U.S. patent application number 17/170357 was filed with the patent office on 2021-08-05 for methods and systems for rapid detection of microorganisms using infectious agents.
This patent application is currently assigned to Laboratory Corporation of America Holdings. The applicant listed for this patent is Laboratory Corporation of America Holdings. Invention is credited to Dwight Lyman Anderson, Stephen Erickson, Jose S. Gil, Ben Barrett Hopkins, Minh Mindy Bao Nguyen.
Application Number | 20210238559 17/170357 |
Document ID | / |
Family ID | 1000005526932 |
Filed Date | 2021-08-05 |
United States Patent
Application |
20210238559 |
Kind Code |
A1 |
Gil; Jose S. ; et
al. |
August 5, 2021 |
Methods and Systems for Rapid Detection of Microorganisms Using
Infectious Agents
Abstract
Disclosed herein are methods and systems for rapid detection of
microorganisms in a sample. A genetically modified bacteriophage is
also disclosed which comprises an indicator gene in the late gene
region. The specificity of the bacteriophage, such as CBA120,
allows detection of a specific microorganism, such as E. coli
O157:H7, and an indicator signal may be amplified to optimize assay
sensitivity.
Inventors: |
Gil; Jose S.; (Winnetka,
CA) ; Erickson; Stephen; (White Bear Township,
MN) ; Hopkins; Ben Barrett; (Sherman Oaks, CA)
; Nguyen; Minh Mindy Bao; (Shoreview, MN) ;
Anderson; Dwight Lyman; (Minneapolis, MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Laboratory Corporation of America Holdings |
Burlington |
NC |
US |
|
|
Assignee: |
Laboratory Corporation of America
Holdings
Burlington
NC
|
Family ID: |
1000005526932 |
Appl. No.: |
17/170357 |
Filed: |
February 8, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15409258 |
Jan 18, 2017 |
10913934 |
|
|
17170357 |
|
|
|
|
13773339 |
Feb 21, 2013 |
9482668 |
|
|
15409258 |
|
|
|
|
62280043 |
Jan 18, 2016 |
|
|
|
62280465 |
Jan 19, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/689 20130101;
C12N 2795/00021 20130101; C12N 7/00 20130101; C12N 2795/00052
20130101; C12Q 1/10 20130101; C12Q 2600/158 20130101; C12Q 1/6804
20130101 |
International
Class: |
C12N 7/00 20060101
C12N007/00; C12Q 1/10 20060101 C12Q001/10; C12Q 1/6804 20060101
C12Q001/6804; C12Q 1/689 20060101 C12Q001/689 |
Claims
1. A recombinant bacteriophage comprising an indicator gene
inserted into a late gene region of the bacteriophage CBA120
genome.
2. The recombinant bacteriophage of claim 1, wherein the
recombinant bacteriophage specifically infects E. coli O157:H7.
3. The recombinant bacteriophage of claim 1, wherein the indicator
gene is codon-optimized and encodes a soluble protein product that
generates an intrinsic signal or a soluble enzyme that generates
signal upon reaction with substrate.
4. The recombinant bacteriophage of claim 3, further comprising an
untranslated region upstream of the codon-optimized indicator gene,
wherein the untranslated region includes a bacteriophage late gene
promoter and a ribosomal entry site.
5. A method of preparing a recombinant indicator bacteriophage
comprising: selecting a wild-type bacteriophage that specifically
infects a target pathogenic bacterium; preparing a homologous
recombination plasmid/vector comprising an indicator gene;
transforming the homologous recombination plasmid/vector into
target pathogenic bacteria; infecting the transformed target
pathogenic bacteria with the selected wild-type bacteriophage,
thereby allowing homologous recombination to occur between the
plasmid/vector and the bacteriophage genome; and isolating a
particular clone of recombinant bacteriophage.
6. The method of claim 5, wherein preparing a homologous
recombination plasmid/vector comprises: determining the natural
nucleotide sequence in the late region of the genome of the
selected bacteriophage; annotating the genome and identifying the
major capsid protein gene of the selected bacteriophage; designing
a sequence for homologous recombination downstream of the major
capsid protein gene, wherein the sequence comprises a
codon-optimized indicator gene; and incorporating the sequence
designed for homologous recombination into a plasmid/vector.
7. The method of claim 6, wherein designing a sequence further
comprises inserting an untranslated region including a phage late
gene promoter and ribosomal entry site upstream of the
codon-optimized indicator gene.
8. The method of claim 5, wherein the homologous recombination
plasmid comprises an untranslated region including a bacteriophage
late gene promoter and a ribosomal entry site upstream of the
codon-optimized indicator gene.
9. The method of claim 5, wherein the wild-type bacteriophage is
CBA120 and the target pathogenic bacterium is E. coli O157:H7.
10. The method of claim 5, wherein isolating a particular clone of
recombinant bacteriophage comprises a limiting dilution assay for
isolating a clone that demonstrates expression of the indicator
gene.
11. A method for detecting E. coli O157:H7 in a sample comprising:
incubating the sample with a recombinant bacteriophage derived from
CBA120, and detecting an indicator protein product produced by the
recombinant bacteriophage, wherein positive detection of the
indicator protein product indicates that E. coli O157:H7 is present
in the sample.
12. The method of claim 11, wherein the sample is a food,
environmental, water, commercial, or clinical sample.
13. The method of claim 11, wherein the method detects as few as
10, 9, 8, 7, 6, 5, 4, 3, 2, or a single bacterium in a sample of a
standard size for the food safety industry.
14. The method of claim 12, wherein the sample comprises beef or
vegetables.
15. The method of claim 11, wherein the sample is first incubated
in conditions favoring growth for an enrichment period of 9 hours
or less, 8 hours or less, 7 hours or less, 6 hours or less, 5 hours
or less, 4 hours or less, 3 hours or less, or 2 hours or less.
16. The method of claim 11, wherein the total time to results is
less than 12 hours, less than 11 hours, less than 10 hours, less
than 9 hours, less than 8 hours, less than 7 hours, or less than 6
hours.
17. The method of claim 11, wherein the ratio of signal to
background generated by detecting the indicator is at least 2.0 or
at least 2.5.
18. A kit for detecting E. coli O157:H7 comprising a recombinant
bacteriophage derived from CBA120.
19. The kit of claim 18, further comprising a substrate for
reacting with an indicator to detect the soluble protein product
expressed by the recombinant bacteriophage.
20. A system for detecting E. coli O157:H7 comprising a recombinant
bacteriophage derived from CBA120.
Description
RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Provisional
Patent Application No. 62/280,043, filed Jan. 18, 2016 and U.S.
Provisional Patent Application No. 62/280,465, filed Jan. 19, 2016.
The disclosures of U.S. Provisional Patent Application Nos.
62/280,043 and 62/280,465 are hereby incorporated by reference in
their entirety herein. This application is a Continuation of Ser.
No. 15/409,258, filed Jan. 18, 2017, which is a
Continuation-in-Part of U.S. application Ser. No. 13/773,339, filed
Feb. 21, 2013 and is related to U.S. application Ser. No.
14/625,481, filed Feb. 18, 2015; and U.S. application Ser. No.
15/263,619, filed Sep. 13, 2016. The disclosures of U.S.
application Ser. Nos. 13/773,339, 14/625,481, 15/263,619, and
15/409,258 are hereby incorporated by reference in their entirety
herein.
REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA
EFS-WEB
[0002] The official copy of the sequence listing is submitted
electronically via EFS-Web as an ASCII formatted sequence listing
with a file named 1035090 ST25.txt, created on Jan. 17, 2017, and
having a size of 7 kilobytes and is filed concurrently with the
specification. The sequence listing contained in this ASCII
formatted document is part of the specification and is herein
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0003] This invention relates to methods and systems for the
detection of microorganisms using infectious agents.
BACKGROUND
[0004] There is a strong interest in improving speed and
sensitivity for detection of bacteria, viruses, and other
microorganisms in biological, food, water, and clinical samples.
Microbial pathogens can cause substantial morbidity among humans
and domestic animals, as well as immense economic loss. Also,
detection of microorganisms is a high priority for the Food and
Drug Administration (FDA) and Centers for Disease Control (CDC)
given outbreaks of life-threatening or fatal illness caused by
ingestion of food contaminated with certain microorganisms, e.g.,
Escherichia coli or Salmonella spp.
[0005] Traditional microbiological tests for the detection of
bacteria rely on non-selective and selective enrichment cultures
followed by plating on selective media and further testing to
confirm suspect colonies. Such procedures can require several days.
A variety of rapid methods have been investigated and introduced
into practice to reduce the time requirement. However, these
methods have drawbacks. For example, techniques involving direct
immunoassays or gene probes generally require an overnight
enrichment step in order to obtain adequate sensitivity. Polymerase
chain reaction (PCR) tests also include an amplification step and
therefore are capable of both very high sensitivity and
selectivity; however, the sample size that can be economically
subjected to PCR testing is limited. With dilute bacterial
suspensions, most small sub samples will be free of cells and
therefore purification and/or lengthy enrichment steps are still
required.
[0006] The time required for traditional biological enrichment is
dictated by the growth rate of the target bacterial population of
the sample, by the effect of the sample matrix, and by the required
sensitivity. In practice, most high sensitivity methods employ an
overnight incubation and take about 24 hours overall. Due to the
time required for cultivation, these methods can take up to three
days, depending upon the organism to be identified and the source
of the sample. This lag time is generally unsuitable as the
contaminated food, water (or other product) may have already made
its way into livestock or humans. In addition, increases in
antibiotic-resistant bacteria and biodefense considerations make
rapid identification of bacterial pathogens in water, food and
clinical samples critical priorities worldwide.
[0007] Therefore, there is a need for more rapid, simple and
sensitive detection and identification of microorganisms, such as
bacteria and other potentially pathogenic microorganisms.
SUMMARY
[0008] Embodiments of the invention comprise compositions, methods,
systems and kits for the detection of microorganisms. The invention
may be embodied in a variety of ways.
[0009] In some aspects, the invention comprises a recombinant
bacteriophage comprising an indicator gene inserted into a late
gene region of a bacteriophage genome. In some embodiments the
recombinant bacteriophage is a genetically modified CBA120 genome.
In some embodiments the recombinant bacteriophage is a genetically
modified T4-like or ViI-like bacteriophage genome. In some
embodiments the recombinant bacteriophage specifically infects E.
coli O157:H7. In an embodiment, the recombinant bacteriophage can
distinguish E. coli O157:H7 in the presence of more than 100 other
types of bacteria.
[0010] In some embodiments of recombinant indicator bacteriophage,
the indicator gene can be codon-optimized and can encode a soluble
protein product that generates an intrinsic signal or a soluble
enzyme that generates signal upon reaction with substrate. Some
recombinant bacteriophage further comprise an untranslated region
upstream of a codon-optimized indicator gene, wherein the
untranslated region includes a bacteriophage late gene promoter and
a ribosomal entry site. In some embodiments, the indicator gene is
a luciferase gene. The luciferase gene can be a naturally occurring
gene, such as Oplophorus luciferase, Firefly luciferase, Lucia
luciferase, or Renilla luciferase, or it can be a genetically
engineered gene.
[0011] Also disclosed herein are methods for preparing a
recombinant indicator bacteriophage. Some embodiments include
selecting a wild-type bacteriophage that specifically infects a
target pathogenic bacterium; preparing a homologous recombination
plasmid/vector comprising an indicator gene; transforming the
homologous recombination plasmid/vector into target pathogenic
bacteria; infecting the transformed target pathogenic bacteria with
the selected wild-type bacteriophage, thereby allowing homologous
recombination to occur between the plasmid/vector and the
bacteriophage genome; and isolating a particular clone of
recombinant bacteriophage. In some embodiments the selected
wild-type bacteriophage is CBA120. In some embodiments the selected
wild-type bacteriophage is T4-like or ViI-like.
[0012] In some embodiments, preparing a homologous recombination
plasmid/vector includes determining the natural nucleotide sequence
in the late region of the genome of the selected bacteriophage;
annotating the genome and identifying the major capsid protein gene
of the selected bacteriophage; designing a sequence for homologous
recombination downstream of the major capsid protein gene, wherein
the sequence comprises a codon-optimized indicator gene; and
incorporating the sequence designed for homologous recombination
into a plasmid/vector. The step of designing a sequence can include
inserting an untranslated region, including a phage late gene
promoter and ribosomal entry site, upstream of the codon-optimized
indicator gene. Thus in some methods the homologous recombination
plasmid comprises an untranslated region including a bacteriophage
late gene promoter and a ribosomal entry site upstream of the
codon-optimized indicator gene.
[0013] Some embodiments of the invention are compositions that
include a recombinant indicator bacteriophage as described herein.
For example, compositions can include one or more wild-type or
genetically modified infectious agents (e.g., bacteriophages) and
one or more indicator genes. In some embodiments, compositions can
include cocktails of different indicator phages that may encode and
express the same or different indicator proteins.
[0014] In some embodiments, the invention comprises a method for
detecting a microorganism of interest in a sample comprising the
steps of incubating the sample with a recombinant bacteriophage
that infects the microorganism of interest, wherein the recombinant
bacteriophage comprises an indicator gene inserted into a late gene
region of the bacteriophage such that expression of the indicator
gene during bacteriophage replication following infection of host
bacteria results in a soluble indicator protein product, and
detecting the indicator protein product, wherein positive detection
of the indicator protein product indicates that the microorganism
of interest is present in the sample.
[0015] In some embodiments of methods for preparing recombinant
indicator bacteriophage, the wild-type bacteriophage is CBA120 and
the target pathogenic bacterium is E. coli O157:H7. In some
embodiments, isolating a particular clone of recombinant
bacteriophage comprises a limiting dilution assay for isolating a
clone that demonstrates expression of the indicator gene.
[0016] Other aspects of the invention include methods for detecting
bacteria, such as E. coli O157:H7, in a sample, including steps of
incubating the sample with a recombinant bacteriophage derived from
CBA120 and detecting an indicator protein product produced by the
recombinant bacteriophage, wherein positive detection of the
indicator protein product indicates that E. coli O157:H7 is present
in the sample. The sample can be a food, environmental, water,
commercial, or clinical sample. In some embodiments, the sample
comprises beef or vegetables.
[0017] In some embodiments of methods for detecting bacteria, the
sample is first incubated in conditions favoring growth for an
enrichment period of 9 hours or less, 8 hours or less, 7 hours or
less, 6 hours or less, 5 hours or less, 4 hours or less, 3 hours or
less, or 2 hours or less. In some embodiments, the total time to
results is less than 12 hours, less than 11 hours, less than 10
hours, less than 9 hours, less than 8 hours, less than 7 hours, or
less than 6 hours. In some embodiments, the ratio of signal to
background generated by detecting the indicator is at least 2.0 or
at least 2.5. In some embodiments, the method detects as few as 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or
100 of the specific bacteria in a sample of a standard size for the
food safety industry.
[0018] Additional embodiments include systems and kits for
detecting E. coli O157:H7, wherein the systems or kits include a
recombinant bacteriophage derived from CBA120. Some embodiments
further include a substrate for reacting with an indicator to
detect the soluble protein product expressed by the recombinant
bacteriophage. These systems or kits can include features described
for the bacteriophage, compositions, and methods of the invention.
In still other embodiments, the invention comprises non-transient
computer readable media for use with methods or systems according
to the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0019] The present invention may be better understood by referring
to the following non-limiting figures.
[0020] FIG. 1 shows a portion of the genome of the wild-type CBA120
bacteriophage and the annotated late gene region in particular.
[0021] FIG. 2 shows one embodiment of a plasmid designed for
homologous recombination with the CBA120 bacteriophage genome.
Capsid protein gp23 (ORF187) is believed to represent the major
capsid protein. As this virion protein is expressed at a very high
level, any genes inserted into this region can be expected to have
similar expression levels, as long as late gene promoters and/or
other similar control elements are used.
[0022] FIG. 3 shows an embodiment of homologous recombination of
the wild-type CBA120 genome in FIG. 1 with the plasmid illustrated
in FIG. 2.
[0023] FIG. 4 depicts the isolation of recombinant bacteriophage
from a mixture of wild-type and recombinant bacteriophage derived
from transforming target bacteria with a plasmid carrying a
sequence designed to recombine in homologous fashion with the
natural bacteriophage genome, and then infecting the transformed
bacteria with wild-type bacteriophage to allow homologous
recombination. A series of sequential infection and dilution steps
allow identification and isolation of recombinant phage that
expresses an indicator/reporter gene.
[0024] FIG. 5 is an electron micrograph of one embodiment of a
recombinant indicator bacteriophage, the CBA120NanoLuc
bacteriophage.
[0025] FIG. 6 depicts the use of indicator bacteriophage encoding a
soluble reporter (e.g., luciferase) to detect bacterial cells via
detection of luciferase generated from replication of indicator
bacteriophage during infection of the bacterial cells, according to
an embodiment of the invention.
[0026] FIG. 7 demonstrates the detection of pathogenic bacteria
using different phage concentrations of CBA120NanoLuc for infecting
samples with known numbers of cells, with 10.sup.6 phage/mL
yielding the highest signal to background ratio.
[0027] FIG. 8 demonstrates that replicates of experiments using
10.sup.6 phage/mL CBA120NanoLuc for infecting samples with known
numbers of cells show significant differences between signal from a
single cell and signal from 0 cells, 2 cells, or more.
[0028] FIG. 9 demonstrates that the signal to background ratio for
the experiment shown in FIG. 8 is greater than 2.0.
[0029] FIG. 10 shows Relative Light Units (RLU) and signal to
background ratios for detection of E. coli O157:H7 in a 1 mL
concentration sample from 25 g ground beef when the assay is
conducted after 5, 6, and 7 hours of enrichment.
[0030] FIG. 11 summarizes detection of E. coli O157:H7 in a 1 mL
concentration sample from 25 g ground beef as shown in FIG. 10 with
confirmation of the results using a secondary method.
[0031] FIG. 12 shows RLU and signal to background ratios for
detection of E. coli O157:H7 in a 10 mL concentration sample from
25 g ground beef when the assay is conducted after 5 hours of
enrichment with confirmation of the results using a secondary
method.
[0032] FIG. 13 shows RLU and signal to background ratios for
detection of E. coli O157:H7 in 1 mL concentration samples from 125
g beef trim when the assay is conducted after 7, 8, and 9 hours of
enrichment.
[0033] FIG. 14 shows RLU and signal to background ratios for
detection of E. coli O157:H7 in 10 mL concentration samples from
125 g beef trim when the assay is conducted after 7, 8, and 9 hours
of enrichment.
[0034] FIG. 15 summarizes detection of E. coli O157:H7 in 1 mL
concentration samples from 125 g beef trim as shown in FIG. 13 with
confirmation of the results using a secondary method.
[0035] FIG. 16 summarizes detection of E. coli O157:H7 in 10 mL
concentration samples from 125 g beef trim as shown in FIG. 14 with
confirmation of the results using a secondary method.
[0036] FIG. 17 shows RLU and signal to background ratios for
detection of E. coli O157:H7 in 100 mL spinach wash filtered and
subjected to a filter assay format with confirmation of the results
using a secondary method.
DETAILED DESCRIPTION OF THE INVENTION
[0037] Disclosed herein are compositions, methods and systems that
demonstrate surprising sensitivity for detection of a microorganism
of interest in test samples (e.g., biological, food, water, and
clinical samples). Detection can be achieved in a shorter timeframe
than was previously thought possible using genetically modified
infectious agents in assays performed without culturing for
enrichment, or in some embodiments with minimal incubation times
during which microorganisms could potentially multiply. Also
surprising is the success of using a potentially high multiplicity
of infection (MOI), or high concentrations of plaque forming
units
[0038] (PFU), for incubation with a test sample. Such high phage
concentrations (PFU/mL) were previously purported to be detrimental
in bacterium detection assays, as they were purported to cause
"lysis from without." However, a high concentration of phage can
facilitate finding, binding, and infecting a low number of target
cells.
[0039] The compositions, methods, systems and kits of the invention
may comprise infectious agents for use in detection of such
microorganisms. In certain embodiments, the invention may comprise
a composition comprising a recombinant bacteriophage having an
indicator gene inserted into a late gene region of the
bacteriophage. In certain embodiments, expression of the indicator
gene during bacteriophage replication following infection of a host
bacterium results in production of a soluble indicator protein
product. In certain embodiments, the indicator gene may be inserted
into a late gene (i.e., class III) region of the bacteriophage. The
bacteriophage can be derived from T7, T4, T4-like, ViI, ViI-like
(or Vi1 virus, per GenBank/NCBI), CBA120, or another wild-type or
engineered bacteriophage.
[0040] In some aspects, the invention comprises a method for
detecting a microorganism of interest. The method may use an
infectious agent for detection of the microorganism of
interest.
[0041] For example, in certain embodiments, the microorganism of
interest is a bacterium and the infectious agent is a
bacteriophage. Thus, in certain embodiments, the method may
comprise detection of a bacterium of interest in a sample by
incubating the sample with a recombinant bacteriophage that infects
the bacterium of interest. In certain embodiments, the recombinant
bacteriophage comprises an indicator gene. The indicator gene may,
in certain embodiments, be inserted into a late gene region of the
bacteriophage such that expression of the indicator gene during
bacteriophage replication following infection of host bacteria
results in production of an indicator protein product. The method
may comprise detecting the indicator protein product, wherein
positive detection of the indicator protein product indicates that
the bacterium of interest is present in the sample. In some
embodiment the indicator protein is soluble.
[0042] In certain embodiments, the invention may comprise a system.
The system may contain at least some of the compositions of the
invention. Also, the system may comprise at least some of the
components for performing the method. In certain embodiments, the
system is formulated as a kit. Thus, in certain embodiments, the
invention may comprise a system for rapid detection of a
microorganism of interest in a sample, comprising: a component for
incubating the sample with an infectious agent specific for the
microorganism of interest, wherein the infectious agent comprises
an indicator moiety; and a component for detecting the indicator
moiety. In yet other embodiments, the invention comprises software
for use with the methods or systems.
[0043] Thus, some embodiments of the present invention solve a need
by using bacteriophage-based methods for amplifying a detectable
signal indicating the presence of bacteria. In certain embodiments
as little as a single bacterium is detected. The principles applied
herein can be applied to the detection of a variety of
microorganisms. Because of numerous binding sites for an infectious
agent on the surface of a microorganism, the capacity to produce
one hundred or more agent progeny during infection, and the
potential for high level expression of an encoded indicator moiety,
the infectious agent or an indicator moiety can be more readily
detectable than the microorganism itself. In this way, embodiments
of the present invention can achieve tremendous signal
amplification from even a single infected cell.
[0044] Aspects of the present invention utilize the high
specificity of binding agents that can bind to particular
microorganisms, such as the binding component of infectious agents,
as a means to detect and/or quantify the specific microorganism in
a sample. In some embodiments, the present invention utilizes the
high specificity of infectious agents such as bacteriophage.
[0045] In some embodiments, detection is achieved through an
indicator moiety associated with the binding agent specific for the
microorganism of interest. For example, an infectious agent may
comprise an indicator moiety, such as a gene encoding a soluble
indicator. In some embodiments the indicator may be encoded by the
infectious agent, such as a bacteriophage, and the bacteriophage is
designated an indicator phage.
[0046] Some embodiments of the invention disclosed and described
herein utilize the discovery that a single microorganism is capable
of binding specific recognition agents, such as phage.
[0047] Following infection and replication of the phage, progeny
phage may be detected via an indicator moiety expressed during
phage replication. This principle allows amplification of indicator
signal from one or a few cells based on specific recognition of
microorganism surface receptors. For example, by exposing even a
single cell of a bacterium to a plurality of phage, thereafter
allowing amplification of the phage and high-level expression of an
encoded indicator gene product during replication, the indicator
signal is amplified such that the single bacterium is
detectable.
[0048] Embodiments of the methods and systems of the invention can
be applied to detection and quantification of a variety of
microorganisms (e.g., bacteria, fungi, yeast) in a variety of
circumstances, including but not limited to detection of pathogens
from food, water, clinical and commercial samples. The methods of
the present invention provide high detection sensitivity and
specificity rapidly and without the need for traditional biological
enrichment (e.g., culturing for enrichment), which is a surprising
aspect as all available methods require culturing. In some
embodiments detection is possible within a single replication cycle
of the bacteriophage, which is unexpected.
Definitions
[0049] Unless otherwise defined herein, scientific and technical
terms used in connection with the present invention shall have the
meanings that are commonly understood by those of ordinary skill in
the art. Further, unless otherwise required by context, singular
terms shall include pluralities and plural terms shall include the
singular. Generally, nomenclatures used in connection with, and
techniques of, cell and tissue culture, molecular biology,
immunology, microbiology, genetics and protein and nucleic acid
chemistry and hybridization described herein are those well known
and commonly used in the art. Known methods and techniques are
generally performed according to conventional methods well known in
the art and as described in various general and more specific
references that are discussed throughout the present specification
unless otherwise indicated. Enzymatic reactions and purification
techniques are performed according to manufacturer's
specifications, as commonly accomplished in the art or as described
herein. The nomenclatures used in connection with the laboratory
procedures and techniques described herein are those well known and
commonly used in the art.
[0050] The following terms, unless otherwise indicated, shall be
understood to have the following meanings:
[0051] As used herein, the terms "a", "an", and "the" can refer to
one or more unless specifically noted otherwise.
[0052] The use of the term "or" is used to mean "and/or" unless
explicitly indicated to refer to alternatives only or the
alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." As used herein "another" can mean at least a second or
more.
[0053] Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among samples.
[0054] The term "solid support" or "support" means a structure that
provides a substrate and/or surface onto which biomolecules may be
bound. For example, a solid support may be an assay well (i.e.,
such as a microtiter plate or multi-well plate), or the solid
support may be a location on a filter, an array, or a mobile
support, such as a bead or a membrane (e.g., a filter plate or
lateral flow strip).
[0055] The term "binding agent" refers to a molecule that can
specifically and selectively bind to a second (i.e., different)
molecule of interest. The interaction may be non-covalent, for
example, as a result of hydrogen bonding, van der Waals
interactions, or electrostatic or hydrophobic interactions, or it
may be covalent. The term "soluble binding agent" refers to a
binding agent that is not associated with (i.e., covalently or
non-covalently bound) to a solid support.
[0056] As used herein, an "analyte" refers to a molecule, compound
or cell that is being measured. The analyte of interest may, in
certain embodiments, interact with a binding agent. As described
herein, the term "analyte" may refer to a protein or peptide of
interest. An analyte may be an agonist, an antagonist, or a
modulator. Or, an analyte may not have a biological effect.
Analytes may include small molecules, sugars, oligosaccharides,
lipids, peptides, peptidomimetics, organic compounds and the
like.
[0057] The term "detectable moiety" or "detectable biomolecule" or
"reporter" or "indicator" or "indicator moiety" refers to a
molecule that can be measured in a quantitative assay. For example,
an indicator moiety may comprise an enzyme that may be used to
convert a substrate to a product that can be measured. An indicator
moiety may be an enzyme that catalyzes a reaction that generates
bioluminescent emissions (e.g., luciferase). Or, an indicator
moiety may be a radioisotope that can be quantified. Or, an
indicator moiety may be a fluorophore. Or, other detectable
molecules may be used.
[0058] As used herein, "bacteriophage" or "phage" includes one or
more of a plurality of bacterial viruses. In this disclosure, the
terms "bacteriophage" and "phage" include viruses such as
mycobacteriophage (such as for TB and paraTB), mycophage (such as
for fungi), mycoplasma phage, and any other term that refers to a
virus that can invade living bacteria, fungi, mycoplasma, protozoa,
yeasts, and other microscopic living organisms and uses them to
replicate itself. Here, "microscopic" means that the largest
dimension is one millimeter or less. Bacteriophages are viruses
that have evolved in nature to use bacteria as a means of
replicating themselves. A phage does this by attaching itself to a
bacterium and injecting its DNA (or RNA) into that bacterium, and
inducing it to replicate the phage hundreds or even thousands of
times. This is referred to as phage amplification.
[0059] As used herein, "late gene region" refers to a region of a
viral genome that is transcribed late in the viral life cycle. The
late gene region typically includes the most abundantly expressed
genes (e.g., structural proteins assembled into the bacteriophage
particle). Late genes are synonymous with class III genes and
include genes with structure and assembly functions. For example,
the late genes (synonymous with class III,) are transcribed in
phage T7, e.g., from 8 minutes after infection until lysis, class I
(e.g., RNA polymerase) is early from 4-8 minutes, and class II from
6-15 minutes, so there is overlap in timing of II and III. A late
promoter is one that is naturally located and active in such a late
gene region.
[0060] As used herein, "culturing for enrichment" refers to
traditional culturing, such as incubation in media favorable to
propagation of microorganisms, and should not be confused with
other possible uses of the word "enrichment," such as enrichment by
removing the liquid component of a sample to concentrate the
microorganism contained therein, or other forms of enrichment that
do not include traditional facilitation of microorganism
propagation. Culturing for enrichment for very short periods of
time may be employed in some embodiments of methods described
herein, but is not necessary and is for a much shorter period of
time than traditional culturing for enrichment, if it is used at
all.
[0061] As used herein "recombinant" refers to genetic (i.e.,
nucleic acid) modifications as usually performed in a laboratory to
bring together genetic material that would not otherwise be found.
This term is used interchangeably with the term "modified"
herein.
[0062] As used herein "RLU" refers to relative light units as
measured by a luminometer (e.g., GLOMAX.RTM. 96) or similar
instrument that detects light. For example, the detection of the
reaction between luciferase and appropriate substrate (e.g.,
NANOLUC.RTM. with NANO-GLO.RTM.) is often reported in RLU
detected.
[0063] As used herein "time to results" refers to the total amount
of time from beginning of sample preparation to the collection of
data. Time to results does not include any confirmatory testing
time.
Samples
[0064] Each of the embodiments of the methods and systems of the
invention can allow for the rapid detection and quantification of
microbes in a sample. For example, methods according to the present
invention can be performed in a shortened time period with superior
results.
[0065] Microbes detected by the methods and systems of the present
invention include pathogens that are of natural, commercial,
medical or veterinary concern. Such pathogens include Gram-negative
bacteria, Gram-positive bacteria, mycoplasmas and viruses. Any
microbe for which an infectious agent that is specific for the
particular microbe has been identified can be detected by the
methods of the present invention. Those skilled in the art will
appreciate that there is no limit to the application of the present
methods other than the availability of the necessary specific
infectious agent/microbe pairs.
[0066] Bacterial cells detectable by the present invention include,
but are not limited to, bacterial cells that are food or water
borne pathogens. Bacterial cells detectable by the present
invention include, but are not limited to, all species of
Salmonella, all strains of Escherichia coli, including, but not
limited to E. coli O157:H7, all species of Listeria, including, but
not limited to L. monocytogenes, and all species of Campylobacter.
Bacterial cells detectable by the present invention include, but
are not limited to, bacterial cells that are pathogens of medical
or veterinary significance. Such pathogens include, but are not
limited to, Bacillus spp., Bordetella pertussis, Camplyobacter
jejuni, Chlamydia pneumoniae, Clostridium perfringens, Enterobacter
spp., Klebsiella pneumoniae, Mycoplasma pneumoniae, Salmonella
typhi, Shigella sonnei, Staphylococcus aureus, and Streptococcus
spp.
[0067] The sample may be an environmental or food or water sample.
Some embodiments may include medical or veterinary samples. Samples
may be liquid, solid, or semi-solid. Samples may be swabs of solid
surfaces. Samples may include environmental materials, such as the
water samples, or the filters from air samples or aerosol samples
from cyclone collectors. Samples may be of meat, poultry, processed
foods, milk, cheese, or other dairy products. Medical or veterinary
samples include, but are not limited to, blood, sputum,
cerebrospinal fluid, and fecal samples and different types of
swabs.
[0068] In some embodiments, samples may be used directly in the
detection methods of the present invention, without preparation,
concentration, or dilution. For example, liquid samples, including
but not limited to, milk and juices, may be assayed directly.
Samples may be diluted or suspended in solution, which may include,
but is not limited to, a buffered solution or a bacterial culture
medium. A sample that is a solid or semi-solid may be suspending in
a liquid by mincing, mixing or macerating the solid in the liquid.
A sample should be maintained within a pH range that promotes
bacteriophage attachment to the host bacterial cell. A sample
should also contain the appropriate concentrations of divalent and
monovalent cations, including but not limited to Na.sup.+,
Mg.sup.2+, and K.sup.+. Preferably a sample is maintained at a
temperature that maintains the viability of any pathogen cells
contained within the sample.
[0069] Preferably throughout detection assays, the sample is
maintained at a temperature that maintains the viability of any
pathogen cell present in the sample. During steps in which
bacteriophages are attaching to bacterial cells, it is preferable
to maintain the sample at a temperature that facilitates
bacteriophage attachment. During steps in which bacteriophages are
replicating within an infected bacterial cell or lysing such an
infected cell, it is preferable to maintain the sample at a
temperature that promotes bacteriophage replication and lysis of
the host. Such temperatures are at least about 25 degrees Celsius
(C.), more preferably no greater than about 45 degrees C., most
preferably about 37 degrees C. It is also preferred that the
samples be subjected to gentle mixing or shaking during
bacteriophage attachment, replication and cell lysis.
[0070] Assays may include various appropriate control samples. For
example, control samples containing no bacteriophages or control
samples containing bacteriophages without bacteria may be assayed
as controls for background signal levels.
Indicator Bacteriophage
[0071] As described in more detail herein, the compositions,
methods, systems and kits of the invention may comprise infectious
agents for use in detection of pathogenic microorganisms. In
certain embodiments, the invention comprises a recombinant
indicator bacteriophage, wherein the bacteriophage genome is
genetically modified to include an indicator or reporter gene. In
some embodiments, the invention may include a composition
comprising a recombinant bacteriophage having an indicator gene
incorporated into the genome of the bacteriophage.
[0072] A recombinant indicator bacteriophage can include a reporter
or indicator gene. In certain embodiments of the infectious agent,
the indicator gene does not encode a fusion protein.
[0073] For example, in certain embodiments, expression of the
indicator gene during bacteriophage replication following infection
of a host bacterium results in a soluble indicator protein product.
In certain embodiments, the indicator gene may be inserted into a
late gene region of the bacteriophage. Late genes are generally
expressed at higher levels than other phage genes, as they code for
structural proteins. The late gene region may be a class III gene
region and may include a gene for a major capsid protein.
[0074] Some embodiments include designing (and optionally
preparing) a sequence for homologous recombination downstream of
the major capsid protein gene. In some embodiments, the sequence
comprises a codon-optimized reporter gene preceded by an
untranslated region. The untranslated region may include a phage
late gene promoter and ribosomal entry site.
[0075] In some embodiments, an indicator bacteriophage is derived
from T7, T4 or another similar phage. An indicator bacteriophage
may also be derived from T4-like, T7-like, ViI, ViI-like, CBA120,
or another bacteriophage having a genome with at least 70, 71, 72,
73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,
90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% homology to T7, T7-like,
T4, T4-like, CBA120, ViI, or ViI-like (or Vi1 virus-like, per
GenBank/NCBI) bacteriophages. In some embodiments, the indicator
phage is derived from a bacteriophage that is highly specific for a
particular pathogenic microorganism. The genetic modifications may
avoid deletions of wild-type genes and thus the modified phage may
remain more similar to the wild-type infectious agent than many
commercially available phage. Environmentally derived bacteriophage
may be more specific for bacteria that are found in the environment
and as such, genetically distinct from phage available
commercially.
[0076] Moreover, phage genes thought to be nonessential may have
unrecognized function. For example, an apparently nonessential gene
may have an important function in elevating burst size such as
subtle cutting, fitting, or trimming functions in assembly.
Therefore, deleting genes to insert an indicator may be
detrimental. Most phages can package a DNA that is a few percent
larger than their natural genome. With this consideration, a
smaller indicator gene may be a more appropriate choice for
modifying a bacteriophage, especially one with a smaller genome.
OpLuc and NANOLUC.RTM. proteins are only about 20 kDa
(approximately 500-600 bp to encode), while FLuc is about 62 kDa
(approximately 1,700 bp to encode). For comparison, the genome of
T7 is around 40 kbp, while the T4 genome is about 170 kbp, and the
genome of CBA120 is about 157 kbp. Moreover, the reporter gene
should not be expressed endogenously by the bacteria (i.e., is not
part of the bacterial genome), should generate a high signal to
background ratio, and should be readily detectable in a timely
manner. Promega's NANOLUC.RTM. is a modified Oplophorus
gracilirostris (deep sea shrimp) luciferase. In some embodiments,
NANOLUC.RTM. combined with Promega's NANO-GLO.RTM., an
imidazopyrazinone substrate (furimazine), can provide a robust
signal with low background.
[0077] In some indicator phage embodiments, the indicator gene can
be inserted into an untranslated region to avoid disruption of
functional genes, leaving wild-type phage genes intact, which may
lead to greater fitness when infecting non-laboratory strains of
bacteria. Additionally, including stop codons in all three reading
frames may help to increase expression by reducing read-through,
also known as leaky expression. This strategy may also eliminate
the possibility of a fusion protein being made at low levels, which
would manifest as background signal (e.g., luciferase) that cannot
be separated from the phage.
[0078] An indicator gene may express a variety of biomolecules. The
indicator gene is a gene that expresses a detectable product or an
enzyme that produces a detectable product. For example, in one
embodiment the indicator gene encodes a luciferase enzyme. Various
types of luciferase may be used. In alternate embodiments, and as
described in more detail herein, the luciferase is one of
Oplophorus luciferase, Firefly luciferase, Lucia luciferase,
Renilla luciferase, or an engineered luciferase. In some
embodiments, the luciferase gene is derived from Oplophorus. In
some embodiments, the indicator gene is a genetically modified
luciferase gene, such as NANOLUC.RTM..
[0079] Thus, in some embodiments, the present invention comprises a
genetically modified bacteriophage comprising a non-bacteriophage
indicator gene in the late (class III) gene region. In some
embodiments, the non-native indicator gene is under the control of
a late promoter. Using a viral late gene promoter insures the
reporter gene (e.g., luciferase) is not only expressed at high
levels, like viral capsid proteins, but also does not shut down
like endogenous bacterial genes or even early viral genes.
[0080] In some embodiments, the late promoter is a T4-, T7-, or
ViI-like promoter, or another phage promoter similar to that found
in the selected wild-type phage, i.e., without genetic
modification. The late gene region may be a class III gene region,
and the bacteriophage may be derived from T7, T4, T4-like, ViI,
ViI-like, CBA120, or another natural bacteriophage having a genome
with at least 70, 75, 80, 85, 90 or 95% homology to T7, T4,
T4-like, ViI, ViI-like, or CBA120 phage.
[0081] Genetic modifications to infectious agents may include
insertions, deletions, or substitutions of a small fragment of
nucleic acid, a substantial part of a gene, or an entire gene. In
some embodiments, inserted or substituted nucleic acids comprise
non-native sequences. A non-native indicator gene may be inserted
into a bacteriophage genome such that it is under the control of a
bacteriophage promoter. In some embodiments, the non-native
indicator gene is not part of a fusion protein. That is, in some
embodiments, a genetic modification may be configured such that the
indicator protein product does not comprise polypeptides of the
wild-type bacteriophage. In some embodiments, the indicator protein
product is soluble. In some embodiments, the invention comprises a
method for detecting a bacterium of interest comprising the step of
incubating a test sample with such a recombinant bacteriophage.
[0082] In some embodiments, expression of the indicator gene in
progeny bacteriophage following infection of host bacteria results
in a free, soluble protein product. In some embodiments, the
non-native indicator gene is not contiguous with a gene encoding a
structural phage protein and therefore does not yield a fusion
protein. Unlike systems that employ a fusion of a detection moiety
to the capsid protein (i.e., a fusion protein), some embodiments of
the present invention express a soluble luciferase. This may
greatly increase the sensitivity of the assay (down to a single
bacterium), and simplifies the assay, allowing the assay to be
completed in less than an hour for some embodiments, as opposed to
several hours due to additional purification steps required with
constructs that produce detectable fusion proteins. Further, fusion
proteins may be less active than soluble proteins due, e.g., to
protein folding constraints that may alter the conformation of the
enzyme active site or access to the substrate.
[0083] Moreover, fusion proteins by definition limit the number of
the moieties attached to subunits of a protein in the
bacteriophage. For example, using a commercially available system
designed to serve as a platform for a fusion protein would result
in about 415 copies of the fusion moiety, corresponding to the
about 415 copies of the gene 10B capsid protein in each T7
bacteriophage particle. Without this constraint, infected bacteria
can be expected to express many more copies of the detection moiety
(e.g., luciferase) than can fit on the bacteriophage.
[0084] Additionally, large fusion proteins, such as a
capsid-luciferase fusion, may inhibit assembly of the bacteriophage
particle, thus yielding fewer bacteriophage progeny. Thus a
soluble, non-fusion indicator gene product may be preferable.
[0085] In some embodiments, the indicator phage encodes a reporter,
such as a detectable enzyme. The indicator gene product may
generate light and/or may be detectable by a color change. Various
appropriate enzymes are commercially available, such as alkaline
phosphatase (AP), horseradish peroxidase (HRP), or luciferase
(Luc). In some embodiments, these enzymes may serve as the
indicator moiety. In some embodiments, Firefly luciferase is the
indicator moiety. In some embodiments, Oplophorus luciferase is the
indicator moiety. In some embodiments, NANOLUC.RTM. is the
indicator moiety. Other engineered luciferases or other enzymes
that generate detectable signals may also be appropriate indicator
moieties.
[0086] In some embodiments, the use of a soluble detection moiety
eliminates the need to remove contaminating parental phage from the
lysate of the infected sample cells. With a fusion protein system,
any bacteriophage used to infect sample cells would have the
detection moiety attached, and would be indistinguishable from the
daughter bacteriophage also containing the detection moiety. As
detection of sample bacteria relies on the detection of a newly
created (de novo synthesized) detection moiety, using fusion
constructs requires additional steps to separate old (parental)
moieties from newly created (daughter bacteriophage) moieties. This
may be accomplished by washing the infected cells multiple times,
prior to the completion of the bacteriophage life cycle,
inactivating excess parental phage after infection by physical or
chemical means, and/or chemically modifying the parental
bacteriophage with a binding moiety (such as biotin), which can
then be bound and separated (such as by streptavidin-coated
sepharose beads). However, even with all these attempts at removal,
parental phage can remain when a high concentration of parental
phage is used to assure infection of a low number of sample cells,
creating background signal that may obscure detection of signal
from infected cell progeny phage.
[0087] By contrast, with the soluble detection moiety expressed in
some embodiments of the present invention, purification of the
parental phage from the final lysate is unnecessary, as the
parental phage do not have any detection moiety attached. Thus any
detection moiety present after infection must have been created de
novo, indicating the presence of an infected bacterium or bacteria.
To take advantage of this benefit, the production and preparation
of parental phage may include purification of the phage from any
free detection moiety produced during the production of parental
bacteriophage in bacterial culture. Standard bacteriophage
purification techniques may be employed to purify some embodiments
of phage according to the present invention, such as sucrose
density gradient centrifugation, cesium chloride isopycnic density
gradient centrifugation, HPLC, size exclusion chromatography, and
dialysis or derived technologies (such as Amicon brand
concentrators--Millipore, Inc.). Cesium chloride isopycnic
ultracentrifugation can be employed as part of the preparation of
recombinant phage of the invention, to separate parental phage
particles from contaminating luciferase protein produced upon
propagation of the phage in the bacterial host. In this way, the
parental recombinant bacteriophage of the invention is
substantially free of any luciferase generated during production in
the bacteria. Removal of residual luciferase present in the phage
stock can substantially reduce background signal observed when the
recombinant bacteriophage are incubated with a test sample.
[0088] In some embodiments of modified bacteriophage, the late
promoter (class III promoter, e.g., from T7, T4, or ViI) has high
affinity for RNA polymerase of the same bacteriophage that
transcribes genes for structural proteins assembled into the
bacteriophage particle. These proteins are the most abundant
proteins made by the phage, as each bacteriophage particle
comprises dozens or hundreds of copies of these molecules. The use
of a viral late promoter can ensure optimally high level of
expression of the luciferase detection moiety. The use of a late
viral promoter derived from, specific to, or active under the
original wild-type bacteriophage the indicator phage is derived
from (e.g., a T4, T7, or ViI late promoter with a T4-, T7-, or
ViI-based system) can further ensure optimal expression of the
detection moiety. The use of a standard bacterial
(non-viral/non-bacteriophage) promoter may in some cases be
detrimental to expression, as these promoters are often
down-regulated during bacteriophage infection (in order for the
bacteriophage to prioritize the bacterial resources for phage
protein production). Thus, in some embodiments, the phage is
preferably engineered to encode and express at high level a soluble
(free) indicator moiety, using a placement in the genome that does
not limit expression to the number of subunits of a phage
structural component.
[0089] Compositions of the invention may comprise one or more
wild-type or genetically modified infectious agents (e.g.,
bacteriophages) and one or more indicator genes. In some
embodiments, compositions can include cocktails of different
indicator phages that may encode and express the same or different
indicator proteins.
Methods of Preparing Indicator Bacteriophage
[0090] Embodiments of methods for making indicator bacteriophage
begin with selection of a wild-type bacteriophage for genetic
modification. Some bacteriophage are highly specific for a target
bacterium. This presents an opportunity for highly specific
detection.
[0091] Thus, the methods of the present invention utilizes the high
specificity of binding agents, associated with infectious agents,
that recognize and bind to a particular microorganism of interest
as a means to amplify a signal and thereby detect low levels of a
microorganism (e.g., a single microorganism) present in a sample.
For example, infectious agents (e.g., bacteriophage) specifically
recognize surface receptors of particular microorganisms and thus
specifically infect those microorganisms. As such, these infectious
agents may be appropriate binding agents for targeting a
microorganism of interest.
[0092] A variety of infectious agents may be used. In alternate
embodiments, bacteriophages, phages, mycobacteriophages (such as
for TB and paraTB), mycophages (such as for fungi), mycoplasma
phages, and any other virus that can invade living bacteria, fungi,
mycoplasma, protozoa, yeasts, and other microscopic living
organisms can be employed to target a microorganism of interest.
For example, in an embodiment, where the microorganism of interest
is a bacterium, the infectious agent may comprise a bacteriophage.
For example, well-studied phages of E. coli include T1, T2, T3, T4,
T5, T7, and lambda; other E. coli phages available in the ATCC
collection, for example, include phiX174, S13, Ox6, MS2, phiV1, fd,
PR772, and ZIK1. As discussed herein, the bacteriophage may
replicate inside of the bacteria to generate hundreds of progeny
phage. Detection of the product of an indicator gene inserted into
the bacteriophage genome can be used as a measure of the bacteria
in the sample.
[0093] Some embodiments of the invention utilize the specificity of
binding and high-level genetic expression capacity of recombinant
bacteriophage for rapid and sensitive targeting to infect and
facilitate detection of a bacterium of interest. In some
embodiments, CBA120 bacteriophage is genetically modified to
include a reporter gene. In some embodiments the late gene region
of a bacteriophage is genetically modified to include a reporter
gene. In some embodiments, a reporter gene is positioned downstream
of the major capsid gene. In other embodiments, a reporter gene is
positioned upstream of the major capsid gene.
[0094] Some embodiments of methods for preparing a recombinant
indicator bacteriophage include selecting a wild-type bacteriophage
that specifically infects a target pathogenic bacterium; preparing
a homologous recombination plasmid/vector that comprises an
indicator gene; transforming the homologous recombination
plasmid/vector into target pathogenic bacteria; infecting the
transformed target pathogenic bacteria with the selected wild-type
bacteriophage, thereby allowing homologous recombination to occur
between the plasmid/vector and the bacteriophage genome; and
isolating a particular clone of recombinant bacteriophage.
[0095] Various methods for designing and preparing a homologous
recombination plasmid are known. Various methods for transforming
bacteria with a plasmid are known, including heat-shock, F pilus
mediated bacterial conjugation, electroporation, and other methods.
Various methods for isolating a particular clone following
homologous recombination are also known. Some method embodiments
described herein utilize particular strategies.
[0096] Thus, some embodiments of methods for preparing indicator
bacteriophage include the steps of selecting a wild-type
bacteriophage that specifically infects a target pathogenic
bacterium; determining the natural sequence in the late region of
the genome of the selected bacteriophage; annotating the genome and
identifying the major capsid protein gene of the selected
bacteriophage; designing a sequence for homologous recombination
adjacent to the major capsid protein gene, wherein the sequence
comprises a codon-optimized reporter gene; incorporating the
sequence designed for homologous recombination into a
plasmid/vector; transforming the plasmid/vector into target
pathogenic bacteria; selecting for the transformed bacteria;
infecting the transformed bacteria with the selected wild-type
bacteriophage, thereby allowing homologous recombination to occur
between the plasmid and the bacteriophage genome; determining the
titer of the resulting recombinant bacteriophage lysate; and
performing a limiting dilution assay to enrich and isolate the
recombinant bacteriophage. Some embodiments comprise further
repeating the limiting dilution and titer steps, following the
first limiting dilution assay, as needed until the recombinant
bacteriophage represent a detectable fraction of the mixture. For
example, in some embodiments the limiting dilution and titer steps
can be repeated until at least 1/30 of the bacteriophage in the
mixture are recombinant before isolating a particular clone of
recombinant bacteriophage. A ratio of 1:30 recombinant:wild-type is
expected to yield an average of 3.2 transducing units (TU) per 96
plaques (e.g., in a 96-well plate). By Poisson distribution, a 1:30
ratio therefore generates a 96% chance of observing at least one TU
somewhere in the 96 wells.
[0097] FIG. 1 depicts a schematic representation of the wild-type
CBA120 bacteriophage genome. The late gene cluster 110 was
identified, and open reading frames 120 (ORF) in the late gene
region were annotated. The ORF187/gp23 putative gene for the major
capsid protein 130 (MCP) was identified and its sequence, along
with downstream sequence in the late gene cluster, was used to
prepare a recombinant plasmid carrying the desired reporter
gene.
[0098] Some embodiments of methods of preparing a recombinant
indicator bacteriophage include designing a plasmid that can
readily recombine with the wild-type bacteriophage genome to
generate recombinant genomes. In designing a plasmid, some
embodiments include addition of a codon-optimized reporter gene,
such as a luciferase gene. Some embodiments further include
addition of elements into the upstream untranslated region. For
example, in designing a plasmid to recombine with the CBA120
genome, an upstream untranslated region can be added between the
sequence encoding the C-terminus of the gp23/Major Capsid Protein
and the start codon of the NANOLUC.RTM. reporter gene. The
untranslated region can include a promoter, such as a T4, T4-like,
T7, T7-like, CBA120, ViI, or ViI-like promoter. The untranslated
region can also include a Ribosomal Entry/Binding Site (RBS), also
known as a "Shine-Dalgarno Sequence" with bacterial systems. Either
or both of these elements, or other untranslated elements, can be
embedded within a short upstream untranslated region made of random
sequences comprising about the same GC content as rest of the phage
genome. The random region should not include an ATG sequence, as
that will act as a start codon.
[0099] There are numerous known methods and commercial products for
preparing plasmids. For example PCR, site-directed mutagenesis,
restriction digestion, ligation, cloning, and other techniques may
be used in combination to prepare plasmids. Synthetic plasmids can
also be ordered commercially (e.g., GeneWiz). Cosmids can also be
employed, or the CRISPR/CAS9 system could be used to selectively
edit a bacteriophage genome.
[0100] FIG. 2 shows an embodiment of a plasmid designed to
recombine with the CBA120 bacteriophage genome to generate a
recombinant bacteriophage. This particular plasmid is designated
pUC57.HR.CBA120.NanoLuc. The detection/indicator moiety is encoded
by the NANOLUC.RTM. reporter gene 941-1540. The insert (396-1883)
is in the standard AmpR version of pUC57. The major capsid protein
C-terminal fragment is represented by 396-895, ORF187/gp23. A
T4-like phage late promoter consensus sequence (902-912) &
Shine-Dalgarno Ribosomal Entry/Binding Site (927-934) within the 5'
untranslated region are represented by 896-940. The codon-optimized
NANOLUC.RTM. reporter gene is represented by 941-1540. The
untranslated region (UTR) and ORF185 hypothetical protein
N-Terminal fragment are represented by 1541-1838. The
transcriptional terminator (1839-1883) is only in the plasmid, and
does not become part of the phage genome as a result of
recombination.
[0101] The ORF187/gp23 fragment 396-895 is a part of a structural
gene that encodes a virion protein. As these virion proteins are
expressed at a very high level, any genes inserted into this region
can be expected to have similar expression levels, as long as late
gene promoters and/or other similar control elements are used.
[0102] FIG. 3 shows a schematic of the homologous recombination
expected between the plasmid of FIG. 2 and bacteriophage genome of
FIG. 1 to create recombinant bacteriophage that express the
luciferase gene. In this embodiment of homologous recombination to
generate recombinant bacteriophage, the CBA120 phage genome is
157,304 base pairs, while the synthesized plasmid is 4,117 base
pairs. The final recombinant genome resulting from recombination is
157,949 base pairs.
[0103] In some embodiments, indicator phage according to the
invention comprise CBA120 bacteriophage genetically engineered to
comprise a reporter gene such as a luciferase gene. For example, an
indicator phage can be the CBA120 bacteriophage wherein the genome
comprises the sequence of the NANOLUC.RTM. gene. A recombinant
CBA120 bacteriophage genome may further comprise a T4, T7, CBA120,
ViI, or another late promoter.
[0104] Thus, in the embodiment of the recombinant phage generated
as a result of the recombination illustrated in FIG. 3, the
indicator gene (i.e., NANOLUC.RTM.) is inserted into the late gene
region, just downstream of the gene encoding the major capsid
protein, and thus creates recombinant bacteriophage genomes
comprising the NANOLUC.RTM. gene. The construct may additionally
comprise the consensus T4, T7, CBA120, ViI, or another late
promoter or another suitable promoter to drive transcription and
expression of the luciferase gene. The construct may also comprise
a composite untranslated region synthesized from several UTRs. This
construct ensures soluble luciferase is produced such that
expression is not limited to the number of capsid proteins inherent
in the phage display system.
[0105] FIG. 4 depicts the isolation of recombinant phage from the
mixture of wild-type and recombinant bacteriophage resulting from
the homologous recombination illustrated in FIG. 3, using the
plasmid construct shown in FIG. 2.
[0106] In the first step 402, bacteria transformed with the
homologous recombination plasmid are infected with bacteriophage,
resulting in progeny phage with a mixture of parental and
recombinant phage with a ratio of approximately 120 wild-type 432:1
recombinant phage 434.
[0107] The resulting recombinant phage mix is diluted 404 into
96-well plates 406 to give an average of 3 recombinant transducing
units (TU) per plate, which corresponds to about 3.8 infectious
units (IU) of mostly wild-type phage per well. The 96-well plate is
assayed for luciferase activity to identify wells 436 containing
recombinant phage as compared to wells 440 containing wild-type
bacteriophage. Bacteria 438 are added 408; for example, each well
may contain about 50 .mu.L of a turbid E. coli O157:H7 culture.
This allows the phage to replicate and produce the luciferase
enzyme 442. After 2 hours of incubation at 37.degree. C. shown in
410, wells may be screened for the presence of luciferase 442. Any
positive wells are likely to have been inoculated with a single
recombinant phage, and at this stage the mixture may contain a
ratio of approximately 3.8 wild-type phage: 1 recombinant, an
enrichment over the original 120:1 ratio. In one embodiment,
soluble luciferase and phage were present at an approximate ratio
of 16 wild-type:1 recombinant. If necessary (i.e., if the ratio of
recombinant:wild-type is lower than 1:30), progeny from this
enriched culture 412 may be subjected to additional limiting
dilution assay(s) 414 to increase the ratio and determine the
actual concentration of recombinant phage transducing units. For
example, about 3 recombinant TU per 96-well plate 416 may be
aliquoted 414 from the first purification stock, leading to an
approximate inoculation of .about.20 mostly wild-type phage per
well of a second dilution assay plate 420. Any positive luciferase
wells are likely to have been inoculated with a single recombinant
along with .about.20 wild-type phage. These wells may be analyzed
for presence of luciferase 442.
[0108] After addition of bacteria and incubation (e.g., for 2 hours
at 37.degree. C.) 418, soluble luciferase and phage are present at
approximately 20 wild-type: 1 recombinant 420. Finally, a plaque
assay may be performed 422 to screen for recombinants that express
luciferase 446. A small number of individual (e.g., n=48) plaques
may be individually picked and screened in a third multiwell plate
426 for luciferase activity 436. In an embodiment, this approach
should insure that about 3 recombinants would be in the mix of
plaques being screened. One plaque may be removed from the plate to
each well of a 96-well plate 424 and a luciferase assay performed
426 to determine which wells contained phage exhibiting luciferase
activity 442. Wells 428 demonstrating luciferase activity represent
pure recombinant phage 434, while wells without luciferase activity
430 represent pure wild-type phage 432.
[0109] Individual plaques may then be suspended in buffer (e.g.,
100 .mu.L TMS) or media, and an aliquot (e.g., about 5 .mu.L) added
to a well containing a turbid E. coli O157:H7 culture, and assayed
after incubation (e.g., about 45 minutes to 1 hour at 37.degree.
C.). Positive wells are expected to contain a pure culture of
recombinant phage. Certain embodiments can include additional
rounds of plaque purification.
[0110] Thus, as illustrated in FIG. 4, recombinant phage generated
by homologous recombination of a plasmid designed for recombination
with the wild-type phage genome can be isolated from a mixture
comprising only 0.005% of total phage genomes. Following isolation,
large scale production may be performed to obtain high titer
recombinant indicator phage stocks appropriate for use in the E.
coli O157:H7 detection assay. Furthermore, cesium chloride
isopycnic density gradient centrifugation may be used to separate
phage particles from contaminating luciferase protein to reduce
background.
[0111] FIG. 5 shows an electron micrograph of one embodiment of a
recombinant indicator bacteriophage generated by recombination of
the wild-type CBA120 bacteriophage genome shown in FIG. 1 with the
plasmid shown in FIG. 2, as illustrated in FIG. 3. To capture the
image, the bacteriophage purified on a 5-20% sucrose density
gradient were adsorbed onto a glow discharge-treated carbon film
and stained with 2% uranyl acetate. The sample was viewed in a FEI
Tecnai G.sup.2 Spirit BioTwin Transmission Electron Microscope and
the micrograph taken with an Eagle.TM. 2K CCD. This indicator
bacteriophage is designated "CBA120NanoLuc" (or
[0112] "CBA120NanoLuc indicator phage") and was utilized in the
assays described herein. The data presented in Examples and Figures
herein were obtained using this Indicator Phage for infection of
bacteria in the sample being tested.
[0113] In this way, and as described in more detail in the Examples
below, recombinant bacteriophage having the reporter gene of
interest (e.g., luciferase gene such as Firefly, Oplophorus or an
engineered luciferase such as NANOLUC.RTM.) inserted into a
wild-type bacteriophage may be generated.
Methods of Using Infectious Agents for Detecting Microorganisms
[0114] As noted herein, in certain embodiments, the invention may
comprise methods of using infectious particles for detecting
microorganisms. The methods of the invention may be embodied in a
variety of ways.
[0115] In an embodiment, the invention may comprise a method for
detecting a bacterium of interest in a sample comprising the steps
of: incubating the sample with bacteriophage that infects the
bacterium of interest, wherein the bacteriophage comprises an
indicator gene such that expression of the indicator gene during
bacteriophage replication following infection of the bacterium of
interest results in production of a soluble indicator protein
product; and detecting the indicator protein product, wherein
positive detection of the indicator protein product indicates that
the bacterium of interest is present in the sample.
[0116] In certain embodiments, the assay may be performed to
utilize a general concept that can be modified to accommodate
different sample types or sizes and assay formats. Embodiments
employing recombinant bacteriophage of the invention (i.e.,
indicator bacteriophage) may allow rapid detection of specific
bacterial strains, with total assay times under 1.5, 2.0, 2.5, 3.0,
3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5,
10.0, 10.5, 11.0, 11.5, or 12 hours, depending on the sample type,
sample size, and assay format. For example, the amount of time
required may be somewhat shorter or longer depending on the strain
of bacteriophage and the strain of bacteria to be detected in the
assay, type and size of the sample to be tested, conditions
required for viability of the target, complexity of the
physical/chemical environment, and the concentration of
"endogenous" non-target bacterial contaminants.
[0117] FIG. 6 illustrates an embodiment of an assay for detecting a
bacterium of interest using a modified bacteriophage according to
an embodiment of the invention. Aliquots of indicator phage 614 are
distributed to the individual wells 602 of a multi-well plate 604,
and then test sample aliquots containing bacteria 612 are added and
incubated 606 for a period of time (e.g., 45 minutes at 37.degree.
C.) sufficient for phage to replicate and generate soluble
indicator 616 (e.g., luciferase). The plate wells 608 containing
soluble indicator and phage may then be assayed 610 to measure the
indicator activity on the plate 618 (e.g., luciferase assay).
Experiments utilizing this method are described herein. In some
embodiments, the test samples are not concentrated (e.g., by
centrifugation) but are incubated directly with indicator phage for
a period of time and subsequently assayed for luciferase activity.
In other embodiments, various tools (e.g., a centrifuge or filter)
may be used to concentrate the samples before enrichment or before
testing. For example, a 10 mL aliquot of a prepared sample may be
extracted and centrifuged to pellet cells and large debris. The
pellet can be resuspended in a smaller volume for enrichment or for
testing (i.e., before infecting the sample with Indicator
Bacteriophage).
[0118] In some embodiments, the sample may be enriched prior to
testing by incubation in conditions that encourage growth. In such
embodiments, the enrichment period can be 1, 2, 3, 4, 5, 6, 7, or
up to 8 hours or longer, depending on the sample type and size.
[0119] Thus, in some embodiments, the indicator bacteriophage
comprises a detectable indicator moiety, and infection of a single
pathogenic cell (e.g., bacterium) can be detected by an amplified
signal generated via the indicator moiety. Thus the method may
comprise detecting an indicator moiety produced during phage
replication, wherein detection of the indicator indicates that the
bacterium of interest is present in the sample.
[0120] In an embodiment, the invention may comprise a method for
detecting a bacterium of interest in a sample comprising the steps
of: incubating the sample with a recombinant bacteriophage that
infects the bacterium of interest, wherein the recombinant
bacteriophage comprises an indicator gene inserted into a late gene
region of the bacteriophage such that expression of the indicator
gene during bacteriophage replication following infection of host
bacteria results in production of a soluble indicator protein
product; and detecting the indicator protein product, wherein
positive detection of the indicator protein product indicates that
the bacterium of interest is present in the sample. In some
embodiments, the amount of indicator moiety detected corresponds to
the amount of the bacterium of interest present in the sample.
[0121] As described in more detail herein, the methods and systems
of the invention may utilize a range of concentrations of parental
indicator bacteriophage to infect bacteria present in the sample.
In some embodiments the indicator bacteriophage are added to the
sample at a concentration sufficient to rapidly find, bind, and
infect target bacteria that are present in very low numbers in the
sample, such as a single cell. In some embodiments, the phage
concentration can be sufficient to find, bind, and infect the
target bacteria in less than one hour. In other embodiments, these
events can occur in less than two hours, or less than three hours,
following addition of indicator phage to the sample. For example,
in certain embodiments, the bacteriophage concentration for the
incubating step is greater than 1.times.10.sup.5 PFU/mL, greater
than 1.times.10.sup.6 PFU/mL, or greater than 1.times.10.sup.7
PFU/mL.
[0122] In certain embodiments, the recombinant infectious agent may
be purified so as to be free of any residual indicator protein that
may be generated upon production of the infectious agent stock.
Thus, in certain embodiments, the recombinant bacteriophage may be
purified using cesium chloride isopycnic density gradient
centrifugation prior to incubation with the sample. When the
infectious agent is a bacteriophage, this purification may have the
added benefit of removing bacteriophage that do not have DNA (i.e.,
empty phage or "ghosts").
[0123] In some embodiments of the methods of the invention, the
microorganism may be detected without any isolation or purification
of the microorganisms from a sample. For example, in certain
embodiments, a sample containing one or a few microorganisms of
interest may be applied directly to an assay container such as a
spin column, a microtiter well, or a filter and the assay is
conducted in that assay container. Various embodiments of such
assays are disclosed herein.
[0124] Aliquots of a test sample may be distributed directly into
wells of a multi-well plate, indicator phage may be added, and
after a period of time sufficient for infection, a lysis buffer may
be added as well as a substrate for the indicator moiety (e.g.,
luciferase substrate for a luciferase indicator) and assayed for
detection of the indicator signal. Some embodiments of the method
can be performed on filter plates. Some embodiments of the method
can be performed with or without concentration of the sample before
infection with indicator phage.
[0125] For example, in many embodiments, multi-well plates are used
to conduct the assays. The choice of plates (or any other container
in which detecting may be performed) may affect the detecting step.
For example, some plates may include a colored or white background,
which may affect the detection of light emissions. Generally
speaking, white plates have higher sensitivity but also yield a
higher background signal. Other colors of plates may generate lower
background signal but also have a slightly lower sensitivity.
Additionally, one reason for background signal is the leakage of
light from one well to another, adjacent well. There are some
plates that have white wells but the rest of the plate is black.
This allows for a high signal inside the well but prevents
well-to-well light leakage and thus may decrease background. Thus
the choice of plate or other assay vessel may influence the
sensitivity and background signal for the assay.
[0126] Methods of the invention may comprise various other steps to
increase sensitivity. For example, as discussed in more detail
herein, the method may comprise a step for washing the captured and
infected bacterium, after adding the bacteriophage but before
incubating, to remove excess parental bacteriophage and/or
luciferase or other reporter protein contaminating the
bacteriophage preparation.
[0127] In some embodiments, detection of the microorganism of
interest may be completed without the need for culturing the sample
as a way to increase the population of the microorganisms. For
example, in certain embodiments the total time required for
detection is less than 12.0 hours, 11.0 hours, 10.0 hours, 9.0
hours, 8.0 hours, 7.0 hours, 6.0 hours, 5.0 hours, 4.0 hours, 3.0
hours, 2.5 hours, 2.0 hours, 1.5 hours, 1.0 hour, 45 minutes, or
less than 30 minutes. Minimizing time to result is critical in food
and environmental testing for pathogens.
[0128] In contrast to assays known in the art, the method of the
invention can detect individual microorganisms. Thus, in certain
embodiments, the method may detect .ltoreq.10 cells of the
microorganism (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9 microorganisms)
present in a sample. For example, in certain embodiments, the
recombinant bacteriophage is highly specific for E. coli O157:H7.
In an embodiment, the recombinant bacteriophage can distinguish E.
coli O157:H7 in the presence of more than 100 other types of
bacteria. In certain embodiments, the recombinant bacteriophage can
be used to detect a single bacterium of the specific type in the
sample. In certain embodiments, the recombinant bacteriophage
detects as few as 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50,
60, 70, 80, 90, or 100 of the specific bacteria in the sample.
[0129] Thus, aspects of the present invention provide methods for
detection of microorganisms in a test sample via an indicator
moiety. In some embodiments, where the microorganism of interest is
a bacterium, the indicator moiety may be associated with an
infectious agent such as an indicator bacteriophage. The indicator
moiety may react with a substrate to emit a detectable signal or
may emit an intrinsic signal (e.g., fluorescent protein). In some
embodiments, the detection sensitivity can reveal the presence of
as few as 50, 20, 10, 9, 8, 7, 6, 5, 4, 3, or 2 cells of the
microorganism of interest in a test sample. In some embodiments,
even a single cell of the microorganism of interest may yield a
detectable signal. In some embodiments, the bacteriophage is a
T4-like or ViI-like bacteriophage. In some embodiments, the
recombinant bacteriophage is derived from CBA120. In certain
embodiments, a CBA120 recombinant bacteriophage is highly specific
for E. coli O157:H7.
[0130] In some embodiments, the indicator moiety encoded by the
infectious agent may be detectable during or after replication of
the infectious agent. Many different types of detectable
biomolecules suitable for use as indicator moieties are known in
the art, and many are commercially available. In some embodiments
the indicator phage comprises an enzyme, which serves as the
indicator moiety. In some embodiments, the genome of the indicator
phage is modified to encode a soluble protein. In some embodiments,
the indicator phage encodes a detectable enzyme. The indicator may
emit light and/or may be detectable by a color change. Various
appropriate enzymes are commercially available, such as alkaline
phosphatase (AP), horseradish peroxidase (HRP), or luciferase
(Luc). In some embodiments, these enzymes may serve as the
indicator moiety. In some embodiments, Firefly luciferase is the
indicator moiety.
[0131] In some embodiments, Oplophorus luciferase is the indicator
moiety. In some embodiments, NANOLUC.RTM. is the indicator moiety.
Other engineered luciferases or other enzymes that generate
detectable signals may also be appropriate indicator moieties.
[0132] Thus, in some embodiments, the recombinant bacteriophage of
the methods, systems or kits is prepared from wild-type
bacteriophage CBA120. In some embodiments, the indicator gene
encodes a protein that emits an intrinsic signal, such as a
fluorescent protein (e.g., green fluorescent protein or others).
The indicator may emit light and/or may be detectable by a color
change. In some embodiments, the indicator gene encodes an enzyme
(e.g., luciferase) that interacts with a substrate to generate
signal. In some embodiments, the indicator gene is a luciferase
gene. In some embodiments, the luciferase gene is one of Oplophorus
luciferase, Firefly luciferase, Renilla luciferase, External
Gaussia luciferase, Lucia luciferase, or an engineered luciferase
such as NANOLUC.RTM., Rluc8.6-535, or Orange Nano-lantern.
[0133] Detecting the indicator may include detecting emissions of
light. In some embodiments, a luminometer may be used to detect the
reaction of indicator (e.g., luciferase) with a substrate. The
detection of RLU can be achieved with a luminometer, or other
machines or devices may also be used. For example, a
spectrophotometer, CCD camera, or CMOS camera may detect color
changes and other light emissions. Absolute RLU are important for
detection, but the signal to background ratio also needs to be high
(e.g., >2.0, >2.5, or >3.0) in order for single cells or
low numbers of cells to be detected reliably.
[0134] In some embodiments, the indicator phage is genetically
engineered to contain the gene for an enzyme, such as a luciferase,
which is only produced upon infection of bacteria that the phage
specifically recognizes and infects. In some embodiments, the
indicator moiety is expressed late in the viral life cycle. In some
embodiments, as described herein, the indicator is a soluble
protein (e.g., soluble luciferase) and is not fused with a phage
structural protein that limits its copy number.
[0135] Thus in some embodiments utilizing indicator phage, the
invention comprises a method for detecting a microorganism of
interest comprising the steps of capturing at least one sample
bacterium; incubating the at least one bacterium with a plurality
of indicator phage; allowing time for infection and replication to
generate progeny phage and express soluble indicator moiety; and
detecting the progeny phage, or preferably the indicator, wherein
detection of the indicator demonstrates that the bacterium is
present in the sample.
[0136] For example, in some embodiments the test sample bacterium
may be captured by binding to the surface of a plate, or by
filtering the sample through a bacteriological filter (e.g., 0.45
.mu.m pore size spin filter or plate filter). In an embodiment, the
infectious agent (e.g., indicator phage) is added in a minimal
volume to the captured sample directly on the filter. In an
embodiment, the microorganism captured on the filter or plate
surface is subsequently washed one or more times to remove excess
unbound infectious agent. In an embodiment, a medium (e.g.,
Luria-Bertani Broth, also called LB herein, or Tryptic Soy Broth or
Tryptone Soy Broth, also called TSB herein) may be added for
further incubation time, to allow replication of bacterial cells
and phage and high-level expression of the gene encoding the
indicator moiety. However, a surprising aspect of some embodiments
of testing assays is that the incubation step with indicator phage
only needs to be long enough for a single phage life cycle. The
amplification power of using bacteriophage was previously thought
to require more time, such that the phage would replicate for
several cycles. A single replication cycle of indicator phage can
be sufficient to facilitate sensitive and rapid detection according
to some embodiments of the present invention.
[0137] In some embodiments, aliquots of a test sample comprising
bacteria may be applied to a spin column and after infection with a
recombinant bacteriophage and an optional washing to remove any
excess bacteriophage, the amount of soluble indicator detected will
be proportional to the amount of bacteriophage that are produced by
infected bacteria.
[0138] Soluble indicator (e.g., luciferase) released into the
surrounding liquid upon lysis of the bacteria may then be measured
and quantified. In an embodiment, the solution is spun through the
filter, and the filtrate collected for assay in a new receptacle
(e.g., in a luminometer) following addition of a substrate for the
indicator enzyme (e.g., luciferase substrate). Alternatively, the
indicator signal may be measured directly on the filter.
[0139] In various embodiments, the purified parental indicator
phage does not comprise the detectable indicator itself, because
the parental phage can be purified before it is used for incubation
with a test sample. Expression of late (Class III) genes occurs
late in the viral life cycle. In some embodiments of the present
invention, parental phage may be purified to exclude any existing
indicator protein (e.g., luciferase). In some embodiments,
expression of the indicator gene during bacteriophage replication
following infection of host bacteria results in a soluble indicator
protein product. Thus, in many embodiments, it is not necessary to
separate parental from progeny phage prior to the detecting step.
In an embodiment, the microorganism is a bacterium and the
indicator phage is a bacteriophage. In an embodiment, the indicator
moiety is soluble luciferase, which is released upon lysis of the
host microorganism.
[0140] Thus, in an alternate embodiment, the indicator substrate
(e.g., luciferase substrate) may be incubated with the portion of
the sample that remains on a filter or bound to a plate surface.
Accordingly, in some embodiments the solid support is a 96-well
filter plate (or regular 96-well plate), and the substrate reaction
may be detected by placing the plate directly in the
luminometer.
[0141] For example, in an embodiment, the invention may comprise a
method for detecting E. coli O157:H7 comprising the steps of:
infecting cells captured on a 96-well filter plate with a plurality
of parental indicator phage capable of expressing luciferase upon
infection; washing excess phage away; adding LB broth and allowing
time for phage to replicate and lyse the specific E. coli target
(e.g., 30-90 minutes); and detecting the indicator luciferase by
adding luciferase substrate and measuring luciferase activity
directly in the 96-well plate, wherein detection of luciferase
activity indicates that the E. coli O157:H7 is present in the
sample.
[0142] In another embodiment, the invention may comprise a method
for detecting E. coli O157:H7 comprising the steps of: infecting
cells in liquid solution or suspension in a 96-well plate with a
plurality of parental indicator phage capable of expressing
luciferase upon infection;
[0143] allowing time for phage to replicate and lyse the specific
E. coli target (e.g., 30-120 minutes); and detecting the indicator
luciferase by adding luciferase substrate and measuring luciferase
activity directly in the 96-well plate, wherein detection of
luciferase activity indicates that the E. coli O157:H7 is present
in the sample. In such an embodiment no capturing step is
necessary. In some embodiments, the liquid solution or suspension
may be a consumable test sample, such as a vegetable wash. In some
embodiments, the liquid solution or suspension may be vegetable
wash fortified with concentrated LB Broth, Tryptic/Tryptone Soy
Broth, Peptone Water or Nutrient Broth. In some embodiments, the
liquid solution or suspension may be bacteria diluted in LB
Broth.
[0144] In some embodiments, lysis of the bacterium may occur
before, during, or after the detection step. Experiments suggest
that infected unlysed cells may be detectable upon addition of
luciferase substrate in some embodiments. Presumably, luciferase
may exit cells and/or luciferase substrate may enter cells without
complete cell lysis. Thus, for embodiments utilizing the spin
filter system, where only luciferase released into the lysate (and
not luciferase still inside intact bacteria) is analyzed in the
luminometer, lysis is required for detection. However, for
embodiments utilizing filter plates or 96-well plates with sample
in solution or suspension, where the original plate full of intact
and lysed cells is directly assayed in the luminometer, lysis is
not necessary for detection.
[0145] In some embodiments, the reaction of indicator moiety (e.g.,
luciferase) with substrate may continue for 30 minutes or more, and
detection at various time points may be desirable for optimizing
sensitivity. For example, in embodiments using 96-well filter
plates as the solid support and luciferase as the indicator,
luminometer readings may be taken initially and at 10- or 15-minute
intervals until the reaction is completed.
[0146] Surprisingly, high concentrations of phage utilized for
infecting test samples have successfully achieved detection of very
low numbers of target microorganism in a very short timeframe. The
incubation of phage with a test sample in some embodiments need
only be long enough for a single phage life cycle. In some
embodiments, the bacteriophage concentration for this incubating
step is greater than 7.times.10.sup.6, 8.times.10.sup.6,
9.times.10.sup.6, 1.0.times.10.sup.7, 1.1.times.10.sup.7,
1.2.times.10.sup.7, 1.3.times.10.sup.7, 1.4.times.10.sup.7,
1.5.times.10.sup.7, 1.6.times.10.sup.7, 1.7.times.10.sup.7,
1.8.times.10.sup.7, 1.9.times.10.sup.7, 2.0.times.10.sup.7,
3.0.times.10.sup.7, 4.0.times.10.sup.7, 5.0.times.10.sup.7,
6.0.times.10.sup.7, 7.0.times.10.sup.7, 8.0.times.10.sup.7,
9.0.times.10.sup.7, or 1.0.times.10.sup.8 PFU/mL.
[0147] Success with such high concentrations of phage is surprising
because the large numbers of phage were previously associated with
"lysis from without," which killed target cells and thereby
prevented generation of useful signal from earlier phage assays. It
is possible that the clean-up of prepared phage stocks described
herein helps to alleviate this problem (e.g., clean-up by cesium
chloride isopycnic density gradient ultracentrifugation), because
in addition to removing any contaminating luciferase associated
with the phage, this clean-up may also remove ghost particles
(particles that have lost DNA). The ghost particles can lyse
bacterial cells via "lysis from without," killing the cells
prematurely and thereby preventing generation of indicator signal.
Electron microscopy demonstrates that a crude phage lysate (i.e.,
before cesium chloride clean-up) may have greater than 50% ghosts.
These ghost particles may contribute to premature death of the
microorganism through the action of many phage particles puncturing
the cell membrane. Thus ghost particles may have contributed to
previous problems where high PFU concentrations were reported to be
detrimental. Moreover, a very clean phage prep allows the assay to
be performed with no wash steps, which makes the assay possible to
perform without an initial concentration step. Some embodiments do
include an initial concentration step, and in some embodiments this
concentration step allows a shorter enrichment incubation time.
[0148] Some embodiments of testing methods may further include
confirmatory assays. A variety of assays are known in the art for
confirming an initial result, usually at a later point in time. For
example, the samples can be cultured (e.g.,
CHROMAGAR.RTM./DYNABEADS.RTM. assay as described in Example 4), PCR
can be utilized to confirm the presence of the microbial DNA, or
other confirmatory assays can be used to confirm the initial
result.
[0149] FIGS. 7-9 demonstrate data from basic assays (e.g.,
performed as shown in FIG. 6) on samples derived from E. coli
O157:H7 cultures, using the CBA120NanoLuc Indicator Phage.
[0150] FIG. 7 demonstrates three different infecting phage
concentrations, 10.sup.5, 10.sup.6, and 10.sup.7 phage/mL. FIG. 8
uses 6-10 replicates of each indicated cell number to demonstrate
significant differences between signals from single cells as
compared to zero cells (background) or higher numbers of cells.
FIG. 9 shows that the signal to background ratio for the experiment
shown in FIG. 8 is greater than 2.0. Example 3 also describes these
experiments.
Beef Assays
[0151] Existing protocols for detection of E. coli O157:H7 in foods
are complicated, expensive, slow, labor-intensive and prone for
false positives. Detection with a recombinant bacteriophage
specific for this pathogen offers an effective, fast and simple
testing alternative.
[0152] Embodiments of beef assays include sample preparation steps.
Some embodiments can include enrichment time. For example,
enrichment for 1, 2, 3, 4, 5, 6, 7, or 8 hours may be needed,
depending on sample type and size. Following these sample
preparation steps, infection with a high concentration of
recombinant bacteriophage that expresses a reporter or indicator
can be performed in a variety of assay formats, such as that shown
in FIG. 6.
[0153] Embodiments of beef assays can detect a single pathogenic
bacterium in sample sizes corresponding to industry standards, with
a reduction in time-to-results of 20-50%, depending on the sample
type and size.
[0154] FIGS. 10-16 show data from beef assay experiments using
CBA120NanoLuc Indicator Bacteriophage, as described in Example
4.
Vegetable Wash Assays
[0155] To prepare the vegetable wash, vegetable leaves (e.g.,
spinach or lettuce) may be weighed and added to a clean plastic
bag. Liquid can be added to the vegetable wash. For example, in
some embodiments 5 mL of water are added per each gram (g) of
vegetable. Other laboratory liquids (e.g., LB) may also be used.
Leaves and solution can be mixed manually for a few minutes. Liquid
can then be extracted from the plastic bag and can be used as the
"vegetable wash." Using this method, .about.1 million "endogenous"
bacterial contaminants were found to reside on a single spinach
leaf (1-2 g).
[0156] The assay is quantitative in that the signal detected is
proportional to the amount of the bacterium of interest in the
sample. For example, known numbers of E. coli O157:H7 cells can be
added to vegetable wash samples to simulate contamination of
vegetables with pathogenic bacteria. The experiment using vegetable
wash samples described in Example 5 demonstrates marked differences
between the signal from 0 cells, 1 cell, and 7 cells per assay,
demonstrating the ability to detect single-digit cell numbers in
vegetable wash. Using more bacterial cells per assay shows
increasing signal in a dose-dependent manner. The vegetable wash
contains about 10.sup.6 non-target bacteria/mL, corresponding to at
least 10.sup.5 non-target bacteria per sample in this assay
(including the 0 cells E. coli O157:H7 control). The ability to
discern as few as a single target bacterial cell from 10.sup.5
non-target bacteria is surprising and again demonstrates the
specificity and sensitivity of the assay. FIG. 17 shows data from a
vegetable wash experiment (Example 5).
[0157] In some embodiments, the incubating step of the methods
described herein comprises a final bacteriophage concentration of
greater than 7.times.10.sup.6, 8.times.10.sup.6, 9.times.10.sup.6,
1.0.times.10.sup.7, 1.1.times.10.sup.7, 1.2.times.10.sup.7,
1.3.times.10.sup.7, 1.4.times.10.sup.7, 1.5.times.10.sup.7,
1.6.times.10.sup.7, 1.7.times.10.sup.7, 1.8.times.10.sup.7,
1.9.times.10.sup.7, 2.0.times.10.sup.7, 3.0.times.10.sup.7,
4.0.times.10.sup.7, 5.0.times.10.sup.7, 6.0.times.10.sup.7,
7.0.times.10.sup.7, 8.0.times.10.sup.7, 9.0.times.10.sup.7, or
1.0.times.10.sup.8 PFU/mL. Such high phage concentrations were
previously reported to be detrimental to such an assay, and
therefore successful use of such high concentrations generated
unexpected results. In some embodiments, the methods of the
invention require less than 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2
hours for detection of a microorganism of interest. In some
embodiments, the methods can detect as few as 100, 50, 20, 10, 9,
8, 7, 6, 5, 4, 3, or 2 cells of the bacterium of interest. These
are shorter timeframes than were previously thought possible. In
some embodiments, even a single cell of the bacterium is
detectable. In additional embodiments, the invention comprises
systems (e.g., computer systems, automated systems or kits)
comprising components for performing the methods disclosed herein,
and/or using the modified bacteriophage described herein.
Systems and Kits of the Invention
[0158] In some embodiments, the invention comprises systems (e.g.,
automated systems or kits) comprising components for performing the
methods disclosed herein. In some embodiments, indicator phage are
comprised in systems or kits according to the invention. Methods
described herein may also utilize such indicator phage systems or
kits. Some embodiments described herein are particularly suitable
for automation and/or kits, given the minimal amount of reagents
and materials required to perform the methods. In certain
embodiments, each of the components of a kit may comprise a
self-contained unit that is deliverable from a first site to a
second site.
[0159] In some embodiments, the invention comprises systems or kits
for rapid detection of a microorganism of interest in a sample. The
systems or kits may in certain embodiments comprise a component for
incubating the sample with an infectious agent specific for the
microorganism of interest, wherein the infectious agent comprises
an indicator moiety and a component for detecting the indicator
moiety. In some embodiments of both the systems and the kits of the
invention, the infectious agent is a recombinant bacteriophage that
infects the bacterium of interest, and the recombinant
bacteriophage comprises an indicator gene inserted into a late gene
region of the bacteriophage as the indicator moiety such that
expression of the indicator gene during bacteriophage replication
following infection of host bacteria results in a soluble indicator
protein product. Some systems further comprise a component for
capturing the microorganism of interest on a solid support.
[0160] In other embodiments, the invention comprises a method,
system, or kit for rapid detection of a microorganism of interest
in a sample, comprising an infectious agent component that is
specific for the microorganism of interest, wherein the infectious
agent comprises an indicator moiety, and a component for detecting
the indicator moiety. In some embodiments, the bacteriophage is a
T4-like, ViI, ViI-like, or CBA120 bacteriophage. In one embodiment,
the recombinant bacteriophage is derived from CBA120. In certain
embodiments, the recombinant bacteriophage is highly specific for a
particular bacterium. For example, in certain embodiments, the
recombinant bacteriophage is highly specific for E. coli O157:H7.
In an embodiment, the recombinant bacteriophage can distinguish E.
coli O157:H7 in the presence of more than 100 other types of
bacteria. In certain embodiments, a system or kit detects a single
bacterium of the specific type in the sample. In certain
embodiments, a system or kit detects as few as 2, 3, 4, 5, 6, 7, 8,
9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 specific bacteria
in the sample.
[0161] In certain embodiments, the systems and/or kits may further
comprise a component for washing the captured microorganism sample.
Additionally or alternatively, the systems and/or kits may further
comprise a component for determining amount of the indicator
moiety, wherein the amount of indicator moiety detected corresponds
to the amount of microorganism in the sample. For example, in
certain embodiments, the system or kit may comprise a luminometer
or other device for measuring a luciferase enzyme activity.
[0162] In some systems and/or kits, the same component may be used
for multiple steps. In some systems and/or kits, the steps are
automated or controlled by the user via computer input and/or
wherein a liquid-handling robot performs at least one step.
[0163] Thus in certain embodiments, the invention may comprise a
system or kit for rapid detection of a microorganism of interest in
a sample, comprising: a component for incubating the sample with an
infectious agent specific for the microorganism of interest,
wherein the infectious agent comprises an indicator moiety; a
component for capturing the microorganism from the sample on a
solid support; a component for washing the captured microorganism
sample to remove unbound infectious agent; and a component for
detecting the indicator moiety. In some embodiments, the same
component may be used for steps of capturing and/or incubating
and/or washing (e.g., a filter component). Some embodiments
additionally comprise a component for determining amount of the
microorganism of interest in the sample, wherein the amount of
indicator moiety detected corresponds to the amount of
microorganism in the sample. Such systems can include various
embodiments and subembodiments analogous to those described above
for methods of rapid detection of microorganisms. In an embodiment,
the microorganism is a bacterium and the infectious agent is a
bacteriophage. In a computerized system, the system may be fully
automated, semi-automated, or directed by the user through a
computer (or some combination thereof).
[0164] In some embodiments, the system may comprise a component for
isolating the microorganism of interest from the other components
in the sample.
[0165] In an embodiment, the invention comprises a system or kit
comprising components for detecting a microorganism of interest
comprising: a component for isolating at least one microorganism
from other components in the sample; a component for infecting the
at least one microorganism with a plurality of a parental
infectious agent; a component for lysing the at least one infected
microorganism to release progeny infectious agents present in the
microorganism; and a component for detecting the progeny infectious
agents, or with greater sensitivity, a soluble protein encoded and
expressed by the infectious agent, wherein detection of the
infectious agent or a soluble protein product of the infectious
agent indicates that the microorganism is present in the sample.
The infectious agent may comprise CBA120NanoLuc.
[0166] The systems or kits may comprise a variety of components for
detection of progeny infectious agents. For example, in an
embodiment, the progeny infectious agent (e.g., bacteriophage) may
comprise an indicator moiety. In an embodiment, the indicator
moiety in the progeny infectious agent (e.g., bacteriophage) may be
a detectable moiety that is expressed during replication, such as a
soluble luciferase protein.
[0167] In other embodiments, the invention may comprise a kit for
rapid detection of a microorganism of interest in a sample, the
system comprising: a component for incubating the sample with an
infectious agent specific for the microorganism of interest,
wherein the infectious agent comprises an indicator moiety; a
component for capturing the microorganism from the sample on a
solid support; a component for washing the captured microorganism
sample to remove unbound infectious agent; and a component for
detecting the indicator moiety. In some embodiments, the same
component may be used for steps of capturing and/or incubating
and/or washing. Some embodiments additionally comprise a component
for determining amount of the microorganism of interest in the
sample, wherein the amount of indicator moiety detected corresponds
to the amount of microorganism in the sample. Such kits can include
various embodiments and subembodiments analogous to those described
above for methods of rapid detection of microorganisms. In an
embodiment, the microorganism is a bacterium and the infectious
agent is a bacteriophage.
[0168] In some embodiments, a kit may comprise a component for
isolating the microorganism of interest from the other components
in the sample.
[0169] These systems and kits of the invention include various
components. As used herein, the term "component" is broadly defined
and includes any suitable apparatus or collections of apparatuses
suitable for carrying out the recited method. The components need
not be integrally connected or situated with respect to each other
in any particular way. The invention includes any suitable
arrangements of the components with respect to each other. For
example, the components need not be in the same room. But in some
embodiments, the components are connected to each other in an
integral unit. In some embodiments, the same components may perform
multiple functions.
Computer Systems and Computer Readable Media
[0170] The system, as described in the present technique or any of
its components, may be embodied in the form of a computer system.
Typical examples of a computer system include a general-purpose
computer, a programmed microprocessor, a microcontroller, a
peripheral integrated circuit element, and other devices or
arrangements of devices that are capable of implementing the steps
that constitute the method of the present technique.
[0171] A computer system may comprise a computer, an input device,
a display unit, and/or the Internet. The computer may further
comprise a microprocessor. The microprocessor may be connected to a
communication bus. The computer may also include a memory. The
memory may include random access memory (RAM) and read only memory
(ROM). The computer system may further comprise a storage device.
The storage device can be a hard disk drive or a removable storage
drive such as a floppy disk drive, optical disk drive, etc. The
storage device can also be other similar means for loading computer
programs or other instructions into the computer system. The
computer system may also include a communication unit. The
communication unit allows the computer to connect to other
databases and the Internet through an I/O interface. The
communication unit allows the transfer to, as well as reception of
data from, other databases. The communication unit may include a
modem, an Ethernet card, or any similar device which enables the
computer system to connect to databases and networks such as LAN,
MAN, WAN and the Internet. The computer system thus may facilitate
inputs from a user through input device, accessible to the system
through I/O interface.
[0172] A computing device typically will include an operating
system that provides executable program instructions for the
general administration and operation of that computing device, and
typically will include a computer-readable storage medium (e.g., a
hard disk, random access memory, read only memory, etc.) storing
instructions that, when executed by a processor of the server,
allow the computing device to perform its intended functions.
Suitable implementations for the operating system and general
functionality of the computing device are known or commercially
available, and are readily implemented by persons having ordinary
skill in the art, particularly in light of the disclosure
herein.
[0173] The computer system executes a set of instructions that are
stored in one or more storage elements, in order to process input
data. The storage elements may also hold data or other information
as desired. The storage element may be in the form of an
information source or a physical memory element present in the
processing machine.
[0174] The environment can include a variety of data stores and
other memory and storage media as discussed above. These can reside
in a variety of locations, such as on a storage medium local to
(and/or resident in) one or more of the computers or remote from
any or all of the computers across the network. In a particular set
of embodiments, the information may reside in a storage-area
network ("SAN") familiar to those skilled in the art. Similarly,
any necessary files for performing the functions attributed to the
computers, servers, or other network devices may be stored locally
and/or remotely, as appropriate. Where a system includes computing
devices, each such device can include hardware elements that may be
electrically coupled via a bus, the elements including, for
example, at least one central processing unit (CPU), at least one
input device (e.g., a mouse, keyboard, controller, touch screen, or
keypad), and at least one output device (e.g., a display device,
printer, or speaker). Such a system may also include one or more
storage devices, such as disk drives, optical storage devices, and
solid-state storage devices such as random access memory ("RAM") or
read-only memory ("ROM"), as well as removable media devices,
memory cards, flash cards, etc.
[0175] Such devices also can include a computer-readable storage
media reader, a communications device (e.g., a modem, a network
card (wireless or wired), an infrared communication device, etc.),
and working memory as described above. The computer-readable
storage media reader can be connected with, or configured to
receive, a computer-readable storage medium, representing remote,
local, fixed, and/or removable storage devices as well as storage
media for temporarily and/or more permanently containing, storing,
transmitting, and retrieving computer-readable information. The
system and various devices also typically will include a number of
software applications, modules, services, or other elements located
within at least one working memory device, including an operating
system and application programs, such as a client application or
Web browser. It should be appreciated that alternate embodiments
may have numerous variations from that described above. For
example, customized hardware might also be used and/or particular
elements might be implemented in hardware, software (including
portable software, such as applets), or both. Further, connection
to other computing devices such as network input/output devices may
be employed.
[0176] Non-transient storage media and computer readable media for
containing code, or portions of code, can include any appropriate
media known or used in the art, including storage media and
communication media, such as but not limited to volatile and
non-volatile, removable and non-removable media implemented in any
method or technology for storage and/or transmission of information
such as computer readable instructions, data structures, program
modules, or other data, including RAM, ROM, EEPROM, flash memory or
other memory technology, CD-ROM, digital versatile disk (DVD) or
other optical storage, magnetic cassettes, magnetic tape, magnetic
disk storage or other magnetic storage devices, or any other medium
which can be used to store the desired information and which can be
accessed by the a system device. Based on the disclosure and
teachings provided herein, a person of ordinary skill in the art
will appreciate other ways and/or methods to implement the various
embodiments.
[0177] A computer-readable medium may comprise, but is not limited
to, an electronic, optical, magnetic, or other storage device
capable of providing a processor with computer-readable
instructions. Other examples include, but are not limited to, a
floppy disk, CD-ROM, DVD, magnetic disk, memory chip, ROM, RAM,
SRAM, DRAM, content-addressable memory ("CAM"), DDR, flash memory
such as NAND flash or NOR flash, an ASIC, a configured processor,
optical storage, magnetic tape or other magnetic storage, or any
other medium from which a computer processor can read instructions.
In one embodiment, the computing device may comprise a single type
of computer-readable medium such as random access memory (RAM). In
other embodiments, the computing device may comprise two or more
types of computer-readable medium such as random access memory
(RAM), a disk drive, and cache. The computing device may be in
communication with one or more external computer-readable mediums
such as an external hard disk drive or an external DVD or Blu-Ray
drive.
[0178] As discussed above, the embodiment comprises a processor
which is configured to execute computer-executable program
instructions and/or to access information stored in memory. The
instructions may comprise processor-specific instructions generated
by a compiler and/or an interpreter from code written in any
suitable computer-programming language including, for example, C,
C++, C#, Visual Basic, Java, Python, Perl, JavaScript, and
ActionScript (Adobe Systems, Mountain View, Calif.). In an
embodiment, the computing device comprises a single processor. In
other embodiments, the device comprises two or more processors.
Such processors may comprise a microprocessor, a digital signal
processor (DSP), an application-specific integrated circuit (ASIC),
field programmable gate arrays (FPGAs), and state machines. Such
processors may further comprise programmable electronic devices
such as PLCs, programmable interrupt controllers (PICs),
programmable logic devices (PLDs), programmable read-only memories
(PROMs), electronically programmable read-only memories (EPROMs or
EEPROMs), or other similar devices.
[0179] The computing device comprises a network interface. In some
embodiments, the network interface is configured for communicating
via wired or wireless communication links. For example, the network
interface may allow for communication over networks via Ethernet,
IEEE 802.11 (Wi-Fi), 802.16 (Wi-Max), Bluetooth, infrared, etc. As
another example, network interface may allow for communication over
networks such as CDMA, GSM, UMTS, or other cellular communication
networks. In some embodiments, the network interface may allow for
point-to-point connections with another device, such as via the
Universal Serial Bus (USB), 1394 FireWire, serial or parallel
connections, or similar interfaces. Some embodiments of suitable
computing devices may comprise two or more network interfaces for
communication over one or more networks. In some embodiments, the
computing device may include a data store in addition to or in
place of a network interface.
[0180] Some embodiments of suitable computing devices may comprise
or be in communication with a number of external or internal
devices such as a mouse, a CD-ROM, DVD, a keyboard, a display,
audio speakers, one or more microphones, or any other input or
output devices. For example, the computing device may be in
communication with various user interface devices and a display.
The display may use any suitable technology including, but not
limited to, LCD, LED, CRT, and the like.
[0181] The set of instructions for execution by the computer system
may include various commands that instruct the processing machine
to perform specific tasks such as the steps that constitute the
method of the present technique. The set of instructions may be in
the form of a software program. Further, the software may be in the
form of a collection of separate programs, a program module with a
larger program or a portion of a program module, as in the present
technique. The software may also include modular programming in the
form of object-oriented programming. The processing of input data
by the processing machine may be in response to user commands,
results of previous processing, or a request made by another
processing machine.
[0182] While the present invention has been disclosed with
references to certain embodiments, numerous modifications,
alterations and changes to the described embodiments are possible
without departing from the scope and spirit of the present
invention, as defined in the appended claims. Accordingly, it is
intended that the present invention not be limited to the described
embodiments, but that it have the full scope defined by the
language of the following claims, and equivalents thereof.
EXAMPLES
[0183] Results depicted in the following examples demonstrate
detection of a low number of cells, even a single bacterium, in a
shortened time to results.
Example 1
Creation of Indicator Phage from CBA120
[0184] Indicator Phage CBA120NanoLuc was created through homologous
recombination using the following detailed procedures, as
illustrated in FIGS. 1-3.
[0185] The genomic sequence of the CBA120 bacteriophage was
available on the National Center for Biotechnology Information's
GenBank, filed under "Escherichia phage Cba120," ID 12291. The
genome was fully annotated, though most of the genes were labeled
as "hypothetical protein," denoting that automated Open Reading
Frame discover was used. Hypothetical proteins need only have a
start and stop codon, and may not be expressed, as DNA regulation
(promoters/enhancers/operators, etc.) are not defined in the
sequence.
[0186] The late gene region was determined by comparison with other
phage genomes. CBA120, and all other ViI-like phage, fall under the
ViI-like phage group (genus ViI virus or Vi1 virus), which are
related to T4-like phages. Bacteriophage T4 being the most studied
bacteriophage, many of the genes homologs could be found, and were
labeled as such. This includes the late gene region, which consists
of the highly expressed phage structural proteins. This region was
targeted for insertion of the NANOLUC.RTM. reporter gene. The major
capsid protein was specifically identified. As the major capsid
protein typically has the highest expression, inserting the
reporter directly downstream of the major capsid protein can
maximize expression of the reporter.
[0187] A sequence was designed to insert a codon-optimized
NANOLUC.RTM. gene downstream of the major capsid protein. As
illustrated in FIG. 2, a homologous recombination (HR) plasmid was
designed, initially with 500 bp upstream and downstream of the
insert point. Previous HR plasmids using Firefly Luciferase as a
reporter gave poor transformation, which was alleviated by using a
shorter downstream region. Presumably, there was a toxic effect
with the full 500 bp region selected against in the bacteria. As
such, the modified downstream region extends only about 300 bp.
[0188] The upstream region consisted of the 3' end of the major
capsid protein, with the insert occurring immediately after the
stop codon (TAA): SEQ ID NO: 1
TABLE-US-00001 ctttcatgctggaagttgaagcgaacggtatcggtgttgacacccgtcg
tggtaaaggcaaccgtgttctgtgttctccgaacgtggcatccgctctg
gcgatgtctggcatgctggactatgctccggttctgcaggaaaacacta
aactggctgttgacccgactggccagaccttcgctggtgttctgtccaa
cggtatgcgcgtctatgttgacccgtatgctgtagcagaatatatcacc
ctggcatacaaaggcgcaactgcgctggatgccggtatcttcttcgcgc
cgtatgtgccgctggaaatgtaccgcacccagggtgaaaccaccttcgc
tccgcgtatggcgttcaaaacccgttacggcatctgtgctaacccgttc
gtacagattccggctaaccaagacccgcaggtttacgtgactgctgacg
gtattgctcaagacagcaacccgtatttccgcaaaggtctgatcaaatc tctgttctaa
[0189] This was followed by an MluI restriction site, then a T4
late gene promoter consensus sequence, which consists of the -10
.sigma..sup.70 factor consensus binding sequence (CTAAATAcCcc (SEQ
ID NO: 2)). This promoter was designed based on compositing known
-10 sequences. 14 random base pairs later, the ribosomal entry
site, the Shine-Dalgarno consensus sequence (aaggaggt) was
inserted, followed by 6 more random base pairs. The random base
pairs were chosen to keep a similar GC content to other upstream
untranslated regions. SEQ ID NO: 3
TABLE-US-00002 acgcgtCTAAATAcCccaaatactagtagataaggaggttttcga
[0190] A codon-optimized version of Promega's NANOLUC.RTM. with
excretion signal, from pNL1.3 was inserted. SEQ ID NO: 4
TABLE-US-00003 ATGAATAGCTTTAGCACCAGCGCCTTTGGCCCTGTTGCCTTTAGCCTGG
GCCTGCTGCTGGTTCTGCCGGCAGCATTTCCGGCCCCGGTGTTCACCCT
GGAAGATTTTGTGGGCGATTGGCGCCAGACCGCCGGTTATAACCTGGAT
CAGGTGCTGGAACAGGGTGGTGTGAGCAGCCTGTTTCAGAATCTGGGCG
TGAGCGTGACCCCGATTCAGCGCATTGTGCTGAGCGGCGAGAACGGCCT
GAAAATTGATATTCATGTTATTATTCCGTATGAGGGTCTGAGCGGCGAT
CAGATGGGCCAGATTGAAAAAATCTTTAAGGTGGTGTATCCGGTGGACG
ACCATCATTTCAAGGTGATCCTGCATTACGGCACACTGGTGATTGACGG
CGTTACCCCGAACATGATCGACTATTTCGGCCGCCCGTATGAAGGTATC
GCCGTGTTCGACGGCAAGAAAATTACCGTGACCGGTACCCTGTGGAACG
GCAACAAGATCATTGACGAGCGCCTGATTAACCCGGATGGTAGCCTGCT
GTTTCGCGTGACCATTAATGGCGTGACCGGCTGGCGTCTGTGTGAACGC ATCCTGGCCTAA
[0191] This was followed by 298 bp of the downstream HR segment,
which includes a hypothetical gene. SEQ ID NO: 5
TABLE-US-00004 gcgacaggttttgataacaaaccccgcttcggcggggtttttctttata
gggatatgtaagataataaagcctcatttatcaaaggaggttaaaatgt
ctcatcaattatctggcggtgcagtcgatactctattcgttcttttctg
gtttggacctcgtgaagctggggaaatacctgctaaatctggagaagcc
gaattggcctccctggggttttgtaaacgagttgatgttaaaaacgtac
caaaaggtcgagatacacatctgtgtgtactcaccgaggaaggttacaa atac
[0192] Following this, a consensus transcription terminator was
inserted along with stop codons, which should only function on the
plasmid to reduce any read through and possible toxic effects. As
homologous recombination occurs only at the HR regions, the
transcriptional terminator shouldn't be included in the recombinant
phage. SEQ ID NO: 6
TABLE-US-00005 taaTTTGATAACAAACCCCGCTTCGGCGGGGTTTTTCTTTATAGG
[0193] The full sequence was synthesized into a plasmid (GeneWiz).
The plasmid was transformed into previously prepared E. coli
O157:H7 electroporation competent cells using the protocol included
in the Bio-Rad MicroPulser Electroporation Apparatus Operating
Instructions and Applications Guide (catalog # 165-2100).
[0194] Synthesized plasmid DNA (pUC57.CBA.HR.NanoLuc) (4 .mu.g
plasmid DNA) was dissolved in autoclaved filtered deionized water
(40 .mu.L) to make a 100 ng/.mu.L stock. This plasmid (1 .mu.L) was
mixed with 20 .mu.L thawed (on ice) E. coli O157:H7 electroporation
competent cells (derived from non-toxic E. coli O157:H7 bacteria,
ATCC 43888). The cell+DNA mix was transferred to an ice-cold
Bio-Rad 0.1 cm electroporation cuvette, and subjected to the
MicroPulser Electroporation Apparatus using program Ec1. The mix
was immediately transferred into 1 mL Recovery Medium (Life
Technologies), and incubated for 1 hour at 42.degree. C., 220
rpm.
[0195] Aliquots of 1 .mu.L, 100 .mu.L, and the remainder of the
culture concentrated by centrifugation (2 min@6800g) and
resuspended in 100 .mu.L were plated onto selective medium (LB+Amp
agar plates from Teknova) and incubated overnight at 37.degree.
C.
[0196] The next day, 23 colonies (+1 negative control) were
screened by inoculating 100 LB+Amp and incubating for 2.5 hours at
37.degree. C., then screened for luciferase activity. 5 .mu.L of
each culture were subjected to Promega NANO-GLO.RTM. luciferase
assay, and read on a Promega GLOMAX.RTM. 96 luminometer. All 23
colonies were positive.
[0197] The top 3 wells were mixed and inoculated into 4 mL LB+Amp
and grown to 1.8.times.10.sup.7 cells/mL. Bacteria were infected
with wild-type CBA120 bacteriophage from the Kutter lab (see Kutter
et al., Virology Journal 2011, 8:430) at an MOI of 0.1, and the
homologous recombination infection was incubated for 3
hours@37.degree. C.
[0198] Bacterial concentration was monitored for 4 hours; bacteria
doubled by 2 hours, then began to drop, indicating a successful
phage infection.
Example 2
Isolation of CBA120NanoLuc
[0199] Following homologous recombination to generate recombinant
bacteriophage genomes, a series of titer and enrichment steps was
used to isolate a specific recombinant bacteriophage that expresses
NANOLUC.RTM..
[0200] To reduce background NANOLUC.RTM. signal from plasmid
expression, the lysate was washed 3 times with TMS in an Amicon
Ultra Concentrator, spun to concentrate the volume from 4 mL to 500
TMS was added to bring the volume to 4 mL, and this series was
repeated.
[0201] In order to determine the initial ratio of recombinant to
wild-type phage, limiting dilution assays based on the TCID50
(tissue culture infectious dose 50%) were used to both determine
the concentration of infectious units (IU/mL), akin to number of
virus particles or plaque forming units, and to determine the
number of luciferase transducing units (TU/mL). In these assays,
the sample was serially diluted, with each dilution aliquoted into
replicate wells with E. coli O157:H7 bacteria. Any wells that
showed luciferase activity must have been infected with at least
one recombinant phage. Any wells that showed cell lysis had been
infected by at least one phage. Based on the highest dilution where
each of these cases occurred, the original concentrations were
back-calculated. These initial phage mixtures from transformed
cells typically yielded a ratio of 20,000 wild-type IU for each
recombinant phage TU. Steps were then taken to isolate and amplify
the recombinant phage.
[0202] As illustrated in FIG. 4, in some experiments recombinant
phage were isolated from a mixture comprising 0.83% of total phage.
The phage mixtures were diluted into 96 well plates to give an
average of 3 recombinant TU per plate, which corresponds to about
3.8 infectious units (IU) of mostly wild-type phage per well.
Bacteria were added such that each well contained 50 of turbid E.
coli O157:H7. After 2 hours of incubation at 37.degree. C., wells
were sampled and screened for the presence of luciferase. Any
positive wells are likely to have been inoculated with a single
recombinant phage, and at this stage the mixture contained an
enriched ratio of 1 recombinant phage: 3.8 wild-type phage, which
is an enrichment over the original 1:120 ratio. Of 96 wells
screened, 7 were positive. Further rounds of limiting dilution
assay were not necessary in this experiment.
[0203] A plaque assay was performed, wherein plaques were
individually picked and screened for luciferase transducing
ability, insuring about 3 recombinants were in the mix of plaques
being screened. Each plaque was suspended in 100 .mu.L TMS, and
5.mu.L was added to a well containing a turbid E. coli O157:H7
culture, and wells were assayed after incubation for 45 minutes to
1 hour at 37.degree. C.
[0204] Positive wells were expected to contain a pure culture of
recombinant phage, but an additional round of plaque purification
was performed. Finally, large-scale production was performed to
obtain high titer stocks appropriate for use in the E. coli O157:H7
detection assay. Cesium chloride isopycnic density gradient
centrifugation was used to separate phage particles from
contaminating luciferase protein to reduce background.
Example 3
Bacterial Detection Using CBA120NanoLuc Indicator Phage
[0205] Detection of E. coli O157:H7 using the CBA120NanoLuc
Indicator Phage was tested in experiments using the basic assay
format depicted in FIG. 6. First, cell numbers ranging from
1-10,000 were taken from cultures and infected with 10.sup.5,
10.sup.6, and 10.sup.7 phage/mL in identical sample volumes of LB
for 2 hours. Following the addition of lysis buffer and
NANO-GLO.RTM. reagent, the reaction was read using a GLOMAX.RTM. 96
instrument. FIG. 7 shows that the highest ratio of
signal/background was achieved with 10.sup.6 phage/mL used for
infecting the sample.
[0206] FIG. 8 shows the data from 6-10 replicates, each using the
same cell numbers from cell cultures in LB. A phage concentration
of 10.sup.6 phage/mL was used for infecting the sample, and
infected cells were incubated for 2 hours at 37.degree. C.
Following the addition of lysis buffer and NANO-GLO.RTM. reagent,
the reaction was read using a GLOMAX.RTM. 96 instrument. FIG. 8
shows that CBA120NanoLuc can detect a single (1) cell with a signal
that is significantly higher than background.
[0207] FIG. 9 shows from the data of FIG. 8 that CBA120NanoLuc can
detect a single (1) E. coli O157:H7 cell with a signal to
background ratio of >2.0.
[0208] The performance of CBA120NanoLuc indicator phage for
detecting E. coli O157:H7 was also certified Aug. 1, 2016 by the
AOAC Research Institute (Certificate No. 081601).
Example 4
Bacterial Detection in Beef Assays Using CBA120NanoLuc
[0209] CBA120NanoLuc was used to detect E. coli O157:H7 in beef
assays. For all of the beef experiments, 50 RLU was used as the
background value, and 3 times background value was considered
positive (i.e., >150 RLU is positive, or Signal/Background
>3.0). There were no false positives or negatives when compared
to the secondary confirmation method described below.
[0210] For 25 g beef samples, pre-warmed TSB medium (42.degree. C.)
was added to the sample to 1:3 sample:medium (25g:75mL). The sample
was blended with a Stomacher for 30 seconds on low setting/or
equivalent, followed by incubation at 42.degree. C. without
shaking. The bag was closed by folding over the top 2-3 times and
clipping closed. After 5 hours (for 10 mL aliquots in the next
step) or 6 hours (for 1 mL aliquots in the next step) of enrichment
at 42.degree. C., the bag was gently massaged to thoroughly mix the
contents.
[0211] An aliquot of either 1 mL or 10 mL was removed from the bag
for testing. These correspond to the "1 mL concentration" or "10 mL
concentration" in the data presented for all beef assay experiments
in FIGS. 10-16.
[0212] Aliquots of 10 mL were centrifuged at 3400g for 5 minutes,
the supernatant was discarded, and the contents were resuspended in
1 mL pre-warmed TSB. The CBA120 Indicator Phage was added to infect
any target bacteria in the sample by adding 10 .mu.L of
1.times.10.sup.8 phage/mL.
[0213] Aliquots of 1 mL were centrifuged for 1 minute at the
highest speed in a microfuge, the supernatant was discarded, and
the contents were resuspended in 200 .mu.L pre-warmed TSB. To
infect target bacteria, 15 .mu.L of 1.2.times.10.sup.7 phage/mL of
the CBA120 Indicator Phage was added.
[0214] Samples with CBA120 Indicator Phage were incubated for 2
hours at 37.degree. C., vortexed briefly, centrifuged for 5-10
seconds to pellet debris, and 150 .mu.L sample was transferred to a
96-well plate (being careful not to disturb debris pellet). Lysis
buffer (10 .mu.L) was added to each well and gently mixed by
pipetting. Freshly prepared NANO-GLO.RTM. reagent (50 .mu.L) was
added to each well and gently mixed by pipetting (or automatically
injected). (NANO-GLO.RTM. reagent was prepared diluting the
NANO-GLO.RTM. Luciferase Assay Substrate 1:50 into NANO-GLO.RTM.
Luciferase Assay Buffer, e.g., to make 1 mL of NANO-GLO.RTM.
reagent, and 20 .mu.L of NANO-GLO.RTM. Luciferase Assay Substrate
was added to 1 mL of NANO-GLO.RTM. Luciferase Assay Buffer.)
[0215] The plate was read on a GLOMAX.RTM. 96 instrument 3 minutes
after substrate addition.
Secondary Confirmation Method:
[0216] Confirmation of E. coli O157:H7 was performed on
overnight-enriched cultures using immuno-magnetic separation (IMS)
with particles coated with 0157 antibodies (DYNABEADS.RTM., Life
Technologies #71004) and plating onto selective plates
(CHROMAGAR.RTM. plates, BD #214984).
[0217] To prepare for the confirmation, the samples were incubated
overnight (18-24 hours total or 13-19 additional hours) at
42.degree. C. .+-.1.degree. . From the overnight culture, 1 mL was
removed and the DYNABEADS.RTM. anti-E. coli O157 procedure was
followed. Briefly, 20 .mu.L of IMS particles were added to the
diluted overnight culture and incubated for 10 minutes at room
temperature. Magnetic particles were isolated for 3 minutes with
the magnet, then washed 3 times with PBS, 1 ml per wash. After the
final wash, particles were plated onto CHROMAGAR.RTM. plates (BD
#214984) and incubated 18-24 hours at 37.degree.
C..+-.1.degree..
[0218] Mauve-colored colonies (presumptive positive) were cultured
in TSB media overnight (18-24 hours) at 37.degree. C..+-.1.degree.
for serological confirmation. Presence of 0157 and H7 antigens was
determined using an agglutination assay (Remel Wellcolex E. coli
O157:H7 #R30959601). The manufacturer's instructions were followed,
using 40 .mu.L of the overnight culture. Results confirmed presence
or absence of O157 and/or H7 antigens and provided confirmation for
E. coli O157:H7.
[0219] Data from 25 g beef samples are shown in FIGS. 10-12. FIGS.
10-11 correspond to the 1 mL concentration and FIG. 12 to the 10 mL
concentration of enriched samples. All positives were detected
after 6 hours enrichment for the 1 mL concentration and after 5
hours enrichment for the 10 mL concentration. FIGS. 11-12 show
confirmation by DYNABEADS.RTM./CHROMAGAR.RTM. plating.
[0220] For larger (125 g) beef samples, experiments were performed
with both ground beef and beef trim. The procedure was similar,
except that beef trim samples required treatment with the stomacher
for at least 120 seconds on high setting/or equivalent. Enrichment
for either sample type followed for 8 hours at 42.degree. C., and
the rest of the procedure was as described above.
[0221] Data from 125 g beef samples are shown in FIGS. 13-16. FIGS.
13 and 15 correspond to the 1 mL concentration and FIGS. 14 and 16
correspond to the 10 mL concentration. FIGS. 15-16 show
confirmation by DYNABEADS.RTM./CHROMAGAR.RTM. plating. All
positives were detected after 7 hours of enrichment.
Example 5
Vegetable Wash Assays
[0222] Data from spinach wash filter assays are shown in FIG. 17,
which shows that the assay can detect 1 cell of E. coli O157:H7 in
100 mL of spinach wash following 3 hours of enrichment. These
results were confirmed by using the DYNABEADS.RTM./CHROMAGAR.RTM.
tests on overnight cultures of each sample according to the
manufacturer's instructions, as described in the "Secondary
Confirmation Method" above.
[0223] To prepare the vegetable wash, vegetable leaves (e.g.,
spinach or lettuce) were weighed and added to a clean plastic bag.
Five mL of water was added per each gram (g) of vegetable. Leaves
and solution were mixed manually for a few minutes. Liquid was then
extracted from the plastic bag and used as the "vegetable wash."
Using this method, .about.1 million bacteria were found by CFU to
reside on a single spinach leaf (1-2 g).
[0224] Next, 100 mL of "vegetable wash" was vacuum filtered through
a 47 mm 0.45 .mu.M filter. The filter was removed and placed in a
small sealable plastic bag. Prewarmed (42.degree. C.) TSB medium
(600 .mu.L) was added to the bag to cover the filter. The filter
was then incubated at 42.degree. C. for 3 hours with gentle
agitation. An aliquot of enriched media (300 .mu.L) was removed for
confirmation purposes. CBA120NanoLuc Indicator Bacteriophage was
then added to the remaining medium in the bag to a final
concentration of 1.times.10.sup.6 phage/mL, and the bag was
agitated gently followed by incubation for 2 hours at 37.degree. C.
Finally, 100-150 .mu.L of the infection reaction was transferred to
a 96-well plate. Lysis buffer (10 .mu.L) and prepared NANO-GLO.RTM.
reagent (50 .mu.L) were added and the sample was read on a
luminometer (GLOMAX.RTM. 96).
[0225] FIG. 17 shows data from a spinach wash assay, including
confirmatory results from DYNABEADS.RTM./CHROMAGAR.RTM. plating.
The ability to discern a single target bacterial cell from 10.sup.5
non-target bacteria in vegetable wash is surprising and again
demonstrates the specificity and sensitivity of the assay.
Sequence CWU 1
1
61500DNAgenus ViI virus 1ctttcatgct ggaagttgaa gcgaacggta
tcggtgttga cacccgtcgt ggtaaaggca 60accgtgttct gtgttctccg aacgtggcat
ccgctctggc gatgtctggc atgctggact 120atgctccggt tctgcaggaa
aacactaaac tggctgttga cccgactggc cagaccttcg 180ctggtgttct
gtccaacggt atgcgcgtct atgttgaccc gtatgctgta gcagaatata
240tcaccctggc atacaaaggc gcaactgcgc tggatgccgg tatcttcttc
gcgccgtatg 300tgccgctgga aatgtaccgc acccagggtg aaaccacctt
cgctccgcgt atggcgttca 360aaacccgtta cggcatctgt gctaacccgt
tcgtacagat tccggctaac caagacccgc 420aggtttacgt gactgctgac
ggtattgctc aagacagcaa cccgtatttc cgcaaaggtc 480tgatcaaatc
tctgttctaa 500211DNAArtificial Sequencesynthetic consensus binding
sequence 2ctaaataccc c 11345DNAArtificial Sequencesynthetic
bacteriophage nucleotide sequence 3acgcgtctaa ataccccaaa tactagtaga
taaggaggtt ttcga 454600DNAArtificial Sequencesynethetic
bacteriophage nucleotide sequence 4atgaatagct ttagcaccag cgcctttggc
cctgttgcct ttagcctggg cctgctgctg 60gttctgccgg cagcatttcc ggccccggtg
ttcaccctgg aagattttgt gggcgattgg 120cgccagaccg ccggttataa
cctggatcag gtgctggaac agggtggtgt gagcagcctg 180tttcagaatc
tgggcgtgag cgtgaccccg attcagcgca ttgtgctgag cggcgagaac
240ggcctgaaaa ttgatattca tgttattatt ccgtatgagg gtctgagcgg
cgatcagatg 300ggccagattg aaaaaatctt taaggtggtg tatccggtgg
acgaccatca tttcaaggtg 360atcctgcatt acggcacact ggtgattgac
ggcgttaccc cgaacatgat cgactatttc 420ggccgcccgt atgaaggtat
cgccgtgttc gacggcaaga aaattaccgt gaccggtacc 480ctgtggaacg
gcaacaagat cattgacgag cgcctgatta acccggatgg tagcctgctg
540tttcgcgtga ccattaatgg cgtgaccggc tggcgtctgt gtgaacgcat
cctggcctaa 6005298DNAArtificial Sequencesynethetic bacteriophage
nucleotide sequence 5gcgacaggtt ttgataacaa accccgcttc ggcggggttt
ttctttatag ggatatgtaa 60gataataaag cctcatttat caaaggaggt taaaatgtct
catcaattat ctggcggtgc 120agtcgatact ctattcgttc ttttctggtt
tggacctcgt gaagctgggg aaatacctgc 180taaatctgga gaagccgaat
tggcctccct ggggttttgt aaacgagttg atgttaaaaa 240cgtaccaaaa
ggtcgagata cacatctgtg tgtactcacc gaggaaggtt acaaatac
298645DNAArtificial Sequencesynethetic bacteriophage nucleotide
sequence 6taatttgata acaaaccccg cttcggcggg gtttttcttt atagg 45
* * * * *