Production Of Organic Acids From Aspergillus Cis-aconitic Acid Decarboxylase (cada) Deletion Strains

Abstract

This application provides recombinant Aspergillus fungi having an endogenous cis-aconitic acid decarboxylase (cadA) gene genetically inactivated, which allows aconitic acid production by the recombinant fungi. Such recombinant fungi can further include an exogenous nucleic acid molecule encoding aspartate decarboxylase (panD), an exogenous nucleic acid molecule encoding .beta.-alanine-pyruvate aminotransferase (BAPAT), and an exogenous nucleic acid molecule encoding 3-hydroxypropironate dehydrogenase (HPDH). Kits including these fungi, and methods of using these fungi to produce aconitic acid and 3-hydroxypropionic acid (3-HP) are also provided.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional of U.S. application Ser. No. 16/393,149 filed Apr. 24, 2019, which claims priority to U.S. Provisional Application No. 62/661,804 filed Apr. 24, 2018, both herein incorporated by reference in their entireties.

FIELD

[0003] Recombinant Aspergillus genetically inactivated for an endogenous cis-aconitic acid decarboxylase (cadA) gene are provided, as are methods of using such recombinant fungi to produce aconitic acid and 3-hydroxypropionic acid (3-HP).

BACKGROUND

[0004] Itaconic acid (IA) is utilized as a monomer or co-monomer to form polymers that are used as raw material for plastics, resins, synthetic fibers and elastomers, detergents and cleaners. Aspergillus terreus Thom, produces an appreciable amount of itaconic acid when grown in a glucose medium. Cell-free extracts of Aspergillus terreus contain cis-aconitic decarboxylase (cadA), which can decarboxylate cis-aconitic acid into equal moles of itaconic acid and carbon dioxide.

[0005] The itaconic acid gene cluster (IA cluster) includes four genes, including cis-aconitic acid decarboxylase (cadA), a predicted transcription factor (tf), mitochondrial organic acid transporter (mttA), and MFS (Major Facilitator Superfamily) type transporter (mfsA) located in plasma membranes. Expression of one or more genes of the IA gene cluster in hetereologous hosts, including E. coli, A. niger, and S. cerevisiae, can result in the production of itaconic acid in non itaconic acid host microorganisms.

[0006] Characterization and regulation of genes in the IA biosynthesis cluster through gene deletion had not been previously investigated. The inventors used protoplast transformation to delete each gene in the IA cluster in Aspergillus terreus/Aspergillus pseudoterreus, which allowed for the effect on cell growth and IA production to be investigated.

SUMMARY

[0007] The role of cis-aconitic acid decarboxylase (cadA), a predicted transcription factor (tf), mitochondrial organic acid transporter (mttA), and MFS (Major Facilitator Superfamily) type transporter (mfsA) in IA biosynthesis in A. pseudoterreus ATCC 32359 is shown herein. Expressed Sequence Tag (EST) analysis showed a similar expression pattern among those four genes distinct from neighboring genes. Systematic gene deletion analysis demonstrated that tf, cadA, mttA and mfsA genes in the cluster are essential for IA production. Interestingly, significant amounts of aconitic acid production was detected in the cadA deletion strain but not in the other deletion strains.

[0008] Based on these observations, a novel recombinant .DELTA.cadA Aspergillus strain is provided, which can be used for aconitic acid and other organic acid production. Provided herein are isolated recombinant fungi (such as Aspergillus filamentous fungi) having a gene inactivation (also referred to herein as a gene deletion or functional deletion) of a cis-aconitic acid decarboxylase (cadA) gene (referred to herein as AcadA strains). In some examples, the Aspergillus fungi is Aspergillus terreus or Aspergillus pseudoterreus, or particular strains thereof (for example A. pseudoterreus ATCC32359 and A. terreus NRRL 1960). In particular examples, a .DELTA.cadA strain exhibits one or more of the following characteristics: produces at least 2-fold, at least 3-fold,at least 3.5 fold, at least 5-fold, at least 8-fold, or at least 10-fold more total aconitic acid than a wild-type Aspergillus terreus or Aspergillus pseudoterreus (for example at day 3, 4, 5, 6, 7, 8, 9 or 10 of production); produces at least 2-fold more cis-aconitic acid at day 5, 6, 7, 8, 9, or 10 of culturing in Riscaldati medium than a wild-type Aspergillus terreus or Aspergillus pseudoterreus; produces at least 2-fold, at least 3-fold, at least 5-fold, or at least 10- fold more trans-aconitic acid at day 10 of culturing in Riscaldati medium than a wild-type Aspergillus terreus or Aspergillus pseudoterreus; or combinations thereof. In some examples, such increases are relative to Aspergillus terreus strain ATCC 32359 grown under the same conditions.

[0009] In particular examples, a .DELTA.cadA fungi further includes an exogenous nucleic acid molecule encoding aspartate 1-decarboxylase (panD), an exogenous nucleic acid molecule encoding .beta.-alanine-pyruvate aminotransferase (BAPAT), and an exogenous nucleic acid molecule encoding 3-hydroxypropionate dehydrogenase (HPDH). The .DELTA.cadA fungi expressing panD, BAPAT, and HPDH can be used to produce 3-HP. Such exogenous nucleic acid molecules can be part of one or more exogenous nucleic acid molecules, such as 1, 2 or 3 exogenous nucleic acid molecules. In one example, the exogenous nucleic acid molecule encoding panD has at least 80%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to SEQ ID NO: 53 or 65 and/or encodes a panD protein having at least 80%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to SEQ ID NO: 54. In one example, the exogenous nucleic acid molecule encoding BAPAT has at least 80% , at least 90%, at least 95%, at least 98%, or 100% sequence identity to SEQ ID NO: 55, and/or encodes a BAPAT protein having at least 80%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to SEQ ID NO: 56. In one example, the exogenous nucleic acid molecule encoding HPDH has at least 80%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to SEQ ID NO: 57, and/or encodes a HPDH protein having at least 80%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to SEQ ID NO: 58. Such panD, BAPAT, and HPDH nucleic acid molecules can be part of a vector. In addition, expression of the panD, BAPAT, and HPDH can be driven by one or more promoters.

[0010] The endogenous cadA gene is genetically inactivated in some examples by a deletion mutation (complete or partial) or by insertional mutation (e.g., by insertion of an antibiotic resistance gene, such as hygromycin). In some examples, prior to its genetic inactivation, the cadA gene encodes a protein having at least 80%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to SEQ ID NO: 50 or 52. In some examples, prior to its genetic inactivation, the cadA gene (or a cadA coding sequence) comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to SEQ ID NO: 49, 51, 59 or 92.

[0011] Also provided herein are compositions (such as a culture media or fermentation broth) and kits that include a Aspergillus .DELTA.cadA strain. Also provided herein are compositions (such as a culture media or fermentation broth) and kits that include an Aspergillus AcadA strain that also express panD, BAPAT, and HPDH, in some examples such genes are exogenous to the fungi. In some examples, the composition or kit includes Riscaldati medium (such as modified Riscaldati medium with 20.times. trace elements).

[0012] Also provided herein are methods of making aconitic acid (such as cis-aconitic acid, trans-aconitic acid, or both) using the disclosed Aspergillus .DELTA.cadA strains. For example, such a method can include culturing an isolated .DELTA.cadA Aspergillus under conditions that permit the fungus to make aconitic acid, thereby producing aconitic acid. For example, the AcadA fungus can be cultured in Riscaldati medium. In some examples, the method further includes isolating the aconitic acid produced, for example isolating it from the culture media or from the fungus.

[0013] Also provided herein are methods of making 3-hydroxypropionic acid (3-HP using the disclosed Aspergillus .DELTA.cadA strains that also expresses panD, BAPAT, and HPDH (which can be exogenous). For example, such a method can include culturing an isolated .DELTA.cadA Aspergillus that also expresses panD, BAPAT, and HPDH under conditions that permit the fungus to make 3-HP, thereby producing 3-HP. For example, the .DELTA.cadA fungus that also expresses panD, BAPAT, and HPDH can be cultured in Riscaldati medium (such as one including 20.times. trace elements). In some examples, the method further includes isolating the 3-HP produced, for example isolating it from the culture media or from the fungus.

[0014] The foregoing and other objects and features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

[0015] FIG. 1. Hypothesized itaconic acid (IA) production and transport pathway in Aspergillus pseudoterreus and Aspergillus terreus. Glucose is utilized by A. terreus and A. pseudoterreus to form pyruvate and is subsequently converted to citric acid for tricarboxylic acid (TCA) cycle in the mitochondria. Citric acid is dehydrated to cis-aconitic acid, which is then transported from mitochondria to cytosol through transporter mttA. In the cytosol, cis-aconitic acid is decarboxylated into itaconic acid and CO2 by cis-aconitic decarboxylase. Finally, itaconic acid secreted outside of cell through transporters, for example mfsA.

[0016] FIG. 2. Aspergillus pseudoterreus ATCC 32359 fermentation data for collecting samples for EST sequencing. A 20 L volume of Riscaldati production medium (see Riscaldati et al., J Biotechnol 2000, 83:219-230) in a 30 L working volume Sartorius fermenter was inoculated with 10.sup.6 A. pseudoterreus spores per ml. The three samples referred to as "preproduction, production onset and production" were collected at 40, 50 and 62 hours, respectively. Itaconic acid and glucose data are shown on the left y-axis and fungal ash free dry weight (AFDW) is shown on the right y-axis.

[0017] FIGS. 3A-3B. Aspergillus pseudoterreus IA Cluster Analysis after five days growth in Riscadati medium. Spores 0.5.times.10.sup.8 were inoculated into 50 ml of production media for IA production as described in Riscaldati et al. (J Biotechnol 2000, 83:219-230). The cultivation was performed at 30.degree. C. on a rotary shaker at 150 rpm. At the end of five days, samples were obtained for HPLC analysis and biomass measurement. (A) Dry mass measurement of wild type and mutant strains (B) Itaconic acid production of wild type and mutant strains. The average obtained from three independent experiments are shown. Error bars represent standard deviations from the means.

[0018] FIG. 4. Kinetics of itaconic acid production by wild type A. pseudoterreus and .DELTA.tf strains grown in production media at 30.degree. C. Spores 0.5.times.10.sup.8 were inoculated into 50 ml of production media for itaconic acid production as described in Riscaldati et al. (J Biotechnol 2000, 83:219-230). The cultivation was performed at 30.degree. C. on a rotary shaker at 150 rpm. All experiments were done in three replicates. At day 2, 4, 6, and 7, HPLC analysis was performed to determine amount of IA produced. Each sample was measured in five replicates. Error bars represent standard deviation from the means.

[0019] FIG. 5. Real-time (RT)-PCR analysis of the relative levels of mttA, cadA, mfsA mRNAs in wild type and .DELTA.tf strains. Spores 0.5.times.10.sup.8 were inoculated into 50 ml of production media for itaconic acid production as described in Riscaldati et al. (J Biotechnol 2000, 83:219-230). The cultivation was performed at 30.degree. C. on a rotary shaker at 150 rpm. All experiments were done in three biological replicates. At day 3, samples were collected and RNA was extracted for RT-PCR. The average of results obtained from five independent RNA preparations is shown. All transcript levels were measured in triplicate for each RNA preparation. Error bars represent standard deviations from the means. Compared to wild type, expression level of mttA, cadA and mfsA were decreased 57, 37 and 23 fold in the .DELTA.tf strain.

[0020] FIGS. 6A-6C. Aconitic acid production in .DELTA.cadA strain. The cultivation was performed at 30.degree. C. on a rotary shaker at 150 rpm. All experiments were done in three biological replicates. (A) at day 5, only .DELTA.cadA produced cis-aconitic and trans-aconitic acid, while wild type and other mutants did not. (B) Time course of cis- and trans-aconitic acid production in .DELTA.cad strain over 10 days. (C) Comparison of total aconitic acid production between wild type and .DELTA.cadA mutant strains.

[0021] FIG. 7. Arrangement of transgene expression cassette for 3-HP Production in A. pseudoterreus with a synthetic beta-alanine pathway. A description of each Fragment is described in Example 8. The relevant fragments were cloned into pBlueScript SK(-) vector linearized with restriction enzyme H3/PstI. The whole expression cassette was linearized with restriction enzyme Xhol for the protoplast transformation for homologous recombination at cadA locus.

[0022] FIG. 8. Southern blot confirmation of cadA gene interruption by 3HP transgene expression cassette (FIG. 7). The cadA gene in the transgenic strains #2 (3HP-2) and #6 (3HP-6) was disrupted by the homologous recombination, while the random integration occurred in the strains #4 (3HP-4) and #5 (3HP-5). No insertion was observed in strains #1 and #3.

[0023] FIGS. 9A-9B. 3-HP production. A. pseudoterreus having a genetically inactivated cadA locus alone (cad1.DELTA.), or additionally expressing panD, BAPAT, and HPDH (3HP-2, 3HP-4, 3HP-5, and 3-HP6), were grown at 30.degree. C. on a rotary shaker at 200 rpm for (A) 7 days, or (B) over 8 days, in the Riscaldati media with 20.times. TE, and 3-HP present in the supernatant measured using HPLC.

SEQUENCE LISTING

[0024] The nucleic acid sequences listed in the accompanying sequence listing are shown using standard abbreviations for nucleotide bases and amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The sequence listing submitted herewith, generated on Feb. 5, 2021, 80 kb, is herein incorporated by reference. In the accompanying sequence listing:

[0025] SEQ ID NOS: 1-8 are primers used to delete the tf gene in A. pseudoterreus.

[0026] SEQ ID NOS: 9-16 are primers used to delete the mttA gene in A. pseudoterreus.

[0027] SEQ ID NOS: 17-24 are primers used to delete the cadA gene in A. pseudoterreus.

[0028] SEQ ID NOS: 25-32 are primers used to delete the mfsA gene in A. pseudoterreus.

[0029] SEQ ID NOS: 33-40 are primers used to delete the p450 gene in A. pseudoterreus.

[0030] SEQ ID NOS: 41-42 are primers used to amplify mttA in A. pseudoterreus.

[0031] SEQ ID NOS: 43-44 are primers used to amplify cadA in A. pseudoterreus.

[0032] SEQ ID NOS: 45-46 are primers used to amplify mfsA in A. pseudoterreus.

[0033] SEQ ID NOS: 47-48 are primers used to amplify benA in A. pseudoterreus.

[0034] SEQ ID NOS: 49 and 50 are exemplary cadA nucleic acid and protein sequences, respectively, from A. terreus (GenBank Accession Nos. AB326105.1 and BAG49047.1).

[0035] SEQ ID NOS: 51 and 52 are exemplary cadA nucleic acid and protein sequences, respectively, from A. vadensis CBS 113365 (GenBank Accession Nos. XM_025706777.1 and XP_025563141.1).

[0036] SEQ ID NOS: 53 and 54 are exemplary aspartate 1-decarboxylase (panD) nucleic acid and protein sequences, respectively, from Tribolium castaneum (GenBank Accession Nos. NM_001102585.1 and NP_001096055.1). Coding sequence nt 41-1663.

[0037] SEQ ID NOS: 55 and 56 are exemplary .beta.-alanine-pyruvate aminotransferase (BAPAT) nucleic acid and protein sequences, respectively, from Bacillus cereus AH1272 (GenBank Accession Nos. ACMS01000158.1 (complement (10606 . . . 11961)) and EEL86940.1).

[0038] SEQ ID NOS: 57 and 58 are exemplary 3-hydroxypropionate dehydrogenase (HPDH) nucleic acid and protein sequences (GenBank Accession No. WP_000636571), respectively.

[0039] SEQ ID NO: 59 is an A. pseudoterreus 5'-cadA nucleic acid sequence.

[0040] SEQ ID NOS: 60-61 are primers used to isolate an A. pseudoterreus 5'-cadA gene.

[0041] SEQ ID NO: 62 is an A. niger gpdA promoter nucleic acid sequence.

[0042] SEQ ID NOS: 63-64 are primers used to isolate an A. niger gpdA promoter.

[0043] SEQ ID NO: 65 is panD cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus.

[0044] SEQ ID NOS: 66-67 are primers used to isolate panD cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus.

[0045] SEQ ID NO: 68 is a bidirectional terminator from A. niger elf3/multifunctional chaperone.

[0046] SEQ ID NOS: 69-70 are primers used to isolate bidirectional terminator from A. niger elf3/multifunctional chaperone.

[0047] SEQ ID NO: 71 is codon optimized synthetic cDNA of .beta.-alanine-pyruvate aminotransferase (BAPAT) of Bacillus cereus.

[0048] SEQ ID NOS: 72-73 are primers used to isolate a codon optimized synthetic cDNA of BAPAT of Bacillus cereus.

[0049] SEQ ID NO: 74 is an A. niger eno1 promoter.

[0050] SEQ ID NOS: 75-76 are primers used to isolate an A. niger eno1 promoter.

[0051] SEQ ID NO: 77 is an A. nidulans gpdA promoter.

[0052] SEQ ID NOS: 78-79 are primers used to isolate an A. nidulans gpdA promoter.

[0053] SEQ ID NO: 80 is the codon optimized synthetic cDNA of E. coli 3-hydroxypropionate dehydrogenase (HPDH).

[0054] SEQ ID NOS: 81-82 are primers used to isolate a codon optimized synthetic cDNA of E. coli HPDH.

[0055] SEQ ID NO: 83 is a trpC terminator of A. nidulans.

[0056] SEQ ID NOS: 84-85 are primers used to isolate the trpC terminator of A. nidulans.

[0057] SEQ ID NO: 86 is a trpC terminator of A. nidulans.

[0058] SEQ ID NOS: 87-88 are primers used to isolate a trpC terminator of A. nidulans.

[0059] SEQ ID NO: 89 is an A. oryzae ptrA selection marker gene.

[0060] SEQ ID NOS: 90-91 are primers used to isolate the A. oryzae ptrA selection marker gene.

[0061] SEQ ID NO: 92 is an A. pseudoterreus 3'-cadA gene.

[0062] SEQ ID NOS: 93-94 are primers used to isolate an A. pseudoterreus 3'-cadA gene fragment.

[0063] SEQ ID NO: 95 is a combination of Fragments 7 to 9 (SEQ ID NOS: 77, 80, and 83, respectively).

[0064] SEQ ID NO: 96 is a primer used to isolate Fragments 7 to 9 (in combination with SEQ ID NO: 88).

[0065] SEQ ID NO: 97 is a combination of Fragments 11 and 12 (SEQ ID NOS: 89 and 92, respectively).

[0066] SEQ ID NO: 98 is a primer used to isolate Fragments 11 to 12 (in combination with SEQ ID NO: 90).

DETAILED DESCRIPTION

[0067] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

[0068] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Hence "comprising A or B" means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, references and Genbank.RTM. Accession numbers (the sequence available on Apr. 24, 2019) mentioned herein are incorporated by reference in their entireties. The materials, methods, and examples are illustrative only and not intended to be limiting.

[0069] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

[0070] 3-hydroxypropionate dehydrogenase (HPDH): EC 1.1.1.59 An enzyme that catalyzes the chemical reaction: 3-hydroxypropanoate+NAD.sup..+-..revreaction.3-oxopropanoate+NADH+H.sup.+- . The term HPDH includes any HPDH gene (such as a bacterial or fungal panD sequence), cDNA, mRNA, or protein, that is a HPDH that can covert 3-hydroxypropanoate and NAD.sup.+ into 3-oxopropanoate, NADH, and H.sup.+ and vice versa. Expression or increased expression of HPDH, for example in an Aspergillus also expressing BAPAT and panD and having a genetically inactivated cadA gene (.DELTA.cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0071] HPDH sequences are publicly available. For example, SEQ ID NO: 57 discloses an HPDH coding sequence and GenBank.RTM. Accession No: WP_000636571 discloses an HPDH protein sequence (SEQ ID NO: 58); GenBank.RTM. Accession Nos. FR729477.2 (nt 1005136 . . . 1005885) and CBY27203.1 disclose exemplary Yersinia enterocolitica subsp. palearctica Y11 HPDH nucleic acid and protein sequences, respectively; and GenBank.RTM. Accession Nos: CP004083.1 (complement(1399227 . . . 1399973) and AJQ99264.1 disclose exemplary Enterobacteriaceae bacterium bta3-1 HPDH nucleic acid and protein sequences, respectively. However, one skilled in the art will appreciate that in some examples, a HPDH sequence can include variant sequences (such as allelic variants and homologs) that retain HPDH activity and when expressed in an Aspergillus also expressing BAPAT and panD and with a genetically inactivated cadA gene (.DELTA.cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0072] Aconitic acid: An organic acid with two isomers, cis- and trans-aconitic acid. The .DELTA.cadA fungi provided herein can be used to produce cis- and trans-aconitic acid.

##STR00001##

[0073] Aspartate 1-decarboxylase (panD): EC 4.1.1.11. An enzyme that catalyzes the chemical reaction: L-aspartate.revreaction.beta-alanine+CO.sub.2. The term panD includes any panD gene (such as a bacterial or fungal panD sequence), cDNA, mRNA, or protein, that is a panD that can covert L-aspartate into beta-alanine+CO.sub.2 and vice versa. Expression or increased expression of panD, for example in an Aspergillus also expressing BAPAT and HPDH and having a genetically inactivated cadA gene (.DELTA.cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions)

[0074] panD sequences are publicly available. For example, GenBank.RTM. Accession Nos: NM_001102585.1 and NP_001096055.1 disclose Tribolium castaneum panD nucleic acid and protein sequences, respectively (SEQ ID NOS: 55 and 56); GenBank.RTM. Accession Nos. CP002745.1 (complement(4249351 . . . 4249824)) and AEK63458.1 disclose exemplary Collimonas fungivorans Ter331 panD nucleic acid and protein sequences, respectively; and GenBank.RTM. Accession Nos: CP029034.1 (nt 1201611 . . . 1201994) and AWE15802.1 disclose exemplary Bacillus velezensis panD nucleic acid and protein sequences, respectively. However, one skilled in the art will appreciate that in some examples, a panD sequence can include variant sequences (such as allelic variants and homologs) that retain panD activity and when expressed in an Aspergillus also expressing BAPAT and HPDH and with a genetically inactivated cadA gene (.DELTA.cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0075] .beta.-alanine-pyruvate aminotransferase (BAPAT): EC 2.6.1.18. An enzyme that can catalyze the reaction L-alanine+3-oxopropanoate.revreaction.beta-alanine+pyruvate. The term BAPAT includes any BAPAT gene (such as a bacterial or fungal panD sequence), cDNA, mRNA, or protein, that is a BAPAT that can convert beta-alanine and pyuvate to L-alanine and 3-oxopropanoate [or malonic semialdehyde], and vice versa. Expression or increased expression of BAPAT, for example in an Aspergillus also expressing HPDH and panD and having a genetically inactivated cadA gene (.DELTA.cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0076] BAPAT sequences are publicly available. For example, GenBank.RTM. Accession Nos: ACMS01000158.1 (complement(10606 . . . 11961)) and EEL86940.1 disclose Bacillus cereus AH1272 BAPAT nucleic acid and protein sequences, respectively (SEQ ID NOS: 55 and 56); GenBank.RTM. Accession Nos. DF820429.1 (complement (241627 . . . 242967)) and GAK28710.1disclose exemplary Serratia liquefaciens FK01 BAPAT nucleic acid and protein sequences, respectively; and GenBank Accession Nos: LGUJ01000001.1 complement (92812 . . . 94140) and KOY12524.1 disclose exemplary Bradyrhizobium diazoefficiens BAPAT nucleic acid and protein sequences, respectively. However, one skilled in the art will appreciate that in some examples, a BAPAT sequence can include variant sequences (such as allelic variants and homologs) that retain BAPAT activity and when expressed in an Aspergillus also expressing HPDH and panD and with a genetically inactivated cadA gene (AcadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0077] cadA (cis-aconitic acid decarboxylase): The cadA gene encodes an enzyme (EC 4.1.1.6) that catalyzes the chemical reaction cis-aconitate.revreaction.itaconate+CO.sub.2. The term cadA (or cadA) includes any cadA gene (such as a fungal cadA sequence), cDNA, mRNA, or protein, that is a cadA that can catalyze the decarboxylation of cis-aconitate to itaconate and CO.sub.2 and vice versa, and when genetically inactivated results in a fungus that produces more aconitic acid than the parent strain without a genetically inactivated cadA gene (such as at least 20%, at least 30%, at least 50%, at least 60%, at least 75%, at least 100%, at least 200%, at least 500%, or 1000% more than a parent strain under the same growing conditions, for example at day 5 of production). In some examples, a parental strain containing a functional native cadA sequence does not produce detectable aconitic acid. In some examples, genetic inactivation of cadA results in a fungus that produces more trans-aconitic acid than cis-aconitic acid at day 10 of production, (such as at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold more at day 10 of production).

[0078] cadA sequences are publicly available for many species of Aspergillus. For example, GenBank.RTM. Accession Nos: AB326105.1 and BAG49047.1 disclose Aspergillus terreus cadA nucleic acid and protein sequences, respectively (SEQ ID NOS: 49 and 50); GenBank.RTM. Accession Nos: XM_025706777.1 and XP_025563141.1 disclose Aspergillus vadensis CBS 113365 cadA nucleic acid and protein sequences, respectively (SEQ ID NOS: 51 and 52); and GenBank.RTM. Accession Nos: XM_025663103.1 and XP_025520527.1 disclose Aspergillus piperis CBS 112811 cadA nucleic acid and protein sequences, respectively. However, one skilled in the art will appreciate that in some examples, a cadA sequence can include variant sequences (such as allelic variants and homologs) that retain cadA activity but when genetically inactivated in Aspergillus results in a fungus that has an ability to produce more aconitic acid than the parent strain without a genetically inactivated cadA gene (such as at least 20%, at least 30%, at least 50%, at least 60%, at least 75%, at least 100%, at least 200%, at least 500%, or 1000% more than a parent strain under the same growing conditions, for example at day 5 of production).

[0079] Detectable: Capable of having an existence or presence ascertained. For example, production of aconitic acid or 3-HP is detectable if the signal generated is strong enough to be measurable.

[0080] Exogenous: The term "exogenous" as used herein with reference to nucleic acid and a particular cell refers to any nucleic acid that does not originate from that particular cell as found in nature. Thus, a non-naturally-occurring nucleic acid is considered to be exogenous to a cell once introduced into the cell. A nucleic acid that is naturally-occurring also can be exogenous to a particular cell. For example, an entire chromosome isolated from cell X is an exogenous nucleic acid with respect to cell Y once that chromosome is introduced into cell Y, even if X and Y are the same cell type.

[0081] In some examples, the panD, BAPAT, and HPDH nucleic acid or protein expressed in an Aspergillus terreus or Aspergillus pseudoterreus fungi does not naturally occur in the Aspergillus terreus or Aspergillus pseudoterreus fungi and is therefore exogenous to that fungi. For example, the panD, BAPAT, and HPDH nucleic acid molecule introduced into an Aspergillus terreus or Aspergillus pseudoterreus fungi can be from another organism, such as a bacterial panD, BAPAT, and HPDH sequence.

[0082] Genetic enhancement or up-regulation: When used in reference to the expression of a nucleic acid molecule, such as a gene, refers to any process which results in an increase in production of a gene product. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Examples of processes that increase transcription include those that facilitate formation of a transcription initiation complex, those that increase transcription initiation rate, those that increase transcription elongation rate, those that increase processivity of transcription and those that relieve transcriptional repression (for example by blocking the binding of a transcriptional repressor). Gene up-regulation can include inhibition of repression as well as expression above an existing level. Examples of processes that increase translation include those that increase translational initiation, those that increase translational elongation and those that increase mRNA stability. In one example, additional copies of genes are introduced into a cell in order to increase expression of that gene in the resulting transgenic cell.

[0083] Gene up-regulation includes any detectable increase in the production of a gene product. In certain examples, production of a gene product increases by at least 1.5-fold, at least 2-fold, or at least 5-fold), such as aspartate decarboxylase (panD), .beta.-alanine-pyruvate aminotransferase (BAPAT), and 3-hydroxypropironate dehydrogenase (HPDH). For example, expression of a panD, BAPAT, and HPDH genes in Aspergillus (e.g., A. terreus) results in an Aspergillus strain having increased levels of the panD, BAPAT, and HPDH proteins, respectively, relative to the parent strain, which can permit the recombinant fungus to produce 3-HP. Genetic enhancement is also referred to herein as "enhancing or increasing expression."

[0084] Genetic inactivation or down-regulation: When used in reference to the expression of a nucleic acid molecule, such as a gene, refers to any process which results in a decrease in production of a gene product. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Therefore, gene down-regulation or deactivation includes processes that decrease transcription of a gene or translation of mRNA.

[0085] For example, a mutation, such as a substitution, partial or complete deletion, insertion, or other variation, can be made to a gene sequence that significantly reduces (and in some cases eliminates) production of the gene product or renders the gene product substantially or completely non-functional. For example, a genetic inactivation of the cadA gene in Aspergillus (e.g., A. pseudoterreus) results in Aspergillus having a non-functional or non-existent cadA protein, which results in the recombinant fungus to produce more aconitic acid. Genetic inactivation is also referred to herein as "functional deletion".

[0086] Isolated: To be significantly separated from other agents. An "isolated" biological component (such as a nucleic acid molecule or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component occurs, for example, other chromosomal and extra-chromosomal DNA and RNA, and proteins. Nucleic acid molecules and proteins which have been "isolated" include nucleic acid molecules and proteins purified by standard purification methods. The term also embraces nucleic acid molecules and proteins prepared by recombinant expression in a host cell as well as chemically synthesized proteins and nucleic acids. Samples of isolated biological components include samples of the biological component wherein the biological component represents greater than 90% (for example, greater than 95%, such as greater than 98%) of the sample.

[0087] An "isolated" microorganism (such as a .DELTA.cadA strain of Aspergillus) has been substantially separated or purified away from microorganisms of different types, strains, or species. Microorganisms can be isolated by a variety of techniques, including serial dilution and culturing and resistance to certain chemicals, such as antibiotics. In some examples, an isolated AcadA strain of Aspergillus is at least 90% (for example, at least 95%, as at least 98%, at least 99%, or at least 99.99%) pure.

[0088] Mutation: A change in a nucleic acid sequence (such as a gene sequence) or amino acid sequence, for example as compared to a nucleic acid or amino acid sequence present in a wild-type or native organism. In particular examples, a mutation is introduced into a cadA gene in Aspergillus. Mutations can occur spontaneously, or can be introduced, for example using molecular biology methods (e.g., thereby generating a recombinant or transformed cell or microorganism). In particular examples, a mutation includes one or more nucleotide substitutions, deletions, insertions, or combinations thereof. In particular examples, the presence of one or more mutations in a gene can significantly inactivate and reduce expression of that gene.

[0089] Promoter: An array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. In some examples, a promoter is bi-directional. Native and non-native promoters can be used to drive expression of a gene, such as panD, BAPAT, and HPDH. Exemplary promoters that can be used include but are not limited to: eno1 promoter from A. niger, and dthl from A. nidulans or A. niger.

[0090] Examples of promoters include, but are not limited to the SV40 promoter, the CMV enhancer-promoter, and the CMV enhancer/.beta.-actin promoter. Both constitutive and inducible promoters can be used in the methods provided herein (see e.g., Bitter et al., Methods in Enzymology 153:516-544, 1987). Also included are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell-type specific, tissue-specific, or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the gene. Promoters produced by recombinant DNA or synthetic techniques can also be used to provide for transcription of the nucleic acid sequences.

[0091] Recombinant: A recombinant nucleic acid molecule or protein is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. In particular examples, this artificial combination is accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques such as those described in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 3d ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001. The term recombinant includes nucleic acid molecules that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid molecule. A recombinant or transformed organism or cell, such as a recombinant Aspergillus, is one that includes at least one exogenous nucleic acid molecule, such as one used to genetically inactivate an endogenous cadA gene, and one used to express a non-native protein, such as exogenous panD, BAPAT, and HPDH nucleic acid coding sequences.

[0092] Sequence identity/similarity: The identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are.

[0093] Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

[0094] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, Md. 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.

[0095] BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options can be set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seq1.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2.

[0096] To compare two amino acid sequences, the options of B12seq can be set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seq1.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.

[0097] Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1166 matches when aligned with a test sequence having 1554 nucleotides is 75.0 percent identical to the test sequence (i.e., 1166/1554*100=75.0). The percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. The length value will always be an integer. In another example, a target sequence containing a 20-nucleotide region that aligns with 20 consecutive nucleotides from an identified sequence as follows contains a region that shares 75 percent sequence identity to that identified sequence (i.e., 15/20*100=75).

[0098] For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). Homologs are typically characterized by possession of at least 70% sequence identity counted over the full-length alignment with an amino acid sequence using the NCBI Basic Blast 2.0, gapped blastp with databases such as the nr or swissprot database. Queries searched with the blastn program are filtered with DUST (Hancock and Armstrong, 1994, Comput. Appl. Biosci. 10:67-70). Other programs use SEG. In addition, a manual alignment can be performed. Proteins with even greater similarity will show increasing percentage identities when assessed by this method, such as at least 75%, 80%, 85%, 90%, 95%, or 99% sequence identity.

[0099] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode identical or similar (conserved) amino acid sequences, due to the degeneracy of the genetic code. Changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein. Such homologous nucleic acid sequences can, for example, possess at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity determined by this method.

[0100] One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is possible that strongly significant homologs could be obtained that fall outside the ranges provided. Thus, a variant cadA, panD, BAPAT, or HPDH protein or nucleic acid molecule that can be used with the organisims and methods of the present disclosure can have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the SEQ ID NOs: and GenBank.RTM. Accession Nos. provided herein.

[0101] Transformed: A cell, such as a fungal cell, into which a nucleic acid molecule has been introduced, for example by molecular biology methods. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including, but not limited to chemical methods (e.g., calcium-phosphate transfection), physical methods (e.g., electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), receptor-mediated endocytosis (e.g., DNA-protein complexes, viral envelope/capsid-DNA complexes) and by biological infection by viruses such as recombinant viruses. In one example, the protoplast transformation provide herein, such as in Example 1, is used.

[0102] Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed or recombinant host cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. A vector may also include a panD, BAPAT, or HPDH coding sequence, or a sequence used to genetically inactivate cadA for example in combination with a promoter, and/or selectable marker genes, and other genetic elements. A vector can transduce, transform or infect a cell, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell. A vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a viral particle, liposome, protein coating or the like. In one example, a vector is a plasmid.

Overview

[0103] The filamentous fungus Aspergillus pseudoterreus has been used for industrial production of itaconic acid. cis-aconitic acid decarboxylase (cadA) is the key enzyme in itaconic acid production. The itaconic acid biosynthesis cluster is composed of genes tf, mttA, cadA and mfsA. As shown in FIG. 1, itaconic acid (IA) is produced from glucose. Glucose is utilized in the cell mainly by the glycolytic pathway and metabolized to pyruvate, which forms citric acid. cis-aconitic acid is derived from citric acid as a primary precursor of IA. cis-aconitic acid decarboxylase (cadA) removes carbon dioxide from cis-aconitic acid and forms itaconic acid. However, cadA is localized in the cytosol, while cis-aconitic acid is formed from the TCA cycle in the mitochondria. mttA is localized on the mitochondrial membrane and functiond to transport cis-aconitic acid from mitochondria to cytosol. Another transporter, mfsA is also an organic acid transporter that may be involved in exporting itaconic acid out of cells.

[0104] The first demonstration of genetically inactivating the cadA gene in Aspergillus pseudoterreus is shown herein. In the cadA deletion strain (.DELTA.cadA), no more itaconic acid is produced. At the same time significant amount of cis-aconitic acid and trans-aconitic acid are detected. Blocking the itaconic acid production pathway permits the carbon to be diverted towards other organic acid production. The .DELTA.cadA Aspergillus can be used as a host for chemical platform, and provides a new way to produce aconitic acid and other organic acids (for example by expressing other genes needed for procution of those acids, such as panD, BAPAT, and HPDH for 3-HP production). This strain works as biocatalyst that converts biomass into aconitic acid through bioproduction method at room temperature (such as about 20-35.degree. C.) and ordinary pressure (such as about 1 atm). Current processes of aconitic acid production include chemical synthesis that require high temperatures and harmful reagents.

[0105] The EST data provided herein demonstrated that four genes, tf, cadA, mttA and mfsA show high transcription frequency after IA production starts, but not before IA production begins. The high expression of these genes persists through the production process. Genes upstream and downstream of the cluster did not show expression differences before and after production. One gene downstream next to mfsA, a p450 enzyme, also showed high expression after IA production started, however, deletion of this gene did not effect IA yield.

[0106] Correlations between the IA gene cluster and IA production were further investigated by constructing deletion strains. In a .DELTA.cad strain, no IA was detected, while trace amounts of IA were detected in an mttA knockout. IA production in an mfsA deletion strain decreased one third compared with wild type. This indicates mfsA can transport IA across the cell membrane. In the .DELTA.tf strain, IA production decreased eight fold and slowed the production rate compared to wild type. Also in the tf deletion strain, expression of cadA, mttA and mfsA significantly decreased. RT-PCR results indicated that the expression level of genes in the IA cluster was regulated by tf, which is turned on by IA production conditions.

[0107] The .DELTA.cadA strain produced aconitc acid. During the production, cis-aconitic acid was detected first, followed by the appearance of trans-aconitic acid. cis-aconitic acid levels remained consistent from day 5 forward. The trans-aconitic acid levels continued to increase from days 4 to 10. By day 10, more than 10g/L trans-aconitic acid was detected in the supernatant. In the .DELTA.cadA strain, cis-aconitic acid decarboxylase is not produced, and the cis-aconitic acid cannot be converted to itaconic acid by decarboxylation and accumulates in the cell. cis-aconitic acid was transported outside the cell. cis-aconitic acid is not stable in the acid solution and is rapidly converted into trans-aconitic acid.

[0108] Aconitic acid is an unsaturated tricarcoxylic acid and is noted as a top 30 potential building block by United States Department of Energy (DOE). Trans-aconitic acid can be used to make polymers. Currently, trans-aconitc acid is produced by chemical synthesis and requires high temperature and harmful solvents. Generation of trans-aconitic acid has been achieved by metabolic engineering aconitase isomerase from Pseudomonas sp. WU-0701 into E. coli. However, the substrate for the recombinant E. coli to produce trans-aconitic acid is citric acid, which has to be generated first from fermentation. In contrast, the disclosed .DELTA.cadA fungi can produce trans-aconitic acid directly from renewable biomass substrates. Also since the cadA is not functional and precursors from TAC cycle accumulate in the cell, the carbon can be rerouted to generate other organic acid since A. pseudoterreus is industrial filamentous fungi and tolerant to low pH.

[0109] Based on these observations, provided herein are isolated recombinant (i.e., transformed) Aspergillus fungi that include a genetic inactivation (also referred to as a functional deletion) of an endogenous cis-aconitic acid decarboxylase (cadA) gene. Such fungi are referred to herein as .DELTA.cadA fungi. Exemplary Aspergillus species that can be used include Aspergillus pseudoterreus and Aspergillus terreus. In some examples, the endogenous cadA gene is genetically inactivated by mutation (such as a complete or partial deletion of the cadA gene) or by insertional mutation (such as by insertion of another nucleic acid molecule into the cadA gene, such as an antibiotic resistance marker).

[0110] In some examples, the cadA gene prior to its genetic inactivation encodes a protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 50 or 52. In some examples, the cadA gene (or its coding sequence) prior to its genetic inactivation comprises at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 49, 51, 59 or 92.

[0111] The disclosed .DELTA.cadA fungi can include other exogenous genes to express proteins needed to permit the fungi to produce other organic acids. For example, the disclosed .DELTA.cadA fungi can further include an exogenous nucleic acid molecule encoding aspartate 1-decarboxylase (panD), an exogenous nucleic acid molecule encoding .beta.-alanine-pyruvate aminotransferase (BAPAT), and an exogenous nucleic acid molecule encoding 3-hydroxypropionate dehydrogenase (HPDH). panD, BAPAT, and HPDH coding sequences can be part of a one or more nucleic acid molecules, such as a vector. In addition, expression of the panD, BAPAT, and HPDH coding sequences can be driven by one or more promoters, such as a bi-directional promoter. In some examples, the promoter is native to the gene it is expressing. In some examples, the promoter is from A. niger. In some examples, the panD, BAPAT, and/or HPDH coding sequences are inserted into the cadA gene, genetically inactivating cadA. In some examples, the exogenous nucleic acid molecule encoding panD has at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 53 or 65, and/or encodes a panD protein comprising at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 54. In some examples, the exogenous nucleic acid molecule encoding BAPAT has at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 55, and/or encodes a BAPAT protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 56. In some examples, the exogenous nucleic acid molecule encoding HPDH has at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 57, and/or encodes a HPDH protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 58.

[0112] The disclosure also provides compositions that include the .DELTA.cadA fungi, and the .DELTA.cadA fungi expressing other genes (such as panD, BAPAT, and HPDH). Such a composition can include a solid or liquid culture or growth media, such as complete media, minimal media, or Riscaldati medium (such as modified Riscaldati medium with 20.times. trace elements).

[0113] The disclosure also provides kits that include the .DELTA.cadA fungi, and the .DELTA.cadA fungi expressing other genes (such as panD, BAPAT, and HPDH). Such a kits can include a solid or liquid culture or growth media, such as complete media, minimal media, or Riscaldati medium (such as modified Riscaldati medium with 20.times. trace elements).

[0114] Also provided are methods of using the disclosed .DELTA.cadA fungi to make aconitic acid. Such a method can include culturing the recombinant Aspergillus .DELTA.cadA fungi under conditions that permit the fungus to make aconitic acid, such as growth in Riscaldati medium, thereby making aconitic acid. In some examples the aconitic acid generated is cis-aconitic acid, trans-aconitic acid, or both. In some examples, the fungi are cultured at room temperature (e.g., 20-35.degree. C.) at normal atmospheric pressure (e.g., 1 atm). In some examples, the method includes purifying or isolating the aconitic acid, for example from the culture media or from the cultured fungus. In some examples, the aconitic acid is isolated at least 2 days, at least 3 days, at least 5 days, at least 8 days or at least 10 days after the start of culturing, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the start of culturing.

[0115] Also provided are methods of using the disclosed .DELTA.cadA fungi expressing panD, BAPAT, and HPDH to make 3-HP. Such a method can include culturing the recombinant Aspergillus .DELTA.cadA fungi expressing panD, BAPAT, and HPDH under conditions that permit the fungus to make 3-HP, such as growth in Riscaldati medium (such as modified Riscaldati medium with 20.times. trace elements), thereby making 3-HP. In some examples, the fungi are cultured at room temperature (e.g., 20-35.degree. C.) at normal atmospheric pressure (e.g., 1 atm). In some examples, the method includes purifying or isolating the 3-HP, for example from the culture media or from the cultured fungus. In some examples, the 3-HP is isolated at least 2 days, at least 3 days, at least 5 days, at least 8 days or at least 10 days after the start of culturing, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the start of culturing.

Recombinant .DELTA.cadA Fungi

[0116] The present disclosure provides isolated recombinant Aspergillus fungi having its endogenous cadA gene genetically inactivated (e.g., functional deletion) of. Such fungi are referred to herein as .DELTA.cadA fungal strains. It is shown herein that .DELTA.cadA Aspergillus strains have increased aconitic acid production as compared to Aspergillus having native levels of cadA expression.

[0117] Any variety or strain of Aspergillus can be used. In particular examples, the Aspergillus fungus is A. terreus or A. pseudoterreus, as well as particular strains thereof (for example A. terreus NRRL 1960, A. pseudoterreus ATCC 32359).

[0118] In addition, any method for genetic inactivation can be used, as long as the expression of the cadA gene is significantly reduced or eliminated, or the function of the cadA protein is significantly reduced or eliminated. In particular examples, the cadA gene is genetically inactivated by complete or partial deletion mutation or by insertional mutation. In some examples genetic inactivation need not be 100%. In some embodiments, genetic inactivation refers to at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% gene or protein inactivation. The term "reduced" or "decreased" as used herein with respect to a cell and a particular gene or protein activity refers to a lower level of activity than that measured in a comparable cell of the same species. For example, a particular A. terreus or A. pseudoterreus lacking cadA activity has reduced cadA activity if a comparable A. terreus or A. pseudoterreus not having an cadA genetic inactivation has detectable cadA activity.

[0119] cadA sequences are disclosed herein and others are publicly available, for example from GenBank or EMBL. In some examples, the cadA gene functionally deleted encoded a protein having at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 50 or 52 prior to is genetic inactivation. In some examples, the endogenous cadA gene functionally deleted comprises at least 80%, at least 90%, at least 95%, at least 97%, or at least 98% sequence identity to SEQ ID NO: 49, 51, 59, or 92 prior to is genetic inactivation.

[0120] The genetic inactivation of cadA results in many phenotypes in the recombinant .DELTA.cadA Aspergillus, such as A. terreus or A. pseudoterreus. For example, .DELTA.cadA mutants can have one or more of the following phenotypes: produces at least 2-fold, at least 3-fold,at least 3.5 fold, at least 5-fold, at least 8-fold, or at least 10-fold more total aconitic acid than a wild-type Aspergillus terreus or Aspergillus pseudoterreus (for example at day 3, 4, 5, 6, 7, 8, 9 or 10 of production); produces at least 2-fold more cis-aconitic acid at day 5, 6, 7, 8, 9, or 10 of culturing in Riscaldati medium than a wild-type Aspergillus terreus or Aspergillus pseudoterreus; produces at least 2-fold, at least 3-fold, at least 5-fold, or at least 10-fold more trans-aconitic acid at day 10 of culturing in Riscaldati medium than a wild-type Aspergillus terreus or Aspergillus pseudoterreus; or combinations thereof. In some examples, such increases are relative to Aspergillus terreus strain ATCC 32359 grown under the same conditions as the .DELTA.cadA mutant. In some examples, an increased total aconitic acid production by .DELTA.cadA fungi occurs at least 3 days (such as at least 4, 5, 6, 7, 8, 9, or 10 days) after inoculation in Riscaldati medium (such as at least 0.5 g/L aconitic acid or at least 1 g/L aconitic acid), as compared to no detectable aconitic acid produced by Aspergillus terreus strain ATCC 32359 at the same time point.

[0121] Additional genes can also be inactivated in the .DELTA.cadA fungi, wherein the additional genes may or may not provide additional enhancement of aconitic acid production to the fungus. In one example, the .DELTA.cadA fungi includes overexpressed or upregulated aconitic acid transporters.

[0122] In some examples, .DELTA.cadA fungi include one or more additional exogenous nucleic acid molecules, for example to permit production of other organic acids by the recombinant fungi. In one example, the .DELTA.cadA fungi includes an exogenous nucleic acid molecule encoding aspartate decarboxylase (panD), an exogenous nucleic acid molecule encoding .beta.-alanine-pyruvate aminotransferase (BAPAT), and an exogenous nucleic acid molecule encoding 3-hydroxypropironate dehydrogenase (HPDH). Such exogenous nucleic acid molecules can be part of one or more exogenous nucleic acid molecules (such as 1, 2 or 3 exogenous nucleic acid molecules). In some examples, exogenous nucleic acid molecules can be part of a vector, such as a plasmid or viral vector. In some examples, expression of the exogenous nucleic acid molecules is driven by one or more promoters, such as a constitutive or inducible promoter, or a bi-directional promoter. In some examples, the promoter used to drive expression of panD, BAPAT, and HPDH is a native promoter (e.g., native to the panD, BAPAT, and HPDH gene expressed). In other examples, the promoter used to drive expression of panD, BAPAT, and HPDH is a non-native promoter (e.g., exogenous to the panD, BAPAT, and HPDH gene expressed). In some examples, such a .DELTA.cadA fungi expressing panD, BAPAT, and HPDH are used to produce 3-HP.

[0123] A. Methods of Functionally Deleting cadA

[0124] As used herein, an "inactivated" or "functionally deleted" cadA gene means that the cadA gene has been mutated, for example by insertion, deletion, or substitution (or combinations thereof) of one or more nucleotides such that the mutation substantially reduces (and in some cases abolishes) expression or biological activity of the encoded cadA gene product. The mutation can act through affecting transcription or translation of the cadA gene or its mRNA, or the mutation can affect the cadA polypeptide product itself in such a way as to render it substantially inactive.

[0125] In one example, a strain of Aspergillus is transformed with a vector which has the effect of down-regulating or otherwise inactivating a cadA gene. This can be done by mutating control elements such as promoters and the like which control gene expression, by mutating the coding region of the gene so that any protein expressed is substantially inactive, or by deleting the cadA gene entirely. For example, a cadA gene can be functionally deleted by complete or partial deletion mutation (for example by deleting a portion of the coding region of the gene) or by insertional mutation (for example by inserting a sequence of nucleotides into the coding region of the gene, such as a sequence of about 1-5000 nucleotides). In one example, the cadA gene is genetically inactivated by inserting coding sequences for panD, BAPAT, and/or HPDH. Thus, the disclosure provides transformed fungi that include at least one exogenous nucleic acid molecule which genetically inactivates a cadA gene. In one example, such a transformed cell produces more aconitic acid, for example relative to a comparable fungus with a native or wild-type cadA sequence.

[0126] In particular examples, an insertional mutation includes introduction of a sequence that is in multiples of three bases (e.g., a sequence of 3, 9, 12, or 15 nucleotides) to reduce the possibility that the insertion will be polar on downstream genes. For example, insertion or deletion of even a single nucleotide that causes a frame shift in the open reading frame, which in turn can cause premature termination of the encoded cadA polypeptide or expression of a substantially inactive polypeptide. Mutations can also be generated through insertion of foreign gene sequences, for example the insertion of a gene encoding antibiotic resistance (such as hygromycin or bleomycin), or panD, BAPAT, and/or HPDH coding sequences.

[0127] In one example, genetic inactivation is achieved by deletion of a portion of the coding region of the cadA gene. For example, some, most (such as at least 50%) or virtually the entire coding region can be deleted. In particular examples, about 5% to about 100% of the gene is deleted, such as at least 20% of the gene, at least 40% of the gene, at least 75% of the gene, or at least 90% of the cadA gene.

[0128] Deletion mutants can be constructed using any of a number of techniques. In one example, homologous double crossover with fusion PCR products is employed to genetically inactivate one or more genes in Aspergillus. A specific example of such a method is described in Example 1 below.

[0129] In one example, a strategy using counterselectable markers can be employed which has been utilized to delete genes. For a review, see Reyrat et al. (Infec. Immun. 66:4011-4017, 1998). In this technique, a double selection strategy is employed wherein a plasmid is constructed encoding both a selectable and counterselectable marker, with flanking DNA sequences derived from both sides of the desired deletion. The selectable marker is used to select for fungi in which the plasmid has integrated into the genome in the appropriate location and manner. The counterselecteable marker is used to select for the very small percentage of fungi that have spontaneously eliminated the integrated plasmid. A fraction of these fungi will then contain only the desired deletion with no other foreign DNA present.

[0130] In another technique, the cre-lox system is used for site specific recombination of DNA (for example see Steiger et al., Appl. Environ. Microbiol. 77(1):114, 2011). The system includes 34 base pair lox sequences that are recognized by the bacterial cre recombinase gene. If the lox sites are present in the DNA in an appropriate orientation, DNA flanked by the lox sites will be excised by the cre recombinase, resulting in the deletion of all sequences except for one remaining copy of the lox sequence. Using standard recombination techniques, the targeted gene of interest (e.g., cadA) can be deleted in the Aspergillus genome and to replace it with a selectable marker (for example a gene coding for kanamycin resistance) that is flanked by the lox sites. Transient expression (by electroporation of a suicide plasmid containing the cre gene under control of a promoter that functions in Aspergillus) of the cre recombinase should result in efficient elimination of the lox flanked marker. This process will produce a mutant containing the desired deletion mutation and one copy of the lox sequence.

[0131] In another method, a cadA gene sequence in the Aspergillus genome is replaced with a marker gene, such as green fluorescent protein, .beta.-galactosidase, or luciferase. In this technique, DNA segments flanking a desired deletion are prepared by PCR and cloned into a suicide (non-replicating) vector for Aspergillus. An expression cassette, containing a promoter active in Aspergillus and the appropriate marker gene, is cloned between the flanking sequences. The plasmid is introduced into wild-type Aspergillus. Fungi that incorporate and express the marker gene are isolated and examined for the appropriate recombination event (replacement of the wild type cadA gene with the marker gene).

[0132] Thus, for example, a fungal cell can be engineered to have a disrupted cadA gene using common mutagenesis or knock-out technology. (Methods in Yeast Genetics (1997 edition), Adams, Gottschling, Kaiser, and Sterns, Cold Spring Harbor Press, 1998; Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97: 6640-5, 2000; and Dai et al., Appl. Environ. Microbiol. 70(4):2474-85, 2004). Alternatively, antisense technology can be used to reduce or eliminate the activity of cadA. For example, a fungal cell can be engineered to contain a cDNA that encodes an antisense molecule that prevents cadA from being translated. The term "antisense molecule" encompasses any nucleic acid molecule or nucleic acid analog (e.g., peptide nucleic acids) that contains a sequence that corresponds to the coding strand of an endogenous cadA gene. An antisense molecule also can have flanking sequences (e.g., regulatory sequences).

[0133] Thus, antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axehead structures, provided the molecule cleaves RNA. Further, gene silencing can be used to reduce the activity of cadA.

[0134] In one example, to genetically inactivate cadA in A. pseudoterreus or A. terreus, protoplast transformation is used, for example as described in Example 1. For example, conidia of A. pseudoterreus or A. terreus are grown in liquid complete medium at room temperature (e.g., about 20-35.degree. C., such as 30.degree. C.) and grown for at least 12 hours (such as at least 16 hours, or at least 18 hours, such as 12-24 hours, or 16-18 hours), at least 100 rpm, such as at least 150 rpm, for example 100 to 200 rpm. The resulting mycelia are subsequently harvested, for example by filtration. Protoplasts are prepared, for example by treating the harvested mycelia with a lysing enzyme (for example in an osmotic wash buffer for at least 30 min, at least 60 min, at least 120 min, or at leave 240 min, such as 2 h). The resulting protoplasts are collected (e.g., by filtering). Protoplasts can be washed, for example with a Washing Solution (0.6M KCl, 0.1M Tris/HCl, pH 7.0) and Conditioning Solution (0.6M KCl, 50 mM CaCl.sub.2, 10 mM Tris/HCl, pH 7.5). The protoplasts are transformed, for example in the conditioning solution. In some examples, at least 0.5 ug, at least 1 ug, or at least 2 ug of DNA (such as 1-2 ug DNA) is added to at least 10.sup.6 protoplasts (such as at least 10.sup.7 or 2.times.10.sup.7 protoplasts). Polyethylene glycol (PEG), such as PEG8000 is added (such as 25% PEG8000, 0.6M KCl, 50 mM CaCl.sub.2, 10 mM Tris/HCl, and pH 7.5) and the reaction incubated for at least 5 min (such as at least 10 min, at least 20 min, or at least 30 min, such as 10-30 min, 15-20 min, or 20 min) on ice. Additional PEG solution can be added and the reaction incubated for at least 1 min, at least 3 min, or at least 5 min, on ice. Conditioning Solution is added to the reaction, and the protoplast suspension mixed with warm selection agar (Minimal media+0.6M KCl+1.5% Agar+100 ug/ml hygromycin) (such as at 50.degree. C.), and poured directly onto petri dish plates and allowed to solidify. Solidified plates can be inverted and incubated overnight at room temperature (e.g., about 20-35.degree. C., such as 30.degree. C.). The following day, the plates can be overlaid with Minimal Medium containing a selection antibiotic, such as hygromycin. Colonies appear after 3-4 days. Transformants can be excised and transferred to MM plate containing the selection antibiotic.

[0135] B. Measuring Gene Inactivation

[0136] A fungus having an inactivated cadA gene can be identified using known methods. For example, PCR and nucleic acid hybridization techniques, such as Northern and Southern analysis, can be used to confirm that a fungus has a genetically inactivated cadA gene. In one example, real-time reverse transcription PCR (qRT-PCR) is used for detection and quantification of targeted messenger RNA, such as mRNA of cadA gene in the parent and mutant strains as grown at the same culture conditions. Immunohisto-chemical and biochemical techniques can also be used to determine if a cell expresses cadA by detecting the expression of the cadA peptide encoded by cadA. For example, an antibody having specificity for cadA can be used to determine whether or not a particular fungus contains a functional nucleic acid encoding cadA protein. Further, biochemical techniques can be used to determine if a cell contains a cadA gene inactivation by detecting a product produced as a result of the lack of expression of the peptide. For example, production of aconitic acid by A. terreus or A. pseudoterreus can indicate that such a fungus contains an inactivated cadA gene.

[0137] C. Measuring Aconitic Acid Production

[0138] Methods of determining whether a genetic inactivation of cadA in Aspergillus, such as A. terreus or A. pseudoterreus. increases aconitic acid production, for example relative to the same strain of A. terreus or A. pseudoterreus with a native cadA sequence (such as a parental strain), are provided herein. Although particular examples are disclosed herein, the methods are not limiting.

[0139] For example, production of aconitic acid by Aspergillus (such as a .DELTA.cadA strain) can be measured using a spectrophotometric assay, by liquid chromatography (LC), or high-pressure liquid chromatography (HPLC) methods. In some examples, the supernatant of the fungus is analyzed for the presence of aconitic acid. In some examples, the culture media containing the .DELTA.cadA strain is filtered prior to measuring aconitic acid in the culture media (supernatant).

[0140] D. cadA Sequences

[0141] cadA protein and nucleic acid sequences are publicly available and specific examples are provided herein. In addition, cadA sequences can be identified using molecular biology methods.

[0142] Examples of cadA nucleic acid sequences are shown in SEQ ID NOS: 49, 51, 59 and 92. However, the disclosure also encompasses variants of SEQ ID NOS: 49, 51, 59 and 92 which encode a functional cadA protein. One skilled in the art will understand variants of the cadA nucleic acid sequences provided herein can be genetically inactivated. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). In addition, the degeneracy of the code permits multiple nucleic acid sequences to encode the same protein. Such variant cadA nucleic acid molecules can share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any cadA nucleic acid sequence, such as SEQ ID NO: 49, 51, 59 or 92.

[0143] Examples of cadA protein sequences are shown in SEQ ID NOS: 50 and 52. However, the disclosure also encompasses variants SEQ ID NOS: 50 and 52 which retain cadA activity. One skilled in the art will understand that variants of these cadA enzyme sequences can be inactivated. Variant sequences can be identified, for example by aligning known cadA sequences. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). Such cadA peptides share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to a cadA protein sequence, such as SEQ ID NO: 50 or 52.

[0144] In some examples, a cadA sequence that is to be genetically inactivated encodes or includes one or more conservative amino acid substitutions. A conservative amino acid substitution is a substitution of one amino acid (such as one found in a native sequence) for another amino acid having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting peptide. In one example, a cadA sequence (such as SEQ ID NO: 50 or 52) includes one or more amino acid substitutions, such as conservative substitutions (for example at 1, 2, 5 or 10 residues). Examples of amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include: Ser for Ala; Lys for Arg; Gln or His for Asn; Glu for Asp; Ser for Cys; Asn for Gln; Asp for Glu; Pro for Gly; Asn or Gln for His; Leu or Val for Ile; Ile or Val for Leu; Arg or Gln for Lys; Leu or Ile for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr; Tyr for Trp; Trp or Phe for Tyr; and Ile or Leu for Val. Further information about conservative substitutions can be found in, among other locations in, Ben-Bassat et al., (J. Bacteriol. 169:751-7, 1987), O'Regan et al., (Gene 77:237-51, 1989), Sahin-Toth et al., (Protein Sci. 3:240-7, 1994), Hochuli et al., (Bio/Technology 6:1321-5, 1988), WO 00/67796 (Curd et al.) and in standard textbooks of genetics and molecular biology.

[0145] The cadA gene inactivated in a fungus, in particular examples, includes a sequence that encodes a cadA protein having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a cadA protein sequence, such as SEQ ID NO: 50 or 52, wherein the protein can catalyze the decarboxylation of cis-aconitate to itaconate and CO.sub.2 and vice versa. In a specific example, the cadA gene inactivated in a fungus encodes a cadA protein shown in SEQ ID NO: 50 or 52.

[0146] The cadA gene that is to be inactivated in a fungus, in particular examples, includes a sequence (such as a coding sequence) having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a cadA nucleic acid sequence, such as SEQ ID NO: 49, 51, 59, or 92, and encodes a cadA protein that can catalyze the decarboxylation of cis-aconitate to itaconate and CO.sub.2 and vice versa. In a specific example, cadA gene inactivated in a fungus is the sequence of SEQ ID NO: 2 or 4.

[0147] One skilled in the art will appreciate that additional cadA sequences can be identified. For example, cadA nucleic acid molecules that encode a cadA protein can be identified and obtained using molecular cloning or chemical nucleic acid synthesis procedures and techniques, including PCR. In addition, nucleic acid sequencing techniques and software programs that translate nucleic acid sequences into amino acid sequences based on the genetic code can be used to determine whether or not a particular nucleic acid has any sequence homology with known cadA sequences. Sequence alignment software such as MEGALIGN (DNASTAR, Madison, Wis., 1997) can be used to compare various sequences.

[0148] In addition, nucleic acid hybridization techniques can be used to identify and obtain a nucleic acid molecule that encodes a cadA protein. Briefly, any known cadA nucleic acid molecule, or fragment thereof, can be used as a probe to identify similar nucleic acid molecules by hybridization under conditions of moderate to high stringency. Such similar nucleic acid molecules then can be isolated, sequenced, and analyzed to determine whether the encoded protein is a cadA protein.

[0149] E. panD, BAPAT, and HPDH Sequences

[0150] panD, BAPAT, and HPDH protein and nucleic acid sequences are publicly available and specific examples are provided herein. In addition, panD, BAPAT, and HPDH sequences can be identified using molecular biology methods.

[0151] Exemplary of panD coding sequences are shown in SEQ ID NO: 53 and 65. However, the disclosure also encompasses variants of SEQ ID NO: 53 and 65 which encode a functional panD protein. Exemplary of BAPAT coding sequences are shown in SEQ ID NO: 55 and 71. However, the disclosure also encompasses variants of SEQ ID NO: 55 and 71 which encode a functional BAPAT protein. Exemplary of HPDH coding sequences are shown in SEQ ID NO: 57 and 80. However, the disclosure also encompasses variants of SEQ ID NO: 57 and 80 which encode a functional HPDH protein.

[0152] One skilled in the art will understand variants of the panD, BAPAT, and HPDH nucleic acid sequences provided herein can be introduced into an Aspergillus fungus, such as one that is .DELTA.cadA, such as inserting panD, BAPAT, and HPDH expression sequences into the native cadA gene.to inactivate it. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). In addition, the degeneracy of the code permits multiple nucleic acid sequences to encode the same protein. In some examples, a panD, BAPAT, and HPDH sequence that is to be expressed in an Aspergillus fungus is codon optimized for expression in Aspergillus, such as Aspergillus terreus or pseudoterreus. Such variant panD, BAPAT, and HPDH nucleic acid molecules in some examples share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any panD, BAPAT, and HPDH nucleic acid sequence, such as SEQ ID NO: 53, 55, or 57, respectively, or SEQ ID NO: 65, 71, or 80, respectively.

[0153] Exemplary panD, BAPAT, and HPDH protein sequences are shown in SEQ ID NOS: 54, 56, and 58, respectively. However, the disclosure also encompasses variants SEQ ID NOS: 54, 56, and 58 which retain panD, BAPAT, and HPDH activity, respectively. One skilled in the art will understand that variants of these panD, BAPAT, and HPDH sequences can be expressed in an Aspergillus fungus, such as one that is .DELTA.cadA, Variant sequences can be identified, for example by aligning known panD, BAPAT, and HPDH sequences. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). Such panD, BAPAT, and HPDH peptides expressed in a.DELTA.cadA fungus in some examples share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to a panD, BAPAT, and HPDH protein sequence, such as SEQ ID NO: 54, 56, or 58, respectively.

[0154] In some examples, a panD, BAPAT, and HPDH sequence that is to be expressed in an Aspergillus fungus encodes or includes one or more conservative amino acid substitutions. In one example, a panD, BAPAT, or HPDH sequence (such as SEQ ID NO: 54, 56, or 58, respectively) includes one or more amino acid substitutions, such as conservative substitutions (for example at 1, 2, 5, or 10 residues). Examples of conservative substitutions are provided elsewhere herein.

[0155] The panD, BAPAT, and HPDH gene expressed in a fungus, in particular examples, includes a sequence that encodes a panD, BAPAT, and HPDH protein having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a panD, BAPAT, and HPDH protein sequence, such as SEQ ID NO: 54, 56, or 58, respectively, wherein the variant protein has the biological activity of panD, BAPAT, or HPDH , respectively. In a specific example, the panD, BAPAT, and HPDH gene expressed in a .DELTA.cadA fungus encodes the protein shown in SEQ ID NO: 54, 56, and 58, respectively.

[0156] One skilled in the art will appreciate that additional panD, BAPAT, and HPDH sequences can be identified. For example, panD, BAPAT, and HPDH nucleic acid molecules that encode a panD, BAPAT, and HPDH protein, respectively can be identified and obtained using molecular cloning or chemical nucleic acid synthesis procedures and techniques, including PCR. In addition, nucleic acid sequencing techniques and software programs that translate nucleic acid sequences into amino acid sequences based on the genetic code can be used to determine whether or not a particular nucleic acid has any sequence homology with panD, BAPAT, or HPDH sequences. Sequence alignment software such as MEGALIGN (DNASTAR, Madison, Wis., 1997) can be used to compare various sequences.

[0157] In addition, nucleic acid hybridization techniques can be used to identify and obtain a nucleic acid molecule that encodes a panD, BAPAT, or HPDH protein. Briefly, any known panD, BAPAT, or HPDH nucleic acid molecule, or fragment thereof, can be used as a probe to identify similar nucleic acid molecules by hybridization under conditions of moderate to high stringency. Such similar nucleic acid molecules then can be isolated, sequenced, and analyzed to determine whether the encoded protein is a panD, BAPAT, or HPDH protein.

[0158] In one example, exogenous panD, BAPAT, and/or HPDH nucleic acid sequences are introduced into A. pseudoterreus or A. terreus using protoplast transformation, for example as described in Example 1 (and described above).

[0159] F. Methods of Increasing panD, BAPAT, and HPDH Expression

[0160] In some examples, a native A. pseudoterreus or A. terreus fungi does not have or express panD, BAPAT, and/or HPDH nucleic acid sequences. Thus, in some examples, expression of these genes is increased by introducing panD, BAPAT, and/or HPDH nucleic acid coding sequences (such may be codon optimized) into the A. pseudoterreus or A. terreus fungi.

[0161] In some examples, a native A. pseudoterreus or A. terreus fungi does express native panD, BAPAT, and/or HPDH nucleic acid sequences. Thus, in some examples, expression of these genes is upregulated by introducing additional copies of panD, BAPAT, and/or HPDH nucleic acid coding sequences (such may be codon optimized) into the A. pseudoterreus or A. terreus fungi. As used herein, "up-regulated" gene means that expression of the gene or gene product (e.g., protein) has been up-regulated, for example by introduction of additional copies of the appropriate gene or coding sequence into the fungus (or other molecular biology methods), such that the introduced nucleic acid sequence is expressed, resulting in increased expression or biological activity of the encoded gene product. In some embodiments, introduction of one or more transgenes including panD, BAPAT, and/or HPDH coding sequences into a native A. pseudoterreus or A. terreus fungi increases expression of panD, BAPAT, and/or HPDH by at least 20%, at least 40%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, or at least 500%, for example relative to the parental fungal strain without the introduced panD, BAPAT, and/or HPDH coding sequences. The term "increased" or "up-regulated" as used herein with respect to a cell and a particular gene or protein activity refers to a higher level of activity than that measured in a comparable cell of the same species. For example, a particular fungi having increased or up-regulated panD, BAPAT, and/or HPDH activity has increased panD, BAPAT, and/or HPDH activity if a comparable fungi having native panD, BAPAT, and/or HPDH activity has less detectable panD, BAPAT, and/or HPDH activity (for example as measured by gene or protein expression).

[0162] In one example, a strain of Aspergillus is transformed with a vector which has the effect of up-regulating a panD, BAPAT, and/or HPDH gene (such as a native or non-native panD, BAPAT, and/or HPDH gene). This can be done by introducing one or more panD, BAPAT, and/or HPDH coding sequences (such as a gene sequence), whose expression is controlled by elements such as promoters and the like which control gene expression, by introducing a nucleic acid sequence which itself (or its encoded protein) can increase panD, BAPAT, and/or HPDH protein activity in the fungus, or by introducing another molecule (such as a protein or antibody) increases panD, BAPAT, and/or HPDH protein activity in the fungus. For example, a panD, BAPAT, and/or HPDH gene can be up-regulated by introduction of a vector that includes one or more panD, BAPAT, and/or HPDH sequences (such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 panD, BAPAT, and/or HPDH sequences or copies of such sequences) into the desired fungus. In some examples, such panD, BAPAT, and/or HPDH sequences are from different fungal species, can be multiple copies from a single species, or combinations thereof, such as panD, BAPAT, and/or HPDH sequences from at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different fungal species. In some examples, the panD, BAPAT, and/or HPDH sequence(s) introduced into the fungus is optimized for codon usage. Thus, the disclosure in some examples provides transformed fungi that include at least one exogenous nucleic acid molecule which includes a panD, BAPAT, and/or HPDH gene or coding sequence (such as a nucleic acid sequence encoding SEQ ID NO: 54, 56, or 58, respectively), for example in combination with .DELTA.cadA. In one example, such transformed cells produce more 3HP, for example relative to a comparable fungus with a native cadA.

[0163] In one example, the cre-lox system is used for site specific recombination of DNA (for example see Steiger et al., Appl. Environ. Microbiol. 77(1):114, 2011). Using recombination techniques, the targeted gene of interest (e.g., cadA) can be deleted in the Aspergillus genome and replaced with one or more copies of a non-native panD, BAPAT, and/or HPDH sequence (for example in A. terreus, replacing one or both A. terreus cadA sequences with panD, BAPAT, and/or HPDH sequences from A. nidulans or A. flavus) flanked by the lox sites. Transient expression (by electroporation of a suicide plasmid containing the cre gene under control of a promoter that functions in Aspergillus) of the cre recombinase should result in efficient elimination of the lox flanked marker. This process will produce a fungus containing the desired insertion mutation and one copy of the lox sequence.

[0164] In one example, a transgene is generated and expressed in the desired fungal cell, such as an .DELTA.cadA fungal cell, to increase panD, BAPAT, and HPDH expression. For example, one or more transgenes can include a panD, BAPAT, and HPDH genomic or cDNA sequence (such as one having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any panD, BAPAT, and HPDH sequence provided herein), for example operably linked to one or more promoters, such as gpdA and eno1 . In one example, the promoter has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 74 and/or 77. In some examples, the transgene further includes a trpC transcriptional terminator sequence of A. nidulans, for example downstream of the panD, BAPAT, and/or HPDH sequence. As an alternative to trpC, other transcriptional terminators can be used, such as promoters which include a transcriptional terminators (e.g., ArsA7, Arsa-37, polyubiquitin (ubi4)). In one example, the trpC transcriptional terminator has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 83 or 86. In one example, the trpC transcriptional terminator comprises or consists of the sequence shown in SEQ ID NO: 83 or 86. In some examples, the transgene further includes a ptrA sequence, for example downstream of the trpC transcriptional terminator sequence. As an alternative to ptrA, the bleomycin gene or bar gene can be used. In one example, the ptrA sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 89. In one example, the ptrA sequence comprises or consists of the sequence shown in SEQ ID NO: 89

[0165] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 59, 62, 65, 68, 71, and/or 74. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 59, 62, 65, 68, 71, and/or 74.

[0166] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 77, 80, and/or 83. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 77, 80, and/or 83.

[0167] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 86, 89, and/or 92. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 86, 89, and/or 92.

[0168] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 89 and/or 92. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 89 and/or 92.

[0169] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 95 and/or 97. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 95 and/or 97.

[0170] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 59, 62, 65, 68, 71, 74, 77, 80, 83, 86, 89, and/or 92. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 59, 62, 65, 68, 71, 74, 77, 80, 83, 86, 89, and/or 92.

[0171] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 59, 62, 65, 68, 71, 74, 77, 80, 83, 89, and/or 92. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 59, 62, 65, 68, 71, 74, 77, 80, 83, 89, and/or 92.

[0172] G. Measuring Gene Expression

[0173] A .DELTA.cadA fungus expressing panD, BAPAT, and/or HPDH can be identified using known methods. For example, PCR and nucleic acid hybridization techniques, such as Northern, RT-PCR, and Southern analysis, can be used to confirm that a fungus expresses panD, BAPAT, and/or HPDH such as an increase in the panD, BAPAT, and/or HPDH copy number. Immunohisto-chemical and biochemical techniques can also be used to determine if a cell expresses panD, BAPAT, and/or HPDH by detecting the expression of the panD, BAPAT, and/or HPDH peptide encoded by panD, BAPAT, and/or HPDH. For example, an antibody having specificity for panD, BAPAT, and/or HPDH can be used to determine whether or not a particular fungus has increased panD, BAPAT, and/or HPDH protein expression, respectively. Further, biochemical techniques can be used to determine if a cell has increased panD, BAPAT, and/or HPDH expression by detecting a product produced as a result of the expression of the peptide. For example, production of 3-HP by .DELTA.cadA A. terreus or A. pseudoterreus can indicate that such a fungus expresses panD, BAPAT, and HPDH.

[0174] H. Measuring 3-HP Production

[0175] Methods of determining whether a genetic inactivation of cadA in combination with expression of panD, BAPAT, and HPDH in Aspergillus increases 3-HP production, for example relative to the same strain with a native cadA sequence, (such as a parental strain) include HPLC.

[0176] Methods of Producing Aconitic Acid

[0177] The recombinant .DELTA.cadA fungi can be used to produce aconitic acid (for example for as a building block for other materials, such as polymers). Such fungi can be from any Aspergillus species, such as Aspergillus terreus or pseudoterreus. For example, the disclosure provides methods of making aconitic acid (such as cis-aconitic acid, trans-aconitic acid, or both), which can include culturing .DELTA.cadA fungi under conditions that permit the fungus to make aconitic acid, for example in Riscaldati medium.

[0178] In some examples, the fungi are cultured at room temperature (e.g., 20-35.degree. C.) at normal atmospheric pressure (e.g., 1 atm). In some examples, the method includes purifying or isolating the aconitic acid, for example from the culture media or from the cultured fungus. In some examples, the aconitic acid is isolated at least 2 days, at least 3 days, at least 5 days, at least 8 days or at least 10 days after the start of culturing, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the start of culturing.

[0179] Methods of making aconitic acid include culturing .DELTA.cadA fungi under conditions that permit the fungus to make aconitic acid. In general, the culture media and/or culture conditions can be such that the fungi grow to an adequate density and produce aconitic acid efficiently. In one example the .DELTA.cadA fungi are cultured or grown in an acidic liquid medium, such as Riscaldati medium (100 g Glucose, 0.11 g KH.sub.2PO.sub.4, 2.36 g (NH.sub.4).sub.2SO.sub.4, 2.08 g MgSO.sub.4*7H2O, 0.074 g NaCl, 0.13 g CaCl.sub.2*2H.sub.2O, 1 ml of 1000.times. trace elements in 1000 ml DI water, adjust pH to 3.4 with H.sub.2SO.sub.4, 1000.times. trace elements contains 1.3g/L ZnSO.sub.4*7H.sub.2O, 5.5g/L FeSO.sub.4*7H.sub.2O, 0.2 g/L CuSO.sub.4*5H.sub.2O, 0.7 g/L MnCl.sub.2*4H.sub.2O). In one example the .DELTA.cadA fungi are cultured or grown in a liquid medium having an initial pH of less than 4, such as less than 3.5, for example about pH 3 to 4, 3.5 to 4, 3.3 to 3.5, for example pH 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9 or 4. In some examples the .DELTA.cadA fungi are cultured or grown in a liquid Riscaldati medium at about 20 to 35.degree. C. (such as 20.degree. C. to 30.degree. C., 25.degree. C. to 30.degree. C., 28 to 32.degree. C., or 30.degree. C.) with rotation (such as at least 100 rpm, at least 120 rpm, such as 150 rpm) at normal pressure.

[0180] In one example, the fungi are grown in culture containers (such as baffled flasks, and in some examples are silanized (5% solution of dichlorodimethylsilane in heptane (Sigma, St. Louis, Mo.)). Each culture container is inoculated with spores (such as at least 10.sup.6 spores/ml [agree?]) and incubated for at least 3 days, at least 4 days, at least 5 days, or at least 10 days at 30.degree. C. and 100 to 200 rpm to obtain aconitic acid.

[0181] In one example, the .DELTA.cadA fungi produce more aconitic acid than a corresponding fungus with wild-type cadA. In specific examples, the .DELTA.cadA fungi produce at least 1 g/l of total aconitic acid after 4 days, for example at least 2 g/l, at least 3 g/l, at least 4 g/l, at least 5 g/l, at least 6 g/l, at least 7 g/l, at least 8 g/l, at least 9 g/l or at least 10 g/l after at least 5 days, at least 6 days, at least 7 days, at least 8 days, or at least 10 days, such as after 4 to 6 days, 8 to 10 days, or 4 to 5 days) when grown in Riscaldati medium at 30.degree. C. with 150 rpm shaking. In specific examples, the .DELTA.cadA fungi produce at least 1 g/l of cis-aconitic acid after 4 days, for example at least 2 g/l after at least 5 days, at least 6 days, at least 7 days, at least 8 days, or at least 10 days, such as after 4 to 6 days, 8 to 10 days, or 4 to 5 days when grown in Riscaldati medium at 30.degree. C. with 150 rpm shaking. In specific examples, the .DELTA.cadA fungi produce at least 1 g/1 of trans-aconitic acid after 6 days, for example at least 2 g/l, at least 3 g/l, at least 4 g/l, at least 5 g/l, at least 6 g/l, at least 7 g/l, at least 8 g/l, at least 9 g/1 or at least 10 g/l after at least 7 days, at least 8 days, or at least 10 days, such as after 6 to 12 days, 5 to 10 days, or 6 to 10 days) when grown in Riscaldati medium at 30.degree. C. with 150 rpm shaking.

[0182] In some examples, the method further includes isolating the aconitic acid made by the .DELTA.cadA fungi. Once produced, any method can be used to isolate the aconitic acid. For example, separation techniques (such as filtration) can be used to remove the fungal biomass from the culture medium, and isolation procedures (e.g., filtration, distillation, precipitation, electrodialysis, and ion-exchange procedures) can be used to obtain the aconitic acid from the broth (such as a fungi-free broth). In addition, the aconitic acid can be isolated from the culture medium after the aconitic acid production phase has been terminated.

Methods of Producing 3-HP

[0183] The recombinant .DELTA.cadA fungi that also express panD, BAPAT, and HPDH can be used to produce 3-HP

##STR00002##

[0184] (for example for as a building block for other materials, such as acrylonitrile, acrylic acid by dehydration, malonic acid by oxidation, esters by esterification reactions with alcohols, and reduction to 1,3 propanediol). Such fungi can be from any Aspergillus species, such as Aspergillus terreus or pseudoterreus. For example, the disclosure provides methods of making 3-HP, which can include culturing .DELTA.cadA fungi that also express panD, BAPAT, and HPDH under conditions that permit the fungus to make 3-HP, for example in Riscaldati medium (such as modified Riscaldati medium with 20.times. trace elements).

[0185] In some examples, the .DELTA.cadA fungi that also express panD, BAPAT, and HPDH are cultured at room temperature (e.g., 20-35.degree. C.) at normal atmospheric pressure (e.g., 1 atm). In some examples, the method includes purifying or isolating the 3-HP, for example from the culture media or from the cultured fungus. In some examples, the 3-HP is isolated at least 2 days, at least 3 days, at least 5 days, at least 7 days, at least 8 days or at least 10 days after the start of culturing, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the start of culturing.

[0186] Methods of making 3-HP include culturing .DELTA.cadA fungi that also express panD, BAPAT, and HPDH under conditions that permit the fungus to make 3-HP. In general, the culture media and/or culture conditions can be such that the fungi grow to an adequate density and produce 3-HP efficiently. In one example the .DELTA.cadA fungi that also express panD, BAPAT, and HPDH are cultured or grown in an acidic liquid medium, such as Riscaldati medium (100 g Glucose, 0.11 g KH.sub.2PO.sub.4, 2.36 g (NH.sub.4).sub.2SO.sub.4, 2.08g MgSO.sub.4*7H.sub.2O, 0.074g NaCl, 0.13g CaCl.sub.2*2H.sub.2O, 1 ml of 1000.times. trace elements in 1000 ml DI water, adjust pH to 3.4 with H.sub.2SO.sub.4, 1000.times. trace elements contains 1.3 g/L ZnSO.sub.4*7H.sub.2O, 5.5 g/L FeSO.sub.4*7H.sub.2O, 0.2 g/L CuSO.sub.4*5H.sub.2O, 0.7 g/L MnCl.sub.2*4H.sub.2O, which may include 20.times. trace elements). In one example the .DELTA.cadA fungi are cultured or grown in a liquid medium having an initial pH of less than 4, such as less than 3.5, for example about pH 3 to 4, 3.5 to 4, 3.3 to 3.5, for example pH 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9 or 4. In some examples the .DELTA.cadA fungi that also express panD, BAPAT, and HPDH are cultured or grown in a liquid modified Riscaldati medium with 20.times. trace elements at about 20 to 35.degree. C. (such as 20.degree. C. to 30.degree. C., 25.degree. C. to 30.degree. C., 28 to 32.degree. C., or 30.degree. C.) with rotation (such as at least 100 rpm, at least 120 rpm, such as 150 or 200 rpm) at normal pressure.

[0187] In one example, the fungi are grown in culture containers (such as baffled flasks, and in some examples are silanized (5% solution of dichlorodimethylsilane in heptane (Sigma, St. Louis, Mo.)). Each culture container is inoculated with spores (such as at least 10.sup.6 spores/ml) and incubated for at least 3 days, at least 4 days, at least 5 days, or at least 10 days at 30.degree. C. and 100 to 300 rpm (such as 150 or 200 rpm) to obtain 3-HP.

[0188] In one example, the cadA fungi that also express panD, BAPAT, and HPDH produce more 3-HP than a corresponding fungus with wild-type cadA (either with or without panD, BAPAT, and HPDH expression). In specific examples, the .DELTA.cadA fungi that also express panD, BAPAT, and HPDH produce at least 0.1 g/l of 3-HP after at least 4 days, for example at least 0.2 g/l at least 0.25 g/l at least 0.3 g/1, at least 0.4 g/l, at least 0.5 g/l at least 0.6 g/l at least 0.7 g/l at least 0.8 g/l, at least 0.9 g/1, at least 1.1 g/l, at least 1.2 g/l, at least 1.5 g/l, or at least 1.6 g/l after at least 5 days, at least 6 days, at least 7 days, at least 8 days, or at least 10 days, such as after 4 to 6 days, 8 to 10 days, or 4 to 5 days, when grown in Riscaldati medium (such as modified Riscaldati medium with 20.times. trace elements) at 30.degree. C. with 150 rpm shaking.

[0189] In some examples, the method further includes isolating the 3-HP made by the .DELTA.cadA fungi. Once produced, any method can be used to isolate the 3-HP. For example, separation techniques (such as filtration) can be used to remove the fungal biomass from the culture medium, and isolation procedures (e.g., filtration, distillation, precipitation, electrodialysis, and ion-exchange procedures) can be used to obtain the 3-HP from the broth (such as a fungi-free broth). In addition, the 3-HP can be isolated from the culture medium after the 3-HP production phase has been terminated.

Compositions and Kits

[0190] Also provided by the present disclosure are compositions that include isolated .DELTA.cadA fungi (which in some examples also express panD, BAPAT, and HPDH, such as exogenous panD, BAPAT, and HPDH proteins), such as a medium for culturing, storing, or growing the fungus. In some examples, the .DELTA.cadA fungi and .DELTA.cadA fungi which express panD, BAPAT, and HPDH in the composition are freeze dried or lyophilized.

[0191] Also provided by the present disclosure are kits that include isolated AcadA fungi (which in some examples also express panD, BAPAT, and HPDH, such as exogenous panD, BAPAT, and HPDH proteins), such as a kit that includes a medium for culturing, storing, or growing the fungus. In some examples, the .DELTA.cadA fungi and .DELTA.cadA fungi which express panD, BAPAT, and HPDH in the kit are freeze dried or lyophilized.

[0192] Exemplary mediums include that can be in the disclosed compositions and kits include solid medium (such as those containing agar, for example complete medium (CM) or minimal medium (MM)) and liquid media (such as a fermentation broth, such as CM, MM, or CAP medium). In one example, the kit or composition includes Riscaldati medium (100 g Glucose, 0.11 g KH.sub.2PO.sub.4, 2.36 g (NH4).sub.2SO.sub.4, 2.08 g MgSO.sub.4*7H.sub.2O, 0.074 g NaCl, 0.13 g CaCl.sub.2*2H.sub.2O, 1 ml of 1000.times. trace elements in 1000 ml DI water, adjust pH to 3.4 with H.sub.2SO.sub.4, 1000.times. trace elements contains 1.3 g/L ZnSO.sub.4*7H.sub.2O, 5.5 g/L FeSO.sub.4*7H.sub.2O, 0.2 g/L CuSO.sub.4*5H.sub.2O, 0.7 g/L MnCl.sub.2*4H.sub.2O), for example

TABLE-US-00001 Conc. (g/L) Amount Notes Glucose 100 100 g KH.sub.2PO.sub.4 0.11 0.11 g (NH.sub.4).sub.2SO.sub.4 2.36 2.36 g MgSO.sub.4 * 7H.sub.2O 2.08 2.08 g NaCl 0.074 0.074 g CaCl.sub.2 * 2H2O 0.13 0.13 g ZnSO.sub.4 * 7H.sub.2O 0.0013 0.0013 g Use 1000 X soln. FeSO.sub.4 * 7H.sub.2O 0.0055 0.0055 g Use 1000 X soln. CuSO.sub.4 * 5H2O 0.0002 0.0002 g Use 1000 X soln. MnCl.sub.2 * 4H.sub.2O 0.0007 0.0007 g Use 1000 X soln. DI Water (L) 1 L Autoclave Time 15 min for small flasks 30 min for large flasks 30-60 for fermenter Comments: Adjust to pH = 3.4 with H.sub.2SO.sub.4

[0193] In one example, the kit or composition includes a modified Riscaldati medium with 20.times. trace elements, for example 20 times of the following

TABLE-US-00002 ZnSO.sub.4 * 7H.sub.2O 0.0013 0.0013 g Use 1000 X soln. FeSO.sub.4 * 7H.sub.2O 0.0055 0.0055 g Use 1000 X soln. CuSO.sub.4 * 5H2O 0.0002 0.0002 g Use 1000 X soln. MnCl.sub.2 * 4H.sub.2O 0.0007 0.0007 g Use 1000 X soln.

EXAMPLE 1

Materials and Methods

[0194] This example describes methods used in the experiments described in Examples 2-6 below.

[0195] Strains and vector. The parental wild type A. pseudoterreus strain ATCC 32359 was from ATCC. The hygromycin phosphotransferase (hph) marker cassette was amplified from vector pCB1003.

[0196] Growth conditions. All strains were maintained on complete medium (CM) agar and conidia of spore were harvested from cultures grown for five days on complete medium (CM) plate (10 g Glucose, 2 g Triptase peptone, 1 g yeast extract, 1 g casamino acids, 50 ml 20.times.NO.sub.3 Salts, 1 ml of 1000.times.Trace elements, 1 ml of 1000.times.Vitamin stock, in 1000 ml DI water, pH to 6.5), 20.times. NO.sub.3 Salts contains in g/l, Na.sub.2NO.sub.3, 120; KCL, 10.4 g; MgSO.sub.4.7H.sub.2O, 10.4 g; KH.sub.2PO.sub.4, 30.4 g. 1000.times. vitamin solution contains in per 100 ml H.sub.2O: Biotin, 0.01 gm; pyridoxinHCL, 0.01 gm; thiamineHCl, 0.01 gm; riboflavin, 0.01 gm; paba, 0.01 gm; nicotinic acid, 0.01 gm, filtered and stock at 4.degree. C. 1000.times. trace element contains in per 100 ml H.sub.2O: ZnSO.sub.4.7H.sub.2O, 2.2 g; H.sub.3BO.sub.3, 1.1 g; MnCl.sub.2.4H.sub.2O, 0.5 g; FeSO.sub.4.7H.sub.2O, 0.5 g; CoCl.sub.2.6H.sub.2O, 0.17 g; CuSO.sub.4.5H.sub.2O, 0.16 g; Na.sub.2MoO.sub.4.2H.sub.2O, 0.15 g; Na.sub.2EDTA, 5 g, add the compounds in order, boil and cool to 60.degree. C. Adjust pH to 6.5 with KOH. Cool to room temperature. Adjust volume to 100 ml with distilled water.

[0197] The transformants were selected for hygromycin resistance on minimum media (MM) (10 g Glucose, 50 ml 20.times.NO.sub.3 Salts, 1 ml of 1000.times.Trace elements, 1 ml of 1000.times.Vitamin stock, 1000 ml DI water, pH to 6.25.about.6.5, hygromycin 100 ug/ml). 0.5.times.10.sup.8 conidia were inoculated into 50 ml of production media for itaconic acid production (Riscaldati medium) as described previously (100 g Glucose, 0.11 g KH.sub.2PO.sub.4, 2.36 g (NH.sub.4).sub.2SO.sub.4, 2.08 g MgSO.sub.4.7H.sub.2O, 0.074 g NaCl, 0.13 g CaCl.sub.2.2H.sub.2O, 1 ml of 1000.times.trace elements in 1000 ml DI water, adjust pH to 3.4 with H.sub.2SO.sub.4, 1000.times. trace elements contains 1.3 g/L ZnSO.sub.4.7H.sub.2O, 5.5 g/L FeSO.sub.4.7H.sub.2O, 0.2 g/L CuSO.sub.4.5H2O, 0.7 g/L MnCl.sub.2.4H.sub.2O). Cultivation was performed at 30.degree. C. on a rotary shaker at 150rpm. At intervals during the incubation period, three single flasks were harvested for HPLC analysis, biomass measurement and RNA extraction. All experiments were replicated three times, and the standard deviation of the itaconic acid concentrations or dry weight was always less than 10% of the mean. For collecting samples for EST analysis, A. pseudoterreus was grown in 20 liter stirred tank bioreactor.

[0198] Construction of deletion mutants. The deletion mutants were constructed by homologous double crossover with fusion PCR products. Synthetic oligos used for each construct are described in Table 1. Oligonucleotides were from IDT (Coraville, Iowa). Ex Taq polymerase (TaKaRa, Japan) was used to generate DNA constructs for making gene knockouts. Briefly, the 5' flanking region (.about.1.5 kb) of the target gene was amplified by primer pair F1 and R3. The 3' flanking region (.about.1.5 kb) of the target genes was amplified by primer pair F4 and R6. R3 and F4 carried 20-25 bases complementary to 5' and 3' ends of the hph cassette, respectively. The hph marker cassette was amplified from pCB1003 with the hphF and hphR primers that carried 30 bases complementary to the 3' end of the 5' flanking region and the 5' of the 3' flanking region, respectively. The three fragments, including the 5' flanking region, the hph marker cassette and the 3' flanking region were mixed in 1:3:1 molar ratio and combined by overlap PCR during the second round PCR. In the third round of PCR, the fusion PCR product was amplified with a nested primer pair (F2 and R5). This final PCR product carried a hygromycin marker cassette flanked by sequences homologous to the upstream and downstream regions of the target gene. 1-2 ug of the final product was used to transform strain A. pseudoterreus strain ATCC 32359.

TABLE-US-00003 TABLE 1 Primers for making deletion constructs gene targeted primer name primer sequence (SEQ ID NO) tf at tff1 gagccatagccatgcaagcg (1) at tff2 atagagtccttggatgagacg (2) at tfr5 gtggatttcgaggttccttgc (3) at tfr6 gaagtagaaccatgtggatcg (4) at hphf tfr3 tgacctccactagctccagcactactagataggcccgtttagagagtgcc (5) at hphr tff4 aatagagtagatgccgaccggccgcttcgacgacagctctgcactctcc (6) at tfr3hphf ggcactctctaaacgggcctatctagtagtgctggagctagtggaggtca (7) at tftff4hphr ggagagtgcagagctgtcgtcgaagcggccggtcggcatctactctatt (8) mttA at motf1 gctgcatactcggattacgc (9) at motf2 Gaaaaggtactcggagtacg (10) at motr5 cagaccaaggagctttcctg (11) at motr6 cattaagccacaggcttgcg (12) athphfmotr3 tgacctccactagctccagcaatatggatgctgttcgttcgccgtgctgg (13) athphrmotf4 aatagagtagatgccgaccgtgacgaggatgtgctgagtccaaacaaagc (14) at motr3hphf ccagcacggcgaacgaacagcatccatattgctggagctagtggaggtca (15) at motf4hphr gctttgtttggactcagcacatcctcgtcacggtcggcatctactctatt (16) cadA at cadf1 ctccagtaacagaaccgacc (17) at cadf2 gaacttcactgccgcattgg (18) at cadr5 ggacactccaagaggataagg (19) at cadr6 gctcatcacattgtttgccg (20) at hphfcadr3 tgacctccactagctccagcggtcaatttaagaggacgatcttcgctgcg (21) at hphrcadf4 Aatagagtagatgccgaccgtcagcctggacaggctcaccgacattagcc (22) at cadr3hphf cgcagcgaagatcgtcctcttaaattgaccgctggagctagtggaggtca (23) at cadf4hphr ggctaatgtcggtgagcctgtccaggctgacggtcggcatctactctatt (24) mfsA mfsf1 tgatgagctgaattcgttgc (25) mfsf2 tatagccagcttttgctgtg (26) mfsr5 catagcgttcagagtgttg (27) mfsr6 ccatttcaatgctttgtgcg (28) mfsr3hphf ccataccacccttaccctcttggagtgtccgctggagctagtggaggtca (29) mfsf4hphr gctgtggcctcctggcgattacgcaatattcggtcggcatctactctatt (30) hphfmfsr3 tgacctccactagctccagcggacactccaagagggtaagggtggtatgg (31) hphrmfsf4 aatagagtagatgccgaccgaatattgcgtaatcgccaggaggccacagc (32) p450 p450f1 tctccaaatcatcgtcatcg (33) p450f2 cttcaatcgcaccgacatcc (34) p450r5 tcgtgtagacaagtccagtc (35) p450r6 ctataccactctagtgatgg (36) p450r3hphf cctctgctcaggttgttttcgaacaggagcgctggagctagtggaggtca (37) p450f4hphr cggaatgcagataggcatcacagtccagaacggtcggcatctactctatt (38) hphfp450r3 tgacctccactagctccagcgctcctgttcgaaaacaacctgagcagagg (39) hphrp450f4 aatagagtagatgccgaccgttctggactgtgatgcctatctgcattccg (40)

[0199] Transformation of A. pseudoterreus protoplasts. 10.sup.8 conidia of A. pseudoterreus ATCC 32359 were used to inoculate 300 ml Erlenmeyer baffle flasks containing 100 ml of complete media. The cultures were grown overnight (16-18 hrs) at 30.degree. C. and 150 rpm. The mycelia were then harvested by filtering the culture through miracloth and rinsing the mycelia mat with sterile water. The protoplasts were prepared by treating mycelia (mass of approximately 1-2 beans) with 20 mg/ml lysing enzyme (L1412, Sigma) dissolved in 20 ml of osmotic wash buffer (0.5M KCl, 10 mM sodium phosphate, pH 5.8) for 2 h. Protoplasts were collected by filtering protoplasts through sterile miracloth into a 50 ml screw cap centrifuge tube and centrifuging at 1000.times.g for 10 min at 4.degree. C. Protoplasts were then washed twice with 20 ml Washing Solution (0.6M KCl, 0.1M Tris/HCl, pH 7.0) and once in 10 ml Conditioning Solution (0.6M KCl, 50 mM CaCl.sub.2, 10 mM Tris/HCl, pH 7.5). For transformation, 1-2 ug DNA was added to 2.times.10.sup.7 protoplasts in 0.1 ml Conditioning Solution. A control reaction without added DNA was performed at the same time. 25 .mu.l of PEG solution (25% PEG8000, 0.6M KCl, 50 mM CaCl.sub.2, 10 mM Tris/HCl, and pH 7.5) was added and the protoplasts were incubated for 20 min on ice. An additional 500 ul of the PEG was added using a wide bore pipette tip and carefully mixed with the protoplasts by gently pipetting up and down 1-2 times. The protoplast solution was then incubated for 5 min on ice. 1 ml of cold Conditioning Solution was added and mixed by gently inverting the tube several times. Then the protoplast suspension was mixed with 12 ml of 50.degree. C. selection agar (Minimal media+0.6M KCl+1.5% Agar+100 ug/ml hygromycin) contained in a 15 ml screwcap centrifuge tube. The tubes were then mixed by inverting the tubes 3-4 times and poured directly onto the petri dish plates. The control reaction was divided into a positive control plate (no selection antibiotics in the top agar and bottom plates) and a negative control (with selection hygromycin in top and bottom agar). The solidified plates were inverted and incubated overnight at 30.degree. C. The next day, the plates were then overlaid with 15 ml of Minimal Medium (MM) containing 150 ug/ml hygromycin. Colonies should start to appear after 3-4 days. The transformants were excised and transferred to MM plate containing 100 ug/ml hygromycin. Correct transformants on the hygromycin plate were confirmed by PCR approaches and southern blot.

[0200] Dry mass measurement. Dry mass at each time point was determined by harvesting the mycelium on miracloth by suction filtration and washed twice with 50 ml distilled water. Subsequently, the dry weight was determined by drying it overnight in pre-weighed tubes on lyophilizer.

[0201] HPLC. The content of itaconic acid, aconitic acid, and glucose in each sample collected from filtration (0.22 um) was assayed by a high-pressure liquid chromatography (HPLC) on a Bio-Rad Aminex HPX-87H ion exclusion column (300 mm.times.7.8 mm). Columns were eluted with Sulfuric acid (0.005 M) at a flow rate of 0.55 mL/min. The sample volume was 10-100 ul, and IA was detected at 210 nm with a Waters 2414 refractive index detector.

[0202] RNA isolation and transcript analysis by Quantitative real time RT-PCR. Wild type and tf deletion strains were grown in Riscaldati medium at 30.degree. C. After 3 days growth, mycelia were harvested, pressed dry between paper towels and immediately flash frozen in liquid nitrogen. The entire sample was then ground in a mortar and pestle with liquid nitrogen. Approximately 100 mg samples (about 0.1 ml) were extracted using Trizol.RTM. reagent (Chomczynski, BioTechniques 1993, 15(3):532-534, 536-537) and the resulting RNA was converted to cDNA using high capacity RNA-to-DNA kit (Applied Biosystems). Quantitative RT-PCR were performed in 50 ul reactions containing 25 ul of Power SYBR green PCR master mix (Applied Biosystems), 50 ng cDNA (from 50 ng RNA) and 0.2 uM forward and reverse primers. The RT-PCR primers used for analysis of the mttA, cadA, mfsA genes and benA (.beta.-tubulin) as endogenous control gene are listed in Table 3. There are two additional controls, one is a no RT (without adding RT enzyme mix) control to estimate contamination from genomic DNA, and the other is no-template controls for each primer pair to measure effect from primer dimer formation . Amplification was performed using 7900HT Fast Real-Time PCR system (Applied Biosystems) programmed to initially hold at 95.degree. C. for 10 min and then to complete 45 cycles of 95.degree. C. for 15 s, 60.degree. C., for 60 s. The data were analyzed using the comparative C.sub.T method (e.g., see Schmittgen et al., Analytical biochemistry 2000, 285(2):194-204)

EXAMPLE 2

Expression Profile of Itaconic Acid Gene Cluster in A. pseudoterreus

[0203] RNA samples were prepared from three different growth stages of A. pseudoterreus in the itaconic acid production process. The stages were 1) "pre-production," before itaconic acid production begins, 2) "production onset," the beginning of itaconic acid production correlated with phosphate depletion, and 3) "production," early in the phase of maximum itaconic acid production rate (FIG. 2). EST data revealed four genes in the cluster having high expression frequency both in the onset phase and production phase, but not in the pre-production phase (Table 2). These genes were tf, mttA, cadA, and mfsA.

TABLE-US-00004 TABLE 2 Number of ESTs per gene at three stages of itaconic acid production Broad Institute Gene Pre- Production Gene No. Description Production Onset Production ATEG_09968.1 upstream 0 0 0 flanking gene; lovE ATEG_09969.1 tf 0 4 4 ATEG_09970.1 mttA 0 81 93 ATEG_09971.1 cadA 0 77 110 ATEG_09972.1 mfsA 0 6 7 ATEG_09973.1 p450 0 7 11 ATEG_09974.1 downstream 0 0 0 flanking gene ATEG_09817.1 control; gapdh 31 51 43

[0204] cadA has 77 ESTs at the beginning of itaconic acid (IA) production and 110 ESTs during the IA production, while mttA has 81 and 93 ESTs respectively in each stage. Both have no transcript detected before IA is produced. Transcription factor (tf) and mfsA, like cadA and mttA, did not show any expression before IA production, but had significant levels of transcription following the initiation of itaconic acid production (Table 2).

[0205] When genes upstream and downstream of tf, cadA, mttA and mfsA were examined, a similar expression pattern was not observed. No transcript was detected for either upstream or downstream genes in any stage of IA production except for p450. Control gene gpdh, which is far away from this region, showed high expression through the whole growth stage. This EST data clearly demonstrated that four genes tf, cadA, mttA and mfsA have the same expression pattern and are closely related to the IA production process. In addition, these four genes are in the same cluster. They are turned on strongly at the onset of IA production and persists through the production phase (FIG. 2).

EXAMPLE 3

Effect of tf, cadA, mttA and mfsA Deletion on Itaconic Acid Production in A. pseudoterreus

[0206] A transformation system was developed to allow for transformation of A. pseudoterreus (see Example 1). This system was used to generate recombinant knockout strains for each of the endogenous tf, cadA, mttA and mfsA genes. The KO mutant strains were confirmed by PCR and southern blot. The transformation protocol gave very high frequency of homologous deletion, 8 out 10 had the correct deletion. This high deletion frequency may be due to the presence of a ku gene mutation in the genome of wild-type A. pseudoterreus.

[0207] Biomass accumulation and itaconic acid (IA) production of each of the four knockout mutants and wild type A. pseudoterreus were measured at day 5. All strains, including wild type, had similar biomass accumulation (FIG. 3A). There is no significant difference in biomass among these five strains, indicating that deletion of these genes does not cause a noticeable growth defect.

[0208] However, the yield of IA was significantly lower in all four deletion strains (.DELTA.tf, .DELTA.cadA, .DELTA.mttA and .DELTA.mfsA.DELTA.) when compared to wild type A. pseudoterreus. After 5 days growth in the Riscardati medium, the .DELTA.tf strain had only generated .about.3g/l IA, compared to the wild type strain, which generated .about.24 g/l of IA (about an 8-fold decrease). No detectable IA was produced by the .DELTA.cadA and .DELTA.mttA strains. .DELTA.mfsA produced around 16 g/L itaconic acid, about 2/3 of wild type A. pseudoterreus.

[0209] These observations demonstrate that tf, mttA, cadA and mfsA genes play a role in itaconic acid production.

EXAMPLE 4

Production Kinetics of Itaconic Acid in Wild Type and tf Deletion Strain

[0210] To test the production kinetics in the deletion strains, .DELTA.tf and wild type A. pseudoterreus strain ATCC 32359 were tested for IA production during the growth on a rotary shaker for 7 days. IA was analyzed by HPLC for 2, 4, 6 and 7 day cultures.

[0211] As shown in FIG. 4, the IA yield plateaued at day 7 in both .DELTA.tf and wild type strains. Interestingly, the IA yield in .DELTA.tf (5g/l) is much lower than that of wild type (35 g/l), a decrease of about 7-fold. Thus, the .DELTA.tf strain produces IA at slower rate with a lower maximum IA yield than the wild type strain.

EXAMPLE 5

tf Regulation

[0212] The effects of tf gene deletion on the transcription level of other genes in the cluster were investigated by real-time reverse transcription PCR (RT-PCR). In the both .DELTA.tf and wild type strains, expression level of each gene was analyzed by RT-PCR by measuring mttA, cadA, mfsA mRNA levels using primers specific for those genes (Table 3).

TABLE-US-00005 TABLE 3 primers for real-time RT-PCR analysis of cluster gene transcript level Gene targeted Primer name Primer sequence (SEQ ID NO:) mttA mttF Gctttcaatgtggttcctac (41) mttR ctccatcacctaccctttc (42) cadA cadF gaagtgtgggatctggc (43) cadR gggttcggtatttgtgaag (44) mfsA mfsF caagaacagtttggcctgag (45) mfsR gcggacatcatacaatctgg (46) benA .beta. -tubulinF ttgtcgatgttgttcgtcgc (47) .beta.-tubulinR tggcgttgtaaggctcaacc (48)

[0213] As shown in FIG. 5, in .DELTA.tf strains, mRNA level of mttA decreased 57 fold, cadA mRNA level decreased 37 fold, and mfsA decreased 23 fold, as compared to their expression in wild type A. pseudoterreus 32359. Thus, inactivation of the tf gene dramatically reduced the level of mRNA of other genes in the cluster. Within the itaconic acid biosynthesis cluster, the transcription factor potentially controls expression of other genes.

EXAMPLE 6

cadA Deletion Creates a Novel Strain that Produces Aconitic Acid

[0214] In A. pseudoterreus, when cadA was deleted, itaconic acid production was completely abolished (FIG. 3B). However, 3.5 g per liter aconitic acid in the .DELTA.cadA strain was detected at day 5 (FIG. 6A). Aconitic acid was not produced by the wild type, .DELTA.mttA or .DELTA.mfsA strains (FIG. 6A). A time course analysis showed that aconitic acid started to appear in the supernatant at day 3, similar as IA in the wild type strain (FIG. 6B). At day 3, only cis-aconitic acid was detected in the supernatant. At day 4, both cis-aconitic acid and trans-aconitic acid were detected. From day 5 onward, cis-aconitic acid remained consistent at about 2 g/L, while trans-aconitic acid yield continued to increase (FIG. 6B). By day 10, 10 g/L trans-aconitic acid was detected in the supernatant from the .DELTA.cadA strain (FIG. 6B). FIG. 6C shows a comparison of total aconitic acid production between wild type and .DELTA.cadA fungi. Thus, .DELTA.cadA stains of A. pseudoterreus and A. terreus can be used to produce cis- and trans-aconitic acid.

EXAMPLE 7

Materials and Methods

[0215] This example describes methods used in the experiments described in Example 8.

Transgene Expression Vector for 3-HP Production

[0216] Isolation of DNA Fragments:

[0217] Fragment 1: A. pseudoterreus 5'-cadA gene, 987 bp (SEQ ID NO: 59) isolated by PCR with the oligo pair 1969 and 1970 (SEQ ID NOS: 60 and 61, respectively) and A. pseudoterreus genomic DNA;

[0218] Fragment 2: A. niger gpdA promoter, 813 bp (SEQ ID NO: 62) isolated by PCR with oligo pair of 1971 and 1972 (SEQ ID NOS: 63 and 64, respectively) and A. niger genomic DNA;

[0219] Fragment 3: aspartate 1-decarboxylase (panD) cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus, 1617 bp (SEQ ID NO: 65) was isolated by PCR with the oligo pair of 1973 and 1974 (SEQ ID NOS: 66 and 67, respectively) and the plasmid DNA containing the synthesized panD cDNA;

[0220] Fragment 4: bidirectional terminator from A. niger elf3/multifunctional chaperone (SEQ ID NO: 68) was isolated by PCR with oligo pair of 1975 and 1976 (SEQ ID NOS: 69 and 70, respectively) and the genomic DNA of A. niger;

[0221] Fragment 5: codon optimized synthetic cDNA of .beta.-alanine-pyruvate aminotransferase (BAPAT) of Bacillus cereus, 1350 bp (SEQ ID NO: 71) was isolated by PCR with oligo pair of 1977 and 1978 (SEQ ID NOS: 72 and 73, respectively) and the plasmid DNA containing the synthesized BABAT cDNA;

[0222] Fragment 6: A. niger eno1 promoter, 704 bp (SEQ ID NO: 74) isolated by PCR with oligo pair of 1979 and 1980 (SEQ ID NOS: 75 and 76, respectively) and A. niger genomic DNA;

[0223] Fragment 7: A. nidulans gpdA promoter, 885 bp (SEQ ID NO: 77) was isolated by PCR with the oligo pair of 2002 and 1982 (SEQ ID NOS: 78 and 79, respectively) and A. nidulans genomic DNA;

[0224] Fragment 8: the codon optimized synthetic cDNA of E. coli 3-hydroxypropionate dehydrogenase (HPDH), 741 bp (SEQ ID NO: 80) was isolated by PCR with oligo pair of 1983 and 1984 (SEQ ID NOS: 81 and 82, respectively) and the plasmid DNA containing the codon-optimized synthesized HPDH DNA of E. coli;

[0225] Fragment 9: trpC terminator of A. nidulans, 473 bp (SEQ ID NO: 83) isolated by PCR with oligo pair of 1985 and 2004 (SEQ ID NOS: 84 and 85, respectively) and plasmid DNA of pAN7.1;

[0226] Fragment 10: trpC terminator of A. nidulans, 473 bp (SEQ ID NO: 86) isolated by PCR with the oligo pair of 2005 and 1986 (SEQ ID NOS: 87 and 88, respectively) and plasmid DNA of pAN7.1;

[0227] Fragment 11: A. oryzae ptrA selection marker gene, 2005 bp; SEQ ID NO: 89) isolated by PCR with the oligo pair of 1987 and 1988 (SEQ ID NOS: 90 and 91, respectively) and A. oryzae genomic DNA;

[0228] Fragment 12: A. pseudoterreus 3'-cadA gene, 908 bp (SEQ ID NO: 92) isolated by PCR with the oligo pair 1989 and 2003 (SEQ ID NOS: 93 and 94, respectively) and A. oryzae genomic DNA;

[0229] Fragment 13 (SEQ ID NO: 95): Combination of Fragments 7 to 9 (SEQ ID NOS: 77, 80, and 83, respectively), 2099 bp isolated by PCR with oligo pair of 1981 and 1986 (SEQ ID NOS: 96 and 88, respectively) and plasmid DNA of pZD-2; and

[0230] Fragment 14 (SEQ ID NO: 97): Combination of Fragments 11 to 12 (SEQ ID NOS: 89 and 92, respectively), 2913 bp was isolated by PCR with the oligo pair of 1987 and 1990 (SEQ ID NOS: 90 and 98, respectively) and plasmid DNA of pZD-3.

[0231] The oligonucleotide primers used are shown in Table 4.

TABLE-US-00006 TABLE 4 Primers used to generate vector for 3-HP production Name Sequence (SEQ ID NO:) 1969cad1 ccctcgaggtcgacggtatcgataGATATCGGTTGTAGCAGCGTAAA CAC (60) 1970cad2 tctttcatagtagCCTTGGTGAACATCTTGAGG (61) 1971gpdA1 atgttcaccaaggCTACTATGAAAGACCGCGATG (63) 1972gpdA2 cgccggtggcgggCATTGTTTAGATGTGTCTATGTG (64) 1973pan1 catctaaacaatgCCCGCCACCGGCGAGGACCA (66) 1974pan2 atccaacccatcaGAGGTCGGAGCCCAGGCGTTCG (67) 1975ter1 gggctccgacctcTGATGGGTTGGATGACGATG (69) 1976ter2 tctggcccagctcTGAGTCCTAGATGGGTGGTG (70) 1977bap1 catctaggactcaGAGCTGGGCCAGACATTCCTTC (72) 1978bap2 gtccatcaacatgGAACTGATGATCGTCCAGGTCAC (73) 1979eno1 cgatcatcagttcCATGTTGATGGACTGGAGGG (75) 1980eno2 gaactagtggatcccccgggctgcGttaaCTCGAGCTTACAAGAAGTA GCC (76) 1981gpdA1 acaggctacttcttgtaagctcgagttTCTGTACAGTGACCGGTGAC (96) 1982gpdA2 tgaccagcacgatCATGGTGATGTCTGCTCAAG (79) 1983hpd1 agacatcaccatgATCGTGCTGGTCACGGGCGC (81) 1984hpd2 gccatcggtcctaTTGGCGGTGGACGTTCAGGC (82) 1985trp1 cgtccaccgccaaTAGGACCGATGGCTGTGTAG (84) 1986trp2 cccgtctgtcagaGAGCGGATTCCTCAGTCTCG (88) 1987ptrA1 gaggaatccgctcTCTGACAGACGGGCAATTGATTAC (90) 1988ptrA2 gaatgttgctgagGAGCCGCTCTTGCATCTTTG (91) 1989cad3 gcaagagcggctcCTCAGCAACATTCGCCATGTTC (93) 1990cad4 actaaagggaacaaaagctggagctCAGCTCCACTGCTCATAGTCTTT G(98) 2002gpdA5 ccctcgaggtcgacggtatcgataGTTAACTCTGTACAGTGACCGGTG AC (78) 2003cad3 gaactagtggatcccccgggctgcaCAGCTCCACTGCTCATAGTCTTT G (94) 2004trpR gaactagtggatcccccgggctgcaGAGCGGATTCCTCAGTCTCG (85) 2005trpF ccctcgaggtcgacggtatcgataTAGGACCGATGGCTGTGTAG (87)

[0232] An overview of the arrangement of the Fragments is shown in FIG. 7. Fragments 1 to 6 (SEQ ID NOS: 59, 62, 65, 68, 71 and 74, respectively) were assembled into the plasmid DNA pBlueScript SK (-) linearized with HindIll and Pstl via Gibson Assembly master kit to form plasmid pZD-1. A restriction enzyme site HpaI was introduced at the end of the fragment 6 for further cloning.

[0233] Fragments 7 to 9 (SEQ ID NOS: 77, 80, and 83, respectively) were assembled into the plasmid DNA pBlueScript SK (-) linearized with HindIII and PstI via Gibson Assembly master kit to form plasmid DNA pZD-2.

[0234] Fragments 10 to 12 (SEQ ID NOS: 86, 89, and 92, respectively) were assembled into the pBlueScript SK(-) vector linearized with restriction enzyme HindIII and PstI by Gibson assembly to form the plasmid vector ZD-3. (Only fragments 11 and 12 were used in the next step; SEQ ID NOS: 89 and 92).

[0235] Fragments 13 and 14 (SEQ ID NOS: 95 and 97) were assembled together into the plasmid DNA vector ZD-1 linearized with restriction enzyme HpaI/SacI via Gibson Assembly master kit to form pZD-4.

[0236] Genomic DNA isolation and Southern blotting analysis were performed as described in Example 1 (and see Dai et al., 2017, Appl Microbiol Biotechnol 101:6099-6110).

Detection of 3-HP

[0237] The extracellular 3-HP in the culture supernatants was quantified with HPLC method as described in Example 1.

EXAMPLE 8

Production of 3-HP

[0238] The constructs generated in Example 7 (FIG. 7) were transformed into wild type A. pseudoterreus strain ATCC 32359 using he methods describe in Example 1, thereby inactivating/disrupting the cadA gene in some examples.

[0239] As shown in FIG. 8, restriction fragment length polymorphism of selected transgenic strains show that the transgene expression cassette was inserted into the cadA locus in strain-2 (with one copy) and strain-6 (two copies), while the strain-4 and strain-5 carry the transgene expression cassette with random integration. No integration of transgene expression cassette was observed in strain-1 and strain-3.

[0240] 3-HP production was measured in several transformants. As shown in FIG. 9A, the .DELTA.cadA strain did not produce 3-HP, while insertion of the transgene expression cassette that allowed for expression of panD, BAPAT, and HPDH, into the cadA locus with one copy or two copies and resulted in 0.9 or 1.7 g/l 3-HP accumulation in the strains 3HP-2 or 3HP-6. In contrast, when the transgene expression cassette was randomly inserted into the chromosome, 3HP production was substantially lower (Strains 3HP-4 and 3HP-5). FIG. 9B shows 3-HP production over 8 days in Strains 3HP-2 and 3HP-6 (strains 2 and 6, respectively). Thus, genetically inactivating cadA can increase 3-HP production.

[0241] In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Sequence CWU 1

1

98120DNAArtificial Sequenceprimer used to delete tf gene in A. pseudoterreus 1gagccatagc catgcaagcg 20221DNAArtificial Sequenceprimer used to delete tf gene in A. pseudoterreus 2atagagtcct tggatgagac g 21321DNAArtificial Sequenceprimer used to delete tf gene in A. pseudoterreus 3gtggatttcg aggttccttg c 21421DNAArtificial Sequenceprimer used to delete tf gene in A. pseudoterreus 4gaagtagaac catgtggatc g 21550DNAArtificial Sequenceprimer used to delete tf gene in A. pseudoterreus 5tgacctccac tagctccagc actactagat aggcccgttt agagagtgcc 50649DNAArtificial Sequenceprimer used to delete tf gene in A. pseudoterreus 6aatagagtag atgccgaccg gccgcttcga cgacagctct gcactctcc 49750DNAArtificial Sequenceprimer used to delete tf gene in A. pseudoterreus 7ggcactctct aaacgggcct atctagtagt gctggagcta gtggaggtca 50849DNAArtificial Sequenceprimer used to delete tf gene in A. pseudoterreus 8ggagagtgca gagctgtcgt cgaagcggcc ggtcggcatc tactctatt 49920DNAArtificial Sequenceprimer used to delete mttA gene in A. pseudoterreus 9gctgcatact cggattacgc 201020DNAArtificial Sequenceprimer used to delete mttA gene in A. pseudoterreus 10gaaaaggtac tcggagtacg 201120DNAArtificial Sequenceprimer used to delete mttA gene in A. pseudoterreus 11cagaccaagg agctttcctg 201220DNAArtificial Sequenceprimer used to delete mttA gene in A. pseudoterreus 12cattaagcca caggcttgcg 201350DNAArtificial Sequenceprimer used to delete mttA gene in A. pseudoterreus 13tgacctccac tagctccagc aatatggatg ctgttcgttc gccgtgctgg 501450DNAArtificial Sequenceprimer used to delete mttA gene in A. pseudoterreus 14aatagagtag atgccgaccg tgacgaggat gtgctgagtc caaacaaagc 501550DNAArtificial Sequenceprimer used to delete mttA gene in A. pseudoterreus 15ccagcacggc gaacgaacag catccatatt gctggagcta gtggaggtca 501650DNAArtificial Sequenceprimer used to delete mttA gene in A. pseudoterreus 16gctttgtttg gactcagcac atcctcgtca cggtcggcat ctactctatt 501720DNAArtificial Sequenceprimer used to delete cadA gene in A. pseudoterreus 17ctccagtaac agaaccgacc 201820DNAArtificial Sequenceprimer used to delete cadA gene in A. pseudoterreus 18gaacttcact gccgcattgg 201921DNAArtificial Sequenceprimer used to delete cadA gene in A. pseudoterreus 19ggacactcca agaggataag g 212020DNAArtificial Sequenceprimer used to delete cadA gene in A. pseudoterreus 20gctcatcaca ttgtttgccg 202150DNAArtificial Sequenceprimer used to delete cadA gene in A. pseudoterreus 21tgacctccac tagctccagc ggtcaattta agaggacgat cttcgctgcg 502250DNAArtificial Sequenceprimer used to delete cadA gene in A. pseudoterreus 22aatagagtag atgccgaccg tcagcctgga caggctcacc gacattagcc 502350DNAArtificial Sequenceprimer used to delete cadA gene in A. pseudoterreus 23cgcagcgaag atcgtcctct taaattgacc gctggagcta gtggaggtca 502450DNAArtificial Sequenceprimer used to delete cadA gene in A. pseudoterreus 24ggctaatgtc ggtgagcctg tccaggctga cggtcggcat ctactctatt 502520DNAArtificial Sequenceprimer used to delete mfsA gene in A. pseudoterreus 25tgatgagctg aattcgttgc 202620DNAArtificial Sequenceprimer used to delete mfsA gene in A. pseudoterreus 26tatagccagc ttttgctgtg 202719DNAArtificial Sequenceprimer used to delete mfsA gene in A. pseudoterreus 27catagcgttc agagtgttg 192820DNAArtificial Sequenceprimer used to delete mfsA gene in A. pseudoterreus 28ccatttcaat gctttgtgcg 202950DNAArtificial Sequenceprimer used to delete mfsA gene in A. pseudoterreus 29ccataccacc cttaccctct tggagtgtcc gctggagcta gtggaggtca 503050DNAArtificial Sequenceprimer used to delete mfsA gene in A. pseudoterreus 30gctgtggcct cctggcgatt acgcaatatt cggtcggcat ctactctatt 503150DNAArtificial Sequenceprimer used to delete mfsA gene in A. pseudoterreus 31tgacctccac tagctccagc ggacactcca agagggtaag ggtggtatgg 503250DNAArtificial Sequenceprimer used to delete mfsA gene in A. pseudoterreus 32aatagagtag atgccgaccg aatattgcgt aatcgccagg aggccacagc 503320DNAArtificial Sequenceprimer used to delete p450 gene in A. pseudoterreus 33tctccaaatc atcgtcatcg 203420DNAArtificial Sequenceprimer used to delete p450 gene in A. pseudoterreus 34cttcaatcgc accgacatcc 203520DNAArtificial Sequenceprimer used to delete p450 gene in A. pseudoterreus 35tcgtgtagac aagtccagtc 203620DNAArtificial Sequenceprimer used to delete p450 gene in A. pseudoterreus 36ctataccact ctagtgatgg 203750DNAArtificial Sequenceprimer used to delete p450 gene in A. pseudoterreus 37cctctgctca ggttgttttc gaacaggagc gctggagcta gtggaggtca 503850DNAArtificial Sequenceprimer used to delete p450 gene in A. pseudoterreus 38cggaatgcag ataggcatca cagtccagaa cggtcggcat ctactctatt 503950DNAArtificial Sequenceprimer used to delete p450 gene in A. pseudoterreus 39tgacctccac tagctccagc gctcctgttc gaaaacaacc tgagcagagg 504050DNAArtificial Sequenceprimer used to delete p450 gene in A. pseudoterreus 40aatagagtag atgccgaccg ttctggactg tgatgcctat ctgcattccg 504120DNAArtificial Sequenceprimer used to amplify mttA in A. pseudoterreus 41gctttcaatg tggttcctac 204219DNAArtificial Sequenceprimer used to amplify mttA in A. pseudoterreus 42ctccatcacc taccctttc 194317DNAArtificial Sequenceprimer used to amplify cadA in A. pseudoterreus 43gaagtgtggg atctggc 174419DNAArtificial Sequenceprimer used to amplify cadA in A. pseudoterreus 44gggttcggta tttgtgaag 194520DNAArtificial Sequenceprimer used to amplify mfsA in A. pseudoterreus 45caagaacagt ttggcctgag 204620DNAArtificial Sequenceprimer used to amplify mfsA in A. pseudoterreus 46gcggacatca tacaatctgg 204720DNAArtificial Sequenceprimer used to amplify beta-tubulin in A. pseudoterreus 47ttgtcgatgt tgttcgtcgc 204820DNAArtificial Sequenceprimer used to amplify beta-tubulin in A. pseudoterreus 48tggcgttgta aggctcaacc 20492206DNAAspergillus terreus 49gtgggtcttg aaatcgtatg ccacacttgc tccggatgaa acacattccg gagcgcgcat 60cgatattgct acacagtata gacccaatgg tctgcagatg ccctaaatgg tagttctcac 120tggcctgcat taagttctgg ttgcagatca ttgtcggcct aacatcagtg taggttacgg 180tgtgagattt acttgcatag aagattccag accacaaggt tctagatcct ttgacggcgg 240actcccctcg aggtgccggg cgccgacgtg tgcgttgctc cgggatttgt aggacgcagc 300tcggatacct agccgttatg ggaatcggag gttgtagcag cgtaaacaca tggatagtta 360aataatcgga tgtacaccca ctgttggaaa tgacgggggc ctacaacacg agattatctg 420atccaatttc tgttcgttgg cattctatca ttcgcagcga aaattgtcct attaaattga 480ccatgaccaa acaatctgcg gacagcaacg caaagtcagg agttacgtcc gaaatatgtc 540attgggcatc caacctggcc actgacgaca tcccttcgga cgtattagaa agagcaaaat 600accttattct cgacggtatt gcatgtgcct gggttggtgc aagagtgcct tggtcagaga 660agtatgttca ggcaacgatg agctttgagc cgccgggggc ctgcagggtg attggatatg 720gacaggtaaa ttttattcac tctagacggt ccacaaagta tactgacgat ccttcgtata 780gaaactgggg cctgttgcag cagccatgac caattccgct ttcatacagg ctacggagct 840tgacgactac cacagcgaag cccccctaca ctctgcaagc attgtccttc ctgcggtctt 900tgcagcaagt gaggtcttag ccgagcaggg caaaacaatt tccggtatag atgttattct 960agccgccatt gtggggtttg aatctggccc acggatcggc aaagcaatct acggatcgga 1020cctcttgaac aacggctggc attgtggagc tgtgtatggc gctccagccg gtgcgctggc 1080cacaggaaag ctcctcggtc taactccaga ctccatggaa gatgctctcg gaattgcgtg 1140cacgcaagcc tgtggtttaa tgtcggcgca atacggaggc atggtaaagc gtgtgcaaca 1200cggattcgca gcgcgtaatg gtcttcttgg gggactgttg gcccatggtg ggtacgaggc 1260aatgaaaggt gtcctggaga gatcttacgg cggtttcctc aagatgttca ccaagggcaa 1320cggcagagag cctccctaca aagaggagga agtggtggct ggtctcggtt cattctggca 1380tacctttact attcgcatca agctctatgc ctgctgcgga cttgtccatg gtccagtcga 1440ggctatcgaa aaccttcagg ggagataccc cgagctcttg aatagagcca acctcagcaa 1500cattcgccat gttcatgtac agctttcaac ggcctcgaac agtcactgtg gatggatacc 1560agaggagaga cccatcagtt caatcgcagg gcagatgagt gtcgcataca ttctcgccgt 1620ccagctggtc gaccagcaat gtcttttgtc ccagttttct gagtttgatg acaacctgga 1680gaggccagaa gtttgggatc tggccaggaa ggttacttca tctcaaagcg aagagtttga 1740tcaagacggc aactgtctca gtgcgggtcg cgtgaggatt gagttcaacg atggttcttc 1800tattacggaa agtgtcgaga agcctcttgg tgtcaaagag cccatgccaa acgaacggat 1860tctccacaaa taccgaaccc ttgctggtag cgtgacggac gaatcccggg tgaaagagat 1920tgaggatctt gtcctcggcc tggacaggct caccgacatt agcccattgc tggagctgct 1980gaattgcccc gtgaaatcgc cactggtata aatgggaagc gatatggaaa catttcatgt 2040cacgggcaca aattctaggt catatcgtac ctggatggtg aaaccaccag cggtttagca 2100gatagaagat agactccttc tgctctgcgt tgcgtcttga atttagttcg ttcactggct 2160taagaactta gaatgcaata cagtctctct tatttcttat taaaat 220650490PRTAspergillus terreus 50Met Thr Lys Gln Ser Ala Asp Ser Asn Ala Lys Ser Gly Val Thr Ser1 5 10 15Glu Ile Cys His Trp Ala Ser Asn Leu Ala Thr Asp Asp Ile Pro Ser 20 25 30Asp Val Leu Glu Arg Ala Lys Tyr Leu Ile Leu Asp Gly Ile Ala Cys 35 40 45Ala Trp Val Gly Ala Arg Val Pro Trp Ser Glu Lys Tyr Val Gln Ala 50 55 60Thr Met Ser Phe Glu Pro Pro Gly Ala Cys Arg Val Ile Gly Tyr Gly65 70 75 80Gln Lys Leu Gly Pro Val Ala Ala Ala Met Thr Asn Ser Ala Phe Ile 85 90 95Gln Ala Thr Glu Leu Asp Asp Tyr His Ser Glu Ala Pro Leu His Ser 100 105 110Ala Ser Ile Val Leu Pro Ala Val Phe Ala Ala Ser Glu Val Leu Ala 115 120 125Glu Gln Gly Lys Thr Ile Ser Gly Ile Asp Val Ile Leu Ala Ala Ile 130 135 140Val Gly Phe Glu Ser Gly Pro Arg Ile Gly Lys Ala Ile Tyr Gly Ser145 150 155 160Asp Leu Leu Asn Asn Gly Trp His Cys Gly Ala Val Tyr Gly Ala Pro 165 170 175Ala Gly Ala Leu Ala Thr Gly Lys Leu Leu Gly Leu Thr Pro Asp Ser 180 185 190Met Glu Asp Ala Leu Gly Ile Ala Cys Thr Gln Ala Cys Gly Leu Met 195 200 205Ser Ala Gln Tyr Gly Gly Met Val Lys Arg Val Gln His Gly Phe Ala 210 215 220Ala Arg Asn Gly Leu Leu Gly Gly Leu Leu Ala His Gly Gly Tyr Glu225 230 235 240Ala Met Lys Gly Val Leu Glu Arg Ser Tyr Gly Gly Phe Leu Lys Met 245 250 255Phe Thr Lys Gly Asn Gly Arg Glu Pro Pro Tyr Lys Glu Glu Glu Val 260 265 270Val Ala Gly Leu Gly Ser Phe Trp His Thr Phe Thr Ile Arg Ile Lys 275 280 285Leu Tyr Ala Cys Cys Gly Leu Val His Gly Pro Val Glu Ala Ile Glu 290 295 300Asn Leu Gln Gly Arg Tyr Pro Glu Leu Leu Asn Arg Ala Asn Leu Ser305 310 315 320Asn Ile Arg His Val His Val Gln Leu Ser Thr Ala Ser Asn Ser His 325 330 335Cys Gly Trp Ile Pro Glu Glu Arg Pro Ile Ser Ser Ile Ala Gly Gln 340 345 350Met Ser Val Ala Tyr Ile Leu Ala Val Gln Leu Val Asp Gln Gln Cys 355 360 365Leu Leu Ser Gln Phe Ser Glu Phe Asp Asp Asn Leu Glu Arg Pro Glu 370 375 380Val Trp Asp Leu Ala Arg Lys Val Thr Ser Ser Gln Ser Glu Glu Phe385 390 395 400Asp Gln Asp Gly Asn Cys Leu Ser Ala Gly Arg Val Arg Ile Glu Phe 405 410 415Asn Asp Gly Ser Ser Ile Thr Glu Ser Val Glu Lys Pro Leu Gly Val 420 425 430Lys Glu Pro Met Pro Asn Glu Arg Ile Leu His Lys Tyr Arg Thr Leu 435 440 445Ala Gly Ser Val Thr Asp Glu Ser Arg Val Lys Glu Ile Glu Asp Leu 450 455 460Val Leu Gly Leu Asp Arg Leu Thr Asp Ile Ser Pro Leu Leu Glu Leu465 470 475 480Leu Asn Cys Pro Val Lys Ser Pro Leu Val 485 490511862DNAAspergillus vadensis 51gttttctgtg tgtctttggg gggttataaa tagggtgtcg aatatctgga agatagggaa 60ttctttctct ttcaatcaat caatcaagaa ttcttttagg gagtttctat actacatccg 120atatggtcgc catcaccgct aaatctgaag cggcttctgc tacttcgccc attcctacca 180attctaatac taccatgact actaccctca acggggtaga tggttcaaaa gagaaagaaa 240aagaccagat acccccaaac aaagaggaag gaacaaaagc agaagagaaa gaaaccgaag 300catacaactc ctccaacggc gtcaccagcc aactctgcaa ctggatcgcc tctctccagc 360tagaagacat tccagactct gtccgcaccc gcgccaagta cctctttctc gatggcatcg 420cctgcgcact cgtcggtgcg cgcgtcccat ggtcgcagaa ggcttttgat gcgatggctg 480ttttcgagga gaagggaaag catgtggtta ttgggtatga agagcgcctt ggtgctatcg 540ccgccgcaac cctcaacggc tcctggatcc aagcctgcga agtagacgac taccacagcg 600tggcgcccct gcactcgcag gccgtggtca tccctcctct cttcgctgcc gccgtcagtg 660cgcggaacca tccgaccgca ccgcgcatca tcgacgggcg aacacttctt ctcgcctccg 720tggtagggtt cgaggttggt ccgcgcgtgg gcatggcgct acacggcacc gagatgctcg 780cgaagggatg gcactgcggg tctgtgtttg gtggacccgc ggccgcaggc agttctgcaa 840aactactcgg tttgtcggcg ggtcaagtcg aagacgcgat cggagtagca gcgacacaag 900catgcggact catggcggcg cagtacgacg ggatggtgaa gcggatgcat catggcttcg 960cggcaaggaa tggactgttg ggcacgatgt tagcgtgggg aggttatgaa gggatcaaga 1020aggtgtttga gcggccgtat ggaggatttc tggcaatgtt tggcctaggg tcgaagcaca 1080cgcctagttc gaagccggag gaggtggcaa aggatttggg gacgttctgg cacacggcgg 1140agtggattcg gttgaagttg catgcgtgct gtggggggat tcatggcacg attgagtgtt 1200tggcggagat gcaggagatg tatccagagc gatttggacg ggagaaacta ggagagatca 1260aggagattcg gatccagttg agtgatgcgg tgtttcatca ttgtggatgg gcgccggaga 1320cgaggccgtt gaccccgacg ggggcgcaga tgaatacggc gtttgtggcg gcctcgcagt 1380tggtggatgg acaagtgttg ttggagcagt tctcgtcggg gaagttggat cgggatgagg 1440tttgggaatt gattgggaag acgagttgta ttcatacggc ggagttggac aagccgaata 1500ttggttgtgg tgcgttgatc tccatcacgt ttgcggatgg cagtcaggtt cagcattcgt 1560tgttgaagcc gaagggggtg gatgaaccca tttcgaatga ggagatcttg gagaagtttc 1620gtcggttgac gggcgggttg attggggtgg agaggcagga gaagattgaa aaggccgtgc 1680tggggatgga ggagttgcag gatgtggatg agttgattga gttgctgagt gtgaatgtgg 1740tcaatccgtt gcagtagtat actagtcatc tgttttgatg cttctggcgt tggtcgtgtt 1800gggatagtat ctcataattt tgaattaata aatcattcaa catggtgaaa atcatatttg 1860tg 186252544PRTAspergillus vadensis 52Met Val Ala Ile Thr Ala Lys Ser Glu Ala Ala Ser Ala Thr Ser Pro1 5 10 15Ile Pro Thr Asn Ser Asn Thr Thr Met Thr Thr Thr Leu Asn Gly Val 20 25 30Asp Gly Ser Lys Glu Lys Glu Lys Asp Gln Ile Pro Pro Asn Lys Glu 35 40 45Glu Gly Thr Lys Ala Glu Glu Lys Glu Thr Glu Ala Tyr Asn Ser Ser 50 55 60Asn Gly Val Thr Ser Gln Leu Cys Asn Trp Ile Ala Ser Leu Gln Leu65 70 75 80Glu Asp Ile Pro Asp Ser Val Arg Thr Arg Ala Lys Tyr Leu Phe Leu 85 90 95Asp Gly Ile Ala Cys Ala Leu Val Gly Ala Arg Val Pro Trp Ser Gln 100 105 110Lys Ala Phe Asp Ala Met Ala Val Phe Glu Glu Lys Gly Lys His Val 115 120 125Val Ile Gly Tyr Glu Glu Arg Leu Gly Ala Ile Ala Ala Ala Thr Leu 130 135 140Asn Gly Ser Trp Ile Gln Ala Cys Glu Val Asp Asp Tyr His Ser Val145 150 155 160Ala Pro Leu His Ser Gln Ala Val Val Ile Pro Pro Leu Phe Ala Ala 165 170 175Ala Val Ser Ala Arg Asn His Pro Thr Ala Pro Arg Ile Ile Asp Gly 180 185 190Arg Thr Leu Leu Leu Ala Ser Val Val Gly Phe Glu Val Gly Pro Arg 195 200 205Val Gly Met Ala Leu His Gly Thr Glu Met Leu Ala Lys Gly Trp His 210 215 220Cys Gly Ser Val Phe Gly Gly Pro Ala Ala Ala Gly Ser Ser Ala Lys225 230 235 240Leu Leu Gly Leu Ser Ala Gly Gln Val Glu

Asp Ala Ile Gly Val Ala 245 250 255Ala Thr Gln Ala Cys Gly Leu Met Ala Ala Gln Tyr Asp Gly Met Val 260 265 270Lys Arg Met His His Gly Phe Ala Ala Arg Asn Gly Leu Leu Gly Thr 275 280 285Met Leu Ala Trp Gly Gly Tyr Glu Gly Ile Lys Lys Val Phe Glu Arg 290 295 300Pro Tyr Gly Gly Phe Leu Ala Met Phe Gly Leu Gly Ser Lys His Thr305 310 315 320Pro Ser Ser Lys Pro Glu Glu Val Ala Lys Asp Leu Gly Thr Phe Trp 325 330 335His Thr Ala Glu Trp Ile Arg Leu Lys Leu His Ala Cys Cys Gly Gly 340 345 350Ile His Gly Thr Ile Glu Cys Leu Ala Glu Met Gln Glu Met Tyr Pro 355 360 365Glu Arg Phe Gly Arg Glu Lys Leu Gly Glu Ile Lys Glu Ile Arg Ile 370 375 380Gln Leu Ser Asp Ala Val Phe His His Cys Gly Trp Ala Pro Glu Thr385 390 395 400Arg Pro Leu Thr Pro Thr Gly Ala Gln Met Asn Thr Ala Phe Val Ala 405 410 415Ala Ser Gln Leu Val Asp Gly Gln Val Leu Leu Glu Gln Phe Ser Ser 420 425 430Gly Lys Leu Asp Arg Asp Glu Val Trp Glu Leu Ile Gly Lys Thr Ser 435 440 445Cys Ile His Thr Ala Glu Leu Asp Lys Pro Asn Ile Gly Cys Gly Ala 450 455 460Leu Ile Ser Ile Thr Phe Ala Asp Gly Ser Gln Val Gln His Ser Leu465 470 475 480Leu Lys Pro Lys Gly Val Asp Glu Pro Ile Ser Asn Glu Glu Ile Leu 485 490 495Glu Lys Phe Arg Arg Leu Thr Gly Gly Leu Ile Gly Val Glu Arg Gln 500 505 510Glu Lys Ile Glu Lys Ala Val Leu Gly Met Glu Glu Leu Gln Asp Val 515 520 525Asp Glu Leu Ile Glu Leu Leu Ser Val Asn Val Val Asn Pro Leu Gln 530 535 540531797DNATribolium castaneumCDS(41)..(1663) 53acttgtgaat cagtcgtgcc cccacgagga tccacacacg atg ccg gcc aca ggc 55 Met Pro Ala Thr Gly 1 5gaa gac caa gac ctg gtg caa gac ctc atc gag gag ccc gcc acc ttc 103Glu Asp Gln Asp Leu Val Gln Asp Leu Ile Glu Glu Pro Ala Thr Phe 10 15 20agc gac gcc gtc ctc tcc tcc gac gag gaa ctc ttc cac cag aag tgc 151Ser Asp Ala Val Leu Ser Ser Asp Glu Glu Leu Phe His Gln Lys Cys 25 30 35ccc aaa ccc gcc ccc att tac tcc ccg gtc tcg aaa ccg gtc tcc ttc 199Pro Lys Pro Ala Pro Ile Tyr Ser Pro Val Ser Lys Pro Val Ser Phe 40 45 50gag agc ctc ccc aac agg cgc ctc cac gag gag ttc ctc cgc agc tcg 247Glu Ser Leu Pro Asn Arg Arg Leu His Glu Glu Phe Leu Arg Ser Ser 55 60 65gtg gac gtc ctc ctc cag gag gcg gtg ttc gag gga acg aac cgc aag 295Val Asp Val Leu Leu Gln Glu Ala Val Phe Glu Gly Thr Asn Arg Lys70 75 80 85aac cgg gtg ctg caa tgg cgg gag ccg gag gag ttg agg cgt ctg atg 343Asn Arg Val Leu Gln Trp Arg Glu Pro Glu Glu Leu Arg Arg Leu Met 90 95 100gac ttt ggg gtg cgg agt gcg ccc tcc acg cac gag gag ttg ttg gag 391Asp Phe Gly Val Arg Ser Ala Pro Ser Thr His Glu Glu Leu Leu Glu 105 110 115gtg ttg aag aag gtt gta act tat tcg gtt aaa acc gga cat ccg tac 439Val Leu Lys Lys Val Val Thr Tyr Ser Val Lys Thr Gly His Pro Tyr 120 125 130ttc gtg aac cag ttg ttc tcg gcg gtg gat ccg tac ggt ttg gtg gca 487Phe Val Asn Gln Leu Phe Ser Ala Val Asp Pro Tyr Gly Leu Val Ala 135 140 145caa tgg gcc acg gat gcg ctc aat ccg agt gtt tac acc tac gag gtt 535Gln Trp Ala Thr Asp Ala Leu Asn Pro Ser Val Tyr Thr Tyr Glu Val150 155 160 165tcg ccg gtt ttt gtt ctg atg gag gaa gtg gtt ttg agg gag atg agg 583Ser Pro Val Phe Val Leu Met Glu Glu Val Val Leu Arg Glu Met Arg 170 175 180gcc att gtg ggg ttc gag ggg gga aag ggc gat ggg att ttt tgc cca 631Ala Ile Val Gly Phe Glu Gly Gly Lys Gly Asp Gly Ile Phe Cys Pro 185 190 195gga ggg tcc att gcc aat gga tat gcc atc agt tgt gcc aga tac agg 679Gly Gly Ser Ile Ala Asn Gly Tyr Ala Ile Ser Cys Ala Arg Tyr Arg 200 205 210ttt atg ccc gat att aag aaa aaa ggc ctc cac tct ctc ccc cgt ttg 727Phe Met Pro Asp Ile Lys Lys Lys Gly Leu His Ser Leu Pro Arg Leu 215 220 225gtc ctc ttc acc tct gaa gat gcc cac tat tcc atc aaa aaa ctc gcc 775Val Leu Phe Thr Ser Glu Asp Ala His Tyr Ser Ile Lys Lys Leu Ala230 235 240 245tct ttc caa ggc atc ggc acc gac aac gtc tac ttg ata cga acg gac 823Ser Phe Gln Gly Ile Gly Thr Asp Asn Val Tyr Leu Ile Arg Thr Asp 250 255 260gcc cga ggt cgc atg gac gtc tcg cac ctg gtg gag gaa atc gag cgt 871Ala Arg Gly Arg Met Asp Val Ser His Leu Val Glu Glu Ile Glu Arg 265 270 275tcg ctc cgt gaa ggc gcc gct cct ttc atg gtc agt gcc acc gct gga 919Ser Leu Arg Glu Gly Ala Ala Pro Phe Met Val Ser Ala Thr Ala Gly 280 285 290acc aca gtg att ggt gcc ttt gac ccc atc gaa aaa atc gca gat gtg 967Thr Thr Val Ile Gly Ala Phe Asp Pro Ile Glu Lys Ile Ala Asp Val 295 300 305tgc caa aaa tac aaa ctg tgg ttg cac gtg gat gcc gcc tgg gga ggt 1015Cys Gln Lys Tyr Lys Leu Trp Leu His Val Asp Ala Ala Trp Gly Gly310 315 320 325ggc gcg ctt gtc tct gcc aaa cac cgc cac ctc ctc aaa ggg att gag 1063Gly Ala Leu Val Ser Ala Lys His Arg His Leu Leu Lys Gly Ile Glu 330 335 340agg gcc gac tcg gtc acc tgg aac cct cac aaa ctc cta aca gcc ccc 1111Arg Ala Asp Ser Val Thr Trp Asn Pro His Lys Leu Leu Thr Ala Pro 345 350 355cag caa tgt tcc aca ctt tta ctg cga cat gag ggt gtc ctc gcc gag 1159Gln Gln Cys Ser Thr Leu Leu Leu Arg His Glu Gly Val Leu Ala Glu 360 365 370gcg cat tcc acg aac gcc gct tac ctc ttc caa aaa gac aaa ttc tac 1207Ala His Ser Thr Asn Ala Ala Tyr Leu Phe Gln Lys Asp Lys Phe Tyr 375 380 385gac acc aaa tac gac acg ggc gac aag cac atc cag tgc ggc cgc agg 1255Asp Thr Lys Tyr Asp Thr Gly Asp Lys His Ile Gln Cys Gly Arg Arg390 395 400 405gcc gac gtc ctc aag ttc tgg ttc atg tgg aag gcg aag gga aca tca 1303Ala Asp Val Leu Lys Phe Trp Phe Met Trp Lys Ala Lys Gly Thr Ser 410 415 420ggg ttg gag aaa cac gtc gat aaa gtg ttc gaa aat gcg aga ttt ttc 1351Gly Leu Glu Lys His Val Asp Lys Val Phe Glu Asn Ala Arg Phe Phe 425 430 435acc gat tgt ata aaa aat cgg gaa ggg ttt gaa atg gtg ata gcg gag 1399Thr Asp Cys Ile Lys Asn Arg Glu Gly Phe Glu Met Val Ile Ala Glu 440 445 450ccc gaa tac aca aac atc tgc ttt tgg tac gtg ccg aag agt ctg agg 1447Pro Glu Tyr Thr Asn Ile Cys Phe Trp Tyr Val Pro Lys Ser Leu Arg 455 460 465ggg cgc aag gac gaa gcc gat tac aaa gac aag ctg cat aag gtg gcc 1495Gly Arg Lys Asp Glu Ala Asp Tyr Lys Asp Lys Leu His Lys Val Ala470 475 480 485ccc agg att aag gag agg atg atg aag gag ggc tcc atg atg gtc acg 1543Pro Arg Ile Lys Glu Arg Met Met Lys Glu Gly Ser Met Met Val Thr 490 495 500tac cag gcg caa aag gga cac ccg aat ttt ttc agg att gtg ttc cag 1591Tyr Gln Ala Gln Lys Gly His Pro Asn Phe Phe Arg Ile Val Phe Gln 505 510 515aat tcg ggg ctt gac aag gct gat atg gtg cac ctt gtt gag gag att 1639Asn Ser Gly Leu Asp Lys Ala Asp Met Val His Leu Val Glu Glu Ile 520 525 530gag cgg ttg ggg agc gat ctt taa ggccttgaat ggtgctagtt gtagattgtg 1693Glu Arg Leu Gly Ser Asp Leu 535 540taattaatgt aaaaagtatt atttaaaaaa tgtaaatttt gatgtattta ttctcattag 1753ttgtagttta ttcaaataaa agtttaaaaa aaaaaaaaaa aaaa 179754540PRTTribolium castaneum 54Met Pro Ala Thr Gly Glu Asp Gln Asp Leu Val Gln Asp Leu Ile Glu1 5 10 15Glu Pro Ala Thr Phe Ser Asp Ala Val Leu Ser Ser Asp Glu Glu Leu 20 25 30Phe His Gln Lys Cys Pro Lys Pro Ala Pro Ile Tyr Ser Pro Val Ser 35 40 45Lys Pro Val Ser Phe Glu Ser Leu Pro Asn Arg Arg Leu His Glu Glu 50 55 60Phe Leu Arg Ser Ser Val Asp Val Leu Leu Gln Glu Ala Val Phe Glu65 70 75 80Gly Thr Asn Arg Lys Asn Arg Val Leu Gln Trp Arg Glu Pro Glu Glu 85 90 95Leu Arg Arg Leu Met Asp Phe Gly Val Arg Ser Ala Pro Ser Thr His 100 105 110Glu Glu Leu Leu Glu Val Leu Lys Lys Val Val Thr Tyr Ser Val Lys 115 120 125Thr Gly His Pro Tyr Phe Val Asn Gln Leu Phe Ser Ala Val Asp Pro 130 135 140Tyr Gly Leu Val Ala Gln Trp Ala Thr Asp Ala Leu Asn Pro Ser Val145 150 155 160Tyr Thr Tyr Glu Val Ser Pro Val Phe Val Leu Met Glu Glu Val Val 165 170 175Leu Arg Glu Met Arg Ala Ile Val Gly Phe Glu Gly Gly Lys Gly Asp 180 185 190Gly Ile Phe Cys Pro Gly Gly Ser Ile Ala Asn Gly Tyr Ala Ile Ser 195 200 205Cys Ala Arg Tyr Arg Phe Met Pro Asp Ile Lys Lys Lys Gly Leu His 210 215 220Ser Leu Pro Arg Leu Val Leu Phe Thr Ser Glu Asp Ala His Tyr Ser225 230 235 240Ile Lys Lys Leu Ala Ser Phe Gln Gly Ile Gly Thr Asp Asn Val Tyr 245 250 255Leu Ile Arg Thr Asp Ala Arg Gly Arg Met Asp Val Ser His Leu Val 260 265 270Glu Glu Ile Glu Arg Ser Leu Arg Glu Gly Ala Ala Pro Phe Met Val 275 280 285Ser Ala Thr Ala Gly Thr Thr Val Ile Gly Ala Phe Asp Pro Ile Glu 290 295 300Lys Ile Ala Asp Val Cys Gln Lys Tyr Lys Leu Trp Leu His Val Asp305 310 315 320Ala Ala Trp Gly Gly Gly Ala Leu Val Ser Ala Lys His Arg His Leu 325 330 335Leu Lys Gly Ile Glu Arg Ala Asp Ser Val Thr Trp Asn Pro His Lys 340 345 350Leu Leu Thr Ala Pro Gln Gln Cys Ser Thr Leu Leu Leu Arg His Glu 355 360 365Gly Val Leu Ala Glu Ala His Ser Thr Asn Ala Ala Tyr Leu Phe Gln 370 375 380Lys Asp Lys Phe Tyr Asp Thr Lys Tyr Asp Thr Gly Asp Lys His Ile385 390 395 400Gln Cys Gly Arg Arg Ala Asp Val Leu Lys Phe Trp Phe Met Trp Lys 405 410 415Ala Lys Gly Thr Ser Gly Leu Glu Lys His Val Asp Lys Val Phe Glu 420 425 430Asn Ala Arg Phe Phe Thr Asp Cys Ile Lys Asn Arg Glu Gly Phe Glu 435 440 445Met Val Ile Ala Glu Pro Glu Tyr Thr Asn Ile Cys Phe Trp Tyr Val 450 455 460Pro Lys Ser Leu Arg Gly Arg Lys Asp Glu Ala Asp Tyr Lys Asp Lys465 470 475 480Leu His Lys Val Ala Pro Arg Ile Lys Glu Arg Met Met Lys Glu Gly 485 490 495Ser Met Met Val Thr Tyr Gln Ala Gln Lys Gly His Pro Asn Phe Phe 500 505 510Arg Ile Val Phe Gln Asn Ser Gly Leu Asp Lys Ala Asp Met Val His 515 520 525Leu Val Glu Glu Ile Glu Arg Leu Gly Ser Asp Leu 530 535 540551356DNABacillus cereus 55ttaaagttga gctaaacatt ctttcattgt tttaacgata aaagtaaagt cttcctctgt 60gatgcttaat ggaggtgcaa gctgcaaaat attattgtaa cctgcaacag tgtcaccatt 120tttaccaata attagacctt tttctttaca agcattgatg actttgttca tcttttcaat 180ggaagccggt tcttttgttt gcttatcttc cactagttca atacctaaaa gaaggccttt 240tccgcgaaca tctcctacgt ttggatgctc ttttacatct tctagttcat ataacagtcg 300ttcacccaat tctttggaac gttcaatgag tttctcattc tccataattt ctaaattctt 360caaagctaag gcgcaagcag caggatttcc tccaaacgta tttacatggc ggaagcgatc 420ataatcatca ctgcctacga atgcctcata aacctctcgt ctaactgctg ttgctgacaa 480aggaagatac gcacttgtaa taccttttgc cattgtaatg atatctggtt tgacgccata 540attcataaat ccaaacggct tccctgttcg tccaaatcca catataactt catcacaaat 600gagcaacgca ccatgcttct cgcaaatttc ttttactttt tccatatatc catcaggagg 660cattaaaatt ccgcccccag taatgattgg ctccataatc acaccggcta ctgtttggct 720taactcccat gtcatgacac gatcgatttc ctcagcactt gccagtgtat gaacatcctc 780tggattgcga tacgtatcag gcggtgctac atgcaaaaaa ccttgtccta atggctcata 840tttatacttt ctttgtgctt gccctgttgc tgcaagagca cccattgagt taccgtgata 900agcgcggtag cgggaaataa acttatagcg tccatgatca cctttttgct gatgatattg 960acgagcaatt ttaaatgctg tttcatttgc ttctgatcca ctgttagaaa agaaaatgac 1020gtattcatca tccagccatt cattcaattt ctctgctaat ttaatggcag gaacatgact 1080ttgtgtcaga gggaaatatg gcatttcttc aagttgctca aatgccgctc ttgcaagctc 1140ttttcggccg tatccaacat tcacacacca aagaccagac ataccgtcta aataacggtt 1200tccatcaata tccgtcaccc atgccccttc tgcttttgtg ataattaaat tcgttggact 1260aggggccgct cctctcatcg catgccaaag gtacttttca tctgtttttt tcaaactttg 1320tgtttgctct gtcacttgca caatcatcag ctccat 135656451PRTBacillus cereus 56Met Glu Leu Met Ile Val Gln Val Thr Glu Gln Thr Gln Ser Leu Lys1 5 10 15Lys Thr Asp Glu Lys Tyr Leu Trp His Ala Met Arg Gly Ala Ala Pro 20 25 30Ser Pro Thr Asn Leu Ile Ile Thr Lys Ala Glu Gly Ala Trp Val Thr 35 40 45Asp Ile Asp Gly Asn Arg Tyr Leu Asp Gly Met Ser Gly Leu Trp Cys 50 55 60Val Asn Val Gly Tyr Gly Arg Lys Glu Leu Ala Arg Ala Ala Phe Glu65 70 75 80Gln Leu Glu Glu Met Pro Tyr Phe Pro Leu Thr Gln Ser His Val Pro 85 90 95Ala Ile Lys Leu Ala Glu Lys Leu Asn Glu Trp Leu Asp Asp Glu Tyr 100 105 110Val Ile Phe Phe Ser Asn Ser Gly Ser Glu Ala Asn Glu Thr Ala Phe 115 120 125Lys Ile Ala Arg Gln Tyr His Gln Gln Lys Gly Asp His Gly Arg Tyr 130 135 140Lys Phe Ile Ser Arg Tyr Arg Ala Tyr His Gly Asn Ser Met Gly Ala145 150 155 160Leu Ala Ala Thr Gly Gln Ala Gln Arg Lys Tyr Lys Tyr Glu Pro Leu 165 170 175Gly Gln Gly Phe Leu His Val Ala Pro Pro Asp Thr Tyr Arg Asn Pro 180 185 190Glu Asp Val His Thr Leu Ala Ser Ala Glu Glu Ile Asp Arg Val Met 195 200 205Thr Trp Glu Leu Ser Gln Thr Val Ala Gly Val Ile Met Glu Pro Ile 210 215 220Ile Thr Gly Gly Gly Ile Leu Met Pro Pro Asp Gly Tyr Met Glu Lys225 230 235 240Val Lys Glu Ile Cys Glu Lys His Gly Ala Leu Leu Ile Cys Asp Glu 245 250 255Val Ile Cys Gly Phe Gly Arg Thr Gly Lys Pro Phe Gly Phe Met Asn 260 265 270Tyr Gly Val Lys Pro Asp Ile Ile Thr Met Ala Lys Gly Ile Thr Ser 275 280 285Ala Tyr Leu Pro Leu Ser Ala Thr Ala Val Arg Arg Glu Val Tyr Glu 290 295 300Ala Phe Val Gly Ser Asp Asp Tyr Asp Arg Phe Arg His Val Asn Thr305 310 315 320Phe Gly Gly Asn Pro Ala Ala Cys Ala Leu Ala Leu Lys Asn Leu Glu 325 330 335Ile Met Glu Asn Glu Lys Leu Ile Glu Arg Ser Lys Glu Leu Gly Glu 340 345 350Arg Leu Leu Tyr Glu Leu Glu Asp Val Lys Glu His Pro Asn Val Gly 355 360 365Asp Val Arg Gly Lys Gly Leu Leu Leu Gly Ile Glu Leu Val Glu Asp 370 375 380Lys Gln Thr Lys Glu Pro Ala Ser Ile Glu Lys Met Asn Lys Val Ile385 390 395 400Asn Ala Cys Lys Glu Lys Gly Leu Ile Ile Gly Lys Asn Gly Asp Thr 405 410 415Val Ala Gly Tyr Asn Asn Ile Leu Gln Leu Ala Pro Pro Leu Ser Ile 420 425 430Thr Glu Glu Asp Phe Thr Phe Ile Val Lys Thr Met Lys Glu Cys Leu 435 440 445Ala Gln Leu 45057747DNAEscherichia coli 57atgatcgttt tagtaactgg agcaacggca ggttttggtg aatgcattac tcgtcgtttt 60attcaacaag ggcataaagt tatcgccact ggccgtcgcc aggagcggtt gcaggagtta 120aaagacgaac tgggagataa tctgtatatc gcccaactgg

acgttcgcaa ccgcgccgct 180attgaagaga tgctggcatc gcttcctgcc gagtggtgca atattgatat cctggtaaat 240aatgccggct tggcgttggg catggagcct gcgcataaag ccagcgttga agactgggaa 300acgatgattg ataccaacaa caaaggcctg gtatatatga cgcgcgccgt cttaccgggt 360atggttgaac gtaatcatgg tcatattatt aacattggct caacggcagg tagctggccg 420tatgccggtg gtaacgttta cggtgcgacg aaagcgtttg ttcgtcagtt tagcctgaat 480ctgcgtacgg atctgcatgg tacggcggtg cgcgtcaccg acatcgaacc gggtctggtg 540ggtggcaccg agttttccaa tgtccgcttt aaaggcgatg acggtaaagc ggaaaaaacc 600tatcaaaata ccgttgcatt gacgccagaa gatgtcagcg aagccgtctg gtgggtgtca 660acgctgcctg ctcacgtcaa tatcaatacc ctggaaatga tgccggttac ccaaagctat 720gccggactga atgtccaccg tcagtaa 74758248PRTProteobacteria 58Met Ile Val Leu Val Thr Gly Ala Thr Ala Gly Phe Gly Glu Cys Ile1 5 10 15Thr Arg Arg Phe Ile Gln Gln Gly His Lys Val Ile Ala Thr Gly Arg 20 25 30Arg Gln Glu Arg Leu Gln Glu Leu Lys Asp Glu Leu Gly Asp Asn Leu 35 40 45Tyr Ile Ala Gln Leu Asp Val Arg Asn Arg Ala Ala Ile Glu Glu Met 50 55 60Leu Ala Ser Leu Pro Ala Glu Trp Cys Asn Ile Asp Ile Leu Val Asn65 70 75 80Asn Ala Gly Leu Ala Leu Gly Met Glu Pro Ala His Lys Ala Ser Val 85 90 95Glu Asp Trp Glu Thr Met Ile Asp Thr Asn Asn Lys Gly Leu Val Tyr 100 105 110Met Thr Arg Ala Val Leu Pro Gly Met Val Glu Arg Asn His Gly His 115 120 125Ile Ile Asn Ile Gly Ser Thr Ala Gly Ser Trp Pro Tyr Ala Gly Gly 130 135 140Asn Val Tyr Gly Ala Thr Lys Ala Phe Val Arg Gln Phe Ser Leu Asn145 150 155 160Leu Arg Thr Asp Leu His Gly Thr Ala Val Arg Val Thr Asp Ile Glu 165 170 175Pro Gly Leu Val Gly Gly Thr Glu Phe Ser Asn Val Arg Phe Lys Gly 180 185 190Asp Asp Gly Lys Ala Glu Lys Thr Tyr Gln Asn Thr Val Ala Leu Thr 195 200 205Pro Glu Asp Val Ser Glu Ala Val Trp Trp Val Ser Thr Leu Pro Ala 210 215 220His Val Asn Ile Asn Thr Leu Glu Met Met Pro Val Thr Gln Ser Tyr225 230 235 240Ala Gly Leu Asn Val His Arg Gln 24559987DNAAspergillus pseudoterreus 59ggttgtagca gcgtaaacac atggatagtt aaataatcgg atgtacaccc actgttggaa 60atgacggggg cctacaacac gagattatct gatccaattt ctgttcgttg gcattctatc 120attcgcagcg aaaattgtcc tattaaattg accatgacca aacaatctgc ggacagcaac 180gcaaagtcag gagttacgtc cgaaatatgt cattgggcat ccaacctggc cactgacgac 240atcccttcgg acgtattaga aagagcaaaa taccttattc tcgacggtat tgcatgtgcc 300tgggttggtg caagagtgcc ttggtcagag aagtatgttc aggcaacgat gagctttgag 360ccgccggggg cctgcagggt gattggatat ggacaggtaa attttattca ctctagacgg 420tccacaaagt atactgacga tccttcgtat agaaactggg gcctgttgca gcagccatga 480ccaattccgc tttcatacag gctacggagc ttgacgacta ccacagcgaa gcccccctac 540actctgcaag cattgtcctt cctgcggtct ttgcagcaag tgaggtctta gccgagcagg 600gcaaaacaat ttccggtata gatgttattc tagccgccat tgtggggttt gaatctggcc 660cacggatcgg caaagcaatc tacggatcgg acctcttgaa caacggctgg cattgtggag 720ctgtgtatgg cgctccagcc ggtgcgctgg ccacaggaaa gctcctcggt ctaactccag 780actccatgga agatgctctc ggaattgcgt gcacgcaagc ctgtggttta atgtcggcgc 840aatacggagg catggtaaag cgtgtgcaac acggattcgc agcgcgtaat ggtcttcttg 900ggggactgtt ggcccatggt gggtacgagg caatgaaagg tgtcctggag agatcttacg 960gcggtttcct caagatgttc accaagg 9876050DNAArtificial Sequenceprimer used to isolate A. pseudoterreus 5'-cadA gene 60ccctcgaggt cgacggtatc gatagatatc ggttgtagca gcgtaaacac 506133DNAArtificial Sequenceprimer used to isolate A. pseudoterreus 5'-cadA gene 61tctttcatag tagccttggt gaacatcttg agg 3362813DNAAspergillus niger 62ctactatgaa agaccgcgat gggccgatag tagtagttac ttccattaca tcatctcatc 60cgcccggttc ctcgcctccg cggcagtcta cgggtaggat cgtagcaaaa acccggggga 120tagacccgtc gtcccgagct ggagttccgt ataacctagg tagaaggtat caattgaacc 180cgaacaactg gcaaaacatt ctcgagatcg taggagtgag tacccggcgt gatggagggg 240gagcacgctc attggtccgt acggcagctg ccgaggggga gcaggagatc caaatatcgt 300gagtctcctg ctttgcccgg tgtatgaaac cggaaaggac tgctggggaa ctggggagcg 360gcgcaagccg ggaatcccag ctgacaattg acccatcctc atgccgtggc agagcttgag 420gtagcttttg ccccgtctgt ctccccggtg tgcgcattcg actgggcgcg gcatctgtgc 480ctcctccagg agcggaggac ccagtagtaa gtaggcctga cctggtcgtt gcgtcagtcc 540agaggttccc tcccctaccc tttttctact tcccctcccc cgccgctcaa cttttctttc 600ccttttactt tctctctctc ttcctcttca tccatcctct cttcatcact tccctcttcc 660cttcatccaa ttcatcttcc aagtgagtct tcctccccat ctgtccctcc atctttccca 720tcatcatctc ccttcccagc tcctcccctc ctctcgtctc ctcacgaagc ttgactaacc 780attaccccgc cacatagaca catctaaaca atg 8136334DNAArtificial Sequenceprimer used to isolate an A. niger gpdA promoter 63atgttcacca aggctactat gaaagaccgc gatg 346436DNAArtificial Sequenceprimer used to isolate an A. niger gpdA promoter 64cgccggtggc gggcattgtt tagatgtgtc tatgtg 36651617DNAArtificial SequencepanD cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus 65cccgccaccg gcgaggacca ggacctggtg caggacctga tcgaggaacc cgccaccttc 60tccgacgccg tcctgtcctc cgacgaggaa ctgttccacc agaagtgccc caagccggct 120ccgatctaca gccccgtcag caagcccgtc agcttcgagt ccctgccgaa ccgccgcctg 180cacgaagagt tcctccgctc ctccgtcgac gtcctgctgc aagaggccgt gttcgagggc 240accaaccgca agaaccgcgt cctgcagtgg cgcgagcccg aagaactgcg ccgcctgatg 300gacttcggcg tccgcagcgc cccgtccacg catgaggaac tgctcgaggt cctgaagaag 360gtcgtcacct actccgtcaa gaccggccat ccgtacttcg tcaaccagct gttctccgcc 420gtcgatccct acggcctggt cgcccagtgg gccaccgacg cgctgaaccc ctccgtctac 480acctacgagg tcagccccgt gttcgtcctg atggaagagg tcgtcctgcg cgagatgcgc 540gccatcgtcg gcttcgaagg cggcaaaggc gacggcatct tctgccctgg cggctcgatc 600gccaacggct acgccatcag ctgcgcccgc taccgcttca tgcccgacat caagaagaag 660ggcctgcact ccctgccgcg cctggtcctg ttcacctccg aggacgccca ctactcgatc 720aagaagctgg cctcgttcca aggcatcggc accgacaacg tctacctgat ccgcaccgac 780gctcgcggtc gcatggacgt cagccacctg gtcgaagaga tcgagcgctc cctccgcgag 840ggcgctgccc cgttcatggt cagcgccacc gccggcacca ccgtcatcgg cgccttcgat 900cccatcgaga agatcgccga cgtctgccag aagtacaagc tctggctgca cgtcgacgcc 960gcctggggcg gaggcgctct ggtgtccgcc aagcaccgcc atctgctgaa gggcatcgag 1020cgcgccgact ccgtcacctg gaatccccac aagctgctga ccgctccgca gcagtgcagc 1080accctgctgc tgcgccacga gggcgtcctg gccgaggcgc actccaccaa cgccgcctac 1140ctgttccaga aggacaagtt ctacgacacc aagtacgaca ccggcgacaa gcacatccag 1200tgcggccgtc gcgccgacgt gctgaagttc tggttcatgt ggaaggccaa gggcacctcc 1260ggcctcgaga agcacgtgga caaggtgttc gagaacgccc gcttcttcac cgactgcatc 1320aagaaccgtg agggcttcga gatggtgatc gccgagcctg agtacaccaa catctgtttc 1380tggtacgtcc ccaagagcct gcgcggacgc aaggacgagg ccgactacaa ggacaagctg 1440cacaaggtcg cccctcgcat caaagaacgc atgatgaagg aaggctccat gatggtcacc 1500taccaggcgc agaagggcca tccgaatttc ttccgcatcg tctttcagaa ctccggcctg 1560gacaaggccg acatggtcca tctggtcgag gaaatcgaac gcctgggctc cgacctc 16176633DNAArtificial Sequenceprimer used to isolate panD cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus 66catctaaaca atgcccgcca ccggcgagga cca 336735DNAArtificial Sequenceprimer used to isolate panD cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus 67atccaaccca tcagaggtcg gagcccaggc gttcg 35681040DNAAspergillus niger 68tgatgggttg gatgacgatg acttcatgtg attttgttat ttagaatatt ttatatttcc 60ttttcttctt ctcaccaccg atccccttaa cactcttgct tcatttgctt cagatttctc 120ggtttcttct tttttcttct ccccagttat ccactatatc tttgctagac cggcctgcgc 180cctggcatgc atcataaaat catgtccgtt ggtcatcatc tgttttgtat atccgtcata 240taaagtattc ttttattccc tcccccctcg gtcgtctttc gctgtcccgc ttcctacctc 300cggtttatag agcatggttc atctcttccg tacatttccg ttggtactag catttatgtc 360ttcagctagt atagaagctg ccgcagttgt tcgcttacta cctgcctaag tccttaactt 420tttaaagtgt ttaacctata cgtagtgtta aacgagtact gggaggtggt gaggtagaaa 480atgttctgca cgggcagtgg gtatttggta gtgtgtaagg cggttattta tcaggctgac 540gctaaagact tctatgggag cagtatggga tcgcggctca tagaagtaca caaaatctaa 600gagtcgtttg ataattaatt gattcccggc agggtcttct tgggattgag agaactggtt 660actttgattt gagatattgt aaagcttaag gctcttaaca cgtacgagcg aaacagcagg 720ggggaaatcg ggaaaagggg cgtggggtga ataaaaaagt tgaaataaga cactgtatct 780tgctgggggt gaataaagag agaataaaag agaggtaaat tccactcagc cccttttctt 840cgctctccaa acatcaaact ccgccggccg acccacagga tcccgaacaa gtggaagata 900tgtgccggtc cagacccttc gcacagctaa aagcagacct tcataagcgt ttccgggtag 960tattcgcaca cctgaactgg cacgtcgggg acacaactgt ttttgataca caagaacaca 1020caccacccat ctaggactca 10406933DNAArtificial Sequenceprimer used to isolate bidirectional terminator from A. niger elf3/multifunctional chaperone 69gggctccgac ctctgatggg ttggatgacg atg 337033DNAArtificial Sequenceprimer used to isolate bidirectional terminator from A. niger elf3/multifunctional chaperone 70tctggcccag ctctgagtcc tagatgggtg gtg 33711350DNAArtificial Sequencecodon optimized synthetic cDNA of beta-alanine-pyruvate aminotransferase (BAPAT) of Bacillus cereus 71gagctgggcc agacattcct tcatagtctt gacgatgaag gtgaagtcct cttcggtgat 60ggacagcgga ggggcgagct gcaggatgtt gttgtagccg gccacggtgt cgccgttctt 120gccgatgatc agacccttct ctttgcaggc gttgatgacc ttgttcatct tttcgatgga 180ggcgggctct ttggtctgct tatcctcgac gagttcgata cccagcagga ggcccttgcc 240gcggacgtcc ccgacgttgg ggtgctcttt gacgtcctcc aactcgtaca gcaggcgctc 300gcccagttct ttggaccgct cgatgagctt ctcgttttcc atgatctcga ggttcttcag 360ggccagcgcg caggcggcag ggttgccgcc gaaggtgttg acatggcgga agcggtcgta 420gtcgtcggag ccgacgaagg cctcgtagac ctcgcggcgg accgcggtgg cagacagcgg 480caggtaggcc gaggtgatac ccttggccat ggtgataatg tcgggcttga cgccgtagtt 540catgaagccg aagggcttgc cggtgcgacc gaagccgcag atgacctcgt cgcagatcag 600cagggcgccg tgcttttcgc agatctcttt gaccttttcc atgtagccgt ccggcggcat 660caggatgcca ccaccggtga tgatgggttc catgatgacg ccggcgacgg tctgggacag 720ctcccaggtc atgacgcggt cgatttcttc ggcggaggcc agggtgtgca cgtcctcggg 780gttgcgatag gtgtccggag gggccacgtg caggaagccc tgaccgaggg gctcgtactt 840gtacttgcgc tgggcctgac cggtcgcggc cagggcaccc atggagttgc cgtggtaggc 900gcggtagcga gagatgaact tgtagcggcc gtggtcaccc ttctgctggt ggtactggcg 960ggcgatcttg aaggcggttt cgttggcctc cgagccggag ttggagaaga agatgacgta 1020ctcgtcgtcc agccactcgt tcagcttctc ggccagcttg atggcgggga cgtgcgactg 1080cgtcagcggg aagtacggca tctcttccag ctgctcgaag gcagcgcgag ccagctcttt 1140gcggccgtag ccgacgttga cgcaccacag gccggacatg ccgtccaggt agcggttgcc 1200gtcgatgtcg gtgacccacg cgccttcggc cttggtgatg atcaggttgg tcggactcgg 1260agcggcaccg cgcatggcgt gccacaggta cttctcgtcg gttttcttca ggctctgggt 1320ctgctcggtg acctggacga tcatcagttc 13507235DNAArtificial Sequenceprimer used to isolate codon optimized synthetic cDNA of beta-alanine-pyruvate aminotransferase (BAPAT) of Bacillus cereus 72catctaggac tcagagctgg gccagacatt ccttc 357336DNAArtificial Sequenceprimer used to isolate codon optimized synthetic cdna of beta-alanine-pyruvate aminotransferase (bapat) of bacillus cereus 73gtccatcaac atggaactga tgatcgtcca ggtcac 3674704DNAAspergillus niger 74catgttgatg gactggaggg ggatgagtta tggatcagtg aaactgggag aaaacaaaga 60tggcaaaggg agaacatggc ccagatatag gaaaaaacgg aggaggcaaa aatgtaagcg 120ctccggactt gctgtttcgg tgtgcactag cagcagcggg ggggaaggtg gtgagtgttc 180accgaggacc caaaaagaat gagcggatgg cggatgagtg acggagaagg gaaggacggg 240gggggaatta gaggtggaga ggtccgatcc atcaaataga ccaggctcgg cacagccaag 300tttcccaaat gatcaactaa tcaatgggac ttggtgctaa atccggagat gccagatcat 360tgatagacag acaggatgga gtgatggcat atagacagga ggatggatgg atggatagat 420ggaggggtca agcacaacat ggtgggatga tggcggggtc atgactagca gctaagagga 480agaagaggag gatgaaatgg acagagaaag atgggagggg tgataaaatg agtatatggg 540acaagtcata cttacaggac cttgaagatg gtggttgtac tatctaagaa aggctttttt 600tgagagtact cttaacacaa gaggaggagg gaggaggggg aagtagtaga taaataataa 660acacgaccac agacttgcta caggctactt cttgtaagct cgag 7047533DNAArtificial Sequenceprimer used to isolate an A. niger eno1 promoter 75cgatcatcag ttccatgttg atggactgga ggg 337651DNAArtificial Sequenceprimer used to isolate an A. niger eno1 promoter 76gaactagtgg atcccccggg ctgcgttaac tcgagcttac aagaagtagc c 5177885DNAAspergillus nidulans 77tctgtacagt gaccggtgac tctttctggc atgcggagag acggacggac gcagagagaa 60gggctgagta ataagccact ggccagacag ctctggcggc tctgaggtgc agtggatgat 120tattaatccg ggaccggccg cccctccgcc ccgaagtgga aaggctggtg tgcccctcgt 180tgaccaagaa tctattgcat catcggagaa tatggagctt catcgaatca ccggcagtaa 240gcgaaggaga atgtgaagcc aggggtgtat agccgtcggc gaaatagcat gccattaacc 300taggtacaga agtccaattg cttccgatct ggtaaaagat tcacgagata gtaccttctc 360cgaagtaggt agagcgagta cccggcgcgt aagctcccta attggcccat ccggcatctg 420tagggcgtcc aaatatcgtg cctctcctgc tttgcccggt gtatgaaacc ggaaaggccg 480ctcaggagct ggccagcggc gcagaccggg aacacaagct ggcagtcgac ccatccggtg 540ctctgcactc gacctgctga ggtccctcag tccctggtag gcagctttgc cccgtctgtc 600cgcccggtgt gtcggcgggg ttgacaaggt cgttgcgtca gtccaacatt tgttgccata 660ttttcctgct ctccccacca gctgctcttt tcttttctct ttcttttccc atcttcagta 720tattcatctt cccatccaag aacctttatt tcccctaagt aagtactttg ctacatccat 780actccatcct tcccatccct tattcctttg aacctttcag ttcgagcttt cccacttcat 840cgcagcttga ctaacagcta ccccgcttga gcagacatca ccatg 8857850DNAArtificial Sequenceprimer used to isolate an A. nidulans gpdA promoter 78ccctcgaggt cgacggtatc gatagttaac tctgtacagt gaccggtgac 507933DNAArtificial Sequenceprimer used to isolate an A. nidulans gpdA promoter 79tgaccagcac gatcatggtg atgtctgctc aag 3380741DNAArtificial Sequencecodon optimized synthetic cDNA of E. coli HPDH 80atcgtgctgg tcacgggcgc gaccgccggt ttcggcgagt gcatcacccg ccgcttcatc 60cagcagggcc acaaggtgat cgctaccgga cgccgccaag agcgcctcca agagctgaag 120gatgagctgg gcgacaacct gtacattgcc cagctggacg tgcgcaaccg ggctgccatc 180gaagaaatgc tcgcctcgct gcccgccgag tggtgcaaca tcgacatcct ggtcaacaac 240gccggtctgg ccctcggcat ggaaccggcg cacaaggcca gcgtcgagga ctgggaaacc 300atgatcgaca ccaacaacaa gggactcgtc tacatgaccc gcgctgtgct gcccggcatg 360gtcgagcgca accacggcca catcatcaac atcggctcca ccgctggcag ctggccctac 420gctggcggca acgtctatgg cgcgaccaag gcgttcgtcc gccagttctc cctgaacctg 480cgcaccgacc tgcacggcac cgccgtccgc gtgaccgaca ttgagcccgg tctggtcggc 540ggcaccgagt tcagcaacgt ccgcttcaag ggcgacgacg gcaaggccga gaaaacctac 600cagaacaccg tcgctctgac ccctgaggat gtcagcgagg ccgtctggtg ggtcagcact 660ctgcccgcgc acgtcaacat caacaccctc gagatgatgc ccgtcacgca gtcctacgcc 720ggcctgaacg tccaccgcca a 7418133DNAArtificial Sequenceprimer used to isolate a codon optimized synthetic cDNA of E. coli HPDH 81agacatcacc atgatcgtgc tggtcacggg cgc 338233DNAArtificial Sequenceprimer used to isolate a codon optimized synthetic cDNA of E. coli HPDH 82gccatcggtc ctattggcgg tggacgttca ggc 3383473DNAAspergillus nidulans 83taggaccgat ggctgtgtag aagtactcgc cgatagtgga aaccgacgcc ccagcactcg 60tccgagggca aaggaataga gtagatgccg accgcgggat ccacttaacg ttactgaaat 120catcaaacag cttgacgaat ctggatataa gatcgttggt gtcgatgtca gctccggagt 180tgagacaaat ggtgttcagg atctcgataa gatacgttca tttgtccaag cagcaaagag 240tgccttctag tgatttaata gctccatgtc aacaagaata aaacgcgttt tcgggtttac 300ctcttccaga tacagctcat ctgcaatgca ttaatgcatt gactgcaacc tagtaacgcc 360ttcaggctcc ggcgaagaga agaatagctt agcagagcta ttttcatttt cgggagacga 420gatcaagcag atcaacggtc gtcaagagac ctacgagact gaggaatccg ctc 4738433DNAArtificial Sequenceprimer used to isolate the trpC terminator of A. nidulans 84cgtccaccgc caataggacc gatggctgtg tag 338545DNAArtificial Sequenceprimer used to isolate the trpC terminator of A. nidulans 85gaactagtgg atcccccggg ctgcagagcg gattcctcag tctcg 4586510DNAAspergillus nidulans 86ccctcgaggt cgacggtatc gatataggac cgatggctgt gtagaagtac tcgccgatag 60tggaaaccga cgccccagca ctcgtccgag ggcaaaggaa tagagtagat gccgaccgcg 120ggatccactt aacgttactg aaatcatcaa acagcttgac gaatctggat ataagatcgt 180tggtgtcgat gtcagctccg gagttgagac aaatggtgtt caggatctcg ataagatacg 240ttcatttgtc caagcagcaa agagtgcctt ctagtgattt aatagctcca tgtcaacaag 300aataaaacgc gttttcgggt ttacctcttc cagatacagc tcatctgcaa tgcattaatg 360cattgactgc aacctagtaa cgccttcagg ctccggcgaa gagaagaata gcttagcaga 420gctattttca ttttcgggag acgagatcaa gcagatcaac ggtcgtcaag agacctacga 480gactgaggaa tccgctctct gacagacggg 5108744DNAArtificial Sequenceprimer used to isolate a trpC terminator of A. nidulans 87ccctcgaggt cgacggtatc gatataggac cgatggctgt gtag 448833DNAArtificial Sequenceprimer used to isolate a trpC terminator of A. nidulans 88cccgtctgtc agagagcgga ttcctcagtc tcg 33892005DNAAspergillus oryzae 89tctgacagac gggcaattga ttacgggatc ccattggtaa cgaaatgtaa aagctaggag 60atcgtccgcc

gatgtcagga tgatttcact tgtttcttgt ccggctcacc ggtcaaagct 120aaagaggagc aaaaggaacg gatagaatcg ggtgccgctg atctatacgg tatagtgccc 180ttatcacgtt gactcaaccc atgctattta actcaacccc tccttctgaa ccccaccatc 240ttcttccttt tcctctcatc ccacacaatt ctctatctca gatttgaatt ccaaaagtcc 300tcggacgaaa ctgaacaagt cttcctccct tcgataaacc tttggtgatt ggaataactg 360accatcttct atagttccca aaccaaccga caatgtaaat acactcctcg attagccctc 420tagagggcat acgatggaag tcatggaata cttttggctg gactctcaca atgatcaagg 480tatcttaggt aacgtctttg gcgtgggccg gtgttcgttc ccagtcatcg atgcattcac 540atgccctccc taagctgggc cctagactct aggatcctag tctagaagga catggcatcg 600atggactggg ttcgttctga gattatacgg ctaaaacttg atctggataa taccagcgaa 660aagggtcatg ccttctctcg ttcttcctgt tgatggaatg gctaacagat gatagtcatt 720gcaacttgaa acatgtctcc tccagctgcc atctacgaac ccactgtggc cgctaccggc 780ctcaagggta aggtcgtggt ttctgagacc gtccccgttg agggagcttc tcagaccaag 840ctgttggacc atttcggtgg caagtgggac gagttcaagt tcgcccctat ccgcgaaagc 900caggtctctc gtgccatgac cagacgttac tttgaggacc tggacaagta cgctgaaagt 960gacgttgtca ttgttggtgc tggttcctgc ggtctgagca ctgcgtacgt cttggccaag 1020gctcgtccgg acctgaagat tgctatcgtc gaggccagcg tctctcctgg tcagtagtcc 1080atgatggatt gccttgcact cagctttccg gaactaacgt gcaataggtg gcggtgcctg 1140gttgggtggc caactctttt ctgctatggt catgcgccgt cccgcggaag tcttcctgaa 1200cgagctgggt gttccttacg aagaggacgc aaaccccaac tacgttgtcg tcaagcacgc 1260ctccctgttt acctcgacac tcatgtcgaa ggttctctcc ttccccaatg tcaagctctt 1320caatgctacc gctgttgagg acttgatcac ccgtccgacc gagaacggca acccccagat 1380tgctggtgtt gtcgtcaact ggacgctggt cacccttcac cacgatgatc actcctgcat 1440ggaccccaac actatcaacg ctcctgtcat catcagtacc actggtcacg atgggccatt 1500cggcgccttc tgtgcgaagc gcttggtgtc catgggcagc gtcgacaagc taggtggcat 1560gcgtggtctc gacatgaact cggccgagga tgccatcgtc aagaacaccc gcgaggttac 1620taagggcttg ataatcggcg gtatggagct gtctgaaatt gatggcttta accgcatggg 1680ccctaccttc ggtgccatgg ttctcagtgg tgtcaaggct gccgaggagg cattgaaggt 1740gttcgacgag cgtcagcgcg agtgtgctga gtaaatgact cactacccga atgggttcag 1800tgcatgaacc ggatttgtct tacggtcttt gacgataggg gaatgatgat tatgtgatag 1860ttctgagatt tgaatgaact cgttagctcg taatccacat gcatatgtaa atggctgtgt 1920cccgtatgta acggtggggc attctagaat aattatgtgt aacaagaaag acagtataat 1980acaaacaaag atgcaagagc ggctc 20059037DNAArtificial Sequenceprimer used to isolate the A. oryzae ptrA selection marker gene 90gaggaatccg ctctctgaca gacgggcaat tgattac 379133DNAArtificial Sequenceprimer used to isolate the A. oryzae ptrA selection marker gene 91gaatgttgct gaggagccgc tcttgcatct ttg 3392908DNAAspergillus pseudoterreus 92ctcagcaaca ttcgccatgt tcatgtacag ctttcaacgg cctcgaacag tcactgtgga 60tggataccag aggagagacc catcagttca atcgcagggc agatgagtgt cgcatacatt 120ctcgccgtcc agctggtcga ccagcaatgt cttttgtccc agttttctga gtttgatgac 180aacctggaga ggccagaagt ttgggatctg gccaggaagg ttacttcatc tcaaagcgaa 240gagtttgatc aagacggcaa ctgtctcagt gcgggtcgcg tgaggattga gttcaacgat 300ggttcttcta ttacggaaag tgtcgagaag cctcttggtg tcaaagagcc catgccaaac 360gaacggattc tccacaaata ccgaaccctt gctggtagcg tgacggacga atcccgggtg 420aaagagattg aggatcttgt cctcggcctg gacaggctca ccgacattag cccattgctg 480gagctgctga attgccccgt gaaatcgcca ctggtataaa tgggaagcga tatggaaaca 540tttcatgtca cgggcacaaa ttctaggtca tatcgtacct ggatggtgaa accaccagcg 600gtttagcaga tagaagatag actccttctg ctctgcgttg cgtcttgaat ttagttcgtt 660cactggctta agaacttaga atgcaataca gtctctctta tttcttatta aaatcacgta 720ttcccacatt cggcgactgg aggatacgaa agcagtgttg gtggtgctcc ccgtaatgga 780tatgattttg ctgactggac tattctatga ccattccctc caacggagat cctttctcga 840cactttagat gttgacgctg tctggaggaa ctacttttgc gctgcaaaga ctatgagcag 900tggagctg 9089335DNAArtificial Sequenceprimer used to isolate an A. pseudoterreus 3'-cad1 gene fragment 93gcaagagcgg ctcctcagca acattcgcca tgttc 359449DNAArtificial Sequenceprimer used to isolate an A. pseudoterreus 3'-cad1 gene fragment 94gaactagtgg atcccccggg ctgcacagct ccactgctca tagtctttg 49952099DNAArtificial Sequencecombination of SEQ ID NOS 77, 80, and 83 95tctgtacagt gaccggtgac tctttctggc atgcggagag acggacggac gcagagagaa 60gggctgagta ataagccact ggccagacag ctctggcggc tctgaggtgc agtggatgat 120tattaatccg ggaccggccg cccctccgcc ccgaagtgga aaggctggtg tgcccctcgt 180tgaccaagaa tctattgcat catcggagaa tatggagctt catcgaatca ccggcagtaa 240gcgaaggaga atgtgaagcc aggggtgtat agccgtcggc gaaatagcat gccattaacc 300taggtacaga agtccaattg cttccgatct ggtaaaagat tcacgagata gtaccttctc 360cgaagtaggt agagcgagta cccggcgcgt aagctcccta attggcccat ccggcatctg 420tagggcgtcc aaatatcgtg cctctcctgc tttgcccggt gtatgaaacc ggaaaggccg 480ctcaggagct ggccagcggc gcagaccggg aacacaagct ggcagtcgac ccatccggtg 540ctctgcactc gacctgctga ggtccctcag tccctggtag gcagctttgc cccgtctgtc 600cgcccggtgt gtcggcgggg ttgacaaggt cgttgcgtca gtccaacatt tgttgccata 660ttttcctgct ctccccacca gctgctcttt tcttttctct ttcttttccc atcttcagta 720tattcatctt cccatccaag aacctttatt tcccctaagt aagtactttg ctacatccat 780actccatcct tcccatccct tattcctttg aacctttcag ttcgagcttt cccacttcat 840cgcagcttga ctaacagcta ccccgcttga gcagacatca ccatgatcgt gctggtcacg 900ggcgcgaccg ccggtttcgg cgagtgcatc acccgccgct tcatccagca gggccacaag 960gtgatcgcta ccggacgccg ccaagagcgc ctccaagagc tgaaggatga gctgggcgac 1020aacctgtaca ttgcccagct ggacgtgcgc aaccgggctg ccatcgaaga aatgctcgcc 1080tcgctgcccg ccgagtggtg caacatcgac atcctggtca acaacgccgg tctggccctc 1140ggcatggaac cggcgcacaa ggccagcgtc gaggactggg aaaccatgat cgacaccaac 1200aacaagggac tcgtctacat gacccgcgct gtgctgcccg gcatggtcga gcgcaaccac 1260ggccacatca tcaacatcgg ctccaccgct ggcagctggc cctacgctgg cggcaacgtc 1320tatggcgcga ccaaggcgtt cgtccgccag ttctccctga acctgcgcac cgacctgcac 1380ggcaccgccg tccgcgtgac cgacattgag cccggtctgg tcggcggcac cgagttcagc 1440aacgtccgct tcaagggcga cgacggcaag gccgagaaaa cctaccagaa caccgtcgct 1500ctgacccctg aggatgtcag cgaggccgtc tggtgggtca gcactctgcc cgcgcacgtc 1560aacatcaaca ccctcgagat gatgcccgtc acgcagtcct acgccggcct gaacgtccac 1620cgccaatagg accgatggct gtgtagaagt actcgccgat agtggaaacc gacgccccag 1680cactcgtccg agggcaaagg aatagagtag atgccgaccg cgggatccac ttaacgttac 1740tgaaatcatc aaacagcttg acgaatctgg atataagatc gttggtgtcg atgtcagctc 1800cggagttgag acaaatggtg ttcaggatct cgataagata cgttcatttg tccaagcagc 1860aaagagtgcc ttctagtgat ttaatagctc catgtcaaca agaataaaac gcgttttcgg 1920gtttacctct tccagataca gctcatctgc aatgcattaa tgcattgact gcaacctagt 1980aacgccttca ggctccggcg aagagaagaa tagcttagca gagctatttt cattttcggg 2040agacgagatc aagcagatca acggtcgtca agagacctac gagactgagg aatccgctc 20999647DNAArtificial Sequenceprimer to isolate Fragments 7 to 9 96acaggctact tcttgtaagc tcgagtttct gtacagtgac cggtgac 47972913DNAArtificial Sequencecombination of SEQ ID NOS 89 and 92 97tctgacagac gggcaattga ttacgggatc ccattggtaa cgaaatgtaa aagctaggag 60atcgtccgcc gatgtcagga tgatttcact tgtttcttgt ccggctcacc ggtcaaagct 120aaagaggagc aaaaggaacg gatagaatcg ggtgccgctg atctatacgg tatagtgccc 180ttatcacgtt gactcaaccc atgctattta actcaacccc tccttctgaa ccccaccatc 240ttcttccttt tcctctcatc ccacacaatt ctctatctca gatttgaatt ccaaaagtcc 300tcggacgaaa ctgaacaagt cttcctccct tcgataaacc tttggtgatt ggaataactg 360accatcttct atagttccca aaccaaccga caatgtaaat acactcctcg attagccctc 420tagagggcat acgatggaag tcatggaata cttttggctg gactctcaca atgatcaagg 480tatcttaggt aacgtctttg gcgtgggccg gtgttcgttc ccagtcatcg atgcattcac 540atgccctccc taagctgggc cctagactct aggatcctag tctagaagga catggcatcg 600atggactggg ttcgttctga gattatacgg ctaaaacttg atctggataa taccagcgaa 660aagggtcatg ccttctctcg ttcttcctgt tgatggaatg gctaacagat gatagtcatt 720gcaacttgaa acatgtctcc tccagctgcc atctacgaac ccactgtggc cgctaccggc 780ctcaagggta aggtcgtggt ttctgagacc gtccccgttg agggagcttc tcagaccaag 840ctgttggacc atttcggtgg caagtgggac gagttcaagt tcgcccctat ccgcgaaagc 900caggtctctc gtgccatgac cagacgttac tttgaggacc tggacaagta cgctgaaagt 960gacgttgtca ttgttggtgc tggttcctgc ggtctgagca ctgcgtacgt cttggccaag 1020gctcgtccgg acctgaagat tgctatcgtc gaggccagcg tctctcctgg tcagtagtcc 1080atgatggatt gccttgcact cagctttccg gaactaacgt gcaataggtg gcggtgcctg 1140gttgggtggc caactctttt ctgctatggt catgcgccgt cccgcggaag tcttcctgaa 1200cgagctgggt gttccttacg aagaggacgc aaaccccaac tacgttgtcg tcaagcacgc 1260ctccctgttt acctcgacac tcatgtcgaa ggttctctcc ttccccaatg tcaagctctt 1320caatgctacc gctgttgagg acttgatcac ccgtccgacc gagaacggca acccccagat 1380tgctggtgtt gtcgtcaact ggacgctggt cacccttcac cacgatgatc actcctgcat 1440ggaccccaac actatcaacg ctcctgtcat catcagtacc actggtcacg atgggccatt 1500cggcgccttc tgtgcgaagc gcttggtgtc catgggcagc gtcgacaagc taggtggcat 1560gcgtggtctc gacatgaact cggccgagga tgccatcgtc aagaacaccc gcgaggttac 1620taagggcttg ataatcggcg gtatggagct gtctgaaatt gatggcttta accgcatggg 1680ccctaccttc ggtgccatgg ttctcagtgg tgtcaaggct gccgaggagg cattgaaggt 1740gttcgacgag cgtcagcgcg agtgtgctga gtaaatgact cactacccga atgggttcag 1800tgcatgaacc ggatttgtct tacggtcttt gacgataggg gaatgatgat tatgtgatag 1860ttctgagatt tgaatgaact cgttagctcg taatccacat gcatatgtaa atggctgtgt 1920cccgtatgta acggtggggc attctagaat aattatgtgt aacaagaaag acagtataat 1980acaaacaaag atgcaagagc ggctcctcag caacattcgc catgttcatg tacagctttc 2040aacggcctcg aacagtcact gtggatggat accagaggag agacccatca gttcaatcgc 2100agggcagatg agtgtcgcat acattctcgc cgtccagctg gtcgaccagc aatgtctttt 2160gtcccagttt tctgagtttg atgacaacct ggagaggcca gaagtttggg atctggccag 2220gaaggttact tcatctcaaa gcgaagagtt tgatcaagac ggcaactgtc tcagtgcggg 2280tcgcgtgagg attgagttca acgatggttc ttctattacg gaaagtgtcg agaagcctct 2340tggtgtcaaa gagcccatgc caaacgaacg gattctccac aaataccgaa cccttgctgg 2400tagcgtgacg gacgaatccc gggtgaaaga gattgaggat cttgtcctcg gcctggacag 2460gctcaccgac attagcccat tgctggagct gctgaattgc cccgtgaaat cgccactggt 2520ataaatggga agcgatatgg aaacatttca tgtcacgggc acaaattcta ggtcatatcg 2580tacctggatg gtgaaaccac cagcggttta gcagatagaa gatagactcc ttctgctctg 2640cgttgcgtct tgaatttagt tcgttcactg gcttaagaac ttagaatgca atacagtctc 2700tcttatttct tattaaaatc acgtattccc acattcggcg actggaggat acgaaagcag 2760tgttggtggt gctccccgta atggatatga ttttgctgac tggactattc tatgaccatt 2820ccctccaacg gagatccttt ctcgacactt tagatgttga cgctgtctgg aggaactact 2880tttgcgctgc aaagactatg agcagtggag ctg 29139849DNAArtificial Sequenceprimer used to isolate Fragments 11-12 98actaaaggga acaaaagctg gagctcagct ccactgctca tagtctttg 49

Claims

1. An isolated recombinant Aspergillus fungus comprising a genetic inactivation of an endogenous cis-aconitic acid decarboxylase (cadA) gene.

2. The isolated recombinant Aspergillus fungus of claim 1, wherein the Aspergillus fungus is Aspergillus pseudoterreus.

3. The isolated recombinant Aspergillus fungus of claim 1, wherein the Aspergillus fungus is Aspergillus terreus.

4. The isolated recombinant Aspergillus fungus of claim 1, wherein the endogenous cadA gene is genetically inactivated by complete or partial deletion mutation or by insertional mutation.

5. The isolated recombinant Aspergillus fungus of claim 1, wherein the cadA gene prior to its genetic inactivation encodes a protein having at least 80% sequence identity to SEQ ID NO: 50 or 52.

6. The isolated recombinant Aspergillus fungus of claim 1, wherein the cadA gene prior to its genetic inactivation comprises a coding sequence comprising at least 80% sequence identity to SEQ ID NO: 49, 51, 59 or 92.

7. A composition comprising the isolated recombinant Aspergillus fungus of claim 1.

8. A kit, comprising: the isolated recombinant Aspergillus fungus of claim 1; and a medium for culturing the fungus.

9. A method of making aconitic acid, comprising: culturing the isolated recombinant Aspergillus fungus of claim 1 under conditions that permit the fungus to make aconitic acid; thereby making aconitic acid.

10. The method of claim 9, wherein the fungus is cultured in Riscaldati medium.

11. The method of claim 9, further comprising isolating the aconitic acid from culture media or from the fungus.

12. The method of claim 9, wherein the aconitic acid is cis-aconitic acid.