TMPRSS6 iRNA COMPOSITIONS AND METHODS OF USE THEREOF

Abstract

The invention relates to RNAi agents, e.g, double-stranded RNAi agents, targeting the TMPRSS6 gene, and methods of using such RNAi agents to inhibit expression of TMPRSS6 and methods of treating subjects having a TMPRSS6 associated disorder, e.g., an iron overload associated disorder, such as .beta.-thalassemia or hemochromatosis.

Description

RELATED APPLICATIONS

[0001] This application is a continuation of U.S. patent application Ser. No. 16/191,579, filed on Nov. 15, 2018, which is a divisional of U.S. patent application Ser. No. 15/695,254, filed on Sep. 5, 2017, which is a continuation of U.S. patent application Ser. No. 14/947,025, filed on Nov. 20, 2015, now U.S. Pat. No. 9,783,806, issued on Oct. 10, 2017, which is a 35 .sctn. U.S.C. 111(a) continuation application which claims the benefit of priority to PCT/US2014/039149, filed on May 22, 2014, which, in turn, claims priority to U.S. Provisional Patent Application No. 61/826,178, filed on May 22, 2013, and U.S. Provisional Patent Application No. 61/912,988, filed on Dec. 6, 2013. The entire contents of each of the foregoing patent applications are hereby incorporated herein by reference.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Dec. 7, 2020, is named 121301_00707_SL.txt and is 449,779 bytes in size.

BACKGROUND OF THE INVENTION

[0003] TMPRSS6 (Transmembrane Protease, Serine 6) gene encodes TMPRSS6, also known as matriptase-2, a type II serine protease. It is primarily expressed in the liver, although high levels of TMPRSS6 mRNA are also found in the kidney, with lower levels in the uterus and much smaller amounts detected in many other tissues (Ramsay et al., Haematologica (2009), 94(6), 840-849). TMPRSS6 plays a role in iron homeostatis by binding and proteolytically degrading the hepcidin activator and BMP co-receptor HJV (hemojuvelin), which causes down-regulation of hepcidin levels.

[0004] TMPRSS6 consists of a short N-terminal intracytoplasmic tail, a type II transmembrane domain, a stem region composed of two extracellular CUB (complement factor Cls/Clr, urchin embryonic growth factor and BMP (bone morphogenetic protein)) domains, three LDLR (low-density-lipoprotein receptor class A) domains, and a C-terminal trypsin-like serine protease domain. There are also consensus sites for N-glycosylation in the extracellular domain, and a potential phosphorylation site in the intracytoplasmic tail region.

[0005] Numberous disorders can be associated with iron overload, a condition characterized by increased levels of iron. Iron overload can result in excess iron deposition in various tissues and can lead to tissue and organ damage. Accordingly, methods for effective treatment of disorders associated with iron overload are currently needed.

SUMMARY OF THE INVENTION

[0006] The present invention provides compositions comprising RNAi agents, e.g, double-stranded iRNA agents, targeting TMPRSS6. The present invention also provides methods using the compositions of the invention for inhibiting TMPRSS6 expression and for treating TMPRSS6 associated disorders, e.g., iron overload associated disorders, such as thalassemia, e.g., .beta.-thalassemia, or hemochromatosis.

[0007] Accordingly, in one aspect, the present invention provides RNAi agents, e.g., double-stranded RNAi agents, capable of inhibiting the expression of TMPRSS6 (matriptase-2) in a cell, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO: 10,

[0008] wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and

[0009] wherein the sense strand is conjugated to a ligand attached at the 3'-terminus.

[0010] In one embodiment, all of the nucleotides of said sense strand and all of the nucleotides of said antisense strand are modified nucleotides.

[0011] In one embodiment, the sense strand and the antisense strand comprise a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12.

[0012] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5' phosphate or 5' phosphate mimic (see, e.g, PCT Publication No. WO 2011/005860), and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

[0013] In one embodiment, at least one strand comprises a 3' overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0014] In another aspect, the present invention provides RNAi agents, e.g., double-stranded RNAi agents, capable of inhibiting the expression of TMPRSS6 (matriptase-2) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding TMPRSS6, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III):

sense: 5'n.sub.p-N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.- j--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--(X'X'X').sub.k--N.sub.b'--Y'Y'Y'--N.sub.b'-(Z'Z'Z')- .sub.l--N.sub.a'-n.sub.q'5' (III)

[0015] wherein:

[0016] i, j, k, and l are each independently 0 or 1;

[0017] p, p', q, and q' are each independently 0-6;

[0018] each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;

[0019] each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 nucleotides which are either modified or unmodified or combinations thereof;

[0020] each n.sub.p, n.sub.p', n.sub.q, and n.sub.q', each of which may or may not be present, independently represents an overhang nucleotide;

[0021] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides;

[0022] modifications on N.sub.b differ from the modification on Y and modifications on N.sub.b' differ from the modification on Y'; and

[0023] wherein the sense strand is conjugated to at least one ligand.

[0024] In one embodiment, i is 0; j is 0; i is 1; j is 1; both i and j are 0; or both i and j are 1. In another embodiment, k is 0; 1 is 0; k is 1; 1 is 1; both k and l are 0; or both k and l are 1.

[0025] In one embodiment, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.

[0026] In one embodiment, YYY motif occurs at or near the cleavage site of the sense strand.

[0027] In one embodiment, Y'Y'Y' motif occurs at the 11, 12 and 13 positions of the antisense strand from the 5'-end.

[0028] In one embodiment, Y' is 2'-O-methyl.

[0029] In one embodiment, formula (III) is represented by formula (IIIa):

sense: 5'n.sub.p-N.sub.a--YYY--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--Y'Y'Y'--N.sub.a'-n.sub.q'5' (IIIa).

[0030] In another embodiment, formula (III) is represented by formula (IIIb):

sense: 5'n.sub.p-N.sub.a--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--Y'Y'Y'--N.sub.b'--Z'Z'Z'--N.sub.a'-n.sub.q'5' (IIIb)

[0031] wherein each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 1-5 modified nucleotides.

[0032] In yet another embodiment, formula (III) is represented by formula (IIIc):

sense: 5'n.sub.p-N.sub.a--XXX--N.sub.b--YYY--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--X'X'X'--N.sub.b'--Y'Y'Y'--N.sub.a'-n.sub.q'5' (IIIc)

[0033] wherein each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 1-5 modified nucleotides.

[0034] In one embodiment, formula (III) is represented by formula (IIId):

sense: 5'n.sub.p-N.sub.a--XXX--N.sub.b--YYY--N.sub.b--ZZZ--N.sub.a-n.sub- .q3'

antisense: 3'n.sub.p'--N.sub.a'--X'X'X'--N.sub.b'--Y'Y'Y'--N.sub.b'--Z'Z'Z'--N.sub.a- '-n.sub.q'5' (IIId)

[0035] wherein each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 1-5 modified nucleotides and each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 2-10 modified nucleotides.

[0036] In one embodiment, the double-stranded region is 15-30 nucleotide pairs in length. In another embodiment, the double-stranded region is 17-23 nucleotide pairs in length. In yet another embodiment, the double-stranded region is 17-25 nucleotide pairs in length. In one embodiment, the double-stranded region is 23-27 nucleotide pairs in length. In another embodiment, the double-stranded region is 19-21 nucleotide pairs in length. In another embodiment, the double-stranded region is 21-23 nucleotide pairs in length. In one embodiment, each strand has 15-30 nucleotides. In another embodiment, each strand has 19-30 nucleotides.

[0037] In one embodiment, the modifications on the nucleotides are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof. In another embodiment, the modifications on the nucleotides are 2'-O-methyl or 2'-fluoro modifications.

[0038] In one embodiment, the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In another embodiment, the ligand is

##STR00001##

[0039] In one embodiment, the ligand is attached to the 3' end of the sense strand.

[0040] In one embodiment, the RNAi agent is conjugated to the ligand as shown in the following schematic

##STR00002##

wherein X is O or S. In a specific embodiment, X is O.

[0041] In one embodiment, the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

[0042] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3'-terminus of one strand. In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand.

[0043] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5'-terminus of one strand. In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand.

[0044] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the both the 5'- and 3'-terminus of one strand. In one embodiment, the strand is the antisense strand.

[0045] In one embodiment, the RNAi agent comprises 6-8 phosphorothioate internucleotide linkages.

[0046] In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5'-terminus or the 3'-terminus.

[0047] In one embodiment, the base pair at the 1 position of the 5'-end of the antisense strand of the duplex is an AU base pair.

[0048] In one embodiment, the Y nucleotides contain a 2'-fluoro modification.

[0049] In one embodiment, the Y' nucleotides contain a 2'-O-methyl modification.

[0050] In one embodiment, p'>0. In another embodiment, p'=2.

[0051] In one embodiment, q'=0, p=0, q=0, and p' overhang nucleotides are complementary to the target mRNA. In another embodiment, q'=0, p=0, q=0, and p' overhang nucleotides are non-complementary to the target mRNA.

[0052] In one embodiment, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.

[0053] In one embodiment, at least one n.sub.p' is linked to a neighboring nucleotide via a phosphorothioate linkage.

[0054] In one embodiment, all n.sub.p' are linked to neighboring nucleotides via phosphorothioate linkages.

[0055] In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12.

[0056] In one embodiment, the RNAi agent is AD-59743. In another embodiment, the RNAi agent is AD-60940.

[0057] In one aspect, the present invention provides double stranded RNAi agents for inhibiting expression of TMPRSS6 in a cell,

[0058] wherein the double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region,

[0059] wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO: 10,

[0060] wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification,

[0061] wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus,

[0062] wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification,

[0063] wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus, and

[0064] wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a branched bivalent or trivalent linker at the 3'-terminus.

[0065] In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification.

[0066] In another aspect, the present invention provides RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting the expression of TMPRSS6 (matriptase-2) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding TMPRSS6, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III):

sense: 5'n.sub.p-N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.- j--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--(X'X'X').sub.k--N.sub.b'--Y'Y'Y'--N.sub.b'--(Z'Z'Z'- ).sub.l--N.sub.a'-n.sub.q'5' (III)

[0067] wherein:

[0068] i, j, k, and l are each independently 0 or 1;

[0069] p, p', q, and q' are each independently 0-6;

[0070] each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;

[0071] each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 nucleotides which are either modified or unmodified or combinations thereof;

[0072] each n.sub.p, n.sub.p', n.sub.q, and n.sub.q', each of which may or may not be present independently represents an overhang nucleotide;

[0073] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0074] modifications on N.sub.b differ from the modification on Y and modifications on N.sub.b' differ from the modification on Y'; and

[0075] wherein the sense strand is conjugated to at least one ligand.

[0076] In yet another aspect, the present invention provides RNAi agents, e.g, double stranded RNAi agents, capable of inhibiting the expression of TMPRSS6 (matriptase-2) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding TMPRSS6, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III):

sense: 5'n.sub.p-N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.- j--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--(X'X'X').sub.k--N.sub.b'--Y'Y'Y'--N.sub.b'--(Z'Z'Z'- ).sub.l--N.sub.a'-n.sub.q'5' (III)

[0077] wherein:

[0078] i, j, k, and l are each independently 0 or 1;

[0079] each n.sub.p, n.sub.q, and n.sub.q', each of which may or may not be present, independently represents an overhang nucleotide;

[0080] p, q, and q' are each independently 0-6;

[0081] n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via a phosphorothioate linkage;

[0082] each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;

[0083] each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 nucleotides which are either modified or unmodified or combinations thereof; [0084] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0085] modifications on N.sub.b differ from the modification on Y and modifications on N.sub.b' differ from the modification on Y'; and

[0086] wherein the sense strand is conjugated to at least one ligand.

[0087] In a further aspect, the present invention provides RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting the expression of TMPRSS6 (matriptase-2) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding TMPRSS6, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III):

sense: 5'n.sub.p-N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.- j--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--(X'X'X').sub.k--N.sub.b'--Y'Y'Y'--N.sub.b'--(Z'Z'Z'- ).sub.l--N.sub.a'-n.sub.q'5' (III)

[0088] wherein:

[0089] i, j, k, and l are each independently 0 or 1;

[0090] each n.sub.p, n.sub.q, and n.sub.q', each of which may or may not be present, independently represents an overhang nucleotide;

[0091] p, q, and q' are each independently 0-6;

[0092] n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via a phosphorothioate linkage;

[0093] each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;

[0094] each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 nucleotides which are either modified or unmodified or combinations thereof;

[0095] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0096] modifications on N.sub.b differ from the modification on Y and modifications on N.sub.b' differ from the modification on Y'; and

[0097] wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0098] In another aspect, the present invention provides RNAi agents, e.g., double stranded RNAi agents capable of inhibiting the expression of TMPRSS6 (matriptase-2) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding TMPRSS6, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III):

sense: 5'n.sub.p-N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.- j--N.sub.a-n.sub.q3'

antisense:3'n.sub.p'--N.sub.a'--(X'X'X').sub.k--N.sub.b'--Y'Y'Y'--N.sub.- b'--(Z'Z'Z').sub.l--N.sub.a'-n.sub.q'5' (III)

[0099] wherein:

[0100] i, j, k, and l are each independently 0 or 1;

[0101] each n.sub.p, n.sub.q, and n.sub.q', each of which may or may not be present, independently represents an overhang nucleotide;

[0102] p, q, and q' are each independently 0-6;

[0103] n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via a phosphorothioate linkage;

[0104] each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;

[0105] each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 nucleotides which are either modified or unmodified or combinations thereof;

[0106] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0107] modifications on N.sub.b differ from the modification on Y and modifications on N.sub.b' differ from the modification on Y';

[0108] wherein the sense strand comprises at least one phosphorothioate linkage; and

[0109] wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0110] In yet another aspect, the present invention provides RNAi agents, e.g, double stranded RNAi agents, capable of inhibiting the expression of TMPRSS6 (matriptase-2) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding TMPRSS6, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III):

sense: 5'n.sub.p-N.sub.a--YYY--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--Y'Y'Y'--N.sub.a'-n.sub.q'5' (IIIa)

[0111] wherein:

[0112] each n.sub.p, n.sub.q, and n.sub.q', each of which may or may not be present, independently represents an overhang nucleotide;

[0113] p, q, and q' are each independently 0-6;

[0114] n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via a phosphorothioate linkage;

[0115] each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;

[0116] YYY and Y'Y'Y' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0117] wherein the sense strand comprises at least one phosphorothioate linkage; and

[0118] wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0119] In one embodiment, the present invention provides RNAi agent selected from the group of RNAi agents listed in any one of Tables 1, 2, 4, 5, 8, 19, and 12.

[0120] In one aspect, the present invention provides compositions comprising a modified antisense polynucleotide agent, wherein the agent is capable of inhibiting the expression of TMPRSS6 in a cell, and comprises a sequence complementary to a sense sequence selected from the group of the sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12, wherein the polynucleotide is about 14 to about 30 nucleotides in length.

[0121] The present invention also provides cells, vectors, host cells, and pharmaceutical compositions comprising, e.g., the double stranded RNAi agents of the invention.

[0122] In some embodiments, the RNAi agent is administered using a pharmaceutical composition.

[0123] In preferred embodiments, the RNAi agent is administered in a solution. In some such embodiments, the siRNA is administered in an unbuffered solution. In one embodiment, the siRNA is administered in water. In other embodiments, the siRNA is administered with a buffer solution, such as an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer or any combination thereof. In some embodiments, the buffer solution is phosphate buffered saline (PBS).

[0124] In one embodiment, the pharmaceutical compositions further comprise a lipid formulation. In one embodiment, the lipid formulation comprises a LNP, or XTC. In another embodiment, the lipid formulation comprises a MC3.

[0125] In one aspect, the present invention provides methods of inhibiting TMPRSS6 expression in a cell. The methods include contacting the cell with an RNAi agent, e.g., a double stranded RNAi agent, or a modified antisense polynucleotide agent of the invention, or vector of the invention, or a pharmaceutical composition of the invention; and maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of a TMPRSS6 gene, thereby inhibiting expression of the TMPRSS6 gene in the cell.

[0126] In one embodiment, the cell is within a subject.

[0127] In one embodiment, the subject is a human.

[0128] In one embodiment, the TMPRSS6 expression is inhibited by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100%.

[0129] In another embodiment, hepcidin gene expression is increased by at least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, or about 5-fold.

[0130] In yet another embodiment, serum hepcidin concentration is increased by at least about 10%, about 25%, about 50%, about 100%, about 150%, about 200%, about 250%, or about 300%.

[0131] In one embodiment, serum iron concentration is decreased by at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98% or about 100%.

[0132] In another embodiment, a percent transferrin saturation is decreased by at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98% or about 100%.

[0133] In another aspect, the present invention provides methods of treating a subject having a disorder mediated by, or associated with, TMPRSS6 expression. The methods include administering to the subject a therapeutically effective amount of an RNAi agent, e.g., a double stranded RNAi agent, of the invention, or a modified antisense polynucleotide agent of the invention, or a vector of the invention, or a pharmaceutical composition of the invention, thereby treating the subject.

[0134] In one aspect, the present invention provides methods of treating a subject having a TMPRSS6-associated disorder. The methods include subcutaneously administering to the subject a therapeutically effective amount of a double stranded RNAi agent,

[0135] wherein the double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region,

[0136] wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO: 10,

[0137] wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification,

[0138] wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus,

[0139] wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification,

[0140] wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and,

[0141] wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a branched bivalent or trivalent linker at the 3'-terminus, thereby treating the subject.

[0142] In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification.

[0143] In one embodiment, the subject is a human.

[0144] In one embodiment, the subject has a disorder associated with iron overload, e.g., hereditary hemochromatosis, .beta.-thalassemia (e.g., .beta.-thalassemia major and .beta.-thalassemia intermedia) erythropoietic porphyria, Parkinson's Disease, Alzheimer's Disease or Friedreich's Ataxia.

[0145] In one embodiment, the RNAi agent, e.g., double stranded RNAi agent, is administered at a dose of about 0.01 mg/kg to about 10 mg/kg, about 1 mg/kg to about 10 mg/kg, about 2 mg/kg to about 10 mg/kg, about 3 mg/kg to about 10 mg/kg, about 4 mg/kg to about 10 mg/kg, about 5 mg/kg to about 15 mg/kg, about 6 mg/kg to about 15 mg/kg, about 7 mg/kg to about 15 mg/kg, about 8 mg/kg to about 15 mg/kg, about 9 mg/kg to about 15 mg/kg, about 10 mg/kg to about 20 mg/kg, about 12 mg/kg to about 20 mg/kg, about 13 mg/kg to about 20 mg/kg, about 14 mg/kg to about 20 mg/kg, about 15 mg/kg to about 20 mg/kg, about 16 mg/kg to about 20 mg/kg or about 18 mg/kg to about 20 mg/kg. In particular embodiments, the double stranded RNAi agent is administered at a dose of about 0.1 mg/kg, about 1.0 mg/kg, or about 3.0 mg/kg.

[0146] In one embodiment, the RNAi agent, e.g., double stranded RNAi agent, is administered subcutaneously or intravenously.

[0147] In one embodiment, the RNAi agent is administered in two or more doses. In a specific embodiment, the RNAi agent is administered at intervals selected from the group consisting of once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, once every about 96 hours, once about every 7 days, or once about every 14 days. In particular embodiments, the RNAi agent is administered once a week for up to 2 weeks, up to 3 weeks, up to 4 weeks, up to 5 weeks, or longer.

[0148] In yet another aspect, the present invention provides methods of treating an iron overload associated disorder in a subject. The methods include administering to the subject a therapeutically effective amount of an RNAi agent, e.g., a double stranded RNAi agent, or the vector of the invention, thereby treating the subject.

[0149] In one embodiment, the iron overload associated disorder is hemochromatosis. In another embodiment, the iron overload associated disorder is a thalassemia, e.g., .beta.-thalassemia (e.g, .beta.-thalassemia major and .beta.-thalassemia intermedia), or erythropoietic porphyria. In yet another embodiment, the iron overload associated disorder is a neurological disease, e.g., Parkinson's Disease, Alzheimer's Disease or Friedreich's Ataxia.

[0150] In one embodiment, the subject is a primate or rodent. In another embodiment, the subject is a human.

[0151] In one embodiment, the RNAi agent, e.g, double stranded RNAi agent, is administered at a dose of about 0.01 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 50 mg/kg, about 10 mg/kg to about 30 mg/kg, about 10 mg/kg to about 20 mg/kg, about 15 mg/kg to about 20 mg/kg, about 15 mg/kg to about 25 mg/kg, about 15 mg/kg to about 30 mg/kg, or about 20 mg/kg to about 30 mg/kg.

[0152] In one embodiment, the RNAi agent, e.g., double stranded RNAi agent, is administered subcutaneously or intravenously.

[0153] In one embodiment, the RNAi agent is administered in two or more doses. In a specific embodiment, the RNAi agent is administered at intervals selected from the group consisting of once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, once every about 96 hours, once about every 7 days, or once about every 14 days.

[0154] In one embodiment, administering results in a decrease in iron levels, ferritin level and/or transferrin saturation level in the subject.

[0155] In one embodiment, the methods further comprise determining the iron level in the subject.

[0156] In one embodiment, the methods of the invention which include administering an iRNA agent of the invention (or pharmaceutical composition of the invention) to a subject are practiced in combination with administration of additional pharmaceuticals and/or other therapeutic methods. In one embodiment, the methods of the invention further comprise administering an iron chelator, e.g, deferiprone, deferoxamine, and deferasirox, to a subject.

[0157] The present invention is further illustrated by the following detailed description and drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

[0158] FIG. 1 is a graph showing relative levels of TMPRSS6 mRNA in the liver of wild-type mice following administration of a single dose of 1 mg/kg, 3 mg/kg or 10 mg/kg of the iRNA agent AD-59743.

[0159] FIG. 2 is a graph showing relative levels of hepcidin mRNA in the liver of wild-type mice following administration of a single dose of 1 mg/kg, 3 mg/kg or 10 mg/kg of the iRNA agent AD-59743.

[0160] FIG. 3A is a graph showing the levels of hepatic TMPRSS6 mRNA in C57BL/6 mice at various time points following a single subcutaneous injection of AD-60940 at a dose of 0.3 mg/kg, 1.0 mg/kg or 3.0 mg/kg, or PBS alone (control). Each data point represents the mean value from three mice. The standard deviation of the mean is represented by error bars.

[0161] FIG. 3B is a graph showing the levels of hepatic hepcidin mRNA in C57BL/6 mice at various time points following a single subcutaneous injection of AD-60940 at a dose of 0.3 mg/kg, 1.0 mg/kg or 3.0 mg/kg, or PBS alone (control). Each data point represents the mean value from three mice. The standard deviation of the mean is represented by error bars.

[0162] FIG. 3C is a graph showing the levels of serum hepcidin in C57BL/6 mice at various time points following a single subcutaneous injection of AD-60940 at a dose of 0.3 mg/kg, 1.0 mg/kg or 3.0 mg/kg, or PBS alone (control). Each data point represents the mean value from three mice. The standard deviation of the mean is represented by error bars.

[0163] FIG. 3D is a graph showing the levels of total serum iron in C57BL/6 mice at various time points following a single subcutaneous injection of AD-60940 at a dose of 0.3 mg/kg, 1.0 mg/kg or 3.0 mg/kg, or PBS alone (control). Each data point represents the mean value from three mice. The standard deviation of the mean is represented by error bars.

[0164] FIG. 3E is a graph showing the percent transferrin saturation (FIG. 3E) in C57BL/6 mice at various time points following a single subcutaneous injection of AD-60940 at a dose of 0.3 mg/kg, 1.0 mg/kg or 3.0 mg/kg, or PBS alone (control). Each data point represents the mean value from three mice. The standard deviation of the mean is represented by error bars.

[0165] FIG. 3F is a graph demonstrating the relative hepatic TMPRSS6 mRNA concentration as a function of AD-60940 dose at 11 days following administration. Each data point represents the maximum suppression of TMPRSS6 mRNA concentration observed at each dose level. The data were fit to the Hill equation.

[0166] FIG. 4A is a schematic depicting the administration regimen of one dose per week for three weeks followed by sacrifice of the mice at day 21. FIG. 4B is a graph showing the levels of hepatic TMPRSS6 mRNA, hepatic hepcidin mRNA, and percent transferrin saturation in C57BL/6 mice administered a subcutaneous injection of AD-60940 at a dose of 0.3 mg/kg, 1.0 mg/kg, or PBS (control) according to the regimen shown in FIG. 4A. Each bar represents the mean value from three mice. The standard deviation of the mean is represented by error bars.

[0167] FIG. 4C demonstrates the relative hepatic TMPRSS6 mRNA concentration as a function of AD-60940 dose. The data were fit to the Hill equation.

[0168] FIG. 5A is a graph showing the relationship between serum hepcidin concentration and relative TMPRSS6 mRNA levels.

[0169] FIG. 5B is a graph showing the relationship between percent transferrin saturation and relative TMPRSS6 mRNA levels.

[0170] FIG. 5C is a graph showing the relationship between serum hepcidin concentration and relative hepcidin mRNA levels.

[0171] FIG. 5D is a graph showing the relationship between percent transferrin saturation and serum hepcidin concentration.

[0172] FIG. 6 is a graph showing relative levels of TMPRSS6 mRNA in the liver of C57BL/6 mice following administration of a single subcutaneous dose of 3 mg/kg of the indicated iRNA agent or PBS (control). The bars represent the mean from three mice and the error bars represent the standard deviation of the mean.

[0173] FIG. 7 is a graph showing relative levels of TMPRSS6 mRNA in the liver of C57BL/6 mice following a subcutaneous dose of 0.3 mg/kg or 1.0 mg/kg of the indicated iRNA agent, or PBS (control), once a week for three weeks. The bars represent the mean from three mice and the error bars represent the standard deviation of the mean.

[0174] FIG. 8 shows the nucleotide sequence of Homo sapiens TMPRSS6 (SEQ ID NO: 1).

[0175] FIG. 9 shows the nucleotide sequence of Mus musculus TMPRSS6 (SEQ ID NO:2).

[0176] FIG. 10 shows the nucleotide sequence of Rattus norvegicus TMPRSS6 (SEQ ID NO:3).

[0177] FIG. 11 shows the nucleotide sequence of Macaca mulatta TMPRSS6 (SEQ ID NO:4).

[0178] FIG. 12 shows the nucleotide sequence of Macaca mulatta TMPRSS6 (SEQ ID NO:5).

[0179] FIG. 13 shows the reverse complement of SEQ ID NO: 1 (SEQ ID NO:6).

[0180] FIG. 14 shows the reverse complement of SEQ ID NO:2 (SEQ ID NO:7).

[0181] FIG. 15 shows the reverse complement of SEQ ID NO:3 (SEQ ID NO:8).

[0182] FIG. 16 shows the reverse complement of SEQ ID NO:4 (SEQ ID NO:9).

[0183] FIG. 17 shows the reverse complement of SEQ ID NO:5 (SEQ ID NO: 10).

DETAILED DESCRIPTION OF THE INVENTION

[0184] The present invention provides compositions comprising RNAi agents, e.g, double-stranded iRNA agents, targeting TMPRSS6. The present invention also provides methods using the compositions of the invention for inhibiting TMPRSS6 expression and for treating TMPRSS6 associated disorders, e.g., .beta.-thalassemia or hemochromatosis.

[0185] TMPRSS6 plays an important role in iron homeostasis as an inhibitor of HAMP gene expression. The HAMP gene encodes the liver hormone hepcidin, which is a central regulator of iron homeostasis. Hepcidin binds to the iron exporter protein ferroportin (FPN1), which is localized mainly on absorptive enterocytes, hepatocytes and macrophages. Hepcidin binding to the extracellular domain of ferroportin leads to the internalization and degradation of ferroportin, thus decreasing the absorption of dietary iron from the intestine, and the release of iron from macrophages and hepatocytes. HAMP gene expression can be stimulated in response to iron through Bone Morphogenetic Protein (BMP)/Sons of Mothers Against Decapentaplegic (SMAD)-dependent signal transduction cascade mediated by the BMP-co-receptor hemojuvelin (HJV). The key role of TMPRSS6 in HAMP regulation is in the inhibition of BMP-mediated HAMP upregulation. TMPRSS6 inhibits BMP-mediated HAMP upregulation by cleaving the BMP co-receptor HJV, which is essential for BMP-mediated HAMP upregulation; thus preventing BMP signaling, SMAD translocation to the nucleus, and HAMP transcriptional activation.

[0186] Several human and mouse studies have confirmed the role of TMPRSS6 in HAMP regulation and iron homeostasis (Du et al. Science 2008, Vol. 320, pp 1088-1092; Folgueras et al. Blood 2008, Vol. 112, pp 2539-45). Studies have shown that loss of function mutations in TMPRSS6 can lead to the upregulation of hepcidin expression, causing an inherited iron deficiency anemia called iron refractory iron deficiency anemia (IRIDA) (Finberg. Seminars in Hematology 2009, Vol. 46, pp 378-86), which is characterized by elevated hepcidin levels, hypochromic microcytic anemia, low mean corpuscular volume (MCV), low transferrin saturation, poor absorption of oral iron, and incomplete response to parenteral iron. However, loss of function mutations in positive regulators of HAMP (e.g., BMP1, BMP4, and HFE) have been shown to downregulate hepcidin expression and cause iron overload disorders (Milet et al. Am J Hum Gen 2007, Vol. 81, pp 799-807; Finberg et al. Blood 2011, Vol. 117, pp 4590-9). In the primary iron overload disorders, collectively called hereditary hemochromatosis (HH), in anemias characterized by massive ineffective hematopoiesis, and in iron overload (secondary hemochromatosis), such as .beta.-thalassemia intermedia (TI), hepcidin levels are low despite elevated serum iron concentrations and iron stores. A mouse model of .beta.-thalassemia intermedia has demonstrated that the loss of TMPRSS6 expression leads to elevated levels of hepcidin (Finberg 2010 Oral Presentation: "TMPRSS6, an inhibitor of Hepatic BMP/Smad Signaling, is required for Hepcidin Suppression and Iron Loading in a Mouse Model of .beta.-Thalassemia." American Society of Hematology Annual Meeting 2010, Abstract No.: 164).

[0187] The present invention describes iRNA agents, compositions and methods for modulating the expression of a TMPRSS6 gene. In certain embodiments, expression of TMPRSS6 is reduced or inhibited using a TMPRSS6-specific iRNA agent, thereby leading to increase HAMP expression, and decreased serum iron levels. Thus, inhibition of TMPRSS6 gene expression or activity using the iRNA compositions featured in the invention can be a useful approach to therapies aimed at reducing the iron levels in a subject. Such inhibition can be useful for treating iron overload associated disorders, such as hemochromatosis or thalassemia, e.g., .beta.-thalassemia (e.g, .beta.-thalassemia major and .beta.-thalassemia intermedia).

I. Definitions

[0188] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

[0189] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0190] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

[0191] The term "or" is used herein to mean, and is used interchangeably with, the term "and/or," unless context clearly indicates otherwise.

[0192] As used herein, "TMPRSS6" refers to the type II plasma membrane serine protease (TTSP) gene or protein. TMPRSS6 is also known as matriptase-2, IRIDA (iron refractory iron-deficiency anemia), transmembrane protease serine 6, type II transmembrane serine protease 6, and membrane-bound mosaic serine proteinase matriptase-2. TMPRSS6 is a serine protease Type II transmembrane protein of approximately 899 amino acids in length. TMPRSS6 contains multiple domains, e.g., a short endo domain, a transmembrane domain, a sea urchin sperm protein/enteropeptidase domain/agrin (SEA) domain, two complement factor/urchin embryonic growth factor/BMP domains (CUB), three LDL-R class a domains (LDLa), and a trypsin-like serine protease domain with conserved His-Asp-Ser triad (HDS). The term "TMPRSS6" includes human TMPRSS6, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GI: 56682967; mouse TMPRSS6, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GT125656151; rat TMPRSS6, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GI: 194474097; rhesus TMPRSS6, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. XM_001085203.2 (GT297260989) and XM_001085319.1 (GI: 109094061). Additional examples of AGT mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site.

[0193] The term "TMPRSS6," as used herein, also refers to naturally occurring DNA sequence variations of the TMPRSS6 gene, such as a single nucleotide polymorphism (SNP) in the TMPRSS6 gene. Exemplary SNPs may be found in the dbSNP database available at www.ncbi.nlm.nih.gov/projects/SNP.

[0194] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a TMPRSS6 gene, including mRNA that is a product of RNA processing of a primary transcription product.

[0195] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

[0196] "G," "C," "A" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. "T" and "dT" are used interchangeably herein and refer to a deoxyribonucleotide wherein the nucleobase is thymine, e.g., deoxyribothymine, 2'-deoxythymidine or thymidine. However, it will be understood that the term "ribonucleotide" or "nucleotide" or "deoxyribonucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.

[0197] The terms "iRNA", "RNAi agent," "iRNA agent,", "RNA interference agent" as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of TMPRSS6 in a cell, e.g, a cell within a subject, such as a mammalian subject.

[0198] In one embodiment, an RNAi agent of the invention includes a single stranded RNA that interacts with a target RNA sequence, e.g, a TMPRSS6 target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the invention relates to a single stranded RNA (siRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., a TMPRSS6 gene. Accordingly, the term "siRNA" is also used herein to refer to an RNAi as described above.

[0199] In another embodiment, the RNAi agent may be a single-stranded siRNA that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150;:883-894.

[0200] In yet another embodiment, the present invention provides single-stranded antisense oligonucleotide molecules targeting TMPRSS6. A "single-stranded antisense oligonucleotide molecule" is complementary to a sequence within the target mRNA (i.e., TMPRSS6). Single-stranded antisense oligonucleotide molecules can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. Alternatively, the single-stranded antisense oligonucleotide molecules inhibit a target mRNA by hydridizing to the target and cleaving the target through an RNaseH cleavage event. The single-stranded antisense oligonucleotide molecule may be about 10 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence. For example, the single-stranded antisense oligonucleotide molecule may comprise a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense nucleotide sequences described herein, e.g., the sequences provided in any one of Tables, 1, 2, 4, 5, 8, 10, and 12, or bind any of the target sites described herein. The single-stranded antisense oligonucleotide molecules may comprise modified RNA, DNA, or a combination thereof.

[0201] In another embodiment, an "iRNA" for use in the compositions, uses, and methods of the invention is a double-stranded RNA and is referred to herein as a "double stranded RNAi agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA". The term "dsRNA", refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations with respect to a target RNA, i.e., a TMPRSS6 gene. In some embodiments of the invention, a double-stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

[0202] In general, the majority of nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide. In addition, as used in this specification, an "RNAi agent" may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by "RNAi agent" for the purposes of this specification and claims.

[0203] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a "hairpin loop." Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a "linker." The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi agent may comprise one or more nucleotide overhangs.

[0204] In one embodiment, an RNAi agent of the invention is a dsRNA of 24-30 nucleotides that interacts with a target RNA sequence, e.g., a TMPRSS6 target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188).

[0205] As used herein, a "nucleotide overhang" refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of an RNAi agent when a 3'-end of one strand of the RNAi agent extends beyond the 5'-end of the other strand, or vice versa. "Blunt" or "blunt end" means that there are no unpaired nucleotides at that end of the double stranded RNAi agent, i.e., no nucleotide overhang. A "blunt ended" RNAi agent is a dsRNA that is double-stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule. The RNAi agents of the invention include RNAi agents with nucleotide overhangs at one end (i.e., agents with one overhang and one blunt end) or with nucleotide overhangs at both ends.

[0206] The term "antisense strand" refers to the strand of a double stranded RNAi agent which includes a region that is substantially complementary to a target sequence (e.g., a human TMPRSS6 mRNA). As used herein, the term "region complementary to part of an mRNA encoding transthyretin" refers to a region on the antisense strand that is substantially complementary to part of a TMPRSS6 mRNA sequence. Where the region of complementarity is not fully complementary to the target sequence, the mismatches are most tolerated in the terminal regions and, if present, are generally in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5' and/or 3' terminus.

[0207] The term "sense strand," as used herein, refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.

[0208] As used herein, the term "cleavage region" refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

[0209] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or 70.degree. C. for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. For example, a complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g, RNAi. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

[0210] Sequences can be "fully complementary" with respect to each when there is base-pairing of the nucleotides of the first nucleotide sequence with the nucleotides of the second nucleotide sequence over the entire length of the first and second nucleotide sequences. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary" for the purposes described herein.

[0211] "Complementary" sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but not limited to, G:U Wobble or Hoogstein base pairing.

[0212] The terms "complementary," "fully complementary" and "substantially complementary" herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

[0213] As used herein, a polynucleotide that is "substantially complementary to at least part of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding TMPRSS6) including a 5' UTR, an open reading frame (ORF), or a 3' UTR. For example, a polynucleotide is complementary to at least a part of a TMPRSS6 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding TMPRSS6.

[0214] The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating," "suppressing" and other similar terms, and includes any level of inhibition.

[0215] The phrase "inhibiting expression of a TMPRSS6," as used herein, includes inhibition of expression of any TMPRSS6 gene (such as, e.g., a mouse TMPRSS6 gene, a rat TMPRSS6 gene, a monkey TMPRSS6 gene, or a human TMPRSS6 gene) as well as variants, (e.g., naturally occurring variants), or mutants of a TMPRSS6 gene. Thus, the TMPRSS6 gene may be a wild-type TMPRSS6 gene, a mutant TMPRSS6 gene, or a transgenic TMPRSS6 gene in the context of a genetically manipulated cell, group of cells, or organism.

[0216] "Inhibiting expression of a TMPRSS6 gene" includes any level of inhibition of a TMPRSS6 gene, e.g., at least partial suppression of the expression of a TMPRSS6 gene, such as an inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0217] The expression of a TMPRSS6 gene may be assessed based on the level of any variable associated with TMPRSS6 gene expression, e.g., TMPRSS6 mRNA level, TMPRSS6 protein level, hepcidin mRNA level, hepcidin protein level, or iron levels in tissues or serum. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

[0218] The phrase "contacting a cell with a double stranded RNAi agent," as used herein, includes contacting a cell by any possible means. Contacting a cell with a double stranded RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0219] Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and/or be coupled to a ligand, e.g., a GalNAc3 ligand, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. In connection with the methods of the invention, a cell might also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.

[0220] A "patient" or "subject," as used herein, is intended to include either a human or non-human animal, preferably a mammal, e.g., human or a monkey. Most preferably, the subject or patient is a human.

[0221] A "TMPRSS6 associated disorder", as used herein, is intended to include any disorder that can be treated or prevented, or the symptoms of which can be alleviated, by inhibiting the expression of TMPRSS6. In some embodiments, the TMPRSS6 associated disorder is also associated with iron overload, a condition characterized by elevated iron levels, or iron dysregulation. Iron overload may be caused, for example, by hereditary conditions, by elevated iron uptake from diet, or by excess iron administered parenterally that includes intravenous injection of excess iron, and transfusional iron overload.

[0222] TMPRSS6 associated disorders include, but are not limited to, hereditary hemochromatosis, idiopathic hemochromatosis, primary hemochromatosis, secondary hemochromatosis, severe juvenile hemochromatosis, neonatal hemochromatosis, sideroblastic anemia, hemolytic anemia, dyserythropoietic anemia, sickle-cell anemia, hemoglobinopathy, thalassemia (e.g., .beta.-thalassemia and .alpha.-thalassemia), chronic liver diseases, porphyria cutanea tarda, erythropoietic porphyria, atransferrinemia, hereditary tyrosinemia, cerebrohepatorenal syndrome, idiopathic pulmonary hemosiderosis, renal hemosiderosis.

[0223] TMPRSS6 associated disorders include disorders associated with oral administration of excess iron, transfusional iron overload and intravenous injection of excess iron.

[0224] TMPRSS6 associated disorders also include disorders with symptoms that are associated with or may be caused by iron overload. Such symptoms include increased risk for liver disease (cirrhosis, cancer), heart attack or heart failure, diabetes mellitus, osteoarthritis, osteoporosis, metabolic syndrome, hypothyroidism, hypogonadism, and in some cases premature death. In one embodiment, TMPRSS6 associated disorders include neurodegenerative disorders associated with iron overload and/or iron dysregulation, such as Alzheimer's Disease, Parkinson's Disease, Huntington's Disease, Friedreich's Ataxia, epilepsy and multiple sclerosis. Administration of an iRNA that targets TMPRSS6, e.g, an iRNA described in any one of Tables 1, 2, 4, 5, 8, 10, and 12 can treat one or more of these symptoms, or prevent the development or progression of a disease or disorder that is aggravated by increased iron levels.

[0225] In one embodiment, a TMPRSS6 associated disorder is a .beta.-thalassemia. A .beta.-thalassemia is any one of a group of hereditary disorders characterized by a genetic deficiency in the synthesis of beta-globin chains. In the homozygous state, beta thalassemia ("thalassemia major") causes severe, transfusion-dependent anemia. In the heterozygous state, the beta thalassemia trait ("thalassemia minor") causes mild to moderate microcytic anemia.

[0226] "Thalassemia intermedia" is a .beta.-thalassemia that results in subjects in whom the clinical severity of the disease is somewhere between the mild symptoms of .beta.-thalassemia minor and the .beta.-thalassemia major. The diagnosis is a clinical one that is based on the patient maintaining a satisfactory hemoglobin (Hb) level of at least 6-7 g/dL at the time of diagnosis without the need for regular blood transfusions.

[0227] In one embodiment, a .beta.-thalassemia is thalassemia major. In another embodiment, a .beta.-thalassemia is thalassemia intermedia.

[0228] "Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a patient for treating a TMPRSS6 associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, stage of pathological processes mediated by TMPRSS6 expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0229] "Prophylactically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject who does not yet experience or display symptoms of a TMPRSS6-associated disease, but who may be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0230] A "therapeutically-effective amount" or "prophylactically effective amount" also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. RNAi gents employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

[0231] The term "sample," as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In preferred embodiments, a "sample derived from a subject" refers to blood or plasma drawn from the subject. In further embodiments, a "sample derived from a subject" refers to liver tissue (or subcomponents thereof) derived from the subject.

II. iRNAs of the Invention

[0232] Described herein are improved double-stranded RNAi agents which inhibit the expression of a TMPRSS6 gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a TMPRSS6 associated disorder, e.g., .beta.-thalassemia (e.g, .beta.-thalassemia major and .beta.-thalassemia intermedia) or hemochromatosis, and uses of such double-stranded RNAi agents.

[0233] Accordingly, the invention provides double-stranded RNAi agents with chemical modifications capable of inhibiting the expression of a target gene (i.e., a TMPRSS6 gene) in vivo. In certain aspects of the invention, substantially all of the nucleotides of an iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of an iRNA of the invention are modified. iRNAs of the invention in which "substantially all of the nucleotides are modified" are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0234] The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may range from 12-30 nucleotides in length. For example, each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 19-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.

[0235] The sense strand and antisense strand typically form a duplex double stranded RNA ("dsRNA"), also referred to herein as an "RNAi agent." The duplex region of an RNAi agent may be 12-30 nucleotide pairs in length. For example, the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0236] In one embodiment, the RNAi agent may contain one or more overhang regions and/or capping groups at the 3'-end, 5'-end, or both ends of one or both strands. The overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.

[0237] In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2'-sugar modified, such as, 2-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.

[0238] The 5'- or 3'-overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3'-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3'-overhang is present in the antisense strand. In one embodiment, this 3'-overhang is present in the sense strand.

[0239] The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3'-terminal end of the sense strand or, alternatively, at the 3'-terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5'-end of the antisense strand (or the 3'-end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3'-end, and the 5'-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5'-end of the antisense strand and 3'-end overhang of the antisense strand favor the guide strand loading into RISC process.

[0240] Any of the nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkages, clef base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g, at the 2'-position or 4'-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified iRNA will have a phosphorus atom in its internucleoside backbone.

[0241] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.

[0242] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

[0243] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

[0244] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0245] In other embodiments, suitable RNA mimetics are contemplated for use in iRNAs, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

[0246] Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0247] Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH.sub.2--NH--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--O--CH.sub.2-[known as a methylene (methylimino) or MMI backbone], --CH.sub.2--O--N(CH.sub.3)--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and --N(CH.sub.3)--CH.sub.2--CH.sub.2-[wherein the native phosphodiester backbone is represented as --O--P--O--CH.sub.2-] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

[0248] Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2)..sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2.

[0249] Other modifications include 2'-methoxy (2'-OCH.sub.3), 2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0250] An iRNA can also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as deoxy-thymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methyl guanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0251] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0252] The RNA of an iRNA can also be modified to include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0253] Representative U.S. patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and 7,399,845, the entire contents of each of which are hereby incorporated herein by reference.

[0254] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3''-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.

[0255] A. Modified iRNAs Comprising Motifs of the Invention

[0256] In certain aspects of the invention, the double-stranded RNAi agents of the invention include agents with chemical modifications as disclosed, for example, in U.S. Provisional Application No. 61/561,710, filed on Nov. 18, 2011, or in PCT/US2012/065691, filed on Nov. 16, 2012, the entire contents of each of which are incorporated herein by reference.

[0257] As shown herein and in Provisional Application No. 61/561,710, a superior result may be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides into a sense strand and/or antisense strand of a RNAi agent, particularly at or near the cleavage site. In some embodiments, the sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if present, of the sense and/or antisense strand. The RNAi agent may be optionally conjugated with a GalNAc derivative ligand, for instance on the sense strand. The resulting RNAi agents present superior gene silencing activity.

[0258] More specifically, it has been surprisingly discovered that when the sense strand and antisense strand of the double-stranded RNAi agent are modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of an RNAi agent, the gene silencing activity of the RNAi agent was superiorly enhanced.

[0259] In one embodiment, the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end.

[0260] In another embodiment, the RNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8, 9, 10 from the 5'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end.

[0261] In yet another embodiment, the RNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end.

[0262] In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5'end; the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. Preferably, the 2 nucleotide overhang is at the 3'-end of the antisense strand. When the 2 nucleotide overhang is at the 3'-end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5'-end of the sense strand and at the 5'-end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2'-O-methyl or 3'-fluoro, e.g., in an alternating motif. Optionally, the RNAi agent further comprises a ligand (preferably GalNAc.sub.3).

[0263] In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5' end; wherein the 3' end of the first strand and the 5' end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3' end than the first strand, wherein the duplex region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferentially results in an siRNA comprising the 3' end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.

[0264] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.

[0265] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand

[0266] For an RNAi agent having a duplex region of 17-23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5'-end. Thus the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1.sup.st nucleotide from the 5'-end of the antisense strand, or, the count starting from the 1.sup.st paired nucleotide within the duplex region from the 5'-end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5'-end.

[0267] The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

[0268] In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term "wing modification" herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.

[0269] Like the sense strand, the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.

[0270] In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3'-end, 5'-end or both ends of the strand.

[0271] In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3'-end, 5'-end or both ends of the strand.

[0272] When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.

[0273] When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.

[0274] In one embodiment, every nucleotide in the sense strand and antisense strand of the RNAi agent, including the nucleotides that are part of the motifs, may be modified. Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with "dephospho" linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.

[0275] As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety. In some cases the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3' or 5' terminal position, may only occur in a terminal region, e.g, at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA. For example, a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5' end or ends can be phosphorylated.

[0276] It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5' or 3' overhang, or in both. For example, it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3' or 5' overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2' position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.

[0277] In one embodiment, each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. The strands can contain more than one modification. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

[0278] At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2'-O-methyl or 2'-fluoro modifications, or others.

[0279] In one embodiment, the N.sub.a and/or N.sub.b comprise modifications of an alternating pattern. The term "alternating motif" as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be "ABAB ABAB ABAB . . . ," "AABBAABBAABB . . . ," "AABAABAABAAB . . . ," "AAABAAABAAAB . . . ," "AAABBBAAABBB . . . ," or "ABCABCABCABC . . . ," etc.

[0280] The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as "ABABAB . . . ", "AC AC AC . . . " "BDBDBD . . . " or "CDCDCD . . . ," etc.

[0281] In one embodiment, the RNAi agent of the invention comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with "ABABAB" from 5'-3' of the strand and the alternating motif in the antisense strand may start with "BAB ABA" from 5'-3' of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with "AABBAABB" from 5'-3' of the strand and the alternating motif in the antisense strand may start with "BBAABBAA" from 5'-3' of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.

[0282] In one embodiment, the RNAi agent comprises the pattern of the alternating motif of 2'-O-methyl modification and 2'-F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2'-O-methyl modification and 2'-F modification on the antisense strand initially, i.e., the 2'-O-methyl modified nucleotide on the sense strand base pairs with a 2'-F modified nucleotide on the antisense strand and vice versa. The 1 position of the sense strand may start with the 2'-F modification, and the 1 position of the antisense strand may start with the 2'-O-methyl modification.

[0283] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and/or antisense strand interrupts the initial modification pattern present in the sense strand and/or antisense strand. This interruption of the modification pattern of the sense and/or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense strand surprisingly enhances the gene silencing activity to the target gene.

[0284] In one embodiment, when the motif of three identical modifications on three consecutive nucleotides is introduced to any of the strands, the modification of the nucleotide next to the motif is a different modification than the modification of the motif. For example, the portion of the sequence containing the motif is " . . . N.sub.aYYYN.sub.b . . . ," where "Y" represents the modification of the motif of three identical modifications on three consecutive nucleotide, and "N.sub.a" and "N.sub.b" represent a modification to the nucleotide next to the motif "YYY" that is different than the modification of Y, and where N.sub.a and N.sub.b can be the same or different modifications. Alternatively, N.sub.a and/or N.sub.b may be present or absent when there is a wing modification present.

[0285] The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both strands in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand and/or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand.

[0286] In one embodiment, the RNAi comprises a phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. These terminal three nucleotides may be at the 3'-end of the antisense strand, the 3'-end of the sense strand, the 5'-end of the antisense strand, and/or the 5'end of the antisense strand.

[0287] In one embodiment, the 2 nucleotide overhang is at the 3'-end of the antisense strand, and there are two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. Optionally, the RNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5'-end of the sense strand and at the 5'-end of the antisense strand.

[0288] In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.

[0289] In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5'-end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g, non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5'-end of the duplex.

[0290] In one embodiment, the nucleotide at the 1 position within the duplex region from the 5'-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5'-end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5'-end of the antisense strand is an AU base pair.

[0291] In one embodiment, the sense strand sequence may be represented by formula (I):

5'n.sub.p-N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.j--N.su- b.a-n.sub.q3' (I)

[0292] wherein:

[0293] i and j are each independently 0 or 1;

[0294] p and q are each independently 0-6;

[0295] each N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0296] each N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0297] each n.sub.p and n.sub.q independently represent an overhang nucleotide;

[0298] wherein N.sub.b and Y do not have the same modification; and

[0299] XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably YYY is all 2'-F modified nucleotides.

[0300] In one embodiment, the N.sub.a and/or N.sub.b comprise modifications of alternating pattern.

[0301] In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13) of--the sense strand, the count starting from the 1.sup.st nucleotide, from the 5'-end; or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5'-end.

[0302] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:

5'n.sub.p-N.sub.a--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3' (Ib);

5'n.sub.p-N.sub.a--XXX--N.sub.b--YYY--N.sub.a-n.sub.q3' (Ic); or

5'n.sub.p-N.sub.a--XXX--N.sub.b--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3' (Id).

[0303] When the sense strand is represented by formula (Ib), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0304] When the sense strand is represented as formula (Ic), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0305] When the sense strand is represented as formula (Id), each N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.

[0306] Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6 Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0307] Each of X, Y and Z may be the same or different from each other.

[0308] In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:

5'n.sub.p-N.sub.a--YYY--N.sub.a-n.sub.q3' (Ia).

[0309] When the sense strand is represented by formula (Ia), each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0310] In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):

5'n.sub.q'--N.sub.a'--(Z'Z'Z').sub.k--N.sub.b'--Y'Y'Y'--N.sub.b'--(X'X'X- ').sub.l--N'.sub.a-n.sub.p'3' (II)

[0311] wherein:

[0312] k and l are each independently 0 or 1;

[0313] p' and q' are each independently 0-6;

[0314] each N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0315] each N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0316] each n.sub.p' and n.sub.q' independently represent an overhang nucleotide;

[0317] wherein N.sub.b' and Y' do not have the same modification;

[0318] and

[0319] X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0320] In one embodiment, the N.sub.a' and/or N.sub.b' comprise modifications of alternating pattern.

[0321] The Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotide in length, the Y'Y'Y' motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the 1.sup.st nucleotide, from the 5'-end; or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5'-end. Preferably, the Y'Y'Y' motif occurs at positions 11, 12, 13.

[0322] In one embodiment, Y'Y'Y' motif is all 2'-OMe modified nucleotides.

[0323] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0324] The antisense strand can therefore be represented by the following formulas:

5'n.sub.q'--N.sub.a'--Z'Z'Z'--N.sub.b'--Y'Y'Y'--N.sub.a'-n.sub.p'3' (IIb);

5'n.sub.q'--N.sub.a'--Y'Y'Y'--N.sub.b'--X'X'X'-n.sub.p'3' (IIc); or

5'n.sub.q'--N.sub.a'--Z'Z'Z'--N.sub.b'--Y'Y'Y'--N.sub.b'--X'X'X'--N.sub.- a'-n.sub.p'3' (IId).

[0325] When the antisense strand is represented by formula (IIb), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0326] When the antisense strand is represented as formula (IIc), N.sub.b' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0327] When the antisense strand is represented as formula (IId), each N.sub.b' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6.

[0328] In other embodiments, k is 0 and l is 0 and the antisense strand may be represented by the formula:

5'n.sub.p'--N.sub.a'--Y'Y'Y'--N.sub.a'-n.sub.q'3' (Ia).

[0329] When the antisense strand is represented as formula (IIa), each N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0330] Each of X', Y' and Z' may be the same or different from each other.

[0331] Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X', Y' and Z', in particular, may represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0332] In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1.sup.st nucleotide from the 5'-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5'-end; and Y represents 2'-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2'-OMe modification or 2'-F modification.

[0333] In one embodiment the antisense strand may contain Y'YY motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1.sup.st nucleotide from the 5'-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5'-end; and Y' represents 2'-O-methyl modification. The antisense strand may additionally contain X'X'X' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex region; and X'X'X' and Z'Z'Z' each independently represents a 2'-OMe modification or 2'-F modification.

[0334] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (IIa), (IIb), (IIc), and (IId), respectively.

[0335] Accordingly, the RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):

sense: 5'n.sub.p-N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.- j--N.sub.a-n.sub.q3'

antisense: 3'n.sub.p'--N.sub.a'--(X'X'X').sub.k--N.sub.b'--YYY'--N.sub.b'--(Z'Z'Z').- sub.l--N.sub.a'-n.sub.q'5' (III)

[0336] wherein:

[0337] i, j, k, and l are each independently 0 or 1;

[0338] p, p', q, and q' are each independently 0-6;

[0339] each N.sub.a and N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0340] each N.sub.b and N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0341] wherein

[0342] each n.sub.p', n.sub.p, n.sub.q', and n.sub.q, each of which may or may not be present, independently represents an overhang nucleotide; and

[0343] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0344] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0345] Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:

5'n.sub.p-N.sub.a--YYY--N.sub.a-n.sub.q3'

3'n.sub.p'--N.sub.a'--Y'Y'Y'--N.sub.a'n.sub.q'5' (IIIa)

5'n.sub.p-N.sub.a--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3'

3'n.sub.p'--N.sub.a'--YYY'--N.sub.b--Z'Z'Z'--N.sub.a'n.sub.q'5' (IIIb)

5'n.sub.p-N.sub.a--XXX--N.sub.b--YYY--N.sub.a-n.sub.q3'

3'n.sub.p'--N.sub.a'--X'X'X'--N.sub.b'--YYY'--N.sub.a'-n.sub.q'5' (IIIc)

5'n.sub.p-N.sub.a--XXX--N.sub.b--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3'

3'n.sub.p'--N.sub.a'--X'X'X'--N.sub.b'--YYY'--N.sub.b'--Z'Z'Z'--N.sub.a-- n.sub.q'5' (IIId)

[0346] When the RNAi agent is represented by formula (IIIa), each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0347] When the RNAi agent is represented by formula (IIIb), each N.sub.b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0348] When the RNAi agent is represented as formula (IIIc), each N.sub.b, N.sub.b' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0349] When the RNAi agent is represented as formula (IIId), each N.sub.b, N.sub.b' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a, N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of N.sub.a, N.sub.a', N.sub.b and N.sub.b independently comprises modifications of alternating pattern.

[0350] Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be the same or different from each other.

[0351] When the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y' nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y' nucleotides.

[0352] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z' nucleotides.

[0353] When the RNAi agent is represented as formula (IIIc) or (IIId), at least one of the X nucleotides may form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X' nucleotides.

[0354] In one embodiment, the modification on the Y nucleotide is different than the modification on the Y' nucleotide, the modification on the Z nucleotide is different than the modification on the Z' nucleotide, and/or the modification on the X nucleotide is different than the modification on the X' nucleotide.

[0355] In one embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications and n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications, n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications, n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0356] In one embodiment, when the RNAi agent is represented by formula (IIIa), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications, n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0357] In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

[0358] In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

[0359] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5' end, and one or both of the 3' ends and are optionally conjugated to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.

[0360] Various publications describe multimeric RNAi agents that can be used in the methods of the invention. Such publications include WO2007/091269, U.S. Pat. No. 7,858,769, WO2010/141511, WO2007/117686, WO2009/014887 and WO2011/031520 the entire contents of each of which are hereby incorporated herein by reference.

[0361] The RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g, nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

[0362] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one "backbone attachment point," preferably two "backbone attachment points" and (ii) at least one "tethering attachment point." A "backbone attachment point" as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g, the phosphate, or modified phosphate, e.g, sulfur containing, backbone, of a ribonucleic acid. A "tethering attachment point" (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g, a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g, a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g, an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g, a ligand to the constituent ring.

[0363] The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.

[0364] In certain specific embodiments, the RNAi agent for use in the methods of the invention is an agent selected from the group of agents listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12.

[0365] In one embodiment, when the agent is an agent listed in Table 12, the agent may lack a terminal dT.

[0366] The present invention further includes double-stranded RNAi agents comprising any one of the sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12 which comprise a 5' phosphate or phosphate mimetic on the antisense strand (see, e.g., PCT Publication No. WO 2011005860). Further, the present invention includes double-stranded RNAi agents comprising any one of the sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12 which include a 2'fluoro group in place of a 2'-OMe group at the 5'end of the sense strand.

[0367] These agents may further comprise a ligand.

[0368] In one embodiment, the agent is AD-60940 (sense strand: CfsusGfgUfaUfuUfCfCfuAfgGfgUfaCfaAfL96; antisense strand: usUfsgUfaCfcCfuAfggaAfaUfaCfcAfgsasg).

[0369] A. Ligands

[0370] The double-stranded RNA (dsRNA) agents of the invention may optionally be conjugated to one or more ligands. The ligand can be attached to the sense strand, antisense strand or both strands, at the 3'-end, 5'-end or both ends. For instance, the ligand may be conjugated to the sense strand. In preferred embodiments, the ligand is conjugated to the 3'-end of the sense strand. In one preferred embodiment, the ligand is a GalNAc ligand. In particularly preferred embodiments, the ligand is GalNAc.sub.3:

##STR00003##

[0371] In some embodiments, the ligand, e.g., GalNAc ligand, is attached to the 3' end of the RNAi agent. In one embodiment, the RNAi agent is conjugated to the ligand, e.g., GalNAc ligand, as shown in the following schematic

##STR00004##

wherein X is O or S. In one embodiment, X is O.

[0372] A wide variety of entities can be coupled to the RNAi agents of the present invention. Preferred moieties are ligands, which are coupled, preferably covalently, either directly or indirectly via an intervening tether.

[0373] In preferred embodiments, a ligand alters the distribution, targeting or lifetime of the molecule into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, receptor e.g, a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Ligands providing enhanced affinity for a selected target are also termed targeting ligands.

[0374] Some ligands can have endosomolytic properties. The endosomolytic ligands promote the lysis of the endosome and/or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. The endosomolytic ligand may be a polyanionic peptide or peptidomimetic which shows pH-dependent membrane activity and fusogenicity. In one embodiment, the endosomolytic ligand assumes its active conformation at endosomal pH. The "active" conformation is that conformation in which the endosomolytic ligand promotes lysis of the endosome and/or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. Exemplary endosomolytic ligands include the GALA peptide (Subbarao et al., Biochemistry, 1987, 26: 2964-2972), the EALA peptide (Vogel et al., J. Am. Chem. Soc., 1996, 118: 1581-1586), and their derivatives (Turk et al., Biochem. Biophys. Acta, 2002, 1559: 56-68). In one embodiment, the endosomolytic component may contain a chemical group (e.g, an amino acid) which will undergo a change in charge or protonation in response to a change in pH. The endosomolytic component may be linear or branched.

[0375] Ligands can improve transport, hybridization, and specificity properties and may also improve nuclease resistance of the resultant natural or modified oligoribonucleotide, or a polymeric molecule comprising any combination of monomers described herein and/or natural or modified ribonucleotides.

[0376] Ligands in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; and nuclease-resistance conferring moieties. General examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimics.

[0377] Ligands can include a naturally occurring substance, such as a protein (e.g, human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); a carbohydrate (e.g, a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g, a synthetic polyamino acid, an oligonucleotide (e.g, an aptamer). Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[0378] Ligands can also include targeting groups, e.g, a cell or tissue targeting agent, e.g, a lectin, glycoprotein, lipid or protein, e.g, an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer.

[0379] Other examples of ligands include dyes, intercalating agents (e.g., acridines), cross-linkers (e.g., psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or a chelator (e.g., EDTA), lipophilic molecules, e.g, cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0380] Ligands can be proteins, e.g, glycoproteins, or peptides, e.g, molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, or aptamers. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-.kappa.B.

[0381] The ligand can be a substance, e.g, a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g, by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0382] The ligand can increase the uptake of the oligonucleotide into the cell by, for example, activating an inflammatory response. Exemplary ligands that would have such an effect include tumor necrosis factor alpha (TNFalpha), interleukin-1 beta, or gamma interferon.

[0383] In one aspect, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g, human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g, a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g, HSA.

[0384] A lipid based ligand can be used to modulate, e.g, control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

[0385] In a preferred embodiment, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.

[0386] In another preferred embodiment, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.

[0387] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include B vitamins, e.g, folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low density lipoprotein (LDL) and high-density lipoprotein (HDL).

[0388] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.

[0389] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g, consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 11). An RFGF analogue (e.g, amino acid sequence AALLPVLLAAP (SEQ ID NO: 12)) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a "delivery" peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ) (SEQ ID NO: 13) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK) (SEQ ID NO: 14) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Preferably the peptide or peptidomimetic tethered to an iRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized. An RGD peptide moiety can be used to target a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide can facilitate targeting of an iRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Preferably, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell expressing .alpha..sub.V.beta..sub.3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001). Peptides that target markers enriched in proliferating cells can be used. For example, RGD containing peptides and peptidomimetics can target cancer cells, in particular cells that exhibit an integrin. Thus, one could use RGD peptides, cyclic peptides containing RGD, RGD peptides that include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Generally, such ligands can be used to control proliferating cells and angiogeneis. Preferred conjugates of this type of ligand target PECAM-1, VEGF, or other cancer gene, e.g., a cancer gene described herein.

[0390] A "cell permeation peptide" is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an .alpha.-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g, .alpha.-defensin, .beta.-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g, PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0391] In one embodiment, a targeting peptide can be an amphipathic .alpha.-helical peptide. Exemplary amphipathic .alpha.-helical peptides include, but are not limited to, cecropins, lycotoxins, paradaxins, buforin, CPF, bombinin-like peptide (BLP), cathelicidins, ceratotoxins, S. clava peptides, hagfish intestinal antimicrobial peptides (HFIAPs), magainines, brevinins-2, dermaseptins, melittins, pleurocidin, H.sub.2A peptides, Xenopus peptides, esculentinis-1, and caerins. A number of factors will preferably be considered to maintain the integrity of helix stability. For example, a maximum number of helix stabilization residues will be utilized (e.g., leu, ala, or lys), and a minimum number helix destabilization residues will be utilized (e.g., proline, or cyclic monomeric units. The capping residue will be considered (for example Gly is an exemplary N-capping residue and/or C-terminal amidation can be used to provide an extra H-bond to stabilize the helix. Formation of salt bridges between residues with opposite charges, separated by i.+-.3, or i.+-.4 positions can provide stability. For example, cationic residues such as lysine, arginine, homo-arginine, ornithine or histidine can form salt bridges with the anionic residues glutamate or aspartate.

[0392] Peptide and peptidomimetic ligands include those having naturally occurring or modified peptides, e.g, D or L peptides; .alpha., .beta., or .gamma. peptides; N-methyl peptides; azapeptides; peptides having one or more amide, i.e., peptide, linkages replaced with one or more urea, thiourea, carbamate, or sulfonyl urea linkages; or cyclic peptides.

[0393] The targeting ligand can be any ligand that is capable of targeting a specific receptor. Examples are: folate, GalNAc, galactose, mannose, mannose-6P, clusters of sugars such as GalNAc cluster, mannose cluster, galactose cluster, or an apatamer. A cluster is a combination of two or more sugar units. The targeting ligands also include integrin receptor ligands, Chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. The ligands can also be based on nucleic acid, e.g, an aptamer. The aptamer can be unmodified or have any combination of modifications disclosed herein.

[0394] Endosomal release agents include imidazoles, poly or oligoimidazoles, PEIs, peptides, fusogenic peptides, polycaboxylates, polyacations, masked oligo or poly cations or anions, acetals, polyacetals, ketals/polyketyals, orthoesters, polymers with masked or unmasked cationic or anionic charges, dendrimers with masked or unmasked cationic or anionic charges.

[0395] PK modulator stands for pharmacokinetic modulator. PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Examplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g, oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple phosphorothioate linkages in the backbaone are also amenable to the present invention as ligands (e.g., as PK modulating ligands).

[0396] In addition, aptamers that bind serum components (e.g., serum proteins) are also amenable to the present invention as PK modulating ligands.

[0397] Other ligand conjugates amenable to the invention are described in U.S. patent application Ser. No. 10/916,185, filed Aug. 10, 2004; U.S. Ser. No. 10/946,873, filed Sep. 21, 2004; U.S. Ser. No. 10/833,934, filed Aug. 3, 2007; U.S. Ser. No. 11/115,989 filed Apr. 27, 2005 and U.S. Ser. No. 11/944,227 filed Nov. 21, 2007, which are incorporated by reference in their entireties for all purposes.

[0398] When two or more ligands are present, the ligands can all have same properties, all have different properties or some ligands have the same properties while others have different properties. For example, a ligand can have targeting properties, have endosomolytic activity or have PK modulating properties. In a preferred embodiment, all the ligands have different properties.

[0399] Ligands can be coupled to the oligonucleotides at various places, for example, 3'-end, 5'-end, and/or at an internal position. In preferred embodiments, the ligand is attached to the oligonucleotides via an intervening tether, e.g, a carrier described herein. The ligand or tethered ligand may be present on a monomer when the monomer is incorporated into the growing strand. In some embodiments, the ligand may be incorporated via coupling to a "precursor" monomer after the "precursor" monomer has been incorporated into the growing strand. For example, a monomer having, e.g, an amino-terminated tether (i.e., having no associated ligand), e.g, TAP--(CH.sub.2).sub.nNH.sub.2 may be incorporated into a growing oligonucleotide strand. In a subsequent operation, i.e., after incorporation of the precursor monomer into the strand, a ligand having an electrophilic group, e.g, a pentafluorophenyl ester or aldehyde group, can subsequently be attached to the precursor monomer by coupling the electrophilic group of the ligand with the terminal nucleophilic group of the precursor monomer's tether.

[0400] In another example, a monomer having a chemical group suitable for taking part in Click Chemistry reaction may be incorporated, e.g, an azide or alkyne terminated tether/linker. In a subsequent operation, i.e., after incorporation of the precursor monomer into the strand, a ligand having complementary chemical group, e.g. an alkyne or azide can be attached to the precursor monomer by coupling the alkyne and the azide together.

[0401] For double-stranded oligonucleotides, ligands can be attached to one or both strands. In some embodiments, a double-stranded iRNA agent contains a ligand conjugated to the sense strand. In other embodiments, a double-stranded iRNA agent contains a ligand conjugated to the antisense strand.

[0402] In some embodiments, ligand can be conjugated to nucleobases, sugar moieties, or internucleosidic linkages of nucleic acid molecules. Conjugation to purine nucleobases or derivatives thereof can occur at any position including, endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7-, or 8-positions of a purine nucleobase are attached to a conjugate moiety. Conjugation to pyrimidine nucleobases or derivatives thereof can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of a pyrimidine nucleobase can be substituted with a conjugate moiety. Conjugation to sugar moieties of nucleosides can occur at any carbon atom. Example carbon atoms of a sugar moiety that can be attached to a conjugate moiety include the 2', 3', and 5' carbon atoms. The 1' position can also be attached to a conjugate moiety, such as in an abasic residue. Internucleosidic linkages can also bear conjugate moieties. For phosphorus-containing linkages (e.g., phosphodiester, phosphorothioate, phosphorodithiotate, phosphoroamidate, and the like), the conjugate moiety can be attached directly to the phosphorus atom or to an O, N, or S atom bound to the phosphorus atom. For amine- or amide-containing internucleosidic linkages (e.g., PNA), the conjugate moiety can be attached to the nitrogen atom of the amine or amide or to an adjacent carbon atom.

[0403] Any suitable ligand in the field of RNA interference may be used, although the ligand is typically a carbohydrate e.g. monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, polysaccharide.

[0404] Linkers that conjugate the ligand to the nucleic acid include those discussed above. For example, the ligand can be one or more GalNAc (V-acetyl glucosamine) derivatives attached through a bivalent or trivalent branched linker.

[0405] In one embodiment, the dsRNA of the invention is conjugated to a bivalent and trivalent branched linkers include the structures shown in any of formula (IV)-(VII):

##STR00005##

wherein:

[0406] q.sup.2A, q.sup.2B, q.sup.3A, q.sup.3B, q.sup.4A, q.sup.4B, q.sup.5A, q.sup.5B and q.sup.5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;

P.sup.2A, P.sup.2B, P.sup.3A, P.sup.3B, P.sup.4A, P.sup.4B, P.sup.5A, P.sup.5B, P.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A, T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2O;

[0407] Q.sup.2A, Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B, Q.sup.5A, Q.sup.5B, Q.sup.5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO.sub.2, N(R.sup.n), C(R').dbd.C(R''), C.ident.C or C(O);

[0408] R.sup.2A, R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.5C are each independently for each occurrence absent, NH, O, S, CH.sub.2, C(O)O, C(O)NH, NHCH(R.sup.a)C(O), --C(O)--CH(R.sup.a)--NH--, CO, CH.dbd.N--O,

##STR00006##

or heterocyclyl;

[0409] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B, L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and

[0410] R.sup.a is H or amino acid side chain.

[0411] Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (VII):

##STR00007##

[0412] wherein L.sup.5A, L.sup.5B and L.sup.5C represent a monosaccharide, such as GalNAc derivative. Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the following compounds:

##STR00008## ##STR00009## ##STR00010##

[0413] In other embodiments, the RNAi agent for use in the methods of the invention is AD-59743.

III. Delivery of an iRNA of the Invention

[0414] The delivery of an iRNA agent of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g, a subject in need thereof, such as a subject having a TMPRSS6 associated disorder, such as a hemochromatosis) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g, a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.

[0415] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian R L. (1992) Trends Cell. Biol. 2(5): 139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, M J., et al (2004) Retina 24:132-138) and subretinal injections in mice (Reich, S J., et al (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J., et al (2005) Mol. Ther. 11261-274) and can prolong survival of tumor-bearing mice (Kim, W J., et al (2006) Mol. Ther. 14:343-350; Li, S., et al (2007) Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, P H., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMCNeurosci. 3:18; Shishkina, G T., et al (2004) Neuroscience 129:521-528; Thakker, E R., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al (2005) J. Neurophysiol 93:594-602) and to the lungs by intranasal administration (Howard, K A., et al (2006) Mol. Ther. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). For administering an iRNA systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo. Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, J O., et al (2006) Nat. Biotechnol 24:1005-1015). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim S H., et al (2008) Journal of Controlled Release 129(2): 107-116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic-iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al (2003) J. Mol. Biol 327:761-766; Verma, U N., et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N., et al (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T S., et al (2006) Nature 441:111-114), cardiolipin (Chien, P Y., et al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E., et al (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006)Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A., et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, E L, et al (1999) Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.

[0416] A. Vector Encoded iRNAs of the Invention

[0417] iRNA targeting the TMPRSS6 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0418] The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g, by transfection or infection) into a target cell. Alternatively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

[0419] iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.

[0420] iRNA expression plasmids can be transfected into target cells as a complex with cationic lipid carriers (e.g., Oligofectamine) or non-cationic lipid-based carriers (e.g, Transit-TKO.TM.). Multiple lipid transfections for iRNA-mediated knockdowns targeting different regions of a target RNA over a period of a week or more are also contemplated by the invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP). Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.

[0421] Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picomavirus vectors; (i) pox virus vectors such as an orthopox, e.g, vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g, promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are further described below.

[0422] Vectors useful for the delivery of an iRNA will include regulatory elements (promoter, enhancer, etc.) sufficient for expression of the iRNA in the desired target cell or tissue. The regulatory elements can be chosen to provide either constitutive or regulated/inducible expression.

[0423] Expression of the iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems, suitable for the control of dsRNA expression in cells or in mammals include, for example, regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-beta-D1-thiogalactopyranoside (IPTG). A person skilled in the art would be able to choose the appropriate regulatory/promoter sequence based on the intended use of the iRNA transgene.

[0424] Viral vectors that contain nucleic acid sequences encoding an iRNA can be used. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding an iRNA are cloned into one or more vectors, which facilitate delivery of the nucleic acid into a patient. More detail about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al, Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV based vectors described in U.S. Pat. Nos. 6,143,520; 5,665,557; and 5,981,276, which are herein incorporated by reference.

[0425] Adenoviruses are also contemplated for use in delivery of iRNAs of the invention. Adenoviruses are especially attractive vehicles, e.g., for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al, Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing an iRNA featured in the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.

[0426] Adeno-associated virus (AAV) vectors may also be used to delivery an iRNA of the invention (Walsh et al, Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA featured in the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Pat. Nos. 5,252,479; 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.

[0427] Another viral vector suitable for delivery of an iRNA of the inevtion is a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.

[0428] The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors can be made to target different cells by engineering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.

[0429] The pharmaceutical preparation of a vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

IV. Pharmaceutical Compositions of the Invention

[0430] The present invention also includes pharmaceutical compositions and formulations which include the iRNAs of the invention. In one embodiment, provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA are useful for treating a TMPRSS6 associated disease or disorder, e.g. hemochromatosis. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV) delivery. Another example is compositions that are formulated for direct delivery into the brain parenchyma, e.g., by infusion into the brain, such as by continuous pump infusion.

[0431] The pharmaceutical compositions comprising RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors.

[0432] In the methods of the invention, the RNAi agent may be administered in a solution. A free RNAi agent may be administered in an unbuffered solution, e.g., in saline or in water. Alternatively, the free siRNA may also be administered in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject.

[0433] In some embodiments, the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g., at the physiologic values of the human plasma. Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolarity of the solution is a salt. In certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.

[0434] The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a TMPRSS6 gene.

[0435] In general, a suitable dose of an iRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. For example, the dsRNA can be administered at about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg about 10 mg/kg, about 20 mg/kg, about 30 mg/kg, about 40 mg/kg, or about 50 mg/kg per single dose.

[0436] For example, the RNAi agent, e.g, dsRNA, may be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0437] In another embodiment, the RNAi agent, e.g, dsRNA, is administered at a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kb, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0438] For example, the RNAi agent, e.g., dsRNA, may be administered at a dose of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg.

[0439] Values and ranges intermediate to the recited values are also intended to be part of this invention. In another embodiment, the RNAi agent, e.g., dsRNA, is administered at a dose of about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. In one embodiment, the dsRNA is administered at a dose of about 10 mg/kg to about 30 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0440] For example, subjects can be administered a therapeutic amount of iRNA, such as about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0441] In certain embodiments, for example, when a composition of the invention comprises a dsRNA as described herein and a lipid, subjects can be administered a therapeutic amount of iRNA, such as about 0.01 mg/kg to about 5 mg/kg, about 0.01 mg/kg to about 10 mg/kg, about 0.05 mg/kg to about 5 mg/kg, about 0.05 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 5 mg/kg, about 0.1 mg/kg to about 10 mg/kg, about 0.2 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 10 mg/kg, about 0.3 mg/kg to about 5 mg/kg, about 0.3 mg/kg to about 10 mg/kg, about 0.4 mg/kg to about 5 mg/kg, about 0.4 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 5 mg/kg, about 0.5 mg/kg to about 10 mg/kg, about 1 mg/kg to about 5 mg/kg, about 1 mg/kg to about 10 mg/kg, about 1.5 mg/kg to about 5 mg/kg, about 1.5 mg/kg to about 10 mg/kg, about 2 mg/kg to about 2.5 mg/kg, about 2 mg/kg to about 10 mg/kg, about 3 mg/kg to about 5 mg/kg, about 3 mg/kg to about 10 mg/kg, about 3.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 5 mg/kg, about 4.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 10 mg/kg, about 4.5 mg/kg to about 10 mg/kg, about 5 mg/kg to about 10 mg/kg, about 5.5 mg/kg to about 10 mg/kg, about 6 mg/kg to about 10 mg/kg, about 6.5 mg/kg to about 10 mg/kg, about 7 mg/kg to about 10 mg/kg, about 7.5 mg/kg to about 10 mg/kg, about 8 mg/kg to about 10 mg/kg, about 8.5 mg/kg to about 10 mg/kg, about 9 mg/kg to about 10 mg/kg, or about 9.5 mg/kg to about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention. For example, the dsRNA may be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0442] In certain embodiments of the invention, for example, when a double-stranded RNAi agent includes modifications (e.g., one or more motifs of three identical modifications on three consecutive nucleotides, including one such motif at or near the cleavage site of the agent), six phosphorothioate linkages, and a ligand, such an agent is administered at a dose of about 0.01 to about 0.5 mg/kg, about 0.01 to about 0.4 mg/kg, about 0.01 to about 0.3 mg/kg, about 0.01 to about 0.2 mg/kg, about 0.01 to about 0.1 mg/kg, about 0.01 mg/kg to about 0.09 mg/kg, about 0.01 mg/kg to about 0.08 mg/kg, about 0.01 mg/kg to about 0.07 mg/kg, about 0.01 mg/kg to about 0.06 mg/kg, about 0.01 mg/kg to about 0.05 mg/kg, about 0.02 to about 0.5 mg/kg, about 0.02 to about 0.4 mg/kg, about 0.02 to about 0.3 mg/kg, about 0.02 to about 0.2 mg/kg, about 0.02 to about 0.1 mg/kg, about 0.02 mg/kg to about 0.09 mg/kg, about 0.02 mg/kg to about 0.08 mg/kg, about 0.02 mg/kg to about 0.07 mg/kg, about 0.02 mg/kg to about 0.06 mg/kg, about 0.02 mg/kg to about 0.05 mg/kg, about 0.03 to about 0.5 mg/kg, about 0.03 to about 0.4 mg/kg, about 0.03 to about 0.3 mg/kg, about 0.03 to about 0.2 mg/kg, about 0.03 to about 0.1 mg/kg, about 0.03 mg/kg to about 0.09 mg/kg, about 0.03 mg/kg to about 0.08 mg/kg, about 0.03 mg/kg to about 0.07 mg/kg, about 0.03 mg/kg to about 0.06 mg/kg, about 0.03 mg/kg to about 0.05 mg/kg, about 0.04 to about 0.5 mg/kg, about 0.04 to about 0.4 mg/kg, about 0.04 to about 0.3 mg/kg, about 0.04 to about 0.2 mg/kg, about 0.04 to about 0.1 mg/kg, about 0.04 mg/kg to about 0.09 mg/kg, about 0.04 mg/kg to about 0.08 mg/kg, about 0.04 mg/kg to about 0.07 mg/kg, about 0.04 mg/kg to about 0.06 mg/kg, about 0.05 to about 0.5 mg/kg, about 0.05 to about 0.4 mg/kg, about 0.05 to about 0.3 mg/kg, about 0.05 to about 0.2 mg/kg, about 0.05 to about 0.1 mg/kg, about 0.05 mg/kg to about 0.09 mg/kg, about 0.05 mg/kg to about 0.08 mg/kg, or about 0.05 mg/kg to about 0.07 mg/kg. Values and ranges intermediate to the foregoing recited values are also intended to be part of this invention, e.g., the RNAi agent may be administered to the subject at a dose of about 0.015 mg/kg to about 0.45 mg/mg.

[0443] For example, the RNAi agent, e.g, RNAi agent in a pharmaceutical composition, may be administered at a dose of about 0.01 mg/kg, 0.0125 mg/kg, 0.015 mg/kg, 0.0175 mg/kg, 0.02 mg/kg, 0.0225 mg/kg, 0.025 mg/kg, 0.0275 mg/kg, 0.03 mg/kg, 0.0325 mg/kg, 0.035 mg/kg, 0.0375 mg/kg, 0.04 mg/kg, 0.0425 mg/kg, 0.045 mg/kg, 0.0475 mg/kg, 0.05 mg/kg, 0.0525 mg/kg, 0.055 mg/kg, 0.0575 mg/kg, 0.06 mg/kg, 0.0625 mg/kg, 0.065 mg/kg, 0.0675 mg/kg, 0.07 mg/kg, 0.0725 mg/kg, 0.075 mg/kg, 0.0775 mg/kg, 0.08 mg/kg, 0.0825 mg/kg, 0.085 mg/kg, 0.0875 mg/kg, 0.09 mg/kg, 0.0925 mg/kg, 0.095 mg/kg, 0.0975 mg/kg, 0.1 mg/kg, 0.125 mg/kg, 0.15 mg/kg, 0.175 mg/kg, 0.2 mg/kg, 0.225 mg/kg, 0.25 mg/kg, 0.275 mg/kg, 0.3 mg/kg, 0.325 mg/kg, 0.35 mg/kg, 0.375 mg/kg, 0.4 mg/kg, 0.425 mg/kg, 0.45 mg/kg, 0.475 mg/kg, or about 0.5 mg/kg. Values intermediate to the foregoing recited values are also intended to be part of this invention.

[0444] The pharmaceutical composition can be administered once daily, or the iRNA can be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the iRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the iRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0445] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per week. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered bi-monthly.

[0446] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.

[0447] Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as a disorder associated with iron overload that would benefit from reduction in the expression of TMPRSS6. Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, the thalassemic Th3/+ mouse as a model of .beta.-thalassemia (Douet et al., Am. J. Pathol. (2011), 178(2):774-83), the HFE knockout mouse as a model of hereditary hemochromatosis (Zhou et al. (1998) Proc. Natl. Acad. Sci USA, 85:2492-2497); a Uros(mut248) mouse as a model of congenital erythropoietic porphyria (Ged et al. (2006) Genomics, 87(1):84-92).

[0448] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration

[0449] The iRNA can be delivered in a manner to target a particular tissue, such as the liver (e.g., the hepatocytes of the liver).

[0450] Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g, dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g, dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g, dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the invention can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, iRNAs can be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acyl choline, or a C.sub.1-20 alkyl ester (e.g, isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof). Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.

[0451] A. iRNA Formulations Comprising Membranous Molecular Assemblies

[0452] An iRNA for use in the compositions and methods of the invention can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the iRNA composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the iRNA composition, although in some examples, it may. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the iRNA are delivered into the cell where the iRNA can specifically bind to a target RNA and can mediate RNAi. In some cases the liposomes are also specifically targeted, e.g., to direct the iRNA to particular cell types.

[0453] A liposome containing a RNAi agent can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of RNAi agent.

[0454] If necessary a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). pH can also adjusted to favor condensation.

[0455] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al, Proc. Natl. Acad Sci., USA 8:7413-7417, 1987; U.S. Pat. Nos. 4,897,355; 5,171,678; Bangham, et al. M. Mol. Biol. 23:238, 1965; Olson, et al. Biochim. Biophys. Acta 557:9, 1979; Szoka, et al. Proc. Natl Acad Sci. 75: 4194, 1978; Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984; Kim, et al. Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al. Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer, et al. Biochim. Biophys. Acta 858:161, 1986). Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984). These methods are readily adapted to packaging RNAi agent preparations into liposomes.

[0456] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0457] Liposomes which are pH-sensitive or negatively-charged, entrap nucleic acids rather than complex with it. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0458] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

[0459] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. Nos. 5,283,185; 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Feigner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natol. Acad. Set. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992.

[0460] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome.TM. I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome.TM. II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4(6) 466).

[0461] Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside Gm, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0462] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad Sci., 1987, 507, 64) reported the ability of monosialoganglioside Gm, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside Gm or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).

[0463] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

[0464] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

[0465] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

[0466] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. Lipofectin.TM. Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

[0467] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide ("DOGS") (Transfectam.TM., Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide ("DPPES") (see, e.g., U.S. Pat. No. 5,171,678).

[0468] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol ("DC-Chol") which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

[0469] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agent into the skin. In some implementations, liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner el al, Journal of Drug Targeting, 1992, vol. 2, 405-410 and du Plessis et al., Antiviral Research, 18, 1992, 259-265; Mannino, R. J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al. Gene 56:267-276. 1987; Nicolau, C. et al. Meth. Enz. 149:157-176, 1987; Straubinger, R. M. and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad Sci. USA 84:7851-7855, 1987).

[0470] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with RNAi agent are useful for treating a dermatological disorder.

[0471] Liposomes that include iRNA can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposomes. Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transferosomes can be self-optimizing (adaptive to the shape of pores, e.g, in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading.

[0472] Other formulations amenable to the present invention are described in U.S. provisional application Ser. No. 61/018,616, filed Jan. 2, 2008; 61/018,611, filed Jan. 2, 2008; 61/039,748, filed Mar. 26, 2008; 61/047,087, filed Apr. 22, 2008 and 61/051,528, filed May 8, 2008. PCT application no PCT/US2007/080331, filed Oct. 3, 2007 also describes formulations that are amenable to the present invention.

[0473] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0474] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0475] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0476] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[0477] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[0478] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

[0479] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0480] The iRNA for use in the methods of the invention can also be provided as micellar formulations. "Micelles" are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

[0481] A mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal Cx to C22 alkyl sulphate, and a micelle forming compounds. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle forming compounds may be added at the same time or after addition of the alkali metal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide smaller size micelles.

[0482] In one method a first micellar composition is prepared which contains the siRNA composition and at least the alkali metal alkyl sulphate. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition. In another method, the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.

[0483] Phenol and/or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and/or m-cresol may be added with the micelle forming ingredients. An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.

[0484] For delivery of the micellar formulation as a spray, the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant. The propellant, which is under pressure, is in liquid form in the dispenser. The ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve. The dispensed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.

[0485] Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.

[0486] The specific concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral cavities, it is often desirable to increase, e.g, at least double or triple, the dosage for through injection or administration through the gastrointestinal tract.

[0487] B. Lipid Particles

[0488] iRNAs, e.g, dsRNAs of in the invention may be fully encapsulated in a lipid formulation, e.g, a LNP, or other nucleic acid-lipid particle.

[0489] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. LNPs contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (c-g; a PEG-lipid conjugate). LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.

[0490] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the invention.

[0491] The cationic lipid can be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N--(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N--(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)--N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydr- o-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami- no)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0492] In another embodiment, the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. Synthesis of 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. provisional patent application No. 61/107,998 filed on Oct. 23, 2008, which is herein incorporated by reference. In one embodiment, the lipid-siRNA particle includes 40% 2, 2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0.+-.20 nm and a 0.027 siRNA/Lipid Ratio.

[0493] The ionizable/non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.

[0494] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (Ci.sub.2), a PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl (Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated lipid that prevents aggregation of particles can be from 0 mol % to about mol % or about 2 mol % of the total lipid present in the particle.

[0495] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.

[0496] In one embodiment, the lipidoid ND98-4HCl (MW 1487) (see U.S. patent application Ser. No. 12/056,230, filed Mar. 26, 2008, which is incorporated herein by reference), Cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (i.e., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml. TheND98, Cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g., 42:48:10 molar ratio. The combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-dsRNA nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.

##STR00011##

[0497] LNP01 formulations are described, e.g., in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.

[0498] Additional exemplary lipid-dsRNA formulations are described in Table A.

TABLE-US-00001 TABLE A cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate Ionizable/Cationic Lipid Lipid:siRNA ratio LNP-1 1,2-Dilinolenyloxy-N,N-dimethylaminopropane DLinDMA/DPPC/Cholesterol/PEG-cDMA (DLinDMA) (57.1/7.1/34.4/1.4) lipid:siRNA ~7:1 2-XTC 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DPPC/Cholesterol/PEG-cDMA dioxolane (XTC) 57.1/7.1/34.4/1.4 lipid:siRNA ~7:1 LNP05 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~6:1 LNP06 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~11:1 LNP07 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~6:1 LNP08 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~11:1 LNP09 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 50/10/38.5/1.5 Lipid:siRNA 10:1 LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)- ALN100/DSPC/Cholesterol/PEG-DMG octadeca-9,12-dienyl)tetrahydro-3aH- 50/10/38.5/1.5 cyclopenta[d][1,3]dioxol-5-amine (ALN100) Lipid:siRNA 10:1 LNP11 (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31- MC-3/DSPC/Cholesterol/PEG-DMG tetraen-19-yl 4-(dimethylamino)butanoate 50/10/38.5/1.5 (MC3) Lipid:siRNA 10:1 LNP12 1,1'-(2-(4-(2-((2-(bis(2- Tech G1/DSPC/Cholesterol/PEG-DMG hydroxydodecyl)amino)ethyl)(2- 50/10/38.5/1.5 hydroxydodecyl)amino)ethyl)piperazin-1- Lipid:siRNA 10:1 yl)ethylazanediyl)didodecan-2-ol (Tech G1) LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 33:1 LNP14 MC3 MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:siRNA: 11:1 LNP15 MC3 MC3/DSPC/Chol/PEG-DSG/GalNAc-PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA: 11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:siRNA: 8:1 LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1 DSPC: distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000) PEG-DSG: PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000) PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000) LNP (1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in International Publication No. WO2009/127060, filed Apr. 15, 2009, which is hereby incorporated by reference. XTC comprising formulations are described, e.g., in U.S. Provisional Ser. No. 61/148,366, filed Jan. 29, 2009; U.S. Provisional Ser. No. 61/156,851, filed Mar. 2, 2009; U.S. Provisional Ser. No. filed Jun. 10, 2009; U.S. Provisional Ser. No. 61/228,373, filed Jul. 24, 2009; U.S. Provisional Ser. No. 61/239,686, filed Sep. 3, 2009, and International Application No. PCT/US2010/022614, filed Jan. 29, 2010, which are hereby incorporated by reference. MC3 comprising formulations are described, e.g., in U.S. Publication No. 2010/0324120, filed Jun. 10, 2010, the entire contents of which are hereby incorporated by reference. ALNY-100 comprising formulations as described, e.g., International patent application number PCT/US09/63933, filed on Nov. 10, 2009, which is hereby incorporated by reference. C12-200 comprising formulations are described in U.S. Provisional Ser. No. 61/175,770, filed May 5, 2009 and International Application No. PCT/US10/33777, filed May 5, 2010, which are hereby incorporated by reference.

[0499] Synthesis of Ionizable/Cationic Lipids

[0500] Any of the compounds, e.g., cationic lipids and the like, used in the nucleic acid-lipid particles of the invention can be prepared by known organic synthesis techniques, including the methods described in more detail in the Examples. All substituents are as defined below unless indicated otherwise.

[0501] "Alkyl" means a straight chain or branched, noncyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Representative saturated straight chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.

[0502] "Alkenyl" means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Representative straight chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, and the like.

[0503] "Alkynyl" means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbons. Representative straight chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1 butynyl, and the like.

[0504] "Acyl" means any alkyl, alkenyl, or alkynyl wherein the carbon at the point of attachment is substituted with an oxo group, as defined below. For example, --C(.dbd.O)alkyl, --C(.dbd.O)alkenyl, and --C(.dbd.O)alkynyl are acyl groups.

[0505] "Heterocycle" means a 5- to 7-membered monocyclic, or 7- to 10-membered bicyclic, heterocyclic ring which is either saturated, unsaturated, or aromatic, and which contains from 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms can be optionally oxidized, and the nitrogen heteroatom can be optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle can be attached via any heteroatom or carbon atom. Heterocycles include heteroaryls as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.

[0506] The terms "optionally substituted alkyl", "optionally substituted alkenyl", "optionally substituted alkynyl", "optionally substituted acyl", and "optionally substituted heterocycle" means that, when substituted, at least one hydrogen atom is replaced with a substituent. In the case of an oxo substituent (.dbd.O) two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, --CN, --ORx, --NRxRy, --NRxC(.dbd.O)Ry, --NRxSO2Ry, --C(.dbd.O)Rx, --C(.dbd.O)ORx, --C(.dbd.O)NRxRy, --SOnRx and --SOnNRxRy, wherein n is 0, 1 or 2, Rx and Ry are the same or different and independently hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents can be further substituted with one or more of oxo, halogen, --OH, --CN, alkyl, --ORx, heterocycle, --NRxRy, --NRxC(.dbd.O)Ry, --NRxSO2Ry, --C(.dbd.O)Rx, --C(.dbd.O)ORx, --C(.dbd.O)NRxRy, --SOnRx and --SOnNRxRy.

[0507] "Halogen" means fluoro, chloro, bromo and iodo.

[0508] In some embodiments, the methods of the invention can require the use of protecting groups. Protecting group methodology is well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, T. W. et al., Wiley-Interscience, New York City, 1999). Briefly, protecting groups within the context of this invention are any group that reduces or eliminates unwanted reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group. In some embodiments an "alcohol protecting group" is used. An "alcohol protecting group" is any group which decreases or eliminates unwanted reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.

[0509] Synthesis of Formula A

[0510] In some embodiments, nucleic acid-lipid particles of the invention are formulated using a cationic lipid of formula A:

##STR00012##

where R1 and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is XTC (2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane). In general, the lipid of formula A above can be made by the following Reaction Schemes 1 or 2, wherein all substituents are as defined above unless indicated otherwise.

##STR00013##

[0511] Lipid A, where R1 and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring, can be prepared according to Scheme 1. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 1 and 2 yields ketal 3. Treatment of ketal 3 with amine 4 yields lipids of formula A. The lipids of formula A can be converted to the corresponding ammonium salt with an organic salt of formula 5, where X is anion counter ion selected from halogen, hydroxide, phosphate, sulfate, or the like.

##STR00014##

[0512] Alternatively, the ketone 1 starting material can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 6 and 7 yields ketone 1. Conversion of ketone 1 to the corresponding lipids of formula A is as described in Scheme 1.

[0513] Synthesis of MC3

[0514] Preparation of DLin-M-C3-DMA (i.e., (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate) was as follows. A solution of (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N,N-dimethylaminopyridine (0.61 g) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 mL) was stirred at room temperature overnight. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organic fractions were dried over anhydrous magnesium sulphate, filtered and the solvent removed on a rotovap. The residue was passed down a silica gel column (20 g) using a 1-5% methanol/dichloromethane elution gradient. Fractions containing the purified product were combined and the solvent removed, yielding a colorless oil (0.54 g).

[0515] Synthesis of ALNY-100

[0516] Synthesis of ketal 519 [ALNY-100] was performed using the following scheme 3:

##STR00015##

[0517] Synthesis of 515

[0518] To a stirred suspension of LiAlH4 (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in a two neck RBF (1 L), was added a solution of 514 (10 g, 0.04926 mol) in 70 mL of THF slowly at 0 0 C under nitrogen atmosphere. After complete addition, reaction mixture was warmed to room temperature and then heated to reflux for 4 h. Progress of the reaction was monitored by TLC. After completion of reaction (by TLC) the mixture was cooled to 0 0 C and quenched with careful addition of saturated Na2SO4 solution. Reaction mixture was stirred for 4 h at room temperature and filtered off. Residue was washed well with THF. The filtrate and washings were mixed and diluted with 400 mL dioxane and 26 mL cone. HCl and stirred for 20 minutes at room temperature. The volatilities were stripped off under vacuum to furnish the hydrochloride salt of 515 as a white solid. Yield: 7.12 g 1H-NMR (DMSO, 400 MHz): .delta.=9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66-2.60 (m, 2H), 2.50-2.45 (m, 5H).

[0519] Synthesis of 516

[0520] To a stirred solution of compound 515 in 100 mL dry DCM in a 250 mL two neck RBF, was added NEt3 (37.2 mL, 0.2669 mol) and cooled to 0 0 C under nitrogen atmosphere. After a slow addition of N-(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) in 50 mL dry DCM, reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 h by TLC) mixture was washed successively with 1N HCl solution (1.times.100 mL) and saturated NaHCO3 solution (1.times.50 mL). The organic layer was then dried over anhyd. Na2SO4 and the solvent was evaporated to give crude material which was purified by silica gel column chromatography to get 516 as sticky mass. Yield: 11 g (89%). 1H-NMR (CDCl3, 400 MHz): .delta.=7.36-7.27 (m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, 3H), 2.60 (m, 2H), 2.30-2.25 (m, 2H). LC-MS [M+H]-232.3 (96.94%).

[0521] Synthesis of 517A and 517B

[0522] The cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 mL acetone and water (10:1) in a single neck 500 mL RBF and to it was added N-methyl morpholine-N-oxide (7.6 g, 0.06492 mol) followed by 4.2 mL of 7.6% solution of Os04 (0.275 g, 0.00108 mol) in tert-butanol at room temperature. After completion of the reaction (3 h), the mixture was quenched with addition of solid Na2SO3 and resulting mixture was stirred for 1.5 h at room temperature. Reaction mixture was diluted with DCM (300 mL) and washed with water (2.times.100 mL) followed by saturated NaHCO3 (1.times.50 mL) solution, water (1.times.30 mL) and finally with brine (lx 50 mL). Organic phase was dried over an.Na2SO4 and solvent was removed in vacuum. Silica gel column chromatographic purification of the crude material was afforded a mixture of diastereomers, which were separated by prep HPLC. Yield: -6 g crude 517A--Peak-1 (white solid), 5.13 g (96%). 1H-NMR (DMSO, 400 MHz): .delta.=7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4.48-4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, 3H), 1.72-1.67 (m, 4H). LC-MS--[M+H]-266.3, [M+NH4+]-283.5 present, HPLC-97.86%. Stereochemistry confirmed by X-ray.

[0523] Synthesis of 518

[0524] Using a procedure analogous to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. 1H-NMR (CDCl3, 400 MHz): .delta.=7.35-7.33 (m, 4H), 7.30-7.27 (m, 1H), 5.37-5.27 (m, 8H), 5.12 (s, 2H), 4.75 (m, 1H), 4.58-4.57 (m, 2H), 2.78-2.74 (m, 7H), 2.06-2.00 (m, 8H), 1.96-1.91 (m, 2H), 1.62 (m, 4H), 1.48 (m, 2H), 1.37-1.25 (br m, 36H), 0.87 (m, 6H). HPLC-98.65%.

[0525] General Procedure for the Synthesis of Compound 519

[0526] A solution of compound 518 (1 eq) in hexane (15 mL) was added in a drop-wise fashion to an ice-cold solution of LAH in THF (1 M, 2 eq). After complete addition, the mixture was heated at 40.degree. C. over 0.5 h then cooled again on an ice bath. The mixture was carefully hydrolyzed with saturated aqueous Na2SO4 then filtered through celite and reduced to an oil. Column chromatography provided the pure 519 (1.3 g, 68%) which was obtained as a colorless oil. 13C NMR .delta.=130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23.3, 226, 14.1; Electrospray MS (+ve): Molecular weight for C44H80NO2 (M+H)+ Calc. 654.6, Found 654.6.

[0527] Formulations prepared by either the standard or extrusion-free method can be characterized in similar manners. For example, formulations are typically characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sediment. Particle size and particle size distribution of lipid-nanoparticles can be measured by light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, USA). Particles should be about 20-300 nm, such as 40-100 nm in size. The particle size distribution should be unimodal. The total dsRNA concentration in the formulation, as well as the entrapped fraction, is estimated using a dye exclusion assay. A sample of the formulated dsRNA can be incubated with an RNA-binding dye, such as Ribogreen (Molecular Probes) in the presence or absence of a formulation disrupting surfactant, e.g., 0.5% Triton-X100. The total dsRNA in the formulation can be determined by the signal from the sample containing the surfactant, relative to a standard curve. The entrapped fraction is determined by subtracting the "free" dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. Percent entrapped dsRNA is typically >85%. For LNP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, and at least 120 nm. The suitable range is typically about at least 50 nm to about at least 110 nm, about at least 60 nm to about at least 100 nm, or about at least 80 nm to about at least 90 nm.

[0528] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the invention are administered in conjunction with one or more penetration enhancer surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcamitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the invention can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. Pat. No. 6,887,906, US Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.

[0529] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0530] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating hepatic disorders such as hepatic carcinoma.

[0531] The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0532] The compositions of the present invention can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.

C. Additional Formulations

[0533] i. Emulsions

[0534] The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 .mu.m in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

[0535] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semi solid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0536] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

[0537] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tri stearate.

[0538] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0539] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

[0540] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0541] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

[0542] ii. Microemulsions

[0543] In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0544] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

[0545] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

[0546] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.

[0547] Microemulsions of the present invention can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories-surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

[0548] iii. Microparticles

[0549] An RNAi agent of the invention may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

[0550] iv. Penetration Enhancers

[0551] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

[0552] Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

[0553] Surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

[0554] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acyl carnitines, acylcholines, C.sub.1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g, Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0555] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

[0556] Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

[0557] As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0558] Agents that enhance uptake of iRNAs at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al. U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine.TM. (Invitrogen; Carlsbad, Calif.), Lipofectamine 2000.TM. (Invitrogen; Carlsbad, Calif.), 293Fectin.TM. (Invitrogen; Carlsbad, Calif.), Cellfectin.TM. (Invitrogen; Carlsbad, Calif.), DMRIE-C.TM. (Invitrogen; Carlsbad, Calif.), FreeStyle.TM.MAX (Invitrogen; Carlsbad, Calif.), Lipofectamine.TM. 2000 CD (Invitrogen; Carlsbad, Calif.), Lipofectamine.TM. (Invitrogen; Carlsbad, Calif.), RNAiMAX (Invitrogen; Carlsbad, Calif.), Oligofectamine.TM. (Invitrogen; Carlsbad, Calif.), Optifect.TM. (Invitrogen; Carlsbad, Calif.), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam.RTM. Reagent (Promega; Madison, Wis.), TransFast.TM. Transfection Reagent (Promega; Madison, Wis.), Tfx.TM.-20 Reagent (Promega; Madison, Wis.), Tfx.TM.-50 Reagent (Promega; Madison, Wis.), DreamFect.TM. (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass.sup.a D1 Transfection Reagent (New England Biolabs; Ipswich, Mass., USA), LyoVec.TM./LipoGen.TM. (Invitrogen; San Diego, Calif., USA), PerFectin Transfection Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), GenePORTER Transfection reagent (Genlantis; San Diego, Calif., USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, Calif., USA), Cytofectin Transfection Reagent (Genlantis; San Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), TroganPORTER.TM. transfection Reagent (Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton, Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR (B-Bridge International; Mountain View, Calif., USA), SureFECTOR (B-Bridge International; Mountain View, Calif., USA), or HiFect.TM. (B-Bridge International, Mountain View, Calif., USA), among others.

[0559] Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

[0560] v. Carriers

[0561] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.

[0562] vi. Excipients

[0563] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc); disintegrants (e.g., starch, sodium starch glycolate, etc); and wetting agents (e.g., sodium lauryl sulphate, etc).

[0564] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0565] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

[0566] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0567] vii. Other Components

[0568] The compositions of the present invention can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

[0569] Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.

[0570] In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA compounds and (b) one or more agents which function by a non-RNAi mechanism and which are useful in treating a bleeding disorder. Examples of such agents include, but are not limited to an anti-inflammatory agent, anti-steatosis agent, anti-viral, and/or anti-fibrosis agent. In addition, other substances commonly used to protect the liver, such as silymarin, can also be used in conjunction with the iRNAs described herein. Other agents useful for treating liver diseases include telbivudine, entecavir, and protease inhibitors such as telaprevir and other disclosed, for example, in Tung et al., U.S. Application Publication Nos. 2005/0148548, 2004/0167116, and 2003/0144217; and in Hale et al., U.S. Application Publication No. 2004/0127488.

[0571] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred.

[0572] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the invention lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC.sub.50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

[0573] In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents effective in treatment of pathological processes that are mediated by iron overload and that can be treated by inhibiting TMPRSS6 expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

V. Methods For Inhibiting TMPRSS6 Expression

[0574] The present invention provides methods of inhibiting expression of TMPRSS6 (matriptase-2) in a cell. The methods include contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to inhibit expression of the TMPRSS6 in the cell, thereby inhibiting expression of the TMPRSS6 in the cell. Contacting of a cell with a double stranded RNAi agent may be done in vitro or in vivo.

[0575] Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi agent. Combinations of in vitro and in vivo methods of contacting are also possible. Contacting may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate moiety, e.g, a GalNAc.sub.3 ligand, or any other ligand that directs the RNAi agent to a site of interest, e.g, the liver of a subject.

[0576] The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating" and other similar terms, and includes any level of inhibition.

[0577] The phrase "inhibiting expression of a TMPRSS6" is intended to refer to inhibition of expression of any TMPRSS6 gene (such as, e.g., a mouse TMPRSS6 gene, a rat TMPRSS6 gene, a monkey TMPRSS6 gene, or a human TMPRSS6 gene) as well as variants or mutants of a TMPRSS6 gene. Thus, the TMPRSS6 gene may be a wild-type TMPRSS6 gene, a mutant TMPRSS6 gene, or a transgenic TMPRSS6 gene in the context of a genetically manipulated cell, group of cells, or organism.

[0578] "Inhibiting expression of a TMPRSS6 gene" includes any level of inhibition of a TMPRSS6 gene, e.g., at least partial suppression of the expression of a TMPRSS6 gene. The expression of the TMPRSS6 gene may be assessed based on the level, or the change in the level, of any variable associated with TMPRSS6 gene expression, e.g., TMPRSS6 mRNA level, TMPRSS6 protein level, or lipid levels. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject.

[0579] Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with TMPRSS6 expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g, a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g, buffer only control or inactive agent control).

[0580] In some embodiments of the methods of the invention, expression of a TMPRSS6 gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0581] Inhibition of the expression of a TMPRSS6 gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a TMPRSS6 gene is transcribed and which has or have been treated (e.g, by contacting the cell or cells with an RNAi agent of the invention, or by administering an RNAi agent of the invention to a subject in which the cells are or were present) such that the expression of a TMPRSS6 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s)). In preferred embodiments, the inhibition is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula:

( mRNA .times. .times. in .times. .times. control .times. .times. cells ) - ( mRNA .times. .times. in .times. .times. treated .times. .times. cells ) ( mRNA .times. .times. in .times. .times. control .times. .times. cells ) 100 .times. % ##EQU00001##

[0582] Alternatively, inhibition of the expression of a TMPRSS6 gene may be assessed in terms of a reduction of a parameter that is functionally linked to TMPRSS6 gene expression, e.g, TMPRSS6 protein expression, hepcidin gene or protein expression, or iron levels in tissues or serum. TMPRSS6 gene silencing may be determined in any cell expressing TMPRSS6, either constitutively or by genomic engineering, and by any assay known in the art. The liver is the major site of TMPRSS6 expression. Other significant sites of expression include the kidneys and the uterus.

[0583] Inhibition of the expression of a TMPRSS6 protein may be manifested by a reduction in the level of the TMPRSS6 protein that is expressed by a cell or group of cells (e.g, the level of protein expressed in a sample derived from a subject). As explained above for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

[0584] A control cell or group of cells that may be used to assess the inhibition of the expression of a TMPRSS6 gene includes a cell or group of cells that has not yet been contacted with an RNAi agent of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.

[0585] The level of TMPRSS6 mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of TMPRSS6 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g, mRNA of the TMPRSS6 gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, in situ hybridization, and microarray analysis.

[0586] In one embodiment, the level of expression of TMPRSS6 is determined using a nucleic acid probe. The term "probe", as used herein, refers to any molecule that is capable of selectively binding to a specific TMPRSS6. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0587] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to TMPRSS6 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of TMPRSS6 mRNA.

[0588] An alternative method for determining the level of expression of TMPRSS6 in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of TMPRSS6 is determined by quantitative fluorogenic RT-PCR (i.e., the TaqMan.TM. System).

[0589] The expression levels of TMPRSS6 mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as Northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of TMPRSS6 expression level may also comprise using nucleic acid probes in solution.

[0590] In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of these methods is described and exemplified in the Examples presented herein.

[0591] The level of TMPRSS6 protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like.

[0592] The term "sample" as used herein refers to a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, ocular fluids, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In preferred embodiments, a "sample derived from a subject" refers to blood or plasma drawn from the subject. In further embodiments, a "sample derived from a subject" refers to liver tissue derived from the subject.

[0593] In some embodiments of the methods of the invention, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site within the subject. The inhibition of expression of TMPRSS6 may be assessed using measurements of the level or change in the level of TMPRSS6 mRNA or TMPRSS6 protein in a sample derived from fluid or tissue from the specific site within the subject. In preferred embodiments, the site is the liver. The site may also be a subsection or subgroup of cells from any one of the aforementioned sites. The site may also include cells that express a particular type of receptor.

VI. Methods for Treating or Preventing a TMPRSS6 Associated Disorder

[0594] The present invention also provides methods for treating or preventing diseases and conditions that can be modulated by TMPRSS6 gene expression. For example, the compositions described herein can be used to treat any disorder associated with iron overload, e.g, a thalassemia (e.g, .beta.-thalassemia or .alpha.-thalassemia), primary hemochromatosis, secondary hemochromatosis, severe juvenile hemochromatosis, erythropoietic porphyria, sideroblastic anemia, hemolytic anemia, dyserythropoietic anemia, or sickle-cell anemia. In one embodiment, a TMPRSS6 iRNA is used to treat a hemoglobinopathy. The TMPRSS6 iRNAs of the invention can also be used to treat elevated levels of iron due to other conditions, such as chronic alcoholism.

[0595] In thalassemias, the bone marrow synthesizes insufficient amounts of a hemoglobin chain; this in turn reduces the production of red blood cells and causes anemia. Either the .alpha. or the .beta. chain may be affected, but .beta. thalassemias are more common. Newborn babies are healthy because their bodies still produce HbF, which does not have P chains; during the first few months of life, the bone marrow switches to producing HbA, and symptoms start to appear.

[0596] .beta.-thalassemias result from mutation with either non-expressing (.beta..degree.) or low expressing (.beta.+) alleles of the HBB gene, .beta.-thalassemias vary in severity depending on the genotype, and include minor/trait .beta.-thalassemia (.beta./.beta..degree. or .beta./.beta.+), intermedia .beta.-thalassemia (.beta..degree./.beta.+), and major .beta.-thalassemia (.beta..degree./.beta..degree. or .beta.''7 .beta.+).

[0597] Thalassemia intermedia (TI) typically presents with little hemolysis, while major .beta.-thalassemia (TM) is typically accompanied by abundant hemolysis which causes, e.g., anemia and splenomegaly; and highly ineffective erythropoiesis, which causes bone marrow drive (skeletal changes, oteopenia), increased erythropoietin synthesis, hepato-splenomegaly, consumption of haematinics (megablastic anemia), and high uric acid in blood. The iRNAs of the invention, e.g., TMPRSS6 iRNAs, are better suited for treating the iron overload that typically accompanies thalassemia's that are more TI like (e.g., for treating individuals having a .beta..degree./.beta.+, .beta./.beta..degree. or .beta./.beta.+ genotype).

[0598] Symptoms of .beta.-thalassemias also include, e.g, complication due to therapy, e.g, iron overload, which causes endocrinopathy, liver fibrosis and cardiac fibrosis. Administration of an iRNA agent that targets TMPRSS6 can be effective to treat one or more of these symptoms.

[0599] .alpha.-thalassemias result from mutation with either non-expressing (a.degree.) or low expressing (a+) alleles of the HBA1 or HBA2 genes, orthalassemias vary in severity depending on the genotype, and include trait thalassemia (-.alpha./.alpha..alpha.), Hb Bart and Hydrops fetalis (a.degree./a.degree.), a-Thalaseemia minor (-/.alpha..alpha.), (-.alpha./-.alpha.), and HbH disease (-/-a). Lower a-globin chains are produced, resulting in an excess of .beta. chains in adults and excess .gamma. chains in newborns. The excess .beta. chains form unstable tetramers (called Hemoglobin H or HbH of 4 beta chains), which have abnormal oxygen dissociation curves. Administration of an iRNA agent that targets TMPRSS6 can be effective to treat iron overload in a subject who has an a-thalassemias.

[0600] Symptoms of hemochromatosis include, e.g, abdominal pain, joint pain, fatigue, lack of energy, weakness, darkening of the skin (often referred to as "bronzing"), and loss of body hair. Administration of an iRNA agent that targets TMPRSS6 can be effective to treat one or more of these symptoms.

[0601] Other symptoms associated with iron overload include increased risk for liver disease (cirrhosis, cancer), heart attack or heart failure, diabetes mellitus, osteoarthritis, osteoporosis, metabolic syndrome, hypothyroidism, hypogonadism, and in some cases premature death. Iron mismanagement resulting in overload can also accelerate such neurodegenerative diseases as Alzheimer's, early-onset Parkinson's, Huntington's, epilepsy and multiple sclerosis. Administration of an iRNA agent that targets TMPRSS6, e.g, an iRNA described in Tables 1 or 2 can treat one or more of these symptoms, or prevent the development or progression of a disease or disorder that is aggrevated by increased iron levels.

[0602] The methods of the invention further relate to the use of an iRNA agent or a pharmaceutical composition thereof, e.g, for treating a disorder associated with iron overload, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, an iRNA agent targeting TMPRSS6 is administered in combination with, e.g., iron chelators (e.g., desferoxamine), folic acid, a blood transfusion, a phlebotomy, agents to manage ulcers, agents to increase fetal hemoglobin levels (e.g, hydroxyurea), agents to control infection (e.g, antibiotics and antivirals), agents to treat thrombotic state, or a stem cell or bone marrow transplant. A stem cell transplant can utilize stem cells from an umbilical cord, such as from a relative, e.g, a sibling. Exemplary iron chelators include desferoxamine, Deferasirox (Exjade), deferiprone, vitamin E, wheat germ oil, tocophersolan, and indicaxanthin.

[0603] The iRNA agent and an additional therapeutic agent can be administered in the same composition, e.g, parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein. Administration of the iRNA agent and the additional therapeutic agent can be at the same time, or at different times and, in any order.

[0604] Administration of the iRNA agent of the invention can lower iron levels, lower ferritin levels, and/or lower transferrin saturation levels. For example, administration of the dsRNA can lower serum iron levels and/or lower serum ferritin levels. Transferrin saturation levels can be lowered by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or more. In another embodiment, the transferrin saturation levels remain lower for 7 days, 10 days, 20 days, 30 days, or more following administration.

[0605] Transferrin saturation levels can be lowered to below 50%, below 45%, below 40%, below 35%, below 35%, below 30%, below 25%, below 20%, below 15%, or lower. In another embodiment, the lower transferrin saturation levels are maintained for 7 days, 10 days, 20 days, 30 days, or more following administration. Transferrin saturation is a measure of the amount of iron bound to serum transferrin, and corresponds to the ratio of serum iron and total iron-binding capacity.

[0606] Serum iron levels can be lowered by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In another embodiment, the serum iron levels remain lower for 7 days, 10 days, 20 days, 30 days, or more following administration.

[0607] Administration of the iRNA agent of the invention preferably results in lowered iron levels in the blood, and more particularly in the serum, or in one or more tissues of the mammal. In some embodiments, iron levels are decreased by at least 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more, as compared to pretreatment levels.

[0608] By "lower" in this context is meant a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without such disorder.

[0609] Administration of the iRNA agent of the invention can increase serum hepcidin levels, and/or increase hepcidin gene expression. For example, administration of the dsRNA can increase serum hepcidin by at least about 10%, 25%, 50%, 100%, 150%, 200%, 250%, 300%, or more. In a further example, administration of the dsRNA can increase hepcidin mRNA levels by at least about 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, or greater.

[0610] Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, the levels of transferrin saturation or serum ferritin can be monitored for efficacy of a given treatment regime.

[0611] Iron level tests are typically performed on a sample of a pateint's blood. An iron level test measure the amount of iron in the blood serum that is being carried by the proteins transferrin. A TIBC (Total iron-binding capacity) test measures the amount of iron that the blood would carry if the transferrin were fully saturated. Since transferrin is produced by the liver, the TIBC can be used to monitor liver function and nutrition. The transferrin test is a direct measure of transferrin (also called siderophilin) levels in the blood. The saturation level of transferrin can be calculated by dividing the serum iron level by the TIBC. The ferritin test measures the level of a protein in the blood that stores iron for later use by the body.

[0612] The iRNA treatments described herein can be used to treat individuals afflicted with a TMPRSS6 associated disorder, e.g., elevated iron levels, as may be indicated by iron levels in serum e.g., iron levels measuring greater than 350 .mu.g/dL, greater than 500 .mu.g/dL, greater than 1000 .mu.g/dL, or more. In an embodiment, elevated levels of iron in serum, e.g., greater than 15, 20, 25, or 30 mg/g dry weight.

[0613] The iRNA treatments described herein can also be used to treat individuals having elevated iron levels, as may be indicated by elevated ferritin levels in serum, e.g, ferritin levels measuring greater than 300 .mu.g/L, greater than 500 .mu.g/L, greater than 1000 .mu.g/L, greater than 1500 .mu.g/L, greater than 2000 .mu.g/L, greater than 2500 .mu.g/L, or 3000 .mu.g/L, or more.

[0614] The iRNA treatments described herein can further be used to treat individuals having elevated iron levels, as may be indicated by elevated transferrin levels in serum, e.g., transferrin levels measuring greater than 400 mg/dL, greater than 500 mg/L, greater than 1000 mg/dL, or more.

[0615] The iRNA treatments described herein can also be used to treat individuals having moderately elevated iron levels, as may be indicated by moderately elevated transferrin saturation levels, e.g., saturation levels of 40%, 45%, or 50% or more. In addition, the treatment described herein may also be used to prevent elevated iron levels in individuals with only minor elevations in transferrin saturation. One of skill in the art can easily monitor the transferrin saturation levels in subjects receiving treatment with iRNA as described herein and assay for a reduction in transferrin saturation levels of at least 5% or 10%.

[0616] The iRNA treatments described herein can be used to treat individuals having elevated iron levels, as may be indicated by a TIBC value greater than 400 .mu.g/dL, greater than 500 .mu.g/dL, or greater than 1000 .mu.g/dL, or more.

[0617] In some embodiments, individuals in need of treatment with an iRNA agent of the invention have decreased hematocrit levels, decreased hemoglobin levels, increased red blood cell distribution width, increased number of reticulocytes, decreased number of mature red blood cells, increased unsaturated iron binding capacity, decreased ineffective erythropoiesis, decreased extradedullary hematopoiesis, and/or decreased HAMP1 expression levels.

[0618] A patient can be further monitored by assay of blood sugar (glucose) level or a fetoprotein level, by echocardiogram (e.g, to examine the heart's function), electrocardiogram (ECG) (e.g., to look at the electrical activity of the heart), imaging tests (such as CT scans, MRI and ultrasound), and liver function tests. Excess iron staining or iron concentrations can be measured on liver biopsy samples, or to confirm the extent of liver damage, e.g, the stage of liver disease.

[0619] A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.

[0620] Alternatively, the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale.

[0621] As used herein, a "subject" includes a human or non-human animal, preferably a vertebrate, and more preferably a mammal. A subject may include a transgenic organism. Most preferably, the subject is a human, such as a human suffering from or predisposed to developing a TMPRSS6 associated disorder.

[0622] In some embodiments of the methods of the invention, TMPRSS6 expression is decreased for an extended duration, e.g., at least one week, two weeks, three weeks, or four weeks or longer. For example, in certain instances, expression of the TMPRSS6 gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% by administration of an iRNA agent described herein. In some embodiments, the TMPRSS6 gene is suppressed by at least about 60%, 70%, or 80% by administration of the iRNA agent. In some embodiments, the TMPRSS6 gene is suppressed by at least about 85%, 90%, or 95% by administration of the double-stranded oligonucleotide. In another embodiment, the TMPRSS6 gene remains suppressed for 7 days, 10 days, 20 days, 30 days, or more following administration.

[0623] The RNAi agents of the invention may be administered to a subject using any mode of administration known in the art, including, but not limited to subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof. In preferred embodiments, the agents are administered subcutaneously.

[0624] In some embodiments, the administration is via a depot injection. A depot injection may release the RNAi agent in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of TMPRSS6, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.

[0625] In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the RNAi agent to the liver.

[0626] Other modes of administration include epidural, intracerebral, intracerebroventricular, nasal administration, intraarterial, intracardiac, intraosseous infusion, intrathecal, and intravitreal, and pulmonary. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

[0627] The method includes administering an iRNA agent, e.g., a dose sufficient to depress levels of TMPRSS6 mRNA for at least 5, more preferably 7, 10, 14, 21, 25, 30 or 40 days; and optionally, administering a second single dose of dsRNA, wherein the second single dose is administered at least 5, more preferably 7, 10, 14, 21, 25, 30 or 40 days after the first single dose is administered, thereby inhibiting the expression of the TMPRSS6 gene in a subject.

[0628] In one embodiment, doses of iRNA agent of the invention are administered not more than once every four weeks, not more than once every three weeks, not more than once every two weeks, or not more than once every week. In another embodiment, the administrations can be maintained for one, two, three, or six months, or one year or longer. In another embodiment, doses of iRNA agent of the invention are administered once a week for three weeks.

[0629] In general, the iRNA agent does not activate the immune system, e.g., it does not increase cytokine levels, such as TNF-alpha or IFN-alpha levels. For example, when measured by an assay, such as an in vitro PBMC assay, such as described herein, the increase in levels of TNF-alpha or IFN-alpha, is less than 30%, 20%, or 10% of control cells treated with a control dsRNA, such as a dsRNA that does not target TMPRSS6.

[0630] For example, a subject can be administered a therapeutic amount of an iRNA agent, such as 0.3 mg/kg, 0.5 mg/kg, 1.0 mg/kg, 1.5 mg/kg, 2.0 mg/kg, 2.5 mg/kg, or 3 mg/kg of dsRNA.

[0631] The iRNA agent can be administered by intravenous infusion over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, or 25 minute period. The administration is repeated, for example, on a regular basis, such as biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration biweekly for three months, administration can be repeated once per month, for six months or a year or longer. Administration of the iRNA agent can reduce TMPRSS6 levels, e.g, in a cell, tissue, blood, urine or other compartment of the patient by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% or more.

[0632] Before administration of a full dose of the iRNA agent, patients can be administered a smaller dose, such as a dose resulting in less than 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction, or for elevated lipid levels or blood pressure. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.

[0633] Many disorders associated with elevated iron levels are hereditary. Therefore, a patient in need of a TMPRSS6 iRNA may be identified by taking a family history. A healthcare provider, such as a doctor, nurse, or family member, can take a family history before prescribing or administering a TMPRSS6 dsRNA. A DNA test may also be performed on the patient to identify a mutation in the TMPRSS6 gene, before a TMPRSS6 dsRNA is administered to the patient. For example, diagnosis of hereditary hemochromatosis can be confirmed by identifying the two HFE (Hemochromatosis) gene mutations C282Y and H63D, according to GenBank Accession No. CAB07442.1 (GF 1890180, record dated Oct. 23, 2008).

[0634] A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA agent of the invention or formulation of that iRNA agent can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.

[0635] In one embodiment, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, e.g., between about 0.25 mg/kg to about 0.5 mg/kg, between about 0.25 mg/kg to about 1 mg/kg, between about 0.25 mg/kg to about 5 mg/kg, between about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about 30 mg/kg, between about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg.

[0636] In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg, about 11 mg/kg, about 12 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, about 16 mg/kg, about 17 mg/kg, about 18 mg/kg, about 19 mg/kg, about 20 mg/kg, about 21 mg/kg, about 22 mg/kg, about 23 mg/kg, about 24 mg/kg, about 25 mg/kg, about 26 mg/kg, about 27 mg/kg, about 28 mg/kg, about 29 mg/kg, 30 mg/kg, about 31 mg/kg, about 32 mg/kg, about 33 mg/kg, about 34 mg/kg, about 35 mg/kg, about 36 mg/kg, about 37 mg/kg, about 38 mg/kg, about 39 mg/kg, about 40 mg/kg, about 41 mg/kg, about 42 mg/kg, about 43 mg/kg, about 44 mg/kg, about 45 mg/kg, about 46 mg/kg, about 47 mg/kg, about 48 mg/kg, about 49 mg/kg or about 50 mg/kg.

[0637] In certain embodiments, for example, when a composition of the invention comprises a dsRNA as described herein and a lipid, subjects can be administered a therapeutic amount of iRNA, such as about 0.01 mg/kg to about 5 mg/kg, about 0.01 mg/kg to about 10 mg/kg, about 0.05 mg/kg to about 5 mg/kg, about 0.05 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 5 mg/kg, about 0.1 mg/kg to about 10 mg/kg, about 0.2 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 10 mg/kg, about 0.3 mg/kg to about 5 mg/kg, about 0.3 mg/kg to about 10 mg/kg, about 0.4 mg/kg to about 5 mg/kg, about 0.4 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 5 mg/kg, about 0.5 mg/kg to about 10 mg/kg, about 1 mg/kg to about 5 mg/kg, about 1 mg/kg to about 10 mg/kg, about 1.5 mg/kg to about 5 mg/kg, about 1.5 mg/kg to about 10 mg/kg, about 2 mg/kg to about 2.5 mg/kg, about 2 mg/kg to about 10 mg/kg, about 3 mg/kg to about 5 mg/kg, about 3 mg/kg to about 10 mg/kg, about 3.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 5 mg/kg, about 4.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 10 mg/kg, about 4.5 mg/kg to about 10 mg/kg, about 5 mg/kg to about 10 mg/kg, about 5.5 mg/kg to about 10 mg/kg, about 6 mg/kg to about 10 mg/kg, about 6.5 mg/kg to about 10 mg/kg, about 7 mg/kg to about 10 mg/kg, about 7.5 mg/kg to about 10 mg/kg, about 8 mg/kg to about 10 mg/kg, about 8.5 mg/kg to about 10 mg/kg, about 9 mg/kg to about 10 mg/kg, or about 9.5 mg/kg to about 10 mg/kg.

[0638] Values and ranges intermediate to the recited values are also intended to be part of this invention. For example, the dsRNA may be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.

[0639] In certain embodiments of the invention, for example, when a double-stranded RNAi agent includes one or more modifications (e.g., motifs of three identical modifications on three consecutive nucleotides, including one such motif at or near the cleavage site of the agent), six phosphorothioate linkages, and a ligand, such an agent is administered at a dose of about 0.01 to about 0.5 mg/kg, about 0.01 to about 0.4 mg/kg, about 0.01 to about 0.3 mg/kg, about 0.01 to about 0.2 mg/kg, about 0.01 to about 0.1 mg/kg, about 0.01 mg/kg to about 0.09 mg/kg, about 0.01 mg/kg to about 0.08 mg/kg, about 0.01 mg/kg to about 0.07 mg/kg, about 0.01 mg/kg to about 0.06 mg/kg, about 0.01 mg/kg to about 0.05 mg/kg, about 0.02 to about 0.5 mg/kg, about 0.02 to about 0.4 mg/kg, about 0.02 to about 0.3 mg/kg, about 0.02 to about 0.2 mg/kg, about 0.02 to about 0.1 mg/kg, about 0.02 mg/kg to about 0.09 mg/kg, about 0.02 mg/kg to about 0.08 mg/kg, about 0.02 mg/kg to about 0.07 mg/kg, about 0.02 mg/kg to about 0.06 mg/kg, about 0.02 mg/kg to about 0.05 mg/kg, about 0.03 to about 0.5 mg/kg, about 0.03 to about 0.4 mg/kg, about 0.03 to about 0.3 mg/kg, about 0.03 to about 0.2 mg/kg, about 0.03 to about 0.1 mg/kg, about 0.03 mg/kg to about 0.09 mg/kg, about 0.03 mg/kg to about 0.08 mg/kg, about 0.03 mg/kg to about 0.07 mg/kg, about 0.03 mg/kg to about 0.06 mg/kg, about 0.03 mg/kg to about 0.05 mg/kg, about 0.04 to about 0.5 mg/kg, about 0.04 to about 0.4 mg/kg, about 0.04 to about 0.3 mg/kg, about 0.04 to about 0.2 mg/kg, about 0.04 to about 0.1 mg/kg, about 0.04 mg/kg to about 0.09 mg/kg, about 0.04 mg/kg to about 0.08 mg/kg, about 0.04 mg/kg to about 0.07 mg/kg, about 0.04 mg/kg to about 0.06 mg/kg, about 0.05 to about 0.5 mg/kg, about 0.05 to about 0.4 mg/kg, about 0.05 to about 0.3 mg/kg, about 0.05 to about 0.2 mg/kg, about 0.05 to about 0.1 mg/kg, about 0.05 mg/kg to about 0.09 mg/kg, about 0.05 mg/kg to about 0.08 mg/kg, or about 0.05 mg/kg to about 0.07 mg/kg. Values and ranges intermediate to the foregoing recited values are also intended to be part of this invention, e.g., the RNAi agent may be administered to the subject at a dose of about 0.015 mg/kg to about 0.45 mg/mg.

[0640] For example, the RNAi agent, e.g, RNAi agent in a pharmaceutical composition, may be administered at a dose of about 0.01 mg/kg, 0.0125 mg/kg, 0.015 mg/kg, 0.0175 mg/kg, 0.02 mg/kg, 0.0225 mg/kg, 0.025 mg/kg, 0.0275 mg/kg, 0.03 mg/kg, 0.0325 mg/kg, 0.035 mg/kg, 0.0375 mg/kg, 0.04 mg/kg, 0.0425 mg/kg, 0.045 mg/kg, 0.0475 mg/kg, 0.05 mg/kg, 0.0525 mg/kg, 0.055 mg/kg, 0.0575 mg/kg, 0.06 mg/kg, 0.0625 mg/kg, 0.065 mg/kg, 0.0675 mg/kg, 0.07 mg/kg, 0.0725 mg/kg, 0.075 mg/kg, 0.0775 mg/kg, 0.08 mg/kg, 0.0825 mg/kg, 0.085 mg/kg, 0.0875 mg/kg, 0.09 mg/kg, 0.0925 mg/kg, 0.095 mg/kg, 0.0975 mg/kg, 0.1 mg/kg, 0.125 mg/kg, 0.15 mg/kg, 0.175 mg/kg, 0.2 mg/kg, 0.225 mg/kg, 0.25 mg/kg, 0.275 mg/kg, 0.3 mg/kg, 0.325 mg/kg, 0.35 mg/kg, 0.375 mg/kg, 0.4 mg/kg, 0.425 mg/kg, 0.45 mg/kg, 0.475 mg/kg, or about 0.5 mg/kg. Values intermediate to the foregoing recited values are also intended to be part of this invention.

[0641] The dose of an RNAi agent that is administered to a subject may be tailored to balance the risks and benefits of a particular dose, for example, to achieve a desired level of TMPRSS6 gene suppression (as assessed, e.g., based on TMPRSS6 mRNA suppression, TMPRSS6 protein expression, or a reduction in lipid levels) or a desired therapeutic or prophylactic effect, while at the same time avoiding undesirable side effects.

[0642] In some embodiments, the RNAi agent is administered in two or more doses. If desired to facilitate repeated or frequent infusions, implantation of a delivery device, e.g, a pump, semi-permanent stent (e.g, intravenous, intraperitoneal, intracisternal or intracapsular), or reservoir may be advisable. In some embodiments, the number or amount of subsequent doses is dependent on the achievement of a desired effect, e.g., the suppression of a TMPRSS6 gene, or the achievement of a therapeutic or prophylactic effect, e.g., reducing iron overload. In some embodiments, the RNAi agent is administered according to a schedule. For example, the RNAi agent may be administered once per week, twice per week, three times per week, four times per week, or five times per week. In some embodiments, the schedule involves regularly spaced administrations, e.g, hourly, every four hours, every six hours, every eight hours, every twelve hours, daily, every 2 days, every 3 days, every 4 days, every 5 days, weekly, biweekly, or monthly. In other embodiments, the schedule involves closely spaced administrations followed by a longer period of time during which the agent is not administered. For example, the schedule may involve an initial set of doses that are administered in a relatively short period of time (e.g, about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours) followed by a longer time period (e.g, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the RNAi agent is not administered. In one embodiment, the RNAi agent is initially administered hourly and is later administered at a longer interval (e.g, daily, weekly, biweekly, or monthly). In another embodiment, the RNAi agent is initially administered daily and is later administered at a longer interval (e.g, weekly, biweekly, or monthly). In certain embodiments, the longer interval increases over time or is determined based on the achievement of a desired effect. In a specific embodiment, the RNAi agent is administered once daily during a first week, followed by weekly dosing starting on the eighth day of administration. In another specific embodiment, the RNAi agent is administered every other day during a first week followed by weekly dosing starting on the eighth day of administration.

[0643] In some embodiments, the RNAi agent is administered in a dosing regimen that includes a "loading phase" of closely spaced administrations that may be followed by a "maintenance phase", in which the RNAi agent is administered at longer spaced intervals. In one embodiment, the loading phase comprises five daily administrations of the RNAi agent during the first week.

[0644] In another embodiment, the maintenance phase comprises one or two weekly administrations of the RNAi agent. In a further embodiment, the maintenance phase lasts for 5 weeks.

[0645] Any of these schedules may optionally be repeated for one or more iterations. The number of iterations may depend on the achievement of a desired effect, e.g, the suppression of a TMPRSS6 gene, and/or the achievement of a therapeutic or prophylactic effect, e.g, reducing iron levels or reducing a symptom of thalassemia, e.g, .beta.-thalassemia, or hemotochromatosis.

[0646] In another aspect, the invention features, a method of instructing an end user, e.g., a caregiver or a subject, on how to administer an iRNA agent described herein. The method includes, optionally, providing the end user with one or more doses of the iRNA agent, and instructing the end user to administer the iRNA agent on a regimen described herein, thereby instructing the end user.

VII. Kits

[0647] The present invention also provides kits for using any of the iRNA agents and/or performing any of the methods of the invention. Such kits include one or more RNAi agent(s) and instructions for use, e.g., instructions for inhibiting expression of a TMPRSS6 in a cell by contacting the cell with the RNAi agent(s) in an amount effective to inhibit expression of the TMPRSS6. The kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g., an injection device), or means for measuring the inhibition of TMPRSS6 (e.g, means for measuring the inhibition of TMPRSS6 mRNA or TTR protein). Such means for measuring the inhibition of TMPRSS6 may comprise a means for obtaining a sample from a subject, such as, e.g, a plasma sample. The kits of the invention may optionally further comprise means for administering the RNAi agent(s) to a subject or means for determining the therapeutically effective or prophylactically effective amount.

[0648] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

EXAMPLES

Materials and Methods

[0649] The following materials and methods were used in the Examples.

cDNA Synthesis Using ABI High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, Calif., Cat #4368813)

[0650] A master mix of 2 .mu.l 10.times. Buffer, 0.8 .mu.l 25.times. dNTPs, 2 .mu.l Random primers, 1 .mu.l Reverse Transcriptase, 1 .mu.l RNase inhibitor and 3.2 .mu.l of H.sub.2O per reaction was added into 10 .mu.l total RNA. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, Calif.) through the following steps: 25.degree. C. 10 min, 37.degree. C. 120 min, 85.degree. C. 5 sec, 4.degree. C. hold.

Cell Culture and Transfections

[0651] Hep3B cells (ATCC, Manassas, Va.) were grown to near confluence at 37.degree. C. in an atmosphere of 5% CO2 in EMEM (ATCC) supplemented with 10% FBS, streptomycin, and glutamine (ATCC) before being released from the plate by trypsinization. Transfection was carried out by adding 14.8 .mu.l of Opti-MEM plus 0.2 .mu.l of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5 .mu.l of siRNA duplexes per well into a 96-well plate and incubated at room temperature for 15 minutes. Subsequently, 80 .mu.l of complete growth media without antibiotic containing .about.2.times.10.sup.4 Hep3B cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 10 nM and 0.1 nM final duplex concentration.

Total RNA Isolation Using DYNABEADS mRNA Isolation Kit (Invitrogen, Part #; 610-12)

[0652] Cells were harvested and lysed in 150 .mu.l of Lysis/Binding Buffer then mixed for 5 minute at 850 rpm using a platform shaker (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 .mu.l Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supernatant was removed without disturbing the beads. After the supernatant was removed, the lysed cells were added to the remaining beads and mixed for 5 minutes. After the supernatant was removed, magnetic beads were washed 2 times with 150 .mu.l Wash Buffer A and mixed for 1 minute. Beads were capture again and supernatant removed. Beads were then washed with 150 .mu.l Wash Buffer B, captured and supernatant was removed. Beads were next washed with 150 .mu.l Elution Buffer, captured and supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50 .mu.l of Elution Buffer was added and mixed for 5 minutes at 75.degree. C. Beads were captured on magnet for 5 minutes, and 50 .mu.l of supernatant containing the purified RNA was removed and added to a new 96 well plate.

Real Time PCR

[0653] Two .mu.l of cDNA was added to a master mix containing 0.5 .mu.l human GAPDH TaqMan Probe (Applied Biosystems Cat #4326317E), 0.5 .mu.l human TMPRSS6 TaqMan probe (Applied Biosystems cat #Hs00542184_m1) and 5 .mu.l Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plate (Roche cat #04887301001). Real time PCR was performed in a Roche LC480 Real Time PCR system (Roche) using the .DELTA..DELTA.Ct(RQ) assay. Each duplex was tested in two independent transfections and each transfection was assayed in duplicate, unless otherwise noted.

[0654] To calculate relative fold change, real time data were analyzed using the .DELTA..DELTA.Ct method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells.

[0655] The sense and antisense sequences of AD-1955 are:

TABLE-US-00002 (SEQ ID NO: 15) SENSE 5'-cuuAcGcuGAGuAcuucGAdTsdT-3'; and (SEQ ID NO: 16) ANTISENSE: 5'-UCGAAGuACUcAGCGuAAGdTsdT-3'.

TABLE-US-00003 TABLE B Abbreviations of nucleotide monomers used in nucleic acid sequence representation. Abbreviation Nucleotide(s) A Adenosine-3'-phosphate Ab beta-L-adenosine-3'-phosphate Af 2'-fluoroadenosine-3'-phosphate Afs 2'-fluoroadenosine-3'-phosphorothioate As adenosine-3'-phosphorothioate C cytidine-3'-phosphate Cb beta-L-cytidine-3'-phosphate Cf 2'-fluorocytidine-3'-phosphate Cfs 2'-fluorocytidine-3'-phosphorothioate Cs cytidine-3'-phosphorothioate G guanosine-3'-phosphate Gb beta-L-guanosine-3'-phosphate Gbs beta-L-guanosine-3'-phosphorothioate Gf 2'-fluoroguanosine-3'-phosphate Gfs 2'-fluoroguanosine-3'-phosphorothioate Gs guanosine-3'-phosphorothioate T 5'-methyluridine-3'-phosphate Tf 2'-fluoro-5-methyluridine-3'-phosphate Tfs 2'-fluoro-5-methyluridine-3'-phosphorothioate Ts 5-methyluridine-3'-phosphorothioate U Uridine-3'-phosphate Uf 2'-fluorouridine-3'-phosphate Ufs 2'-fluorouridine-3'-phosphorothioate Us uridine-3'-phosphorothioate N any nucleotide (G, A, C, T or U) a 2'-O-methyladenosine-3'-phosphate as 2'-O-methyladenosine-3'-phosphorothioate c 2'-O-methylcytidine-3'-phosphate cs 2'-O-methylcytidine-3'-phosphorothioate g 2'-O-methylguanosine-3'-phosphate gs 2'-O-methylguanosine-3'-phosphorothioate t 2'-O-methyl-5-methyluridine-3'-phosphate ts 2'-O-methyl-5-methyluridine-3'-phosphorothioate u 2'-O-methyluridine-3'-phosphate us 2'-O-methyluridine-3'-phosphorothioate dT 2'-deoxythymidine dTs 2'-deoxythymidine-3'-phosphorothioate dU 2'-deoxyuridine s phosphorothioate linkage L96 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp-(GalNAc-alkyl)3 (Aeo) 2'-O-methoxyethyladenosine-3'-phosphate (Aeos) 2'-O-methoxyethyladenosine-3'-phosphorothioate (Geo) 2'-O-methoxyethylguanosine-3'-phosphate (Geos) 2'-O-methoxyethylguanosine-3'-phosphorothioate (Teo) 2'-O-methoxyethyl-5-methyluridine-3'-phosphate (Teos) 2'-O-methoxyethyl-5-methyluridine-3'-phosphorothioate (m5Ceo) 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate (m5Ceos) 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate (A3m) 3'-O-methyladenosine-2'-phosphate (A3mx) 3'-O-methyl-xylofuranosyladenosine-2'-phosphate (G3m) 3'-O-methylguanosine-2'-phosphate (G3mx) 3'-O-methyl-xylofuranosylguanosine-2'-phosphate (C3m) 3'-O-methylcytidine-2'-phosphate (C3mx) 3'-O-methyl-xylofuranosylcytidine-2'-phosphate (U3m) 3'-O-methyluridine-2'-phosphate (U3mx) 3'-O-methylxylouridine-2'-phosphate (Chd) 2'-O-hexadecyl-cytidine-3'-phosphate (pshe) Hydroxyethylphosphorothioate (Uhd) 2'-O-hexadecyl-uridine-3'-phosphate (Tgn) Thymidine-glycol nucleic acid (GNA) S-Isomer (Cgn) Cytidine-glycol nucleic acid (GNA) (Chd) 2'-O-hexadecyl-cytidine-3'-phosphate (Ggn) 2'-O-hexadecyl-cytidine-3'-phosphate (Agn) Adenosine-glycol nucleic acid (GNA) P 5'-phosphate (m5Cam) 2'-O-(N-methylacetamide)-5-methylcytidine-3'-phosphate (m5Cams) 2'-O-(N-methylacetamide)-5-methylcytidine-3'- phosphorothioate (Tam) 2'-O-(N-methylacetamide)thymidine-3'-phosphate (Tams) 2'-O-(N-methylacetamide)thymidine-3'-phosphorothioate (Aam) 2'-O-(N-methylacetamide)adenosine-3'-phosphate (Aams) 2'-O-(N-methylacetamide)adenosine-3'-phosphorothioate (Gam) 2'-O-(N-methylacetamide)guanosine-3'-phosphate (Gams) 2'-O-(N-methylacetamide)guanosine-3'-phosphorothioate Y44 2-hydroxymethyl-tetrahydrofurane-5-phosphate

Example 1. Design, Specificity and Efficacy Prediction of Oligonucleotides

Transcripts

[0656] siRNA design was carried out to identify siRNAs targeting human, rhesus (Macaca mulatta), mouse, and rat TMPRSS6 transcripts annotated in the NCBI Gene database (http://www.ncbi.nlm.nih.gov/gene/). Design used the following transcripts from the NCBI RefSeq collection: Human--NM_153609.2; Rhesus--XM_001085203.2 and XM_001085319.1; Mouse--NM_027902.2; Rat--NM_001130556.1. Due to high primate/rodent sequence divergence, siRNA duplexes were designed in several separate batches, including but not limited to batches containing duplexes matching human and rhesus transcripts only; human, rhesus, and mouse transcripts only; human, rhesus, mouse, and rat transcripts only; and mouse and rat transcripts only. All siRNA duplexes were designed that shared 100% identity with the listed human transcript and other species transcripts considered in each design batch (above).

[0657] The specificity of all possible 19mers was predicted from each sequence. Candidate 19mers that lacked repeats longer than 7 nucleotides were then selected. These 1259 candidate human/rhesus, 91 human/rhesus/mouse, 37 human/rhesus/mouse/rat, and 810 mouse/rat siRNAs were used in comprehensive searches against the appropriate transcriptomes (defined as the set of NM_ and XM_records within the human, rhesus, mouse, or rat NCBI Refseq sets) using an exhaustive "brute-force" algorithm implemented in the python script `BruteForce.py`. The script next parsed the transcript-oligo alignments to generate a score based on the position and number of mismatches between the siRNA and any potential `off-target` transcript. The off-target score is weighted to emphasize differences in the `seed` region of siRNAs, in positions 2-9 from the 5' end of the molecule. Each oligo-transcript pair from the brute-force search was given a mismatch score by summing the individual mismatch scores; mismatches in the position 2-9 were counted as 2.8, mismatches in the cleavage site positions 10-11 were counted as 1.2, and mismatches in region 12-19 counted as 1.0. An additional off-target prediction was carried out by comparing the frequency of heptamers and octomers derived from 3 distinct, seed-derived hexamers of each oligo. The hexamers from positions 2-7 relative to the 5' start were used to create 2 heptamers and one octomer. Heptamerl was created by adding a 3' A to the hexamer; heptamer2 was created by adding a 5' A to the hexamer; the octomer was created by adding an A to both 5' and 3' ends of the hexamer. The frequency of octomers and heptamers in the human, rhesus, mouse, or rat 3'UTRome (defined as the subsequence of the transcriptome from NCBI's Refseq database where the end of the coding region, the `CDS`, is clearly defined) was pre-calculated. The octomer frequency was normalized to the heptamer frequency using the median value from the range of octomer frequencies. A `mirSeedScore` was then calculated by calculating the sum of ((3.times. normalized octomer count)+(2.times.heptamer2 count)+(1.times.heptamer1 count)).

[0658] Both siRNA strands were assigned to a category of specificity according to the calculated scores: a score above 3 qualified as highly specific, equal to 3 as specific and between 2.2 and 2.8 qualified as moderately specific. The siRNAs were sorted by the specificity of the antisense strand. Duplexes from the human/rhesus and mouse/rat sets whose antisense oligos lacked GC at the first position, lacked G at both positions 13 and 14, and had 3 or more Us or As in the seed region (characteristics of duplexes with high predicted efficacy) were then selected. Similarly, duplexes from the human/rhesus/mouse and human/rhesus/mouse/rat sets that had had 3 or more Us or As in the seed region were selected.

[0659] Candidate GalNAc-conjugated duplexes, 21 and 23 nucleotides long on the sense and antisense strands respectively, were designed by extending antisense 19mers 4 additional nucleotides in the 3' direction (preserving perfect complementarity with the target transcript). The sense strand was specified as the reverse complement of the first 21 nucleotides of the antisense 23mer. Duplexes were selected that maintained perfect matches to all selected species transcripts across all 23 nucleotides.

siRNA Sequence Selection

[0660] A total of 39 sense and 39 antisense derived human/rhesus, 6 sense and 6 antisense derived human/rhesus/mouse, 3 sense and 3 antisense derived human/rhesus/mouse/rat, and 16 sense and 16 antisense derived mouse/rat siRNA 21/23mer oligos were synthesized and formed into GalNAc-conjugated duplexes.

[0661] The sequences of the sense and antisense strands of the modified duplexes are shown in Table 1, and the sequences of the sense and antisense strands of the unmodified duplexes are shown in Table 2.

TABLE-US-00004 TABLE 1 TMPRSS6 modified sequences Sense SEQ SEQ Duplex sequence ID Antisense ID ID ID Sense sequence NO: sequence Antisense sequence NO: AD- A-119159.1 UfsgsGfcCfuGfgAfGfA 17 A-119160.1 usUfsgAfaGfgAfcAfcc 65 58686.1 fgGfuGfuCfcUfuCfL96 uCfuCfcAfgGfcsCfsa AD- A-119175.1 GfsgsGfgUfgCfuAfCfU 18 A-119176.1 asGfsgAfaAfuAfcCfag 66 58687.1 fcUfgGfuAfuUfuCfL96 aGfuAfgCfaCfcsCfsc AD- A-119191.1 CfsasAfcGfgCfcUfGfG 19 A-119192.1 asGfsuUfuCfuCfuCfau 67 58688.1 faUfgAfgAfgAfaAfL96 cCfaGfgCfcGfusUfsg AD- A-119207.1 AfsusCfgCfcAfcUfUfC 20 A-119208.1 asAfsgAfuCfcUfgGfga 68 58689.1 fuCfcCfaGfgAfuCfL96 gAfaGfuGfgCfgsAfsu AD- A-119223.1 GfsgsUfgGfcAfgGfAfG 21 A-119224.1 asCfsaAfgAfuGfcCfac 69 58690.1 fgUfgGfcAfuCfuUfL96 cUfcCfuGfcCfasCfsc AD- A-119161.1 GfsasCfcGfaCfuGfGfC 22 A-119162.1 asCfsgUfcAfuAfcAfug 70 58692.1 fcAfuGfuAfuGfaCfL96 gCfcAfgUfcGfgsUfsc AD- A-119177.1 GfsgsUfgUfgCfgGfGfU 23 A-119178.1 asAfsgCfcAfuAfgUfgc 71 58693.1 fgCfaCfuAfuGfgCfL96 aCfcCfgCfaCfasCfsc AD- A-119193.1 GfsgsCfcUfgGfaUfGfA 24 A-119194.1 asCfsgCfaGfuUfuCfuc 72 58694.1 fgAfgAfaAfcUfgCfL96 uCfaUfcCfaGfgsCfsc AD- A-119209.1 CfsusCfuGfgUfaUfUfU 25 A-119210.1 usUfsgUfaCfcCfuAfgg 73 58695.1 fcCfuAfgGfgUfaCfL96 aAfaUfaCfcAfgsAfsg AD- A-119225.1 GfscsCfcCfuGfgUfCfU 26 A-119226.1 asGfsaUfcCfcAfaGfuu 74 58696.1 faAfcUfuGfgGfaUfL96 aGfaCfcAfgGfgsGfsc AD- A-119163.1 GfsasGfgCfaGfaAfGfU 27 A-119164.1 asCfsgGfcAfaAfuCfau 75 58698.1 faUfgAfuUfuGfcCfL96 aCfuUfcUfgCfcsUfsc AD- A-119179.1 AfsasGfcCfaGfuGfUfG 28 A-119180.1 asGfscUfaUfgUfcUfuu 76 58699.1 faAfaGfaCfaUfaGfL96 cAfcAfcUfgGfcsUfsu AD- A-119195.1 GfscsCfgGfgAfcCfGfA 29 A-119196.1 asUfsaCfaUfgGfcCfag 77 58700.1 fcUfgGfcCfaUfgUfL96 uCfgGfuCfcCfgsGfsc AD- A-119211.1 CfsusCfcAfgGfuUfCfG 30 A-119212.1 asUfsgUfgUfcGfaCfcc 78 58701.1 fgGfgUfcGfaCfaCfL96 cGfaAfcCfuGfgsAfsg AD- A-119227.1 AfsgsCfcCfcUfgGfUfC 31 A-119228.1 gsAfsuCfcCfaAfgUfua 79 58702.1 fuAfaCfuUfgGfgAfL96 gAfcCfaGfgGfgsCfsu AD- A-119165.1 UfscsGfcCfaCfuUfCfU 32 A-119166.1 usAfsaGfaUfcCfuGfgg 80 58704.1 fcCfcAfgGfaUfcUfL96 aGfaAfgUfgGfcsGfsa AD- A-119181.1 AfscsUfcUfgGfuAfUfU 33 A-119182.1 usGfsuAfcCfcUfaGfga 81 58705.1 fuCfcUfaGfgGfuAfL96 aAfuAfcCfaGfasGfsu AD- A-119197.1 UfscsGfcUfgAfcCfGfC 34 A-119198.1 usGfsuUfaUfcAfcCfca 82 58706.1 fuGfgGfuGfaUfaAfL96 gCfgGfuCfaGfcsGfsa AD- A-119213.1 GfscsCfcCfaAfcGfGfC 35 A-119214.1 usCfsuCfuCfaUfcCfag 83 58707.1 fcUfgGfaUfgAfgAfL96 gCfcGfuUfgGfgsGfsc AD- A-119229.1 GfscsCfaAfgCfaGfGfG 36 A-119230.1 gsAfsaUfaCfuUfgUfcc 84 58708.1 fgGfaCfaAfgUfaUfL96 cCfcUfgCfuUfgsGfsc AD- A-119167.1 UfscsCfcCfuAfcAfGfG 37 A-119168.1 usUfscGfuAfcUfcGfgc 85 58710.1 fgCfcGfaGfuAfcGfL96 cCfuGfuAfgGfgsGfsa AD- A-119183.1 CfsusGfgGfuUfgUfUfA 38 A-119184.1 usAfsgCfuGfuAfgCfgg 86 58711.1 fcCfgCfuAfcAfgCfL96 uAfaCfaAfcCfcsAfsg AD- A-119199.1 CfsusGfgCfcUfgGfAfG 39 A-119200.1 usGfsaAfgGfaCfaCfcu 87 58712.1 faGfgUfgUfcCfuUfL96 cUfcCfaGfgCfcsAfsg AD- A-119215.1 GfsusGfcGfgGfuGfCfA 40 A-119216.1 usAfscAfaGfcCfaUfag 88 58713.1 fcUfaUfgGfcUfuGfL96 uGfcAfcCfcGfcsAfsc AD- A-119231.1 UfsgsGfcAfgGfaGfGfU 41 A-119232.1 asGfsaCfaAfgAfuGfcc 89 58714.1 fgGfcAfuCfuUfgUfL96 aCfcUfcCfuGfcsCfsa AD- A-119169.1 CfscsCfuAfcAfgGfGfC 42 A-119170.1 asCfsuUfcGfuAfcUfcg 90 58716.1 fcGfaGfuAfcGfaAfL96 gCfcCfuGfuAfgsGfsg AD- A-119185.1 AfscsCfuGfcUfuCfUfU 43 A-119186.1 asGfsaAfuGfaAfcCfag 91 58717.1 fcUfgGfuUfcAfuUfL96 aAfgAfaGfcAfgsGfsu AD- A-119201.1 UfsgsCfcUfgUfgAfUfG 44 A-119202.1 asGfsuCfcUfuGfaCfcc 92 58718.1 fgGfgUfcAfaGfgAfL96 cAfuCfaCfaGfgsCfsa AD- A-119217.1 CfsasGfcUfuCfgGfAfA 45 A-119218.1 usAfsgAfcCfaGfgGfgc 93 58719.1 fgCfcCfcUfgGfuCfL96 uUfcCfgAfaGfcsUfsg AD- A-119233.1 CfscsCfcUfgGfuCfUfA 46 A-119234.1 csAfsgAfuCfcCfaAfgu 94 58720.1 faCfuUfgGfgAfuCfL96 uAfgAfcCfaGfgsGfsg AD- A-119171.1 UfsgsCfuUfcUfuCfUfG 47 A-119172.1 usGfsgAfgAfaUfgAfac 95 58721.1 fgUfuCfaUfuCfuCfL96 cAfgAfaGfaAfgsCfsa AD- A-119187.1 CfscsCfaAfcGfgCfCfU 48 A-119188.1 usUfsuCfuCfuCfaUfcc 96 58722.1 fgGfaUfgAfgAfgAfL96 aGfgCfcGfuUfgsGfsg AD- A-119203.1 AfsasGfgGfcCfuGfCfA 49 A-119204.1 usCfsgUfaGfuAfgCfug 97 58723.1 fcAfgCfuAfcUfaCfL96 uGfcAfgGfcCfcsUfsu AD- A-119219.1 GfsusCfuAfaCfuUfGfG 50 A-119220.1 csAfsuUfcCfcAfgAfuc 98 58724.1 fgAfuCfuGfgGfaAfL96 cCfaAfgUfuAfgsAfsc AD- A-119235.1 AfsgsCfuUfcGfgAfAfG 51 A-119236.1 usUfsaGfaCfcAfgGfgg 99 58725.1 fcCfcCfuGfgUfcUfL96 cUfuCfcGfaAfgsCfsu AD- A-119173.1 CfscsAfgUfgUfgAfAfA 52 A-119174.1 usGfscAfgCfuAfuGfuc 100 58726.1 fgAfcAfuAfgCfuGfL96 uUfuCfaCfaCfusGfsg AD- A-119189.1 CfscsAfgGfuUfcGfGfG 53 A-119190.1 asGfsaUfgUfgUfcGfac 101 58727.1 fgUfcGfaCfaCfaUfL96 cCfcGfaAfcCfusGfsg AD- A-119205.1 UfscsCfaCfgCfuGfGfG 54 A-119206.1 usAfsgCfgGfuAfaCfaa 102 58728.1 fuUfgUfuAfcCfgCfL96 cCfcAfgCfgUfgsGfsa AD- A-119221.1 UfsgsCfcAfaGfcAfGfG 55 A-119222.1 asAfsuAfcUfuGfuCfcc 103 58729.1 fgGfgAfcAfaGfuAfL96 cCfuGfcUfuGfgsCfsa AD- A-119241.1 AfsusCfcAfgAfaCfAfG 56 A-119242.1 csCfsaCfaCfaGfcCfuc 104 58697.1 fgAfgGfcUfgUfgUfL96 cUfgUfuCfuGfgsAfsu AD- A-119243.1 UfsusCfaCfcUfcCfCfA 57 A-119244.1 gsUfsgAfgGfgAfgAfuc 105 58703.1 fgAfuCfuCfcCfuCfL96 uGfgGfaGfgUfgsAfsa AD- A-119245.1 CfscsUfcCfgAfgGfGfU 58 A-119246.1 csCfsaUfgGfcCfaCfuc 106 58709.1 fgAfgUfgGfcCfaUfL96 aCfcCfuCfgGfasGfsg AD- A-119247.1 UfscsCfaGfaAfcAfGfG 59 A-119248.1 gsCfscAfcAfcAfgCfcu 107 58715.1 faGfgCfuGfuGfuGfL96 cCfuGfuUfcUfgsGfsa AD- A-119237.1 GfsusGfuCfcUfcCfGfA 60 A-119238.1 gsGfscCfaCfuCfaCfcc 108 58730.1 fgGfgUfgAfgUfgGfL96 uCfgGfaGfgAfcsAfsc AD- A-119249.1 UfsusCfgGfgGfuCfGfA 61 A-119250.1 csCfscAfcAfgAfuGfug 109 58731.1 fcAfcAfuCfuGfuGfL96 uCfgAfcCfcCfgsAfsa AD- A-119251.1 UfscsGfgGfgUfcGfAfC 62 A-119252.1 csCfscCfaCfaGfaUfgu 110 58734.1 faCfaUfcUfgUfgGfL96 gUfcGfaCfcCfcsGfsa AD- A-119253.1 UfsgsCfuUfcCfaGfGfA 63 A-119254.1 gsCfscAfuGfcUfgUfcc 111 58737.1 fgGfaCfaGfcAfuGfL96 uCfcUfgGfaAfgsCfsa AD- A-120243.1 UfscsUfgGfuAfuUfUfC 64 A-120244.1 usGfsuAfcCfcUfaGfga 112 59743.1 fcUfaGfgGfuAfcAfL96 aAfuAfcCfaGfasgsu

TABLE-US-00005 TABLE 2 TMPRSS6 unmodified sequences Sense SEQ Position Anti- SEQ Position Duplex sequence Sense ID in NM_ sense ID in NM_ ID ID sequence NO: 153609.2 sequence Antisense sequence NO: 153609.2 AD- A- UGGCCUGGAGA 113 2041-2063 A- UUGAAGGACACCUCUCCAGGCCA 161 2041-2063 58686.1 119159.1 GGUGUCCUUC 119160.1 AD- A- GGGGUGCUACU 114 319-341 A- AGGAAAUACCAGAGUAGCACCCC 162 319-341 58687.1 119175.1 CUGGUAUUUC 119176.1 AD- A- CAACGGCCUGG 115 1557-1579 A- AGUUUCUCUCAUCCAGGCCGUUG 163 1557-1579 58688.1 119191.1 AUGAGAGAAA 119192.1 AD- A- AUCGCCACUUC 116 401-423 A- AAGAUCCUGGGAGAAGUGGCGAU 164 401-423 58689.1 119207.1 UCCCAGGAUC 119208.1 AD- A- GGUGGCAGGAG 117 2665-2688 A- ACAAGAUGCCACCUCCUGCCACC 165 2665-2688 58690.1 119223.1 GUGGCAUCUU 119224.1 AD- A- GACCGACUGGC 118 922-944 A- ACGUCAUACAUGGCCAGUCGGUC 166 922-944 58692.1 119161.1 CAUGUAUGAC 119162.1 AD- A- GGUGUGCGGGU 119 1444-1466 A- AAGCCAUAGUGCACCCGCACACC 167 1444-1466 58693.1 119177.1 GCACUAUGGC 119178.1 AD- A- GGCCUGGAUGA 120 1561-1583 A- ACGCAGUUUCUCUCAUCCAGGCC 168 1561-1583 58694.1 119193.1 GAGAAACUGC 119194.1 AD- A- CUCUGGUAUUU 121 328-350 A- UUGUACCCUAGGAAAUACCAGAG 169 328-350 58695.1 119209.1 CCUAGGGUAC 119210.1 AD- A- GCCCCUGGUCU 122 2966-2989 A- AGAUCCCAAGUUAGACCAGGGGC 170 2966-2989 58696.1 119225.1 AACUUGGGAU 119226.1 AD- A- GAGGCAGAAGU 123 1281-1303 A- ACGGCAAAUCAUACUUCUGCCUC 171 1281-1303 58698.1 119163.1 AUGAUUUGCC 119164.1 AD- A- AAGCCAGUGUG 124 731-753 A- AGCUAUGUCUUUCACACUGGCUU 172 731-753 58699.1 119179.1 AAAGACAUAG 119180.1 AD- A- GCCGGGACCGA 125 917-939 A- AUACAUGGCCAGUCGGUCCCGGC 173 917-939 58700.1 119195.1 CUGGCCAUGU 119196.1 AD- A- CUCCAGGUUCG 126 1894-1916 A- AUGUGUCGACCCCGAACCUGGAG 174 1894-1916 58701.1 119211.1 GGGUCGACAC 119212.1 AD- A- AGCCCCUGGUC 127 2965-2988 A- GAUCCCAAGUUAGACCAGGGGCU 175 2965-2988 58702.1 119227.1 UAACUUGGGA 119228.1 AD- A- UCGCCACUUCU 128 402-424 A- UAAGAUCCUGGGAGAAGUGGCGA 176 402-424 58704.1 119165.1 CCCAGGAUCU 119166.1 AD- A- ACUCUGGUAUU 129 327-349 A- UGUACCCUAGGAAAUACCAGAGU 177 327-349 58705.1 119181.1 UCCUAGGGUA 119182.1 AD- A- UCGCUGACCGC 130 1934-1956 A- UGUUAUCACCCAGCGGUCAGCGA 178 1934-1956 58706.1 119197.1 UGGGUGAUAA 119198.1 AD- A- GCCCCAACGGC 131 1553-1575 A- UCUCUCAUCCAGGCCGUUGGGGC 179 1553-1575 58707.1 119213.1 CUGGAUGAGA 119214.1 AD- A- GCCAAGCAGGG 132 2610-2633 A- GAAUACUUGUCCCCCUGCUUGGC 180 2610-2633 58708.1 119229.1 GGACAAGUAU 119230.1 AD- A- UCCCCUACAGG 133 680-702 A- UUCGUACUCGGCCCUGUAGGGGA 181 680-702 58710.1 119167.1 GCCGAGUACG 119168.1 AD- A- CUGGGUUGUUA 134 769-791 A- UAGCUGUAGCGGUAACAACCCAG 182 769-791 58711.1 119183.1 CCGCUACAGC 119184.1 AD- A- CUGGCCUGGAG 135 2040-2062 A- UGAAGGACACCUCUCCAGGCCAG 183 2040-2062 58712.1 119199.1 AGGUGUCCUU 119200.1 AD- A- GUGCGGGUGCA 136 1447-1469 A- UACAAGCCAUAGUGCACCCGCAC 184 1447-1469 58713.1 119215.1 CUAUGGCUUG 119216.1 AD- A- UGGCAGGAGGU 137 2667-2690 A- AGACAAGAUGCCACCUCCUGCCA 185 2667-2690 58714.1 119231.1 GGCAUCUUGU 119232.1 AD- A- CCCUACAGGGC 138 682-704 A- ACUUCGUACUCGGCCCUGUAGGG 186 682-704 58716.1 119169.1 CGAGUACGAA 119170.1 AD- A- ACCUGCUUCUU 139 559-581 A- AGAAUGAACCAGAAGAAGCAGGU 187 559-581 58717.1 119185.1 CUGGUUCAUU 119186.1 AD- A- UGCCUGUGAUG 140 1530-1552 A- AGUCCUUGACCCCAUCACAGGCA 188 1530-1552 58718.1 119201.1 GGGUCAAGGA 119202.1 AD- A- CAGCUUCGGAA 141 2955-2978 A- UAGACCAGGGGCUUCCGAAGCUG 189 2955-2978 58719.1 119217.1 GCCCCUGGUC 119218.1 AD- A- CCCCUGGUCUA 142 2967-2990 A- CAGAUCCCAAGUUAGACCAGGGG 190 2967-2990 58720.1 119233.1 ACUUGGGAUC 119234.1 AD- A- UGCUUCUUCUG 143 562-584 A- UGGAGAAUGAACCAGAAGAAGCA 191 562-584 58721.1 119171.1 GUUCAUUCUC 119172.1 AD- A- CCCAACGGCCU 144 1555-1577 A- UUUCUCUCAUCCAGGCCGUUGGG 192 1555-1577 58722.1 119187.1 GGAUGAGAGA 119188.1 AD- A- AAGGGCCUGCA 145 1054-1076 A- UCGUAGUAGCUGUGCAGGCCCUU 193 1054-1076 58723.1 119203.1 CAGCUACUAC 119204.1 AD- A- GUCUAACUUGG 146 2973-2996 A- CAUUCCCAGAUCCCAAGUUAGAC 194 2973-2996 58724.1 119219.1 GAUCUGGGAA 119220.1 AD- A- AGCUUCGGAAG 147 2956-2979 A- UUAGACCAGGGGCUUCCGAAGCU 195 2956-2979 58725.1 119235.1 CCCCUGGUCU 119236.1 AD- A- CCAGUGUGAAA 148 734-756 A- UGCAGCUAUGUCUUUCACACUGG 196 734-756 58726.1 119173.1 GACAUAGCUG 119174.1 AD- A- CCAGGUUCGGG 149 1896-1918 A- AGAUGUGUCGACCCCGAACCUGG 197 1896-1918 58727.1 119189.1 GUCGACACAU 119190.1 AD- A- UCCACGCUGGG 150 763-785 A- UAGCGGUAACAACCCAGCGUGGA 198 763-785 58728.1 119205.1 UUGUUACCGC 119206.1 AD- A- UGCCAAGCAGG 151 2609-2632 A- AAUACUUGUCCCCCUGCUUGGCA 199 2609-2632 58729.1 119221.1 GGGACAAGUA 119222.1 AD- A- AUCCAGAACAG 152 1324-1346 A- CCACACAGCCUCCUGUUCUGGAU 200 1324-1346 58697.1 119241.1 GAGGCUGUGU 119242.1 AD- A- UUCACCUCCCA 153 1414-1436 A- GUGAGGGAGAUCUGGGAGGUGAA 201 1414-1436 58703.1 119243.1 GAUCUCCCUC 119244.1 AD- A- CCUCCGAGGGU 154 1862-1884 A- CCAUGGCCACUCACCCUCGGAGG 202 1862-1884 58709.1 119245.1 GAGUGGCCAU 119246.1 AD- A- UCCAGAACAGG 155 1325-1347 A- GCCACACAGCCUCCUGUUCUGGA 203 1325-1347 58715.1 119247.1 AGGCUGUGUG 119248.1 AD- A- GUGUCCUCCGA 156 1858-1880 A- GGCCACUCACCCUCGGAGGACAC 204 1858-1880 58730.1 119237.1 GGGUGAGUGG 119238.1 AD- A- UUCGGGGUCGA 157 1901-1923 A- CCCACAGAUGUGUCGACCCCGAA 205 1901-1923 58731.1 119249.1 CACAUCUGUG 119250.1 AD- A- UCGGGGUCGAC 158 1902-1924 A- CCCCACAGAUGUGUCGACCCCGA 206 1902-1924 58734.1 119251.1 ACAUCUGUGG 119252.1 AD- A- UGCUUCCAGGA 159 1966-1988 A- GCCAUGCUGUCCUCCUGGAAGCA 207 1966-1988 58737.1 119253.1 GGACAGCAUG 119254.1 AD- A- UCUGGUAUUUC 160 A- UGUACCCUAGGAAAUACCAGAGU 208 59743.1 120243.1 CUAGGGUACA 120244.1

Example 2. In Vitro Single Dose Screen

[0662] The modified and conjugated TMPRSS6 siRNA duplexes were also evaluated for efficacy by transfection assays in human cell line Hep3B. TMPRSS6 siRNAs were transfected at two doses, 10 nM and 0.1 nM. The results of these assays are shown in Table 3 and the data are expressed as a fraction of the message remaining in cells transfected with siRNAs targeting TMPRSS6, relative to cells transfected with a negative control siRNA, AD-1955.+-.the standard deviation (SD).

TABLE-US-00006 TABLE 3 TMPRSS6 single dose screen. Duplex ID Avg 10 nM SD 10 nM Avg 0.1 nM SD 0.1 nM AD-58686.1 71.58 18.94 103.29 32.00 AD-58687.1 89.33 13.14 104.94 20.06 AD-58688.1 34.16 11.36 87.18 8.43 AD-58689.1 79.82 7.28 110.37 6.08 AD-58690.1 69.10 9.83 99.92 24.84 AD-58692.1 79.21 5.67 136.49 0.84 AD-58693.1 77.29 12.12 106.01 17.97 AD-58694.1 50.51 10.36 89.47 3.84 AD-58695.1 54.37 5.75 87.66 13.59 AD-58696.1 93.26 0.06 84.79 3.84 AD-58697.1 72.95 23.41 98.98 10.29 AD-58698.1 42.61 7.81 109.98 16.78 AD-58699.1 24.93 8.58 79.71 12.55 AD-58700.1 74.10 15.37 89.75 7.80 AD-58701.1 79.18 8.18 89.70 9.98 AD-58702.1 96.43 18.38 113.05 10.65 AD-58703.1 79.15 28.50 97.30 6.79 AD-58704.1 67.92 0.87 92.26 1.24 AD-58705.1 59.50 20.47 99.25 3.28 AD-58706.1 71.67 0.75 102.38 14.88 AD-58707.1 77.89 22.26 97.52 1.31 AD-58708.1 73.87 9.61 98.38 1.81 AD-58709.1 94.62 4.69 100.73 16.10 AD-58710.1 59.19 10.57 95.23 11.99 AD-58711.1 63.62 16.83 103.11 3.66 AD-58712.1 65.79 6.96 81.58 1.50 AD-58713.1 84.14 26.41 101.56 5.60 AD-58714.1 64.73 6.06 102.37 1.63 AD-58715.1 91.05 18.67 101.08 11.00 AD-58716.1 70.07 13.02 97.20 2.98 AD-58717.1 11.27 6.91 66.56 4.32 AD-58718.1 62.10 18.62 89.01 15.30 AD-58719.1 72.94 18.26 91.58 9.97 AD-58720.1 60.51 14.43 90.92 5.68 AD-58721.1 17.72 7.70 56.72 2.57 AD-58722.1 51.65 11.33 81.44 0.50 AD-58723.1 53.27 21.60 94.25 16.20 AD-58724.1 58.03 49.89 77.11 4.63 AD-58725.1 54.58 40.10 76.12 1.59 AD-58726.1 10.33 9.88 42.75 7.97 AD-58727.1 62.80 26.45 83.23 13.10 AD-58728.1 49.36 36.27 83.30 1.74 AD-58729.1 43.83 61.99 73.54 19.33 AD-58730.1 59.60 41.85 76.12 1.03 AD-58731.1 85.29 24.78 128.06 32.14 AD-58734.1 85.71 10.74 101.75 6.11 AD-58737.1 79.87 10.59 114.89 7.46

Example 3. In Vivo Single Dose Screen Using AD-59743

[0663] The ability of AD-59743 to suppress expression of TMPRSS6 protein was assessed by measuring levels of TMPRSS6 and hepcidin mRNA in the liver of wild-type C57BL/6 mice following administration of AD-59743. A single dose of 1, 3 or 10 mg/kg of AD-59743 was administered subcutaneously, and the mice were sacrificed on day 3 or day 7. Levels of TMPRSS6 and hepcidin mRNA in the liver were measured by qPCR using the methods described above. A control group received injections with PBS.

[0664] The levels of TMPRSS6 mRNA following administration of AD-59743 are shown in FIG. 1, and the levels of hepcidin mRNA following administration of AD-59743 are shown in FIG. 2. The results demonstrate a dose-dependent decrease in the levels of TMPRSS6 transcripts that is sustained through day 7.

Example 4. In Vivo Effect of TMPRSS6 iRNA Agents in Combination with an Iron Chelator

[0665] The purpose of this study was to test the effect of co-administered TMPRSS6 specific siRNA and iron chelators on iron levels. In the study, 6-week old wild-type C57BL/6 and thalassemic Th3/+ mice (Douet et al., Am. J. Pathol. (2011), 178(2):774-83) were fed low-iron diets containing 3-5 ppm iron. The mice were administered intravevously the formulation AF-011-46273 containing deferiprone, an iron chelator at a dose of 250 mg/kg/day and an iRNA agent with the following structure: oligoSeq-sense--uGGuAuuuccuAGGGuAcAdTsdT (SEQ ID NO: 209); oligoSeq-antisense--UGuACCCuAGGAAAuACcAdTsdT (SEQ ID NO: 210). The formulation also contained MC-3/DSPC/Cholesterol/PEG-DMG 50/10/38.5/1.5. Liver and spleen tissues were collected and tissue nonheme iron concentrations were determined as described previously (see, e.g., Schmidt et al. (2013) Blood 121(7):1200-8; Cook, J D, et al. Tissue iron stores. In: Cook J D, editor. Methods in Hematology. Vol 1. New York, N.Y.: Churchill Livingstone Press; 1980. p. 104-109).

[0666] The results of these experiments demonstrate an additive effect of AD-46273 and deferiprone in Th3/+ mice, with the decreased iron levels relative to the negative controls.

Example 5. Design, Specificity and Efficacy Prediction of Oligonucleotides

Transcripts

[0667] siRNA design was carried out to identify siRNAs targeting human, cynomolgus monkey (Macacafascicularis; henceforth "cyno"), mouse, and rat TMPRSS6 transcripts annotated in the NCBI Gene database (http://www.ncbi.nlm.nih.gov/gene/). Design used the following transcripts from the NCBI RefSeq collection: Human--NM_153609.2; Mouse--NM_027902.2; Rat--NM_001130556.1. For cyno, a transcript sequence was obtained via alignment with human TMPRSS6 of sequence assembled from two accessions: "ENSP00000384964 [mRNA] locus=chr10:82446450:82485403:-" and FR874253.1, available from the M. fascicularis genome project and NCBI Nucleotide databases, respectively (http://macaque.genomics.org.cn/page/species/download.jsp and http://www.ncbi.nlm.nih.gov/nucleotide/). Due to high primate/rodent sequence divergence, siRNA duplexes were designed in several separate batches, including but not limited to batches containing duplexes matching human and cyno transcripts only; human, cyno, and mouse transcripts only; and human, cyno, mouse, and rat transcripts only. Most siRNA duplexes were designed that shared 100% identity in the designated region with the listed human transcript and other species transcripts considered in each design batch (above). In some instances, mismatches between duplex and mRNA target were allowed at the first antisense (last sense) position when the antisense strand:target mRNA complementary basepair was a GC or CG pair. In these cases, duplexes were designed with UA or AU pairs at the first anti sense:last sense pair. Thus the duplexes maintained complementarity but were mismatched with respect to target (U:C, U:G, A:C, or A:G).

[0668] The specificity of all possible 19mers was predicted from each sequence. Candidate 19mers that lacked repeats longer than 7 nucleotides were then selected. These 1128 candidate human/cyno, 69 human/cyno/mouse, and 23 human/cyno/mouse/rat siRNAs were used in comprehensive searches against the appropriate transcriptomes (defined as the set of NM_and XM_records within the human, mouse, or rat NCBI Refseq sets, and the cyno transcriptome set in NCBI nucleotide) using an exhaustive "brute-force" algorithm implemented in the python script `BruteForce.py`. The script next parsed the transcript-oligo alignments to generate a score based on the position and number of mismatches between the siRNA and any potential `off-target` transcript. The off-target score is weighted to emphasize differences in the `seed` region of siRNAs, in positions 2-9 from the 5' end of the molecule. Each oligo-transcript pair from the brute-force search was given a mismatch score by summing the individual mismatch scores; mismatches in the position 2-9 were counted as 2.8, mismatches in the cleavage site positions 10-11 were counted as 1.2, and mismatches in region 12-19 counted as 1.0. An additional off-target prediction was carried out by comparing the frequency of heptamers and octomers derived from 3 distinct, seed-derived hexamers of each oligo. The hexamers from positions 2-7 relative to the 5' start were used to create 2 heptamers and one octomer. Heptamerl was created by adding a 3' A to the hexamer; heptamer2 was created by adding a 5' A to the hexamer; the octomer was created by adding an A to both 5' and 3' ends of the hexamer. The frequency of octomers and heptamers in the human, cyno, mouse, or rat 3'UTRome (defined as the subsequence of the transcriptome from NCBI's Refseq database where the end of the coding region, the `CDS`, is clearly defined) was pre-calculated. The octomer frequency was normalized to the heptamer frequency using the median value from the range of octomer frequencies. A `mirSeedScore` was then calculated by calculating the sum of ((3.times.normalized octomer count)+(2.times.heptamer2 count)+(1.times.heptamer1 count)).

[0669] Both siRNAs strands were assigned to a category of specificity according to the calculated scores: a score above 3 qualifies as highly specific, equal to 3 as specific and between 2 and 2.8 as moderately specific. We sorted by the specificity of the antisense strand. We then selected moderately (or higher) specific duplexes whose antisense oligos possessed characteristics of duplexes with high predicted efficacy, including maximal UA content in the seed region and low overall GC content.

[0670] For GalNaC-conjugated duplexes, sense 21mer and antisense 23mer oligos were designed by extending antisense 19mers (described above) to 23 nucleotides of target-complementary sequence. All species transcripts included in the design batch were checked for complementarity. For each duplex, the sense 21mer was specified as the reverse complement of the first 21 nucleotides of the antisense strand.

siRNA Sequence Selection

[0671] A total of 5 sense and 5 antisense human, 32 sense and 32 antisense derived human/cyno, 4 sense and 4 antisense derived human/cyno/mouse, 8 sense and 8 antisense derived human/cyno/mouse/rat, 19 sense and 19 antisense derived human/cyno/rat, 2 sense and 2 antisense derived human/mouse, and 1 sense and 1 antisense derived human/mouse/rat siRNA 21/23mer oligos were synthesized and formed into GalNAc-conjugated duplexes.

[0672] The sequences of the sense and antisense strands of the unmodified duplexes are shown in Table 4, and the sequences of the sense and antisense strands of the modified duplexes are shown in Table 5.

TABLE-US-00007 TABLE 4 TMPRSS6-unmodified seqeunces Position Sense SEQ Antisense SEQ in sequence Sense ID sequence ID NM_ Duplex ID ID sequence NO: ID Antisense sequence NO: 153609.2 AD-60944.1 A-122732.1 GGUGCUACUCU 211 A-122733.1 AGGAAAUACCAGAGUAGCACCCC 280 318 GGUAUUUCCU AD-59743.1 A-120243.1 UCUGGUAUUUC 212 A-120244.1 UGUACCCUAGGAAAUACCAGAGU 281 326 CUAGGGUACA AD-60940.1 A-122745.1 CUGGUAUUUCC 213 A-122746.1 UUGUACCCUAGGAAAUACCAGAG 282 327 UAGGGUACAA AD-61002.2 A-122838.1 UGGUAUUUCCU 214 A-122839.1 UUUGUACCCUAGGAAAUACCAGA 283 328 AGGGUACAAA AD-61000.1 A-122852.1 GGUAUUUCCUA 215 A-122853.1 UCUUGUACCCUAGGAAAUACCAG 284 329 GGGUACAAGA AD-46273.1 A-96908.1 UGGUAUUUCCU 216 A-96909.1 UGUACCCUAGGAAAUACCA 285 330 AGGGUACA AD-61003.1 A-122854.1 GUAUUUCCUAG 217 A-122855.1 UCCUUGUACCCUAGGAAAUACCA 286 330 GGUACAAGGA AD-60994.1 A-122848.1 AUUUCCUAGGG 218 A-122849.1 UCGCCUUGUACCCUAGGAAAUAC 287 332 UACAAGGCGA AD-60990.1 A-122830.1 UUUCCUAGGGU 219 A-122831.1 UCCGCCUUGUACCCUAGGAAAUA 288 333 ACAAGGCGGA AD-60956.1 A-122736.1 CGCCACUUCUC 220 A-122737.1 AAGAUCCUGGGAGAAGUGGCGAU 289 400 CCAGGAUCUU AD-60981.1 A-122757.1 GCCACUUCUCC 221 A-122758.1 UAAGAUCCUGGGAGAAGUGGCGA 290 401 CAGGAUCUUA AD-60953.1 A-122775.1 CUGCUUCUUCU 222 A-122776.1 AGAAUGAACCAGAAGAAGCAGGU 291 558 GGUUCAUUCU AD-60977.1 A-122783.1 CUUCUUCUGGU 223 A-122784.1 UGGAGAAUGAACCAGAAGAAGCA 292 561 UCAUUCUCCA AD-60964.1 A-119169.2 CCCUACAGGGC 224 A-122764.1 UUCGUACUCGGCCCUGUAGGGGA 293 679 CGAGUACGAA AD-60947.1 A-122773.1 CUACAGGGCCG 225 A-122774.1 ACUUCGUACUCGGCCCUGUAGGG 294 681 AGUACGAAGU AD-60957.1 A-122751.1 GCCAGUGUGAA 226 A-122752.1 AGCUAUGUCUUUCACACUGGCUU 295 730 AGACAUAGCU AD-60960.1 A-122792.1 AGUGUGAAAGA 227 A-122793.1 UGCAGCUAUGUCUUUCACACUGG 296 733 CAUAGCUGCA AD-60972.1 A-122796.1 CACGCUGGGUU 228 A-122797.1 UAGCGGUAACAACCCAGCGUGGA 297 762 GUUACCGCUA AD-60970.1 A-122765.1 GGGUUGUUACC 229 A-122766.1 UAGCUGUAGCGGUAACAACCCAG 298 768 GCUACAGCUA AD-60963.1 A-122753.1 CGGGACCGACU 230 A-122754.1 AUACAUGGCCAGUCGGUCCCGGC 299 916 GGCCAUGUAU AD-60968.1 A-122739.1 CCGACUGGCCA 231 A-122740.1 ACGUCAUACAUGGCCAGUCGGUC 300 921 UGUAUGACGU AD-60942.1 A-122786.1 GGGCCUGCACA 232 A-122787.1 UCGUAGUAGCUGUGCAGGCCCUU 301 1053 GCUACUACGA AD-60951.1 A-122749.1 GGCAGAAGUAU 233 A-122750.1 ACGGCAAAUCAUACUUCUGCCUC 302 1280 GAUUUGCCGU AD-60984.1 A-122800.1 CCAGAACAGGA 234 A-122801.1 CCACACAGCCUCCUGUUCUGGAU 303 1323 GGCUGUGUGG AD-60955.1 A-122806.1 CAGAACAGGAG 235 A-122807.1 GCCACACAGCCUCCUGUUCUGGA 304 1324 GCUGUGUGGC AD-60943.1 A-122802.1 CACCUCCCAGA 236 A-122803.1 GUGAGGGAGAUCUGGGAGGUGAA 305 1413 UCUCCCUCAC AD-61001.1 A-122823.1 CACCUCCCAGA 237 A-122824.1 UUGAGGGAGAUCUGGGAGGUGAA 306 1413 UCUCCCUCAA AD-60974.1 A-122741.1 UGUGCGGGUGC 238 A-122742.1 AAGCCAUAGUGCACCCGCACACC 307 1443 ACUAUGGCUU AD-60982.1 A-122769.1 GCGGGUGCACU 239 A-122770.1 UACAAGCCAUAGUGCACCCGCAC 308 1446 AUGGCUUGUA AD-60996.1 A-122834.1 CCCCUGCCCUG 240 A-122835.1 AGGAACUCUCCAGGGCAGGGGUC 309 1479 GAGAGUUCCU AD-60997.1 A-122850.1 CCCUGCCCUGG 241 A-122851.1 UAGGAACUCUCCAGGGCAGGGGU 310 1480 AGAGUUCCUA AD-61006.1 A-122856.1 CCUGCCCUGGA 242 A-122857.1 AGAGGAACUCUCCAGGGCAGGGG 311 1481 GAGUUCCUCU AD-60988.1 A-122844.1 CUGCCCUGGAG 243 A-122845.1 UAGAGGAACUCUCCAGGGCAGGG 312 1482 AGUUCCUCUA AD-60959.1 A-122777.1 CCUGUGAUGGG 244 A-122778.1 AGUCCUUGACCCCAUCACAGGCA 313 1529 GUCAAGGACU AD-60999.1 A-122836.1 GGACUGCCCCA 245 A-122837.1 UCCAGGCCGUUGGGGCAGUCCUU 314 1545 ACGGCCUGGA AD-60991.1 A-122846.1 ACUGCCCCAAC 246 A-122847.1 UAUCCAGGCCGUUGGGGCAGUCC 315 1547 GGCCUGGAUA AD-60993.1 A-122832.1 CUGCCCCAACG 247 A-122833.1 UCAUCCAGGCCGUUGGGGCAGUC 316 1548 GCCUGGAUGA AD-61005.1 A-122840.1 UGCCCCAACGG 248 A-122841.1 UUCAUCCAGGCCGUUGGGGCAGU 317 1549 CCUGGAUGAA AD-60987.1 A-119213.2 GCCCCAACGGC 249 A-122829.1 UCUCAUCCAGGCCGUUGGGGCAG 318 1550 CUGGAUGAGA AD-60986.1 A-122842.1 CCCCAACGGCC 250 A-122843.1 UUCUCAUCCAGGCCGUUGGGGCA 319 1551 UGGAUGAGAA AD-60952.1 A-119187.2 CCCAACGGCCU 251 A-122761.1 UCUCUCAUCCAGGCCGUUGGGGC 320 1552 GGAUGAGAGA AD-60983.1 A-119191.2 CAACGGCCUGG 252 A-122785.1 UUUCUCUCAUCCAGGCCGUUGGG 321 1554 AUGAGAGAAA AD-60950.1 A-122734.1 ACGGCCUGGAU 253 A-122735.1 AGUUUCUCUCAUCCAGGCCGUUG 322 1556 GAGAGAAACU AD-60980.1 A-122743.1 CCUGGAUGAGA 254 A-122744.1 ACGCAGUUUCUCUCAUCCAGGCC 323 1560 GAAACUGCGU AD-60998.1 A-122821.1 CACUGUGACUG 255 A-122822.1 UUGGAGGCCACAGUCACAGUGCU 324 1804 UGGCCUCCAA AD-60961.1 A-122808.1 GUCCUCCGAGG 256 A-122809.1 GGCCACUCACCCUCGGAGGACAC 325 1857 GUGAGUGGCC AD-61004.1 A-122825.1 CUCCGAGGGUG 257 A-122826.1 UAUGGCCACUCACCCUCGGAGGA 326 1860 AGUGGCCAUA AD-60949.1 A-122804.1 UCCGAGGGUGA 258 A-122805.1 CCAUGGCCACUCACCCUCGGAGG 327 1861 GUGGCCAUGG AD-60969.1 A-119189.2 CCAGGUUCGGG 259 A-122755.1 AUGUGUCGACCCCGAACCUGGAG 328 1893 GUCGACACAU AD-60966.1 A-122794.1 AGGUUCGGGGU 260 A-122795.1 AGAUGUGUCGACCCCGAACCUGG 329 1895 CGACACAUCU AD-60967.1 A-122810.1 CGGGGUCGACA 261 A-122811.1 CCCACAGAUGUGUCGACCCCGAA 330 1900 CAUCUGUGGG AD-60989.1 A-122816.1 CGGGGUCGACA 262 A-122817.1 UCCACAGAUGUGUCGACCCCGAA 331 1900 CAUCUGUGGA AD-60973.1 A-122812.1 GGGGUCGACAC 263 A-122813.1 CCCCACAGAUGUGUCGACCCCGA 332 1901 AUCUGUGGGG AD-60992.1 A-122818.1 GGGGUCGACAC 264 A-122819.1 UCCCACAGAUGUGUCGACCCCGA 333 1901 AUCUGUGGGA AD-60985.1 A-122827.1 GGGUCGACACA 265 A-122828.1 UCCCCACAGAUGUGUCGACCCCG 334 1902 UCUGUGGGGA AD-60946.1 A-122759.1 GCUGACCGCUG 266 A-122760.1 UGUUAUCACCCAGCGGUCAGCGA 335 1933 GGUGAUAACA AD-60979.1 A-122814.1 CUUCCAGGAGG 267 A-122815.1 GCCAUGCUGUCCUCCUGGAAGCA 336 1965 ACAGCAUGGC AD-60976.1 A-122767.1 GGCCUGGAGAG 268 A-122768.1 UGAAGGACACCUCUCCAGGCCAG 337 2039 GUGUCCUUCA AD-60939.1 A-122730.1 GCCUGGAGAGG 269 A-122731.1 UUGAAGGACACCUCUCCAGGCCA 338 2040 UGUCCUUCAA AD-60978.1 A-122798.1 CCAAGCAGGGG 270 A-122799.1 AAUACUUGUCCCCCUGCUUGGCA 339 2608 GACAAGUAUU AD-60958.1 A-122762.1 CAAGCAGGGGG 271 A-122763.1 GAAUACUUGUCCCCCUGCUUGGC 340 2609

ACAAGUAUUC AD-60962.1 A-119231.2 UGGCAGGAGGU 272 A-122738.1 ACAAGAUGCCACCUCCUGCCACC 341 2664 GGCAUCUUGU AD-60941.1 A-122771.1 GCAGGAGGUGG 273 A-122772.1 AGACAAGAUGCCACCUCCUGCCA 342 2666 CAUCUUGUCU AD-60965.1 A-122779.1 GCUUCGGAAGC 274 A-122780.1 UAGACCAGGGGCUUCCGAAGCUG 343 2954 CCCUGGUCUA AD-60954.1 A-122790.1 CUUCGGAAGCC 275 A-122791.1 UUAGACCAGGGGCUUCCGAAGCU 344 2955 CCUGGUCUAA AD-60975.1 A-119233.2 CCCCUGGUCUA 276 A-122756.1 GAUCCCAAGUUAGACCAGGGGCU 345 2964 ACUUGGGAUC AD-60945.1 A-122747.1 CCCUGGUCUAA 277 A-122748.1 AGAUCCCAAGUUAGACCAGGGGC 346 2965 CUUGGGAUCU AD-60971.1 A-122781.1 CCUGGUCUAAC 278 A-122782.1 CAGAUCCCAAGUUAGACCAGGGG 347 2966 UUGGGAUCUG AD-60948.1 A-122788.1 CUAACUUGGGA 279 A-122789.1 CAUUCCCAGAUCCCAAGUUAGAC 348 2972 UCUGGGAAUG

TABLE-US-00008 TABLE 5 TMPRSS6 modified sequences Sense SEQ Antisense SEQ sequence ID sequence ID Duplex ID ID Sense sequence NO: ID Antisense sequence NO: AD-46273.1 A-96908.1 uGGuAuuuccuAGGGuAcA 349 A-96909.1 UGuACCCuAGGAAAuACcA 418 dTsdT dTsdT AD-59743.1 A-120243.1 UfscsUfgGfuAfuUfUfC 350 A-120244.1 usGfsuAfcCfcUfaGfga 419 fcUfaGfgGfuAfcAfL96 aAfuAfcCfaGfasgsu AD-60939.1 A-122730.1 GfscsCfuGfgAfgAfGfG 351 A-122731.1 usUfsgAfaGfgAfcAfcc 420 fuGfuCfcUfuCfaAfL96 uCfuCfcAfgGfcscsa AD-60940.1 A-122745.1 CfsusGfgUfaUfuUfCfC 352 A-122746.1 usUfsgUfaCfcCfuAfgg 421 fuAfgGfgUfaCfaAfL96 aAfaUfaCfcAfgsasg AD-60941.1 A-122771.1 GfscsAfgGfaGfgUfGfG 353 A-122772.1 asGfsaCfaAfgAfuGfcc 422 fcAfuCfuUfgUfcUfL96 aCfcUfcCfuGfcscsa AD-60942.1 A-122786.1 GfsgsGfcCfuGfcAfCfA 354 A-122787.1 usCfsgUfaGfuAfgCfug 423 fgCfuAfcUfaCfgAfL96 uGfcAfgGfcCfcsusu AD-60943.1 A-122802.1 CfsasCfcUfcCfcAfGfA 355 A-122803.1 gsUfsgAfgGfgAfgAfuc 424 fuCfuCfcCfuCfaCfL96 uGfgGfaGfgUfgsasa AD-60944.1 A-122732.1 GfsgsUfgCfuAfcUfCfU 356 A-122733.1 asGfsgAfaAfuAfcCfag 425 fgGfuAfuUfuCfcUfL96 aGfuAfgCfaCfcscsc AD-60945.1 A-122747.1 CfscsCfuGfgUfcUfAfA 357 A-122748.1 asGfsaUfcCfcAfaGfuu 426 fcUfuGfgGfaUfcUfL96 aGfaCfcAfgGfgsgsc AD-60946.1 A-122759.1 GfscsUfgAfcCfgCfUfG 358 A-122760.1 usGfsuUfaUfcAfcCfca 427 fgGfuGfaUfaAfcAfL96 gCfgGfuCfaGfcsgsa AD-60947.1 A-122773.1 CfsusAfcAfgGfgCfCfG 359 A-122774.1 asCfsuUfcGfuAfcUfcg 428 faGfuAfcGfaAfgUfL96 gCfcCfuGfuAfgsgsg AD-60948.1 A-122788.1 CfsusAfaCfuUfgGfGfA 360 A-122789.1 csAfsuUfcCfcAfgAfuc 429 fuCfuGfgGfaAfuGfL96 cCfaAfgUfuAfgsasc AD-60949.1 A-122804.1 UfscsCfgAfgGfgUfGfA 361 A-122805.1 csCfsaUfgGfcCfaCfuc 430 fgUfgGfcCfaUfgGfL96 aCfcCfuCfgGfasgsg AD-60950.1 A-122734.1 AfscsGfgCfcUfgGfAfU 362 A-122735.1 asGfsuUfuCfuCfuCfau 431 fgAfgAfgAfaAfcUfL96 cCfaGfgCfcGfususg AD-60951.1 A-122749.1 GfsgsCfaGfaAfgUfAfU 363 A-122750.1 asCfsgGfcAfaAfuCfau 432 fgAfuUfuGfcCfgUfL96 aCfuUfcUfgCfcsusc AD-60952.1 A-119187.2 CfscsCfaAfcGfgCfCfU 364 A-122761.1 usCfsuCfuCfaUfcCfag 433 fgGfaUfgAfgAfgAfL96 gCfcGfuUfgGfgsgsc AD-60953.1 A-122775.1 CfsusGfcUfuCfuUfCfU 365 A-122776.1 asGfsaAfuGfaAfcCfag 434 fgGfuUfcAfuUfcUfL96 aAfgAfaGfcAfgsgsu AD-60954.1 A-122790.1 CfsusUfcGfgAfaGfCfC 366 A-122791.1 usUfsaGfaCfcAfgGfgg 435 fcCfuGfgUfcUfaAfL96 cUfuCfcGfaAfgscsu AD-60955.1 A-122806.1 CfsasGfaAfcAfgGfAfG 367 A-122807.1 gsCfscAfcAfcAfgCfcu 436 fgCfuGfuGfuGfgCfL96 cCfuGfuUfcUfgsgsa AD-60956.1 A-122736.1 CfsgsCfcAfcUfuCfUfC 368 A-122737.1 asAfsgAfuCfcUfgGfga 437 fcCfaGfgAfuCfuUfL96 gAfaGfuGfgCfgsasu AD-60957.1 A-122751.1 GfscsCfaGfuGfuGfAfA 369 A-122752.1 asGfscUfaUfgUfcUfuu 438 faGfaCfaUfaGfcUfL96 cAfcAfcUfgGfcsusu AD-60958.1 A-122762.1 CfsasAfgCfaGfgGfGfG 370 A-122763.1 gsAfsaUfaCfuUfgUfcc 439 faCfaAfgUfaUfuCfL96 cCfcUfgCfuUfgsgsc AD-60959.1 A-122777.1 CfscsUfgUfgAfuGfGfG 371 A-122778.1 asGfsuCfcUfuGfaCfcc 440 fgUfcAfaGfgAfcUfL96 cAfuCfaCfaGfgscsa AD-60960.1 A-122792.1 AfsgsUfgUfgAfaAfGfA 372 A-122793.1 usGfscAfgCfuAfuGfuc 441 fcAfuAfgCfuGfcAfL96 uUfuCfaCfaCfusgsg AD-60961.1 A-122808.1 GfsusCfcUfcCfgAfGfG 373 A-122809.1 gsGfscCfaCfuCfaCfcc 442 fgUfgAfgUfgGfcCfL96 uCfgGfaGfgAfcsasc AD-60962.1 A-119231.2 UfsgsGfcAfgGfaGfGfU 374 A-122738.1 asCfsaAfgAfuGfcCfac 443 fgGfcAfuCfuUfgUfL96 cUfcCfuGfcCfascsc AD-60963.1 A-122753.1 CfsgsGfgAfcCfgAfCfU 375 A-122754.1 asUfsaCfaUfgGfcCfag 444 fgGfcCfaUfgUfaUfL96 uCfgGfuCfcCfgsgsc AD-60964.1 A-119169.2 CfscsCfuAfcAfgGfGfC 376 A-122764.1 usUfscGfuAfcUfcGfgc 445 fcGfaGfuAfcGfaAfL96 cCfuGfuAfgGfgsgsa AD-60965.1 A-122779.1 GfscsUfuCfgGfaAfGfC 377 A-122780.1 usAfsgAfcCfaGfgGfgc 446 fcCfcUfgGfuCfuAfL96 uUfcCfgAfaGfcsusg AD-60966.1 A-122794.1 AfsgsGfuUfcGfgGfGfU 378 A-122795.1 asGfsaUfgUfgUfcGfac 447 fcGfaCfaCfaUfcUfL96 cCfcGfaAfcCfusgsg AD-60967.1 A-122810.1 CfsgsGfgGfuCfgAfCfA 379 A-122811.1 csCfscAfcAfgAfuGfug 448 fcAfuCfuGfuGfgGfL96 uCfgAfcCfcCfgsasa AD-60968.1 A-122739.1 CfscsGfaCfuGfgCfCfA 380 A-122740.1 asCfsgUfcAfuAfcAfug 449 fuGfuAfuGfaCfgUfL96 gCfcAfgUfcGfgsusc AD-60969.1 A-119189.2 CfscsAfgGfuUfcGfGfG 381 A-122755.1 asUfsgUfgUfcGfaCfcc 450 fgUfcGfaCfaCfaUfL96 cGfaAfcCfuGfgsasg AD-60970.1 A-122765.1 GfsgsGfuUfgUfuAfCfC 382 A-122766.1 usAfsgCfuGfuAfgCfgg 451 fgCfuAfcAfgCfuAfL96 uAfaCfaAfcCfcsasg AD-60971.1 A-122781.1 CfscsUfgGfuCfuAfAfC 383 A-122782.1 csAfsgAfuCfcCfaAfgu 452 fuUfgGfgAfuCfuGfL96 uAfgAfcCfaGfgsgsg AD-60972.1 A-122796.1 CfsasCfgCfuGfgGfUfU 384 A-122797.1 usAfsgCfgGfuAfaCfaa 453 fgUfuAfcCfgCfuAfL96 cCfcAfgCfgUfgsgsa AD-60973.1 A-122812.1 GfsgsGfgUfcGfaCfAfC 385 A-122813.1 csCfscCfaCfaGfaUfgu 454 faUfcUfgUfgGfgGfL96 gUfcGfaCfcCfcsgsa AD-60974.1 A-122741.1 UfsgsUfgCfgGfgUfGfC 386 A-122742.1 asAfsgCfcAfuAfgUfgc 455 faCfuAfuGfgCfuUfL96 aCfcCfgCfaCfascsc AD-60975.1 A-119233.2 CfscsCfcUfgGfuCfUfA 387 A-122756.1 gsAfsuCfcCfaAfgUfua 456 faCfuUfgGfgAfuCfL96 gAfcCfaGfgGfgscsu AD-60976.1 A-122767.1 GfsgsCfcUfgGfaGfAfG 388 A-122768.1 usGfsaAfgGfaCfaCfcu 457 fgUfgUfcCfuUfcAfL96 cUfcCfaGfgCfcsasg AD-60977.1 A-122783.1 CfsusUfcUfuCfuGfGfU 389 A-122784.1 usGfsgAfgAfaUfgAfac 458 fuCfaUfuCfuCfcAfL96 cAfgAfaGfaAfgscsa AD-60978.1 A-122798.1 CfscsAfaGfcAfgGfGfG 390 A-122799.1 asAfsuAfcUfuGfuCfcc 459 fgAfcAfaGfuAfuUfL96 cCfuGfcUfuGfgscsa AD-60979.1 A-122814.1 CfsusUfcCfaGfgAfGfG 391 A-122815.1 gsCfscAfuGfcUfgUfcc 460 faCfaGfcAfuGfgCfL96 uCfcUfgGfaAfgscsa AD-60980.1 A-122743.1 CfscsUfgGfaUfgAfGfA 392 A-122744.1 asCfsgCfaGfuUfuCfuc 461 fgAfaAfcUfgCfgUfL96 uCfaUfcCfaGfgscsc AD-60981.1 A-122757.1 GfscsCfaCfuUfcUfCfC 393 A-122758.1 usAfsaGfaUfcCfuGfgg 462 fcAfgGfaUfcUfuAfL96 aGfaAfgUfgGfcsgsa AD-60982.1 A-122769.1 GfscsGfgGfuGfcAfCfU 394 A-122770.1 usAfscAfaGfcCfaUfag 463 faUfgGfcUfuGfuAfL96 uGfcAfcCfcGfcsasc AD-60983.1 A-119191.2 CfsasAfcGfgCfcUfGfG 395 A-122785.1 usUfsuCfuCfuCfaUfcc 464 faUfgAfgAfgAfaAfL96 aGfgCfcGfuUfgsgsg AD-60984.1 A-122800.1 CfscsAfgAfaCfaGfGfA 396 A-122801.1 csCfsaCfaCfaGfcCfuc 465 fgGfcUfgUfgUfgGfL96 cUfgUfuCfuGfgsasu AD-60985.1 A-122827.1 GfsgsGfuCfgAfcAfCfA 397 A-122828.1 usCfscCfcAfcAfgAfug 466 fuCfuGfuGfgGfgAfL96 uGfuCfgAfcCfcscsg AD-60986.1 A-122842.1 CfscsCfcAfaCfgGfCfC 398 A-122843.1 usUfscUfcAfuCfcAfgg 467 fuGfgAfuGfaGfaAfL96 cCfgUfuGfgGfgscsa AD-60987.1 A-119213.2 GfscsCfcCfaAfcGfGfC 399 A-122829.1 usCfsuCfaUfcCfaGfgc 468 fcUfgGfaUfgAfgAfL96 cGfuUfgGfgGfcsasg AD-60988.1 A-122844.1 CfsusGfcCfcUfgGfAfG 400 A-122845.1 usAfsgAfgGfaAfcUfcu 469 faGfuUfcCfuCfuAfL96 cCfaGfgGfcAfgsgsg AD-60989.1 A-122816.1 CfsgsGfgGfuCfgAfCfA 401 A-122817.1 usCfscAfcAfgAfuGfug 470 fcAfuCfuGfuGfgAfL96 uCfgAfcCfcCfgsasa AD-60990.1 A-122830.1 UfsusUfcCfuAfgGfGfU 402 A-122831.1 usCfscGfcCfuUfgUfac 471 faCfaAfgGfcGfgAfL96 cCfuAfgGfaAfasusa AD-60991.1 A-122846.1 AfscsUfgCfcCfcAfAfC 403 A-122847.1 usAfsuCfcAfgGfcCfgu 472 fgGfcCfuGfgAfuAfL96 uGfgGfgCfaGfuscsc AD-60992.1 A-122818.1 GfsgsGfgUfcGfaCfAfC 404 A-122819.1 usCfscCfaCfaGfaUfgu 473 faUfcUfgUfgGfgAfL96 gUfcGfaCfcCfcsgsa AD-60993.1 A-122832.1 CfsusGfcCfcCfaAfCfG 405 A-122833.1 usCfsaUfcCfaGfgCfcg 474 fgCfcUfgGfaUfgAfL96 uUfgGfgGfcAfgsusc AD-60994.1 A-122848.1 AfsusUfuCfcUfaGfGfG 406 A-122849.1 usCfsgCfcUfuGfuAfcc 475 fuAfcAfaGfgCfgAfL96 cUfaGfgAfaAfusasc AD-60996.1 A-122834.1 CfscsCfcUfgCfcCfUfG 407 A-122835.1 asGfsgAfaCfuCfuCfca 476 fgAfgAfgUfuCfcUfL96 gGfgCfaGfgGfgsusc AD-60997.1 A-122850.1 CfscsCfuGfcCfcUfGfG 408 A-122851.1 usAfsgGfaAfcUfcUfcc 477 faGfaGfuUfcCfuAfL96 aGfgGfcAfgGfgsgsu AD-60998.1 A-122821.1 CfsasCfuGfuGfaCfUfG 409 A-122822.1 usUfsgGfaGfgCfcAfca 478 fuGfgCfcUfcCfaAfL96 gUfcAfcAfgUfgscsu

AD-60999.1 A-122836.1 GfsgsAfcUfgCfcCfCfA 410 A-122837.1 usCfscAfgGfcCfgUfug 479 faCfgGfcCfuGfgAfL96 gGfgCfaGfuCfcsusu AD-61000.1 A-122852.1 GfsgsUfaUfuUfcCfUfA 411 A-122853.1 usCfsuUfgUfaCfcCfua 480 fgGfgUfaCfaAfgAfL96 gGfaAfaUfaCfcsasg AD-61001.1 A-122823.1 CfsasCfcUfcCfcAfGfA 412 A-122824.1 usUfsgAfgGfgAfgAfuc 481 fuCfuCfcCfuCfaAfL96 uGfgGfaGfgUfgsasa AD-61002.1 A-122838.1 UfsgsGfuAfuUfuCfCfU 413 A-122839.1 usUfsuGfuAfcCfcUfag 482 faGfgGfuAfcAfaAfL96 gAfaAfuAfcCfasgsa AD-61003.1 A-122854.1 GfsusAfuUfuCfcUfAfG 414 A-122855.1 usCfscUfuGfuAfcCfcu 483 fgGfuAfcAfaGfgAfL96 aGfgAfaAfuAfcscsa AD-61004.1 A-122825.1 CfsusCfcGfaGfgGfUfG 415 A-122826.1 usAfsuGfgCfcAfcUfca 484 faGfuGfgCfcAfuAfL96 cCfcUfcGfgAfgsgsa AD-61005.1 A-122840.1 UfsgsCfcCfcAfaCfGfG 416 A-122841.1 usUfscAfuCfcAfgGfcc 485 fcCfuGfgAfuGfaAfL96 gUfuGfgGfgCfasgsu AD-61006.1 A-122856.1 CfscsUfgCfcCfuGfGfA 417 A-122857.1 asGfsaGfgAfaCfuCfuc 486 fgAfgUfuCfcUfcUfL96 cAfgGfgCfaGfgsgsg

Example 6. In Vitro Single Dose Screen

Cell Culture and Transfections for Single Dose and Dose Response Studies

[0673] Hep3B cells (ATCC, Manassas, Va.) were grown to near confluence at 37.degree. C. in an atmosphere of 5% CO.sub.2 in DMEM (ATCC) supplemented with 10% FBS, streptomycin, and glutamine (ATCC) before being released from the plate by trypsinization. Transfection was carried out by adding 14.8 .mu.l of Opti-MEM plus 0.2 .mu.l of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5 .mu.l of siRNA duplexes per well into a 96-well plate and incubated at room temperature for 15 minutes. 80 .mu.l of complete growth media without antibiotic containing .about.2.times.10.sup.4 Hep3B cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Experiments were performed at 10 nM and 0.1 nM final duplex concentration.

Total RNA Isolation Using DYNABEADS mRNA Isolation Kit (Invitrogen, Part #; 610-12)

[0674] Cells were harvested and lysed in 150 .mu.l of Lysis/Binding Buffer then mixed for 5 minutes at 850 rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 .mu.l Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supernatant was removed without disturbing the beads. After removing supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing supernatant, magnetic beads were washed 2 times with 150 .mu.l Wash Buffer A and mixed for 1 minute. Beads were capture again and supernatant removed. Beads were then washed with 150 .mu.l Wash Buffer B, captured and supernatant was removed. Beads were next washed with 150 .mu.l Elution Buffer, captured and supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50 .mu.l of Elution Buffer was added and mixed for 5 minutes at 70.degree. C. Beads were captured on magnet for 5 minutes. 40 .mu.l of supernatant was removed and added to another 96 well plate.

cDNA Synthesis Using ABI High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, Calif., Cat #4368813)

[0675] A master mix of 2 .mu.l 10.times. Buffer, 0.8 .mu.l 25.times. dNTPs, 2 .mu.l Random primers, 1 .mu.l Reverse Transcriptase, 1 .mu.l RNase inhibitor and 3.2 .mu.l of H2O per reaction were added into 10 .mu.l total RNA. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, Calif.) through the following steps: 25.degree. C. 10 min, 37.degree. C. 120 min, 85.degree. C. 5 sec, 4.degree. C. hold.

Real Time PCR

[0676] 2 .mu.l of cDNA were added to a master mix containing 0.5 .mu.l 1 GAPDH TaqMan Probe (Applied Biosystems Cat #4326317E), 0.5 .mu.l TMPRSS6 TaqMan probe (Applied Biosystems cat #Hs00542184_m1) and 5 .mu.l Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well 50 plates (Roche cat #04887301001). Real time PCR was done in an Roche Lightcycler Real Time PCR system (Roche) using the .DELTA..DELTA.Ct(RQ) assay. Each duplex was tested in two independent transfections and each transfection was assayed in duplicate, unless otherwise noted in the summary tables.

[0677] To calculate relative fold change, real time data were analyzed using the .DELTA..DELTA.Ct method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells.

[0678] Data are expressed as a fraction of TMPRSS6 message remaining in cells transfected with siRNAs targeting TMPRSS6, relative to naive cells. All siRNAs were transfected at least two times and qPCR reactions were performed in duplicate. Data are show in Table 6.

TABLE-US-00009 TABLE 6 TMPRSS6 single dose screen. Duplex ID Avg 10 nM Avg 0.1 nM SD 10 nM SD 0.1 nM AD-46273 76.5 112.1 14.3 18.6 AD-59743 61.4 108.2 8.7 4.4 AD-60939 38.0 85.7 19.3 25.2 AD-60940 24.2 22.6 10.1 9.7 AD-60941 48.5 84.7 11.7 29.7 AD-60942 102.9 111.2 4.3 44.8 AD-60943 86.2 96.5 2.3 28.8 AD-60944 24.6 78.5 1.1 36.5 AD-60945 65.8 140.9 0.5 59.2 AD-60946 50.3 105.9 4.1 31.2 AD-60947 79.1 147.2 12.3 51.2 AD-60948 81.0 113.9 0.6 32.7 AD-60949 111.3 96.2 8.2 28.1 AD-60950 53.8 93.2 7.6 42.3 AD-60951 74.1 121.6 6.4 56.2 AD-60952 47.6 118.3 8.1 52.4 AD-60953 22.0 56.7 8.3 18.0 AD-60954 23.3 55.8 5.3 31.7 AD-60955 110.8 117.5 1.6 38.7 AD-60956 15.8 29.6 1.7 10.2 AD-60957 22.3 58.3 1.5 6.1 AD-60958 106.4 136.0 24.1 61.7 AD-60959 79.6 123.3 0.6 49.9 AD-60960 17.4 49.4 8.6 10.2 AD-60961 107.7 129.0 6.6 50.5 AD-60962 90.2 113.3 8.0 67.2 AD-60963 117.4 138.1 2.6 16.8 AD-60964 80.7 123.2 24.2 18.9 AD-60965 30.1 80.2 9.0 20.8 AD-60966 54.1 133.6 4.6 44.0 AD-60967 122.2 147.4 11.7 42.0 AD-60968 86.9 142.0 39.9 49.7 AD-60969 106.2 116.3 16.6 39.1 AD-60970 54.6 112.6 7.3 11.8 AD-60971 50.5 118.8 6.9 47.0 AD-60972 55.6 94.2 6.5 3.4 AD-60973 126.1 133.6 8.0 36.8 AD-60974 82.6 115.0 8.7 43.7 AD-60975 88.2 114.3 13.6 43.9 AD-60976 46.3 71.0 11.6 30.2 AD-60977 13.5 26.4 3.4 9.2 AD-60978 72.7 92.9 6.4 31.7 AD-60979 103.8 97.0 13.7 29.2 AD-60980 28.4 58.0 12.3 21.1 AD-60981 56.0 80.6 18.3 4.5 AD-60982 102.4 137.4 15.2 16.4 AD-60983 60.8 87.1 10.1 20.3 AD-60984 53.6 116.7 1.2 47.8 AD-60985 72.6 99.2 0.7 21.7 AD-60986 90.1 96.4 6.6 29.5 AD-60987 83.1 90.7 1.6 13.7 AD-60988 69.4 102.3 2.4 55.4 AD-60989 112.4 105.7 0.6 14.7 AD-60990 90.4 93.4 6.2 4.1 AD-60991 97.6 95.6 15.5 23.4 AD-60992 104.0 131.4 6.9 33.7 AD-60993 118.6 129.2 10.5 30.1 AD-60994 25.9 57.2 6.8 0.3 AD-60996 77.3 94.2 7.8 12.6 AD-60997 60.1 80.9 18.8 7.5 AD-60998 32.6 61.4 5.7 24.6 AD-60999 133.6 110.9 39.7 15.4 AD-61000 55.8 117.6 14.2 24.9 AD-61001 57.9 85.2 8.1 42.0 AD-61002 15.4 31.4 1.5 10.1 AD-61003 82.3 98.1 4.0 11.8 AD-61004 106.4 97.7 38.5 18.8 AD-61005 138.0 141.2 65.7 20.0 AD-61006 31.7 70.9 7.8 6.6

Example 7. In Vivo Effect of Single Dose Administration of TMPRSS6 iRNA Agent

[0679] Female C57BL/6 mice were administered a single subcutaneous injection of AD-60940 at a dose of 0.3 mg/kg, 1.0 mg/kg or 3.0 mg/kg, or PBS alone as a control. Three mice were evaluated per dose for hepatic TMPRSS6 mRNA, hepatic hepcidin mRNA, serum hepcidin, total serum iron, and percent transferrin saturation at various time points. Mice receiving 1.0 mg/kg or 3.0 mg/kg of AD-60940 or PBS were evaluated at day 0 (pre-treatment) and 7, 11, 14 and 21 days after treatment. Mice receiving 0.3 mg/kg AD-60940 were evaluated at day 0 (pre-treatment) and at 7 and 11 days after treatment. Hepatic TMPRSS6 mRNA and hepatic hepcidin mRNA levels were determined by qPCR, normalized to GAPDH mRNA levels and expressed relative to the mRNA levels in mice administered PBS alone. Serum hepcidin was measured by ELISA (Intrinsic Life Sciences). Total serum iron and percent transferrin saturation (% TfSat) were measured using an Olympus AU400 Serum Chemistry Analyzer. Each data point represents the mean value from three mice. The standard deviation of the mean is represented by error bars.

[0680] Single dose administration of AD-60940 resulted in robust and durable suppression of hepatic TMPRSS6 mRNA relative to the control. TMPRSS6 mRNA concentration was suppressed by greater than 90% for up to three weeks following administration of the 3.0 mg/kg dose (FIG. 3A). As a result of the suppression of hepatic TMPRSS6 mRNA concentration, hepcidin mRNA levels, increased two-fold relative to the control (FIG. 3B), and serum hepcidin concentration increased greater than 2-fold relative to the control (FIG. 3C). In addition, total serum iron (FIG. 3D) decreased and percent transferrin saturation decreased by greater than 50% relative to the control (FIG. 3E). The decreases in total serum iron and percent transferring saturation were durable for up to three weeks following administration of AD-60940. FIG. 3F demonstrates the relative hepatic TMPRSS6 mRNA concentration as a function of AD-60940 dose at 11 days following administration. Each data point represents the maximum suppression of TMPRSS6 mRNA concentration observed at each dose level. The data were fit to the Hill equation.

[0681] The degree to which AD-60940 modulates hepcidin and serum iron mobilization is nearly identical to that observed in the previous Hbb.sup.th3/+ mouse studies (Schmidt et al., Blood (2013), 121(7), 1200-1208) and indicates that AD-60940 is a potent RNAi therapeutic for producing disease modifying effects in .beta.-Thalassemia.

Example 8. In Vivo Effect of Multi-Dose Administration of TMPRSS6 iRNA Agent

[0682] Female C57BL/6 mice were administered a subcutaneous injection of AD-60940 at a dose of 0.3 mg/kg, 1.0 mg/kg, or PBS alone (as a control) once per week for three weeks then sacrificed 7 days after the final dose (FIG. 4A). Three mice per dose were evaluated for hepatic TMPRSS6 mRNA, hepatic hepcidin mRNA, and percent transferrin saturation. Hepatic TMPRSS6 mRNA and hepatic hepcidin mRNA levels were determined by qPCR, normalized to GAPDH mRNA levels and expressed relative to the mRNA levels in mice administered PBS alone. Percent transferrin saturation (% TfSat) was measured using an Olympus AU400 Serum Chemistry Analyzer. Each data point represents the mean value from three mice. The standard deviation of the mean is represented by error bars.

[0683] Multi-dose administration of 1.0 mg/kg AD-60940 resulted in greater than 90% suppression of TMPRSS6 mRNA concentration (FIG. 4B). Hepcidin mRNA concentration increased two-fold and percent transferrin saturation decreased by greater than 50% relative to the control (FIG. 4B). FIG. 4C demonstrates the relative hepatic TMPRSS6 mRNA concentration as a function of AD-60940 dose. The data were fit to the Hill equation. These data indicate that the multi-dose ED80 is less than 1.0 mg/kg.

[0684] This study demonstrates that AD-60940 exhibits robust and durable suppression of TMPRSS6, resulting in hepcidin induction and systemic iron restriction and indicates that AD-60940 is a potent RNAi therapeutic for producing disease modifying effects in .beta.-Thalassemia.

Example 9. Relationship Between Liver TMPRSS6 mRNA Levels and Serum Hepcidin Concentration and Percent Transferrin Saturation

[0685] Data generated using AD-59743, AD-61002, AD-60940, and other TMPRSS6 iRNA agents were further analyzed to evaluate the relationship between liver TMPRSS6 mRNA levels and serum hepcidin levels and percent transferrin saturation. Serum hepcidin concentration demonstrated a non-linear relationship to TMPRSS6 mRNA levels using the Hill equation (FIG. 5A). The percent transferrin saturation demonstrated a linear relationship to TMPRSS6 mRNA levels when fit to a simple linear regression equation (FIG. 5B). The linear relationship between TMPRSS6 mRNA levels and percent transferrin saturation indicate that iron restriction can be precisely and predictably modulated by AD-60940. Serum hepcidin concentration and relative hepcidin mRNA levels also demonstrated a linear relationship when fit to a simple linear regression equation (FIG. 5C). In contrast, the relationship between percent transferrin saturation and serum hepcidin concentration was non-linear and fit to the Hill equation (FIG. 5D).

Example 10. In Vivo Single Dose Screen

[0686] TMPRSS6 siRNA duplexes as indicated in FIG. 6 were evaluated for efficacy by their ability to suppress levels of TMPRSS6 mRNA in the liver of female C57BL/6 mice following administration of the siRNA duplex. A single subcutaneous dose of 3 mg/kg of TMPRSS6 siRNA duplex was administered, and the mice were sacrificed 7 days later. The level of TMPRSS6 mRNA in the liver was measured by qPCR using the methods described above. Mice in a control group received an injection of PBS.

[0687] The levels of TMPRSS6 mRNA following administration of a TMPRSS6 siRNA duplex are shown in FIG. 6. The results demonstrate that administration of AD-60940, AD-59743 and AD-61002 resulted in substantial suppression of liver TMPRSS6 mRNA with AD60940 producing the greatest silencing. Specifically, TMPRSS6 siRNA duplex AD-60940 reduced TMPRSS6 mRNA by greater than 80% relative to the control. The data also demonstrate that treatment with AD-59743, AD-60940, AD-61002, AD-60994, AD-60998 and AD-61001 result in a decrease in the level of TMPRSS6 transcript that is maintained through day 7.

Example 11. In Vivo Multi-Dose Screen

[0688] TMPRSS6 siRNA duplexes as indicated in FIG. 7 were evaluated for efficacy by their ability to suppress levels of TMPRSS6 mRNA in the liver of wild-type C57BL/6 mice following administration of the siRNA duplex. A subcutaneous dose of either 0.3 mg/kg or 1.0 mg/kg of TMPRSS6 siRNA duplex was administered once a week for three weeks. The mice were sacrificed 7 days after the last dose. The level of TMPRSS6 mRNA in the liver was measured by qPCR using the methods described above. Mice in a control group received an injection of PBS.

[0689] The levels of TMPRSS6 mRNA following administration of a TMPRSS6 siRNA duplex are shown in FIG. 7. The results demonstrate that the 1.0 mg/kg dosing regimen of TMPRSS6 siRNA duplex AD-60940 reduces TMPRSS6 mRNA by greater than 80% relative to the control.

Example 12. Optimization of AD-60940

[0690] Based on the observation that administration of AD-60940 durably reduced TMPRSS6 mRNA by greater than 80% relative to the control, additional siRNAs based on the parent sequence of AD-60940 with a variety of chemical modifications were evaluated for efficacy in single dose screens at 10 nM and 0.1 nM by transfection in Hep3B cells. The sequences of the sense and antisense strands of these agents are shown in Table 8 and the results of this screen are shown in Table 9. The data in Table 9 are expressed as the average fraction message remaining relative to control.

[0691] In addition, a subset of siRNA described in Tables 4 and 5, above, were modified to replace a 2'F with a 2'OMe modification at the 5'-end of the sense strand and to add a 5'-phosphate on the antisense strand. These siRNA agents were also evaluated for in vitro efficacy in single dose screens at 10 nM and 0.1 nM by transfection in Hep3B cells. The sequences of the sense and antisense strands of these agents are shown in Table 10 and the results of this screen are shown in Table 11. The data in Table 11 are expressed as the average fraction message remaining relative to control.

TABLE-US-00010 TABLE 8 TMSPRSS6 Modified Sequences SEQ SEQ ID ID DuplexID SenseID Sense Sequence NO: AntisenseID Antisense Sequence NO: AD-63214 A-126586.2 Y44CfsusGfgUfaUfuUf 487 A-126587.2 PusUfsgUfaCfcCfuAfg 544 CfCfuAfgGfgUfaCfaAf gaAfaUfaCfcAfgsasg L96 AD-63240 A-122745.11 CfsusGfgUfaUfuUfCfC 488 A-126607.1 usUfsguaCfcCfuAfgga 545 fuAfgGfgUfaCfaAfL96 AfaUfaccagsasg AD-63209 A-126594.1 csusgguaUfuUfCfCfua 489 A-122746.13 usUfsgUfaCfcCfuAfgg 546 ggGfdTacaaL96 aAfaUfaCfcAfgsasg AD-63208 A-122745.6 CfsusGfgUfaUfuUfCfC 490 A-126587.1 PusUfsgUfaCfcCfuAfg 547 fuAfgGfgUfaCfaAfL96 gaAfaUfaCfcAfgsasg AD-63202 A-126586.1 Y44CfsusGfgUfaUfuUf 491 A-122746.6 usUfsgUfaCfcCfuAfgg 548 CfCfuAfgGfgUfaCfaAf aAfaUfaCfcAfgsasg L96 AD-63216 A-122745.7 CfsusGfgUfaUfuUfCfC 492 A-126603.1 usUfsgUfaCfccuAfgga 549 fuAfgGfgUfaCfaAfL96 AfaUfaCfcAfgsasg AD-63219 A-126617.1 gsgsUfaUfuUfCfCfuAf 493 A-126618.1 PusUfsgUfaCfcCfuAfg 550 gGfgUfaCfaAfL96 gaAfaUfaCfcsasg AD-63228 A-122745.9 CfsusGfgUfaUfuUfCfC 494 A-126605.1 usUfsgUfaCfcCfuAfgg 551 fuAfgGfgUfaCfaAfL96 aAfaUfaccagsasg AD-63205 A-122745.13 CfsusGfgUfaUfuUfCfC 495 A-126609.1 usUfsgUfaccCfuaggaA 552 fuAfgGfgUfaCfaAfL96 faUfaccAfgsasg AD-63241 A-126589.2 csusgguaUfuUfCfCfua 496 A-126611.3 usUfsguaCfccUfaggaA 553 ggGfuacaaL96 faUfaccagsasg AD-63243 A-126621.3 csusGfguaUfuUfCfCfu 497 A-126624.1 usUfsGfuaCfcCfuAfgg 554 AfgGfguAfcaaL96 aAfAfuaCfcAfgsasg AD-63203 A-126593.1 csusgguaUfuUfCfCfua 498 A-122746.12 usUfsgUfaCfcCfuAfgg 555 ggGfuadCaaL96 aAfaUfaCfcAfgsasg AD-63223 A-122745.16 CfsusGfgUfaUfuUfCfC 499 A-126612.1 usUfsguaCfccuaggaAf 556 fuAfgGfgUfaCfaAfL96 aUfaccagsasg AD-63231 A-126621.1 csusGfguaUfuUfCfCfu 500 A-126622.1 usUfsGfuaCfcCfuAfgg 557 AfgGfguAfcaaL96 aAfaUfaCfcAfgsasg AD-63199 A-122745.12 CfsusGfgUfaUfuUfCfC 501 A-126608.1 usUfsgUfaccCfuAfgga 558 fuAfgGfgUfaCfaAfL96 AfaUfaccAfgsasg AD-63217 A-122745.15 CfsusGfgUfaUfuUfCfC 502 A-126611.1 usUfsguaCfccUfaggaA 559 fuAfgGfgUfaCfaAfL96 faUfaccagsasg AD-63229 A-122745.17 CfsusGfgUfaUfuUfCfC 503 A-126613.1 usUfsguaCfcCfUfagga 560 fuAfgGfgUfaCfaAfL96 AfaUfaccagsasg AD-63255 A-126621.5 csusGfguaUfuUfCfCfu 504 A-126626.1 usUfsGfuAfCfcCfuAfg 561 AfgGfguAfcaaL96 gaAfAfuaCfcAfgsasg AD-63226 A-126589.1 csusgguaUfuUfCfCfua 505 A-122746.8 usUfsgUfaCfcCfuAfgg 562 ggGfuacaaL96 aAfaUfaCfcAfgsasg AD-63211 A-122745.14 CfsusGfgUfaUfuUfCfC 506 A-126610.1 usUfsgUfacccuAfggaA 563 fuAfgGfgUfaCfaAfL96 faUfaccAfgsasg AD-63273 A-126621.8 csusGfguaUfuUfCfCfu 507 A-126629.1 usUfsGfuaCfcCfuAfgg 564 AfgGfguAfcaaL96 aAfAfuAfccagsasg AD-60940 A-122745.1 CfsusGfgUfaUfuUfCfC 508 A-122746.1 usUfsgUfaCfcCfuAfgg 565 fuAfgGfgUfaCfaAfL96 aAfaUfaCfcAfgsasg AD-63249 A-126621.4 csusGfguaUfuUfCfCfu 509 A-126625.1 usUfsGfuAfCfcCfuAfg 566 AfgGfguAfcaaL96 gaAfAfuAfCfcAfgsasg AD-63256 A-122745.19 CfsusGfgUfaUfuUfCfC 510 A-126634.1 usUfsgUfaccCfuAfgga 567 fuAfgGfgUfaCfaAfL96 AfaUfaCfcAfgsasg AD-63280 A-126639.1 csusGfgUfaUfuUfCfCf 511 A-126587.3 PusUfsgUfaCfcCfuAfg 568 uAfgGfgUfaCfaAfL96 gaAfaUfaCfcAfgsasg AD-63237 A-126621.2 csusGfguaUfuUfCfCfu 512 A-126623.1 usUfsGfuAfCfcCfuAfg 569 AfgGfguAfcaaL96 gaAfaUfaCfcAfgsasg AD-63285 A-126621.10 csusGfguaUfuUfCfCfu 513 A-126631.1 usUfsGfuaCfcCfuAfgg 570 AfgGfguAfcaaL96 aAfAfuAfccAfgsasg AD-63215 A-126595.1 csusgguaUfuUfCfdCua 514 A-122746.14 usUfsgUfaCfcCfuAfgg 571 ggGfuacaaL96 aAfaUfaCfcAfgsasg AD-63222 A-122745.8 CfsusGfgUfaUfuUfCfC 515 A-126604.1 usUfsguaCfcCfuAfgga 572 fuAfgGfgUfaCfaAfL96 AfaUfaccAfgsasg AD-63232 A-126590.1 csusgguAfuuUfcCfUfa 516 A-122746.9 usUfsgUfaCfcCfuAfgg 573 gGfGfuacaaL96 aAfaUfaCfcAfgsasg AD-63218 A-126594.2 csusgguaUfuUfCfCfua 517 A-126611.7 usUfsguaCfccUfaggaA 574 ggGfdTacaaL96 faUfaccagsasg AD-63261 A-126621.6 csusGfguaUfuUfCfCfu 518 A-126627.1 usUfsGfuaCfcCfuAfgg 575 AfgGfguAfcaaL96 aAfAfuAfCfcagsasg AD-63267 A-126621.7 csusGfguaUfuUfCfCfu 519 A-126628.1 usUfsGfuAfCfcCfuAfg 576 AfgGfguAfcaaL96 gaAfAfuAfCfcagsasg AD-63234 A-122745.10 CfsusGfgUfaUfuUfCfC 520 A-126606.1 usUfsguaCfccuAfggaA 577 fuAfgGfgUfaCfaAfL96 faUfaccAfgsasg AD-63250 A-122745.18 CfsusGfgUfaUfuUfCfC 521 A-126633.1 ususgUfaCfcCfuAfgga 578 fuAfgGfgUfaCfaAfL96 AfaUfaCfcAfgsasg AD-63212 A-126593.2 csusgguaUfuUfCfCfua 522 A-126611.6 usUfsguaCfccUfaggaA 579 ggGfuadCaaL96 faUfaccagsasg AD-63210 A-126602.1 csusgguauuucdCuaggg 523 A-122746.21 usUfsgUfaCfcCfuAfgg 580 (Tgn)acaaL96 aAfaUfaCfcAfgsasg AD-63244 A-126621.11 csusGfguaUfuUfCfCfu 524 A-126632.1 usUfsGfuAfCfcCfuAfg 581 AfgGfguAfcaaL96 gaAfAfuAfccAfgsasg AD-63235 A-126588.2 csusgguAfuuuCfCfuAf 525 A-126611.2 usUfsguaCfccUfaggaA 582 ggGfuacaaL96 faUfaccagsasg AD-63279 A-126621.9 csusGfguaUfuUfCfCfu 526 A-126630.1 usUfsGfuAfCfcCfuAfg 583 AfgGfguAfcaaL96 gaAfAfuAfccagsasg AD-63227 A-126597.1 csusgguAfuuucCfuagg 527 A-122746.16 usUfsgUfaCfcCfuAfgg 584 gdTacaaL96 aAfaUfaCfcAfgsasg AD-63220 A-126588.1 csusgguAfuuuCfCfuAf 528 A-122746.7 usUfsgUfaCfcCfuAfgg 585 ggGfuacaaL96 aAfaUfaCfcAfgsasg AD-63238 A-126591.1 csusgguAfuuucCfuagg 529 A-122746.10 usUfsgUfaCfcCfuAfgg 586 guacaaL96 aAfaUfaCfcAfgsasg AD-63242 A-126598.2 csusgguAfuuucCfdTag 530 A-126611.11 usUfsguaCfccUfaggaA 587 gguacaaL96 faUfaccagsasg AD-63239 A-126599.1 csusgguauuucCfdTagg 531 A-122746.18 usUfsgUfaCfcCfuAfgg 588 guacaaL96 aAfaUfaCfcAfgsasg AD-63233 A-126598.1 csusgguAfuuucCfdTag 532 A-122746.17 usUfsgUfaCfcCfuAfgg 589 gguacaaL96 aAfaUfaCfcAfgsasg AD-63268 A-126636.1 CfsusGfgUfaUfuUfCfc 533 A-122746.22 usUfsgUfaCfcCfuAfgg 590 uAfgGfgUfaCfaAfL96 aAfaUfaCfcAfgsasg AD-63221 A-126596.1 csusgguAfuuucCfuagg 534 A-122746.15 usUfsgUfaCfcCfuAfgg 591 guadCaaL96 aAfaUfaCfcAfgsasg AD-63236 A-126597.2 csusgguAfuuucCfuagg 535 A-126611.10 usUfsguaCfccUfaggaA 592 gdTacaaL96 faUfaccagsasg AD-63197 A-126592.1 csusgguauuucCfUfagg 536 A-122746.11 usUfsgUfaCfcCfuAfgg 593 guacaaL96 aAfaUfaCfcAfgsasg AD-63224 A-126595.2 csusgguaUfuUfCfdCua 537 A-126611.8 usUfsguaCfccUfaggaA 594 ggGfuacaaL96 faUfaccagsasg AD-63200 A-126590.2 csusgguAfuuUfcCfUfa 538 A-126611.4 usUfsguaCfccUfaggaA 595 gGfGfuacaaL96 faUfaccagsasg AD-63262 A-122745.20 CfsusGfgUfaUfuUfCfC 539 A-126635.1 usUfsgUfaCfcCfuAfgg 596 fuAfgGfgUfaCfaAfL96 aaaUfaCfcAfgsasg AD-63204 A-126601.1 csusgguauuucdCuaggg 540 A-122746.20 usUfsgUfaCfcCfuAfgg 597 uacaaL96 aAfaUfaCfcAfgsasg AD-63230 A-126596.2 csusgguAfuuucCfuagg 541 A-126611.9 usUfsguaCfccUfaggaA 598 guadCaaL96 faUfaccagsasg AD-63198 A-126600.1 csusgguauuucdCdTagg 542 A-122746.19 usUfsgUfaCfcCfuAfgg 599 guacaaL96 aAfaUfaCfcAfgsasg AD-63206 A-126591.2 csusgguAfuuucCfuagg 543 A-126611.5 usUfsguaCfccUfaggaA 600 guacaaL96 faUfaccagsasg

TABLE-US-00011 TABLE 9 TMPRSS6 Single Dose Screen 10 nM 0.1 nM DuplexID Avg Avg AD-63214 12.40 19.46 AD-63240 12.29 27.03 AD-63209 17.11 23.38 AD-63208 14.77 23.31 AD-63202 14.87 27.08 AD-63216 15.97 34.05 AD-63219 18.47 27.82 AD-63228 19.44 34.52 AD-63205 15.44 38.23 AD-63241 18.81 41.42 AD-63243 19.15 30.87 AD-63203 17.06 42.12 AD-63223 21.98 27.52 AD-63231 22.42 30.68 AD-63199 17.74 39.50 AD-63217 18.81 38.99 AD-63229 22.33 33.42 AD-63255 21.06 34.31 AD-63226 18.36 41.65 AD-63211 26.00 32.07 AD-63273 23.11 34.96 AD-60940 22.99 34.34 AD-63249 30.83 28.35 AD-63256 23.18 35.19 AD-63280 25.10 32.42 AD-63237 23.95 35.43 AD-63285 21.53 39.60 AD-63215 29.27 42.54 AD-63222 23.88 38.24 AD-63232 30.29 35.04 AD-63218 27.02 37.31 AD-63261 24.22 46.61 AD-63267 28.32 38.90 AD-63234 24.42 55.83 AD-63250 26.77 47.92 AD-63212 28.43 46.01 AD-63210 27.91 44.35 AD-63244 30.66 45.65 AD-63235 32.75 51.82 AD-63279 38.00 48.80 AD-63227 33.15 58.12 AD-63220 38.31 54.08 AD-63238 45.56 51.50 AD-63242 47.96 54.26 AD-63239 51.98 49.22 AD-63233 51.37 65.83 AD-63268 41.22 82.16 AD-63221 57.02 65.11 AD-63236 49.86 71.66 AD-63197 47.67 78.29 AD-63224 67.73 60.88 AD-63200 62.89 67.68 AD-63262 64.25 79.72 AD-63204 68.01 80.99 AD-63230 66.88 81.04 AD-63198 65.67 78.28 AD-63206 65.10 82.71

TABLE-US-00012 TABLE 10 TMPRSS6 Modified Sequences SEQ SEQ ID ID DuplexID SenseID Sense Sequence NO: AntisenseID Antisense Sequence NO: AD-63214 A-126586.2 Y44CfsusGfgUfaUfuUf 601 A-126587.2 PusUfsgUfaCfcCfuAfg 658 CfCfuAfgGfgUfaCfaAf gaAfaUfaCfcAfgsasg L96 AD-63240 A-122745.11 CfsusGfgUfaUfuUfCfC 602 A-126607.1 usUfsguaCfcCfuAfgga 659 fuAfgGfgUfaCfaAfL96 AfaUfaccagsasg AD-63209 A-126594.1 csusgguaUfuUfCfCfua 603 A-122746.13 usUfsgUfaCfcCfuAfgg 660 ggGfdTacaaL96 aAfaUfaCfcAfgsasg AD-63208 A-122745.6 CfsusGfgUfaUfuUfCfC 604 A-126587.1 PusUfsgUfaCfcCfuAfg 661 fuAfgGfgUfaCfaAfL96 gaAfaUfaCfcAfgsasg AD-63202 A-126586.1 Y44CfsusGfgUfaUfuUf 605 A-122746.6 usUfsgUfaCfcCfuAfgg 662 CfCfuAfgGfgUfaCfaAf aAfaUfaCfcAfgsasg L96 AD-63216 A-122745.7 CfsusGfgUfaUfuUfCfC 606 A-126603.1 usUfsgUfaCfccuAfgga 663 fuAfgGfgUfaCfaAfL96 AfaUfaCfcAfgsasg AD-63219 A-126617.1 gsgsUfaUfuUfCfCfuAf 607 A-126618.1 PusUfsgUfaCfcCfuAfg 664 gGfgUfaCfaAfL96 gaAfaUfaCfcsasg AD-63228 A-122745.9 CfsusGfgUfaUfuUfCfC 608 A-126605.1 usUfsgUfaCfcCfuAfgg 665 fuAfgGfgUfaCfaAfL96 aAfaUfaccagsasg AD-63205 A-122745.13 CfsusGfgUfaUfuUfCfC 609 A-126609.1 usUfsgUfaccCfuaggaA 666 fuAfgGfgUfaCfaAfL96 faUfaccAfgsasg AD-63241 A-126589.2 csusgguaUfuUfCfCfua 610 A-126611.3 usUfsguaCfccUfaggaA 667 ggGfuacaaL96 faUfaccagsasg AD-63243 A-126621.3 csusGfguaUfuUfCfCfu 611 A-126624.1 usUfsGfuaCfcCfuAfgg 668 AfgGfguAfcaaL96 aAfAfuaCfcAfgsasg AD-63203 A-126593.1 csusgguaUfuUfCfCfua 612 A-122746.12 usUfsgUfaCfcCfuAfgg 669 ggGfuadCaaL96 aAfaUfaCfcAfgsasg AD-63223 A-122745.16 CfsusGfgUfaUfuUfCfC 613 A-126612.1 usUfsguaCfccuaggaAf 670 fuAfgGfgUfaCfaAfL96 aUfaccagsasg AD-63231 A-126621.1 csusGfguaUfuUfCfCfu 614 A-126622.1 usUfsGfuaCfcCfuAfgg 671 AfgGfguAfcaaL96 aAfaUfaCfcAfgsasg AD-63199 A-122745.12 CfsusGfgUfaUfuUfCfC 615 A-126608.1 usUfsgUfaccCfuAfgga 672 fuAfgGfgUfaCfaAfL96 AfaUfaccAfgsasg AD-63217 A-122745.15 CfsusGfgUfaUfuUfCfC 616 A-126611.1 usUfsguaCfccUfaggaA 673 fuAfgGfgUfaCfaAfL96 faUfaccagsasg AD-63229 A-122745.17 CfsusGfgUfaUfuUfCfC 617 A-126613.1 usUfsguaCfcCfUfagga 674 fuAfgGfgUfaCfaAfL96 AfaUfaccagsasg AD-63255 A-126621.5 csusGfguaUfuUfCfCfu 618 A-126626.1 usUfsGfuAfCfcCfuAfg 675 AfgGfguAfcaaL96 gaAfAfuaCfcAfgsasg AD-63226 A-126589.1 csusgguaUfuUfCfCfua 619 A-122746.8 usUfsgUfaCfcCfuAfgg 676 ggGfuacaaL96 aAfaUfaCfcAfgsasg AD-63211 A-122745.14 CfsusGfgUfaUfuUfCfC 620 A-126610.1 usUfsgUfacccuAfggaA 677 fuAfgGfgUfaCfaAfL96 faUfaccAfgsasg AD-63273 A-126621.8 csusGfguaUfuUfCfCfu 621 A-126629.1 usUfsGfuaCfcCfuAfgg 678 AfgGfguAfcaaL96 aAfAfuAfccagsasg AD-60940 A-122745.1 CfsusGfgUfaUfuUfCfC 622 A-122746.1 usUfsgUfaCfcCfuAfgg 679 fuAfgGfgUfaCfaAfL96 aAfaUfaCfcAfgsasg AD-63249 A-126621.4 csusGfguaUfuUfCfCfu 623 A-126625.1 usUfsGfuAfCfcCfuAfg 680 AfgGfguAfcaaL96 gaAfAfuAfCfcAfgsasg AD-63256 A-122745.19 CfsusGfgUfaUfuUfCfC 624 A-126634.1 usUfsgUfaccCfuAfgga 681 fuAfgGfgUfaCfaAfL96 AfaUfaCfcAfgsasg AD-63280 A-126639.1 csusGfgUfaUfuUfCfCf 625 A-126587.3 PusUfsgUfaCfcCfuAfg 682 uAfgGfgUfaCfaAfL96 gaAfaUfaCfcAfgsasg AD-63237 A-126621.2 csusGfguaUfuUfCfCfu 626 A-126623.1 usUfsGfuAfCfcCfuAfg 683 AfgGfguAfcaaL96 gaAfaUfaCfcAfgsasg AD-63285 A-126621.10 csusGfguaUfuUfCfCfu 627 A-126631.1 usUfsGfuaCfcCfuAfgg 684 AfgGfguAfcaaL96 aAfAfuAfccAfgsasg AD-63215 A-126595.1 csusgguaUfuUfCfdCua 628 A-122746.14 usUfsgUfaCfcCfuAfgg 685 ggGfuacaaL96 aAfaUfaCfcAfgsasg AD-63222 A-122745.8 CfsusGfgUfaUfuUfCfC 629 A-126604.1 usUfsguaCfcCfuAfgga 686 fuAfgGfgUfaCfaAfL96 AfaUfaccAfgsasg AD-63232 A-126590.1 csusgguAfuuUfcCfUfa 630 A-122746.9 usUfsgUfaCfcCfuAfgg 687 gGfGfuacaaL96 aAfaUfaCfcAfgsasg AD-63218 A-126594.2 csusgguaUfuUfCfCfua 631 A-126611.7 usUfsguaCfccUfaggaA 688 ggGfdTacaaL96 faUfaccagsasg AD-63261 A-126621.6 csusGfguaUfuUfCfCfu 632 A-126627.1 usUfsGfuaCfcCfuAfgg 689 AfgGfguAfcaaL96 aAfAfuAfCfcagsasg AD-63267 A-126621.7 csusGfguaUfuUfCfCfu 633 A-126628.1 usUfsGfuAfCfcCfuAfg 690 AfgGfguAfcaaL96 gaAfAfuAfCfcagsasg AD-63234 A-122745.10 CfsusGfgUfaUfuUfCfC 634 A-126606.1 usUfsguaCfccuAfggaA 691 fuAfgGfgUfaCfaAfL96 faUfaccAfgsasg AD-63250 A-122745.18 CfsusGfgUfaUfuUfCfC 635 A-126633.1 ususgUfaCfcCfuAfgga 692 fuAfgGfgUfaCfaAfL96 AfaUfaCfcAfgsasg AD-63212 A-126593.2 csusgguaUfuUfCfCfua 636 A-126611.6 usUfsguaCfccUfaggaA 693 ggGfuadCaaL96 faUfaccagsasg AD-63210 A-126602.1 csusgguauuucdCuaggg 637 A-122746.21 usUfsgUfaCfcCfuAfgg 694 (Tgn)acaaL96 aAfaUfaCfcAfgsasg AD-63244 A-126621.11 csusGfguaUfuUfCfCfu 638 A-126632.1 usUfsGfuAfCfcCfuAfg 695 AfgGfguAfcaaL96 gaAfAfuAfccAfgsasg AD-63235 A-126588.2 csusgguAfuuuCfCfuAf 639 A-126611.2 usUfsguaCfccUfaggaA 696 ggGfuacaaL96 faUfaccagsasg AD-63279 A-126621.9 csusGfguaUfuUfCfCfu 640 A-126630.1 usUfsGfuAfCfcCfuAfg 697 AfgGfguAfcaaL96 gaAfAfuAfccagsasg AD-63227 A-126597.1 csusgguAfuuucCfuagg 641 A-122746.16 usUfsgUfaCfcCfuAfgg 698 gdTacaaL96 aAfaUfaCfcAfgsasg AD-63220 A-126588.1 csusgguAfuuuCfCfuAf 642 A-122746.7 usUfsgUfaCfcCfuAfgg 699 ggGfuacaaL96 aAfaUfaCfcAfgsasg AD-63238 A-126591.1 csusgguAfuuucCfuagg 643 A-122746.10 usUfsgUfaCfcCfuAfgg 700 guacaaL96 aAfaUfaCfcAfgsasg AD-63242 A-126598.2 csusgguAfuuucCfdTag 644 A-126611.11 usUfsguaCfccUfagga 701 gguacaaL96 AfaUfaccagsasg AD-63239 A-126599.1 csusgguauuucCfdTagg 645 A-122746.18 usUfsgUfaCfcCfuAfgg 702 guacaaL96 aAfaUfaCfcAfgsasg AD-63233 A-126598.1 csusgguAfuuucCfdTag 646 A-122746.17 usUfsgUfaCfcCfuAfgg 703 gguacaaL96 aAfaUfaCfcAfgsasg AD-63268 A-126636.1 CfsusGfgUfaUfuUfCfc 647 A-122746.22 usUfsgUfaCfcCfuAfgg 704 uAfgGfgUfaCfaAfL96 aAfaUfaCfcAfgsasg AD-63221 A-126596.1 csusgguAfuuucCfuagg 648 A-122746.15 usUfsgUfaCfcCfuAfgg 705 guadCaaL96 aAfaUfaCfcAfgsasg AD-63236 A-126597.2 csusgguAfuuucCfuagg 649 A-126611.10 usUfsguaCfccUfaggaA 706 gdTacaaL96 faUfaccagsasg AD-63197 A-126592.1 csusgguauuucCfUfagg 650 A-122746.11 usUfsgUfaCfcCfuAfgg 707 guacaaL96 aAfaUfaCfcAfgsasg AD-63224 A-126595.2 csusgguaUfuUfCfdCua 651 A-126611.8 usUfsguaCfccUfaggaA 708 ggGfuacaaL96 faUfaccagsasg AD-63200 A-126590.2 csusgguAfuuUfcCfUfa 652 A-126611.4 usUfsguaCfccUfaggaA 709 gGfGfuacaaL96 faUfaccagsasg AD-63262 A-122745.20 CfsusGfgUfaUfuUfCfC 653 A-126635.1 usUfsgUfaCfcCfuAfgg 710 fuAfgGfgUfaCfaAfL96 aaaUfaCfcAfgsasg AD-63204 A-126601.1 csusgguauuucdCuaggg 654 A-122746.20 usUfsgUfaCfcCfuAfgg 711 uacaaL96 aAfaUfaCfcAfgsasg AD-63230 A-126596.2 csusgguAfuuucCfuagg 655 A-126611.9 usUfsguaCfccUfaggaA 712 guadCaaL96 faUfaccagsasg AD-63198 A-126600.1 csusgguauuucdCdTagg 656 A-122746.19 usUfsgUfaCfcCfuAfgg 713 guacaaL96 aAfaUfaCfcAfgsasg AD-63206 A-126591.2 csusgguAfuuucCfuagg 657 A-126611.5 usUfsguaCfccUfaggaA 714 guacaaL96 faUfaccagsasg

TABLE-US-00013 TABLE 11 TMPRSS6 Single Dose Screen 10 nM 0.1 nM DuplexID Avg SD Avg SD AD-60998 26.1 3.1 42.9 13.3 AD-60970 24.3 9.3 39.0 24.2 AD-61002 27.5 8.5 32.1 9.8 AD-60994 19.9 5.8 28.2 9.3 AD-60992 57.9 15.4 67.5 13.6 AD-61006 25.8 2.5 33.4 8.7 AD-59743 21.1 3.2 31.7 8.1 AD-60966 64.6 15.6 76.0 18.2 AD-60952 44.1 10.7 76.9 16.5 AD-61000 37.2 5.8 43.3 12.7 AD-60949 94.9 22.3 91.3 13.2 AD-60969 100.7 18.5 124.5 43.0 AD-60967 93.7 6.4 112.1 31.5 AD-60984 44.7 21.4 58.2 9.6 AD-60943 65.6 11.0 61.7 9.8 AD-61001 69.2 8.3 100.8 8.4 AD-60986 38.9 13.9 58.9 4.8 AD-60988 61.7 12.0 68.6 15.2 AD-60993 92.1 13.1 86.5 10.0 AD-60987 113.9 15.3 97.9 21.0 AD-60997 54.8 7.2 75.8 16.4 AD-60973 61.5 15.7 80.8 9.3 AD-61005 116.8 23.4 128.1 10.8 AD-60985 71.2 15.1 78.7 14.6 AD-61003 101.0 15.2 97.5 15.8 AD-60989 75.8 9.8 97.2 20.8 AD-60955 108.6 23.4 102.0 16.6 AD-60991 96.6 19.4 95.6 12.4 AD-61004 111.1 6.4 110.9 18.3 AD-60961 96.9 36.0 84.1 28.2 AD-60999 106.7 12.7 92.3 24.6 AD-60990 92.9 38.4 97.6 16.8 AD-60996 71.2 7.5 101.5 8.9

Example 13. Optimization of AD-60940

[0692] Additional duplexes targeting TMPRSS6 were produced and screened in vitro for efficacy using the materials and methods below.

Design, Synthesis, and in Vitro Screening of Additional siRNAs siRNA Design

[0693] TMPRSS6 duplexes, 19 nucleotides long for both the sense and antisense strand, were designed using the human TMPRSS6 mRNA sequence set forth in GenBank Accession No. NM_153609.3. Three thousand one hundred and eighty duplexes were initially identified that did not contain repeats longer than 7 nucleotides, spanning substantially the entire 3209 nucleotide transcript. All 3180 duplexes were then scored for predicted efficacy according to a linear model that evaluates the nucleotide pair at each duplex position, and the dose and cell line used for screening. The duplexes were also matched against all transcripts in the human RefSeq collection using a custom brute force algorithm, and scored for lowest numbers of mismatches (per strand) to transcripts other than TMPRSS6. Duplexes to be synthesized and screened were then selected from the 3180, according to the following scheme: Beginning at the 5' end of the transcript, a duplex was selected within a "window" of every 10.+-.2 nucleotides that had the highest predicted efficacy, had at least one mismatch in both strands to all transcripts other than TMPRSS6, and had not already been synthesized and screened as part of other duplex sets. If no duplex is identified within a given window that satisfied all criteria, that window was skipped. Three hundred and three duplexes were selected according to the above criteria. An additional 31 duplexes were also selected.

[0694] A detailed list of the 334 TMPRSS6 sense and antisense strand sequences is shown in Table 12.

Cell Culture and Transfections

[0695] Hep3B2.1-7 cells were obtained from American Type Culture Collection (Rockville, Md., cat. No. HB-8064) and cultured in EMEM (ATCC #30-2003), supplemented to contain 10% fetal calf serum (FCS) (Biochrom AG, Berlin, Germany, cat. No. SOI 15) and Penicillin 100 U/ml, Streptomycin 100 mg/ml (Biochrom AG, Berlin, Germany, cat. No. A2213), at 37.degree. C. in an atmosphere with 5% CO.sub.2 in a humidified incubator (Heraeus HERAcell, Kendro Laboratory Products, Langenselbold, Germany).

[0696] Transfection of dsRNA was performed directly after seeding 15,000 cells/well on a 96-well plate, and was carried out with Lipofectamine 2000 (Invitrogen GmbH, Karlsruhe, Germany, cat.No. 11668-019) as described by the manufacturer. Transfections were performed in quadruplicates and dsRNAs were transfected at a concentration of 10 nM.

Branched DNA Assays--QuantiGene 2.0 (Panomics cat #; OS0011)

[0697] For measurement of TMPRSS6 mRNA cells were harvested 24 hours after transfection and lysed at 53.degree. C. following procedures recommended by the manufacturer of the Quantigene II Kit for TMPRSS6 and Quantigene I Explore Kit for bDNA (Panomics, Fremont, Calif., USA, cat. No. 15735 or QG0004, respectively). Subsequently, 50 .mu.l of the lysates were incubated with probesets specific to human TMPRSS6 and 10 .mu.l of the lysates for human GAPDH and processed according to the manufacturer's protocol for QuantiGene. Chemoluminescence was measured in a Victor2-Light (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with the human TMPRSS6 probeset were normalized to the respective human GAPDH values for each well and then related to the mean of three unrelated control dsRNAs.

[0698] The in vitro efficacy of the compounds is shown in Table 13.

TABLE-US-00014 TABLE 12 Additional modified TMPRSS6 siRNAs SEQ Position SEQ Sense ID in NM_ ID Antisense Duplex ID Sequence NO: Sense ID 153609.3 Antisense Sequence NO: ID AD-63290.1 UGAGCCAGACCC 715 A-126858.1 3-21 CUGGACUGGGUCUGGCUCAdTdT 1049 A-126859.1 AGUCCAGdTdT AD-63296.1 GACCCAGUCCAG 716 A-126860.1 10-28 ACCAGAGCUGGACUGGGUCdTdT 1050 A-126861.1 CUCUGGUdTdT AD-63302.1 CUCUGGUGCCUG 717 A-126862.1 22-40 CAGAGGGCAGGCACCAGAGdTdT 1051 A-126863.1 CCCUCUGdTdT AD-63308.1 GCCCUCUGGUGC 718 A-126864.1 33-51 UCAGCUCGCACCAGAGGGCdTdT 1052 A-126865.1 GAGCUGAdTdT AD-63314.1 GGUGCGAGCUGA 719 A-126866.1 40-58 UCUCAGGUCAGCUCGCACCdTdT 1053 A-126867.1 CCUGAGAdTdT AD-63320.1 UGACCUGAGAUG 720 A-126868.1 49-67 GGAAGUGCAUCUCAGGUCAdTdT 1054 A-126869.1 CACUUCCdTdT AD-63326.1 UGCACUUCCCUC 721 A-126870.1 59-77 CACAGAGGAGGGAAGUGCAdTdT 1055 A-126871.1 CUCUGUGdTdT AD-63332.1 CUGUGAGCUGUC 722 A-126872.1 73-91 GUGCCGAGACAGCUCACAGdTdT 1056 A-126873.1 UCGGCACdTdT AD-63291.1 GUCUCGGCACCC 723 A-126874.1 82-100 UGCAAGUGGGUGCCGAGACdTdT 1057 A-126875.1 ACUUGCAdTdT AD-63297.1 CCACUUGCAGUC 724 A-126876.1 92-110 CGGCAGUGACUGCAAGUGGdTdT 1058 A-126877.1 ACUGCCGdTdT AD-63303.1 GUCACUGCCGCC 725 A-126878.1 101-119 AACAUCAGGCGGCAGUGACdTdT 1059 A-126879.1 UGAUGUUdTdT AD-63309.1 GCCUGAUGUUGU 726 A-126880.1 110-128 AAGAGUAACAACAUCAGGCdTdT 1060 A-126881.1 UACUCUUdTdT AD-63315.1 UUACUCUUCCAC 727 A-126882.1 121-139 UUUUGGAGUGGAAGAGUAAdTdT 1061 A-126883.1 UCCAAAAdTdT AD-63321.1 ACUCCAAAAGGA 728 A-126884.1 131-149 ACGGGCAUCCUUUUGGAGUdTdT 1062 A-126885.1 UGCCCGUdTdT AD-63327.1 UGCCCGUGGCCG 729 A-126886.1 143-161 GGGGCCUCGGCCACGGGCAdTdT 1063 A-126887.1 AGGCCCCdTdT AD-63333.1 UGGCCGAGGCCC 730 A-126888.1 149-167 ACCUGGGGGGCCUCGGCCAdTdT 1064 A-126889.1 CCCAGGUdTdT AD-63292.1 CCAGGUGGCUGG 731 A-126890.1 162-180 CUGCCCGCCAGCCACCUGGdTdT 1065 A-126891.1 CGGGCAGdTdT AD-63298.1 GCGGGCAGGGGG 732 A-126892.1 173-191 CCUCCGUCCCCCUGCCCGCdTdT 1066 A-126893.1 ACGGAGGdTdT AD-63304.1 GGACGGAGGUGA 733 A-126894.1 183-201 CUCGCCAUCACCUCCGUCCdTdT 1067 A-126895.1 UGGCGAGdTdT AD-63310.1 GUGAUGGCGAGG 734 A-126896.1 191-209 UCCGCUUCCUCGCCAUCACdTdT 1068 A-126897.1 AAGCGGAdTdT AD-63316.1 GAAGCGGAGCCG 735 A-126898.1 202-220 UCCCCUCCGGCUCCGCUUCdTdT 1069 A-126899.1 GAGGGGAdTdT AD-63322.1 GCCGGAGGGGAU 736 A-126900.1 210-228 CUUGAACAUCCCCUCCGGCdTdT 1070 A-126901.1 GUUCAAGdTdT AD-63328.1 UGUUCAAGGCCU 737 A-126902.1 221-239 UCCUCACAGGCCUUGAACAdTdT 1071 A-126903.1 GUGAGGAdTdT AD-63334.1 CUGUGAGGACUC 738 A-126904.1 231-249 UCUCUUGGAGUCCUCACAGdTdT 1072 A-126905.1 CAAGAGAdTdT AD-63293.1 ACUCCAAGAGAA 739 A-126906.1 239-257 CGGGCUUUUCUCUUGGAGUdTdT 1073 A-126907.1 AAGCCCGdTdT AD-63299.1 GCCCGGGGCUAC 740 A-126908.1 253-271 GGCGGAGGUAGCCCCGGGCdTdT 1074 A-126909.1 CUCCGCCdTdT AD-63305.1 ACCUCCGCCUGG 741 A-126910.1 263-281 AGGGGCACCAGGCGGAGGUdTdT 1075 A-126911.1 UGCCCCUdTdT AD-63311.1 GCCUGGUGCCCC 742 A-126912.1 269-287 ACAAACAGGGGCACCAGGCdTdT 1076 A-126913.1 UGUUUGUdTdT AD-63317.1 UGUUUGUGCUGC 743 A-126914.1 281-299 AGGGCCAGCAGCACAAACAdTdT 1077 A-126915.1 UGGCCCUdTdT AD-63323.1 UGCUGGCCCUGC 744 A-126916.1 290-308 AGCACGAGCAGGGCCAGCAdTdT 1078 A-126917.1 UCGUGCUdTdT AD-63329.1 GCUCGUGCUGGC 745 A-126918.1 300-318 CGCCGAAGCCAGCACGAGCdTdT 1079 A-126919.1 UUCGGCGdTdT AD-63335.1 UCGGCGGGGGUG 746 A-126920.1 313-331 AGAGUAGCACCCCCGCCGAdTdT 1080 A-126921.1 CUACUCUdTdT AD-63294.1 CGGCGGGGGUGC 747 A-126922.1 314-332 CAGAGUAGCACCCCCGCCGdTdT 1081 A-126923.1 UACUCUGdTdT AD-63300.1 GGCGGGGGUGCU 748 A-126924.1 315-333 CCAGAGUAGCACCCCCGCCdTdT 1082 A-126925.1 ACUCUGGdTdT AD-63306.1 GCGGGGGUGCUA 749 A-126926.1 316-334 ACCAGAGUAGCACCCCCGCdTdT 1083 A-126927.1 CUCUGGUdTdT AD-63312.1 CGGGGGUGCUAC 750 A-126928.1 317-335 UACCAGAGUAGCACCCCCGdTdT 1084 A-126929.1 UCUGGUAdTdT AD-63318.1 GGGGGUGCUACU 751 A-126930.1 318-336 AUACCAGAGUAGCACCCCCdTdT 1085 A-126931.1 CUGGUAUdTdT AD-63324.1 GGGUGCUACUCU 752 A-126932.1 320-338 AAAUACCAGAGUAGCACCCdTdT 1086 A-126933.1 GGUAUUUdTdT AD-63330.1 GGUGCUACUCUG 753 A-126934.1 321-339 GAAAUACCAGAGUAGCACCdTdT 1087 A-126935.1 GUAUUUCdTdT AD-63336.1 GUGCUACUCUGG 754 A-126936.1 322-340 GGAAAUACCAGAGUAGCACdTdT 1088 A-126937.1 UAUUUCCdTdT AD-63295.1 GCUACUCUGGUA 755 A-126938.1 324-342 UAGGAAAUACCAGAGUAGCdTdT 1089 A-126939.1 UUUCCUAdTdT AD-63301.1 CUACUCUGGUAU 756 A-126940.1 325-343 CUAGGAAAUACCAGAGUAGdTdT 1090 A-126941.1 UUCCUAGdTdT AD-63307.1 UACUCUGGUAUU 757 A-126942.1 326-344 CCUAGGAAAUACCAGAGUAdTdT 1091 A-126943.1 UCCUAGGdTdT AD-63313.1 ACUCUGGUAUUU 758 A-126944.1 327-345 CCCUAGGAAAUACCAGAGUdTdT 1092 A-126945.1 CCUAGGGdTdT AD-63319.1 CUCUGGUAUUUC 759 A-126946.1 328-346 ACCCUAGGAAAUACCAGAGdTdT 1093 A-126947.1 CUAGGGUdTdT AD-63325.1 CUGGUAUUUCCU 760 A-126948.1 330-348 GUACCCUAGGAAAUACCAGdTdT 1094 A-126949.1 AGGGUACdTdT AD-63331.1 GUAUUUCCUAGG 761 A-126950.1 333-351 CUUGUACCCUAGGAAAUACdTdT 1095 A-126951.1 GUACAAGdTdT AD-63337.1 UAUUUCCUAGGG 762 A-126952.1 334-352 CCUUGUACCCUAGGAAAUAdTdT 1096 A-126953.1 UACAAGGdTdT AD-63343.1 AUUUCCUAGGGU 763 A-126954.1 335-353 GCCUUGUACCCUAGGAAAUdTdT 1097 A-126955.1 ACAAGGCdTdT AD-63349.1 UUUCCUAGGGUA 764 A-126956.1 336-354 CGCCUUGUACCCUAGGAAAdTdT 1098 A-126957.1 CAAGGCGdTdT AD-63355.1 UUCCUAGGGUAC 765 A-126958.1 337-355 CCGCCUUGUACCCUAGGAAdTdT 1099 A-126959.1 AAGGCGGdTdT AD-63361.1 CCUAGGGUACAA 766 A-126960.1 339-357 CUCCGCCUUGUACCCUAGGdTdT 1100 A-126961.1 GGCGGAGdTdT AD-63367.1 CUAGGGUACAAG 767 A-126962.1 340-358 CCUCCGCCUUGUACCCUAGdTdT 1101 A-126963.1 GCGGAGGdTdT AD-63373.1 UAGGGUACAAGG 768 A-126964.1 341-359 ACCUCCGCCUUGUACCCUAdTdT 1102 A-126965.1 CGGAGGUdTdT AD-63379.1 AGGGUACAAGGC 769 A-126966.1 342-360 CACCUCCGCCUUGUACCCUdTdT 1103 A-126967.1 GGAGGUGdTdT AD-63338.1 GGGUACAAGGCG 770 A-126968.1 343-361 UCACCUCCGCCUUGUACCCdTdT 1104 A-126969.1 GAGGUGAdTdT AD-63344.1 GGUACAAGGCGG 771 A-126970.1 344-362 AUCACCUCCGCCUUGUACCdTdT 1105 A-126971.1 AGGUGAUdTdT AD-63350.1 GUACAAGGCGGA 772 A-126972.1 345-363 CAUCACCUCCGCCUUGUACdTdT 1106 A-126973.1 GGUGAUGdTdT AD-63356.1 UACAAGGCGGAG 773 A-126974.1 346-364 CCAUCACCUCCGCCUUGUAdTdT 1107 A-126975.1 GUGAUGGdTdT AD-63362.1 ACAAGGCGGAGG 774 A-126976.1 347-365 ACCAUCACCUCCGCCUUGUdTdT 1108 A-126977.1 UGAUGGUdTdT AD-63368.1 CAAGGCGGAGGU 775 A-126978.1 348-366 GACCAUCACCUCCGCCUUGdTdT 1109 A-126979.1 GAUGGUCdTdT

AD-63374.1 AAGGCGGAGGUG 776 A-126980.1 349-367 UGACCAUCACCUCCGCCUUdTdT 1110 A-126981.1 AUGGUCAdTdT AD-63380.1 AGGCGGAGGUGA 777 A-126982.1 350-368 CUGACCAUCACCUCCGCCUdTdT 1111 A-126983.1 UGGUCAGdTdT AD-63339.1 UGAUGGUCAGCC 778 A-126984.1 359-377 UACACCUGGCUGACCAUCAdTdT 1112 A-126985.1 AGGUGUAdTdT AD-63345.1 CCAGGUGUACUC 779 A-126986.1 369-387 ACUGCCUGAGUACACCUGGdTdT 1113 A-126987.1 AGGCAGUdTdT AD-63351.1 GCAGUCUGCGUG 780 A-126988.1 383-401 UUGAGUACACGCAGACUGCdTdT 1114 A-126989.1 UACUCAAdTdT AD-63357.1 GCGUGUACUCAA 781 A-126990.1 390-408 GUGGCGAUUGAGUACACGCdTdT 1115 A-126991.1 UCGCCACdTdT AD-63363.1 UCGCCACUUCUC 782 A-126992.1 402-420 AUCCUGGGAGAAGUGGCGAdTdT 1116 A-126993.1 CCAGGAUdTdT AD-63369.1 CUCCCAGGAUCU 783 A-126994.1 411-429 GCGGGUAAGAUCCUGGGAGdTdT 1117 A-126995.1 UACCCGCdTdT AD-63375.1 UACCCGCCGGGA 784 A-126996.1 423-441 ACUAGAUUCCCGGCGGGUAdTdT 1118 A-126997.1 AUCUAGUdTdT AD-63381.1 CCGGGAAUCUAG 785 A-126998.1 429-447 GAAGGCACUAGAUUCCCGGdTdT 1119 A-126999.1 UGCCUUCdTdT AD-63340.1 AGUGCCUUCCGC 786 A-127000.1 439-457 UUUCACUGCGGAAGGCACUdTdT 1120 A-127001.1 AGUGAAAdTdT AD-63346.1 GUGAAACCGCCA 787 A-127002.1 452-470 UGGGCUUUGGCGGUUUCACdTdT 1121 A-127003.1 AAGCCCAdTdT AD-63352.1 CGCCAAAGCCCA 788 A-127004.1 459-477 CAUCUUCUGGGCUUUGGCGdTdT 1122 A-127005.1 GAAGAUGdTdT AD-63358.1 CAGAAGAUGCUC 789 A-127006.1 469-487 GCUCCUUGAGCAUCUUCUGdTdT 1123 A-127007.1 AAGGAGCdTdT AD-63364.1 UCAAGGAGCUCA 790 A-127008.1 479-497 CUGGUGAUGAGCUCCUUGAdTdT 1124 A-127009.1 UCACCAGdTdT AD-63370.1 ACCAGCACCCGC 791 A-127010.1 493-511 UUCCCAGGCGGGUGCUGGUdTdT 1125 A-127011.1 CUGGGAAdTdT AD-63376.1 GCCUGGGAACUU 792 A-127012.1 503-521 UUGUAGUAAGUUCCCAGGCdTdT 1126 A-127013.1 ACUACAAdTdT AD-63382.1 GAACUUACUACA 793 A-127014.1 509-527 CUGGAGUUGUAGUAAGUUCdTdT 1127 A-127015.1 ACUCCAGdTdT AD-63341.1 AACUCCAGCUCC 794 A-127016.1 520-538 AAUAGACGGAGCUGGAGUUdTdT 1128 A-127017.1 GUCUAUUdTdT AD-63347.1 CCGUCUAUUCCU 795 A-127018.1 530-548 UCCCCAAAGGAAUAGACGGdTdT 1129 A-127019.1 UUGGGGAdTdT AD-63353.1 UUGGGGAGGGAC 796 A-127020.1 542-560 GUGAGGGGUCCCUCCCCAAdTdT 1130 A-127021.1 CCCUCACdTdT AD-63359.1 CCCCUCACCUGC 797 A-127022.1 553-571 AGAAGAAGCAGGUGAGGGGdTdT 1131 A-127023.1 UUCUUCUdTdT AD-63365.1 CUGCUUCUUCUG 798 A-127024.1 561-579 AAUGAACCAGAAGAAGCAGdTdT 1132 A-127025.1 GUUCAUUdTdT AD-63371.1 CUGGUUCAUUCU 799 A-127026.1 570-588 GAUUUGGAGAAUGAACCAGdTdT 1133 A-127027.1 CCAAAUCdTdT AD-63377.1 UCUCCAAAUCCC 800 A-127028.1 579-597 GUGCUCGGGGAUUUGGAGAdTdT 1134 A-127029.1 CGAGCACdTdT AD-63383.1 CCGAGCACCGCC 801 A-127030.1 590-608 AUCAGCCGGCGGUGCUCGGdTdT 1135 A-127031.1 GGCUGAUdTdT AD-63342.1 GGCUGAUGCUGA 802 A-127032.1 602-620 UCGGGGCUCAGCAUCAGCCdTdT 1136 A-127033.1 GCCCCGAdTdT AD-63348.1 UGAGCCCCGAGG 803 A-127034.1 611-629 UGCACCACCUCGGGGCUCAdTdT 1137 A-127035.1 UGGUGCAdTdT AD-63354.1 UGGUGCAGGCAC 804 A-127036.1 623-641 ACCAGCAGUGCCUGCACCAdTdT 1138 A-127037.1 UGCUGGUdTdT AD-63360.1 AGGCACUGCUGG 805 A-127038.1 629-647 UCCUCCACCAGCAGUGCCUdTdT 1139 A-127039.1 UGGAGGAdTdT AD-63366.1 GUGGAGGAGCUG 806 A-127040.1 640-658 UGGACAGCAGCUCCUCCACdTdT 1140 A-127041.1 CUGUCCAdTdT AD-63372.1 UGUCCACAGUCA 807 A-127042.1 653-671 GAGCUGUUGACUGUGGACAdTdT 1141 A-127043.1 ACAGCUCdTdT AD-63378.1 UCAACAGCUCGG 808 A-127044.1 662-680 ACGGCAGCCGAGCUGUUGAdTdT 1142 A-127045.1 CUGCCGUdTdT AD-63384.1 UCGGCUGCCGUC 809 A-127046.1 670-688 UGUAGGGGACGGCAGCCGAdTdT 1143 A-127047.1 CCCUACAdTdT AD-63390.1 AGUGGACCCCGA 810 A-127048.1 702-720 UAGGCCCUCGGGGUCCACUdTdT 1144 A-127049.1 GGGCCUAdTdT AD-63396.1 AGGGCCUAGUGA 811 A-127050.1 713-731 UCCAGGAUCACUAGGCCCUdTdT 1145 A-127051.1 UCCUGGAdTdT AD-63402.1 UAGUGAUCCUGG 812 A-127052.1 719-737 CUGGCUUCCAGGAUCACUAdTdT 1146 A-127053.1 AAGCCAGdTdT AD-63408.1 AAGCCAGUGUGA 813 A-127054.1 731-749 AUGUCUUUCACACUGGCUUdTdT 1147 A-127055.1 AAGACAUdTdT AD-63414.1 UGAAAGACAUAG 814 A-127056.1 740-758 AAUGCAGCUAUGUCUUUCAdTdT 1148 A-127057.1 CUGCAUUdTdT AD-63420.1 UGCAUUGAAUUC 815 A-127058.1 753-771 CAGCGUGGAAUUCAAUGCAdTdT 1149 A-127059.1 CACGCUGdTdT AD-63426.1 CUACAGCUACGU 816 A-127060.1 783-801 CUGGCCCACGUAGCUGUAGdTdT 1150 A-127061.1 GGGCCAGdTdT AD-63385.1 CUACGUGGGCCA 817 A-127062.1 789-807 CUGGCCCUGGCCCACGUAGdTdT 1151 A-127063.1 GGGCCAGdTdT AD-63391.1 AGGGCCAGGUCC 818 A-127064.1 800-818 AGCCGGAGGACCUGGCCCUdTdT 1152 A-127065.1 UCCGGCUdTdT AD-63397.1 CCGGCUGAAGGG 819 A-127066.1 813-831 GUCAGGCCCCUUCAGCCGGdTdT 1153 A-127067.1 GCCUGACdTdT AD-63403.1 GGGCCUGACCAC 820 A-127068.1 823-841 AGGCCAGGUGGUCAGGCCCdTdT 1154 A-127069.1 CUGGCCUdTdT AD-63409.1 CCACCUGGCCUC 821 A-127070.1 831-849 GCAGCUGGAGGCCAGGUGGdTdT 1155 A-127071.1 CAGCUGCdTdT AD-63415.1 CCAGCUGCCUGU 822 A-127072.1 842-860 AGGUGCCACAGGCAGCUGGdTdT 1156 A-127073.1 GGCACCUdTdT AD-63421.1 CUGUGGCACCUG 823 A-127074.1 850-868 GGCCCUGCAGGUGCCACAGdTdT 1157 A-127075.1 CAGGGCCdTdT AD-63427.1 CUGCAGGGCCCC 824 A-127076.1 859-877 GGUCCUUGGGGCCCUGCAGdTdT 1158 A-127077.1 AAGGACCdTdT AD-63386.1 CCAAGGACCUCA 825 A-127078.1 869-887 UUGAGCAUGAGGUCCUUGGdTdT 1159 A-127079.1 UGCUCAAdTdT AD-63392.1 UGCUCAAACUCC 826 A-127080.1 881-899 UCCAGCCGGAGUUUGAGCAdTdT 1160 A-127081.1 GGCUGGAdTdT AD-63398.1 CCGGCUGGAGUG 827 A-127082.1 891-909 CAGCGUCCACUCCAGCCGGdTdT 1161 A-127083.1 GACGCUGdTdT AD-63404.1 GACGCUGGCAGA 828 A-127084.1 903-921 CCGGCACUCUGCCAGCGUCdTdT 1162 A-127085.1 GUGCCGGdTdT AD-63410.1 GGCAGAGUGCCG 829 A-127086.1 909-927 UCGGUCCCGGCACUCUGCCdTdT 1163 A-127087.1 GGACCGAdTdT AD-63416.1 ACCGACUGGCCA 830 A-127088.1 923-941 UCAUACAUGGCCAGUCGGUdTdT 1164 A-127089.1 UGUAUGAdTdT AD-63422.1 CCAUGUAUGACG 831 A-127090.1 932-950 CCGGCCACGUCAUACAUGGdTdT 1165 A-127091.1 UGGCCGGdTdT AD-63428.1 GUGGCCGGGCCC 832 A-127092.1 943-961 UCUCCAGGGGCCCGGCCACdTdT 1166 A-127093.1 CUGGAGAdTdT AD-63387.1 CCCUGGAGAAGA 833 A-127094.1 953-971 AUGAGCCUCUUCUCCAGGGdTdT 1167 A-127095.1 GGCUCAUdTdT AD-63393.1 AGAAGAGGCUCA 834 A-127096.1 959-977 GAGGUGAUGAGCCUCUUCUdTdT 1168 A-127097.1 UCACCUCdTdT AD-63399.1 ACCUCGGUGUAC 835 A-127098.1 973-991 UGCAGCCGUACACCGAGGUdTdT 1169 A-127099.1 GGCUGCAdTdT AD-63405.1 ACGGCUGCAGCC 836 A-127100.1 983-1001 UCCUGGCGGCUGCAGCCGUdTdT 1170 A-127101.1 GCCAGGAdTdT AD-63411.1 GCCGCCAGGAGC 837 A-127102.1 992-1010 ACCACGGGCUCCUGGCGGCdTdT 1171 A-127103.1 CCGUGGUdTdT AD-63417.1 AGCCCGUGGUGG 838 A-127104.1 1001-1019 AGAACCUCCACCACGGGCUdTdT 1172 A-127105.1

AGGUUCUdTdT AD-63423.1 GUGGAGGUUCUG 839 A-127106.1 1009-1027 CCGACGCCAGAACCUCCACdTdT 1173 A-127107.1 GCGUCGGdTdT AD-63429.1 UGGCGUCGGGGG 840 A-127108.1 1019-1037 AUGAUGGCCCCCGACGCCAdTdT 1174 A-127109.1 CCAUCAUdTdT AD-63388.1 CCAUCAUGGCGG 841 A-127110.1 1031-1049 CAGACGACCGCCAUGAUGGdTdT 1175 A-127111.1 UCGUCUGdTdT AD-63394.1 GCGGUCGUCUGG 842 A-127112.1 1039-1057 CCUUCUUCCAGACGACCGCdTdT 1176 A-127113.1 AAGAAGGdTdT AD-63400.1 GGAAGAAGGGCC 843 A-127114.1 1049-1067 CUGUGCAGGCCCUUCUUCCdTdT 1177 A-127115.1 UGCACAGdTdT AD-63406.1 CCUGCACAGCUA 844 A-127116.1 1059-1077 GUCGUAGUAGCUGUGCAGGdTdT 1178 A-127117.1 CUACGACdTdT AD-63412.1 ACUACGACCCCU 845 A-127118.1 1070-1088 AGCACGAAGGGGUCGUAGUdTdT 1179 A-127119.1 UCGUGCUdTdT AD-63418.1 CCUUCGUGCUCU 846 A-127120.1 1079-1097 UGCACGGAGAGCACGAAGGdTdT 1180 A-127121.1 CCGUGCAdTdT AD-63424.1 CCGUGCAGCCGG 847 A-127122.1 1091-1109 AAGACCACCGGCUGCACGGdTdT 1181 A-127123.1 UGGUCUUdTdT AD-63430.1 CGGUGGUCUUCC 848 A-127124.1 1100-1118 CAGGCCUGGAAGACCACCGdTdT 1182 A-127125.1 AGGCCUGdTdT AD-63389.1 AGGCCUGUGAAG 849 A-127126.1 1112-1130 AGGUUCACUUCACAGGCCUdTdT 1183 A-127127.1 UGAACCUdTdT AD-63395.1 AAGUGAACCUGA 850 A-127128.1 1121-1139 UCCAGCGUCAGGUUCACUUdTdT 1184 A-127129.1 CGCUGGAdTdT AD-63401.1 GACGCUGGACAA 851 A-127130.1 1131-1149 GAGCCUGUUGUCCAGCGUCdTdT 1185 A-127131.1 CAGGCUCdTdT AD-63407.1 ACAACAGGCUCG 852 A-127132.1 1139-1157 UGGGAGUCGAGCCUGUUGUdTdT 1186 A-127133.1 ACUCCCAdTdT AD-63413.1 ACUCCCAGGGCG 853 A-127134.1 1151-1169 CUGAGGACGCCCUGGGAGUdTdT 1187 A-127135.1 UCCUCAGdTdT AD-63419.1 CCCCGUACUUCC 854 A-127136.1 1172-1190 UAGCUGGGGAAGUACGGGGdTdT 1188 A-127137.1 CCAGCUAdTdT AD-63425.1 UUCCCCAGCUAC 855 A-127138.1 1180-1198 GCGAGUAGUAGCUGGGGAAdTdT 1189 A-127139.1 UACUCGCdTdT AD-63431.1 ACUACUCGCCCC 856 A-127140.1 1190-1208 UGGGUUUGGGGCGAGUAGUdTdT 1190 A-127141.1 AAACCCAdTdT AD-63437.1 CCCAAACCCACU 857 A-127142.1 1199-1217 CAGGAGCAGUGGGUUUGGGdTdT 1191 A-127143.1 GCUCCUGdTdT AD-63443.1 GCUCCUGGCACC 858 A-127144.1 1211-1229 ACCGUGAGGUGCCAGGAGCdTdT 1192 A-127145.1 UCACGGUdTdT AD-63449.1 ACCUCACGGUGC 859 A-127146.1 1220-1238 AGAGAGGGCACCGUGAGGUdTdT 1193 A-127147.1 CCUCUCUdTdT AD-63455.1 CUCUCUGGACUA 860 A-127148.1 1233-1251 CAAGCCGUAGUCCAGAGAGdTdT 1194 A-127149.1 CGGCUUGdTdT AD-63461.1 GACUACGGCUUG 861 A-127150.1 1240-1258 AGAGGGCCAAGCCGUAGUCdTdT 1195 A-127151.1 GCCCUCUdTdT AD-63467.1 CCCUCUGGUUUG 862 A-127152.1 1253-1271 UAGGCAUCAAACCAGAGGGdTdT 1196 A-127153.1 AUGCCUAdTdT AD-63473.1 GUUUGAUGCCUA 863 A-127154.1 1260-1278 CAGUGCAUAGGCAUCAAACdTdT 1197 A-127155.1 UGCACUGdTdT AD-63432.1 GCACUGAGGAGG 864 A-127156.1 1273-1291 ACUUCUGCCUCCUCAGUGCdTdT 1198 A-127157.1 CAGAAGUdTdT AD-63438.1 GGAGGCAGAAGU 865 A-127158.1 1280-1298 AAAUCAUACUUCUGCCUCCdTdT 1199 A-127159.1 AUGAUUUdTdT AD-63444.1 AUGAUUUGCCGU 866 A-127160.1 1292-1310 UGGGUGCACGGCAAAUCAUdTdT 1200 A-127161.1 GCACCCAdTdT AD-63450.1 UGCACCCAGGGC 867 A-127162.1 1303-1321 UCCACUGGCCCUGGGUGCAdTdT 1201 A-127163.1 CAGUGGAdTdT AD-63456.1 GCCAGUGGACGA 868 A-127164.1 1313-1331 UUCUGGAUCGUCCACUGGCdTdT 1202 A-127165.1 UCCAGAAdTdT AD-63462.1 GGACGAUCCAGA 869 A-127166.1 1319-1337 CUCCUGUUCUGGAUCGUCCdTdT 1203 A-127167.1 ACAGGAGdTdT AD-63468.1 ACAGGAGGCUGU 870 A-127168.1 1331-1349 AAGCCACACAGCCUCCUGUdTdT 1204 A-127169.1 GUGGCUUdTdT AD-63474.1 CUGUGUGGCUUG 871 A-127170.1 1339-1357 GGAUGCGCAAGCCACACAGdTdT 1205 A-127171.1 CGCAUCCdTdT AD-63433.1 UGCGCAUCCUGC 872 A-127172.1 1349-1367 UAGGGCUGCAGGAUGCGCAdTdT 1206 A-127173.1 AGCCCUAdTdT AD-63439.1 AGCCCUACGCCG 873 A-127174.1 1361-1379 AUCCUCUCGGCGUAGGGCUdTdT 1207 A-127175.1 AGAGGAUdTdT AD-63445.1 CCGAGAGGAUCC 874 A-127176.1 1370-1388 ACCACGGGGAUCCUCUCGGdTdT 1208 A-127177.1 CCGUGGUdTdT AD-63451.1 CCGUGGUGGCCA 875 A-127178.1 1382-1400 CCGGCCGUGGCCACCACGGdTdT 1209 A-127179.1 CGGCCGGdTdT AD-63457.1 CCACGGCCGGGA 876 A-127180.1 1391-1409 AUGGUGAUCCCGGCCGUGGdTdT 1210 A-127181.1 UCACCAUdTdT AD-63463.1 GGAUCACCAUCA 877 A-127182.1 1400-1418 GUGAAGUUGAUGGUGAUCCdTdT 1211 A-127183.1 ACUUCACdTdT AD-63469.1 UCAACUUCACCU 878 A-127184.1 1409-1427 AUCUGGGAGGUGAAGUUGAdTdT 1212 A-127185.1 CCCAGAUdTdT AD-63475.1 CCCAGAUCUCCC 879 A-127186.1 1421-1439 CCGGUGAGGGAGAUCUGGGdTdT 1213 A-127187.1 UCACCGGdTdT AD-63434.1 CCCUCACCGGGC 880 A-127188.1 1430-1448 ACACCGGGCCCGGUGAGGGdTdT 1214 A-127189.1 CCGGUGUdTdT AD-63440.1 CCCGGUGUGCGG 881 A-127190.1 1441-1459 AGUGCACCCGCACACCGGGdTdT 1215 A-127191.1 GUGCACUdTdT AD-63446.1 GCUUGUACAACC 882 A-127192.1 1463-1481 UCCGACUGGUUGUACAAGCdTdT 1216 A-127193.1 AGUCGGAdTdT AD-63452.1 ACAACCAGUCGG 883 A-127194.1 1469-1487 CAGGGGUCCGACUGGUUGUdTdT 1217 A-127195.1 ACCCCUGdTdT AD-63458.1 ACCCCUGCCCUG 884 A-127196.1 1481-1499 AACUCUCCAGGGCAGGGGUdTdT 1218 A-127197.1 GAGAGUUdTdT AD-63464.1 CCUGGAGAGUUC 885 A-127198.1 1489-1507 AACAGAGGAACUCUCCAGGdTdT 1219 A-127199.1 CUCUGUUdTdT AD-63470.1 UCUGUUCUGUGA 886 A-127200.1 1502-1520 AGUCCAUUCACAGAACAGAdTdT 1220 A-127201.1 AUGGACUdTdT AD-63476.1 GAAUGGACUCUG 887 A-127202.1 1512-1530 AGGGACACAGAGUCCAUUCdTdT 1221 A-127203.1 UGUCCCUdTdT AD-63435.1 CUGUGUCCCUGC 888 A-127204.1 1521-1539 AUCACAGGCAGGGACACAGdTdT 1222 A-127205.1 CUGUGAUdTdT AD-63441.1 CUGCCUGUGAUG 889 A-127206.1 1529-1547 UUGACCCCAUCACAGGCAGdTdT 1223 A-127207.1 GGGUCAAdTdT AD-63447.1 GGUCAAGGACUG 890 A-127208.1 1542-1560 GUUGGGGCAGUCCUUGACCdTdT 1224 A-127209.1 CCCCAACdTdT AD-63453.1 UGCCCCAACGGC 891 A-127210.1 1552-1570 CAUCCAGGCCGUUGGGGCAdTdT 1225 A-127211.1 CUGGAUGdTdT AD-63459.1 CGGCCUGGAUGA 892 A-127212.1 1560-1578 GUUUCUCUCAUCCAGGCCGdTdT 1226 A-127213.1 GAGAAACdTdT AD-63465.1 GAGAGAAACUGC 893 A-127214.1 1570-1588 UGCAAACGCAGUUUCUCUCdTdT 1227 A-127215.1 GUUUGCAdTdT AD-63471.1 UUUGCAGAGCCA 894 A-127216.1 1583-1601 UGGAAUGUGGCUCUGCAAAdTdT 1228 A-127217.1 CAUUCCAdTdT AD-63477.1 GCCACAUUCCAG 895 A-127218.1 1591-1609 CUUUGCACUGGAAUGUGGCdTdT 1229 A-127219.1 UGCAAAGdTdT AD-63436.1 GUGCAAAGAGGA 896 A-127220.1 1602-1620 UGUGCUGUCCUCUUUGCACdTdT 1230 A-127221.1 CAGCACAdTdT AD-63442.1 GAGGACAGCACA 897 A-127222.1 1609-1627 AGAUGCAUGUGCUGUCCUCdTdT 1231 A-127223.1 UGCAUCUdTdT AD-63448.1 GCAUCUCACUGC 898 A-127224.1 1622-1640 ACCUUGGGCAGUGAGAUGCdTdT 1232 A-127225.1 CCAAGGUdTdT AD-63454.1 GCCCAAGGUCUG 899 A-127226.1 1632-1650 CCCAUCACAGACCUUGGGCdTdT 1233 A-127227.1 UGAUGGGdTdT AD-63460.1 UGUGAUGGGCAG 900 A-127228.1 1642-1660 AAUCAGGCUGCCCAUCACAdTdT 1234 A-127229.1 CCUGAUUdTdT AD-63466.1 GCAGCCUGAUUG 901 A-127230.1 1650-1668 GUUGAGACAAUCAGGCUGCdTdT

1235 A-127231.1 UCUCAACdTdT AD-63472.1 GUCUCAACGGCA 902 A-127232.1 1661-1679 UCGUCGCUGCCGUUGAGACdTdT 1236 A-127233.1 GCGACGAdTdT AD-63478.1 GCGACGAAGAGC 903 A-127234.1 1673-1691 UGGCACUGCUCUUCGUCGCdTdT 1237 A-127235.1 AGUGCCAdTdT AD-63484.1 AGCAGUGCCAGG 904 A-127236.1 1682-1700 ACCCCUUCCUGGCACUGCUdTdT 1238 A-127237.1 AAGGGGUdTdT AD-63490.1 GAAGGGGUGCCA 905 A-127238.1 1693-1711 UCCCACAUGGCACCCCUUCdTdT 1239 A-127239.1 UGUGGGAdTdT AD-63496.1 CCAUGUGGGACA 906 A-127240.1 1702-1720 AGGUGAAUGUCCCACAUGGdTdT 1240 A-127241.1 UUCACCUdTdT AD-63502.1 CAUUCACCUUCC 907 A-127242.1 1712-1730 UCACACUGGAAGGUGAAUGdTdT 1241 A-127243.1 AGUGUGAdTdT AD-63508.1 CAGUGUGAGGAC 908 A-127244.1 1723-1741 AGCUCCGGUCCUCACACUGdTdT 1242 A-127245.1 CGGAGCUdTdT AD-63514.1 GACCGGAGCUGC 909 A-127246.1 1732-1750 UCUUCACGCAGCUCCGGUCdTdT 1243 A-127247.1 GUGAAGAdTdT AD-63520.1 CUGCGUGAAGAA 910 A-127248.1 1740-1758 GUUGGGCUUCUUCACGCAGdTdT 1244 A-127249.1 GCCCAACdTdT AD-63479.1 AGCCCAACCCGC 911 A-127250.1 1751-1769 UCACACUGCGGGUUGGGCUdTdT 1245 A-127251.1 AGUGUGAdTdT AD-63485.1 CAGUGUGAUGGG 912 A-127252.1 1762-1780 CGGGCCGCCCAUCACACUGdTdT 1246 A-127253.1 CGGCCCGdTdT AD-63491.1 GCGGCCCGACUG 913 A-127254.1 1773-1791 GUCCCUGCAGUCGGGCCGCdTdT 1247 A-127255.1 CAGGGACdTdT AD-63497.1 CUGCAGGGACGG 914 A-127256.1 1782-1800 AUCCGAGCCGUCCCUGCAGdTdT 1248 A-127257.1 CUCGGAUdTdT AD-63503.1 ACGGCUCGGAUG 915 A-127258.1 1790-1808 UGCUCCUCAUCCGAGCCGUdTdT 1249 A-127259.1 AGGAGCAdTdT AD-63509.1 UGAGGAGCACUG 916 A-127260.1 1800-1818 ACAGUCACAGUGCUCCUCAdTdT 1250 A-127261.1 UGACUGUdTdT AD-63515.1 CUGUGACUGUGG 917 A-127262.1 1809-1827 CUGGAGGCCACAGUCACAGdTdT 1251 A-127263.1 CCUCCAGdTdT AD-63521.1 GCCUCCAGGGCC 918 A-127264.1 1820-1838 CUGGAGGGGCCCUGGAGGCdTdT 1252 A-127265.1 CCUCCAGdTdT AD-63480.1 CCCCUCCAGCCG 919 A-127266.1 1830-1848 AACAAUGCGGCUGGAGGGGdTdT 1253 A-127267.1 CAUUGUUdTdT AD-63486.1 CCGCAUUGUUGG 920 A-127268.1 1839-1857 AGCUCCACCAACAAUGCGGdTdT 1254 A-127269.1 UGGAGCUdTdT AD-63492.1 GUGGAGCUGUGU 921 A-127270.1 1850-1868 UCGGAGGACACAGCUCCACdTdT 1255 A-127271.1 CCUCCGAdTdT AD-63498.1 CUCCGAGGGUGA 922 A-127272.1 1863-1881 UGGCCACUCACCCUCGGAGdTdT 1256 A-127273.1 GUGGCCAdTdT AD-63504.1 GGGUGAGUGGCC 923 A-127274.1 1869-1887 CUGCCAUGGCCACUCACCCdTdT 1257 A-127275.1 AUGGCAGdTdT AD-63510.1 AUGGCAGGCCAG 924 A-127276.1 1881-1899 CUGGAGGCUGGCCUGCCAUdTdT 1258 A-127277.1 CCUCCAGdTdT AD-63516.1 CCUCCAGGUUCG 925 A-127278.1 1893-1911 UCGACCCCGAACCUGGAGGdTdT 1259 A-127279.1 GGGUCGAdTdT AD-63522.1 GGUUCGGGGUCG 926 A-127280.1 1899-1917 GAUGUGUCGACCCCGAACCdTdT 1260 A-127281.1 ACACAUCdTdT AD-63481.1 ACAUCUGUGGGG 927 A-127282.1 1913-1931 AGGGCCCCCCCACAGAUGUdTdT 1261 A-127283.1 GGGCCCUdTdT AD-63487.1 GUGGGGGGGCCC 928 A-127284.1 1919-1937 GCGAUGAGGGCCCCCCCACdTdT 1262 A-127285.1 UCAUCGCdTdT AD-63493.1 AUCGCUGACCGC 929 A-127286.1 1933-1951 UCACCCAGCGGUCAGCGAUdTdT 1263 A-127287.1 UGGGUGAdTdT AD-63499.1 ACCGCUGGGUGA 930 A-127288.1 1940-1958 GCUGUUAUCACCCAGCGGUdTdT 1264 A-127289.1 UAACAGCdTdT AD-63505.1 UGAUAACAGCUG 931 A-127290.1 1949-1967 CAGUGGGCAGCUGUUAUCAdTdT 1265 A-127291.1 CCCACUGdTdT AD-63511.1 CCCACUGCUUCC 932 A-127292.1 1961-1979 UCCUCCUGGAAGCAGUGGGdTdT 1266 A-127293.1 AGGAGGAdTdT AD-63517.1 CCAGGAGGACAG 933 A-127294.1 1971-1989 GGCCAUGCUGUCCUCCUGGdTdT 1267 A-127295.1 CAUGGCCdTdT AD-63523.1 ACAGCAUGGCCU 934 A-127296.1 1979-1997 ACCGUGGAGGCCAUGCUGUdTdT 1268 A-127297.1 CCACGGUdTdT AD-63482.1 CCACGGUGCUGU 935 A-127298.1 1991-2009 ACGGUCCACAGCACCGUGGdTdT 1269 A-127299.1 GGACCGUdTdT AD-63488.1 GGACCGUGUUCC 936 A-127300.1 2003-2021 UUGCCCAGGAACACGGUCCdTdT 1270 A-127301.1 UGGGCAAdTdT AD-63494.1 UCCUGGGCAAGG 937 A-127302.1 2012-2030 UGCCACACCUUGCCCAGGAdTdT 1271 A-127303.1 UGUGGCAdTdT AD-63500.1 GUGUGGCAGAAC 938 A-127304.1 2023-2041 AGCGCGAGUUCUGCCACACdTdT 1272 A-127305.1 UCGCGCUdTdT AD-63506.1 GAACUCGCGCUG 939 A-127306.1 2031-2049 UCCAGGCCAGCGCGAGUUCdTdT 1273 A-127307.1 GCCUGGAdTdT AD-63512.1 GGCCUGGAGAGG 940 A-127308.1 2042-2060 AAGGACACCUCUCCAGGCCdTdT 1274 A-127309.1 UGUCCUUdTdT AD-63518.1 AGGUGUCCUUCA 941 A-127310.1 2051-2069 CUCACCUUGAAGGACACCUdTdT 1275 A-127311.1 AGGUGAGdTdT AD-63524.1 CAAGGUGAGCCG 942 A-127312.1 2061-2079 GAGCAGGCGGCUCACCUUGdTdT 1276 A-127313.1 CCUGCUCdTdT AD-63483.1 GCCUGCUCCUGC 943 A-127314.1 2072-2090 UACGGGUGCAGGAGCAGGCdTdT 1277 A-127315.1 ACCCGUAdTdT AD-63489.1 GCACCCGUACCA 944 A-127316.1 2082-2100 CUCUUCGUGGUACGGGUGCdTdT 1278 A-127317.1 CGAAGAGdTdT AD-63495.1 CCACGAAGAGGA 945 A-127318.1 2091-2109 AUGGCUGUCCUCUUCGUGGdTdT 1279 A-127319.1 CAGCCAUdTdT AD-63501.1 AGGACAGCCAUG 946 A-127320.1 2099-2117 UCGUAGUCAUGGCUGUCCUdTdT 1280 A-127321.1 ACUACGAdTdT AD-63507.1 ACUACGACGUGG 947 A-127322.1 2111-2129 AGCAGCGCCACGUCGUAGUdTdT 1281 A-127323.1 CGCUGCUdTdT AD-63513.1 UGGCGCUGCUGC 948 A-127324.1 2120-2138 UCGAGCUGCAGCAGCGCCAdTdT 1282 A-127325.1 AGCUCGAdTdT AD-63519.1 AGCUCGACCACC 949 A-127326.1 2132-2150 ACCACCGGGUGGUCGAGCUdTdT 1283 A-127327.1 CGGUGGUdTdT AD-63525.1 CCGGUGGUGCGC 950 A-127328.1 2143-2161 CGGCCGAGCGCACCACCGGdTdT 1284 A-127329.1 UCGGCCGdTdT AD-63531.1 UGCGCUCGGCCG 951 A-127330.1 2150-2168 CGCACGGCGGCCGAGCGCAdTdT 1285 A-127331.1 CCGUGCGdTdT AD-63537.1 CCGUGCGCCCCG 952 A-127332.1 2162-2180 AGGCAGACGGGGCGCACGGdTdT 1286 A-127333.1 UCUGCCUdTdT AD-63543.1 CCGUCUGCCUGC 953 A-127334.1 2171-2189 CGCGCGGGCAGGCAGACGGdTdT 1287 A-127335.1 CCGCGCGdTdT AD-63549.1 CCGCGCGCUCCC 954 A-127336.1 2183-2201 AAGAAGUGGGAGCGCGCGGdTdT 1288 A-127337.1 ACUUCUUdTdT AD-63555.1 CCCACUUCUUCG 955 A-127338.1 2192-2210 CCGGGCUCGAAGAAGUGGGdTdT 1289 A-127339.1 AGCCCGGdTdT AD-63561.1 GAGCCCGGCCUG 956 A-127340.1 2203-2221 AGCAGUGCAGGCCGGGCUCdTdT 1290 A-127341.1 CACUGCUdTdT AD-63567.1 GGCCUGCACUGC 957 A-127342.1 2209-2227 UAAUCCAGCAGUGCAGGCCdTdT 1291 A-127343.1 UGGAUUAdTdT AD-63526.1 UGGAUUACGGGC 958 A-127344.1 2221-2239 CGCCCCAGCCCGUAAUCCAdTdT 1292 A-127345.1 UGGGGCGdTdT AD-63532.1 GCUGGGGCGCCU 959 A-127346.1 2231-2249 UCGCGCAAGGCGCCCCAGCdTdT 1293 A-127347.1 UGCGCGAdTdT AD-63538.1 UGCGCGAGGGCG 960 A-127348.1 2243-2261 AUGGGGCCGCCCUCGCGCAdTdT 1294 A-127349.1 GCCCCAUdTdT AD-63544.1 AGGGCGGCCCCA 961 A-127350.1 2249-2267 UUGCUGAUGGGGCCGCCCUdTdT 1295 A-127351.1 UCAGCAAdTdT AD-63550.1 UCAGCAACGCUC 962 A-127352.1 2261-2279 UUCUGCAGAGCGUUGCUGAdTdT 1296 A-127353.1 UGCAGAAdTdT AD-63556.1 UGCAGAAAGUGG 963 A-127354.1 2273-2291 UGCACAUCCACUUUCUGCAdTdT 1297 A-127355.1 AUGUGCAdTdT

AD-63562.1 AAGUGGAUGUGC 964 A-127356.1 2279-2297 AUCAACUGCACAUCCACUUdTdT 1298 A-127357.1 AGUUGAUdTdT AD-63568.1 GCAGUUGAUCCC 965 A-127358.1 2289-2307 GUCCUGUGGGAUCAACUGCdTdT 1299 A-127359.1 ACAGGACdTdT AD-63527.1 CACAGGACCUGU 966 A-127360.1 2300-2318 UCGCUGCACAGGUCCUGUGdTdT 1300 A-127361.1 GCAGCGAdTdT AD-63533.1 GCAGCGAGGUCU 967 A-127362.1 2312-2330 UAGCGAUAGACCUCGCUGCdTdT 1301 A-127363.1 AUCGCUAdTdT AD-63539.1 GUCUAUCGCUAC 968 A-127364.1 2320-2338 UCACCUGGUAGCGAUAGACdTdT 1302 A-127365.1 CAGGUGAdTdT AD-63545.1 CCAGGUGACGCC 969 A-127366.1 2331-2349 CAUGCGUGGCGUCACCUGGdTdT 1303 A-127367.1 ACGCAUGdTdT AD-63551.1 CCACGCAUGCUG 970 A-127368.1 2341-2359 CGGCACACAGCAUGCGUGGdTdT 1304 A-127369.1 UGUGCCGdTdT AD-63557.1 CUGUGUGCCGGC 971 A-127370.1 2350-2368 UGCGGUAGCCGGCACACAGdTdT 1305 A-127371.1 UACCGCAdTdT AD-63563.1 ACCGCAAGGGCA 972 A-127372.1 2363-2381 UCCUUCUUGCCCUUGCGGUdTdT 1306 A-127373.1 AGAAGGAdTdT AD-63569.1 GCAAGAAGGAUG 973 A-127374.1 2372-2390 UGACAGGCAUCCUUCUUGCdTdT 1307 A-127375.1 CCUGUCAdTdT AD-63528.1 GCCUGUCAGGGU 974 A-127376.1 2383-2401 CUGAGUCACCCUGACAGGCdTdT 1308 A-127377.1 GACUCAGdTdT AD-63534.1 GUGACUCAGGUG 975 A-127378.1 2393-2411 AGCGGACCACCUGAGUCACdTdT 1309 A-127379.1 GUCCGCUdTdT AD-63540.1 GUGGUCCGCUGG 976 A-127380.1 2402-2420 UUGCACACCAGCGGACCACdTdT 1310 A-127381.1 UGUGCAAdTdT AD-63546.1 UGGUGUGCAAGG 977 A-127382.1 2411-2429 CUGAGUGCCUUGCACACCAdTdT 1311 A-127383.1 CACUCAGdTdT AD-63552.1 GCACUCAGUGGC 978 A-127384.1 2422-2440 ACCAGCGGCCACUGAGUGCdTdT 1312 A-127385.1 CGCUGGUdTdT AD-63558.1 GCCGCUGGUUCC 979 A-127386.1 2432-2450 CCCGCCAGGAACCAGCGGCdTdT 1313 A-127387.1 UGGCGGGdTdT AD-63564.1 UCCUGGCGGGGC 980 A-127388.1 2441-2459 CUGACCAGCCCCGCCAGGAdTdT 1314 A-127389.1 UGGUCAGdTdT AD-63570.1 GCUGGUCAGCUG 981 A-127390.1 2451-2469 CAGGCCCCAGCUGACCAGCdTdT 1315 A-127391.1 GGGCCUGdTdT AD-63529.1 GGGCCUGGGCUG 982 A-127392.1 2463-2481 CCGGCCACAGCCCAGGCCCdTdT 1316 A-127393.1 UGGCCGGdTdT AD-63535.1 GGCUGUGGCCGG 983 A-127394.1 2470-2488 AGUUAGGCCGGCCACAGCCdTdT 1317 A-127395.1 CCUAACUdTdT AD-63541.1 CUAACUACUUCG 984 A-127396.1 2483-2501 UAGACGCCGAAGUAGUUAGdTdT 1318 A-127397.1 GCGUCUAdTdT AD-63547.1 CGGCGUCUACAC 985 A-127398.1 2493-2511 GAUGCGGGUGUAGACGCCGdTdT 1319 A-127399.1 CCGCAUCdTdT AD-63553.1 ACACCCGCAUCA 986 A-127400.1 2501-2519 ACACCUGUGAUGCGGGUGUdTdT 1320 A-127401.1 CAGGUGUdTdT AD-63559.1 ACAGGUGUGAUC 987 A-127402.1 2512-2530 UCCAGCUGAUCACACCUGUdTdT 1321 A-127403.1 AGCUGGAdTdT AD-63565.1 UCAGCUGGAUCC 988 A-127404.1 2522-2540 ACUUGCUGGAUCCAGCUGAdTdT 1322 A-127405.1 AGCAAGUdTdT AD-63571.1 CAGCAAGUGGUG 989 A-127406.1 2533-2551 CUCAGGUCACCACUUGCUGdTdT 1323 A-127407.1 ACCUGAGdTdT AD-63530.1 UGACCUGAGGAA 990 A-127408.1 2543-2561 GGGGCAGUUCCUCAGGUCAdTdT 1324 A-127409.1 CUGCCCCdTdT AD-63536.1 GGAACUGCCCCC 991 A-127410.1 2551-2569 UUUGCAGGGGGGCAGUUCCdTdT 1325 A-127411.1 CUGCAAAdTdT AD-63542.1 CUGCAAAGCAGG 992 A-127412.1 2563-2581 GGUGGGCCCUGCUUUGCAGdTdT 1326 A-127413.1 GCCCACCdTdT AD-63548.1 GCAGGGCCCACC 993 A-127414.1 2570-2588 UCCAGGAGGUGGGCCCUGCdTdT 1327 A-127415.1 UCCUGGAdTdT AD-63554.1 CCUCCUGGACUC 994 A-127416.1 2580-2598 GCUCUCUGAGUCCAGGAGGdTdT 1328 A-127417.1 AGAGAGCdTdT AD-63560.1 CUCAGAGAGCCC 995 A-127418.1 2589-2607 UUGCCCUGGGCUCUCUGAGdTdT 1329 A-127419.1 AGGGCAAdTdT AD-63566.1 CCAGGGCAACUG 996 A-127420.1 2599-2617 UGCUUGGCAGUUGCCCUGGdTdT 1330 A-127421.1 CCAAGCAdTdT AD-63572.1 GGACAAGUAUUC 997 A-127422.1 2621-2639 CCCGCCAGAAUACUUGUCCdTdT 1331 A-127423.1 UGGCGGGdTdT AD-63578.1 CUGGCGGGGGGU 998 A-127424.1 2632-2650 CUCCCCCACCCCCCGCCAGdTdT 1332 A-127425.1 GGGGGAGdTdT AD-63584.1 GGGUGGGGGAGA 999 A-127426.1 2640-2658 CCUGCUCUCUCCCCCACCCdTdT 1333 A-127427.1 GAGCAGGdTdT AD-63590.1 AGAGAGCAGGCC 1000 A-127428.1 2649-2667 ACCACAGGGCCUGCUCUCUdTdT 1334 A-127429.1 CUGUGGUdTdT AD-63596.1 CCCUGUGGUGGC 1001 A-127430.1 2659-2677 ACCUCCUGCCACCACAGGGdTdT 1335 A-127431.1 AGGAGGUdTdT AD-63602.1 GGAGGUGGCAUC 1002 A-127432.1 2672-2690 GAGACAAGAUGCCACCUCCdTdT 1336 A-127433.1 UUGUCUCdTdT AD-63608.1 CAUCUUGUCUCG 1003 A-127434.1 2680-2698 UCAGGGACGAGACAAGAUGdTdT 1337 A-127435.1 UCCCUGAdTdT AD-63614.1 CCCUGAUGUCUG 1004 A-127436.1 2693-2711 ACUGGAGCAGACAUCAGGGdTdT 1338 A-127437.1 CUCCAGUdTdT AD-63573.1 CUGCUCCAGUGA 1005 A-127438.1 2702-2720 CCUGCCAUCACUGGAGCAGdTdT 1339 A-127439.1 UGGCAGGdTdT AD-63579.1 AUGGCAGGAGGA 1006 A-127440.1 2713-2731 UUCUCCAUCCUCCUGCCAUdTdT 1340 A-127441.1 UGGAGAAdTdT AD-63585.1 GGAUGGAGAAGU 1007 A-127442.1 2722-2740 UGCUGGCACUUCUCCAUCCdTdT 1341 A-127443.1 GCCAGCAdTdT AD-63591.1 UGCCAGCAGCUG 1008 A-127444.1 2733-2751 UGACCCCCAGCUGCUGGCAdTdT 1342 A-127445.1 GGGGUCAdTdT AD-63597.1 AGCUGGGGGUCA 1009 A-127446.1 2740-2758 GACGUCUUGACCCCCAGCUdTdT 1343 A-127447.1 AGACGUCdTdT AD-63603.1 UCAAGACGUCCC 1010 A-127448.1 2749-2767 UCCUCAGGGGACGUCUUGAdTdT 1344 A-127449.1 CUGAGGAdTdT AD-63609.1 CCCUGAGGACCC 1011 A-127450.1 2759-2777 UGGGCCUGGGUCCUCAGGGdTdT 1345 A-127451.1 AGGCCCAdTdT AD-63615.1 GCCCACACCCAG 1012 A-127452.1 2773-2791 AGAAGGGCUGGGUGUGGGCdTdT 1346 A-127453.1 CCCUUCUdTdT AD-63574.1 AGCCCUUCUGCC 1013 A-127454.1 2783-2801 AUUGGGAGGCAGAAGGGCUdTdT 1347 A-127455.1 UCCCAAUdTdT AD-63580.1 CCUCCCAAUUCU 1014 A-127456.1 2793-2811 AGGAGAGAGAAUUGGGAGGdTdT 1348 A-127457.1 CUCUCCUdTdT AD-63586.1 CUCUCUCCUCCG 1015 A-127458.1 2803-2821 AAGGGGACGGAGGAGAGAGdTdT 1349 A-127459.1 UCCCCUUdTdT AD-63592.1 UCCGUCCCCUUC 1016 A-127460.1 2811-2829 AGUGGAGGAAGGGGACGGAdTdT 1350 A-127461.1 CUCCACUdTdT AD-63598.1 CUUCCUCCACUG 1017 A-127462.1 2819-2837 UAGGCAGCAGUGGAGGAAGdTdT 1351 A-127463.1 CUGCCUAdTdT AD-63604.1 CUGCCUAAUGCA 1018 A-127464.1 2831-2849 ACUGCCUUGCAUUAGGCAGdTdT 1352 A-127465.1 AGGCAGUdTdT AD-63610.1 GCAAGGCAGUGG 1019 A-127466.1 2840-2858 UGCUGAGCCACUGCCUUGCdTdT 1353 A-127467.1 CUCAGCAdTdT AD-63616.1 UGGCUCAGCAGC 1020 A-127468.1 2849-2867 CAUUCUUGCUGCUGAGCCAdTdT 1354 A-127469.1 AAGAAUGdTdT AD-63575.1 CAAGAAUGCUGG 1021 A-127470.1 2860-2878 UGUAGAACCAGCAUUCUUGdTdT 1355 A-127471.1 UUCUACAdTdT AD-63581.1 UGGUUCUACAUC 1022 A-127472.1 2869-2887 UCCUCGGGAUGUAGAACCAdTdT 1356 A-127473.1 CCGAGGAdTdT AD-63587.1 CCCGAGGAGUGU 1023 A-127474.1 2880-2898 ACCUCAGACACUCCUCGGGdTdT 1357 A-127475.1 CUGAGGUdTdT AD-63593.1 GUCUGAGGUGCG 1024 A-127476.1 2890-2908 AGUGGGGCGCACCUCAGACdTdT 1358 A-127477.1 CCCCACUdTdT AD-63599.1 GCCCCACUCUGU 1025 A-127478.1 2901-2919 CCUCUGUACAGAGUGGGGCdTdT 1359 A-127479.1 ACAGAGGdTdT AD-63605.1 CUGUACAGAGGC 1026 A-127480.1 2909-2927 CCAAACAGCCUCUGUACAGdTdT 1360 A-127481.1 UGUUUGGdTdT

AD-63611.1 CUGUUUGGGCAG 1027 A-127482.1 2920-2938 GGCAAGGCUGCCCAAACAGdTdT 1361 A-127483.1 CCUUGCCdTdT AD-63617.1 CUUGCCUCCAGA 1028 A-127484.1 2933-2951 UCUGCUCUCUGGAGGCAAGdTdT 1362 A-127485.1 GAGCAGAdTdT AD-63576.1 UCCAGAGAGCAG 1029 A-127486.1 2939-2957 CUGGAAUCUGCUCUCUGGAdTdT 1363 A-127487.1 AUUCCAGdTdT AD-63582.1 GAUUCCAGCUUC 1030 A-127488.1 2950-2968 GGCUUCCGAAGCUGGAAUCdTdT 1364 A-127489.1 GGAAGCCdTdT AD-63588.1 GAAUGGAAGGUG 1031 A-127490.1 2991-3009 AUGGGAGCACCUUCCAUUCdTdT 1365 A-127491.1 CUCCCAUdTdT AD-63594.1 GUGCUCCCAUCG 1032 A-127492.1 3000-3018 UCCCCUCCGAUGGGAGCACdTdT 1366 A-127493.1 GAGGGGAdTdT AD-63600.1 UCGGAGGGGACC 1033 A-127494.1 3009-3027 CUCUGAGGGUCCCCUCCGAdTdT 1367 A-127495.1 CUCAGAGdTdT AD-63606.1 CCCUCAGAGCCC 1034 A-127496.1 3019-3037 GUCUCCAGGGCUCUGAGGGdTdT 1368 A-127497.1 UGGAGACdTdT AD-63612.1 GAGACUGCCAGG 1035 A-127498.1 3033-3051 AGGCCCACCUGGCAGUCUCdTdT 1369 A-127499.1 UGGGCCUdTdT AD-63618.1 AGGUGGGCCUGC 1036 A-127500.1 3042-3060 AGUGGCAGCAGGCCCACCUdTdT 1370 A-127501.1 UGCCACUdTdT AD-63577.1 CUGCCACUGUAA 1037 A-127502.1 3053-3071 UUUUGGCUUACAGUGGCAGdTdT 1371 A-127503.1 GCCAAAAdTdT AD-63583.1 CUGUAAGCCAAA 1038 A-127504.1 3059-3077 CCCACCUUUUGGCUUACAGdTdT 1372 A-127505.1 AGGUGGGdTdT AD-63589.1 GUGGGGAAGUCC 1039 A-127506.1 3073-3091 GGAGUCAGGACUUCCCCACdTdT 1373 A-127507.1 UGACUCCdTdT AD-63595.1 CCUGACUCCAGG 1040 A-127508.1 3083-3101 CAAGGACCCUGGAGUCAGGdTdT 1374 A-127509.1 GUCCUUGdTdT AD-63601.1 GGGUCCUUGCCC 1041 A-127510.1 3093-3111 AGGGGUGGGGCAAGGACCCdTdT 1375 A-127511.1 CACCCCUdTdT AD-63607.1 GCCCCACCCCUG 1042 A-127512.1 3101-3119 UGGCAGGCAGGGGUGGGGCdTdT 1376 A-127513.1 CCUGCCAdTdT AD-63613.1 CCUGCCACCUGG 1043 A-127514.1 3113-3131 UGAGGGCCCAGGUGGCAGGdTdT 1377 A-127515.1 GCCCUCAdTdT AD-63619.1 CUGGGCCCUCAC 1044 A-127516.1 3121-3139 CUGGGCUGUGAGGGCCCAGdTdT 1378 A-127517.1 AGCCCAGdTdT AD-63620.1 UCACAGCCCAGA 1045 A-127518.1 3129-3147 GUGAGGGUCUGGGCUGUGAdTdT 1379 A-127519.1 CCCUCACdTdT AD-63621.1 CUCACUGGGAGG 1046 A-127520.1 3143-3161 GAGCUCACCUCCCAGUGAGdTdT 1380 A-127521.1 UGAGCUCdTdT AD-63622.1 GGUGAGCUCAGC 1047 A-127522.1 3153-3171 AAGGGCAGCUGAGCUCACCdTdT 1381 A-127523.1 UGCCCUUdTdT AD-63623.1 UGGAAUAAAGCU 1048 A-127524.1 3172-3190 AUCAGGCAGCUUUAUUCCAdTdT 1382 A-127525.1 GCCUGAUdTdT

TABLE-US-00015 TABLE 13 TMPRSS6 single dose screen (10 nM) in Hep3B cells with dT modified siRNAs Avg % message Duplex ID remaining SD AD-63290.1 122.8 18.0 AD-63296.1 87.4 6.0 AD-63302.1 71.4 16.9 AD-63308.1 82.1 10.3 AD-63314.1 59.1 5.3 AD-63320.1 90.7 4.5 AD-63326.1 121.0 18.2 AD-63332.1 114.4 11.6 AD-63291.1 84.7 15.0 AD-63297.1 82.8 3.9 AD-63303.1 67.6 5.5 AD-63309.1 55.8 6.5 AD-63315.1 64.2 7.4 AD-63321.1 85.8 6.4 AD-63327.1 91.9 14.9 AD-63333.1 76.4 5.2 AD-63292.1 54.4 22.9 AD-63298.1 54.6 5.0 AD-63304.1 24.6 7.3 AD-63310.1 23.3 0.6 AD-63316.1 50.9 7.2 AD-63322.1 53.7 10.5 AD-63328.1 29.2 2.3 AD-63334.1 28.5 1.2 AD-63293.1 50.9 6.8 AD-63299.1 85.5 2.3 AD-63305.1 43.0 7.2 AD-63311.1 28.9 2.6 AD-63317.1 40.9 2.7 AD-63323.1 40.2 7.3 AD-63329.1 27.9 12.0 AD-63335.1 82.0 4.2 AD-63294.1 21.8 1.0 AD-63300.1 32.3 8.0 AD-63306.1 32.9 8.3 AD-63312.1 26.5 4.6 AD-63318.1 31.3 2.4 AD-63324.1 25.7 1.9 AD-63330.1 24.5 2.0 AD-63336.1 36.1 8.6 AD-63295.1 29.2 1.8 AD-63301.1 28.9 5.2 AD-63307.1 68.8 10.6 AD-63313.1 90.2 8.2 AD-63319.1 21.9 3.3 AD-63325.1 26.1 4.8 AD-63331.1 36.7 4.5 AD-63337.1 67.7 9.3 AD-63343.1 83.9 15.0 AD-63349.1 71.6 3.5 AD-63355.1 62.8 10.4 AD-63361.1 56.0 3.3 AD-63367.1 49.3 8.7 AD-63373.1 54.1 8.2 AD-63379.1 47.5 6.3 AD-63338.1 28.0 2.8 AD-63344.1 29.7 5.7 AD-63350.1 23.0 2.3 AD-63356.1 81.5 13.7 AD-63362.1 19.7 2.9 AD-63368.1 42.2 4.7 AD-63374.1 24.5 2.0 AD-63380.1 24.9 4.9 AD-63339.1 28.9 10.1 AD-63345.1 29.9 5.6 AD-63351.1 20.4 3.7 AD-63357.1 35.8 6.8 AD-63363.1 30.4 2.5 AD-63369.1 29.0 3.1 AD-63375.1 36.6 2.4 AD-63381.1 29.1 4.3 AD-63340.1 40.4 18.8 AD-63346.1 36.4 3.5 AD-63352.1 25.8 3.9 AD-63358.1 42.6 8.1 AD-63364.1 48.1 6.6 AD-63370.1 24.6 2.8 AD-63376.1 22.1 4.2 AD-63382.1 31.0 7.5 AD-63341.1 37.6 13.7 AD-63347.1 27.6 2.0 AD-63353.1 76.4 14.5 AD-63359.1 25.3 1.1 AD-63365.1 27.3 3.4 AD-63371.1 16.3 1.3 AD-63377.1 65.4 7.1 AD-63383.1 72.2 7.0 AD-63342.1 30.8 7.3 AD-63348.1 72.7 9.2 AD-63354.1 38.7 5.0 AD-63360.1 28.7 3.0 AD-63366.1 30.9 6.8 AD-63372.1 84.0 9.0 AD-63378.1 64.1 8.6 AD-63384.1 38.0 2.6 AD-63390.1 48.3 10.6 AD-63396.1 45.6 7.0 AD-63402.1 42.0 9.9 AD-63408.1 40.4 9.1 AD-63414.1 23.8 6.2 AD-63420.1 55.3 5.2 AD-63426.1 61.6 8.5 AD-63385.1 61.6 10.2 AD-63391.1 38.0 3.1 AD-63397.1 66.7 16.8 AD-63403.1 77.2 15.4 AD-63409.1 60.3 10.7 AD-63415.1 35.0 5.4 AD-63421.1 60.6 2.9 AD-63427.1 40.5 7.2 AD-63386.1 42.0 7.4 AD-63392.1 34.2 3.1 AD-63398.1 62.6 18.5 AD-63404.1 65.9 8.1 AD-63410.1 19.7 4.0 AD-63416.1 51.3 9.0 AD-63422.1 59.3 2.7 AD-63428.1 58.2 9.7 AD-63387.1 42.2 4.8 AD-63393.1 27.9 4.4 AD-63399.1 49.6 8.4 AD-63405.1 72.5 9.3 AD-63411.1 45.4 14.9 AD-63417.1 36.7 9.4 AD-63423.1 76.8 4.9 AD-63429.1 77.8 14.4 AD-63388.1 37.4 4.4 AD-63394.1 31.5 4.6 AD-63400.1 60.9 28.6 AD-63406.1 40.7 14.3 AD-63412.1 22.0 7.0 AD-63418.1 22.8 4.3 AD-63424.1 25.5 2.8 AD-63430.1 21.5 3.2 AD-63389.1 34.4 5.3 AD-63395.1 31.1 0.7 AD-63401.1 44.3 9.5 AD-63407.1 41.5 4.9 AD-63413.1 52.4 6.4 AD-63419.1 26.3 5.6 AD-63425.1 78.8 4.6 AD-63431.1 32.8 6.6 AD-63437.1 42.3 1.4 AD-63443.1 56.4 8.9 AD-63449.1 26.0 5.9 AD-63455.1 28.0 9.7 AD-63461.1 32.1 11.1 AD-63467.1 33.8 19.8 AD-63473.1 28.9 3.4 AD-63432.1 36.5 7.4 AD-63438.1 27.3 4.3 AD-63444.1 54.6 36.0 AD-63450.1 42.0 6.1 AD-63456.1 36.6 10.2 AD-63462.1 23.3 3.0 AD-63468.1 48.8 27.3 AD-63474.1 23.8 3.2 AD-63433.1 51.8 13.8 AD-63439.1 41.7 5.5 AD-63445.1 74.6 6.1 AD-63451.1 49.6 9.0 AD-63457.1 26.7 4.9 AD-63463.1 27.8 3.8 AD-63469.1 48.4 14.0 AD-63475.1 40.3 1.4 AD-63434.1 93.3 9.9 AD-63440.1 37.6 4.7 AD-63446.1 38.1 15.4 AD-63452.1 42.3 4.0 AD-63458.1 29.7 7.9 AD-63464.1 25.7 3.4 AD-63470.1 44.8 7.8 AD-63476.1 33.9 4.7 AD-63435.1 23.4 5.2 AD-63441.1 37.1 4.5 AD-63447.1 46.5 9.0 AD-63453.1 73.1 16.8 AD-63459.1 31.8 4.6 AD-63465.1 27.3 6.6 AD-63471.1 19.5 3.1 AD-63477.1 35.2 4.7 AD-63436.1 21.8 4.7 AD-63442.1 44.1 11.2 AD-63448.1 33.6 6.0 AD-63454.1 58.2 16.8 AD-63460.1 27.7 2.4 AD-63466.1 27.1 4.4 AD-63472.1 20.5 4.1 AD-63478.1 36.3 7.3 AD-63484.1 48.4 31.3 AD-63490.1 44.0 6.1 AD-63496.1 45.5 19.9 AD-63502.1 49.0 18.3 AD-63508.1 41.4 2.7 AD-63514.1 36.0 5.1 AD-63520.1 40.9 4.2 AD-63479.1 35.1 6.5 AD-63485.1 45.5 24.0 AD-63491.1 69.0 14.5 AD-63497.1 57.1 25.1 AD-63503.1 36.0 15.3 AD-63509.1 29.7 6.4 AD-63515.1 33.9 5.7 AD-63521.1 117.2 10.2 AD-63480.1 38.6 0.7 AD-63486.1 48.5 12.1 AD-63492.1 38.7 3.7 AD-63498.1 64.6 20.3 AD-63504.1 41.7 1.9 AD-63510.1 39.6 4.0 AD-63516.1 30.9 4.8 AD-63522.1 56.4 15.6 AD-63481.1 72.0 7.3 AD-63487.1 128.8 48.9 AD-63493.1 31.7 6.7 AD-63499.1 44.2 17.7 AD-63505.1 69.4 7.6 AD-63511.1 43.8 5.3 AD-63517.1 75.3 2.2 AD-63523.1 82.1 10.6 AD-63482.1 40.1 12.2 AD-63488.1 42.3 12.7 AD-63494.1 19.0 1.1 AD-63500.1 30.2 11.2 AD-63506.1 30.5 7.6 AD-63512.1 38.1 15.2 AD-63518.1 35.0 7.3 AD-63524.1 60.5 3.7 AD-63483.1 22.7 3.6 AD-63489.1 47.6 13.7 AD-63495.1 31.0 12.7 AD-63501.1 24.3 2.1 AD-63507.1 37.4 7.0 AD-63513.1 32.3 5.1 AD-63519.1 46.0 6.6 AD-63525.1 66.5 14.5 AD-63531.1 104.0 24.1 AD-63537.1 32.1 3.4 AD-63543.1 31.2 3.8 AD-63549.1 35.2 5.2 AD-63555.1 41.7 9.3 AD-63561.1 44.2 7.0 AD-63567.1 39.2 4.9

AD-63526.1 66.9 15.7 AD-63532.1 90.3 17.8 AD-63538.1 50.8 11.5 AD-63544.1 31.9 2.4 AD-63550.1 35.0 8.8 AD-63556.1 31.0 6.0 AD-63562.1 20.2 2.4 AD-63568.1 30.6 2.7 AD-63527.1 28.8 2.4 AD-63533.1 63.3 6.9 AD-63539.1 28.4 3.5 AD-63545.1 26.9 8.5 AD-63551.1 52.5 4.7 AD-63557.1 26.7 2.2 AD-63563.1 28.1 2.7 AD-63569.1 29.2 2.8 AD-63528.1 52.9 9.0 AD-63534.1 42.5 6.8 AD-63540.1 50.5 10.9 AD-63546.1 53.6 10.5 AD-63552.1 38.8 5.0 AD-63558.1 49.3 3.0 AD-63564.1 69.2 3.1 AD-63570.1 50.6 6.0 AD-63529.1 59.5 6.5 AD-63535.1 21.0 1.7 AD-63541.1 40.1 23.4 AD-63547.1 26.0 9.6 AD-63553.1 31.5 6.0 AD-63559.1 34.9 2.7 AD-63565.1 43.3 5.3 AD-63571.1 41.6 4.4 AD-63530.1 127.6 15.0 AD-63536.1 38.0 16.0 AD-63542.1 48.3 8.4 AD-63548.1 41.9 7.9 AD-63554.1 88.2 15.2 AD-63560.1 48.8 17.7 AD-63566.1 33.6 6.8 AD-63572.1 82.4 67.9 AD-63578.1 78.5 11.5 AD-63584.1 55.7 7.2 AD-63590.1 53.4 2.9 AD-63596.1 63.5 8.6 AD-63602.1 49.3 3.6 AD-63608.1 29.2 4.4 AD-63614.1 30.0 7.4 AD-63573.1 96.1 14.7 AD-63579.1 38.1 4.5 AD-63585.1 40.0 2.1 AD-63591.1 30.5 2.5 AD-63597.1 55.1 5.8 AD-63603.1 43.6 4.0 AD-63609.1 37.7 2.7 AD-63615.1 44.4 9.7 AD-63574.1 44.3 10.3 AD-63580.1 33.1 3.5 AD-63586.1 39.3 2.9 AD-63592.1 73.7 1.6 AD-63598.1 32.4 6.6 AD-63604.1 98.7 7.1 AD-63610.1 42.1 7.1 AD-63616.1 55.2 10.4 AD-63575.1 27.8 3.0 AD-63581.1 36.3 3.2 AD-63587.1 36.1 3.3 AD-63593.1 39.2 4.7 AD-63599.1 37.0 5.6 AD-63605.1 49.3 3.7 AD-63611.1 88.8 7.7 AD-63617.1 45.6 6.6 AD-63576.1 59.9 2.9 AD-63582.1 82.9 8.3 AD-63588.1 33.5 6.7 AD-63594.1 64.7 18.0 AD-63600.1 99.5 11.9 AD-63606.1 40.8 2.7 AD-63612.1 44.5 5.3 AD-63618.1 41.7 4.6 AD-63577.1 31.1 0.3 AD-63583.1 57.3 8.6 AD-63589.1 61.9 5.9 AD-63595.1 51.2 8.5 AD-63601.1 70.7 15.4 AD-63607.1 39.4 1.9 AD-63613.1 36.8 2.7 AD-63619.1 83.8 13.8 AD-63620.1 69.4 7.3 AD-63621.1 30.6 3.1 AD-63622.1 51.8 8.4 AD-63623.1 37.3 8.6

Sequence CWU 1

1

138213212DNAHomo sapiens 1cttgagccag acccagtcca gctctggtgc ctgccctctg gtgcgagctg acctgagatg 60cacttccctc ctctgtgagc tgtctcggca cccacttgca gtcactgccg cctgatgttg 120ttactcttcc actccaaaag gatgcccgtg gccgaggccc cccaggtggc tggcgggcag 180ggggacggag gtgatggcga ggaagcggag ccggagggga tgttcaaggc ctgtgaggac 240tccaagagaa aagcccgggg ctacctccgc ctggtgcccc tgtttgtgct gctggccctg 300ctcgtgctgg cttcggcggg ggtgctactc tggtatttcc tagggtacaa ggcggaggtg 360atggtcagcc aggtgtactc aggcagtctg cgtgtactca atcgccactt ctcccaggat 420cttacccgcc gggaatctag tgccttccgc agtgaaaccg ccaaagccca gaagatgctc 480aaggagctca tcaccagcac ccgcctggga acttactaca actccagctc cgtctattcc 540tttggggagg gacccctcac ctgcttcttc tggttcattc tccaaatccc cgagcaccgc 600cggctgatgc tgagccccga ggtggtgcag gcactgctgg tggaggagct gctgtccaca 660gtcaacagct cggctgccgt cccctacagg gccgagtacg aagtggaccc cgagggccta 720gtgatcctgg aagccagtgt gaaagacata gctgcattga attccacgct gggttgttac 780cgctacagct acgtgggcca gggccaggtc ctccggctga aggggcctga ccacctggcc 840tccagctgcc tgtggcacct gcagggcccc aaggacctca tgctcaaact ccggctggag 900tggacgctgg cagagtgccg ggaccgactg gccatgtatg acgtggccgg gcccctggag 960aagaggctca tcacctcggt gtacggctgc agccgccagg agcccgtggt ggaggttctg 1020gcgtcggggg ccatcatggc ggtcgtctgg aagaagggcc tgcacagcta ctacgacccc 1080ttcgtgctct ccgtgcagcc ggtggtcttc caggcctgtg aagtgaacct gacgctggac 1140aacaggctcg actcccaggg cgtcctcagc accccgtact tccccagcta ctactcgccc 1200caaacccact gctcctggca cctcacggtg ccctctctgg actacggctt ggccctctgg 1260tttgatgcct atgcactgag gaggcagaag tatgatttgc cgtgcaccca gggccagtgg 1320acgatccaga acaggaggct gtgtggcttg cgcatcctgc agccctacgc cgagaggatc 1380cccgtggtgg ccacggccgg gatcaccatc aacttcacct cccagatctc cctcaccggg 1440cccggtgtgc gggtgcacta tggcttgtac aaccagtcgg acccctgccc tggagagttc 1500ctctgttctg tgaatggact ctgtgtccct gcctgtgatg gggtcaagga ctgccccaac 1560ggcctggatg agagaaactg cgtttgcaga gccacattcc agtgcaaaga ggacagcaca 1620tgcatctcac tgcccaaggt ctgtgatggg cagcctgatt gtctcaacgg cagcgacgaa 1680gagcagtgcc aggaaggggt gccatgtggg acattcacct tccagtgtga ggaccggagc 1740tgcgtgaaga agcccaaccc gcagtgtgat gggcggcccg actgcaggga cggctcggat 1800gaggagcact gtgactgtgg cctccagggc ccctccagcc gcattgttgg tggagctgtg 1860tcctccgagg gtgagtggcc atggcaggcc agcctccagg ttcggggtcg acacatctgt 1920gggggggccc tcatcgctga ccgctgggtg ataacagctg cccactgctt ccaggaggac 1980agcatggcct ccacggtgct gtggaccgtg ttcctgggca aggtgtggca gaactcgcgc 2040tggcctggag aggtgtcctt caaggtgagc cgcctgctcc tgcacccgta ccacgaagag 2100gacagccatg actacgacgt ggcgctgctg cagctcgacc acccggtggt gcgctcggcc 2160gccgtgcgcc ccgtctgcct gcccgcgcgc tcccacttct tcgagcccgg cctgcactgc 2220tggattacgg gctggggcgc cttgcgcgag ggcggcccca tcagcaacgc tctgcagaaa 2280gtggatgtgc agttgatccc acaggacctg tgcagcgagg tctatcgcta ccaggtgacg 2340ccacgcatgc tgtgtgccgg ctaccgcaag ggcaagaagg atgcctgtca gggtgactca 2400ggtggtccgc tggtgtgcaa ggcactcagt ggccgctggt tcctggcggg gctggtcagc 2460tggggcctgg gctgtggccg gcctaactac ttcggcgtct acacccgcat cacaggtgtg 2520atcagctgga tccagcaagt ggtgacctga ggaactgccc ccctgcaaag cagggcccac 2580ctcctggact cagagagccc agggcaactg ccaagcaggg ggacaagtat tctggcgggg 2640ggtgggggag agagcaggcc ctgtggtggc aggaggtggc atcttgtctc gtccctgatg 2700tctgctccag tgatggcagg aggatggaga agtgccagca gctgggggtc aagacgtccc 2760ctgaggaccc aggcccacac ccagcccttc tgcctcccaa ttctctctcc tccgtcccct 2820tcctccactg ctgcctaatg caaggcagtg gctcagcagc aagaatgctg gttctacatc 2880ccgaggagtg tctgaggtgc gccccactct gtacagaggc tgtttgggca gccttgcctc 2940cagagagcag attccagctt cggaagcccc tggtctaact tgggatctgg gaatggaagg 3000tgctcccatc ggaggggacc ctcagagccc tggagactgc caggtgggcc tgctgccact 3060gtaagccaaa aggtggggaa gtcctgactc cagggtcctt gccccacccc tgcctgccac 3120ctgggccctc acagcccaga ccctcactgg gaggtgagct cagctgccct ttggaataaa 3180gctgcctgat caaaaaaaaa aaaaaaaaaa aa 321223206DNAMus musculus 2agtttcattg tcgccctgga cctgacagga gaggcccatg gaacttgggg ccacaggcca 60caagggacaa gggccagaca ccccagccat ggctccaggc cattgatcca acctaagctg 120gccagttggg ggtggaaaga ccttggcctg gataaacaga ggcctccagg cctgtgtgca 180ggcccggcac ctaccttcca ctcttgaaga tgccgagatg tttccagctc ccctgttcta 240ccaggatgcc caccaccgag gtcccccaag cggctgatgg tcagggcgat gcgggtgatg 300gagaggaagc tgctgagcca gaggggaagt tcaagccccc aaaaaacacc aagagaaaaa 360accgggacta cgtccgcttc acgccactgt tgctggtctt ggctgcgctg gtctcagcag 420gggtcatgct ttggtatttc ctagggtaca aagcggaagt gaccgtaagc caggtgtact 480ctggcagcct ccgggtgctc aaccgtcatt tctcccagga cctgggccga cgggagtcta 540ttgctttccg cagtgaatct gccaaagccc agaagatgct ccaagaactg gttgccagca 600cccgcctggg tacttactac aactctagtt ctgtctactc ctttggggag ggacccctca 660cctgcttctt ctggtttatc cttgacatcc ctgagtacca gcgactgacc ctgagccctg 720aagtagtgcg cgagctcctg gtggatgagc tactgtccaa cagctcaacc ctggcttcct 780ataagaccga atatgaggtg gacccggaag gcctggtgat cctggaagcc agtgtgaacg 840acatagtcgt actgaattcc acgctgggct gttatcgcta cagctatgtg aacccaggcc 900aggtcctccc attgaagggg cctgaccagc agaccacaag ctgcctgtgg catctgcaag 960ggcccgaaga cctcatgatc aaagtgcggc tggagtggac ccgggtcgat tgcagagaca 1020gggtggcgat gtacgacgca gctgggcccc tggagaagag acttatcacc tcggtctatg 1080ggtgcagccg ccaggaacct gtgatggagg tgctggcatc gggctccgtc atggccgtgg 1140tgtggaaaaa gggcatgcat agctactatg accctttcct gctctcagtg aagtctgtgg 1200ccttccagga ctgccaggtg aacctgacac tggagggccg gctggacaca cagggcttcc 1260tccgtacacc ctactacccc agttactact ctcccagtac ccactgctcc tggcatctca 1320cggtaccctc tctggactac ggcttggcgc tctggttcga tgcctacgca ctgaggaggc 1380agaagtacaa ccgactgtgt actcagggcc agtggatgat ccagaacagg aggctgtgtg 1440gcttccgtac cctgcagcca tatgctgaga ggatccccat ggtggcctca gatggtgtca 1500ccatcaactt cacctcccag atctccctca caggcccggg tgtgcaagtg tactacagct 1560tgtacaacca atcagacccc tgccctggtg agttcctctg ctctgtgaat ggactgtgtg 1620tccctgcgtg tgacgggatc aaggactgcc ccaatggcct ggatgagaga aactgtgtct 1680gcagagccat gttccagtgc caagaggaca gcacgtgcat ttcactgcct agagtctgtg 1740accggcagcc cgactgtctc aatggcagtg acgaagaaca gtgccaagaa ggagtgccct 1800gtgggacatt cactttccag tgtgaggacc ggagctgtgt gaagaagccc aacccagagt 1860gtgacggcca gtcagattgc agagacggct cagatgagca acactgtgac tgtggcctcc 1920agggcctctc cagccgtatt gtgggcggga ccgtgtcctc cgagggtgag tggccatggc 1980aggccagcct ccagattcgg ggtcgacaca tctgtggggg ggctctcatc gctgaccgct 2040gggtcataac ggccgcccac tgcttccagg aggacagcat ggcctccccg aagctgtgga 2100ccgtgttcct gggaaagatg cggcagaact cgcgctggcc aggcgaggtg tccttcaagg 2160tgagccgtct gttcctgcac ccgtaccacg aggaggacag ccatgactac gacgtggccc 2220tgctgcagct cgaccacccc gtggtgtact cggccactgt gcgccccgtc tgcctgcctg 2280cccgctccca cttctttgag ccaggccagc actgctggat cacaggctgg ggagcccagc 2340gagagggtgg tccggtgagc aacaccctgc agaaggtgga cgtacagctg gtccctcagg 2400acctctgcag tgaggcctac cgctaccagg tgtccccacg catgctctgt gctggctacc 2460gcaagggcaa gaaagatgcc tgccagggtg actctggagg cccactggtt tgcagggagc 2520ccagtggccg ctggttcctg gcagggttgg ttagctgggg cctgggctgt ggccgaccca 2580atttctttgg cgtctacacc cgtgtcacac gtgtgatcaa ctggatccag caggtgctga 2640cctgagggct gttctacaga gctggacctg cctccaggcc aagttcaggg tgtccaccca 2700gccaggacac aagtattctg gggcaagtga ccctgctaag gcctgtttcc ctcaggccta 2760ccccagtgac agtacagaga aggatgtcag ctggtggtta ggatgcctcc tgaggtccag 2820gggccagcct cggctaggtt tcacttctaa ccctttctta ttctagtcct ttcccctccc 2880tgctcctacc actgttttgg agtggggtct ggcggccatg accttggcct ccgggtctct 2940gtaggaaaga aagaatcctt ccccttgcaa aagcctcttg ggggaactgc acagagaaag 3000aaggtgcctc tatcaaggct ctatcagagc ccttgagtct gccaagtggg ctgtactcta 3060agccaaatca ccgggcagcc tcagctgcag atgcctgctg aagctctgcc tgctacaggg 3120gcctccctgc cattcactgg aggcccactg tctgttctgg gaataaagca cttgaccaag 3180ccctgacact gaaaaaaaaa aaaaaa 320632999DNARattus norvegicus 3attgtccgtc ctggacctga caggaggccc atggaacttg gggccacagg ccacgaggga 60caagggccag acaccccagt catggttcca ggctattgat ccaacctaag ctggccagtt 120gtgggtggag agaccttggc ctggataaac agaggcctcc aggcctgtgt tcaggcccag 180cacctacctt ccactcttga agatgccaag atgtttccag ctcccctgtt ctaccaggat 240gcccaccgct gaggttcccc aagcagctgg tggtcagggt gatggaggtg atggagagga 300agctgcagag ccagaggggg tgttcaaggc ccccagaaac gccaagagaa aagacaggga 360ctacgtccgc ttcacaccac tgttgctggt cttggctgcg ttggcttcgg caggagtcat 420gctctggtat ttcctagggt acaaggcgga agtgaccata agccaggtgt actctggcag 480cctccgggtg ctcaaccgcc atttttcaca ggacttggcc cgacgggagt ctattgcttt 540ccgcactgaa actgccaaag cccagaagat gttccaagag ctggttgcca gcacccgctt 600gggtacttac tacaactcca gttccatcta cgcctttggg gagggacccc ttatctgctt 660cttctggttc atccttgaca tccccgagta ccagcgactg accctgagcc ctgaggtggt 720gcgcgagctc ctggtgggtg agctactgtc caacagctca gccttggctt cctataggac 780cgaatatgag gtggacccgg aaggcctggt gatactagaa gccagcgtga acgacatagt 840cgtactgaat tccacgctgg gctgttaccg ctacagctac gtgaacccgg gccaggtcct 900ccggttgagg gggcccgacc agcagaccac tagctgcctg tggcacctgc aggggcccga 960ggacctcatg ctcaaagtgc agctagagtg gactcgggtt gattgcagag acagggtggc 1020gatgtacgac gcagctgggc ccctggagaa gagacttatc acctcggtct atgggtgcag 1080ccgccaggaa cccgtgatgg aggtgctggc gtcgggctct gtcatggccg tggtgtggaa 1140gaagggcttg catagcttct atgacccttt tctgctctca gtgaagtctg tggccttcca 1200ggactgccag gtgaacctga ccctggaagg ccggctggat ccacagggct tcctccgtac 1260accctactac cccagttact actcgcccag tacccactgc tcctggcatc tcacggttcc 1320ctctctggac tatggcttgg cactctggtt tgacgcctat gcactgagga ggcagaagta 1380caacctacta tgtactcagg gccagtggat gatccagaac aggaggctat gtggcttccg 1440taccctgcag ccatatgctg agaggatccc cgtggtggcc tcggatggta tcaccatcaa 1500cttcacctcc cagatctccc tcacaggccc gggtgtgcaa gtgtactaca gcttgtacaa 1560ccaatcagac ccctgccctg gagagttcct ctgctctgtg aatggattgt gtgtccctgc 1620ttgtgacgga atcaaggact gccccaacgg cctggatgag aggaactgtg tctgcagagc 1680catgttccag tgccaagagg acagcacgtg catctcactg ccgagagtct gtgaccggca 1740gcccgactgt ctcaatggta gcgacgaaga gcagtgccaa gaaggagtgc cctgtgggac 1800attcactttc cagtgtgagg accggagctg tgtgaagaag cccaaccccg agtgtgacgg 1860gcaggcagac tgcagggatg gctcggatga ggagcactgt gactgtggcc tccagggccc 1920ctccagccgc attgtgggcg gggccatgtc ctcggagggt gagtggccct ggcaggccag 1980tctccagatt cggggtcgac acatctgtgg gggggctctc atcgctgacc gctgggtcat 2040aacagccgct cactgcttcc aggaggacag catggcctcc ccgaggctgt ggaccgtgtt 2100tctgggaaag atgcggcaga attcacgctg gccgggcgag gtgtccttca aggtgagccg 2160cctgttcctg cacccgtatc atgaggagga cagccatgac tacgacgtgg ccctgctgca 2220gctggaccac cctgtggtgt actcggccac cgtgcgcccc gtctgcctgc ccgcacgctc 2280tcacttcttt gagccaggcc agcactgctg gatcacaggc tggggagccc agcgagaggg 2340tggtcctggt agcagcaccc ttcagaaggt ggatgtgcaa ctgatccctc aggacctgtg 2400caatgaggcc taccgttacc aggtgacccc acgcatgctc tgtgctggtt atcgcaaggg 2460caagaaagat gcctgccagg gcgactctgg aggcccactg gtttgcaagg agcccaggtg 2520accacccagc cagggcacaa gtattctggg gcgagcgacc ctgctaaggc ctgtcccctc 2580atgcctaccc cagggacagt acagagaagg atgtcagctg gtggttagga tgcctccagg 2640ggctagcctc agctcggctt cacttccaac cctttcttat tctagtcctt tcccctctcc 2700cctcctactg ctgttttggg gtggggtctg gtggcaatga tgctggttcc aaggtctgtg 2760ggaaagtaag attccttccc cttgcaaaag cctctagggg gaactggatc cgagaaagaa 2820ggtgcctcta tcaaggctct gtcagagccc ttgagactgc caagtagggc cataccgtaa 2880gccaaatcat ggggcagcct cagctgcggg tgcctgctgt gctctgcctg ctacagggcc 2940ctccctgcca ttcactggag gcccactgtc tgttccggaa ataaagcagt tggccaagc 299942440DNAMacaca mulatta 4caggatgcct gtggccaagg ccccccaggt ggctggtggg cagggggacg gaggtgatgg 60cgaggaagcg gagccagagg ggatgttcga ggcccgtgag gactccaaga gaaaagcccg 120gggctacctc cgcctggcgc ccctgtggct gaccctggtt gtgctgactt cagtgggggt 180gctactctgg tatttcctag ggtacaaggc ggaggtgacg gtcagccagg tgtactcagg 240cagcctgcgc gtgctcaatc gccacttctc ccaggatctt acccgccggg aatccagtgc 300cttccgcagt gaaaccgcca aagcccagaa gatgctcaag gagctcatcg ccagcacccg 360cctgggaact tattacaact ccagctccgt ctattccttt ggggagggac cgctcacctg 420cttcttctgg ttcattctcc aaatccccga gcaccgccgg ctgatgctga gccccgaggt 480ggtgcaggca ctgctggtgg aggagctgct gtccacagtc aacagctcgg cggctgtccc 540ctacagggcc gagtacgaag tggaccccga gggcctagtg atcctagaag ccagtgtgaa 600agacatagct gcactgaatt ccacgctggg ttgttaccgc tacagctacg tgggccaggg 660tcaggtcctc cggctgaagg gacccgacca cctggcctcc agctgcctgt ggcacctgca 720gggccccgaa gacctcatgc tgaaactccg gctggagtgg acgctggccg agtgccggga 780ccgactggcc atgtatgacg tggctgggcc cctggagaag aggctcatca cctcggtgta 840tggctgcagc cgccaggagc ctgtggtgga agtcctggca tcgggggcca tcatggcggt 900ggtctggaag aagggcctgc acagctacta cgaccccttt atgctctccg tgcagtcggt 960ggtcttccag gcctgcgagg taaacctgac gctggatgac aggctggact cccagggcgt 1020cctcagcacc ccgtacttcc ccagctacta ctcgccccga acccactgct cctggcacct 1080cacggtgccc tctctggact acggcttggc cctctggttt gacgcctacg cactgcggag 1140gcagaagtat gatttgccgt gcacccaggg ccagtggacg atccagaaca ggaggctgtg 1200tggcctgcgc atcctgcagc cttacgccga gaggatcccc gtggtggcca cggccggcat 1260caccatcaat ttcacctccc agatctccct cacagggcct ggtgtgcggg tgcactatgg 1320cttgtacaac cagtcggacc cctgccctgg agagttcctc tgctctgtga acggactctg 1380cgtccctgcc tgtgatgggg tcaaggactg ccccaacggc ctggatgaga gaaactgcgt 1440ttgcagagcc acattccagt gccaagagga cagcacgtgc atctcactgc ttaaggtctg 1500tgacgggcag cctgactgtc tcaacggcag cgatgaagag cggtgccagg aaggggtgcc 1560ctgcgggaca ttcaccttcc agtgtgagga ccagagctgc gtgaagaagc ccaacccaca 1620gtgtgatggg cggcccgact gcagggacgg ctcagacgag cagcactgtg actgtggcct 1680ccagggcccc tccagtcgca ttgttggtgg ggccgtgtcc tccgagggtg agtggccatg 1740gcaggccagc ctccaggttc ggggtcgaca catctgtggg ggcgccctca tcgctgaccg 1800ctgggtgata acagctgccc attgcttcca ggaggacagc atggcctccc cggcgctgtg 1860gacggtgttc ctgggcaagg tgtggcagaa ctcgcgctgg cctggagagg tgtccttcaa 1920ggtgagccgc ctactcctgc atccgtatca cgaagaggac agccacgact acgacgtggc 1980gctgttgcag ctcgaccacc cggtggtgcg ctcggccgcc gtgcgtccag tctgcctgcc 2040cgcgcgctcc cacttcttcg aacccggcct gcactgctgg atcactggct ggggcgccct 2100gcgcgaaggc ggccccacca gcaatgctct gcagaaagtg gacgtgcagt tgatcccaca 2160ggacctgtgc agcgaggcct atcgctacca ggtgacgcca cgcatgctgt gtgccggcta 2220ccgcaagggc aagaaggatg cctgccaggg tgactcgggt ggtccgctgg tatgcaaggc 2280actcagtggc cgctggttcc tggcagggct ggtcagctgg ggcctgggct gtggccggcc 2340taactacttc ggcgtctaca cccgcatcac aggtgtgatc ggctggatcc agcaagtggt 2400gacctgagga actgcccccc tgcagagcag gtcccacctc 244053188DNAMacaca mulatta 5cttgagccac acccagtcca gctctggtgc ctgccctctg gggtgagctg ccttgagatg 60cacttcgctc ctctgtgaac tgtctcggca cccacttccg gtcactgccg cctgatgttg 120ttactcttcc actctgaaag gatgcctgtg gccaaggccc cccaggtggc tggtgggcag 180ggggacggag gtgatggcga ggaagcggag ccagagggga tgttcgaggc ccgtgaggac 240tccaagagaa aagcccgggg ctacctccgc ctggcgcccc tgtggctgac cctggttgtg 300ctgacttcag tgggggtgct actctggtat ttcctagggt acaaggcgga ggtgacggtc 360agccaggtgt actcaggcag cctgcgcgtg ctcaatcgcc acttctccca ggatcttacc 420cgccgggaat ccagtgcctt ccgcagtgaa accgccaaag cccagaagat gctcaaggag 480ctcatcgcca gcacccgcct gggaacttat tacaactcca gctccgtcta ttcctttggg 540gagggaccgc tcacctgctt cttctggttc attctccaaa tccccgagca ccgccggctg 600atgctgagcc ccgaggtggt gcaggcactg ctggtggagg agctgctgtc cacagtcaac 660agctcggcgg ctgtccccta cagggccgag tacgaagtgg accccgaggg cctagtgatc 720ctagaagcca gtgtgaaaga catagctgca ctgaattcca cgctgggttg ttaccgctac 780agctacgtgg gccagggtca ggtcctccgg ctgaagggac ccgaccacct ggcctccagc 840tgcctgtggc acctgcaggg ccccgaagac ctcatgctga aactccggct ggagtggacg 900ctggccgagt gccgggaccg actggccatg tatgacgtgg ctgggcccct ggagaagagg 960ctcatcacct cggtgtatgg ctgcagccgc caggagcctg tggtggaagt cctggcatcg 1020ggggccatca tggcggtggt ctggaagaag ggcctgcaca gctactacga cccctttatg 1080ctctccgtgc agtcggtggt cttccaggcc tgcgaggtaa acctgacgct ggatgacagg 1140ctggactccc agggcgtcct cagcaccccg tacttcccca gctactactc gccccgaacc 1200cactgctcct ggcacctcac ggtgccctct ctggactacg gcttggccct ctggtttgac 1260gcctacgcac tgcggaggca gaagtatgat ttgccgtgca cccagggcca gtggacgatc 1320cagaacagga ggctgtgtgg cctgcgcatc ctgcagcctt acgccgagag gatccccgtg 1380gtggccacgg ccggcatcac catcaatttc acctcccaga tctccctcac agggcctggt 1440gtgcgggtgc actatggctt gtacaaccag tcggacccct gccctggaga gttcctctgc 1500tctgtgaacg gactctgcgt ccctgcctgt gatggggtca aggactgccc caacggcctg 1560gatgagagaa actgcgtttg cagagccaca ttccagtgcc aagaggacag cacgtgcatc 1620tcactgctta aggtctgtga cgggcagcct gactgtctca acggcagcga tgaagagcgg 1680tgccaggaag gggtgccctg cgggacattc accttccagt gtgaggacca gagctgcgtg 1740aagaagccca acccacagtg tgatgggcgg cccgactgca gggacggctc agacgagcag 1800cactgtgact gtggcctcca gggcccctcc agtcgcattg ttggtggggc cgtgtcctcc 1860gagggtgagt ggccatggca ggccagcctc caggttcggg gtcgacacat ctgtgggggc 1920gccctcatcg ctgaccgctg ggtgataaca gctgcccatt gcttccagga ggacagcatg 1980gcctccccgg cgctgtggac ggtgttcctg ggcaaggtgt ggcagaactc gcgctggcct 2040ggagaggtgt ccttcaaggt gagccgccta ctcctgcatc cgtatcacga agaggacagc 2100cacgactacg acgtggcgct gttgcagctc gaccacccgg tggtgcgctc ggccgccgtg 2160cgtccagtct gcctgcccgc gcgctcccac ttcttcgaac ccggcctgca ctgctggatc 2220actggctggg gcgccctgcg cgaaggcggc cccaccagca atgctctgca gaaagtggac 2280gtgcagttga tcccacagga cctgtgcagc gaggcctatc gctaccaggt gacgccacgc 2340atgctgtgtg ccggctaccg caagggcaag aaggatgcct gccagggtga ctcgggtggt 2400ccgctggtat gcaaggcact cagtggccgc tggttcctgg cagggctggt cagctggggc 2460ctgggctgtg gccggcctaa ctacttcggc gtctacaccc gcatcacagg tgtgatcggc 2520tggatccagc aagtggtgac ctgaggaact gcccccctgc agagcaggtc ccacctcttg 2580gactcagaga gcccagggca attgccaagc agggggacaa gtattctggg gggagggggg 2640cgcgagcagg ccctgtggtg gcaggaggtg gcatcttgtc ttgtccctga tgtctgctcc 2700agtgatggca ggaggatgga ggagtgccag cagctggggg tcaagacgtc ccctagggac 2760ccaggcccac acccagccct tctgcctccc gattctctct cctctgtccc cttcctccac 2820tgctgcctat tgcaaggaag tggctcagca gcaagaatgc tggctctacg tccccaggag 2880tgtctgagct gtgccccact ctgtacagag gctgcttggg cagccttgcc tctagagagc 2940agatgccagc ttcggaagcc cctggtctaa cttgggatct gggaatggaa ggtgccccca 3000taggagggga

ccctcacagc cccggggact gccaggtggg ccggctgcca ccgtaagcca 3060aaaaaggtgg ggaagccctg actccaaggt ccttgcccca cccctgcctg ccacctggcc 3120cctcacagcc cagaccctca ccggcaggtg agctcagctg ccctttggaa taaagctgcc 3180tgatccaa 318863212DNAHomo sapiens 6tttttttttt tttttttttt tgatcaggca gctttattcc aaagggcagc tgagctcacc 60tcccagtgag ggtctgggct gtgagggccc aggtggcagg caggggtggg gcaaggaccc 120tggagtcagg acttccccac cttttggctt acagtggcag caggcccacc tggcagtctc 180cagggctctg agggtcccct ccgatgggag caccttccat tcccagatcc caagttagac 240caggggcttc cgaagctgga atctgctctc tggaggcaag gctgcccaaa cagcctctgt 300acagagtggg gcgcacctca gacactcctc gggatgtaga accagcattc ttgctgctga 360gccactgcct tgcattaggc agcagtggag gaaggggacg gaggagagag aattgggagg 420cagaagggct gggtgtgggc ctgggtcctc aggggacgtc ttgaccccca gctgctggca 480cttctccatc ctcctgccat cactggagca gacatcaggg acgagacaag atgccacctc 540ctgccaccac agggcctgct ctctccccca ccccccgcca gaatacttgt ccccctgctt 600ggcagttgcc ctgggctctc tgagtccagg aggtgggccc tgctttgcag gggggcagtt 660cctcaggtca ccacttgctg gatccagctg atcacacctg tgatgcgggt gtagacgccg 720aagtagttag gccggccaca gcccaggccc cagctgacca gccccgccag gaaccagcgg 780ccactgagtg ccttgcacac cagcggacca cctgagtcac cctgacaggc atccttcttg 840cccttgcggt agccggcaca cagcatgcgt ggcgtcacct ggtagcgata gacctcgctg 900cacaggtcct gtgggatcaa ctgcacatcc actttctgca gagcgttgct gatggggccg 960ccctcgcgca aggcgcccca gcccgtaatc cagcagtgca ggccgggctc gaagaagtgg 1020gagcgcgcgg gcaggcagac ggggcgcacg gcggccgagc gcaccaccgg gtggtcgagc 1080tgcagcagcg ccacgtcgta gtcatggctg tcctcttcgt ggtacgggtg caggagcagg 1140cggctcacct tgaaggacac ctctccaggc cagcgcgagt tctgccacac cttgcccagg 1200aacacggtcc acagcaccgt ggaggccatg ctgtcctcct ggaagcagtg ggcagctgtt 1260atcacccagc ggtcagcgat gagggccccc ccacagatgt gtcgaccccg aacctggagg 1320ctggcctgcc atggccactc accctcggag gacacagctc caccaacaat gcggctggag 1380gggccctgga ggccacagtc acagtgctcc tcatccgagc cgtccctgca gtcgggccgc 1440ccatcacact gcgggttggg cttcttcacg cagctccggt cctcacactg gaaggtgaat 1500gtcccacatg gcaccccttc ctggcactgc tcttcgtcgc tgccgttgag acaatcaggc 1560tgcccatcac agaccttggg cagtgagatg catgtgctgt cctctttgca ctggaatgtg 1620gctctgcaaa cgcagtttct ctcatccagg ccgttggggc agtccttgac cccatcacag 1680gcagggacac agagtccatt cacagaacag aggaactctc cagggcaggg gtccgactgg 1740ttgtacaagc catagtgcac ccgcacaccg ggcccggtga gggagatctg ggaggtgaag 1800ttgatggtga tcccggccgt ggccaccacg gggatcctct cggcgtaggg ctgcaggatg 1860cgcaagccac acagcctcct gttctggatc gtccactggc cctgggtgca cggcaaatca 1920tacttctgcc tcctcagtgc ataggcatca aaccagaggg ccaagccgta gtccagagag 1980ggcaccgtga ggtgccagga gcagtgggtt tggggcgagt agtagctggg gaagtacggg 2040gtgctgagga cgccctggga gtcgagcctg ttgtccagcg tcaggttcac ttcacaggcc 2100tggaagacca ccggctgcac ggagagcacg aaggggtcgt agtagctgtg caggcccttc 2160ttccagacga ccgccatgat ggcccccgac gccagaacct ccaccacggg ctcctggcgg 2220ctgcagccgt acaccgaggt gatgagcctc ttctccaggg gcccggccac gtcatacatg 2280gccagtcggt cccggcactc tgccagcgtc cactccagcc ggagtttgag catgaggtcc 2340ttggggccct gcaggtgcca caggcagctg gaggccaggt ggtcaggccc cttcagccgg 2400aggacctggc cctggcccac gtagctgtag cggtaacaac ccagcgtgga attcaatgca 2460gctatgtctt tcacactggc ttccaggatc actaggccct cggggtccac ttcgtactcg 2520gccctgtagg ggacggcagc cgagctgttg actgtggaca gcagctcctc caccagcagt 2580gcctgcacca cctcggggct cagcatcagc cggcggtgct cggggatttg gagaatgaac 2640cagaagaagc aggtgagggg tccctcccca aaggaataga cggagctgga gttgtagtaa 2700gttcccaggc gggtgctggt gatgagctcc ttgagcatct tctgggcttt ggcggtttca 2760ctgcggaagg cactagattc ccggcgggta agatcctggg agaagtggcg attgagtaca 2820cgcagactgc ctgagtacac ctggctgacc atcacctccg ccttgtaccc taggaaatac 2880cagagtagca cccccgccga agccagcacg agcagggcca gcagcacaaa caggggcacc 2940aggcggaggt agccccgggc ttttctcttg gagtcctcac aggccttgaa catcccctcc 3000ggctccgctt cctcgccatc acctccgtcc ccctgcccgc cagccacctg gggggcctcg 3060gccacgggca tccttttgga gtggaagagt aacaacatca ggcggcagtg actgcaagtg 3120ggtgccgaga cagctcacag aggagggaag tgcatctcag gtcagctcgc accagagggc 3180aggcaccaga gctggactgg gtctggctca ag 321273206DNAMus musculus 7tttttttttt tttttcagtg tcagggcttg gtcaagtgct ttattcccag aacagacagt 60gggcctccag tgaatggcag ggaggcccct gtagcaggca gagcttcagc aggcatctgc 120agctgaggct gcccggtgat ttggcttaga gtacagccca cttggcagac tcaagggctc 180tgatagagcc ttgatagagg caccttcttt ctctgtgcag ttcccccaag aggcttttgc 240aaggggaagg attctttctt tcctacagag acccggaggc caaggtcatg gccgccagac 300cccactccaa aacagtggta ggagcaggga ggggaaagga ctagaataag aaagggttag 360aagtgaaacc tagccgaggc tggcccctgg acctcaggag gcatcctaac caccagctga 420catccttctc tgtactgtca ctggggtagg cctgagggaa acaggcctta gcagggtcac 480ttgccccaga atacttgtgt cctggctggg tggacaccct gaacttggcc tggaggcagg 540tccagctctg tagaacagcc ctcaggtcag cacctgctgg atccagttga tcacacgtgt 600gacacgggtg tagacgccaa agaaattggg tcggccacag cccaggcccc agctaaccaa 660ccctgccagg aaccagcggc cactgggctc cctgcaaacc agtgggcctc cagagtcacc 720ctggcaggca tctttcttgc ccttgcggta gccagcacag agcatgcgtg gggacacctg 780gtagcggtag gcctcactgc agaggtcctg agggaccagc tgtacgtcca ccttctgcag 840ggtgttgctc accggaccac cctctcgctg ggctccccag cctgtgatcc agcagtgctg 900gcctggctca aagaagtggg agcgggcagg caggcagacg gggcgcacag tggccgagta 960caccacgggg tggtcgagct gcagcagggc cacgtcgtag tcatggctgt cctcctcgtg 1020gtacgggtgc aggaacagac ggctcacctt gaaggacacc tcgcctggcc agcgcgagtt 1080ctgccgcatc tttcccagga acacggtcca cagcttcggg gaggccatgc tgtcctcctg 1140gaagcagtgg gcggccgtta tgacccagcg gtcagcgatg agagcccccc cacagatgtg 1200tcgaccccga atctggaggc tggcctgcca tggccactca ccctcggagg acacggtccc 1260gcccacaata cggctggaga ggccctggag gccacagtca cagtgttgct catctgagcc 1320gtctctgcaa tctgactggc cgtcacactc tgggttgggc ttcttcacac agctccggtc 1380ctcacactgg aaagtgaatg tcccacaggg cactccttct tggcactgtt cttcgtcact 1440gccattgaga cagtcgggct gccggtcaca gactctaggc agtgaaatgc acgtgctgtc 1500ctcttggcac tggaacatgg ctctgcagac acagtttctc tcatccaggc cattggggca 1560gtccttgatc ccgtcacacg cagggacaca cagtccattc acagagcaga ggaactcacc 1620agggcagggg tctgattggt tgtacaagct gtagtacact tgcacacccg ggcctgtgag 1680ggagatctgg gaggtgaagt tgatggtgac accatctgag gccaccatgg ggatcctctc 1740agcatatggc tgcagggtac ggaagccaca cagcctcctg ttctggatca tccactggcc 1800ctgagtacac agtcggttgt acttctgcct cctcagtgcg taggcatcga accagagcgc 1860caagccgtag tccagagagg gtaccgtgag atgccaggag cagtgggtac tgggagagta 1920gtaactgggg tagtagggtg tacggaggaa gccctgtgtg tccagccggc cctccagtgt 1980caggttcacc tggcagtcct ggaaggccac agacttcact gagagcagga aagggtcata 2040gtagctatgc atgccctttt tccacaccac ggccatgacg gagcccgatg ccagcacctc 2100catcacaggt tcctggcggc tgcacccata gaccgaggtg ataagtctct tctccagggg 2160cccagctgcg tcgtacatcg ccaccctgtc tctgcaatcg acccgggtcc actccagccg 2220cactttgatc atgaggtctt cgggcccttg cagatgccac aggcagcttg tggtctgctg 2280gtcaggcccc ttcaatggga ggacctggcc tgggttcaca tagctgtagc gataacagcc 2340cagcgtggaa ttcagtacga ctatgtcgtt cacactggct tccaggatca ccaggccttc 2400cgggtccacc tcatattcgg tcttatagga agccagggtt gagctgttgg acagtagctc 2460atccaccagg agctcgcgca ctacttcagg gctcagggtc agtcgctggt actcagggat 2520gtcaaggata aaccagaaga agcaggtgag gggtccctcc ccaaaggagt agacagaact 2580agagttgtag taagtaccca ggcgggtgct ggcaaccagt tcttggagca tcttctgggc 2640tttggcagat tcactgcgga aagcaataga ctcccgtcgg cccaggtcct gggagaaatg 2700acggttgagc acccggaggc tgccagagta cacctggctt acggtcactt ccgctttgta 2760ccctaggaaa taccaaagca tgacccctgc tgagaccagc gcagccaaga ccagcaacag 2820tggcgtgaag cggacgtagt cccggttttt tctcttggtg ttttttgggg gcttgaactt 2880cccctctggc tcagcagctt cctctccatc acccgcatcg ccctgaccat cagccgcttg 2940ggggacctcg gtggtgggca tcctggtaga acaggggagc tggaaacatc tcggcatctt 3000caagagtgga aggtaggtgc cgggcctgca cacaggcctg gaggcctctg tttatccagg 3060ccaaggtctt tccaccccca actggccagc ttaggttgga tcaatggcct ggagccatgg 3120ctggggtgtc tggcccttgt cccttgtggc ctgtggcccc aagttccatg ggcctctcct 3180gtcaggtcca gggcgacaat gaaact 320682999DNARattus norvegicus 8gcttggccaa ctgctttatt tccggaacag acagtgggcc tccagtgaat ggcagggagg 60gccctgtagc aggcagagca cagcaggcac ccgcagctga ggctgcccca tgatttggct 120tacggtatgg ccctacttgg cagtctcaag ggctctgaca gagccttgat agaggcacct 180tctttctcgg atccagttcc ccctagaggc ttttgcaagg ggaaggaatc ttactttccc 240acagaccttg gaaccagcat cattgccacc agaccccacc ccaaaacagc agtaggaggg 300gagaggggaa aggactagaa taagaaaggg ttggaagtga agccgagctg aggctagccc 360ctggaggcat cctaaccacc agctgacatc cttctctgta ctgtccctgg ggtaggcatg 420aggggacagg ccttagcagg gtcgctcgcc ccagaatact tgtgccctgg ctgggtggtc 480acctgggctc cttgcaaacc agtgggcctc cagagtcgcc ctggcaggca tctttcttgc 540ccttgcgata accagcacag agcatgcgtg gggtcacctg gtaacggtag gcctcattgc 600acaggtcctg agggatcagt tgcacatcca ccttctgaag ggtgctgcta ccaggaccac 660cctctcgctg ggctccccag cctgtgatcc agcagtgctg gcctggctca aagaagtgag 720agcgtgcggg caggcagacg gggcgcacgg tggccgagta caccacaggg tggtccagct 780gcagcagggc cacgtcgtag tcatggctgt cctcctcatg atacgggtgc aggaacaggc 840ggctcacctt gaaggacacc tcgcccggcc agcgtgaatt ctgccgcatc tttcccagaa 900acacggtcca cagcctcggg gaggccatgc tgtcctcctg gaagcagtga gcggctgtta 960tgacccagcg gtcagcgatg agagcccccc cacagatgtg tcgaccccga atctggagac 1020tggcctgcca gggccactca ccctccgagg acatggcccc gcccacaatg cggctggagg 1080ggccctggag gccacagtca cagtgctcct catccgagcc atccctgcag tctgcctgcc 1140cgtcacactc ggggttgggc ttcttcacac agctccggtc ctcacactgg aaagtgaatg 1200tcccacaggg cactccttct tggcactgct cttcgtcgct accattgaga cagtcgggct 1260gccggtcaca gactctcggc agtgagatgc acgtgctgtc ctcttggcac tggaacatgg 1320ctctgcagac acagttcctc tcatccaggc cgttggggca gtccttgatt ccgtcacaag 1380cagggacaca caatccattc acagagcaga ggaactctcc agggcagggg tctgattggt 1440tgtacaagct gtagtacact tgcacacccg ggcctgtgag ggagatctgg gaggtgaagt 1500tgatggtgat accatccgag gccaccacgg ggatcctctc agcatatggc tgcagggtac 1560ggaagccaca tagcctcctg ttctggatca tccactggcc ctgagtacat agtaggttgt 1620acttctgcct cctcagtgca taggcgtcaa accagagtgc caagccatag tccagagagg 1680gaaccgtgag atgccaggag cagtgggtac tgggcgagta gtaactgggg tagtagggtg 1740tacggaggaa gccctgtgga tccagccggc cttccagggt caggttcacc tggcagtcct 1800ggaaggccac agacttcact gagagcagaa aagggtcata gaagctatgc aagcccttct 1860tccacaccac ggccatgaca gagcccgacg ccagcacctc catcacgggt tcctggcggc 1920tgcacccata gaccgaggtg ataagtctct tctccagggg cccagctgcg tcgtacatcg 1980ccaccctgtc tctgcaatca acccgagtcc actctagctg cactttgagc atgaggtcct 2040cgggcccctg caggtgccac aggcagctag tggtctgctg gtcgggcccc ctcaaccgga 2100ggacctggcc cgggttcacg tagctgtagc ggtaacagcc cagcgtggaa ttcagtacga 2160ctatgtcgtt cacgctggct tctagtatca ccaggccttc cgggtccacc tcatattcgg 2220tcctatagga agccaaggct gagctgttgg acagtagctc acccaccagg agctcgcgca 2280ccacctcagg gctcagggtc agtcgctggt actcggggat gtcaaggatg aaccagaaga 2340agcagataag gggtccctcc ccaaaggcgt agatggaact ggagttgtag taagtaccca 2400agcgggtgct ggcaaccagc tcttggaaca tcttctgggc tttggcagtt tcagtgcgga 2460aagcaataga ctcccgtcgg gccaagtcct gtgaaaaatg gcggttgagc acccggaggc 2520tgccagagta cacctggctt atggtcactt ccgccttgta ccctaggaaa taccagagca 2580tgactcctgc cgaagccaac gcagccaaga ccagcaacag tggtgtgaag cggacgtagt 2640ccctgtcttt tctcttggcg tttctggggg ccttgaacac cccctctggc tctgcagctt 2700cctctccatc acctccatca ccctgaccac cagctgcttg gggaacctca gcggtgggca 2760tcctggtaga acaggggagc tggaaacatc ttggcatctt caagagtgga aggtaggtgc 2820tgggcctgaa cacaggcctg gaggcctctg tttatccagg ccaaggtctc tccacccaca 2880actggccagc ttaggttgga tcaatagcct ggaaccatga ctggggtgtc tggcccttgt 2940ccctcgtggc ctgtggcccc aagttccatg ggcctcctgt caggtccagg acggacaat 299992440DNAMacaca mulatta 9gaggtgggac ctgctctgca ggggggcagt tcctcaggtc accacttgct ggatccagcc 60gatcacacct gtgatgcggg tgtagacgcc gaagtagtta ggccggccac agcccaggcc 120ccagctgacc agccctgcca ggaaccagcg gccactgagt gccttgcata ccagcggacc 180acccgagtca ccctggcagg catccttctt gcccttgcgg tagccggcac acagcatgcg 240tggcgtcacc tggtagcgat aggcctcgct gcacaggtcc tgtgggatca actgcacgtc 300cactttctgc agagcattgc tggtggggcc gccttcgcgc agggcgcccc agccagtgat 360ccagcagtgc aggccgggtt cgaagaagtg ggagcgcgcg ggcaggcaga ctggacgcac 420ggcggccgag cgcaccaccg ggtggtcgag ctgcaacagc gccacgtcgt agtcgtggct 480gtcctcttcg tgatacggat gcaggagtag gcggctcacc ttgaaggaca cctctccagg 540ccagcgcgag ttctgccaca ccttgcccag gaacaccgtc cacagcgccg gggaggccat 600gctgtcctcc tggaagcaat gggcagctgt tatcacccag cggtcagcga tgagggcgcc 660cccacagatg tgtcgacccc gaacctggag gctggcctgc catggccact caccctcgga 720ggacacggcc ccaccaacaa tgcgactgga ggggccctgg aggccacagt cacagtgctg 780ctcgtctgag ccgtccctgc agtcgggccg cccatcacac tgtgggttgg gcttcttcac 840gcagctctgg tcctcacact ggaaggtgaa tgtcccgcag ggcacccctt cctggcaccg 900ctcttcatcg ctgccgttga gacagtcagg ctgcccgtca cagaccttaa gcagtgagat 960gcacgtgctg tcctcttggc actggaatgt ggctctgcaa acgcagtttc tctcatccag 1020gccgttgggg cagtccttga ccccatcaca ggcagggacg cagagtccgt tcacagagca 1080gaggaactct ccagggcagg ggtccgactg gttgtacaag ccatagtgca cccgcacacc 1140aggccctgtg agggagatct gggaggtgaa attgatggtg atgccggccg tggccaccac 1200ggggatcctc tcggcgtaag gctgcaggat gcgcaggcca cacagcctcc tgttctggat 1260cgtccactgg ccctgggtgc acggcaaatc atacttctgc ctccgcagtg cgtaggcgtc 1320aaaccagagg gccaagccgt agtccagaga gggcaccgtg aggtgccagg agcagtgggt 1380tcggggcgag tagtagctgg ggaagtacgg ggtgctgagg acgccctggg agtccagcct 1440gtcatccagc gtcaggttta cctcgcaggc ctggaagacc accgactgca cggagagcat 1500aaaggggtcg tagtagctgt gcaggccctt cttccagacc accgccatga tggcccccga 1560tgccaggact tccaccacag gctcctggcg gctgcagcca tacaccgagg tgatgagcct 1620cttctccagg ggcccagcca cgtcatacat ggccagtcgg tcccggcact cggccagcgt 1680ccactccagc cggagtttca gcatgaggtc ttcggggccc tgcaggtgcc acaggcagct 1740ggaggccagg tggtcgggtc ccttcagccg gaggacctga ccctggccca cgtagctgta 1800gcggtaacaa cccagcgtgg aattcagtgc agctatgtct ttcacactgg cttctaggat 1860cactaggccc tcggggtcca cttcgtactc ggccctgtag gggacagccg ccgagctgtt 1920gactgtggac agcagctcct ccaccagcag tgcctgcacc acctcggggc tcagcatcag 1980ccggcggtgc tcggggattt ggagaatgaa ccagaagaag caggtgagcg gtccctcccc 2040aaaggaatag acggagctgg agttgtaata agttcccagg cgggtgctgg cgatgagctc 2100cttgagcatc ttctgggctt tggcggtttc actgcggaag gcactggatt cccggcgggt 2160aagatcctgg gagaagtggc gattgagcac gcgcaggctg cctgagtaca cctggctgac 2220cgtcacctcc gccttgtacc ctaggaaata ccagagtagc acccccactg aagtcagcac 2280aaccagggtc agccacaggg gcgccaggcg gaggtagccc cgggcttttc tcttggagtc 2340ctcacgggcc tcgaacatcc cctctggctc cgcttcctcg ccatcacctc cgtccccctg 2400cccaccagcc acctgggggg ccttggccac aggcatcctg 2440103188DNAMacaca mulatta 10ttggatcagg cagctttatt ccaaagggca gctgagctca cctgccggtg agggtctggg 60ctgtgagggg ccaggtggca ggcaggggtg gggcaaggac cttggagtca gggcttcccc 120accttttttg gcttacggtg gcagccggcc cacctggcag tccccggggc tgtgagggtc 180ccctcctatg ggggcacctt ccattcccag atcccaagtt agaccagggg cttccgaagc 240tggcatctgc tctctagagg caaggctgcc caagcagcct ctgtacagag tggggcacag 300ctcagacact cctggggacg tagagccagc attcttgctg ctgagccact tccttgcaat 360aggcagcagt ggaggaaggg gacagaggag agagaatcgg gaggcagaag ggctgggtgt 420gggcctgggt ccctagggga cgtcttgacc cccagctgct ggcactcctc catcctcctg 480ccatcactgg agcagacatc agggacaaga caagatgcca cctcctgcca ccacagggcc 540tgctcgcgcc cccctccccc cagaatactt gtccccctgc ttggcaattg ccctgggctc 600tctgagtcca agaggtggga cctgctctgc aggggggcag ttcctcaggt caccacttgc 660tggatccagc cgatcacacc tgtgatgcgg gtgtagacgc cgaagtagtt aggccggcca 720cagcccaggc cccagctgac cagccctgcc aggaaccagc ggccactgag tgccttgcat 780accagcggac cacccgagtc accctggcag gcatccttct tgcccttgcg gtagccggca 840cacagcatgc gtggcgtcac ctggtagcga taggcctcgc tgcacaggtc ctgtgggatc 900aactgcacgt ccactttctg cagagcattg ctggtggggc cgccttcgcg cagggcgccc 960cagccagtga tccagcagtg caggccgggt tcgaagaagt gggagcgcgc gggcaggcag 1020actggacgca cggcggccga gcgcaccacc gggtggtcga gctgcaacag cgccacgtcg 1080tagtcgtggc tgtcctcttc gtgatacgga tgcaggagta ggcggctcac cttgaaggac 1140acctctccag gccagcgcga gttctgccac accttgccca ggaacaccgt ccacagcgcc 1200ggggaggcca tgctgtcctc ctggaagcaa tgggcagctg ttatcaccca gcggtcagcg 1260atgagggcgc ccccacagat gtgtcgaccc cgaacctgga ggctggcctg ccatggccac 1320tcaccctcgg aggacacggc cccaccaaca atgcgactgg aggggccctg gaggccacag 1380tcacagtgct gctcgtctga gccgtccctg cagtcgggcc gcccatcaca ctgtgggttg 1440ggcttcttca cgcagctctg gtcctcacac tggaaggtga atgtcccgca gggcacccct 1500tcctggcacc gctcttcatc gctgccgttg agacagtcag gctgcccgtc acagacctta 1560agcagtgaga tgcacgtgct gtcctcttgg cactggaatg tggctctgca aacgcagttt 1620ctctcatcca ggccgttggg gcagtccttg accccatcac aggcagggac gcagagtccg 1680ttcacagagc agaggaactc tccagggcag gggtccgact ggttgtacaa gccatagtgc 1740acccgcacac caggccctgt gagggagatc tgggaggtga aattgatggt gatgccggcc 1800gtggccacca cggggatcct ctcggcgtaa ggctgcagga tgcgcaggcc acacagcctc 1860ctgttctgga tcgtccactg gccctgggtg cacggcaaat catacttctg cctccgcagt 1920gcgtaggcgt caaaccagag ggccaagccg tagtccagag agggcaccgt gaggtgccag 1980gagcagtggg ttcggggcga gtagtagctg gggaagtacg gggtgctgag gacgccctgg 2040gagtccagcc tgtcatccag cgtcaggttt acctcgcagg cctggaagac caccgactgc 2100acggagagca taaaggggtc gtagtagctg tgcaggccct tcttccagac caccgccatg 2160atggcccccg atgccaggac ttccaccaca ggctcctggc ggctgcagcc atacaccgag 2220gtgatgagcc tcttctccag gggcccagcc acgtcataca tggccagtcg gtcccggcac 2280tcggccagcg tccactccag ccggagtttc agcatgaggt cttcggggcc ctgcaggtgc 2340cacaggcagc tggaggccag gtggtcgggt cccttcagcc ggaggacctg accctggccc 2400acgtagctgt agcggtaaca acccagcgtg gaattcagtg cagctatgtc tttcacactg 2460gcttctagga tcactaggcc ctcggggtcc acttcgtact cggccctgta ggggacagcc 2520gccgagctgt tgactgtgga cagcagctcc tccaccagca gtgcctgcac cacctcgggg 2580ctcagcatca gccggcggtg ctcggggatt tggagaatga accagaagaa gcaggtgagc 2640ggtccctccc caaaggaata gacggagctg gagttgtaat aagttcccag gcgggtgctg 2700gcgatgagct ccttgagcat cttctgggct ttggcggttt cactgcggaa ggcactggat 2760tcccggcggg taagatcctg

ggagaagtgg cgattgagca cgcgcaggct gcctgagtac 2820acctggctga ccgtcacctc cgccttgtac cctaggaaat accagagtag cacccccact 2880gaagtcagca caaccagggt cagccacagg ggcgccaggc ggaggtagcc ccgggctttt 2940ctcttggagt cctcacgggc ctcgaacatc ccctctggct ccgcttcctc gccatcacct 3000ccgtccccct gcccaccagc cacctggggg gccttggcca caggcatcct ttcagagtgg 3060aagagtaaca acatcaggcg gcagtgaccg gaagtgggtg ccgagacagt tcacagagga 3120gcgaagtgca tctcaaggca gctcacccca gagggcaggc accagagctg gactgggtgt 3180ggctcaag 31881116PRTUnknownsource/note="Description of Unknown Exemplary hydrophobic membrane translocation peptide" 11Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro1 5 10 151211PRTUnknownsource/note="Description of Unknown RFGF analogue peptide" 12Ala Ala Leu Leu Pro Val Leu Leu Ala Ala Pro1 5 101313PRTHuman immunodeficiency virus 13Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln1 5 101416PRTDrosophila sp. 14Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys1 5 10 151521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 15cuuacgcuga guacuucgat t 211621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 16ucgaaguacu cagcguaagt t 211721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 17uggccuggag agguguccuu c 211821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 18ggggugcuac ucugguauuu c 211921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 19caacggccug gaugagagaa a 212021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 20aucgccacuu cucccaggau c 212121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 21gguggcagga gguggcaucu u 212221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 22gaccgacugg ccauguauga c 212321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 23ggugugcggg ugcacuaugg c 212421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 24ggccuggaug agagaaacug c 212521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 25cucugguauu uccuagggua c 212621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 26gccccugguc uaacuuggga u 212721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 27gaggcagaag uaugauuugc c 212821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 28aagccagugu gaaagacaua g 212921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 29gccgggaccg acuggccaug u 213021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 30cuccagguuc ggggucgaca c 213121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 31agccccuggu cuaacuuggg a 213221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 32ucgccacuuc ucccaggauc u 213321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 33acucugguau uuccuagggu a 213421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 34ucgcugaccg cugggugaua a 213521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 35gccccaacgg ccuggaugag a 213621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 36gccaagcagg gggacaagua u 213721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 37uccccuacag ggccgaguac g 213821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 38cuggguuguu accgcuacag c 213921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 39cuggccugga gagguguccu u 214021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 40gugcgggugc acuauggcuu g 214121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 41uggcaggagg uggcaucuug u 214221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 42cccuacaggg ccgaguacga a 214321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 43accugcuucu ucugguucau u 214421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 44ugccugugau ggggucaagg a 214521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 45cagcuucgga agccccuggu c 214621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 46ccccuggucu aacuugggau c 214721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 47ugcuucuucu gguucauucu c 214821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 48cccaacggcc uggaugagag a 214921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 49aagggccugc acagcuacua c 215021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 50gucuaacuug ggaucuggga a 215121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 51agcuucggaa gccccugguc u 215221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 52ccagugugaa agacauagcu g 215321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 53ccagguucgg ggucgacaca u 215421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 54uccacgcugg guuguuaccg c 215521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 55ugccaagcag ggggacaagu a 215621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 56auccagaaca ggaggcugug u 215721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 57uucaccuccc agaucucccu c 215821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 58ccuccgaggg ugaguggcca u 215921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 59uccagaacag gaggcugugu g 216021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 60guguccuccg agggugagug g 216121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 61uucggggucg acacaucugu g 216221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 62ucggggucga cacaucugug g 216321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 63ugcuuccagg aggacagcau g 216421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 64ucugguauuu ccuaggguac a 216523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 65uugaaggaca ccucuccagg cca 236623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 66aggaaauacc agaguagcac ccc 236723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 67aguuucucuc auccaggccg uug 236823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 68aagauccugg gagaaguggc gau 236923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 69acaagaugcc accuccugcc acc 237023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 70acgucauaca uggccagucg guc 237123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 71aagccauagu gcacccgcac acc 237223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 72acgcaguuuc ucucauccag gcc 237323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 73uuguacccua ggaaauacca gag 237423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 74agaucccaag uuagaccagg ggc 237523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 75acggcaaauc auacuucugc cuc 237623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 76agcuaugucu uucacacugg cuu 237723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 77auacauggcc agucgguccc ggc 237823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 78augugucgac cccgaaccug gag 237923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 79gaucccaagu uagaccaggg gcu 238023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 80uaagauccug ggagaagugg cga 238123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 81uguacccuag gaaauaccag agu 238223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 82uguuaucacc cagcggucag cga 238323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 83ucucucaucc aggccguugg ggc 238423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 84gaauacuugu cccccugcuu ggc 238523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 85uucguacucg gcccuguagg gga 238623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 86uagcuguagc gguaacaacc cag 238723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 87ugaaggacac cucuccaggc cag 238823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 88uacaagccau agugcacccg cac 238923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 89agacaagaug ccaccuccug cca 239023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 90acuucguacu cggcccugua ggg 239123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 91agaaugaacc agaagaagca ggu 239223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 92aguccuugac cccaucacag gca 239323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 93uagaccaggg gcuuccgaag cug 239423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 94cagaucccaa guuagaccag ggg 239523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 95uggagaauga accagaagaa gca 239623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 96uuucucucau ccaggccguu ggg 239723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 97ucguaguagc ugugcaggcc cuu 239823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 98cauucccaga ucccaaguua gac 239923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 99uuagaccagg ggcuuccgaa gcu 2310023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 100ugcagcuaug ucuuucacac ugg 2310123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic

oligonucleotide" 101agaugugucg accccgaacc ugg 2310223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 102uagcgguaac aacccagcgu gga 2310323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 103aauacuuguc ccccugcuug gca 2310423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 104ccacacagcc uccuguucug gau 2310523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 105gugagggaga ucugggaggu gaa 2310623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 106ccauggccac ucacccucgg agg 2310723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 107gccacacagc cuccuguucu gga 2310823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 108ggccacucac ccucggagga cac 2310923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 109cccacagaug ugucgacccc gaa 2311023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 110ccccacagau gugucgaccc cga 2311123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 111gccaugcugu ccuccuggaa gca 2311223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 112uguacccuag gaaauaccag agu 2311321RNAHomo sapiens 113uggccuggag agguguccuu c 2111421RNAHomo sapiens 114ggggugcuac ucugguauuu c 2111521RNAHomo sapiens 115caacggccug gaugagagaa a 2111621RNAHomo sapiens 116aucgccacuu cucccaggau c 2111721RNAHomo sapiens 117gguggcagga gguggcaucu u 2111821RNAHomo sapiens 118gaccgacugg ccauguauga c 2111921RNAHomo sapiens 119ggugugcggg ugcacuaugg c 2112021RNAHomo sapiens 120ggccuggaug agagaaacug c 2112121RNAHomo sapiens 121cucugguauu uccuagggua c 2112221RNAHomo sapiens 122gccccugguc uaacuuggga u 2112321RNAHomo sapiens 123gaggcagaag uaugauuugc c 2112421RNAHomo sapiens 124aagccagugu gaaagacaua g 2112521RNAHomo sapiens 125gccgggaccg acuggccaug u 2112621RNAHomo sapiens 126cuccagguuc ggggucgaca c 2112721RNAHomo sapiens 127agccccuggu cuaacuuggg a 2112821RNAHomo sapiens 128ucgccacuuc ucccaggauc u 2112921RNAHomo sapiens 129acucugguau uuccuagggu a 2113021RNAHomo sapiens 130ucgcugaccg cugggugaua a 2113121RNAHomo sapiens 131gccccaacgg ccuggaugag a 2113221RNAHomo sapiens 132gccaagcagg gggacaagua u 2113321RNAHomo sapiens 133uccccuacag ggccgaguac g 2113421RNAHomo sapiens 134cuggguuguu accgcuacag c 2113521RNAHomo sapiens 135cuggccugga gagguguccu u 2113621RNAHomo sapiens 136gugcgggugc acuauggcuu g 2113721RNAHomo sapiens 137uggcaggagg uggcaucuug u 2113821RNAHomo sapiens 138cccuacaggg ccgaguacga a 2113921RNAHomo sapiens 139accugcuucu ucugguucau u 2114021RNAHomo sapiens 140ugccugugau ggggucaagg a 2114121RNAHomo sapiens 141cagcuucgga agccccuggu c 2114221RNAHomo sapiens 142ccccuggucu aacuugggau c 2114321RNAHomo sapiens 143ugcuucuucu gguucauucu c 2114421RNAHomo sapiens 144cccaacggcc uggaugagag a 2114521RNAHomo sapiens 145aagggccugc acagcuacua c 2114621RNAHomo sapiens 146gucuaacuug ggaucuggga a 2114721RNAHomo sapiens 147agcuucggaa gccccugguc u 2114821RNAHomo sapiens 148ccagugugaa agacauagcu g 2114921RNAHomo sapiens 149ccagguucgg ggucgacaca u 2115021RNAHomo sapiens 150uccacgcugg guuguuaccg c 2115121RNAHomo sapiens 151ugccaagcag ggggacaagu a 2115221RNAHomo sapiens 152auccagaaca ggaggcugug u 2115321RNAHomo sapiens 153uucaccuccc agaucucccu c 2115421RNAHomo sapiens 154ccuccgaggg ugaguggcca u 2115521RNAHomo sapiens 155uccagaacag gaggcugugu g 2115621RNAHomo sapiens 156guguccuccg agggugagug g 2115721RNAHomo sapiens 157uucggggucg acacaucugu g 2115821RNAHomo sapiens 158ucggggucga cacaucugug g 2115921RNAHomo sapiens 159ugcuuccagg aggacagcau g 2116021RNAHomo sapiens 160ucugguauuu ccuaggguac a 2116123RNAHomo sapiens 161uugaaggaca ccucuccagg cca 2316223RNAHomo sapiens 162aggaaauacc agaguagcac ccc 2316323RNAHomo sapiens 163aguuucucuc auccaggccg uug 2316423RNAHomo sapiens 164aagauccugg gagaaguggc gau 2316523RNAHomo sapiens 165acaagaugcc accuccugcc acc 2316623RNAHomo sapiens 166acgucauaca uggccagucg guc 2316723RNAHomo sapiens 167aagccauagu gcacccgcac acc 2316823RNAHomo sapiens 168acgcaguuuc ucucauccag gcc 2316923RNAHomo sapiens 169uuguacccua ggaaauacca gag 2317023RNAHomo sapiens 170agaucccaag uuagaccagg ggc 2317123RNAHomo sapiens 171acggcaaauc auacuucugc cuc 2317223RNAHomo sapiens 172agcuaugucu uucacacugg cuu 2317323RNAHomo sapiens 173auacauggcc agucgguccc ggc 2317423RNAHomo sapiens 174augugucgac cccgaaccug gag 2317523RNAHomo sapiens 175gaucccaagu uagaccaggg gcu 2317623RNAHomo sapiens 176uaagauccug ggagaagugg cga 2317723RNAHomo sapiens 177uguacccuag gaaauaccag agu 2317823RNAHomo sapiens 178uguuaucacc cagcggucag cga 2317923RNAHomo sapiens 179ucucucaucc aggccguugg ggc 2318023RNAHomo sapiens 180gaauacuugu cccccugcuu ggc 2318123RNAHomo sapiens 181uucguacucg gcccuguagg gga 2318223RNAHomo sapiens 182uagcuguagc gguaacaacc cag 2318323RNAHomo sapiens 183ugaaggacac cucuccaggc cag 2318423RNAHomo sapiens 184uacaagccau agugcacccg cac 2318523RNAHomo sapiens 185agacaagaug ccaccuccug cca 2318623RNAHomo sapiens 186acuucguacu cggcccugua ggg 2318723RNAHomo sapiens 187agaaugaacc agaagaagca ggu 2318823RNAHomo sapiens 188aguccuugac cccaucacag gca 2318923RNAHomo sapiens 189uagaccaggg gcuuccgaag cug 2319023RNAHomo sapiens 190cagaucccaa guuagaccag ggg 2319123RNAHomo sapiens 191uggagaauga accagaagaa gca 2319223RNAHomo sapiens 192uuucucucau ccaggccguu ggg 2319323RNAHomo sapiens 193ucguaguagc ugugcaggcc cuu 2319423RNAHomo sapiens 194cauucccaga ucccaaguua gac 2319523RNAHomo sapiens 195uuagaccagg ggcuuccgaa gcu 2319623RNAHomo sapiens 196ugcagcuaug ucuuucacac ugg 2319723RNAHomo sapiens 197agaugugucg accccgaacc ugg 2319823RNAHomo sapiens 198uagcgguaac aacccagcgu gga 2319923RNAHomo sapiens 199aauacuuguc ccccugcuug gca 2320023RNAHomo sapiens 200ccacacagcc uccuguucug gau 2320123RNAHomo sapiens 201gugagggaga ucugggaggu gaa 2320223RNAHomo sapiens 202ccauggccac ucacccucgg agg 2320323RNAHomo sapiens 203gccacacagc cuccuguucu gga 2320423RNAHomo sapiens 204ggccacucac ccucggagga cac 2320523RNAHomo sapiens 205cccacagaug ugucgacccc gaa 2320623RNAHomo sapiens 206ccccacagau gugucgaccc cga 2320723RNAHomo sapiens 207gccaugcugu ccuccuggaa gca 2320823RNAHomo sapiens 208uguacccuag gaaauaccag agu 2320921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 209ugguauuucc uaggguacat t 2121021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 210uguacccuag gaaauaccat t 2121121RNAHomo sapiens 211ggugcuacuc ugguauuucc u 2121221RNAHomo sapiens 212ucugguauuu ccuaggguac a 2121321RNAHomo sapiens 213cugguauuuc cuaggguaca a 2121421RNAHomo sapiens 214ugguauuucc uaggguacaa a 2121521RNAHomo sapiens 215gguauuuccu aggguacaag a 2121619RNAHomo sapiens 216ugguauuucc uaggguaca 1921721RNAHomo sapiens 217guauuuccua ggguacaagg a 2121821RNAHomo sapiens 218auuuccuagg guacaaggcg a 2121921RNAHomo sapiens 219uuuccuaggg uacaaggcgg a 2122021RNAHomo sapiens 220cgccacuucu cccaggaucu u 2122121RNAHomo sapiens 221gccacuucuc ccaggaucuu a 2122221RNAHomo sapiens 222cugcuucuuc ugguucauuc u 2122321RNAHomo sapiens 223cuucuucugg uucauucucc a 2122421RNAHomo sapiens 224cccuacaggg ccgaguacga a 2122521RNAHomo sapiens 225cuacagggcc gaguacgaag u 2122621RNAHomo sapiens 226gccaguguga aagacauagc u 2122721RNAHomo sapiens 227agugugaaag acauagcugc a 2122821RNAHomo sapiens 228cacgcugggu uguuaccgcu a 2122921RNAHomo sapiens 229ggguuguuac cgcuacagcu a 2123021RNAHomo sapiens 230cgggaccgac uggccaugua u 2123121RNAHomo sapiens 231ccgacuggcc auguaugacg u 2123221RNAHomo sapiens 232gggccugcac agcuacuacg a 2123321RNAHomo sapiens 233ggcagaagua ugauuugccg u 2123421RNAHomo sapiens 234ccagaacagg aggcugugug g 2123521RNAHomo sapiens 235cagaacagga ggcugugugg c 2123621RNAHomo sapiens 236caccucccag aucucccuca c 2123721RNAHomo sapiens 237caccucccag aucucccuca a 2123821RNAHomo sapiens 238ugugcgggug cacuauggcu u 2123921RNAHomo sapiens 239gcgggugcac uauggcuugu a 2124021RNAHomo sapiens 240ccccugcccu ggagaguucc u 2124121RNAHomo sapiens 241cccugcccug gagaguuccu a 2124221RNAHomo sapiens 242ccugcccugg agaguuccuc u 2124321RNAHomo sapiens 243cugcccugga gaguuccucu a 2124421RNAHomo sapiens 244ccugugaugg ggucaaggac u 2124521RNAHomo sapiens 245ggacugcccc aacggccugg a 2124621RNAHomo sapiens 246acugccccaa cggccuggau a 2124721RNAHomo sapiens 247cugccccaac ggccuggaug a 2124821RNAHomo sapiens 248ugccccaacg gccuggauga a 2124921RNAHomo sapiens 249gccccaacgg ccuggaugag a 2125021RNAHomo sapiens 250ccccaacggc cuggaugaga a 2125121RNAHomo sapiens 251cccaacggcc uggaugagag a 2125221RNAHomo sapiens 252caacggccug gaugagagaa a 2125321RNAHomo sapiens 253acggccugga ugagagaaac u 2125421RNAHomo sapiens 254ccuggaugag agaaacugcg u 2125521RNAHomo sapiens 255cacugugacu guggccucca a 2125621RNAHomo sapiens 256guccuccgag ggugaguggc c 2125721RNAHomo sapiens 257cuccgagggu gaguggccau a 2125821RNAHomo sapiens 258uccgagggug aguggccaug g 2125921RNAHomo sapiens 259ccagguucgg ggucgacaca u 2126021RNAHomo sapiens 260agguucgggg ucgacacauc u 2126121RNAHomo sapiens 261cggggucgac acaucugugg g 2126221RNAHomo sapiens 262cggggucgac acaucugugg a 2126321RNAHomo sapiens 263ggggucgaca caucuguggg g 2126421RNAHomo sapiens 264ggggucgaca caucuguggg a 2126521RNAHomo sapiens 265gggucgacac aucugugggg a 2126621RNAHomo sapiens 266gcugaccgcu gggugauaac a 2126721RNAHomo sapiens 267cuuccaggag gacagcaugg c 2126821RNAHomo sapiens 268ggccuggaga gguguccuuc a 2126921RNAHomo sapiens 269gccuggagag guguccuuca a 2127021RNAHomo sapiens 270ccaagcaggg ggacaaguau u 2127121RNAHomo sapiens 271caagcagggg gacaaguauu c 2127221RNAHomo sapiens 272uggcaggagg uggcaucuug u 2127321RNAHomo sapiens 273gcaggaggug gcaucuuguc u 2127421RNAHomo sapiens 274gcuucggaag

ccccuggucu a 2127521RNAHomo sapiens 275cuucggaagc cccuggucua a 2127621RNAHomo sapiens 276ccccuggucu aacuugggau c 2127721RNAHomo sapiens 277cccuggucua acuugggauc u 2127821RNAHomo sapiens 278ccuggucuaa cuugggaucu g 2127921RNAHomo sapiens 279cuaacuuggg aucugggaau g 2128023RNAHomo sapiens 280aggaaauacc agaguagcac ccc 2328123RNAHomo sapiens 281uguacccuag gaaauaccag agu 2328223RNAHomo sapiens 282uuguacccua ggaaauacca gag 2328323RNAHomo sapiens 283uuuguacccu aggaaauacc aga 2328423RNAHomo sapiens 284ucuuguaccc uaggaaauac cag 2328519RNAHomo sapiens 285uguacccuag gaaauacca 1928623RNAHomo sapiens 286uccuuguacc cuaggaaaua cca 2328723RNAHomo sapiens 287ucgccuugua cccuaggaaa uac 2328823RNAHomo sapiens 288uccgccuugu acccuaggaa aua 2328923RNAHomo sapiens 289aagauccugg gagaaguggc gau 2329023RNAHomo sapiens 290uaagauccug ggagaagugg cga 2329123RNAHomo sapiens 291agaaugaacc agaagaagca ggu 2329223RNAHomo sapiens 292uggagaauga accagaagaa gca 2329323RNAHomo sapiens 293uucguacucg gcccuguagg gga 2329423RNAHomo sapiens 294acuucguacu cggcccugua ggg 2329523RNAHomo sapiens 295agcuaugucu uucacacugg cuu 2329623RNAHomo sapiens 296ugcagcuaug ucuuucacac ugg 2329723RNAHomo sapiens 297uagcgguaac aacccagcgu gga 2329823RNAHomo sapiens 298uagcuguagc gguaacaacc cag 2329923RNAHomo sapiens 299auacauggcc agucgguccc ggc 2330023RNAHomo sapiens 300acgucauaca uggccagucg guc 2330123RNAHomo sapiens 301ucguaguagc ugugcaggcc cuu 2330223RNAHomo sapiens 302acggcaaauc auacuucugc cuc 2330323RNAHomo sapiens 303ccacacagcc uccuguucug gau 2330423RNAHomo sapiens 304gccacacagc cuccuguucu gga 2330523RNAHomo sapiens 305gugagggaga ucugggaggu gaa 2330623RNAHomo sapiens 306uugagggaga ucugggaggu gaa 2330723RNAHomo sapiens 307aagccauagu gcacccgcac acc 2330823RNAHomo sapiens 308uacaagccau agugcacccg cac 2330923RNAHomo sapiens 309aggaacucuc cagggcaggg guc 2331023RNAHomo sapiens 310uaggaacucu ccagggcagg ggu 2331123RNAHomo sapiens 311agaggaacuc uccagggcag ggg 2331223RNAHomo sapiens 312uagaggaacu cuccagggca ggg 2331323RNAHomo sapiens 313aguccuugac cccaucacag gca 2331423RNAHomo sapiens 314uccaggccgu uggggcaguc cuu 2331523RNAHomo sapiens 315uauccaggcc guuggggcag ucc 2331623RNAHomo sapiens 316ucauccaggc cguuggggca guc 2331723RNAHomo sapiens 317uucauccagg ccguuggggc agu 2331823RNAHomo sapiens 318ucucauccag gccguugggg cag 2331923RNAHomo sapiens 319uucucaucca ggccguuggg gca 2332023RNAHomo sapiens 320ucucucaucc aggccguugg ggc 2332123RNAHomo sapiens 321uuucucucau ccaggccguu ggg 2332223RNAHomo sapiens 322aguuucucuc auccaggccg uug 2332323RNAHomo sapiens 323acgcaguuuc ucucauccag gcc 2332423RNAHomo sapiens 324uuggaggcca cagucacagu gcu 2332523RNAHomo sapiens 325ggccacucac ccucggagga cac 2332623RNAHomo sapiens 326uauggccacu cacccucgga gga 2332723RNAHomo sapiens 327ccauggccac ucacccucgg agg 2332823RNAHomo sapiens 328augugucgac cccgaaccug gag 2332923RNAHomo sapiens 329agaugugucg accccgaacc ugg 2333023RNAHomo sapiens 330cccacagaug ugucgacccc gaa 2333123RNAHomo sapiens 331uccacagaug ugucgacccc gaa 2333223RNAHomo sapiens 332ccccacagau gugucgaccc cga 2333323RNAHomo sapiens 333ucccacagau gugucgaccc cga 2333423RNAHomo sapiens 334uccccacaga ugugucgacc ccg 2333523RNAHomo sapiens 335uguuaucacc cagcggucag cga 2333623RNAHomo sapiens 336gccaugcugu ccuccuggaa gca 2333723RNAHomo sapiens 337ugaaggacac cucuccaggc cag 2333823RNAHomo sapiens 338uugaaggaca ccucuccagg cca 2333923RNAHomo sapiens 339aauacuuguc ccccugcuug gca 2334023RNAHomo sapiens 340gaauacuugu cccccugcuu ggc 2334123RNAHomo sapiens 341acaagaugcc accuccugcc acc 2334223RNAHomo sapiens 342agacaagaug ccaccuccug cca 2334323RNAHomo sapiens 343uagaccaggg gcuuccgaag cug 2334423RNAHomo sapiens 344uuagaccagg ggcuuccgaa gcu 2334523RNAHomo sapiens 345gaucccaagu uagaccaggg gcu 2334623RNAHomo sapiens 346agaucccaag uuagaccagg ggc 2334723RNAHomo sapiens 347cagaucccaa guuagaccag ggg 2334823RNAHomo sapiens 348cauucccaga ucccaaguua gac 2334921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 349ugguauuucc uaggguacat t 2135021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 350ucugguauuu ccuaggguac a 2135121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 351gccuggagag guguccuuca a 2135221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 352cugguauuuc cuaggguaca a 2135321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 353gcaggaggug gcaucuuguc u 2135421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 354gggccugcac agcuacuacg a 2135521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 355caccucccag aucucccuca c 2135621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 356ggugcuacuc ugguauuucc u 2135721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 357cccuggucua acuugggauc u 2135821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 358gcugaccgcu gggugauaac a 2135921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 359cuacagggcc gaguacgaag u 2136021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 360cuaacuuggg aucugggaau g 2136121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 361uccgagggug aguggccaug g 2136221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 362acggccugga ugagagaaac u 2136321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 363ggcagaagua ugauuugccg u 2136421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 364cccaacggcc uggaugagag a 2136521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 365cugcuucuuc ugguucauuc u 2136621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 366cuucggaagc cccuggucua a 2136721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 367cagaacagga ggcugugugg c 2136821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 368cgccacuucu cccaggaucu u 2136921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 369gccaguguga aagacauagc u 2137021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 370caagcagggg gacaaguauu c 2137121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 371ccugugaugg ggucaaggac u 2137221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 372agugugaaag acauagcugc a 2137321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 373guccuccgag ggugaguggc c 2137421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 374uggcaggagg uggcaucuug u 2137521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 375cgggaccgac uggccaugua u 2137621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 376cccuacaggg ccgaguacga a 2137721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 377gcuucggaag ccccuggucu a 2137821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 378agguucgggg ucgacacauc u 2137921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 379cggggucgac acaucugugg g 2138021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 380ccgacuggcc auguaugacg u 2138121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 381ccagguucgg ggucgacaca u 2138221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 382ggguuguuac cgcuacagcu a 2138321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 383ccuggucuaa cuugggaucu g 2138421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 384cacgcugggu uguuaccgcu a 2138521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 385ggggucgaca caucuguggg g 2138621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 386ugugcgggug cacuauggcu u 2138721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 387ccccuggucu aacuugggau c 2138821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 388ggccuggaga gguguccuuc a 2138921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 389cuucuucugg uucauucucc a 2139021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 390ccaagcaggg ggacaaguau u 2139121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 391cuuccaggag gacagcaugg c 2139221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 392ccuggaugag agaaacugcg u 2139321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 393gccacuucuc ccaggaucuu a 2139421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 394gcgggugcac uauggcuugu a 2139521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 395caacggccug gaugagagaa a 2139621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 396ccagaacagg aggcugugug g 2139721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 397gggucgacac aucugugggg a 2139821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 398ccccaacggc cuggaugaga a 2139921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 399gccccaacgg ccuggaugag a 2140021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 400cugcccugga gaguuccucu a 2140121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 401cggggucgac acaucugugg a 2140221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 402uuuccuaggg uacaaggcgg a 2140321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 403acugccccaa cggccuggau a 2140421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 404ggggucgaca caucuguggg a 2140521RNAArtificial Sequencesource/note="Description of

Artificial Sequence Synthetic oligonucleotide" 405cugccccaac ggccuggaug a 2140621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 406auuuccuagg guacaaggcg a 2140721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 407ccccugcccu ggagaguucc u 2140821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 408cccugcccug gagaguuccu a 2140921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 409cacugugacu guggccucca a 2141021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 410ggacugcccc aacggccugg a 2141121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 411gguauuuccu aggguacaag a 2141221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 412caccucccag aucucccuca a 2141321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 413ugguauuucc uaggguacaa a 2141421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 414guauuuccua ggguacaagg a 2141521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 415cuccgagggu gaguggccau a 2141621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 416ugccccaacg gccuggauga a 2141721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 417ccugcccugg agaguuccuc u 2141821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 418uguacccuag gaaauaccat t 2141923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 419uguacccuag gaaauaccag agu 2342023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 420uugaaggaca ccucuccagg cca 2342123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 421uuguacccua ggaaauacca gag 2342223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 422agacaagaug ccaccuccug cca 2342323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 423ucguaguagc ugugcaggcc cuu 2342423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 424gugagggaga ucugggaggu gaa 2342523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 425aggaaauacc agaguagcac ccc 2342623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 426agaucccaag uuagaccagg ggc 2342723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 427uguuaucacc cagcggucag cga 2342823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 428acuucguacu cggcccugua ggg 2342923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 429cauucccaga ucccaaguua gac 2343023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 430ccauggccac ucacccucgg agg 2343123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 431aguuucucuc auccaggccg uug 2343223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 432acggcaaauc auacuucugc cuc 2343323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 433ucucucaucc aggccguugg ggc 2343423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 434agaaugaacc agaagaagca ggu 2343523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 435uuagaccagg ggcuuccgaa gcu 2343623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 436gccacacagc cuccuguucu gga 2343723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 437aagauccugg gagaaguggc gau 2343823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 438agcuaugucu uucacacugg cuu 2343923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 439gaauacuugu cccccugcuu ggc 2344023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 440aguccuugac cccaucacag gca 2344123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 441ugcagcuaug ucuuucacac ugg 2344223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 442ggccacucac ccucggagga cac 2344323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 443acaagaugcc accuccugcc acc 2344423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 444auacauggcc agucgguccc ggc 2344523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 445uucguacucg gcccuguagg gga 2344623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 446uagaccaggg gcuuccgaag cug 2344723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 447agaugugucg accccgaacc ugg 2344823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 448cccacagaug ugucgacccc gaa 2344923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 449acgucauaca uggccagucg guc 2345023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 450augugucgac cccgaaccug gag 2345123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 451uagcuguagc gguaacaacc cag 2345223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 452cagaucccaa guuagaccag ggg 2345323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 453uagcgguaac aacccagcgu gga 2345423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 454ccccacagau gugucgaccc cga 2345523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 455aagccauagu gcacccgcac acc 2345623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 456gaucccaagu uagaccaggg gcu 2345723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 457ugaaggacac cucuccaggc cag 2345823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 458uggagaauga accagaagaa gca 2345923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 459aauacuuguc ccccugcuug gca 2346023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 460gccaugcugu ccuccuggaa gca 2346123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 461acgcaguuuc ucucauccag gcc 2346223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 462uaagauccug ggagaagugg cga 2346323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 463uacaagccau agugcacccg cac 2346423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 464uuucucucau ccaggccguu ggg 2346523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 465ccacacagcc uccuguucug gau 2346623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 466uccccacaga ugugucgacc ccg 2346723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 467uucucaucca ggccguuggg gca 2346823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 468ucucauccag gccguugggg cag 2346923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 469uagaggaacu cuccagggca ggg 2347023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 470uccacagaug ugucgacccc gaa 2347123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 471uccgccuugu acccuaggaa aua 2347223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 472uauccaggcc guuggggcag ucc 2347323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 473ucccacagau gugucgaccc cga 2347423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 474ucauccaggc cguuggggca guc 2347523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 475ucgccuugua cccuaggaaa uac 2347623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 476aggaacucuc cagggcaggg guc 2347723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 477uaggaacucu ccagggcagg ggu 2347823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 478uuggaggcca cagucacagu gcu 2347923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 479uccaggccgu uggggcaguc cuu 2348023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 480ucuuguaccc uaggaaauac cag 2348123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 481uugagggaga ucugggaggu gaa 2348223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 482uuuguacccu aggaaauacc aga 2348323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 483uccuuguacc cuaggaaaua cca 2348423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 484uauggccacu cacccucgga gga 2348523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 485uucauccagg ccguuggggc agu 2348623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 486agaggaacuc uccagggcag ggg 2348721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 487cugguauuuc cuaggguaca a 2148821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 488cugguauuuc cuaggguaca a 2148921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 489cugguauuuc cuagggtaca a 2149021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 490cugguauuuc cuaggguaca a 2149121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 491cugguauuuc cuaggguaca a 2149221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 492cugguauuuc cuaggguaca a 2149319RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 493gguauuuccu aggguacaa 1949421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 494cugguauuuc cuaggguaca a 2149521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 495cugguauuuc cuaggguaca a 2149621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 496cugguauuuc cuaggguaca a 2149721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 497cugguauuuc cuaggguaca a 2149821DNAArtificial Sequencesource/note="Description of Artificial

Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 498cugguauuuc cuaggguaca a 2149921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 499cugguauuuc cuaggguaca a 2150021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 500cugguauuuc cuaggguaca a 2150121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 501cugguauuuc cuaggguaca a 2150221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 502cugguauuuc cuaggguaca a 2150321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 503cugguauuuc cuaggguaca a 2150421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 504cugguauuuc cuaggguaca a 2150521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 505cugguauuuc cuaggguaca a 2150621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 506cugguauuuc cuaggguaca a 2150721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 507cugguauuuc cuaggguaca a 2150821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 508cugguauuuc cuaggguaca a 2150921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 509cugguauuuc cuaggguaca a 2151021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 510cugguauuuc cuaggguaca a 2151121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 511cugguauuuc cuaggguaca a 2151221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 512cugguauuuc cuaggguaca a 2151321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 513cugguauuuc cuaggguaca a 2151421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 514cugguauuuc cuaggguaca a 2151521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 515cugguauuuc cuaggguaca a 2151621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 516cugguauuuc cuaggguaca a 2151721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 517cugguauuuc cuagggtaca a 2151821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 518cugguauuuc cuaggguaca a 2151921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 519cugguauuuc cuaggguaca a 2152021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 520cugguauuuc cuaggguaca a 2152121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 521cugguauuuc cuaggguaca a 2152221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 522cugguauuuc cuaggguaca a 2152321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide"modified_base(17)..(17)Thymidine-glycol nucleic acid (GNA) S-Isomer 523cugguauuuc cuagggtaca a 2152421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 524cugguauuuc cuaggguaca a 2152521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 525cugguauuuc cuaggguaca a 2152621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 526cugguauuuc cuaggguaca a 2152721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 527cugguauuuc cuagggtaca a 2152821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 528cugguauuuc cuaggguaca a 2152921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 529cugguauuuc cuaggguaca a 2153021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 530cugguauuuc ctaggguaca a 2153121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 531cugguauuuc ctaggguaca a 2153221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 532cugguauuuc ctaggguaca a 2153321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 533cugguauuuc cuaggguaca a 2153421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 534cugguauuuc cuaggguaca a 2153521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 535cugguauuuc cuagggtaca a 2153621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 536cugguauuuc cuaggguaca a 2153721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 537cugguauuuc cuaggguaca a 2153821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 538cugguauuuc cuaggguaca a 2153921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 539cugguauuuc cuaggguaca a 2154021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 540cugguauuuc cuaggguaca a 2154121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 541cugguauuuc cuaggguaca a 2154221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 542cugguauuuc ctaggguaca a 2154321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 543cugguauuuc cuaggguaca a 2154423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 544uuguacccua ggaaauacca gag 2354523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 545uuguacccua ggaaauacca gag 2354623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 546uuguacccua ggaaauacca gag 2354723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 547uuguacccua ggaaauacca gag 2354823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 548uuguacccua ggaaauacca gag 2354923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 549uuguacccua ggaaauacca gag 2355021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 550uuguacccua ggaaauacca g 2155123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 551uuguacccua ggaaauacca gag 2355223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 552uuguacccua ggaaauacca gag 2355323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 553uuguacccua ggaaauacca gag 2355423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 554uuguacccua ggaaauacca gag 2355523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 555uuguacccua ggaaauacca gag 2355623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 556uuguacccua ggaaauacca gag 2355723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 557uuguacccua ggaaauacca gag 2355823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 558uuguacccua ggaaauacca gag 2355923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 559uuguacccua ggaaauacca gag 2356023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 560uuguacccua ggaaauacca gag 2356123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 561uuguacccua ggaaauacca gag 2356223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 562uuguacccua ggaaauacca gag 2356323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 563uuguacccua ggaaauacca gag 2356423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 564uuguacccua ggaaauacca gag 2356523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 565uuguacccua ggaaauacca gag 2356623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 566uuguacccua ggaaauacca gag 2356723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 567uuguacccua ggaaauacca gag 2356823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 568uuguacccua ggaaauacca gag 2356923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 569uuguacccua ggaaauacca gag 2357023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 570uuguacccua ggaaauacca gag 2357123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 571uuguacccua ggaaauacca gag 2357223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 572uuguacccua ggaaauacca gag 2357323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 573uuguacccua ggaaauacca gag 2357423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 574uuguacccua ggaaauacca gag 2357523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 575uuguacccua ggaaauacca gag 2357623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 576uuguacccua ggaaauacca gag 2357723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 577uuguacccua ggaaauacca gag 2357823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 578uuguacccua ggaaauacca gag 2357923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 579uuguacccua ggaaauacca gag 2358023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 580uuguacccua ggaaauacca gag 2358123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 581uuguacccua ggaaauacca gag 2358223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 582uuguacccua ggaaauacca gag 2358323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 583uuguacccua ggaaauacca gag

2358423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 584uuguacccua ggaaauacca gag 2358523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 585uuguacccua ggaaauacca gag 2358623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 586uuguacccua ggaaauacca gag 2358723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 587uuguacccua ggaaauacca gag 2358823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 588uuguacccua ggaaauacca gag 2358923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 589uuguacccua ggaaauacca gag 2359023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 590uuguacccua ggaaauacca gag 2359123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 591uuguacccua ggaaauacca gag 2359223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 592uuguacccua ggaaauacca gag 2359323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 593uuguacccua ggaaauacca gag 2359423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 594uuguacccua ggaaauacca gag 2359523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 595uuguacccua ggaaauacca gag 2359623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 596uuguacccua ggaaauacca gag 2359723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 597uuguacccua ggaaauacca gag 2359823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 598uuguacccua ggaaauacca gag 2359923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 599uuguacccua ggaaauacca gag 2360023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 600uuguacccua ggaaauacca gag 2360121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 601cugguauuuc cuaggguaca a 2160221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 602cugguauuuc cuaggguaca a 2160321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 603cugguauuuc cuagggtaca a 2160421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 604cugguauuuc cuaggguaca a 2160521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 605cugguauuuc cuaggguaca a 2160621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 606cugguauuuc cuaggguaca a 2160719RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 607gguauuuccu aggguacaa 1960821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 608cugguauuuc cuaggguaca a 2160921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 609cugguauuuc cuaggguaca a 2161021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 610cugguauuuc cuaggguaca a 2161121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 611cugguauuuc cuaggguaca a 2161221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 612cugguauuuc cuaggguaca a 2161321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 613cugguauuuc cuaggguaca a 2161421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 614cugguauuuc cuaggguaca a 2161521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 615cugguauuuc cuaggguaca a 2161621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 616cugguauuuc cuaggguaca a 2161721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 617cugguauuuc cuaggguaca a 2161821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 618cugguauuuc cuaggguaca a 2161921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 619cugguauuuc cuaggguaca a 2162021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 620cugguauuuc cuaggguaca a 2162121RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 621cugguauuuc cuaggguaca a 2162221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 622cugguauuuc cuaggguaca a 2162321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 623cugguauuuc cuaggguaca a 2162421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 624cugguauuuc cuaggguaca a 2162521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 625cugguauuuc cuaggguaca a 2162621RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 626cugguauuuc cuaggguaca a 2162721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 627cugguauuuc cuaggguaca a 2162821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 628cugguauuuc cuaggguaca a 2162921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 629cugguauuuc cuaggguaca a 2163021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 630cugguauuuc cuaggguaca a 2163121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 631cugguauuuc cuagggtaca a 2163221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 632cugguauuuc cuaggguaca a 2163321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 633cugguauuuc cuaggguaca a 2163421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 634cugguauuuc cuaggguaca a 2163521RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 635cugguauuuc cuaggguaca a 2163621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 636cugguauuuc cuaggguaca a 2163721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide"modified_base(17)..(17)Thymidine-glycol nucleic acid (GNA) S-Isomer 637cugguauuuc cuagggtaca a 2163821RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 638cugguauuuc cuaggguaca a 2163921RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 639cugguauuuc cuaggguaca a 2164021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 640cugguauuuc cuaggguaca a 2164121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 641cugguauuuc cuagggtaca a 2164221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 642cugguauuuc cuaggguaca a 2164321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 643cugguauuuc cuaggguaca a 2164421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 644cugguauuuc ctaggguaca a 2164521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 645cugguauuuc ctaggguaca a 2164621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 646cugguauuuc ctaggguaca a 2164721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 647cugguauuuc cuaggguaca a 2164821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 648cugguauuuc cuaggguaca a 2164921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 649cugguauuuc cuagggtaca a 2165021RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 650cugguauuuc cuaggguaca a 2165121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 651cugguauuuc cuaggguaca a 2165221RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 652cugguauuuc cuaggguaca a 2165321RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 653cugguauuuc cuaggguaca a 2165421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 654cugguauuuc cuaggguaca a 2165521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 655cugguauuuc cuaggguaca a 2165621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 656cugguauuuc ctaggguaca a 2165721RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 657cugguauuuc cuaggguaca a 2165823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 658uuguacccua ggaaauacca gag 2365923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 659uuguacccua ggaaauacca gag 2366023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 660uuguacccua ggaaauacca gag 2366123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 661uuguacccua ggaaauacca gag 2366223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 662uuguacccua ggaaauacca gag 2366323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 663uuguacccua ggaaauacca gag 2366421RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 664uuguacccua ggaaauacca g 2166523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 665uuguacccua ggaaauacca gag 2366623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 666uuguacccua ggaaauacca gag 2366723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 667uuguacccua ggaaauacca gag 2366823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 668uuguacccua ggaaauacca gag

2366923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 669uuguacccua ggaaauacca gag 2367023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 670uuguacccua ggaaauacca gag 2367123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 671uuguacccua ggaaauacca gag 2367223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 672uuguacccua ggaaauacca gag 2367323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 673uuguacccua ggaaauacca gag 2367423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 674uuguacccua ggaaauacca gag 2367523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 675uuguacccua ggaaauacca gag 2367623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 676uuguacccua ggaaauacca gag 2367723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 677uuguacccua ggaaauacca gag 2367823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 678uuguacccua ggaaauacca gag 2367923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 679uuguacccua ggaaauacca gag 2368023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 680uuguacccua ggaaauacca gag 2368123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 681uuguacccua ggaaauacca gag 2368223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 682uuguacccua ggaaauacca gag 2368323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 683uuguacccua ggaaauacca gag 2368423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 684uuguacccua ggaaauacca gag 2368523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 685uuguacccua ggaaauacca gag 2368623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 686uuguacccua ggaaauacca gag 2368723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 687uuguacccua ggaaauacca gag 2368823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 688uuguacccua ggaaauacca gag 2368923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 689uuguacccua ggaaauacca gag 2369023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 690uuguacccua ggaaauacca gag 2369123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 691uuguacccua ggaaauacca gag 2369223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 692uuguacccua ggaaauacca gag 2369323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 693uuguacccua ggaaauacca gag 2369423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 694uuguacccua ggaaauacca gag 2369523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 695uuguacccua ggaaauacca gag 2369623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 696uuguacccua ggaaauacca gag 2369723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 697uuguacccua ggaaauacca gag 2369823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 698uuguacccua ggaaauacca gag 2369923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 699uuguacccua ggaaauacca gag 2370023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 700uuguacccua ggaaauacca gag 2370123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 701uuguacccua ggaaauacca gag 2370223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 702uuguacccua ggaaauacca gag 2370323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 703uuguacccua ggaaauacca gag 2370423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 704uuguacccua ggaaauacca gag 2370523RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 705uuguacccua ggaaauacca gag 2370623RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 706uuguacccua ggaaauacca gag 2370723RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 707uuguacccua ggaaauacca gag 2370823RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 708uuguacccua ggaaauacca gag 2370923RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 709uuguacccua ggaaauacca gag 2371023RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 710uuguacccua ggaaauacca gag 2371123RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 711uuguacccua ggaaauacca gag 2371223RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 712uuguacccua ggaaauacca gag 2371323RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 713uuguacccua ggaaauacca gag 2371423RNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide" 714uuguacccua ggaaauacca gag 2371521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 715ugagccagac ccaguccagt t 2171621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 716gacccagucc agcucuggut t 2171721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 717cucuggugcc ugcccucugt t 2171821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 718gcccucuggu gcgagcugat t 2171921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 719ggugcgagcu gaccugagat t 2172021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 720ugaccugaga ugcacuucct t 2172121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 721ugcacuuccc uccucugugt t 2172221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 722cugugagcug ucucggcact t 2172321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 723gucucggcac ccacuugcat t 2172421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 724ccacuugcag ucacugccgt t 2172521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 725gucacugccg ccugauguut t 2172621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 726gccugauguu guuacucuut t 2172721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 727uuacucuucc acuccaaaat t 2172821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 728acuccaaaag gaugcccgut t 2172921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 729ugcccguggc cgaggcccct t 2173021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 730uggccgaggc cccccaggut t 2173121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 731ccagguggcu ggcgggcagt t 2173221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 732gcgggcaggg ggacggaggt t 2173321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 733ggacggaggu gauggcgagt t 2173421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 734gugauggcga ggaagcggat t 2173521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 735gaagcggagc cggaggggat t 2173621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 736gccggagggg auguucaagt t 2173721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 737uguucaaggc cugugaggat t 2173821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 738cugugaggac uccaagagat t 2173921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 739acuccaagag aaaagcccgt t 2174021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 740gcccggggcu accuccgcct t 2174121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 741accuccgccu ggugccccut t 2174221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 742gccuggugcc ccuguuugut t 2174321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 743uguuugugcu gcuggcccut t 2174421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 744ugcuggcccu gcucgugcut t 2174521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 745gcucgugcug gcuucggcgt t 2174621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 746ucggcggggg ugcuacucut t 2174721DNAArtificial

Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 747cggcgggggu gcuacucugt t 2174821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 748ggcgggggug cuacucuggt t 2174921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 749gcgggggugc uacucuggut t 2175021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 750cgggggugcu acucugguat t 2175121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 751gggggugcua cucugguaut t 2175221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 752gggugcuacu cugguauuut t 2175321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 753ggugcuacuc ugguauuuct t 2175421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 754gugcuacucu gguauuucct t 2175521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 755gcuacucugg uauuuccuat t 2175621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 756cuacucuggu auuuccuagt t 2175721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 757uacucuggua uuuccuaggt t 2175821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 758acucugguau uuccuagggt t 2175921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 759cucugguauu uccuagggut t 2176021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 760cugguauuuc cuaggguact t 2176121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 761guauuuccua ggguacaagt t 2176221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 762uauuuccuag gguacaaggt t 2176321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 763auuuccuagg guacaaggct t 2176421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 764uuuccuaggg uacaaggcgt t 2176521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 765uuccuagggu acaaggcggt t 2176621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 766ccuaggguac aaggcggagt t 2176721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 767cuaggguaca aggcggaggt t 2176821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 768uaggguacaa ggcggaggut t 2176921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 769aggguacaag gcggaggugt t 2177021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 770ggguacaagg cggaggugat t 2177121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 771gguacaaggc ggaggugaut t 2177221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 772guacaaggcg gaggugaugt t 2177321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 773uacaaggcgg aggugauggt t 2177421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 774acaaggcgga ggugauggut t 2177521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 775caaggcggag gugaugguct t 2177621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 776aaggcggagg ugauggucat t 2177721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 777aggcggaggu gauggucagt t 2177821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 778ugauggucag ccagguguat t 2177921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 779ccagguguac ucaggcagut t 2178021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 780gcagucugcg uguacucaat t 2178121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 781gcguguacuc aaucgccact t 2178221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 782ucgccacuuc ucccaggaut t 2178321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 783cucccaggau cuuacccgct t 2178421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 784uacccgccgg gaaucuagut t 2178521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 785ccgggaaucu agugccuuct t 2178621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 786agugccuucc gcagugaaat t 2178721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 787gugaaaccgc caaagcccat t 2178821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 788cgccaaagcc cagaagaugt t 2178921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 789cagaagaugc ucaaggagct t 2179021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 790ucaaggagcu caucaccagt t 2179121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 791accagcaccc gccugggaat t 2179221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 792gccugggaac uuacuacaat t 2179321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 793gaacuuacua caacuccagt t 2179421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 794aacuccagcu ccgucuauut t 2179521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 795ccgucuauuc cuuuggggat t 2179621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 796uuggggaggg accccucact t 2179721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 797ccccucaccu gcuucuucut t 2179821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 798cugcuucuuc ugguucauut t 2179921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 799cugguucauu cuccaaauct t 2180021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 800ucuccaaauc cccgagcact t 2180121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 801ccgagcaccg ccggcugaut t 2180221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 802ggcugaugcu gagccccgat t 2180321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 803ugagccccga gguggugcat t 2180421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 804uggugcaggc acugcuggut t 2180521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 805aggcacugcu gguggaggat t 2180621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 806guggaggagc ugcuguccat t 2180721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 807uguccacagu caacagcuct t 2180821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 808ucaacagcuc ggcugccgut t 2180921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 809ucggcugccg uccccuacat t

2181021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 810aguggacccc gagggccuat t 2181121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 811agggccuagu gauccuggat t 2181221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 812uagugauccu ggaagccagt t 2181321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 813aagccagugu gaaagacaut t 2181421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 814ugaaagacau agcugcauut t 2181521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 815ugcauugaau uccacgcugt t 2181621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 816cuacagcuac gugggccagt t 2181721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 817cuacgugggc cagggccagt t 2181821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 818agggccaggu ccuccggcut t 2181921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 819ccggcugaag gggccugact t 2182021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 820gggccugacc accuggccut t 2182121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 821ccaccuggcc uccagcugct t 2182221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 822ccagcugccu guggcaccut t 2182321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 823cuguggcacc ugcagggcct t 2182421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 824cugcagggcc ccaaggacct t 2182521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 825ccaaggaccu caugcucaat t 2182621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 826ugcucaaacu ccggcuggat t 2182721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 827ccggcuggag uggacgcugt t 2182821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 828gacgcuggca gagugccggt t 2182921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 829ggcagagugc cgggaccgat t 2183021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 830accgacuggc cauguaugat t 2183121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 831ccauguauga cguggccggt t 2183221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 832guggccgggc cccuggagat t 2183321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 833cccuggagaa gaggcucaut t 2183421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 834agaagaggcu caucaccuct t 2183521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 835accucggugu acggcugcat t 2183621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 836acggcugcag ccgccaggat t 2183721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 837gccgccagga gcccguggut t 2183821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 838agcccguggu ggagguucut t 2183921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 839guggagguuc uggcgucggt t 2184021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 840uggcgucggg ggccaucaut t 2184121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 841ccaucauggc ggucgucugt t 2184221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 842gcggucgucu ggaagaaggt t 2184321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 843ggaagaaggg ccugcacagt t 2184421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 844ccugcacagc uacuacgact t 2184521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 845acuacgaccc cuucgugcut t 2184621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 846ccuucgugcu cuccgugcat t 2184721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 847ccgugcagcc gguggucuut t 2184821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 848cgguggucuu ccaggccugt t 2184921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 849aggccuguga agugaaccut t 2185021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 850aagugaaccu gacgcuggat t 2185121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 851gacgcuggac aacaggcuct t 2185221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 852acaacaggcu cgacucccat t 2185321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 853acucccaggg cguccucagt t 2185421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 854ccccguacuu ccccagcuat t 2185521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 855uuccccagcu acuacucgct t 2185621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 856acuacucgcc ccaaacccat t 2185721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 857cccaaaccca cugcuccugt t 2185821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 858gcuccuggca ccucacggut t 2185921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 859accucacggu gcccucucut t 2186021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 860cucucuggac uacggcuugt t 2186121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 861gacuacggcu uggcccucut t 2186221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 862cccucugguu ugaugccuat t 2186321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 863guuugaugcc uaugcacugt t 2186421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 864gcacugagga ggcagaagut t 2186521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 865ggaggcagaa guaugauuut t 2186621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 866augauuugcc gugcacccat t 2186721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 867ugcacccagg gccaguggat t 2186821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 868gccaguggac gauccagaat t 2186921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 869ggacgaucca gaacaggagt t 2187021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 870acaggaggcu guguggcuut t 2187121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 871cuguguggcu ugcgcaucct t 2187221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA

Molecule Synthetic oligonucleotide" 872ugcgcauccu gcagcccuat t 2187321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 873agcccuacgc cgagaggaut t 2187421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 874ccgagaggau ccccguggut t 2187521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 875ccgugguggc cacggccggt t 2187621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 876ccacggccgg gaucaccaut t 2187721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 877ggaucaccau caacuucact t 2187821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 878ucaacuucac cucccagaut t 2187921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 879cccagaucuc ccucaccggt t 2188021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 880cccucaccgg gcccggugut t 2188121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 881cccggugugc gggugcacut t 2188221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 882gcuuguacaa ccagucggat t 2188321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 883acaaccaguc ggaccccugt t 2188421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 884accccugccc uggagaguut t 2188521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 885ccuggagagu uccucuguut t 2188621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 886ucuguucugu gaauggacut t 2188721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 887gaauggacuc ugugucccut t 2188821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 888cugugucccu gccugugaut t 2188921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 889cugccuguga uggggucaat t 2189021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 890ggucaaggac ugccccaact t 2189121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 891ugccccaacg gccuggaugt t 2189221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 892cggccuggau gagagaaact t 2189321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 893gagagaaacu gcguuugcat t 2189421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 894uuugcagagc cacauuccat t 2189521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 895gccacauucc agugcaaagt t 2189621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 896gugcaaagag gacagcacat t 2189721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 897gaggacagca caugcaucut t 2189821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 898gcaucucacu gcccaaggut t 2189921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 899gcccaagguc ugugaugggt t 2190021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 900ugugaugggc agccugauut t 2190121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 901gcagccugau ugucucaact t 2190221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 902gucucaacgg cagcgacgat t 2190321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 903gcgacgaaga gcagugccat t 2190421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 904agcagugcca ggaaggggut t 2190521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 905gaaggggugc caugugggat t 2190621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 906ccauguggga cauucaccut t 2190721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 907cauucaccuu ccagugugat t 2190821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 908cagugugagg accggagcut t 2190921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 909gaccggagcu gcgugaagat t 2191021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 910cugcgugaag aagcccaact t 2191121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 911agcccaaccc gcagugugat t 2191221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 912cagugugaug ggcggcccgt t 2191321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 913gcggcccgac ugcagggact t 2191421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 914cugcagggac ggcucggaut t 2191521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 915acggcucgga ugaggagcat t 2191621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 916ugaggagcac ugugacugut t 2191721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 917cugugacugu ggccuccagt t 2191821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 918gccuccaggg ccccuccagt t 2191921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 919ccccuccagc cgcauuguut t 2192021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 920ccgcauuguu gguggagcut t 2192121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 921guggagcugu guccuccgat t 2192221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 922cuccgagggu gaguggccat t 2192321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 923gggugagugg ccauggcagt t 2192421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 924auggcaggcc agccuccagt t 2192521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 925ccuccagguu cggggucgat t 2192621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 926gguucggggu cgacacauct t 2192721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 927acaucugugg gggggcccut t 2192821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 928gugggggggc ccucaucgct t 2192921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 929aucgcugacc gcugggugat t 2193021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 930accgcugggu gauaacagct t 2193121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 931ugauaacagc ugcccacugt t 2193221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 932cccacugcuu ccaggaggat t 2193321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 933ccaggaggac agcauggcct t 2193421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 934acagcauggc cuccacggut t 2193521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic

oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 935ccacggugcu guggaccgut t 2193621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 936ggaccguguu ccugggcaat t 2193721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 937uccugggcaa gguguggcat t 2193821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 938guguggcaga acucgcgcut t 2193921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 939gaacucgcgc uggccuggat t 2194021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 940ggccuggaga gguguccuut t 2194121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 941agguguccuu caaggugagt t 2194221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 942caaggugagc cgccugcuct t 2194321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 943gccugcuccu gcacccguat t 2194421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 944gcacccguac cacgaagagt t 2194521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 945ccacgaagag gacagccaut t 2194621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 946aggacagcca ugacuacgat t 2194721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 947acuacgacgu ggcgcugcut t 2194821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 948uggcgcugcu gcagcucgat t 2194921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 949agcucgacca cccgguggut t 2195021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 950ccgguggugc gcucggccgt t 2195121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 951ugcgcucggc cgccgugcgt t 2195221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 952ccgugcgccc cgucugccut t 2195321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 953ccgucugccu gcccgcgcgt t 2195421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 954ccgcgcgcuc ccacuucuut t 2195521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 955cccacuucuu cgagcccggt t 2195621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 956gagcccggcc ugcacugcut t 2195721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 957ggccugcacu gcuggauuat t 2195821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 958uggauuacgg gcuggggcgt t 2195921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 959gcuggggcgc cuugcgcgat t 2196021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 960ugcgcgaggg cggccccaut t 2196121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 961agggcggccc caucagcaat t 2196221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 962ucagcaacgc ucugcagaat t 2196321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 963ugcagaaagu ggaugugcat t 2196421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 964aaguggaugu gcaguugaut t 2196521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 965gcaguugauc ccacaggact t 2196621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 966cacaggaccu gugcagcgat t 2196721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 967gcagcgaggu cuaucgcuat t 2196821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 968gucuaucgcu accaggugat t 2196921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 969ccaggugacg ccacgcaugt t 2197021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 970ccacgcaugc ugugugccgt t 2197121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 971cugugugccg gcuaccgcat t 2197221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 972accgcaaggg caagaaggat t 2197321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 973gcaagaagga ugccugucat t 2197421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 974gccugucagg gugacucagt t 2197521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 975gugacucagg ugguccgcut t 2197621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 976gugguccgcu ggugugcaat t 2197721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 977uggugugcaa ggcacucagt t 2197821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 978gcacucagug gccgcuggut t 2197921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 979gccgcugguu ccuggcgggt t 2198021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 980uccuggcggg gcuggucagt t 2198121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 981gcuggucagc uggggccugt t 2198221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 982gggccugggc uguggccggt t 2198321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 983ggcuguggcc ggccuaacut t 2198421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 984cuaacuacuu cggcgucuat t 2198521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 985cggcgucuac acccgcauct t 2198621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 986acacccgcau cacaggugut t 2198721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 987acagguguga ucagcuggat t 2198821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 988ucagcuggau ccagcaagut t 2198921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 989cagcaagugg ugaccugagt t 2199021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 990ugaccugagg aacugcccct t 2199121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 991ggaacugccc cccugcaaat t 2199221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 992cugcaaagca gggcccacct t 2199321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 993gcagggccca ccuccuggat t 2199421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 994ccuccuggac ucagagagct t 2199521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 995cucagagagc ccagggcaat t 2199621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 996ccagggcaac ugccaagcat t 2199721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 997ggacaaguau ucuggcgggt t 2199821DNAArtificial

Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 998cuggcggggg gugggggagt t 2199921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 999ggguggggga gagagcaggt t 21100021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1000agagagcagg cccuguggut t 21100121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1001cccuguggug gcaggaggut t 21100221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1002ggagguggca ucuugucuct t 21100321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1003caucuugucu cgucccugat t 21100421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1004cccugauguc ugcuccagut t 21100521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1005cugcuccagu gauggcaggt t 21100621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1006auggcaggag gauggagaat t 21100721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1007ggauggagaa gugccagcat t 21100821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1008ugccagcagc ugggggucat t 21100921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1009agcugggggu caagacguct t 21101021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1010ucaagacguc cccugaggat t 21101121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1011cccugaggac ccaggcccat t 21101221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1012gcccacaccc agcccuucut t 21101321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1013agcccuucug ccucccaaut t 21101421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1014ccucccaauu cucucuccut t 21101521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1015cucucuccuc cguccccuut t 21101621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1016uccguccccu uccuccacut t 21101721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1017cuuccuccac ugcugccuat t 21101821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1018cugccuaaug caaggcagut t 21101921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1019gcaaggcagu ggcucagcat t 21102021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1020uggcucagca gcaagaaugt t 21102121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1021caagaaugcu gguucuacat t 21102221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1022ugguucuaca ucccgaggat t 21102321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1023cccgaggagu gucugaggut t 21102421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1024gucugaggug cgccccacut t 21102521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1025gccccacucu guacagaggt t 21102621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1026cuguacagag gcuguuuggt t 21102721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1027cuguuugggc agccuugcct t 21102821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1028cuugccucca gagagcagat t 21102921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1029uccagagagc agauuccagt t 21103021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1030gauuccagcu ucggaagcct t 21103121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1031gaauggaagg ugcucccaut t 21103221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1032gugcucccau cggaggggat t 21103321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1033ucggagggga cccucagagt t 21103421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1034cccucagagc ccuggagact t 21103521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1035gagacugcca ggugggccut t 21103621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1036aggugggccu gcugccacut t 21103721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1037cugccacugu aagccaaaat t 21103821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1038cuguaagcca aaaggugggt t 21103921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1039guggggaagu ccugacucct t 21104021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1040ccugacucca ggguccuugt t 21104121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1041ggguccuugc cccaccccut t 21104221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1042gccccacccc ugccugccat t 21104321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1043ccugccaccu gggcccucat t 21104421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1044cugggcccuc acagcccagt t 21104521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1045ucacagccca gacccucact t 21104621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1046cucacuggga ggugagcuct t 21104721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1047ggugagcuca gcugcccuut t 21104821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1048uggaauaaag cugccugaut t 21104921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1049cuggacuggg ucuggcucat t 21105021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1050accagagcug gacuggguct t 21105121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1051cagagggcag gcaccagagt t 21105221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1052ucagcucgca ccagagggct t 21105321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1053ucucagguca gcucgcacct t 21105421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1054ggaagugcau cucaggucat t 21105521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1055cacagaggag ggaagugcat t 21105621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1056gugccgagac agcucacagt t 21105721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1057ugcaaguggg ugccgagact t 21105821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1058cggcagugac ugcaaguggt t 21105921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1059aacaucaggc ggcagugact t 21106021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1060aagaguaaca acaucaggct t

21106121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1061uuuuggagug gaagaguaat t 21106221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1062acgggcaucc uuuuggagut t 21106321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1063ggggccucgg ccacgggcat t 21106421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1064accugggggg ccucggccat t 21106521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1065cugcccgcca gccaccuggt t 21106621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1066ccuccguccc ccugcccgct t 21106721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1067cucgccauca ccuccgucct t 21106821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1068uccgcuuccu cgccaucact t 21106921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1069uccccuccgg cuccgcuuct t 21107021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1070cuugaacauc cccuccggct t 21107121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1071uccucacagg ccuugaacat t 21107221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1072ucucuuggag uccucacagt t 21107321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1073cgggcuuuuc ucuuggagut t 21107421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1074ggcggaggua gccccgggct t 21107521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1075aggggcacca ggcggaggut t 21107621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1076acaaacaggg gcaccaggct t 21107721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1077agggccagca gcacaaacat t 21107821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1078agcacgagca gggccagcat t 21107921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1079cgccgaagcc agcacgagct t 21108021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1080agaguagcac ccccgccgat t 21108121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1081cagaguagca cccccgccgt t 21108221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1082ccagaguagc acccccgcct t 21108321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1083accagaguag cacccccgct t 21108421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1084uaccagagua gcacccccgt t 21108521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1085auaccagagu agcaccccct t 21108621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1086aaauaccaga guagcaccct t 21108721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1087gaaauaccag aguagcacct t 21108821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1088ggaaauacca gaguagcact t 21108921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1089uaggaaauac cagaguagct t 21109021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1090cuaggaaaua ccagaguagt t 21109121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1091ccuaggaaau accagaguat t 21109221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1092cccuaggaaa uaccagagut t 21109321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1093acccuaggaa auaccagagt t 21109421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1094guacccuagg aaauaccagt t 21109521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1095cuuguacccu aggaaauact t 21109621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1096ccuuguaccc uaggaaauat t 21109721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1097gccuuguacc cuaggaaaut t 21109821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1098cgccuuguac ccuaggaaat t 21109921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1099ccgccuugua cccuaggaat t 21110021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1100cuccgccuug uacccuaggt t 21110121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1101ccuccgccuu guacccuagt t 21110221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1102accuccgccu uguacccuat t 21110321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1103caccuccgcc uuguacccut t 21110421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1104ucaccuccgc cuuguaccct t 21110521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1105aucaccuccg ccuuguacct t 21110621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1106caucaccucc gccuuguact t 21110721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1107ccaucaccuc cgccuuguat t 21110821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1108accaucaccu ccgccuugut t 21110921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1109gaccaucacc uccgccuugt t 21111021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1110ugaccaucac cuccgccuut t 21111121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1111cugaccauca ccuccgccut t 21111221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1112uacaccuggc ugaccaucat t 21111321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1113acugccugag uacaccuggt t 21111421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1114uugaguacac gcagacugct t 21111521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1115guggcgauug aguacacgct t 21111621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1116auccugggag aaguggcgat t 21111721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1117gcggguaaga uccugggagt t 21111821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1118acuagauucc cggcggguat t 21111921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1119gaaggcacua gauucccggt t 21112021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1120uuucacugcg gaaggcacut t 21112121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1121ugggcuuugg cgguuucact t 21112221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1122caucuucugg gcuuuggcgt t 21112321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA

Molecule Synthetic oligonucleotide" 1123gcuccuugag caucuucugt t 21112421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1124cuggugauga gcuccuugat t 21112521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1125uucccaggcg ggugcuggut t 21112621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1126uuguaguaag uucccaggct t 21112721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1127cuggaguugu aguaaguuct t 21112821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1128aauagacgga gcuggaguut t 21112921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1129uccccaaagg aauagacggt t 21113021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1130gugagggguc ccuccccaat t 21113121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1131agaagaagca ggugaggggt t 21113221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1132aaugaaccag aagaagcagt t 21113321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1133gauuuggaga augaaccagt t 21113421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1134gugcucgggg auuuggagat t 21113521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1135aucagccggc ggugcucggt t 21113621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1136ucggggcuca gcaucagcct t 21113721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1137ugcaccaccu cggggcucat t 21113821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1138accagcagug ccugcaccat t 21113921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1139uccuccacca gcagugccut t 21114021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1140uggacagcag cuccuccact t 21114121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1141gagcuguuga cuguggacat t 21114221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1142acggcagccg agcuguugat t 21114321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1143uguaggggac ggcagccgat t 21114421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1144uaggcccucg ggguccacut t 21114521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1145uccaggauca cuaggcccut t 21114621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1146cuggcuucca ggaucacuat t 21114721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1147augucuuuca cacuggcuut t 21114821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1148aaugcagcua ugucuuucat t 21114921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1149cagcguggaa uucaaugcat t 21115021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1150cuggcccacg uagcuguagt t 21115121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1151cuggcccugg cccacguagt t 21115221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1152agccggagga ccuggcccut t 21115321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1153gucaggcccc uucagccggt t 21115421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1154aggccaggug gucaggccct t 21115521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1155gcagcuggag gccagguggt t 21115621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1156aggugccaca ggcagcuggt t 21115721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1157ggcccugcag gugccacagt t 21115821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1158gguccuuggg gcccugcagt t 21115921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1159uugagcauga gguccuuggt t 21116021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1160uccagccgga guuugagcat t 21116121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1161cagcguccac uccagccggt t 21116221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1162ccggcacucu gccagcguct t 21116321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1163ucggucccgg cacucugcct t 21116421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1164ucauacaugg ccagucggut t 21116521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1165ccggccacgu cauacauggt t 21116621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1166ucuccagggg cccggccact t 21116721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1167augagccucu ucuccagggt t 21116821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1168gaggugauga gccucuucut t 21116921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1169ugcagccgua caccgaggut t 21117021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1170uccuggcggc ugcagccgut t 21117121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1171accacgggcu ccuggcggct t 21117221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1172agaaccucca ccacgggcut t 21117321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1173ccgacgccag aaccuccact t 21117421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1174augauggccc ccgacgccat t 21117521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1175cagacgaccg ccaugauggt t 21117621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1176ccuucuucca gacgaccgct t 21117721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1177cugugcaggc ccuucuucct t 21117821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1178gucguaguag cugugcaggt t 21117921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1179agcacgaagg ggucguagut t 21118021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1180ugcacggaga gcacgaaggt t 21118121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1181aagaccaccg gcugcacggt t 21118221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1182caggccugga agaccaccgt t 21118321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1183agguucacuu cacaggccut t 21118421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1184uccagcguca gguucacuut t 21118521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1185gagccuguug uccagcguct t 21118621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic

oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1186ugggagucga gccuguugut t 21118721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1187cugaggacgc ccugggagut t 21118821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1188uagcugggga aguacggggt t 21118921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1189gcgaguagua gcuggggaat t 21119021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1190uggguuuggg gcgaguagut t 21119121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1191caggagcagu ggguuugggt t 21119221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1192accgugaggu gccaggagct t 21119321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1193agagagggca ccgugaggut t 21119421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1194caagccguag uccagagagt t 21119521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1195agagggccaa gccguaguct t 21119621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1196uaggcaucaa accagagggt t 21119721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1197cagugcauag gcaucaaact t 21119821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1198acuucugccu ccucagugct t 21119921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1199aaaucauacu ucugccucct t 21120021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1200ugggugcacg gcaaaucaut t 21120121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1201uccacuggcc cugggugcat t 21120221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1202uucuggaucg uccacuggct t 21120321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1203cuccuguucu ggaucgucct t 21120421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1204aagccacaca gccuccugut t 21120521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1205ggaugcgcaa gccacacagt t 21120621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1206uagggcugca ggaugcgcat t 21120721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1207auccucucgg cguagggcut t 21120821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1208accacgggga uccucucggt t 21120921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1209ccggccgugg ccaccacggt t 21121021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1210auggugaucc cggccguggt t 21121121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1211gugaaguuga uggugaucct t 21121221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1212aucugggagg ugaaguugat t 21121321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1213ccggugaggg agaucugggt t 21121421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1214acaccgggcc cggugagggt t 21121521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1215agugcacccg cacaccgggt t 21121621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1216uccgacuggu uguacaagct t 21121721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1217cagggguccg acugguugut t 21121821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1218aacucuccag ggcaggggut t 21121921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1219aacagaggaa cucuccaggt t 21122021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1220aguccauuca cagaacagat t 21122121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1221agggacacag aguccauuct t 21122221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1222aucacaggca gggacacagt t 21122321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1223uugaccccau cacaggcagt t 21122421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1224guuggggcag uccuugacct t 21122521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1225cauccaggcc guuggggcat t 21122621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1226guuucucuca uccaggccgt t 21122721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1227ugcaaacgca guuucucuct t 21122821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1228uggaaugugg cucugcaaat t 21122921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1229cuuugcacug gaauguggct t 21123021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1230ugugcugucc ucuuugcact t 21123121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1231agaugcaugu gcuguccuct t 21123221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1232accuugggca gugagaugct t 21123321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1233cccaucacag accuugggct t 21123421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1234aaucaggcug cccaucacat t 21123521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1235guugagacaa ucaggcugct t 21123621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1236ucgucgcugc cguugagact t 21123721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1237uggcacugcu cuucgucgct t 21123821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1238accccuuccu ggcacugcut t 21123921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1239ucccacaugg caccccuuct t 21124021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1240aggugaaugu cccacauggt t 21124121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1241ucacacugga aggugaaugt t 21124221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1242agcuccgguc cucacacugt t 21124321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1243ucuucacgca gcuccgguct t 21124421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1244guugggcuuc uucacgcagt t 21124521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1245ucacacugcg gguugggcut t 21124621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1246cgggccgccc aucacacugt t 21124721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1247gucccugcag ucgggccgct t 21124821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1248auccgagccg ucccugcagt t 21124921DNAArtificial

Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1249ugcuccucau ccgagccgut t 21125021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1250acagucacag ugcuccucat t 21125121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1251cuggaggcca cagucacagt t 21125221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1252cuggaggggc ccuggaggct t 21125321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1253aacaaugcgg cuggaggggt t 21125421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1254agcuccacca acaaugcggt t 21125521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1255ucggaggaca cagcuccact t 21125621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1256uggccacuca cccucggagt t 21125721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1257cugccauggc cacucaccct t 21125821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1258cuggaggcug gccugccaut t 21125921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1259ucgaccccga accuggaggt t 21126021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1260gaugugucga ccccgaacct t 21126121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1261agggcccccc cacagaugut t 21126221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1262gcgaugaggg cccccccact t 21126321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1263ucacccagcg gucagcgaut t 21126421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1264gcuguuauca cccagcggut t 21126521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1265cagugggcag cuguuaucat t 21126621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1266uccuccugga agcagugggt t 21126721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1267ggccaugcug uccuccuggt t 21126821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1268accguggagg ccaugcugut t 21126921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1269acgguccaca gcaccguggt t 21127021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1270uugcccagga acacggucct t 21127121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1271ugccacaccu ugcccaggat t 21127221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1272agcgcgaguu cugccacact t 21127321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1273uccaggccag cgcgaguuct t 21127421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1274aaggacaccu cuccaggcct t 21127521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1275cucaccuuga aggacaccut t 21127621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1276gagcaggcgg cucaccuugt t 21127721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1277uacgggugca ggagcaggct t 21127821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1278cucuucgugg uacgggugct t 21127921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1279auggcugucc ucuucguggt t 21128021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1280ucguagucau ggcuguccut t 21128121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1281agcagcgcca cgucguagut t 21128221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1282ucgagcugca gcagcgccat t 21128321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1283accaccgggu ggucgagcut t 21128421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1284cggccgagcg caccaccggt t 21128521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1285cgcacggcgg ccgagcgcat t 21128621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1286aggcagacgg ggcgcacggt t 21128721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1287cgcgcgggca ggcagacggt t 21128821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1288aagaaguggg agcgcgcggt t 21128921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1289ccgggcucga agaagugggt t 21129021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1290agcagugcag gccgggcuct t 21129121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1291uaauccagca gugcaggcct t 21129221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1292cgccccagcc cguaauccat t 21129321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1293ucgcgcaagg cgccccagct t 21129421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1294auggggccgc ccucgcgcat t 21129521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1295uugcugaugg ggccgcccut t 21129621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1296uucugcagag cguugcugat t 21129721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1297ugcacaucca cuuucugcat t 21129821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1298aucaacugca cauccacuut t 21129921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1299guccuguggg aucaacugct t 21130021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1300ucgcugcaca gguccugugt t 21130121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1301uagcgauaga ccucgcugct t 21130221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1302ucaccuggua gcgauagact t 21130321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1303caugcguggc gucaccuggt t 21130421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1304cggcacacag caugcguggt t 21130521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1305ugcgguagcc ggcacacagt t 21130621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1306uccuucuugc ccuugcggut t 21130721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1307ugacaggcau ccuucuugct t 21130821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1308cugagucacc cugacaggct t 21130921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1309agcggaccac cugagucact t 21131021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1310uugcacacca gcggaccact t 21131121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1311cugagugccu ugcacaccat t

21131221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1312accagcggcc acugagugct t 21131321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1313cccgccagga accagcggct t 21131421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1314cugaccagcc ccgccaggat t 21131521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1315caggccccag cugaccagct t 21131621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1316ccggccacag cccaggccct t 21131721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1317aguuaggccg gccacagcct t 21131821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1318uagacgccga aguaguuagt t 21131921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1319gaugcgggug uagacgccgt t 21132021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1320acaccuguga ugcgggugut t 21132121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1321uccagcugau cacaccugut t 21132221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1322acuugcugga uccagcugat t 21132321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1323cucaggucac cacuugcugt t 21132421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1324ggggcaguuc cucaggucat t 21132521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1325uuugcagggg ggcaguucct t 21132621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1326ggugggcccu gcuuugcagt t 21132721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1327uccaggaggu gggcccugct t 21132821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1328gcucucugag uccaggaggt t 21132921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1329uugcccuggg cucucugagt t 21133021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1330ugcuuggcag uugcccuggt t 21133121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1331cccgccagaa uacuugucct t 21133221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1332cucccccacc ccccgccagt t 21133321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1333ccugcucucu cccccaccct t 21133421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1334accacagggc cugcucucut t 21133521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1335accuccugcc accacagggt t 21133621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1336gagacaagau gccaccucct t 21133721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1337ucagggacga gacaagaugt t 21133821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1338acuggagcag acaucagggt t 21133921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1339ccugccauca cuggagcagt t 21134021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1340uucuccaucc uccugccaut t 21134121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1341ugcuggcacu ucuccaucct t 21134221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1342ugacccccag cugcuggcat t 21134321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1343gacgucuuga cccccagcut t 21134421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1344uccucagggg acgucuugat t 21134521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1345ugggccuggg uccucagggt t 21134621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1346agaagggcug ggugugggct t 21134721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1347auugggaggc agaagggcut t 21134821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1348aggagagaga auugggaggt t 21134921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1349aaggggacgg aggagagagt t 21135021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1350aguggaggaa ggggacggat t 21135121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1351uaggcagcag uggaggaagt t 21135221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1352acugccuugc auuaggcagt t 21135321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1353ugcugagcca cugccuugct t 21135421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1354cauucuugcu gcugagccat t 21135521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1355uguagaacca gcauucuugt t 21135621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1356uccucgggau guagaaccat t 21135721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1357accucagaca cuccucgggt t 21135821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1358aguggggcgc accucagact t 21135921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1359ccucuguaca gaguggggct t 21136021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1360ccaaacagcc ucuguacagt t 21136121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1361ggcaaggcug cccaaacagt t 21136221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1362ucugcucucu ggaggcaagt t 21136321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1363cuggaaucug cucucuggat t 21136421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1364ggcuuccgaa gcuggaauct t 21136521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1365augggagcac cuuccauuct t 21136621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1366uccccuccga ugggagcact t 21136721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1367cucugagggu ccccuccgat t 21136821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1368gucuccaggg cucugagggt t 21136921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1369aggcccaccu ggcagucuct t 21137021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1370aguggcagca ggcccaccut t 21137121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1371uuuuggcuua caguggcagt t 21137221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1372cccaccuuuu ggcuuacagt t 21137321DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1373ggagucagga cuuccccact t 21137421DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA

Molecule Synthetic oligonucleotide" 1374caaggacccu ggagucaggt t 21137521DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1375aggggugggg caaggaccct t 21137621DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1376uggcaggcag ggguggggct t 21137721DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1377ugagggccca gguggcaggt t 21137821DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1378cugggcugug agggcccagt t 21137921DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1379gugagggucu gggcugugat t 21138021DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1380gagcucaccu cccagugagt t 21138121DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1381aagggcagcu gagcucacct t 21138221DNAArtificial Sequencesource/note="Description of Artificial Sequence Synthetic oligonucleotide"source/note="Description of Combined DNA/RNA Molecule Synthetic oligonucleotide" 1382aucaggcagc uuuauuccat t 21

Claims

1. A double stranded RNAi agent capable of inhibiting expression of TMPRSS6 in a cell, wherein said double stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:1, SEQ ID NO:4, or SEQ ID NO:1, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:1, or SEQ ID NON, SEQ ID NO:9, or SEQ ID NO: 10, wherein substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand are modified nucleotides, and wherein said sense strand is conjugated to a ligand attached at the 3'-terminus.

2. The double stranded RNAi agent of claim 1, wherein all of the nucleotides of said sense strand and all of the nucleotides of said antisense strand are modified nucleotides.

3. The double stranded RNAi agent of claim 1, wherein said sense strand and said antisense strand comprise a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12.

4. (canceled)

5. The double stranded RNAi agent of any claim 1, wherein at least one strand comprises a 3' overhang of at least 1 nucleotide or at least 2 nucleotide.

6. (canceled)

7. A double stranded RNAi agent capable of inhibiting expression of TMPRSS6 (matriptase-2) in a cell, wherein said double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein said antisense strand comprises a region complementary to part of an mRNA encoding TMPRSS6, wherein each strand is about 14 to about nucleotides in length, wherein said double stranded RNAi agent is represented by formula (III): sense: 5'n.sub.p-N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.j--N.sub- .a-n.sub.q3' antisense: 3'n.sub.p'--N.sub.a'--(X'X'X').sub.k--N.sub.b'--Y'Y'Y'--N.sub.b'--(Z'Z'Z'- ).sub.l--N.sub.a'-n.sub.q'5' (III) wherein: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0-6; each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides; each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 nucleotides which are either modified or unmodified or combinations thereof; each n.sub.p, n.sub.p', n.sub.q, and n.sub.q', each of which may or may not be present, independently represents an overhang nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; modifications on N.sub.b differ from the modification on Y and modifications on N.sub.b' differ from the modification on Y'; and wherein the sense strand is conjugated to at least one ligand.

8-10. (canceled)

11. The double stranded RNAi agent of claim 7, wherein the YYY motif occurs at or near the cleavage site of the sense strand.

12-17. (canceled)

18. The double stranded RNAi agent of claim 7, wherein the double-stranded region is 15-30 nucleotide pairs in length.

19-23. (canceled)

24. The double stranded RNAi agent of claim 7, wherein each strand has 15-30 nucleotides.

25. (canceled)

26. The double stranded RNAi agent of claim 7, wherein the modifications on the nucleotides are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.

27. (canceled)

28. The double stranded RNAi agent of claim 1, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

29. The double stranded RNAi agent of claim 1, wherein the ligand is ##STR00016##

30. (canceled)

31. (canceled)

32. The double stranded RNAi agent of claim 1, wherein said agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

33-40. (canceled)

41. The double stranded RNAi agent of claim 32, wherein said RNAi agent comprises 6-8 phosphorothioate internucleotide linkages.

42-52. (canceled)

53. The double stranded RNAi agent of claim 1, wherein said RNAi agent is selected from the group of RNAi agents listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12.

54. (canceled)

55. (canceled)

56. A double stranded RNAi agent capable of inhibiting expression of TMPRSS6 in a cell, wherein said double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region, wherein said sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO: 10, wherein substantially all of the nucleotides of said sense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, wherein said sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus, wherein substantially all of the nucleotides of said antisense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, wherein said antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus, and wherein said sense strand is conjugated to one or more GalNAc derivatives attached through a branched bivalent or trivalent linker at the 3'-terminus.

57-67. (canceled)

68. A pharmaceutical composition comprising the double stranded RNAi agent of claim 1.

69-73. (canceled)

74. A method of inhibiting TMPRSS6 expression in a cell, the method comprising: (a) contacting the cell with the double stranded RNAi agent of claim 1; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of a TMPRSS6 gene, thereby inhibiting expression of the TMPRSS6 gene in the cell.

75-81. (canceled)

82. A method of treating a subject having a TMPRSS6 associated disorder, comprising administering to the subject a therapeutically effective amount of the double stranded RNAi agent of claim 1 or a pharmaceutical composition of claim 68, thereby treating said subject.

83-100. (canceled)

101. The double stranded RNAi agent of claim 7, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

102. The double stranded RNAi agent of claim 7, wherein the ligand is ##STR00017##

103. The double stranded RNAi agent of claim 7, wherein said agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

104. The double stranded RNAi agent of claim 103, wherein said RNAi agent comprises 6-8 phosphorothioate internucleotide linkages.

105. The double stranded RNAi agent of claim 7, wherein said RNAi agent is selected from the group of RNAi agents listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12.