U.S. patent application number 17/124066 was filed with the patent office on 2021-06-17 for reagents for treatment of hepatitis b virus (hbv) infection and use thereof.
The applicant listed for this patent is BENITEC BIOPHARMA LIMITED. Invention is credited to MICHAEL GRAHAM, SHIH-CHU KAO, TIN MAO, DAVID SUHY.
Application Number | 20210177885 17/124066 |
Document ID | / |
Family ID | 1000005419563 |
Filed Date | 2021-06-17 |
United States Patent
Application |
20210177885 |
Kind Code |
A1 |
MAO; TIN ; et al. |
June 17, 2021 |
REAGENTS FOR TREATMENT OF HEPATITIS B VIRUS (HBV) INFECTION AND USE
THEREOF
Abstract
This disclosure relates to RNA interference (RNAi) reagents for
treatment of hepatitis B virus (HBV) infection, compositions
comprising same, and use thereof to treat individuals infected with
HBV.
Inventors: |
MAO; TIN; (MILLBRAE, CA)
; KAO; SHIH-CHU; (MOUNTAIN VIEW, CA) ; SUHY;
DAVID; (SAN RAMON, CA) ; GRAHAM; MICHAEL; (SAN
MATEO, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BENITEC BIOPHARMA LIMITED |
NORTH SYDNEY |
|
AU |
|
|
Family ID: |
1000005419563 |
Appl. No.: |
17/124066 |
Filed: |
December 16, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15572143 |
Nov 6, 2017 |
10898505 |
|
|
PCT/AU2016/050340 |
May 6, 2016 |
|
|
|
17124066 |
|
|
|
|
62319971 |
Apr 8, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2320/11 20130101;
A61P 31/20 20180101; C12N 15/63 20130101; C12N 2310/14 20130101;
C12N 2310/531 20130101; A61K 31/7105 20130101; A61K 31/713
20130101; C12N 2310/51 20130101; A61K 48/005 20130101; C12N 15/1131
20130101 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; C12N 15/113 20060101 C12N015/113; A61K 31/713
20060101 A61K031/713; A61P 31/20 20060101 A61P031/20; A61K 48/00
20060101 A61K048/00; C12N 15/63 20060101 C12N015/63 |
Foreign Application Data
Date |
Code |
Application Number |
May 6, 2015 |
AU |
2015901617 |
Claims
1-41. (canceled)
42. A DNA-directed RNA interference (ddRNAi) construct comprising:
(a) a first nucleic acid comprising a DNA sequence which encodes a
short hairpin RNA (shRNA) comprising an effector sequence of at
least 19 nucleotides in length which is substantially complementary
to a RNA transcript encoded by the sequence set forth in SEQ ID NO:
9; and (b) a second nucleic acid comprising a DNA sequence which
encodes a shRNA comprising an effector sequence of at least 19
nucleotides in length which is substantially complementary to a RNA
transcript encoded by the sequence set forth in SEQ ID NO:
58.
43. The ddRNAi construct of claim 42, wherein: (a) the first
nucleic acid comprises a DNA sequence which encodes a shRNA
comprising an effector sequence which is substantially
complementary to a RNA transcript encoded by the sequence set forth
in SEQ ID NO: 48; and (b) the second nucleic acid comprises a DNA
sequence which encodes a shRNA comprising an effector sequence
which is substantially complementary to a RNA transcript encoded by
the sequence set forth in SEQ ID NO: 58.
44. The ddRNAi construct of claim 43, wherein: (a) the first
nucleic acid comprises a DNA sequence encoding a shRNA comprising
an effector sequence set forth in SEQ ID NO:47 and an effector
complement sequence set forth in SEQ ID NO:48; and (b) the second
nucleic acid comprises a DNA sequence encoding a shRNA comprising
an effector sequence set forth in SEQ ID NO:57 and an effector
complement sequence set forth in SEQ ID NO:58.
45. The ddRNAi construct according to claim 44, wherein: (a) the
first nucleic acid comprises a DNA sequence encoding a shRNA
comprising or consisting of the sequence set forth in SEQ ID NO:92;
and (b) the second nucleic acid comprises a DNA sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO:101.
46. The ddRNAi construct according to claim 42, comprising a RNA
pol III promoter upstream of each nucleic acid encoding a
shRNA.
47. The ddRNAi construct according to claim 46, wherein each RNA
pol III promoter is selected from a U6 and a H1 promoter.
48. The ddRNAi construct according to claim 47, wherein the U6
promoter is a U6-1 promoter, U6-8 promoter or U6-9 promoter.
49. An expression vector comprising the ddRNAi construct of claim
42.
50. The expression vector of claim 49, wherein: the expression
vector is a plasmid or minicircle; or (ii) the expression vector is
a viral vector selected from the group consisting of: an
adeno-associated viral (AAV) vector, a retroviral vector, an
adenoviral (AdV) vector and a lentiviral (LV) vector; optionally
wherein the or each expression vector is complexed with a cationic
DNA binding polymer.
51. The expression vector of claim 49, wherein the expression
vector is an adeno-associated viral (AAV) vector.
52. A composition comprising a ddRNAi construct according to claim
42 and one or more pharmaceutically acceptable carriers, optionally
wherein the ddRNAi construct is comprised within an expression
vector.
53. The composition of claim 52, wherein the expression vector is
an adeno-associated viral (AAV) vector.
54. A method of treating Hepatitis B virus (HBV) infection in a
subject, said method comprising administering to the subject a
composition of claim 52.
55. The method according to claim 54, wherein the subject is
suffering from chronic HBV infection.
56. The method of claim 54, wherein administering the composition
to the subject reduces HBV viral load in the subject and/or reduces
severity of symptoms associated with HBV infection in the subject
and/or reduces infectivity of HBV in the subject.
Description
RELATED APPLICATION DATA
[0001] This application is a Continuation of application Ser. No.
15/572,143, filed Nov. 6, 2017, which is the National Stage of
International Application No. PCT/AU2016/050340, filed May 6, 2016,
which claims priority from Australian Provisional Application No.
2015901617 filed on 6 May 2015 and U.S. Provisional Application No.
62/319,971 filed on 8 Apr. 2016, the full contents of which are
incorporated by reference herein in their entirety.
TECHNICAL FIELD
[0002] The present disclosure relates to RNA interference (RNAi)
reagents for treatment of hepatitis B virus (HBV) infection,
compositions comprising same, and use thereof to treat individuals
infected with HBV.
BACKGROUND
[0003] HBV is a serious and common infectious disease of the liver,
affecting millions of people throughout the world. HBV is a
hepatotrophic DNA virus belonging to the Hepadnaviridae. The
full-length of the viral genome is about 3.2kb, and it has four
open reading frames (ORFs) including surface antigen (the "S
gene"), core antigen (the "C gene"), DNA polymerase (the "P gene")
and a gene of undetermined function referred to as the "X gene".
More than 2 billion people worldwide have been infected with HBV at
some time in their lives, and of these about 350-400 million remain
chronically infected and are carriers of the virus. HBV infection
can cause acute and chronic type B hepatitis, and may eventually
lead to the development of chronic hepatic insufficiency,
cirrhosis, and hepatocellular carcinoma. In addition, HBV carriers
can transmit the disease for many years. Persons with chronic HBV
infection i.e., carriers, have at least 12 times higher risk of
developing hepatocellular carcinoma than non-carriers, and HBV
causes 60-80% of the world's primary liver cancers. As a
consequence, HBV ranks second only to tobacco as a known human
carcinogen.
[0004] Although vaccines against HBV are available, the rate of HBV
infection in the population remains high. Furthermore, current
therapies for chronic HBV infection have only limited inhibitory
effects on viral gene expression and replication in the majority of
chronically infected patients. Another limitation of existing
therapies for chronic HBV infection is the development of viral
resistance to drugs.
[0005] For these reasons, there remains a need for new therapeutic
agents to treat HBV infection.
SUMMARY
[0006] The present disclosure is based, in part, on the recognition
that existing vaccines and therapeutic agents for treatment and/or
prevention of HBV infection are limited in their efficacy, such as
where long term treatment is necessary e.g., due to the development
of viral resistance to therapy and/or variation in responsiveness
to therapy between genotypes of HBV. The present disclosure
provides RNAi reagents targeting one or more conserved regions of
RNA transcripts produced by the HBV genome i.e., regions conserved
among a plurality of different genotypes of HBV. The inventors have
shown that these RNAi reagents are effective for inhibiting
expression of HBV genes e.g., HBV pol gene, in cells infected with
HBV. For example, it has been shown that exemplary RNAi reagents of
the disclosure inhibit or reduce expression of HBV gene transcripts
in HepG2.2.15 cells harbouring active HBV. It has also been shown
that exemplary RNAi reagents of the disclosure inhibit or reduce
expression of HBV gene transcripts, reduce intracellular and
extracellular HBV DNA, and reduce HBV covalently-closed circular
DNA (cccDNA) in human hepatocytes inoculated with HBV and in a PXB
chimeric mouse infected with HBV. These findings by the inventors
provide new compounds that inhibit or reduce expression of a
nucleic acid and/or protein expressed by HBV and uses of such
compounds e.g., to treat a HBV infection in a subject.
[0007] Accordingly, the present disclosure provides a RNA
comprising an effector sequence of at least 17 nucleotides in
length and an effector complement sequence, wherein the effector
sequence is substantially complementary to a RNA transcript encoded
by a region of the HBV genome, wherein the region comprises a
sequence set forth in any one of SEQ ID NOs: 1-10. For example, the
effector sequence will be less than 30 nucleotides in length. For
example, a suitable effector sequence may be in the range of 17-29
nucleotides in length.
[0008] The effector sequence may comprise 4 base pair mismatches
relative to the sequence set forth in any one of SEQ ID NOs: 1-10
to which the effector sequence is substantially complementary. In
another example, the effector sequence comprises 3 base pair
mismatches relative to the sequence set forth in any one of SEQ ID
NOs: 1-10 to which the effector sequence is substantially
complementary. In another example, the effector sequence comprises
2 base pair mismatches relative to the sequence set forth in any
one of SEQ ID NOs: 1-10 to which the effector sequence is
substantially complementary. In another example, the effector
sequence comprises 1 base pair mismatch relative to the sequence
set forth in any one of SEQ ID NOs: 1-10 to which the effector
sequence is substantially complementary. In yet another example,
the effector sequence is 100% complementary to a region of
equivalent length within a sequence set forth in any one of SEQ ID
NOs: 1-10.
[0009] In one example, the RNA may be selected from the group
consisting of:
[0010] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:12, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:12; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0011] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:14, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:14; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0012] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:16, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:16; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0013] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:18, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:18; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0014] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:20, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:20; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0015] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:22, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:22; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0016] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:24, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:24; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0017] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:26, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:26; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0018] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:28, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:28; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0019] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:30, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:30; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0020] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:32, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:32; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0021] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:34, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:34; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0022] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:36, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:36; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0023] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:38, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:38; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0024] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:40, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:40; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0025] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:42, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:42; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0026] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:44, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:44; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0027] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:46, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:46; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0028] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:48, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:48; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence;
[0029] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:50, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:50; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence; and
[0030] a RNA comprising: (i) an effector sequence which is
complementary to the sequence set forth in SEQ ID NO:52, optionally
with the exception of 1, 2, 3 or 4 base mismatches, provided that
the effector sequence is capable of forming a duplex with a
sequence set forth in SEQ ID NO:52; and (ii) an effector complement
sequence comprising a sequence which is substantially complementary
to the effector sequence.
[0031] In another example, the RNA may be selected from the group
consisting of:
[0032] a RNA comprising an effector sequence set forth in SEQ ID
NO:11 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:11 and capable
of forming a duplex therewith;
[0033] a RNA comprising an effector sequence set forth in SEQ ID
NO:13 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:13 and capable
of forming a duplex therewith;
[0034] a RNA comprising an effector sequence set forth in SEQ ID
NO:15 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:15 and capable
of forming a duplex therewith;
[0035] a RNA comprising an effector sequence set forth in SEQ ID
NO:17 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:17 and capable
of forming a duplex therewith;
[0036] a RNA comprising an effector sequence set forth in SEQ ID
NO:19 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:19 and capable
of forming a duplex therewith;
[0037] a RNA comprising an effector sequence set forth in SEQ ID
NO:21 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:21 and capable
of forming a duplex therewith;
[0038] a RNA comprising an effector sequence set forth in SEQ ID
NO:23 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:23 and capable
of forming a duplex therewith;
[0039] a RNA comprising an effector sequence set forth in SEQ ID
NO:25 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:25 and capable
of forming a duplex therewith;
[0040] a RNA comprising an effector sequence set forth in SEQ ID
NO:27 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:27 and capable
of forming a duplex therewith;
[0041] a RNA comprising an effector sequence set forth in SEQ ID
NO:29 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:29 and capable
of forming a duplex therewith;
[0042] a RNA comprising an effector sequence set forth in SEQ ID
NO:31 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:31 and capable
of forming a duplex therewith;
[0043] a RNA comprising an effector sequence set forth in SEQ ID
NO:33 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:33 and capable
of forming a duplex therewith;
[0044] a RNA comprising an effector sequence set forth in SEQ ID
NO:35 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:35 and capable
of forming a duplex therewith;
[0045] a RNA comprising an effector sequence set forth in SEQ ID
NO:37 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:37 and capable
of forming a duplex therewith;
[0046] a RNA comprising an effector sequence set forth in SEQ ID
NO:39 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:39 and capable
of forming a duplex therewith;
[0047] a RNA comprising an effector sequence set forth in SEQ ID
NO:41 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:41 and capable
of forming a duplex therewith;
[0048] a RNA comprising an effector sequence set forth in SEQ ID
NO:43 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:43 and capable
of forming a duplex therewith;
[0049] a RNA comprising an effector sequence set forth in SEQ ID
NO:45 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:45 and capable
of forming a duplex therewith;
[0050] a RNA comprising an effector sequence set forth in SEQ ID
NO:47 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:47 and capable
of forming a duplex therewith;
[0051] a RNA comprising an effector sequence set forth in SEQ ID
NO:49 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:49 and capable
of forming a duplex therewith; and
[0052] a RNA comprising an effector sequence set forth in SEQ ID
NO:51 and an effector complement sequence which is substantially
complementary to the sequence set forth in SEQ ID NO:51 and capable
of forming a duplex therewith.
[0053] For example, an effector complement sequence of a RNA of the
disclosure may comprise 1, 2, 3 or 4 mismatches relative to the
corresponding effector sequence provided that the cognate effector
and effector complement sequences are capable of forming a
duplex.
[0054] In another example, the RNA may be selected from the group
consisting of:
[0055] a RNA comprising an effector sequence set forth in SEQ ID
NO:11 and an effector complement sequence set forth in SEQ ID
NO:12;
[0056] a RNA comprising an effector sequence set forth in SEQ ID
NO:13 and an effector complement sequence set forth in SEQ ID
NO:14;
[0057] a RNA comprising an effector sequence set forth in SEQ ID
NO:15 and an effector complement sequence set forth in SEQ ID
NO:16;
[0058] a RNA comprising an effector sequence set forth in SEQ ID
NO:17 and an effector complement sequence set forth in SEQ ID
NO:18;
[0059] a RNA comprising an effector sequence set forth in SEQ ID
NO:19 and an effector complement sequence set forth in SEQ ID NO:
20;
[0060] a RNA comprising an effector sequence set forth in SEQ ID
NO:21 and an effector complement sequence set forth in SEQ ID
NO:22;
[0061] a RNA comprising an effector sequence set forth in SEQ ID
NO:23 and an effector complement sequence set forth in SEQ ID
NO:24;
[0062] a RNA comprising an effector sequence set forth in SEQ ID
NO:25 and an effector complement sequence set forth in SEQ ID
NO:26;
[0063] a RNA comprising an effector sequence set forth in SEQ ID
NO:27 and an effector complement sequence set forth in SEQ ID
NO:28;
[0064] a RNA comprising an effector sequence set forth in SEQ ID
NO:29 and an effector complement sequence set forth in SEQ ID
NO:30;
[0065] a RNA comprising an effector sequence set forth in SEQ ID
NO:31 and an effector complement sequence set forth in SEQ ID
NO:32;
[0066] a RNA comprising an effector sequence set forth in SEQ ID
NO:33 and an effector complement sequence set forth in SEQ ID
NO:34;
[0067] a RNA comprising an effector sequence set forth in SEQ ID
NO:35 and an effector complement sequence set forth in SEQ ID
NO:36;
[0068] a RNA comprising an effector sequence set forth in SEQ ID
NO:37 and an effector complement sequence set forth in SEQ ID
NO:38;
[0069] a RNA comprising an effector sequence set forth in SEQ ID
NO:39 and an effector complement sequence set forth in SEQ ID
NO:40;
[0070] a RNA comprising an effector sequence set forth in SEQ ID
NO:41 and an effector complement sequence set forth in SEQ ID
NO:42;
[0071] a RNA comprising an effector sequence set forth in SEQ ID
NO:43 and an effector complement sequence set forth in SEQ ID
NO:44;
[0072] a RNA comprising an effector sequence set forth in SEQ ID
NO:45 and an effector complement sequence set forth in SEQ ID
NO:46;
[0073] a RNA comprising an effector sequence set forth in SEQ ID
NO:47 and an effector complement sequence set forth in SEQ ID
NO:48;
[0074] a RNA comprising an effector sequence set forth in SEQ ID
NO:49 and an effector complement sequence set forth in SEQ ID
NO:50; and
[0075] a RNA comprising an effector sequence set forth in SEQ ID
NO:51 and an effector complement sequence set forth in SEQ ID
NO:52.
[0076] In one example, the RNA is a RNAi reagent.
[0077] The RNA of the disclosure may be provided in the form of a
short hairpin RNA (shRNA). When provided as a shRNA, the RNA of the
disclosure may comprise a loop sequence positioned between the
effector sequence and the effector complement sequence. Suitable
loop sequences may be selected from those known in the art. For
example, an shRNA in accordance with the present disclosure may
comprise a sequence set forth in any one of SEQ ID NOs: 65-98.
[0078] Alternatively, the RNA of the disclosure may be provided in
the form of a short interfering RNA (siRNA) duplex or a
double-stranded RNA (dsRNA).
[0079] It will be understood by a person of skill in the art that a
RNA in accordance with the present disclosure may be combined or
used in conjunction with other therapeutic agents for treating HBV.
Accordingly, the present disclosure provides a RNA as described
herein in combination with one or more other agents for treating
HBV. In one example, a plurality of RNAs are provided comprising:
[0080] (a) at least one RNA as described herein; and [0081] (b) at
least one RNA selected from: [0082] (i) a RNA in accordance with
the RNA described herein; or [0083] (ii) a RNA comprising an
effector sequence of at least 17 nucleotides in length and a
effector complement sequence, wherein the effector sequence is
substantially complementary to a RNA sequence set forth in any one
of SEQ ID NOs: 54, 56, 58, 60, 62 and 64;
[0084] wherein the RNA at (a) and the RNA at (b) comprise different
effector sequences.
[0085] In one example, a plurality of RNAs of the disclosure
comprises:
[0086] (a) at least one RNA selected from the group consisting of:
[0087] a RNA comprising an effector sequence set forth in SEQ ID
NO:11 and an effector complement sequence set forth in SEQ ID
NO:12; [0088] a RNA comprising an effector sequence set forth in
SEQ ID NO:13 and an effector complement sequence set forth in SEQ
ID NO:14; [0089] a RNA comprising an effector sequence set forth in
SEQ ID NO:15 and an effector complement sequence set forth in SEQ
ID NO:16; [0090] a RNA comprising an effector sequence set forth in
SEQ ID NO:17 and an effector complement sequence set forth in SEQ
ID NO:18; [0091] a RNA comprising an effector sequence set forth in
SEQ ID NO:19 and an effector complement sequence set forth in SEQ
ID NO: 20; [0092] a RNA comprising an effector sequence set forth
in SEQ ID NO:21 and an effector complement sequence set forth in
SEQ ID NO:22; [0093] a RNA comprising an effector sequence set
forth in SEQ ID NO:23 and an effector complement sequence set forth
in SEQ ID NO:24; [0094] a RNA comprising an effector sequence set
forth in SEQ ID NO:25 and an effector complement sequence set forth
in SEQ ID NO:26; [0095] a RNA comprising an effector sequence set
forth in SEQ ID NO:27 and an effector complement sequence set forth
in SEQ ID NO:28; [0096] a RNA comprising an effector sequence set
forth in SEQ ID NO:29 and an effector complement sequence set forth
in SEQ ID NO:30; [0097] a RNA comprising an effector sequence set
forth in SEQ ID NO:31 and an effector complement sequence set forth
in SEQ ID NO:32; [0098] a RNA comprising an effector sequence set
forth in SEQ ID NO:33 and an effector complement sequence set forth
in SEQ ID NO:34; [0099] a RNA comprising an effector sequence set
forth in SEQ ID NO:35 and an effector complement sequence set forth
in SEQ ID NO:36; [0100] a RNA comprising an effector sequence set
forth in SEQ ID NO:37 and an effector complement sequence set forth
in SEQ ID NO:38; [0101] a RNA comprising an effector sequence set
forth in SEQ ID NO:39 and an effector complement sequence set forth
in SEQ ID NO:40; [0102] a RNA comprising an effector sequence set
forth in SEQ ID NO:41 and an effector complement sequence set forth
in SEQ ID NO:42; [0103] a RNA comprising an effector sequence set
forth in SEQ ID NO:43 and an effector complement sequence set forth
in SEQ ID NO:44; [0104] a RNA comprising an effector sequence set
forth in SEQ ID NO:45 and an effector complement sequence set forth
in SEQ ID NO:46; [0105] a RNA comprising an effector sequence set
forth in SEQ ID NO:47 and an effector complement sequence set forth
in SEQ ID NO:48; [0106] a RNA comprising an effector sequence set
forth in SEQ ID NO:49 and an effector complement sequence set forth
in SEQ ID NO:50; and [0107] a RNA comprising an effector sequence
set forth in SEQ ID NO:51 and an effector complement sequence set
forth in SEQ ID NO:52; and [0108] (b) at least one RNA selected
from: [0109] (i) a RNA selected from the group described at (a); or
[0110] (ii) a RNA comprising an effector sequence of at least 17
nucleotides in length and a effector complement sequence, wherein
the effector sequence is substantially complementary to a RNA
sequence set forth in any one of SEQ ID NOs: 54, 56, 58, 60, 62 and
64;
[0111] wherein the RNA at (a) and the RNA at (b) comprise different
effector sequences.
[0112] For example, the effector sequence which is substantially
complementary to a RNA sequence set forth in any one of SEQ ID NOs:
54, 56, 58, 60, 62 and 64 will be less than 30 nucleotides in
length. For example, a suitable effector sequence may be in the
range of 17-29 nucleotides in length.
[0113] A plurality of RNAs in accordance with the present
disclosure may comprise up to 10 RNAs, such as two RNAs or three
RNAs or four RNAs or five RNAs or six RNAs or seven RNAs or eight
RNAs or nine RNAs or ten RNAs. In one example, the plurality of
RNAs comprises two of the RNAs described herein. In another
example, the plurality of RNAs comprises three of the RNAs
described herein. In one example, the plurality of RNAs comprises
four of the RNAs described herein. In one example, the plurality of
RNAs comprises five of the RNAs described herein. In one example,
the plurality of RNAs comprises six of the RNAs described herein.
In one example, the plurality of RNAs comprises seven of the RNAs
described herein. In one example, the plurality of RNAs comprises
eight of the RNAs described herein. In one example, the plurality
of RNAs comprises nine of the RNAs described herein. In one
example, the plurality of RNAs comprises ten of the RNAs described
herein.
[0114] In one example, the plurality of RNAs described herein are
provided in a single composition.
[0115] In another example, the plurality of RNAs described herein
are provided as multiple compositions. For example, each of the
RNAs of the plurality may be provided separately.
[0116] Alternatively, at least one RNA of the plurality may be
provided separately and two or more of the plurality provided
together in a composition.
[0117] As described herein, a RNA comprising an effector sequence
which is substantially complementary to a RNA sequence set forth in
any one of SEQ ID NOs: 54, 56, 58, 60, 62 and 64, may be selected
from the group consisting of:
[0118] a RNA comprising an effector sequence set forth in SEQ ID
NO:53 and an effector complement sequence set forth in SEQ ID
NO:54;
[0119] a RNA comprising an effector sequence set forth in SEQ ID
NO:55 and an effector complement sequence set forth in SEQ ID
NO:56;
[0120] a RNA comprising an effector sequence set forth in SEQ ID
NO:57 and an effector complement sequence set forth in SEQ ID
NO:58;
[0121] a RNA comprising an effector sequence set forth in SEQ ID
NO:59 and an effector complement sequence set forth in SEQ ID
NO:60;
[0122] a RNA comprising an effector sequence set forth in SEQ ID
NO:61 and an effector complement sequence set forth in SEQ ID
NO:62; and
[0123] a RNA comprising an effector sequence set forth in SEQ ID
NO:63 and an effector complement sequence set forth in SEQ ID
NO:64.
[0124] At least one or each of the RNAs in the plurality of RNAs
described herein may be present in the form of a shRNA. For
example, the present disclosure may provide a plurality of shRNAs.
Thus, one or more of the RNAs in the plurality of RNAs may comprise
a loop sequence positioned between the corresponding effector
sequence and effector complement sequence. Suitable loop sequences
may be selected from those known in the art. Alternatively,
suitable stem loops may be developed de novo.
[0125] In one example, a plurality of RNAs in accordance with the
present disclosure may comprise: [0126] (a) at least one RNA which
is a shRNA comprising a sequence set forth in any one of SEQ ID
NOs: 65-98; and [0127] (b) at least one RNA which is selected from:
[0128] (i) a RNA which is a shRNA comprising a sequence set forth
in any one of SEQ ID NOs: 65-98; or [0129] (ii) a shRNA comprising
a sequence set forth in any one of SEQ ID NOs: 99-104; and
[0130] wherein the shRNA at (a) and the shRNA at (b) are
different.
[0131] The present disclosure also provides a nucleic acid
comprising a sequence which encodes one or more RNAs as described
herein. In one example, the nucleic acid comprises a DNA sequence.
In one example, the nucleic acid is DNA.
[0132] The present disclosure also provides a plurality nucleic
acids comprising: [0133] (a) a first nucleic acid comprising a
sequence which encodes a RNA as described herein; and [0134] (b) a
second nucleic acid comprising a sequence which encodes a RNA
selected from: [0135] (i) a RNA as described herein; or [0136] (ii)
a RNA comprising an effector sequence of at least 17 nucleotides in
length and a effector complement sequence, wherein the effector
sequence is substantially complementary to a RNA sequence set forth
in any one of SEQ ID NOs: 54, 56, 58, 60, 62 and 64; and
[0137] wherein the RNAs encoded by the first and second nucleic
acids comprise different effector sequences. For example, the RNA
encoded by the second nucleic acid comprises an effector sequence
which is less than 30 nucleotides in length. For example, a
suitable effector sequence may be in the range of 17-29 nucleotides
in length.
[0138] In one example, the first and second nucleic acids form
separate parts of the same polynucleotide (i.e., series of
covalently linked nucleotide residues). In another example, the
first and second nucleic acids form parts of different
polynucleotides.
[0139] As described herein, a RNA comprising an effector sequence
which is substantially complementary to a RNA sequence set forth in
any one of SEQ ID NOs: 54, 56, 58, 60, 62 and 64 may be selected
from the group consisting of:
[0140] a RNA comprising an effector sequence set forth in SEQ ID
NO:53 and an effector complement sequence set forth in SEQ ID
NO:54;
[0141] a RNA comprising an effector sequence set forth in SEQ ID
NO:55 and an effector complement sequence set forth in SEQ ID
NO:56;
[0142] a RNA comprising an effector sequence set forth in SEQ ID
NO:57 and an effector complement sequence set forth in SEQ ID
NO:58;
[0143] a RNA comprising an effector sequence set forth in SEQ ID
NO:59 and an effector complement sequence set forth in SEQ ID
NO:60;
[0144] a RNA comprising an effector sequence set forth in SEQ ID
NO:61 and an effector complement sequence set forth in SEQ ID
NO:62; and
[0145] a RNA comprising an effector sequence set forth in SEQ ID
NO:63 and an effector complement sequence set forth in SEQ ID
NO:64.
[0146] In one example, one or more of the nucleic acids encodes a
shRNA. For example, each of the nucleic acids encodes a shRNA. In
one example, the or each nucleic acid also encodes a loop sequence
positioned between the effector sequence and the effector
complement sequence. Suitable loop sequences will be apparent to
the skilled person and/or described herein.
[0147] In one example, the plurality of nucleic acids comprise:
[0148] (a) a first nucleic acid comprising a sequence which encodes
a shRNA comprising a sequence set forth in any one of SEQ ID NOs:
65-98; and [0149] (b) a second nucleic acid comprising a sequence
which encodes a shRNA selected from: [0150] (i) a shRNA comprising
a sequence set forth in any one of SEQ ID NOs: 65-98; or [0151]
(ii) a shRNA comprising a sequence set forth in any one of SEQ ID
NOs: 99-104; and
[0152] wherein the shRNAs encoded by the first and second nucleic
acids are different.
[0153] The or each nucleic acid in accordance with the present
disclosure may comprise, or be in operable linkage with, one or
more transcriptional terminator sequences. For example, the or each
nucleic acid may comprise a transcriptional terminator sequence at
the 3' terminus of the sequence encoding the RNA. Such sequences
will be known to a person of skill in the art, but may include
`TTTTT` or `TTTTTT`.
[0154] Alternatively, or in addition, the or each nucleic acid in
accordance with the present disclosure may comprise, or be in
operable linkage with, transcription initiator sequence. For
example, the or each nucleic acid may comprise a transcription
initiator sequence at the 5' terminus of the sequence encoding the
RNA. Such sequences will be known to a person of skill in the art,
but may include `G`.
[0155] Alternatively, or in addition, the or each nucleic acid in
accordance with the present disclosure may comprise one or more
restriction sites e.g., to facilitate cloning of the nucleic
acid(s) into cloning or expression vectors. For example, the
nucleic acids described herein may include a restriction site
upstream and/or downstream of the sequence encoding a RNA of the
disclosure. Suitable restriction enzyme recognition sequences will
be known to a person of skill in the art. However, in one example,
the nucleic acid(s) of the disclosure may include a BamH1
restriction site (GGATCC) at the 5' terminus i.e., upstream of the
sequence encoding the RNA, and a EcoR1restriction site (GAATTC) at
the 3' terminus i.e., downstream of the sequence encoding the
RNA.
[0156] A nucleic acid in accordance with the present disclosure may
also be provided in the form of, or be comprised in, a DNA-directed
RNA interference (ddRNAi) construct which is capable of expressing
one or more RNAs of the present disclosure which is/are encoded by
the nucleic acid. In this regard, one or more ddRNAi constructs
comprising a nucleic acid of the disclosure is also provided.
[0157] In another example, a plurality of ddRNAi constructs, each
encoding an shRNA described herein is provided, wherein: [0158] (a)
at least one of the plurality of ddRNAi constructs comprises a
first nucleic acid of the plurality of nucleic acids as described
herein; and [0159] (b) at least one of the plurality of ddRNAi
constructs comprises a second nucleic acid of the plurality of
nucleic acids described herein; and
[0160] wherein the first and second nucleic acids are different to
one another.
[0161] In yet another example, a ddRNAi construct of the disclosure
encodes at least two shRNAs, wherein the ddRNAi construct
comprises: [0162] (a) a nucleic acid encoding a first shRNA
comprising a sequence set forth in any one of SEQ ID NOs: 65-98;
and [0163] (b) a nucleic acid comprising a DNA sequence encoding a
second shRNA, wherein the second shRNA comprises an effector
sequence of at least 17 nucleotides in length and a effector
complement sequence, wherein the effector sequence is substantially
complementary to a region of a RNA transcript encoded by the genome
of the Hepatitis B virus; and
[0164] wherein the first and second shRNAs are different.
[0165] For example, the second shRNA comprises an effector sequence
which is less than 30 nucleotides in length. For example, a
suitable effector sequence may be in the range of 17-29 nucleotides
in length.
[0166] In one example, the ddRNAi construct encoding at least two
shRNAs comprises the plurality of nucleic acids described
herein.
[0167] In yet another example, a ddRNAi construct encoding at least
two shRNAs comprises a nucleic acid comprising a DNA sequence
encoding a third shRNA, wherein the third shRNA comprises an
effector sequence of at least 17 nucleotides in length and a
effector complement sequence, wherein the effector sequence is
substantially complementary to a region of a RNA transcript encoded
by the genome of the Hepatitis B virus, and
[0168] wherein the third shRNA is different to the first and second
shRNAs.
[0169] For example, the third shRNA comprises an effector sequence
which is less than 30 nucleotides in length. For example, a
suitable effector sequence may be in the range of 17-29 nucleotides
in length.
[0170] In an exemplified form of the disclosure, the nucleic acid
encoding the third shRNA is a nucleic acid selected from any one of
the nucleic acids in the plurality of nucleic acids described
herein.
[0171] One example of a ddRNAi construct of the disclosure
comprises: [0172] (a) a nucleic acid encoding a shRNA comprising or
consisting of the sequence set forth in SEQ ID NO:92: [0173] (b) a
nucleic acid selected from any one of the nucleic acids in the
plurality of nucleic acids described herein; and [0174] (c) a
nucleic acid encoding a shRNA comprising or consisting of the
sequence set forth in SEQ ID NO:78;
[0175] wherein the nucleic acid at (b) encodes a shRNA which is
different to the shRNA encoded by the nucleic acid at (a) and
(c).
[0176] In another example, the ddRNAi construct of the disclosure
comprises: [0177] (a) a first nucleic acid encoding a shRNA
comprising or consisting of the sequence set forth in SEQ ID NO:92:
[0178] (b) a second nucleic acid encoding a shRNA comprising or
consisting of the sequence set forth in SEQ ID NO:101; and [0179]
(c) a third nucleic acid encoding a shRNA comprising or consisting
of the sequence set forth in SEQ ID NO:78.
[0180] In yet another example, the ddRNAi construct of the
disclosure comprises: [0181] (a) a first nucleic acid encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO:92: [0182] (b) a second nucleic acid encoding a shRNA comprising
or consisting of the sequence set forth in SEQ ID NO:79; and [0183]
(c) a third nucleic acid encoding a shRNA comprising or consisting
of the sequence set forth in SEQ ID NO:78.
[0184] An exemplary ddRNAi construct of the disclosure comprises,
in a 5' to 3' direction: [0185] (a) a first nucleic acid encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO:78: [0186] (b) a second nucleic acid encoding a shRNA comprising
or consisting of the sequence set forth in SEQ ID NO:101; and
[0187] (c) a third nucleic acid encoding a shRNA comprising or
consisting of the sequence set forth in SEQ ID NO:92.
[0188] A further exemplary the ddRNAi construct of the disclosure
comprises, in a 5' to 3' direction: [0189] (a) a first nucleic acid
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO:78: [0190] (b) a second nucleic acid encoding a shRNA
comprising or consisting of the sequence set forth in SEQ ID NO:79;
and [0191] (c) a third nucleic acid encoding a shRNA comprising or
consisting of the sequence set forth in SEQ ID NO:92.
[0192] In one example, a ddRNAi construct as described herein
comprises a single promoter which is operably-linked to the or each
nucleic acid encoding an shRNA of the disclosure.
[0193] In another example, each nucleic acid encoding an shRNA of
the disclosure is operably-linked to a separate promoter. For
example, the promoter(s) is(are) positioned upstream of the
respective nucleic acid(s) encoding the shRNA(s). In a ddRNAi
construct comprising multiple promoters, the promoters may be the
same or different. Exemplary promoters are RNA pol III promoters,
such as for example, the U6 and H1 promoters.
[0194] In one example of a ddRNAi construct comprising nucleic
acids encoding three shRNAs each of which are linked to a separate
promoter, the promoter linked to two of the nucleic acids is the
same and the promoter linked to the third nucleic acid is
different. For example, in the context of a ddRNAi construct
described above comprising three nucleic acids encoding shRNAs, the
first and third nucleic acids are linked to separate promoters that
are the same and the second nucleic acid is linked to a different
promoter.
[0195] In one example of a ddRNAi construct comprising nucleic
acids encoding three shRNAs each of which are linked to a separate
promoter, all of the promoters are the same.
[0196] An exemplary ddRNAi construct of the disclosure comprises,
in a 5' to 3' direction: [0197] (a) a first nucleic acid encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO:78 operably-linked to a U6 promoter: [0198] (b) a second nucleic
acid encoding a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO:101 operably-linked to a U6 promoter; and [0199]
(c) a third nucleic acid encoding a shRNA comprising or consisting
of the sequence set forth in SEQ ID NO:92 operably-linked to a U6
promoter.
[0200] A further exemplary the ddRNAi construct of the disclosure
comprises, in a 5' to 3' direction: [0201] (a) a first nucleic acid
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO:78 operably-linked to a U6 promoter: [0202] (b) a
second nucleic acid encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO:79 operably-linked to a U6
promoter; and [0203] (c) a third nucleic acid encoding a shRNA
comprising or consisting of the sequence set forth in SEQ ID NO:92
operably-linked to a U6 promoter.
[0204] The present disclosure also provides an expression vector,
comprising a ddRNAi constructs of the disclosure.
[0205] The present disclosure also provides plurality of expression
vectors each of which comprises a ddRNAi construct of the
disclosure. For example, one or more of the plurality of expression
vectors comprises a plurality of ddRNAi constructs as disclosed
herein. In another example, each of the plurality of expression
vectors comprises a plurality of ddRNAi constructs as disclosed
herein. In a further example, each of the plurality of expression
vectors comprises a single ddRNAi construct as described herein. In
any of the foregoing ways in this paragraph, the plurality of
expression vectors may collectively express a plurality of shRNAs
in accordance with the present disclosure.
[0206] In one example, the or each expression vector is a plasmid
or a minicircle.
[0207] In one example, the plasmid or minicircle or expression
vector or ddRNAi construct is complexed with a cationic DNA binding
polymer.
[0208] In another example, the or each expression vector is a viral
vector. For example, the viral vector is selected from the group
consisting of an adeno-associated viral (AAV) vector, a retroviral
vector, an adenoviral vector (AdV) and a lentiviral (LV)
vector.
[0209] The present disclosure also provides a composition
comprising a ddRNAi construct and/or expression vector as described
herein. In one example, the composition may also comprise one or
more pharmaceutically acceptable carriers and/or diluents.
[0210] The present disclosure also provides a method of treating
HBV infection in a subject, the method comprising administering a
therapeutically effective amount of a RNA, plurality of RNAs,
nucleic acid, plurality of nucleic acids, ddRNAi construct,
plurality of ddRNAi constructs, expression vector, plurality of
expression vectors and/or composition described herein to the
subject.
[0211] The present disclosure also provides a method of reducing
HBV viral load in a subject infected with HBV, the method
comprising administering a therapeutically effective amount of a
RNA, plurality of RNAs, nucleic acid, plurality of nucleic acids,
ddRNAi construct, plurality of ddRNAi constructs, expression
vector, plurality of expression vectors and/or composition
described herein to the subject.
[0212] The present disclosure also provides a method of reducing
severity of one or more symptoms associated with HBV infection in a
subject suffering therefrom, the method comprising administering to
the subject a therapeutically effective amount of a RNA, plurality
of RNAs, nucleic acid, plurality of nucleic acids, ddRNAi
construct, plurality of ddRNAi constructs, expression vector,
plurality of expression vectors and/or composition described herein
to the subject.
[0213] The present disclosure also provides a method of reducing
the infectivity of HBV in a subject infected therewith, the method
comprising administering to the subject a therapeutically effective
amount of a RNA, plurality of RNAs, nucleic acid, plurality of
nucleic acids, ddRNAi construct, plurality of ddRNAi constructs,
expression vector, plurality of expression vectors and/or
composition described herein to the subject.
[0214] The present disclosure also provides a method for reducing
the risk of a subject suffering from a HBV infection developing
chronic hepatic insufficiency, cirrhosis, and/or hepatocellular
carcinoma, the method comprising administering to the subject a
therapeutically effective amount of a RNA, plurality of RNAs,
nucleic acid, plurality of nucleic acids, ddRNAi construct,
plurality of ddRNAi constructs, expression vector, plurality of
expression vectors and/or composition described herein to the
subject.
[0215] In accordance with any method described herein, in one
example, the subject is suffering from acute HBV infection.
Alternatively, in one example, the subject is suffering from
chronic HBV infection.
[0216] In one example, the methods described herein comprise
inhibiting expression of one or more transcripts encoded by the HBV
genome in the subject.
[0217] In one example, the subject to which the RNA, plurality of
RNAs, nucleic acid, plurality of nucleic acids, ddRNAi construct,
plurality of ddRNAi constructs, expression vector, plurality of
expression vectors and/or composition of the disclosure is/are
administered has already received treatment with another
therapeutic agent for treating HBV infection. For example, the
subject and/or the HBV is refractory or resistant to treatment with
the other agent known for treating HBV infection.
[0218] In another example, the RNA, plurality of RNAs, nucleic
acid, plurality of nucleic acids, ddRNAi construct, plurality of
ddRNAi constructs, expression vector, plurality of expression
vectors and/or composition of the disclosure is administered in
combination with another therapeutic agent known for treating HBV
infection i.e., as an adjunctive therapy.
[0219] In one example, a composition of the present disclosure is
provided in a kit. For example, a composition of the present
disclosure is packaged together with one or more other therapeutic
agents known for treating HBV infections. Such other therapeutic
agents will be known to a person of skill in the art. In another
example, the composition is packaged with instruction for use in a
method of the disclosure.
[0220] The present disclosure also provides use of a RNA, plurality
of RNAs, nucleic acid, plurality of nucleic acids, ddRNAi
construct, plurality of ddRNAi constructs, expression vector,
plurality of expression vectors and/or composition described herein
in the preparation of a medicament, e.g., for treating HBV
infection in a subject and/or in a method disclosed herein. In one
example, the subject is suffering from acute HBV infection. In an
alternative example, the subject is suffering from chronic HBV
infection.
[0221] The present disclosure also provides a RNA, plurality of
RNAs, nucleic acid, plurality of nucleic acids, ddRNAi construct,
plurality of ddRNAi constructs, expression vector, plurality of
expression vectors and/or composition described herein for use in
therapy. For example, the RNA, plurality of RNAs, nucleic acid,
plurality of nucleic acids, ddRNAi construct, plurality of ddRNAi
constructs, expression vector, plurality of expression vectors
and/or composition may be for use in treating HBV infection in a
subject and/or in a method disclosed herein. The subject may be
suffering from acute HBV infection. In an alternative example, the
subject may be suffering from chronic HBV infection.
[0222] Treatment of HBV in accordance with any example described
herein, may comprise one or more of reducing HBV viral load in the
subject, reducing severity of symptoms associated with HBV
infection and/or reducing the infectivity of HBV in a subject. In
one example, the medicament will reduce HBV gene transcription
products in the subject to which the medicament is
administered.
BRIEF DESCRIPTION OF DRAWINGS
[0223] FIG. 1 shows a map of the HBV genome and the position of
siRNA target regions. The inner circle represents the HBV genome,
boxes around these represent the indicated protein coding sequences
and the outer curved arrows represent HBV mRNAs. The positions of
highly conserved regions listed in Table 1 (Region 1 to Region 10)
and regions targeted by additional shRNAs in Table 4 (shRNAs 3, 8
and 11) are indicated by broken lines.
[0224] FIG. 2 illustrates the HBV inhibitory activity of siRNAs
having antisense and sense sequence of shRNA9, shRNA15 and shRNA27
respectively in a Luciferase reporter assay system.
[0225] FIG. 3 illustrates the activity of siRNAs having antisense
and sense sequence of shRNA9, shRNA27 and shRNA27 respectively to
inhibit HBV transcripts from regions corresponding to HBV antigens
HBsAg, HBcAg and HbxAg in HepG2.2.15 cells.
[0226] FIG. 4 shows location of the HBV siRNAs relative to the
polymerase gene and the respective HBV antigens HBsAg, HBcAg and
HbxAg.
[0227] FIG. 5a illustrates the ability of shRNAs designated shRNA1,
shRNA4, shRNA15, shRNA18, shRNA35, shRNA36 and shRNA39 to inhibit
luciferase protein expression in a Luciferase reporter assay
system.
[0228] FIG. 5b illustrates the ability of shRNAs designated shRNA1,
shRNA4, shRNA15, shRNA18, shRNA35, shRNA36 and shRNA39 to inhibit
luciferase protein expression in a Luciferase reporter assay
system.
[0229] FIG. 5c illustrates the ability of the shRNAs designated
shRNAS, shRNA6, shRNA7, shRNA8, shRNA35, shRNA26, shRNA27, shRNA30
and shRNA40 to inhibit luciferase protein expression in Luciferase
reporter assay.
[0230] FIG. 5d illustrates the ability of the shRNAs designated
shRNA5, shRNA6, shRNA7, shRNA8, shRNA35, shRNA26, shRNA27, shRNA30
and shRNA40 to inhibit luciferase protein expression in Luciferase
reporter assay.
[0231] FIG. 5e illustrates the ability of the shRNAs designated
shRNA9, shRNA10, shRNA11, shRNA12, shRNA33, shRNA34, shRNA19,
shRNA20, shRNA23 and shRNA24 to inhibit expression of luciferase
protein expression in Luciferase reporter assay.
[0232] FIG. 5f illustrates the ability of the shRNAs designated
shRNA9, shRNA10, shRNA11, shRNA12, shRNA33, shRNA34, shRNA19,
shRNA20, shRNA23 and shRNA24 to inhibit expression of luciferase
protein expression in Luciferase reporter assay.
[0233] FIG. 6a illustrates the ability of shRNA designated shRNA1,
to inhibit luciferase protein expression in a Luciferase reporter
assay system in dose-dependent manner.
[0234] FIG. 6b illustrates the ability of shRNA designated shRNA15
to inhibit luciferase protein expression in a Luciferase reporter
assay system in dose-dependent manner.
[0235] FIG. 6c illustrates the ability of shRNA designated shRNA36
to inhibit luciferase protein expression in a Luciferase reporter
assay system in dose-dependent manner.
[0236] FIG. 6d illustrates the ability of shRNA designated shRNA27
to inhibit luciferase protein expression in a Luciferase reporter
assay system in dose-dependent manner.
[0237] FIG. 6e illustrates the ability of shRNA designated shRNA30
to inhibit luciferase protein expression in a Luciferase reporter
assay system in dose-dependent manner.
[0238] FIG. 6f illustrates the ability of shRNA designated shRNA9
to inhibit luciferase protein expression in a Luciferase reporter
assay system in dose-dependent manner.
[0239] FIG. 6g illustrates the ability of shRNA designated shRNA20
to inhibit luciferase protein expression in a Luciferase reporter
assay system in dose-dependent manner.
[0240] FIG. 6h illustrates the ability of shRNAs designated shRNA1,
shRNA15 and shRNA36 to inhibit luciferase protein expression in a
Luciferase reporter assay system in dose-dependent manner.
[0241] FIG. 6i illustrates the ability of shRNAs designated shRNA27
and shRNA30 to inhibit luciferase protein expression in a
Luciferase reporter assay system in dose-dependent manner.
[0242] FIG. 6j illustrates the ability of shRNAs designated shRNA9
and shRNA20 to inhibit luciferase protein expression in a
Luciferase reporter assay system in dose-dependent manner.
[0243] FIG. 7a illustrates the ability of shRNA designated shRNA1
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner.
[0244] FIG. 7b illustrates the ability of shRNA designated shRNA15
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner.
[0245] FIG. 7c illustrates the ability of shRNA designated shRNA36
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner.
[0246] FIG. 7d illustrates the ability of shRNA designated shRNA27
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner.
[0247] FIG. 7e illustrates the ability of shRNAs designated All 9-2
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner.
[0248] FIG. 7f illustrates the ability of shRNAs designated All 4-1
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner.
[0249] FIG. 7g illustrates the ability of shRNA designated shRNA20
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner.
[0250] FIG. 7h illustrates the ability of shRNAs designated shRNA9
and shRNA20 to inhibit luciferase protein expression in a
Luciferase reporter assay system in a dose-dependent manner.
[0251] FIG. 7i illustrates the ability of shRNAs designated shRNA1,
shRNA15 and shRNA36 to inhibit luciferase protein expression in a
Luciferase reporter assay system in a dose-dependent manner.
[0252] FIG. 7j illustrates the ability of shRNAs designated shRNA27
and shRNA30 to inhibit luciferase protein expression in a
Luciferase reporter assay system in a dose-dependent manner.
[0253] FIG. 8a illustrates the ability of shRNA designated shRNA1
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner in HEK293 cells
co-transfected with a non-specific filler plasmid to ensure that
constant levels of DNA are being transfected into cells.
[0254] FIG. 8b illustrates the ability of shRNA designated shRNA15
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner in HEK293 cells
co-transfected with a non-specific filler plasmid to ensure that
constant levels of DNA are being transfected into cells.
[0255] FIG. 8c illustrates the ability of shRNA designated shRNA36
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner in HEK293 cells
co-transfected with a non-specific filler plasmid to ensure that
constant levels of DNA are being transfected into cells.
[0256] FIG. 8d illustrates the ability of shRNA designated shRNA27
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner in HEK293 cells
co-transfected with a non-specific filler plasmid to ensure that
constant levels of DNA are being transfected into cells.
[0257] FIG. 8e illustrates the ability of shRNA designated shRNA30
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner in HEK293 cells
co-transfected with a non-specific filler plasmid to ensure that
constant levels of DNA are being transfected into cells.
[0258] FIG. 8f illustrates the ability of shRNA designated shRNA9
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner in HEK293 cells
co-transfected with a non-specific filler plasmid to ensure that
constant levels of DNA are being transfected into cells.
[0259] FIG. 8g illustrates the ability of shRNA designated shRNA20
to inhibit luciferase protein expression in a Luciferase reporter
assay system in a dose-dependent manner in HEK293 cells
co-transfected with a non-specific filler plasmid to ensure that
constant levels of DNA are being transfected into cells.
[0260] FIG. 8h illustrates the ability of shRNAs designated shRNA1,
shRNA27 and shRNA36 to inhibit luciferase protein expression in a
Luciferase reporter assay system in a dose-dependent manner in
HEK293 cells co-transfected with a non-specific filler plasmid to
ensure that constant levels of DNA are being transfected into
cells.
[0261] FIG. 8i illustrates the ability of shRNAs designated shRNA27
and shRNA36 to inhibit luciferase protein expression in a
Luciferase reporter assay system in a dose-dependent manner in
HEK293 cells co-transfected with a non-specific filler plasmid to
ensure that constant levels of DNA are being transfected into
cells.
[0262] FIG. 8j illustrates the ability of shRNAs designated shRNA9
and shRNA20 to inhibit luciferase protein expression in a
Luciferase reporter assay system in a dose-dependent manner in
HEK293 cells co-transfected with a non-specific filler plasmid to
ensure that constant levels of DNA are being transfected into
cells.
[0263] FIG. 9a illustrates the ability of ddRNAi constructs
expressing shRNAs designated shRNA9,shRNA13, shRNA14, to inhibit
expression of luciferase protein in Luciferase reporter assay
system.
[0264] FIG. 9b illustrates the ability of ddRNAi constructs
expressing shRNAs designated shRNA20, shRNA21 and shRNA22 to
inhibit expression of luciferase protein in Luciferase reporter
assay system.
[0265] FIG. 10 shows standard curves obtained by qPCR determining
the number of shRNAs expressed per cell following transductions
thereof with HBV AdVs.
[0266] FIG. 11a shows the level of expression for shRNA designated
shRNA14, in: (i) HepG2.2.15 cells transduced with an HBV shRNA AdV
vector expressing the respective shRNA individually at the various
MOIs; (ii) HepG2.2.15 cells simultaneously transduced with three
HBV shRNA AdV vectors expressing the shRNAs designated shRNA14,
shRNA37 and shRNA28 respectively at various MOIs; and (iii)
HepG2.2.15 cells simultaneously transduced with three HBV shRNA AdV
vectors expressing the shRNAs designated shRNA14, shRNA15 and
shRNA28 respectively at various MOIs.
[0267] FIG. 11b shows the level of expression for shRNA designated
shRNA15 in: (i) HepG2.2.15 cells transduced with an HBV shRNA AdV
vector expressing the respective shRNA individually at the various
MOIs; (ii) HepG2.2.15 cells simultaneously transduced with three
HBV shRNA AdV vectors expressing the shRNAs designated shRNA14,
shRNA37 and shRNA28 respectively at various MOIs; and (iii)
HepG2.2.15 cells simultaneously transduced with three HBV shRNA AdV
vectors expressing the shRNAs designated shRNA14, shRNA15 and
shRNA28 respectively at various MOIs.
[0268] FIG. 11c shows the level of expression for shRNA designated
shRNA37 in: (i) HepG2.2.15 cells transduced with an HBV shRNA AdV
vector expressing the respective shRNA individually at the various
MOIs; (ii) HepG2.2.15 cells simultaneously transduced with three
HBV shRNA AdV vectors expressing the shRNAs designated shRNA14,
shRNA37 and shRNA28 respectively at various MOIs; and (iii)
HepG2.2.15 cells simultaneously transduced with three HBV shRNA AdV
vectors expressing the shRNAs designated shRNA14, shRNA15 and
shRNA28 respectively at various MOIs.
[0269] FIG. 11d shows the level of expression for shRNA designated
shRNA28 in: (i) HepG2.2.15 cells transduced with an HBV shRNA AdV
vector expressing the respective shRNA individually at the various
MOIs; (ii) HepG2.2.15 cells simultaneously transduced with three
HBV shRNA AdV vectors expressing the shRNAs designated shRNA14,
shRNA37 and shRNA28 respectively at various MOIs; and (iii)
HepG2.2.15 cells simultaneously transduced with three HBV shRNA AdV
vectors expressing the shRNAs designated shRNA14, shRNA15 and
shRNA28 respectively at various MOIs.
[0270] FIG. 12a illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a HBV shRNA AdV vector expressing shRNA14 at
various MOIs.
[0271] FIG. 12b illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a HBV shRNA AdV vector expressing shRNA15 at
various MOIs.
[0272] FIG. 12c illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a HBV shRNA AdV vector expressing shRNA37 at
various MOIs.
[0273] FIG. 12d illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a HBV shRNA AdV vector expressing shRNA28 at
various MOIs.
[0274] FIG. 12e illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with three HBV shRNA AdV vectors expressing the shRNAs
designated shRNA14, shRNA37 and shRNA28 respectively at various
MOIs.
[0275] FIG. 12f illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with three HBV shRNA AdV vectors expressing the shRNAs
designated shRNA14, shRNA15 and shRNA28 respectively at various
MOIs.
[0276] FIG. 13a shows the level of expression for shRNA designated
shRNA14 in: (i) HepG2.2.15 cells transduced with a HBV shRNA AdV
vector expressing shRNA14 individually at MOI 100; (ii) HepG2.2.15
cells transduced with a triple HBV shRNA AdV vector expressing
three shRNAs designated shRNA14, shRNA37 and shRNA28 respectively
at MOI 100; and (iii) HepG2.2.15 cells transduced with a triple HBV
shRNA AdV vector expressing three shRNAs designated shRNA14,
shRNA15 and shRNA28 respectively at MOI 100.
[0277] FIG. 13b shows the level of expression for shRNA designated
shRNA15 in: (i) HepG2.2.15 cells transduced with a HBV shRNA AdV
vector expressing shRNA15 individually at MOI 100; (ii) HepG2.2.15
cells transduced with a triple HBV shRNA AdV vector expressing
three shRNAs designated shRNA14, shRNA37 and shRNA28 respectively
at MOI 100; and (iii) HepG2.2.15 cells transduced with a triple HBV
shRNA AdV vector expressing three shRNAs designated shRNA14,
shRNA15 and shRNA28 respectively at MOI 100.
[0278] FIG. 13c shows the level of expression for shRNA designated
shRNA37 in: (i) HepG2.2.15 cells transduced with a HBV shRNA AdV
vector expressing shRNA37 individually at MOI 100; (ii) HepG2.2.15
cells transduced with a triple HBV shRNA AdV vector expressing
three shRNAs designated shRNA14, shRNA37 and shRNA28 respectively
at MOI 100; and (iii) HepG2.2.15 cells transduced with a triple HBV
shRNA AdV vector expressing three shRNAs designated shRNA14,
shRNA15 and shRNA28 respectively at MOI 100.
[0279] FIG. 13d shows the level of expression for shRNA designated
shRNA28 in: (i) HepG2.2.15 cells transduced with a HBV shRNA AdV
vector expressing shRNA28 individually at MOI 100; (ii) HepG2.2.15
cells transduced with a triple HBV shRNA AdV vector expressing
three shRNAs designated shRNA14, shRNA37 and shRNA28 respectively
at MOI 100; and (iii) HepG2.2.15 cells transduced with a triple HBV
shRNA AdV vector expressing three shRNAs designated shRNA14,
shRNA15 and shRNA28 respectively at MOI 100.
[0280] FIG. 14a illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a HBV shRNA AdV vector expressing shRNA14.
[0281] FIG. 14b illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a HBV shRNA AdV vector expressing shRNA15.
[0282] FIG. 14c illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a HBV shRNA AdV vector expressing shRNA37.
[0283] FIG. 14d illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a HBV shRNA AdV vector expressing shRNA28.
[0284] FIG. 14e illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a triple HBV shRNA AdV vector expressing three
shRNAs designated shRNA14, shRNA37 and shRNA28.
[0285] FIG. 14f illustrates the level of inhibition of HBV
transcripts at regions corresponding to HBV antigens HBsAg, HBcAg
and HbxAg relative to expression of GAPDH in HepG2.2.15 cells
transduced with a triple HBV shRNA AdV vector expressing three
shRNAs designated shRNA14, shRNA15 and shRNA28.
[0286] FIG. 15a shows the level of expression for shRNAs designated
shRNA14, shRNA37 and shRNA28 for human hepatocytes inoculated with
HBV and treated with a triple HBV shRNA AdV vector expressing three
shRNAs designated shRNA14, shRNA37 and shRNA28 at MOT 10.
[0287] FIG. 15b shows the level of inhibition of HBV transcripts at
regions corresponding to HBV antigens HBsAg, HBcAg and HbxAg for
human hepatocytes inoculated with HBV and treated with a triple HBV
shRNA AdV vector expressing three shRNAs designated shRNA14,
shRNA37 and shRNA28 at MOI 10.
[0288] FIG. 15c shows the level of intracellular and extracellular
HBV DNA for human hepatocytes inoculated with HBV and treated with
a triple HBV shRNA AdV vector expressing three shRNAs designated
shRNA14, shRNA37 and shRNA28 at MOI 10.
[0289] FIG. 15d shows the level of extracellular HBV transcripts at
regions corresponding to HBV antigens HBcAg and HBsAg for human
hepatocytes inoculated with HBV and treated with a triple HBV shRNA
AdV vector expressing three shRNAs designated shRNA14, shRNA37 and
shRNA28 at MOI 10.
[0290] FIG. 15e shows the level of cccDNA for human hepatocytes
inoculated with HBV and treated with a triple HBV shRNA AdV vector
expressing three shRNAs designated shRNA14, shRNA37 and shRNA28 at
MOI 10.
[0291] FIG. 16 is a plot showing serum levels of extracellular HBV
DNA (expressed in Log copies/mL) in animals from (i) Group 1
treated with saline only (control), (ii) Group 2 treated with
medium dose of the triple HBV shRNA AdV vector, and (iii) Group 3
treated with high dose of the triple HBV shRNA AdV vector, over the
course of 56 days.
[0292] FIG. 17 is a plot showing serum levels of extracellular HBV
DNA (expressed in copies/mL) in animals from (i) Group 1 treated
with saline only (control), (ii) Group 2 treated with medium dose
of the triple HBV shRNA AdV vector, and (iii) Group 3 treated with
high dose of the triple HBV shRNA AdV vector, over the course of 56
days.
[0293] FIG. 18 is a plot showing serum levels of HBsAg (IU/mL) in
animals from (i) Group 1 treated with saline only (control), (ii)
Group 2 treated with medium dose of the triple HBV shRNA AdV
vector, and (iii) Group 3 treated with high dose of the triple HBV
shRNA AdV vector, over the course of 56 days.
[0294] FIG. 19 is a plot showing serum levels of HBeAg (IU/mL) in
animals from (i) Group 1 treated with saline only (control), (ii)
Group 2 treated with medium dose of the triple HBV shRNA AdV
vector, and (iii) Group 3 treated with high dose of the triple HBV
shRNA AdV vector, over the course of 56 days.
[0295] FIG. 20 shows the level of intracellular HBV DNA (copies of
intracellular HBV DNA/100 ng DNA) in animals from (i) Group 1
treated with saline only (control), (ii) Group 2 treated with
medium dose of the triple HBV shRNA AdV vector, and (iii) Group 3
treated with high dose of the triple HBV shRNA AdV vector, 56 days
post treatment. This figures illustrates the level of inhibition of
intracellular HBV DNA by medium and high doses of the triple HBV
shRNA AdV vector relative to the control saline treatment.
[0296] FIG. 21 shows the level of intracellular cccDNA (copies of
HBV cccDNA/100ng DNA) in animals from (i) Group 1 treated with
saline only (control), (ii) Group 2 treated with medium dose of the
triple HBV shRNA AdV vector, and (iii) Group 3 treated with high
dose of the triple HBV shRNA AdV vector, 56 days post treatment.
This figures illustrates the level of inhibition of HBV cccDNA by
medium and high doses of the triple HBV shRNA AdV vector relative
to the control saline treatment.
[0297] FIG. 22 illustrates the level of inhibition of HBV viral
transcripts corresponding to shRNAs expressed by the triple HBV
shRNA AdV vector (shRNA14, shRNA 37 and shRNA28, respectively) at
56 days post treatment with the triple HBV shRNA AdV vector at
medium and high doses.
KEY TO THE SEQUENCE LISTING
[0298] SEQ ID NO: 1: DNA sequence for target region within HBV
genome designated Region 1. [0299] SEQ ID NO: 2: DNA sequence for
target region within HBV genome designated Region 2. [0300] SEQ ID
NO: 3: DNA sequence for target region within HBV genome designated
Region 3. [0301] SEQ ID NO: 4: DNA sequence for target region
within HBV genome designated Region 4. [0302] SEQ ID NO: 5: DNA
sequence for target region within HBV genome designated Region 5.
[0303] SEQ ID NO: 6: DNA sequence for target region within HBV
genome designated Region 6. [0304] SEQ ID NO: 7: DNA sequence for
target region within HBV genome designated Region 7. [0305] SEQ ID
NO: 8: DNA sequence for target region within HBV genome designated
Region 8. [0306] SEQ ID NO: 9: DNA sequence for target region
within HBV genome designated Region 9. [0307] SEQ ID NO: 10: DNA
sequence for target region within HBV genome designated Region 10.
[0308] SEQ ID NO: 11: RNA effector sequence for shRNAs designated
shRNA1 and shRNA4. [0309] SEQ ID NO: 12: RNA effector complement
sequence for shRNAs designated shRNA1 and shRNA4. [0310] SEQ ID NO:
13: RNA effector sequence for shRNA designated shRNA2. [0311] SEQ
ID NO: 14: RNA effector complement sequence for shRNA designated
shRNA2. [0312] SEQ ID NO: 15: RNA effector sequence for shRNA
designated shRNA3. [0313] SEQ ID NO: 16: RNA effector complement
sequence for shRNA designated shRNA3. [0314] SEQ ID NO: 17: RNA
effector sequence for shRNAs designated shRNA5 and shRNA6. [0315]
SEQ ID NO: 18: RNA effector complement sequence for shRNAs
designated shRNA5 and shRNA6. [0316] SEQ ID NO: 19: RNA effector
sequence for shRNAs designated shRNA7 and shRNA8. [0317] SEQ ID NO:
20: RNA effector complement sequence for shRNAs designated shRNA7
and shRNA8. [0318] SEQ ID NO: 21: RNA effector sequence for shRNAs
designated shRNA9 and shRNA10. [0319] SEQ ID NO: 22: RNA effector
complement sequence for shRNAs designated shRNA9 and shRNA10.
[0320] SEQ ID NO: 23: RNA effector sequence for shRNAs designated
shRNA11 and shRNA12. [0321] SEQ ID NO: 24: RNA effector complement
sequence for shRNAs designated shRNAll and shRNA12. [0322] SEQ ID
NO: 25: RNA effector sequence for shRNA designated shRNA13. [0323]
SEQ ID NO: 26: RNA effector complement sequence for shRNA
designated shRNA13 [0324] SEQ ID NO: 27: RNA effector sequence for
shRNA designated shRNA14. [0325] SEQ ID NO: 28: RNA effector
complement sequence for shRNA designated shRNA14 [0326] SEQ ID NO:
29: RNA effector sequence for shRNAs designated shRNA15 and
shRNA18. [0327] SEQ ID NO: 30: RNA effector complement sequence for
shRNAs designated shRNA15 and shRNA18. [0328] SEQ ID NO: 31: RNA
effector sequence for shRNA designated shRNA16. [0329] SEQ ID NO:
32: RNA effector complement sequence for shRNA designated shRNA16.
[0330] SEQ ID NO: 33: RNA effector sequence for shRNA designated
shRNA17. [0331] SEQ ID NO: 34: RNA effector complement sequence for
shRNA designated shRNA17. [0332] SEQ ID NO: 35: RNA effector
sequence for shRNAs designated shRNA19 and shRNA20. [0333] SEQ ID
NO: 36: RNA effector complement sequence for shRNAs designated
shRNA19 and shRNA20. [0334] SEQ ID NO: 37: RNA effector sequence
for shRNA designated shRNA21. [0335] SEQ ID NO: 38: RNA effector
complement sequence for shRNA designated shRNA21. [0336] SEQ ID NO:
39: RNA effector sequence for shRNA designated shRNA22. [0337] SEQ
ID NO: 40: RNA effector complement sequence for shRNA designated
shRNA22. [0338] SEQ ID NO: 41: RNA effector sequence for shRNAs
designated shRNA23 and shRNA24. [0339] SEQ ID NO: 42: RNA effector
complement sequence for shRNAs designated shRNA23 and shRNA24.
[0340] SEQ ID NO: 43: RNA effector sequence for shRNAs designated
shRNA25 and shRNA26. [0341] SEQ ID NO: 44: RNA effector complement
sequence for shRNAs designated shRNA25 and shRNA26. [0342] SEQ ID
NO: 45: RNA effector sequence for shRNAs designated shRNA27 and
shRNA30. [0343] SEQ ID NO: 46: RNA effector complement sequence for
shRNAs designated shRNA27 and shRNA30. [0344] SEQ ID NO: 47: RNA
effector sequence for shRNAs designated shRNA28 and shRNA31. [0345]
SEQ ID NO: 48: RNA effector complement sequence for shRNAs
designated shRNA28 and shRNA31. [0346] SEQ ID NO: 49: RNA effector
sequence for shRNAs designated shRNA29 and shRNA32. [0347] SEQ ID
NO: 50: RNA effector complement sequence for shRNAs designated
shRNA29 and shRNA32. [0348] SEQ ID NO: 51: RNA effector sequence
for shRNAs designated shRNA33 and shRNA34. [0349] SEQ ID NO: 52:
RNA effector complement sequence for shRNAs designated shRNA33 and
shRNA34. [0350] SEQ ID NO: 53: RNA effector sequence for shRNA
designated shRNA35. [0351] SEQ ID NO: 54: RNA effector complement
sequence for shRNA designated shRNA35. [0352] SEQ ID NO: 55: RNA
effector sequence for shRNA designated shRNA 36. [0353] SEQ ID NO:
56: RNA effector complement sequence for shRNA designated shRNA35.
[0354] SEQ ID NO: 57: RNA effector sequence for shRNA designated
shRNA37. [0355] SEQ ID NO: 58: RNA effector complement sequence for
shRNA designated shRNA37. [0356] SEQ ID NO: 59: RNA effector
sequence for shRNA designated shRNA38. [0357] SEQ ID NO: 60: RNA
effector complement sequence for shRNA designated shRNA38. [0358]
SEQ ID NO: 61: RNA effector sequence for shRNA designated shRNA39.
[0359] SEQ ID NO: 62: RNA effector complement sequence for shRNA
designated shRNA39. [0360] SEQ ID NO: 63: RNA effector sequence for
shRNA designated shRNA40. [0361] SEQ ID NO: 64: RNA effector
complement sequence for shRNA designated shRNA40. [0362] SEQ ID NO:
65: RNA sequence for shRNA designated shRNA1. [0363] SEQ ID NO: 66:
RNA sequence for shRNA designated shRNA2 [0364] SEQ ID NO: 67: RNA
sequence for shRNA designated shRNA3 [0365] SEQ ID NO: 68: RNA
sequence for shRNA designated shRNA4 [0366] SEQ ID NO: 69: RNA
sequence for shRNA designated shRNA5 [0367] SEQ ID NO: 70: RNA
sequence for shRNA designated shRNA6 [0368] SEQ ID NO: 71: RNA
sequence for shRNA designated shRNA7 [0369] SEQ ID NO: 72: RNA
sequence for shRNA designated shRNA8 [0370] SEQ ID NO: 73: RNA
sequence for shRNA designated shRNA9 [0371] SEQ ID NO: 74: RNA
sequence for shRNA designated shRNA10 [0372] SEQ ID NO: 75: RNA
sequence for shRNA designated shRNA11 [0373] SEQ ID NO: 76: RNA
sequence for shRNA designated shRNA12 [0374] SEQ ID NO: 77: RNA
sequence for shRNA designated shRNA13 [0375] SEQ ID NO: 78: RNA
sequence for shRNA designated shRNA14 [0376] SEQ ID NO: 79: RNA
sequence for shRNA designated shRNA15 [0377] SEQ ID NO: 80: RNA
sequence for shRNA designated shRNA16 [0378] SEQ ID NO: 81: RNA
sequence for shRNA designated shRNA17 [0379] SEQ ID NO: 82: RNA
sequence for shRNA designated shRNA18 [0380] SEQ ID NO: 83: RNA
sequence for shRNA designated shRNA19 [0381] SEQ ID NO: 84: RNA
sequence for shRNA designated shRNA20 [0382] SEQ ID NO: 85: RNA
sequence for shRNA designated shRNA21 [0383] SEQ ID NO: 86: RNA
sequence for shRNA designated shRNA22 [0384] SEQ ID NO: 87: RNA
sequence for shRNA designated shRNA23 [0385] SEQ ID NO: 88: RNA
sequence for shRNA designated shRNA24 [0386] SEQ ID NO: 89: RNA
sequence for shRNA designated shRNA25 [0387] SEQ ID NO: 90: RNA
sequence for shRNA designated shRNA26 [0388] SEQ ID NO: 91: RNA
sequence for shRNA designated shRNA27 [0389] SEQ ID NO: 92: RNA
sequence for shRNA designated shRNA28 [0390] SEQ ID NO: 93: RNA
sequence for shRNA designated shRNA29 [0391] SEQ ID NO: 94: RNA
sequence for shRNA designated shRNA30 [0392] SEQ ID NO: 95: RNA
sequence for shRNA designated shRNA31 [0393] SEQ ID NO: 96: RNA
sequence for shRNA designated shRNA32 [0394] SEQ ID NO: 97: RNA
sequence for shRNA designated shRNA33 [0395] SEQ ID NO: 98: RNA
sequence for shRNA designated shRNA34 [0396] SEQ ID NO: 99: RNA
sequence for shRNA designated shRNA35 [0397] SEQ ID NO: 100: RNA
sequence for shRNA designated shRNA36 [0398] SEQ ID NO: 101: RNA
sequence for shRNA designated shRNA37 [0399] SEQ ID NO: 102: RNA
sequence for shRNA designated shRNA38 [0400] SEQ ID NO: 103: RNA
sequence for shRNA designated shRNA39 [0401] SEQ ID NO: 104: RNA
sequence for shRNA designated shRNA40 [0402] SEQ ID NO: 105: DNA
sequence for pBL183 HBV Triple V2 [0403] SEQ ID NO: 106: DNA
sequence for pBL183 HBV Triple V1
DETAILED DESCRIPTION
General
[0404] Throughout this specification, unless specifically stated
otherwise or the context requires otherwise, reference to a single
step, feature, composition of matter, group of steps or group of
features or compositions of matter shall be taken to encompass one
and a plurality (i.e. one or more) of those steps, features,
compositions of matter, groups of steps or groups of features or
compositions of matter.
[0405] Those skilled in the art will appreciate that the present
disclosure is susceptible to variations and modifications other
than those specifically described. It is to be understood that the
disclosure includes all such variations and modifications. The
disclosure also includes all of the steps, features, compositions
and compounds referred to or indicated in this specification,
individually or collectively, and any and all combinations or any
two or more of said steps or features.
[0406] The present disclosure is not to be limited in scope by the
specific examples described herein, which are intended for the
purpose of exemplification only. Functionally-equivalent products,
compositions and methods are clearly within the scope of the
present disclosure.
[0407] Any example of the present disclosure herein shall be taken
to apply mutatis mutandis to any other example of the disclosure
unless specifically stated otherwise.
[0408] Unless specifically defined otherwise, all technical and
scientific terms used herein shall be taken to have the same
meaning as commonly understood by one of ordinary skill in the art
(for example, in cell culture, molecular genetics, immunology,
immunohistochemistry, protein chemistry, and biochemistry).
[0409] Unless otherwise indicated, the recombinant DNA, recombinant
protein, cell culture, and immunological techniques utilized in the
present disclosure are standard procedures, well known to those
skilled in the art. Such techniques are described and explained
throughout the literature in sources such as, J. Perbal, A
Practical Guide to Molecular Cloning, John Wiley and Sons (1984),
J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press (1989), T.A. Brown (editor),
Essential Molecular Biology: A Practical Approach, Volumes 1 and 2,
IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA
Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and
1996), and F.M. Ausubel et al. (editors), Current Protocols in
Molecular Biology, Greene Pub. Associates and Wiley-Interscience
(1988, including all updates until present), Ed Harlow and David
Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory, (1988), and J.E. Coligan et al. (editors) Current
Protocols in Immunology, John Wiley & Sons (including all
updates until present).
[0410] Throughout this specification, unless the context requires
otherwise, the word "comprise", or variations such as "comprises"
or "comprising", is understood to imply the inclusion of a stated
step or element or integer or group of steps or elements or
integers but not the exclusion of any other step or element or
integer or group of elements or integers.
[0411] The term "and/or", e.g., "X and/or Y" shall be understood to
mean either "X and Y" or "X or Y" and shall be taken to provide
explicit support for both meanings or for either meaning.
Selected Definitions
[0412] By "RNA" is meant a molecule comprising at least one
ribonucleotide residue. By "ribonucleotide" is meant a nucleotide
with a hydroxyl group at the 2' position of a
.beta.-D-ribo-furanose moiety. The terms include double-stranded
RNA, single-stranded RNA, isolated RNA such as partially purified
RNA, essentially pure RNA, synthetic RNA, recombinantly produced
RNA, as well as altered RNA that differs from naturally occurring
RNA by the addition, deletion, substitution and/or alteration of
one or more nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of the siNA or
internally, for example at one or more nucleotides of the RNA.
Nucleotides in the RNA molecules of the instant disclosure can also
comprise non-standard nucleotides, such as non-naturally occurring
nucleotides or chemically synthesized nucleotides or
deoxynucleotides. These altered RNAs can be referred to as analogs
or analogs of naturally-occurring RNA. In one example, all of the
residues in the RNA are ribonucleotides.
[0413] As used herein, the term "RNAi reagent" refers to a RNA that
is capable of eliciting "RNA interference" or "RNAi".
[0414] The term "RNA interference" or "RNAi" refers generally to
RNA-dependent silencing of gene expression initiated by double
stranded RNA (dsRNA) molecules in a cell's cytoplasm. The dsRNA
molecule reduces or inhibits transcription products of a target
nucleic acid sequence, thereby silencing the gene.
[0415] As used herein, the term "double stranded RNA" or "dsRNA"
refers to a RNA molecule having a duplex structure and comprising
an effector sequence and an effector complement sequence which are
of similar length to one another. The effector sequence and the
effector complement sequence can be in a single RNA strand or in
separate RNA strands. The "effector sequence" (often referred to as
a "guide strand") is substantially complementary to a target
sequence, which in the present case, is a region of a RNA
transcription product of the HBV genome. The "effector sequence"
can also be referred to as the "antisense sequence". The "effector
complement sequence" will be of sufficient complementary to the
effector sequence such that it can anneal to the effector sequence
to form a duplex. In this regard, the effector complement sequence
will be substantially homologous to a region of target sequence. As
will be apparent to the skilled person, the term "effector
complement sequence" can also be referred to as the "complement of
the effector sequence" or the sense sequence.
[0416] As used herein, the term "duplex" refers to regions in two
complementary or substantially complementary nucleic acids (e.g.,
RNAs), or in two complementary or substantially complementary
regions of a single-stranded nucleic acid (e.g., RNA), that form
base pairs with one another, either by Watson-Crick base pairing or
any other manner that allows for a stabilized duplex between the
nucleotide sequences that are complementary or substantially
complementary. It will be understood by the skilled person that
within a duplex region, 100% complementarity is not required;
substantial complementarity is allowable. Substantial
complementarity includes may include 79% or greater
complementarity. For example, a single mismatch in a duplex region
consisting of 19 base pairs (i.e., 18 base pairs and one mismatch)
results in 94.7% complementarity, rendering the duplex region
substantially complementary. In another example, two mismatches in
a duplex region consisting of 19 base pairs (i.e., 17 base pairs
and two mismatches) results in 89.5% complementarity, rendering the
duplex region substantially complementary, In yet another example,
three mismatches in a duplex region consisting of 19 base pairs
(i.e., 16 base pairs and three mismatches) results in 84.2%
complementarity, rendering the duplex region substantially
complementary, and so on.
[0417] The dsRNA may be provided as a hairpin or stem loop
structure, with a duplex region comprised of an effector sequence
and effector complement sequence linked by at least 2 nucleotide
sequence which is termed a stem loop. When a dsRNA is provided as a
hairpin or stem loop structure it can be referred to as a "hairpin
RNA" or "short hairpin RNAi agent" or "shRNA".
[0418] As used herein, the term "complementary" with regard to a
sequence refers to a complement of the sequence by Watson-Crick
base pairing, whereby guanine (G) pairs with cytosine (C), and
adenine (A) pairs with either uracil (U) or thymine (T). A sequence
may be complementary to the entire length of another sequence, or
it may be complementary to a specified portion or length of another
sequence. One of skill in the art will recognize that U may be
present in RNA, and that T may be present in DNA. Therefore, an A
within either of a RNA or DNA sequence may pair with a U in a RNA
sequence or T in a DNA sequence.
[0419] As used herein, the term "substantially complementary" is
used to indicate a sufficient degree of complementarity or precise
pairing such that stable and specific binding occurs between
nucleic acid sequences e.g., between the effector sequence and the
effector complement sequence or between the effector sequence and
the target sequence. It is understood that the sequence of a
nucleic acid need not be 100% complementary to that of its target
or complement. The term encompasses a sequence complementary to
another sequence with the exception of an overhang. In some cases,
the sequence is complementary to the other sequence with the
exception of 1-2 mismatches. In some cases, the sequences are
complementary except for 1 mismatch. In some cases, the sequences
are complementary except for 2 mismatches. In other cases, the
sequences are complementary except for 3 mismatches. In yet other
cases, the sequences are complementary except for 4 mismatches.
[0420] The term "encoded", as used in the context of a IRNA of the
disclosure, shall be understood to mean a RNA is capable of being
transcribed from a DNA template. Accordingly, a nucleic acid that
encodes a RNA of the disclosure will comprise a DNA sequence which
serves as a template for transcription of the respective RNA.
[0421] The term "DNA-directed RNAi construct" or "ddRNAi construct"
refers to a nucleic acid comprising a DNA sequence which, when
transcribed produces a RNA molecule which elicits RNAi. The ddRNAi
construct may comprise a nucleic acid which is transcribed as a
single RNA that is capable of self-annealing into a hairpin
structure with a duplex region linked by a stem loop of at least 2
nucleotides i.e., shRNA, or as a single RNA with multiple shRNA or
as multiple RNA transcripts each capable of folding as a single
shRNA respectively. The ddRNAi construct may be within an
expression vector i.e., "ddRNAi expression construct", e.g.,
operably linked to a promoter. In one example, the ddRNAi construct
comprises only DNA.
[0422] As used herein, the term "operably-linked" or "operable
linkage" (or similar) means that a. coding nucleic acid sequence is
linked to, or in association with, a regulatory sequence, e,g.,
promoter, in a manner which facilitates expression of the coding
sequence. Regulatory sequences include promoters, enhancers, and
other expression control elements that are art-recognized and are
selected. to direct expression of the coding sequence.
[0423] A "vector" will be understood to mean a vehicle for
introducing a nucleic acid into a cell, Vectors include, but are
not limited to, plasmids, phagernids, viruses, bacteria, and
vehicles derived from viral or bacterial sources. A "plasrnid" is a
circular, double-stranded DNA molecule. A useful type of vector for
use in accordance with the present disclosure is a viral vector,
wherein heterologous DNA sequences are inserted into a viral genome
that can be modified to delete one or more viral genes or parts
thereof. Certain vectors are capable of autonomous replication in a
host cell (e.g., vectors having an origin of replication that
functions in the host cell). Other vectors can be stably integrated
into the genome of a host cell, and are thereby replicated along
with the host genome. As used herein, the term "expression vector"
will be understood to mean a vector capable of expressing a RNA
molecule of the disclosure.
[0424] As used herein, the terms "treating", "treat" or "treatment"
and variations thereof, refer to clinical intervention designed to
alter the natural course of the individual or cell being treated
during the course of clinical pathology. Desirable effects of
treatment include decreasing the rate of disease progression,
ameliorating or palliating the disease state, and remission or
improved prognosis. It follows that treatment of HBV infection
includes reducing HBV viral load in a subject infected with HBV,
reducing severity of symptoms associated with HBV infection, and
reducing the infectivity of HBV in a subject. An individual is
successfully "treated", for example, if one or more of the above
treatment outcomes is achieved.
[0425] A "therapeutically effective amount" is at least the minimum
concentration or amount required to effect a measurable improvement
of a particular disease (e.g., a HBV infection). A therapeutically
effective amount herein may vary according to factors such as the
disease state, age, sex, and weight of the patient, and the ability
of the RNA, ddRNAi or expression construct to elicit a desired
response in the individual. A therapeutically effective amount is
also one in which any toxic or detrimental effects of the RNA,
ddRNAi or expression construct are outweighed by the
therapeutically beneficial effects.
[0426] As used herein, the "subject" or "patient" can be a human or
non-human animal infected with HBV. The "non-human animal" may be a
primate, livestock (e.g. sheep, horses, cattle, pigs, donkeys),
companion animal (e.g. pets such as dogs and cats), laboratory test
animal (e.g. mice, rabbits, rats, guinea pigs), performance animal
(e.g. racehorses, camels, greyhounds) or captive wild animal. In
one example, the subject or patient is a mammal. In one example,
the subject or patient is a primate. In one example, the subject or
patient is a human.
[0427] The terms "reduced expression", "reduction in expression" or
similar, refer to the absence or an observable decrease in the
level of protein and/or mRNA product from the target gene e.g., the
HBV pol gene or other HBV gene. The decrease does not have to be
absolute, but may be a partial decrease sufficient for there to a
detectable or observable change as a result of the RNAi effected by
the RNA of the disclosure. The decrease can be measured by
determining a decrease in the level of mRNA and/or protein product
from a target nucleic acid relative to a cell lacking the RNA,
ddRNAi construct or expression construct, and may be as little as
1%, 5% or 10%, or may be absolute i.e., 100% inhibition. The
effects of the decrease may be determined by examination of the
outward properties i.e., quantitative and/or qualitative phenotype
of the cell or organism, and may also include an assessment of the
viral load following administration of a ddRNAi construct of the
disclosure.
Agents for RNAi
[0428] In one example, the present disclosure provides a RNA, i.e.,
capable of eliciting RNAi, wherein the RNA comprises an effector
sequence of at least 17 nucleotides in length and a effector
complement sequence, wherein the effector sequence is substantially
complementary to a RNA transcript encoded by a region of the HBV
genome set forth in Table 1. For example, the RNA of the disclosure
will comprise an effector sequence which is less than 30
nucleotides in length. For example, suitable effector sequences may
be in the range of 17-29 nucleotides in length.
[0429] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 1 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 1 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 1 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 1 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 1 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 1 set forth in Table 1.
[0430] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 2 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 2 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 2 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 2 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 2 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 2 set forth in Table 1.
[0431] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 3 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 3 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 3 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 3 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 3 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 3 set forth in Table 1.
[0432] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 4 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 4 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 4 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 4 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 4 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 4 set forth in Table 1.
[0433] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 5 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 5 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 5 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 5 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 5 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 5 set forth in Table 1.
[0434] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 6 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 6 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 6 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 6 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 6 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 6 set forth in Table 1.
[0435] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 7 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 7 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 7 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 7 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 7 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 7 set forth in Table 1.
[0436] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 8 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 8 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 8 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 8 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 8 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 8 set forth in Table 1.
[0437] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 9 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 9 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 9 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 9 set forth in Table 1 and contain 2 mismatch bases relative
thereto. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 9 set forth in
Table 1 and contain 1 mismatch base relative thereto. For example,
the effector sequence may be 100% complementary to a RNA transcript
encoded by Region 9 set forth in Table 1.
[0438] In one example, the effector sequence is substantially
complementary to a RNA transcript encoded by Region 10 set forth in
Table 1. For example, the effector sequence may be substantially
complementary to a RNA transcript encoded by Region 10 set forth in
Table 1 and contain 4 mismatch bases relative thereto. For example,
the effector sequence may be substantially complementary to a RNA
transcript encoded by Region 10 set forth in Table 1 and contain 3
mismatch bases relative thereto. For example, the effector sequence
may be substantially complementary to a RNA transcript encoded by
Region 10 set forth in Table 1 and contain 2 mismatch bases
relative thereto. For example, the effector sequence may be
substantially complementary to a RNA transcript encoded by Region
10 set forth in Table 1 and contain 1 mismatch base relative
thereto. For example, the effector sequence may be 100%
complementary to a RNA transcript encoded by Region 10 set forth in
Table 1.
[0439] In one example, the RNA of the disclosure comprises is a RNA
comprising an effector sequence which is substantially
complementary to a RNA transcript encoded by Region 1, Region 5,
Region 9, Region 4 or Region 6 set forth in Table 1 as described
herein.
[0440] In one example, the RNA of the disclosure is a short
interfering RNA (siRNA) duplex or a double-stranded RNA
(dsRNA).
[0441] In one example, the disclosure provides a plurality of RNAs,
i.e., capable of eliciting RNAi, wherein each RNA comprises an
effector sequence of at least 17 nucleotides in length and a
effector complement sequence, wherein the effector sequence of each
RNA is substantially complementary to a RNA transcript encoded by a
region of the HBV genome set forth in Table 1. For example, each
RNA of the plurality comprises an effector sequence which is less
than 30 nucleotides in length. For example, suitable effector
sequences may be in the range of 17-29 nucleotides in length.
[0442] A plurality of RNAs in accordance with the present
disclosure may comprise up to 10 RNAs as described herein. In one
example, the plurality of RNAs comprises two RNAs described herein.
In another example, the plurality of RNAs comprises three RNAs
described herein. In one example, the plurality of RNAs comprises
four RNAs described herein. In one example, the plurality of RNAs
comprises five RNAs described herein. In one example, the plurality
of RNAs comprises six RNAs described herein. In one example, the
plurality of RNAs comprises seven RNAs described herein. In one
example, the plurality of RNAs comprises eight RNAs described
herein. In one example, the plurality of RNAs comprises nine RNAs
described herein. In one example, the plurality of RNAs comprises
ten RNAs described herein.
[0443] Thus, the plurality of RNAs in accordance with the present
disclosure may comprise one or more of the RNAs described herein
comprising an effector sequence substantially complementary to a
RNA transcript encoded by a region of the HBV genome set forth in
Table 1.
[0444] In one example, the plurality of RNAs described herein are
provided together as a single composition.
[0445] In another example, the plurality of RNAs described herein
are provided as multiple compositions. For example, each of the
RNAs of the plurality may be provided separately. Alternatively, at
least one RNA of the plurality may be provided separately and two
or more of the plurality provided together in a composition.
[0446] In one example, the effector sequence of a RNA in the
plurality is substantially complementary to a RNA transcript
encoded by Region 1 in Table 1.
[0447] In one example, the effector sequence of a RNA in the
plurality is substantially complementary to a RNA transcript
encoded by Region 5 in Table 1.
[0448] In one example, the effector sequence of a RNA in the
plurality is substantially complementary to a RNA transcript
encoded by Region 9 in Table 1.
[0449] In one example, the effector sequence of a RNA in the
plurality is substantially complementary to a RNA transcript
encoded by Region 4 in Table 1.
[0450] In one example, the effector sequence of a RNA in the
plurality is substantially complementary to a RNA transcript
encoded by Region 6 in Table 1.
[0451] In one example, the effector sequence of a RNA in the
plurality is substantially complementary to a RNA transcript
encoded by Region 9 in Table 1 and the effector sequence of another
RNA in the plurality is substantially complementary to a RNA
transcript encoded by Region 4 in Table 1.
[0452] In one example, the effector sequence of a RNA in the
plurality is substantially complementary to a RNA transcript
encoded by Region 9 in Table 1 and the effector sequence of another
RNA in the plurality is substantially complementary to a RNA
transcript encoded by Region 4 in Table 1 and the effector sequence
of another RNA in the plurality is a RNA transcript encoded by
Region 5 in Table 1.
[0453] In one example, the disclosure provides a plurality of RNA
i.e., capable of eliciting RNAi, wherein:
[0454] (i) at least one RNA comprises an effector sequence of at
least 17 nucleotides in length and a effector complement sequence,
wherein the effector sequence of each RNA is substantially
complementary to a RNA transcript encoded by a region of the HBV
genome set forth in Table 1; and
[0455] (ii) at least one RNA comprises an effector sequence and an
effector complement sequence, wherein the effector sequence of each
RNA comprises or consists of a sequence set forth in the column
labelled "Effector" in Table 4. In one example, the effector
complement sequence of the RNA comprises or consists of a sequence
set forth in the column labelled "Effector complement" in Table
4.
[0456] For example, each RNA comprises an effector sequence which
is less than 30 nucleotides in length. For example, suitable
effector sequences may be in the range of 17-29 nucleotides in
length.
[0457] In one example, the RNA at (i) comprises an effector
sequence that is substantially complementary to a RNA transcript
encoded by Region 1 in Table 1 and the RNA at (ii) comprises an
effector sequence consisting of a sequence set forth in SEQ ID NO:
57. In one example, the RNA at (ii) comprises an effector
complement sequence which consists of a sequence set forth in SEQ
ID NO: 58.
[0458] In one example, the RNA at (i) comprises an effector
sequence that is substantially complementary to a RNA transcript
encoded by Region 5 in Table 1 and the RNA at (ii) comprises an
effector sequence consisting of a sequence set forth in SEQ ID NO:
57. In one example, the RNA at (ii) comprises an effector
complement sequence which consists of a sequence set forth in SEQ
ID NO: 58.
[0459] In one example, the RNA at (i) comprises an effector
sequence that is substantially complementary to a RNA transcript
encoded by Region 9 in Table 1 and the RNA at (ii) comprises an
effector sequence consisting of a sequence set forth in SEQ ID NO:
57. In one example, the RNA at (ii) comprises an effector
complement sequence which consists of a sequence set forth in SEQ
ID NO: 58.
[0460] In one example, the RNA at (i) comprises an effector
sequence that is substantially complementary to a RNA transcript
encoded by Region 4 in Table 1 and the RNA at (ii) comprises an
effector sequence consisting of a sequence set forth in SEQ ID NO:
57. In one example, the RNA at (ii) comprises an effector
complement sequence which consists of a sequence set forth in SEQ
ID NO: 58.
[0461] In one example, the RNA at (i) comprises an effector
sequence that is substantially complementary to a RNA transcript
encoded by Region 6 in Table 1 and the RNA at (ii) comprises an
effector sequence consisting of a sequence set forth in SEQ ID NO:
57. In one example, the RNA at (ii) comprises an effector
complement sequence which consists of a sequence set forth in SEQ
ID NO: 58.
[0462] In one example, a RNA at (i) comprises an effector sequence
that is substantially complementary to a RNA transcript encoded by
Region 9 in Table 1 and another RNA at (i) comprises an effector
sequence that is substantially complementary to a RNA transcript
encoded by Region 4 in Table 1 and the RNA at (ii) comprises an
effector sequence consisting of a sequence set forth in SEQ ID NO:
57. In one example, the RNA at (ii) comprises an effector
complement sequence which consists of a sequence set forth in SEQ
ID NO: 58.
[0463] In one example, a RNA at (i) comprises an effector sequence
that is substantially complementary to a RNA transcript encoded by
Region 9 in Table 1 and another RNA at (i) comprises an effector
sequence that is substantially complementary to a RNA transcript
encoded by Region 4 in Table 1 and the effector sequence of another
RNA in the plurality is a RNA transcript encoded by Region 5 in
Table 1 and the RNA at (ii) comprises an effector sequence
consisting of a sequence set forth in SEQ ID NO: 57. In one
example, the RNA at (ii) comprises an effector complement sequence
which consists of a sequence set forth in SEQ ID NO: 58.
[0464] An exemplary RNA in accordance with the present disclosure
comprises an effector sequence and an effector complement sequence,
wherein the effector sequence is substantially complementary to an
effector complement sequence described in the column labelled
"Effector complement" in Table 2.
[0465] In one example, the present disclosure provides a RNA i.e.,
capable of eliciting RNAi, comprising an effector sequence which is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2, with the exception of 4
base mismatches.
[0466] In one example, the present disclosure provides a RNA i.e.,
capable of eliciting RNAi, comprising an effector sequence which is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2, with the exception of 3
base mismatches.
[0467] In one example, the present disclosure provides a RNA i.e.,
capable of eliciting RNAi, comprising an effector sequence which is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2, with the exception of 2
base mismatches.
[0468] In one example, the present disclosure provides a RNA i.e.,
capable of eliciting RNAi, comprising an effector sequence which is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2, with the exception of a
single base mismatch.
[0469] Where a RNA of the disclosure comprises an effector sequence
which is substantially complementary to a sequence described in the
column labelled "Effector complement" in Table 2 with the exception
of 1, 2, 3 or 4 mismatches, the effector sequence will still be
able to form a duplex with the corresponding effector complement
sequence in Table 2.
[0470] In one example, the present disclosure provides a RNA i.e.,
capable of eliciting RNAi, comprising an effector sequence and an
effector complement sequence, wherein the effector sequence is 100%
complementary to a sequence described in the column labelled
"Effector complement" in Table 2. In one example, the effector
complement sequence of the RNA is substantially complementary to
the effector sequence thereof. For example, the effector complement
sequence of the RNA may comprise 1, 2, 3 or 4 mismatches relative
to the cognate effector sequence, but still be capable of forming a
duplex therewith.
[0471] Exemplary RNAs in accordance with the present disclosure
comprise corresponding effector and effector complement sequences
as described in Table 2. In one example, the corresponding effector
and effector complement sequences of the RNAs may be provided as
separate nucleic acids which are duplexed (dsRNA) e.g., by
Watson-Crick base pairing.
[0472] In one example, the disclosure provides a RNA, i.e., capable
of eliciting RNAi, wherein the RNA comprises an effector sequence
and an effector complement sequence, wherein the effector sequence
consists of a sequence set forth in the column labelled "Effector"
in Table 2.
[0473] In one example, the effector complement sequence consists of
a sequence set forth in the column labelled "Effector complement"
in Table 2.
[0474] An exemplary RNA of the disclosure comprises an effector
sequence consisting of the sequence set forth in SEQ ID NO: 47 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 48.
[0475] An exemplary RNA of the disclosure comprises an effector
sequence consisting of the sequence set forth in SEQ ID NO: 27 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 28.
[0476] An exemplary RNA of the disclosure comprises an effector
sequence consisting of the sequence set forth in SEQ ID NO: 29 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 30.
[0477] An exemplary RNA of the disclosure comprises an effector
sequence consisting of the sequence set forth in SEQ ID NO: 11 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 12.
[0478] An exemplary RNA of the disclosure comprises an effector
sequence consisting of the sequence set forth in SEQ ID NO: 45 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 46.
[0479] An exemplary RNA of the disclosure comprises an effector
sequence consisting of the sequence set forth in SEQ ID NO: 35 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 36.
[0480] An exemplary RNA of the disclosure comprises an effector
sequence consisting of the sequence set forth in SEQ ID NO: 21 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 22.
[0481] In one example, the disclosure provides a plurality of RNAs,
i.e., capable of eliciting RNAi, wherein each RNA comprises an
effector sequence and an effector complement sequence, wherein the
effector sequence of each RNA is substantially complementary to an
effector complement sequence set forth in the column labelled
"Effector complement" in Table 2. Exemplary RNAs comprising an
effector sequence which is substantially complementary to an
effector complement sequence set forth in the column labelled
"Effector complement" in Table 2 are described herein.
[0482] In one example, the effector sequence of each RNA consists
of a sequence set forth in the column labelled "Effector" in Table
2. In one example, the effector complement sequence of each RNA
consists of a sequence set forth in the column labelled "Effector
complement" in Table 2.
[0483] In one example, the disclosure provides a plurality of RNAs,
i.e., capable of eliciting RNAi, wherein:
[0484] (i) at least one RNA comprises an effector sequence and a
effector complement sequence, wherein the effector sequence of the
RNA consists of a sequence set forth in the column labelled
"Effector" in Table 2 (in one example, the effector complement
sequence of each RNA consists of a sequence set forth in the column
labelled "Effector complement" in Table 2); and
[0485] (ii) at least one RNA comprises an effector sequence and an
effector complement sequence, wherein the effector sequence of the
RNA consists of a sequence set forth in the column labelled
"Effector" in Table 4 (in one example, the effector complement
sequence of the RNA comprises or consists of a sequence set forth
in the column labelled "Effector complement" in Table 4).
[0486] An exemplary plurality of RNAs of the disclosure
comprises:
[0487] (i) a RNA comprising an effector sequence consisting of the
sequence set forth in SEQ ID NO: 47 and an effector complement
sequence consisting of the sequence set forth in SEQ ID NO: 48;
and
[0488] (ii) a RNA comprising an effector sequence consisting of the
sequence set forth in SEQ ID NO: 27 and an effector complement
sequence consisting of the sequence set forth in SEQ ID NO: 28.
[0489] An exemplary plurality of RNAs of the disclosure
comprises:
[0490] (i) a RNA comprising an effector sequence consisting of the
sequence set forth in SEQ ID NO: 47 and an effector complement
sequence consisting of the sequence set forth in SEQ ID NO: 48;
[0491] (ii) a RNA comprising an effector sequence consisting of the
sequence set forth in SEQ ID NO: 27 and an effector complement
sequence consisting of the sequence set forth in SEQ ID NO: 28;
and
[0492] (iii) a RNA comprising an effector sequence consisting of
the sequence set forth in SEQ ID NO: 29 and an effector complement
sequence consisting of the sequence set forth in SEQ ID NO: 30.
[0493] An exemplary plurality of RNAs of the disclosure
comprises:
[0494] (i) a RNA comprising an effector sequence consisting of the
sequence set forth in SEQ ID NO: 47 and an effector complement
sequence consisting of the sequence set forth in SEQ ID NO: 48;
[0495] (ii) a RNA comprising an effector sequence consisting of the
sequence set forth in SEQ ID NO: 27 and an effector complement
sequence consisting of the sequence set forth in SEQ ID
[0496] NO: 28; and
[0497] (iii) a RNA comprising an effector sequence consisting of
the sequence set forth in SEQ ID NO: 57 and an effector complement
sequence consisting of the sequence set forth in SEQ ID NO: 58.
[0498] RNA of the disclosure may comprise either synthetic RNAs or
DNA-directed RNAs (ddRNAs). Synthetic RNAs may be manufactured by
methods known in the art such as by typical oligonucleotide
synthesis, and may incorporate chemical modifications to increase
half-life and/or efficacy of the siRNA agent, and/or to allow for a
more robust delivery formulation. Many chemical modifications of
oligonucleotides are known and well described in the art.
[0499] In one example, substantially all of the nucleotides of a
RNA of the disclosure are modified. In other example, all of the
nucleotides of a RNA of the disclosure are modified. RNAs of the
disclosure in which "substantially all of the nucleotides are
modified" are largely but not wholly modified and can include not
more than 5, 4, 3, 2, or 1 unmodified nucleotides.
[0500] In one example, the RNA of the disclosure comprises one or
more overhang regions and/or capping groups at the 3'-end, 5'-end,
or both ends of one or both strands of the duplex. The overhang
regions can be 1-6 nucleotides in length, for instance 2-6
nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides
in length, 1-4 nucleotides in length, 2-4 nucleotides in length,
1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2
nucleotides in length. The overhangs can be the result of one
strand being longer than the other, or the result of two strands of
the same length being staggered. The overhang can form a mismatch
with the target mRNA or it can be complementary to the gene
sequences being targeted or can be another sequence. The first and
second strands can also be joined, e.g., by additional bases to
form a hairpin, or by other non-base linkers.
[0501] In one example, the nucleotides in the overhang region of
the RNA each independently are a modified or unmodified nucleotide
including, but no limited to 2'-sugar modified, such as, 2-F,
2'-O-methyl, thymidine (T), deoxy-thymine (dT),
2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyladenosine
(Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any
combinations thereof. For example, dTdT can be an overhang sequence
for either end on either strand. The overhang can form a mismatch
with the target mRNA or it can be complementary to the gene
sequences being targeted or can be another sequence.
[0502] The 5'- or 3'-overhangs at the sense strand, antisense
strand or both strands of the RNA can be phosphorylated. In some
examples, the overhang region(s) contains two nucleotides having a
phosphorothioate between the two nucleotides, where the two
nucleotides can be the same or different.
[0503] In one example, the RNA contains only a single overhang,
which can strengthen the interference activity of the RNA, without
affecting its overall stability. For example, the single-stranded
overhang is be located at the 3'-terminal end of the effector
sequence or, alternatively, at the 3'-terminal end of the effector
complement sequence. In one example, the RNA also comprises a blunt
end, located at the 5'-end of the effector complement sequence (or
the 3'-end of the effector sequence) or vice versa.
[0504] Modifications include, for example, end modifications, e.g.,
5'-end modifications (phosphorylation, conjugation, inverted
linkages) or 3'-end modifications (conjugation, DNA nucleotides,
inverted linkages, etc.); base modifications, e.g., replacement
with stabilizing bases, destabilizing bases, or bases that base
pair with an expanded repertoire of partners, removal of bases
(abasic nucleotides), or conjugated bases; sugar modifications
(e.g., at the 2'-position or 4'-position) or replacement of the
sugar; and/or backbone modifications, including modification or
replacement of the phosphodiester linkages. Specific examples of
RNAs useful in the disclosure include, but are not limited to RNAs
containing modified backbones or no natural internucleoside
linkages. RNAs having modified backbones include, among others,
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified RNAs that do not have a phosphorus atom in their
internucleoside backbone can also be considered to be
oligonucleosides. In some example, a modified RNA will have a
phosphorus atom in its internucleoside backbone. Representative
U.S. patents that teach the preparation of phosphorus-containing
linkages include, but are not limited to, U.S. Pat. Nos. 7,015,315;
7,041,816; 7,273,933; 7,321,029; and US Pat RE39464.
[0505] Modified RNA backbones that do not include a phosphorus atom
therein have backbones that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or
cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and
CH.sub.2 component parts. Representative U.S. patents that teach
exemplary forms of these oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,663,312; 5,633,360; 5,677,437; and
5,677,439.
[0506] In one example, the RNA of the disclosure comprises only
unmodified or natural bases, e.g., a described below.
[0507] In other examples, the RNAs of the disclosure comprise or
are a RNA mimetic, e.g., the backbone, of the nucleotide units are
replaced with novel groups. The base units are maintained for
hybridization with an appropriate nucleic acid target compound. One
such oligomeric compound, a RNA mimetic that has been shown to have
excellent hybridization properties, is referred to as a peptide
nucleic acid (PNA). In PNA compounds, the sugar backbone of a RNA
is replaced with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative U.S. patents that teach the
preparation of PNA compounds include, but are not limited to, U.S.
Pat. Nos. 5,539,082; 5,714,331; and 5,719,262.
[0508] Modified RNAs can also contain one or more substituted sugar
moieties. The RNAs, e.g., dsRNAs, featured herein can include one
of the following at the 2'-position: OH; F; O--, S--, or N-alkyl;
O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl can be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Exemplary suitable modifications include
O[CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.1).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10.
[0509] A RNA can also include nucleobase (often referred to in the
art simply as "base") modifications or substitutions. As used
herein, "unmodified" or "natural" nucleobases include the purine
bases adenine (A) and guanine (G), and the pyrimidine bases thymine
(T), cytosine (C) and uracil (U). Modified nucleobases include
other synthetic and natural nucleobases such as deoxy-thymine (dT),
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and
cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and
guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-daazaadenine and 3-deazaguanine and 3-deazaadenine. *
[0510] The RNA can also be modified to include one or more locked
nucleic acids (LNA). A locked nucleic acid is a nucleotide having a
modified ribose moiety in which the ribose moiety comprises an
extra bridge connecting the 2' and 4' carbons. This structure
effectively "locks" the ribose in the 3'-endo structural
conformation. The addition of locked nucleic acids to siRNAs has
been shown to increase siRNA stability in serum, and to reduce
off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research
33(1):439-447). Potentially stabilizing modifications to the ends
of RNA can include N-(acetylaminocaproyl)-4-hydroxyprolinol
(Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6),
N-(acetyl-4-hydroxyprolinol (Hyp-NHAc),
thymidine-2'-O-deoxythymidine (ether),
N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino),
2-docosanoyl-uridine-3''-phosphate, inverted base dT(idT) and
others. Disclosure of this modification can be found in PCT
Publication No. WO 2011/005861.
[0511] In another example, the exemplary RNAs of the disclosure
(e.g., as set forth in Table 2 and/or Table 4) may be provided as
short hairpin RNAs (shRNAs) comprising a stem loop sequence
positioned between the effector sequence and the effector
complement sequence such that the respective RNA forms a single
contiguous sequence. A stem loop sequence is of sufficient length
to permit the effector sequence and the effector complement
sequence to anneal to one another. Suitable stem loop sequences may
for instance be selected from those known in the art. For example,
an shRNA in accordance with the present disclosure may comprise a
sequence set forth in Table 3, optionally modified as described
herein.
[0512] In one example, a RNA of the disclosure is chemically
synthesized. Oligonucleotides (e.g., certain modified
oligonucleotides or portions of oligonucleotides lacking
ribonucleotides) are synthesized using protocols known in the art,
for example as described in Caruthers et al., 1992, Methods in
Enzymology 211, 3-19, WO 99/54459, Wincott et al., 1995, Nucleic
Acids Res. 23, 2677-2684, Wincott et al., 1997, Methods Mol. Bio.,
74, 59, Brennan et al., 1998, Biotechnol Bioeng., 61, 33-45, and
Brennan, U.S. Pat. No. 6,001,311. The synthesis of oligonucleotides
makes use of common nucleic acid protecting and coupling groups,
such as dimethoxytrityl at the 5'-end, and phosphoramidites at the
3'-end.
[0513] RNA without modifications are synthesized using procedures
as described in Usman et al., 1987, J. Am. Chem. Soc., 109, 7845;
Scaringe et al., 1990, Nucleic Acids Res., 18, 5433. These
syntheses makes use of common nucleic acid protecting and coupling
groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites
at the 3'-end that can be used for certain RNA of the
disclosure.
[0514] In certain examples, the RNAs of the disclosure are
synthesized, deprotected, and analyzed according to methods
described in U.S. Pat. Nos. 6,995,259, 6,686,463, 6,673,918,
6,649,751, and/or 6,989,442.
[0515] In an alternative example, a RNA of the disclosure is
synthesized as discrete components and joined together
post-synthetically, for example, by ligation (Moore et al., 1992,
Science 256, 9923 or WO 93/23569), or by hybridization following
synthesis and/or deprotection.
[0516] In one example, an exemplary shRNA comprises or consists of
the sequence set forth in SEQ ID NO: 92. In one example, an
exemplary shRNA comprises or consists of the sequence set forth in
SEQ ID NO: 95.
[0517] In one example, an exemplary shRNA comprises or consists of
the sequence set forth in SEQ ID NO: 78.
[0518] In one example, an exemplary shRNA comprises or consists of
the sequence set forth in SEQ ID NO: 79. In one example, an
exemplary shRNA comprises or consists of the sequence set forth in
SEQ ID NO: 82.
[0519] In one example, an exemplary shRNA comprises or consists of
the sequence set forth in SEQ ID NO: 65. In one example, an
exemplary shRNA comprises or consists of the sequence set forth in
SEQ ID NO: 68.
[0520] In one example, an exemplary shRNA comprises or consists of
the sequence set forth in SEQ ID NO: 91. In one example, an
exemplary shRNA comprises or consists of the sequence set forth in
SEQ ID NO: 94.
[0521] In one example, an exemplary shRNA comprises or consists of
the sequence set forth in SEQ ID NO: 83. In one example, an
exemplary shRNA comprises or consists of the sequence set forth in
SEQ ID NO: 84.
[0522] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 92 and at least one other RNA
of the disclosure.
[0523] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 95 and at least one other RNA
of the disclosure. The present disclosure also provides a plurality
of RNAs, wherein the plurality comprises a shRNA comprising or
consisting of the sequence set forth in SEQ ID NO: 78 and at least
one other RNA of the disclosure.
[0524] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 79 and at least one other RNA
of the disclosure.
[0525] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 82 and at least one other RNA
of the disclosure.
[0526] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 65 and at least one other RNA
of the disclosure.
[0527] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 68 and at least one other RNA
of the disclosure.
[0528] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 91 and at least one other RNA
of the disclosure.
[0529] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 94 and at least one other RNA
of the disclosure.
[0530] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 83 and at least one other RNA
of the disclosure.
[0531] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 84 and at least one other RNA
of the disclosure.
[0532] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises:
[0533] (i) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 92;
[0534] (ii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 78; and
[0535] (iii) at least one other RNA of the disclosure.
[0536] In one example, the other RNA of the disclosure is a shRNA
comprising a sequence set forth in SEQ ID NO: 79, 82, 65, 68, 91,
94, 83 or 84.
[0537] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises or consists of:
[0538] (i) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 92;
[0539] (ii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 78; and
[0540] (iii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 79.
[0541] The present disclosure also provides a plurality of RNAs,
wherein the plurality comprises or consists of:
[0542] (i) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 92;
[0543] (ii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 78; and
[0544] (iii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 101.
ddRNAi
[0545] A RNA of the disclosure can be transcribed from a nucleic
acid. Accordingly, in one example, the disclosure provides a
nucleic acid encoding a RNA of the disclosure.
[0546] In one example, the nucleic acid is DNA.
[0547] In another example, the disclosure provides a nucleic acid
encoding a plurality of RNAs of the disclosure.
[0548] In another example, the disclosure provides a plurality of
nucleic acids encoding a plurality of RNAs of the disclosure. For
example, each nucleic acid of the plurality may encode a single RNA
described herein. In another example, one or more nucleic acids
encodes a plurality of RNAs e.g., a nucleic acid of the plurality
encodes two or more RNAs of the disclosure and another nucleic acid
of the plurality encodes one or more RNAs of the disclosure.
[0549] In one example, the plurality of nucleic acids described
herein are provided together e.g., in a single composition.
[0550] In another example, the plurality of nucleic acids described
herein are provided as multiple components e.g., multiple
compositions. For example, each of the nucleic acids of the
plurality may be provided separately. Alternatively, in an example
where at least three nucleic acids of the disclosure are provided,
at least one of the nucleic acids may be provided separately and
two or more of the plurality provided together.
[0551] In some examples, a nucleic acid of the disclosure comprises
one or more additional elements e.g., to facilitate transcription
of the RNA. For example, the nucleic acid may comprise a promoter
operably linked to a sequence encoding a RNA of the disclosure.
Other elements e.g., transcriptional terminators, are known in the
art and/or described herein.
[0552] In one example, the nucleic acid is a DNA-directed RNAi
(ddRNAi) construct.
[0553] In one example, the ddRNAi construct comprises a sequence
encoding a RNA of the disclosure operably linked to a promoter.
[0554] In one example, the ddRNAi construct comprises a sequence
encoding a RNA comprising an effector sequence and an effector
complement sequence of the disclosure. Exemplary effector sequences
and effector complement sequences are set forth in Table 2.
[0555] For example, the sequences may be operably linked to a
promoter. In one example, both sequences may be operably linked to
the same promoter. In one example, both sequences may be operably
linked to different promoters.
[0556] In one example, the disclosure provides a ddRNAi construct
comprising a sequence encoding an effector sequence and a sequence
encoding an effector complement sequence, wherein the effector
sequence is substantially complementary to an effector complement
sequence described in the column labelled "Effector complement" in
Table 2. For example, an effector sequence which is substantially
complementary to an effector complement sequence described in the
column labelled "Effector complement" in Table 2 may comprise 0, 1,
2, 3 or 4 mismatches when duplexed with the corresponding effector
complement sequence in Table 2.
[0557] In one example, the disclosure provides an ddRNAi construct
comprising a sequence encoding an effector sequence which is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2, with the exception of 4
base mismatches.
[0558] In one example, the disclosure provides an ddRNAi construct
comprising a sequence encoding an effector sequence which is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2, with the exception of 3
base mismatches.
[0559] In one example, the disclosure provides an ddRNAi construct
comprising a sequence encoding an effector sequence which is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2, with the exception of 2
base mismatches.
[0560] In one example, the disclosure provides an ddRNAi construct
comprising a sequence encoding an effector sequence which is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2, with the exception of a
single base mismatch.
[0561] In one example, the present disclosure provides a ddRNAi
construct comprising a sequence encoding an effector sequence and
an effector complement sequence, wherein the effector sequence is
100% complementary to a sequence described in the column labelled
"Effector complement" in Table 2. In one example, ddRNAi construct
comprises a sequence encoding an effector complement sequence which
is substantially complementary to the effector sequence encoded by
the ddRNAi construct.
[0562] Exemplary ddRNAi constructs of the disclosure comprise
sequences encoding corresponding effector and effector complement
sequences as described in Table 2.
[0563] In one example, the disclosure provides a ddRNAi construct
comprising a sequence which encodes an effector sequence and a
sequence encoding an effector complement sequence, wherein the
effector sequence consists of a sequence set forth in the column
labelled "Effector" in Table 2. In one example, the effector
complement sequence consists of a sequence set forth in the column
labelled "Effector complement" in Table 2.
[0564] An exemplary ddRNAi construct of the disclosure comprises a
sequence encoding an effector sequence consisting of the sequence
set forth in SEQ ID NO: 47 and a sequence encoding an effector
complement sequence consisting of the sequence set forth in SEQ ID
NO: 48.
[0565] Another exemplary ddRNAi construct of the disclosure
comprises a sequence encoding an effector sequence consisting of
the sequence set forth in SEQ ID NO: 27 and a sequence encoding an
effector complement sequence consisting of the sequence set forth
in SEQ ID NO: 28.
[0566] A further exemplary ddRNAi construct of the disclosure
comprises a sequence encoding an effector sequence consisting of
the sequence set forth in SEQ ID NO: 29 and a sequence encoding an
effector complement sequence consisting of the sequence set forth
in SEQ ID NO: 30.
[0567] A further exemplary ddRNAi construct of the disclosure
comprises a sequence encoding an effector sequence consisting of
the sequence set forth in SEQ ID NO: 11 and a sequence encoding an
effector complement sequence consisting of the sequence set forth
in SEQ ID NO: 12.
[0568] A further exemplary ddRNAi construct of the disclosure
comprises a sequence encoding an effector sequence consisting of
the sequence set forth in SEQ ID NO: 45 and a sequence encoding an
effector complement sequence consisting of the sequence set forth
in SEQ ID NO: 46.
[0569] A further exemplary ddRNAi construct of the disclosure
comprises a sequence encoding an effector sequence consisting of
the sequence set forth in SEQ ID NO: 35 and a sequence encoding an
effector complement sequence consisting of the sequence set forth
in SEQ ID NO: 36.
[0570] A further exemplary ddRNAi construct of the disclosure
comprises a sequence encoding an effector sequence consisting of
the sequence set forth in SEQ ID NO: 21 and a sequence encoding an
effector complement sequence consisting of the sequence set forth
in SEQ ID NO: 22.
[0571] In another example, the disclosure provides a ddRNAi
construct encoding a plurality of RNAs of the disclosure or
comprising a sequence encoding a RNA of the disclosure and at least
one other RNA capable of eliciting RNAi.
[0572] In one example, the disclosure provides a ddRNAi construct
encoding a plurality of RNAs of the disclosure, wherein each RNA
comprises an effector sequence and an effector complement sequence,
wherein the effector sequence of at least one (or each) RNA is
substantially complementary to a sequence described in the column
labelled "Effector complement" in Table 2. Exemplary RNAs of the
disclosure comprising an effector sequence which is "substantially
complementary" to a sequence described in the column labelled
"Effector complement" in Table 2 have been described and shall be
taken to apply mutatis mutandis to this example of the disclosure.
However, in one example, the disclosure provides a ddRNAi construct
encoding a plurality of RNAs of the disclosure, wherein each RNA
comprises an effector sequence and an effector complement sequence,
wherein the effector sequence of at least one (or each) RNA
consists of a sequence set forth in the column labelled "Effector"
in Table 2. In one example, the effector complement sequence of at
least one (or each) RNA consists of a sequence set forth in the
column labelled "Effector complement" in Table 2.
[0573] In one example, the disclosure provides a ddRNAi construct
encoding a plurality of RNAs of the disclosure, wherein:
[0574] (i) at least one RNA comprises an effector sequence and a
effector complement sequence, wherein the effector sequence of the
RNA consists of a sequence set forth in the column labelled
"Effector" in Table 2 (in one example, the effector complement
sequence of each RNA consists of a sequence set forth in the column
labelled "Effector complement" in Table 2); and
[0575] (ii) at least one RNA comprises an effector sequence and an
effector complement sequence, wherein the effector sequence of the
RNA consists of a sequence set forth in the column labelled
"Effector" in Table 4 (in one example, the effector complement
sequence of the RNA comprises or consists of a sequence set forth
in the column labelled "Effector complement" in Table 4).
[0576] Exemplary combinations of RNAs are described herein and
shall be taken to apply mutatis mutandis to this example of the
disclosure.
[0577] An exemplary ddRNAi construct of the disclosure
comprises:
[0578] (i) a sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 47 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 48; and
[0579] (ii) a sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 27 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 28.
[0580] An exemplary ddRNAi construct of the disclosure
comprises:
[0581] (i) a sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 47 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 48;
[0582] (ii) a sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 27 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 28; and
[0583] (iii) a sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 29 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 30.
[0584] For example, the ddRNAi construct of the disclosure may
comprise, in a 5'-3' direction:
[0585] (i) a DNA sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 27 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 28;
[0586] (ii) a DNA sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 29 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 30; and
[0587] (iii) a DNA sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 47 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 48.
[0588] Each of the DNA sequences encoding the RNAs at (i) to (iii)
in the ddRNAi construct may also be in operable linkage with a
separate promoter in the ddRNAi construct e.g., a U6 or H1
promoter.
[0589] Another exemplary ddRNAi of the disclosure comprises:
[0590] (i) a sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 47 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 48;
[0591] (ii) a sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 27 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 28; and
[0592] (iii) a sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 57 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 58.
[0593] For example, the ddRNAi construct of the disclosure may
comprise, in a 5'-3' direction:
[0594] (i) a DNA sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 27 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 28;
[0595] (ii) a DNA sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 57 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 58; and
[0596] (iii) a DNA sequence encoding a RNA comprising an effector
sequence consisting of the sequence set forth in SEQ ID NO: 47 and
an effector complement sequence consisting of the sequence set
forth in SEQ ID NO: 48.
[0597] Each of the DNA sequences encoding the RNAs at (i) to (iii)
in the ddRNAi construct may also be in operable linkage with a
separate promoter in the ddRNAi construct e.g., a U6 or H1
promoter.
[0598] In one example, the ddRNAi construct comprises a sequence
encoding a shRNA of the disclosure operably linked to a promoter.
For example, the ddRNAi construct of the disclosure comprises a
sequence encoding a shRNA comprising or consisting of a sequence
set forth in Table 3 operably linked to a promoter e.g., a U6 or H1
promoter.
[0599] For example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 92.
[0600] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 95.
[0601] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 78.
[0602] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 79.
[0603] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 82.
[0604] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 65.
[0605] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 68.
[0606] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 91.
[0607] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 94.
[0608] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 83.
[0609] In one example, the ddRNAi construct may comprise a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 84.
[0610] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising a shRNA comprising or consisting of a sequence set forth
in Table 3 and at least one other RNA of the disclosure. For
example, the other RNA may be a shRNA, e.g., comprising or
consisting of a sequence set forth in Table 3 or in Table 5.
[0611] In one example, the disclosure also provides a ddRNAi
construct comprising a sequence encoding a plurality of RNAs, the
plurality comprising a shRNA comprising or consisting of the
sequence set forth in SEQ ID NO: 92 and at least one other RNA of
the disclosure. The present disclosure also provides a ddRNAi
construct comprising a sequence encoding a plurality of RNAs, the
plurality comprising a shRNA comprising or consisting of the
sequence set forth in SEQ ID NO: 95 and at least one other RNA of
the disclosure.
[0612] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 78 and at least one other RNA of the
disclosure.
[0613] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 79 and at least one other RNA of the
disclosure.
[0614] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 82 and at least one other RNA of the
disclosure.
[0615] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 65 and at least one other RNA of the
disclosure.
[0616] In one example, the disclosure also provides a ddRNAi
construct comprising a sequence encoding a plurality of RNAs, the
plurality comprising a shRNA comprising or consisting of the
sequence set forth in SEQ ID NO: 68 and at least one other RNA of
the disclosure.
[0617] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 91 and at least one other RNA of the
disclosure.
[0618] In one example, the disclosure also provides a ddRNAi
construct comprising a sequence encoding a plurality of RNAs, the
plurality comprising a shRNA comprising or consisting of the
sequence set forth in SEQ ID NO: 94 and at least one other RNA of
the disclosure.
[0619] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 83 and at least one other RNA of the
disclosure.
[0620] In one example, the disclosure provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 84 and at least one other RNA of the
disclosure.
[0621] The present disclosure also provides a ddRNAi comprising a
sequence encoding a plurality of RNAs wherein the plurality
comprises:
[0622] (i) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 92;
[0623] (ii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 78; and
[0624] (iii) at least one other RNA of the disclosure.
[0625] In one example, the other RNA encoded by the ddRNAi
construct of the disclosure is a shRNA comprising a sequence set
forth in SEQ ID NO: 79, 82, 65, 68, 91, 94, 83 or 84.
[0626] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising:
[0627] (i) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 92;
[0628] (ii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 78; and
[0629] (iii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 79.
[0630] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, the plurality
comprising:
[0631] (i) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 92;
[0632] (ii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 78; and
[0633] (iii) a shRNA comprising or consisting of the sequence set
forth in SEQ ID NO: 101.
[0634] As discussed above, a ddRNAi construct generally comprises a
sequence encoding a RNA of the disclosure (e.g., a shRNA of the
disclosure) operably linked to a promoter. Often the ddRNAi
construct is within a vector, e.g., a plasmid or a miniplasmid or a
viral vector.
[0635] In one example, the sequences encoding a plurality of RNAs
(e.g., shRNAs) in a ddRNAi construct are operably linked to the
same promoter. For example, the construct may comprise multiple
copies of the same promoter with each copy operably linked to a
sequence encoding a different RNA of the disclosure.
[0636] In another example, each promoter operably linked to a RNA
of the disclosure is different. For example, in a ddRNAi construct
encoding three RNAs (e.g., three shRNAs), the three sequences
encoding the RNAs are each operably linked to a different
promoter.
[0637] In a further example, in a ddRNAi construct encoding three
or more RNAs (e.g., shRNAs), two (or more) of the sequences
encoding the RNAs are linked to the same promoter and one (or more)
of the sequences encoding the RNAs is linked to a different
promoter.
[0638] In one example, the promoter is a constitutive promoter. The
term "constitutive" when made in reference to a promoter means that
the promoter is capable of directing transcription of an operably
linked nucleic acid sequence in the absence of a specific stimulus
(e.g., heat shock, chemicals, light, etc.). Typically, constitutive
promoters are capable of directing expression of a coding sequence
in substantially any cell and any tissue. The promoters used to
transcribe the RNA of the disclosure include a promoter for
ubiquitin, CMV, (3-actin, histone H4, EF-1.alpha. or pgk genes
controlled by RNA polymerase II, or promoter elements controlled by
RNA polymerase I.
[0639] In one example, a Pol II promoter such as CMV, SV40, U1,
.beta.-actin or a hybrid Pol H promoter is employed.
[0640] In another example, a promoter controlled by RNA polymerase
III is used, such as a U6 promoter (U6-1, U6-8, U6-9), H1 promoter,
7SL promoter, a human Y promoter (hYl, hY3, hY4 (see Maraia, et
al., Nucleic Acids Res 22(15):3045-52(1994)) and hY5 (see Maraia,
et al., Nucleic Acids Res 24(18):3552-59(1994)), a human MRP-7-2
promoter, an Adenovirus VA1 promoter, a human tRNA promoter, or a
5s ribosomal RNA promoter.
[0641] Suitable promoters for use in a ddRNAi construct of the
disclosure are described in U.S. Pat. No. 8,008,468 and US Patent
No. 8,129,510.
[0642] In one example, the promoter is a RNA pol III promoter. For
example, the promoter is a U6 promoter. In another example, the
promoter is a H1 promoter.
[0643] In the case of a ddRNAi construct encoding a plurality of
RNAs of the disclosure (e.g., shRNAs of the disclosure) a sequence
encoding at least one of the RNAs is operably linked to a U6
promoter and a sequence encoding at least one other of the RNAs is
operably linked to a H1 promoter.
[0644] In the case of a ddRNAi construct encoding three RNAs of the
disclosure (e.g., shRNAs of the disclosure), the sequences encoding
two of the RNAs are each operably linked to a U6 promoter and a
sequence encoding the other of the RNAs is operably linked to a H1
promoter. For example, when considered in a 5' to 3' direction, the
first and third sequences are operably linked to the U6 promoter
and the second sequence is operably linked to a H1 promoter.
[0645] In another example, sequences encoding two of the RNAs are
each operably linked to a H1 promoter and a sequence encoding the
other of the RNAs is operably linked to a U6 promoter. For example,
when considered in a 5' to 3' direction, the first and third
sequences are operably linked to the H1 promoter and the second
sequence is operably linked to a U6 promoter.
[0646] In one example, the promoter in a construct is a U6
promoter. For example, the promoter is a U6-1 promoter. For
example, the promoter is a U6-8 promoter. For example, the promoter
is a U6-9 promoter.
[0647] In some examples, promoters of variable strength are
employed. For example, use of two or more strong promoters (such as
a Pol III-type promoter) may tax the cell, by, e.g., depleting the
pool of available nucleotides or other cellular components needed
for transcription. In addition or alternatively, use of several
strong promoters may cause a toxic level of expression of RNAi
agents in the cell. Thus, in some examples one or more of the
promoters in the multiple-promoter ddRNAi construct is weaker than
other promoters in the construct, or all promoters in the construct
may express RNAs at less than a maximum rate. Promoters may also be
modified using various molecular techniques, or otherwise, e.g.,
through modification of various regulatory elements, to attain
weaker levels or stronger levels of transcription. One means of
achieving reduced transcription is to modify sequence elements
within promoters known to control promoter activity. For example
the Proximal Sequence Element (PSE) is known to effect the activity
of human U6 promoters (see Domitrovich, et al., Nucleic Acids Res
31: 2344-2352 (2003). Replacing the PSE elements present in strong
promoters, such as the human U6-1, U6-8 or U6-9 promoters, with the
element from a weak promoter, such as the human U6-7 promoter,
reduces the activity of the hybrid U6-1, U6-8 or U6-9 promoters.
This approach has been used in the examples described in this
application, but other means to achieve this outcome are known in
the art.
[0648] Promoters useful in some examples of the present disclosure
can be tissue-specific or cell-specific. The term "tissue specific"
as it applies to a promoter refers to a promoter that is capable of
directing selective transcription of a nucleic acid of interest to
a specific type of tissue (e.g., liver tissue) in the relative
absence of expression of the same nucleotide sequence of interest
in a different type of tissue (e.g., muscle). The term
"cell-specific" as applied to a promoter refers to a promoter which
is capable of directing selective transcription of a nucleic acid
of interest in a specific type of cell in the relative absence of
expression of the same nucleotide sequence of interest in a
different type of cell within the same tissue.
[0649] In one example, a ddRNAi construct of the disclosure may
additionally comprise one or more enhancers to increase expression
of the RNA(s). Enhancers appropriate for use in examples of the
present disclosure include the Apo E HCR enhancer, a CMV enhancer
(Xia et al, Nucleic Acids Res 31-17(2003)), and other enhancers
known to those skilled in the art. Suitable enhancers for use in a
ddRNAi construct of the disclosure are described in U.S. Pat. No.
8,008,468.
[0650] In a further example, a ddRNAi construct of the disclosure
may comprise a transcriptional terminator linked to a nucleic acid
encoding a RNA of the disclosure. In the case of a ddRNAi construct
encoding multiple RNAs, the terminators linked to each nucleic acid
can be the same or different. In one example, the terminator is a
contiguous stretch of 4 or more or 5 or more or 6 or more T
residues.
[0651] In some examples, where different promoters are used, the
terminators can be different and are matched to the promoter from
the gene from which the terminator is derived. Such terminators
include the SV40 poly A, the AdV VA1 gene, the 5S ribosomal RNA
gene, and the terminators for human t-RNAs. In addition, promoters
and terminators may be mixed and matched, as is commonly done with
RNA pol II promoters and terminators.
[0652] In one example, the promoter and terminator in each
promoter/RNA encoding sequence/terminator component in a ddRNAi
construct encoding multiple RNAs are all different to decrease the
likelihood of DNA recombination events between components.
[0653] In an example, a ddRNAi construct of the disclosure
comprises a sequence encoding a RNA of the disclosure operably
linked to a U6 promoter and linked to a terminator comprising at
least four thymidine residues e.g., 4 or 5 or 6 thymidine residues.
In one example, the sequence encoding the RNA is also linked to a
transcription initiator comprising a single guanine.
[0654] In an example, a ddRNAi construct of the disclosure
comprises a sequence encoding a shRNA consisting of a sequence set
forth in Table 3 operably linked to a promoter, e.g., a U6
promoter. In one example, the sequence encoding the shRNA is linked
to a terminator e.g., comprising at least four thymidine residues,
such as 4 or 5 or 6 thymidine residues. In one example, the
sequence encoding the shRNA is linked to a transcription initiator
e.g., comprising a single guanine residue.
[0655] One exemplary ddRNAi construct comprises a sequence encoding
a shRNA comprising or consisting of the sequence set forth in SEQ
ID NO: 92 operably linked to a U6 promoter, a transcription
initiator sequence comprising a single guanine residue and a
terminator sequence comprising five contiguous thymidine
residues.
[0656] Another exemplary ddRNAi construct comprises a sequence
encoding a shRNA comprising or consisting of the sequence set forth
in SEQ ID NO: 78 operably linked to a U6 promoter and a terminator
comprising six contiguous thymidine residues. Another exemplary
ddRNAi construct comprises a sequence encoding a shRNA comprising
or consisting of the sequence set forth in SEQ ID NO: 79 operably
linked to a U6 promoter, a transcription initiator sequence
comprising a single guanine residue and a terminator comprising six
contiguous thymidine residues. In another example, the disclosure
provides a ddRNAi construct comprising a sequence encoding a
plurality of RNAs, wherein the ddRNAi construct comprises (i) a
sequence encoding a shRNA comprising or consisting of a sequence
set forth in Table 3 operably linked to a promoter e.g., a U6
promoter, and (ii) a sequence encoding at least one other RNA of
the disclosure operably linked to a promoter. In one example, the
sequence at (i) is linked to a terminator e.g., comprising at least
five thymidine residues. In one example, the sequence at (i) is
linked to a transcription initiator e.g., comprising a single
guanine residue. In one example, the sequence at (i) is linked to a
terminator e.g., comprising at least five thymidine residues, and
linked to a transcription initiator e.g., comprising a single
guanine residue. In one example, the sequence at (ii) is linked to
a terminator e.g., comprising at least five thymidine residues. In
one example, the sequence at (ii) is linked to a transcription
initiator e.g., comprising a single guanine residue. In one
example, the sequence at (ii) is linked to a terminator e.g.,
comprising at least five thymidine residues, and linked to a
transcription initiator e.g., comprising a single guanine residue.
In one example, the sequences at (i) and (ii) are each linked to a
terminator e.g., comprising at least five thymidine residues. In
one example, the sequences at (i) and (ii) are each linked to a
transcription initiator e.g., comprising a single guanine residue.
In one example, the sequences at (i) and (ii) are each linked to a
terminator e.g., comprising at least five thymidine residues, and
linked to a transcription initiator e.g., comprising a single
guanine residue.
[0657] In one example, the disclosure provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, wherein the
ddRNAi construct comprises: (i) a sequence encoding a shRNA
comprising or consisting of the sequence set forth in SEQ ID NO: 92
operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five contiguous thymidine residues; and (ii) a sequence
encoding at least one other RNA of the disclosure operably linked
to a promoter and a terminator comprising at least five thymidine
residues and optionally a transcription initiator sequence. In one
example, the present disclosure provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, wherein the
ddRNAi construct comprises: (i) a sequence encoding a shRNA
comprising or consisting of the sequence set forth in SEQ ID NO: 78
operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising six contiguous thymidine residues; and (ii) a sequence
encoding at least one other RNA of the disclosure operably linked
to a promoter and a terminator comprising at least five thymidine
residues and optionally a transcription initiator sequence.
[0658] In one example, the present disclosure provides a ddRNAi
construct comprising a sequence encoding a plurality of RNAs,
wherein the ddRNAi construct comprises: (i) a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 79 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising six contiguous thymidine residues; and (ii) a sequence
encoding at least one other RNA of the disclosure operably linked
to a promoter and a terminator comprising at least five thymidine
residues and optionally a transcription initiator sequence.
[0659] The present disclosure also provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, wherein the
ddRNAi construct comprises:
[0660] (i) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 92 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising five contiguous
thymidine residues;
[0661] (ii) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 78 operably linked to a U6
promoter and a terminator comprising six contiguous thymidine
residues; and
[0662] (iii) a sequence encoding at least one other RNA of the
disclosure operably linked to a promoter and a terminator
comprising at least five thymidine residues and optionally a
transcription initiator sequence.
[0663] In one example, the other RNA at (iii) is a shRNA set forth
in Table 3 or 5.
[0664] The present disclosure also provides a ddRNAi comprising a
sequence encoding a plurality of RNAs, wherein the ddRNAi construct
comprises:
[0665] (i) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 78 operably linked to a U6
promoter and a terminator comprising six contiguous thymidine
residues;
[0666] (ii) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 79 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising six contiguous
thymidine residues; and
[0667] (iii) a sequence encoding a shRNA comprising or consisting
of the sequence set forth in SEQ ID NO: 92 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising five contiguous
thymidine residues.
[0668] For example, the present disclosure provides a ddRNAi
comprising a sequence encoding a plurality of RNAs, wherein the
ddRNAi construct comprises, in a 5' to 3' direction:
[0669] (i) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 78 operably linked to a U6
promoter and a terminator comprising six contiguous thymidine
residues;
[0670] (ii) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 79 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising six contiguous
thymidine residues; and
[0671] (iii) a sequence encoding a shRNA comprising or consisting
of the sequence set forth in SEQ ID NO: 92 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising five contiguous
thymidine residues.
[0672] An exemplary ddRNAi construct of the disclosure encoding a
plurality of RNAs comprises a sequence set forth in SEQ ID NO:
105.
[0673] The present disclosure also provides a ddRNAi comprising a
sequence encoding a plurality of RNAs, wherein the ddRNAi construct
comprises:
[0674] (i) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 78 operably linked to a U6
promoter and a terminator comprising six contiguous thymidine
residues;
[0675] (ii) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 101 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising five contiguous
thymidine residues; and
[0676] (iii) a sequence encoding a shRNA comprising or consisting
of the sequence set forth in SEQ ID NO: 92 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising five thymidine
residues.
[0677] For example, the present disclosure provides a ddRNAi
comprising a sequence encoding a plurality of RNAs, wherein the
ddRNAi construct comprises, in a 5' to 3' direction:
[0678] (i) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 78 operably linked to a U6
promoter and a terminator comprising six contiguous thymidine
residues;
[0679] (ii) a sequence encoding a shRNA comprising or consisting of
the sequence set forth in SEQ ID NO: 101 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising five contiguous
thymidine residues; and
[0680] (iii) a sequence encoding a shRNA comprising or consisting
of the sequence set forth in SEQ ID NO: 92 operably linked to a U6
promoter, a transcription initiator sequence comprising a single
guanine residue and a terminator comprising five thymidine
residues.
[0681] An exemplary ddRNAi construct of the disclosure encoding a
plurality of RNAs comprises a sequence set forth in SEQ ID NO:
106.
[0682] In another example, the disclosure provides a ddRNAi
construct comprising a sequence encoding a plurality of RNAs,
wherein the ddRNAi construct comprises (i) a sequence encoding a
shRNA comprising or consisting of a sequence set forth in Table 3
operably linked to a promoter e.g., a U6 promoter, and (ii) a
sequence encoding at least one other RNA of the disclosure operably
linked to a promoter. In one example, the sequence at (i) is linked
to a terminator e.g., comprising at least five thymidine residues.
In one example, the sequence at (i) is linked to a transcription
initiator e.g., comprising a single guanine residue. In one
example, the sequence at (i) is linked to a terminator e.g.,
comprising at least five thymidine residues, and linked to a
transcription initiator e.g., comprising a single guanine residue.
In one example, the sequence at (ii) is linked to a terminator
e.g., comprising at least five thymidine residues. In one example,
the sequence at (ii) is linked to a transcription initiator e.g.,
comprising a single guanine residue. In one example, the sequence
at (ii) is linked to a terminator e.g., comprising at least five
thymidine residues, and linked to a transcription initiator e.g.,
comprising a single guanine residue. In one example, the sequences
at (i) and (ii) are each linked to a terminator e.g., comprising at
least five thymidine residues. In one example, the sequences at (i)
and (ii) are each linked to a transcription initiator e.g.,
comprising a single guanine residue. In one example, the sequences
at (i) and (ii) are each linked to a terminator e.g., comprising at
least five thymidine residues, and linked to a transcription
initiator e.g., comprising a single guanine residue.
[0683] In one example, the disclosure provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, wherein the
ddRNAi construct comprises: (i) a sequence encoding a shRNA
comprising or consisting of the sequence set forth in SEQ ID NO: 92
operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five contiguous thymidine residues; and (ii) a sequence
encoding at least one other RNA of the disclosure operably linked
to a promoter and a terminator comprising at least five thymidine
residues and optionally a transcription initiator sequence. In one
example, the present disclosure provides a ddRNAi construct
comprising a sequence encoding a plurality of RNAs, wherein the
ddRNAi construct comprises: (i) a sequence encoding a shRNA
comprising or consisting of the sequence set forth in SEQ ID NO: 78
operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising six contiguous thymidine residues; and (ii) a sequence
encoding at least one other RNA of the disclosure operably linked
to a promoter and a terminator comprising at least five thymidine
residues and optionally a transcription initiator sequence.
[0684] In one example, the present disclosure provides a ddRNAi
construct comprising a sequence encoding a plurality of RNAs,
wherein the ddRNAi construct comprises: (i) a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 79 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising six contiguous thymidine residues; and (ii) a sequence
encoding at least one other RNA of the disclosure operably linked
to a promoter and a terminator comprising at least five thymidine
residues and optionally a transcription initiator sequence. In
another example, the present disclosure provides a plurality of
ddRNAi constructs each encoding a RNA i.e., capable of eliciting
RNAi, wherein at least one of the ddRNAi constructs in the
plurality is a ddRNAi construct comprising a sequence encoding a
RNA of the disclosure. For example, at least one ddRNAi construct
of the plurality comprises a sequence encoding a shRNA described in
Table 3 operably linked to a promoter e.g., a U6 promoter. In one
example, the present disclosure provides a plurality of ddRNAi
constructs comprising two or more ddRNAi constructs, each
comprising a sequence encoding a RNA of the disclosure. For
example, each ddRNAi construct of the plurality may comprise a
sequence encoding a shRNA described in Table 3 operably linked to a
promoter e.g., a U6 promoter.
[0685] In one example, the plurality of ddRNAi constructs
comprises:
[0686] (i) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 92 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
sequence comprising five contiguous thymidine residues; and
[0687] (ii) a ddRNAi construct comprising a sequence encoding at
least one other RNA of the disclosure operably linked to a promoter
and a terminator comprising at least five thymidine residues and
optionally a transcription initiator sequence; or
[0688] (iii) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 101 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five contiguous thymidine residues.
[0689] In one example, the plurality of ddRNAi constructs
comprises:
[0690] (i) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 78 operably linked to a U6 promoter and a terminator comprising
six contiguous thymidine residues; and
[0691] (ii) a ddRNAi construct comprising a sequence encoding at
least one other RNA of the disclosure operably linked to a promoter
and a terminator comprising at least five thymidine residues and
optionally a transcription initiator sequence; or
[0692] (iii) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 101 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five contiguous thymidine residues.
[0693] In another example, the plurality of ddRNAi constructs
comprises:
[0694] (i) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 79 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising six contiguous thymidine residues; and
[0695] (ii) a ddRNAi construct comprising a sequence encoding at
least one other RNA of the disclosure operably linked to a promoter
and a terminator comprising at least five thymidine residues and
optionally a transcription initiator sequence; or
[0696] (iii) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 101 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five contiguous thymidine residues.
[0697] The present disclosure also provides a plurality of ddRNAi
constructs, wherein the plurality comprises:
[0698] (i) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 92 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five contiguous thymidine residues;
[0699] (ii) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 78 operably linked to a U6 promoter and a terminator comprising
six contiguous thymidine residues; and
[0700] (iii) a ddRNAi construct comprising a sequence encoding at
least one other RNA of the disclosure operably linked to a promoter
and a terminator comprising at least five thymidine residues and
optionally a transcription initiator sequence.
[0701] The present disclosure also provides a plurality of ddRNAi
constructs, wherein the plurality comprises:
[0702] (i) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 92 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five contiguous thymidine residues;
[0703] (ii) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 78 operably linked to a U6 promoter and a terminator comprising
six contiguous thymidine residues; and
[0704] (iii) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 79 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising six contiguous thymidine residues.
[0705] The present disclosure also provides a plurality of ddRNAi
constructs, wherein the plurality comprises:
[0706] (i) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 92 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five thymidine residues;
[0707] (ii) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 78 operably linked to a U6 promoter and a terminator comprising
six contiguous thymidine residues; and
[0708] (iii) a ddRNAi construct comprising a sequence encoding a
shRNA comprising or consisting of the sequence set forth in SEQ ID
NO: 101 operably linked to a U6 promoter, a transcription initiator
sequence comprising a single guanine residue and a terminator
comprising five contiguous thymidine residues.
[0709] In addition, the or each ddRNAi construct can comprise one
or more multiple cloning sites and/or unique restriction sites that
are located strategically, such that the promoter, RNA encoding
sequence and/or terminator elements are easily removed or replaced.
The or each ddRNAi construct can be assembled from smaller
oligonucleotide components using strategically located restriction
sites and/or complementary sticky ends. The base vector for one
approach according to the present disclosure comprises plasmids
with a multilinker in which all sites are unique (though this is
not an absolute requirement). Sequentially, each promoter is
inserted between its designated unique sites resulting in a base
cassette with one or more promoters, all of which can have variable
orientation. Sequentially, again, annealed primer pairs are
inserted into the unique sites downstream of each of the individual
promoters, resulting in a single-, double- or multiple-expression
cassette construct. The insert can be moved into, e.g. an AdV
backbone using two unique restriction enzyme sites (the same or
different ones) that flank the single-, double- or
multiple-expression cassette insert.
[0710] Generation of the or each construct can be accomplished
using any suitable genetic engineering techniques known in the art,
including without limitation, the standard techniques of PCR,
oligonucleotide synthesis, restriction endonuclease digestion,
ligation, transformation, plasmid purification, and DNA sequencing.
If the or each construct is a viral construct, the construct
comprises, for example, sequences necessary to package the ddRNAi
construct into viral particles and/or sequences that allow
integration of the ddRNAi construct into the target cell genome. In
some examples, the or each viral construct additionally contains
genes that allow for replication and propagation of virus, however
such genes will be supplied in trans. Additionally, the or each
viral construct cam contain genes or genetic sequences from the
genome of any known organism incorporated in native form or
modified. For example, a viral construct may comprise sequences
useful for replication of the construct in bacteria.
[0711] The or each construct also may contain additional genetic
elements. The types of elements that may be included in the
construct are not limited in any way and may be chosen by one with
skill in the art. For example, additional genetic elements may
include a reporter gene, such as one or more genes for a
fluorescent marker protein such as GFP or RFP; an easily assayed
enzyme such as beta-galactosidase, luciferase, beta-glucuronidase,
chloramphenical acetyl transferase or secreted embryonic alkaline
phosphatase; or proteins for which immunoassays are readily
available such as hormones or cytokines.
[0712] Other genetic elements that may find use in embodiments of
the present disclosure include those coding for proteins which
confer a selective growth advantage on cells such as adenosine
deaminase, aminoglycodic phosphotransferase, dihydrofolate
reductase, hygromycin-B-phosphotransferase, drug resistance, or
those genes coding for proteins that provide a biosynthetic
capability missing from an auxotroph. If a reporter gene is
included along with the or each construct, an internal ribosomal
entry site (IRES) sequence can be included. In one example, the
additional genetic elements are operably linked with and controlled
by an independent promoter/enhancer. In addition a suitable origin
of replication for propagation of the construct in bacteria may be
employed. The sequence of the origin of replication generally is
separated from the ddRNAi construct and other genetic sequences.
Such origins of replication are known in the art and include the
pUC, ColE1, 2-micron or SV40 origins of replication.
Expression Constructs
[0713] In one example, a ddRNAi construct of the disclosure is
included within an expression construct.
[0714] In one example, the expression construct is an expression
vector.
[0715] In one example, the expression vector is a plasmid, e.g., as
is known in the art. In one example, a suitable plasmid expression
vector is a pSsh vector e.g., with a U6 promoter and proximal
sequence element 7 (PSE7).
[0716] In one example, the expression vector is mini-circle DNA.
Mini-circle DNA is described in U.S. Patent Publication No.
2004/0214329. Mini-circle DNA are useful for persistently high
levels of nucleic acid transcription. The circular vectors are
characterized by being devoid of expression-silencing bacterial
sequences. For example, mini-circle vectors differ from bacterial
plasmid vectors in that they lack an origin of replication, and
lack drug selection markers commonly found in bacterial plasmids,
e.g. 0-lactamase, tet, and the like. Consequently, minicircle DNA
becomes smaller in size, allowing more efficient delivery.
[0717] In one example, the expression vector is a viral vector.
[0718] A viral vector based on any appropriate virus may be used to
deliver a ddRNAi of the disclosure. In addition, hybrid viral
systems may be of use. The choice of viral delivery system will
depend on various parameters, such as the tissue targeted for
delivery, transduction efficiency of the system, pathogenicity,
immunological and toxicity concerns, and the like.
[0719] Commonly used classes of viral systems used in gene therapy
can be categorized into two groups according to whether their
genomes integrate into host cellular chromatin (oncoretroviruses
and lentiviruses) or persist in the cell nucleus predominantly as
extrachromosomal episomes (adeno-associated virus, adenoviruses and
herpesviruses). In one example, a viral vector of the disclosure
integrates into a host cell's chromatin. In another example, a
viral vector of the disclosure persists in a host cell's nucleus as
an extrachomosomal episome.
[0720] In one example, a viral vector is an adenoviral (AdV)
vector. Adenoviruses are medium-sized double-stranded,
non-enveloped DNA viruses with linear genomes that is between 26-48
Kbp. Adenoviruses gain entry to a target cell by receptor-mediated
binding and internalization, penetrating the nucleus in both
non-dividing and dividing cells. Adenoviruses are heavily reliant
on the host cell for survival and replication and are able to
replicate in the nucleus of vertebrate cells using the host's
replication machinery.
[0721] In one example, a viral vector is from the Parvoviridae
family. The Parvoviridae is a family of small single-stranded,
non-enveloped DNA viruses with genomes approximately 5000
nucleotides long. Included among the family members is
adeno-associated virus (AAV). In one example, a viral vector of the
disclosure is an AAV. AAV is a dependent parvovirus that generally
requires co-infection with another virus (typically an adenovirus
or herpesvirus) to initiate and sustain a productive infectious
cycle. In the absence of such a helper virus, AAV is still
competent to infect or transduce a target cell by receptor-mediated
binding and internalization, penetrating the nucleus in both
non-dividing and dividing cells. Because progeny virus is not
produced from AAV infection in the absence of helper virus, the
extent of transduction is restricted only to the initial cells that
are infected with the virus. It is this feature which makes AAV a
desirable vector for the present disclosure. Furthermore, unlike
retrovirus, adenovirus, and herpes simplex virus, AAV appears to
lack human pathogenicity and toxicity (Kay, et al., Nature. 424:
251 (2003)). Since the genome normally encodes only two genes it is
not surprising that, as a delivery vehicle, AAV is limited by a
packaging capacity of 4.5 single stranded kilobases (kb). However,
although this size restriction may limit the genes that can be
delivered for replacement gene therapies, it does not adversely
affect the packaging and expression of shorter sequences such as
shRNA.
[0722] Another viral delivery system useful with the ddRNAi
constructs of the disclosure is a system based on viruses from the
family Retroviridae. Retroviruses comprise single-stranded RNA
animal viruses that are characterized by two unique features.
First, the genome of a retrovirus is diploid, consisting of two
copies of the RNA. Second, this RNA is transcribed by the
virion-associated enzyme reverse transcriptase into double-stranded
DNA. This double-stranded DNA or provirus can then integrate into
the host genome and be passed from parent cell to progeny cells as
a stably-integrated component of the host genome.
[0723] In some examples, a viral vector is a lentivirus. Lentivirus
vectors are often pseudotyped with vesicular steatites virus
glycoprotein (VSV-G), and have been derived from the human
immunodeficiency virus (HIV); visan-maedi, which causes
encephalitis (visna) or pneumonia in sheep; equine infectious
anemia virus (EIAV), which causes autoimmune hemolytic anemia and
encephalopathy in horses; feline immunodeficiency virus (Hy), which
causes immune deficiency in cats; bovine immunodeficiency virus
(BIV) which causes lymphadenopathy and lymphocytosis in cattle; and
simian immunodeficiency virus (SIV), which causes immune deficiency
and encephalopathy in non-human primates. Vectors that are based on
HIV generally retain <5% of the parental genome, and <25% of
the genome is incorporated into packaging constructs, which
minimizes the possibility of the generation of reverting
replication-competent HIV. Biosafety has been further increased by
the development of self-inactivating vectors that contain deletions
of the regulatory elements in the downstream long-terminal-repeat
sequence, eliminating transcription of the packaging signal that is
required for vector mobilization. One of the main advantages to the
use of lentiviral vectors is that gene transfer is persistent in
most tissues or cell types, even following cell division of the
transduced cell.
[0724] A lentiviral-based construct used to express a RNA of the
disclosure comprises sequences from the 5' and 3' long terminal
repeats (LTRs) of a lentivirus. In one example, the viral construct
comprises an inactivated or self-inactivating 3' LTR from a
lentivirus. The 3' LTR may be made self-inactivating by any method
known in the art.
[0725] For example, the U3 element of the 3' LTR contains a
deletion of its enhancer sequence, e.g., the TATA box, Spl and
NF-kappa B sites. As a result of the self-inactivating 3' LTR, the
provirus that is integrated into the host genome will comprise an
inactivated 5' LTR. The LTR sequences may be LTR sequences from any
lentivirus from any species. The lentiviral-based construct also
may incorporate sequences for MMLV or MSCV, RSV or mammalian genes.
In addition, the U3 sequence from the lentiviral 5' LTR may be
replaced with a promoter sequence in the viral construct. This may
increase the titer of virus recovered from the packaging cell line.
An enhancer sequence may also be included.
[0726] Other viral or non-viral systems known to those skilled in
the art may be used to deliver the ddRNAi or nucleic acid of the
present disclosure to cells of interest, including but not limited
to gene-deleted adenovirus-transposon vectors (see Yant, et al.,
Nature Biotech. 20:999-1004 (2002)); systems derived from Sindbis
virus or Semliki forest virus (see Perri, et al, J. Virol.
74(20):9802-07 (2002)); systems derived from Newcastle disease
virus or Sendai virus.
Testing a RNA or ddRNAi Construct of the Disclosure
Cell Culture Models
[0727] HBV does not infect cells in culture. However, transfection
of HBV DNA (either as a head-to-tail dimer or as an "overlength"
genome of >100%) into HuH7 or Hep G2 hepatocytes results in
viral gene expression and production of HBV virions released into
the media. An example of such a cell line is HepG2.2.15, which is a
sub-cell line of the HepG2 human hepatocellular carcinoma cell line
which stably harbors the complete HBV genome (serotype ayw,
genotype D). HepG2.2.15 expresses all HBV viral RNA and proteins,
produce viral genomes, and secretes virus-like particles. As
exemplified herein, activity of a RNA of the disclosure is
determined by administering the RNA to the cell and subsequently
measuring the level of expression of a RNA or protein encoded by
the HBV genome. Intracellular HBV gene expression can be assayed
either by a TaqmanTm assay or other real time PCR assay for HBV RNA
or by ELISA for HBV protein. Extracellular virus can be assayed
either by PCR for DNA or ELISA for protein. Antibodies are
commercially available for HBV surface antigen and core protein.
Various means for normalizing differences in transfection
efficiency and sample recovery are known in the art. Recent
advances in cell culture systems using primary human hepatocytes
show promise for determining the activity of HBV therapeutics.
[0728] A RNA of the disclosure that reduces expression of a RNA or
protein encoded by the HBV genome by at least 50% compared to in
the absence of the RNA of the disclosure is considered to be useful
in a method of the disclosure.
Animal Models
[0729] There are several small animal models available to study HBV
replication. One is the transplantation of HBV-infected liver
tissue into irradiated mice. Viremia (as evidenced by measuring HBV
DNA by PCR) is first detected 8 days after transplantation and
peaks between 18- 25 days (Ilan et al., 1999, Hepatology, 29,
553-562).
[0730] Transgenic mice that express HBV have also been used as a
model to evaluate potential anti-virals. HBV DNA is detectable in
both liver and serum of the transgenic mice (Money et al.,
Antiviral Res., 42, 97-108, 1999).
[0731] An additional model is to establish subcutaneous tumors in
nude mice with Hep G2 cells transfected with HBV. Tumors develop in
about 2 weeks after inoculation and express HBV surface and core
antigens. HBV DNA and surface antigen are also detected in the
circulation of tumor-bearing mice (Yao et al., J. Viral Hepat., 3,
19-22, 1996).
[0732] An additional model is to use is the PXB mouse, a chimeric
group of mice in which immunodeficient mice that have liver disease
(uPA/SCID) have been transplanted with human hepatocytes. Because
the uPA/SCID mice exhibit significant liver toxicity, transplanting
healthy human cells can result in the production of a mouse with a
healthy and functional liver that has been 70 to 90 percent
repopulated by human hepatocytes. Because PXB mice exhibit normal
histological structures in the liver and exhibit many of the
hallmark of human liver cells, the mice can sustain active HBV
infection in the chimeric hepatic tissues.
[0733] An additional model is the use of the Quantum B model which
is a 3 dimensional cell culture platform in which the human
hepatocytes supplied into the model, assemble in such a way that
mimics the architecture and physiology of the human liver. Because
the model is solely comprised of liver hepatocytes, it is thought
to be the first long term stable fully human full viral lifecycle
model of Hepatitis B and recapitulates some critical features of
the HBV infectious life cycle.
[0734] Any of the foregoing animal models can be used to determine
the efficacy of a RNA of the disclosure in treating or reducing a
HBV infection.
Carriers
[0735] In some examples, a RNA or ddRNAi or expression construct of
the disclosure is in a composition with a carrier.
[0736] In some examples, the carrier is a lipid-based carrier,
cationic lipid, or liposome nucleic acid complex, a liposome, a
micelle, a virosome, a lipid nanoparticle or a mixture thereof.
[0737] In some examples, the carrier is a polymer-based carrier
such as a cationic polymer-nucleic acid complex.
[0738] In a further example, the carrier is a cyclodextrin-based
carrier such as a cyclodextrin polymer-nucleic acid complex.
[0739] In a further example, the carrier is a protein-based carrier
such as a cationic peptide-nucleic acid complex.
[0740] In another example, the carrier is a lipid nanoparticle.
Exemplary nanoparticles are described, for example, in
US7514099.
[0741] In some examples, a RNA or ddRNAi or expression construct of
the disclosure is formulated with a lipid nanoparticle composition
comprising a cationic lipid/Cholesterol/PEG-C-DMA/DSPC (e.g., in a
40/48/2/10 ratio), a cationic lipid/Cholesterol/PEG-DMG/DSPC (e.g.,
in a 40/48/2/10 ratio), or a cationic lipid/Cholesterol/PEG-DMG
(e.g., in a 60/38/2 ratio). In some examples, the cationic lipid is
Octyl CL in DMA, DL in DMA, L-278, DLinKC.sub.2DMA, or MC3.
[0742] In another example, a RNA or ddRNAi or expression construct
of the disclosure is formulated with any of the cationic lipid
formulations described in WO 2010/021865; WO 2010/080724; WO
2010/042877; WO 2010/105209 or WO 2011/022460.
[0743] In another example, a RNA or ddRNAi or expression construct
of the disclosure is conjugated to or complexed with another
compound, e.g., to facilitate delivery of the RNA or ddRNAi or
expression construct. Non-limiting, examples of such conjugates are
described in US 2008/0152661 and US 2004/0162260 (e.g., CDM-LBA,
CDM-Pip-LBA, CDM-PEG, CDM-NAG, etc.).
[0744] In another example, polyethylene glycol (PEG) is covalently
attached to a RNA or ddRNAi or expression construct of the
disclosure. The attached PEG can be any molecular weight, e.g.,
from about 100 to about 50,000 daltons (Da).
[0745] In yet other example, a RNA or ddRNAi or expression
construct of the disclosure is formulated with a carrier comprising
surface-modified liposomes containing poly(ethylene glycol) lipids
(PEG-modified, or long-circulating liposomes or stealth liposomes),
such as is disclosed in for example, WO 96/10391; WO 96/10390; or
WO 96/10392.
[0746] In some examples, a RNA or ddRNAi or expression construct of
the disclosure can also be formulated or complexed with
polyethyleneimine or a derivative thereof, such as
polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine
(PEI-PEG-GAL) or
polyethyleneimine-polyethyleneglycol-tri-N-acetylgalactosamine
(PEI-PEG-triGAL) derivatives. In one example, a RNA or ddRNAi or
expression construct of the disclosure is formulated as described
in U.S. Patent Application Publication No. 2003/0077829.
[0747] In other examples, a RNA or ddRNAi or expression construct
of the disclosure is complexed with membrane disruptive agents such
as those described in U.S. Patent Application Publication No.
2001/0007666.
[0748] Other carriers include cyclodextrins (see for example,
Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074; or WO
03/46185), poly(lactic-co-glycolic)acid (PLGA) and PLCA
microspheres (see for example US 2002130430).
Compositions and Methods of Treatment
[0749] A RNA or ddRNAi or expression construct of the disclosure is
used in compositions for preventing or treating HBV infection. The
therapeutic compositions of the disclosure may be used alone or in
combination with one or more materials, including other antiviral
agents. Currently, lamivudine, adefovir dipivoxil, and interferon
alpha have been approved for treatment of HBV. Since a RNA or
ddRNAi or expression construct of the disclosure act against HBV
through a different mechanism to other approved drugs, combination
therapy of the agents of the disclosure and other antivirals is
expected to significantly increase the efficacy of therapy while
substantially reducing the development of drug resistance, e.g.,
the development of lamivudine resistance, a problem of major
concern with long term lamivudine therapy.
[0750] Compositions will desirably include materials that increase
the biological stability of the RNA or ddRNAi or expression
construct of the disclosure and/or materials that increase the
ability of the compositions to penetrate hepatocytes selectively.
The therapeutic compositions of the disclosure may be administered
in pharmaceutically acceptable carriers (e.g., physiological
saline), which are selected on the basis of the mode and route of
administration, and standard pharmaceutical practice. One having
ordinary skill in the art can readily formulate a pharmaceutical
composition that comprises a RNA or ddRNAi or expression construct
of the disclosure. In some cases, an isotonic formulation is used.
Generally, additives for isotonicity can include sodium chloride,
dextrose, mannitol, sorbitol and lactose. In some cases, isotonic
solutions such as phosphate buffered saline are preferred.
Stabilizers include gelatin and albumin. In some examples, a
vasoconstriction agent is added to the formulation. The
compositions according to the present disclosure are provided
sterile and pyrogen free. Suitable pharmaceutical carriers, as well
as pharmaceutical necessities for use in pharmaceutical
formulations, are described in Remington: The Science and Practice
of Pharmacy (formerly Remington's Pharmaceutical Sciences), Mack
Publishing Co., a standard reference text in this field, and in the
USP/NF.
[0751] Routes of administration include, but are not limited to,
intramuscular, intraperitoneal, intradermal, subcutaneous,
intravenous, intrathecal, intraarterially, intraoccularly and oral
as well as transdermal or by inhalation or suppository. Exemplary
routes of administration include intravenous, intramuscular, oral,
intraperitoneal, intradermal, intraarterial and subcutaneous
injection. Targeted transfection of hepatocytes in vivo for
delivery of a RNA or ddRNAi or expression construct of the
disclosure may be accomplished through IV injection with a
composition comprising a DNA or RNA expression vector as described
herein complexed with a mixture (e.g., a 35%/65% ratio) of a
lactosyl spermine (mono or trilactosylated) and cholesteryl
spermine (containing spermine to DNA at a charge ratio of 0.8).
Such compositions are useful for pharmaceutical applications and
may readily be formulated in a suitable sterile, non-pyrogenic
vehicle, e.g., buffered saline for injection, for parenteral
administration, e.g., IV (including IV infusion), IM, SC, and for
intraperitoneal administration. In certain compositions, a ddRNAi
construct of the disclosure complexed with an endosomolytic
spermine such cholesteryl spermine alone, without a targeting
spermine; some routes of administration, such as intraperitoneal
injection or infusion, may achieve effective hepatic delivery and
transfection of a ddRNAi construct, and expression of RNA.
[0752] Intraperitoneal administration (e.g., ultrasound guided
intraperitoneal injection) of a sterile pharmaceutical composition
comprising a RNA or ddRNAi or expression construct of the
disclosure in a specially formulated delivery vehicle may be an
advantageous route of delivery to promote uptake by liver cells,
including hepatocytes.
[0753] The volume, concentration, and formulation of the
pharmaceutical composition as well as the dosage regimen may be
tailored specifically to maximize cellular delivery while
minimizing toxicity such as an inflammatory response. E.g,
relatively large volumes (5, 10, 20, 50 ml or more) with
corresponding low concentrations of active ingredients, as well as
the inclusion of an anti-inflammatory compound such as a
corticosteroid, may be utilized if desired.
[0754] In HBV infected individuals it is anticipated that a RNA or
ddRNAi or expression construct of the disclosure is useful as a
pre-treatment in conjunction with therapeutic vaccination protocols
designed to boost immunity against the virus. It is also
anticipated that the RNA or ddRNAi or expression construct of the
disclosure is useful for prophylaxis in a regimen of periodic
administrations to individuals who because of occupational or other
potential for exposure are considered at high risk of exposure to
HBV.
Kits
[0755] The present disclosure also provides a RNA or ddRNAi or
expression construct of the disclosure in a kit. The kit may
comprise a container. The kit typically contains a RNA or ddRNAi or
expression construct of the disclosure with instructions for its
administration. In some examples, the kit contains more than one
RNA or ddRNAi or expression construct of the disclosure and/or
another RNA or ddRNAi or expression construct of the
disclosure.
TABLE-US-00001 TABLE 1 Target regions within HBV genome Region ID
Region sequence (5'-3') SEQ ID NO: Region 1 CATCCTGCTGCTATGCCTCA
SEQ ID NO: 1 Region 2 TTTGCTGACGCAACCCCCACTGG SEQ ID NO: 2 Region 3
AAGCCTCCAAGCTGTGCCTT SEQ ID NO: 3 Region 4
GCAGGTCCCCTAGAAGAAGAACTCCCT SEQ ID NO: 4 CGCCTCA Region 5
CAAGGTATGTTGCCCGTTTGTCC SEQ ID NO: 5 Region 6 CTCGTGGTGGACTTCTCTCA
SEQ ID NO: 6 Region 7 CTCGTGTTACAGGCGGGGTTTTT SEQ ID NO: 7 Region 8
CCGTGTGCACTTCGCTTCACCTCTGCA SEQ ID NO: 8 CGT Reaion 9
TACGTCCCGTCGGCGCTGAATC SE0 ID NO: 9 Region 10 AAATGCCCCTATCTTATCA
SEQ ID NO: 10
TABLE-US-00002 TABLE 2 RNAs duplexes Effector shRNA ID Effector
(5'-3') SEQ ID NO: complement (5'-3') SEQ ID NO: shRNA1
UGAGGCAUAGCAGCAGGAUG SEQ ID NO: 11 CAUCCUGCUGCUAUGCCUCA SEQ ID NO:
12 shRNA2 GAUGAGGCAUAGCAGCAGGA SEQ ID NO: 13 UCCUGCUGCUAUGCCUCAUC
SEQ ID NO: 14 shRNA3 GAGGCAUAGCAGCAGGAUGC SEQ ID NO: 15
GCAUCCUGCUGCUAUGCCUC SEQ ID NO: 16 shRNA4 UGAGGCAUAGCAGCAGGAUG SEQ
ID NO: 11 CAUCCUGCUGCUAUGCCUCA SEQ ID NO: 12 shRNA5
CCAGUGGGGGUUGCGUCAGC SEQ ID NO: 17 GCUGACGCAACCCCCACUGG SEQ ID NO:
18 shRNA6 CCAGUGGGGGUUGCGUCAGC SEQ ID NO: 17 GCUGACGCAACCCCCACUGG
SEQ ID NO: 18 shRNA7 AAGGCACAGCUUGGAGGCUU SEQ ID NO: 19
AAGCCUCCAAGCUGUGCCUU SEQ ID NO: 20 shRNA8 AAGGCACAGCUUGGAGGCUU SEQ
ID NO: 19 AAGCCUCCAAGCUGUGCCUU SEQ ID NO: 20 shRNA9
GAGUUCUUCUUCUAGGGGACC SEQ ID NO: 21 GGUCCCCUAGAAGAAGAACUC SEQ ID
NO: 22 shRNA10 GAGUUCUUCUUCUAGGGGACC SEQ ID NO: 21
GGUCCCCUAGAAGAAGAACUC SEQ ID NO: 22 shRNA11 GAGGGAGUUCUUCUUCUAGGG
SEQ ID NO: 23 CCCUAGAAGAAGAACUCCCUC SEQ ID NO: 24 shRNA12
GAGGGAGUUCUUCUUCUAGGG SEQ ID NO: 23 CCCUAGAAGAAGAACUCCCUC SEQ ID
NO: 24 shRNA13 GCGAGUUCUUCUUCUAGGGGA SEQ ID NO: 25
UCCCCUAGAAGAAGAACUCGC SEQ ID NO: 26 shRNA14 UUCUUCUUCUAGGGGACCUGC
SEQ ID NO: 27 GCAGGUCCCCUAGAAGAAGAA SEQ ID NO: 28 shRNA15
ACAAACGGGCAACAUACCUUG SEQ ID NO: 29 CAAGGUAUGUUGCCCGUUUGU SEQ ID
NO: 30 shRNA16 GGACAAACGGGCAACAUACCU SEQ ID NO: 31
AGGUAUGUUGCCCGUUUGUCC SEQ ID NO: 32 shRNA17 GACAAACGGGCAACAUACCUU
SEQ ID NO: 33 AAGGUAUGUUGCCCGUUUGUC SEQ ID NO: 34 shRNA18
ACAAACGGGCAACAUACCUUG SEQ ID NO: 29 CAAGGUAUGUUGCCCGUUUGU SEQ ID
NO: 30 shRNA19 UGAGAGAAGUCCACCACGAG SEQ ID NO: 35
CUCGUGGUGGACUUCUCUCA SEQ ID NO: 36 shRNA20 UGAGAGAAGUCCACCACGAG SEQ
ID NO: 35 CUCGUGGUGGACUUCUCUCA SEQ ID NO: 36 shRNA21
AUUGAGAGAAGUCCACCACG SEQ ID NO: 37 CGUGGUGGACUUCUCUCAAU SEQ ID NO:
38 shRNA22 AGAGAAGUCCACCACGAGUC SEQ ID NO: 39 GACUCGUGGUGGACUUCUCU
SEQ ID NO: 40 shRNA23 AAACCCCGCCUGUAACACGAG SEQ ID NO: 41
CUCGUGUUACAGGCGGGGUUU SEQ ID NO: 42 shRNA24 AAACCCCGCCUGUAACACGAG
SEQ ID NO: 41 CUCGUGUUACAGGCGGGGUUU SEQ ID NO: 42 shRNA25
UGCAGAGGUGAAGCGAAGUGC SEQ ID NO: 43 GCACUUCGCUUCACCUCUGCA SEQ ID
NO: 44 shRNA26 UGCAGAGGUGAAGCGAAGUGC SEQ ID NO: 43
GCACUUCGCUUCACCUCUGCA SEQ ID NO: 44 shRNA27 GAUUCAGCGCCGACGGGACGU
SEQ ID NO: 45 ACGUCCCGUCGGCGCUGAAUC SEQ ID NO: 46 shRNA28
GGAUUCAGCGCCGACGGGACG SEQ ID NO: 47 CGUCCCGUCGGCGCUGAAUCC SEQ ID
NO: 48 shRNA29 AUUCAGCGCCGACGGGACGUA SEQ ID NO: 49
UACGUCCCGUCGGCGCUGAAU SEQ ID NO: 50 shRNA30 GAUUCAGCGCCGACGGGACGU
SEQ ID NO: 45 ACGUCCCGUCGGCGCUGAAUC SEQ ID NO: 46 shRNA31
GGAUUCAGCGCCGACGGGACG SEQ ID NO: 47 CGUCCCGUCGGCGCUGAAUCC SEQ ID
NO: 48 shRNA32 AUUCAGCGCCGACGGGACGUA SEQ ID NO: 49
UACGUCCCGUCGGCGCUGAAU SEQ ID NO: 50 shRNA33 UGAUAAGAUAGGGGCAUUU SEQ
ID NO: 51 AAAUGCCCCUAUCUUAUCA SEQ ID NO: 52 shRNA34
UGAUAAGAUAGGGGCAUUU SEQ ID NO: 51 AAAUGCCCCUAUCUUAUCA SEQ ID NO:
52
TABLE-US-00003 TABLE 3 shRNAs shRNA ID shRNA sequence (5'-3') SEQ
ID NO: shRNA1 CAUCCUGCUGCUAUGCCUCACAAGAGAUGAGGCAUAGCAGCAGGAUG SEQ
ID NO: 65 shRNA2 UCCUGCUGCUAUGCCUCAUCCAAGAGAGAUGAGGCAUAGCAGCAGGA
SEQ ID NO: 66 shRNA3
GCAUCCUGCUGCUAUGCCUCCAAGAGAGAGGCAUAGCAGCAGGAUGC SEQ ID NO: 67
shRNA4 UGAGGCAUAGCAGCAGGAUGCAAGAGACAUCCUGCUGCUAUGCCUCA SEQ ID NO:
68 shRNA5 GCUGACGCAACCCCCACUGGCAAGAGACCAGUGGGGGUUGCGUCAGC SEQ ID
NO: 69 shRNA6 CCAGUGGGGGUUGCGUCAGCCAAGAGAGCUGACGCAACCCCCACUGG SEQ
ID NO: 70 shRNA7 AAGCCUCCAAGCUGUGCCUUUGUGCUUAAGGCACAGCUUGGAGGCUU
SEQ ID NO: 71 shRNA8
AAGGCACAGCUUGGAGGCUUUGUGCUUAAGCCUCCAAGCUGUGCCUU SEQ ID NO: 72
shRNA9 GGUCCCCUAGAAGAAGAACUCCAAGAGAGAGUUCUUCUUCUAGGGGACC SEQ ID NO:
73 shRNA10 GAGUUCUUCUUCUAGGGGACCCAAGAGAGGUCCCCUAGAAGAAGAACUC SEQ ID
NO: 74 shRNA11 CCCUAGAAGAAGAACUCCCUCCAAGAGAGAGGGAGUUCUUCUUCUAGGG
SEQ ID NO: 75 shRNA12
GAGGGAGUUCUUCUUCUAGGGCAAGAGACCCUAGAAGAAGAACUCCCUC SEQ ID NO: 76
shRNA13 UCCCCUAGAAGAAGAACUCGCCAAGAGAGCGAGUUCUUCUUCUAGGGGA SEQ ID
NO: 77 shRNA14 GCAGGUCCCCUAGAAGAAGAACAAGAGAUUCUUCUUCUAGGGGACCUGC
SEQ ID NO: 78 shRNA15
CAAGGUAUGUUGCCCGUUUGUCAAGAGAACAAACGGGCAACAUACCUUG SEQ ID NO: 79
shRNA16 AGGUAUGUUGCCCGUUUGUCCCAAGAGAGGACAAACGGGCAACAUACCU SEQ ID
NO: 80 shRNA17 AAGGUAUGUUGCCCGUUUGUCCAAGAGAGACAAACGGGCAACAUACCUU
SEQ ID NO: 81 shRNA18
ACAAACGGGCAACAUACCUUGCAAGAGACAAGGUAUGUUGCCCGUUUGU SEQ ID NO: 82
shRNA19 CUCGUGGUGGACUUCUCUCACAAGAGAUGAGAGAAGUCCACCACGAG SEQ ID NO:
83 shRNA20 UGAGAGAAGUCCACCACGAGCAAGAGACUCGUGGUGGACUUCUCUCA SEQ ID
NO: 84 shRNA21 AUUGAGAGAAGUCCACCACGCAAGAGACGUGGUGGACUUCUCUCAAU SEQ
ID NO: 85 shRNA22 AGAGAAGUCCACCACGAGUCCAAGAGAGACUCGUGGUGGACUUCUCU
SEQ ID NO: 86 shRNA23
CUCGUGUUACAGGCGGGGUUUUGUGCUUAAACCCCGCCUGUAACACGAG SEQ ID NO: 87
shRNA24 AAACCCCGCCUGUAACACGAGUGUGCUUCUCGUGUUACAGGCGGGGUUU SEQ ID
NO: 88 shRNA25 GCACUUCGCUUCACCUCUGCACAAGAGAUGCAGAGGUGAAGCGAAGUGC
SEQ ID NO: 89 shRNA26
UGCAGAGGUGAAGCGAAGUGCCAAGAGAGCACUUCGCUUCACCUCUGCA SEQ ID NO: 90
shRNA27 ACGUCCCGUCGGCGCUGAAUCUGUGCUUGAUUCAGCGCCGACGGGACGU SEQ ID
NO: 91 shRNA28 CGUCCCGUCGGCGCUGAAUCCUGUGCUUGGAUUCAGCGCCGACGGGACG
SEQ ID NO: 92 shRNA29
UACGUCCCGUCGGCGCUGAAUUGUGCUUAUUCAGCGCCGACGGGACGUA SEQ ID NO: 93
shRNA30 GAUUCAGCGCCGACGGGACGUUGUGCUUACGUCCCGUCGGCGCUGAAUC SEQ ID
NO: 94 shRNA31 GGAUUCAGCGCCGACGGGACGUGUGCUUCGUCCCGUCGGCGCUGAAUCC
SEQ ID NO: 95 shRNA32
AUUCAGCGCCGACGGGACGUAUGUGCUUUACGUCCCGUCGGCGCUGAAU SEQ ID NO: 96
shRNA33 AAAUGCCCCUAUCUUAUCAUGUGCUUUGAUAAGAUAGGGGCAUUU SEQ ID NO: 97
shRNA34 UGAUAAGAUAGGGGCAUUUUGUGCUUAAAUGCCCCUAUCUUAUCA SEQ ID NO:
98
TABLE-US-00004 TABLE 4 Additional RNAs duplexes Effector shRNA ID
Effector (5'-3') SEQ ID NO: complement (5'-3') SEQ ID NO: shRNA35
UGAGGCCCACUCCCAUAGGUAU SEQ ID NO: 53 AUACCUAUGGGAGUGGGCCUCA SEQ ID
NO: 54 shRNA36 GGAAAGCCCUACGAACCACUGA SEQ ID NO: 55
UCAGUGGUUCGUAGGGCUUUCC SEQ ID NO: 56 shRNA37 GGGAAAGCCCUACGAACCACUG
SEQ ID NO: 57 CAGUGGUUCGUAGGGCUUUCCC SEQ ID NO: 58 shRNA38
GGGGAAAGCCCUACGAACCACU SEQ ID NO: 59 AGUGGUUCGUAGGGCUUUCCCC SEQ ID
NO: 60 shRNA39 GGGAAAGCCCUACGAACCACUG SEQ ID NO: 61
CAUUGUUUCGUCGGGCUUUCCC SEQ ID NO: 62 shRNA40 CCGGGCAACGGGGUAAAGGUUC
SEQ ID NO: 63 GAACCUUUACCCCGUUGCCCGG SEQ ID NO: 64
TABLE-US-00005 TABLE 5 Additional shRNAs shRNA ID shRNA sequence
(5'-3') SEQ ID NO: shRNA35
AUACCUAUGGGAGUGGGCCUCACAAGAGAUGAGGCCCACUCCCAUAGGUAU SEQ ID NO: 99
shRNA36 UCAGUGGUUCGUAGGGCUUUCCCAAGAGAGGAAAGCCCUACGAACCACUGA SEQ ID
NO: 100 shRNA37 CAGUGGUUCGUAGGGCUUUCCCCAAGAGAGGGAAAGCCCUACGAACCACUG
SEQ ID NO: 101 shRNA38
AGUGGUUCGUAGGGCUUUCCCCCAAGAGAGGGGAAAGCCCUACGAACCACU SEQ ID NO: 102
shRNA39 GGGAAAGCCCUACGAACCACUGCAAGAGACAUUGUUUCGUCGGGCUUUCCC SEQ ID
NO: 103 shRNA40 GAACCUUUACCCCGUUGCCCGGCAAGAGACCGGGCAACGGGGUAAAGGUUC
SEQ ID NO: 104
EXAMPLES
Example 1
Target Regions for Design of ddRNAi Constructs
[0756] Sequences representing potential targets for design of
ddRNAi constructs were identified from the full length HBV genome.
Briefly, a database of HBV sequence was compiled from sequences
retrieved from non-proprietary, public domain sources. The initial
collection was compiled from Release 202.0 of Genbank (June 15,
2014) using the search terms {hepatitis b virus complete genome}
and {hepatitis b virus complete genome +genotype}; only human HBV
sequences were included. Initial sequence alignments were performed
using Sequence Assembly, Clustal, MUSCLE and SEQUENCHER, Release
5.0.1/5.2. Initial alignments were manually curated to remove
formatting derived sequence differences (e.g., variation in
sequence start sites), artificial viral sequences (e.g., HBV-based
constructs), obvious outliers (e.g., poor alignments or alignments
with Ns, indicative of poor quality sequences) and incorrectly
annotated sequences, including duplicate entries. The remaining
sequences, of which there were 4345 sequences representing all HBV
genotypes (A-H), were re-aligned using CLUSTALW (both fast and
slow) and Megalign, Lasergene, Release 12. Alignments were scanned
for regions of highest conservation (at least 18/20 nucleotides)
across all genotypes. The 10 most highly conserved regions were
chosen as targets for design of shRNAs. The sequences of the target
regions identified are presented in Table 1. A map of the HBV
genome showing the location of the target regions is shown in FIG.
1.
Example 2
siRNA Duplexes
[0757] siRNA duplexes comprising effector sequences substantially
complementary to the target regions described in Table 1 were
designed and are presented in Table 2 The siRNA duplexes were
synthesized with two nucleotide 3' dTdT overhangs.
Example 3
Activity of siRNAs in Dual-Luciferase Reporter Assay
[0758] To test the efficacy of the siRNAs of the disclosure to
knockdown expression of HBV transcripts, dual-luciferase reporter
assays were performed in HEK293 cells.
[0759] Plasmid reporter constructs based on the pGL3 Luciferase
Reporter Vector were constructed for HBV siRNAs targeting each of
regions Region 4, Region 5 or Region 9. The Luciferase reporter
constructs were generated by inserting a HBV shRNA target sequence
for Region 4, Region 5 or Region 9 with 20bp flanking sequences at
each end onto the pGL3-control vector (Promega, Madison, WI). The
inserts were subcloned using Fsel and Xbal restriction enzyme sites
within the 3' UTR of the luciferase reporter gene.
[0760] The dual-luciferase reporter assays were performed in HEK293
cells. The HEK293 cell line was purchased from ATCC (Manassas,
Va.). The HEK293 cells were cultured in DMEM medium containing 10%
fetal bovine serum, 2mM glutamine, penicillin (100U/mL), and
streptomycin (100 pg/mL) at 37.degree. C. humid incubator with 5%
CO2. Briefly, the HEK293 cell were seeded at a density of
2.times.10.sup.4 cells per well into 96-well culture plate one day
prior to transfection.
[0761] The HBV siRNAs having antisense and sense sequences of
shRNAs designated shRNA9, shRNA15 and shRNA27 respectively and
their corresponding Luciferase reporter constructs were
co-transfected into HEK293 cells using Lipofectamine 2000 reagents
(Life Technologies, Carlsbad, Calif.) according to manufacturer's
instructions. For each well of transfection, 1 or 2 pmol of one of
the HBV siRNA, 10 ng of the corresponding Luciferase reporter
construct and ing of Renilla reporter construct (served as loading
controls) were co-transfected using 0.3uL of Lipotectamine 2000. 48
hour post-transfection, cell lysates were collected and analyzed
using Dual Luciferase Reporter Assay System (Promega, Madison,
Wis.). The firefly/ Renilla activity ratios were determined for
each well, and the inhibition efficiency of siRNAs were calculated
by normalizing to an irrelevant siRNA, namely the siGlo control.
Percent inhibition of HBV reporter constructs in HEK293 cells for
the sense and antisense strands of each of HBV siRNAs shRNA9,
shRNA15 and shRNA27 relative to the siGlo control is presented in
Table 8 and illustrated in FIG. 2.
TABLE-US-00006 TABLE 8 Inhibitory activity of siRNAs having
antisense and sense sequence of shRNA9, shRNA15 and shRNA27 in
dual-luciferase reporter assay % Inhibition of HBV reporter siRNA
siRNA strand 1pmol siRNA 2pmol siRNA shRNA9 Antisense 89.71 86.87
Sense 6.57 7.98 shRNA15 Antisense 91.47 92.27 Sense 6.03 7.40
shRNA27 Antisense 84.61 84.75 Sense -8.73 -1.29
[0762] As is apparent from Table 8 and FIG. 2, even when present in
an amount as low as 1pmol, the exemplary siRNAs having antisense
and sense sequences of shRNAs designated shRNA9, shRNA15 and
shRNA27 respectively downregulated the level of luciferase
expressed from the pGL3 Luciferase reporter vector in HEK293
cells.
Example 4
Activity of siRNAs against HBV Antigens Expressed in HepG2.2.15
Cells
[0763] To test the efficacy of siRNAs of the disclosure to
knockdown expression of HBV genes, HepG2.2.15 were transfected with
representative siRNA of the disclosure and inhibition of HBV gene
expression was assayed.
[0764] HepG2.2.15 is a sub-cell line of the HepG2 human
hepatocellular carcinoma cell line which stably harbors the
complete HBV genome (serotype ayw, genotype D). HepG2.2.15
expresses all HBV viral RNA and proteins, produces viral genomes,
and secretes virus-like particles. The HepG2.2.15 cells were
provided by Dr. Brent Korba of Georgetown University. The
HepG2.2.15 cells were maintained in the RPMI1640 medium
supplemented with 4% fetal bovine serum, 4mM glutamine, penicillin
(100U/mL), and streptomycin (100 .mu.g/mL) and propagated in a
37.degree. C. humid incubator in an atmosphere of 5% CO.sub.2.
[0765] Cells were transfected with HBV siRNAs having antisense and
sense sequences of the shRNAs designated shRNA9, shRNA15 and
shRNA27 respectively in suspension using Lipofectamine RNAiMax
reagents (Life Technologies, Carlsbad, Calif.). Transfections were
performed according to manufacturer's instructions. For each
transfection, HepG2.2.15 cells were seeded at a density of
9.times.10.sup.4 cells per well onto 24-well culture plates and
transfected with 5 pmol of one of the HBV siRNAs using 1.5uL
Lipotectamine RNAiMax. 72hr post-transfection, cells were harvested
for RNA.
[0766] Total RNA was isolated using miRNeasy Mini Kit (Qiagen,
Valencia, Calif.). Total RNA was quantified using the NanoDrop 1000
Spectrophotometer (Thermo Scientific) and diluted to a working
concentration of 10 ng/.mu.1. One hundred nanogram of total RNA was
used to synthesize cDNA using High Capacity cDNA Reverse
Transcription Kit (Life Technologies, Carlsbad, Calif.) according
to manufacturer's instructions.
[0767] Quantitative PCR amplifications of regions within HBV
antigens HBsAg, HBcAg, HbxAg, and GAPDH were performed using Power
SYBR Green PCR Master Mix (Life Technologies) and the following
primer sets listed in Table 9. Standard real-time PCR conditions
were used: initial denaturation at 95.degree. C. for 10min followed
by 40 cycles of 95.degree. C. for 15sec and 60.degree. C. for 1
min.
TABLE-US-00007 TABLE 9 Primer sets for RT-qPCR HBV Antigen Primer
Sequence (5'-3') HBsAg HBsAg_fwd ATGTTGCCCGTTTGTCCTCT HBsAg_rev
CCGTCCGAAGGTTTGGTACA HBxAg HBxAg_fwd CGTCCTTTGTTTACGTCCCG HBxAg_rev
AGTCCGCGTAAAGAGAGGTG HBcAg HBcAg_fwd CCACCAAATGCCCCTATCCT HBcAg_rev
ATTGAGACCTTCGTCTGCGA GAPDH GAPDH_fwd ACACCATGGGGAAGGTGAAG GAPDH_rev
GTGACCAGGCGCCCAATA
[0768] The level of inhibition of HBV transcripts at regions
corresponding to HBV antigens HBsAg, HBcAg and HbxAg were
determined relative to levels of GAPDH mRNA. Percentage inhibition
of HBsAg, HBcAg, HbxA mRNA expression were calculated relative to a
negative control, in this instance a siGlo siRNA (Dharmacon). The
level of inhibition of HBV transcripts at regions corresponding to
HBV antigens HBsAg, HBcAg and HbxAg, is presented in Table 10 and
illustrated FIG. 3. FIG. 4 shows location of the HBV siRNAs
relative to the HBV polymerase gene and the respective HBV antigens
HBsAg, HBcAg and HbxAg.
TABLE-US-00008 TABLE 10 Inhibition of expression of HBV antigens in
HepG2.2.15 cells by siRNA siRNA HBV Inhibition corresponding to
Antigen (%) shRNA9 HBsAg 19.88 HBxAg 28.02 HBcAg 65.78 shRNA15
HBsAg 81.26 HBxAg 83.23 HBcAg 61.77 shRNA27 HBsAg 60.46 HBxAg 72.15
HBcAg 17.37
Example 5
Activity of ddRNAi Expression Constructs in Dual-Luciferase
Reporter Assay
[0769] To test the efficacy of ddRNAi expression constructs
expressing shRNAs of the disclosure to knockdown HBV transcripts,
dual-luciferase reporter assays were performed in HEK293 cells.
[0770] Initial screens were performed to determine strand
preference for the following 26 shRNAs of the disclosure: shRNA1,
shRNA4, shRNA15, shRNA18, shRNA35, shRNA36, shRNA39, shRNA5,
shRNA6, shRNA7, shRNA8, shRNA25, shRNA26, shRNA30, shRNA40, shRNA9,
shRNA10, shRNA11, shRNA12, shRNA33, shRNA34, shRNA19, shRNA20,
shRNA23 and shRNA24.
[0771] Plasmid reporter constructs based on the pGL3 Luciferase
Reporter Vector were constructed for the sense strand and antisense
strand of each of the 26 shRNA sequences. The Luciferase reporter
constructs were generated by inserting the sense strand sequence or
the antisense strand sequence of the respective shRNA (as
appropriate) with 20bp flanking sequences at each end into the
pGL3-control vector (Promega, Madison, Wis.). The inserts were
subcloned using Fsel and Xbal restriction enzyme sites following
the luciferase reporter gene.
[0772] The HEK293 cell line was purchased from ATCC (Manassas,
Va.). The HEK293 cells were cultured in DMEM medium containing 10%
fetal bovine serum, 2mM glutamine, penicillin (100U/mL), and
streptomycin (100 .mu.g/mL) at 37.degree. C. humid incubator with
5% CO2. Briefly, the HEK293 cells were seeded at a density of
2.times.10.sup.4 cells per well into 96-well culture plate one day
prior to transfection.
[0773] For each shRNA, a ddRNAi expression construct was
constructed by inserting the respective shRNA sequence into a pSsh
vector with a U6 promoter and proximal sequence element 7 (PSE7).
The U6 promoters were based on either human U6-1, U6-8 or U6-9
sequences For each well of transfection, the corresponding ddRNAi
expression construct and one of the two Luciferase reporter
constructs were co-transfected into HEK293 cells at a ratio of 10:1
(ddRNAi expression construct: Luciferase reporter construct) using
0.3 uL of Lipofectamine 2000 reagent (Life Technologies, Carlsbad,
Calif.) according to manufacturer's instructions. The cells were
also transfected with ing of a Renilla reporter construct (serving
as a transfection control). 48 hour post-transfection, cell lysates
were collected and analyzed using Dual Luciferase Reporter Assay
System (Promega, Madison, Wis.). The firefly/ Renilla activity
ratios were determined for each well. Percentage inhibition of
reporter expression were calculated relative to a negative control,
in this instance a construct that used the U6-9 promoter to express
a random non-targeting sequence with no homology to human or mouse
sequences, termed U6-9cont. U6-9cont was designed to express the
sequence CGTCGGTACCACAAGCAAGAGTCGGCAGTAAGAAGATGGCGTATATATTAT
GAAAGGTACCGAGATTGGCCATTCGGAGTGTTTAGTCGACCAAACTGAT. The experiment
was performed in replicate.
[0774] The ability of each shRNA to inhibit expression of
luciferase protein from the respective Luciferase reporter
constructs is illustrated in FIGS. 5a-f.
[0775] Seven of the 26 shRNA assayed were selected for further
testing based on their ability to inhibit expression of luciferase
protein from the respective Luciferase reporter constructs i.e.,
shRNA1, shRNA15, shRNA36, shRNA27, shRNA30, shRNA9 and shRNA20.
These 7 shRNA were subjected to a nine point dose response curve to
assess hyperfunctional properties of the hairpins. Two dose curve
experiments were undertaken: [0776] Experiment 1: HEK293 cells were
transfected with a shRNA:target ratio ranging from 1:1 to 1:5000;
and [0777] Experiment 2: HEK293 cells were transfected with a
shRNA:target ratio ranging from 10:1 to 1:500.
[0778] In each of Experiments 1 and 2, the seven shRNAs were tested
against Luciferase reporter constructs designed to detect
inhibition of luciferase activity by the antisense strand i.e.,
comprising sense strand sequence. The reporter constructs were
designed as described above. The ddRNAi expression constructs for
the respective shRNAs were also as described above.
[0779] Experiment 1
[0780] HEK293 cells were seeded at a density of 2.5.times.10.sup.4
cells per well into 96-well culture plates one day prior to
transfection. For each of the seven ddRNAi expression constructs, a
well containing HEK293 cells was co-transfected with 50 ng, 25ng,
10 ng, 2.5ng, 0.83ng, 0.28ng, 0.09ng, 0.03ng, or 0.01ng of the
respective ddRNAi expression construct and 50 ng of the
corresponding Luciferase reporter construct using 0.3uL of
Lipofectamine 2000 reagent (Life Technologies, Carlsbad, Calif.)
according to manufacturer's instructions. The cells were also
transfected with ing of a Renilla reporter construct (serving as a
loading control). 48 hour post-transfection, cell lysates were
collected and analyzed using Dual Luciferase Reporter Assay System
(Promega, Madison, Wis.). The firefly/Renilla activity ratios were
determined for each well, and the inhibition efficiency of ddRNAi
expression constructs were calculated.
[0781] The ability of each of the ddRNAi expression constructs to
inhibit expression of luciferase from the respective Luciferase
reporter constructs in a dose-dependent manner is illustrated in
FIGS. 6a-j.
[0782] Experiment 2
[0783] HEK293 cells were seeded at a density of 2.5.times.10.sup.4
cells per well into 96-well culture plates one day prior to
transfection. For each of the seven ddRNAi expression constructs, a
well containing HEK293 cells was co-transfected with 100 ng, 50 ng,
20ng, 5ng, 1.67ng, 0.56ng, 0.19ng, 0.06ng, or 0.02ng of the
respective ddRNAi expression construct and 10 ng of the
corresponding Luciferase reporter construct using 0.3uL of
Lipofectamine 2000 reagent (Life Technologies, Carlsbad, Calif.)
according to manufacturer's instructions. The cells were also
transfected with ing of a Renilla reporter construct (serving as a
loading control). 48 hour post-transfection, cell lysates were
collected and analyzed using Dual Luciferase Reporter Assay System
(Promega, Madison, Wis.). The firefly/Renilla activity ratios were
determined for each well, and the inhibition efficiency of ddRNAi
expression constructs were calculated.
[0784] The ability of each of the ddRNAi expression constructs to
inhibit expression of luciferase from the respective Luciferase
reporter constructs in a dose-dependent manner is illustrated in
FIGS. 7a-j.
Example 6
Hyperfunctional Properties of ddRNAs Co-Transfected with Filler
Plasmid
[0785] The hyperfunctional properties of the seven lead ddRNAi
constructs described in Example 5 were then assessed when
co-transfected with a U69-PSE7fix-Random100 (pBL-153) filler
plasmid in HEK293 cells.
[0786] Plasmid reporter constructs based on the pGL3 Luciferase
Reporter Vector were prepared for the sense and antisense strands
of each of the seven shRNA sequences of the ddRNAi constructs, as
previously described.
[0787] HEK293 cells cultured in accordance with the methods
previously described and were seeded at a density of
2.5.times.10.sup.4 cells per well into 96-well culture plates one
day prior to transfection. For each of the seven ddRNAi expression
constructs, a well containing HEK293 cells was co-transfected with
(i) 50 ng, 25 ng, 10 ng, 2.5 ng, 0.83 ng, 0.28 ng, 0.09 ng, 0.03
ng, or 0.01 ng of the respective ddRNAi expression construct, (ii)
various amounts of filler plasmid to adjust the final DNA content
to 50 ng, and (iii) 50 ng of the corresponding Luciferase reporter
construct, using 0.3 uL of Lipofectamine 2000 reagent (Life
Technologies, Carlsbad, Calif.) according to manufacturer's
instructions. The cells were also transfected with ing of a Renilla
reporter construct (serving as a loading control). 48 hour
post-transfection, cell lysates were collected and analyzed using
Dual Luciferase Reporter Assay System (Promega, Madison, Wis.). The
firefly/Renilla activity ratios were determined for each well, and
the inhibition efficiency of ddRNAi expression constructs were
calculated.
[0788] The ability of each of the ddRNAi expression constructs to
inhibit expression of luciferase from the respective Luciferase
reporter constructs in a dose-dependent manner when co-transfected
with a filler plasmid is illustrated in FIGS. 8a-j.
Example 7
HBV Inhibitory Activity of Variant shRNAs
[0789] Two variant shRNAs were designed and prepared for each of
shRNAs designated shRNA 9 (SEQ ID NO: 73) and shRNA20 (SEQ ID NO:
84). The variants prepared were as follows:
[0790] shRNA13 (SEQ ID NO:77);
[0791] shRNA14 (SEQ ID NO: 78);
[0792] shRNA21 (SEQ ID NO: 85); and
[0793] shRNA22 (SEQ ID NO: 86).
[0794] ddRNAi constructs were prepared by inserting each of the
original and variant shRNA sequences into two pPsh vectors, one
comprising a U69-PSE7-U68 hybrid promoter and the other comprising
a U69-PSE7 promoter. Dual-luciferase reporter assays were then
performed in HEK293 cells to test efficacy of the various shRNAs to
knockdown expression of HBV genes.
[0795] Luciferase reporter constructs were prepared for the sense
and antisense strands of the shRNAs in each of the ddRNAi
expression constructs in accordance with the methodology previously
described.
[0796] HEK293 cells were cultured in DMEM medium containing 10%
fetal bovine serum, 2mM glutamine, penicillin (100U/mL), and
streptomycin (100 .mu.g/mL) at 37.degree. C. humid incubator with
5% CO2. The HEK293 cells were seeded at a density of
2.times.10.sup.4 cells per well into 96-well culture plate one day
prior to transfection.
[0797] For each well of transfection, 10 ng of the corresponding
ddRNAi expression construct and 100 ng of one of the two Luciferase
reporter constructs were co-transfected into HEK293 cells using
0.3uL of Lipofectamine 2000 reagent (Life Technologies, Carlsbad,
CA) according to manufacturer's instructions. The cells were also
transfected with 5ng of a Renilla reporter construct (serving as a
loading control). 48 hour post-transfection, cell lysates were
collected and analyzed using Dual Luciferase Reporter Assay System
(Promega, Madison, WI). The firefly/ Renilla activity ratios were
determined for each well, and the inhibition efficiency of
respective shRNA were calculated. The ability of each shRNA to
inhibit expression of luciferase protein from the respective
Luciferase reporter constructs is illustrated in FIGS. 9a-b.
Example 8
Preparation of AdV-shRNA Vectors
[0798] HBV shRNA sequences for shRNAs designated shRNA14, shRNA15,
shRNA37 and shRNA28 were synthesized and cloned downstream of
modified U6-1, U6-8, or U6-9 promoters. The entire expression
cassette was subcloned into adenovirus (AdV) construct for virus
production from Vector Biolabs (Malvern, Pa.).
Example 9
shRNA Knockdown of HBV Transcripts in HepG2.2.15 Cells
[0799] HBV shRNA AdV vectors were prepared for shRNAs designated
shRNA14, shRNA15, shRNA37 and shRNA28 in accordance with Example
8.
[0800] HepG2.2.15 cells were prepared in accordance with methods
described in Example 4 for subsequent transduction with the HBV
shRNA AdV vectors. The HepG2.2.15 cells were then infected with the
HBV shRNA AdV vectors in cell suspension and cultured on 24-well
plates. Briefly, each well contained a suspension of
1.0.times.10.sup.5 HepG2.2.15 cells and one of the HBV shRNA AdV
vectors at the following MOIs: 6, 15, 30, 60, 90, or 120. To
simulate treatment with a triple HBV shRNA expression cassette,
cell cultures were also simultaneously infected with three HBV
shRNA adenovirus at the following MOI of each: 2, 5, 10, 20, 30,
40, 60, or 90. The triple HBV shRNA expression cassettes simulated
were (i) shRNA14/shRNA15/shRNA28 and (ii) shRNA14/shRNA37/shRNA28.
After transduction, the cells were cultured at 37.degree. C. at 5%
CO.sub.2 for 72h before being harvested for RNA and DNA extraction
using Qiagen miRNeasy mini kit and QiAmp DNA mini kit, respectively
(Valencia, Calif.).
[0801] Total RNA was isolated using miRNeasy Mini Kit (Qiagen,
Valencia, CA). Total RNA was quantified using the NanoDrop 1000
Spectrophotometer (Thermo Scientific) and diluted to a working
concentration of 10 ng/.mu.l.
[0802] Production of shRNA by the AdV vectors was measured using
Qiagen's miScript PCR system (Valencia, CA). For each RT-qPCR
analysis, 50 ng of total RNA were converted into cDNA using
Qiagen's miScript II RT kit. Quantitative PCR of shRNA was then
carried out using Qiagen miScript SYBR green PCR kit with custom
primers set forth in Table 11 and the following real-time PCR
conditions: initial denaturation at 95.degree. C. for 15min
followed by 40 cycles of 94.degree. C. for 15sec, 55.degree. C. for
30sec and 70.degree. C. for 30sec.
TABLE-US-00009 TABLE 11 Custom primers for quantifying shRNA
expression Primer Sequence (5'-3') shRNA15_fwd
ACAAACGGGCAACATACCTTG shRNA37_fwd GGGAAAGCCCTACGAACCACTG
shRNA28_fwd GGATTCAGCGCCGACGGGACG shRNA14_fwd
TTCTTCTTCTAGGGGACCTGC
[0803] To assist in determining the expression levels of the
various shRNAs, qPCR standard assays were developed for the guide
RNA sequences (Table 12) which were predicted to be processed from
the shRNAs.
TABLE-US-00010 TABLE 12 Guide RNA sequences Primer Sequence (5'-
3') shRNA15_std ACAAACGGGCAACAUACCUUG shRNA37_std
GGGAAAGCCCUACGAACCACUG shRNA28_std GGAUUCAGCGCCGACGGGACG
shRNA14_std UUCUUCUUCUAGGGGACCUGC
[0804] Standard curves for these assays were generated by
amplifying known amounts of these guide RNAs and are presented in
FIG. 10. RNA copy numbers per cell were calculated based on the
estimate of 20ng total RNA in each cell. shRNA copies per cell were
determined for each of shRNA14, shRNA15, shRNA37 and shRNA28 when
expressed individually at the various MOIs and when expressed
simultaneously in the triplet combinations at the various MOIs
(FIGS. 11a-d). Overall, individual shRNA expression in cells
transduced with the triplet HBV shRNA AdV combinations was 1.5-2.0
fold lower than those cells transduced with the single HBV shRNA
AdV vector at equivalent doses e.g., MOT of 30 vs MOI 30+30+30.
[0805] Levels of inhibition of HBV transcripts at regions
corresponding to HBV antigens HBsAg, HBcAg and HbxAg, relative to
levels of GAPDH mRNA, were then determined by normalizing the HBV
mRNA transcript levels to GAPDH mRNA for each sample. Briefly, 100
ng of total RNA was used to synthesize cDNA using High Capacity
cDNA Reverse Transcription Kit (Life Technologies, Carlsbad, CA)
according to manufacturer instructions. Quantitative PCR
amplifications of regions within HBV antigens HBsAg, HBcAg, HbxAg,
and GAPDH were performed using Power SYBR Green PCR Master Mix
(Life Technologies) and the primer sets listed in Table 9. Standard
real-time PCR conditions were used: initial denaturation at
95.degree. C. for 10min followed by 40 cycles of 95.degree. C. for
15sec and 60.degree. C. for 1 min.
[0806] The levels of inhibition of HBV transcripts at regions
corresponding to HBV antigens HBsAg, HBcAg and HbxAg, relative to
levels of GAPDH mRNA, for each of shRNA14, shRNA15, shRNA37 and
shRNA28 when expressed individually, and when expressed
simultaneously in the triplet combinations, at various MOIs are
illustrated in FIGS. 12a-f. As will be apparent from FIGS. 12a-f,
the triplet combinations showed significantly better knockdown of
HBV RNA relative to the single shRNA constructs, particularly when
transduced as lower equivalent doses.
Example 10
shRNA Knockdown of HBV Transcripts in HepG2.2.15 Cells
[0807] Single HBV shRNA AdV vectors were prepared for shRNAs
designated shRNA14, shRNA15, shRNA37 and shRNA28 respectively in
accordance with Example 8.
[0808] Two triple HBV shRNA AdV vectors were also prepared, each
comprising a triple HBV shRNA expression cassette. The triple HBV
shRNA expression cassettes comprised sequence coding for (i)
shRNA14/shRNA15/shRNA28 and (ii) shRNA14/shRNA37/shRNA28,
respectively, and three modified U6 promoters (i.e., U6-1, U6-8, or
U6-9 promoters), one positioned immediately upstream of each shRNA
coding sequence in the cassette. The triple HBV shRNA expression
cassettes were each synthesized and subcloned into adenovirus (AdV)
construct for virus production from Vector Biolabs (Malvern,
PA).
[0809] HepG2.2.15 cells were prepared in accordance with methods
described in Example 4. The HepG2.2.15 cells were then infected
with a single or triple HBV shRNA AdV vector in cell suspension and
cultured on 24-well plates. Briefly, each well contained a
suspension of 1.2.times.10.sup.5 HepG2.2.15 cells and one of the
single or triple HBV shRNA AdV vectors at MOI 100. After
transduction, the cells were cultured at 37.degree. C. at 5%
CO.sub.2 for 72h, 96h, 120h and 144h before being harvested for RNA
and DNA extraction using Qiagen miRNeasy mini kit and QiAmp DNA
mini kit, respectively (Valencia, Calif.).
[0810] Total RNA was isolated and prepared in accordance with
methods described in Example 9. Production of shRNA by the AdV
vectors was also measured in accordance with methods described in
Example 9.
[0811] shRNA copies per cell were determined for each of shRNA14,
shRNA15, shRNA37 and shRNA28 when expressed from the single or
triple HBV shRNA AdV vector(s) at MOI 100 (FIGS. 13a-d). Overall,
individual shRNA expression in cells transduced with the triplet
HBV shRNA AdV vector at 72h was comparable to cells transduced with
the single HBV shRNA AdV vector. shRNA15 and shRNA37 continued to
accumulate even after 6 days of transduction whereas shRNA14 and
shRNA28 expression levels appeared to plateau at day 5.
[0812] Levels of inhibition of HBV transcripts at regions
corresponding to HBV antigens HBsAg, HBcAg and HbxAg, relative to
levels of GAPDH mRNA, were then determined by normalizing the HBV
mRNA transcript levels to GAPDH mRNA for each sample in accordance
with methods described in Example 9.
[0813] The levels of inhibition of HBV transcripts at regions
corresponding to HBV antigens HBsAg, HBcAg and HbxAg, relative to
levels of GAPDH mRNA, for each of shRNA14, shRNA15, shRNA37 and
shRNA28 when expressed from the single or triple HBV shRNA AdV
vector(s) at MOI 100 at 72h, 96h, 120h and 144h are illustrated in
FIGS. 14a-f. As will be apparent from FIGS. 14a-f, the triple HBV
shRNA AdV vectors showed significantly better knockdown of HBV RNA
relative to the corresponding single shRNA vectors at 72h (day 3).
All single HBV shRNA AdV vectors showed increased knockdown levels
with prolonged time course and were comparable to the triple HBV
shRNA AdV vectors at 144h (day 6). At 144h, the triple HBV shRNA
AdV vector expressing shRNA14/shRNA37/shRNA28 achieved over 90%
knockdown in the HBsAg and HBxAg region and close to 80% knockdown
in the HBcAg region.
Example 11
Inhibition of HBV Transcripts In Vitro
[0814] The inventors determined the effect of the triple HBV shRNA
AdV vector expressing shRNA14/shRNA37/shRNA28 on formation of
covalently-closed circular DNA (cccDNA) in a cell model infected de
novo with HBV inoculum.
[0815] The triple HBV shRNA AdV vector expressing
shRNA14/shRNA37/shRNA28 was prepared in accordance with Example
10.
[0816] Human hepatocytes were isolated from the PhoenixBio mouse
model (PXB-mice), which is a chimeric mouse with a liver highly
replaced with human hepatocytes (i.e., a humanized liver). The
isolated human hepatocytes (PXB-cells) were seeded at a density of
4.0.times.10.sup.5 cells per well into 24-well culture plates one
day prior to inoculation. The PXB-cells were then inoculated with
HBV on day 0. After inoculation, the cells were treated with (i)
the triple HBV shRNA AdV vector at MOIs: 10, 30, 60 and 100 or (ii)
the AdV vector backbone at MOIs: 10, 30, 60 and 100, or (iii)
received no treatment, and were then cultured at 37.degree. C. at
5% CO.sub.2 for 6, 11 and 16 days before being harvested for RNA
and DNA extraction using Qiagen miRNeasy mini kit and QiAmp DNA
mini kit, respectively (Valencia, Calif.).
[0817] For PXB-cells inoculated with the triple HBV shRNA AdV
vector at MOI 10, shRNA copies per cell were determined for each of
shRNA14, shRNA37 and shRNA28 at day 6, 11 and 16 post treatment in
accordance with methods described in Example 9 (FIG. 15a).
Effective knockdown of HBV transcripts (78-85%) was observed at day
6 post treatment with the triple HBV shRNA AdV vector, and this
knockdown was observed to increase up to 97-99% at day 16 post
treatment. This increase in knockdown of HBV transcripts between
day 6 and day 16 was found to coincide with a concomitant increase
in the production of shRNAs by the AdV vector.
[0818] The level of inhibition of HBV transcripts at regions
corresponding to HBV antigens HBsAg, HBcAg and HbxAg was measured
in accordance with methods described in Example 9 for cells treated
with the triple HBV shRNA AdV vector relative to those cells
treated with the AdV backbone only (FIG. 15b).
[0819] The levels of intracellular and extracellular HBV DNA
following treatment with the triple HBV shRNA AdV vector were also
measured by real time PCR assay and are illustrated in FIGS. 15c.
An 85% and 1 log drop in intracellular and extracellular HBV DNA,
respectively, was observed at day 11 following treatment.
[0820] The levels of HBV transcripts at regions corresponding to
HBV antigens HBsAg and HBcAg were measured in accordance with
methods described in Example 9, the results of which are
illustrated in FIG. 15d. The level of extracellular HBcAg and HBsAg
was observed to drop by approximately 90% at day 11 in cells
treated with the triple HBV shRNA AdV vector as compared to the AdV
backbone control.
[0821] The levels cccDNA were also measured in PXB-cells following
treatment with the triple HBV shRNA AdV vector, the results of
which are illustrated in FIG. 15e. At day 11 post treatment, a 66%
decrease in cccDNA was observed in the HBV infected PXB-cells
treated with the triple HBV shRNA AdV vector compared to HBV
infected PXB-cells treated with the AdV backbone control and
untreated PXB-cells.
Example 12
Inhibition of HBV Transcripts In Vivo
[0822] The in vivo effect of the triple HBV shRNA AdV vector
expressing shRNA14/shRNA37/shRNA28 on (i) expression of HBV viral
transcripts, (ii) extracellular HBsAg and HBeAg, (iii)
extracellular and intracellular HBV DNA, and (iv) formation of
cccDNA, was determined in a PXB mouse model infected de novo with
HBV inoculum.
[0823] Methods
[0824] The triple HBV shRNA AdV vector expressing
shRNA14/shRNA37/shRNA28 was prepared in accordance with Example
10.
[0825] Chimeric PXB mice (PXB-mice.RTM.) were obtained from
PhoenixBio. All mice were housed individually at 23.+-.5.degree. C.
and a humidity of 55.+-.25% humidity, exposed to 12
hours-light/dark cycles and fed and watered ad libitum throughout
the experiment.
[0826] Briefly, 19-23 week-old male PXB mice were inoculated with
HBV genotype C and incubated for 4 weeks to allow baseline HBV
infection to establish. To determine baseline HBV infection, blood
was taken from mice at days -28, -21, -14 and -7 (i.e., 0, 7, 14
and 21 days post inoculation, respectively), from which the human
albumin (h-Alb) concentration and serum concentrations of HBV DNA,
HBsAg and HBeAg determined.
[0827] Blood was collected from animals under isoflurane
(Escain.RTM., Mylan, Osaka, Japan) anesthesia via the retro-orbital
plexus/sinus using Intramedic.TM. Polyethylene Tubing (Becton,
Dickinson and Company, NJ, USA) at each time point.
[0828] To measure blood h-Alb concentration, 2.mu.L of the whole
blood was diluted in saline and a clinical chemistry analyzer
(BioMajesty.TM. Series JCA-BM6050, JEOL Ltd., Tokyo, Japan) was
used to measure the blood h-Alb concentration using latex
agglutination immunonephelometry (LZ Test "Eiken" U-ALB, Eiken
Chemical Co., Ltd., Tokyo, Japan).
[0829] Whole blood was centrifuged to separate serum for HBV DNA
quantification, HBsAg and HBeAg analysis.
[0830] To measure serum HBV DNA, HBV DNA was extracted from 5 .mu.L
of serum using the SMITESTEX-R&D Nucleic Acid Extraction Kit
(MEDICAL & BIOLOGICAL LABORATORIES CO., LTD., Nagoya, Japan).
The purified DNA was then dissolved in 20 .mu.L nuclease-free water
(Ambion). Serum from an HBV-infected PXB-mouse was used as the HBV
DNA standard. Synthetic HBV DNA was used to determine the
concentration of the HBV DNA standard which was then used in
quantification of the serum HBV DNA level. The HBV DNA was
extracted from the HBV DNA standard and used for real-time PCR
after appropriate dilution. For this study, the range of the
standard used was between 4.0E.sup.+04 and 2.0E.sup.+09
copies/mL.
[0831] Real-time PCR to measure the serum HBV DNA concentration was
performed using the TaqMan Fast Advanced Master Mix (Applied
Biosystems, Thermo Fisher Scientific Inc.) and ABI Prism 7500
sequence detector system (Applied Biosystems). The PCR reaction
mixture was added into 5 .mu.L of the extracted DNA. The initial
activation of uracil-N-glycosylase at 50.degree. C. for 2 minutes
was followed by the polymerase activation at 95.degree. C. for 20
seconds. Subsequent PCR amplification consisted of 53 cycles of
denaturation at 95.degree. C. for 3 seconds and annealing and
extension at 60.degree. C. for 32 seconds per cycle in an ABI 7500
sequence detector. The average serum HBV DNA level was calculated
from the values of two separate wells.
[0832] The primers and probes used for real time PCR are as
follows:
TABLE-US-00011 Sequence Information Target 5' Identification
Location Dye Nucleotides 3' Dye Forward primer 166-186 n/a
CACATCAGGATTCC n/a TAGGACC Reverse primer 344-325 n/a
AGGTTGGTGAGTGA n/a TTGGAG TaqMan probe 242-267 6-FAM CAGAGTCTAGACTC
TAMRA GTGGTGGACTTC
[0833] The lowest quantification limit of this assay was
4.0E.sup.+04 copies/mL serum.
[0834] Serum HBsAg concentration was determined by SRL, Inc.
(Tokyo, Japan) using ChemiLuminescence ImmunoAssay (CLIA) developed
by Abbott (ARCHITECT.RTM. SYSTEM). The dilution factor was 30, and
the measurement range of this assay was between 0.05 and 250 IU/mL.
For the 30-fold diluted samples, the measurement range was adjusted
to be between 1.5 and 7500 IU/mL.
[0835] Serum HBeAg concentration was determined by SRL, Inc.
(Tokyo, Japan) using ChemiLuminescence ImmunoAssay (CLIA) developed
by Abbott (ARCHITECT.RTM. SYSTEM). The dilution factor was 30 and
the lowest quantification limit of this assay was 0.5 S/CO. For the
30-fold diluted samples, the lowest quantification limit was
adjusted to be 15 S/CO.
[0836] Animals were included in subsequent treatment experiment if
they met the following criteria: [0837] (i) weighed 15g or more at
day -1 (i.e., day 27 post HBV inoculation); [0838] (ii) had a serum
HBV DNA concentration of at least 1.0E.sup.+6 copies/mL at day -7
(i.e., day 21 post HBV inoculation); and [0839] (iii) had a h-Alb
measurement of 10mg/mL or more at day -7 (i.e., day 21 post HBV
inoculation).
[0840] Those mice in which baseline HBV infection was established
and met the criteria above were placed into three treatment groups
i.e., treatment groups 1-3 (n=4 per group). To minimise variance
between groups, the group composition was randomised based on the
arithmetic mean values for body weight and geometric mean values
for blood h-Alb concentration and serum HBV DNA concentration.
[0841] The treatment groups were as follows: [0842] Group 1: no
treatment; [0843] Group 2: a single bolus, having a dose volume of
10 .mu.L/gram body weight, containing 2.00E.sup.+11 vg/mL of the
triple HBV shRNA AdV vector, delivered to the tail vein by IV
injection; and [0844] Group 3: a single bolus, having a dose volume
of 10 .mu.L/gram body weight, containing 2.00E.sup.+12 vg/mL triple
HBV shRNA AdV vector, delivered to the tail vein by IV
injection.
[0845] Following administration of the treatment (day 0), animals
were then incubated for a further 56 days. During this time blood
was taken on a weekly basis for 8 weeks (at days 7, 14, 21, 28, 35,
42, 49 and 56 post treatment), and serum concentrations of
extracellular HBsAg, extracellular HBeAg and extracellular HBV DNA
determined by real time PCR, using the methodologies described.
[0846] After the completion of blood sampling on Day 56, all the
surviving animals were kept under isoflurane anesthesia and
sacrificed by cardiac puncture and exsanguination.
[0847] Once sacrificed, whole livers were harvested from mice and
weighed. A slice of 3 to 5 mm in thickness was obtained from left
lateral lobe and cut into cubes approximately 1 to 2 mm on a side.
These liver cubes were transferred into a labelled tube and
immersed in RNAlater.RTM. solution (Ambion, Thermo Fisher
Scientific Inc., Waltham, MA, USA) as quickly as possible. The
liver samples were incubated in .gtoreq.5 volumes of RNAlater.RTM.
overnight at 4.degree. C. to allow the solution to penetrate the
tissue. After the incubation, the RNAlater.RTM. solution was
removed and the liver pieces were stored at -80.degree. C. for
later quantification of hepatic HBV DNA levels.
[0848] To determine the level of hepatic HBV DNA following
treatment, HBV DNA was extracted from frozen
RNAlater.RTM.-preserved liver tissue using the DNeasy.RTM. Blood
& Tissue Kits (Qiagen K. K., Tokyo, Japan). The DNA was
dissolved in 200 .mu.L nuclease-free water, after which the
concentration of the DNA solution was determined using
BioPhotometer 6131 (Eppendorf Co., Ltd., Tokyo, Japan). The
concentration of DNA solution was adjusted to 20 ng/pt using
Nuclease-free water.
[0849] Real-time PCR to measure liver HBV cccDNA concentration was
then performed using the TaqMan Fast Advanced Master Mix and ABI
Prism 7500 sequence detector system. Briefly, the PCR reaction
mixture was added into 5 .mu.L of the extracted DNA. The PCR
reaction was conducted based on the Takkenberg's condition. The
initial activation of uracil-N-glycosylase at 50.degree. C. for 2
minutes was followed by the polymerase activation at 95.degree. C.
for 20 seconds. Subsequent 55 cycles of PCR amplification was
conducted at 95.degree. C. for 3 seconds and 60.degree. C. for 32
seconds per cycle in an ABI 7500 sequence detector. The average HBV
cccDNA level was calculated from the values of the two separate
wells. A plasmid containing the HBV full-genome sequence was used
as a standard sample for HBV cccDNA quantification. The range of
the standard used was between 1.0E.sup.+02 and 1.0E.sup.+05
copies/100 ng DNA.
[0850] The primers and probes used for real time PCR are as
follows:
TABLE-US-00012 Sequence Information Target 5' Identification
Location Dye Nucleotides 3' Dye Forward primer 1545-1563 n/a
CTCCCCGTCTGTGC n/a CTTCT Reverse primer 1900-1883 n/a
GCCCCAAAGCCACC n/a CAAG TaqMan probe 1602-1628 6-FAM CGTCGCATGGARAC
TAMRA CACCGTGAACGCC
[0851] The lowest quantification limit of this assay was
1.0E.sup.+02 copies/100 ng DNA in extracted DNA solution.
[0852] Results
[0853] All animals maintained body weight of more than 80% of the
initial level throughout the treatment. In addition, the lowest
average values of the body weights in Groups 2 and 3 were slightly
lower than that in the control group receiving no treatment.
[0854] As will be apparent from FIGS. 16 and 17, animals in
treatment groups receiving the triple HBV shRNA AdV vector showed a
steady reduction in serum HBV DNA throughout the course of the
experiment relative to animals in group 1 which received the
control treatment. At day 56, animals receiving the medium dose
treatment (Group 2) showed an average of 0.59 log and 74.4%
reduction in serum HBV DNA, and animals receiving the high dose
treatment (Group 3) showed an average of 1.83 log and 98.5%
reduction in serum HBV DNA.
[0855] Similarly, serum concentrations of HBsAg and HBeAg steadily
reduced following treatment with the triple HBV shRNA AdV vector
(FIGS. 18 and 19) relative to those animals in Group 1 which
received the control treatment. At day 56, animals receiving the
medium dose treatment (Group 2) showed an average reduction of
78.4% and 63.6% in serum levels of HBsAg and HBeAg respectively,
and animals receiving the high dose treatment (Group 3) showed an
average reduction of 97.6% and 92.6% in serum levels of HBsAg and
HBeAg respectively.
[0856] The levels of intracellular HBV DNA and cccDNA at day 56
were also shown to be reduced for animals in the medium and high
dose treatments (Groups 2 and 3 respectively) relative to animals
receiving the control treatment (Group 1). For example, as
illustrated in FIG. 20, treatment with medium and high doses of the
triple HBV shRNA AdV vector resulted in a 48.6% and 94.9%
reduction, respectively, in copy number of intracellular HBV DNA at
day 56. Similarly, FIG. 21 shows that treatment with medium and
high doses of the triple HBV shRNA AdV vector resulted in a 36.9%
and 57.7% reduction, respectively, in copy number of cccDNA at day
56.
[0857] The level of inhibition of HBV viral transcripts
corresponding to the shRNAs expressed by the triple HBV shRNA AdV
vector (i.e., shRNA14, shRNA 37 and shRNA28) was also measured at
day 56 by real time PCR. As shown in FIG. 22, viral RNA
corresponding to shRNA14, shRNA 37 and shRNA28 was reduced by
39.4%, 39.2% and 53.3% in animals in Group 2 treated with the
medium dose relative to levels of expression of those HBV viral
transcripts in animals from group 1 administered the control
treatment. Likewise, FIG. 22 shows that viral RNA corresponding to
shRNA14, shRNA 37 and shRNA28 was reduced by 86.2%, 82.0% and 89.1%
in animals in Group 3 treated with the high dose relative to levels
of expression of those HBV viral transcripts in animals from group
1 administered the control treatment.
[0858] Based on the results from the present study, the triple HBV
shRNA AdV vector was shown to have clear effects on the viral
parameters of serum HBV DNA, serum HBsAg, serum HBeAg and hepatic
HBV DNA when administered to HBV infected PXB-mice with a humanized
liver. These antiviral effects were observed at a dosage of
2.00E+.sup.12 vg/kg (Group 2) and 2.00E.sup.+13 vg/kg (Group 3)
demonstrating the efficacy of the triple HBV shRNA AdV vector at
different dosages.
[0859] It will be appreciated by persons skilled in the art that
numerous variations and/or modifications may be made to the
above-described embodiments, without departing from the broad
general scope of the present disclosure. The present embodiments
are, therefore, to be considered in all respects as illustrative
and not restrictive.
Sequence CWU 1
1
129120DNAHepatitis B virus 1catcctgctg ctatgcctca 20223DNAHepatitis
B virus 2tttgctgacg caacccccac tgg 23320DNAHepatitis B virus
3aagcctccaa gctgtgcctt 20434DNAHepatitis B virus 4gcaggtcccc
tagaagaaga actccctcgc ctca 34523DNAHepatitis B virus 5caaggtatgt
tgcccgtttg tcc 23620DNAHepatitis B virus 6ctcgtggtgg acttctctca
20723DNAHepatitis B virus 7ctcgtgttac aggcggggtt ttt
23830DNAHepatitis B virus 8ccgtgtgcac ttcgcttcac ctctgcacgt
30922DNAHepatitis B virus 9tacgtcccgt cggcgctgaa tc
221019DNAHepatitis B virus 10aaatgcccct atcttatca
191120RNAartificial sequenceEffector sequence for shRNA1 and shRNA4
11ugaggcauag cagcaggaug 201220RNAartificial sequenceEffector
complement sequence for shRNA1 and shRNA4 12cauccugcug cuaugccuca
201320RNAartificial sequenceEffector sequence for shRNA2
13gaugaggcau agcagcagga 201420RNAartificial sequenceEffector
complement sequence for shRNA2 14uccugcugcu augccucauc
201520RNAartificial sequenceEffector sequence for shRNA3
15gaggcauagc agcaggaugc 201620RNAartificial sequenceEffector
complement sequence for shRNA3 16gcauccugcu gcuaugccuc
201720RNAartificial sequenceEffector sequence for shRNA5 and shRNA6
17ccaguggggg uugcgucagc 201820RNAartificial sequenceEffector
complement sequence for shRNA5 and shRNA6 18gcugacgcaa cccccacugg
201920RNAartificial sequenceEffector sequence for shRNA7 and shRNA8
19aaggcacagc uuggaggcuu 202020RNAartificial sequenceEffector
complement sequence for shRNA7 and shRNA8 20aagccuccaa gcugugccuu
202121RNAartificial sequenceEffector sequence for shRNA9 and
shRNA10 21gaguucuucu ucuaggggac c 212221RNAartificial
sequenceEffector complement sequence for shRNA9 and shRNA10
22gguccccuag aagaagaacu c 212321RNAartificial sequenceEffector
sequence for shRNA11 and shRNA12 23gagggaguuc uucuucuagg g
212421RNAartificial sequenceEffector complement sequence for
shRNA11 and shRNA12 24cccuagaaga agaacucccu c 212521RNAartificial
sequenceEffect sequence for shRNA13 25gcgaguucuu cuucuagggg a
212621RNAartificial sequenceEffect complement sequence for shRNA13
26uccccuagaa gaagaacucg c 212721RNAartificial sequenceEffector
sequence for shRNA14 27uucuucuucu aggggaccug c 212821RNAartificial
sequenceEffector complement sequence for shRNA14 28gcaggucccc
uagaagaaga a 212921RNAartificial sequenceEffector sequence for
shRNA15 and shRNA18 29acaaacgggc aacauaccuu g 213021RNAartificial
sequenceEffector complement sequence for shRNA15 and shRNA18
30caagguaugu ugcccguuug u 213121RNAartificial sequenceEffector
sequence for shRNA16 31ggacaaacgg gcaacauacc u 213221RNAartificial
sequenceEffector complement sequence for shRNA16 32agguauguug
cccguuuguc c 213321RNAartificial sequenceEffector sequence for
shRNA17 33gacaaacggg caacauaccu u 213421RNAartificial
sequenceEffector complement sequence for shRNA17 34aagguauguu
gcccguuugu c 213520RNAartificial sequenceEffector sequence for
shRNA19 and shRNA20 35ugagagaagu ccaccacgag 203620RNAartificial
sequenceEffector complement sequence for shRNA19 and shRNA20
36cucguggugg acuucucuca 203720RNAartificial sequenceEffector
sequence for shRNA21 37auugagagaa guccaccacg 203820RNAartificial
sequenceEffector complement sequence for shRNA21 38cgugguggac
uucucucaau 203920RNAartificial sequenceEffector sequence for
shRNA22 39agagaagucc accacgaguc 204020RNAartificial
sequenceEffector complement sequence for shRNA22 40gacucguggu
ggacuucucu 204121RNAartificial sequenceEffector sequence for
shRNA23 and shRNA24 41aaaccccgcc uguaacacga g 214221RNAartificial
sequenceEffector complement sequence for shRNA23 and shRNA24
42cucguguuac aggcgggguu u 214321RNAartificial sequenceEffector
sequence for shRNA25 and shRNA26 43ugcagaggug aagcgaagug c
214421RNAartificial sequenceEffector complement sequence for
shRNA25 and shRNA26 44gcacuucgcu ucaccucugc a 214521RNAartificial
sequenceEffector sequence for shRNA27 and shRNA30 45gauucagcgc
cgacgggacg u 214621RNAartificial sequenceEffector complement
sequence for shRNA27 and shRNA30 46acgucccguc ggcgcugaau c
214721RNAartificial sequenceEffector sequence for shRNA28 and
shRNA31 47ggauucagcg ccgacgggac g 214821RNAartificial
sequenceEffector complement sequence for shRNA28 and shRNA31
48cgucccgucg gcgcugaauc c 214921RNAartificial sequenceEffector
sequence for shRNA29 and shRNA32 49auucagcgcc gacgggacgu a
215021RNAartificial sequenceEffector complement sequence for
shRNA29 and shRNA32 50uacgucccgu cggcgcugaa u 215119RNAartificial
sequenceEffector sequence for shRNA33 and shRNA34 51ugauaagaua
ggggcauuu 195219RNAartificial sequenceEffector complement sequence
for shRNA33 and shRNA34 52aaaugccccu aucuuauca 195322RNAartificial
sequenceEffector sequence for shRNA35 53ugaggcccac ucccauaggu au
225422RNAartificial sequenceEffector complement sequence for
shRNA35 54auaccuaugg gagugggccu ca 225522RNAartificial
sequenceEffector sequence for shRNA36 55ggaaagcccu acgaaccacu ga
225622RNAartificial sequenceEffector complement sequence for
shRNA36 56ucagugguuc guagggcuuu cc 225722RNAartificial
sequenceEffector sequence for shRNA37 57gggaaagccc uacgaaccac ug
225822RNAartificial sequenceEffector complement sequence for
shRNA37 58cagugguucg uagggcuuuc cc 225922RNAartificial
sequenceEffector sequence for shRNA38 59ggggaaagcc cuacgaacca cu
226022RNAartificial sequenceEffector complement sequence for
shRNA38 60agugguucgu agggcuuucc cc 226122RNAartificial
sequenceEffector sequence for shRNA39 61gggaaagccc uacgaaccac ug
226222RNAartificial sequenceEffector complement sequence for
shRNA39 62cauuguuucg ucgggcuuuc cc 226322RNAartificial
sequenceEffector sequence for shRNA40 63ccgggcaacg ggguaaaggu uc
226422RNAartificial sequenceEffector complement sequence for
shRNA40 64gaaccuuuac cccguugccc gg 226547RNAartificial
sequenceshRNA1 sequence 65cauccugcug cuaugccuca caagagauga
ggcauagcag caggaug 476647RNAartificial sequenceshRNA2 sequence
66uccugcugcu augccucauc caagagagau gaggcauagc agcagga
476747RNAartificial sequenceshRNA3 sequence 67gcauccugcu gcuaugccuc
caagagagag gcauagcagc aggaugc 476847RNAartificial sequenceshRNA4
sequence 68ugaggcauag cagcaggaug caagagacau ccugcugcua ugccuca
476947RNAartificial sequenceshRNA5 sequence 69gcugacgcaa cccccacugg
caagagacca guggggguug cgucagc 477047RNAartificial sequenceshRNA6
sequence 70ccaguggggg uugcgucagc caagagagcu gacgcaaccc ccacugg
477147RNAartificial sequenceshRNA7 sequence 71aagccuccaa gcugugccuu
ugugcuuaag gcacagcuug gaggcuu 477247RNAartificial sequenceshRNA8
sequence 72aaggcacagc uuggaggcuu ugugcuuaag ccuccaagcu gugccuu
477349RNAartificial sequenceshRNA9 sequence 73gguccccuag aagaagaacu
ccaagagaga guucuucuuc uaggggacc 497449RNAartificial sequenceshRNA10
sequence 74gaguucuucu ucuaggggac ccaagagagg uccccuagaa gaagaacuc
497549RNAartificial sequenceshRNA11 sequence 75cccuagaaga
agaacucccu ccaagagaga gggaguucuu cuucuaggg 497649RNAartificial
sequenceshRNA12 sequence 76gagggaguuc uucuucuagg gcaagagacc
cuagaagaag aacucccuc 497749RNAartificial sequenceshRNA13 sequence
77uccccuagaa gaagaacucg ccaagagagc gaguucuucu ucuagggga
497849RNAartificial sequenceshRNA14 sequence 78gcaggucccc
uagaagaaga acaagagauu cuucuucuag gggaccugc 497949RNAartificial
sequenceshRNA15 sequence 79caagguaugu ugcccguuug ucaagagaac
aaacgggcaa cauaccuug 498049RNAartificial sequenceshRNA16 sequence
80agguauguug cccguuuguc ccaagagagg acaaacgggc aacauaccu
498149RNAartificial sequenceshRNA17 sequence 81aagguauguu
gcccguuugu ccaagagaga caaacgggca acauaccuu 498249RNAartificial
sequenceshRNA18 sequence 82acaaacgggc aacauaccuu gcaagagaca
agguauguug cccguuugu 498347RNAartificial sequenceshRNA19 sequence
83cucguggugg acuucucuca caagagauga gagaagucca ccacgag
478447RNAartificial sequenceshRNA20 sequence 84ugagagaagu
ccaccacgag caagagacuc gugguggacu ucucuca 478547RNAartificial
sequenceshRNA21 sequence 85auugagagaa guccaccacg caagagacgu
gguggacuuc ucucaau 478647RNAartificial sequenceshRNA22 sequence
86agagaagucc accacgaguc caagagagac ucguggugga cuucucu
478749RNAartificial sequenceshRNA23 sequence 87cucguguuac
aggcgggguu uugugcuuaa accccgccug uaacacgag 498849RNAartificial
sequenceshRNA24 sequence 88aaaccccgcc uguaacacga gugugcuucu
cguguuacag gcgggguuu 498949RNAartificial sequenceshRNA25 sequence
89gcacuucgcu ucaccucugc acaagagaug cagaggugaa gcgaagugc
499049RNAartificial sequenceshRNA26 sequence 90ugcagaggug
aagcgaagug ccaagagagc acuucgcuuc accucugca 499149RNAartificial
sequenceshRNA27 sequence 91acgucccguc ggcgcugaau cugugcuuga
uucagcgccg acgggacgu 499249RNAartificial sequenceshRNA28 sequence
92cgucccgucg gcgcugaauc cugugcuugg auucagcgcc gacgggacg
499349RNAartificial sequenceshRNA29 sequence 93uacgucccgu
cggcgcugaa uugugcuuau ucagcgccga cgggacgua 499449RNAartificial
sequenceshRNA30 sequence 94gauucagcgc cgacgggacg uugugcuuac
gucccgucgg cgcugaauc 499549RNAartificial sequenceshRNA31 sequence
95ggauucagcg ccgacgggac gugugcuucg ucccgucggc gcugaaucc
499649RNAartificial sequenceshRNA32 sequence 96auucagcgcc
gacgggacgu augugcuuua cgucccgucg gcgcugaau 499745RNAartificial
sequenceshRNA33 sequence 97aaaugccccu aucuuaucau gugcuuugau
aagauagggg cauuu 459845RNAartificial sequenceshRNA34 sequence
98ugauaagaua ggggcauuuu gugcuuaaau gccccuaucu uauca
459951RNAartificial sequenceshRNA35 sequence 99auaccuaugg
gagugggccu cacaagagau gaggcccacu cccauaggua u 5110051RNAartificial
sequenceshRNA36 sequence 100ucagugguuc guagggcuuu cccaagagag
gaaagcccua cgaaccacug a 5110151RNAartificial sequenceshRNA37
sequence 101cagugguucg uagggcuuuc cccaagagag ggaaagcccu acgaaccacu
g 5110251RNAartificial sequenceshRNA38 sequence 102agugguucgu
agggcuuucc cccaagagag gggaaagccc uacgaaccac u 5110351RNAartificial
sequenceshRNA39 sequence 103gggaaagccc uacgaaccac ugcaagagac
auuguuucgu cgggcuuucc c 5110451RNAartificial sequenceshRNA40
sequence 104gaaccuuuac cccguugccc ggcaagagac cgggcaacgg gguaaagguu
c 511051856DNAartificial
sequencepBL184_HBV_Triple_V2misc_feature(696)..(696)n is a, c, g,
or tmisc_feature(699)..(699)n is a, c, g, or t 105gcatgcaggg
cggtgcggct caggctctgc cccgcctccg gggctatttg catacgacca 60tttccagtaa
ttcccagcag ccaccgtagc tatatttggt agaacaacga gcactttctc
120aactccagtc aataactacg ttagttgcat tacacattgg gctaatataa
atagaggtta 180aatctctagg tcatttaaga gaacggtcac cgtaaggaaa
acaaatgaaa agactcccgt 240gccttataag gcctgtgggt gacttcttct
caacggatcc gcaggtcccc tagaagaaga 300acaagagatt cttcttctag
gggacctgct tttttagatc tgttcggctt tacgtcacgc 360gagggcggca
gggaggacgg aatggcgggg tttggggtgg gtccctcctc gggggagccc
420tgggaaaaga ggactgcgtg tgggaagaga aggtggaaat ggcgttttgg
ttgacatgtg 480ccgcctgcga gcgtgctgcg gggaggggcc gagggcagat
tcgggaatga tggcgcgggg 540tgggggcgtg ggggctttct cgggagaggc
ccttccctgg aagtttgggg tgcgatggtg 600aggttctcgg ggcacctctg
gaggggcctc ggcacggaaa gcgaccacct gggagggcgt 660gtggggacca
ggttttgcct ttagttttgc acacdnadna actgtagttc atctttatgg
720agatgctcat ggcctcattg aagccccacg gatctgggca ggaagagggc
ctatttccca 780tgattccttc atatttgcat atacgataca aggctgttag
agagataatt agaattaatt 840tgactgtaaa cacaaagata ttagtacaaa
atacgtgacg tagaaagtaa taatttcttg 900ggtagtttgc agttttaaaa
ttatgtttta aaatggacta tcatatggtt accgtaagga 960aaacaaatga
tttcgatttc ttggctttat atatcttgtg gaaaggacga ggatccgcaa
1020ggtatgttgc ccgtttgtca agagaacaaa cgggcaacat accttgtttt
ttctagagaa 1080ttgtacagct ctggtagcgg taaccatgcg tatttgacac
acgaaggaac tagggaaaag 1140gcattaggtc atttcaagcc gaaattcaca
tgtgctagaa tccagattcc atgctgaccg 1200atgccccagg atatagaaaa
tgagaatctg gtccttacct tcaagaacat tcttaaccgt 1260aatcagcctc
tggtatctta gctccaccct cactggtttt ttcttgtttg ttgaaccggc
1320caagctgctg gcctccctcc tcaaccgttc tgatcatgct tgctaaaata
gtcaaaaccc 1380cggccagtta aatatgcttt agcctgcttt attatgatta
tttttgttgt tttggcaatg 1440acctggctac ctgttgtttc tcccactaaa
actttttaag ggcagggaat tgatctagaa 1500aaaaaaaagc tagtggtacc
ggtcctacgc ggggcccttt acccagggtg ccccgggcgc 1560tcatttgcat
gtcccaccca acaggtaaac ctgacaggtc atcgcggcca ggtacgacct
1620cggtcagagc accaaacata cgagccttgt gatgagttcc gttgcatgaa
attctcccaa 1680aggctccaag atggacagga aagggcgcgg ttcggtcacc
gtaaggaaaa caaatgaaaa 1740gactcccgtg ccttataagg cctgtgggtg
acttcttctc aacggatccg cgtcccgtcg 1800gcgctgaatc ctgtgcttgg
attcagcgcc gacgggacgt tttttctaga gaattc 18561061851DNAartificial
sequencepBL183_HBV_Triple_V1 106gcatgcaggg cggtgcggct caggctctgc
cccgcctccg gggctatttg catacgacca 60tttccagtaa ttcccagcag ccaccgtagc
tatatttggt agaacaacga gcactttctc 120aactccagtc aataactacg
ttagttgcat tacacattgg gctaatataa atagaggtta 180aatctctagg
tcatttaaga gaacggtcac cgtaaggaaa acaaatgaaa agactcccgt
240gccttataag gcctgtgggt gacttcttct caacggatcc gcaggtcccc
tagaagaaga 300acaagagatt cttcttctag gggacctgct tttttagatc
tgttcggctt tacgtcacgc 360gagggcggca gggaggacgg aatggcgggg
tttggggtgg gtccctcctc gggggagccc 420tgggaaaaga ggactgcgtg
tgggaagaga aggtggaaat ggcgttttgg ttgacatgtg 480ccgcctgcga
gcgtgctgcg gggaggggcc gagggcagat tcgggaatga tggcgcgggg
540tgggggcgtg ggggctttct cgggagaggc ccttccctgg aagtttgggg
tgcgatggtg 600aggttctcgg ggcacctctg gaggggcctc ggcacggaaa
gcgaccacct gggagggcgt 660gtggggacca ggttttgcct ttagttttgc
acacactgta gttcatcttt atggagatgc 720tcatggcctc attgaagccc
cacggatctg ggcaggaaga gggcctattt cccatgattc 780cttcatattt
gcatatacga tacaaggctg ttagagagat aattagaatt aatttgactg
840taaacacaaa gatattagta caaaatacgt gacgtagaaa gtaataattt
cttgggtagt 900ttgcagtttt aaaattatgt tttaaaatgg actatcatat
ggttaccgta aggaaaacaa 960atgatttcga tttcttggct ttatatatct
tgtggaaagg acgaggatcc gcagtggttc 1020gtagggcttt ccccaagaga
gggaaagccc tacgaaccac tgtttttcta gagaattgta 1080cagctctggt
agcggtaacc atgcgtattt gacacacgaa ggaactaggg aaaaggcatt
1140aggtcatttc aagccgaaat tcacatgtgc tagaatccag attccatgct
gaccgatgcc 1200ccaggatata gaaaatgaga atctggtcct taccttcaag
aacattctta accgtaatca 1260gcctctggta tcttagctcc accctcactg
gttttttctt gtttgttgaa ccggccaagc 1320tgctggcctc cctcctcaac
cgttctgatc atgcttgcta aaatagtcaa aaccccggcc 1380agttaaatat
gctttagcct gctttattat gattattttt gttgttttgg caatgacctg
1440gctacctgtt gtttctccca ctaaaacttt ttaagggcag ggaattgatc
tagaaaaaaa 1500aaagctagtg gtaccggtcc tacgcggggc cctttaccca
gggtgccccg ggcgctcatt 1560tgcatgtccc acccaacagg taaacctgac
aggtcatcgc ggccaggtac gacctcggtc 1620agagcaccaa acatacgagc
cttgtgatga gttccgttgc atgaaattct cccaaaggct 1680ccaagatgga
caggaaaggg cgcggttcgg
tcaccgtaag gaaaacaaat gaaaagactc 1740ccgtgcctta taaggcctgt
gggtgacttc ttctcaacgg atccgcgtcc cgtcggcgct 1800gaatcctgtg
cttggattca gcgccgacgg gacgtttttt ctagagaatt c
185110720DNAArtificial sequenceForward primer sequence for HBsAg
107atgttgcccg tttgtcctct 2010820DNAArtificial sequenceReverse
primer sequence for HBsAg 108ccgtccgaag gtttggtaca
2010920DNAArtificial sequenceForward primer sequence for HBxAg
109cgtcctttgt ttacgtcccg 2011020DNAArtificial sequenceReverse
primer sequence for HBxAg 110agtccgcgta aagagaggtg
2011120DNAArtificial sequenceForward primer sequence for HBcAg
111ccaccaaatg cccctatcct 2011220DNAArtificial sequenceReverse
primer sequence for HBcAg 112attgagacct tcgtctgcga
2011320DNAArtificial sequenceForward primer sequence for GAPDH
113acaccatggg gaaggtgaag 2011418DNAArtificial sequenceReverse
primer sequence for GAPDH 114gtgaccaggc gcccaata
18115100DNAArtificial sequenceSequence for U6-9cont 115cgtcggtacc
acaagcaaga gtcggcagta agaagatggc gtatatatta tgaaaggtac 60cgagattggc
cattcggagt gtttagtcga ccaaactgat 10011621DNAArtificial
sequencePrimer sequence for shRNA15 116acaaacgggc aacatacctt g
2111722DNAArtificial sequencePrimer sequence for shRNA37
117gggaaagccc tacgaaccac tg 2211821DNAArtificial sequencePrimer
sequence for shRNA28 118ggattcagcg ccgacgggac g
2111921DNAArtificial sequencePrimer sequence for shRNA14
119ttcttcttct aggggacctg c 2112021RNAArtificial sequenceGuide RNA
sequence for shRNA15 120acaaacgggc aacauaccuu g
2112122RNAArtificial sequenceGuide RNA sequence for shRNA37
121gggaaagccc uacgaaccac ug 2212221RNAArtificial sequenceGuide RNA
sequence for shRNA28 122ggauucagcg ccgacgggac g
2112321RNAArtificial sequenceGuide RNA sequence for shRNA14
123uucuucuucu aggggaccug c 2112421DNAArtificial sequenceForward
primer for real time PCR 124cacatcagga ttcctaggac c
2112520DNAArtificial sequenceReverse primer for real time PCR
125aggttggtga gtgattggag 2012626DNAArtificial sequenceTaqMan probe
for real time PCR 126cagagtctag actcgtggtg gacttc
2612719DNAArtificial sequenceForward primer for real time PCR
127ctccccgtct gtgccttct 1912818DNAArtificial sequenceReverse primer
for real time PCR 128gccccaaagc cacccaag 1812927DNAArtificial
sequenceTaqMan probe for real time PCR 129cgtcgcatgg araccaccgt
gaacgcc 27
* * * * *