U.S. patent application number 17/153067 was filed with the patent office on 2021-06-03 for agents useful in treating facioscapulohumeral muscular dystrophy.
The applicant listed for this patent is Universite de Mons. Invention is credited to Eugenie Ansseau, Alexandra Belayew, Frederique Coppee, Celine Vanderplanck, Stephen Donald Wilton.
Application Number | 20210163941 17/153067 |
Document ID | / |
Family ID | 1000005389346 |
Filed Date | 2021-06-03 |
United States Patent
Application |
20210163941 |
Kind Code |
A1 |
Belayew; Alexandra ; et
al. |
June 3, 2021 |
AGENTS USEFUL IN TREATING FACIOSCAPULOHUMERAL MUSCULAR
DYSTROPHY
Abstract
Antisense agents and RNA interference agents useful for treating
diseases and conditions the treatment of which can benefit from
reducing the expression of double homeobox 4 and/or double homeobox
4c, more particularly facioscapulohumeral muscular dystrophy.
Methods, uses and further products employing such agents are also
described.
Inventors: |
Belayew; Alexandra; (Tilff,
BE) ; Coppee; Frederique; (Havre, BE) ;
Vanderplanck; Celine; (Asquillies, BE) ; Wilton;
Stephen Donald; (Applecross, AU) ; Ansseau;
Eugenie; (Dour, BE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Universite de Mons |
Mons |
|
BE |
|
|
Family ID: |
1000005389346 |
Appl. No.: |
17/153067 |
Filed: |
January 20, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16562030 |
Sep 5, 2019 |
10907157 |
|
|
17153067 |
|
|
|
|
15873751 |
Jan 17, 2018 |
|
|
|
16562030 |
|
|
|
|
15047258 |
Feb 18, 2016 |
9988628 |
|
|
15873751 |
|
|
|
|
14078133 |
Nov 12, 2013 |
|
|
|
15047258 |
|
|
|
|
13225384 |
Sep 2, 2011 |
|
|
|
14078133 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/3513 20130101;
C12N 15/113 20130101; C12N 2310/315 20130101; C12N 2310/321
20130101; C12N 15/111 20130101; C12N 2310/11 20130101; C12N 2310/14
20130101; C12N 2310/531 20130101; C12N 2310/3233 20130101; C12N
2320/33 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 15/11 20060101 C12N015/11 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 2, 2010 |
EP |
10175125.3 |
Claims
1-26. (canceled)
27. A method for reducing DUX4 protein levels in a muscle cell of a
subject having facioscapulohumeral muscular dystrophy (FSHD), the
method comprising contacting the muscle cell with an
oligonucleotide compound in an amount effective to reduce DUX4
protein level in the muscle cell, wherein the reduction in DUX4
protein levels is detectable at 3 days following contacting the
muscle cell with the oligonucleotide compound, wherein the
oligonucleotide compound comprises an antisense strand of 18-35
nucleotides in length that is complementary to at least 15
contiguous nucleotides of a DUX4 gene sequence as set forth in SEQ
ID NO: 71, and wherein the subject has 1-10 copies of D4Z4
repeats.
28. The method of claim 27, wherein the antisense strand is 20-30
nucleotides in length.
29. The method of claim 27, wherein the antisense strand is
complementary to a sequence that is required for splicing.
30. The method of claim 29, wherein the sequence required for
splicing is selected from the group consisting of splice donor
sites, splice acceptor sites, pyrimidine-rich or polypyrimidine
tracts upstream of splice acceptor sites, exon-intron boundaries,
intron-exon boundaries, branch sites and exonic splicing enhancer
elements.
31. The method of claim 27, wherein the antisense strand is
complementary to the 3' untranslated region of the DUX4 gene.
32. The method of claim 27, wherein the antisense strand is
complementary to a sequence that comprises a polyadenylation
signal.
33. The method of claim 27, wherein the oligonucleotide compound
comprises one or more modified nucleosides.
34. The method of claim 33, wherein the one or more modified
nucleoside are selected from nucleosides with 2'-O-methylated
sugar, 2'-O-ethylated sugar, 2'-O-methoxyethylated sugar,
2'-O,4'-C-methylene-linked sugar, and 2'-O,4'C-ethylene-linked
sugar.
35. The method of claim 27, wherein the oligonucleotide compound
comprises one or more modified internucleotide linkages.
36. The method of claim 35, wherein the modified internucleotide
linkage is a phosphorothioate linkage.
37. The method of claim 27, wherein the oligonucleotide compound
comprises one or more phosphorodiamidate morpholinos.
38. The method of claim 27, wherein the oligonucleotide compound is
a phosphorodiamidate morpholino oligomer (PMO).
39. The method of claim 27, wherein the oligonucleotide compound
further comprises a sense strand that is annealed to the antisense
strand to form a double stranded RNAi agent.
40. The method of claim 27, wherein the oligonucleotide compound
further comprises a moiety that enhances the cellular uptake of the
oligonucleotide compound.
41. The method of claim 40, wherein the moiety is conjugated via a
linker.
42. The method of claim 40, wherein the moiety enhances uptake of
the oligonucleotide compound into muscle cells.
43. The method of claim 40, wherein the moiety is a
cell-penetrating peptide.
44. The method of claim 27, wherein the subject is human.
45. The method of claim 27, wherein the muscle cell is in a primary
myotube.
46. The method of claim 27, wherein the antisense compound does not
reduce DUX4c level in the muscle cell.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/873,751, filed Jan. 17, 2018, which is a
continuation of U.S. patent application Ser. No. 15/047,258 (now
U.S. Pat. No. 9,988,628), filed Feb. 18, 2016, which is a
continuation of U.S. patent application Ser. No. 14/078,133
(abandoned), filed Nov. 12, 2013, which is a divisional of U.S.
application Ser. No. 13/225,384 (abandoned) filed Sep. 2, 2011,
which claims priority to European Patent Application No.
10175125.3, entitled "Agents useful in treating facioscapulohumeral
muscular dystrophy," filed on Sep. 2, 2010; which applications are
each incorporated herein by reference in their entireties.
REFERENCE TO SEQUENCE LISTING
[0002] The material in the ASCII text filed submitted herewith, is
incorporated herein by reference. The ACSII text file is named
"SequenceListing.txt", created Sep. 5, 2019 and is 63 KB in
size.
FIELD OF THE INVENTION63
[0003] The invention generally relates to diseases and conditions
the treatment of which can benefit from reducing the expression of
double homeobox 4 and/or double homeobox 4c. Such diseases and
conditions include inter alia those comprising increased levels
and/or increased activity of double homeobox 4 and/or double
homeobox 4c, and more particularly include facioscapulohumeral
muscular dystrophy. Such diseases and conditions also include those
comprising expression of a fusion protein between DUX4 or DUX4c and
another, unrelated protein, more particularly wherein the disease
or condition is a tumour, even more particularly a sarcoma such as
Ewing's family tumours, paediatric undifferentiated soft tissue
sarcomas and rhabdomyosarcomas. The invention concerns agents, more
specifically antisense agents and RNA interference agents, capable
of reducing or abolishing the expression of double homeobox 4
and/or double homeobox 4c, and elaborates methods, uses and further
aspects employing such agents.
BACKGROUND OF THE INVENTION
[0004] Facioscapulohumeral muscular dystrophy (FSHD, FSHMD or FSH)
also known as Landouzy-Dejerine muscular dystrophy is an autosomal
dominant muscle disorder affecting about 1/20,000 births. It is
characterised by progressive weakness and atrophy of the muscles
from the face, the upper-arms and shoulder girdle to the lower
limbs.
[0005] FSHD is genetically linked to contractions of the D4Z4
repeat array on the 4q35 subtelomeric region. Non-affected
individuals typically have between 11-100 copies of the 3.3-kb D4Z4
element, while FSHD patients only have 1-10 copies. A typical
feature associated with the genetic defect is a decrease in DNA
methylation of the contracted D4Z4 array as compared to
non-affected individuals (van Overveld et al. 2005 (Ann Neurol. 58:
569-76.)). Whereas a small group of patients with a typical FSHD
phenotype does present more than 10 copies of the D4Z4 element,
their DNA methylation level is low, similarly to that found in
contracted D4Z4 arrays. DNA hypomethylation is typically associated
with an open chromatin structure suitable for transcription (de
Greef et al. 2009 (Hum Mutat. 30: 1449-59)).
[0006] Gabriels et al. 1999 (Gene 236(1): 25-32) identified the
double homeobox 4 (DUX4) gene within each D4Z4 element repeated in
the array. The DUX4 sequence was later corrected as published by
Kowaljow et al. 2007 (Neuromuscul Disord 17: 611-23) and is
available under the NCBI Genbank accession number: AF117653.2.
Subsequent studies showed that the encoded DUX4 protein was
expressed in primary myoblasts and biopsies of patients with FSHD
but not in non-affected individuals, and that the DUX4 protein is a
transcription factor targeting a large set of genes including inter
alia genes encoding further transcription factors, and that DUX4
gene activation at the FSHD locus initiates a transcription cascade
leading to muscle atrophy, inflammation, decreased differentiation
potential and oxidative stress, recapitulating the key features of
FSHD (Bosnakowski et al. 2008 (EMBO J 27(20): 2766-79); Kowaljow et
al. 2007 (Neuromuscul Disord 17: 611-23); Dixit et al. 2007 (Proc
Natl Acad Sci USA 104: 18157-18162)). Double homeobox 4 is thus
considered a major contributor to the pathology of FSHD
muscles.
[0007] Dixit et al. 2007 (supra) also demonstrated in myoblast
cultures that whereas transcription can initiate at any D4Z4
element within the repeat array, a prevalent stable DUX4 mRNA
originates from the most distal D4Z4 unit and extends into the pLAM
region which flanks the telomeric side of the D4Z4 array, whereby
the pLAM region provides the DUX4 transcript with an intron and a
polyadenylation signal (FIGS. 1 and 2). However, also additional
transcripts were identified that span several D4Z4 units, may have
various parts spliced out, and may also comprise the pLAM region
(Snider et al. 2009. Hum Mol Genet 18: 2414-30; Coppee et al.,
unpublished, see FIGS. 26-28). Moreover, polymorphisms have been
found in the pLAM region such as the presence or absence of a 1.6
kb sequence within its intron (Gabriels et al. 1999, supra; van
Deutekom et al. 2009. Hum Mutat 30: 1449-59).
[0008] Lemmers et al. 2010 (Science, August 19) propose a unifying
genetic model for FSHD.
[0009] Furthermore, the homologous DUX4c gene was identified 42kb
centromeric of the D4Z4 array, within a truncated and inverted
solitary D4Z4 unit. The DUX4c gene encodes a 47-kDa protein with a
double homeodomain identical to DUX4 but divergent in the
carboxyl-terminal region. The DUX4c protein is expressed at low
levels in control muscles, it is induced in muscles of patients
affected with Duchenne muscular dystrophy and is present at similar
or yet higher levels in FSHD muscles. Additional experiments
suggested that DUX4c could be involved in myoblast proliferation
during muscle regeneration and that changes in its expression could
contribute to the FSHD pathology (Ansseau et al. 2009 (PLoS One
4(10): e7482).
[0010] In certain tumour types a fusion gene is seen that includes
the 3' region of the DUX4 gene as a result of chromosome
rearrangements. Fusion between CIC, a human homolog of Drosophila
capicua, and DUX4 was seen in Ewing's family tumours (EFTs)
(Kawamura-Saito et al. 2006. Hum Mol Genet 15: 2125-2137) and
paediatric undifferentiated soft tissue sarcomas (USTS) (Yoshimoto
et al. 2009. Cancer Genet Cytogenet 195: 1-11), and
rhabdomyosarcomas (RMS) showed fusion between the EWSR1 gene and
DUX4. (Sirvent et al. 2009. Caner Genet Cytogenet 195: 12-08). As a
consequence of fusion with the C-terminal fragment of DUX4 the
resulting fusion proteins acquire an enhanced transcriptional
activity, which leads to tumour formation.
SUMMARY OF THE INVENTION
[0011] The inventors postulate that down-regulating the expression
of double homeobox 4 and/or double homeobox 4c can counteract the
pathological effects thereof and allows muscle regeneration to
occur in FSHD patients. The inventors further postulate that
down-regulating the expression of double homeobox 4 and/or double
homeobox 4c can counteract the enhanced transcriptional activity of
DUX4-containing fusion proteins that is seen in certain tumours,
particularly in certain types of sarcomas, and thereby have a
therapeutic benefit, e.g., slow down formation and/or progression,
of such tumours.
[0012] Having conducted extensive tests the inventors realised that
antisense agents targeting sequence elements involved in splicing
of DUX4 or DUX4c transcripts can reduce or abolish the production
of the respective proteins. This finding is unexpected, since
antisense agents targeting sequence elements required for splicing
were previously contemplated for therapeutic exon skipping to at
least partly restore the functionality of defective proteins, such
as for example to remove nonsense mutations or restore the reading
frame disrupted by genomic deletions or duplications in the
dystrophin gene in Duchenne muscular dystrophy (DMD) (Wilton et al.
2007 (Mol Ther 15(7): 1288-96); Adams et al. 2007 (BMC Mol Biol 8:
57)). Moreover, the introns of the DUX4 transcript are located in
its 3' untranslated region (3' UTR), which is unusual, and
interference with splicing would therefore not be expected to alter
the DUX4 coding sequence or the production of the DUX4 protein.
[0013] The inventors also realised that antisense agents targeting
sequence elements involved in polyadenylation of DUX4 or DUX4c
transcripts can reduce or abolish the production of the respective
proteins.
[0014] In an aspect the invention thus generally provides an
antisense agent capable of reducing or abolishing the production of
DUX4 or DUX4c proteins. An antisense agent as intended herein may
be capable of binding to (annealing with) DUX4 or DUX4c genes. In
particular, such antisense agent may be capable of binding to
(annealing with) a sequence region in DUX4 or DUX4c (pre-mRNA)
sequence.
[0015] Double homeobox 4 emerges as particularly implicated in the
aetiology of facioscapulohumeral muscular dystrophy (FSHD). Hence,
preferably disclosed herein are: an antisense agent capable of
reducing or abolishing the production of DUX4 protein; an antisense
agent capable of binding to DUX4 gene; an antisense agent capable
of binding to a sequence region in DUX4 (pre-mRNA) sequence.
[0016] Also preferably disclosed herein are: an antisense agent
capable of reducing or abolishing the production of DUX4 protein
but not of DUX4c protein; an antisense agent capable of binding to
DUX4 gene but not to DUX4c gene; an antisense agent capable of
binding to a sequence region in DUX4 (pre-mRNA) sequence but not to
a sequence region in DUX4c (pre-mRNA) sequence.
[0017] In an alternative, disclosed herein are: an antisense agent
capable of reducing or abolishing the production of DUX4c protein
but not of DUX4 protein; an antisense agent capable of binding to
DUX4c gene but not to DUX4 gene; an antisense agent capable of
binding to a sequence region in DUX4c (pre-mRNA) sequence but not
to a sequence region in DUX4 (pre-mRNA) sequence.
[0018] In a preferred aspect the invention provides an antisense
agent capable of binding to a sequence element required for
splicing of the double homeobox 4 (DUX4) or double homeobox 4c
(DUX4c) genes (as explained elsewhere in this specification, a
mention of splicing or splicing of a gene generally refers to
splicing of a gene's pre-mRNA to remove intervening sequence(s)).
The antisense agent can reduce or abolish the production of the
respective DUX4 or DUX4c proteins. For example and without being
bound by any theory, such antisense agents might interfere with
splicing of the DUX4 or DUX4c genes (pre-mRNA) or might act through
another mechanism.
[0019] Double homeobox 4 emerges as particularly implicated in the
aetiology of facioscapulohumeral muscular dystrophy (FSHD). Hence,
preferably disclosed herein is an antisense agent capable of
binding to a sequence element required for splicing of the double
homeobox 4 (DUX4) gene. The antisense agent can reduce or abolish
the production of DUX4 protein.
[0020] Also preferably disclosed herein is an antisense agent
capable of binding to a sequence element required for splicing of
the DUX4 gene but not of the DUX4c gene. The antisense agent can
reduce or abolish the production of DUX4 protein but does not
reduce or abolish the production of DUX4c protein. In an
alternative, disclosed is an antisense agent capable of binding to
a sequence element required for splicing of the DUX4c gene but not
of the DUX4 gene. The antisense agent can reduce or abolish the
production of DUX4c protein but does not reduce or abolish the
production of DUX4 protein.
[0021] Sequence elements required for splicing of the DUX4 or DUX4c
genes as intended herein particularly denote cis sequence elements,
i.e., those located within said DUX4 or DUX4c genes,
respectively.
[0022] Sequence elements to be targeted by (i.e., selected to be
bound by) antisense agents as disclosed herein may be preferably
chosen from the group comprising or consisting of splice donor
sites (i.e., 5' splice sites), splice acceptor sites (i.e., 3'
splice sites), pyrimidine-rich or polypyrimidine tracts upstream of
(i.e., 5' relative to) splice acceptor sites, exon-intron
boundaries, intron-exon boundaries, branch sites and exonic
splicing enhancer elements of the DUX4 or DUX4c genes. Splice donor
sites and splice acceptor sites, exon-intron boundaries and
intron-exon boundaries may be readily accessible for targeting and
may thus constitute preferred sequence elements as intended herein.
Further, particularly effective antisense agents as disclosed
herein include those capable of binding to splice acceptor sites or
intron-exon boundaries of the DUX4 or DUX4c genes.
[0023] Antisense agents as disclosed herein may preferably bind to
a whole sequence element required for splicing DUX4 or DUX4c (i.e.,
may wholly overlap with or wholly anneal to such sequence element).
Alternatively, antisense agents as disclosed herein may bind to one
or more portions of a sequence element required for splicing DUX4
or DUX4c (e.g., may partly overlap with or partly anneal to such
sequence element).
[0024] Reference to "binding to a sequence element required for
splicing" also encompasses antisense agents that bind at a position
sufficiently close to said element. For example, the antisense
agents may bind at a position sufficiently close to said element to
disrupt the binding and function of splicing machinery that would
normally mediate a particular splicing reaction occurring at that
element (e.g., such agents may bind to pre-mRNA at a position
within about 3, about 6, or about 9 bases of said element).
[0025] In another preferred aspect the invention provides an
antisense agent capable of binding to a sequence element required
for polyadenylation of DUX4 or DUX4c genes (as explained elsewhere
in this specification, a mention of polyadenylation or
polyadenylation of a gene generally refers to polyadenylation of a
gene's pre-mRNA). The antisense agent can reduce or abolish the
production of the DUX4 or DUX4c proteins. For example and without
being bound by any theory, such antisense agents might interfere
with polyadenylation of the DUX4 or DUX4c genes (pre-mRNA) or might
act through another mechanism.
[0026] Double homeobox 4 emerges as particularly implicated in the
aetiology of FSHD. Preferably disclosed herein is thus an antisense
agent capable of binding to a sequence element required for
polyadenylation of the DUX4 gene. The antisense agent can reduce or
abolish the production of DUX4 protein.
[0027] Also preferably disclosed herein is an antisense agent
capable of binding to a sequence element required for
polyadenylation of the DUX4 gene but not of the DUX4c gene. The
antisense agent can reduce or abolish the production of DUX4
protein but does not reduce or abolish the production of DUX4c
protein. In an alternative, disclosed is an antisense agent capable
of binding to a sequence element required for polyadenylation of
the DUX4c gene but not of the DUX4 gene. The antisense agent can
reduce or abolish the production of DUX4c protein but does not
reduce or abolish the production of DUX4 protein.
[0028] Also preferably disclosed herein is an antisense agent
capable of binding to a sequence element required for
polyadenylation of the DUX4 gene but not capable of binding to the
DUX4c gene. The antisense agent can reduce or abolish the
production of DUX4 protein but does not reduce or abolish the
production of DUX4c protein. In an alternative, disclosed is an
antisense agent capable of binding to a sequence element required
for polyadenylation of the DUX4c gene but not capable of binding to
the DUX4 gene. The antisense agent can reduce or abolish the
production of DUX4c protein but does not reduce or abolish the
production of DUX4 protein.
[0029] Sequence elements required for polyadenylation of the DUX4
or DUX4c genes as intended herein particularly denote cis sequence
elements, i.e., those located within said DUX4 or DUX4c genes,
respectively.
[0030] Sequence elements to be targeted by (i.e., selected to be
bound by) antisense agents capable of binding to a sequence element
required for polyadenylation of the DUX4 or DUX4c genes may be
preferably polyadenylation signals (such as more preferably the
polyadenylation signal ATTAAA) of the DUX4 or DUX4c genes.
[0031] Antisense agents capable of binding to a sequence element
required for polyadenylation of the DUX4 or DUX4c genes may
preferably bind to a whole sequence element required for
polyadenylation of DUX4 or DUX4c (i.e., may wholly overlap with or
wholly anneal to such sequence element). Alternatively, antisense
agents capable of binding to a sequence element required for
polyadenylation of the DUX4 or DUX4c genes may bind to one or more
portions of a sequence element required for polyadenylation of DUX4
or DUX4c (e.g., may partly overlap with or partly anneal to such
sequence element).
[0032] Reference to "binding to a sequence element required for
polyadenylation" also encompasses antisense agents that bind at a
position sufficiently close to said element (e.g., such agents may
bind to pre-mRNA at a position within about 3, about 6, or about 9
bases of said element).
[0033] Antisense agents as intended herein preferably comprise or
denote antisense molecules such as more preferably antisense
nucleic acid molecules or antisense nucleic acid analogue
molecules. Preferably, antisense agents may refer to antisense
oligonucleotides or antisense oligonucleotide analogues. By means
of an example and not limitation, such antisense agents or
molecules may be between about 10 and about 100 nucleotides or
nucleotide analogues in length, preferably between about 12 and
about 80 nucleotides or nucleotide analogues in length, also
preferably between about 15 and about 50 nucleotides or nucleotide
analogues in length, more preferably between about 20 and about 40
(such as, e.g., between about 20 and about 30) nucleotides or
nucleotide analogues in length.
[0034] Preferably disclosed herein are antisense agents including
antisense nucleic acid analogue molecules, such as, e.g., antisense
oligonucleotide analogues, more preferably antisense
oligonucleotide analogues comprising a 2'-O-methylated
phosphorothioate backbone or more preferably antisense
oligonucleotide analogues comprising a phosphorodiamidate
morpholino backbone as schematically illustrated in FIGS. 24 and
25, respectively. Splice-switching phosphorodiamidate morpholino
oligomers have been successfully employed to restore dystrophin
expression in DMD, thereby validating this oligonucleotide
chemistry (Kinali et al. 2009 (Lancet Neurol 8: 918-28)).
[0035] Advantageously, an antisense agent as disclosed herein may
be conjugated to a cell penetrating peptide (CPP) to enhance the
cellular uptake of said antisense agents.
[0036] Further by means of an example and not limitation, such
antisense agents or molecules may be configured to bind to (anneal
with) a sequence region, more particularly a region in DUX4 or
DUX4c (pre-mRNA) sequence, wherein said region is at least about 10
nucleotides in length, preferably at least about 12 nucleotides in
length, also preferably at least about 15 nucleotides in length,
more preferably at least about 20 nucleotides in length, even more
preferably at least about 25 or at least about 30 nucleotides in
length, such as for example between about 10 and about 100
nucleotides in length, preferably between about 12 and about 80
nucleotides in length, also preferably between about 15 and about
50 nucleotides in length, and more preferably between about 20 and
about 40 (such as, e.g., between about 20 and about 30) nucleotides
in length, wherein the reference to nucleotides may preferably
denote consecutive nucleotides.
[0037] A DUX4 gene preferably intended for targeting by the
antisense agents as disclosed herein resides in the distal-most
D4Z4 unit which extends into the pLAM region flanking the telomeric
side of the D4Z4 array. Such DUX4 gene leads to production of
comparably stable mRNA(s) (Dixit et al. 2007, supra). As
schematically illustrated in FIG. 2 with reference to an exemplary
but non-limiting genomic sequence as shown in FIG. 3, such DUX4
gene comprises two introns which are located in its 3' UTR, namely
intron 1 (or intron A) within the D4Z4 unit and intron 2 (or intron
B) provided by the pLAM region. Such DUX4 gene further comprises a
polyadenylation signal ATTAAA located within the pLAM region.
[0038] A DUX4 gene as intended herein may also denote a DUX4
transcription units that span several D4Z4 units, may display
alternative splicing, and may comprise the pLAM region, in
particular as disclosed by Snider et al. 2009, supra. As
schematically illustrated in FIGS. 26 and 28, such DUX4 transcripts
may comprise intron 1, intron ibis or intron 2a within the D4Z4
unit, intron 2 provided by the pLAM region or intron 2a bis
provided by the D4Z4 unit and the pLAM region. Such DUX4 transcript
further comprises a polyadenylation signal ATTAAA located within
the pLAM region.
[0039] Hence, sequence elements to be targeted by anti-DUX4
antisense agents as disclosed herein, particularly sequence
elements required for splicing of the DUX4 gene to be targeted by
anti-DUX4 antisense agents capable of binding to such elements,
preferably include those sequence elements (such as, e.g., splice
donor sites, splice acceptor sites, exon-intron boundaries,
intron-exon boundaries, pyrimidine-rich or polypyrimidine tracts,
branch sites and/or exonic splicing enhancer elements) required for
removal of said DUX4 intron 1, intron 1 bis, intron 2, intron 2a or
intron 2a bis (preferably of intron 1 or 2) upon splicing of a DUX4
gene. Preferably, the targeted DUX4 sequence elements may be chosen
from the group comprising or consisting of splice donor sites of
said DUX4 intron 1, intron 1 bis, intron 2, intron 2a or intron 2a
bis (preferably of intron 1 or 2) and splice acceptor sites of said
DUX4 intron 1, intron 1 bis, intron 2, intron 2a or intron 2a bis
(preferably of intron 1 or 2); more preferably from the group
comprising or consisting of splice acceptor sites of said DUX4
intron 1, intron 1 bis, intron 2, intron 2a or intron 2a bis
(preferably of intron 1 or 2); even more preferably may be the
splice acceptor site of said DUX4 intron 2.
[0040] Sequence elements to be targeted by anti-DUX4 antisense
agents as disclosed herein, particularly sequence elements required
for polyadenylation of the DUX4 gene and to be targeted by
anti-DUX4 antisense agents capable of binding to such elements,
preferably include the polyadenylation signal ATTAAA.
[0041] As shown in an exemplary but non-limiting genomic sequence
of the DUX4c gene (Genbank accession no. AY500824, sequence version
1, i.e., AY500824.1), the ORF encoding the DUX4c protein is found
at positions 918-2042 of AY500824.1 and is not disrupted by
introns. However, a larger exemplary but non-limiting genomic
sequence of the DUX4c gene (Genbank accession no. NC_000004,
sequence version 11, i.e., NC_000004.11, range 190940254..190945505
complement) indicates that the DUX4c ORF may be included within a
larger DUX4c transcript containing six putative exons (denoted as
exons 1 to 6) at respectively positions 1-65, 617-741, 966-1160,
1385-2945, 4034-4154 and 4911-5251 of NC_000004.11 (range
190940254..190945505, complement) (wherein putative exon 4 contains
the DUX4c ORF) and corresponding five putative introns (denoted
introns 1 to 5) at positions 66-616, 742-965, 1161-1384, 2946-4033
and 4155-4910 of NC_000004.11 (range 190940254..190945505,
complement).
[0042] Hence, sequence elements to be targeted by anti-DUX4c
antisense agents as disclosed herein, particularly sequence
elements required for splicing of the DUX4c gene to be targeted by
anti-DUX4c antisense agents capable of binding to such elements,
preferably include those sequence elements (such as, e.g., splice
donor sites, splice acceptor sites, exon-intron boundaries,
intron-exon boundaries, pyrimidine-rich or polypyrimidine tracts,
branch sites and/or exonic splicing enhancer elements) required for
removal of said DUX4c introns, e.g., DUX4c introns 1, 2, 3, 4 or 5
upon splicing of such DUX4c gene. Preferably, the targeted DUX4c
sequence elements may be chosen from the group comprising or
consisting of splice donor sites of said DUX4c introns 1, 2, 3, 4
or 5 and splice acceptor sites of said DUX4c introns 1, 2, 3, 4 or
5; more preferably from the group comprising or consisting of
splice acceptor sites of said DUX4c introns 1, 2, 3, 4 or 5.
[0043] Without limitation, where a targeted sequence element is a
splice donor site in DUX4 or DUX4c genes, an antisense agent as
disclosed herein may be configured to bind to a region in DUX4 or
DUX4c sequence corresponding to positions about +30 to about -30,
preferably about +25 to about -25, more preferably about +20 to
about -20 relative to the respective exon-intron boundary (i.e.,
position +1 denoting the last base of the preceding exon and
position -1 denoting the first base of the following intron). In
particular, an antisense agent may be configured to bind to (anneal
with) at least about 10 bases, preferably at least about 15 bases,
more preferably at least about 20 bases, even more preferably at
least about 25 bases or at least about 30 bases, such as to between
about 10 and about 40 bases or to between about 20 and about 30
bases in any one of the above recited regions in DUX4 or DUX4c
sequence, wherein said reference to bases may preferably denote
consecutive bases. Preferably, such binding (annealing) will
involve at least positions -1 or -2 (more preferably both positions
-1 and -2) and/or positions +1 or +2 (more preferably both
positions +1 and +2) relative to the respective exon-intron
boundary. For example, such binding (annealing) may involve at
least positions +1 to -1 or +1 to -2 or +2 to -1 or +2 to -2. These
positions denote bases which adjoin the respective exon-intron
boundary and which are particularly relevant for splicing. Hence,
and without limitation, an antisense agent may be configured to
bind to any one of the above recited regions in DUX4 or DUX4c
sequence such that it anneals over (i.e., spans or crosses) the
respective exon-intron boundary and base pairs with at least 1
base, preferably at least 2 bases, more preferably at least 5 bases
and even more preferably at least 7 or at least 10 bases on each
side of said exon-intron boundary, such as with between 1 and about
20 bases, preferably between 2 and about 15 bases or between 2 and
about 10 bases on each side of said exon-intron boundary.
[0044] Without limitation, where a targeted sequence element is a
splice acceptor site in DUX4 or DUX4c genes, an antisense agent as
disclosed herein may be configured to bind to a region in DUX4 or
DUX4c sequence corresponding to positions about -30 to about +30,
preferably about -25 to about +25, more preferably about -20 to
about +20 relative to the respective intron-exon boundary (i.e.,
position -1 denoting the last base of the preceding intron and
position +1 denoting the first base of the following exon). In
particular, an antisense agent may be configured to bind to (anneal
with) at least about 10 bases, preferably at least about 15 bases,
more preferably at least about 20 bases, even more preferably at
least about 25 bases or at least about 30 bases, such as to between
about 10 and about 40 bases or to between about 20 and about 30
bases in any one of the above recited regions in DUX4 or DUX4c
sequence, wherein said reference to bases may preferably denote
consecutive bases. Preferably, such binding (annealing) will
involve at least positions -1 or -2 (more preferably both positions
-1 and -2) and/or positions +1 or +2 (more preferably both
positions +1 and +2) relative to the respective intron-exon
boundary. For example, such binding (annealing) may involve at
least positions -1 to +1 or -1 to +2 or -2 to +1 or -2 to +2. These
positions denote bases which adjoin the respective intron-exon
boundary and which are particularly relevant for splicing. Hence,
and without limitation, an antisense agent may be configured to
bind to any one of the above recited regions in DUX4 or DUX4c
sequence such that it anneals over (i.e., spans or crosses) the
respective intron-exon boundary and base pairs with at least 1
base, preferably at least 2 bases, more preferably at least 5 bases
and even more preferably at least 7 or at least 10 bases on each
side of said intron-exon boundary, such as with between 1 and about
20 bases, preferably between 2 and about 15 bases or between 2 and
about 10 bases on each side of said intron-exon boundary.
[0045] In an example, an anti-DUX4 antisense agent may be
configured to bind to (anneal with) at least about 10 bases,
preferably at least about 15 bases, more preferably at least about
20 bases, even more preferably at least about 25 bases or at least
about 30 bases, such as to between about 10 and about 40 bases or
to between about 20 and about 30 bases, preferably wherein said
reference to bases denotes consecutive bases, of any one of the
following DUX4 sequences (SEQ ID NO: 2 to 9) or of variants thereof
having at least about 80% and preferably at least about 90% or at
least about 95% sequence identity to the respective sequences:
[0046] ggctctgctggaggagcntaggacgcggg|gttgggacggggtcgggtggttcggggcag
(SEQ ID NO: 2; positions +30 to -30 of an exemplary DUX4 exon
1-intron 1 boundary; the intron sequence is in italics);
[0047] gaggagctttaggacgcggg|gttgggacggggtcgggtgg (SEQ ID NO: 3;
positions +20 to -20 of an exemplary DUX4 exon 1-intron 1 boundary;
the intron sequence is in italics);
[0048]
gctgaccggcctgggattcctgccttctag|gtctaggcccggtgagagactccacaccgc (SEQ
ID NO: 4; positions -30 to +30 of an exemplary DUX4 intron 1-exon 2
boundary; the intron sequence is in italics);
[0049] ctgggattcctgccttctag|gtctaggcccggtgagagac (SEQ ID NO: 5;
positions -20 to +20 of an exemplary DUX4 intron 1-exon 2 boundary;
the intron sequence is in italics);
[0050]
ggcatcccggggatcccagagccggcccag|gtacctgcgcacgcgcgggtttgcgggcag (SEQ
ID NO: 6; positions +30 to -30 of an exemplary DUX4 exon 2-intron 2
boundary; the intron sequence is in italics);
[0051] ggatcccagagccggcccag|gtacctgcgcacgcgcgggt (SEQ ID NO: 7;
positions +20 to -20 of an exemplary DUX4 exon 2-intron 2 boundary;
the intron sequence is in italics);
[0052]
tctgtctgtctttgcccgcttcctggctag|acctgcgcgcagtgcgcaccccggctgacg (SEQ
ID NO: 8; positions -30 to +30 of an exemplary DUX4 intron 2-exon 3
boundary; the intron sequence is in italics).
[0053] tttgcccgcttcctggctag|acctgcgcgcagtgcgcacc (SEQ ID NO: 9;
positions -20 to +20 of an exemplary DUX4 intron 2-exon 3 boundary;
the intron sequence is in italics).
[0054] Preferably, the anti-DUX4 antisense agent is capable of
annealing over (i.e., span or cross) the respective exon-intron or
intron-exon boundaries found in SEQ ID NO: 2 to 9 or in the
variants thereof (indicated by the "|" symbol above). Also
preferably, the anti-DUX4 antisense agent is capable of annealing
with at least one and preferably both of the two intronic bases
(indicated above in bold italics) adjacent to the respective
exon-intron or intron-exon boundaries and/or (preferably "and")
with at least one and preferably both of the two exonic bases
(underlined above) adjacent to the respective exon-intron or
intron-exon boundaries.
[0055] In non-limiting embodiments, an effective anti-DUX4
antisense agent may be configured to bind to (anneal with) any one
of the following DUX4 sequences (SEQ ID NO: 10 to 15, 66) or to
variants thereof having at least about 80% and preferably at least
about 90% or at least about 95% sequence identity to the respective
sequences, or to fragments thereof comprising at least 10 bases, or
at least 12 bases, preferably at least about 15 bases, more
preferably at least about 20 bases, even more preferably at least
about 25 bases, preferably wherein said reference to bases denotes
consecutive bases, of the respective sequences or variants. More
specifically, such an anti-DUX4 antisense agent may comprise,
consist essentially of or consist of a sequence (e.g., a nucleic
acid sequence or nucleic acid analogue sequence) complementary to
any one of said DUX4 sequences SEQ ID NO: 10 to 15, 66 or to
variants thereof having at least about 80% and preferably at least
about 90% or at least about 95% sequence identity to the respective
sequences, or to fragments thereof comprising at least 10 bases, or
at least 12 bases, preferably at least about 15 bases, more
preferably at least about 20 bases, even more preferably at least
about 25 bases, preferably wherein said reference to bases denotes
consecutive bases, of the respective sequences or variants:
[0056] cttctaggtctaggcccggtgagag (SEQ ID NO: 10; positions -7 to
+18 of an exemplary DUX4 intron 1-exon 2 boundary; positions
12241-12265 of Genbank sequence AF117653.2 (see FIG. 3); the intron
sequence is in italics);
[0057] tggctagacctgcgcgcagtgcgca (SEQ ID NO: 11; positions -7 to
+18 of an exemplary DUX4 intron 2-exon 3 boundary; positions
12678-12702 of AF117653.2; the intron sequence is in italics);
[0058] cttcctggctagacctgcgcgcagt (SEQ ID NO: 12; positions -12 to
+13 of an exemplary DUX4 intron 2-exon 3 boundary; positions
12673-12697 of AF117653.2; the intron sequence is in italics);
[0059] agacctgcgcgcagtgcgcaccccg (SEQ ID NO: 13; positions -2 to
+23 of an exemplary DUX4 intron 2-exon 3 boundary; positions
12685-12703 of AF117653.2; the intron sequence is in italics);
[0060] cttcctggctagacctgcgcgcagtgcgca (SEQ ID NO: 14; positions -12
to +18 of an exemplary DUX4 intron 2-exon 3 boundary; positions
12673-12702 of AF117653.2; the intron sequence is in italics);
[0061] gcccgcttcctggctagacctgcgcgcagt (SEQ ID NO: 15; positions -17
to +13 of an exemplary DUX4 intron 2-exon 3 boundary; positions
12668-12697 of AF117653.2; the intron sequence is in italics).
[0062] acgcggggttgggacggggtcgggt (SEQ ID NO: 66; positions +7 to
-18 of an exemplary DUX4 exon 1-intron 1 boundary; positions
12105-12129 of AF117653.2; the intron sequence is in italics).
[0063] For example, disclosed herein are anti-DUX4 antisense agents
comprising, consisting essentially of or consisting of any one of
sequences (e.g., nucleic acid sequences or nucleic acid analogue
sequences) SEQ ID NO: 16 to 21, 64 or variants thereof having at
least about 80% and preferably at least about 90% or at least about
95% sequence identity to the respective sequences, or fragments
thereof comprising at least 10 bases, or at least 12 bases,
preferably at least about 15 bases, more preferably at least about
20 bases, even more preferably at least about 25 bases, preferably
wherein said reference to bases denotes consecutive bases, of the
respective sequences or variants:
TABLE-US-00001 (SEQ ID NO: 16) CUCUCACCGGGCCUAGACCUAGAAG; (SEQ ID
NO: 17) UGCGCACUGCGCGCAGGUCUAGCCA; (SEQ ID NO: 18)
ACUGCGCGCAGGUCUAGCCAGGAAG; (SEQ ID NO: 19)
CGGGGUGCGCACUGCGCGCAGGUCU; (SEQ ID NO: 20)
UGCGCACUGCGCGCAGGUCUAGCCAGGAAG; (SEQ ID NO: 21)
ACUGCGCGCAGGUCUAGCCAGGAAGCGGGC; (SEQ ID NO: 64)
ACCCGACCCCGUCCCAACCCCGCGU;
[0064] wherein U denotes uracil (which may be optionally replaced
by thymine, T). In particular, the anti-DUX4 antisense agents
comprising, consisting essentially of or consisting of any one of
sequences SEQ ID NO: 16 to 21, 64 or the variants or fragments
thereof display complementarity to, and are hence configured to
bind to (anneal with), the above DUX4 sequences SEQ ID NO: 10 to
15, 66 or the variants or fragments thereof.
[0065] In an example, an anti-DUX4c antisense agent may be
configured to bind to (anneal with) at least about 10 bases,
preferably at least about 15 bases, more preferably at least about
20 bases, even more preferably at least about 25 bases or at least
about 30 bases, such as to between about 10 and about 40 bases or
to between about 20 and about 30 bases, preferably wherein said
reference to bases denotes consecutive bases, of any one of the
following DUX4c sequences (SEQ ID NO: 22 to 41) or of variants
thereof having at least about 80% and preferably at least about 90%
or at least about 95% sequence identity to the respective
sequences:
[0066]
acctccccacagcccacagctcttgtcata|gtgcgggaatagtgttctatcactacagga (SEQ
ID NO: 22; positions +30 to -30 of an exemplary putative DUX4c exon
1-intron 1 boundary; positions 36-95 of Genbank sequence
NC_000004.11 range 190940254..190945505, complement; the intron
sequence is in italics);
[0067] agcccacagctcttgtcata|gtgcgggaatagtgttctat (SEQ ID NO: 23;
positions +20 to -20 of said exemplary DUX4c exon 1-intron 1
boundary; the intron sequence is in italics);
[0068]
gcagagaggaaagcggtcttccgcctccag|ggccagcgggacctcgcactccgggaaaac (SEQ
ID NO: 24; positions -30 to +30 of an exemplary putative DUX4c
intron 1-exon 2 boundary; positions 587-646 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0069] aagcggtatccgcctccag|ggccagcgggacctcgcact (SEQ ID NO: 25;
positions -20 to +20 of said exemplary DUX4c intron 1-exon 2
boundary; the intron sequence is in italics);
[0070]
gctcaccagccctccggatcgccggcccgg|gtcacttcatcccggagcaattcggacgaa (SEQ
ID NO: 26; positions +30 to -30 of an exemplary putative DUX4c exon
2-intron 2 boundary; positions 712-771 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0071] cctccggatcgccggcccgg|gtcacttcatcccggagcaa (SEQ ID NO: 27;
positions +20 to -20 of said exemplary DUX4c exon 2-intron 2
boundary; the intron sequence is in italics);
[0072] cgggttccacgctccttcgccctctgcaag|ggacctgttgctcgcgtgtctcccgcccc
(SEQ ID NO: 28; positions -30 to +30 of an exemplary putative DUX4c
intron 2-exon 3 boundary; positions 936-995 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0073] gctcatcgccctctgcaag|gggacctgttgctcgcgtgt (SEQ ID NO: 29;
positions -20 to +20 of said exemplary DUX4c intron 2-exon 3
boundary; the intron sequence is in italics);
[0074]
ttgcaggaaacaggaatccgtggtcaggcc|gtgatgcacccgacgtttcttttctctgca (SEQ
ID NO: 30; positions +30 to -30 of an exemplary putative DUX4c exon
3-intron 3 boundary; positions 1131-1190 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0075] caggaatccgtggtcaggcc|gtgatgcacccgacgtttct (SEQ ID NO: 31;
positions +20 to -20 of said exemplary DUX4c exon 3-intron 3
boundary; the intron sequence is in italics);
[0076]
agtcaagacagcggcttccagtttccatag|aattactggagaacctcagagagccagccc (SEQ
ID NO: 32; positions -30 to +30 of an exemplary putative DUX4c
intron 3-exon 4 boundary; positions 1355-1414 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0077] gcggatccagtttccatag|aattactggagaacctcaga (SEQ ID NO: 33;
positions -20 to +20 of said exemplary DUX4c intron 3-exon 4
boundary; the intron sequence is in italics);
[0078]
gaagaacaccgggctctgctggaggagcag|gttggagcggggttggggcggggtgggggc (SEQ
ID NO: 34; positions +30 to -30 of an exemplary putative DUX4c exon
4-intron 4 boundary; positions 2916-2975 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0079] gggctctgctggaggagcag|gttggagcggggttggggcg (SEQ ID NO: 35;
positions +20 to -20 of said exemplary DUX4c exon 4-intron 4
boundary; the intron sequence is in italics);
[0080]
ctggattccacgtttctttgccctctgcag|aggtgcctgttgctcaagtctctgcccccg (SEQ
ID NO: 36; positions -30 to +30 of an exemplary putative DUX4c
intron 4-exon 5 boundary; positions 3404-4063 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0081] cgtttctttgccctctgcag|agtgcctgttgctcaagtc (SEQ ID NO: 37;
positions -20 to +20 of said exemplary DUX4c intron 4-exon 5
boundary; the intron sequence is in italics);
[0082]
ttccaggaatgcgtggaacaccagcatcgt|gtcggtgctctcctttccagtttcaaacag (SEQ
ID NO: 38; positions +30 to -30 of an exemplary putative DUX4c exon
5-intron 5 boundary; positions 4125-4184 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0083] gcgtggaacaccagcatcgt|gtcggtgctctcctttccag (SEQ ID NO: 39;
positions +20 to -20 of said exemplary DUX4c exon 5-intron 5
boundary; the intron sequence is in italics);
[0084]
ctgtcctcttggtgctgtgggtcctgaaag|ttgtcgagtgcgcccgtccctgtggtggga (SEQ
ID NO: 40; positions -30 to +30 of an exemplary putative DUX4c
intron 5-exon 6 boundary; positions 4881-4940 of NC_000004.11 range
190940254..190945505, complement; the intron sequence is in
italics);
[0085] ggtgctgtgggtcctgaaag|ttgtcgagtgcgcccgtccc (SEQ ID NO: 41;
positions -20 to +20 of said exemplary DUX4c intron 5-exon 6
boundary; the intron sequence is in italics).
[0086] Preferably, the anti-DUX4c antisense agent is capable of
annealing over (i.e., span or cross) the respective exon-intron or
intron-exon boundaries found in SEQ ID NO: 22 to 41 or in the
variants thereof (indicated by the "|" symbol above). Also
preferably, the anti-DUX4c antisense agent is capable of annealing
with at least one and preferably both of the two intronic bases
(indicated above in bold italics) adjacent to the respective
exon-intron or intron-exon boundaries and/or (preferably "and")
with at least one and preferably both of the two exonic bases
(underlined above) adjacent to the respective exon-intron or
intron-exon boundaries.
[0087] Without limitation, where a targeted sequence element is a
polyadenylation signal in the DUX4 or DUX4c gene, such as
preferably the polyadenylation signal ATTAAA, an antisense agent as
disclosed herein may be configured to bind to a region in DUX4 or
DUX4c sequence corresponding to positions about -30 to about +30,
preferably about -25 to about +25, more preferably about -20 to
about +20 relative to said polyadenylation signal (i.e., position
-1 denoting the last base preceding the polyadenylation signal and
position +1 denoting the first base following the polyadenylation
signal). In particular, such antisense agent may be configured to
bind to (anneal with) at least about 10 bases, preferably at least
about 15 bases, more preferably at least about 20 bases, even more
preferably at least about 25 bases or at least about 30 bases, such
as to between about 10 and about 40 bases or to between about 20
and about 30 bases in any one of the above recited regions in the
DUX4 or DUX4c sequence, wherein said reference to bases may
preferably denote consecutive bases. Preferably, the antisense
agent may be configured to bind such that it anneals with at least
a portion of (e.g., .gtoreq.1, .gtoreq.2, .gtoreq.3, .gtoreq.4,
.gtoreq.5 or .gtoreq.6 nucleotides) the polyadenylation signal or
with the entire polyadenylation signal. For example but without
limitation, such antisense agent may be configured to anneal over
(i.e., to span or cross) the polyadenylation signal and to base
pair with at least 1 base, preferably at least 2 bases, more
preferably at least 5 bases and even more preferably at least 7 or
at least 10 bases on each side of said polyadenylation signal, such
as with between 1 and about 20 bases, preferably between 2 and
about 15 bases or between 2 and about 10 bases on each side of said
polyadenylation signal.
[0088] In an example, an anti-DUX4 antisense agent may be
configured to bind to (anneal with) at least about 10 bases,
preferably at least about 15 bases, more preferably at least about
20 bases, even more preferably at least about 25 bases or at least
about 30 bases, such as to between about 10 and about 40 bases or
to between about 20 and about 30 bases, preferably wherein said
reference to bases denotes consecutive bases, of the following DUX4
sequences (SEQ ID NO: 67 or 68) or of variants thereof having at
least about 80% and preferably at least about 90% or at least about
95% sequence identity to the respective sequences:
[0089]
acatctcctggatgattagncagagatatattaaaatgccccctccctgtggatcctatagaaga
(SEQ ID NO: 67; positions -30 to +30 of an exemplary DUX4
polyadenylation signal; the polyadenylation signal is in
italics);
[0090] gatgattagttcagagatatattaaaatgccccctccctgtggatc (SEQ ID NO:
68; positions -20 to +20 of an exemplary DUX4 polyadenylation
signal; the polyadenylation signal is in italics);
[0091] Preferably, the anti-DUX4 antisense agent may be capable of
annealing over (i.e., span or cross) the polyadenylation signal
ATTAAA found in SEQ ID NO: 67 or 68 or in the variants thereof.
[0092] In non-limiting embodiments, an effective anti-DUX4
antisense agent may be configured to bind to (anneal with) the
following DUX4 sequence (SEQ ID NO: 69) or to variants thereof
having at least about 80% and preferably at least about 90% or at
least about 95% sequence identity to said sequence, or to fragments
thereof comprising at least 10 bases, or at least 12 bases,
preferably at least about 15 bases, more preferably at least about
20 bases, even more preferably at least about 25 bases, preferably
wherein said reference to bases denotes consecutive bases, of said
sequence or variants. More specifically, such an anti-DUX4
antisense agent may comprise, consist essentially of or consist of
a sequence (e.g., a nucleic acid sequence or nucleic acid analogue
sequence) complementary to said DUX4 sequences SEQ ID NO: 69 or to
variants thereof having at least about 80% and preferably at least
about 90% or at least about 95% sequence identity to said sequence,
or to fragments thereof comprising at least 10 bases, or at least
12 bases, preferably at least about 15 bases, more preferably at
least about 20 bases, even more preferably at least about 25 bases,
preferably wherein said reference to bases denotes consecutive
bases, of the respective sequences or variants:
[0093] agttcagagatatattaaaatgccc (SEQ ID NO: 69; positions -13 to
+6 of an exemplary DUX4 polyadenylation signal; positions
12839-12863 of Genbank sequence AF117653.2 (see FIG. 3); the
polyadenylation signal is in italics);
[0094] For example, disclosed herein is an anti-DUX4 antisense
agents comprising, consisting essentially of or consisting of
sequence (e.g., nucleic acid sequences or nucleic acid analogue
sequences) SEQ ID NO: 65 or variants thereof having at least about
80% and preferably at least about 90% or at least about 95%
sequence identity to said sequence, or fragments thereof comprising
at least 10 bases, or at least 12 bases, preferably at least about
15 bases, more preferably at least about 20 bases, even more
preferably at least about 25 bases, preferably wherein said
reference to bases denotes consecutive bases, of said sequence or
variants:
TABLE-US-00002 (SEQ ID NO: 65) GGGCAUUUUAAUAUAUCUCUGAACU
[0095] wherein U denotes uracil (which may be optionally replaced
by thymine, T). In particular, the anti-DUX4 antisense agents
comprising, consisting essentially of or consisting of any one of
sequence SEQ ID NO: 65 or the variants or fragments thereof display
complementarity to, and are hence configured to bind to (anneal
with), the above DUX4 sequences SEQ ID NO: 69 or the variants or
fragments thereof.
[0096] In a further aspect the invention provides an RNA
interference (RNAi) agent capable of reducing or abolishing the
production of DUX4 and/or DUX4c proteins.
[0097] In particular, the RNAi agent may be configured to target
DUX4 and/or DUX4c messenger RNA (mRNA), respectively. Whereas the
RNAi agent may be configured to target any part of DUX4 and/or
DUX4c mRNA, such as for example the 5'-untranslated region (5'
UTR), ORF or 3' UTR thereof, the RNAi agent may be preferably
configured to target the 3' UTR of DUX4 and/or DUX4c mRNA. The
inventors realised that targeting the 3'UTR of DUX4 and/or DUX4c
mRNA allows for particularly effective RNAi-mediated downregulation
of the production of DUX4 and/or DUX4c proteins. Moreover,
targeting the 3'UTR of DUX4 or DUX4c mRNA allows for RNAi agents
which are highly specific for either DUX4 or DUX4c mRNA, presumably
but without limitation due to sequence differences in the distinct
3' UTRs.
[0098] DUX4 emerges as particularly implicated in the aetiology of
FSHD. Hence, preferably disclosed herein is an RNAi agent capable
of reducing or abolishing the production of DUX4 protein. Such RNAi
agent is configured to target DUX4 mRNA.
[0099] Also preferably disclosed herein is an RNAi agent capable of
reducing or abolishing the production of DUX4 protein but not of
the DUX4c protein. Such RNAi agent is configured to target DUX4
mRNA but not DUX4c mRNA. In an alternative, disclosed is an RNAi
agent capable of reducing or abolishing the production of DUX4c
protein but not of the DUX4 protein. Such RNAi agent is configured
to target DUX4c mRNA but not DUX4 mRNA.
[0100] RNAi agents as intended herein may particularly comprise or
denote (i.e., may be selected from a group comprising or consisting
of) RNAi nucleic acid molecules or RNAi nucleic acid analogue
molecules, such as preferably short interfering nucleic acids and
short interfering nucleic acid analogues (siNA) such as short
interfering RNA and short interfering RNA analogues (siRNA), and
may further denote inter alia double-stranded RNA and
double-stranded RNA analogues (dsRNA), micro-RNA and micro-RNA
analogues (miRNA), and short hairpin RNA and short hairpin RNA
analogues (shRNA).
[0101] Advantageously, an RNAi agent as disclosed herein may be
conjugated to a cell penetrating peptide (CPP), to enhance the
cellular uptake of said RNAi agents.
[0102] An RNAi agent typically includes a double stranded portion
(notwithstanding the optional and potentially preferred presence of
any single-stranded overhands) comprising at least 16 bases,
preferably at least 17 bases, more preferably at least 18 bases and
still more preferably at least 19 bases, and usually between 18 and
35 bases, preferably between 19 and 30 bases, more preferably
between 20 and 25 bases and even more preferably between 21 and 23
bases which are identical or almost identical to (e.g., showing 90%
or more, e.g., at least 95%, sequence identity to, or showing
maximum 2 and preferably only 1 mismatch with) an mRNA whose
silencing is desired and which is thus targeted by said RNAi agent
(such as, e.g., DUX4 and/or DUX4c mRNAs).
[0103] A DUX4 gene preferably intended for targeting by the RNAi
agents as disclosed herein resides in the distal-most D4Z4 unit
which extends into the pLAM region flanking the telomeric side of
the D4Z4 array. Such DUX4 gene leads to production of comparably
stable mRNA(s) (Dixit et al. 2007, supra). As schematically
illustrated in FIG. 2 with reference to an exemplary but
non-limiting genomic sequence as shown in FIG. 3, such DUX4 gene
comprises two introns which are located in its 3' UTR, namely
intron 1 (or intron A) within the D4Z4 unit and intron 2 (or intron
B) provided by the pLAM region. Alternative splicing of intron 1 as
schematically captured in FIG. 2 leads to alternative DUX4
mRNAs.
[0104] Exemplary but non-limiting DUX4 cDNA sequences including or
not intron 1 are shown in FIGS. 4 (SEQ ID NO: 42) and 5 (SEQ ID NO:
43), respectively.
[0105] Accordingly, in an embodiment anti-DUX4 RNAi agents as
intended herein may be configured to target DUX4 mRNA as
represented by the DUX4 cDNA sequence set forth in SEQ ID NO: 42 or
variants thereof having at least about 80% and preferably at least
about 90% or at least about 95% sequence identity to SEQ ID NO: 42.
Preferably, such anti-DUX4 RNAi agents may be configured to target
the 3' UTR of said DUX4 mRNA or variants, such as for example to
target 3' UTR sequences corresponding to or overlapping with exon
1, intron 1, exon 2 and/or exon 3.
[0106] In another embodiment anti-DUX4 RNAi agents as intended
herein may be configured to target DUX4 mRNA as represented by the
DUX4 cDNA sequence set forth in SEQ ID NO: 43 or variants thereof
having at least about 80% and preferably at least about 90% or at
least about 95% sequence identity to SEQ ID NO: 43. Preferably,
such anti-DUX4 RNAi agents may be configured to target the 3' UTR
of said DUX4 mRNA or variants, such as for example to target 3' UTR
sequences corresponding to or overlapping with exon 1, exon 2
and/or exon 3.
[0107] In an example, an anti-DUX4 RNAi agent may be configured to
target any one of the following DUX4 mRNA sequences (SEQ ID NO: 44
to 46) or variants thereof having at least about 80% and preferably
at least about 90% or at least about 95% sequence identity to the
respective sequences, or fragments thereof comprising at least 16
bases, preferably at least 17 bases, more preferably at least 18
bases and still more preferably at least 19 bases, and usually
between 18 and 35 bases, preferably between 19 and 30 bases, more
preferably between 20 and 25 bases and even more preferably between
21 and 23 bases, preferably wherein said reference to bases denotes
consecutive bases, of the respective sequences or variants:
TABLE-US-00003 (SEQ ID NO: 44) CGCGGGGAACACCUGGCUGGCUACGGAGGGGCGUG
(SEQ ID NO: 45) GCCUUCUAGGUCUAGGCCCGGUGAGAGACUCCACA (SEQ ID NO: 46)
UAGGCAAACCUGGAUUAGAGUUACAUCUCCUGGAU
[0108] wherein U denotes uracil (which may be optionally replaced
by thymine, T).
[0109] In exemplary but non-limiting embodiments, an anti-DUX4 RNAi
agent as disclosed herein may comprise any one of the following
sequences (SEQ ID NO: 47 to 49) or variants thereof having at least
about 80% and preferably at least about 90% or at least about 95%
sequence identity to (e.g., variants showing maximum 2 and
preferably only 1 mismatch with) the respective sequences, or
fragments thereof comprising at least 16 bases, preferably at least
17 bases and more preferably at least 18 bases, preferably wherein
said reference to bases denotes consecutive bases, of the
respective sequences or variants:
TABLE-US-00004 (SEQ ID NO: 47) acaccuggcuggcuacgga; (SEQ ID NO: 48)
ggucuaggcccggugagag; (SEQ ID NO: 49) ccuggauuagaguuacauc.
[0110] wherein U denotes uracil (which may be optionally replaced
by thymine, T).
[0111] Exemplary but non-limiting DUX4c cDNA sequences are shown in
FIGS. 6 (SEQ ID NO: 50) and 7 (SEQ ID NO: 51), including 3' UTR
regions of distinct lengths.
[0112] Accordingly, in an embodiment anti-DUX4c RNAi agents as
intended herein may be configured to target DUX4c mRNA as
represented by the DUX4c cDNA sequence set forth in SEQ ID NO: 50
or variants thereof having at least about 80% and preferably at
least about 90% or at least about 95% sequence identity to SEQ ID
NO: 50. Preferably, such anti-DUX4c RNAi agents may be configured
to target the 3' UTR of said DUX4c mRNA or variants.
[0113] In another embodiment anti-DUX4c RNAi agents as intended
herein may be configured to target DUX4c mRNA as represented by the
DUX4c cDNA sequence set forth in SEQ ID NO: 51 or variants thereof
having at least about 80% and preferably at least about 90% or at
least about 95% sequence identity to SEQ ID NO: 51. Preferably,
such anti-DUX4c RNAi agents may be configured to target the 3' UTR
of said DUX4c mRNA or variants.
[0114] As noted above, a further exemplary but non-limiting genomic
sequence of the DUX4c gene (Genbank accession no. NC_000004 range
190940254..190945505, complement, sequence version 11, i.e.,
NC_000004.11 range 190940254..190945505, complement) predicts a
longer DUX4c mRNA than those shown in FIGS. 6 and 7. In particular,
such further exemplary but non-limiting DUX4c cDNA sequence is
available in the Genbank database under accession no. XR_041199
(sequences version 2, i.e., XR_041199.2) and reproduced in FIG. 8
(SEQ ID NO: 52).
[0115] Hence, in an embodiment anti-DUX4c RNAi agents as intended
herein may be configured to target DUX4c mRNA as represented by the
DUX4c cDNA sequence set forth in SEQ ID NO: 52 or variants thereof
having at least about 80% and preferably at least about 90% or at
least about 95% sequence identity to SEQ ID NO: 52. Preferably,
such anti-DUX4c RNAi agents may be configured to target the 3' UTR
of said DUX4c mRNA or variants.
[0116] In an example, an anti-DUX4c RNAi agent may be configured to
target any one of the following DUX4c mRNA sequences (SEQ ID NO: 53
to 55) or variants thereof having at least about 80% and preferably
at least about 90% or at least about 95% sequence identity to the
respective sequences, or fragments thereof comprising at least 16
bases, preferably at least 17 bases, more preferably at least 18
bases and still more preferably at least 19 bases, and usually
between 18 and 35 bases, preferably between 19 and 30 bases, more
preferably between 20 and 25 bases and even more preferably between
21 and 23 bases, preferably wherein said reference to bases denotes
consecutive bases, of the respective sequences or variants:
TABLE-US-00005 (SEQ ID NO: 53) uguagacaccagaguuucagcaaaaggcacgaccu
(SEQ ID NO: 54) cacacagaggagggcugucauucuuuccugagcau (SEQ ID NO: 55)
uuuccccagcguucuucagucgaguuggcggagac
[0117] wherein U denotes uracil (which may be optionally replaced
by thymine, T).
[0118] In exemplary but non-limiting embodiments, an anti-DUX4c
RNAi agent as disclosed herein may comprise any one of the
following sequences (SEQ ID NO: 56 to 58) or variants thereof
having at least about 80% and preferably at least about 90% or at
least about 95% sequence identity to (e.g., variants showing
maximum 2 and preferably only 1 mismatch with) the respective
sequences, or fragments thereof comprising at least 16 bases,
preferably at least 17 bases and more preferably at least 18 bases,
preferably wherein said reference to bases denotes consecutive
bases, of the respective sequences or variants:
TABLE-US-00006 (SEQ ID NO: 56) ccagaguuucagcaaaagg; (SEQ ID NO: 57)
ggagggcugucauucuuuc; (SEQ ID NO: 58) gcguucuucagucgaguug;
[0119] wherein U denotes uracil (which may be optionally replaced
by thymine, T).
[0120] Also disclosed herein is a method for producing any one
anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent as taught
herein, particularly wherein said agent comprises, consists
essentially of or consists of a nucleic acid molecule or a nucleic
acid analogue molecule, comprising synthesising said agent from its
constituent nucleotides or nucleotide analogues, and optionally and
preferably at least partly purifying the agent from the synthesis
reaction.
[0121] Further disclosed herein is a nucleic acid, more
specifically an isolated nucleic acid, encoding any one or more
anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent as taught
herein. Preferably, the nucleic acid may be operably linked to one
or more regulatory sequences allowing for expression of the nucleic
acid in an expression system, such as without limitation in vitro
(e.g., in a cell-free expression system) or in a host cell or host
organism.
[0122] As well disclosed is a recombinant nucleic acid construct
(i.e., a vector) comprising a nucleic acid encoding any one or more
anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent as taught
herein. Such construct (vector) may allow inter alia to propagate
the nucleic acid encoding said agent, e.g., in vitro or in a host
cell or host organism. Also contemplated is a method for producing
said recombinant nucleic acid construct (vector) comprising
introducing the nucleic acid encoding said agent to a recipient
nucleic acid construct (recipient vector).
[0123] Preferably, the recombinant nucleic acid construct may be an
expression construct (i.e., an expression vector), hence may be
capable of expressing (configured to express) the nucleic acid
encoding the one or more anti-DUX4 and/or anti-DUX4c antisense
agent or RNAi agent in an expression system, such as without
limitation in vitro (e.g., in a cell-free expression system) or in
a host cell or host organism. In an expression construct
(expression vector), the nucleic acid encoding said agent is
operably linked to one or more regulatory sequences allowing for
expression of the nucleic acid in said expression system. Also
contemplated is thus a method for producing said expression
construct (expression vector) comprising introducing the nucleic
acid encoding said agent to a recipient expression construct
(recipient expression vector).
[0124] Also disclosed is thus a method for producing any one or
more anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent as
taught herein comprising expressing said agent from an expression
construct (expression vector) as taught herein comprising a nucleic
acid encoding said agent, in an expression system, and optionally
at least partly purifying the agent.
[0125] Disclosed herein is as well a host cell comprising any one
or more anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent,
or an isolated nucleic acid encoding such an agent, or a
recombinant construct (vector) (preferably an expression construct,
expression vector) comprising a nucleic acid encoding such an
agent, as taught herein. Also encompassed is a method for producing
such a host cell comprising introducing into a recipient host cell
the anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent, or
the isolated nucleic acid encoding such an agent, or the
recombinant construct (vector) (preferably an expression construct,
expression vector) comprising a nucleic acid encoding such an
agent. Preferably, the host cell may be a prokaryotic or eukaryotic
cell, more preferably a bacterial, fungal, plant or animal cell,
even more preferably a mammal cell or a primate cell, including
very preferably human cells, as well as non-human mammal cells and
non-human primate cells. For example, said human host cell may be a
myoblast or a myoblast precursor derived from a patient, such as
for example a myoblast derived from a muscle biopsy of said patient
or derived from a mesangioblast of said patient, or said myoblast
or myoblast precursor may be differentiated from an adult stem cell
or an induced pluripotent stem (iPS) cell of said patient. The
isolated nucleic acid or construct (vector) may be integrated,
preferably stably integrated, into the genome of the host cell or
may remain extra-genomic or extra-chromosomal. Insofar the host
cell comprises said agent, isolated nucleic acid or construct
(vector), it may be denoted a `transgenic` or `transformed` cell in
that regard. Preferably, a host cell expresses or is under suitable
conditions capable of expressing the isolated nucleic acid or
vector comprised therein, thereby producing the anti-DUX4 and/or
anti-DUX4c antisense agent or RNAi agent encoded thereby. Also
contemplated is thus a method for producing any one or more
anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent as taught
herein comprising culturing or maintaining a host cell comprising
an isolated nucleic acid encoding said agent or an expression
construct (expression vector) comprising a nucleic acid encoding
said agent, under conditions conducive to expression of said agent
from said isolated nucleic acid or expression construct. The
so-produced agent may be intended to exert its silencing effect in
the host cell expressing it, or may by intended for use elsewhere
in which case the method may further optionally and preferably
comprise at least partly purifying the agent.
[0126] Disclosed herein is as well a host organism comprising any
one or more anti-DUX4 and/or anti-DUX4c antisense agent or RNAi
agent, or an isolated nucleic acid encoding such an agent, or a
recombinant construct (vector) (preferably an expression construct,
expression vector) comprising a nucleic acid encoding such an
agent, or a host cell, as taught herein. Also encompassed is a
method for producing such a host organism comprising introducing
the anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent, or
the isolated nucleic acid encoding such an agent, or the
recombinant construct (vector) (preferably an expression construct,
expression vector) comprising a nucleic acid encoding such an
agent, into a recipient host organism, e.g., to a cell, tissue or
organ of said host organism, or introducing the host cell as taught
herein to a recipient host organism, or at least partly
regenerating an organism from said host cell. Preferably, the host
organism may be a multi-cellular organism, more preferably a plant
or animal organism, even more preferably a mammal or primate,
particularly including non-human mammals and non-human primates.
The isolated nucleic acid or construct (vector) may be integrated,
preferably stably integrated, into the genome of the host organism
or may remain extra-genomic or extra-chromosomal. Insofar the host
organism comprises said agent, isolated nucleic acid or construct
(vector), it may be denoted a `transgenic` or `transformed`
organism in that regard. Preferably, a host organism expresses or
is under suitable conditions capable of expressing the isolated
nucleic acid or vector comprised therein, thereby producing the
anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent encoded
thereby. Also contemplated is thus a method for producing any one
or more anti-DUX4 and/or anti-DUX4c antisense agent or RNAi agent
as taught herein comprising culturing or maintaining a host
organism comprising an isolated nucleic acid encoding said agent or
an expression construct (expression vector) comprising a nucleic
acid encoding said agent, under conditions conducive to expression
of said agent from said isolated nucleic acid or expression
construct. The so-produced agent may be intended to exert its
silencing effect in the host organism expressing it, or may by
intended for use elsewhere in which case the method may further
optionally and preferably comprise at least partly purifying the
agent.
[0127] As well encompassed is a progeny of the host cell or host
organism as taught herein. Particularly intended is progeny
comprising the introduced agent, or isolated nucleic acid encoding
the agent, or a construct (vector) comprising a nucleic acid
encoding the agent, or comprising a replicated copy of said nucleic
acid or construct (vector), i.e., progeny transgenic or transformed
with regard to said nucleic acid or construct.
[0128] Also intended are compositions and formulations comprising
any one or more anti-DUX4 and/or anti-DUX4c antisense agent or RNAi
agent as taught herein, or an isolated nucleic acid encoding such
an agent, a recombinant construct (vector) (preferably an
expression construct, expression vector) comprising a nucleic acid
encoding such an agent, or a host cell or host organism as taught
herein, and one or more additional components, such as without
limitation one or more solvents and/or one or more pharmaceutically
acceptable carriers. Further provided are methods for producing the
above compositions or formulations, comprising admixing said agent,
isolated nucleic acid, construct (vector), host cell or host
organism as taught herein with one or more additional
components.
[0129] Particularly intended are pharmaceutical compositions and
formulations comprising any one or more anti-DUX4 and/or anti-DUX4c
antisense agent or RNAi agent as taught herein, or an isolated
nucleic acid encoding such an agent, a recombinant construct
(vector) (preferably an expression construct, expression vector)
comprising a nucleic acid encoding such an agent, or a host cell or
host organism as taught herein, one or more pharmaceutically
acceptable carriers; and methods for producing said pharmaceutical
compositions and formulations, comprising admixing said agent,
isolated nucleic acid, construct (vector), host cell or host
organism as taught herein with said one or more pharmaceutically
acceptable carriers.
[0130] Further disclosed herein are kits of parts comprising any
one or more anti-DUX4 and/or anti-DUX4c antisense agent or RNAi
agent as taught herein, or an isolated nucleic acid encoding such
an agent, a recombinant construct (vector) (preferably an
expression construct, expression vector) comprising a nucleic acid
encoding such an agent, or a host cell or host organism or progeny
thereof as taught herein, or composition(s) or formulation(s)
comprising any of such. The components of the kits may be in
various forms, such as, e.g., lyophilised, free in solution or
immobilised on a solid phase. They may be, e.g., provided in a
multi-well plate or as an array or microarray, or they may be
packaged separately and/or individually. A kit will further
typically comprise instructions for its use. The kits may be
advantageously employed in various applications, such as inter alia
in therapeutic, diagnostic, compound-screening and research
applications.
[0131] Further provided is:
[0132] any one or more anti-DUX4 and/or anti-DUX4c antisense agent
or RNAi agent as taught herein, or an isolated nucleic acid
encoding such an agent, a recombinant construct (vector)
(preferably an expression construct, expression vector) comprising
a nucleic acid encoding such an agent, or a host cell or host
organism or progeny thereof as taught herein, or composition(s) or
formulation(s) comprising any of such, for use as a medicament; or
for use in the treatment of a disease or condition the treatment of
which can benefit from reducing the expression of double homeobox 4
and/or double homeobox 4c;
[0133] use of any one or more anti-DUX4 and/or anti-DUX4c antisense
agent or RNAi agent as taught herein, or an isolated nucleic acid
encoding such an agent, a recombinant construct (vector)
(preferably an expression construct, expression vector) comprising
a nucleic acid encoding such an agent, or a host cell or host
organism or progeny thereof as taught herein, or composition(s) or
formulation(s) comprising any of such, for the manufacture of a
medicament for the treatment of a disease or condition the
treatment of which can benefit from reducing the expression of
double homeobox 4 and/or double homeobox 4c; or
[0134] a method for treating a disease or condition the treatment
of which can benefit from reducing the expression of double
homeobox 4 and/or double homeobox 4c in a subject, comprising
administering to said subject a therapeutically or prophylactically
effective amount of any one or more anti-DUX4 and/or anti-DUX4c
antisense agent or RNAi agent as taught herein, or an isolated
nucleic acid encoding such an agent, a recombinant construct
(vector) (preferably an expression construct, expression vector)
comprising a nucleic acid encoding such an agent, or a host cell or
host organism or progeny thereof as taught herein, or
composition(s) or formulation(s) comprising any of such.
[0135] Preferably, the diseases or conditions include ones
comprising increased levels and/or increased activity of double
homeobox 4 and/or double homeobox 4c, more preferably the disease
or condition is facioscapulohumeral muscular dystrophy (FSHD).
Double homeobox 4 emerges as particularly implicated in the
aetiology of FSHD. Anti-DUX4 antisense and/or RNAi agents and the
related or derived reagents are thus preferred.
[0136] It shall be appreciated that the reference herein to "any
one or more anti-DUX4 and/or anti-DUX4c antisense agent or RNAi
agent" covers not only such single agents, but also any
combinations of two or more such agents. Expressly intended are
without limitation a combination of two or more anti-DUX4 and/or
anti-DUX4c antisense agents; a combination of two or more anti-DUX4
and/or anti-DUX4c RNAi agents; and a combination of one or more
anti-DUX4 and/or anti-DUX4c antisense agent and one or more
anti-DUX4 and/or anti-DUX4c RNAi agent. Agents in a combination of
two or more agents may be typically provided as separate molecules,
or may otherwise be covalently or non-covalently conjugated to one
another, either directly or via a suitable linker or carrier. A
non-limiting example of joined agents includes "weasel" agents of
two or more co-joined antisense oligonucleotides as disclosed in WO
2006/000057, or in Aartsma-Rus et al. 2004 (Am J Hum Genet 74:
83-92).
[0137] The above and further aspects and preferred embodiments of
the invention are described in the following sections and in the
appended claims. The subject matter of appended claims 1 to 28 is
hereby specifically incorporated in this specification.
BRIEF DESCRIPTION OF THE FIGURES
[0138] FIG. 1 illustrates a schematic representation of the DUX4
transcripts expressed from an exemplary pathogenic D4Z4 repeat
array containing four D4Z4 units (grey arrows) at the 4q35 locus.
Each of the four D4Z4 units contains the DUX4 open reading frame
(ORF) (white boxes) and a transcription start site (white bended
arrows). The repeat array is flanked on its telomeric end by the
pLAM region (grey box) which is only present on the 4qA allele
uniquely linked to FSHD. The alternative 4qB allele is not linked
to FSHD (Lemmers et al. 2004 (Am J Hum Genet 75(6): 1124-30)).
[0139] FIG. 2 illustrates a scheme of an EcoRI genomic fragment
cloned in pGEM7Z and encompassing the 3'portion of the DUX4 ORF and
its 3' UTR. The stop codon of the DUX4 ORF, the pLAM region and the
poly-A addition signal (ATTAAA) are indicated in the upper panel.
The lower panel captures the mapping of the 3' mRNA ends and
illustrates the location of introns 1 and 2. Intron 1 is
alternatively spliced. The nucleotide positions are as shown in the
sequence in FIG. 3.
[0140] FIG. 3 illustrates the sequence (SEQ ID NO: 1) of an
exemplary genomic fragment as schematically set out in FIG. 2,
encompassing the 3' portion of the DUX4 ORF and its 3' UTR. This
particular sequence reproduces positions 12001 to 13080 of the
genomic sequence available in the NCBI Genbank database under
accession number AF117653 (sequence version no. 2, i.e.,
AF117653.2). In this AF117653 sequence said DUX4 ORF extends from
an ATG translation initiation codon at position 10829 (not shown)
to the stop codon at positions 12101-12103 (boxed). Exon 1 ends at
position 12111, intron 1 extends from position 12112 to 12247
within the D4Z4 unit (italics), exon 2 extends from position 12248
to 12329 (bold), the last D4Z4 unit ends at position 12329
continuing with the pLAM region, intron 2 extends from position
12330 to 12684 (larger) (italics) or alternatively 12338-12682
(smaller), and exon 3 extends from position 12685 to 12873
(bold).
[0141] FIG. 4 illustrates the sequence (SEQ ID NO: 42) of an
exemplary DUX4 cDNA. The DUX4 ORF, demarcated by the translation
initiation codon (bold, boxed) and the stop codon (boxed), and the
5' UTR upstream of the ATG codon correspond to these portions in
the exemplary DUX4 cDNA sequence available in Genbank under
accession no. NM_033178 (sequence version 2, i.e., NM_033178.2).
The 3' UTR downstream of the stop codon (i.e., starting from
position 1576 of SEQ ID NO: 42) is compiled from the DUX4 genomic
sequence AF117653.2 (see FIG. 3 and legend thereto) and includes
the remainder of exon 1, intron 1 (italics), exon 2 (bold) and exon
3 (underlined).
[0142] FIG. 5 illustrates the sequence (SEQ ID NO: 43) of an
exemplary DUX4 cDNA. The DUX4 ORF, demarcated by the translation
initiation codon (bold, boxed) and the stop codon (boxed), and the
5' UTR upstream of the ATG codon correspond to these portions in
the exemplary DUX4 cDNA sequence available in Genbank under
accession no. NM_033178 (sequence version 2, i.e., NM_033178.2).
The 3' UTR downstream of the stop codon (i.e., starting from
position 1576 of SEQ ID NO: 43) is compiled from the DUX4 genomic
sequence AF117653.2 (see FIG. 3 and legend thereto) and includes
the remainder of exon 1, exon 2 (bold) and exon 3 (underlined).
[0143] FIG. 6 illustrates the sequence (SEQ ID NO: 50) of an
exemplary putative DUX4c cDNA. This sequence corresponds to
positions 727 to 2440 of an exemplary but non-limiting genomic
sequence of the DUX4c gene (Genbank accession no. AY500824,
sequence version 1, i.e., AY500824.1). Indicated are the putative
GC-box (underlined) at positions 1-13 of SEQ ID NO: 50 (positions
727-739 of AY500824.1), the putative TATA-box variant (double
underlined) at positions 48-52 of SEQ ID NO: 50 (positions 774-778
of AY500824.1), the DUX4c ORF demarcated by the translation
initiation codon (bold, boxed) at positions 192-194 of SEQ ID NO:
50 (positions 918-920 of AY500824.1) and the stop codon (boxed) at
positions 1314-1316 of SEQ ID NO: 50 (positions 2040-2042 of
AY500824.1). The 3' UTR as experimentally detected extends
downstream of the stop codon (i.e., starting from position 1317 of
SEQ ID NO: 50; position 2043 of AY500824.1) down to position 1714
of SEQ ID NO: 50 (position 2440 of AY500824.1).
[0144] FIG. 7 illustrates the sequence (SEQ ID NO: 51) of an
exemplary putative DUX4c cDNA. This sequence corresponds to
positions 727 to 2629 of an exemplary but non-limiting genomic
sequence of the DUX4c gene (Genbank accession no. AY500824,
sequence version 1, i.e., AY500824.1). Indicated are the putative
GC-box (underlined) at positions 1-13 of SEQ ID NO: 51 (positions
727-739 of AY500824.1), the putative TATA-box variant (double
underlined) at positions 48-52 of SEQ ID NO: 51 (positions 774-778
of AY500824.1), the DUX4c ORF demarcated by the translation
initiation codon (bold, boxed) at positions 192-194 of SEQ ID NO:
51 (positions 918-920 of AY500824.1) and the stop codon (boxed) at
positions 1314-1316 of SEQ ID NO: 51 (positions 2040-2042 of
AY500824.1). The 3' UTR as experimentally detected in an FSHD
patient extends downstream of the stop codon (i.e., starting from
position 1317 of SEQ ID NO: 51; position 2043 of AY500824.1) down
to position 1903 of SEQ ID NO: 51 (position 2629 of
AY500824.1).
[0145] FIG. 8 illustrates the sequence (SEQ ID NO: 52) of an
exemplary putative DUX4c cDNA. This sequence corresponds to
predicted DUX4c mRNA as available in the Genbank database under
accession no. XR_041199 (sequences version 2, i.e., XR_041199.2).
Indicated are the DUX4c ORF demarcated by the translation
initiation codon (bold, boxed) at positions 688-670 and the stop
codon (boxed) at positions 1810-1812. The predicted 3' UTR extends
downstream of the stop codon (i.e., starting from position
1813.
[0146] FIG. 9 illustrates the inhibitory effect of anti-DUX4
pre-mRNA antisense oligomers on DUX4 protein expression.
[0147] FIGS. 10 and 11 illustrate that antisense oligomer 1524 can
exert a specific inhibitory effect on DUX4 protein expression.
[0148] FIG. 12 illustrates that antisense oligomers 1524, 1523 and
1522 can exert a specific inhibitory effect on DUX4 protein
expression.
[0149] FIGS. 13A, 13B and 14 illustrate evaluation of siRNA
targeting DUX4c.
[0150] FIG. 15 illustrates evaluation of siRNA targeting DUX4.
[0151] FIG. 16 illustrates evaluation of anti-DUX4c and anti-DUX4
siRNA specificity by Western blot. (A) anti-DUX4 antibody, (B)
anti-DUX4c antibody.
[0152] FIG. 17 illustrates pLVTH-shRNA expression vector.
[0153] FIG. 18 schematically illustrates production of shRNA from
an shRNA vector and its subsequence processing to siRNA by
Dicer.
[0154] FIG. 19 illustrates efficiency and specificity of shRNA
vectors in western blot.
[0155] FIG. 20 illustrates an exemplary sequence of DUX4
protein.
[0156] FIG. 21 illustrates an exemplary sequence of DUX4c
protein.
[0157] FIG. 22 illustrates optimal transfection conditions for FSHD
primary myoblasts.
[0158] FIG. 23 illustrates evaluation of siRNA targeting DUX4 in
FSHD primary myoblasts.
[0159] FIG. 24 illustrates a schematic representation of the
structure of an oligonucleotide chemically modified with a
2'-O-methylated phosphorothioate backbone.
[0160] FIG. 25 illustrates a schematic representation of the
structure of an oligonucleotide chemically modified with a
phosphorodiamidate morpholino backbone.
[0161] FIG. 26 illustrates exemplary transcripts derived from one
or more D4Z4 units and comprising the pLAM region or not. The upper
panel schematically shows genomic fragments of a D4Z4 unit and the
pLAM region. The DUX4 ORF is represented in black with the two
homeobox regions in grey. The positions of the different introns
are indicated (dark grey boxes). The pLAM region encompasses an
intron (dark grey box) and the poly-A signal (ATTAAA). The lower
panels illustrate the location of introns 1, 2, 2a, 1 bis and 2a
bis. The first transcript published (Dixit et al., supra) begins in
the last D4Z4 unit with alternative splicing of intron 1 in the
D4Z4 sequence, then extending into the pLAM region where intron 2
is always spliced out, and ending 6 to 16 bp after the poly-A
signal. We found a second transcript (Coppee et al., unpublished)
that begins in a D4Z4 unit (adjacent or not to the last unit) that
has the same intron 1 as reported above. The transcript continues
in the adjacent D4Z4 unit where another intron is found that is
named either 2a if the splice acceptor site is in the D4Z4 unit or
2a bis if this splice acceptor site is in the pLAM region. No
poly-A signals were reported at proximity Snider et al., supra
found a DUX4 transcript corresponding to those described in Dixit
et al. and a DUX4 transcript with 2 copies of exon 2.
[0162] FIG. 27 illustrates exemplary genomic sequence of the DUX4
transcripts of FIG. 26. Snider et al. reported a different sequence
for the beginning of the pLAM region that contains the intron 2
donor splicing site (boxed sequence GGTACC). Sequence comparison
revealed that this sequence is identical to those in the beginning
of a D4Z4 unit surrounding the intron 2a splice donor site (Coppee
et al.).
[0163] FIG. 28 schematically shows the DUX4 gene structure by
aligning D4Z4 and pLAM variants. Two adjacent D4Z4 units are
represented to scale from GenBank accession number AF117653.1
(first and second line) as well as the flanking pLAM region (fourth
line). This region differs from that represented in the third line
(GenBank accession number U74497.1) by a deletion of a 1609-bp
segment (vertical stripes). This pLAM region (third line) is nearly
identical to a D4Z4 unit over 1890 bp (grey stripes) and diverges
in further distal sequences. The 1609-bp deletion in the pLAM
region of the fourth line is found in the region nearly identical
to D4Z4. The DUX4 ORF is represented in black with the two homeobox
regions in grey. The positions of the different introns are
indicated (dark grey boxes). The DUX4 mRNA start sites are
indicated by black upward arrows for the 1'' mRNA (Dixit et al.
2007) and the 2' mRNA (Coppee et al., unpublished). The DUX4 mRNA
ends are indicated by black downwards arrows. Different ends were
found: 6 to 16 bp downstream from the poly-A signal (Dixit et al.,
2007) for the 1'' mRNA, and two possible ends (either in D4Z4 or in
pLAM) for the 2' mRNA.
[0164] FIGS. 29A and 29B illustrate the efficiency of the antisense
oligonucleotides 1521 (a) and 1523 (b) in decreasing endogenous
DUX4 mRNA amount in FSHD primary myotubes.
[0165] FIG. 30 illustrates the efficiency of anti-DUX4 siRNA3 in
decreasing endogenous DUX4 mRNA amount in FSHD primary
myotubes.
[0166] FIG. 31 schematically shows the position of the antisense
oligonucleotides 2245 and 2250 on the DUX4 genomic sequence
fragment available in Genbank under accession no. AF117653
(sequence version 2, i.e., AF117653.2). (see FIG. 3 and legend
thereto). This sequence fragment includes intron 1 (italics), exon
2 (bold), exon 3 (italics, bold) and the stop codon of the DUX4 ORF
(boxed), antisense oligonucleotides 2245 (underlined) and 2250
(underlined, bold).
[0167] FIG. 32 illustrates the inhibitory effect of the antisense
oligomers 2245 and 2250 on DUX4 protein expression.
[0168] FIG. 33 illustrates optimal concentration of antisense
oligomer 2245 for specific inhibition of DUX4 protein
expression.
DETAILED DESCRIPTION OF THE INVENTION
[0169] As used herein, the singular forms "a", "an", and "the"
include both singular and plural referents unless the context
clearly dictates otherwise.
[0170] The terms "comprising", "comprises" and "comprised of" as
used herein are synonymous with "including", "includes" or
"containing", "contains", and are inclusive or open-ended and do
not exclude additional, non-recited members, elements or method
steps.
[0171] The recitation of numerical ranges by endpoints includes all
numbers and fractions subsumed within the respective ranges, as
well as the recited endpoints.
[0172] The terms "about" or "approximately" as used herein when
referring to a measurable value such as a parameter, an amount, a
temporal duration, and the like, is meant to encompass variations
of and from the specified value, in particular variations of +/-10%
or less, preferably +/-5% or less, more preferably +/-1% or less,
and still more preferably +/-0.1% or less of and from the specified
value, insofar such variations are appropriate to perform in the
disclosed invention. It is to be understood that the value to which
the modifier "about" refers is itself also specifically, and
preferably, disclosed.
[0173] All documents cited in the present specification are hereby
incorporated by reference in their entirety.
[0174] Unless otherwise defined, all terms used in disclosing the
invention, including technical and scientific terms, have the
meaning as commonly understood by one of ordinary skill in the art
to which this invention belongs. By means of further guidance, term
definitions may be included to better appreciate the teaching of
the present invention.
[0175] For general methods relating to the invention, reference is
made inter alia to well-known textbooks, including, e.g.,
"Molecular Cloning: A Laboratory Manual, 2nd Ed." (Sambrook et al.,
1989), Animal Cell Culture (R. I. Freshney, ed., 1987), the series
Methods in Enzymology (Academic Press), Gene Transfer Vectors for
Mammalian Cells (J. M. Miller & M. P. Calos, eds., 1987);
"Current Protocols in Molecular Biology and Short Protocols in
Molecular Biology, 3rd Ed." (F. M. Ausubel et al., eds., 1987 &
1995); Recombinant DNA Methodology II (R. Wu ed., Academic Press
1995).
[0176] General techniques in cell culture and media uses are
outlined inter alia in Large Scale Mammalian Cell Culture (Hu et
al. 1997. Curr Opin Biotechnol 8: 148); Serum-free Media (K.
Kitano. 1991. Biotechnology 17: 73); or Large Scale Mammalian Cell
Culture (Curr Opin Biotechnol 2: 375, 1991).
[0177] As used herein, the terms "double homeobox 4" and " DUX4"
are synonymous and refer to genes, gene products, nucleic acids,
proteins and polypeptides commonly known under these designations
in the art. The terms encompass such genes, gene products, nucleic
acids, proteins and polypeptides of any organism where found, and
particularly of animals, preferably vertebrates, more preferably
mammals, including humans and non-human mammals, even more
preferably of humans.
[0178] The terms particularly encompass such genes, gene products,
nucleic acids, proteins and polypeptides with a native sequence,
i.e., ones of which the primary sequence is the same as that of
DUX4 found in or derived from nature. A skilled person understands
that native sequences of DUX4 may differ between different species
due to genetic divergence between such species. Moreover, the
native sequences of DUX4 may differ between or within different
individuals of the same species due to normal genetic diversity
(genetic variation) or due to mutation within a given species.
Also, the native sequences of DUX4 may differ between or even
within different individuals of the same species due to
post-transcriptional or post-translational modifications.
Accordingly, all DUX4 sequences found in or derived from nature are
considered "native".
[0179] The terms encompass DUX4 genes, gene products, nucleic
acids, proteins and polypeptides when forming a part of a living
organism, organ, tissue or cell, when forming a part of a
biological sample, as well as when at least partly isolated from
such sources. The terms also encompass genes, gene products,
nucleic acids, proteins and polypeptides when produced by
recombinant or synthetic means.
[0180] DUX4 gene as intended herein may particularly denote a DUX4
gene present in the distal-most unit of a D4Z4 array on chromosome
4q35, particularly wherein the DUX4 gene extends into the pLAM
region flanking the telomeric side of the D4Z4 array, more
particularly wherein said pLAM region provides a polyadenylation
signal, such as preferably ATTAAA. Such DUX4 gene leads to
production of comparably stable mRNA(s) (Dixit et al. 2007,
supra).
[0181] While additional DUX4 transcripts have been identified that
may span several D4Z4 units and may display alternative splicing,
and preferably also comprise the pLAM region (Snider et al. 2009,
supra; Coppee et al., unpublished), DUX4 gene as intended herein
may also particularly denote such D4Z4-resident transcription
units, particularly ones that give rise to a transcript leading to
production of comparably stable mRNA comprising DUX4 sequences,
even more particularly wherein the transcript comprises the pLAM
region, still more particularly wherein said pLAM region provides a
polyadenylation signal, such as preferably ATTAAA. Such DUX4
transcripts and mRNA are schematically illustrated in FIGS. 26 and
28 with reference to an exemplary but non-limiting genomic sequence
as shown in FIG. 27.
[0182] It shall also be appreciated that the pLAM region may
display polymorphisms, such as without limitation the presence or
absence of a 1.6-kb sequence within its intron (Gabriels et al.
1999, supra; van Deutekom et al. 2009, supra).
[0183] Even more particularly, DUX4 gene as intended herein denotes
DUX4 gene as above as present in a pathogenic D4Z4 array associated
with facioscapulohumeral muscular dystrophy (FSHD).
[0184] Exemplary DUX4 gene includes without limitation human DUX4
gene having nucleic acid sequence as annotated under NCBI Genbank
(http://www.ncbi.nlm.nih.gov/) accession number AF117653 (sequence
version no. 2 revised on Nov. 30, 2009, i.e., AF117653.2, SEQ ID
NO: 70), more particularly the DUX4 gene at positions about 10650
to about 12873 (e.g., SEQ ID NO: 71) of AF117653.2, also
particularly at positions about 10829 to about 12873 of
AF117653.2.
[0185] Exemplary but non-limiting DUX4 cDNA (and respective mRNA)
includes without limitation human DUX4 cDNA having nucleic acid
sequence as annotated under Genbank accession number NM_033178
(sequence version 2 revised on Feb. 28, 2010, i.e., NM_033178.2).
Further exemplary but non-limiting DUX4 cDNA (and respective mRNA)
include without limitation human DUX4 cDNA having nucleic acid
sequence as set out in SEQ ID NO: 42 (FIG. 4) or SEQ ID NO: 43
(FIG. 5).
[0186] Exemplary DUX4 protein or polypeptide includes without
limitation human DUX4 protein or polypeptide having primary amino
acid sequence as annotated under Genbank accession no. NP_149418
(sequence version 3 revised on Feb. 28, 2010, i.e., NP_149418.3),
also reproduced in FIG. 20 as SEQ ID NO: 59.
[0187] As used herein, the terms "double homeobox 4c" and " DUX4c"
are synonymous and refer to genes, gene products, nucleic acids,
proteins and polypeptides commonly known under these designations
in the art. The terms encompass such genes, gene products, nucleic
acids, proteins and polypeptides of any organism where found, and
particularly of animals, preferably vertebrates, more preferably
mammals, including humans and non-human mammals, even more
preferably of humans.
[0188] The terms particularly encompass such genes, gene products,
nucleic acids, proteins and polypeptides with a native sequence,
i.e., ones of which the primary sequence is the same as that of
DUX4c found in or derived from nature. A skilled person understands
that native sequences of DUX4c may differ between different species
due to genetic divergence between such species. Moreover, the
native sequences of DUX4c may differ between or within different
individuals of the same species due to normal genetic diversity
(genetic variation) or due to mutation within a given species.
Also, the native sequences of DUX4c may differ between or even
within different individuals of the same species due to
post-transcriptional or post-translational modifications.
Accordingly, all DUX4c sequences found in or derived from nature
are considered "native".
[0189] The terms encompass DUX4c genes, gene products, nucleic
acids, proteins and polypeptides when forming a part of a living
organism, organ, tissue or cell, when forming a part of a
biological sample, as well as when at least partly isolated from
such sources. The terms also encompass genes, gene products,
nucleic acids, proteins and polypeptides when produced by
recombinant or synthetic means.
[0190] Exemplary DUX4c gene includes without limitation human DUX4c
gene having nucleic acid sequence as annotated under Genbank
accession number AY500824 (sequence version 1 revised on December
1, 2009, i.e., AY500824.1). A further exemplary DUX4c gene includes
without limitation human DUX4c gene having nucleic acid sequence as
annotated under Genbank accession number NC_000004 range
190940254..190945505, complement (sequence version 11 revised on
Jun. 10, 2009, i.e., NC_000004.11).
[0191] Exemplary but non-limiting DUX4c cDNA (and respective mRNA)
includes without limitation human DUX4c cDNA having nucleic acid
sequence as set out in SEQ ID NO: 50 (FIG. 6) or SEQ ID NO: 51
(FIG. 7). A further exemplary but non-limiting DUX4c cDNA (and
respective mRNA) includes without limitation human DUX4c cDNA
having nucleic acid sequence as annotated under Genbank accession
no. XR_041199 (sequences version 2 revised on June 10, 2009, i.e.,
XR_041199.2) also reproduced in FIG. 8.
[0192] Exemplary DUX4c protein or polypeptide includes without
limitation human DUX4c protein or polypeptide having primary amino
acid sequence as annotated under Genbank accession no. AAS15569
(sequence version 1 revised on Dec. 1, 2009, i.e., AAS15569.1),
also reproduced in FIG. 21 as SEQ ID NO: 60.
[0193] It shall be appreciated that other DUX genes homologous to
DUX4 and/or DUX4c are present in and transcribed from the human
genome but are not linked to FSHD. Consequently, antisense and
siRNA agents as intended herein preferably target DUX4 and/or DUX4c
genes specifically, i.e., substantially to the exclusion of other
DUX genes. In particular, such specific agents may display adequate
sequence identity to DUX4 and/or DUX4c sequences but not to said
other DUX genes. The particular antisense and siRNA agents as
taught herein are highly advantageous in this respect.
[0194] The reference herein to DUX4 and DUX4c genes, gene products,
nucleic acids, proteins and polypeptides also encompasses fragments
and/or variants of the respective substances.
[0195] The term "fragment" with reference to a protein or
polypeptide generally denotes a N- and/or C-terminally truncated
form of a protein or polypeptide. Preferably, a fragment may
comprise at least about 30%, e.g., at least about 50% or at least
about 70%, preferably at least about 80%, e.g., at least about 85%,
more preferably at least about 90%, and yet more preferably at
least about 95% or even about 99% of the amino acid sequence length
of said protein or polypeptide.
[0196] The term "fragment" with reference to a nucleic acid
(polynucleotide) generally denotes a 5'- and/or 3'-truncated form
of a nucleic acid. Preferably, a fragment may comprise at least
about 30%, e.g., at least about 50% or at least about 70%,
preferably at least about 80%, e.g., at least about 85%, more
preferably at least about 90%, and yet more preferably at least
about 95% or even about 99% of the nucleic acid sequence length of
said nucleic acid.
[0197] The term "variant" of a given recited nucleic acid
(polynucleotide), protein or polypeptide refers to nucleic acids,
proteins or polypeptides the sequence (i.e., nucleotide sequence or
amino acid sequence, respectively) of which is substantially
identical (i.e., largely but not wholly identical) to the sequence
of said recited nucleic acid, protein or polypeptide, e.g., at
least about 80% identical or at least about 85% identical, e.g.,
preferably at least about 90% identical, e.g., at least 91%
identical, 92% identical, more preferably at least about 93%
identical, e.g., at least 94% identical, even more preferably at
least about 95% identical, e.g., at least 96% identical, yet more
preferably at least about 97% identical, e.g., at least 98%
identical, and most preferably at least 99% identical. Preferably,
a variant may display such degrees of identity to a recited nucleic
acid, protein or polypeptide when the whole sequence of the recited
nucleic acid, protein or polypeptide is queried in the sequence
alignment (i.e., overall sequence identity).
[0198] Also included among fragments and variants of a given
recited nucleic acid, protein or polypeptide are fusion products of
said nucleic acid, protein or polypeptide with another, usually
unrelated, nucleic acid, protein or polypeptide, respectively.
Particularly included among fragments and variants as intended
herein are thus fusion genes between the DUX4 or DUX4c gene and
other genes, leading to the expression of fusion (i.e., chimeric)
proteins. More specifically included are such fusion genes arising
through chromosomal rearrangements, even more specifically wherein
said fusion genes and their chimeric proteins cause or contribute
to a pathology. Hence, examples of DUX4 or DUX4c fragments and
variants which are encompassed herein and may benefit from
targeting by the antisense or RNAi agents of the present invention
include fusions between CIC, a human homolog of Drosophila capicua,
and DUX4, as seen in Ewing's family tumours (EFTs) (Kawamura-Saito
et al. 2006, supra) and paediatric undifferentiated soft tissue
sarcomas (USTS) (Yoshimoto et al. 2009, supra), and fusions between
EWSRJ and DUX4, as seen in rhabdomyosarcomas (RMS) (Sirvent et al.
2009, supra). More generally, fusions containing the C-terminal
fragment of DUX4 are intended, since the resultant chimeric
proteins acquire an enhanced transcriptional activity, which may
lead to tumour formation.
[0199] Sequence identity may be determined using suitable
algorithms for performing sequence alignments and determination of
sequence identity as know per se. Exemplary but non-limiting
algorithms include those based on the Basic Local Alignment Search
Tool (BLAST) originally described by Altschul et al. 1990 (J Mol
Biol 215: 403-10), such as the "Blast 2 sequences" algorithm
described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174:
247-250), for example using the published default settings or other
suitable settings (such as, e.g., for the BLASTN algorithm: cost to
open a gap=5, cost to extend a gap=2, penalty for a mismatch=-2,
reward for a match=1, gap x_dropoff=50, expectation value=10.0,
word size=28; or for the BLASTP algorithm: matrix=Blosum62, cost to
open a gap=11, cost to extend a gap=1, expectation value=10.0, word
size=3).
[0200] In an embodiment, a variant of a given nucleic acid
(polynucleotide), protein or polypeptide may be a homologue (e.g.,
orthologue or paralogue) of said nucleic acid, protein or
polypeptide. As used herein, the term "homology" generally denotes
structural similarity between two macromolecules, particularly
between two nucleic acids, proteins or polypeptides, from same or
different taxons, wherein said similarity is due to shared
ancestry.
[0201] Where the present specification refers to variants and/or
fragments of substances such as of antisense or RNAi agents,
nucleic acids, proteins or polypeptides, this particularly denotes
variants and/or fragments which are "functional", i.e., which at
least partly retain the biological activity or intended
functionality of the respective agents, nucleic acids, proteins or
polypeptides.
[0202] By means of an example and not limitation, a functional
variant and/or fragment of a DUX4 or DUX4c gene, gene product,
nucleic acid, protein or polypeptide shall at least partly retain
the biological activity of DUX4 or DUX4c, respectively. For
example, such functional variant and/or fragment may retain one or
more aspects of the biological activity of DUX4 or DUX4c, such as,
e.g., ability to participate in one or more cellular pathways,
ability to regulate transcription of one or more genes, etc.
[0203] By means of an example and not limitation, a functional
variant and/or fragment of an anti-DUX4 and/or anti-DUX4c antisense
agent or RNAi agent shall at least partly retain the functionality
of said agent, i.e., its ability to reduce or abolish the
expression of the target molecule such as DUX4 and/or DUX4c.
[0204] Preferably, a functional variant and/or fragment may retain
at least about 20%, e.g., at least 30%, or at least about 40%, or
at least about 50%, e.g., at least 60%, more preferably at least
about 70%, e.g., at least 80%, yet more preferably at least about
85%, still more preferably at least about 90%, and most preferably
at least about 95% or even about 100% or higher of the intended
biological activity or functionality compared to the corresponding
recited substance such as an agent, gene, gene product, nucleic
acid, protein or polypeptide.
[0205] The term "nucleic acid" as used herein typically refers to a
polymer (preferably a linear polymer) of any length composed
essentially of nucleoside units. A nucleoside unit commonly
includes a heterocyclic base and a sugar group. Heterocyclic bases
may include inter alia purine and pyrimidine bases such as adenine
(A), guanine (G), cytosine (C), thymine (T) and uracil (U) which
are widespread in naturally-occurring nucleic acids, other
naturally-occurring bases (e.g., xanthine, inosine, hypoxanthine)
as well as chemically or biochemically modified (e.g., methylated),
non-natural or derivatised bases. Exemplary modified nucleobases
include without limitation 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. In particular, 5-methylcytosine substitutions
have been shown to increase nucleic acid duplex stability and may
be preferred base substitutions in for example antisense agents,
even more particularly when combined with 2'-O-methoxyethyl sugar
modifications. Sugar groups may include inter alia pentose
(pentofuranose) groups such as preferably ribose and/or
2-deoxyribose common in naturally-occurring nucleic acids, or
arabinose, 2-deoxyarabinose, threose or hexose sugar groups, as
well as modified or substituted sugar groups (such as without
limitation 2'-O-alkylated, e.g., 2'-O-methylated or 2'-O-ethylated
sugars such as ribose; 2'-O-alkyloxyalkylated, e.g.,
2'-O-methoxyethylated sugars such as ribose; or
2'-O,4'-C-alkylene-linked, e.g., 2'-O,4'-C-methylene-linked or
2'-O,4'-C-ethylene-linked sugars such as ribose;
2'-fluoro-arabinose, etc.). Nucleoside units may be linked to one
another by any one of numerous known inter-nucleoside linkages,
including inter alia phosphodiester linkages common in
naturally-occurring nucleic acids, and further modified phosphate-
or phosphonate-based linkages such as phosphorothioate, alkyl
phosphorothioate such as methyl phosphorothioate,
phosphorodithioate, alkylphosphonate such as methylphosphonate,
alkylphosphonothioate, phosphotriester such as
alkylphosphotriester, phosphoramidate, phosphoropiperazidate,
phosphoromorpholidate, bridged phosphoramidate, bridged methylene
phosphonate, bridged phosphorothioate; and further siloxane,
carbonate, sulfamate, carboalkoxy, acetamidate, carbamate such as
3'-N-carbamate, morpholino, borano, thioether, 3'-thioacetal, and
sulfone internucleoside linkages. Preferably, inter-nucleoside
linkages may be phosphate-based linkages including modified
phosphate-based linkages, such as more preferably phosphodiester,
phosphorothioate or phosphorodithioate linkages or combinations
thereof. The term "nucleic acid" also encompasses any other
nucleobase containing polymers such as nucleic acid mimetics,
including, without limitation, peptide nucleic acids (PNA), peptide
nucleic acids with phosphate groups (PHONA), locked nucleic acids
(LNA), morpholino phosphorodiamidate-backbone nucleic acids (PMO),
cyclohexene nucleic acids (CeNA), tricyclo-DNA (tcDNA), and nucleic
acids having backbone sections with alkyl linkers or amino linkers
(see, e.g., Kurreck 2003 (Eur J Biochem 270: 1628-1644)). "Alkyl"
as used herein particularly encompasses lower hydrocarbon moieties,
e.g., C1-C4 linear or branched, saturated or unsaturated
hydrocarbon, such as methyl, ethyl, ethenyl, propyl, 1-propenyl,
2-propenyl, and isopropyl. Nucleic acids as intended herein may
include naturally occurring nucleosides, modified nucleosides or
mixtures thereof. A modified nucleoside may include a modified
heterocyclic base, a modified sugar moiety, a modified
inter-nucleoside linkage or a combination thereof. The term
"nucleic acid" further preferably encompasses DNA, RNA and DNA/RNA
hybrid molecules, specifically including hnRNA, pre-mRNA, mRNA,
cDNA, genomic DNA, amplification products, oligonucleotides, and
synthetic (e.g. chemically synthesised) DNA, RNA or DNA/RNA
hybrids. A nucleic acid can be naturally occurring, e.g., present
in or isolated from nature, can be recombinant, i.e., produced by
recombinant DNA technology, and/or can be, partly or entirely,
chemically or biochemically synthesised. A "nucleic acid" can be
double-stranded, partly double stranded, or single-stranded. Where
single-stranded, the nucleic acid can be the sense strand or the
antisense strand. In addition, nucleic acid can be circular or
linear.
[0206] Nucleic acids and particularly antisense oligonucleotides or
RNAi agents may be herein denoted as comprising uracil (U) bases.
It shall be appreciated that U may be optionally substituted by
thymine (T) in (at least some) such nucleic acids and agents. For
example, as 2'-O-methyl phosphorothioate antisense oligonucleotides
are more `RNA-like`, U may be used and denoted in such molecules.
With other antisense chemistries, such as peptide nucleic acids or
morpholino backbones, T bases may be preferably denoted and
used.
[0207] The term "oligonucleotide" as used herein refers to a
nucleic acid (including nucleic acid analogues and mimetics)
oligomer or polymer as defined herein. Preferably, an
oligonucleotide, such as more particularly an antisense
oligonucleotide, is (substantially) single-stranded.
Oligonucleotides as intended herein may be preferably between about
10 and about 100 nucleoside units (i.e., nucleotides or nucleotide
analogues) in length, preferably between about 15 and about 50,
more preferably between about 20 and about 40, also preferably
between about 20 and about 30. Preferably, oligonucleotides as
intended herein may comprise one or more or all non-naturally
occurring heterocyclic bases and/or one or more or all
non-naturally occurring sugar groups and/or one or more or all
non-naturally occurring inter-nucleoside linkages, the inclusion of
which may improve properties such as, for example, enhanced
cellular uptake, increased stability in the presence of nucleases
and increased hybridization affinity, increased tolerance for
mismatches, etc. Further, oligonucleotides as intended herein may
be configured to not activate RNAse H, accordance with known
techniques (see, e.g., U.S. Pat. No. 5,149,797).
[0208] Antisense agents such as oligonucleotides as taught herein
may be further conjugated (e.g., covalently or non-covalently,
directly or via a suitable linker) to one or more moieties or
conjugates that enhance the activity, cellular distribution or
cellular uptake of the oligonucleotide. Such moieties include but
are not limited to lipid moieties such as a cholesterol moiety,
cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a
thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl
residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or
triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a
polyamine or a polyethylene glycol chain, or adamantane acetic
acid, a palmityl moiety, or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety.
[0209] It is not necessary for all positions in a given agent to be
uniformly modified, and in fact more than one of the aforementioned
modifications may be incorporated in a single agent or even at a
single nucleoside within an oligonucleotide. Further included are
antisense compounds that are chimeric compounds. "Chimeric"
antisense compounds or "chimeras" are antisense molecules,
particularly oligonucleotides, which contain two or more chemically
distinct regions, each made up of at least one monomer unit, i.e.,
a nucleotide in the case of an oligonucleotide compound. These
oligonucleotides typically contain at least one region wherein the
oligonucleotide is modified so as to confer upon the increased
resistance to nuclease degradation, increased cellular uptake, and
an additional region for increased binding affinity for the target
nucleic acid.
[0210] The term "antisense" generally refers to an agent (e.g., an
oligonucleotide) configured to specifically anneal with (hybridise
to) a given sequence in a target nucleic acid, such as for example
in a target DNA, hnRNA, pre-mRNA or mRNA, and typically comprises,
consist essentially of or consist of a nucleic acid sequence that
is complementary or substantially complementary to said target
nucleic acid sequence. Antisense agents suitable for use herein may
typically be capable of annealing with (hybridising to) the
respective target nucleic acid sequences at high stringency
conditions, and capable of hybridising specifically to the target
under physiological conditions.
[0211] The terms "complementary" or "complementarity" as used
herein with reference to nucleic acids, refer to the normal binding
of single-stranded nucleic acids under permissive salt (ionic
strength) and temperature conditions by base pairing, preferably
Watson-Crick base pairing. By means of example, complementary
Watson-Crick base pairing occurs between the bases A and T, A and U
or G and C. For example, the sequence 5'-A-G-U-3' is complementary
to sequence 5'-A-C-U-3'.
[0212] The term "bind" or "binding" as used herein preferably
refers to specific binding, i.e., where an agent binds to (anneals
with) one or more targets of interest, such as to one or more
pre-mRNA molecules or fragments or variants thereof, substantially
to the exclusion of other molecules which are random or unrelated,
and optionally substantially to the exclusion of other molecules
that are structurally related. Binding of an agent to a target may
be evaluated inter alia using conventional interaction-querying
methods, such as in silico sequence analysis or nucleic acid
hybridisation experiments, e.g., to verify specific hybridisation,
e.g., under high stringency conditions.
[0213] Specific binding does not necessarily require that an agent
binds exclusively to its intended target(s). For example, an agent
may be said to specifically bind to a given pre-mRNA of interest or
fragments or variants thereof if its affinity for such intended
target(s) under the conditions of binding is at least about 2-fold
greater, preferably at least about 5-fold greater, more preferably
at least about 10-fold greater, yet more preferably at least about
25-fold greater, still more preferably at least about 50-fold
greater, and even more preferably at least about 100-fold or at
least about 1000-fold or more greater, than its affinity for a
non-target molecule, such as non-target other DUX genes.
[0214] The sequence of an antisense agent need not be 100%
complementary to that of its target sequence to bind or hybridise
specifically with the latter. An antisense agent may be said to be
specifically hybridisable when binding of the agent to a target
nucleic acid molecule interferes with the normal function of the
target nucleic acid such as to attain an intended outcome (e.g.,
loss of utility), and there is a sufficient degree of
complementarity to avoid non-specific binding of the antisense
agent to non-target sequences under conditions in which specific
binding is desired, i.e., under physiological conditions in the
case of in vivo assays or therapeutic treatment, and in the case of
in vitro assays, under conditions in which the assays are
performed. Thus, "specifically hybridisable" and "complementary"
may indicate a sufficient degree of complementarity or precise
pairing such that stable and specific binding occurs between an
antisense agent and a nucleic acid target. Agents as intended
herein preferably specifically bind to the desired DUX4 and/or
DUX4c targets substantially to the exclusion of other DUX
genes.
[0215] Preferably, to ensure specificity of antisense agents
towards the desired DUX4 and/or DUX4c targets over unrelated
molecules, such as over other DUX genes, the sequence of said
antisense agents may be at least about 80% identical, preferably at
least about 90% identical, more preferably at least about 95%
identical, such as, e.g., about 96%, about 97%, about 98%, about
99% and up to 100% identical to the respective target DUX4 and/or
DUX4c sequence.
[0216] The term "reduce" generally denotes a qualitative and/or
quantitative alteration, change or variation leading to decrease of
that which is being reduced (e.g., production and/or level of a
given protein).
[0217] The term covers any extent of such reduction. For example,
where reduction effects a determinable or measurable variable, then
such reduction may encompass a decrease in the value of said
variable by at least about 10%, e.g., by at least about 20%, by at
least about 30%, e.g., by at least about 40%, by at least about
50%, e.g., by at least about 60%, by at least about 70%, e.g., by
at least about 80%, by at least about 90%, e.g., by at least about
95%, such as by at least about 96%, 97%, 98%, 99% or even by 100%
(abolishment), compared to a reference situation without said
reduction. Preferably, reduction of the production and/or level of
intended target(s) may be specific or selective, i.e., the
production and/or level of the intended target(s) may be modulated
without substantially altering the production and/or level of
random, unrelated targets.
[0218] Agents such as antisense or RNAi agents as taught herein may
without limitation reduce or abolish the production and/or level of
DUX4 and/or DUX4c pre-mRNA and/or mRNA, whereby such agents may be
capable of reducing or abolishing the production of DUX4 and/or
DUX4c proteins.
[0219] Reference to the "level" of a target may preferably
encompass the quantity and/or the availability (e.g., availability
for performing its biological activity) of the target, e.g., within
a cell, tissue, organ or an organism.
[0220] The terms "splicing", "splicing of a gene" and similar as
used herein are synonymous and have their art-established meaning.
By means of additional explanation, splicing denotes the process
and means of removing intervening sequences (introns) from pre-mRNA
in the process of producing mature mRNA. The reference to splicing
particularly aims at native splicing such as occurs under normal
physiological conditions. The terms "pre-mRNA" and "transcript" are
used herein to denote RNA species that precede mature mRNA, such as
in particular a primary RNA transcript and any partially processed
forms thereof. Sequence elements required for splicing refer
particularly to cis elements in the sequence of pre-mRNA which
direct the cellular splicing machinery (spliceosome) towards
correct and precise removal of introns from the pre-mRNA. Sequence
elements involved in splicing are generally known per se and can be
further determined by known techniques including inter alia
mutation or deletion analysis. By means of further explanation,
"splice donor site" or "5' splice site" generally refer to a
conserved sequence immediately adjacent to an exon-intron boundary
at the 5' end of an intron. Commonly, a splice donor site may
contain a dinucleotide GU, and may involve a consensus sequence of
about 8 bases at about positions +2 to -6. "Splice acceptor site"
or "3' splice site" generally refers to a conserved sequence
immediately adjacent to an intron-exon boundary at the 3' end of an
intron. Commonly, a splice acceptor site may contain a dinucleotide
AG, and may involve a consensus sequence of about 16 bases at about
positions -14 to +2 (see, e.g., FIG. 1 of WO 2006/00057 for
illustrative consensus sequences of splice donor and splice
acceptor sites).
[0221] The terms "polyadenylation", "polyadenylation of a gene" and
similar are used interchangeably herein and have their
art-established meaning. By means of additional explanation,
polyadenylation denotes the process and means of adding a
polyadenylic acid (poly(A)) tail, i.e., multiple adenosine
monophosphates, to an RNA molecule. In particular, polyadenylation
may denote the process and means of adding a poly(A) tail to a
pre-mRNA molecule, in the process of producing mature mRNA. The
reference to polyadenylation particularly aims at native
polyadenylation such as occurs under normal physiological
conditions.
[0222] Sequence elements required for polyadenylation refer
particularly to cis elements in the sequence of pre-mRNA which the
cellular polyadenylation machinery recognises such as to which it
binds, such as for example the polyadenylation signal. These
sequence such as the polyadenylation signal may vary between groups
of eukaryotes. For example, in humans the polyadenylation signal
sequence may typically be AATAAA (i.e., AAUAAA in RNA such as
pre-mRNA), but variants of it exist, such as ATTAAA.
[0223] The term "cell-penetrating peptide" or "CPP" generally
refers to peptides capable of entering into cells. This ability can
be exploited for the delivery of agents as disclosed herein to
cells. Exemplary but non-limiting CPP include HIV-1 Tat-derived CPP
(see, e.g., Frankel et al. 1988 (Science 240: 70-73)); Antennapedia
peptides or penetratins (see, e.g., Derossi et al. 1994 (J Biol
Chem 269: 10444-10450)); peptides derived from HSV-1 VP22 (see,
e.g., Aints et al. 2001 (Gene Ther 8: 1051-1056)); transportans
(see, e.g., Pooga et al. 1998 (FASEB J 12: 67-77)); protegrin 1
(PG-1) anti-microbial peptide SynB (Kokryakov et al. 1993 (FEBS
Lett 327: 231-236)); model amphipathic (MAP) peptides (see, e.g.,
Oehlke et al. 1998 (Biochim Biophys Acta 1414: 127-139)); signal
sequence-based cell-penetrating peptides (NLS) (see, e.g., Lin et
al. 1995 (J Biol Chem 270: 14255-14258)); hydrophobic membrane
translocating sequence (MTS) peptides (see, e.g., Lin et al. 1995,
supra); and polyarginine, oligoarginine and arginine-rich peptides
(see, e.g., Futaki et al. 2001 (J Biol Chem 276: 5836-5840)). The
carrier peptides that have been derived from these proteins show
little sequence homology with each other, but are all highly
cationic and arginine or lysine rich.
[0224] CPP can be of any length. For example CPP may be less than
or equal to 500, 250, 150, 100, 50, 25, 10 or 6 amino acids in
length. For example CPP may be greater than or equal to 4, 5, 6,
10, 25, 50, 100, 150 or 250 amino acids in length. Preferably, a
CPP may be between 4 and 25 amino acids in length. The suitable
length and design of the CPP will be easily determined by those
skilled in the art. As a general reference on CPPs can serve inter
alia "Cell penetrating peptides: processes and applications" (ed.
Ulo Langel, 1st ed., CRC Press 2002); Advanced Drug Delivery
Reviews 57: 489-660 (2005); Dietz & Bahr 2004 (Moll Cell
Neurosci 27: 85-131)).
[0225] An agent as disclosed herein may be conjugated with a CPP
directly or indirectly, e.g., by means of a suitable linker, such
as without limitation a PEG-based linker "RNA interference" or
"RNAi" technology is known in the art, and refers generally to the
process and means of sequence-specific post-transcriptional gene
silencing mediated particularly by short interfering nucleic acids
(siNA). For teaching on RNAi molecules and design thereof, see
inter alia Elbashir et al. 2001 (Nature 411: 494-501), Reynolds et
al. 2004 (Nat Biotechnol 22: 326-30),
http://rnaidesigner.invitrogen.com/rnaiexpress, Wang & Mu 2004
(Bioinformatics 20: 1818-20), Yuan et al. 2004 (Nucleic Acids Res
32(Web Server issue): W130-4), by M Sohail 2004 ("Gene Silencing by
RNA Interference: Technology and Application", 1'' ed., CRC, ISBN
0849321417), U Schepers 2005 ("RNA Interference in Practice:
Principles, Basics, and Methods for Gene Silencing in C. elegans,
Drosophila, and Mammals", 1.sup.st ed., Wiley-VCH, ISBN
3527310207), and D R Engelke & J J Rossi 2005 ("Methods in
Enzymology, Volume 392: RNA Interference", 1.sup.st ed., Academic
Press, ISBN 0121827976).
[0226] An RNAi agent typically comprises, consists essentially of
or consists of a double-stranded portion or region (notwithstanding
the optional and potentially preferred presence of single-stranded
overhangs) of annealed complementary strands, one of which has a
sequence corresponding to a target nucleotide sequence (hence, to
at least a portion of an mRNA) of the target gene to be
down-regulated. The other strand of the RNAi agent is complementary
to said target nucleotide sequence.
[0227] Whereas the sequence of an RNAi agent need not be completely
identical to a target sequence to be down-regulated, the number of
mismatches between a target sequence and a nucleotide sequence of
the RNAi agent is preferably no more than 1 in 5 bases, or 1 in 10
bases, or 1 in 20 bases, or 1 in 50 bases.
[0228] Preferably, to ensure specificity of RNAi agents towards the
desired DUX4 and/or DUX4c targets over unrelated molecules, such as
over other DUX genes, the sequence of said RNAi agents may be at
least about 80% identical, preferably at least about 90% identical,
more preferably at least about 95% identical, such as, e.g., about
96%, about 97%, about 98%, about 99% and up to 100% identical to
the respective target DUX4 and/or DUX4c sequence.
[0229] An RNAi agent may be formed by separate sense and antisense
strands or, alternatively, by a common strand providing for
fold-back stem-loop or hairpin design where the two annealed
strands of an RNAi agent are covalently linked.
[0230] An siRNA molecule may be typically produced, e.g.,
synthesised, as a double stranded molecule of separate,
substantially complementary strands, wherein each strand is about
18 to about 35 bases long, preferably about 19 to about 30 bases,
more preferably about 20 to about 25 bases and even more preferably
about 21 to about 23 bases.
[0231] shRNA is in the form of a hairpin structure. shRNA can be
synthesized exogenously or can be formed by transcribing from RNA
polymerase III promoters in vivo. Preferably, shRNAs can be
engineered in host cells or organisms to ensure continuous and
stable suppression of a desired gene. It is known that siRNA can be
produced by processing a hairpin RNA in cells.
[0232] RNAi agents as intended herein may include any modifications
as set out herein for nucleic acids and oligonucleotides, in order
to improve their therapeutic properties.
[0233] In embodiments, at least one strand of an RNAi molecules may
have a 3' overhang from about 1 to about 6 bases in length, e.g.,
from 2 to 4 bases, more preferably from 1 to 3 bases. For example,
one strand may have a 3' overhang and the other strand may be
either blunt-ended or may also have a 3'overhang. The length of the
overhangs may be the same or different for each strand. The 3'
overhangs can be stabilised against degradation. For example, the
RNA may be stabilised by including purine nucleotides, such as A or
G nucleotides. Alternatively, substitution of pyrimidine
nucleotides by modified analogues, e.g., substitution of U 3'
overhangs by 2'-deoxythymidine is tolerated and does not affect the
efficiency of RNAi.
[0234] An exemplary but non-limiting siRNA molecule may by
characterized by any one or more, and preferably by all of the
following criteria: [0235] at least about 80% sequence identity,
more preferably at least about 90% or at least about 95% or at
least about 97% sequence identity to target mRNA, e.g., DUX4 and/or
DUX4c mRNA; [0236] having a sequence which targets an area of the
target gene present in mature mRNA (e.g., an exon or alternatively
spliced intron); [0237] showing a preference for targeting the 3'
end of the target gene.
[0238] The exemplary siRNA may be further characterised by one or
more or all of the following criteria: [0239] having a
double-stranded nucleic acid length of between 16 to 30 bases and
preferably of between 18 to 23 bases, and preferably of 19
nucleotides; [0240] having GC content between about 30 and about
50% [0241] having a TT(T) sequence at 3' end; [0242] showing no
secondary structure when adopting the duplex form; [0243] having a
Tm (melting temperature) of lower than 20.degree. C. [0244] having
the nucleotides indicated here below in the sequence of the
nucleotides, wherein "h" is A, C, T/U but not G; wherein "d" is A,
G, T/U but not C, and wherein "w" is A or T/U, but not G or C:
TABLE-US-00007 [0244] -- -- 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
17 18 19 -- -- mRNA P'5 A A A U h w 3'-OH si-ASense OH-3' T T U A d
w 5'-P si-Sense P-5' A U h w T T 3'-OH
[0245] Production of agents intended herein, such as antisense
agents and RNAi agents, can be carried out by any processes known
in the art, such as inter alia partly or entirely by chemical
synthesis (e.g., routinely known solid phase synthesis; an
exemplary an non-limiting method for synthesising oligonucleotides
on a modified solid support is described in U.S. Pat. No.
4,458,066; in another example, diethyl-phosphoramidites are used as
starting materials and may be synthesised as described by Beaucage
et al. 1981 (Tetrahedron Letters 22: 1859-1862)), or partly or
entirely by biochemical (enzymatic) synthesis, e.g., by in vitro
transcription from a nucleic acid construct (template) using a
suitable polymerase such as a T7 or SP6 RNA polymerase, or by
recombinant nucleic acid techniques, e.g., expression from a vector
in a host cell or host organism. Nucleotide analogues can be
introduced by in vitro chemical or biochemical synthesis. In an
embodiment, the antisense agents of the invention are synthesised
in vitro and do not include antisense compositions of biological
origin, or genetic vector constructs designed to direct the in vivo
synthesis of antisense molecules.
[0246] The term "isolated" with reference to a particular component
(such as for instance a nucleic acid) generally denotes that such
component exists in separation from--for example, has been
separated from or prepared and/or maintained in separation
from--one or more other components of its natural environment. For
instance, an isolated human or animal nucleic acid may exist in
separation from a human or animal body where it naturally
occurs.
[0247] The term "isolated" as used herein may preferably also
encompass the qualifier "purified". By means of example, the term
"purified" with reference to a substance (e.g., an agent or a
nucleic acid) does not require absolute purity. Instead, it denotes
that such substances are in a discrete environment in which their
abundance (conveniently expressed in terms of mass or weight or
concentration) relative to other relevant substances is greater
than in a biological sample. A discrete environment denotes a
single medium, such as for example a single solution, gel,
precipitate, lyophilisate, etc. Purified substances may be obtained
by known methods including, for example, laboratory or recombinant
synthesis, chromatography, preparative electrophoresis,
centrifugation, precipitation, affinity purification, etc.
[0248] By means of example and not limitation, purified nucleic
acids (including NA-based or NA-comprising agents) may preferably
constitute by weight .gtoreq. about 10%, more preferably .gtoreq.
about 50%, such as .gtoreq. about 60%, yet more preferably .gtoreq.
about 70%, such as .gtoreq. about 80%, and still more preferably
.gtoreq. about 90%, such as .gtoreq. about 95%, .gtoreq. about 96%,
.gtoreq. about 97%, .gtoreq. about 98%, .gtoreq. about 99% or even
100%, of the nucleic acid content of the discrete environment. For
example, purity of a nucleic acid may be determined by measuring
absorbance A.sub.260/A.sub.280. Also, an isolated nucleic acid may
be purified to homogeneity as determined by agarose- or
polyacrylamide-gel electrophoresis and ethidium bromide or similar
staining
[0249] By "encoding" is particularly meant that a nucleic acid
sequence or part(s) thereof corresponds to another nucleic acid
sequence in a template--transcription product (e.g., RNA or RNA
analogue) relationship, or corresponds, by virtue of the genetic
code of an organism in question, to a particular amino acid
sequence, e.g., the amino acid sequence of one or more desired
proteins or polypeptides.
[0250] Preferably, a nucleic acid encoding one or more proteins or
polypeptides may comprise an open reading frame (ORF) encoding said
protein or polypeptide. An "open reading frame" or "ORF" refers to
a succession of coding nucleotide triplets (codons) starting with a
translation initiation codon and closing with a translation
termination codon known per se, and not containing any internal
in-frame translation termination codon, and potentially capable of
encoding a protein or polypeptide. Hence, the term may be
synonymous with "coding sequence" as used in the art.
[0251] Expression of transcription products or proteins and
polypeptides can be achieved through operably linking nucleic acid
sequences or ORFs encoding the intended transcription products or
proteins and polypeptides with regulatory sequences allowing for
expression of the nucleic acids or ORFs, e.g., in vitro, in a host
cell, host organ and/or host organism. Such expression may be
achieved, e.g., under suitable (culture) conditions or upon
addition of inducers (e.g., where inducible regulatory sequences
are used).
[0252] An "operable linkage" is a linkage in which regulatory
sequences and sequences sought to be expressed are connected in
such a way as to permit said expression. For example, sequences,
such as, e.g., a promoter and an ORF, may be said to be operably
linked if the nature of the linkage between said sequences does
not: (1) result in the introduction of a frame-shift mutation, (2)
interfere with the ability of the promoter to direct the
transcription of the ORF, (3) interfere with the ability of the ORF
to be transcribed from the promoter sequence.
[0253] The precise nature of regulatory sequences or elements
required for expression may vary between expression environments,
but may typically include a promoter and a transcription
terminator, and optionally an enhancer, as known per se.
[0254] The term "vector" generally refers to a nucleic acid
molecule, typically DNA, to which nucleic acid segments may be
inserted and cloned, i.e., propagated. Hence, a vector will
typically contain one or more unique restriction sites, and may be
capable of autonomous replication in a defined host or vehicle
organism such that the cloned sequence is reproducible. Vectors may
include, without limitation, plasmids, phagemids, bacteriophages,
bacteriophage-derived vectors, PAC, BAC, linear nucleic acids,
e.g., linear DNA, viral vectors, etc., as appropriate. Expression
vectors are generally configured to allow for and/or effect the
expression of nucleic acids or ORFs introduced thereto in a desired
expression system, e.g., in vitro, in a host cell, host organ
and/or host organism. For example, expression vectors may
advantageously comprise suitable regulatory sequences.
[0255] Preferred vectors for use herein are viral vectors, which
are well known and include vectors derived from for example, but
without limitation, retroviruses, vaccinia viruses, poxviruses,
adenoviruses, and adeno-associated viruses (AAV). Such viral
vectors may me be engineered by recombinant techniques as known per
se to introduce thereto nucleic acid sequence(s) encoding any one
of the antisense or RNAi agents disclosed herein.
[0256] For example, a retroviral vector may be used herein.
Generally, retroviral vectors may comprise the retroviral genomic
sequences encoding components necessary for the integration of the
recombinant viral genome (randomly) into the host cell genome and
the nucleic acid sequence(s) of interest, such as in particular the
nucleic acid sequence(s) encoding any one of the antisense or RNAi
agents disclosed herein. Such retroviral vectors may be readily
constructed using standard recombinant techniques (e.g., Sambrook
et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring
Harbor Laboratory Press, 1989) from a wide variety of retroviruses,
including for example, B, C, and D type retroviruses as well as
spumaviruses and lentiviruses (see RNA Tumor Viruses, Second
Edition, Cold Spring Harbor Laboratory, 1985).
[0257] Recombinant adenoviral vectors may also be contemplated for
delivery and expression of antisense or RNAi agents as disclosed
herein in a host cell. Adenovirus-based viral vectors have the
advantage of being capable of infecting non-dividing host cells,
but the recombinant viral genome is not integrated into the host
cell genome. For example, a suitable adenoviral vector, a method
for constructing a recombinant adenoviral vector thereof, and a
method for delivering the recombinant vector into host cells, are
described in Xia H et al. (2002) (Nat. Biotech. 20: 1006-1010). Use
of recombinant AAV (RAAV) vectors is also contemplated herein. RAAV
vectors can infect both dividing and non-dividing cells and may
incorporate its recombinant viral genome into that of the host
cell. RAAV vectors may be generated from a variety of
adeno-associated viruses, including for example, serotypes 1
through 6. Generally, RAAV vectors may comprise, in order, a 5'
adeno-associated virus inverted terminal repeat (ITR), a nucleic
acid of interest, such as in particular a nucleic acid sequence
encoding any one of the antisense or RNAi agents disclosed herein,
operatively linked to a sequence which regulates its expression in
a host cell or host organism, and a 3' adeno-associated virus ITR.
In addition, the rAAV vector may preferably have a polyadenylation
signal. Suitable RAAV vectors are described inter alia in WO
1994/13788, WO 1993/24641, and in Goyenvalle et al. 2004 (Science
306: 1796-1799) where antisense sequences are linked to a modified
U7 small nuclear RNA.
[0258] Other preferred viral vectors for use herein are vectors
derived from a pox virus such as a vaccinia virus, for example an
attenuated vaccinia virus such as Modified Virus Ankara (MVA) or
NYVAC, an avipox virus such as fowl pox virus or canary pox
virus.
[0259] The terms "host cell" and "host organism" may suitably refer
to cells or organisms encompassing both prokaryotes, such as
bacteria, and eukaryotes, such as yeast, fungi, protozoan, plants
and animals. Contemplated as host cells are inter alia unicellular
organisms, such as bacteria (e.g., E. coli, Salmonella
tymphimurium, Serratia marcescens, or Bacillus subtilis), yeast
(e.g., Saccharomyces cerevisiae or Pichia pastoris), (cultured)
plant cells (e.g., from Arabidopsis thaliana or Nicotiana tobaccum)
and (cultured) animal cells (e.g., vertebrate animal cells,
mammalian cells, primate cells, human cells or insect cells).
Contemplated as host organisms are inter alia multi-cellular
organisms, such as plants and animals, preferably animals, more
preferably warm-blooded animals, even more preferably vertebrate
animals, still more preferably mammals, yet more preferably
primates; particularly contemplated are such animals and animal
categories which are non-human.
[0260] The reference to antisense agents and RNAi agents as used
herein also encompasses any pharmaceutically acceptable salts,
esters, or salts of such esters, or any other compound which, upon
administration to an animal including a human, is capable of
providing (directly or indirectly) the biologically active
metabolite or residue thereof. Accordingly, for example, also
encompassed in the disclosure are pro-drugs and pharmaceutically
acceptable salts of the compounds of the invention,
pharmaceutically acceptable salts of such pro-drugs, and other
bio-equivalents.
[0261] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the agents
disclosed herein, wherein said salts retain the desired biological
activity of the parent agent and do not impart undesired
toxicological effects thereto. For oligonucleotides, preferred
examples of pharmaceutically acceptable salts include but are not
limited to (a) salts formed with cations such as sodium, potassium,
ammonium, magnesium, calcium, polyamines such as spermine and
spermidine, etc.; (b) acid addition salts formed with inorganic
acids, for example hydrochloric acid, hydrobromic acid, sulfuric
acid, phosphoric acid, nitric acid and the like; (c) salts formed
with organic acids such as, for example, acetic acid, oxalic acid,
tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic
acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic
acid, palmitic acid, alginic acid, polyglutamic acid,
naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic
acid, naphthalenedisulfonic acid, polygalacturonic acid, and the
like; and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0262] The various active substances of the present disclosure,
such as inter alia antisense agents, RNAi agents, vectors and cells
as taught herein or pharmaceutically acceptable derivatives
thereof, may be formulated into pharmaceutical compositions or
formulations with one or more pharmaceutically acceptable
carriers/excipients.
[0263] The term "pharmaceutically acceptable" as used herein is
consistent with the art and means compatible with the other
ingredients of a pharmaceutical composition and not deleterious to
the recipient thereof.
[0264] As used herein, "carrier" or "excipient" includes any and
all solvents, diluents, buffers (such as, e.g., neutral buffered
saline, phosphate buffered saline, or optionally Tris-HCl, acetate
or phosphate buffers), solubilisers (such as, e.g., Tween 80,
Polysorbate 80), colloids, dispersion media, vehicles, fillers,
chelating agents (such as, e.g., EDTA or glutathione), amino acids
(such as, e.g., glycine), proteins, disintegrants, binders,
lubricants, wetting agents, emulsifiers, sweeteners, colorants,
flavourings, aromatisers, thickeners, agents for achieving a depot
effect, coatings, antifungal agents, preservatives (such as, e.g.,
Thimerosal.TM., benzyl alcohol), antioxidants (such as, e.g.,
ascorbic acid, sodium metabisulfite), tonicity controlling agents,
absorption delaying agents, adjuvants, bulking agents (such as,
e.g., lactose, mannitol) and the like. The use of such media and
agents for pharmaceutical active substances is well known in the
art. Except insofar as any conventional media or agent is
incompatible with the active substance, its use in the therapeutic
compositions may be contemplated. Suitable pharmaceutical carriers
are described inter alia in Remington's Pharmaceutical Sciences,
18th ed., Mack Publishing Co., Easton, Pa. (1990).
[0265] Illustrative, non-limiting carriers for use in formulating
the pharmaceutical compositions include, for example, oil-in-water
or water-in-oil emulsions, aqueous compositions with or without
inclusion of organic co-solvents suitable for intravenous (IV) use,
liposomes or surfactant-containing vesicles, particulate
preparations with polymeric compounds such as inter alia polylactic
acid or polyglycolic acid, microspheres, microbeads and microsomes,
powders, tablets, capsules, suppositories, aqueous suspensions,
aerosols, and other carriers apparent to one of ordinary skill in
the art.
[0266] Pharmaceutical carriers may comprise sterile liquids, such
as water and oils, including those of petroleum, animal, vegetable
or synthetic origin, such as peanut oil, soybean oil, mineral oil,
sesame oil and the like.
[0267] Pharmaceutical compositions of the invention may be
formulated for essentially any route of administration, such as
without limitation, oral administration (such as, e.g., oral
ingestion or inhalation), intranasal administration (such as, e.g.,
intranasal inhalation or intranasal mucosal application), pulmonary
(such as, e.g., by inhalation or insufflation of powders or
aerosols), parenteral administration (such as, e.g., subcutaneous,
intravenous, intra-arterial, intramuscular, intraperitoneal or
intrasternal injection or infusion, or intracranial, e.g.,
intrathecal or intraventricular administration), epidermal and
transdermal, or transmucosal (such as, e.g., oral, sublingual,
intranasal) administration, topical administration (including inter
alia ophthalmic administration), rectal, vaginal or intra-tracheal
instillation, and the like. In this way, the therapeutic effects
attainable by the methods and compositions of the invention can be,
for example, systemic, local, tissue-specific, etc., depending of
the specific needs of a given application of the invention.
Oligonucleotides with at least one 2'-O-methoxyethyl modification
are believed to be particularly useful for oral administration.
[0268] For example, for oral administration, pharmaceutical
compositions may be formulated in the form of pills, tablets,
lacquered tablets, coated (e.g., sugar-coated) tablets, granules,
hard and soft gelatin capsules, aqueous, alcoholic or oily
solutions, syrups, emulsions or suspensions. In an example, without
limitation, preparation of oral dosage forms may be is suitably
accomplished by uniformly and intimately blending together a
suitable amount of the active compound in the form of a powder,
optionally also including finely divided one or more solid carrier,
and formulating the blend in a pill, tablet or a capsule. Exemplary
but non-limiting solid carriers include calcium phosphate,
magnesium stearate, talc, sugars (such as, e.g., glucose, mannose,
lactose or sucrose), sugar alcohols (such as, e.g., mannitol),
dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, low
melting waxes and ion exchange resins. Compressed tablets
containing the pharmaceutical composition can be prepared by
uniformly and intimately mixing the active ingredient with a solid
carrier such as described above to provide a mixture having the
necessary compression properties, and then compacting the mixture
in a suitable machine to the shape and size desired. Moulded
tablets maybe made by moulding in a suitable machine, a mixture of
powdered compound moistened with an inert liquid diluent. Suitable
carriers for soft gelatin capsules and suppositories are, for
example, fats, waxes, semisolid and liquid polyols, natural or
hardened oils, etc.
[0269] For example, for oral or nasal aerosol or inhalation
administration, pharmaceutical compositions may be formulated with
illustrative carriers, such as, e.g., as in solution with saline,
polyethylene glycol or glycols, DPPC, methylcellulose, or in
mixture with powdered dispersing agents, further employing benzyl
alcohol or other suitable preservatives, absorption promoters to
enhance bioavailability, fluorocarbons, and/or other solubilising
or dispersing agents known in the art. Suitable pharmaceutical
formulations for administration in the form of aerosols or sprays
are, for example, solutions, suspensions or emulsions of the
compounds of the invention or their physiologically tolerable salts
in a pharmaceutically acceptable solvent, such as ethanol or water,
or a mixture of such solvents. If required, the formulation can
also additionally contain other pharmaceutical auxiliaries such as
surfactants, emulsifiers and stabilizers as well as a propellant.
Illustratively, delivery may be by use of a single-use delivery
device, a mist nebuliser, a breath-activated powder inhaler, an
aerosol metered-dose inhaler (MDI) or any other of the numerous
nebuliser delivery devices available in the art. Additionally, mist
tents or direct administration through endotracheal tubes may also
be used.
[0270] Examples of carriers for administration via mucosal surfaces
depend upon the particular route, e.g., oral, sublingual,
intranasal, etc. When administered orally, illustrative examples
include pharmaceutical grades of mannitol, starch, lactose,
magnesium stearate, sodium saccharide, cellulose, magnesium
carbonate and the like, with mannitol being preferred. When
administered intranasally, illustrative examples include
polyethylene glycol, phospholipids, glycols and glycolipids,
sucrose, and/or methylcellulose, powder suspensions with or without
bulking agents such as lactose and preservatives such as
benzalkonium chloride, EDTA. In a particularly illustrative
embodiment, the phospholipid 1,2
dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) is used as an
isotonic aqueous carrier at about 0.01-0.2% for intranasal
administration of the compound of the subject invention at a
concentration of about 0.1 to 3.0 mg/ml.
[0271] For example, for parenteral administration, pharmaceutical
compositions may be advantageously formulated as solutions,
suspensions or emulsions with suitable solvents, diluents,
solubilisers or emulsifiers, etc. Suitable solvents are, without
limitation, water, physiological saline solution or alcohols, e.g.
ethanol, propanol, glycerol, in addition also sugar solutions such
as glucose, invert sugar, sucrose or mannitol solutions, or
alternatively mixtures of the various solvents mentioned. The
injectable solutions or suspensions may be formulated according to
known art, using suitable non-toxic, parenterally-acceptable
diluents or solvents, such as mannitol, 1,3-butanediol, water,
Ringer's solution or isotonic sodium chloride solution, or suitable
dispersing or wetting and suspending agents, such as sterile,
bland, fixed oils, including synthetic mono- or diglycerides, and
fatty acids, including oleic acid. The compounds and
pharmaceutically acceptable salts thereof of the invention can also
be lyophilised and the lyophilisates obtained used, for example,
for the production of injection or infusion preparations. For
example, one illustrative example of a carrier for intravenous use
includes a mixture of 10% USP ethanol, 40% USP propylene glycol or
polyethylene glycol 600 and the balance USP Water for Injection
(WFI). Other illustrative carriers for intravenous use include 10%
USP ethanol and USP WFI; 0.01-0.1% triethanolamine in USP WFI; or
0.01-0.2% dipalmitoyl diphosphatidylcholine in USP WFI; and 1-10%
squalene or parenteral vegetable oil-in-water emulsion. Water or
saline solutions and aqueous dextrose and glycerol solutions may be
preferably employed as carriers, particularly for injectable
solutions. Illustrative examples of carriers for subcutaneous or
intramuscular use include phosphate buffered saline (PBS) solution,
5% dextrose in WFI and 0.01-0.1% triethanolamine in 5% dextrose or
0.9% sodium chloride in USP WFI, or a 1 to 2 or 1 to 4 mixture of
10% USP ethanol, 40% propylene glycol and the balance an acceptable
isotonic solution such as 5% dextrose or 0.9% sodium chloride; or
0.01-0.2% dipalmitoyl diphosphatidylcholine in USP WFI and 1 to 10%
squalene or parenteral vegetable oil-in-water emulsions.
[0272] Where aqueous formulations are preferred, such may comprise
one or more surfactants. For example, the composition can be in the
form of a micellar dispersion comprising at least one suitable
surfactant, e.g., a phospholipid surfactant. Illustrative examples
of phospholipids include diacyl phosphatidyl glycerols, such as
dimyristoyl phosphatidyl glycerol (DPMG), dipalmitoyl phosphatidyl
glycerol (DPPG), and distearoyl phosphatidyl glycerol (DSPG),
diacyl phosphatidyl cholines, such as dimyristoyl
phosphatidylcholine (DPMC), dipalmitoyl phosphatidylcholine (DPPC),
and distearoyl phosphatidylcholine (DSPC); diacyl phosphatidic
acids, such as dimyristoyl phosphatidic acid (DPMA), dipahnitoyl
phosphatidic acid (DPPA), and distearoyl phosphatidic acid (DSPA);
and diacyl phosphatidyl ethanolamines such as dimyristoyl
phosphatidyl ethanolamine (DPME), dipalmitoyl phosphatidyl
ethanolamine (DPPE) and distearoyl phosphatidyl ethanolamine
(DSPE). Typically, a surfactant:active substance molar ratio in an
aqueous formulation will be from about 10:1 to about 1:10, more
typically from about 5:1 to about 1:5, however any effective amount
of surfactant may be used in an aqueous formulation to best suit
the specific objectives of interest.
[0273] When rectally administered in the form of suppositories,
these formulations may be prepared by mixing the compounds
according to the invention with a suitable non-irritating
excipient, such as cocoa butter, synthetic glyceride esters or
polyethylene glycols, which are solid at ordinary temperatures, but
liquidify and/or dissolve in the rectal cavity to release the
drug.
[0274] Suitable carriers for microcapsules, implants or rods are,
for example, copolymers of glycolic acid and lactic acid.
[0275] One skilled in this art will recognize that the above
description is illustrative rather than exhaustive. Indeed, many
additional formulations techniques and pharmaceutically-acceptable
excipients and carrier solutions are well-known to those skilled in
the art, as is the development of suitable dosing and treatment
regimens for using the particular compositions described herein in
a variety of treatment regimens.
[0276] Further, there are several well-known methods of introducing
nucleic acids (e.g., antisense and RNAi agents) into animal cells,
any of which may be used herein. At the simplest, the nucleic acid
can be directly injected into the target cell/target tissue. Other
methods include fusion of the recipient cell with bacterial
protoplasts containing the nucleic acid, the use of compositions
like calcium chloride, rubidium chloride, lithium chloride, calcium
phosphate, DEAE dextran, cationic lipids or liposomes or methods
like receptor-mediated endocytosis, biolistic particle bombardment
("gene gun" method), infection with viral vectors, for example such
as taught herein, electroporation, and the like. Other techniques
or methods which are suitable for delivering nucleic acid molecules
to target cells include the continuous delivery of an NA molecule
from poly (lactic-Co-Glycolic Acid) polymeric microspheres or the
direct injection of protected (stabilized) NA molecule(s) into
micropumps delivering the product. Another possibility is the use
of implantable drug-releasing biodegradable micropsheres. Also
envisaged is encapsulation of NA in various types of liposomes
(immunoliposomes, PEGylated (immuno) liposomes), cationic lipids
and polymers, nanoparticules or dendrimers, poly
(lactic-Co-Glycolic Acid) polymeric microspheres, implantable
drug-releasing biodegradable microspheres, etc; and co-injection of
NA with protective agent like the nuclease inhibitor
aurintricarboxylic acid. It shall be clear that also a combination
of different above-mentioned delivery modes or methods may be
used.
[0277] A preferred method of intracellular delivery of the
antisense agents and RNAi agents disclosed herein may include
infection with viral vectors as taught herein. In such method, a
recombinant viral vector as taught herein, is brought in contact
with a host cell, such as introduced (e.g., locally or
systemically) to a host organism, and incubated at conditions
favourable to viral infection and hence, makes use of the natural
ability of a virus to infect a cell. For example, a retrovirus
obtains entry to a host cell via the interaction of a retroviral
protein with a transmembrane protein acting as a receptor on the
surface of the host cell. Another approach of viral vector-mediated
delivery of antisense and RNAi agents as disclosed herein may
encompass a physical cell entry-based technique, such as for
example the use of ultrasound and microbubbles, in combination with
viral vector-mediated delivery as described in WO 2006/129080.
[0278] Further ways of delivery of nucleic acids such as antisense
agents and RNAi agents may employ previously published methods. For
example, intracellular delivery of the nucleic acids may be via a
composition comprising an admixture of the nucleic acid molecule
and an effective amount of a block copolymer. An example of this
method is described in US 2004/0248833.
[0279] Other methods of delivery of nucleic acids to the nucleus
are described in Mann et al. 2001 (Proc Natl Acad Science 98(1):
42-47) and in Gebski et al. 2003 (Human Molecular Genetics 12(15):
1801-1811).
[0280] A method for introducing a nucleic acid molecule into a cell
by way of an expression vector either as naked DNA or complexed to
lipid carriers, is described in U.S. Pat. No. 6,806,084.
[0281] It may be desirable to deliver a nucleic acid molecule in a
colloidal dispersion system. Colloidal dispersion systems include
macromolecule complexes, nanocapsules, microspheres, beads, and
lipid-based systems including oil-in-water emulsions, micelles,
mixed micelles, and liposomes or liposome formulations. Liposomes
are artificial membrane vesicles which are useful as delivery
vehicles in vitro and in vivo. These formulations may have net
cationic, anionic or neutral charge characteristics and are useful
characteristics with in vitro, in vivo and ex vivo delivery
methods. It has been shown that large unilamellar vesicles (LUV),
which range in size from 0.2-4.0 PHI.m can encapsulate a
substantial percentage of an aqueous buffer containing large
macromolecules. RNA, and DNA can be encapsulated within the aqueous
interior and be delivered to cells in a biologically active form
(Fraley et al. 1981 (Trends Biochem ScL 6: 77).
[0282] In order for a liposome to be an efficient gene transfer
vehicle, the following characteristics should be present: (1)
encapsulation of the nucleic acid molecule of interest at high
efficiency while not compromising their biological activity; (2)
preferential and substantial binding to a target cell in comparison
to non-target cells; (3) delivery of the aqueous contents of the
vesicle to the target cell cytoplasm at high efficiency; and (4)
accurate and effective expression of genetic information (Mannino
et al. 1988 (Biotechniques 6: 682).
[0283] The composition of the liposome is usually a combination of
phospholipids, particularly high-phase-transition-temperature
phospholipids, usually in combination with steroids, especially
cholesterol. Other phospholipids or other lipids may also be used.
The physical characteristics of liposomes depend on pH, ionic
strength, and the presence of divalent cations.
[0284] Alternatively, the nucleic acid molecule may be combined
with other pharmaceutically acceptable carriers or diluents to
produce a pharmaceutical composition. Suitable carriers and
diluents include isotonic saline solutions, for example
phosphate-buffered saline. The composition may be formulated for
parenteral, intramuscular, intravenous, subcutaneous, intraocular,
oral or transdermal administration.
[0285] The routes of administration described are intended only as
a guide since a skilled practitioner will be able to determine
readily the optimum route of administration and any dosage for any
particular animal and condition. Multiple approaches for
introducing functional new genetic material into cells, both in
vitro and in vivo have been attempted (Friedmann 1989 (Science 244:
1275-1280)). These approaches include integration of the gene to be
expressed into modified retroviruses (Friedmann 1989, supra;
Rosenberg 1991(Cancer Research 51(18), suppl.: 5074S-5079S));
integration into non-retrovirus vectors (Rosenfeld et al. 1992
(Cell 68: 143-155); Rosenfeld et al. 1991 (Science 252: 431-434));
or delivery of a transgene linked to a heterologous
promoter-enhancer element via liposomes (Friedmann 1989, supra;
Brigham et al. 1989 (Am J Med Sci 298: 278-281); Nabel et al. 1990
(Science 249: 1285-1288); Hazinski et al. 1991 (Am J Resp Cell
Molec Biol 4: 206-209); and Wang and Huang 1987 (Proc Natl Acad Sci
USA,84: 7851-7855)); coupled to ligand-specific, cation-based
transport systems (Wu and Wu 1988 (J Biol Chem 263: 14621-14624))
or the use of naked DNA, expression vectors (Nabel et al. 1990,
supra); Wolff et al. 1990 (Science 247: 1465-1468)). Direct
injection of transgenes into tissue produces only localized
expression (Rosenfeld 1992, supra; Rosenfeld et al. 1991, supra;
Brigham et al. 1989, supra; Nabel 1990, supra; and Hazinski et al.
1991, supra). The Brigham et al. group (Am J Med Sci 298: 278-281
(1989) and Clinical Research 39 (abstract) (1991)) have reported in
vivo transfection only of lungs of mice following either
intravenous or intratracheal administration of a DNA liposome
complex. An example of a review article of human gene therapy
procedures is: Anderson 1992 (Science 256: 808-813).
[0286] The pharmaceutical formulations as disclosed herein, which
may conveniently be presented in unit dosage form, may be prepared
according to conventional techniques well known in the
pharmaceutical industry. Such techniques may generally include the
step of bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0287] The present active substances may be used alone or in
combination with any other pharmaceutically or biologically active
ingredient, particularly which is suitable for the treatment of
diseases as taught herein ("combination therapy"). Combination
therapies as contemplated herein may comprise the administration of
at least one active substance of the present invention and at least
one other pharmaceutically or biologically active ingredient. Said
present active substance(s) and said pharmaceutically or
biologically active ingredient(s) may be administered in either the
same or different pharmaceutical formulation(s), simultaneously or
sequentially in any order.
[0288] The dosage or amount of the present active substances used,
optionally in combination with one or more other active compound to
be administered, depends on the individual case and is, as is
customary, to be adapted to the individual circumstances to achieve
an optimum effect. Thus, it depends on the nature and the severity
of the disorder to be treated, and also on the sex, age, body
weight, general health, diet, mode and time of administration, and
individual responsiveness of the human or animal to be treated, on
the route of administration, efficacy, metabolic stability and
duration of action of the compounds used, on whether the therapy is
acute or chronic or prophylactic, or on whether other active
compounds are administered in addition to the agent(s) of the
invention.
[0289] Without limitation, depending on the type and severity of
the disease, a typical daily dosage might range from about 1
.mu.g/kg to 100 mg/kg of body weight or more, depending on the
factors mentioned above. For repeated administrations over several
days or longer, depending on the condition, the treatment is
sustained until a desired suppression of disease symptoms occurs. A
preferred dosage of the active substance of the invention may be in
the range from about 0.05 mg/kg to about 10 mg/kg of body weight.
Thus, one or more doses of about 0.5 mg/kg, 2.0 mg/kg, 4.0 mg/kg or
10 mg/kg (or any combination thereof) may be administered to the
patient. Such doses may be administered intermittently, e.g., every
week or every two or three weeks.
[0290] In an embodiment, a pharmaceutical composition may comprise
between about 10 nM and about 1 .mu.M, preferably between about 20
nM and about 600 nM, such as, e.g., about 100 nM or about 200 nM,
or about 300 nM, or about 400 nM or about 500 nM of antisense agent
or RNAi agent as taught herein.
[0291] Except when noted, "subject" or "patient" are used
interchangeably and refer to animals, preferably warm-blooded
animals, more preferably vertebrates, even more preferably mammals,
still more preferably primates, and specifically includes human
patients and non-human mammals and primates. Preferred patients are
human subjects.
[0292] As used herein, a phrase such as "a subject in need of
treatment" includes subjects that would benefit from treatment of a
given condition, particularly of facioscapulohumeral muscular
dystrophy (FSHD) or a tumour, such as preferably a sarcoma, such as
more preferably a sarcoma selected from Ewing's family tumours,
paediatric undifferentiated soft tissue sarcomas and
rhabdomyosarcomas. Such subjects may include, without limitation,
those that have been diagnosed with said condition, those prone to
contract or develop said condition and/or those in whom said
condition is to be prevented.
[0293] The terms "treat" or "treatment" encompass both the
therapeutic treatment of an already developed disease or condition,
such as the therapy of an already developed FSHD or tumour, such as
preferably a sarcoma, such as more preferably a sarcoma selected
from Ewing's family tumours, paediatric undifferentiated soft
tissue sarcomas and rhabdomyosarcomas, as well as prophylactic or
preventative measures, wherein the aim is to prevent or lessen the
chances of incidence of an undesired affliction, such as to prevent
the chances of contraction and progression of FSHD or a tumour,
such as preferably a sarcoma, such as more preferably a sarcoma
selected from Ewing's family tumours, paediatric undifferentiated
soft tissue sarcomas and rhabdomyosarcomas. Beneficial or desired
clinical results may include, without limitation, alleviation of
one or more symptoms or one or more biological markers,
diminishment of extent of disease, stabilised (i.e., not worsening)
state of disease, delay or slowing of disease progression,
amelioration or palliation of the disease state, and the like.
"Treatment" can also mean prolonging survival as compared to
expected survival if not receiving treatment.
[0294] The term "prophylactically effective amount" refers to an
amount of an active compound or pharmaceutical agent that inhibits
or delays in a subject the onset of a disorder as being sought by a
researcher, veterinarian, medical doctor or other clinician. The
term "therapeutically effective amount" as used herein, refers to
an amount of active compound or pharmaceutical agent that elicits
the biological or medicinal response in a subject that is being
sought by a researcher, veterinarian, medical doctor or other
clinician, which may include inter alia alleviation of the symptoms
of the disease or condition being treated. Methods are known in the
art for determining therapeutically and prophylactically effective
doses for the present compounds.
[0295] Reference to "diseases or conditions comprising increased
levels and/or increased activity of double homeobox 4 and/or double
homeobox 4c" generally covers diseases and conditions in which the
level and/or activity of DUX4 and/or DUX4c is increased by any
(measurable) extent compared to a reference non-disease state, such
as without limitation is increased by at least about 10%, e.g., by
at least about 20%, preferably by at least about 30%, e.g., by at
least about 40%, more preferably by at least about 50%, e.g., by at
least about 75%, even more preferably by at least about 100%, e.g.,
by at least about 150%, 200%, 250%, 300%, 400% or by at least about
500%, compared to a reference non-disease state. The term also
covers situations in which a reference non-disease state comprises
no demonstrable level and/or activity of DUX4 and/or DUX4c whereas
a disease state comprises some demonstrable level and/or activity
of DUX4 and/or DUX4c. The level and/or activity of DUX4 and/or
DUX4c may be increased in any cells, tissues and/or organs of a
patient, preferably in cells, tissues and/or organs relevant to or
affected in a disease or condition. For example, the level and/or
activity of DUX4 and/or DUX4c may be increased in muscle cells and
muscle tissues, such as, e.g., in myoblasts and/or in myocytes, in
smooth muscles and/or in striated muscles such as in skeletal and
or cardiac muscles, etc.
[0296] The level of DUX4 and/or DUX4c may be measured at any one or
more stages, such as at the stage of pre-mRNA or mRNA (e.g., by
qualitative or quantitative RT-PCR) and/or protein (e.g.,
immunoassay methods). The activity of DUX4 and/or DUX4c protein may
be measured by any suitable biochemical or cellular assays, e.g.,
measuring its trans-activation potential on known targets.
[0297] Facioscapulohumeral muscular dystrophy (FSHD, FSHMD or FSH)
also known as Landouzy-Dejerine muscular dystrophy encompasses all
diseases and condition known under these designations in the art.
More particularly, FSHD as intended herein is an autosomal dominant
muscle disorder genetically linked to contractions of the D4Z4
repeat array on the 4q35 subtelomeric region, more particularly
where FSHD patients have between 1 and 10 D4Z4 copies, such as
e.g., 2, 3, 4, 5, 6, 7, 8 or 9 copies. Also particularly, FSHD may
be linked to the 4qA allele, even more particularly to the
permissive alleles 4A161, 4A161L, 4A159 or 4A168.
[0298] Moreover, although a small group of patients with a typical
FSHD phenotype presents more than 10 copies of the D4Z4 element,
these patients show sub-normal DNA methylation level at the repeat,
similar to that found in contracted D4Z4 arrays. Consequently, FSHD
can be generally concluded when DNA hypomethylation is observed at
the D4Z4 repeat, irrespective of the number of D4Z4 units.
[0299] Diseases or conditions the treatment of which can benefit
from reducing the expression of double homeobox 4 and/or double
homeobox 4c also specifically encompass those which comprise
expression of DUX4 and/or DUX4c fragments or variants, more
particularly expression of fusion proteins between DUX4 or DUX4c
(preferably DUX4) and other, unrelated proteins, more preferably,
such fusion proteins comprising the C-terminal fragment of DUX4 or
DUX4c (preferably DUX4), even more preferably such fusion proteins
with CIC, a human homolog of Drosophila capicua, or with EWSR1.
Said fusion proteins are commonly expressed as a result of
chromosomal rearrangements and favour cell proliferation and hence,
may cause tumours, such as in particular Ewing's family tumours
(EFTs) (Kawamura-Saito et al. 2006, supra) and paediatric
undifferentiated soft tissue sarcomas (Yoshimoto et al. 2009,
supra) and rhabdomyosarcomas (Sirvent et al. 2009, supra),
respectively. Since said fusion mRNAs include the sequence elements
of the DUX4 or DUX4c genes (preferably the DUX4 gene) that are
targeted by the antisense agents and/or RNAi agents as described
herein, these tools may reduce the expression of said fusion
proteins similarly as they reduce the expression of the full length
DUX4 or DUX4c protein. Hence, diseases and conditions intended
herein also include tumours, more particularly sarcomas, even more
particularly the aforementioned tumour types. As used herein, the
term "tumour" refers to an abnormal mass of tissue that results
from excessive cell division. A tumour comprises "tumour cells"
which are neoplastic cells with abnormal growth properties and may
also comprise "tumour-associated non-tumour cells", e.g., vascular
cells which form blood vessels to supply the tumour. A tumour may
be benign or malignant. The term "sarcoma" encompasses tumour types
involving connective tissue cells, such as for example but without
limitation bone, cartilage, fat cells, muscles and blood
vessels.
[0300] It is apparent that there have been provided in accordance
with the invention products, methods and uses that provide for
substantial advantages as set forth above. While the invention has
been described in conjunction with specific embodiments thereof, it
is evident that many alternatives, modifications, and variations
will be apparent to those skilled in the art in light of the
foregoing description. Accordingly, it is intended to embrace all
such alternatives, modifications, and variations as follows in the
spirit and broad scope of the appended claims.
[0301] The above aspects and embodiments are further supported by
the following non-limiting examples.
EXAMPLES
Example 1: Antisense Oligonucleotides Directed Against Sequence
Elements Involved in Splicing of DUX4 Pre-mRNA are Highly Effective
in Down-Regulating Double Homeobox 4 Expression
[0302] Antisense oligomers (AO) were designed based on the sequence
of the DUX4 gene 3' UTR (FIG. 1). The 7 AO include one (JSR 1521
pLAM2A) directed against positions -7+18 of DUX4 intron 1-exon 2
boundary (incl. intron 1 splice acceptor site), and six AO directed
against DUX4 intron 2-exon 3 boundary (incl. intron 2 splice
acceptor site), denoted JSR 1522 pLam3A(-7+18), JSR1523 pLAM3A
(-12+13), JSR1524 pLAM3A (-2+23), JSR1696 pLAM3A (-7+18), JSR1719
pLAM3A (-12+18) and JSR1720 pLAM3A (-17+13). An AO targeting
dystrophin was used as negative control.
[0303] Anti-DUX4 AO:
TABLE-US-00008 JSR 1521 pLAM2A (-7 + 18): (SEQ ID NO: 16)
CUCUCACCGGGCCUAGACCUAGAAG JSR 1522 pLam3A (-7 + 18): (SEQ ID NO:
17) UGCGCACUGCGCGCAGGUCUAGCCA JSR1523 pLAM3A (-12 + 13): (SEQ ID
NO: 18) ACUGCGCGCAGGUCUAGCCAGGAAG JSR1524 pLAM3A (-2 + 23): (SEQ ID
NO: 19) CGGGGUGCGCACUGCGCGCAGGUCU JSR1696 pLAM3A (-7 + 18): (SEQ ID
NO: 17) UGCGCACUGCGCGCAGGUCUAGCCA JSR1719 pLAM3A (-12 + 18): (SEQ
ID NO: 20) UGCGCACUGCGCGCAGGUCUAGCCAGGAAG JSR1720 pLAM3A (-17 +
13): (SEQ ID NO: 21) ACUGCGCGCAGGUCUAGCCAGGAAGCGGGC
[0304] AO Targeting Dystrophin (Negative Controls)
TABLE-US-00009 JSR 1662 mGMCSF3A (-05 + 20):
UCCCACAGAAGCUAACAUGUGUGCAGAC
[0305] All AO used in this example had 2'-O-methyl-phosphorothioate
backbone. AO having phosphorodiamidate morpholino backbone are used
with at least comparable or superior results. AO conjugated to a
cell penetrating peptide (CPP) are used with at least comparable or
superior results.
[0306] Testing C2C12 Mouse Myoblasts Transiently Expressing
Dux4
[0307] The efficacy of antisense oligonucleotides (AO) against the
DUX4 pre-mRNA was evaluated in transient expression in C2C12 mouse
myoblasts grown in vitro. These cells were transfected with the
pCIneo-DUX4 expression vector that contains the DUX4 coding region
of the last D4Z4 element and the flanking pLAM region under the
strong CMV promoter.
[0308] 10.sup.5 C2C12 mouse myoblasts were seeded per well of
6-well dishes and grown at 37.degree. C. and 5% CO.sub.2 in DMEM,
10% foetal bovine serum gold (PAA), 1% antibiotics (penicillin,
streptomycin, fungizon). They were transfected 24 hours later with
500 ng per well of expression vector pCIneo-DUX4 alone or combined
with the indicated AO. The negative control is AO 1662 that targets
the dystrophin mRNA. The transfection reagent was
Lipofectamine.RTM. 2000 (Invitrogen) used at a ratio of 1 .mu.g
AO/1 .mu.l reagent, and 600 nM AO concentration. The cells were
lysed 24 hours after transfection, and total protein extracts were
prepared in NuPAGE.RTM. LDS sample buffer (Invitrogen). 15 .mu.g of
protein extracts were separated by electrophoresis (SDS-PAGE 12%),
and transferred to a nitrocellulose membrane. DUX4 (52 kDa) was
detected on this Western blot with the 9A12 monoclonal antibody
followed by anti-mouse IgG antibodies coupled to peroxidase (HRP),
and revealed with Lumi-Light kit (Roche) detected on a film. After
striping these antibodies, the same membrane was incubated with an
anti-actin antibody to provide a loading control. The mouse
monoclonal antibody (MAb 9A12) was raised as described in Dixit et
al. 2007 (supra) directed against the carboxyl terminal part of
DUX4. Whereas this antibody cross reacts with DUX4c, the two
proteins can be readily distinguished in Western blot based on
their different apparent molecular weights, i.e., 52 kDa for DUX4
and 47 kDa for DUX4c.
[0309] The results are shown in FIG. 9. No DUX4 protein (arrow)
could be detected by Western blot using the 9A12 monoclonal
antibody following the addition of different AO directed against
the DUX4 pre-mRNA. In contrast the DUX4 protein was clearly
expressed with the AO directed against the dystrophin pre-mRNA or
in the absence of AO.
[0310] Testing C2C12 Mouse Myoblasts Transiently Expressing Dux4 or
Dux4c
[0311] Another experiment demonstrates, using the above-explained
transient expression approach, that AO 1524 can achieve specific
downregulation of DUX4 expression without affecting DUX4c protein
expression (FIG. 10). C2C12 cells were transfected with either the
expression vector pCIneo-DUX4 or pCIneo-DUX4c, alone or with
different concentrations of AO 1524 targeting the DUX4 mRNA, or the
negative control AO 1662 (concentration of 600 nM). DUX4 and DUX4c
proteins were detected on a Western blot of cell protein extracts
as described above. In this experiment 100 nM AO (boxed in FIG. 10)
substantially suppressed DUX4 protein detection on the Western blot
but did not affect DUX4c levels, thereby demonstrating specificity
of the targeting by this AO.
[0312] Testing C2C12 Mouse Myoblasts Transiently Expressing Dux4
and Dux4c
[0313] Similar results have been obtained in a co-transfection
experiment in C2C12 cells using both DUX4 and DUX4c pCIneo
expression vectors, so that both mRNAs were present simultaneously
in the same cells. C2C12 cells were co-transfected with both
pCIneo-DUX4 and pCIneo-DUX4c expression vectors, with different
concentrations of AO 1524 targeting the DUX4 mRNA, or the negative
control AO 1662 (600 nM). The DUX4 and DUX4c proteins were detected
on a Western blot of cell protein extracts as described above. In
this experiment 150 nM AO (FIG. 11) substantially suppressed DUX4
protein detection on the Western blot but did not affect DUX4c
levels, thereby further corroborating specificity of the targeting
by this AO.
[0314] In analogous co-transfection studies using the other AO,
comparable specificity for DUX4 was also demonstrated for AO 1522
and 1523 (using 150 nM AO, see FIG. 12) and AO 1521 (using 50 nM
AO, not shown). Moreover, lower concentrations in this experiment
achieve comparable specificity for AO1719 and 1720.
[0315] Testing FSHD Primary Myoblasts Endogenously Expressing
DUX4
[0316] To test the efficacy of AOs 1521 pLAM2A(-7+18) and 1523
pLAM3A(-12+13) on endogenous DUX4 expression, primary FSHD
myoblasts were transfected with 50 nM 1521 pLAM2A(-7+18) or with
150 nM 1523 pLAM3A(-12+13) or with 600 nM of the negative control
AO (nc-AO; JSR 1662 mGMCSF3A (-5+20)). Differentiation was induced
4 hours after transfection and three days later myotubes were lysed
for total RNA extraction. Reverse transcription (RT) was performed
on 500 ng of DNase-treated myotube total RNA using the
FirstChoice.RTM.RLM-RACE kit (Ambion). 5 .mu.l of the resulting
cDNA were amplified by nested PCR with primers previously shown to
be specific of the DUX4 mRNA 3'UTR (Dixit et al. 2007. supra).
GAPDH mRNA amplification was used as an internal control. The
RT-PCR products were analysed by electrophoresis on a 1% agarose
gel. A densitometry of the bands was performed for quantification.
Data were normalized to GAPDH mRNA levels.
[0317] FIG. 29 shows that the expected 550 bp DNA fragment was
detected in FSHD myotubes treated with nc-AO and at a 30% and 50%
reduced intensity in cells treated with AOs 1521 pLAM2A(-7+18)
(FIG. 29a) or 1523 pLAM3A(-12+13) (FIG. 29b), respectively. This
amplicon was also observed in the positive control, i.e. C2C12
cells transfected with pGEM42, but not in the negative controls,
i.e. either C2C12 cells transfected with the empty pGEM vector, or
primary myoblasts from a healthy donor, or upon omission of reverse
transcriptase. The RT-PCR products were cloned and sequenced to
confirm DUX4 mRNA amplification (data not shown).
Example 2: siRNA (Small Interfering RNA) Directed Against 3'UTR
Region of DUX4 or DUX4c mRNA Achieve Specific Silencing of DUX4 or
DUX4c Expression
[0318] Anti-DUX4 siRNA agents were developed based on and
comprising the following DUX4 mRNA sequences:
TABLE-US-00010 (SEQ ID NO: 47) siRNA-DUX41: acaccuggcuggcuacgga
(SEQ ID NO: 48) siRNA-DUX42: ggucuaggcccggugagag (SEQ ID NO: 49)
siRNA-DUX43: ccuggauuagaguuacauc.
[0319] Anti-DUX4c siRNA agents were developed based on the
following DUX4c mRNA sequences:
TABLE-US-00011 (SEQ ID NO: 56) siRNA-DUX4c1: ccagaguuucagcaaaagg;
(SEQ ID NO: 57) siRNA-DUX4c2: ggagggcugucauucuuuc; (SEQ ID NO: 58)
siRNA-DUX4c3: gcguucuucagucgaguug.
[0320] Cells were transfected using the "Silencer siRNA Starter
Kit" (Ambion) containing the transfection agent SiPORT.TM.
NeoFX.TM. (Ambion). TE671 cells (cells derived from a human
alveolar rhabdomyosarcoma) were used for transfections, using the
"reverse" method recommended by the supplier, in which the
transfection reagent is introduced into the culture dish before
seeding the cells. This method was three times superior than the
traditional method in our hands. Transfection conditions were
optimised using control anti-GAPDH siRNA supplied with the above
kit. The optimised conditions included 2 .mu.l SiPORT.TM. NeoFX.TM.
reagent, 10 nM siRNA, and 5.times.10.sup.4 cells/ml cell
density.
[0321] Testing a TE671 Cell Line with an Inducible DUX4c
Transgene
[0322] The efficiency of siRNA directed against the DUX4c mRNA was
tested using stable TE671-DUX4c lines established previously. These
cells have incorporated the pAC1M2-DUX4c expression vector in which
DUX4c transcription is inducible by doxycycline (DOX).
[0323] The cells were first transfected using the above conditions,
which lead to only a weak DUX4c inhibition. Therefore the siRNA
concentration was increased to 20 nM that was not toxic to the
cells.
[0324] The cells were seeded at a density of 1.times.10.sup.5
cells/well of a 6 well culture dish and transfected with
siRNA-DUX4c1 20 nm ("si") by the reverse transfection method
(Ambion). 4 hours after transfection, the expression of DUX4c was
induced ("I") by adding 1 mg/ml of doxycycline in the culture
medium. The 3rd or 5th day after induction, the cells were lysed
and 20 .mu.g of protein extracts were analyzed by SDS-PAGE
electrophoresis (10%), and transferred to a nitrocellulose
membrane. The membrane was incubated with the anti-DUX4c rabbit
serum directed against a peptide in the carboxyterminal domain
followed by a secondary antibody coupled to peroxidase and revealed
with the kit LiteABlot.RTM. (Euroclone). DUX4c protein expression
(nuclear staining) was also analysed by immunohistochemistry in
TE-DUX4c cells transfected with siRNA-DUX4c1. The cells were
transfected and DUX4c expression was induced as explained above.
The 3rd or 5th day after induction, cells were fixed in PAF and
incubated with anti-DUX4c rabbit serum and secondary antibodies
coupled to a red dye (Alexa Fluor.RTM.). Pictures were taken under
a fluorescence microscope after selecting a field where many cells
were visible in white light.
[0325] After three days, a significant decrease of the DUX4c
protein amount could be observed in extracts from cells treated
with siRNA 1 compared to untreated cells as well by Western blot
(FIG. 13A) as by immunofluorescence (not shown). After five days,
DUX4c expression increased again in the transfected cells (FIG.
13A), which could be explained by a possible degradation or
dilution of the siRNA with time. Similar data has been obtained
using siRNA-DUX4c 2 ("si2") or 3 ("si3") compared to a negative
control siRNA ("SiCN") at 3rd day after induction of DUX4c
expression (FIG. 13B).
[0326] Testing a TE671 Cell Line Transiently Expressing DUX4c
[0327] To confirm the results obtained on stable TE671-DUX4c line,
we repeated the experiment on TE671 cells. We transfected cells
with the siRNA and four hours later with the pCIneo-DUX4c
expression vector which contains the strong cytomegalovirus
promoter/enhancer.
[0328] The cells were transfected with siRNA-DUX4c 20 nM ("si1",
"si2" and "si3") or negative control siRNA ("SiCN") using reverse
transfection (Ambion) and 4 hours later with the pCIneo-DUX4c
vector (DUX4c). The protein extracts were prepared and cells were
fixed the third day after transfection of the pCIneo-DUX4c vector.
The methodologies for the Western blot and immunofluorescence were
as set out above.
[0329] An inhibition of DUX4c expression similar to the previous
experiment was observed by Western blot (FIG. 14) and
immunofluorescence (not shown). We selected siRNA 1 as the most
effective.
[0330] Testing a TE671 Cell Line Transiently Expressing DUX4
[0331] Using similar methodology as in the previous section (except
that the gel is a SDS-PAGE 12%, the primary antibody is the
9A12monoclonal antibody), we first transfected TE671 cells using
the reverse transfection method with each of the three siRNA
against DUX4. Four hours later we transfected these cells with the
pCIneo-DUX4 expression vector. Three days after the second
transfection, the DUX4 expression had completely disappeared in
cells treated with siRNA as well on Western blot (FIG. 15) as in
immunofluorescence (not shown). We selected the siRNA 3 for further
studies as it targets a region particularly specific of DUX4.
[0332] Specificity of the Selected siRNAs
[0333] TE671 cells were transfected with siRNA-DUX4c ("siDUX4c") or
siRNA-DUX4 ("siDUX4") (20 nM) using reverse transfection and 4
hours later with the pCIneo-DUX4 ("DUX4") or pCIneo-DUX4c ("DUX4c")
expression vector. The protein extracts were prepared on the third
day after pCIneo vectors transfection and revealed by Western blot
with the 9A12 monoclonal antibody and secondary antibodies coupled
to HRP. The antibodies were then stripped, and the same membrane
developed with an anti-actin serum(internal control).
[0334] The siRNA specificity was confirmed by the disappearance, in
western blot, of bands corresponding to the molecular weight of
DUX4 or DUX4c following the addition of their respective siRNA and
not with the siRNA of their homologue (FIG. 16).
[0335] Construction of shRNA (Small Hairpin RNA) Vectors
[0336] To test the effect of siRNA on FSHD myotubes, we used
lentiviral vectors to produce shRNAs that are processed in the cell
to yield identical siRNAs to those that we selected (FIG. 17). It
has been previously demonstrated that myoblasts and myotubes could
be efficiently transduced by such vectors. For this, synthetic DNA
corresponding to the sequences of selected siRNA (sense sequence
+loop (CTCGAG) +antisense sequence) were inserted into an
expression vector containing the promoter of the histone H1 gene.
Hence, the transcription unit contains the following element: H1
promoter - - - CCGG(sense strand)loop(anti-sense strand)TTTTT - - -
. Transcription produces shRNA which is processed to siRNA by Dicer
(see FIG. 18). The H1-shRNA gene was sub-cloned in a pLVTH vector
containing all the necessary elements for encapsidation.
[0337] Prior to encapsidation, we have checked the efficiency of
pLVTH-shRNA vectors by Western blot on TE671 cells co-transfected
with these vectors and with pCIneo-DUX4 or DUX4c expression
vector.
[0338] FIG. 19 shows Western blot analysis of DUX4 protein
expression on extracts of TE671 cells transfected with the
pCIneo-DUX4 expression vector alone ("TE+DUX4") or with shRNA-DUX4
("TE DUX4+shDUX4") or shRNA-DUX4c ("TE DUX4+shDUX4c") (Fugene 6,
Roche Molecular Biochemical). 48 hours after transfection, proteins
were extracted and 20 .mu.g of these extracts were analyzed by
SDS-PAGE electrophoresis (12%), then transferred to a
nitrocellulose membrane. The membrane was incubated with 9A12 MAb
followed by a secondary antibody coupled to peroxidase and revealed
with the LiteABlot.RTM. kit (Euroclone). The antibodies were then
stripped, and the same membrane revealed with an anti-actin serum
(internal control). Immunofluorescence analysis of DUX4c protein
expression (nuclear staining) in TE671 cells transfected with the
pCIneo-DUX4c vector alone or with shRNA-DUX4 or shRNA-DUX4c was
performed (Fugene 6). 48 hours after transfection, cells were fixed
in 4% PAF and incubated with anti-DUX4c and a secondary antibody
coupled to a red dye (Alexa Fluor.RTM.) (not shown).
[0339] A decrease in intensity of the band corresponding to 52 kDa
DUX4 (FIG. 19) and of the DUX4c signal in immunofluorescence (not
shown) was confirmed following the addition of their respective
shRNA.
[0340] Once their efficiency was proven, we encapsidated the
pLVTH-shRNA vectors. We then co-transduced immortal control
myoblasts with recombinant lentivirus expressing either DUX4 or
DUX4c and recombinant lentivirus expressing their respective shRNA.
72 hours after transduction, we detected by immunofluorescence the
DUX4 and DUX4c proteins using monoclonal antibody 9A12. The
presence of shRNA in the cells is confirmed by the expression of
GFP encoded by the shRNA vector.
[0341] After 72 hours, a decreased expression of both proteins
following the addition of their respective shRNA was visible by
immunofluorescence (not shown).
[0342] Testing FSHD Primary Myoblasts Endogenously Expressing
DUX4
[0343] Human FSHD primary myoblasts, which are difficult to
transfect, were transfected following the reverse transfection
method as described above using the "Silencer siRNA Starter Kit"
(Ambion). Optimal transfection conditions, defining an effective
transfection reagent with low cytotoxicity for human primary
myoblasts, were set up using control anti-GAPDH siRNA supplied with
the above kit. 72 hours after transfection, cells were harvested
and 10 .mu.g of protein extracts were separated by SDS-PAGE (12%)
and transferred to a nitrocellulose membrane. The protein transfer
was confirmed by staining the membrane with Ponceau red. After
rinsing the membrane, it was incubated with anti-GAPDH monoclonal
antibody, followed by a secondary antibody coupled to horseradish
peroxidase and revealed with the Lumilight substrate (Roche)
followed by detection on a photographic film. Optimal transfection
conditions included 4 .mu.l SiPORT.TM. NeoFX.TM. reagent, 20 nM
siRNA, and a cell density of 10.sup.5 cells in a 35 mm culture dish
(FIG. 22).
[0344] To test the efficiency of siRNA directed against the DUX4
mRNA, we transfected FSHD primary myoblasts with the siRNA using
the transfection conditions specified above. The cells were seeded
at a density of 10.sup.5 cells in a 35 mm culture dish and
transfected with control siRNA or DUX4-siRNA3 following the reverse
transfection method using 4 .mu.l SiPORT.TM. NeoFX.TM. reagent. 3
different DUX4-siRNA3 concentrations were tested (10 nM, 20 nM and
30 nM) to determine the best concentration to use to reduce the
endogenous DUX4 expression. Since the DUX4 protein is only
detectable in myotubes, 4 hours after transfection, myoblasts
differentiation was induced by replacing the culture medium by a
medium without serum. Cells were harvested 72 h after
differentiation and nuclear protein extracts were realised. 20
.mu.g of these nuclear protein extracts and 5 .mu.g of nuclear
protein extract of TE671 cells that were transfected with the
pCIneo-DUX4 expression vector (TE-DUX4), which was used as a
positive control, were separated by SDS-PAGE (12%) and transferred
onto a nitrocellulose membrane. Protein transfer was confirmed by
staining the membrane with Ponceau red (not shown). After rinsing
the membrane, it was incubated with the 9A12 monoclonal antibody
followed by a secondary antibody coupled to horseradish peroxidase
and revealed with the Femto Super Signal kit (Pierce) followed by
detection on a photographic film. The antibodies were then stripped
and the same membrane was immunostained with a TBP monoclonal
antibody as a nuclear loading control.
[0345] After three days, a significant decrease of the DUX4 protein
amount, as indicated by the red arrow, could be observed in protein
extracts from cells treated with DUX4-siRNA compared to cells
treated with the control siRNA by Western blot (FIG. 23).
[0346] The efficiency of the siRNA targeting the DUX4 mRNA was
confirmed by RT-PCR as a decrease of endogenous DUX4 mRNA amount in
FSHD primary myotubes. FSHD primary myoblasts were transfected with
10 nM DUX4-siRNA 3 or control siRNA (30 nM) using the transfection
conditions specified above. 4 hours after transfection, myoblast
differentiation was induced as specified above. Following
differentiation for 3 days, total RNA was extracted from the
myotubes. Reverse transcription (RT) was performed on 500 ng of
DNase-treated myotube total RNA using the FirstChoice.RTM.RLM-RACE
kit (Ambion). 5 .mu.l of the resulting cDNA were amplified by
nested PCR with primers previously shown to be specific of the DUX4
mRNA 3' UTR (Dixit et al. 2007. supra). GAPDH mRNA amplification
was used as an internal control. The RT-PCR products were analysed
by electrophoresis on a 1% agarose gel. A densitometry of the bands
was performed for quantification. Data were normalized to GAPDH
mRNA levels.
[0347] As shown in FIG. 30, the expected 550 bp DNA fragment was
detected in FSHD myotubes transfected with the control siRNA
(nc-siRNA) and at a 80% reduced intensity in cells treated with the
DUX4-siRNA 3. This amplicon was also observed in the positive
control i.e. C2C12 cells transfected with the pGEM42 vector
containing two D4Z4 units (Gabriels et al. 1999. supra) but not in
primary myoblasts from a healthy donor (Cont), or upon omission of
reverse transcriptase. The RT-PCR products were cloned and
sequenced to confirm DUX4 mRNA amplification (data not shown).
Example 3: Further Antisense Oligonucleotides Directed Against DUX4
Pre-mRNA
[0348] Two further antisense oligomers (AO) directed against the
DUX4 pre-mRNA were designed based on the DUX4 gene sequence. One of
these AOs, JSR 2245 pLAM polyA (-13+6), is capable of binding to a
sequence element required for polyadenylation of the DUX4 mRNA. The
other AO, JSR 2250 pLAM1D (+7-18 around exon-1 intron-1 boundary),
is capable of binding to a sequence element located in the 3'
untranslated sequence of the DUX4 mRNA between the stop codon and
the first intron (see FIG. 31). Whereas JSR 2250 pLAM1D binds to an
exon-intron boundary, it does not in an initial experiment appear
to interfere with splicing of DUX4.
TABLE-US-00012 JSR 2245 pLAM polyA (-13 + 6): (SEQ ID NO: 65)
GGGCAUUUUAAUAUAUCUCUGAACU JSR 2250 pLAM1D (+7 - 18): (SEQ IDNO: 64)
ACCCGACCCCGUCCCAACCCCGCGU
[0349] Both AOs had 2'-O-methyl-phosphorothioate backbone.
[0350] The efficacy of both AOs, JSR 2245 and JSR 2250, was
evaluated in transient expression in C2C12 mouse myoblasts grown in
vitro that were co-transfected with both DUX4 and DUX4c pCIneo
expression vectors, so that both mRNAs were present simultaneously
in the same cells.
[0351] 10.sup.5 C2C12 mouse myoblasts were seeded per well of
6-well dishes and grown at 37.degree. C. and 5% CO.sub.2 in DMEM,
10% foetal bovine serum gold (PAA), 1% antibiotics (penicillin,
streptomycin, fungizon). They were co-transfected 24 hours later
with 500 ng per well of the expression vectors pCIneo-DUX4 and
pCIneo-DUX4c combined with the indicated AO. As the 150 nM
concentration seemed to be most effective in previous experiments
(see Example 1), we tested the effect of the AOs 2245 and 2250
targeting the DUX4 mRNA using this concentration. The negative
control was AO 1662 that targets the dystrophin mRNA and was used
at a concentration of 600 nM. The transfection reagent was
Lipofectamine.TM. 2000 (Invitrogen) used at a ratio of 1 .mu.g AO/1
.mu.l reagent. The cells were lysed 24 hours after transfection,
and total protein extracts were prepared in NuPAGE.RTM. LDS sample
buffer (Invitrogen). 15 .mu.g of protein extracts were separated by
electrophoresis (SDS-PAGE 12%), and transferred to a nitrocellulose
membrane. DUX4 (52 kDa) was detected on this Western blot with the
9A12 monoclonal antibody followed by anti-mouse IgG antibodies
coupled to peroxidase (HRP), and revealed with Lumi-Light kit
(Roche) detected on a film. After striping these antibodies, the
same membrane was incubated with an anti-actin antibody to provide
a loading control.
[0352] The results are shown in FIG. 32. In the conditions as
specified above, AO 2250 could strongly reduce DUX4 levels as
compared to the negative control AO 1662 while DUX4c was still
expressed. In contrast AO 2245 suppressed both DUX4 and DUX4c
proteins at this concentration, suggesting that yet lower amounts
may need to be used in case specific targeting of DUX4 production
is intended (FIG. 32).
[0353] In a similar experiment, AO 2245 was used at a concentration
of 10, 25, 50, 100 or 150 nM. The optimal concentration for
specifically inhibiting DUX4 protein expression was found to be 50
nM (FIG. 33).
Sequence CWU 1
1
7111080DNAHomo sapiens 1agaaacggag gccccggggg agctggaggc ctcggaagag
gccgcctcgc tggaagcacc 60cctcagcgag gaagaatacc gggctctgct ggaggagctt
taggacgcgg ggttgggacg 120gggtcgggtg gttcggggca gggccgtggc
ctctctttcg cggggaacac ctggctggct 180acggaggggc gtgtctccgc
cccgccccct ccaccgggct gaccggcctg ggattcctgc 240cttctaggtc
taggcccggt gagagactcc acaccgcgga gaactgccat tctttcctgg
300gcatcccggg gatcccagag ccggcccagg tacctgcgca cgcgcgggtt
tgcgggcagc 360cgcctgggct gtgggagcag cccgggcaga gctctcctgc
ctctccacca gcccaccccg 420ccgcctgacc gccccctccc caccccccac
cccccacccc cggaaaacgc gtcgtcccct 480gggctgggtg gagacccccg
tcccgcgaaa caccgggccc cgcgcagcgt ccgggcctga 540ctccgctccg
gcggctcgcc tcctgtgtgc ccccgcgcca ccgtcgcccg cccgcccggg
600cccctgcagc ctcccagctg ccagcgcgga gctcctggcg gtcaaaagca
tacctctgtc 660tgtctttgcc cgcttcctgg ctagacctgc gcgcagtgcg
caccccggct gacgtgcaag 720ggagctcgct ggcctctctg tgcccttgtt
cttccgtgaa attctggctg aatgtctccc 780cccaccttcc gacgctgtct
aggcaaacct ggattagagt tacatctcct ggatgattag 840ttcagagata
tattaaaatg ccccctccct gtggatccta tagaagattt gcatcttttg
900tgtgatgagt gcagagatat gtcacaatat cccctgtaga aaaagcctga
aattggttta 960cataacttcg gtgatcagtg cagatgtgtt tcagaactcc
atagtagact gaacctagag 1020aatggttaca tcacttaggt gatcagtgta
gagatatgtt aaaattctcg tgtagacaga 1080260DNAHomo sapiens 2ggctctgctg
gaggagcttt aggacgcggg gttgggacgg ggtcgggtgg ttcggggcag 60340DNAHomo
sapiens 3gaggagcttt aggacgcggg gttgggacgg ggtcgggtgg 40460DNAHomo
sapiens 4gctgaccggc ctgggattcc tgccttctag gtctaggccc ggtgagagac
tccacaccgc 60540DNAHomo sapiens 5ctgggattcc tgccttctag gtctaggccc
ggtgagagac 40660DNAHomo sapiens 6ggcatcccgg ggatcccaga gccggcccag
gtacctgcgc acgcgcgggt ttgcgggcag 60740DNAHomo sapiens 7ggatcccaga
gccggcccag gtacctgcgc acgcgcgggt 40860DNAHomo sapiens 8tctgtctgtc
tttgcccgct tcctggctag acctgcgcgc agtgcgcacc ccggctgacg 60940DNAHomo
sapiens 9tttgcccgct tcctggctag acctgcgcgc agtgcgcacc 401025DNAHomo
sapiens 10cttctaggtc taggcccggt gagag 251125DNAHomo sapiens
11tggctagacc tgcgcgcagt gcgca 251225DNAHomo sapiens 12cttcctggct
agacctgcgc gcagt 251325DNAHomo sapiens 13agacctgcgc gcagtgcgca
ccccg 251430DNAHomo sapiens 14cttcctggct agacctgcgc gcagtgcgca
301530DNAHomo sapiens 15gcccgcttcc tggctagacc tgcgcgcagt
301625RNAArtificialDUX4 antisense agent 16cucucaccgg gccuagaccu
agaag 251725RNAArtificialDUX4 antisense agent 17ugcgcacugc
gcgcaggucu agcca 251825RNAArtificialDUX4 antisense agent
18acugcgcgca ggucuagcca ggaag 251925RNAArtificialDUX4 antisense
agent 19cggggugcgc acugcgcgca ggucu 252030RNAArtificialDUX4
antisense agent 20ugcgcacugc gcgcaggucu agccaggaag
302130RNAArtificialDUX4 antisense agent 21acugcgcgca ggucuagcca
ggaagcgggc 302260DNAHomo sapiens 22acctccccac agcccacagc tcttgtcata
gtgcgggaat agtgttctat cactacagga 602340DNAHomo sapiens 23agcccacagc
tcttgtcata gtgcgggaat agtgttctat 402460DNAHomo sapiens 24gcagagagga
aagcggtctt ccgcctccag ggccagcggg acctcgcact ccgggaaaac
602540DNAHomo sapiens 25aagcggtctt ccgcctccag ggccagcggg acctcgcact
402660DNAHomo sapiens 26gctcaccagc cctccggatc gccggcccgg gtcacttcat
cccggagcaa ttcggacgaa 602740DNAHomo sapiens 27cctccggatc gccggcccgg
gtcacttcat cccggagcaa 402860DNAHomo sapiens 28cgggttccac gctccttcgc
cctctgcaag gggacctgtt gctcgcgtgt ctcccgcccc 602940DNAHomo sapiens
29gctccttcgc cctctgcaag gggacctgtt gctcgcgtgt 403060DNAHomo sapiens
30ttgcaggaaa caggaatccg tggtcaggcc gtgatgcacc cgacgtttct tttctctgca
603140DNAHomo sapiens 31caggaatccg tggtcaggcc gtgatgcacc cgacgtttct
403260DNAHomo sapiens 32agtcaagaca gcggcttcca gtttccatag aattactgga
gaacctcaga gagccagccc 603340DNAHomo sapiens 33gcggcttcca gtttccatag
aattactgga gaacctcaga 403460DNAHomo sapiens 34gaagaacacc gggctctgct
ggaggagcag gttggagcgg ggttggggcg gggtgggggc 603540DNAHomo sapiens
35gggctctgct ggaggagcag gttggagcgg ggttggggcg 403660DNAHomo sapiens
36ctggattcca cgtttctttg ccctctgcag aggtgcctgt tgctcaagtc tctgcccccg
603740DNAHomo sapiens 37cgtttctttg ccctctgcag aggtgcctgt tgctcaagtc
403860DNAHomo sapiens 38ttccaggaat gcgtggaaca ccagcatcgt gtcggtgctc
tcctttccag tttcaaacag 603940DNAHomo sapiens 39gcgtggaaca ccagcatcgt
gtcggtgctc tcctttccag 404060DNAHomo sapiens 40ctgtcctctt ggtgctgtgg
gtcctgaaag ttgtcgagtg cgcccgtccc tgtggtggga 604140DNAHomo sapiens
41ggtgctgtgg gtcctgaaag ttgtcgagtg cgcccgtccc 40421990DNAHomo
sapiens 42ccaccccccc cccccaccac caccaccacc accaccccgc cggccggccc
caggcctcga 60cgccctgggt cccttccggg gtggggcggg ctgtcccagg ggggctcacc
gccattcatg 120aaggggtgga gcctgcctgc ctgtgggcct ttacaagggc
ggctggctgg ctggctggct 180gtccgggcag gcctcctggc tgcacctgcc
gcagtgcaca gtccggctga ggtgcacggg 240agcccgccgg cctctctctg
cccgcgtccg tccgtgaaat tccggccggg gctcaccgcg 300atggccctcc
cgacaccctc ggacagcacc ctccccgcgg aagcccgggg acgaggacgg
360cgacggagac tcgtttggac cccgagccaa agcgaggccc tgcgagcctg
ctttgagcgg 420aacccgtacc cgggcatcgc caccagagaa cggctggccc
aggccatcgg cattccggag 480cccagggtcc agatttggtt tcagaatgag
aggtcacgcc agctgaggca gcaccggcgg 540gaatctcggc cctggcccgg
gagacgcggc ccgccagaag gccggcgaaa gcggaccgcc 600gtcaccggat
cccagaccgc cctgctcctc cgagcctttg agaaggatcg ctttccaggc
660atcgccgccc gggaggagct ggccagagag acgggcctcc cggagtccag
gattcagatc 720tggtttcaga atcgaagggc caggcacccg ggacagggtg
gcagggcgcc cgcgcaggca 780ggcggcctgt gcagcgcggc ccccggcggg
ggtcaccctg ctccctcgtg ggtcgccttc 840gcccacaccg gcgcgtgggg
aacggggctt cccgcacccc acgtgccctg cgcgcctggg 900gctctcccac
agggggcttt cgtgagccag gcagcgaggg ccgcccccgc gctgcagccc
960agccaggccg cgccggcaga gggggtctcc caacctgccc cggcgcgcgg
ggatttcgcc 1020tacgccgccc cggctcctcc ggacggggcg ctctcccacc
ctcaggctcc tcggtggcct 1080ccgcacccgg gcaaaagccg ggaggaccgg
gacccgcagc gcgacggcct gccgggcccc 1140tgcgcggtgg cacagcctgg
gcccgctcaa gcggggccgc agggccaagg ggtgcttgcg 1200ccacccacgt
cccaggggag tccgtggtgg ggctggggcc ggggtcccca ggtcgccggg
1260gcggcgtggg aaccccaagc cggggcagct ccacctcccc agcccgcgcc
cccggacgcc 1320tccgcctccg cgcggcaggg gcagatgcaa ggcatcccgg
cgccctccca ggcgctccag 1380gagccggcgc cctggtctgc actcccctgc
ggcctgctgc tggatgagct cctggcgagc 1440ccggagtttc tgcagcaggc
gcaacctctc ctagaaacgg aggccccggg ggagctggag 1500gcctcggaag
aggccgcctc gctggaagca cccctcagcg aggaagaata ccgggctctg
1560ctggaggagc tttaggacgc ggggttggga cggggtcggg tggttcgggg
cagggccgtg 1620gcctctcttt cgcggggaac acctggctgg ctacggaggg
gcgtgtctcc gccccgcccc 1680ctccaccggg ctgaccggcc tgggattcct
gccttctagg tctaggcccg gtgagagact 1740ccacaccgcg gagaactgcc
attctttcct gggcatcccg gggatcccag agccggccca 1800gacctgcgcg
cagtgcgcac cccggctgac gtgcaaggga gctcgctggc ctctctgtgc
1860ccttgttctt ccgtgaaatt ctggctgaat gtctcccccc accttccgac
gctgtctagg 1920caaacctgga ttagagttac atctcctgga tgattagttc
agagatatat taaaatgccc 1980cctccctgtg 1990431854DNAHomo sapiens
43ccaccccccc cccccaccac caccaccacc accaccccgc cggccggccc caggcctcga
60cgccctgggt cccttccggg gtggggcggg ctgtcccagg ggggctcacc gccattcatg
120aaggggtgga gcctgcctgc ctgtgggcct ttacaagggc ggctggctgg
ctggctggct 180gtccgggcag gcctcctggc tgcacctgcc gcagtgcaca
gtccggctga ggtgcacggg 240agcccgccgg cctctctctg cccgcgtccg
tccgtgaaat tccggccggg gctcaccgcg 300atggccctcc cgacaccctc
ggacagcacc ctccccgcgg aagcccgggg acgaggacgg 360cgacggagac
tcgtttggac cccgagccaa agcgaggccc tgcgagcctg ctttgagcgg
420aacccgtacc cgggcatcgc caccagagaa cggctggccc aggccatcgg
cattccggag 480cccagggtcc agatttggtt tcagaatgag aggtcacgcc
agctgaggca gcaccggcgg 540gaatctcggc cctggcccgg gagacgcggc
ccgccagaag gccggcgaaa gcggaccgcc 600gtcaccggat cccagaccgc
cctgctcctc cgagcctttg agaaggatcg ctttccaggc 660atcgccgccc
gggaggagct ggccagagag acgggcctcc cggagtccag gattcagatc
720tggtttcaga atcgaagggc caggcacccg ggacagggtg gcagggcgcc
cgcgcaggca 780ggcggcctgt gcagcgcggc ccccggcggg ggtcaccctg
ctccctcgtg ggtcgccttc 840gcccacaccg gcgcgtgggg aacggggctt
cccgcacccc acgtgccctg cgcgcctggg 900gctctcccac agggggcttt
cgtgagccag gcagcgaggg ccgcccccgc gctgcagccc 960agccaggccg
cgccggcaga gggggtctcc caacctgccc cggcgcgcgg ggatttcgcc
1020tacgccgccc cggctcctcc ggacggggcg ctctcccacc ctcaggctcc
tcggtggcct 1080ccgcacccgg gcaaaagccg ggaggaccgg gacccgcagc
gcgacggcct gccgggcccc 1140tgcgcggtgg cacagcctgg gcccgctcaa
gcggggccgc agggccaagg ggtgcttgcg 1200ccacccacgt cccaggggag
tccgtggtgg ggctggggcc ggggtcccca ggtcgccggg 1260gcggcgtggg
aaccccaagc cggggcagct ccacctcccc agcccgcgcc cccggacgcc
1320tccgcctccg cgcggcaggg gcagatgcaa ggcatcccgg cgccctccca
ggcgctccag 1380gagccggcgc cctggtctgc actcccctgc ggcctgctgc
tggatgagct cctggcgagc 1440ccggagtttc tgcagcaggc gcaacctctc
ctagaaacgg aggccccggg ggagctggag 1500gcctcggaag aggccgcctc
gctggaagca cccctcagcg aggaagaata ccgggctctg 1560ctggaggagc
tttaggacgc ggggtctagg cccggtgaga gactccacac cgcggagaac
1620tgccattctt tcctgggcat cccggggatc ccagagccgg cccagacctg
cgcgcagtgc 1680gcaccccggc tgacgtgcaa gggagctcgc tggcctctct
gtgcccttgt tcttccgtga 1740aattctggct gaatgtctcc ccccaccttc
cgacgctgtc taggcaaacc tggattagag 1800ttacatctcc tggatgatta
gttcagagat atattaaaat gccccctccc tgtg 18544435RNAHomo sapiens
44cgcggggaac accuggcugg cuacggaggg gcgug 354535RNAHomo sapiens
45gccuucuagg ucuaggcccg gugagagacu ccaca 354635RNAHomo sapiens
46uaggcaaacc uggauuagag uuacaucucc uggau 354719RNAArtificialDUX4
RNA interference agent 47acaccuggcu ggcuacgga
194819RNAArtificialDUX4 RNA interference agent 48ggucuaggcc
cggugagag 194919RNAArtificialDUX4 RNA interference agent
49ccuggauuag aguuacauc 19501714DNAHomo sapiens 50ggagggcggg
ctaccccggg accttgggcc ccgagctcat gcatgttcat aacgcggtgg 60aggtggtagg
tctttctaag ggcctcctgg ctgcacctgc cgcagtgcac aggccggctg
120aggtgcacgg gagcccgccg gcctctctct gcccgcgtcc gtccgtgaaa
ttccggccgg 180ggctcaccgc gatggccctc ccgacacctt cggacagcac
cctccccgcg gaagcccggg 240gacgaggacg gcgacggaga ctcgtttgga
ccccgagcca aagcgaggcc ctgcgagcct 300gctttgagcg gaacccgtac
ccgggcatcg ccaccagaga acggctggcc caggccatcg 360gcattccgga
gcccagggtc cagatttggt ttcagaatga gaggtcacgc cagctgaggc
420agcaccggcg ggaatctcgg ccctggcccg ggagacgcgg cccgccagaa
ggccggcgaa 480agcggaccgc cgtcaccgga tcccagaccg ccctgctcct
ccgagccttt gagaaggatc 540gctttccagg catcgccgcc cgggaggagc
tggccagaga gacgggcctc ccggagtcca 600ggattcagat ctggtttcag
aatcgaaggg ccaggcaccc gggacagggt ggcagggcgc 660ccgcgcaggc
aggcggcctg tgcagcgcgg cccccggcgg gggtcaccct gctccctcgt
720gggtcgcctt cgcccacacc ggcgcgtggg gaacggggct tcccgcaccc
cacgtgccct 780gcgcgcctgg ggctctccca cagggggctt tcgtgagcca
ggcagcgagg gccgcccccg 840cgctgcagcc cagccaggcc gcgccggcag
aggggatctc ccaacctgcc ccggcgcgcg 900gggatttcgc ctacgccgcc
ccggctcctc cggacggggc gctctcccac cctcaggctc 960ctcggtggcc
tccgcacccg ggcaaaagcc gggaggaccg ggacccgcag cgcgacggcc
1020tgccgggccc ctgcgcggtg gcacagcctg ggcccgctca agcggggccg
cagggccaag 1080gggtgcttgc gccacccacg tcccagggga gtccgtggtg
gggctggggc cggggtcccc 1140aggtcgccgg ggcggcgtgg gaaccccaag
ccggggcagc tccacctccc cagcccgcgc 1200ccccggacgc ctccgcggca
agcacagatg ccagccatcc aggcgcctcc caaccgctcc 1260aggagccggg
gcgctcgtct acagtcacct ccagcctgtt atatgagctc ctgtagacac
1320cagagtttca gcaaaaggca cgacctttcc tagatccggc gccactgggg
gagctgaagg 1380acgtggaaga gcccgctctg ctggaaccac tcctcagcca
ggaagaacac cgggctctgc 1440tggaggagca ggttggagcg gggttggggc
ggggtggggg caggacggcg ccctctcttt 1500cgcggtgaac ctctgactcg
gtatggagag gcgtgccttc ccttccagct gacctgtcta 1560ggatccctga
gttccaggtc cggtgagaga ctccacacag aggagggctg tcattctttc
1620ctgagcatcc cggggatccc agggcccgcc caggtaccgg gaggtggact
gtctactgcg 1680catgcgcagg tttgcaggca gcagcctagg tttt
1714511903DNAHomo sapiens 51ggagggcggg ctaccccggg accttgggcc
ccgagctcat gcatgttcat aacgcggtgg 60aggtggtagg tctttctaag ggcctcctgg
ctgcacctgc cgcagtgcac aggccggctg 120aggtgcacgg gagcccgccg
gcctctctct gcccgcgtcc gtccgtgaaa ttccggccgg 180ggctcaccgc
gatggccctc ccgacacctt cggacagcac cctccccgcg gaagcccggg
240gacgaggacg gcgacggaga ctcgtttgga ccccgagcca aagcgaggcc
ctgcgagcct 300gctttgagcg gaacccgtac ccgggcatcg ccaccagaga
acggctggcc caggccatcg 360gcattccgga gcccagggtc cagatttggt
ttcagaatga gaggtcacgc cagctgaggc 420agcaccggcg ggaatctcgg
ccctggcccg ggagacgcgg cccgccagaa ggccggcgaa 480agcggaccgc
cgtcaccgga tcccagaccg ccctgctcct ccgagccttt gagaaggatc
540gctttccagg catcgccgcc cgggaggagc tggccagaga gacgggcctc
ccggagtcca 600ggattcagat ctggtttcag aatcgaaggg ccaggcaccc
gggacagggt ggcagggcgc 660ccgcgcaggc aggcggcctg tgcagcgcgg
cccccggcgg gggtcaccct gctccctcgt 720gggtcgcctt cgcccacacc
ggcgcgtggg gaacggggct tcccgcaccc cacgtgccct 780gcgcgcctgg
ggctctccca cagggggctt tcgtgagcca ggcagcgagg gccgcccccg
840cgctgcagcc cagccaggcc gcgccggcag aggggatctc ccaacctgcc
ccggcgcgcg 900gggatttcgc ctacgccgcc ccggctcctc cggacggggc
gctctcccac cctcaggctc 960ctcggtggcc tccgcacccg ggcaaaagcc
gggaggaccg ggacccgcag cgcgacggcc 1020tgccgggccc ctgcgcggtg
gcacagcctg ggcccgctca agcggggccg cagggccaag 1080gggtgcttgc
gccacccacg tcccagggga gtccgtggtg gggctggggc cggggtcccc
1140aggtcgccgg ggcggcgtgg gaaccccaag ccggggcagc tccacctccc
cagcccgcgc 1200ccccggacgc ctccgcggca agcacagatg ccagccatcc
aggcgcctcc caaccgctcc 1260aggagccggg gcgctcgtct acagtcacct
ccagcctgtt atatgagctc ctgtagacac 1320cagagtttca gcaaaaggca
cgacctttcc tagatccggc gccactgggg gagctgaagg 1380acgtggaaga
gcccgctctg ctggaaccac tcctcagcca ggaagaacac cgggctctgc
1440tggaggagca ggttggagcg gggttggggc ggggtggggg caggacggcg
ccctctcttt 1500cgcggtgaac ctctgactcg gtatggagag gcgtgccttc
ccttccagct gacctgtcta 1560ggatccctga gttccaggtc cggtgagaga
ctccacacag aggagggctg tcattctttc 1620ctgagcatcc cggggatccc
agggcccgcc caggtaccgg gaggtggact gtctactgcg 1680catgcgcagg
tttgcaggca gcagcctagg ttttccaacc agcccaggcg gagctctcat
1740tcctttttcc ccagcgttct tcagtcgagt tggcggagac ctcagtccgc
gaagcgctgg 1800gccggggcag aagccaggcc agttctcctt tccgtggctc
gactcctctg cctcttcgct 1860caccaacact tgccaacccc cgtcccgcca
gcctcctcgc cag 1903522409DNAHomo sapiens 52atgtcttatc gtcacttccg
tgtcatccta tccctgacct ccccacagcc cacagctctt 60gtcataggcc agcgggacct
cgcactccgg gaaaacgtgg ggtgcccggt gcaggccgag 120agctcggccc
acagccgcgt ctgcttgcgg ggcgcccacc agctcaccag ccctccggat
180cgccggcccg ggggacctgt tgctcgcgtg tctcccgccc ccgaaagcgc
gaccacgttg 240gctgtttccc gagctctgcg gggacacaga aacctccagc
gaagcgtgga aaagcagcat 300cgtgacttcg ctctcctttc cggtttccag
accggccaca gtggagactc cccttgttgc 360aggaaacagg aatccgtggt
caggccaatt actggagaac ctcagagagc cagccccgga 420agcccctctt
tcccctccaa tccggccctg cacccaccca ccccacaagg ccctggtccc
480tgtggttttc ggcttcggag ggcgggctac cccgggacct tgggccccga
gctcatgcat 540gttcataacg cggtggaggt ggtaggtctt tctaagggcc
tcctggctgc acctgccgca 600gtgcacaggc cggctgaggt gcacgggagc
ccgccggcct ctctctgccc gcgtccgtcc 660gtgaaattcc ggccggggct
caccgcgatg gccctcccga caccctcgga cagcaccctc 720cccgcggaag
cccggggacg aggacggcga cggagactcg tttggacccc gagccaaagc
780gaggccctgc gagcctgctt tgagcggaac ccgtacccgg gcatcgccac
cagagaacgg 840ctggcccagg ccatcggcat tccggagccc agggtccaga
tttggtttca gaatgagagg 900tcacgccagc tgaggcagca ccggcgggaa
tctcggccct ggcccgggag acgcggcccg 960ccagaaggcc ggcgaaagcg
gaccgccgtc accggatccc agaccgccct gctcctccga 1020gcctttgaga
aggatcgctt tccaggcatc gccgcccggg aggagctggc cagagagacg
1080ggcctcccgg agtccaggat tcagatctgg tttcagaatc gaagggccag
gcacccggga 1140cagggtggca gggcgcccgc gcaggcaggc ggcctgtgca
gcgcggcccc tggcgggggt 1200caccctgctc cctcgtgggt cgccttcgcc
cacaccggcg cgtggggaac ggggcttccc 1260gcaccccacg tgccctgcgc
gcctggggct ctcccacagg gggctttcgt gagccaggca 1320gcgagggccg
cccccgcgct gcagcccagc caggccgcgc cggcagaggg ggtctcccaa
1380cctgccccgg cgcgcgggga tttcgcctac gccgccccgg ctcctccgga
cggggcgctc 1440tcccaccctc aggctcctcg gtggcctccg cacccgggca
aaagccggga ggaccgggac 1500gcgcagcgcg acggcctgcc gggcccctgc
gcggtggcac agcctgggcc cgctcaagcg 1560gggccgcagg gccaaggggt
gcttgcgcca cccacgtccc aggggagtcc gtggtggggc 1620tggggccggg
gtccccaggt cgccggggcg gcgtgggaac cccaagccgg ggcagctcca
1680cctccccagc ccgcgccccc ggacgcctcc gcggcaagca cagatgccag
ccatccaggc 1740gcctcccaac cgctccagga gccggggcgc tcgtctacag
tcacctccag cctgttatat 1800gagctcctgt agacaccaga gtttcagcaa
aaggcacgac ctttcctaga tccggcgcca 1860ctgggggagc tgaaggacgt
ggaagagccc gctctgctgg aaccactcct cagccaggaa 1920gaacaccggg
ctctgctgga ggagcagagg tgcctgttgc tcaagtctct gcccccgccc
1980cccgaaagtg tgaccatgtt gactgtttgt ttcccgagct ctgtggggac
ccagaaactt 2040ccaggaatgc gtggaacacc agcatcgttt gtcgagtgcg
cccgtccctg tggtgggagc 2100agtggccccg agcgtgccca cgggccccgg
cttgggtttc tctcgtgttt agaatggtat 2160ggccgtagac aatggcggtg
gcgcctggct ggtccaagag cccggtccag ctacgcgcgt 2220ctgattccag
gcgtcaccac caacccgggg ccgcgaggct gggatcaggc acccccggag
2280ccgctcgccc gcggccgggc tgctctcccc ctctatacgc ccaagcacca
gtcgccgcgc 2340tgcgttttcc gccggcctcg cagagcgtcc cgctatcgcc
ggcggccaga ccacgcgcag 2400gaccgctga 24095335RNAHomo sapiens
53uguagacacc agaguuucag
caaaaggcac gaccu 355435RNAHomo sapiens 54cacacagagg agggcuguca
uucuuuccug agcau 355535RNAHomo sapiens 55uuuccccagc guucuucagu
cgaguuggcg gagac 355619RNAArtificialDUX4c RNA interference agent
56ccagaguuuc agcaaaagg 195719RNAArtificialDUX4c RNA interference
agent 57ggagggcugu cauucuuuc 195819RNAArtificialDUX4c RNA
interference agent 58gcguucuuca gucgaguug 1959485PRTHomo sapiens
59Met Lys Gly Trp Ser Leu Pro Ala Cys Gly Pro Leu Gln Gly Arg Leu1
5 10 15Ala Gly Trp Leu Ala Val Arg Ala Gly Leu Leu Ala Ala Pro Ala
Ala 20 25 30Val His Ser Pro Ala Glu Val His Gly Ser Pro Pro Ala Ser
Leu Cys 35 40 45Pro Arg Pro Ser Val Lys Phe Arg Pro Gly Leu Thr Ala
Met Ala Leu 50 55 60Pro Thr Pro Ser Asp Ser Thr Leu Pro Ala Glu Ala
Arg Gly Arg Gly65 70 75 80Arg Arg Arg Arg Leu Val Trp Thr Pro Ser
Gln Ser Glu Ala Leu Arg 85 90 95Ala Cys Phe Glu Arg Asn Pro Tyr Pro
Gly Ile Ala Thr Arg Glu Arg 100 105 110Leu Ala Gln Ala Ile Gly Ile
Pro Glu Pro Arg Val Gln Ile Trp Phe 115 120 125Gln Asn Glu Arg Ser
Arg Gln Leu Arg Gln His Arg Arg Glu Ser Arg 130 135 140Pro Trp Pro
Gly Arg Arg Gly Pro Pro Glu Gly Arg Arg Lys Arg Thr145 150 155
160Ala Val Thr Gly Ser Gln Thr Ala Leu Leu Leu Arg Ala Phe Glu Lys
165 170 175Asp Arg Phe Pro Gly Ile Ala Ala Arg Glu Glu Leu Ala Arg
Glu Thr 180 185 190Gly Leu Pro Glu Ser Arg Ile Gln Ile Trp Phe Gln
Asn Arg Arg Ala 195 200 205Arg His Pro Gly Gln Gly Gly Arg Ala Pro
Ala Gln Ala Gly Gly Leu 210 215 220Cys Ser Ala Ala Pro Gly Gly Gly
His Pro Ala Pro Ser Trp Val Ala225 230 235 240Phe Ala His Thr Gly
Ala Trp Gly Thr Gly Leu Pro Ala Pro His Val 245 250 255Pro Cys Ala
Pro Gly Ala Leu Pro Gln Gly Ala Phe Val Ser Gln Ala 260 265 270Ala
Arg Ala Ala Pro Ala Leu Gln Pro Ser Gln Ala Ala Pro Ala Glu 275 280
285Gly Val Ser Gln Pro Ala Pro Ala Arg Gly Asp Phe Ala Tyr Ala Ala
290 295 300Pro Ala Pro Pro Asp Gly Ala Leu Ser His Pro Gln Ala Pro
Arg Trp305 310 315 320Pro Pro His Pro Gly Lys Ser Arg Glu Asp Arg
Asp Pro Gln Arg Asp 325 330 335Gly Leu Pro Gly Pro Cys Ala Val Ala
Gln Pro Gly Pro Ala Gln Ala 340 345 350Gly Pro Gln Gly Gln Gly Val
Leu Ala Pro Pro Thr Ser Gln Gly Ser 355 360 365Pro Trp Trp Gly Trp
Gly Arg Gly Pro Gln Val Ala Gly Ala Ala Trp 370 375 380Glu Pro Gln
Ala Gly Ala Ala Pro Pro Pro Gln Pro Ala Pro Pro Asp385 390 395
400Ala Ser Ala Ser Ala Arg Gln Gly Gln Met Gln Gly Ile Pro Ala Pro
405 410 415Ser Gln Ala Leu Gln Glu Pro Ala Pro Trp Ser Ala Leu Pro
Cys Gly 420 425 430Leu Leu Leu Asp Glu Leu Leu Ala Ser Pro Glu Phe
Leu Gln Gln Ala 435 440 445Gln Pro Leu Leu Glu Thr Glu Ala Pro Gly
Glu Leu Glu Ala Ser Glu 450 455 460Glu Ala Ala Ser Leu Glu Ala Pro
Leu Ser Glu Glu Glu Tyr Arg Ala465 470 475 480Leu Leu Glu Glu Leu
48560374PRTHomo sapiens 60Met Ala Leu Pro Thr Pro Ser Asp Ser Thr
Leu Pro Ala Glu Ala Arg1 5 10 15Gly Arg Gly Arg Arg Arg Arg Leu Val
Trp Thr Pro Ser Gln Ser Glu 20 25 30Ala Leu Arg Ala Cys Phe Glu Arg
Asn Pro Tyr Pro Gly Ile Ala Thr 35 40 45Arg Glu Arg Leu Ala Gln Ala
Ile Gly Ile Pro Glu Pro Arg Val Gln 50 55 60Ile Trp Phe Gln Asn Glu
Arg Ser Arg Gln Leu Arg Gln His Arg Arg65 70 75 80Glu Ser Arg Pro
Trp Pro Gly Arg Arg Gly Pro Pro Glu Gly Arg Arg 85 90 95Lys Arg Thr
Ala Val Thr Gly Ser Gln Thr Ala Leu Leu Leu Arg Ala 100 105 110Phe
Glu Lys Asp Arg Phe Pro Gly Ile Ala Ala Arg Glu Glu Leu Ala 115 120
125Arg Glu Thr Gly Leu Pro Glu Ser Arg Ile Gln Ile Trp Phe Gln Asn
130 135 140Arg Arg Ala Arg His Pro Gly Gln Gly Gly Arg Ala Pro Ala
Gln Ala145 150 155 160Gly Gly Leu Cys Ser Ala Ala Pro Gly Gly Gly
His Pro Ala Pro Ser 165 170 175Trp Val Ala Phe Ala His Thr Gly Ala
Trp Gly Thr Gly Leu Pro Ala 180 185 190Pro His Val Pro Cys Ala Pro
Gly Ala Leu Pro Gln Gly Ala Phe Val 195 200 205Ser Gln Ala Ala Arg
Ala Ala Pro Ala Leu Gln Pro Ser Gln Ala Ala 210 215 220Pro Ala Glu
Gly Ile Ser Gln Pro Ala Pro Ala Arg Gly Asp Phe Ala225 230 235
240Tyr Ala Ala Pro Ala Pro Pro Asp Gly Ala Leu Ser His Pro Gln Ala
245 250 255Pro Arg Trp Pro Pro His Pro Gly Lys Ser Arg Glu Asp Arg
Asp Pro 260 265 270Gln Arg Asp Gly Leu Pro Gly Pro Cys Ala Val Ala
Gln Pro Gly Pro 275 280 285Ala Gln Ala Gly Pro Gln Gly Gln Gly Val
Leu Ala Pro Pro Thr Ser 290 295 300Gln Gly Ser Pro Trp Trp Gly Trp
Gly Arg Gly Pro Gln Val Ala Gly305 310 315 320Ala Ala Trp Glu Pro
Gln Ala Gly Ala Ala Pro Pro Pro Gln Pro Ala 325 330 335Pro Pro Asp
Ala Ser Ala Ala Ser Thr Asp Ala Ser His Pro Gly Ala 340 345 350Ser
Gln Pro Leu Gln Glu Pro Gly Arg Ser Ser Thr Val Thr Ser Ser 355 360
365Leu Leu Tyr Glu Leu Leu 370611800DNAHomo sapiens 61ctctgctgga
ggagctttag gacgcggggt tgggacgggg tcgggtggtt cggggcaggg 60ccgtggcctc
tctttcgcgg ggaacacctg gctggctacg gaggggcgtg tctccgcccc
120gccccctcca ccgggctgac cggcctggga ttcctgcctt ctaggtctag
gcccggtgag 180agactccaca ccgcggagaa ctgccattct ttcctgggca
tcccggggat cccagagccg 240gcccaggtac cagcaggtgg gccgcctact
gcgcacgcgc gggtttgcgg gcagccgcct 300gggctgtggg agcagcccgg
gcagagctct cctgcctctc caccagccca ccccgccgcc 360tgaccgcccc
ctccccaccc cccacccccc acccccggaa aacgcgtcgt cccctgggct
420gggtggagac ccccgtcccg cgaaacaccg ggccccgcgc agcgtccggg
cctgacaccg 480ctccggcggc tcgcctccta tgcgcccccg cgccaccgtc
gcccgcccgc ccgggcccct 540gcagccgccc aggtgccagc acggagcgcc
tggcggcgga acgcagaccc caggcccggc 600gcacaccggg gacgctgagc
gttccaggcg ggagggaagg cgggcagaga tggagagagg 660aacgggagac
ctagaggggc ggaaggacgg gcggagggac gttaggaggg agggagggag
720gcagggaggc agggaggaac ggagggaaag acagagcgac gcagggactg
ggggcgggcg 780ggagggagcc ggggaacggg gggaggaagg cagggaggaa
aagcggtcct cggcctccgg 840gagtagcggg acccccgccc tccgggaaaa
cggtcagcgt ccggcgcggg ctgagggctg 900ggcccacagc cgccgcgccg
gccggcgggg caccacccat tcgccccggt tccgtggccc 960agggagtggg
cggtttcctc cgggacaaaa gaccgggact cgggttgccg tcgggtcttc
1020acccgcgcgg ttcacagacc gcacatcccc aggctgagcc ctgcaacgcg
gcgcgaggcc 1080gacagccccg gccacggagg agccacacgc aggacgacgg
aggcgtgatt ttggtttccg 1140cgtggctttg ccctccgcaa ggcggcctgt
tgctcacgtc tctccggccc ccgaaaggct 1200ggccatgccg actgtttgct
cccggagctc tgcgggcacc cggaaacatg cagggaaggg 1260tgcaagcccg
gcacggtgcc ttcgctctcc ttgccaggtt ccaaaccggc cacactgcag
1320actccccacg ttgccgcacg cgggaatcca tcgtcaggcc atcacgccgg
ggaggcatct 1380cctctctggg gtctcgctct ggtcttctac gtggaaatga
acgagagcca cacgcctgcg 1440tgtgcgagac cgtcccggca acggcgacgc
ccacaggcat tgcctccttc acggagagag 1500ggcctggcac actcaagact
cccacggagg ttcagttcca cactcccctc caccctccca 1560ggctggtttc
tccctgctgc cgacgcgtgg gagcccagag agcggcttcc cgttcccgcg
1620ggatccctgg agaggtccgg agagccggcc cccgaaacgc gcccccctcc
cccctccccc 1680ctctccccct tcctcttcgt ctctccggcc ccaccaccac
caccgccacc acgccctccc 1740cccccccccc ccccccccac caccaccacc
accaccccgc cggccggccc caggcctcga 1800621229DNAHomo sapiens
62ctctgctgga ggagctttag gacgcggggt tgggacgggg tcgggtggtt cggggcaggg
60ccgtggcctc tctttcgcgg ggaacacctg gctggctacg gaggggcgtg tctccgcccc
120gccccctcca ccgggctgac cggcctggga ttcctgcctt ctaggtctag
gcccggtgag 180agactccaca ccgcggagaa ctgccattct ttcctgggca
tcccggggat cccagagccg 240gcccaggtac ctgcgcacgc gcgggtttgc
gggcagccgc ctgggctgtg ggagcagccc 300gggcagagct ctcctgcctc
tccaccagcc caccccgccg cctgaccgcc ccctccccac 360cccccacccc
ccacccccgg aaaacgcgtc gtcccctggg ctgggtggag acccccgtcc
420cgcgaaacac cgggccccgc gcagcgtccg ggcctgactc cgctccggcg
gctcgcctcc 480tgtgtgcccc cgcgccaccg tcgcccgccc gcccgggccc
ctgcagcctc ccagctgcca 540gcgcggagct cctggcggtc aaaagcatac
ctctgtctgt ctttgcccgc ttcctggcta 600gacctgcgcg cagtgcgcac
cccggctgac gtgcaaggga gctcgctggc ctctctgtgc 660ccttgttctt
ccgtgaaatt ctggctgaat gtctcccccc accttccgac gctgtctagg
720caaacctgga ttagagttac atctcctgga tgattagttc agagatatat
taaaatgccc 780cctccctgtg gatcctatag aagatttgca tcttttgtgt
gatgagtgca gagatatgtc 840acaatatccc ctgtagaaaa agcctgaaat
tggtttacat aacttcggtg atcagtgcag 900atgtgtttca gaactccata
gtagactgaa cctagagaat ggttacatca cttaggtgat 960cagtgtagag
atatgttaaa attctcgtgt agacagagcc tagacaattg ttacatcacc
1020tagtgatcag tgcagggata agtcataaag cctcctgtag gcagagtgta
ggcaagtgtt 1080ccctccctgg gctgatcagt gcagagatat ctcacaaagc
ccctataagc caaaccttga 1140caagggttac atcacctgtt tgagcagtgg
aaatatatat cacaaagccc cctgtagaca 1200aagcccagac aatttttaca
tctcctgag 1229631246DNAHomo sapiens 63ctctgctgga ggagctttag
gacgcggggt tgggacgggg tcgggtggtt cggggcaggg 60ccgtggcctc tctttcgcgg
ggaacacctg gctggctacg gaggggcgtg tctccgcccc 120gccccctcca
ccgggctgac cggcctggga ttcctgcctt ctaggtctag gcccggtgag
180agactccaca ccgcggagaa ctgccattct ttcctgggca tcccggggat
cccagagccg 240gcccaggtac cagcaggtgg gccgcctact gcgcacgcgc
gggtttgcgg gcagccgcct 300gggctgtggg agcagcccgg gcagagctct
cctgcctctc caccagccca ccccgccgcc 360tgaccgcccc ctccccaccc
ccacccccca cccccggaaa acgcgtcgtc ccctgggctg 420ggtggagacc
cccgtcccgc gaaacaccgg gccccgcgca gcgtccgggc ctgacaccgc
480tccggcggct cgcctcctct gcgcccccgc gccaccgtcg cccgcccgcc
cgggcccctg 540cagcctccca gctgccagcg cggagctcct ggcggtcaaa
agcatacctc tgtctgtctt 600tgcccgcttc ctggctagac ctgcgcgcag
tgcgcacccc ggctgacgtg caagggagct 660cgctggcctc tctgtgccct
tgttcttccg tgaaattctg gctgaatgtc tccccccacc 720ttccgacgct
gtctaggcaa acctggatta gagttacatc tcctggatga ttagttcaga
780gatatattaa aatgccccct ccctgtggat cctatagaag atttgcatct
tttgtgtgat 840gagtgcagag atatgtcaca atatcccctg tagaaaaagc
ctgaaattgg tttacataac 900ttcggtgatc agtgcagatg tgtttcagaa
ctccatagta gactgaacct agagaatggt 960tacatcactt aggtgatcag
tgtagagata tgttaaaatt ctcgtgtaga cagagcctag 1020acaattgtta
catcacctag tgatcagtgc agggataagt cataaagcct cctgtaggca
1080gagtgtaggc aagtgttccc tccctgggct gatcagtgca gagatatctc
acaaagcccc 1140tataagccaa accttgacaa gggttacatc acctgtttga
gcagtggaaa tatatatcac 1200aaagccccct gtagacaaag cccagacaat
ttttacatct cctgag 12466425RNAArtificialDUX4 antisense agent
64acccgacccc gucccaaccc cgcgu 256525RNAArtificialDUX4 antisense
agent 65gggcauuuua auauaucucu gaacu 256625DNAHomo sapiens
66acgcggggtt gggacggggt cgggt 256766DNAHomo sapiens 67acatctcctg
gatgattagt tcagagatat attaaaatgc cccctccctg tggatcctat 60agaaga
666846DNAHomo sapiens 68gatgattagt tcagagatat attaaaatgc cccctccctg
tggatc 466925DNAHomo sapiens 69agttcagaga tatattaaaa tgccc
257013477DNAHomo sapiens 70gaattctatc tggtacccag agggaagggg
gttcccagtg agggcaggac caggcttcat 60gcacctcttc aggaatgttc tcctcatagt
ccagcctcaa ggtgtgcatc ctctgtgtgc 120atggagtcca tggcaggctc
tgcctgggga gccgtccagc tgcacacctg caatgtggtg 180gtgaccctca
tgaatgggtg gttctgggcc ccatggctgg cagcagagag ggagatgttc
240agccaccaag cccagagccc tgccacaggc ttctgtgagg cctccatctg
ctctgggttc 300ttgccctgag aggctgccct gaagtcaaac agaagcaggt
gggcctctct tccagggctg 360ctctctcccc cactgacagc tccctagagg
gagactcaga cagcggggac agattcctca 420ggcataagca ctggagttta
ggctggccag ttcattccat acgcccacat gacatgacac 480aaggcagagg
ctgtgggaca aaggtattgc cttttcttct ggcatgagga atggcttagg
540aagcagggga tggtggggct ggggttgagt gatgggctgt gggccacaag
gagtgggtgg 600gcgctgagaa agtgtcctgg ttgtctgtcc atagacgcag
aatgagtggc atcccaggag 660cctgtgaggg gctggcagag acttactggt
tccagtaaaa gccccatgtg gatgcagtaa 720tgctgcctgc tggtccttgg
ctgtaattac aaacaggtac atgaggtacc catgcatctt 780gaagctctca
gggagtgggt tccagctgct catggtaggc acttttagtc actgaacatg
840cttcaggcat gtccaagctt gattaagcca ggcatcttgc tgtgaggccc
tccacttcac 900taagaacact cttccttgct tcccctggaa gttggacctt
ccagttctgg ttctggagac 960acgatggccc ctcctggacc cctgggagaa
tgtgctcagg tgacacacag ttgatggggc 1020ccatttccaa gccattcttc
catttcccac tgtttgaggg acccgaggcc ggtgacaagc 1080acagagccac
ccaaggccag ctgtctgcac ctaaatgtga tgcttgtctg gatgtctcag
1140ggccagaacc ctccaggtga gatggcctgg tcctcaccac ctggcgtccg
tgctcccttt 1200tcctctgttc aatcctggcg ccaatgcctc cctcaactct
caggtcacca ttggagaaga 1260tgctcaggaa gaacaagcag ctgcagttaa
ccctgctgaa agtggcagat gggtccaggc 1320tcttgagctc gtcttggaca
tggaacatgt ggatacaggc tttgagcagt gtgtgtagct 1380ctttcaggaa
ggaagggaaa agggtgttac ccgggtccta caccctggaa cgacccttct
1440cagacagtaa atagttggca gggtgcggtc atgtgtgatt ttagttttca
actttaggct 1500ttcattttca aattccacaa taaacacata aggtggagtt
ctggtttcag cacacacaca 1560cacacacaca aacacacaca cacacacaca
cacagtctct ctctctgtat gtctctttct 1620gtctctctct ctctccttcc
tgcaaggatc cttgttaaca agaaaccttc tgccaaatgc 1680ctctgaagca
caggcaggtc ttggggagcc acaaggccac ttcctctttg tgcactagtg
1740tcttgggtag gcatagcttt cagagctctg gggcctccac aaccttgccc
tgctgtccag 1800gggcagccct catgcagggg tgtcctaaga acttttcagg
atgcacaagt tcagcactgt 1860cttccaatgt gtgtttcacg atattttaat
ggtggttctt ttgggaaaaa ggaaaggttc 1920tgtgatcaat tatgggacac
attgagctac agatcttttt cacaattgct cttaacaagc 1980aggtagaccc
tgagaacatg agtagcttcc ccgcaggtaa cttgagtgca tgagaacttt
2040tgctttacaa ccatgccaat ctcacctcag cagttggcag tgctgcacgg
ggcagacttc 2100cctactcaaa ggctgtgaag cttttctttc ttttttttta
aacattattt ttctttatag 2160aattttgttg ggctgatatc aagcctggct
tggtactgcc tcattttttt tggaatcaga 2220acgctgttct ttaactcacg
ggttgtgaag ttagaaggtg ctggtgtgac agcctgacaa 2280gcagagcgca
gctccaatcc caccttcatg ctctcatctg acgcagagcc ctcagagaag
2340tggggaagtg cttcctggcc ctgcttctgg gggccgtccc caaggcagtc
caccgaactt 2400ccaaaacagc cttccctcac acacagccct gagccctcct
gccgctcctc aatgttgcac 2460atctctgaga agtggtccag catgttgctg
tccaggggca gtgagaagca ggtgcggtga 2520cacatgtctt cacggaccat
gagcaccggg taaatctcct gcacaatctc cttgggggac 2580accttgaggg
agaaagcccc aacaactgat ggcatgccac atggcagaaa gcaaagactt
2640accctttccc cagcccaaag tcctgagaat catgccaaaa atccttggtt
tcccactttt 2700taaaaatttt aaaattaaaa tcccaggttc cgcgtataca
tgccatgccc acctgcacct 2760gtgtgtgtgt gtgtgtttgt gcacgcagga
cagagcctgg cccattgact attcctgcag 2820accaagaaaa atccctatgc
agagtaaggg gagatggaag aaacgaggga gagaaaatgg 2880cagccttgcc
tcctcccttg cccagtgcta aggtccccag ggcaaatggc ttttgccttc
2940aacttcacct taacaacata caaaatatat tcatttttac ttccgtcact
ttcttaacat 3000tacaaattgt atctttatat atgatttgta ttttcacaga
gatttaagaa tttaatgcac 3060cattatagta gaaaattgta tatctgtgta
tatatttaca ttgaacagag agctttatat 3120tttcatgtgg ttttatgatg
ctgtccagca tcatttaatt tttcaacata attaactctc 3180tttagcattt
tttttcctag ggttattcta gtagttaaca acctcagctt ttttatttta
3240atctttgaaa gtctttattt ttttctaatt tttgaaatac agtatttccc
agatcaatta 3300ttattggttg ctagtatttt ttctttcatc gctttgaaat
ctggaaagtt cttagcatcc 3360ccgctttttc tctgaaataa tgtttatgcc
attttctccc tctattcttt ttaaaagact 3420ctatctctga atgtattggt
ctacttgatg gtgtccagta agtcttatat ttcacccgta 3480attttcccat
tctttaaaat attagtttcc aggactcaat atttgtgaat aatatatgtt
3540caattttctt ttttctgctc cattgtttgc tgttgtgtct ctgtagtgaa
tttataaaac 3600tcagttatta tattcttcaa ctctatgatt tctgttgggt
ttttaaaaat agtttttatc 3660tctttgttga tattttgctc attcgttatt
tttaaatttc actcagttgt ctctttctgt 3720tatagttttg ctcactgaga
atgcataaga tgattatttt aagttctcca tcagatatgc 3780aaaaatcttt
atttgttaaa attcagtttc tgaatattta tgtttttctt ccaatgggga
3840atattttctg ccttctctgt gtgccttgtg attttttttt ttaaagagat
ctggggatct 3900atacagcact catcaaatct agcatttaaa gactggctca
gtaaaggggg ataccgacag 3960caatagtcca ggctatagat tctaggtgct
tcacaaacac attcccaaat atattttctc 4020tggacttcgc tgtgtttcca
agttaaagag aattttttct caatgtattt tagattctat 4080tgtatatttt
cttccccagt tggctgtctg tggtattgca gtttcactag tgctgtagca
4140aacactcatc tttcttctca gcagacacaa actgtcatct atatgactcc
atcatgtcct 4200tcagcactcc acatcaggag agaaagaatc tagtcattag
acaatttatc aaaaagccaa 4260acatttcaac acatattcta ctgttttaat
tctctcctga aggagatact gggagttggg 4320cattttctca ttagcccagt
tactgttctg ggtgaaaaaa
taaactgcag tggacaggct 4380gtaagccaga cttcatcaaa tttctgcacc
aatgaaaaaa aaatttacaa gagaaaaaca 4440aaaaacccta ttaaacgtca
cggacaaggc cagagtttga atatactgtg gtcatctctg 4500ctccagtgca
aactgtttcc agaaagccta cttctatttt ccttgctgta acagaggaac
4560atttcctgtc ttatgtttat tctactctgc aatcccctaa ggctttttct
ctccctccca 4620gaatcttaaa gtgcattcga actcacaggc aaaatcctcc
cagaatcttg tgagaacata 4680aatgatctga ctagtttggc attgcttttg
gggatctggg aaaatctgtg cacacttctg 4740gagacccttg tcatgccatt
ttttataaat ctattgtgcc tcaagtcaga agtgtgtgag 4800gggagatggg
gagacattgg gatgcgcgcg cctggggctc tcccacaggg ggctttcgtg
4860agccaggcag cgagggccgc ccccgcgctg cagcccagcc aggccgcgac
ggcagagggg 4920gtctcccaac ctgccccggc gcgcggggat ttcgcctacg
ccgccccggc tcctccggac 4980ggggcgctct cccaccctca ggctcctcgg
tggcctccgc acccgggcaa aagccgggag 5040gaccgggacc cgcagcgcga
cggcctgccg ggcccctgcg cggtggcaca gcctgggccc 5100gctcaagcgg
ggccgcaggg ccaaggggtg cttgcgccac ccacgtccca ggggagtccg
5160tggtggggct ggggccgggt ccccaggtcg ccggggcggc gtgggaaccc
caagccgggg 5220caagcttcca cctccccagc ccgcgccccc ggacgcctcc
gcctccgcgc ggcaggggca 5280gatgcaaggc atcccggcgc cctcccaggc
gctccaggag ccggcgccct ggtctgcact 5340cccctgcggc ctgctgctgg
atgagctcct ggcgagcccg gagtttctgc agcaggcgca 5400acctctccta
gaaacggagg ccccggggga gctggaggcc tcggaagagg ccgcctcgct
5460ggaagcaccc ctcagcgagg aagaataccg ggctctgctg gaggagcttt
aggacgcggg 5520gttgggacgg ggtcgggtgg ttcggggcag ggcggtggcc
tctctttcgc ggggaacacc 5580tggctggcta cggaggggcg tgtctccgcc
ccgccccctc caccgggctg accggcctgg 5640gattcctgcc ttctaggtct
aggcccggtg agagactcca caccgcggag aactgccatt 5700ctttcctggg
catcccgggg atcccagagc cggcccaggt accagcaggt gggccgccta
5760ctgcgcacgc gcgggtttgc gggcagccgc ctgggctgtg ggagcagccc
gggcagagct 5820ctcctgcctc tccaccagcc caccccgccg cctgaccgcc
ccctccccac cccccacccc 5880ccacccccgg aaaacgcgtc gtcccctggg
ctgggtggag acccccgtcc cgcgaaacac 5940cgggccccgc gcagcgtccg
ggcctgacac cgctccggcg gctcgcctcc tatgcgcccc 6000cgcgccaccg
tcgcccgccc gcccgggccc ctgcagccgc ccaggtgcca gcacggagcg
6060cctggcggcg gaacgcagac cccaggcccg gcgcacaccg gggacgctga
gcgttccagg 6120cgggagggaa ggcgggcaga gatggagaga ggaacgggag
acctagaggg gcggaaggac 6180gggcggaggg acgttaggag ggagggaggg
aggcagggag gcagggagga acggagggaa 6240agacagagcg acgcagggac
tgggggcggg cgggagggag ccggggaacg gggggaggaa 6300ggcagggagg
aaaagcggtc ctcggcctcc gggagtagcg ggacccccgc cctccgggaa
6360aacggtcagc gtccggcgcg ggctgagggc tgggcccaca gccgccgcgc
cggccggcgg 6420ggcaccaccc attcgccccg gttccgtggc ccagggagtg
ggcggtttcc tccgggacaa 6480aagaccggga ctcgggttgc cgtcgggtct
tcacccgcgc ggttcacaga ccgcacatcc 6540ccaggctgag ccctgcaacg
cggcgcgagg ccgacagccc cggccacgga ggagccacac 6600gcaggacgac
ggaggcgtga ttttggtttc cgcgtggctt tgccctccgc aaggcggcct
6660gttgctcacg tctctccggc ccccgaaagg ctggccatgc cgactgtttg
ctcccggagc 6720tctgcgggca cccggaaaca tgcagggaag ggtgcaagcc
cggcacggtg ccttcgctct 6780ccttgccagg ttccaaaccg gccacactgc
agactcccca cgttgccgca cgcgggaatc 6840catcgtcagg ccatcacgcc
ggggaggcat ctcctctctg gggtctcgct ctggtcttct 6900acgtggaaat
gaacgagagc cacacgcctg cgtgtgcgag accgtcccgg caacggcgac
6960gcccacaggc attgcctcct tcacggagag agggcctggc acactcaaga
ctcccacgga 7020ggttcagttc cacactcccc tccaccctcc caggctggtt
tctccctgct gccgacgcgt 7080gggagcccag agagcggctt cccgttcccg
cgggatccct ggagaggtcc ggagagccgg 7140cccccgaaac gcgcccccct
cccccctccc ccctctcccc cttcctcttc gtctctccgg 7200ccccaccacc
accaccgcca ccacgccctc cccccccacc cccccccccc accaccacca
7260ccaccacccc gccggccggc cccaggcctc gacgccctgg ggtcccttcc
ggggtggggc 7320gggctgtccc aggggggctc accgccattc atgaaggggt
ggagcctgcc tgcctgtggg 7380cctttacaag ggcggctggc tggctggccg
gctgtccggg caggcctcct ggctgcacct 7440gccgcagtgc acagtccggc
tgaggtgcac gggagcccgc cggcctctct ctgcccgcgt 7500ccgtccgtga
aattccggcc ggggctcacc gcgatggccc tcccgacacc ctcggacagc
7560accctccccg cggaagcccg gggacgagga cggcgacgga gactcgtttg
gaccccgagc 7620caaagcgagg ccctgcgagc ctgctttgag cggaacccgt
acccgggcat cgccaccaga 7680gaacggctgg cccaggccat cggcattccg
gagcccaggg tccagatttg gtttcagaat 7740gagaggtcac gccagctgag
gcagcaccgg cgggaatctc ggccctggcc cgggagacgc 7800ggcccgccag
aaggccggcg aaagcggacc gccgtcaccg gatcccagac cgccctgctc
7860ctccgagcct ttgagaagga tcgctttcca ggcatcgccg cccgggagga
gctggccaga 7920gagacgggcc tcccggagtc caggattcag atctggtttc
agaatcgaag ggccaggcac 7980ccgggacagg gtggcagggc gcccgcgcag
gcaggcggcc tgtgcagcgc ggcccccggc 8040gggggtcacc ctgctccctc
gtgggtcgcc ttcgcccaca ccggcgcgtg gggaacgggg 8100cttcccgcac
cccacgtgcc ctgcgcgcct ggggctctcc cacagggggc tttcgtgagc
8160caggcagcga gggccgcccc cgcgctgcag cccagccagg ccgcgccggc
agaggggatc 8220tcccaacctg ccccggcgcg cggggatttc gcctacgccg
ccccggctcc tccggacggg 8280gcgctctccc accctcaggc tcctcggtgg
cctccgcacc cgggcaaaag ccgggaggac 8340cgggacccgc agcgcgacgg
cctgccgggc ccctgcgcgg tggcacagcc tgggcccgct 8400caagcggggc
cgcagggcca aggggtgctt gcgccaccca cgtcccaggg gagtccgtgg
8460tggggctggg gccggggtcc ccaggtcgcc ggggcggcgt gggaacccca
agccggggca 8520gctccacctc cccagcccgc gcccccggac gcctccgcct
ccgcgcggca ggggcagatg 8580caaggcatcc cggcgccctc ccaggcgctc
caggagccgg cgccctggtc tgcactcccc 8640tgcggcctgc tgctggatga
gctcctggcg agcccggagt ttctgcagca ggcgcaacct 8700ctcctagaaa
cggaggcccc gggggagctg gaggcctcgg aagaggccgc ctcgctggaa
8760gcacccctca gcgaggaaga ataccgggct ctgctggagg agctttagga
cgcggggttg 8820ggacggggtc gggtggttcg gggcagggcg gtggcctctc
tttcgcgggg aacacctggc 8880tggctacgga ggggcgtgtc tccgccccgc
cccctccacc gggctgaccg gcctgggatt 8940cctgccttct aggtctaggc
ccggtgagag actccacacc gcggagaact gccattcttt 9000cctgggcatc
ccggggatcc cagagccggc ccaggtacca gcaggtgggc cgcctactgc
9060gcacgcgcgg gtttgcgggc agccgcctgg gctgtgggag cagcccgggc
agagctctcc 9120tgcctctcca ccagcccacc ccgccgcctg accgccccct
ccccaccccc caccccccac 9180ccccggaaaa cgcgtcgtcc cctgggctgg
gtggagaccc ccgtcccgcg aaacaccggg 9240ccccgcgcag cgtccgggcc
tgacaccgct ccggcggctc gcctcctatg cgcccccgcg 9300ccaccgtcgc
ccgcccgccc gggcccctgc agccgcccag gtgccagcac ggagcgcctg
9360gcggcggaac gcagacccca ggcccggcgc acaccgggga cgctgagcgt
tccaggcggg 9420agggaaggcg ggcagagatg gagagaggaa cgggagacct
agaggggcgg aaggacgggc 9480ggagggacgt taggagggag ggagggaggc
agggaggcag ggaggaacgg agggaaagac 9540agagcgacgc agggactggg
ggcgggcggg agggagccgg ggaacggggg gaggaaggca 9600gggaggaaaa
gcggtcctcg gcctccggga gtagcgggac ccccgccctc cgggaaaacg
9660gtcagcgtcc ggcgcgggct gagggctggg cccacagccg ccgcgccggc
cggcggggca 9720ccacccattc gccccggttc cgtggcccag ggagtgggcg
gtttcctccg ggacaaaaga 9780ccgggactcg ggttgccgtc gggtcttcac
ccgcgcggtt cacagaccgc acatccccag 9840gctgagccct gcaacgcggc
gcgaggccga cagccccggc cacggaggag ccacacgcag 9900gacgacggag
gcgtgatttt ggtttccgcg tggctttgcc ctccgcaagg cggcctgttg
9960ctcacgtctc tccggccccc gaaaggctgg ccatgccgac tgtttgctcc
cggagctctg 10020cgggcacccg gaaacatgca gggaagggtg caagcccggc
acggtgcctt cgctctcctt 10080gccaggttcc aaaccggcca cactgcagac
tccccacgtt gccgcacgcg ggaatccatc 10140gtcaggccat cacgccgggg
aggcatctcc tctctggggt ctcgctctgg tcttctacgt 10200ggaaatgaac
gagagccaca cgcctgcgtg tgcgagaccg tcccggcaac ggcgacgccc
10260acaggcattg cctccttcac ggagagaggg cctggcacac tcaagactcc
cacggaggtt 10320cagttccaca ctcccctcca ccctcccagg ctggtttctc
cctgctgccg acgcgtggga 10380gcccagagag cggcttcccg ttcccgcggg
atccctggag aggtccggag agccggcccc 10440cgaaacgcgc ccccctcccc
cctcccccct ctcccccttc ctcttcgtct ctccggcccc 10500accaccacca
ccgccaccac gccctccccc cccccccccc ccccccacca ccaccaccac
10560caccccgccg gccggcccca ggcctcgacg ccctgggtcc cttccggggt
ggggcgggct 10620gtcccagggg ggctcaccgc cattcatgaa ggggtggagc
ctgcctgcct gtgggccttt 10680acaagggcgg ctggctggct ggctggctgt
ccgggcaggc ctcctggctg cacctgccgc 10740agtgcacagt ccggctgagg
tgcacgggag cccgccggcc tctctctgcc cgcgtccgtc 10800cgtgaaattc
cggccggggc tcaccgcgat ggccctcccg acaccctcgg acagcaccct
10860ccccgcggaa gcccggggac gaggacggcg acggagactc gtttggaccc
cgagccaaag 10920cgaggccctg cgagcctgct ttgagcggaa cccgtacccg
ggcatcgcca ccagagaacg 10980gctggcccag gccatcggca ttccggagcc
cagggtccag atttggtttc agaatgagag 11040gtcacgccag ctgaggcagc
accggcggga atctcggccc tggcccggga gacgcggccc 11100gccagaaggc
cggcgaaagc ggaccgccgt caccggatcc cagaccgccc tgctcctccg
11160agcctttgag aaggatcgct ttccaggcat cgccgcccgg gaggagctgg
ccagagagac 11220gggcctcccg gagtccagga ttcagatctg gtttcagaat
cgaagggcca ggcacccggg 11280acagggtggc agggcgcccg cgcaggcagg
cggcctgtgc agcgcggccc ccggcggggg 11340tcaccctgct ccctcgtggg
tcgccttcgc ccacaccggc gcgtggggaa cggggcttcc 11400cgcaccccac
gtgccctgcg cgcctggggc tctcccacag ggggctttcg tgagccaggc
11460agcgagggcc gcccccgcgc tgcagcccag ccaggccgcg ccggcagagg
ggatctccca 11520acctgccccg gcgcgcgggg atttcgccta cgccgccccg
gctcctccgg acggggcgct 11580ctcccaccct caggctcctc gctggcctcc
gcacccgggc aaaagccggg aggaccggga 11640cccgcagcgc gacggcctgc
cgggcccctg cgcggtggca cagcctgggc ccgctcaagc 11700ggggccgcag
ggccaagggg tgcttgcgcc acccacgtcc caggggagtc cgtggtgggg
11760ctggggccgg ggtccccagg tcgccggggc ggcgtgggaa ccccaagccg
gggcagctcc 11820acctccccag cccgcgcccc cggacgcctc cgcctccgcg
cggcaggggc agatgcaagg 11880catcccggcg ccctcccagg cgctccagga
gccggcgccc tggtctgcac tcccctgcgg 11940cctgctgctg gatgagctcc
tggcgagccc ggagtttctg cagcaggcgc aacctctcct 12000agaaacggag
gccccggggg agctggaggc ctcggaagag gccgcctcgc tggaagcacc
12060cctcagcgag gaagaatacc gggctctgct ggaggagctt taggacgcgg
ggttgggacg 12120gggtcgggtg gttcggggca gggccgtggc ctctctttcg
cggggaacac ctggctggct 12180acggaggggc gtgtctccgc cccgccccct
ccaccgggct gaccggcctg ggattcctgc 12240cttctaggtc taggcccggt
gagagactcc acaccgcgga gaactgccat tctttcctgg 12300gcatcccggg
gatcccagag ccggcccagg tacctgcgca cgcgcgggtt tgcgggcagc
12360cgcctgggct gtgggagcag cccgggcaga gctctcctgc ctctccacca
gcccaccccg 12420ccgcctgacc gccccctccc caccccccac cccccacccc
cggaaaacgc gtcgtcccct 12480gggctgggtg gagacccccg tcccgcgaaa
caccgggccc cgcgcagcgt ccgggcctga 12540ctccgctccg gcggctcgcc
tcctgtgtgc ccccgcgcca ccgtcgcccg cccgcccggg 12600cccctgcagc
ctcccagctg ccagcgcgga gctcctggcg gtcaaaagca tacctctgtc
12660tgtctttgcc cgcttcctgg ctagacctgc gcgcagtgcg caccccggct
gacgtgcaag 12720ggagctcgct ggcctctctg tgcccttgtt cttccgtgaa
attctggctg aatgtctccc 12780cccaccttcc gacgctgtct aggcaaacct
ggattagagt tacatctcct ggatgattag 12840ttcagagata tattaaaatg
ccccctccct gtggatccta tagaagattt gcatcttttg 12900tgtgatgagt
gcagagatat gtcacaatat cccctgtaga aaaagcctga aattggttta
12960cataacttcg gtgatcagtg cagatgtgtt tcagaactcc atagtagact
gaacctagag 13020aatggttaca tcacttaggt gatcagtgta gagatatgtt
aaaattctcg tgtagacaga 13080gcctagacaa ttgttacatc acctagtgat
cagtgcaggg ataagtcata aagcctcctg 13140taggcagagt gtaggcaagt
gttccctccc tgggctgatc agtgcagaga tatctcacaa 13200agcccctata
agccaaacct tgacaagggt tacatcacct gtttgagcag tggaaatata
13260tatcacaaag ccccctgtag acaaagccca gacaattttt acatctcctg
agtgagcatt 13320ggagagatct gtcacaatgc ccctgtaggc agagcttaga
caagtgttac atcacctggg 13380tgatcagtgc agagatatgt caaaacgctc
ctgtagtctg aacctagaca ggagttacat 13440caccttgggg atcagtgcag
agatacgtga gaattcc 13477716123DNAHomo sapiens 71aggggtggag
cctgcctgcc tgtgggcctt tacaagggcg gctggctggc tggccggctg 60tccgggcagg
cctcctggct gcacctgccg cagtgcacag tccggctgag gtgcacggga
120gcccgccggc ctctctctgc ccgcgtccgt ccgtgaaatt ccggccgggg
ctcaccgcga 180tggccctccc gacaccctcg gacagcaccc tccccgcgga
agcccgggga cgaggacggc 240gacggagact cgtttggacc ccgagccaaa
gcgaggccct gcgagcctgc tttgagcgga 300acccgtaccc gggcatcgcc
accagagaac ggctggccca ggccatcggc attccggagc 360ccagggtcca
gatttggttt cagaatgaga ggtcacgcca gctgaggcag caccggcggg
420aatctcggcc ctggcccggg agacgcggcc cgccagaagg ccggcgaaag
cggaccgccg 480tcaccggatc ccagaccgcc ctgctcctcc gagcctttga
gaaggatcgc tttccaggca 540tcgccgcccg ggaggagctg gccagagaga
cgggcctccc ggagtccagg attcagatct 600ggtttcagaa tcgaagggcc
aggcacccgg gacagggtgg cagggcgccc gcgcaggcag 660gcggcctgtg
cagcgcggcc cccggcgggg gtcaccctgc tccctcgtgg gtcgccttcg
720cccacaccgg cgcgtgggga acggggcttc ccgcacccca cgtgccctgc
gcgcctgggg 780ctctcccaca gggggctttc gtgagccagg cagcgagggc
cgcccccgcg ctgcagccca 840gccaggccgc gccggcagag gggatctccc
aacctgcccc ggcgcgcggg gatttcgcct 900acgccgcccc ggctcctccg
gacggggcgc tctcccaccc tcaggctcct cggtggcctc 960cgcacccggg
caaaagccgg gaggaccggg acccgcagcg cgacggcctg ccgggcccct
1020gcgcggtggc acagcctggg cccgctcaag cggggccgca gggccaaggg
gtgcttgcgc 1080cacccacgtc ccaggggagt ccgtggtggg gctggggccg
gggtccccag gtcgccgggg 1140cggcgtggga accccaagcc ggggcagctc
cacctcccca gcccgcgccc ccggacgcct 1200ccgcctccgc gcggcagggg
cagatgcaag gcatcccggc gccctcccag gcgctccagg 1260agccggcgcc
ctggtctgca ctcccctgcg gcctgctgct ggatgagctc ctggcgagcc
1320cggagtttct gcagcaggcg caacctctcc tagaaacgga ggccccgggg
gagctggagg 1380cctcggaaga ggccgcctcg ctggaagcac ccctcagcga
ggaagaatac cgggctctgc 1440tggaggagct ttaggacgcg gggttgggac
ggggtcgggt ggttcggggc agggcggtgg 1500cctctctttc gcggggaaca
cctggctggc tacggagggg cgtgtctccg ccccgccccc 1560tccaccgggc
tgaccggcct gggattcctg ccttctaggt ctaggcccgg tgagagactc
1620cacaccgcgg agaactgcca ttctttcctg ggcatcccgg ggatcccaga
gccggcccag 1680gtaccagcag gtgggccgcc tactgcgcac gcgcgggttt
gcgggcagcc gcctgggctg 1740tgggagcagc ccgggcagag ctctcctgcc
tctccaccag cccaccccgc cgcctgaccg 1800ccccctcccc accccccacc
ccccaccccc ggaaaacgcg tcgtcccctg ggctgggtgg 1860agacccccgt
cccgcgaaac accgggcccc gcgcagcgtc cgggcctgac accgctccgg
1920cggctcgcct cctatgcgcc cccgcgccac cgtcgcccgc ccgcccgggc
ccctgcagcc 1980gcccaggtgc cagcacggag cgcctggcgg cggaacgcag
accccaggcc cggcgcacac 2040cggggacgct gagcgttcca ggcgggaggg
aaggcgggca gagatggaga gaggaacggg 2100agacctagag gggcggaagg
acgggcggag ggacgttagg agggagggag ggaggcaggg 2160aggcagggag
gaacggaggg aaagacagag cgacgcaggg actgggggcg ggcgggaggg
2220agccggggaa cggggggagg aaggcaggga ggaaaagcgg tcctcggcct
ccgggagtag 2280cgggaccccc gccctccggg aaaacggtca gcgtccggcg
cgggctgagg gctgggccca 2340cagccgccgc gccggccggc ggggcaccac
ccattcgccc cggttccgtg gcccagggag 2400tgggcggttt cctccgggac
aaaagaccgg gactcgggtt gccgtcgggt cttcacccgc 2460gcggttcaca
gaccgcacat ccccaggctg agccctgcaa cgcggcgcga ggccgacagc
2520cccggccacg gaggagccac acgcaggacg acggaggcgt gattttggtt
tccgcgtggc 2580tttgccctcc gcaaggcggc ctgttgctca cgtctctccg
gcccccgaaa ggctggccat 2640gccgactgtt tgctcccgga gctctgcggg
cacccggaaa catgcaggga agggtgcaag 2700cccggcacgg tgccttcgct
ctccttgcca ggttccaaac cggccacact gcagactccc 2760cacgttgccg
cacgcgggaa tccatcgtca ggccatcacg ccggggaggc atctcctctc
2820tggggtctcg ctctggtctt ctacgtggaa atgaacgaga gccacacgcc
tgcgtgtgcg 2880agaccgtccc ggcaacggcg acgcccacag gcattgcctc
cttcacggag agagggcctg 2940gcacactcaa gactcccacg gaggttcagt
tccacactcc cctccaccct cccaggctgg 3000tttctccctg ctgccgacgc
gtgggagccc agagagcggc ttcccgttcc cgcgggatcc 3060ctggagaggt
ccggagagcc ggcccccgaa acgcgccccc ctcccccctc ccccctctcc
3120cccttcctct tcgtctctcc ggccccacca ccaccaccgc caccacgccc
tccccccccc 3180cccccccccc ccaccaccac caccaccacc ccgccggccg
gccccaggcc tcgacgccct 3240gggtcccttc cggggtgggg cgggctgtcc
caggggggct caccgccatt catgaagggg 3300tggagcctgc ctgcctgtgg
gcctttacaa gggcggctgg ctggctggct ggctgtccgg 3360gcaggcctcc
tggctgcacc tgccgcagtg cacagtccgg ctgaggtgca cgggagcccg
3420ccggcctctc tctgcccgcg tccgtccgtg aaattccggc cggggctcac
cgcgatggcc 3480ctcccgacac cctcggacag caccctcccc gcggaagccc
ggggacgagg acggcgacgg 3540agactcgttt ggaccccgag ccaaagcgag
gccctgcgag cctgctttga gcggaacccg 3600tacccgggca tcgccaccag
agaacggctg gcccaggcca tcggcattcc ggagcccagg 3660gtccagattt
ggtttcagaa tgagaggtca cgccagctga ggcagcaccg gcgggaatct
3720cggccctggc ccgggagacg cggcccgcca gaaggccggc gaaagcggac
cgccgtcacc 3780ggatcccaga ccgccctgct cctccgagcc tttgagaagg
atcgctttcc aggcatcgcc 3840gcccgggagg agctggccag agagacgggc
ctcccggagt ccaggattca gatctggttt 3900cagaatcgaa gggccaggca
cccgggacag ggtggcaggg cgcccgcgca ggcaggcggc 3960ctgtgcagcg
cggcccccgg cgggggtcac cctgctccct cgtgggtcgc cttcgcccac
4020accggcgcgt ggggaacggg gcttcccgca ccccacgtgc cctgcgcgcc
tggggctctc 4080ccacaggggg ctttcgtgag ccaggcagcg agggccgccc
ccgcgctgca gcccagccag 4140gccgcgccgg cagaggggat ctcccaacct
gccccggcgc gcggggattt cgcctacgcc 4200gccccggctc ctccggacgg
ggcgctctcc caccctcagg ctcctcgctg gcctccgcac 4260ccgggcaaaa
gccgggagga ccgggacccg cagcgcgacg gcctgccggg cccctgcgcg
4320gtggcacagc ctgggcccgc tcaagcgggg ccgcagggcc aaggggtgct
tgcgccaccc 4380acgtcccagg ggagtccgtg gtggggctgg ggccggggtc
cccaggtcgc cggggcggcg 4440tgggaacccc aagccggggc agctccacct
ccccagcccg cgcccccgga cgcctccgcc 4500tccgcgcggc aggggcagat
gcaaggcatc ccggcgccct cccaggcgct ccaggagccg 4560gcgccctggt
ctgcactccc ctgcggcctg ctgctggatg agctcctggc gagcccggag
4620tttctgcagc aggcgcaacc tctcctagaa acggaggccc cgggggagct
ggaggcctcg 4680gaagaggccg cctcgctgga agcacccctc agcgaggaag
aataccgggc tctgctggag 4740gagctttagg acgcggggtt gggacggggt
cgggtggttc ggggcagggc cgtggcctct 4800ctttcgcggg gaacacctgg
ctggctacgg aggggcgtgt ctccgccccg ccccctccac 4860cgggctgacc
ggcctgggat tcctgccttc taggtctagg cccggtgaga gactccacac
4920cgcggagaac tgccattctt tcctgggcat cccggggatc ccagagccgg
cccaggtacc 4980tgcgcacgcg cgggtttgcg ggcagccgcc tgggctgtgg
gagcagcccg ggcagagctc 5040tcctgcctct ccaccagccc accccgccgc
ctgaccgccc cctccccacc ccccaccccc 5100cacccccgga aaacgcgtcg
tcccctgggc tgggtggaga cccccgtccc gcgaaacacc 5160gggccccgcg
cagcgtccgg gcctgactcc gctccggcgg ctcgcctcct gtgtgccccc
5220gcgccaccgt cgcccgcccg cccgggcccc tgcagcctcc cagctgccag
cgcggagctc 5280ctggcggtca aaagcatacc tctgtctgtc tttgcccgct
tcctggctag acctgcgcgc 5340agtgcgcacc ccggctgacg tgcaagggag
ctcgctggcc tctctgtgcc cttgttcttc 5400cgtgaaattc tggctgaatg
tctcccccca ccttccgacg ctgtctaggc aaacctggat 5460tagagttaca
tctcctggat gattagttca gagatatatt aaaatgcccc ctccctgtgg
5520atcctataga agatttgcat cttttgtgtg atgagtgcag agatatgtca
caatatcccc 5580tgtagaaaaa gcctgaaatt ggtttacata acttcggtga
tcagtgcaga tgtgtttcag 5640aactccatag tagactgaac ctagagaatg
gttacatcac ttaggtgatc agtgtagaga 5700tatgttaaaa ttctcgtgta
gacagagcct agacaattgt tacatcacct agtgatcagt 5760gcagggataa
gtcataaagc ctcctgtagg cagagtgtag gcaagtgttc cctccctggg
5820ctgatcagtg cagagatatc tcacaaagcc cctataagcc aaaccttgac
aagggttaca 5880tcacctgttt gagcagtgga
aatatatatc acaaagcccc ctgtagacaa agcccagaca 5940atttttacat
ctcctgagtg agcattggag agatctgtca caatgcccct gtaggcagag
6000cttagacaag tgttacatca cctgggtgat cagtgcagag atatgtcaaa
acgctcctgt 6060agtctgaacc tagacaggag ttacatcacc ttggggatca
gtgcagagat acgtgagaat 6120tcc 6123
* * * * *
References