U.S. patent application number 17/201582 was filed with the patent office on 2021-07-08 for viral delivery of rna utilizing self-cleaving ribozymes and crispr-based applications thereof.
The applicant listed for this patent is Icahn School of Medicine at Mount Sinai. Invention is credited to Benhur Lee, Arnold Park, Ruth Watkinson.
Application Number | 20210207169 17/201582 |
Document ID | / |
Family ID | 1000005478425 |
Filed Date | 2021-07-08 |
United States Patent
Application |
20210207169 |
Kind Code |
A1 |
Park; Arnold ; et
al. |
July 8, 2021 |
VIRAL DELIVERY OF RNA UTILIZING SELF-CLEAVING RIBOZYMES AND
CRISPR-BASED APPLICATIONS THEREOF
Abstract
The present disclosure relates to viral delivery of RNA
utilizing self-cleaving ribozymes and applications of such,
including but not limited to CRISPR-Cas related applications.
Inventors: |
Park; Arnold; (New York,
NY) ; Lee; Benhur; (New York, NY) ; Watkinson;
Ruth; (New York, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Icahn School of Medicine at Mount Sinai |
New York |
NY |
US |
|
|
Family ID: |
1000005478425 |
Appl. No.: |
17/201582 |
Filed: |
March 15, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16311887 |
Dec 20, 2018 |
10988779 |
|
|
PCT/US17/38780 |
Jun 22, 2017 |
|
|
|
17201582 |
|
|
|
|
62353452 |
Jun 22, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2800/80 20130101; C12N 7/00 20130101; C12N 2310/121 20130101;
C12N 2310/20 20170501; C12N 2760/10121 20130101; C12N 9/22
20130101; C12N 2760/18843 20130101; C12N 15/86 20130101 |
International
Class: |
C12N 15/86 20060101
C12N015/86; C12N 7/00 20060101 C12N007/00; C12N 9/22 20060101
C12N009/22; C12N 15/113 20060101 C12N015/113 |
Goverment Interests
STATEMENT REGARDING FEDERAL FUNDING
[0002] This invention was made with government support under grant
number R21 AI115226 awarded by the National Institute of Health
(NIH). The United States government has certain rights in the
invention.
Claims
1. A viral particle comprising a nucleic acid comprising a genome
sequence of a single-stranded RNA (ssRNA) virus or antigenome
sequence that is complementary to the genome sequence, the
antigenome sequence comprising a first region comprising (i) a
target segment; and (ii) a first segment encoding a first
self-cleaving ribozyme, wherein the target segment is adjacent to
the first segment.
2. The viral particle of claim 1, wherein the first region further
comprises (iii) a second segment encoding a second self-cleaving
ribozyme, wherein the target segment is flanked by the first
segment and the second segment.
3. The viral particle of claim 1, wherein the first self-cleaving
ribozyme is a 3' self-cleaving ribozyme or a 5' self-cleaving
ribozyme.
4. The viral particle of claim 3, wherein the first self-cleaving
ribozyme comprises one of a hammerhead ribozyme and a hepatitis
delta virus (HDV) ribozyme.
5. The viral particle of claim 1, wherein the antigenome sequence
further comprises a second region comprising a third segment
encoding a nuclease.
6. The viral particle of claim 5, wherein the second region further
comprises a fourth segment encoding a reporter molecule.
7. The viral particle of claim 5, wherein the nuclease comprises
Cas9 or Cpf1.
8. The viral particle of claim 1, wherein the target segment
comprises guide RNA (gRNA), wherein the gRNA has a scaffold
sequence and a targeting sequence.
9. The viral particle of claim 1, wherein the first self-cleaving
ribozyme comprises a hammerhead ribozyme.
10. The viral particle of claim 1, further comprising a third
region comprising a fifth segment, wherein the fifth segment
comprises a mutant P gene.
11. The viral particle of claim 1, further comprising a fourth
region comprising a fourth region comprising a sixth segment,
wherein the sixth segment comprises a mutant L gene.
12. The viral particle of claim 1, wherein the viral particle is
within the order mononegavirales.
13. The viral particle of claim 1, wherein the viral particle is
within the family paramyxoviridae.
14. The viral particle of claim 1, wherein the viral particle is a
Sendai virus (SeV) or a Newcastle disease virus (NDV).
15. The viral particle of claim 1, wherein the viral particle is a
temperature sensitive mutant.
16. A method of introducing into a host cell a target RNA,
comprising (i) contacting the viral particle of claim 1 with said
host cell; and (ii) culturing the host cell under conditions
allowing (a) producing a target RNA; and (b) liberating the target
RNA, wherein the first self-cleaving ribozyme liberates the target
RNA from the transcribed first region.
17. The method of claim 16, wherein the host cell is selected from
the group consisting of an archaea cell, bacterial cell, and a
eukaryotic cell.
18. The method of claim 17, wherein the host cell is a stem
cell.
19. A method of introducing a site-specific modification to target
DNA in a host cell comprising (i) contacting the viral particle of
claim 1 with said host cell; (ii) culturing the host cell under
conditions allowing (a) producing the gRNA flanked by the 5'
self-cleaving ribozyme and the nuclease; (b) liberating the gRNA,
wherein the 5' self-cleaving ribozyme liberates the gRNA; (c)
expressing the nuclease; (d) forming a complex between the nuclease
and the gRNA, wherein the scaffold sequence of the gRNA is bound to
the nuclease; and (e) contacting the target DNA with the complex,
wherein the targeting sequence of the gRNA binds to a sequence on
the target DNA adjacent to a protospacer adjacent motif (PAM); and
(iii) introducing the site-specific modification to the target
DNA.
20. The method of claim 19, wherein the site-specific modification
is one of an insertion, a deletion, a frameshift, and a point
mutation.
21. The method of claim 19, wherein the DNA is genomic.
22. The method of claim 19, wherein the host cell is selected from
the group consisting of an archaea cell, bacterial cell, and a
eukaryotic cell.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 16/311,887, filed Dec. 20, 2018, which is a U.S. national
stage under 35 U.S.C. .sctn. 371 of PCT International Patent
Application No. PCT/US2017/038780, filed Jun. 22, 2017, which
claims priority to U.S. Provisional Patent Application No.
62/353,452, filed Jun. 22, 2016, the contents of each of which are
hereby incorporated by reference.
FIELD OF THE INVENTION
[0003] The field of the invention generally relates to viral
delivery of RNA utilizing self-cleaving ribozymes and CRISPR-based
applications thereof.
BACKGROUND OF THE INVENTION
[0004] Gene therapies broadly involve the delivery of nucleic acid
polymers (e.g. RNA or DNA) into a cell in order to treat an
underlying disease or condition. One such gene therapy which has
gained much attention over the last several years is CRISPR/Cas9.
CRISPR/Cas9 technology promises to revolutionize genomics and
modern medicine by allowing for the introduction of point-level
mutations into a host genome, e.g. allowing the host genome to be
cut at a desired location and then allowing genes to be removed or
added. The CRISPR/Cas9 system generally relies on delivery of a
specific nuclease, typically Cas9, into a cell, which is guided by
guide RNA ("gRNA") to the appropriate section of the genome for
cutting. Known viral vector systems for delivery of CRISPR/Cas9,
e.g. lentivirus and adeno-associated virus (AAV), have successfully
modified cells both ex vivo and in vivo; however, the DNA-based
replication of these viruses carries the risk of unwanted
integration into the host genome and thus genotoxicity or
oncogenesis. Despite much attention to this problem and innovations
such as the use of integration-defective lentivirus, undesirable
integration remains a carefully monitored risk that may affect the
success of future gene therapy trials. These drawbacks are not
simply unique to CRISPR/Cas9. Accordingly, there is an urgent need
for improved viral vector delivery systems, including for delivery
of CRISPR-based technology.
SUMMARY OF THE INVENTION
[0005] The present disclosure relates to viral delivery of RNA
utilizing self-cleaving ribozymes inserted into the RNA viral
genome that are adjacent the target RNA to be delivered into the
host cell, and particularly the use of such in CRISPR-based
technology. Accordingly, in some embodiments, the present
disclosure is directed to a nucleic acid. In some embodiments, the
nucleic acid comprises a genome sequence of a single-stranded RNA
(ssRNA) virus. In some embodiments, the genome sequence comprises
antisense RNA. In some embodiments, the nucleic acid comprises an
antigenome sequence. In some embodiments, the antigenome sequence
is complementary to the genome sequence. In some embodiments, the
antigenome sequence comprises sense RNA. In some embodiments, the
antigenome sequence comprises a first region. In some embodiments,
the genome sequence comprises a first region. In some embodiments,
the first region comprises (i) a target segment and (ii) a first
segment comprising a first self-cleaving ribozyme. In some
embodiments, the first region further comprises (iii) a second
segment encoding a second self-cleaving ribozyme. In some
embodiments, the target segment is adjacent to the first segment.
In some embodiments, the target segment is immediately upstream of
the first segment. In some embodiments, the target segment is
immediately downstream of the first segment. In some embodiments,
the target segment is immediately upstream of the second segment.
In some embodiments, the target segment is immediately downstream
of the second segment. In some embodiments, the target segment is
immediately upstream of a self-cleaving ribozyme. In some
embodiments, the target segment is immediately downstream of a
self-cleaving ribozyme. In some embodiments, the target segment is
flanked by the first segment and the second segment. In some
embodiments, the first self-cleaving ribozyme is a 5' self-cleaving
ribozyme. In other embodiments, the first self-cleaving ribozyme is
a 3' self-cleaving ribozyme. In some embodiments, the second
self-cleaving ribozyme is a 5' self-cleaving ribozyme. In other
embodiments, the second self-cleaving ribozyme is a 3'
self-cleaving ribozyme. In some embodiments, the target segment is
flanked by a 5' self-cleaving ribozyme and a 3' self-cleaving
ribozyme. In some embodiments, the first region comprises an RNA
expression cassette.
[0006] In some embodiments, the 5' self-cleaving ribozyme is a
hammerhead ribozyme. In some embodiments, the 3' self-cleaving
ribozyme is a hammerhead ribozyme. In some embodiments, both the 5'
self-cleaving ribozyme and the 3' self-cleaving ribozyme are
hammerhead ribozymes. In some embodiments, neither the 5'
self-cleaving ribozyme and the 3' self-cleaving ribozyme are
hammerhead ribozymes. In some embodiments, the 5' self-cleaving
ribozyme includes SEQ ID NO: 2. In some embodiments, SEQ ID NO: 2
has conservative substitutions. In some embodiments, the 3'
self-cleaving ribozyme includes SEQ ID NO: 3. In some embodiments,
SEQ ID NO: 3 has conservative substitutions. In some embodiments,
the 3' self-cleaving ribozyme is a hepatitis delta virus (HDV)
ribozyme. In some embodiments, the 5' self-cleaving ribozyme is a
hammerhead ribozyme and the 3' self-cleaving ribozyme is a
hepatitis delta virus (HDV) ribozyme. In some embodiments, the 5'
self-cleaving ribozyme is a twister ribozyme. In some embodiments,
the 3' self-cleaving ribozyme is a twister ribozyme. In some
embodiments, both the 5' self-cleaving ribozyme and the 3'
self-cleaving ribozyme are twister ribozymes. In some embodiments,
the 5' self-cleaving ribozyme is a twister sister ribozyme. In some
embodiments, the 3' self-cleaving ribozyme is a twister sister
ribozyme. In some embodiments, both the 5' self-cleaving ribozyme
and the 3' self-cleaving ribozyme are twister sister ribozymes. In
some embodiments, the 5' self-cleaving ribozyme is a pistol
ribozyme. In some embodiments, the 3' self-cleaving ribozyme is a
pistol ribozyme. In some embodiments, both the 5' self-cleaving
ribozyme and the 3' self-cleaving ribozyme are pistol ribozymes. In
some embodiments, the 5' self-cleaving ribozyme is a hatchet
ribozyme. In some embodiments, the 3' self-cleaving ribozyme is a
hatchet ribozyme. In some embodiments, both the 5' self-cleaving
ribozyme and the 3' self-cleaving ribozyme are hatchet ribozymes.
In some embodiments, the 5' self-cleaving ribozyme is a hairpin
ribozyme. In some embodiments, the 3' self-cleaving ribozyme is a
hairpin ribozyme. In some embodiments, both the 5' self-cleaving
ribozyme and the 3' self-cleaving ribozyme are hairpin
ribozymes.
[0007] In some embodiments, the antigenome sequence comprises a
second region. In some embodiments, the genome sequence comprises a
second region. In some embodiments, the first region is upstream of
the second region. In some embodiments, the first region is
downstream of the second region. In some embodiments, the second
region comprises an expression cassette.
[0008] In some embodiments, the second region comprises a third
segment encoding a nuclease. In some embodiments, the nuclease
comprises a CRISPR-associated protein ("Cas"). In some embodiments,
the nuclease comprises Cas9. In some embodiments, the nuclease
comprises Cpf1. In some embodiments, the nuclease comprises a
Cas9-like protein or a Cas9-like synthetic protein. In some
embodiments, the nuclease comprises a Cfp1-like protein or a
Cfp1-like synthetic protein. In some embodiments, the nuclease
comprises a C2c1 protein, C2c2 protein, C2c3 protein, or variants
and modifications thereof. In some embodiments, the nuclease
comprises Class 2 CRISPR-associated nuclease. In some embodiments,
the nuclease comprises a Class 2 Type II CRISPR-associated
nuclease. In some embodiments, the nuclease comprises a Class 2
Type V CRISPR-associated nuclease. In some embodiments, the second
region further comprises a ribosomal skipping sequence. In some
embodiments, the ribosomal skipping sequence is a P2A ribosomal
skipping sequence. In some embodiments, the second region comprises
a fourth segment encoding a reporter molecule. In some embodiments,
the reporter molecule includes a protein. In some embodiments, the
reporter molecule is green fluorescent protein (GFP). In some
embodiments, the reporter molecule is red fluoresecent protein
(RFP). In some embodiments, the reporter molecule is mCherry. In
some embodiments, the target segment comprises target RNA. In some
embodiments, the target segment comprises guide RNA (gRNA). In some
embodiments, the gRNA has a scaffold sequence and a targeting
sequence. In some embodiments, the target segment further comprises
trans-activating crRNA (tracrRNA).
[0009] In some embodiments, the antigenome sequence comprises a
third region. In some embodiments, the genome sequence comprises a
third region. In some embodiments, the third region is upstream of
the first region. In some embodiments, the third region is
downstream of the first region. In some embodiments, the third
region is upstream of the second region. In some embodiments, the
third region is downstream of the second region. In some
embodiments, the third region is upstream of the first region and
downstream of the second region. In some embodiments, the third
region is downstream of the first region and upstream of the second
region. In some embodiments, the third region is flanked by the
first region and the second region. In some embodiments, the third
region comprises a fifth segment. In some embodiments, the fifth
segment comprises a P gene. In some embodiments, the P gene
comprises a mutant P gene. In some embodiments, the mutant P gene
has one or more of the following mutations: D433A, R434A, K437A,
and combinations thereof.
[0010] In some embodiments, the antigenome sequence comprises a
fourth region. In some embodiments, the genome sequence comprises a
fourth region. In some embodiments, the fourth region is upstream
of the first region. In some embodiments, the fourth region is
downstream of the first region. In some embodiments, the fourth
region is upstream of the second region. In some embodiments, the
fourth region is downstream of the second region. In some
embodiments, the fourth region is upstream of the first region and
downstream of the second region. In some embodiments, the fourth
region is downstream of the first region and upstream of the second
region. In some embodiments, the fourth region is upstream of the
first region, second region, and third region. In some embodiments,
the fourth region is downstream of the first region, second region,
and third region. In some embodiments, the fourth region is
downstream of the first region, second region, and upstream of the
third region. In some embodiments, the fourth region is upstream of
the first region, second region, and downstream of the third
region. In some embodiments, the fourth region is upstream of the
first region, third region, and downstream of the second region. In
some embodiments, the fourth region is downstream of the first
region, third region, and upstream of the second region. In some
embodiments, the third region comprises a sixth segment. In some
embodiments, the sixth segment comprises a L gene. In some
embodiments, the L gene comprises a mutant L gene. In some
embodiments, the mutant L gene has one or more of the following
mutations: N1197S, L15581, K1795E, and combinations thereof.
[0011] In some embodiments, the first region is heterologous. In
some embodiments, the second region is heterologous. In some
embodiments, the third region is heterologous. In some embodiments,
the fourth region is heterologous. In some embodiments, the first
region and the second region are heterologous. In some embodiments,
the first region and the third region are heterologous. In some
embodiments, the first region and the fourth region are
heterologous. In some embodiments, the second region and the third
region are heterologous. In some embodiments, the second region and
the fourth region are heterologous. In some embodiments, the first
region, second region and the third region are heterologous. In
some embodiments, the first region, second region and the fourth
region are heterologous. In some embodiments, the first region,
second region, third region and the fourth region are heterologous.
In some embodiments, the target segment is heterologous. In some
embodiments, the first segment is heterologous. In some
embodiments, the second segment is heterologous. In some
embodiments, the third segment is heterologous. In some
embodiments, the fourth segment is heterologous. In some
embodiments, the fifth segment is heterologous. In some
embodiments, the sixth segment is heterologous.
[0012] In some embodiments, the present disclosure is directed to
an RNA expression cassette. In some embodiments, the expression
cassette comprises a target sequence, a first segment encoding a
self-cleaving ribozyme, and a second segment encoding a
self-cleaving ribozyme. In some embodiments, the target segment is
flanked by the first segment and the second segment. In some
embodiments, the first self-cleaving ribozyme is a 5' self-cleaving
ribozyme. In other embodiments, the first self-cleaving ribozyme is
a 3' self-cleaving ribozyme. In some embodiments, the second
self-cleaving ribozyme is a 5' self-cleaving ribozyme. In other
embodiments, the second self-cleaving ribozyme is a 3'
self-cleaving ribozyme. In some embodiments, the target segment is
flanked by a 5' self-cleaving ribozyme and a 3' self-cleaving
ribozyme. In some embodiments, the 5' self-cleaving ribozyme and
the 3' self-cleaving ribozyme are hammerhead ribozymes. In some
embodiments, the 5' self-cleaving ribozyme is a hammerhead ribozyme
and the 3' self-cleaving ribozyme is a hepatitis delta virus (HDV)
ribozyme. In some embodiments, the target sequence comprises guide
RNA (gRNA). In some embodiments, the target sequence further
comprises trans-activating crRNA (tracrRNA).
[0013] In some embodiments, the present disclosure is directed to a
viral particle. In some embodiments, the viral particle comprises a
nucleic acid according to any aspect of the present disclosure. In
some embodiments, the viral particle is a single-stranded RNA
(ssRNA) virus. In some embodiments, the genome of the ssRNA virus
is of negative polarity. In some embodiments, the ssRNA virus is
within the order mononegavirales. In some embodiments, the ssRNA
virus is a Sendai virus. In some embodiments, the ssRNA virus is
attenuated. In some embodiments, the first region is inserted
between intergenic elements. In some embodiments, the intergenic
elements are P and M elements. In some embodiments, the second
region is inserted between intergenic elements. In some
embodiments, the intergenic elements are N and P elements. In some
embodiments, the viral particle comprises an RNA expression
cassette according to any aspect of the present disclosure. In some
embodiments, the RNA expression cassette is located in the 3'
region of the viral genome. In some embodiemnts, the viral particle
comprises a temperature sensitive mutant. In some embodiments, the
viral particle comprises a PL mutant. In some embodiments, the PL
mutant does not stimulate host interferon production.
[0014] In some embodiments, the present disclosure is directed to a
method of introducing target RNA into a host cell. In some
embodiments, the host cell is a prokaryotic cell. In some
embodiments, the prokaryotic cell comprises a bacterial or
archaebacterial cell. In some embodiments, the host cell is a
eukaryotic cell. In some embodiments, the eukaryotic cell comprises
a plant cell, an animal cell, a protist, or a fungal cell. In some
embodiments, the animal cell comprises a vertebrate (chordate)
cell. In some embodiments, the animal cell comprises an
invertebrate cell. In some embodiments, the animal cell comprises a
mammalian cell. In some embodiments, the method comprises the steps
of (i) contacting the host cell with a viral particle according to
any aspect of the present disclosure; and (ii) culturing the host
cell under conditions allowing (a) producing a target RNA; and (b)
liberating the target RNA, wherein the first self-cleaving ribozyme
liberates the target RNA from the transcribed first region. In some
embodiments, the host cell is selected from the group consisting of
an archaea cell, bacterial cell, and a eukaryotic cell.
[0015] In some embodiments, the present disclosure is directed to a
method of introducing a site-specific modification to target DNA in
a host cell. In some embodiments, the host cell is a prokaryotic
cell. In some embodiments, the prokaryotic cell comprises a
bacterial or archaebacterial cell. In some embodiments, the host
cell is a eukaryotic cell. In some embodiments, the eukaryotic cell
comprises a plant cell, an animal cell, a protist, or a fungal
cell. In some embodiments, the animal cell comprises a vertebrate
(chordate) cell. In some embodiments, the animal cell comprises an
invertebrate cell. In some embodiments, the animal cell comprises a
mammalian cell. In some embodiments, the method comprises the steps
of (i) contacting the host cell with a viral particle according to
any aspect of this disclosure where the viral particle has a genome
encoding a 5' self-cleaving ribozyme, gRNA, and a nuclease; (ii)
culturing the host cell under conditions allowing (a) producing the
gRNA flanked by the 5' self-cleaving ribozyme and the nuclease; (b)
liberating the gRNA, wherein the 5' self-cleaving ribozyme
liberates the gRNA, (c) expressing the nuclease; (d) forming a
complex between the nuclease and the gRNA, wherein the scaffold
sequence of the gRNA is bound to the nuclease; and (e) contacting
the target DNA with the complex, wherein the targeting sequence of
the gRNA binds to a sequence on the target DNA adjacent to a
protospacer adjacent motif (PAM); and (iii) introducing the
site-specific modification to the target DNA. In some embodiments,
the site-specific modification is an insertion. In some
embodiments, the site-specific modification is a deletion. In some
embodiments, the site-specific modification is a frameshift. In
some embodiments, the site-specific modification is a point
mutation. In some embodiments, the site-specific modification is
one of an insertion, a deletion, a frameshift, and a point
mutation. In some embodiments, the DNA is genomic. In some
embodiments, the DNA is chromosomal. In other embodiments, the DNA
is extra-chromosomal. In some embodiments, the DNA is mitochondrial
DNA. In some embodiments, the DNA is chloroplast DNA. In some
embodiments, the DNA is on a plasmid.
[0016] In some embodiments, the present disclosure is directed to a
vector or vector system. In some embodiments, the vector comprises
DNA encoding any nucleic acid of the present disclosure. In some
embodiments, the vector is one or more plasmids. In some
embodiments, the vector or vector system is one or more cosmids. In
some embodiments, at least one plasmid has a T7-driven promoter
element. In some embodiments, the present disclosure is directed to
a cell transformed with a vector or vector system of any aspect of
the present disclosure. In some embodiments, the cell is a
bacterial cell. In some embodiments, the cell is E. coli. In some
embodiments, the cell is S. pyogenes. In some embodiments, the cell
is a fungal cell. In some embodiments, the cell is S. cerevisiae or
S. pombe. In some embodiments, the cell is P. pastoris. In some
embodiments, expression of one or more vectors is concomitant. In
other embodiments, expression of one or more vectors is separately
inducible.
[0017] In some embodiments, the present disclosure is directed to a
kit. In some embodiments, the kit comprises a vector according to
any aspect of the present disclosure. In some embodiments, the kit
comprises a pharmaceutically acceptable preservative or carrier. In
some embodiments, the kit further comprises reagents for expressing
the DNA encoding the genome sequence or the antigenome sequence
that is complementary to the genome sequence. In some embodiments,
the reagents include polymerase. In some embodiments, the
polymerase is T7 RNA polymerase. In some embodiments, the reagents
include primers. In some embodiments, the kit further comprises
instructions for use.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 represents Sendai virus incorporating Cas9 and a
guide RNA (gRNA) flanked by self-cleaving ribozymes replicates to
high titer. FIG. 1A: The negative-sense RNA genome is flanked by
virus promoters (the 3' leader (le), which serves as the genomic
promoter, and the 5' trailer (tr), which serves as the antigenomic
promoter). Shown are the Sendai virus genes N (nucleoprotein), P
(phosphoprotein), M (matrix), F (fusion protein), HN (attachment
protein), and L (large RNA-dependent RNA polymerase). An
EGFP-P2A-Cas9 cassette (5.1 kb) was inserted between N and P, and a
guide RNA flanked by self-cleaving ribozymes (rbz 1 and 2) (0.2 kb
total) was inserted between P and M. The ribozymes are only
functional in the positive-sense, or 5'-to-3', orientation. Genome
may be transcribed from 3' to 5' into either full length antigenome
or individual capped and polyadenylated mRNAs. These mRNAs are
produced in a polar transcriptional gradient, with N mRNAs being
the most abundant, and L mRNAs being the least abundant. FIG. 1B:
The self-cleaving hammerhead ribozyme sequences (SEQ ID NO:2 and
SEQ ID NO:3) and structures are shown. The chimeric guide RNA is
shown in orange, corresponding to the orange highlight in FIG. 1A.
Arrows indicate sites of cleavage. FIG. 1C: The self-cleavage
activity of the ribozymes was assayed by qRT-PCR as described in
Materials and Methods. Error bars represent standard deviation from
3 independent experiments. FIG. 1D: rSeV-Cas9 (WT), or rSeV-Cas9
with both ribozymes mutated to abolish self-cleavage (Mut), was
rescued from plasmid DNA. As EGFP is only expressed upon conversion
of transfected antigenome to genome and subsequent virus mRNA
production, rescue efficiency was determined by observing GFP+
cells (rescue events) by flow cytometry at 1-2 days
post-transfection (dpt). Error bars represent standard deviation
from 3 replicates. ns, not significant. FIG. 1E: BSR-T7 cells were
infected at a multiplicity of infection (MOI) of 0.01. Although the
ribozymes in rSeV-Cas9 (WT) appear to affect growth compared to the
mutant with no self-cleavage (Mut), they both reach the same peak
titer of almost 10.sup.8 IU/mL. FIG. 1F: HEK293 cells in 6-well
were transfected with 2 ug px330 (from which the FLAG-tagged Cas9
in rSeV-Cas9 was derived) or infected with rSeV-Cas9 at a MOI of
10. Cell lysates were collected 2 days later and processed via
SDS-PAGE and Western blot analysis for detection of the FLAG
epitope on Cas9. COX IV represents the loading control.
[0019] FIG. 2 represents rSeV-Cas9 targeting mCherry gene achieves
almost complete mutagenesis of a reporter cell line. FIG. 2A:
mCherry-inducible HEK293 cells were infected with rSeV-Cas9-control
(no guide RNA) or rSeV-Cas9-mCherry (guide RNA targeting mCherry)
at MOI 25. Expression of mCherry was induced with doxycycline (dox)
after 4 days post-infection, and cells were collected for flow
cytometry the following day. Percent knockout (KO) of mCherry
fluorescence was determined as 100*(1-(C/(C+D)/(A/(A+B)). Results
from 3 independent experiments are shown. FIG. 2B: Cells treated as
in panel FIG. 2A were imaged by fluorescence microscopy. The same
exposure was used for each condition. FIG. 2C: rSeV-Cas9-mCherry
was mutated to render Rbz 2 (Rbz 2-mut) or both ribozymes (Rbz
1/2-mut) non-functional. An alternative 3' ribozyme, the hepatitis
delta virus (HDV) ribozyme, was also tested via replacement of Rbz
2. The experiment was performed as in FIG. 2A. FIG. 2D: HEK293
cells were infected with rSeV-Cas9-control or rSeV-Cas9-mCherry at
MOI 25 and collected for deep sequencing of the mCherry locus at 6
days post-infection. Error bars represent Jeffreys 95% confidence
intervals. The 5 most abundant species of mutated target (SEQ ID
NOs: 44-49, respectively) and their relative abundance percentages
are shown. Highlights represent the 20 bp target sequence, the
arrowhead represents the Cas9 cleavage site, and the 3 bp PAM motif
is shown.
[0020] FIG. 3 represents rSeV-Cas9 efficiently mutates endogenous
ccr5 and efnb2. FIG. 3A: Affinofile cells were infected with
rSeV-Cas9-control or rSeV-Cas9-CCR5 at MOI 25. CD4/CCR5
overexpression was induced at day 2, and cells were further
infected with CCR5-tropic HIV-1 the following day. Flow cytometry
for p24 and CCR5 was performed 5 days after infection with rSeV.
Data shown is gated on rSeV-infected cells (GFP+). FIG. 3B: HEK293
cells were infected with rSeV-Cas9-control or the targeting viruses
rSeV-Cas9-CCR5 or rSeV-Cas9-EFNB2 at MOI 25. Flow cytometry at 2
days post-infection indicated 98% infection. Cells were collected
at 6 days post-infection for deep sequencing of target and
off-target loci (see Table 2 infra for genomic locations and
sequences). Error bars represent Jeffreys 95% confidence intervals.
For each target, the 5 most abundant species of mutated target (SEQ
ID NOs: 50-61, respectively) and their relative abundance
percentages are shown.
[0021] FIG. 4 represents Ccr5-targeting rSeV-Cas9 edits primary
human monocytes at high frequency. FIG. 4A: Primary human monocytes
were infected with rSeV-Cas9-control or rSeV-Cas9-CCR5 at MOI 50
with simultaneous stimulation with GM-CSF and collected at 5 days
post-infection for deep sequencing of on-target and off-target
loci. Flow cytometry showed 98% infection. Error bars represent
Jeffreys 95% confidence intervals. For each target, the 5 most
abundant species of mutated target (SEQ ID NOs: 62-67,
respectively) and their relative abundance percentages are shown.
FIG. 4B: Primary human monocytes from an independent donor were
infected as in panel a, and cells were collected at 5 days
post-infection for flow cytometry of cell surface CCR5. Data shown
is gated on infected cells (GFP+).
[0022] FIG. 5 represents a time course of mCherry fluorescence
knockout by rSeV-Cas9-mCherry. FIG. 5A: mCherry-inducible HEK293
cells were infected with rSeV-Cas9-control or rSeV-Cas9-mCherry at
MOI 25. mCherry expression was induced with doxycycline at the
indicated days post-infection, and cells were collected for flow
cytometry the following day. FIG. 5B: Histograms of mCherry
expression (gated on infected GFP+ cells) are shown below as an
alternative comparison.
[0023] FIG. 6 represents abundance of ccr5 mutation variants in
monocytes (FIG. 6A) and HEK293s (FIG. 6B). The relative abundance
of all mutation variants for ccr5 are shown in the pie charts.
These specific variants are also highlighted in the HEK293 pie
chart. The distributions of variant abundance for the 100 most
abundant variants for either monocytes or HEK293s are shown at
right.
[0024] FIG. 7 represents a diagram of qRT-PCR primers used for
ribozyme cleavage assay.
[0025] FIG. 8 represents a schematic of the PL mutant generated in
Example 2. FIG. 8A shows a schematic of the specific P and L
mutations. FIG. 8B shows the temperature sensitive phenotype of the
PL mutants.
[0026] FIG. 9 represents the PL mutant's (ts rSeV-Cas9-CCR5 vector)
ability to infect human CD34+ hematopoietic stem cells (HSCs) from
both human fetal liver and peripheral blood. FIG. 9A shows the same
schematic from FIG. 8A for reference. The gRNA is targeted against
CCR5 and is the exact gRNA that was used in Example 1. FIG. 8B
shows PL mutant transduction/infection of purified human fetal
liver CD34+ and peripheral blood mobilized CD34+ HSCs (>90% GFP+
at 2 days post-infection (dpi) using an MOI of 5; infection
performed at 34.degree. C.). FIG. 9C shows time course of infection
at 34.degree. C. vs 37.degree. C. CD34+ HSCs were infected at
34.degree. C. for 2 days and then either maintained at 34.degree.
C. or shifted to 37.degree. C. at 2 dpi. The GFP+ cells steadily
declined. FIG. 9D shows Sanger sequencing data from PL
mutant-infected CD34+ HSCs at 2 dpi. 19/24 clones (.about.80%)
showed indels at the targeted CCR5 locus. The wild type and first
four clones have SEQ ID NOs: 68-72, respectively.
[0027] FIG. 10 represents the PL mutant (ts rSeV-Cas9-CCR5 vector)
efficiently transduces human
CD34+/CD38-/CD45RA-/CD90+(Thy1+)/CD49fhigh cells (LT-HSC,
SCID-Repopulating Cells). Phenotyping of infected CD34+ HSCs showed
that the PL mutants can infect >90% of
CD34+/CD38-/CD45RA-/CD90+(Thy1+)/CD49f-high cells which are known
in the literature as long-term-HSC or SCID-repopulating cells,
capable of reconstituting SCID (immuodeficient) mice at a single
cell level (i.e. "true" stem cells.)
[0028] FIG. 11 represents the fold induction of 2 representative
ISGs (interferon stimulated genes) in 293T cells infected with
either the "wild type" rSeV-Cas9 vector or the PL mustants across a
wide range of viral inoculum. IFIT1 fold induction is represented
in FIG. 11A. RIG-1 fold induction is represented in FIG. 11B. Viral
replication and ISG induction was measured by qRT-PCR. Eveb at high
viral genome copies, the PL mutant virus was markedly deficient in
inducing ISGs. This remained true regardless of the gRNA contained
(mCherry or CCR5). Data is shown for the CCR5 gRNA virus.
[0029] FIG. 12 represents a schematic diagram of an rSeV vector
that can deliver two gRNAs, e.g. CCR5 gRNA and HRPT gRNA. FIG. 12A
represents a schematic of the PL mutant. FIG. 12B represents a
schematic of a PL mutant modified to be missing the Fusion protein
(.DELTA.F) and a target RNA delivery region modified to deliver two
gRNAs; CCR5 and HRPT, both flanked by hammerhead and HDV
self-cleaving ribozymes.
DETAILED DESCRIPTION OF THE INVENTION
[0030] One embodiment of the present disclosure relates to novel
nucleic acids, including but not limited to, RNA expression
cassettes. The nucleic acids generally relate to genetically
modified genomes or antigenomes complementary to the genomes of
ssRNA viruses, e.g. the Sendai virus (SeV). The genome of
mononegavirales, including but not limited to paramyxoviruses and
SeV, is antisense RNA (i.e. having negative polarity). Thus, when
the present specification refers to a nucleic acid comprising a
genome sequence of a single-stranded RNA (ssRNA) virus, the genome
sequence is understood as being antisense RNA. The antigenome
sequence is therefore sense RNA. Accordingly, an RNA antigenome
transcribed from the negative polarity genome of, e.g. Sendai
virus, will contain sense RNA. mRNA transcribed from the genome of
an ssRNA virus will likewise contain sense RNA that can be
translated, or in the instance where the mRNA contains a target
sequence adjacent to one or more self-cleaving ribozymes (e.g.
flanked by self-cleaving ribozymes), the self-cleaving ribozymes
will be able to liberate the target sequence. Because the
antigenome of the present disclosure is oriented in the 5' to 3'
direction, similar to the biologically active mRNA transcribed from
the negative polarity genome, elements of the nucleic acids of the
present disclosure are typically referred to by their antigenome
components. However, the invention as described herein is
explicitly not limited to just the antigenome components, as the
genomic components, e.g. as contained within the viral particles of
the present disclosure (discussed infra) represent novel nucleic
acids that may be transcribed in vitro or in vivo into an
antigenome or antigenomic elements thereof or transcribed into mRNA
fragments which undertake a biologically active role.
[0031] The antigenome sequences of the present disclosure generally
comprise a first region comprising (i) a target segment, and (ii) a
first segment encoding a first self-cleaving ribozyme. The target
segment is to be understood as being a payload, e.g. an RNA
payload, that is capable of being liberated from mRNA transcribed
from the genome by the one or more self-cleaving ribozymes adjacent
to the target segment. This self-cleaving ribozyme may be either a
5' self-cleaving ribozyme or a 3' self-cleaving ribozyme. Preferred
embodiments of the present disclosure utilize both a 5'
self-cleaving ribozyme and a 3' self-cleaving ribozyme that flank
the target segment to be delivered to the cell. FIG. 2C illustrates
that while it is preferable to have both 5' and 3' self-cleaving
ribozymes present, only one is truly necessary for the invention to
work in this aspect. However, while not wishing to be bound by
theory, it is believed that for methods involving introduction of
site-specific modifications to target DNA (i.e. CRISPR-related
applications), at least one 5' self-cleaving ribozyme must be
present. This is because the targeting sequence of gRNA is located
on the 5' end of the gRNA and small alterations to such may result
in a loss of targeting ability. However, for general delivery of
target segments, e.g. target RNA to a cell, either a single 5'
self-cleaving ribozyme or a 3' self-cleaving ribozyme will be
sufficient. The general concept of the present disclosure with
respect to this aspect is that the genome and the antigenome
sequences can "store" (i.e. encode) one or more self-cleaving
ribozymes without being active, as they are only biologically
active once transcribed into mRNA from the genome sequences. While
not wishing to be bound by theory, it is believed that although the
antigenome contains the ribozyme(s) in the same orientation as mRNA
transcribed from the genome, the self-cleaving ribozymes are not
active in the antigenome. This is believed to be due to
co-transcriptional encapsidation of the genomic and antigenomic RNA
by the viral nucleocapsid protein. This is significant because if
the antigenome was self-cleaving, production of additional
full-length genomes from the antigenome would be impossible.
Therefore, the ribozymes of the present disclosure are considered
only active in the mRNAs transcribed from the genome, which are not
encapisdated by the nucleocapsid protein which encapisdates the
viral antigenome (represented by N in FIG. 1). Once mRNA is
transcribed from the viral genome, the self-cleaving ribozymes
activate and cleave themselves and by doing so, liberate the target
segment that they are either adjacent to (in the case of a single
self-cleaving ribozyme) or flank (in the preferred case of two
self-cleaving ribozymes). The target segment is then free to serve
any particular utility in the cell which transcribed the viral
genome.
[0032] The self-cleaving ribozymes of the present disclosure can
take a number of forms. The exemplary self-cleaving ribozymes are
hammerhead ribozymes, as shown in FIG. 1A. However, other
self-cleaving ribozymes may be used, including hepatitis delta
virus (HDV) ribozymes. It is important to note that as detailed
herein, HDV ribozymes may only be utilized as 3' self-cleaving
ribozymes, whereas hammerhead ribozymes may be utilized in both 5'
and 3' self-cleaving ribozymes. Other self-cleaving ribozymes which
may be utilized include twister (e.g. Twiser from O. sativa, env9,
and env22), twister-sister, pistol, hatchet, hairpin, Neurospora
VS, and glmS ribozymes. Self-cleaving ribozymes are generally
characterized by distinct active site architectures and divergent,
but similar, biochemical properties. The cleavage activities of
self-cleaving ribozymes are highly dependent upon divalent cations,
pH, and base-specific mutations, which can cause changes in the
nucleotide arrangement and/or electrostatic potential around the
cleavage site. Self-cleaving ribozymes are detailed in Weinberg et
al., 2015, Nature Chemical Biology, "New classes of self-cleaving
ribozymes revealed by comparative genomics analysis" and Lee et
al., 2017, Molecules, "Structural and Biochemical Properties of
Novel Self-Cleaving Ribozymes," both references hereby incorporated
by reference in their entireties. Without wishing to be bound by
theory, the mechanism of action of most self-cleaving ribozymes is
based in acid-base catalysis of guanine and adenine in close
proximity of the cleavage site. Additionally, metal ions are
believed to play a structural rather than catalytic role, despite
the fact that some crystal structures have shown a direct metal ion
coordination to a non-bridging phosphate oxygen at the cleavage
site. As new self-cleaving ribozymes arise, they too will be
considered to be within the scope of this disclosure, so long as
they are capable of self-cleaving and successfully delivering
target segments (e.g. RNA payloads) to a target cell when
transcribed from a ssRNA viral genome.
[0033] As an exemplary method of use of the novel nucleic acids,
the target segments may comprise guide RNA (gRNA), and/or tracrRNA.
In such embodiments, the nucleic acids may further (but not
necessarily) comprise a second region. The second region of the
genome may contain a nucleotide sequence that, when transcribed,
produces mRNA that is capable of being translated to code for a
nuclease, e.g. Cas9, including but not limited to Cas9 homologs, or
Cpf1, although other nucleases may be suitable for incorporation
into the present disclosure. An exemplary embodiment of this
nucleic acid is shown at FIG. 1A. In such embodiments, the first
region and the second region may be subcloned into different
locations within the ssRNA viral genome. One particular
consideration in where to subclone the first region/second region
is the rate of transcriptional activity relative to genome
location. For example, with SeV, an exemplary ssRNA virus,
transcription is more active in the 3' region of the viral genome,
thus a region (or expression cassette) that is located in the 3'
region of the genome will be overexpressed relative to an region
(or expression cassette) located within the 5' region of the viral
genome. This trait is common to all paramyxoviruses, which carries
with it the strong implication that success achieved with SeV, as
shown in Example 1 infra, translates to the other members of the
family. Thus there may be various benefits to cloning such regions
closer to or farther from the 5' or 3' end of the viral genome. The
takeaway is that the location of cloning into the viral genome of
the first region and the second region is discretionary, and that
the emphasis should be on the composition of the regions
themselves, and not the remainder of the viral genome elements.
[0034] Another aspect of the present disclosure relates to viral
particles that comprise the foregoing nucleic acids discussed in
the above section titled "nucleic acids." As mentioned supra, the
nucleic acids of the present disclosure relate to modified genomes
and antigenomes of ssRNA viruses. Thus, this aspect of the
disclosure relates to the modified ssRNA viruses. As previously
discussed, any ssRNA virus where the RNA is negative polarity (i.e.
antisense) is considered to be within the scope of this disclosure
and thus suitable for use. Explicitly, the viruses of the order
mononegavirales are considered to be within the scope of this
disclosure. This is because viruses of the order mononegavirales
have common attributes that lend them suitable to incorporate the
nucleic acids of the present disclosure. Mononegavirales possess a
linear, single-stranded, non-infectious RNA strand having negative
polarity. Mononegavirales have characteristic gene order, produce
5-10 distinct mRNAs via polar sequential transcription, and
replicate by synthesizing complete antigenomes.
[0035] Families within mononegavirales include bornaviridae,
filoviridae, nyamiviridae, paramyxodiridae, and rhabdoviridae.
Genera within bornaviridae include bornavirus. Genera within
filoviridae include cuevavirus, ebolavirus, and marburgvirus.
Genera within nyamiviridae include nyavirus. Genera within
paramyxoviridae include aquaparamyxovirus, avulavirus, feravirus,
heniparvirus, morbillivirus, respirovirus, rubulavirus,
pneumovirus, and metapneumovirus. Genera within rhabdoviridae
include alemndravirus, baiavirus, curiovirus, cytorhabdovirus,
dichorhavirus, ephemerovirus, hapavirus, ledantevirus, lyssavirus,
novirhabdovirus, nuclearhabdovirus, perhabdovirus, sawgravirus,
sigmavirus, sprivivirus, tibrovirus, tupavirus, and vesiculovirus.
While one of ordinary skill in the art will readily realize that
not all of these candidates may be as suitable for incorporation
into certain embodiments of the present disclosure as
paramyxoviridae, including but not limited to Newcastle disease
virus (NDV) and the Sendai virus, each of these viruses possess the
necessary features from a compositional standpoint to incorporate
the nucleic acids of the present disclosure.
[0036] Viral particles of the present disclosure may be generated
by routines known to those of ordinary skill in the art. For
example, the viral particles of the present disclosure may be
generated from packaging cells that are transfected with vectors,
e.g. one or more plasmids of the present disclosure, that contain
DNA encoding a nucleic acid of the present disclosure, e.g. a viral
genome or antigenome of the present disclosure. This allows for
scalable production of the viral particles, especially in instances
where the viral particles are attenuated, e.g. not
replication-competent. Expression of the vectors is induced in the
packaging cells and the viruses assemble for harvesting. This
process is exemplified in Example 1, where E. coli cells were
transfected with plasmid containing elements of the rSev-Cas9
recombinant genome/antigenome. Other packaging cells are known to
one of ordinary skill in the art and may include, but are
explicitly not limited to, HEK293 cells and PA317 cells.
[0037] Of the ssRNA viruses suitable for the present disclosure,
the Sendai virus (SeV) is of particular interest, and is an
exemplary virus used throughout Example 1 infra. The present
disclosure has surprisingly shown that certain ssRNA viruses, e.g.
paramyxoviruses, exemplified by the Sendai virus, can tolerate
self-cleaving ribozymes within the genome. While not wishing to be
bound by theory, as discussed supra, this is likely due to
co-transcriptional encapsidation of the genomic and antigenomic RNA
by the nucleoprotein and thus prevention of ribozyme activity
during replication of the full-length RNA. Along with further
incorporation of Cas9 expression, the rescued replication-competent
virus was able to efficiently induce mutagenesis of the guide RNA
target sequence in the genome. For example, although the efficiency
of the ccr5-targeting virus is not directly comparable to other
studies due to the differing guide RNA sequences and target cells
used, rates of ccr5 mutagenesis (75-88%) was achieved similar to or
higher than those achieved via lentivirus or AAV CRISPR/Cas9
transduction. Further, because infection with Sendai virus was
highly efficient, achieving these high rates of mutagenesis did not
require sorting or selection for infected cells, another distinct
advantage.
[0038] In addition to the advantages of broad tropism, growth to
high titers, and robust expression of foreign genes previously
mentioned, ssRNA viruses, e.g. Sendai virus, have additional
important advantages as a gene therapy vector. First, such viruses
are amenable to envelope switching or modification, in which
envelope proteins with different cell type specificities can be
substituted for the original, or the original attachment or fusion
protein itself can be modified to have a different specificity.
Second, Sendai virus, like other paramyxoviruses, has a polar
transcriptional gradient (FIG. 1A) with reduction of transcript
levels as the polymerase complex moves from the 3' to 5' end of the
genome. The efficiency versus the specificity of Cas9 activity
appears to be a trade-off, and the optimal levels of Cas9 and guide
RNA expression therefore likely must be determined for each CRISPR
delivery platform. Thus, for paramyxoviruses in particular, levels
of Cas9 and guide RNA expression can be modulated and fine-tuned by
shifting the inserted regions of these introduced elements within
the genome, or by modifying the strength of gene start signals.
Third, paramyxoviruses are not prone to genetic recombination or
instability, and no homologous or heterologous recombination has
ever been detected for Sendai virus. Fourth, despite a high
prevalence of immunity to the related human parainfluenza virus-1,
cross-neutralizing anti-Sendai virus titers are low. Thus, Sendai
virus, as a mouse pathogen, would not encounter significant
pre-existing specific immunity in humans, making Sendai virus in
particular a highly attractive target for gene therapy, e.g.
delivery of a RNA target to a cell.
[0039] Although the disclosure is strictly not limited to Sendai
virus (SeV), the Sendai virus has several characteristics that
render it surprisingly effective. The Sendai virus has been
extensively studied and modified to develop temperature-sensitive,
non-cytopathic, and replication-incompetent Sendai viruses that are
useful for ex vivo and in vivo gene therapy applications. Mutations
and variants of Sendai virus have been characterized that allow
replication of Sendai virus at a permissive temperature until a
temporary shift to a non-permissive temperature, after which
replication is blocked and can no longer be detected. Such control
of Sendai viral replication with temperature sensitivity can allow
for temporal control of Cas9 and guide RNA expression, which would
reduce off-target effects by removing the vector once editing is
complete, again speaking to the particular utility of the Sendai
virus. Mutations that further confer the ability to avoid
triggering innate immune responses and concomitant
cytopathogenicity would avoid disturbing sensitive cell types such
as hematopoietic stem cells or other primary cells. Finally, the
Sendai virus is amenable to single and multiple deletions of the
envelope and/or matrix genes such that the virus can only replicate
when these viral factors are supplied in trans. Upon infection of
target cells in the absence of these exogenously supplied factors,
the virus can produce the factors encoded on its genome but cannot
amplify via production of subsequent infectious virus.
[0040] Example 2 infra illustrates preferred embodiments of the
recombinant Sendai viral vectors, having mutant P and L genes,
designated as PL mutants. The PL mutants are temperature sensitive,
efficiently transfecting at 34.degree. C. but not at 37.degree. C.
More surprisingly, however, is that the PL mutants do not induce a
host interferon (IFN) response, i.e. do not stimulate production of
IFN in a host when infected with the PL mutant vectors. The
IFN-silent phenotype is particularly important when applying the
viral vectors to sensitive cells like CD34+ hematopoietic stem
cells where induction of IFN can drive differentiation and
compromise "sternness". Accordingly PL mutants, particularly PL
mutants of the Sendai virus, represent a surprisingly effective
vehicle for RNA transfection in a host cell, e.g. stem cell.
[0041] The viral particles of the present disclosure may be
utilized to introduce an RNA payload into a target cell, e.g. a
gRNA payload in the case of CRISPR-related applications. Generally,
the a host cell is infected with a viral particle of the present
disclosure and the host cell is cultured under conditions that
allow for the liberation of the target RNA. Cell culturing
techniques are known to one of ordinary skill in the art. As
detailed supra, transcription of the viral genome or a portion of
the viral genome, e.g. transcription of an RNA expression cassette
inserted into the viral genome, into mRNA allows for the one or
more self-cleaving ribozyme(s) to cleave themselves out of the
transcribed mRNA and the target RNA along with it. In such
embodiments, there need be only one self-cleaving ribozyme present,
e.g. 5' self-cleaving ribozyme or a 3' self-cleaving ribozyme. The
self-cleaving ribozyme must be adjacent to or flank the target RNA
payload so that it is capable of liberating the payload upon
transcription of the viral genome into mRNA.
[0042] The target RNA may be, e.g., microRNA (miRNA), gRNA, or any
other RNA. The RNA payload does not have to have any particular
therapeutic use, but one of ordinary skill in the art can envision
many such uses. For example, the target RNA may be involved in RNA
silencing. The RNA may be utilized to regulate gene expression,
e.g. post-transcriptionally. Some non-limiting examples of a target
RNA include siRNA and miRNA, which may or may not have specific
therapeutic uses. siRNA may be utilized for RNA interference (RNAi)
to promote gene silencing. miRNAs are used for similar therapeutic
end means, and may represent a particularly useful therapeutic
non-CRISPR related application of the present disclosure. miRNAs
are currently being utilized to treat many distinct types of
diseases, from autoimmune disease to neurodegenerative disorders to
cancer. miRNAs are typically endogenous 17-24 base-long
single-stranded, non-coding RNAs that regulate gene expression in a
sequence-specific manner in plants and animals. Endogenously,
miRNAs are derived from longer RNA transcripts by Drosha and Dicer.
The resultant miRNAs bind to their target sequence, typically
within the 3' untranslated region (UTR) of mRNA, thus leading to
repression of translation. The present disclosure provides an
alternative delivery mechanism for miRNA by simply cleaving the
miRNA from the transcribed antigenome, e.g. by flanking
self-cleaving ribozyme(s). One of ordinary skill in the art will
appreciate that the class of miRNAs which can be delivered in this
manner are vast, and are not considered to be limited according to
the therapeutic use of such, rather they are to be considered
within the scope of delivering a target RNA to a cell according to
the present disclosure.
[0043] An exemplary use of the nucleic acids/viral particles of the
present disclosure relates to gene editing via CRISPR-related
technology. CRISPR stands for clustered regularly interspaced short
palindromic repeats type II system. CRISPR is a bacterial immune
system that is modified for genetic engineering purposes. Prior to
CRISPR the most common genomic engineering approaches utilized zinc
finger nucleases. CRISPR relies on two components, a guide RNA
(gRNA) and a non-specific CRISPR-associated endonuclease, e.g.
Cas9. The gRNA is a synthetic RNA having a scaffold sequence and a
target sequence. The scaffold sequence is necessary for binding to
the nuclease, e.g., Cas9. The targeting sequence, often
approximately (although explicitly not necessarily) 20 nucleotides
in length, defines the genomic target to be modified. Thus, one of
ordinary skill in the art can change the genomic target by simply
changing the targeting sequence present in the gRNA. The genomic
target can be any .about.20 nucleotide DNA sequence, provided it
meets two conditions: 1) the sequence is unique compared to the
rest of the organism's genome and 2) the target is present
immediately upstream of a Protospacer Adjacent Motif (PAM). The PAM
sequence is dependent upon the exact species from which the
nuclease was originally derived from. For example, the PAM for Cas9
derived from S. pyogenes is 5'-XGG-3', wherein X is any nucleobase,
whereas the PAM for Cfp1 is 5'-TTX-3'. One of ordinary skill in the
art will be familiar with different nucleases, e.g. Cas9 and
related proteins, and their corresponding PAMs.
[0044] Cas9 was originally isolated from S. pyogenes, and while
that remains an exemplary nuclease in the disclosure, there are
many different nucleases, including Cas9 variants, which are
suitable for use in this aspect of the disclosure. For example,
there are synthetic Cas9 proteins that have artificial PAM
recognition sequences, e.g. as described in Kleinstiver B P et al.,
Nature, 2015 Jun. 23; 523(7561):481-5, hereby incorporated by
reference in its entirety. There are Cas9 homologs derived from
organisms other than S. pyogenes, for example, Cas9 from S. aureus
(SaCas9). SaCas9 is approximately 1 kilobase smaller in size than
Cas9 from S. pyogenes, which may render it more suitable for
incorporation into the viral particles of the present disclosure
due to the limited genome size of some viral particles, although
this is not an issue for Sendai virus as illustrated in Example 1
infra. One of ordinary skill in the art will appreciate that Cas9
derived from other organisms are only compatible with tracrRNA and
crRNA or synthetic gRNA derived from the same host species.
Furthermore, there are alternatives to Cas9 derived from S.
pyogenes, synthetic Cas9, or Cas9 homologs. One such alternative is
Cpf1, described in Zetsche B et al., Cell. 2015 Oct. 22;
163(3):759-71 and Kleinstiver B. P. et al., Nature Methods 2016
Aug. 30; 714(13), both references incorporated by reference in
their entireties. Cpf1 has a PAM of 5'-TTX-3, wherein X is any
nucleobase, and is located immediately upstream of the target DNA,
instead of the target DNA being immediately upstream of the PAM in
the case of Cas9. Furthermore, Cpf1 cleavage results in a 5
nucleotide 5' overhang 18 base pairs from the PAM sequence, whereas
Cas9 cutting results in blunt DNA ends 3 base pairs distal to the
PAM sequence. Additionally, Cpf1 only requires CRISPR RNA (crRNA)
for successful targeting whereas Cas9 requires both crRNA and
transactivating crRNA (tracrRNA). Further CRISPR proteins may
include C2c1, C2c2, and C2c3 proteins, disclosed in, for example,
Shmakov et al., Molecular Cell 2015 Oct. 22; 60(3): 385-397, hereby
incorporated by reference in its entirety.
[0045] CRISPR-Cas gene editing systems have recently been
reclassified into two primary classes spanning five types and
sixteen subtypes, reviewed in Makarova, K., et al., Nature Reviews
Microbiology 13:1-15 (2015), hereby incorporated by reference in
its entirety. Classification was based upon identifying all cas
genes in a CRISPR-Cas locus and subsequently determining key genes
in each locus. This lead to a conclusion that currently known
CRISPR-Cas systems can classified as either "Class 1" or "Class 2"
depending on the genes encoding the proteins involved in the
interference stage. A recent sixth CRISPR-Cas system has been
identified, described in Abudayyeh O., et al. Science 2016, hereby
incorporated by reference in its entirety.
[0046] "Class 1" systems generally comprise a multi-subunit
crRNA-effector complex, whereas "Class 2" systems generally
comprise a single protein, such as Cas9, Cpf1, C2c1, C2c2, C2c3, or
a crRNA-effector complex. Class 1 systems comprise "Type I," "Type
III" and "Type IV" systems. "Class 2" systems comprise "Type II"
and "Type V" systems. Class 1 CRISPR-Cas systems are characterized
by effector modules consisting of multiple subunits. Class 1
systems comprise about 90% of all CRISPR-Cas loci identified in
bacteria and archaea and can target both DNA and RNA, as described
in Makarova et al., Cell (2017) 168(5), hereby incorporated by
reference in its entirety.
[0047] Type I systems are characterized by a Cas3 protein that has
helicase activity and cleavage activity. Type I systems are further
divided into seven specific sub-types (I-A, I-B, I-C, I-D, I-E,
I-F, and I-U). Each Type I subtype has a defined combination of
signature genes and distinct operon organization. Type I systems
additionally have a multiprotein crRNA-effector complex that is
involved in the processing and interference stages of the
CRISPR-Cas immune system, known as CRISPR-associated complex for
antiviral defense ("Cascade"). Sub-type I-A comprises a csa5 gene
which encodes a small subunit protein, a cas8 gene that encodes
degraded large and small subunits, and a split cas3 gene.
Archaeoglobus fulgidus is an exemplary organism with a sub-type I-A
CRISPR-Cas system. Sub-type I-B has a set
cas1-cas2-cas3-cas4-cas5-cas6-cas7-cas8 gene arrangement while
lacking a csa5 gene. Clostridium kluyveri is an exemplary organism
with a sub-type I-B CRISPR-Cas system. Sub-type I-C lacks a cash
gene. Bacillus halodurans is an exemplary organism with a sub-type
I-C CRISPR-Cas system. Sub-type I-D has a cas10d gene instead of a
cas8 gene. Cyanothece spp. is an exemplary organism with a sub-type
I-D CRISPR-Cas system. Sub-type I-E lacks a cas4 gene. Escherichia
coli is an exemplary organism with a sub-type I-E CRISPR-Cas
system. Sub-type I-F lacks a cas4 gene and has a cas2 fused to a
cas3. Yersinia pseudotuberculosis is an exemplary organism with a
sub-type I-F CRISPR-Cas system. Geobacter sulfurreducens is an
exemplary organism with a sub-type I-U CRISPR-Cas system.
[0048] All type III CRISPR-Cas systems have a cas10 gene, which
encodes a multidomain protein containing a Palm domain, which is a
variant of the RNA recognition motif (RRM), that is homologous to
the core domain of numerous nucleic acid polymerases and cyclases
and that is the largest subunit of type III crRNA-effector
complexes. Type III loci encode the small subunit protein, one Cas5
protein and typically several Cas7 proteins. Type III are further
divided into four sub-types, (III-A, III-B, III-C, and III-D).
Sub-type III-A has a csm2 gene encoding a small subunit and also
has cas1, cas2 and cas6 genes. Staphylococcus epidermidis is an
exemplary organism with a sub-type III-A CRISPR-Cas system.
Sub-type III-B has a cmr5 gene encoding a small subunit, lacking
cas1, cas2 and cas6 genes. Pyrococcus furiosus is an exemplary
organism with a sub-type III-B CRISPR-Cas system. Sub-type III-C
has a Cas10 protein, but with an inactive cyclase-like domain,
further lacking a cast and cas2 gene. Methanothermobacter
thermautotrophicus is an exemplary organism with a sub-type III-C
CRISPR-Cas system. Sub-type III-D has a Cas10 protein that lacks
the HD domain, further lacking a cas1 and cas2 gene, but having a
cas5-like gene known as csx10. Roseiflexus spp. is an exemplary
organism with a sub-type III-D CRISPR-Cas system.
[0049] Type IV CRISPR-Cas systems encode a minimal multisubunit
crRNA-effector complex comprising a partially degraded large
subunit, Csf1, Cas5, Cas7, and in some cases, a putative small
subunit. Type IV systems lack cast and cas2 genes. Type IV systems
do not have sub-types, however there are two Type IV system
variants. One Type IV variant has a DinG family helicase while the
other does not, but the other has a gene encoding a small
.alpha.-helical protein. Acidithiobacillus ferrooxidans is an
exemplary organism with a Type IV CRISPR-Cas system.
[0050] Type II CRISPR-Cas systems have cas1, cas2 and cas9 genes.
The cas9 gene encodes the Cas9 protein, a multidomain protein that
combines the functions of the crRNA-effector complex with target
DNA cleavage. Type II systems also encode a tracrRNA. Type II
systems are further divided into three sub-types, sub-types II-A,
II-B and II-C. Sub-type II-A comprises the additional gene, csn2.
Streptococcus thermophiles is an exemplary organism with a sub-type
II-A CRISPR-Cas system. Sub-type II-B lacks the csn2 gene, but has
the cas4 gene. Legionella pneumophilai is an exemplary organism
with a sub-type II-B CRISPR-Cas system. Sub-type II-C is the most
common Type II system has only three proteins, Cas1, Cas2 and Cas9.
Neisseria lactamica is an exemplary organism with a sub-type II-C
CRISPR-Cas system
[0051] Type V systems have a cpf1 gene and cas1 and cast genes. The
cpf1 gene encodes a protein, Cpf1, that has a RuvC-like nuclease
domain that is homologous to the respective domain of Cas9, but
lacks the HNH nuclease domain that is present in Cas9 proteins.
Type V systems have been identified in several bacteria, including
Parcubacteria bacterium GWC2011_GWC2_44_17 (PbCpf1),
Lachnospiraceae bacterium MC2017 (Lb3 Cpf1), Butyrivibrio
proteoclasticus (BpCpf1), Peregrinibacteria bacterium GW2011 GWA
33_10 (PeCpf1), Acidaminococcus spp. BV3L6 (AsCpf1), Porphyromonas
macacae (PmCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1),
Porphyromonas crevioricanis (PcCpf1), Prevotella disiens (PdCpf1),
Moraxella bovoculi 237(MbCpf1), Smithella spp. SC_KO8D17 (SsCpf1),
Leptospira inadai (L1Cpf1), Lachnospiraceae bacterium MA2020
(Lb2Cpf1), Franciscella novicida U112 (FnCpf1), Candidatus
methanoplasma termitum (CMtCpf1), and Eubacterium eligens (EeCpf1).
It has also been demonstrated that Cpf1 also has RNase activity and
it is responsible for pre-crRNA processing, as disclosed in
Fonfara, I et al., Nature 28; 532(7600):517-21 (2016), hereby
incorporated by reference in its entirety.
[0052] In Class 1 systems, the expression and interference stages
involve multisubunit CRISPR RNA (crRNA)-effector complexes. In
contrast, in Class 2 systems, the expression and interference
stages involve a single large protein, e.g., Cas9, Cpf1, C2c1,
C2c1, or C2c3, each of which is explicitly considered within the
scope of this invention.
[0053] In Class 1 systems, the expression and interference stages
involve multisubunit CRISPR RNA (crRNA)-effector complexes. In
contrast, in Class 2 systems, the expression and interference
stages involve a single large protein, e.g., Cas9, Cpf1, C2c1,
C2c1, or C2c3.
[0054] In Class 1 systems, pre-crRNA is bound to the multisubunit
crRNA-effector complex and processed into a mature crRNA. In Type I
and III systems this involves an RNA endonuclease, for example,
Cash. In Class 2 Type II systems, pre-crRNA is bound to Cas9 and
processed into a mature crRNA in a step that involves RNase III and
a tracrRNA. However, in at least one described Type II CRISPR-Cas
system, crRNAs with mature 5'-ends are directly transcribed from
internal promoters where crRNA processing does not occur.
[0055] In Class 1 systems, the crRNA is associated with the
crRNA-effector complex and achieves interference by combining
nuclease activity with RNA-binding domains and base pair formation
between the crRNA and a target nucleic acid.
[0056] In Type I systems, the crRNA and target binding of the
crRNA-effector complex involves Cas7, Cas5, and Cas8 fused to a
small subunit protein. The target nucleic acid cleavage of Type I
systems involves the HD nuclease domain, which is either fused to
the superfamily 2 helicase Cas3' or is encoded by a separate gene,
cas3.
[0057] In Type III systems, the crRNA and target binding of the
crRNA-effector complex involves Cas7, Cas5, Cas10 and a small
subunit protein. The target nucleic acid cleavage of Type III
systems involves the combined action of the Cas7 and Cas10
proteins, with a distinct HD nuclease domain fused to Cas10, which,
while not wishing to be bound by theory, is thought to cleave
single-strand DNA during interference.
[0058] In Class 2 systems, the crRNA is associated with a single
protein and achieves interference by combining nuclease activity
with RNA-binding domains and base pair formation between the crRNA
and a target nucleic acid.
[0059] In Type II systems, the crRNA and target binding involves
Cas9 as does the target nucleic acid cleavage. In Type II systems,
the RuvC-like nuclease (RNase H fold) domain and the HNH
(McrA-like) nuclease domain of Cas9 each cleave one of the strands
of the target nucleic acid. The Cas9 cleavage activity of Type II
systems also requires hybridization of crRNA to tracrRNA to form a
duplex that facilitates the crRNA and target binding by the
Cas9.
[0060] In Type V systems, the crRNA and target binding involves
Cpf1 as does the target nucleic acid cleavage. In Type V systems,
the RuvC-like nuclease domain of Cpf1 cleaves one strand of the
target nucleic acid and a putative nuclease domain cleaves the
other strand of the target nucleic acid in a staggered
configuration, producing 5' overhangs, which is in contrast to the
blunt ends generated by Cas9 cleavage. While not wishing to be
bound by theory, these 5' overhangs may facilitate insertion of DNA
through non-homologous end-joining methods.
[0061] As discussed herein, the Cpf1 cleavage activity of Type V
systems also does not require hybridization of crRNA to tracrRNA to
form a duplex, rather the crRNA of Type V systems use a single
crRNA that has a stem loop structure forming an internal duplex.
Cpf1 binds the crRNA in a sequence and structure specific manner,
that recognizes the stem loop and sequences adjacent to the stem
loop, most notably, the nucleotide 5' of the spacer sequences that
hybridizes to the target nucleic acid. This stem loop structure is
typically in the range of 15 to 19 nucleotides in length.
Substitutions that disrupt this stem loop duplex abolish cleavage
activity, whereas other substitutions that do not disrupt the stem
loop duplex do not abolish cleavage activity. In Type V systems,
the crRNA forms a stem loop structure at the 5' end and the
sequence at the 3' end is complementary to a sequence in a target
nucleic acid.
[0062] Other proteins associated with Type V crRNA and target
binding and cleavage include Class 2 candidate 1 (C2c1) and Class 2
candidate 3 (C2c3). C2c1 and C2c3 proteins are similar in length to
Cas9 and Cpf1 proteins, ranging from approximately 1,100 amino
acids to approximately 1,500 amino acids. C2c1 and C2c3 proteins
also contain RuvC-like nuclease domains and have an architecture
similar to Cpf1. C2c1 proteins are similar to Cas9 proteins in
requiring a crRNA and a tracrRNA for target binding and cleavage,
but have an optimal cleavage temperature of 50.degree. C. C2c1
proteins target an AT-rich PAM, which similar to Cpf1, is 5' of the
target sequence. In contrast, Class 2 candidate 2 (C2c2) does not
share sequence similarity to other CRISPR effector proteins, and
was recently identified as a Type VI system. C2c2 proteins have two
HEPN domains and demonstrate ssRNA-cleavage activity. C2c2 proteins
are similar to Cpf1 proteins in requiring a crRNA for target
binding and cleavage, while not requiring tracrRNA. Also like Cpf1,
the crRNA for C2c2 proteins forms a stable hairpin, or stem loop
structure, that aid in association with the C2c2 protein.
[0063] Specifically regarding Class 2 Type II CRISPR Cas systems, a
large number of Cas9 orthologs are known in the art as well as
their associated polynucleotide components (tracrRNA and crRNA)
(see, e.g., Fonfara, I., et al., Nucleic Acids Research 42.4
(2014): 2577-2590, and Chylinski K., et al., Nucleic Acids
Research, 2014; 42(10):6091-6105, both references hereby
incorporated by reference in their entireties. Cas9-like synthetic
proteins are known in the art (see, e.g., U.S. 2014/0315985 and
U.S. 2016/0362667, both references hereby incorporated by reference
in their entireties). Aspects of the present disclosure can be
practiced by one of ordinary skill in the art following the
guidance of the specification to use Type II CRISPR Cas proteins
and Cas-protein encoding polynucleotides, including, but not
limited to Cas9, Cas9-like, proteins encoded by Cas9 orthologs,
Cas9-like synthetic proteins, and variants and modifications
thereof. Cognate RNA components of these Cas proteins can be
manipulated and modified for use in the practice of the present
disclosure.
[0064] In CRISPR-Cas related embodiments, the target sequence
comprises a gRNA sequence. The target sequence may also further
comprise transactivating crRNA (tracrRNA), and may comprise other
elements. Furthermore, in such CRISPR-related embodiments, the
viral genome and antigenome contains a second region that includes
a sequence encoding a nuclease, e.g. Cas9. The second region may or
may not contain a sequence encoding a reporter molecule or any
other additional sequences. As detailed supra, the second region,
like the first region, may be subcloned practically anywhere in the
viral genome. However, in the case of paramyxoviruses, e.g. the
Sendai virus, one of ordinary skill in the art will take into
consideration the relative rates of transcription. FIG. 1
represents an exemplary genome for this embodiment. In such
embodiments, once the portion of the viral genome encoding the gRNA
and one or more ribozymes is transcribed into mRNA containing the
gRNA, the gRNA is liberated by the ribozyme(s). At least a 5'
ribozyme must be present, but in preferred embodiments (though not
necessarily), a flanking 3' ribozyme is present too. The type of
the ribozymes utilized (hammerhead, HDV, etc.) can be according to
any of the embodiments discussed herein. Once the gRNA is
liberated, and after the mRNA sequence encoding the nuclease is
translated, the gRNA binds to the nuclease, e.g. Cas9, through the
scaffold sequence. The nuclease undergoes a conformational change
once bound to the gRNA through the scaffold sequence which shifts
the nuclease from an inactive conformation to an active DNA-binding
conformation. Importantly, the targeting sequence of the gRNA
remains exposed so that it may interact with the DNA binding site.
The gRNA then directs the bound complex to the target DNA sequence,
immediately upstream of the PAM, to which the nuclease will cleave.
Alterations to the DNA sequence may then be introduced.
[0065] One of ordinary skill in the art will be generally familiar
with how to introduce an alternation to target DNA after a
double-stranded break has been introduced, however for exemplary
purposes, the most common pathways utilized are the non-homologous
end joining (NHEJ) DNA repair pathway and the homology directed
repair (HDR) pathway. These pathways allow for introduction of
alterations, most commonly insertions or deletions ("indels") but
these alterations may include deletions, additions, substitutions,
frameshift mutations, or point insertions. One potential advantage
of the NHEJ pathway over the HDR pathway is that, unlike HDR, the
NHEJ pathway is active throughout the cell cycle and has a higher
capacity for repair, as there is no requirement for a repair
template. Furthermore, NHEJ also repairs most types of breaks
within minutes, which is significantly faster than HDR. However,
HDR is the more accurate mechanisms of the two due to the
requirement of higher sequence homology between the damaged and
intact donor strands of DNA. HDR can be error-free if the DNA
template used for repair is identical to the original DNA sequence
at the location of the break. Thus, HDR can introduce very specific
mutations into the damaged DNA. The HDR pathway generally follows
the following steps. First, the 5'-ended DNA strand is resected at
the break to create a 3' overhang. This serves as a substrate for
proteins required for strand invasion and a further as a primer for
DNA repair synthesis. The invasive strand then displaces a strand
of the homologous DNA duplex and pair with another. This results in
the formation of hybrid DNA referred to as the displacement loop (D
loop). The recombination intermediates are then resolved to
complete the DNA repair process. In contrast, the NHEJ pathway
generally follows the following steps. First, after a
double-stranded break has been introduced, the broken ends are
recognized by a heterodimer, e.g. a Ku70/Ku80 heterodimer. The
heterodimer will act as a scaffold for recruitment of a kinase,
e.g. DNA-PKcs and a ligase, as well as some accessory factors, e.g.
PAXX, XLF. This forms a paired end complex, which then ligates the
compatible DNA ends together. NHEJ utilizes a number of
polymerases, e.g. Pol.mu. and Polk, nucleases as well as structure
specific enzymes, e.g. Tdp2 and Aprataxin. The processing of DNA
ends is where mutations are introduced in the NHEJ pathway.
[0066] Another aspect of the present disclosure relates to vectors,
aside from the viral particles of the present disclosure that
comprise the nucleic acids of the present disclosure. The vectors
may be DNA or RNA vectors. In an exemplary embodiment, the vectors
comprise plasmids that contain DNA encoding both the genome and the
antigenome. The plasmids may be induced to generate the viral
particles. The vector may include appropriate sequences for
amplifying expression. In addition, the expression vector
preferably contains one or more selectable marker genes to provide
a phenotypic trait for selection of transformed host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic cell
cultures, or such as tetracycline or ampicillin resistance in E.
coli.
[0067] Some embodiments of the present disclosure are directed to
cells transformed with the plasmids. Any of the procedures known in
the art for introducing foreign nucleotide sequences into host
cells may be used. Examples include the use of calcium phosphate
transfection, polybrene, protoplast fusion, electroporation,
nucleofection, liposomes, microinjection, naked DNA, plasmid
vectors, viral vectors, both episomal and integrative, and any of
the other well-known methods for introducing cloned genomic DNA,
cDNA, synthetic DNA or other foreign genetic material into a host
cell.
[0068] Another aspect of the present disclosure relates to kits
comprising the vectors of the present disclosure. The kits may
further include reagents. In an exemplary embodiment, the reagents
include T7 RNA polymerase. The kits may contain controls. The kits
may contain instructions or directions for use. The kit may be
comprised of one or more containers and may also include collection
equipment, for example, bottles, bags (such as intravenous fluids
bags), vials, syringes, and test tubes. Other components may
include needles, diluents and buffers. Usefully, the kit may
include at least one container comprising a
pharmaceutically-acceptable buffer, such as phosphate-buffered
saline, Ringer's solution and dextrose solution. Optionally, the
kits of the disclosure further include software to expedite the
generation, analysis and/or storage of data, and to facilitate
access to databases. The software includes logical instructions,
instructions sets, or suitable computer programs that can be used
in the collection, storage and/or analysis of the data. Comparative
and relational analysis of the data is possible using the software
provided.
[0069] The terms "conservative sequence modifications" or
"conservative substitutions" as used herein may refer to nucleotide
substitutions that do not significantly affect or alter the
activity or characteristics of the self-cleaving ribozymes of the
present disclosure.
[0070] The term "CRISPR" as used herein may refer to "clustered
regularly interspaced short palindromic repeat", which in the scope
of the present disclosure is understood to be utilized in
conjunction with a nuclease such as Cas9 to edit a target DNA
sequence, e.g. CRISPR/Cas9 system. The term "Cas" as used herein
may refer to "CRISPR associated protein", and includes but is not
limited to the nuclease Cas9 and Cas9 proteins. "Cas9" or "Cas9
protein" as used herein includes Cas9 wild-type protein derived
from CRISPR-Cas9 systems, modifications of Cas9 proteins, analogs
of Cas9 proteins, variants of Cas9 proteins, proteins expressed by
cas9 orthologs, and combinations thereof. Other "Cas" proteins are
known in the art and are considered to be within the scope of this
disclosure, including Cas9-like synthetic proteins, Cpf1 proteins
(including wild-type Cpf1), Cpf1-like synthetic proteins, C2c1
proteins, C2c2 proteins, C2c3 proteins, and variants and
modifications thereof "Cpf1" or "Cpf1 proteins" as used herein
includes Cpf1 wild-type protein derived from CRISPR-Cpf1 systems,
modifications of Cpf1 proteins, variants of Cpf1 proteins, Cpf1
analogs, proteins expressed by cpf1 orthologs, and combinations
thereof.
[0071] As used herein, the term "guide RNA" or "gRNA" may refer to
an RNA molecule that can bind to a nuclease and guide the nuclease
to a specific location within a target DNA. A guide RNA can
comprise two segments: a "targeting sequence" and a "scaffold
sequence". "Targeting sequence" as used herein may refer to a
nucleotide sequence that is complementary to, or at least can
hybridize to under stringent conditions, a target DNA sequence. The
protein-binding segment binds to nuclease, e.g. Cas9, Cpf1, or a
related CRISPR associated protein ("Cas") disclosed herein. The
targeting sequence and the scaffold sequence can be located in the
same RNA molecule or in two or more separate RNA molecules.
[0072] The term "heterologous" as used herein may refer to
biological elements that are from different sources, e.g. foreign
DNA or RNA introduced into an organism. For example, in the present
disclosure, a nuclease may be from a first source, e.g. Cas9 from
S. pyogenes bacterium. Or, a target sequence, e.g., gRNA may be
from a second organism or may be synthetic. One of ordinary skill
in the art will appreciate that introduction of foreign genetic
material into an organism, e.g. introduction of an expression
cassette, may introduce many heterologous elements to the
organism.
[0073] The term "homology" as used herein may refer to the
existence of shared structure between two compositions. The term
"homology" in the context of proteins may refer to the amount (e.g.
expressed in a percentage) of overlap between two or more amino
acid and/or peptide sequences. In the context of nucleic acids, the
term may refer to the amount (e.g. expressed in a percentage) of
overlap between two or more nucleic acid sequences. As used herein,
the percent (%) homology between two sequences is equivalent to the
percent identity between the two sequences. The percent identity
between the two sequences is a function of the number of identical
positions shared by the sequences (i.e., % homology=# of identical
positions/total # of positions.times.100), taking into account the
number of gaps, and the length of each gap, which need to be
introduced for optimal alignment of the two sequences. The
comparison of sequences and determination of percent identity
between two sequences can be accomplished using a mathematical
algorithm. Such homology is well-represented in the art via local
alignment tools and/or algorithms, and may include pairwise
alignment, multiple sequence alignment methods, structural
alignment methods, and/or phylogenetic analysis methods.
[0074] As used herein, the term "expression" refers to
transcription of a polynucleotide from a DNA template, resulting
in, for example, an mRNA or other RNA transcript (e.g., non-coding,
such as structural or scaffolding RNAs). The term further refers to
the process through which transcribed mRNA is translated into
peptides, polypeptides, or proteins. Transcripts and encoded
polypeptides may be referred to collectively as "gene products."
Expression may include splicing the mRNA in a eukaryotic cell, if
the polynucleotide is derived from genomic DNA.
[0075] The terms "polynucleotide", "nucleotide sequence" or
"nucleic acid" as used herein may refer to a polymer composed of a
multiplicity of nucleotide units (ribonucleotide or
deoxyribonucleotide or related structural variants) linked via
phosphodiester bonds, including but not limited to, DNA or RNA. The
term encompasses sequences that include any of the known base
analogs of DNA and RNA. Examples of a nucleic acid include and are
not limited to mRNA, miRNA, tRNA, rRNA, snRNA, siRNA, dsRNA, cDNA
and DNA/RNA hybrids. Nucleic acids may be single stranded or double
stranded, or may contain portions of both double stranded and
single stranded sequence. The nucleic acid may be DNA, both genomic
and cDNA, RNA, or a hybrid, where the nucleic acid may contain
combinations of deoxyribo- and ribo-nucleotides, and combinations
of bases including uracil (U), adenine (A), thymine (T), cytosine
(C), guanine (G), and their derivative compounds. Nucleic acids may
be obtained by chemical synthesis methods or by recombinant
methods. The depiction of a single strand also defines the sequence
of the complementary strand. Thus, a nucleic acid also encompasses
the complementary strand of a depicted single strand. Many variants
of a nucleic acid may be used for the same purpose as a given
nucleic acid. Thus, a nucleic acid also encompasses substantially
identical nucleic acids and complements thereof.
[0076] The term "ribozyme" as used herein refers to RNA molecules
that are capable of catalyzing specific biochemical reactions. The
activity of a ribozyme is similar to that of a protein enzyme, the
chief difference being the composition of the two. The term
"self-cleaving ribozyme" as used herein refers to a RNA molecule
motif that catalyzes cleavage and related reactions at a specific
site within an RNA polymer. Examples of self-cleaving ribozymes
include but are not limited to hammerhead ribozymes, hepatitis
delta virus (HDV) ribozymes, twister ribozymes, twister sister
ribozymes, pistol ribozymes, hairpin irobzymes, and hatchet
ribozymes.
[0077] The term "treating" or "treatment" of a disease refers to
executing a protocol, which may include administering one or more
drugs to a patient (human or otherwise), in an effort to alleviate
signs or symptoms of the disease. Alleviation can occur prior to
signs or symptoms of the disease appearing as well as after their
appearance. Thus, "treating" or "treatment" includes "preventing"
or "prevention" of disease. The terms "prevent" or "preventing"
refer to prophylactic and/or preventative measures, wherein the
object is to prevent or slow down the targeted pathologic condition
or disorder. In addition, "treating" or "treatment" does not
require complete alleviation of signs or symptoms, does not require
a cure, and specifically includes protocols that have only a
marginal effect on the patient.
[0078] As used herein, a "host cell" generally refers to a
biological cell. A cell can be the basic structural, functional
and/or biological unit of a living organism. A cell can originate
from any organism having one or more cells. Examples of host cells
include, but are not limited to: a prokaryotic cell, a eukaryotic
cell, a bacterial cell, an archaeal cell, a cell of a single-cell
eukaryotic organism, a protozoa cell, a cell from a plant, an algal
cell, a fungal cell (e.g., a yeast cell), an animal cell, a cell
from an invertebrate animal, a cell from a vertebrate animal (e.g.,
fish, amphibian, reptile, bird, mammal), a cell from a mammal
(e.g., a pig, a cow, a goat, a sheep, a rodent, a rat, a mouse, a
non-human primate, a human, etc.). A host cell can be a stem cell
or progenitor cell.
[0079] The term "patient" as used herein may refer to a biological
system to which a treatment can be administered. A biological
system can include, for example, an individual cell, a set of cells
(e.g., a cell culture), an organ, a tissue, or a multi-cellular
organism. A "patient" can refer to a human patient or a non-human
patient.
[0080] The term "protospacer adjacent motif" or "PAM" as used
herein refers to the DNA sequence immediately following the target
DNA sequence that is targeted by the nuclease in a CRISPR
application setting. The PAM is nuclease specific, and the nuclease
will not successfully bind to or cleave the target DNA sequence if
it is not followed by the PAM. The term "vector" as used herein may
refer to a nucleic acid sequence containing an origin of
replication. A vector may be a plasmid, bacteriophage, bacterial
artificial chromosome, yeast artificial chromosome or a virus. A
vector may be a DNA or RNA vector. A vector may be either a
self-replicating extrachromosomal vector or a vector which
integrates into a host genome. The term "expression vector" refers
to a nucleic acid assembly containing a promoter which is capable
of directing the expression of a sequence or gene of interest in a
cell. Vectors typically contain nucleic acid sequences encoding
selectable markers for selection of cells that have been
transfected by the vector. Generally, "vector construct,"
"expression vector," and "gene transfer vector," refer to any
nucleic acid construct capable of directing the expression of a
gene of interest and which can transfer gene sequences to target
cells or host cells.
[0081] As used herein and in the appended claims, the singular
forms "a", "and" and "the" include plural references unless the
context clearly dictates otherwise.
[0082] The term "about" refers to a range of values which would not
be considered by a person of ordinary skill in the art as
substantially different from the baseline values. For example, the
term "about" may refer to a value that is within 20%, 15%, 10%, 9%,
8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the
stated value, as well as values intervening such stated values.
[0083] Publications disclosed herein are provided solely for their
disclosure prior to the filing date of the present disclosure.
[0084] Each of the applications and patents cited in this text, as
well as each document or reference, patent or non-patent
literature, cited in each of the applications and patents
(including during the prosecution of each issued patent;
"application cited documents"), and each of the PCT and foreign
applications or patents corresponding to and/or claiming priority
from any of these applications and patents, and each of the
documents cited or referenced in each of the application cited
documents, are hereby expressly incorporated herein by reference in
their entirety. More generally, documents or references are cited
in this text, either in a Reference List before the claims; or in
the text itself; and, each of these documents or references
("herein-cited references"), as well as each document or reference
cited in each of the herein-cited references (including any
manufacturer's specifications, instructions, etc.), is hereby
expressly incorporated herein by reference.
[0085] The following non-limiting examples serve to further
illustrate the present disclosure.
EXAMPLES
Example 1: Sendai Virus Delivers CRISPR/Cas9 for Gene Editing
A. Materials and Methods
[0086] Cell Lines
[0087] Flp-In T-REx HEK293 cells (Invitrogen), Vero cells (ATCC
CCL-81), BSR-T7 cells (BHK-based cell line with stable expression
of T7 polymerase), and Affinofile cells (HEK293-based cell line
with inducible overexpression of CD4 and CCR5) were propagated in
Dulbecco's modified Eagle's medium (Invitrogen) supplemented with
10% fetal bovine serum (FBS) (Atlanta Biologicals) and
penicillin/streptomycin at 37.degree. C. Flp-In T-REx HEK293 cells
were additionally maintained in blasticidin and zeocin according to
manufacturer protocol, BSR-T7 cells were additionally maintained in
1 mg/mL G418 to maintain the T7 transgene, and Affinofile cells
were additionally maintained in 50 .mu.g/mL blasticidin. To
generate the mCherry-inducible cells, the mCherry gene was inserted
into pcDNA5/FRT/TO and co-transfected with pOG44 (Flp-recombinase)
into parental Flp-In T-REx HEK293 cells. Selection with hygromycin
(replacing zeocin) and blasticidin according to manufacturer
protocol yielded a stable cell line with doxycycline-inducible
expression of mCherry.
[0088] Whole human blood was obtained from the New York Blood
Center. Peripheral blood mononuclear cells were isolated using
Ficoll-Paque (GE Healthcare), and monocytes were further purified
using CD14 MicroBeads (Miltenyi Biotec). Monocytes were propagated
in RPMI 1640 medium (Invitrogen) supplemented with 10% FBS (Atlanta
Biologicals).
[0089] Sendai Virus Reverse Genetics Plasmids
[0090] The basis for rSeV-Cas9 was a recombinant Sendai virus with
an EGFP reporter inserted between the N and P genes via duplication
of the N-to-P intergenic region, derived from RGV0, a Fushimi
strain SeV with mutations in the F and M genes that allow
trypsin-independent growth. All modifications to the plasmid
encoding the T7-driven antigenome were performed using standard and
overlapping PCRs with Velocity DNA polymerase (Bioline), with
subsequent insertion into the construct at unique restriction sites
by In-Fusion ligation-independent cloning (Clontech). All cloning
was performed with Stb12 E. coli (Invitrogen) with growth at
30.degree. C. FLAG-tagged codon-optimized S. pyogenes Cas9 was
amplified from px330 (Addgene, cat #42230) and inserted into rSeV
following the EGFP reporter, linked with a P2A ribosomal skipping
sequence (ATNFSLLKQAGDVEENPGP) (SEQ ID NO: 4). The P2A sequence was
preceded by a GSG linker to ensure complete ribosomal skipping. An
additional two nucleotides were added after the stop codon of Cas9
to maintain the rule of six, by which the genome length of
paramyxoviruses must be an exact multiple of six to ensure
efficient replication. The Cas9 is flanked by unique NotI and FseI
restriction sites to aid in any future modifications. To create the
guide RNA and ribozyme cassette, the mCherry-targeting 20 bp
sequence was cloned into px330 (discussed supra), and the full
chimeric guide RNA cassette (SEQ ID NO: 1, see Table 1 below) was
then PCR-amplified. The hammerhead ribozymes were incorporated via
overhangs in the synthesized primers in subsequent PCRs. This
cassette was inserted between the P and M genes via duplication of
the P-to-M intergenic region, with unique AsiSI and SnaBI
restriction sites flanking the cassette to aid in future
modifications including changing the guide RNA target sequence. The
guide RNA target sequences were chosen based on high predicted
specificity using a CRISPR design tool available online through
MIT.
TABLE-US-00001 (SEQ ID NO: 1, Guide RNA Cassette)
ATCCCGGGTGAGGCATCCCACCATCCTCAGTCACAGAGAGACCC
AATCTACCATCAGCATCAGCCAGTAAAGATTAAGAAAAACTTAG
GGTGAAAGAAATTTCACCTAACACGGCGCAGCGATCGCGTGGCC
CTGATGAGTCCGTGAGGACGAAACGGTAGGAATTCCTACCGTCG
GCCACGAGTTCGAGATCGAGTTTTAGAGCTAGAAATAGCAAGTT
AAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAG
TCGGTGCACGTATCACCGGAGTCGACTCCGGTCTGATGAGTCCG
TGAGGACGAAATACGTATCCCGGGTGAGGCATCCCACCATCCTC
AGTCACAGAGAGACCCAATCTACCATCAGCATCAGCCAGTAAAG
ATTAAGAAAAACTTAGGGTGAAAGAAATTTCACCTAACACGGCG CA
TABLE-US-00002 TABLE 1 Annotated sequence of gRNA Cassette.
Nucleotide Positions Within Guide RNA Cassette (SEQ ID NO: 1)
Description 1-118, 325-442 P-to-M intergenic region; guide RNA
cassette inserted via duplication of this region in this instance
73-83, 397-407 Gene stop signal 84-86, 408-410 Intergenic
trinucleotide 87-96, 411-420 Gene start signal 119-126 Restriction
site, e.g. modified AsiSI restriction site in this instance
127-132, 176-181 Stem for 5' ribozyme (e.g. rbz 1). Note: 1.sup.st
part of stem, e.g. GTGGCC in this instance, must be the reverse
complement of the beginning of the gRNA targeting sequence. See,
e.g., FIG. 1B for stem structure. 133-175 5' ribozyme (e.g. rbz 1)
176-195 Guide RNA (gRNA), e.g. mCherry-targeting sequence in this
instance 196-271 TracrRNA 272-277, 319-324 Stem for 3' ribozyme
(e.g. rbz 2) 278-318 3' ribozyme (e.g. rbz 2) 320-325 Restriction
site, e.g. modified SnaBI restriction site in this instance 135
Mutated to C to abolish 5' ribozyme activity 299 Mutated to C to
abolish 3' ribozyme activity
[0091] Cleavage Assay
[0092] qRT-PCR primers were designed to flank ribozyme 1 (product
A), ribozyme 2 (product B), and within the downstream M gene
(product C, representing total RNA) (see FIG. 7). rSeV-Cas9-mCherry
T7-driven antigenome plasmid was transfected into T7-expressing
BSR-T7 cells for 2 hours before collection in TRIzol (Invitrogen).
Samples were treated with DNase (Invitrogen) at 1 mM MgCl.sub.2,
treated with EDTA, and reverse-transcribed at 1 mM MgCl.sub.2 with
the SuperScript III First-Strand Synthesis System (Invitrogen).
qRT-PCR was performed with the SensiFAST SYBR & Fluorescein kit
(Bioline), with copy numbers determined by standard curves using
the rSeV-Cas9-mCherry antigenome plasmid as template. Percent
ribozyme 1 cleavage was determined as 100*((C-A)/C) and normalized
to the construct with both ribozymes mutated, and percent ribozyme
2 cleavage was determined as 100*((C-B)/C) and normalized to the
construct with ribozyme 2 mutated.
[0093] Viruses and Infections
[0094] BSR-T7 cells in 6-well were transfected with 4 ug T7-driven
antigenome, 1.44 .mu.g T7-N, 0.77 .mu.g T7-P, 0.07 .mu.g T7-L, and
4 .mu.g codon-optimized T7 polymerase, using Lipofectamine LTX
(Invitrogen) according to manufacturer's recommendations. Virus
rescue was monitored by appearance and spread of EGFP fluorescence,
and rescued virus was further expanded on BSR-T7 cells. Stocks of
clarified virus were stored at -80.degree. C. Virus titers were
determined by titration on Vero cells, with individual infection
events detected and counted by EGFP fluorescence at 24 hours
post-infection in an Acumen plate reader (TTP Labtech).
[0095] For SeV infection of HEK293-based cell lines,
5.times.10.sup.4 cells were mixed with the virus inoculum
immediately prior to plating in poly-L-lysine-coated wells. Media
was changed the following day and every 2 days thereafter. For
induction of mCherry, 100 ng/mL doxycycline was used. For
Affinofile cells, 2 .mu.g/mL ponasterone A and 8 ng/mL doxycycline
were used to induce CCR5 and CD4, respectively. For further HIV-1
infection of Affinofile cells, JR-FL HIV-1 was spinoculated onto
cells at 2000 rpm for 2 hours at 37.degree. C. in the presence of 2
.mu.g/mL polybrene (Sigma).
[0096] For SeV infection of monocytes, virus stocks were further
purified by ultracentrifugation into a discontinuous 20% to 65%
sucrose gradient. The interface was collected, titered on Vero
cells, and stored at -80.degree. C. until use. 5.times.10.sup.5
cells in serum-free medium were plated for 30 minutes at 37.degree.
C. to allow adherence before infection with virus inoculum via
spinoculation at 2000 rpm for 2 hours at 37.degree. C. Media was
changed to RPMI with 10% FBS following spinoculation and changed
every 2 days thereafter. 100 ng/mL GM-CSF (Peprotech) was included
in the media following infection to stimulate macrophage
differentiation and concomitant upregulation of CCR5.
[0097] Flow Cytometry
[0098] For CCR5 staining, cells were lifted and blocked in
phosphate-buffered saline (PBS) with 2% FBS. Alexa 647-conjugated
rat anti-human CCR5 (BioLegend, cat #313712) was added at 1:100 for
30 minutes at 4.degree. C. before washing and resuspension in 2%
paraformaldehyde (PFA). For p24 staining (RD1-conjugated mouse
anti-p24 clone KC57, Beckman Coulter, cat #6604667, 1:100
dilution), cells were fixed and permeabilized using the
Cytofix/Cytoperm kit (BD Biosciences) before blocking. Flow
cytometry was performed on a BD LSR II at the Flow Cytometry Core
at the Icahn School of Medicine at Mount Sinai.
[0099] Characterization of Mutagenesis
[0100] Genomic DNA was extracted using the PureLink Genomic DNA
Mini Kit (Invitrogen). Specific genomic loci were amplified using
Velocity DNA Polymerase (Bioline) and primers as shown in Table 2
below. Off-target loci represent the top predicted off-target sites
in the CRISPR Design Tool. For Sanger sequencing of individual
alleles, primers contained appropriate overhangs for insertion
between the HindIII and XhoI sites of pcDNA3 via In-Fusion
ligation-independent cloning (Clontech). PCR products were
gel-extracted (NucleoSpin Gel and PCR Clean-up kit, Clontech),
transformed into Stellar competent E. coli (Clontech), and selected
on ampicillin LB agar. Individual colonies were prepped and
sequenced. For deep sequencing, the gel-extracted products were
pooled and further prepared for sequencing via paired-end
2.times.300 bp MiSeq (IIlumina) sequencing by Genewiz, Inc. Unique
sequences were identified and quantified from merged sequenced
reads. For each on-target and off-target amplicon reference
sequence, 18 bp sequences were selected just beyond 35 bp upstream
and downstream from the 20 bp guide RNA target sequence. Unique
sequences with exact matches to both of these 18 bp sequences were
extracted and collated, with an average of 170,432 reads per
amplicon. For each amplicon, sequences with lengths divergent from
the reference sequence were identified as having insertions or
deletions (indels).
TABLE-US-00003 TABLE 2 On-target and off-target genomic locations,
sequences, and amplification primers utilized. Genomic Target + PAM
Sequence Location (underlined) Primer Sequences mCherry n/a
GGCCACGAGTTCGAGATCGAGGG Forward: GGCGAGGAGGATAACATGG (SEQ ID NO: 5)
(SEQ ID NO: 18) Reverse: CTTCAGCCTCTGCTTGATCTC (SEQ ID NO: 19) ccr5
on- chr3, +146373721 CAGGTTGGACCAAGCTATGCAGG Forward: target (SEQ
ID NO: 6) TTGTCATGGTCATCTGCTACTC (SEQ ID NO: 20) Reverse:
GTGTCACAAGCCCACAGATATT (SEQ ID NO: 21) ccr5 off #1 chrl,
-1179505884 CAGACTGGATCAAGCTATGCCAG Forward: (SEQ ID NO: 7)
CTCCACTTTCCATAACAGTCTAGG (SEQ ID NO: 22) Reverse:
GGTCCTTGGAACAGTAGAGATAG (SEQ ID NO: 23) ccr5 off #2 chr3,
-132755718 CAAGTTACAACAAGCTATGCAAG Forward: (SEQ ID NO: 8)
TGTTTGCTGTGAGGCTACTTTG (SEQ ID NO: 24) Reverse:
TCACTGTCCAATCTGCTTTACC (SEQ ID NO: 25) ccr5 off #3 chr20,
-117216675 AAGGTTTTTCCAAGCTATGCTAG Forward: (SEQ ID NO: 9)
GCAGAGGCATTATAAACCCAATATG (SEQ ID NO: 26) Reverse:
CCAGGAGGAACTGGCAAAT (SEQ ID NO: 27) ccr5 off #4 chr2, +1140172166
CAGGATTCACCAAGCTCTGCCAG Forward: (SEQ ID NO: 10)
AAGCTCCATCTTCTTCGTTCTT (SEQ ID NO: 28) Reverse:
AGTAGGAGATGGATTTACAGGTATT (SEQ ID NO: 29) ccr5 off #5 chr12,
+159746621 CAGTTTGGTTCAAGCTATGTTAG Forward: (SEQ ID NO: 11)
CAGTGACATGAGCACCTGAA (SEQ ID NO: 30) Reverse:
GCAAGGACATCCTCATCCATAA (SEQ ID NO: 31) efnb2 on- chr13, -1106512590
AGAATTCAGCCCTAACCTCTGGG Forward: target (SEQ ID NO: 12)
CCTGGACAAGGACTGGTACTAT (SEQ ID NO: 32) Reverse:
TAGCACAGGGTCCCAAATTC (SEQ ID NO: 33) efnb2 off chr7, -1136299453
AGAATTCAGGCTTAACCTCTTAG Forward: #1 (SEQ ID NO: 13)
GCAGGCTGGTAATTGATCTTTC (SEQ ID NO: 34) Reverse:
TGATCCACAGTTGGTTGAATCC (SEQ ID NO: 35) efnb2 off chr2, +136596395
AAAATTCTTCCCTAACCTCTAAG Forward: #2 (SEQ ID NO: 14)
CCAGAATGTGTCCTGGGTTTAG (SEQ ID NO: 36) Reverse:
GTGTCAGAGCGAGACTTTGT (SEQ ID NO: 37) efnb2 off chr7, +198992870
ACATTTCAGCTCTAACCTCTGGG Forward: #3 (SEQ ID NO: 15)
GGAGTATCTTCAGCTGTGAGAAG (SEQ ID NO: 38) Reverse:
CTGTTACACGTTCCTTGCTACT (SEQ ID NO: 39) efnb2 off chr14, +198564083
ATAAATCAGCCCTAACATCTGAG Forward: #4 (SEQ ID NO: 16)
CTGATTGAGTGGGTCATCAGAA (SEQ ID NO: 40) Reverse: GCTACGTGCTGGTGCTAAA
(SEQ ID NO: 41) efnb2 off chr3, -16909191 AAAAGTTTGCCCTAACCTCTCAG
Forward: #5 (SEQ ID NO: 17) GTCCAGGAAAGAAAGTTGCATAAG (SEQ ID NO:
42) Reverse: GCTGTCTGCTGGAAAGATAGT (SEQ ID NO: 43)
B. Results
[0101] Sendai Virus Incorporating Cas9 and a Guide RNA Flanked by
Self-Cleaving Ribozymes Replicates to High Titer
[0102] Paramyxoviruses have a single-stranded, negative-sense RNA
genome. During replication, the virus replication complex
(nucleoprotein (N), phosphoprotein (P), and large RNA-dependent RNA
polymerase (L)) uses the genome as a template for production of
both full length antigenome (the reverse complement of the genome)
and individual capped and polyadenylated mRNAs (FIG. 1A). The
antigenome is further transcribed into genome, thus amplifying the
genome for replication. During mRNA production, gene start and gene
stop signals within the flanking intergenic regions determine the
ends of the mRNA transcript. For this proof-of-principle study, a
recombinant SeV (rSeV) with EGFP inserted between the N and P genes
via duplication of the N-to-P intergenic region was utilized. S.
pyogenes Cas9 was inserted downstream of the EGFP reporter via a
P2A ribosomal skipping sequence (FIG. 1A). A chimeric guide RNA (20
bp target sequence and 76 bp trans-activating CRISPR RNA) was
inserted as a new cassette between the P and M genes via
duplication of the P-to-M intergenic region (FIG. 1A). The guide
RNA was flanked by a self-cleaving 5' ribozyme and a self-cleaving
3' ribozyme, e.g. hammerhead ribozymes, to provide precise ends to
the guide RNA (FIGS. 1A and 1B). The sequence of the exemplary
self-cleaving 5' ribozyme and the self-cleaving 3' ribozyme, are
shown in FIG. 1B in their conformational orientation, and in 5' to
3' as follows:
TABLE-US-00004 Rbz1: (SEQ ID NO: 2)
GUGGCCCUGAUGAGCGAAACGGUAGGAAUUCCUACCGUC Rbz2: (SEQ ID NO: 3)
CACCGGAGUCGACUCCGGUCUGAUGAGUCCGUGAGGACGAAAUACGU
[0103] The ribozymes were confirmed as functional for cleavage by
transfecting the DNA construct encoding the T7-driven rSeV-Cas9
positive-sense antigenome (the ribozymes are functional in the RNA
positive-sense orientation) into BSR-T7 cells (BHK cells stably
expressing T7 polymerase). qRT-PCR on T7-transcribed antigenomic
RNA extracted from transfected cells showed efficient self-cleavage
for both ribozymes (FIG. 1C). Replication-competent rSeV-Cas9 were
rescued by co-transfecting the antigenome construct with the
accessory SeV-N, --P, and -L expression constructs required for
genomic replication and thus virus rescue. Tescue efficiency and/or
genomic replication was hypothesize as potentially being impaired
or even blocked by the presence of self-cleaving ribozymes in the
antigenome. However, it was also hypothesized that nucleoprotein
encapsidation of the antigenomic RNA would happen quickly enough to
prevent formation of the ribozyme structure and thus self-cleavage
of the antigenome; by contrast, mRNAs are not encapsidated, and
thus the mRNA encoding the guide RNA would be free to undergo
ribozyme cleavage. Unexpectedly and surprisingly, rSeV-Cas9 rescued
as efficiently as a corresponding control virus with mutations in
the ribozymes to prevent ribozyme activity (FIG. 1D). Although the
growth kinetics of rSeV-Cas9 were slower than those of the control
virus, consistent with some negative effect of the ribozymes on
genomic replication, rSeV-Cas9 still reached the same peak titer of
almost 10.sup.8 IU/mL (FIG. 1E), consistent with standard peak
titers for SeV in cell culture. It was further confirmed that
rSeV-Cas9 produced the Cas9 protein upon infection. Western blot
analysis of HEK293 cells either transfected with a Cas9-expressing
plasmid or infected with rSeV-Cas9 showed the expression of Cas9
protein (FIG. 1F).
[0104] rSeV-Cas9 Targeting mCherry Gene Achieves Almost Complete
Mutagenesis of a Reporter Cell Line
[0105] The initial rSeV-Cas9 incorporated a guide RNA specific for
the mCherry gene (rSeV-Cas9-mCherry). A HEK293-based reporter cell
line was generated with inducible mCherry, and this cell line was
infected at a multiplicity of infection (MOI) of 25 with either
rSeV-Cas9-mCherry or a control virus expressing Cas9 but lacking
the guide RNA cassette (rSeV-Cas9-control). Induction of mCherry
expression at various days post-infection showed a progression of
knockout over time, with knockout appearing more pronounced
starting at 4 days post-infection (FIG. 2A and FIG. 5).
Quantification of this time point (induction at day 4 and
collection for flow cytometry at day 5) showed .about.80% knockout
of mCherry fluorescence (FIG. 2A). Fluorescence microscopy visually
confirmed the strong reduction of mCherry fluorescence upon
knockout (FIG. 2B).
[0106] The reporter cell line was utilized to confirm the
requirement for the ribozymes to preserve guide RNA function.
Mutation of the 3' ribozyme (rbz 2) strongly reduced reporter
knockout efficiency, while mutation of both the 5' and 3' ribozymes
(rbz 1/2) abrogated knockout activity (FIG. 2C, compare to FIG.
2A). An alternative 3' ribozyme was tested, the widely-used
hepatitis delta virus ribozyme, in place of the existing hammerhead
ribozyme. This version of rSeV-Cas9-mCherry also efficiently
knocked out mCherry fluorescence, surprisingly with potentially
even greater efficiency (FIG. 2C).
[0107] To quantitatively assess the degree of mutagenesis induced
by rSeV-Cas9-mCherry, deep sequencing was performed on the mCherry
locus amplified from reporter cells collected at day 6
post-infection. 98% of alleles had indels, indicating nearly
complete mutagenesis of the reporter (FIG. 2D). These results
strongly indicated that the rSeV-Cas9 vector is highly efficient in
targeting endogenous alleles.
[0108] rSeV-Cas9 Efficiently Mutates Endogenous Ccr5 and Efnb2
[0109] As opposed to the single allele of mCherry in the reporter
cell line, there are two or more alleles of most endogenous genes
per cell. To test the ability of the Sendai virus vector to target
the more abundant endogenous alleles, rSeV-Cas9 viruses were
generated targeting coding exons of the human ccr5 and efnb2 genes.
A preliminary test of the ability of rSeV-Cas9-CCR5 was performed
to induce mutagenesis resulting in functional disruption of ccr5.
HEK293 cells were utilized since HEK293 cells express negligible
levels of CCR5, which contain inducible CD4 and CCR5 transgenes in
addition to their endogenous alleles. CD4 and CCR5 are cell surface
receptors required for infection by R5-tropic HIV-1, and Affinofile
cells have been used extensively to characterize CCR5-mediated HIV
entry. Affinofile cells were infected with rSeV-Cas9-CCR5, and at 2
days post-infection, CD4/CCR5 overexpression was induced, and the
cells were further infected with an R5-tropic HIV-1 isolate the
following day (FIG. 3A). At this early time point, cells infected
with rSeV-Cas9-CCR5 were expected to have lower levels of CCR5
relative to cells infected with rSeV-Cas9-control due to ongoing
mutagenesis of the inducible ccr5 transgene and endogenous ccr5
alleles. After an additional 2 days, flow cytometry revealed
efficient knockout of the induced CCR5, and p24 staining indicative
of HIV-1 infection at the earlier time point had a 43% reduction in
geometric mean fluorescence intensity compared to the
rSeV-Cas9-control infection (FIG. 3A).
[0110] To examine mutagenesis of endogenous alleles, HEK293 cells
were infected with the ccr5- and efnb2-targeting rSeV-Cas9 viruses
at a MOI of 25 and were collected at 6 days post-infection. The
on-target loci as well as the top five predicted off-target sites
were PCR amplified. HEK293 cells are known to generally have 3
copies of chromosome 3 (encoding ccr5) and 2-3 copies of chromosome
13 (encoding efnb2). Deep sequencing revealed high rates of
on-target mutagenesis (75% and 88% for ccr5 and efnb2,
respectively) (FIG. 3B), once again strongly suggesting that
rSeV-Cas9 is effective. Off-target mutagenesis was unremarkable for
this first-generation Cas9 without modifications to increase
specificity, ranging from no detectable increase to 0.05% above the
non-targeting control (FIG. 3B). These results confirmed that
Sendai virus delivery of CRISPR/Cas9 can efficiently target
endogenous genes.
[0111] Ccr5-Targeting rSeV-Cas9 Edits Primary Human Monocytes at
High Frequency
[0112] Primary human CD14+ monocytes were infected with rSev-Cas9,
which are normally resistant to lentiviral transduction, at a MOI
of 50. To better visualize reduction in CCR5 expression upon
mutagenesis, monocytes were also stimulated with GM-CSF to induce
macrophage differentiation with concomitant upregulation of CCR5.
Cells were collected at 5 days post-infection, and deep sequencing
revealed 88% on-target mutagenesis (FIG. 4A). Surprisingly, the two
single nucleotide deletions flanking the cleavage site together
comprised 78% of all detected indels (FIG. 4A and FIG. 6); by
contrast, in HEK293 cells the same deletions together comprised 9%
of detected indels, and no single mutation comprised more than 10%
of the total (FIG. 3B and FIG. 6). Infection of monocytes from an
independent donor showed a similar result, with the above deletions
comprising .about.50% of mutant alleles (19/38 mutations via Sanger
sequencing), indicating that this may represent a cell
type-specific phenomenon. When single specific mutations comprise
such a large proportion of the total indels, mismatch-based assays
such as the T7E1 endonuclease assay, which relies on highly
variable mutagenesis to detect mutations, may strongly
underestimate the degree of on-target mutagenesis. As with the
HEK293 cells, detected mutagenesis of predicted off-target loci in
the monocytes was negligible (FIG. 4A). Flow cytometry of infected
monocytes from an independent donor confirmed knockout of cell
surface CCR5 at the same time point (FIG. 4B).
Example 2: Temperature Sensitive Mutants of rSeV-Cas9 Vector
[0113] A temperature sensitive (ts) mutant of the rSev-Cas9 vector
described in Example 1 above was created. This mutant was made by
introducing several mutations into the P (D433A, R434A, K437A) and
L (L15581, N1197S, K1795E) genes of the recombinant Sendai virus
vector, referred to herein as the "PL mutant." The PL mutant
efficiently edits at permissive temperatures, for example,
temperatures up to and around 34.degree. C., but is eliminated upon
shifting to non-permissive temperatures, for example, temperatures
above 37.degree. C. and above. PL mutants of the Sendai virus have
been previously reported in literature, but not for purposes of
CRISPR-Cas gene editing. Generation of PL mutants can be found at,
for example, Ban H. et al. PNAS 2011 Aug. 23; 108(34): 14234-14239,
hereby incorporated by reference in its entirety. The PL mutant
generated in Ban H. et al. was a Z strain of Sendai virus, whereas
the present rSev-Cas9 vector used was a Fushimi F1R strain. A
schematic of the ts mutations adapted from Ban H. et al. in the
rSev-Cas9 vector (PL mutant) is illustrated in FIGS. 8A and 9A. The
temperature sensitive phenotype of the PL mutant is shown in FIG.
8B.
[0114] The PL mutant has been shown to be capable of infecting
human CD34+ hematopoietic stem cells (HSCs) from both human fetal
liver and peripheral blood mobilized CD34+ HSCs at 80-90%
efficiency. Furthermore, editing frequency in these HSCs at about
80%. For example, as shown in FIG. 9B, the PL mutants (ts
rSeV-Cas9-CCR5 vectors) successfully infected and transduced
purified human fetal liver CD34+ and peripheral blood mobilized
CD34+ HSCs. Time course of infection is shown in FIG. 9C. Sanger
sequencing data, from ts rSeV-Cas9-CCR5 infected CD34+ HSCs at 2
dpi. 19/24 clones (.about.80%), shown in FIG. 9D, showed indels at
the targeted CCR5 locus.
[0115] Infected CD34+ HSCs have been transplanted into
immunodeficient SCID-Hu mice (n=9 for each group). All except one
mice remained healthy at 10 weeks post-transplant. This illustrated
that the PL mutants did not revert in vivo to a pathogenic virus,
as wild type Sendai virus is highly pathogenic even in wild-type
immunocompetent mice, and likely would have killed the
immunodeficient SCID-Hu mice. Phenotyping of infected CD34+ HSCs
(FIG. 10) illustrated that the PL mutants can infect >90% of
CD34+/CD38-/CD45RA-/CD90+(Thy1+)/CD49f-high cells which are known
as long-term-HSC or SCID-re-populating cells, capable of
reconstituting SCID-Hu mice at a single cell level.
[0116] Additionally, the PL mutants generated were essentially
silent in inducing the IFN response compared to the non PL-mutants
(i.e. non-temperature sensitive rSeV-Cas9 vectors). This is a
highly surprising but important phenotype. Furthermore, the PL
mutants generated in Ban H. et al. did not mention the effect
(positive or negative) of the PL mutants on the interferon
response. There is additionally no present indication why the PL
mutant generated in this Example possesses an "IFN-silent"
phenotype, as Sendai virus infection is known to induce the
production of IFN. FIGS. 11A and 11B show the fold induction of 2
representative interferon stimulated genes (ISGs) in 293T cells
infected with either the rSeV-Cas9 vector of Example 1 or the
temperature sensitive PL mutant vector across a wide range of viral
inoculum, as measured by qRT-PCR. At high viral genome copies, the
PL mutant vector is markedly deficient in inducing ISGs compared to
the rSeV-Cas9 vector of Example 1. This remained true regardless of
the gRNA contained, either mCherry or CCR5.
Example 3: Additional Modifications to the rSeV-Cas9 Vectors
[0117] An additional deletion mutant of the rSeV-Cas9 vector
described in Example 1 was created, missing the Fusion protein
(i.e. .DELTA.F mutants). These are only capable of growing in an
F-complementing cell line. The temperature sensitive PL mutants of
Example 2 are generated to be .DELTA.F mutants. rSev-Cas9 vectors
that can deliver two gRNAs are generated and illustrated in FIG.
12.
[0118] The foregoing examples and description of the preferred
embodiments should be taken as illustrating, rather than as
limiting the present disclosure as defined by the claims. As will
be readily appreciated, numerous variations and combinations of the
features set forth above can be utilized without departing from the
present disclosure as set forth in the claims. Such variations are
not regarded as a departure from the scope of the disclosure, and
all such variations are intended to be included within the scope of
the following claims. All references cited herein are incorporated
by reference in their entireties.
Sequence CWU 1
1
751442DNAArtificialsynthetic 1atcccgggtg aggcatccca ccatcctcag
tcacagagag acccaatcta ccatcagcat 60cagccagtaa agattaagaa aaacttaggg
tgaaagaaat ttcacctaac acggcgcagc 120gatcgcgtgg ccctgatgag
tccgtgagga cgaaacggta ggaattccta ccgtcggcca 180cgagttcgag
atcgagtttt agagctagaa atagcaagtt aaaataaggc tagtccgtta
240tcaacttgaa aaagtggcac cgagtcggtg cacgtatcac cggagtcgac
tccggtctga 300tgagtccgtg aggacgaaat acgtatcccg ggtgaggcat
cccaccatcc tcagtcacag 360agagacccaa tctaccatca gcatcagcca
gtaaagatta agaaaaactt agggtgaaag 420aaatttcacc taacacggcg ca
442239RNAArtificialsynthetic 2guggcccuga ugagcgaaac gguaggaauu
ccuaccguc 39347RNAArtificialsynthetic 3caccggaguc gacuccgguc
ugaugagucc gugaggacga aauacgu 47419PRTArtificialsynthetic 4Ala Thr
Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn1 5 10 15Pro
Gly Pro523DNAArtificialsynthetic 5ggccacgagt tcgagatcga ggg
23623DNAArtificialsynthetic 6caggttggac caagctatgc agg
23723DNAArtificialsynthetic 7cagactggat caagctatgc cag
23823DNAArtificialsynthetic 8caagttacaa caagctatgc aag
23923DNAArtificialsynthetic 9aaggtttttc caagctatgc tag
231023DNAArtificialsynthetic 10caggattcac caagctctgc cag
231123DNAArtificialsynthetic 11cagtttggtt caagctatgt tag
231223DNAArtificialsynthetic 12agaattcagc cctaacctct ggg
231323DNAArtificialsynthetic 13agaattcagg cttaacctct tag
231423DNAArtificialsynthetic 14aaaattcttc cctaacctct aag
231523DNAArtificialsynthetic 15acatttcagc tctaacctct ggg
231623DNAArtificialsynthetic 16ataaatcagc cctaacatct gag
231723DNAArtificialsynthetic 17aaaagtttgc cctaacctct cag
231819DNAArtificialsynthetic 18ggcgaggagg ataacatgg
191921DNAArtificialsynthetic 19cttcagcctc tgcttgatct c
212022DNAArtificialsynthetic 20ttgtcatggt catctgctac tc
222122DNAArtificialsynthetic 21gtgtcacaag cccacagata tt
222224DNAArtificialsynthetic 22ctccactttc cataacagtc tagg
242323DNAArtificialsynthetic 23ggtccttgga acagtagaga tag
232422DNAArtificialsynthetic 24tgtttgctgt gaggctactt tg
222522DNAArtificialsynthetic 25tcactgtcca atctgcttta cc
222625DNAArtificialsynthetic 26gcagaggcat tataaaccca atatg
252719DNAArtificialsynthetic 27ccaggaggaa ctggcaaat
192822DNAArtificialsynthetic 28aagctccatc ttcttcgttc tt
222925DNAArtificialsynthetic 29agtaggagat ggatttacag gtatt
253020DNAArtificialsynthetic 30cagtgacatg agcacctgaa
203122DNAArtificialsynthetic 31gcaaggacat cctcatccat aa
223222DNAArtificialsynthetic 32cctggacaag gactggtact at
223320DNAArtificialsynthetic 33tagcacaggg tcccaaattc
203422DNAArtificialsynthetic 34gcaggctggt aattgatctt tc
223522DNAArtificialsynthetic 35tgatccacag ttggttgaat cc
223622DNAArtificialsynthetic 36ccagaatgtg tcctgggttt ag
223720DNAArtificialsynthetic 37gtgtcagagc gagactttgt
203823DNAArtificialsynthetic 38ggagtatctt cagctgtgag aag
233922DNAArtificialsynthetic 39ctgttacacg ttccttgcta ct
224022DNAArtificialsynthetic 40ctgattgagt gggtcatcag aa
224119DNAArtificialsynthetic 41gctacgtgct ggtgctaaa
194224DNAArtificialsynthetic 42gtccaggaaa gaaagttgca taag
244321DNAArtificialsynthetic 43gctgtctgct ggaaagatag t
214449DNAArtificial SequencePrimer 44aacggccacg agttcgagat
cgagggcgag ggcgagggcc gcccctacg 494550DNAArtificial Sequenceprimer
45aacggccacg agttcgagat tcgagggcga gggcgagggc cgcccctacg
504643DNAArtificial Sequenceprimer 46aacggccacg agttcgaggg
cgagggcgag ggccgcccct acg 434737DNAArtificial Sequenceprimer
47aacggccacg agggcgaggg cgagggccgc ccctacg 374837DNAArtificial
Sequenceprimer 48aacggccacg agttcgaggg cgagggccgc ccctacg
374910DNAArtificial Sequenceprimer 49aacggccacg 105029DNAArtificial
Sequenceprimer 50taacaggttg gaccaagcta tgcaggtga
295124DNAArtificial Sequenceprimer 51taacaggttg gaccaagcag gtga
245227DNAArtificial Sequenceprimer 52taacaggttg gaccaagctg caggtga
275328DNAArtificial Sequenceprimer 53taacaggttg gaccaagctt gcaggtga
285430DNAArtificial Sequenceprimer 54taacaggttg gaccaagcta
ttgcaggtga 305527DNAArtificial Sequenceprimer 55taacaggttg
gaccaagcta caggtga 275629DNAArtificial Sequenceprimer 56tcaagaattc
agccctaacc tctggggtc 295728DNAArtificial Sequenceprimer
57tcaagaattc agccctaact ctggggtc 285827DNAArtificial Sequenceprimer
58tcaagaattc agccctaacc tggggtc 275930DNAArtificial Sequenceprimer
59tcaagaattc agccctaacc ctctggggtc 306027DNAArtificial
Sequenceprimer 60tcaagaattc agccctaatc tggggtc 276130DNAArtificial
Sequenceprimer 61tcaagaattc agccctaacc ttctggggtc
306229DNAArtificial Sequenceprimer 62taacaggttg gaccaagcta
tgcaggtga 296328DNAArtificial Sequenceprimer 63taacaggttg
gaccaagctt gcaggtga 286428DNAArtificial Sequenceprimer 64taacaggttg
gaccaagcta gcaggtga 286527DNAArtificial Sequenceprimer 65taacaggttg
gaccaagctg caggtga 276625DNAArtificial Sequenceprimer 66taacaggttg
gaccaatgca ggtga 256730DNAArtificial Sequenceprimer 67taacaggttg
gaccaagcta ttgcaggtga 306855DNAArtificial Sequenceprimer
68aataattgca gtagctctaa caggttggac caagctatgc aggtgacaga gactc
556956DNAArtificial Sequenceprimer 69aataattgca gtagctctaa
caggttggac caagctattg caggtgacag agactc 567056DNAArtificial
Sequenceprimer 70aataattgca gtagctctaa caggttggac caagctattg
caggtgacaa aaactc 567134DNAArtificial Sequenceprimer 71aataattgca
gtagctctaa caggttggac caag 347234DNAArtificial Sequenceprimern = a,
c, g, or t(32)..(34)misc_feature(32)..(32)n is a, c, g, or
tmisc_feature(34)..(34)n is a, c, g, or t 72aataattgca ataactctaa
caaggtggaa cnan 347320RNAArtificial Sequenceguide sequence
73ggccacgagu gugcacguau 207450RNAArtificial Sequencesynthetic
74cguggcccug augaguccgu gaggacgaaa cgguaggaau uccuaccguc
507548RNAArtificial Sequencesynthetic 75caccggaguc gacuccgguc
ugaugagucc gugaggacga aauacgua 48
* * * * *