U.S. patent application number 17/301976 was filed with the patent office on 2021-08-19 for multi-copy reference assay.
The applicant listed for this patent is LIFE TECHNOLOGIES CORPORATION. Invention is credited to Pius BRZOSKA, Wing LEE, Zheng LI, Wendy LIN, David MERRILL, Mandi WONG.
Application Number | 20210254181 17/301976 |
Document ID | / |
Family ID | 1000005539255 |
Filed Date | 2021-08-19 |
United States Patent
Application |
20210254181 |
Kind Code |
A1 |
MERRILL; David ; et
al. |
August 19, 2021 |
MULTI-COPY REFERENCE ASSAY
Abstract
A method, comprising amplifying a nucleic acid sequence of
interest in a sample comprising genomic DNA of a subject;
amplifying a reference nucleic acid sequence in the sample;
quantifying the amplified sequence of interest relative to the
amplified reference sequence; and determining a copy number of the
sequence of interest from the relative quantified amplified
sequence of interest. The reference sequence may have at least 80%
sequence identity to at least one of SEQ ID NO:1-38, such as SEQ ID
NO:1-13. Also disclosed are kits and compositions, each comprising
a first probe which specifically hybridizes to at least a portion
of at least one reference sequence. Also disclosed is a system
configured to perform the above method.
Inventors: |
MERRILL; David; (Millbrae,
CA) ; BRZOSKA; Pius; (Woodside, CA) ; LI;
Zheng; (San Ramon, CA) ; LIN; Wendy; (San
Francisco, CA) ; LEE; Wing; (San Leandro, CA)
; WONG; Mandi; (South San Francisco, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
LIFE TECHNOLOGIES CORPORATION |
Carlsbad |
CA |
US |
|
|
Family ID: |
1000005539255 |
Appl. No.: |
17/301976 |
Filed: |
April 20, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15128076 |
Sep 21, 2016 |
11008621 |
|
|
PCT/US2015/021853 |
Mar 20, 2015 |
|
|
|
17301976 |
|
|
|
|
61968609 |
Mar 21, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2600/158 20130101;
C12Q 1/6851 20130101; C12Q 2600/166 20130101; C12Q 2600/156
20130101; C12Q 1/6858 20130101; C12Q 1/6886 20130101 |
International
Class: |
C12Q 1/6886 20060101
C12Q001/6886; C12Q 1/6858 20060101 C12Q001/6858; C12Q 1/6851
20060101 C12Q001/6851 |
Claims
1. A method, comprising: amplifying a nucleic acid sequence of
interest in a sample comprising genomic DNA of a subject;
amplifying a reference sequence in the sample, wherein the
reference sequence has at least 80% sequence identity to at least
one portion of genomic DNA comprising from about 60 to about 150
base pairs, wherein the at least one portion is present in
chr1-121790-133586, chr1-329448-341534, chr1-648129-660266,
chr1-222643865-228172047, chr1-243203764-243215874,
chr10-38741930-38753964, chr11-114010-126106,
chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes; quantifying the amplified
sequence of interest relative to the amplified reference sequence;
and determining a copy number of the sequence of interest from the
relative quantified amplified sequence of interest.
2. The method of claim 1, wherein the reference sequence has at
least 80% sequence identity to at least one of SEQ ID NOs:
1-31.
3. The method of claim 1, wherein the reference sequence has at
least 80% sequence identity to at least one of SEQ ID NO:1-13.
4. The method of claim 1, wherein the sample comprises tissue
suspected of being cancer tissue.
5. The method of claim 4, wherein the sample has been subjected to
formalin fixing and paraffin embedding (FFPE) prior to amplifying
the sequence of interest and amplifying the reference sequence.
6. The method of claim 4, further comprising: diagnosing the
subject as having a cancer-related biomarker, based on the sequence
of interest being associated with the cancer and the copy number
being indicative of the cancer.
7. The method of claim 1, wherein amplifying the sequence of
interest and amplifying the reference sequence are performed by
TaqMan quantitative polymerase chain reaction (qPCR).
8. A composition, comprising: a first probe which specifically
hybridizes to at least a portion of at least one reference sequence
having at least 80% sequence identity to at least one portion of
genomic DNA comprising from about 60 to about 150 base pairs,
wherein the at least one portion is present in chr1-121790-133586,
chr1-329448-341534, chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes.
9. The composition of claim 8, wherein the reference sequence has
at least 80% sequence identity to at least one of SEQ ID
NO:1-31.
10. The composition of claim 8, wherein the reference sequence has
at least 80% sequence identity to at least one of SEQ ID
NO:1-13.
11. The composition of claim 8, wherein the first probe comprises a
nucleic acid sequence configured to specifically hybridize to at
least the portion of the at least one reference sequence, a
fluorescent reporter at a first end of the nucleic acid sequence,
and a fluorescent quencher at a second end of the nucleic acid
sequence.
12. The composition of claim 8, further comprising: a first primer
configured to specifically hybridize to a first end of the at least
one reference sequence, and a second primer configured to
specifically hybridize to a sequence complementary to a second end
of the at least one reference sequence.
13. The composition of claim 8, further comprising: a second probe
which specifically hybridizes to at least a portion of at least one
nucleic acid sequence of interest.
14. The composition of claim 13, further comprising: a third primer
configured to specifically hybridize to a first end of the at least
one nucleic acid sequence of interest, and a fourth primer
configured to specifically hybridize to a sequence complementary to
a second end of the at least one nucleic acid sequence of
interest.
15. A system, comprising: a nucleic acid amplifier configured to
amplify a nucleic acid sequence of interest in a sample comprising
genomic DNA of a subject and amplify a reference sequence in the
sample, a reagent reservoir containing at least a first primer
configured to specifically hybridize to a first end of the at least
one reference sequence, wherein the reference sequence has at least
80% sequence identity to at least one portion of genomic DNA
comprising from about 60 to about 150 base pairs, wherein the at
least one portion is present in chr1-121790-133586,
chr1-329448-341534, chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes; , and a second primer
configured to specifically hybridize to a sequence complementary to
a second end of the at least one reference sequence; a detector
configured to provide a first indication relating to an amount of
the amplified sequence of interest and a second indication relating
to an amount of the amplified reference sequence; and a controller
configured to quantify the amplified sequence of interest relative
to the amplified reference sequence, based at least in part on the
first indication and the second indication; and determine a copy
number of the sequence of interest from the relative quantified
amplified sequence of interest.
16. The system of claim 15, wherein the reference sequence has at
least 80% sequence identity to at least one of SEQ ID NO:1-31.
17. The system of claim 16, wherein the reference sequence has at
least 80% sequence identity to at least one of SEQ ID NO:1-13.
18. The system of claim 17, wherein the sample comprises tissue
suspected of being cancer tissue.
19. The system of claim 18, wherein the sample has been subjected
to formalin fixing and paraffin embedding (FFPE).
20. The system of claim 19, wherein the controller is further
configured to indicate the subject as having a cancer-related
biomarker, based on the sequence of interest being associated with
the cancer and the copy number being indicative of the cancer.
Description
BACKGROUND
[0001] Information relating to the copy number of a target of
interest in the genome of a biological sample may be desirable for
a number of purposes, including basic research and clinical
diagnosis of various diseases. One class of diseases where the copy
number of a target of interest may be particularly desirable to
know is cancer. Numerous cancers present with abnormal copy numbers
of one or more genes. In many cases, there exists a positive
correlation between copy number and the existence and/or
progression of cancer. Therefore, determining the copy number of a
target of interest in a sample from a patient of tissue suspected
of being cancer tissue may be useful, for example, in diagnosing,
treating, and/or monitoring the course of the patient's cancer.
[0002] To date, quantitative polymerase chain reaction (qPCR) has
been under consideration as a molecular technique for determining
copy number of a target of interest. To determine copy number of a
target of interest, qPCR may require the simultaneous amplification
of both the target of interest and a reference sequence in the
genome of the sample. From the relative quantities of the target of
interest amplicon and the reference sequence amplicon, the relative
copy numbers of the target of interest and the reference sequence
can be determined, and assuming the absolute copy number of the
reference sequence is known, the copy number of the target of
interest may be determined.
[0003] However, when attempting to apply qPCR to determine the copy
number of a target of interest in a cancer cell, the technique may
be rendered difficult as a result of one or both of the random,
evolving genomic abnormalities (e.g., aneuploidy) found in cancer
cells and the modifications to nucleic acids that may occur when
tissue samples are archived by formalin fixing and paraffin
embedding (FFPE).
[0004] Genomic abnormalities of various types are known to occur in
cancer cells, and increase in their quantity, distribution, and
complexity as the cancer cells are replicated over time. These
genomic abnormalities include gene deletions and multiplications,
some of which may be related to a specific function in humans and
common to certain cancer types, while others may have no overt
effect or association with disease. As a result, a reference
sequence of interest may undergo deletion and/or multiplication in
the genome of a cancer cell, thereby making it very difficult to
determine the absolute copy number of the reference sequence.
[0005] Modifications to the nucleic acids (DNA and RNA), such as
cross linking of nucleotides to themselves or proteins,
depurination of nucleotides, and fragmentation of the nucleic acids
are known to occur as part of the archiving of cancer samples by
the FFPE method. However, the locations and extent of these
modifications are random and vary greatly across FFPE samples, due
in large part to one or more factors, such as variability in the
sample tissue itself, reagents used in fixation and embedding, and
user preferred variations in the FFPE method at different labs.
These effects also make it difficult or impossible to determine the
absolute copy number of the reference sequence.
[0006] Both of these observations provide significant challenges to
current molecular genetic assays and tests for DNA level copy
number variation, such as qPCR.
[0007] Therefore, there exists a need for the selection of
reference sequences that are relatively resistant to cancer-induced
genomic abnormalities and/or FFPE-induced nucleic acid
modifications.
SUMMARY OF THE DISCLOSURE
[0008] In one embodiment, the present disclosure relates to a
method, comprising quantifying a nucleic acid sequence of interest
relative to a reference nucleic acid sequence, wherein at least a
first minimum number of copies of the reference nucleic acid
sequence is present on each of at least a second minimum number of
chromosomes of the genomic DNA of the subject; and determining a
copy number of the sequence of interest from the relative
quantified amplified sequence of interest.
[0009] In some embodiments, the method may further comprise
amplifying the nucleic acid sequence of interest in a sample
comprising genomic DNA of a subject; and amplifying the reference
nucleic acid sequence in the sample; prior to quantifying.
[0010] In one embodiment, the reference sequence may have at least
80% sequence identity to at least one portion of genomic DNA
comprising from about 60 to about 150 base pairs, wherein the at
least one portion is present in chr1-121790-133586,
chr1-329448-341534, chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes.
[0011] In a particular embodiment, the reference nucleic acid
sequence may have at least 80% sequence identity to at least one
of
TABLE-US-00001 (SEQ ID NO: 1)
GGCTGYTTGCRGTAGTWRTSTRKSWRSMRSMMRMWSRMYGSMSRCARRSRA
RRMARWYWSTWDVWAKKMN, (SEQ ID NO: 2)
GGCTGCTTGCAGTAGTTGTGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCC, (SEQ ID NO: 3)
GGCTGCTTGCGGTAGTTATGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCC, (SEQ ID NO: 4)
GGCTGCTTGCGGTAGTTGTCTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCC, (SEQ ID NO: 5)
GGCTGCTTGCGGTAGTTGTGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAAAAATTCC, (SEQ ID NO: 6)
GGCTGCTTGCGGTAGTTGTGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCC, (SEQ ID NO: 7)
GGCTGCTTGCGGTAGTTGTGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCN, (SEQ ID NO: 8)
GGCTGTTTGCGGTAGTAGTCTGTGTAGCAGCAGCACAATGGCCGCAGACGA
GGAAAACAGTTTCTAGGAA, (SEQ ID NO: 9)
AGTGCAGYRWTGYTGACTCTTCCAAGCTTAACATTTCTCASAARTCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 10)
AGTGCAGCAATGTTGACTCTTCCAAGCTTAACATTTCTCAGAAGTCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 11)
AGTGCAGCGATGCTGACTCTTCCAAGCTTAACATTTCTCACAAGTCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 12)
AGTGCAGCGTTGCTGACTCTTCCAAGCTTAACATTTCTCACAAATCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 13)
AGTGCAGTGATGCTGACTCTTCCAAGCTTAACATTTCTCACAAGTCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 14)
GTGTAGCAGCAGCACAATGGCCGCAGACAAGGAAAACAGTTTCTAGGAATT
CCTCGTATATAATTTTATATTTTTGACAAGATTAATGACCCATGCTCC, (SEQ ID NO: 15)
TGCARMGATGCTGACTCTTCCAAGCTTAACATTTCTCACAAGTCAATTAGC TTTGTACTGGGAGG,
(SEQ ID NO: 16) TGCTGACTCTTCCAAGCTTAACATTTCTCACAAGTCAATTAGCTTTGTACT
GGGAGGAGGGCGTGAAGGGCTGCTTGCG, (SEQ ID NO: 17)
CAAGGGACAAGGAAAAATTATCCAAACATTGTTTAAAACAATCATCATTAA
TTAGTAACACTTATCCAGGGGGGTTTTTAACCTTTCCCCCACTCAASGATT
ATTCTAATGTCAGAGTAGAATAAAAAATAAGTGCARMGATGCTGAC, (SEQ ID NO: 18)
GGAGGAGGAAAATAGGTAGTTTTTCAAAAGTTTTCAAAAATATGAAAAGAA
GAAATGAAATGGTACTTGGAAGAGATTGTTGAAATGGGAGAGACTATGGTG GC, (SEQ ID NO:
19) CAACTAAAAGGCAATGTCACTCCAATAATCACCAGAGTAATCAATTTGCTT
ATTGCTGTCCCTTTAAATATAGTTCTCTGG, (SEQ ID NO: 20)
GGAGAGACTATGGTGGCTTGTTTAGAAGCAGTTGAGATAGATCCAATTGAG
ATAGAGATATTGAGTATATAAACAAAAGAATGACAAATTAATAGTGTAATG
GATAACTTGACTTTGGCA, (SEQ ID NO: 21)
GTGTAATGGATAACTTGACTTTGGCAAATATTGTGAATTTTTGTGAAAGTA
CAACTAAAAGGCAATGTCACTCCAATAATCACCAG, (SEQ ID NO: 22)
GTAATCAATTTGCTTATTGCTGTCCCTTTAAATATAGTTCTCTGGTATCAA
CTAACATGTTTTTAACTAATGATGCTTCTTAAAGAAAAGGGAAAAGACCT, (SEQ ID NO: 23)
CCCTGGGCCCCTCAGGGGAGTCCCTGCTGGACAGTGAGACAGAGAATGACC
ATGATGATGCTTTCCT, (SEQ ID NO: 24)
GGGTTTATGTTTGATATRTAATGTAATTTTCTAATGCTAAATCAAGTGGTA
ATTTTGTTAGTCAAGTTGATTTAGTGGCTTGGGAAGAAAGCT, (SEQ ID NO: 25)
GAGACCCCCAGGTGTTGAGGCAGGGCTGGGGTGTCCCCTTCCAACCAGGCT
GTCAAGGCCCCAACTCTGGGGCAGAGGCAGTGGCAGGG, (SEQ ID NO: 26)
CATCCGTTTCACCTGCAGTTGAAGATCCGTGAGGTGCCCAGAAGATCATGC
AGTCAWCAGTCCCACG, (SEQ ID NO: 27)
GAKATAAGGAAGCTCGAGGAAGAGAAAAAACAACTGGAAGGAGAAATCATA
GATTTTTATAAAATGAMAGCTGCCTCTGAAGC, (SEQ ID NO: 28)
CCGTTTTGGAGGAGGAACAGATTCCATGTCCACTAGAATGGAATGAACAAG
AAATGGAGGAGGAAAATAGGTAGTTTTTCAAAAGTTTTCAAAAATATGAAA
AGAAGAAATGAAATGGTACTTGGAAGAGATTGTTGAAATGGGA, (SEQ ID NO: 29)
TGCTTCTTAAAGAAAAGGGAAAAGACCTTTTTCTTTCTTTCAGTCTTCAAT
GATTCACTGCTTCATCTCGCTCCACCAAAGATAAATGAAATCTACATCTC T, (SEQ ID NO:
30) CTTTCCCCCACTCAASGATTATTCTAATGTCAGAGTAGAATAAAAAATAAG
TGCARMGATGCTGACTCTTCCAAGCTTAACATTTCTCA, or (SEQ ID NO: 31)
GGGAGGAGGGCGTGAAGGGCTGCTTGCGGTAGTTGTGTAGCAGCAGCACAA
TGGCCGCAGACAAG.
[0012] In another embodiment, the present disclosure relates to a
kit, comprising a first probe which specifically hybridizes to at
least a portion of at least one reference sequence that has at
least 80% sequence identity to at least one portion of genomic DNA
comprising from about 60 to about 150 base pairs, wherein the at
least one portion is present in chr1-121790-133586,
chr1-329448-341534, chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes.
[0013] In still another embodiment, the present disclosure relates
to a composition, comprising a first probe which specifically
hybridizes to at least a portion of at least one reference sequence
that has at least 80% sequence identity to at least one portion of
genomic DNA comprising from about 60 to about 150 base pairs,
wherein the at least one portion is present in chr1-121790-133586,
chr1-329448-341534, chr1-648129-660266, chrl-222643865-228172047,
chrl-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes.
[0014] In yet another embodiment, the present disclosure relates to
a system, comprising a nucleic acid amplifier configured to amplify
a nucleic acid sequence of interest in a sample comprising genomic
DNA of a subject and amplify a reference sequence in the sample; a
reagent reservoir containing at least a first primer configured to
specifically hybridize to a first end of the at least one reference
sequence, wherein the reference sequence has at least 80% sequence
identity to at least one portion of genomic DNA comprising from
about 60 to about 150 base pairs, wherein the at least one portion
is present in chr1-121790-133586, chr1-329448-341534,
chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes, and a second primer
configured to specifically hybridize to a sequence complementary to
a second end of the at least one reference sequence,; a detector
configured to provide a first indication relating to an amount of
the amplified sequence of interest and a second indication relating
to an amount of the amplified reference sequence; and a controller
configured to quantify the amplified sequence of interest relative
to the amplified reference sequence, based at least in part on the
first indication and the second indication and determine a copy
number of the sequence of interest from the relative quantified
amplified sequence of interest.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present disclosure. The disclosure may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0016] FIG. 1A shows the decimal point calculated copy number of
IRS2 as determined by qPCR with an RNaseP reference assay.
[0017] FIG. 1B shows the rounded copy number of IRS2 as determined
by qPCR with an RNaseP reference assay.
[0018] FIG. 2A shows the decimal point calculated copy number of
IRS2 as determined by qPCR with a reference assay based on SEQ ID
NO:1-8.
[0019] FIG. 2B shows the rounded copy number of IRS2 as determined
by qPCR with a reference assay based on SEQ ID NO:1-8.
[0020] FIG. 3A shows the decimal point calculated copy number of
IRS2 as determined by qPCR with a reference assay based on SEQ ID
NO:9-13.
[0021] FIG. 3B shows the rounded copy number of IRS2 as determined
by qPCR with a reference assay based on SEQ ID NO:9-13.
DESCRIPTION
[0022] Various embodiments of the present disclosure provide
reference sequences that are relatively resistant to cancer-induced
genomic abnormalities and/or FFPE-induced nucleic acid
modifications. More specifically, the disclosure provides target
sequences in the genome that are repeated multiple times, across
many chromosomes, and demonstrate substantially normal copy number
and resistance to severe modifications and fragmentation, even in
cancer cells subjected to FFPE.
[0023] In one embodiment, the present disclosure relates to a
method, comprising amplifying a nucleic acid sequence of interest
in a sample comprising genomic DNA of a subject; amplifying a
reference nucleic acid sequence in the sample, wherein at least one
copy of the reference nucleic acid sequence is present on each of
at least ten chromosomes of the genomic DNA of the subject;
quantifying the amplified sequence of interest relative to the
amplified reference sequence; and determining a copy number of the
sequence of interest from the relative quantified amplified
sequence of interest.
[0024] Amplifying may be performed by any technique known to the
person of ordinary skill in the art. Desirably, amplifying may be
performed by a technique which permits quantification of the
sequence of interest relative to the reference sequence. Exemplary
techniques include, but are not limited to, polymerase chain
reaction (PCR) (Saiki et al. (1985) Science 230: 1350),
quantitative real-time PCR (qPCR), digital PCR, ligase chain
reaction (LCR) (Landegren et al. (1988) Science 241:1077-1080),
helicase-dependent amplification (HDA) (Vincent et al. (2004) EMBO
rep 5(8):795-800), thermostable HDA (tHDA) (An et al. (2005) J Biol
Chem 280 (32):28952-28958), strand displacement amplification (SDA)
(Walker et al. (1992) Nucleic Acids Res 20(7):16916), multiple
displacement amplification (MDA) (Dean et al. (2002) Proc Natl Acad
Sci USA 99(8): 5261-5266), rolling circle amplification (RCA) (Liu
et al. (1996) J Am Chem Soc 118:1587-1594), restriction aided RCA
(Wang et al. (2004) Genome Res 14:2357-2366), single primer
isothermal amplification (SPIA) (Daffom et al. (2004) Biotechniques
37(5):854-7), transcription mediated amplification (TMA) (Vuorinen
et al. (1995) J Clin Microbio133: 1856-1859), nicking enzyme
amplification reaction (NEAR) (Maples et al. US2009017453),
exponential amplification reaction (EXPAR) (Van Ness et al. (2003)
Proc Natl Acad Sci USA 100 (8):4504-4509), loop mediated isothermal
amplification (LAMP) (Notomi et al. (2000) Nucleic Acids Res
28(12):e63), recombinase polymerase amplification (RPA) (Piepenburg
et al. (2006) PloS Biol 4(7): 1115-1120), nucleic acid sequence
based amplification (NASBA) (Kievits et al. (1991) J Virol Methods
35:273-286), smart-amplification process (SMAP) (Mitani et al.
(2007) Nat Methods 4(3):257-62), nanostring amplification (Geiss et
al (2008) Nature Biotechnology 26:317-325; Schwanhausser et al
(2011) Nature 473:337-342; commercially available as the
nCounter.RTM. platform from NanoString Technologies, Seattle, WA),
or next generation sequencing (NGS) (Rothberg et al (2011) Nature
475:348-352; Metzker M (2010) Nature Rev Genetics 11:31-46).
[0025] In a particular embodiment, amplification is performed by
TaqMan quantitative polymerase chain reaction (qPCR).
[0026] Generally, qPCR platform assays use two genome targets
together to determine the copy number of a gene or region of the
genome in a test sample. One of the genome targets is a qPCR assay
for the target of interest (TOI), and the second is a qPCR
reference assay for what is assumed to be a normal, unmodified
region of the genome. The two assays are run simultaneously and in
parallel on the same test sample. After one or more cycles of the
polymerase chain reaction, the Cq values of each assay (indicative
of the relative amount of TOI or reference amplicon) may be
determined by techniques known to the person of ordinary skill in
the art and/or described in more detail below, and a delta Cq
between them is calculated. This calculated delta Cq may then be
compared to a delta Cq that is representative of a known copy
number for the TOI. For example, the representative delta Cq may be
a delta Cq determined from a sample known to be normal (i.e.,
having a copy number of 2, one copy from each of a pair of
chromosomes). This final calculated delta delta Cq between test
sample and known sample/value may then be transformed into a
decimal number or an integer number representing the copy number of
the gene or region of genome in the test sample.
[0027] For reasons described above, the challenge in cancer FFPE
samples is in the ability to find a reference genome target (qPCR
reference assay target) that is both normal and relatively
unmodified by fixation and embedding. Additionally or
alternatively, for some samples the ability to find a reference
genome target may be complicated by a particular disease state,
which includes but is not limited to cancer, where a potential
reference genomic target may be altered by the disease state and is
itself multiplied relative to its typical population.
[0028] Any nucleic acid sequence from the genomic DNA of a subject
and of interest to the user of the method may be amplified and
quantified according to the method. For example, the sequence of
interest may be at least a portion of a gene which has an
association with a disease. As will be apparent to the person of
ordinary skill in the art, the sample may be any tissue likely or
possibly containing the nucleic acid sequence of interest in
genomic DNA.
[0029] The method may be used to amplify and quantify a sequence of
interest from tissue suspected of being cancer tissue, including
tissue which has been subjected to formalin fixing and paraffin
embedding (FFPE) prior to the amplifying the sequence of interest
and amplifying the reference sequence. In such a use, the sequence
of interest may be at least a portion of a gene for which there
exists a correlation between the gene's copy number and the
presence and/or stage of a cancer.
[0030] Any reference nucleic acid sequence known or expected to be
present in the genomic DNA of the sample may be amplified. However,
a person of ordinary skill in the art will be aware that in many
embodiments, such as those in which the sample is suspected of
being cancer tissue, and especially a sample previously subject to
FFPE, any particular locus of a copy of a reference nucleic acid
sequence may have undergone a recombination event, an aneuploidy
event, or the like. Thus, the number of copies of the reference
sequence in the sample may differ from that expected by simple
counting of the number of loci of the reference sequence in a
non-diseased sample from the subject or a member of the subject's
species.
[0031] Therefore, it is desirable that the sample comprises at
least one copy of the reference nucleic acid sequence on each of at
least ten chromosomes of the genomic DNA of the subject. The
presence of multiple, physically dispersed copies of the reference
sequence may smooth or average out the effects of individual
disruptions or duplications of various loci.
[0032] In one embodiment, the reference sequence has at least 80%
sequence identity to at least one portion of genomic DNA comprising
from about 60 to about 150 base pairs, wherein the at least one
portion is present in chr1-121790-133586, chr1-329448-341534,
chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes.
[0033] In one embodiment, the first minimum number may be 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, or 15 copies. Independently, the second
minimum number may be 5, 6, 7, 8, 9, 10, or 11 chromosomes. The
first and second minimum numbers may be enumerated, estimated, or
predicted based on any available human reference genome.
[0034] In a particular embodiment, the reference sequence has at
least 80% sequence identity to at least one of
TABLE-US-00002 (SEQ ID NO: 1)
GGCTGYTTGCRGTAGTWRTSTRKSWRSMRSMMRMWSRMYGSMSRCARRSRA
RRMARWYWSTWDVWAKKMN, (SEQ ID NO: 2)
GGCTGCTTGCAGTAGTTGTGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCC, (SEQ ID NO: 3)
GGCTGCTTGCGGTAGTTATGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCC, (SEQ ID NO: 4)
GGCTGCTTGCGGTAGTTGTCTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCC, (SEQ ID NO: 5)
GGCTGCTTGCGGTAGTTGTGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAAAAATTCC, (SEQ ID NO: 6)
GGCTGCTTGCGGTAGTTGTGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCC, (SEQ ID NO: 7)
GGCTGCTTGCGGTAGTTGTGTAGCAGCAGCACAATGGCCGCAGACAAGGAA
AACAGTTTCTAGGAATTCN, (SEQ ID NO: 8)
GGCTGTTTGCGGTAGTAGTCTGTGTAGCAGCAGCACAATGGCCGCAGACGA
GGAAAACAGTTTCTAGGAA, (SEQ ID NO: 9)
AGTGCAGYRWTGYTGACTCTTCCAAGCTTAACATTTCTCASAARTCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 10)
AGTGCAGCAATGTTGACTCTTCCAAGCTTAACATTTCTCAGAAGTCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 11)
AGTGCAGCGATGCTGACTCTTCCAAGCTTAACATTTCTCACAAGTCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 12)
AGTGCAGCGTTGCTGACTCTTCCAAGCTTAACATTTCTCACAAATCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 13)
AGTGCAGTGATGCTGACTCTTCCAAGCTTAACATTTCTCACAAGTCAATTA
GCTTTGTACTGGGAGG, (SEQ ID NO: 14)
GTGTAGCAGCAGCACAATGGCCGCAGACAAGGAAAACAGTTTCTAGGAATT
CCTCGTATATAATTTTATATTTTTGACAAGATTAATGACCCATGCTCC, (SEQ ID NO: 15)
TGCARMGATGCTGACTCTTCCAAGCTTAACATTTCTCACAAGTCAATTAGC TTTGTACTGGGAGG,
(SEQ ID NO: 16) TGCTGACTCTTCCAAGCTTAACATTTCTCACAAGTCAATTAGCTTTGTACT
GGGAGGAGGGCGTGAAGGGCTGCTTGCG, (SEQ ID NO: 17)
CAAGGGACAAGGAAAAATTATCCAAACATTGTTTAAAACAATCATCATTAA
TTAGTAACACTTATCCAGGGGGGTTTTTAACCTTTCCCCCACTCAASGATT
ATTCTAATGTCAGAGTAGAATAAAAAATAAGTGCARMGATGCTGAC, (SEQ ID NO: 18)
GGAGGAGGAAAATAGGTAGTTTTTCAAAAGTTTTCAAAAATATGAAAAGAA
GAAATGAAATGGTACTTGGAAGAGATTGTTGAAATGGGAGAGACTATGGTG GC, (SEQ ID NO:
19) CAACTAAAAGGCAATGTCACTCCAATAATCACCAGAGTAATCAATTTGCTT
ATTGCTGTCCCTTTAAATATAGTTCTCTGG, (SEQ ID NO: 20)
GGAGAGACTATGGTGGCTTGTTTAGAAGCAGTTGAGATAGATCCAATTGAG
ATAGAGATATTGAGTATATAAACAAAAGAATGACAAATTAATAGTGTAATG
GATAACTTGACTTTGGCA, (SEQ ID NO: 21)
GTGTAATGGATAACTTGACTTTGGCAAATATTGTGAATTTTTGTGAAAGTA
CAACTAAAAGGCAATGTCACTCCAATAATCACCAG, (SEQ ID NO: 22)
GTAATCAATTTGCTTATTGCTGTCCCTTTAAATATAGTTCTCTGGTATCAA
CTAACATGTTTTTAACTAATGATGCTTCTTAAAGAAAAGGGAAAAGACCT, (SEQ ID NO: 23)
CCCTGGGCCCCTCAGGGGAGTCCCTGCTGGACAGTGAGACAGAGAATGACC
ATGATGATGCTTTCCT, (SEQ ID NO: 24)
GGGTTTATGTTTGATATRTAATGTAATTTTCTAATGCTAAATCAAGTGGTA
ATTTTGTTAGTCAAGTTGATTTAGTGGCTTGGGAAGAAAGCT, (SEQ ID NO: 25)
GAGACCCCCAGGTGTTGAGGCAGGGCTGGGGTGTCCCCTTCCAACCAGGCT
GTCAAGGCCCCAACTCTGGGGCAGAGGCAGTGGCAGGG, (SEQ ID NO: 26)
CATCCGTTTCACCTGCAGTTGAAGATCCGTGAGGTGCCCAGAAGATCATGC
AGTCAWCAGTCCCACG, (SEQ ID NO: 27)
GAKATAAGGAAGCTCGAGGAAGAGAAAAAACAACTGGAAGGAGAAATCATA
GATTTTTATAAAATGAMAGCTGCCTCTGAAGC, (SEQ ID NO: 28)
CCGTTTTGGAGGAGGAACAGATTCCATGTCCACTAGAATGGAATGAACAAG
AAATGGAGGAGGAAAATAGGTAGTTTTTCAAAAGTTTTCAAAAATATGAAA
AGAAGAAATGAAATGGTACTTGGAAGAGATTGTTGAAATGGGA, (SEQ ID NO: 29)
TGCTTCTTAAAGAAAAGGGAAAAGACCTTTTTCTTTCTTTCAGTCTTCAAT
GATTCACTGCTTCATCTCGCTCCACCAAAGATAAATGAAATCTACATCTC T, (SEQ ID NO:
30) CTTTCCCCCACTCAASGATTATTCTAATGTCAGAGTAGAATAAAAAATAAG
TGCARMGATGCTGACTCTTCCAAGCTTAACATTTCTCA, or (SEQ ID NO: 31)
GGGAGGAGGGCGTGAAGGGCTGCTTGCGGTAGTTGTGTAGCAGCAGCACAA
TGGCCGCAGACAAG.
[0035] In one embodiment, the reference sequence has at least 80%
sequence identity to at least one of SEQ ID NO:1-8.
[0036] In one embodiment, the reference sequence has at least 80%
sequence identity to at least one of SEQ ID NO:9-13.
[0037] A first set of sequences, SEQ ID NO:1-8, correspond to
sequences found in the human genome at chr1:121836-121905,
chr1:243203810-243203879, chr1:341419+341488, chr1:648175-648244,
chr2:243071825+243071894, chr3:197962362+197962431,
chr4:119569113+119569182, chr5:180768034+180768103,
chr6:132997-133066, chr6:170922434+170922503,
chr10:38753924+38753993, chr11:114056-114125,
chr16:90251439+90251508, chr19:183990-184059,
chr20:62933558+62933627, chrUn_g1000227:58864-58933,
chrY:26436540+26436609, and chrY:27525831-27525900.
[0038] A second set of sequences, SEQ ID NO:9-13, correspond to
sequences found in the human genome at chr1:224126101-224126167,
chr1:228152189+228152255, chr1:243203891-243203957,
chr1:341341+341407, chr1:648256-648322, chr2:243071747+243071813,
chr3:197962284+197962350, chr4:119569035+119569101,
chr5:180767956+180768022, chr6:133078-133144,
chr6:170922356+170922422, chr8:143260-143326,
chr10:38753846+38753912, chr11:114137-114203,
chr16:90251361+90251427, chr19:184071-184137,
chr20:62933480+62933546, and chrUn_gl000227:58945-59011.
[0039] In any nucleic acid sequence listing herein, the standard
IUPAC table of naturally-occurring and degenerate nucleotides is
used:
TABLE-US-00003 Symbol Description Bases represented A adenine A C
cytosine C G guanine G T thymine T U uracil U W Weak A, T S Strong
C, G M Amino A, C K Keto G, T R Purine A, G Y Pyrimidine C, T B Not
adenine C, G, T D Not cytosine A, G, T H Not guanine A, C, T V Not
thymine A, C, G N Any base (not a gap) A, C, G, T
[0040] Though not to be bound by theory, the present inventor has
found that each of the first set and the second set of sequences
are both highly repeated (.about.20 copies in the human genome),
physically dispersed throughout the human genome, and relatively
more resistant to disruption and/or duplication by FFPE than
typical genomic DNA sequences. As a result, a sequence having at
least 80% identity to one or more of SEQ ID NO:1-13 may be
particularly suitable as a reference sequence, especially in
samples suspected of being cancer tissue, particular FFPE-processed
tissue.
[0041] The amplifying steps yield an amplified sequence of interest
and an amplified reference sequence. Generally, so long as
performance of the amplifying steps is synchronized and
amplification has not proceeded to an extent where the quantity of
any reagent other than the amplified sequence of interest and the
amplified reference sequence is rate-limiting, at any point, the
relative amounts of the amplified sequence of interest and the
amplified reference sequence will be proportional to their copy
number in the genomic DNA of the sample.
[0042] Thus, the method may comprise quantifying the amplified
sequence of interest relative to the amplified reference sequence.
The quantifying may be performed by any technique known to the
person of ordinary skill in the art. For example, by the use of two
probes, each comprising a fluorescent moiety at a first end and a
quencher for that fluorescent moiety at a second end, with one
probe specifically hybridizing to the sequence of interest and the
other specifically hybridizing to the reference sequence, in TaqMan
qPCR, cleavage of the quencher by the action of Taq polymerase will
generate a fluorescence signal proportional to the amount of probe
hybridized to the sequence of interest or the reference sequence.
Thus, in a simple hypothetical non-limiting example, if the
fluorescence signal from the probe hybridizing to the reference
sequence is five times more intense than the fluorescence signal
from the probe hybridizing to the sequence of interest, the
relative quantity of the amplified sequence of interest would be
0.2. (As will be apparent to the person of ordinary skill in the
art, alternative mathematically equivalent expressions may be used
to arrive at a relative quantity).
[0043] In some embodiments, amplification of the TOI and the
reference sequence may be omitted. Techniques for quantifying
non-amplified nucleic acid sequences are known to the person of
ordinary skill in the art.
[0044] The measure of relative quantitation may be reported using
the term "fold change", which refers to the amount of amplified
product (which relates to the copy number) in the sequence of
interest relative to that of the reference genome target. Fold
change can be quantified using any of several available methods,
including but not limited to those described by Livak, et al.
(Methods, 25:402-408 (2001)), commercially available products such
as CopyCaller.TM. (Applied Biosystems), or any other suitable
algorithm for comparing amounts of fluorescence signals. In many
embodiments, fold change is determined by comparing the C.sub.T of
the sequence of interest to the C.sub.T of the reference genome
target. Some suitable algorithms include but are not limited to,
the methods described in U.S. application Ser. No. 13/107,786,
"Karyotyping Assay" filed on May 13, 2011, the disclosure of which
is hereby incorporated by reference in its entirety.
[0045] The quantifying step yields a relative quantified amplified
sequence of interest. The method may then comprise determining a
copy number of the sequence of interest from the relative
quantified amplified sequence of interest. Determining requires an
indication of the copy number of the reference sequence. Such an
indication may be provided by analysis of the genome of a
non-diseased sample from the subject or one or more members of the
subject's species. This technique may be especially suitable,
regarding samples suspected of being cancer tissue, for a reference
sequence that is one or more of highly repeated, physically
dispersed, and relatively resistant to disruption and/or
duplication by FFPE. For example, the copy number of a reference
sequence having at least 80% identity to one or more of SEQ ID
NO:1-13 in a non-diseased sample may be expected to be
substantially equal to the copy number of the reference sequence in
a sample suspected of being cancer tissue.
[0046] Continuing the simple hypothetical non-limiting example
begun above, if the copy number of the reference sequence is 20,
then the copy number of the amplified sequence of interest may be
determined to be 20*0.2=4. (As should be apparent, this is a simple
probe-based example of a copy number calculation. It is a routine
matter for the person of ordinary skill in the art, having the
benefit of the present disclosure, to perform copy number
calculation for other assay techniques, such as qPCR.)
[0047] The determined copy number of the sequence of interest may
be used for any purpose which would commend itself to the person of
ordinary skill in the art. In a particular embodiment, the method
may further comprise diagnosing the subject as having a
cancer-related biomarker, based on the sequence of interest being
associated with the cancer and the copy number being indicative of
the cancer.
[0048] In one embodiment, the present disclosure relates to a kit
comprising a first probe which specifically hybridizes to at least
a portion of at least one reference sequence having at least 80%
sequence identity to at least one portion of genomic DNA comprising
from about 60 to about 150 base pairs, wherein the at least one
portion is present in chr1-121790-133586, chr1-329448-341534,
chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes.
[0049] In a particular embodiment, the reference sequence has at
least 80% sequence identity to at least one of SEQ ID NO:1-31.
[0050] In a more particular embodiment, the reference sequence has
at least 80% sequence identity to at least one of SEQ ID
NO:1-13.
[0051] A "probe," as used herein, refers to a compound comprising a
nucleic acid sequence and a detectable moiety. As such, and for the
avoidance of doubt, any "probe" referred to herein is non-naturally
occurring.
[0052] In one embodiment, the first probe comprises a nucleic acid
sequence configured to specifically hybridize to at least the
portion of the at least one reference sequence, a fluorescent
reporter at a first end of the nucleic acid sequence, and a
fluorescent quencher at a second end of the nucleic acid
sequence.
[0053] In a further embodiment, the nucleic acid sequence is
configured to specifically hybridize to the entirety of at least
one reference sequence.
[0054] A percentage of sequence identity can be determined by any
technique known to the person of ordinary skill in the art. In some
embodiments, the reference sequence has at least 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, 99.5%, or 99.9% sequence identity to at least one of
SEQ ID NO:1-13.
[0055] By use of techniques known to the person of ordinary skill
in the art, the first probe may allow the detection of at least the
portion of the at least one reference sequence.
[0056] In addition to the first probe, the kit may comprise other
components. For example, the kit may further comprise a first
primer configured to specifically hybridize to a first end of the
at least one reference sequence, and a second primer configured to
specifically hybridize to a sequence complementary to a second end
of the at least one reference sequence.
[0057] By "primers" is meant nucleic acid molecules which, in the
presence of the at least one reference sequence and other
reagent(s), may allow amplification of the at least one reference
sequence.
[0058] Alternatively or in addition, the kit may further comprise a
second probe which specifically hybridizes to at least a portion of
at least one nucleic acid sequence of interest. Other than the
sequence to which it specifically hybridizes, the second probe may
have the same characteristics as the first probe described
above.
[0059] Any nucleic acid sequence of interest may be the
hybridization target of the second probe. In one embodiment, the
sequence of interest is a portion or the entirety of a gene
associated with a cancer.
[0060] Alternatively or in addition, the kit may further comprise a
third primer configured to specifically hybridize to a first end of
the at least one nucleic acid sequence of interest, and a fourth
primer configured to specifically hybridize to a sequence
complementary to a second end of the at least one nucleic acid
sequence of interest. In one embodiment, the present disclosure
relates to a composition, comprising a first probe which
specifically hybridizes to at least a portion of at least one
reference sequence having at least 80% sequence identity to at
least one portion of genomic DNA comprising from about 60 to about
150 base pairs, wherein the at least one portion is present in
chr1-121790-133586, chr1-329448-341534, chr1-648129-660266,
chr1-222643865-228172047, chr1-243203764-243215874,
chr10-38741930-38753964, chr11-114010-126106,
chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes.
[0061] In a particular embodiment, the reference sequence has at
least 80% sequence identity to at least one of SEQ ID NO:1-31.
[0062] In a more particular embodiment, the reference sequence has
at least 80% sequence identity to at least one of SEQ ID
NO:1-13.
[0063] The first probe may be substantially the same as the first
probe of the kit, described above.
[0064] The composition may further comprise one or more of (i) a
first primer configured to specifically hybridize to a first end of
at least one reference sequence, and a second primer configured to
specifically hybridize to a sequence complementary to a second end
of at least one reference sequence; (ii) a second probe which
specifically hybridizes to at least a portion of at least one
nucleic acid sequence of interest; or (iii) a third primer
configured to specifically hybridize to a first end of at least one
nucleic acid sequence of interest, and a fourth primer configured
to specifically hybridize to a sequence complementary to a second
end of at least one nucleic acid sequence of interest,
substantially the same as the corresponding further component(s) of
the kit, described above.
[0065] In one embodiment, the present disclosure relates to a
system, comprising:
[0066] a nucleic acid amplifier configured to amplify a nucleic
acid sequence of interest in a sample comprising genomic DNA of a
subject and amplify a reference sequence in the sample;
[0067] a reagent reservoir containing at least a first primer
configured to specifically hybridize to a first end of at least one
reference sequence, wherein the reference sequence has at least 80%
sequence identity to at least one portion of genomic DNA comprising
from about 60 to about 150 base pairs, wherein the at least one
portion is present in chr1-121790-133586, chr1-329448-341534,
chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes., and a second primer
configured to specifically hybridize to a sequence complementary to
a second end of at least one reference sequence;
[0068] a detector configured to provide a first indication relating
to an amount of the amplified sequence of interest and a second
indication relating to an amount of the amplified reference
sequence; and
[0069] a controller configured to quantify the amplified sequence
of interest relative to the amplified reference sequence, based at
least in part on the first indication and the second indication;
and determine a copy number of the sequence of interest from the
relative quantified amplified sequence of interest.
[0070] Nucleic acid amplifiers are known to the person of ordinary
skill in the art. Generally, nucleic acid amplifiers use one or
more primers and one or more chemical or enzymatic agents to copy a
template nucleic acid sequence, such as a sequence of interest or a
reference sequence. Such copying can be cycled multiple times to
yield relatively large amounts of the sequence of interest and the
reference sequence. Desirably, the nucleic acid amplifier is
configured to amplify the sequence of interest and the reference
sequence simultaneously and in parallel, e.g., by adding different
sets of primers, one specific to the sequence of interest and the
other specific to the reference sequence, to otherwise identical
reaction solutions, such as in different wells of a multi-well
plate.
[0071] The system also comprises a reagent reservoir. Generally,
the reagent reservoir contains materials required for the
amplification reaction to occur, such as primers, chemical or
enzymatic agents, free nucleotides incorporable into copies of
template sequences, etc. The reagent reservoir may also contain one
or more probes or other compounds comprising detectable moieties.
Any of these materials may be stored separately and/or two or more
thereof may be combined for storage in the reagent reservoir. These
materials are generally in aqueous solution and can be introduced
to reaction solution(s) by techniques known to the person of
ordinary skill in the art. Such introduction can occur once or
multiple times before, during, or after an amplification process.
For example, some reagent(s) may be added once per amplification
cycle.
[0072] In one embodiment, the reagent reservoir containing at least
a first primer configured to specifically hybridize to a first end
of the at least one reference sequence, wherein the reference
sequence has at least 80% sequence identity to at least one of SEQ
ID NO:1-31, such as SEQ ID NO:1-13, and a second primer configured
to specifically hybridize to a sequence complementary to a second
end of the at least one reference sequence.
[0073] The reference sequence, the determination of a sequence
identity percentage, and SEQ ID NO:1-38 are described elsewhere
herein.
[0074] The system also comprises a detector. Generally, the
detector may be configured to detect a probe for the sequence of
interest, the reference sequence, or both. Upon detection, the
detector may perform various signal processing and/or analysis
operations to provide a first indication relating to an amount of
the amplified sequence of interest and a second indication relating
to an amount of the amplified reference sequence.
[0075] The system also comprises a controller. The controller may
be configured to quantify the amplified sequence of interest
relative to the amplified reference sequence, based at least in
part on the first indication and the second indication; and
determine a copy number of the sequence of interest from the
relative quantified amplified sequence of interest. It may store
the determined copy number in a memory, display it to a user, write
it to a computer-readable file, or the like.
[0076] In a further embodiment, the controller may be configured to
diagnose the subject as having a cancer-related biomarker, based on
the sequence of interest being associated with the cancer and the
copy number being indicative of the cancer.
[0077] Although the nucleic acid amplifier, the reagent reservoir,
the detector, and the controller have been described separately
above, any two or more thereof may be components of a single
apparatus.
[0078] In certain embodiments, the disclosure provides:
[0079] 1. A method, comprising:amplifying a nucleic acid sequence
of interest in a sample comprising genomic DNA of a
subject;amplifying a reference sequence in the sample, wherein the
reference sequence has at least 80% sequence identity to at least
one portion of genomic DNA comprising from about 60 to about 150
base pairs, wherein the at least one portion is present in
chr1-121790-133586, chr1-329448-341534, chr1-648129-660266,
chr1-222643865-228172047, chr1-243203764-243215874,
chr10-38741930-38753964, chr11-114010-126106,
chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes;quantifying the amplified
sequence of interest relative to the amplified reference sequence;
and determining a copy number of the sequence of interest from the
relative quantified amplified sequence of interest.
[0080] 2. In the method, the reference sequence can have at least
80% sequence identity to at least one of SEQ ID NOs: 1-31.
[0081] 3. In the method, the reference sequence can have at least
80% sequence identity to at least one of SEQ ID NO:1-13.
[0082] 4. In the method, the sample can include tissue suspected of
being cancer tissue.
[0083] 5. In the method, the sample has been subjected to formalin
fixing and paraffin embedding (FFPE) prior to amplifying the
sequence of interest and amplifying the reference sequence.
[0084] 6. The method can also include: diagnosing the subject as
having a cancer-related biomarker, based on the sequence of
interest being associated with the cancer and the copy number being
indicative of the cancer.
[0085] 7. In the method, amplifying the sequence of interest and
amplifying the reference sequence can be performed by TaqMan
quantitative polymerase chain reaction (qPCR).
[0086] 8. A kit, comprising:a first probe which specifically
hybridizes to at least a portion of at least one reference sequence
having at least 80% sequence identity to at least one portion of
genomic DNA comprising from about 60 to about 150 base pairs,
wherein the at least one portion is present in chr1-121790-133586,
chr1-329448-341534, chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes
[0087] 9. In the kit, the reference sequence can have at least 80%
sequence identity to at least one of SEQ ID NO:1-31.
[0088] 10. In the kit, the reference sequence can have at least 80%
sequence identity to at least one of SEQ ID NO:1-13.
[0089] 11. In the kit, the first probe can include a nucleic acid
sequence configured to specifically hybridize to at least the
portion of the at least one reference sequence, a fluorescent
reporter at a first end of the nucleic acid sequence, and a
fluorescent quencher at a second end of the nucleic acid
sequence.
[0090] 12. The kit can further include: a first primer configured
to specifically hybridize to a first end of the at least one
reference sequence, and a second primer configured to specifically
hybridize to a sequence complementary to a second end of the at
least one reference sequence.
[0091] 13. The kit can further include: a second probe which
specifically hybridizes to at least a portion of at least one
nucleic acid sequence of interest.
[0092] 14. The kit can further include: a third primer configured
to specifically hybridize to a first end of the at least one
nucleic acid sequence of interest, and a fourth primer configured
to specifically hybridize to a sequence complementary to a second
end of the at least one nucleic acid sequence of interest.
[0093] 15. A composition that includes: a first probe which
specifically hybridizes to at least a portion of at least one
reference sequence having at least 80% sequence identity to at
least one portion of genomic DNA comprising from about 60 to about
150 base pairs, wherein the at least one portion is present in
chr1-121790-133586, chr1-329448-341534, chr1-648129-660266,
chr1-222643865-228172047, chr1-243203764-243215874,
chr10-38741930-38753964, chr11-114010-126106,
chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes.
[0094] 16. In the composition, the reference sequence can have at
least 80% sequence identity to at least one of SEQ ID NO:1-31.
[0095] 17. In the composition, the reference sequence can have at
least 80% sequence identity to at least one of SEQ ID NO:1-13.
[0096] 18. In the composition, the first probe can include a
nucleic acid sequence configured to specifically hybridize to at
least the portion of the at least one reference sequence, a
fluorescent reporter at a first end of the nucleic acid sequence,
and a fluorescent quencher at a second end of the nucleic acid
sequence.
[0097] 19. The composition can further include: a first primer
configured to specifically hybridize to a first end of the at least
one reference sequence, and a second primer configured to
specifically hybridize to a sequence complementary to a second end
of the at least one reference sequence.
[0098] 20. The composition can further include: a second probe
which specifically hybridizes to at least a portion of at least one
nucleic acid sequence of interest.
[0099] 21. The composition can further include: a third primer
configured to specifically hybridize to a first end of the at least
one nucleic acid sequence of interest, and a fourth primer
configured to specifically hybridize to a sequence complementary to
a second end of the at least one nucleic acid sequence of
interest.
[0100] 22. A system that includes: a nucleic acid amplifier
configured to amplify a nucleic acid sequence of interest in a
sample comprising genomic DNA of a subject and amplify a reference
sequence in the sample, a reagent reservoir containing at least a
first primer configured to specifically hybridize to a first end of
the at least one reference sequence, wherein the reference sequence
has at least 80% sequence identity to at least one portion of
genomic DNA comprising from about 60 to about 150 base pairs,
wherein the at least one portion is present in chrl-121790-133586,
chr1-329448-341534, chr1-648129-660266, chr1-222643865-228172047,
chr1-243203764-243215874, chr10-38741930-38753964,
chr11-114010-126106, chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes; , and a second primer
configured to specifically hybridize to a sequence complementary to
a second end of the at least one reference sequence; a detector
configured to provide a first indication relating to an amount of
the amplified sequence of interest and a second indication relating
to an amount of the amplified reference sequence; and a controller
configured to quantify the amplified sequence of interest relative
to the amplified reference sequence, based at least in part on the
first indication and the second indication; and determine a copy
number of the sequence of interest from the relative quantified
amplified sequence of interest.
[0101] 23. In the system, the reference sequence can have at least
80% sequence identity to at least one of SEQ ID NO:1-31.
[0102] 24. In the system, the reference sequence can have at least
80% sequence identity to at least one of SEQ ID NO:1-13.
[0103] 25. In the system, the sample can include tissue suspected
of being cancer tissue.
[0104] 26. In the system, the sample has been subjected to formalin
fixing and paraffin embedding (FFPE).
[0105] 27. In the system, the controller is further configured to
indicate the subject as having a cancer-related biomarker, based on
the sequence of interest being associated with the cancer and the
copy number being indicative of the cancer.
[0106] 28. In the system, the nucleic acid amplifier is configured
to amplify the sequence of interest and amplify the reference
sequence by TaqMan quantitative polymerase chain reaction
(qPCR).
[0107] 29. A method that includes quantifying a nucleic acid
sequence of interest in a sample comprising genomic DNA of a
subject relative to a reference sequence in the sample, wherein the
reference sequence has at least 80% sequence identity to at least
one portion of genomic DNA comprising from about 60 to about 150
base pairs, wherein the at least one portion is present in
chr1-121790-133586, chr1-329448-341534, chr1-648129-660266,
chr1-222643865-228172047, chr1-243203764-243215874,
chr10-38741930-38753964, chr11-114010-126106,
chr16-90239446-90251554, chr19-183944-196032,
chr2-114323560-114323652, chr2-243064480-243071940,
chr20-62921559-62933673, chr3-197950387-197962431,
chr4-119557144-120325498, chr4-165196360-165199636,
chr5-180756063-180768074, chr6-170921836-170922549,
chr7-39837560-63231088, chr7-128296352-128298474,
chr8-143133-150475, chr9-49679-49771, chrY-26424506-27537936, or
chr6-132951-145064; the at least one portion is present in at least
a first minimum number of copies in the genome; and at least one
copy of the at least one portion is present on each of at least a
second minimum number of chromosomes; and determining a copy number
of the sequence of interest from the relative quantified nucleic
acid sequence of interest.
[0108] 30. In the method, the reference sequence can have at least
80% sequence identity to at least one of SEQ ID NO:1-38.
[0109] 31. In the method, the reference sequence can have at least
80% sequence identity to at least one of SEQ ID NO:1-13.
[0110] 32. In the method, the sample includes tissue suspected of
being cancer tissue.
[0111] 33. In the method, the sample has been subjected to formalin
fixing and paraffin embedding (FFPE) prior to amplifying the
sequence of interest and amplifying the reference sequence.
[0112] 34. The method can further include: diagnosing the subject
as having a cancer-related biomarker, based on the sequence of
interest being associated with the cancer and the copy number being
indicative of the cancer.
[0113] The following examples are included to demonstrate
particular embodiments of the disclosure. It should be appreciated
by those of skill in the art that the techniques disclosed in the
examples which follow represent techniques discovered by the
inventor to function well in the practice of the disclosure, and
thus can be considered to constitute particular modes for its
practice. However, those of skill in the art should, in light of
the present disclosure, appreciate that many changes can be made in
the specific embodiments which are disclosed and still obtain a
like or similar result without departing from the spirit and scope
of the disclosure.
EXAMPLE 1
[0114] SEQ ID NO:1-13 were identified by a two-stage process.
First, a bioinformatics algorithm was used to identify candidate
targets in the genome that met certain criteria associated with
substantially normal copy number, even in cancer cells subjected to
FFPE. Generally, sequences suspected of being relatively resistant
to copy number abnormalities in cancer cells and/or cells subjected
to FFPE were used to query publicly-available human genomic
databases, and only those sequences returning multiple hits were
considered as candidate targets for further testing.
[0115] The first stage identified SEQ ID NO:1-31. SEQ ID NO:2-8 and
10-13 are located in the genome at the loci given supra. SEQ ID
NO:14-31 are located in the genome at least at the following
loci:
[0116] SEQ ID NO:14, chr10 38753941 . . . 38753964 . . . 38754039
chr11.11250s.
[0117] SEQ ID NO:15, chr10 38753848 . . . 38753866 . . . 38753912
chr11.11350s.
[0118] SEQ ID NO:16, chr10 38753856 . . . 38753896 . . . 38753934
chr1.5850s.
[0119] SEQ ID NO:17, chr10 38753715 . . . 38753794 . . . 38753862
chr1.5950s.
[0120] SEQ ID NO:18, chr10 38753145 . . . 38753206 . . . 38753248
chr16.2650s.
[0121] SEQ ID NO:19, chr10 38753377 . . . 38753408 . . . 38753457
chr16.2850s.
[0122] SEQ ID NO:20, chr10 38753232 . . . 38753257 . . . 38753351
chr20.2650s.
[0123] SEQ ID NO:21, chr10 38753326 . . . 38753360 . . . 38753411
chr20.2750s.
[0124] SEQ ID NO:22, chr10 38753413 . . . 38753454 . . . 38753513
chr20.2850s.
[0125] SEQ ID NO:23, chr11 123673 . . . 123696 . . . 123739
chr20.3850s.
[0126] SEQ ID NO:24, chr10 38750797 . . . 38750847 . . . 38750889
chr3.150s.
[0127] SEQ ID NO:25, chr10 38741930 . . . 38741975 . . . 38742018
chr3.1550s.
[0128] SEQ ID NO:26, chr10 38742246 . . . 38742274 . . . 38742312
chr3.1850s.
[0129] SEQ ID NO:27, chr10 38746651 . . . 38746676 . . . 38746733
chr3.6250s.
[0130] SEQ ID NO:28, chr10 38753090 . . . 38753126 . . . 38753234
chr5.2550s.
[0131] SEQ ID NO:29, chr10 38753486 . . . 38753535 . . . 38753587
chr5.2950s.
[0132] SEQ ID NO:30, chr10 38753797 . . . 38753835 . . . 38753885
chr5.3250s.
[0133] SEQ ID NO:31, chr10 38753907 . . . 3/8753935 . . . 38753971
chr5.3350s.
TABLE-US-00004 Twenty-three larger regions to which the candidate
sequences mapped were as Starting Ending follows: Region Chromosome
position position 1 chr1 121790 133586 2 chr1 329448 341534 3 chr1
648129 660266 4 chr1 222643865 228172047 5 chr1 243203764 243215874
6 chr10 38741930 38753964 7 chr11 114010 126106 8 chr16 90239446
90251554 9 chr19 183944 196032 10 chr2 114323560 114323652 11 chr2
243064480 243071940 12 chr20 62921559 62933673 13 chr3 197950387
197962431 14 chr4 119557144 120325498 15 chr4 165196360 165199636
16 chr5 180756063 180768074 17 chr6 170921836 170922549 18 chr7
39837560 63231088 19 chr7 128296352 128298474 20 chr8 143133 150475
21 chr9 49679 49771 22 chrY 26424506 27537936 23 chr6 132951
145064
[0134] (As the person of ordinary skill in the art is aware, as of
this writing, the resistance of a sequence to copy number
abnormalities in cancer cells and/or cells subjected to FFPE cannot
be predicted with sufficient accuracy from sequence data alone.
Further testing, such as that described below, is required to
identify sequences suitable for use as a multicopy reference
assay).
[0135] Numerous qPCR, TaqMan reference assays were designed using
the candidate targets and tested on cancer samples alongside a
qPCR, TaqMan target of interest (TOI) assay. The assays mapped to
the target regions many-fold:
TABLE-US-00005 number of number of id hits chromosomes
chr11.11250s.1 16 11 chr11.11350s.1 17 12 chr1.5850s.1 17 11
chr1.5950s.1 15 11 chr16.2650s.1 15 11 chr16.2850s.1 15 11
chr16.3250s.1 16 11 chr16.3350s.1 16 11 chr20.2650s.1 16 11
chr20.2750s.1 16 11 chr20.2850s.1 16 11 chr20.3250s.1 17 12
chr20.3350s.1 16 11 chr20.3850s.1 17 11 chr2.3250s.1 15 11
chr3.150s.1 15 12 chr3.1550s.1 16 11 chr3.1850s.1 23 11
chr3.6250s.1 18 13 chr5.2550s.1 17 12 chr5.2850s.1 15 11
chr5.2950s.1 19 13 chr5.3250s.1 17 12 chr5.3350s.1 16 11
[0136] After initial testing, two targets provided results
suggestive of substantially normal copy number, even in cancer
cells subjected to FFPE, and were selected for a final round of
testing on an expanded panel of samples.
[0137] The final round of testing evaluated the performance of
these two de novo qPCR multicopy reference assays, a conventional
qPCR single copy reference assay (RNaseP) and five qPCR TOI assays
for the IRS2 gene. The qPCR assays all used as template genomic DNA
extracted from 35 colorectal normal tissue samples subjected to
FFPE. All assays were performed in duplicate, with the reference
assay and target of interest assay run in separate wells to
generate accurate Cq values.
[0138] The first multicopy reference assay, corresponding to SEQ ID
NO:1-8, used a first set comprising forward primer, reverse primer,
and probe sequence. The second multicopy reference assay,
corresponding to SEQ ID NO:9-13, used a second set comprising
forward primer, reverse primer, and probe sequence.
[0139] The expectation was that a result of 2 copies for the IRS2
gene should be determined for normal samples, if a test generated
accurate results. A snapshot summary of the results is provided in
FIGS. 1A-3B for each of the three reference assays: RNaseP (FIGS.
1A-1B), SEQ ID NO:1-8 (FIGS. 2A-2B), and SEQ ID NO:9-13 (FIGS.
3A-3B). In each figure, the copy number is plotted on the y-axis
and the 35 samples in duplicate times the five different IRS2 TOI
assays are plotted on the x-axis. Each figure contains 350 data
points.
[0140] The results depended not only on the reference assay used,
but also the IRS2 TOI assay used. The two multicopy reference
assays performed well, along with the first 3 IRS2 TOI assays. In
each figure, subfigure A has decimal point calculated copy number,
and subfigure B has rounded copy number.
[0141] All of the compositions, methods, and/or systems disclosed
and claimed herein can be made and executed without undue
experimentation in light of the present disclosure. While the
compositions and methods of this disclosure have been described in
terms of particular embodiments, it will be apparent to those of
skill in the art that variations may be applied to the
compositions, methods, and/or systems and in the steps or in the
sequence of steps of the method described herein without departing
from the concept, spirit and scope of the disclosure. More
specifically, it will be apparent that certain agents which are
both chemically and physiologically related may be substituted for
the agents described herein while the same or similar results would
be achieved. All such similar substitutes and modifications
apparent to those skilled in the art are deemed to be within the
spirit, scope and concept of the disclosure as defined by the
appended claims.
Sequence CWU 1
1
31170DNAHomo sapiensmisc_feature70n = A,T,C or G 1ggctgyttgc
rgtagtwrts trkswrsmrs mmrmwsrmyg smsrcarrsr arrmarwyws 60twdvwakkmn
70270DNAHomo sapiens 2ggctgcttgc agtagttgtg tagcagcagc acaatggccg
cagacaagga aaacagtttc 60taggaattcc 70370DNAHomo sapiens 3ggctgcttgc
ggtagttatg tagcagcagc acaatggccg cagacaagga aaacagtttc 60taggaattcc
70470DNAHomo sapiens 4ggctgcttgc ggtagttgtc tagcagcagc acaatggccg
cagacaagga aaacagtttc 60taggaattcc 70570DNAHomo sapiens 5ggctgcttgc
ggtagttgtg tagcagcagc acaatggccg cagacaagga aaacagtttc 60taaaaattcc
70670DNAHomo sapiens 6ggctgcttgc ggtagttgtg tagcagcagc acaatggccg
cagacaagga aaacagtttc 60taggaattcc 70770DNAHomo
Sapiensmisc_feature70n = A,T,C or G 7ggctgcttgc ggtagttgtg
tagcagcagc acaatggccg cagacaagga aaacagtttc 60taggaattcn
70870DNAHomo Sapiens 8ggctgtttgc ggtagtagtc tgtgtagcag cagcacaatg
gccgcagacg aggaaaacag 60tttctaggaa 70967DNAHomo sapiens 9agtgcagyrw
tgytgactct tccaagctta acatttctca saartcaatt agctttgtac 60tgggagg
671067DNAHomo sapiens 10agtgcagcaa tgttgactct tccaagctta acatttctca
gaagtcaatt agctttgtac 60tgggagg 671167DNAHomo sapiens 11agtgcagcga
tgctgactct tccaagctta acatttctca caagtcaatt agctttgtac 60tgggagg
671267DNAHomo sapiens 12agtgcagcgt tgctgactct tccaagctta acatttctca
caaatcaatt agctttgtac 60tgggagg 671367DNAHomo sapiens 13agtgcagtga
tgctgactct tccaagctta acatttctca caagtcaatt agctttgtac 60tgggagg
671499DNAHomo sapiens 14gtgtagcagc agcacaatgg ccgcagacaa ggaaaacagt
ttctaggaat tcctcgtata 60taattttata tttttgacaa gattaatgac ccatgctcc
991565DNAHomo sapiens 15tgcarmgatg ctgactcttc caagcttaac atttctcaca
agtcaattag ctttgtactg 60ggagg 651679DNAHomo sapiens 16tgctgactct
tccaagctta acatttctca caagtcaatt agctttgtac tgggaggagg 60gcgtgaaggg
ctgcttgcg 7917148DNAHomo sapiens 17caagggacaa ggaaaaatta tccaaacatt
gtttaaaaca atcatcatta attagtaaca 60cttatccagg ggggttttta acctttcccc
cactcaasga ttattctaat gtcagagtag 120aataaaaaat aagtgcarmg atgctgac
14818104DNAHomo sapiens 18ggaggaggaa aataggtagt ttttcaaaag
ttttcaaaaa tatgaaaaga agaaatgaaa 60tggtacttgg aagagattgt tgaaatggga
gagactatgg tggc 1041981DNAHomo sapiens 19caactaaaag gcaatgtcac
tccaataatc accagagtaa tcaatttgct tattgctgtc 60cctttaaata tagttctctg
g 8120120DNAHomo sapiens 20ggagagacta tggtggcttg tttagaagca
gttgagatag atccaattga gatagagata 60ttgagtatat aaacaaaaga atgacaaatt
aatagtgtaa tggataactt gactttggca 1202186DNAHomo sapiens
21gtgtaatgga taacttgact ttggcaaata ttgtgaattt ttgtgaaagt acaactaaaa
60ggcaatgtca ctccaataat caccag 8622101DNAHomo sapiens 22gtaatcaatt
tgcttattgc tgtcccttta aatatagttc tctggtatca actaacatgt 60ttttaactaa
tgatgcttct taaagaaaag ggaaaagacc t 1012367DNAHomo sapiens
23ccctgggccc ctcaggggag tccctgctgg acagtgagac agagaatgac catgatgatg
60ctttcct 672493DNAHomo sapiens 24gggtttatgt ttgatatrta atgtaatttt
ctaatgctaa atcaagtggt aattttgtta 60gtcaagttga tttagtggct tgggaagaaa
gct 932589DNAHomo sapiens 25gagaccccca ggtgttgagg cagggctggg
gtgtcccctt ccaaccaggc tgtcaaggcc 60ccaactctgg ggcagaggca gtggcaggg
892667DNAHomo sapiens 26catccgtttc acctgcagtt gaagatccgt gaggtgccca
gaagatcatg cagtcawcag 60tcccacg 672783DNAHomo sapiens 27gakataagga
agctcgagga agagaaaaaa caactggaag gagaaatcat agatttttat 60aaaatgamag
ctgcctctga agc 8328145DNAHomo sapiens 28ccgttttgga ggaggaacag
attccatgtc cactagaatg gaatgaacaa gaaatggagg 60aggaaaatag gtagtttttc
aaaagttttc aaaaatatga aaagaagaaa tgaaatggta 120cttggaagag
attgttgaaa tggga 14529102DNAHomo sapiens 29tgcttcttaa agaaaaggga
aaagaccttt ttctttcttt cagtcttcaa tgattcactg 60cttcatctcg ctccaccaaa
gataaatgaa atctacatct ct 1023089DNAHomo sapiens 30ctttccccca
ctcaasgatt attctaatgt cagagtagaa taaaaaataa gtgcarmgat 60gctgactctt
ccaagcttaa catttctca 893165DNAHomo sapiens 31gggaggaggg cgtgaagggc
tgcttgcggt agttgtgtag cagcagcaca atggccgcag 60acaag 65
* * * * *