U.S. patent application number 17/175245 was filed with the patent office on 2021-06-10 for method for modifying genome sequence to introduce specific mutation to targeted dna sequence by base-removal reaction, and molecular complex used therein.
This patent application is currently assigned to National University Corporation Kobe University. The applicant listed for this patent is National University Corporation Kobe University. Invention is credited to Akihiko KONDO, Keiji NISHIDA.
Application Number | 20210171935 17/175245 |
Document ID | / |
Family ID | 1000005405935 |
Filed Date | 2021-06-10 |
United States Patent
Application |
20210171935 |
Kind Code |
A1 |
NISHIDA; Keiji ; et
al. |
June 10, 2021 |
METHOD FOR MODIFYING GENOME SEQUENCE TO INTRODUCE SPECIFIC MUTATION
TO TARGETED DNA SEQUENCE BY BASE-REMOVAL REACTION, AND MOLECULAR
COMPLEX USED THEREIN
Abstract
The present invention provides a method of modifying a targeted
site of a double stranded DNA, including a step of contacting a
complex wherein a nucleic acid sequence-recognizing module that
specifically binds to a target nucleotide sequence in a selected
double stranded DNA and DNA glycosylase with sufficiently low
reactivity with a DNA having an unrelaxed double helix structure
(unrelaxed DNA) are bonded, with the double stranded DNA, to
convert one or more nucleotides in the targeted site to other one
or more nucleotides or delete one or more nucleotides, or insert
one or more nucleotides into the targeted site, without cleaving at
least one strand of the double stranded DNA in the targeted
site.
Inventors: |
NISHIDA; Keiji; (Kobe,
JP) ; KONDO; Akihiko; (Kobe, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
National University Corporation Kobe University |
Kobe |
|
JP |
|
|
Assignee: |
National University Corporation
Kobe University
Kobe
JP
|
Family ID: |
1000005405935 |
Appl. No.: |
17/175245 |
Filed: |
February 12, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15523939 |
May 2, 2017 |
10920215 |
|
|
PCT/JP2015/080958 |
Nov 2, 2015 |
|
|
|
17175245 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/1024 20130101;
C07K 19/00 20130101; C12N 15/11 20130101; C12N 2310/20 20170501;
C12N 9/24 20130101; C12N 9/2497 20130101; C12N 15/09 20130101; C12Y
302/02027 20130101; C12N 9/22 20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10; C07K 19/00 20060101 C07K019/00; C12N 9/24 20060101
C12N009/24; C12N 15/09 20060101 C12N015/09; C12N 9/22 20060101
C12N009/22; C12N 15/11 20060101 C12N015/11 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 4, 2014 |
JP |
2014-224745 |
Claims
1. A method of modifying a targeted site of a double stranded DNA
in a cell, comprising a step of contacting a complex wherein a
nucleic acid sequence-recognizing module that specifically binds to
a target nucleotide sequence in a given double stranded DNA and DNA
glycosylase with sufficiently low reactivity with a DNA having an
unrelaxed double helix structure (unrelaxed DNA) are bonded, with
said double stranded DNA, to convert one or more nucleotides in the
targeted site to other one or more nucleotides or delete one or
more nucleotides, or insert one or more nucleotides into said
targeted site, without cleaving at least one strand of said double
stranded DNA in the targeted site.
2. The method according to claim 1, wherein the nucleic acid
sequence-recognizing module is selected from the group consisting
of a CRISPR-Cas system wherein at least one DNA cleavage ability of
Cas is inactivated, a zinc finger motif, a TAL effector and a PPR
motif.
3. The method according to claim 1, wherein the nucleic acid
sequence-recognizing module is a CRISPR-Cas system wherein at least
one DNA cleavage ability of Cas is inactivated.
4. The method according to claim 1, wherein the double stranded DNA
is further contacted with a factor that changes a DNA double
stranded structure.
5. The method according to claim 1, which uses two or more kinds of
nucleic acid sequence-recognizing modules each specifically binding
to a different target nucleotide sequence.
6. The method according to claim 5, wherein the different target
nucleotide sequences are present in different genes.
7. The method according to claim 1, wherein the DNA glycosylase has
cytosine-DNA glycosylase (CDG) activity or thymine-DNA glycosylase
(TDG) activity.
8. The method according to claim 7, wherein the DNA glycosylase
having CDG activity or TDG activity is a mutant of uracil-DNA
glycosylase (UDG).
9. The method according to claim 1, further comprising contacting
the double stranded DNA with an AP endonuclease having binding
capacity to an abasic site but lacking nuclease activity.
10. The method according to claim 1, wherein the DNA glycosylase
has natively low reactivity with a DNA having an unrelaxed double
helix structure.
11. The method according to claim 10, wherein the DNA glycosylase
is a mutant of UDG derived from a virus belonging to Poxviridae and
having CDG activity or TDG activity.
12. The method according to claim 11, wherein the double stranded
DNA is further contacted with A20 protein.
13. The method according to claim 1, wherein the DNA glycosylase is
a mutant having reduced reactivity with a DNA having an unrelaxed
double helix structure (unrelaxed DNA) as compared to a wild-type
one.
14. The method according to claim 1, wherein the DNA glycosylase,
and an element of the nucleic acid sequence-recognizing module
which is directly bonded to the DNA glycosylase are respectively
split into two fragments, the fragments of either of the DNA
glycosylase and the element are respectively linked to the
fragments of the other to provide two partial complexes, and when
the partial complexes are refolded with each other, the nucleic
acid sequence-recognizing module is capable of specifically binding
to the target nucleotide sequence and the specific bond enables the
DNA glycosylase to exhibit enzyme activity.
15. The method according to claim 14, wherein the element of the
nucleic acid sequence-recognizing module which is directly bonded
to the DNA glycosylase is a Cas protein wherein at least one of the
DNA cleavage abilities is inactivated.
16. The method according to claim 14, wherein the two partial
complexes are provided as separate molecule complexes, and are
refolded by association thereof in the cell.
17. The method according to claim 1, wherein the double stranded
DNA is contacted with the complex by introducing a nucleic acid
encoding the complex into a cell having the double stranded
DNA.
18. The method according to claim 17, wherein the cell is a
prokaryotic cell.
19. A nucleic acid-modifying enzyme complex wherein a nucleic acid
sequence-recognizing module that specifically binds to a target
nucleotide sequence in a given double stranded DNA and DNA
glycosylase with sufficiently low reactivity with a DNA having an
unrelaxed double helix structure (unrelaxed DNA) are bonded, which
converts one or more nucleotides in the targeted site to other one
or more nucleotides or deletes one or more nucleotides, or inserts
one or more nucleotides into said targeted site, without cleaving
at least one strand of said double stranded DNA in the targeted
site.
20. A nucleic acid encoding the nucleic acid-modifying enzyme
complex according to claim 19.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application is a continuation of copending U.S.
patent application Ser. No. 15/523,939, filed on May 2, 2017, which
is the U.S. national phase of International Patent Application No.
PCT/JP2015/080958, filed on Nov. 2, 2015, which claims the benefit
of Japanese Patent Application No. 2014-224745, filed on Nov. 4,
2014, which are incorporated by reference in their entireties
herein.
INCORPORATION-BY-REFERENCE OF MATERIAL ELECTRONICALLY SUBMITTED
[0002] Incorporated by reference in its entirety herein is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: 49,254 bytes ASCII
(Text) file named "752116SequenceListing.txt," created Feb. 11,
2021.
TECHNICAL FIELD
[0003] The present invention relates to a modification method of a
genome sequence, which enables modification of a nucleic acid base
in a particular region of a genome, without cleaving double
stranded DNA (no cleavage or single strand cleavage), or inserting
a foreign DNA fragment, but utilizing a base excision reaction, and
a complex of a nucleic acid sequence-recognizing module and DNA
glycosylase to be used therefor.
BACKGROUND ART
[0004] In recent years, genome editing is attracting attention as a
technique for modifying the object gene and genome region in
various species. Conventionally, as a method of genome editing, a
method utilizing an artificial nuclease comprising a molecule
having a sequence-independent DNA cleavage ability and a molecule
having a sequence recognition ability in combination has been
proposed (non-patent document 1).
[0005] For example, a method of performing recombination at a
target gene locus in DNA in a plant cell or insect cell as a host,
by using a zinc finger nuclease (ZFN) wherein a zinc finger DNA
binding domain and a non-specific DNA cleavage domain are linked
(patent document 1), a method of cleaving or modifying a target
gene in a particular nucleotide sequence or a site adjacent thereto
by using TALEN wherein a transcription activator-like (TAL)
effector which is a DNA binding module that the plant pathogenic
bacteria Xanthomonas has, and a DNA endonuclease are linked (patent
document 2), a method utilizing CRISPR-Cas9 system wherein DNA
sequence CRISPR (Clustered Regularly interspaced short palindromic
repeats) that functions in an acquired immune system possessed by
eubacterium and archaebacterium, and nuclease Cas
(CRISPR-associated) protein family having an important function
along with CRISPR are combined (patent document 3) and the like
have been reported. Furthermore, a method of cleaving a target gene
in the vicinity of a particular sequence, by using artificial
nuclease wherein a PPR protein constituted to recognize a
particular nucleotide sequence by a continuation of PPR motifs each
consisting of 35 amino acids and recognizing one nucleic acid base,
and nuclease are linked (patent document 4) has also been
reported.
[0006] These genome editing techniques basically presuppose double
stranded DNA breaks (DSB). However, since they include unexpected
genome modifications, side effects such as strong cytotoxicity,
chromosomal rearrangement and the like occur, and they have common
problems of impaired reliability in gene therapy, extremely small
number of surviving cells by nucleotide modification, and
difficulty in genetic modification itself in primate ovum and
unicellular microorganisms.
[0007] On the other hand, as a method of performing nucleotide
modification without causing DSB, utilization of DNA glycosylase
has been proposed. For example, patent document 5 describes that
mutant DNA glycosylase having an activity to eliminate a thymine or
cytosine base from a single stranded or double stranded DNA (TDG
activity or CDG activity) was obtained by introducing mutation into
human uracil-DNA glycosylase (UDG) and, using the enzyme, the
efficiency of mutation induction in Escherichia coli was
improved.
[0008] Furthermore, patent document 6 and non-patent document 2
describe that targeted nucleotide modification into a genome region
having a Tet operator (TetO) DNA sequence specifically recognized
by TetR is possible by using a fusion protein of yeast
3-methyladenine-DNA glycosylase (MAG1) and Tet repressor protein
(TetR). However, MAG1 essentially removes a special DNA base that
was injured by alkylation and the like, which is mainly
3-methyladenine, and the ability to remove a base from normal
bases, particularly base pairs without a mismatch, is extremely
low. Therefore, it is difficult to observe the effect of mutation
introduction by MAG1 in normal cells, and a detectable mutation
rate has been obtained only by overexpressing MAG1 in cells with
disrupted genes of base excision repair system. In addition, when
the DNA-repair system is weakened, the mutation rate of the entire
genome also increases, which makes practicalization a far goal.
However, when a mutant UDG having CDG activity to act on a normal
cytosine base was used for this system instead of MAG1, the
efficiency of mutation induction did not increase (patent document
6, non-patent document 2).
DOCUMENT LIST
Patent Documents
[0009] patent document 1: JP-B-4968498 [0010] patent document 2:
National Publication of International Patent Application No.
2013-513389 [0011] patent document 3: National Publication of
International Patent Application No. 2010-519929 [0012] patent
document 4: JP-A-2013-128413 [0013] patent document 5: WO 97/25416
[0014] patent document 6: WO 2014/127287
Non-Patent Documents
[0014] [0015] non-patent document 1: Kelvin M Esvelt, Harris H Wang
(2013) Genome-scale engineering for systems and synthetic biology,
Molecular Systems Biology 9: 641 [0016] non-patent document 2:
Shwan P. Finney-Manchester, Narendra Maheshri, (2013) Harnessing
mutagenic homologous recombination for targeted mutagenesis in vivo
by TaGTEAM, Nucleic Acids Research 41(9): e99
SUMMARY OF THE INVENTION
Problems to be Solved by the Invention
[0017] An object of the present invention is to provide a novel
method of genome editing for modifying a nucleic acid base of a
particular sequence of a gene without DSB or insertion of foreign
DNA fragment, i.e., by non-cleavage of a double stranded DNA or
single strand cleavage, and a complex of a nucleic acid
sequence-recognizing module and a mutation introducing enzyme
therefor.
Means of Solving the Problems
[0018] The present inventors have already reported that they have
successfully modified, without DSB, a genome sequence by nucleic
acid base conversion in a region containing a particular DNA
sequence, by using deaminase that catalyzes a deamination reaction
and linking the enzyme and a molecule having a DNA sequence
recognition ability (WO 2015/133554). In expectation of affording a
mutation introduction tendency different from that of deaminase and
the like, the present invention is based on an idea of causing a
base excision reaction by hydrolysis of N-glycosidic bond of DNA,
and then inducing mutation introduction in a repair process of
cells. Thus, attempts have been made to use an enzyme having CDG
activity or TDG activity, which is a mutant of yeast mitochondrial
uracil-DNA glycosylase (UNG 1), as an enzyme that performs such
base excision reaction.
[0019] The present inventors assumed that one of the reasons for a
failure to improve efficiency of mutation induction by conventional
methods (e.g., patent document 6 and non-patent document 2) even by
using mutant UDG having CDG activity is that the enzyme causes base
excision everywhere in the double stranded DNA, which in turn
causes high cytotoxicity and makes it difficult to express the
enzyme protein itself. Under such hypothesis, the present inventors
modified a genome sequence by nucleic acid base conversion in a
region containing a particular DNA sequence, by introducing a
mutation that lowers an action on a DNA having an unrelaxed double
helix structure (unrelaxed (double-helical) DNA) into a mutant UDG
having CDG activity or TDG activity, and linking the mutant enzyme
and a molecule having a DNA sequence recognition ability.
[0020] To be specific, CRISPR-Cas system (CRISPR-mutant Cas) was
used. That is, a DNA encoding an RNA molecule wherein genome
specific CRISPR-RNA:crRNA (gRNA) containing a sequence
complementary to a target sequence of a gene to be modified is
linked to an RNA (trans-activating crRNA: tracrRNA) for recruiting
Cas protein was produced, a DNA wherein a DNA encoding a mutant Cas
protein (dCas) wherein cleavage ability of both strands of a double
stranded DNA is inactivated and a mutant CDG or TDG gene are linked
was produced, and these DNAs were introduced into a host yeast cell
containing a gene to be modified. As a result, mutation could be
introduced randomly within the range of several hundred nucleotides
of the object gene including the target sequence. Furthermore,
mutation could be introduced extremely efficiently by targeting
multiple regions in the object gene. That is, a host cell
introduced with DNA was seeded in a nonselective medium, and the
sequence of the object gene was examined in randomly selected
colonies. As a result, introduction of mutation was confirmed in
almost all colonies. The efficiency of mutation induction was
further improved by coexpressing mutant AP endonuclease lacking its
function as an enzyme of a base excision repair system, thereby
increasing the frequency of repair errors in an abasic site (AP
site).
[0021] It was also confirmed that a system using a heterogenous
mutant UDG also functions in yeast. Unexpectedly, UDG derived from
vaccinia virus (vvUDG) does not cause cytotoxicity even in the
absence of introduction of mutation that lowers the action on an
unrelaxed double helix structure of DNA, and mutant UDG introduced
solely with mutations that change substrate specificity rather
showed higher efficiency of mutation induction. That is, vvUDG was
suggested to be an enzyme having a natively low action on DNA
having an unrelaxed double-helix structure. This was also supported
by the fact that the mutated sites by vvUDG are concentrated in a
particular base within the target sequence (i.e., single strand
part). In addition, the activity of vvUDG could be increased by
co-expressing A20, which is known as a cofactor.
[0022] The present inventors obtained an idea of utilization of
split Cas9 system as a means to decrease non-specific mutation by
UDG, in addition to the introduction of mutation into the enzyme.
Split Cas9 is a variant of Cas9, which is designed to function only
when N-terminal fragment and C-terminal fragment split from Cas9
protein are associated with gRNA (Nat Biotechnol. 33(2): 139-142
(2015); PNAS 112(10): 2984-2989 (2015)). The present inventors
constructed a system expressing split dCas9-mutant UNG1 as one
fusion protein consisting of N-terminal fragment of
dCas9--N-terminal fragment of mutant UNG1--C-terminal fragment of
dCas9--C-terminal fragment of mutant UNG1, and a system separately
expressing N-terminal fragment of dCas9--C-terminal fragment of
mutant UNG1, and N-terminal fragment of mutant UNG1--C-terminal
fragment of dCas9, and then examined the frequency of mutation and
non-specific mutation at the target site by using a sequence in the
Can1 gene as a target, as well as cell proliferation. As a result,
in any system, the cell survival rate on a nonselective medium is
hardly different between mutant UNG1 introduced only with mutation
(N222D) that imparts CDG activity, and mutant UNG1 further
introduced with mutation (R308C) that decreases the action on an
unrelaxed double helix structure of DNA, and the cytotoxicity was
markedly reduced by utilization of the split enzyme. When split
enzyme was used, the frequency of non-specific mutation using
thialysine resistance as an index was also reduced without
depending on the presence or absence of R308 mutation. The
efficiency of mutation induction at the original target site rather
decreased, since addition of the R308C mutation also decreases the
CDG activity. It was suggested, therefore, a mutation that reduces
the action on an unrelaxed double helix structure of DNA is
preferably not added to UDG when a split enzyme is used.
[0023] The present inventor have conducted further studies based on
these findings and completed the present invention.
[0024] Therefore, the present invention is as described below.
[1] A method of modifying a targeted site of a double stranded DNA
in a cell, comprising a step of contacting a complex wherein a
nucleic acid sequence-recognizing module that specifically binds to
a target nucleotide sequence in a given double stranded DNA and DNA
glycosylase with sufficiently low reactivity with a DNA having an
unrelaxed double helix structure (unrelaxed DNA) are bonded, with
said double stranded DNA, to convert one or more nucleotides in the
targeted site to other one or more nucleotides or delete one or
more nucleotides, or insert one or more nucleotides into said
targeted site, without cleaving at least one strand of said double
stranded DNA in the targeted site. [2] The method of the
above-mentioned [1], wherein the aforementioned nucleic acid
sequence-recognizing module is selected from the group consisting
of a CRISPR-Cas system wherein at least one DNA cleavage ability of
Cas is inactivated, a zinc finger motif, a TAL effector and a PPR
motif. [3] The method of the above-mentioned [1], wherein the
aforementioned nucleic acid sequence-recognizing module is a
CRISPR-Cas system wherein at least one DNA cleavage ability of Cas
is inactivated. [4] The method of the above-mentioned [1] or [2],
wherein the double stranded DNA is further contacted with a factor
that changes a DNA double stranded structure. [5] The method of any
of the above-mentioned [1]-[4], which uses two or more kinds of
nucleic acid sequence-recognizing modules each specifically binding
to a different target nucleotide sequence. [6] The method of the
above-mentioned [5], wherein the aforementioned different target
nucleotide sequences are present in different genes. [7] The method
of any of the above-mentioned [1]-[6], wherein the aforementioned
DNA glycosylase has cytosine-DNA glycosylase (CDG) activity or
thymine-DNA glycosylase (TDG) activity. [8] The method of the
above-mentioned [7], wherein the aforementioned DNA glycosylase
having CDG activity or TDG activity is a mutant of uracil-DNA
glycosylase (UDG). [9] The method of any of the above-mentioned
[1]-[8], further comprising contacting the double stranded DNA with
an AP endonuclease having binding capacity to an abasic site but
lacking nuclease activity. [10] The method of any of the
above-mentioned [1]-[9], wherein the aforementioned DNA glycosylase
has natively low reactivity with a DNA having an unrelaxed double
helix structure. [11] The method of the above-mentioned [10],
wherein the aforementioned DNA glycosylase is a mutant of
uracil-DNA glycosylase (UDG) derived from a virus belonging to
Poxviridae and having CDG activity or TDG activity. [12] The method
of the above-mentioned [11], wherein the double stranded DNA is
further contacted with A20 protein. [13] The method of any of the
above-mentioned [1]-[9], wherein the aforementioned DNA glycosylase
is a mutant having reduced reactivity with a DNA having an
unrelaxed double helix structure (unrelaxed DNA) as compared to a
wild-type one. [14] The method of any of the above-mentioned
[1]-[9], wherein the aforementioned DNA glycosylase, and an element
of the aforementioned nucleic acid sequence-recognizing module
which is directly bonded to the DNA glycosylase are respectively
split into two fragments, the fragments of either of the DNA
glycosylase and the element are respectively linked to the
fragments of the other to provide two partial complexes, and when
the partial complexes are refolded with each other, the nucleic
acid sequence-recognizing module is capable of specifically binding
to the target nucleotide sequence and the specific bond enables the
DNA glycosylase to exhibit enzyme activity. [15] The method of the
above-mentioned [14], wherein the element of the nucleic acid
sequence-recognizing module which is directly bonded to the
aforementioned DNA glycosylase is a Cas protein wherein at least
one of the DNA cleavage abilities is inactivated. [16] The method
of the above-mentioned [14] or [15], wherein the aforementioned two
partial complexes are provided as separate molecule complexes, and
are refolded by association thereof in the cell. [17] The method of
any of the above-mentioned [1]-[16], wherein the double stranded
DNA is contacted with the complex by introducing a nucleic acid
encoding the complex into a cell having the double stranded DNA.
[18] The method of the above-mentioned [17], wherein the
aforementioned cell is a prokaryotic cell. [19] The method of the
above-mentioned [17], wherein the aforementioned cell is a
eukaryotic cell. [20] The method of the above-mentioned [17],
wherein the aforementioned cell is a microbial cell. [21] The
method of the above-mentioned [17], wherein the aforementioned cell
is a plant cell. [22] The method of the above-mentioned [17],
wherein the aforementioned cell is an insect cell. [23] The method
of the above-mentioned [17], wherein the aforementioned cell is an
animal cell. [24] The method of the above-mentioned [17], wherein
the aforementioned cell is a vertebrate cell. 25 [25] The method of
the above-mentioned [17], wherein the aforementioned cell is a
mammalian cell. [26] The method of any of the above-mentioned
[18]-[25], wherein the aforementioned cell is a polyploid cell, and
all of the targeted sites in alleles on a homologous chromosome are
modified. [27] A nucleic acid-modifying enzyme complex wherein a
nucleic acid sequence-recognizing module that specifically binds to
a target nucleotide sequence in a given double stranded DNA and DNA
glycosylase with sufficiently low reactivity with a DNA having an
unrelaxed double helix structure (unrelaxed DNA) are bonded, which
converts one or more nucleotides in the targeted site to other one
or more nucleotides or deletes one or more nucleotides, or inserts
one or more nucleotides into said targeted site, without cleaving
at least one strand of said double stranded DNA in the targeted
site. [28] A nucleic acid encoding the nucleic acid-modifying
enzyme complex of the above-mentioned [27].
Effect of the Invention
[0025] According to the genome editing technique of the present
invention, since it does not accompany insertion of a foreign DNA
or double stranded DNA breaks, the technique is superior in safety,
and has no small possibility of affording a solution to cases
causing biological or legal disputes on conventional methods as
relating to gene recombination. It is also possible to set an
appropriate range of mutation introduction up to the range of
several hundred bases including the target sequence, and the
technique can also be applied to topical evolution induction by
introduction of random mutation into a particular restricted
region, which has been almost impossible heretofore.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG. 1 is a schematic showing of the mechanism of DNA
sequence specific targeting of uracil-DNA glycosylase mutant.
[0027] FIG. 2 is a schematic showing of a mechanism of the genetic
modification method of the present invention using DNA glycosylase
and the CRISPR-Cas system.
[0028] FIG. 3 shows the results of verification, by using a budding
yeast, of the effect of the genetic modification method of the
present invention comprising a CRISPR-Cas system and mutant
uracil-DNA glycosylase derived from budding yeast (having CDG
activity and decreased reactivity with DNA having unrelaxed double
helix structure) in combination.
[0029] FIG. 4 shows the results of verification, by using a budding
yeast, of the effect of the genetic modification method of the
present invention comprising a CRISPR-Cas system and budding
yeast-derived mutant uracil-DNA glycosylase (having CDG activity or
TDG activity and decreased reactivity with DNA having unrelaxed
double helix structure) in combination.
[0030] FIG. 5 shows the analysis results of mutated sites in the
canavanine-resistant colony obtained in FIG. 4.
[0031] FIG. 6 shows the results when an expression construct
constructed such that budding yeast-derived mutant uracil-DNA
glycosylase and dCas9 are bound via SH3 domain and a binding ligand
thereof is introduced into a budding yeast together with two kinds
of gRNA.
[0032] FIG. 7 shows that the efficiency of mutation induction by
mutant UNG1 ("Ung" in Figure means UNG1 derived from yeast,
hereinafter the same) is improved by coexpression of AP
endonuclease (Ape1) mutants (E96Q, D210N).
[0033] FIG. 8 shows that cytotoxicity in a host yeast introduced
with mutant UNG1 having CDG activity (N222D) or TDG activity
(Y164A) can be avoided by introducing a mutation (L304A) that
decreases reactivity with a DNA having an unrelaxed double helix
structure.
[0034] FIG. 9 shows survival rate and efficiency of mutation
induction in a yeast introduced with a heterogenous mutant
uracil-DNA glycosylase derived from Escherichia coli or vaccinia
virus (EcUDG or vvUDG). vvUDG did not cause cytotoxicity in a host
yeast even without introduction of a mutation (R187C) that
decreases reactivity with a DNA having an unrelaxed double helix
structure. The efficiency of mutation induction by vvUDG was
remarkably improved by coexpression of A20 protein.
[0035] FIG. 10 shows comparison of mutation introduction sites
between mutant UNG1 derived from yeast and mutant UDG derived from
vaccinia virus (vvUDG) in the target nucleotide sequences and in
the vicinity thereof.
[0036] FIG. 11 shows that non-specific mutation by mutant UNG1 can
be reduced by utilizing a split enzyme.
DESCRIPTION OF EMBODIMENTS
[0037] The present invention provides a method of modifying a
nucleotide of a targeted site of a double stranded DNA by utilizing
an error in base excision repair (BER) of cells, by excising a base
from a nucleotide in a single strand region or in a region in which
the double helix structure is relaxed in the target nucleotide
sequence of the double stranded DNA and in the vicinity thereof,
without cleaving at least one strand of the double stranded DNA to
be modified. The method is characterized in that it contains a step
of contacting a complex wherein the nucleic acid
sequence-recognizing module that specifically binds to the target
nucleotide sequence in the double stranded DNA, and DNA glycosylase
with sufficiently low reactivity with a DNA having an unrelaxed
double helix structure are bonded with the double stranded DNA to
convert the targeted site, i.e., the target nucleotide sequence and
nucleotides in the vicinity thereof, to other nucleotides or delete
same, or insert one or more nucleotides into the targeted site.
[0038] In the present invention, the "modification" of a double
stranded DNA means that a nucleotide (e.g., dC) on a DNA strand is
converted to other nucleotide (e.g., dT, dA or dG), or deleted, or
a nucleotide or a nucleotide sequence is inserted between certain
nucleotides on a DNA strand. While the double stranded DNA to be
modified is not particularly limited, it is preferably a genomic
DNA. The "targeted site" of a double stranded DNA means the whole
or partial "target nucleotide sequence", which a nucleic acid
sequence-recognizing module specifically recognizes and binds to,
or the vicinity of the target nucleotide sequence (one or both of
5' upstream and 3' downstream), and the range thereof can be
appropriately adjusted between 1 base and several hundred bases
according to the object.
[0039] In the present invention, the "nucleic acid
sequence-recognizing module" means a molecule or molecule complex
having an ability to specifically recognize and bind to a
particular nucleotide sequence (i.e., target nucleotide sequence)
on a DNA strand. Binding of the nucleic acid sequence-recognizing
module to a target nucleotide sequence enables a DNA glycosylase
linked to the module to specifically act on a targeted site of a
double stranded DNA.
[0040] In the present invention "DNA glycosylase" means an enzyme
that hydrolyzes N-glycosidic bond of DNA. DNA glycosylase
originally plays a role of eliminating injured bases from DNA in
BER. In the present invention, DNA glycosylase capable of acting on
normal bases (i.e., dC, dT, dA and dG, or those after epigenetic
modification) in DNA is preferable. A mutant DNA glycosylase which
natively does not react with a normal base or has low reactivity
but which acquired reactivity or has improved reactivity with a
normal base by mutation is encompassed in the DNA glycosylase in
the present invention and can be preferably used. An abasic site
(apurinic/apyrimidic (AP) site) resulting from the base excision
reaction by the enzyme is treated with an enzyme at the downstream
of the BER pathway, such as AP endonuclease, DNA polymerase, DNA
ligase and the like.
[0041] With "sufficiently low reactivity with a DNA having an
unrelaxed double helix structure" means that a base excision
reaction in a region where a DNA having an unrelaxed double helix
structure is formed is performed only at a frequency sufficient to
suppress cytotoxicity to a level uninfluential on the survival of
the cells. As used herein, a "DNA having an unrelaxed double helix
structure" refers to having formed a firm double helix structure
(namely, unrelaxed double-helical DNA (or simply unrelaxed DNA)),
and does not include the state of single strand DNA from completely
dissociated pairing bases, and the state of double strands in an
unwound and relaxed double helix structure forming base pairs
(relaxed double-stranded DNA). Examples of the DNA glycosylase with
sufficiently low reactivity with a DNA having an unrelaxed double
helix structure include DNA glycosylase with natively sufficiently
low reactivity with a DNA having an unrelaxed double helix
structure, mutant DNA glycosylase introduced with a mutation to
decrease reactivity with a DNA having an unrelaxed double helix
structure as compared to wild-type and the like. Furthermore, DNA
glycosylase which is a split enzyme designed to be split into two
fragments, wherein respective fragments are bonded to either one of
the nucleic acid sequence-recognizing module split into two to form
two complexes, when the both complexes are refolded, the nucleic
acid sequence-recognizing module can be specifically bonded to the
target nucleotide sequence, and, due to the specific bond, the DNA
glycosylase can catalize the base excision reaction is also
encompassed in the "DNA glycosylase with sufficiently low
reactivity with a DNA having an unrelaxed double helix structure"
in the present invention.
[0042] In the present invention, the "nucleic acid-modifying enzyme
complex" means a molecule complex comprising a complex wherein the
above-mentioned nucleic acid sequence-recognizing module and a DNA
glycosylase with sufficiently low reactivity with a DNA having an
unrelaxed double helix structure are linked, which molecule complex
is imparted with a particular nucleotide sequence recognition
ability, and an activity to catalyze a base excision reaction of
nucleic acid. The "complex" here encompasses not only one
constituted of multiple molecules, but also one having a nucleic
acid sequence-recognizing module and DNA glycosylase in a single
molecule, like a fusion protein. In addition, the "nucleic
acid-modifying enzyme complex" in the present invention also
encompasses a molecule complex in which nucleic acid
sequence-recognizing module split into two fragments and either
fragments of DNA glycosylase split into two fragments are linked to
each other to form two "partial complexes", and the molecule
complex acquires a nucleotide sequence recognition ability and a
base excision reaction catalyst activity when the partial complexes
are refolded with each other.
[0043] While DNA glycosylase to be used in the present invention is
not particularly limited as long as it can hydrolyze N-glycosidic
bond of DNA to catalyze a reaction for releasing a base, DNA
glycosylase capable of acting on normal bases (i.e., dC, dT, dA and
dG, or those after epigenetic modification, for example,
5-methylcytosine etc.) in DNA is preferable to increase versatility
as a genome editing technique. Examples of such enzyme include an
enzyme having CDG activity to catalyze a reaction for releasing
cytosine, an enzyme having TDG activity to catalyze a reaction for
releasing thymine, an enzyme having activity to catalyze a reaction
for releasing 5-methylcytosine (5-mCDG activity) and the like.
While DNA glycosylase natively having CDG activity has not been
reported to date, in almost all species, a mutant UDG having CDG
activity or TDG activity that recognizes cytidine or thymidine as a
substrate can be obtained by introducing a mutation into a
particular amino acid residue of UNG known as the major UDG
responsible for the removal of uracil incorporated in DNA (in the
case of eucaryote, it has two splice variants of mitochondrial
localization UNG1 and nuclear localization UNG2, which have a
common amino acid sequence except N-terminal sequence containing
each oraganelle localization signal) (see FIG. 1, upper panel).
More specifically, for example, in the case of UNG1 derived from
yeast (SEQ ID NO: 2; GenBank accession No. NP_013691), CDG activity
can be imparted by substituting the 222nd asparagine from the
N-terminal with aspartic acid (the mutant is also referred to as
N222D), and TDG activity can be imparted by substituting the 164th
tyrosine with alanine (the mutant is also referred to as Y164A)
(Kavli B. et al., EMBO J. (1996) 15(13): 3442-7). The present
inventors have newly found that TDG activity higher than that of
Y164A mutant can be imparted by substituting the 164th tyrosine
with glycine (the mutant is also referred to as Y164G).
Furthermore, since cytosine is obtained by substituting the
carbonyl group at the 4-position of uracil with an amino group and
thymine is equivalent to uracil in which the 5-position is
methylated, DNA glycosylase having an activity to release
5-methylcytosine, derived from methylation of the 5-position of
cytosine, from DNA (5-mCDG activity) can be obtained by introducing
double mutation into the 222nd asparagine residue and the 164th
tyrosine residue (e.g., N222D/Y164A or N222D/Y164G). Since base
excision of 5-methylcytosine can change the methylation state of
the genomic DNA, the genome editing technique of the present
invention also enables epigenome editing to change epigenetic
modification.
[0044] When UNG2 is used, mutant UNG having CDG activity, TDG
activity or 5-mCDG activity can be obtained by introducing similar
mutation into the amino acid residue corresponding to the
above-mentioned mutated site.
[0045] In the mutant UNG, the above-mentioned site may be
substituted with an amino acid other than the above-mentioned amino
acid, or the mutation may be introduced into a site other than the
above-mentioned site, as long as it can act on a normal base.
Whether the mutant UNG can act on a normal base can be confirmed by
the method described in, for example, Kavli B. et al., EMBO J.
(1996) 15(13): 3442-7.
[0046] While the derivation of UNG is not particularly limited, for
example, ung derived Escherichia coli (Varshney, U. et al. (1988)
J. Biol. Chem., 263, 7776-7784), UNG1 or UNG2 derived from yeast,
mammal (e.g., human, mouse, swine, bovine, horse, monkey etc.) and
the like, or UDG derived from virus (e.g., Poxviridae (vaccinia
virus etc.), Herpesviridae and the like) can be used. For example,
UniprotKB Nos. P13051-2 and P13051-1 can be referred to for the
amino acid sequences of human UNG1 and UNG2, respectively. In
addition, UniprotKB No. P12295 can be referred to for the amino
acid sequence of Escherichia coli (K-12 strain) ung, and UniprotKB
No. P20536 can be referred to for the amino acid sequence of
vaccinia virus (Copenhagen Strain) UDG. The amino acid sequence of
UNG is highly preserved among species, and the corresponding site
for mutation can be identified by aligning the amino acid sequence
of UNG1 or UNG2 derived from a desired organism with that of the
above-mentioned yeast UNG1. For example, in the case of human UNG1,
the amino acid corresponding to N222 of yeast UNG1 is the 204th
asparagine (N204), and the amino acid corresponding to Y164 is the
147th tyrosine (Y147). In the case of Escherichia coli ung, the
amino acid corresponding to N222 of yeast UNG1 is the 123rd
asparagine (N123), and the amino acid corresponding to Y164 is the
66th tyrosine (Y66).
[0047] In the case of UDG derived from Poxviridae virus such as
vaccinia virus, smallpoxvirus, monkeypoxvirus, fowlpox virus,
swinepox virus, rabbit fibroma virus, the amino acid corresponding
to N222 of yeast UNG1 is the 120th asparagine (N120), and the amino
acid corresponding to Y164 is the 70th tyrosine (Y70).
[0048] While UNG can remove uracil from single stranded DNA and
double stranded DNA, it has higher affinity for single stranded
DNA. This tendency is also found in the above-mentioned mutant UNG
conferred with CDG activity and TDG activity. However, since
cytosine and thymine exist everywhere in the genomic DNA, mutant
UNG having CDG activity or TDG activity acts, unlike wild-type UNG
that exclusively uses, as a substrate, uracil which is rarely
introduced into genomic DNA by an error on replication or
deamination of cytosine, on any site in the nucleotide sequence
targeted by a nucleic acid sequence-recognizing module and double
stranded DNA in the vicinity thereof to remove cytosine or thymine,
thus causing strong cytotoxicity. Therefore, DNA glycosylase to be
used in the present invention is required to show sufficiently low
reactivity with a DNA having an unrelaxed double helix structure.
When mutant UNG is used as DNA glycosylase, the cytotoxicity by the
enzyme can be avoided by further introducing a mutation that
decreases reactivity with a DNA having an unrelaxed double helix
structure to make a base excision reaction by mutant UNG having CDG
activity or TDG activity more selective to the region of a relaxed
double-stranded or single stranded DNA (see FIG. 1, middle panel).
Specifically, for example, in the case of UNG, a mutation that
decreases the reactivity with U-A 25 mer double stranded DNA to not
more than 1/20, more preferably not more than 1/50, further
preferably not more than 1/100, in vitro, that of the wild-type can
be mentioned. However, as long as the reactivity with a DNA having
an unrelaxed double helix structure is decreased to a level free
from lethal cytotoxicity in vivo, it is not limited by the
reactivity in vitro. Whether the DNA glycosylase to be used has
"sufficiently low reactivity with a DNA having an unrelaxed double
helix structure" can be confirmed, for example, by inserting the
DNA glycosylase into the construct described in FIG. 2, introducing
the construct together with the guide RNA into the object cell by
the method described in Example 1, culturing the obtained
transformant, and verifying the survivability thereof.
Alternatively, a candidate of DNA glycosylase with "sufficiently
low reactivity with a DNA having an unrelaxed double helix
structure" can also be screened for by evaluating, as one of the
criteria, the reactivity with a double stranded DNA oligomer in
vitro by the method described in Chen, C. Y. et al. DNA Repair
(Amst) (2005) 4(7): 793-805.
[0049] As a DNA glycosylase fulfilling the above-mentioned
conditions in the case of, for example, UNG1 derived from yeast
(SEQ ID NO: 2), a mutant in which the 304th leucine from the
N-terminal is substituted with alanine can be mentioned (the mutant
is also referred to as L304A) (Slupphaug, G. et al. Nature (1996)
384(6604): 87-92). Alternatively, a mutant in which the 308th
arginine is substituted with glutamic acid or cysteine (the mutants
are also referred to as R308E, R308C, respectively) also shows
remarkably decreased reactivity with a DNA having an unrelaxed
double helix structure (Chen, C. Y. et al. DNA Repair (Amst) (2005)
4(7): 793-805). When a different species derived from UNG is used,
the corresponding site for mutation can be identified by aligning
the amino acid sequence of UNG1 or UNG2 derived from a desired
organism with that of the above-mentioned yeast UNG1. For example,
in the case of human UNG1, the amino acid corresponding to L304 of
yeast UNG1 is the 272nd leucine (L272), and the amino acid
corresponding to R308 is the 276th arginine (R276). In the case of
Escherichia coli ung, the amino acid corresponding to L304 of yeast
UNG1 is the 191st leucine (L191), and the amino acid corresponding
to R308 is the 195th arginine (R195). In the case of vaccinia virus
UDG, the amino acid corresponding to R308 of yeast UNG1 is the
187th arginine (R187).
[0050] The substrate specificity of UNG1(ung) to yeast
(Saccharomyces cerevisiae), Escherichia coli, human and Poxviridae
virus, and the site of mutation that changes the reactivity with a
DNA having an unrelaxed double helix structure are shown in Table
1. Mutant amino acid is indicated with one letter, and the number
shows the position of mutant amino acid when N-terminal amino acid
is 1.
TABLE-US-00001 TABLE 1 Escherichia pox change of mutant form and
yeast coli human virus phenotype Y164 Y66 Y147 Y70 recognizes
thymine by mutation to A, G N222 N123 N204 N120 recognizes cytosine
by mutation to D L304 L191 L272 -- reactivity with DNA having
unrelaxed double helix structure decreases by mutation to A R308
R195 R276 R187.sup.a) reactivity with DNA having unrelaxed double
helix structure decreases by mutation to E, C .sup.a)In vaccinia
virus UDG etc., wild-type itself is considered to have natively low
reactivity with DNA having unrelaxed double helix structure.
[0051] From the above, preferable examples of the "DNA glycosylase
with sufficiently low reactivity with a DNA having an unrelaxed
double helix structure" to be used in the present invention include
N222D/L304A double mutant, N222D/R308E double mutant, N222D/R308C
double mutant, Y164A/L304A double mutant, Y164A/R308E double
mutant, Y164A/R308C double mutant, Y164G/L304A double mutant,
Y164G/R308E double mutant, Y164G/R308C double mutant,
N222D/Y164A/L304A triple mutant, N222D/Y164A/R308E triple mutant,
N222D/Y164A/R308C triple mutant, N222D/Y164G/L304A triple mutant,
N222D/Y164G/R308E triple mutant, N222D/Y164G/R308C triple mutant
and the like of yeast UNG1. When different UNG is used instead of
yeast UNG1, a mutant having an amino acid corresponding to each of
the above-mentioned mutants, which is introduced with a similar
mutation, may be used.
[0052] Alternatively, as a "DNA glycosylase with sufficiently low
reactivity with a DNA having an unrelaxed double helix structure",
DNA glycosylase with natively low reactivity with a DNA having an
unrelaxed double helix structure, and high selectivity to relaxed
double stranded or single stranded DNA can also be used. Examples
of such DNA glycosylase include SMUG1 having UDG activity (Single
strand-selective Monofunctional Uracil-DNA Glycosylase). While a
mutation conferring CDG activity or TDG activity to SMUG1 is not
known, it has been reported that the SMUG1 is important for removal
of uracil resulting from deamination of cytosine (Nilsen, H. et al.
EMBO J. (2001) 20: 4278-4286). The present inventors have already
developed a method for specifically introducing a mutation into the
targeted nucleotide sequence and the vicinity thereof, by combining
cytidine deaminase capable of converting cytosine to uracil, and a
nucleic acid sequence-recognizing module similar to that in the
present invention (WO 2015/133554). By combining with the
technique, cytosine can be artificially converted to uracil in the
targeted site in genomic DNA, after which SMUG1 can be further
reacted to release the uracil from DNA. While the derivation of
SMUG1 is not particularly limited, for example, SMUG1 derived from
Escherichia coli, yeast, mammal (e.g., human, mouse, swine, bovine,
horse, monkey etc.) and the like can be used. For example,
UniprotKB No. Q53HC7-1 and Q53HV7-2 can be referred to for the two
amino acid sequences of the two isoforms of human SMUG1. In
addition, while the derivation of cytidine deaminase is not
particularly limited, for example, Petromyzon marinus-derived
PmCDA1 (Petromyzon marinus cytosine deaminase 1), or AID
(Activation-induced cytidine deaminase; AICDA) derived from mammal
(e.g., human, swine, bovine, horse, monkey etc.) can be used. For
example, GenBank accession No. EF094822 and ABO15149 can be
referred to for the base sequence and the amino acid sequence of
PmCDA1 cDNA, and GenBank accession No. NM_020661 and NP_065712 can
be referred to for the base sequence and the amino acid sequence of
human AID cDNA.
[0053] In another preferable embodiment, as the DNA glycosylase
with natively low reactivity with a DNA having an unrelaxed double
helix structure, UDG derived from virus belonging to Poxviridae
such as vaccinia virus and the like can be mentioned. As shown in
the below-mentioned Examples, vaccinia virus-derived UDG (vvUDG) is
considered to be sufficiently low in the reactivity with a DNA
having an unrelaxed double helix structure to a level free from
toxicity in a host cell, because it shows growth equivalent to that
in yeast UNG1 and Escherichia coli ung, introduced with a mutation
that decreases reactivity with a DNA having an unrelaxed double
helix structure (e.g., R187C), on a nonselective medium, even when
such mutation is not introduced. When UDG derived from Poxviridae
virus such as vvUDG and the like is used as a DNA glycosylase, a
mutation (e.g., R187C) corresponding to the mutation that decreases
reactivity with a DNA having an unrelaxed double helix structure in
yeast UNG1 can be further introduced. However, when such mutation
decreases the CDG activity (N120D) and TDG activity (Y70A, Y70G) of
UDG, it is desirably avoided. From the above, preferable examples
of UDG derived from Poxviridae virus such as vvUDG to be used in
the present invention include N120D mutant, Y70G or Y70A mutant,
N120D/Y70G double mutant or N120D/Y70A double mutant and the
like.
[0054] When UDG derived from Poxviridae virus such as mutant vvUDG
and the like is used as the DNA glycosylase, it is preferable to
contact A20 protein, which interacts with UDG to form a heterodimer
that functions as a processivity factor of viral DNA polymerase,
with double stranded DNA together with UDG. Since combined use with
A20 protein increases CDG activity or TDG activity of mutant UDG,
for example, the efficiency of mutation induction into thymine, of
mutant vvUDG having low TDG activity (Y70G) as compared to CDG
activity (N120D) can be improved by the combined use with A20
protein. While the derivation of A20 is not particularly limited,
for example, A20 derived from virus belonging to Poxviridae such as
vaccinia virus, smallpoxvirus, monkeypoxvirus, fowlpox virus,
swinepox virus, rabbit fibroma virus can be used. For example,
UniprotKB No. P20995 can be referred for the amino acid sequence of
vaccinia virus (Copenhagen Strain) A20.
[0055] In yet another preferable embodiment, a split enzyme
designed such that nucleic acid sequence-recognizing module and DNA
glycosylase are each split into two fragments, either fragments are
linked to each other to form two partial complexes, these complexes
are associated to reconstitute a functional nucleic acid
sequence-recognizing module, and the module is bonded to the target
nucleotide sequence to reconstitute a functional DNA glycosylase
can be used as a DNA glycosylase having low reactivity with a DNA
having an unrelaxed double helix structure. In the split enzyme,
since the enzyme activity is exhibited only when it is bonded to
the target nucleotide sequence, even when the DNA glycosylase
itself to be reconstituted does not have a reduced reactivity with
a DNA having an unrelaxed double helix structure, it consequently
acts selectively on the single stranded DNA or relaxed double
stranded DNA part in the target nucleotide sequence and the
vicinity thereof. For example, nucleic acid sequence-recognizing
module and DNA glycosylase are each split into N-terminal side
fragments and C-terminal side fragments, for example, N-terminal
side fragments are linked to each other to give a partial complex,
C-terminal side fragments are linked to each other to give a
partial complex (or N-terminal side fragments of nucleic acid
sequence-recognizing module and C-terminal side fragments of DNA
glycosylase are linked to give a partial complex, and N-terminal
side fragments of DNA glycosylase and C-terminal side fragments of
nucleic acid sequence-recognizing module are linked to give a
partial complex), and they are associated, whereby functional
nucleic acid sequence-recognizing module and functional DNA
glycosylase can be reconstituted. The combination of the fragments
to be linked is not particularly limited as long as a complex of
the functional nucleic acid sequence-recognizing module and the
functional DNA glycosylase is reconstituted when the two partial
complexes are associated. The two partial complexes may be provided
as separate molecules, or may be provided as a single fusion
protein by linking them directly or via a suitable linker. The
split site in DNA glycosylase is not particularly limited as long
as two split fragments can be reconstituted as functional DNA
glycosylase, and DNA glycosylase may be split at one site to
provide N-terminal side fragment and C-terminal side fragment, or
not less than 3 fragments obtained by splitting at two or more
sites may be appropriately linked to give two fragments. The
three-dimensional structures of various UDG proteins are known, and
those of ordinary skill in the art can appropriately select the
split sites based on such information. For example, yeast UNG1 (SEQ
ID NO: 2) can be split between the 258th amino acid and 259th amino
acid from the N-terminal to give N-terminal side fragment (1-258)
and C-terminal side fragment (259-359).
[0056] As mentioned above, in the base excision repair (BER)
mechanism, when a base is excised by DNA glycosylase, AP
endonuclease puts a nick in the abasic site (AP site), and
exonuclease completely excises the AP site. When the AP site is
excised, DNA polymerase produces a new base by using the base of
the opposing strand as a template, and DNA ligase finally seals the
nick to complete the repair. Mutant AP endonuclease that has lost
the enzyme activity but maintains the binding capacity to the AP
site is known to competitively inhibit BER. Therefore, when the
mutant AP endonuclease is contacted with double stranded DNA
together with DNA glycosylase, the repair of the AP site by
endogenous BER mechanism in the host cell is inhibited, and the
frequency of repair errors, namely, efficiency of mutation
induction, is improved. For example, the efficiency of mutation
induction into thymine in mutant yeast UNG1 having lower TDG
activity (Y164G) as compared to CDG activity (N222D) can be
improved by using mutant AP endonuclease in combination. While the
derivation of AP endonuclease is not particularly limited, for
example, AP endonuclease derived from Escherichia coli, yeast,
mammal (e.g., human, mouse, swine, bovine, horse, monkey etc.) and
the like can be used. For example, UniprotKB No. P27695 can be
referred to for the amino acid sequence of human Ape1. Examples of
the mutant AP endonuclease that has lost the enzyme activity but
maintains the binding capacity to the AP site include proteins
having mutated activity site and mutated Mg (cofactor)-binding
site. For example, E96Q, Y171A, Y171F, Y171H, D210N, D210A, N212A
and the like can be mentioned for human Ape1.
[0057] A target nucleotide sequence in a double stranded DNA to be
recognized by the nucleic acid sequence-recognizing module in the
nucleic acid-modifying enzyme complex of the present invention is
not particularly limited as long as the module specifically binds
to, and may be any sequence in the double stranded DNA. The length
of the target nucleotide sequence only needs to be sufficient for
specific binding of the nucleic acid sequence-recognizing module.
For example, when mutation is introduced into a particular site in
the genomic DNA of a mammal, it is not less than 12 nucleotides,
preferably not less than 15 nucleotides, more preferably not less
than 17 nucleotides, according to the genome size thereof. While
the upper limit of the length is not particularly limited, it is
preferably not more than 25 nucleotides, more preferably not more
than 22 nucleotides.
[0058] As the nucleic acid sequence-recognizing module in the
nucleic acid-modifying enzyme complex of the present invention,
CRISPR-Cas system wherein at least one DNA cleavage ability of Cas
is inactivated (CRISPR-mutant Cas), zinc finger motif, TAL effector
and PPR motif and the like, as well as a fragment containing a DNA
binding domain of a protein that specifically binds to DNA, such as
restriction enzyme, transcription factor, RNA polymerase and the
like, and free of a DNA double strand cleavage ability and the like
can be used, but the module is not limited thereto. Preferably,
CRISPR-mutant Cas, zinc finger motif, TAL effector, PPR motif and
the like can be mentioned.
[0059] A zinc finger motif is constituted by linkage of 3-6
different Cys2His2 type zinc finger units (1 finger recognizes
about 3 bases), and can recognize a target nucleotide sequence of
9-18 bases. A zinc finger motif can be produced by a known method
such as Modular assembly method (Nat Biotechnol (2002) 20:
135-141), OPEN method (Mol Cell (2008) 31: 294-301), CoDA method
(Nat Methods (2011) 8: 67-69), Escherichia coli one-hybrid method
(Nat Biotechnol (2008) 26:695-701) and the like. The
above-mentioned patent document 1 can be referred to as for the
detail of the zinc finger motif production.
[0060] A TAL effector has a module repeat structure with about 34
amino acids as a unit, and the 12th and 13th amino acid residues
(called RVD) of one module determine the binding stability and base
specificity. Since each module is highly independent, TAL effector
specific to a target nucleotide sequence can be produced by simply
connecting the module. For TAL effector, a production method
utilizing an open resource (REAL method (Curr Protoc Mol Biol
(2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012)
30: 460-465), and Golden Gate method (Nucleic Acids Res (2011) 39:
e82) etc.) have been established, and a TAL effector for a target
nucleotide sequence can be designed comparatively conveniently. The
above-mentioned patent document 2 can be referred to as for the
detail of the production of TAL effector.
[0061] PPR motif is constituted such that a particular nucleotide
sequence is recognized by a continuation of PPR motifs each
consisting of 35 amino acids and recognizing one nucleic acid base,
and recognizes a target base only by 1, 4 and ii(-2) amino acids of
each motif. Motif constitution has no dependency, and is free of
interference of motifs on both sides. Therefore, like TAL effector,
a PPR protein specific to the target nucleotide sequence can be
produced by simply connecting PPR motifs. The above-mentioned
patent document 4 can be referred to as for the detail of the
production of PPR motif.
[0062] When a fragment of restriction enzyme, transcription factor,
RNA polymerase and the like is used, since the DNA binding domains
of these proteins are well known, a fragment containing the domain
and free of a DNA double strand cleavage ability can be easily
designed and constructed.
[0063] As mentioned above, DNA glycosylase used for the nucleic
acid-modifying enzyme complex of the present invention is
preferably mutant UDG conferred with CDG activity or TDG activity,
more preferably UNG, and it needs to be sufficiently low in the
reactivity with a DNA having an unrelaxed double helix structure so
that CDG activity or TDG activity will not act on anywhere in the
targeted site (see FIG. 1, middle panel) Therefore, the targeted
site is desirably in the state of single stranded DNA, or relaxed
DNA structure resulting from unwinding of at least firm double
helix structure, which enables the DNA glycosylase to act
efficiently when brought into contact with DNA glycosylase. When
CRISPR-Cas system is used as the nucleic acid sequence-recognizing
module, guide RNA complementary to the target nucleotide sequence
recognizes the sequence of the object double stranded DNA and
specifically forms a hybrid with the target nucleotide sequence,
whereby the targeted site becomes the state of single strand or
unwound double helix structure (relaxed double stranded) state.
Therefore, DNA glycosylase with sufficiently low reactivity with a
DNA having an unrelaxed double helix structure selectively acts on
cytosine or thymine in the targeted site and can excise the base
(see FIG. 1, lower panel). On the other hand, when zinc finger
motif, TAL effector, PPR motif and the like are used as the nucleic
acid sequence-recognizing module, since the module itself does not
have a function to change the structure of double stranded DNA
(cause distortion of double helix structure), it is desirable to
contact the nucleic acid-modifying enzyme complex of the present
invention in combination with a factor (e.g., gyrase,
topoisomerase, helicase etc.), which changes the structure of the
object double stranded DNA, with the double stranded DNA.
[0064] Any of the above-mentioned nucleic acid sequence-recognizing
module can be provided as a fusion protein with the above-mentioned
DNA glycosylase, or a protein binding domain such as SH3 domain,
PDZ domain, GK domain, GB domain and the like and a binding partner
thereof may be fused with a nucleic acid sequence-recognizing
module and a DNA glycosylase, respectively, and provided as a
protein complex via an interaction of the domain and a binding
partner thereof. Alternatively, a nucleic acid sequence-recognizing
module and a DNA glycosylase may be each fused with intein, and
they can be linked by ligation after protein synthesis.
[0065] The nucleic acid-modifying enzyme complex of the present
invention containing a complex (including fusion protein) wherein a
nucleic acid sequence-recognizing module and DNA glycosylase are
bonded is contacted with a double stranded DNA (e.g., genomic DNA)
by introducing the complex or a nucleic acid encoding the complex
into a cell having the object double stranded DNA. In consideration
of the introduction and expression efficiency, it is desirable to
introduce the nucleic acid-modifying enzyme complex into the cell
in the form of a nucleic acid encoding the complex, rather than the
complex itself, and allow for expression of the complex in the
cell. Also when mutant AP endonuclease, A20 protein and the like
are used in combination, it is desirable to introduce them into the
cell in the form of a nucleic acid encoding them, and allow for
expression of the complex in the cell.
[0066] Therefore, the nucleic acid sequence-recognizing module and
the DNA glycosylase are preferably prepared as a nucleic acid
encoding a fusion protein thereof, or in a form capable of forming
a complex in a host cell after translation into a protein by
utilizing a binding domain, intein and the like, or as a nucleic
acid encoding each of them. The nucleic acid here may be a DNA or
an RNA. When it is a DNA, it is preferably a double stranded DNA,
and provided in the form of an expression vector disposed under
regulation of a functional promoter in a host cell. When it is an
RNA, it is preferably a single stranded RNA.
[0067] When nucleic acid sequence-recognizing module and DNA
glycosylase are each split into two fragments, the fragments of
either of them are respectively linked to the fragments of the
other to provide two partial complexes, for example, a DNA encoding
the N-terminal side fragment and a DNA encoding the C-terminal side
fragment of the nucleic acid sequence-recognizing module are
respectively prepared by the PCR method using suitable primers; and
a DNA encoding the N-terminal side fragment and a DNA encoding the
C-terminal side fragment of DNA glycosylase are prepared in the
same manner and, for example, the DNAs encoding the N-terminal side
fragments, and the DNAs encoding the C-terminal side fragments are
linked to each other by a conventional method, whereby a DNA
encoding the two partial complexes can be produced. Alternatively,
a DNA encoding the N-terminal side fragment of the nucleic acid
sequence-recognizing module and a DNA encoding the C-terminal side
fragment of the DNA glycosylase are linked; and a DNA encoding the
N-terminal side fragment of the DNA glycosylase and a DNA encoding
the C-terminal side fragment of the nucleic acid
sequence-recognizing module are linked, whereby a DNA encoding the
two partial complexes can also be produced. The combination of the
fragments to be linked is not particularly limited as long as a
complex of the functional nucleic acid sequence-recognizing module
and the functional DNA glycosylase is reconstituted when the two
partial complexes are associated. The two partial complexes are not
only expressed as separate molecules, but may also be expressed as
a single fusion protein by linking nucleic acids encoding them
directly or via a suitable linker, which protein forms a complex of
the functional nucleic acid sequence-recognizing module and the
functional DNA glycosylase by intramolecular association.
[0068] Since the complex of the present invention wherein a nucleic
acid sequence-recognizing module and a DNA glycosylase are bonded
does not accompany double stranded DNA breaks (DSB), genome editing
with low toxicity is possible, and the genetic modification method
of the present invention can be applied to a wide range of
biological materials. Therefore, the cells to be introduced with
nucleic acid encoding nucleic acid sequence-recognizing module
and/or DNA glycosylase can encompass cells of any species, from
bacterium of Escherichia coli and the like which are prokaryotes,
cells of microorganism such as yeast and the like which are lower
eucaryotes, to cells of vertebrata including mammals such as human
and the like, and cells of higher eukaryote such as insect, plant
and the like.
[0069] A DNA encoding a nucleic acid sequence-recognizing module
such as zinc finger motif, TAL effector, PPR motif and the like can
be obtained by any method mentioned above for each module. A DNA
encoding a sequence-recognizing module of restriction enzyme,
transcription factor, RNA polymerase and the like can be cloned by,
for example, synthesizing an oligoDNA primer covering a region
encoding a desired part of the protein (part containing DNA binding
domain) based on the cDNA sequence information thereof, and
amplifying by the RT-PCR method using, as a template, the total RNA
or mRNA fraction prepared from the protein-producing cells.
[0070] A DNA encoding DNA glycosylase can also be cloned similarly
by synthesizing an oligoDNA primer based on the cDNA sequence
information thereof, and amplifying by the RT-PCR method using, as
a template, the total RNA or mRNA fraction prepared from the
enzyme-producing cells. For example, a DNA encoding UNG1 of yeast
can be cloned by designing suitable primers for the upstream and
downstream of CDS based on the cDNA sequence (accession No.
NM_001182379) registered in the NCBI database, and cloning from
yeast-derived mRNA by the RT-PCR method.
[0071] A nucleic acid encoding DNA glycosylase with sufficiently
low reactivity with a DNA having an unrelaxed double helix
structure can be obtained by a site specific mutagenesis method
known per se by using the obtained cDNA as a template, and
introducing a mutation imparting CDG activity, TDG activity or
5-mCDG activity, and a mutation that decreases reactivity with a
DNA having an unrelaxed double helix structure. When DNA
glycosylase with natively sufficiently low reactivity with a DNA
having an unrelaxed double helix structure, such as vvUDG and the
like, only a mutation imparting CDG activity, TDG activity or
5-mCDG activity can be introduced.
[0072] The cloned DNA may be directly, or after digestion with a
restriction enzyme when desired, or after addition of a suitable
linker (e.g., GS linker, GGGAR linker etc.), spacer (e.g., FLAG
sequence etc.) and/or a nuclear localization signal (NLS) (each
organelle localization signal when the object double stranded DNA
is mitochondria or chloroplast DNA), ligated with a DNA encoding a
nucleic acid sequence-recognizing module to prepare a DNA encoding
a fusion protein. Since UNG1 and UNG2 each have a mitochondria
localization signal and a nuclear localization signal on the
N-terminal, they may also be utilized as they are. Alternatively,
for example, when UNG1 is used for nucleotide modification
targeting nuclear genomic DNA, it is possible to remove the
mitochondria localization signal and separately link a nuclear
localization signal.
[0073] Alternatively, a DNA encoding a nucleic acid
sequence-recognizing module, and a DNA encoding a DNA glycosylase
may be each fused with a DNA encoding a binding domain or a binding
partner thereof, or both DNAs may be fused with a DNA encoding a
separation intein, whereby the nucleic acid sequence-recognizing
conversion module and the DNA glycosylase are translated in a host
cell to form a complex. In these cases, a linker and/or a nuclear
localization signal can be linked to a suitable position of one of
or both DNAs when desired.
[0074] A DNA encoding a nucleic acid sequence-recognizing module
and a DNA encoding a DNA glycosylase can be obtained by chemically
synthesizing the DNA strand, or by connecting synthesized partly
overlapping oligoDNA short strands by utilizing the PCR method and
the Gibson Assembly method to construct a DNA encoding the full
length thereof. The advantage of constructing a full-length DNA by
chemical synthesis or a combination of PCR method or Gibson
Assembly method is that the codon to be used can be designed in CDS
full-length according to the host into which the DNA is introduced.
In the expression of a heterologous DNA, the protein expression
level is expected to increase by converting the DNA sequence
thereof to a codon highly frequently used in the host organism. As
the data of codon use frequency in host to be used, for example,
the genetic code use frequency database
(www.kazusa.or.jp/codon/index.html) disclosed in the home page of
Kazusa DNA Research Institute can be used, or documents showing the
codon use frequency in each host may be referred to. By reference
to the obtained data and the DNA sequence to be introduced, codons
showing low use frequency in the host from among those used for the
DNA sequence may be converted to a codon coding the same amino acid
and showing high use frequency.
[0075] An expression vector containing a DNA encoding a nucleic
acid sequence-recognizing module and/or a DNA glycosylase can be
produced, for example, by linking the DNA to the downstream of a
promoter in a suitable expression vector.
[0076] As the expression vector, Escherichia coli-derived plasmids
(e.g., pBR322, pBR325, pUC12, pUC13); Bacillus subtilis-derived
plasmids (e.g., pUB110, pTP5, pC194); yeast-derived plasmids (e.g.,
pSH19, pSH15); insect cell expression plasmids (e.g., pFast-Bac);
animal cell expression plasmids (e.g., pA1-11, pXT1, pRc/CMV,
pRc/RSV, pcDNAI/Neo); bacteriophages such as Aphage and the like;
insect virus vectors such as baculovirus and the like (e.g., BmNPV,
AcNPV); animal virus vectors such as retrovirus, vaccinia virus,
adenovirus and the like, and the like are used.
[0077] As the promoter, any promoter appropriate for a host to be
used for gene expression can be used. In a conventional method
using DSB, since the survival rate of the host cell sometimes
decreases markedly due to the toxicity, it is desirable to increase
the number of cells by the start of the induction by using an
inductive promoter. However, since sufficient cell proliferation
can also be afforded by expressing the nucleic acid-modifying
enzyme complex of the present invention, a constitution promoter
can also be used without limitation.
[0078] For example, when the host is an animal cell, SR.alpha.
promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus)
promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney mouse
leukemia virus) LTR, HSV-TK (simple herpes virus thymidine kinase)
promoter and the like are used. Of these, CMV promoter, SR.alpha.
promoter and the like are preferable.
[0079] When the host is Escherichia coli, trp promoter, lac
promoter, recA promoter, .lamda.P.sub.L promoter, lpp promoter, T7
promoter and the like are preferable.
[0080] When the host is genus Bacillus, SPO1 promoter, SPO2
promoter, penP promoter and the like are preferable.
[0081] When the host is a yeast, Gal1/10 promoter, PHO5 promoter,
PGK promoter, GAP promoter, ADH promoter and the like are
preferable.
[0082] When the host is an insect cell, polyhedrin promoter, P10
promoter and the like are preferable.
[0083] When the host is a plant cell, CaMV35S promoter, CaMV19S
promoter, NOS promoter and the like are preferable.
[0084] As the expression vector, besides those mentioned above, one
containing enhancer, splicing signal, terminator, polyA addition
signal, a selection marker such as drug resistance gene,
auxotrophic complementary gene and the like, replication origin and
the like on demand can be used.
[0085] An RNA encoding a nucleic acid sequence-recognizing module
and/or a DNA glycosylase can be prepared by, for example,
transcription to mRNA in a vitro transcription system known per se
by using a vector encoding DNA encoding the above-mentioned nucleic
acid sequence-recognizing module and/or a DNA glycosylase as a
template.
[0086] A complex of a nucleic acid sequence-recognizing module and
a DNA glycosylase can be intracellularly expressed by introducing
an expression vector containing a DNA encoding a nucleic acid
sequence-recognizing module and/or a DNA glycosylase into a host
cell, and culturing the host cell.
[0087] As the host, genus Escherichia, genus Bacillus, yeast,
insect cell, insect, animal cell and the like are used.
[0088] As the genus Escherichia, Escherichia coli K12 DH1 [Proc.
Natl. Acad. Sci. USA, 60, 160 (1968)], Escherichia coli JM103
[Nucleic Acids Research, 9, 309 (1981)], Escherichia coli JA221
[Journal of Molecular Biology, 120, 517 (1978)], Escherichia coli
HB101 [Journal of Molecular Biology, 41, 459 (1969)], Escherichia
coli C600 [Genetics, 39, 440 (1954)] and the like are used.
[0089] As the genus Bacillus, Bacillus subtilis MI114 [Gene, 24,
255 (1983)], Bacillus subtilis 207-21 [Journal of Biochemistry, 95,
87 (1984)] and the like are used.
[0090] As the yeast, Saccharomyces cerevisiae AH22, AH22R.sup.-,
NA87-11A, DKD-5D, 20B-12, Schizosaccharomyces pombe NCYC1913,
NCYC2036, Pichia pastoris KM71 and the like are used.
[0091] As the insect cell when the virus is AcNPV, cells of cabbage
armyworm larva-derived established line (Spodoptera frugiperda
cell; Sf cell), MG1 cells derived from the mid-intestine of
Trichoplusia ni, High Five.TM. cells derived from an egg of
Trichoplusia ni, Mamestra brassicae-derived cells, Estigmena
acrea-derived cells and the like are used. When the virus is BmNPV,
cells of Bombyx mori-derived established line (Bombyx mori N cell;
BmN cell) and the like are used as insect cells. As the Sf cell,
for example, Sf9 cell (ATCC CRL1711), Sf21 cell [all above, In
Vivo, 13, 213-217 (1977)] and the like are used.
[0092] As the insect, for example, larva of Bombyx mori,
Drosophila, cricket and the like are used [Nature, 315, 592
(1985)].
[0093] As the animal cell, cell lines such as monkey COS-7 cell,
monkey Vero cell, Chinese hamster ovary (CHO) cell, dhfr
gene-deficient CHO cell, mouse L cell, mouse AtT-20 cell, mouse
myeloma cell, rat GH3 cell, human FL cell and the like, pluripotent
stem cells such as iPS cell, ES cell and the like of human and
other mammals, and primary cultured cells prepared from various
tissues are used. Furthermore, zebrafish embryo, Xenopus oocyte and
the like can also be used.
[0094] As the plant cell, suspend cultured cells, callus,
protoplast, leaf segment, root segment and the like prepared from
various plants (e.g., grain such as rice, wheat, corn and the like,
product crops such as tomato, cucumber, egg plant and the like,
garden plants such as carnation, Eustoma russellianum and the like,
experiment plants such as tobacco, Arabidopsis thaliana and the
like, and the like) are used.
[0095] All the above-mentioned host cells may be haploid
(monoploid), or polyploid (e.g., diploid, triploid, tetraploid and
the like). In the conventional mutation introduction methods,
mutation is, in principle, introduced into only one homologous
chromosome to produce a hetero gene type. Therefore, desired
phenotype is not expressed unless dominant mutation occurs, and
homozygousness inconveniently requires labor and time. In contrast,
according to the present invention, since mutation can be
introduced into any allele on the homologous chromosome in the
genome, desired phenotype can be expressed in a single generation
even in the case of recessive mutation, which is extremely useful
since the problem of the conventional method can be solved.
[0096] An expression vector can be introduced by a known method
(e.g., lysozyme method, competent method, PEG method, CaCl.sub.2
coprecipitation method, electroporation method, the microinjection
method, the particle gun method, lipofection method, Agrobacterium
method and the like) according to the kind of the host.
[0097] Escherichia coli can be transformed according to the methods
described in, for example, Proc. Natl. Acad. Sci. USA, 69, 2110
(1972), Gene, 17, 107 (1982) and the like.
[0098] The genus Bacillus can be introduced into a vector according
to the methods described in, for example, Molecular & General
Genetics, 168, 111 (1979) and the like.
[0099] A yeast can be introduced into a vector according to the
methods described in, for example, Methods in Enzymology, 194,
182-187 (1991), Proc. Natl. Acad. Sci. USA, 75, 1929 (1978) and the
like.
[0100] An insect cell and an insect can be introduced into a vector
according to the methods described in, for example, Bio/Technology,
6, 47-55 (1988) and the like.
[0101] An animal cell can be introduced into a vector according to
the methods described in, for example, Cell Engineering additional
volume 8, New Cell Engineering Experiment Protocol, 263-267 (1995)
(published by Shujunsha), and Virology, 52, 456 (1973).
[0102] A cell introduced with a vector can be cultured according to
a known method according to the kind of the host.
[0103] For example, when Escherichia coli or genus Bacillus is
cultured, a liquid medium is preferable as a medium to be used for
the culture. The medium preferably contains a carbon source,
nitrogen source, inorganic substance and the like necessary for the
growth of the transformant. Examples of the carbon source include
glucose, dextrin, soluble starch, sucrose and the like; examples of
the nitrogen source include inorganic or organic substances such as
ammonium salts, nitrate salts, corn steep liquor, peptone, casein,
meat extract, soybean cake, potato extract and the like; and
examples of the inorganic substance include calcium chloride,
sodium dihydrogen phosphate, magnesium chloride and the like. The
medium may contain yeast extract, vitamins, growth promoting factor
and the like. The pH of the medium is preferably about 5-about
8.
[0104] As a medium for culturing Escherichia coli, for example, M9
medium containing glucose, casamino acid [Journal of Experiments in
Molecular Genetics, 431-433, Cold Spring Harbor Laboratory, New
York 1972] is preferable. Where necessary, for example, agents such
as 3.beta.-indolylacrylic acid may be added to the medium to ensure
an efficient function of a promoter. Escherichia coli is cultured
at generally about 15-about 43.degree. C. Where necessary, aeration
and stirring may be performed.
[0105] The genus Bacillus is cultured at generally about 30-about
40.degree. C. Where necessary, aeration and stirring may be
performed.
[0106] Examples of the medium for culturing yeast include
Burkholder minimum medium [Proc. Natl. Acad. Sci. USA, 77, 4505
(1980)], SD medium containing 0.5% casamino acid [Proc. Natl. Acad.
Sci. USA, 81, 5330 (1984)] and the like. The pH of the medium is
preferably about 5-about 8. The culture is performed at generally
about 20.degree. C.-about 35.degree. C. Where necessary, aeration
and stirring may be performed.
[0107] As a medium for culturing an insect cell or insect, for
example, Grace's Insect Medium [Nature, 195, 788 (1962)] containing
an additive such as inactivated 10% bovine serum and the like as
appropriate and the like are used. The pH of the medium is
preferably about 6.2-about 6.4. The culture is performed at
generally about 27.degree. C. Where necessary, aeration and
stirring may be performed.
[0108] As a medium for culturing an animal cell, for example,
minimum essential medium (MEM) containing about 5-about 20% of
fetal bovine serum [Science, 122, 501 (1952)], Dulbecco's modified
Eagle medium (DMEM) [Virology, 8, 396 (1959)], RPMI 1640 medium
[The Journal of the American Medical Association, 199, 519 (1967)],
199 medium [Proceeding of the Society for the Biological Medicine,
73, 1 (1950)] and the like are used. The pH of the medium is
preferably about 6-about 8. The culture is performed at generally
about 30.degree. C.-about 40.degree. C. Where necessary, aeration
and stirring may be performed.
[0109] As a medium for culturing a plant cell, for example, MS
medium, LS medium, B5 medium and the like are used. The pH of the
medium is preferably about 5-about 8. The culture is performed at
generally about 20.degree. C.-about 30.degree. C. Where necessary,
aeration and stirring may be performed.
[0110] As mentioned above, a complex of a nucleic acid
sequence-recognizing module and a DNA glycosylase, i.e., nucleic
acid-modifying enzyme complex, can be expressed
intracellularly.
[0111] An RNA encoding a nucleic acid sequence-recognizing module
and/or a DNA glycosylase can be introduced into a host cell by
microinjection method, lipofection method and the like. RNA
introduction can be performed once or repeated multiple times
(e.g., 2-5 times) at suitable intervals.
[0112] When a complex of a nucleic acid sequence-recognizing module
and a DNA glycosylase is expressed by an expression vector or RNA
molecule introduced into the cell, the nucleic acid
sequence-recognizing module specifically recognizes and binds to a
target nucleotide sequence in the double stranded DNA (e.g.,
genomic DNA) of interest and, due to the action of the DNA
glycosylase linked to the nucleic acid sequence-recognizing module,
base excision reaction occurs in the sense strand or antisense
strand of the targeted site (whole or partial target nucleotide
sequence or appropriately adjusted within several hundred bases
including the vicinity thereof) and an abasic site (AP site) is
produced in one of the strands of the double stranded DNA. Then,
the base excision repair (BER) system in the cell operates, AP
endonuclease first recognizes the AP site and cleaves the
phosphoric acid bond in one of DNA strand, and exonuclease removes
nucleotide subjected to base excision. Then, DNA polymerase inserts
a new nucleotide by using the opposing strand DNA as a template and
finally DNA ligase repairs the joint. Various mutations are
introduced by a repair miss occurring at any stage of this BER. As
mentioned above, the BER mechanism in the cell is inhibited, and
the frequency of repair miss, and thus, efficiency of mutation
induction can be improved by using a mutant AP endonuclease which
lost enzyme activity but retains binding capacity to AP site in
combination.
[0113] As for zinc finger motif, production of many actually
functionable zinc finger motifs is not easy, since production
efficiency of a zinc finger that specifically binds to a target
nucleotide sequence is not high and selection of a zinc finger
having high binding specificity is complicated. While TAL effector
and PPR motif have a high degree of freedom of target nucleic acid
sequence recognition as compared to zinc finger motif, a problem
remains in the efficiency since a large protein needs to be
designed and constructed every time according to the target
nucleotide sequence. Furthermore, since these nucleic acid
sequence-recognizing modules do not have a function to change the
structure of double stranded DNA (causing strain in the double
helix structure), for a DNA glycosylase with sufficiently low
reactivity with a DNA having an unrelaxed double helix structure to
efficiently act on the targeted site, it is necessary to separately
contact a factor that changes the structure of the double stranded
DNA with the object double stranded DNA, thus making the operation
complicated.
[0114] In contrast, since the CRISPR-Cas system recognizes the
object double stranded DNA sequence by a guide RNA complementary to
the target nucleotide sequence, any sequence can be targeted by
simply synthesizing an oligoDNA capable of specifically forming a
hybrid with the target nucleotide sequence. Moreover, at the
targeted site, since the double stranded DNA is unwound to generate
a region having a single stranded structure, and a region adjacent
thereto which has a structure of relaxed double stranded DNA, DNA
glycosylase can be made to act efficiently in a targeted
site-specific manner, without combining factors that change the
structure of double stranded DNA.
[0115] Therefore, in a more preferable embodiment of the present
invention, a CRISPR-Cas system wherein at least one DNA cleavage
ability of Cas is inactivated (CRISPR-mutant Cas), is used as a
nucleic acid sequence-recognizing module.
[0116] FIG. 2 is a schematic showing of the double stranded DNA
modification method of the present invention using CRISPR-mutant
Cas as a nucleic acid sequence-recognizing module.
[0117] The nucleic acid sequence-recognizing module of the present
invention using CRISPR-mutant Cas is provided as a complex of an
RNA molecule consisting of a guide RNA complementary to the target
nucleotide sequence and tracrRNA necessary for recruiting mutant
Cas protein, and a mutant Cas protein.
[0118] The Cas protein to be used in the present invention is not
particularly limited as long as it belongs to the CRISPR system,
and preferred is Cas9. Examples of Cas9 include, but are not
limited to, Streptococcus pyogenes-derived Cas9 (SpCas9),
Streptococcus thermophilus-derived Cas9 (StCas9) and the like.
Preferred is SpCas9. AS a mutant Cas to be used in the present
invention, any of Cas wherein the cleavage ability of the both
strands of the double stranded DNA is inactivated and one having
nickase activity wherein at least one cleavage ability of one
strand alone is inactivated can be used. For example, in the case
of SpCas9, a D10A mutant in which the 10th Asp residue is converted
to an Ala residue and lacking cleavage ability of a strand opposite
to the strand forming a complementary strand with a guide RNA, or
H840A mutant in which the 840th His residue is converted to an Ala
residue and lacking cleavage ability of strand complementary to
guide RNA, or a double mutant thereof can be used, and other mutant
Cas can be used similarly.
[0119] DNA glycosylase is provided as a complex with mutant Cas by
a method similar to the coupling scheme with the above-mentioned
zinc finger and the like. Alternatively, a DNA glycosylase and
mutant Cas can also be bound by utilizing RNA aptamers MS2F6, PP7
and the like and RNA scaffold by binding proteins thereto. Guide
RNA forms a complementary strand with the target nucleotide
sequence, mutant Cas is recruited by the tracrRNA attached and
mutant Cas recognizes DNA cleavage site recognition sequence PAM
(protospacer adjacent motif) (when SpCas9 is used, PAM is 3 bases
of NGG (N is any base), and, theoretically, can target any position
on the genome). One or both DNAs cannot be cleaved, and, due to the
action of the DNA glycosylase linked to the mutant Cas, base
excision occurs in the targeted site (appropriately adjusted within
several hundred bases including whole or partial target nucleotide
sequence) and a AP site occurs in the double stranded DNA. Various
mutations are introduced due to the errors made by the BER system
of the cell to be repaired (see, for example, FIG. 5).
[0120] Even when CRISPR-mutant Cas is used as a nucleic acid
sequence-recognizing module, a nucleic acid sequence-recognizing
module and a DNA glycosylase are desirably introduced, in the form
of a nucleic acid encoding same, into a cell having a double
stranded DNA of interest, similar to when zinc finger and the like
are used as a nucleic acid sequence-recognizing module.
[0121] A DNA encoding Cas can be cloned by a method similar to the
above-mentioned method for a DNA encoding a DNA glycosylase, from a
cell producing the enzyme. A mutant Cas can be obtained by
introducing a mutation to convert an amino acid residue of the part
important for the DNA cleavage activity (e.g., 10th Asp residue and
840th His residue for Cas9, though not limited thereto) to other
amino acid, into a DNA encoding cloned Cas, by a site specific
mutation induction method known per se.
[0122] Alternatively, a DNA encoding mutant Cas can also be
constructed as a DNA showing codon usage suitable for expression in
a host cell to be used, by a method similar to those mentioned
above for a DNA encoding a nucleic acid sequence-recognizing module
and a DNA encoding a DNA glycosylase, and by a combination of
chemical synthesis or PCR method or Gibson Assembly method. For
example, CDS sequence and amino acid sequence optimized for the
expression of SpCas9 in eukaryotic cells are shown in SEQ ID NOs: 3
and 4. In the sequence shown in SEQ ID NO: 3, when "A" is converted
to "C" in base No. 29, a DNA encoding a D10A mutant can be
obtained, and when "CA" is converted to "GC" in base No. 2518-2519,
a DNA encoding an H840A mutant can be obtained.
[0123] A DNA encoding a mutant Cas and a DNA encoding a DNA
glycosylase may be linked to allow for expression as a fusion
protein, or designed to be separately expressed using a binding
domain, intein and the like, and form a complex in a host cell via
protein-protein interaction and protein ligation. Alternatively, a
design may be employed in which a DNA encoding mutant Cas and a DNA
encoding DNA glycosylase are each split into two fragments at
suitable split site, either fragments are linked to each other
directly or via a suitable linker to express a nucleic
acid-modifying enzyme complex as two partial complexes, which are
associated and refolded in the cell to reconstitute functional
mutant Cas having a particular nucleic acid sequence recognition
ability, and a functional DNA glycosylase having a base excision
reaction catalyst activity is reconstituted when the mutant Cas is
bonded to the target nucleotide sequence. For example, a DNA
encoding the N-terminal side fragment and a DNA encoding the
C-terminal side fragment of mutant Cas are respectively prepared by
the PCR method by using suitable primers; a DNA encoding the
N-terminal side fragment and a DNA encoding the C-terminal side
fragment of DNA glycosylase are prepared in the same manner; for
example, the DNAs encoding the N-terminal side fragments are linked
to each other, and the DNAs encoding the C-terminal side fragments
are linked to each other by a conventional method, whereby a DNA
encoding two partial complexes can be produced. Alternatively, a
DNA encoding the N-terminal side fragment of mutant Cas and a DNA
encoding the C-terminal side fragment of DNA glycosylase are
linked; and a DNA encoding the N-terminal side fragment of DNA
glycosylase and a DNA encoding the C-terminal side fragment of
mutant Cas are linked, whereby a DNA encoding two partial complexes
can also be produced. Respective partial complexes may be linked to
allow for expression as a fusion protein, or designed to be
separately expressed using a binding domain, intein and the like,
and form a complex in a host cell via protein-protein interaction
and protein ligation. Two partial complexes may be linked to be
expressed as a fusion protein. The split site of the mutant Cas is
not particularly limited as long as the two split fragments can be
reconstituted such that they recognize and bind to the target
nucleotide sequence, and it may be split at one site to provide
N-terminal side fragment and C-terminal side fragment, or not less
than 3 fragments obtained by splitting at two or more sites may be
appropriately linked to give two fragments. The three-dimensional
structures of various Cas proteins are known, and those of ordinary
skill in the art can appropriately select the split site based on
such information. For example, since the region consisting of the
94th to the 718th amino acids from the N terminus of SpCas9 is a
domain (REC) involved in the recognition of the target nucleotide
sequence and guide RNA, and the region consisting of the 1099th
amino acid to the C-terminal amino acid is the domain (PI) involved
in the interaction with PAM, the N-terminal side fragment and the
C-terminal side fragment can be split at any site in REC domain or
PI domain, preferably in a region free of a structure (e.g.,
between 204th and 205th amino step from the N-terminal (204 . . .
205), between 535th and 536th amino acids from the N-terminal (535
. . . 536) and the like) (see, for example, Nat Biotechnol. 33(2):
139-142 (2015)).
[0124] The obtained DNA encoding a mutant Cas and/or a DNA
glycosylase can be inserted into the downstream of a promoter of an
expression vector similar to the one mentioned above, according to
the host.
[0125] On the other hand, a DNA encoding guide RNA and tracrRNA can
be obtained by designing an oligoDNA sequence linking guide RNA
sequence complementary to the target nucleotide sequence and known
tracrRNA sequence (e.g.,
gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggc
accgagtcggtggtgctttt; SEQ ID NO: 5) and chemically synthesizing
using a DNA/RNA synthesizer. While a DNA encoding guide RNA and
tracrRNA can also be inserted into an expression vector similar to
the one mentioned above, according to the host. As the promoter,
pol III system promoter (e.g., SNR6, SNR52, SCR1, RPR1, U6, H1
promoter etc.) and terminator (e.g., T.sub.6 sequence) are
preferably used.
[0126] An RNA encoding mutant Cas and/or a DNA glycosylase can be
prepared by, for example, transcription to mRNA in a vitro
transcription system known per se by using a vector encoding the
above-mentioned mutant Cas and/or DNA encoding a DNA glycosylase as
a template.
[0127] Guide RNA-tracrRNA can be obtained by designing an oligoDNA
sequence linking a sequence complementary to the target nucleotide
sequence and known tracrRNA sequence and chemically synthesizing
using a DNA/RNA synthesizer.
[0128] A DNA or RNA encoding mutant Cas and/or a DNA glycosylase,
guide RNA-tracrRNA or a DNA encoding same can be introduced into a
host cell by a method similar to the above, according to the
host.
[0129] Since conventional artificial nuclease accompanies double
stranded DNA breaks (DSB), inhibition of growth and cell death
assumedly caused by disordered cleavage of chromosome (off-target
cleavage) occur by targeting a sequence in the genome. The effect
thereof is particularly fatal for many microorganisms and
prokaryotes, and prevents applicability. In the present invention,
mutation is introduced not by DNA cleavage but by a base excision
reaction on the DNA base, and therefore, drastic reduction of
toxicity can be realized.
[0130] The modification of the double stranded DNA in the present
invention does not prevent occurrence of cleavage of the double
stranded DNA in a site other than the targeted site (appropriately
adjusted within several hundred bases including whole or partial
target nucleotide sequence). However, one of the greatest
advantages of the present invention is avoidance of toxicity by
off-target cleavage, which is generally applicable to any species.
In preferable one embodiment, therefore, the modification of the
double stranded DNA in the present invention does not accompany
cleavage of DNA strand not only in a targeted site of a given
double stranded DNA but in a site other than same.
[0131] As shown in the below-mentioned Examples, when
sequence-recognizing modules are produced corresponding to the
adjacent multiple target nucleotide sequences, and simultaneously
used, the mutation introduction can be efficiency increased than by
using a single nucleotide sequence as a target. As the effect
thereof, similarly mutation induction is realized even when both
target nucleotide sequences partly overlap or when the both are
apart by about 600 bp. It can occur both when the target nucleotide
sequences are in the same direction (target nucleotide sequences
are present on the same strand), and when they are opposed (target
nucleotide sequence is present on each strand of double stranded
DNA).
[0132] The genome sequence modification method of the present
invention can introduce mutation into almost all cells in which the
nucleic acid-modifying enzyme complex of the present invention has
been expressed, by selecting a suitable target nucleotide sequence.
Thus, insertion and selection of a selection marker gene, which are
essential in the conventional genome editing, are not necessary.
This dramatically facilitates and simplifies gene manipulation and
enlarges the applicability to crop breeding and the like since a
recombinant organism with foreign DNA is not produced.
[0133] Since the genome sequence modification method of the present
invention shows extremely high efficiency of mutation induction,
and does not require selection by markers, modification of multiple
DNA regions at completely different positions as targets can be
performed. Therefore, in one preferable embodiment of the present
invention, two or more kinds of nucleic acid sequence-recognizing
modules that specifically bind to different target nucleotide
sequences (which may be present in one object gene, or two or more
different object genes, which object genes may be present on the
same chromosome or different chromosomes) can be used. In this
case, each one of these nucleic acid sequence-recognizing modules
and DNA glycosylase form a nucleic acid-modifying enzyme complex.
Here, a common DNA glycosylase can be used. For example, when
CRISPR-Cas system is used as a nucleic acid sequence-recognizing
module, a common complex of a Cas protein and a DNA glycosylase
(including fusion protein) is used, and two or more kinds of
chimeric RNAs of tracrRNA and each of two or more guide RNAs that
respectively form a complementary strand with a different target
nucleotide sequence are produced and used as guide RNA-tracrRNAs.
On the other hand, when zinc finger motif, TAL effector and the
like are used as nucleic acid sequence-recognizing modules, for
example, a DNA glycosylase can be fused with a nucleic acid
sequence-recognizing module that specifically binds to a different
target nucleotide.
[0134] To express the nucleic acid-modifying enzyme complex of the
present invention in a host cell, as mentioned above, an expression
vector containing a DNA encoding the nucleic acid-modifying enzyme
complex, or an RNA encoding the nucleic acid-modifying enzyme
complex is introduced into a host cell. For efficient introduction
of mutation, it is desirable to maintain an expression of nucleic
acid-modifying enzyme complex of a given level or above for not
less than a given period. From such aspect, it is ensuring to
introduce an expression vector (plasmid etc.) autonomously
replicatable in a host cell. However, since the plasmid etc. are
foreign DNAs, they are preferably removed rapidly after successful
introduction of mutation. When mutant AP endonuclease is used in
combination, since the mutant enzyme inhibits the BER mechanism in
the host cell, it may induce undesirable spontaneous mutations
outside the target region. Thus, it is preferable to also remove a
plasmid containing a DNA encoding the mutant enzyme promptly after
introduction of the desired mutation. Therefore, though subject to
change depending on the kind of host cell and the like, for
example, the introduced plasmid is desirably removed from the host
cell after a lapse of for 6 hr-2 days from the introduction of an
expression vector by using various plasmid removal methods well
known in the art.
[0135] Alternatively, as long as expression of a nucleic
acid-modifying enzyme complex, which is sufficient for the
introduction of mutation, is obtained, it is preferable to
introduce mutation into the object double stranded DNA by transient
expression by using an expression vector without autonomous
replicatability in a host cell (e.g., vector etc. lacking
replication origin that functions in host cell and/or gene encoding
protein necessary for replication) or RNA.
[0136] The present invention is explained in the following by
referring to Examples, which are not to be construed as
limitative.
EXAMPLES
[0137] In the below-mentioned Examples, experiments were performed
as follows.
<Cell Line, Culture, Transformation, and Expression
Induction>
[0138] Budding yeast Saccharomyces cerevisiae BY4741 strain
(requiring leucine and uracil) was cultured in a standard YPDA
medium or SD medium with a Dropout composition meeting the
auxotrophicity. The culture performed was stand culture in an agar
plate or shaking culture in a liquid medium between 25.degree. C.
and 30.degree. C. Transformation was performed by an acetic acid
lithium method, and selection was made in SD medium meeting
appropriate auxotrophicity. For expression induction by galactose,
after preculture overnight in an appropriate SD medium, culture in
SR medium with carbon source changed from 2% glucose to 2%
raffinose overnight, and further culture in SGal medium with carbon
source changed to 0.2% galactose for 3 hr to about two nights were
conducted for expression induction.
[0139] For the measurement of the number of surviving cells and
Can1 mutation rate, a cell suspension was appropriately diluted,
applied on SD plate medium or SD-Arg+60 mg/l Canavanine plate
medium or SD+300 mg/l Canavanine plate medium, applied, and the
number of colonies that emerge 3 days later was counted as the
number of surviving cells. Using number of surviving colonies in SD
plate as the total number of cells, and the number of surviving
colonies in Canavanine plate as resistant mutant strain number, the
mutation rate was calculated and evaluated. The site of mutation
introduction was identified by amplifying DNA fragments containing
the target gene region of each strain by a colony PCR method,
performing DNA sequencing, and performing an alignment analysis
based on the sequence of Saccharomyces Genome Database
(www.yeastgenome.org/).
<Nucleic Acid Operation>
[0140] DNA was processed or constructed by any of PCR method,
restriction enzyme treatment, ligation, Gibson Assembly method, and
artificial chemical synthesis. For plasmid, as a yeast Escherichia
coli shuttle vector, pRS315 for leucine selection and pRS426 for
uracil selection were used as the backbone. Plasmid was amplified
by Escherichia coli line XL-10 gold or DH5.alpha., and introduced
into yeast by the acetic acid lithium method.
<Construct>
[0141] For inducible expression, budding yeast pGal1/10 (SEQ ID NO:
6) which is a bidirectional promoter induced by galactose was used.
At the downstream of the promoter, a nuclear localization signal
(ccc aag aag aag agg aag gtg; SEQ ID NO: 7 (PKKKRV; encoding SEQ ID
NO: 8)) was added to Streptococcus pyogenes-derived Cas9 gene ORF
having a codon optimized for eucaryon expression (SEQ ID NO: 3) and
the sequence of ORF (ORF of wild-type gene is shown in SEQ ID NO:
1, Y164A mutation is substitution of base number 490-491 ta with gc
(ta490gc); Y164G mutation is substitution of base number 490-491 ta
with gg (ta490gg); N222D mutation is substitution of base number
664 a with g (a664g); L304A mutation is substitution of base number
910-911 tt with gc (tt910gc); R308E mutation is substitution of
base number 922-923 ag with ga (ag922ga); R308C mutation is
substitution of base number 922-924 aga with tgt (aga922tgt)) of
wild-type or various mutant uracil-DNA glycosylase genes (UNG1
derived from yeast Saccharomyces cerevisiae), excluding a region
(base number 1-60) encoding the mitochondria localization signal,
was ligated via a linker sequence and expressed as a fusion
protein. For comparison, UNG1 gene instead of deaminase gene
(PmCDA1 derived from Petromyzon marinus Petromyzon marinus) was
ligated and expressed as a fusion protein. As a linker sequence,
2.times.GS linker (two repeats of ggt gga gga ggt tct; SEQ ID NO: 9
(GGGGS; encoding SEQ ID NO: 10)) was used. As a terminator, budding
yeast-derived ADH1 terminator (SEQ ID NO: 11) and Top2 terminator
(SEQ ID NO: 12) were ligated. In the domain integration method,
Cas9 gene ORF was ligated to SH3 domain (SEQ ID NOs: 13 and 14) via
2.times.GS linker to give one protein, mutant yeast UNG1 added with
SH3 ligand sequence (SEQ ID NOs: 15 and 16) as another protein and
they were ligated to Gal1/10 promoter on both directions and
simultaneously expressed. These were incorporated into pRS315
plasmid.
[0142] In Cas9, mutation to convert the 10th aspartic acid to
alanine (D10A, corresponding DNA sequence mutation a29c) and
mutation to convert the 840th histidine to alanine (H840A,
corresponding DNA sequence mutation ca2518gc) were introduced to
remove cleavage ability of each side of DNA strand.
[0143] gRNA as a chimeric structure with tracrRNA (derived from
Streptococcus pyogenes; SEQ ID NO: 5) was disposed between SNR52
promoter (SEQ ID NO: 17) and Sup4 terminator (SEQ ID NO: 18), and
incorporated into pRS426 plasmid. As gRNA target base sequence,
793-812 (aacccaggtgcctggggtcc; SEQ ID NO: 19) and 767-786
complementary strand sequence (ataacggaatccaactgggc; SEQ ID NO: 20)
of CAN1 gene ORF were used. For simultaneous expression of multiple
targets, a sequence from a promoter to a terminator as one set and
a plurality thereof were incorporated into the same plasmid. They
were introduced into cells along with Cas9-UNG1 expression plasmid,
intracellularly expressed, and a complex of gRNA-tracrRNA and
Cas9-UNG1 was formed.
Example 1: Modification of Genome Sequence by Linking DNA Sequence
Recognition Ability of CRISPR-Cas to Mutant Uracil-DNA Glycosylase
(1)
[0144] To test the effect of genome sequence modification technique
of the present invention by utilizing mutant uracil--DNA
glycosylase and CRISPR-Cas nucleic acid sequence recognition
ability, introduction of mutation into CAN1 gene encoding
canavanine transporter that acquire canavanine-resistance due to
gene deficiency was tried. As gRNA, a sequence complementary to
793-812 of CAN1 gene ORF and a sequence complementary to 767-786
complementary strand sequence were used, a chimeric RNA expression
vector obtained by linking thereto Streptococcus pyogenes-derived
tracrRNA, and a vector expressing a protein obtained by fusing
dCas9 with impaired nuclease activity by introducing mutations
(D10A and H840A) into Streptococcus pyogenes-derived Cas9 (SpCas9),
and wild-type yeast-derived UNG1 or yeast-derived UNG1 introduced
with various mutations (N222D single mutation and double mutation
of N222D and L304A, R308E or R308C mutation) were constructed,
introduced into the budding yeast by the acetic acid lithium
method, and coexpressed. The results are shown in FIG. 3. When
cultured on a canavanine-containing SD plate, only the cells
subjected to introduction and expression of gRNA-tracrRNA and
dCas9-mutant UNG1 (double mutant of N222D mutation imparting CDG
activity and L304A, R308E or R308C mutation that decreases
reactivity with DNA having an unrelaxed double helix structure)
formed canavanine-resistant colonies. With N222D single mutation,
the cytotoxicity was strong, and cell culture and evaluation were
difficult, and therefore, the results are not shown. From the
above, it was shown that target specific mutation introduction
becomes possible by decreasing the reactivity of DNA glycosylase
with a DNA having an unrelaxed double helix structure.
Example 2: Modification of Genome Sequence by Linking DNA Sequence
Recognition Ability of CRISPR-Cas to Mutant Uracil-DNA Glycosylase
(2)
[0145] Using yeast UNG1 introduced with double mutation of R308C
mutation that decreases reactivity with a DNA having an unrelaxed
double helix structure, and N222D mutation imparting CDG activity,
or Y164A or Y164G mutation imparting TDG activity, and by a method
similar to that in Example 1, introduction of mutation into CAN1
gene was tried. The results are shown in FIG. 4. It was shown that
R308C N222D can achieve efficiency of mutation induction comparable
to that of deaminase PmCDA1, and mutant strain can be obtained even
without selection. It was shown that thymine base could be edited,
since canavanine-resistant colony was also obtained in R308C Y164A.
Y164G mutation improved the efficiency of mutation induction.
[0146] Then, each canavanine-resistant clone was subjected to the
sequence analysis of the Can1 gene region. The results are shown in
FIG. 5. Mutations were somewhat randomly centered around two
adjacent target sites (767-786, 793-812). This is different from
the pinpoint introduction of mutation by deaminase (WO
2015-133554), and suggests that the genome editing technique of the
present invention is suitable for random introduction of mutation
into the target nucleotide sequence and in the vicinity thereof. As
assumed, point mutation from C or G was mainly found in N222D, and
point mutation from T or A was mainly found in Y164A and Y164G.
Example 3: Use of Different Coupling Scheme
[0147] Whether mutation can be introduced into a targeted gene even
when Cas9 and DNA glycosylase are not used as a fusion protein but
when a nucleic acid-modifying enzyme complex is formed via a
binding domain and a ligand thereof was examined. As Cas9, dCas9
used in Example 1 was used, yeast UNG1 mutant (double mutant of
N222D or Y164A mutation, and R308E or R308C mutant) was used as DNA
glycosylase, SH3 domain was fused with the former, and a binding
ligand thereof was fused with the latter to produce various
constructs shown in FIG. 6. In the same manner as in Example 1,
sequences in the CAN1 gene were used as gRNA targets, and these
constructs were introduced into a budding yeast. As a result, even
when dCas9 and DNA glycosylase were bound via the binding domain,
mutation was efficiently introduced into the targeted site of the
CAN1 gene (FIG. 6).
Example 4 Improvement of Efficiency of Mutation Induction by
Coexpression of Mutant AP Endonuclease
[0148] Using yeast UNG1 introduced with double mutation of R308C
mutation that decreases reactivity with a DNA having an unrelaxed
double helix structure, and N222D mutation imparting CDG activity
or Y164G mutation imparting TDG activity, and mutant human APE1
(E96Q, D210N) which lost enzyme activity but retained binding
capacity to AP site, and by a method similar to that in Example 1,
introduction of mutation into CAN1 gene was tried. The results are
shown in FIG. 7. When mutant APE1 was coexpressed, the number of
canavanine-resistant colonies increased even in Y164G, R308C that
showed low efficiency when used alone, and efficiency of mutation
introduction targeting thymine was remarkably improved.
Example 5 Reduction of Cytotoxicity by Introduction of Mutation
that Decreases Reactivity with DNA Having an Unrelaxed Double Helix
Structure
[0149] An influence of the presence or absence of mutation (L304A)
that decreases reactivity with a DNA having an unrelaxed double
helix structure in UNG1 on the survival rate of the host yeast was
examined. The results are shown in FIG. 8. The host yeast
introduced with mutant UNG1 having only the mutation imparting CDG
activity (N222D) or TDG activity (Y164A) showed a marked decrease
in the survival rate as compared to the yeast introduced with
wild-type UNG1. This is assumed to be because wild-type UNG1
removes uracil which is an aberrant base that appears rarely in
DNA, whereas mutant UNG1 having CDG activity or TDG activity
removes cytosine or thymine anywhere on the genomic DNA and
produces mutations undesirable for the survival of the cell. On the
other hand, when the reactivity with a DNA having an unrelaxed
double helix structure is decreased by introducing L304 mutation,
the survival rate of the host yeast recovered remarkably and
cytotoxicity could be avoided.
Example 6 Utilization of Heterogenous Uracil-DNA Glycosylase
[0150] Whether introduction of targeted mutation into the host
yeast is possible even when heterogenous mutant UNG1 is used
instead of mutant UNG1 derived from yeast was examined. Two kinds
of Escherichia coli-derived mutant ungs (EcUDG) (N123D/L191A double
mutant, Y66G/L191A double mutant) and four kinds of vaccinia
virus-derived mutant UDGs (vvUDG) (N120D/R187C double mutant,
Y70G/R187C double mutant, N120D mutant, Y70G mutant) were used. The
results are shown in FIG. 9. While both EcUDG, vvUDG were
functional in yeast, the efficiency of mutation induction was low
as compared to yeast UNG1, and it was shown that the use of
allogeneic DNA glycosylase was advantageous. Surprisingly, it was
clarified that cytotoxicity was absent in vvUDG, regardless of the
presence or absence of R187C mutation corresponding to R308C
mutation of yeast UNG1. As a result of sequence analysis, since
mutation by vvUDG was concentrated in a specific base in the target
nucleotide sequence regardless of the presence or absence of R187C
mutation (see FIG. 10), vvUDG was suggested to be a DNA glycosylase
with natively sufficiently low reactivity with a DNA having an
unrelaxed double helix structure. The efficiency of mutation
induction by vvUDG was remarkably increased in virus DNA polymerase
by coexpressing A20, which interacts with vvUDG and acts as a
processivity factor (FIG. 9).
Example 7 Reduction of Non-Specific Mutation by Utilization of
Split Enzyme
[0151] In addition to the utilization of mutation that decreases
reactivity with a DNA having an unrelaxed double helix structure,
and DNA glycosylase with natively low reactivity with a DNA having
a double helix structure such as vvUDG, utilization of split enzyme
technique was tried as a different means for reducing non-specific
mutation by DNA glycosylase. The plasmids shown in FIG. 11
containing DNA encoding various split enzymes were introduced into
the host yeast together with a plasmid containing a DNA encoding
guide RNA-tracrRNA by a method similar to that in Example 1, and
the cell number, the number of canavanine-resistant (mutation at
targeted site) colonies, the number of thialysine-resistant
(non-specific mutation) colonies on a nonselective medium were
examined. The survival rate of the host yeast on a nonselective
medium was equivalent to that when mutant UNG1 introduced with
mutation (R308C) that decreases reactivity with a DNA having an
unrelaxed double helix structure was introduced even when any split
enzyme was used. Thus, it was shown that cytotoxicity can be
sufficiently decreased by the utilization of a split enzyme, even
without introducing a mutation that decreases reactivity with a DNA
having an unrelaxed double helix structure, whereby it was
suggested that non-specific mutation can be suppressed (FIG. 11).
In fact, the frequency of non-specific mutation by using
thialysine-resistance as an index was decreased by the utilization
of a split enzyme (FIG. 11).
INDUSTRIAL APPLICABILITY
[0152] The present invention makes it possible to safely introduce
site specific mutation into any species without accompanying
insertion of a foreign DNA or double-stranded DNA breaks. It is
also possible to set a wide range of mutation introduction to
target nucleotide sequence and several hundred bases in the
vicinity thereof, and the technique can also be applied to topical
evolution induction by introduction of random mutation into a
particular restricted region, which has been almost impossible
heretofore, and is extremely useful. Furthermore, when mutation
imparting CDG activity and mutation imparting TDG activity are
imparted to UNG, base excision using 5-methylcytidine as a
substrate becomes possible. According to the present invention,
therefore, the epigenome information can be rewritten into, for
example, region-specific release of methylation state to change the
gene expression pattern and the like. Therefore, artificial cell
differentiation, cancer cell inhibition, modification of gene
function without rewriting genome sequence, and the like become
possible.
[0153] This application is based on a patent application No.
2014-224745 filed in Japan (filing date: Nov. 4, 2014), the
contents of which are incorporated in full herein.
Sequence CWU 1
1
2711077DNASaccharomyces
cerevisiaeCDS(1)..(1077)transit_peptide(1)..(60) 1atg tgg tgc atg
aga aga ttg cca aca aat tca gtt atg acg gtg gct 48Met Trp Cys Met
Arg Arg Leu Pro Thr Asn Ser Val Met Thr Val Ala1 5 10 15cga aag aga
aag caa act acg atc gaa gac ttc ttt ggt aca aag aaa 96Arg Lys Arg
Lys Gln Thr Thr Ile Glu Asp Phe Phe Gly Thr Lys Lys 20 25 30agc act
aat gag gcg ccc aat aag aaa ggt aaa tcg ggc gct act ttc 144Ser Thr
Asn Glu Ala Pro Asn Lys Lys Gly Lys Ser Gly Ala Thr Phe 35 40 45atg
acc ata aca aat ggc gca gct atc aag aca gag aca aag gcg gtc 192Met
Thr Ile Thr Asn Gly Ala Ala Ile Lys Thr Glu Thr Lys Ala Val 50 55
60gca aag gag gca aac acg gac aaa tat cct gct aat tca aat gca aaa
240Ala Lys Glu Ala Asn Thr Asp Lys Tyr Pro Ala Asn Ser Asn Ala
Lys65 70 75 80gat gta tat tcg aag aac ttg agc agc aat tta cgt aca
cta ctg tcg 288Asp Val Tyr Ser Lys Asn Leu Ser Ser Asn Leu Arg Thr
Leu Leu Ser 85 90 95ctg gag cta gaa acg att gat gat tcg tgg ttt cca
cat tta atg gat 336Leu Glu Leu Glu Thr Ile Asp Asp Ser Trp Phe Pro
His Leu Met Asp 100 105 110gaa ttt aaa aag cca tat ttt gta aag ttg
aaa cag ttt gtc act aaa 384Glu Phe Lys Lys Pro Tyr Phe Val Lys Leu
Lys Gln Phe Val Thr Lys 115 120 125gag caa gct gat cat aca gta ttt
ccg cct gca aag gat att tac tca 432Glu Gln Ala Asp His Thr Val Phe
Pro Pro Ala Lys Asp Ile Tyr Ser 130 135 140tgg acc agg cta acg cct
ttt aat aaa gtt aaa gtc gtg att atc ggt 480Trp Thr Arg Leu Thr Pro
Phe Asn Lys Val Lys Val Val Ile Ile Gly145 150 155 160caa gat ccc
tac cac aac ttt aat cag gcg cat ggc ttg gct ttt agc 528Gln Asp Pro
Tyr His Asn Phe Asn Gln Ala His Gly Leu Ala Phe Ser 165 170 175gtc
aaa ccc cct aca cca gca cca ccg tca tta aag aac ata tat aag 576Val
Lys Pro Pro Thr Pro Ala Pro Pro Ser Leu Lys Asn Ile Tyr Lys 180 185
190gaa ctg aag caa gag tat cct gat ttt gtt gaa gat aat aaa gtg gga
624Glu Leu Lys Gln Glu Tyr Pro Asp Phe Val Glu Asp Asn Lys Val Gly
195 200 205gat tta act cac tgg gct tca caa ggg gtt tta ttg ctt aat
acc tcg 672Asp Leu Thr His Trp Ala Ser Gln Gly Val Leu Leu Leu Asn
Thr Ser 210 215 220tta act gta aga gca cat aat gca aac tcg cat tct
aag cat ggt tgg 720Leu Thr Val Arg Ala His Asn Ala Asn Ser His Ser
Lys His Gly Trp225 230 235 240gaa act ttt aca aaa agg gta gtt cag
ttg ttg atc cag gac aga gag 768Glu Thr Phe Thr Lys Arg Val Val Gln
Leu Leu Ile Gln Asp Arg Glu 245 250 255gcc gac ggt aag agt tta gta
ttc ctc tta tgg ggg aac aat gct atc 816Ala Asp Gly Lys Ser Leu Val
Phe Leu Leu Trp Gly Asn Asn Ala Ile 260 265 270aaa tta gta gag tct
ctg ttg gga tct act tcc gtt gga agc ggt agt 864Lys Leu Val Glu Ser
Leu Leu Gly Ser Thr Ser Val Gly Ser Gly Ser 275 280 285aag tac cct
aat atc atg gtg atg aag tca gtg cat ccg tct cca tta 912Lys Tyr Pro
Asn Ile Met Val Met Lys Ser Val His Pro Ser Pro Leu 290 295 300agt
gca agt aga gga ttt ttt ggt acc aac cat ttc aaa atg ata aac 960Ser
Ala Ser Arg Gly Phe Phe Gly Thr Asn His Phe Lys Met Ile Asn305 310
315 320gat tgg cta tac aat acc cgc gga gag aaa atg ata gac tgg agt
gtt 1008Asp Trp Leu Tyr Asn Thr Arg Gly Glu Lys Met Ile Asp Trp Ser
Val 325 330 335gtt cct gga acg tca tta aga gaa gtt cag gag gca aat
gct cgc tta 1056Val Pro Gly Thr Ser Leu Arg Glu Val Gln Glu Ala Asn
Ala Arg Leu 340 345 350gag tca gaa tca aag gac cct 1077Glu Ser Glu
Ser Lys Asp Pro 3552359PRTSaccharomyces cerevisiae 2Met Trp Cys Met
Arg Arg Leu Pro Thr Asn Ser Val Met Thr Val Ala1 5 10 15Arg Lys Arg
Lys Gln Thr Thr Ile Glu Asp Phe Phe Gly Thr Lys Lys 20 25 30Ser Thr
Asn Glu Ala Pro Asn Lys Lys Gly Lys Ser Gly Ala Thr Phe 35 40 45Met
Thr Ile Thr Asn Gly Ala Ala Ile Lys Thr Glu Thr Lys Ala Val 50 55
60Ala Lys Glu Ala Asn Thr Asp Lys Tyr Pro Ala Asn Ser Asn Ala Lys65
70 75 80Asp Val Tyr Ser Lys Asn Leu Ser Ser Asn Leu Arg Thr Leu Leu
Ser 85 90 95Leu Glu Leu Glu Thr Ile Asp Asp Ser Trp Phe Pro His Leu
Met Asp 100 105 110Glu Phe Lys Lys Pro Tyr Phe Val Lys Leu Lys Gln
Phe Val Thr Lys 115 120 125Glu Gln Ala Asp His Thr Val Phe Pro Pro
Ala Lys Asp Ile Tyr Ser 130 135 140Trp Thr Arg Leu Thr Pro Phe Asn
Lys Val Lys Val Val Ile Ile Gly145 150 155 160Gln Asp Pro Tyr His
Asn Phe Asn Gln Ala His Gly Leu Ala Phe Ser 165 170 175Val Lys Pro
Pro Thr Pro Ala Pro Pro Ser Leu Lys Asn Ile Tyr Lys 180 185 190Glu
Leu Lys Gln Glu Tyr Pro Asp Phe Val Glu Asp Asn Lys Val Gly 195 200
205Asp Leu Thr His Trp Ala Ser Gln Gly Val Leu Leu Leu Asn Thr Ser
210 215 220Leu Thr Val Arg Ala His Asn Ala Asn Ser His Ser Lys His
Gly Trp225 230 235 240Glu Thr Phe Thr Lys Arg Val Val Gln Leu Leu
Ile Gln Asp Arg Glu 245 250 255Ala Asp Gly Lys Ser Leu Val Phe Leu
Leu Trp Gly Asn Asn Ala Ile 260 265 270Lys Leu Val Glu Ser Leu Leu
Gly Ser Thr Ser Val Gly Ser Gly Ser 275 280 285Lys Tyr Pro Asn Ile
Met Val Met Lys Ser Val His Pro Ser Pro Leu 290 295 300Ser Ala Ser
Arg Gly Phe Phe Gly Thr Asn His Phe Lys Met Ile Asn305 310 315
320Asp Trp Leu Tyr Asn Thr Arg Gly Glu Lys Met Ile Asp Trp Ser Val
325 330 335Val Pro Gly Thr Ser Leu Arg Glu Val Gln Glu Ala Asn Ala
Arg Leu 340 345 350Glu Ser Glu Ser Lys Asp Pro
35534116DNAArtificial SequenceSynthetic Streptococcus
pyogenes-derived Cas9 CDS optimized for eucaryotic
expressionCDS(1)..(4116) 3atg gac aag aag tac tcc att ggg ctc gat
atc ggc aca aac agc gtc 48Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp
Ile Gly Thr Asn Ser Val1 5 10 15ggt tgg gcc gtc att acg gac gag tac
aag gtg ccg agc aaa aaa ttc 96Gly Trp Ala Val Ile Thr Asp Glu Tyr
Lys Val Pro Ser Lys Lys Phe 20 25 30aaa gtt ctg ggc aat acc gat cgc
cac agc ata aag aag aac ctc att 144Lys Val Leu Gly Asn Thr Asp Arg
His Ser Ile Lys Lys Asn Leu Ile 35 40 45ggc gcc ctc ctg ttc gac tcc
ggg gag acg gcc gaa gcc acg cgg ctc 192Gly Ala Leu Leu Phe Asp Ser
Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60aaa aga aca gca cgg cgc
aga tat acc cgc aga aag aat cgg atc tgc 240Lys Arg Thr Ala Arg Arg
Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys65 70 75 80tac ctg cag gag
atc ttt agt aat gag atg gct aag gtg gat gac tct 288Tyr Leu Gln Glu
Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 85 90 95ttc ttc cat
agg ctg gag gag tcc ttt ttg gtg gag gag gat aaa aag 336Phe Phe His
Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110cac
gag cgc cac cca atc ttt ggc aat atc gtg gac gag gtg gcg tac 384His
Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120
125cat gaa aag tac cca acc ata tat cat ctg agg aag aag ctt gta gac
432His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp
130 135 140agt act gat aag gct gac ttg cgg ttg atc tat ctc gcg ctg
gcg cat 480Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu
Ala His145 150 155 160atg atc aaa ttt cgg gga cac ttc ctc atc gag
ggg gac ctg aac cca 528Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu
Gly Asp Leu Asn Pro 165 170 175gac aac agc gat gtc gac aaa ctc ttt
atc caa ctg gtt cag act tac 576Asp Asn Ser Asp Val Asp Lys Leu Phe
Ile Gln Leu Val Gln Thr Tyr 180 185 190aat cag ctt ttc gaa gag aac
ccg atc aac gca tcc gga gtt gac gcc 624Asn Gln Leu Phe Glu Glu Asn
Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205aaa gca atc ctg agc
gct agg ctg tcc aaa tcc cgg cgg ctc gaa aac 672Lys Ala Ile Leu Ser
Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220ctc atc gca
cag ctc cct ggg gag aag aag aac ggc ctg ttt ggt aat 720Leu Ile Ala
Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn225 230 235
240ctt atc gcc ctg tca ctc ggg ctg acc ccc aac ttt aaa tct aac ttc
768Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe
245 250 255gac ctg gcc gaa gat gcc aag ctt caa ctg agc aaa gac acc
tac gat 816Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr
Tyr Asp 260 265 270gat gat ctc gac aat ctg ctg gcc cag atc ggc gac
cag tac gca gac 864Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp
Gln Tyr Ala Asp 275 280 285ctt ttt ttg gcg gca aag aac ctg tca gac
gcc att ctg ctg agt gat 912Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp
Ala Ile Leu Leu Ser Asp 290 295 300att ctg cga gtg aac acg gag atc
acc aaa gct ccg ctg agc gct agt 960Ile Leu Arg Val Asn Thr Glu Ile
Thr Lys Ala Pro Leu Ser Ala Ser305 310 315 320atg atc aag cgc tat
gat gag cac cac caa gac ttg act ttg ctg aag 1008Met Ile Lys Arg Tyr
Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335gcc ctt gtc
aga cag caa ctg cct gag aag tac aag gaa att ttc ttc 1056Ala Leu Val
Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350gat
cag tct aaa aat ggc tac gcc gga tac att gac ggc gga gca agc 1104Asp
Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360
365cag gag gaa ttt tac aaa ttt att aag ccc atc ttg gaa aaa atg gac
1152Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp
370 375 380ggc acc gag gag ctg ctg gta aag ctt aac aga gaa gat ctg
ttg cgc 1200Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu
Leu Arg385 390 395 400aaa cag cgc act ttc gac aat gga agc atc ccc
cac cag att cac ctg 1248Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro
His Gln Ile His Leu 405 410 415ggc gaa ctg cac gct atc ctc agg cgg
caa gag gat ttc tac ccc ttt 1296Gly Glu Leu His Ala Ile Leu Arg Arg
Gln Glu Asp Phe Tyr Pro Phe 420 425 430ttg aaa gat aac agg gaa aag
att gag aaa atc ctc aca ttt cgg ata 1344Leu Lys Asp Asn Arg Glu Lys
Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445ccc tac tat gta ggc
ccc ctc gcc cgg gga aat tcc aga ttc gcg tgg 1392Pro Tyr Tyr Val Gly
Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460atg act cgc
aaa tca gaa gag acc atc act ccc tgg aac ttc gag gaa 1440Met Thr Arg
Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu465 470 475
480gtc gtg gat aag ggg gcc tct gcc cag tcc ttc atc gaa agg atg act
1488Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr
485 490 495aac ttt gat aaa aat ctg cct aac gaa aag gtg ctt cct aaa
cac tct 1536Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys
His Ser 500 505 510ctg ctg tac gag tac ttc aca gtt tat aac gag ctc
acc aag gtc aaa 1584Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu
Thr Lys Val Lys 515 520 525tac gtc aca gaa ggg atg aga aag cca gca
ttc ctg tct gga gag cag 1632Tyr Val Thr Glu Gly Met Arg Lys Pro Ala
Phe Leu Ser Gly Glu Gln 530 535 540aag aaa gct atc gtg gac ctc ctc
ttc aag acg aac cgg aaa gtt acc 1680Lys Lys Ala Ile Val Asp Leu Leu
Phe Lys Thr Asn Arg Lys Val Thr545 550 555 560gtg aaa cag ctc aaa
gaa gac tat ttc aaa aag att gaa tgt ttc gac 1728Val Lys Gln Leu Lys
Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575tct gtt gaa
atc agc gga gtg gag gat cgc ttc aac gca tcc ctg gga 1776Ser Val Glu
Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590acg
tat cac gat ctc ctg aaa atc att aaa gac aag gac ttc ctg gac 1824Thr
Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600
605aat gag gag aac gag gac att ctt gag gac att gtc ctc acc ctt acg
1872Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr
610 615 620ttg ttt gaa gat agg gag atg att gaa gaa cgc ttg aaa act
tac gct 1920Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr
Tyr Ala625 630 635 640cat ctc ttc gac gac aaa gtc atg aaa cag ctc
aag agg cgc cga tat 1968His Leu Phe Asp Asp Lys Val Met Lys Gln Leu
Lys Arg Arg Arg Tyr 645 650 655aca gga tgg ggg cgg ctg tca aga aaa
ctg atc aat ggg atc cga gac 2016Thr Gly Trp Gly Arg Leu Ser Arg Lys
Leu Ile Asn Gly Ile Arg Asp 660 665 670aag cag agt gga aag aca atc
ctg gat ttt ctt aag tcc gat gga ttt 2064Lys Gln Ser Gly Lys Thr Ile
Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685gcc aac cgg aac ttc
atg cag ttg atc cat gat gac tct ctc acc ttt 2112Ala Asn Arg Asn Phe
Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700aag gag gac
atc cag aaa gca caa gtt tct ggc cag ggg gac agt ctt 2160Lys Glu Asp
Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu705 710 715
720cac gag cac atc gct aat ctt gca ggt agc cca gct atc aaa aag gga
2208His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly
725 730 735ata ctg cag acc gtt aag gtc gtg gat gaa ctc gtc aaa gta
atg gga 2256Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val
Met Gly 740 745 750agg cat aag ccc gag aat atc gtt atc gag atg gcc
cga gag aac caa 2304Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala
Arg Glu Asn Gln 755 760 765act acc cag aag gga cag aag aac agt agg
gaa agg atg aag agg att 2352Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg
Glu Arg Met Lys Arg Ile 770 775 780gaa gag ggt ata aaa gaa ctg ggg
tcc caa atc ctt aag gaa cac cca 2400Glu Glu Gly Ile Lys Glu Leu Gly
Ser Gln Ile Leu Lys Glu His Pro785 790 795 800gtt gaa aac acc cag
ctt cag aat gag aag ctc tac ctg tac tac ctg 2448Val Glu Asn Thr Gln
Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815cag aac ggc
agg gac atg tac gtg gat cag gaa ctg gac atc aat cgg 2496Gln Asn Gly
Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830ctc
tcc gac tac gac gtg gat cat atc gtg ccc cag tct ttt ctc aaa 2544Leu
Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 835 840
845gat gat tct att gat aat aaa gtg ttg aca aga tcc gat aaa aat aga
2592Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg
850 855 860ggg aag agt gat aac gtc ccc tca gaa gaa gtt gtc aag aaa
atg aaa 2640Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys
Met Lys865 870 875 880aat tat tgg cgg cag ctg ctg aac gcc aaa ctg
atc aca caa cgg aag 2688Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu
Ile Thr Gln Arg Lys 885 890 895ttc gat aat ctg act aag gct gaa cga
ggt ggc ctg tct gag ttg gat 2736Phe Asp Asn Leu Thr Lys Ala Glu Arg
Gly Gly Leu Ser Glu Leu Asp 900 905 910aaa gcc ggc ttc atc aaa agg
cag ctt gtt gag aca cgc cag atc acc 2784Lys Ala Gly Phe Ile Lys Arg
Gln Leu Val Glu Thr Arg Gln Ile Thr 915 920 925aag cac gtg gcc caa
att ctc gat tca cgc atg aac acc aag tac gat 2832Lys His Val Ala Gln
Ile Leu
Asp Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940gaa aat gac aaa ctg
att cga gag gtg aaa gtt att act ctg aag tct 2880Glu Asn Asp Lys Leu
Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser945 950 955 960aag ctg
gtc tca gat ttc aga aag gac ttt cag ttt tat aag gtg aga 2928Lys Leu
Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965 970
975gag atc aac aat tac cac cat gcg cat gat gcc tac ctg aat gca gtg
2976Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val
980 985 990gta ggc act gca ctt atc aaa aaa tat ccc aag ctt gaa tct
gaa ttt 3024Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser
Glu Phe 995 1000 1005gtt tac gga gac tat aaa gtg tac gat gtt agg
aaa atg atc gca 3069Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys
Met Ile Ala 1010 1015 1020aag tct gag cag gaa ata ggc aag gcc acc
gct aag tac ttc ttt 3114Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala
Lys Tyr Phe Phe 1025 1030 1035tac agc aat att atg aat ttt ttc aag
acc gag att aca ctg gcc 3159Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr
Glu Ile Thr Leu Ala 1040 1045 1050aat gga gag att cgg aag cga cca
ctt atc gaa aca aac gga gaa 3204Asn Gly Glu Ile Arg Lys Arg Pro Leu
Ile Glu Thr Asn Gly Glu 1055 1060 1065aca gga gaa atc gtg tgg gac
aag ggt agg gat ttc gcg aca gtc 3249Thr Gly Glu Ile Val Trp Asp Lys
Gly Arg Asp Phe Ala Thr Val 1070 1075 1080cgg aag gtc ctg tcc atg
ccg cag gtg aac atc gtt aaa aag acc 3294Arg Lys Val Leu Ser Met Pro
Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095gaa gta cag acc gga
ggc ttc tcc aag gaa agt atc ctc ccg aaa 3339Glu Val Gln Thr Gly Gly
Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105 1110agg aac agc gac
aag ctg atc gca cgc aaa aaa gat tgg gac ccc 3384Arg Asn Ser Asp Lys
Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120 1125aag aaa tac
ggc gga ttc gat tct cct aca gtc gct tac agt gta 3429Lys Lys Tyr Gly
Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140ctg gtt
gtg gcc aaa gtg gag aaa ggg aag tct aaa aaa ctc aaa 3474Leu Val Val
Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155agc
gtc aag gaa ctg ctg ggc atc aca atc atg gag cga tca agc 3519Ser Val
Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser 1160 1165
1170ttc gaa aaa aac ccc atc gac ttt ctc gag gcg aaa gga tat aaa
3564Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys
1175 1180 1185gag gtc aaa aaa gac ctc atc att aag ctt ccc aag tac
tct ctc 3609Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser
Leu 1190 1195 1200ttt gag ctt gaa aac ggc cgg aaa cga atg ctc gct
agt gcg ggc 3654Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser
Ala Gly 1205 1210 1215gag ctg cag aaa ggt aac gag ctg gca ctg ccc
tct aaa tac gtt 3699Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser
Lys Tyr Val 1220 1225 1230aat ttc ttg tat ctg gcc agc cac tat gaa
aag ctc aaa ggg tct 3744Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys
Leu Lys Gly Ser 1235 1240 1245ccc gaa gat aat gag cag aag cag ctg
ttc gtg gaa caa cac aaa 3789Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe
Val Glu Gln His Lys 1250 1255 1260cac tac ctt gat gag atc atc gag
caa ata agc gaa ttc tcc aaa 3834His Tyr Leu Asp Glu Ile Ile Glu Gln
Ile Ser Glu Phe Ser Lys 1265 1270 1275aga gtg atc ctc gcc gac gct
aac ctc gat aag gtg ctt tct gct 3879Arg Val Ile Leu Ala Asp Ala Asn
Leu Asp Lys Val Leu Ser Ala 1280 1285 1290tac aat aag cac agg gat
aag ccc atc agg gag cag gca gaa aac 3924Tyr Asn Lys His Arg Asp Lys
Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300 1305att atc cac ttg ttt
act ctg acc aac ttg ggc gcg cct gca gcc 3969Ile Ile His Leu Phe Thr
Leu Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320ttc aag tac ttc
gac acc acc ata gac aga aag cgg tac acc tct 4014Phe Lys Tyr Phe Asp
Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335aca aag gag
gtc ctg gac gcc aca ctg att cat cag tca att acg 4059Thr Lys Glu Val
Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345 1350ggg ctc
tat gaa aca aga atc gac ctc tct cag ctc ggt gga gac 4104Gly Leu Tyr
Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp 1355 1360 1365agc
agg gct gac 4116Ser Arg Ala Asp 137041372PRTArtificial
SequenceSynthetic Construct 4Met Asp Lys Lys Tyr Ser Ile Gly Leu
Asp Ile Gly Thr Asn Ser Val1 5 10 15Gly Trp Ala Val Ile Thr Asp Glu
Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30Lys Val Leu Gly Asn Thr Asp
Arg His Ser Ile Lys Lys Asn Leu Ile 35 40 45Gly Ala Leu Leu Phe Asp
Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60Lys Arg Thr Ala Arg
Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys65 70 75 80Tyr Leu Gln
Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 85 90 95Phe Phe
His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105
110His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr
115 120 125His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu
Val Asp 130 135 140Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu
Ala Leu Ala His145 150 155 160Met Ile Lys Phe Arg Gly His Phe Leu
Ile Glu Gly Asp Leu Asn Pro 165 170 175Asp Asn Ser Asp Val Asp Lys
Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190Asn Gln Leu Phe Glu
Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205Lys Ala Ile
Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220Leu
Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn225 230
235 240Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn
Phe 245 250 255Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp
Thr Tyr Asp 260 265 270Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly
Asp Gln Tyr Ala Asp 275 280 285Leu Phe Leu Ala Ala Lys Asn Leu Ser
Asp Ala Ile Leu Leu Ser Asp 290 295 300Ile Leu Arg Val Asn Thr Glu
Ile Thr Lys Ala Pro Leu Ser Ala Ser305 310 315 320Met Ile Lys Arg
Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335Ala Leu
Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345
350Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser
355 360 365Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys
Met Asp 370 375 380Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu
Asp Leu Leu Arg385 390 395 400Lys Gln Arg Thr Phe Asp Asn Gly Ser
Ile Pro His Gln Ile His Leu 405 410 415Gly Glu Leu His Ala Ile Leu
Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430Leu Lys Asp Asn Arg
Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445Pro Tyr Tyr
Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460Met
Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu465 470
475 480Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met
Thr 485 490 495Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro
Lys His Ser 500 505 510Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu
Leu Thr Lys Val Lys 515 520 525Tyr Val Thr Glu Gly Met Arg Lys Pro
Ala Phe Leu Ser Gly Glu Gln 530 535 540Lys Lys Ala Ile Val Asp Leu
Leu Phe Lys Thr Asn Arg Lys Val Thr545 550 555 560Val Lys Gln Leu
Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575Ser Val
Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585
590Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp
595 600 605Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr
Leu Thr 610 615 620Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu
Lys Thr Tyr Ala625 630 635 640His Leu Phe Asp Asp Lys Val Met Lys
Gln Leu Lys Arg Arg Arg Tyr 645 650 655Thr Gly Trp Gly Arg Leu Ser
Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670Lys Gln Ser Gly Lys
Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685Ala Asn Arg
Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700Lys
Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu705 710
715 720His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys
Gly 725 730 735Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys
Val Met Gly 740 745 750Arg His Lys Pro Glu Asn Ile Val Ile Glu Met
Ala Arg Glu Asn Gln 755 760 765Thr Thr Gln Lys Gly Gln Lys Asn Ser
Arg Glu Arg Met Lys Arg Ile 770 775 780Glu Glu Gly Ile Lys Glu Leu
Gly Ser Gln Ile Leu Lys Glu His Pro785 790 795 800Val Glu Asn Thr
Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815Gln Asn
Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825
830Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys
835 840 845Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys
Asn Arg 850 855 860Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val
Lys Lys Met Lys865 870 875 880Asn Tyr Trp Arg Gln Leu Leu Asn Ala
Lys Leu Ile Thr Gln Arg Lys 885 890 895Phe Asp Asn Leu Thr Lys Ala
Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905 910Lys Ala Gly Phe Ile
Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915 920 925Lys His Val
Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940Glu
Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser945 950
955 960Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val
Arg 965 970 975Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu
Asn Ala Val 980 985 990Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys
Leu Glu Ser Glu Phe 995 1000 1005Val Tyr Gly Asp Tyr Lys Val Tyr
Asp Val Arg Lys Met Ile Ala 1010 1015 1020Lys Ser Glu Gln Glu Ile
Gly Lys Ala Thr Ala Lys Tyr Phe Phe 1025 1030 1035Tyr Ser Asn Ile
Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1040 1045 1050Asn Gly
Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu 1055 1060
1065Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val
1070 1075 1080Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys
Lys Thr 1085 1090 1095Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser
Ile Leu Pro Lys 1100 1105 1110Arg Asn Ser Asp Lys Leu Ile Ala Arg
Lys Lys Asp Trp Asp Pro 1115 1120 1125Lys Lys Tyr Gly Gly Phe Asp
Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140Leu Val Val Ala Lys
Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155Ser Val Lys
Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser 1160 1165 1170Phe
Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180
1185Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu
1190 1195 1200Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser
Ala Gly 1205 1210 1215Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro
Ser Lys Tyr Val 1220 1225 1230Asn Phe Leu Tyr Leu Ala Ser His Tyr
Glu Lys Leu Lys Gly Ser 1235 1240 1245Pro Glu Asp Asn Glu Gln Lys
Gln Leu Phe Val Glu Gln His Lys 1250 1255 1260His Tyr Leu Asp Glu
Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys 1265 1270 1275Arg Val Ile
Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1280 1285 1290Tyr
Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300
1305Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala
1310 1315 1320Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr
Thr Ser 1325 1330 1335Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His
Gln Ser Ile Thr 1340 1345 1350Gly Leu Tyr Glu Thr Arg Ile Asp Leu
Ser Gln Leu Gly Gly Asp 1355 1360 1365Ser Arg Ala Asp
1370583DNAStreptococcus pyogenes 5gttttagagc tagaaatagc aagttaaaat
aaggctagtc cgttatcaac ttgaaaaagt 60ggcaccgagt cggtggtgct ttt
836665DNASaccharomyces cerevisiae 6tttcaaaaat tcttactttt tttttggatg
gacgcaaaga agtttaataa tcatattaca 60tggcattacc accatataca tatccatata
catatccata tctaatctta cttatatgtt 120gtggaaatgt aaagagcccc
attatcttag cctaaaaaaa ccttctcttt ggaactttca 180gtaatacgct
taactgctca ttgctatatt gaagtacgga ttagaagccg ccgagcgggt
240gacagccctc cgaaggaaga ctctcctccg tgcgtcctcg tcttcaccgg
tcgcgttcct 300gaaacgcaga tgtgcctcgc gccgcactgc tccgaacaat
aaagattcta caatactagc 360ttttatggtt atgaagagga aaaattggca
gtaacctggc cccacaaacc ttcaaatgaa 420cgaatcaaat taacaaccat
aggatgataa tgcgattagt tttttagcct tatttctggg 480gtaattaatc
agcgaagcga tgatttttga tctattaaca gatatataaa tgcaaaaact
540gcataaccac tttaactaat actttcaaca ttttcggttt gtattacttc
ttattcaaat 600gtaataaaag tatcaacaaa aaattgttaa tatacctcta
tactttaacg tcaaggagaa 660aaaac 665721DNAArtificial
SequenceSynthetic Nuclear transition signalCDS(1)..(21) 7ccc aag
aag aag agg aag gtg 21Pro Lys Lys Lys Arg Lys Val1 587PRTArtificial
SequenceSynthetic Construct 8Pro Lys Lys Lys Arg Lys Val1
5915DNAArtificial SequenceSynthetic GS linkerCDS(1)..(15) 9ggt gga
gga ggt tct 15Gly Gly Gly Gly Ser1 5105PRTArtificial
SequenceSynthetic Construct 10Gly Gly Gly Gly Ser1
511188DNASaccharomyces cerevisiae 11gcgaatttct tatgatttat
gatttttatt attaaataag ttataaaaaa aataagtgta 60tacaaatttt aaagtgactc
ttaggtttta aaacgaaaat tcttattctt gagtaactct 120ttcctgtagg
tcaggttgct ttctcaggta tagcatgagg tcgctcttat tgaccacacc 180tctaccgg
18812417DNASaccharomyces cerevisiae 12ataccaggca tggagcttat
ctggtccgtt cgagttttcg acgagtttgg agacattctt 60tatagatgtc cttttttttt
aatgatattc gttaaagaac aaaaagtcaa agcagtttaa 120cctaacacct
gttgttgatg ctacttgaaa caaggcttct aggcgaatac ttaaaaaggt
180aatttcaata gcggtttata tatctgtttg cttttcaaga tattatgtaa
acgcacgatg 240tttttcgccc aggctttatt ttttttgttg ttgttgtctt
ctcgaagaat tttctcgggc 300agatctttgt cggaatgtaa aaaagcgcgt
aattaaactt tctattatgc tgactaaaat 360ggaagtgatc accaaaggct
atttctgatt atataatcta gtcattactc gctcgag 41713171DNAArtificial
SequenceSynthetic SH3 domainCDS(1)..(171) 13gca gag tat gtg cgg gcc
ctc ttt gac ttt aat ggg aat gat gaa gaa 48Ala Glu
Tyr Val Arg Ala Leu Phe Asp Phe Asn Gly Asn Asp Glu Glu1 5 10 15gat
ctt ccc ttt aag aaa gga gac atc ctg aga atc cgg gat aag cct 96Asp
Leu Pro Phe Lys Lys Gly Asp Ile Leu Arg Ile Arg Asp Lys Pro 20 25
30gaa gag cag tgg tgg aat gca gag gac agc gaa gga aag agg ggg atg
144Glu Glu Gln Trp Trp Asn Ala Glu Asp Ser Glu Gly Lys Arg Gly Met
35 40 45att cct gtc cct tac gtg gag aag tat 171Ile Pro Val Pro Tyr
Val Glu Lys Tyr 50 551457PRTArtificial SequenceSynthetic Construct
14Ala Glu Tyr Val Arg Ala Leu Phe Asp Phe Asn Gly Asn Asp Glu Glu1
5 10 15Asp Leu Pro Phe Lys Lys Gly Asp Ile Leu Arg Ile Arg Asp Lys
Pro 20 25 30Glu Glu Gln Trp Trp Asn Ala Glu Asp Ser Glu Gly Lys Arg
Gly Met 35 40 45Ile Pro Val Pro Tyr Val Glu Lys Tyr 50
551533DNAArtificial SequenceSynthetic SH3-binding
ligandCDS(1)..(33) 15cct cca cct gct ctg cca cct aag aga agg aga
33Pro Pro Pro Ala Leu Pro Pro Lys Arg Arg Arg1 5
101611PRTArtificial SequenceSynthetic Construct 16Pro Pro Pro Ala
Leu Pro Pro Lys Arg Arg Arg1 5 1017269DNASaccharomyces cerevisiae
17tctttgaaaa gataatgtat gattatgctt tcactcatat ttatacagaa acttgatgtt
60ttctttcgag tatatacaag gtgattacat gtacgtttga agtacaactc tagattttgt
120agtgccctct tgggctagcg gtaaaggtgc gcattttttc acaccctaca
atgttctgtt 180caaaagattt tggtcaaacg ctgtagaagt gaaagttggt
gcgcatgttt cggcgttcga 240aacttctccg cagtgaaaga taaatgatc
2691814DNASaccharomyces cerevisiae 18tgttttttat gtct
141920DNASaccharomyces cerevisiae 19aacccaggtg cctggggtcc
202020DNASaccharomyces cerevisiae 20ataacggaat ccaactgggc
202110DNASaccharomyces cerevisiae 21tgautgcatg
102210DNASaccharomyces cerevisiae 22catgcagtca
102310DNASaccharomyces cerevisiae 23tgactgcatg
102423DNASaccharomyces cerevisiae 24tgacttgact gcatgacctg act
232523DNASaccharomyces cerevisiae 25agtcaggtca tgcagtcaag tca
232610RNASaccharomyces cerevisiae 26ugacugcaug
102713DNASaccharomyces cerevisiae 27gcatgacctg act 13
* * * * *