U.S. patent application number 17/168709 was filed with the patent office on 2021-06-03 for topical formulations based on ionic species for skin treatment.
The applicant listed for this patent is The Regents of the University of California. Invention is credited to Samir Mitragotri, Michael Zakrewsky.
Application Number | 20210162050 17/168709 |
Document ID | / |
Family ID | 1000005391219 |
Filed Date | 2021-06-03 |
United States Patent
Application |
20210162050 |
Kind Code |
A1 |
Zakrewsky; Michael ; et
al. |
June 3, 2021 |
TOPICAL FORMULATIONS BASED ON IONIC SPECIES FOR SKIN TREATMENT
Abstract
Compositions containing a complex that contains a cation with
alkyl chains and a macromolecule anion, and methods of making and
using are disclosed. The compositions are typically charge neutral
and a liquid at room temperature and standard pressure. The
macromolecule anions may be nucleic acids, peptides, proteins,
and/or carbohydrates. The compositions have enhanced penetration
across the skin barrier (stratum corneum) and into the skin cells,
delivering the macromolecules to the skin cells. The compositions
are topically applied to the skin and are particularly useful for
treatment of skin conditions.
Inventors: |
Zakrewsky; Michael; (San
Diego, CA) ; Mitragotri; Samir; (Lexington,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Regents of the University of California |
Oakland |
CA |
US |
|
|
Family ID: |
1000005391219 |
Appl. No.: |
17/168709 |
Filed: |
February 5, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16329574 |
Feb 28, 2019 |
10912834 |
|
|
PCT/US2017/049170 |
Aug 29, 2017 |
|
|
|
17168709 |
|
|
|
|
62380761 |
Aug 29, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 8/416 20130101;
A61K 47/36 20130101; A61K 47/186 20130101; A61K 31/713 20130101;
A61K 9/0014 20130101; A61K 38/385 20130101; A61Q 19/08 20130101;
A61K 8/735 20130101; A61K 47/42 20130101 |
International
Class: |
A61K 47/18 20060101
A61K047/18; A61K 9/00 20060101 A61K009/00; A61K 47/42 20060101
A61K047/42; A61K 47/36 20060101 A61K047/36; A61K 8/41 20060101
A61K008/41; A61K 8/73 20060101 A61K008/73; A61K 31/713 20060101
A61K031/713; A61K 38/38 20060101 A61K038/38; A61Q 19/08 20060101
A61Q019/08 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with Government support under Grant
No. 5R21CA19133-02 awarded by the National Institutes of Health.
The Government has certain rights in this invention.
Claims
1. A composition for transdermal delivery of a macromolecule
comprising a complex comprising a macromolecule anion, and a
cation; wherein the complex is non-irritating to the skin, and
wherein the composition is in a form suitable for topical
application to the skin.
2. The composition of claim 1, wherein the composition is a liquid
at room temperature and standard pressure.
3. The composition of claim 1 or claim 2, wherein the macromolecule
anion and the cation are present in a charge ratio of 0.5:1, 1:1,
or 2:1.
4. The composition of any one of claims 1-3, wherein the
macromolecule anion is a macromolecule selected from the group
consisting of nucleic acids, peptides, proteins, and
polysaccharides.
5. The composition of any one of claims 1-4, wherein the
macromolecule anion is a nucleic acid.
6. The composition of any one of claims 1-5, wherein the
macromolecule anion is an RNA interference molecule selected from
the group consisting of microRNA (miRNA), short hairpin RNA
(shRNA), and small interfering RNA (siRNA), preferably wherein the
macromolecule anion is siRNA.
7. The composition of any one of claims 1-6, wherein the
macromolecule anion is a double stranded siRNA, wherein each strand
has a length ranging from 20 to 25 nucleotides.
8. The composition of any one of claims 1-7, wherein the
macromolecule anion is a double stranded siRNA, wherein each strand
has a length of 23 nucleotides.
9. The composition of any one of claims 1-7, wherein the
macromolecule anion is a double stranded siRNA, wherein each strand
has a length of 21 nucleotides.
10. The composition of any one of claims 1-4, wherein the
macromolecule anion is a polysaccharide.
11. The composition of claim 10, wherein the polysaccharide is
selected from the group consisting of hyaluronic acid,
carboxymethylcellulose, gum arabic, honey, hydroxypropyl starch
phosphate, mucopolysaccharides, chondroitins, pectin, sugar
tensides, seaweed polysaccharides, tragant, xanthan gum, and
derivatives thereof, and combinations thereof, preferably wherein
the polysaccharide is hyaluronic acid.
12. The composition of any one of claims 1-11, wherein the cation
comprises an alkyl chain with a length ranging from three carbon
atoms to twenty carbon atoms.
13. The composition of any one of claims 1-12, wherein the cation
comprises an alkyl chain with a length ranging from six carbon
atoms to sixteen carbon atoms.
14. The composition of any one of claims 1-13, wherein the cation
has the structure of Formula II: ##STR00015## wherein n is an
integer ranging from 3 to 19, inclusive.
15. The composition of claim 14, wherein the cationic surfactant is
not benzyldimethyldodecyl ammonium.
16. The composition of claim 14, wherein the cation is a cationic
surfactant selected from the group consisting of
benzyldimethyloctyl ammonium, benzyldimethyltetradecyl ammonium,
and benzyldimethylstearyl ammonium.
17. The composition of any one of claims 1-16, wherein the
hydrophobicity of the complex, as determined by its octanol/water
partition coefficient (P.sub.o/w), is increased by at least one log
unit (Log P.sub.o/w) compared to the hydrophobicity of the
macromolecule anion when it is complexed with a sodium cation.
18. The composition of claim 17, wherein the hydrophobicity of the
complex is increased by 1 to 5 log units (Log P.sub.o/w) when
compared to the hydrophobicity of the macromolecule anion when it
is complexed with a sodium cation.
19. The composition of any one of claims 1-18, wherein the cation
increases the hydrophobicity of the macromolecule anion sufficient
to cross the stratum corneum in the absence of additional
treatments to increase porosity or remove the stratum corneum.
20. The composition of any one of claims 1-19, wherein either or
both the macromolecule anion and the cation alone are irritating to
the skin.
21. The composition of any one of claims 1-20, wherein the
composition has substantially the same cytotoxicity to cells in
vitro relative to the cytotoxicity in vitro of the macromolecule
anion complexed with a sodium cation.
22. The composition of any one of claims 1-21, wherein the complex
is charge neutral.
23. The composition of any one of claims 1-13, wherein the cation
has the structure of Formula I, ##STR00016## wherein Q is nitrogen
(N) or phosphorus (P), wherein R1, R2, R3, and R4 are independently
absent, hydrogen, substituted alkyl, unsubstituted alkyl,
substituted alkenyl, unsubstituted alkenyl, substituted alkynyl,
unsubstituted alkynyl, substituted alkoxy, unsubstituted alkoxy,
substituted amino, unsubstituted amino, substituted alkylamino,
unsubstituted alkylamino, substituted alkylthio, or unsubstituted
alkylthio, substituted aryl, unsubstituted aryl, substituted
heteroaryl, unsubstituted heteroaryl, substituted C3-C30
cycloalkyl, unsubstituted C3-C30 cycloalkyl, substituted
heterocyclyl, unsubstituted heterocyclyl, and any pair of R1, R2,
R3, and R4 independently combine to form five- and/or six-membered
rings, wherein the five- and/or six-membered rings formed from
combining any pair of R1, R2, R3, and R4 optionally include an
additional heteroatom.
24. The composition of claim 23, wherein the cation is not
cetyltrimethyl ammonium, decyltrimethyl ammonium,
benzyldimethyldodecyl ammonium, myristyltrimethyl ammonium, or
dodecyl pyridinium.
25. The composition of claim 23, wherein at least one of R1, R2,
R3, and R4 is independently a substituted alkyl, wherein the
substituted alkyl is a substituted aralkyl or unsubstituted
aralkyl.
26. The composition of claim 23, wherein at least one of R1, R2,
R3, and R4 is independently a substituted alkyl, wherein the
substituted alkyl is a substituted aralkyl or unsubstituted
aralkyl, with the proviso that the cation is not benzyldimethyl
dodecyl ammonium.
27. The composition of claim 23, wherein R1 is independently a
substituted alkyl, wherein the substituted alkyl is a substituted
aralkyl or unsubstituted aralkyl, R2, R3, and R4 are independently
substituted alkyl or unsubstituted alkyl, with the proviso that
when R2, R3, and R4 are substituted alkyls, the substituted alkyl
is not a substituted aralkyl or unsubstituted aralkyl.
28. The composition of claim 23, wherein R1 is independently a
substituted alkyl, wherein the substituted alkyl is a substituted
aralkyl or unsubstituted aralkyl, wherein R2, R3, and R4 are
independently substituted alkyl or unsubstituted alkyl, with the
proviso that when R2, R3, and R4 are substituted alkyls, the
substituted alkyl is not a substituted aralkyl or unsubstituted
aralkyl, and with the proviso that the cationic surfactant is not
benzyldimethyl dodecyl ammonium.
29. A method of treating one or more skin conditions in a subject
in need thereof, the method comprising topically administering to
the skin of the subject an effective amount of the composition of
any one of claims 1-28.
30. The method of claim 29, wherein prior to, subsequent to or
simultaneous with the step of topically administering the
composition, the skin is not subjected to additional treatments to
increase the porosity of the skin, remove all or a portion of the
stratum corneum, push the complex through the stratum corneum, or
otherwise aid in transport of the composition or the complex
through one or more layers of the skin.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of and priority to U.S.
Ser. No. 62/380,761, filed Aug. 29, 2016, and where permissible is
hereby incorporated by reference in its entirety.
REFERENCE TO SEQUENCE LISTING
[0003] The Sequence Listing submitted as a text file named
"UCSB_2017_042_ST25.txt," created on Aug. 15, 2016, and having a
size of 3,132 bytes is hereby incorporated by reference pursuant to
37 C.F.R. .sctn. 1.52(e)(5).
FIELD OF THE INVENTION
[0004] The field of the invention is transdermal drug delivery
formulations, and topically administered formulations, such as for
the treatment of skin diseases, and methods for making and using
these formulations.
BACKGROUND OF THE INVENTION
[0005] Skin disease is one of the most common human illnesses
affecting upwards of 70% of the population globally (Hay et al.,
Journal of Investigative Dermatology, 134:1527-1534 (2014)).
Symptoms of skin disease range from purely cosmetic (e.g.
cellulite, wrinkling, and brown spots) to debilitating and even
deadly (e.g. severe pain, skin barrier disruption, dehydration, and
systemic infection) (Zakrewsky et al., Journal of Controlled
Release, 218:445-456 (2015)). High prevalence of skin disease and
outward presentation of symptoms combined with high rates of
morbidity and mortality associated with severe skin disease results
in significant physical, emotional, and economic burden (Hay et
al., Journal of Investigative Dermatology, 134:1527-1534 (2014);
Bickers et al., Journal of the American Academy of Dermatology,
55:490-500 (2006)). Skin disease is estimated to be the fourth
leading cause of non-fatal disease burden globally, more burdensome
than chronic obstructive pulmonary disease, diabetes mellitus,
osteoarthritis, and drug abuse (Hay et al., Journal of
Investigative Dermatology, 134:1527-1534 (2014). However, effective
treatment of skin disease remains poorly addressed (Hay et al.,
Journal of Investigative Dermatology, 134:1527-1534 (2014); Bickers
et al., Journal of the American Academy of Dermatology, 55:490-500
(2006); Freeman E. E., Journal of Investigative Dermatology,
134:2663-2665 (2014)).
[0006] Topical and transdermal drug delivery provide many
advantages over other common delivery routes, such as oral,
subcutaneous, and intravenous. These advantages include avoidance
of major degradative pathways associated with the gastrointestinal
(GI) tract, reduction in side effects associated with systemic
toxicity, and needle-free drug administration. Brown, et al.,
"Dermal and transdermal drug delivery systems: current and future
prospects", Drug Delivery, 13:175-87 (2006).
[0007] Unfortunately, the outermost layer of the skin, the stratum
corneum (SC), functions as a barrier to most foreign material and
severely limits passive diffusion of many molecules. To overcome
this barrier, several strategies have been employed, including the
use of chemical penetration enhancers (CPEs). CPEs have been shown
to enhance transport through the skin, for a variety of molecules,
by disrupting the lipid composition and organization in the SC
(Karande, et al., Proceedings of the National Academy of Sciences
of the United States of America, 102:4688-93 (2005)). However, the
extent of lipid disruption often correlates closely with skin
irritation (Karande 2005).
[0008] For the treatment of bacterial skin infections, a second
transport barrier to drug delivery exists--the bacterial biofilm.
Biofilm-protected bacteria account for 65% of bacterial infections
in humans and are 50-500 times more resistant to antibiotics than
unprotected bacteria. Palmer, et al., "Molecular techniques to
detect biofilm bacteria in long bone nonunion: a case report",
Clinical orthopaedics and related research, 469:3037-42 (2011). The
antibiotic resistance is due to the transport barrier posed by
extracellular polymeric substances (EPS), e.g. polysaccharides,
humic acids and nucleic acids. Although the chemical compositions
of the SC and bacterial biofilm are different, overcoming the
transport barrier posed by the SC and biofilm can be accomplished
in a similar manner, such as through fluidization or extraction of
the barrier components by a suitable solvent.
[0009] For example, extensive efforts have been expended to achieve
more effective delivery of topical siRNA. Strategies to overcome
the SC barrier include physical methods such as microneedle patches
(Chong et al., Journal of Controlled Release, 166:211-219 (2013))
and laser ablation (Lee et al., Human gene therapy, 20:580-588
(2009)), active methods such as sonophoresis (Tran et al., 8.sup.th
International Symposium on Therapeutic Ultrasound, 423-427 (2009))
and iontophoresis (Kigasawa et al., International journal of
pharmaceutics, 383:157-160 (2010)), and passive methods such as
peptides (Hsu et al., Proceedings of the National Academy of
Sciences of the United States of America, 108:15816-15821 (2011);
Lin et al., Archives of Dermatological Research, 304:139-144
(2012); Uchida, et al., Journal of Pharmacology and Experimental
Therapeutics, 388:443-450 (2011); Yi et al., Molecular Therapy,
19:362-371 (2011)) and spherical nucleic acids (Randeria et al.,
Proceedings of the National Academy of Sciences of the United
States of America, 112:5573-5578 (2015); Zheng et al., Proceedings
of the National Academy of Sciences of the United States of
America, 109:11975-11980 (2012)).
[0010] Skin disease symptoms, however, typically manifest over
large surface areas and often limit the use of device-based
methods. Passive delivery methods are often useful for application
on large surface areas; however, current passive methods have
limitations including complex synthesis and the necessity to use
siRNA conjugation chemistries (Hsu et al., Proceedings of the
National Academy of Sciences of the United States of America,
108:15816-15821 (2011); Chen et al., Journal of Controlled Release,
179:33-41 (2014); Meade et al., Nat Biotech, 32:1256-1261 (2014);
Cutler et al., Journal of the American Chemical Society,
132:1376-1391 (2012)).
[0011] There is a need for compositions and methods that improve
transdermal transport of therapeutic compositions without
irritating the skin.
[0012] Therefore, it is an object of the invention to provide
compositions for improved transdermal transport of therapeutic,
prophylactic, or diagnostic agents.
[0013] It is a further object of the invention to provide improved
compositions for the treatment of diseases and disorders within the
skin.
[0014] It is a further object of the invention to provide methods
for improving transdermal transport of therapeutic, prophylactic,
or diagnostic agents.
[0015] It is a still further object of the invention to provide
improved methods for treatment of diseases and disorders of the
skin.
SUMMARY OF THE INVENTION
[0016] Disclosed herein are compositions for improved transdermal
transport of therapeutic, prophylactic, or diagnostic agents. The
compositions include complexes of macromolecular anions and cations
with alkyl chains. The compositions are typically charge neutral,
and in liquid form at room temperature and standard pressure. In
some aspects, the ratio of macromolecular anions and alkyl chain
cations may deviate from 1:1. In this aspect, additional small
counterions such as sodium or chloride may be present in a
sufficient amount to provide a charge neutral composition.
[0017] Suitable macromolecular anions include RNA interference
molecules, such as small interfering RNA (siRNA), small hairpin RNA
(shRNA), and microRNA (miRNA), peptides, proteins, and/or
polysaccharides, such as hyaluronic acid.
[0018] Suitable cations with alkyl chains include benzyl dimethyl
alkyls, such as benzyl dimethyl octyl ammonium (BDOA), benzyl
dimethyl tetradecyl ammonium (BDTA), benzyl dimethyl stearyl
ammonium (BDSA). In some embodiments, the cation contains 8 carbons
in the alkyl chain, such as benzyl dimethyl octyl ammonium (BDOA)
or the cation contains 18 carbons in the alkyl chain, such as
benzyl dimethyl stearyl ammonium (BDSA).
[0019] Typically, the alkyl chain lengths of cations confer
desirable properties to the complexes so that the complexes can
transport through the skin barrier (SC) and enter skin cells. The
desirable properties include sufficient hydrophobicity,
hydrodynamic size, and non-irritating to the skin.
[0020] The compositions described herein are suitable for topical
administration to the skin without the use of devices to push the
composition through the stratum corneum and/or epidermis, modify
the porosity of the skin, remove layers from the skin, or pierce
the skin, such as microneedle devices, elecroprators or
ionoporators. Typically, no additional interventions to the skin,
such as injections, sonophoresis, abrasion, electroporation, or
ionoporation, are needed to deliver the agent in the compositions
through the stratum corneum, optionally to one or more layers of
the epidermis.
[0021] The compositions described herein are of suitable
hydrophobicity to cross the skin barrier and enter skin cells.
Preferably the agent is delivered through the epidermis and into
the dermis. Optionally, the agent is delivered beyond the
dermis.
[0022] The compositions are useful for treating one or more
conditions of the skin, including cosmetic or disease conditions.
Cosmetic conditions include wrinkling, age spots (liver spots),
scarring, acne, and the like. Disease conditions include
inflammatory, infectious, autoimmune, allergic, neoplastic, and
other chronic, acquired or acute diseases of the skin.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 is a line graph showing a change in octanol-water
partitioning coefficient P.sub.o/w in log scale (Log P.sub.o/w) as
a function of alkyl chain length for benzyl dimethyl alkyl ammonium
chlorides and robed-siRNAs for varying alkyl chain lengths. Error
bars represent mean+SD for n=3. Log P.sub.o/w for chloride salts
are published experimental and predicted values (See Table 2).
[0024] FIGS. 2A and 2B are bar graphs showing the percentage of the
applied dose of free siRNA, or robed-siRNA delivered to different
skin layers of porcine skin. FIG. 2A shows the percent applied dose
delivered for the siRNA1. Transdermal delivery of siRNA1 is
significantly enhanced when robed with IL moieties. Delivery depth
increases from left to right. Naked FAM-siRNA1 (open bars),
BDOA-FAM-siRNA1 (hatched bars), BDTA-FAM-siRNA1 (cross-hatched
bars), and BDSA-FAM-siRNA1 (closed bars). Error bars represent
mean+SD for n=3. * p<0.05 compared to naked FAM-siRNA (open
bars). FIG. 2B shows the percent applied dose delivered for siRNA2.
Delivery depth increases from left to right. Naked FAM-siRNA2 (open
bars), BDOA-FAM-siRNA2 (hatched bars), BDTA-FAM-siRNA2
(cross-hatched bars), and BDSA-FAM-siRNA2 (closed bars). Error bars
represent mean+SD for n=3. * p<0.05 compared to naked siRNA2
(open bars).
[0025] FIGS. 3A, 3B, and 3C are line graphs showing percent cell
viability relative to control when cells were incubated with the
various concentrations of: naked FAM-siRNA1 and robed-FAMsiRNA1s
(FIG. 3A), naked FAM-siRNA1 and IL moieties alone (FIG. 3B), or
naked FAM-siRNA2 and robed-FAM-siRNA2s (FIG. 3C) after 4 hour
incubation. Error bars represent mean+SD for n=6. * p<0.05
relative to control (incubated with media alone).
[0026] FIG. 4 is a line graph showing percent cell viability
relative to control when HEKa cells were incubated with the various
concentrations (nM) of BDOA-FAM-siRNA1 for 72 hours. Error bars
represent mean+SD for n=6. * p<0.05 relative to control
(incubated with media alone).
[0027] FIG. 5 is a bar graph showing change in GAPDH protein level
(GAPDH per total protein (normalized to untreated control)) when
HEKa cells were incubated with various formulations of siRNA1, or
were left untreated. BDOA-siRNA1 results in significant gene
silencing in HEKa cells in vitro. GAPDH expression is relative to
control (cells incubated with media alone). Error bars represent
mean+SD for n=6. * p<0.05 compared to control.
[0028] FIG. 6 is a bar graph showing change in percent viability
(relative to no UV control) of skin cells treated with various
formulations of siRNA. BDOA-siRNA does not cause skin irritation
following application to MatTek Epiderm.TM. tissues. % Viability is
normalized by the control (tissue not exposed to UV light). Error
bars represent mean+SD for n=3. No statistically significant
differences were observed.
[0029] FIG. 7A is a bar graph showing change in normalized elastase
levels in MatTek Epiderm.TM. tissues treated with various
formulations of siRNA and UV, treated with UV and saline, or
untreated (no UV). FIG. 7B is a bar graph showing change in
normalized elastin levels in MatTek Epiderm.TM. tissues treated
with various formulations of siRNA and UV, treated with UV and
saline, or untreated (no UV). Robed-siRNA significantly limited
elastase upregulation and subsequent elastin degradation following
MatTek Epiderm.RTM. tissue irradiation with UVB light. Elastase
expression is normalized by the UV control (tissue exposed to UV
light and treated with saline). Elastin expression is normalized by
the no UV control (tissue not exposed to UV light). Error bars
represent mean+SD for n=3. ** p<0.01 compared to UV; saline
control. * p<0.05 compared to the no UV control.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0030] The term "alkyl chain" refers to straight-chain,
branched-chain and cyclic hydrocarbon groups. Unless specified
otherwise, alkyl groups include hydrocarbon groups containing one
or more double or triple bonds. An alkyl group containing at least
one ring system is a cycloalkyl group. An alkyl group containing at
least one double bond is an alkenyl group, and an alkyl group
containing at least one triple bond is an alkynyl group.
[0031] "Nucleic acids" refer to polymers made from at least two
nucleotides. Nucleic acids may be single stranded, as in the case
of RNA, or double stranded, as in the case of DNA. Nucleic acids
may be made from naturally occurring nucleotides, or may contain
one or more non-natural nucleotides. The nucleic acid may also
include derivatives and analogs of nucleic acids, including peptide
nucleic acids (a polyamino acid sequence substituted by purine and
pyrimidine bases) and glycol nucleic acids (wherein the cyclic
ribose component is replaced by an acyclic di- or triol linked by
phosphodiester bonds).
[0032] The term "polysaccharide" refers to a compound made from at
least two monosaccharide units which are linked via a glycosylic
(or glycosidic) bond. Unless otherwise specified, a polysaccharide
may contain only sugar components, or may contain non-sugar
components as well, such as amino acids and small molecule
aglycones. Polysaccharides having a molecular weight greater than
about 10,000 Da may be designated "high-molecular-weight
polysaccharides," whereas polysaccharides having a molecular weight
less than about 10,000 Da may be designated "low-molecular-weight
polysaccharides." Polysaccharide molecular weight may be determined
using standard methods known to one skilled in the art, including,
but not limited to, mass spectrometry (e.g., of digested fragments
by ESI or MALDI) or calculation from known carbohydrate sequences.
Polysaccharides can be naturally occurring or non-naturally
occurring, synthetic, or semi-synthetic.
[0033] The term "protein" refers to a polymer of amino acids linked
to each other by peptide bonds to form a polypeptide for which the
chain length is sufficient to produce at least a detectable
tertiary structure. Proteins having a molecular weight greater than
about 100 kDa may be designated "high-molecular-weight proteins,"
whereas proteins having a molecular weight less than about 100 kDa
may be designated "low-molecular-weight proteins." The term
"low-molecular-weight protein" excludes small peptides lacking the
requisite of at least tertiary structure necessary to be considered
a protein. Protein molecular weight may be determined using
standard methods known to one skilled in the art, including, but
not limited to, mass spectrometry (e.g., ESI, MALDI) or calculation
from known amino acid sequences and glycosylation. Proteins can be
naturally occurring or non-naturally occurring, synthetic, or
semi-synthetic.
[0034] "Hydrophilic" refers to substances that have strongly polar
groups that readily interact with water. Hydrophilicity can be
quantified by measuring its partition coefficient between water (or
a buffered aqueous solution) and a water-immiscible organic
solvent, such as octanol, methylene chloride, or methyl tert-butyl
ether. If after equilibration a greater concentration of the
compound is attained in water than in the organic solvent, then the
compound is considered hydrophilic. For example, if the organic
solvent is octanol, then a negative log P value indicates that the
compound is hydrophilic.
[0035] "Hydrophobic" refers to substances that lack an affinity for
water; tending to repel and not absorb water as well as not
dissolve in or mix with water. Hydrophobicity can be quantified by
measuring its partition coefficient between water (or a buffered
aqueous solution) and a water-immiscible organic solvent, such as
octanol, methylene chloride, or methyl tert-butyl ether. If after
equilibration a greater concentration of the compound is attained
in the organic solvent than in water, the compound is considered
hydrophobic. For example, if the organic solvent is octanol, then a
positive log P value indicates that the compound is
hydrophobic.
[0036] The term "effective amount" or "therapeutically effective
amount" means a dosage sufficient to treat, inhibit, or alleviate
one or more symptoms of a disease state or condition being treated
or to otherwise provide a desired pharmacologic and/or physiologic
effect. The precise dosage depends on a variety of factors such as
subject-dependent variables (e.g., age, immune system health,
etc.), the disease or disorder, and the treatment being
administered. The effect of the effective amount can be relative to
a control. Such controls are known in the art and discussed herein,
and can be, for example the condition of the subject prior to or in
the absence of administration of the drug, or drug combination, or
in the case of drug combinations, the effect of the combination can
be compared to the effect of administration of only one of the
drugs.
[0037] The numerical ranges provided herein are inclusive of all
values in a given range. This includes the given minimum value, the
given maximum value, as well as values between the minimum value
and the maximum value, unless otherwise specified. For numerical
ranges referring to integers, the ranges are inclusive of all
integers between the minimum value and the maximum value, unless
otherwise specified.
[0038] Use of the term "about" generally describes values either
above or below the stated value in a range of approximately +/-10%;
in other aspects the values may range in value either above or
below the stated value in a range of approximately +/-5%; in other
aspects the values may range in value either above or below the
stated value in a range of approximately +/-2%; in other aspects
the values may range in value either above or below the stated
value in a range of approximately +/-1%. The preceding ranges are
intended to be made clear by context, and no further limitation is
implied.
II. Composition
[0039] The compositions described herein include complexes of
macromolecular anions and cations with alkyl chains. The
compositions are suitable for topical administration to a subject,
such as a human or other mammal. The compositions are typically
charge neutral.
[0040] Typically, the macromolecular anions and cations within the
complex are associated by non-covalent interactions, such as
hydrogen bonds, van der Waal's interactions, electrostatic
interactions, and stearic arrangement. The complexes form ionic
liquid compositions (ILs), certain properties of which are
disclosed in the Publication No. WO 2015/066647, the relevant parts
of which are incorporated herein by reference.
[0041] Macromolecular anions complexed with cations with alkyl
chain lengths form compositions, such as ionic liquid compositions.
Specific macromolecular anions complexed with cations with alkyl
chains are referred to herein as "robed anions", such as
robed-siRNA.
[0042] A. Ionic Liquids
[0043] Ionic liquids (ILs) are crystalline or amorphous salts,
zwitterions, or mixtures thereof that are liquids at or near
temperatures where most conventional salts are solids. For example,
ionic liquids are in the liquid state at a temperature that is less
than 200.degree. C., or less than 100.degree. C., or less than
80.degree. C. Some ionic liquids have melting temperatures around
room temperature, e.g. between 10.degree. C. and 40.degree. C., or
between 15.degree. C. and 35.degree. C.
[0044] The ionic liquids are organic salts or mixtures of organic
salts which are in a liquid state at room temperature and standard
pressure.
[0045] Zwitterions are overall neutrally charged molecules, which
carry formal positive and negative charges on different chemical
groups in the molecule. Examples of ionic liquids are described in
Riduan et al., Chem. Soc. Rev., 42:9055-9070, 2013; Rantwijk et
al., Chem. Rev., 107:2757-2785, 2007; Earle et al., Pure Appl.
Chem., 72(7):1391-1398, 2000; and Sheldon et al., Green Chem.,
4:147-151, 2002.
[0046] The ionic liquids contain at least one anionic and at least
one cationic component. Optionally, the IL contains an additional
hydrogen bond donor (i.e. any molecule that can provide an --OH or
an --NH group), examples include but are not limited to alcohols,
fatty acids, and amines.
[0047] The at least one anionic and at least one cationic component
may be present in any molar ratio. Exemplary molar ratios
(cation:anion) include but are not limited to 1:1, 1:2, 2:1, 1:3,
3:1, 2:3, 3:2, and ranges between these ratios.
[0048] In some aspects, the IL composition is a deep eutectic
solvent (DES). A DES is composed of a mixture which forms a
eutectic with a melting point much lower than either of the
individual components in the IL. Exemplary DES include, but are not
limited to, choline oleate, choline hexanoate, choline geranate,
choline malonate (choline disodium malonate), and urea-choline. In
these the formulation is a DES and not a true ionic liquid because
excess carboxylate precludes 1:1 ion pairing.
[0049] 1. Macromolecule Anions
[0050] The macromolecule anion in the complex typically has a
molecular weight of greater than 500 Da, optionally greater than
750 Da, greater than 800 Da, greater than 900 Da, greater than 1
kDa, or greater than 5 kDa. Optionally the macromolecule anion has
a molecular weight that is greater than 10 kDa, greater than 15
kDa, greater than 20 kDa, greater than 30 kDa, greater than 40 kDa.
The size of the macromolecule anion is generally less than 500 kDa,
400 kDa, 300 kDa, 100 kDa, optionally less than 50 kDa. For
example, the macromolecule anion typically has a molecular weight
within the range of 500 Da to 50 kDa, 500 Da to 100 kDa, 500 Da to
300 kDa, 500 Da to 400 kDa, 500 Da to 500 kDa, 750 Da to 50 kDa,
750 Da to 100 kDa, 750 Da to 300 kDa, 750 Da to 400 kDa, 750 Da to
500 kDa, 800 Da to 50 kDa, 800 Da to 100 kDa, 800 Da to 300 kDa,
800 Da to 400 kDa, 800 Da to 500 kDa, 900 Da to 50 kDa, 900 Da to
100 kDa, 900 Da to 300 kDa, 900 Da to 400 kDa, 900 Da to 500 kDa, 1
kDa to 50 kDa, 1 kDa to 100 kDa, 1 kDa to 300 kDa, 1 kDa to 400
kDa, 1 kDa to 500 kDa, 5 kDa to 50 kDa, 5 kDa to 100 kDa, 5 kDa to
300 kDa, 5 kDa to 400 kDa, 5 kDa to 500 kDa, 10 kDa to 50 kDa, 10
kDa to 100 kDa, 10 kDa to 300 kDa, 10 kDa to 400 kDa, 10 kDa to 500
kDa, 15 kDa to 50 kDa, 15 kDa to 100 kDa, 15 kDa to 300 kDa, 15 kDa
to 400 kDa, or 15 kDa to 500 kDa.
[0051] a. Nucleic Acids
[0052] Any nucleic acid for therapeutic, diagnostic, prophylactic,
nutraceutical, or drug delivery use can be used in IL compositions.
Suitable nucleic acids include complementary DNA (cDNA), DNA
aptamers, DNAzymes, RNA aptamers, external guide sequences, RNA
interference molecules, such as small interfering RNA, antisense
RNA, short hairpin RNA, and micro RNA (miRNA), morpholinos,
messenger RNA (mRNA), long non-coding RNA (lncRNA), long intergenic
non-coding RNA (lincRNA), as well as ribozymes, and triplex-forming
molecules. The nucleic acids are capable of modulating
functionality of the genes once they arrive within a cell.
[0053] Antisense molecules are designed to interact with a target
nucleic acid molecule through either canonical or non-canonical
base pairing. The interaction of the antisense molecule and the
target molecule is designed to promote the destruction of the
target molecule through, for example, RNAse H mediated RNA-DNA
hybrid degradation, or, to interrupt a processing function that
normally would take place on the target molecule, such as
transcription or replication. Preferably, the antisense molecules
bind the target molecule with a dissociation constant (Kd) less
than or equal to 10.sup.-6, 10.sup.-8, 10.sup.-10, or
10.sup.-12.
[0054] Aptamers are small nucleic acids ranging from 15-50 bases in
length that fold into defined secondary and tertiary structures,
such as stem-loops or G-quartets and are evolved to recognize
specific targets. Methods for evolving aptamers to desired targets
are known in the art. Optionally, the aptamers bind the target
molecule with a Kd less than 10.sup.-6, 10.sup.-8, 10.sup.-10, or
10.sup.-12. Preferably, the aptamer can bind the target molecule
with a very high degree of specificity.
[0055] Preferred ribozymes cleave RNA or DNA substrates, and more
preferably cleave RNA substrates.
[0056] Triplex forming nucleic acid molecules interact with either
a double-stranded or single-stranded nucleic acid. Preferably, the
triplex forming molecules bind a target molecule with a Kd less
than 10.sup.-6, 10.sup.-8, 10.sup.-10, or 10.sup.-12.
[0057] External guide sequences (EGSs) bind a target nucleic acid
molecule forming a complex, which is recognized by RNase P, which
then cleaves the target molecule. EGSs can be designed to
specifically target a RNA molecule of choice. Methods for making
and using EGS molecules to facilitate cleavage of a variety of
different target molecules are known in the art.
[0058] Gene expression can also be effectively silenced in a highly
specific manner through RNA interference (RNAi). Small Interfering
RNA (siRNA) is a double-stranded RNA that can induce
sequence-specific post-transcriptional gene silencing, thereby
decreasing or even inhibiting gene expression. Sequence specific
gene silencing can be achieved in mammalian cells using synthetic,
short double-stranded RNAs that mimic the siRNAs produced by the
enzyme Dicer (Elbashir, et al. Nature, 411:494 498 (2001)) (Ui-Tei,
et al. FEBS Lett 479:79-82 (2000)). siRNA can be chemically or in
vitro-synthesized or can be the result of short double-stranded
hairpin-like RNAs (shRNAs) that are processed into siRNAs inside
the cell. Synthetic siRNAs are generally designed using algorithms
and a conventional DNA/RNA synthesizer. Suppliers include
AMBION.RTM. (Austin, Tex.), CHEMGENES.RTM. (Ashland, Mass.),
DHARMACON.RTM. (Lafayette, Colo.), Glen Research (Sterling, Va.),
MWB Biotech (Esbersberg, Germany), PROLIGO.RTM. (Boulder, Colo.),
and QIAGEN.RTM. (Dusseldorf, Germany) siRNA can also be synthesized
in vitro using kits such as Ambion's SILENCER.RTM. siRNA
Construction Kit.
[0059] Other useful nucleic acid molecules include CRISPR, zinc
finger nucleases (ZFNs), transcription activator-like effector
nuclease (TALEN), Locked nucleic acids (LNA), i.e., modified RNA
nucleotides (see, for example, Braasch, et al., Chem. Biol.,
8(1):1-7 (2001)), Peptide nucleic acids (PNAs).
[0060] CRISPR (Clustered Regularly Interspaced Short Palindromic
Repeats) is an acronym for DNA loci that contain multiple, short,
direct repetitions of base sequences. Methods of preparing
compositions for use in genome editing using the CRISPR/Cas systems
are described in detail in WO 2013/176772 and WO 2014/018423.
[0061] Exemplary ZFN are disclosed for example in U.S. Pat. Nos.
5,356,802; 5,436,150 and 5,487,994; as well as Li et al. Proc.,
Natl. Acad. Sci. USA 89 (1992):4275-4279; Li et al. Proc. Natl.
Acad. Sci. USA, 90:2764-2768 (1993); Kim et al. Proc. Natl. Acad.
Sci. USA. 91:883-887 (1994a); Kim et al. J. Biol. Chem. 269:31,
978-31,982 (1994b).
[0062] TALENs have an overall architecture similar to that of ZFNs,
with the main difference that the DNA-binding domain comes from TAL
effector proteins, transcription factors from plant pathogenic
bacteria. Methods of engineering TAL to bind to specific nucleic
acids are described in Cermak, et al, Nucl. Acids Res. 1-11 (2011);
US Published Application No. 2011/0145940, and Miller et al. Nature
Biotechnol., 29: 143 (2011). General design principles for TALEN
binding domains can be found in, for example, WO 2011/072246.
[0063] Methods for the chemical assembly of PNAs are known. See,
for example, U.S. Pat. Nos. 5,539,082; 5,527,675; 5,623,049;
5,714,331; 5,736,336; 5,773,571; and 5,786,571.
[0064] Properties of the morpholino-based subunits typically
include: the ability to be linked in an oligomeric form by stable,
uncharged backbone linkages; the ability to support a nucleotide
base (e.g. adenine, cytosine, guanine, thymidine, uracil or
inosine) such that the polymer formed can hybridize with a
complementary-base target nucleic acid, including target RNA, with
high melting temperature, even with oligomers as short as 10-14
bases; the ability of the oligomer to be actively transported into
mammalian cells; and the ability of an oligomer: RNA heteroduplex
to resist RNAse degradation.
[0065] b. Vectors
[0066] Suitable viral vectors include recombinant retroviruses,
lentiviruses, adenoviruses, adeno-associated viruses, and
baculoviruses. These expression vectors are well known in the art
(Boeckle and Wagner, The AAPS Journal, 8(4):E731-E742 (2006); Hu,
Acta Pharmacologica Sinica, 26(4):405-416 (2005)). Bacterial
expression vectors including plasmids, cosmids, phagemids, and
equivalents thereof, are known in the art and discussed in detail
in T. A. Brown. Chapter 2--Vectors for Gene Cloning: Plasmids and
Bacteriophages. Gene Cloning and DNA Analysis: An Introduction (6th
ed.). (2010) Wiley-Blackwell. ISBN 978-1405181730.
[0067] c. Peptides and Proteins
[0068] In certain aspects, the macromolecule anion is a peptide or
a protein. Suitable peptides or proteins include any peptide or
protein that is required or desirable to introduce into a healthy
or diseased skin cell. For example, peptides conferring anti-aging,
anti-inflammatory, antigenic, antiproliferative, or anti-apoptotic
responses to the skin cells may be suitable as macromolecular
anions.
[0069] Suitable peptides and proteins include structural proteins,
such as collagen, enzymes, such as alginase, DNase, RNase,
superoxide dismutase, glutathione reductase, lipase, viral
antigens, bacterial antigens, fungal antigens, interferons,
cytokines, tumor antigens, such as melanoma-associated antigen
(MAGE), and the like.
[0070] d. Polysaccharides
[0071] In certain aspects, the macromolecule anion can be a
polysaccharide. The polysaccharide can include neutral, positively
charged, or negatively charged monosaccharides units, with the
proviso that the polysaccharide has a net negative charge. One or
more of the monosaccharide units can be linear or cyclic. The
cyclic units can be any combination of an .alpha.-anomer or a
.beta.-anomer and an L-isomer or a D-isomer. The polysaccharide may
be naturally occurring or synthetically derived.
[0072] The polysaccharide may have molecular weights between about
1 kDa and about 2,000 kDa, inclusive, between about 1 kDa and about
100 kDa, inclusive, between about 1 kDa and about 50 kDa,
inclusive, between about 1 kDa and about 20 kDa, inclusive, between
about 3 kDa and about 6 kDa, inclusive, or between about 10 kDa and
20 kDa, inclusive. In some aspects, the polysaccharide may have a
molecular weight greater than 500 kDa, greater than 750 kDa, or
even greater than 2,000 kDa.
[0073] Certain polysaccharides may have a molecular weight between
about 500 kDa and about 2,000 kDa, inclusive, between about 500 kDa
and about 750 kDa, inclusive, or between about 750 kDa and about
2,000 kDa, inclusive. In other aspects, the polysaccharide can have
a molecular weight less than 1,000 Da, preferably between about 300
Da and about 1,000 Da, inclusive.
[0074] Preferred carbohydrates include glycosaminoglycans (GAGs),
including, but are not limited to, low molecular weight heparins
(LMWH), unfractionated heparin (UFH), chondroitins, keratins, and
hyaluronic acids (Yip et al., Molecular Cancer Therapeutics, 2006,
5:2139-2148).
[0075] Other useful polysaccharide include necuparanib (M402,
Momenta Pharmaceuticals, Inc.), heparin sulfate or unfractionated
heparin (UFH), a low molecular weight heparin (LMWH) such as
enoxaparin (LOVENOX.RTM.), dalteparin (FRAGMIN.RTM.), nadroparin
calcium (FRAXIPARIN.RTM.), tinzaparin (INNOHEP.RTM.), ardeparin
(NORMIFLO.RTM.), delingoparin, bemiparin, reviparin, or certoparin,
or a non-anticoagulanting heparin such as O-desulfated heparin
(ODSH), sulodexide, curdlan sulfate, acarbose (GLUCOBAY.RTM.),
fondaparinux (ARIXTRA.RTM.), sodium hyaluronate (ORTHOVISC),
cylexin (CY-1503), rivipansel (GMI-1070), GSC-150, Mana(1-2)Man,
sialyl Lewis.sup.a, sialyl Lewisx and their mimetics, GQ1b.alpha.
and its mimetics, and Lewis.sup.a and its mimetics (Ernst et al.,
Nature Reviews Drug Discovery, 2009, 8:661-77), Sulodexide
(SULONEX.RTM., Keryx Biopharmaceuticals).
[0076] In other aspects, the polysaccharide may be a plant- or
fungal-derived compound, such as a pectin,
galactomannan/mannoglycan, xyloglucan, or beta-glucan/lentinan.
Other suitable polysaccharides include chitosan, fucoidan,
galactan, carrageenan, k-carrageenan, galactofucan,
mannoglucoronofucan, arabinogalactans, xylomannan sulfate,
xylogalactofucan, ulvan, dextrans and derivatives thereof, and
other compounds such as described by Chattopadhyay, International
Journal of Polymer Science, 2010, 2010:1-7; or Patel, 3 Biotech,
2012, 2:171-185).
[0077] The polysaccharides, heparin, enoxaparin, dalteparin,
nadroparin, tinzaparin, and delingoparin, ODSH, non-antigoagulating
heparin, and sulodexide have been tested in clinical trials for
efficacy in conditions such as infertility, inhalation injury,
inflammation, vulvodynia, ulcerative colitis, diabetic foot ulcers,
pregnancy complications, burns, cystic fibrosis, pulmonary
conditions, labor, microalbuminuria, and breast, colorectal, lung,
prostate, and vasoocclusive cancers, as well as adenocarcinoma of
the colon (Page, ISRN Pharmacology, 2013, 2013:1-13).
[0078] Fucoidan has been noted for antioxidant, immunostimulatory,
lipid lowering, antibacterial and antihyperpeisic effects. Fucoidan
and ulvan are also used in nanomedicine for wound healing, and for
in vitro and in vivo controlled drug release (Patel, 3 Biotech,
2012, 2:171-185).
[0079] Galactan, carrageenan and k-carrageenan exhibit antioxidant,
immunostimulatory, anti-inflammatory and antinociceptive,
anticoagulant and antiviral effects. Galactofucan and
mannoglucoronofucan may have antitumor effects. Arabinogalactants
may have anticoagulant and antithrombotic effects. Xylomannan
sulfate and xylogalactofucan exhibit antiviral effects,
particularly against such viruses as influenza, herpes and human
immunodeficiency virus (Patel, 3 Biotech, 2012, 2:171-185).
[0080] Dextran is a branched polysaccharide. Both dextran and many
of its naturally-occurring and synthetic derivatives exhibit
antithrombic activity.
[0081] A particular group of polysaccharides for topical
administration to a subject includes polysaccharides such as
alginate, agar, alginic acid (align), carrageen, chitin, chitosan,
glucan, carboxymethyl-glucan (CM-glucan), chitin-glucan,
carboxymethylcellulose (CMC), dextrins, glycogen, guar gum, gum
arabic, honey, hydroxypropyl starch phosphate, hyaluronic acid,
hydroxyethyl cellulose, methyl cellulose, mucopolysaccharides
(glucosaminoglycans), pectin, sugar tensides, seaweed
polysaccharides, fucans, fucoidans, tragant (E 413), xanthan gum,
their derivatives, and combinations thereof, preferably hyaluronic
acid.
[0082] In other aspects, the polysaccharide may be conjugated to an
active agent, such as a vaccine, a protein or a small molecule.
Exemplary vaccines which may be conjugated to polysaccharides
include haemophilus b, pneumococcal, and meningococcal vaccines.
Exemplary proteins that may be conjugated to polysaccharides,
include trichosanthin, epidermal growth factor, and the anticancer
enzymes asparaginase and carboxypeptidase G2. Exemplary small
molecule therapeutics that may be conjugated to polysaccharides
include doxorubicin, cisplatin, camptothecin, mitomycin,
methotrexate, and paclitaxel.
[0083] 2. Cations
[0084] Suitable cations with alkyl chains in the complexes include
cationic surfactants. The cationic surfactants have the general
formula below:
##STR00001##
[0085] wherein Q is nitrogen (N) or phosphorus (P),
[0086] wherein R1, R2, R3, and R4 are independently absent,
hydrogen, substituted alkyl, unsubstituted alkyl, substituted
alkenyl, unsubstituted alkenyl, substituted alkynyl, unsubstituted
alkynyl, substituted alkoxy, unsubstituted alkoxy, substituted
amino, unsubstituted amino, substituted alkylamino, unsubstituted
alkylamino, substituted alkylthio, or unsubstituted alkylthio,
substituted aryl, unsubstituted aryl, substituted heteroaryl,
unsubstituted heteroaryl, substituted C.sub.3-C.sub.30 cycloalkyl,
unsubstituted C.sub.3-C.sub.30 cycloalkyl, substituted
heterocyclyl, unsubstituted heterocyclyl, and any pair of R.sub.1,
R.sub.2, R.sub.3, and R.sub.4 independently combine to form five-
and/or six-membered rings, wherein the five- and/or six-membered
rings formed from combining any pair of R.sub.1, R.sub.2, R.sub.3,
and R.sub.4 optionally include an additional heteroatom.
[0087] In some aspects, the five- and/or six-membered rings formed
from combining any pair of R.sub.1, R.sub.2, R.sub.3, and R.sub.4,
optionally including an additional heteroatom, can be heterocyclic
or heteroaromatic.
[0088] In some aspects, the cationic surfactants have the general
formula described above for Formula I, with the exception that the
cationic surfactant is not cetyltrimethyl ammonium, decyltrimethyl
ammonium, benzyldimethyl dodecyl ammonium, myristyltrimethyl
ammonium, or dodecyl pyridinium.
[0089] In some aspects, the cationic surfactants have the general
formula described above for Formula I, and at least one of R.sub.1,
R.sub.2, R.sub.3, and R.sub.4 is independently a substituted alkyl,
wherein the substituted alkyl is a substituted aralkyl or
unsubstituted aralkyl.
[0090] In some aspects, the cationic surfactants have the general
formula described above for Formula I, and at least one of R.sub.1,
R.sub.2, R.sub.3, and R.sub.4 is independently a substituted alkyl,
wherein the substituted alkyl is a substituted aralkyl or
unsubstituted aralkyl, and with the exception that the cationic
surfactant is not benzyldimethyl dodecyl ammonium.
[0091] In some aspects, the cationic surfactants have the general
formula described above for Formula I, and R.sub.1 is independently
a substituted alkyl, wherein the substituted alkyl is a substituted
aralkyl or unsubstituted aralkyl, R.sub.2, R.sub.3, and R.sub.4 are
independently substituted alkyl or unsubstituted alkyl, with the
proviso that when R.sub.2, R.sub.3, and R.sub.4 are substituted
alkyl, the substituted alkyl is not a substituted aralkyl or
unsubstituted aralkyl.
[0092] In some aspects, the cationic surfactants have the general
formula described above for Formula I, and R.sub.1 is independently
a substituted alkyl, wherein the substituted alkyl is a substituted
aralkyl or unsubstituted aralkyl, R.sub.2, R.sub.3, and R.sub.4 are
independently substituted alkyl or unsubstituted alkyl, with the
proviso that when R.sub.2, R.sub.3, and R.sub.4 are a substituted
alkyl, the substituted alkyl is not a substituted aralkyl or
unsubstituted aralkyl, and with the proviso that the cationic
surfactant is not benzyldimethyl dodecyl ammonium.
[0093] Any of the cationic surfactants described above can include
carbon chains of various lengths, i.e. chain length, as defined by
the longest number of contiguously bonded carbon atoms within a
chain. The chain length can be between three and twenty carbon
atoms, inclusive.
[0094] In some aspects, the chain length varies and may be
dependent on the overall charge of the macromolecular anion to form
a charge neutral, hydrophobic, non-irritating to the skin
complex.
[0095] In some aspects, the cationic surfactants forming the
complexes have the formula shown below:
##STR00002##
[0096] wherein n is any integer between three and nineteen,
including three or nineteen. Examples of cationic surfactants
within the scope of Formula II are shown in Tables 4 and 5.
[0097] In some aspects, the cationic surfactant in the complex has
the formula of Formula II, with the exception that the cationic
surfactant is not benzyldimethyldodecyl ammonium.
[0098] In some aspects, the cationic surfactant in the complex has
the formula of Formula II, where n is 6, 12, or 16. These cationic
surfactants are also commonly referred to as benzyldimethyloctyl
ammonium, benzyldimethyltetradecyl ammonium, or
benzyldimethylstearyl ammonium, respectively.
[0099] The lengths of the carbon chains in the cationic surfactant
can influence the hydrophobicity of the cation:anion complex, the
hydrodynamic size of the cation:anion complex, and the aggregation
potency of the complex. For example, Example 1, Tables 2 and 3, and
FIG. 1, show that while the anion remains unchanged (siRNA1), the
length of the alkyl chain length affects the hydrophobicity,
hydrodynamic size, and aggregation properties of the complexes.
[0100] It is to be understood that the genera of cationic
surfactants or specific cationic surfactants described herein or
referred to in the Tables or Examples herein can be specifically
included, excluded, or combined in any combination, with the genera
of anionic macromolecules or specific anionic macromolecules
described herein or referred to in the Tables or Examples
herein.
[0101] C. Optional Additional Therapeutic, Diagnostic,
Prophylactic, and/or Nutraceutic Agents
[0102] In addition to the complexes described above, the
compositions optionally further include one or more additional
chemical or biological molecules providing a therapeutic,
diagnostic, prophylactic, or nutraceutical effect in vivo. The
molecule (also referred to herein as "drug") is selected based on
the disease or disorder to be treated or prevented. The drug can be
a small molecule or macromolecule, such as a protein or
peptide.
[0103] A wide range of drugs may be included in the compositions as
an additional agent (i.e. in addition to the agent in the
complex).
[0104] While the composition is generally charge neutral, the
additional drug can be positively or negatively charged and contain
its own counterion, which can be the same counterion as the one
used to neutralize macromolecular ion, or different. Suitable
counterions to neutralize the drug include ions suitable for
biological applications, such as sodium, calcium, magnesium,
chloride, phosphate, sulfate, and others.
[0105] Alternatively the additional drug can be charge neutral.
[0106] Drugs contemplated for use in the compositions include, but
are not limited to, the following categories and examples of drugs
and alternative forms of these drugs such as alternative salt
forms, free acid forms, free base forms, and hydrates:
analgesics/antipyretics (e.g., aspirin, acetaminophen, ibuprofen,
naproxen sodium, buprenorphine, propoxyphene hydrochloride,
propoxyphene napsylate, meperidine hydrochloride, hydromorphone
hydrochloride, morphine, oxycodone, codeine, dihydrocodeine
bitartrate, pentazocine, hydrocodone bitartrate, levorphanol,
diflunisal, trolamine salicylate, nalbuphine hydrochloride,
mefenamic acid, butorphanol, choline salicylate, butalbital,
phenyltoloxamine citrate, diphenhydramine citrate,
methotrimeprazine, cinnamedrine hydrochloride, and meprobamate);
antibiotics (e.g., neomycin, streptomycin, chloramphenicol,
cephalosporin, ampicillin, penicillin, tetracycline, and
ciprofloxacin); antidiabetics (e.g., biguanides and sulfonylurea
derivatives); antifungal agents (e.g., griseofulvin, ketoconazole,
itraconizole, amphotericin B, nystatin, and candicidin);
antihypertensive agents (e.g., propranolol, propafenone,
oxyprenolol, nifedipine, reserpine, trimethaphan, phenoxybenzamine,
pargyline hydrochloride, deserpidine, diazoxide, guanethidine
monosulfate, minoxidil, rescinnamine, sodium nitroprusside,
rauwolfia serpentina, alseroxylon, and phentolamine);
anti-inflammatories (e.g., (non-steroidal) indomethacin,
ketoprofen, flurbiprofen, naproxen, ibuprofen, ramifenazone,
piroxicam, (steroidal) cortisone, dexamethasone, fluazacort,
celecoxib, rofecoxib, hydrocortisone, prednisolone, and
prednisone); antineoplastics (e.g., cyclophosphamide, actinomycin,
bleomycin, daunorubicin, doxorubicin, epirubicin, mitomycin,
methotrexate, fluorouracil, carboplatin, carmustine (BCNU),
methyl-CCNU, cisplatin, etoposide, camptothecin and derivatives
thereof, phenesterine, paclitaxel and derivatives thereof,
docetaxel and derivatives thereof, vinblastine, vincristine,
tamoxifen, and piposulfan); immunosuppressive agents (e.g.,
cyclosporine, azathioprine, mizoribine, and FK506 (tacrolimus));
antimigraine agents (e.g., ergotamine, propranolol, isometheptene
mucate, and dichloralphenazone); antianginal agents (e.g.,
beta-adrenergic blockers; calcium channel blockers such as
nifedipine, and diltiazem; and nitrates such as nitroglycerin,
isosorbide dinitrate, pentaerythritol tetranitrate, and erythrityl
tetranitrate); antiarthritic agents (e.g., phenylbutazone,
sulindac, penicillamine, salsalate, piroxicam, azathioprine,
indomethacin, meclofenamate, gold sodium thiomalate, ketoprofen,
auranofin, aurothioglucose, and tolmetin sodium); antigout agents
(e.g., colchicine, and allopurinol); anticoagulants (e.g., heparin,
heparin sodium, and warfarin sodium); thrombolytic agents (e.g.,
urokinase, streptokinase, and alteplase); antifibrinolytic agents
(e.g., aminocaproic acid); hemorheologic agents (e.g.,
pentoxifylline); antiplatelet agents (e.g., aspirin);
antihistamines/antipruritics (e.g., hydroxyzine, diphenhydramine,
chlorpheniramine, brompheniramine maleate, cyproheptadine
hydrochloride, terfenadine, clemastine fumarate, triprolidine,
carbinoxamine, diphenylpyraline, phenindamine, azatadine,
tripelennamine, dexchlorpheniramine maleate, methdilazine, and);
agents useful for calcium regulation (e.g., calcitonin, and
parathyroid hormone); antibacterial agents (e.g., amikacin sulfate,
aztreonam, chloramphenicol, chloramphenicol palmitate,
ciprofloxacin, clindamycin, clindamycin palmitate, clindamycin
phosphate, metronidazole, metronidazole hydrochloride, gentamicin
sulfate, lincomycin hydrochloride, tobramycin sulfate, vancomycin
hydrochloride, polymyxin B sulfate, colistimethate sodium, and
colistin sulfate); antiviral agents (e.g., interferon alpha, beta
or gamma, zidovudine, amantadine hydrochloride, ribavirin, and
acyclovir); antimicrobials (e.g., cephalosporins such as cefazolin
sodium, cephradine, cefaclor, cephapirin sodium, ceftizoxime
sodium, cefoperazone sodium, cefotetan disodium, cefuroxime e
azotil, cefotaxime sodium, cefadroxil monohydrate, cephalexin,
cephalothin sodium, cephalexin hydrochloride monohydrate,
cefamandole nafate, cefoxitin sodium, cefonicid sodium, ceforanide,
ceftriaxone sodium, ceftazidime, cefadroxil, cephradine, and
cefuroxime sodium; penicillins such as ampicillin, amoxicillin,
penicillin G benzathine, cyclacillin, ampicillin sodium, penicillin
G potassium, penicillin V potassium, piperacillin sodium, oxacillin
sodium, bacampicillin hydrochloride, cloxacillin sodium,
ticarcillin disodium, azlocillin sodium, carbenicillin indanyl
sodium, penicillin G procaine, methicillin sodium, and nafcillin
sodium; erythromycins such as erythromycin ethylsuccinate,
erythromycin, erythromycin estolate, erythromycin lactobionate,
erythromycin stearate, and erythromycin ethylsuccinate; and
tetracyclines such as tetracycline hydrochloride, doxycycline
hyclate, and minocycline hydrochloride, azithromycin,
clarithromycin); anti-infectives (e.g., GM-CSF); steroidal
compounds, hormones and hormone analogues (e.g., incretins and
incretin mimetics such as GLP-1 and exenatide, androgens such as
danazol, testosterone cypionate, fluoxymesterone,
ethyltestosterone, testosterone enathate, methyltestosterone, and
fluoxymesterone; estrogens such as estradiol, estropipate, and
conjugated estrogens; progestins such as methoxyprogesterone
acetate, and norethindrone acetate; corticosteroids such as
triamcinolone, betamethasone, betamethasone sodium phosphate,
dexamethasone, dexamethasone sodium phosphate, dexamethasone
acetate, prednisone, methylprednisolone acetate suspension,
triamcinolone acetonide, methylprednisolone, prednisolone sodium
phosphate, methylprednisolone sodium succinate, hydrocortisone
sodium succinate, triamcinolone hexacetonide, hydrocortisone,
hydrocortisone cypionate, prednisolone, fludrocortisone acetate,
paramethasone acetate, prednisolone tebutate, and prednisolone
acetate; and thyroid hormones such as levothyroxine sodium);
hypoglycemic agents (e.g., human insulin, purified beef insulin,
purified pork insulin, recombinantly produced insulin, insulin
analogs, glyburide, chlorpropamide, glipizide, tolbutamide, and
tolazamide); hypolipidemic agents (e.g., clofibrate,
dextrothyroxine sodium, probucol, pravastitin, atorvastatin,
lovastatin, and niacin); agents useful for erythropoiesis
stimulation (e.g., erythropoietin); oil-soluble vitamins (e.g.,
vitamins A, D, E, K, and the like); as well as other drugs such as
mitotane, halonitrosoureas, anthrocyclines, and ellipticine.
[0107] A description of these and other classes of useful drugs and
a listing of species within each class can be found in Martindale,
The Extra Pharmacopoeia, 30th Ed. (The Pharmaceutical Press, London
1993), the disclosure of which is incorporated herein by reference
in its entirety.
[0108] D. Exemplary Complexes
[0109] The anions and cations described above can be combined to
form the IL. For example, the nucleic acids, vectors, anionic
peptide or protein, anionic polysaccharide, and combinations
thereof, can be combined with the cations of Formula I. Exemplary
complexes include:
[0110] (i) Exemplary Complexes of siRNA and Cation Surfactants
[0111] In some forms, the IL contains an siRNA in complex with a
cation surfactant of Formula I, as described above, (i) with the
exception that the cationic surfactant is not cetyltrimethyl
ammonium, decyltrimethyl ammonium, benzyldimethyldodecyl ammonium,
myristyltrimethyl ammonium, or dodecyl pyridinium; (ii) at least
one of R.sub.1, R.sub.2, R.sub.3, and R.sub.4 is independently a
substituted alkyl, wherein the substituted alkyl is a substituted
aralkyl or unsubstituted aralkyl; (iii) at least one of R.sub.1,
R.sub.2, R.sub.3, and R.sub.4 is independently a substituted alkyl,
wherein the substituted alkyl is a substituted aralkyl or
unsubstituted aralkyl, and wherein the cationic surfactant is not
benzyldimethyl dodecyl ammonium; (iv) R.sub.1 is independently a
substituted alkyl, wherein the substituted alkyl is a substituted
aralkyl or unsubstituted aralkyl, R.sub.2, R.sub.3, and R.sub.4 are
independently substituted alkyl or unsubstituted alkyl, with the
proviso that when R.sub.2, R.sub.3, and R.sub.4 are substituted
alkyl, the substituted alkyl is not a substituted aralkyl or
unsubstituted aralkyl; or (iv) R.sub.1 is independently a
substituted alkyl, wherein the substituted alkyl is a substituted
aralkyl or unsubstituted aralkyl, R.sub.2, R.sub.3, and R.sub.4 are
independently substituted alkyl or unsubstituted alkyl, with the
proviso that when R.sub.2, R.sub.3, and R.sub.4 are substituted
alkyl, the substituted alkyl is not a substituted aralkyl or
unsubstituted aralkyl, and wherein the cationic surfactant is not
benzyldimethyl dodecyl ammonium.
[0112] In some forms, the IL contains an siRNA in complex with a
cationic surfactant of Formula II
##STR00003##
[0113] wherein n is any integer between three and nineteen,
including three or nineteen the exception that the cationic
surfactant is not benzyldimethyldodecyl ammonium, wherein the siRNA
is selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
and combinations thereof.
[0114] In some forms, the IL contains an siRNA in complex with a
cationic surfactant selected from hydroxyethyltrimethyl ammonium,
tetradecyltrimethyl ammonium, benzyldimethyltetradecyl ammonium,
benzyldimethylstearyl ammonium, and combinations thereof, wherein
the siRNA is selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID
NO: 12, and combinations thereof.
[0115] In some forms, the IL contains an siRNA in complex with a
cationic surfactant selected from benzyldimethyltetradecyl
ammonium, benzyldimethylstearyl ammonium, and combinations thereof,
wherein the siRNA is selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ
ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11,
SEQ ID NO: 12, and combinations thereof.
[0116] (ii) Exemplary Complexes of Anionic Polysaccharides and
Cationic Surfactants
[0117] In some forms, the IL contains an anionic polysaccharide in
complex with a cation surfactant of Formula I.
[0118] In some forms, the IL contains an anionic polysaccharide
(e.g. hyaluronic acid, alginate, alginic acid, glycosaminoglycans,
etc.) in complex with a cation surfactant of Formula I as described
above, with the exception that (i) the cationic surfactant is not
cetyltrimethyl ammonium, decyltrimethyl ammonium,
benzyldimethyldodecyl ammonium, myristyltrimethyl ammonium, or
dodecyl pyridinium; (ii) at least one of R.sub.1, R.sub.2, R.sub.3,
and R.sub.4 is independently a substituted alkyl, wherein the
substituted alkyl is a substituted aralkyl or unsubstituted
aralkyl; (iii) at least one of R.sub.1, R.sub.2, R.sub.3, and
R.sub.4 is independently a substituted alkyl, wherein the
substituted alkyl is a substituted aralkyl or unsubstituted
aralkyl, and wherein the cationic surfactant is not benzyldimethyl
dodecyl ammonium; (iv) R.sub.1 is independently a substituted
alkyl, wherein the substituted alkyl is a substituted aralkyl or
unsubstituted aralkyl, R.sub.2, R.sub.3, and R.sub.4 are
independently substituted alkyl or unsubstituted alkyl, with the
proviso that when R.sub.2, R.sub.3, and R.sub.4 are substituted
alkyl, the substituted alkyl is not a substituted aralkyl or
unsubstituted aralkyl; or (iv) R.sub.1 is independently a
substituted alkyl, wherein the substituted alkyl is a substituted
aralkyl or unsubstituted aralkyl, R.sub.2, R.sub.3, and R.sub.4 are
independently substituted alkyl or unsubstituted alkyl, with the
proviso that when R.sub.2, R.sub.3, and R.sub.4 are substituted
alkyl, the substituted alkyl is not a substituted aralkyl or
unsubstituted aralkyl, and wherein the cationic surfactant is not
benzyldimethyl dodecyl ammonium.
[0119] In some forms, the IL contains hyaluronic acid, alginate,
alginic acid, glycosaminoglycans, and combinations thereof,
preferably hyaluronic acid, in complex with a cationic surfactant
of Formula II
##STR00004##
[0120] wherein n is any integer between three and nineteen,
including three or nineteen the exception that the cationic
surfactant is not benzyldimethyldodecyl ammonium.
[0121] In some forms, the IL contains hyaluronic acid, alginate,
alginic acid, glycosaminoglycans, and combinations thereof,
preferably hyaluronic acid, in complex with a cationic surfactant
selected from hydroxyethyltrimethyl ammonium, tetradecyltrimethyl
ammonium, benzyldimethyltetradecyl ammonium, benzyldimethylstearyl
ammonium, and combinations thereof.
[0122] In some forms, the IL contains hyaluronic acid in complex
with a cationic surfactant selected from hydroxyethyltrimethyl
ammonium, tetradecyltrimethyl ammonium, benzyldimethyltetradecyl
ammonium, benzyldimethylstearyl ammonium, and combinations
thereof.
[0123] E. Properties of the Compositions
[0124] The cations and the macromolecular anions form complexes
that typically are charge neutral, sufficiently hydrophobic to
cross the skin barrier and enter skin cells. Additionally, the
compositions are generally non-irritating to the skin.
[0125] 1. Charge Neutrality
[0126] Typically, the compositions are charge neutral.
[0127] In the complexes included in the compositions, the cations,
which can contain various alkyl chain lengths, and the
macromolecular anions, are typically mixed at 1:1 charge ratio.
However, other charge ratios may be used to mix the cations of
various alkyl chain lengths and the macromolecular anions, for
example, suitable charge ratios (charges on the macromolecular
anions to the charges on the alkyl chain cations) include 0.5:1,
1:1, or 2:1, and ratios there between. In some aspects, the cations
of various alkyl chain lengths and the macromolecular anions are
mixed at a molar ratios of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8,
1:9, 1:10, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1, or any
suitable molar ratio to confer charge neutrality to the overall
complex. When the ratio of charges on the macromolecular anions to
the charges on the alkyl chain cations deviates from one (1:1),
additional counterions may be present in a sufficient amount to
neutralize the charges on the complex. Suitable counterions to
neutralize the drug include ions suitable for biological
applications, such as sodium, calcium, magnesium, chloride,
phosphate, sulfate, and others.
[0128] The charge neutrality of the composition may be conferred by
inclusion of other ions in addition to those in the complex. For
example, the macromolecular ion complex can be suspended or
dissolved in a buffer, such as a phosphate buffered saline.
[0129] 2. Hydrophobicity of Complexes in Composition
[0130] The hydrophobicity of the formed complexes may be
characterized by the octanol/water partition coefficient
(P.sub.o/w), presented in Log.sub.10 values (Table 2). Typically,
the hydrophobicity of the complex of a cation with varying alkyl
chain lengths and a macromolecular anion, as determined by its
octanol/water partition coefficient (P.sub.o/w), is greater by at
least one Log(10) unit (Log P.sub.o/w) compared to the
hydrophobicity of the macromolecule anion when it is complexed with
sodium ion.
[0131] In some aspects, the hydrophobicity of the macromolecule
anion, as determined by its octanol/water partition coefficient, is
increased by a factor ranging from one to five Log(10) units (Log
P.sub.o/w).
[0132] To determine the hydrophobicity of a given macromolecular
anion in a complex, the Log P.sub.o/w for the macromolecular anion
when in the complex of interest can be determined and compared to
the Log P.sub.o/w for the same macromolecular anion when complexed
to a sodium ion. The P.sub.o/w partition coefficient may be
measured using any standard test. An exemplary test is provided
below.
[0133] 5 mL ddH.sub.2O may be mixed overnight at room temperature
with 5 mL octanol. A complex containing a macromolecular anion
complexed with sodium ions or with cations with alkyl chains is
then added to the mixture and again allowed to mix overnight at
room temperature in the dark. After overnight incubation, the
solution is centrifuged to separate the octanol layer and water
layer. The concentration of the macromolecular anion present in
each layer is quantified by UV-Vis spectroscopy, or fluorescence
spectroscopy, using, for example, a SAFIRE, XFLUOR4, V4.50
microplate reader (Tecan Group Ltd, Morrisville, N.Y.). For
detection of siRNA, the fluorescence detection may be performed at
an excitation of 485 nm and an emission of 520 nm, and the method
may be validated for linearity, accuracy, and precision. Log
P.sub.o/w may be calculated as the logarithm of the ratio of
fluorescence in the octanol layer compared to the water layer.
[0134] 3. Non-Irritating to the Skin
[0135] The compositions described herein are typically
non-irritating to the skin. Each of the components in the IL (i.e.,
anionic and cationic components) may on its own be irritating to
the skin. However, the combination of the ionic components used in
the complex that is included in the composition is not irritating,
or substantially non-irritating (i.e. causes at most a minimal skin
reaction) when applied to the surface of the skin.
[0136] The compositions may cause minimal or no skin reaction, such
as redness, rash, inching, burning or tingling sensations. Minimal
skin reaction may be understood as slight skin reaction with signs
of irritation but one that is not uncomfortable or painful to the
subject.
[0137] For example, the compositions are non-irritating to the skin
even when either or both the macromolecule anion and the cation
alone are irritating to the skin.
[0138] Typically, the compositions are non-toxic to the skin cells.
The compositions do not induce any adverse reactions in the healthy
skin cells, such as reduction in viability of healthy skin cell,
when applied to the skin. For example, the compositions have
substantially the same cytotoxicity to the healthy skin cells in
vitro or in vivo as the cytotoxicity in vitro or in vivo of the
macromolecule anion complexed with a sodium cation.
[0139] 4. Transport Through the Skin Layers
[0140] Typically, the compositions are sufficiently hydrophobic to
transport through one or more the skin barrier layers, such as SC,
and/or through one or more skin cell layers, such as epidermis and
dermis without the need for an additional treatment of the skin to
increase its porosity, or to push the compositions through the SC
and/or one or more additional layers of the skin.
[0141] The human skin can be divided into epidermis and dermis.
Each of these components is subdivided into layers.
[0142] a. Transport Through the Epidermis
[0143] The epidermis is divided into five sublayers: stratum
corneum, stratum lucidum, stratum granulosum, stratum spinosum, and
stratum germinativum (also called "stratum basale"). The epidermis
is devoid of blood vessels and is nourished by diffusion from the
dermis.
[0144] The epidermis is divided into several layers of cells that
are formed through mitosis at the innermost layers. They move up
the strata changing shape and composition as they differentiate and
become filled with keratin. They eventually reach the top layer
called stratum corneum, which serves as a skin barrier layer, and
are sloughed off, or desquamated. The outermost layer of the
epidermis consists of 25 to 30 layers of dead cells.
[0145] The complexes described herein are able to transport through
the five different sublayers of the epidermis and reach the dermis.
Typically, after topical application to the skin, the
macromolecular anions complexed with the cations with alkyl chains
are transported through the stratum corneum and reach the various
sublayers of epidermis, in greater amounts than the amounts
achieved following topical application of the same macromolecular
anions when complexed with sodium ions. The macromolecular anions
complexed with the cations with alkyl chains may pass through one
or more layers of the skin, such as one or more layers of the
epidermis, and even through one or more layers of the dermis,
following topical administration. In these aspects, the composition
passes through the one or more layers of the skin in greater
amounts than the amounts achieved following topical application of
the same macromolecular anions when complexed with sodium ions.
[0146] Optionally the macromolecular anions complexed with the
cations with alkyl chains pass through all of the layers of the
skin, following topical administration. In this aspect, the
composition passes through all the layers of the skin in greater
amounts than the amounts achieved following topical application of
the same macromolecular anions when complexed with sodium ions.
[0147] b. Transport into the Dermis
[0148] The dermis is the layer of skin beneath the epidermis that
consists of epithelial tissue. The dermis is structurally divided
into two areas: a superficial area adjacent to the epidermis,
called the papillary region, and a deep thicker area known as the
reticular region.
[0149] The dermis is tightly connected to the epidermis by a
basement membrane. It also harbors many nerve endings that provide
the sense of touch and heat. It contains the hair follicles, sweat
glands, sebaceous glands, apocrine glands, lymphatic vessels and
blood vessels. The blood vessels in the dermis provide nourishment
and waste removal from its own cells as well as from the stratum
basale of the epidermis.
[0150] Preferably, after topical application of the composition to
the skin, the macromolecular anions complexed with the cations with
alkyl chains are transported through the epidermis and into one or
more layers of the dermis, in greater amounts than the amounts
achieved following topical application of the same macromolecular
anions complexed with sodium ions.
III. Methods of Making the Composition
[0151] Methods of making the compositions are known in the art and
described by Nishimura et al., Biomaterials, 26:5558-5563
(2005).
[0152] Typically, the methods include chloride salts of the cations
and converting these to their corresponding hydroxide salts, such
as by using an anion exchange resin (e.g., Amberlite IRA-402
hydroxide form anion exchange resin from Santa Cruz Biotechnology,
Dallas, Tex.), as indicated in Scheme 1. The chloride salts of the
cations are dissolved in ultrapure ddH.sub.2O (e.g., ultrapure
ddH.sub.2O from Life Technologies, Grand Island, N.Y.) at a
suitable concentration, such as a concentration of 1.0% wt, and
mixed with excess resin for 1 hour under constant agitation. The
slurry is then centrifuged to pellet the resin and collect
supernatant. Complete anion exchange can be verified by the lack of
precipitate following dropwise addition of silver nitrate (e.g., 2
g/mL solution of silver nitrate in ddH.sub.2O from Sigma Aldrich,
St. Louis, Mo.). The final solution of the cation hydroxide can be
freeze-dried to remove ddH.sub.2O.
##STR00005##
[0153] Similarly, the macromolecular anion sodium salts can be
converted to acidic form using a cation exchange resin (e.g.,
Amberlite IR-120 hydrogen cation exchange resin from Santa Cruz
Biotechnology, Dallas, Tex.), as indicated in Scheme 2. Complete
cation exchange can be verified by titration. The final solution of
hydrogen form of macromolecular anion can be freeze-dried to remove
ddH.sub.2O.
##STR00006##
[0154] Acidic groups on the macromolecular anion can be complexed,
optionally neutralized, to the corresponding cation by addition of
cation in a suitable solvent (e.g., the hydroxide form of the
cation, optionally a cationic surfactant, in methanol), as shown in
Scheme 3. Neutralization is allowed to proceed for a suitable
period of time, such as overnight, at room temperature with
constant agitation. The solvent (e.g. methanol) is then removed,
such as by rotary evaporation, and subsequently freeze-dried, and
robed-anion is stored, e.g. at -20.degree. C., until further
use.
##STR00007##
IV. Methods of Using the Composition
[0155] The compositions are applied topically to a subject's (human
or other mammal) skin in an effective amount to transport the
complex through the stratum corneum, and preferably to or through
one or more layers of the epidermis. An effective amount of the
complex may be transported to the dermis. Optionally, the complex
is delivered to cells beyond one or more layers of the dermis. The
complex may be transported through the various layers of the skin
alone, or in combination with one or more with additional
therapeutic, diagnostic, prophylactic, or nutraceutical agents.
[0156] The complex is transported through the stratum corneum, and
optionally to or through the different layers of the epidermis
and/or dermis without additional treatments to the skin to increase
the porosity of the skin, to remove one or more layers of the
stratum corneum, and/or to push the complex or components of the
composition through the skin, prior to, simultaneous with, or
subsequent to, topical application of the composition.
[0157] When applied to an individual's skin, the compositions do
not cause undue irritation, such as evidenced by redness, burning
and/or itching sensations.
[0158] Each of the components in the IL complexes (i.e., anionic
and cationic components), or ionic component(s) in the IL and drug,
may on its own be irritating to the skin. However, the combination
of the ionic components (or ionic component and drug) used in the
composition is not irritating when applied to the surface of the
skin.
[0159] The compositions described herein may be topically applied
in an effective amount to treat skin disease. In some embodiments,
the compositions contain, RNAi molecules, such as siRNA.
Optionally, the composition contains a complex, such as
BDOA-siRNA.
[0160] A. Targeted Delivery
[0161] The compositions may be selected to deliver a drug to a
particular site, such as within the stratum corneum, epidermis
and/or dermis, or through and beyond all of the layers of the
skin.
[0162] As shown in the examples, different ILs demonstrated three
different transport regimes, depending on the IL employed: 1) Drug
retention in the donor solution. 2) Enhanced localization and
retention within the SC, epidermis, and dermis. 3) Enhanced
transdermal penetration through all layers of the skin and into the
acceptor solution. In all of the aspects, the composition is not
irritating to the skin, although one or more of the components on
its own may be irritating.
[0163] In some aspects, the components of the composition (e.g.
cationic component, anionic component) are selected such that the
agent (or complex) to be delivered is delivered within the layers
of the skin. This may be particularly useful for the treatment of
diseases or disorders of the skin, such as treatment of an
infection, cut, burn, or rash.
[0164] In other aspects, the components of the composition (e.g.
cationic component, anionic component, and/or drug) are selected
such that the drug to be delivered is transported through the skin,
such as beyond the layers in the dermis.
[0165] In still other aspects, the components of the composition
may be selected such that they prevent transfer of a drug (or other
substance) through the stratum corneum. This may be useful as a
coating to protect the skin or treat large open wounds Suitable
complexes for use in these compositions possess characteristics
that limit their penetration. These characteristics include
formation of aggregates or particles, increased viscosity, and/or
increased density, compared to compositions that pass through the
stratum corneum.
[0166] B. Conditions to be Treated
[0167] The IL compositions described herein may be used for
transdermal macromolecular anion delivery, optionally with
therapeutic, diagnostic, prophylactic, and/or nutraceutical
drugs.
[0168] The IL compositions may be applied to the surface of the
skin to treat a disease or disorder of the skin, including but not
limited to atopic dermatitis, acne, wound, rash, folliculitis,
furunculosis, carbunculosis fungal infection, and other diseases of
infectious origin.
[0169] C. Effective Amounts
[0170] Effective amounts vary with condition to be treated and the
macromolecular anion and, optionally, additional drug to be
delivered to the skin. The effective amount may be reached with
one, or more than one topical application of the compositions. For
example, each application containing 10 ng, 20 ng, 50 ng, 100 ng, 1
.mu.g, 10 .mu.g, 20 .mu.g, 50 .mu.g, 100 .mu.g, or 10 mg of one or
more agents (macromolecular anion, optionally with an additional
drug), may be applied to a skin site and deliver an effective dose
of 10 ng, 20 ng, 50 ng, 100 ng, 1 .mu.g, 10 .mu.g, 20 .mu.g, 50
.mu.g, 100 .mu.g, 1 mg, 10 mg, 20 mg, 50 mg, or 100 mg of the
agent(s), respectively.
[0171] An effective dose of an active agent may be delivered by
altering the number of applications, by altering the amount of the
agent in each of the applications, or both. The effective amount of
the active agent may be delivered over a period of 1 day, 2-3 days,
or over the period of one week, or few weeks to 3-6 months.
[0172] Suitable dosages include topical applications of the
compositions in suitable volumes that contain between 0.001 .mu.g
to 1000 mg of the macromolecule anion and/or drug to the skin site
of the subject to be treated.
[0173] D. Dosage Forms
[0174] The IL compositions may be in dosage units and dosage forms
delivering an effective amount of the macromolecular anion and/or
drug to the skin.
[0175] Any dosage form suitable for delivery to the skin may be
used. The compositions may be in the form of films, depots, patches
or neat liquids, creams, lotions. The dosage forms may be
prepackaged for delivery of the effective amount of the
macromolecular anion via single, or multiple applications.
[0176] In one aspect, compositions are delivered to the skin
surface by a drug delivery device containing a reservoir for
holding the compositions. Optionally, the reservoir also contains
one or more additional drug(s).
[0177] In another aspect, the compositions may be contained within
a drug delivery device. A variety of different devices having
different geometries and structures may be used. For example, the
device may be a multicompartment device, which contains the IL
compositions, optionally, additional compartments contain one or
more additional agents.
[0178] Typically, the dosage forms are delivered without the need
of injecting devices, such as devices with microneedles, or other
devices or agents for increasing skin permeability or pushing the
complexes through the skin, as the IL compositions are able to
cross the skin barrier and reach the cells of the skin.
EXAMPLES
Example 1. Synthesis and Characterization of Robed-siRNAs
[0179] Materials and Methods
[0180] siRNA robed with ionic liquid (IL) moieties were synthesized
by acid-base neutralization as described previously (Nishimura et
al., Biomaterials, 26:5558-5563 (2005)). Benzyl dimethyl alkyl
ammonium chloride salts were purchased from Sigma Aldrich (St.
Louis, Mo.). FAM-GAPDH siRNA (siRNA1, 5'-FAM-GACGUAAACGGCCACAAG
UUC-3' (SEQ ID NO:1)), FAM-GAPDH siRNA (siRNA2,
5'-FAM-GUGUGAACCACGAGAAAUAUU-3'(SEQ ID NO:2)), FAM-Elastase siRNA
(siRNA3, 5'-FAM-UCACUUACAGGAUCUAUAAUU-3' (SEQ ID NO:3)), and
FAM-Control siRNA (siRNA4, 5'-FAM-UAAGGCUAUGAAGAGAUACUU-3' (SEQ ID
NO:4)) were purchased from Dharmacon, Thermo Fisher Scientific
(Waltham, Mass.).
[0181] Chloride salts were converted to their corresponding
hydroxide salts using Amberlite IRA-402 hydroxide form anion
exchange resin (Santa Cruz Biotechnology, Dallas, Tex.).
Benzyldimethyl alkyl ammonium chloride salts were dissolved in
ultrapure ddH.sub.2O (Life Technologies, Grand Island, N.Y.) at a
concentration of 1.0% wt and mixed with excess resin for 1 hour
under constant agitation. The slurry was then centrifuged to pellet
the resin and collect supernatant. Complete anion exchange was
verified by the lack of precipitate following dropwise addition of
silver nitrate (2 g/mL in ddH.sub.2O, Sigma Aldrich, St. Louis,
Mo.). The final solution of benzyldimethyl alkyl ammonium hydroxide
was freeze-dried to remove ddH.sub.2O. Similarly, siRNA sodium
salts were converted to acidic form using Amberlite IR-120 hydrogen
cation exchange resin (Santa Cruz Biotechnology, Dallas, Tex.).
Complete cation exchange was verified by titration. The final
solution of hydrogen form of siRNA was freeze-dried to remove
ddH.sub.2O. Acidic groups on siRNA were neutralized by addition of
equivalent benzyl dimethyl alkyl ammonium hydroxide in methanol.
Neutralization was allowed to proceed overnight at room temperature
with constant agitation. Methanol was then removed by rotary
evaporation and subsequent freeze-drying, and robed-siRNA was
stored at -20.degree. C. until further use.
[0182] Composition of robed-siRNA was confirmed by elemental
analysis. CHN elemental analysis was performed with a CE-440 Rapid
Analysis Elemental Analyzer (Exeter Analytical, North Chelmsford,
Mass.). Sample size was .about.1 mg weighed in small aluminum
capsules. Capsules were placed in protective nickel sleeves, loaded
into the autosampler wheel, and introduced into the combustion
furnace by means of a mechanically operated quartz ladle. Percent
weights of carbon, nitrogen, and hydrogen were determined by
high-temperature combustion at 1000.degree. C. in an
oxygen-enriched helium atmosphere.
[0183] Robed-siRNA were characterized by measuring partitioning
into octanol and water (Log P.sub.o/w). 5 mL ddH.sub.2O was mixed
overnight at room temperature with 5 mL octanol. FAM-siRNA or
robed-FAM-siRNA was then added to the mixture and again allowed to
mix overnight at room temperature in the dark. After overnight
incubation, the solution was centrifuged to separate the octanol
layer and water layer. The concentration of FAM-siRNA present in
each layer was quantified by fluorescence spectroscopy using a
SAFIRE, XFLUOR4, V4.50 microplate reader (Tecan Group Ltd,
Morrisville, N.Y.). Fluorescence detection was performed at an
excitation of 485 nm and an emission of 520 nm, and the method was
validated for linearity, accuracy, and precision. The linear range
during the measurements was from 0.25 pmol/mL to 25 pmol/mL
(r.sup.2=0.9999). Log P.sub.o/w was calculated as the logarithm of
the ratio of fluorescence in the octanol layer compared to the
water layer.
[0184] Aggregation propensity was determined by photon correlation
spectroscopy (Zetasizer Nano series, Malvern Instruments Ltd.,
Worcestershire, UK). Robed-FAM-siRNA were dissolved in ddH.sub.2O
or octanol and sonicated for 30 minutes. Measurements were made at
25.degree. C. with a fixed angle of 173.degree.. Measurements were
performed using a red laser to avoid interference from the
FAM-labeled siRNA. Sizes quoted here are the number means for the
robed-siRNA hydrodynamic diameter.
[0185] Statistical Analysis
[0186] Data reported are mean.+-.SD except where otherwise noted.
Where appropriate, statistical significance was confirmed by one
way-ANOVA and post-hoc test or the two-tailed, unpaired Student's
t-test in Microsoft Excel. The level of significance was set at
p<0.05.
[0187] Results
[0188] siRNAs robed with cationic moieties were synthesized to form
an ionic liquid using a simple, scalable two-step process
consisting of cation/anion exchange followed by acid-base
neutralization (Schemes 1-3).
[0189] Benzyl dimethyl alkyl ammoniums were used as the IL moieties
as described previously (Nishimura et al., Biomaterials,
26:5558-5563 (2005)). Three different alkyl chain lengths were
used: octyl (BDOA), tetradecyl (BDTA), and stearyl (BDSA) (Table
5). Further, several different siRNA sequences were used including
two different glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
knockdown sequences (abbreviated as siRNA1 and siRNA2) as well as a
matrix metalloproteinase-12 (MMP-12) knockdown sequence
(abbreviated as siRNA3) and a non-silencing control siRNA sequence
(abbreviated as siRNA4) (Table 5). Complexes were then lyophilized
to remove all residual water. 1:1 ion pairing and final
compositions were confirmed using elemental analysis (Table 1).
Specifically, percent weights of carbon, nitrogen, and hydrogen
were not significantly different than expected values.
[0190] Robed-siRNAs were characterized by octanol/water
partitioning (P.sub.o/w) (Table 2). As expected all robed-siRNAs
partition well into octanol. While naked siRNA1 was highly
hydrophilic (Log P.sub.o/w=-3.76.+-.0.13), robed-siRNA1s were
hydrophobic with Log P.sub.o/w ranging from 1.43.+-.0.04 for
BDOA-siRNA1 to 3.79.+-.0.38 for BDTA-siRNA1. Similar results were
observed regardless of the siRNA sequence used (Table 2). In
addition, all robed-siRNAs were more hydrophobic than their
corresponding benzyl dimethyl alkyl ammonium salt. For example,
BDOA chloride is only slightly hydrophobic with Log P.sub.o/w=0.85
(predicted value). In contrast, BDOA-siRNA1 was .about.4-fold more
hydrophobic.
TABLE-US-00001 TABLE 1 Synthesis of siRNA robed with IL moieties as
verified using elemental analysis. % wt % wt % wt Carbon/ Carbon
Hydrogen Nitrogen Nitrogen Sample Expected Measured Expected
Measured Expected Measured Expected Measured siRNA1 33.8 32.0 3.4
3.3 (0.07) 14.4 14.4 2.3 2.2 (0.02) (0.04) (0.15) BDOA- 56.0 55.8
7.3 7.7 (0.10) 11.2 11.4 5.0 4.9 (0.05) siRNA1 (0.06) (0.11) BDTA-
68.4 69.0 9.4 9.5 (0.11) 11.2 11.3 6.1 6.1 (0.18) siRNA1 (0.77)
(0.22) BDSA- 76.7 76.1 10.8 10.8 11.2 11.3 6.8 6.8 (0.03) siRNA1
(0.46) (0.04) (0.06) Table 1 shows % wt of Carbon, Hydrogen, and
Nitrogen and Carbon/Nitrogen ratio for FAM-siRNA1 and - siRNA1
robed with IL moieties. Standard deviation for n = 3 is given in
parentheses. Expected and measured values are shown and measured
values compare well with expected values which strongly suggests
incorporation of IL moieties.
TABLE-US-00002 TABLE 2 siRNA robed with IL moieties are
significantly more hydrophobic than native siRNA and native IL
moiety. Log P.sub.o/w Chloride siRNA1 siRNA2 Sodium -3.76 (0.13)
-3.80 (0.21) BDOA 0.85.sup.1 1.43 (0.04) 1.88 (0.16) BDTA
1.81.sup.2 3.79 (0.38) 4.27 (0.78) BDSA 3.23.sup.3 2.31 (0.04) 2.75
(0.33)
[0191] Table 2 shows Log P.sub.o/w for FAM-siRNA1 and -siRNA2.
Standard deviation for n=3 is given in parentheses. .sup.1Predicted
value; .sup.2Hansch et al., Exploring QSAR-Hydrophobic, Electronic,
and Steric Constants. Washington, D.C.: American Chemical Society,
p. 182 (1995); .sup.3Hansch et al., American Chemical Society., p.
188 (1995).
[0192] The size and aggregation propensity of robed-siRNAs in
octanol and water were determined using dynamic light scattering
(DLS). In contrast to polyplexes which do not readily penetrate
skin, siRNA robed with IL moieties at the molecular scale were
produced that readily cross the skin barrier and reach skin cells.
Since siRNA sequence does not appear to affect partitioning, only
siRNA1 was studied here. Importantly, DLS measurement suggests
robed-siRNA1 form individual complexes and do not aggregate in
octanol (representative of the SC) (Table 3). Hydrophilic naked
siRNA1 was not soluble in octanol and thus DLS was not performed.
In water, however, the hydrodynamic diameter of naked siRNA1 was
1.06.+-.0.32 nm. All robed-siRNAs were soluble in octanol.
Hydrodynamic diameters of robed-siRNA1 in octanol were larger than
for naked siRNA1 in water and increased with increasing alkyl chain
length of the IL moieties. Aggregation was observed in water for
BDTA and BDSA-siRNA1. Specifically, BDTA- and BDSA-siRNA1 possessed
hydrodynamic diameters in water of 182.0.+-.92.4 and 846.4.+-.176.1
nm, respectively. In contrast, BDOA-siRNA1 was not observed to
aggregate in water (hydrodynamic diameter=1.63.+-.0.16 nm). As a
control, the size of a siRNA polyplex (Lipofectamine.RTM. RNAiMax,
Life Technologies, Grand Island, N.Y.) was also determined. Similar
to naked siRNA1, RNAiMax-siRNA1 was insoluble in octanol thus DLS
was not performed. In water, the hydrodynamic radius was
88.3.+-.1.2 nm. Taken together the data show that robed-siRNAs do
not aggregate in octanol and therefore may move through the
hydrophobic SC as single complexes as opposed to polyplexes.
TABLE-US-00003 TABLE 3 DLS measurements of siRNA robed with IL
moieties shows formation of individual complexes without
aggregation in octanol (representative of the SC), while in water
aggregation is dependent on alkyl chain length of the IL moiety.
Effective Effective diameter (nm) diameter (nm) in octanol in water
siRNA1 Insoluble 1.06 (0.32) BDOA-siRNA1 2.03 (0.33) 1.63 (0.16)
BDTA-siRNA1 2.68 (0.52) 182.0 (92.4) BDSA-siRNA1 4.44 (1.29) 846.4
(176.1) RNAiMax-siRNA1 Insoluble 88.3 (1.2)
[0193] Table shows effective complex diameters (nm) for
robed-FAM-siRNA. Standard deviation for n=3 is given in
parenthesis.
Example 2. Robed-siRNA is Efficiently Transported Through the
Skin
[0194] Materials and Methods
[0195] Measurement of Skin Transport
[0196] Full thickness pig skin (Lampire Biological Laboratories,
Pipersville, Pa.) was used in this study. All skin samples were
stored at -80.degree. C. Skin was defrosted and hair were trimmed
immediately prior to use. Skin pieces were cleaned with PBS (pH
7.4) and skin conductivity was measured to ensure that the samples
were intact. Skin penetration was assessed in Franz diffusion cells
(FDCs) as described previously (Chen et al., Journal of Controlled
Release, 179:33-41 (2014); Karande et al., Nature Biotechnology,
22:192-197 (2004)). Briefly, the receptor compartment was filled
with PBS at pH 7.4. Each test formulation was assessed in
triplicate. Skin was mounted with the SC facing up and the donor
compartment left dry and open to atmosphere for 30 minutes before
applying the test formulation. Caution was taken to remove all air
bubbles between the underside of the skin (dermis) and the receptor
solution. 150 .mu.L of 50 .mu.M FAM-siRNA or robed-FAM-siRNA was
applied to skin surface. FDCs were incubated for 24 hours at
37.degree. C. with moderate stirring. After 24 hours the
formulations were removed from the skin by washing five times with
PBS (pH 7.4). The SC was isolated from the epidermis by stripping
with an adhesive tape (Scotch.RTM. Transparent Tape, 3M Corporate,
St. Paul, Minn.). Ten tape strips were performed consecutively. The
stripped tapes were collected in glass vials as follows: SC 1=1st
strip and SC 2-10=2nd-10th strips. 10 strips were assumed to remove
the entirety of the SC. After tape-stripping, the epidermis was
isolated from the dermis with a surgical sterile scalpel. The
epidermis and dermis were cut into small pieces and transferred
into separate glass vials. Finally, 3 mL volume from the acceptor
solution was transferred to glass vial. For extraction of
fluorescent siRNA, 3 mL of methanol and PBS pH 7.4 (1:1, v/v)
mixture was added to each vial and shaken overnight at room
temperature. Afterwards the solutions were centrifuged for 10
minutes to pellet skin tissue. Supernatants were withdrawn, diluted
if necessary, and concentrations of fluorescent probes were
determined by fluorescence spectroscopy as described above.
[0197] Visualization of Skin Transport
[0198] To visualize transport of FAM-siRNA and robed-FAM-siRNA into
skin, formulations were applied to skin in FDCs as described above.
After incubation for 24 hours, thin sections (20 .mu.m)
corresponding to the application area were prepared using a Leica
Cryostat CM1850 (Leica, Buffalo Grove, Ill.). Sections were imaged
using an Olympus Fluoview 1000 Spectral confocal microscope
(Olympus, Center Valley, Pa.). All instrument settings were kept
constant between samples for comparison between experimental
conditions.
[0199] Results
[0200] Skin penetration was assessed using Franz diffusion cells
(FDCs) as described previously (Chen et al., Journal of Controlled
Release, 179:33-41 (2014); Karande et al., Nature Biotechnology,
22:192-197 (2004)). Importantly, skin transport of siRNA1 was
significantly enhanced by robing with IL moieties (FIGS. 2A and
2B). Percent (%) applied dose delivered into the viable epidermis
was 9.85.+-.2.64, 9.60.+-.2.85, and 7.33.+-.0.24 for BDOA-, BDTA-,
and BDSA-siRNA1 compared to only 2.06.+-.0.15 for naked siRNA1.
Similarly, % applied dose delivered into the deeper skin tissue
layer of the dermis was 12.94.+-.2.56 and 8.89.+-.0.77 for BDOA-
and BDSA-siRNA1 compared to only 2.26.+-.1.16 for naked siRNA1.
Interestingly, % applied dose delivered into the dermis was
actually retarded (0.49.+-.0.18) when siRNA1 was robed with BDTA.
Similar results were observed regardless of siRNA sequence used
(FIG. 2B).
[0201] Delivery enhancement of robed-FAM-siRNA into skin was
confirmed with confocal microscopy. Significantly higher skin
transport of siRNA was observed when robing with IL moieties
compared to unrobed siRNA
Example 3. Robed-siRNA is not Toxic to Cells
[0202] Materials and Methods
[0203] Cell Culture
[0204] All cell culture materials were acquired from Life
Technologies (Grand Island, N.Y.). Human adult epidermal
keratinocytes were cultured in EpiLife Medium supplemented with
Human Keratinocyte Growth Supplement, 25 U/mL penicillin, 25
.mu.g/mL streptomycin, and 50 .mu.g/mL neomycin. Cultures were
grown at 37.degree. C. with 5% CO2.
[0205] Evaluation of Biocompatibility in Cell Culture
[0206] Cells were seeded in a 96-well microplate (Corning Inc.,
Corning, N.Y.) and were allowed to attach and proliferate. Once
cells reached .about.80% confluency, the media was removed and
FAM-siRNA, robed-FAM-siRNA, or benzyl dimethyl alkyl ammonium
chloride salts in media was added. Media alone was used as a
control. Cells were incubated with test solution for 4 hours at
37.degree. C. and 5% CO.sub.2. After incubation, test solutions
were removed, cells were washed with HBSS, and fresh media was
added to each well. Cells were allowed to proliferate overnight
before being assessed for viability using the MTT Cell
Proliferation Assay (ATCC, Manassas, Va.). Viability was determined
according to the manufacturer's recommended protocol using a
SAFIRE, XFLUOR4, V4.50 microplate reader (Tecan Group Ltd,
Morrisville, N.Y.).
[0207] Results
[0208] The ability of robed-siRNA to cross cell membranes was
assessed in vitro by confocal laser scanning microscopy (CLSM).
Human adult epidermal keratinocytes (HEKa cells) are the primary
cell type in the viable epidermis and thus were used for all in
vitro studies. HEKa cells were incubated with 100 nM robed-siRNA1
for 4 hours. Cells were then washed, nuclei stained with Hoechst
33342, and imaged to visualize siRNA1 internalization.
Internalization of robed-siRNA1 was compared to internalization of
naked siRNA1. Importantly, compared to naked siRNA1, cell
internalization was enhanced by robing with IL moieties. On the
other hand, the extent of cell internalization does appear to
depend on the IL moiety used. For example, BDTA showed the most
internalization enhancement while BDOA showed the least
enhancement.
[0209] Biocompatibility of robed-siRNAs was assessed in vitro
against HEKa cells using the MTT assay (ATCC, Manassas, Va.).
Importantly, robed-siRNA1 shows negligible cytotoxicity to HEKa
cells up 100 nM (FIG. 3A). Above 100 nM, however, cytotoxicity was
observed for BDTA-siRNA1 and BDSA-siRNA1. Specifically, following
incubation with 1000 nM BDTA- or BDSA-siRNA1% cell viability was
18.48.+-.2.66 and 67.60.+-.9.92 compared to HEKa cells incubated
with culture media alone. In contrast, no significant cytotoxicity
was observed following incubation with 1000 nM BDOA-siRNA1. Naked
siRNA1 was non-toxic for all concentrations studied (FIGS. 3A-3C).
In addition, BDOA, BDTA, and BDSA appear to be more toxic as free
salts than when deliver as robed with siRNAs (FIG. 3B). This
observation was most apparent at higher concentrations; however,
the differences were not statistically significant (p >0.05).
Again, similar results were observed regardless of the siRNA
sequence used (FIG. 3C).
Example 4. Robed-siRNA is Successfully Internalized in Skin
Cells
[0210] Materials and Methods
[0211] Cells were seeded on poly-D-lysine-coated glass bottom
culture dishes (MatTek Corporation, Ashland, Mass.) and were
allowed to attach and proliferate. Once cells reached .about.80%
confluency, the media was removed and FAM-siRNA or robed-FAM-siRNA
in media was added. Cells were incubated with test formulations for
4 hours under standard culture conditions. After incubation with
test solutions, cells were stained with 5 .mu.g/mL Hoechst 33342
(Life Technologies, Grand Island, N.Y.) for 5 min at room
temperature and then washed 3 times for 5 min each with Hank's
Balanced Salt Solution (HBSS, Lonza Group Ltd., Basel,
Switzerland). Cells were imaged using an Olympus Fluoview 1000
Spectral confocal microscope (Olympus, Center Valley, Pa.). All
instrument settings were kept constant for any comparisons between
experimental conditions and a 30.times. silicon immersion objective
was used to capture the entire thickness of the cell.
[0212] Results
[0213] BDOA-siRNA demonstrated excellent transport into deep viable
skin layers (epidermis and dermis), the ability to improve cell
internalization compared to naked siRNA, and superior
biocompatibility compared to BDTA- and BDSA-siRNA (FIGS. 2A-3C).
Since siRNA in cell culture typically requires extended incubation
times to elicit a response, BDOA-siRNA cell internalization and
biocompatibility was also confirmed following 72 hour incubation.
As expected, cell internalization in HEKa cells was significantly
enhanced following 72 hour exposure to BDOA-siRNA1 compared to
naked siRNA1. Further, negligible cytotoxicity was observed up to
300 nM BDOA-siRNA relative to cells incubated with media alone
(FIG. 4).
[0214] As an additional control, cell internalization of
BDOA-siRNA1 was compared to Lipofectamine RNAiMax-siRNA1. In
contrast to RNAiMax-siRNA1, BDOA-siRNA1 shows significantly less
cell internalization. Interestingly, however, the internalization
pattern of BDOA-siRNA1 was strikingly different. Specifically,
BDOA-siRNA1 demonstrated diffuse fluorescence indicative of
cytoplasmic localization. In contrast, RNAiMax-siRNA1 demonstrated
punctate fluorescence indicative of endosomal sequestration.
Example 5. Robed-siRNA Successfully Silences Gene Expression in
Cells
[0215] Materials and Methods
[0216] Cells were seeded in a 96-well microplate (Corning Inc.,
Corning, N.Y.) and were allowed to attach and proliferate. Once
cells reached .about.80% confluency, media was removed and
FAM-siRNA or robed-FAM-siRNA in media was added. Media alone was
used as a control. Cells were incubated with test solution for 72
hours at 37.degree. C. and 5% CO2. After incubation, total protein
and GAPDH expression were quantified. Total protein was assessed
with the Bicinchoninic Acid Protein Assay Kit (Thermo Scientific,
Rockford, Ill.) and GAPDH levels were measured using the KDalert
GAPDH Assay Kit (Life Technologies, Grand Island, N.Y.) according
to the manufacturer's recommended protocol and using a SAFIRE,
XFLUOR4, V4.50 microplate reader (Tecan Group Ltd, Morrisville,
N.Y.).
[0217] Results
[0218] The ability of BDOA-siRNA to elicit a therapeutic response
was first confirmed in vitro. GAPDH was used as a model knockdown
target. BDOA-siRNA1 was incubated with HEKa cells at various
concentrations and GAPDH knockdown was assessed as described
previously (Chen et al., Journal of Controlled Release, 179:33-41
(2014)). As controls, naked siRNA1 and BDOA-siRNA4 (non-silencing
control siRNA) were also studied. As an additional control
RNAiMax-siRNA1 and RNAiMax-siRNA4 were also used at the
manufacturer's recommended concentration (10 nM). As expected,
naked siRNA1 as well as non-silencing siRNA4 formulations did not
reduce GAPDH expression in HEKa cells after 72 hour incubation
(FIG. 5). In addition, 100 nM and 200 nM BDOA-siRNA1 showed no
significant difference in GAPDH expression compared to the
untreated control. Incubation with 300 nM BDOA-siRNA1, however, did
result in significant GAPDH knockdown (58.7.+-.2.0% GAPDH
expression compared to the untreated control) (FIG. 5). Similarly,
incubation with 10 nM RNAiMax-siRNA1 resulted in significant GAPDH
knockdown (36.9.+-.3.2% GAPDH expression compared to the untreated
control).
Example 6. Robed-siRNA Disease Treatment and Biocompatibility in
MatTek Epiderm.TM. Tissue Samples
[0219] Materials and Methods
[0220] MatTek Epiderm.TM. human skin equivalent tissues were used
as described previously (Afaq et al., Exp Dermatol, 18:553-561
(2009)) to evaluate treatment of premature wrinkle formation using
robed-siRNA. Briefly, Epiderm.TM. tissues were allowed to acclimate
at 37.degree. C. and 5% CO2 for 24 hours with 2.5 mL media in
6-well culture plates (Corning Inc., Corning, N.Y.). After 24 hours
incubation, media was replaced and 100 .mu.L of ddH.sub.2O
(control) or 50 .mu.M native elastase siRNA (siRNA3), 50 .mu.M
BDOA-control non-silencing siRNA (siRNA4), 25 .mu.M BDOA-siRNA3, or
50 .mu.M BDOA-siRNA3 was applied to the apical side of the skin
tissues. After 24 hours incubation, test formulations were removed
and the skin was exposed to 200 mJ/cm2 UVB irradiation using a
6-watt UV lamp with 302 nm wavelength and white light tubes (Cole
Parmer, Vernon, Ill.). Irradiation was measured with a Solarmeter
model 6.2 UV meter (Solar Light Company Inc., Glenside, Pa.).
Following exposure freshly prepared formulations were reapplied to
the skin tissues and incubated for an additional 96 hours. At the
conclusion of the experiment, 2 mL of media was collected and
analyzed for elastin and elastase content using a Human Elastin
ELISA kit and Human MMP-12 ELISA kit (Biomatik USA LLC.,
Wilmington, Del.), respectively, following the manufacturer's
recommended protocol. Biocompatibility of the test formulations was
confirmed using the MTT assay following MatTek's recommended
protocol.
[0221] Results
[0222] The clinical potential of BDOA-siRNA was assessed against a
skin aging model in human skin equivalent tissues (Afaq et al., Exp
Dermatol, 18:553-561 (2009)). Elastase upregulation has been
proposed as an important factor for ultraviolet irradiation induced
wrinkle formation (Tsuji et al., Photochemistry and Photobiology,
74:283-290 (2001)). Therefore, knockdown of elastase with topically
applied RNAi is a proposed option for the treatment and prevention
of skin wrinkling. Following UVB irradiation and application of
BDOA-siRNAs there was no observed decrease in tissue viability
(FIG. 6). This result confirms 1) irradiation of a suberythemal
dose and 2) biocompatibility of BDOA-siRNA. Moreover, UVB
irradiation resulted in significant upregulation of elastase (FIG.
7A) and significant reduction in elastin (FIG. 7B) compared to
tissues not exposed to UVB irradiation confirming the validity of
the disease model. Topical application of naked siRNA3 or
BDOA-siRNA4 was unable to protect against elastase upregulation and
consequent elastin degradation. In contrast, application of
BDOA-siRNA3 at both 50 .mu.M and 25 .mu.M were able to maintain the
non-altered state of the skin following UVB irradiation thus
confirming the clinical potential of robed-siRNAs (FIGS. 7A and
7B).
Example 7. Cation Paired Hyaluronic Acid (HA) is an Efficient Skin
Penetration Agent
[0223] Materials and Methods
[0224] Cation paired HA was prepared according to methods described
in Example 1.
[0225] Results
[0226] Different species of cation paired HA and their
octanol-water partition coefficients are show in Table 4. The
pairing of hydrophobic cations with hyaluronic acid dramatically
enhances their octanol-water partition coefficient. This
enhancement in octanol-water partition coefficient is expected to
increase their skin penetration. Pairing of hyaluronic acid with
hydrophobic cations led to up to 1,000,000-fold improvement in
their octanol-water partition coefficient, similar to those seen
for siRNA. Such dramatic enhancement in partition coefficient is
expected to increase their skin penetration.
TABLE-US-00004 TABLE 4 Exemplary cations paired with HA and their
octanol-water partitioning coefficients. Cations paired with HA
LogP.sub.o/w Na+ -3.69 Sodium ##STR00008## -3.32 ##STR00009## 2.14
##STR00010## 2.53 ##STR00011## 2.40
Example 8. Dermal Delivery of Bovine Serum Albumin and Ovalbumin in
the Presence of Choline-Geranic Acid IL
[0227] Materials and Methods
[0228] Choline and geranic acid deep eutectic liquid was prepared
as described in WO 2015/066647, and fluorescently-labeled albumin
(bovine serum albumin or ovalbumin) was added to it. Albumin-loaded
choline-geranic acid formulation was placed on porcine skin for 24
hours and skin was sectioned to assess the penetration of albumin
Control experiments were performed using PBS.
[0229] Results
[0230] Significant and deep penetration of albumin was seen when
albumin was delivered from choline and geranic acid. The benefits
of choline and geranic acid formulation are expected to extend to
other proteins including insulin, antibodies, and therapeutic
peptides. The benefits of choline and geranic acid are also
expected to extend to other ionic liquids.
[0231] BDOA-siRNA exhibited the most enhancement into the deep
viable tissue layers of the skin (epidermis and dermis) (FIGS. 2A
and 2B). In addition, although cell internalization was less
efficient compared to BDTA- and BDSA-siRNA, BDOA-siRNA shows
negligible cytotoxicity to skin cells at significantly higher
concentrations (FIGS. 3A-3C).
[0232] The ability of BDOA-siRNA to prevent wrinkle formation was
assessed against a skin aging model in human skin equivalent
tissues as described previously (Afaq et al., Exp Dermatol,
18:553-561 (2009)). BDOA robed-antielastase siRNA was applied on
the apical surface of human skin equivalent tissues. As controls,
saline, naked anti-elastase siRNA, and BDOA robed-non-silencing
control siRNA were also tested. UVB irradiation induced significant
elastase upregulation and elastin degradation in control tissues
(FIGS. 7A and 7B). In contrast, tissues treated with 25 .mu.M or 50
.mu.M BDOA robed-antielastase siRNA showed identical elastase and
elastin content as unexposed, healthy tissues (i.e. no UVB
treatment).
[0233] Efficacy and safety of BDOA-siRNA is related to its
physicochemical properties. The extent of transport correlates well
with hydrophobicity of robed-siRNAs. Naked siRNA is hydrophilic and
transport through the SC is minimal (FIGS. 2A and 2B). In contrast,
the hydrophobic robed-siRNAs were able to penetrate the SC in
significant quantities. BDTA was the most hydrophobic and transport
into the SC was highest. However, due to high fusogenicity between
BDTA and SC lipids, BDTA-siRNA was retained in superficial layers
of the skin and did not penetrate into deep tissue layers. Thus, a
balance must be sought to allow enhanced partitioning into the SC
from the donor solution as well as out of the SC into viable tissue
layers of the skin. Cell internalization of robed-siRNAs also
correlates well with hydrophobicity. Log P.sub.o/w of BDTA-siRNA
was highest among robed-siRNAs, and BDTA-siRNA1 possessed the
highest degree of cell internalization. In contrast, Log P.sub.o/w
of BDOA-siRNA was lowest among robed-siRNAs, and BDOA-siRNA1
possessed the lowest degree of cell internalization albeit still
significantly higher than was observed for naked siRNA1.
[0234] The relationships between hydrophobicity and transport
properties of robed-siRNAs presents an opportunity for tuning their
efficacy through facile manipulation of the IL moiety counter
species. Hydrophobicity appears tunable to an extent by varying the
alkyl chain length of the counter species. Robing with BDOA
resulted in the lowest Log P.sub.o/w while BDTA and BDSA-siRNAs
were significantly more hydrophobic. However, the relation between
hydrophobicity and chain length was not linear. Specifically, BDTA
(alkyl chain=14 carbons) was significantly more hydrophobic than
BDSA (alkyl chain=18 carbons). This is in contrast to the Log
P.sub.o/w of individual benzyl dimethyl alkyl ammonium species
which increase linearly with chain length (FIG. 1, r.sup.2=0.9497)
according to predicted and experimentally determined values.
Aggregation propensity and the size of aggregates also appear to
depend on alkyl chain length (Table 3). Ideally, robed-siRNAs would
transport as single, hydrophobic molecules as opposed to polyplexes
to maximize transdermal and transcellular transport. Aggregation
into polyplexes is expected to significantly hinder the kinetics of
skin transport as well as the depth of delivery thus aggregation
should be avoided through optimization of the IL moiety alkyl chain
length. Exemplary cations, with sodium ion used as control, and
anions are shown in Table 5.
TABLE-US-00005 TABLE 5 Exemplary cations and anions used in the
studies. Cations Anions Na+ GACGUAAACGGCCACAAGUUCUU SEQ ID NO: 5
Sodium UUCUGCAUUUGCCGGUGUUCAAG SEQ ID NO: 6 siRNA1 (GAPDH)
##STR00012## GUGUGAACCACGAGAAAUAUUUU SEQ ID NO: 7
UUCACACUUGGUGCUCUUUAUAA SEQ ID NO: 8 siRNA2 (GAPDH) ##STR00013##
UCACUUACAGGAUCUAGAAUU SEQ ID NO: 9 UUAGUGAAUGUCCUAGAUAUU SEQ ID NO:
10 siRNA3 (Elastase) ##STR00014## UAAGGCUAUGAAGAGAUACUU SEQ ID NO:
11 UUAUUCCGAUACUUCUCUAUG SEQ ID NO: 12 siRNA4 (Control)
[0235] Lipofectamine RNAiMax is a commercially available siRNA
polyplex platform that has been optimized over many years to afford
consistent, fast, and efficient delivery of siRNA into cells.
RNAiMax-siRNA outperformed BDOA-siRNA at 30-fold lower
concentrations (FIG. 5). Therefore, the data do not support the use
of BDOA-siRNA for gene-silencing applications in cell culture in
vitro. The difference could be related to the stability of
robed-siRNAs in aqueous solution. RNAiMax-siRNA polyplexes are
stable in high salt and buffered solutions while robed-siRNAs are
held together simply by 1:1 ion pairing and thus are expected to
dissolve in dilute aqueous conditions. Maximizing ion association
between siRNA phosphate groups and the IL moiety may be one
potential option to mitigate dissociation and subsequently maximize
cell internalization and gene silencing at lower concentrations in
solution. Ionic liquids are known to have varying degrees of ion
association both neat as well as in solution depending on the
choice of ion pairing (Zhang et al., Journal of Physical and
Chemical Reference Data, 35:1475-1517 (2006)).
[0236] High concentrations of benzyl dimethyl alkyl ammonium
robed-siRNA needed to minimize dissociation were also met with
significant observed cytotoxicity. As with transport properties,
cytotoxicity correlates well with hydrophobicity. This is not
surprising given hydrophobicity is commonly used as an indicator
for IL moiety cytotoxicity (Ranke et al., Ecotoxicology and
Environmental Safety, 58:396-404 (2004); Ranke et al.,
Ecotoxicology and Environmental Safety, 67:430-438 (2007)) but may
impose some limitations of robed-siRNA use as a balance may need to
be struck between transport enhancement into skin and cells and
biocompatibility. Interestingly, however, robed siRNAs do appear to
be less toxic than equal concentrations of the IL moiety chloride
salts (FIGS. 3A-3C). This suggests ion pairing may reduce
cytotoxicity of the individual components somewhat which is in
agreement with previous studies of ionic liquid toxicity (Aoyagi et
al., TECHNOLOGY, 03:214-238 (2015); Zakrewsky et al., Proceedings
of the National Academy of Sciences, 111:13313-13318 (2014)).
[0237] On the other hand, no toxicity effects were observed in
human skin equivalent tissues. Therefore, biocompatibility may only
be an issue for extending this strategy for knockdown in cell
culture or following systemic administration in vivo. Cell
internalization enhancement relative to naked siRNA and avoidance
or release from endosomal compartments in combination with
excellent dermal delivery highly supports the use of BDOA-siRNA for
gene silencing applications in skin. Indeed, the skin presents a
unique environment where robed siRNAs can penetrate through the
hydrophobic SC as single complexes and then interact immediately
with diseased cells in the viable epidermis, thus limiting the
extent of dissociation and enhancing cell internalization and gene
silencing. This is consistent with the observations after
application of BDOA-siRNA on human skin equivalent tissues (FIGS.
6, 7A and 7B). In addition, robed-siRNA properties and behavior are
independent of siRNA sequence. This opens up the possibilities of
using robed-siRNAs for the treatment of myriad other skin diseases
for which known protein knockdown targets exist such as psoriasis,
atopic dermatitis, skin cancer, melasma, pachyonychia congenita,
and many others (Zakrewsky et al., Journal of Controlled Release,
218:445-456 (2015)). Further, this opens up the possibility for
more effective treatments through the use robed-siRNA cocktails
that knockdown several protein targets simultaneously.
[0238] Therefore, knockdown of elastase with topically applied RNAi
may be a viable option for the treatment and prevention of skin
wrinkling, as well as provide patients with a safe alternative to
current options. Topically applied RNAi must transport through the
skin and into cells to elicit a therapeutic response. In addition,
the therapy must be biocompatible.
Sequence CWU 1
1
12121RNAArtificial SequenceFAM-GAPDH siRNA, shown 5' to
3'misc_feature(1)..(1)5' FAM modification 1gacguaaacg gccacaaguu c
21221RNAArtificial SequenceFAM-GAPDH siRNA, shown 5' to
3'misc_feature(1)..(1)5' FAM modification 2gugugaacca cgagaaauau u
21321RNAArtificial SequenceFAM-Elastase siRNA, shown 5' to
3'misc_feature(1)..(1)5' FAM modification 3ucacuuacag gaucuauaau u
21421RNAArtificial SequenceFAM siRNA, shown 5' to
3'misc_feature(1)..(1)5' FAM modification 4uaaggcuaug aagagauacu u
21523RNAArtificial SequencesiRNA sequence for GAPDH, shown 5' to 3'
5gacguaaacg gccacaaguu cuu 23623RNAArtificial SequencesiRNA
sequence for GAPDH, shown 5' to 3' 6gaacuugugg ccguuuacgu cuu
23723RNAArtificial SequencesiRNA sequence for GAPDH - shown 5' to
3' 7gugugaacca cgagaaauau uuu 23823RNAArtificial SequencesiRNA
sequence for GAPDH, shown 5' to 3' 8aauauuucuc gugguucaca cuu
23921RNAArtificial SequencesiRNA sequence for elastase, shown 5' to
3' 9ucacuuacag gaucuagaau u 211021RNAArtificial SequencesiRNA
sequence for elastase, shown 5' to 3' 10uuauagaucc uguaagugau u
211121RNAArtificial Sequencenon-silencing siRNA control sequence,
shown 5' to 3' 11uaaggcuaug aagagauacu u 211221RNAArtificial
Sequencenon-silencing siRNA control sequence, shown 5' to 3'
12guaucucuuc auagccuuau u 21
* * * * *