U.S. patent application number 17/191222 was filed with the patent office on 2021-07-01 for compositions for selection of aptamers.
The applicant listed for this patent is Augmanity Nano LTD. Invention is credited to Almogit Abu-Horowitz, Yaniv Amir, Ido Bachelet, Gil Harari, Erez Lavi, Noam Mamet, Itai Rusinek, Anastasia Shapiro.
Application Number | 20210198674 17/191222 |
Document ID | / |
Family ID | 1000005447818 |
Filed Date | 2021-07-01 |
United States Patent
Application |
20210198674 |
Kind Code |
A1 |
Bachelet; Ido ; et
al. |
July 1, 2021 |
COMPOSITIONS FOR SELECTION OF APTAMERS
Abstract
The present disclosure describes compositions and methods for
rapid selection of both binding and functional oligonucleotides
(DNA, RNA, or any natural or synthetic analog of these). In certain
embodiments, provided herein are flow cells (e.g., flow cells for
an Illumina sequencing instrument or a Polonator sequencing
instrument) comprising within its flow chamber a plurality of
immobilized aptamer clusters (e.g., from an aptamer library
described herein) and, optionally, one or more target cells (e.g.,
cancer cells, immune cells, etc.) and/or a detectable indicator of
cellular function (e.g., a fluorescent indicator of apoptosis, cell
proliferation, gene or protein expression, etc.). In certain
embodiments, provided herein are methods of using such an aptamer
cluster-containing flow cell to identify functional aptamers from
an aptamer library (e.g., in a sequencing instrument, such as an
Illumina sequencing instrument).
Inventors: |
Bachelet; Ido; (Tel
Aviv-Yafo, IL) ; Mamet; Noam; (Tel Aviv-Yafo, IL)
; Rusinek; Itai; (Holon, IL) ; Harari; Gil;
(Tel Aviv, IL) ; Shapiro; Anastasia; (Rishon
LeZion, IL) ; Amir; Yaniv; (Tel Aviv, IL) ;
Lavi; Erez; (Yavne, IL) ; Abu-Horowitz; Almogit;
(Herzliya, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Augmanity Nano LTD |
Rehovot |
|
IL |
|
|
Family ID: |
1000005447818 |
Appl. No.: |
17/191222 |
Filed: |
March 3, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16599970 |
Oct 11, 2019 |
|
|
|
17191222 |
|
|
|
|
16165267 |
Oct 19, 2018 |
10501743 |
|
|
16599970 |
|
|
|
|
PCT/IB2018/000418 |
Mar 30, 2018 |
|
|
|
16165267 |
|
|
|
|
62478993 |
Mar 30, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
B01L 3/5027 20130101;
C12N 15/115 20130101; C12N 2320/13 20130101; C12N 2310/16 20130101;
C12Q 1/6811 20130101; C12N 15/1048 20130101 |
International
Class: |
C12N 15/115 20060101
C12N015/115; B01L 3/00 20060101 B01L003/00; C12N 15/10 20060101
C12N015/10; C12Q 1/6811 20060101 C12Q001/6811 |
Claims
1. A method for identifying one or more aptamers that mediate a
cell function in a target cell, the method comprising: (i)
contacting a plurality of surface-immobilized aptamer clusters with
the target cell; and (ii) identifying immobilized aptamer clusters
that mediate the cell function in the target cell.
2. The method of claim 1, wherein the surface-immobilized aptamer
clusters are immobilized on beads.
3. The method of claim 2, wherein the beads are paramagnetic
bead.
4. The method of claim 2, wherein the beads are detectably
labeled.
5. The method of claim 1, further comprising the steps of: (a)
immobilizing a plurality of aptamers from an aptamer library on
surfaces; and (b) amplifying the plurality of immobilized aptamers
locally on the surfaces to form the plurality of immobilized
aptamer clusters.
6. The method of claim 5, wherein the amplification is conducted
via bridge PCR amplification or rolling circle amplification.
7. The method of claim 6, wherein the method further comprises
removing the complementary strands from the immobilized aptamer
clusters to provide single stranded immobilized aptamer
clusters.
8. The method of claim 1, further comprising an aptamer folding
step, wherein the aptamer folding step comprises raising and then
lowering the temperature of the surface.
9. The method of claim 1, further comprising an aptamer folding
step, wherein the aptamer folding step comprises adding a
denaturing agent to the surfaces and then removing the denaturing
agent from the surfaces.
10. The method of claim 1, further comprising the step of
sequencing the aptamer clusters identified in step (ii).
11. The method of claim 10, wherein the sequencing is conducted via
Illunmia sequencing or Polonator sequencing.
12. The method of claim 1, wherein at least 10.sup.8 distinct
aptamers are immobilized on the one or more surfaces and each
aptamer cluster comprises 10.sup.3 to 10.sup.6 copies of an
aptamer.
13. The method of claim 1, wherein the target cell is detectably
labeled.
14. The method of claim 1, wherein the target cell is a mammalian
cell.
15. The method of claim 14, wherein the mammalian cell is a human
cell.
16. The method of claim 15, wherein the human cell in an immune
cell.
17. The method of claim 15, wherein the human cell is a cancer
cell.
18. The method of claim 15, wherein the cell function is cell
death, caspase-3/7 activity, proliferation, gene expression, or
cytokine expression.
19. The method of claim 18, wherein the cell function is cell
death.
20. The method of claim 19, wherein the target cell is labeled with
a fluorescent reporter of cell death.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/599,970, filed Oct. 11, 2019, which is a
divisional of U.S. patent application Ser. No. 16/165,267, filed
Oct. 19, 2018, now U.S. patent Ser. No. 10/501,743, which is a
continuation of International Patent Application No.
PCT/IB2018/000418, filed Mar. 30, 2018, which claims the benefit of
priority to U.S. Provisional Patent Application Ser. No.
62/478,993, filed Mar. 30, 2017, each of which is hereby
incorporated by reference in its entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Jul. 30, 2018, is named ANB-001_25_SL.txt and is 2,065 bytes in
size.
BACKGROUND
[0003] Aptamers are short, single-stranded nucleic acid oligomers
that can bind to a specific target molecule. Aptamers are typically
selected from a large random pool of oligonucleotides in an
iterative process. More recently, aptamers have been successfully
selected in cells, in-vivo and in-vitro.
[0004] The selection of aptamers, their structure-function
relationship, and their mechanisms of action are all
poorly-understood. Although more than 100 aptamer structures have
been solved and reported, almost no recurring structural motifs
have been identified.
[0005] A variety of different aptamer selection processes have been
described for identifying aptamers capable of binding to a
particular target. However, the ability to rapidly and conveniently
identify aptamers able to mediate a desirable functional effect on
a target of interest would have a profound impact on aptamer
therapeutics.
SUMMARY
[0006] Provided herein are compositions and methods related to the
identification of aptamers that bind to and/or mediate a functional
effect on a target (e.g., a target cell or a target molecule). For
example, in certain embodiments, provided herein are flow cells
(e.g., flow cells for an Illumina sequencing instrument or a
Polonator sequencing instrument) comprising within its flow chamber
a plurality of immobilized aptamer clusters (e.g., from an aptamer
library described herein) and, optionally, one or more target cells
(e.g., cancer cells, immune cells, etc.) and/or a detectable
indicator of cellular function (e.g., a fluorescent indicator of
apoptosis, cell proliferation, gene or protein expression, etc.).
In certain embodiments, provided herein are methods of using such
an aptamer cluster-containing flow cell to identify functional
aptamers from an aptamer library (e.g., in a sequencing instrument,
such as an Illumina sequencing instrument).
[0007] In certain aspects, provided herein are methods for
identifying one or more aptamers that specifically bind to a target
(e.g., a target cell, a target virus, a target protein, a
topographic feature on a cell). In some embodiments, the methods
comprise (i) contacting a plurality of aptamer clusters immobilized
on a surface (e.g., a flow cell surface) with the target; and (ii)
identifying immobilized aptamer clusters that bind to the target.
In certain embodiments, the methods further comprise performing a
wash step after step (i) to remove unbound target from surface
(e.g., a flow cell surface). In some embodiments, the target is
detectably labeled (e.g., fluorescently labeled).
[0008] In some aspects, provided herein are methods for identifying
one or more aptamers that modulate a property of a cell (e.g., a
prokaryotic cell or a eukaryotic cell). In some embodiments, the
methods comprise (i) contacting a plurality of aptamer clusters
immobilized on a surface with the cell; and (ii) identifying the
immobilized aptamer clusters that modulate the property of the cell
(e.g., cell viability, cell proliferation, gene expression, cell
morphology, etc.). In some embodiments, the methods further
comprise performing a wash step after step (i) to remove unbound
target from surface (e.g., a flow cell surface). In some
embodiments, the cell comprises a detectable label (e.g., a
fluorescent dye, such as a calcium sensitive dye, a cell tracer
dye, a lipophilic dye, a cell proliferation dye, a cell cycle dye,
a metabolite sensitive dye, a pH sensitive dye, a membrane
potential sensitive dye, a mitochondrial membrane potential
sensitive dye, or a redox potential dye). In some embodiments, a
change in the property of the cell causes a change in the
properties of the detectable label which are detected in order to
identify the immobilized aptamer clusters that modulate the
property of the cell.
[0009] In some aspects, provided herein are methods for identifying
one or more aptamers that possess a functional property (e.g., an
enzymatic property) that modulates a target (e.g., a target
molecule, such as a target protein). In some embodiments, the
methods comprise (i) contacting a plurality of aptamer clusters
immobilized on a surface with the target; and (ii) identifying the
immobilized aptamer clusters that modulate the target (e.g., that
cleave the target, that induce a chemical or structural change on
the target, etc.). In some embodiments, the methods further
comprise performing a wash step after step (i) to remove unbound
target from flow cell.
[0010] In certain embodiments, the methods further comprise the
generation of the immobilized aptamer clusters. In some
embodiments, the immobilized aptamer clusters are generated by: (a)
immobilizing a plurality of aptamers (e.g., from an aptamer
library) on the surface; and (b) amplifying the plurality of
immobilized aptamers locally on the flow cell surface (e.g., via
bridge PCR amplification or rolling circle amplification) to form
the plurality of immobilized aptamer clusters. In some embodiments,
the methods further comprise removing the complementary strands
from the immobilized aptamer clusters to provide single stranded
immobilized aptamer clusters. In certain embodiments, the
immobilized aptamer clusters are sequenced following step (b)
(e.g., using Illumina sequencing or Polonator sequencing). In some
embodiments, the immobilized aptamer clusters are generated by
printing aptamer clusters (e.g., from an aptamer library) directly
on the surface. In some embodiments, the methods comprise the
generation of the aptamer library (e.g., through chemical nucleic
acid synthesis).
[0011] In certain aspects, provided herein are compositions
comprising aptamer clusters (e.g., a clustered aptamer library). In
certain embodiments, the aptamer clusters are immobilized on a
solid support (e.g., a flow cell). In certain embodiments, the
composition further comprises a target (e.g., a target cell, a
target molecule, a target protein). In certain embodiments, the
composition further comprises a detectable label (e.g., a
fluorescent dye, such as a calcium sensitive dye, a cell tracer
dye, a lipophilic dye, a cell proliferation dye, a cell cycle dye,
a metabolite sensitive dye, a pH sensitive dye, a membrane
potential sensitive dye, a mitochondrial membrane potential
sensitive dye, or a redox potential dye). In some embodiments the
composition comprises 10.sup.4-10.sup.9 aptamer clusters (e.g., at
least about 10.sup.4, 5.times.10.sup.4, 10.sup.5, 5.times.10.sup.5,
10.sup.6, 5.times.10.sup.5, 10.sup.6, 5.times.10.sup.6, 10.sup.7,
5.times.10.sup.7, or 10.sup.8 aptamer clusters. In some
embodiments, each cluster in the library contains
10.sup.3-10.sup.6) of aptamers (e.g., at least about 10.sup.3,
5.times.10.sup.3, 10.sup.4, 5.times.10.sup.4, 10.sup.5,
5.times.10.sup.5 aptamers per cluster.
BRIEF DESCRIPTION OF FIGURES
[0012] FIG. 1 is a schematic diagram of aptamer library synthesis,
sequencing and target identification work flow according to certain
embodiments described herein.
[0013] FIG. 2 is a bar graph showing the binding of target cells
(Hana cells) to a library of aptamers (Lib), short or long aptamers
of random sequence, aptamer outputs of SELEX selection process for
the specific target cells cycles 6 and 7 (Cyc6 and Cyc7
respectively), specific aptamer sequences from SELEX selection
process (Apt1 and Apt2), and an empty lane (empty) on a Illumina
GAIIx flow-cell. Cells were run down flow cell lanes, and bound
cells counted (bound vs. unbound, expressed as fraction, 1=100% of
cells).
[0014] FIG. 3 is an image of a cell bound to aptamers on a flow
cell. The image shows the movement of the cell relative to the
surface over time. The image shows that the cell is retained by the
immobilized aptamer cluster, rather than attached to the surface
itself, and is thus free to move but confined to that location.
Imaging was performed on an Illumina GAIIx.
[0015] FIG. 4 is a schematic representation of certain aptamer
structures according to certain exemplary embodiments provided
herein.
[0016] FIG. 5 includes three panels and illustrates an exemplary
aptamer identification method according to certain embodiments
disclosed herein. Panel A, is a schematic representation of a
flow-cell based aptamer detection method. An initial aptamer
library (SEQ ID NOS 5-7, respectively, in order of appearance) is
sequenced and a flow-cell is generated in which aptamers from the
library are clustered at a unique coordinates. Positive targets
(e.g. tumor biopsy cells) and negative targets (e.g. peripheral
bloods) are labeled with fluorescent indicators for one or more
biological effects (e.g. apoptosis) and introduced into different
lanes of the flow-cell on which the aptamer clusters are
immobilized. Following an incubation, fluorescence is detected and
associated with a position on the flow cell on which an aptamer
cluster is immobilized. Aptamers are scored based on effectiveness
yes/no (Effect/No Effect) and selectivity yes/no (Selective/Not
Selective). The highest scored oligos (E+S) are synthesized and
validated. Panel B shows a photograph of a flow-cell following
sequencing, held inside a custom-built adapter for a screening
fluorescent microscope. Panel C is a screenshot of a fluorescent
microscope image obtained during performance of an embodiment of
the claimed method showing target cells following incubation, with
apoptotic cells producing a positive signal.
DETAILED DESCRIPTION
General
[0017] Provided herein are methods and composition related to the
identification of aptamers that bind to and/or mediate a functional
effect on a target (e.g., a target cell or a target molecule). In
certain embodiments the methods comprise contacting the target to a
plurality of aptamer clusters immobilized on a surface. Thus, in
some embodiments, the method comprises flowing a solution
comprising the target across the surface of a flow cell to which
clusters of aptamers have been immobilized and detecting which
aptamer clusters bind to, interact with and/or mediate a functional
effect on the target.
[0018] In certain embodiments, the sequence of each immobilized
aptamer cluster is known and/or determined, for example, by
sequencing the aptamer clusters or by printing aptamers of known
sequences onto predetermined positions of the surface. Thus, by
determining the position on the surface at which the target binds
to, interacts with and/or is modulated by an aptamer cluster, the
relevant effect can be associated with the aptamer sequence at that
position.
[0019] For example, in some embodiments, aptamers that bind to a
target are identified by running a composition comprising a target
that comprises a detectable label (e.g., a fluorescent label)
across a surface to which aptamer clusters of known sequences are
immobilized at known positions. The positions on the surface at
which the target is retained are determined (e.g., using
fluorescent microscopy), indicating that the aptamers immobilized
at those positions bind to the target.
[0020] In certain embodiments, aptamers that functionally modulate
a target are identified by running a composition comprising a
target that comprises a detectable label indicative of the function
being modulated (e.g., a fluorescent dye, such as a calcium
sensitive dye, a cell tracer dye, a lipophilic dye, a cell
proliferation dye, a cell cycle dye, a metabolite sensitive dye, a
pH sensitive dye, a membrane potential sensitive dye, a
mitochondrial membrane potential sensitive dye, or a redox
potential dye) across a surface to which aptamer clusters of known
sequences are immobilized at known positions. The positions on the
surface at which the detectable label indicates that the target is
modulated are determined (e.g., using fluorescent microscopy),
indicating that the aptamers immobilized at those positions are
able to modulate the target.
[0021] In certain aspects, also provided herein are methods and
compositions related to the creation of immobilized of aptamer
clusters on a surface. In some embodiments, aptamers (e.g., from an
aptamer library disclosed herein) are immobilized onto a surface,
such as a flow cell surface. In some embodiments, a localized
amplification process, such as bridge amplification or rolling
circle amplification, is then performed to generate aptamer
clusters. The aptamer clusters can then be sequenced (e.g., by
Illumina sequencing or Polonator sequencing) in order to associate
the sequence of each aptamer cluster with a position on the
surface. The complementary strands can be stripped in order to
generate single-stranded aptamer clusters. The surface (e.g., flow
cell) is then ready for use in an aptamer identification method
provided herein.
[0022] Conveniently, in certain embodiments, all the steps in the
methods provided herein can be performed in an Illumina sequencing
instrument, such as an Illumina GAIIx instrument.
[0023] In certain aspects, provided herein are compositions
comprising aptamer clusters (e.g., a clustered aptamer library
generated during the performance of a method provided herein). In
certain embodiments, the aptamer clusters are immobilized on a
solid support (e.g., a flow cell). In certain embodiments, the
composition further comprises a target (e.g., a target cell, a
target molecule, a target protein). In certain embodiments, the
composition further comprises a detectable label (e.g., a
fluorescent dye, such as a calcium sensitive dye, a cell tracer
dye, a lipophilic dye, a cell proliferation dye, a cell cycle dye,
a metabolite sensitive dye, a pH sensitive dye, a membrane
potential sensitive dye, a mitochondrial membrane potential
sensitive dye, or a redox potential dye). In some embodiments the
composition comprises 10.sup.4-10.sup.9 aptamer clusters (e.g., at
least about 10.sup.4, 5.times.10.sup.4, 10.sup.5, 5.times.10.sup.5,
10.sup.6, 5.times.10.sup.5, 10.sup.6, 5.times.10.sup.6, 10.sup.7,
5.times.10.sup.7, or 10.sup.8 aptamer clusters. In some
embodiments, each cluster in the library contains
10.sup.3-10.sup.6) of aptamers (e.g., at least about 10.sup.3,
5.times.10.sup.3, 10.sup.4, 5.times.10.sup.4, 10.sup.5,
5.times.10.sup.5 aptamers per cluster.
[0024] In some embodiments, the target can be a cell of any type
(e.g. prokaryotic cell, such as a bacterium, or a eukaryotic cell,
such as a mammalian cell), a virus, a protein, and/or a particle.
In some embodiments, the particle is attached to the target.
[0025] In some embodiments, the detectable label is a fluorescent
reporter of function. In some embodiments the fluorescent reporter
of function is a cell death reporter, a redox potential reporter, a
membrane integrity reporter. In some embodiments, the fluorescent
reporter of function is a virus reporter, such as a capsid
integrity reporter (e.g., a reporter for measuring the capsid
integrity and or functions of a virus). In some embodiments, the
fluorescent reporter of function is a protein reporter, such as a
protein integrity reporter (i.e., a reporter for measuring a
protein's structural integrity and stability) or a protein
denaturation reporter (i.e., a reporter to detect protein
denaturation).
[0026] Examples of cell death reporters are 7-AAD, and Annexin V
fluorophore. In certain embodiments, the target is linked to, bound
by or comprises a detectable label that allows for the detection of
a biological or chemical effect on the target. In some embodiments,
the detectable label is a fluorescent dye. Non-limiting examples of
fluorescent dyes include, but are not limited to, a calcium
sensitive dye, a cell tracer dye, a lipophilic dye, a cell
proliferation dye, a cell cycle dye, a metabolite sensitive dye, a
pH sensitive dye, a membrane potential sensitive dye, a
mitochondrial membrane potential sensitive dye, and a redox
potential dye. In one embodiment, the target is labeled with a
calcium sensitive dye, a cell tracer dye, a lipophilic dye, a cell
proliferation dye, a cell cycle dye, a metabolite sensitive dye, a
pH sensitive dye, a membrane potential sensitive dye, a
mitochondrial membrane potential sensitive dye, or a redox
potential dye.
[0027] In certain embodiments, the target is labeled with an
activation associated marker, an oxidative stress reporter, an
angiogenesis marker, an apoptosis marker, an autophagy marker, a
cell viability marker, or a marker for ion concentrations. In yet
another embodiment, the target is labeled with an activation
associated marker, an oxidative stress reporter, an angiogenesis
marker, an apoptosis marker, an autophagy marker, a cell viability
marker, or a marker for ion concentrations prior to exposure of
aptamers to the target.
[0028] In some embodiments, the target cell is labeled with a
calcium sensitive dye, a cell tracer dye, a lipophilic dye, a cell
proliferation dye, a cell cycle dye, a metabolite sensitive dye, a
pH sensitive dye, a membrane potential sensitive dye, a
mitochondrial membrane potential sensitive dye, or a redox
potential dye. In certain embodiments, the target cell is labeled
with an activation associated marker, an oxidative stress reporter,
an angiogenesis marker, an apoptosis marker, an autophagy marker, a
cell viability marker, or a marker for ion concentrations. In yet
another embodiment, target cell is labeled with an activation
associated marker, an oxidative stress reporter, an angiogenesis
marker, an apoptosis marker, an autophagy marker, a cell viability
marker, or a marker for ion concentrations prior to exposure of
aptamers to the cell. In some embodiments, the target cell is
labeled after to exposure of aptamers to the target. In one
embodiment, the target cell is labeled with a fluorescently-labeled
antibody or antigen-binding fragment thereof, annexin V, a
fluorescently-labeled fusion protein, a fluorescently-labeled
sugar, or fluorescently labeled lectin. In one embodiment, the
target cell is labeled with a fluorescently-labeled antibody or
antigen-binding fragment thereof, annexin V, a
fluorescently-labeled fusion protein, a fluorescently-labeled
sugar, or fluorescently labeled lectin after exposure of aptamers
to the cell.
[0029] In some embodiments the aptamer clusters are immobilized on
a flow cell (e.g., a flow cell is used for image-based DNA
sequencing, such as, Illumina instrument flow cell and/or Polonator
sequencer flow cell). In certain embodiments, the flow cell can be
made of any material. In some embodiments the flow cell is made of
plastic, glass, polymer, or metal. In some embodiments, the flow
cell is a plate, a tray, or a chip. In some embodiments, the flow
cell contains between its floor and ceiling one or more of the
following: air, water, aqueous buffer, culture medium, serum,
patient-derived sample (e.g. blood, plasma, serum, urine), matrix
(e.g. gel), a polymer, and/or a protein (e.g. collage, or
patient-derived extracellular matrix). In some embodiments, the
flow cell contains targets (e.g., target cells). In some
embodiments, the flow cell (e.g. its floor and/or its ceiling) is
coated with a blocker, such as, a polymer, a protein, an oligo, a
lipid, and/or a chemical group. In some embodiments, the flow cell
contains an anchor of any length to bind the target at proximity to
clusters. In some embodiments, the anchor is a polymer, a protein,
an oligo, a lipid, and/or a chemical group.
[0030] In some embodiments, the aptamer clusters are arranged
randomly in the flow cell. In other embodiments, the aptamer
clusters are arranged according to a specific pattern in the flow
cell. In some embodiments, the flow cell is fixed at any stage. In
some embodiments, the composition further comprises a fixative. In
some embodiments, the flow cell is used for iterative process of
oligo selection. In other embodiments, the flow cell is used in
non-iterative process of oligo selection.
[0031] In certain embodiments, the target is labeled with an
activation associated marker, an oxidative stress reporter, an
angiogenesis marker, an apoptosis marker, an autophagy marker, a
cell viability marker, or a marker for ion concentrations. In yet
another embodiment, the target is labeled with an activation
associated marker, an oxidative stress reporter, an angiogenesis
marker, an apoptosis marker, an autophagy marker, a cell viability
marker, or a marker for ion concentrations prior to exposure of
aptamers to the target.
Definitions
[0032] For convenience, certain terms employed in the
specification, examples, and appended claims are collected
here.
[0033] The articles "a" and "an" are used herein to refer to one or
to more than one (e.g., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0034] As used herein, the term "aptamer" refers to a short (e.g.,
less than 200 bases), single stranded nucleic acid molecule (ssDNA
and/or ssRNA) able to specifically bind to a protein or peptide
target or to a topographic feature on a target cell.
[0035] As used herein, the term "aptamer cluster" refers to a
collection of locally immobilized aptamers (e.g., at least 10) of
identical sequence.
[0036] The term "binding" or "interacting" refers to an
association, which may be a stable association, between two
molecules, e.g., between an aptamer and target, e.g., due to, for
example, electrostatic, hydrophobic, ionic and/or hydrogen-bond
interactions under physiological conditions.
[0037] As used herein, two nucleic acid sequences "complement" one
another or are "complementary" to one another if they base pair one
another at each position.
[0038] As used herein, two nucleic acid sequences "correspond" to
one another if they are both complementary to the same nucleic acid
sequence.
[0039] The term "modulation", when used in reference to a
functional property or biological activity or process (e.g., enzyme
activity or receptor binding), refers to the capacity to either up
regulate (e.g., activate or stimulate), down regulate (e.g.,
inhibit or suppress) or otherwise change a quality of such
property, activity, or process. In certain instances, such
regulation may be contingent on the occurrence of a specific event,
such as activation of a signal transduction pathway, and/or may be
manifest only in particular cell types.
[0040] As used herein, "specific binding" refers to the ability of
an aptamer to bind to a predetermined target. Typically, an aptamer
specifically binds to its target with an affinity corresponding to
a K.sub.D of about 10.sup.-7 M or less, about 10.sup.-8 M or less,
or about 10.sup.-9 M or less and binds to the target with a K.sub.D
that is significantly less (e.g., at least 2 fold less, at least 5
fold less, at least 10 fold less, at least 50 fold less, at least
100 fold less, at least 500 fold less, or at least 1000 fold less)
than its affinity for binding to a non-specific and unrelated
target (e.g., BSA, casein, or an unrelated cell, such as an HEK 293
cell or an E. coli cell).
[0041] As used herein, the Tm or melting temperature of two
oligonucleotides is the temperature at which 50% of the
oligonucleotide/targets are bound and 50% of the oligonucleotide
target molecules are not bound. Tm values of two oligonucleotides
are oligonucleotide concentration dependent and are affected by the
concentration of monovalent, divalent cations in a reaction
mixture. Tm can be determined empirically or calculated using the
nearest neighbor formula, as described in Santa Lucia, J. PNAS
(USA) 95:1460-1465 (1998), which is hereby incorporated by
reference.
[0042] The terms "polynucleotide" and "nucleic acid" are used
herein interchangeably. They refer to a polymeric form of
nucleotides of any length, either deoxyribonucleotides or
ribonucleotides, or analogs thereof. Polynucleotides may have any
three-dimensional structure, and may perform any function, known or
unknown. The following are non-limiting examples of
polynucleotides: coding or non-coding regions of a gene or gene
fragment, loci (locus) defined from linkage analysis, exons,
introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA,
ribozymes, cDNA, synthetic polynucleotides, recombinant
polynucleotides, branched polynucleotides, plasmids, vectors,
isolated DNA of any sequence, isolated RNA of any sequence, nucleic
acid probes, and primers. A polynucleotide may comprise modified
nucleotides, such as methylated nucleotides and nucleotide analogs.
If present, modifications to the nucleotide structure may be
imparted before or after assembly of the polymer. The sequence of
nucleotides may be interrupted by non-nucleotide components. A
polynucleotide may be further modified, such as by conjugation with
a labeling component.
Aptamer Libraries
[0043] In certain embodiments, the methods and compositions
provided herein relate to the identification of aptamers having
desired properties from among the aptamers present in an aptamer
library. As used herein, an aptamer library is a collection of
nucleic acid molecules (e.g., DNA and/or RNA) having distinct
sequences (e.g., at least 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5,
10.sup.6 or 10.sup.7 distinct sequences) and wherein at least a
subset of the nucleic acid molecules is structured such that they
are capable of specifically binding to a target protein, peptide,
or cellular topographic feature. In some embodiments, any library
of potential aptamers can be used in the methods and compositions
provided herein.
[0044] In some embodiments, the aptamer library used in the methods
and compositions provided herein comprises, consists of and/or
consists essentially of nucleic acid molecules (e.g., DNA and/or
RNA) having a sequence according to Formula (I):
P1-R-P2 (I),
[0045] wherein P1 is a 5' primer site sequence of about 10 to 100
bases in length, about 10 to 50 bases in length, about 10 to 30
bases in length, about 15 to 50 bases in length or about 15 to 30
bases in length; P2 is a 3' primer site sequence of about 10 to 100
bases in length, about 10 to 50 bases in length, about 10 to 30
bases in length, about 15 to 50 bases in length or about 15 to 30
bases in length; and R is a sequence comprising randomly positioned
bases of about at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75 or 80 bases in length and/or no more than about 120,
115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55 or 50 bases
in length.
[0046] In one embodiment, R is a sequence comprising about 25% A.
In another embodiment, R is a sequence comprising about 25% T. In
another embodiment, R is a sequence comprising about 25% G. In
another embodiment, R is a sequence comprising about 25% C. In yet
another embodiment, R is a sequence comprising about 25% A, about
25% T, about 25% G, and about 25% C.
[0047] In some embodiments, the aptamer library used in the methods
and compositions provided herein comprises, consists of and/or
consists essentially of nucleic acid molecules (DNA and/or RNA)
having a sequence according to Formula (I):
P1-R''-P2 (I),
[0048] wherein P1 is a 5' primer site sequence of about 10 to 100
bases in length, about 10 to 50 bases in length, about 10 to 30
bases in length, about 15 to 50 bases in length or about 15 to 30
bases in length; P2 is a 3' primer site sequence of about 10 to 100
bases in length, about 10 to 50 bases in length, about 10 to 30
bases in length, about 15 to 50 bases in length or about 15 to 30
bases in length; and R'' is a sequence of about at least 10, 15,
20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or 80 bases in
length and/or no more than about 120, 115, 110, 105, 100, 95, 90,
85, 80, 75, 70, 65, 60, 55 or 50 bases in length comprising
randomly positioned bases from a biased mixture or any combination
of random strings with repetitive or biased strings.
[0049] In some embodiments, the aptamer library used in the methods
and compositions provided herein comprises, consists of and/or
consists essentially of nucleic acid molecules (DNA and/or RNA)
having a sequence according to Formula II (an exemplary schematic
representation is provided in FIG. 4A),
P1-S1-L1-S1*-S2-L2-S2*-P2 (II),
[0050] wherein:
[0051] P1 is a 5' primer site sequence of about 10 to 100 bases in
length, about 10 to 50 bases in length, about 10 to 30 bases in
length, about 15 to 50 bases in length or about 15 to 30 bases in
length; P2 is a 3' primer site sequence of about 10 to 100 bases in
length, about 10 to 50 bases in length, about 10 to 30 bases in
length, about 15 to 50 bases in length or about 15 to 30 bases in
length; S1 and S2 are each independently a stem region sequence of
at least one base (e.g., of about 4 to 40 bases in length or 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or
40 bases in length); S1* is a complementary sequence to S1; S2* is
a complementary sequence to S2; L1 and L2 are each independently a
Loop region sequence of at least one base (e.g., of about 1 to 50
bases in length or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49 or 50 bases in length); and S1-L1-S1*-S2-L2-S2* is collectively
about at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75 or 80 bases in length and/or no more than about 120, 115, 110,
105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55 or 50 bases in
length.
[0052] In some embodiments, the aptamer library used in the methods
and compositions provided herein comprises, consists of and/or
consists essentially of nucleic acid molecules (DNA and/or RNA)
having a sequence according Formula III (an exemplary schematic
representation is provided in FIG. 4B):
P1-S1-L1-S2-L2-S2*-L1-S1*-P2 (III),
[0053] wherein:
[0054] P1 is a 5' primer site sequence of about 10 to 100 bases in
length, about 10 to 50 bases in length, about 10 to 30 bases in
length, about 15 to 50 bases in length or about 15 to 30 bases in
length; P2 is a 3' primer site sequence of about 10 to 100 bases in
length, about 10 to 50 bases in length, about 10 to 30 bases in
length, about 15 to 50 bases in length or about 15 to 30 bases in
length;
[0055] S1 and S2 are each independently a stem region sequence of
at least one base (e.g., of about 4 to 40 bases in length or 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or
40 bases in length); S1* is a complementary sequence to S1; S2* is
a complementary sequence to S2;
[0056] L1 and L2 are each independently a Loop region sequence of
at least one base (e.g., of about 1 to 50 bases in length or 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases in
length); and
[0057] S1-L1-S2-L2-S2*-L1-S1* is collectively about at least 10,
15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or 80 bases in
length and/or no more than about 120, 115, 110, 105, 100, 95, 90,
85, 80, 75, 70, 65, 60, 55 or 50 bases in length.
[0058] In some embodiments, the aptamer library used in the methods
and compositions provided herein comprises, consists of and/or
consists essentially of nucleic acid molecules (DNA and/or RNA)
having a sequence according Formula IV (an exemplary schematic
representation is provided in FIG. 4C):
P1-Lib-M1/M2-D-M1/M2*-Lib-P2 (IV),
[0059] wherein:
[0060] P1 is a 5' primer site sequence of about 10 to 100 bases in
length, about 10 to 50 bases in length, about 10 to 30 bases in
length, about 15 to 50 bases in length or about 15 to 30 bases in
length; P2 is a 3' primer site sequence of about 10 to 100 bases in
length, about 10 to 50 bases in length, about 10 to 30 bases in
length, about 15 to 50 bases in length or about 15 to 30 bases in
length;
[0061] Lib is sequence having a formula selected from: (i) R; (ii)
R''; (iii) S1-L1-S1*-S2-L2-S2*; and (iv)
S1-L1-S2-L2-S2*-L1-S1*;
[0062] R is a sequence comprising randomly positioned bases of
about at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75 or 80 bases in length and/or no more than about 120, 115, 110,
105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55 or 50 bases in
length;
[0063] R'' is a sequence of about at least 10, 15, 20, 25, 30, 35,
40, 45, 50, 55, 60, 65, 70, 75 or 80 bases in length and/or no more
than about 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60,
55 or 50 bases in length comprising randomly positioned bases from
a biased mixture or any combination of random strings with
repetitive or biased strings; 51 and S2 are each independently a
stem region sequence of at least one base (e.g., of about 4 to 40
bases in length or 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39 or 40 bases in length); S1* is a
complementary sequence to 51; S2* is a complementary sequence to
S2;
[0064] L1 and L2 are each independently a Loop region sequence of
at least one base (e.g., of about 1 to 50 bases in length or 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases in
length);
[0065] wherein S1-L1-S1*-S2-L2-S2* is collectively about at least
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or 80 bases
in length and/or no more than about 120, 115, 110, 105, 100, 95,
90, 85, 80, 75, 70, 65, 60, 55 or 50 bases in length;
[0066] D is a spacer sequence comprising at least one base (e.g.,
of about 1 to 20 bases in length or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 bases in length); M1 is a
multimer-forming domain sequence of about 10 to 18 bases in length
or 10, 11, 12, 13, 14, 15, 16, 17 or 18 bases in length that
enables a strand of the sequence to interact with another strand
that contains a complementary domain; and
[0067] M2 is a complementary domain of M1 comprising a strand that
interacts with a strand of the M1 sequence.
[0068] In some embodiments, the aptamer library used in the methods
and compositions provided herein comprises, consists of and/or
consists essentially of nucleic acid molecules (DNA and/or RNA)
having a sequence according Formula V (an exemplary schematic
representation is provided in FIG. 4D):
P1-Lib-T*-Lib-P2 (V),
[0069] wherein:
[0070] P1 is a 5' primer site sequence of about 10 to 100 bases in
length, about 10 to 50 bases in length, about 10 to 30 bases in
length, about 15 to 50 bases in length or about 15 to 30 bases in
length; P2 is a 3' primer site sequence of about 10 to 100 bases in
length, about 10 to 50 bases in length, about 10 to 30 bases in
length, about 15 to 50 bases in length or about 15 to 30 bases in
length;
[0071] Lib is sequence having a formula selected from: (i) R; (ii)
R''; (iii) S1-L1-S1*-S2-L2-S2*; and (iv)
S1-L1-S2-L2-S2*-L1-S1*;
[0072] R is a sequence comprising randomly positioned bases of
about at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75 or 80 bases in length and/or no more than about 120, 115, 110,
105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55 or 50 bases in
length;
[0073] R'' is a sequence of about at least 10, 15, 20, 25, 30, 35,
40, 45, 50, 55, 60, 65, 70, 75 or 80 bases in length and/or no more
than about 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60,
55 or 50 bases in length comprising randomly positioned bases from
a biased mixture or any combination of random strings with
repetitive or biased strings;
[0074] S1 and S2 are each independently a stem region sequence of
at least one base (e.g., of about 4 to 40 bases in length or 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or
40 bases in length); S1* is a complementary sequence to S1; S2* is
a complementary sequence to S2;
[0075] L1 and L2 are each independently a Loop region sequence of
at least one base (e.g., of about 1 to 50 bases in length or 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases in
length);
[0076] wherein S1-L1-S1*-S2-L2-S2* is collectively about at least
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or 80 bases
in length and/or no more than about 120, 115, 110, 105, 100, 95,
90, 85, 80, 75, 70, 65, 60, 55 or 50 bases in length;
[0077] T is a second strand bound by Watson/Crick or Hoogsteen base
pairing to any part of the Lib sequence or T*, wherein the strand
optionally contains unpaired domains on its 5' and 3' ends (e.g.,
to facilitate attachment of a functional moiety to the aptamer);
and
[0078] T* is a dedicated domain sequence (e.g., of about 4 to 40
bases in length or 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39 or 40 bases in length).
[0079] In some embodiments of the Formulae above, R is randomly
positioned bases from any random mixture (e.g., for canonical
bases, 25% A, 25% T, 25% G, 25% C) of about at least 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or 80 bases in length
and/or no more than about 120, 115, 110, 105, 100, 95, 90, 85, 80,
75, 70, 65, 60, 55 or 50 bases in length.
[0080] In one embodiment of the Formulae above, R is a sequence
comprising about 25% A. In another embodiment, R is a sequence
comprising about 25% T. In another embodiment, R is a sequence
comprising about 25% G. In another embodiment, R is a sequence
comprising about 25% C. In yet another embodiment, R is a sequence
comprising about 25% A, about 25% T, about 25% G, and about 25%
C.
[0081] In some embodiments of the Formulae above, R'' is a sequence
comprising comprises randomly positioned bases from a biased
mixture (e.g., for canonical bases, any mixture deviating from 25%
per base). In some embodiments, R'' is a sequence that comprises
about 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70% or 75% A. In some embodiments, R'' is a sequence that
comprises about 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,
50%, 55%, 60%, 65%, 70% or 75% T. In some embodiments, R'' is a
sequence that comprises about 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70% or 75% C. In some embodiments,
R'' is a sequence that comprises about 0%, 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or 75% G. In some
embodiments, R'' is a sequence that comprises any combination of
random strings (string is any sequence including a single base)
with repetitive or biased strings.
[0082] In some embodiments of the Formulae above, R'' is randomly
positioned bases from a biased mixture (e.g., for canonical bases,
any mixture deviating from 25% per base); or any combination of
random strings (string is any sequence including a single base)
with repetitive or biased strings of about at least 10, 15, 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or 80 bases in length and/or
no more than about 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70,
65, 60, 55 or 50 bases in length.
[0083] In some embodiments of the Formulae above, S1 is a stem
region sequence of at least 1 base or more. In other embodiments,
S1 is a stem region sequence of between about 4 to 40 bases in
length or 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39 or 40 bases in length.
[0084] In some embodiments of the Formulae above, S2 is a stem
region sequence of at least 1 base or more. In other embodiments,
S2 is a stem region sequence of between about 4 to 40 bases in
length or 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39 or 40 bases in length.
[0085] In some embodiments of the Formulae above, L1 is a Loop
region sequence of at least one base. In other embodiments, L1 is a
Loop region sequence of about 1 to 50 bases in length or 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases in
length.
[0086] In some embodiments of the Formulae above, L2 is a Loop
region sequence of at least one base. In other embodiments, L2 is a
Loop region sequence of about 1 to 50 bases in length or 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases in
length.
[0087] In some embodiments of the Formulae above, T may include
unpaired domains on its 5' and 3' ends, or it may be a padlock tail
(e.g., a loop between two domains paired with the library).
[0088] The aptamers of the present disclosure may contain any
number of stems and loops, and other structures comprised of stems
and loops (e.g., hairpins, bulges, etc.). In some embodiments, the
loops in the aptamer contain bases implanted in order to form
stable loop-loop WC pairing forming a stem which is orthogonal to
the main library axis. In other embodiments, two loops in the
aptamer together form an orthogonal stem. In yet other embodiments,
the loops in the aptamer contain bases implanted in order to form
stable Hoogsteen pairing with an existing stem along the main
library axis. In other embodiments, the loops in the aptamer can
form Hoogsteen pairing with any stem in the aptamer.
[0089] In some embodiments of the formulae above, the aptamer
sequence further contains one or more multimer-forming domains.
[0090] In some embodiments of the formulae above, the aptamer
sequence further contains one or more spacers (e.g., of about 1 to
20 bases in length or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19 or 20 bases in length).
[0091] The aptamers of the present disclosure can be prepared in a
variety of ways. In one embodiment, the aptamers are prepared
through chemical synthesis. In another embodiment, the aptamers are
prepared through enzymatic synthesis. In one embodiment, the
enzymatic synthesis can be carried out using any enzyme that can
add nucleotides to elongate a primer, with or without template. In
some embodiments, the aptamers are prepared by assembling together
k-mers (e.g., k.gtoreq.2 bases).
[0092] In some embodiments, the aptamers of the present disclosure
may contain any combination of DNA, RNA, and their natural and/or
synthetic analogs. In one embodiment, the aptamer comprises DNA. In
one embodiment, the aptamer comprises RNA.
[0093] In other embodiments, the aptamers of the present disclosure
may contain any modification on the 5' end, 3' end, or internally.
Modifications of the aptamers include, but are not limited to,
spacers, phosphorylation, linkers, conjugation chemistries,
fluorophores, quenchers, photoreactive, and modified bases (e.g.,
LNA, PNA, UNA, PS, methylation, 2-O-methyl, halogenated,
superbases, iso-dN, inverted bases, L-ribose, other sugars as
backbone, etc.).
[0094] In some embodiments, the aptamers of the present disclosure
may be conjugated to external, non-nucleic acid molecules on the 5'
end, 3' end, or internally. Non-limiting examples of non-nucleic
acid molecules include, but are not limited to. amino acids,
peptides, proteins, small molecule drugs, mono- and
polysaccharides, lipids, antibodies and antibody fragments, or a
combination thereof.
[0095] The aptamers of the present disclosure may contain any
domain which has a biological function. Non-limiting examples of
biological functions of the aptamers described herein include, but
are not limited to, acting as templates for RNA transcription,
binding to, recognizing, and/or modulating the activity of
proteins, binding to transcription factors, specialized nucleic
acid structure (e.g., Z-DNA, H-DNA, G-quad, etc.), and acting as an
enzymatic substrate for restriction enzymes, specific exo- and
endonucleases, recombination sites, editing sites, or siRNA. In one
embodiment, the aptamers modulate the activity of at least one
protein. In another embodiment, the aptamers inhibit the activity
of at least one protein. In yet another embodiment, the aptamers
inhibit the activity of at least one protein
[0096] In other embodiments, the aptamers of the present disclosure
may contain any domain for integration into a nucleic acid
nanostructure built by any one of several known methods (Shih et
al, Nature 427:618-621 (2004); Rothemund, Nature 440:297-302
(2006); Zheng et al, Nature 461:74-77 (2009); Dietz et al, Science
325:725-730 (2009); Wei et al, Nature 485:623-626 (2012); Ke et al,
Science 338:1177-1183 (2012); Douglas et al, Science 335:831-834
(2012), each of which are hereby incorporated by reference). In yet
other embodiments, the aptamers of the present disclosure may
contain any domain that serves a function in molecular logic and
computation (Seelig et al, Science 314:1585-1588 (2006); Macdonald
et al, Nano Lett 6:2598-2603 (2006); Qian et al, Nature 475:368-372
(2011); Douglas et al, Science 335:831-834 (2012); Amir et al, Nat
Nanotechnol 9:353-357 (2014), each of which is hereby incorporated
by reference).
[0097] In some embodiments, the aptamers of the present disclosure
undergo one or more cycles of negative selection versus a target
(e.g., eukaryotic or prokaryotic cell, virus or viral particle,
molecule, tissue, or whole organism, in-vivo or ex-vivo). In other
embodiments, the aptamers of the present disclosure undergo one or
more cycles of positive selection versus a target (e.g., eukaryotic
or prokaryotic cell, virus or viral particle, molecule, tissue, or
whole organism, in-vivo or ex-vivo).
[0098] The aptamers of the present disclosure can be in solution or
attached to a solid phase (e.g., surface, particles, resin, matrix,
etc.). In some embodiments, the aptamer is attached to a surface.
In one embodiment, the surface is a flow cell surface.
[0099] In some embodiments, the aptamers of the present disclosure
are synthesized in an aptamer library. The aptamer library of the
present disclosure can be prepared in a variety of ways. In one
embodiment, the aptamer library is prepared through chemical
synthesis. In another embodiment, the aptamer library is prepared
through enzymatic synthesis. In one embodiment, the enzymatic
synthesis can be carried out using any enzyme that can add
nucleotides to elongate a primer, with or without template.
[0100] In some embodiments, the aptamers synthesized in an aptamer
library may contain any combination of DNA, RNA, and their natural
and/or synthetic analogs. In one embodiment, the aptamers
synthesized in an aptamer library comprise DNA. In one embodiment,
the aptamers synthesized in an aptamer library comprise RNA.
[0101] In some embodiments, the aptamers synthesized in an aptamer
library are a nucleic acid (e.g., DNA, RNA, natural or synthetic
bases, base analogs, or a combination thereof) collection of
10.sup.K species (K.gtoreq.2), with Z copies per species
(1.ltoreq.Z.ltoreq.K-1).
[0102] In other embodiments, the aptamers synthesized in an aptamer
library of the present disclosure may contain any modification on
the 5' end, 3' end, or internally. Modifications of the aptamers
include, but are not limited to, spacers, phosphorylation, linkers,
conjugation chemistries, fluorophores, quenchers, photoreactive
modifications, and modified bases (e.g., LNA, PNA, UNA, PS,
methylation, 2-O-methyl, halogenated, superbases, iso-dN, inverted
bases, L-ribose, other sugars as backbone).
[0103] In some embodiments, the aptamers synthesized in an aptamer
library may be conjugated to external, non-nucleic acid molecules
on the 5' end, 3' end, or internally. Non-limiting examples of
non-nucleic acid molecules include, but are not limited to. amino
acids, peptides, proteins, small molecule drugs, mono- and
polysaccharides, lipids, antibodies and antibody fragments, or a
combination thereof.
[0104] The aptamers synthesized in an aptamer library may contain
any domain which has a biological function. Non-limiting examples
of biological functions of the aptamers described herein include,
but are not limited to, acting as templates for RNA transcription,
binding to, recognizing, and/or modulating the activity of
proteins, binding to transcription factors, specialized nucleic
acid structure (e.g., Z-DNA, H-DNA, G-quad, etc.), acting as an
enzymatic substrate for restriction enzymes, specific exo- and
endonucleases, recombination sites, editing sites, or siRNA. In one
embodiment, the aptamers synthesized in an aptamer library modulate
the activity of at least one protein. In another embodiment, the
aptamers synthesized in an aptamer library inhibit the activity of
at least one protein. In yet another embodiment, the aptamers
synthesized in an aptamer library inhibit the activity of at least
one protein
[0105] In other embodiments, the aptamers synthesized in an aptamer
library may contain any domain for integration into a nucleic acid
nanostructure built by one of several known methods (Shih et al,
Nature 427:618-621 (2004); Rothemund, Nature 440:297-302 (2006);
Zheng et al, Nature 461:74-77 (2009); Dietz et al, Science
325:725-730 (2009); Wei et al, Nature 485:623-626 (2012); Ke et al,
Science 338:1177-1183 (2012); Douglas et al, Science 335:831-834
(2012), each of which are hereby incorporated by reference). In yet
other embodiments, the aptamers of the present disclosure may
contain any domain that serves a function in molecular logic and
computation (Seelig et al, Science 314:1585-1588 (2006); Macdonald
et al, Nano Lett 6:2598-2603 (2006); Qian et al, Nature 475:368-372
(2011); Douglas et al, Science 335:831-834 (2012); Amir et al, Nat
Nanotechnol 9:353-357 (2014), each of which is hereby incorporated
by reference)
[0106] In some embodiments, the aptamers synthesized in an aptamer
library undergo one or more cycles of negative selection versus a
target (e.g., eukaryotic or prokaryotic cell, virus or viral
particle, molecule, tissue, or whole organism, in-vivo or ex-vivo).
In other embodiments, the aptamers of the present disclosure
undergo one or more cycles of positive selection versus a target
(e.g., eukaryotic or prokaryotic cell, virus or viral particle,
molecule, tissue, or whole organism, in-vivo or ex-vivo).
[0107] The aptamers synthesized in an aptamer library can be in
solution or attached to a solid phase (e.g., surface, particles,
resin, matrix, etc.). In some embodiments, the aptamers synthesized
in an aptamer library are attached to a surface. In one embodiment,
the surface is a flow cell surface.
Immobilized Aptamer Clusters
[0108] In certain aspects, provided herein are methods for
identifying aptamers that bind to and/or modulate a target by
flowing a sample comprising the target across a plurality of
aptamer clusters (e.g., clusters of aptamers from the aptamer
libraries provided herein) immobilized on a surface. In certain
embodiments the surface can be any solid support. In some
embodiments, the surface is the surface of a flow cell. In some
embodiments, the surface is a slide or chip (e.g., the surface of a
gene chip). In some embodiments, the surface is a bead (e.g., a
paramagnetic bead).
[0109] In certain embodiments, any method known in the art can be
used to generate the immobilized aptamer clusters on the surface.
In some embodiments, the aptamer clusters are printed directly onto
the surface. For example, in some embodiments, the aptamer clusters
are printed with fine-pointed pins onto glass slides, printed using
photolithography, printed using ink-jet printing, or printed by
electrochemistry on microelectrode arrays. In some embodiments, at
least about 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6 or
10.sup.7 distinct aptamer clusters are printed onto the surface. In
some embodiments, each aptamer cluster comprises at least about 10,
20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300,
350, 400, 450, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000,
5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000,
80,000, 90,000 or 100,000 identical aptamer molecules.
[0110] Advantageously, direct printing of microarrays allows for
aptamers of known sequence to be specifically immobilized at a
predetermined position on the surface, so subsequent sequencing may
be unnecessary.
[0111] In certain embodiments, the surface-immobilized aptamer
clusters are generated by first immobilizing aptamers (e.g., from
an aptamer library disclosed herein) onto the surface (e.g.,
wherein the position at which each aptamer is immobilized is
random). In some embodiments, at least about 10.sup.2, 10.sup.3,
10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9 or
10.sup.10 distinct aptamers are immobilized onto the surface.
Following aptamer immobilization, a localized amplification process
(e.g., bridge amplification or rolling circle amplification), is
then performed to generate clusters of copies of each immobilized
aptamer positioned proximal to the immobilization site of the
original immobilized aptamer. In certain embodiments (e.g.,
embodiments in which rolling circle amplification is performed) the
aptamer cluster is housed in a nano-pit or pore on the surface
rather than being directly immobilized on the surface. In some
embodiments, amplification results in each aptamer cluster
comprising at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100,
125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800,
900, 1000, 2000, 3000, 4000, 5000, 10,000, 20,000, 30,000, 40,000,
50,000, 60,000, 70,000, 80,000, 90,000 or 100,000 identical aptamer
molecules. In certain embodiments, the aptamer clusters are then
sequenced (e.g., by Illumina sequencing or Polonator sequencing) in
order to associate the sequence of each aptamer cluster with its
position on the surface. If present, complementary strands can be
stripped from the aptamer cluster by washing the surface under
conditions not amenable to strand hybridization (e.g., due to salt
concentration and/or temperature) in order to generate clusters of
single-stranded aptamers. The surface (e.g., flow cell) is then
ready for use in an aptamer identification method provided herein.
In some embodiments, the immobilized aptamer clusters are prepared
and/or sequenced on one instrument, and then transferred to a
separate instrument for aptamer identification. In other
embodiments, the aptamer clusters are prepared and/or sequenced on
the same instrument as is used for aptamer identification.
[0112] In some embodiments of the methods above, the aptamers or
aptamer clusters (e.g., from the aptamer library) comprise an
adapter that will bring the aptamers to surface height (e.g., in
cases where the surface is not flat, such as in flow cells that
include pores). In one embodiment, the aptamers or aptamer clusters
are immobilized inside pores on a flow cell surface and adapters
are used to bind the aptamer to the surface in order to bring the
aptamers to surface height. In some embodiments, the adapter is a
nucleic acid adapter (e.g., a sequence of at least about 10, 15,
20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or
100 bases in length). In some embodiments, a sequence complementary
to the adapter sequence is hybridized to the adapter prior to
aptamer screening. In some embodiments, the adapter is a chemical
adapter (e.g., a polymer connecting the aptamer to the
surface).
Aptamer Library Screening
[0113] In certain aspects, provided herein are methods for
identifying one or more aptamers that specifically bind to and/or
modulate a target, the method generally comprising: (i) contacting
a plurality of aptamer clusters immobilized on a surface with the
target; and (ii) identifying the immobilized aptamer clusters that
specifically bind to and/or modulate the target. Because the
sequence of each aptamer cluster is associated with a specific
position on the surface (e.g., determined according to the methods
provided herein), the sequence of the aptamer responsible for the
binding/modulation is identified and the position at which the
target is bound and/or modulated can be determined.
[0114] In some embodiments, the target is labeled with and/or
comprises a detectable label. The target can be detectably labeled
directly (e.g., through a direct chemical linker) or indirectly
(e.g., using a detectably labeled target-specific antibody). In
embodiments in which the target is a cell, it can be labeled by
incubating the target cell with the detectable label under
conditions such that the detectable label is internalized by the
cell. In some embodiments, the target is detectably labeled before
performing the aptamer screening methods described herein. In some
embodiments, the target is labeled during the performance of the
aptamer screening methods provided herein. In some embodiments, the
target is labeled after is it is bound to an aptamer cluster (e.g.,
by contacting the bound target with a detectably labeled antibody).
In some embodiments, any detectable label can be used. Examples of
detectable labels include, but are not limited to, fluorescent
moieties, radioactive moieties, paramagnetic moieties, luminescent
moieties and/or colorimetric moieties. In some embodiments, the
targets described herein are linked to, comprise and/or are bound
by a fluorescent moiety. Examples of fluorescent moieties include,
but are not limited to, Allophycocyanin, Fluorescein,
Phycoerythrin, Peridinin-chlorophyll protein complex, Alexa Fluor
350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor
514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor
568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 635, Alexa Fluor
647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, Alexa Fluor
750, Alexa Fluor 790, EGFP, mPlum, mCherry, mOrange, mKO, EYFP,
mCitrine, Venus, YPet, Emerald, Cerulean and CyPet.
[0115] The target can be a non-molecular or a supramolecular
target. Non-limiting examples of targets to which the aptamers of
the present disclosure can bind to and/or modulate include, but are
not limited to, cells, bacteria, fungi, archaea, protozoa, viruses,
virion particles, synthetic and naturally-occurring microscopic
particles, and liposomes. In some embodiments, the target
introduced into the flow cell is live/native. In other embodiments,
the target introduced into the flow cell is fixed in any
solution.
[0116] In some embodiments, the target is a cell. In some
embodiments, the cell is a prokaryotic cell. In some embodiments,
the cell is a bacterial cell. non-limiting examples of bacteria
include Aspergillus, Brugia, Candida, Chlamydia, Coccidia,
Cryptococcus, Dirofilaria, Gonococcus, Histoplasma, Klebsiella,
Legionella, Leishmania, Meningococci, Mycobacterium, Mycoplasma,
Paramecium, Pertussis, Plasmodium, Pneumococcus, Pneumocystis,
Pseudomonas, Rickettsia, Salmonella, Shigella, Staphylococcus,
Streptococcus, Toxoplasma and Vibriocholerae. Exemplary species
include Neisseria gonorrhea, Mycobacterium tuberculosis, Candida
albicans, Candida tropicalis, Trichomonas vaginalis, Haemophilus
vaginalis, Group B Streptococcus sp., Microplasma hominis,
Hemophilus ducreyi, Granuloma inguinale, Lymphopathia venereum,
Treponema pallidum, Brucella abortus. Brucella melitensis, Brucella
suis, Brucella canis, Campylobacter fetus, Campylobacter fetus
intestinalis, Leptospira pomona, Listeria monocytogenes, Brucella
ovis, Chlamydia psittaci, Trichomonas foetus, Toxoplasma gondii,
Escherichia coli, Actinobacillus equuli, Salmonella abortus ovis,
Salmonella abortus equi, Pseudomonas aeruginosa, Corynebacterium
equi, Corynebacterium pyogenes, Actinobaccilus seminis, Mycoplasma
bovigenitalium, Aspergillus fumigatus, Absidia ramosa, Trypanosoma
equiperdum, Babesia caballi, Clostridium tetani, and Clostridium
botulinum. In some embodiments, the cell is a eukaryotic cell. In
some embodiments, the cell is an animal cell (e.g., a mammalian
cell). In some embodiments, the cell is a human cell. In some
embodiments, the cell is from a non-human animal, such as a mouse,
rat, rabbit, pig, bovine (e.g., cow, bull, buffalo), deer, sheep,
goat, llama, chicken, cat, dog, ferret, or primate (e.g., marmoset,
rhesus monkey). In some embodiments, the cell is a parasite cell
(e.g., a malaria cell, a leishmanias cell, a cryptosporidium cell
or an amoeba cell). In some embodiments, the cell is a fungal cell,
such as, e.g., Paracoccidioides brasiliensis.
[0117] In some embodiments, the cell is a cancer cell (e.g., a
human cancer cell). In some embodiments, the cell is from any
cancerous or pre-cancerous tumor. Non-limiting examples of cancer
cells include cancer cells from the bladder, blood, bone, bone
marrow, brain, breast, colon, esophagus, gastrointestine, gum,
head, kidney, liver, lung, nasopharynx, neck, ovary, prostate,
skin, stomach, testis, tongue, or uterus. In addition, the cancer
may specifically be of the following histological type, though it
is not limited to these: neoplasm, malignant, carcinoma, carcinoma,
undifferentiated, giant and spindle cell carcinoma, small cell
carcinoma, papillary carcinoma, squamous cell carcinoma,
lymphoepithelial carcinoma, basal cell carcinoma, pilomatrix
carcinoma, transitional cell carcinoma, papillary transitional cell
carcinoma, adenocarcinoma, gastrinoma, malignant,
cholangiocarcinoma, hepatocellular carcinoma, combined
hepatocellular carcinoma and cholangiocarcinoma, trabecular
adenocarcinoma, adenoid cystic carcinoma, adenocarcinoma in
adenomatous polyp, adenocarcinoma, familial polyposis coli, solid
carcinoma, carcinoid tumor, malignant, branchiolo-alveolar
adenocarcinoma, papillary adenocarcinoma, chromophobe carcinoma,
acidophil carcinoma, oxyphilic adenocarcinoma, basophil carcinoma,
clear cell adenocarcinoma, granular cell carcinoma, follicular
adenocarcinoma, papillary and follicular adenocarcinoma,
nonencapsulating sclerosing carcinoma, adrenal cortical carcinoma,
endometroid carcinoma, skin appendage carcinoma, apocrine
adenocarcinoma, sebaceous adenocarcinoma, ceruminous
adenocarcinoma, mucoepidermoid carcinoma, cystadenocarcinoma,
papillary cystadenocarcinoma, papillary serous cystadenocarcinoma,
mucinous cystadenocarcinoma, mucinous adenocarcinoma, signet ring
cell carcinoma, infiltrating duct carcinoma, medullary carcinoma,
lobular carcinoma, inflammatory carcinoma, paget's disease,
mammary, acinar cell carcinoma, adenosquamous carcinoma,
adenocarcinoma w/squamous metaplasia, thymoma, malignant, ovarian
stromal tumor, malignant, thecoma, malignant, granulosa cell tumor,
malignant, and roblastoma, malignant, sertoli cell carcinoma,
leydig cell tumor, malignant, lipid cell tumor, malignant,
paraganglioma, malignant, extra-mammary paraganglioma, malignant,
pheochromocytoma, glomangiosarcoma, malignant melanoma, amelanotic
melanoma, superficial spreading melanoma, malig melanoma in giant
pigmented nevus, epithelioid cell melanoma, blue nevus, malignant,
sarcoma, fibrosarcoma, fibrous histiocytoma, malignant,
myxosarcoma, liposarcoma, leiomyosarcoma, rhabdomyosarcoma,
embryonal rhabdomyosarcoma, alveolar rhabdomyosarcoma, stromal
sarcoma, mixed tumor, malignant, mullerian mixed tumor,
nephroblastoma, hepatoblastoma, carcinosarcoma, mesenchymoma,
malignant, brenner tumor, malignant, phyllodes tumor, malignant,
synovial sarcoma, mesothelioma, malignant, dysgerminoma, embryonal
carcinoma, teratoma, malignant, struma ovarii, malignant,
choriocarcinoma, mesonephroma, malignant, hemangiosarcoma,
hemangioendothelioma, malignant, kaposi's sarcoma,
hemangiopericytoma, malignant, lymphangiosarcoma, osteosarcoma,
juxtacortical osteosarcoma, chondrosarcoma, chondroblastoma,
malignant, mesenchymal chondrosarcoma, giant cell tumor of bone,
ewing's sarcoma, odontogenic tumor, malignant, ameloblastic
odontosarcoma, ameloblastoma, malignant, ameloblastic fibrosarcoma,
pinealoma, malignant, chordoma, glioma, malignant, ependymoma,
astrocytoma, protoplasmic astrocytoma, fibrillary astrocytoma,
astroblastoma, glioblastoma, oligodendroglioma,
oligodendroblastoma, primitive neuroectodermal, cerebellar sarcoma,
ganglioneuroblastoma, neuroblastoma, retinoblastoma, olfactory
neurogenic tumor, meningioma, malignant, neurofibrosarcoma,
neurilemmoma, malignant, granular cell tumor, malignant, malignant
lymphoma, Hodgkin's disease, Hodgkin's lymphoma, paragranuloma,
malignant lymphoma, small lymphocytic, malignant lymphoma, large
cell, diffuse, malignant lymphoma, follicular, mycosis fungoides,
other specified non-Hodgkin's lymphomas, malignant histiocytosis,
multiple myeloma, mast cell sarcoma, immunoproliferative small
intestinal disease, leukemia, lymphoid leukemia, plasma cell
leukemia, erythroleukemia, lymphosarcoma cell leukemia, myeloid
leukemia, basophilic leukemia, eosinophilic leukemia, monocytic
leukemia, mast cell leukemia, megakaryoblastic leukemia, myeloid
sarcoma, and hairy cell leukemia.
[0118] In some embodiments, the target is a virus. For example, in
some embodiments, the virus is HIV, hepatitis A, hepatitis B,
hepatitis C, herpes virus (e.g., HSV-1, HSV-2, CMV, HAV-6, VZV,
Epstein Barr virus), adenovirus, influenza virus, flavivirus,
echovirus, rhinovirus, coxsackie virus, coronavirus, respiratory
syncytial virus, mumps virus, rotavirus, measles virus, rubella
virus, parvovirus, vaccinia virus, HTLV, dengue virus,
papillomavirus, molluscum virus, poliovirus, rabies virus, JC
virus, or ebola virus
[0119] In some embodiments, the target is a protein. In certain
embodiments, when protein targets are screened they are immobilized
on a bead (e.g., a detectably labeled bead). In some embodiments,
protein targets are linked to a detectable moiety. Non-limiting
examples of target proteins include glycoprotein IIb/IIIa,
TNF-.alpha., TNF.alpha. receptor, CD52, IL-2R.alpha., B cell
activating factor, VEGF, CD30, IL-1.beta., epidermal growth factor
receptor, CD38, RANK ligand, Complement protein C5, CD11a, CD20,
CTLA4, PD-1, PD-L1, PD-L2, CD3, alpha-4 integrin, IgE, RSV F
protein, IL-6R, ErbB2, IL-12, and IL-23. In some embodiments, the
target protein is a cancer-associated antigen. Examples of
cancer-associated antigens include, but are not limited to,
adipophilin, AIM-2, ALDH1A1, alpha-actinin-4, alpha-fetoprotein
("AFP"), ALK, ANKRD30A, ARTC1, B-RAF, BAGE-1, BCLX (L), BCR-ABL
fusion protein b3a2, beta-catenin, BING-4, BIRC7, CA-125, CA9,
CALCA, carcinoembryonic antigen ("CEA"), CALR, CASP-5, CASP-8,
CCR5, CD19, CD20, CD22, CD27, CD274, CD30, CD33, CD38, CD40, CD44,
CD45, CD52, CD56, CD79, Cdc27, CDK12, CDK4, CDKN2A, CEA, CLEC12A,
CLPP, COA-1, CPSF, CSNK1A1, CTAG1, CTAG2, cyclin D1, Cyclin-A1,
dek-can fusion protein, DKK1, EFTUD2, EGFR, EGFR variant III,
Elongation factor 2, ENAH (hMena), Ep-CAM, EpCAM, EphA2, EphA3,
epithelial tumor antigen ("ETA"), ERBB3, ERBB4, ETV6-AML1 fusion
protein, EZH2, FCRL3, FGFS, FLT3-ITD, FN1, FOLR1, G250/MN/CAIX,
GAGE-1,2,8, GAGE-3,4,5,6,7, GAS7, glypican-3, GnTV, gp100/Pme117,
GPNMB, GM3, GPR112, IL3RA, HAUS3, Hepsin, HER-2/neu, HERV-K-MEL,
HLA-A11, HLA-A2, HLA-DOB, hsp70-2, IDO1, IGF2B3, IL13Ralpha2,
Intestinal carboxyl esterase, K-ras, Kallikrein 4, KIF20A, KIT,
KK-LC-1, KKLC1, KM-HN-1, KMHN1 also known as CCDC110, KRAS, LAGE-1,
LDLR-fucosyltransferaseAS fusion protein, Lengsin, LGR5, LMP2,
M-CSF, MAGE-A1, MAGE-A10, MAGE-A12, MAGE-A2, MAGE-A3, MAGE-A4,
MAGE-A6, MAGE-A9, MAGE-C1, MAGE-C2, malic enzyme, mammaglobin-A,
MART2, MATN, MC1R, MCSP, mdm-2, ME1, Melan-A/MART-1, Meloe,
Midkine, MMP-2, MMP-7, MUC1, MUC2, MUC3, MUC4, MUC5, MUC5AC, MUC16,
mucin, MUM-1, MUM-2, MUM-3, Myosin, Myosin class I, N-raw, NA88-A,
neo-PAP, NFYC, NY-BR-1, NY-ESO-1/LAGE-2, OA1, OGT, OS-9, OX40, P
polypeptide, p53, PAP, PAX3, PAX5, PBF, PLAC1, PMEL, pml-RARalpha
fusion protein, polymorphic epithelial mucin ("PEM"), PPP1R3B,
PRAME, PRDX5, PRLR, PSA, PSMA, PTPRK, RAB38/NY-MEL-1, RAGE-1,
RBAF600, RET, RGS5, RhoC, RNF43, ROR1, RU2AS, SAGE, SART1, SART3,
secernin 1, SIRT2, SLAMF7, SLC39A6, SNRPD1, SOX10, Sp17, SPA17,
SSX-2, SSX-4, STEAP1, STEAP2, survivin, SYT-SSX1 or -SSX2 fusion
protein, TAG-1, TAG-2, Telomerase, TERT, TGF-betaRII,
Thompson-nouvelle antigen, TMPRSS2, TNFRSF17, TPBG, TRAG-3,
Triosephosphate isomerase, TRP-1/gp75, TRP-2, TRP2-INT2,
tyrosinase, tyrosinase ("TYR"), UPK3A, VEGF, VTCN1, WT1, and
XAGE-1b/GAGED2a. In some embodiments, the target protein is a
neo-antigen.
[0120] In some embodiments, the property of the cell that is
modulated is cell viability, cell proliferation, gene expression,
cellular morphology, cellular activation, phosphorylation, calcium
mobilization, degranulation, cellular migration, and/or cellular
differentiation. In certain embodiments, the target is linked to,
bound by or comprises a detectable label that allows for the
detection of a biological or chemical effect on the target. In some
embodiments, the detectable label is a fluorescent dye.
Non-limiting examples of fluorescent dyes include, but are not
limited to, a calcium sensitive dye, a cell tracer dye, a
lipophilic dye, a cell proliferation dye, a cell cycle dye, a
metabolite sensitive dye, a pH sensitive dye, a membrane potential
sensitive dye, a mitochondrial membrane potential sensitive dye,
and a redox potential dye. In one embodiment, the target is labeled
with a calcium sensitive dye, a cell tracer dye, a lipophilic dye,
a cell proliferation dye, a cell cycle dye, a metabolite sensitive
dye, a pH sensitive dye, a membrane potential sensitive dye, a
mitochondrial membrane potential sensitive dye, or a redox
potential dye.
[0121] In certain embodiments, the target is labeled with an
activation associated marker, an oxidative stress reporter, an
angiogenesis marker, an apoptosis marker, an autophagy marker, a
cell viability marker, or a marker for ion concentrations. In yet
another embodiment, the target is labeled with an activation
associated marker, an oxidative stress reporter, an angiogenesis
marker, an apoptosis marker, an autophagy marker, a cell viability
marker, or a marker for ion concentrations prior to exposure of
aptamers to the target.
[0122] In some embodiments, the target is labeled after to exposure
of aptamers to the target. In one embodiment, the target is labeled
with fluorescently-labeled antibodies, annexin V, antibody
fragments and artificial antibody-based constructs, fusion
proteins, sugars, or lectins. In another embodiment, the target is
labeled with fluorescently-labeled antibodies, annexin V, antibody
fragments and artificial antibody-based constructs, fusion
proteins, sugars, or lectins after exposure of aptamers to the
target.
[0123] In some embodiments, the target cell is labeled with a
fluorescent dye. Non-limiting examples of fluorescent dyes include,
but are not limited to, a calcium sensitive dye, a cell tracer dye,
a lipophilic dye, a cell proliferation dye, a cell cycle dye, a
metabolite sensitive dye, a pH sensitive dye, a membrane potential
sensitive dye, a mitochondrial membrane potential sensitive dye,
and a redox potential dye.
[0124] In some embodiments, the target cell is labeled with a
calcium sensitive dye, a cell tracer dye, a lipophilic dye, a cell
proliferation dye, a cell cycle dye, a metabolite sensitive dye, a
pH sensitive dye, a membrane potential sensitive dye, a
mitochondrial membrane potential sensitive dye, or a redox
potential dye. In certain embodiments, the target cell is labeled
with an activation associated marker, an oxidative stress reporter,
an angiogenesis marker, an apoptosis marker, an autophagy marker, a
cell viability marker, or a marker for ion concentrations. In yet
another embodiment, target cell is labeled with an activation
associated marker, an oxidative stress reporter, an angiogenesis
marker, an apoptosis marker, an autophagy marker, a cell viability
marker, or a marker for ion concentrations prior to exposure of
aptamers to the cell. In some embodiments, the target cell is
labeled after to exposure of aptamers to the target. In one
embodiment, the target cell is labeled with a fluorescently-labeled
antibody or antigen-binding fragment thereof, annexin V, a
fluorescently-labeled fusion protein, a fluorescently-labeled
sugar, or fluorescently labeled lectin. In one embodiment, the
target cell is labeled with a fluorescently-labeled antibody or
antigen-binding fragment thereof, annexin V, a
fluorescently-labeled fusion protein, a fluorescently-labeled
sugar, or fluorescently labeled lectin after exposure of aptamers
to the cell.
[0125] The position of the detectable marker on the surface can be
determined using any method known in the art, including, for
example, fluorescent microscopy.
[0126] FIG. 1 provides an exemplary workflow illustrating certain
embodiments of the methods provided herein. The workflow begins
with an initial aptamer library (e.g., an aptamer library provided
herein) chosen and prepared as though for Illumina sequencing. The
library can be, for example, newly synthesized, or an output of a
previous selection process. This process can involve one or more
positive selection cycles, one or more negative selection cycles,
or both, in either combination and sequence.
[0127] The prepared library is mounted on adapters on an Illumina
flow cell. Bridge PCR amplification turns each single sequence from
the initial library into a cluster of about 100,000 copies of the
same sequence. The library is then Illumina-sequenced. This process
produces a map linking each sequence from the library to a specific
set of coordinates on the flow cell surface.
[0128] The complementary strands to those from the library, added
in the process of sequencing by synthesis, are stripped by any one
of a number of methods (e.g., detergents, denaturing agents, etc.).
The oligonucleotide strands complementary to the Illumina adapter
and to the PCR primers are then pumped into the flow cell, leaving
only the aptamer region single-stranded. When RNA aptamers are
being synthesized as part of the library, transcription is
initiated and halted by any one of a number of methods (e.g.,
Ter-bound Tus protein, or biotin-bound streptavidin protein).
[0129] The flow cell temperature is raised and then cooled, in
order to allow all oligonucleotides on the surface to assume their
proper 3D structure, folding according to a folding protocol. In
this state, the oligo library is folded and ready to engage
targets.
[0130] The solution comprising the targets is run into the flow
cell using the instrument's hardware. The targets can be labeled
prior to introduction into the flow cell/instrument with a
fluorescent dye, for the purpose of reporting a biological or
chemical effect on the target. The targets are incubated for a
certain amount of time to allow the effect to take place.
Fluorescent dyes or markers for reporting the biological or
chemical effect (e.g., cell activation, apoptosis, etc.) can then
be pumped into the flow cell. (See FIG. 1)
[0131] Affected targets (hits) are recognized by image analysis,
and corresponding sequences are analyzed. Extracted sequences are
synthesized and tested separately for binding and function.
EXAMPLES
Example 1--Preparation of Aptamer Library
[0132] Aptamer libraries were prepared using an Illumina high
throughput sequencing platform sample preparation kits which
included the attachment of an adapter DNA sequence on the flanks of
the sample sequence to complement strands already attached to the
surface of the flow cell. The prepared library was mounted onto
adapters on the surface of an Illumina flow cell.
[0133] For the preparation of the aptamer libraries, a two-step
"tail" PCR process was used to attach the adapters. The PCR
reaction mix contained the following components shown in Table
1:
TABLE-US-00001 TABLE 1 Component Amount in .mu.l Herculase II
fusion DNA polymerase 0.5 buffer 10 Dntp (10 mM each) 1.25 Forward
tail primer 1 Reverse tail primer 1 upw 35.25 sample 1
[0134] The primers were set in a way that adapters would have a
specific orientation with respect to the sample sequence. This was
done to hold the forward aptamer sequence in the clusters in a
single read run.
The sequence of the primers used in 1st PCR reaction:
TABLE-US-00002 TruSeq p7 side stab forward primer [SEQ ID NO: 1]
GTCACATCTCGTATGCCG TCTTCTGCTTG ATCCAGAGTGACGCAGCA; and TruSeq p5
side stab reverse primer [SEQ ID NO: 2] CTCTTTCCCTACACGACG
CTCTTCCGATCT ACTAAGCCACCGTGTCCA
[0135] The PCR program used for the first reaction is shown herein
below in Table 2:
TABLE-US-00003 TABLE 2 Step Temperature Time (seconds) 1 95 180 2
95 30 3 56 10 4 72 10 5 Return to step 2 .times. 3 6 95 30 7 85 10
8 72 10 9 Return to step 6 .times. 10 10 4 Forever
[0136] The product of first PCR reaction (PCR 1) is the input for
the 2nd PCR reaction.
[0137] The sequence of the primers used in the 2nd PCR
reaction:
TABLE-US-00004 TruSeq p7 side start [SEQ ID NO: 3]
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC ATCTCGTATGCCG; and TruSeq p5 side
start [SEQ ID NO: 4] AATGATACGGCGACCACCGAGATCTACACACAC
TCTTTCCCTACACGACG.
[0138] The PCR program used for the second reaction is shown herein
below in Table 3:
TABLE-US-00005 TABLE 3 Step Temperature time 1 95 30 2 67 10 3 72
10 4 95 30 5 65 10 6 72 10 7 95 30 8 63 10 9 72 10 10 95 30 11 62
10 12 72 10 13 95 30 14 87 10 15 72 10 16 Return to step 13 .times.
1 17 95 30 18 85 10 19 72 10 20 Return to step 17 .times. 7 21 4
Forever
[0139] Completed libraries underwent quality control which included
qbit check for concentration and tapstation/fragment analyzer to
check for library size and byproducts. Cluster generation and
sequencing was carried out according to the sequencing platform and
Illumina protocols. After the sequencing process, denaturation
provides the clusters in a single strand form. Adapters and primers
are then blocked and aptamers will fold to their 3d conformation in
their folding buffer.
Generation and Sequencing of Clusters
[0140] Bridge PCR amplification was used to turn each single
sequence from the initial library into a cluster of about 100,000
copies of the same sequence. The cluster library was then
Illumina-sequenced. This process produced a map linking each
sequence from the library to a specific set of coordinates on the
flow cell surface.
[0141] The complementary strands to those from the library, added
in the process of sequencing by synthesis, were stripped and
oligonucleotide strands complementary to the Illumina adapter and
to the PCR primers were pumped to the flow cell, leaving only the
aptamer region single-stranded. In case of RNA aptamers,
transcription was initiated and halted by any one of a number of
methods (e.g., Ter-bound Tus protein, or biotin-bound streptavidin
protein).
[0142] The flow cell temperature was raised and then cooled, to
allow all oligonucleotides on the surface of the flow cell to
assume their proper 3D conformation in the appropriate folding
buffer. For example, one folding buffer recipe used (cellselex
paper) included 1 liter PBS, 5 ml of 1M MgCl.sub.2, and 4.5 g
glucose
Target Introduction
[0143] Target (e.g., cells, bacteria, particles, viruses, proteins,
etc.) were introduced into the system in the desired binding buffer
according to the environment they would be used in (e.g., human
serum, PBS, lb) using the machine's hardware. One option for a
general binding buffer recipe is (cellselsex paper): 1 liter PBS, 5
ml 1M MgCl.sub.2, 4.5 g glucose, 100 mg tRNA, and 1 g BSA. Targets
were labeled prior to or after introduction into the flow
cell/machine and incubated for a certain amount of time to let
effect take place.
[0144] Targets can be labeled using different fluorophore that will
fit the platforms excitation source and emission filters. Labeling
can be done through any possible docking site available on the
target. Examples of labeling agents include, but are not limited
to, DiI, anti HLA+secondery Dylight 650, anti HLA PE-Cy5, and
Dylight 650.
[0145] For the screening of functional aptamers, fluorescent
reporters can be used to visualize the effect. For example,
introduction of 7AAD to the flow cell can be used to label the
targets to screen for cell death, or annexin V fluorophore
conjugate can be used to label the targets to screen for apoptosis.
The reporter agent, its concentration, time of incubation and
specific recipe protocol should be adjusted in accordance with the
specific effect screening for.
[0146] Representative method for sequencing initial library
followed by target cell introduction and acquisition of functional
oligonucleotide clusters 80 .mu.l of "Incorporation Mix Buffer" is
pumped into the flow cell at a rate of 250 .mu.l/min. The
temperature is then set temperature to 55.degree. C. 60 .mu.l of
"Incorporation Mix" is pumped to the flow cell at a rate of 250
.mu.l/min and after 80 seconds 10 .mu.l of "Incorporation Mix" is
pumped to the flow cell at a rate of 250 .mu.l/min. After 211
seconds, the temperature is set to 22.degree. C. and 60 .mu.l of
"Incorporation Mix Buffer" is pumped to the flow cell at a rate of
250 .mu.l/min. 75 .mu.l of "Scan Mix" is then pumped into to the
flow cell at a rate of 250 .mu.l/min.
[0147] The method then calibrates to focus to the plane of the
clusters and align microscope and flow cell planes. 100 .mu.l of
"Incorporation Mix Buffer" is pumped into to the flow cell at a
rate of 250 .mu.l/min. The incorporation steps above are repeated
99 times.
[0148] The temperature control is turned off and 125 .mu.l of
"Cleavage Buffer" is pumped into the flow cell at a rate of 250
.mu.l/min. The temperature is then set to 55.degree. C. and 75
.mu.l of "Cleavage Mix" pumped into the to the flow cell at a rate
of 250 .mu.l/min. After 80 seconds, 25 .mu.l of "Cleavage Mix" is
pumped into the flow cell at a rate of 250 .mu.l/min.
After an addition 80 seconds, 25 .mu.l of "Cleavage Mix" is pumped
into the flow cell at a rate of 250 .mu.l/min. After 80 seconds,
the temperature is set to 22.degree. C. The temperature control is
then turned off and 60 .mu.l of "Incorporation Mix Buffer" is
pumped into the flow cell at a rate of 250 .mu.l/min. The volume
remaining in each water tube is then checked to verify proper
delivery.
[0149] Denaturation then takes place followed by capping. For the
denaturation steps, the temperature is then set to 20.degree. C.
for 120 seconds. 75 .mu.l of "Wash Buffer" is pumped into the flow
cell at a rate of 60 .mu.l/min, followed by 75 .mu.l of
"Denaturation Solution" at a rate of 60 .mu.l/min and 75 .mu.l of
"Wash Buffer" at a rate of 60 .mu.l/min.
[0150] For the capping steps, 75 .mu.l of "Wash Buffer" is pumped
into the flow cell at a rate of 60 .mu.l/min and the temperature is
set to 85.degree. C. for 120 seconds. 80 .mu.l of "5' Cap" is then
pumped into the flow cell at a rate of 80 .mu.l/min and the
temperature is set to 85.degree. C. for 30 seconds. 10 .mu.l of "5'
Cap" is pumped into the flow cell at a rate of 13 .mu.l/min and the
temperature is set to 85.degree. C. for 60 seconds. 10 .mu.l of "5'
Cap" is pumped into the flow cell at a rate of 13 .mu.l/min and the
temperature is set to 85.degree. C. for 90 seconds. 10 .mu.l of "5'
Cap" is pumped into to the flow cell at a rate of 13 .mu.l/min and
the temperature is set to 85.degree. C. for 120 seconds. 10 .mu.l
of "5' Cap" is pumped into the flow cell at a rate of 13 .mu.l/min
and the temperature is set to 85.degree. C. for 150 seconds. 10
.mu.l of "5' Cap" is pumped into the flow cell at a rate of 13
.mu.l/min and the temperature is set to 85.degree. C. for 180
seconds. 10 .mu.l of "5' Cap" is pumped into the flow cell at a
rate of 13 .mu.l/min and the temperature is set to 85.degree. C.
for 210 seconds. 10 .mu.l of "5' Cap" is pumped into the flow cell
at a rate of 13 .mu.l/min and the temperature is set to 85.degree.
C. for 240 seconds. 10 .mu.l of "5' Cap" is pumped into the flow
cell at a rate of 13 .mu.l/min and the temperature is set to
85.degree. C. for 270 seconds. 75 .mu.l of "Wash Buffer" is pumped
into the flow cell at a rate of 60 .mu.l/min and the temperature is
set to 85.degree. C. for 120 seconds.
[0151] For the 3' Cap, 80 .mu.l of "3' Cap" is pumped into the flow
cell at a rate of 80 .mu.l/min and the temperature is set to
85.degree. C. for 30 seconds. 10 .mu.l of "3' Cap" is pumped into
the flow cell at a rate of 13 .mu.l/min and the temperature is set
to 85.degree. C. for 60 seconds. 10 .mu.l of "3' Cap" is pumped
into the flow cell at a rate of 13 .mu.l/min and the temperature is
set to 85.degree. C. for 90 seconds. 10 .mu.l of "3' Cap" is pumped
into the flow cell at a rate of 13 .mu.l/min and the temperature is
set to 85.degree. C. for 120 seconds. 10 .mu.l of "3' Cap" is
pumped into the flow cell at a rate of 13 .mu.l/min and the
temperature is set to 85.degree. C. for 150 seconds. 10 .mu.l of
"3' Cap" is pumped into the flow cell at a rate of 13 .mu.l/min and
the temperature is set to 85.degree. C. for 180 seconds. 10 .mu.l
of "3' Cap" is pumped into the flow cell at a rate of 13 .mu.l/min
and the temperature is set to 85.degree. C. for 210 seconds. 10
.mu.l of "3' Cap" is pumped into the flow cell at a rate of 13
.mu.l/min and the temperature is set to 85.degree. C. for 240
seconds.
[0152] 10 .mu.l of "3' Cap" is pumped into the flow cell at a rate
of 13 .mu.l/min and the temperature is set to 85.degree. C. for 270
seconds. 75 .mu.l of "Wash Buffer" is pumped into the flow cell at
a rate of 60 .mu.l/min and the temperature is set to 0.degree. C.
200 .mu.l of "Folding Buffer (chilled)" is pumped into the flow
cell at a rate of 250 .mu.l/min followed by 160 .mu.l of "Folding
Buffer (chilled)" at a rate of 40 .mu.l/min and the temperature is
set to 0.degree. C. for 600 seconds.
[0153] The temperature is raised to 37.degree. C. for 120 seconds.
This is followed by a binding step.
[0154] For the binding step, 80 .mu.l of "Binding Buffer" is pumped
into the flow cell at a rate of 250 .mu.l/min and the temperature
is set to 37.degree. C. 80 .mu.l of "Target #1" is pumped into the
flow cell at a rate of 100 .mu.l/min and the temperature is set to
37.degree. C. for 300 seconds. 10 .mu.l of "Target #1" is again
pumped into the flow cell at a rate of 13 .mu.l/min and the
temperature is set to 37.degree. C. for 300 seconds. Lastly, 10
.mu.l of "Target #1" is pumped into to the flow cell at a rate of
13 .mu.l/min and the temperature is set to 37.degree. C. for 2700
seconds.
[0155] This is followed by a three consecutive incorporation steps
and wash steps to remove unbound target consisting of
incorporation, pumping 80 .mu.l of "Binding Buffer" into the flow
cell at a rate of 13 .mu.l/min, incorporation, pumping 80 .mu.l of
"Binding Buffer" into the flow cell at a rate of 80 .mu.l/min,
incorporation, pumping 80 .mu.l of "Binding Buffer" into the flow
cell at a rate of 200 .mu.l/min and incorporation.
[0156] The denaturing, capping, binding, incorporation and washing
steps above are repeated until sequencing and target introduction
is complete. Various targets are then added and binding to and/or
activity of the aptamers is evaluated.
[0157] FIG. 3 shows a time lapse image of the movement of a Hana
cell bound to the flow cell. The results demonstrate that the cell
is actually bound by the sequences attached to the surface itself,
rather than the surface itself, and is thus free to move but
confined to that location.
Example 2--Functional Aptamer Identification
[0158] An embodiment of the method provided herein was used to
identify aptamers that induce apoptosis in freshly isolated (12 hr)
human triple negative breast cancer cells. An aptamer library as
described herein was immobilized on a flow cell and bridge
[0159] PCR was performed in an Illumina instrument to generate a
clustered library. During the amplification process the clustered
library was sequenced according to the Illumina protocol with the
exception that PBS was used in place of bleaching reagent at the
end of the sequencing process so that the flow cell was not
destroyed following sequencing. The known probes made up 0.1-1% of
the library so that the resulting sequencing map could be aligned
to later generated fluorescent microscope images.
[0160] After the final PBS wash, the flow cell was loaded onto a
fluorescent microscope with temperature control, and clusters were
imaged at phase to view clusters and in the green fluorescence
channel to view the apoptosis indicator. The coordinates of the
known probe sequences were used to align the microscope-generated
image with the sequence cluster map generated during the sequencing
process by the sequencer.
[0161] Freshly isolated human breast cancer cells from bone marrow
aspirate were prepared at 10.sup.6 cells/mL concentration to
achieve an average cell density of .about.1 per 100 micron.sup.2 on
the flow cell chamber floor in PBS containing 1% albumin and 1 mM
Mg.sup.2+. Target cells were loaded with a green fluorescent
caspase 3/7 activity reporter dye as per the manufacturer's
instructions and washed. Cells were pumped into the flow cell using
a syringe pump.
[0162] The flow cell was imaged at t=0 in Phase and Green channel
and then incubated at 37 degrees and imaged again at 30 minute
intervals. Aptamer-induced apoptosis was detected by green
fluorescence when the target cell was engaged by a functional
aptamer. Cells were washed with the same buffer under increasing
pump pressure and further imaged to identify functional aptamers
that had a higher affinity for the target cells.
[0163] The clustered aptamer library analysis was repeated using
peripheral blood mononuclear cells as a counter-target in a
different lane of the flow-cell using the same sequenced library to
identify target-specific aptamer sequences. Computational analysis
was performed to translate coordinates at which target or
counter-target cells bound to aptamer clusters and underwent
apoptosis to identify aptamer sequences that preferentially
mediated apoptotic function in the target cells versus the
counter-target cells. More than 1,000 aptamers capable of
specifically mediating target-selective apoptosis on tumor cells
from the specific donor were successfully identified from the
library.
Example 3--Functional Aptamer Identification in an Illumina
Sequencer
[0164] An embodiment of the method provided herein is used to
identify aptamers that induce apoptosis in freshly isolated (12 hr)
human tumor cells.
[0165] An aptamer library as described herein is immobilized on a
flow cell and bridge PCR was performed in an Illumina instrument to
generate a clustered library. During the amplification process the
clustered library is sequenced according to the Illumina protocol
with the exception that PBS was used in place of bleaching reagent
at the end of the sequencing process so that the flow cell is not
destroyed following sequencing.
[0166] After the final PBS wash, the clusters are imaged in the
Illumina Instrument in the green fluorescence channel to view the
apoptosis indicator. Freshly isolated human breast cancer cells
from bone marrow aspirate are prepared at 10.sup.6 cells/mL
concentration to achieve an average cell density of .about.1 per
100 micron.sup.2 on the flow cell chamber floor in PBS containing
1% albumin and 1 mM Mg.sup.2+. Target cells are loaded with a green
fluorescent caspase 3/7 activity reporter dye as per the
manufacturer's instructions and washed. Cells are pumped into the
flow cell using the Illumina instrument.
[0167] An additional sequencing cycle is run during which the flow
cell is imaged. The position of target cells within the flow cell
is determined based on the presence of a cell-specific fluorescent
signal. Aptamer-induced apoptosis is detected by the appearance of
fluorescent signal at flow cell coordinates associated with one or
more aptamer clusters. Cells appear to the sequencer as "spots" of
several clusters. Target cells undergoing apoptosis are identified
based the fluorescence emission of the activity reporter dye.
[0168] The clustered aptamer library analysis is repeated using
non-tumor cells as a counter-target in a different lane of the
flow-cell using the same sequenced library to identify
target-specific aptamer sequences. Computational analysis is
performed to translate coordinates at which target or
counter-target cells bound to aptamer clusters and underwent
apoptosis to identify aptamer sequences that preferentially
mediated apoptotic function in the target cells versus the
counter-target cells. Aptamers capable of specifically mediating
target-selective apoptosis on tumor cells from the specific donor
are identified from the library.
INCORPORATION BY REFERENCE
[0169] All publications, patents, and patent applications mentioned
herein are hereby incorporated by reference in their entirety as if
each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by
reference. In case of conflict, the present application, including
any definitions herein, will control.
EQUIVALENTS
[0170] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
7147DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 1gtcacatctc gtatgccgtc ttctgcttga
tccagagtga cgcagca 47248DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 2ctctttccct acacgacgct cttccgatct actaagccac cgtgtcca
48346DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 3gatcggaaga gcacacgtct gaactccagt
cacatctcgt atgccg 46450DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 4aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg
50543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 5tagtatccta ggactctcga
gtcaatgcgc aacgtcgcac gag 43643DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 6tagtatccta tccaaggatt accaggagcc ccgttccctg acg
43743DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 7tagtatccta ctcactcgta
tggtcctacg gaaagatatc tgg 43
* * * * *