example 28-56 days
between administrations), starting at 2 months of age, and followed
by a toddler administration at 12-18 months of age. In an
embodiment, said schedule consists of a series of 5 administrations
wherein each administration is separated by an interval of about 1
month to about 2 months (for example 28-56 days between
administrations), starting at 2 months of age, and followed by a
toddler administration at 12-15 months of age.
[0990] In an embodiment of said 6-administrations schedule, the
first immunogenic composition according to the invention and the
concomitant administration of the first immunogenic composition
according to the invention with the second immunogenic composition
are administered in the order according to the any of the 30
schedules provided for the 5-administrations schedule (see above
table, schedule 1 to 30), followed by a sixth administration. In an
embodiment, the first immunogenic composition according to the
invention is administered at the sixth administration. In another
embodiment, the concomitant administration of the first immunogenic
composition according to the invention with the second immunogenic
composition is administered at the sixth administration.
[0991] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 7
administrations.
[0992] In an embodiment, said schedule consists of a series of 7
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 7 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 7 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 7
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 7 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 7 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 7 administrations wherein each administration is
separated by an interval of about 2 months.
[0993] In an embodiment said 7-administrations schedule consists of
a series of 6 administrations wherein each administration is
separated by an interval of about 1 month followed by a seventh
administration about 10 months to about 13 months after the first
administration.
[0994] In an embodiment of said 7-administrations schedule, the
first, second, third, fourth, fifth and sixth administrations are
administered in the first year of age and the seventh
administration is a toddler administration. In an embodiment, said
7-administrations schedule consists of a series of 6
administrations wherein each administration is separated by an
interval of about 1 month (for example 28-40 days between
administrations), starting at 2 months of age, and followed by a
toddler administration at 12-18 months of age. In an embodiment,
said schedule consists of a series of 6 administrations wherein
each administration is separated by an interval of about 1 month
(for example 28-40 days between administrations), starting at 2
months of age, and followed by a toddler administration at 12-15
months of age.
[0995] In an embodiment of said 7-administrations schedule, the
first immunogenic composition according to the invention (such as
the ones of section 2 above) and the concomitant administration of
the first immunogenic composition according to the invention with
the second immunogenic composition are administered in the order
according to the any of the schedules provided for the
6-administrations schedule (see above), followed by a seventh
administration. In an embodiment, the first immunogenic composition
according to the invention is administered at the seventh
administration. In another embodiment, the concomitant
administration of the first immunogenic composition according to
the invention with the second immunogenic composition is
administered at the seventh administration.
[0996] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 8
administrations.
[0997] In an embodiment, said schedule consists of a series of 8
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 8 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 8 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 8
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 8 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 8 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 8 administrations wherein each administration is
separated by an interval of about 2 months.
[0998] In an embodiment said 8-administration schedule consists of
a series of 7 administrations wherein each administration is
separated by an interval of about 1 month followed by an eight
administration about 10 months to about 13 months after the first
administration.
[0999] In an embodiment of said 8-administrations schedule, the
first, second, third, fourth, fifth, sixth and seventh
administrations are administered in the first year of age and the
eighth administration is a toddler administration. In an
embodiment, said 8-administrations schedule consists of a series of
7 administrations wherein each administration is separated by an
interval of about 1 month (for example 28-40 days between
administrations), starting at 2 months of age, and followed by a
toddler administration at 12-18 months of age. In an embodiment,
said schedule consists of a series of 7 administrations wherein
each administration is separated by an interval of about 1 month
(for example 28-40 days between administrations), starting at 2
months of age, and followed by a toddler administration at 12-15
months of age.
[1000] In an embodiment of said 8-administrations schedule, the
first immunogenic composition according to the invention (such as
the ones of section 2 above) and the concomitant administration of
the first immunogenic composition according to the invention with
the second immunogenic composition are administered in the order
according to the any of the schedules provided for the
7-administrations schedule (see above), followed by a eighth dose.
In an embodiment, the first immunogenic composition according to
the invention is administered at the eighth dose. In another
embodiment, the concomitant administration of the first immunogenic
composition according to the invention with the second immunogenic
composition is administered at the eighth dose.
[1001] In an embodiment, in the administration schedules disclosed
above the concomitant administration(s) is/are replaced by a
concurrent administration.
[1002] In an embodiment, the present invention pertains to the
sequential administration of: [1003] (a) the second immunogenic
composition (such as the ones of section 3 above) and [1004] (b)
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition.
[1005] In an embodiment said second immunogenic composition is any
of the immunogenic compositions disclosed at section 3 above.
[1006] In an embodiment, the schedule of administration is any one
of the schedules disclosed above for the sequential administration
of a first immunogenic composition according to the invention and
the concomitant administration of the first immunogenic composition
according to the invention with a second immunogenic composition
(bottom of page 152-to page 164), wherein administration of said
second immunogenic composition of (a) replace administration of the
first immunogenic composition of (a) in said schedules.
[1007] In an embodiment, in any of the administration schedules
disclosed above a concomitant administration(s) is/are replaced by
a concurrent administration.
[1008] Therefore in an embodiment, the present invention pertains
to the sequential administration of: [1009] (a) the second
immunogenic composition (such as the ones of section 3 above) and
[1010] (b) the concomitant administration of the first immunogenic
composition according to the invention (such as the ones of section
2 above) with said second immunogenic composition.
[1011] In an embodiment said second immunogenic composition is any
of the immunogenic compositions disclosed at section 3 above.
[1012] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 2
administrations. In an embodiment, the schedule of vaccination
consists of a series of 2 administrations separated by an interval
of about 1 month to about 12 months. In a particular embodiment,
said schedule consists of a series of 2 administrations separated
by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12
months. In a particular embodiment, said schedule consists of a
series of 2 administrations separated by an interval of about 1
month to about 6 months. In a particular embodiment, said schedule
consists of a series of 2 administrations separated by an interval
of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, the schedule
of vaccination consists of a series of 2 administrations separated
by an interval of about 1 month to about 2 months. In a particular
embodiment, said schedule consists of a series of 2 administrations
separated by an interval of about 1 month, or a series of 2
administrations separated by an interval of about 2 months.
[1013] In an embodiment of said schedule, the second immunogenic
composition (such as the ones of section 3 above) is administered
first and the concomitant administration of the first immunogenic
composition according to the invention (such as the ones of section
2 above) with said second immunogenic composition is administered
second. In another embodiment, the concomitant administration of
the first immunogenic composition according to the invention (such
as the ones of section 2 above) with said second immunogenic
composition is administered first and the second immunogenic
composition (such as the ones of section 3 above) is administered
second.
[1014] In an embodiment of said 2-administrations schedule, the
first and second administrations are administered in the first year
of age. In an embodiment of said 2-administrations schedule, the
first administration is administered in the first year of age and
the second administration is a toddler administration. In an
embodiment, said toddler administration is administered at 12-18
months of age. In an embodiment, said toddler administration is
administered at 12-15 months of age.
[1015] In an embodiment, in any of the 2-administrations schedules
disclosed above the concomitant administration(s) is/are replaced
by a concurrent administration.
[1016] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 3
administrations. In an embodiment, said schedule consists of a
series of 3 administrations separated by an interval of about 1
month to about 12 months. In a particular embodiment, said schedule
consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11 or 12 months. In a particular embodiment, said
schedule consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1 month to
about 6 months. In a particular embodiment, said schedule consists
of a series of 3 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5 or 6 months. In an
embodiment, said schedule consists of a series of 3 administrations
separated by an interval of about 1 month to about 2 months. In
another embodiment, said schedule consists of a series of 3
administrations wherein each administration is separated by an
interval of about 1 month, or a series of 3 administrations wherein
each administration is separated by an interval of about 2 months.
In another embodiment, said schedule consists of a series of 3
administrations wherein the first two administrations are separated
by an interval of about 1 month to about 2 months followed by a
third administration about 10 months to about 13 months after the
first administration.
[1017] In an embodiment of said 3-administrations schedule, the
first and second administrations are administered in the first year
of age and the third administration is a toddler administration. In
an embodiment, the first and second administrations are separated
by an interval of about 1 month to about 2 months (for example
28-56 days between administrations), starting at 2 months of age,
and the third administration is a toddler administration at 12-18
months of age. In an embodiment, the first and second
administrations are separated by an interval of about 1 month to
about 2 months (for example 28-56 days between administrations),
starting at 2 months of age, and the third administration is a
toddler administration at 12-15 months of age.
[1018] In an embodiment of said schedule, the second immunogenic
composition (such as the ones of section 3 above) is administered
first and the concomitant administration of the first immunogenic
composition according to the invention (such as the ones of section
2 above) with said second immunogenic composition is administered
second.
[1019] In an embodiment of said 3-administrations schedule, the
second immunogenic composition (such as the ones of section 3
above) is administered at the first and second administrations and
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
third administration.
[1020] In another embodiment of said 3-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
first and second administrations and the second immunogenic
composition (such as the ones of section 3 above) is administered
at the third administration.
[1021] In another embodiment of said 3-administrations schedule,
the second immunogenic composition (such as the ones of section 3
above) is administered at the first administration, the concomitant
administration of the first immunogenic composition according to
the invention (such as the ones of section 2 above) is administered
at the second administration and the second immunogenic composition
(such as the ones of section 3 above) is administered at the third
administration.
[1022] In yet another embodiment of said 3-administrations
schedule, the concomitant administration of the first immunogenic
composition according to the invention (such as the ones of section
2 above) is administered at the first administration, the second
immunogenic composition (such as the ones of section 3 above) is
administered at the second administration and the concomitant
administration of the first immunogenic composition according to
the invention (such as the ones of section 2 above) is administered
at the third administration.
[1023] In yet another embodiment of said 3-administrations
schedule, the second immunogenic composition (such as the ones of
section 3 above) is administered at the first administration and
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above) is
administered at the second and third administrations.
[1024] In another embodiment of said 3-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above) is
administered at the first administration and the second immunogenic
composition (such as the ones of section 3 above) is administered
at the second and third administrations.
[1025] Therefore in an embodiment of said 3-administrations
schedule, the second immunogenic composition (such as the ones of
section 3 above) (designated 2.sup.nd IC in the below table) and
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
(designated 1.sup.st IC/2.sup.nd IC in the below table B) are
administered in the following order:
TABLE-US-00009 TABLE B Schedule Dose number 1 2 3 1 2.sup.nd IC
2.sup.nd IC 1st IC/2nd IC 2 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC
3 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 4 1st IC/2nd IC 2.sup.nd IC
1st IC/2nd IC 5 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 6 1st
IC/2nd IC 2.sup.nd IC 2.sup.nd IC
[1026] The above table provides the order of administration of the
second immunogenic composition (such as the ones of section 3
above) (designated 2.sup.nd IC in the below table) and the
concomitant administration of the first immunogenic composition
according to the invention with said second immunogenic composition
(designated 1.sup.st IC/2.sup.nd IC in the below table) for the
different doses, for example schedule number 1 is to be read as: in
embodiment of said 3-administrations schedule, the second
immunogenic composition is administered as the first and second
doses and the concomitant administration of the first immunogenic
composition according to the invention with said second immunogenic
composition is administered as the third dose.
[1027] In a preferred embodiment, the order of administration is
according to schedule 1.
[1028] In an embodiment, in any of the 3-administrations schedules
disclosed above the concomitant administration(s) is/are replaced
by a concurrent administration.
[1029] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 4
administrations.
[1030] In an embodiment, said schedule consists of a series of 4
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 4 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 4 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 4
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 4 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 4 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 4 administrations wherein each administration is
separated by an interval of about 2 months.
[1031] In an embodiment of said 4-administrations schedule, said
schedule consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1 month to
about 4 months followed by a fourth administration about 10 months
to about 13 months after the first administration. In another
embodiment, said schedule consists of a series of 3 administrations
wherein each administration is separated by an interval of about 1,
2, 3 or 4 months followed by a fourth administration about 10
months to about 13 months after the first administration. In
another embodiment, said schedule consists of a series of 3
administrations wherein each administration is separated by an
interval of about 1 month to about 2 months followed by a fourth
administration about 10 months to about 13 months after the first
administration. In another embodiment, said schedule consists of a
series of 3 administrations wherein each administration is
separated by an interval of about 1 month followed by a fourth
administration about 10 months to about 13 months after the first
administration, or a series of 3 administrations wherein each
administration is separated by an interval of about 2 months
followed by a fourth administration about 10 months to about 13
months after the first administration.
[1032] In an embodiment of said 4-administrations schedule, the
first, second and third administrations are administered in the
first year of age and the fourth administration is a toddler
administration. In an embodiment, said 4-administrations schedule
consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1 month to
about 2 months (for example 28-56 days between administrations),
starting at 2 months of age, and followed by a toddler
administration at 12-18 months of age. In an embodiment, said
schedule consists of a series of 3 administrations wherein each
administration is separated by an interval of about 1 month to
about 2 months (for example 28-56 days between administrations),
starting at 2 months of age, and followed by a toddler
administration at 12-15 months of age.
[1033] In an embodiment, said 4-administrations schedule consists
of a series of administrations at 2, 4, 6, and 12-15 months of
age.
[1034] In an embodiment of said 4-administrations schedule, the
second immunogenic composition (such as the ones of section 3
above) is administered at the first, second and third
administrations and the concomitant administration of the first
immunogenic composition according to the invention (such as the
ones of section 2 above) with said second immunogenic composition
is administered at the fourth administration.
[1035] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
first, second and third administrations and the second immunogenic
composition (such as the ones of section 3 above) is administered
at the fourth administration.
[1036] In another embodiment of said 4-administrations schedule,
the second immunogenic composition (such as the ones of section 3
above) is administered at the first and second administrations and
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
third and fourth administrations.
[1037] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
first and second administrations and the second immunogenic
composition (such as the ones of section 3 above) is administered
at the third and fourth administrations.
[1038] In another embodiment of said 4-administrations schedule,
the second immunogenic composition (such as the ones of section 3
above) is administered at the first and second administrations, the
concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
third administration and the second immunogenic composition (such
as the ones of section 3 above) is administered at the fourth
administration.
[1039] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
first and second administrations, the second immunogenic
composition (such as the ones of section 3 above) is administered
at the third administration and the concomitant administration of
the first immunogenic composition according to the invention (such
as the ones of section 2 above) with said second immunogenic
composition is administered at the fourth administration.
[1040] In another embodiment of said 4-administrations schedule,
the second immunogenic composition (such as the ones of section 3
above) is administered at the first administration and the
concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
second, third and fourth administrations.
[1041] In another embodiment of said 4-administration schedule, the
concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
first administration and the second immunogenic composition (such
as the ones of section 3 above) is administered at the second,
third and fourth administration.
[1042] In another embodiment of said 4-administrations schedule,
the second immunogenic composition (such as the ones of section 3
above) is administered at the first administration, the concomitant
administration of the first immunogenic composition according to
the invention (such as the ones of section 2 above) with said
second immunogenic composition is administered at the second
administration, the second immunogenic composition (such as the
ones of section 3 above) is administered at the third
administration and the concomitant administration of the first
immunogenic composition according to the invention (such as the
ones of section 2 above) with said second immunogenic composition
is administered at the fourth administration.
[1043] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
first administration, the second immunogenic composition (such as
the ones of section 3 above) is administered at the second
administration, the concomitant administration of the first
immunogenic composition according to the invention (such as the
ones of section 2 above) with said second immunogenic composition
is administered at the third administration and the second
immunogenic composition is administered at the fourth
administration.
[1044] In another embodiment of said 4-administration schedule, the
second immunogenic composition (such as the ones of section 3
above) is administered at the first administration, the concomitant
administration of the first immunogenic composition according to
the invention (such as the ones of section 2 above) with said
second immunogenic composition is administered at the second
administration and the second immunogenic composition (such as the
ones of section 3 above) is administered at the third and fourth
administrations.
[1045] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
first administration, the second immunogenic composition (such as
the ones of section 3 above) is administered at the second
administration and the concomitant administration of the first
immunogenic composition according to the invention (such as the
ones of section 2 above) with said second immunogenic composition
is administered at the third and fourth administrations.
[1046] In another embodiment of said 4-administrations schedule,
the second immunogenic composition (such as the ones of section 3
above) is administered at the first administration, the concomitant
administration of the first immunogenic composition according to
the invention (such as the ones of section 2 above) with said
second immunogenic composition is administered at the second and
third administrations and the second immunogenic composition (such
as the ones of section 3 above) is administered at the fourth
administration.
[1047] In another embodiment of said 4-administrations schedule,
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition is administered at the
first administration, the second immunogenic composition (such as
the ones of section 3 above) is administered at the second and
third administrations and the concomitant administration of the
first immunogenic composition according to the invention (such as
the ones of section 2 above) with said second immunogenic
composition is administered at the fourth administration.
[1048] Therefore in an embodiment of said 4-administrations
schedule, the second immunogenic composition (such as the ones of
section 3 above) (designated 2.sup.nd IC in the below table) and
the concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition (designated 1.sup.st
IC/2.sup.nd IC in the below table C) are administered in the
following order:
TABLE-US-00010 TABLE C Schedule Dose number 1 2 3 4 1 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 2 1st IC/2nd IC 1st IC/2nd IC
1st IC/2nd IC 2.sup.nd IC 3 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC
1st IC/2nd IC 4 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC
5 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 6 1st IC/2nd IC
1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 7 2.sup.nd IC 1st IC/2nd IC
1st IC/2nd IC 1st IC/2nd IC 8 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 9 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC
10 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 11 2.sup.nd
IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 12 1st IC/2nd IC 2.sup.nd
IC 1st IC/2nd IC 1st IC/2nd IC 13 2.sup.nd IC 1st IC/2nd IC 1st
IC/2nd IC 2.sup.nd IC 14 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st
IC/2nd IC
[1049] The above table provides the order of administration of the
second immunogenic composition (such as the ones of section 3
above) (designated 2.sup.nd IC in the below table) and the
concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition (designated 1.sup.st
IC/2.sup.nd IC in the below table) for the different doses, for
example schedule number 1 is to be read as: in embodiment of said
3-administrations schedule, the second immunogenic composition is
administered as the first, second and third doses and the
concomitant administration of the first immunogenic composition
according to the invention with said second immunogenic composition
is administered as the fourth dose.
[1050] In a preferred embodiment, the order of administration is
according to schedule 1, 3 or 5. In an embodiment, in any of the
4-administrations schedules disclosed above the concomitant
administration(s) is/are replaced by a concurrent
administration.
[1051] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 5
administrations.
[1052] In an embodiment, said schedule consists of a series of 5
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 5 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 5 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 5
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 5 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 5 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 5 administrations wherein each administration is
separated by an interval of about 2 months.
[1053] In an embodiment said schedule consists of a series of 4
administrations wherein each dose is separated by an interval of
about 1 month to about 3 months followed by a fifth administration
about 10 months to about 13 months after the first administration.
In another embodiment, said schedule consists of a series of 4
administrations wherein each administration is separated by an
interval of about 1 month to about 2 months followed by a fifth
administration about 10 months to about 13 months after the first
dose. In another embodiment, said schedule consists of a series of
4 administrations wherein each dose is separated by an interval of
about 1 month followed by a fifth administration about 10 months to
about 13 months after the first administration, or a series of 4
administrations wherein each administration is separated by an
interval of about 2 months followed by a fifth administration about
10 months to about 13 months after the first administration.
[1054] In an embodiment of said 5-administrations schedule, the
first, second, third and fourth administrations are administered in
the first year of age and the fifth administration is a toddler
dose. In an embodiment, said 5-administrations schedule consists of
a series of 4 administrations wherein each administration is
separated by an interval of about 1 month to about 2 months (for
example 28-56 days between doses), starting at 2 months of age, and
followed by a toddler administration at 12-18 months of age. In an
embodiment, said schedule consists of a series of 4 administrations
wherein each administrations is separated by an interval of about 1
month to about 2 months (for example 28-56 days between doses),
starting at 2 months of age, and followed by a toddler
administration at 12-15 months of age.
[1055] In an embodiment of said 5-administrations schedule, the
second immunogenic composition (such as the ones of section 3
above) (designated 2.sup.nd IC in the below table) and the
concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition (designated 1.sup.st
IC/2.sup.nd IC in the below table D) are administered in the
following order:
TABLE-US-00011 TABLE D Schedule Dose number 1 2 3 4 5 1 1st IC/2nd
IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2 1st
IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 3
1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 4
1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC
5 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC
6 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 7
1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 8
1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC
9 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC
10 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd
IC 11 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd
IC 12 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 1st
IC/2nd IC 13 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC
2.sup.nd IC 14 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
1st IC/2nd IC 15 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 16 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd
IC 1st IC/2nd IC 17 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 1st
IC/2nd IC 2.sup.nd IC 18 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC
2.sup.nd IC 1st IC/2nd IC 19 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd
IC 2.sup.nd IC 2.sup.nd IC 20 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC
1st IC/2nd IC 1st IC/2nd IC 21 2.sup.nd IC 1st IC/2nd IC 2.sup.nd
IC 1st IC/2nd IC 2.sup.nd IC 22 2.sup.nd IC 1st IC/2nd IC 2.sup.nd
IC 2.sup.nd IC 1st IC/2nd IC 23 2.sup.nd IC 1st IC/2nd IC 2.sup.nd
IC 2.sup.nd IC 2.sup.nd IC 24 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC
1st IC/2nd IC 1st IC/2nd IC 25 2.sup.nd IC 2.sup.nd IC 1st IC/2nd
IC 1st IC/2nd IC 2.sup.nd IC 26 2.sup.nd IC 2.sup.nd IC 1st IC/2nd
IC 2.sup.nd IC 1st IC/2nd IC 27 2.sup.nd IC 2.sup.nd IC 1st IC/2nd
IC 2.sup.nd IC 2.sup.nd IC 28 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
1st IC/2nd IC 1st IC/2nd IC 29 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
1st IC/2nd IC 2.sup.nd IC 30 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 1st IC/2nd IC
[1056] The above table provides the order of administration of the
second immunogenic composition (such as the ones of section 3
above) (designated 2.sup.nd IC in the below table) and the
concomitant administration of the first immunogenic composition
according to the invention (such as the ones of section 2 above)
with said second immunogenic composition (designated 1.sup.st
IC/2.sup.nd IC in the below table) for the different doses, for
example schedule number 1 is to be read as: in embodiment of said
5-administrations schedule, the concomitant administration of the
first immunogenic composition according to the invention with said
second immunogenic composition is administered as the first,
second, third and fourth doses and the second immunogenic
composition is administered as the fifth dose.
[1057] In a preferred embodiment, the order of administration is
according to schedule 16, 17, 18, 19, 20, 22, 23, 24, 25, 26, 27,
28 or 30.
[1058] In an embodiment, in any of the 5-administrations schedules
disclosed above the concomitant administration(s) is/are replaced
by a concurrent administration.
[1059] In an embodiment, the schedule of vaccination of said
sequential dose consists of a series of 6 administrations.
[1060] In an embodiment, said schedule consists of a series of 6
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 6 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 6 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 6
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 6 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 6 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 6 administrations wherein each administration is
separated by an interval of about 2 months.
[1061] In an embodiment said 6-administrations schedule consists of
a series of 5 administrations wherein each administration is
separated by an interval of about 1 month to about 2 months
followed by a sixth administration about 10 months to about 13
months after the first administration. In another embodiment, said
schedule consists of a series of 5 administrations wherein each
administration is separated by an interval of about 1 month
followed by a sixth administration about 10 months to about 13
months after the first administration, or a series of 5
administrations wherein each administration is separated by an
interval of about 2 months followed by a sixth administration about
10 months to about 13 months after the first administration.
[1062] In an embodiment of said 6-administrations schedule, the
first, second, third, fourth and fifth administrations are
administered in the first year of age and the sixth administration
is a toddler administration. In an embodiment, said
6-administrations schedule consists of a series of 5
administrations wherein each administration is separated by an
interval of about 1 month to about 2 months (for example 28-56 days
between administrations), starting at 2 months of age, and followed
by a toddler administration at 12-18 months of age. In an
embodiment, said schedule consists of a series of 5 administrations
wherein each administration is separated by an interval of about 1
month to about 2 months (for example 28-56 days between
administrations), starting at 2 months of age, and followed by a
toddler administration at 12-15 months of age.
[1063] In an embodiment of said 6-administrations schedule, the
second immunogenic composition (such as the ones of section 3
above) and the concomitant administration of the first immunogenic
composition according to the invention (such as the ones of section
2 above) with said second immunogenic composition are administered
in the order according to the any of the 30 schedules provided for
the 5-administrations schedule (see above table, schedules 1 to
30), followed by a sixth administration. In an embodiment, the
second immunogenic composition is administered at the sixth
administration. In another embodiment, the concomitant
administration of the first immunogenic composition according to
the invention with said second immunogenic composition is
administered at the sixth administration.
[1064] In an embodiment, in any of the 6-administrations schedules
disclosed above the concomitant administration(s) is/are replaced
by a concurrent administration.
[1065] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 7
administrations.
[1066] In an embodiment, said schedule consists of a series of 7
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 7 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 7 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 7
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 7 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 7 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 7 administrations wherein each administration is
separated by an interval of about 2 months.
[1067] In an embodiment said 7-administrations schedule consists of
a series of 6 administrations wherein each administration is
separated by an interval of about 1 month followed by a seventh
administration about 10 months to about 13 months after the first
administration.
[1068] In an embodiment of said 7-administrations schedule, the
first, second, third, fourth, fifth and sixth administrations are
administered in the first year of age and the seventh
administration is a toddler administration. In an embodiment, said
7-administrations schedule consists of a series of 6
administrations wherein each administration is separated by an
interval of about 1 month (for example 28-40 days between
administrations), starting at 2 months of age, and followed by a
toddler administration at 12-18 months of age. In an embodiment,
said schedule consists of a series of 6 administrations wherein
each administration is separated by an interval of about 1 month
(for example 28-40 days between administrations), starting at 2
months of age, and followed by a toddler administration at 12-15
months of age.
[1069] In an embodiment of said 7-administrations schedule, the
second immunogenic composition (such as the ones of section 3
above) and the concomitant administration of the first immunogenic
composition according to the invention (such as the ones of section
2 above) with said second immunogenic composition are administered
in the order according to the any of the schedules provided for the
6-administrations schedule (see above), followed by a seventh
administration. In an embodiment, the second immunogenic
composition is administered at the seventh administration. In
another embodiment, the concomitant administration of the first
immunogenic composition according to the invention with said second
immunogenic composition is administered at the seventh
administration.
[1070] In an embodiment, in any of the 7-administrations schedules
disclosed above the concomitant administration(s) is/are replaced
by a concurrent administration.
[1071] In an embodiment, the schedule of vaccination of said
sequential administration consists of a series of 8
administrations.
[1072] In an embodiment, said schedule consists of a series of 8
administrations separated by an interval of about 1 month to about
12 months. In a particular embodiment, said schedule consists of a
series of 8 administrations wherein each administration is
separated by an interval of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 months. In a particular embodiment, said schedule consists of
a series of 8 administrations wherein each administration is
separated by an interval of about 1 month to about 6 months. In a
particular embodiment, said schedule consists of a series of 8
administrations wherein each administration is separated by an
interval of about 1, 2, 3, 4, 5 or 6 months. In an embodiment, said
schedule consists of a series of 8 administrations separated by an
interval of about 1 month to about 2 months. In another embodiment,
said schedule consists of a series of 8 administrations wherein
each administration is separated by an interval of about 1 month,
or a series of 8 administrations wherein each administration is
separated by an interval of about 2 months.
[1073] In an embodiment said 8-administration schedule consists of
a series of 7 administrations wherein each administration is
separated by an interval of about 1 month followed by an eight
administration about 10 months to about 13 months after the first
administration.
[1074] In an embodiment of said 8-administrations schedule, the
first, second, third, fourth, fifth, sixth and seventh
administrations are administered in the first year of age and the
eighth administration is a toddler administration. In an
embodiment, said 8-administrations schedule consists of a series of
7 administrations wherein each administration is separated by an
interval of about 1 month (for example 28-40 days between
administrations), starting at 2 months of age, and followed by a
toddler administration at 12-18 months of age. In an embodiment,
said schedule consists of a series of 7 administrations wherein
each administration is separated by an interval of about 1 month
(for example 28-40 days between administrations), starting at 2
months of age, and followed by a toddler administration at 12-15
months of age.
[1075] In an embodiment of said 8-administrations schedule, the
second immunogenic composition (such as the ones of section 3
above) and the concomitant administration of the first immunogenic
composition according to the invention (such as the ones of section
2 above) with said second immunogenic composition are administered
in the order according to the any of the schedules provided for the
7-administrations schedule (see above), followed by a eighth dose.
In an embodiment, the second immunogenic composition is
administered at the eighth dose. In another embodiment, the
concomitant administration of the first immunogenic composition
according to the invention with said second immunogenic composition
is administered at the eighth dose.
[1076] In an embodiment, in any of the 8-administrations schedules
disclosed above the concomitant administration(s) is/are replaced
by a concurrent administration.
[1077] In an embodiment, the immunogenic compositions disclosed
herein are administered by intramuscular or subcutaneous
injection.
[1078] In an embodiment, the immunogenic compositions are
administered by intramuscular injection in a thigh or arm. In an
embodiment, the injection site is the anterolateral thigh muscle or
the deltoid muscle.
[1079] In an embodiment, the immunogenic compositions are
administered by subcutaneous injection in a thigh or an arm. In an
embodiment, the injection site is the fatty tissue over the
anterolateral thigh muscle or the fatty tissue over triceps.
[1080] In case of concomitant administration, the first injection
can be made in one thigh and the second in the other thigh
(preferably in the anterolateral thigh muscles). Alternatively, the
first injection can be made in one arm and the second in the other
arm (preferably in the deltoid muscles). The first injection can
also be made in a thigh and the second in an arm or the first
injection in an arm and the second in a thigh.
[1081] In an aspect the invention pertains to the kit of the
present invention (such as the ones of section 4 above) for use in
any of the immunization schedules disclosed above.
[1082] Particular embodiments of the invention are set forth in the
following numbered paragraphs:
[1083] 1. An immunogenic composition comprising at least one
glycoconjugate selected from the group consisting of a
glycoconjugate from S. pneumoniae serotype 15B, a glycoconjugate
from S. pneumoniae serotype 22F, a glycoconjugate from S.
pneumoniae serotype 33F, a glycoconjugate from S. pneumoniae
serotype 12F, a glycoconjugate from S. pneumoniae serotype 10A, a
glycoconjugate from S. pneumoniae serotype 11A and a glycoconjugate
from S. pneumoniae serotype 8, wherein said composition is a 1, 2,
3, 4, 5, 6 or 7-valent pneumococcal conjugate composition.
[1084] 2. The immunogenic composition of paragraph 1, wherein said
composition comprises at least one glycoconjugate from S.
pneumoniae serotype 15B.
[1085] 3. The immunogenic composition of any one of paragraphs 1-2,
wherein said composition comprises at least one glycoconjugate from
S. pneumoniae serotype 22F.
[1086] 4. The immunogenic composition of any one of paragraphs 1-3,
wherein said composition comprises at least one glycoconjugate from
S. pneumoniae serotype 33F.
[1087] 5. The immunogenic composition of any one of paragraphs 1-4,
wherein said composition comprises at least one glycoconjugate from
S. pneumoniae serotype 12F.
[1088] 6. The immunogenic composition of any one of paragraphs 1-5,
wherein said composition comprises at least one glycoconjugate from
S. pneumoniae serotype 10A.
[1089] 7. The immunogenic composition of any one of paragraphs 1-6,
wherein said composition comprises at least one glycoconjugate from
S. pneumoniae serotype 11A.
[1090] 8. The immunogenic composition of any one of paragraphs 1-7,
wherein said composition comprises at least one glycoconjugate from
S. pneumoniae serotype 8.
[1091] 9. The immunogenic composition of any one of paragraphs 1-8,
wherein said composition comprises a glycoconjugate from S.
pneumoniae serotype 15B, a glycoconjugate from S. pneumoniae
serotype 22F, glycoconjugate from S. pneumoniae serotype 33F, a
glycoconjugate from S. pneumoniae serotype 12F, a glycoconjugate
from S. pneumoniae serotype 10A, a glycoconjugate from S.
pneumoniae serotype 11A and a glycoconjugate from S. pneumoniae
serotype 8, wherein said composition is a 7-valent pneumococcal
conjugate composition.
[1092] 10. The immunogenic composition of any one of paragraphs
1-9, wherein said glycoconjugates are individually conjugated to
CRM.sub.197.
[1093] 11. The immunogenic composition of any one of paragraphs
1-9, wherein said glycoconjugates are individually conjugated to
PD.
[1094] 12. The immunogenic composition of any one of paragraphs
1-9, wherein said glycoconjugates are individually conjugated to
TT.
[1095] 13. The immunogenic composition of any one of paragraphs
1-9, wherein said glycoconjugates are individually conjugated to
DT.
[1096] 14. The immunogenic composition of any one of paragraphs
1-13, wherein said serotype 15B glycoconjugate has a molecular
weight of between 1,000 kDa and 20,000 kDa.
[1097] 15. The immunogenic composition of any one of paragraphs
1-14 wherein said serotype 15B glycoconjugate has a molecular
weight of between 10,000 kDa and 16,000 kDa.
[1098] 16. The immunogenic composition of any one of paragraphs
1-15, wherein the ratio (w/w) of serotype 15B capsular
polysaccharide to carrier protein in serotype 15B glycoconjugate is
between 0.5 and 3.
[1099] 17. The immunogenic composition of any one of paragraphs
1-16, wherein the ratio (w/w) of serotype 15B capsular
polysaccharide to carrier protein in serotype 15B glycoconjugate is
between 0.7 and 0.9.
[1100] 18. The immunogenic composition of any one of paragraphs
1-17, wherein said serotype 15B glycoconjugate comprises less than
about 50% of free serotype 15B capsular polysaccharide compared to
the total amount of serotype 15B capsular polysaccharide.
[1101] 19. The immunogenic composition of any one of paragraphs
1-18, wherein at least 40% of the serotype 15B glycoconjugates have
a K.sub.d below or equal to 0.3 in a CL-4B column.
[1102] 20. The immunogenic composition of any one of paragraphs
1-19, wherein said serotype 15B glycoconjugate comprises at least
0.1 mM acetate per mM serotype 15B capsular polysaccharide.
[1103] 21. The immunogenic composition of any one of paragraphs
1-20, wherein said serotype 15B glycoconjugate comprises at least
0.7 mM acetate per mM serotype 15B capsular polysaccharide.
[1104] 22. The immunogenic composition of any one of paragraphs
1-21, wherein the ratio of mM acetate per mM serotype 15B capsular
polysaccharide in the serotype 15B glycoconjugate to mM acetate per
mM serotype 15B capsular polysaccharide in the isolated
polysaccharide is at least 0.6.
[1105] 23. The immunogenic composition of any one of paragraphs
1-22, wherein the ratio of mM acetate per mM serotype 15B capsular
polysaccharide in the serotype 15B glycoconjugate to mM acetate per
mM serotype 15B capsular polysaccharide in the activated
polysaccharide is at least 0.6.
[1106] 24. The immunogenic composition of any one of paragraphs
1-23, wherein said serotype 15B glycoconjugate comprises at least
0.1 mM glycerol per mM serotype 15B capsular polysaccharide.
[1107] 25. The immunogenic composition of any one of paragraphs
1-24, wherein said serotype 15B glycoconjugate comprises at least
0.5 mM glycerol per mM serotype 15B capsular polysaccharide.
[1108] 26. The immunogenic composition of any one of paragraphs
1-25, wherein said serotype 15B glycoconjugate comprises at least
0.7 mM glycerol per mM serotype 15B capsular polysaccharide.
[1109] 27. The immunogenic composition of any one of paragraphs
1-26, wherein the degree of conjugation of said serotype 15B
glycoconjugate is between 2 and 15.
[1110] 28. The immunogenic composition of any one of paragraphs
1-27, wherein said serotype 15B glycoconjugate comprise a
saccharide having a molecular weight of between 10 kDa and 1,500
kDa.
[1111] 29. The immunogenic composition of any one of paragraphs
1-28, wherein the carrier protein of said serotype 15B
glycoconjugate is CRM.sub.197.
[1112] 30. The immunogenic composition of any one of paragraphs
1-29, wherein said serotype 15B glycoconjugate is prepared using
reductive amination.
[1113] 31. The immunogenic composition of any one of paragraphs 1
or 3-30, wherein said serotype 22F glycoconjugate has a molecular
weight of between 400 kDa and 15,000 kDa.
[1114] 32. The immunogenic composition of any one of paragraphs 1
or 3-31, wherein said serotype 22F glycoconjugate has a molecular
weight of between 1,000 kDa and 8,000 kDa.
[1115] 33. The immunogenic composition of any one of paragraphs 1
or 3-32, wherein the ratio (w/w) of serotype 22F capsular
polysaccharide to carrier protein in serotype 22F glycoconjugate is
between 0.5 and 3.
[1116] 34. The immunogenic composition of any one of paragraphs 1
or 3-33, wherein the ratio (w/w) of serotype 22F capsular
polysaccharide to carrier protein in serotype 22F glycoconjugate is
between 0.9 and 1.1.
[1117] 35. The immunogenic composition of any one of paragraphs 1
or 3-34, wherein said serotype 22F glycoconjugate comprises less
than about 50% of free serotype 22F capsular polysaccharide
compared to the total amount of serotype 22F capsular
polysaccharide.
[1118] 36. The immunogenic composition of any one of paragraphs 1
or 3-35, wherein at least 30% of the serotype 22F glycoconjugates
have a K.sub.d below or equal to 0.3 in a CL-4B column.
[1119] 37. The immunogenic composition of any one of paragraphs 1
or 3-36, wherein said serotype 22F glycoconjugate comprises at
least 0.1 mM acetate per mM serotype 22F capsular
polysaccharide.
[1120] 38. The immunogenic composition of any one of paragraphs 1
or 3-37, wherein said serotype 22F glycoconjugate comprises at
least 0.7 mM acetate per mM serotype 22F capsular
polysaccharide.
[1121] 39. The immunogenic composition of any one of paragraphs 1
or 3-38, wherein the ratio of mM acetate per mM serotype 22F
capsular polysaccharide in the serotype 22F glycoconjugate to mM
acetate per mM serotype 22F capsular polysaccharide in the isolated
polysaccharide is at least 0.6.
[1122] 40. The immunogenic composition of any one of paragraphs 1
or 3-39, wherein the ratio of mM acetate per mM serotype 22F
capsular polysaccharide in the serotype 22F glycoconjugate to mM
acetate per mM serotype 22F capsular polysaccharide in the
activated polysaccharide is at least 0.6.
[1123] 41. The immunogenic composition of any one of paragraphs 1
or 3-40, wherein the degree of conjugation of said serotype 22F
glycoconjugate is between 2 and 15.
[1124] 42. The immunogenic composition of any one of paragraphs 1
or 3-41, wherein said serotype 22F glycoconjugate comprise a
saccharide having a molecular weight of between 10 kDa and 2,000
kDa.
[1125] 43. The immunogenic composition of any one of paragraphs 1
or 3-42, wherein the carrier protein of said serotype 22F
glycoconjugate is CRM.sub.197.
[1126] 44. The immunogenic composition of any one of paragraphs 1
or 3-43, wherein said serotype 22F glycoconjugate is prepared using
reductive amination.
[1127] 45. The immunogenic composition of any one of paragraphs 1
or 4-44, wherein said serotype 33F glycoconjugate has a molecular
weight of between 50 kDa and 20,000 kDa.
[1128] 46. The immunogenic composition of any one of paragraphs 1
or 4-45, wherein said serotype 33F glycoconjugate has a molecular
weight of between 1,000 kDa and 5,000 kDa.
[1129] 47. The immunogenic composition of any one of paragraphs 1
or 4-46, wherein the ratio (w/w) of serotype 33F capsular
polysaccharide to carrier protein in serotype 33F glycoconjugate is
between 0.2 and 4.
[1130] 48. The immunogenic composition of any one of paragraphs 1
or 4-47, wherein the ratio (w/w) of serotype 33F capsular
polysaccharide to carrier protein in serotype 33F glycoconjugate is
between 0.4 and 1.7.
[1131] 49. The immunogenic composition of any one of paragraphs 1
or 4-48, wherein said serotype 33F glycoconjugate comprises less
than about 40% of free serotype 33F capsular polysaccharide
compared to the total amount of serotype 33F capsular
polysaccharide.
[1132] 50. The immunogenic composition of any one of paragraphs 1
or 4-49, wherein at least 35% of the serotype 33F glycoconjugates
have a K.sub.d below or equal to 0.3 in a CL-4B column.
[1133] 51. The immunogenic composition of any one of paragraphs 1
or 4-50, wherein said serotype 33F glycoconjugate comprises at
least 0.1 mM acetate per mM serotype 33F capsular
polysaccharide.
[1134] 52. The immunogenic composition of any one of paragraphs 1
or 4-51, wherein said serotype 33F glycoconjugate comprises at
least 0.7 mM acetate per mM serotype 33F capsular
polysaccharide.
[1135] 53. The immunogenic composition of any one of paragraphs 1
or 4-52, wherein the ratio of mM acetate per mM serotype 33F
capsular polysaccharide in the serotype 33F glycoconjugate to mM
acetate per mM serotype 33F capsular polysaccharide in the isolated
polysaccharide is at least 0.6.
[1136] 54. The immunogenic composition of any one of paragraphs 1
or 4-53, wherein the ratio of mM acetate per mM serotype 33F
capsular polysaccharide in the serotype 33F glycoconjugate to mM
acetate per mM serotype 33F capsular polysaccharide in the
activated polysaccharide is at least 0.6.
[1137] 55. The immunogenic composition of any one of paragraphs 1
or 4-54, wherein the degree of conjugation of said serotype 33F
glycoconjugate is between 2 and 20.
[1138] 56. The immunogenic composition of any one of paragraphs 1
or 4-55, wherein said serotype 33F glycoconjugate comprise a
saccharide having a molecular weight of between 10 kDa and 2,000
kDa.
[1139] 57. The immunogenic composition of any one of paragraphs 1
or 4-56, wherein said serotype 33F glycoconjugate comprise at least
one covalent linkage between the carrier protein and saccharide for
every 2 to 25 saccharide repeat units.
[1140] 58. The immunogenic composition of any one of paragraphs 1
or 4-57, wherein the carrier protein of said serotype 33F
glycoconjugate is CRM.sub.197.
[1141] 59. The immunogenic composition of any one of paragraphs 1
or 4-58, wherein said serotype 33F glycoconjugate is prepared using
reductive amination.
[1142] 60. The immunogenic composition of any one of paragraphs 1
or 4-59, wherein said serotype 33F glycoconjugate is prepared using
eTEC conjugation.
[1143] 61. The immunogenic composition of paragraph 60, wherein
said serotype 33F glycoconjugate is represented by the general
formula (III):
##STR00006##
[1144] where the atoms that comprise the eTEC spacer are contained
in the central box.
[1145] 62. The immunogenic composition of any one of paragraphs 1
or 5-61, wherein said serotype 12F glycoconjugate has a molecular
weight of between 50 kDa and 20,000 kDa.
[1146] 63. The immunogenic composition of any one of paragraphs 1
or 5-62, wherein said serotype 12F glycoconjugate has a molecular
weight of between 500 kDa and 5,000 kDa.
[1147] 64. The immunogenic composition of any one of paragraphs 1
or 5-63, wherein the ratio (w/w) of serotype 12F capsular
polysaccharide to carrier protein in serotype 12F glycoconjugate is
between 0.2 and 4.
[1148] 65. The immunogenic composition of any one of paragraphs 1
or 5-64, wherein the ratio (w/w) of serotype 12F capsular
polysaccharide to carrier protein in serotype 12F glycoconjugate is
between 0.8 and 1.8.
[1149] 66. The immunogenic composition of any one of paragraphs 1
or 5-65, wherein said serotype 22F glycoconjugate comprises less
than about 50% of free serotype 12F capsular polysaccharide
compared to the total amount of serotype 12F capsular
polysaccharide.
[1150] 67. The immunogenic composition of any one of paragraphs 1
or 5-66, wherein at least 35% of the serotype 12F glycoconjugates
have a K.sub.d below or equal to 0.3 in a CL-4B column.
[1151] 68. The immunogenic composition of any of one of paragraphs
1 or 5-67, wherein the degree of conjugation of said serotype 12F
glycoconjugate is between 2 and 20.
[1152] 69. The immunogenic composition of any one of paragraphs 1
or 5-68, wherein said serotype 12F glycoconjugate comprise a
saccharide having a molecular weight of between 10 kDa and 2,000
kDa.
[1153] 70. The immunogenic composition of any one of paragraphs 1
or 5-69, wherein said serotype 12F glycoconjugate comprise at least
one covalent linkage between the carrier protein and saccharide for
every 2 to 25 saccharide repeat units.
[1154] 71. The immunogenic composition of any one of paragraphs 1
or 5-70, wherein the carrier protein of said serotype 12F
glycoconjugate is CRM.sub.197.
[1155] 72. The immunogenic composition of any one of paragraphs 1
or 5-71, wherein said serotype 12F glycoconjugate is prepared using
reductive amination.
[1156] 73. The immunogenic composition of any one of paragraphs 1
or 5-72, wherein said serotype 12F glycoconjugate is prepared using
TEMPO/NCS-reductive amination.
[1157] 74. The immunogenic composition of any one of paragraphs 1
or 6-73, wherein said serotype 10A glycoconjugate has a molecular
weight of between 50 kDa and 20,000 kDa.
[1158] 75. The immunogenic composition of any one of paragraphs 1
or 6-74, wherein said serotype 10A glycoconjugate has a molecular
weight of between 1,000 kDa and 10,000 kDa.
[1159] 76. The immunogenic composition of any one of paragraphs 1
or 6-75, wherein the ratio (w/w) of serotype 10A capsular
polysaccharide to carrier protein in serotype 10A glycoconjugate is
between 0.5 and 3.
[1160] 77. The immunogenic composition of any one of paragraphs 1
or 6-76, wherein the ratio (w/w) of serotype 10A capsular
polysaccharide to carrier protein in serotype 10A glycoconjugate is
between 0.8 and 1.2.
[1161] 78. The immunogenic composition of any one of paragraphs 1
or 6-77, wherein said serotype 10A glycoconjugate comprises less
than about 50% of free serotype 10A capsular polysaccharide
compared to the total amount of serotype 10A capsular
polysaccharide.
[1162] 79. The immunogenic composition of any one of paragraphs 1
or 6-78, wherein at least 30% of the serotype 10A glycoconjugates
have a K.sub.d below or equal to 0.3 in a CL-4B column.
[1163] 80. The immunogenic composition of any of one of paragraphs
1 or 6-79, wherein the degree of conjugation of said serotype 10A
glycoconjugate is between 2 and 15.
[1164] 81. The immunogenic composition of any one of paragraphs 1
or 6-80, wherein said serotype 10A glycoconjugate comprise a
saccharide having a molecular weight of between 10 kDa and 2,000
kDa.
[1165] 82. The immunogenic composition of any one of paragraphs 1
or 6-81, wherein the carrier protein of said serotype 10A
glycoconjugate is CRM.sub.197.
[1166] 83. The immunogenic composition of any one of paragraphs 1
or 6-82, wherein said serotype 10A glycoconjugate is prepared using
reductive amination.
[1167] 84. The immunogenic composition of any one of paragraphs 1
or 7-83, wherein said serotype 11A glycoconjugate has a molecular
weight of between 50 kDa and 20,000 kDa.
[1168] 85. The immunogenic composition of any one of paragraphs 1
or 7-84, wherein said serotype 11A glycoconjugate has a molecular
weight of between 500 kDa and 20,000 kDa.
[1169] 86. The immunogenic composition of any of one of paragraphs
1 or 7-85, wherein the ratio (w/w) of serotype 11A capsular
polysaccharide to carrier protein in serotype 11A glycoconjugate is
between 0.2 and 4.
[1170] 87. The immunogenic composition of any one of paragraphs 1
or 7-86, wherein the ratio (w/w) of serotype 11A capsular
polysaccharide to carrier protein in serotype 11A glycoconjugate is
between 0.8 and 1.6.
[1171] 88. The immunogenic composition of any one of paragraphs 1
or 7-87, wherein said serotype 11A glycoconjugate comprises less
than about 50% of free serotype 11A capsular polysaccharide
compared to the total amount of serotype 11A capsular
polysaccharide.
[1172] 89. The immunogenic composition of any one of paragraphs 1
or 7-88, wherein at least 30% of the serotype 11A glycoconjugates
have a K.sub.d below or equal to 0.3 in a CL-4B column.
[1173] 90. The immunogenic composition of any one of paragraphs 1
or 7-89, wherein said serotype 11A glycoconjugate comprises at
least 0.3 mM acetate per mM serotype 11A capsular
polysaccharide.
[1174] 91. The immunogenic composition of any one of paragraphs 1
or 7-90, wherein said serotype 11A glycoconjugate comprises at
least 1.8 mM acetate per mM serotype 11A capsular
polysaccharide.
[1175] 92. The immunogenic composition of any one of paragraphs 1
or 7-91, wherein the ratio of mM acetate per mM serotype 11A
capsular polysaccharide in the serotype 11A glycoconjugate to mM
acetate per mM serotype 11A capsular polysaccharide in the isolated
polysaccharide is at least 0.6.
[1176] 93. The immunogenic composition of any one of paragraphs 1
or 7-92, wherein the ratio of mM acetate per mM serotype 11A
capsular polysaccharide in the serotype 11A glycoconjugate to mM
acetate per mM serotype 11A capsular polysaccharide in the
activated polysaccharide is at least 0.6
[1177] 94. The immunogenic composition of any one of paragraphs 1
or 7-93, wherein said serotype 11A glycoconjugate comprises at
least 0.1 mM glycerol per mM serotype 11A capsular
polysaccharide.
[1178] 95. The immunogenic composition of any one of paragraphs 1
or 7-94, wherein said serotype 11A glycoconjugate comprises at
least 0.4 mM glycerol per mM serotype 11A capsular
polysaccharide.
[1179] 96. The immunogenic composition of any one of paragraphs 1
or 7-95, wherein the degree of conjugation of said serotype 11A
glycoconjugate is between 1 and 15.
[1180] 97. The immunogenic composition of any one of paragraphs 1
or 7-96, wherein said serotype 11A glycoconjugate comprise a
saccharide having a molecular weight of between 10 kDa and 2,000
kDa.
[1181] 98. The immunogenic composition of any one of paragraphs 1
or 7-97, wherein the carrier protein of said serotype 11A
glycoconjugate is CRM.sub.197.
[1182] 99. The immunogenic composition of any one of paragraphs 1
or 7-98, wherein said serotype 11A glycoconjugate is prepared using
reductive amination.
[1183] 100. The immunogenic composition of any one of paragraphs 1
or 8-99, wherein said serotype 8 glycoconjugate has a molecular
weight of between 50 kDa and 20,000 kDa.
[1184] 101. The immunogenic composition of any one of paragraphs 1
or 8-100, wherein said serotype 8 glycoconjugate has a molecular
weight of between 1,000 kDa and 15,000 kDa.
[1185] 102. The immunogenic composition of any one of paragraphs 1
or 8-101, wherein the ratio (w/w) of serotype 8 capsular
polysaccharide to carrier protein in serotype 8 glycoconjugate is
between 0.2 and 4.
[1186] 103. The immunogenic composition of any one of paragraphs 1
or 8-102, wherein the ratio (w/w) of serotype 8 capsular
polysaccharide to carrier protein in serotype 8 glycoconjugate is
between 0.8 and 1.5.
[1187] 104. The immunogenic composition of any one of paragraphs 1
or 8-103, wherein said serotype 8 glycoconjugate comprises less
than about 50% of free serotype 8 capsular polysaccharide compared
to the total amount of serotype 8 capsular polysaccharide.
[1188] 105. The immunogenic composition of any one of paragraphs 1
or 8-104, wherein at least 30% of the serotype 8 glycoconjugates
have a K.sub.d below or equal to 0.3 in a CL-4B column.
[1189] 106. The immunogenic composition of any one of paragraphs 1
or 8-105, wherein the degree of conjugation of said serotype 8
glycoconjugate is between 2 and 20.
[1190] 107. The immunogenic composition of any one of paragraphs 1
or 8-106, wherein said serotype 8 glycoconjugate comprise a
saccharide having a molecular weight of between 10 kDa and 2,000
kDa.
[1191] 108. The immunogenic composition of any one of paragraphs 1
or 8-107, wherein the carrier protein of said serotype 8
glycoconjugate is CRM.sub.197.
[1192] 109. The immunogenic composition of any one of paragraphs 1
or 8-108, wherein said serotype 8 glycoconjugate is prepared using
reductive amination.
[1193] 110. The immunogenic composition of any one of paragraphs
1-109, wherein each dose of said immunogenic composition comprises
0.1 .mu.g to 100 .mu.g of polysaccharide of each serotype.
[1194] 111. The immunogenic composition of any one of paragraphs
1-110, wherein each dose of said immunogenic composition comprises
1.0 .mu.g to 10 .mu.g of polysaccharide of each serotype.
[1195] 112. The immunogenic composition of any one of paragraphs
1-111, wherein each dose of said immunogenic composition comprises
about 1.0 .mu.g, about 1.2 .mu.g, about 1.4 .mu.g, about 1.6 .mu.g,
about 1.8 .mu.g, 2.0 .mu.g, about 2.2 .mu.g, about 2.4 .mu.g, about
2.6 .mu.g, about 2.8 .mu.g, about 3.0 .mu.g, about 3.2 .mu.g, about
3.4 .mu.g, about 3.6 .mu.g, about 3.8 .mu.g, about 4.0 .mu.g, about
4.2 .mu.g, about 4.4 .mu.g, about 4.6 .mu.g, about 4.8 .mu.g, about
5.0 .mu.g, about 5.2 .mu.g, about 5.4 .mu.g, about 5.6 .mu.g, about
5.8 .mu.g or about 6.0 .mu.g of polysaccharide for each serotype
glycoconjugate.
[1196] 113. The immunogenic composition of any one of paragraphs
1-112, wherein each dose of said immunogenic composition comprises
about 1.5 .mu.g to about 3.0 .mu.g of polysaccharide for each
glycoconjugate from S. pneumoniae serotype 8, 10A, 11A, 12F, 15B,
22F, and/or 33F, if present.
[1197] 114. The immunogenic composition of any one of paragraphs
1-113, wherein each dose of said immunogenic composition comprises
10 .mu.g to 150 .mu.g of carrier protein.
[1198] 115. The immunogenic composition of any one of paragraphs
1-114, wherein each dose of said immunogenic composition comprises
about 1 .mu.g, about 2 .mu.g, about 3 .mu.g, about 4 .mu.g, about 5
.mu.g, about 6 .mu.g, about 7 .mu.g, about 8 .mu.g, about 9 .mu.g,
about 10 .mu.g, about 11 .mu.g, about 12 .mu.g, about 13 .mu.g,
about 14 .mu.g, about 15 .mu.g, about 16 .mu.g, about 17 .mu.g,
about 18 .mu.g, about 19 .mu.g, about 20 .mu.g, about 21 .mu.g,
about 22 .mu.g, about 23 .mu.g, about 24 .mu.g, about 25 .mu.g,
about 26 .mu.g, about 27 .mu.g, about 28 .mu.g, about 29 .mu.g,
about 30 .mu.g, about 31 .mu.g, about 32 .mu.g, about 33 .mu.g,
about 34 .mu.g, about 35 .mu.g, about 36 .mu.g, about 37 .mu.g,
about 38 .mu.g, about 39 .mu.g, about 40 .mu.g, about 41 .mu.g,
about 42 .mu.g, about 43 .mu.g, about 44 .mu.g, about 45 .mu.g,
about 46 .mu.g, about 47 .mu.g, about 48 .mu.g, about 49 .mu.g,
about 50 .mu.g, about 51 .mu.g, about 52 .mu.g, about 53 .mu.g,
about 54 .mu.g, about 55 .mu.g, about 56 .mu.g, about 57 .mu.g,
about 58 .mu.g, about 59 .mu.g, about 60 .mu.g, about 61 .mu.g,
about 62 .mu.g, about 63 .mu.g, about 64 .mu.g, about 65 .mu.g,
about 66 .mu.g, about 67 .mu.g, about 68 .mu.g, about 69 .mu.g,
about 70 .mu.g, about 71 .mu.g, about 72 .mu.g, about 73 .mu.g,
about 74 .mu.g or about 75 .mu.g of carrier protein.
[1199] 116. The immunogenic composition of any one of paragraphs
1-115, wherein said immunogenic composition further comprises at
least one antigen from other pathogens.
[1200] 117. The immunogenic composition of any one of paragraphs
1-116, wherein said immunogenic composition further comprises at
least one antigen selected from the group consisting of a
diphtheria toxoid (D), a tetanus toxoid (T), a pertussis antigen
(P), an acellular pertussis antigen (Pa), a hepatitis B virus (HBV)
surface antigen (HBsAg), a hepatitis A virus (HAV) antigen, a
conjugated Haemophilus influenzae type b capsular saccharide (Hib),
and inactivated poliovirus vaccine (IPV).
[1201] 118. The immunogenic composition of any one of paragraphs
1-117, wherein said immunogenic composition further comprises D, T
and Pa.
[1202] 119. The immunogenic composition of any one of paragraphs
1-117, wherein said immunogenic composition further comprises D, T,
Pa and Hib.
[1203] 120. The immunogenic composition of any one of paragraphs
1-117, wherein said immunogenic composition further comprises D, T,
Pa and IPV.
[1204] 121. The immunogenic composition of any one of paragraphs
1-117, wherein said immunogenic composition further comprises D, T,
Pa and HBsAg.
[1205] 122. The immunogenic composition of any one of paragraphs
1-117, wherein said immunogenic composition further comprises D, T,
Pa, HBsAg and IPV.
[1206] 123. The immunogenic composition of any one of paragraphs
1-117, wherein said immunogenic composition further comprises D, T,
Pa, HBsAg and Hib.
[1207] 124. The immunogenic composition of any one of paragraphs
1-117, wherein said immunogenic composition further comprises D, T,
Pa, HBsAg, IPV and Hib.
[1208] 125. The immunogenic composition of any one of paragraphs
1-124, wherein said immunogenic composition further comprises a
conjugated N. meningitidis serogroup Y capsular saccharide
(MenY).
[1209] 126. The immunogenic composition of any one of paragraphs
1-125, wherein said immunogenic composition further comprises a
conjugated N. meningitidis serogroup C capsular saccharide
(MenC).
[1210] 127. The immunogenic composition of any one of paragraphs
1-126, wherein said immunogenic composition further comprises a
conjugated N. meningitidis serogroup A capsular saccharide
(MenA).
[1211] 128. The immunogenic composition of any one of paragraphs
1-127, wherein said immunogenic composition further comprises a
conjugated N. meningitidis serogroup W135 capsular saccharide
(MenW135).
[1212] 129. The immunogenic composition of any one of paragraphs
1-128, wherein said immunogenic composition further comprises a
conjugated N. meningitidis serogroup Y capsular saccharide (MenY)
and a conjugated N. meningitidis serogroup C capsular saccharide
(MenC).
[1213] 130. The immunogenic composition of any one of paragraphs
1-124, wherein said immunogenic composition further comprises a
conjugated N. meningitidis serogroup
[1214] W135 capsular saccharide (MenW135), a conjugated N.
meningitidis serogroup Y capsular saccharide (MenY), and/or a
conjugated N. meningitidis serogroup C capsular saccharide
(MenC).
[1215] 131. The immunogenic composition of any one of paragraphs
1-124, wherein said immunogenic composition further comprises a
conjugated N. meningitidis serogroup A capsular saccharide (MenA),
a conjugated N. meningitidis serogroup W135 capsular saccharide
(MenW135), a conjugated N. meningitidis serogroup Y capsular
saccharide (MenY), and/or a conjugated N. meningitidis serogroup C
capsular saccharide (MenC).
[1216] 132. The immunogenic composition of any one of paragraphs
1-131, wherein said immunogenic composition further comprises at
least one adjuvant.
[1217] 133. The immunogenic composition of any one of paragraphs
1-132, wherein said immunogenic composition further comprises at
least one adjuvant selected from the group consisting of aluminum
phosphate, aluminum sulfate or aluminum hydroxide, calcium
phosphate, liposomes, an oil-in-water emulsion, MF59 (4.3% w/v
squalene, 0.5% w/v polysorbate 80, 0.5% w/v sorbitan trioleate), a
water-in-oil emulsion, MONTANIDE.TM.,
poly(D,L-lactide-co-glycolide) (PLG) microparticles and
poly(D,L-lactide-co-glycolide) (PLG) nanoparticles.
[1218] 134. The immunogenic composition of any one of paragraphs
1-131 wherein said immunogenic composition further comprise at
least one adjuvant selected from the group consisting of aluminum
phosphate, aluminum sulfate and aluminum hydroxide.
[1219] 135. The immunogenic composition of any one of paragraphs
1-131 wherein said immunogenic composition further comprise
aluminum phosphate as adjuvant.
[1220] 136. The immunogenic composition of any one of paragraphs
1-131 wherein said immunogenic composition further comprise
aluminum sulfate as adjuvant.
[1221] 137. The immunogenic composition of any one of paragraphs
1-131 wherein said immunogenic composition further comprise
aluminum hydroxide as adjuvant.
[1222] 138. The immunogenic composition of any one of paragraphs
1-131 wherein said immunogenic composition comprise from 0.1 mg/mL
to 1 mg/mL of elemental aluminum in the form of aluminum phosphate
as adjuvant.
[1223] 139. The immunogenic composition of any one of paragraphs
1-131 wherein said immunogenic composition comprise from 0.2 mg/mL
to 0.3 mg/mL of elemental aluminum in the form of aluminum
phosphate as adjuvant.
[1224] 140. The immunogenic composition of any one of paragraphs
1-131 wherein said immunogenic composition comprise about 0.25
mg/mL of elemental aluminum in the form of aluminum phosphate as
adjuvant.
[1225] 141. The immunogenic composition of any one of paragraphs
1-140, wherein said immunogenic composition further comprises a CpG
Oligonucleotide.
[1226] 142. The immunogenic composition of any one of paragraphs
1-141, wherein said immunogenic composition is formulated in a
liquid form.
[1227] 143. The immunogenic composition of any one of paragraphs
1-141, wherein said immunogenic composition is formulated in a
lyophilized form.
[1228] 144. The immunogenic composition of any one of paragraphs
1-142, wherein said immunogenic composition is formulated in an
aqueous liquid form.
[1229] 145. The immunogenic composition of any one of paragraphs
1-144, wherein said immunogenic composition comprises one or more
of a buffer, a salt, a divalent cation, a non-ionic detergent, a
cryoprotectant such as a sugar, and an anti-oxidant such as a free
radical scavenger or chelating agent, or any combinations
thereof.
[1230] 146. The immunogenic composition of any one of paragraphs
1-145, wherein said immunogenic composition comprises a buffer.
[1231] 147. The immunogenic composition of paragraph 146, wherein
said buffer has a pKa of about 3.5 to about 7.5.
[1232] 148. The immunogenic composition of any one of paragraphs
146-147, wherein said buffer is phosphate, succinate, histidine or
citrate.
[1233] 149. The immunogenic composition of any one of paragraphs
146-148, wherein said buffer is succinate at a final concentration
of 1.0 mM to 10 mM.
[1234] 150. The immunogenic composition of any one of paragraphs
146-149, wherein said buffer is succinate at a final concentration
of about 5.0 mM.
[1235] 151. The immunogenic composition of any one of paragraphs
1-150, wherein the immunogenic composition comprises a salt.
[1236] 152. The immunogenic composition of paragraph 151, wherein
said salt is selected from the group consisting of magnesium
chloride, potassium chloride, sodium chloride and a combination
thereof.
[1237] 153. The immunogenic composition of any one of paragraphs
151-152, wherein said salt is sodium chloride.
[1238] 154. The immunogenic composition of any one of paragraphs
151-153, wherein said salt is sodium chloride at a concentration of
about 150 mM.
[1239] 155. The immunogenic composition of any one of paragraphs
1-154, wherein the immunogenic composition comprises a
surfactant.
[1240] 156. The immunogenic composition of paragraph 155, wherein
said surfactant is selected from the group consisting of
polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 65,
polysorbate 80, polysorbate 85, Triton N-1 01, Triton X-100,
oxtoxynol 40, nonoxynol-9, triethanolamine, triethanolamine
polypeptide oleate, polyoxyethylene-660 hydroxystearate,
polyoxyethylene-35-ricinoleate, soy lecithin and a poloxamer.
[1241] 157. The immunogenic composition of any one of paragraphs
155-156, wherein said surfactant is selected from the group
polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 65,
polysorbate 80, polysorbate 85 and a poloxamer.
[1242] 158. The immunogenic composition of any one of paragraphs
155-157, wherein said surfactant is polysorbate 80.
[1243] 159. The immunogenic composition of any one of paragraphs
155-158, wherein the surfactant is polysorbate 80 at a final
concentration of at least 0.0001% to 10% weight to weight
(w/w).
[1244] 160. The immunogenic composition of any one of paragraphs
155-159, wherein the surfactant is polysorbate 80 at a final
concentration of at least 0.001% to 1% weight to weight (w/w).
[1245] 161. The immunogenic composition of any one of paragraphs
155-160, wherein the surfactant is polysorbate 80 at a final
concentration of at least 0.01% to 1% weight to weight (w/w).
[1246] 162. The immunogenic composition of any one of paragraphs
155-161, wherein the surfactant is polysorbate 80 at a final
concentration of 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%,
0.08%, 0.09% or 0.1% weight to weight (w/w).
[1247] 163. The immunogenic composition of any one of paragraphs
1-162, wherein said immunogenic composition has a pH of 5.5 to
7.5.
[1248] 164. The immunogenic composition of any one of paragraphs
1-163, wherein said immunogenic composition has a pH of 5.6 to
7.0.
[1249] 165. The immunogenic composition of any one of paragraphs
1-164, wherein said immunogenic composition has a pH of 5.8 to
6.0.
[1250] 166. A kit comprising: (a) a first immunogenic composition
comprising said immunogenic composition of any one of paragraphs
1-165; and (b) a second immunogenic composition comprising at least
one glycoconjugate from a Streptococcus pneumoniae serotype
selected from the group consisting of serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F.
[1251] 167. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F.
[1252] 168. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F.
[1253] 169. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and
23F.
[1254] 170. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F
and 23F.
[1255] 171. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F and
22F.
[1256] 172. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F and
33F.
[1257] 173. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F, 22F
and 33F.
[1258] 174. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F,
23F and 22F.
[1259] 175. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F,
23F and 33F.
[1260] 176. 175. The kit of paragraph 166, wherein said second
immunogenic composition comprises glycoconjugates from S.
pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F,
23F, 22F and 33F.
[1261] 177. The kit of any one of paragraphs 166-176, wherein said
glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C,
19F and 23F are conjugated to CRM.sub.197.
[1262] 178. The kit of any one of paragraphs 166-177, wherein said
glycoconjugates from S. pneumoniae serotypes 1, 5 and 7F are
conjugated to CRM.sub.197.
[1263] 179. The kit of any one of paragraphs 166-178, wherein said
glycoconjugates from S. pneumoniae serotypes 6A and 19A are
conjugated to CRM.sub.197.
[1264] 180. The kit of any one of paragraphs 166-179, wherein said
glycoconjugate from S. pneumoniae serotypes 3 is conjugated to
CRM.sub.197.
[1265] 181. The kit of any one of paragraphs 166-180, wherein said
glycoconjugate from S. pneumoniae serotypes 22F is conjugated to
CRM.sub.197.
[1266] 182. The kit of any one of paragraphs 166-181, wherein said
glycoconjugate from S. pneumoniae serotypes 33F is conjugated to
CRM.sub.197.
[1267] 183. The kit of any one of paragraphs 166-182, wherein said
glycoconjugates are all individually conjugated to CRM.sub.197.
[1268] 184. The kit of any one of paragraphs 166-176, wherein said
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V,
14 and 23F are individually conjugated to PD.
[1269] 185. The kit of any one of paragraphs 166-176 or 184,
wherein said glycoconjugate from S. pneumoniae serotype 18C is
conjugated to TT.
[1270] 186. The kit of any one of paragraphs 166-176 or 184-185,
wherein said glycoconjugate from S. pneumoniae serotype 19F is
conjugated to DT.
[1271] 187. The kit of any one of paragraphs 166-176 or 184-186,
wherein said glycoconjugates from S. pneumoniae serotypes 1, 4, 5,
6B, 7F, 9V, 14 and/or 23F are individually conjugated to PD, said
glycoconjugate from S. pneumoniae serotype 18C is conjugated to TT
and said glycoconjugate from S. pneumoniae serotype 19F is
conjugated to DT.
[1272] 188. The kit of any one of paragraphs 184-187, wherein said
glycoconjugate from S. pneumoniae serotypes 22F is conjugated to
CRM.sub.197.
[1273] 189. The kit of any one of paragraphs 184-188, wherein said
glycoconjugate from S. pneumoniae serotypes 33F is conjugated to
CRM.sub.197
[1274] 190. The kit of any one of paragraphs 166-189, wherein said
second immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14 or
15-valent pneumococcal conjugate composition.
[1275] 191. The kit of any one of paragraphs 166-190, wherein said
second immunogenic composition is a 10, 11, 12, 13, 14 or 15-valent
pneumococcal conjugate composition.
[1276] 192. The kit of any one of paragraphs 166-191, wherein said
second immunogenic composition is a 13-valent pneumococcal
conjugate composition.
[1277] 193. The kit of any one of paragraphs 166-191, wherein said
second immunogenic composition is an 11-valent pneumococcal
conjugate composition wherein said 11 conjugates consists of
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V,
14 and 23F individually conjugated to PD, glycoconjugate from S.
pneumoniae serotype 18C conjugated to TT, glycoconjugate from S.
pneumoniae serotype 19F conjugated to DT and glycoconjugate from S.
pneumoniae serotype 22F conjugated to CRM.sub.197.
[1278] 194. The kit of any one of paragraphs 166-191, wherein said
second immunogenic composition is an 11-valent pneumococcal
conjugate composition wherein said 11 conjugates consists of
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V,
14 and 23F individually conjugated to PD, glycoconjugate from S.
pneumoniae serotype 18C conjugated to TT, glycoconjugate from S.
pneumoniae serotype 19F conjugated to DT and glycoconjugate from S.
pneumoniae serotype 33F conjugated to CRM.sub.197.
[1279] 195. The kit of any one of paragraphs 166-191, wherein said
second immunogenic composition is a 12-valent pneumococcal
conjugate composition wherein said 12 conjugates consists of
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V,
14 and 23F individually conjugated to PD, glycoconjugate from S.
pneumoniae serotype 18C conjugated to TT, glycoconjugate from S.
pneumoniae serotype 19F conjugated to DT, glycoconjugate from S.
pneumoniae serotype 22F conjugated to CRM.sub.197 and
glycoconjugate from S. pneumoniae serotype 33F conjugated to
CRM.sub.197.
[1280] 196. The kit of any one of paragraphs 166-192, wherein said
second immunogenic composition is a 13-valent pneumococcal
conjugate composition wherein said 13 conjugates consists of
glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F and 23F individually conjugated to
CRM.sub.197.
[1281] 197. The kit of any one of paragraphs 166-191, wherein said
second immunogenic composition is a 14-valent pneumococcal
conjugate composition wherein said 14 conjugates consists of
glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F, 23F and 22F individually conjugated to
CRM.sub.197.
[1282] 198. The kit of any one of paragraphs 166-191, wherein said
second immunogenic composition is a 14-valent pneumococcal
conjugate composition wherein said 14 conjugates consists of
glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F, 23F and 33F individually conjugated to
CRM.sub.197.
[1283] 199. The kit of any one of paragraphs 166-191, wherein said
second immunogenic composition is a 15-valent pneumococcal
conjugate composition wherein said 15 conjugates consists of
glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F individually conjugated
to CRM.sub.197.
[1284] 200. The kit of any one of paragraphs 166-199, wherein said
glycoconjugates of the second immunogenic composition are all
conjugated to the carrier protein by reductive amination.
[1285] 201. The kit of any one of paragraphs 166-200, wherein each
dose of said second immunogenic composition comprises 1.0 .mu.g to
10 .mu.g of polysaccharide of each serotype.
[1286] 202. The kit of any one of paragraphs 166-201, wherein each
dose of said second immunogenic composition comprises 10 .mu.g to
150 .mu.g of carrier protein.
[1287] 203. The kit of any one of paragraphs 166-202, wherein each
dose of said second immunogenic composition comprises about 15
.mu.g, about 16 .mu.g, about 17 .mu.g, about 18 .mu.g, about 19
.mu.g, about 20 .mu.g, about 21 .mu.g, about 22 .mu.g, about 23
.mu.g, about 24 .mu.g, about 25 .mu.g, about 26 .mu.g, about 27
.mu.g, about 28 .mu.g, about 29 .mu.g, about 30 .mu.g, about 31
.mu.g, about 32 .mu.g, about 33 .mu.g, about 34 .mu.g, about 35
.mu.g, about 36 .mu.g, about 37 .mu.g, about 38 .mu.g, about 39
.mu.g, about 40 .mu.g, about 41 .mu.g, about 42 .mu.g, about 43
.mu.g, about 44 .mu.g, about 45 .mu.g, about 46 .mu.g, about 47
.mu.g, about 48 .mu.g, about 49 .mu.g or about 50 .mu.g of carrier
protein.
[1288] 204. The kit of any one of paragraphs 166-203, wherein said
second immunogenic composition further comprises at least one
antigen from other pathogens.
[1289] 205. The kit of any one of paragraphs 166-204, wherein said
second immunogenic composition further comprises at least one
adjuvant.
[1290] 206. The kit of any one of paragraphs 166-204, wherein said
second immunogenic composition further comprises at least one
adjuvant selected from the group consisting of aluminum phosphate,
aluminum sulfate and aluminum hydroxide.
[1291] 207. The kit of any one of paragraphs 166-204, wherein said
second immunogenic composition further comprises aluminum phosphate
as adjuvant.
[1292] 208. The kit of any one of paragraphs 166-204, wherein said
second immunogenic composition further comprises from 0.2 mg/mL to
0.3 mg/mL of elemental aluminum in the form of aluminum phosphate
as adjuvant.
[1293] 209. The kit of any one of paragraphs 166-204, wherein said
second immunogenic composition further comprises about 0.25 mg/mL
of elemental aluminum in the form of aluminum phosphate as
adjuvant.
[1294] 210. The kit of any one of paragraphs 166-209, wherein said
second immunogenic composition further comprises a buffer.
[1295] 211. The kit of paragraph 210, wherein said buffer has a pKa
of about 3.5 to about 7.5.
[1296] 212. The kit of any one of paragraphs 210-211, wherein said
buffer is phosphate, succinate, histidine or citrate.
[1297] 213. The kit of paragraph 212, wherein said buffer is
succinate at a final concentration of about 5.0 mM.
[1298] 214. The kit of any one of paragraphs 166-213, wherein said
second immunogenic composition further comprises a salt.
[1299] 215. The kit of paragraph 214, wherein said salt is selected
from the group consisting of magnesium chloride, potassium
chloride, sodium chloride and a combination thereof.
[1300] 216. The kit of any one of paragraphs 166-215, wherein said
second immunogenic composition comprises sodium chloride at a final
concentration of 150 mM.
[1301] 217. The kit of any one of paragraphs 166-216, wherein said
second immunogenic composition further comprises a surfactant.
[1302] 218. The kit of paragraph 217, wherein said surfactant is
polysorbate 80.
[1303] 219. The kit of paragraph 218, wherein the final
concentration of polysorbate 80 is 0.01%, 0.02%, 0.03%, 0.04%,
0.05%, 0.06%, 0.07%, 0.08%, 0.09% or 0.1% (w/w).
[1304] 220. The kit of any one of paragraphs 166-219, wherein said
second immunogenic composition has a pH of 5.8 to 6.0.
[1305] 221. The kit of any one of paragraphs 166-220, wherein said
first immunogenic composition and said second immunogenic
composition are in separate containers.
[1306] 222. The kit of any one of paragraphs 166-221, wherein said
first and second immunogenic compositions are formulated in a
liquid form.
[1307] 223. The kit of any one of paragraphs 166-221, wherein said
first and second immunogenic compositions are formulated in a
lyophilized form.
[1308] 224. The kit of any one of paragraphs 166-221, wherein said
first immunogenic composition is in a liquid form and said second
immunogenic composition is in a lyophilized form.
[1309] 225. The kit of any one of paragraphs 166-221, wherein said
first immunogenic composition is in lyophilized form and said
second immunogenic composition is in liquid form.
[1310] 226. The immunogenic composition of any one of paragraphs
1-165, wherein said immunogenic composition is simultaneously,
concurrently, concomitantly or sequentially administered with a
second immunogenic composition.
[1311] 227. The immunogenic composition of any one of paragraphs
1-165, for simultaneous, concurrent, concomitant or sequential
administration with a second immunogenic composition.
[1312] 228. The immunogenic composition of any one of paragraphs
1-165 for simultaneous, concurrent, concomitant or sequential
administration with any of the immunogenic compositions disclosed
at section 3 above.
[1313] 229. The immunogenic composition of any one of paragraphs
226-228, wherein said second immunogenic composition comprises at
least one glycoconjugate from a Streptococcus pneumoniae serotype
selected from the group consisting of serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F.
[1314] 230. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F.
[1315] 231. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and
23F.
[1316] 232. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F
and 23F.
[1317] 233. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F and 23F.
[1318] 234. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F and
22F.
[1319] 235. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F and
33F.
[1320] 236. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F, 22F
and 33F.
[1321] 237. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F, 23F and 22F.
[1322] 238. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F, 23F and 33F.
[1323] 239. The immunogenic composition of paragraph 229, wherein
said second immunogenic composition comprises glycoconjugates from
S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F, 23F, 22F and 33F.
[1324] 240. The immunogenic composition of any one of paragraphs
229-239, wherein said glycoconjugates from S. pneumoniae serotypes
4, 6B, 9V, 14, 18C, 19F and 23F are conjugated to CRM.sub.197.
[1325] 241. The immunogenic composition of any one of paragraphs
229-240, wherein said glycoconjugates from S. pneumoniae serotypes
1, 5 and 7F are conjugated to CRM.sub.197.
[1326] 242. The immunogenic composition of any one of paragraphs
229-241, wherein said glycoconjugates from S. pneumoniae serotypes
6A and 19A are conjugated to CRM.sub.197.
[1327] 243. The immunogenic composition of any one of paragraphs
229-242, wherein said glycoconjugate from S. pneumoniae serotypes 3
is conjugated to CRM.sub.197.
[1328] 244. The immunogenic composition of any one of paragraphs
229-243, wherein said glycoconjugate from S. pneumoniae serotypes
22F is conjugated to CRM.sub.197.
[1329] 245. The immunogenic composition of any one of paragraphs
229-244, wherein said glycoconjugate from S. pneumoniae serotypes
33F is conjugated to CRM.sub.197.
[1330] 246. The immunogenic composition of any one of paragraphs
229-246, wherein said glycoconjugates are all individually
conjugated to CRM.sub.197.
[1331] 247. The immunogenic composition of any one of paragraphs
229-239, wherein said glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F are individually conjugated to
PD.
[1332] 248. The immunogenic composition of any one of paragraphs
229-239 or 247, wherein said glycoconjugate from S. pneumoniae
serotype 18C is conjugated to TT.
[1333] 249. The immunogenic composition of any one of paragraphs
229-239 or 247-248, wherein said glycoconjugate from S. pneumoniae
serotype 19F is conjugated to DT.
[1334] 250. The immunogenic composition of any one of paragraphs
229-239 or 247-249, wherein said glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F are individually
conjugated to PD, said glycoconjugate from S. pneumoniae serotype
18C is conjugated to TT and said glycoconjugate from S. pneumoniae
serotype 19F is conjugated to DT.
[1335] 251. The immunogenic composition of any one of paragraphs
247-250, wherein said glycoconjugate from S. pneumoniae serotype
22F is conjugated to CRM.sub.197.
[1336] 252. The immunogenic composition of any one of paragraphs
247-251, wherein said glycoconjugate from S. pneumoniae serotype
33F is conjugated to CRM.sub.197.
[1337] 253. The immunogenic composition of any one of paragraphs
226-252, wherein said second immunogenic composition is a 7, 8, 9,
10, 11, 12, 13, 14 or 15-valent pneumococcal conjugate
composition.
[1338] 254. The immunogenic composition of any one of paragraphs
226-253, wherein said second immunogenic composition is a 10, 11,
12, 13, 14 or 15-valent pneumococcal conjugate composition.
[1339] 255. The immunogenic composition of any one of paragraphs
226-254, wherein said second immunogenic composition is a 13, 14 or
15-valent pneumococcal conjugate composition.
[1340] 256. The immunogenic composition of any one of paragraphs
226-255, wherein said second immunogenic composition is a 13-valent
pneumococcal conjugate composition.
[1341] 257. The immunogenic composition of any one of paragraphs
226-254, wherein said second immunogenic composition is an
11-valent pneumococcal conjugate composition wherein said 11
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT and
glycoconjugate from S. pneumoniae serotype 22F conjugated to
CRM.sub.197.
[1342] 258. The immunogenic composition of any one of paragraphs
226-254, wherein said second immunogenic composition is an
11-valent pneumococcal conjugate composition wherein said 11
conjugates consists of glycoconjugates from S. pneumoniae serotypes
1, 4, 5, 6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT and
glycoconjugate from S. pneumoniae serotype 33F conjugated to
CRM.sub.197.
[1343] 259. The immunogenic composition of any one of paragraphs
226-254, wherein said second immunogenic composition is a 12-valent
pneumococcal conjugate composition wherein said 12 conjugates
consists of glycoconjugates from S. pneumoniae serotypes 1, 4, 5,
6B, 7F, 9V, 14 and 23F individually conjugated to PD,
glycoconjugate from S. pneumoniae serotype 18C conjugated to TT,
glycoconjugate from S. pneumoniae serotype 19F conjugated to DT,
glycoconjugate from S. pneumoniae serotype 22F conjugated to
CRM.sub.197 and glycoconjugate from S. pneumoniae serotype 33F
conjugated to CRM.sub.197.
[1344] 260. The immunogenic composition of any one of paragraphs
226-256, wherein said second immunogenic composition is a 13-valent
pneumococcal conjugate composition wherein said 13 conjugates
consists of glycoconjugates from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F individually
conjugated to CRM.sub.197.
[1345] 261. The immunogenic composition of any one of paragraphs
226-255, wherein said second immunogenic composition is a 14-valent
pneumococcal conjugate composition wherein said 14 conjugates
consists of glycoconjugates from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 22F individually
conjugated to CRM.sub.197.
[1346] 262. The immunogenic composition of any one of paragraphs
226-255, wherein said second immunogenic composition is a 14-valent
pneumococcal conjugate composition wherein said 14 conjugates
consists of glycoconjugates from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 33F individually
conjugated to CRM.sub.197.
[1347] 263. The immunogenic composition of any one of paragraphs
226-255, wherein said second immunogenic composition is a 15-valent
pneumococcal conjugate composition wherein said 15 conjugates
consists of glycoconjugates from S. pneumoniae serotypes 1, 3, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F individually
conjugated to CRM.sub.197.
[1348] 264. The immunogenic composition of any one of paragraphs
229-263, wherein said glycoconjugates of the second immunogenic
composition are all conjugated to the carrier protein by reductive
amination.
[1349] 265. The immunogenic composition of any one of paragraphs
229-264, wherein each dose of said second immunogenic composition
comprises 1 to 10 .mu.g of polysaccharide of each serotype.
[1350] 266. The immunogenic composition of any one of paragraphs
229-265, wherein each dose of said second immunogenic composition
comprises 10 .mu.g to 150 .mu.g of carrier protein.
[1351] 267. The immunogenic composition of any one of paragraphs
229-266, wherein each dose of said second immunogenic composition
comprises about 15 .mu.g, about 16 .mu.g, about 17 .mu.g, about 18
.mu.g, about 19 .mu.g, about 20 .mu.g, about 21 .mu.g, about 22
.mu.g, about 23 .mu.g, about 24 .mu.g, about 25 .mu.g, about 26
.mu.g, about 27 .mu.g, about 28 .mu.g, about 29 .mu.g, about 30
.mu.g, about 31 .mu.g, about 32 .mu.g, about 33 .mu.g, about 34
.mu.g, about 35 .mu.g, about 36 .mu.g, about 37 .mu.g, about 38
.mu.g, about 39 .mu.g, about 40 .mu.g, about 41 .mu.g, about 42
.mu.g, about 43 .mu.g, about 44 .mu.g, about 45 .mu.g, about 46
.mu.g, about 47 .mu.g, about 48 .mu.g, about 49 .mu.g or about 50
.mu.g of carrier protein.
[1352] 268. The immunogenic composition of any one of paragraphs
229-267, wherein said second immunogenic composition further
comprise antigens from other pathogens.
[1353] 269. The immunogenic composition of any one of paragraphs
229-268, wherein said second immunogenic composition further
comprises at least one adjuvant.
[1354] 270. The immunogenic composition of any one of paragraphs
229-268, wherein said second immunogenic composition further
comprises at least one adjuvant selected from the group consisting
of aluminum phosphate, aluminum sulfate and aluminum hydroxide.
[1355] 271. The immunogenic composition of any one of paragraphs
229-268, wherein said second immunogenic composition further
comprises aluminum phosphate as adjuvant.
[1356] 272. The immunogenic composition of any one of paragraphs
229-268, wherein said second immunogenic composition further
comprises from 0.2 mg/mL to 0.3 mg/mL of elemental aluminum in the
form of aluminum phosphate as adjuvant.
[1357] 273. The immunogenic composition of any one of paragraphs
229-268, wherein said second immunogenic composition further
comprises about 0.25 mg/mL of elemental aluminum in the form of
aluminum phosphate as adjuvant.
[1358] 274. The immunogenic composition of any one of paragraphs
229-273, wherein said second immunogenic composition further
comprises a buffer.
[1359] 275. The immunogenic composition of any one of paragraphs
229-274, wherein said second immunogenic composition comprises a
buffer having a pKa of about 3.5 to about 7.5.
[1360] 276. The immunogenic composition of any one of paragraphs
274-275, wherein said buffer of said second immunogenic composition
is phosphate, succinate, histidine or citrate.
[1361] 277. The immunogenic composition of any one of paragraphs
274-276, wherein said buffer of said second immunogenic composition
is succinate at a final concentration of about 5.0 mM.
[1362] 278. The immunogenic composition of any one of paragraphs
229-277, wherein said second immunogenic composition further
comprises a salt.
[1363] 279. The immunogenic composition of any one of paragraphs
229-278 wherein said salt of said second immunogenic composition is
selected from the group consisting of magnesium chloride, potassium
chloride, sodium chloride and a combination thereof.
[1364] 280. The immunogenic composition of any one of paragraphs
229-179, wherein said second immunogenic composition comprises
sodium chloride at a final concentration of 150 mM.
[1365] 281. The immunogenic composition of any one of paragraphs
229-280, wherein said second immunogenic composition further
comprises a surfactant.
[1366] 282. The immunogenic composition of paragraph 281, wherein
said surfactant of said second immunogenic composition is
polysorbate 80.
[1367] 283. The immunogenic composition of any one of paragraphs
281-282, wherein the final concentration of polysorbate 80 in said
second immunogenic composition is 0.01%, 0.02%, 0.03%, 0.04%,
0.05%, 0.06%, 0.07%, 0.08%, 0.09% or 0.1% (w/w).
[1368] 284. The immunogenic composition of any one of paragraphs
229-283, wherein said second immunogenic composition has a pH of
5.8 to 6.0.
[1369] 285. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule is a
single dose schedule.
[1370] 286. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule is a
multiple dose schedule.
[1371] 287. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 2 doses separated by an interval of about 1
month to about 12 months.
[1372] 288. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 2 doses separated by an interval of about 1
month to about 6 months.
[1373] 289. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 2 doses separated by an interval of about 1
month to about 2 months 290. The immunogenic composition of any one
of paragraphs 1-165 for use in vaccination wherein the vaccination
schedule consists of a series of 3 doses separated by an interval
of about 1 month to about 12 months.
[1374] 291. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 3 doses separated by an interval of about 1
month to about 6 months.
[1375] 292. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 3 doses separated by an interval of about 1
month to about 2 months.
[1376] 293. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 3 doses separated by an interval of about 1
month to about 4 months followed by a fourth dose about 10 months
to about 13 months after the first dose.
[1377] 294. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 3 doses separated by an interval of about 1
month to about 2 months followed by a fourth dose about 10 months
to about 13 months after the first dose.
[1378] 295. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 2 or 3 doses separated by an interval of
about 1 month to about 2 months, starting at 2 months of age,
followed by a toddler dose at 12-18 months of age.
[1379] 296. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a series of 2 doses separated by an interval of about 2
months, starting at 2 months of age, followed by a toddler dose at
12-18 months of age.
[1380] 297. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a 4 doses of vaccine administered at 2, 4, 6, and 12-15
months of age.
[1381] 298. The immunogenic composition of any one of paragraphs
1-165 for use in vaccination wherein the vaccination schedule
consists of a prime dose given at day 0 and one or more booster
doses given at intervals that range from about 2 to about 24
weeks.
[1382] 299. The kit of any one of paragraphs 166-225 for
simultaneous, concurrent, concomitant or sequential administration
of the first and second immunogenic compositions.
[1383] 300. The immunogenic composition of any one of paragraphs
226-284 or the kit of paragraph 299 for use in a method of
simultaneous administration of the first and second immunogenic
compositions.
[1384] 301. The immunogenic composition or kit of paragraph 300
wherein the schedule of vaccination of said simultaneous
administration is a single dose.
[1385] 302. The immunogenic composition or kit of paragraph 300
wherein the schedule of vaccination of said simultaneous
administration is a multiple dose schedule.
[1386] 303. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a series of 2 doses
separated by an interval of about 1 month to about 12 months.
[1387] 304. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a series of 2 doses
separated by an interval of about 1 month to about 2 months.
[1388] 305. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a series of 3 doses
separated by an interval of about 1 month to about 12 months.
[1389] 306. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a series of 3 doses
separated by an interval of about 1 month to about 2 months.
[1390] 307. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a series of 3 doses
separated by an interval of about 1 month to about 2 months
followed by a fourth dose about 10 months to about 13 months after
the first dose.
[1391] 308. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a series of 3 doses
wherein each dose is separated by an interval of about 1, 2, 3 or 4
months followed by a fourth dose about 10 months to about 13 months
after the first dose.
[1392] 309. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of at least one dose
(e.g., 1, 2 or 3 doses) in the first year of age followed by at
least one toddler dose.
[1393] 310. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a series of 2 or 3
doses separated by an interval of about 1 month to about 2 months
(for example 28-56 days between doses), starting at 2 months of
age, followed by a toddler dose at 12-18 months of age.
[1394] 311. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a 4 dose series of
vaccine administered at 2, 4, 6, and 12-15 months of age.
[1395] 312. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a prime dose given
at day 0 and one or more booster doses given at intervals that
range from about 2 to about 24 weeks, preferably with a dosing
interval of 4-8 weeks.
[1396] 313. The immunogenic composition or kit of paragraph 302
wherein said multiple dose schedule consists of a prime dose given
at day 0 and a booster dose given about 3 months later.
[1397] 314. The immunogenic composition of any one of paragraphs
226-284 or the kit of paragraph 299 for use in a method of
concomitant administration of the first and second immunogenic
compositions.
[1398] 315. The immunogenic composition or kit of paragraph 314
wherein the schedule of vaccination of said concomitant
administration is a single dose.
[1399] 316. The immunogenic composition or kit of paragraph 314
wherein the schedule of vaccination of said concomitant
administration is a multiple dose schedule.
[1400] 317. The immunogenic composition of any one of paragraphs
226-284 or the kit of paragraph 299 for use in a method of
concurrent administration of the first and second immunogenic
compositions.
[1401] 318. The immunogenic composition or kit of paragraph 317
wherein the schedule of vaccination of said concurrent
administration is a single dose.
[1402] 319. The immunogenic composition or kit of paragraph 317
wherein the schedule of vaccination of said concurrent
administration is a multiple dose schedule.
[1403] 320. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a series of 2
doses separated by an interval of about 1 month to about 12
months.
[1404] 321. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a series of 2
doses separated by an interval of about 1 month to about 2
months.
[1405] 322. The immunogenic composition or kit of paragraph 315 or
318 wherein said multiple dose schedule consists of a series of 3
doses separated by an interval of about 1 month to about 12
months.
[1406] 323. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a series of 3
doses separated by an interval of about 1 month to about 2
months.
[1407] 324. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a series of 3
doses separated by an interval of about 1 month to about 4 months
followed by a fourth dose about 10 months to about 13 months after
the first dose.
[1408] 325. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a series of 3
doses separated by an interval of about 1 month to about 2 months
followed by a fourth dose about 10 months to about 13 months after
the first dose.
[1409] 326. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of at least one
dose (e.g., 1, 2 or 3 doses) in the first year of age followed by
at least one toddler dose.
[1410] 327. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a series of 2
or 3 doses separated by an interval of about 1 month to about 2
months (for example 28-56 days between doses), starting at 2 months
of age, followed by a toddler dose at 12-18 months of age.
[1411] 328. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a 4-dose series
of vaccine administered at 2, 4, 6, and 12-15 months of age.
[1412] 329. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a prime dose
given at day 0 and one or more booster doses given at intervals
that range from about 2 to about 24 weeks, preferably with a dosing
interval of 4-8 weeks.
[1413] 330. The immunogenic composition or kit of paragraph 316 or
319 wherein said multiple dose schedule consists of a prime dose
given at day 0 and a booster dose given about 3 months later.
[1414] 331. The immunogenic composition of any one of paragraphs
226-284 or the kit of paragraph 299 for use in a method of
sequential administration of the first and second immunogenic
compositions.
[1415] 332. The immunogenic composition or kit of paragraph 331
wherein the schedule of vaccination of said sequential
administration consists of a series of 2, 3, 4, 5, 6, 7 or 8
doses.
[1416] 333. The immunogenic composition or kit of paragraph 331 or
332 wherein the schedule of vaccination of said sequential
administration consists of a series of 2, 3 or 4 doses.
[1417] 334. The immunogenic composition or kit of any one of
paragraphs 331-333 wherein the first immunogenic composition is
administered first and the second immunogenic composition is
administered second.
[1418] 335. The immunogenic composition or kit of any one of
paragraphs 331-333 wherein the second immunogenic composition is
administered first and the first immunogenic composition is
administered second.
[1419] 336. The immunogenic composition or kit of any one of
paragraphs 331-335 wherein the schedule of vaccination consists of
a series of 2 doses separated by an interval of about 1 month to
about 12 months.
[1420] 337. The immunogenic composition or kit of any one of
paragraphs 331-335 wherein the schedule of vaccination consists of
a series of 2 doses separated by an interval of about 1 month to
about 2 months.
[1421] 338. The immunogenic composition or kit of any one of
paragraphs 331-338 wherein the first and second doses are
administered in the first year of age.
[1422] 339. The immunogenic composition or kit of any one of
paragraphs 331-338 wherein the first dose is administered in the
first year of age and the second dose is a toddler dose.
[1423] 340. The immunogenic composition or kit of paragraph 339
wherein said toddler dose is administered at 12-18 months of
age.
[1424] 341. The immunogenic composition or kit of paragraph 332 or
333 wherein the schedule of vaccination of said sequential
administration consists of a series of 3 doses.
[1425] 342. The immunogenic composition or kit of paragraph 341
wherein said schedule consists of a series of 3 doses wherein each
dose is separated by an interval of about 1 month to about 12
months.
[1426] 343. The immunogenic composition or kit of paragraph 341
wherein said schedule consists of a series of 3 doses wherein each
dose is separated by an interval of about 1 month to about 2
months.
[1427] 344. The immunogenic composition or kit of any one of
paragraphs 341-343 wherein the first and second doses are
administered in the first year of age and the third dose is a
toddler dose.
[1428] 345. The immunogenic composition or kit of any one of
paragraphs 341-344 wherein the first and second doses are separated
by an interval of about 1 month to about 2 months (for example
28-56 days between doses), starting at 2 months of age, and the
third dose is a toddler dose at 12-18 months of age.
[1429] 346. The immunogenic composition or kit of any one of
paragraphs 341-345 wherein the first immunogenic composition is
administered as the first and second doses and the second
immunogenic composition is administered as the third dose.
[1430] 347. The immunogenic composition or kit of any one of
paragraphs 341-345 wherein the second immunogenic composition is
administered as the first and second doses and the first
immunogenic composition is administered as the third dose.
[1431] 348. The immunogenic composition or kit of any one of
paragraphs 341-345 wherein the first immunogenic composition is
administered as the first dose, the second immunogenic composition
is administered as the second dose and the first immunogenic
composition is administered as the third dose.
[1432] 349. The immunogenic composition or kit of any one of
paragraphs 341-345 wherein the second immunogenic composition is
administered as the first dose, the first immunogenic composition
is administered as the second dose and the second immunogenic
composition is administered as the third dose.
[1433] 350. The immunogenic composition or kit of any one of
paragraphs 341-345 wherein the first immunogenic composition is
administered as the first dose and the second immunogenic
composition is administered as the second and third doses.
[1434] 351. The immunogenic composition or kit of any one of
paragraphs 341-345 wherein the second immunogenic composition is
administered as the first dose and the first immunogenic
composition is administered as the second and third doses.
[1435] 352. The immunogenic composition or kit of paragraph 332 or
333 wherein the schedule of vaccination of said sequential
administration consists of a series of 4 doses.
[1436] 353. The immunogenic composition or kit of paragraph 352
wherein the first, second and third doses are separated by an
interval of about 1 month to about 4 months followed by the fourth
dose about 10 months to about 13 months after the first dose.
[1437] 354. The immunogenic composition or kit of paragraph 352 or
353 wherein the first, second and third doses are separated by an
interval of about 1 month to about 2 months followed by the fourth
dose about 10 months to about 13 months after the first dose.
[1438] 355. The immunogenic composition or kit of any one of
paragraphs 352-354 wherein the first, second and third doses are
administered in the first year of age and the fourth dose is a
toddler dose.
[1439] 356. The immunogenic composition or kit of any one of
paragraphs 352-355 wherein the first, second and third doses are
separated by an interval of about 1 month to about 2 months (for
example 28-56 days between doses), starting at 2 months of age, and
the fourth dose is a toddler dose at 12-18 months of age.
[1440] 357. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the first immunogenic composition is
administered as the first, second and third doses and the second
immunogenic composition is administered as the fourth dose.
[1441] 358. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the second immunogenic composition is
administered as the first, second and third doses and the first
immunogenic composition is administered as the fourth dose.
[1442] 359. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the first immunogenic composition is
administered as the first and second doses and the second
immunogenic composition is administered as the third and fourth
doses.
[1443] 360. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the second immunogenic composition is
administered as the first and second doses and the first
immunogenic composition is administered as the third and fourth
doses.
[1444] 361. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the first immunogenic composition is
administered as the first and second doses, the second immunogenic
composition is administered as the third dose and the first
immunogenic composition is administered as the fourth dose.
[1445] 362. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the second immunogenic composition is
administered as the first and second doses, the first immunogenic
composition is administered as the third dose and the second
immunogenic composition is administered as the fourth dose.
[1446] 363. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the first immunogenic composition is
administered as the first dose and the second immunogenic
composition is administered as the second, third and fourth
doses.
[1447] 364. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the second immunogenic composition is
administered as the first dose and the first immunogenic
composition is administered as the second, third and fourth
doses.
[1448] 365. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the first immunogenic composition is
administered as the first dose, the second immunogenic composition
is administered as the second dose, the first immunogenic
composition is administered as the third dose and the second
immunogenic composition is administered as the fourth dose.
[1449] 366. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the second immunogenic composition is
administered as the first dose, the first immunogenic composition
is administered as the second dose, the second immunogenic
composition is administered as the third dose and the first
immunogenic composition is administered as the fourth dose.
[1450] 367. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the first immunogenic composition is
administered as the first dose, the second immunogenic composition
is administered as the second dose and the first immunogenic
composition is administered as the third and fourth doses.
[1451] 368. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the second immunogenic composition is
administered as the first dose, the first immunogenic composition
is administered as the second dose and the second immunogenic
composition is administered as the third and fourth doses.
[1452] 369. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the first immunogenic composition is
administered as the first dose, the second immunogenic composition
is administered as the second and third doses and the first
immunogenic composition is administered as the fourth dose.
[1453] 370. The immunogenic composition or kit of any one of
paragraphs 352-356 wherein the second immunogenic composition is
administered as the first dose, the first immunogenic composition
is administered as the second and third doses and the second
immunogenic composition is administered as the fourth dose.
[1454] 371. The immunogenic composition or kit of any one of
paragraphs 331-332 wherein the schedule of vaccination of said
sequential administration consists of a series of 5 doses.
[1455] 372. The immunogenic composition or kit of paragraph 371
wherein the schedule of vaccination consists of a series of 4 doses
separated by an interval of about 1 month to about 3 months
followed by a fifth dose about 10 months to about 13 months after
the first dose.
[1456] 373. The immunogenic composition or kit of any one of
paragraphs 371-372 wherein the first, second, third and fourth
doses are administered in the first year of age and the fifth dose
is a toddler dose.
[1457] 374. The immunogenic composition or kit of any one of
paragraphs 371-372 wherein the first immunogenic composition
(1.sup.st IC) and the second immunogenic composition (2.sup.nd IC)
are administered according to any of the following schedules:
TABLE-US-00012 TABLE E Dose 1 2 3 4 5 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC
[1458] 375. The immunogenic composition or kit of any one of
paragraphs 331-332 wherein the schedule of vaccination of said
sequential administration consists of a series of 6 doses.
[1459] 376. The immunogenic composition or kit of paragraph 375
wherein the schedule of vaccination consists of a series of 5 doses
separated by an interval of about 1 month to about 2 months
followed by a sixth dose about 10 months to about 13 months after
the first dose.
[1460] 377. The immunogenic composition or kit of any one of
paragraphs 375-376 wherein the first, second, third, fourth and
fifth doses are administered in the first year of age and the sixth
dose is a toddler dose.
[1461] 378. The immunogenic composition or kit of any one of
paragraphs 375-377 wherein the first immunogenic composition and
the second immunogenic composition are administered according to
any of the schedules of paragraph 374 followed by a sixth dose.
[1462] 379. The immunogenic composition or kit of any one of
paragraphs 378 wherein the first immunogenic composition according
to the invention is administered as the sixth dose.
[1463] 380. The immunogenic composition or kit of any one of
paragraphs 378 wherein the second immunogenic composition according
to the invention is administered as the sixth dose.
[1464] 381. The immunogenic composition or kit of any one of
paragraphs 331-332 wherein the schedule of vaccination of said
sequential administration consists of a series of 7 doses.
[1465] 382. The immunogenic composition or kit of paragraph 381
wherein the schedule of vaccination consists of a series of 6 doses
separated by an interval of about 1 month followed by a seventh
dose about 10 months to about 13 months after the first dose.
[1466] 383. The immunogenic composition or kit of any one of
paragraphs 381-382 wherein the first, second, third, fourth, fifth
and sixth doses are administered in the first year of age and the
seventh dose is a toddler dose.
[1467] 384. The immunogenic composition or kit of any one of
paragraphs 381-383 wherein the first immunogenic composition and
the second immunogenic composition are administered according to
any of the schedules of paragraph 379 or 380 followed by a seventh
dose.
[1468] 385. The immunogenic composition or kit of paragraph 384
wherein the first immunogenic composition according to the
invention is administered as the seventh dose.
[1469] 386. The immunogenic composition or kit of paragraph 384
wherein the second immunogenic composition according to the
invention is administered as the seventh dose.
[1470] 387. The immunogenic composition or kit of any one of
paragraphs 331-332 wherein the schedule of vaccination of said
sequential administration consists of a series of 8 doses.
[1471] 388. The immunogenic composition or kit of paragraph 387
wherein the schedule of vaccination consists of a series of 7 doses
separated by an interval of about 1 month followed by an eighth
dose about 10 months to about 13 months after the first dose.
[1472] 389. The immunogenic composition or kit of any one of
paragraphs 387-388 wherein the first, second, third, fourth, fifth,
sixth and seventh doses are administered in the first year of age
and the seventh dose is a toddler dose.
[1473] 390. The immunogenic composition or kit of any one of
paragraphs 387-389 wherein the first immunogenic composition and
the second immunogenic composition are administered according to
any of the schedules of paragraph 385 or 386 followed by a eighth
dose.
[1474] 391. The immunogenic composition or kit of any one of
paragraphs 390 wherein the first immunogenic composition according
to the invention is administered as the eighth dose.
[1475] 392. The immunogenic composition or kit of any one of
paragraphs 390 wherein the second immunogenic composition according
to the invention is administered as the eighth dose.
[1476] 393. The immunogenic composition or kit of any one of
paragraphs 331-333 wherein the schedule of vaccination consists of
the sequential administration of:
[1477] (a) the first immunogenic composition and
[1478] (b) the concomitant or concurrent administration of the
first immunogenic composition with the second immunogenic
composition.
[1479] 394. The immunogenic composition or kit of paragraph 393
wherein the schedule of vaccination consists of a series of 2
administrations.
[1480] 395. The immunogenic composition or kit of any one of
paragraphs 393-395 wherein the schedule of vaccination consists of
a series of 2 administrations separated by an interval of about 1
month to about 12 months.
[1481] 396. The immunogenic composition or kit of any one of
paragraphs 393-396 wherein the first immunogenic composition is
administered first and the concomitant or concurrent administration
is administered second.
[1482] 397. The immunogenic composition or kit of any one of
paragraphs 393-396 wherein the concomitant or concurrent
administration is administered first and the first immunogenic
composition is administered second.
[1483] 398. The immunogenic composition or kit of any one of
paragraphs 393-398 wherein the first and second administrations are
administered in the first year of age.
[1484] 399. The immunogenic composition or kit of any one of
paragraphs 393-398 wherein the first administration is administered
in the first year of age and the second administration is a toddler
administration.
[1485] 400. The immunogenic composition or kit of paragraph 399
wherein said toddler administration is administered at 12-18 months
of age.
[1486] 401. The immunogenic composition or kit of paragraph 393
wherein the schedule of vaccination consists of a series of 3
administrations.
[1487] 402. The immunogenic composition or kit of paragraph 401
wherein said schedule consists of a series of 3 administrations
separated by an interval of about 1 month to about 12 months.
[1488] 403. The immunogenic composition or kit of any one of
paragraphs 401-402 wherein the first and second administrations are
administered in the first year of age and the third administration
is a toddler administration.
[1489] 404. The immunogenic composition or kit of any one of
paragraphs 401-403 wherein the first and second administrations are
separated by an interval of about 1 month to about 2 months (for
example 28-56 days between administrations), starting at 2 months
of age, and the third administration is a toddler administration at
12-18 months of age.
[1490] 405. The immunogenic composition or kit of any one of
paragraphs 401-404 wherein the first immunogenic composition is
administered at the first and second administrations and the
concomitant or concurrent administration is administered at the
third administration.
[1491] 406. The immunogenic composition or kit of any one of
paragraphs 401-404 wherein the concomitant or concurrent
administration is administered at the first and second
administrations and the first immunogenic composition is
administered at the third administration.
[1492] 407. The immunogenic composition or kit of any one of
paragraphs 401-404 wherein the first immunogenic composition is
administered at the first administration, the concomitant or
concurrent administration is administered at the second
administration and the first immunogenic composition is
administered at the third administration.
[1493] 408. The immunogenic composition or kit of any one of
paragraphs 401-404 wherein the concomitant or concurrent
administration is administered at the first administration, the
first immunogenic composition is administered at the second
administration and the concomitant or concurrent is administered at
the third administration.
[1494] 409. The immunogenic composition or kit of any one of
paragraphs 401-404 wherein the first immunogenic composition is
administered at the first administration and the concomitant or
concurrent administration is administered at the second and third
administrations.
[1495] 410. The immunogenic composition or kit of any one of
paragraphs 401-404 wherein the concomitant or concurrent
administration is administered at the first administration and the
first immunogenic composition is administered at the second and
third administrations.
[1496] 411. The immunogenic composition or kit of paragraph 393
wherein the schedule of vaccination consists of a series of 4
administrations.
[1497] 412. The immunogenic composition or kit of paragraph 411
wherein the first, second and third administrations are separated
by an interval of about 1 month to about 4 months followed by the
fourth administration about 10 months to about 13 months after the
first administration.
[1498] 413. The immunogenic composition or kit of paragraph 411
wherein the first, second and third administrations are separated
by an interval of about 1 month to about 2 months followed by the
fourth administration about 10 months to about 13 months after the
first administration.
[1499] 414. The immunogenic composition or kit of any one of
paragraphs 411-413 wherein the first, second and third
administrations are administered in the first year of age and the
fourth administration is a toddler administration.
[1500] 415. The immunogenic composition or kit of any one of
paragraphs 411-414 wherein the first, second and third
administrations are separated by an interval of about 1 month to
about 2 months (for example 28-56 days between administrations),
starting at 2 months of age, and the fourth administration is a
toddler administration at 12-18 months of age.
[1501] 416. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the first immunogenic composition is
administered at the first, second and third administrations and the
concomitant or concurrent administration is administered at the
fourth administration.
[1502] 417. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein, the concomitant or concurrent
administration is administered at the first, second, and third
administrations and the first immunogenic composition is
administered at the fourth administration.
[1503] 418. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the first immunogenic composition is
administered at the first and second administrations and the
concomitant or concurrent administration is administered at the
third and fourth administrations.
[1504] 419. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the concomitant or concurrent
administration is administered at the first and second
administrations and the first immunogenic composition is
administered at the third and fourth administrations.
[1505] 420. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the first immunogenic composition is
administered at the first and second administrations, the
concomitant or concurrent administration is administered at the
third administration and the first immunogenic composition is
administered at the fourth administration.
[1506] 421. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the concomitant or concurrent
administration is administered at the first and second
administrations, the first immunogenic composition is administered
at the third administration and the concomitant or concurrent
administration is administered at the fourth administration.
[1507] 422. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein, the first immunogenic composition is
administered at the first administration and the concomitant or
concurrent administration is administered at the second, third and
fourth administrations.
[1508] 423. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the concomitant or concurrent
administration is administered at the first administration and the
first immunogenic composition is administered at the second, third
and fourth administrations.
[1509] 424. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the first immunogenic composition is
administered at the first administration, the concomitant or
concurrent administration is administered at the second
administration, the first immunogenic composition is administered
at the third administration and the concomitant or concurrent
administration is administered at the fourth administration.
[1510] 425. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the concomitant or concurrent
administration is administered at the first administration, the
first immunogenic composition is administered at the second
administration, the concomitant or concurrent administration is
administered at the third administration and the first immunogenic
composition is administered at the fourth administration.
[1511] 426. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the first immunogenic composition is
administered at the first administration, the concomitant or
concurrent administration is administered at the second
administration and the first immunogenic composition is
administered at the third and fourth administrations.
[1512] 427. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the concomitant or concurrent
administration is administered at the first administration, the
first immunogenic composition is administered at the second
administration and the concomitant or concurrent administration is
administered at the third and fourth administrations.
[1513] 428. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the first immunogenic composition is
administered at the first administration, the concomitant or
concurrent administration is administered at the second and third
administrations and the first immunogenic composition is
administered at the fourth administration.
[1514] 429. The immunogenic composition or kit of any one of
paragraphs 411-415 wherein the concomitant or concurrent
administration is administered at the first administration, the
first immunogenic composition is administered at the second and
third administrations and the concomitant or concurrent
administration is administered at the fourth administration.
[1515] 430. The immunogenic composition or kit of paragraph 393
wherein the schedule of vaccination consists of a series of 5
administrations.
[1516] 431. The immunogenic composition or kit of paragraph 430
wherein the schedule consists of a series of 4 administrations
wherein each dose is separated by an interval of about 1 month to
about 3 months followed by a fifth administration about 10 months
to about 13 months after the first administration.
[1517] 432. The immunogenic composition or kit of any one of
paragraphs 430-431 wherein, the first, second, third and fourth
administrations are administered in the first year of age and the
fifth administration is a toddler dose.
[1518] 433. The immunogenic composition or kit of any one of
paragraphs 430-432 wherein, the first immunogenic composition
(1.sup.st IC) and the concomitant or concurrent administration of
the first immunogenic composition with the second immunogenic
composition (1.sup.st IC/2.sup.nd IC) are administered according to
any of the following schedules:
TABLE-US-00013 TABLE F Dose 1 2 3 4 5 1st IC/2nd IC 1st IC/2nd IC
1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC
1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC
1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC
1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC
1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC
1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1st
IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st
IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1st
IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st
IC/2nd IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC
1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC
1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC
1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1st
IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1st
IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1st
IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1st
IC/2nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC
1.sup.st IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC
1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1st IC/2nd IC
1.sup.st IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1st IC/2nd IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1st
IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1st
IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1st
IC/2nd IC 1.sup.st IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1st
IC/2nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st
IC 1st IC/2nd IC 1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
1st IC/2nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 1st IC/2nd IC
[1519] 434. The immunogenic composition or kit of paragraph 393
wherein the schedule of vaccination consists of a series of 6
administrations.
[1520] 435. The immunogenic composition or kit of paragraph 434
wherein the schedule consists of a series of 5 administrations
wherein each administration is separated by an interval of about 1
month to about 2 months followed by a sixth administration about 10
months to about 13 months after the first administration.
[1521] 436. The immunogenic composition or kit any one of
paragraphs 434-435 wherein the first, second, third, fourth and
fifth administrations are administered in the first year of age and
the sixth administration is a toddler administration.
[1522] 437. The immunogenic composition or kit any one of
paragraphs 434-436 wherein the first immunogenic composition and
the concomitant or concurrent administration of the first
immunogenic composition with the second immunogenic composition are
administered according to any of the schedules of paragraph 433
followed by a sixth administration.
[1523] 438. The immunogenic composition or kit of any one of
paragraphs 437 wherein the first immunogenic composition is
administered as the sixth administration.
[1524] 439. The immunogenic composition or kit of any one of
paragraphs 437 wherein the concomitant or concurrent administration
of the first immunogenic composition with the second immunogenic
composition is administered at the sixth administration.
[1525] 440. The immunogenic composition or kit of paragraph 393
wherein the schedule of vaccination consists of a series of 7
administrations.
[1526] 441. The immunogenic composition or kit of paragraph 440
wherein the schedule of vaccination consists of a series of 6
administrations wherein each administration is separated by an
interval of about 1 month followed by a seventh administration
about 10 months to about 13 months after the first
administration.
[1527] 442. The immunogenic composition or kit of any one of
paragraphs 440-441 wherein, the first, second, third, fourth, fifth
and sixth administrations are administered in the first year of age
and the seventh administration is a toddler administration.
[1528] 443. The immunogenic composition or kit of any one of
paragraphs 440-442 wherein the first immunogenic composition and
the concomitant administration of the first immunogenic composition
with the second immunogenic composition are administered according
to any of the schedule of paragraph 438 or 439 followed by a
seventh administration.
[1529] 444. The immunogenic composition or kit of paragraph 443
wherein the first immunogenic composition is administered as the
seventh administration.
[1530] 445. The immunogenic composition or kit of paragraph 443
wherein the concomitant or concurrent administration of the first
immunogenic composition with the second immunogenic composition is
administered as the seventh administration.
[1531] 446. The immunogenic composition or kit of paragraph 393
wherein the schedule of vaccination consists of a series of 8
administrations.
[1532] 447. The immunogenic composition or kit of paragraph 446
wherein the schedule of vaccination consists of a series of 7
administrations wherein each administration is separated by an
interval of about 1 month followed by an eighth administration
about 10 months to about 13 months after the first
administration.
[1533] 448. The immunogenic composition or kit of any one of
paragraphs 446-447 wherein, the first, second, third, fourth,
fifth, sixth and seventh administrations are administered in the
first year of age and the seventh administration is a toddler
administration.
[1534] 449. The immunogenic composition or kit of any one of
paragraphs 446-448 wherein the first immunogenic composition and
the concomitant or concurrent administration of the first
immunogenic composition with the second immunogenic composition are
administered according to any of the schedule of paragraph 444 or
445 followed by an eighth administration.
[1535] 450. The immunogenic composition or kit of paragraph 449
wherein the first immunogenic composition is administered as the
eighth administration.
[1536] 451. The immunogenic composition or kit of paragraph 449
wherein the concomitant or concurrent administration of the first
immunogenic composition with the second immunogenic composition is
administered as the eighth administration.
[1537] 452. The immunogenic composition or kit of any one of
paragraphs 331-333 wherein the schedule of vaccination consists of
the sequential administration of:
[1538] (a) the second immunogenic composition and
[1539] (b) the concomitant or concurrent administration of the
first immunogenic composition with the second immunogenic
composition
[1540] 453. The immunogenic composition or kit of paragraph 452
wherein said schedule is any one of the schedule according to
paragraphs 394-451 wherein administration of said second
immunogenic composition of (a) replaces administration of the first
immunogenic composition of (a) in said paragraphs.
[1541] 454. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use as a
medicament.
[1542] 455. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use as a
vaccine.
[1543] 456. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use in a
method for preventing, treating or ameliorating a bacterial
infection, disease or condition in a subject.
[1544] 457. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use in a
method for preventing a bacterial infection, disease or condition
in a subject.
[1545] 458. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use in a
method to protect or treat a human susceptible to pneumococcal
infection, by means of administering said immunogenic compositions
via a systemic or mucosal route.
[1546] 459. The immunogenic composition or kit of paragraph 458
wherein said immunogenic composition(s) is/are administered by
intramuscular, intraperitoneal, intradermal or subcutaneous
routes.
[1547] 460. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use as a
vaccine, wherein the subject to be vaccinated is human being less
than 1 year of age.
[1548] 461. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use as a
vaccine, wherein the subject to be vaccinated is a human being less
than 2 year of age.
[1549] 462. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use as a
vaccine, wherein the subject to be vaccinated is a human adult 50
years of age or older.
[1550] 463. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use as a
vaccine, wherein the subject to be vaccinated is an
immunocompromised human.
[1551] 464. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use in a
single dose schedule.
[1552] 465. The immunogenic composition of any one of paragraphs
1-165 or the kit of any one of paragraphs 166-225 for use in a
multiple dose schedule.
[1553] 466. The immunogenic composition or kit of paragraph 465
wherein said multiple dose schedule consists of a series of 2 doses
separated by an interval of about 1 month to about 2 months.
[1554] 467. The immunogenic composition or kit of paragraph 465
wherein said multiple dose schedule consists of a series of 3 doses
separated by an interval of about 1 month to about 2 months.
[1555] 468. The immunogenic composition or kit of paragraph 465
wherein said multiple dose schedule consists of a series of 3 doses
separated by an interval of about 1 month to about 2 months
followed by a fourth dose about 10 months to about 13 months after
the first dose.
[1556] 469. The immunogenic composition or kit of paragraph 465
wherein said multiple dose schedule consists of at least one dose
in the first year of age followed by at least one toddler dose.
[1557] 470. The immunogenic composition or kit of paragraph 465
wherein said multiple dose schedule consists of a series of 2 or 3
doses separated by an interval of about 1 month to about 2 months,
starting at 2 months of age, and followed by a toddler dose at
12-18 months of age.
[1558] 471. The immunogenic composition or kit of paragraph 465
wherein said multiple dose schedule consists of 4 doses series of
vaccine administered at 2, 4, 6, and 12-15 months of age.
[1559] 472. The immunogenic composition or kit of any one of
paragraphs 331-333 wherein the schedule of vaccination consists of
the sequential administration of:
[1560] (a) the second immunogenic composition and
[1561] (b) the concomitant or concurrent administration of the
first immunogenic composition with the second immunogenic
composition.
[1562] 473. The immunogenic composition or kit of paragraph 472
wherein the schedule of vaccination consists of a series of 2
administrations.
[1563] 474. The immunogenic composition or kit of any one of
paragraphs 472-473 wherein the schedule of vaccination consists of
a series of 2 administrations separated by an interval of about 1
month to about 12 months.
[1564] 475. The immunogenic composition or kit of any one of
paragraphs 472-474 wherein the second immunogenic composition is
administered first and the concomitant or concurrent administration
is administered second.
[1565] 476. The immunogenic composition or kit of any one of
paragraphs 472-474 wherein the concomitant or concurrent
administration is administered first and the second immunogenic
composition is administered second.
[1566] 477. The immunogenic composition or kit of any one of
paragraphs 472-476 wherein the first and second administrations are
administered in the first year of age.
[1567] 478. The immunogenic composition or kit of any one of
paragraphs 472-476 wherein the first administration is administered
in the first year of age and the second administration is a toddler
administration.
[1568] 479. The immunogenic composition or kit of paragraph 478
wherein said toddler administration is administered at 12-18 months
of age.
[1569] 480. The immunogenic composition or kit of paragraph 472
wherein the schedule of vaccination consists of a series of 3
administrations.
[1570] 481. The immunogenic composition or kit of paragraph 480
wherein said schedule consists of a series of 3 administrations
separated by an interval of about 1 month to about 12 months.
[1571] 482. The immunogenic composition or kit of any one of
paragraphs 480-481 wherein the first and second administrations are
administered in the first year of age and the third administration
is a toddler administration.
[1572] 483. The immunogenic composition or kit of any one of
paragraphs 480-482 wherein the first and second administrations are
separated by an interval of about 1 month to about 2 months (for
example 28-56 days between administrations), starting at 2 months
of age, and the third administration is a toddler administration at
12-18 months of age.
[1573] 484. The immunogenic composition or kit of any one of
paragraphs 480-483 wherein the second immunogenic composition is
administered at the first and second administrations and the
concomitant or concurrent administration is administered at the
third administration.
[1574] 485. The immunogenic composition or kit of any one of
paragraphs 480-483 wherein the concomitant or concurrent
administration is administered at the first and second
administrations and the second immunogenic composition is
administered at the third administration.
[1575] 486. The immunogenic composition or kit of any one of
paragraphs 480-483 wherein the second immunogenic composition is
administered at the first administration, the concomitant or
concurrent administration is administered at the second
administration and the second immunogenic composition is
administered at the third administration.
[1576] 487. The immunogenic composition or kit of any one of
paragraphs 480-483 wherein the concomitant or concurrent
administration is administered at the first administration, the
second immunogenic composition is administered at the second
administration and the concomitant or concurrent is administered at
the third administration.
[1577] 488. The immunogenic composition or kit of any one of
paragraphs 480-483 wherein the second immunogenic composition is
administered at the first administration and the concomitant or
concurrent administration is administered at the second and third
administrations.
[1578] 489. The immunogenic composition or kit of any one of
paragraphs 480-483 wherein the concomitant or concurrent
administration is administered at the first administration and the
second immunogenic composition is administered at the second and
third administrations.
[1579] 490. The immunogenic composition or kit of paragraph 472
wherein the schedule of vaccination consists of a series of 4
administrations.
[1580] 491. The immunogenic composition or kit of paragraph 490
wherein the first, second and third administrations are separated
by an interval of about 1 month to about 4 months followed by the
fourth administration about 10 months to about 13 months after the
first administration.
[1581] 492. The immunogenic composition or kit of paragraph 490
wherein the first, second and third administrations are separated
by an interval of about 1 month to about 2 months followed by the
fourth administration about 10 months to about 13 months after the
first administration.
[1582] 493. The immunogenic composition or kit of any one of
paragraphs 490-492 wherein the first, second and third
administrations are administered in the first year of age and the
fourth administration is a toddler administration.
[1583] 494. The immunogenic composition or kit of any one of
paragraphs 490-493 wherein the first, second and third
administrations are separated by an interval of about 1 month to
about 2 months (for example 28-56 days between administrations),
starting at 2 months of age, and the fourth administration is a
toddler administration at 12-18 months of age.
[1584] 495. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the second immunogenic composition is
administered at the first, second and third administrations and the
concomitant or concurrent administration is administered at the
fourth administration.
[1585] 496. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein, the concomitant or concurrent
administration is administered at the first, second, and third
administrations and the second immunogenic composition is
administered at the fourth administration.
[1586] 497. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the second immunogenic composition is
administered at the first and second administrations and the
concomitant or concurrent administration is administered at the
third and fourth administrations.
[1587] 498. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the concomitant or concurrent
administration is administered at the first and second
administrations and the second immunogenic composition is
administered at the third and fourth administrations.
[1588] 499. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the second immunogenic composition is
administered at the first and second administrations, the
concomitant or concurrent administration is administered at the
third administration and the second immunogenic composition is
administered at the fourth administration.
[1589] 500. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the concomitant or concurrent
administration is administered at the first and second
administrations, the second immunogenic composition is administered
at the third administration and the concomitant or concurrent
administration is administered at the fourth administration.
[1590] 501. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein, the second immunogenic composition is
administered at the first administration and the concomitant or
concurrent administration is administered at the second, third and
fourth administrations.
[1591] 502. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the concomitant or concurrent
administration is administered at the first administration and the
second immunogenic composition is administered at the second, third
and fourth administrations.
[1592] 503. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the second immunogenic composition is
administered at the first administration, the concomitant or
concurrent administration is administered at the second
administration, the second immunogenic composition is administered
at the third administration and the concomitant or concurrent
administration is administered at the fourth administration.
[1593] 504. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the concomitant or concurrent
administration is administered at the first administration, the
second immunogenic composition is administered at the second
administration, the concomitant or concurrent administration is
administered at the third administration and the second immunogenic
composition is administered at the fourth administration.
[1594] 505. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the second immunogenic composition is
administered at the first administration, the concomitant or
concurrent administration is administered at the second
administration and the second immunogenic composition is
administered at the third and fourth administrations.
[1595] 506. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the concomitant or concurrent
administration is administered at the first administration, the
second immunogenic composition is administered at the second
administration and the concomitant or concurrent administration is
administered at the third and fourth administrations.
[1596] 507. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the second immunogenic composition is
administered at the first administration, the concomitant or
concurrent administration is administered at the second and third
administrations and the second immunogenic composition is
administered at the fourth administration.
[1597] 508. The immunogenic composition or kit of any one of
paragraphs 490-494 wherein the concomitant or concurrent
administration is administered at the first administration, the
second immunogenic composition is administered at the second and
third administrations and the concomitant or concurrent
administration is administered at the fourth administration.
[1598] 509. The immunogenic composition or kit of paragraph 472
wherein the schedule of vaccination consists of a series of 5
administrations.
[1599] 510. The immunogenic composition or kit of paragraph 509
wherein the schedule consists of a series of 4 administrations
wherein each dose is separated by an interval of about 1 month to
about 3 months followed by a fifth administration about 10 months
to about 13 months after the first administration.
[1600] 511. The immunogenic composition or kit of any one of
paragraphs 509-510 wherein, the first, second, third and fourth
administrations are administered in the first year of age and the
fifth administration is a toddler dose.
[1601] 512. The immunogenic composition or kit of any one of
paragraphs 509-511 wherein, the second immunogenic composition
(2.sup.nd IC) and the concomitant or concurrent administration of
the first immunogenic composition with the second immunogenic
composition (1.sup.st IC/2.sup.nd IC) are administered according to
any of the following schedules:
TABLE-US-00014 TABLE G Dose 1 2 3 4 5 1st IC/2nd IC 1st IC/2nd IC
1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC
1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC
1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC
2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC
2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC
2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 1st
IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st
IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 1st
IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st
IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC
2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC
2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 1st
IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 1st
IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 1st
IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 1st
IC/2nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC
2.sup.nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC
2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC
2.sup.nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 1st IC/2nd IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1st
IC/2nd IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st
IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1st
IC/2nd IC 2.sup.nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 1st
IC/2nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd
IC 1st IC/2nd IC 1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
1st IC/2nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 1st IC/2nd IC
[1602] 513. The immunogenic composition or kit of paragraph 472
wherein the schedule of vaccination consists of a series of 6
administrations.
[1603] 514. The immunogenic composition or kit of paragraph 513
wherein the schedule consists of a series of 5 administrations
wherein each administration is separated by an interval of about 1
month to about 2 months followed by a sixth administration about 10
months to about 13 months after the first administration.
[1604] 515. The immunogenic composition or kit any one of
paragraphs 513-514 wherein the first, second, third, fourth and
fifth administrations are administered in the first year of age and
the sixth administration is a toddler administration.
[1605] 516. The immunogenic composition or kit any one of
paragraphs 513-515 wherein the second immunogenic composition and
the concomitant or concurrent administration of the first
immunogenic composition with the second immunogenic composition are
administered according to any of the schedules of paragraph 512
followed by a sixth administration.
[1606] 517. The immunogenic composition or kit of any one of
paragraphs 516 wherein the second immunogenic composition is
administered as the sixth administration.
[1607] 518. The immunogenic composition or kit of any one of
paragraphs 516 wherein the concomitant or concurrent administration
of the first immunogenic composition with the second immunogenic
composition is administered at the sixth administration.
[1608] 519. The immunogenic composition or kit of paragraph 472
wherein the schedule of vaccination consists of a series of 7
administrations.
[1609] 520. The immunogenic composition or kit of paragraph 519
wherein the schedule of vaccination consists of a series of 6
administrations wherein each administration is separated by an
interval of about 1 month followed by a seventh administration
about 10 months to about 13 months after the first
administration.
[1610] 521. The immunogenic composition or kit of any one of
paragraphs 519-520 wherein, the first, second, third, fourth, fifth
and sixth administrations are administered in the first year of age
and the seventh administration is a toddler administration.
[1611] 522. The immunogenic composition or kit of any one of
paragraphs 519-521 wherein the second immunogenic composition and
the concomitant administration of the first immunogenic composition
with the second immunogenic composition are administered according
to any of the schedule of paragraph 517 or 518 followed by a
seventh administration.
[1612] 523. The immunogenic composition or kit of paragraph 522
wherein the second immunogenic composition is administered as the
seventh administration.
[1613] 524. The immunogenic composition or kit of paragraph 522
wherein the concomitant or concurrent administration of the first
immunogenic composition with the second immunogenic composition is
administered as the seventh administration.
[1614] 525. The immunogenic composition or kit of paragraph 472
wherein the schedule of vaccination consists of a series of 8
administrations.
[1615] 526. The immunogenic composition or kit of paragraph 525
wherein the schedule of vaccination consists of a series of 7
administrations wherein each administration is separated by an
interval of about 1 month followed by an eighth administration
about 10 months to about 13 months after the first
administration.
[1616] 527. The immunogenic composition or kit of any one of
paragraphs 525-526 wherein, the first, second, third, fourth,
fifth, sixth and seventh administrations are administered in the
first year of age and the seventh administration is a toddler
administration.
[1617] 528. The immunogenic composition or kit of any one of
paragraphs 525-527 wherein the second immunogenic composition and
the concomitant or concurrent administration of the first
immunogenic composition with the second immunogenic composition are
administered according to any of the schedule of paragraph 523 or
524 followed by an eighth administration.
[1618] 529. The immunogenic composition or kit of paragraph 528
wherein the second immunogenic composition is administered as the
eighth administration.
[1619] 530. The immunogenic composition or kit of paragraph 528
wherein the concomitant or concurrent administration of the first
immunogenic composition with the second immunogenic composition is
administered as the eighth administration.
[1620] 531. The immunogenic composition or kit of paragraph 352
wherein the first and second doses are administered in the first
year of age and the third and fourth doses are a toddler dose.
[1621] 532. The immunogenic composition or kit of paragraph 352
wherein the schedule consists of a series of 2 doses wherein each
dose is separated by an interval of about 1 month to about 2 months
followed by a third dose about 10 months to about 13 months after
the first dose and a fourth dose about 1 month to about 2 months
after the third dose.
[1622] 533. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the first immunogenic composition is
administered as the first, second and third doses and the second
immunogenic composition is administered as the fourth dose.
[1623] 534. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the second immunogenic composition is
administered as the first, second and third doses and the first
immunogenic composition is administered as the fourth dose.
[1624] 535. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the first immunogenic composition is
administered as the first and second doses and the second
immunogenic composition is administered as the third and fourth
doses.
[1625] 536. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the second immunogenic composition is
administered as the first and second doses and the first
immunogenic composition is administered as the third and fourth
doses.
[1626] 537. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the first immunogenic composition is
administered as the first and second doses, the second immunogenic
composition is administered as the third dose and the first
immunogenic composition is administered as the fourth dose.
[1627] 538. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the second immunogenic composition is
administered as the first and second doses, the first immunogenic
composition is administered as the third dose and the second
immunogenic composition is administered as the fourth dose.
[1628] 539. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the first immunogenic composition is
administered as the first dose and the second immunogenic
composition is administered as the second, third and fourth
doses.
[1629] 540. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the second immunogenic composition is
administered as the first dose and the first immunogenic
composition is administered as the second, third and fourth
doses.
[1630] 541. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the first immunogenic composition is
administered as the first dose, the second immunogenic composition
is administered as the second dose, the first immunogenic
composition is administered as the third dose and the second
immunogenic composition is administered as the fourth dose.
[1631] 542. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the second immunogenic composition is
administered as the first dose, the first immunogenic composition
is administered as the second dose, the second immunogenic
composition is administered as the third dose and the first
immunogenic composition is administered as the fourth dose.
[1632] 543. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the first immunogenic composition is
administered as the first dose, the second immunogenic composition
is administered as the second dose and the first immunogenic
composition is administered as the third and fourth doses.
[1633] 544. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the second immunogenic composition is
administered as the first dose, the first immunogenic composition
is administered as the second dose and the second immunogenic
composition is administered as the third and fourth doses.
[1634] 545. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the first immunogenic composition is
administered as the first dose, the second immunogenic composition
is administered as the second and third doses and the first
immunogenic composition is administered as the fourth dose.
[1635] 546. The immunogenic composition or kit of any one of
paragraphs 531-532 wherein the second immunogenic composition is
administered as the first dose, the first immunogenic composition
is administered as the second and third doses and the second
immunogenic composition is administered as the fourth dose.
[1636] 547. The immunogenic composition or kit of paragraph 371
wherein the first, second and third doses are administered in the
first year of age and the fourth and fifth doses are a toddler
dose.
[1637] 548. The immunogenic composition or kit of paragraph 371
wherein the schedule consists of a series of 3 doses wherein each
dose is separated by an interval of about 1 month to about 2 months
followed by a fourth dose about 10 months to about 13 months after
the first dose and a fifth dose about 1 month to about 2 months
after the fourth dose.
[1638] 549. The immunogenic composition or kit of any one of
paragraphs 547-548 wherein the first immunogenic composition
(1.sup.st IC) and the second immunogenic composition (2.sup.nd IC)
are administered according to any of the following schedules:
TABLE-US-00015 TABLE H Dose 1 2 3 4 5 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 2.sup.nd IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC
1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC
2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 2.sup.nd IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 2.sup.nd IC 1.sup.st IC 1.sup.st IC 1.sup.st IC
1.sup.st IC 1.sup.st IC 2.sup.nd IC
[1639] 550. The immunogenic composition or kit of any one of
paragraphs 547-548 wherein the first immunogenic composition
(1.sup.st IC) and the second immunogenic composition (2.sup.nd IC)
are administered according to any of the following schedules:
TABLE-US-00016 TABLE J Dose 1 2 3 4 5 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 2.sup.nd IC 1.sup.st IC 2.sup.nd IC 2.sup.nd IC
2.sup.nd IC 1.sup.st IC 2.sup.nd IC
[1640] As used herein, the term "about" means within a
statistically meaningful range of a value, such as a stated
concentration range, time frame, molecular weight, temperature or
pH. Such a range can be within an order of magnitude, typically
within 20%, more typically within 10%, and even more typically
within 5% or within 1% of a given value or range. Sometimes, such a
range can be within the experimental error typical of standard
methods used for the measurement and/or determination of a given
value or range. The allowable variation encompassed by the term
"about" will depend upon the particular system under study, and can
be readily appreciated by one of ordinary skill in the art.
Whenever a range is recited within this application, every whole
number integer within the range is also contemplated as an
embodiment of the disclosure.
[1641] The terms "comprising", "comprise" and "comprises" herein
are intended by the inventors to be optionally substitutable with
the terms "consisting essentially of", "consist essentially of",
"consists essentially of", "consisting of", "consist of" and
"consists of", respectively, in every instance.
[1642] An "immunogenic amount", an "immunologically effective
amount", a "therapeutically effective amount", a "prophylactically
effective amount", or "dose", each of which is used interchangeably
herein, generally refers to the amount of antigen or immunogenic
composition sufficient to elicit an immune response, either a
cellular (T cell) or humoral (B cell or antibody) response, or
both, as measured by standard assays known to one skilled in the
art.
[1643] All references or patent applications cited within this
patent specification are incorporated by reference herein.
[1644] The invention is illustrated in the accompanying examples.
The examples below are carried out using standard techniques, which
are well known and routine to those of skill in the art, except
where otherwise described in detail. The examples are illustrative,
but do not limit the invention.
EXAMPLE
Example 1. General Process for Preparation of eTEC Linked
Glycoconjugates
[1645] Activation of Saccharide and Thiolation with Cystamine
dihydrochloride
[1646] The saccharide is reconstituted in anhydrous
dimethylsulfoxide (DMSO). Moisture content of the solution is
determined by Karl Fischer (KF) analysis and adjusted to reach a
moisture content of between 0.1% and 0.4%, typically 0.2%.
[1647] To initiate the activation, a solution of
1,1'-carbonyl-di-1,2,4-triazole (CDT) or 1,1'-carbonyldiimidazole
(CDI) is freshly prepared at a concentration of 100 mg/mL in DMSO.
The saccharide is activated with various amounts of CDT/CDI (1-10
molar equivalents) and the reaction is allowed to proceed for 1
hour at 23.+-.2.degree. C. The activation level may be determined
by HPLC. Cystamine dihydrochloride is freshly prepared in anhydrous
DMSO at a concentration of 50 mg/mL. The activated saccharide is
reacted with 1 molar equivalents (mol. eq.) of cystamine
dihydrochloride. Alternatively, the activated saccharide is reacted
with 1 mol. eq. of cysteamine hydrochloride. The thiolation
reaction is allowed to proceed for 21.+-.2 hours at 23.+-.2.degree.
C., to produce a thiolated saccharide. The thiolation level is
determined by the added amount of CDT/CDI.
[1648] Residual CDT/CDI in the activation reaction solution is
quenched by the addition of 100 mM sodium tetraborate, pH 9.0
solution. Calculations are performed to determine the added amount
of tetraborate and to adjust the final moisture content to be up to
1-2% of total aqueous.
[1649] Reduction and Purification of Activated Thiolated
Saccharide
[1650] The thiolated saccharide reaction mixture is diluted 10-fold
by addition to pre-chilled 5 mM sodium succinate in 0.9% saline, pH
6.0 and filtered through a 5 .mu.m filter. Dialfiltration of
thiolated saccharide is performed against 40-fold diavolume of WFI.
To the retentate a solution of tris(2-carboxyethyl)phosphine
(TCEP), 1-5 mol. eq., is added after dilution by 10% volume of 0.1M
sodium phosphate buffer, pH 6.0. This reduction reaction is allowed
to proceed for 20.+-.2 hours at 5.+-.3.degree. C. Purification of
the activated thiolated saccharide is performed preferably by
ultrafiltration/dialfiltration of against pre-chilled 10 mM sodium
phosphate monobasic, pH 4.3. Alternatively, the thiolated
saccharide is purified by standard size exclusion chromatographic
(SEC) procedures or ion exchange chromatographic methods. An
aliquot of activated thiolated saccharide retentate is pulled to
determine the saccharide concentration and thiol content (Ellman)
assays.
[1651] Alternative Reduction and Purification of Activated
Thiolated Saccharide
[1652] As an alternative to the purification procedure described
above, activated thiolated saccharide was also purified as
below.
[1653] To the thiolated saccharide reaction mixture a solution of
tris(2-carboxyethyl)phosphine (TCEP), 5-10 mol. eq., was added and
allowed to proceed for 3.+-.1 hours at 23.+-.2.degree. C. The
reaction mixture was then diluted 5-fold by addition to pre-chilled
5 mM sodium succinate in 0.9% saline, pH 6.0 and filtered through a
5 .mu.m filter. Dialfiltration of thiolated saccharide was
performed using 40-fold diavolume of pre-chilled 10 mM sodium
phosphate monobasic, pH 4.3. An aliquot of activated thiolated
saccharide retentate was pulled to determine the saccharide
concentration and thiol content (Ellman) assays.
[1654] Activation and Purification of Bromoacetylated Carrier
Protein
[1655] Free amino groups of the carrier protein are bromoacteylated
by reaction with a bromoacetylating agent, such as bromoacetic acid
N-hydroxysuccinimide ester (BAANS), bromoacetylbromide, or another
suitable reagent.
[1656] The carrier protein (in 0.1 M Sodium Phosphate, pH
8.0.+-.0.2) is first kept at 8.+-.3.degree. C., at about pH 7 prior
to activation. To the protein solution, the N-hydroxysuccinimide
ester of bromoacetic acid (BAANS) as a stock dimethylsulfoxide
(DMSO) solution (20 mg/mL) is added in a ratio of 0.25-0.5 BAANS:
protein (w/w). The reaction is gently mixed at 5.+-.3.degree. C.
for 30-60 minutes. The resulting bromoacetylated (activated)
protein is purified, e.g., by ultrafiltration/diafiltration using
10 kDa MWCO membrane using 10 mM phosphate (pH 7.0) buffer.
Following purification, the protein concentration of the
bromoacetylated carrier protein is estimated by Lowry protein
assay.
[1657] The extent of activation is determined by total bromide
assay by ion-exchange liquid chromatography coupled with suppressed
conductivity detection (ion chromatography). The bound bromide on
the activated bromoacetylated protein is cleaved from the protein
in the assay sample preparation and quantitated along with any free
bromide that may be present. Any remaining covalently bound bromine
on the protein is released by conversion to ionic bromide by
heating the sample in alkaline 2-mercaptoethanol.
[1658] Activation and Purification of Bromoacetylated
CRM.sub.197
[1659] CRM.sub.197 was diluted to 5 mg/mL with 10 mM phosphate
buffered 0.9% NaCl pH 7 (PBS) and then made 0.1 M NaHCO.sub.3, pH
7.0, using 1 M stock solution. BAANS was added at a
CRM.sub.197:BAANS ratio 1:0.35 (w:w) using a BAANS stock solution
of 20 mg/mL DMSO. The reaction mixture was incubated at between
3.degree. C. and 11.degree. C. for 30 mins-1 hour then purified by
ultrafiltration/diafiltration using a 10K MWCO membrane and 10 mM
Sodium Phosphate/0.9% NaCl, pH 7.0. The purified activated
CRM.sub.197 was assayed by the Lowry assay to determine the protein
concentration and then diluted with PBS to 5 mg/mL. Sucrose was
added to 5% wt/vol as a cryoprotectant and the activated protein
was frozen and stored at -25.degree. C. until needed for
conjugation.
[1660] Bromoacetylation of lysine residues of CRM.sub.197 was very
consistent, resulting in the activation of 15 to 25 lysines from 39
lysines available. The reaction produced high yields of activated
protein.
[1661] Conjugation of Activated Thiolated Saccharide to
Bromoacetylated Carrier Protein
[1662] Before starting the conjugation reaction, the reaction
vessels are pre-cooled to 5.degree. C. Bromoacetylated carrier
protein and activated thiolated saccharide are subsequently added
and mixed at an agitation speed of 150-200 rpm. The
saccharide/protein input ratio is 0.9.+-.0.1. The reaction pH is
adjusted to 8.0.+-.0.1 with 1 M NaOH solution. The conjugation
reaction is allowed to proceed at 5.degree. C. for 20.+-.2
hours.
[1663] Capping of Residual Reactive Functional Groups
[1664] The unreacted bromoacetylated residues on the carrier
protein are quenched by reacting with 2 mol. eq. of
N-acetyl-L-cysteine as a capping reagent for 3 hours at 5.degree.
C. Residual free sulfhydryl groups are capped with 4 mol. eq. of
iodoacetamide (IAA) for 20 hours at 5.degree. C.
[1665] Purification of eTEC-Linked Glycoconjugate
[1666] The conjugation reaction (post-IAA-capped) mixture is
filtered through 0.45 .mu.m filter. Ultrafiltration/dialfiltration
of the glycoconjugate is performed against 5 mM succinate-0.9%
saline, pH 6.0. The glycoconjugate retentate is then filtered
through 0.2 .mu.m filter. An aliquot of glycoconjugate is pulled
for assays. The remaining glycoconjugate is stored at 5.degree.
C.
Example 2. Preparation of Pn-33F eTEC Conjugates
Activation Process
[1667] Activation of Pn33F Polysaccharide
[1668] Pn-33F polysaccharide was compounded with 500 mM of
1,2,4-triazole (in WFI) to obtain 10 grams of triazole per gram of
polysaccharide. The mixture was shell-frozen in dry ice-ethanol
bath and then lyophilized to dryness. The lyophilized 33F
polysaccharide was reconstituted in anhydrous dimethylsulfoxide
(DMSO). Moisture content of the lyophilized 33F/DMSO solution was
determined by Karl Fischer (KF) analysis. The moisture content was
adjusted by adding WFI to the 33F/DMSO solution to reach a moisture
content of 0.2%.
[1669] To initiate the activation, 1,1'-carbonyl-di-1,2,4-triazole
(CDT) was freshly prepared as 100 mg/mL in DMSO solution. Pn33F
polysaccharide was activated with various amounts of CDT prior to
the thiolation step. The CDT activation was carried out at
23.+-.2.degree. C. for 1 hour. The activation level was determined
by HPLC (A220/A205). Sodium tetraborate, 100 mM, pH 9.0 solution
was added to quench any residual CDT in the activation reaction
solution. Calculations are performed to determine the added amount
of tetraborate and to allow the final moisture content to be 1.2%
of total aqueous. The reaction was allowed to proceed for 1 hour at
23.+-.2.degree. C.
[1670] Thiolation of Activated Pn-33F Polysaccharide
[1671] Cystamine-dihydrochloride was freshly prepared in anhydrous
DMSO and 1 mol. eq. of cystamine dihydrochloride was added to the
activated polysaccharide reaction solution. The reaction was
allowed to proceed for 21.+-.3 hours at 23.+-.2.degree. C. The
thiolated saccharide solution was diluted 10-fold by addition to
pre-chilled 5 mM sodium succinate in 0.9% saline, pH 6.0. The
diluted reaction solution was filtered through a 5 .mu.m filter.
Dialfiltration of thiolated Pn-33F polysaccharide was carried out
with 100K MWCO ultrafilter membrane cassettes, using Water for
Injection (WFI).
[1672] Reduction and Purification of Activated Thiolated Pn-33F
Polysaccharide
[1673] To the retentate a solution of tris(2-carboxyethyl)phosphine
(TCEP), 5 mol. eq., was added after dilution by 10% volume of 0.1 M
sodium phosphate buffer, pH 6.0. This reduction reaction was
allowed to proceed for 2.+-.1 hours at 23.+-.2.degree. C.
Dialfiltration of thiolated 33F polysaccharide was carried out with
100K MWCO ultrafilter membrane cassettes. Diafiltration was
performed against pre-chilled 10 mM sodium phosphate, pH 4.3. The
thiolated 33F polysaccharide retentate was pulled for both
saccharide concentration and thiol (Ellman) assays.
[1674] Alternative Reduction and Purification of Activated
Thiolated Pn-33F Polysaccharide
[1675] As an alternative to the purification procedure described
above, 33F activated thiolated saccharide was also purified as
follows.
[1676] To the thiolated saccharide reaction mixture a solution of
tris(2-carboxyethyl)phosphine (TCEP), 5 mol. eq., was added and
allowed to proceed for 3.+-.1 hours at 23.+-.2.degree. C. The
reaction mixture was then diluted 5-fold by addition to pre-chilled
5 mM sodium succinate in 0.9% saline, pH 6.0 and filtered through a
5 .mu.m filter. Dialfiltration of thiolated saccharide was
performed using 40-fold diavolume of pre-chilled 10 mM sodium
phosphate monobasic, pH 4.3 with 100K MWCO ultrafilter membrane
cassettes. The thiolated 33F polysaccharide retentate was pulled
for both saccharide concentration and thiol (Ellman) assays. A flow
diagram of the activation process is provided in FIG. 8(A).
[1677] Conjugation Process
[1678] Conjugation of Thiolated Pn33F Polysaccharide to
Bromoacetylated CRM.sub.197
[1679] The CRM.sub.197 carrier protein was activated separately by
bromoacetylation, as described in Example 1, and then reacted with
the activated Pn-33F polysaccharide for the conjugation reaction.
Before starting the conjugation reaction, the reaction vessel was
pre-cooled to 5.degree. C. Bromoacetylated CRM.sub.197 and
thiolated 33F polysaccharide were mixed together in a reaction
vessel at an agitation speed of 150-200 rpm. The saccharide/protein
input ratio was 0.9.+-.0.1. The reaction pH was adjusted to
8.0-9.0. The conjugation reaction was allowed to proceed at
5.degree. C. for 20.+-.2 hours.
[1680] Capping of Reactive Groups on Bromoacetylated CRM.sub.197
and Thiolated Pn33F Polysaccharide
[1681] The unreacted bromoacetylated residues on CRM.sub.197
proteins were capped by reacting with 2 mol. eq. of
N-acetyl-L-cysteine for 3 hours at 5.degree. C., followed by
capping any residual free sulfhydryl groups of the thiolated
33F-polysaccharide with 4 mol. eq. of iodoacetamide (IAA) for 20
hours at 5.degree. C.
[1682] Purification of eTEC-Linked Pn-33F Glycoconjugate
[1683] The conjugation solution was filtered through a 0.45 .mu.m
or 5 .mu.m filter. Dialfiltration of the 33F glycoconjugate was
carried out with 300K MWCO ultrafilter membrane cassettes.
Diafiltration was performed against 5 mM succinate-0.9% saline, pH
6.0. The Pn-33F glycoconjugate 300K retentate was then filtered
through a 0.22 .mu.m filter and stored at 5.degree. C. A flow
diagram of the conjugation process is provided in FIG. 8(B).
[1684] Results
[1685] The reaction parameters and characterization data for
several batches of Pn-33F eTEC glycoconjugates are shown in Table
1. The CDT activation-thiolation with cystamine dihydrochloride
generated glycoconjugates having from 63% to 90% saccharide yields
and <1% to 13% free saccharides.
TABLE-US-00017 TABLE 1 Experimental Parameters and Characterization
Data of Pn33F eTEC Conjugates Conjugate Batch 33F-1A 33F-2B 33F-3C
33F-4D 33F-5E 33F-6F 33F-7G Activation level 0.21 0.13 0.164 0.103
0.183 0.22 0.19 (mol of thiol/mol of polysaccharide) Activation
level 21 13 16.4 10.3 18.3 22 19 (% Thiol) Saccharide/Protein 0.75
1.0 0.75 1.0 1.0 0.75 0.80 (Input) ratio Saccharide yield 69% 63%
71% 63% 69% 82% 90% (%) Saccharide/Protein 1.3 1.7 1.2 1.9 1.6 1.1
1.5 Ratio Free Saccharide 12.9% 7.7% 4.4% 7.2% 7.3% <4% <4%
MW by SEC-MALLS 2627 2561 4351 2981 3227 3719 5527 (kDa) CMCA/CMC
14.4/0 13.4/0 6.8/1.9 2.7/0.6 5.9/0.6 8.2/0 11.4/0.6 % K.sub.d
(.ltoreq.0.3) N/A 85% 88% 75% 68% 67% 76% Acetylation level 0.89
1.16 0.99 0.85 0.81 0.85 1.01 (mol of acetate/mol of
polysaccharide) N/A = not available
[1686] OPA Titers of Pn-33F eTEC glycoconjugates to CRM.sub.197
[1687] Pn-33F OPA titers in mice were determined under standard
conditions (similar to the OPA procedures described below for 10A
and 22F conjugates). OPA titers (GMT with 95% CI) at four and seven
weeks are shown in Table 2, demonstrating that the serotype 33F Pn
glycoconjugate elicited OPA titers in a murine immunogenicity
model.
TABLE-US-00018 TABLE 2 Pn-33F OPA Titers (GMT with 95% CI) 33F Pn
Conjugate 0.001 .mu.g 0.01 .mu.g 0.1 .mu.g week 4 4 (4, 5) 37 (17,
82) 414 (234, 734) week 7 8 (5, 13) 131 (54, 314) 17567 (9469,
32593)
Example 3. Preparation of Additional Pn-33F eTEC Conjugates
[1688] Additional Pn-33F eTEC Conjugates were generated using the
process described in Example 2. The reaction parameters and
characterization data for these additional batches of Pn-33F eTEC
glycoconjugates are shown in Table 3.
TABLE-US-00019 TABLE 3 Experimental Parameters and Characterization
Data of further Pn33F eTEC Conjugates Conjugate Batch 33F-8H 33F-9I
33F-10J 33F-11K 33F-12L 33F-13M 33F-14N 33F-15O 33F-16P Activation
level 0.22 0.11 0.11 0.13 0.14 0.13 0.06 0.13 0.11 (mol of
thiol/mol of polysaccharide) Saccharide/Protein 0.75 0.8 0.8 0.8
0.8 0.8 0.8 0.8 0.8 (Input) ratio Saccharide yield 78% 88% 89% 67%
69% 86% 81% 91% 88% (%) Saccharide/Protein 1.0 2.2 2.1 1.4 1.4 1.4
2.2 1.9 1.9 Ratio Free Saccharide <1% 6.8% 5.9% 2.3% 3.6% LOQ
8.2% 3.6% 6.6% MW by SEC- 4729 3293 3295 2246 2498 5539 3070 6009
3789 MALLS (kDa) CMCA/CMC 6.6/LOQ 14.2/2.1 15.4/2.1 5.5/1 5.4/1.1
NA/LOQ 1.7/1.2 4.1/2.2 2.2/1.2 % K.sub.d (.ltoreq.0.3) 69% N/A N/A
N/A N/A 88% 87% 87% 85% Acetylation level 0.86 0.93 0.87 1.01 0.99
0.71 0.78 0.8 0.82 (mol of acetate/mol of polysaccharide) LOQ =
limit of quantitation; N/A= not available.
[1689] As shown above and in Table 3, several Pn-33F conjugates
were obtained using the eTEC conjugation above. The eTEC chemistry
allowed preparation of conjugates with high yield, low % free
saccharide and high degree of conjugation (conjugated lysines).
Additionally, it was possible to preserve more than 80% of acetyl
functionality using the eTEC conjugation process.
Example 4. Evaluation of Pn-33F eTEC Glycoconjugates Stability: %
Free Saccharide Trends
[1690] Aliquots of conjugate batch 33F-2B (see table 1) were
dispensed into polypropylene tubes and stored at 4.degree. C.,
25.degree. C., and 37.degree. C., respectively and monitored for
trends in % free saccharide. The data (% free saccharide) are shown
in Table 4. As shown in this Table, there were no significant
changes in the % free saccharide.
TABLE-US-00020 TABLE 4 % Free Saccharide Stability for Pn-33F eTEC
Glycoconjugate at 4.degree. C., 25.degree. C. and 37.degree. C.
Free Saccharide (%) Time Lot# 0 1 wk 3 wks 1 M 2 M 3 M 6 M
4.degree. C. 33F-2B 7.7 N/A 8.3 N/A 9.7 11.2 13 25.degree. C. 7.7
N/A 10.8 N/A 11.8 N/A N/A 37.degree. C. 7.7 12.1 N/A 13.4 N/A N/A
N/A wk = week; M = month; N/A = not available.
[1691] The accelerated stability of another conjugate lot (Batch
33F-3C) was also conducted at 37.degree. C. up to 1 month. As shown
in Table 5, there was no significant change to % free saccharide at
37.degree. C., up to 1 month.
TABLE-US-00021 TABLE 5 % Free Saccharide Stability for Pn- 33F eTEC
Glycoconjugate at 37.degree. C. Free Saccharide (%) Time 0 1 day 1
wk 2 wks 1 M Lot# 37.degree. C. 33F-3C 4.4 5.9 6.4 7.1 7.2
[1692] To further confirm the stability of eTEC conjugates,
additional conjugate batches (33F-3C and 33F-5E (see Table 1))
stored at 4.degree. C. were monitored up to approximately one year,
for potential trends in % free saccharide. As shown in Table 6,
there were no significant changes in % free saccharide levels for
the conjugates stored at 4.degree. C. for an extended period up to
approximately one year.
TABLE-US-00022 TABLE 6 % Free Saccharide Stability Results for
Pn-33F eTEC Glycoconjugates at 4.degree. C. Free Saccharide (%)
Time 0 3 M 4 M 12 M 14 M Lot# 4.degree. C. 33F-3C 4.4 N/A 5.3 N/A
7.6 33F-5E 7.3 6.3 N/A 7.4 N/A M = month; N/A = not availabe
[1693] The Serotype 33F conjugates generated by 33F eTEC chemistry
were demonstrated to be stable without noticeable degradation as
monitored by the free saccharide trends at various temperatures
(real time and accelerated).
Example 5. Preparation of Pn-8 Conjugates to CRM.sub.197
[1694] Preparation of Pn-8 RAC/DMSO Glycoconjugates
[1695] Frozen polysaccharide was thawed and transferred to the
reaction vessel. 2 M acetic acid and WFI (Water for Injection) was
added to the polysaccharide solution to achieve a final
polysaccharide concentration of about 2.5 g/L and a final acetic
acid concentration of 0.2 M.
[1696] Hydrolysis of the Polysaccharide
[1697] The native polysaccharide was chemically hydrolyzed prior to
activation. The diluted polysaccharide solution was heated to
70.degree. C., and then held this temperature for 3.5 hours.
[1698] Oxidation of the Polysaccharide
[1699] Oxidation of polysaccharide was initiated by the addition of
sodium periodate solution and the reaction kept to proceed for 20
hrs at 23.degree. C.
[1700] Purification of Activated Polysaccharide
[1701] The activated polysaccharide was concentrated using
ultrafiltration cassettes. Diafiltration was performed against
20-fold diavolume of WFI.
[1702] Lyophilization
[1703] The activated polysaccharide is compounded with sucrose to a
ratio of 25 grams of sucrose per gram of activated polysaccharide.
The bottles containing the activated saccharide and sucrose are
shell frozen in ethanol baths and lyophilized.
[1704] Conjugation of Activated Polysaccharide to CRM.sub.197 and
Capping
[1705] Lyophilized activated polysaccharide was reconstituted to 2
mg/mL in DMSO. DMSO was added to lyophilized CRM.sub.197 for
reconstitution. Reconstituted CRM.sub.197 was added to the
reconstituted activated polysaccharide. Conjugation was then
initiated by adding sodium cyanoborohydride to the reaction mixture
and was incubated at 23.degree. C. for 24 hrs. Termination of
conjugation reaction is done by adding 2 MEq of sodium borohydride.
This capping reaction proceeded for 3 hrs at 23.degree. C.
[1706] Purification of Conjugate
[1707] The conjugate solution was then diluted into chilled 5 mM
succinate-0.9% saline (pH 6.0), filtered, concentrated to 2-4 g/L
using 300K cellulose membranes, and a first-stage diafiltration was
performed against 5 mM succinate-0.9% saline (pH6.0). A final
purification step was done by diafiltration with 5 mM
succinate-0.9% saline, pH 6.0 buffer. After the diafiltration is
completed, the purified conjugate was transferred to a collection
tank through a 0.22 .mu.m filter.
[1708] Dilution of the Monovalent Bulk Conjugate
[1709] The conjugate was diluted further with 5 mM succinate/0.9%
saline (pH 6), to a target saccharide concentration of 0.5 mg/mL.
Final 0.22 .mu.m filtration step was completed to prepare the
monovalent bulk conjugate (MBC) product for formulation.
[1710] Several conjugates were obtained using the above described
process by varying different parameters (e.g., saccharide-protein
input ratio, reaction concentration and Meq of sodium
cyanoborohydride). Characterization for representative Pn-8
glycoconjugates to CRM.sub.197 is provided in Table 7.
TABLE-US-00023 TABLE 7 Characterization of Pn8-CRM.sub.197
Conjugates Sample No. 1 2 3 4 5 6 7 8 9 Activated Saccharide 267
270 352 65 233 340 113 250 230 MW by MALLS (kDa) Saccaride/Protein
0.81 0.84 0.5 2.7 1.15 1.0 0.81 0.64 0.42 Ratio MW by SEC-MALLS
12200 8670 3460 3379 4748 4255 5470 9924 6787 (kDa)
[1711] The Opsonophagocytic activity (OPA) titers for Serotype
8-CRM.sub.197 conjugates in mice were determined in mice under
standard conditions (similar to the OPA procedures described below
for 10A and 22F conjugates). OPA titers (geometric mean titer (GMT)
with 95% confidence interval (CI)) at four weeks at different doses
are shown in Table 8 and 9 (two separate experiments),
demonstrating that the serotype 8 conjugate (Samples 1-9; also see
Table 7 for characterization data of these conjugates) elicited OPA
titers in a murine immunogenicity model.
[1712] As shown in Table 8, serotype 8 conjugates were shown to
have significantly higher antibody titers, compared to the control
unconjugated polysaccharide which had poor antibody titers.
TABLE-US-00024 TABLE 8 Immunogenicity of Serotype 8-CRM.sub.197
Conjugates Sample OPA GMT (95% CI) No. 0.001 .mu.g 0.01 .mu.g 0.1
.mu.g 1 17 (10, 30) 88 (47, 165) 1344 (896, 2016) 2 7 (4, 11) 184
(87, 387) 1934 (1313, 2847) 3 4 (4, 4) 17 (9, 30) 779 (345, 1757) 4
5 (4, 7) 74 (41, 136) 558 (311, 1001) Uncon- 13 (3, 55) jugated
PS
TABLE-US-00025 TABLE 9 Immunogenicity of Serotype 8-CRM.sub.197
Conjugates Sample OPA GMT (95% CI) No. 0.001 .mu.g 0.01 .mu.g 5 8
(5, 12) 322 (208, 498) 6 12 (8, 19) 264 (129, 537) 7 12 (7, 21) 521
(366, 743) 8 19 (10, 38) 404 (238, 687) 9 33 (14, 80) 686 (380,
1237) 2 13 (7, 23) 177 (94, 336)
[1713] The overall data generated from conjugates prepared by the
above reductive amination process demonstrated that it allowed
preparing conjugates with good conjugation yield, low % free
saccharide and with good stability. Additionally, the prepared
conjugates elicited good OPA titers in a murine immunogenicity
model.
Example 6. Preparation of Serotype 10A Polysaccharide--CRM.sub.197
Conjugate
[1714] Preparation of isolated S. pneumoniae serotype 10A
polysaccharide Serotype 10A capsular polysaccharides can be
obtained directly from bacteria using isolation procedures known to
one of ordinary skill in the art (see for example methods disclosed
in U.S. Patent App. Pub. Nos. 2006/0228380, 2006/0228381,
2007/0184071, 2007/0184072, 2007/0231340, and 2008/0102498 and WO
2008/118752). Streptococcus pneumoniae serotype 10A were grown in a
seed bottle and then transferred to a seed fermentor. Once the
targeted optical density was reached, the cells were transferred to
a production fermentor. The fermentation broth was inactivated by
the addition of N-lauroyl sarcosine and purified by ultrafiltration
and diafiltration.
[1715] Oxidation of Isolated Streptococcus pneumoniae Serotype 10A
Capsular Polysaccharide
[1716] A calculated volume of 0.1 M potassium phosphate buffer (pH
6.0) and water-for-injection (WFI) was added to the polysaccharide
solution to achieve a final polysaccharide concentration of 2.5 g/L
and a final concentration of 25 mM potassium phosphate buffer, if
required pH was adjusted to 6.0, approximately. The diluted
polysaccharide was then cooled to 5.degree. C. Oxidation was
initiated by the addition of 0.25 molar equivalents (MEq) of sodium
periodate solution. The oxidation reaction time was approximately 4
hrs at 5.degree. C. The oxidation reaction was quenched with 1 MEq
of 2,3-butanediol under continuous stirring at 5.degree. C. for 1-2
hrs.
[1717] After reaching the target reaction time, the activated
polysaccharide was concentrated using 30K MWCO Millipore
ultrafiltration cassettes. The diafiltration was then performed
against 20-fold diavolume of WFI. The purified activated
polysaccharide was stored at 5.degree. C. The purified activated
saccharide is characterized inter alia by (i) Molecular Weight by
SEC-MALLS and (ii) Degree of Oxidation.
[1718] Conjugation of activated S. pneumoniae serotype 10A
polysaccharide with CRM.sub.197
[1719] The conjugation process consisted of the following
steps:
[1720] a. Compounding with sucrose excipient, and
lyophilization;
[1721] b. Reconstitution of the lyophilized polysaccharide and
CRM.sub.197,
[1722] c. Conjugation of activated polysaccharide to CRM.sub.197
and capping; and
[1723] d. Purification of the conjugate
[1724] a. Compounding with Sucrose
[1725] The activated polysaccharide is compounded with sucrose to a
ratio of 25 g of sucrose per gram of activated polysaccharide. The
bottle of compounded mixture was then lyophilized. Following
lyophilization, bottles containing lyophilized activated
polysaccharide were stored at -20.degree. C.
[1726] b. Reconstitution of Lyophilized Activated Polysaccharide
and CRM.sub.197 Protein
[1727] Lyophilized activated polysaccharide was reconstituted in
anhydrous dimethyl sulfoxide (DMSO). Upon complete dissolution of
polysaccharide, the same amount of DMSO was added to the calculated
CRM.sub.197 for reconstitution.
[1728] c. Conjugation of Activated Polysaccharide to CRM.sub.197
and Capping
[1729] Reconstituted CRM.sub.197 (in DMSO) was added to the
reconstituted activated polysaccharide in the conjugation reactor.
The final polysaccharide concentration is 1 g/L. Conjugation was
performed by adding 1.2 MEq of sodium cyanoborohydride to the
reaction mixture. The reaction was incubated and at 23.degree. C.
for 24 hrs. Termination of conjugation reaction is done by adding 2
MEq of sodium borohydride. The capping reaction was incubated at
23.degree. C. for 3 hrs.
[1730] Termination of conjugation reaction is done by adding 2 MEq
of sodium borohydride. This capping reaction proceeded for 3 hrs at
23.degree. C.
[1731] d. Purification of Conjugate
[1732] The conjugate solution was then diluted into 5.times. (by
volume) chilled 5 mM succinate-0.9% saline (pH 6.0) and a 20.times.
diafiltration was performed using 5 mM succinate-0.9% saline
(pH6.0). After the initial diafiltration was completed, the
conjugate retentate was transferred through a 0.22 .mu.m filter.
The conjugate was diluted further with 5 mM succinate/0.9% saline
(pH 6), and after the final 0.22 .mu.m filtration step it was
stored at 2-8.degree. C.
[1733] Several conjugates were obtained using the above described
process by varying different parameters (e.g., saccharide-protein
input ratio, reaction concentration and MEq of sodium
cyanoborohydride). The above chemistry allowed to generate serotype
10A conjugates which were demonstrated to be stable without
noticeable degradation as monitored by the free saccharide trends
at various temperatures (real time and accelerated).
Characterization for representative Pn-10A glycoconjugates to
CRM.sub.197 is provided in Table 10.
TABLE-US-00026 TABLE 10 Characterization of Pn-10A-CRM.sub.197
Conjugates Conjugate No. 1 2 3 4 5 6 DO 12.2 19.5 5.2 10.3 10.8
10.5 Activated 191 240 80 170 170 170 Saccharide MW, kDa Input
Ratio 1.0 1.0 1.0 1.1 1.1 1.1 % Yield 56 28.5 65 82 73 66 % Free
6.8 10.0 6.7 6.8 6.4 9.7 Saccharide Conjugate 3838 5810 4630 4034
3463 5540 MW, kDa Saccaride/ 0.82 0.88 0.85 1.1 1.2 1.0 Protein
Ratio Lys 7.4 3.7 13.1 6.9 6.7 6.1 modification AAA
[1734] The opsonophagocytic activity (OPA) titers for Serotype
10A-CRM.sub.197 conjugates in mice were determined under standard
conditions. Groups of thirty 6-7 week old female Swiss Webster mice
were immunized with 0.001 .mu.g, 0.01 .mu.g, or 0.1 .mu.g of test
conjugates via the subcutaneous route on week 0. The mice were
boosted with the same dose of conjugate on week 3 and then bled at
week 4. Serotype-specific OPAs were performed on week 4 sera
samples.
[1735] Opsonophagocytic activity (OPA) assays are used to measure
functional antibodies in murine sera specific for S. pneumonia
serotype 10A. Test serum is set up in assay reactions that measure
the ability of capsular polysaccharide specific immunoglobulin to
opsonize bacteria, trigger complement deposition, thereby
facilitating phagocytosis and killing of bacteria by phagocytes.
The OPA titer is defined as the reciprocal dilution that results in
a 50% reduction in bacterial count over control wells without test
serum. The OPA titer is interpolated from the two dilutions that
encompass this 50% killing cut-off. OPA procedures were based on
methods described in Hu et al. (2005) Clin Diagn Lab Immunol12
(2):287-295 with the following modifications. Test serum was
serially diluted 2.5-fold and added to microtiter assay plates.
Live serotype 10A target bacterial strains were added to the wells
and the plates were shaken at 37.degree. C. for 30 minutes.
[1736] Differentiated HL-60 cells (phagocytes) and baby rabbit
serum (3- to 4-week old, PEL-FREEZ.RTM., 12.5% final concentration)
were added to the wells, and the plates were shaken at 37.degree.
C. for 60 minutes. To terminate the reaction, 80 .mu.L of 0.9% NaCl
was added to all wells, mixed, and a 10 .mu.L aliquot were
transferred to the wells of MULTISCREEN.RTM. HTS HV filter plates
(MILLIPORE.RTM.) containing 200 .mu.L of water. Liquid was filtered
through the plates under vacuum, and 150 .mu.L of HYSOY.RTM. medium
was added to each well and filtered through. The filter plates were
then incubated at 37.degree. C., 5% CO.sub.2 overnight and were
then fixed with Destain Solution (Bio-Rad Laboratories, Inc.,
Hercules, Calif.). The plates were then stained with Coomassie Blue
and destained once. Colonies were imaged and enumerated on a
Cellular Technology Limited (CTL) (Shaker Heights, Ohio)
IMMUNOSPOT.RTM. Analyzer. Raw colony counts were used to plot kill
curves and calculate OPA titers.
[1737] OPA titers (geometric mean titer (GMT) with 95% confidence
interval (CI)) at four weeks at different doses are shown in Table
11, demonstrating that the serotype 10A conjugate (Samples 1-3;
also see Table 10 for characterization data of these conjugates)
elicited OPA titers in a murine immunogenicity model. As shown in
Table 11, serotype 10A conjugates were shown to have significantly
higher OPA titers, compared to the control unconjugated
polysaccharide, which had a poor OPA response.
TABLE-US-00027 TABLE 11 Immunogenicity of Serotype 10A-CRM.sub.197
Conjugates Sample OPA GMT (95% CI) No. 0.001 .mu.g 0.01 .mu.g 0.1
.mu.g 1 858 (556, 1324) 1015 (610, 1691) 4461 (3065, 6494) 2 1411
(737, 2703) 796 (460, 1378) 2873 (1768, 4842) 3 322 (180, 574) 1062
(528, 2135) 2618 (1415, 4842) Uncon- 602 (193, 1882) jugated PS
Example 7. Conjugation of Pn Serotype-12F Using TEMPO/NCS
[1738] In order to improve the stability of serotype
12F-CRM.sub.197 glycoconjugates, alternate chemistries were
explored using 2,2,6,6-Tetramethyl-1-piperidinyloxy free radical
(TEMPO) and N-Chlorosuccinimide (NCS) as the cooxidant to oxidize
primary alcohols to aldehyde groups. GC/MS analysis showed that the
sites of oxidation were different from that of periodate-mediated
oxidation. In the case of TEMPO-NCS oxidation, the .alpha.-D-Glcp
and 2-Glcp were oxidized, whereas .alpha.-D-Galp was the major site
of oxidation when periodate was used (see FIG. 4). As described in
further detail herein, TEMPO was used in catalytic amounts 0.1
molar equivalents) and the desired degree of oxidation (DO) was
achieved by varying the amounts of NCS used. Subsequently several
conjugates were synthesized and characterized. In general, the
production of Serotype 12F glycoconjugates was carried out in
several phases, as follows:
[1739] a) Hydrolysis of Serotype 12F polysaccharide to molecular
weights 50 kDa to 500 kDa
[1740] b) Activation of Serotype 12F polysaccharide with
TEMPO/NCS,
[1741] c) Purification of the activated polysaccharide;
[1742] d) Conjugation of activated Serotype 12F to CRM.sub.197
protein; and
[1743] e) Purification of Serotype 12F--CRM.sub.197 conjugates.
[1744] Hydrolysis and Oxidation of Serotype 12F
[1745] The hydrolysis of the polysaccharide was typically performed
under acidic conditions with heating to obtain an average molecular
weight in the desired range of 100 kDa to 350 kDa. A typical
experiment is described below.
[1746] Hydrolysis
[1747] The Serotype 12F polysaccharide solution was added to a
jacketed reaction vessel. To this, the required volume of 0.30 M
Acetic acid and water for injection (WFI) were added to maintain
.about.0.1 M acetic acid concentration. The pH of the solution was
adjusted to 3.2.+-.0.3 using 1 N NaOH or Glacial Acetic acid. The
temperature of the reaction mixture was increased to
70.+-.5.degree. C. The reaction mixture was stirred at
70.+-.5.degree. C. for 90-120 minutes. The reaction mixture was
cooled down to 23.+-.2.degree. C. and neutralized (pH 7.0) by
adding 1 M NaOH solution. The hydrolyzed polysaccharide was
purified by ultrafiltration/diafiltration against WFI using 30K
MWCO membranes. The solution was filtered through a 0.22 .mu.m
filter and stored at 2 to 8.degree. C. until oxidation. The
molecular weight of the hydrolyzed polysaccharide was analyzed by
SEC-MALLS to ensure that the molecular weight met the target range
of 100 kDa to 350 kDa.
[1748] Partial Oxidation
[1749] In one experiment, the serotype 12F polysaccharide was
mechanically sized using pressure homogenization using a
microfluidiser to reduce the molecular weight to approximately 100
kDa to 500 kDa. The sized polysaccharide was added to a reaction
vessel at a concentration of 4.0 mg/mL and mixed with
bicarbonate/carbonate buffer (0.5 M NaHCO.sub.3/0.05 M
Na.sub.2CO.sub.3 buffer, pH 8.6) at a ratio of 1:1 v/v. To the
stirred mixture was added 0.1 mol equivalent of TEMPO. The reaction
was started by the addition of 0.6 to 1.0 mol equivalent of NCS.
The reaction mixture was stirred at room temperature for 2 hours,
after which the activated polysaccharide was purified by
diafiltration, with WFI using a 30K ultrafiltration membrane. The
purified polysaccharide was collected and the degree of oxidation
(DO) was determined by quantitative measurements of aldehyde (using
a 3-methyl-2-benothiazolinone hydrazone (MBTH) assay) and
polysaccharide (using an anthrone assay).
[1750] In another experiment, the serotype 12F polysaccharide was
hydrolyzed to reduce the molecular weight to a molecular weight of
approximately 100 kDa to 500 kDa. The serotype 12F polysaccharide
was added to a reaction vessel and mixed with 0.5 M
NaHCO.sub.3/0.05 M Na.sub.2CO.sub.3 buffer (pH 8.6) at a ratio of
1:1 v/v. To the stirred mixture was added 0.6 to 1.0 molar
equivalents of NCS dissolved in WFI. The activation was initiated
by the addition of approximately 0.1 molar equivalents of TEMPO
dissolved in WFI. The reaction mixture was stirred at room
temperature for 2 hours, after which the activated polysaccharide
was purified by diafiltration with WFI using a 30K ultrafiltration
membrane. The purified activated polysaccharide was filtered
through a 0.2 .mu.m filter and stored at 4.degree. C. before
use.
[1751] The TEMPO/NCS mediated oxidations were also performed
successfully in sodium phosphate buffers of pH 6.5, 7.0, 7.5 and
8.0. In some activation experiments a primary alcohol such as
n-propanol was used to quench the reagents in order to avoid
saccharide overoxidation. In another set of experiments the
chemically hydrolysed polysaccharide was subjected to oxidation
directly, without the ultrafiltration/diafiltration purification
step.
[1752] Conjugation of Serotype 12F Oxidized Polysaccharide
[1753] In one experiment, the purified oxidized Serotype 12F
polysaccharide was added to a reaction vessel followed by the
addition of 0.5 M Sodium phosphate buffer (pH 6.5) to a final
buffer concentration of 0.1 M. To this solution, previously
lyophilized CRM.sub.197 was added and mixed thoroughly in order to
obtain a homogenous solution. The pH was adjusted to 6.8 using
diluted HCl or 1 N NaOH solution. This was followed by the addition
of 1.5 molar equivalents of NaCNBH.sub.3. The reaction mixture was
stirred for 24 hours at room temperature (23.degree. C.) and for
2.5 days at 37.degree. C. The reaction mixture was then diluted
with 1.times.0.9% saline and the unreacted aldehyde groups were
"capped" with 2 molar equivalents of sodium borohydride. The
capping reaction time was 3 hours.
[1754] In another experiment, the purified activated serotype 12F
was added to a reaction vessel followed by the addition of 0.5 M
sodium phosphate buffer (pH 6.5) to a final buffer concentration of
0.1 M. To this solution, previously lyophilized CRM.sub.197 was
added and mixed thoroughly to obtain a homogenous solution. The pH
was adjusted to 6.8 using diluted HCl or 1 N NaOH solution. This
was followed by the addition of 3 molar equivalents of
NaCNBH.sub.3. The reaction mixture was stirred for 24 hours at
23.degree. C. and for 48 hrs at 37.degree. C. The reaction mixture
was then diluted with 1.times.0.9% saline and with stirring, the
unreacted aldehyde groups were "capped" with 1 molar equivalent
sodium borohydride NaBH.sub.4. The capping reaction time was 3
hours.
[1755] In another experiment, the purified activated serotype 12F
was added to a reaction vessel and mixed with CRM.sub.197 solution.
The mixture was lyophilized and the powder was dissolved in 0.1 M
sodium phosphate buffer (pH 6.8) to a final saccharide
concentration of 5 mg/mL. If needed the pH was adjusted to 6.8
using diluted HCl or 1N NaOH solution. This was followed by the
addition of 3 molar equivalents NaCNBH.sub.3. The reaction mixture
was stirred for 24 hours at 23.degree. C. and for 48 hrs at
37.degree. C. The reaction mixture was then diluted with
1.times.0.9% saline, the unreacted aldehyde groups were "capped"
with 1 molar equivalent sodium borohydride NaBH4. The capping
reaction time was 3 hours.
[1756] Conjugate Purification
[1757] The capped reaction mixture was filtered using a 5 .mu.m
filter and then purified using 100K MWCO ultra filtration
membranes. The conjugate was first diafiltered using 10 mM
succinate/0.9% saline, pH 6.0 buffer. The purified conjugate was
then filtered through 0.45/0.22 .mu.m filters to obtain the bulk
conjugate.
[1758] Degree of Oxidation
[1759] Successful oxidation of primary alcohols in the serotype 12F
polysaccharide was achieved using the TEMPO/NCS system. The
hydrolyzed Serotype 12F polysaccharides were oxidized to varying
degrees of oxidation (DO) levels by adjusting the amount of NCS
cooxidant. The effect on DO by varying amounts of NCS using
different polysaccharide batches and molecular weights is shown in
FIG. 9. Typically the oxidation reaction is complete in 2 hours as
no significant change in DO was observed after 2 hours.
[1760] Several serotytpe 12F conjugates were generated and
characterized using the TEMPO/NCS oxidized polysaccharide. The
results are summarized in Table 12.
TABLE-US-00028 TABLE 12 Pneumococcal Serotype 12F-CRM.sub.197
conjugates Conjugate Batch 12F-84A 12F-97B 12F-147C 12F-171D
12F-177-6E 12F-181F Oxidation Time (hr) 2 2 4 2 2 2 Degree of
Oxidation 12.0 6.0 9.6 12.0 11.5 11.5 (DO) % Activated 80 71 70 89
86 86 Saccharide Yield Activated 137 155 170 190 240 240 Saccharide
MW by MALLS (kDa) Conjugation process Lyo-CRM Lyo-CRM Lyo-CRM
Lyo-CRM Lyo-CRM Co-Lyo Conjugate Results Saccharide yield (%) 51.6
76.8 53.6 76.3 65.8 40.7 Saccharide/Protein 1.2 0.9 1.0 1.1 1.4 0.9
Ratio % Free Saccharide 24 10 17 20 23 14 MW by SEC-MALLS 2050 3000
3600 1500 2400 2100 (kDa)
Example 8. Immunogenicity of Pn-Serotype 12F-CRM.sub.197 Conjugates
Using the TEMPO/NCS Oxidation Method
[1761] The opsonophagocytic activity (OPA) titers for serotype
12F-CRM.sub.197 conjugates in mice were determined in mice under
standard conditions. OPA titers (geometric mean titer (GMT) with
95% confidence interval (CI)) at four and seven weeks are shown in
Table 13, demonstrating that the serotype 12F-CRM.sub.197 conjugate
(Batch 12F-97B; also see Table 12 for characterization data of this
conjugate) elicited OPA titers in a murine immunogenicity model.
The conjugate generated by the TEMPO-NCS was more immunogenic than
the control conjugate (171B) generated from the periodate
oxidation.
TABLE-US-00029 TABLE 13 Immunogenicity of Serotype 12F-CRM.sub.197
Conjugates Dose Conjugate Sample 0.001 .mu.g 0.01 .mu.g 0.1 .mu.g
Periodate Oxidation 4 16 172 (171B) Control TEMPO/NCS Oxidation 40
417 880 (12F-97B)
Example 9. Evaluation of Pn-12F Glycoconjugates Stability
[1762] Comparison of the stability (at 25.degree. C.) of the
conjugates generated by periodate oxidation vs. TEMPO/NCS oxidation
(see FIG. 10) demonstrated that the conjugate generated by the
oxidation of the Pn-12F polysaccharides were relatively more
stable. As shown in FIG. 10, an increase in the free saccharide
over time was observed for the glycoconjugate generated by the
periodate oxidation of the Pn-12F polysaccharide at 25.degree. C.
In contrast, the glycoconjugate prepared using the TEMPO/NCS
oxidation of the Pn-12F polysaccharide showed no significant trends
for the free saccharide under similar conditions.
Example 10. Preparation of Serotype 15B Polysaccharide--CRM.sub.197
Conjugate
[1763] Preparation of isolated Streptococcus pneumoniae serotype
15B polysaccharide Serotype 15B capsular polysaccharides can be
obtained directly from bacteria using isolation procedures known to
one of ordinary skill in the art. The S. pneumoniae serotype 15B
were grown in a seed bottle and then transferred to a seed
fermentor. Once the targeted optical density was reached, the cells
were transferred to a production fermentor. The fermentation was
broth was inactivated by the addition of N-lauroyl sarcosine and
purified by ultrafiltration and diafiltration.
[1764] The purified S. pneumoniae serotype 15B polysaccharide was
then sized by high pressure homogenization using a PANDA 2K.RTM.
homogenizer (GEA Niro Soavi, Parma, Italy) to produce the isolated
S. pneumoniae serotype 15B polysaccharide.
[1765] Preferably, the isolated S. pneumoniae serotype 15B capsular
polysaccharide obtained by the above process comprises at least 0.6
mM acetate per mM of serotype 15B capsular polysaccharide and has a
molecular weight between 50 kDa and 500 kDa, preferably 150 kDa to
350 kDa.
[1766] Oxidation of Isolated Streptococcus pneumoniae Serotype 15B
Capsular Polysaccharide
[1767] Polysaccharide oxidation was carried out in 100 mM potassium
phosphate buffer (pH 6.0) by sequential addition of calculated
amount of 500 mM potassium phosphate buffer (pH 6.0) and WFI to
give final polysaccharide concentration of 2.0 g/L. If required,
the reaction pH was adjusted to pH 6.0, approximately. After pH
adjustment, the reaction temperature was adjusted to 23.degree. C.
Oxidation was initiated by the addition of approximately 0.25 molar
equivalents of sodium periodate. The oxidation reaction was
performed at 23.degree. C. during 16 hrs, approximately.
[1768] Concentration and diafiltration of the activated
polysaccharide was carried out using 10K MWCO ultrafiltration
cassettes. Diafiltration was performed against 20-fold diavolumes
of WFI. The purified activated polysaccharide was then stored at
5.degree. C. The purified activated saccharide was characterized
inter alia by (i) saccharide concentration by colorimetric assay;
(ii) aldehyde concentration by colorimetric assay; (iii) Degree of
Oxidation (iv) Molecular Weight by SEC-MALLS and (v) presence of
O-acetyl and glycerol.
[1769] SEC-MALLS is used for the determination of the molecular
weight of polysaccharides and polysaccharide-protein conjugates.
SEC is used to separate the polysaccharides by hydrodynamic volume.
Refractive index (RI) and multi-angle laser light scattering
(MALLS) detectors are used for the determination of the molecular
weight. When light interacts with matter, it scatters and the
amount of scattered light is related to the concentration, the
square of the do/dc (the specific refractive index increments), and
the molar mass of the matter. The molecular weight measurement is
calculated based on the readings from the scattered light signal
from the MALLS detector and the concentration signal from the RI
detector.
[1770] The degree of oxidation (DO=moles of sugar repeat unit/moles
of aldehyde) of the activated polysaccharide was determined as
follows:
[1771] The moles of sugar repeat unit is determined by various
colorimetric methods, example by using Anthrone method. The
polysaccharide is first broken down to monosaccharides by the
action of sulfuric acid and heat. The Anthrone reagent reacts with
the hexoses to form a yellow green colored complex whose absorbance
is read spectrophotometrically at 625 nm. Within the range of the
assay, the absorbance is directly proportional to the amount of
hexose present.
[1772] The moles of aldehyde also are determined simultaneously,
using MBTH colorimetric method. The MBTH assay involves the
formation of an azine compound by reacting aldehyde groups (from a
given sample) with a 3-methyl-2-benzothiazolone hydrazone (MBTH
assay reagent). The excess 3-methyl-2-benzothiazolone hydrazone
oxidizes to form a reactive cation. The reactive cation and the
azine react to form a blue chromophore. The formed chromophore is
then read spectroscopically at 650 nm.
[1773] Preferably, the activated S. pneumoniae serotype 15B
capsular polysaccharide obtained by the above process comprises at
least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide
and has a molecular weight between 50 kDa and 500 kDa, preferably
150 kDa to 350 kDa.
[1774] Conjugation of Activated S. pneumoniae Serotype 15B Capsular
Polysaccharide with CRM.sub.197
[1775] The conjugation process consisted in the following
steps:
[1776] a) Compounding with sucrose excipient and
lyophilization;
[1777] b) Reconstitution of the lyophilized activated
polysaccharide and CRM.sub.197;
[1778] c) Conjugation of activated polysaccharide to CRM.sub.197
and capping; and
[1779] d) Purification of the conjugate
[1780] a) Compounding with Sucrose Excipient, and
Lyophilization
[1781] The activated polysaccharide was compounded with sucrose to
a ratio of 25 grams of sucrose per gram of activated
polysaccharide. The bottle of compounded mixture was then
lyophilized. Following lyophilization, bottles containing
lyophilized activated polysaccharide were stored at -20.degree. C.
Calculated amount of CRM.sub.197 protein was shell-frozen and
lyophilized separately. Lyophilized CRM.sub.197 was stored at
-20.degree. C.
[1782] b) Reconstitution of Lyophilized Activated Polysaccharide
and CRM.sub.197 Protein
[1783] Lyophilized activated polysaccharide was reconstituted in
anhydrous dimethyl sulfoxide (DMSO). Upon complete dissolution of
polysaccharide, an equal amount of anhydrous DMSO was added to
lyophilized CRM.sub.197 for reconstitution.
[1784] c) Conjugation and Capping
[1785] Reconstituted activated polysaccharide was combined with
reconstituted CRM.sub.197 in the reaction vessel (input ratio:
0.8:1), followed by mixing thoroughly to obtain a clear solution
before initiating the conjugation with sodium cyanoborohydride. The
final polysaccharide concentration in reaction solution is
approximately 1 g/L. Conjugation was initiated by adding 1.0-1.5
MEq of sodium cyanoborohydride to the reaction mixture and was
incubated at 23.degree. C. for 40-48 hrs. Conjugation reaction was
terminated by adding 2 MEq of sodium borohydride (NaBH.sub.4) to
cap unreacted aldehydes. This capping reaction continued at
23.degree. C. for 3 hrs
[1786] d) Purification of the Conjugate
[1787] The conjugate solution was diluted 1:10 with chilled 5 mM
succinate-0.9% saline (pH 6.0) in preparation for purification by
tangential flow filtration using 100-300K MWCO membranes. The
diluted conjugate solution was passed through a 5 .mu.m filter and
diafiltration was performed using 5 mM succinate-0.9% saline (pH
6.0) as the medium. After the diafiltration was completed, the
conjugate retentate was transferred through a 0.22 .mu.m
filter.
[1788] The conjugate was diluted further with 5 mM succinate/0.9%
saline (pH 6), to a target saccharide concentration of
approximately 0.5 mg/mL. Final 0.22 .mu.m filtration step was
completed to obtain the glycoconjugate.
[1789] Preferably, the conjugate obtained by the above process
comprises at least 0.6 mM acetate per mM of serotype 15B capsular
polysaccharide, has a molecular weight between 3,000 kDa and 20,000
kDa and has a degree of conjugation between 2 and 6.
Example 11. Characterization of Glycoconjugate Comprising S.
pneumoniae Serotype 15B Capsular Polysaccharide Covalently Linked
to a CRM.sub.197
[1790] Conjugate 1 was prepared by the process of Example 10.
Conjugates 2 and 3 were prepared by a similar process using
different amount of oxidizing agent. Conjugate 4 was prepared by a
similar process except that the purified serotype 15B capsular
polysaccharide was not sized and was activated to a lower DO
(higher oxidation level) and the conjugation was performed in
aqueous medium. Conjugate 5 was prepared by a similar process
except that the purified serotype 15B capsular polysaccharide was
sized by chemical hydrolysis and the conjugation was performed in
aqueous medium. Conjugates 6 and 7 were prepared by a similar
process except that the purified serotype 15B capsular
polysaccharide was not sized.
[1791] The obtained conjugates were characterized and the results
are summarized in Table 14.
TABLE-US-00030 TABLE 14 Streptococcus pneumoniae serotype 15B
capsular polysaccharide-CRM.sub.197 conjugates Conjugate 1 2 3 4 5
6 7 Polysaccharide Sized Sized Sized Native Hydrolyzed Native
Native O-Acetyl; activated 0.69 0.69 0.69 1.01 0.66 0.76 N/A
Polysaccharide (.mu.mol acetate/.mu.mol poly) Solvent medium DMSO
DMSO DMSO Aqueous Aqueous DMSO DMSO Activated 11.4 5.8 9.7 4.8 8.8
5 12 Polysaccharide DO Activated 196 KDa 218 KDa 235 KDa 435 KDa
270 KDa 431 KDa 460 KDa Polysaccharide MW Yield (%) 87.2 64 63.7
96.2 78.8 24.2 26.2 Saccharide Protein 0.68 0.65 0.71 1.22 1.29 0.9
1.5 Ratio Free Saccharide (%) <5 <5 6.1 18.1 14.2 8.8 18
Conjugate MW, SEC- 6190 7090 7937 1766 1029 6293 4466 MALLS (kDa)
O-Acetylation, 0.68 0.7 0.68 0.61 0.44 0.85 N/A Conjugate (.mu.mol
acetate/.mu.mol poly) <0.3 K.sub.d (%), SEC N/A 73 N/A N/A 62
N/A N/A Degree of Conj 3.7 3.9 4.1 N/A 3.4 N/A N/A (AAA); Modified
Lys % O-Acetyl Retained 99% 100% 99.5% 60% 67% 100% N/A in
Conjugate N/A = not available
[1792] The percentage of free polysaccharide is measured by a
procedure utilizing aluminum hydroxide gel to bind protein and
covalently bound saccharide for removal by centrifugation. Samples
are mixed with phosphate buffered aluminum hydroxide gel and
centrifuged. Bound saccharide is pelleted with the gel and free
saccharide remains in the supernatant. The resulting supernatant
and controls samples are quantitated by appropriate colorimetric
assays to determine the percentage of free saccharide and to
confirm sufficient removal of protein and recovery of
saccharide.
[1793] For the amino acid analysis the polysaccharide-protein
sample is first hydrolyzed into its individual components as free
amino acids, using 6 N hydrochloric acid (HCl) hydrolysis under
vacuum and heat (160.degree. C. for 15 minutes). After hydrolysis,
the samples are analyzed using Amino Acid Analyzer. The individual
amino acids are separated through ion exchange chromatography using
a step gradient of sodium citrate buffer with temperature and flow
rate changes. After separation, the amount of each amino acid
residual is quantitatively determined using a postcolumn ninhydrin
coupling detection system. In this system, the ninhydrin is mixed
with the column eluate in the postcolumn reactor system and the
mixture passed into the photometer. The reaction of ninhydrin with
eluated amino acids yields a purple compound that absorbs maximally
at 570 nm. This absorbance is a linear response (function) of the
amount of .alpha.-amino groups present and this reaction provides
quantitative colorimetric assay for all organic compounds with
.alpha.-amino groups. In the reaction with imino acids such as
proline and hydroxylproline, which do not have free amino group, a
bright yellow compound is generated and monitored at 440 nm. The
peak areas for each amino acid are calculated using both 570 nm and
440 nm wavelength outputs.
[1794] The yield is calculated as follows: (amount of
polysaccharide in the conjugate.times.100)/amount of activated
polysaccharide.
[1795] Conjugates (4 and 5) generated using an aqueous medium
demonstrated significant loss in O-acetyl levels. Conjugates
generated in DMSO solvent, using native polysaccharide without MW
sizing (6 and 7) did not demonstrate loss in O-acetyl levels.
However, the conjugate yields were very poor in addition to poor
filterability characteristics. Conjugates generated in DMSO using
polysaccharides that were sized by high pressure homogenization (1,
2 and 3) had high yield and better filterability characteristics
with significant preservation of O-acetyl levels. These conjugates
also had very low levels of free polysaccharides.
Example 12. Opsonophagocytic Activity (OPA) Assay Using Pn-Serotype
15B-CRM.sub.197 Conjugates
[1796] The immunogenicity of the S. pneumoniae serotype 15B
conjugates of the invention can be assessed using the OPA assay
described below.
[1797] Groups of 30 6-7 week old female Swiss Webster mice were
immunized with 0.001 .mu.g, 0.01 .mu.g, or 0.1 .mu.g of test
conjugates via the subcutaneous route on week 0. The mice were
boosted with the same dose of conjugate on week 3 and then bled at
week 4. Serotype-specific OPAs were performed on week 4 sera
samples.
[1798] OPAs are used to measure functional antibodies in murine
sera specific for S. pneumoniae serotype 15B. Test serum is set up
in assay reactions that measure the ability of capsular
polysaccharide specific immunoglobulin to opsonize bacteria,
trigger complement deposition, thereby facilitating phagocytosis
and killing of bacteria by phagocytes. The OPA titer is defined as
the reciprocal dilution that results in a 50% reduction in
bacterial count over control wells without test serum. The OPA
titer is interpolated from the two dilutions that encompass this
50% killing cut-off.
[1799] OPA procedures were based on methods described in Hu et al.
(2005) Clin Diagn Lab Immunol12 (2):287-295 with the following
modifications. Test serum was serially diluted 2.5-fold and added
to microtiter assay plates. Live serotype 15B target bacteria were
added to the wells and the plates were shaken at 37.degree. C. for
30 minutes. Differentiated HL-60 cells (phagocytes) and baby rabbit
serum (3- to 4-week old, PEL-FREEZ.RTM., 6.25% final concentration)
were added to the wells, and the plates were shaken at 37.degree.
C. for 45 minutes. To terminate the reaction, 80 .mu.L of 0.9% NaCl
was added to all wells, mixed, and a 10 .mu.L aliquot were
transferred to the wells of MULTISCREEN.RTM. HTS HV filter plates
(MILLIPORE.RTM.) containing 200 .mu.L of water. Liquid was filtered
through the plates under vacuum, and 150 .mu.L of HYSOY.RTM. medium
was added to each well and filtered through. The filter plates were
then incubated at 37.degree. C., 5% CO.sub.2 overnight and were
then fixed with Destain Solution (Bio-Rad Laboratories, Inc.,
Hercules, Calif.). The plates were then stained with Coomassie Blue
and destained once. Colonies were imaged and enumerated on a
Cellular Technology Limited (CTL) (Shaker Heights, Ohio)
IMMUNOSPOT.RTM. Analyzer. Raw colony counts were used to plot kill
curves and calculate OPA titers.
[1800] The immunogenicity of conjugates 1 and 2 has been tested
according to the above mentioned assay. One additional conjugate
and an unconjugated native S. pneumoniae serotype 15B capsular
polysaccharide (unconjugated PS) were also tested in the same
assay:
[1801] Conjugate 9 was prepared by conjugation of native (i.e., not
sized) serotype 15B capsular polysaccharide to CRM.sub.197 by
reductive amination in aqueous solution.
[1802] The results are shown at Table 15.
TABLE-US-00031 TABLE 15 OPA Titers of Animal Testing using Serotype
15B-CRM.sub.197 Conjugates OPA GMT (95% CI) 0.001 .mu.g 0.01 .mu.g
0.1 .mu.g Conjugate 1 485 (413, 569) 804 (565, 1145) 1563 (1048,
2330) Conjugate 2 556 (438, 707) 871 (609, 1247) 1672 (1054, 2651)
Conjugate 9 395 (329, 475) 856 (627, 1168) 1802 (1108, 2930)
Unconjugated -- -- 698 (466, 1045) PS
[1803] As shown in the Table 15 above, conjugates 1 and 2, when
administered to mice, generated antibodies capable of opsonizing S.
pneumoniae serotype 15B, triggering complement deposition, thereby
facilitating phagocytosis and killing of bacteria by phagocytes. In
addition, despite their lower molecular weight, they also exhibited
similar level of immunogenicity as compared to conjugate 9 which
has not been sized.
Example 13. Preparation of Serotype 22F Polysaccharide--CRM.sub.197
Conjugate
[1804] Preparation of Isolated S. pneumoniae Serotype 22F
Polysaccharide
[1805] The S. pneumoniae serotype 22F were grown in a seed bottle
and then transferred to a seed fermentor. Once the targeted optical
density was reached, the cells were transferred to a production
fermentor. The fermentation was broth was inactivated by the
addition of N-lauroyl sarcosine and purified by ultrafiltration and
diafiltration.
[1806] The purified S. pneumoniae serotype 22F polysaccharide was
sized by high pressure homogenization using a PANDA 2K.RTM.
homogenizer (GEA Niro Soavi, Parma, Italy) to produce the isolated
S. pneumoniae serotype 22F polysaccharide
[1807] Oxidation of Isolated S. pneumoniae Serotype 22F Capsular
Polysaccharide
[1808] Oxidation of polysaccharide was carried out in 100 mM
potassium phosphate buffer (pH 5.8) obtained by sequential addition
of calculated amount of 500 mM potassium phosphate buffer (pH 5.8)
and WFI to give final polysaccharide concentration of 2.0 g/L. If
required, the reaction pH was adjusted to 5.8, approximately. After
pH adjustment, the reaction temperature was lowered to 5.degree. C.
Oxidation was initiated by the addition of 0.10 molar equivalents
(MEq) of sodium periodate. The target oxidation reaction time is 16
hrs at 5.degree. C.
[1809] The oxidation reaction was quenched with 2 MEq of
2,3-butanediol under continuous stirring at 5.degree. C. for 1-2
hrs.
[1810] Concentration and diafiltration of the activated
polysaccharide was carried out using 100K MWCO ultrafiltration
cassettes. Diafiltration was performed against 35-fold diavolume of
WFI. The purified activated polysaccharide was stored at 5.degree.
C. The purified activated saccharide is characterized inter alia by
(i) Molecular Weight by SEC-MALLS (ii) presence of O-acetyl and
(iii) Degree of Oxidation.
[1811] SEC-MALLS is used for the determination of the molecular
weight of polysaccharides and polysaccharide-protein conjugates.
SEC is used to separate the polysaccharides by hydrodynamic volume.
Refractive index (RI) and multi-angle laser light scattering
(MALLS) detectors are used for the determination of the molecular
weight. When light interacts with matter, it scatters and the
amount of scattered light is related to the concentration, the
square of the do/dc (the specific refractive index increments), and
the molar mass of the matter. The molecular weight measurement is
calculated based on the readings from the scattered light signal
from the MALLS detector and the concentration signal from the RI
detector.
[1812] The degree of oxidation (DO=moles of sugar repeat unit/moles
of aldehyde) of the activated polysaccharide was determined as
follows:
[1813] The moles of sugar repeat unit is determined by various
colorimetric methods, for example by using Anthrone method. The
polysaccharide is first broken down to monosaccharides by the
action of sulfuric acid and heat. The Anthrone reagent reacts with
the hexoses to form a yellow green colored complex whose absorbance
is read spectrophotometrically at 625 nm. Within the range of the
assay, the absorbance is directly proportional to the amount of
hexose present.
[1814] The moles of aldehyde also are determined simultaneously,
using MBTH colorimetric method. The MBTH assay involves the
formation of an azine compound by reacting aldehyde groups (from a
given sample) with a 3-methyl-2-benzothiazolone hydrazone (MBTH
assay reagent). The excess 3-methyl-2-benzothiazolone hydrazone
oxidizes to form a reactive cation. The reactive cation and the
azine react to form a blue chromophore. The formed chromophore is
then read spectroscopically at 650 nm.
[1815] Conjugation of Activated S. pneumoniae Serotype 22F
Polysaccharide with CRM.sub.197
[1816] The conjugation process consisted in the following
steps:
[1817] a. Compounding with sucrose excipient, and
lyophilization;
[1818] b. Reconstitution of the lyophilized polysaccharide and
CRM.sub.197,
[1819] c. Conjugation of activated polysaccharide to CRM.sub.197
and capping; and
[1820] d. Purification of the conjugate
[1821] a. Compounding with Sucrose and Lyophilization
[1822] The activated polysaccharide was compounded with sucrose
(50% w/v in WFI) to a ratio of 25 grams of sucrose per gram of
activated polysaccharide. The bottle of compounded mixture was then
lyophilized. Following lyophilization, bottles containing
lyophilized activated polysaccharide were stored at -20.degree. C.
Calculated amount of CRM.sub.197 protein (target S/P input ratio=1)
was shellfrozen and lyophilized separately. Lyophilized CRM.sub.197
was stored at -20.degree. C.
[1823] b. Reconstitution of Lyophilized Activated Polysaccharide
and CRM.sub.197 Protein
[1824] Lyophilized activated polysaccharide was reconstituted in
anhydrous dimethyl sulfoxide (DMSO). Upon complete dissolution of
polysaccharide, an equal amount of anhydrous DMSO was added to
lyophilized CRM.sub.197 for reconstitution.
[1825] c. Conjugation of Activated Polysaccharide to CRM.sub.197
and Capping
[1826] Reconstituted CRM.sub.197 (in DMSO) was combined in the
conjugation reaction vessel with the reconstituted activated
polysaccharide. The final polysaccharide concentration in reaction
solution is 1 g/L. Conjugation was initiated by adding 1.5 MEq of
sodium cyanoborohydride to the reaction mixture and the reaction
was incubated at 23.degree. C. for 20 hrs. Termination of
conjugation reaction is done by adding 2 MEq of sodium borohydride.
The capping reaction was incubated at 23.degree. C. for 3 hrs.
[1827] d. Purification of Conjugate
[1828] The conjugate solution was diluted 1:5 with chilled 5 mM
succinate-0.9% saline (pH 6.0) in preparation for purification by
tangential flow filtration using 100K MWCO membranes and a
20.times. diafiltration was performed using 5 mM succinate-0.9%
saline (pH6.0) as the medium. After the diafiltration was
completed, the conjugate retentate was further diluted, filtered
through a 0.22 .mu.m filter and stored at 2-8.degree. C.
[1829] Several conjugates were obtained using the above described
process by varying different parameters (e.g., saccharide-protein
input ratio, reaction concentration and Meq of sodium
cyanoborohydride). Characterization for representative Pn-22F
glycoconjugates to CRM.sub.197 is provided in Table 16
TABLE-US-00032 TABLE 16 Pneumococcal Serotype 22F-CRM.sub.197
conjugates Batch 1 2 3 4 5 6 7 8 9 10 Degree of Oxidation 12.6 19.5
17.2 14.0 12.4 14.9 11.1 14.6 14.4 13.7 (D.O) Activated Saccharide
540 697 864 92 866 631 614 639 709 416 MW by MALLS (kDa) Conjugate
Results Saccharide/Protein 0.75 0.87 2 0.8 0.8 0.4 1.9 0.8 0.65 1.0
Ratio O--Ac (%) 105 100 N/A N/A N/A N/A N/A N/A N/A N/A % Free
Saccharide <5 2 15.5 35 <5 <5 33 <5 <5 8 MW by
SEC-MALLS 2787 1668 2194 1419 5039 10450 1577 3911 3734 4453 (kDa)
N/A = not available
[1830] The % O-Acetyl (preserved) level in the final conjugate was
calculated from the ratio of the O-Acetyl content of the conjugate
(.mu.mol O-Acetyl per .mu.mol of the serotype 22F saccharide repeat
unit) relative to the O-Acetyl content of the polysaccharide
(.mu.mol 0-Acetyl per .mu.mol of the serotype 22F saccharide repeat
unit).
[1831] The immunogenicity of the conjugates obtained above have
been assessed using the opsonophagocytic assay (OPA) described
below.
[1832] Groups of thirty 6-7 week old female Swiss Webster mice were
immunized with 0.001 .mu.g, 0.005 .mu.g or 0.01 .mu.g of test
conjugates via the subcutaneous route on week 0. The mice were
boosted with the same dose of conjugate on week 3 and then bled at
week 4. Serotype-specific OPAs were performed on week 4 sera
samples.
[1833] Opsonophagocytic activity (OPA) assays are used to measure
functional antibodies in murine sera specific for S. pneumonia
serotype 22F. Test serum is set up in assay reactions that measure
the ability of capsular polysaccharide specific immunoglobulin to
opsonize bacteria, trigger complement deposition, thereby
facilitating phagocytosis and killing of bacteria by phagocytes.
The OPA titer is defined as the reciprocal dilution that results in
a 50% reduction in bacterial count over control wells without test
serum. The OPA titer is interpolated from the two dilutions that
encompass this 50% killing cut-off.
[1834] OPA procedures were based on methods described in Hu et al.
(2005) Clin Diagn Lab Immunol12(2):287-295 with the following
modifications. Test serum was serially diluted 2.5-fold and added
to microtiter assay plates. Live serotype 22F target bacterial
strains were added to the wells and the plates were shaken at
25.degree. C. for 30 minutes. Differentiated HL-60 cells
(phagocytes) and baby rabbit serum (3- to 4-week old,
PEL-FREEZ.RTM., 12.5% final concentration) were added to the wells,
and the plates were shaken at 37.degree. C. for 45 minutes. To
terminate the reaction, 80 .mu.L of 0.9% NaCl was added to all
wells, mixed, and a 10 .mu.L aliquot were transferred to the wells
of MULTISCREEN.RTM. HTS HV filter plates (MILLIPORE.RTM.)
containing 200 .mu.L of water. Liquid was filtered through the
plates under vacuum, and 150 .mu.L of HYSOY.RTM. medium was added
to each well and filtered through. The filter plates were then
incubated at 37.degree. C., 5% CO.sub.2 overnight and were then
fixed with Destain Solution (Bio-Rad Laboratories, Inc., Hercules,
Calif.). The plates were then stained with Coomassie Blue and
destained once. Colonies were imaged and enumerated on a Cellular
Technology Limited (CTL) (Shaker Heights, Ohio) IMMUNOSPOT.RTM.
Analyzer. Raw colony counts were used to plot kill curves and
calculate OPA titers.
[1835] The Opsonophagocytic activity (OPA) titers for Serotype
22F-CRM.sub.197 conjugates were determined as mentioned above. OPA
titers (geometric mean titer (GMT) with 95% confidence interval
(CI)) at four weeks at different doses are shown in Tables 17 and
18, (two separate experiments) demonstrating that the serotype 22F
conjugate (Batches 1-7; also see Table 16 for characterization data
of these conjugates) elicited OPA titers in a murine immunogenicity
model.
TABLE-US-00033 TABLE 17 Immunogenicity of Serotype 22F-CRM.sub.197
Conjugates Sample OPA GMT (95% CI) No. 0.001 .mu.g 0.005 .mu.g 0.01
.mu.g 1 86 (45, 165) 597 (285, 1252) 2519 (1409, 4504) 2 98 (51,
191) 782 (410, 1492) 2236 (1319, 3790) 3 35 (18, 69) 250 (122, 512)
509 (273, 950)
TABLE-US-00034 TABLE 18 Immunogenicity of Serotype 22F-CRM.sub.197
Conjugates Sample OPA GMT (95% CI) No. 0.001 .mu.g 0.01 .mu.g 4 37
(18, 76) 3383 (1911, 5987) 5 45 (20, 103) 1773 (1072, 2931) 6 235
(108, 513) 4335 (3018, 6226) 7 10 (7, 13) 252 (138, 457)
Example 14. Preparation of Pn-11A Conjugates to CRM.sub.197
[1836] Preparation of Pn-11A RAC Glycoconjugates
[1837] The frozen sized polysaccharide stored in de-ionized water
or 25 mM potassium phosphate buffer (pH 6.0) was thawed at
5.degree. C.
[1838] Oxidation of Polysaccharide
[1839] Polysaccharide oxidation was carried out in 100 mM potassium
phosphate buffer (pH 6.0) by addition of of 500 mM potassium
phosphate buffer (pH 6.0) and WFI to give final polysaccharide
concentration of 2.0 g/L. Oxidation reaction was carried out at
23.degree. C. Oxidation was initiated by the addition of sodium
periodate. The agitation rate ranges from 100-140 rpm.
[1840] Purification of Activated 11A Polysaccharide
[1841] Concentration and diafiltration of the activated
polysaccharide was carried out using ultrafiltration cassettes.
Diafiltration was performed against 20-fold diavolume of WFI. After
0.22 .mu.m filtration, the purified activated polysaccharide was
stored at 5.degree. C.
[1842] Conjugation Process Description
[1843] The conjugation process consisted in the following steps:
[1844] a. Shell freezing and lyophilization of CRM.sub.197 protein;
[1845] b. Reconstitution of the activated polysaccharide and
CRM.sub.197; [1846] c. Conjugation of activated polysaccharide to
CRM.sub.197; and [1847] d. Purification and dilution of the
conjugate
[1848] a. Shell Freezing and Lyophilization of CRM.sub.197
Protein
[1849] CRM.sub.197 protein was shell-frozen and lyophilized.
[1850] b. Reconstitution of Activated Polysaccharide and
CRM.sub.197 Protein
[1851] Activated polysaccharide solution (.about.10 g/L) was
charged into reactor followed by addition of calculated amount 0.5
N sodium phosphate buffer (pH 7.2). Under stirring, lyophilized
CRM.sub.197 was added and the reaction mixture was stirred for 2-4
hours in order to reach complete dissolution of CRM.sub.197.
[1852] c. Conjugation and Capping
[1853] Conjugation was initiated by adding cyanoborohydride. The
reaction mixture was incubated at 23.degree. C. for 72-96 hrs.
Termination of conjugation reaction was done by adding
0.5.times.WFI followed by 2 MEq of sodium borohydride. This capping
reaction was kept at 23.degree. C. for 3-4 hrs.
[1854] d. Dilution and Initial Purification of Conjugate
[1855] The conjugate solution was diluted 1:5 (reaction volume)
with 0.15 N sodium phosphate buffer (pH 8.0) in preparation for
purification by tangential flow filtration (TFF). Diluted conjugate
was mixed in the dilution vessel and then passed through a 5 .mu.m
filter. The filtered conjugate solution was then concentrated down
to 1-2 g/L. A two-steps diafiltration process was performed. In
step one, TFF was carried out using 30.times. (diafiltration
volume) of 0.15 N sodium phosphate buffer (pH 8.0) followed by
20.times. of 5 mM succinate-0.9% NaCl (pH6.0). After the initial
diafiltration was completed, the conjugate retentate was
transferred through a 0.45 .mu.m filter into a collection tank.
[1856] Final Diafiltration of Conjugate
[1857] The final purification step was a 20.times. diafiltration
with 5 mM succinate-0.9% NaCl, pH 6.0 medium using regenerated
cellulose membranes.
[1858] Dilution of the Monovalent Bulk Conjugate (MBC)
[1859] The conjugate was diluted further with 5 mM succinate/0.9%
NaCl, pH 6, to a target saccharide concentration of 0.5 mg/mL.
Final 0.22 .mu.m filtration step was completed to prepare the
monovalent bulk conjugate (MBC) product for formulation.
[1860] Several conjugates were obtained using the above described
process by varying different parameters (e.g., saccharide-protein
input ratio, reaction concentration and Meq of sodium
cyanoborohydride). Characterization for representative Pn-11A
glycoconjugates to CRM.sub.197 is provided in Table 19 (batches 1
to 5).
[1861] Preparation of Pn-11A Glycoconjugates Using RAC/DMSO
[1862] Oxidized polysaccharide was prepared and purified as
described above (see Preparation of Pn-11A RAC
Glycoconjugates).
[1863] Conjugation Via Reductive Amination in DMSO (RAC/DMSO)
[1864] Conjugation of 11A through RAC/DMSO consisted of the
following steps: [1865] a. Compounding with sucrose, shell freezing
and lyophilization; [1866] b. Reconstitution of the lyophilized
polysaccharide and CRM.sub.197; [1867] c. Conjugation of activated
polysaccharide to CRM.sub.197; and [1868] d. Purification and
dilution of the conjugate.
[1869] a. Compounding with Sucrose, Shell Freezing and
Lyophilization
[1870] The activated polysaccharide prepared from sized
polysaccharide was compounded with sucrose (50% w/v in WFI) to a
ratio of 25 grams of sucrose per gram of activated polysaccharide.
The components were mixed the shell-frozen bottle of compounded
mixture was then lyophilized. CRM.sub.197 protein was shell-frozen
and lyophilized separately.
[1871] b. Reconstitution of Lyophilized Activated Polysaccharide
and CRM.sub.197 Protein
[1872] Lyophilized activated polysaccharide was reconstituted in
DMSO at 2 mg/mL concentration. Upon the complete dissolution of
polysaccharide, DMSO was added to lyophilized CRM.sub.197 for
reconstitution
[1873] c. Conjugation and Capping
[1874] Reconstituted CRM.sub.197 (in DMSO) was combined in the
conjugation reaction vessel with the reconstituted activated
polysaccharide. The final polysaccharide concentration in reaction
solution is 1 g/L. Conjugation was initiated by adding
cyanoborohydride to the reaction mixture and was incubated at
23.degree. C. for 22 hours. Termination of conjugation reaction is
done by adding 2 MEq of sodium borohydride. This capping reaction
was kept at 23.degree. C. for 3-4 hrs.
[1875] d. Purification and Dilution of the Conjugate
[1876] The conjugate solution was purified and diluted using a
similar process as described above.
[1877] Several conjugates were obtained using the above described
process by varying different parameters (e.g., saccharide-protein
input ratio, reaction concentration and Meq of sodium
cyanoborohydride). Characterization for representative Pn-11A
glycoconjugates to CRM.sub.197 obtained by the above process is
provided at Table 19 (batches 6 to 8).
TABLE-US-00035 TABLE 19 Pneumococcal Serotype 11A-CRM.sub.197
conjugates Batch 1 2 3 4 5 6 7 8 Activated Saccharide 207 129 103
199 183 232 113 113 MW by MALLS (kDa) Conjugate Results
Saccharide/Protein 1.24 1.09 1.32 1.47 1.31 1 0.78 0.68 Ratio
Acetate(mol/mol PS) 2.72 2.89 2.72 3.2 3.13 N/A N/A N/A Glycerol
(mol/mol PS)* 0.62 0.68 0.75 0.51 0.41 N/A N/A N/A MW by SEC-MALLS
3224 837 623 827 994 12200 6543 15730 (kDa) N/A = not available
*Glycerol was quantitated by High Performance Anion Exchange
Chromatography with Pulsed Amperometric Detection (HPAEC-PAD) after
its release from the polysaccharide by hydrofluoric acid (HF).
[1878] The overall data generated from conjugates prepared by the
above reductive amination processes demonstrated that it allowed
preparing conjugates with good conjugation yield, low % free
saccharide and with good stability.
[1879] The immunogenicity of the conjugates obtained above have
been assessed using the opsonophagocytic assay (OPA) described
below.
[1880] Groups of thirty 6-7 week old female Swiss Webster mice were
immunized with 0.001 .mu.g, 0.005 .mu.g, 0.01 .mu.g, or 0.1 .mu.g
of test conjugates via the subcutaneous route on week 0. The mice
were boosted with the same dose of conjugate on week 3 and then
bled at week 4. Serotype-specific OPAs were performed on week 4
sera samples.
[1881] Opsonophagocytic activity (OPA) assays are used to measure
functional antibodies in murine sera specific for S. pneumonia
serotype 11A. Test serum is set up in assay reactions that measure
the ability of capsular polysaccharide specific immunoglobulin to
opsonize bacteria, trigger complement deposition, thereby
facilitating phagocytosis and killing of bacteria by phagocytes.
The OPA titer is defined as the reciprocal dilution that results in
a 50% reduction in bacterial count over control wells without test
serum. The OPA titer is interpolated from the two dilutions that
encompass this 50% killing cut-off. OPA procedures were based on
methods described in Hu et al. (2005) Clin Diagn Lab Immunol12
(2):287-295 with the following modifications. Test serum was
serially diluted 2.5-fold and added to microtiter assay plates.
Live serotype 22F target bacterial strains were added to the wells
and the plates were shaken at 25.degree. C. for 30 minutes.
Differentiated HL-60 cells (phagocytes) and baby rabbit serum (3-
to 4-week old, PEL-FREEZ.RTM., 12.5% final concentration) were
added to the wells, and the plates were shaken at 37.degree. C. for
60 minutes. To terminate the reaction, 80 .mu.L of 0.9% NaCl was
added to all wells, mixed, and a 10 .mu.L aliquot were transferred
to the wells of MULTISCREEN.RTM. HTS HV filter plates
(MILLIPORE.RTM.) containing 200 .mu.L of water. Liquid was filtered
through the plates under vacuum, and 150 .mu.L of HYSOY.RTM. medium
was added to each well and filtered through. The filter plates were
then incubated at 37.degree. C., 5% CO.sub.2 overnight and were
then fixed with Destain Solution (Bio-Rad Laboratories, Inc.,
Hercules, Calif.). The plates were then stained with Coomassie Blue
and destained once. Colonies were imaged and enumerated on a
Cellular Technology Limited (CTL) (Shaker Heights, Ohio)
IMMUNOSPOT.RTM. Analyzer. Raw colony counts were used to plot kill
curves and calculate OPA titers.
[1882] The Opsonophagocytic activity (OPA) titers for serotype
11A-CRM.sub.197 conjugates in mice were determined as mentioned
above. OPA titers (geometric mean titer (GMT) with 95% confidence
interval (CI)) at four weeks at different doses are shown in Table
20, demonstrating that the serotype 11A conjugate (Batches 2-4 and
8; also see Table 19 for characterization data of these conjugates)
elicited OPA titers in a murine immunogenicity model.
TABLE-US-00036 TABLE 20 Immunogenicity of Serotype 11A-CRM.sub.197
Conjugates OPA GMT (95% CI) Batch No. 0.001 .mu.g 0.01 .mu.g 0.1
.mu.g 2 326 (260, 408) 1391 (794, 2437) 4366 (3063, 6223) 3 389
(316, 478) 1113 (690, 1795) 5527 (3698, 8260) 4 192 (149, 248) 926
(661, 1298) 2800 (1975, 3970) 8 303 (224, 411) 1099 (624, 1935)
3861 (2629, 5669)
Example 15. Formulation of a 16-valent Pneumococcal Conjugate
Vaccine
[1883] A 16-valent conjugates composition comprising
glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F (16vPnC) all
individually conjugated to CRM.sub.197 was formulated.
[1884] Glycoconjugates from S. pneumoniae from serotypes 15B, 22F
and 33F were produced as disclosed above and S. pneumoniae
glycoconjugates from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C,
19A, 19F and 23F were produced as disclosed in WO 2006/110381. The
required volumes of bulk concentrates were calculated based on the
batch volume and the bulk saccharide concentrations. The formulated
bulk vaccine was prepared by adding the required volume of
NaCl/succinate buffer (pH 5.8) to obtain a final target buffer
concentration of succinate 5.0 mM and 150 mM NaCl. Polysorbate 80
to a final concentration of 0.02% and the 16 pneumococcal
conjugates were added. The preparation was filtered through a 0.2
.mu.m Millipore PES membrane, followed by the addition of AlPO4.
The formulation was mixed to allow for binding and to achieve
homogeneity.
[1885] The formulation was then filled into glass syringes to
deliver a dose volume of 0.5 mL. The final dosage form consisted in
2.2 .mu.g of each of glycoconjugates from S. pneumoniae serotypes
1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F
individually conjugated to CRM.sub.197, 4.4 .mu.g of glycoconjugate
from S. pneumoniae serotype 6B, 5 mM succinate buffer pH 5.8, 0.02%
(w/w) PS80, 150 mM NaCl and 0.25 mg/mL aluminum as AlPO.sub.4 for a
dose of 0.5m L. CRM.sub.197, content was about 38 .mu.g for a dose
of 0.5 mL.
Example 16. Formulation of a 20-Valent Pneumococcal Conjugate
Vaccine
[1886] A 20 valent conjugates composition comprising
glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B,
7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F
(20vPnC) all individually conjugated to CRM.sub.197 was
formulated.
[1887] Glycoconjugates from S. pneumoniae from serotypes 8, 10A,
11A, 12F, 15B, 22F and 33F were produced as disclosed above and S.
pneumoniae glycoconjugates from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F and 23F were produced as disclosed in WO
2006/110381.
[1888] The required volumes of bulk concentrates were calculated
based on the batch volume and the bulk saccharide concentrations.
The formulated bulk vaccine was prepared by adding the required
volume of NaCl/succinate buffer (pH 5.8) to obtain a final target
buffer concentration of succinate 5.0 mM and 150 mM NaCl.
Polysorbate 80 to a final concentration of 0.02% and the 20
pneumococcal conjugates are added. The preparation was filtered
through a 0.2 .mu.m Millipore PES membrane, followed by the
addition of AlPO.sub.4. The formulation was mixed well to obtain
maximum binding of the conjugates to the aluminum.
[1889] The formulation is then filled into glass syringes to
deliver a dose volume of 0.5 mL.
[1890] The final dosage form consisted in 2.2 .mu.g of each of
glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8,
9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F
individually conjugated to CRM.sub.197, 4.4 .mu.g of glycoconjugate
from S. pneumoniae serotype 6B, 5 mM succinate buffer pH 5.8, 0.02%
(w/w) PS80, 150 mM NaCl and 0.25 mg/mL aluminum as AlPO4 for a dose
of 0.5 mL. CRM.sub.197, content was about 46 .mu.g for a dose of
0.5m L.
Example 17. Immunogenicity of a 16-Valent Immunogenic
Composition
[1891] The immunogenicity of the 16-valent immunogenic composition
(see Example 15) was assessed in Rabbits using multiplexed direct
Luminex immunoassays (dLIAs) to measure serotype-specific IgG
concentrations in sera and serotype-specific OPAs.
[1892] Groups of ten 2.5 kg to 3.5 kg female New Zealand white
rabbits were immunized with the proposed human clinical dose (2.2
.mu.g of conjugate except serotype 6B which was at 4.4 .mu.g; plus
0.1 mg aluminum as AlPO.sub.4) via the intramuscular route on week
0. The rabbits were boosted with the same dose of conjugate vaccine
on week 2 and then bled at week 4. Serotype-specific dLIAs and OPAs
were performed on week 0 and week 4 sera samples.
[1893] To quantify the total polysaccharide binding antibody (IgG)
specific to each pneumococcal polysaccharide (PnPS), rabbit sera
were evaluated in two direct Luminex immunoassays (dLIAs, 13-plex
dLIA, PREVNAR 13.RTM. serotypes and 7-plex dLIA, additional
serotypes). The 13-plex assay measures anti-PnPS antibodies
specific to the 13 serotypes included in the 13-valent pneumococcal
conjugate (PnC) vaccine (1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F, and 23F) and the 7-plex assay measures anti-PnPS antibodies to
the additional serotypes (15B, 22F, 33F). Each assay contains a
combination of 13 or 7 spectrally distinct magnetic microspheres
coupled to PnPS conjugates (PnPS-PLL conjugates: PnPS conjugated to
poly-L-Lysine).
[1894] Briefly, reference standard, controls and test sera were
first pre-adsorbed with two Pn absorbents; CWPS1 (cell wall
polysaccharide from PnA containing C-polysaccharide) and CWPS2 (CWP
from acapsular S. pneumoniae serotype 2) to block non-specific
antibodies from binding to the PnPS coating antigen. Following
preadsorption, the PnPS-coupled microspheres were incubated with
appropriately diluted reference standard serum, controls or rabbit
test sera. After incubation, each mixture was washed and an
R-Phycoerythrin-conjugated goat anti-rabbit IgG secondary antibody
was added. Fluorescent signals (expressed as median fluorescence
intensities (MFIs)) were measured using a Bio-Plex reader and
correlated to the amount of bound PnPS-specific IgG. Values for
test sera are reported as (Units/mL, U/mL).
[1895] Serotype-specific OPAs were performed as described above.
The OPA titer is the reciprocal of the highest serum dilution
resulting in 50% reduction in the number of bacterial colony
forming units (CFUs) when compared to the control without serum
(defined as the background CFU). The titer is interpolated from the
two dilutions that encompass this 50% killing cut-off.
TABLE-US-00037 TABLE 21 16vPnC Total IgG Concentrations and OPA
Titers Total IgG (Pn dLIA) Opsonophagocytic Antibody (OPA) Wk 0 Wk
4 Wk 4 IgG GMC Wk 4 OPA GMT GMC GMC 95% CI Ratio Wk 0 Wk 4 95% CI
Ratio Serotype (.mu.g/ml) (.mu.g/ml) (LCI-UCI) Wk 4:Wk 0 GMT GMT
(LCI-UCI) Wk 4:Wk 0 1 0.08 28 17-44 369 4 87 55-139 22 3 0.08 88
60-128 1062 4 214 151-304 54 4 0.08 30 14-67 402 4 934 551-1583 233
5 0.08 34 18-64 449 4 368 232-584 87 6A 0.03 46 15-142 1835 4 3026
1607-5696 756 6B 0.08 89 33-241 1182 4 6156 3043-12453 1539 7F 0.01
50 31-78 3969 6 2917 2013-4227 528 9V 0.03 24 15-38 881 5 613
426-883 112 14 0.08 28 20-39 368 19 449 331-610 24
TABLE-US-00038 TABLE 21 16vPnC Total IgG Concentrations and OPA
Titers Total IgG (Pn dLIA) Opsonophagocytic Antibody (OPA) Wk 0 Wk
4 Wk 4 IgG GMC Wk 4 OPA GMT GMC GMC 95% CI Ratio Wk 0 Wk 4 95% CI
Ratio Serotype (.mu.g/ml) (.mu.g/ml) (LCI-UCI) Wk 4:Wk 0 GMT GMT
(LCI-UCI) Wk 4:Wk 0 18C 0.05 79 45-139 1587 4 1847 1003-3401 462
19A 0.08 120 71-205 1605 4 1410 851-2336 352 19F 0.08 156 96-255
2083 4 3207 1783-5771 802 23F 0.05 33 13-84 668 4 997 487-2042 249
15B 0.05 54 40-71 1073 6 741 514-1069 116 22F 0.08 158 95-262 2103
5 1078 661-1756 211 33F 0.10 11 6-20 115 49 1337 829-2154 27
Abbreviations: GMC, geometric mean concentration; CI, confidence
interval; LCI, lower confidence interval; UCI, upper confidence
interval.
[1896] Results showed a significant increase in serotype-specific
IgG and functional OPA antibody responses following two
immunizations with 16vPnC (Table 21). Serum IgG levels increased
more than 2-logs above baseline. Similarly, a robust functional OPA
antibody response was elicited with a minimum of a 22-fold increase
in OPA GMT above baseline. Pre-immune sera (Wk 0) showed
undetectable levels of PnPS-specific IgG and functional OPA
antibody for the majority of the 16v Pn serotypes with the
exception of serotypes 14 and 33F. Low level OPA titers were
present for these serotypes but these baseline responses did not
adversely affect the antibody response following vaccination.
Example 18. Immunogenicity of a 20-Valent Immunogenic
Composition
[1897] The immunogenicity of the 20-valent immunogenic composition
(as prepared at example 16) was assessed in rabbits using
multiplexed direct Luminex immunoassays (dLIAs) to measure
serotype-specific IgG concentrations in sera and serotype-specific
OPAs. Groups of ten 2.5 kg to 3.5 kg female New Zealand white
rabbits were immunized with the proposed human clinical dose (2.2
.mu.g of conjugate except serotype 6B which was at 4.4 .mu.g; plus
0.1 mg aluminum as AlPO.sub.4) via the intramuscular route on week
0. The rabbits were boosted with the same dose of conjugate vaccine
on week 2 and then bled at week 4. Serotype-specific dLIAs and OPAs
were performed on week 0 and week 4 sera samples.
[1898] To quantify the total polysaccharide binding antibody (IgG)
specific to each pneumococcal polysaccharide (PnPS), rabbit sera
were evaluated in two direct Luminex immunoassays (dLIAs, 13-plex
dLIA, PREVNAR 13.RTM. serotypes and 7-plex dLIA, additional
serotypes). The 13-plex assay measures anti-PnPS antibodies
specific to the 13 serotypes included in the 13-valent pneumococcal
conjugate (PnC) vaccine (1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F, and 23F) and the 7-plex assay measures anti-PnPS antibodies to
the additional serotypes (15B, 22F, 33F). Each assay contains a
combination of 13 or 7 spectrally distinct magnetic microspheres
coupled to PnPS conjugates (PnPS-PLL conjugates: PnPS conjugated to
poly-L-Lysine).
[1899] Briefly, reference standard, controls and test sera were
first pre-adsorbed with two Pn absorbents; CWPS1 (cell wall
polysaccharide from PnA containing C-polysaccharide) and CWPS2 (CWP
from acapsular S. pneumoniae serotype 2) to block non-specific
antibodies from binding to the PnPS coating antigen. Following
preadsorption, the PnPS-coupled microspheres were incubated with
appropriately diluted reference standard serum, controls or rabbit
test sera. After incubation, each mixture was washed and an
R-Phycoerythrin-conjugated goat anti-rabbit IgG secondary antibody
was added. Fluorescent signals (expressed as median fluorescence
intensities (MFIs)) were measured using a Bio-Plex reader and
correlated to the amount of bound PnPS-specific IgG. Values for
test sera are reported as (Units/mL, U/mL).
[1900] Serotype-specific OPAs were performed as described above.
The OPA titer is the reciprocal of the highest serum dilution
resulting in 50% reduction in the number of bacterial colony
forming units (CFUs) when compared to the control without serum
(defined as the background CFU). The titer is interpolated from the
two dilutions that encompass this 50% killing cut-off.
[1901] Rabbits immunized with the 20vPnC also demonstrated
significant increases in total IgG and functional OPA antibody
titers against serotypes common to the 16v and 20v formulations as
well as to the additional four serotypes (8, 10A, 11A, and 12F)
(Table 22). A 2-log increase in serum IgG levels across the 20
serotypes was induced following two immunizations. OPA GMTs
elicited with the vaccine were at least 27-fold above baseline. Low
level OPA titers in pre-immune sera for serotypes 14 and 33F were
similarly observed following 20vPnC vaccination, but again did not
alter the robustness of the post-vaccination antibody
responses.
[1902] The 16vPnC and 20vPnC formulations elicited a robust humoral
response that was both specific for Pneumococcal polysaccharides
and associated with functional killing of the bacterium (see Tables
21 and 22). In conclusion, studies shown in Examples 17 and 18
demonstrated good immunogenicity of both the 16vPnC and 20vPnC
formulations.
TABLE-US-00039 TABLE 22 20vPnC Total IgG Concentrations and OPA
Titers Total IgG (Pn dLIA) Opsonophagocytic Antibody (OPA) Wk 0 Wk
4 Wk 4 IgG GMC Wk 4 OPA GMT GMC GMC 95% CI Ratio Wk 0 Wk 4 95% CI
Ratio Serotype (.mu.g/ml) (.mu.g/ml) (LCI-UCI) Wk 4:Wk 0 GMT GMT
(LCI-UCI) Wk 4:Wk 0 1 0.08 28 19-43 379 4 106 69-164 27 3 0.08 116
76-176 1542 4 286 193-425 72 4 0.08 62 39-97 821 4 1477 954-2287
369 5 0.08 49 33-71 648 4 509 350-742 127 6A 0.03 30 14-66 1209 4
3682 2743-4944 849 6B 0.08 58 36-94 775 4 4469 3002-6653 1117 7F
0.02 62 39-101 3681 6 3226 2226-4675 500 9V 0.05 30 19-48 644 6 956
634-1442 150 14 0.08 34 20-60 457 12 506 348-736 42 18C 0.05 106
67-166 2115 4 1942 1263-2986 485 19A 0.08 112 73-171 1493 4 1580
1071-2332 395 19F 0.08 178 119-266 2372 4 3392 2085-5519 848 23F
0.05 48 23-103 960 4 1514 889-2577 378 15B 0.05 70 51-98 1410 6
1332 949-1869 210 22F 0.10 172 118-250 1811 5 1304 1000-1700 279
33F 0.12 14 10-20 120 54 1490 1117-1989 28 8 0.13 144 100-207 1149
4 1388 988-1949 333 10A 0.13 54 31-94 433 5 1129 732-1741 236 11A
0.13 178 125-254 1423 7 10483 6373-17241 1434 12F 0.08 31 15-63 408
4 828 608-1127 191 Abbreviations: GMC, geometric mean
concentration; CI, confidence interval; LCI, lower confidence
interval; UCI, upper confidence interval.
Example 19. Evaluation of Cross-Reactive Opsonophagocytic Immune
Responses within Serogroup 9 of Streptococcus pneumoniae
[1903] The pneumococcal opsonophagocytic assay (OPA), which
measures killing of S. pneumoniae cells by phagocytic effector
cells in the presence of functional antibody and complement, is
considered to be an important surrogate for evaluating the
effectiveness of pneumococcal vaccines.
[1904] Materials and Methods
[1905] Two randomly selected subsets of immune sera from adults
vaccinated with a 13-valent pneumococcal conjugate vaccine (13v
PnC) were tested in OPA assays for the serotypes 9V, 9A, 9L and 9N.
The sera were collected from U.S. clinical trials 6115A1-004 (N=59,
post-vaccinated) and 6115A1-3005 (N=66, matched pre- and
post-vaccination), respectively.
[1906] Study 6115A1-3005 (ClinicalTrials.gov Identifier:
NCT00546572) was a phase 3, randomized, active-controlled, modified
double-blind trial evaluating the safety, tolerability, and
immunogenicity of PREVNAR 13.RTM. compared with a 23-valent
pneumococcal polysaccharide vaccine (23vPS) in ambulatory elderly
individuals aged 70 years and older who received 1 dose of 23vPS at
least 5 years before study enrollment (see:
http://clinicaltrials.gov/ct2/show/NCT00546572, accessed on Mar.
31, 2014). Study 6115A1-004 (ClinicalTrials.gov Identifier:
NCT00427895) was a phase 3, randomized, active-controlled, modified
double-blind trial evaluating the safety, tolerability, and
immunogenicity of a 13-valent pneumococcal conjugate vaccine
(13vPnC) compared to a 23-valent pneumococcal polysaccharide
vaccine (23vPS) in adults 60 to 64 years old who are naive to 23vPS
and the safety, olerability, and immunogenicity of 13vPnC in adults
18 to 59 years old who are naive to 23vPS (see:
http://clinicaltrials.gov/show/NCT00427895, accessed on Mar. 31,
2014).
[1907] The 13-valent pneumococcal conjugate vaccine (13vPnC) tested
in these studies contained conjugates from pneumococcal serotypes
1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F,
individually conjugated to diphtheria cross-reacting material 197
(CRM.sub.197) carrier protein.
[1908] OPAs are used to measure functional antibodies in human sera
against S. pneumoniae serotypes 9V, 9N, 9A and/or 9L. Test serum is
set up in assay reactions that measure the ability of capsular
polysaccharide specific immunoglobulin to opsonize bacteria,
trigger complement deposition, thereby facilitating phagocytosis
and killing of bacteria by phagocytes. The OPA titer is defined as
the reciprocal dilution that results in a 50% reduction in
bacterial count over control wells without test serum. The OPA
titer is interpolated from the two dilutions that encompass this
50% killing cut-off.
[1909] OPA procedures were based on methods described in Hu et al.
(2005) Clin Diagn Lab Immunol122):287-295. Test heat-inactivated
serum was serially diluted 2.5-fold and was added together with the
target bacteria in assay plates and incubated for 30 minutes with
shaking. Differentiated HL-60 cells (phagocytes) and baby rabbit
serum (3- to 4-week old, PEL-FREEZ.RTM., Arkansas, 12.5% final
concentration) were then added to the wells, at an approximate
effector to target ratio of 200:1, and incubated at 37.degree. C.
with shaking. To terminate the reaction, 80 .mu.L of 0.9% NaCl was
added to all wells, mixed, and a 10 .mu.L aliquot were transferred
to the wells of MULTISCREEN.RTM. HTS HV filter plates
(MILLIPORE.RTM.) containing 200 .mu.L of water. Liquid was filtered
through the plates under vacuum, and 150 .mu.L of HYSOY.RTM. medium
was added to each well and filtered through. The filter plates were
then incubated at 37.degree. C., 5% CO.sub.2 overnight and were
then fixed with Destain Solution (Bio-Rad Laboratories, Inc.,
Hercules, Calif.). The plates were then stained with Coomassie Blue
and destained once. Colonies were imaged and enumerated on a
Cellular Technology Limited (CTL) (Shaker Heights, Ohio)
IMMUNOSPOT.RTM. Analyzer.
[1910] Statistical Analysis: Pearson two-tailed correlations were
calculated.
[1911] Results--OPA Responses in 9V, 9A, 9L and 9N
[1912] The cross-functional response from immune sera of adults
immunized with 13vPnC against serotypes 9A, 9L, and 9N, was
evaluated in the respective microcolony Opsonophagocytic Assays
(mcOPAs), along with the homologous functional response to serotype
9V. Two randomly selected subsets of immune sera from adults
vaccinated with 13vPnC were tested. The sera were collected from
U.S. clinical trials 6115A1-004 (N=59, post-vaccinated) and
6115A1-3005 (N=66, matched pre- and post-vaccination),
respectively.
[1913] Subjects in study 6115A1-004 were previously naive to any
pneumococcal vaccination and received a single dose of 13vPnC as
part of the study protocol. The immune sera from study 6115A1-004
shows a similar percentage of responders for all the serogroups
with values of 98.3%, 98.3%, 100% and 93.2% for 9V, 9A, 9L and 9N
respectively (FIG. 11), supporting the results from 6115A1-3005
(FIG. 12). A relative good OPA titer correlations were observed
between serotypes 9V and 9A (Pearson correlation .rho.=0.5456,
p<0.0001) or 9L (.rho.=0.7353, p<0.0001), but not with 9N
(.rho.=0.1217, p<0.3627).
[1914] Subjects in study 6115A1-3005 had previously received 1 dose
of 23vPS at least 5 years before study enrollment and received a
single dose of 13vPnC as part of the study protocol. Matched pre-
and post-vaccination serum panel (N=66) from adults immunized with
13vPnC (study 6115A1-3005) was evaluated on OPA for the homologous
response to serotype 9V and for cross-reactivity of anti-9V
antibodies to serotypes 9A, 9L, and 9N. As shown in FIG. 12, a
relatively high immunity (percentage responders) to 9V (84%), 9A
(66%), 9L (82%) and 9N (86%) was detected in the OPA assay likely
due to their previous immunization with 23vPS, which includes
unconjugated polysaccharides from serotypes 9V and 9N. However, the
percentage responders increased to 95% or more for all four
serotypes after vaccination with 13vPnC, which only contains
serotype 9V conjugate from serogroup 9. The fold-rise in titer
values are shown in Table 23 and are similar between the serotypes
also suggesting cross-reactivity.
TABLE-US-00040 TABLE 23 OPA Titer Fold-Rise Matched Pre- and
Post-Vaccination, 13vPnC OPA Titers 9V 9A 9L 9N Pre Post Pre Post
Pre Post Pre Post GMT 221 1323 41 308 165 706 322 693 Fold-rise 5.9
7.5 4.2 2.1
[1915] A more comprehensive analysis of the OPA titer distribution
is shown in the reverse cumulative distribution curves (RCDC) in
FIGS. 13-16. The RCDCs show an increase in serotype-specific immune
response post vaccination for serotypes 9V, 9A, 9L and to a lesser
extent 9N. The correlation of the fold-rise of titer of individual
matched/samples between 9V 9A, 9V/9L, and 9V/9N were also analyzed
using Pearson's correlation. Relatively good correlations of
fold-rises of titers were observed between serotypes 9V and 9A
(Pearson correlation .rho.=0.8720, p<0.0001) or 9N
(.rho.=0.5801, p<0.0001), but to a lesser extent with 9L
(.rho.=0.1804, p<0.1640).
[1916] Conclusion
[1917] Based on these data, the 13vPnC vaccine is likely to provide
broader serotype coverage by providing additional protection
against serotypes 9A, 9L, and 9N.
Example 20: Cross-Functional OPA Responses Between Serotype 15B and
Serotype 15C
[1918] Pneumococcal serogroup 15 includes four structurally-related
serotypes: 15A, 15B, 15C, and 15F. Serotypes 15B and 15C are
undistinguishable by genetic typing techniques and have similar
capsular polysaccharide (PS) composition, except that the 15B-PS is
the O-acetylated variant of 15C-PS. To understand whether
anti-capsular PS antibodies for serotype 15B are functionally
cross-reacting with serotype 15C, 10 rabbits were immunized with
16vPnC (see example 15) and 20vPnC (see example 16) vaccines both
containing an immunogenic conjugate comprising S. pneumoniae
serotype 15B capsular polysaccharide covalently linked to
CRM.sub.197 as disclosed herein as part of their formulation. Sera
from pre- and post-vaccination were tested in OPA assays against
serotypes 15B and 15C target pneumococcal strains.
[1919] Of the 10 rabbits from each group, 100% had OPA response to
serotype 15B following immunization with a serotype 15B conjugate.
Of these same samples, 100% had OPA response to serotype 15C as
well (Table 24 and Table 25). Low OPA titers were observed in
prevaccination sera in 15C OPA. However, over 10-fold GMT OPA titer
increase with post vaccination sera compared to pre vaccination
demonstrated that the immunogenic conjugates of the invention
induces the formation of antibodies capable of killing serotype 15B
and 15C Streptococcus pneumonia in an OPA.
TABLE-US-00041 TABLE 24 OPA Titers Against serotypes 15B and 15C
strains in Rabbit Sera Pre and Post vaccination with 16vPnC 15B OPA
15C OPA Animal wk 0 wk 4 wk 0 wk 4 1 4 4129 50 2524 2 4 1645 182
472 3 4 1131 126 818 4 4 3199 50 1189 5 4 2664 36 727 6 4 4589 68
2492 7 11 3601 169 1137 8 4 1838 165 672 9 4 1334 98 528 10 4 1108
204 2425 GMT 4 2222 98 1075
TABLE-US-00042 TABLE 25 OPA Titers Against serotypes 15B and 15C
strains in Rabbit Sera Pre and Post vaccination with 20vPnC 15B OPA
15C OPA Animal wk 0 wk 4 wk 0 wk 4 1 4 3784 indeterminable* 2353 2
4 862 480 938 3 4 3056 69 1497 4 4 1948 indeterminable* 1316 5 4
2360 4 4665 6 4 1594 indeterminable* 1835 7 4 4943 172 4085 8 4
2419 117 1458 9 4 1245 indeterminable* 527 10 4 616 indeterminable*
545 GMT 4 1917 77 1515 *Titer cannot be determined due to bad
killing curves
Example 21. Formulation of a 7-Valent Pneumococcal Conjugate
Vaccine
[1920] A 7 valent conjugate composition comprising glycoconjugates
from S. pneumoniae serotypes 8, 10A, 11A, 12F, 15B, 22F and 33F
(7vPnC) all individually conjugated to CRM.sub.197 was
formulated.
[1921] Glycoconjugates from S. pneumoniae from serotypes 8, 10A,
11A, 12F, 15B, 22F and 33F were produced as disclosed above.
[1922] The required volumes of bulk concentrates were calculated
based on the batch volume and the bulk saccharide concentrations.
The formulated bulk vaccine was prepared by adding the required
volume of NaCl/succinate buffer (pH 5.8) to obtain a final target
buffer concentration of 5.0 mM succinate and 150 mM NaCl.
Polysorbate 80 to a final concentration of 0.02% and the 7
pneumococcal conjugates are added. The preparation was filtered
through a 0.2 .mu.m Millipore PES membrane, followed by the
addition of AlPO.sub.4. The formulation was mixed well to obtain
maximum binding of the conjugates to the aluminum.
[1923] The formulation is then filled into glass syringes to
deliver a dose volume of 0.5 mL. The final dosage form consisted of
2.2 .mu.g of each of the glycoconjugates from S. pneumoniae
serotypes 8, 10A, 11A, 12F, 15B, 22F and 33F individually
conjugated to CRM.sub.197, 5.0 mM succinate buffer at pH 5.8, 0.02%
(w/w) PS80, 150 mM NaCl and 0.25 mg/mL aluminum as AlPO4 for a dose
of 0.5 mL.
[1924] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are hereby incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[1925] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, certain changes and modifications may be
practiced within the scope of the appended claims.
Sequence CWU 1
1
40121DNAArtificial Sequence"A class" CpG oligonucleotide
1ggggacgacg tcgtgggggg g 21221DNAArtificial Sequence"A class" CpG
oligonucleotide 2ggggacgacg tcgtgggggg g 21321DNAArtificial
Sequence"B class" CpG oligonucleotide 3tcgtcgtttt tcggtgcttt t
21421DNAArtificial Sequence"B class" CpG oligonucleotide
4tcgtcgtttt tcggtcgttt t 21524DNAArtificial Sequence"B class" CpG
oligonucleotide 5tcgtcgtttt gtcgttttgt cgtt 24624DNAArtificial
Sequence"B class" CpG oligonucleotide 6tcgtcgtttc gtcgttttgt cgtt
24724DNAArtificial Sequence"B class" CpG oligonucleotide
7tcgtcgtttt gtcgtttttt tcga 24821DNAArtificial SequenceB-Class
oligonucleotide 8tcgtcgtttt tcggtgcttt t 21921DNAArtificial
SequenceB-Class oligonucleotide 9tcgtcgtttt tcggtcgttt t
211024DNAArtificial SequenceB-Class oligonucleotide 10tcgtcgtttt
gtcgttttgt cgtt 241124DNAArtificial SequenceB-Class oligonucleotide
11tcgtcgtttc gtcgttttgt cgtt 241224DNAArtificial SequenceB-Class
oligonucleotide 12tcgtcgtttt gtcgtttttt tcga 241322DNAArtificial
SequenceC class CpG Oligonucleotide 13tcgcgtcgtt cggcgcgcgc cg
221423DNAArtificial SequenceC class CpG Oligonucleotide
14tcgtcgacgt tcggcgcgcg ccg 231521DNAArtificial SequenceC class CpG
Oligonucleotide 15tcggacgttc ggcgcgcgcc g 211619DNAArtificial
SequenceC class CpG Oligonucleotide 16tcggacgttc ggcgcgccg
191720DNAArtificial SequenceC class CpG Oligonucleotide
17tcgcgtcgtt cggcgcgccg 201820DNAArtificial SequenceC class CpG
Oligonucleotide 18tcgacgttcg gcgcgcgccg 201918DNAArtificial
SequenceC class CpG Oligonucleotide 19tcgacgttcg gcgcgccg
182018DNAArtificial SequenceC class CpG Oligonucleotide
20tcgcgtcgtt cggcgccg 182122DNAArtificial SequenceC class CpG
Oligonucleotide 21tcgcgacgtt cggcgcgcgc cg 222222DNAArtificial
SequenceC class CpG Oligonucleotide 22tcgtcgtttt cggcgcgcgc cg
222322DNAArtificial SequenceC class CpG Oligonucleotide
23tcgtcgtttt cggcggccgc cg 222424DNAArtificial SequenceC class CpG
Oligonucleotide 24tcgtcgtttt acggcgccgt gccg 242523DNAArtificial
SequenceC class CpG Oligonucleotide 25tcgtcgtttt cggcgcgcgc cgt
232622DNAArtificial SequenceC-Class oligonucleotides 26tcgcgtcgtt
cggcgcgcgc cg 222723DNAArtificial SequenceC-Class oligonucleotide
27tcgtcgacgt tcggcgcgcg ccg 232821DNAArtificial SequenceC-Class
oligonucleotide 28tcggacgttc ggcgcgcgcc g 212919DNAArtificial
SequenceC-Class oligonucleotide 29tcggacgttc ggcgcgccg
193020DNAArtificial SequenceC-Class oligonucleotide 30tcgcgtcgtt
cggcgcgccg 203120DNAArtificial SequenceC-Class oligonucleotide
31tcgacgttcg gcgcgcgccg 203218DNAArtificial SequenceC-Class
oligonucleotide 32tcgacgttcg gcgcgccg 183318DNAArtificial
SequenceC-Class oligonucleotide 33tcgcgtcgtt cggcgccg
183422DNAArtificial SequenceC-Class oligonucleotide 34tcgcgacgtt
cggcgcgcgc cg 223522DNAArtificial SequenceC-Class oligonucleotide
35tcgtcgtttt cggcgcgcgc cg 223622DNAArtificial SequenceC-Class
oligonucleotide 36tcgtcgtttt cggcggccgc cg 223724DNAArtificial
SequenceC-Class oligonucleotide 37tcgtcgtttt acggcgccgt gccg
243823DNAArtificial SequenceC-Class oligonucleotide 38tcgtcgtttt
cggcgcgcgc cgt 233923DNAArtificial SequenceP class CpG
oligonucleotide 39tcgtcgacga tcggcgcgcg ccg 234023DNAArtificial
SequenceP class CpG oligonucleotide 40tcgtcgacga tcggcgcgcg ccg
23
* * * * *
References