U.S. patent application number 17/209398 was filed with the patent office on 2021-07-08 for nucleotide analogs.
The applicant listed for this patent is ABBOTT MOLECULAR INC.. Invention is credited to Dae Hyun Kim.
Application Number | 20210207192 17/209398 |
Document ID | / |
Family ID | 1000005476143 |
Filed Date | 2021-07-08 |
United States Patent
Application |
20210207192 |
Kind Code |
A1 |
Kim; Dae Hyun |
July 8, 2021 |
NUCLEOTIDE ANALOGS
Abstract
Provided herein is technology relating to the manipulation and
detection of nucleic acids, including but not limited to
compositions, methods, and kits related to nucleotides comprising a
chemically reactive linking moiety.
Inventors: |
Kim; Dae Hyun; (Northbrook,
IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ABBOTT MOLECULAR INC. |
Des Plaines |
IL |
US |
|
|
Family ID: |
1000005476143 |
Appl. No.: |
17/209398 |
Filed: |
March 23, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16752865 |
Jan 27, 2020 |
10995363 |
|
|
17209398 |
|
|
|
|
15944553 |
Apr 3, 2018 |
10577646 |
|
|
16752865 |
|
|
|
|
14463412 |
Aug 19, 2014 |
9932623 |
|
|
15944553 |
|
|
|
|
61867202 |
Aug 19, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07H 19/10 20130101;
C12N 15/1065 20130101; C07H 21/04 20130101; C12N 15/1093 20130101;
C12Q 1/6869 20130101; C12Q 1/6806 20130101; C07H 19/20
20130101 |
International
Class: |
C12Q 1/6806 20060101
C12Q001/6806; C12N 15/10 20060101 C12N015/10; C07H 19/20 20060101
C07H019/20; C07H 19/10 20060101 C07H019/10; C07H 21/04 20060101
C07H021/04; C12Q 1/6869 20060101 C12Q001/6869 |
Claims
1. A composition comprising a nucleotide analog having a structure
according to: ##STR00024## wherein B is a base and P comprises a
phosphate moiety.
2. The composition of claim 1 wherein P comprises a tetraphosphate,
a triphosphate, a diphosphate, a monophosphate, a modified
tetraphosphate, a modified triphosphate, a modified diphosphate, or
a modified monophosphate.
3. The composition of claim 1 wherein B is selected from the group
consisting of cytosine, guanine, adenine, thymine, and uracil.
4. The composition of claim 1 wherein B comprises a purine, a
pyrimidine, a modified purine, or a modified pyrimidine
5. The composition of claim 1 wherein the nucleotide analog
comprises a thio-alkynyl, thio-propargyl, 3'-S-propargyl,
thiofuranose, thioribose, thiodeoxyribose, arabinose, or a modified
sugar.
6. The composition of claim 1 wherein P comprises a 5' hydroxyl, an
alpha thiophosphate, a beta thiophosphate, a gamma thiophosphate,
an alpha methylphosphonate, a beta methylphosphonate, or a gamma
methylphosphonate.
7. The composition of claim 1 further comprising a polymerase, a
nucleic acid, or a nucleotide.
8. The composition of claim 1 wherein the nucleotide analog is
modified with a sulfur.
9. The composition of claim 1 further comprising a nucleotide
comprising the base B, wherein the number ratio of the nucleotide
analog to the nucleotide is 1:1, 1:2, 1:3, 1:4, 1:5, 1:10, 1:15,
1:20, 1:25, 1:30, 1:50, 1:75, 1:100, 1:200, 1:300, 1:400, 1:500,
1:600, 1:700, 1:800, 1:900, 1:1000, 1:5000 or 1:10000.
10. A composition comprising a nucleic acid comprising the
nucleotide analog of claim 1.
11. The composition of claim 10 wherein the nucleotide analog is at
the 3' end of the nucleic acid.
12. The composition of claim 10 wherein the nucleic acid is
produced by a polymerase.
13. The composition of claim 10 further comprising an azide.
14. The composition of claim 10 further comprising a second nucleic
acid.
15. The composition of claim 10 further comprising a second nucleic
acid comprising an azide moiety.
16. The composition of claim 10 further comprising a second nucleic
acid comprising an azide moiety at the 5' end of the second nucleic
acid.
17. The composition of claim 10 further comprising a label
comprising an azide, a tag comprising an azide, a solid support
comprising an azide, a nucleotide comprising an azide, a biotin
comprising an azide, or a protein comprising an azide.
18. The composition of claim 10 further comprising a copper-based
catalyst reagent.
19. The composition of claim 10 further comprising a nucleic acid
comprising a triazole.
20. The composition of claim 10 further comprising a nucleic acid
comprising a 1', 4' substituted triazole.
21. The composition of claim 10 further comprising an adaptor
oligonucleotide, an adaptor oligonucleotide comprising a barcode,
or a barcode oligonucleotide.
22. The composition of claim 10 further comprising a nucleic acid
comprising a structure according to: ##STR00025##
23. A composition comprising a 3'O-propargyl nucleotide and a
5'-oligonucleotide
Description
[0001] This Application is a continuation of U.S. patent
application Ser. No. 16/752,865, filed Jan. 27, 2020, which is a
continuation of U.S. application Ser. No. 15/944,553 filed Apr. 3,
2018, now U.S. Pat. No. 10,577,646, issued Mar. 3, 2020, which is a
continuation of U.S. application Ser. No. 14/463,412 filed Aug. 19,
2014, now U.S. Pat. No. 9,932,623, issued Apr. 3, 2018, which
claims priority to U.S. provisional patent application Ser. No.
61/867,202, filed Aug. 19, 2013, each of which are herein
incorporated by reference in their entirety.
FIELD OF INVENTION
[0002] Provided herein is technology relating to the manipulation
and detection of nucleic acids, including but not limited to
compositions, methods, and kits related to nucleotides comprising a
chemically reactive linking moiety.
BACKGROUND
[0003] Nucleic acid detection methodologies continue to serve as a
critical tool in the field of molecular diagnostics. The ability to
manipulate biomolecules specifically and efficiently provides the
basis for many successful detection technologies. For example,
linking a chemical, biological, or physical moiety (e.g., adding a
"tag") to a biomolecule of interest is one key technology related
to the subsequent manipulation, detection, and/or identification of
the biomolecule.
[0004] Conventional linking technologies often rely on
enzyme-assisted methods. For example, some methods to append a
desired tag onto a target DNA use a ligase enzyme to join the
target DNA to the tag (e.g., another DNA fragment comprising the
tag, another DNA fragment to serve as the tag itself, etc.). In
another method, a polymerase enzyme incorporates a tag-modified
substrate of the polymerase (e.g., a dNTP or a modified-dNTP) into
a nucleic acid. An advantage of these enzyme-assisted methods is
that the links joining the biomolecule to the moiety are "natural"
linkages that allow further manipulation of the conjugated product.
However, some important drawbacks include low product yields,
inefficient reactions, and low specificity due to multiple reactive
groups present on a target biomolecule that the enzyme can
recognize. In addition, conventional methods have high costs in
both time and money.
SUMMARY
[0005] Accordingly, provided herein is technology related to
linking moieties to biomolecules using chemical conjugation. These
linkage reactions are more specific and efficient that conventional
technologies because the reactions are designed to include a
mechanism of conjugation between specific chemical moieties.
[0006] While most conventional chemical covalent linkages are not
recognized and/or processed by biological catalysts (e.g.,
enzymes), thus limiting subsequent manipulation of the conjugated
product, the technology described herein provides a chemical
linkage that allows downstream manipulation of the conjugated
product by standard molecular biological and biochemical
techniques.
[0007] For example, while there are many nucleotide analogs
currently available that can terminate a polymerase reaction (e.g.,
dideoxynucleotides and various 3' modified nucleotide analogs),
these molecules inhibit or severely limit further manipulation of
nucleic acids terminated by these analogs. For example, subsequent
enzymatic reactions such as the polymerase chain reaction are
completely or substantially inhibited by the nucleotide analogs. In
addition, some solutions have utilized nucleotide analogs called
"reversible terminators" in which the 3' hydroxyl groups are capped
with a chemical moiety that can be removed with a specific chemical
reaction, thus regenerating a free 3' hydroxyl. Use of these
nucleotide analogs, however, requires the additional deprotection
(uncapping) step to remove the protecting (capping) moiety from the
nucleic acid as well as an additional purification step to remove
the released protecting (capping) moiety from the reaction
mixture.
[0008] In contrast to conventional technologies, provided herein is
technology related to the design, synthesis, and use of nucleotide
(e.g., ribonucleotide, deoxyribonucleotide) analogs that comprise
chemically reactive groups. For example, some embodiments provide a
nucleotide analog comprising an alkyne group, e.g., a nucleotide
comprising a 3' alkyne group such as provided in embodiments of the
technology related to a 3'-O-propargyl deoxynucleotides. The
chemical groups and linkages do not impair or significantly limit
the use of subsequent molecular biological techniques to manipulate
compounds (e.g., nucleic acids, conjugates, and other biomolecules)
comprising the nucleotide analogs. As such, the compounds (e.g.,
nucleic acids, conjugates, and other biomolecules) comprising the
described nucleotide analogs are useful for many applications.
[0009] In some embodiments, nucleotide analogs find use as
functional nucleotide terminators, that is, the nucleotide analogs
terminate synthesis of a nucleic acid by a polymerase and
additionally comprise a functional reactive group for subsequent
chemical and/or biochemical processing, reaction, and/or
manipulation. In particular, some embodiments provide a nucleotide
analog in which the 3' hydroxyl group is capped by a chemical
moiety comprising, e.g., an alkyne (e.g., a carbon-carbon triple
bond, e.g., C.ident.C). When the 3' alkyne nucleotide analog is
incorporated into a nucleic acid by a polymerase (e.g., a DNA
and/or RNA polymerase) during synthesis, further elongation of the
nucleic acid is halted ("terminated") because the nucleic acid does
not have a free 3' hydroxyl to provide the proper substrate for
subsequent nucleotide addition.
[0010] While the nucleotide analogs are not a natural substrate for
conventional molecular biological enzymes, the alkyne chemical
moiety is a well-known chemical conjugation partner reactive with
particular functional moieties. For example, an alkyne reacts with
an azide group (e.g., N.sub.3, e.g., N.dbd.N.dbd.N) in a copper
(I)-catalyzed azide-alkyne cycloaddition ("CuAAC") reaction to form
two new covalent bonds between azide nitrogens and alkyl carbons.
The covalent bonds form a chemical link (e.g., comprising a
five-membered triazole ring) between a first component and a second
component that comprised the azide and the alkyne moieties before
linkage. This type of cycloaddition reaction is one of the
foundational reactions of "click chemistry" because it provides a
desirable chemical yield, is physiologically stable, and exhibits a
large thermodynamic driving force that favors a "spring-loaded"
reaction that yields a single product (e.g., a 1,4-regioisomer of
1,2,3-triazole). See, e.g., Huisgen (1961) "Centenary
Lecture--1,3-Dipolar Cycloadditions", Proceedings of the Chemical
Society of London 357; Kolb, Finn, Sharpless (2001) "Click
Chemistry: Diverse Chemical Function from a Few Good Reactions",
Angewandte Chemie International Edition 40(11): 2004-2021. For
example:
##STR00001##
where R.sub.1 and R.sub.2 are individually any chemical structure
or chemical moiety.
[0011] The reaction can be performed in a variety of solvents,
including aqueous mixtures, compositions comprising water and/or
aqueous mixtures, and a variety of organic solvents including
compositions comprising alcohols, dimethyl sulfoxide (DMSO),
dimethylformamide (DMF), tert-butyl alcohol (TBA or tBuOH; also
known as 2-methyl-2-propanol (2M2P)), and acetone. In some
embodiments, the reaction is performed in a milieu comprising a
copper-based catalyst such as Cu/Cu(OAc).sub.2, a tertiary amine
such as tris-(benzyltriazolylmethyl)amine (TBTA), and/or
tetrahydrofuran and acetonitrile (THF/MeCN).
[0012] In some embodiments, the triazole ring linkage has a
structure according to:
##STR00002##
where R.sub.1 and R.sub.2 are individually any chemical structure
or chemical moiety (and may be the same or different chemical
structures or chemical moieties in different structures) and B,
B.sub.1, and B.sub.2 individually indicate the base of the
nucleotide (e.g., adenine, guanine, thymine, cytosine, or a natural
or synthetic nucleobase, e.g., a modified purine such as
hypoxanthine, xanthine, 7-methylguanine; a modified pyrimidine such
as 5,6-dihydrouracil, 5-methylcytosine, 5- hydroxymethylcytosine;
etc.).
[0013] The triazole ring linkage formed by the alkyne-azide
cycloaddition has similar characteristics (e.g., physical,
biological, biochemical, chemical characteristics, etc.) as a
natural phosphodiester bond present in nucleic acids and therefore
is a nucleic acid backbone mimic. Consequently, conventional
enzymes that recognize natural nucleic acids as substrates also
recognize as substrates the products formed by alkyne-azide
cycloaddition as provided by the technology described herein. See,
e.g., El-Sagheer et al. (2011) "Biocompatible artificial DNA linker
that is read through by DNA polymerases and is functional in
Escherichia coli", Proc Natl Acad Sci USA108(28): 11338-43.
[0014] In some embodiments, the use of nucleotide analogs
comprising an alkyne (e.g., a 3'-O-propargyl nucleotide analog)
produces nucleic acids (e.g., DNA or RNA polynucleotide fragments)
that have a terminal 3' alkyne group. For example, in some
embodiments, nucleotide analogs comprising an alkyne (e.g., a
3'-O-propargyl nucleotide analog) are incorporated into a growing
strand of a nucleic acid in a polymerase extension reaction; once
incorporated, the nucleotide analogs halt the polymerase reaction.
These terminated nucleic acids are an appropriate chemical reactant
for a click chemistry reaction (e.g., alkyne-azide cycloaddition),
e.g., for a chemical ligation to an azide-modified molecule such as
a 5'-azide modified nucleic acid, a labeling moiety comprising an
azide, a solid support comprising an azide, a protein comprising an
azide, etc., including, but not limited to moieties, entities, and
components discussed herein. In some embodiments, for example, the
3'-O-propargyl group at the 3' terminal of the nucleic acid product
is used in a tagging reaction with an azide-modified tag using
chemical ligation, e.g., as provided by a click chemistry reaction.
The covalent linkage created using this chemistry mimics that of a
natural nucleic acid phosphodiester bond, thereby providing for the
use of the chemically ligated nucleic acids in subsequent enzymatic
reactions, such as a polymerase chain reaction, with the triazole
chemical linkage causing minimal, limited, or undetectable (e.g.,
no) inhibition of the enzymatic reaction.
[0015] In some embodiments, the nucleotide analog comprising an
alkyne is reacted with a reactant comprising a phosphine moiety in
a Staudinger ligation. In a Staudinger ligation, an electrophilic
trap (e.g., a methyl ester) is placed on a triarylphosphine aryl
group (usually ortho to the phosphorus atom) and reacted with the
azide to yield an aza-ylide intermediate, which then rearranges
(e.g., in aqueous media) to produce a compound with amide group and
a phosphine oxide function. The Staudinger ligation ligates
(attaches and covalently links) the two starting molecules
together.
[0016] Accordingly, provided herein is technology related to a
composition comprising a nucleotide analog having a structure
according to:
##STR00003##
wherein B is a base and P comprises a phosphate moiety. In some
embodiments, P comprises a tetraphosphate; a triphosphate; a
diphosphate; a monophosphate; a 5' hydroxyl; an alpha thiophosphate
(e.g., phosphorothioate or phosphorodithioate), a beta
thiophosphate (e.g., phosphorothioate or phosphorodithioate),
and/or a gamma thiophosphate (e.g., phosphorothioate or
phosphorodithioate); or an alpha methylphosphonate, a beta
methylphosphonate, and/or a gamma methylphosphonate.
[0017] In some embodiments, P comprises an azide (e.g., N.sub.3,
e.g., N.dbd.N.dbd.N), thus providing, in some embodiments, a
directional, bi-functional polymerization agent as described
herein.
[0018] In some embodiments, B is a cytosine, guanine, adenine,
thymine, or uracil base. That is, in some embodiments, B is a
purine or a pyrimidine or a modified purine or a modified
pyrimidine. The technology is not limited in the bases B that find
use in the nucleotide analogs. For example, B can be any synthetic,
artificial, or natural base; thus, in some embodiments B is a
synthetic base; in some embodiments, B is an artificial base; in
some embodiments, B is a natural base. In some embodiments,
compositions comprise a nucleotide analog and a nucleic acid (e.g.,
a polynucleotide). Compositions in some embodiments further
comprise a polymerase and/or a nucleotide (e.g., a conventional
nucleotide). In compositions comprising a nucleotide and a
nucleotide analog, in some embodiments the number ratio of the
nucleotide analog to the nucleotide is 1:1, 1:2, 1:3, 1:4, 1:5,
1:10, 1:15, 1:20, 1:25, 1:30, 1:50, 1:75, 1:100, 1:200, 1:300,
1:400, 1:500, 1:600, 1:700, 1:800, 1:900, 1:1000, 1:5000, or
1:10000.
[0019] In some embodiments, a nucleic acid comprises a nucleotide
analog as provided herein. In some embodiments, the nucleic acid
comprises the nucleotide analog at its 3' end (e.g., the nucleotide
analog is at the 3' end of the nucleic acid). The technology, in
some embodiments relates to the synthesis of a nucleic acid
comprising a nucleotide analog by a biological enzyme. That is, the
biological enzyme recognizes the nucleotide analog as a substrate
and incorporates the nucleotide analog into the nucleic acid. For
example, in some embodiments, the nucleic acid is produced by a
polymerase.
[0020] In some embodiments, the compositions further comprise an
azide, e.g., a component, entity, molecule, surface, biomolecule,
etc., comprising an azide.
[0021] In some embodiments, the compositions comprise multiple
nucleic acids; accordingly, in some embodiments, compositions
comprise a second nucleic acid (e.g., in addition to a nucleic acid
comprising a nucleotide analog). The technology encompasses
functionalized nucleic acids for reacting with a nucleic acid
comprising a nucleotide analog. Thus, in some embodiments, the
second nucleic acid comprises an azide moiety, e.g., in some
embodiments, the second nucleic acid comprises an azide moiety at
the 5' end of the second nucleic acid.
[0022] The technology is not limited in the entity (e.g.,
comprising an azide group) reacted with the nucleic acid comprising
the nucleotide analog. For instance, in some embodiments,
compositions further comprise a label comprising an azide, a tag
comprising an azide, a solid support comprising an azide, a
nucleotide comprising an azide, a biotin comprising an azide, or a
protein comprising an azide. In some embodiments, an alkyne moiety
and an azide moiety are reacted using a "click chemistry" reaction
catalyzed by a copper-based catalyst. As such, in some embodiments
compositions further comprise a copper-based catalyst reagent. The
reaction of the azide and alkyne produces, in some embodiments, a
triazole moiety. In some embodiments, a nucleic acid comprising an
alkyne (e.g., a nucleic acid comprising a nucleotide analog
comprising an alkyne) is reacted with a nucleic acid comprising an
azide to produce a longer nucleic acid. As such, in some
embodiments compositions according to the technology further
comprise a nucleic acid comprising a triazole (e.g., that forms a
link between the two nucleic acids). In some embodiments, the
reaction of the alkyne and azide proceeds with regioselectivity,
e.g., in some embodiments the nucleic acid comprises a 1', 4'
substituted triazole. In some embodiments, the nucleic acid
comprising the nucleotide analog is reacted with an adaptor
oligonucleotide, an adaptor oligonucleotide comprising a barcode,
or a barcode oligonucleotide comprising an azide. Thus, in some
embodiments are provided reaction mixtures comprising an adaptor
oligonucleotide, an adaptor oligonucleotide comprising a barcode,
or a barcode oligonucleotide.
[0023] In some embodiments, a nucleic acid (e.g., formed from
uniting two nucleic acids by "click chemistry" reaction of an
alkyne and an azide) comprises a structure according to:
##STR00004##
where R.sub.1 and R.sub.2 are individually any chemical structure
or chemical moiety (and may be the same or different chemical
structures or chemical moieties in different structures) and
B.sub.1 and B.sub.2 individually indicate the base of the
nucleotide (e.g., adenine, guanine, thymine, cytosine, or a natural
or synthetic nucleobase, e.g., a modified purine such as
hypoxanthine, xanthine, 7-methylguanine; a modified pyrimidine such
as 5,6-dihydrouracil, 5-methylcytosine, 5-hydroxymethylcytosine;
etc.).
[0024] Another aspect of the technology relates to embodiments of
methods for synthesizing a modified nucleic acid, the method
comprising providing a nucleotide analog comprising an alkyne group
and linking a nucleic acid to the nucleotide analog to produce a
modified nucleic acid comprising the nucleotide analog. In some
embodiments, the nucleotide analog has a structure according
to:
##STR00005##
wherein B is a base (e.g., cytosine, guanine, adenine, thymine, or
uracil) and P comprises a triphosphate moiety. Embodiments of the
method comprise further providing, e.g., a template, a primer, a
nucleotide (e.g., a conventional nucleotide), and/or a polymerase.
The nucleotide analogs are recognized as a substrate by biological
enzymes such as polymerases; thus, in some embodiments, a
polymerase catalyzes linking a nucleic acid to the nucleotide
analog to produce a modified nucleic acid comprising the nucleotide
analog. The modified nucleic acid provides a substrate for reaction
with an azide-carrying entity, e.g., to form a conjugated product
by a "click chemistry" reaction. Thus, in some embodiments the
methods further comprise reacting the modified nucleic acid with an
azide moiety. The methods are not limited in the entity that
comprises the azide moiety; for example, in some embodiments the
methods comprise reacting the modified nucleic acid with a second
nucleic acid comprising an azide moiety, e.g., reacting the
modified nucleic acid with a second nucleic acid comprising an
azide moiety at the 5' end of the second nucleic acid, a label
comprising an azide, a tag comprising an azide, a solid support
comprising an azide, a nucleotide comprising an azide, and/or a
protein comprising an azide.
[0025] The methods find use in linking an adaptor oligonucleotide
(e.g., for use in next-generation sequencing) to a nucleic acid
comprising a nucleotide analog. Accordingly, in some embodiments,
the methods further comprise reacting the modified nucleic acid
with an adaptor oligonucleotide comprising an azide moiety, an
adaptor oligonucleotide comprising a barcode and comprising an
azide moiety, and/or a barcode oligonucleotide comprising an azide
moiety, e.g., to produce a nucleic acid-oligonucleotide conjugate.
In some embodiments, reactions of a nucleotide analog (e.g., a
nucleic acid comprising a nucleotide analog) and an azide are
catalyzed by a copper-based catalyst reagent. Associated methods,
according, in some embodiments comprise reacting the modified
nucleic acid with an azide moiety and a copper-based catalyst
reagent. As the triazole ring formed by the "click chemistry"
reaction does not substantially and/or detectably inhibit
biological enzyme activity, the nucleic acid-oligonucleotide
conjugate provides a useful nucleic acid for further manipulation,
e.g., in some embodiments the modified nucleic acid is a substrate
for a biological enzyme, the modified nucleic acid is a substrate
for a polymerase, and/or the modified nucleic acid is a substrate
for a sequencing reaction.
[0026] The nucleotide analogs provided herein are functional
terminators, e.g., they act to terminate synthesis of a nucleic
acid (e.g., similar to a dideoxynucleotide as used in Sanger
sequencing) while also comprising a reactive group for further
chemical processing. Accordingly, as described herein, in some
embodiments, the methods further comprise terminating
polymerization with the nucleotide analog.
[0027] Related methods provide, in some embodiments, a method for
sequencing a nucleic acid, the method comprising hybridizing a
primer to a nucleic acid template to form a hybridized
primer/nucleic acid template complex; providing a plurality of
nucleotide analogs, each nucleotide analog comprising an alkyne
moiety; reacting the hybridized primer/nucleic acid template
complex and the nucleotide analog with a polymerase to add the
nucleotide analog to the primer by a polymerase reaction to form an
extended product comprising an incorporated nucleotide analog; and
reacting the extended product with an azide-containing compound to
form a structure comprising a triazole ring. In particular
embodiments, the nucleotide analogs are 3'-O-propargyl-dNTP
nucleotide analogs and N is selected from the group consisting of
A, C, G, T and U. As the triazole ring formed by the "click
chemistry" reaction does not substantially and/or detectably
inhibit biological enzyme activity, the nucleic
acid-oligonucleotide conjugate provides a useful nucleic acid for
further manipulation. Thus, in some embodiments the structure
comprising a triazole ring is used in subsequent enzymatic
reactions, e.g., a polymerase chain reaction and/or a sequencing
reaction. Polymerization in the presence of nucleotide analogs is
performed, in some embodiments, in the presence also of
conventional (e.g., non-terminator) nucleotides. Related methods
comprise providing conventional nucleotides.
[0028] Also provided herein are embodiments of kits. For example,
in some embodiments, kits are provided for synthesizing a modified
nucleic acid, the kit comprising a nucleotide analog comprising an
alkynyl group; and a copper-based catalyst reagent. In some
embodiments kits further comprise other components that find use in
the processing and/or manipulation of nucleic acids. Thus, in some
embodiments kits further comprise a polymerase, an adaptor
oligonucleotide comprising an azide moiety, and/or a nucleotide
(e.g., a conventional nucleotide). For example, some embodiments of
the technology relate to kits for producing a NGS sequencing
library and/or for obtaining sequence information from a target
nucleic acid. For example, some embodiments provide a kit
comprising a nucleotide analog, e.g., for producing a nucleotide
fragment ladder according to the methods provided herein. In some
embodiments, the nucleotide analog is a 3'-O-blocked nucleotide
analog, e.g., a 3'-O-alkynyl nucleotide analog, e.g., a
3'-O-propargyl nucleotide analog. In some embodiments, conventional
A, C, G, U, and/or T nucleotides are provided in a kit as well as
one or more (e.g., 1, 2, 3, or 4) A, C, G, U, and/or T nucleotide
analogs.
[0029] In some embodiments, kits comprise a polymerase (e.g., a
natural polymerase, a modified polymerase, and/or an engineered
polymerase, etc.), e.g., for amplification (e.g., by thermal
cycling, isothermal amplification) or for sequencing, etc. In some
embodiments, kits comprise a ligase, e.g., for attaching adaptors
to a nucleic acid such as an amplicon or a ladder fragment or for
circularizing an adaptor-amplicon. Some embodiments of kits
comprise a copper-based catalyst reagent, e.g., for a click
chemistry reaction, e.g., to react an azide and an alkynyl group to
form a triazole link. Some kit embodiments provide buffers, salts,
reaction vessels, instructions, and/or computer software.
[0030] In some embodiments, kits comprise primers and/or adaptors.
In some embodiments, the adaptors comprise a chemical modification
suitable for attaching the adaptor to the nucleotide analog, e.g.,
by click chemistry. For example, in some embodiments, the kit
comprises a nucleotide analog comprising an alkyne group and an
adaptor oligonucleotide comprising an azide (N.sub.3) group. In
some embodiments, a "click chemistry" process such as an
azide-alkyne cycloaddition is used to link the adaptor to the
fragment via formation of a triazole.
[0031] Particular kit embodiments provide a kit for generating a
sequencing library, the kit comprising an adaptor oligonucleotide
comprising a first reactive group (e.g., an azide), a 3'-O-blocked
nucleotide analog (e.g., a 3'-O-alkynyl nucleotide analog or a
3'-O-propargyl nucleotide analog, e.g., comprising an alkyne group,
e.g., comprising a second reactive group that forms a chemical bond
with the first reactive group, e.g., using click chemistry), a
polymerase (e.g., a polymerase for isothermal amplification or
thermal cycling), a second adaptor oligonucleotide, one or more
compositions comprising a nucleotide or a mixture of nucleotides,
and a ligase or a copper-based click chemistry catalyst
reagent.
[0032] In some embodiments of kits, kits comprise one or more
3'-O-blocked nucleotide analog(s) (e.g., one or more 3'-O-alkynyl
nucleotide analog(s) such as one or more 3'-O-propargyl nucleotide
analog(s) and one or more adaptor oligonucleotides comprising an
azide group (e.g., a 5'-azido oligonucleotide, e.g., a
5'-azido-methyl oligonucleotide). Some kit embodiments further
provide a 5'-azido-methyl oligonucleotide comprising a barcode.
Some kit embodiments further provide a plurality of 5'-azido-methyl
oligonucleotides comprising a plurality of barcodes (e.g., each
5'-azido-methyl oligonucleotide comprises a barcode that is
distinguishable from one or more other barcodes of one or more
other 5'-azido-methyl oligonucleotide(s) comprising a different
barcode). Further kit embodiments comprise a click chemistry
catalytic reagent (e.g., a copper(I) catalytic reagent).
[0033] Some kit embodiments comprise one or more standard dNTPs in
addition to the one or more one or more 3'-O-blocked nucleotide
analog(s) (e.g., one or more 3'-O-alkynyl nucleotide analog(s) such
as one or more 3'-O-propargyl nucleotide analog(s). For instance,
some kit embodiment provide dATP, dCTP, dGTP, and dTTP, either in
separate vessels or as a mixture with one or more
3'-O-propargyl-dATP, 3'-O-propargyl-dCTP, 3'-O-propargyl-dGTP,
and/or 3'-O-propargyl-dATP.
[0034] Some kit embodiments further comprise a polymerase obtained
from, derived from, isolated from, cloned from, etc. a Thermococcus
species (e.g., an organism of the taxonomic lineage Archaea;
Euryarchaeota; Thermococci; Thermococcales; Thermococcaceae;
Thermococcus). In some embodiments, the polymerase is obtained
from, derived from, isolated from, cloned from, etc. a Thermococcus
species 9.degree. N-7. In some embodiments, the polymerase
comprises amino acid substitutions that provide for improved
incorporation of modified substrates such as modified
dideoxynucleotides, ribonucleotides, and acyclonucleotides. In some
embodiments, the polymerase comprises amino acid substitutions that
provide for improved incorporation of nucleotide analogs comprising
modified 3' functional groups such as the 3'-O-propargyl dNTPs
described herein. In some embodiments the amino acid sequence of
the polymerase comprises one or more amino acid substitutions
relative to the Thermococcus sp. 9.degree. N-7 wild-type polymerase
amino acid sequence, e.g., a substitution of alanine for the
aspartic acid at amino acid position 141 (D141A), a substitution of
alanine for the glutamic acid at amino acid position 143 (E143A), a
substitution of valine for the tyrosine at amino acid position 409
(Y409V), and/or a substitution of leucine for the alanine at amino
acid position 485 (A485L). In some embodiments, the polymerase is
provided in a heterologous host organism such as Escherichia coil
that comprises a cloned Thermococcus sp. 9.degree. N-7 polymerase
gene, e.g., comprising one or more mutations (e.g., D141A, E143A,
Y409V, and/or A485L). In some embodiments, the polymerase is a
Thermococcus sp. 9.degree. N-7 polymerase sold under the trade name
THERMINATOR (e.g., THERMINATOR II) by New England BioLabs (Ipswich,
Mass.).
[0035] Accordingly, some kit embodiments comprise one or more
3'-O-propargyl nucleotide analog(s) (e.g., one or more of
3'-O-propargyl-dATP, 3'-O-propargyl-dCTP, 3'-O-propargyl-dGTP,
and/or 3'-O-propargyl-dATP), a mixture of standard dNTPs (e.g.,
dATP, dCTP, dGTP, and dTTP), one or more 5'-azido-methyl
oligonucleotide adaptors, a polymerase obtained from, derived from,
isolated from, cloned from, etc. a Thermococcus species, and a
click chemistry catalyst for forming a triazole from an azide group
and an alkyl group. In some embodiments, the one or more
3'-O-propargyl nucleotide analog(s) (e.g., one or more of
3'-O-propargyl-dATP, 3'-O-propargyl-dCTP, 3'-O-propargyl-dGTP,
and/or 3'-O-propargyl-dATP) and the mixture of standard dNTPs
(e.g., dATP, dCTP, dGTP, and dTTP) are provided together, e.g., the
kit comprises a solution comprising the one or more 3'-O-propargyl
nucleotide analog(s) (e.g., one or more of 3'-O-propargyl-dATP,
3'-O-propargyl-dCTP, 3'-O-propargyl-dGTP, and/or
3'-O-propargyl-dATP) and the mixture of standard dNTPs (e.g., dATP,
dCTP, dGTP, and dTTP). In some embodiments, the solution comprises
the one or more 3'-O-propargyl nucleotide analog(s) (e.g., one or
more of 3'-O-propargyl-dATP, 3'-O-propargyl-dCTP,
3'-O-propargyl-dGTP, and/or 3'-O-propargyl-dATP) and the mixture of
standard dNTPs (e.g., dATP, dCTP, dGTP, and dTTP) at a ratio of
from 1:500 to 500:1 (e.g., 1:500, 1:450, 1:400, 1:350, 1:300,
1:250, 1:200, 1:150, 1:100, 1:90, 1:80, 1:70, 1:60, 1:50, 1:40,
1:30, 1:20, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 2:1, 3:1,
4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1,
70:1, 80:1, 90:1, 100:1, 150:1, 200:1, 250:1, 300:1, 350:1, 400:1,
450:1, or 500:1).
[0036] Some embodiments of kits further comprise software for
processing sequence data, e.g., to extract nucleotide sequence data
from the data produced by a sequencer; to identify barcodes and
target subsequences from the data produced by a sequencer; to align
and/or assemble subsequences from the data produced by a sequencer
to produce a consensus sequence; and/or to align subsequences
and/or a consensus sequence to a reference sequence.
[0037] In some embodiments, provided herein are compositions
comprising a nucleotide analog having a structure according to:
##STR00006##
wherein B is a base (e.g., a purine or a pyrimidine such as a
cytosine, guanine, adenine, thymine, or uracil; e.g., a modified
purine or a modified pyrimidine) and P comprises a phosphate moiety
(e.g., a tetraphosphate; a triphosphate; a diphosphate; a
monophosphate; a 5' hydroxyl; an alpha thiophosphate (e.g.,
phosphorothioate or phosphorodithioate), a beta thiophosphate
(e.g., phosphorothioate or phosphorodithioate), and/or a gamma
thiophosphate (e.g., phosphorothioate or phosphorodithioate); or an
alpha methylphosphonate, a beta methylphosphonate, and/or a gamma
methylphosphonate); a nucleic acid; a polymerase; and a nucleotide
(e.g., comprising the base B, e.g., in a number ratio of the
nucleotide analog to the nucleotide that is 1:1, 1:2, 1:3, 1:4,
1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:50, 1:75, 1:100, 1:200, 1:300,
1:400, 1:500, 1:600, 1:700, 1:800, 1:900, 1:1000, 1:5000, or
1:10000).
[0038] Also provided are embodiments of compositions comprising a
nucleic acid (e.g., produced by a polymerase), wherein the nucleic
acid comprises a nucleotide analog (e.g., at its 3' end) having a
structure according to:
##STR00007##
wherein B is a base (e.g., a purine or a pyrimidine such as a
cytosine, guanine, adenine, thymine, or uracil; e.g., a modified
purine or a modified pyrimidine) and P comprises a phosphate moiety
(e.g., a tetraphosphate; a triphosphate; a diphosphate; a
monophosphate; a 5' hydroxyl; an alpha thiophosphate (e.g.,
phosphorothioate or phosphorodithioate), a beta thiophosphate
(e.g., phosphorothioate or phosphorodithioate), and/or a gamma
thiophosphate (e.g., phosphorothioate or phosphorodithioate); or an
alpha methylphosphonate, a beta methylphosphonate, and/or a gamma
methylphosphonate); a second nucleic acid (e.g., comprising an
azide, e.g., at its 5' end), a label comprising an azide, a tag
comprising an azide, a solid support comprising an azide, a
nucleotide comprising an azide, a biotin comprising an azide, or a
protein comprising an azide; a copper (e.g., copper-based) catalyst
reagent; a nucleic acid comprising a triazole (e.g., a 1', 4'
substituted triazole); and/or a structure such as:
##STR00008##
where R.sub.1 and R.sub.2 are individually any chemical structure
or chemical moiety (and may be the same or different chemical
structures or chemical moieties in different structures) and
B.sub.1 and B.sub.2 individually indicate the base of the
nucleotide (e.g., adenine, guanine, thymine, cytosine, or a natural
or synthetic nucleobase, e.g., a modified purine such as
hypoxanthine, xanthine, 7-methylguanine; a modified pyrimidine such
as 5,6-dihydrouracil, 5-methylcytosine, 5-hydroxymethylcytosine;
etc.); an adaptor oligonucleotide, an adaptor oligonucleotide
comprising a barcode, or a barcode oligonucleotide.
[0039] In another aspect, the technology provides a method for
synthesizing a modified nucleic acid, the method comprising
providing a nucleotide analog comprising an alkyne group, e.g., a
nucleotide having a structure according to:
##STR00009##
wherein B is a base (e.g., cytosine, guanine, adenine, thymine, or
uracil) and P comprises a triphosphate moiety; linking a nucleic
acid to the nucleotide analog to produce a modified nucleic acid
comprising the nucleotide analog; providing a template; providing a
primer; providing a nucleotide; providing a polymerase (e.g., to
catalyze the linking of the nucleic acid to the nucleotide analog);
terminating polymerization with the nucleotide analog; reacting the
modified nucleic acid with an azide moiety (e.g., with a second
nucleic acid comprising an azide moiety at its 5' end, a label
comprising an azide, a tag comprising an azide, a solid support
comprising an azide, a nucleotide comprising an azide, a protein
comprising an azide, an adaptor oligonucleotide comprising an azide
moiety, an adaptor oligonucleotide comprising a barcode and
comprising an azide moiety, or a barcode oligonucleotide comprising
an azide moiety), e.g., to produce a nucleic acid-oligonucleotide
conjugate (e.g., that is a substrate for a biological enzyme such
as a polymerase and/or to provide a substrate for a sequencing
reaction); and/or reacting the modified nucleic acid with an azide
moiety and a copper-based catalyst reagent.
[0040] In some embodiments are provided a method for sequencing a
nucleic acid, the method comprising hybridizing a primer to a
nucleic acid template to form a hybridized primer/nucleic acid
template complex; providing a plurality of nucleotide analogs
(e.g., 3'-O-propargyl-dNTP nucleotide analogs wherein N is selected
from the group consisting of A, C, G, T, and U), each nucleotide
analog comprising an alkyne moiety; providing conventional
nucleotides; reacting the hybridized primer/nucleic acid template
complex and the nucleotide analog with a polymerase to add the
nucleotide analog to the primer by a polymerase reaction to form an
extended product comprising an incorporated nucleotide analog; and
reacting the extended product with an azide-containing compound to
form a structure comprising a triazole ring (e.g., that is used in
subsequent enzymatic reactions such as a polymerase chain
reaction).
[0041] In some embodiments are provided a kit for synthesizing a
modified nucleic acid, the kit comprising a nucleotide analog
comprising an alkynyl group; a copper-based catalyst reagent; a
polymerase; an adaptor oligonucleotide comprising an azide moiety;
and a conventional nucleotide.
[0042] Particular embodiments are related to generating a nucleic
acid fragment ladder using a polymerase reaction comprising
standard dNTPs and 3'-O-propargyl-dNTPs at a molar ratio of from
1:500 to 500:1 (standard dNTPs to 3'-O-propargyl-dNTPs). Terminated
nucleic acid fragments produced by methods described herein
comprise a prop argyl group on their 3' ends. Further embodiments
are related to attaching an adaptor to the 3' ends of the nucleic
acid fragments using chemical conjugation. For example, in some
embodiments a 5'-azido-modified oligonucleotide (e.g., a
5'-azido-methyl-modified oligonucleotide) is conjugated to the
3'-propargyl-terminated nucleic acid fragments by click chemistry
(e.g., in a reaction catalyzed by a copper (e.g., copper (I))
reagent). In some embodiments, a target region is first amplified
(e.g., by PCR) to produce a target amplicon for sequencing. In some
embodiments, amplifying the target region comprises amplification
of the target region for 5 to 15 cycles (e.g., a "limited cycle" or
"low-cycle" amplification).
[0043] Further embodiments provide that the target amplicon
comprises a tag (e.g., comprises a barcode sequence), e.g., the
target amplicon is an identifiable amplicon. In some embodiments, a
primer used in the amplification of the target region comprises a
tag (e.g., comprising a barcode sequence) that is subsequently
incorporated into the target amplicon (e.g., in a "copy and tag"
reaction) to produce an identifiable amplicon. In some embodiments,
an adaptor comprising the tag (e.g., comprising a barcode sequence)
is ligated to the target amplicon after amplification (e.g., in a
ligase reaction) to produce an identifiable adaptor-amplicon. In
some embodiments, the primer used to produce an identifiable
amplicon in a copy and tag reaction comprises a 3' region
comprising a target-specific priming sequence and a 5' region
comprising two different universal sequences (e.g., a universal
sequence A and a universal sequence B) flanking a degenerate
sequence. In some embodiments, an adaptor ligated to an amplicon to
produce an identifiable adaptor-amplicon is a double stranded
adaptor, e.g., comprising one strand comprising a degenerate
sequence (e.g., comprising 8 to12 bases) flanked on both the 5' end
and the 3' end by two different universal sequences (e.g., a
universal sequence A and a universal sequence B) and a second
strand comprising a universal sequence C (e.g., at the 5' end) and
a sequence (e.g., at the 3' end) that is complementary to the
universal sequence B and that has an additional T at the
3'-terminal position.
[0044] Embodiments of the technology provide for the generation of
nucleic acid ladder fragments from an adaptor-amplicon, e.g., to
provide a sequencing library for NGS. In particular, the technology
provides for the generation of a 3'-O-propargyl-dN terminated
nucleic acid ladder for nucleic acid sequencing (e.g., NGS), e.g.,
by using a polymerase reaction comprising standard dNTPs and
3'-O-propargyl-dNTPs at a molar ratio of from 1:500 to 500:1
(standard dNTPs to 3'-O-propargyl-dNTPs). Then, in some
embodiments, the technology provides for attaching an adaptor to
the 3' ends of the nucleic acid fragments using chemical
conjugation. For example, in some embodiments, a 5'-azido-modified
oligonucleotide (e.g., a 5'-azido-methyl-modified oligonucleotide)
is conjugated to the 3'-propargyl-terminated nucleic acid fragments
by click chemistry (e.g., in a reaction catalyzed by a copper
(e.g., copper (I)) reagent).
[0045] Some embodiments of the technology provide a composition for
use as a next-generation sequencing library to obtain a sequence of
a target nucleic acid, the composition comprising n nucleic acids
(e.g., a nucleic acid fragment library), wherein each of the n
nucleic acids comprises a 3'-O-blocked nucleotide analog (e.g., a
3'-O-alkynyl nucleotide analog such as a 3'-O-propargyl nucleotide
analog). In some embodiments, each nucleic acid of the n nucleic
acids comprises a nucleotide subsequence of a target nucleotide
sequence.
[0046] In particular, embodiments provide a composition comprising
n nucleic acids, wherein each of the n nucleic acids is terminated
by a 3'-O-blocked nucleotide analog (e.g., a 3'-O-alkynyl
nucleotide analog such as a 3'-O-propargyl nucleotide analog).
Further embodiments provide a composition comprising n nucleic
acids (e.g., a nucleic acid fragment library), wherein each of the
n nucleic acids comprises a 3'-O-blocked nucleotide analog (e.g., a
3'-O-alkynyl nucleotide analog such as a 3'-O-propargyl nucleotide
analog) and each of the n nucleic acids is conjugated (e.g.,
linked) to an oligonucleotide adaptor by a triazole linkage (e.g.,
a linkage formed from a chemical conjugation of a prop argyl group
and an azido group, e.g., by a click chemistry reaction). For
example, some embodiments provide a composition comprising n
nucleic acids (e.g., a nucleic acid fragment library), wherein each
of the n nucleic acids comprises a 3'-O-propargyl nucleotide analog
(e.g., a 3'-O-propargyl-dA, 3'-O-propargyl-dC, 3'-O-propargyl-dG,
and/or a 3'-O-propargyl-dT) conjugated (e.g., linked) to an
oligonucleotide adaptor by a triazole linkage (e.g., a linkage
formed from a chemical conjugation of a propargyl group and an
azido group, e.g., by a click chemistry reaction).
[0047] In some embodiments, the composition for use as a
next-generation sequencing library to obtain a sequence of a target
nucleic acid is produced by a method comprising synthesizing a n
nucleic acids (e.g., a nucleic acid fragment library) using a
mixture of dNTPs and one or more 3'-O-blocked nucleotide analog(s)
(e.g., one or more 3'-O-alkynyl nucleotide analog(s) such as one or
more 3'-O-propargyl nucleotide analog(s)), e.g., at a molar ratio
of from 1:500 to 500:1 (e.g., 1:500, 1:450, 1:400, 1:350, 1:300,
1:250, 1:200, 1:150, 1:100, 1:90, 1:80, 1:70, 1:60, 1:50, 1:40,
1:30, 1:20, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 2:1, 3:1,
4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1,
70:1, 80:1, 90:1, 100:1, 150:1, 200:1, 250:1, 300:1, 350:1, 400:1,
450:1, or 500:1). In some embodiments, the composition is produced
using a polymerase obtained from, derived from, isolated from,
cloned from, etc. a Thermococcus species (e.g., an organism of the
taxonomic lineage Archaea; Euryarchaeota; Thermococci;
Thermococcales; Thermococcaceae; Thermococcus). In some
embodiments, the polymerase is obtained from, derived from,
isolated from, cloned from, etc. a Thermococcus species 9.degree.
N-7. In some embodiments, the polymerase comprises amino acid
substitutions that provide for improved incorporation of modified
substrates such as modified dideoxynucleotides, ribonucleotides,
and acyclonucleotides. In some embodiments, the polymerase
comprises amino acid substitutions that provide for improved
incorporation of nucleotide analogs comprising modified 3'
functional groups such as the 3'-O-propargyl dNTPs described
herein. In some embodiments the amino acid sequence of the
polymerase comprises one or more amino acid substitutions relative
to the Thermococcus sp. 9.degree. N-7 wild-type polymerase amino
acid sequence, e.g., a substitution of alanine for the aspartic
acid at amino acid position 141 (D141A), a substitution of alanine
for the glutamic acid at amino acid position 143 (E143A), a
substitution of valine for the tyrosine at amino acid position 409
(Y409V), and/or a substitution of leucine for the alanine at amino
acid position 485 (A485L). In some embodiments, the polymerase is
provided in a heterologous host organism such as Escherichia coil
that comprises a cloned Thermococcus sp. 9.degree. N-7 polymerase
gene, e.g., comprising one or more mutations (e.g., D141A, E143A,
Y409V, and/or A485L). In some embodiments, the polymerase is a
Thermococcus sp. 9.degree. N-7 polymerase sold under the trade name
THERMINATOR (e.g., THERMINATOR II) by New England BioLabs (Ipswich,
Mass.).
[0048] Accordingly, the technology relates to reaction mixtures
comprising a target nucleic acid, a mixture of dNTPs and one or
more 3'-O-blocked nucleotide analog(s) (e.g., one or more
3'-O-alkynyl nucleotide analog(s) such as one or more
3'-O-propargyl nucleotide analog(s)), e.g., at a molar ratio of
from 1:500 to 500:1 (e.g., 1:500, 1:450, 1:400, 1:350, 1:300,
1:250, 1:200, 1:150, 1:100, 1:90, 1:80, 1:70, 1:60, 1:50, 1:40,
1:30, 1:20, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 2:1, 3:1,
4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1,
70:1, 80:1, 90:1, 100:1, 150:1, 200:1, 250:1, 300:1, 350:1, 400:1,
450:1, or 500:1), and a polymerase for synthesizing a nucleic acid
using the dNTPs and one or more 3'-O-blocked nucleotide analog(s)
(e.g., a polymerase obtained from, derived from, isolated from,
cloned from, etc. a Thermococcus species). In some embodiments, the
target nucleic acid is an amplicon. In some embodiments, the target
nucleic acid comprises a barcode. In some embodiments, the target
nucleic acid is an amplicon comprising a barcode. In some
embodiments, the target nucleic acid is an amplicon ligated to an
adaptor comprising a barcode. Some embodiments provide reaction
mixtures that comprises a plurality of target nucleic acids, each
target nucleic acid comprising a barcode associated with an
identifiable characteristic of the target nucleic acid.
[0049] Some embodiments provide a reaction mixture composition
comprising a template (e.g., a circular template, e.g., comprising
a universal nucleotide sequence and/or a barcode nucleotide
sequence) comprising a subsequence of a target nucleic acid, a
polymerase, one or more fragments of a ladder fragment library, and
a 3'-O-blocked nucleotide analog.
[0050] Some embodiments provide a reaction mixture composition
comprising a library of nucleic acids, the library of nucleic acids
comprising overlapping short nucleotide sequences tiled over a
target nucleic acid (e.g., the overlapping short nucleotide
sequences cover a region of the target nucleic acid comprising 100
bases, 200 bases, 300 bases, 400 bases, 500 bases, 600 bases, 700
bases, 800 bases, 900 bases, 1000 bases, or more than 1000 bases,
e.g., 2000 bases, 2500 bases, 3000 bases, 3500 bases, 4000 bases,
4500 bases, 5000 bases, or more than 5000 bases) and offset from
one another by 1-20, 1-10, or 1-5 bases (e.g., 1 base) and each
nucleic acid of the library comprising less than 100 bases, less
than 90 bases, less than 80 bases, less than 70 bases, less than 60
bases, less than 50 bases, less than 45 bases, less than 40 bases,
less than 35 bases, or less than 30 bases.
[0051] Additional embodiments are provided below and as variations
of the technology described as understood by a person having
ordinary skill in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] These and other features, aspects, and advantages of the
present technology will become better understood with regard to the
following drawings:
[0053] FIG.1 is a schematic showing a polymerase extension reaction
using 3'-O-propargyl-dGTP. The polymerase extension halts after the
incorporation of 3'-O-propargyl-dGTP, producing product 1. A
5'-azide-modified DNA fragment is chemically ligated to product 1
using click chemistry producing product 2. The covalent linkage
created by the formation of the triazole ring mimics that of the
natural DNA backbone phosphodiester linkage. Product 2 is used
subsequently in enzymatic reactions (e.g., PCR).
[0054] FIG. 2 is a schematic showing a polymerase extension
reaction using a combination of dNTPs and 3'-O-propargyl-dNTPs. DNA
ladder fragments (n+1 fragments) are generated with each of the
fragments' 3'-ends having an alkyne group. These DNA ladder
fragments are ligated to a 5'-azide-modified DNA molecule, which
has a "universal" sequence and/or a barcode sequence and/or a
primer binding site, via click chemistry. The ligated DNA fragments
are subsequently treated and used as input in next generation
sequencing (NGS) processes. These DNA fragments with the n+1
characteristic produce DNA sequencing data by assembling short
reads, thereby significantly decreasing the NGS run time.
[0055] FIG. 3A-3G show analytical data for
3'-O-propargyl-2'-deoxycytidine-5'-triphosphate
(3'-O-propargyl-dCTP) synthesized as described herein. FIG. 3A
shows .sup.1H NMR data for 3'-O-propargyl-dCTP. FIG. 3B shows an
enlarged portion of the .sup.1H NMR data for 3'-O-propargyl-dCTP
shown in FIG. 3A. FIG. 3C shows an enlarged portion of the .sup.1H
NMR data for 3'-O-propargyl-dCTP shown in FIG. 3A. FIG. 3D shows
.sup.31P NMR data for 3'-O-propargyl-dCTP. FIG. 3E shows an
enlarged portion of the .sup.31P NMR data for 3'-O-propargyl-dCTP
shown in FIG.3D. FIG. 3F shows anion-exchange HPLC data for
3'-O-propargyl-dCTP. FIG. 3G shows high-resolution mass spectrum
data for 3'-O-propargyl-dCTP.
[0056] FIG. 4A-4G show analytical data for
3'-O-propargyl-2'-deoxythymidine-5'-triphosphate
(3'-O-propargyl-dTTP) synthesized as described herein. FIG. 4A
shows .sup.1H NMR data for 3'-O-propargyl-dTTP. FIG. 4B shows an
enlarged portion of the .sup.1H NMR data for 3'-O-propargyl-dTTP
shown in FIG. 4A. FIG. 4C shows an enlarged portion of the .sup.1H
NMR data for 3'-O-propargyl-dTTP shown in FIG. 4A. FIG. 4D shows
.sup.31P NMR data for 3'-O-propargyl-dTTP. FIG. 4E shows an
enlarged portion of the .sup.31P NMR data for 3'-O-propargyl-dTTP
shown in FIG. 4D. FIG. 4F shows anion-exchange HPLC data for
3'-O-propargyl-dTTP. FIG. 4G shows high-resolution mass spectrum
data for 3'-O-propargyl-dTTP.
[0057] FIG. 5A-5G show analytical data for
3'-O-propargyl-2'-deoxyadenosine-5'-triphosphate
(3'-O-propargyl-dATP) synthesized as described herein. FIG. 5A
shows .sup.1H NMR data for 3'-O-propargyl-dATP. FIG. 5B shows an
enlarged portion of the .sup.1H NMR data for 3'-O-propargyl-dATP
shown in FIG. 5A. FIG. 5C shows an enlarged portion of the .sup.1H
NMR data for 3'-O-propargyl-dATP shown in FIG. 5A. FIG. 5D shows
.sup.31P NMR data for 3'-O-propargyl-dATP. FIG. 5E shows an
enlarged portion of the .sup.31P NMR data for 3'-O-propargyl-dATP
shown in FIG. 5D. FIG. 5F shows anion-exchange HPLC data for
3'-O-propargyl-dATP. FIG. 5G shows high-resolution mass spectrum
data for 3'-O-propargyl-dATP.
[0058] FIG. 6A-6G show analytical data for
3'-O-propargyl-2'-deoxyguanosine-5'-riphosphate
(3'-O-propargyl-dGTP) synthesized as described herein. FIG. 6A
shows .sup.1H NMR data for 3'-O-propargyl-dGTP. FIG. 6B shows an
enlarged portion of the .sup.1H NMR data for 3'-O-propargyl-dGTP
shown in FIG. 6A. FIG. 6C shows an enlarged portion of the .sup.1H
NMR data for 3'-O-propargyl-dGTP shown in FIG. 6A. FIG. 6D shows
.sup.31P NMR data for 3'-O-propargyl-dGTP. FIG. 6E shows an
enlarged portion of the .sup.31P NMR data for 3'-O-propargyl-dGTP
shown in FIG. 6D. FIG. 6F shows anion-exchange HPLC data for
3'-O-propargyl-dGTP. FIG. 6G shows high-resolution mass spectrum
data for 3'-O-propargyl-dGTP.
[0059] It is to be understood that the figures are not necessarily
drawn to scale, nor are the objects in the figures necessarily
drawn to scale in relationship to one another. The figures are
depictions that are intended to bring clarity and understanding to
various embodiments of apparatuses, systems, and methods disclosed
herein. Wherever possible, the same reference numbers will be used
throughout the drawings to refer to the same or like parts.
Moreover, it should be appreciated that the drawings are not
intended to limit the scope of the present teachings in any
way.
DETAILED DESCRIPTION
[0060] Provided herein is technology relating to the manipulation
and detection of nucleic acids, including but not limited to
compositions, methods, systems, and kits related to nucleotides
comprising a chemically reactive linking moiety. In particular
embodiments, the technology provides nucleotide analogs comprising
a base (e.g., adenine, guanine, cytosine, thymine, or uracil), a
sugar (e.g., a ribose or deoxyribose), and an alkyne chemical
moiety, e.g., attached to the 3' oxygen of the sugar (e.g., the 3'
oxygen of the deoxyribose or the 3' oxygen of the ribose). The
nucleotide analogs (e.g., a 3'-alkynyl nucleotide analog, e.g., a
3'-O-propargyl nucleotide analog such as a 3'-O-propargyl dNTP or a
3'-O-propargyl NTP) find use in embodiments of the technology to
introduce a particular chemical moiety (e.g., an alkyne) at the end
(e.g., the 3' end) of a nucleic acid (e.g., a DNA or RNA) by a
polymerase extension reaction, and, consequently, to produce a
nucleic acid modification that does not exist in natural biological
systems. Chemical ligation between the polymerase extension
products and appropriate conjugation partners (e.g., azide modified
entities) is achieved with high efficiency and specificity using
click chemistry. Embodiments of the functional nucleotide
terminators provided herein are used to produce nucleic acids that
are useful for various molecular biology, biochemical, and
biotechnology applications.
[0061] The technology provides several advantages over current
technologies. For instance, the technology provides sequence data
that is better (e.g., higher quality, longer reads, fewer errors,
etc.) or comparable than existing technologies in a shorter run
time than existing technologies. Moreover, the technology provides
sequence data reads that can be stitched together to provide a
longer read of high quality.
[0062] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the described
subject matter in any way. In this detailed description of the
various embodiments, for purposes of explanation, numerous specific
details are set forth to provide a thorough understanding of the
embodiments disclosed. One skilled in the art will appreciate,
however, that these various embodiments may be practiced with or
without these specific details. In other instances, structures and
devices are shown in block diagram form. Furthermore, one skilled
in the art can readily appreciate that the specific sequences in
which methods are presented and performed are illustrative and it
is contemplated that the sequences can be varied and still remain
within the spirit and scope of the various embodiments disclosed
herein.
[0063] All literature and similar materials cited in this
application, including but not limited to, patents, patent
applications, articles, books, treatises, and internet web pages
are expressly incorporated by reference in their entirety for any
purpose. Unless defined otherwise, all technical and scientific
terms used herein have the same meaning as is commonly understood
by one of ordinary skill in the art to which the various
embodiments described herein belongs. When definitions of terms in
incorporated references appear to differ from the definitions
provided in the present teachings, the definition provided in the
present teachings shall control.
Definitions
[0064] To facilitate an understanding of the present technology, a
number of terms and phrases are defined below. Additional
definitions are set forth throughout the detailed description.
[0065] Throughout the specification and claims, the following terms
take the meanings explicitly associated herein, unless the context
clearly dictates otherwise. The phrase "in one embodiment" as used
herein does not necessarily refer to the same embodiment, though it
may. Furthermore, the phrase "in another embodiment" as used herein
does not necessarily refer to a different embodiment, although it
may. Thus, as described below, various embodiments of the invention
may be readily combined, without departing from the scope or spirit
of the invention.
[0066] In addition, as used herein, the term "or" is an inclusive
"or" operator and is equivalent to the term "and/or" unless the
context clearly dictates otherwise. The term "based on" is not
exclusive and allows for being based on additional factors not
described, unless the context clearly dictates otherwise. In
addition, throughout the specification, the meaning of "a", "an",
and "the" include plural references. The meaning of "in" includes
"in" and "on."
[0067] As used herein, a "nucleotide" comprises a "base"
(alternatively, a "nucleobase" or "nitrogenous base"), a "sugar"
(in particular, a five-carbon sugar, e.g., ribose or
2-deoxyribose), and a "phosphate moiety" of one or more phosphate
groups (e.g., a monophosphate, a diphosphate, a triphosphate, a
tetraphosphate, etc. consisting of one, two, three, four or more
linked phosphates, respectively). Without the phosphate moiety, the
nucleobase and the sugar compose a "nucleoside". A nucleotide can
thus also be called a nucleoside monophosphate or a nucleoside
diphosphate or a nucleoside triphosphate, depending on the number
of phosphate groups attached. The phosphate moiety is usually
attached to the 5-carbon of the sugar, though some nucleotides
comprise phosphate moieties attached to the 2-carbon or the
3-carbon of the sugar. Nucleotides contain either a purine (e.g.,
in the nucleotides adenine and guanine) or a pyrimidine base (e.g.,
in the nucleotides cytosine, thymine, and uracil). Some nucleotides
contain non-natural bases. Ribonucleotides are nucleotides in which
the sugar is ribose. Deoxyribonucleotides are nucleotides in which
the sugar is deoxyribose.
[0068] As used herein, a "nucleic acid" shall mean any nucleic acid
molecule, including, without limitation, DNA, RNA, and hybrids
thereof. The nucleic acid bases that form nucleic acid molecules
can be the bases A, C, G, T and U, as well as derivatives
thereof.
[0069] Derivatives of these bases are well known in the art. The
term should be understood to include, as equivalents, analogs of
either DNA or RNA made from nucleotide analogs. The term as used
herein also encompasses cDNA that is complementary DNA produced
from an RNA template, for example by the action of a reverse
transcriptase. It is well known that DNA (deoxyribonucleic acid) is
a chain of nucleotides consisting of 4 types of nucleotides--A
(adenine), T (thymine), C (cytosine), and G (guanine)--and that RNA
(ribonucleic acid) is a chain of nucleotides consisting of 4 types
of nucleotides--A, U (uracil), G, and C. It is also known that all
of these 5 types of nucleotides specifically bind to one another in
combinations called complementary base pairing. That is, adenine
(A) pairs with thymine (T) (in the case of RNA, however, adenine
(A) pairs with uracil (U)) and cytosine (C) pairs with guanine (G),
so that each of these base pairs forms a double strand. As used
herein, "nucleic acid sequencing data", "nucleic acid sequencing
information", "nucleic acid sequence", "genomic sequence", "genetic
sequence", "fragment sequence", or "nucleic acid sequencing read"
denotes any information or data that is indicative of the order of
the nucleotide bases (e.g., adenine, guanine, cytosine, and
thymine/uracil) in a molecule (e.g., a whole genome, a whole
transcriptome, an exome, oligonucleotide, polynucleotide, fragment,
etc.) of DNA or RNA. It should be understood that the present
teachings contemplate sequence information obtained using all
available varieties of techniques, platforms or technologies,
including, but not limited to: capillary electrophoresis,
microarrays, ligation-based systems, polymerase-based systems,
hybridization-based systems, direct or indirect nucleotide
identification systems, pyrosequencing, ion- or pH-based detection
systems, electronic signature-based systems, pore-based (e.g.,
nanopore), visualization-based systems, etc.
[0070] Reference to a base, a nucleotide, or to another molecule
may be in the singular or plural. That is, "a base" may refer to a
single molecule of that base or to a plurality of the base, e.g.,
in a solution.
[0071] A "polynucleotide", "nucleic acid", or "oligonucleotide"
refers to a linear polymer of nucleosides (including
deoxyribonucleosides, ribonucleosides, or analogs thereof) joined
by internucleosidic linkages. Typically, a polynucleotide comprises
at least three nucleosides. Usually oligonucleotides range in size
from a few monomeric units, e.g. 3 to 4, to several hundreds of
monomeric units. Whenever a polynucleotide such as an
oligonucleotide is represented by a sequence of letters, such as
"ATGCCTG", it will be understood that the nucleotides are in 5' to
3' order from left to right and that "A" denotes deoxyadenosine,
"C" denotes deoxycytidine, "G" denotes deoxyguanosine, and "T"
denotes thymidine, unless otherwise noted. The letters A, C, G, and
T may be used to refer to the bases themselves, to nucleosides, or
to nucleotides comprising the bases, as is standard in the art.
[0072] As used herein, the phrase "dNTP" means
deoxynucleotidetriphosphate, where the nucleotide comprises a
nucleotide base, such as A, T, C, G or U.
[0073] The term "monomer" as used herein means any compound that
can be incorporated into a growing molecular chain by a given
polymerase. Such monomers include, without limitation, naturally
occurring nucleotides (e.g., ATP, GTP, TTP, UTP, CTP, dATP, dGTP,
dTTP, dUTP, dCTP, synthetic analogs), precursors for each
nucleotide, non-naturally occurring nucleotides and their
precursors or any other molecule that can be incorporated into a
growing polymer chain by a given polymerase.
[0074] As used herein, "complementary" generally refers to specific
nucleotide duplexing to form canonical Watson-Crick base pairs, as
is understood by those skilled in the art. However, complementary
also includes base-pairing of nucleotide analogs that are capable
of universal base-pairing with A, T, G or C nucleotides and locked
nucleic acids that enhance the thermal stability of duplexes. One
skilled in the art will recognize that hybridization stringency is
a determinant in the degree of match or mismatch in the duplex
formed by hybridization.
[0075] As used herein, "moiety" refers to one of two or more parts
into which something may be divided, such as, for example, the
various parts of a tether, a molecule, or a probe.
[0076] As used herein, a "linker" is a molecule or moiety that
joins two molecules or moieties and/or provides spacing between the
two molecules or moieties such that they are able to function in
their intended manner. For example, a linker can comprise a diamine
hydrocarbon chain that is covalently bound through a reactive group
on one end to an oligonucleotide analog molecule and through a
reactive group on another end to a solid support, such as, for
example, a bead surface. Coupling of linkers to nucleotides and
substrate constructs of interest can be accomplished through the
use of coupling reagents that are known in the art (see, e.g.,
Efimov et al., Nucleic Acids Res. 27: 4416-4426, 1999). Methods of
derivatizing and coupling organic molecules are well known in the
arts of organic and bioorganic chemistry. A linker may also be
cleavable (e.g., photocleavable) or reversible.
[0077] A "polymerase" is an enzyme generally for joining 3'-OH,
5'-triphosphate nucleotides, oligomers, and their analogs.
Polymerases include, but are not limited to, DNA-dependent DNA
polymerases, DNA-dependent RNA polymerases, RNA-dependent DNA
polymerases, RNA-dependent RNA polymerases, T7 DNA polymerase, T3
DNA polymerase, T4 DNA polymerase, T7 RNA polymerase, T3 RNA
polymerase, SP6 RNA polymerase, DNA polymerase 1, Klenow fragment,
Thermophilus aquaticus DNA polymerase, Tth DNA polymerase, Vent DNA
polymerase (New England Biolabs), Deep Vent DNA polymerase (New
England Biolabs), Bst DNA Polymerase Large Fragment, Stoeffel
Fragment, 9.degree. N DNA Polymerase, Pfu DNA Polymerase, Tfl DNA
Polymerase, RepliPHI Phi29 Polymerase, Tli DNA polymerase,
eukaryotic DNA polymerase beta, telomerase, Therminator polymerase
(New England Biolabs) (e.g., Therminator I, Therminator II, and
other variants), KOD HiFi. DNA polymerase (Novagen), KOD1 DNA
polymerase, Q-beta replicase, terminal transferase, AMV reverse
transcriptase, M-MLV reverse transcriptase, Phi6 reverse
transcriptase, HIV-1 reverse transcriptase, novel polymerases
discovered by bioprospecting, and polymerases cited in U.S. Pat.
Appl. Pub. No. 2007/0048748 and in U.S. Pat. Nos. 6,329,178;
6,602,695; and 6,395,524. These polymerases include wild-type,
mutant isoforms, and genetically engineered variants such as
exo.sup.- polymerases and other mutants, e.g., that tolerate
modified (e.g., labeled) nucleotides and incorporate them into a
strand of nucleic acid.
[0078] The term "primer" refers to an oligonucleotide, whether
occurring naturally as in a purified restriction digest or produced
synthetically, that is capable of acting as a point of initiation
of synthesis when placed under conditions in which synthesis of a
primer extension product that is complementary to a nucleic acid
strand is induced, (e.g., in the presence of nucleotides and an
inducing agent such as a polymerase and at a suitable temperature
and pH). The primer is preferably single stranded for maximum
efficiency in amplification, but may alternatively be double
stranded. If double stranded, the primer is first treated to
separate its strands before being used to prepare extension
products. Preferably, the primer is an oligodeoxyribonucleotide.
The primer must be sufficiently long to prime the synthesis of
extension products in the presence of the inducing agent. The exact
lengths of the primers depends on many factors including
temperature, source of primer, and the use of the method.
[0079] As used herein, an "adaptor" is an oligonucleotide that is
linked or is designed to be linked to a nucleic acid to introduce
the nucleic acid into a sequencing workflow. An adaptor may be
single-stranded or double-stranded (e.g., a double-stranded DNA or
a single-stranded DNA). As used herein, the term "adaptor" refers
to the adaptor nucleic in a state that is not linked to another
nucleic acid and in a state that is linked to a nucleic acid.
[0080] At least a portion of the adaptor comprises a known
sequence. For example, some embodiments of adaptors comprise a
primer binding sequence for amplification of the nucleic acid
and/or for binding of a sequencing primer. Some adaptors comprise a
sequence for hybridization of a complementary capture probe. Some
adaptors comprise a chemical or other moiety (e.g., a biotin
moiety) for capture and/or immobilization to a solid support (e.g.,
comprising an avidin moiety). Some embodiments of adaptors comprise
a marker, index, barcode, tag, or other sequence by which the
adaptor and a nucleic acid to which it is linked are
identifable.
[0081] Some adaptors comprise a universal sequence. A universal
sequence is a sequence shared by a plurality of adaptors that may
otherwise have different sequences outside of the universal
sequence. For example, a universal sequence provides a common
primer binding site for a collection of nucleic acids from
different target nucleic acids, e.g., that may comprise different
barcodes.
[0082] Some embodiments of adaptors comprise a defined but unknown
sequence. For example, some embodiments of adaptors comprise a
degenerate sequence of a defined number of bases (e.g., a 1- to
20-base degenerate sequence). Such a sequence is defined even if
each individual sequence is not known--such a sequence may
nevertheless serve as an index, barcode, tag, etc. marking nucleic
acid fragments from, e.g., the same target nucleic acid.
[0083] Some adaptors comprise a blunt end and some adaptors
comprise an end with an overhang of one or more bases.
[0084] In particular embodiments provided herein, an adaptor
comprises an azido moiety, e.g., the adaptor comprises an azido
(e.g., an azido-methyl) moiety on its 5' end. Thus, some
embodiments are related to adaptors that are or that comprise a
5'-azido-modified oligonucleotide or a 5'- azido-methyl-modified
oligonucleotide.
[0085] In some embodiments, a unique index (a "marker" in some
embodiments) is used to associate a fragment with the template
nucleic acid from which it was produced. In some embodiments, a
unique index is a unique sequence of synthetic nucleotides or a
unique sequence of natural nucleotides that allows for easy
identification of the target nucleic acid within a complicated
collection of oligonucleotides (e.g., fragments) containing various
sequences. In certain embodiments, unique index identifiers are
attached to nucleic acid fragments prior to attaching adaptor
sequences. In some embodiments, unique index identifiers are
contained within adaptor sequences such that the unique sequence is
contained in the sequencing reads. This ensures that homologous
fragments can be detected based upon the unique indices that are
attached to each fragment, thus further providing for unambiguous
reconstruction of a consensus sequence. Homologous fragments may
occur for example by chance due to genomic repeats, two fragments
originating from homologous chromosomes, or fragments originating
from overlapping locations on the same chromosome. Homologous
fragments may also arise from closely related sequences (e.g.,
closely related gene family members, paralogs, orthologs, ohnologs,
xenologs, and/or pseudogenes). Such fragments may be discarded to
ensure that long fragment assembly can be computed unambiguously.
The markers may be attached as described above for the adaptor
sequences. The indices (e.g., markers) may be included in the
adaptor sequences.
[0086] In some embodiments, the unique index (e.g., index
identifier, tag, marker, etc.) is a "barcode". As used herein, the
term "barcode" refers to a known nucleic acid sequence that allows
some feature of a nucleic acid with which the barcode is associated
to be identified. In some embodiments, the feature of the nucleic
acid to be identified is the sample or source from which the
nucleic acid is derived. In some embodiments, barcodes are at least
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more nucleotides in
length. In some embodiments, barcodes are shorter than 10, 9, 8, 7,
6, 5, or 4 nucleotides in length. In some embodiments, barcodes
associated with some nucleic acids are of a different length than
barcodes associated with other nucleic acids. In general, barcodes
are of sufficient length and comprise sequences that are
sufficiently different to allow the identification of samples based
on barcodes with which they are associated. In some embodiments, a
barcode and the sample source with which it is associated can be
identified accurately after the mutation, insertion, or deletion of
one or more nucleotides in the barcode sequence, such as the
mutation, insertion, or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more nucleotides. In some embodiments, each barcode in a
plurality of barcodes differs from every other barcode in the
plurality at two or more nucleotide positions, such as at 2, 3, 4,
5, 6, 7, 8, 9, 10, or more positions. In some embodiments, one or
more adaptors comprise(s) at least one of a plurality of barcode
sequences. In some embodiments, methods of the technology further
comprise identifying the sample or source from which a target
nucleic acid is derived based on a barcode sequence to which the
target nucleic acid is joined. In some embodiments, methods of the
technology further comprise identifying the target nucleic acid
based on a barcode sequence to which the target nucleic acid is
joined. Some embodiments of the method further comprise identifying
a source or sample of the target nucleotide sequence by determining
a barcode nucleotide sequence. Some embodiments of the method
further comprise molecular counting applications (e.g., digital
barcode enumeration and/or binning) to determine expression levels
or copy number status of desired targets. In general, a barcode may
comprise a nucleic acid sequence that when joined to a target
nucleic acid serves as an identifier of the sample from which the
target polynucleotide was derived.
[0087] In some embodiments, an oligonucleotide such as a primer,
adaptor, etc. comprises a "universal" sequence. A universal
sequence is a known sequence, e.g., for use as a primer or probe
binding site using a primer or probe of a known sequence (e.g.,
complementary to the universal sequence). While a template-specific
sequence of a primer, a barcode sequence of a primer, and/or a
barcode sequence of an adaptor might differ in embodiments of the
technology, e.g., from fragment to fragment, from sample to sample,
from source to source, or from region of interest to region of
interest, embodiments of the technology provide that a universal
sequence is the same from fragment to fragment, from sample to
sample, from source to source, or from region of interest to region
of interest so that all fragments comprising the universal sequence
can be handled and/or treated in a same or similar manner, e.g.,
amplified, identified, sequenced, isolated, etc., using similar
methods or techniques (e.g., using the same primer or probe).
[0088] In particular embodiments, a primer is used comprising a
universal sequence (e.g., universal sequence A), a barcode
sequence, and a template-specific sequence. In particular
embodiments, a first adaptor comprising a universal sequence (e.g.,
universal sequence B) is used and in particular embodiments, a
second adaptor comprising a universal sequence (e.g., universal
sequence C) is used. Universal sequence A, universal sequence B,
and universal sequence C can be any sequence. This nomenclature is
used to note that the universal sequence A of a first nucleic acid
(e.g., a fragment) comprising universal sequence A is the same as
the universal sequence A of a second nucleic acid (e.g., a
fragment) comprising universal sequence A, the universal sequence B
of a first nucleic acid (e.g., a fragment) comprising universal
sequence B is the same as the universal sequence B of a second
nucleic acid (e.g., a fragment) comprising universal sequence B,
and the universal sequence C of a first nucleic acid (e.g., a
fragment) comprising universal sequence C is the same as the
universal sequence C of a second nucleic acid (e.g., a fragment)
comprising universal sequence C. While universal sequences A, B,
and C are generally different in embodiments of the technology,
they need not be. Thus, in some embodiments, universal sequences A
and B are the same; in some embodiments, universal sequences B and
C are the same; in some embodiments, universal sequences A and C
are the same; and in some embodiments, universal sequences A, B,
and C are the same. In some embodiments, universal sequences A, B,
and C are different.
[0089] For example, if two regions of interest are to be sequenced
(e.g., from the same or different sources or, e.g., from two
different regions of the same nucleic acid, chromosome, gene,
etc.), two primers may be used, one primer comprising a first
template-specific sequence for priming from the first region of
interest and a first barcode to associate the first amplified
product with the first region of interest and a second primer
comprising a second template-specific sequence for priming from the
second region of interest and a second barcode to associate the
second amplified product with the second region of interest. These
two primers, however, in some embodiments, will comprise the same
universal sequence (e.g., universal sequence A) for pooling and
downstream processing together. Two or more universal sequences may
be used and, in general, the number of universal sequences will be
less than the number of target-specific sequences and/or barcode
sequences for pooling of samples and treatment of pools as a single
sample (batch).
[0090] Accordingly, in some embodiments, determining the first
nucleotide subsequence and the second nucleotide subsequence
comprises priming from a universal sequence. In some embodiments
determining the first nucleotide subsequence and the second
nucleotide subsequence comprises terminating polymerization with a
3'-O-blocked nucleotide analog. For example, in some embodiments
determining the first nucleotide subsequence and the second
nucleotide subsequence comprises terminating polymerization with a
3'-O-alkynyl nucleotide analog, e.g., in some embodiments
determining the first nucleotide subsequence and the second
nucleotide subsequence comprises terminating polymerization with a
3'-O-propargyl nucleotide analog. In some embodiments determining
the first nucleotide subsequence and the second nucleotide
subsequence comprises terminating polymerization with a nucleotide
analog comprising a reversible terminator.
[0091] The obtained short sequence reads are partitioned according
to their barcode (i.e., de-multiplexed) and reads originating from
the same samples, sources, regions of interest, etc. are binned
together, e.g., saved to separate files or held in an organized
data structure that allows binned reads to be identified as such.
Then the binned short sequences are assembled into a consensus
sequence. Sequence assembly can generally be divided into two broad
categories: de novo assembly and reference genome mapping assembly.
In de novo assembly, sequence reads are assembled together so that
they form a new and previously unknown sequence. In reference
genome mapping, sequence reads are assembled against an existing
backbone sequence (e.g., a reference sequence, etc.) to build a
sequence that is similar but not necessarily identical to the
backbone sequence.
[0092] Thus, in some embodiments, target nucleic acids
corresponding to each region of interest are reconstructed using a
de-novo assembly. To begin the reconstruction process, short reads
are stitched together bioinformatically by finding overlaps and
extending them to produce a consensus sequence. In some embodiments
the method further comprises mapping the consensus sequence to a
reference sequence. Methods of the technology take advantage of
sequencing quality scores that represent base calling confidence to
reconstruct full length fragments. In addition to de-novo assembly,
fragments can be used to obtain phasing (assignment to homologous
copies of chromosomes) of genomic variants by observing that
consensus sequences originate from either one of the
chromosomes.
[0093] As used herein, a "system" denotes a set of components, real
or abstract, comprising a whole where each component interacts with
or is related to at least one other component within the whole.
[0094] Various nucleic acid sequencing platforms, nucleic acid
assembly and/or mapping systems (e.g., computer software and/or
hardware) are described, e.g., in U.S. Pat. Appl. Pub. No.
2011/0270533, which is incorporated herein by reference.
[0095] As used herein, the terms "alkyl" and the prefix "alk-" are
inclusive of both straight chain and branched chain saturated or
unsaturated groups, and of cyclic groups, e.g., cycloalkyl and
cycloalkenyl groups. Unless otherwise specified, acyclic alkyl
groups are from 1 to 6 carbons. Cyclic groups can be monocyclic or
polycyclic and preferably have from 3 to 8 ring carbon atoms.
Exemplary cyclic groups include cyclopropyl, cyclopentyl,
cyclohexyl, and adamantyl groups. Alkyl groups may be substituted
with one or more substituents or unsubstituted. Exemplary
substituents include alkoxy, aryloxy, sulfhydryl, alkylthio,
arylthio, halogen, alkylsilyl, hydroxyl, fluoroalkyl,
perfluoralkyl, amino, aminoalkyl, disubstituted amino, quaternary
amino, hydroxyalkyl, carboxyalkyl, and carboxyl groups. When the
prefix "alk" is used, the number of carbons contained in the alkyl
chain is given by the range that directly precedes this term, with
the number of carbons contained in the remainder of the group that
includes this prefix defined elsewhere herein. For example, the
term "C.sub.1-C.sub.4 alkaryl" exemplifies an aryl group of from 6
to 18 carbons (e.g., see below) attached to an alkyl group of from
1 to 4 carbons.
[0096] As used herein, the term "alkoxy" refers to a chemical
substituent of the formula --OR, where R is an alkyl group. By
"aryloxy" is meant a chemical substituent of the formula --OR',
where R' is an aryl group.
[0097] As used herein, the term "alkyne" refers to a hydrocarbon
comprising a carbon-carbon triple bond. One example of an
alkyne-containing functional group is the propargyl group. Prop
argyl is an alkyl functional group of 2-propynyl with the structure
HCEC.ident.CH.sub.2--, derived from the alkyne propyne.
[0098] As used herein, the term "azide" or "azido" refers to any
compound having the N.sub.3-- moiety therein. The azide may be an
organic azide or a metal azide. One reaction involving azides is a
type of click chemistry known as a copper (I)-catalyzed 1,3-dipolar
cyclo-addition reaction. This reaction conjugates alkynes and
azides to form a five-membered triazole ring that provides a
covalent linkage.
[0099] As used herein, the term "backbone" refers to a structural
component of a nucleic acid molecule that is a series of covalently
bonded atoms that together create the continuous chain of the
molecule. In "natural" nucleic acids the backbone comprises
phosphodiester bonds linking alternating sugars (e.g., ribose or
deoxyribose) and phosphate moieties (related to phosphoric
acid).
[0100] As used herein a "target site" is a site of a subject at
which it is desired for a bioactive agent to be delivered and to be
active. A target site may be a cell, a cell type, a tissue, an
organ, an area, or other designation of a subject's anatomy and/or
physiology.
[0101] The terms "protein" and "polypeptide" refer to compounds
comprising amino acids joined via peptide bonds and are used
interchangeably. Conventional one and three-letter amino acid codes
are used herein as follows--Alanine: Ala, A; Arginine: Arg, R;
Asparagine: Asn, N; Aspartate: Asp, D; Cysteine: Cys, C; Glutamate:
Glu, E; Glutamine: Gln, Q; Glycine: Gly, G; Histidine: His, H;
Isoleucine: Ile, I; Leucine: Leu, L; Lysine: Lys, K; Methionine:
Met, M; Phenylalanine: Phe, F; Proline: Pro, P; Serine: Ser, S;
Threonine: Thr, T; Tryptophan: Trp, W; Tyrosine: Tyr, Y; Valine
Val, V. As used herein, the codes Xaa and X refer to any amino
acid.
[0102] In some embodiments compounds of the technology comprise an
antibody component or moiety, e.g., an antibody or fragments or
derivatives thereof. As used herein, an "antibody", also known as
an "immunoglobulin" (e.g., IgG, IgM, IgA, IgD, IgE), comprises two
heavy chains linked to each other by disulfide bonds and two light
chains, each of which is linked to a heavy chain by a disulfide
bond. The specificity of an antibody resides in the structural
complementarity between the antigen combining site of the antibody
(or paratope) and the antigen determinant (or epitope). Antigen
combining sites are made up of residues that are primarily from the
hypervariable or complementarity determining regions (CDRs).
Occasionally, residues from nonhypervariable or framework regions
influence the overall domain structure and hence the combining
site. In some embodiments the targeting moiety is a fragment of
antibody, e.g., any protein or polypeptide-containing molecule that
comprises at least a portion of an immunoglobulin molecule such as
to permit specific interaction between said molecule and an
antigen. The portion of an immunoglobulin molecule may include, but
is not limited to, at least one complementarity determining region
(CDR) of a heavy or light chain or a ligand binding portion
thereof, a heavy chain or light chain variable region, a heavy
chain or light chain constant region, a framework region, or any
portion thereof. Such fragments may be produced by enzymatic
cleavage, synthetic or recombinant techniques, as known in the art
and/or as described herein. Antibodies can also be produced in a
variety of truncated forms using antibody genes in which one or
more stop codons have been introduced upstream of the natural stop
site. The various portions of antibodies can be joined together
chemically by conventional techniques, or can be prepared as a
contiguous protein using genetic engineering techniques.
[0103] Fragments of antibodies include, but are not limited to, Fab
(e.g., by papain digestion), F(ab')2 (e.g., by pepsin digestion),
Fab' (e.g., by pepsin digestion and partial reduction) and Fv or
scFv (e.g., by molecular biology techniques) fragments.
[0104] A Fab fragment can be obtained by treating an antibody with
the protease papaine. Also, the Fab may be produced by inserting
DNA encoding a Fab of the antibody into a vector for prokaryotic
expression system or for eukaryotic expression system, and
introducing the vector into a prokaryote or eukaryote to express
the Fab. A F(ab')2 may be obtained by treating an antibody with the
protease pepsin. Also, the F(ab')2 can be produced by binding a
Fab' via a thioether bond or a disulfide bond. A Fab may be
obtained by treating F(ab')2 with a reducing agent, e.g.,
dithiothreitol. Also, a Fab' can be produced by inserting DNA
encoding a Fab' fragment of the antibody into an expression vector
for a prokaryote or an expression vector for a eukaryote, and
introducing the vector into a prokaryote or eukaryote for its
expression. A Fv fragment may be produced by restricted cleavage by
pepsin, e.g., at 4.degree. C. and pH 4.0. (a method called "cold
pepsin digestion"). The Fv fragment consists of the heavy chain
variable domain (VH) and the light chain variable domain (VL) held
together by strong noncovalent interaction. A scFv fragment may be
produced by obtaining cDNA encoding the VH and VL domains as
previously described, constructing DNA encoding scFv, inserting the
DNA into an expression vector for prokaryote or an expression
vector for eukaryote, and then introducing the expression vector
into a prokaryote or eukaryote to express the scFv.
[0105] In general, antibodies can usually be raised to any antigen,
using the many conventional techniques now well known in the art.
Any targeting antibody to an antigen which is found in sufficient
concentration at a site in the body of a mammal which is of
diagnostic or therapeutic interest can be used to make the
compounds provided herein.
[0106] As used herein, the term "conjugated" refers to when one
molecule or agent is physically or chemically coupled or adhered to
another molecule or agent. Examples of conjugation include covalent
linkage and electrostatic complexation. The terms "complexed,"
"complexed with," and "conjugated" are used interchangeably
herein.
[0107] As used herein, the term "treatment" is defined as the
application or administration of a therapeutic agent described
herein, or identified by a method described herein, to a patient,
or application or administration of the therapeutic agent to an
isolated tissue or cell line from a patient, who has a disease, a
symptom of disease or a predisposition toward a disease, with the
purpose to cure, heal, alleviate, relieve, alter, remedy,
ameliorate, improve or affect the disease, the symptoms of disease,
or the predisposition toward disease.
[0108] As a result of the selection of substituents and substituent
patterns, certain of the compounds of the present technology can
have asymmetric centers and can occur as mixtures of stereoisomers,
or as individual diastereomers, or enantiomers. All isomeric forms
of these compounds, whether isolated or in mixtures, are within the
scope of the present technology. Pharmaceutically acceptable salts
include both the metallic (inorganic) salts and organic salts, a
list of which is given in Remington's Pharmaceutical Sciences, 17th
Edition, pg. 1418 (1985). It is well known to one skilled in the
art that an appropriate salt form is chosen based on physical and
chemical properties. As will be understood by those skilled in the
art, pharmaceutically acceptable salts include, but are not limited
to salts of inorganic acids such as hydrochloride, sulfate,
phosphate, diphosphate, hydrobromide, and nitrate; or salts of an
organic acid such as malate, maleate, fumarate, tartrate,
succinate, citrate, acetate, lactate, methanesulfonate,
p-toluenesulfonate or palmoate, salicylate, and stearate. Similarly
pharmaceutically acceptable cations include, but are not limited to
sodium, potassium, calcium, aluminum, lithium, and ammonium
(especially ammonium salts with secondary amines). Also included
within the scope of this technology are crystal forms, hydrates,
and solvates.
[0109] Compositions according to the technology can be administered
in the form of pharmaceutically acceptable salts. The term
"pharmaceutically acceptable salt" refers to a salt that possesses
the effectiveness of the parent compound and is not biologically or
otherwise undesirable (e.g., is neither toxic nor otherwise
deleterious to the recipient thereof). Suitable salts include acid
addition salts that may, for example, be formed by mixing a
solution of the compound of the present technology with a solution
of a pharmaceutically acceptable acid such as hydrochloric acid,
sulfuric acid, acetic acid, trifluoroacetic acid, or benzoic acid.
Certain of the compounds employed in the present technology may
carry an acidic moiety (e.g., COOH or a phenolic group), in which
case suitable pharmaceutically acceptable salts thereof can include
alkali metal salts (e.g., sodium or potassium salts), alkaline
earth metal salts (e.g., calcium or magnesium salts), and salts
formed with suitable organic ligands such as quaternary ammonium
salts. Also, in the case of an acid (COOH) or alcohol group being
present, pharmaceutically acceptable esters can be employed to
modify the solubility or hydrolysis characteristics of the
compound.
[0110] The term "administration" and variants thereof (e.g.,
"administering" a compound) in reference to a compound mean
providing the compound or a prodrug of the compound to the
individual in need of treatment or prophylaxis. When a compound of
the technology or a prodrug thereof is provided in combination with
one or more other active agents, "administration" and its variants
are each understood to include provision of the compound or prodrug
and other agents at the same time or at different times. When the
agents of a combination are administered at the same time, they can
be administered together in a single composition or they can be
administered separately. As used herein, the term "composition" is
intended to encompass a product comprising the specified
ingredients in the specified amounts, as well as any product that
results, directly or indirectly, from combining the specified
ingredients in the specified amounts.
[0111] By "pharmaceutically acceptable" is meant that the
ingredients of the pharmaceutical composition must be compatible
with each other and not deleterious to the recipient thereof.
[0112] The term "subject" as used herein refers to an animal,
preferably a mammal, most preferably a human, who has been the
object of treatment, observation, or experiment.
[0113] The term "effective amount" as used herein means that amount
of active compound or pharmaceutical agent that elicits the
biological or medicinal response in a cell, tissue, organ, system,
animal, or human that is being sought by a researcher,
veterinarian, medical doctor, or other clinician. In some
embodiments, the effective amount is a "therapeutically effective
amount" for the alleviation of the symptoms of the disease or
condition being treated. In some embodiments, the effective amount
is a "prophylactically effective amount" for prophylaxis of the
symptoms of the disease or condition being prevented. The term also
includes herein the amount of active compound sufficient to inhibit
the mineralocorticoid receptor and thereby elicit a response being
sought (e.g., an "inhibition effective amount"). When the active
compound is administered as the salt, references to the amount of
active ingredient are to the free form (the non-salt form) of the
compound. In some embodiments, this amount is between 1 mg and 1000
mg per day, e.g., between 1 mg and 500 mg per day (between 1 mg and
200 mg per day).
[0114] In the method of the present technology, compounds,
optionally in the form of a salt, can be administered by any means
that produces contact of the active agent with the agent's site of
action. They can be administered by any conventional means
available for use in conjunction with pharmaceuticals, either as
individual therapeutic agents or in a combination of therapeutic
agents. They can be administered alone, but typically are
administered with a pharmaceutical carrier selected on the basis of
the chosen route of administration and standard pharmaceutical
practice. The compounds of the technology can, for example, be
administered orally, parenterally (including subcutaneous
injections, intravenous, intramuscular, intrasternal injection, or
infusion techniques), by inhalation spray, or rectally, in the form
of a unit dosage of a pharmaceutical composition containing an
effective amount of the compound and conventional non-toxic
pharmaceutically-acceptable carriers, adjuvants, and vehicles.
Liquid preparations suitable for oral administration (e.g.,
suspensions, syrups, elixirs, and the like) can be prepared
according to techniques known in the art and can employ any of the
usual media such as water, glycols, oils, alcohols, and the like.
Solid preparations suitable for oral administration (e.g., powders,
pills, capsules, and tablets) can be prepared according to
techniques known in the art and can employ such solid excipients as
starches, sugars, kaolin, lubricants, binders, disintegrating
agents, and the like. Parenteral compositions can be prepared
according to techniques known in the art and typically employ
sterile water as a carrier and optionally other ingredients, such
as a solubility aid. Injectable solutions can be prepared according
to methods known in the art wherein the carrier comprises a saline
solution, a glucose solution, or a solution containing a mixture of
saline and glucose. Further description of methods suitable for use
in preparing pharmaceutical compositions for use in the present
technology and of ingredients suitable for use in said compositions
is provided in Remington's Pharmaceutical Sciences, 18th edition,
edited by A. R. Gennaro, Mack Publishing Co., 1990. Compounds of
the present technology can be made by a variety of methods depicted
in the synthetic reaction schemes provided herein. The starting
materials and reagents used in preparing these compounds generally
are either available from commercial suppliers, such as Aldrich
Chemical Co., or are prepared by methods known to those skilled in
the art following procedures set forth in references such as Fieser
and Fieser's Reagents for Organic Synthesis, Wiley & Sons: New
York, Volumes 1-21; R. C. LaRock, Comprehensive Organic
Transformations, 2nd edition Wiley-VCH, New York 1999;
Comprehensive Organic Synthesis, B. Trost and I. Fleming (Eds.)
vol. 1-9 Pergamon, Oxford, 1991; Comprehensive Heterocyclic
Chemistry, A. R. Katritzky and C. W. Rees (Eds) Pergamon, Oxford
1984, vol. 1-9; Comprehensive Heterocyclic Chemistry II, A. R.
Katritzky and C. W. Rees (Eds) Pergamon, Oxford 1996, vol. 1-11;
and Organic Reactions, Wiley & Sons: New York, 1991, Volumes
1-40. The synthetic reaction schemes and examples provided herein
are merely illustrative of some methods by which the compounds of
the present technology can be synthesized, and various
modifications to these synthetic reaction schemes can be made and
will be suggested to one skilled in the art having referred to the
disclosure contained in this application.
[0115] The starting materials and the intermediates of the
synthetic reaction schemes can be isolated and purified if desired
using conventional techniques, including but not limited to,
filtration, distillation, crystallization, chromatography, and the
like. Such materials can be characterized using conventional means,
including physical constants and spectral data.
Description
[0116] The technology described herein relates to nucleotide
analogs and related methods, compositions (e.g., reaction
mixtures), kits, and systems for manipulating, detecting,
isolating, and sequencing nucleic acids. In particular, some
embodiments of the nucleotide analogs comprise an alkyne moiety
that provides both terminating and linking functionalities. The
technology provides advantages over conventional methods such as a
lower cost and reduced complexity.
[0117] 1. Nucleotide Analogs
[0118] Provided herein are analogs of nucleotides. In some
embodiments, the nucleotide analogs comprise one or more alkyne
terminator moieties. For example, in some embodiments the
technology provides a 3'-O-blocked nucleotide analog that is a
3'-O-alkynyl nucleotide analog. In some embodiments, the
3'-O-blocked nucleotide analog is a 3'-O -propargyl nucleotide
analog having a structure as shown below:
##STR00010##
wherein B is the base of the nucleotide, e.g., adenine, guanine,
cytosine, thymine, or uracil, e.g., B is one of:
##STR00011##
or a natural or synthetic nucleobase, e.g., a modified purine such
as hypoxanthine, xanthine, 7-methylguanine; a modified pyrimidine
such as 5,6-dihydrouracil, 5-methylcytosine,
5-hydroxymethylcytosine; etc. and wherein P comprises a phosphate
moiety (e.g., a monophosphate, a diphosphate, a triphosphate, a
tetraphosphate); a 5' hydroxyl; an alpha thiophosphate (e.g.,
phosphorothioate or phosphorodithioate), a beta thiophosphate
(e.g., phosphorothioate or phosphorodithioate), and/or a gamma
thiophosphate (e.g., phosphorothioate or phosphorodithioate); or an
alpha methylphosphonate, a beta methylphosphonate, and/or a gamma
methylphosphonate, as defined herein.
[0119] The nucleotide analogs are not limited to a specific
phosphate group. In some embodiments, the phosphate group is a
monophosphate group or a polyphosphate such as a diphosphate group,
a triphosphate group, or a tetraphosphate group. In some
embodiments, the phosphate group is a pyrophosphate. In some
embodiments, P represents a group comprising a 5' hydroxyl; an
alpha thiophosphate (e.g., phosphorothioate or phosphorodithioate),
a beta thiophosphate (e.g., phosphorothioate or
phosphorodithioate), and/or a gamma thiophosphate (e.g.,
phosphorothioate or phosphorodithioate); or an alpha
methylphosphonate, a beta methylphosphonate, and/or a gamma
methylphosphonate.
[0120] Moreover, the base of the nucleotide analogs is not limited
to a specific base. In some embodiments, the base is an adenine,
cytosine, guanine, thymine, uracil, and analogs thereof such as,
for example, acyclic bases. The nucleotide analogs are not limited
to a specific sugar moiety. In some embodiments, said sugar moiety
is a ribose, deoxyribose, dideoxyribose, and analogs, derivatives,
and/or modifications thereof (e.g., a thiofuranose, thioribose,
thiodeoxyribose, etc.). In some embodiments, the sugar moiety is an
arabinose or other related carbohydrate.
[0121] In some embodiments, the nucleotide analog is a
3'-O-propargyl-dNTP where N is selected from the group consisting
of A, C, G, T and U. In some embodiments, the nucleotide analogs
comprise detectable labels or tags such as an optically detectable
moiety (e.g., a fluorescent dye), electrochemically detectable
moieties (e.g., a redox active group), a quantum dot, a chromogen,
a biological image contrast agent, a drug delivery vehicle tag,
etc.
[0122] The synthesis of compounds provided herein is performed as
described in, e.g., Bentley et al. (2008) "Accurate whole genome
sequencing using reversible terminator chemistry" Nature 456(7218):
53-9 and Ju et al. (2006) "Four Color DNA Sequencing by synthesis
using cleavable fluorescent nucleotide reversible terminators,"
PNAS 103(52): 19635-40, incorporated herein by reference, with the
modifications as needed to provide the various nucleotide analogs
described herein. Additionally, various molecular characterizations
such as NMR, mass spectrometry, and chromatography/affinity
analysis are used in some embodiments to confirm successful
synthesis of the correct compounds.
[0123] In some embodiments, synthetic methods for compounds
encompassed and contemplated by the technology described herein
comprise one or more of the following synthetic schemes or
modifications thereof:
[0124] Synthesis of 3'-O-propargyl dCTP
##STR00012##
Synthesis of 3'-O-propargyi dTTP
##STR00013##
Synthesis of 3'-O-propargyi dATP
##STR00014## ##STR00015##
Synthesis of 3'-O-propargyi dGTP
##STR00016## ##STR00017##
[0125] In some embodiments, the nucleotide analogs are used to
incorporate alkyne moieties into nucleic acid polymers, e.g., by a
polymerase. In some embodiments, a polymerase is modified to
enhance incorporation of the nucleotide analogs disclosed herein.
Exemplary modified polymerases are disclosed in U.S. Pat. Nos.
4,889,818; 5,374,553; 5,420,029; 5,455,170; 5,466,591; 5,618,711;
5,624,833; 5,674,738; 5,789,224; 5,795,762; 5,939,292; and U.S.
Patent Publication Nos. 2002/0012970 and 2004/0005599. A
non-limiting example of a modified polymerase includes G46E E678G
CS5 DNA polymerase, G46E E678G CS5 DNA polymerase, E615G Taq DNA
polymerase, .DELTA.ZO5R polymerase, and G46E L329A E678G CS5 DNA
polymerase disclosed in U.S. Patent Publication No. 2005/0037398.
In some embodiments, the polymerase is a Thermococcus sp. 9.degree.
N-7 polymerase sold under the trade name THERMINATOR (e.g.,
THERMINATOR II) by New England BioLabs (Ipswich, Mass.). The
production of modified polymerases can be accomplished using many
conventional techniques in molecular biology and recombinant DNA
described herein and known in the art. In some embodiments,
polymerase mutants, such as those described in U.S. Pat. No.
5,939,292, which incorporate NTPs as well as dNTPs are used.
[0126] In some embodiments the nucleotide analogs contain tags in
addition to alkyne moieties (see supra). In some embodiments,
nucleotide analogs with 3' alkyne moieties are used to terminate a
polymerase reaction. Chemical tags containing an azido moiety can
then be appended to the nucleic acid polymer through click
chemistry. In some embodiments, the reaction of the terminator
alkyne compound with the azido moiety-containing compound forms a
triazole compound. In some embodiments, the triazole compound
functions as a nucleic acid backbone and further enzymatic
reactions such as PCR are performed on the triazole compound.
[0127] 2. Oligonucleotides
[0128] In some embodiments, the nucleotide analogs find use for the
synthesis of triazole-backbone-modified nucleic acids (e.g.,
oligonucleotide analogs). For example, the nucleotide analogs find
use in methods for aqueous, solid-phase oligonucleotide synthesis.
Such methods thus obviate the need for, inter alia, use of organic
solvents, deprotection steps, and capping steps in some
conventional syntheses; in addition, aqueous methods minimize or
eliminate the undesired oxidation of phosphorous in the synthesized
compounds, e.g., during cycle synthesis. It is contemplated that an
advantage of aqueous-phase synthesis is that it is more rapid than
conventional organic-phase synthesis techniques.
[0129] In some embodiments are provided a
triazole-backbone-modified oligonucleotide comprising nucleotide
analogs provided herein. That is, the nucleotide analogs described
herein find use in the synthesis of modified oligonucleotides
comprising one or more nucleotide analogs and comprising triazole
groups in the molecular backbone. In some embodiments,
oligonucleotides comprise some conventional nucleotides and some
nucleotide analogs in various proportions. In some embodiments,
oligonucleotides comprise only nucleotide analogs and do not
comprise conventional nucleotides.
[0130] Accordingly, in some embodiments are provided a nucleotide
analog as described elsewhere herein, e.g., having a structure
according to:
##STR00018##
where B is the base of the nucleotide (e.g., adenine, guanine,
thymine, cytosine, or a natural or synthetic nucleobase, e.g., a
modified purine such as hypoxanthine, xanthine, 7-methylguanine; a
modified pyrimidine such as 5,6-dihydrouracil, 5-methylcytosine,
5-hydroxymethylcytosine; etc.).
[0131] Such nucleotide analogs and variants and modified
derivatives thereof (e.g., comprising a base analog or alternative
sugar as described herein) provide a directional, bi-functional
nucleotide analog (e.g., a directional, bi-functional
polymerization agent), e.g., for the synthesis of an
oligonucleotide (e.g., an oligonucleotide analog, e.g., an
oligonucleotide comprising a nucleotide analog described herein).
In some embodiments, the directional, bi-functional nucleotide
analog provides for synthesis of an oligonucleotide in a 5' to 3'
direction and in some embodiments the directional, bi-functional
nucleotide analog provides for synthesis of an oligonucleotide in a
3' to 5' direction. In some embodiments, the synthesis of the
oligonucleotide comprises use of propargyl moiety and a linker
attached to a solid support (e.g., a linker (e.g., a carboxylate
linker) that is cleavable under acidic (e.g., mildly acidic)
conditions). In some embodiments, the synthesis of the
oligonucleotide comprises use of a propargyl moiety and an azide
linker attached to a solid support. In some embodiments, a
3'-thio-modified propargyl moiety is linked to the solid support
and is cleaved with a reagent comprising silver nitrate or mercuric
chloride. In some embodiments, the solid support comprises a
controlled pore glass, silica, sephadex, agarose, acrylamide,
latex, or polystyrene, etc., provided, in some embodiments, as
microspheres.
[0132] Representative synthetic schemes for producing
oligonucleotides are provided as follows:
a. 3' to 5' oligonucleotide synthesis using 3'-alkynyl/5'-azido
nucleotide analog
##STR00019##
[0134] In exemplary synthetic scheme a, X is a solid support, the
wavy line (.about.) is a cleavable linker, B.sub.1 is a first
nucleotide base, and B.sub.2 is a second nucleotide base that may
be the same or different than B.sub.1. The first step (1) links the
first nucleotide analog to the solid support (e.g., using a click
chemistry reaction, e.g., using a copper-based catalyst). Then, one
or more (e.g., multiple) rounds of the second step (2) (e.g., using
a click chemistry reaction, e.g., using a copper-based catalyst)
result in synthesis of the oligonucleotide analog, with each step
adding another nucleotide analog to the growing polymer chain.
b. 5' to 3' oligonucleotide synthesis using 3'-alkynyl/5'-azido
nucleotide analog
##STR00020##
[0136] In exemplary synthetic scheme b, X is a solid support, the
wavy line (.about.) is a cleavable linker (e.g., a carboxylate
linker), B.sub.1 is a first nucleotide base, and B.sub.2 is a
second nucleotide base that may be the same or different than
B.sub.1. After reacting the first nucleotide analog with the solid
support comprising a linker and reactive carboxylate moiety (e.g.,
to form an ester link), one or more (e.g., multiple) rounds of
nucleotide addition and reaction (1) (e.g., using a click chemistry
reaction, e.g., using a copper-based catalyst) result in synthesis
of the oligonucleotide analog, with each step adding another
nucleotide analog to the growing polymer chain.
c. 5' to 3' oligonucleotide synthesis using 3'-azido/5'-alkynyl
nucleotide analog
##STR00021##
[0138] In exemplary synthetic scheme c, X is a solid support, the
wavy line (.about.) is a cleavable linker, B.sub.1 is a first
nucleotide base, and B.sub.2 is a second nucleotide base that may
be the same or different than B.sub.1. The first step (1) links the
first nucleotide analog to the solid support (e.g., using a click
chemistry reaction, e.g., using a copper-based catalyst). Then, one
or more (e.g., multiple) rounds of the second step (2) (e.g., using
a click chemistry reaction, e.g., using a copper-based catalyst)
result in synthesis of the oligonucleotide analog, with each step
adding another nucleotide analog to the growing polymer chain.
d. 3' to 5' oligonucleotide synthesis using 3'-azido/5'-alkynyl
nucleotide analog
##STR00022##
[0140] In exemplary synthetic scheme d, X is a solid support, the
wavy line (.about.) is a cleavable linker, B.sub.1 is a first
nucleotide base, and B2 is a second nucleotide base that may be the
same or different than B.sub.1. The first step (1) links the first
nucleotide analog to the solid support (e.g., using a click
chemistry reaction, e.g., using a copper-based catalyst). Then, one
or more (e.g., multiple) rounds of the second step (2) (e.g., using
a click chemistry reaction, e.g., using a copper-based catalyst)
result in synthesis of the oligonucleotide analog, with each step
adding another nucleotide analog to the growing polymer chain.
[0141] In some embodiments, the oligonucleotide and/or nucleotide
analog is reacted with a linker to attach the oligonucleotide
and/or nucleotide analog to a solid support, e.g., a bead, a planar
surface (an array), a column, etc. The term "solid support" as used
herein refers to a material or group of materials having a rigid or
semi-rigid surface or surfaces. In many embodiments, at least one
surface of the solid support is substantially flat, although in
some embodiments it may be desirable to separate regions of the
solid support with, for example, wells, raised regions, pins,
etched trenches, or the like. According to other embodiments, the
solid support takes the form of beads, resins, gels, microspheres,
or other geometric configurations. See, e.g., U.S. Pat. No.
5,744,305 and U.S. Pat. Pub. Nos. 20090149340 and 20080038559 for
exemplary substrates. In some embodiments, the linker is a
cleavable linker (e.g., cleavable by light, heat, chemical, or
biochemical reaction).
[0142] In exemplary synthesis schemes a, b, c, and d, embodiments
of methods for synthesizing an oligonucleotide comprise one or more
additional steps of adding a nucleotide analog, reacting a
nucleotide analog, washing away and/or otherwise removing an
unincorporated nucleotide analog (e.g., after a synthesis step),
cleaving a linker, isolating a synthesized oligonucleotide,
purifying a synthesized oligonucleotide, and/or adding a tag or a
label to the synthesized oligonucleotide.
[0143] 3. Tagging and Labeling
[0144] Nucleic acid detection methodologies serve a critical role
in the field of molecular diagnostics. The ability to manipulate
biomolecules specifically and efficiently has been the core driving
force behind many successful nucleic acid detection technologies.
Among the many molecular biology techniques, the ability to label
or "tag" a biomolecule of interest has been a key technology for
subsequent detection and identification of the biomolecule.
[0145] Accordingly, in some embodiments the technology provides
compositions, methods, systems, and kits related to tagging of
biomolecules such as nucleic acids and/or nucleotides. In some
embodiments, alkyne-containing nucleotides such as
3'-O-propargyl-modified nucleotides (e.g.,3'-O-propargyl dNTPs) are
incorporated into a nucleic acid in a polymerase extension
reaction. In some embodiments, the nucleotide analog halts the
polymerase reaction. In some embodiments, the alkyne-containing
nucleotide is used (e.g., without further processing and/or
purification) in a tagging reaction with an azide-modified tag or
labeling reagent using chemical ligation (e.g., a click chemistry
reaction). The covalent linkage created using this chemistry mimics
natural nucleic acid phosphodiester bonds, thus providing a
conjugated product that is suitable for use in subsequent enzymatic
reactions such as a polymerase chain reaction.
[0146] Labels and tags are compounds, structures, or elements that
are amenable to at least one method of detection and/or isolation
that allows for discrimination between different labels and/or
tags. For example, labels and/or tags comprise semiconductor
nanocrystals, metal compounds, peptides, antibodies, small
molecules, isotopes, particles, or structures having different
shapes, colors, barcodes, or diffraction patterns associated
therewith or embedded therein, strings of numbers, random fragments
of proteins or nucleic acids, or different isotopes.
[0147] The term "label" or "tag" are used interchangeably herein to
refer to any chemical moiety attached to a nucleotide or nucleic
acid, wherein the attachment may be covalent or non-covalent.
Preferably, the label is detectable and renders the nucleotide or
nucleic acid detectable to the practitioner of the technology.
Exemplary detectable labels that find use with the technology
provided herein include, for example, a fluorescent label, a
chemiluminescent label, a quencher, a radioactive label, biotin,
and gold, or combinations thereof. Detectable labels include
luminescent molecules, fluorochromes, fluorescent quenching agents,
colored molecules (e.g., chromogens used for in situ hybridization
(ISH, FISH) and bright field imaging applications), radioisotopes,
or scintillants. Detectable labels also include any useful linker
molecule (such as biotin, avidin, digoxigenin, streptavidin, HRP,
protein A, protein G, antibodies or fragments thereof, Grb2,
polyhistidine, Ni.sup.2+, FLAG tags, myc tags), heavy metals,
enzymes (examples include alkaline phosphatase, peroxidase, and
luciferase), electron donors/acceptors, acridinium esters, dyes,
and calorimetric substrates. It is also envisioned that a change in
mass may be considered a detectable label, e.g., as finds use in
surface plasmon resonance detection.
[0148] The technology also finds use in applications such as
linking DNA-containing alkynes to an image contrast agent (e.g.,
meglumines, ferumoxsil, ferumoxides, gadodiamide, gadoversetamide,
gallium compounds, indium compounds, thallium compounds, rubidium
compounds, technetium compounds, iopamidol, etc.), e.g., for
biomedical imaging (e.g., magnetic resonance imaging (MRI),
computed tomography (CT) scanning, X-ray, etc.), coupling DNA to
oligo and/or antisense drug-delivery vehicle tags (e.g., steroids,
lipids, cholesterol, vitamins, hormones, carbohydrates, and/or
receptor-specific ligands (e.g., folate, nicotinamide,
acetylcholine, GABA, glutamate, serotonin, etc.), and coupling to
chromogen moieties for in situ hybridization applications. The
skilled artisan would readily recognize useful detectable labels
that are not mentioned above, which may be employed in the
operation of the present invention.
[0149] As such, the technology is not limited in the label or tag
that is linked to the nucleic acid, e.g., by use of an azide
labeling reagent in a click chemistry reaction. Thus, in some
embodiments, the label comprises a fluorescently detectable moiety
that is based on a dye, wherein the dye is a xanthene, fluorescein,
rhodamine, BODIPY, cyanine, coumarin, pyrene, phthalocyanine,
phycobiliprotein, ALEXA FLUOR.RTM. 350, ALEXA FLUOR.RTM. 405, ALEXA
FLUOR.RTM. 430, ALEXA FLUOR.RTM. 488, ALEXA FLUOR.RTM. 514, ALEXA
FLUOR.RTM. 532, ALEXA FLUOR.RTM. 546, ALEXA FLUOR.RTM. 555, ALEXA
FLUOR.RTM. 568, ALEXA FLUOR.RTM. 568, ALEXA FLUOR.RTM. 594, ALEXA
FLUOR.RTM. 610, ALEXA FLUOR.RTM. 633, ALEXA FLUOR.RTM. 647, ALEXA
FLUOR.RTM. 660, ALEXA FLUOR.RTM. 680, ALEXA FLUOR.RTM. 700, ALEXA
FLUOR.RTM. 750, a fluorescent semiconductor crystal, or a squaraine
dye. In some embodiments, the tag or label comprises a
radioisotope, a spin label, a quantum dot, or a bioluminescent
moiety. In some embodiments, the label is a fluorescently
detectable moiety as described in, e.g., Haugland (September 2005)
MOLECULAR PROBES HANDBOOK OF FLUORESCENT PROBES AND RESEARCH
CHEMICALS (10th ed.), which is herein incorporated by reference in
its entirety.
[0150] In some embodiments the label (e.g., a fluorescently
detectable label) is one available from ATTO-TEC GmbH (Am
Eichenhang 50, 57076 Siegen, Germany), e.g., as described in U.S.
Pat. Appl. Pub. Nos. 20110223677, 20110190486, 20110172420,
20060179585, and 20030003486; and in U.S. Pat. No. 7,935,822, all
of which are incorporated herein by reference.
[0151] In some embodiments, the nucleic acid and/or nucleotide
comprising a modified nucleotide, e.g., comprising an alkyne group,
is tagged with a moiety that provides for detection and/or
isolation of the nucleic acid and/or nucleotide by specific
interaction with a second moiety. For example, in some embodiments,
the nucleic acid and/or nucleotide is linked (e.g., by a click
chemistry reaction) to a tag comprising an azide and a biotin
moiety, an epitope, an antigen, an aptamer, an affinity tag, a
histidine tag, a barcode oligonucleotide, a poly-A tail, a capture
oligonucleotide, a protein, a sugar, a chelator, a mass tag (e.g.,
2-nitro-methyl-benzyl group, a 2-nitro-methyl-3-fluorobenzyl group,
a 2-nitro-.alpha.-methyl-3,4-difluorobenzyl group, a
2-nitro-.alpha.-methyl-3,4-dimethoxybenzyl group, a
2-nitro-.alpha.-methyl-benzyl group, a
2-nitro-.alpha.-methyl-3-fluorobenzyl group, a
2-nitro-methyl-3,4-difluorobenzyl group, a
2-nitro-.alpha.-methyl-3,4-dimethoxybenzyl), a charge tag.
[0152] In some embodiments, the nucleic acid and/or nucleotide
comprising an alkyne is reacted with a linker comprising an azide
to attach the nucleic acid and/or nucleotide to a solid support,
e.g., a bead, a planar surface (an array), a column, etc. In some
embodiments, the linker is a cleavable linker (e.g., cleavable by
light, heat, chemical, or biochemical reaction).
[0153] 4. Reactions
[0154] In some embodiments, the technology finds use in linking an
oligonucleotide to a nucleic acid (e.g., a DNA, an RNA). For
example, in some embodiments, a nucleic acid comprising a
nucleotide analog (e.g., a nucleic acid comprising an alkyne group,
e.g., a 3'-O-propargyl nucleotide, e.g., a 3'-O-propargyl dNTP) is
linked to an oligonucleotide comprising a group (e.g., an azide
group) that is chemically reactive with the chemical moiety of the
nucleotide analog, e.g., by a click chemistry reaction. In some
embodiments, the oligonucleotide is single-stranded and in some
embodiments the oligonucleotide is double-stranded. In some
embodiments the nucleic acid is a DNA and in some embodiments the
nucleic acid is an RNA; in some embodiments the oligonucleotide is
a DNA and in some embodiments the oligonucleotide is an RNA.
[0155] In some embodiments, methods of the technology involve
attaching an adaptor to a nucleic acid. In some embodiments an
adaptor comprises a functional moiety for chemical ligation to a
nucleotide analog. For example, in some embodiments an adaptor
comprises an azide group (e.g., at the 5' end) that is reactive
with an alkynyl group (e.g., a propargyl group, e.g., at the 3' end
of a nucleic acid comprising the nucleotide analog), e.g., by a
click chemistry reaction (e.g., using a copper (e.g., a
copper-based) catalyst reagent).
[0156] In some embodiments the alkyne is a butargyl group or a
structural derivative thereof. In some embodiments the alkyne
comprises a sulfur atom, e.g., to provide a thio-alkynyl, a
thio-propargyl (e.g. 3'-S-propargyl) group, or a structural
derivative thereof.
[0157] In some embodiments, the adaptors comprise a universal
sequence and/or an index, e.g., a barcode nucleotide sequence.
Additionally, adaptors can contain one or more of a variety of
sequence elements, including but not limited to, one or more
amplification primer annealing sequences or complements thereof,
one or more sequencing primer annealing sequences or complements
thereof, one or more barcode sequences, one or more common
sequences shared among multiple different adaptors or subsets of
different adaptors (e.g., a universal sequence), one or more
restriction enzyme recognition sites, one or more overhangs
complementary to one or more target polynucleotide overhangs, one
or more probe binding sites (e.g. for attachment to a sequencing
platform, such as a flow cell for massive parallel sequencing, such
as developed by Illumina, Inc.), one or more random or near-random
sequences (e.g. one or more nucleotides selected at random from a
set of two or more different nucleotides at one or more positions,
with each of the different nucleotides selected at one or more
positions represented in a pool of adaptors comprising the random
sequence), and combinations thereof. Two or more sequence elements
can be non-adjacent to one another (e.g. separated by one or more
nucleotides), adjacent to one another, partially overlapping, or
completely overlapping. For example, an amplification primer
annealing sequence can also serve as a sequencing primer annealing
sequence. Sequence elements can be located at or near the 3' end,
at or near the 5' end, or in the interior of the adaptor
oligonucleotide. When an adaptor oligonucleotide is capable of
forming secondary structure, such as a hairpin, sequence elements
can be located partially or completely outside the secondary
structure, partially or completely inside the secondary structure,
or in between sequences participating in the secondary structure.
For example, when an adaptor oligonucleotide comprises a hairpin
structure, sequence elements can be located partially or completely
inside or outside the hybridizable sequences (the "stem"),
including in the sequence between the hybridizable sequences (the
"loop"). In some embodiments, the adaptor oligonucleotides in a
plurality of adaptor oligonucleotides having different barcode
sequences comprise a sequence element common among all adaptor
oligonucleotides in the plurality. A difference in sequence
elements can be any such that at least a portion of different
adaptors do not completely align, for example, due to changes in
sequence length, deletion or insertion of one or more nucleotides,
or a change in the nucleotide composition at one or more nucleotide
positions (such as a base change or base modification). In some
embodiments, an adaptor oligonucleotide comprises a 5' overhang, a
3' overhang, or both that is complementary to one or more target
polynucleotides. Complementary overhangs can be one or more
nucleotides in length, including but not limited to 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more nucleotides in length.
Complementary overhangs may comprise a fixed sequence.
Complementary overhangs may comprise a random sequence of one or
more nucleotides, such that one or more nucleotides are selected at
random from a set of two or more different nucleotides at one or
more positions, with each of the different nucleotides selected at
one or more positions represented in a pool of adaptors with
complementary overhangs comprising the random sequence. In some
embodiments, an adaptor overhang is complementary to a target
polynucleotide overhang produced by restriction endonuclease
digestion. In some embodiments, an adaptor overhang consists of an
adenine or a thymine.
[0158] In some embodiments, the adaptor sequences contain a
molecular binding site identification element to facilitate
identification and isolation of the target nucleic acid for
downstream applications. Molecular binding as an affinity mechanism
allows for the interaction between two molecules to result in a
stable association complex. Molecules that can participate in
molecular binding reactions include proteins, nucleic acids,
carbohydrates, lipids, and small organic molecules such as ligands,
peptides, or drugs.
[0159] When a nucleic acid molecular binding site is used as part
of the adaptor, it can be used to employ selective hybridization to
isolate a target sequence. Selective hybridization may restrict
substantial hybridization to target nucleic acids containing the
adaptor with the molecular binding site and capture nucleic acids,
which are sufficiently complementary to the molecular binding site.
Thus, through "selective hybridization" one can detect the presence
of the target polynucleotide in an impure sample containing a pool
of many nucleic acids. An example of a nucleotide-nucleotide
selective hybridization isolation system comprises a system with
several capture nucleotides, which are complementary sequences to
the molecular binding identification elements, and are optionally
immobilized to a solid support. In other embodiments, the capture
polynucleotides are complementary to the target sequences itself or
a barcode or unique tag contained within the adaptor. The capture
polynucleotides can be immobilized to various solid supports, such
as inside of a well of a plate, mono-dispersed spheres,
microarrays, or any other suitable support surface known in the
art. The hybridized complementary adaptor polynucleotides attached
on the solid support can be isolated by washing away the
undesirable non-binding nucleic acids, leaving the desirable target
polynucleotides behind. If complementary adaptor molecules are
fixed to paramagnetic spheres or similar bead technology for
isolation, then spheres can then be mixed in a tube together with
the target polynucleotide containing the adaptors. When the adaptor
sequences have been hybridized with the complementary sequences
fixed to the spheres, undesirable molecules can be washed away
while spheres are kept in the tube with a magnet or similar agent.
The desired target molecules can be subsequently released by
increasing the temperature, changing the pH, or by using any other
suitable elution method known in the art.
[0160] As described elsewhere herein, a "barcode" or "barcode
oligonucleotide" is a known nucleic acid sequence that allows some
feature of a nucleic acid with which the barcode is associated to
be identified. For example, in some embodiments, the feature of the
nucleic acid to be identified is the sample or source from which
the nucleic acid is derived. The barcode sequence generally
includes certain features that make the sequence useful, e.g., in
sequencing reactions. For example, the barcode sequences are
designed to have minimal or no homopolymer regions, e.g., 2 or more
of the same base in a row such as AA or CCC, within the barcode
sequence. In some embodiments, the barcode sequences are also
designed so that they are at least one edit distance away from the
base addition order when performing a manipulation or molecular
biological process, such as base-by-base sequencing, ensuring that
the first and last bases do not match the expected bases of the
sequence.
[0161] In some embodiments, the barcode sequences are designed such
that each sequence is correlated to a particular nucleic acid.
Methods of designing sets of barcode sequences are shown, for
example, in U.S. Pat. No. 6,235,475, the contents of which are
incorporated by reference herein in their entirety. In some
embodiments, barcode sequences range from about 5 nucleotides to
about 15 nucleotides. In a particular embodiment, the barcode
sequences range from about 4 nucleotides to about 7 nucleotides. In
some embodiments, lengths and sequences of barcode sequences are
designed to achieve a desired level of accuracy of determining the
identity of a nucleic acid. For example, in some embodiments
barcode sequences are designed such that after a tolerable number
of point mutations, the identity of the associated nucleic acid is
deduced with a desired accuracy. In some embodiments, a Tn-5
transposase (commercially available from Epicentre Biotechnologies;
Madison, Wis.) cuts a nucleic acid into fragments and inserts short
pieces of DNA into the cuts. The short pieces of DNA are used to
incorporate the barcode sequences.
[0162] Methods for designing sets of barcode sequences and other
methods for attaching adaptors (e.g., comprising barcode sequences)
are shown in U.S. Pat. Nos. 6,138,077; 6,352,828; 5,636,400;
6,172,214; 6235,475; 7,393,665; 7,544,473; 5,846,719; 5,695,934;
5,604,097; 6,150,516; RE39,793; 7,537,897; 6172,218; and 5,863,722,
the content of each of which is incorporated by reference herein in
its entirety.
[0163] With appropriate changes to reaction schemes, use of 5'
alkynyl/3' azido and 5' azido/3' alkynyl nucleotide analogs are
contemplated to be interchangeable in reactions with the
appropriate reactive substrates for linking to the 5' and/or 3'
ends of nucleotide analogs, e.g., by click chemistry.
[0164] In some embodiments, the technology finds use in a primer
extension reaction (see, e.g., FIG. 1) and/or adaptor ligation
(see, e.g., FIG. 1). In particular embodiments, a primer annealed
to a template (e.g., a target nucleic acid) is extended by a
polymerase, which adds a nucleotide analog to the primer. While
FIG. 1 shows the exemplary addition of a G-containing nucleotide
analog across from the C base in the template, the primer extension
technology is not limited in the bases that are added. Then, in
some embodiments, an azide-modified DNA (e.g., an adaptor, e.g., an
adaptor comprising a primer binding site and/or a barcode) is
ligated to the primer extension product (e.g., by click chemistry).
The ligation product comprises a linkage that mimics the
conventional nucleic acid backbone, e.g., a triazole, and that is
biocompatible with downstream enzymatic and/or chemical reactions,
e.g., PCR (e.g., see FIG. 1).
[0165] 5. Sequencing
[0166] In some embodiments, the nucleotide analogs find use in
nucleic acid sequencing, e.g., "next generation sequencing" (NGS).
For example, DNA sequencing-by-synthesis (SBS) involves determining
DNA sequence by detecting certain signals (e.g., pyrophosphate
groups) that are generated when a nucleotide is incorporated by a
polymerase reaction. Other SBS methods involve alternate means of
detecting the polymerase addition of nucleotides such as detection
of light emission, change in fluorescence, chance in pH, or some
other physical or chemical change. For example, Illumina's
reversible terminator sequencing relies upon dye-containing
reversible terminator bases. When one such base is added to the
growing nucleic acid polymer, the reaction is halted and the dye on
the terminal nucleic acid is detectable. The terminator-containing
molecule can then be treated with a cleavage enzyme that reverses
the termination and allows for the addition of additional
nucleotides. This step-wise process is an improvement on earlier
technology, but the extra cleavage step and subsequent sample
purification leave room for further improvement.
[0167] In some embodiments, the present invention provides
functional terminator nucleotides containing 3'-alkynes that are
incorporated into a growing nucleic acid polymer and terminate the
extension reaction. The 3'-alkyne can be immediately used in a
reaction with an azide-modified tag through click chemistry. The
linkage created through click chemistry mimics a natural nucleic
acid phosphodiester bond and provides for the use of the conjugated
product in subsequent enzymatic reactions such as PCR. In this way,
some embodiments of the present invention eschew the terminator
cleavage step of the reversible terminator sequencing reaction and
thereby decrease the run time of the reaction (see, e.g., the
embodiment depicted in FIG. 2).
[0168] In some embodiments, a nucleotide analog, e.g., a 3'-alkynyl
nucleotide analog (e.g., a 3'-O-propargyl nucleotide analog such as
a 3'-O-propargyl dNTP) is used in a polymerase reaction and nucleic
acid extension products are made in which the 3' end comprises an
alkyne group. The alkyne-modified nucleic acid products can
subsequently be used as a specific substrate in chemical ligation
reactions with compounds containing azido moieties through click
chemistry (e.g., a copper(I)-catalyzed 1,3-dipolar cyclo-addition
reaction). This type of click chemistry conjugates alkynes and
azides, forming a covalent linkage (e.g., a five-membered triazole
ring) between the alkyne-containing compound and the
azide-containing compound. For example, a 5'-azide-modified DNA
fragment can be chemically ligated to a 3'-alkyne-modified DNA
fragment using click chemistry. This conjugated DNA product can
then be used as input in subsequent enzymatic reactions such as PCR
or sequencing because the covalent linkage created by the
five-membered triazole ring mimics the natural phosphodiester bond
of the DNA backbone and does not significantly and/or detectably
inhibit subsequent enzymatic activities.
[0169] The contemplated reactions involving the nucleotide analogs
provide multiple potential detection events. In some embodiments,
the nucleotide analog incorporates a specific fluorophore into the
elongating nucleic acid strand. In some embodiments, the addition
of the nucleotide analog creates a detectable signal such as
pyrophosphate. In some embodiments, the incorporation of the
nucleotide analog can be detected by emission of light, change in
fluorescence, change in pH, change in conformation, or some other
chemical change. In some embodiments the click chemistry reaction
between the incorporated nucleotide analog and a compound
comprising an azido moiety can be detected in ways similar to the
incorporation of the nucleotide analog.
[0170] Because of the click chemistry, the alkyne-containing
nucleotide analogs readily react with compounds containing azido
moieties. Using this click chemistry, various tags can be inserted
covalently into an elongating nucleic acid strand that contains one
of the nucleotide analogs. Examples of such tags include but are
not limited to fluorescent dyes, DNA, RNA, oligonucleotides,
nucleosides, proteins, amino acids, polypeptides, polysaccharides,
nucleic acid, synthetic polymers, and viruses.
[0171] The technology relates in some embodiments to methods for
sequencing a nucleic acid. In some embodiments, sequencing is
performed by the following sequence of events with the exemplary
use of a nucleotide analog comprising a 3'-O-propargyl moiety.
First, the nucleotide analog is oriented in the polymerase active
site (e.g., by a polymerase) to be base-paired to a complementary
base of the template strand and to be adjacent to the free 3'
hydroxyl of the growing synthesized strand. Next, the nucleotide
analog is added to the 3' end of a growing strand by the
polymerase, e.g., by the enzyme-catalyzed attack of the 3' hydroxyl
on the alpha-phosphate of the nucleotide analog. Further extension
of the strand by the polymerase is blocked by the 3'-O-propargyl
terminating group on the incorporated nucleotide analog. In some
embodiments, the strand is then subjected to a PCR reaction and
used in various sequencing methods.
[0172] In some embodiments, the 3'-O-propargyl terminating moiety
is treated with an azide-tagged DNA molecule. This removes the
terminator alkyne. Once the terminator has been removed the growing
strand is free for further polymerization: the next base is
incorporated to continue another cycle, e.g., a nucleotide analog
is oriented in the polymerase active site, the nucleotide analog is
added to the 3' end of the growing strand by the polymerase, and
the nucleotide analog is queried to identify the base added.
[0173] Some embodiments relate to parallel (e.g., massively
parallel) sequencing.
[0174] In some embodiments, the technology described herein is
related to a method for sequencing nucleic acid comprising:
hybridizing a primer to a nucleic acid to form a hybridized
primer/nucleic acid complex, providing a plurality of nucleotide
analogs, each nucleotide analog comprising a nucleotide and an
alkyne moiety attached to the nucleotide, reacting the hybridized
primer/nucleic acid complex and the nucleotide analog with a
polymerase to add the nucleotide analog to the primer by a
polymerase reaction to form an extended product comprising an
incorporated nucleotide analog, querying the extended product to
identify the incorporated nucleotide analog, reacting the extended
product with an azide-containing compound to form a structure
comprising a triazole ring. In some embodiments the nucleotide
analogs comprise 3'-O-propargyl-dNTP where N is selected from the
group consisting of A, C, G, T and U. In some embodiments, the
nucleic acid conjugate comprising a triazole ring is used in
subsequent enzymatic reactions such as polymerase chain reaction.
In some embodiments, the method includes providing conventional
nucleotides during the same step that the nucleotide analogs are
provided.
[0175] In some embodiments, the technology described herein
provides a method for sequencing a nucleic acid comprising:
hybridizing a primer to a nucleic acid to form a hybridized
primer/nucleic acid complex, providing a plurality of nucleotides
(some of which are nucleotide analogs comprising a nucleotide and
an alkyne moiety attached to the nucleotide), reacting the
hybridized primer/nucleic acid complex and the nucleotide analog
with a polymerase to add the nucleotide analog to the primer by a
polymerase reaction to form an extended product comprising an
incorporated nucleotide analog, and querying the structure
comprising a triazole ring to identify which analog nucleotide was
incorporated.
[0176] In some embodiments, the methods further comprise reacting
the extended product with an azide-containing compound to form a
structure comprising a triazole ring. In some embodiments the
nucleotide analogs comprise 3'-O-propargyl-dNTP where N is selected
from the group consisting of A, C, G, T and U. In some embodiments,
the structure comprising a triazole ring is used in subsequent
enzymatic reactions such as polymerase chain reaction. In some
embodiments, the method includes providing conventional nucleotides
during the same step that the nucleotide analogs are provided.
[0177] In some particular embodiments comprising use of a
polymerase to incorporate the nucleotide analogs into a nucleic
acid (e.g., PCR, primer extension, DNA sequencing (e.g., NGS),
single-base extension, etc.), the polymerase is a polymerase
obtained from, derived from, isolated from, cloned from, etc. a
Thermococcus species (e.g., an organism of the taxonomic lineage
Archaea; Euryarchaeota; Thermococci; Thermococcales;
Thermococcaceae; Thermococcus). In some embodiments, the polymerase
is obtained from, derived from, isolated from, cloned from, etc. a
Thermococcus species 9.degree. N-7 (see, e.g., Southworth, et al.
(1996) "Cloning of thermostable DNA polymerases from
hyperthermophilic marine Archaea with emphasis on Thermococcus sp.
9.degree. N-7 and mutations affecting 3'-5' exonuclease activity"
Proc. Natl. Acad. Sci. USA 93: 5281, incorporated herein by
reference in its entirety). The nucleotide sequence encoding the
wild type Thermococcus sp. 9.degree. N-7 polymerase is provided by
GenBank Accession Number U47108 (e.g., the polymerase gene starts
at nucleotide 40 of Accession Number U47108) and the amino acid
sequence of the wild type Thermococcus sp. 9.degree. N-7 polymerase
is provided by GenBank Accession Number AAA88769.
[0178] In some embodiments, the polymerase comprises amino acid
substitutions that provide for improved incorporation of modified
substrates such as modified dideoxynucleotides, ribonucleotides,
and acyclonucleotides. In some embodiments, the polymerase
comprises amino acid substitutions that provide for improved
incorporation of nucleotide analogs comprising modified 3'
functional groups such as the 3'-O-propargyl dNTPs described
herein. In some embodiments the amino acid sequence of the
polymerase comprises one or more amino acid substitutions relative
to the Thermococcus sp. 9.degree. N-7 wild-type polymerase amino
acid sequence, e.g., a substitution of alanine for the aspartic
acid at amino acid position 141 (D141A), a substitution of alanine
for the glutamic acid at amino acid position 143 (E143A), a
substitution of valine for the tyrosine at amino acid position 409
(Y409V), and/or a substitution of leucine for the alanine at amino
acid position 485 (A485L).
[0179] In some embodiments, the polymerase is provided in a
heterologous host organism such as Escherichia coil that comprises
a cloned Thermococcus sp. 9.degree. N-7 polymerase gene, e.g.,
comprising one or more mutations (e.g., D141A, E143A, Y409V, and/or
A485L). In some embodiments, the polymerase is a Thermococcus sp.
9.degree. N-7 polymerase sold under the trade name THERMINATOR
(e.g., THERMINATOR II) by New England BioLabs (Ipswich, Mass.).
[0180] In some embodiments, methods for producing polymerase
mutants and screening their activities (e.g., incorporation of
modified nucleotides) are described in, e.g., Gardner and Jack
(1999) "Determinants of nucleotide sugar recognition in an archaeon
DNA polymerase" Nucleic Acids Research 27(12): 2545, incorporated
by reference herein in its entirety. In particular, methods for
producing and identifying polymerase mutants that incorporate
modified nucleotides are provided by, e.g., Gardner and Jack (2002)
"Acyclic and dideoxy terminator preferences denote divergent sugar
recognition by archaeon and Taq DNA polymerases" Nucleic Acids
Research 30(2): 605, incorporated by reference herein in its
entirety. Additional assays for characterizing the incorporation of
modified nucleotides by various polymerases are described, e.g., in
Ruparel et al. (2005). Proc. Natl. Acad. Sci. USA. 26: 5932; Barnes
(1978). J. Mol. Biol. 119: 83; Sanger et al. (1977). Proc. Natl.
Acad. Sci. USA. 74: 5463; Haff and Simirnov (1997) Genome Methods
7: 378; and in U.S. Pat. No. 5,558,991, each incorporated herein by
reference in entirety.
[0181] 6. Uses
[0182] The nucleotide analogs provided herein find use in a wide
range of applications. Non-limiting examples of uses for the
nucleotide analogs described include use as antiviral and/or
anticancer agents. In some embodiments, the nucleotide analogs
provided herein find use in diagnostic medical imaging, e.g., as
contrast agents for use in, e.g., MRI, computed tomography (CT)
scans, X-ray imaging, angiography (e.g., venography, digital
subtraction angiography (DSA), arteriography), intravenous
urography, intravenous pyelography, myelography, interventional
medicine (e.g., angioplasty (e.g., percutaneous transluminal
angioplasty), artery ablation and/or occlusion (e.g., to treat
cancer and/or vascular abnormalities), and placement of stents),
arthrography, sialography, retrograde choledocho-pancreatography,
micturating cystography, etc. Additional illustrative and
non-limiting uses for such contrast agents include in vivo imaging
for human diagnostics, drug discovery, and drug development in
model systems (mouse models, etc.).
[0183] In some embodiments, an oligonucleotide comprising one or
more nucleotide analogs described herein finds use in a
nanoconjugate (e.g., comprising nanoparticles such as titanium
dioxide nanoparticles, an oligonucleotide (e.g., comprising a
nucleotide analog), and/or a contrast agent (e.g., a heavy metal
contrast agent such as gadolinium)) for use in imaging and/or
therapy (e.g., neutron-capture cancer therapy). See, e.g., Paunesku
et al. Nanomedicine 4(3): 201-7, 2008.
[0184] In some embodiments, the technology finds use as a drug
delivery tag, e.g., for the targeted cellular delivery of
oligonucleotide and antisense therapeutics (e.g., siRNA, miRNA,
etc.). In some embodiments, the technology finds use for the
delivery of drugs linked to a nucleic acid comprising a nucleotide
analog, wherein the nucleic acid serves as a targeting moiety. In
some embodiments, the technology comprises use of a cell targeting
moiety to direct and/or deliver an oligonucleotide to a particular
cell, tissue, organ, etc. The cell targeting moiety imbues
compounds (e.g., an oligonucleotide (e.g., oligonucleotide analog)
according to the technology described herein linked to a
cell-targeting/drug delivery moiety, e.g., as described below) with
characteristics such that the compounds and/or oligonucleotides are
preferably recognized, bound, imported, processed, activated, etc.
by one or more target cell types relative to one or more other
non-target cell types. For example, endothelial cells have a high
affinity for the peptide targeting moiety Arg-Gly-Asp (RGD), cancer
and kidney cells preferentially interact with compounds having a
folic acid moiety, immune cells have an affinity for mannose, and
cardiomyocytes have an affinity for the peptide
CWLSEAGPVVTVRALRGTGSW (see, e.g., Biomaterials 31: 8081-8087,
2010). Other targeting/delivery moieties are known in the art.
Accordingly, compounds comprising a targeting moiety preferentially
interact with and are taken up by the targeted cell type.
[0185] In some embodiments, the compounds comprise an RGD peptide.
RGD peptides comprise 4 to 30 (e.g., 5 to 20 or 5 to 15) amino
acids and target tumor cells (e.g., endothelial tumor cells). Such
peptides and agents derived therefrom are known in the art, and are
described by Beer et al. in Methods Mol. Biol. 680: 183-200 (2011)
and in Theranostics 1: 48-57 (2011); by Morrison et al. in
Theranostics 1: 149-153 (2011); by Zhou et al. in Theranostics 1:
58-82 (2011); and by Auzzas et al. in Curr. Med. Chem. 17:
1255-1299 (2010).
[0186] In some embodiments, the targeting moiety is folic acid,
e.g., for targeting to cells expressing the folate receptor. The
folate receptor is overexpressed on the cell surfaces of human
cancer cells in, e.g., cancers of the brain, kidney, lung, ovary,
and breast relative to lower levels in normal cells (see, e.g.,
Sudimack J, et al. 2000 "Targeted drug delivery via the folate
receptor" Adv Drug Deliv Rev 41: 147-162).
[0187] In some embodiments, the targeting moiety comprises
transferrin, which targets the compounds to, e.g., macrophages,
erythroid precursors in bone marrow, and cancer cells. When a
transferrin protein encounters a transferrin receptor on the
surface of a cell, the transferrin receptor binds to the
transferrin and transports the transferrin into the cell. Drugs and
other compounds and/or moieties linked to the tranferrin are also
transported to the cell and, in some cases, imported into the
cells. In some embodiments, a fragment of a transferrin targets the
compounds of the technology to the target cell. See, e.g., Qian et
al. (2002) "Targeted drug delivery via the transferrin
receptor-mediated endocytosis pathway", Pharmacol Rev. 54: 561-87;
Daniels et al. (2006) "The transferrin receptor part I: Biology and
targeting with cytotoxic antibodies for the treatment of cancer",
Clin. Immunol. 121: 144-58.
[0188] In some embodiments, the targeting moiety comprises the
peptide VHSPNKK. This peptide targets compounds to cells expressing
vascular cell adhesion molecule 1 (VCAM-1), e.g., to activated
endothelial cells. Targeting activated endothelial cells finds use,
e.g., in delivery of therapeutic agents to cells for treatment of
inflammation and cancer. Certain melanoma cells use VCAM-1 to
adhere to the endothelium and VCAM-1 participates in monocyte
recruitment to atherosclerotic sites. Accordingly, the peptide
VHSPNKK finds use in targeting compounds of the present technology
to cancer (e.g., melanoma) cells and atherosclerotic sites.
[0189] See, e.g., Lochmann, et al. (2004) "Drug delivery of
oligonucleotides by peptides" Eur. J. Pharmaceutics and
Biopharmaceutics 58: 237-251, incorporated herein by reference,
discussing targeting moieties and the cells targeted by those
moieties.
[0190] In some embodiments, the cell-targeting moiety comprises an
antibody, or derivative or fragment thereof. Antibodies to
cell-specific molecules such as, e.g., proteins (e.g.,
cell--surface proteins, membrane proteins, proteoglycans,
glycoproteins, peptides, and the like); polynucleotides (nucleic
acids, nucleotides); lipids (e.g., phospholipids, glycolipids, and
the like), or fragments thereof comprising an epitope or antigen
specifically recognized by the antibody, target compounds according
to the technology to the cells expressing the cell-specific
molecules.
[0191] For example, many antibodies and antibody fragments
specifically bind markers produced by or associated with tumors or
infectious lesions, including viral, bacterial, fungal, and
parasitic infections, and antigens and products associated with
such microorganisms (see, e.g., U.S. Pat. Nos. 3,927,193;
4,331,647; 4348,376; 4,361,544; 4,468,457; 4,444,744; 4,460,459;
4,460,561; 4,818,709; and 4,624,846, incorporated herein by
reference) Moreover, antibodies that target myocardial infarctions
are disclosed in, e.g., U.S. Pat. No. 4,036,945. Antibodies that
target normal tissues or organs are disclosed in, e.g., U.S. Pat.
No. 4,735,210. Anti-fibrin antibodies are known in the art, as are
antibodies that bind to atherosclerotic plaque and to lymphocyte
autoreactive clones.
[0192] For cancer (e.g., breast cancer) and its metastases, a
specific marker or markers may be chosen from cell surface markers
such as, for example, members of the MUC-type mucin family, an
epithelial growth factor (EGFR) receptor, a carcinoembryonic
antigen (CEA), a human carcinoma antigen, a vascular endothelial
growth factor (VEGF) antigen, a melanoma antigen (MAGE) gene,
family antigen, a T/Tn antigen, a hormone receptor, growth factor
receptors, a cluster designation/differentiation (CD) antigen, a
tumor suppressor gene, a cell cycle regulator, an oncogene, an
oncogene receptor, a proliferation marker, an adhesion molecule, a
proteinase involved in degradation of extracellular matrix, a
malignant transformation related factor, an apoptosis related
factor, a human carcinoma antigen, glycoprotein antigens, DF3, 4F2,
MGFM antigens, breast tumor antigen CA 15-3, calponin, cathepsin,
CD 31 antigen, proliferating cell nuclear antigen 10 (PC 10), and
pS2. For other forms of cancer and their metastases, a specific
marker or markers may be selected from cell surface markers such
as, for example, vascular endothelial growth factor receptor
(VEGFR) family, a member of carcinoembryonic antigen (CEA) family,
a type of anti-idiotypic mAB, a type of ganglioside mimic, a member
of cluster designation differentiation antigens, a member of
epidermal growth factor receptor (EGFR) family, a type of a
cellular adhesion molecule, a member of MUC-type mucin family, a
type of cancer antigen (CA), a type of a matrix metalloproteinase,
a type of glycoprotein antigen, a type of melanoma associated
antigen (MAA), a proteolytic enzyme, a calmodulin, a member of
tumor necrosis factor (TNF) receptor family, a type of angiogenesis
marker, a melanoma antigen recognized by T cells (MART) antigen, a
member of melanoma antigen encoding gene (MAGE) family, a prostate
membrane specific antigen (PMSA), a small cell lung carcinoma
antigen (SCLCA), a T/Tn antigen, a hormone receptor, a tumor
suppressor gene antigen, a cell cycle regulator antigen, an
oncogene antigen, an oncogene receptor antigen, a proliferation
marker, a proteinase involved in degradation of extracellular
matrix, a malignant transformation related factor, an
apoptosis-related factor, and a type of human carcinoma
antigen.
[0193] The antibody may have an affinity for a target associated
with a disease of the immune system such as, for example, a
protein, a cytokine, a chemokine, an infectious organism, and the
like. In another embodiment, the antibody may be targeted to a
predetermined target associated with a pathogen-borne condition.
The particular target and the antibody may be specific to, but not
limited to, the type of the pathogen-borne condition. A pathogen is
defined as any disease-producing agent such as, for example, a
bacterium, a virus, a microorganism, a fungus, a prion, and a
parasite. The antibody may have an affinity for the pathogen or
pathogen associated matter. The antibody may have an affinity for a
cell marker or markers associated with a pathogen-borne condition.
The marker or markers may be selected such that they represent a
viable target on infected cells. For a pathogen-borne condition,
the antibody may be selected to target the pathogen itself. For a
bacterial condition, a predetermined target may be the bacterium
itself, for example, Escherichia cell or Bacillus anthracis. For a
viral condition, a predetermined target may be the virus itself,
for example, Cytomegalovirus (CMV), Epstein-Barr virus (EBV), a
hepatitis virus, such as Hepatitis B virus, human immunodeficiency
virus, such as HIV, HIV-1, or HIV-2, or a herpes virus, such as
Herpes virus 6. For a parasitic condition, a predetermined target
may be the parasite itself, for example, Trypanasoma cruzi,
Kinetoplastid, Schistosoma mansoni, Schistosoma japonicum, or
Schistosoma brucel. For a fungal condition, a predetermined target
may be the fungus itself, for example, Aspergillus, Candida,
Cryptococcus neoformans, or Rhizomucor.
[0194] In another embodiment, the antibody may be targeted to a
predetermined target associated with an undesirable target. The
particular target and antibody may be specific to, but not limited
to, the type of the undesirable target. An undesirable target is a
target that may be associated with a disease or an undesirable
condition, but also present in the normal condition. For example,
the target may be present at elevated concentrations or otherwise
be altered in the disease or undesirable state. Antibody may have
an affinity for the undesirable target or for biological molecular
pathways related to the undesirable target. Antibody may have an
affinity for a cell marker or markers associated with the
undesirable target. For an undesirable target, the choice of a
predetermined target may be important to therapy utilizing the
compounds according to the present technology (e.g., the drug
and/or therapeutic moieties). The antibody may be selected to
target biological matter associated with a disease or undesirable
condition. For arteriosclerosis, a predetermined target may be, for
example, apolipoprotein B on low density lipoprotein (LDL). For
obesity, a predetermined marker or markers may be chosen from cell
surface markers such as, for example, one of gastric inhibitory
polypeptide receptor and CD36 antigen. Another undesirable
predetermined target may be clotted blood. In another embodiment,
the antibody may be targeted to a predetermined target associated
with a reaction to an organ transplanted into the patient. The
particular target and antibody may be specific to, but not limited
to, the type of organ transplant. The antibody may have an affinity
for a biological molecule associated with a reaction to an organ
transplant. The antibody may have an affinity for a cell marker or
markers associated with a reaction to an organ transplant. The
marker or markers may be selected such that they represent a viable
target on T cells or B cells of the immune system. In another
embodiment, the antibody may be targeted to a predetermined target
associated with a toxin in the patient. A toxin is defined as any
poison produced by an organism including, but not limited to,
bacterial toxins, plant toxins, insect toxin, animal toxins, and
man-made toxins. The particular target and antibody may be specific
to, but not limited to, the type of toxin. The antibody may have an
affinity for the toxin or a biological molecule associated with a
reaction to the toxin. The antibody may have an affinity for a cell
marker or markers associated with a reaction to the toxin. In
another embodiment, the antibody may be targeted to a predetermined
target associated with a hormone-related disease. The particular
target and antibody may be specific to, but not limited to, a
particular hormone disease. The antibody may have an affinity for a
hormone or a biological molecule associated with the hormone
pathway. The antibody may have an affinity for a cell marker or
markers associated with the hormone disease. In another embodiment,
the antibody may be targeted to a predetermined target associated
with non-cancerous diseased tissue. The particular target and
antibody may be specific to, but not limited to, a particular
non-cancerous diseased tissue, such as non-cancerous diseased
deposits and precursor deposits. The antibody may have an affinity
for a biological molecule associated with the non-cancerous
diseased tissue. The antibody may have an affinity for a cell
marker or markers associated with the non-cancerous diseased
tissue. In another embodiment, the antibody may be targeted to a
proteinaceous pathogen. The particular target and antibody may be
specific to, but not limited to, a particular proteinaceous
pathogen. The antibody may have an affinity for a proteinaceous
pathogen or a biological molecule associated with the proteinaceous
pathogen. The antibody may have an affinity for a cell marker or
markers associated with the proteinaceous pathogen. For prion
diseases, also known as transmissible spongiform encephalopathies,
a predetermined target may be, for example, Prion protein 3F4.
[0195] See, e.g., U.S. Pat. Appl. Pub. No. 20050090732 (in
particular Table I), incorporated herein by reference for a list of
targets, cell-specific markers (e.g., antigens for targeting with
an antibody moiety), antibodies, and indications associated with
those targets, cell-specific markers, and antigens/antibodies.
[0196] In some embodiments, the technology finds use in imaging,
such as for in situ hybridization (ISH). In some embodiments, the
nucleotide analogs provided herein find use in nucleic acids that
are hybridization probes for ISH and fluorescence in situ
hybridization (FISH). In some embodiments, the nucleotide analogs
find use in direct ISH and/or for immuno-histochemistry
applications without using secondary detection reagents.
[0197] 7. Pharmaceutical Formulations
[0198] In some embodiments, nucleotide analogs, oligonucleotides
comprising a nucleotide analog, etc. are provided in a
pharmaceutical formulation for administration to a subject. It is
generally contemplated that the compounds (e.g., nucleotide
analogs, oligonucleotides comprising a nucleotide analog,
conjugates of nucleotide analogs and/or oligonucleotides comprising
a nucleotide analog, etc.) related to the technology are formulated
for administration to a mammal, and especially to a human with a
condition that is responsive to the administration of such
compounds. Therefore, where contemplated compounds are administered
in a pharmacological composition, it is contemplated that the
contemplated compounds are formulated in admixture with a
pharmaceutically acceptable carrier. For example, contemplated
compounds can be administered orally as pharmacologically
acceptable salts, or intravenously in a physiological saline
solution (e.g., buffered to a pH of about 7.2 to 7.5). Conventional
buffers such as phosphates, bicarbonates, or citrates can be used
for this purpose. Of course, one of ordinary skill in the art may
modify the formulations within the teachings of the specification
to provide numerous formulations for a particular route of
administration. In particular, contemplated compounds may be
modified to render them more soluble in water or other vehicle,
which for example, may be easily accomplished with minor
modifications (salt formulation, esterification, etc.) that are
well within the ordinary skill in the art. It is also well within
the ordinary skill of the art to modify the route of administration
and dosage regimen of a particular compound to manage the
pharmacokinetics of the present compounds for maximum beneficial
effect in a patient.
[0199] In certain pharmaceutical dosage forms, prodrug forms of
contemplated compounds may be formed for various purposes,
including reduction of toxicity, increasing the organ or target
cell specificity, etc. Among various prodrug forms, acylated
(acetylated or other) derivatives, pyridine esters, and various
salt forms of the present compounds are preferred. One of ordinary
skill in the art will recognize how to modify the present compounds
to prodrug forms to facilitate delivery of active compounds to a
target site within the host organism or patient. One of ordinary
skill in the art will also take advantage of favorable
pharmacokinetic parameters of the prodrug forms, where applicable,
in delivering the present compounds to a targeted site within the
host organism or patient to maximize the intended effect of the
compound. Similarly, it should be appreciated that contemplated
compounds may also be metabolized to their biologically active
form, and all metabolites of the compounds herein are therefore
specifically contemplated. In addition, contemplated compounds (and
combinations thereof) may be administered in combination with yet
further agents.
[0200] With respect to administration to a subject, it is
contemplated that the compounds be administered in a
pharmaceutically effective amount. One of ordinary skill recognizes
that a pharmaceutically effective amount varies depending on the
therapeutic agent used, the subject's age, condition, and sex, and
on the extent of the disease in the subject. Generally, the dosage
should not be so large as to cause adverse side effects, such as
hyperviscosity syndromes, pulmonary edema, congestive heart
failure, and the like. The dosage can also be adjusted by the
individual physician or veterinarian to achieve the desired
therapeutic goal.
[0201] As used herein, the actual amount encompassed by the term
"pharmaceutically effective amount" will depend on the route of
administration, the type of subject being treated, and the physical
characteristics of the specific subject under consideration. These
factors and their relationship to determining this amount are well
known to skilled practitioners in the medical, veterinary, and
other related arts. This amount and the method of administration
can be tailored to maximize efficacy but will depend on such
factors as weight, diet, concurrent medication, and other factors
that those skilled in the art will recognize.
[0202] Pharmaceutical compositions preferably comprise one or more
compounds of the present technology associated with one or more
pharmaceutically acceptable carriers, diluents, or excipients.
Pharmaceutically acceptable carriers are known in the art such as
those described in, for example, Remingtons Pharmaceutical
Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985),
explicitly incorporated herein by reference for all purposes.
[0203] Accordingly, in some embodiments, the immunotherapeutic
agent is formulated as a tablet, a capsule, a time release tablet,
a time release capsule; a time release pellet; a slow release
tablet, a slow release capsule; a slow release pellet; a fast
release tablet, a fast release capsule; a fast release pellet; a
sublingual tablet; a gel capsule; a microencapsulation; a
transdermal delivery formulation; a transdermal gel; a transdermal
patch; a sterile solution; a sterile solution prepared for use as
an intramuscular or subcutaneous injection, for use as a direct
injection into a targeted site, or for intravenous administration;
a solution prepared for rectal administration; a solution prepared
for administration through a gastric feeding tube or duodenal
feeding tube; a suppository for rectal administration; a liquid for
oral consumption prepared as a solution or an elixir; a topical
cream; a gel; a lotion; a tincture; a syrup; an emulsion; or a
suspension.
[0204] In some embodiments, the time release formulation is a
sustained-release, sustained-action, extended-release,
controlled-release, modified release, or continuous-release
mechanism, e.g., the composition is formulated to dissolve quickly,
slowly, or at any appropriate rate of release of the compound over
time.
[0205] In some embodiments, the compositions are formulated so that
the active ingredient is embedded in a matrix of an insoluble
substance (e.g., various acrylics, chitin) such that the dissolving
compound finds its way out through the holes in the matrix, e.g.,
by diffusion. In some embodiments, the formulation is enclosed in a
polymer-based tablet with a laser-drilled hole on one side and a
porous membrane on the other side. Stomach acids push through the
porous membrane, thereby pushing the drug out through the
laser-drilled hole. In time, the entire drug dose releases into the
system while the polymer container remains intact, to be excreted
later through normal digestion. In some sustained-release
formulations, the compound dissolves into the matrix and the matrix
physically swells to form a gel, allowing the compound to exit
through the gel's outer surface. In some embodiments, the
formulations are in a micro-encapsulated form, e.g., which is used
in some embodiments to produce a complex dissolution profile. For
example, by coating the compound around an inert core and layering
it with insoluble substances to form a microsphere, some
embodiments provide more consistent and replicable dissolution
rates in a convenient format that is combined in particular
embodiments with other controlled (e.g., instant) release
pharmaceutical ingredients, e.g., to provide a multipart gel
capsule.
[0206] In some embodiments, the pharmaceutical preparations and/or
formulations of the technology are provided in particles.
"Particles" as used herein in a pharmaceutical context means nano-
or microparticles (or in some instances larger) that can consist in
whole or in part of the compounds as described herein. The
particles may contain the preparations and/or formulations in a
core surrounded by a coating, including, but not limited to, an
enteric coating. The preparations and/or formulations also may be
dispersed throughout the particles. The preparations and/or
formulations also may be adsorbed into the particles. The particles
may be of any order release kinetics, including zero order release,
first order release, second order release, delayed release,
sustained release, immediate release, and any combination thereof,
etc. The particle may include, in addition to the preparations
and/or formulations, any of those materials routinely used in the
art of pharmacy and medicine, including, but not limited to,
erodible, nonerodible, biodegradable, or nonbiodegradable materials
or combinations thereof. The particles may be microcapsules which
contain the formulation in a solution or in a semi-solid state. The
particles may be of virtually any shape.
[0207] Both non-biodegradable and biodegradable polymeric materials
can be used in the manufacture of particles for delivering the
preparations and/or formulations. Such polymers may be natural or
synthetic polymers. The polymer is selected based on the period of
time over which release is desired. Bioadhesive polymers of
particular interest include bioerodible hydrogels described by H.
S. Sawhney, C. P. Pathak and J. A. Hubell in Macromolecules, (1993)
26: 581-587, the teachings of which are incorporated herein by
reference. These include polyhyaluronic acids, casein, gelatin,
glutin, polyanhydrides, polyacrylic acid, alginate, chitosan,
poly(methyl methacrylates), poly(ethyl methacrylates),
poly(butylmethacrylate), poly (isobutyl methacrylate),
poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl
methacrylate), poly(phenylmethacrylate), poly(methyl acrylate),
poly(isopropyl acrylate), poly(isobutyl acrylate), and
poly(octadecyl acrylate).
[0208] The technology also provides methods for preparing stable
pharmaceutical preparations containing aqueous solutions of the
compounds or salts thereof to inhibit formation of degradation
products. A solution is provided that contains the compound or
salts thereof and at least one inhibiting agent. The solution is
processed under at least one sterilization technique prior to
and/or after terminal filling the solution in the sealable
container to form a stable pharmaceutical preparation. The present
formulations may be prepared by various methods known in the art so
long as the formulation is substantially homogenous, e.g., the
pharmaceutical is distributed substantially uniformly within the
formulation. Such uniform distribution facilitates control over
drug release from the formulation.
[0209] In some embodiments, the compound is formulated with a
buffering agent. The buffering agent may be any pharmaceutically
acceptable buffering agent. Buffer systems include citrate buffers,
acetate buffers, borate buffers, and phosphate buffers. Examples of
buffers include citric acid, sodium citrate, sodium acetate, acetic
acid, sodium phosphate and phosphoric acid, sodium ascorbate,
tartartic acid, maleic acid, glycine, sodium lactate, lactic acid,
ascorbic acid, imidazole, sodium bicarbonate and carbonic acid,
sodium succinate and succinic acid, histidine, and sodium benzoate
and benzoic acid.
[0210] In some embodiments, the compound is formulated with a
chelating agent. The chelating agent may be any pharmaceutically
acceptable chelating agent. Chelating agents include
ethylenediaminetetraacetic acid (also synonymous with EDTA, edetic
acid, versene acid, and sequestrene), and EDTA derivatives, such as
dipotassium edetate, disodium edetate, edetate calcium disodium,
sodium edetate, trisodium edetate, and potassium edetate. Other
chelating agents include citric acid and derivatives thereof.
Citric acid also is known as citric acid monohydrate. Derivatives
of citric acid include anhydrous citric acid and
trisodiumcitrate-dihydrate. Still other chelating agents include
niacinamide and derivatives thereof and sodium desoxycholate and
derivatives thereof.
[0211] In some embodiments, the compound is formulated with an
antioxidant. The antioxidant may be any pharmaceutically acceptable
antioxidant. Antioxidants are well known to those of ordinary skill
in the art and include materials such as ascorbic acid, ascorbic
acid derivatives (e.g., ascorbylpalmitate, ascorbylstearate, sodium
ascorb ate, calcium ascorbate, etc.), butylated hydroxy anisole,
buylated hydroxy toluene, alkylgallate, sodium meta-bisulfate,
sodium bisulfate, sodium dithionite, sodium thioglycollic acid,
sodium formaldehyde sulfoxylate, tocopherol and derivatives
thereof, (d-alpha tocopherol, d-alpha tocopherol acetate, dl-alpha
tocopherol acetate, d-alpha tocopherol succinate, beta tocopherol,
delta tocopherol, gamma tocopherol, and d-alpha tocopherol
polyoxyethylene glycol 1000 succinate) monothioglycerol, and sodium
sulfite. Such materials are typically added in ranges from 0.01 to
2.0%.
[0212] In some embodiments, the compound is formulated with a
cryoprotectant. The cryoprotecting agent may be any
pharmaceutically acceptable cryoprotecting agent. Common
cryoprotecting agents include histidine, polyethylene glycol,
polyvinyl pyrrolidine, lactose, sucrose, mannitol, and polyols.
[0213] In some embodiments, the compound is formulated with an
isotonicity agent. The isotonicity agent can be any
pharmaceutically acceptable isotonicity agent. This term is used in
the art interchangeably with iso-osmotic agent, and is known as a
compound which is added to the pharmaceutical preparation to
increase the osmotic pressure, e.g., in some embodiments to that of
0.9% sodium chloride solution, which is iso-osmotic with human
extracellular fluids, such as plasma. Preferred isotonicity agents
are sodium chloride, mannitol, sorbitol, lactose, dextrose and
glycerol.
[0214] The pharmaceutical preparation may optionally comprise a
preservative. Common preservatives include those selected from the
group consisting of chlorobutanol, parabens, thimerosol, benzyl
alcohol, and phenol. Suitable preservatives include but are not
limited to: chlorobutanol (0.3-0.9% w/v), parabens (0.01-5.0%),
thimerosal (0.004-0.2%), benzyl alcohol (0.5-5%), phenol
(0.1-1.0%), and the like.
[0215] In some embodiments, the compound is formulated with a
humectant to provide a pleasant mouth-feel in oral applications.
Humectants known in the art include cholesterol, fatty acids,
glycerin, lauric acid, magnesium stearate, pentaerythritol, and
propylene glycol.
[0216] In some embodiments, an emulsifying agent is included in the
formulations, for example, to ensure complete dissolution of all
excipients, especially hydrophobic components such as benzyl
alcohol. Many emulsifiers are known in the art, e.g., polysorbate
60.
[0217] For some embodiments related to oral administration, it may
be desirable to add a pharmaceutically acceptable flavoring agent
and/or sweetener. Compounds such as saccharin, glycerin, simple
syrup, and sorbitol are useful as sweeteners.
[0218] 8. Administration, Treatments, and Dosing
[0219] In some embodiments, the technology relates to methods of
providing a dosage of a nucleotide analog, oligonucleotide
comprising a nucleotide analog, or a conjugate thereof (e.g.,
comprising a targeting moiety, contrast agent, label, tag, etc.) to
a subject. In some embodiments, a compound, a derivative thereof,
or a pharmaceutically acceptable salt thereof, is administered in a
pharmaceutically effective amount. In some embodiments, a compound,
a derivative thereof, or a pharmaceutically acceptable salt
thereof, is administered in a therapeutically effective dose.
[0220] The dosage amount and frequency are selected to create an
effective level of the compound without substantially harmful
effects. When administered orally or intravenously, the dosage of
the compound or related compounds will generally range from 0.001
to 10,000 mg/kg/day or dose (e.g., 0.01 to 1000 mg/kg/day or dose;
0.1 to 100 mg/kg/day or dose).
[0221] Methods of administering a pharmaceutically effective amount
include, without limitation, administration in parenteral, oral,
intraperitoneal, intranasal, topical, sublingual, rectal, and
vaginal forms. Parenteral routes of administration include, for
example, subcutaneous, intravenous, intramuscular, intrastemal
injection, and infusion routes. In some embodiments, the compound,
a derivative thereof, or a pharmaceutically acceptable salt
thereof, is administered orally.
[0222] In some embodiments, a single dose of a compound or a
related compound is administered to a subject. In other
embodiments, multiple doses are administered over two or more time
points, separated by hours, days, weeks, etc. In some embodiments,
compounds are administered over a long period of time (e.g.,
chronically), for example, for a period of months or years (e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more months or
years).
[0223] In such embodiments, compounds may be taken on a regular
scheduled basis (e.g., daily, weekly, etc.) for the duration of the
extended period.
[0224] The technology also relates to methods of treating a subject
with a drug appropriate for the subject's malady. According to
another aspect of the technology, a method is provided for treating
a subject in need of such treatment with an effective amount of a
compound or a salt thereof. The method involves administering to
the subject an effective amount of a compound or a salt thereof in
any one of the pharmaceutical preparations described above,
detailed herein, and/or set forth in the claims. The subject can be
any subject in need of such treatment. In the foregoing
description, the technology is in connection with a compound or
salts thereof. Such salts include, but are not limited to, bromide
salts, chloride salts, iodide salts, carbonate salts, and sulfate
salts. It should be understood, however, that the compound is a
member of a class of compounds and the technology is intended to
embrace pharmaceutical preparations, methods, and kits containing
related derivatives within this class. Another aspect of the
technology then embraces the foregoing summary but read in each
aspect as if any such derivative is substituted wherever "compound"
appears.
[0225] In some embodiments, a subject is tested to assess the
presence, the absence, or the level of a malady and/or a condition.
Such testing is performed, e.g., by assaying or measuring a
biomarker, a metabolite, a physical symptom, an indication, etc.,
to determine the risk of or the presence of the malady or
condition. In some embodiments, the subject is treated with a
compound based on the outcome of the test. In some embodiments, a
subject is treated, a sample is obtained and the level of
detectable agent is measured, and then the subject is treated again
based on the level of detectable agent that was measured. In some
embodiments, a subject is treated, a sample is obtained and the
level of detectable agent is measured, the subject is treated again
based on the level of detectable agent that was measured, and then
another sample is obtained and the level of detectable agent is
measured. In some embodiments, other tests (e.g., not based on
measuring the level of detectable agent) are also used at various
stages, e.g., before the initial treatment as a guide for the
initial dose. In some embodiments, a subsequent treatment is
adjusted based on a test result, e.g., the dosage amount, dosage
schedule, identity of the drug, etc. is changed. In some
embodiments, a patient is tested, treated, and then tested again to
monitor the response to therapy and/or change the therapy. In some
embodiments, cycles of testing and treatment may occur without
limitation to the pattern of testing and treating, the periodicity,
or the duration of the interval between each testing and treatment
phase. As such, the technology contemplates various combinations of
testing and treating without limitation, e.g., test/treat,
treat/test, test/treat/test, treat/test/treat,
test/treat/test/treat, test/treat/test/treat/test,
test/treat/test/test/treat/treat/treat/test,
treat/treat/test/treat, test/treat/treat/test/treat/treat, etc.
[0226] Although the disclosure herein refers to certain illustrated
embodiments, it is to be understood that these embodiments are
presented by way of example and not by way of limitation.
EXAMPLES
Example 1--Characterization of Nucleotide Analogs
[0227] During the development of embodiments of the technology
provided herein, nucleotide analogs were characterized by
analytical chemical methods. In particular, 3'-O-propargyl-dATP,
3'-O-propargyl-dCTP, 3'-O-propargyl-dGTP, and 3'-O-propargyl-dTTP
were synthesized according to the synthetic schemes described
herein and characterized by .sup.1H NMR, .sup.31P NMR, anion
exchange HPLC, and high-resolution mass spectrometry. The
analytical testing indicated that the synthesis and purification
were successful (Figures X-Y).
Example 2--Assays for Identifying Compatible Polymerases
[0228] In some embodiments, the technology is related to the
incorporation of nucleotide analogs into a nucleic acid.
Accordingly, the technology provides assays for identifying
polymerases that recognize nucleotide analogs (e.g.,
3'-O-propargyl-dNTP) as substrates. For example, in some exemplary
assays and/or embodiments, compatible polymerases are identified by
a polymerase extension reaction (e.g., a single base extension
reaction). See, e.g., Ausebel et al. (eds.), Current Protocols in
Molecular Biology. New York: John Wiley & Sons, Inc; Sambrook
et al. (1989). Molecular Cloning: A Laboratory Manual. (2nd ed.).
Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
[0229] For example, identifying compatible polymerases comprises
providing a polymerase to test and a reaction buffer appropriate
for the polymerase. For polymerases obtained from a commercial
supplier (e.g., New England BioLabs, United States Biologicals,
Promega, Invitrogen, Worthington, Sigma-Aldrich, Fluka, Finnzymes,
Roche, 5 Prime, Qiagen, KAPA Biosystems, Thermo Scientific,
Agilent, Life Technologies, etc.), the polymerase is often supplied
with an appropriate reaction buffer. An exemplary reaction buffer
comprises, e.g., a compatible buffer (e.g., 20 mM Tris-HCl), a salt
(e.g., 10 mM KCl), a source of magnesium or manganese (e.g., 2 mM
MgSO.sub.4; 2 mM MnCl.sub.2, etc.), a detergent (e.g., 0.1% TRITON
X-100) and has a suitable pH (e.g., approximately pH 8.8 at
approximately 25.degree. C.). The activities of some polymerases
are improved in the presence of other compounds, such as sulfate
and other salts (e.g., 10 mM (NH.sub.4).sub.2SO.sub.4). Reaction
mixtures for polymerase extension reactions are typically tested
using Mg.sup.2+ or Mn.sup.2+ as the enzyme cofactor.
[0230] Polymerases are tested by providing in the reaction mixture
a DNA template, a DNA primer that is complementary to the DNA
template, and one or more nucleotides and/or nucleotide analogs.
Typical concentrations of template and primer are approximately
from 1 to 100 nM and typical concentrations of nucleotides and/or
nucleotide analogs are approximately from 1 to 125 .mu.M (e.g., 1
to 125 .mu.M for each nucleotide and/or nucleotide analog and/or 1
to 500 .mu.M total concentration of all nucleotides and/or
nucleotide analogs). Templates and primers are synthesized by
methods known in the art (e.g., using solid supports and
phosphoramidite chemistry) and are available from several
commercial suppliers (e.g., Integrated DNA Technologies,
Coralville, Iowa).
[0231] A pre-annealed primer/template is typically produced for
testing polymerases. For example, the primer is typically
resuspended in a suitable buffer (e.g., Tris-EDTA, pH 8.0) at a
suitable concentration, e.g., at 1 to 500 .mu.M (e.g., at 100
.mu.M) and the template is typically resuspended in a suitable
buffer (e.g., Tris-EDTA, pH 8.0) at a suitable concentration, e.g.,
at 1 to 500 .mu.M (e.g., at 100 .mu.M). Then, a pre-annealed
primer/template is produced by mixing approximately equal amounts
of the primer and template in an annealing buffer. For example, a
pre-annealed primer/template is produced by mixing approximately
100 p1 of the approximately 1 to 500 .mu.M (e.g., at 100 .mu.M)
primer solution to approximately 100 .mu.l of the approximately 1
to 500 .mu.M (e.g., at 100 .mu.M) template solution in
approximately 800 .mu.l of an annealing buffer (e.g., 200 mM Tris,
100 mM potassium chloride, and 0.1 mM EDTA, pH 8.45) to provide a
milliliter of primer/template solution. One of skill in the art can
scale the volumes and concentrations as appropriate for the
concentrations and volumes that are appropriate for the particular
analysis. Then, an aliquot (e.g., 100 .mu.l) of the primer/template
solution is heated to denature intramolecular and/or intermolecular
secondary structures (e.g., by heating at approximately 85.degree.
C. to 97.degree. C. (e.g., at approximately 95.degree. C.), e.g.,
for 1 to 5 minutes (e.g., 2 minutes). Next, the aliquot is cooled
to an annealing temperature (e.g., 20.degree. C. to 60.degree. C.
(e.g., 25.degree. C.) and incubated for 1 to 10 minutes (e.g., for
approximately 5 minutes) to allow the primer and template to anneal
to form a primer/template. The primer/template can be diluted in an
appropriate substrate dilution buffer (e.g., 20 mM Tris, 10 mM
potassium chloride, and 0.01 mM EDTA, pH 8.45; e.g., a 1 to 10
dilution of the annealing buffer described above) for storage. For
example, the primer/template can be diluted to a final
concentration of 0.01 .mu.M (e.g., to provide a 10x stock) in the
substrate dilution buffer, aliquoted, and stored at -20.degree.
C.
[0232] Software packages are known in the art that provide
assistance in designing templates and primers for these assays. In
addition, several equations are available for calculating
denaturation (e.g., melting (Tm) temperatures) and annealing
temperatures. Standard references describe a simple estimate of the
Tm value that may be calculated by the equation:
T.sub.m=81.5+0.41*(% G+C), when a nucleic acid is in aqueous
solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative
Filter Hybridization, in Nucleic Acid Hybridization (1985). Other
references (e.g., Allawi and SantaLucia, Biochemistry 36: 10581-94
(1997) include more sophisticated computations that account for
structural, environmental, and sequence characteristics.
[0233] The primer and template or pre-annealed template is/are used
to test the polymerase. For example, primer extension assays are
conducted with 1 to 100 nM (e.g., 50 nM) of the primer/template,
dNTPs (e.g., a mixture of 1 to 125 .mu.M of each dATP, dCTP, dGTP,
dTTP, modified dATP (e.g., 3'-O-propargyl-dATP), modified dCTP
(e.g., 3'-O-propargyl-dCTP), modified dGTP (e.g.,
3'-O-propargyl-dGTP), and/or modified dTTP (e.g.,
3'-O-propargyl-dTTP)), and polymerase (e.g., 1 to 100 U of
thermostable/thermophilic polymerase or mesophilic polymerase) in a
final volume of approximately 1 to 100 .mu.l (e.g., 10 to 20 .mu.l)
containing an appropriate buffer (e.g., as provided by the
commercial supplier of the polymerase or the exemplary reaction
buffer as described above). In some assays, the reaction mixture
comprises 1 to 50 U (e.g., 1 U) of thermostable
pyrophosphatase.
[0234] In some assays, a mixture of dNTPs and modified dNTPs is
used. For example, some assays test the incorporation of a single
base into a nucleic acid (e.g., in a single base extension assay).
In such an assay, the primer hybridizes to a complementary region
in the template to form a duplex such that the primer's terminal 3'
end is directly adjacent to the base pairing partner of the
nucleotide analog to be tested. In a successful test, the candidate
polymerase being tested incorporates a single nucleotide analog at
the 3' end of the primer. Many approaches are available for
detecting the incorporation of the nucleotide analog, including
fluorescence labeling, mass labeling for mass spectrometry,
measuring enzyme activity using a protein moiety, and isotope
labeling.
[0235] In particular, the assay tests the incorporation of a
modified nucleotide (e.g., 3'-O-propargyl-dNTP) to the 3' end of
the primer as directed by the template. In such an assay, the
reaction mixture can contain three dNTPs and the one particular
modified dNTP that is added to the 3' end of the primer as directed
by the template. Some assays comprise the use of four individual
reaction mixtures comprising each of the four primers annealed to a
template (e.g., four primer/templates) designed such that each of
the four modified nucleotides is to be added to the 3' end of the
primer as directed by the template. For example, in some
embodiments a primer/template is provided to test incorporation of
a modified dATP (e.g., 3'-O-propargyl-dATP):
TABLE-US-00001 NNNNNNNNNNNNNNN |||||||||||||||
NNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNN
in which N is any nucleotide and "|" indicates complementary base
pairing between the exemplary primer (top strand) and exemplary
template (bottom strand). In some embodiments a primer/template is
provided to test incorporation of a modified dCTP (e.g.,
3'-O-propargyl-dCTP):
TABLE-US-00002 NNNNNNNNNNNNNNN |||||||||||||||
NNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNN
in which N is any nucleotide and "|" indicates complementary base
pairing between the exemplary primer (top strand) and exemplary
template (bottom strand). In some embodiments a primer/template is
provided to test incorporation of a modified dGTP (e.g.,
3'-O-propargyl-dGTP):
TABLE-US-00003 NNNNNNNNNNNNNNN |||||||||||||||
NNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNN
in which N is any nucleotide and "|" indicates complementary base
pairing between the exemplary primer (top strand) and exemplary
template (bottom strand). In some embodiments a primer/template is
provided to test incorporation of a modified dTTP (e.g.,
3'-O-propargyl-dTTP):
TABLE-US-00004 NNNNNNNNNNNNNNN |||||||||||||||
NNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNN
in which N is any nucleotide and "|" indicates complementary base
pairing between the exemplary primer (top strand) and exemplary
template (bottom strand). The primers and templates can be any
appropriate length for the assay and the position of the
single-base extension can be directed by any appropriate nucleotide
of the template, usually within the central portion of the
template.
[0236] The polymerase is tested in the reaction mixture at a
temperature appropriate for the polymerase. For example, a
mesophilic polymerase is tested at a temperature of from 20.degree.
C. to 60.degree. C. and a thermophilic polymerase is tested at a
temperature from 80.degree. C. to 97.degree. C. or more (e.g.,
100.degree. C. or more). Appropriate temperatures are indicated by
the literature accompanying commercially supplied polymerases;
appropriate temperatures for other (e.g., any) polymerase can be
determined by one of skill in the art by testing polymerase
activity with standard nucleotides over a range of
temperatures.
[0237] In some assays, the temperature is cycled between a
temperature to denature nucleic acids (e.g., a melting temperature)
of approximately 85.degree. C. to 97.degree. C. (e.g., at
approximately 95.degree. C.) for 1 to 5 minutes (e.g., 2 minutes),
an annealing temperature of approximately 40.degree. C. to
70.degree. C. (e.g., at 55.degree. C.) for 5 to 60 seconds (e.g.,
15 to 20 seconds), and an extension temperature of approximately 60
to 75.degree. C. (e.g., 70 to 75.degree. C.) for 15 to 60 seconds
(e.g., 20 to 45 seconds), e.g., for 20 to 50 cycles.
[0238] Successful incorporation of a modified nucleotide (e.g., a
3'-O-propargyl dNTP) is determined by any number of methods. In
some particular assays, the size of the reaction product is
quantified to determine if the modified nucleotide (e.g., a
3'-O-propargyl dNTP) was added to the primer. In particular, the
product of a successful incorporation is one base pair longer than
the known length of the primer. The primer can be assayed as a
negative control sample for comparison. Also, a synthetic positive
control oligonucleotide having the length and structure of a
reaction product expected from a successful incorporation can be
assessed. Any method of discriminating between nucleic acids that
differ by one base is appropriate for the assay, e.g., gel
electrophoresis (e.g., Agilent Bioanalyzer), mass spectrometry,
HPLC, etc.
Example 3--Polymerase Screening
[0239] During the development of embodiments of the technology
provided herein, experiments were conducted to identify polymerases
that can efficiently incorporate 3'-O-propargyl-dNTP as substrates.
In particular, embodiments of the exemplary nucleotide extension
assays described in Example 2 were used to test multiple polymerase
enzymes including those sold under the trade names Ampli-Taq (Life
Technologies), KAPA HiFi (KAPA Biosystems), KAPA 2G (KAPA
Biosystems), Herculase II Fusion DNA polymerase (Agilent), PfuUltra
II Fusion HS DNA polymerase (Agilent), Phire HS II DNA polymerase
(Thermo Scientific), M-MuLV Reverse Transcriptase (NEB), rTth DNA
polymerase, 9.degree. N DNA Polymerase (NEB), THERMINATOR I DNA
Polymerase (NEB), THERMINATOR II DNA polymerase (NEB), and 5
additional custom, non-catalog polymerases from NEB. Reaction
conditions recommended by the commercial suppliers were followed
for all polymerases tested. Tests of each polymerase were performed
using both Mg.sup.2+ and Mn.sup.2+ as the co-factor in the reaction
mixture.
[0240] The data collected indicated that the polymerases derived
from Thermococcus sp. (e.g., Thermococcus sp. 9.degree. N (e.g.,
THERMINATOR I and THERMINATOR II)) incorporated the 3'-O-propargyl
dNTPs provided herein into a nucleic acid (Table 1).
TABLE-US-00005 TABLE 1 Summary of polymerase screening Amplitaq
KAPA KAPA Herculase PfuUltra Phire M- co-factor Gold HiFi 2 G II
Fusion II Fusion HS II MuLV rTth 9.degree. N Mg.sup.2+ - - - - - -
- - - Mn.sup.2+ - - - - - - - - + Therminator Therminator NEB NEB
NEB NEB NEB co-factor I II 1 2 3 4 5 Mg.sup.2+ - + - - - - -
Mn.sup.2+ - +++ - - - - -
[0241] In Table 1, a minus ("-") indicates that the polymerase did
not produce a detectable product incorporating the 3'-O-propargyl
dNTP, a single plus ("+") indicates that the polymerase produced a
detectable product incorporating the 3'-O-propargyl dNTP, and three
plusses ("+++") indicates that the polymerase produced a
substantial amount of 3'-O-propargyl dNTP incorporation product.
NEB1, NEB2, NEB3, NEB4, and NEB5 indicate each of the five
non-commercial New England BioLabs polymerases tested.
[0242] It is to be understood that assays (e.g., as described
herein, as described elsewhere, and as are known in the art) are
available to identify any polymerases that incorporate modified
nucleotides (e.g., the 3'-O-propargyl dNTPs provided herein) into a
nucleic acid. Accordingly, the technology is not limited by the use
of the Thermococcus sp. 9.degree. N (THERMINATOR I and THERMINATOR
II) polymerases and contemplates the use of any appropriate extant
or yet to be discovered polymerase that incorporates the modified
nucleotides (e.g., the 3'-O-propargyl dNTPs provided herein) into a
nucleic acid. Experiments described herein using the Thermococcus
sp. 9.degree. N (THERMINATOR II) polymerases are exemplary and do
not limit the technology to the use of any particular
polymerase.
Example 4--Incorporation of 3'-O-propargyl-dNTP into a Nucleic
Acid
[0243] During the development of embodiments of the technology
provided herein, experiments were conducted to assess the
incorporation of 3'-O-propargyl-dNTPs into a nucleic acid by a
polymerase. In particular, experiments were conducted to evaluate
the accurate incorporation of 3'-O-propargyl-dNTPs into a nucleic
acid and to evaluate the terminating activity of the
3'-O-propargyl-dNTPs. To assess these characteristics of the
nucleotide analogs provided herein, polymerase extension assays
were conducted using a template nucleic acid having a sequence from
human KRAS (e.g., KRAS exon 2 and flanking intron sequences) and a
complementary primer (Table 2).
TABLE-US-00006 TABLE 2 template & primer sequences used to test
incorporation of 3'-O-propargyl-dNTP length SEQ Name Sequence (5'
to 3') (bases) ID NO: KRAS template TTATTATAAGGCCTGCTGAAAATGACTGAA
177 1 TATAAACTTGTGGTAGTTGGAGCTGGTGGC GTAGGCAAGAGTGCCTTGACGATACAGCTA
ATTCAGAATCATTTTGTGGACGAATATGAT CCAACAATAGAGGTAAATCTTGTTTTAATA
TGCATATTACTGGTGCAGGACCATTCT R_ke2_trP1_T_bio
bTAAUCCTCTCTATGGGCAGTCGGTGATAG 48 2 AATGGTCCTGCACCAGTAA
R_ke2_trP1_A_bio bTAAUCCTCTCTATGGGCAGTCGGTGATAG 49 3
AATGGTCCTGCACCAGTAAT R_ke2_trP1_G_bio
bTAAUCCTCTCTATGGGCAGTCGGTGATAG 51 4 AATGGTCCTGCACCAGTAATAT
R_ke2_trP1_C_bio bTAAUCCTCTCTATGGGCAGTCGGTGATAG 52 5
AATGGTCCTGCACCAGTAATATG
In Table 2, a "b" indicates a biotin modification and a "U"
indicates a deoxyuridine modification. Incorporation of the primers
into extension products produces extension products comprising a
uracil. The uracil is useful, e.g., for cleavage of the product
(e.g., using uracil cleavage reagents) in a number of molecular
biological manipulations (e.g., cleaving the product from a solid
support).
[0244] To test incorporation of a 3'-O-propargyl-dTTP into a
nucleic acid, a polymerase extension reaction mix was assembled
comprising 20 mM Tris-HCl, 10 mM (NH.sub.4)SO.sub.4, 10 mM KCl, 2
mM MnCl.sub.2, 0.1% Triton X-100, 200 pmol 3'-O-propargyl-dTTP,
6.25 pmol of primer R_ke2_trP1_T_bio (SEQ ID NO: 2), and 2 units of
Therminator II DNA polymerase (New England BioLabs) in a 25-.mu.l
final reaction volume. A volume of 0.5 pmol of the KRAS template
(SEQ ID NO: 1) was used as template (Table 2). The polymerase
extension reaction was performed using a temperature cycling
profile comprising exposing the reaction to a temperature of
95.degree. C. for 2 minutes followed by 35 cycles of 95.degree. C.
for 15 seconds, 55.degree. C. for 25 seconds, and 65.degree. C. for
35 seconds.
[0245] After the polymerase extension reaction, 1 .mu.l of the
reaction mix was used directly for nucleic acid size analysis by
gel electrophoresis (e.g., using an Agilent 2100 Bioanalyzer and
High Sensitivity DNA Assay Chip). Data collected from size analysis
showed the presence of a population of nucleic acids having a
length corresponding to the length of the primer used in the
reaction (e.g., 48 bases) and a population of nucleic acids having
a length corresponding to the length of the primer plus one base
(e.g., 49 bases). Accordingly, the data collected indicated the
successful incorporation of the 3'-O-propargyl-dTTP at the 3' end
of the primer. Further, the amounts of the two populations of
nucleic acids were approximately equal, thus indicating the robust
incorporation of the 3'-O-propargyl-dTTP at the 3' end of the
primer to form the extension product.
[0246] Additional polymerase extension experiments were performed
using the reaction conditions described above and replacing the
3'-O-propargyl-dTTP and the primer R_ke2_trP1_T_bio with
3'-O-propargyl-dATP and the primer R_ke2_trP1_A_bio (SEQ ID NO: 3);
3'-O-propargyl-dCTP and the primer R_ke2_trPl_C_bio (SEQ ID NO: 5);
and 3'-O-propargyl dGTP and the primer R_ke2_trP1_G_bio (SEQ ID NO:
4). The data collected from these experiments similarly indicated
the successful incorporation of 3'-O-propargyl-dATP,
3'-O-propargyl-dCTP, and 3'-O-propargyl-dGTP, respectively, at the
3' end of the primers.
Example 5--Ladder Fragment Generation
[0247] During the development of embodiments of the technology
provided herein, experiments were conducted to assess using the
nucleotide analogs of the present technology to generate nucleic
acid fragments that terminate at base-specific positions. In
particular, reaction mixtures were produced and tested that
included both natural dNTPs and each of the 3'-O-propargyl-dNTPs
individually.
[0248] To test the fragment generation by 3'-O-propargyl-dTTP, a
DNA fragment generation reaction mix was prepared comprising 20 mM
Tris-HCl, 10 mM (NH.sub.4)SO.sub.4, 10 mM KCl, 2 mM MnCl.sub.2,
0.1% Triton X-100, 1000 pmol dATP, 1000 pmol dCTP, 1000 pmol dGTP,
1000 pmol dTTP, 200 pmol 3'-O-propargyl-dTTP, 6.25 pmol of primer
R_ke2_trP1_T_bio (SEQ ID NO: 2), and 2 units of THERMINATOR II DNA
polymerase (New England BioLabs) in a 25-.mu.l final reaction
volume. A volume of 0.5 pmol of the KRAS template (SEQ ID NO: 1)
was used as template. The polymerase extension reaction was
performed using a temperature cycling profile comprising exposing
the reaction to a temperature of 95.degree. C. for 2 minutes
followed by 50 cycles of 95.degree. C. for 15 seconds, 55.degree.
C. for 25 seconds, and 65.degree. C. for 35 seconds.
[0249] After the polymerase extension reaction, 1 .mu.l of the
reaction mix was used directly for nucleic acid size analysis by
gel electrophoresis (e.g., using an Agilent 2100 Bioanalyzer and
High Sensitivity DNA Assay Chip). Data collected from size analysis
showed that the reaction generated a population of nucleic acid
fragments having a range of sizes corresponding to the expected
lengths of nucleic acids that are complementary to the template and
terminated by 3'-O-propargyl-dT at each position where termination
is expected.
[0250] Additional polymerase extension experiments were performed
using the reaction conditions described above and replacing the
3'-O-propargyl-dTTP with 3'-O-propargyl-dATP, 3'-O-propargyl-dCTP,
or 3'-O-propargyl dGTP. The data collected from these experiments
similarly indicated that the reactions generated populations of
nucleic acid fragments having a range of sizes corresponding to the
expected lengths of nucleic acids that are complementary to the
template and terminated by 3'-O-propargyl-dA, 3'-O-propargyl-dC, or
3'-O-propargyl-dG at each position where termination is
expected.
Example 6--Synthesis of 5'-azido-methyl-modified
Oligonucleotide
[0251] During the development of embodiments of the technology
provided herein, an oligonucleotide comprising a 5'-azido-methyl
modification was synthesized and characterized. Synthesis of the
modified oligonucleotide was performed using phosphoramidite
chemical synthesis. In the last synthetic step, phosphoramidite
chemical synthesis was used to incorporate a 5'-iodo-dT
phosphoramidite at the terminal 5' position. The oligonucleotide
attached to the solid support in the reaction column was then
treated as follows.
[0252] First, sodium azide (30 mg) was resuspended in dry DMF (1
ml), heated for 3 hours at 55.degree. C., and cooled to room
temperature. The supernatant was taken up with a 1-ml syringe and
passed back and forth through the reaction column comprising the
5'-iodo-modified oligonucleotide and incubated overnight at ambient
(room) temperature. After incubation, the column was washed with
dry DMF, washed with acetonitrile, and then dried via argon gas.
The resulting 5'-azido-methyl-modified oligonucleotide was cleaved
from the solid support and deprotected by heating in aqueous
ammonia for 5 hours at 55.degree. C. The final product was an
oligonucleotide having the sequence shown below:
TABLE-US-00007 (SEQ ID NO: 6)
Az-TCTGAGTCGGAGACACGCAGGGATGAGATGGT
The "Az" indicates the azido-methyl modification at the 5' end
(e.g., 5'-azido-methyl modification), e.g., to provide an
oligonucleotide having a structure according to:
##STR00023##
where B is the base of the nucleotide (e.g., adenine, guanine,
thymine, cytosine, or a natural or synthetic nucleobase, e.g., a
modified purine such as hypoxanthine, xanthine, 7-methylguanine; a
modified pyrimidine such as 5,6-dihydrouracil, 5-methylcytosine,
5-hydroxymethylcytosine; etc.).
Example 7--Conjugation of 5'-azido-methyl-modified oligonucleotide
and 3'-O-propargyl-Modified Nucleic Acid Fragments
[0253] During the development of embodiments of the technology
provided herein, experiments were conducted to test the conjugation
of a 5'-azido-methyl-modified oligonucleotide (e.g., see Example 6)
to 3'-O-propargyl-modified nucleic acid fragments (e.g., see
Example 5) by click chemistry. In particular, experiments were
conducted in which a 5'-azido-methyl-modified oligonucleotide was
chemically conjugated to 3'-O-propargyl-modified DNA fragments
using copper (I) catalyzed 1,3-dipolar alkyne-azide cycloaddition
chemistry ("click chemistry").
[0254] Click chemistry was performed using commercially available
reagents (baseclick GmbH, Oligo-Click-M Reload kit) according to
the manufacturer's instructions. Briefly, approximately 0.1 pmol of
3'-O-propargyl-modified DNA fragments comprising a 5'-biotin
modification were reacted with approximately 500 pmol of
5'-azido-methyl-modified oligonucleotide (see, e.g., Example 6,
e.g., SEQ ID NO: 6) using the click chemistry reagent in a total
volume of 10 .mu.I. The reaction mixture was incubated at
45.degree. C. for 30 minutes. Following the incubation, the
supernatant was transferred to a new microcentrifuge tube and a
40-.mu.l volume of the commercially supplied binding and wash
buffer (e.g., 1 M NaCl, 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) was
added. The conjugated reaction product was isolated from the excess
5'-azido-methyl-modified oligonucleotide by incubating the click
chemistry reaction mixture with streptavidin-coated magnetic beads
(Dynabeads, MyOne Streptavidin C1, Life Technologies) at ambient
(room) temperature for 15 minutes. The beads were separated from
the supernatant using a magnet and the supernatant was removed.
Subsequently, the beads were washed twice using the binding and
wash buffer and then resuspended in 25 .mu.l of TE buffer (10 mM
Tris-HCl, 0.1 mM EDTA, pH approximately 8).
[0255] The product was cleaved from the solid support (bead) using
uracil cleavage (Uracil Glycosylase and Endonuclease VIII,
Enzymatics). In particular, uracil cleavage reagents were used to
cleave the reaction products at the site of the deoxyuridine
modification located near the 5'-terminal location of the
conjugated product (see SEQ ID NOs: 2-5). Finally, the supernatant
comprising the conjugated product was purified using Ampure XP
(Beckman Coulter) following the manufacturer's protocol and eluted
in 20 .mu.l of TE buffer.
Example 8--Amplification of Conjugated Product
[0256] During the development of embodiments of the technology
described herein, experiments were performed to characterize the
chemical conjugation of the 5'-azido-methyl-modified
oligonucleotide to the 3'-O-propargyl modified nucleic acid
fragments and to evaluate the triazole linkage as a mimic of a
natural phosphodiester bond in a nucleic acid backbone. To test the
ability of a polymerase to recognize the conjugated product as a
template and traverse the triazole linkage during synthesis, PCR
primers were designed to produce amplicons that span the triazole
linkage of the conjugation products:
TABLE-US-00008 Primer 1 SEQ ID NO: 7 CCTCTCTATGGGCAGTCGGTGAT Primer
2 SEQ ID NO: 8 CCATCTCATCCCTGCGTGTCTC
[0257] A commercially available PCR pre-mix (KAPA 2G HS, KAPA
Biosystems) was used to provide a 25-.mu.l reaction mixture
comprising, in addition to components provided by the mix (e.g.,
buffer, polymerase, dNTPs), 0.25 .mu.M Primer 1 (SEQ ID NO: 7),
0.25 .mu.M of Primer 2 (SEQ ID NO: 8), and 2 .mu.l of purified
conjugated product (see Example 7) as template for amplification.
The reaction mixture was thermally cycled by incubating the sample
at 95.degree. C. for 5 minutes, followed by 30 cycles of 98.degree.
C. for 20 seconds, 60.degree. C. for 30 seconds, and 72.degree. C.
for 20 seconds. The amplification products were analyzed by gel
electrophoresis (e.g., using an Agilent Bioanalyzer 2100 system and
High-Sensitivity DNA Chip) to determine the size distributions of
the reaction products.
[0258] Analysis of the amplification products indicated that the
amplification reaction successfully produced amplicons using the
conjugated products of the click chemistry reaction (see Example 7)
as templates for amplification. In particular, analysis of the
amplification products indicated that the polymerase processed
along the template and through the triazole linkage to produce
amplicons from the template. Further, the amplification produced a
heterogeneous population of amplicons having a range of sizes
corresponding to the expected sizes produced by amplification of
the base-specific terminated DNA fragments via incorporation of the
3'-O-propargyl-dNTP. The fragment analysis also showed the proper
fragment size increase corresponding to thirty one (31) additional
bases from the conjugated 5'-azido-methyl-modified
oligonucleotide.
Example 9--Ladder Generation using 3'-O-propargyl dNTP
Termination
[0259] During the development of embodiments of the technology
provided herein, experiments were conducted to assess the
generation of terminated nucleic acid fragments in a reaction
comprising a mixture of 3'-O-propargyl-dNTPs and natural (standard)
dNTPs. In particular, experiments were conducted to assess the
generation of fragments terminated at each position within the
target region by incorporation of chain-terminating
3'-O-propargyl-dNTPs by DNA polymerase during synthesis.
[0260] Experiments were conducted using a mixture of natural dNTPs
and all four of the 3'-O-propargyl-dNTPs in a single reaction. The
DNA fragment generation reaction mix comprised 20 mM Tris-HCl, 10
mM (NH.sub.4)SO.sub.4, 10 mM KCl, 2 mM MnCl.sub.2, 0.1% Triton
X-100, 1000 pmol dATP, 1000 pmol dCTP, 1000 pmol dGTP, 1000 pmol
dTTP, 100 pmol of 3'-O-propargyl-dATP, 100 pmol of
3'-O-propargyl-dCTP, 100 pmol of 3'-O-propargyl-dGTP, 100 pmol of
3'-O-propargyl-dTTP, 6.25 pmol of primer R_ke2_trP1_T_bio (SEQ ID
NO: 2), and 2 units of Therminator II DNA polymerase (New England
BioLabs) in a 25-.mu.l reaction volume. 0.5 pmol of purified
amplicon corresponding to a region in KRAS exon 2 (SEQ ID NO: 1)
was used as template. The polymerase extension reaction was
thermocycled by heating to 95.degree. C. for 2 minutes, followed by
45 cycles at 95.degree. C. for 15 seconds, 55.degree. C. for 25
seconds, and 65.degree. C. for 35 seconds.
[0261] After the polymerase extension reaction, 1 .mu.I of the
reaction mix was used directly for DNA fragment size analysis using
gel electrophoresis (Agilent 2100 Bioanalyzer and High Sensitivity
DNA Assay Chip). Fragment size analysis of the reaction products
indicated that the fragment generation reaction successfully
produced a ladder of nucleic acid fragments having the expected
sizes.
[0262] Subsequently, a 5'-azido-methyl-modified oligonucleotide
(see, e.g., Example 6, e.g., SEQ ID NO: 6) was chemically
conjugated to the terminated DNA fragments comprising
3'-O-propargyl-dN using click chemistry as described in Example 6
and Example 7 above. After the conjugation, an amplification
reaction was performed to amplify the conjugated products as
described in Example 8. DNA fragment size analysis of the amplicons
produced from the conjugated products showed the expected shift in
size resulting from conjugation of the 5'-azido-modified
oligonucleotide to the amplicons produced from the fragment
ladder.
Example 10--Control of Fragment Size
[0263] During the development of embodiments of the technology
provided herein, experiments were conducted to control the size
distribution of terminated nucleic acid fragments produced in a
reaction comprising a mixture of 3'-O-propargyl-dNTPs and natural
(standard) dNTPs by adjusting the ratio of 3'-O-propargyl-dNTPs to
natural (standard) dNTPs. It was contemplated that the molar ratio
of 3'-O-propargyl-dNTPs and natural dNTPs affects the fragment size
distribution due to competition between the 3'-O-propargyl-dNTPs
(that terminate extension) and natural dNTPs (that elongate the
polymerase product) for incorporation into the synthesized nucleic
acid by the polymerase.
[0264] Accordingly, experiments were performed in which the
products of fragment ladder generation reactions were assessed at
various molar ratios of 3'-O-propargyl-dNTPs to natural dNTPs.
Fragment ladder generation reactions were performed using 2:1,
10:1, and 100:1 molar ratios of natural dNTPs to
3'-O-propargyl-dNTPs. The fragment generation reaction mixtures
used in these experiments comprised 20 mM Tris-HCl, 10 mM
(NH.sub.4)SO.sub.4, 10 mM KCl, 2 mM MnCl.sub.2, 0.1% Triton X-100,
1000 pmol dATP, 1000 pmol dCTP, 1000 pmol dGTP, 1000 pmol dTTP,
6.25 pmol of primer R_ke2_trP1_T_bio (SEQ ID NO: 2), 2 units of
Therminator II DNA polymerase (New England BioLabs), and 0.5 pmol
of purified amplicon corresponding to a region in KRAS exon 2 (SEQ
ID NO: 1) as template in a 25-.mu.l final reaction volume.
[0265] In addition, reactions testing a 2:1 ratio of natural dNTPs
to 3'-O-propargyl-dNTPs comprised 500 pmol of 3'-O-propargyl-dATP,
500 pmol of 3'-O-propargyl-dCTP, 500 pmol of 3'-O-propargyl-dGTP,
and 500 pmol of 3'-O-propargyl-dTTP. Reactions testing a 10:1 ratio
of natural dNTPs to 3'-O-propargyl-dNTPs comprised 100 pmol of
3'-O-propargyl-dATP, 100 pmol of 3'-O-propargyl-dCTP, 100 pmol of
3'-O-propargyl-dGTP, and 100 pmol of 3'-O-propargyl-dTTP. Reactions
testing a 100:1 ratio of natural dNTPs to 3'-O-propargyl-dNTPs
comprised 10 pmol of 3'-O-propargyl-dATP, 10 pmol of
3'-O-propargyl-dCTP, 10 pmol of 3'-O-propargyl-dGTP, and 10 pmol of
3'-O-propargyl-dTTP
[0266] The polymerase extension reactions were temperature cycled
by incubating at 95.degree. C. for 2 minutes, followed by 45 cycles
at 95.degree. C. for 15 seconds, 55.degree. C. for 25 seconds, and
65.degree. C. for 35 seconds. After the polymerase extension
reaction, 5'-azido-methyl-modified oligonucleotides (see, e.g.,
Example 6, e.g., SEQ ID NO: 6) were chemically conjugated to the
nucleic acid fragments terminated with 3'-O-propargyl-dN using
click chemistry as described in Example 6 and Example 7. After the
conjugation, the conjugation products were used as templates for
amplification to produce amplicons corresponding to the conjugated
products as described in Example 8. Fragment size analysis was
performed on the conjugated products.
[0267] Fragment size analysis of the amplified conjugation products
produced from the products of the three different molar ratio
conditions indicated that the fragment size depended on the ratio
of 3'-O-propargyl-dNTPs to natural dNTPs. Analysis of the fragment
sizes shows a in fragment size distribution shift as a function of
the molar ratios of dNTP to 3'-O-propargyl-dNTP. At the 2:1 molar
ratio, larger populations of shorter fragments were detected
compared to the other two molar ratio conditions. At the 10:1 molar
ratio, a larger fraction of longer fragments was present relative
to the 2:1 molar ratio. At the 100:1 molar ratio, the major
population of fragments comprised longer DNA fragments relative to
the other two molar ratios.
[0268] All publications and patents mentioned in the above
specification are herein incorporated by reference in their
entirety for all purposes. Various modifications and variations of
the described compositions, methods, and uses of the technology
will be apparent to those skilled in the art without departing from
the scope and spirit of the technology as described. Although the
technology has been described in connection with specific exemplary
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention that are obvious to those skilled in the art are intended
to be within the scope of the following claims.
Sequence CWU 1
1
101177DNAhomo sapiens 1ttattataag gcctgctgaa aatgactgaa tataaacttg
tggtagttgg agctggtggc 60gtaggcaaga gtgccttgac gatacagcta attcagaatc
attttgtgga cgaatatgat 120ccaacaatag aggtaaatct tgttttaata
tgcatattac tggtgcagga ccattct 177248DNAArtificialSynthetic
2taaucctctc tatgggcagt cggtgataga atggtcctgc accagtaa
48349DNAArtificialSynthetic 3taaucctctc tatgggcagt cggtgataga
atggtcctgc accagtaat 49451DNAArtificialSynthetic 4taaucctctc
tatgggcagt cggtgataga atggtcctgc accagtaata t
51552DNAArtificialSynthetic 5taaucctctc tatgggcagt cggtgataga
atggtcctgc accagtaata tg 52632DNAArtificialSynthetic 6tctgagtcgg
agacacgcag ggatgagatg gt 32723DNAArtificialSynthetic 7cctctctatg
ggcagtcggt gat 23822DNAArtificialSynthetic 8ccatctcatc cctgcgtgtc
tc 22921PRTArtificialSynthetic 9Cys Trp Leu Ser Glu Ala Gly Pro Val
Val Thr Val Arg Ala Leu Arg1 5 10 15Gly Thr Gly Ser Trp
20107PRThomo sapiens 10Val His Ser Pro Asn Lys Lys1 5
* * * * *