U.S. patent application number 17/189368 was filed with the patent office on 2021-08-26 for telomerase reverse transcriptase-based therapies.
This patent application is currently assigned to Fundacion del Sector P blico Estatal Centro Nacional de Investigaciones Oncologicas Carlos III (F.S.. The applicant listed for this patent is Fundacion del Sector P blico Estatal Centro Nacional de Investigaciones Oncologicas Carlos III (F.S., Universitat Aut noma de Barcelona. Invention is credited to Christian Baer, Maria Antonia Blasco Marhuenda, Maria Bobadilla, Fatima Bosch Tubert, Ivan Formentini.
Application Number | 20210260169 17/189368 |
Document ID | / |
Family ID | 1000005579766 |
Filed Date | 2021-08-26 |
United States Patent
Application |
20210260169 |
Kind Code |
A1 |
Bobadilla; Maria ; et
al. |
August 26, 2021 |
TELOMERASE REVERSE TRANSCRIPTASE-BASED THERAPIES
Abstract
The invention provides compositions and methods useful for the
treatment and prevention of conditions associated with short
telomere length.
Inventors: |
Bobadilla; Maria; (Rosenau,
FR) ; Formentini; Ivan; (Hovas, SE) ; Blasco
Marhuenda; Maria Antonia; (Madrid, ES) ; Baer;
Christian; (Hannover, DE) ; Bosch Tubert; Fatima;
(Bellaterra, ES) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Fundacion del Sector P blico Estatal Centro Nacional de
Investigaciones Oncologicas Carlos III (F.S.
Universitat Aut noma de Barcelona |
Madrid
Bellaterra |
|
ES
ES |
|
|
Assignee: |
Fundacion del Sector P blico
Estatal Centro Nacional de Investigaciones Oncologicas Carlos III
(F.S.
Madrid
ES
Universitat Aut noma de Barcelona
Bellaterra
ES
|
Family ID: |
1000005579766 |
Appl. No.: |
17/189368 |
Filed: |
March 2, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15502522 |
Feb 8, 2017 |
|
|
|
PCT/EP2015/067874 |
Aug 4, 2015 |
|
|
|
17189368 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2267/03 20130101;
A01K 2227/105 20130101; A01K 67/0271 20130101; C12Y 207/07049
20130101; A61K 48/0058 20130101; A61K 48/0066 20130101; A01K
67/0276 20130101; A61K 38/45 20130101; C12N 9/1276 20130101; A01K
2267/0381 20130101; A01K 2207/12 20130101; C12N 2750/14145
20130101; A61K 48/005 20130101; A01K 2217/206 20130101; A01K
2217/075 20130101 |
International
Class: |
A61K 38/45 20060101
A61K038/45; A01K 67/027 20060101 A01K067/027; C12N 9/12 20060101
C12N009/12; A61K 48/00 20060101 A61K048/00 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 8, 2014 |
EP |
14382312.8 |
Claims
1.-12. (canceled)
13. A method of treating a condition associated with a disease, the
method comprising: administering a recombinant viral vector
comprising at least a capsid and a nucleic acid comprising a coding
sequence for telomerase reverse transcriptase (TERT) to a subject,
wherein the condition is associated with pulmonary fibrosis.
14. The method of claim 13, wherein TERT is encoded by a nucleic
acid sequence comprising a sequence that is at least 60% identical
to the sequence of SEQ ID NO: 1 or SEQ ID NO: 3.
15. The method of claim 13, wherein TERT comprises an amino acid
sequence that is at least 60% identical to the amino acid sequence
of SEQ ID NO:2 or SEQ ID NO: 4.
16. The method of claim 13, wherein the nucleic acid sequence
encoding TERT is operably linked to a regulatory sequence that
drives the expression of the coding sequence.
17. The method of claim 13, wherein the vector is a non-integrative
vector.
18. The method of claim 13, wherein the vector is an
adeno-associated virus-based non-integrative vector.
19. The method of claim 13, wherein the vector is an
adeno-associated virus-based vector whose capsid is derived from a
serotype 9 adeno-associated virus (AAV9).
20. The method of claim 19, wherein the nucleic acid sequence
packaged in the capsid is flanked at both ends by internal terminal
repeats of the serotype 2 adeno-associated virus.
21. The method of claim 13, wherein the vector comprises a
regulatory sequence which is a constitutive promoter.
22. The method of claim 21, wherein the constitutive promoter is
the cytomegalovirus (CMV) promoter.
23. The method of claim 13, wherein the pulmonary fibrosis is
characterized by mutations in a gene or genes involved in telomere
maintenance.
Description
FIELD OF INVENTION
[0001] This invention falls within the field of molecular biology,
biotechnology and medicine. More particularly, it relates to
compositions and methods useful for the treatment of conditions
associated with short telomere length. More particularly, it
relates to compositions and methods useful for the treatment of
conditions associated with aplastic anemia.
BACKGROUND OF THE INVENTION
[0002] Telomeres are specialized structures at the ends of
chromosomes, which have a role in protecting the chromosome ends
from DNA repair and degrading activities (Blackburn, 2001. Cell
106, 661-673; de Lange, 2005. Genes Dev. 19, 2100-2110) Mammalian
telomeres consist of TTAGGG repeats bound by a multi-protein
complex known as shelterin (de Lange, 2005. Genes Dev. 19,
2100-2110). A minimum length of TTAGGG repeats and the integrity of
the shelterin complex are necessary for telomere protection
(Blackburn, 2001. Cell 106, 661-673; de Lange, 2005. Genes Dev. 19,
2100-2110). Telomerase is a cellular reverse transcriptase (TERT,
telomerase reverse transcriptase; also known as TP2; TRT; EST2;
TCSl; hEST2) capable of compensating telomere attrition through de
novo addition of TTAGGG repeats onto the chromosome ends by using
an associated R A component as template (Terc, telomerase RNA
component) (Greider and Blackburn, 1985. Cell 43, 405-413).
Telomerase is expressed in most adult stem cell compai tments,
however, this is not sufficient to maintain telomere length as
evidenced by the fact that telomere shortening occurs with age in
most human and mouse tissues (Harley et al., 1990. Nature 345,
458-460; Blasco, 2007. Nat Chem Biol. 3, 640-649; Flores et al,
2008. Genes and Dev 22, 654-667).
[0003] Mice carrying homozygous deletion for the TERC gene (the
telomerase RNA component) lack any detectable telomerase activity
and showed progressive telomere shortening from one generation to
the other at a rate comparable to the rate reported in human cells
(Blasco et al., 1997). Severe phenotypes typical of late generation
TERC-/- mice (e.g. bone marrow aplasia and signs of premature
aging) could be rescued by re-introducing a copy of the TERC gene
(Samper et al., 2001). Multiple tissue degeneration arising in
later generations in a conditional mouse model defective for TERT
(the catalytic telomerase subunit) could be reversed upon
telomerase reactivation even in aged mice (Jaskelioff et al.,
2011).
[0004] In the context of wild-type mice, introducing an additional
copy of the telomerase gene, which is expressed in a wide range of
epithelial tissues, led to an increased wound healing capacity of
the skin (Gonzalez-Suarez et al., 2001). When this allele was
introduced in a tumour-resistant genetic background
(Sp53/Sp16/SArf) remarkable delay of aging in concert with an
increased median lifespan of 40% compared to mice not expressing
the telomerase transgene was observed (Tomas-Loba et al.,
2008).
[0005] A virus (AAV) based telomerase gene therapy was found to be
beneficial to extend health span, in the context of normal
physiological aging in wild-type mice. In the study examining this
benefit, adult and aged mice were subjected to AAV9-mTERT gene
therapy to broadly express the catalytic subunit of mouse
telomerase (mTERT). The health span of the TERT treated mice was
significantly increased, and aging was decelerated, as indicated by
a number of physiological parameters (glucose and insulin
tolerance, osteoporosis, neuromuscular coordination, rota-rod,
etc). In addition, their mean lifespan, compared to control groups,
was increased by 24% and 13% in adult an old mice, respectively. A
single intravenous administration of AAV9-TERT in adult mice
resulted in an increase in telomere length in peripheral blood
cells (Bernardes de Jesus et al., 2012).
[0006] Shortened telomeres have been associated with numerous
diseases, such as Dyskeratosis congenita, Aplastic anaemia,
Myelodysplastic Syndrome, and Fanconi anaemia. Given the severity
of these diseases and the poor prognosis of the patients suffering
from them, there is a need for novel therapies to treat diseases
associated with short telomere length.
[0007] Aplastic anemia is a potentially life-threatening, rare and
heterogeneous disorder of the blood in which the bone marrow cannot
produce sufficiently enough new blood cells due to a marked
reduction of immature hematopoietic stem (HSC) and progenitor cells
(Scopes et al., 1994, Maciejewski et al., 1994). Accordingly, the
main disease manifestations are pancytopenia and marrow hypoplasia
which can emerge at any stage of life but are more frequent in
young people (age 10-25 years) and the elderly (>60 years)
(Marsh et al., 2009). Aplastic anemia can be acquired or inherited.
The acquired type is mainly autoimmune-mediated but can also be
triggered by environmental factors such as radiation, toxin and
virus exposure (Nakao, 1997). The congenital form is rarer,
however, mutations in more than 30 genes with functions in DNA
repair, ribosome biogenesis and telomere maintenance pathways have
been identified to date (Dokal & Vulliamy, 2010). A frequently
observed clinical feature of aplastic anemia is short telomere
length in peripheral blood leukocytes even in the absence of
mutations in the telomere maintenance machinery.
[0008] Telomeres, the termini of vertebrate chromosomes are highly
specialised nucleoprotein structures composed of hexanucleotide
(TTAGGG) tandem repeat sequences which are bound by a six protein
complex (TRF1, TRF2, TIN2, RAP1, TPP1 and POT1) termed shelterin
(Blackburn, 2001, de Lange, 2005). These structures are essential
for chromosome integrity by preventing telomere fusions and
telomere fragility. Telomere length is controlled by the
ribonucleoprotein enzyme telomerase which can de novo add telomeric
sequences onto telomeres. Because telomeric sequence is naturally
lost upon every cell division (known as the end replication
problem) and somatic cells express telomerase at very low levels or
not at all telomeres shorten throughout life. When telomeres become
critically short they lose their protective function and a
persistent DNA damage response at the telomeres is triggered which
subsequently leads to a cellular senescence response (Harley et
al., 1990, Flores et al., 2008). HSCs, in contrast to most somatic
cells, show low level of telomerase activity. However, this
activity is insufficient to stop telomere attrition and
consequently the regeneration potential of HSCs cells may become
limited during the aging process (Hiyama & Hiyama, 2007). In
line with this, recipients of bone marrow transplants have shorter
telomere lengths than their donors suggesting that telomerase
cannot cope with increased replicative proliferation demand during
the engraftment phase (Wynn et al., 1998). Moreover, telomeres have
been shown to shorten much faster in patients with aplastic anemia
compared to the normal aging-related attrition found in healthy
individuals potentially owed to a higher than normal number of cell
divisions (Ball et al., 1998).
[0009] Accelerated telomere shortening due to defects in telomere
components or telomerase itself prematurely limits the
proliferation potential of cells which particularly affects the
tissue renewal capacity in stem cell compartments (Harley et al.,
1990, Flores et al., 2005). Thus, tissues with a high proliferative
index such as the hematopoietic system are particularly affected by
lower than normal telomerase levels which can ultimately lead to
severe disorders such as aplastic anemia (Vulliamy et al., 2002).
For instance, the telomeropathy dyskeratosis congenita has been
linked to mutations in 7 genes with important functions in telomere
maintenance (TERT, TERC, DKC1, TIN2, NOP10, NHP2 and TCAB1) and is
characterized by very short telomeres. Dyskeratosis congenita is a
multisystem syndrome comprising diverse clinical features such as
nail dystrophy, oral leucoplakia, abnormal skin pigmentation and
cerebellar hypoplasia (Dokal, 2011). The most severe complication,
however, is the development of aplastic anemia in 80% of the cases
underlining that the clinical features are caused by excessive
telomere shortening which eventually leads to the exhaustion of the
stem cell reserve (Dokal & Vulliamy, 2010).
[0010] The causality between proliferation potential and telomere
length suggests that a therapeutic intervention with telomerase,
aimed at preventing telomere loss beyond a critically short length,
may be a feasible strategy to treat those forms of aplastic anemia
associated with limited blood forming capacity due to the presence
of short telomeres. In this regard, we previously developed a
telomerase (Tert) gene therapy using adeno-associated virus (AAV9)
vectors. Interestingly, telomerase gene therapy using AAV9 Tert in
adult wilt-type mice attenuated or reverted the aging-associated
telomere erosion in peripheral blood monocytes (Bernardes de Jesus
et al., 2012), suggesting that this gene therapy may be effective
in the treatment of hematological disorders related to short
telomeres.
[0011] To test this hypothesis we used our recently generated mouse
model of aplastic anemia which recapitulates the bone marrow
phenotype observed in patients (Beier et al., 2012). In this mouse
model bone marrow specific depletion of the shelterin gene Trfl
cause severe telomere uncapping and provokes a DNA damage response
which in turn leads to a fast clearance of those HSCs and
progenitor cells deficient for Trfl. However, in this model we
induce Trfl deletion at a frequency that does not target 100% of
the HSCs and progenitor cells. Therefore, cells that retain intact
Trfl undergo additional rounds of compensatory proliferation
leading to fast telomere attrition. Thus, partial depletion of the
stem and progenitor cell compartment by Trfl deletion recapitulates
the compensatory hyperproliferation observed after bone marrow
transplantation or in autoimmune-mediated aplastic anemia, as well
as presence of very short telomeres in patients owing to mutations
in telomere maintenance genes. Interestingly, in our mouse model we
can adjust the rate of telomere shortening through the frequency of
Trfl deletion-mediated HSC depletion which allows to control the
onset of bone marrow aplasia and pancytopenia (Beier et al.,
2012).
[0012] In this study we employ this mouse model of aplastic anemia
to investigate whether telomerase activation using state of the art
gene therapy vectors can be an effective treatment to attenuate
telomere attrition and HSC depletion, and thus prevent bone marrow
failure.
SUMMARY
[0013] The invention provides compositions and methods useful for
the treatment and prevention of conditions associated with short
telomere length.
[0014] One aspect of the invention provides a method of treating a
patient with a condition associated with short telomere length
comprising administering to the patient a nucleic acid vector
comprising a coding sequence for telomerase reverse transcriptase
(TERT). In one embodiment, the TERT is encoded by a nucleic acid
sequence comprising a sequence that is at least 90% identical to
the sequence of SEQ ID NO: 1 or SEQ ID NO: 3. In one embodiment,
the TERT is encoded by a nucleic acid sequence comprising the
sequence of SEQ ID NO: 1 or SEQ ID NO: 3. In one embodiment, the
TERT is encoded by a nucleic acid sequence consisting of the
sequence of SEQ ID NO: 1 or SEQ ID NO: 3 In one embodiment, the
TERT comprises an amino acid sequence that is at least 90%
identical to the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:
4. In one embodiment, the TERT comprises an amino acid sequence of
SEQ ID NO:2 or SEQ ID NO: 4. In one embodiment, the TERT consists
of the amino acid sequence of SEQ ID NO:2 or SEQ ID NO: 4. In one
embodiment, the nucleic acid sequence encoding TERT is operably
linked to a regulatory sequence that drives the expression of the
coding sequence. In one embodiment, the vector is a non-integrative
vector, such as an adeno-associated virus-based non-integrative
vector. In one embodiment, the vector is an adeno-associated
virus-based vector derived from a serotype 9 adeno-associated virus
(AAV9). In one embodiment, the capsid of the adeno-associated
virus-based vector is made of capsid proteins of the serotype 9
adeno-associated virus (AAV9), and the nucleic acid sequence
contained in the capsid is flanked at both ends by internal
terminal repeats corresponding to serotype 2 adenoassociated
viruses. In one embodiment, the nucleic acid contained in the
capsid comprises a fragment which encodes the amino acid sequence
coding for TERT. In one embodiment, the vector comprises a
regulatory sequence which is a constitutive promoter. In one
embodiment, the regulatory sequence is the cytomegalovirus (CMV)
promoter. In one embodiment, the condition associated with short
telomere length is characterized by mutations in a gene or genes
involved in telomere maintenance. In one embodiment, the condition
associated with short telomere length is selected from the group
consisting of Dyskeratosis congenita, Aplastic anaemia,
Myelodysplastic Syndrome, Fanconi anaemia.
[0015] In yet further embodiments, the invention is directed to the
following set of subject matters:
[0016] 1. A method of treating a patient with a condition
associated with short telomere length comprising administering to
the patient a nucleic acid vector comprising a coding sequence for
telomerase reverse transcriptase (TERT).
[0017] 2. The method of 1, wherein TERT is encoded by a nucleic
acid sequence comprising a sequence that is at least 90% identical
to the sequence of SEQ ID NO: 1 or SEQ ID NO: 3.
[0018] 3. The method of 1 or 2, wherein TERT is encoded by a
nucleic acid sequence comprising the sequence of SEQ ID NO: 1 or
SEQ ID NO: 3.
[0019] 4. The method of any of 1-3, wherein TERT is encoded by a
nucleic acid sequence consisting of the sequence of SEQ ID NO: 1 or
SEQ ID NO: 3
[0020] 5. The method of any of 1-4, wherein TERT comprises an amino
acid sequence that is at least 90% identical to the amino acid
sequence of SEQ ID NO:2 or SEQ ID NO: 4.
[0021] 6. The method of any of 1-5, wherein TERT comprises an amino
acid sequence of SEQ ID NO:2 or SEQ ID NO: 4.
[0022] 7. The method of any of 1-6, wherein TERT consists of the
amino acid sequence of SEQ ID NO:2 or SEQ ID NO: 4.
[0023] 8. The method of any of 1-7, wherein the nucleic acid
sequence encoding TERT is operably linked to a regulatory sequence
that drives the expression of the coding sequence.
[0024] 9. The method of any of 1-8, wherein the vector is a
non-integrative vector.
[0025] 10. The method of any of 1-9, wherein the vector is an
adeno-associated virus-based non-integrative vector.
[0026] 11. The method of any of 1-10, wherein the vector is an
adeno-associated virus-based vector derived from a serotype 9
adeno-associated virus (AAV9).
[0027] 12. The method of 11, wherein the capsid of the
adeno-associated virus-based vector is made of capsid proteins of
the serotype 9 adeno-associated virus (AAV9), and the nucleic acid
sequence contained in the capsid is flanked at both ends by
internal terminal repeats corresponding to serotype 2
adenoassociated viruses.
[0028] 13. The method of 12, wherein the nucleic acid contained in
the capsid comprises a fragment which encodes the amino acid
sequence coding for TERT.
[0029] 14. The method of any of 1-13, wherein the vector comprises
a regulatory sequence which is a constitutive promoter.
[0030] 15. The method of 14, wherein the regulatory sequence is the
cytomegalovirus (CMV) promoter.
[0031] 16. The method of any of 1-15, wherein the condition
associated with short telomere length is characterized by mutations
in a gene or genes involved in telomere maintenance.
[0032] 17. The method of any of 1-16, wherein the condition
associated with short telomere length is selected from the group
consisting of Dyskeratosis congenita, Aplastic anaemia,
Myelodysplastic Syndrome, Fanconi anaemia, and pulmonary
fibrosis.
[0033] 18. A nucleic acid vector comprising a coding sequence for
telomerase reverse transcriptase (TERT) for use in treating a
condition associated with with short telomere length.
[0034] 19. The nucleic acid vector of 18, wherein TERT is encoded
by a nucleic acid sequence comprising a sequence that is at least
90% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 3.
[0035] 20. The nucleic acid vector of 18 or 19, wherein TERT is
encoded by a nucleic acid sequence comprising the sequence of SEQ
ID NO: 1 or SEQ ID NO: 3.
[0036] 21. The nucleic acid vector of any of 18-20, wherein TERT is
encoded by a nucleic acid sequence consisting of the sequence of
SEQ ID NO: 1 or SEQ ID NO: 3
[0037] 22. The nucleic acid vector of any of 18-21, wherein TERT
comprises an amino acid sequence that is at least 90% identical to
the amino acid sequence of SEQ ID NO:2 or SEQ ID NO: 4.
[0038] 23. The nucleic acid vector of any of 18-22, wherein TERT
comprises an amino acid sequence of SEQ ID NO:2 or SEQ ID NO:
4.
[0039] 24. The nucleic acid vector of any of 18-23, wherein TERT
consists of the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:
4.
[0040] 25. The nucleic acid vector of any of 18-24, wherein the
nucleic acid sequence encoding TERT is operably linked to a
regulatory sequence that drives the expression of the coding
sequence.
[0041] 26. The nucleic acid vector of any of 18-25, wherein the
vector is a non-integrative vector.
[0042] 27. The nucleic acid vector of any of 18-26, wherein the
vector is an adeno-associated virus-based non-integrative
vector.
[0043] 28. The nucleic acid vector of any of 18-27, wherein the
vector is an adeno-associated virus-based vector derived from a
serotype 9 adeno-associated virus (AAV9).
[0044] 29. The nucleic acid vector of 28, wherein the capsid of the
adeno-associated virus-based vector is made of capsid proteins of
the serotype 9 adeno-associated virus (AAV9), and the nucleic acid
sequence contained in the capsid is flanked at both ends by
internal terminal repeats corresponding to serotype 2
adenoassociated viruses.
[0045] 30. The nucleic acid vector of 29, wherein the nucleic acid
contained in the capsid comprises a fragment which encodes the
amino acid sequence coding for TERT.
[0046] 31. The nucleic acid vector of any of 18-30, wherein the
vector comprises a regulatory sequence which is a constitutive
promoter.
[0047] 32. The nucleic acid vector of 31, wherein the regulatory
sequence is the cytomegalovirus (CMV) promoter.
[0048] 33. The nucleic acid vector of any of 18-32, wherein the
condition associated with short telomere length is characterized by
mutations in a gene or genes involved in telomere maintenance.
[0049] 34. The nucleic acid vector of any of 18-33, wherein the
condition associated with short telomere length is selected from
the group consisting of Dyskeratosis congenita, Aplastic anaemia,
Myelodysplastic Syndrome, Fanconi anaemia, and pulmonary
fibrosis.
[0050] 35. The nucleic acid vector of any of 18-34, wherein the
condition associated with short telomere length is dyskeratosis
congenita.
BRIEF DESCRIPTION OF THE FIGURES
[0051] FIG. 1: AAV9-Tert effects on survival (A-C) and blood counts
(D-E)
[0052] FIG. 2: AAV9-Tert effects on telomere length in peripheral
blood (A-C) and bone marrow (D-E)
DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION
[0053] The invention provides compositions and methods useful for
the treatment and prevention of conditions associated with short
telomere length.
[0054] A "condition associated with short telomere length" is one
which is characterized by an accumulation of critically short
telomeres. In certain embodiments, subjects suffering from such a
condition exhibit premature onset of pathologies resulting from a
defective regenerative capacity of tissues.
[0055] In certain embodiments, the condition associated with short
telomere length is characterized by mutations in a gene or genes
involved in telomere maintenance. Specific examples of such
genetically based conditions include, but are not limited to
Dyskeratosis congenita, Aplastic anaemia, Myelodysplastic Syndrome,
Fanconi anaemia, and pulmonary fibrosis.
[0056] Dyskeratosis congenita (DKC) is a genetically heterogeneous
human disease, which is paradigmatic of premature ageing syndromes
(Dokal, 2011). DKC is characterised by the presence of
short/dysfunctional telomeres owing to mutations in genes related
to telomere maintenance, being the most frequently mutated those
encoding proteins of the telomerase complex (i.e. TERT, TERC,
NOP10, DKC1, NHP2) (Dokal, 2011; Dokal and Vulliamy, 2010; Mason
and Bessler, 2011; Savage and Alter, 2008). In addition, a subset
of patients carry mutations in the gene encoding TIN2
(TRF1-interacting protein) a component of the shelterin complex,
which binds and protects mammalian telomeres (Dokal, 2011; Martinez
and Blasco, 2011; Walne et al., 2008). Both a functional telomerase
complex and a proper telomere capping structure by the shelterin
proteins are required for maintenance and capping of chromosome
ends, respectively.
[0057] Clinical features of patients suffering from DKC include
skin abnormalities (i.e. skin hyperpigmentation), signs of
premature aging (i.e. hair greying, nail dystrophy, oral
leucoplakia, etc), predisposition to cancer, and several other
life-threatening conditions, including aplastic anemia and
pulmonary fibrosis (Armanios and Blackburn, 2012). In particular,
tissues with a high proliferative index are most affected due to
the loss of telomeric DNA that occurs upon each cell division. This
explains why DKC patients are particularly vulnerable to impaired
bone marrow function leading to pancytopenia and eventually bone
marrow failure (BMF) (Armanios and Blackburn, 2012; Blasco,
2007)
[0058] Aplastic anaemia, is a life threatening bone marrow disorder
characterised by hypocellular bone marrow and low blood cell
counts. Patients with acquired aplastic anaemia present with
leukocytes which have considerably shorter telomeres than
age-matched healthy individuals (Carroll and Ly, 2009). Aplastic
anaemia is frequently caused by an autoimmune mediated attack
against hematopoietic stem cells. However, recent studies
demonstrated that mutations in the core telomerase components TERT
and TERC are the underlying cause in a clinically relevant
subpopulation (Yamaguchi et al., 2003; Yamaguchi et al., 2005).
Mutations in the core telomerase components TERT and TERC, as well
as in the shelterin component TIN2 have been linked to this disease
(Savage et al., 2006).
[0059] Myelodysplastic Syndrome (MDS) encompasses several bone
marrow diseases characterised by ineffective production of the
myeloid class of blood cells. Caused by progressive bone marrow
failure, similar to DKC, MDS patients often report with severe
anaemia and cytopenias. In approximately one third of the cases the
disease progresses quickly and transforms into acute myelogenous
leukemia (AML) which is particularly resistant to treatment. Even
though shortened telomeres in patients with MDS suggest that
insufficient or hampered telomeric maintenance is causative for the
syndrome, only 3 out of 210 cases showed heterozygous TERC
mutations in a previous study (Yamaguchi et al., 2003). However, a
recently published study clearly circumstantiated the connection
between human telomerase mutations and MDS, aplastic anaemia and
AML. (Holme et al., 2012) reported various families with mutations
of the telomerase components TERC and TERT which e.g. the
grandfather suffered from AML, the daughter from MDS and the
grandson from aplastic anaemia (Holme et al., 2012) emphasising the
close relation of different clinical manifestations with impaired
telomere maintenance.
[0060] Fanconi anaemia (FA) is a heterogeneous genetic disease
caused by mutations in genes involved in DNA repair. Affected
individuals display multiple congenital defects and haematological
deficiencies at a young age of onset (Kee and D'Andrea, 2012).
Manifestations related to the latter however are the predominant
symptoms of this syndrome and as the disease progresses can develop
into the aforementioned syndromes including aplastic anaemia, MDS
and AML. Importantly, patients suffering from FA have been also
shown to present shorter telomeres than normal (Gadalla et al.,
2010). The facts that mutations causing FA show impaired DNA damage
response (DDR) and telomeres are particularly vulnerable to
replicative stress may provide an explanation for the observed
telomere erosion. In support of this Callen et al. (2002) suggested
that in FA patients increased telomere breakage in concert with
replicative shortening account for the observed telomere
shortening.
[0061] Pulmonary fibrosis refers to a condition characterised by
scarring of the lung tissue. Pulmonary fibrosis can be caused by
many factors, including chronic inflammatory processes, infections,
environmental compounds, ionizing radiation (for example radiation
therapy to treat tumors of the chest), chronic medical conditions
(lupus, rheumatoid arthritis). Idiopathic pulmonary fibrosis (IPF)
refers to pulmonary fibrosis without an identifiable cause.
[0062] Accordingly, the invention provides methods of treating a
patient suffering from a condition associated with short telomere
length comprising administering to the patient an agent which
increases the telomere length of the patient. In one embodiment,
the agent prevents degradation of the chromosomal ends. In one
embodiment, the agent increases the activity of telomerase reverse
transcriptase (TERT). In one embodiment, the method of treatment is
a gene therapy method comprises administering to the patient a
nucleic acid vector comprising a coding sequence for telomerase
reverse transcriptase (TERT).
[0063] In certain embodiments, the TERT sequence used in the gene
therapy vector is derived from the same species as the subject. For
example, gene therapy in humans would be carried out using the
human TERT sequence. Gene therapy in mice would be carried out
using the mouse TERT sequence, as described in the examples. In one
embodiment, the TERT is encoded by the nucleic acid sequence as set
forth in SEQ ID NO: 1 or SEQ ID NO: 3 (human TERT variants 1 and
2), or is an active fragment or functional equivalent of SEQ ID NO:
1 or SEQ ID NO: 3. The polypeptide sequence encoded by SEQ ID NO: 1
is set forth in SEQ ID NO: 2. The polypeptide encoded by SEQ ID NO:
3 is set forth in SEQ ID NO: 4. As used herein, "functional
equivalent" refers to a nucleic acid molecule that encodes a
polypeptide that has TERT activity or a polypeptide that has TERT
activity. The functional equivalent may displays 50%, 60%, 70%,
80%, 90%, 95%, 98%, 99%, 100% or more activity compared to TERT
encoded by SEQ ID NO: 1 or SEQ ID NO: 3. Functional equivalents may
be artificial or naturally-occurring. For example,
naturally-occurring variants of the TERT sequence in a population
fall within the scope of functional equivalent. TERT sequences
derived from other species also fall within the scope of the term
"functional equivalent", in particular the murine TERT sequence
given in SEQ ID NO: 5. In a particular embodiment, the functional
equivalent is a nucleic acid with a nucleotide sequence having at
least 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%
identity to SEQ ID NO: 1 or SEQ ID NO: 3. In a further embodiment,
the functional equivalent is a polypeptide with an amino acid
sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%,
99%, 99.5%, 99.9% identity to SEQ ID NO: 2 or SEQ ID NO: 4. In the
case of functional equivalents, sequence identity should be
calculated along the entire length of the nucleic acid. Functional
equivalents may contain one or more, e.g. 2, 3, 4, 5, 10, 15, 20,
30 or more, nucleotide insertions, deletions and/or substitutions
when compared to SEQ ID NO: 1 or SEQ ID NO: 3. The term "functional
equivalent" also encompasses nucleic acid sequences that encode a
TERT polypeptide with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%,
98%, 99%, 99.5%, 99.9% sequence identity to the sequence as set
forth in SEQ ID NO:2 or SEQ ID NO: 4, but that show little homology
to the nucleic acid sequence given in SEQ ID NO: 1 or SEQ ID NO: 3
because of the degeneracy of the genetic code.
[0064] As used herein, the term "active fragment" refers to a
nucleic acid molecule that encodes a polypeptide that has TERT
activity or polypeptide that has TERT activity, but which is a
fragment of the nucleic acid as set forth in SEQ ID NO: 1 or SEQ ID
NO: 3 or the amino acid sequence as set forth in SEQ ID NO: 2 or
SEQ ID NO: 4. An active fragment may be of any size provided that
TERT activity is retained. A fragment will have at least 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 100% identity to SEQ ID
NO: 1-4 along the length of the alignment between the shorter
fragment and SEQ ID NO: 1-4.
[0065] Fusion proteins including these fragments can be comprised
in the nucleic acid vectors needed to carry out the invention. For
example, an additional 5, 10, 20, 30, 40, 50 or even 100 amino acid
residues from the polypeptide sequence, or from a homologous
sequence, may be included at either or both the C terminal and/or N
terminus without prejudicing the ability of the polypeptide
fragment to fold correctly and exhibit biological activity.
[0066] Sequence identity may be calculated by any one of the
various methods in the art, including for example BLAST (Altschul S
F, Gish W, Miller W, Myers E W, Lipman D J (1990). "Basic local
alignment search tool". J Mol Biol 215 (3): 403-410) and FASTA
(Lipman, D J; Pearson, W R (1985). "Rapid and sensitive protein
similarity searches". Science 227 (4693): 1435-41;
http://fasta.bioch.Virginia,edu/fasta_www2/fasta_list2.shtml) and
variations on these alignment programs.
[0067] In one embodiment, the method of treatment is a gene therapy
method and/or the nucleic acid vector used is a gene therapy
vector. Gene therapy methods and vectors are well known in the art
and generally comprise delivering a nucleic acid encoding a
therapeutically active protein to a subject. The nucleic acid may
be delivered in a number of ways including delivering naked DNA
such as plasmid or mini-circles, the use of liposomes or cationic
polymers or other engineered nano-particles containing the nucleic
acid, or viral vectors that encapsidate the nucleic acid.
[0068] In a further embodiment, the gene therapy is achieved using
stable transformation of organisms with an inducible expression
system. Suitable inducible expression systems are known in the art
and include the CRE-LOX recombinase based system which is suitable
for use in mice and tetracycline-regulated which can be used in the
treatment of human subjects.
[0069] In one embodiment the gene therapy vector is a viral vector.
Viral gene therapy vectors are well known in the art. Vectors
include integrative and non-integrative vectors such as those based
on retroviruses, adenoviruses (AdV), adeno-associated viruses
(AAV), lentiviruses, pox viruses, alphaviruses, and herpes
viruses.
[0070] Using non-integrative viral vectors, such as AAV, seems to
be particularly advantageous. In one aspect, this is because
non-integrative vectors do not cause any permanent genetic
modification. Second, the vectors target to adult tissues, avoiding
having the subjects under the effect of constitutive telomerase
expression from early stages of development. Additionally,
non-integrative vectors effectively incorporate a safety mechanism
to avoid over-proliferation of TERT expressing cells. Cells will
lose the vector (and, as a consequence, the telomerase expression)
if they start proliferating quickly.
[0071] Particular examples of suitable non-integrative vectors
include those based on adenoviruses (AdV) in particular gutless
adenoviruses, adeno-associated viruses (AAV), integrase deficient
lentiviruses, pox viruses, alphaviruses, and herpes viruses.
Preferably, the non-integrative vector used in the invention is an
adeno-associated virus-based non-integrative vector, similar to
natural adeno-associated virus particles. AAV preferentially
targets post-mitotic tissues, which are considered more resistant
to cancer than the highly proliferative ones. Examples of
adeno-associated virus-based non integrative vectors include
vectors based on any AAV serotype, i.e. AAV1, AAV2, AAV3, AAV4,
AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and pseudotyped AAV.
Tissue specificity is determined by the capsid serotype.
Pseudotyping of AAV vectors and capsid engineering to alter their
tropism range will likely be important to their use in therapy.
[0072] Vectors derived from adeno-associated viruses (AAVs) have
emerged as one of the vectors of choice for many gene transfer
applications because of their many desirable properties, including
capability to transduce a broad range of tissues at high
efficiency, poor immunogenicity and an excellent safety profile
(Merten, Geny-Fiamma et al. 2005; Buning, Perabo et al. 2008),
toxicity being absent in many preclinical models (Niemeyer, Herzog
et al Blood 2009; Mas, Montane et al Diabetes 2006; Jiang,
Lillicrap et al blood 2006; Ghosh, Yue et al Molecular therapy
2007; Tafuro, Ayuso et al cardiovascular research 2009). AAV
vectors transduce post-mitotic cells and can sustain long-term gene
expression (up to several years) both in small and large animal
models of disease (Niemeyer, Herzog et al Blood 2009; Mas, Montane
et al Diabetes 2006; Jiang, Lillicrap et al blood 2006; Ghosh, Yue
et al Molecular therapy 2007; Tafuro, Ayuso et al cardiovascular
research 2009). Safety and efficacy of AAV gene transfer has been
extensively studied in humans with encouraging results in the
liver, muscle, CNS, and retina (Manno et al Nat medicine 2006,
Stroes et al ATVB 2008, Kaplitt, Feigin, Lancet 2009; Maguire,
Simonelli et al NEJM 2008; Bainbridge et al NEJM 2008).
[0073] AAV2 is the best characterized serotype for gene transfer
studies both in humans and experimental models. AAV2 presents
natural tropism towards skeletal muscles, neurons, vascular smooth
muscle cells and hepatocytes. AAV2 is therefore a good choice of
vector to target these tissues, in particular when using the
methods or vectors of the invention to treat a condition associated
with one of these tissues. For example, treatment of neuromuscular
degeneration may be targeted to skeletal muscle and/or neurons in
this way.
[0074] Newly isolated serotypes, such as AAV7, AAV8, and AAV9 have
been successfully adopted in preclinical studies (Gao, Alvira et al
PNAS 2002). Although limited immunologic responses have been
detected in human subjects treated with AAV2 or AAV1 against the
AAV capsid (Manno et al Nat Med 2006; Mingozzi et al Nat Med 2007;
Brantly et al PNAS 2009; Mingozzi et al blood 2009), long term
expression of the therapeutic gene is possible depending on the
target tissue and the route of administration (Brantly et al PNAS
2009; Simonelli et al mol therapy 2010). In addition, the use of
non-human serotypes, like AAV8 and AAV9, might be useful to
overcome these immunological responses in subjects, and clinical
trials have just commenced (ClinicalTrials.gov Identifier:
NCT00979238). Altogether, these encouraging data suggest that AAV
vectors are useful tools to treat human diseases with a high safety
and efficient profile.
[0075] The choice of adeno-associated viruses of wide tropism, such
as those derived from serotype 9 adeno-associated virus (AAV9) is
particularly advantageous when treating conditions associated with
short telomere length. AAV9 viruses have shown efficient
transduction in a broad range of tissues, with high tropism for
liver, heart and skeletal muscle (Inagaki et al Molecular Therapy
2006) and thus the beneficial effects of gene therapy can be
achieved in more tissues. In addition, AAV9 vectors have the unique
ability to cross the blood-brain-barrier and target the brain upon
intravenous injection in adult mice and cats (Foust et al Nature
biotechnology 2009; Duque et al Molecular therapy et al 2009).
[0076] One aspect of the invention provides a system in which the
capsid (which is the part of the virus which determines the virus
tropism) of the adeno-associated virus-based vector is made of
capsid proteins of the serotype 9 adeno-associated virus (AAV9). In
one embodiment of the viral vectors for use in the invention, the
polynucleotide sequence packed in the capsid is flanked by internal
terminal repeats (ITRs) of an adeno-associated virus, preferably of
serotype 2 which has been extensively characterised in the art, and
presents a coding sequence located between the ITRs. As set out
above, the nucleic acid preferably codes for a functional TERT
polypeptide. In one embodiment, the regulatory sequence operatively
linked to the TERT coding sequence is the cytomegalovirus promoter
(CMV), although other suitable regulatory sequences will be known
to those of skill in the art.
[0077] When treating conditions associated with short telomere
length, it is advantageous to target the treatment to the effected
tissues. The choice of AAV serotype for the capsid protein of the
gene therapy vector may be thus based on the desired site of gene
therapy. If the target tissue is skeletal muscle, for example, in
treating loss of neuromuscular coordination, AAV1- and AAV6-based
viral vectors can be used. Both of these serotypes are more
efficient at trans fecting muscle than other AAV serotypes. AAV3 is
useful for trans fecting haematopoietic cells. A thorough review of
AAV-based vectors for gene therapy can be found in Shi et al,
(2008) "AAV-based targeting gene therapy" Am. J. Immunol.
4:51-65.
[0078] Alternatively, other viral vectors can be used in the
present invention. Any vector compatible with use in gene therapy
can be used in the present invention. Heilbronn & Weger (2010)
Handb Exp Pharmacol. 197: 143-70 provides a review of viral vectors
that are useful in gene therapy. In accordance with all the
previous discussion, vectors comprising a coding sequence for
telomerase reverse transcriptase (TERT) suitable for use in gene
therapy are an important point for putting the invention into
practice. Suitable gene therapy vectors include any kind of
particle that comprises a polynucleotide fragment encoding the
telomerase reverse transcriptase (TERT) protein, operably linked to
a regulatory element such as a promoter, which allows the
expression of a functional TERT protein demonstrating telomerase
reverse transcriptase activity in the targeted cells. Preferably,
TERT is encoded by the nucleic acid sequence as set forth in SEQ ID
NO: 1 or SEQ ID NO: 3, or is an active fragment or functional
equivalent of TERT.
[0079] The term gene therapy vector includes within its scope naked
DNA molecules such as plasmids or mini-circles, i.e. circular DNA
molecules which do not contain bacterial DNA sequences, provided
that the TERT coding sequence and its linked regulatory element are
inserted in the plasmid, as well as to more complicated systems,
such as particles with the structure of virions (viral particles),
comprising at least a capsid and at least a polynucleotide
sequence, with a size that allows the polynucleotide sequence to be
packed within the capsid in a manner similar to that of the native
genome of the virus of origin of the capsid. The polynucleotide
sequence must include a region where the TERT coding sequence and
its linked regulatory element are inserted such that the telomerase
reverse transcriptase protein can be expressed from that
polynucleotide sequence once the viral particle has infected a
cell.
[0080] In one embodiment, the gene therapy vector suitable for
being used in the invention is a non-integrative vector, such as an
adeno-associated virus-based non-integrative vector. For the
purposes of the invention, the choice of non-integrative vectors
seems to be particularly advantageous, because they do not cause
any permanent genetic modification. Also, as stated before, such
vectors incorporate a safety mechanism to avoid over-proliferation
of TERT expressing cells that will lose the vector if the cells
start proliferating quickly.
[0081] Adeno-associated virus-based vectors derived from a serotype
9 adeno-associated virus (AAV9) are preferred because the
beneficial effects can be achieved in more tissues (see above). In
one particularly preferred embodiment, the regulatory sequence
operatively linked to the TERT coding sequence is the
cytomegalovirus promoter (CMV). The nucleic acid sequence encoding
TERT is operably linked to a regulatory sequence that drives the
expression of the coding sequence. As used herein, the term
"regulatory element" means a nucleic acid sequence that serves as a
promoter, i.e., regulates expression of a nucleic acid sequence
operably linked to the promoter. Such "regulatory elements" or
"promoters" can control the expression of linked nucleic acid
sequences either constitutively or inducible.
[0082] The regulatory sequence may be a constitutive promoter. An
example of a regulatory sequence which is a constitutive promoter
is the cytomegalovirus (CMV) promoter.
[0083] The expression of TERT following gene therapy according to
the invention persists for a time of several months to several
years. In mice, TERT expression was detectable after 5 months. In
monkey, gene expression following gene therapy with an AAV-based
vector has been detected up to 6 years after treatment and up to 8
years in dogs (Rivera et al Blood 2005, and Niemeyer et al blood
2009). Frequent repetition of treatment using the methods and
vectors of the invention is therefore not necessary. In one
embodiment of the invention, the subject is treated once. In an
alternative embodiment, the subject is treated initially, and is
then treated again once TERT expression levels decrease by about
50% of those attained immediately following treatment. Treatment
may be repeated with the same or alternative vector to maintain the
reduction in age-related disorders if necessary, for example
annually, or once every 5 years or once a decade. When
administering a second or subsequent dose, it may be necessary to
use a different gene therapy vector, for example when using an
AAV-based vector the second and subsequent administrations may be a
vector with a capsid derived from a different serotype than that
used for the first administration. It is possible that a subject
may develop neutralising antibodies to the first gene therapy
vector, making it ineffective if administered a second or
subsequent time (Amado et al (2010) Science Translational Medicine
2(21):21ra16).
[0084] The methods of treatment of the invention have the effect of
treating and/or preventing conditions associated with short
telomere length. In a further aspect, therefore, the invention
refers to a gene therapy method or the use of a nucleic acid vector
as described above, for use in the treatment or prevention in a
subject of condition associated with short telomere length,
including but not limited to genetically based conditions such as
Dyskeratosis congenita, Aplastic anaemia, Myelodysplastic Syndrome,
Fanconi anaemia, and pulmonary fibrosis.
[0085] The effectiveness of treatment of the conditions associated
with short telomere length can be measured by various methods known
in the art. In one embodiment, the effectiveness of the treatment
is measured by an increase in lifespan of a treated patient
suffering from a condition associated with short telomere length as
compared to the expected lifespan of an untreated patient suffering
from the same condition. In certain embodiments, the lifespan is
extended by 5%, 10%, 15%, 20% or more, with reference to the
expected lifespan for a patient suffering from the same
condition.
[0086] In one embodiment, the effectiveness of the treatment is
measured by a delayed or prevented bone marrow failure in a treated
patient suffering from a condition associated with short telomere
as compared to the expected onset of bone marrow failure in an
untreated patient suffering from the same condition. In certain
embodiments, the delay in the onset of bone marrow failure of a
treated patient suffering from a condition associated with short
telomere length is extended by 5%, 10%, 15%, 20% or more, with
reference to the expected onset of bone marrow failure for an
untreated patient suffering from the same condition.
[0087] In one embodiment, the effectiveness of the treatment is
measured by an increase in overall fitness of a treated patient
suffering from a condition associated with short telomere length
treated as compared to the overall fitness of an untreated patient
suffering from the same condition. Overall fitness can be
determined by measuring physical attributes associated with the
particular condition. Examples of such physical attributes include
skin abnormalities (such as skin hyperpigmentation), premature
aging (such as hair greying, nail dystrophy, oral leucoplakia), and
anaemic pallor. Dokal, I. 2011. Hematology Am Soc Hematol Educ
Program, 480-486. Thus an increase in overal fitness can be
determined by a decrease in physical attributes associated with the
particular condition exhibited by the treated patient. Overall
fitness can also be measure by determining the blood count of the
patient. In one embodiment, increased overall fitness is measured
by determining the amount of leukocytes, lymphocytes, thrombocytes
in a peripheral blood sample. Higher blood count indicates an
increased overall fitness. In certain embodiments, the blood count
in a treated patient is increased by 5%, 10%, 15%, 20% or more,
with reference to the blood count of an untreated patient suffering
from the same condition.
[0088] The efficacy of the treatment can also be measured by
directly determining telomere length in sample taken from the
patient. Telomere length can be measured, for example, by using
standard hybridization techniques, such as fluorescence in situ
hybridization (FISH), Quantitative Fluorescent in situ
hybridization (Q-FISH), or High Throughput Quantitative Fluorescent
in situ hybridization (HT Q-FISH). (Gonzalez-Suarez, Samper et al.
2001) in a sample taken from the patient, Samples suitable for
telomere analysis include bone marrow tissue and blood samples.
Telomere length can also be measured as described in Slagboom et al
or Canela et al. (2007, PNAS 104:5300-5305).
[0089] In a particular embodiment, samples are taken from the
patient undergoing treatment throughout the course of the treatment
so that both absolute telomere length and the rate of telomere
shortening over the course of treatment can be determined. Samples
may be taken every day during the course of treatment, or at longer
intervals. In one embodiment, samples are taken once a week, once
every two week, once every three weeks, once every 4 weeks, once
every five weeks, once every six weeks or longer.
[0090] Comparison of telomere length can be measured by a comparing
the proportion of short telomeres in a sample taken from a patient.
In one embodiment, the proportion of short telomeres is the
fraction of telomeres presenting an intensity below the mean
intensity of the sample as measured by a in situ hybridization
technique, such as FISH or Q-FISH. In embodiment, the proportion of
short telomeres is the fraction of telomeres presenting an
intensity 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40% or more below the
mean intensity of the sample. In one particular embodiment, the
proportion of short telomeres is the fraction of telomeres
presenting an intensity 50% or more below the mean intensity of the
sample.
[0091] In another embodiments, the proportion of short telomeres is
the fraction of telomeres below a certain length, e.g. 8 kb, 7 kb,
6 kb, 5 kb, or shorter In one embodiment, the proportion of short
telomeres is the fraction of telomeres 8 kb or shorter. In another
embodiment, the proportion of short telomeres is the fraction of
telomeres 7 kb or shorter. In another embodiment, the proportion of
short telomeres is the fraction of telomeres 6 kb or shorter. In
another embodiment, the proportion of short telomeres is the
fraction of telomeres 5 kb or shorter. In another embodiment, the
proportion of short telomeres is the fraction of telomeres 4 kb or
shorter. In another embodiment, the proportion of short telomeres
is the fraction of telomeres 3 kb or shorter.
[0092] In one embodiment, the effectiveness of the treatment is
measured by a decrease in the proportion of short telomeres in
sample taken from a treated patient suffering from a condition
associated with short telomere length as compared to a control
sample. In one embodiment, the proportion of short telomeres in a
sample taken from a treated patient is decreased by 10%, 20%, 30%,
40%, 50%, 60%, 70%, or greater as compared to a control sample. In
one embodiment, the control sample is a sample taken from the same
patient prior to the treatment, or taken at an earlier stage of the
treatment. In another embodiment, the control sample is a sample
taken from a patient suffering from the same condition and not
provided the treatment.
[0093] In a further aspect, the invention is applied to the subject
by administering a pharmaceutical composition comprising an
effective amount of any one of the gene therapy vectors compatible
with the invention described above.
[0094] A "pharmaceutical composition" is intended to include the
combination of an active agent with a carrier, inert or active,
making the composition suitable for diagnostic or therapeutic use
in vitro, in vivo or ex vivo.
[0095] "Composition" is intended to mean a combination of active
agent and another compound or composition, inert (for example, a
detectable agent or label) or active. An "effective amount" is an
amount sufficient to effect beneficial or desired results. An
effective amount can be administered in one or more
administrations, applications or dosages.
[0096] They will usually include components in addition to the
active component (such as the gene therapy vector) e.g. they
typically include one or more pharmaceutical carrier(s) and/or
excipient(s). A thorough discussion of such components is available
in Gennaro (2000) Remington: The Science and Practice of Pharmacy.
20th edition, ISBN: 0683306472.
[0097] Compositions will generally be administered to a subject in
aqueous form. Prior to administration, however, the composition may
have been in a non-aqueous form. For instance, although some viral
vectors are manufactured in aqueous form, then filled and
distributed and administered also in aqueous form, other viral
vectors are lyophilised during manufacture and are reconstituted
into an aqueous form at the time of use. Thus a composition of the
invention may be dried, such as a lyophilised formulation. The
composition may include preservatives such as thiomersal or
2-phenoxyethanol. It is preferred, however, that the composition
should be substantially free from (i.e. less than 5 .mu.g/mi)
mercurial material e.g. thiomersal-free.
[0098] To control tonicity, it is preferred to include a
physiological salt, such as a sodium salt. Sodium chloride (NaCl)
is preferred, which may be present at between 1 and 20 mg/ml e.g.
about 10+2 mg/ml NaCl. Other salts that may be present include
potassium chloride, potassium dihydrogen phosphate, disodium
phosphate dehydrate, magnesium chloride, calcium chloride, etc.
[0099] Compositions will generally have an osmolality of between
200 mOsm/kg and 400 mOsm/kg, preferably between 240-360 mOsm/kg,
and will more preferably fall within the range of 290-310
mOsm/kg.
[0100] Compositions may include one or more buffers. Typical
buffers include: a phosphate buffer; a Tris buffer; a borate
buffer; a succinate buffer; a histidine buffer (particularly with
an aluminum hydroxide adjuvant); or a citrate buffer. Buffers will
typically be included in the 5-20 mM range.
[0101] The composition may include material for a single
administration, or may include material for multiple
administrations (i.e. a `multidose` kit). The inclusion of a
preservative is preferred in multidose arrangements. As an
alternative (or in addition) to including a preservative in
multidose compositions, the compositions may be contained in a
container having an aseptic adaptor for removal of material.
[0102] Compositions of the invention for use in humans are
typically administered in a dosage volume of about 0.5 ml, although
a half dose (i.e. about 0.25 ml) may be administered to
children.
[0103] As well as methods of treatment described herein, the
invention also provides a nucleic acid sequence encoding a TERT for
use in therapy. The invention also provides a nucleic acid vector
comprising a coding sequence for telomerase reverse transcriptase
(TERT), for use in a method of therapy and a gene therapy vector
comprising a coding sequence for telomerase reverse transcriptase
(TERT), for use in a method of therapy. In particular, the therapy
may be treating or preventing a condition associated with short
telomere length. As described for methods of treatment, the TERT
nucleic acid sequence may be the sequence as recited in SEQ ID NO:
1 or SEQ ID NO: 3 or a fragment or functional equivalent thereof.
The TERT protein may have a sequence as recited in SEQ ID NO: 2 or
SEQ ID NO: 4, or a fragment or functional equivalent thereof.
[0104] The term "patient" refers to a mammal. In certain
embodiments the patient is a rodent, primate, ungulate, cat, dog,
or other domestic pet or domesticated mammal. In certain
embodiments, the mammal is a mouse, rat, rabbit, pig, horse, sheep,
cow, domestic cat or dog, or a human. In a preferred embodiment,
the patient is a human.
[0105] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, the descriptions and examples should not be
construed as limiting the scope of the invention. The disclosures
of all patent and scientific literature cited herein are expressly
incorporated in their entirety by reference.
EXAMPLES
Example 1 Mouse Model for Dyskeratosis Congenita
[0106] Mice of C57B6 background that are homozygous carrier of a
conditional TRF1 transgene (TRF and further are transgenic for the
Cre-recombinase under the control of the endogenous and
interferon-inducible Mx1 promoter will be used to test the efficacy
of the telomerase gene therapy to treat Dyskeratosis congenital
(DKC). To exclusively study the effects of TRF1 ablation in the
hematopoietic compartment bone marrow will be transplanted from
these mice into irradiated wild-type mice as described previously
(Beier et al., 2012). One month after transplantation the mice will
be injected via their tail vein with 4.times.10.sup.12 AAV9 genomes
carrying the mTERT cDNA under the control of the potent
cytomegalovirus promoter (for virus production, see below 3.3). By
analogy, empty AAV9 lacking the telomerase gene will be injected
into a control group. Furthermore, to follow the viral tropism and
transgene expression over time, a separate group of animals will be
injected with AAV9-eGFP. One week after the virus infection TRF1
deletion in the bone marrow will be induced by long-term
polyinosinic-polycytidylic acid (pI:pC) treatment with
intraperitoneal injections every third day. pI:pC acts as
immunostimulant and activates Cre expression which in turn leads to
TRF1 deletion in approximately 50% of hematopoietic cells (upon
each injection) with the above mentioned consequences (see 2). In
contrast to pI:pC treatment, animal groups previously infected with
AAV9-mTERT and AAV9-empty will not undergo pI:pC treatment to serve
as additional control cohorts.
[0107] With this experimental design the dramatic telomere
shortening, owed to compensatory proliferation in the remaining
hematopoietic cells which have not lost TRF1, by ectopic expression
of telomerase, will be reduced. The strongest measure to assess the
effectiveness of the gene therapy is an extended life span by
virtue of delayed or prevented bone marrow failure (end point of
experiment=death of animals). Furthermore, successful telomerase
treatment should show improvements with regards to overall fitness
of the animals, i.e. no skin abnormalities and no anaemic pallor.
The latter goes hand in hand with higher blood counts (leukocytes,
lymphocytes, thrombocytes), which will be determined from
peripheral blood samples. The efficacy of telomerase expression on
the molecular level will include telomere length measurements. To
so Q-FISH analysis from bone marrow tissue sections and high
throughput Q-FISH analysis from peripheral blood samples will be
performed. For the second, blood will be taken every three to four
weeks throughout the course of the experiment. In this way not only
absolute telomere length, but also the rate of telomere shortening
over time can be determined. Moreover, attenuated or abolished
replicative senescence and exhaustion of stem and progenitor cells
in the hematopoietic compartment will be monitored by assessment of
common senescent markers such as beta-galactosidase activity and
p21 protein levels. These markers as well as .gamma.H2AX and
phospho-CHK1, molecular markers for replicative stress, can then be
correlated with telomere length and survival of the animals.
Example 2 Production of Viruses
[0108] AAV based viral vectors for transduction will be generated
by triple transfection of HEK293T cells as described in (Matsushita
et al., 1998). Briefly, to 80% confluence grown cells are
co-transfected with plasmids (1) carrying the expression cassette
flanked by the AAV9 viral ITRs, (2) a helper plasmid carrying the
AAV rep2 and cap9 genes, and (3) a plasmid carrying the adenovirus
helper functions. The expression cassettes harbour murine TERT
under the control of CMV promoter plus 3'-UTR (AAV9-mTERT), CMV
promoter (AAV9-empty) alone and eGFP under the control of CMV
promoter and SV40 polyA signal (AAV9-eGFP). Vectors are purified
following an optimised method based on two consecutive cesium
chloride gradients (Ayuso et al., 2010). Titres of viral genomes
particles are determined by quantitative real time PCR. Viruses can
be stably kept at -80.degree. C. until infection of animals.
Example 3 Telomere Analysis
[0109] Telomere Q-FISH Analysis on Paraffin Sections
[0110] Q-FISH determination on paraffin-embedded tissue sections
mice are hybridized with a PNA-telomeric probe, and fluorescence
intensity of telomeres are determined as described
(Gonzalez-Suarez, Samper et al. 2001). Quantitative image analysis
is performed using the Definiens Developer Cell software (version
XD 1.2; Definiens AG). For statistical analysis a two-tailed
Student t test is used to assess significance (GraphPad Prism
software).
[0111] Quantitative Real-Time RT-PCR
[0112] Total RNA from tissues is extracted with Trizol (Life
Technologies). RNA samples are DNase I treated and are used as
template for a reverse transcription reaction using random primers
and Superscript Reverse Transcriptase (Life
[0113] Technologies), according to the manufacturer's guidelines.
Quantitative real-time PCR is performed using an ABI
[0114] PRISM 7700 (Applied Biosystems), using DNA Master SYBR Green
I mix (Applied Biosystems).
TABLE-US-00001 The primers: Actin-For: (SEQ ID NO: 7)
GGCACCACACCTTCTACAATG; Actin-Rev: (SEQ ID NO: 8)
GTGGTGGTGAAGCTGTAG; TERT-For: (SEQ ID NO: 9) GGATTGCCACTGGCTCCG;
TERT-Rev: (SEQ ID NO: 10) TGCCTGACCTCCTCTTGTGAC. p16-For: (SEQ ID
NO: 11) CGTACCCCGATTCAGGTGAT p16-Rev: (SEQ ID NO: 12)
TTGAGCAGAAGAGCTGCTACGT Axin2-For: (SEQ ID NO: 13)
GGCAAAGTGGAGAGGATCGAC Axin2-Rev: (SEQ ID NO: 14) TCGTGGCTGTTGCGTAGG
Cyclin D1 - For: (SEQ ID NO: 15) TGCGCCCTCCGTATCTTAC Cyclin D1 -
Rev: (SEQ ID NO: 16) ATCTTAGAGGCCACGAACATGC CD44 - For: (SEQ ID NO:
17) CAGCCTACTGGAGATCAGGATGA CD44 - Rev: (SEQ ID NO: 18)
GGAGTCCTTGGATGAGTCTCGA KIf4 - For: (SEQ ID NO: 19)
GCGAACTCACACAGGCGAGAAACC KIf4 - Rev: (SEQ ID NO: 20)
TCGCTTCCTCTTCCTCCGACACA Tieg1 - For: (SEQ ID NO: 21)
CCCATTGCCCCTGCTCCTG Tieg1 - Rev: (SEQ ID NO: 22)
TGTGTCCGCCGGTGTCTGG
[0115] Statistical analyses (Student's t-test) is performed on the
Ct values as described before (Munoz, Blanco et al. 2005).
Example 4 Telomerase Gene Therapy in Aplastic Anemia
[0116] Mice and Animal Procedures
[0117] Mice were of pure C57/BL6 background and were produced and
housed at the specific pathogen-free (SPF) animal house of the CNIO
in Madrid, Spain. Trfl.sup.lox/lox Mx1-Cre and Trfl.sup.lox/lox
Mx1-wt mice were generated previously described (Martinez et al.,
2009) ENREF 20. For bone marrow transplantation 10 weeks old
Trfl.sup.lox/lox Mx1-Cre mice were used as bone marrow donors for
transplantation into 8 weeks old lethally (12Gy) irradiated
wild-type mice as previously described (Beier et al., 2012, Samper
et al., 2002). A total of 2 million cells were transplanted via
tail vein injection at a donor:recipient ratio of 1:8 and mice were
left for a latency period of 30 days to allow bone marrow
reconstitution. To induce Cre expression, mice were
intraperitoneally injected with polyinosinic-polycytidylic acid
(pI:pC; Sigma-Aldrich) (15 ug/g body weight) 3 times per week for a
total duration of 5 weeks. Mice were left for an additional week
before they were randomly assigned to two groups for the treatment
with AAV9-Tert or AAV9-empty gene therapy vectors. Vectors were
administered via tail vein injection at a concentration of
4.times.10E12 viral genomes per mouse.
[0118] Gene Therapy Vector Production
[0119] Viral vectors were generated as described previously
(Matsushita et al., 1998) and purified described in (Ayuso et al.,
2010). Briefly, vectors were produced through triple transfection
of HEK293T. Cells were grown in roller bottles (Corning, N.Y., USA)
in Dulbecco's Modified Eagle's Medium supplemented with FBS (10%
v/v) to 80% confluence and then co-transfected with: plasmid-1
carrying the expression cassette for gene of interest flanked by
the AAV2 viral ITRs; plasmid-2 carrying the AAV rep2 and cap9
genes; plasmid-3 carrying the adenovirus helper functions (plasmids
were kindly provided by K. A. High, Children's Hospital of
Philadelphia). Expression cassettes were under the control of the
cytomegalovirus (CMV) promoter and contained a SV40 polyA signal
for EGFP and the CMV promoter and the 3'UTR of the Tert gene as
polyA signal for Tert. AAV9 particles were purified following an
optimized method using two caesium chloride gradients, dialysed
against PBS, filtered and stored at -80.degree. C. until use (Ayuso
et al., 2010). Viral genomes particles titres were determined by a
standardized quantitative real time PCR method (Ayuso et al., 2014)
and primers specific for the CMV sequence:
TABLE-US-00002 CMV-Forward: (SEQ ID NO: 23)
5'-CAATTACGGGGTCATTAGTTCATAGC; CMV-Reverse: (SEQ ID NO: 24)
5'-ATACGTAGATGTACTGCCAAGTAGGA.
[0120] Histology
[0121] Bone marrow samples (sternum or tibia bone) were fixed in
phosphate-buffered 4% formaldehyde and bones after decalcification
paraffin embedded. 5 .mu.m tissue sections were stained with
Hematoxylin-Eosin for histological bone marrow assessment
Immunohistochemistry was performed on deparaffinized tissues
sections. After antigen retrieval samples were processed with the
anti-EGFP antibodies (rabbit anti-EGFP, 1:200; Abcam, ab290). EGFP
positive cells were counted in a semi automated way using ImageJ
software.
[0122] FACS Sorting
[0123] For sorting of HSCs whole bone marrow cells were extracted
from the long bones (femur & tibia) as previously described
(Samper et al., 2002). Erythrocytes were lysed by incubating cells
for 10 min in 10 ml erythrocyte lysis buffer (Roche), washed once
with 10 ml PBS, and resuspended in FACS buffer (PBS, 2 mM EDTA,
0.3% BSA) containing Fc-block (1:400) at a concentration of
5-10.times.10{circumflex over ( )}6 cell/100 .mu.l. Cells were
incubated for 10 min and washed once in FACS buffer. Cells were
then resuspended in FACS buffer at 20-25.times.10{circumflex over (
)}6 cell/ml and the antibody cocktail was added as follows:
Anti-sca-1-PerCP-Cy5.5 (1:200), lin cocktail-eFluor450 (1:50) (all
eBioscience), and anti-c-kit-APC-H7 (1:100) (BD Pharmingen). Cells
were incubated for 30 min. After washing cells twice with PBS, 2 L
of DAPI (200 g/mL) was added and cells were subsequently sorted in
a FACS ARIA IIu (Becton Dickinson, San Jose, Calif.) into HSCs (lin
negatice, scal and c-kit positive) and lineage positive (lin
positive) fractions.
[0124] Colony Forming Assay
[0125] Short-term colony-forming assay (CFA) was performed by
plating 1.times.10.sup.4 and 2.times.10.sup.4 freshly isolated
mononucleated bone marrow cells (erythrocytes were lysed as
described above) in 35-mm dishes (StemCell Technologies) containing
Methocult (methylcellulose-based) media (StemCell Technologies) as
described in the manufacturer's protocol. All experiments were
performed in duplicates and the numbers of colonies formed were
counted after 12 days incubation at 37.degree. C.
[0126] Blood Counts
[0127] Peripheral blood was drawn from the facial vein (.about.50
.mu.l) and collected into anti-coagulation tubes (EDTA). Blood
counts were determined using an Abacus Junior Vet veterinary
hematology analyzer.
[0128] Quantitative Real-Time PCR and Western Blots
[0129] Total RNA from whole bone marrow extracts or FACS sorted
bone marrow cells was isolated using Qiagen's RNeasy mini kit
according to the manufacturer protocol. The optional DNaseI digest
was always performed. Quantitative real-time PCR was performed
using an ABI PRISM 7700 or QuantStudio 6 Flex (both Applied
Biosystems). Primers sequences for Tert and reference genes Act1
and TBP are as follows:
TABLE-US-00003 Tert-Forward (SEQ ID NO: 9) 5'GGATTGCCACTGGCTCCG;
Tert-Reverse (SEQ ID NO: 10) 5'TGCCTGACCTCCTCTTGTGAC; Actin-Forward
(SEQ ID NO: 7) 5'GGCACCACACCTTCTACAATG; Actin-Reverse (SEQ ID NO:
8) 5'GTGGTGGTGAAGCTGTAG; TBP-Forward (SEQ ID NO: 25)
5'CTTCCTGCCACAATGTCACAG; TBP-Reverse (SEQ ID NO: 26)
5'CCTTTCTCATGCTTGCTTCTCTG.
[0130] Q-FISH Telomere Analysis
[0131] Q-FISH analysis on bone marrow tissues sections was
performed as described previously (Samper et al., 2000). Briefly,
tissues sections were post fixed in 4% formaldehyde for 5 min,
washed 3.times.5 min in PBS and incubated at 37.degree. C. for 15
min in pepsin solution (0.1% Porcine Pepsin, Sigma; 0.01M HCl,
Merck). Washes and fixation was repeated and slides dehydrated in a
70%-90%-100% ethanol series (5 min each). Slides were 10 min
air-dried and 30 .mu.l of telomere probe mix added to each slide
(10 mM TrisCl pH 7, 25 mM MgCl2, 9 mM citric acid, 82 mM Na2HPO4,
70% deionized formamide (Sigma), 0.25% blocking reagent (Roche) and
0.5 mg/ml Telomeric PNA probe (Panagene)), a cover slip added and
slides incubated for 3 min at 85.degree. C., and 2 h at room
temperature in a wet chamber in the dark. Slides were washed
2.times.15 min in 10 mM TrisCl pH 7, 0.1% BSA in 70% formamide
under vigorous shaking, then 3.times.5 min in TBS 0.08% Tween20,
and then incubated in a 40,6-diamidino-2-phenylindole (DAPI) bath
(4 mg/ml 1 DAPI (Sigma) in PBS). Samples were mounted in
Vectashield (Vector.TM.). Confocal image were acquired as stacks
every 0.5 .mu.m for a total of 1.5 .mu.m using a Leica SP5-MP
confocal microscope and maximum projections were done with the
LAS-AF software. Telomere signal intensity was quantified using
Definiens software.
[0132] High throughput (HT)-Q-FISH on peripheral blood leukocytes
was done as described (Canela et al., 2007a). Briefly, 120-150
.mu.l of blood were extracted from the facial vein. Erythrocytes
were lysed (Erythrocyte lysis buffer, Qiagen) and 30-90 k
leukocytes were plated in duplicate into clear-bottom, black-walled
96-well plates pre-coated for 30 min with 0.001% poly-L-lysine.
Plates were incubated at 37.degree. C. for 2 h and fixed with
methanol/acetic acid (3:1, v/v) 2.times.10 min and overnight at
-20.degree. C. Fixative was removed, plates dried for at least 1 h
at 37.degree. C. and samples were rehydrated in PBS. Plates were
then subjected to a standard Q-FISH protocol (see above) using a
telomere-specific PNA-CY3 probe; DAPI was used to stain nuclei.
Sixty images per well were captured using the OPERA (Perkin Elmer)
High-Content Screening system. TL values were analysed using
individual telomere spots (>10,000 telomere spots per sample).
The average fluorescence intensities of each sample were converted
into kilobase using L5178-R and L5178-S cells as calibration
standards, which have stable TLs of 79.7 and 10.2 kb, respectively.
Samples were analyzed in duplicate.
[0133] AAV9-Tert Targets Bone Marrow and Hematopoietic Stem
Cells
[0134] First, we set out to address the capability of AAV9 vectors
to transduce the bone marrow upon intra-venous injection by using
both a AAV9-EGFP reporter virus, which allows determination of the
location and percentage of AAV9-transduced cells, as well as by
determining Tert mRNA expression in vivo in different bone marrow
cell populations following AAV9-Tert treatment. To this end, we
first injected wild-type mice with AAV9-EGFP particles at a
concentration of 3.5E12 viral genomes per mouse through tail vein
injections Immunohistochemistry analysis of bone marrow section
with specific anti-EGFP antibodies revealed 2% positive EGFP
expressing cells in the middle bone sections and this was increased
up to 10% in the regions adjacent to the joints, which were the
ones showing the highest AAV9-transduction. We then injected
wild-type mice with the same amount of AAV9-Tert particles and
determined Tert mRNA expression by RT-PCR in whole bone marrow
isolates at two weeks and 8 months after virus injection. As soon
as two weeks post-treatment with the AAV9 vectors, we found
increased Tert mRNA expression in the AAV9-Tert treated mice
compared to those treated with the AAV9 empty vector and this
difference was maintained still 8 months after initial treatment.
We then studied Tert mRNA expression specifically in the
blood-forming cells of the bone marrow. To this end, we performed
FACS sorting of c-kit and Sca-1 positive HSCs cells and
lin-positive lineage committed cells. We found a significant
increase in both HSCs (10 fold) and lineage committed bone marrow
cells (3.5 fold) in Tert mRNA in AAV9-Tert treated mice compared to
mice treated with the empty vector, demonstrating that bone marrow
cells including HSCs cells are targeted by Tert gene therapy. Given
that we achieved increased Tert expression in HSCs, we next
addressed whether this affected their stem cell potential. To this
end, we performed a colony forming cell assay (MethoCult)
Interestingly, we observed significantly increased number of
colonies in the AAV9-Tert mice compared to the empty vector
controls.
[0135] In summary these data suggest that AAV9 administered at a
high dose can target hematopoietic cells and that these enhances
the proliferation capacity of those cells.
[0136] AAV9-Tert Treatment in a Mouse Model of Aplastic Anemia
Rescues Survival
[0137] We next tested whether treatment with AAV9-Tert is effective
in increasing survival upon induction of lethal aplastic anemia
owing to critically short telomeres (Beier et al., 2012). In
particular, we used a conditional Trfl mouse model recently
developed by us in which we lethally irradiate wild-type mice and
transplant them with bone marrow isolated from Trfl.sup.lox/lox
Mx1-Cre mice to exclusively study the effects on bone marrow. Trfl
deletion can be induced by administration of pl:pC and subsequent
expression of the Cre recombinase (Beier et al., 2012). Cells
depleted for Trfl die and are rapidly removed from the bone marrow,
while cells that remain with intact Trfl undergo compensatory
rounds of cell division which leads to rapid telomere shortening,
follow by replicative senescence and finally results in bone marrow
failure. In the specific experimental settings here we induced Trfl
deletion by injecting mice 3 times per week with pI:pC for a total
period of 5 weeks, at which point these mice start showing signs of
aplastic anemia (Beier et al., 2012). One week after we stopped the
induction of Trfl deletion, mice were subjected to gene therapy
treatment with AAV9-Tert or AAV9-empty control vectors. We
monitored the survival of these mice for 100 days following the
treatment with the AAV9 vectors. Strikingly, AAV9-Tert treatment
drastically improved survival (87%) compared with mice treated with
the empty vector (55%) (FIG. 1A). In particular, while only 4 mice
injected with AAV9-Tert developed aplastic anemia during this time
(13%), 16 mice of the control group (44%) died with clear signs of
aplastic anemia (FIG. 1B,C). In agreement with the anemic
appearance blood count analysis from these mice (blood drawn from
AAV9-empty and AAV9-Tert upon sacrificing) showed a drastic drop in
platelet count and haemoglobin level compared with mice without
signs of aplastic anemia (FIG. 1D, E). Post mortem histopathologic
analysis of bone marrow sections from mice that died during the
first 100 days further confirmed the aplastic anemia phenotype. In
particular, mice presented with severe bone marrow hypo- and
aplasia in 2 or all 3 blood lineages. While the diagnosis at the
point of death in both groups was marrow bone failure and aplasia
the phenotype appeared milder in the AAV9-Tert group compared with
the AAV9-empty group as seen by higher bone marrow cellularity.
[0138] Our results suggest that AAV9-Tert gene therapy
significantly reduces aplastic anemia mortality by preventing the
loss of blood forming hematopoietic cells.
[0139] Telomerase Treatment Leads to Telomere Elongation in
Peripheral Blood and Bone Marrow
[0140] Because the aplastic anemia phenotype in our mouse model is
caused by the loss of telomeres, we next compared telomere length
in mice treated with telomerase to mice receiving the control
vector. First we used HT-Q-FISH technology (Canela et al., 2007b)
to follow telomere length in peripheral blood monocytes in a
longitudinal manner. To do so, we extracted blood at 4 different
time points; after bone marrow engraftment (1), after pI:pC
treatment (2), 2 months after AAV9 injection (3) and 4 months after
AAV9 injection (4). As expected we found that telomere length
between time point 1 and 2 in both groups drops by approximately 10
kb which is owed to the pI:pC treatment. While telomere length in
the AAV9-empty group between time point 2 and 4 continuous to
slightly shorten, AAV9-Tert treatment led to a net increase in
average telomere of 10 kb (FIG. 2A,B). Throughout the course of
this experiment AAV9-empty treated mice showed an average telomere
length loss of 12 kb, whereas in AAV9-Tert treated mice telomeres
were re-elongated to similar levels as before the pI:pC treatment
(FIG. 2C). Next we performed Q-FISH analysis on bone marrow
cross-sections. In agreement with longer telomere length in
peripheral blood we found that AAV9-Tert treated mice had
significantly longer telomeres compared with empty vector treated
mice (FIG. 2D, E).
REFERENCES
[0141] Armanios, M. (2012). An emerging role for the conserved
telomere component 1 (CTC1) in human genetic disease. Pediatr Blood
Cancer 59, 209-210. [0142] Armanios, M., and Blackburn, E. H.
(2012). The telomere syndromes. Nature reviews. Genetics 13,
693-704. [0143] Ayuso, E., Mingozzi, F., Montane, J., Leon, X.,
Anguela, X. M., Haurigot, V., Edmonson, S. A., Africa, L., Zhou,
S., High, K. A., et al. (2010). High AAV vector purity results in
serotype- and tissue-independent enhancement of transduction
efficiency. Gene therapy 17, 503-510. [0144] Beier, F., Foronda,
M., Martinez, P., and Blasco, M. A. (2012). Conditional TRF1
knockout in the hematopoietic compartment leads to bone marrow
failure and recapitulates clinical features of Dyskeratosis
congenita. Blood. [0145] Bernardes de Jesus, B., Vera, E.,
Schneeberger, K., Tejera, A. M., Ayuso, E., Bosch, F., and Blasco,
M. A. (2012). Telomerase gene therapy in adult and old mice delays
aging and increases longevity without increasing cancer. EMBO
molecular medicine 4, 691-704. [0146] Bernardes de Jesus de Jesus,
B. and Blasco, M. A, (2013). Telomerase at the intersection of
cancer and aging. Trends Genet. 29, 513-520. [0147] Blasco, M. A.
(2007). Telomere length, stem cells and aging. Nature chemical
biology 3, 640-649. [0148] Blasco, M. A., Lee, H. W., Hande, M. P.,
Samper, E., Lansdorp, P. M., DePinho, R. A., and Greider, C. W.
(1997). Telomere shortening and tumor formation by mouse cells
lacking telomerase RNA. Cell 91, 25-34. [0149] Buning, H., Perabo,
L., Coutelle, O., Quadt-Humme, S., and Hallek, M. (2008). Recent
developments in adeno-associated virus vector technology. The
journal of gene medicine 10, 717-733. [0150] Calado, R. T.,
Yewdell, W. T., Wilkerson, K. L., Regal, J. A., Kajigaya, S.,
Stratakis, C. A., and Young, N. S. (2009). Sex hormones, acting on
the TERT gene, increase telomerase activity in human primary
hematopoietic cells. Blood 114, 2236-2243. [0151] Callen, E.,
Samper, E., Ramirez, M. J., Creus, A., Marcos, R., Ortega, J. J.,
Olive, T., Badell, I., Blasco, M. A., and Surralles, J. (2002).
Breaks at telomeres and TRF2-independent end fusions in Fanconi
anemia. Hum Mol Genet 11, 439-444. [0152] Carroll, K. A., and Ly,
H. (2009). Telomere dysfunction in human diseases: the long and
short of it! International journal of clinical and experimental
pathology 2, 528-543. [0153] Dokal, I. (2011). Dyskeratosis
congenita. Hematology/the Education Program of the American Society
of Hematology. American Society of Hematology. Education Program
2011, 480-486. [0154] Dokal, I., and Vulliamy, T. (2010). Inherited
bone marrow failure syndromes. Haematologica 95, 1236-1240. [0155]
Duque, S., Joussemet, B., Riviere, C., Marais, T., Dubreil, L.,
Douar, A. M., Fyfe, J., Moullier, P., Colle, M. A., and Barkats, M.
(2009). Intravenous administration of self-complementary AAV9
enables transgene delivery to adult motor neurons. Molecular
therapy: the journal of the American Society of Gene Therapy 17,
1187-1196. [0156] Foust, K. D., Nurre, E., Montgomery, C. L.,
Hernandez, A., Chan, C. M., and Kaspar, B. K. (2009). Intravascular
AAV9 preferentially targets neonatal neurons and adult astrocytes.
Nat Biotechnol 27, 59-65. [0157] Gadalla, S. M., Cawthon, R., Giri,
N., Alter, B. P., and Savage, S. A. (2010). Telomere length in
blood, buccal cells, and fibroblasts from patients with inherited
bone marrow failure syndromes. Aging (Albany N. Y.) 2, 867-874.
[0158] Gao, G. P., Alvira, M. R., Wang, L., Calcedo, R., Johnston,
J., and Wilson, J. M. (2002). Novel adeno-associated viruses from
rhesus monkeys as vectors for human gene therapy. Proc Natl Acad
Sci USA 99, 11854-11859. [0159] Gonzalez-Suarez, E., Samper, E.,
Ramirez, A., Flores, J. M., Martin-Caballero, J., Jorcano, J. L.,
and Blasco, M. A. (2001). Increased epidermal tumors and increased
skin wound healing in transgenic mice overexpressing the catalytic
subunit of telomerase, mTERT, in basal keratinocytes. EMBO J 20,
2619-2630. [0160] Herrera, E., Samper, E., Martin-Caballero, J.,
Flores, J. M., Lee, H. W., and Blasco, M. A. (1999). Disease states
associated with telomerase deficiency appear earlier in mice with
short telomeres. EMBO J 18, 2950-2960. [0161] Holme, H., Hossain,
U., Kirwan, M., Walne, A., Vulliamy, T., and Dokal, I. (2012).
Marked genetic heterogeneity in familial myelodysplasia/acute
myeloid leukaemia. British journal of haematology 158, 242-248.
[0162] Inagaki, K., Fuess, S., Storm, T. A., Gibson, G. A.,
McTiernan, C. F., Kay, M. A., and Nakai, H. (2006). Robust systemic
transduction with AAV9 vectors in mice: efficient global cardiac
gene transfer superior to that of AAV8. Molecular therapy: the
journal of the American Society of Gene Therapy 14, 45-53. [0163]
Jaime-Perez, J. C., Colunga-Pedraza, P. R., Gomez-Ramirez, C. D.,
Gutierrez-Aguirre, C. H., Cantu-Rodriguez, O. G., Tarin-Arzaga, L.
C., and Gomez-Almaguer, D. (2011). Danazol as first-line therapy
for aplastic anemia. Annals of hematology 90, 523-527. [0164]
Jaskelioff, M., Muller, F. L., Paik, J. H., Thomas, E., Jiang, S.,
Adams, A. C., Sahin, E., Kost-Alimova, M., Protopopov, A.,
Cadinanos, J., et al. (2011). Telomerase reactivation reverses
tissue degeneration in aged telomerase-deficient mice. Nature 469,
102-106. [0165] Jiang, H., Lillicrap, D., Patarroyo-White, S., Liu,
T., Qian, X., Scallan, C. D., Powell, S., Keller, T., McMurray, M.,
Labelle, A., et al. (2006). Multiyear therapeutic benefit of AAV
serotypes 2, 6, and 8 delivering factor VIII to hemophilia A mice
and dogs. Blood 108, 107-115. [0166] Kaplitt, M. G. (2009). Gene
therapy clinical trials in the human brain. Protocol development
and review of current applications. Frontiers of neurology and
neuroscience 25, 180-188. [0167] Kee, Y., and D'Andrea, A. D.
(2012). Molecular pathogenesis and clinical management of Fanconi
anemia. J Clin Invest 122, 3799-3806. [0168] Lee, H. W., Blasco, M.
A., Gottlieb, G. J., Horner, J. W., 2nd, Greider, C. W., and
DePinho, R. A. (1998). Essential role of mouse telomerase in highly
proliferative organs. Nature 392, 569-574. [0169] Maguire, A. M.,
Simonelli, F., Pierce, E. A., Pugh, E. N., Jr., Mingozzi, F.,
Bennicelli, J., Banfi, S., Marshall, K. A., Testa, F., Surace, E.
M., et al. (2008). Safety and efficacy of gene transfer for Leber's
congenital amaurosis. The New England journal of medicine 358,
2240-2248. [0170] Manno, C. S., Pierce, G. F., Arruda, V. R.,
Glader, B., Ragni, M., Rasko, J. J., Ozelo, M. C., Hoots, K.,
Blatt, P., Konkle, B., et al. (2006). Successful transduction of
liver in hemophilia by AAV-Factor IX and limitations imposed by the
host immune response. Nature medicine 12, 342-347. [0171] Martinez,
P., and Blasco, M. A. (2011). Telomeric and extra-telomeric roles
for telomerase and the telomere-binding proteins. Nature reviews.
Cancer 11, 161-176. [0172] Mas, A., Montane, J., Anguela, X. M.,
Munoz, S., Douar, A. M., Riu, E., Otaegui, P., and Bosch, F.
(2006). Reversal of type 1 diabetes by engineering a glucose sensor
in skeletal muscle. Diabetes 55, 1546-1553. [0173] Mason, P. J.,
and Bessler, M. (2011). The genetics of dyskeratosis congenita.
Cancer genetics 204, 635-645. [0174] Matsushita, T., Elliger, S.,
Elliger, C., Podsakoff, G., Villarreal, L., Kurtzman, G. J., Iwaki,
Y., and Colosi, P. (1998). Adeno-associated virus vectors can be
efficiently produced without helper virus. Gene therapy 5, 938-945.
[0175] Mavilio, F. (2012). Gene therapies need new development
models. Nature 490, 7. [0176] Niemeyer, G. P., Herzog, R. W.,
Mount, J., Arruda, V. R., Tillson, D. M., Hathcock, J., van Ginkel,
F. W., High, K. A., and Lothrop, C. D., Jr. (2009). Long-term
correction of inhibitor-prone hemophilia B dogs treated with
liver-directed AAV2-mediated factor IX gene therapy. Blood 113,
797-806. [0177] O'Reilly, M., Shipp, A., Rosenthal, E., Jambou, R.,
Shih, T., Montgomery, M., Gargiulo, L., Patterson, A., and
Corrigan-Curay, J. (2012). NIH oversight of human gene transfer
research involving retroviral, lentiviral, and adeno-associated
virus vectors and the role of the NIH recombinant DNA advisory
committee. Methods in enzymology 507, 313-335. [0178] Samper, E.,
Flores, J. M., and Blasco, M. A. (2001). Restoration of telomerase
activity rescues chromosomal instability and premature aging in
Terc-/- mice with short telomeres. EMBO Rep 2, 800-807. [0179]
Savage, S. A., and Alter, B. P. (2008). The role of telomere
biology in bone marrow failure and other disorders. Mechanisms of
ageing and development 129, 35-47. [0180] Savage, S. A., Calado, R.
T., Xin, Z. T., Ly, H., Young, N. S., and Chanock, S. J. (2006).
Genetic variation in telomeric repeat binding factors 1 and 2 in
aplastic anemia. Experimental hematology 34, 664-671. [0181]
Stroes, E. S., Nierman, M. C., Meulenberg, J. J., Franssen, R.,
Twisk, J., Henny, C. P., Maas, M. M., Zwinderman, A. H., Ross, C.,
Aronica, E., et al. (2008). Intramuscular administration of
AAV1-lipoprotein lipase S447X lowers triglycerides in lipoprotein
lipase-deficient patients. Arteriosclerosis, thrombosis, and
vascular biology 28, 2303-2304. [0182] Tafuro, S., Ayuso, E.,
Zacchigna, S., Zentilin, L., Moimas, S., Dore, F., and Giacca, M.
(2009). Inducible adeno-associated virus vectors promote functional
angiogenesis in adult organisms via regulated vascular endothelial
growth factor expression. Cardiovascular research 83, 663-671.
[0183] Tomas-Loba, A., Flores, I., Fernandez-Marcos, P. J.,
Cayuela, M. L., Maraver, A., Tejera, A., Borras, C., Matheu, A.,
Klatt, P., Flores, J. M., et al. (2008). Telomerase reverse
transcriptase delays aging in cancer-resistant mice. Cell 135,
609-622. [0184] Walne, A. J., Vulliamy, T., Beswick, R., Kirwan,
M., and Dokal, I. (2008). TINF2 mutations result in very short
telomeres: analysis of a large cohort of patients with dyskeratosis
congenita and related bone marrow failure syndromes. Blood 112,
3594-3600. [0185] Yamaguchi, H., Baerlocher, G. M., Lansdorp, P.
M., Chanock, S. J., Nunez, O., Sloand, E., and Young, N. S. (2003).
Mutations of the human telomerase RNA gene (TERC) in aplastic
anemia and myelodysplastic syndrome. Blood 102, 916-918. [0186]
Yamaguchi, H., Calado, R. T., Ly, H., Kajigaya, S., Baerlocher, G.
M., Chanock, S. J., Lansdorp, P. M., and Young, N. S. (2005).
Mutations in TERT, the gene for telomerase reverse transcriptase,
in aplastic anemia. The New England journal of medicine 352,
1413-1424. [0187] Ziegler, P., Schrezenmeier, H., Akkad, J.,
Brassat, U., Vankann, L., Panse, J., Wilop, S., Balabanov, S.,
Schwarz, K., Martens, U. M., and Brummendorf, T. H. (2012).
Telomere elongation and clinical response to androgen treatment in
a patient with aplastic anemia and a heterozygous hTERT gene
mutation. Annals of hematology 91, 1115-1120. [0188] Ayuso, E., V.
Blouin, M. Lock, S. McGorray, X. Leon, M. R. Alvira, A. Auricchio,
S. Bucher, A. Chtarto, K. R. Clark, C. Darmon, M. Doria, W.
Fountain, G. Gao, K. Gao, M. Giacca, J. Kleinschmidt, B. Leuchs, C.
Melas, H. Mizukami, M. Muller, Y. Noordman, O. Bockstael, K. Ozawa,
C. Pythoud, M. Sumaroka, R. Surosky, L. Tenenbaum, I. Van der
Linden, B. Weins, J. F. Wright, X. Zhang, L. Zentilin, F. Bosch, R.
O. Snyder & P. Moullier, (2014) Manufacturing and
Characterization of a Recombinant Adeno-Associated Virus Type 8
Reference Standard Material. Hum Gene Ther. [0189] Ayuso, E., F.
Mingozzi, J. Montane, X. Leon, X. M. Anguela, V. Haurigot, S. A.
Edmonson, L. Africa, S. Zhou, K. A. High, F. Bosch & J. F.
Wright, (2010) High AAV vector purity results in serotype- and
tissue-independent enhancement of transduction efficiency. Gene
Ther 17: 503-510. [0190] Ball, S. E., F. M. Gibson, S. Rizzo, J. A.
Tooze, J. C. Marsh & E. C. Gordon-Smith, (1998) Progressive
telomere shortening in aplastic anemia. Blood 91: 3582-3592. [0191]
Beier, F., M. Foronda, P. Martinez & M. A. Blasco, (2012)
Conditional TRF1 knockout in the hematopoietic compartment leads to
bone marrow failure and recapitulates clinical features of
Dyskeratosis congenita. Blood. [0192] Bernardes de Jesus, B., E.
Vera, K. Schneeberger, A. M. Tejera, E. Ayuso, F. Bosch & M. A.
Blasco, (2012) Telomerase gene therapy in adult and old mice delays
aging and increases longevity without increasing cancer. EMBO Mol
Med 4: 1-14. [0193] Blackburn, E. H., (2001) Switching and
signaling at the telomere. Cell 106: 661-673. [0194] Canela, A., P.
Klatt & M. A. Blasco, (2007a) Telomere length analysis. Methods
Mol Biol 371: 45-72. [0195] Canela, A., E. Vera, P. Klatt & M.
A. Blasco, (2007b) High-throughput telomere length quantification
by FISH and its application to human population studies. Proc Natl
Acad Sci USA 104: 5300-5305. [0196] de Lange, T., (2005) Shelterin:
the protein complex that shapes and safeguards human telomeres.
Genes Dev 19: 2100-2110. [0197] Dokal, I., (2011) Dyskeratosis
congenita. Hematology Am Soc Hematol Educ Program 2011: 480-486.
[0198] Dokal, I. & T. Vulliamy, (2010) Inherited bone marrow
failure syndromes. Haematologica 95: 1236-1240. [0199] Flores, I.,
A. Canela, E. Vera, A. Tejera, G. Cotsarelis & M. A. Blasco,
(2008) The longest telomeres: a general signature of adult stem
cell compartments. Genes Dev 22: 654-667. [0200] Flores, I., M. L.
Cayuela & M. A. Blasco, (2005) Effects of telomerase and
telomere length on epidermal stem cell behavior. Science 309:
1253-1256. [0201] Harley, C. B., A. B. Futcher & C. W. Greider,
(1990) Telomeres shorten during ageing of human fibroblasts. Nature
345: 458-460. [0202] Hiyama, E. & K. Hiyama, (2007) Telomere
and telomerase in stem cells. Br J Cancer 96: 1020-1024. [0203]
Maciejewski, J. P., S. Anderson, P. Katevas & N. S. Young,
(1994) Phenotypic and functional analysis of bone marrow progenitor
cell compartment in bone marrow failure. Br J Haematol 87: 227-234.
[0204] Marsh, J. C., S. E. Ball, J. Cavenagh, P. Darbyshire, I.
Dokal, E. C. Gordon-Smith, J. Keidan, A. Laurie, A. Martin, J.
Mercieca, S. B. Killick, R. Stewart & J. A. Yin, (2009)
Guidelines for the diagnosis and management of aplastic anaemia. Br
J Haematol 147: 43-70. [0205] Martinez, P., M. Thanasoula, P.
Munoz, C. Liao, A. Tejera, C. McNees, J. M. Flores, O.
Fernandez-Capetillo, M. Tarsounas & M. A. Blasco, (2009)
Increased telomere fragility and fusions resulting from TRF1
deficiency lead to degenerative pathologies and increased cancer in
mice. Genes Dev 23: 2060-2075. [0206] Matsushita, T., S. Elliger,
C. Elliger, G. Podsakoff, L. Villarreal, G. J. Kurtzman, Y. Iwaki
& P. Colosi, (1998) Adeno-associated virus vectors can be
efficiently produced without helper virus. Gene Ther 5: 938-945.
[0207] Nakao, S., (1997) Immune mechanism of aplastic anemia. Int J
Hematol 66: 127-134. [0208] Samper, E., P. Fernandez, R. Eguia, L.
Martin-Rivera, A. Bernad, M. A. Blasco & M. Aracil, (2002)
Long-term repopulating ability of telomerase-deficient murine
hematopoietic stem cells. Blood 99: 2767-2775. [0209] Samper, E.,
F. A. Goytisolo, P. Slijepcevic, P. P. van Buul
& M. A. Blasco, (2000) Mammalian Ku86 protein prevents
telomeric fusions independently of the length of TTAGGG repeats and
the G-strand overhang. EMBO Rep 1: 244-252. [0210] Scopes, J., M.
Bagnara, E. C. Gordon-Smith, S. E. Ball & F. M. Gibson, (1994)
Haemopoietic progenitor cells are reduced in aplastic anaemia. Br J
Haematol 86: 427-430. [0211] Vulliamy, T., A. Marrone, I. Dokal
& P. J. Mason, (2002) Association between aplastic anaemia and
mutations in telomerase RNA. Lancet 359: 2168-2170. [0212] Wynn, R.
F., M. A. Cross, C. Hatton, A. M. Will, L. S. Lashford, T. M.
Dexter & N. G. Testa, (1998) Accelerated telomere shortening in
young recipients of allogeneic bone-marrow transplants. Lancet 351:
178-181.
Sequence CWU 1
1
2614018DNAHomo sapiens 1caggcagcgc tgcgtcctgc tgcgcacgtg ggaagccctg
gccccggcca cccccgcgat 60gccgcgcgct ccccgctgcc gagccgtgcg ctccctgctg
cgcagccact accgcgaggt 120gctgccgctg gccacgttcg tgcggcgcct
ggggccccag ggctggcggc tggtgcagcg 180cggggacccg gcggctttcc
gcgcgctggt ggcccagtgc ctggtgtgcg tgccctggga 240cgcacggccg
ccccccgccg ccccctcctt ccgccaggtg tcctgcctga aggagctggt
300ggcccgagtg ctgcagaggc tgtgcgagcg cggcgcgaag aacgtgctgg
ccttcggctt 360cgcgctgctg gacggggccc gcgggggccc ccccgaggcc
ttcaccacca gcgtgcgcag 420ctacctgccc aacacggtga ccgacgcact
gcgggggagc ggggcgtggg ggctgctgct 480gcgccgcgtg ggcgacgacg
tgctggttca cctgctggca cgctgcgcgc tctttgtgct 540ggtggctccc
agctgcgcct accaggtgtg cgggccgccg ctgtaccagc tcggcgctgc
600cactcaggcc cggcccccgc cacacgctag tggaccccga aggcgtctgg
gatgcgaacg 660ggcctggaac catagcgtca gggaggccgg ggtccccctg
ggcctgccag ccccgggtgc 720gaggaggcgc gggggcagtg ccagccgaag
tctgccgttg cccaagaggc ccaggcgtgg 780cgctgcccct gagccggagc
ggacgcccgt tgggcagggg tcctgggccc acccgggcag 840gacgcgtgga
ccgagtgacc gtggtttctg tgtggtgtca cctgccagac ccgccgaaga
900agccacctct ttggagggtg cgctctctgg cacgcgccac tcccacccat
ccgtgggccg 960ccagcaccac gcgggccccc catccacatc gcggccacca
cgtccctggg acacgccttg 1020tcccccggtg tacgccgaga ccaagcactt
cctctactcc tcaggcgaca aggagcagct 1080gcggccctcc ttcctactca
gctctctgag gcccagcctg actggcgctc ggaggctcgt 1140ggagaccatc
tttctgggtt ccaggccctg gatgccaggg actccccgca ggttgccccg
1200cctgccccag cgctactggc aaatgcggcc cctgtttctg gagctgcttg
ggaaccacgc 1260gcagtgcccc tacggggtgc tcctcaagac gcactgcccg
ctgcgagctg cggtcacccc 1320agcagccggt gtctgtgccc gggagaagcc
ccagggctct gtggcggccc ccgaggagga 1380ggacacagac ccccgtcgcc
tggtgcagct gctccgccag cacagcagcc cctggcaggt 1440gtacggcttc
gtgcgggcct gcctgcgccg gctggtgccc ccaggcctct ggggctccag
1500gcacaacgaa cgccgcttcc tcaggaacac caagaagttc atctccctgg
ggaagcatgc 1560caagctctcg ctgcaggagc tgacgtggaa gatgagcgtg
cgggactgcg cttggctgcg 1620caggagccca ggggttggct gtgttccggc
cgcagagcac cgtctgcgtg aggagatcct 1680ggccaagttc ctgcactggc
tgatgagtgt gtacgtcgtc gagctgctca ggtctttctt 1740ttatgtcacg
gagaccacgt ttcaaaagaa caggctcttt ttctaccgga agagtgtctg
1800gagcaagttg caaagcattg gaatcagaca gcacttgaag agggtgcagc
tgcgggagct 1860gtcggaagca gaggtcaggc agcatcggga agccaggccc
gccctgctga cgtccagact 1920ccgcttcatc cccaagcctg acgggctgcg
gccgattgtg aacatggact acgtcgtggg 1980agccagaacg ttccgcagag
aaaagagggc cgagcgtctc acctcgaggg tgaaggcact 2040gttcagcgtg
ctcaactacg agcgggcgcg gcgccccggc ctcctgggcg cctctgtgct
2100gggcctggac gatatccaca gggcctggcg caccttcgtg ctgcgtgtgc
gggcccagga 2160cccgccgcct gagctgtact ttgtcaaggt ggatgtgacg
ggcgcgtacg acaccatccc 2220ccaggacagg ctcacggagg tcatcgccag
catcatcaaa ccccagaaca cgtactgcgt 2280gcgtcggtat gccgtggtcc
agaaggccgc ccatgggcac gtccgcaagg ccttcaagag 2340ccacgtctct
accttgacag acctccagcc gtacatgcga cagttcgtgg ctcacctgca
2400ggagaccagc ccgctgaggg atgccgtcgt catcgagcag agctcctccc
tgaatgaggc 2460cagcagtggc ctcttcgacg tcttcctacg cttcatgtgc
caccacgccg tgcgcatcag 2520gggcaagtcc tacgtccagt gccaggggat
cccgcagggc tccatcctct ccacgctgct 2580ctgcagcctg tgctacggcg
acatggagaa caagctgttt gcggggattc ggcgggacgg 2640gctgctcctg
cgtttggtgg atgatttctt gttggtgaca cctcacctca cccacgcgaa
2700aaccttcctc aggaccctgg tccgaggtgt ccctgagtat ggctgcgtgg
tgaacttgcg 2760gaagacagtg gtgaacttcc ctgtagaaga cgaggccctg
ggtggcacgg cttttgttca 2820gatgccggcc cacggcctat tcccctggtg
cggcctgctg ctggataccc ggaccctgga 2880ggtgcagagc gactactcca
gctatgcccg gacctccatc agagccagtc tcaccttcaa 2940ccgcggcttc
aaggctggga ggaacatgcg tcgcaaactc tttggggtct tgcggctgaa
3000gtgtcacagc ctgtttctgg atttgcaggt gaacagcctc cagacggtgt
gcaccaacat 3060ctacaagatc ctcctgctgc aggcgtacag gtttcacgca
tgtgtgctgc agctcccatt 3120tcatcagcaa gtttggaaga accccacatt
tttcctgcgc gtcatctctg acacggcctc 3180cctctgctac tccatcctga
aagccaagaa cgcagggatg tcgctggggg ccaagggcgc 3240cgccggccct
ctgccctccg aggccgtgca gtggctgtgc caccaagcat tcctgctcaa
3300gctgactcga caccgtgtca cctacgtgcc actcctgggg tcactcagga
cagcccagac 3360gcagctgagt cggaagctcc cggggacgac gctgactgcc
ctggaggccg cagccaaccc 3420ggcactgccc tcagacttca agaccatcct
ggactgatgg ccacccgccc acagccaggc 3480cgagagcaga caccagcagc
cctgtcacgc cgggctctac gtcccaggga gggaggggcg 3540gcccacaccc
aggcccgcac cgctgggagt ctgaggcctg agtgagtgtt tggccgaggc
3600ctgcatgtcc ggctgaaggc tgagtgtccg gctgaggcct gagcgagtgt
ccagccaagg 3660gctgagtgtc cagcacacct gccgtcttca cttccccaca
ggctggcgct cggctccacc 3720ccagggccag cttttcctca ccaggagccc
ggcttccact ccccacatag gaatagtcca 3780tccccagatt cgccattgtt
cacccctcgc cctgccctcc tttgccttcc acccccacca 3840tccaggtgga
gaccctgaga aggaccctgg gagctctggg aatttggagt gaccaaaggt
3900gtgccctgta cacaggcgag gaccctgcac ctggatgggg gtccctgtgg
gtcaaattgg 3960ggggaggtgc tgtgggagta aaatactgaa tatatgagtt
tttcagtttt gaaaaaaa 401821132PRTHomo sapiens 2Met Pro Arg Ala Pro
Arg Cys Arg Ala Val Arg Ser Leu Leu Arg Ser1 5 10 15His Tyr Arg Glu
Val Leu Pro Leu Ala Thr Phe Val Arg Arg Leu Gly 20 25 30Pro Gln Gly
Trp Arg Leu Val Gln Arg Gly Asp Pro Ala Ala Phe Arg 35 40 45Ala Leu
Val Ala Gln Cys Leu Val Cys Val Pro Trp Asp Ala Arg Pro 50 55 60Pro
Pro Ala Ala Pro Ser Phe Arg Gln Val Ser Cys Leu Lys Glu Leu65 70 75
80Val Ala Arg Val Leu Gln Arg Leu Cys Glu Arg Gly Ala Lys Asn Val
85 90 95Leu Ala Phe Gly Phe Ala Leu Leu Asp Gly Ala Arg Gly Gly Pro
Pro 100 105 110Glu Ala Phe Thr Thr Ser Val Arg Ser Tyr Leu Pro Asn
Thr Val Thr 115 120 125Asp Ala Leu Arg Gly Ser Gly Ala Trp Gly Leu
Leu Leu Arg Arg Val 130 135 140Gly Asp Asp Val Leu Val His Leu Leu
Ala Arg Cys Ala Leu Phe Val145 150 155 160Leu Val Ala Pro Ser Cys
Ala Tyr Gln Val Cys Gly Pro Pro Leu Tyr 165 170 175Gln Leu Gly Ala
Ala Thr Gln Ala Arg Pro Pro Pro His Ala Ser Gly 180 185 190Pro Arg
Arg Arg Leu Gly Cys Glu Arg Ala Trp Asn His Ser Val Arg 195 200
205Glu Ala Gly Val Pro Leu Gly Leu Pro Ala Pro Gly Ala Arg Arg Arg
210 215 220Gly Gly Ser Ala Ser Arg Ser Leu Pro Leu Pro Lys Arg Pro
Arg Arg225 230 235 240Gly Ala Ala Pro Glu Pro Glu Arg Thr Pro Val
Gly Gln Gly Ser Trp 245 250 255Ala His Pro Gly Arg Thr Arg Gly Pro
Ser Asp Arg Gly Phe Cys Val 260 265 270Val Ser Pro Ala Arg Pro Ala
Glu Glu Ala Thr Ser Leu Glu Gly Ala 275 280 285Leu Ser Gly Thr Arg
His Ser His Pro Ser Val Gly Arg Gln His His 290 295 300Ala Gly Pro
Pro Ser Thr Ser Arg Pro Pro Arg Pro Trp Asp Thr Pro305 310 315
320Cys Pro Pro Val Tyr Ala Glu Thr Lys His Phe Leu Tyr Ser Ser Gly
325 330 335Asp Lys Glu Gln Leu Arg Pro Ser Phe Leu Leu Ser Ser Leu
Arg Pro 340 345 350Ser Leu Thr Gly Ala Arg Arg Leu Val Glu Thr Ile
Phe Leu Gly Ser 355 360 365Arg Pro Trp Met Pro Gly Thr Pro Arg Arg
Leu Pro Arg Leu Pro Gln 370 375 380Arg Tyr Trp Gln Met Arg Pro Leu
Phe Leu Glu Leu Leu Gly Asn His385 390 395 400Ala Gln Cys Pro Tyr
Gly Val Leu Leu Lys Thr His Cys Pro Leu Arg 405 410 415Ala Ala Val
Thr Pro Ala Ala Gly Val Cys Ala Arg Glu Lys Pro Gln 420 425 430Gly
Ser Val Ala Ala Pro Glu Glu Glu Asp Thr Asp Pro Arg Arg Leu 435 440
445Val Gln Leu Leu Arg Gln His Ser Ser Pro Trp Gln Val Tyr Gly Phe
450 455 460Val Arg Ala Cys Leu Arg Arg Leu Val Pro Pro Gly Leu Trp
Gly Ser465 470 475 480Arg His Asn Glu Arg Arg Phe Leu Arg Asn Thr
Lys Lys Phe Ile Ser 485 490 495Leu Gly Lys His Ala Lys Leu Ser Leu
Gln Glu Leu Thr Trp Lys Met 500 505 510Ser Val Arg Asp Cys Ala Trp
Leu Arg Arg Ser Pro Gly Val Gly Cys 515 520 525Val Pro Ala Ala Glu
His Arg Leu Arg Glu Glu Ile Leu Ala Lys Phe 530 535 540Leu His Trp
Leu Met Ser Val Tyr Val Val Glu Leu Leu Arg Ser Phe545 550 555
560Phe Tyr Val Thr Glu Thr Thr Phe Gln Lys Asn Arg Leu Phe Phe Tyr
565 570 575Arg Lys Ser Val Trp Ser Lys Leu Gln Ser Ile Gly Ile Arg
Gln His 580 585 590Leu Lys Arg Val Gln Leu Arg Glu Leu Ser Glu Ala
Glu Val Arg Gln 595 600 605His Arg Glu Ala Arg Pro Ala Leu Leu Thr
Ser Arg Leu Arg Phe Ile 610 615 620Pro Lys Pro Asp Gly Leu Arg Pro
Ile Val Asn Met Asp Tyr Val Val625 630 635 640Gly Ala Arg Thr Phe
Arg Arg Glu Lys Arg Ala Glu Arg Leu Thr Ser 645 650 655Arg Val Lys
Ala Leu Phe Ser Val Leu Asn Tyr Glu Arg Ala Arg Arg 660 665 670Pro
Gly Leu Leu Gly Ala Ser Val Leu Gly Leu Asp Asp Ile His Arg 675 680
685Ala Trp Arg Thr Phe Val Leu Arg Val Arg Ala Gln Asp Pro Pro Pro
690 695 700Glu Leu Tyr Phe Val Lys Val Asp Val Thr Gly Ala Tyr Asp
Thr Ile705 710 715 720Pro Gln Asp Arg Leu Thr Glu Val Ile Ala Ser
Ile Ile Lys Pro Gln 725 730 735Asn Thr Tyr Cys Val Arg Arg Tyr Ala
Val Val Gln Lys Ala Ala His 740 745 750Gly His Val Arg Lys Ala Phe
Lys Ser His Val Ser Thr Leu Thr Asp 755 760 765Leu Gln Pro Tyr Met
Arg Gln Phe Val Ala His Leu Gln Glu Thr Ser 770 775 780Pro Leu Arg
Asp Ala Val Val Ile Glu Gln Ser Ser Ser Leu Asn Glu785 790 795
800Ala Ser Ser Gly Leu Phe Asp Val Phe Leu Arg Phe Met Cys His His
805 810 815Ala Val Arg Ile Arg Gly Lys Ser Tyr Val Gln Cys Gln Gly
Ile Pro 820 825 830Gln Gly Ser Ile Leu Ser Thr Leu Leu Cys Ser Leu
Cys Tyr Gly Asp 835 840 845Met Glu Asn Lys Leu Phe Ala Gly Ile Arg
Arg Asp Gly Leu Leu Leu 850 855 860Arg Leu Val Asp Asp Phe Leu Leu
Val Thr Pro His Leu Thr His Ala865 870 875 880Lys Thr Phe Leu Arg
Thr Leu Val Arg Gly Val Pro Glu Tyr Gly Cys 885 890 895Val Val Asn
Leu Arg Lys Thr Val Val Asn Phe Pro Val Glu Asp Glu 900 905 910Ala
Leu Gly Gly Thr Ala Phe Val Gln Met Pro Ala His Gly Leu Phe 915 920
925Pro Trp Cys Gly Leu Leu Leu Asp Thr Arg Thr Leu Glu Val Gln Ser
930 935 940Asp Tyr Ser Ser Tyr Ala Arg Thr Ser Ile Arg Ala Ser Leu
Thr Phe945 950 955 960Asn Arg Gly Phe Lys Ala Gly Arg Asn Met Arg
Arg Lys Leu Phe Gly 965 970 975Val Leu Arg Leu Lys Cys His Ser Leu
Phe Leu Asp Leu Gln Val Asn 980 985 990Ser Leu Gln Thr Val Cys Thr
Asn Ile Tyr Lys Ile Leu Leu Leu Gln 995 1000 1005Ala Tyr Arg Phe
His Ala Cys Val Leu Gln Leu Pro Phe His Gln Gln 1010 1015 1020Val
Trp Lys Asn Pro Thr Phe Phe Leu Arg Val Ile Ser Asp Thr Ala1025
1030 1035 1040Ser Leu Cys Tyr Ser Ile Leu Lys Ala Lys Asn Ala Gly
Met Ser Leu 1045 1050 1055Gly Ala Lys Gly Ala Ala Gly Pro Leu Pro
Ser Glu Ala Val Gln Trp 1060 1065 1070Leu Cys His Gln Ala Phe Leu
Leu Lys Leu Thr Arg His Arg Val Thr 1075 1080 1085Tyr Val Pro Leu
Leu Gly Ser Leu Arg Thr Ala Gln Thr Gln Leu Ser 1090 1095 1100Arg
Lys Leu Pro Gly Thr Thr Leu Thr Ala Leu Glu Ala Ala Ala Asn1105
1110 1115 1120Pro Ala Leu Pro Ser Asp Phe Lys Thr Ile Leu Asp 1125
113033982DNAHomo sapiens 3caggcagcgc tgcgtcctgc tgcgcacgtg
ggaagccctg gccccggcca cccccgcgat 60gccgcgcgct ccccgctgcc gagccgtgcg
ctccctgctg cgcagccact accgcgaggt 120gctgccgctg gccacgttcg
tgcggcgcct ggggccccag ggctggcggc tggtgcagcg 180cggggacccg
gcggctttcc gcgcgctggt ggcccagtgc ctggtgtgcg tgccctggga
240cgcacggccg ccccccgccg ccccctcctt ccgccaggtg tcctgcctga
aggagctggt 300ggcccgagtg ctgcagaggc tgtgcgagcg cggcgcgaag
aacgtgctgg ccttcggctt 360cgcgctgctg gacggggccc gcgggggccc
ccccgaggcc ttcaccacca gcgtgcgcag 420ctacctgccc aacacggtga
ccgacgcact gcgggggagc ggggcgtggg ggctgctgct 480gcgccgcgtg
ggcgacgacg tgctggttca cctgctggca cgctgcgcgc tctttgtgct
540ggtggctccc agctgcgcct accaggtgtg cgggccgccg ctgtaccagc
tcggcgctgc 600cactcaggcc cggcccccgc cacacgctag tggaccccga
aggcgtctgg gatgcgaacg 660ggcctggaac catagcgtca gggaggccgg
ggtccccctg ggcctgccag ccccgggtgc 720gaggaggcgc gggggcagtg
ccagccgaag tctgccgttg cccaagaggc ccaggcgtgg 780cgctgcccct
gagccggagc ggacgcccgt tgggcagggg tcctgggccc acccgggcag
840gacgcgtgga ccgagtgacc gtggtttctg tgtggtgtca cctgccagac
ccgccgaaga 900agccacctct ttggagggtg cgctctctgg cacgcgccac
tcccacccat ccgtgggccg 960ccagcaccac gcgggccccc catccacatc
gcggccacca cgtccctggg acacgccttg 1020tcccccggtg tacgccgaga
ccaagcactt cctctactcc tcaggcgaca aggagcagct 1080gcggccctcc
ttcctactca gctctctgag gcccagcctg actggcgctc ggaggctcgt
1140ggagaccatc tttctgggtt ccaggccctg gatgccaggg actccccgca
ggttgccccg 1200cctgccccag cgctactggc aaatgcggcc cctgtttctg
gagctgcttg ggaaccacgc 1260gcagtgcccc tacggggtgc tcctcaagac
gcactgcccg ctgcgagctg cggtcacccc 1320agcagccggt gtctgtgccc
gggagaagcc ccagggctct gtggcggccc ccgaggagga 1380ggacacagac
ccccgtcgcc tggtgcagct gctccgccag cacagcagcc cctggcaggt
1440gtacggcttc gtgcgggcct gcctgcgccg gctggtgccc ccaggcctct
ggggctccag 1500gcacaacgaa cgccgcttcc tcaggaacac caagaagttc
atctccctgg ggaagcatgc 1560caagctctcg ctgcaggagc tgacgtggaa
gatgagcgtg cgggactgcg cttggctgcg 1620caggagccca ggggttggct
gtgttccggc cgcagagcac cgtctgcgtg aggagatcct 1680ggccaagttc
ctgcactggc tgatgagtgt gtacgtcgtc gagctgctca ggtctttctt
1740ttatgtcacg gagaccacgt ttcaaaagaa caggctcttt ttctaccgga
agagtgtctg 1800gagcaagttg caaagcattg gaatcagaca gcacttgaag
agggtgcagc tgcgggagct 1860gtcggaagca gaggtcaggc agcatcggga
agccaggccc gccctgctga cgtccagact 1920ccgcttcatc cccaagcctg
acgggctgcg gccgattgtg aacatggact acgtcgtggg 1980agccagaacg
ttccgcagag aaaagagggc cgagcgtctc acctcgaggg tgaaggcact
2040gttcagcgtg ctcaactacg agcgggcgcg gcgccccggc ctcctgggcg
cctctgtgct 2100gggcctggac gatatccaca gggcctggcg caccttcgtg
ctgcgtgtgc gggcccagga 2160cccgccgcct gagctgtact ttgtcaagga
caggctcacg gaggtcatcg ccagcatcat 2220caaaccccag aacacgtact
gcgtgcgtcg gtatgccgtg gtccagaagg ccgcccatgg 2280gcacgtccgc
aaggccttca agagccacgt ctctaccttg acagacctcc agccgtacat
2340gcgacagttc gtggctcacc tgcaggagac cagcccgctg agggatgccg
tcgtcatcga 2400gcagagctcc tccctgaatg aggccagcag tggcctcttc
gacgtcttcc tacgcttcat 2460gtgccaccac gccgtgcgca tcaggggcaa
gtcctacgtc cagtgccagg ggatcccgca 2520gggctccatc ctctccacgc
tgctctgcag cctgtgctac ggcgacatgg agaacaagct 2580gtttgcgggg
attcggcggg acgggctgct cctgcgtttg gtggatgatt tcttgttggt
2640gacacctcac ctcacccacg cgaaaacctt cctcaggacc ctggtccgag
gtgtccctga 2700gtatggctgc gtggtgaact tgcggaagac agtggtgaac
ttccctgtag aagacgaggc 2760cctgggtggc acggcttttg ttcagatgcc
ggcccacggc ctattcccct ggtgcggcct 2820gctgctggat acccggaccc
tggaggtgca gagcgactac tccagctatg cccggacctc 2880catcagagcc
agtctcacct tcaaccgcgg cttcaaggct gggaggaaca tgcgtcgcaa
2940actctttggg gtcttgcggc tgaagtgtca cagcctgttt ctggatttgc
aggtgaacag 3000cctccagacg gtgtgcacca acatctacaa gatcctcctg
ctgcaggcgt acaggtttca 3060cgcatgtgtg ctgcagctcc catttcatca
gcaagtttgg aagaacccca catttttcct 3120gcgcgtcatc tctgacacgg
cctccctctg ctactccatc ctgaaagcca agaacgcagg 3180gatgtcgctg
ggggccaagg gcgccgccgg ccctctgccc tccgaggccg tgcagtggct
3240gtgccaccaa gcattcctgc tcaagctgac tcgacaccgt gtcacctacg
tgccactcct 3300ggggtcactc aggacagccc agacgcagct gagtcggaag
ctcccgggga cgacgctgac 3360tgccctggag gccgcagcca acccggcact
gccctcagac ttcaagacca tcctggactg 3420atggccaccc gcccacagcc
aggccgagag cagacaccag cagccctgtc acgccgggct 3480ctacgtccca
gggagggagg ggcggcccac acccaggccc gcaccgctgg gagtctgagg
3540cctgagtgag tgtttggccg aggcctgcat gtccggctga aggctgagtg
tccggctgag 3600gcctgagcga gtgtccagcc aagggctgag tgtccagcac
acctgccgtc ttcacttccc 3660cacaggctgg cgctcggctc caccccaggg
ccagcttttc ctcaccagga gcccggcttc 3720cactccccac ataggaatag
tccatcccca gattcgccat tgttcacccc tcgccctgcc 3780ctcctttgcc
ttccaccccc accatccagg tggagaccct gagaaggacc ctgggagctc
3840tgggaatttg gagtgaccaa aggtgtgccc tgtacacagg cgaggaccct
gcacctggat 3900gggggtccct gtgggtcaaa ttggggggag gtgctgtggg
agtaaaatac tgaatatatg 3960agtttttcag ttttgaaaaa aa 398241120PRTHomo
sapiens 4Met Pro Arg Ala Pro Arg Cys Arg Ala Val Arg Ser
Leu Leu Arg Ser1 5 10 15His Tyr Arg Glu Val Leu Pro Leu Ala Thr Phe
Val Arg Arg Leu Gly 20 25 30Pro Gln Gly Trp Arg Leu Val Gln Arg Gly
Asp Pro Ala Ala Phe Arg 35 40 45Ala Leu Val Ala Gln Cys Leu Val Cys
Val Pro Trp Asp Ala Arg Pro 50 55 60Pro Pro Ala Ala Pro Ser Phe Arg
Gln Val Ser Cys Leu Lys Glu Leu65 70 75 80Val Ala Arg Val Leu Gln
Arg Leu Cys Glu Arg Gly Ala Lys Asn Val 85 90 95Leu Ala Phe Gly Phe
Ala Leu Leu Asp Gly Ala Arg Gly Gly Pro Pro 100 105 110Glu Ala Phe
Thr Thr Ser Val Arg Ser Tyr Leu Pro Asn Thr Val Thr 115 120 125Asp
Ala Leu Arg Gly Ser Gly Ala Trp Gly Leu Leu Leu Arg Arg Val 130 135
140Gly Asp Asp Val Leu Val His Leu Leu Ala Arg Cys Ala Leu Phe
Val145 150 155 160Leu Val Ala Pro Ser Cys Ala Tyr Gln Val Cys Gly
Pro Pro Leu Tyr 165 170 175Gln Leu Gly Ala Ala Thr Gln Ala Arg Pro
Pro Pro His Ala Ser Gly 180 185 190Pro Arg Arg Arg Leu Gly Cys Glu
Arg Ala Trp Asn His Ser Val Arg 195 200 205Glu Ala Gly Val Pro Leu
Gly Leu Pro Ala Pro Gly Ala Arg Arg Arg 210 215 220Gly Gly Ser Ala
Ser Arg Ser Leu Pro Leu Pro Lys Arg Pro Arg Arg225 230 235 240Gly
Ala Ala Pro Glu Pro Glu Arg Thr Pro Val Gly Gln Gly Ser Trp 245 250
255Ala His Pro Gly Arg Thr Arg Gly Pro Ser Asp Arg Gly Phe Cys Val
260 265 270Val Ser Pro Ala Arg Pro Ala Glu Glu Ala Thr Ser Leu Glu
Gly Ala 275 280 285Leu Ser Gly Thr Arg His Ser His Pro Ser Val Gly
Arg Gln His His 290 295 300Ala Gly Pro Pro Ser Thr Ser Arg Pro Pro
Arg Pro Trp Asp Thr Pro305 310 315 320Cys Pro Pro Val Tyr Ala Glu
Thr Lys His Phe Leu Tyr Ser Ser Gly 325 330 335Asp Lys Glu Gln Leu
Arg Pro Ser Phe Leu Leu Ser Ser Leu Arg Pro 340 345 350Ser Leu Thr
Gly Ala Arg Arg Leu Val Glu Thr Ile Phe Leu Gly Ser 355 360 365Arg
Pro Trp Met Pro Gly Thr Pro Arg Arg Leu Pro Arg Leu Pro Gln 370 375
380Arg Tyr Trp Gln Met Arg Pro Leu Phe Leu Glu Leu Leu Gly Asn
His385 390 395 400Ala Gln Cys Pro Tyr Gly Val Leu Leu Lys Thr His
Cys Pro Leu Arg 405 410 415Ala Ala Val Thr Pro Ala Ala Gly Val Cys
Ala Arg Glu Lys Pro Gln 420 425 430Gly Ser Val Ala Ala Pro Glu Glu
Glu Asp Thr Asp Pro Arg Arg Leu 435 440 445Val Gln Leu Leu Arg Gln
His Ser Ser Pro Trp Gln Val Tyr Gly Phe 450 455 460Val Arg Ala Cys
Leu Arg Arg Leu Val Pro Pro Gly Leu Trp Gly Ser465 470 475 480Arg
His Asn Glu Arg Arg Phe Leu Arg Asn Thr Lys Lys Phe Ile Ser 485 490
495Leu Gly Lys His Ala Lys Leu Ser Leu Gln Glu Leu Thr Trp Lys Met
500 505 510Ser Val Arg Asp Cys Ala Trp Leu Arg Arg Ser Pro Gly Val
Gly Cys 515 520 525Val Pro Ala Ala Glu His Arg Leu Arg Glu Glu Ile
Leu Ala Lys Phe 530 535 540Leu His Trp Leu Met Ser Val Tyr Val Val
Glu Leu Leu Arg Ser Phe545 550 555 560Phe Tyr Val Thr Glu Thr Thr
Phe Gln Lys Asn Arg Leu Phe Phe Tyr 565 570 575Arg Lys Ser Val Trp
Ser Lys Leu Gln Ser Ile Gly Ile Arg Gln His 580 585 590Leu Lys Arg
Val Gln Leu Arg Glu Leu Ser Glu Ala Glu Val Arg Gln 595 600 605His
Arg Glu Ala Arg Pro Ala Leu Leu Thr Ser Arg Leu Arg Phe Ile 610 615
620Pro Lys Pro Asp Gly Leu Arg Pro Ile Val Asn Met Asp Tyr Val
Val625 630 635 640Gly Ala Arg Thr Phe Arg Arg Glu Lys Arg Ala Glu
Arg Leu Thr Ser 645 650 655Arg Val Lys Ala Leu Phe Ser Val Leu Asn
Tyr Glu Arg Ala Arg Arg 660 665 670Pro Gly Leu Leu Gly Ala Ser Val
Leu Gly Leu Asp Asp Ile His Arg 675 680 685Ala Trp Arg Thr Phe Val
Leu Arg Val Arg Ala Gln Asp Pro Pro Pro 690 695 700Glu Leu Tyr Phe
Val Lys Asp Arg Leu Thr Glu Val Ile Ala Ser Ile705 710 715 720Ile
Lys Pro Gln Asn Thr Tyr Cys Val Arg Arg Tyr Ala Val Val Gln 725 730
735Lys Ala Ala His Gly His Val Arg Lys Ala Phe Lys Ser His Val Ser
740 745 750Thr Leu Thr Asp Leu Gln Pro Tyr Met Arg Gln Phe Val Ala
His Leu 755 760 765Gln Glu Thr Ser Pro Leu Arg Asp Ala Val Val Ile
Glu Gln Ser Ser 770 775 780Ser Leu Asn Glu Ala Ser Ser Gly Leu Phe
Asp Val Phe Leu Arg Phe785 790 795 800Met Cys His His Ala Val Arg
Ile Arg Gly Lys Ser Tyr Val Gln Cys 805 810 815Gln Gly Ile Pro Gln
Gly Ser Ile Leu Ser Thr Leu Leu Cys Ser Leu 820 825 830Cys Tyr Gly
Asp Met Glu Asn Lys Leu Phe Ala Gly Ile Arg Arg Asp 835 840 845Gly
Leu Leu Leu Arg Leu Val Asp Asp Phe Leu Leu Val Thr Pro His 850 855
860Leu Thr His Ala Lys Thr Phe Leu Arg Thr Leu Val Arg Gly Val
Pro865 870 875 880Glu Tyr Gly Cys Val Val Asn Leu Arg Lys Thr Val
Val Asn Phe Pro 885 890 895Val Glu Asp Glu Ala Leu Gly Gly Thr Ala
Phe Val Gln Met Pro Ala 900 905 910His Gly Leu Phe Pro Trp Cys Gly
Leu Leu Leu Asp Thr Arg Thr Leu 915 920 925Glu Val Gln Ser Asp Tyr
Ser Ser Tyr Ala Arg Thr Ser Ile Arg Ala 930 935 940Ser Leu Thr Phe
Asn Arg Gly Phe Lys Ala Gly Arg Asn Met Arg Arg945 950 955 960Lys
Leu Phe Gly Val Leu Arg Leu Lys Cys His Ser Leu Phe Leu Asp 965 970
975Leu Gln Val Asn Ser Leu Gln Thr Val Cys Thr Asn Ile Tyr Lys Ile
980 985 990Leu Leu Leu Gln Ala Tyr Arg Phe His Ala Cys Val Leu Gln
Leu Pro 995 1000 1005Phe His Gln Gln Val Trp Lys Asn Pro Thr Phe
Phe Leu Arg Val Ile 1010 1015 1020Ser Asp Thr Ala Ser Leu Cys Tyr
Ser Ile Leu Lys Ala Lys Asn Ala1025 1030 1035 1040Gly Met Ser Leu
Gly Ala Lys Gly Ala Ala Gly Pro Leu Pro Ser Glu 1045 1050 1055Ala
Val Gln Trp Leu Cys His Gln Ala Phe Leu Leu Lys Leu Thr Arg 1060
1065 1070His Arg Val Thr Tyr Val Pro Leu Leu Gly Ser Leu Arg Thr
Ala Gln 1075 1080 1085Thr Gln Leu Ser Arg Lys Leu Pro Gly Thr Thr
Leu Thr Ala Leu Glu 1090 1095 1100Ala Ala Ala Asn Pro Ala Leu Pro
Ser Asp Phe Lys Thr Ile Leu Asp1105 1110 1115 112053426DNAMus
musculus 5gtgggaggcc catcccggcc ttgagcacaa tgacccgcgc tcctcgttgc
cccgcggtgc 60gctctctgct gcgcagccga taccgggagg tgtggccgct ggcaaccttt
gtgcggcgcc 120tggggcccga gggcaggcgg cttgtgcaac ccggggaccc
gaagatctac cgcactttgg 180ttgcccaatg cctagtgtgc atgcactggg
gctcacagcc tccacctgcc gacctttcct 240tccaccaggt gtcatccctg
aaagagctgg tggccagggt tgtgcagaga ctctgcgagc 300gcaacgagag
aaacgtgctg gcttttggct ttgagctgct taacgaggcc agaggcgggc
360ctcccatggc cttcactagt agcgtgcgta gctacttgcc caacactgtt
attgagaccc 420tgcgtgtcag tggtgcatgg atgctactgt tgagccgagt
gggcgacgac ctgctggtct 480acctgctggc acactgtgct ctttatcttc
tggtgccccc cagctgtgcc taccaggtgt 540gtgggtctcc cctgtaccaa
atttgtgcca ccacggatat ctggccctct gtgtccgcta 600gttacaggcc
cacccgaccc gtgggcagga atttcactaa ccttaggttc ttacaacaga
660tcaagagcag tagtcgccag gaagcaccga aacccctggc cttgccatct
cgaggtacaa 720agaggcatct gagtctcacc agtacaagtg tgccttcagc
taagaaggcc agatgctatc 780ctgtcccgag agtggaggag ggaccccaca
ggcaggtgct accaacccca tcaggcaaat 840catgggtgcc aagtcctgct
cggtcccccg aggtgcctac tgcagagaaa gatttgtctt 900ctaaaggaaa
ggtgtctgac ctgagtctct ctgggtcggt gtgctgtaaa cacaagccca
960gctccacatc tctgctgtca ccaccccgcc aaaatgcctt tcagctcagg
ccatttattg 1020agaccagaca tttcctttac tccaggggag atggccaaga
gcgtctaaac ccctcattcc 1080tactcagcaa cctccagcct aacttgactg
gggccaggag actggtggag atcatctttc 1140tgggctcaag gcctaggaca
tcaggaccac tctgcaggac acaccgtcta tcgcgtcgat 1200actggcagat
gcggcccctg ttccaacagc tgctggtgaa ccatgcagag tgccaatatg
1260tcagactcct caggtcacat tgcaggtttc gaacagcaaa ccaacaggtg
acagatgcct 1320tgaacaccag cccaccgcac ctcatggatt tgctccgcct
gcacagcagt ccctggcagg 1380tatatggttt tcttcgggcc tgtctctgca
aggtggtgtc tgctagtctc tggggtacca 1440ggcacaatga gcgccgcttc
tttaagaact taaagaagtt catctcgttg gggaaatacg 1500gcaagctatc
actgcaggaa ctgatgtgga agatgaaagt agaggattgc cactggctcc
1560gcagcagccc ggggaaggac cgtgtccccg ctgcagagca ccgtctgagg
gagaggatcc 1620tggctacgtt cctgttctgg ctgatggaca catacgtggt
acagctgctt aggtcattct 1680tttacatcac agagagcaca ttccagaaga
acaggctctt cttctaccgt aagagtgtgt 1740ggagcaagct gcagagcatt
ggagtcaggc aacaccttga gagagtgcgg ctacgggagc 1800tgtcacaaga
ggaggtcagg catcaccagg acacctggct agccatgccc atctgcagac
1860tgcgcttcat ccccaagccc aacggcctgc ggcccattgt gaacatgagt
tatagcatgg 1920gtaccagagc tttgggcaga aggaagcagg cccagcattt
cacccagcgt ctcaagactc 1980tcttcagcat gctcaactat gagcggacaa
aacatcctca ccttatgggg tcttctgtac 2040tgggtatgaa tgacatctac
aggacctggc gggcctttgt gctgcgtgtg cgtgctctgg 2100accagacacc
caggatgtac tttgttaagg cagatgtgac cggggcctat gatgccatcc
2160cccagggtaa gctggtggag gttgttgcca atatgatcag gcactcggag
agcacgtact 2220gtatccgcca gtatgcagtg gtccggagag atagccaagg
ccaagtccac aagtccttta 2280ggagacaggt caccaccctc tctgacctcc
agccatacat gggccagttc cttaagcatc 2340tgcaggattc agatgccagt
gcactgagga actccgttgt catcgagcag agcatctcta 2400tgaatgagag
cagcagcagc ctgtttgact tcttcctgca cttcctgcgt cacagtgtcg
2460taaagattgg tgacaggtgc tatacgcagt gccagggcat cccccagggc
tccagcctat 2520ccaccctgct ctgcagtctg tgtttcggag acatggagaa
caagctgttt gctgaggtgc 2580agcgggatgg gttgctttta cgttttgttg
atgactttct gttggtgacg cctcacttgg 2640accaagcaaa aaccttcctc
agcaccctgg tccatggcgt tcctgagtat gggtgcatga 2700taaacttgca
gaagacagtg gtgaacttcc ctgtggagcc tggtaccctg ggtggtgcag
2760ctccatacca gctgcctgct cactgcctgt ttccctggtg tggcttgctg
ctggacactc 2820agactttgga ggtgttctgt gactactcag gttatgccca
gacctcaatt aagacgagcc 2880tcaccttcca gagtgtcttc aaagctggga
agaccatgcg gaacaagctc ctgtcggtct 2940tgcggttgaa gtgtcacggt
ctatttctag acttgcaggt gaacagcctc cagacagtct 3000gcatcaatat
atacaagatc ttcctgcttc aggcctacag gttccatgca tgtgtgattc
3060agcttccctt tgaccagcgt gttaggaaga acctcacatt ctttctgggc
atcatctcca 3120gccaagcatc ctgctgctat gctatcctga aggtcaagaa
tccaggaatg acactaaagg 3180cctctggctc ctttcctcct gaagccgcac
attggctctg ctaccaggcc ttcctgctca 3240agctggctgc tcattctgtc
atctacaaat gtctcctggg acctctgagg acagcccaaa 3300aactgctgtg
ccggaagctc ccagaggcga caatgaccat ccttaaagct gcagctgacc
3360cagccctaag cacagacttt cagaccattt tggactaacc ctgtctcctt
ccgctagatg 3420aacatg 342661122PRTMus musculus 6Met Thr Arg Ala Pro
Arg Cys Pro Ala Val Arg Ser Leu Leu Arg Ser1 5 10 15Arg Tyr Arg Glu
Val Trp Pro Leu Ala Thr Phe Val Arg Arg Leu Gly 20 25 30Pro Glu Gly
Arg Arg Leu Val Gln Pro Gly Asp Pro Lys Ile Tyr Arg 35 40 45Thr Leu
Val Ala Gln Cys Leu Val Cys Met His Trp Gly Ser Gln Pro 50 55 60Pro
Pro Ala Asp Leu Ser Phe His Gln Val Ser Ser Leu Lys Glu Leu65 70 75
80Val Ala Arg Val Val Gln Arg Leu Cys Glu Arg Asn Glu Arg Asn Val
85 90 95Leu Ala Phe Gly Phe Glu Leu Leu Asn Glu Ala Arg Gly Gly Pro
Pro 100 105 110Met Ala Phe Thr Ser Ser Val Arg Ser Tyr Leu Pro Asn
Thr Val Ile 115 120 125Glu Thr Leu Arg Val Ser Gly Ala Trp Met Leu
Leu Leu Ser Arg Val 130 135 140Gly Asp Asp Leu Leu Val Tyr Leu Leu
Ala His Cys Ala Leu Tyr Leu145 150 155 160Leu Val Pro Pro Ser Cys
Ala Tyr Gln Val Cys Gly Ser Pro Leu Tyr 165 170 175Gln Ile Cys Ala
Thr Thr Asp Ile Trp Pro Ser Val Ser Ala Ser Tyr 180 185 190Arg Pro
Thr Arg Pro Val Gly Arg Asn Phe Thr Asn Leu Arg Phe Leu 195 200
205Gln Gln Ile Lys Ser Ser Ser Arg Gln Glu Ala Pro Lys Pro Leu Ala
210 215 220Leu Pro Ser Arg Gly Thr Lys Arg His Leu Ser Leu Thr Ser
Thr Ser225 230 235 240Val Pro Ser Ala Lys Lys Ala Arg Cys Tyr Pro
Val Pro Arg Val Glu 245 250 255Glu Gly Pro His Arg Gln Val Leu Pro
Thr Pro Ser Gly Lys Ser Trp 260 265 270Val Pro Ser Pro Ala Arg Ser
Pro Glu Val Pro Thr Ala Glu Lys Asp 275 280 285Leu Ser Ser Lys Gly
Lys Val Ser Asp Leu Ser Leu Ser Gly Ser Val 290 295 300Cys Cys Lys
His Lys Pro Ser Ser Thr Ser Leu Leu Ser Pro Pro Arg305 310 315
320Gln Asn Ala Phe Gln Leu Arg Pro Phe Ile Glu Thr Arg His Phe Leu
325 330 335Tyr Ser Arg Gly Asp Gly Gln Glu Arg Leu Asn Pro Ser Phe
Leu Leu 340 345 350Ser Asn Leu Gln Pro Asn Leu Thr Gly Ala Arg Arg
Leu Val Glu Ile 355 360 365Ile Phe Leu Gly Ser Arg Pro Arg Thr Ser
Gly Pro Leu Cys Arg Thr 370 375 380His Arg Leu Ser Arg Arg Tyr Trp
Gln Met Arg Pro Leu Phe Gln Gln385 390 395 400Leu Leu Val Asn His
Ala Glu Cys Gln Tyr Val Arg Leu Leu Arg Ser 405 410 415His Cys Arg
Phe Arg Thr Ala Asn Gln Gln Val Thr Asp Ala Leu Asn 420 425 430Thr
Ser Pro Pro His Leu Met Asp Leu Leu Arg Leu His Ser Ser Pro 435 440
445Trp Gln Val Tyr Gly Phe Leu Arg Ala Cys Leu Cys Lys Val Val Ser
450 455 460Ala Ser Leu Trp Gly Thr Arg His Asn Glu Arg Arg Phe Phe
Lys Asn465 470 475 480Leu Lys Lys Phe Ile Ser Leu Gly Lys Tyr Gly
Lys Leu Ser Leu Gln 485 490 495Glu Leu Met Trp Lys Met Lys Val Glu
Asp Cys His Trp Leu Arg Ser 500 505 510Ser Pro Gly Lys Asp Arg Val
Pro Ala Ala Glu His Arg Leu Arg Glu 515 520 525Arg Ile Leu Ala Thr
Phe Leu Phe Trp Leu Met Asp Thr Tyr Val Val 530 535 540Gln Leu Leu
Arg Ser Phe Phe Tyr Ile Thr Glu Ser Thr Phe Gln Lys545 550 555
560Asn Arg Leu Phe Phe Tyr Arg Lys Ser Val Trp Ser Lys Leu Gln Ser
565 570 575Ile Gly Val Arg Gln His Leu Glu Arg Val Arg Leu Arg Glu
Leu Ser 580 585 590Gln Glu Glu Val Arg His His Gln Asp Thr Trp Leu
Ala Met Pro Ile 595 600 605Cys Arg Leu Arg Phe Ile Pro Lys Pro Asn
Gly Leu Arg Pro Ile Val 610 615 620Asn Met Ser Tyr Ser Met Gly Thr
Arg Ala Leu Gly Arg Arg Lys Gln625 630 635 640Ala Gln His Phe Thr
Gln Arg Leu Lys Thr Leu Phe Ser Met Leu Asn 645 650 655Tyr Glu Arg
Thr Lys His Pro His Leu Met Gly Ser Ser Val Leu Gly 660 665 670Met
Asn Asp Ile Tyr Arg Thr Trp Arg Ala Phe Val Leu Arg Val Arg 675 680
685Ala Leu Asp Gln Thr Pro Arg Met Tyr Phe Val Lys Ala Asp Val Thr
690 695 700Gly Ala Tyr Asp Ala Ile Pro Gln Gly Lys Leu Val Glu Val
Val Ala705 710 715 720Asn Met Ile Arg His Ser Glu Ser Thr Tyr Cys
Ile Arg Gln Tyr Ala 725 730 735Val Val Arg Arg Asp Ser Gln Gly Gln
Val His Lys Ser Phe Arg Arg 740 745 750Gln Val Thr Thr Leu Ser Asp
Leu Gln Pro Tyr Met Gly Gln Phe Leu 755 760 765Lys His Leu Gln Asp
Ser Asp Ala Ser Ala Leu Arg Asn Ser Val Val 770 775
780Ile Glu Gln Ser Ile Ser Met Asn Glu Ser Ser Ser Ser Leu Phe
Asp785 790 795 800Phe Phe Leu His Phe Leu Arg His Ser Val Val Lys
Ile Gly Asp Arg 805 810 815Cys Tyr Thr Gln Cys Gln Gly Ile Pro Gln
Gly Ser Ser Leu Ser Thr 820 825 830Leu Leu Cys Ser Leu Cys Phe Gly
Asp Met Glu Asn Lys Leu Phe Ala 835 840 845Glu Val Gln Arg Asp Gly
Leu Leu Leu Arg Phe Val Asp Asp Phe Leu 850 855 860Leu Val Thr Pro
His Leu Asp Gln Ala Lys Thr Phe Leu Ser Thr Leu865 870 875 880Val
His Gly Val Pro Glu Tyr Gly Cys Met Ile Asn Leu Gln Lys Thr 885 890
895Val Val Asn Phe Pro Val Glu Pro Gly Thr Leu Gly Gly Ala Ala Pro
900 905 910Tyr Gln Leu Pro Ala His Cys Leu Phe Pro Trp Cys Gly Leu
Leu Leu 915 920 925Asp Thr Gln Thr Leu Glu Val Phe Cys Asp Tyr Ser
Gly Tyr Ala Gln 930 935 940Thr Ser Ile Lys Thr Ser Leu Thr Phe Gln
Ser Val Phe Lys Ala Gly945 950 955 960Lys Thr Met Arg Asn Lys Leu
Leu Ser Val Leu Arg Leu Lys Cys His 965 970 975Gly Leu Phe Leu Asp
Leu Gln Val Asn Ser Leu Gln Thr Val Cys Ile 980 985 990Asn Ile Tyr
Lys Ile Phe Leu Leu Gln Ala Tyr Arg Phe His Ala Cys 995 1000
1005Val Ile Gln Leu Pro Phe Asp Gln Arg Val Arg Lys Asn Leu Thr Phe
1010 1015 1020Phe Leu Gly Ile Ile Ser Ser Gln Ala Ser Cys Cys Tyr
Ala Ile Leu1025 1030 1035 1040Lys Val Lys Asn Pro Gly Met Thr Leu
Lys Ala Ser Gly Ser Phe Pro 1045 1050 1055Pro Glu Ala Ala His Trp
Leu Cys Tyr Gln Ala Phe Leu Leu Lys Leu 1060 1065 1070Ala Ala His
Ser Val Ile Tyr Lys Cys Leu Leu Gly Pro Leu Arg Thr 1075 1080
1085Ala Gln Lys Leu Leu Cys Arg Lys Leu Pro Glu Ala Thr Met Thr Ile
1090 1095 1100Leu Lys Ala Ala Ala Asp Pro Ala Leu Ser Thr Asp Phe
Gln Thr Ile1105 1110 1115 1120Leu Asp721DNAArtificial
SequencePrimer 7ggcaccacac cttctacaat g 21818DNAArtificial
SequencePrimer 8gtggtggtga agctgtag 18918DNAArtificial
SequencePrimer 9ggattgccac tggctccg 181021DNAArtificial
SequencePrimer 10tgcctgacct cctcttgtga c 211120DNAArtificial
SequencePrimer 11cgtaccccga ttcaggtgat 201222DNAArtificial
SequencePrimer 12ttgagcagaa gagctgctac gt 221321DNAArtificial
SequencePrimer 13ggcaaagtgg agaggatcga c 211418DNAArtificial
SequencePrimer 14tcgtggctgt tgcgtagg 181519DNAArtificial
SequencePrimer 15tgcgccctcc gtatcttac 191622DNAArtificial
SequencePrimer 16atcttagagg ccacgaacat gc 221723DNAArtificial
SequencePrimer 17cagcctactg gagatcagga tga 231822DNAArtificial
SequencePrimer 18ggagtccttg gatgagtctc ga 221924DNAArtificial
SequencePrimer 19gcgaactcac acaggcgaga aacc 242023DNAArtificial
SequencePrimer 20tcgcttcctc ttcctccgac aca 232119DNAArtificial
SequencePrimer 21cccattgccc ctgctcctg 192219DNAArtificial
SequencePrimer 22tgtgtccgcc ggtgtctgg 192326DNAArtificial
SequencePrimer 23caattacggg gtcattagtt catagc 262426DNAArtificial
SequencePrimer 24atacgtagat gtactgccaa gtagga 262521DNAArtificial
SequencePrimer 25cttcctgcca caatgtcaca g 212623DNAArtificial
SequencePrimer 26cctttctcat gcttgcttct ctg 23
* * * * *
References