U.S. patent application number 17/235837 was filed with the patent office on 2021-08-12 for compositions and methods for accurately identifying mutations.
The applicant listed for this patent is Fred Hutchinson Cancer Research Center. Invention is credited to Jason H. BIELAS.
Application Number | 20210246504 17/235837 |
Document ID | / |
Family ID | 1000005542440 |
Filed Date | 2021-08-12 |
United States Patent
Application |
20210246504 |
Kind Code |
A1 |
BIELAS; Jason H. |
August 12, 2021 |
COMPOSITIONS AND METHODS FOR ACCURATELY IDENTIFYING MUTATIONS
Abstract
The present disclosure provides compositions and methods for
accurately detecting mutations by uniquely tagging double stranded
nucleic acid molecules with dual cyphers such that sequence data
obtained from a sense strand can be linked to sequence data
obtained from an anti-sense strand when sequenced, for example, by
massively parallel sequencing methods.
Inventors: |
BIELAS; Jason H.; (Seattle,
WA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Fred Hutchinson Cancer Research Center |
Seattle |
WA |
US |
|
|
Family ID: |
1000005542440 |
Appl. No.: |
17/235837 |
Filed: |
April 20, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16996682 |
Aug 18, 2020 |
|
|
|
17235837 |
|
|
|
|
16898155 |
Jun 10, 2020 |
|
|
|
16996682 |
|
|
|
|
16657898 |
Oct 18, 2019 |
|
|
|
16898155 |
|
|
|
|
16121559 |
Sep 4, 2018 |
|
|
|
16657898 |
|
|
|
|
15199784 |
Jun 30, 2016 |
10450606 |
|
|
16121559 |
|
|
|
|
14378870 |
Aug 14, 2014 |
10011871 |
|
|
PCT/US2013/026505 |
Feb 15, 2013 |
|
|
|
15199784 |
|
|
|
|
61600535 |
Feb 17, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/1065 20130101;
C12N 15/10 20130101; C12Q 1/6874 20130101; C40B 40/08 20130101;
C12Q 1/6869 20130101; C12N 15/1093 20130101; C12N 15/85 20130101;
C40B 50/06 20130101; C12N 15/81 20130101; C12N 15/70 20130101; C12Q
1/6827 20130101 |
International
Class: |
C12Q 1/6874 20060101
C12Q001/6874; C12Q 1/6869 20060101 C12Q001/6869; C12N 15/10
20060101 C12N015/10; C12N 15/70 20060101 C12N015/70; C12N 15/81
20060101 C12N015/81; C12N 15/85 20060101 C12N015/85; C40B 40/08
20060101 C40B040/08; C40B 50/06 20060101 C40B050/06; C12Q 1/6827
20060101 C12Q001/6827 |
Claims
1.-38. (canceled)
39. A method for sequencing double-stranded target nucleic acid
molecules, comprising: (a) ligating the double-stranded target
nucleic acid molecules to double-stranded cyphers at both ends to
form cypher-target nucleic acid complexes, wherein the
double-stranded cyphers each comprise a random or partially random
identifier sequence, and further wherein each target nucleic acid
molecule is a DNA molecule comprising a target tag sequence that
together with the double-stranded cyphers uniquely labels the
double-stranded target nucleic acid molecule; (b) amplifying each
strand of the cypher-target nucleic acid complexes to produce a
plurality of cypher-target amplification products from each of a
first strand and a complementary second strand of the cypher-target
nucleic acid complexes; (c) sequencing the cypher-target
amplification products to produce a plurality of first-strand
sequencing reads and a plurality of second-strand sequencing reads,
wherein the plurality of first-strand sequencing reads and the
plurality of second-strand sequencing reads each comprise an
identifier sequence and a target tag sequence; (d) grouping the
first-strand sequencing reads and second-strand sequencing reads
based on sequence identity of: the identifier sequence, and the
target tag sequence, wherein a group comprises sequencing reads
from one of the uniquely labeled double-stranded target nucleic
acid molecules; and (e) comparing the first-strand sequencing reads
with the second-strand sequencing reads in each group, and
generating an error-corrected sequence for a plurality of the
double-stranded target nucleic acid molecules by distinguishing
erroneous nucleotides in one strand that lack a matched base change
in the complementary strand.
40. The method of claim 39, wherein the double-stranded cyphers
comprise random identifier sequences.
41. The method of claim 39, wherein the double-stranded cyphers
comprise identifier sequences that are not completely random.
42. The method of claim 39, wherein a target tag sequence comprises
nucleotides at an end of a target nucleic acid molecule.
43. The method of claim 42, wherein the end of the target nucleic
acid molecule is a sheared end.
44. The method of claim 39, wherein the random or partially-random
identifier sequence is double-stranded.
45. The method of claim 39, wherein the identifier sequence is at
an end of the double-stranded cypher.
46. The method of claim 39, wherein the target tag sequence is 5
nucleotides to 20 nucleotides in length.
47. The method of claim 39, wherein each of the cyphers are
unique.
48. The method of claim 39, wherein the erroneous nucleotides
comprise a polymerase error that arose during amplification or
sequencing.
49. The method of claim 39, wherein the plurality of target nucleic
acid molecules comprise a mutation present at a frequency of
2.1.times.10.sup.-6 or lower.
50. The method of claim 39, further comprising detecting a cancer
biomarker in one of the error-corrected sequences, wherein the
cancer biomarker comprises a nucleotide mutation.
51. The method of claim 39, further comprising using the
error-corrected sequences to assess cancer response to therapy.
52. The method of claim 39, wherein the sample is derived from a
human subject having cancer, and wherein the method further
comprises detecting in one of the error-corrected sequences a
mutation that confers to the cancer resistance to cancer therapy.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. provisional
patent application Ser. Nos. 61/600,535, filed Feb. 17, 2012, which
is incorporated herein by reference in its entirety.
STATEMENT REGARDING SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing
360056_409-WO_SEQUENCE_LISTING_.txt. The text file is 4 KB, was
created on Feb. 14, 2013, and is being submitted electronically via
EFS-Web.
BACKGROUND
1. Technical Field
[0003] The present disclosure relates to compositions and methods
for accurately detecting mutations using sequencing and, more
particularly, uniquely tagging double stranded nucleic acid
molecules such that sequence data obtained for a sense strand can
be linked to sequence data obtained from the anti-sense strand when
obtained via massively parallel sequencing methods.
2. Description of Related Art
[0004] Detection of spontaneous mutations (e.g., substitutions,
insertions, deletions, duplications), or even induced mutations,
that occur randomly throughout a genome can be challenging because
these mutational events are rare and may exist in one or only a few
copies of DNA. The most direct way to detect mutations is by
sequencing, but the available sequencing methods are not sensitive
enough to detect rare mutations. For example, mutations that arise
de novo in mitochondrial DNA (mtDNA) will generally only be present
in a single copy of mtDNA, which means these mutations are not
easily found since a mutation must be present in as much as 10-25%
of a population of molecules to be detected by sequencing (Jones et
al., Proc. Nat'l. Acad. Sci. U.S.A. 105:4283-88, 2008). As another
example, the spontaneous somatic mutation frequency in genomic DNA
has been estimated to be as low as 1.times.10.sup.-8 and
2.1.times.10.sup.-6 in human normal and cancerous tissues,
respectively (Bielas et al., Proc. Nat'l Acad. Sci. U.S.A.
103:18238-42, 2008).
[0005] One improvement in sequencing has been to take individual
DNA molecules and amplify the number of each molecule by, for
example, polymerase chain reaction (PCR) and digital PCR. Indeed,
massively parallel sequencing represents a particularly powerful
form of digital PCR because multiple millions of template DNA
molecules can be analyzed one by one. However, the amplification of
single DNA molecules prior to or during sequencing by PCR and/or
bridge amplification suffers from the inherent error rate of
polymerases employed for amplification, and spurious mutations
generated during amplification may be misidentified as spontaneous
mutations from the original (endogenous unamplified) nucleic acid.
Similarly, DNA templates damaged during preparation (ex vivo) may
be amplified and incorrectly scored as mutations by massively
parallel sequencing techniques. Again, using mtDNA as an example,
experimentally determined mutation frequencies are strongly
dependent on the accuracy of the particular assay being used
(Kraytsberg et al., Methods 46:269-73, 2008)--these discrepancies
suggest that the spontaneous mutation frequency of mtDNA is either
below, or very close to, the detection limit of these technologies.
Massively parallel sequencing cannot generally be used to detect
rare variants because of the high error rate associated with the
sequencing process--one process using bridge amplification and
sequencing by synthesis has shown an error rate that varies from
about 0.06% to 1%, which depends on various factors including read
length, base-calling algorithms, and the type of variants detected
(see Kinde et al., Proc. Nat'l. Acad. Sci. U.S.A. 108:9530-5,
2011).
BRIEF SUMMARY
[0006] In one aspect, the present disclosure provides a
double-stranded nucleic acid molecule library that includes a
plurality of target nucleic acid molecules and a plurality of
random cyphers, wherein the nucleic acid library comprises
molecules having a formula of X.sup.a-X.sup.b-Y, X.sup.b-X.sup.a-Y,
Y-X.sup.a-X.sup.b, Y-X.sup.b-X.sup.a, X.sup.a-Y-X.sup.b, or
X.sup.b-Y-X.sup.a (in 5' to 3' order), wherein (a) X.sup.a
comprises a first random cypher, (b) Y comprises a target nucleic
acid molecule, and (c) X.sup.b comprises a second random cypher.
Furthermore, each of the plurality of random cyphers comprise a
length ranging from about 5 nucleotides to about 50 nucleotides (or
about 5 nucleotides to about 10 nucleotides, or a length of about
6, about 7, about 8, about 9, about 10, about 11, about 12, about
13, about 14, about 15, about 16, about 17, about 18, about 19, or
about 20 nucleotides).
[0007] In certain embodiments, the double-stranded sequences of the
X.sup.a and X.sup.b cyphers are the same (e.g., X.sup.a=X.sup.b)
for one or more target nucleic acid molecules, provided that each
such target nucleic acid molecule does not have the same
double-stranded cypher sequence as any other such target nucleic
acid molecule. In certain other embodiments, the double-stranded
sequence of the X.sup.a cypher for each target nucleic acid
molecule is different from the double-stranded sequence of the
X.sup.b cypher. In further embodiments, the double-stranded nucleic
acid library is contained in a self-replicating vector, such as a
plasmid, cosmid, YAC, or viral vector.
[0008] In a further aspect, the present disclosure provides a
method for obtaining a nucleic acid sequence or accurately
detecting a true mutation in a nucleic acid molecule by amplifying
each strand of the aforementioned double-stranded nucleic acid
library wherein a plurality of target nucleic acid molecules and
plurality of random cyphers are amplified, and sequencing each
strand of the plurality of target nucleic acid molecules and
plurality of random cyphers. In certain embodiments, the sequencing
is performed using massively parallel sequencing methods. In
certain embodiments, the sequence of one strand of a target nucleic
acid molecule associated with the first random cypher aligned with
the sequence of the complementary strand associated with the second
random cypher results in a measureable sequencing error rate
ranging from about 10.sup.-6 to about 10.sup.-8.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 is a cartoon illustration of an exemplary vector of
the present disclosure useful for generating a double-stranded
nucleic acid library.
[0010] FIG. 2 is a cartoon illustration of an exemplary vector of
the present disclosure, wherein adaptor sequences are included and
are useful for, for example, bridge amplification methods before
sequencing.
[0011] FIGS. 3A and 3B show characteristics of a cypher library and
the detection of true mutations. (A) Data generated in a single
next generation sequence run on MiSeq.RTM. demonstrates broad
coverage and diversity at the upstream seven base pair cypher in a
vector library, wherein the vector used is illustrated in FIG. 2.
(B) Cypher Seq eliminates errors introduced during library
preparation and sequencing. Target nucleic acid molecules were
ligated into a cypher vector library containing previously
catalogued dual, double-stranded cyphers. The target sequences were
amplified and sequenced. All sequencing reads having identical
cypher pairs, along with their reverse complements, were grouped
into families. Comparison of family sequences allowed for
generation of a consensus sequence wherein `mutations` (errors)
arising during library preparation (open circle) and during
sequencing (gray circle and triangle) were computationally
eliminated. Generally, mutations that are present in all or
substantially all reads (black diamond) from the same cypher and
its reverse complement are counted as true mutations.
[0012] FIGS. 4A and 4B show that the cypher system can distinguish
true mutations from artifact mutations. (A) Wild-type TP53 Exon 4
was ligated into a library of Cypher Seq vectors and sequenced on
the Illumina MiSeq.RTM. instrument with a depth of over a million.
Sequences were then compared to wild-type TP53 sequence. Detected
substitutions were plotted before (A) and after correction (B) with
Cypher Seq.
DETAILED DESCRIPTION
[0013] In one aspect, the present disclosure provides a
double-stranded nucleic acid library wherein target nucleic acid
molecules include dual cyphers (i.e., barcodes or origin identifier
tags), one on each end (same or different), so that sequencing each
complementary strand can be connected or linked back to the
original molecule. The unique cypher on each strand links each
strand with its original complementary strand (e.g., before any
amplification), so that each paired sequence serves as its own
internal control. In other words, by uniquely tagging
double-stranded nucleic acid molecules, sequence data obtained from
one strand of a single nucleic acid molecule can be specifically
linked to sequence data obtained from the complementary strand of
that same double-stranded nucleic acid molecule. Furthermore,
sequence data obtained from one end of a double-stranded target
nucleic acid molecule can be specifically linked to sequence data
obtained from the opposite end of that same double-stranded target
nucleic acid molecule (if, for example, it is not possible to
obtain sequence data across the entire target nucleic acid molecule
fragment of the library).
[0014] The compositions and methods of this disclosure allow a
person of ordinary skill in the art to more accurately distinguish
true mutations (i.e., naturally arising in vivo mutations) of a
nucleic acid molecule from artifact "mutations" (i.e., ex vivo
mutations or errors) of a nucleic acid molecule that may arise for
various reasons, such as a downstream amplification error, a
sequencing error, or physical or chemical damage. For example, if a
mutation pre-existed in the original double-stranded nucleic acid
molecule before isolation, amplification or sequencing, then a
transition mutation of adenine (A) to guanine (G) identified on one
strand will be complemented with a thymine (T) to cysteine (C)
transition on the other strand. In contrast, artifact "mutations"
that arise later on an individual (separate) DNA strand due to
polymerase errors during isolation, amplification or sequencing are
extremely unlikely to have a matched base change in the
complementary strand. The approach of this disclosure provides
compositions and methods for distinguishing systematic errors
(e.g., polymerase read fidelity errors) and biological errors
(e.g., chemical or other damage) from actual known or newly
identified true mutations or single nucleotide polymorphisms
(SNPs).
[0015] In certain embodiments, the two cyphers on each target
molecule have sequences that are distinct from each other and,
therefore, provide a unique pair of identifiers wherein one cypher
identifies (or is associated with) a first end of a target nucleic
acid molecule and the second cypher identifies (or is associated
with) the other end of the target nucleic acid molecule. In certain
other embodiments, the two cyphers on each target molecule have the
same sequence and, therefore, provide a unique identifier for each
strand of the target nucleic acid molecule. Each strand of the
double-stranded nucleic acid library (e.g., genomic DNA, cDNA) can
be amplified and sequenced using, for example, next generation
sequencing technologies (such as, emulsion PCR or bridge
amplification combined with pyrosequencing or sequencing by
synthesis, or the like). The sequence information from each
complementary strand of a first double-stranded nucleic acid
molecule can be linked and compared (e.g., computationally
"de-convoluted") due to the unique cyphers associated with each end
or strand of that particular double-stranded nucleic acid molecule.
In other words, each original double-stranded nucleic acid molecule
fragment found in a library of molecules can be individually
reconstructed due to the presence of an associated unique barcode
or pair of barcode (identifier tag) sequences on each target
fragment or strand.
[0016] By way of background, any spontaneous or induced mutation
will be present in both strands of a native genomic,
double-stranded DNA molecule. Hence, such a mutant DNA template
amplified using PCR will result in a PCR product in which 100% of
the molecules produced by PCR include the mutation. In contrast to
an original, spontaneous mutation, a change due to polymerase error
will only appear in one strand of the initial template DNA molecule
(while the other strand will not have the artifact mutation). If
all DNA strands in a PCR reaction are copied equally efficiently,
then any polymerase error that emerges from the first PCR cycle
likely will be found in at least 25% of the total PCR product. But
DNA molecules or strands are not copied equally efficiently, so DNA
sequences amplified from the strand that incorporated an erroneous
nucleotide base during the initial amplification might constitute
more or less than 25% of the population of amplified DNA sequences
depending on the efficiency of amplification, but still far less
than 100%. Similarly, any polymerase error that occurs in later PCR
cycles will generally represent an even smaller proportion of PCR
products (i.e., 12.5% for the second cycle, 6.25% for the third,
etc.) containing a "mutation." PCR-induced mutations may be due to
polymerase errors or due to the polymerase bypassing damaged
nucleotides, thereby resulting in an error (see, e.g., Bielas and
Loeb, Nat. Methods 2:285-90, 2005). For example, a common change to
DNA is the deamination of cytosine, which is recognized by Taq
polymerase as a uracil and results in a cytosine to thymine
transition mutation (Zheng et al., Mutat. Res. 599:11-20,
2006)--that is, an alteration in the original DNA sequence may be
detected when the damaged DNA is sequenced, but such a change may
or may not be recognized as a sequencing reaction error or due to
damage arising ex vivo (e.g., during or after nucleic acid
isolation).
[0017] Due to potential artifacts and alterations of nucleic acid
molecules arising from isolation, amplification and sequencing, the
accurate identification of true somatic DNA mutations is difficult
when sequencing amplified nucleic acid molecules. Consequently,
evaluation of whether certain mutations are related to, or are a
biomarker for, various disease states (e.g., cancer) or aging
becomes confounded.
[0018] Next generation sequencing has opened the door to sequencing
multiple copies of an amplified single nucleic acid
molecule--referred to as deep sequencing. The thought on deep
sequencing is that if a particular nucleotide of a nucleic acid
molecule is sequenced multiple times, then one can more easily
identify rare sequence variants or mutations. In fact, however, the
amplification and sequencing process has an inherent error rate
(which may vary depending on DNA quality, purity, concentration
(e.g., cluster density), or other conditions), so no matter how few
or how many times a nucleic acid molecule is sequenced, a person of
skill in the art cannot distinguish a polymerase error artifact
from a true mutation (especially rare mutations).
[0019] While being able to sequence many different DNA molecules
collectively is advantageous in terms of cost and time, the price
for this efficiency and convenience is that various PCR errors
complicate mutational analysis as long as their frequency is
comparable to that of mutations arising in vivo--in other words,
genuine in vivo mutations will be essentially indistinguishable
from changes that are artifacts of PCR or sequencing errors.
[0020] Thus, the present disclosure, in a further aspect, provides
methods for identifying mutations present before amplification or
sequencing of a double-stranded nucleic acid library wherein the
target molecules include a single double-stranded cypher or dual
cyphers (i.e., barcodes or identifier tags), one on each end, so
that sequencing each complementary strand can be connected back to
the original molecule. In certain embodiments, the method enhances
the sensitivity of the sequencing method such that the error rate
is 5.times.10.sup.-6, 10.sup.-6, 5.times.10.sup.-7, 10.sup.-7,
5.times.10.sup.-8, 10.sup.-8 or less when sequencing many different
target nucleic acid molecules simultaneously or such that the error
rate is 5.times.10.sup.-7, 10.sup.-7, 5.times.10.sup.-8, 10.sup.-8
or less when sequencing a single target nucleic acid molecule in
depth.
[0021] Prior to setting forth this disclosure in more detail, it
may be helpful to an understanding thereof to provide definitions
of certain terms to be used herein. Additional definitions are set
forth throughout this disclosure.
[0022] In the present description, any concentration range,
percentage range, ratio range, or integer range is to be understood
to include the value of any integer within the recited range and,
when appropriate, fractions thereof (such as one tenth and one
hundredth of an integer), unless otherwise indicated. Also, any
number range recited herein relating to any physical feature, such
as polymer subunits, size or thickness, are to be understood to
include any integer within the recited range, unless otherwise
indicated. As used herein, the terms "about" and "consisting
essentially of" mean.+-.20% of the indicated range, value, or
structure, unless otherwise indicated. It should be understood that
the terms "a" and "an" as used herein refer to "one or more" of the
enumerated components. The use of the alternative (e.g., "or")
should be understood to mean either one, both, or any combination
thereof of the alternatives. As used herein, the terms "include,"
"have" and "comprise" are used synonymously, which terms and
variants thereof are intended to be construed as non-limiting.
[0023] As used herein, the term "random cypher" or "cypher" or
"barcode" or "identifier tag" and variants thereof are used
interchangeably and refer to a nucleic acid molecule having a
length ranging from about 5 to about 50 nucleotides. In certain
embodiments, all of the nucleotides of the cypher are not identical
(i.e., comprise at least two different nucleotides) and optionally
do not contain three contiguous nucleotides that are identical. In
further embodiments, the cypher is comprised of about 5 to about 15
nucleotides, about 6 to about 10 nucleotides, and preferably about
7 to about 12 nucleotides. Cyphers will generally be located at one
or both ends a target molecule may, which may be incorporated
directly onto target molecules of interest or onto a vector into
which target molecules will be later added.
[0024] As used herein, "target nucleic acid molecules" and variants
thereof refer to a plurality of double-stranded nucleic acid
molecules that may be fragments or shorter molecules generated from
longer nucleic acid molecules, including from natural samples
(e.g., a genome), or the target nucleic acid molecules may be
synthetic (e.g., cDNA), recombinant, or a combination thereof.
Target nucleic acid fragments from longer molecules may be
generated using a variety of techniques known in the art, such as
mechanical shearing or specific cleavage with restriction
endonucleases.
[0025] As used herein, a "nucleic acid molecule library" and
variants thereof refers to a collection of nucleic acid molecules
or fragments. In certain embodiments, the collection of nucleic
acid molecules or fragments is incorporated into a vector, which
can be transformed or transfected into an appropriate host cell.
The target nucleic acid molecules of this disclosure may be
introduced into a variety of different vector backbones (such as
plasmids, cosmids, viral vectors, or the like) so that recombinant
production of a nucleic acid molecule library can be maintained in
a host cell of choice (such as bacteria, yeast, mammalian cells, or
the like).
[0026] For example, a collection of nucleic acid molecules
representing the entire genome is called a genomic library and a
collection of DNA copies of messenger RNA is referred to as a
complimentary DNA (cDNA) library. Methods for introducing nucleic
acid molecule libraries into vectors are well known in the art
(see, e.g., Current Protocols in Molecular Biology, Ausubel et al.,
Eds., Greene Publishing and Wiley-Interscience, New York, 1995;
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed.,
Cold Spring Harbor Laboratory Vols. 1-3, 1989; Methods in
Enzymology, Vol. 152, Guide to Molecular Cloning Techniques, Berger
and Kimmel, Eds., San Diego: Academic Press, Inc., 1987).
[0027] Depending on the type of library to be generated, the ends
of the target nucleic acid fragments may have overhangs or may be
"polished" (i.e., blunted). Together, the target nucleic acid
molecule fragments can be, for example, cloned directly into a
cypher vector to generate a vector library, or be ligated with
adapters to generate, for example, polonies. The target nucleic
acid molecules, which are the nucleic acid molecules of interest
for amplification and sequencing, may range in size from a few
nucleotides (e.g., 50) to many thousands (e.g., 10,000).
Preferably, the target fragments in the library range in size from
about 100 nucleotides to about 750 nucleotides or about 1,000
nucleotides, or from about 150 nucleotides to about 250 nucleotides
or about 500 nucleotides.
[0028] As used herein, a "nucleic acid molecule priming site" or
"PS" and variants thereof are short, known nucleic acid sequences
contained in the vector. A PS sequence can vary in length from 5
nucleotides to about 50 nucleotides in length, about 10 nucleotides
to about 30 nucleotides, and preferably are about 15 nucleotides to
about 20 nucleotides in length. In certain embodiments, a PS
sequence may be included at the one or both ends or be an integral
part of the random cypher nucleic acid molecules, or be included at
the one or both ends or be an integral part of an adapter sequence,
or be included as part of the vector. A nucleic acid molecule
primer that is complementary to a PS included in a library of the
present disclosure can be used to initiate a sequencing
reaction.
[0029] For example, if a random cypher only has a PS upstream (5')
of the cypher, then a primer complementary to the PS can be used to
prime a sequencing reaction to obtain the sequence of the random
cypher and some sequence of a target nucleic acid molecule cloned
downstream of the cypher. In another example, if a random cypher
has a first PS upstream (5') and a second PS downstream (3') of the
cypher, then a primer complementary to the first PS can be used to
prime a sequencing reaction to obtain the sequence of the random
cypher, the second PS and some sequence of a target nucleic acid
molecule cloned downstream of the second PS. In contrast, a primer
complementary to the second PS can be used to prime a sequencing
reaction to directly obtain the sequence of the target nucleic acid
molecule cloned downstream of the second PS. In this latter case,
more target molecule sequence information will be obtained since
the sequencing reaction beginning from the second PS can extend
further into the target molecule than does the reaction having to
extend through both the cypher and the target molecule.
[0030] As used herein, "next generation sequencing" refers to
high-throughput sequencing methods that allow the sequencing of
thousands or millions of molecules in parallel. Examples of next
generation sequencing methods include sequencing by synthesis,
sequencing by ligation, sequencing by hybridization, polony
sequencing, and pyrosequencing. By attaching primers to a solid
substrate and a complementary sequence to a nucleic acid molecule,
a nucleic acid molecule can be hybridized to the solid substrate
via the primer and then multiple copies can be generated in a
discrete area on the solid substrate by using polymerase to amplify
(these groupings are sometimes referred to as polymerase colonies
or polonies). Consequently, during the sequencing process, a
nucleotide at a particular position can be sequenced multiple times
(e.g., hundreds or thousands of times)--this depth of coverage is
referred to as "deep sequencing."
[0031] As used herein, "base calling" refers to the computational
conversion of raw or processed data from a sequencing instrument
into quality scores and then actual sequences. For example, many of
the sequencing platforms use optical detection and charge coupled
device (CCD) cameras to generate images of intensity information
(i.e., intensity information indicates which nucleotide is in which
position of a nucleic acid molecule), so base calling generally
refers to the computational image analysis that converts intensity
data into sequences and quality scores. Another example is the ion
torrent sequencing technology, which employs a proprietary
semiconductor ion sensing technology to detect release of hydrogen
ions during incorporation of nucleotide bases in sequencing
reactions that take place in a high density array of micro-machined
wells. There are other examples of methods known in the art that
may be employed for simultaneous sequencing of large numbers of
nucleotide molecules. Various base calling methods are described
in, for example, Niedringhaus et al. (Anal. Chem. 83:4327, 2011),
which methods are herein incorporated by reference in their
entirety.
[0032] In the following description, certain specific details are
set forth in order to provide a thorough understanding of various
embodiments of this disclosure. However, upon reviewing this
disclosure, one skilled in the art will understand that the
invention may be practiced without many of these details. In other
instances, newly emerging next generation sequencing technologies,
as well as well-known or widely available next generation
sequencing methods (e.g., chain-termination sequencing,
dye-terminator sequencing, reversible dye-terminator sequencing,
sequencing by synthesis, sequencing by ligation, sequencing by
hybridization, polony sequencing, pyrosequencing, ion semiconductor
sequencing, nanoball sequencing, nanopore sequencing, single
molecule sequencing, FRET sequencing, base-heavy sequencing, and
microfluidic sequencing), have not all been described in detail to
avoid unnecessarily obscuring the descriptions of the embodiments
of the present disclosure. Descriptions of some of these methods,
which methods are herein incorporated by reference in their
entirety, can be found, for example, in PCT Publication Nos. WO
98/44151, WO 00/18957, and WO 2006/08413; and U.S. Pat. Nos.
6,143,496, 6833246, and 7,754,429; and U.S. Patent Application
Publication Nos. U.S. 2010/0227329 and U.S. 2009/0099041.
[0033] Various embodiments of the present disclosure are described
for purposes of illustration, in the context of use with vectors
containing a library of nucleic acid fragments (e.g., genomic or
cDNA library). However, as those skilled in the art will appreciate
upon reviewing this disclosure, use with other nucleic acid
libraries or methods for making a library of nucleic acid fragments
may also be suitable.
[0034] In certain embodiments, a double-stranded nucleic acid
library comprises a plurality of target nucleic acid molecules and
a plurality of random cyphers, wherein the nucleic acid library
comprises molecules having a formula of X.sup.a-Y-X.sup.b (in 5' to
3' order), wherein (a) X.sup.a comprises a first random cypher, (b)
Y comprises a target nucleic acid molecule, and (c) X.sup.b
comprises a second random cypher; wherein each of the plurality of
random cyphers have a length of about 5 to about 50 nucleotides. In
certain embodiments, the double-stranded sequence of the X.sup.a
cypher for each target nucleic acid molecule is different from the
double-stranded sequence of the X.sup.b cypher. In certain other
embodiments, the double-stranded X.sup.a cypher is identical to the
X.sup.b cypher for one or more target nucleic acid molecules,
provided that the double-stranded cypher for each target nucleic
acid molecule is different.
[0035] In further embodiments, the plurality or pool of random
cyphers used in the double-stranded nucleic acid molecule library
or vector library comprise from about 5 nucleotides to about 40
nucleotides, about 5 nucleotides to about 30 nucleotides, about 6
nucleotides to about 30 nucleotides, about 6 nucleotides to about
20 nucleotides, about 6 nucleotides to about 10 nucleotides, about
6 nucleotides to about 8 nucleotides, about 7 nucleotides to about
9 or about 10 nucleotides, or about 6, about 7 or about 8
nucleotides. In certain embodiments, a cypher preferably has a
length of about 6, about 7, about 8, about 9, about 10, about 11,
about 12, about 13, about 14, about 15, about 16, about 17, about
18, about 19, or about 20 nucleotides. In certain embodiments, a
pair of random cyphers associated with nucleic acid sequences or
vectors will have different lengths or have the same length. For
example, a target nucleic acid molecule or vector may have an
upstream (5') first random cypher of about 6 nucleotides in length
and a downstream (3') second random cypher of about 9 nucleotides
in length, or a target nucleic acid molecule or vector may have an
upstream (5') first random cypher of about 7 nucleotides in length
and a downstream (3') second random cypher of about 7 nucleotides
in length.
[0036] In certain embodiments, both the X.sup.a cypher and the
X.sup.b cypher each comprise 6 nucleotides, 7 nucleotides, 8
nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12
nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16
nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, or 20
nucleotides. In certain other embodiments, the X.sup.a cypher
comprises 6 nucleotides and the X.sup.b cypher comprises 7
nucleotides or 8 nucleotides; or the X.sup.a cypher comprises 7
nucleotides and the X.sup.b cypher comprises 6 nucleotides or 8
nucleotides; or the X.sup.a cypher comprises 8 nucleotides and the
X.sup.b cypher comprises 6 nucleotides or 7 nucleotides; or the
X.sup.a cypher comprises 10 nucleotides and the X.sup.b cypher
comprises 11 nucleotides or 12 nucleotides.
[0037] The number of nucleotides contained in each of the random
cyphers or barcodes will govern the total number of possible
barcodes available for use in a library. Shorter barcodes allow for
a smaller number of unique cyphers, which may be useful when
performing a deep sequence of one or a few nucleotide sequences,
whereas longer barcodes may be desirable when examining a
population of nucleic acid molecules, such as cDNAs or genomic
fragments. In certain embodiments, multiplex sequencing may be
desired when targeting specific nucleic acid molecules, specific
genomic regions, smaller genomes, or a subset of cDNA transcripts.
Multiplex sequencing involves amplifying two or more samples that
have been pooled into, for example, a single lane of a flow cell
for bridge amplification to exponentially increase the number of
molecules analyzed in a single run without sacrificing time or
cost. In related embodiments, a unique index sequence (comprising a
length ranging from about 4 nucleotides to about 25 nucleotides)
specific for a particular sample is included with each dual cypher
vector library. For example, if ten different samples are being
pooled in preparation for multiplex sequencing, then ten different
index sequences will be used such that ten dual cypher vector
libraries are used in which each library has a single, unique index
sequence identifier (but each library has a plurality of random
cyphers).
[0038] For example, a barcode of 7 nucleotides would have a formula
of 5'-N-3' (SEQ ID NO.:1), wherein N may be any naturally occurring
nucleotide. The four naturally occurring nucleotides are A, T, C,
and G, so the total number of possible random cyphers is 4.sup.7,
or 16,384 possible random arrangements (i.e., 16,384 different or
unique cyphers). For 6 and 8 nucleotide barcodes, the number of
random cyphers would be 4,096 and 65,536, respectively. In certain
embodiments of 6, 7 or 8 random nucleotide cyphers, there may be
fewer than the pool of 4,094, 16,384 or 65,536 unique cyphers,
respectively, available for use when excluding, for example,
sequences in which all the nucleotides are identical (e.g., all A
or all T or all C or all G) or when excluding sequences in which
three contiguous nucleotides are identical or when excluding both
of these types of molecules. In addition, the first about 5
nucleotides to about 20 nucleotides of the target nucleic acid
molecule sequence may be used as a further identifier tag together
with the sequence of an associated random cypher.
[0039] In still further embodiments, a double-stranded nucleic acid
library comprises a plurality of target nucleic acid molecules and
a plurality of random cyphers, wherein the nucleic acid library
comprises molecules having a formula of X.sup.a-Y-X.sup.b (in 5' to
3' order), wherein (a) X.sup.a comprises a first random cypher, (b)
Y comprises a target nucleic acid molecule, and (c) X.sup.b
comprises a second random cypher; wherein each of the plurality of
random cyphers have a length of about 5 to about 50 nucleotides and
wherein (i) at least two of those nucleotides are different in each
cypher or (ii) each cypher does not contain three contiguous
nucleotides that are identical. In certain embodiments wherein each
cypher does not contain three contiguous nucleotides that are
identical, the double-stranded X.sup.a cypher is identical to the
X.sup.b cypher for one or more target nucleic acid molecules,
provided that the double-stranded cypher for each target nucleic
acid molecule is different.
[0040] In yet further embodiments, a double-stranded nucleic acid
library comprises a plurality of target nucleic acid molecules and
a plurality of random cyphers, wherein the nucleic acid library
comprises molecules having a formula of X.sup.a-X.sup.b-Y,
X.sup.b-X.sup.a-Y, X.sup.b-X.sup.a-Y, Y-X.sup.a-X.sup.b,
Y-X.sup.b-X.sup.a, X.sup.a-Y, X.sup.b-Y, Y-X.sup.a, or Y-X.sup.b
(in 5' to 3' order), wherein (a) X.sup.a comprises a first random
cypher, (b) Y comprises a target nucleic acid molecule, and (c)
X.sup.b comprises a second random cypher; wherein each of the
plurality of random cyphers have a length of about 5 to about 50
nucleotides.
[0041] In any of the embodiments described herein, an Z.sup.a
cypher further comprises about a 5 nucleotide to about a 20
nucleotide sequence of the target nucleic acid molecule that is
downstream of the X.sup.a cypher, or an X.sup.b cypher further
comprises about a 5 nucleotide to about a 20 nucleotide sequence of
the target nucleic acid molecule that is upstream of the X.sup.b
cypher, or an X.sup.a cypher and X.sup.b cypher further comprise
about a 5 nucleotide to about a 20 nucleotide sequence of the
target nucleic acid molecule that is downstream or upstream,
respectively, of each cypher.
[0042] In yet further embodiments, a first target molecule is
associated with and disposed between a first random cypher X.sup.a
and a second random cypher X.sup.b, a second target molecule is
associated with and disposed between a third random cypher X.sup.a
and a fourth random cypher X.sup.b, and so on, wherein the target
molecules of a library or of a vector library each has a unique
X.sup.a cypher (i.e., none of the X.sup.a cyphers have the same
sequence) and each has a unique X.sup.b cypher (i.e., none of the
X.sup.b cyphers have the same sequence), and wherein none or only a
minority of the X.sup.a and X.sup.b cyphers have the same
sequence.
[0043] For example, if the length of the random cypher is 7
nucleotides, then there will a total of 16,384 different barcodes
available as first random cypher X.sup.a and second random cypher
X.sup.b. In this case, if a first target nucleic acid molecule is
associated with and disposed between random cypher X.sup.a number 1
and random cypher X.sup.b number 2 and a second target nucleic acid
molecule is associated with and disposed between random cypher
X.sup.a number 16,383 and random cypher X.sup.b number 16,384, then
a third target nucleic acid molecule can only be associated with
and disposed between any pair of random cypher numbers selected
from numbers 3 to 16,382, and so on for each target nucleic acid
molecule of a library until each of the different random cyphers
have been used (which may or may not be all 16,382). In this
embodiment, each target nucleic acid molecule of a library will
have a unique pair of cyphers that differ from each of the other
pairs of cyphers found associated with each other target nucleic
acid molecule of the library.
[0044] In any of the embodiments described herein, random cypher
sequences from a particular pool of cyphers (e.g., pools of 4,094,
16,384 or 65,536 unique cyphers) may be used more than once. In
further embodiments, each target nucleic acid molecule or a subset
of target molecules has a different (unique) pair of cyphers. For
example, if a first target molecule is associated with and disposed
between random cypher number 1 and random cypher number 100, then a
second target molecule will need to be flanked by a different dual
pair of cyphers--such as random cypher number 1 and random cypher
number 65, or random cypher number 486 and random cypher number
100--which may be any combination other than 1 and 100. In certain
other embodiments, each target nucleic acid molecule or a subset of
target molecules has identical cyphers on each end of one or more
target nucleic acid molecules, provided that the double-stranded
cypher for each target nucleic acid molecule is different. For
example, if a first target molecule is flanked by cypher number 10,
then a second target molecule having identical cyphers on each end
will have to have a different cypher--such as random cypher number
555 or the like--which may be any other cypher other than 10. In
still further embodiments, target nucleic acid molecules of the
nucleic acid molecule library will each have dual unique cyphers
X.sup.a and X.sup.b, wherein none of the X.sup.a cyphers have the
same sequence as any other X.sup.a cypher, none of the X.sup.b
cyphers have the same sequence as any other X.sup.b cypher, and
none of the X.sup.a cyphers have the same sequence as any X.sup.b
cypher. In still further embodiments, target nucleic acid molecules
of the nucleic acid molecule library will each have a unique pair
of X.sup.a-X.sup.b cyphers wherein none of the X.sup.a or X.sup.b
cyphers have the same sequence. A mixture of any of the
aforementioned embodiments may make up a nucleic acid molecule
library of this disclosure.
[0045] In any of the embodiments described herein, the plurality of
target nucleic acid molecules that together are used to generate a
nucleic acid molecule library (or used for insertion into a vector
to generate a vector library containing a plurality of target
nucleic acid molecules) may each have a length that ranges from
about 10 nucleotides to about 10,000 nucleotides, from about 50
nucleotides to about 5,000 nucleotides, from about 100 nucleotides
to about 1,000 nucleotides, or from about 150 nucleotides to about
750 nucleotides, or from about 250 nucleotides to about 500
nucleotides.
[0046] In any of the embodiments described herein, the plurality of
random cyphers may further be linked to a first nucleic acid
molecule priming site (PS1), linked to a second nucleic acid
molecule priming site (PS2), or linked to both a first and a second
nucleic acid molecule priming site. In certain embodiments, a
plurality of random cyphers may each be associated with and
disposed between a first nucleic acid molecule priming site (PS1)
and a second nucleic acid molecule priming site (PS2), wherein the
double-stranded sequence of PS1 is different from the
double-stranded sequence of PS2. In certain embodiments, each pair
of X.sup.a-X.sup.b cyphers may be associated with and disposed
between an upstream and a downstream nucleic acid molecule priming
site (PS1) (see, e.g., FIG. 2).
[0047] In any of the embodiments described herein, a first nucleic
acid molecule priming site PS1 will be located upstream (5') of the
first random cypher X.sup.a and the first nucleic acid molecule
priming site PS1 will also be located downstream (3') of the second
random cypher X.sup.b. In certain embodiments, an oligonucleotide
primer complementary to the sense strand of PS1 can be used to
prime a sequencing reaction to obtain the sequence of the sense
strand of the first random cypher X.sup.a or to prime a sequencing
reaction to obtain the sequence of the anti-sense strand of the
second random cypher X.sup.b, whereas an oligonucleotide primer
complementary to the anti-sense strand of PS1 can be used to prime
a sequencing reaction to obtain the sequence of the anti-sense
strand of the first random cypher X.sup.a or to prime a sequencing
reaction to obtain the sequence of the sense strand of the second
random cypher X.sup.b.
[0048] In any of the embodiments described herein, the second
nucleic acid molecule priming site PS2 will be located downstream
(3') of the first random cypher X.sup.a and the second nucleic acid
molecule priming site PS2 will also be located upstream (5') of the
second random cypher X.sup.b. In certain embodiments, an
oligonucleotide primer complementary to the sense strand of PS2 can
be used to prime a sequencing reaction to obtain the sequence of
the sense strand from the 5'-end of the associated double-stranded
target nucleic acid molecule or to prime a sequencing reaction to
obtain the sequence of the anti-sense strand from the 3'-end of the
associated double-stranded target nucleic acid molecule, whereas an
oligonucleotide primer complementary to the anti-sense strand of
PS2 can be used to prime a sequencing reaction to obtain the
sequence of the anti-sense strand from the 5'-end of the associated
double-stranded target nucleic acid molecule or to prime a
sequencing reaction to obtain the sequence of the sense strand from
the 3'-end of the associated double-stranded target nucleic acid
molecule.
[0049] Depending on the length of the target nucleic acid molecule,
the entire target nucleic acid molecule sequence may be obtained if
it is short enough or only a portion of the entire target nucleic
acid molecule sequence may be obtained if it is longer than about
100 nucleotides to about 250 nucleotides. An advantage of the
compositions and methods of the instant disclosure is that even
though a target nucleic acid molecule is too long to obtain
sequence data for the entire molecule or fragment, the sequence
data obtained from one end of a double-stranded target molecule can
be specifically linked to sequence data obtained from the opposite
end or from the second strand of that same double-stranded target
molecule because each target molecule in a library of this
disclosure will have double-stranded cyphers, or a unique
X.sup.a-X.sup.b pair of cyphers. Linking the sequence data of the
two strands allows for sensitive identification of "true" mutations
wherein deeper sequencing actually increases the sensitivity of the
detection, and these methods can provide sufficient data to
quantify the number of artifact mutations.
[0050] In any of the embodiments described herein, a plurality of
random cyphers may further comprise a first restriction
endonuclease recognition sequence (RE1) and a second restriction
endonuclease recognition sequence (RE2), wherein the first
restriction endonuclease recognition sequence RE1 is located
upstream (5') of the first random cypher X.sup.a and the second
restriction endonuclease recognition sequence RE2 is located
downstream (3') of the second random cypher X.sup.b. In certain
embodiments, a first restriction endonuclease recognition sequence
RE1 and a second restriction endonuclease recognition sequence RE2
are the same or different. In certain embodiments, RE1, RE2, or
both RE1 and RE2 are "rare-cutter" restriction endonucleases that
have a recognition sequence that occurs only rarely within a genome
or within a target nucleic acid molecule sequence or are
"blunt-cutters" that generate nucleic acid molecules with blunt
ends after digestion (e.g., SmaI). Such rare cutter enzymes
generally have longer recognition sites with seven- or
eight-nucleotide or longer recognition sequences, such as AarI,
AbeI, AscI, AsiSI, BbvCI, BstRZ2461, BstSWI, CciNI, CsiBI, CspBI,
FseI, NotI, MchAI, MspSWI, MssI, PacI, PmeI, SbfI, SdaI, SgfI,
SmiI, SrfI, Sse232I, Sse8387I, SwaI, TagII, VpaK32I, or the
like.
[0051] In certain embodiments, a nucleic acid molecule library
comprises nucleic acid molecules having a formula of
5'-RE1-PS1-X.sup.a-PS2-Y-PS2-X.sup.b-PS1-RE2-3', wherein RE1 is a
first restriction endonuclease recognition sequence, PS1 is a first
nucleic acid molecule priming site, PS2 is a second nucleic acid
molecule priming site, RE2 is a second restriction endonuclease
recognition sequence, Y comprises a target nucleic acid molecule,
and X.sup.a and X.sup.b are cyphers comprising a length ranging
from about 5 nucleotides to about 50 nucleotides or about 6
nucleotides to about 15 nucleotides or about 7 nucleotides to about
9 nucleotides. In further embodiments, RE1 and RE2 are sequences
recognized by the same restriction endonuclease or an isoschizomer
or neoschizomer thereof, or RE1 and RE2 have different sequences
recognized by different restriction endonucleases. In further
embodiments, PS1 and PS2 have different sequences. In further
embodiments, target nucleic acid molecules of the nucleic acid
molecule library will each have dual unique cyphers X.sup.a and
X.sup.b, wherein none of the X.sup.a cyphers have the same sequence
as any other X.sup.a cypher, none of the X.sup.b cyphers have the
same sequence as any other X.sup.b cypher, and none of the X.sup.a
cyphers have the same sequence as any X.sup.b cypher. In still
further embodiments, target nucleic acid molecules of the nucleic
acid molecule library will each have a unique cypher or pair of
X.sup.a-X.sup.b cyphers wherein none of the X.sup.a or X.sup.b
cyphers have the same sequence.
[0052] Also contemplated in the present disclosure is using a
library of double-stranded barcoded or dual double-stranded
barcoded target nucleic acid molecules for amplification and
sequencing reactions to detect true mutations. In order to
facilitate certain amplification or sequencing methods, other
features may be included in the compositions of the instant
disclosure. For example, bridge amplification may involve ligating
adapter sequences to each end of a population of target nucleic
acid molecules. Single-stranded oligonucleotide primers
complementary to the adapters are immobilized on a solid substrate,
the target molecules containing the adapter sequences are denatured
into single strands, and hybridized to complementary primers on the
solid substrate. An extension reaction is used to copy the
hybridized target molecule and the double-stranded product is
denatured into single strands again. The copied single strands then
loop over (form a "bridge") and hybridize with a complementary
primer on the solid substrate, upon which the extension reaction is
run again. In this way, many target molecules may be amplified at
the same time and the resulting product is subject to massive
parallel sequencing.
[0053] In certain embodiments, a nucleic acid molecule library
comprises nucleic acid molecules having a formula of
5'-RE1-AS-PS1-X.sup.a-PS2-Y-P S2-X.sup.b-PS1-AS-RE2-3', wherein RE1
and RE2 are first and second restriction endonuclease recognition
sequences, PS1 and PS2 are a first and second nucleic acid molecule
priming sites, AS is an adapter sequence comprising a length
ranging from about 20 nucleotides to about 100 nucleotides, Y
comprises a target nucleic acid molecule, and X.sup.a and X.sup.b
are cyphers comprising a length ranging from about 5 nucleotides to
about 50 nucleotides or about 6 nucleotides to about 15 nucleotides
or about 7 nucleotides to about 9 nucleotides.
[0054] In further embodiments, a nucleic acid molecule library
comprises nucleic acid molecules having a formula of
5'-RE1-AS-PS1-X.sup.a-Y-X.sup.b-PS1-AS-RE2-3', wherein RE1 and RE2
are first and second restriction endonuclease recognition
sequences, PS1 is a first nucleic acid molecule priming site, AS is
an adapter sequence comprising a length ranging from about 20
nucleotides to about 100 nucleotides, Y comprises a target nucleic
acid molecule, and X.sup.a and X.sup.b are cyphers comprising a
length ranging from about 5 nucleotides to about 50 nucleotides or
about 6 nucleotides to about 15 nucleotides or about 7 nucleotides
to about 9 nucleotides. In related embodiments, the AS adapter
sequence of the aforementioned vector may further comprise a PS2
that is a second nucleic acid molecule priming site or the PS2 may
be a part of the original AS sequence. In still further
embodiments, the nucleic acid molecule library may further comprise
an index sequence (comprising a length ranging from about 4
nucleotides to about 25 nucleotides) located between each of the
first and second AS and the PS1 so that the library can be pooled
with other libraries having different index sequences to facilitate
multiplex sequencing (also referred to as multiplexing) either
before or after amplification.
[0055] Each of the aforementioned dual barcoded target nucleic acid
molecules may be assembled into a carrier library in the form of,
for example, a self-replicating vector, such as a plasmid, cosmid,
YAC, viral vector or other vectors known in the art. In certain
embodiments, any of the aforementioned double-stranded nucleic acid
molecules comprising a plurality of target nucleic acid molecules
and a plurality of random cyphers, are contained in a vector. In
still further embodiments, such a vector library is carried in a
host cell, such as bacteria, yeast, or mammalian cells.
[0056] The present disclosure also provides vectors useful for
generating a library of dual barcoded target nucleic acid molecules
according to this disclosure. Exemplary vectors comprising cyphers
and other elements of this disclosure are illustrated in FIGS. 1
and 2.
[0057] In certain embodiments, there are provided a plurality of
nucleic acid vectors, comprising a plurality of random cyphers,
wherein each vector comprises a region having a formula of
5'-RE1-PS1-X.sup.a-PS2-RE3-PS2-X.sup.b-PS1-RE2-3', wherein (a) RE1
is a first restriction endonuclease recognition sequence, (b) PS1
is a first nucleic acid molecule priming site, (c) X.sup.a
comprises a first random cypher, (d) RE3 is a third restriction
endonuclease recognition sequence, wherein RE3 is a site into which
a target nucleic acid molecule can be inserted, (e) X.sup.b
comprises a second random cypher, (f) PS2 is a second nucleic acid
molecule priming site, and (g) RE2 is a second restriction
endonuclease recognition sequence; and wherein each of the
plurality of random cyphers comprise a length ranging from about 5
nucleotides to about 50 nucleotides, preferably from about 7
nucleotides to about 9 nucleotides; and wherein the plurality of
nucleic acid vectors are useful for preparing a double-stranded
nucleic acid molecule library in which each vector has a different
target nucleic acid molecule insert. In certain embodiments, the
sequence of the X.sup.a cypher is different from the sequence of
the X.sup.b cypher in each vector (that is, each vector has a
unique pair). In further embodiments, the plurality of nucleic acid
vectors may further comprise at least one adapter sequence (AS)
between RE1 and PS1 and at least one AS between PS1 and RE2, or
comprise at least one AS between RE1 and X.sup.a cypher and at
least one AS between X.sup.b cypher and RE2, wherein the AS
optionally has a priming site.
[0058] In further vector embodiments, the plurality of random
cyphers can each have the same or different number of nucleotides,
and comprise from about 6 nucleotides to about 8 nucleotides to
about 10 nucleotides to about 12 nucleotides to about 15
nucleotides. In still other embodiments, a plurality of target
nucleic acid molecules comprising from about 10 nucleotides to
about 10,000 nucleotides or comprising from about 100 nucleotides
to about 750 nucleotides or to about 1,000 nucleotides, may be
inserted into the vector at RE3. In certain embodiments, RE3 will
cleave DNA into blunt ends and the plurality of target nucleic acid
molecules ligated into this site will also be blunt-ended.
[0059] In certain embodiments, the plurality of nucleic acid
vectors wherein each vector comprises a region having a formula of
5'-RE1-PS1-X.sup.a-PS2-RE3-PS2-X.sup.b-PS1-RE2-3' the X.sup.a
cyphers and X.sup.b cyphers on each vector is sequenced before a
target nucleic acid molecule is inserted into each vector. In
further embodiments, the plurality of nucleic acid vectors wherein
each vector comprises a region having a formula of
5'-RE1-PS1-X.sup.a-PS2-RE3-PS2-X.sup.b-PS1-RE2-3' the X.sup.a
cyphers and X.sup.b cyphers on each vector is sequenced after a
target nucleic acid molecule is inserted into each vector or is
sequenced at the same time a target nucleic acid molecule insert is
sequenced.
[0060] The dual barcoded target nucleic acid molecules and the
vectors containing such molecules of this disclosure may further be
used in sequencing reactions to determine the sequence and mutation
frequency of the molecules in the library. In certain embodiments,
this disclosure provides a method for obtaining a nucleic acid
sequence by preparing a double-stranded dual barcoded nucleic acid
library as described herein and then sequencing each strand of the
plurality of target nucleic acid molecules and plurality of random
cyphers. In certain embodiments, target nucleic acid molecules and
and associated cyphers are excised for sequencing directly from the
vector using restriction endonuclease enzymes prior to
amplification. In certain embodiments, next generation sequencing
methods are used to determine the sequence of library molecules,
such as sequencing by synthesis, pyrosequencing, reversible
dye-terminator sequencing or polony sequencing.
[0061] In still further embodiments, there are provided methods for
determining the error rate due to amplification and sequencing by
determining the sequence of one strand of a target nucleic acid
molecule associated with the first random cypher and aligning with
the sequence of the complementary strand associated with the second
random cypher to distinguish between a pre-existing mutation and an
amplification or sequencing artifact mutation, wherein the measured
sequencing error rate will range from about 10.sup.-6 to about
5.times.10.sup.-6 to about 10.sup.-7 to about 5.times.10.sup.-7 to
about 10.sup.-8 to about 10.sup.-9. In other words, using the
methods of this disclosure, a person of ordinary skill in the art
can associate each DNA sequence read to an original template DNA.
Given that both strands of the original double-stranded DNA are
barcoded with associated barcodes, this increases the sensitivity
of the sequencing base call by more easily identifying artifact
"mutations" sequence changes introduced during the sequencing
process.
[0062] In certain embodiments, the compositions and methods of this
instant disclosure will be useful in detecting rare mutants against
a large background signal, such as when monitoring circulating
tumor cells; detecting circulating mutant DNA in blood, monitoring
or detecting disease and rare mutations by direct sequencing,
monitoring or detecting disease or drug response associated
mutations. Additional embodiments may be used to quantify DNA
damage, quantify or detect mutations in viral genomes (e.g., HIV
and other viral infections) or other infectious agents that may be
indicative of response to therapy or may be useful in monitoring
disease progression or recurrence. In yet other embodiments, these
compositions and methods may be useful in detecting damage to DNA
from chemotherapy, or in detection and quantitation of specific
methylation of DNA sequences.
EXAMPLES
Example 1
Dual Cypher Sequencing of a Tumor Genomic Library
[0063] Cancer cells contain numerous clonal mutations, i.e.,
mutations that are present in most or all malignant cells of a
tumor and have presumably been selected because they confer a
proliferative advantage. An important question is whether cancer
cells also contain a large number of random mutations, i.e.,
randomly distributed unselected mutations that occur in only one or
a few cells of a tumor. Such random mutations could contribute to
the morphologic and functional heterogeneity of cancers and include
mutations that confer resistance to therapy. The instant disclosure
provides compositions and methods for distinguishing clonal
mutations from random mutations.
[0064] To examine whether malignant cells exhibit a mutator
phenotype resulting in the generation of random mutations
throughout the genome, dual cypher sequencing of present disclosure
will be performed on normal and tumor genomic libraries. Briefly,
genomic DNA from patient-matched normal and tumor tissue is
prepared using Qiagen.RTM. kits (Valencia, Calif.), and quantified
by optical absorbance and quantitative PCR (qPCR). The isolated
genomic DNA is fragmented to a size of about 150-250 base pairs
(short insert library) or to a size of about 300-700 base pairs
(long insert library) by shearing. The DNA fragments having
overhang ends are repaired (i.e., blunted) using T4 DNA polymerase
(having both 3' to 5' exonuclease activity and 5' to 3' polymerase
activity) and the 5'-ends of the blunted DNA are phosphorylated
with T4 polynucleotide kinase (Quick Blunting Kit I, New England
Biolabs), and then purified. The end-repaired DNA fragments are
ligated into the SmaI site of the library of dual cypher vectors
shown in FIG. 2 to generate a target genomic library.
[0065] The ligated cypher vector library is purified and the target
genomic library fragments are amplified by using, for example, the
following PCR protocol: 30 seconds at 98.degree. C.; five to thirty
cycles of 10 seconds at 98.degree. C., 30 seconds at 65.degree. C.,
30 seconds at 72.degree. C.; 5 minutes at 72.degree. C.; and then
store at 4.degree. C. The amplification is performed using sense
strand and anti-sense strand primers that anneal to a sequence
located within the adapter region (in certain embodiments, the
primer will anneal to a sequence upstream of the AS), and is
upstream of the unique cypher and the target genomic insert (and,
if present, upstream of an index sequence if multiplex sequencing
is desired; see, e.g., FIG. 2) for Illumina bridge sequencing. The
sequencing of the library described above will be performed using,
for example, an Illumina.RTM. Genome Analyzer II sequencing
instrument as specified by the manufacturer.
[0066] The unique cypher tags are used to computationally
deconvolute the sequencing data and map all sequence reads to
single molecules (i.e., distinguish PCR and sequencing errors from
real mutations). Base calling and sequence alignment will be
performed using, for example, the Eland pipeline (Illumina, San
Diego, Calif.). The data generated will allow identification of
tumor heterogeneity at the single-nucleotide level and reveal
tumors having a mutator phenotype.
Example 2
Dual Cypher Sequencing of a mtDNA Library
[0067] Mutations in mitochondrial DNA (mtDNA) lead to a diverse
collection of diseases that are challenging to diagnose and treat.
Each human cell has hundreds to thousands of mitochondrial genomes
and disease-associated mtDNA mutations are homoplasmic in nature,
i.e., the identical mutation is present in a preponderance of
mitochondria within a tissue (Taylor and Turnbull, Nat. Rev. Genet.
6:389, 2005; Chatterjee et al., Oncogene 25:4663, 2006). Although
the precise mechanisms of mtDNA mutation accumulation in disease
pathogenesis remain elusive, multiple homoplasmic mutations have
been documented in colorectal, breast, cervical, ovarian, prostate,
liver, and lung cancers (Copeland et al., Cancer Invest. 20:557,
2002; Brandon et al., Oncogene 25:4647, 2006). Hence, the
mitochondrial genome provides excellent potential as a specific
biomarker of disease, which may allow for improved treatment
outcomes and increased overall survival.
[0068] Dual cypher sequencing of present disclosure can be
leveraged to quantify circulating tumor cells (CTCs) and
circulating tumor mtDNA (ctmtDNA) could be used to diagnose and
stage cancer, assess response to therapy, and evaluate progression
and recurrence after surgery. First, mtDNA isolated for prostatic
cancer and peripheral blood cells from the same patient will be
sequenced to identify somatic homoplasmic mtDNA mutations. These
mtDNA biomarkers will be statistically assessed for their potential
fundamental and clinical significance with respect to Gleason
score, clinical stage, recurrence, therapeutic response, and
progression.
[0069] Once specific homoplasmic mutations from individual tumors
are identified, patient-matched blood specimens will be examined
for the presence of identical mutations in the plasma and buffy
coat to determine the frequencies of ctmtDNA and CTCs,
respectfully. This will be accomplished by using the dual cypher
sequencing technology of this disclosure, and as described in
Example 1, to sensitively monitor multiple mtDNA mutations
concurrently. The distribution of CTCs in peripheral blood from
patients with varying PSA serum levels and Gleason scores will be
determined.
Example 3
High-Resolution Detection of TP53 Mutations
[0070] A recent genomics study determined that TP53 is mutated in
96% of high grade serous ovarian carcinoma (HGSC), responsible for
two-thirds of all ovarian cancer deaths (Cancer Genome Atlas
Research Network, Nature 474:609, 2011), and current models
indicate that TP53 loss is an early event in HGSC pathogenesis
(Bowtell, Nat. Rev. Cancer 10:803, 2010). Thus, the near
universality and early occurrence of TP53 mutations in HGSC make
TP53 a promising biomarker candidate for early detection and
disease monitoring of HGSC. Dual cypher sequencing of present
disclosure was used to detect somatic TP53 mutations that arose
during replication in E. coli.
Dual Cypher Vector Construction
[0071] An oligonucleotide containing EcoRI and BamHI restriction
enzyme sites, adapter sequences, indices, and random 7-nucleotide
barcodes flanking a SmaI restriction enzyme site with the following
sequence was made (Integrated DNA Technologies):
GATACAGGATCCAATGATACGGCGACCACCGAGATCTACACTAGATCGCGC
CTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAGNNNNNNNCCCGGGNN
NNNNNCTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGCAGACCGTA
AGGCGAATCTCGTATGCCGTCTTCTGCTTGGAATTCGATACA (SEQ ID NO.:2). To
amplify and create a double-stranded product from this
single-stranded DNA oligonucleotide, 30 cycles of PCR were
performed using PfuUltra High-Fidelity DNA Polymerase (Agilent
Technologies) as per the manufacturer's instructions (forward
primer sequence: GATACAGGATCCAATGATACGG, SEQ ID NO.:3; reverse
primer sequence: TGTATCGAATTCCAAGCAGAAG, SEQ ID NO.:4). The
following cycling conditions were used: 95.degree. C. for 2
minutes, followed by 30 cycles of 95.degree. C. for 1 minute and
64.degree. C. for 1 minute. The double-stranded nature of the
product was verified using a SmaI (New England BioLabs) restriction
digest. The product was then purified (Zymo Research DNA Clean
& Concentrator-5) and subjected to EcoRI/BamHI restriction
digest using BamHI-HF (New England BioLabs) and EcoRI-HF (New
England BioLabs) to prepare the construct for ligation into an
EcoRI/BamHI-digested pUC19 backbone. Digested vector and construct
were run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen)
electrophoresis gel with 1.times. SybrSafe (Invitrogen) and the
appropriate bands were excised. The DNA in the gel fragments was
purified using a Zymo-Clean gel DNA recovery kit (Zymo Research)
and quantified using a spectrophotometer (Nanophotometer, Implen).
Ligation reactions using T4 DNA ligase HC (Invitrogen) and a 1:3
vector to insert molar ratio at room temperature for 2 hours were
carried out, then ethanol precipitated, and resuspended in water.
Purified DNA (2 .mu.l) was electroporated into ElectroMAX DH10B T1
Phage Resistant Cells (Invitrogen). The transformed cells were
plated at a 1:100 dilution on LB agar media containing 100 .mu.g/mL
carbenicillin and incubated overnight at 37.degree. C. to determine
colony counts, and the remainder of the transformation was spiked
into LB cultures for overnight growth at 37.degree. C. The DNA from
the overnight cultures was purified using the QIAquick Spin
Miniprep Kit (Qiagen).
[0072] A single next generation sequencing run on MiSeq.RTM.
demonstrated optimal coverage and diversity at the upstream seven
basepair cypher in the vector library. FIG. 3A shows that the each
nucleotide was detected at approximately the same rate at each
random position of the cypher (here the 5' cyphers were
sequenced).
TP53 Exon 4 Library Construction
[0073] Briefly, SKOV-3 (human ovarian carcinoma cell line) cells
were grown in McCoy's 5a Medium supplemented with 10% Fetal Bovine
Serum, 1.5 mM/L-glutamine, 2200 mg/L sodium bicarbonate, and
Penicillin/Streptomycin. SKOV-3 cells were harvested and DNA was
extracted using a DNeasy Blood and Tissue Kit (Qiagen). PCR primers
were designed to amplify exon 4 of human TP53; forward primer
sequence: TCTGTCTCCTTCCTCTTCCTACA (SEQ ID NO.:5) and reverse primer
sequence: AACCAGCCCTGTCGTCTCT (SEQ ID NO.:6). Thirty cycles of PCR
were performed on SKOV-3 DNA using 0.5 .mu.M primers and GoTaq Hot
Start Colorless Master Mix (Promega) under the following cycling
conditions: 95.degree. C. for 2 minutes; 30 cycles of 95.degree. C.
for 30 seconds, 63.degree. C. for 30 seconds, 72.degree. C. for 1
minute; followed by 72.degree. C. for 5 minutes. Each PCR product
was then cloned into TOPO vectors (Invitrogen), transformed into
One Shot TOP10 Chemically Competent E. coli cells (Invitrogen),
plated on LB agar media containing 100 .mu.g/mL carbenicillin and
incubated overnight at 37.degree. C.
[0074] Ten colonies were picked and cultured overnight. The DNA
from the overnight LB cultures was purified using the QIAquick Spin
Miniprep Kit (Qiagen). Sequencing of the TOPO clones was performed
using capillary electrophoresis-based sequencing on an Applied
Biosystems 3730.times.1 DNA Analyzer. One TOPO clone containing the
appropriate wild type TP53 exon 4 sequence was selected. The DNA
was subjected to EcoRI digestion to excise the TP53 exon 4 insert
and run on a 1.5% UltraPure Low-Melting Point Agarose gel. The TP53
exon 4 DNA band was then manually excised and purified using the
Zymo-Clean gel DNA recovery kit followed by
phenol/chloroform/isoamyl alcohol extraction and ethanol
precipitation. The digested DNA was then blunted and phosphorylated
using the Quick Blunting Kit (New England BioLabs) and purified
with a phenol/chloroform/isoamyl alcohol extraction and ethanol
precipitation.
[0075] The Cypher Seq vector library was digested with SmaI,
treated with Antartic Phosphatase (New England BioLabs), and run on
a 1.5% UltraPure Low-Melting Point Agarose gel. The appropriate
band was excised and purified using the Zymo-Clean gel DNA recovery
kit, followed by phenol/chloroform/isoamyl alcohol extraction and
ethanol precipitation. Blunt-end ligations of the vector and TP53
exon 4 DNA were then carried out in 20 .mu.l reactions using T4 DNA
Ligase HC (Invitrogen) and a 1:10 vector to insert molar ratio. The
ligations were incubated at 16.degree. C. overnight, ethanol
precipitated, and transformed into ElectroMAX DH10b T 1-phage
resistant cells. Bacteria were grown overnight at 37.degree. C. in
LB containing 100 .mu.g/mL carbenicillin and DNA was purified using
the QIAquick Spin Miniprep Kit. The presence of the appropriate
insert was verified by diagnostic restriction digest and gel
electrophoresis.
[0076] The sequencing construct containing the Illumina adapters,
barcodes, and TP53 DNA was then amplified using 10 cycles of PCR
and primers designed against the adapter ends (forward primer:
AATGATACGGCGACCACCGA, SEQ ID NO.:7; and reverse primer:
CAAGCAGAAGACGGCATACGA, SEQ ID NO.:8). PCR cycling conditions were
as follows: 95.degree. C. for 2 minutes; 10 cycles of 95.degree. C.
for 30 seconds, 63.degree. C. for 30 seconds, 72.degree. C. for 1
minute; followed by 72.degree. C. for 5 minutes. The sequencing
construct was gel purified (Zymo-Clean gel DNA recovery kit),
phenol/chloroform/isoamyl alcohol extracted and ethanol
precipitated. The library was quantified using the Quant-iT
PicoGreen assay (Invitrogen) before loading onto the Illumina
MiSeq.RTM. flow cell. Finally, the library was sequenced.
Sequencing was performed as instructed by the manufacturer's
protocol with MiSeq.RTM. at Q30 quality level (Illumina). A Q score
is defined as a property that is logarithmically related to the
base calling error probabilities (Q=-10 log.sub.10P). In the case
of an assigned Q score of 30 (Q30) to a base, this means that the
probability of an incorrect base call is 1 in 1,000 times--that is,
the base call accuracy (i.e., probability of a correct base call)
is 99.9%--considered the gold standard for next generation
sequencing. Barcodes were used to deconvolute the sequencing
data.
Results
[0077] TP53 Exon 4 DNA from a dual cypher vector library produced
in E. coli was sequenced with a depth of over a million, and all
sequencing reads with identical cypher pairs and their reverse
complements were grouped into families to create a consensus
sequence. As illustrated in FIG. 3B, errors introduced during
library preparation (open circle) and during sequencing (gray
circle and triangle) were computationally eliminated from the
consensus sequence and only mutations present in all reads (black
diamonds, FIG. 3B) of a cypher family were counted as true
mutations (see bottom of FIG. 3B).
[0078] Wild-type TP53 Exon 4 sequence was compared to the actual
sequence results and substitutions were plotted before (FIG. 4A)
and after correction with Cypher Seq (FIG. 4B). Prior to
correction, the detected error frequency was 3.9.times.10.sup.-4/bp
(FIG. 4A). In short, the initial error frequency reflects
assay-related errors (e.g., PCR, sequencing, and other errors
introduced after bar-coding). This means that detecting a rare
mutation is difficult due to the noise-to-signal ratio being very
high. After Cypher Seq correction, however, the error frequency
dropped to 8.8.times.10.sup.-7/bp (FIG. 4B). In other words, the
remaining substitutions are most likely biological in nature and
most likely reflect errors introduced during replication in E. coli
prior to ligation into the barcoded vectors. Thus, true mutations
(i.e., those that arise naturally in a cell during replication) are
readily detectable using the cypher system of the instant
disclosure.
[0079] The various embodiments described above can be combined to
provide further embodiments. All of the U.S. patents, U.S. patent
application publications, U.S. patent applications, foreign
patents, foreign patent applications and non-patent publications
referred to in this specification and/or listed in the Application
Data Sheet are incorporated herein by reference, in their entirety.
In general, in the following claims, the terms used should not be
construed to limit the claims to specific embodiments disclosed in
the specification and claims, but should be construed to include
all possible embodiments along with the full scope of equivalents
to which such claims are entitled. Accordingly, the claims are not
limited by the disclosure.
Sequence CWU 1
1
817DNAArtificial SequenceRandom cypher
sequencemisc_feature(1)..(7)n = A,T,C or G 1nnnnnnn
72195DNAArtificial SequenceAn oligonucleotide containing EcoRI and
BamHI restriction enzyme sites, adapter sequences, indices, and
random 7-nucleotide barcodes flanking a SmaI restriction enzyme
sitemisc_feature(1)..(195)n = A,T,C or G 2gatacaggat ccaatgatac
ggcgaccacc gagatctaca ctagatcgcg cctccctcgc 60gccatcagag atgtgtataa
gagacagnnn nnnncccggg nnnnnnnctg tctcttatac 120acatctctga
gcgggctggc aaggcagacc gtaaggcgaa tctcgtatgc cgtcttctgc
180ttggaattcg ataca 195322DNAArtificial Sequenceforward primer
sequence 3gatacaggat ccaatgatac gg 22422DNAArtificial
Sequencereverse primer sequence 4tgtatcgaat tccaagcaga ag
22523DNAArtificial Sequenceforward primer sequence 5tctgtctcct
tcctcttcct aca 23619DNAArtificial Sequencereverse primer sequence
6aaccagccct gtcgtctct 19720DNAArtificial Sequenceforward primer
sequence 7aatgatacgg cgaccaccga 20821DNAArtificial Sequencereverse
primer sequence 8caagcagaag acggcatacg a 21
* * * * *