U.S. patent application number 17/057852 was filed with the patent office on 2021-06-24 for amphiregulin gene-specific double-stranded oligonucleotide and composition for preventing and treating fibrosis-related diseases and respiratory diseases, comprising same.
The applicant listed for this patent is BIONEER CORPORATION. Invention is credited to Seon Joo BAE, Tae-Rim KIM, Youngho KO, Han-Oh PARK, Jun-Hong PARK, Seung Seob SON, Pyoung Oh YOON, Sung-II YUN.
Application Number | 20210189398 17/057852 |
Document ID | / |
Family ID | 1000005434103 |
Filed Date | 2021-06-24 |
United States Patent
Application |
20210189398 |
Kind Code |
A1 |
KIM; Tae-Rim ; et
al. |
June 24, 2021 |
AMPHIREGULIN GENE-SPECIFIC DOUBLE-STRANDED OLIGONUCLEOTIDE AND
COMPOSITION FOR PREVENTING AND TREATING FIBROSIS-RELATED DISEASES
AND RESPIRATORY DISEASES, COMPRISING SAME
Abstract
The present invention relates to a double-stranded
oligonucleotide which can highly specifically and efficiently
inhibit an amphiregulin expression and, preferably, a
double-stranded oligonucleotide comprising a sequence in the form
of RNA/RNA, DNA/DNA or DNA/RNA hybrid, a double-stranded
oligonucleotide structure comprising the double-stranded
oligonucleotide, nanoparticles comprising the double-stranded
oligonucleotide structure, and a fibrosis or respiratory disease
preventive or therapeutic use thereof.
Inventors: |
KIM; Tae-Rim; (Daejeon,
KR) ; YOON; Pyoung Oh; (Daejeon, KR) ; KO;
Youngho; (Seoul, KR) ; BAE; Seon Joo;
(Chungcheongnam-do, KR) ; PARK; Han-Oh;
(Sejong-si, KR) ; SON; Seung Seob;
(Chungcheongnam-do, KR) ; PARK; Jun-Hong;
(Daejeon, KR) ; YUN; Sung-II; (Daejeon,
KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BIONEER CORPORATION |
Daejeon |
|
KR |
|
|
Family ID: |
1000005434103 |
Appl. No.: |
17/057852 |
Filed: |
May 22, 2019 |
PCT Filed: |
May 22, 2019 |
PCT NO: |
PCT/KR2019/006144 |
371 Date: |
November 23, 2020 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/322 20130101;
C12N 15/1136 20130101; C12N 2310/14 20130101; C12N 2310/351
20130101; A61P 11/00 20180101; C12N 2310/314 20130101; C12N
2310/3515 20130101; A61K 9/19 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 9/19 20060101 A61K009/19; A61P 11/00 20060101
A61P011/00 |
Foreign Application Data
Date |
Code |
Application Number |
May 25, 2018 |
KR |
10-2018-0059783 |
Claims
1. An amphiregulin-specific double-stranded oligonucleotide
comprising: a sense strand comprising any one sequence selected
from the group consisting of SEQ ID NOs: 10, 11 and 12; and an
antisense strand comprising a sequence complementary thereto.
2. The amphiregulin-specific double-stranded oligonucleotide of
claim 1, wherein the sense strand or the antisense strand consists
of 19 to 31 nucleotides.
3. The amphiregulin-specific double-stranded oligonucleotide of
claim 1, wherein the oligonucleotide is siRNA, shRNA or miRNA.
4. The amphiregulin-specific double-stranded oligonucleotide of
claim 1, wherein the sense or antisense strand is independently DNA
or RNA.
5. The amphiregulin-specific double-stranded oligonucleotide of
claim 1, wherein the sense strand or the antisense strand of the
double-stranded oligonucleotide comprises a chemical
modification.
6. The amphiregulin-specific double-stranded oligonucleotide of
claim 5, wherein the chemical modification is any one or more
selected from the group consisting of: modification in which a
hydroxyl (OH) group at the 2' carbon position of a sugar structure
in nucleotides is substituted with any one selected from the group
consisting of methyl (--CH.sub.3), methoxy (--OCH.sub.3), amine
(--NH.sub.2), fluorine (--F), --O-2-methoxyethyl, --O-propyl,
--O-2-methylthioethyl, --O-3-aminopropyl,
--O-3-dimethylaminopropyl, --O--N-methylacetamido and --O--
dimethylamidooxyethyl; modification in which oxygen in a sugar
structure in nucleotides is substituted with sulfur; modification
of a bond between nucleotides to any one bond selected from the
group consisting of a phosphorothioate bond, a boranophosphophate
bond and a methyl phosphonate bond; and modification to PNA
(peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked
nucleic acid).
7. The amphiregulin-specific double-stranded oligonucleotide of
claim 1, wherein one or more phosphate groups are bound to the 5'
end of the antisense strand of the double-stranded
oligonucleotide.
8. An amphiregulin-specific double-stranded oligonucleotide
structure comprising a structure represented by the following
Structural Formula 1: A-X--R--Y--B [Structural Formula (1)] wherein
A represents a hydrophilic compound, B represents a hydrophobic
compound, X and Y each independently represent a simple covalent
bond or a linker-mediated covalent bond, and R represents the
double-stranded oligonucleotide of claim 1.
9. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 8, wherein the oligonucleotide structure
comprises a structure represented by the following Structural
Formula (2): ##STR00008## wherein S and AS respectively represent
the sense strand and the antisense strand of the double-stranded
oligonucleotide of claim 8.
10. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 9, wherein oligonucleotide structure comprises a
structure represented by the following Structural Formula (3) or
(4): ##STR00009## wherein A, B, X, Y, S and AS are as defined in
claim 9, and 5' and 3' represent the 5' end and 3' end,
respectively, of the sense strand of the double-stranded
oligonucleotide.
11. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 8, wherein the hydrophilic compound is selected
from the group consisting of polyethylene glycol (PEG),
polyvinylpyrrolidone, and polyoxazoline
12. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 8, wherein the hydrophilic compound has a
structure represented by the following Structural Formula (5) or
(6): (A'.sub.m-J).sub.n [Structural Formula (5)] (J-A'.sub.m).sub.n
[Structural Formula (6)] wherein A' represents a hydrophilic
monomer, J represents a linker that connects a number (m) of
hydrophilic monomers together or connects a number (m) of
hydrophilic monomers with the double-stranded oligonucleotide, m is
an integer ranging from 1 to 15, n is an integer ranging from 1 to
10, the hydrophilic monomer (A') is any one compound selected from
among the following compound (1) to compound (3), and the linker
(J) is selected from the group consisting of --PO.sub.3.sup.---,
--SO.sub.3-- and --CO.sub.2--: ##STR00010## wherein G is selected
from the group consisting of O, S and NH; ##STR00011##
13. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 12, wherein the oligonucleotide structure has a
structure represented by the following Structural Formula (7) or
(8): (A'.sub.m-J).sub.n-X--R--Y--B [Structural Formula (7)]
(J-A'.sub.m).sub.n-X--R--Y--B [Structural Formula (8)]
14. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 8, wherein the hydrophilic compound has a
molecular weight of 200 to 10,000.
15. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 8, wherein the hydrophobic compound has a
molecular weight of 250 to 1,000.
16. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 15, wherein the hydrophobic compound is any one
selected from the group consisting of a steroid derivative, a
glyceride derivative, glycerol ether, polypropylene glycol, a
C.sub.12-C.sub.50 unsaturated or saturated hydrocarbon,
diacylphosphatidylcholine, a fatty acid, a phospholipid,
lipopolyamine, a lipid, tocopherol, and tocotrienol.
17. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 16, wherein the steroid derivative is any one
selected from the group consisting of cholesterol, cholestanol,
cholic acid, cholesteryl formate, cholestanyl formate, and
cholestanyl amine.
18. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 16, wherein the glyceride derivative is any one
selected from the group consisting of mono-glyceride, di-glyceride,
and tri-glyceride.
19. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 8, wherein the covalent bond represented by X
and Y is either a non-degradable bond or a degradable bond.
20. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 19, wherein the non-degradable bond is an amide
bond or a phosphate bond.
21. The amphiregulin-specific double-stranded oligonucleotide
structure of claim 19, wherein the degradable bond is any one
selected from the group consisting of a disulfide bond, an
acid-degradable bond, an ester bond, an anhydride bond, a
biodegradable bond, and an enzyme-degradable bond.
22. A nanoparticle comprising the double-stranded oligonucleotide
of claim 8.
23. The nanoparticle of claim 22, wherein the nanoparticle is
composed of a mixture of double-stranded oligonucleotide structures
comprising double-stranded oligonucleotide having different
sequence.
24. A method for preventing or treating fibrosis or respiratory
disease, comprising administering to a subject in need thereof, the
double-stranded oligonucleotide of claim 1, or an
amphiregulin-specific double-stranded oligonucleotide structure
comprising said double-stranded oligonucleotide, represented by the
following Structural Formula 1: A-X--R--Y--B [Structural Formula
(1)] wherein A represents a hydrophilic compound, B represents a
hydrophobic compound, X and Y each independently represent a simple
covalent bond or a linker-mediated covalent bond, and R represents
said double-stranded oligonucleotide.
25. A method for preventing or treating fibrosis or respiratory
disease, comprising administering the nanoparticle of claim 22 to a
subject in need thereof.
26. The method of claim 24, wherein the respiratory disease is any
one selected from the group consisting of chronic obstructive
disease (COPD), asthma, acute and chronic bronchitis, allergic
rhinitis, cough, sputum, bronchitis, bronchiolitis, sore throat,
tonsillitis, and laryngitis.
27. The method of claim 24, wherein the fibrosis is any one
selected from the group consisting of idiopathic pulmonary fibrosis
(IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial
fibrosis, renal fibrosis, pulmonary fibrosis, cardiac fibrosis, and
radiation-induced fibrosis.
28. The method of claim 25, wherein the respiratory disease is any
one selected from the group consisting of chronic obstructive
disease (COPD), asthma, acute and chronic bronchitis, allergic
rhinitis, cough, sputum, bronchitis, bronchiolitis, sore throat,
tonsillitis, and laryngitis.
29. The method pharmaceutical composition of claim 25, wherein the
fibrosis is any one selected from the group consisting of
idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis,
myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary
fibrosis, cardiac fibrosis, and radiation-induced fibrosis.
30. A lyophilized formulation comprising a pharmaceutical
composition for preventing or treating fibrosis or respiratory
disease, said pharmaceutical composition comprising the
double-stranded oligonucleotide of claim 1, or an
amphiregulin-specific double-stranded oligonucleotide structure
comprising said double-stranded oligonucleotide, represented by the
following Structural Formula 1: A-X--R--Y--B [Structural Formula
(1)] wherein A represents a hydrophilic compound, B represents a
hydrophobic compound, X and Y each independently represent a simple
covalent bond or a linker-mediated covalent bond, and R represents
said double-stranded oligonucleotide.
31. A lyophilized formulation comprising a pharmaceutical
composition for preventing or treating fibrosis or respiratory
disease, said pharmaceutical composition comprising the
nanoparticle of claim 22.
Description
TECHNICAL FIELD
[0001] The present invention relates to a double-stranded
oligonucleotide capable of very specifically inhibiting
amphiregulin expression with high efficiency, preferably a
double-stranded oligonucleotide comprising an RNA/RNA, DNA/DNA or
DNA/RNA hybrid sequence, a double-stranded oligonucleotide
structure comprising the double-stranded oligonucleotide,
nanoparticle comprising the double-stranded oligonucleotide
structure, and the use thereof in the prevention or treatment of
fibrosis or respiratory disease.
BACKGROUND ART
[0002] In 1995, Guo and Kemphues reported that not only sense RNA
but also antisense RNA is effective in inhibiting gene expression
in C. elegans, and since then, studies have been conducted to
identify the cause thereof. In 1998, Fire et al. first described
the phenomenon in which injection of double-stranded RNA (dsRNA)
inhibits gene expression by specifically degrading the mRNA
corresponding thereto. This phenomenon was named RNA interference
(RNAi). RNAi, a process that is used to inhibit gene expression,
may exhibit a distinct effect of inhibiting gene expression in a
simple manner at low cost, and thus the fields of application of
this technology have become more diverse.
[0003] Since this technology of inhibiting gene expression may
regulate the expression of a specific gene, it may remove a
specific gene related to cancer, genetic disease or the like at the
mRNA level, and may be used as an important tool for the
development of therapeutic agents for disease treatment and
validation of targets. As conventional techniques for inhibiting
target gene expression, techniques of introducing a transgene for a
target gene have been disclosed. These techniques include a method
of introducing a transgene in the antisense direction with respect
to the promoter and a method of introducing a transgene in the
antisense direction with respect to the promoter.
[0004] Such RNA therapy targeting RNA is a method of removing the
function of the gene of interest using oligonucleotides against the
target RNA, and can be considered different from conventional
methods in which therapeutic agents such as antibodies and small
molecules mainly target proteins. Approaches for targeting RNA are
roughly classified into two types: double-stranded-RNA mediated
RNAi, and a method using an antisense oligonucleotide (ASO).
Currently, clinical trials are being attempted by targeting RNA in
various diseases.
[0005] An antisense oligonucleotide (hereinafter referred to as
"ASO") is a short synthetic DNA designed to bind to a target gene
according to Watson-Crick base pairing, and may specifically
inhibit the expression of a specific nucleotide sequence of a gene.
Thus, the antisense oligonucleotide has been used to study the
roles of genes and to develop therapeutic agents capable of
treating diseases such as cancer at the molecular level. These ASOs
have the advantage of being able to be easily produced by setting
various targets for inhibiting gene expression, and studies have
been conducted on the use of ASOs in order to inhibit oncogene
expression and cancer cell growth. A process of inhibiting the
expression of a specific gene by the ASO is accomplished either by
binding the ASO to a complementary mRNA sequence to induce RNase H
activity and remove the mRNA or by interfering with the formation
and progression of a ribosome complex for protein translation. In
addition, it has been reported that the ASO binds to genomic DNA to
form a triple-helix structure, thus inhibiting gene transcription.
The ASO has potential as described above, but in order to use the
ASO in clinical practice, it is required that the stability of the
ASO against nucleases be improved and that the ASO be efficiently
delivered into a target tissue or cells so as to bind specifically
to the nucleotide sequence of a target gene. In addition, the
secondary and tertiary structures of genetic mRNA are important
factors for specific binding of the ASO, and a region in which
formation of the mRNA secondary structure decreases is very
advantageous for the ASO to access. Thus, efforts have been made to
effectively achieve gene-specific inhibition not only in vitro but
also in vivo by systematically analyzing a region in which
formation of the mRNA secondary structure decreases, prior to
synthesizing the ASO. These ASOs are more stable than siRNA, a kind
of RNA, and have the advantage of being readily soluble in water
and physiological saline. To date, three ASOs have been approved by
the Federal Drug Administration (FDA) (Jessica, C., J Postdoc Res.,
4:35-50, 2016).
[0006] Since the roles of RNA interference (hereinafter referred to
as "RNAi") were found, it has been found that RNAi acts on
sequence-specific mRNAs in various types of mammalian cells (Barik,
S., J Mol. Med. (2005) 83: 764-773). When a long chain of
double-stranded RNA is delivered into a cell, the delivered
double-stranded RNA is converted into a small interfering RNA
(hereinafter referred to as "siRNA") processed to 21 to 23 base
pairs (bp) by the Dicer endonuclease. The siRNA binds to an
RNA-induced silencing complex (RISC) and inhibits target gene
expression in a sequence-specific manner through a process in which
the guide (antisense) strand recognizes and degrades the target
mRNA. Technology of inhibiting gene expression using SiRNA is used
to inhibit target gene expression in target cells and to observe
the resulting change, and is effectively used in studies to
identify the function of a target gene in target cells. In
particular, inhibiting the function of a target gene in infectious
viruses or cancer cells may be effectively used to develop a
treatment method for the disease of interest. As a result of
conducting in vitro studies and in vivo studies using experimental
animals, it has been reported that it is possible to inhibit target
gene expression by siRNA.
[0007] Bertrand et al. reported that siRNA has a better inhibitory
effect on mRNA expression in vitro and in vivo than an antisense
oligonucleotide (ASO) for against the same target gene, and that
the effect is longer lasting. In addition, regarding the mechanism
of action, siRNA regulates target gene expression in a
sequence-specific manner by complementary binding to the target
mRNA. Thus, siRNA has an advantage over conventional antibody-based
drugs or chemical drugs (small-molecule drugs) in that the range of
subjects to which the siRNA is applicable can be dramatically
expanded (M. A. Behlke, MOLECULAR THERAPY. 2006 13(4):664-670).
[0008] siRNA has excellent effects, and may be used in a wide range
of applications, but in order for siRNA to be developed as a
therapeutic agent, the in vivo stability of siRNA and the cell
delivery efficiency thereof should be improved so that siRNA can be
effectively delivered to cells (F. Y. Xie, Drug Discov. Today. 2006
January; 11(1-2):67-73). In order to improve in vivo stability and
solve problems associated with non-specific innate immune
stimulation of siRNA, studies thereon have been actively attempted
by modifying some nucleotides of siRNA or the backbone thereof to
have nuclease resistance, or using viral vectors, liposomes, or
nanoparticles.
[0009] Delivery systems comprising a viral vector such as
adenovirus or retrovirus have high transfection efficacy, but have
high immunogenicity and oncogenicity. On the other hand, non-viral
delivery systems containing nanoparticles have lower cell delivery
efficiency than viral delivery systems, but have advantages,
including high safety in vivo, target-specific delivery, efficient
uptake and internalization of RNAi oligonucleotides into cells or
tissues, and low cytotoxicity and immune stimulation. Thus,
non-viral delivery systems are currently considered a more
promising delivery method than viral delivery systems (Akhtar S, J
Clin Invest. 2007 December 3; 117(12): 3623-3632).
[0010] Among the non-viral delivery systems, methods that use
nanocarriers are methods in which nanoparticles are formed using
various polymers such as liposomes and cationic polymer complexes
and in which siRNA is loaded into such nanoparticles (i.e.,
nanocarriers) and delivered to cells. Among the methods that use
nanocarriers, frequently used methods include methods that use
polymeric nanoparticles, polymer micelles, lipoplexes, and the
like. Among them, lipoplexes are composed of cationic lipids, and
function to interact with the anionic lipids of cellular endosomes
to induce destabilization of the endosomes, thus allowing
intracellular delivery of the exosomes.
[0011] In addition, it is known that the efficiency of siRNA in
vivo can be increased by conjugating a chemical compound or the
like to the end region of the passenger (sense) strand of the siRNA
so as to impart improved pharmacokinetic characteristics thereto
(J. Soutschek, Nature 11; 432(7014):173-8, 2004). In this case, the
stability of the siRNA changes depending on the properties of the
chemical compound conjugated to the end of the sense (passenger) or
antisense (guide) strand of the siRNA. For example, siRNA
conjugated with a polymer compound such as polyethylene glycol
(PEG) interacts with the anionic phosphate group of siRNA in the
presence of a cationic compound to form a complex, thereby
providing a carrier having improved siRNA stability (S. H. Kim, J.
Control. Release 129(2):107-16, 2008). In particular, micelles
composed of a polymer complex have a very small size and a very
uniform size distribution compared to other drug delivery systems
such as microspheres or nanoparticles, and are spontaneously
formed. Thus, these micelles have advantages in that the quality of
the micelle formulation is easily managed and the reproducibility
thereof is easily secured.
[0012] In order to improve the intracellular delivery efficiency of
siRNA, technology for ensuring the stability of the siRNA and
increasing the cell membrane permeability of the siRNA using a
siRNA conjugate, obtained by conjugating a hydrophilic compound
(e.g., polyethylene glycol (PEG)), which is a biocompatible
polymer, to the siRNA via a simple covalent bond or a
linker-mediated covalent bond, has been developed (Korean Patent
No. 883471). However, even when the siRNA is chemically modified
and conjugated to polyethylene glycol (PEG) (PEGylation), it still
has low stability in vivo and a disadvantage in that it is not
easily delivered into a target organ. In order to overcome these
disadvantages, a double-stranded oligo RNA structures has been
developed, which comprises hydrophilic and hydrophobic compounds
bound to an oligonucleotide, particularly double-stranded oligo RNA
such as siRNA. This structure forms self-assembled nanoparticles,
named SAMiRNA.TM. (Self Assembled Micelle Inhibitory RNA), by
hydrophobic interaction of the hydrophobic compound (Korean Patent
No. 1224828). The SAMiRNA.TM. technology has advantages over
conventional delivery technologies in that homogenous nanoparticles
having a very small size may be obtained.
[0013] Specifically, in the SAMiRNA.TM. technology, PEG
(polyethylene glycol) or HEG (hexaethylene glycol) is used as the
hydrophilic compound. PEG, a synthetic polymer, is generally used
to increase the solubility of medical drugs, particularly proteins,
and to regulate the pharmacokinetics of drugs. PEG is a
polydisperse material, and a one-batch polymer is made up of
different numbers of monomers, and thus shows a molecular weight
having a Gaussian curve. In addition, the homogeneity of a material
is expressed as a polydisperse index (Mw/Mn). In other words, when
PEG has a low molecular weight (3 to 5 kDa), it shows a
polydisperse index of about 1.01, and when PEG has a high molecular
weight (20 kDa), it shows a high a polydisperse index of about 1.2,
indicating that the homogeneity of PEG decreases as the molecular
weight thereof increases. Thus, when PEG is bound to a medical
drug, there is a disadvantage in that the polydisperse properties
of PEG are reflected to the conjugate, and thus it is not easy to
verify a single material. Due to this disadvantage, processes for
the synthesis and purification of PEG have been improved in order
to produce materials having a low polydisperse index. However, when
PEG is bound to a compound having a low molecular weight, there are
problems associated with the polydisperse properties of the
compound, including a problem in that it is not easy to confirm
whether binding was easily achieved (Francesco M. VDRUG DISCOVERY
TODAY(2005) 10(21):1451-1458).
[0014] Accordingly, in recent years, the SAMiRNA.TM. technology
(that is self-assembled nanoparticles) has been improved by forming
the hydrophilic compound of the double-stranded RNA structure
(constituting SAMiRNA.TM.) into basic unit blocks, each comprising
1 to 15 monomers having a uniform molecular weight, and if
necessary, a linker, so that a suitable number of the blocks is
used according to need. Thus, new types of delivery system
technologies, which have small sizes and significantly improved
polydisperse properties, compared to conventional SAMiRNA.TM., have
been developed. It is already known that, when siRNA is injected,
the siRNA is rapidly degraded by various enzymes present in the
blood, and thus the efficiency of delivery thereof to target cells
or tissues is poor. As such, variation in stability and expression
inhibition rate depending on target genes also appeared in improved
SAMiRNA.TM.. Accordingly, in order to more stably and effectively
inhibit the expression of a target gene using SAMiRNA.TM., which is
composed of improved self-assembled nanoparticles, the present
inventors have attempted to enhance the expression inhibitory
effect on the target gene and the stability of SAMiRNA.TM. by
applying a double-stranded oligonucleotide comprising the DNA
sequence of an ASO as the guide (sense) strand and an RNA sequence
as the passenger (antisense sense) sequence.
[0015] Idiopathic pulmonary fibrosis (hereinafter referred to as
"IPF"), a type of fibrosis, is a disease in which chronic
inflammatory cells penetrate the wall of the alveoli (pulmonary
alveolus), causing various changes that make the lung stiff, lead
to various severe structural changes in lung tissue, and gradually
reduce the lung function, leading to death. To date, there is no
effective treatment method for IPF. Once IPF symptoms appear and
the patients are diagnosed with IPF, the average survival time of
the patients is only about 3 to 5 years. Thus, IPF is a disease
with a very poor prognosis. The incidence of IPF is reported to be
about 3 to 5 per 100,000 people in foreign countries, and it is
known that the incidence rate of IPF is usually higher after the 50
s and is twice as high in men as in women.
[0016] Although the cause of IPF has not been clearly identified,
it has been reported that the incidence of IPF is high in smokers,
and antidepressants, chronic lung inhalation due to
gastroesophageal reflux, chronic lung inhalation due to
gastroesophageal reflux, metal dust, wood dust, solvent inhalation,
and the like, are risk factors related to the occurrence of IPF.
However, in most patients, no definite causal factors have been
reported. As to the most frequently mentioned factor, it is known
that, when Th1/Th2 reactions, coagulation cascades, etc. are
activated for whatever reason, fibrotic cytokines are secreted
thereby, and the activated cytokines stimulate fibroblasts and
increase ECM (extracellular matrix), resulting in lung fibrosis. Of
course, this process is accompanied by inflammation of the lungs,
which can lead to fibrosis of the lungs, but in recent years, the
opinion that this process can directly cause lung fibrosis
regardless of lung inflammation is more dominant. A recent
hypothesis is that pathological pulmonary fibrosis occurs during
wound healing due to an abnormal signaling system in the
epithelial-mesenchymal interaction. When epithelial cells are
damaged, apoptosis of the epithelial cells increases, migration of
the epithelial cells is restricted, differentiation of the
migration of the epithelial cells is not regulated, proliferation
is inhibited, and soluble factors (TGF, HGF, KGF, angiotensin II,
ROS, etc.) are secreted. In addition, in this case, apoptosis of
mesenchymal cells together with ECM is inhibited. Apoptosis of
mesenchymal cells is inhibited, resulting in increased
differentiation of myofibroblasts and causing lung fibrosis through
ECM deposition, or resulting in restimulation of epithelial cells.
In other words, it cannot be considered that pulmonary inflammation
directly causes pulmonary fibrosis, but it means that pulmonary
inflammation occurs first, and then pulmonary fibrosis occurs due
to the difference between IPF patients and normal people in the
process of healing to restore normal tissue. In addition, IPF can
be caused by an imbalance of Th1/Th2 cytokines. A Th1 cytokine
response is related to cell-mediated immunity, which restores
damaged tissue areas to normal tissue, whereas Th2 cytokine causes
ECM deposition and fibrosis through the activation and
proliferation of fibroblasts. It has been reported that, when
IFN-.gamma. is administered to a bleomycin-induced pulmonary
fibrosis model, it can prevent pulmonary fibrosis by reducing the
mRNA of TGF-.beta. and procollagen. However, since the etiology of
pulmonary fibrosis is not exactly known, it is necessary to
identify the initial causative factor that causes fibrosis and to
develop a substance that can inhibit genes related to IPF and the
TGF-.beta. signaling system.
[0017] It is known that, when IPF is not treated, IPF continuously
worsens, causing more than 50% of patients to die within 3 to 5
years. In addition, once a lung is completely hardened by fibrosis
as the disease progresses, no matter what type of treatment is
conducted, the patient does not improve. Therefore, it is predicted
that, when IPF is treated at an early stage, the possibility of the
treatment being effective will be high. A method of using a
combination of a steroid with azathioprine or cyclophosphamide for
IPF treatment is known, but appears to have no particular special
effect. In addition, various fibrosis inhibitors have been
attempted in animal experiments and in small groups of patients,
but effects thereof have not been clearly demonstrated. In
particular, there is no effective treatment method other than lung
transplantation for patients with terminal IPF. Therefore, there is
an urgent need to develop a more efficient agent for treating
IPF.
[0018] Fibrosis refers to a disease condition in which a tissue or
organ hardens due to excessive fibrosis of connective tissue for
some reason. All processes in which fibrosis occurs follow the same
path as the process in which scars are healed, regardless of area.
To date, there have been few methods to cure fibrotic symptoms, and
treatment methods have been developed and studied. An effective
fibrosis therapeutic agent may be applied to cirrhosis, liver
fibrosis, myelofibrosis, myocardial fibrosis, renal fibrosis, and
pulmonary fibrosis, which are representative types of fibrosis, as
well as various diseases accompanied by fibrosis, and thus there is
an urgent need for an effective fibrosis therapeutic agent.
[0019] Meanwhile, it is known that amphiregulin activates the
epithelial growth factor receptor (EGFR) pathway by binding to the
epidermal growth factor receptor, and is involved in cell
proliferation. In addition, it has been disclosed that the
expression of amphiregulin can be inhibited by
amphiregulin-specific siRNA, which exhibits therapeutic effects
against certain types of breast cancer. In addition, it has been
disclosed that the use of shRNA against amphiregulin can inhibit
cell penetration in inflammatory breast cancer (Andrea Baillo, J.
Cell Physiol. 2011 226(10): 2691-2701), and that when amphiregulin
expression is inhibited using amphiregulin-specific shRNA,
pulmonary artery remodeling in mice exposed to tobacco smoke is
inhibited. It has been disclosed that amphiregulin is associated
with airway smooth muscle (ASM) hyperplasia and angiogenesis, and
that excessively secreted epidermal growth factor (EGF) and
amphiregulin are involved, especially in promoting airway
remodeling in asthmatic patients and in tissue remodeling following
acute asthma.
[0020] As explained above, the possibility of amphiregulin as a
therapeutic target for respiratory disease and fibrosis,
particularly COPD and IPF, has been suggested, but the development
of RNAi therapeutic agents for amphiregulin and technology for
delivering the same is still insufficient, and the market demand
for a double-stranded oligonucleotide therapeutic agent capable of
inhibiting amphiregulin expression with high efficiency and
specificity and technology of delivering the same is very high.
[0021] Accordingly, the present inventors selected amphiregulin as
a gene associated with fibrosis including IPF, selected a
double-stranded oligonucleotide that targets amphiregulin, and also
identified an RNAi therapeutic agent capable of inhibiting
amphiregulin expression and a carrier for delivering the same,
thereby completing the present invention.
SUMMARY OF THE INVENTION
[0022] An object of the present invention is to provide a
double-stranded oligonucleotide, preferably a double-stranded
oligonucleotide comprising an RNA/RNA, DNA/DNA or DNA/RNA hybrid
sequence, which is capable of very specifically inhibiting
amphiregulin with high efficiency, a double-stranded
oligonucleotide structure comprising the double-stranded
oligonucleotide, and nanoparticle comprising the double-stranded
oligonucleotide structure.
[0023] Another object of the present invention is to provide a
pharmaceutical composition for preventing or treating fibrosis or
respiratory disease comprising, as an active ingredient, the
double-stranded oligonucleotide, a double-stranded oligonucleotide
structure comprising the same, and/or nanoparticle comprising the
double-stranded oligonucleotide structure.
[0024] Still another object of the present invention is to provide
a method for preventing or treating fibrosis or respiratory
disease, the method comprising a step of administering the
pharmaceutical composition for preventing or treating fibrosis or
respiratory disease to a subject in need of prevention or treatment
of fibrosis or respiratory disease.
[0025] Yet another object of the present invention is to provide
the double-stranded oligonucleotide, a double-stranded
oligonucleotide structure comprising the same, and/or nanoparticle
comprising the double-stranded oligonucleotide structure, for use
in a method of prevention or treatment of fibrosis or respiratory
disease.
[0026] Still yet another object of the present invention is to
provide the pharmaceutical composition for use in a method of
prevention or treatment of fibrosis or respiratory disease.
[0027] A further object of the present invention is to provide use
of the double-stranded oligonucleotide, a double-stranded
oligonucleotide structure comprising the same, and/or nanoparticle
comprising the double-stranded oligonucleotide structure, for
manufacture of a medicine for preventing fibrosis or respiratory
disease.
[0028] To achieve the above objects, the present invention provides
a double-stranded oligonucleotide comprising a sense strand
comprising any one sequence selected from the group consisting of
SEQ ID NOs: 1 to 14, more preferably the group consisting of SEQ ID
NOs: 10, 11 and 12, and an antisense strand comprising a sequence
complementary thereto.
[0029] The present invention also provides a double-stranded
oligonucleotide structure comprising the double-stranded
oligonucleotide, and nanoparticle comprising the double-stranded
oligonucleotide structure.
[0030] The present invention also provides a pharmaceutical
composition for preventing or treating fibrosis or respiratory
disease comprising: a double-stranded oligonucleotide comprising a
sense strand comprising any one sequence selected from the group
consisting of SEQ ID NOs: 1 to 14, more preferably the group
consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand
comprising a sequence complementary thereto; or a double-stranded
oligonucleotide structure comprising the double-stranded
oligonucleotide; or nanoparticle comprising the double-stranded
oligonucleotide structure.
[0031] The present invention also provides a method for preventing
or treating fibrosis or respiratory disease, the method comprising
a step of administering the pharmaceutical composition for
preventing or treating fibrosis or respiratory disease to a subject
in need of prevention or treatment of fibrosis or respiratory
disease.
[0032] The double-stranded oligonucleotide comprising a sense
strand according to the present invention, which comprises any one
sequence selected from the group consisting of SEQ ID NOs: 1 to 14,
more preferably the group consisting of SEQ ID NOs: 10, 11 and 12,
and an antisense strand comprising a sequence complementary
thereto, or a double-stranded oligonucleotide structure comprising
the double-stranded oligonucleotide, or nanoparticle comprising the
double-stranded oligonucleotide structure may very efficiently
inhibit amphiregulin expression, and thus each of the
double-stranded oligonucleotide according to the present invention,
a double-stranded oligonucleotide structure comprising the same,
and nanostructures comprising the double-stranded oligonucleotide
structure may be effectively used for the prevention or treatment
of fibrosis or respiratory disease.
[0033] The sequence of SEQ ID NO: 10, 11 and 12 which is comprised
in a preferred double-stranded oligonucleotide provided to achieve
the above object is as follows:
TABLE-US-00001 (SEQ ID NO: 10) 5'-CACCTACTCTGGGAAGCGT-3' (SEQ ID
NO: 11) 5'-ACCTACTCTGGGAAGCGTG-3' (SEQ ID NO: 12)
5'-CTGGGAAGCGTGAACCATT-3'
[0034] As used herein, the term "double-stranded oligonucleotide"
is intended to include all materials having general RNAi (RNA
interference) activity, and it will be obvious to those skilled in
the art that an mRNA-specific double-stranded oligonucleotide that
encodes the amphiregulin protein also includes
amphiregulin-specific shRNA and the like. That is, the
oligonucleotide may be siRNA, shRNA or miRNA.
[0035] In addition, it will be obvious to those skilled in the art
that amphiregulin-specific siRNA which comprises a sense strand and
an antisense strand, or an antisense oligonucleotide, each
comprising a sequence resulting from substitution, deletion or
insertion of one or more nucleotides in a sense strand comprising
any one sequence selected from the group consisting of SEQ ID NOs:
10, 11 and 12, or an antisense strand complementary thereto, is
also included in the scope of the present invention, as long as the
specificity for amphiregulin is maintained.
[0036] In the present invention, the sense or antisense strand may
be independently DNA or RNA. In addition, the sense and antisense
strands may be in the form of a hybrid in which the sense strand is
DNA and the antisense strand is RNA or the sense strand is RNA and
the antisense strand is DNA.
[0037] In the present invention, SEQ ID NOs: 10, 11 and 12 are set
forth in the form of DNA, but when the form of RNA is used, the
sequences of SEQ ID NOs: 10, 11 and 12 may be RNA sequences
corresponding thereto, that is, sequences in which T is substituted
with U.
[0038] In addition, the double-stranded oligonucleotide according
to the present invention includes not only the case where the sense
strand of the sequence is fully complementary (perfect match) to
the binding site of the amphiregulin gene, but also the case where
the sense strand is partially complementary (mismatch) to the
binding site, as long as the specificity for amphiregulin is
maintained.
[0039] The double-stranded oligonucleotide according to the present
invention may comprise, at the 3' end of one or both strands, an
overhang comprising one or more unpaired nucleotides.
[0040] In the present invention, the sense strand or the antisense
strand may preferably consist of 19 to 31 nucleotides, but is not
limited thereto.
[0041] In the present invention, the double-stranded
oligonucleotide comprising the sense strand, comprising any one
sequence selected from the group consisting of SEQ ID NOs: 10, 11
and 12, and the antisense strand comprising a sequence
complementary thereto, may be specific for amphiregulin, but is not
limited thereto.
[0042] In the present invention, the sense strand or antisense
strand of the double-stranded oligonucleotide may comprise various
chemical modifications in order to increase the in vivo stability
thereof or impart nuclease resistance and reduce non-specific
immune responses. The chemical modification may be one or more
selected from, without limitation to, the group consisting of the
following chemical modifications: modification in which an OH group
at the 2' carbon position of a sugar structure in one or more
nucleotides is substituted with any one selected from the group
consisting of --CH.sub.3 (methyl), OCH.sub.3 (methoxy), amine
(--NH.sub.2), fluorine (--F), --O-2-methoxyethyl, --O-propyl,
--O-2-methylthioethyl, --O-3-aminopropyl,
--O-3-dimethylaminopropyl, --O--N-methylacetamido and
--O-dimethylamidooxyethyl; modification in which oxygen in a sugar
structure in nucleotides is substituted with sulfur; modification
of a bond between nucleotides to any one bond selected from the
group consisting of a phosphorothioate bond, a boranophosphophate
bond and a methyl phosphonate bond; modification to PNA (peptide
nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic
acid); and modification to a DNA-RNA hybrid (Ann. Rev. Med. 55,
61-65 2004; U.S. Pat. Nos. 5,660,985; 5,958,691; 6,531,584;
5,808,023; 6,326,358; 6,175,001; Bioorg. Med. Chem. Lett.
14:1139-1143, 2003; RNA, 9:1034-1048, 2003; Nucleic Acid Res.
31:589-595, 2003; Nucleic Acids Research, 38(17) 5761-773, 2010;
Nucleic Acids Research, 39(5):1823-1832, 2011).
[0043] In the present invention, one or more phosphate groups,
preferably one to three phosphate groups, may be bound to the 5'
end of the antisense strand of the double-stranded
oligonucleotide.
[0044] In another aspect, the present invention is directed to a
double-stranded oligonucleotide structure comprising a structure
represented by the following Formula (1), wherein A represents a
hydrophilic compound, B represents a hydrophobic compound, X and Y
each independently represent a simple covalent bond or a
linker-mediated covalent bond, and R represents a double-stranded
oligonucleotide.
[0045] In a preferred embodiment, the double-stranded
oligonucleotide structure comprising an amphiregulin-specific
sequence according to the present invention preferably has a
structure represented by the following Structural Formula (1):
A-X--R--Y--B Structural Formula (1)
[0046] wherein A represents a hydrophilic compound, B represents a
hydrophobic compound, X and Y each independently represent a simple
covalent bond or a linker-mediated covalent bond, and R represents
a double-stranded oligonucleotide.
[0047] The double-stranded oligonucleotide according to the present
invention is preferably in the form of a DNA-RNA hybrid, siRNA
(short interfering RNA), shRNA (short hairpin RNA) or miRNA
(microRNA), but is not limited thereto, and may also include a
single-stranded miRNA inhibitor that may act as an antagonist
against miRNA.
[0048] Hereinafter, the double-stranded oligonucleotide according
to the present invention will be described with a focus on RNA, but
it is will be obvious to those skilled in the art that the present
invention may also be applied to other double-stranded
oligonucleotides having the same characteristics as the
double-stranded oligonucleotide of the present invention.
[0049] More preferably, the double-stranded oligonucleotide
structure comprising the amphiregulin-specific double-stranded
oligonucleotide according to the present invention has a structure
represented by the following Structural Formula (2):
##STR00001##
[0050] wherein A, B, X and Y are as defined in Structural Formula
(1) above, S represents the sense strand of the
amphiregulin-specific double-stranded oligonucleotide, and AS
represents the antisense strand of the amphiregulin-specific
double-stranded oligonucleotide.
[0051] More preferably, the double-stranded oligonucleotide
structure comprising the amphiregulin-specific double-stranded
oligonucleotide has a structure represented by the following
Structural Formula (3) or (4):
##STR00002##
[0052] wherein A, B, S, AS, X and Y are as defined in Structural
Formula (2) above, and 5' and 3' represent the 5' end and 3' end,
respectively, of the sense strand of the amphiregulin-specific
double-stranded oligonucleotide.
[0053] The hydrophilic compound may be selected from the group
consisting of polyethylene glycol (PEG), polyvinylpyrrolidone, and
polyoxazoline, but is not limited thereto.
[0054] It will be obvious to those skilled in the technical field
to which the present invention pertains that one to three phosphate
groups may be bound to the 5' end of the antisense strand of the
double-stranded oligonucleotide RNA structure comprising the
amphiregulin-specific siRNA as shown in Structural Formula (1) to
Structural Formula (4) and that shRNA may be used in place of the
RNA.
[0055] The hydrophilic compound in Structural Formula (1) to
Structural Formula (4) above is preferably a polymer compound
having a molecular weight of 200 to 10,000, more preferably a
polymer compound having a molecular weight of 1,000 to 2,000. For
example, as the hydrophilic polymer compound, it is preferable to
use a nonionic hydrophilic polymer compound such as polyethylene
glycol, polyvinyl pyrrolidone or polyoxazoline, but the disclosure
is not limited thereto.
[0056] In particular, the hydrophilic compound (A) in Structural
Formula (1) to Structural Formula (4) may be used in the form of
hydrophilic blocks as shown in the following Structural Formula (5)
or (6), and a suitable number (n in Structural Formula (5) or (6))
of such hydrophilic blocks may be used as required, thereby
overcoming the problems associated with polydisperse properties
that may occur when general synthetic polymer compounds are
used:
(A'.sub.m-J).sub.n Structural Formula (5)
(J-A'.sub.m).sub.n Structural Formula (6)
[0057] wherein A' represents a hydrophilic monomer, J represents a
linker that connects a number (m) of hydrophilic monomers together
or connects a number (m) of hydrophilic monomers with the
double-stranded oligonucleotide, m is an integer ranging from 1 to
15, n is an integer ranging from 1 to 10, and a repeat unit
represented by (A'.sub.m-J) or (J-A.sub.m') corresponds to the
basic unit of the hydrophilic block.
[0058] When the hydrophilic block as shown in Structural Formula
(5) or (6) above is used, the double-stranded oligonucleotide
structure comprising the amphiregulin-specific oligonucleotide
according to the present invention may have a structure represented
by the following Structural Formula (7) or (8):
(A'.sub.m-J).sub.n-X--R--Y--B Structural Formula (7)
(J-A'.sub.m).sub.n-X--R--Y--B Structural Formula (8)
[0059] wherein X, R, Y and B are as defined in Structural Formula
(1) above, and A', J, m and n are as defined in Structural Formulas
(5) and (6) above.
[0060] As the hydrophilic monomer (A') in Structural Formulas (5)
and (6) above, one selected from among nonionic hydrophilic
polymers may be used without limitation, as long as it is
compatible with the purpose of the present invention. Preferably, a
monomer selected from among compound (1) to compound (3) set forth
in Table 1 below may be used. More preferably, a monomer of
compound (1) may be used. In compound (1), G may preferably be
selected from among 0, S and NH.
[0061] In particular, among hydrophilic monomers, the monomer
represented by compound (1) is very suitable for the production of
the structure according to the present invention, because the
monomer has advantages in that various functional groups may be
introduced to the monomer, and the monomer induces little immune
response by having good in vivo affinity and excellent
biocompatibility, may increase the in vivo stability of the
double-stranded oligonucleotide comprised in the structure
represented by Structural Formula (7) or (8), and may increase the
delivery efficiency of the double-stranded oligonucleotide.
TABLE-US-00002 TABLE 1 Structure of hydrophilic monomers used in
the present invention Compound (1) Compound (2) Compound (3)
##STR00003## G is O, S or NH ##STR00004## ##STR00005##
[0062] The total molecular weight of the hydrophilic compound in
Structural Formula (5) to Structural Formula (8) is preferably in
the range of 1,000 to 2,000. Thus, for example, when compound (1)
in Structural Formula (7) and Structural Formula (8) is
hexaethylene glycol, that is, a compound in which G is O and m is
6, the repeat number (n) is preferably 3 to 5, because the
hexaethylene glycol space has a molecular weight of 344.
Particularly, the present invention is characterized in that a
suitable number (represented by n) of repeat units of the
hydrophilic group (hydrophilic blocks) represented by (A'.sub.m-J)
or (J-A'.sub.m).sub.n in Structural Formula (5) and Structural
Formula (6) may be used as required. The hydrophilic monomer J and
linker J comprised in each hydrophilic block may be the same or
different between the hydrophilic blocks. In other words, when 3
hydrophilic blocks are used (n=3), the hydrophilic monomer of
compound (1), the hydrophilic monomer of compound (2) and the
hydrophilic monomer of compound (3) may be used in the first,
second and third blocks, respectively, suggesting that different
monomers may be used in all hydrophilic blocks. Alternatively, any
one hydrophilic monomer selected from the hydrophilic monomers of
compounds (1) to (3) may also be used in all of the hydrophilic
blocks. Similarly, as the linker that mediates the bonding of the
hydrophilic monomer, the same linker may be used in the hydrophilic
blocks, or different linkers may also be used in the hydrophilic
blocks. In addition, m, which is the number of hydrophilic
monomers, may also be the same or different between the hydrophilic
blocks. In other words, in the first hydrophilic block, three
hydrophilic monomers are connected (m=3), in the second hydrophilic
block, five hydrophilic monomers are connected (m=5), and in the
third hydrophilic block, four hydrophilic monomers are connected
(m=4), suggesting that different numbers of hydrophilic monomers
may be used in the hydrophilic blocks. Alternatively, the same
number of hydrophilic monomers may also be used in all hydrophilic
blocks.
[0063] In addition, in the present invention, the linker (J) is
preferably selected from the group consisting of
--PO.sub.3.sup.---, --SO.sub.3-- and --CO.sub.2--, but is not
limited thereto. It will be obvious to those skilled in the art
that any linker selected in consideration of the hydrophilic
monomer that is used may be used, as long as it is compatible with
the purpose of the present invention.
[0064] The hydrophobic compound (B) in Structural Formula (1) to
Structural Formula (4), Structural Formula (7) and Structural
Formula (8) functions to form nanoparticles composed of the
oligonucleotide structure shown in Structural Formula (1) to
Structural Formula (4), Structural Formula (7) and Structural
formula (8) through hydrophobic interactions. The hydrophobic
compound preferably has a molecular weight of 250 to 1,000, and may
be any one selected from the group consisting of a steroid
derivative, a glyceride derivative, glycerol ether, polypropylene
glycol, a C.sub.12-C.sub.50 unsaturated or saturated hydrocarbon,
diacylphosphatidylcholine, a fatty acid, a phospholipid,
lipopolyamine, a lipid, tocopherol, and tocotrienol, but is not
limited thereto. It will be obvious to those skilled in the art
that any hydrophobic compound may be used, as long as it is
compatible with the purpose of the present invention.
[0065] The steroid derivative may be selected from the group
consisting of cholesterol, cholestanol, cholic acid, cholesteryl
formate, cholestanyl formate, and cholesteryl amine, and the
glyceride derivative may be selected from among mono-, di-, and
tri-glycerides and the like. Here, the fatty acid of the glyceride
is preferably a C.sub.12-C.sub.50 unsaturated or saturated fatty
acid.
[0066] In particular, among the hydrophobic compounds, a saturated
or unsaturated hydrocarbon or cholesterol is preferably used
because it may be easily bound in a step of synthesizing the
double-stranded oligonucleotide structure according to the present
invention. Most preferably, a C.sub.24 hydrocarbon, particularly a
hydrophobic hydrocarbon containing a disulfide bond, is used.
[0067] The hydrophobic compound may be bound to the distal end of
the hydrophilic compound, and may be bound to any position on the
sense or antisense strand of the double-stranded
oligonucleotide.
[0068] The hydrophilic compound or hydrophobic compound in
Structural Formulas (1) to (4), (7) and (8) according to the
present invention is bound to the amphiregulin-specific
oligonucleotide by a single covalent bond or a linker-mediated
covalent bond (X or Y). The linker that mediates the covalent bond
is covalently bound to the hydrophilic or hydrophobic compound at
the end of the amphiregulin-specific oligonucleotide, and is not
specifically limited, as long as it provides a degradable bond in a
specific environment if required. Therefore, the linker that is
used in the present invention may be any compound that is bound in
order to activate the amphiregulin oligonucleotide and/or the
hydrophilic (or hydrophobic) compound in the process of producing
the double-stranded oligonucleotide structure according to the
present invention. The covalent bond may be either one of a
non-degradable bond and a degradable bond. Here, examples of the
non-degradable bond include, but are not limited to, an amide bond
and a phosphate bond, and examples of the degradable bond include,
but are not limited to, a disulfide bond, an acid-degradable bond,
an ester bond, an anhydride bond, a biodegradable bond, and an
enzyme-degradable bond.
[0069] In addition, as the amphiregulin-specific double-stranded
oligonucleotide represented by R (or S and AS) in Structural
Formulas (1) to (4), (7) and (8), any double-stranded
oligonucleotide having the property of binding specifically to the
mRNA of amphiregulin may be used without limitation. Preferably,
the amphiregulin-specific double-stranded oligonucleotide according
to the present invention comprises a sense strand comprising any
one sequence selected from among SEQ ID NOs: 10, 11 and 12, and an
antisense strand comprising a sequence complementary to that of the
sense strand.
[0070] In addition, in the double-stranded oligonucleotide
structure comprising the amphiregulin-specific double-stranded
oligonucleotide according to the present invention, an amine or
polyhistidine group may additionally be introduced to the distal
end of the hydrophilic compound bound to the oligonucleotide in the
structure.
[0071] This facilitates the intracellular uptake and endosomal
escape of a carrier comprising the double-stranded oligonucleotide
structure comprising the amphiregulin-specific double-stranded
oligonucleotide according to the present invention, and it has
already been reported that the introduction of an amine group and a
polyhistidine group may be used to facilitate the intracellular
uptake and endosomal escape of carriers such as quantum dots,
dendrimers or liposomes.
[0072] Specifically, it is known that a primary amine group
introduced to the end or outside of a carrier is protonated at
biological pH while forming a conjugate by interaction with a
negatively charged gene, and that endosomal escape is facilitated
due to an internal tertiary amine having a buffering effect at low
pH after intracellular uptake, whereby the carrier can be protected
from lysosomal degradation (Gene Delivery and Expression Inhibition
Using Polymer-Based Hybrid Material, Polymer Sci. Technol., Vol.
23, No. 3, pp 254-259).
[0073] In addition, it is known that histidine, a non-essential
amino acid, has an imidazole ring (pKa=6.04) at the residue (--R)
thereof, and thus has an effect of increasing buffering capacity in
endosomes and lysosomes, and thus histidine modification may be
used in non-viral gene carriers, including liposomes, in order to
increase endosomal escape efficiency (Novel histidine-conjugated
galactosylated cationic liposomes for efficient hepatocyte
selective gene transfer in human hepatoma HepG2 cells. J.
Controlled Release 118, pp 262-270).
[0074] The amine group or polyhistidine group may be connected to
the hydrophilic compound or the hydrophilic block by one or more
linkers.
[0075] When the amine group or polyhistidine group is introduced to
the hydrophilic compound of the double-stranded oligonucleotide
structure represented by Structural Formula (1) according to the
present invention, the RNA structure may have a structure shown in
the following Structural Formula (9):
P-J.sub.1-J.sub.2-A-X--R--Y--B Structural Formula (9)
[0076] wherein A, B, R, X and Y are as defined in Structural
Formula (1) above,
[0077] P represents an amine group or a polyhistidine group, and
J.sub.1 and J.sub.2 are linkers each of which may be independently
selected from among a simple covalent bond, PO.sub.3.sup.-,
SO.sub.3, CO.sub.2, a C.sub.2-12 alkyl, alkenyl and alkynyl, but
without limitation thereto. It will be obvious to those skilled in
the art that any linkers selected in consideration of the
hydrophilic compound used herein may be used as J.sub.1 and
J.sub.2, as long as they are compatible with the purpose of the
present invention.
[0078] Preferably, when an amine group is introduced, J.sub.2 is a
simple covalent bond or PO.sub.3.sup.-, and J.sub.1 is a C.sub.6
alkyl, but the present invention is not limited thereto.
[0079] In addition, when a polyhistidine group is introduced, it is
preferred that J.sub.2 in Structural Formula (9) be a simple
covalent bond or PO.sub.3.sup.-, and that Jibe compound (4), but
the present invention is not limited thereto.
##STR00006##
[0080] In addition, when the hydrophilic compound of the
double-stranded oligonucleotide structure shown in Structural
Formula (9) is the hydrophilic block represented by Structural
Formula (5) or (6) and an amine group or a polyhistidine group is
introduced thereto, the double-stranded oligonucleotide structure
may have a structure represented by the following Structural
Formula (10) or (11):
P-J.sub.1-J.sub.2-(A'.sub.m-J).sub.n-X--R--Y--B Structural Formula
(10)
P-J.sub.1-J.sub.2-(J-A'.sub.m).sub.n-X--R--Y--B Structural Formula
(11)
[0081] wherein X, R, Y, B, A', J, m and n are as defined in
Structural Formula (5) or (6) above, and P, J.sub.1 and J.sub.2 are
as defined in Structural Formula (9).
[0082] In particular, the hydrophilic compound in Structural
Formula (10) and Structural Formula (11) is preferably bound to the
3' end of the sense strand of the amphiregulin-specific
double-stranded oligonucleotide. In this case, Structural Formula
(9) to Structural Formula (11) may correspond to the following
Structural Formula (12) to Structural Formula (14):
##STR00007##
[0083] wherein X, R, Y, B, A, A' J, m, n, P, J.sub.1 and J.sub.2
are as defined in Structural Formula (9) to Structural Formula (11)
above, and 5' and 3' represent the 5' end and the 3' end of the
sense strand of the amphiregulin-specific double-stranded
oligonucleotide.
[0084] An amine group that may be introduced in the present
invention may be a primary, secondary or tertiary amine group. In
particular, a primary amine group is preferably used. The
introduced amine group may be present as an amine salt. For
example, a salt of the primary amine group may be present as
NH.sub.3.
[0085] In addition, a polyhistidine group that may be introduced in
the present invention preferably comprises 3 to 10 histidines, more
preferably 5 to 8 histidines, and most preferably six histidines.
In addition to histidines, one or more cysteines may be
included.
[0086] Meanwhile, when a targeting moiety is provided in the
double-stranded oligonucleotide structure comprising the
amphiregulin-specific oligonucleotide according to the present
invention and nanoparticles formed therefrom, it may promote the
efficient delivery of the RNA structure to target cells so that the
RNA structure may be delivered to the target cells even at a
relatively low concentration, thus exhibiting a strong effect of
regulating target gene expression. In addition, the targeting
moiety may prevent non-specific delivery of the
amphiregulin-specific double-stranded oligonucleotide to other
organs and cells.
[0087] Accordingly, the present invention provides a
double-stranded oligo RNA structure in which a ligand (L),
particularly a ligand having the property of binding specifically
to a receptor that enhances target cell internalization by
receptor-mediated endocytosis (RME), is further bound to the
structure represented by any one of Structural Formulas (1) to (4),
(7) and (8). For example, a structure wherein a ligand is bound to
the double-stranded oligo RNA structure represented by Structural
Formula (1) has a structure shown in the following Structural
Formula (15):
(L.sub.1-Z)-A-X--R--Y--B Structural Formula (15)
[0088] wherein A, B, X and Y are as defined in Structural Formula
(1) above, L is a ligand having the property of binding
specifically to a receptor that enhances target cell
internalization by receptor-mediated endocytosis (RME), and "i" is
an integer ranging from 1 to 5, preferably from 1 to 3.
[0089] The ligand in Structural Formula (15) may preferably be
selected from among: target receptor-specific antibodies, aptamers
and peptides, which have the RME property of enhancing target cell
internalization; folate (the term "folate" is generally used
interchangeably with folic acid, and the term "folate" as used
herein means folate that is in a natural form or is activated in
the human body); and chemical compounds, including hexosamines such
as N-acetyl galactosamine (NAG), and sugars or carbohydrates such
as glucose and mannose, but is not limited thereto.
[0090] In addition, the hydrophilic compound (A) in Structural
Formula (15) above may be used in the form of the hydrophilic block
represented by Structural Formula (5) or (6).
[0091] In another aspect, the present invention provides a method
for producing a double-stranded oligonucleotide structure
comprising an amphiregulin-specific double-stranded
oligonucleotide.
[0092] For example, the method for producing a double-stranded
oligonucleotide structure comprising an amphiregulin-specific
double-stranded oligonucleotide according to the present invention
may comprise steps of:
[0093] (1) binding a hydrophilic compound to a solid support;
[0094] (2) synthesizing an oligonucleotide single strand on the
hydrophilic compound-bound solid support;
[0095] (3) covalently binding a hydrophobic compound to the 5' end
of the oligonucleotide single strand;
[0096] (4) synthesizing an oligonucleotide single strand having a
sequence complementary to the sequence of the oligonucleotide
single strand of step (2);
[0097] (5) separating and purifying an oligonucleotide-polymer
structure and the oligonucleotide single strand from the solid
support after completion of synthesis; and
[0098] (6) annealing the produced oligonucleotide-polymer structure
with the oligonucleotide single strand having the complementary
sequence, thereby producing a double-stranded oligonucleotide
structure.
[0099] The solid support that is used in the present invention is
preferably controlled pore glass (CPG), but is not limited thereto,
and polystyrene (PS), polymethylmethacrylate (PMMA), silica gel,
cellulose paper or the like may also be used. When CPG is used, it
preferably has a diameter of 40 to 180 .mu.m and a pore size of 500
to 3,000 .ANG.. After step (5), the molecular weights of the
produced and purified RNA-polymer structure and oligonucleotide
single strand may be measured using a MALDI-TOF mass spectrometer
in order to confirm that the desired oligonucleotide-polymer
structure and oligonucleotide single strand are obtained. In the
above-described production method, step (4) of synthesizing the
oligonucleotide single strand having a sequence complementary to
the sequence of the oligonucleotide single strand synthesized in
step (2) may be performed before step (1) or during any one step of
steps (1) to (5).
[0100] In addition, the oligonucleotide single strand having a
sequence complementary to the sequence of the oligonucleotide
single strand synthesized in step (2) may be used in the state in
which a phosphate group is bound to the 5' end of the
oligonucleotide single strand.
[0101] Meanwhile, the present invention provides a method for
producing a double-stranded oligonucleotide structure wherein a
ligand is further bound to the double-stranded oligonucleotide
structure comprising the amphiregulin-specific double-stranded
oligonucleotide.
[0102] For example, the method for producing the ligand-bound
double-stranded oligonucleotide structure comprising the
amphiregulin-specific double-stranded oligonucleotide may comprise
steps of:
[0103] (1) binding a hydrophilic compound to a solid support having
a functional group bound thereto;
[0104] (2) synthesizing an oligonucleotide single strand on the
solid support having the functional group and hydrophilic compound
bound thereto;
[0105] (3) covalently binding a hydrophobic compound to the 5' end
of the oligonucleotide single strand;
[0106] (4) synthesizing an oligonucleotide single strand having a
sequence complementary to the sequence of the oligonucleotide
single strand synthesized in step (2);
[0107] (5) separating the functional group-oligonucleotide-polymer
structure and the oligonucleotide single strand having the
complementary sequence from the solid support after completion of
synthesis;
[0108] (6) binding a ligand to the end of the hydrophilic compound
by the functional group to produce a ligand-oligonucleotide-polymer
structure single strand; and
[0109] (7) annealing the produced ligand-oligonucleotide-polymer
structure with the oligonucleotide single strand having the
complementary sequence, thereby producing a
ligand/double-stranded-oligonucleotide structure.
[0110] After step (6), the produced ligand-oligonucleotide-polymer
structure and the oligonucleotide single strand having the
complementary sequence may be separated and purified, and then the
molecular weights thereof may be measured using a MALDI-TOF mass
spectrometer in order to confirm that the desired
ligand-RNA-polymer structure and the desired RNA single strand
having the complementary sequence are produced. By annealing the
produced ligand/RNA-oligonucleotide structure with the
oligonucleotide single strand having the complementary sequence, a
ligand/double-stranded-oligonucleotide structure may be produced.
In the above-described production method, step (4) of synthesizing
the oligonucleotide single strand having a sequence complementary
to the sequence of the oligonucleotide single strand synthesized in
step (3) may be performed before step (1) or during any one step of
steps (1) to (6).
[0111] In still another aspect, the present invention is directed
to nanoparticles comprising the double-stranded oligonucleotide
structure according to the present invention. The double-stranded
oligonucleotide according to the present invention forms
self-assembled nanoparticles through hydrophobic interaction of the
hydrophobic compound (Korean Patent No. 1224828). These
nanoparticles have excellent in vivo delivery efficiency and in
vivo stability. In addition, the high particle size uniformity of
the nanoparticles makes quality control (QC) easy, and thus a
process of preparing these nanoparticles as a drug is easy.
[0112] In the present invention, the nanoparticle may also be
composed of a mixture of double-stranded oligonucleotide structures
comprising double-stranded structures comprising different
sequences. For example, the nanoparticle may comprise one kind of
amphiregulin-specific double-stranded oligonucleotide comprising a
sense strand, which comprises any one sequence selected from SEQ ID
NOs: 10 to 12, and an antisense strand comprising a sequence
complementary thereto; however, in another embodiment, the
nanoparticle may comprise different kinds of amphiregulin-specific
double-stranded oligonucleotides, each comprising a sense strand,
which comprises any one sequence selected from SEQ ID NOs: 10 to
12, and an antisense strand comprising a sequence complementary
thereto, and may also comprise an amphiregulin-specific
double-stranded oligonucleotide which is not disclosed in the
present invention.
[0113] In still another aspect, the present invention is directed
to a pharmaceutical composition for preventing or treating fibrosis
or respiratory disease, the pharmaceutical composition containing,
as an active ingredient, the double-stranded oligonucleotide
according to the present invention, the double-stranded
oligonucleotide structure, or nanoparticle comprising the
double-stranded oligonucleotide structure.
[0114] The pharmaceutical composition for preventing or treating
fibrosis or respiratory disease according to the present invention
exhibits effects on the prevention or treatment of fibrosis or
respiratory disease by inhibiting connective tissue remodeling,
particularly pulmonary artery remodeling and airway remodeling.
[0115] In the present invention, the respiratory disease may be
chronic obstructive disease (COPD), asthma, acute and chronic
bronchitis, allergic rhinitis, cough, sputum, bronchitis,
bronchiolitis, sore throat, tonsillitis, or laryngitis, and the
fibrosis may be selected from the group consisting of idiopathic
pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis,
myocardial fibrosis, renal fibrosis, pulmonary fibrosis, cardiac
fibrosis, and radiation-induced fibrosis, but the present invention
is not limited thereto. In the present invention, the
radiation-induced fibrosis is a side effect that is frequently
caused by radiotherapy commonly used for the treatment of cancer,
tumors, etc., and the term "radiation-induced fibrosis" may be used
interchangeably with the term "radiation fibrosis syndrome
(RFS)".
[0116] For administration, the composition of the present invention
may further contain one or more pharmaceutically acceptable
carriers, in addition to the above-described active ingredient. The
pharmaceutically acceptable carriers should be compatible with the
active ingredient, and may be selected from among physiological
saline, sterile water, Ringer's solution, buffered saline, dextrose
solution, maltodextrin solution, glycerol, ethanol, and a mixture
of two or more thereof. If necessary, the composition may contain
other conventional additives such as an antioxidant, a buffer or a
bacteriostatic agent. In addition, a diluent, a dispersing agent, a
surfactant, a binder and a lubricant may additionally be added to
the composition to prepare injectable formulations such as an
aqueous solution, a suspension, and an emulsion. In particular, the
composition is preferably provided as a lyophilized formulation.
For the preparation of a lyophilized formulation, a conventional
method known in the technical field to which the present invention
pertains may be used, and a stabilizer for lyophilization may also
be added.
[0117] Furthermore, the composition may preferably be formulated
according to each disease or components by a suitable method known
in the art or by a method disclosed in Remington's Pharmaceutical
Science, Mack Publishing Company, Easton Pa.
[0118] The dose of the composition of the present invention may be
determined by a person skilled in the art based on the condition of
the patient and the severity of the disease. In addition, the
composition may be formulated in various dosage forms, including
powders, tablets, capsules, liquids, injectable solutions,
ointments and syrup formulations, and may be provided in
unit-dosage or multi-dosage containers, for example, sealed ampules
or vials.
[0119] The composition of the present invention may be administered
orally or parenterally. The composition according to the present
invention may be administered, for example, orally, via inhalation,
intravenously, intramuscularly, intraarterially, intramedullarily,
intradurally, intracardially, transdermally, subcutaneously,
intraperitoneally, intrarectally, sublingually, or topically, but
is not limited thereto. In particular, the composition may also be
administered into the lungs by intrabronchial instillation for the
treatment of respiratory disease. The dose of the composition
according to the present invention may vary depending on the
patient's weight, age, sex, state of health and diet, the duration
of administration, the mode of administration, excretion rate,
severity of disease, or the like, and may be easily determined by
those skilled in the art. In addition, for clinical administration,
the composition of the present invention may be prepared into a
suitable formulation using a known technique.
[0120] In another aspect, the present invention is directed to a
lyophilized formulation comprising the pharmaceutical composition
according to the present invention.
[0121] In still another aspect, the present invention is directed
to a method for preventing or treating fibrosis or respiratory
disease, the method comprising a step of administering the
pharmaceutical composition for preventing or treating fibrosis or
respiratory disease according to the present invention to a subject
in need of prevention or treatment of fibrosis or respiratory
disease.
[0122] In the present invention, the respiratory disease may be
chronic obstructive disease (COPD), asthma, acute and chronic
bronchitis, allergic rhinitis, cough, sputum, bronchitis,
bronchiolitis, sore throat, tonsillitis, or laryngitis, and the
fibrosis may be selected from the group consisting of idiopathic
pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis,
myocardial fibrosis, renal fibrosis, pulmonary fibrosis, cardiac
fibrosis, and radiation-induced fibrosis, but the present invention
is not limited thereto.
[0123] In yet another aspect, the present invention is directed to
provide the double-stranded oligonucleotide, a double-stranded
oligonucleotide structure comprising the same, and nanoparticle
comprising the double-stranded oligonucleotide structure, for use
in a method of the prevention or treatment of fibrosis or
respiratory disease.
[0124] In still yet another aspect, the present invention is
directed to a pharmaceutical composition for use in a method of the
prevention or treatment of fibrosis or respiratory disease.
[0125] In a further aspect, the present invention is directed to
the use of the double-stranded oligonucleotide, a double-stranded
oligonucleotide structure comprising the same, and nanoparticle
comprising the double-stranded oligonucleotide structure, for the
manufacture of a medicine for preventing fibrosis or respiratory
disease.
BRIEF DESCRIPTION OF DRAWINGS
[0126] FIG. 1 shows the results of screening 1,257 SAMiRNAs
targeting human amphiregulin.
[0127] FIG. 2 shows the nanoparticle size distributions of
double-stranded DNA/RNA hybrids comprising selected
amphiregulin-specific double-stranded oligonucleotides. (a):
SAMi-AREG #10, (b): SAMi-AREG #11, and (c): SAMi-AREG #12.
[0128] FIG. 3 shows the results of quantitatively analyzing the
mRNA expression levels of amphiregulin in Example 4, and depicts
graphs showing the relative mRNA expression levels (%) of
amphiregulin in the lung cancer cell line A549 with different
concentrations (200 and 600 nM) of SAMiRNA having each of the
sequences of SEQ ID NOs: 1 to 14 of the present invention as a
sense strand.
[0129] FIG. 4 shows the results of quantitatively analyzing the
expression level of amphiregulin mRNA in Example 5, and depicts
graphs showing the results of analyzing the relative mRNA
expression levels (%) of amphiregulin (FIG. 4(a)) and determining
the IC.sub.50 value of SAMiRNA (FIG. 4(b)) in the lung cancer cell
line A549 treated with different concentrations (12.5 nM, 25 nM, 50
nM, 100 nM, 200 nM, 600 nM and 1,200 nM) of SAMiRNA having the
sequence of SEQ ID NO: 10 of the present invention as a sense
strand.
[0130] FIG. 5 shows the results of quantitatively analyzing the
expression level of amphiregulin mRNA in Example 5, and depicts
graphs showing the results of analyzing the relative expression
levels (%) of amphiregulin mRNA (FIG. 5(a)) and determining the
IC.sub.50 value of SAMiRNA (FIG. 5(b)) in the lung cancer cell line
A549 treated with different concentrations (12.5 nM, 25 nM, 50 nM,
100 nM, 200 nM, 600 nM and 1,200 nM) of SAMiRNA having the sequence
of SEQ ID NO: 11 of the present invention as a sense strand.
[0131] FIG. 6 shows the results of quantitatively analyzing the
expression level of amphiregulin mRNA in Example 5, and depicts
graphs showing the results of analyzing the relative expression
levels (%) of amphiregulin mRNA (FIG. 6(a)) and determining the
IC.sub.50 value of SAMiRNA (FIG. 6(b)) in the lung cancer cell line
A549 treated with different concentrations (12.5 nM, 25 nM, 50 nM,
100 nM, 200 nM, 600 nM and 1,200 nM) of SAMiRNA having the sequence
of SEQ ID NO: 12 of the present invention as a sense strand.
[0132] FIG. 7 shows the results of an innate immune response test
for amphiregulin candidate sequences in Example 6, and depicts the
results obtained by treating human peripheral blood mononuclear
cells (PBMCs) with 2.5 .mu.M of amphiregulin-specific SAMiRNA
having each of the sequences of SEQ ID NOs: 10 (AR-1), 11 (AR-2)
and 12 (AR-3) of the present invention as a sense strand, analyzing
the relative increases in mRNA expression levels of innate
immune-related cytokines by amphiregulin-specific SAMiRNA, and
evaluating in vitro cytotoxicity using the human peripheral blood
mononuclear cells. (a): DNA/RNA hybrid SAMiRNA, and (b): RNA/RNA
hybrid SAMiRNA.
[0133] FIG. 8 shows the results of quantitatively analyzing the
mRNA expression levels of amphiregulin in Example 7, and is a graph
comparing the relative mRNA expression levels (%) of amphiregulin
by a double-stranded oligo DNA/RNA hybrid and an RNA/RNA hybrid,
each comprising selected amphiregulin-specific SAMiRNA. That is,
FIG. 8 is a graph comparing the mRNA expression levels of
amphiregulin in the lung cancer cell line A549 treated with
different concentrations (200 nM, 600 nM and 1,200 nM) of SAMiRNA
having each of the sequences of SEQ ID NOs: 10 (AR-1), 11 (AR-2)
and 12 (AR-3) of the present invention as a sense strand.
[0134] FIG. 9 shows the results of screening 237 SAMiRNA, which
target mouse amphiregulin, and 9 candidate sequences selected
therefrom.
[0135] FIG. 10A shows the results of quantitatively analyzing the
mRNA expression levels of mouse amphiregulin in Example 8, and is a
graph showing the relative mRNA expression levels (%) of
amphiregulin in the mouse lung fibroblast cell line MLg treated
with different concentrations (200 and 500 nM) of SAMiRNA having
each of the sequences of SEQ ID NOs: 19, 20 and 21 of the present
invention as a sense strand.
[0136] FIG. 10B shows the results of quantitatively analyzing the
mRNA expression levels of mouse amphiregulin in Example 8, and is a
graph showing the relative mRNA expression levels (%) of
amphiregulin in the mouse lung epithelial cell line LA-4 treated
with different concentrations (200, 500 and 1000 nM) of SAMiRNA
having each of the sequences of SEQ ID NOs: 19, 20 and 21 of the
present invention as a sense strand.
[0137] FIG. 11 depicts graphs showing the results of lung tissue
staining and the relative mRNA expression levels (%) of a target
gene and fibrosis marker genes after 1 mg/kg and 5 mg/kg of
SAMiRNA-AREG #20 were administered intravenously to mice with
silica-induced lung fibrosis in Example 9.
[0138] FIG. 12 depicts graphs showing the results of lung tissue
staining and the relative mRNA expression levels (%) of a target
gene and fibrosis marker genes after 5 mg/kg of SAMiRNA-AREG #20
was administered intravenously to mice with bleomycin-induced lung
fibrosis in Example 10.
[0139] FIG. 13 depicts graphs showing the relative mRNA expression
levels (%) of a target gene, fibrosis marker genes and inflammation
marker genes in renal tissue after 1 mg/kg and 5 mg/kg of
SAMiRNA-AREG #20 were administered intravenously to UUO model mice
subjected to UUO surgery in Example 11.
DETAILED DESCRIPTION AND PREFERRED EMBODIMENTS OF THE INVENTION
[0140] Hereinafter, the present invention will be described in more
detail with reference to examples. It will be obvious to those
skilled in the art that these examples are only to explain the
present invention in more detail and the scope of the present
invention is not limited by these examples. Thus, the substantial
scope of the present invention will be defined by the appended
claims and equivalents thereto.
[0141] In the present invention, three specific sequences capable
of inhibiting amphiregulin expression were identified, and it was
confirmed that these sequences can bind complementarily to an mRNA
encoding amphiregulin and effectively inhibit amphiregulin
expression, thereby effectively treating fibrosis and respiratory
diseases.
Example 1. Algorithm for Screening of SAMiRNAs Targeting
Amphiregulin and Selection of Candidate Sequences
[0142] SAMiRNA-based drug high-throughput screening is a method in
which all possible candidate sequences are generated by applying a
1-base or 2-base sliding window algorithm to the entire mRNA,
unnecessary candidate sequences are removed by performing homology
filtering, and the degrees to which the expression of the gene of
interest is inhibited by all the finally selected SAMiRNAs are
determined.
[0143] First, a design process for SAMiRNA candidate sequences
against amphiregulin was performed. Specifically, 1,257 SAMiRNA
candidate sequences, each consisting of 19 nucleotides, were
selected by applying a 1-basesliding window algorithm to the human
amphiregulin mRNA NM_001657.3 (1,290 bp), and an experiment on the
degree of inhibition of amphiregulin was performed.
Example 2. Synthesis of Double-Stranded Oligo RNA Structure
[0144] A double-stranded oligo RNA structure (SAMiRNA) produced in
the present invention is represented by the following structural
formula:
C.sub.24-5'S
3'-(hexaethyleneglycol-PO.sub.4.sup.-).sub.3-hexaethyleneglycol AS
5T-PO4
[0145] For synthesis of the sense strain of a monoSAMiRNA (n=4)
double-stranded oligo structure, 3,4,6-triacetyl-1-hexa(ethylene
glycol)-N-acetyl galactosamine-CPG was used as a support, and three
demethoxytrityl (DMT) hexaethylene glycol phosphoramidates as
hydrophilic monomers were continuously bound to the support through
a reaction. Next, synthesis of RNA or DNA was performed, and then
hydrophobic C24 (C6-S--S--C18) containing a disulfide bond was
bound to the 5' end region, thereby synthesizing the sense strand
of monoSAMiRNA (n=4) in which
NAG-hexaethyleneglycol-(--PO.sub.3.sup.- hexaethyleneglycol).sub.3
is bound to the 3' end and C.sub.24 (C6-S--S--C.sub.18) is bound to
the 5' end.
[0146] After completion of the synthesis, the synthesized RNA
single strand and oligo (DNA or RNA)-polymer structure were
detached from the CPG by treatment with 28% (v/v) ammonia in a
water bath at 60.degree. C., and then protective residues were
removed by a deprotection reaction. After removal of the protective
residues, the RNA single strand and the oligo (DNA or RNA)-polymer
structure were treated with N-methylpyrrolidone, trimethylamine and
triethylaminetrihydrofluoride at a volume ratio of 10:3:4 in an
oven at 70.degree. C. to remove 2'-TBDMS (tert-butyldimethylsilyl).
An RNA single strand, an oligo (DNA or RNA)-polymer structure and a
ligand-bound oligo (DNA or RNA)-polymer structure were separated
from the reaction products by high-performance liquid
chromatography (HPLC), and the molecular weights thereof were
measured by a MALDI-TOF mass spectrophotometer (MALDI TOF-MS,
SHIMADZU, Japan) to confirm whether they would match the nucleotide
sequence and polymer structure desired to be synthesized.
Thereafter, to produce each double-stranded oligo structure, the
sense strand and the antisense strand were mixed together, added to
1.times. annealing buffer (30 mM HEPES, 100 mM potassium acetate, 2
mM magnesium acetate, pH 7.0 to 7.5), allowed to react in a water
bath at 90.degree. C. for 3 minutes, and then allowed to react at
37.degree. C., thereby producing the desired SAMiRNA. Annealing of
the produced double-stranded oligo RNA structures was confirmed by
electrophoresis.
Example 3. High-Throughput Screening (HTS) of SAMiRNA Nanoparticles
that Target Human Amphiregulin and Induce RNAi
[0147] 3-1 Production of SAMiRNA Nanoparticles
[0148] 1,257 SAMiRNAs targeting amphiregulin sequences, synthesized
in Example 2, were dissolved in 1.times. Dulbecco's phosphate
buffered saline (DPBS) (WELGENE, KR) and freeze-dried in a freeze
dryer (LGJ-100F, CN) for 5 days. The freeze-dried nanoparticle
powders were dissolved and homogenized in 1.429 ml of deionized
distilled water (Bioneer, KR) and used in an experiment for the
present invention.
[0149] 3-2 Treatment of Cells with SAMiRNA Nanoparticles
[0150] To identify SAMiRNA that inhibits amphiregulin expression,
the human lung cancer line A549 was used. The A549 cell line was
cultured in Gibcom Ham's F-12K (Kaighn's) medium (Thermo, US)
containing 10% fetal bovine serum (Hyclone, US) and 1%
penicillin-streptomycin (Hyclone, US) at 37.degree. C. under 5%
CO.sub.2. Using the same medium as above, the A549 cell line was
dispensed into a 96-well plate (Costar, US) at a density of
2.times.10.sup.4 cells/well. The next day, the SAMiRNA homogenized
with deionized distilled water in Example 3.1 above was diluted
with 1.times.DPBS, and the cells were treated with the dilution to
a SAMiRNA concentration of 500 nM or 1,000 nM. Treatment with the
SAMiRNA was performed a total of four times (once every 12 hours),
and the cells were cultured at 37.degree. C. under 5% CO.sub.2.
[0151] 3-3 Screening of SAMiRNA by Inhibition Analysis of mRNA
Expression of Human Amphiregulin
[0152] Total RNA was extracted from the cell line treated with
SAMiRNA in Example 3-2, and was synthesized into cDNA, and then the
relative mRNA expression level of the amphiregulin gene was
quantified by real-time PCR.
[0153] For analysis of the mRNA expression level of the
amphiregulin gene, 300 nM AREG forward primer, 300 nM AREG reverse
primer, 300 nM AREG probe, 300 nM RPL13A forward primer, 300 nM
RPL13A reverse primer, 300 nM RPL13A probe, 400 nM TBP forward
primer, 400 nM TBP reverse primer, and 300 nM TBP probe were added
to each well of AccuPower.RTM. Dual-HotStart RT-qPCR kit (Bioneer,
Korea) and dried (Table 2, the sequences of the primers and
hydrolysis probes used in the high-throughput screening (HTS)
experiment). To evaluate the performance of the prepared kit, a
calibration curve was created using the A549 cell total RNA and the
PCR amplification efficiency was determined (Table 3). RT-qPCR was
performed under the following conditions: 95.degree. C. for 5 min,
and then 45 cycles, each consisting of 95.degree. C. for 5 sec and
58.degree. C. for 15 sec. A protocol in which a fluorescence value
is detected in each cycle was used.
[0154] The 96-well plate (Costar, US) treated with SAMiRNA was
subjected to total RNA extraction and one-step RT-qPCR according to
an automated program using the automated system ExiStation HT.TM.
Korea and the separately prepared AccuPower.RTM. Dual-HotStart
RT-qPCR kit (Bioneer, Korea) comprising primers and probes for
analysis of amphiregulin.
[0155] Based on the Ct values of two genes obtained after qPCR
array, the relative mRNA expression level of amphiregulin in the
test group compared to that in the control group was analyzed by
the 2(-Delta Delta C(T)) method [Livak K J, Schmittgen T D. 2001.
Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods.
December; 25(4):4 02-8].
TABLE-US-00003 TABLE 2 Sequences of primers and hydrolysis probes
used in high-throughput screening (HTS) experiment AREG Forward
primer CAGTGCTGATGGATTTGAGGT (SEQ ID NO: 26) AREG Reverse primer
ATAGCCAGGTATTTGTGGTTCG (SEQ ID NO: 27) AREG probe 5'FAM -
TGAACCGTCCTCGGGAGC CGACT - 3'EBQ (SEQ ID NO: 28) RPL13A Forward
GTGTTTGACGGCATCCCACC primer (SEQ ID NO: 29) RPL13A Reverse
TAGGCTTCAGACGCACGACC primer (SEQ ID NO: 30) RPL13A probe 5'TAMRA-
AAGCGGATGGTGGTTCC TGCT - 3'EBQ (SEQ ID NO: 31) TBP Forward primer
CACCACAGCTCTTCCACTC (SEQ ID NO: 32) TBP Reverse primer
ATCCCAGAACTCTCCGAAGC (SEQ ID NO: 33) TBP probe 5'TEXASRED -
ACCCTTGCCGGGCAC CACTC - 3'EBQ (SEQ ID NO: 34)
TABLE-US-00004 TABLE 3 3-plex RT-qPCR amplification efficacy Slope
R.sup.2 Efficiency AREG Y = -0.2778X + 12.3894 0.9998 90% RPL13A Y
= -0.2863X + 10.5964 0.9999 93% TBP Y = -0.2892X + 13.0351 0.9946
95%
[0156] To select highly efficient SAMiRNA, 14 SAMiRNAs were
selected, which had each of the sequences of SEQ ID NOs: 1 to 14 as
a sense strand. Here, the selected SAMiRNAs showed the highest
efficiency with which the mRNA expression level of amphiregulin at
a final concentration of 500 nM or 1,000 nM decreased compared to
the control.
[0157] As shown in FIG. 1, 14 SAMiRNAs that most effectively
inhibit amphiregulin gene expression were finally selected from
1,257 SAMiRNAs targeting amphiregulin. Information on the sequences
of the selected SAMiRNAs is shown in Table 4 below.
TABLE-US-00005 TABLE 4 Amphiregulin-specific SAMiRNA candidate
sequences selected by 1-base sliding window screening and
high-throughput screening (HTS) SEQ ID NO Accession No. Position
Sequence (DNA/RNA) 1 NM_001657.3 8-26 Sense CCTATAAAGCGGCAGGTGC 35
Antisense GCACCUGCCGCUUUAUAGG 2 NM_001657.3 130-148 Sense
GAGCGGCGCACACTCCCGG 36 Antisense CCGGGAGUGUGCGCCGCUC 3 NM_001657.3
195-213 Sense GTCCCAGAGACCGAGTTGC 37 Antisense GCAACUCGGUCUCUGGGAC
4 NM_001657.3 224-242 Sense GAGACGCCGCCGCTGCGAA 38 Antisense
UUCGCAGCGGCGGCGUCUC 5 NM_001657.3 270-288 Sense CCGGCGCCGGTGGTGCTGT
39 Antisense ACAGCACCACCGGCGCCGG 6 NM_001657.3 278-296 Sense
GGTGGTGCTGTCGCTCTTG 40 Antisense CAAGAGCGACAGCACCACC 7 NM_001657.3
289-307 Sense CGCTCTTGATACTCGGCTC 41 Antisense GAGCCGAGUAUCAAGAGCG
8 NM_001657.3 292-310 Sense TCTTGATACTCGGCTCAGG 42 Antisense
CCUGAGCCGAGUAUCAAGA 9 NM_001657.3 329-347 Sense GGACCTCAATGACACCTAC
43 Antisense GUAGGUGUCAUUGAGGUCC 10 NM_001657.3 341-359 Sense
CACCTACTCTGGGAAGCGT 44 Antisense ACGCUUCCCAGAGUAGGUG 11 NM_001657.3
342-360 Sense ACCTACTCTGGGAAGCGTG 45 Antisense CACGCUUCCCAGAGUAGGU
12 NM_001657.3 349-367 Sense CTGGGAAGCGTGAACCATT 46 Antisense
AAUGGUUCACGCUUCCCAG 13 NM_001657.3 353-371 Sense
GAAGCGTGAACCATTTTCT 47 Antisense AGAAAAUGGUUCACGCUUC 14 NM_001657.3
368-386 Sense TTCTGGGGACCACAGTGCT 48 Antisense
AGCACUGUGGUCCCCAGAA
Example 4. Screening of SAMiRNA Nanoparticles that Target Human
Amphiregulin and Induce RNAi
[0158] The lung cancer cell line A549 was treated with SAMiRNA
(selected in Example 3) having each of the sequences of SEQ ID NOs:
1 to 14 as a sense strand, and the expression pattern of
amphiregulin mRNA in the cell line was analyzed.
[0159] 4-1 Treatment of Cells with SAMiRNA Nanoparticles
[0160] To identify SAMiRNA that inhibits amphiregulin expression,
the human lung cancer line A549 was used. The A549 cell line was
cultured in Gibcom Ham's F-12K (Kaighn's) medium (Thermo, US)
containing 10% fetal bovine serum (Hyclone, US) and 1%
penicillin-streptomycin (Hyclone, US) at 37.degree. C. under 5%
CO.sub.2. Using the same medium as above, the A549 cell line was
dispensed into a 12-well plate (Costar, US) at a density of
8.times.10.sup.4 cells/well. The next day, the SAMiRNA homogenized
with deionized distilled water in Example 3.1 above was diluted
with 1.times.DPBS, and the cells were treated with the dilution to
a SAMiRNA concentration of 200 nM or 600 nM. Treatment with the
SAMiRNA was performed a total of four times (once every 12 hours),
and the cells were cultured at 37.degree. C. under 5% CO.sub.2.
[0161] 4-2 Screening of SAMiRNA by Inhibition Analysis of Human
Amphiregulin mRNA Expression
[0162] Total RNA was extracted from the cell line treated with
SAMiRNA in Example 4-1 and was synthesized into cDNA, and then the
relative mRNA expression level of the amphiregulin gene was
quantified by real-time PCR.
[0163] 4-2-1 RNA Isolation from SAMiRNA-Treated Cells and cDNA
Synthesis
[0164] Using an RNA extraction kit (AccuPrep Cell total RNA
extraction kit, BIONEER, Korea), total RNA was extracted from the
cell line treated with SAMiRNA in Example 4-1 above. The extracted
RNA was synthesized into cDNA in the following manner using RNA
reverse transcriptase (AccuPower.RTM. RocketScript.TM.Cycle RT
Premix with oligo (dT)20, Bioneer, Korea). Specifically, 1 .mu.g of
the extracted RNA was added to AccuPower.RTM. RocketScript.TM.Cycle
RT Premix with oligo (dT)20 (Bioneer, Korea) in each 0.25 ml
Eppendorf tube, and distilled water treated with DEPC (diethyl
pyrocarbonate) was added thereto to a total volume of 20 .mu.l. In
a gene amplification system (MyGenie.TM.96 Gradient Thermal Block,
BIONEER, Korea), a process of hybridizing the RNA with primers at
37.degree. C. for 30 seconds and a process of synthesizing cDNA at
48.degree. C. for 4 minutes were repeated 12 times. Then, the
amplification reaction was terminated by deactivating the enzyme at
95.degree. C. for 5 minutes.
[0165] 4-2-2 Quantitative Analysis of Relative mRNA Expression
Level of Human Amphiregulin mRNA
[0166] Using the cDNA synthesized in Example 4-2-1 as a template,
SYBR green real-time qPCR was performed, and the relative mRNA
expression level of amphiregulin compared to a SAMiRNA control
sample was analyzed in the following manner. The cDNA synthesized
in Example 4-2-1 above was diluted 5-fold with distilled water, and
for analysis of the mRNA expression level of amphiregulin, 3 .mu.l
of the diluted cDNA, 25 .mu.l of AccuPower.RTM. 2.times.
GreenStar.TM. qPCR MasterMix (BIONEER, Korea), 19 .mu.l of
distilled water, and 3 .mu.l of amphiregulin qPCR primers (SEQ ID
NOs: 17 and 18 (Table 5); 10 pmole/.mu.l for each primer, BIONEER,
Korea) were added to each well of a 96-well plate to make a
mixture. Meanwhile, GAPDH (glyceraldehyde 3-phosphate
dehydrogenase), a housekeeping gene (hereinafter referred to as HK
gene), was used as a standard gene to normalize the mRNA expression
level of amphiregulin. The 96-well plate containing the mixture was
subjected to the following reaction using Exicycler.TM. Real-Time
Quantitative Thermal Block (BIONEER, Korea). Specifically, the
mixture was allowed to react at 95.degree. C. for 15 minutes to
activate the enzyme and remove the secondary structure of the cDNA,
and then the mixture was subjected to 42 cycles, each consisting of
denaturation at 94.degree. C. for 30 sec, annealing at 58.degree.
C. for 30 sec, extension at 72.degree. C. for 30 sec, and SYBR
green scan, and to final extension at 72.degree. C. for 3 minutes.
Next, the mixture was maintained at a temperature of 55.degree. C.
for 1 minute, and the melting curve from 55.degree. C. to
95.degree. C. was analyzed.
[0167] After completion of the PCR, the Ct (threshold cycle) value
of the target gene was corrected by the GAPDH gene, and then the
.DELTA.Ct value was calculated using a control treated with the
control sequence SAMiRNA (SAMiCONT) that does not induce gene
expression inhibition. The relative expression level of the target
gene in the cells treated with the amphiregulin-specific SAMiRNA
was quantified using the .DELTA.Ct value and the equation
2(-.DELTA.Ct).times.100.
[0168] To select highly efficient SAMiRNAs, 14 SAMiRNAs were
selected, which had each of the sequences of SEQ ID NOs: 10, 11 and
12 as a sense strand. Here, the selected SAMiRNAs showed the
highest efficiency with which the mRNA expression level of
amphiregulin at a final concentration of 200 nM or 600 nM decreased
compared to the control.
[0169] As shown in FIG. 3, three SAMiRNAs that most effectively
inhibit amphiregulin gene expression were finally selected from 14
SAMiRNAs targeting amphiregulin. Information on the sequences of
the selected SAMiRNAs is shown in Table 6 below.
TABLE-US-00006 TABLE 5 Information on primer sequences for qPCR
Primer Sequence SEQ ID NO hGAPDH-F GGTGAAGGTCGGAGTCAACG 15 hGAPDH-R
ACCATGTAGTTGAGGTCAATGAAGG 16 hAREG-F ACACCTACTCTGGGAAGCGT 17
hAREG-R GCCAGGTATTTGTGGTTCGT 18
(F denotes a forward primer, and R denotes a reverse primer)
TABLE-US-00007 TABLE 6 SAMiRNA sequences that effectively inhibit
amphiregulin expression SEQ Sense ID NO Code Name Position strand
sequence 10 SAMi-AREG#10 341-359 CACCTACTCTGGGAAGCGT 11
SAMi-AREG#11 342-360 ACCTACTCTGGGAAGCGTG 12 SAMi-AREG#12 349-367
CTGGGAAGCGTGAACCATT
Example 5. Inhibition of Human Amphiregulin Expression in Lung
Cancer Cell Line (A549) by Selected SAMiRNAs
[0170] The lung cancer cell line A549 was treated with the SAMiRNA
(selected in Example 4) having each of the sequences of SEQ ID NOs:
10, 11 and 12 as a sense strand, and the expression pattern of
amphiregulin mRNA in the cell line was analyzed to determine the
IC.sub.50 value of the SAMiRNA.
[0171] 5-1 Production and Particle Size Analysis of SAMiRNA
Nanoparticles
[0172] Each of the three SAMiRNAs targeting the amphiregulin
sequence, synthesized in Example 2, was dissolved in 1.times.
Dulbecco's phosphate buffered saline (DPBS) (WELGENE, KR) and
freeze-dried in a freeze dryer (LGJ-100F, CN) for 5 days. The
freeze-dried nanoparticle powders were dissolved and homogenized in
2 ml of deionized distilled water (Bioneer, KR) and used in an
experiment for the present invention. To analyze the particle size
of the produced SAMiRNA nanoparticles, the size and polydispersity
index of the SAMiRNA were measured using Zetasizer Nano ZS
(Malvern, UK). The results of measuring the size and polydispersity
index of the SAMiRNA nanoparticles are shown in Table 7 below and
graphically shown in FIG. 2.
TABLE-US-00008 TABLE 7 Size and polydispersity index of
amphiregulin-specific SAMiRNA nanoparticles Code Name Size PDI
SAMi-AREG#10 103.9 .+-. 3.8 0.406 .+-. 0.065 SAMi-AREG#11 99.9 .+-.
4.0 0.501 .+-. 0.005 SAMi-AREG#12 170.1 .+-. 7.5 0.457 .+-.
0.084
[0173] 5-2 Treatment of Cells with SAMiRNA Nanoparticles
[0174] To evaluate the effect of the selected SAMiRNAs that inhibit
amphiregulin expression, the human lung cancer cell line A549 was
used. The A549 cell line was cultured in Gibcom Ham's F-12K
(Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum
(Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US) at
37.degree. C. under 5% CO.sub.2. Using the same medium as above,
the A549 cell line was dispensed into a 12-well plate (Costar, US)
at a density of (Costar, US) 8.times.10.sup.4 cells/well. The next
day, the SAMiRNA homogenized with deionized distilled water in
Example 5.1 above was diluted with 1.times.DPBS, and the cells were
treated with the dilution to a SAMiRNA concentration of 12.5 nM, 25
nM, 50 nM, 100 nM, 200 nM, 600 nM or 1200 nM. Treatment of the
cells with the SAMiRNA was performed a total of four times (once
every 12 hours), and the cells were cultured at 37.degree. C. under
5% CO.sub.2.
[0175] 5-3 Determination of IC.sub.50 of SAMiRNA by Inhibition
Analysis of mRNA Expression of Human Amphiregulin
[0176] Total RNA was extracted from the cell line treated with the
SAMiRNA in Example 5-2 and was synthesized into cDNA, and then the
relative mRNA expression level of the amphiregulin gene was
quantified by real-time PCR.
[0177] 5-3-1 RNA Isolation from SAMiRNA-Treated Cells and cDNA
Synthesis
[0178] Using an RNA extraction kit (AccuPrep Cell total RNA
extraction kit, BIONEER, Korea), total RNA was extracted from the
cell line treated with the SAMiRNA in Example 5-2 above. The
extracted RNA was synthesized into cDNA in the following manner
using RNA reverse transcriptase (AccuPower.RTM.
RocketScrip.TM.Cycle RT Premix with oligo (dT)20, Bioneer, Korea).
Specifically, 1 .mu.g of the extracted RNA was added to
AccuPower.RTM. RocketScrip.TM.Cycle RT Premix with oligo (dT)20
(Bioneer, Korea) in each 0.25 ml Eppendorf tube, and distilled
water treated with DEPC (diethyl pyrocarbonate) was added thereto
to a total volume of 20 .mu.l. In a gene amplification system
(MyGenie.TM.96 Gradient Thermal Block, BIONEER, Korea), a process
of hybridizing the RNA with primers at 37.degree. C. for 30 seconds
and a process of synthesizing cDNA at 48.degree. C. for 4 minutes
were repeated 12 times. Then, the amplification reaction was
terminated by deactivating the enzyme at 95.degree. C. for 5
minutes.
[0179] 5-3-2 Quantitative Analysis of Relative mRNA Expression
Level of Human Amphiregulin
[0180] Using the cDNA synthesized in Example 5-3-1 as a template,
SYBR green real-time qPCR was performed, and the relative mRNA
expression level of amphiregulin compared to a SAMiRNA control
sample was analyzed in the following manner. The cDNA synthesized
in Example 5-3-1 above was diluted 5-fold with distilled water, and
for analysis of the mRNA expression level of amphiregulin, 3 .mu.l
of the diluted cDNA, 25 .mu.l of AccuPower.RTM. 2.times.
GreenStar.TM. qPCR MasterMix (BIONEER, Korea), 19 .mu.l of
distilled water, and 3 .mu.l of amphiregulin qPCR primers (SEQ ID
NOs: 17 and 18 (Table 5); 10 pmole/.mu.l for each primer, BIONEER,
Korea) were added to each well of a 96-well plate to make a
mixture. Meanwhile, GAPDH (glyceraldehyde 3-phosphate
dehydrogenase), a housekeeping gene (hereinafter referred to as HK
gene), was used as a standard gene to normalize the mRNA expression
level of amphiregulin. The 96-well plate containing the mixture was
subjected to the following reaction using Exicycler.TM. Real-Time
Quantitative Thermal Block (BIONEER, Korea). Specifically, the
mixture was allowed to react at 95.degree. C. for 15 minutes to
activate the enzyme and remove the secondary structure of the cDNA,
and then the mixture was subjected to 42 cycles, each consisting of
denaturation at 94.degree. C. for 30 sec, annealing at 58.degree.
C. for 30 sec, extension at 72.degree. C. for 30 sec, and SYBR
green scan, and to final extension at 72.degree. C. for 3 minutes.
Next, the mixture was maintained at a temperature of 55.degree. C.
for 1 minute, and the melting curve from 55.degree. C. to
95.degree. C. was analyzed.
[0181] After completion of the PCR, the Ct (threshold cycle) value
of the target gene was corrected by the GAPDH gene was determined,
and then the .DELTA.Ct value was calculated using a control treated
with the control sequence SAMiRNA (SAMiCONT) that does not induce
gene expression inhibition. The relative expression level of the
target gene in the cells treated with the amphiregulin-specific
SAMiRNA was quantified using the .DELTA.Ct value and the equation
2(-.DELTA.Ct).times.100.
[0182] As a result, it was confirmed that all the
amphiregulin-specific SAMiRNAs having each of the sequences of SEQ
ID NOs: 10, 11 and 12 as a sense strand showed a 50% or more
decrease in the mRNA expression level of amphiregulin even at a low
concentration of 100 nM, suggesting that the amphiregulin-specific
SAMiRNAs exhibited the effect of inhibiting amphiregulin expression
with high efficiency. It was confirmed that the IC.sub.50 values
were 28.75 nM as shown in FIG. 4 for the amphiregulin-specific
SAMiRNA having the sequence of SEQ ID NO: 10 as a sense strand,
26.04 nM as shown in FIG. 5 for the amphiregulin-specific SAMiRNA
having the sequence of SEQ ID NO: 11 as a sense strand, and 12.07
nM as shown in FIG. 6 for the amphiregulin-specific SAMiRNA having
the sequence of SEQ ID NO: 12 as a sense strand. In particular, it
was confirmed that the amphiregulin-specific SAMiRNA having the
sequence of SEQ ID NO: 12 as a sense strand showed a 50% or more
decrease in the mRNA expression level of amphiregulin even at a low
concentration of 25 nM as shown in FIG. 6, suggesting that it
exhibited the effect of most effectively inhibiting amphiregulin
gene expression among the three selected sequences.
Example 6. Evaluation of In Vitro Cytotoxicity
[0183] Using Human Peripheral Blood Mononuclear Cells (PBMCs)
[0184] In order to examine whether the mRNA expression levels of
innate immune-related cytokines are increased by SAMi-hAREG,
ePBMC.RTM. cryopreserved human PBMCs (human peripheral monocular
cells), Cellular Technology Limited, USA) were dispensed at a
density of 5.times.10.sup.5 cells per well into a 12-well plate
(Costar.RTM. USA) with RPMI1640 (Hyclonem) medium containing 10%
FBS (fetal bovine serum; Hyclone.TM.) The cells were cultured in a
5% CO.sub.2 incubator at 37.degree. C. for 1 hour so as to be
stabilized, and then the dispensed PBMCs were treated with 2.5
.mu.M of each of SAMi-CON (DNA/RNA), SAMi-hAREG #10 (DNA/RNA),
SAMi-hAREG #11 (DNA/RNA), SAMi-hAREG #12 (DNA/RNA), SAMi-CON
(RNA/RNA), SAMi-hAREG #10 (RNA/RNA), SAMi-hAREG #11 (RNA/RNA), an d
SAMi-hAREG #12 (RNA/RNA), and cultured in a 5% CO.sub.2 incubator
at 37.degree. C. for 6 hours. As a positive control, 20 .mu.g/ml of
Concanavalin A (Sigma Aldrich, USA) was used.
[0185] Thereafter, all the cells were harvested, and total RNA was
extracted therefrom using an RNeasy Mini Kit (Qiagen, Germany) and
an RNase-Free DNase Set (Qiagen, Germany) according to the
manufacturer's protocols.
[0186] 200 ng of the extracted RNA was mixed with deionized sterile
DW (Bioneer, Korea) and RNA reverse transcriptase (AccuPower.RTM.
RocketScrip.TM.Cycle RT Premix with oligo (dT)20, Bioneer, Korea),
and the mixture was allowed to react using a gene amplification
system (MyGenie.TM.96 Gradient Thermal Block, BIONEER, Korea) under
conditions of 12 cycles, each consisting of 37.degree. C. for 30
sec, 48.degree. C. for 4 min and 55.degree. C. for 30 sec, and then
95.degree. C. for 5 min, thereby synthesizing a total of 20 .mu.l
of cDNA.
[0187] The synthesized cDNA was mixed with qPCR primers for each of
RPL13A, IL1B, IL6, IFNG, TNF and IL12B genes and then amplified
using Exicycler.TM.96 Real-Time Quantitative Thermal Block
(Bioneer, Korea) under the following conditions: 95.degree. C. for
5 min, and then 45 cycles, each consisting of 95.degree. C. for 5
sec and 58.degree. C. for 15 sec.
[0188] Based on the Ct values of two genes obtained after qPCR
array, the relative mRNA expression level in the test group
compared to that in the control group was analyzed by the 2(-Delta
Delta C(T)) Method [Livak K J, Schmittgen T D. 2001. Analysis of
relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) Method. Methods. December; 25(4):4
02-8].
[0189] As a result, as shown in FIG. 7, it was confirmed that the
expression of innate immune-related cytokines in the human
peripheral blood mononuclear cells (human PBMCs) by each of
amphiregulin-specific SAMiRNA #10, SAMiRNA #11 and SAMiRNA #12 was
not observed.
Example 7. Comparative Analysis of Human Amphiregulin Expression
Inhibition by DNA/RNA Hybrid and RNA/RNA Hybrid SAMiRNAs Comprising
Each of Selected Sequences of SEQ ID NOs: 10, 11 and 12 as Sense
Strand
[0190] The lung cancer cell line A549 was treated with each of a
double stranded DNA/RNA hybrid and RNA/RNA hybrid comprising the
amphiregulin-specific SAMiRNA (selected in Example 4) having each
of the sequences of SEQ ID NOs: 10, and 12 as a sense strand, and
the relative mRNA expression levels (%) of amphiregulin in the cell
line were comparatively analyzed.
[0191] 7-1 Treatment of Cells with SAMiRNA Nanoparticles
[0192] To identify SAMiRNA that inhibits amphiregulin expression,
the human lung cancer line A549 was used. The A549 cell line was
cultured in Gibcom Ham's F-12K (Kaighn's) medium (Thermo, US)
containing 10% fetal bovine serum (Hyclone, US) and 1%
penicillin-streptomycin (Hyclone, US) at 37.degree. C. under 5%
CO.sub.2. Using the same medium as above, the A549 cell line was
dispensed into a 12-well plate (Costar, US) at a density of
8.times.10.sup.4 cells/well. The next day, the SAMiRNA homogenized
with deionized distilled water in Example 3.1 above was diluted
with 1.times.DPBS, and the cells were treated with the dilution to
a SAMiRNA concentration of 200 nM, 600 nM or 1200 nM. Treatment of
the cells with the SAMiRNA was performed a total of four times
(once every 12 hours), and the cells were cultured at 37.degree. C.
under 5% CO.sub.2.
[0193] 7-2 Screening of SAMiRNA by Inhibition Analysis of mRNA
Expression of Human Amphiregulin
[0194] Total RNA was extracted from the cell line treated with
SAMiRNA in Example 7-1 and was synthesized into cDNA, and then the
relative mRNA expression level of the amphiregulin gene was
quantified by real-time PCR.
[0195] 7-2-1 RNA Isolation from SAMiRNA-Treated Cells and cDNA
Synthesis
[0196] Using an RNA extraction kit (AccuPrep Cell total RNA
extraction kit, BIONEER, Korea), total RNA was extracted from the
cell line treated with SAMiRNA in Example 7-1 above. The extracted
RNA was synthesized into cDNA in the following manner using RNA
reverse transcriptase (AccuPower.RTM. RocketScrip.TM.Cycle RT
Premix with oligo (dT)20, Bioneer, Korea). Specifically, 1 .mu.g of
the extracted RNA was added to AccuPower.RTM. RocketScrip.TM.Cycle
RT Premix with oligo (dT)20 (Bioneer, Korea) in each 0.25 ml
Eppendorf tube, and distilled water treated with DEPC (diethyl
pyrocarbonate) was added thereto to a total volume of 20 .mu.l. In
a gene amplification system (MyGenie.TM.96 Gradient Thermal Block,
BIONEER, Korea), a process of hybridizing the RNA with primers at
37.degree. C. for 30 seconds and a process of synthesizing cDNA at
48.degree. C. for 4 minutes were repeated 12 times. Then, the
amplification reaction was terminated by deactivating the enzyme at
95.degree. C. for 5 minutes.
[0197] 7-2-2 Quantitative Analysis of Relative mRNA Expression
Level of Human Amphiregulin
[0198] Using the cDNA synthesized in Example 7-2-1 as a template,
SYBR green real-time qPCR was performed, and the relative mRNA
expression level of amphiregulin compared to a SAMiRNA control
sample was analyzed in the following manner. The cDNA synthesized
in Example 7-2-1 above was diluted 5-fold with distilled water, and
for analysis of the mRNA expression level of amphiregulin, and 3
.mu.l of the diluted cDNA, 25 .mu.l of AccuPower.RTM. 2.times.
GreenStar.TM. qPCR MasterMix (BIONEER, Korea), 19 .mu.l of
distilled water, and 3 .mu.l of amphiregulin qPCR primers (SEQ ID
NOs: 17 and 18 (Table 5); 10 pmole/.mu.l for each primer, BIONEER,
Korea) were added to each well of a 96-well plate to make a
mixture. Meanwhile, GAPDH (glyceraldehyde 3-phosphate
dehydrogenase), a housekeeping gene (hereinafter referred to as HK
gene), was used as a standard gene to normalize the mRNA expression
level of amphiregulin. The 96-well plate containing the mixture was
subjected to the following reaction using Exicycler.TM. Real-Time
Quantitative Thermal Block (BIONEER, Korea). Specifically, the
mixture was allowed to react at 95.degree. C. for 15 minutes to
activate the enzyme and remove the secondary structure of the cDNA,
and then the mixture was subjected to 42 cycles, each consisting of
denaturation at 94.degree. C. for 30 sec, annealing at 58.degree.
C. for 30 sec, extension at 72.degree. C. for 30 sec, and SYBR
green scan, and to final extension at 72.degree. C. for 3 minutes.
Next, the mixture was maintained at a temperature of 55.degree. C.
for 1 minute, and the melting curve from 55.degree. C. to
95.degree. C. was analyzed.
[0199] After completion of the PCR, the Ct (threshold cycle) value
of the target gene was corrected by the GAPDH gene, and then the
.DELTA.Ct value was calculated using a control treated with the
control sequence SAMiRNA (SAMiCONT) that does not induce gene
expression inhibition. The relative expression level of the target
gene was quantified using the .DELTA.Ct value and the equation
2(-.DELTA.Ct).times.100.
[0200] To select highly efficient SAMiRNA from the double-stranded
DNA/RNA hybrid and RNA/RNA hybrid, the DNA/RNA hybrid SAMiRNA
having the sequence of SEQ ID NO: 12 as a sense strand was finally
selected. Here, the selected sequence DNA/RNA hybrid SAMiRNA (a
gene expression inhibition of 90% or more) showed the highest
efficiency with the mRNA expression level of amphiregulin at a
final concentration of 200 nM, 600 nM or 1200 nM decreased compared
to the control.
[0201] As shown in FIG. 8, the DNA/RNA hybrid SAMiRNA 12 that most
effectively inhibits amphiregulin gene expression was finally
selected from the DNA/RNA and RNA/RNA hybrids comprising the three
selected amphiregulin-specific SAMiRNAs, respectively.
Example 8. High-Throughput Screening (HTS) of SAMiRNA Nanoparticles
That Target Mouse Amphiregulin and Induce RNAi
[0202] In the case of siRNA therapeutic agents, it is difficult to
identify an optimal sequence that is applicable to different
strains. In this case, US FDA guidelines are applied, according to
which a DNA sequence (surrogate sequence; mouse gene-specific
siRNA) specific for an animal model for analysis of therapeutic
effects (an in vivo efficacy test) is designed so as to verify
pharmacological activity resulting from the inhibition of
expression of the gene of interest and toxicity resulting from the
inhibition of expression of the gene of interest (presentation by
Robert T. Dorsam Ph.D. Pharmacology/Toxicology Reviewer,
FDA/CDER).
[0203] Previously discovered screening was modified by existing
algorithm-based siRNA program (Turbo-si-designer owned by the
applicant's company), and SAMiRNA-based siRNA sequence
high-throughput screening was performed. 1-base sliding window
scanning (the same method as the above-described human amphiregulin
target screening) of 19-mer siRNAs against the entire target gene
was performed, and a total of 1,190 candidate siRNA sequences
against the possible mouse amphiregulin gene (NM_009704.4) full
transcript sequence were generated. Blast sequence homology
filtering was performed to remove unnecessary candidate sequences
that influence the expression of other genes, and 237 finally
selected SAMiRNAs were synthesized. The mouse NIH3T3 cell line was
treated with each selected SAMiRNA at a concentration of 1 .mu.M in
a cell culture medium containing 10% FBS, and the in vitro
expression inhibitory effects of the SAMiRNAs were first screened
using the primers shown in Table 8 (primer sequence information for
qPCR) (FIG. 9).
[0204] Thereafter, the mouse lung fibroblast cell line MLg was
treated with each of the two sequences (SEQ ID NOs: 19 and 20)
selected in the NIH3T3 cell line and the mouse SAMiRNA-amphiregulin
of SEQ ID NO: 21 discovered through previous milestone studies, at
treatment concentrations of 200 nM and 500 nM in cell culture media
containing 10% FBS, and additional screening was performed. As a
result, it was confirmed that SEQ ID NO: 20 exhibited the best
expression inhibitory effect (FIG. 10A).
[0205] Additionally, the mouse lung epithelial cell line LA-4 was
treated with each of the two selected sequences (SEQ ID NOs: 19 and
20) and the mouse SAMiRNA-amphiregulin of SEQ ID NO: 21 discovered
through previous milestone studies, at treatment concentrations of
200 nM, 500 nM and 1,000 nM in cell culture media containing 10%
FBS, and the expression inhibitory effects were additionally
evaluated. As a result, it was confirmed again that SEQ ID NO: 20
exhibited the best expression inhibitory effect (FIG. 10B).
[0206] As shown in FIG. 10, two SAMiRNAs that most effectively
inhibit amphiregulin gene expression were finally selected from 237
SAMiRNAs targeting mouse amphiregulin, and information of the
sequences of the selected SAMiRNAs is shown in Table 9 below.
TABLE-US-00009 TABLE 8 Primer sequence information for qPCR Primer
Sequence mGAPDH-F AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 22) mGAPDH-R
TGTAGACCATGTAGTTGAGGTCA SEQ ID NO: 23) mAREG-F GAGGCTTCGACAAGAAAACG
(SEQ ID NO: 24) mAREG-R ACCAATGTCATTTCCGGTGT (SEQ ID NO: 25)
(F denotes a forward primer, and R denotes a reverse primer)
TABLE-US-00010 TABLE 9 SAMiRNA sequences that effectively inhibit
mouse amphiregulin expression SEQ Sense ID NO Code Name Position
strand sequence 19 SAMi-mAREG#19 936-954 AACGGGACTGTGCATGCCA 20
SAMi-mAREG#20 937-955 ACGGGACTGTGCATGCCAT 21 SAMi-mAREG#21
1071-1089 CAGTTGTCACTTTTTATGA
Example 9. Investigation of Efficacy of SAMiRNA-mAREG by
Intravenous Administration in Silica-Induced Pulmonary Fibrosis
Model
[0207] To analyze the efficacy of SAMi-mAREG in a pulmonary
fibrosis animal model induced by silica (silicon dioxide, SIGMA,
Korea), and experiment was performed. For the experiment,
7-weeks-old mice were obtained and allowed to acclimatize for 1
week. To induce the model, Silica (3 mg) was dissolved and injected
intratracheally into the mice. On 3 days after the induction, mice
showing no abnormal symptoms were selected and divided into a
normal group, a test group to which physiological buffered saline
(PBS) was administered, a test group to which SAMiRNA-Control was
administered, and test groups (SAMi-mAREG #20) to which 1 mg/kg and
5 mg/kg of SAMi-mAREG #20 were respectively administered three
times at intervals of 2 days. In addition, on 14 days after model
induction, the mice were sacrificed.
[0208] 9-1. Gene Expression Analysis for SAMiRNA in Silica-Induced
Pulmonary Fibrosis Animal Model
[0209] Lung tissue was obtained from the sacrificed mice and the
tissue was crushed using a homogenizer. Using an RNA extraction kit
(AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA
was extracted from the cell line treated with SAMiRNA in Example
7-1 above. The extracted RNA was synthesized into cDNA in the
following manner using RNA reverse transcriptase (AccuPower.RTM.
RocketScrip.TM.Cycle RT Premix with oligo (dT)20, Bioneer, Korea).
Using the synthesized cDNA as a template, SYBR green real-time qPCR
was performed, and the relative expression levels of total RNA in
the groups were analyzed in the following manner. The synthesized
cDNA was diluted 5-fold with distilled water, and for analysis of
the mRNA expression level of amphiregulin, 3 .mu.l of the diluted
cDNA, 25 .mu.l of AccuPower.RTM. 2.times. GreenStar.TM. qPCR
MasterMix (BIONEER, Korea), 19 .mu.l of distilled water, and 3
.mu.l of amphiregulin qPCR primers (SEQ ID NOs: 24 and 25 (Table
8); 10 pmole/.mu.l for each primer, BIONEER, Korea) were added to
each well of a 96-well plate to make a mixture. Meanwhile, RPL13A,
a housekeeping gene (hereinafter referred to as HK gene), was used
as a standard gene to normalize the mRNA expression levels of
amphiregulin, fibronectin and collagen 3.alpha.1.
[0210] After completion of the PCR, the Ct (threshold cycle) value
of each target gene was corrected by the RPL13A gene, and then the
.DELTA.Ct value between the groups was calculated. The relative
expression levels of amphiregulin, fibronectin and collagen
3.alpha.1 genes were quantified using the .DELTA.Ct value and the
equation 2(-.DELTA.Ct).times.100.
[0211] As a result, it was confirmed that the expression of
amphiregulin was observed decreased in the groups treated with 1
mg/kg of SAMiRNA-AREG and 5 mg/kg of SAMiRNA-AREG, respectively,
compared to the silica-induced pulmonary fibrosis model group
treated with physiological buffered saline and the silica-induced
pulmonary fibrosis model group treated with SAMiRNA-Control. In
addition, it was confirmed that fibronectin and collagen 3.alpha.1
decreased in a concentration-dependent manner in the groups treated
with 1 mg/kg of SAMiRNA-AREG and 5 mg/kg of SAMiRNA-AREG,
respectively, compared to the silica-induced pulmonary fibrosis
model group treated with physiological buffered saline and the
silica-induced pulmonary fibrosis model group treated with
SAMiRNA-Control.
[0212] 9-2. Histopathological Analysis for SAMiRNA in
Silica-Induced Pulmonary Fibrosis Animal Model
[0213] In order to verify whether SAMiRNA-AREG against the
silica-induced pulmonary fibrosis model affects the expression of
extracellular matrix components, immunohistochemical staining was
performed. Each animal model group was sacrificed, and paraffin
sections were prepared through tissue fixing, washing, dehydration,
clearing, infiltration, embedding and cutting processes. The
paraffin section was cut thinly with a microtome and the tissue was
mounted on a slide. To observe the lung tissue pathologically,
hematopoietic & eosin (H&E) staining was performed, and to
examine the expression level of collagen 3.alpha.1, Masson's
trichrome staining was performed. In addition, immunohistochemical
staining was performed to analyze the expression level of
amphiregulin.
[0214] Through hematoxylin & eosin staining, it could be seen
that the silica-induced pulmonary fibrosis tissue was more damaged
than the lung tissue of the normal group. However, it could be seen
that the lung tissue of the mice to which SAMiRNA-AREG was
administered had little damage, like the lung tissue of the normal
group. In addition, Masson's trichrome staining was performed to
examine the degree of fibrosis. It was confirmed that the degree of
fibrosis in the lung tissue interstitium in the group to which
SAMiRNA-AREG was administered decreased compared to those in the
silica-induced pulmonary fibrosis model group to which
physiological buffered saline (PBS) and those in the group to which
SAMiRNA-Control was administered. In addition, through
immunohistochemical staining for amphiregulin, it could be seen
that amphiregulin was much expressed in the interstitium between
the cells in the silica-induced pulmonary fibrosis animal group.
However, it could be confirmed that, in the group to which
SAMiRNA-AREG was administered, the expression of AREG in the lung
tissue interstitium decreased.
[0215] In conclusion, 1 mg/kg and 5 mg/kg of SAMiRNA-AREG were
administered intravenously to the silica-induced pulmonary fibrosis
model mice three times (days 10, 12 and 14), and evaluation of the
inhibitory effect of SAMiRNA-AREG on the expression of the target
gene amphiregulin and the fibrosis marker genes in the lung tissue
and H&E staining and Masson's trichrome staining of the lung
tissue were performed. As a result of analyzing the expression of
the target gene amphiregulin and the fibrosis marker genes collagen
3.alpha.1 and fibronectin, it was confirmed that the expression was
increased by silica-induced pulmonary fibrosis and it was confirmed
the effect of inhibiting the expression in a
concentration-dependent manner by treatment with SAMiRNA-AREG. In
addition, as a result of tissue staining, it was confirmed that, in
the silica-induced pulmonary fibrosis mouse treated with PBS or
SAMiRNA-Control, infiltration of cells into the lung tissue and the
expression of collagen increased, but in the test group treated
with SAMiRNA-AREG, cellular infiltration and collagen significantly
decreased to levels comparable with those in the control group
treated with DPBS (FIG. 11).
[0216] In addition, immunohistochemistry staining for AREG in the
silica-induced pulmonary fibrosis model was performed. As shown in
FIG. 11, the expression levels of AREG in the tissues of the
silica-induced pulmonary fibrosis model mice, to which 1 mg/kg and
5 mg/kg of SAMiRNA-AREG were administered, were analyzed by IHC
staining. It was confirmed that, in the lung tissue of the model
mice to which silica+PBS or silica+SAMi-Cont was administered, the
expression of AREG in the interstitial site significantly increased
compared to that in the normal lung tissue. However, as a result of
analyzing the expression of AREG in the tissues to which 1 mg/kg
and 5 mg/kg of SAMiRNA-AREG were administered, it could be
confirmed that the expression of AREG in the tissues significantly
decreased compared to that in the silica-induced pulmonary fibrosis
tissue (FIG. 11).
Example 10. Investigation of Efficacy of SAMiRNA-mAREG by
Intravenous Administration in Bleomycin-Induced Pulmonary Fibrosis
Model
[0217] 5 mg/kg of SAMiRNA-AREG (SAMi-mAREG #20) was administered
intravenously to a bleomycin-induced pulmonary fibrosis mouse model
three times (days 8, 10 and 12), and Sircol assay was performed. As
a result, it was confirmed that the amount of collagen protein in
the test group, to which SAMiRNA-AREG was administered, decreased
by >40% compared to that in the control group SAMiRNA-Cont. In
addition, RNA was extracted from the lung tissue of the same test
group, and the effect of inhibiting the expression of the target
gene amphiregulin and the fibrosis marker gene collagen 3.alpha.1
was analyzed. As a result, the expression inhibitory effect
compared to the control was found. It was confirmed that the effect
of the newly identified test substance of SEQ ID NO: 20 was equal
to or higher than that of the existing sequence. H&E staining
of the lung tissue and collagen 3.alpha.1-specific Masson's
trichrome staining of the lung tissue were performed. As a result
of tissue staining, it was confirmed that, in the bleomycin-induced
pulmonary fibrosis mouse group treated with PBS or SAMiRNA-Control,
infiltration of cells into the lung tissue increased and staining
due to collagen accumulation increased. It was confirmed that, in
the test group treated with SAMiRNA-AREG, cellular infiltration and
collagen accumulation significantly decreased (FIG. 12). The tissue
staining and the analysis of target gene expression were performed
in the same manner as in Example 8.
Example 11. Evaluation of Effect of SAMiRNA-AREG against Renal
Fibrosis Induced by UUO (Unilateral Ureteral Obstruction) in
Mice
[0218] Analysis of the effect of SAMiRNA-AREG (SAMi-mAREG #20) in a
renal fibrosis animal model induced by UUO surgery was performed.
First, inhalation anesthesia of mice with iFran solution (Hana
Pharmaceutical, Korea) was performed to prepare a renal fibrosis
animal model. The skin and peritoneum were incised, and the ureter
of the left kidney was tied with 4-0 silk in two positions. To
prevent urinary tract infections, the middle between the two
locations was cut. In addition, the right kidney was operated in
the same way, but the ureter was not tied. Likewise, the abdomen of
the normal group was also open, and the ureter of the left kidney
was checked, but was not tied. In addition, the peritoneum and skin
were sutured to prevent infection. At 6 hours after model
induction, first administration of 1 mg/kg or 5 mg/kg of
SAMiRNA-AREG was performed. After 24 hours, second administration
was performed. Two administrations were performed, and animals were
sacrificed 24 hours after the last administration. The animal model
groups were a total of four groups: a normal group, an UUO model
group to which physiological buffered saline was administered, and
UUO groups to which 1 mg/kg and 5 mg/kg of SAMiRNA-AREG were
administered, respectively.
[0219] 11-1. Gene Expression Analysis for SAMiRNA in Renal Fibrosis
Induced by UUO (Unilateral Ureteral Obstruction)
[0220] Lung tissue was obtained from the sacrificed mice and the
tissue was crushed using a homogenizer. Using an RNA extraction kit
(AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA
was extracted from the cell line treated with SAMiRNA in Example
7-1 above. The extracted RNA was synthesized into cDNA in the
following manner using RNA reverse transcriptase (AccuPower.RTM.
RocketScript.TM.Cycle RT Premix with oligo (dT)20, Bioneer, Korea).
Using the synthesized cDNA as a template, SYBR green real-time qPCR
was performed, and the relative expression levels of total RNA in
the groups were analyzed in the following manner. The synthesized
cDNA was diluted 5-fold with distilled water, and for analysis of
the mRNA expression levels of amphiregulin and fibrosis markers, 3
.mu.l of the diluted cDNA, 25 .mu.l of AccuPower.RTM. 2.times.
GreenStar.TM. qPCR MasterMix (BIONEER, Korea), 19 .mu.l of
distilled water, and 3 .mu.l of qPCR primers (SEQ ID NOs: 24 and 25
(Table 8); 10 pmole/.mu.l for each primer, BIONEER, Korea) for
amphiregulin and fibrosis markers were added to each well of a
96-well plate to make a mixture. Meanwhile, RPL13A, a housekeeping
gene (hereinafter referred to as HK gene), was used as a standard
gene to normalize the mRNA expression levels of transforming growth
factor-1, amphiregulin, fibronectin, collagen 1, smooth muscle
actin and collagen 3.alpha.1. In addition, the CCR2 gene was also
analyze to verify efficacy against inflammatory factors.
[0221] After completion of the PCR, the Ct (threshold cycle) value
of the target gene was corrected by the RPL13A gene, and then the
.DELTA.Ct value between the groups was calculated. The relative
expression levels of transforming growth factor-1, amphiregulin,
fibronectin, collagen 1, smooth muscle actin, collagen 3.alpha.1
and CCR2 gene were quantified using the .DELTA.Ct value and the
equation 2(-.DELTA.Ct).times.100.
[0222] As a result, the expression level of amphiregulin was 60
times higher in the UUO model group to which physiological buffered
saline was administered than in the normal group. It was confirmed
that the expression of amphiregulin gene decreased in the groups to
which 1 mg/kg of SAMiRNA-AREG and 5 mg/kg of SAMiRNA-AREG were
administered, respectively. In addition, it was confirmed that
fibronectin and transforming growth factor-1 decreased in a
concentration-dependent manner in the groups to which 1 mg/kg of
SAMiRNA-AREG and 5 mg/kg of SAMiRNA-AREG were administered,
respectively, compared to the UUO model group. In addition,
collagen 3.alpha.1, collagen 1, and smooth muscle actin tended to
decrease in the group to which 1 mg/kg of SAMiRNA-AREG was
administered, compared to the UUO model group. However, it was
confirmed that the effect of decreasing the expression of the genes
was better in the group to which 5 mg/kg of SAMiRNA-AREG was
administered than in the group to which 1 mg/kg of SAMiRNA-AREG was
administered. In addition, it was confirmed that CCR2 about 6 times
increased in the UUO model group, but decreased in the groups to
which SAMiRNA-AREG was administered.
[0223] Although the present invention has been described in detail
with reference to specific features, it will be apparent to those
skilled in the art that this description is only of a preferred
embodiment thereof, and does not limit the scope of the present
invention. Thus, the substantial scope of the present invention
will be defined by the appended claims and equivalents thereto.
INDUSTRIAL APPLICABILITY
[0224] The double-stranded oligonucleotide structure comprising the
amphiregulin-specific double-stranded oligonucleotide according to
the present invention, and a pharmaceutical composition comprising
the same as an active ingredient may inhibit amphiregulin with high
efficiency without side effects, and thus may exhibit excellent
effects on the prevention and treatment of diseases caused by
excessive fibrosis and respiratory diseases.
SEQUENCE LIST FREE TEXT
[0225] Electronic file is attached.
Sequence CWU 1
1
48119DNAArtificial SequenceAmphiregulin siRNA sense 1cctataaagc
ggcaggtgc 19219DNAArtificial SequenceAmphiregulin siRNA sense
2gagcggcgca cactcccgg 19319DNAArtificial SequenceAmphiregulin siRNA
sense 3gtcccagaga ccgagttgc 19419DNAArtificial SequenceAmphiregulin
siRNA sense 4gagacgccgc cgctgcgaa 19519DNAArtificial
SequenceAmphiregulin siRNA sense 5ccggcgccgg tggtgctgt
19619DNAArtificial SequenceAmphiregulin siRNA sense 6ggtggtgctg
tcgctcttg 19719DNAArtificial SequenceAmphiregulin siRNA sense
7cgctcttgat actcggctc 19819DNAArtificial SequenceAmphiregulin siRNA
sense 8tcttgatact cggctcagg 19919DNAArtificial SequenceAmphiregulin
siRNA sense 9ggacctcaat gacacctac 191019DNAArtificial
SequenceAmphiregulin siRNA sense 10cacctactct gggaagcgt
191119DNAArtificial SequenceAmphiregulin siRNA sense 11acctactctg
ggaagcgtg 191219DNAArtificial SequenceAmphiregulin siRNA sense
12ctgggaagcg tgaaccatt 191319DNAArtificial SequenceAmphiregulin
siRNA sense 13gaagcgtgaa ccattttct 191419DNAArtificial
SequenceAmphiregulin siRNA sense 14ttctggggac cacagtgct
191520DNAArtificial SequencehGAPDH-F primer 15ggtgaaggtc ggagtcaacg
201625DNAArtificial SequencehGAPDH-R primer 16accatgtagt tgaggtcaat
gaagg 251720DNAArtificial SequencehAREG F primer 17acacctactc
tgggaagcgt 201820DNAArtificial SequencehAREG R primer 18gccaggtatt
tgtggttcgt 201919DNAArtificial SequencemAmphiregulin siRNA sense
strand 19aacgggactg tgcatgcca 192019DNAArtificial
SequencemAmphiregulin siRNA sense strand 20acgggactgt gcatgccat
192119DNAArtificial SequencemAmphiregulin siRNA sense
strand(control) 21cagttgtcac tttttatga 192221DNAArtificial
SequencemGAPDH-F primer 22aggtcggtgt gaacggattt g
212323DNAArtificial SequencemGAPDH-R primer 23tgtagaccat gtagttgagg
tca 232420DNAArtificial SequencemAREG-F primer 24gaggcttcga
caagaaaacg 202520DNAArtificial SequencemAREG-R primer 25accaatgtca
tttccggtgt 202621DNAArtificial SequenceAREG Forward primer
26cagtgctgat ggatttgagg t 212722DNAArtificial SequenceAREG Reverse
primer 27atagccaggt atttgtggtt cg 222823DNAArtificial SequenceAREG
probe 28tgaaccgtcc tcgggagccg act 232920DNAArtificial
SequenceRPL13A Forward primer 29gtgtttgacg gcatcccacc
203020DNAArtificial SequenceRPL13A Reverse primer 30taggcttcag
acgcacgacc 203121DNAArtificial SequenceRPL13A probe 31aagcggatgg
tggttcctgc t 213219DNAArtificial SequenceTBP Forward primer
32caccacagct cttccactc 193320DNAArtificial SequenceTBP Reverse
primer 33atcccagaac tctccgaagc 203420DNAArtificial SequenceTBP
probe 34acccttgccg ggcaccactc 203519RNAArtificial
SequenceAmphiregulin siRNA antisense 35gcaccugccg cuuuauagg
193619RNAArtificial SequenceAmphiregulin siRNA antisense
36ccgggagugu gcgccgcuc 193719RNAArtificial SequenceAmphiregulin
siRNA antisense 37gcaacucggu cucugggac 193819RNAArtificial
SequenceAmphiregulin siRNA antisense 38uucgcagcgg cggcgucuc
193919RNAArtificial SequenceAmphiregulin siRNA antisense
39acagcaccac cggcgccgg 194019RNAArtificial SequenceAmphiregulin
siRNA antisense 40caagagcgac agcaccacc 194119RNAArtificial
SequenceAmphiregulin siRNA antisense 41gagccgagua ucaagagcg
194219RNAArtificial SequenceAmphiregulin siRNA antisense
42ccugagccga guaucaaga 194319RNAArtificial SequenceAmphiregulin
siRNA antisense 43guagguguca uugaggucc 194419RNAArtificial
SequenceAmphiregulin siRNA antisense 44acgcuuccca gaguaggug
194519RNAArtificial SequenceAmphiregulin siRNA antisense
45cacgcuuccc agaguaggu 194619RNAArtificial SequenceAmphiregulin
siRNA antisense 46aaugguucac gcuucccag 194719RNAArtificial
SequenceAmphiregulin siRNA antisense 47agaaaauggu ucacgcuuc
194819RNAArtificial SequenceAmphiregulin siRNA antisense
48agcacugugg uccccagaa 19
* * * * *