U.S. patent application number 17/164585 was filed with the patent office on 2021-05-27 for antisense antibacterial compounds and methods.
This patent application is currently assigned to Board of Regents, The University of Texas System. The applicant listed for this patent is Board of Regents, The University of Texas System, Oregon State University. Invention is credited to Bruce L. GELLER, David GREENBERG, Erdal TOPRAK.
Application Number | 20210155934 17/164585 |
Document ID | / |
Family ID | 1000005374420 |
Filed Date | 2021-05-27 |
![](/patent/app/20210155934/US20210155934A1-20210527-C00001.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00002.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00003.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00004.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00005.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00006.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00007.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00008.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00009.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00010.png)
![](/patent/app/20210155934/US20210155934A1-20210527-C00011.png)
View All Diagrams
United States Patent
Application |
20210155934 |
Kind Code |
A1 |
GREENBERG; David ; et
al. |
May 27, 2021 |
ANTISENSE ANTIBACTERIAL COMPOUNDS AND METHODS
Abstract
Provided are antisense morpholino oligomers targeted against
bacterial virulence factors such as genes that contribute to
antibiotic resistance or biofilm formation, or essential genes, and
related compositions and methods of using the oligomers and
compositions, for instance, in the treatment of an infected
mammalian subject.
Inventors: |
GREENBERG; David; (Coppell,
TX) ; GELLER; Bruce L.; (Corvallis, OR) ;
TOPRAK; Erdal; (Plano, TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Board of Regents, The University of Texas System
Oregon State University |
Austin
Corvallis |
TX
OR |
US
US |
|
|
Assignee: |
Board of Regents, The University of
Texas System
Austin
TX
Oregon State University
Corvallis
OR
|
Family ID: |
1000005374420 |
Appl. No.: |
17/164585 |
Filed: |
February 1, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16064273 |
Jun 20, 2018 |
10907158 |
|
|
PCT/US2016/068373 |
Dec 22, 2016 |
|
|
|
17164585 |
|
|
|
|
62433669 |
Dec 13, 2016 |
|
|
|
62408518 |
Oct 14, 2016 |
|
|
|
62301406 |
Feb 29, 2016 |
|
|
|
62387176 |
Dec 23, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 47/64 20170801;
C12N 2310/11 20130101; C12N 15/1133 20130101; A61K 31/713 20130101;
C07K 4/02 20130101; C12N 2310/3233 20130101; C07K 14/005 20130101;
C12N 15/113 20130101; A61P 31/04 20180101; C12N 9/1247
20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 47/64 20060101 A61K047/64; A61K 31/713 20060101
A61K031/713; A61P 31/04 20060101 A61P031/04; C07K 4/02 20060101
C07K004/02; C07K 14/005 20060101 C07K014/005; C12N 9/12 20060101
C12N009/12 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under grant
number A1098724 awarded by The National Institutes of Health. The
government has certain rights in the invention.
Claims
1. An antisense morpholino oligomer, composed of morpholino
subunits and phosphorus-containing intersubunit linkages joining a
morpholino nitrogen of one subunit to a 5'-exocyclic carbon of an
adjacent subunit, and having (a) about 10-40 nucleotide bases, and
(b) a targeting sequence of sufficient length and complementarity
to specifically hybridize to a bacterial mRNA target sequence that
encodes a virulence factor; where the oligomer is conjugated to a
cell-penetrating peptide (CPP), wherein the target sequence is SEQ
ID NO: 22 (GAT ACA GTG AC) or SEQ ID NO: 23 (AAC GAT ATT CC), and
wherein thymine (T) bases may be uracil (U) bases.
2. The antisense morpholino oligomer of claim 1, wherein the
antisense morpholino oligomer is of formula (I): ##STR00042## or a
pharmaceutically acceptable salt thereof, where each Nu is a
nucleobase which taken together forms a targeting sequence; X is an
integer from 9 to 38; T is selected from OH and a moiety of the
formula: ##STR00043## where each R.sup.4 is independently
C.sub.1-C.sub.6 alkyl, and R.sup.5 is selected from an electron
pair and H, and R.sup.6 is selected from OH,
--N(R.sup.7)CH.sub.2C(O)NH.sub.2, and a moiety of the formula:
##STR00044## where: R.sup.7 is selected from H and C.sub.1-C.sub.6
alkyl, and R.sup.8 is selected from G, --C(O)--R.sup.9OH, acyl,
trityl, and 4-methoxytrityl, where: R.sup.9 is of the formula
--(O-alkyl).sub.y- wherein y is an integer from 3 to 10 and each of
the y alkyl groups is independently selected from C.sub.2-C.sub.6
alkyl; each instance of R.sup.1 is --N(R.sup.10).sub.2R.sup.11
wherein each R.sup.10 is independently C.sub.1-C.sub.6 alkyl, and
R.sup.11 is selected from an electron pair and H; R.sup.2 is
selected from H, G, acyl, trityl, 4-methoxytrityl, benzoyl,
stearoyl, and a moiety of the formula: ##STR00045## where L is
selected from --C(O)(CH.sub.2).sub.6C(O)-- and
--C(O)(CH.sub.2).sub.2S.sub.2(CH.sub.2).sub.2C(O)--, and each
R.sup.12 is of the formula --(CH.sub.2).sub.2OC(O)N(R.sup.14).sub.2
wherein each R.sup.14 is of the formula
--(CH.sub.2).sub.6NHC(.dbd.NH)NH.sub.2; and R.sup.3 is selected
from an electron pair, H, and C.sub.1-C.sub.6 alkyl, wherein G is a
cell penetrating peptide ("CPP") and linker moiety selected from
--C(O)(CH.sub.2).sub.5NH-CPP, --C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP, and
--C(O)CH.sub.2NH-CPP, or G is of the formula: ##STR00046## wherein
the CPP is attached to the linker moiety by an amide bond at the
CPP carboxy terminus, with the proviso that only one instance of G
is present, wherein the targeting sequence specifically hybridizes
to a bacterial mRNA target sequence that encodes a virulence
factor.
3-4. (canceled)
5. The antisense morpholino oligomer of claim 4, wherein the
antibiotic resistance protein is selected from one or more of New
Delhi metallo-beta-lactamase (NDM-1), serine beta-lactamase (KPC),
acridine resistance complex protein AcrA, acridine resistance
complex protein AcrB, acridine resistance complex repressor protein
AcrR, acridine resistance complex protein TolC, and outer membrane
protein A (OmpA).
6-16. (canceled)
17. The antisense morpholino oligomer of claim 1, wherein T is
selected from: ##STR00047##
18. The antisense morpholino oligomer of claim 1, wherein R.sup.2
is selected from H, G, acyl, trityl, 4-methoxytrityl, benzoyl, and
stearoyl.
19. The antisense morpholino oligomer of claim 1, wherein T is
selected from: ##STR00048## and R.sup.2 is G.
20. The antisense morpholino oligomer of claim 1, wherein T is of
the formula: ##STR00049## R.sup.6 is of the formula: ##STR00050##
and R.sup.2 is G.
21. The antisense morpholino oligomer of claim 1, wherein T is of
the formula: ##STR00051## and R.sup.2 is G.
22. The antisense morpholino oligomer of claim 1, wherein T is of
the formula: ##STR00052##
23. The antisense morpholino oligomer according to claim 1, wherein
R.sup.2 is selected from H, acyl, trityl, 4-methoxytrityl, benzoyl,
and stearoyl.
24. The antisense morpholino oligomer according to claim 1, wherein
at least one instance of R.sup.1 is --N(CH.sub.3).sub.2.
25. The antisense morpholino oligomer of claim 24, wherein each
R.sup.1 is --N(CH.sub.3).sub.2.
26. The antisense morpholino oligomer according to claim 1, wherein
the CPP is selected from: ##STR00053## wherein R.sup.a is selected
from H, acetyl, benzoyl, and stearoyl.
27. The antisense morpholino oligomer according to claim 1, wherein
G is selected from: ##STR00054## wherein R.sup.a is selected from
H, acetyl, benzoyl, and stearoyl.
28. The antisense morpholino oligomer of claim 1, wherein the
antisense oligomer is of the formula (VII) selected from:
##STR00055## ##STR00056## or a pharmaceutically acceptable salt of
any of the foregoing, wherein R.sup.a is selected from H, acetyl,
benzoyl, and stearoyl, R.sup.b is selected from H, acetyl, benzoyl,
stearoyl, trityl, and 4-methoxytrityl, and X and Nu are as defined
in claim 1.
29. The antisense morpholino oligomer of claim 28, wherein R.sup.a
is acetyl and R.sup.b is H.
30. The antisense morpholino oligomer according to claim 17,
wherein the targeting sequence is SEQ ID NO: 22 (GAT ACA GTG AC),
wherein thymine bases (T) may be uracil bases (U).
31. The antisense morpholino oligomer according to claim 1, wherein
the targeting sequence is SEQ ID NO: 23 (AAC GAT ATT CC), wherein
thymine bases (T) may be uracil bases (U).
32. (canceled)
33. A pharmaceutical composition, comprising a pharmaceutically
acceptable carrier and an antisense morpholino oligomer according
to claim 1.
34. The pharmaceutical composition of claim 33, wherein the
antisense morpholino oligomer is of formula (I): ##STR00057## or a
pharmaceutically acceptable salt thereof, where each Nu is a
nucleobase which taken together forms a targeting sequence; X is an
integer from 9 to 38; T is selected from OH and a moiety of the
formula: ##STR00058## where each R.sup.4 is independently
C.sub.1-C.sub.6 alkyl, and R.sup.5 is selected from an electron
pair and H, and R.sup.6 is selected from OH,
--N(R.sup.7)CH.sub.2C(O)NH.sub.2, and a moiety of the formula:
##STR00059## where: R.sup.7 is selected from H and C.sub.1-C.sub.6
alkyl, and R.sup.8 is selected from G, --C(O)--R.sup.9OH, acyl,
trityl, and 4-methoxytrityl, where: R.sup.9 is of the formula
--(O-alkyl).sub.y- wherein y is an integer from 3 to 10 and each of
the y alkyl groups is independently selected from C.sub.2-C.sub.6
alkyl; each instance of R.sup.1 is --N(R.sup.10 2R.sup.11 wherein
each R.sup.10 is independently C.sub.1-C.sub.6 alkyl, and R.sup.11
is selected from an electron pair and H; R.sup.2 is selected from
H, G, acyl, trityl, 4-methoxytrityl, benzoyl, stearoyl, and a
moiety of the formula: ##STR00060## where L is selected from
--C(O)(CH.sub.2).sub.6C(O)-- and
--C(O)(CH.sub.2).sub.2S.sub.2(CH.sub.2).sub.2C(O)--, and each
R.sup.12 is of the formula --(CH.sub.2).sub.2OC(O)N(R.sup.14).sub.2
wherein each R.sup.14 is of the formula
--(CH.sub.2).sub.6NHC(.dbd.NH)NH.sub.2; and R.sup.3 is selected
from an electron pair, H, and C.sub.1-C.sub.6 alkyl, wherein G is a
cell penetrating peptide ("CPP") and linker moiety selected from
--C(O)(CH.sub.2).sub.5NH-CPP, --C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP, and
--C(O)CH.sub.2NH-CPP, or G is of the formula: ##STR00061## wherein
the CPP is attached to the linker moiety by an amide bond at the
CPP carboxy terminus, with the proviso that only one instance of G
is present, wherein the targeting sequence specifically hybridizes
to a bacterial mRNA target sequence that encodes a virulence
factor.
35-38. (canceled)
39. A method of reducing expression and activity of a virulence
factor in a bacterium, comprising contacting the bacterium with an
antisense morpholino oligomer according to claim 1.
40. The method of claim 39, wherein the antisense morpholino
oligomer is of formula (I): ##STR00062## or a pharmaceutically
acceptable salt thereof, where each Nu is a nucleobase which taken
together forms a targeting sequence; X is an integer from 9 to 38;
T is selected from OH and a moiety of the formula: ##STR00063##
where each R.sup.4 is independently C.sub.1-C.sub.6 alkyl, and
R.sup.5 is selected from an electron pair and H, and R.sup.6 is
selected from OH, --N(R.sup.7)CH.sub.2C(O)NH.sub.2, and a moiety of
the formula: ##STR00064## where: R.sup.7 is selected from H and
C.sub.1-C.sub.6 alkyl, and R.sup.8 is selected from G,
--C(O)--R.sup.9OH, acyl, trityl, and 4-methoxytrityl, where:
R.sup.9 is of the formula --(O-alkyl).sub.y- wherein y is an
integer from 3 to 10 and each of the y alkyl groups is
independently selected from C.sub.2-C.sub.6 alkyl; each instance of
R.sup.1 is --N(R.sup.10).sub.2R.sup.11 wherein each R.sup.10 is
independently C.sub.1-C.sub.6 alkyl, and R.sup.11 is selected from
an electron pair and H; R.sup.2 is selected from H, G, acyl,
trityl, 4-methoxytrityl, benzoyl, stearoyl, and a moiety of the
formula: ##STR00065## where L is selected from
--C(O)(CH.sub.2).sub.6C(O)-- and
--C(O)(CH.sub.2).sub.2S.sub.2(CH.sub.2).sub.2C(O)--, and each
R.sup.12 is of the formula --(CH.sub.2).sub.2OC(O)N(R.sup.14).sub.2
wherein each R.sup.14 is of the formula
--(CH.sub.2).sub.6NHC(.dbd.NH)NH.sub.2; and R.sup.3 is selected
from an electron pair, H, and C.sub.1-C.sub.6 alkyl, wherein G is a
cell penetrating peptide ("CPP") and linker moiety selected from
--C(O)(CH.sub.2).sub.5NH-CPP, --C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP, and
--C(O)CH.sub.2NH-CPP, or G is of the formula: ##STR00066## wherein
the CPP is attached to the linker moiety by an amide bond at the
CPP carboxy terminus, with the proviso that only one instance of G
is present, wherein the targeting sequence specifically hybridizes
to a bacterial mRNA target sequence that encodes the virulence
factor.
41. The method of claim 39, where the bacterium is in a subject,
and the method comprises administering the antisense morpholino
oligomer to the subject.
42. The method of claim 39 or 14, wherein the bacterium is selected
from the genus Escherichia, Acinetobacter, Klebsiella, and
Burkholderia.
43. The method of claim 42, wherein the bacterium is Escherichia
coli, Acinetobacter baumannii, Klebsiella pneumoniae, or
Burkholderia cepacia (complex).
44-48. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 16/064,273, filed Jun. 20, 2018, which is a national phase
application under 35 U.S.C. .sctn. 371 of International Application
No. PCT/US2016/068373, filed Dec. 22, 2016, which claims the
benefit of priority to: U.S. Provisional Application No.
62/387,176, filed Dec. 23, 2015, U.S. Provisional Application No.
62/301,406, filed Feb. 29, 2016, U.S. Provisional Application No.
62/408,518, filed Oct. 14, 2016, and U.S. Provisional Application
No. 62/433,669, filed Dec. 13, 2016, each of which is herein
incorporated by reference in its entirety.
STATEMENT REGARDING THE SEQUENCE LISTING
[0003] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing is UTSDP2762USD1.txt. The
text file is about 34 KB, was created on Feb. 1, 2021, and is being
submitted electronically via EFS-Web.
BACKGROUND
Technical Field
[0004] The present disclosure relates to antisense morpholino
oligomers targeted against bacterial virulence factors such as
genes that contribute to antibiotic resistance, biofilm formation
or essential processes, and related compositions and methods of
using the oligomers and compositions, for instance, in the
treatment of an infected mammalian subject.
Description of the Related Art
[0005] Currently, there are several types of antibiotic compounds
in use against bacterial pathogens and these compounds act through
a variety of anti-bacterial mechanisms. For example, beta-lactam
antibiotics, such as penicillin and cephalosporin, act to inhibit
the final step in peptidoglycan synthesis. Glycopeptide
antibiotics, including vancomycin and teichoplanin, inhibit both
transglycosylation and transpeptidation of muramyl-pentapeptide,
again interfering with peptidoglycan synthesis. Other well-known
antibiotics include the quinolones, which inhibit bacterial DNA
replication, inhibitors of bacterial RNA polymerase, such as
rifampin, and inhibitors of enzymes in the pathway for production
of tetrahydrofolate, including the sulfonamides.
[0006] Some classes of antibiotics act at the level of protein
synthesis. Notable among these are the aminoglycosides, such as
kanamycin and gentamicin. This class of compounds targets the
bacterial 30S ribosome subunit, preventing the association with the
50S subunit to form functional ribosomes. Tetracyclines, another
important class of antibiotics, also target the 30S ribosome
subunit, acting by preventing alignment of aminoacylated tRNA's
with the corresponding mRNA codon. Macrolides and lincosamides,
another class of antibiotics, inhibit bacterial synthesis by
binding to the 50S ribosome subunit, and inhibiting peptide
elongation or preventing ribosome translocation.
[0007] Despite impressive successes in controlling or eliminating
bacterial infections by antibiotics, the widespread use of
antibiotics both in human medicine and as a feed supplement in
poultry and livestock production has led to drug resistance in many
pathogenic bacteria. Antibiotic resistance mechanisms can take a
variety of forms. One of the major mechanisms of resistance to beta
lactams, particularly in Gram-negative bacteria, is the enzyme
beta-lactamase, which renders the antibiotic inactive by cleaving
the lactam ring. Likewise, resistance to aminoglycosides often
involves an enzyme capable of inactivating the antibiotic, in this
case by adding a phosphoryl, adenyl, or acetyl group. Active efflux
of antibiotics is another way that many bacteria develop
resistance. Genes encoding efflux proteins, such as the tetA, tetG,
tetL, and tetK genes for tetracycline efflux, have been identified.
A bacterial target may develop resistance by altering the target of
the drug. For example, the so-called penicillin binding proteins
(PBPs) in many beta-lactam resistant bacteria are altered to
inhibit the critical antibiotic binding to the target protein.
Resistance to tetracycline may involve, in addition to enhanced
efflux, the appearance of cytoplasmic proteins capable of competing
with ribosomes for binding to the antibiotic. For those antibiotics
that act by inhibiting a bacterial enzyme, such as for
sulfonamides, point mutations in the target enzyme may confer
resistance.
[0008] Biofilm formation can also lead to antibiotic resistance,
among other clinical difficulties. Typically, in situations where
bacteria form a biofilm within an infected host, the infection
turns out to be untreatable and can develop into a chronic state.
Hallmarks of chronic biofilm-based infections not only include
resistance to antibiotic treatments and many other conventional
antimicrobial agents but also a capacity for evading host defenses.
Therefore, strategies that prevent or breakdown biofilm would be of
therapeutic interest and benefit.
[0009] The appearance of antibiotic resistance in many pathogenic
bacteria, including cases involving multi-drug resistance (MDR),
raises the fear of a post-antibiotic era in which many bacterial
pathogens were simply untreatable by medical intervention. Thus,
there is a need for antimicrobial agents that (i) are not subject
to the principal types of antibiotic resistance currently hampering
antibiotic treatment of bacterial infection, (ii) can be developed
rapidly and with some reasonable degree of predictability as to
target-bacteria specificity, (iii) are effective at low doses, and
(iv) show few side effects.
SUMMARY
[0010] Embodiments of the present disclosure relate, in part, to
the discovery that the antisense targeting of bacterial virulence
factors can, inter alia, increase the antibiotic susceptibility of
otherwise antibiotic-resistant pathogenic bacteria, and reduce the
ability of certain pathogenic bacteria to form and maintain
difficult-to-treat biofilms. For example, the antisense targeting
of antibiotic resistance genes such as carbapenemases and efflux
pumps was shown to increase the susceptibility of antibiotic
resistant (e.g., multi-drug resistant) bacteria to many commonly
used antibiotics, and could thus find utility in the treatment of
such bacteria, for instance, in combination with antibiotics. Also,
the antisense targeting of genes associated with biofilm formation
was shown to break down existing biofilms and reduce the production
of new biofilms. Such antisense targeting could find utility in
standalone therapies against biofilm-forming bacteria, and as
combination therapies, for example, to increase the susceptibility
of biofilm-forming bacteria to antibiotics.
[0011] Embodiments of the present disclosure therefore include a
substantially uncharged antisense morpholino oligomer, composed of
morpholino subunits and phosphorus-containing intersubunit linkages
joining a morpholino nitrogen of one subunit to a 5'-exocyclic
carbon of an adjacent subunit, and having (a) about 10-40
nucleotide bases, and (b) a targeting sequence of sufficient length
and complementarity to specifically hybridize to a bacterial mRNA
target sequence that encodes a virulence factor; where the oligomer
is conjugated to a cell-penetrating peptide (CPP).
[0012] In certain embodiments, the target sequence comprises a
translational start codon of the bacterial mRNA and/or a sequence
within about 30 bases upstream or downstream of the translational
start codon of the bacterial mRNA.
[0013] In some embodiments, the virulence factor is an antibiotic
resistance protein or a biofilm formation protein. In some
embodiments, the virulence factor is an essential protein.
[0014] In certain embodiments, the antibiotic resistance protein is
selected from one or more of New Delhi metallo-beta-lactamase
(NDM-1), serine beta-lactamase (KPC), acridine resistance complex
protein AcrA, acridine resistance complex protein AcrB, acridine
resistance complex repressor protein AcrR, acridine resistance
complex protein ToIC, and outer membrane protein A (OmpA). In
specific embodiments, the target sequence is selected from Table
1A. Some antisense oligomers comprise, consist, or consist
essentially of a targeting sequence set forth in Table 2A, a
fragment of at least 10 contiguous nucleotides of a targeting
sequence in Table 2A, or variant having at least 80% sequence
identity to a targeting sequence in Table 2A.
[0015] In some embodiments, the biofilm formation protein is
encoded by one or more of cepl, suhB, CsuE, SecA, Pg1L, PilU1,
AlgZ, AlgU, LasR, FleR and PelF. In particular embodiments, the
target sequence is selected from Table 1B. Some antisense oligomers
comprise, consist, or consist essentially of a targeting sequence
set forth in Table 2B, a fragment of at least 10 contiguous
nucleotides of a targeting sequence in Table 2B, or variant having
at least 80% sequence identity to a targeting sequence in Table
2B.
[0016] In some embodiments, the essential protein is an RNA
polymerase encoded by one or more of RpoD. In some embodiments, the
essential protein is a DNA polymerase II encoded by one or more of
PoIB. Some antisense oligomers comprise, consist, or consist
essentially of a targeting sequence set forth in Table 2C, a
fragment of at least 10 contiguous nucleotides of a targeting
sequence in Table 2C, or variant having at least 80% sequence
identity to a targeting sequence in Table 2C.
[0017] In certain embodiments, an antisense morpholino oligomer of
the disclosure may be of formula (I):
##STR00001##
[0018] or a pharmaceutically acceptable salt thereof,
[0019] where each Nu is a nucleobase which taken together forms a
targeting sequence;
[0020] X is an integer from 9 to 38;
[0021] T is selected from OH and a moiety of the formula:
##STR00002##
[0022] where each R.sup.4 is independently C.sub.1-C.sub.6 alkyl,
and R.sup.5 is selected from an electron pair and H, and R.sup.6 is
selected from OH, --N(R.sup.7)CH.sub.2C(O)NH.sub.2, and a moiety of
the formula:
##STR00003##
[0023] where: [0024] R.sup.7 is selected from H and C.sub.1-C.sub.6
alkyl, and [0025] R.sup.8 is selected from G, --C(O)--R.sup.9OH,
acyl, trityl, and 4-methoxytrityl, where: [0026] R.sup.9 is of the
formula --(O-alkyl).sub.y- wherein y is an integer from 3 to 10 and
each of the y alkyl groups is independently selected from
C.sub.2-C.sub.6 alkyl; [0027] each instance of R.sup.1 is
--N(R.sup.10).sub.2R.sup.11 wherein each R.sup.10 is independently
C.sub.1-C.sub.6 alkyl, and R.sup.11 is selected from an electron
pair and H; [0028] R.sup.2 is selected from H, G, acyl, trityl,
4-methoxytrityl, benzoyl, stearoyl, and a moiety of the
formula:
##STR00004##
[0029] where L is selected from --C(O)(CH.sub.2).sub.6C(O)-- and
--C(O)(CH.sub.2).sub.2S.sub.2(CH.sub.2).sub.2C(O)--, and each
R.sup.12 is of the formula --(CH.sub.2).sub.2OC(O)N(R.sup.14).sub.2
wherein each R.sup.14 is of the formula
--(CH.sub.2).sub.6NHC(.dbd.NH)NH.sub.2; and
[0030] R.sup.3 is selected from an electron pair, H, and
C.sub.1-C.sub.6 alkyl, [0031] wherein G is a cell penetrating
peptide ("CPP") and linker moiety selected from
--C(O)(CH.sub.2).sub.5NH-CPP, --C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP, and
--C(O)CH.sub.2NH-CPP, or G is of the formula:
##STR00005##
[0032] wherein the CPP is attached to the linker moiety by an amide
bond at the CPP carboxy terminus, with the proviso that only one
instance of G is present,
[0033] wherein the targeting sequence specifically hybridizes to a
bacterial mRNA target sequence that encodes a virulence factor.
[0034] In certain embodiments, the CPP is an arginine-rich peptide.
In certain embodiments, the CPP is selected from Table C1.
[0035] Also included are methods of reducing expression and
activity of a virulence factor in a bacteria or bacterium,
comprising contacting the bacteria or bacterium with an antisense
oligomer described herein.
[0036] In some embodiments, the bacterium is in a subject, and the
method comprises administering the antisense oligomer to the
subject.
[0037] In certain embodiments, the bacterium is selected from the
genus Escherichia, Acinetobacter, Klebsiella, and Burkholderia. In
certain embodiments, the bacterium is Escherichia coli,
Acinetobacter baumannii, Klebsiella pneumoniae, or Burkholderia
cepacia (complex). In certain embodiments, the bacterium is
Escherichia coli, Acinetobacter baumannii, or Klebsiella
pneumoniae, and where the virulence factor is an antibiotic
resistance protein selected from one or more of NDM-1 and AdeA.
[0038] In some embodiments, the bacterium is Burkholderia cepacia
(complex) and where the virulence factor is a biofilm formation
protein encoded by one or more of cepl and suhB. In certain
embodiments, the Burkholderia cepacia (complex) comprises one or
more of Burkholderia cenocepacia, Burkholderia multivorans,
Burkholderia vietnamiensis, Burkholderia stabilis, Burkholderia
anthina, Burkholderia pyrrocinia, Burkholderia dolosa, and/or
Burkholderia ambifaria. In certain embodiments, administration of
the antisense oligomer reduces biofilm formation or existing
biofilm by at least about 10%. In certain embodiments, the subject
is immunocompromised and has an underlying lung disease. In
specific embodiments, the subject has cystic fibrosis (CF) or
chronic granulomatous disease (CGD).
[0039] In some embodiments, the bacterium is Acinetobacter
baumannii and where the virulence factor is a chaperone-usher pili
assembly system protein encoded by one or more of CsuE. In some
embodiments, the bacterium is Acinetobacter baumannii and where the
virulence factor is a chaperone-usher pili assembly system protein
encoded by one or more of CsuE. In some embodiments, the bacterium
is Acinetobacter baumannii and where the virulence factor is an
ATPase associated with cell membrane transport encoded by one or
more of SecA. In some embodiments, the bacterium is Acinetobacter
baumannii and where the virulence factor is encoded by one or more
of Pg1L. In some embodiments, the bacterium is Acinetobacter
baumannii and where the virulence factor is encoded by one or more
of Pi/U1. In some embodiments, the bacterium is Pseudomonas
aeruginosa and where the virulence factor is a protein associated
with alginate biosynthesis encoded by one or more of AlgZ. In some
embodiments, the bacterium is Pseudomonas aeruginosa and where the
virulence factor is a protein associated with alginate biosynthesis
encoded by one or more of AlgU. In some embodiments, the bacterium
is Pseudomonas aeruginosa and where the virulence factor is a
transcriptional activator protein encoded by one or more of LasR.
In some embodiments, the bacterium is Pseudomonas aeruginosa and
where the virulence factor is a transcriptional regulator of
flagella expression encoded by one or more of FleR. In some
embodiments, the bacterium is Pseudomonas aeruginosa and where the
virulence factor is a polysaccharide biosynthesis protein encoded
by one or more of PelF. In certain embodiments, administration of
the antisense oligomer reduces biofilm formation or existing
biofilm by at least about 10%.
[0040] Some methods include administering the oligomer separately
or concurrently with an antimicrobial agent, for example, where
administration of the oligomer increases susceptibility of the
bacterium to the antimicrobial agent. Some methods include
administering the oligomer by aerosolization.
[0041] In certain embodiments, the bacterium is Escherichia coli,
Acinetobacter baumannii, or Klebsiella pneumoniae, the virulence
factor is NDM-1, and the antimicrobial agent is a carbapenem. In
certain embodiments, the carbapenem is selected from one or more of
meropenem, imipenem, ertapenem, doripenem, panipenem, biapenem,
razupenem, tebipenem, lenapenem, and tomopenem.
[0042] In certain embodiments, the bacterium is Escherichia coli,
Acinetobacter baumannii, or Klebsiella pneumoniae, the virulence
factor is KPC or KPC 1-4, and the antimicrobial agent is a
carbapenem. In certain embodiments, the carbapenem is selected from
one or more of meropenem, imipenem, ertapenem, doripenem,
panipenem, biapenem, razupenem, tebipenem, lenapenem, and
tomopenem.
[0043] In some embodiments, the bacterium is Escherichia coli,
Acinetobacter baumannii, or Klebsiella pneumoniae, the virulence
factor is AdeA, and the antimicrobial agent is selected from one or
more of aminoglycoside antibiotics, tetracycline antibiotics, and
.beta.-lactam antibiotics. In certain embodiments, the
aminoglycoside is selected from one or more of tobramycin,
gentamicin, kanamycin a, amikacin, dibekacin, sisomicin,
netilmicin, neomycin B, neomycin C, neomycin E (paromomycin), and
streptomycin. In certain embodiments, the tetracycline antibiotic
is selected from one or more of tetracycline, chlortetracycline,
oxytetracycline, demeclocycline, lymecycline, meclocycline,
methacycline, minocycline, rolitetracycline, and doxycyline. In
certain embodiments, the .beta.-lactam antibiotic is selected from
one or more of carbapenems, penicillin derivatives (penams),
cephalosporins (cephems), and monobactams.
[0044] In certain embodiments, the bacterium is Escherichia coli,
Acinetobacter baumannii, or Klebsiella pneumoniae, the virulence
factor is an acridine resistance complex protein encoded by one or
more of AcrA, AcrB, AcrR, and ToIC, and the antimicrobial agent can
be any antibiotic. In another embodiment, the antimicrobial agent
is selected from one or more of Clindamycin,
Piperacillin-tazobactam, Doxycycline, Chloramphenicol, Fusidic
acid, Oxacillin, Erythromycin and/or Trimethoprim.
[0045] In certain embodiments, the bacterium is Escherichia coli,
Acinetobacter baumannii, or Klebsiella pneumoniae, the virulence
factor is an outer membrane protein A encoded by one or more of
OmpA, and the antimicrobial agent can be any antibiotic. In another
embodiment, the antimicrobial agent is selected from one or more of
Clindamycin, Piperacillin-tazobactam, Doxycycline, Chloramphenicol,
Fusidic acid, Oxacillin, Erythromycin and/or Trimethoprim.
[0046] In certain embodiments, the bacterium is Burkholderia
cepacia (complex), the virulence factor is a biofilm formation
protein encoded by one or more of cepl or suhB, and the
antimicrobial agent is selected from one or more of ceftazidime,
doxycycline, piperacillin, meropenem, chloramphenicol, and
co-trimoxazole (trimethoprim/sulfamethoxazole).
[0047] In certain embodiments, the bacterium is Acinetobacter
baumannii, the virulence factor is a biofilm formation protein
encoded by one or more of CsuE, SecA, Pg1L and Pi/U1, and the
antimicrobial agent is selected from one or more of ceftazidime,
minocycline, doxycycline, piperacillin, meropenem, chloramphenicol,
and co-trimoxazole (trimethoprim/sulfamethoxazole).
[0048] In certain embodiments, the bacterium is Pseudomonas
aeruginosa, the virulence factor is a biofilm formation protein
encoded by one or more of AlgZ, AlgU, LasR, FleR and PelF, and the
antimicrobial agent is selected from one or more of ceftazidime,
minocycline, doxycycline, piperacillin, meropenem, chloramphenicol,
and co-trimoxazole (trimethoprim/sulfamethoxazole).
[0049] In certain embodiments, the bacterium is Acinetobacter
baumannii, the virulence factor is an essential protein encoded by
one or more of RpoD, and the antimicrobial agent is selected from
one or more of ceftazidime, minocycline, doxycycline, piperacillin,
meropenem, chloramphenicol, and co-trimoxazole
(trimethoprim/sulfamethoxazole).
[0050] In certain embodiments, the bacterium is Pseudomonas
aeruginosa, the virulence factor is an essential protein encoded by
one or more of Po/B, and the antimicrobial agent is selected from
one or more of ceftazidime, minocycline, doxycycline, piperacillin,
meropenem, chloramphenicol, and co-trimoxazole
(trimethoprim/sulfamethoxazole).
[0051] In some embodiments, the oligomer reduces the minimum
inhibitory concentration (MIC) of the antimicrobial agent against
the bacterium by at least about 10% relative to the antimicrobial
agent alone. In certain embodiments, the oligomer increases the
susceptibility of the bacterium to the antimicrobial agent by at
least about 10% relative to the antimicrobial agent alone.
[0052] Also included are pharmaceutical compositions, comprising an
antisense oligomer described herein and a
pharmaceutically-acceptable carrier. Certain pharmaceutical
compositions can further comprise one or more antimicrobial
agents.
BRIEF DESCRIPTION OF THE FIGURES
[0053] FIG. 1A shows an exemplary morpholino oligomer structure
with a phosphorodiamidate linkage. FIGS. 1B-1E show the repeating
subunit segment of exemplary morpholino oligomers, designated B
through E. FIGS. 1F-1H show exemplary peptide PMO conjugates
structures used in the exemplary PPMOs.
[0054] FIG. 2 shows that PPMOs prevent formation of biofilm in
Acinetobacter spp. A. baumannii or A. iwoffii strains were grown on
MBEC biofilm plates for 20 hours in the presence or absence of
PPMOs. Crystal violet staining of the pegs was performed and the
amount of biofilm present was measured at OD570. The heat map
displays percentage of biofilm reduction compared to no treatment
controls at a PPMO concentration of 8 .mu.M. CsuE-PPMO #21 showed a
>50% reduction in biofilm in 10/12 (83%) of strains tested.
[0055] FIG. 3 shows reduction of biofilm in Acinetobacter spp. is
dose-dependent. Acinetobacter biofilms were grown in the presence
or absence of a CsuE PPMO for 20 hours. Concentrations of PPMO
tested included 8 .mu.M (green bars), 4 .mu.M (red bars), 2 .mu.M
(blue bars) or no PPMO (black bars). Strains included AB NDM-1, AB
AYE, AB 17978 and AB AB307. Reduction in biofilm formation was
dose-dependent as seen in all strains tested.
[0056] FIG. 4 shows that PPMOs prevent formation of biofilm in
Pseudomonas aeruginosa. Strains were grown on MBEC biofilm plates
for 18 hours in the presence of PMBN at 2 .mu.g/ml and the PPMO, a
scrambled PPMO or nothing. The numbers in each cell represent the
concentration of PPMO that reduced biofilm by 50% or greater.
[0057] FIG. 5 shows that reduction of biofilm in Pseudomonas
aeruginosa is dose-dependent.
[0058] Pseudomonas biofilms were grown in the presence or absence
of PPMOs (as indicated). Biofilms were grown for 18 hours and then
stained with crystal violet. Three strains were tested with
multiple PPMO doses as shown. Percent reduction compared to no PPMO
control is shown.
[0059] FIGS. 6A-6D show confocal microscopy demonstrating reduction
of biofilm in Pseudomonas aeruginosa treated with the LasR PPMO #29
or AlgZ PPMO #27. GFP-PAO1 was grown for 18 hours in the presence
of sub-inhibitory concentrations of PMBN alone (FIG. 6A), Scr
PPMO+PMBN (FIG. 6B), LasR PPMO #29+PMBN (FIG. 6C) or AlgZ PPMO
#27+PMBN (FIG. 6D). PPMOs were tested at 8 .mu.M. Biofilm is shown
in red and PAO1 in green. While PAO1 alone or with Scr PPMO
displays robust biofilm formation, PAO1 with LasR PPMO #29 or PAO1
with AlgZ PPMO #27 show a substantial decrease in biofilm mass
(white arrows).
[0060] FIGS. 7A-7B show that PPMOs reduce the MIC of antibiotics in
NDM-1 strains. (FIG. 7A) The MIC of meropenem was measured in
various concentrations of NDM-1 PPMO #18. (FIG. 7B) Viable cells
were measured before (0 hr) or after growth of strain BAA-2149 for
24 hr with meropenem and/or NDM-1 PPMO #19.
[0061] FIGS. 8A-8D show that PPMOs targeted to different regions of
the KPC carbapenemase gene restored susceptibility of K. pneumoniae
to meropenem. The MIC of meropenem was measured in various
concentrations of KPC PPMO #14 (FIG. 8A) and KPC PPMO #13 (FIG.
8C). Viable cells were measured before (0 hr) or after growth for
24 hr with meropenem and/or KPC PPMO #14 (FIG. 8B) or KPC PPMO #13
(FIG. 8D).
[0062] FIGS. 9A-9H show that the NDM-1 PPMO confers protection when
administered concomitantly with meropenem in a systemic infection
with NDM-1-positive E. coli. Mice were infected with E. coli CVB-1
and treated with either 1 mg of meropenem (n=8) (given
subcutaneously), 100 .mu.g (5 mg kg.sup.-1) of PPMO (n=7) (given
intraperitoneally), both treatments (n=12), a scrambled PPMO (Scr)
with meropenem (n=11), or PBS (n=7). (FIG. 9A) Infection and
treatment schedule. (FIG. 9B) Survival of mice was recorded. (FIG.
9C) Body temperatures were monitored. (FIG. 9D) Level of bacteremia
was measured 6 h post-infection. (FIG. 9E) Survival of mice treated
with meropenem (1 mg) and various amounts of NDM-1 PPMO (33.3 .mu.g
(n=13), 11.1 .mu.g (n=11), 3.7 .mu.g (n=11)), Scr PPMO (33.3 .mu.g
(n=10)), or meropenem only (n=10). (FIG. 9F, FIG. 9G) Body
temperature and bacteria in the blood (6 h post-infection) were
monitored. (FIG. 9H) Survival of mice treated at the time of
infection (n=7), 0.5 h post-infection (n=8), or 1 h post-infection
(n=7), with meropenem (1 mg) and PPMO (250 .mu.g). Mice treated
with meropenem and Scr PPMO at the time of infection (n=7) and mice
treated with PBS (n=7) were used as negative controls. For
Kaplan-Meyer survival curves, ***p<0.001 **p<0.01 *p<0.05
by log-rank (Mantel-Cox) test. For other graphs, data represented
as the mean.+-.SEM, ***p<0.001 **p<0.01 *p<0.05 by
two-tailed Mann-Whitney U test.
[0063] FIGS. 10A-10E show that PPMOs targeted to multi-drup efflux
pump genes AcrA, AcrB, AcrR and ToIC were effective at reducing
viability of an E. coli strain when co-incubated with
piperacillin-tazobactam (PT). E. coli were treated with scrambled
PPMOs (FIG. 10A), AcrA PPMOs #3, #4 and #5 (FIG. 10B), AcrB PPMOs
#6 and #8 (FIG. 10C), AcrR PPMO #9 (FIG. 10D), and ToIC PPMO #11
(FIG. 10E). The addition of the active PPMOs reduced the MIC of PT
by 2-8 fold depending on the PPMO tested.
[0064] FIG. 11A: Representation of the AcrAB-ToIC efflux
system.
[0065] FIG. 11B: PPMOs are antisense molecules that may bind to
mRNA molecules and block translation of resistance genes.
[0066] FIG. 11C: Three separate PPMOs were designed to target the
acrA (PPMO #3, left), acrB (PPMO #8, middle), and tolC (PPMO #10,
right) mRNAs. These PPMOs target regions that span the start codons
of the transcribed mRNA. Alignment of the acrA, acrB, and to/C
genes of different bacterial species describe sequence
similarities.
[0067] FIG. 11D: (Left) Dose response curves as a function of
clindamycin concentration for the wild type E. coli without PPMO
(solid circle), with 10 .mu.M scrambled control PPMO (open circle),
with 10 .mu.M acrA-PPMO (top panel, square), E. coli with acrA
deletion (top panel, triangle), with 10 .mu.M acrB-PPMO (middle
panel, squares), E. coli with acrB deletion (middle panel,
triangles), with 10 .mu.M tolC-PPMO (bottom panel, squares), and E.
coli with to/C deletion (bottom panel, triangles). (Right) Sample
growth curves at the conditions shown within the grey shaded areas
on the dose response curves on the left.
[0068] FIG. 12 shows dose response curves as a function of
antibiotic concentration for a number of antibiotics. Top panel:
the wild type E. coli without acrA-PPMO (open circles), with 10
.mu.M scrambled control PPMO (solid circles), with 10 .mu.M
acrA-PPMO (squares), E. coli with acrA deletion (triangles). Middle
panel: the wild type E. coli without acrB-PPMO (open circles), with
10 .mu.M scrambled control PPMO (solid circles), with 10 .mu.M
acrB-PPMO (squares), E. coli with acrB deletion (triangles). Bottom
panel: the wild type E. coli without tolC-PPMO (open circles), with
10 .mu.M scrambled control PPMO (solid circles), with 10 .mu.M
tolC-PPMO (squares), and E. coli with to/C deletion triangles).
[0069] FIGS. 13A-13E depicts AcrA translation in the presence of
AcrA-PPMO and sensitivity against numerous antibiotics. FIG. 13A:
AcrA expression in E. coli cells in increasing concentrations of
acrA-PPMO was quantified using an anti-AcrA antibody (top panel).
AcrA expression was normalized against the expression of cAMP
receptor protein (CRP). AcrA translation was .sup..about.30 times
lower when E. coli cells were treated with 3 .mu.M or higher
concentrations of acrA-PPMO (middle panel). No AcrA expression was
detected when the acrA gene was deleted in E. coli. Error bars
represent the standard deviations of normalized AcrA expression in
six experimental replicates. Consistent with the reduced AcrA
translation in increasing concentrations of acrA-PPMO, growth rates
of E. coli in fixed concentrations of clindamycin gradually
decreased in increasing concentrations of acrA-PPMO (bottom
panel).
[0070] FIG. 13B: Sample antibiotic dose response curves of E. coli
cells in the absence of acrA-PPMO (open circles), in the presence
of 10 .mu.M acrA-PPMO (squares), in the presence of 10 .mu.M
scrambled PPMO (filed circles), and E. coli cells with acrA
deletion (triangles).
[0071] FIG. 13C: Histogram of the measured fold changes in MIC
values for the E. coli cells in the absence of acrA-PPMO (left), E.
coli cells in the presence of 10 .mu.M acrA-PPMO (right), and E.
coli cells with the acrA deletion (center).
[0072] FIG. 13D: Killing of E. coli BW25113, Klebsiella pneumoniae
F45153 (clinical urine isolate) and Burkholderia cenocepacia
complex K56-2 (cystic fibrosis clinical isolate) by
Piperacillin-Tazobactam alone (black circles) or in combination
with 10 .mu.M scrambled PPMO (grey circles), or acrA-PPMO (squares)
after 18 hour incubation. The horizontal dashed line represents the
inoculum (5.times.10.sup.5 CFU mL.sup.-1) prior to 18-hour
incubation. The x-axis represents the normalized concentration of
Piperacillin-Tazobactam in MIC units. The bacteria were grown
overnight in cation-adjusted Mueller-Hinton II broth (MHII, Becton,
Dickinson and Co., Sparks, Md.) at 37.degree. C., 220 rpm. Cultures
were diluted to 5.times.10.sup.5 CFU mL.sup.-1 in fresh MHII and
incubated with serial 2-fold dilutions of Piperacillin/Tazobactam
(Pip/Tazo) alone or in combination with 10 .mu.M Scr PPMO or AcrA
PPMO #3 in a 96-well plate and incubated for 18 h at 37.degree. C.,
220 rpm. Growth controls included H.sub.2O, 10 .mu.M Scr PPMO, and
10 .mu.M AcrA PPMO #3 alone. The minimum inhibitory concentration
(MIC) was defined as the Pip/Tazo concentration at which no visible
growth was detected at 18 h; for reference, the MIC values were 4,
2, and 64 .mu.g mL.sup.-1 for E. coli BW25113, K. pneumoniae
F45153, and B. cenocepacia K56-2, respectively. Growth controls and
wells at 1-, 0.5-, and 0.25-fold the MIC of Pip/Tazo alone or in
combination were serially diluted in PBS and plated on trypticase
soy agar+5% sheep blood (Remel, Lenexa, Kans.) for CFU enumeration.
Experiments were repeated in triplicate.
[0073] FIG. 13E: HBEC3KT human cells were incubated in increasing
doses of acrA-PPMO and number of viable cells was counted
(Cell-Titer-Glo, Promega) every 24 hours. No significant toxicity
was detected due to the use of acrA-PPMO.
[0074] FIGS. 14A-14B shows efficacy of antibiotic combinations in
the presence of acrA-PPMO including antagonistic antibiotic
pairs.
[0075] FIG. 14A: Minimum inhibitory concentrations measured in
two-dimensional gradients of (left) trimethoprim and
sulfamethoxazole and (right) trimethoprim and
piperacillin-tazobactam; for the wild type E. coli cells (circle),
for the wild type E. coli cells in the presence of 10 .mu.M
acrA-PPMO (square), and E. coli cells with acrA deletion
(triangle).
[0076] FIG. 14B: Area under the MIC curves shown in FIG. 13A for
the wild type E. coli cells (left bars), for the wild type E. coli
cells in the presence of 10 .mu.M acrA-PPMO (right bars), and E.
coli cells with acrA deletion (center bars).
DETAILED DESCRIPTION
Definitions
[0077] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by those
of ordinary skill in the art to which the disclosure belongs.
Although any methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present disclosure, preferred methods and materials are described.
For the purposes of the present disclosure, the following terms are
defined below.
[0078] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0079] By "about" is meant a quantity, level, value, number,
frequency, percentage, dimension, size, amount, weight, or length
that varies by as much as 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3,
2 or 1% to a reference quantity, level, value, number, frequency,
percentage, dimension, size, amount, weight, or length.
[0080] By "coding sequence" is meant any nucleic acid sequence that
contributes to the code for the polypeptide product of a gene. By
contrast, the term "non-coding sequence" refers to any nucleic acid
sequence that does not directly contribute to the code for the
polypeptide product of a gene.
[0081] Throughout this specification, unless the context requires
otherwise, the words "comprise," "comprises," and "comprising" will
be understood to imply the inclusion of a stated step or element or
group of steps or elements but not the exclusion of any other step
or element or group of steps or elements.
[0082] By "consisting of" is meant including, and limited to,
whatever follows the phrase "consisting of:" Thus, the phrase
"consisting of" indicates that the listed elements are required or
mandatory, and that no other elements may be present. By
"consisting essentially of" is meant including any elements listed
after the phrase, and limited to other elements that do not
interfere with or contribute to the activity or action specified in
the disclosure for the listed elements. Thus, the phrase
"consisting essentially of" indicates that the listed elements are
required or mandatory, but that other elements are optional and may
or may not be present depending upon whether or not they materially
affect the activity or action of the listed elements.
[0083] As used herein, the terms "contacting a cell", "introducing"
or "delivering" include delivery of the oligomers of this
disclosure into a cell by methods routine in the art, e.g.,
transfection (e.g., liposome, calcium-phosphate,
polyethyleneimine), electroporation (e.g., nucleofection),
microinjection), transformation, and administration.
[0084] The terms "cell penetrating peptide" (CPP) or "a peptide
moiety which enhances cellular uptake" are used interchangeably and
refer to cationic cell penetrating peptides, also called "transport
peptides", "carrier peptides", or "peptide transduction domains".
In some aspects, the peptides have the capability of inducing cell
penetration within about or at least about 30%, 40%, 50%, 60%, 70%,
80%, 90%, or 100% of cells of a given population and/or allow
macromolecular translocation to or within multiple tissues in vivo
upon systemic administration. Particular examples of CPPs include
"arginine-rich peptides." CPPs are well-known in the art and are
disclosed, for example, in U.S. Application No. 2010/0016215, which
is incorporated by reference in its entirety.
[0085] "An electron pair" refers to a valence pair of electrons
that are not bonded or shared with other atoms.
[0086] "Homology" refers to the percentage number of amino acids
that are identical or constitute conservative substitutions.
Homology may be determined using sequence comparison programs such
as GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395)
or BLAST. In this way sequences of a similar or substantially
different length to those cited herein could be compared by
insertion of gaps into the alignment, such gaps being determined,
for example, by the comparison algorithm used by GAP.
[0087] By "isolated" is meant material that is substantially or
essentially free from components that normally accompany it in its
native state. For example, an "isolated polynucleotide" or
"isolated oligomer," as used herein, may refer to a polynucleotide
that has been purified or removed from the sequences that flank it
in a naturally-occurring state, e.g., a DNA fragment that is
removed from the sequences that are adjacent to the fragment in the
genome. The term "isolating" as it relates to cells refers to the
purification of cells (e.g., fibroblasts, lymphoblasts) from a
source subject (e.g., a subject with a polynucleotide repeat
disease). In the context of mRNA or protein, "isolating" refers to
the recovery of mRNA or protein from a source, e.g., cells.
[0088] The term "modulate" includes to "increase" or "decrease" one
or more quantifiable parameters, optionally by a defined and/or
statistically significant amount. By "increase" or "increasing,"
"enhance" or "enhancing," or "stimulate" or "stimulating," refers
generally to the ability of one or antisense compounds or
compositions to produce or cause a greater physiological response
(i.e., downstream effects) in a cell or a subject relative to the
response caused by either no antisense compound or a control
compound. Relevant physiological or cellular responses (in vivo or
in vitro) will be apparent to persons skilled in the art. An
"increased" or "enhanced" amount is typically a "statistically
significant" amount, and may include an increase that is 1.1, 1.2,
2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g.,
500, 1000 times) (including all integers and ranges between and
above 1), e.g., 1.5, 1.6, 1.7. 1.8) the amount produced by no
antisense compound (the absence of an agent) or a control compound.
The term "reduce" or "inhibit" may relate generally to the ability
of one or more antisense compounds or compositions to "decrease" a
relevant physiological or cellular response, such as a symptom of a
disease or condition described herein, as measured according to
routine techniques in the diagnostic art. Relevant physiological or
cellular responses (in vivo or in vitro) will be apparent to
persons skilled in the art, and may include reductions in bacterial
cell growth, reductions in the minimum inhibitory concentration
(MIC) of an antimicrobial agent, and others. A "decrease" in a
response may be "statistically significant" as compared to the
response produced by no antisense compound or a control
composition, and may include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%,
10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or
100% decrease, including all integers and ranges in between.
[0089] As used herein, an "antisense oligomer," "oligomer" or
"oligomer" refers to a linear sequence of nucleotides, or
nucleotide analogs, which allows the nucleobase (for example a
purine or pyrimidine base-pairing moiety) to hybridize to a target
sequence in an RNA by Watson-Crick base pairing, to form an
oligomer:RNA heteroduplex within the target sequence. The terms
"antisense oligomer", "antisense oligomer", "oligomer" and
"compound" may be used interchangeably to refer to an oligomer. The
cyclic subunits may be based on ribose or another pentose sugar or,
in certain embodiments, a morpholino group (see description of
morpholino oligomers below).
[0090] The term "oligomer," "oligomer," or "antisense oligomer"
also encompasses an oligomer having one or more additional moieties
conjugated to the oligomer, e.g., at its 3'- or 5'-end, such as a
polyethylene glycol moiety or other hydrophilic polymer, e.g., one
having 10-100 monomeric subunits, which may be useful in enhancing
solubility, or a moiety such as a lipid or peptide moiety that is
effective to enhance the uptake of the compound into target
bacterial cells and/or enhance the activity of the compound within
the cell, e.g., enhance its binding to a target polynucleotide.
[0091] A "nuclease-resistant" oligomers refers to one whose
backbone is substantially resistant to nuclease cleavage, in
non-hybridized or hybridized form; by common extracellular and
intracellular nucleases in the body or in a bacterial cell (for
example, by exonucleases such as 3'-exonucleases, endonucleases,
RNase H); that is, the oligomer shows little or no nuclease
cleavage under normal nuclease conditions to which the oligomer is
exposed. A "nuclease-resistant heteroduplex" refers to a
heteroduplex formed by the binding of an antisense oligomer to its
complementary target, such that the heteroduplex is substantially
resistant to in vivo degradation by intracellular and extracellular
nucleases, which are capable of cutting double-stranded RNA/RNA or
RNA/DNA complexes. A "heteroduplex" refers to a duplex between an
antisense oligomer and the complementary portion of a target
RNA.
[0092] As used herein, "nucleobase" (Nu), "base pairing moiety" or
"base" are used interchangeably to refer to a purine or pyrimidine
base found in native DNA or RNA (uracil, thymine, adenine,
cytosine, and guanine), as well as analogs of the naturally
occurring purines and pyrimidines, that confer improved properties,
such as binding affinity to the oligomer. Exemplary analogs include
hypoxanthine (the base component of the nucleoside inosine); 2,
6-diaminopurine; 5-methyl cytosine; C5-propynyl-modified
pyrimidines; 9-(aminoethoxy)phenoxazine (G-clamp) and the like.
[0093] A nucleobase covalently linked to a ribose, sugar analog or
morpholino comprises a nucleoside. "Nucleotides" are composed of a
nucleoside together with one phosphate group. The phosphate groups
covalently link adjacent nucleotides to one another to form an
oligomer.
[0094] An oligomer "specifically hybridizes" to a target sequence
if the oligomer hybridizes to the target under physiological
conditions, with a Tm substantially greater than 40.degree. C. or
45.degree. C., preferably at least 50.degree. C., and typically
60.degree. C.-80.degree. C. or higher. Such hybridization
preferably corresponds to stringent hybridization conditions. At a
given ionic strength and pH, the Tm is the temperature at which 50%
of a target sequence hybridizes to a complementary polynucleotide.
Such hybridization may occur with "near" or "substantial"
complementarity of the antisense oligomer to the target sequence,
as well as with exact complementarity.
[0095] As used herein, "sufficient length" includes an antisense
oligomer that is complementary to at least about 8, more typically
about 8-10, 8-11, 8-12, 8-13, 8-14, 8-15, 8-16, 8-17, 8-18, 8-19,
8-20, 8-30, 8-40, or 10-11, 10-12, 10-13, 10-14, 10-15, 10-16,
10-17, 10-18, 10-19, 10-20, 10-30, 10-40 (including all integers
and ranges in between) contiguous or non-contiguous nucleobases in
a region of a bacterial mRNA target sequence. An antisense oligomer
of sufficient length has at least a minimal number of nucleotides
to be capable of specifically hybridizing to a region of the
bacterial mRNA target. In some embodiments, an oligomer of
sufficient length is from 10 to 40 or 10 to 30 nucleotides in
length, for example, about 10-11, 10-12, 10-13, 10-14, 10-15,
10-16, 10-17, 10-18, 10-19, 10-20, 10-25, 10-28, 10-30, 10-40,
11-12, 11-13, 11-14, 11-15, 11-16, 11-17, 11-18, 11-19, 11-20,
11-25, 11-28, 11-30, or 11-40 nucleotides in length, or about 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides
in length.
[0096] The terms "sequence identity" or, for example, comprising a
"sequence 50% identical to," as used herein, refer to the extent
that sequences are identical on a nucleotide-by-nucleotide basis or
an amino acid-by-amino acid basis over a window of comparison.
Thus, a "percentage of sequence identity" may be calculated by
comparing two optimally aligned sequences over the window of
comparison, determining the number of positions at which the
identical nucleic acid base (e.g., A, T, C, G, I) or the identical
amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile,
Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met)
occurs in both sequences to yield the number of matched positions,
dividing the number of matched positions by the total number of
positions in the window of comparison (i.e., the window size), and
multiplying the result by 100 to yield the percentage of sequence
identity. Optimal alignment of sequences for aligning a comparison
window may be conducted by computerized implementations of
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package Release 7.0, Genetics Computer Group, 575
Science Drive Madison, Wis., USA) or by inspection and the best
alignment (i.e., resulting in the highest percentage homology over
the comparison window) generated by any of the various methods
selected. Reference also may be made to the BLAST family of
programs as for example disclosed by Altschul et al., Nucl. Acids
Res. 25:3389, 1997.
[0097] A "subject" or a "subject in need thereof" includes a
mammalian subject such as a human subject.
[0098] The terms "TEG," "EG3," or "triethylene glycol tail" refer
to triethylene glycol moieties conjugated to the oligomer, e.g., at
its 3'- or 5'-end. For example, in some embodiments, "TEG"
includes, for example, wherein T of the compound of formula (I),
(II), or (III) is of the formula:
##STR00006##
[0099] The term "pip-PDA" refers to a 5' terminal
piperazine-phosphorodiamidate moiety that connects a G group, where
the G group comprises a cell-penetrating peptide (CPP) and linker
moiety further discussed below, to the 5'end of the oligomer by way
of an amide bond between the G group linker and the piperazinyl
nitrogen. For example, in some embodiments, "pip-PDA" includes
wherein T of the compound of formula (I) or (II) is of the
formula:
##STR00007##
[0100] The term "target sequence" refers to a portion of the target
RNA, for example, a bacterial mRNA, against which the antisense
oligomer is directed, that is, the sequence to which the oligomer
will hybridize by Watson-Crick base pairing of a complementary
sequence. In certain embodiments, the target sequence may be a
contiguous region of the translation initiation region of a
bacterial gene.
[0101] The "translational start codon region" refers to a region
that is 30 bases upstream or downstream of a translation initiation
codon of a gene.
[0102] The term "targeting sequence" or "antisense targeting
sequence" refers to the sequence in an oligomer that is
complementary or substantially complementary to the target sequence
in the RNA, e.g., the bacterial mRNA. The entire sequence, or only
a portion, of the antisense compound may be complementary to the
target sequence. For example, in an oligomer of about 10-30 bases,
about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, or 29 of the bases may be targeting
sequences that are complementary to the target region. Typically,
the targeting sequence is formed of contiguous bases, but may
alternatively be formed of non-contiguous sequences that when
placed together, e.g., from opposite ends of the oligomer,
constitute sequence that spans the target sequence.
[0103] A "targeting sequence" may have "near" or "substantial"
complementarity to the target sequence and still function for the
purpose of the present disclosure, that is, still be
"complementary." Preferably, the oligomer analog compounds employed
in the present disclosure have at most one mismatch with the target
sequence out of 10 nucleotides, and preferably at most one mismatch
out of 20. Alternatively, the antisense oligomers employed have at
least 90% sequence homology, and preferably at least 95% sequence
homology, with the exemplary targeting sequences as designated
herein.
[0104] As used herein, the term "quantifying", "quantification" or
other related words refer to determining the quantity, mass, or
concentration in a unit volume, of a nucleic acid, polynucleotide,
oligomer, peptide, polypeptide, or protein.
[0105] As used herein, "treatment" of a subject (e.g. a mammal,
such as a human) or a cell is any type of intervention used in an
attempt to alter the natural course of the individual or cell.
Treatment includes, but is not limited to, administration of a
pharmaceutical composition, and may be performed either
prophylactically or subsequent to the initiation of a pathologic
event or contact with an etiologic agent. Also included are
"prophylactic" treatments, which can be directed to reducing the
rate of progression of the disease or condition being treated,
delaying the onset of that disease or condition, or reducing the
severity of its onset. "Treatment" or "prophylaxis" does not
necessarily indicate complete eradication, cure, or prevention of
the disease or condition, or associated symptoms thereof.
[0106] Sequences for Targeting Bacterial Virulence Factors
[0107] Certain embodiments relate to antisense oligomers, and
related compositions and methods, which are of sufficient length
and complementarity to specifically hybridize to a bacterial mRNA
target sequence that encodes a virulence factor. General examples
of virulence factors include antibiotic resistance genes, biofilm
formation genes and their encoded proteins. In addition, virulence
factors include genes that encode regulatory proteins that control
the expression (transcription and/or translation) of other genes
which provide a benefit to the bacterium during the process of
infection.
[0108] In certain embodiments, the target sequence contains all or
a portion (e.g., 1 or 2 nucleotides) of a translational start codon
of the bacterial mRNA. In some embodiments, the target sequence
contains a sequence that is about or within about 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30 bases upstream or downstream of a
translational start codon (e.g., ATG; AUG) of the bacterial mRNA
target sequence. For example, in particular embodiments, the 5'-end
of the target sequence is the adenine, uracil, or guanine
nucleotide in a translational start codon of the bacterial mRNA. In
some embodiments, the 5'-end or 3'-end of the target sequence
begins at residue 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
downstream of the last nucleotide (e.g., guanine) of a
translational start codon of the bacterial mRNA. In some
embodiments, the 5'-end or 3'-end of the target sequence begins at
residue 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 upstream of
the first nucleotide (e.g., adenine) of a translational start codon
of the bacterial mRNA
[0109] In some embodiments, the virulence factor is an antibiotic
resistance gene or its encoded protein, i.e., a gene or protein
that is associated with resistance of the bacteria to at least one
antimicrobial agent. General examples of antibiotic resistance
genes include beta-lactamases, which can enzymatically deactivate
certain antimicrobial agents, and proteins that increase the
permeability or active efflux (pumping-out) of an antimicrobial
agent. Particular examples of antibiotic resistance genes include
New Delhi metallo-beta-lactamase (NDM-1),
resistance-nodulation-cell division (RND)-type multidrug efflux
pump subunit AdeA (adeA), serine beta-lactamase (KPC or KPC 1-4),
acridine resistance complex protein AcrA, acridine resistance
complex protein AcrB, acridine resistance complex repressor protein
AcrR, acridine resistance complex protein ToIC, and outer membrane
protein A (OmpA). Exemplary translational start codon region
sequences of the NDM-1 and AdeA resistance genes are provided in
Table 1A below.
[0110] In some embodiments, the virulence factor is a biofilm
formation gene or its encoded protein, i.e., a gene or protein that
is associated with or contributes to the formation of biofilm. A
biofilm can include any group of bacterial cells that adhere to
each other on a surface, for example, a tissue surface or a surface
of an implanted medical device. Such adherent cells are often
embedded within a self-produced matrix of extracellular polymeric
substance (EPS), a polymeric mixture composed, for example, of
extracellular DNA, proteins, and polysaccharides. Bacteria form a
biofilm in response to many factors, which may include cellular
recognition of specific or non-specific attachment sites on a
surface, nutritional cues, or in some cases, by exposure of cells
to sub-inhibitory concentrations of antibiotics. The microbial
cells growing in a biofilm are physiologically distinct from
individual cells of the same organism. For example, when a
bacterial cell switches to the biofilm mode of growth, it undergoes
a phenotypic shift in behavior in which certain genes (e.g.,
biofilm formation-associated) are differentially regulated.
Particular examples of biofilm formation genes include cepl, cepR,
suhB, CsuE, SecA, Pg1L, PilU1, AlgZ, AlgU, LasR, FleR and PelF. In
particular embodiments, the cepl gene is from a Burkholderia
species or sub-species (e.g., Burkholderia cepacia complex,
Burkholderia cenocepacia) and encodes an acylhomoserine lactone
synthase. In some embodiments, the suhB gene is from a Burkholderia
species or sub-species (e.g., Burkholderia cepacia complex,
Burkholderia cenocepacia) and encodes a putative
inositol-1-monophosphatase. In certain embodiments, the cepR gene
is from a Burkholderia species or sub-species (e.g., Burkholderia
cepacia complex, Burkholderia cenocepacia) and encodes an
acylhomoserine lactone dependent regulatory protein. In some
embodiments, the CsuE gene is from Acinetobacter baumannii and
encodes a chaperone-usher pili assembly system protein. In some
embodiments, the SecA gene is from Acinetobacter baumannii and
encodes an ATPase associated with cell membrane transport. In some
embodiments, the Pg1L gene is from Acinetobacter baumannii. In some
embodiments, the PilU1 gene is from Acinetobacter baumannii. In
some embodiments, the AlgZ gene is from Pseudomonas aeruginosa and
encodes a protein associated with alginate biosynthesis. In some
embodiments, the AlgU gene is from Pseudomonas aeruginosa and
encodes a protein associated with alginate biosynthesis. In some
embodiments, the LasR gene is from Pseudomonas aeruginosa and
encodes a transcriptional activator protein. In some embodiments,
the FleR gene is from Pseudomonas aeruginosa and encodes a
transcriptional regulator of flagellar expression. In some
embodiments, the PelF gene is from Pseudomonas aeruginosa and
encodes a polysaccharide biosynthesis protein. Exemplary
translational start codon region sequences of biofilm formation
genes from Burkholderia are provided in Table 1B below. In some
embodiments, the rpoD gene is from Acinetobacter baumannii and
encodes an RNA polymerase. In some embodiments, the PoIB gene is
from Pseudomonas aeruginosa and encodes a DNA polymerase II.
TABLE-US-00001 TABLE 1 Exemplary Target Sequences Table 1A:
Exemplary Antibiotic Resistance Target Sequences SEQ ID Description
Sequence* NO: E. coli New GTTTTTAATG CTGAATAAAA GGAAAACTTG
ATGGAATTGC Delhi Metallo- CCAATATTAT GCACCCGGTC 1 beta-lactamase- 1
(NDM-1) Klebsiella GTTTTTAATG CTGAATAAAA GGAAAACTTG ATGGAATTGC
pneumoniae CCAATATTAT GCACCCGGTC clone KPM_nasey New Delhi 2
metallo-beta- lactamase 1 (blaNDM-1) gene Acinetobacter AACATCAAAA
AGTCACTAGG TTTGGACAGT ATGCAAAAGC baumannii ATCTTTTACT TCCTTTATTT 3
metallo-beta- lactamase Acinetobacter AACATCAAAA AGTCACTAGG
TTTGGACAGT ATGCAAAAGC 4 baumannii 1605 ATCTTTTACT TCCTTTATTT
RND-type multidrug efflux pump subunit AdeA Table 1B: Exemplary
Biofilm Formation Target Sequences SEQ ID Description Sequence* NO:
cepI GCATACAAAA GCACAGATCC GAGGACATCC ATGCAGACCT Burkholderia
TCGTTCACGA GGAAGGGCGG 5 cenocepacia J2315 N- acylhomoserine lactone
synthase cepI TCACTTGAAA AATAAGTGGA AGCACTTGTA ATGAATATTA
Actinetobacter TTGCTGGATT TCAAAACAAT 6 baumannii AB307-0294 suhB
TCTTCAAATT TGTATTGTAG TGGGTGTTCA ATGGAACCTA Actinetobacter
TGOTGGTGAT GGCTOCGCGT 7 baumannii AYE SuhB CCCGTGCCGC CGGCTACAGG
ATCCAGGCTC ATGCATCCCA Burkholderia TGCTCAACAT TGCTGTCAAG 8
cenocepacia J2315 Inositol- 1-monophosphate suhB Gene ID:
CCCGTGCCGCCGGCTACAGGATCCAGGCTCATGCATCCCATGCTCAACATTG 6932290 Locus
CTGTCAAGGCTGCGCGCCGCGCCGGACAGATCATCAATCGCGCGTCCCTCGA 9 Tag BCAL2157
TCTCGACCTGATCGAGATCCGCAAGAAGCAGCAGAACGACTTCGTCACCGAA
GTGGACAAGGCCGCCGAAGACGCGATCATCGAGACGCTGAAGACCGCCTACC
CCGACCACGCGATCCTCGCGGAGGAATCGGGCGAATCCGACAACGAATCCGA
ATTCAAGTGGATCATCGATCCGCTCGACGGCACGACCAACTTCATCCACGGC
TTCCCGTATTACTGCGTATCGATCGCGCTCGAGCACAAGGGCGTCGTCACGC
AGGCCGTCGTCTACGATCCGAACAAGAACGACCTGTTCACGGCCACCCGCGG
CCGCGGCGCATACCTGAACGACCGCCGCATCCGCGTCGGCCGCCGCGACCGC
CTGGCAGACGCACTGGTCGGCACGGGCTTCCCGTTCCGCGAGAAGGACGGCC
TCGACGCCTACGCGCGCCTCTTCACCGAAATGACGCAGGCCTGCACGGGCCT
GCGCCGTCCGGGCGCGGCGGCGCTCGATCTCGCGAACGTCGCGGCCGGCCGC
CTCGACGCGTTCTTCGAGCAAGGCATCAACGTGTGGGACATGGCAGCGGGCA
GCCTGCTGATCACCGAGGCCGGCGGCCTCGTCGGGAACTACACGGGCGACGC
CGATTTCCTGCATCGCCACGAGATCGTCGCCGCGAACCC *The thymines (T) can be
uracils (U)
[0111] Thus, in certain embodiments, antisense targeting sequences
are designed to hybridize to a region of one or more of the target
sequences listed in Table 1 or a target gene described herein.
Selected antisense targeting sequences can be made shorter, e.g.,
about 8, 9, 10, 11, 12, 13, 14, or 15 bases, or longer, e.g., about
20, 30, or 40 bases, and include a small number of mismatches, as
long as the sequence is sufficiently complementary to reduce
transcription or translation upon hybridization to the target
sequence, and optionally forms with the RNA a heteroduplex having a
Tm of 45.degree. C. or greater.
[0112] In certain embodiments, the degree of complementarity
between the target sequence and antisense targeting sequence is
sufficient to form a stable duplex. The region of complementarity
of the antisense oligomers with the target RNA sequence may be as
short as 8-9 bases, 8-10 bases, 8-11 bases, 8-12 bases, 10-11
bases, 10-12 bases, but can be 12-15 bases or more, e.g., 10-40
bases, 12-30 bases, 12-25 bases, 15-25 bases, 12-20 bases, or 15-20
bases, including all integers in between these ranges. An antisense
oligomer of about 10-15 bases is generally long enough to have a
unique complementary sequence. In certain embodiments, a minimum
length of complementary bases may be required to achieve the
requisite binding Tm, as discussed herein.
[0113] In certain embodiments, oligomers as long as 40 bases may be
suitable, where at least a minimum number of bases, e.g., 10-12
bases, are complementary to the target sequence. In general,
however, facilitated or active uptake in cells is optimized at
oligomer lengths of less than about 30 or less than about 20 bases.
Included are antisense oligomers that consist of about 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases, in
which at least about 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, or 40 contiguous or non-contiguous bases are
complementary to a target gene described herein, for example, a
target sequence of Table 1 (e.g., SEQ ID NOS: 1-9).
[0114] In certain embodiments, antisense oligomers may be 100%
complementary to the target sequence, or may include mismatches,
e.g., to accommodate variants, as long as a heteroduplex formed
between the oligomer and target sequence is sufficiently stable to
withstand the action of cellular nucleases and other modes of
degradation which may occur in vivo, and reduce expression of the
targeted mRNA. Hence, certain oligomers may have about or at least
about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%,
75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%
sequence complementarity, between the oligomer and the target
sequence. Oligomer backbones that are less susceptible to cleavage
by nucleases are discussed herein. Mismatches, if present, are
typically less destabilizing toward the end regions of the hybrid
duplex than in the middle. The number of mismatches allowed will
depend on the length of the oligomer, the percentage of G:C base
pairs in the duplex, and the position of the mismatch(es) in the
duplex, according to well understood principles of duplex
stability. Although such an antisense oligomer is not necessarily
100% complementary to the target sequence, it is effective to
stably and specifically bind to the target sequence, for example,
such that translation of the target RNA is reduced.
[0115] The stability of the duplex formed between an oligomer and a
target sequence is a function of the binding Tm and the
susceptibility of the duplex to cellular enzymatic cleavage. The Tm
of an oligomer with respect to complementary-sequence RNA may be
measured by conventional methods, such as those described by Hames
et al., Nucleic Acid Hybridization, IRL Press, 1985, pp. 107-108 or
as described in Miyada C. G. and Wallace R. B., 1987, Oligomer
Hybridization Techniques, Methods Enzymol. Vol. 154 pp. 94-107. In
certain embodiments, antisense oligomers may have a binding Tm,
with respect to a complementary-sequence RNA, of greater than body
temperature and preferably greater than about 45.degree. C. or
50.degree. C. Tm's in the range 60-80.degree. C. or greater are
also included. According to well-known principles, the Tm of an
oligomer, with respect to a complementary-based RNA hybrid, can be
increased by increasing the ratio of C:G paired bases in the
duplex, and/or by increasing the length (in base pairs) of the
heteroduplex. At the same time, for purposes of optimizing cellular
uptake, it may be advantageous to limit the size of the
oligomer.
[0116] Tables 2A-2C below shows exemplary targeting sequences (in a
5'-to-3' orientation) of antisense oligomers described herein.
TABLE-US-00002 TABLE 2A Exemplary Antibiotic Resistance Targeting
Sequences Target TS SEQ Gene Targeting Sequence (TS)* ID NO: OmpA
CAT GGA TAT CC 10 AcrA ATG TAA ACC TC 11 AcrA GTT CAT ATG TA 12
AcrA AAC CCT CTG TT 13 AcrA TGT TCA TAT GT 14 AcrB GTC TTA ACG GC
15 AcrB AGG CAT GTC TT 16 AcrB TAG GCA TGT CT 17 AcrR TAT GTT CGT
GA 18 TolC TTC ATT TGC AT 19 TolC ATT CCT TGT GG 20 TolC TTT GCA
TTC CT 21 KPC GAT ACA GTG AC 22 KPC 1-4 AAC GAT ATT CC 23 NDM-1 TCA
AGT TTT CC 24 NDM-1 TCC TTT TAT TC 25 NDM-1 GGCAATTCCAT 50
TABLE-US-00003 TABLE 2B Exemplary Biofilm Formation Targeting
Sequences Target TS SEQ Gene Targeting Sequence (TS)* ID NO: CsuE
TTA TAT TCA TGG 26 CsuE TCA TGG CAA AG 27 CsuE TTT CCT GTC AA 28
SecA TTG CCA ACA TG 29 Pg1L CAT TAC CCA AG 30 PilU1 TTA AAA TCC AT
31 AlgZ TAG GCA TCG AC 32 AlgU AAA GCT CCT CT 33 LasR AGG CCA TAG
CG 34 FleR TTA CTC CTG AA 35 PelF TTC GGT CAT GT 36
TABLE-US-00004 TABLE 2C Exemplary Essential Targeting Sequences
Target TS SEQ Gene Targeting Sequence (TS)* ID NO: RpoD TCA TCT TTG
CT 37 PolB AGT AAC TCC AC 38
[0117] *The thymines (T) can be uracils (U).
[0118] Certain antisense oligomers thus comprise, consist, or
consist essentially of a targeting sequence in Tables 2A-2C (e.g.,
SEQ ID NOS: 10-38) or a variant or contiguous or non-contiguous
portion(s) thereof. For instance, certain antisense oligomers
comprise about or at least about 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 contiguous or
non-contiguous nucleotides of any of the targeting sequences in
Tables 2A-2C (e.g., SEQ ID NOS: 10-38). For non-contiguous
portions, intervening nucleotides can be deleted or substituted
with a different nucleotide, or intervening nucleotides can be
added. Additional examples of variants include oligomers having
about or at least about 70% sequence identity or homology, e.g.,
70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99% or 100% sequence identity or homology, over the
entire length of any of the targeting sequences in Tables 2A-2C
(e.g., SEQ ID NOS: 10-38).
[0119] The activity of antisense oligomers and variants thereof can
be assayed according to routine techniques in the art (see, e.g.,
the Examples).
[0120] I. Antisense Oligomer Compounds
[0121] The antisense oligomers typically comprises a base sequence
of sufficient length and complementarity to specifically hybridize
to a bacterial mRNA target sequence that encodes a virulence
factor, and thereby reduce expression (e.g., translation) of the
virulence factor protein. This requirement is optionally met when
the oligomer compound has the ability to be actively taken up by
bacterial cells, and once taken up, form a stable duplex (or
heteroduplex) with the target mRNA, optionally with a Tm greater
than about 40.degree. C. or 45.degree. C.
[0122] A. Antisense Oligomer Chemical Features
[0123] In certain embodiments, the backbone of the antisense
oligomer is substantially uncharged, and is optionally recognized
as a substrate for active or facilitated transport across a cell
wall and/or cell membrane. The ability of the oligomer to form a
stable duplex with the target RNA may also relate to other features
of the backbone, including the length and degree of complementarity
of the antisense oligomer with respect to the target, the ratio of
G:C to A:T base matches, and the positions of any mismatched bases.
The ability of the antisense oligomer to resist cellular nucleases
may promote survival and ultimate delivery of the agent to the
cell. Exemplary antisense oligomer targeting sequences are listed
in Tables 2A-2C (supra).
[0124] In certain embodiments, the antisense oligomer is a
morpholino-based oligomer, for example, a phosphorodiamidate
morpholino oligomer (PMO). Morpholino-based oligomers refer to an
oligomer comprising morpholino subunits supporting a nucleobase
and, instead of a ribose, contains a morpholine ring. Exemplary
internucleoside linkages include, for example, phosphoramidate or
phosphorodiamidate internucleoside linkages joining the morpholine
ring nitrogen of one morpholino subunit to the 4' exocyclic carbon
of an adjacent morpholino subunit. Each morpholino subunit
comprises a purine or pyrimidine nucleobase effective to bind, by
base-specific hydrogen bonding, to a base in an
oligonucleotide.
[0125] Morpholino-based oligomers (including antisense oligomers)
are detailed, for example, in U.S. Pat. Nos. 5,698,685; 5,217,866;
5,142,047; 5,034,506; 5,166,315; 5,185,444; 5,521,063; 5,506,337
and pending U.S. patent application Ser. Nos. 12/271,036;
12/271,040; and PCT Publication No. WO/2009/064471 and
WO/2012/043730 and Summerton et al. 1997, Antisense and Nucleic
Acid Drug Development, 7, 187-195, which are hereby incorporated by
reference in their entirety.
[0126] Within the oligomer structure, the phosphate groups are
commonly referred to as forming the "internucleoside linkages" of
the oligomer. The naturally occurring internucleoside linkage of
RNA and DNA is a 3' to 5' phosphodiester linkage. A
"phosphoramidate" group comprises phosphorus having three attached
oxygen atoms and one attached nitrogen atom, while a
"phosphorodiamidate" group comprises phosphorus having two attached
oxygen atoms and two attached nitrogen atoms. In the uncharged or
the cationic internucleoside linkages of the morpholino-based
oligomers described herein, one nitrogen is always pendant to the
linkage chain. The second nitrogen, in a phosphorodiamidate
linkage, is typically the ring nitrogen in a morpholine ring
structure.
[0127] Accordingly, various embodiments of the disclosure include a
substantially uncharged antisense morpholino oligomer, composed of
morpholino subunits and phosphorus-containing intersubunit linkages
joining a morpholino nitrogen of one subunit to a 5'-exocyclic
carbon of an adjacent subunit, and having (a) about 10-40
nucleotide bases, and (b) a targeting sequence of sufficient length
and complementarity to specifically hybridize to a bacterial mRNA
target sequence that encodes a virulence factor; where the oligomer
is conjugated to a cell-penetrating peptide (CPP). In particular
embodiments, the morpholino subunits are joined by
phosphorous-containing intersubunit linkages in accordance with the
structure:
##STR00008##
[0128] where Y.sub.1=oxygen (O) or sulfur, nitrogen, or carbon;
Z=oxygen or sulfur, preferably oxygen; Pj is a purine or pyrimidine
base-pairing moiety effective to bind, by base-specific hydrogen
bonding, to a base in a polynucleotide, and X is --NRR' where R and
R' are the same or different and are either H or alkyl. In
particular embodiments, X is --NRR', where R and R' are the same or
different and are either H or methyl.
[0129] Also included are antisense oligomer that comprise a
sequence of nucleotides of the formula in FIGS. 1A-1E. In FIG. 1A,
B is a purine or pyrimidine base-pairing moiety effective to bind,
by base-specific hydrogen bonding, to a base in a polynucleotide.
Y.sub.1 or Y.sub.2 may be oxygen, sulfur, nitrogen, or carbon,
preferably oxygen. The X moiety pendant from the phosphorus may be
fluorine, an alkyl or substituted alkyl, an alkoxy or substituted
alkoxy, a thioalkoxy or substituted thioalkoxy, or unsubstituted,
monosubstituted, or disubstituted nitrogen, including cyclic
structures, such as morpholines or piperidines. Alkyl, alkoxy and
thioalkoxy include 1-6 carbon atoms. The Z moieties may be sulfur
or oxygen, and are preferably oxygen.
[0130] In various aspects, an antisense oligomer of the disclosure
includes a compound of formula (I):
##STR00009##
[0131] or a pharmaceutically acceptable salt thereof,
[0132] where each Nu is a nucleobase which taken together forms a
targeting sequence;
[0133] X is an integer from 9 to 38;
[0134] T is selected from OH and a moiety of the formula:
##STR00010##
[0135] where each R.sup.4 is independently C.sub.1-C.sub.6 alkyl,
and R.sup.5 is selected from an electron pair and H, and R.sup.6 is
selected from OH, --N(R.sup.7)CH.sub.2C(O)NH.sub.2, and a moiety of
the formula:
##STR00011##
[0136] where: [0137] R.sup.7 is selected from H and C.sub.1-C.sub.6
alkyl, and [0138] R.sup.8 is selected from G, --C(O)--R.sup.9OH,
acyl, trityl, and 4-methoxytrityl, where: [0139] R.sup.9 is of the
formula --(O-alkyl).sub.y- wherein y is an integer from 3 to 10 and
each of the y alkyl groups is independently selected from
C.sub.2-C.sub.6 alkyl; [0140] each instance of R.sup.1 is
--N(R.sup.10).sub.2R.sup.11 wherein each R.sup.10 is independently
C.sub.1-C.sub.6 alkyl, and R.sup.11 is selected from an electron
pair and H; [0141] R.sup.2 is selected from H, G, acyl, trityl,
4-methoxytrityl, benzoyl, stearoyl, and a moiety of the
formula:
##STR00012##
[0142] where L is selected from --C(O)(CH.sub.2).sub.6C(O)-- and
--C(O)(CH.sub.2).sub.2S.sub.2(CH.sub.2).sub.2C(O)--, and each
R.sup.12 is of the formula --(CH.sub.2).sub.2OC(O)N(R.sup.14).sub.2
wherein each R.sup.14 is of the formula
--(CH.sub.2).sub.6NHC(.dbd.NH)NH.sub.2; and
[0143] R.sup.3 is selected from an electron pair, H, and
C.sub.1-C.sub.6 alkyl, [0144] wherein G is a cell penetrating
peptide ("CPP") and linker moiety selected from
--C(O)(CH.sub.2).sub.5NH-CPP, --C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP, and
--C(O)CH.sub.2NH-CPP, or G is of the formula:
##STR00013##
[0145] wherein the CPP is attached to the linker moiety by an amide
bond at the CPP carboxy terminus, with the proviso that only one
instance of G is present,
[0146] wherein the targeting sequence specifically hybridizes to a
bacterial mRNA target sequence that encodes a virulence factor.
[0147] In some embodiments, X is from 9 to 18. In certain
embodiments, X is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.
[0148] In certain embodiments, T is selected from:
##STR00014##
[0149] In some embodiments, R.sup.2 is selected from H, G, acyl,
trityl, 4-methoxytrityl, benzoyl, and stearoyl.
[0150] In various embodiments, T is selected from:
##STR00015##
[0151] In some embodiments, T is of the formula:
##STR00016##
[0152] R.sup.6 is of the formula:
##STR00017##
and R.sup.2 is G.
[0153] In certain embodiments, T is of the formula:
##STR00018##
and R.sup.2 is G.
[0154] In certain embodiments, T is of the formula:
##STR00019##
[0155] In some embodiments, R.sup.2 is G or T is of the
formula:
##STR00020##
[0156] In some embodiments, R.sup.2 is selected from H, acyl,
trityl, 4-methoxytrityl, benzoyl, and stearoyl.
[0157] In various embodiments, R.sup.2 is selected from H or G, and
R.sup.3 is selected from an electron pair or H. In a particular
embodiment, R.sup.2 is G. In some embodiments, R.sup.2 is H or
acyl. In some embodiments, each R.sup.1 is --N(CH.sub.3).sub.2. In
some embodiments, at least one instance of R.sup.1 is
--N(CH.sub.3).sub.2. In certain embodiments, each instance of
R.sup.1 is --N(CH.sub.3).sub.2.
[0158] In various embodiments of the disclosure, an antisense
oligomer of the disclosure includes a compound of formula (II):
##STR00021##
[0159] or a pharmaceutically acceptable salt thereof,
[0160] where each Nu is a nucleobase which taken together forms a
targeting sequence;
[0161] X is an integer from 9 to 28;
[0162] T is selected from:
##STR00022##
[0163] R.sup.2 is selected from H, G, acyl, trityl,
4-methoxytrityl, benzoyl, and stearoyl; and
[0164] R.sup.3 is selected from an electron pair, H, and
C.sub.1-C.sub.6 alkyl,
[0165] wherein G is a cell penetrating peptide ("CPP") and linker
moiety selected
from --C(O)(CH.sub.2).sub.5NH-CPP, --C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP,
[0166] and --C(O)CH.sub.2NH-CPP, or G is of the formula:
##STR00023##
wherein the CPP is attached to the linker moiety by an amide bond
at the CPP carboxy terminus, with the proviso that only one
instance of G is present. In various embodiments, R.sup.2 is G or T
is of the formula:
##STR00024##
[0167] In some embodiments, T is TEG as defined above, R.sup.2 is
G, and R.sup.3 is an electron pair or H. In certain embodiments,
R.sup.2 is selected from H, acyl, trityl, 4-methoxytrityl, benzoyl,
and stearoyl and T is of the formula:
##STR00025##
[0168] In various aspects, an antisense oligomer of the disclosure
includes a compound of formula (III):
##STR00026##
[0169] or a pharmaceutically acceptable salt thereof,
[0170] where each Nu is a nucleobase which taken together forms a
targeting sequence;
[0171] X is an integer from 9 to 28;
[0172] T is selected from:
##STR00027##
[0173] each instance of R.sup.1 is --N(R.sup.10).sub.2R.sup.11
wherein each R.sup.10 is independently C.sub.1-C.sub.6 alkyl, and
R.sup.11 is selected from an electron pair and H;
[0174] R.sup.2 is selected from an electron pair, H, and
C.sub.1-C.sub.6 alkyl; and
[0175] G is a cell penetrating peptide ("CPP") and linker moiety
selected from --C(O)(CH.sub.2).sub.5NH-CPP,
--C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP,
[0176] and --C(O)CH.sub.2NH-CPP, or G is of the formula:
##STR00028##
wherein the CPP is attached to the linker moiety by an amide bond
at the CPP carboxy terminus. In some embodiments, at least one
instance of R.sup.1 is --N(CH.sub.3).sub.2. In certain embodiments,
each instance of R.sup.1 is --N(CH.sub.3).sub.2.
[0177] In various aspects, an antisense oligomer of the disclosure
includes a compound of formula (IV):
##STR00029##
[0178] or a pharmaceutically acceptable salt thereof, wherein:
[0179] X is an integer from 9 to 28;
[0180] each Nu is a nucleobase which taken together forms a
targeting sequence;
[0181] each instance of R.sup.1 is --N(R.sup.10).sub.2R.sup.11
wherein each R.sup.10 is independently C.sub.1-C.sub.6 alkyl, and
R.sup.11 is selected from an electron pair and H; and
[0182] G is a cell penetrating peptide ("CPP") and linker moiety
selected from --C(O)(CH.sub.2).sub.5NH-CPP,
--C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP,
[0183] and --C(O)CH.sub.2NH-CPP, or G is of the formula:
##STR00030##
[0184] wherein the CPP is attached to the linker moiety by an amide
bond at the CPP carboxy terminus. In some embodiments, at least one
instance of R.sup.1 is --N(CH.sub.3).sub.2. In certain embodiments,
each instance of R.sup.1 is --N(CH.sub.3).sub.2.
[0185] In various aspects, an antisense oligomer of the disclosure
can be a compound of formula (V):
##STR00031##
[0186] wherein:
[0187] X is an integer from 9 to 18;
[0188] each Nu is a nucleobase which taken together forms a
targeting sequence;
[0189] each instance of R.sup.1 is --N(R.sup.10).sub.2R.sup.11
wherein each R.sup.10 is independently C.sub.1-C.sub.6 alkyl, and
R.sup.11 is selected from an electron pair and H;
[0190] R.sup.2 is selected from H, trityl, 4-methoxytrityl, acyl,
benzoyl, and stearoyl; and
[0191] R.sup.3 is selected from an electron pair, H, and
C.sub.1-C.sub.6 alkyl,
[0192] wherein G is a cell penetrating peptide ("CPP") and linker
moiety selected
from --C(O)(CH.sub.2).sub.5NH-CPP, --C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP,
[0193] and --C(O)CH.sub.2NH-CPP, or G is of the formula:
##STR00032##
[0194] wherein the CPP is attached to the linker moiety by an amide
bond at the CPP carboxy terminus. In some embodiments, at least one
instance of R.sup.1 is --N(CH.sub.3).sub.2. In certain embodiments,
each instance of R.sup.1 is --N(CH.sub.3).sub.2.
[0195] In various aspects, an antisense oligomer of the disclosure
includes a compound of formula (VI):
##STR00033##
[0196] or a pharmaceutically acceptable salt thereof, wherein:
[0197] X is an integer from 9 to 28;
[0198] each Nu is a nucleobase which taken together forms a
targeting sequence;
[0199] R.sup.2 is selected from H or acyl; and
[0200] G is a cell penetrating peptide ("CPP") and linker moiety
selected from --C(O)(CH.sub.2).sub.5NH-CPP,
--C(O)(CH.sub.2).sub.2NH-CPP,
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP,
[0201] and --C(O)CH.sub.2NH-CPP, or G is of the formula:
##STR00034##
[0202] wherein the CPP is attached to the linker moiety by an amide
bond at the CPP carboxy terminus.
[0203] The antisense oligomers can be prepared by stepwise
solid-phase synthesis, employing methods known in the art and
described in the references cited herein.
[0204] B. Cell-Penetrating Peptides
[0205] In certain embodiments, the antisense oligomer is conjugated
to a cell-penetrating peptide (CPP). In some embodiments, the CPP
is an arginine-rich peptide. By "arginine-rich carrier peptide" is
meant that the CPP has at least 2, and preferably 2, 3, 4, 5, 6, 7,
or 8 arginine residues, each optionally separated by one or more
uncharged, hydrophobic residues, and optionally containing about
6-14 amino acid residues. FIGS. 1F-1H show exemplary chemical
structures of CPP-PMO conjugates used in the Examples, including 5'
and 3' PMO conjugates.
[0206] Exemplary CPPs are provided in Table C1 (SEQ ID NOS:
43-49).
TABLE-US-00005 TABLE C1 Exemplary Cell-Penetrating Peptides Name
Sequence SEQ ID NO: (RXR).sub.4 RXRRXRRXRRXR 43 (RFF).sub.3R
RFFRFFRFFR 44 (RXR).sub.4XB RXRRXRRXRRXRXB 45 (RFF).sub.3RXB
RFFRFFRFFRXB 46 (RFF).sub.3RG RFFRFFRFFR 47 R.sub.6G RRRRRRG 48
R.sub.6 RRRRRR 49 X is 6-aminohexanoic acid; B is .beta.-alanine; F
is phenylalanine; G is glycine
[0207] CPPs, their synthesis, and methods of conjugating a CPP to
an oligomer are detailed, for example, in International Patent
Application Publication Nos. WO 2004/097017, WO 2009/005793, and WO
2012/150960, which are all incorporated by reference in their
entirety.
[0208] In some embodiments, the CPP is linked at its C-terminus to
the 3'-end or the 5'-end of the oligomer via a 1, 2, 3, 4, or 5
amino acid linker. In particular embodiments, including antisense
oligomer compounds of formula (I)-(VI), the linkers can include:
--C(O)(CH.sub.2).sub.5NH-CPP (X linker),
--C(O)(CH.sub.2).sub.2NH-CPP (B linker),
--C(O)(CH.sub.2).sub.2NHC(O)(CH.sub.2).sub.5NH-CPP (XB peptide
linker), and --C(O)CH.sub.2NH-CPP (Gly linker), or G is of the
formula:
##STR00035##
wherein the CPP is attached to the linker moiety by an amide bond
at the CPP carboxy terminus. In some embodiments of the disclosure,
including antisense oligomer compounds of formula (I)-(VI), G is
selected from SEQ ID NOs: 45 to 48. In various embodiments,
including antisense oligomer compounds of formula (I)-(VI), the CPP
is selected from SEQ ID NO: 43, 44, and 49, and the linker is
selected from the group described above.
[0209] In some embodiments, including antisense oligomer compounds
of formula (I)-(VI), the CPP is selected from:
##STR00036##
[0210] wherein R.sup.a is selected from H, acetyl, benzoyl, and
stearoyl.
[0211] In some embodiments, including antisense oligomer compounds
of formula (I)-(VI), G is selected from:
##STR00037##
[0212] wherein R.sup.a is selected from H, acetyl, benzoyl, and
stearoyl.
[0213] In various aspects, an antisense oligomer of the disclosure,
or a pharmaceutically acceptable salt thereof, includes an
antisense oligomer of the formula (VII) selected from:
##STR00038## ##STR00039## ##STR00040## ##STR00041##
wherein X is an integer from 9 to 38, R.sup.a is selected from H,
acetyl, benzoyl, and stearoyl, R.sup.b is selected from H, acetyl,
benzoyl, stearoyl, trityl, and 4-methoxytrityl, and each Nu is a
purine or pyrimidine base-pairing moiety which taken together form
a targeting sequence described above.
[0214] C. Antisense Oligomer Targeting Sequence
[0215] In various embodiments of the antisense oligomers of the
disclosure, including the antisense oligomer compounds of formulas
(I)-(VII), the targeting sequence can specifically hybridize to a
bacterial mRNA target sequence that encodes a virulence factor. In
some embodiments, the target sequence comprises a translational
start codon of the bacterial mRNA and/or a sequence within about 30
bases upstream or downstream of the translational start codon of
the bacterial mRNA. In certain embodiments, the virulence factor
can be an antibiotic resistance protein, a biofilm formation
protein or an essential protein. In some embodiments, the
antibiotic resistance protein may be selected from at least one of
New Delhi metallo-beta-lactamase (NDM-1),
resistance-nodulation-cell division (RND)-type multidrug efflux
pump subunit AdeA (adeA), serine beta-lactamase (KPC or KPC 1-4),
acridine resistance complex protein AcrA, acridine resistance
complex protein AcrB, acridine resistance complex repressor protein
AcrR, acridine resistance complex protein ToIC, and outer membrane
protein A (OmpA). In some embodiments, the target sequence can be
selected from SEQ ID NOS: 1-4, wherein thymine bases (T) are
optionally uracil bases (U). In certain embodiments, the targeting
sequence may be one of the targeting sequences set forth in SEQ ID
NOS: 10-25, may comprise a fragment of at least 10 contiguous
nucleotides of SEQ ID NOS: 10-25, or may comprise a variant having
at least 80% sequence identity to SEQ ID NOS: 10-25, wherein
thymine bases (T) are optionally uracil bases (U), In some
embodiments, the biofilm formation protein may be encoded by at
least one of Cepl, SuhB, CsuE, SecA, Pg1L, PilU1, AlgZ, AlgU, LasR,
FleR and PelF. In certain embodiments, the target sequence can be
selected from SEQ ID NOS: 5-9, wherein thymine bases (T) are
optionally uracil bases (U). In some embodiments, the targeting
sequence may be one of the targeting sequences set forth in SEQ ID
NOS: 26-36, may comprise a fragment of at least 10 contiguous
nucleotides of SEQ ID NOS: 26-36, or may comprise a variant having
at least 80% sequence identity to SEQ ID NOS: 26-36, wherein
thymine bases (T) are optionally uracil bases (U). In some
embodiments, an essential protein may be encoded by at least one of
RpoD or PoIB. In some embodiments, the targeting sequence may be
one of the targeting sequences set forth in SEQ ID NOS: 37-38, may
comprise a fragment of at least 10 contiguous nucleotides of SEQ ID
NOS: 37-38, or may comprise a variant having at least 80% sequence
identity to SEQ ID NOS: 37-38, wherein thymine bases (T) are
optionally uracil bases (U), In some embodiments of the disclosure,
including the antisense oligomer compounds of formulas (I)-(VII),
the targeting sequence is selected from:
[0216] a) SEQ ID NO: 10 (CAT GGA TAT CC);
[0217] b) SEQ ID NO: 11 (ATG TAA ACC TC);
[0218] c) SEQ ID NO: 12 (GTT CAT ATG TA);
[0219] d) SEQ ID NO: 13 (AAC CCT CTG TT);
[0220] e) SEQ ID NO: 14 (TGT TCA TAT GT);
[0221] f) SEQ ID NO: 15 (GTC TTA ACG GC);
[0222] g) SEQ ID NO: 16 (AGG CAT GTC TT);
[0223] h) SEQ ID NO: 17 (TAG GCA TGT CT);
[0224] i) SEQ ID NO: 18 (TAT GTT CGT GA);
[0225] j) SEQ ID NO: 19 (TTC ATT TGC AT);
[0226] k) SEQ ID NO: 20 (ATT CCT TGT GG);
[0227] l) SEQ ID NO: 21 (TTT GCA TTC CT);
[0228] m) SEQ ID NO: 22 (GAT ACA GTG AC);
[0229] n) SEQ ID NO: 23 (AAC GAT ATT CC);
[0230] o) SEQ ID NO: 24 (TCA AGT TTT CC); and
[0231] p) SEQ ID NO: 25 (TCC TTT TAT TC), wherein X is 9, and
thymine bases (T) may be uracil bases (U).
[0232] In various embodiments of the disclosure, including the
antisense oligomer compounds of formulas (I)-(VII), the targeting
sequence is selected from:
[0233] a) SEQ ID NO: 26 (TTA TAT TCA TGG);
[0234] b) SEQ ID NO: 27 (TCA TGG CAA AG);
[0235] c) SEQ ID NO: 28 (TTT CCT GTC AA);
[0236] d) SEQ ID NO: 29 (TTG CCA ACA TG);
[0237] e) SEQ ID NO: 30 (CAT TAC CCA AG);
[0238] f) SEQ ID NO: 31 (TTA AAA TCC AT);
[0239] g) SEQ ID NO: 32 (TAG GCA TCG AC);
[0240] h) SEQ ID NO: 33 (AAA GCT CCT CT);
[0241] i) SEQ ID NO: 34 (AGG CCA TAG CG);
[0242] j) SEQ ID NO: 35 (TTA CTC CTG AA); and
[0243] k) SEQ ID NO: 36 (TTC GGT CAT GT), wherein X is 9, and
thymine bases (T) may be uracil bases (U).
[0244] In various embodiments of the disclosure, including the
antisense oligomer compounds of formulas (I)-(VII), the targeting
sequence is selected from:
[0245] a) SEQ ID NO: 37 (TCA TCT TTG CT); and
[0246] b) SEQ ID NO: 38 (TCA TGG CAA AG), wherein X is 9, and
thymine bases (T) may be uracil bases (U).
[0247] D. Exemplary Antisense Oligomers Exemplary antisense
oligomers (AONs) of the disclosure include those described in
Tables 3A-3C below.
TABLE-US-00006 TABLE 3A Exemplary Antibiotic Resistance Targeting
AONs PMO Target Targeting Sequence TS SEQ 5' Attachment 3'
Attachment CPP SEQ Name Gene (TS)* ID NO: *** ** ID NO. PPMO#1 OmpA
CAT GGA TAT CC 10 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#2 AcrA
ATG TAA ACC TC 11 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#3 AcrA
GTT CAT ATG TA 12 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#4 AcrA
AAC CCT CTG TT 13 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#5 AcrA
TGT TCA TAT GT 14 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#6 AcrB
GTC TTA ACG GC 15 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#7 AcrB
AGG CAT GTC TT 16 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#8 AcrB
TAG GCA TGT CT 17 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#9 AcrR
TAT GTT CGT GA 18 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#10 ToIC
TTC ATT TGC AT 19 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#11 ToIC
ATT CCT TGT GG 20 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#12 ToIC
TTT GCA TTC CT 21 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#13 KPC
GAT ACA GTG AC 22 (RXR).sub.4XB- H 45 PPMO#14 KPC 1-4 AAC GAT ATT
CC 23 (RXR).sub.4XB- H 45 PPMO#34 KPC GAT ACA GTG AC 22 TEG R6G 48
PPMO#35 KPC GAT ACA GTG AC 22 TEG (RXR)4XB- 45 PPMO#15 NDM-1 TCA
AGT TTT CC 24 TEG R6G 48 PPMO#16 NDM-1 TCC TTT TAT TC 25 R.sub.6G H
or -C(O)CH.sub.3 48 PPMO#17 NDM-1 TCA AGT TTT CC 24 R.sub.6G H or
-C(O)CH.sub.3 48 PPMO#18 NDM-1 TCC TTT TAT TC 25 TEG (RXR).sub.4XB-
45 PPMO#19 NDM-1 TCA AGT TTT CC 24 TEG (RXR).sub.4XB- 45 PPMO#36
NDM-1 TCC TTT TAT TC 25 TEG R.sub.6G 48 PPMO#37 NDM-1 GGCAATTCCAT
50 TEG R.sub.6G 48 *The thymines (T) can be uracils (U); ** X is
6-aminohexanoic acid, B is beta-alanine, G is glycine and TEG is
defined above. *** X is 6-aminohexanoic acid, B is beta-alanine, G
is glycine, TEG is defined above, and a 5' CPP is linked through a
pip-PDA moiety described above.
* The thymines (T) can be uracils (U); ** X is 6-aminohexanoic
acid, B is beta-alanine, G is glycine and TEG is defined above. ***
X is 6-aminohexanoic acid, B is beta-alanine, G is glycine, TEG is
defined above, and a 5' CPP is linked through a pip-PDA moiety
described above.
TABLE-US-00007 TABLE 3B Exemplary Biofilm Formation Targeting AONs
PMO Target Targeting Sequence TS SEQ 5' Attachment 3' Attachment
CPP SEQ Name Gene (TS)* ID NO: *** ** ID NO. PPMO#20 CsuE TTA TAT
TCA TGG 26 R.sub.6G H or -C(O)CH.sub.3 48 PPMO#21 CsuE TCA TGG CAA
AG 27 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#22 CsuE TTA TAT TCA
TGG 26 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#23 CsuE TTT CCT
GTC AA 28 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#24 SecA TTG CCA
ACA TG 29 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#25 PgIL CAT TAC
CCA AG 30 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#26 Pi1U1 TTA
AAA TCC AT 31 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#27 AlgZ TAG
GCA TCG AC 32 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#28 AlgU AAA
GCT CCT CT 33 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#29 LasR AGG
CCA TAG CG 34 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#30 FleR TTA
CTC CTG AA 35 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 PPMO#31 PelF TTC
GGT CAT GT 36 (RXR).sub.4XB- H or -C(O)CH.sub.3 45 *The thymines
(T) can be uracils (U); ** TEG is defined above. *** X is
6-aminohexanoic acid, B is beta-alanine, G is glycine and a 5' CPP
is linked through a pip-PDA moiety described above.
* The thymines (T) can be uracils (U); ** TEG is defined above. ***
X is 6-aminohexanoic acid, B is beta-alanine, G is glycine and a 5'
CPP is linked through a pip-PDA moiety described above.
TABLE-US-00008 TABLE 3C Exemplary Essential Genes Targeting AONs
PMO Target Targeting Sequence TS SEQ 5' Attachment 3' Attachment
CPP SEQ Name Gene (TS)* ID NO: *** ** ID NO. PPMO#32 RpoD TCA TCT
TTG CT 37 TEG (RXR).sub.4XB- 45 PPMO#33 PolB AGT AAC TCC AC 38
(RXR).sub.4XB- H or -C(O)CH.sub.3 45 * The thymines (T) can be
uracils (U); ** X is 6-aminohexanoic acid, B is beta-alanine, TEG
is defined above. *** X is 6-aminohexanoic acid, B is beta-alanine,
TEG is defined above and a 5' CPP is linked through a pip-PDA
moiety described above.
* The thymines (T) can be uracils (U); ** X is 6-aminohexanoic
acid, B is beta-alanine, TEG is defined above. *** X is
6-aminohexanoic acid, B is beta-alanine, TEG is defined above and a
5' CPP is linked through a pip-PDA moiety described above.
[0248] II. Methods of Use and Formulations
[0249] Embodiments of the present disclosure include methods of
using the antisense oligomers described herein to reduce the
expression and activity of one or more bacterial virulence factors.
Certain embodiments include methods of using the antisense
oligomers to reduce replication, proliferation, virulence factors,
or growth of bacteria, for example, to treat bacterial infections
in a subject, either alone or in combination with one or more
additional antimicrobial agents. In some instances, the antisense
oligomers increase the susceptibility of the bacterium to
antibiotics. Certain embodiments include methods of using the
antisense oligomers described herein to reduce the formation or
existence of bacterial biofilms, for instance, to treat bacterial
infections in a subject, either alone or in combination with one or
more additional antimicrobial agents.
[0250] Also included are pharmaceutical compositions comprising the
antisense oligomers, typically in combination with a
pharmaceutically-acceptable carrier. The methods provided herein
can be practiced in vitro or in vivo.
[0251] For example, certain embodiments include methods of treating
a bacterial infection in a subject, comprising administering to a
subject in need thereof (e.g., subject having or at risk for having
a bacterial infection) an antisense oligomer or pharmaceutical
composition described herein. Also included are methods of reducing
virulence and/or biofilm formation of a bacteria or bacterium which
comprises a gene encoding a virulence factor, comprising contacting
the bacteria or bacterium with an antisense oligomer described
herein.
[0252] In some embodiments, the bacterium is selected from the
genus Escherichia, Acinetobacter, Klebsiella, Burkholderia, and
Pseudomonas.
[0253] Escherichia is a genus of Gram-negative, non-spore forming,
facultatively anaerobic, rod-shaped bacteria from the family
Enterobacteriaceae, and includes the species Escherichia coli,
which is responsible for the vast majority of Escherichia-related
pathogenesis.
[0254] Acinetobacter is a genus of Gram-negative bacteria belonging
to the class of Gammaproteobacteria. Examples of
clinically-relevant Acinetobacter complexes include the
Acinetobacter calcoaceticus-baumanii complex (glucose-oxidizing
nonhemolytic), Acinetobacter Iwoffii (glucose-negative
nonhemolytic), and Acinetobacter haemolyticus (hemolytic). Specific
examples include Acinetobacter baumannii. Acinetobacter baumannii
is a ubiquitous organism that has emerged over recent years to be a
significant cause of hospital-acquired infections. It is all the
more concerning given that A. baumannii has become one of the most
antibiotic resistant Gram-negative pathogens that the medical
community currently faces worldwide. The rapid increase in
multidrug-resistance in A. baumannii has left few therapeutic
choices for the treating physician. Older drugs such as colistin
are now frequently used, although colistin-resistant strains have
now emerged. A. baumannii can cause a variety of clinical
infections, with pneumonia being one of the most frequent.
[0255] Klebsiella is a genus of non-motile, Gram-negative,
oxidase-negative, rod-shaped bacteria with a prominent
polysaccharide-based capsule. Klebsiella organisms can lead to a
wide range of disease states, such as pneumonia, urinary tract
infections, septicemia, meningitis, diarrhea, and soft tissue
infections. The majority of human infections are caused by
Klebsiella pneumoniae and Klebsiella oxytoca. Klebsiella has become
increasingly drug resistant. A recent outbreak of Klebsiella
infections at the National Institutes of Health Clinical Center
illustrates the difficulty in treating patients with these
infections and the complexities that institutions can face in
trying to eradicate these strains from the hospital environment.
The spread of carbapenem-resistant Enterobacteriaceae (CRE)
(including K. pneumoniae) has happened rapidly worldwide, including
in the U.S. where carbapenemase-producing CRE has now been reported
in most states.
[0256] Burkholderia (previously part of Pseudomonas) refers to a
group of near ubiquitous gram-negative, motile, obligately aerobic
rod-shaped bacteria. These protobacteria include pathogenic
bacteria such as Burkholderia mallei, responsible for glanders;
Burkholderia pseudomallei, causative agent of melioidosis; and
Burkholderia cepacia, a significant pathogen of pulmonary
infections, for example, in subjects with cystic fibrosis (CF).
Burkholderia cepacia (or Burkholderia cepacia complex) is a
Gram-negative bacterium composed of many different sub-species,
including, for example, Burkholderia cenocepacia, Burkholderia
multivorans, Burkholderia vietnamiensis, Burkholderia stabilis,
Burkholderia anthina, Burkholderia pyrrocinia, Burkholderia dolosa,
and/or Burkholderia ambifaria.
[0257] Pseudomonas is a genus of Gram-negative aerobic
gammaproteobacteria, belonging to the family Pseudomonadaceae.
Pseudomonas aeruginosa is increasingly recognized as an emerging
opportunistic pathogen of clinical relevance. Pseudomonas
aeruginosa can cause a variety of infections in the hospital
setting including VAP, bacteremia and wound infections in burn
patients. In addition, it is the major pathogen associated with
lung infections in cystic fibrosis. Eighty percent of CF patients
are infected with P. aeruginosa by adulthood, and chronic lung
infections with this pathogen are the primary cause of morbidity
and mortality. In the CF patient, complete eradication of P.
aeruginosa is rarely achieved. P. aeruginosa is naturally resistant
to many antibiotics and is becoming resistant to those it was once
sensitive to. Importantly, multi-drug resistant isolates of P.
aeruginosa are now common in both CF and non-CF patients leaving
virtually no therapeutic options. The formation of biofilm is a
major virulence trait in Pseudomonas.
[0258] Thus, in some embodiments, the bacterium is any of the
foregoing members of the genera Escherichia, Acinetobacter,
Klebsiella, Burkholderia, and Pseudomonas. In specific embodiments,
the bacterium is one or more of Escherichia coli, Acinetobacter
baumannii, Klebsiella pneumoniae, Burkholderia cepacia (complex),
or Pseudomonas aeruginosa.
[0259] In certain embodiments, the bacterium is multi-drug
resistance (MDR) bacteria or bacterium. Multiple drug resistance
(MDR), multi-drug resistance or multiresistance is a condition
enabling disease-causing microorganisms (bacteria, viruses, fungi
or parasites) to resist distinct antimicrobials such as
antibiotics, antifungal drugs, antiviral medications, antiparasitic
drugs, and others. In particular embodiments, the bacterium is
extensively-drug resistant (XDR) or pan-drug resistant (PDR). In
some embodiments, the bacterium is an extended-spectrum
.beta.-lactamase (ESBLs) producing Gram-negative bacteria,
Klebsiella pneumoniae carbapenemase (KPC or KPC 1-4) producing
Gram-negative bacteria, or a multi-drug-resistant gram negative rod
(MDR GNR) MDRGN bacteria. In specific embodiments, the bacterium is
MDR Escherichia coli, MDR Acinetobacter baumannii, MDR Klebsiella
pneumoniae, MDR Burkholderia cepacia (complex), or MDR Pseudomonas
aeruginosa.
[0260] As noted above, the bacteria or bacterium described herein
typically comprise (e.g., encode) one or more virulence factors
such as antibiotic resistance genes and/or biofilm formation genes.
General examples of antibiotic resistance genes (and their related
proteins) include beta-lactamases, which can enzymatically
deactivate certain antimicrobial agents, and genes/proteins which
increase the permeability or active efflux (pumping out) of an
antimicrobial agent. Particular examples of antibiotic resistance
genes include New Delhi metallo-beta-lactamase (NDM-1),
resistance-nodulation-cell division (RND)-type multidrug efflux
pump subunit AdeA (adeA), serine beta-lactamase (KPC or KPC 1-4),
acridine resistance complex protein AcrA, acridine resistance
complex protein AcrB, acridine resistance complex repressor protein
AcrR, acridine resistance complex protein ToIC, and outer membrane
protein A (OmpA). In specific embodiments, the bacterium is
Escherichia coli, Acinetobacter baumannii, or Klebsiella
pneumoniae, which comprises or expresses at least one antibiotic
resistance gene selected from NDM-1, AdeA, KPC, KPC 1-4, AcrA,
AcrB, AcrR, ToIC and OmpA.
[0261] Examples of biofilm formation genes (and their related
proteins) include: cepl, cepR and suhB genes, for example, from
Burkholderia; CsuE, SecA, Pg1L and Pi/U1 genes, for example, from
Acinetobacter baumannii; AlgZ, AlgU, LasR, FleR and PelF genes, for
example, from Pseudomonas aeruginosa. In particular embodiments,
the bacterium comprises or expresses a cepl gene, which encodes an
acylhomoserine lactone synthase. In some embodiments, the bacterium
comprises or expresses a suhB gene, which encodes an
inositol-1-monophosphate. In specific embodiments, the bacterium
that comprises or expresses one more biofilm formation genes is a
Burkholderia species, for example, Burkholderia cepacia or
Burkholderia cepacia (complex). In some of these and related
embodiments, the subject in need thereof is immunocompromised and
has an underlying lung disease, such as cystic fibrosis (CF) or
chronic granulomatous disease (CGD).
[0262] In some embodiments, the bacterium comprises or expresses a
CsuE gene, which encodes a chaperone-usher pili assembly system
protein. In some embodiments, the bacterium comprises or expresses
a SecA gene, which encodes an ATPase associated with cell membrane
transport. In some embodiments, the bacterium comprises or
expresses a Pg1L gene. In some embodiments, the bacterium comprises
or expresses a Pi/U1 gene. In specific embodiments, the bacterium
that comprises or expresses one more biofilm formation genes is an
Acinetobacter species, for example, Acinetobacter baumannii.
[0263] In some embodiments, the bacterium comprises or expresses an
AlgZ gene, which encodes a protein associated with alginate
biosynthesis. In some embodiments, the bacterium comprises or
expresses an AlgU gene, which encodes a protein associated with
alginate biosynthesis. In some embodiments, the bacterium comprises
or expresses a LasR gene, which encodes a transcriptional activator
protein. In some embodiments, the bacterium comprises or expresses
a FleR gene, which encodes a transcriptional regulator of flagella
expression. In some embodiments, the bacterium comprises or
expresses the PelF gene, which encodes a polysaccharide
biosynthesis protein. In specific embodiments, the bacterium that
comprises or expresses one more biofilm formation genes is a
Pseudomonas species, for example, Pseudomonas aeruginosa.
[0264] Examples of essential genes (and their related proteins)
include: RpoD gene, for example, from Acinetobacter baumannii and
PolB gene, for example, from Pseudomonas aeruginosa. In some
embodiments, the bacterium comprises or expresses an RpoD gene,
which encodes an RNA polymerase. In specific embodiments, the
bacterium that comprises or expresses one more essential genes is a
Acinetobacter species, for example, Acinetobacter baumannii. In
some embodiments, the bacterium comprises or expresses a PolB gene,
which encodes a DNA polymerase II. In specific embodiments, the
bacterium that comprises or expresses one more biofilm formation
genes is a Pseudomonas species, for example, Pseudomonas
aeruginosa.
[0265] In some embodiments, the antisense oligomer reduces or
inhibits the growth of the bacterium. For instance, in some
embodiments, the antisense oligomer reduces growth of the bacterium
by about or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350,
400, 450, 500, 600, 700, 800, 900, or 1000% or more (including all
integers and ranges in between), relative to a control (e.g.,
absence of the antisense oligomer, scrambled oligomer, prior to
contacting with the oligomer), or by about or at least about 2, 3,
4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65,
70, 75, 80, 85, 90, 95, or 100-fold or more (including all integers
and ranges in between), relative to a control. Bacterial growth can
be measured in vitro (see, e.g., the Examples) or in vivo. In some
embodiments, as described herein, the antisense oligomer is
employed in combination with one or more antimicrobial agents.
[0266] In some embodiments, the antisense oligomer reduces
beta-lactamase (e.g., carbapenemase) activity in the periplasm of
the bacterium by about or at least about 5, 10, 15, 20, 25, 30, 35,
40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250,
300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000% or more
(including all integers and ranges in between), relative to a
control, or by at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or
100-fold or more (including all integers and ranges in between),
relative to a control. In some embodiments, the antisense oligomer
reduces meropenemase enzymatic activity in the periplasm of the
bacterium. In particular embodiments, the antisense oligomer that
reduces beta-lactamase (e.g., carbapenemase) activity is targeted
against NDM-1, and the bacterium is an Acinetobacter, Escherichia,
or Klebsiella species, for example, Escherichia coli, Acinetobacter
baumannii, or Klebsiella pneumoniae which comprises or expresses
NDM-1. These are exemplary bacterial species and it is expected
that any bacterium expressing the NDM-1 gene is susceptible to the
compounds and methods described herein. In particular embodiments,
the antisense oligomer that reduces beta-lactamase (e.g.,
carbapenemase) activity is targeted against KPC or KPC 1-4, and the
bacterium is an Acinetobacter, Escherichia, or Klebsiella species,
for example, Escherichia coli, Acinetobacter baumannii, or
Klebsiella pneumoniae which comprises or expresses KPC or KPC 1-4.
These are exemplary bacterial species and it is expected that any
bacterium expressing the KPC or KPC 1-4 gene is susceptible to the
compounds and methods described herein. Beta-lactamase (e.g.,
carbapenemase) activity can be measured according to routine
techniques in the art.
[0267] In some embodiments, the antisense oligomer reduces
multi-drug efflux pump activity in the bacterium by about or at
least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500,
600, 700, 800, 900, or 1000% or more (including all integers and
ranges in between), relative to a control, or by at least about 2,
3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95, or 100-fold or more (including all
integers and ranges in between), relative to a control. In
particular embodiments, the antisense oligomer that reduces
multi-drug efflux pump activity is targeted against AcrA, AcrB,
AcrR or ToIC, and the bacterium is an Acinetobacter, Escherichia,
or Klebsiella species, for example, Escherichia coli, Acinetobacter
baumannii, or Klebsiella pneumoniae which comprises or expresses
AcrA, AcrB, AcrR or ToIC. These are exemplary bacterial species and
it is expected that any bacterium expressing the AcrA, AcrB, AcrR
or ToIC gene is susceptible to the compounds and methods described
herein. Multi-drug efflux pump activity can be measured according
to routine techniques in the art.
[0268] In some embodiments, the antisense oligomer reduces porin
activity in the bacterium by about or at least about 5, 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100,
150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or
1000% or more (including all integers and ranges in between),
relative to a control, or by at least about 2, 3, 4, 5, 6, 7, 8, 9,
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,
95, or 100-fold or more (including all integers and ranges in
between), relative to a control. In particular embodiments, the
antisense oligomer that reduces porin activity is targeted against
OmpA, and the bacterium is an Acinetobacter, Escherichia, or
Klebsiella species, for example, Escherichia coli, Acinetobacter
baumannii, or Klebsiella pneumoniae which comprises or expresses
OmpA. These are exemplary bacterial species and it is expected that
any bacterium expressing the OmpA gene is susceptible to the
compounds and methods described herein. Porin activity can be
measured according to routine techniques in the art.
[0269] In some embodiments, the antisense oligomer reduces biofilm
formation and/or the levels of existing biofilm relative to a
control (e.g., absence of the oligomer). For instance, in some
embodiments, the antisense oligomer reduces biofilm formation
and/or the levels of existing biofilm by at least about 5, 10, 15,
20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or
1000% or more (including all integers and ranges in between),
relative to a control, or by at least about 2, 3, 4, 5, 6, 7, 8, 9,
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,
95, or 100-fold or more (including all integers and ranges in
between), relative to a control. In particular embodiments, the
antisense oligomer that reduces biofilm formation and/or the levels
of existing biofilm is targeted against cepl, cepR, and/or suhB,
and the bacterium is a Burkholderia species, for example,
Burkholderia cepacia (complex) or a sub-species thereof (e.g.,
Burkholderia cenocepacia, Burkholderia multivorans, Burkholderia
vietnamiensis, Burkholderia stabilis, Burkholderia an thin a,
Burkholderia pyrrocinia, Burkholderia dolosa, Burkholderia
ambifaria), which comprises or expresses cepl, cepR and/or suhB. In
particular embodiments, the antisense oligomer that reduces biofilm
formation and/or the levels of existing biofilm is targeted against
CsuE, SecA, Pg1L and/or PilU1, and the bacterium is a Acinetobacter
species, for example, Acinetobacter baumannii, which comprises or
expresses CsuE, SecA, Pg1L and/or PilU1. In particular embodiments,
the antisense oligomer that reduces biofilm formation and/or the
levels of existing biofilm is targeted against AlgZ, AlgU, LasR,
FleR and/or PelF, and the bacterium is a Pseudomonas species, for
example, Pseudomonas aeruginosa, which comprises or expresses AlgZ,
AlgU, LasR, FleR and/or PelF. Biofilm formation and/or the levels
of existing biofilm can be measured in vitro (see, e.g., the
Examples) or in vivo.
[0270] In some embodiments, the methods are practiced in vivo, and
comprise administering the antisense oligomer to a subject in need
thereof, for example, a subject in need thereof that is infected or
at risk for being infected by one or more of the bacteria or
bacterium described herein. The antisense oligomers of the
disclosure can thus be administered to subjects to treat
(prophylactically or therapeutically) an infection by any of the
bacteria or bacterium described herein. In conjunction with such
treatment, pharmacogenomics (e.g., the study of the relationship
between an individual's genotype/phenotype and that individual's
response to a foreign compound or drug) may be considered.
Differences in metabolism of therapeutics can lead to severe
toxicity or therapeutic failure by altering the relation between
dose and blood concentration of the pharmacologically active
drug.
[0271] Thus, a physician or clinician may consider applying
knowledge obtained in relevant pharmacogenomics studies in
determining whether to administer a therapeutic agent as well as
tailoring the dosage and/or therapeutic regimen of treatment with a
therapeutic agent.
[0272] Effective delivery of the antisense oligomer to the target
nucleic acid is one aspect of treatment. Routes of antisense
oligomer delivery include, but are not limited to, various systemic
routes, including oral and parenteral routes, e.g., intravenous,
subcutaneous, intraperitoneal, and intramuscular, as well as
inhalation, transdermal, and topical delivery. The antisense
oligomer may be aerosolized for delivery. The appropriate route may
be determined by one of skill in the art, as appropriate to the
condition of the subject under treatment. Vascular or extravascular
circulation, the blood or lymph system, and the cerebrospinal fluid
are some non-limiting sites where the antisense oligomers may be
introduced. Direct CNS delivery may be employed, for instance,
intracerebral, intraventricular, or intrathecal administration may
be used as routes of administration.
[0273] In certain embodiments, the antisense oligomers of the
disclosure can be delivered by transdermal methods (e.g., via
incorporation of the antisense oligomers into, e.g., emulsions,
with such antisense oligomers optionally packaged into liposomes).
Such transdermal and emulsion/liposome-mediated methods of delivery
are described for delivery of antisense oligomers in the art, e.g.,
in U.S. Pat. No. 6,965,025, the contents of which are incorporated
in their entirety by reference herein.
[0274] In certain embodiments, the antisense oligomers of this
disclosure can be delivered by aerosolization. Advantages to
administering medications to the lung as an aerosol include: a more
rapid onset of action compared to oral therapy; high local
concentration by delivery directly to the airways; needle-free
systemic delivery of drugs with poor oral bioavailability; and
pain- and needle-free delivery for drugs that require subcutaneous
or intravenous injection. Traditional aerosol therapies with the
lung as the target consist of short-acting .beta.2-adrenergic
agonists and long-acting .beta.2-adrenergic agonists (LABA),
anticholinergics, inhaled corticosteroids (ICSs), nonsteroidal
antiinflammatories, antibiotics and mucolytics. Devices that
deliver these drugs include pressurized metered-dose inhalers
(pMDIs), used either alone, or attached to spacers, or valved
holding chambers (VHCs), breathactuated (BA)-pMDIs, dry powder
inhalers (DPIs), jet nebulizers, vibrating mesh nebulizers and soft
mist inhalers. Well-established treatment guidelines for the
management of asthma and chronic obstructive pulmonary disease
(COPD) each recommend inhaled therapy as the primary route to
administer these medications. Treatment guidelines for cystic
fibrosis (CF) also include recommendations for inhalation of
aerosolized medications.
[0275] The antisense oligomers described herein may also be
delivered via an implantable device. Design of such a device is an
art-recognized process, with, e.g., synthetic implant design
described in, e.g., U.S. Pat. No. 6,969,400, the contents of which
are incorporated by reference.
[0276] Antisense oligomers can be introduced into cells using
art-recognized techniques (e.g., transfection, electroporation,
fusion, liposomes, colloidal polymeric particles and viral and
non-viral vectors as well as other means known in the art). The
method of delivery selected will depend at least on the oligomer
chemistry, the cells to be treated and the location of the cells
and will be apparent to the skilled artisan. For instance,
localization can be achieved by liposomes with specific markers on
the surface to direct the liposome, direct injection into tissue
containing target cells, specific receptor-mediated uptake, or the
like.
[0277] As known in the art, antisense oligomers may be delivered
using, e.g., methods involving liposome-mediated uptake, lipid
conjugates, polylysine-mediated uptake, nanoparticle-mediated
uptake, and receptor-mediated endocytosis, as well as additional
non-endocytic modes of delivery, such as microinjection,
permeabilization (e.g., streptolysin-O permeabilization, anionic
peptide permeabilization), electroporation, and various
non-invasive non-endocytic methods of delivery that are known in
the art (see, e. g., Dokka and Rojanasakul, Advanced Drug Delivery
Reviews 44:35-49, incorporated by reference in its entirety).
[0278] The antisense oligomers may be administered in any
convenient vehicle or carrier which is physiologically and/or
pharmaceutically acceptable. Such a composition may include any of
a variety of standard pharmaceutically acceptable carriers employed
by those of ordinary skill in the art. Examples include, but are
not limited to, saline, phosphate buffered saline (PBS), water,
aqueous ethanol, emulsions, such as oil/water emulsions or
triglyceride emulsions, tablets and capsules. The choice of
suitable physiologically acceptable carrier will vary dependent
upon the chosen mode of administration. "Pharmaceutically
acceptable carrier" is intended to include any and all solvents,
dispersion media, coatings, antibacterial and antifungal agents,
isotonic and absorption delaying agents, and the like, compatible
with pharmaceutical administration. The use of such media and
agents for pharmaceutically active substances is well known in the
art. Except insofar as any conventional media or agent is
incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions
[0279] The compounds (e.g., antisense oligomers, antimicrobial
agents) described herein may generally be utilized as the free acid
or free base. Alternatively, the compounds of this disclosure may
be used in the form of acid or base addition salts. Acid addition
salts of the free amino compounds of the present disclosure may be
prepared by methods well known in the art, and may be formed from
organic and inorganic acids. Suitable organic acids include maleic,
fumaric, benzoic, ascorbic, succinic, methanesulfonic, acetic,
trifluoroacetic, oxalic, propionic, tartaric, salicylic, citric,
gluconic, lactic, mandelic, cinnamic, aspartic, stearic, palmitic,
glycolic, glutamic, and benzenesulfonic acids.
[0280] Suitable inorganic acids include hydrochloric, hydrobromic,
sulfuric, phosphoric, and nitric acids. Base addition salts
included those salts that form with the carboxylate anion and
include salts formed with organic and inorganic cations such as
those chosen from the alkali and alkaline earth metals (for
example, lithium, sodium, potassium, magnesium, barium and
calcium), as well as the ammonium ion and substituted derivatives
thereof (for example, dibenzylammonium, benzylammonium,
2-hydroxyethylammonium, and the like). Thus, the term
"pharmaceutically acceptable salt" is intended to encompass any and
all acceptable salt forms.
[0281] In addition, prodrugs are also included within the context
of this disclosure. Prodrugs are any covalently bonded carriers
that release a compound in vivo when such prodrug is administered
to a patient. Prodrugs are generally prepared by modifying
functional groups in a way such that the modification is cleaved,
either by routine manipulation or in vivo, yielding the parent
compound. Prodrugs include, for example, compounds of this
disclosure wherein hydroxy, amine or sulfhydryl groups are bonded
to any group that, when administered to a patient, cleaves to form
the hydroxy, amine or sulfhydryl groups. Thus, representative
examples of prodrugs include (but are not limited to) acetate,
formate and benzoate derivatives of alcohol and amine functional
groups of the antisense oligomers of the disclosure. Further, in
the case of a carboxylic acid (--COOH), esters may be employed,
such as methyl esters, ethyl esters, and the like.
[0282] In some instances, liposomes may be employed to facilitate
uptake of the antisense oligomer into cells (see, e.g., Williams,
S. A., Leukemia 10(12):1980-1989, 1996; Lappalainen et al.,
Antiviral Res. 23:119, 1994; Uhlmann et al., antisense oligomers: a
new therapeutic principle, Chemical Reviews, Volume 90, No. 4, 25
pages 544-584, 1990; Gregoriadis, G., Chapter 14, Liposomes, Drug
Carriers in Biology and Medicine, pp. 287-341, Academic Press,
1979). Hydrogels may also be used as vehicles for antisense
oligomer administration, for example, as described in WO 93/01286.
Alternatively, the oligomers may be administered in microspheres or
microparticles. (See, e.g., Wu, G. Y. and Wu, C. H., J. Biol. Chem.
262:4429-4432, 30 1987). Alternatively, the use of gas-filled
microbubbles complexed with the antisense oligomers can enhance
delivery to target tissues, as described in U.S. Pat. No.
6,245,747. Sustained release compositions may also be used. These
may include semipermeable polymeric matrices in the form of shaped
articles such as films or microcapsules.
[0283] In certain embodiments, the antisense oligomer is
administered to a mammalian subject, e.g., human or domestic
animal, exhibiting the symptoms of a bacterial infection (e.g.,
antibiotic resistance or MDR bacterial infection), in a suitable
pharmaceutical carrier. In some aspects, the subject is a human
subject, e.g., a patient diagnosed as having a bacterial infection.
In particular embodiments, the antisense oligomer is contained in a
pharmaceutically acceptable carrier, and is delivered orally. In
some embodiments, the antisense oligomer is contained in a
pharmaceutically acceptable carrier, and is delivered intravenously
(i.v.).
[0284] In some embodiments, the antisense oligomer is administered
in an amount and manner effective to result in a peak blood
concentration of at least 200-400 nM antisense oligomer. Typically,
one or more doses of antisense oligomer are administered, generally
at regular intervals, for a period of about one to two weeks.
Certain doses for oral administration are from about 1-1000 mg
oligomer per 70 kg. In some cases, doses of greater than 1000 mg
oligomer/patient may be necessary. For i.v. administration, some
doses are from about 0.5 mg to 1000 mg oligomer per 70 kg. The
antisense oligomer may be administered at regular intervals for a
short time period, e.g., daily for two weeks or less. However, in
some cases the antisense oligomer is administered intermittently
over a longer period of time. Administration may be followed by, or
concurrent with, administration of an antimicrobial (e.g.,
antibiotic) or other therapeutic treatment, as described herein.
The treatment regimen may be adjusted (dose, frequency, route,
etc.) as indicated, based on the results of immunoassays, other
biochemical tests and physiological examination of the subject
under treatment.
[0285] An effective in vivo treatment regimen using the antisense
oligomers of the disclosure may vary according to the duration,
dose, frequency and route of administration, as well as the
condition of the subject under treatment (i.e., prophylactic
administration versus administration in response to localized or
systemic infection). Accordingly, such in vivo therapy will often
include monitoring by tests appropriate to the particular type of
disorder or bacterial infection under treatment, and corresponding
adjustments in the dose or treatment regimen, in order to achieve
an optimal therapeutic outcome.
[0286] Treatment may be monitored, e.g., by general indicators of
disease known in the art. The efficacy of an in vivo administered
antisense oligomer of the disclosure may be determined from
biological samples (tissue, blood, urine etc.) taken from a subject
prior to, during and subsequent to administration of the antisense
oligomer. Assays of such samples include (1) monitoring the
presence or absence of heteroduplex formation with target and
non-target sequences, using procedures known to those skilled in
the art, e.g., an electrophoretic gel mobility assay; (2)
monitoring the amount of a mutant mRNA in relation to a reference
normal mRNA or protein as determined by standard techniques such as
RT-PCR, Northern blotting, ELISA or Western blotting.
[0287] III. Combination Therapies
[0288] Certain embodiments include combination therapies, for
example, the administration of antisense oligomers in combination
with antimicrobial agents such as antibiotics. Combination
therapies can be employed, for example, to increase the sensitivity
or susceptibility of a given bacteria to one or more antimicrobial
agents, and thereby improve the therapeutic outcome (e.g.,
resolution of the infection). Likewise, certain combination
therapies can be employed, for example, to reduce or reverse the
antibiotic resistance of a given bacteria to one or more
antimicrobial agents. In particular embodiments, the antisense
oligomer reduces the minimum inhibitory concentration (MIC) of an
antibiotic against a bacterium. Also included are pharmaceutical
compositions, as described herein, which comprise an antisense
oligomer and an antimicrobial agent such as antibiotic.
[0289] In some embodiments, the antisense oligomer and the
antimicrobial agent are administered separately. In certain
embodiments, the antisense oligomer and the antimicrobial agent are
administered sequentially. In some embodiments, the antisense
oligomer and the antimicrobial agent are administered concurrently,
for example, as part of the same or different pharmaceutical
composition.
[0290] Examples of antimicrobial agents (e.g., antibiotics) that
can be administered in combination with an antisense oligomer
include beta-lactam antibiotics such as carbapenems, penicillin and
penicillin derivatives (or penams), cephalosporins (e.g.,
Cefacetrile (cephacetrile), Cefadroxil (cefadroxyl; Duricef),
Cephalexin (cefalexin; Keflex), Cefaloglycin (cephaloglycin),
Cefalonium (cephalonium), Cefaloridine (cephaloradine), Cefalotin
(cephalothin; Keflin), Cefapirin (cephapirin; Cefadryl),
Cefatrizine, Cefazaflur, Cefazedone, Cefazolin (cephazolin; Ancef,
Kefzol), Cefradine (cephradine; Velosef), Cefroxadine, Ceftezole,
Cefaclor (Ceclor, Distaclor, Keflor, Raniclor), Cefonicid
(Monocid), Cefprozil (cefproxil; Cefzil), Cefuroxime (Zefu, Zinnat,
Zinacef, Ceftin, Biofuroksym, Xorimax), Cefuzonam, Cefmetazole,
Cefotetan, Cefoxitin, loracarbef (Lorabid); Cephamycins:
cefbuperazone, cefmetazole (Zefazone), cefminox, cefotetan
(Cefotan), cefoxitin (Mefoxin), Cefotiam (Pansporin), Cefcapene,
Cefdaloxime, Cefdinir (Sefdin, Zinir, Omnicef, Kefnir), Cefditoren,
Cefetamet, Cefixime (Fixx, Zifi, Suprax), Cefmenoxime, Cefodizime,
Cefotaxime (Claforan), Cefovecin (Convenia), Cefpimizole,
Cefpodoxime (Vantin, PECEF), Cefteram, Ceftibuten (Cedax),
Ceftiofur, Ceftiolene, Ceftizoxime (Cefizox), Ceftriaxone
(Rocephin), Cefoperazone (Cefobid), Ceftazidime (Meezat, Fortum,
Fortaz), latamoxef (moxalactam), Cefclidine, cefepime (Maxipime),
cefluprenam, cefoselis, Cefozopran, Cefpirome (Cefrom), Cefquinome,
flomoxef, Ceftobiprole, Ceftaroline, Cefaloram, Cefaparole,
Cefcanel, Cefedrolor, Cefempidone, Cefetrizole, Cefivitril,
Cefmatilen, Cefmepidium, Cefoxazole, Cefrotil, Cefsumide,
Ceftioxide, Cefuracetime), and monobactams (e.g., aztreonam,
tigemonam, nocardin A, tabtoxin); aminoglycosides such as
tobramycin, gentamicin, kanamycin a, amikacin, dibekacin,
sisomicin, netilmicin, neomycin B, neomycin C, neomycin E
(paromomycin), and streptomycin; tetracyclines such as
tetracycline, chlortetracycline, oxytetracycline, demeclocycline,
lymecycline, meclocycline, methacycline, minocycline,
rolitetracycline, and doxycyline; sulfonamides such as
sulfacetamide, sulfadiazine, sulfadimidine, sulfafurazole,
sulfisomidine, sulfadoxine, sulfamethoxazole, sulfamoxole,
sulfadimethoxine, sulfamethoxypyridazine, sulfametoxydiazine,
sulfadoxine, and sulfametopyrazine; quinolones such as cinoxacin,
nalidixic acid, oxolinic acid (Uroxin), piromidic acid (Panacid),
pipemidic acid (Dolcol) rosoxacin (Eradacil), ciprofloxacin
(Alcipro, Ciprobay, Cipro, Ciproxin, ultracipro), enoxacin
(Enroxil, Penetrex), fleroxacin (Megalone, Roquinol), lomefloxacin
(Maxaquin), nadifloxacin (Acuatim, Nadoxin, Nadixa), norfloxacin
(Lexinor, Noroxin, Quinabic, Janacin), ofloxacin (Floxin, Oxaldin,
Tarivid), pefloxacin (Peflacine), rufloxacin (Uroflox),
balofloxacin (Baloxin), grepafloxacin (Raxar), levofloxacin
(Cravit, Levaquin, Tavanic), pazufloxacin (Pasil, Pazucross),
sparfloxacin (Zagam), temafloxacin (Omniflox), tosufloxacin (Ozex,
Tosacin), clinafloxacin, gatifloxacin (Zigat, Tequin)
(Zymar-opth.), gemifloxacin (Factive), moxifloxacin (Acflox
Woodward, Avelox, Vigamox, sitafloxacin (Gracevit), trovafloxacin
(Trovan), prulifloxacin (Quisnon); oxazolidinones such as
eperezolid, linezolid, posizolid, radezolid, ranbezolid, sutezolid,
and tedizolid; polymyxins such as polysporin, neosporin, polymyxin
B, polymyxin E (colistin); rifamycins such as rifampicin or
rifampin, rifabutin, rifapentine, and rifaximin; lipiarmycins such
as fidaxomicin; macrolides such as azithromycin, clarithromycin,
dirithromycin, erythromycin, roxithromycin, telithromycin,
carbomycin A, josamycin, kitasamycin, midecamycin/midecamycin
acetate, oleandomycin, solithromycin, spiramycin, and
troleandomycin; lincosamides such as lincomycin, clindamycin, and
pirlimycin; cyclic lipopeptides such as daptomycin; glycopeptides
such as vancomycin and teichoplanin; glycylcyclines such as
tigecycline. Thus, any one or more of the foregoing antibiotics can
be combined with any of the antisense oligomers described herein,
for the treatment of any of the bacteria described herein.
[0291] In some embodiments, the antimicrobial agent is a
beta-lactam antibiotic, as described herein. In certain of these
and related embodiments, the bacterium comprises or expresses a
beta-lactamase such as NDM-1, KPC or KPC 1-4, and the antisense
oligomer is targeted against the beta-lactamase. In particular
embodiments, the antimicrobial agent is a carbapenem. Examples of
carbapenems include meropenem, imipenem, ertapenem, doripenem,
panipenem, biapenem, razupenem, tebipenem, lenapenem, and
tomopenem. In certain of these and related embodiments, the
bacterium comprises or expresses a carbapenemase such as NDM-1, KPC
or KPC 1-4, and the antisense oligomer is targeted against the
carbapenemase. In specific embodiments, the bacterium is
Escherichia coli, Acinetobacter baumannii, or Klebsiella
pneumoniae.
[0292] In some embodiments, the antimicrobial agent is an
aminoglycoside such as tobramycin or gentamicin or a tetracycline,
as described herein. In some of these and related embodiments, the
bacterium comprises or expresses the antibiotic resistance gene
adeA, and the antisense oligomer is targeted against the antibiotic
resistance gene. In specific embodiments, the bacterium is
Escherichia coli, Acinetobacter baumannii, or Klebsiella
pneumoniae.
[0293] In some embodiments, the antimicrobial agent can be any
antibiotic, such as, but not limited to, beta-lactams,
aminoglycosides, tetracyclines, sulfonamides, quinolones,
oxazolidinones, polymyxins, rifamycins, macrolides, lincosamides,
cyclic lipopeptides, glycopeptides, glycylcyclines, or other
antibiotics, as described herein. In certain of these and related
embodiments, the bacterium comprises or expresses a porin such as
OmpA, and the antisense oligomer is targeted against the porin. In
particular embodiments, the antimicrobial agent comprises
Clindamycin, Piperacillin-tazobactam, Doxycycline, Chloramphenicol,
Fusidic acid, Oxacillin, Erythromycin and/or Trimethoprim.
[0294] In some embodiments, the antimicrobial agent is can be any
antibiotic, such as, but not limited to, beta-lactams,
aminoglycosides, tetracyclines, sulfonamides, quinolones,
oxazolidinones, polymyxins, rifamycins, macrolides, lincosamides,
cyclic lipopeptides, glycopeptides, glycylcyclines, or other
antibiotics, as described herein. In certain of these and related
embodiments, the bacterium comprises or expresses a protein
associated with a multi-drug efflux pump such as AcrA, AcrB, AcrR
or ToIC, and the antisense oligomer is targeted against the protein
associated with a multi-drug efflux pump or the function of a
multi-drug efflux pump. In particular embodiments, the
antimicrobial agent comprises Clindamycin, Piperacillin-tazobactam,
Doxycycline, Chloramphenicol, Fusidic acid, Oxacillin, Erythromycin
and/or Trimethoprim.
[0295] In certain embodiments, the antimicrobial agent includes one
or more of ceftazidime, doxycycline, piperacillin, meropenem,
chloramphenicol, and/or co-trimoxazole
(trimethoprim/sulfamethoxazole). In some of these and related
embodiments, the bacterium is a Burkholderia species that comprises
or expresses one or more biofilm formation genes such as cepl,
cepR, and/or suhB, and the antisense oligomer is targeted against
the biofilm formation gene(s). In specific embodiments, the
bacterium is Burkholderia cepacia or a Burkholderia cepacia
complex. In specific embodiments, the subject is immunocompromised
and has an underlying lung disease, such as cystic fibrosis (CF) or
chronic granulomatous disease (CGD).
[0296] In certain embodiments, the antimicrobial agent includes one
or more of ceftazidime, doxycycline, piperacillin, minocycline,
meropenem, chloramphenicol, and/or co-trimoxazole
(trimethoprim/sulfamethoxazole). In some of these and related
embodiments, the bacterium is a Acinetobacter species that
comprises or expresses one or more biofilm formation genes such as
CsuE, SecA, Pg1L, and/or Pi/U1, and the antisense oligomer is
targeted against the biofilm formation gene(s). In specific
embodiments, the bacterium is Acinetobacter baumannii.
[0297] In certain embodiments, the antimicrobial agent includes one
or more of ceftazidime, doxycycline, piperacillin, minocycline,
meropenem, chloramphenicol, and/or co-trimoxazole
(trimethoprim/sulfamethoxazole). In some of these and related
embodiments, the bacterium is a Pseudomonas species that comprises
or expresses one or more biofilm formation genes such as AlgZ,
AlgU, LasR, FleR and/or PelF, and the antisense oligomer is
targeted against the biofilm formation gene(s). In specific
embodiments, the bacterium is Pseudomonas aeruginosa.
[0298] In certain embodiments, the antimicrobial agent includes one
or more of ceftazidime, doxycycline, piperacillin, minocycline,
meropenem, chloramphenicol, and/or co-trimoxazole
(trimethoprim/sulfamethoxazole). In some of these and related
embodiments, the bacterium is a Acinetobacter species that
comprises or expresses one or more essential genes such as RpoD,
and the antisense oligomer is targeted against the essential gene.
In specific embodiments, the bacterium is Acinetobacter
baumannii.
[0299] In certain embodiments, the antimicrobial agent includes one
or more of ceftazidime, doxycycline, piperacillin, minocycline,
meropenem, chloramphenicol, and/or co-trimoxazole
(trimethoprim/sulfamethoxazole). In some of these and related
embodiments, the bacterium is a Pseudomonas species that comprises
or expresses one or more essential genes such as PoIB, and the
antisense oligomer is targeted against the essential gene. In
specific embodiments, the bacterium is Pseudomonas aeruginosa.
[0300] In some embodiments, the antisense oligomer increases the
sensitivity of a given bacteria to the antimicrobial agent,
relative to the antimicrobial agent alone. For example, in certain
embodiments, the antisense oligomer increases the sensitivity of
the bacterium to the antimicrobial agent by increasing the
bactericidal (cell-killing) and/or bacteriostatic (growth-slowing)
activity of the antimicrobial agent against the bacterium being
targeted, relative to the antimicrobial agent alone. In particular
embodiments, the antisense increases the sensitivity by about or at
least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500,
600, 700, 800, 900, or 1000% or more (including all integers and
ranges in between), relative to the antimicrobial agent alone, or
by about or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100-fold
or more (including all integers and ranges in between), relative to
the antimicrobial agent alone.
[0301] In some embodiments, the antisense oligomer reduces the
minimum inhibitory concentration (MIC) of an antimicrobial agent
against the bacterium being targeted, relative to the antimicrobial
agent alone. The "minimum inhibitory concentration" or "MIC" refers
to the lowest concentration of an antimicrobial agent that will
inhibit the visible growth of a microorganism after overnight (in
vitro) incubation. Minimum inhibitory concentrations are important
in diagnostic laboratories to confirm resistance of microorganisms
to an antimicrobial agent and also to monitor the activity of new
antimicrobial agents. The MIC is generally regarded as the most
basic laboratory measurement of the activity of an antimicrobial
agent against a bacterial organism. Thus, in certain embodiments,
the oligomer reduces the minimum inhibitory concentration (MIC) of
an antimicrobial agent against the bacterium by at least about 5,
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,
95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800,
900, or 1000% or more (including all integers and ranges in
between), relative to the antimicrobial agent alone. In certain
embodiments, the oligomer reduces the minimum inhibitory
concentration (MIC) of an antimicrobial agent against the bacterium
by about or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100-fold
or more (including all integers and ranges in between), relative to
the antimicrobial agent alone.
[0302] In some embodiments, the antisense oligomer that increases
the sensitivity or reduces the MIC is targeted against NDM-1, the
bacterium is Escherichia coli, Acinetobacter baumannii, or
Klebsiella pneumoniae that comprises or expresses NDM-1, and the
antimicrobial agent is a carbapenem such as meropenem, imipenem,
ertapenem, doripenem, panipenem, biapenem, razupenem, tebipenem,
lenapenem, or tomopenem.
[0303] In some embodiments, the antisense oligomer that increases
the sensitivity or reduces the MIC is targeted against KPC or KPC
1-4, the bacterium is Escherichia coli, Acinetobacter baumannii, or
Klebsiella pneumoniae that comprises or expresses KPC or KPC 1-4,
and the antimicrobial agent is a carbapenem such as meropenem,
imipenem, ertapenem, doripenem, panipenem, biapenem, razupenem,
tebipenem, lenapenem, or tomopenem.
[0304] In some embodiments, the antisense oligomer that increases
the sensitivity or reduces the MIC is targeted against OmpA, the
bacterium is Escherichia coli, Acinetobacter baumannii, or
Klebsiella pneumoniae that comprises or expresses OmpA, and the
antimicrobial agent is any antibiotic, such as, but not limited to,
beta-lactams, aminoglycosides, tetracyclines, sulfonamides,
quinolones, oxazolidinones, polymyxins, rifamycins, macrolides,
lincosamides, cyclic lipopeptides, glycopeptides, glycylcyclines,
or other antibiotics, as described herein. In particular
embodiments, the antimicrobial agent comprises Clindamycin,
Piperacillin-tazobactam, Doxycycline, Chloramphenicol, Fusidic
acid, Oxacillin, Erythromycin and/or Trimethoprim.
[0305] In some embodiments, the antisense oligomer that increases
the sensitivity or reduces the MIC is targeted against AcrA, AcrB,
AcrR or ToIC, the bacterium is Escherichia coli, Acinetobacter
baumannii, or Klebsiella pneumoniae that comprises or expresses
AcrA, AcrB, AcrR or ToIC, and the antimicrobial agent is any
antibiotic, such as, but not limited to, beta-lactams,
aminoglycosides, tetracyclines, sulfonamides, quinolones,
oxazolidinones, polymyxins, rifamycins, macrolides, lincosamides,
cyclic lipopeptides, glycopeptides, glycylcyclines, or other
antibiotics, as described herein. In particular embodiments, the
antimicrobial agent comprises Clindamycin, Piperacillin-tazobactam,
Doxycycline, Chloramphenicol, Fusidic acid, Oxacillin, Erythromycin
and/or Trimethoprim.
[0306] In particular embodiments, the antisense oligomer that
increases the sensitivity or reduces the MIC is targeted against
adeA, the bacterium is Escherichia coli, Acinetobacter baumannii,
or Klebsiella pneumoniae that comprises or expresses adeA, and the
antimicrobial agent is an aminoglycoside antibiotic (e.g.,
tobramycin, gentamicin, kanamycin a, amikacin, dibekacin,
sisomicin, netilmicin, neomycin B, neomycin C, neomycin E
(paromomycin), streptomycin), a tetracycline antibiotic (e.g.,
tetracycline, chlortetracycline, oxytetracycline, demeclocycline,
lymecycline, meclocycline, methacycline, minocycline,
rolitetracycline, doxycyline), or a .beta.-lactam antibiotic (e.g.,
carbapenem, penicillin derivative (penam), cephalosporin (cephem),
monobactam).
[0307] In particular embodiments, the antisense oligomer that
increases the sensitivity or reduces the MIC is targeted against
cepl, the bacterium is a Burkholderia species, for example,
Burkholderia cepacia (complex) or a sub-species thereof (e.g.,
Burkholderia cenocepacia, Burkholderia multivorans, Burkholderia
vietnamiensis, Burkholderia stabilis, Burkholderia an thin a,
Burkholderia pyrrocinia, Burkholderia dolosa, Burkholderia
ambifaria), which comprises or expresses cepl, and the
antimicrobial agent is selected from one or more of ceftazidime,
doxycycline, piperacillin, meropenem, chloramphenicol, and
co-trimoxazole (trimethoprim/sulfamethoxazole).
[0308] In particular embodiments, the antisense oligomer that
increases the sensitivity or reduces the MIC is targeted against
suhB, the bacterium is a Burkholderia species, for example,
Burkholderia cepacia (complex) or a sub-species thereof (e.g.,
Burkholderia cenocepacia, Burkholderia multivorans, Burkholderia
vietnamiensis, Burkholderia stabilis, Burkholderia an thin a,
Burkholderia pyrrocinia, Burkholderia dolosa, Burkholderia
ambifaria), which comprises or expresses suhB, and the
antimicrobial agent is selected from one or more of ceftazidime,
doxycycline, piperacillin, meropenem, chloramphenicol, and
co-trimoxazole (trimethoprim/sulfamethoxazole).
[0309] In particular embodiments, the antisense oligomer that
increases the sensitivity or reduces the MIC is targeted against
CsuE, SecA, Pg1L or Pi/U1, the bacterium is an Acinetobacter
species, for example, Acinetobacter baumannii, which comprises or
expresses CsuE, SecA, Pg1L or PilU1, and the antimicrobial agent is
selected from one or more of ceftazidime, doxycycline,
piperacillin, minocycline, meropenem, chloramphenicol, and
co-trimoxazole (trimethoprim/sulfamethoxazole).
[0310] In particular embodiments, the antisense oligomer that
increases the sensitivity or reduces the MIC is targeted against
AlgZ, AlgU, LasR, FleR or PelF, the bacterium is a Pseudomonas
species, for example, Pseudomonas aeruginosa, which comprises or
expresses AlgZ, AlgU, LasR, FleR or PelF, and the antimicrobial
agent is selected from one or more of ceftazidime, doxycycline,
piperacillin, minocycline, meropenem, chloramphenicol, and
co-trimoxazole (trimethoprim/sulfamethoxazole).
[0311] In particular embodiments, the antisense oligomer that
increases the sensitivity or reduces the MIC is targeted against
RpoD, the bacterium is an Acinetobacter species, for example,
Acinetobacter baumannii, which comprises or expresses RpoD, and the
antimicrobial agent is selected from one or more of ceftazidime,
doxycycline, piperacillin, minocycline, meropenem, chloramphenicol,
and co-trimoxazole (trimethoprim/sulfamethoxazole).
[0312] In particular embodiments, the antisense oligomer that
increases the sensitivity or reduces the MIC is targeted against
PoIB, the bacterium is a Pseudomonas species, for example,
Pseudomonas aeruginosa, which comprises or expresses PoIB, and the
antimicrobial agent is selected from one or more of ceftazidime,
doxycycline, piperacillin, minocycline, meropenem, chloramphenicol,
and co-trimoxazole (trimethoprim/sulfamethoxazole).
[0313] IV. Treatment Monitoring Methods
[0314] The efficacy of a given therapeutic regimen involving the
methods described herein may be monitored, for example, by general
indicators of bacterial infection, such as complete blood count
(CBC), nucleic acid detection methods, immunodiagnostic tests, or
bacterial culture.
[0315] In some aspects, identification and monitoring of bacterial
infection involves one or more of (1) nucleic acid detection
methods, (2) serological detection methods, i.e., conventional
immunoassay, (3) culture methods, and (4) biochemical methods. Such
methods may be qualitative or quantitative.
[0316] Nucleic acid probes may be designed based on publicly
available bacterial nucleic acid sequences, and used to detect
target genes or metabolites (i.e., toxins) indicative of bacterial
infection, which may be specific to a particular bacterial type,
e.g., a particular species or strain, or common to more than one
species or type of bacteria (i.e., Gram positive or Gram negative
bacteria). Nucleic amplification tests (e.g., PCR) may also be used
in such detection methods.
[0317] Serological identification may be accomplished using a
bacterial sample or culture isolated from a biological specimen,
e.g., stool, urine, cerebrospinal fluid, blood, etc. Immunoassay
for the detection of bacteria is generally carried out by methods
routinely employed by those of skill in the art, e.g., ELISA or
Western blot. In addition, monoclonal antibodies specific to
particular bacterial strains or species are often commercially
available.
[0318] Culture methods may be used to isolate and identify
particular types of bacteria, by employing techniques including,
but not limited to, aerobic versus anaerobic culture, growth and
morphology under various culture conditions. Exemplary biochemical
tests include Gram stain (Gram, 1884; Gram positive bacteria stain
dark blue, and Gram negative stain red), enzymatic analyses, and
phage typing.
[0319] It will be understood that the exact nature of such
diagnostic, and quantitative tests as well as other physiological
factors indicative of bacterial infection will vary dependent upon
the bacterial target, the condition being treated and whether the
treatment is prophylactic or therapeutic.
[0320] In cases where the subject has been diagnosed as having a
particular type of bacterial infection, the status of the bacterial
infection is also monitored using diagnostic techniques typically
used by those of skill in the art to monitor the particular type of
bacterial infection under treatment.
[0321] The PMO or PPMO treatment regimen may be adjusted (dose,
frequency, route, etc.), as indicated, based on the results of
immunoassays, other biochemical tests and physiological examination
of the subject under treatment.
[0322] From the foregoing, it will be appreciated how various
objects and features of the disclosure are met. The method provides
an improvement in therapy against bacterial infection, for example,
multi-drug resistant (MDR) bacteria and/or biofilm-forming
bacteria, using anti-virulence antisense oligomers to achieve
enhanced cell uptake and anti-bacterial action. As a result, drug
therapy is more effective and less expensive, both in terms of cost
and amount of compound required.
[0323] One exemplary of the disclosure is that compounds effective
against virtually any pathogenic bacterial can be readily designed
and tested, e.g., for rapid response against new drug-resistant
strains.
[0324] The following examples are intended to illustrate but not to
limit the disclosure. Each of the patent and non-patent references
referred to herein is incorporated by reference in its
entirety.
EXAMPLES
Example 1
Development of Genus- and Gene-Specific PPMOs Against Specific
Virulence Genes in the Multidrug-Resistant Pathogens Acinetobacter
baumannii and Pseudomonas aeruginosa
[0325] Given the importance that biofilm plays in pathogenesis of
infection, various biofilm or quorum-sensing genes were targets for
PPMO development. While a number of PPMO targets were created and
tested for their ability to inhibit Acinetobacter biofilm
formation, the PPMO designed against CsuE was found to be most
potent with over 83% of strains tested having a 50% or greater
reduction in biofilm at a concentration of 8 .mu.M (FIG. 2). This
protein has been previously shown to play a role in attachment to
surfaces and the development of biofilm. Most of the strains tested
had a significantly greater reduction in biofilm formation at the
target 8 .mu.M concentration given as a single dose. Importantly
for the development of PPMOs, activity is not linked to the
underlying level of antibiotic resistance that a particular strain
possesses. PPMO activity has been demonstrated in
multidrug-resistant strains (such as A. baumannii AYE; FIG. 2) to
the same or greater degree as drug-sensitive strains. The reduction
in biofilm was frequently significantly greater than 50% and showed
a dose-dependent response (FIG. 3). For example, in an NDM-1
positive A. baumannii strain (AB NDM-1) there was a greater than
80% reduction in biofilm at a concentration of 8 .mu.M. Similar
findings were observed in A. baumannii AYE, and these strains had a
greater than 50% reduction in biofilm at 4 .mu.M.
[0326] For Pseudomonas aeruginosa, genes that were known to be
involved in biofilm and quorum sensing were also targeted.
Polymyxin B nonapeptide (PMBN) was used at sub-inhibitory
concentrations to enhance delivery of PPMOs in Pseudomonas. PPMOs
in both standard genome sequenced laboratory strains (such as PAO1)
as well as in clinical multidrug-resistant strains from patients
with CF were tested. FIG. 4 shows the heatmap of the lead PPMOs.
For Pseudomonas, there were 3 potential leads targeting the genes
AlgZ, AlgU and LasR. These three gene targets have been shown
previously to be important in the formation of biofilm, and the
results developing PPMOs against these targets confirm this. 80% of
strains tested had at least a 50% reduction in biofilm at 18 hours
compared to no treatment. Concentrations needed to inhibit biofilm
by at least 50% ranged from 8 .mu.M to 0.5 .mu.M. Scrambled
sequence PPMOs did not significantly alter biofilm formation nor
did PMBN alone.
[0327] As was seen in Acinetobacter, the reduction in biofilm was
dose-dependent (FIG. 5). In 3 strains that were tested, the AlgZ
PPMO #27 had a greater that 75% reduction in biofilm at both 4 and
8 .mu.M. The LasR PPMO #29 and AlgU PPMO #28 also demonstrated a
significantly larger reduction in biofilm at 8 .mu.M that was
greater than 50%.
[0328] MBEC pegs and confocal microscopy can be used to visualize
the biofilms themselves. An example of this is shown in FIGS.
6A-6D, where a GFP-expressing P. aeruginosa PAO1 strain and a stain
for biofilm were used to demonstrate the activity of a couple of
the lead PPMOs. As can be seen in FIGS. 6A-6D, in the presence of
PMBN alone (FIG. 6A) or the Scrambled PPMO (FIG. 6B), robust and
thick biofilm is formed at 18 hours. However, when incubated with
either the LasR PPMO #29 (FIG. 6C) or the AlgZ PPMO #27 (FIG. 6D),
there is a decrease in the overall mass of the biofilm.
Importantly, this occurred after just a single dose administration
of PPMO. Animal studies, along with further dosing and kinetic
studies, will be done to assess the impact on biofilm formation
over time as well as studies on dosing in the setting of existing
biofilms.
Example 2
PPMOs Targeted to Antibiotic Resistance Genes
[0329] PPMOs were designed, synthesized and tested that target two
of the most troublesome resistance genes, New Delhi metallo beta
lactamase (NDM-1) and Klebsiella pneumoniae carbapenemase (KPC). It
was found that 2 PPMOs were extremely effective in reducing the MIC
of meropenem and imipenem in NDM-1 strains. The data show that 4
.mu.M of NDM-1 PPMO #18 reduced the MIC of meropenem from 64 to 4
.mu.g/ml (FIG. 7A). The CLSI breakpoint for meropenem in K.
pneumoniae is 8 .mu.g/ml. Another PPMO targeted to NDM-1 (PPMO #19)
was similarly effective, and allowed meropenem to reduce viability
by more than 4 orders of magnitude at 8 .mu.g/ml (FIG. 7B). A
similar reduction in MIC of meropenem was seen in other strains of
K. pneumoniae. Importantly, these PPMOs are targeted to a region of
the NDM-1 gene that is highly conserved across other variations of
NDM, so they should be effective against strains that express the
other known variations of NDM.
[0330] Two PPMOs targeted to different regions of the KPC
carbapenemase gene restored susceptibility of K. pneumoniae to
meropenem (FIGS. 8A-8D). The data show that 4 .mu.M of KPC PPMO #14
reduced the MIC of meropenem from 32 to 0.5 .mu.g/ml, and that 2
.mu.M PPMO plus 1 .mu.g/ml meropenem reduced growth by over 2
orders of magnitude (FIGS. 8A and 8B). KPC PPMO #13 had a similar
potency (FIGS. 8C and 8D). Similar results were achieved with PPMO
#35 as compared to PPMO #14 as shown in the table below.
TABLE-US-00009 Potency of PPMO#14 vs PPMO#35 Relative Potency
(.mu.M.sup.-1) with meropenem K. pneumoniae strain PPMO#14 PPMO#35
15410 2 4 OR1 1 2 OR13 2 0.5
Example 3
Preliminary Animal Tests
[0331] The NDM-1 PPMO #18 was tested in a mouse model of sepsis,
using a strain of E. coli that expresses NDM-1. Mice were infected
and treated by intraperitoneal injection of a freshly-prepared
mixture of E. coli CVB-1 and NDM-1 PPMO (100 .mu.g). Meropenem was
then immediately administered subcutaneously. Treatments were
administered every 6 h post-infection for the first 24 h, and the
mice were monitored for survival for 7 days (FIG. 9a). The results
show 92% survival of the mice treated concomitantly with PPMO and
meropenem. This is a significant increase compared to mice treated
with either PPMO or meropenem separately, or with co-administration
of a scrambled PPMO (Scr) and meropenem, all of which died by 18 h
(FIG. 9b). The mice treated with both NDM-1 PPMO and meropenem were
healthier, as assessed by body temperature (FIG. 9c), and had
significantly less bacterial burden in the bloodstream (FIG. 9d)
and spleen.
[0332] The dose of PPMO was reduced to 33, 11, or 4 .mu.g. The
morbidity and mortality of the mice was inversely proportional to
the dose of PPMO (FIG. 9e-9g). Co-treatment with 33 .mu.g of PPMO
and 1 mg meropenem was sufficient to protect over 75% of the
infected mice (FIG. 9e and FIG. 9f) and significantly decreased the
viable bacteria in the blood (FIG. 9g). Lesser amounts of PPMO were
less effective but still demonstrated significant improvement in
survival as compared to the two negative controls. These data
indicate that the PPMO increased bacterial susceptibility to
antibiotic killing in vivo in a dose-dependent fashion.
[0333] To determine whether PPMO could be used effectively as a
delayed therapy, mice were infected as described above and then
treated with both meropenem (subcutaneously) and 250 .mu.g PPMO
(intraperitoneally) at 0.5 h or 1 h after infection and every 6 h
thereafter for 24 h. When treatment was delayed 0.5 h
post-infection, the administration of meropenem and PPMO was able
to rescue 75% of the mice (FIG. 9h), a significant effect compared
to the treatments given the control groups. Treatment delayed 1 h
was not statistically significant, but there was a trend toward an
increase in mean time to death (14.86 h.+-.2.454) as compared to
the Scr PPMO with meropenem treated group (11.29 h.+-.0.7469).
These in vivo data demonstrate that NDM-1 PPMO can be used
therapeutically and have a protective effect when administered
concurrently with meropenem.
Example 4
PPMOs Targeted to Antibiotic Resistance Genes AcrA, AcrB, AcrR and
ToIC Reduce the MIC of Piperacillin-Tazobactam (PT)
[0334] PPMOs were designed, synthesized and tested that target the
AcrA, AcrB, AcrR and ToIC multi-drug efflux pump genes of E. coli.
E. coli were treated with PPMOs co-incubated with
piperacillin-tazobactam (PT) (FIGS. 10A-10E) and MIC values were
determined for PT with either active or scrambled PPMOs. Scrambled
PPMOs had no effect on the MIC of PT (FIG. 10A), while addition of
active PPMOs targeted against AcrA (PPMOs #3, #4, #5, FIG. 10B),
AcrB (PPMOs #6 and #8, FIG. 10C), AcrR (PPMO #9, FIG. 10D) and ToIC
(PPMO #11, FIG. 10E) reduced the MIC of PT by 2-8 fold depending on
the PPMO tested.
Example 5
acrA, acrB, and tolC: Antibiotic Hypersensitivity
[0335] The AcrAB-ToIC efflux pump complex is among the
best-characterized efflux pumps in E. coli and is composed of AcrB,
the inner membrane antiporter, AcrA, the periplasmic adaptor
protein, and ToIC, the outer membrane channel. Deleting or
silencing acrB or the two other genes (acrA and to/C) that form the
AcrA-AcrB-ToIC efflux pump complex (FIG. 11A) in E. coli may
decrease the intrinsic antibiotic resistance of E. coli.
[0336] Three PPMOs were designed to target the acrA, acrB and to/C
mRNAs respectively (FIG. 11B, FIG. 11C). These PPMOs are 11-base
oligomers that are conjugated to a membrane penetrating peptide
(acrA PPMO #3, acrB PPMO #8 and tolC PPMO #10). The efficacy of
these PPMOs was tested by measuring E. coli minimum inhibitory
concentration (MIC) for several antibiotics in the presence of
PPMOs (FIG. 11D and FIG. 12). As depicted in FIG. 12 (solid
squares), acrA PPMO, acrB PPMO and tolC PPMO each induced
antibiotic sensitivity to E. coli cells. FIG. 11D demonstrates the
effect of 10 .mu.M acrA PPMO when used with clindamycin;
clindamycin resistance decreased by .sup..about.16-fold (FIG. 11D,
solid squares). The deletion of the acrA gene reduced clindamycin
resistance by .sup..about.32-fold (FIG. 11D, triangles).
Example 6
acrA-PPMO Blocks AcrA Translation in a Dose Dependent Manner and
Reduces Resistance to Several Antibiotics
[0337] acrA silencing was quantified by measuring the AcrA
expression in E. coli using increasing concentrations of acrA PPMO
(FIG. 13A). The expression of AcrA in E. coli decreased nearly
thirty-fold at acrA PPMO concentrations greater than 2 .mu.M. This
effect was verified by measuring growth rates of E. coli cells at
different sub-lethal clindamycin concentrations using increasing
concentrations of acrA PPMO. Growth of E. coli cells in constant
clindamycin doses gradually slowed down as acrA PPMO concentration
was increased, indicating that clindamycin sensitivity was
correlated with the AcrA expression in bacterial cells (FIG. 13A,
bottom panel).
[0338] Targeting the acrA gene with the acrA PPMO decreased
resistance of E. coli against eleven antibiotics (FIG. 13B, FIG.
13C). The sensitization effect varied between a 2- and 40-fold
reduction (FIG. 13C). Importantly, the sensitization effect of acrA
PPMO was specific to E. coli. The efficacy of acrA PPMO against
Burkholderia cenocepacia (K56-2), E. coli (BW25113), and Klebsiella
pneumoniae (F45153) was tested by incubating bacterial cells in
increasing concentrations of piperacillin-tazobactam using 10 .mu.M
acrA PPMO and counting colony forming units (CFUs) after 18 hours
of antibiotic exposure. At sub-lethal doses (MIC/4) of
piperacillin-tazobactam, the number of CFUs decreased by
.sup..about.10.sup.6-fold when acrA PPMO was present (FIG. 13D,
left). A similar sensitization effect was seen with acrA PPMO
against Klebsiella pneumoniae, which shares the exact same acrA
sequence with E. coli (FIG. 13D, middle). Without wishing to be
bound by any particular theory, the acrA PPMO had no activity
against Burkholderia cenocepacia may be because of sequence
dissimilarity (FIG. 11C and FIG. 13D). Finally, the toxicity of
acrA PPMO against mammalian cells using the HBEC3KT viability assay
was tested and no toxicity was found (FIG. 13E). These observations
provide clear evidence that acrA PPMO is a promising agent that
works as an efficient antibiotic-enhancer molecule by blocking the
formation of AcrAB-ToIC efflux pump in a species-specific way.
Example 7
Using acrA-PPMO Together with Antibiotic Pairs is a Promising
Strategy, Rescuing Even the Activity of Antagonistic
Antibiotics
[0339] The acrA PPMO was tested together with antibiotic pairs in
order to amplify the antimicrobial activity of antibiotic pairs.
Using antibiotics in combination is generally considered a
promising strategy for using antibiotic compounds more effectively.
Antibiotic therapies that combine synergistic drug pairs are
justifiably favored in clinical practice. However, this requirement
limits the number of drug combinations that can be used in clinical
practice, as higher doses of drugs are required for clinical
efficacy. In addition, when used together, several synergistic
antibiotic pairs are expected to promote evolution of multidrug
resistance since they have overlapping resistance mechanisms.
Therefore, strategies that could rescue the use of antagonistic
drug combinations will be a great advancement in medicine. The
present disclosure demonstrates that sensitizing bacteria against
antibiotics by silencing resistance genes can compensate for the
antagonized activity of drug combinations and therefore allow the
use of antagonistic pairs in combination therapies.
[0340] Pairwise interactions were quantified between trimethoprim,
sulfamethoxazole, and piperacillin-tazobactam in the presence and
absence of acrA PPMO (FIG. 14A). Trimethoprim is an antifolate drug
that blocks the activity of the dihydrofolate reductase enzyme.
Trimethoprim is often used together with sulfamethoxazole (another
antifolate) due to their synergistic interaction. Conversely, using
trimethoprim with piperacillin-tazobactam is problematic since
these two drugs antagonize each other's activities. Two-dimensional
gradients of trimethoprim and sulfamethoxazole (FIG. 14A-left), and
trimethoprim and piperacillin-tazobactam (FIG. 14A-right), were
created and MIC values were measured for the wild type E. coli
strain in the presence (FIG. 14A, triangles) and absence (FIG. 14A,
circles) of acrA PPMO; the MIC values were also measured for the E.
coli strain with acrA deletion (FIG. 14A, squares). The efficacies
of drug combinations were compared by calculating the areas under
the MIC curves (AUC, FIG. 14B). acrA PPMO increased the efficacy of
both drug combinations by approximately five-fold and fifteen-fold
for trimethoprim-sulfamethoxazole (FIG. 14B-left), and
trimethoprim-piperacillin-tazobactam, respectively (FIG.
14B-right). This observation clearly indicates that even though
trimethoprim and piperacillin-tazobactam have antagonistic
interactions, hypersensitizing E. coli by silencing the acrA gene
significantly (.sup..about.15-fold, p<0.001) increases the
efficacy of the trimethoprim-piperacillin-tazobactam combination.
This advancement makes the trimethoprim-piperacillin-tazobactam
combination a promising candidate for treating infections since
trimethoprim and piperacillin-tazobactam have independent
resistance mechanisms that make the emergence of cross-resistance
unlikely.
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 51 <210> SEQ ID NO 1 <211> LENGTH: 60 <212>
TYPE: DNA <213> ORGANISM: Escherichia coli <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(2)..(6) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (9)..(9) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (12)..(12) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (16)..(16)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (28)..(29) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (32)..(32) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (37)..(38)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (45)..(45) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (47)..(48) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (50)..(50)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (59)..(59) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 1 gnnnnnaang cngaanaaaa
ggaaaacnng anggaanngc ccaanannan gcacccggnc 60 <210> SEQ ID
NO 2 <211> LENGTH: 60 <212> TYPE: DNA <213>
ORGANISM: Klebsiella pneumoniae <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (2)..(6) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(9)..(9) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (16)..(16) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(28)..(29) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (32)..(32) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (37)..(38) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(45)..(45) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (47)..(48) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (50)..(50) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(59)..(59) <223> OTHER INFORMATION: n may be thymidine or
uracil <400> SEQUENCE: 2 gnnnnnaang cngaanaaaa ggaaaacnng
anggaanngc ccaanannan gcacccggnc 60 <210> SEQ ID NO 3
<211> LENGTH: 60 <212> TYPE: DNA <213> ORGANISM:
Acinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (13)..(13)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (17)..(17) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (21)..(23) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (30)..(30)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (32)..(32) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (42)..(42) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(47)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (50)..(51) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (54)..(56) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (58)..(60)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 3 aacancaaaa agncacnagg nnnggacagn angcaaaagc
ancnnnnacn nccnnnannn 60 <210> SEQ ID NO 4 <211>
LENGTH: 60 <212> TYPE: DNA <213> ORGANISM:
Acinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (13)..(13)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (17)..(17) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (21)..(23) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (30)..(30)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (32)..(32) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (42)..(42) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(47)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (50)..(51) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (54)..(56) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (58)..(60)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 4 aacancaaaa agncacnagg nnnggacagn angcaaaagc
ancnnnnacn nccnnnannn 60 <210> SEQ ID NO 5 <211>
LENGTH: 60 <212> TYPE: DNA <213> ORGANISM: Burkholderia
cenocepacia <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (4)..(4) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (18)..(18) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (28)..(28)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (32)..(32) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (40)..(41) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(45)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 5 gcanacaaaa gcacagancc gaggacancc angcagaccn
ncgnncacga ggaagggcgg 60 <210> SEQ ID NO 6 <211>
LENGTH: 60 <212> TYPE: DNA <213> ORGANISM:
Actinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(1) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (5)..(6)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (13)..(13) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (17)..(17) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (26)..(27)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (29)..(29) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (32)..(32) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (36)..(36)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (38)..(39) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (41)..(42) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (45)..(45)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (49)..(51) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (60)..(60) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 6
ncacnngaaa aanaagngga agcacnngna angaananna nngcnggann ncaaaacaan
60 <210> SEQ ID NO 7 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Actinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(1) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)..(4) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (9)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (13)..(13)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (15)..(16) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (18)..(18) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (21)..(21)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (25)..(25) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (27)..(28) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (32)..(32)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (39)..(39) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (41)..(41) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(44)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (47)..(47) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (50)..(50) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (54)..(54)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (60)..(60) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 7 ncnncaaann ngnanngnag
ngggngnnca anggaaccna nggnggngan ggcngcgcgn 60 <210> SEQ ID
NO 8 <211> LENGTH: 60 <212> TYPE: DNA <213>
ORGANISM: Burkholderia cenocepacia <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (5)..(5) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(15)..(15) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (22)..(22) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (29)..(29) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(32)..(32) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (36)..(36) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (41)..(41) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(44)..(44) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (50)..(51) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (54)..(54) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(56)..(56) <223> OTHER INFORMATION: n may be thymidine or
uracil <400> SEQUENCE: 8 cccgngccgc cggcnacagg anccaggcnc
angcanccca ngcncaacan ngcngncaag 60 <210> SEQ ID NO 9
<211> LENGTH: 767 <212> TYPE: DNA <213> ORGANISM:
Actinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (15)..(15)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (22)..(22) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (29)..(29) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (32)..(32)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (36)..(36) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (41)..(41) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(44)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (50)..(51) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (54)..(54) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (56)..(56)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (63)..(63) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (83)..(83) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (86)..(86)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (90)..(90) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (97)..(97) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(101)..(101) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (105)..(105) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (107)..(107)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (113)..(113) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (116)..(116) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(122)..(122) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (145)..(146) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (149)..(149)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (158)..(158) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (182)..(182) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(185)..(185) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (194)..(194) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (205)..(205)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (221)..(221) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (224)..(224) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(235)..(235) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (244)..(244) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (256)..(256)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (262)..(263) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (268)..(268) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(272)..(272) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (275)..(275) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (279)..(279)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (284)..(284) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (301)..(302) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(305)..(305) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (313)..(314) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (319)..(319)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (321)..(322) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (325)..(325) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(329)..(329) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (331)..(331) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (335)..(335)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (341)..(341) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (356)..(356) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(359)..(359) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (371)..(371) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (374)..(374)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (376)..(376) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (381)..(381) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(398)..(398) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (400)..(401) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (427)..(427)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (431)..(431) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (446)..(446) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(452)..(452) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (470)..(470) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (482)..(482)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (485)..(485) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (496)..(497) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(502)..(503) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (521)..(521) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (529)..(529)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (539)..(539) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (541)..(542) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(551)..(551) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (562)..(562) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (572)..(572)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (579)..(579) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (596)..(596) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(600)..(600) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (602)..(602) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (611)..(611)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (626)..(626) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (634)..(635) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(637)..(638) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (650)..(650) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (656)..(656)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (658)..(658) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (665)..(665) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(680)..(680) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (683)..(683) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (686)..(686)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (704)..(704) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (707)..(707) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(715)..(715) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (732)..(734) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (737)..(737)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (741)..(741) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (752)..(752) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(755)..(755) <223> OTHER INFORMATION: n may be thymidine or
uracil <400> SEQUENCE: 9 cccgngccgc cggcnacagg anccaggcnc
angcanccca ngcncaacan ngcngncaag 60 gcngcgcgcc gcgccggaca
gancancaan cgcgcgnccc ncgancncga ccngancgag 120 anccgcaaga
agcagcagaa cgacnncgnc accgaagngg acaaggccgc cgaagacgcg 180
ancancgaga cgcngaagac cgccnacccc gaccacgcga nccncgcgga ggaancgggc
240 gaanccgaca acgaanccga anncaagngg ancancganc cgcncgacgg
cacgaccaac 300 nncanccacg gcnncccgna nnacngcgna ncgancgcgc
ncgagcacaa gggcgncgnc 360 acgcaggccg ncgncnacga nccgaacaag
aacgaccngn ncacggccac ccgcggccgc 420 ggcgcanacc ngaacgaccg
ccgcanccgc gncggccgcc gcgaccgccn ggcagacgca 480 cnggncggca
cgggcnnccc gnnccgcgag aaggacggcc ncgacgccna cgcgcgccnc 540
nncaccgaaa ngacgcaggc cngcacgggc cngcgccgnc cgggcgcggc ggcgcncgan
600 cncgcgaacg ncgcggccgg ccgccncgac gcgnncnncg agcaaggcan
caacgngngg 660 gacanggcag cgggcagccn gcngancacc gaggccggcg
gccncgncgg gaacnacacg 720 ggcgacgccg annnccngca ncgccacgag
ancgncgccg cgaaccc 767 <210> SEQ ID NO 10 <211> LENGTH:
11 <212> TYPE: DNA <213> ORGANISM: Acinetobacter
baumannii <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)..(3) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(7) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (9)..(9)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 10 canggananc c 11 <210> SEQ ID NO 11
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Escherichia coli <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (2)..(2) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (4)..(4)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (10)..(10) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 11 angnaaaccn c 11
<210> SEQ ID NO 12 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (2)..(3)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (6)..(6) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (8)..(8) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 12 gnncanangn a 11 <210> SEQ ID NO 13
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Escherichia coli <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (6)..(6) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (10)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 13 aacccncngn n 11
<210> SEQ ID NO 14 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (3)..(4) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(7) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (9)..(9)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 14 ngnncanang n 11
<210> SEQ ID NO 15 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (2)..(2)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (4)..(5) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 15 gncnnaacgg c 11
<210> SEQ ID NO 16 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(6)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (8)..(8) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (10)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 16
aggcangncn n 11 <210> SEQ ID NO 17 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Escherichia coli
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(1) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(7) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (9)..(9)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 17 naggcangnc n 11
<210> SEQ ID NO 18 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (3)..(3) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(6) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (9)..(9)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 18 nangnncgng a 11 <210> SEQ ID NO 19
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Escherichia coli <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(2) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (5)..(7)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 19 nncannngca n 11
<210> SEQ ID NO 20 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (2)..(3)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (6)..(7) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (9)..(9) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 20
annccnngng g 11 <210> SEQ ID NO 21 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Escherichia coli
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(3) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(8) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (11)..(11)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 21 nnngcanncc n 11 <210> SEQ ID NO 22
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Klebsiella pneumoniae <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (3)..(3) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 22 ganacagnga c 11 <210> SEQ ID NO 23
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Klebsiella pneumoniae <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (6)..(6) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(9)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 23 aacganannc c 11 <210> SEQ ID NO 24
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Escherichia coli <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(1) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(9)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 24 ncaagnnnnc c 11 <210> SEQ ID NO 25
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Escherichia coli <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(1) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (4)..(7)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(10) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 25 nccnnnnann c 11
<210> SEQ ID NO 26 <211> LENGTH: 12 <212> TYPE:
DNA <213> ORGANISM: Acinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(2) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (4)..(4) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (6)..(7) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 26 nnananncan gg 12 <210> SEQ ID NO 27
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Acinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(1) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (4)..(4)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 27 ncanggcaaa g 11 <210> SEQ ID NO 28
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Acinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(3) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(6)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (8)..(8) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 28 nnnccngnca a 11
<210> SEQ ID NO 29 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Acinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(2) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n
may be thymidine or uracil <400> SEQUENCE: 29 nngccaacan g 11
<210> SEQ ID NO 30 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Acinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(3)..(4) <223> OTHER INFORMATION: n may be thymidine or
uracil <400> SEQUENCE: 30 cannacccaa g 11 <210> SEQ ID
NO 31 <211> LENGTH: 11 <212> TYPE: DNA <213>
ORGANISM: Acinetobacter baumannii <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (1)..(2) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(7)..(7) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (11)..(11) <223> OTHER INFORMATION: n
may be thymidine or uracil <400> SEQUENCE: 31 nnaaaancca n 11
<210> SEQ ID NO 32 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Pseudomonas aeruginosa <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(1) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (7)..(7) <223> OTHER INFORMATION: n may
be thymidine or uracil <400> SEQUENCE: 32 naggcancga c 11
<210> SEQ ID NO 33 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Pseudomonas aeruginosa <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(6)..(6) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (9)..(9) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 33
aaagcnccnc n 11 <210> SEQ ID NO 34 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Pseudomonas aeruginosa
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (7)..(7) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 34 aggccanagc g 11
<210> SEQ ID NO 35 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Pseudomonas aeruginosa <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(2) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (5)..(5) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (8)..(8) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 35
nnacnccnga a 11 <210> SEQ ID NO 36 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Pseudomonas aeruginosa
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(2) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (6)..(6) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (9)..(9)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 36 nncggncang n 11
<210> SEQ ID NO 37 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Acinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(1) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (4)..(4) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (6)..(8) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (11)..(11)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 37 ncancnnngc n 11 <210> SEQ ID NO 38
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Pseudomonas aeruginosa <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (3)..(3) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (7)..(7)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 38 agnaacncca c 11 <210> SEQ ID NO 39
<400> SEQUENCE: 39 000 <210> SEQ ID NO 40 <400>
SEQUENCE: 40 000 <210> SEQ ID NO 41 <400> SEQUENCE: 41
000 <210> SEQ ID NO 42 <400> SEQUENCE: 42 000
<210> SEQ ID NO 43 <211> LENGTH: 12 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: (RXR)4 Cell-Penetrating Peptide
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (2)..(2) <223> OTHER INFORMATION: Xaa may be
6-aminohexanoic acid <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: Xaa may be 6-aminohexanoic acid <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: Xaa may be 6-aminohexanoic acid
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: Xaa may be
6-aminohexanoic acid <400> SEQUENCE: 43 Arg Xaa Arg Arg Xaa
Arg Arg Xaa Arg Arg Xaa Arg 1 5 10 <210> SEQ ID NO 44
<211> LENGTH: 10 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: (RFF)3R Cell-Penetrating Peptide <400> SEQUENCE:
44 Arg Phe Phe Arg Phe Phe Arg Phe Phe Arg 1 5 10 <210> SEQ
ID NO 45 <211> LENGTH: 14 <212> TYPE: PRT <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: (RXR)4XB Cell-Penetrating Peptide <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(2)..(2) <223> OTHER INFORMATION: Xaa may be 6-aminohexanoic
acid <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (5)..(5) <223> OTHER INFORMATION: Xaa
may be 6-aminohexanoic acid <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (8)..(8) <223>
OTHER INFORMATION: Xaa may be 6-aminohexanoic acid <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(11)..(11) <223> OTHER INFORMATION: Xaa may be
6-aminohexanoic acid <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (13)..(13) <223> OTHER
INFORMATION: Xaa may be 6-aminohexanoic acid <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (14)..(14)
<223> OTHER INFORMATION: Xaa may be beta-alanine <400>
SEQUENCE: 45 Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Xaa
Xaa 1 5 10 <210> SEQ ID NO 46 <211> LENGTH: 12
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: (RFF)3RXB
Cell-Penetrating Peptide <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: Xaa may be 6-aminohexanoic acid <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12)
<223> OTHER INFORMATION: Xaa may be beta-alanine <400>
SEQUENCE: 46 Arg Phe Phe Arg Phe Phe Arg Phe Phe Arg Xaa Xaa 1 5 10
<210> SEQ ID NO 47 <211> LENGTH: 10 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: (RFF)3RG Cell-Penetrating Peptide
<400> SEQUENCE: 47 Arg Phe Phe Arg Phe Phe Arg Phe Phe Arg 1
5 10 <210> SEQ ID NO 48 <211> LENGTH: 7 <212>
TYPE: PRT <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: R6G Cell-Penetrating
Peptide <400> SEQUENCE: 48 Arg Arg Arg Arg Arg Arg Gly 1 5
<210> SEQ ID NO 49 <211> LENGTH: 6 <212> TYPE:
PRT <213> ORGANISM: artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: R6 Cell-Penetrating Peptide
<400> SEQUENCE: 49 Arg Arg Arg Arg Arg Arg 1 5 <210>
SEQ ID NO 50 <211> LENGTH: 11 <212> TYPE: DNA
<213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(7)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 50 ggcaanncca n 11
<210> SEQ ID NO 51 <211> LENGTH: 11 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic peptide <400>
SEQUENCE: 51 Arg Phe Phe Arg Phe Phe Arg Phe Phe Arg Gly 1 5 10
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 51 <210>
SEQ ID NO 1 <211> LENGTH: 60 <212> TYPE: DNA
<213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (2)..(6)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (12)..(12) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (16)..(16)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (28)..(29) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (32)..(32) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (37)..(38)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (45)..(45) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (47)..(48) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (50)..(50)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (59)..(59) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 1 gnnnnnaang cngaanaaaa
ggaaaacnng anggaanngc ccaanannan gcacccggnc 60 <210> SEQ ID
NO 2 <211> LENGTH: 60 <212> TYPE: DNA <213>
ORGANISM: Klebsiella pneumoniae <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (2)..(6) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(9)..(9) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (16)..(16) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(28)..(29) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (32)..(32) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (37)..(38) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(45)..(45) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (47)..(48) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (50)..(50) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(59)..(59) <223> OTHER INFORMATION: n may be thymidine or
uracil <400> SEQUENCE: 2 gnnnnnaang cngaanaaaa ggaaaacnng
anggaanngc ccaanannan gcacccggnc 60 <210> SEQ ID NO 3
<211> LENGTH: 60 <212> TYPE: DNA <213> ORGANISM:
Acinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (13)..(13)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (17)..(17) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (21)..(23) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (30)..(30)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (32)..(32) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (42)..(42) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(47)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (50)..(51) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (54)..(56) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (58)..(60)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 3 aacancaaaa agncacnagg nnnggacagn angcaaaagc
ancnnnnacn nccnnnannn 60 <210> SEQ ID NO 4 <211>
LENGTH: 60 <212> TYPE: DNA <213> ORGANISM:
Acinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (13)..(13)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (17)..(17) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (21)..(23) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (30)..(30)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (32)..(32) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (42)..(42) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(47)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (50)..(51) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (54)..(56) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (58)..(60)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 4 aacancaaaa agncacnagg nnnggacagn angcaaaagc
ancnnnnacn nccnnnannn 60 <210> SEQ ID NO 5 <211>
LENGTH: 60 <212> TYPE: DNA <213> ORGANISM: Burkholderia
cenocepacia <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (4)..(4) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (18)..(18) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (28)..(28)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (32)..(32) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (40)..(41) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(45)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 5 gcanacaaaa gcacagancc gaggacancc angcagaccn
ncgnncacga ggaagggcgg 60 <210> SEQ ID NO 6 <211>
LENGTH: 60 <212> TYPE: DNA <213> ORGANISM:
Actinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(1) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (5)..(6)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (13)..(13) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (17)..(17) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (26)..(27)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (29)..(29) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (32)..(32) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (36)..(36)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (38)..(39) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (41)..(42) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (45)..(45)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (49)..(51) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (60)..(60) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 6
ncacnngaaa aanaagngga agcacnngna angaananna nngcnggann ncaaaacaan
60 <210> SEQ ID NO 7 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Actinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(1) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)..(4) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (9)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (13)..(13)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (15)..(16) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (18)..(18) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (21)..(21)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (25)..(25) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (27)..(28) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (32)..(32)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (39)..(39) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (41)..(41) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(44)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (47)..(47) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (50)..(50) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (54)..(54)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (60)..(60) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 7 ncnncaaann ngnanngnag
ngggngnnca anggaaccna nggnggngan ggcngcgcgn 60 <210> SEQ ID
NO 8 <211> LENGTH: 60 <212> TYPE: DNA <213>
ORGANISM: Burkholderia cenocepacia <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (5)..(5) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(15)..(15) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (22)..(22) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (29)..(29) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(32)..(32) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (36)..(36) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (41)..(41) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(44)..(44) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (50)..(51) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (54)..(54) <223>
OTHER INFORMATION: n may be thymidine or uracil <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(56)..(56) <223> OTHER INFORMATION: n may be thymidine or
uracil <400> SEQUENCE: 8 cccgngccgc cggcnacagg anccaggcnc
angcanccca ngcncaacan ngcngncaag 60 <210> SEQ ID NO 9
<211> LENGTH: 767 <212> TYPE: DNA <213> ORGANISM:
Actinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (15)..(15)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (22)..(22) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (29)..(29) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (32)..(32)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (36)..(36) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (41)..(41) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (44)..(44)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (50)..(51) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (54)..(54) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (56)..(56)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (63)..(63)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (83)..(83) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (86)..(86) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (90)..(90)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (97)..(97) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (101)..(101) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(105)..(105) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (107)..(107) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (113)..(113)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (116)..(116) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (122)..(122) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(145)..(146) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (149)..(149) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (158)..(158)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (182)..(182) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (185)..(185) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(194)..(194) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (205)..(205) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (221)..(221)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (224)..(224) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (235)..(235) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(244)..(244) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (256)..(256) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (262)..(263)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (268)..(268) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (272)..(272) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(275)..(275) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (279)..(279) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (284)..(284)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (301)..(302) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (305)..(305) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(313)..(314) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (319)..(319) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (321)..(322)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (325)..(325) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (329)..(329) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(331)..(331) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (335)..(335) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (341)..(341)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (356)..(356) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (359)..(359) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(371)..(371) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (374)..(374) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (376)..(376)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (381)..(381) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (398)..(398) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(400)..(401) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (427)..(427) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (431)..(431)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (446)..(446) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (452)..(452) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(470)..(470) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (482)..(482) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (485)..(485)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (496)..(497) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (502)..(503) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(521)..(521) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (529)..(529) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (539)..(539)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (541)..(542) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (551)..(551) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(562)..(562) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (572)..(572) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature
<222> LOCATION: (579)..(579) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (596)..(596)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (600)..(600) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (602)..(602) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(611)..(611) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (626)..(626) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (634)..(635)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (637)..(638) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (650)..(650) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(656)..(656) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (658)..(658) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (665)..(665)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (680)..(680) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (683)..(683) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(686)..(686) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (704)..(704) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (707)..(707)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (715)..(715) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (732)..(734) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(737)..(737) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (741)..(741) <223> OTHER INFORMATION: n
may be thymidine or uracil <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (752)..(752)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (755)..(755) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 9 cccgngccgc cggcnacagg
anccaggcnc angcanccca ngcncaacan ngcngncaag 60 gcngcgcgcc
gcgccggaca gancancaan cgcgcgnccc ncgancncga ccngancgag 120
anccgcaaga agcagcagaa cgacnncgnc accgaagngg acaaggccgc cgaagacgcg
180 ancancgaga cgcngaagac cgccnacccc gaccacgcga nccncgcgga
ggaancgggc 240 gaanccgaca acgaanccga anncaagngg ancancganc
cgcncgacgg cacgaccaac 300 nncanccacg gcnncccgna nnacngcgna
ncgancgcgc ncgagcacaa gggcgncgnc 360 acgcaggccg ncgncnacga
nccgaacaag aacgaccngn ncacggccac ccgcggccgc 420 ggcgcanacc
ngaacgaccg ccgcanccgc gncggccgcc gcgaccgccn ggcagacgca 480
cnggncggca cgggcnnccc gnnccgcgag aaggacggcc ncgacgccna cgcgcgccnc
540 nncaccgaaa ngacgcaggc cngcacgggc cngcgccgnc cgggcgcggc
ggcgcncgan 600 cncgcgaacg ncgcggccgg ccgccncgac gcgnncnncg
agcaaggcan caacgngngg 660 gacanggcag cgggcagccn gcngancacc
gaggccggcg gccncgncgg gaacnacacg 720 ggcgacgccg annnccngca
ncgccacgag ancgncgccg cgaaccc 767 <210> SEQ ID NO 10
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Acinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (3)..(3) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (7)..(7)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 10 canggananc c 11
<210> SEQ ID NO 11 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (2)..(2)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (4)..(4) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (10)..(10) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 11
angnaaaccn c 11 <210> SEQ ID NO 12 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Escherichia coli
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (2)..(3) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (6)..(6) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (10)..(10) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 12 gnncanangn a 11
<210> SEQ ID NO 13 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(6)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (8)..(8) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (10)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 13
aacccncngn n 11 <210> SEQ ID NO 14 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Escherichia coli
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(1) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (3)..(4) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (7)..(7)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 14
ngnncanang n 11 <210> SEQ ID NO 15 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Escherichia coli
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (2)..(2) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (4)..(5)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 15 gncnnaacgg c 11 <210> SEQ ID NO 16
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Escherichia coli <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (6)..(6) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (10)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 16 aggcangncn n 11
<210> SEQ ID NO 17 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (7)..(7) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (9)..(9) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (11)..(11)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 17 naggcangnc n 11 <210> SEQ ID NO 18
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Escherichia coli <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(1) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (3)..(3)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (5)..(6) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (9)..(9) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 18
nangnncgng a 11 <210> SEQ ID NO 19 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Escherichia coli
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(2) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(7) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (11)..(11)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 19 nncannngca n 11 <210> SEQ ID NO 20
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Escherichia coli <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (2)..(3) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(7)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 20 annccnngng g 11
<210> SEQ ID NO 21 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)..(3)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (7)..(8) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 21
nnngcanncc n 11 <210> SEQ ID NO 22 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Klebsiella pneumoniae
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (3)..(3) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (8)..(8) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 22
ganacagnga c 11 <210> SEQ ID NO 23 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Klebsiella pneumoniae
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (6)..(6) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (8)..(9) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 23
aacganannc c 11 <210> SEQ ID NO 24 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Escherichia coli
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(1) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (6)..(9) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 24
ncaagnnnnc c 11 <210> SEQ ID NO 25 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Escherichia coli
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(1) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (4)..(7) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (9)..(10)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 25 nccnnnnann c 11 <210> SEQ ID NO 26
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Acinetobacter baumannii <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(2) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (4)..(4)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (6)..(7) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (10)..(10) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 26
nnananncan gg 12
<210> SEQ ID NO 27 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Acinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(1) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (4)..(4) <223> OTHER INFORMATION: n may
be thymidine or uracil <400> SEQUENCE: 27 ncanggcaaa g 11
<210> SEQ ID NO 28 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Acinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(3) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (6)..(6) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (8)..(8) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 28
nnnccngnca a 11 <210> SEQ ID NO 29 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Acinetobacter baumannii
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(2) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (10)..(10) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 29
nngccaacan g 11 <210> SEQ ID NO 30 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Acinetobacter baumannii
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (3)..(4) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 30 cannacccaa g 11
<210> SEQ ID NO 31 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Acinetobacter baumannii <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)..(2) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (7)..(7) <223> OTHER INFORMATION: n may
be thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 31
nnaaaancca n 11 <210> SEQ ID NO 32 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Pseudomonas aeruginosa
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(1) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(7) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 32
naggcancga c 11 <210> SEQ ID NO 33 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Pseudomonas aeruginosa
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (6)..(6) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (9)..(9) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (11)..(11)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 33 aaagcnccnc n 11 <210> SEQ ID NO 34
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Pseudomonas aeruginosa <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(7) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 34
aggccanagc g 11 <210> SEQ ID NO 35 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Pseudomonas aeruginosa
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(2) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: n may be thymidine or uracil
<400> SEQUENCE: 35 nnacnccnga a 11 <210> SEQ ID NO 36
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Pseudomonas aeruginosa <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(2) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(6)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: n may be thymidine or uracil <400> SEQUENCE: 36
nncggncang n 11 <210> SEQ ID NO 37 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Acinetobacter baumannii
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(1) <223> OTHER INFORMATION: n may be
thymidine or uracil <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (4)..(4) <223> OTHER
INFORMATION: n may be thymidine or uracil <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(8)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 37 ncancnnngc n 11
<210> SEQ ID NO 38 <211> LENGTH: 11 <212> TYPE:
DNA <213> ORGANISM: Pseudomonas aeruginosa <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(3)..(3) <223> OTHER INFORMATION: n may be thymidine or
uracil <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (7)..(7) <223> OTHER INFORMATION: n may
be thymidine or uracil <400> SEQUENCE: 38 agnaacncca c 11
<210> SEQ ID NO 39 <400> SEQUENCE: 39 000 <210>
SEQ ID NO 40 <400> SEQUENCE: 40
000 <210> SEQ ID NO 41 <400> SEQUENCE: 41 000
<210> SEQ ID NO 42 <400> SEQUENCE: 42 000 <210>
SEQ ID NO 43 <211> LENGTH: 12 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: (RXR)4 Cell-Penetrating Peptide
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (2)..(2) <223> OTHER INFORMATION: Xaa may be
6-aminohexanoic acid <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (5)..(5) <223> OTHER
INFORMATION: Xaa may be 6-aminohexanoic acid <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: Xaa may be 6-aminohexanoic acid
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: Xaa may be
6-aminohexanoic acid <400> SEQUENCE: 43 Arg Xaa Arg Arg Xaa
Arg Arg Xaa Arg Arg Xaa Arg 1 5 10 <210> SEQ ID NO 44
<211> LENGTH: 10 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: (RFF)3R Cell-Penetrating Peptide <400> SEQUENCE:
44 Arg Phe Phe Arg Phe Phe Arg Phe Phe Arg 1 5 10 <210> SEQ
ID NO 45 <211> LENGTH: 14 <212> TYPE: PRT <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: (RXR)4XB Cell-Penetrating Peptide <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(2)..(2) <223> OTHER INFORMATION: Xaa may be 6-aminohexanoic
acid <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (5)..(5) <223> OTHER INFORMATION: Xaa
may be 6-aminohexanoic acid <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (8)..(8) <223>
OTHER INFORMATION: Xaa may be 6-aminohexanoic acid <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(11)..(11) <223> OTHER INFORMATION: Xaa may be
6-aminohexanoic acid <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (13)..(13) <223> OTHER
INFORMATION: Xaa may be 6-aminohexanoic acid <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (14)..(14)
<223> OTHER INFORMATION: Xaa may be beta-alanine <400>
SEQUENCE: 45 Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Xaa
Xaa 1 5 10 <210> SEQ ID NO 46 <211> LENGTH: 12
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: (RFF)3RXB
Cell-Penetrating Peptide <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: Xaa may be 6-aminohexanoic acid <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12)
<223> OTHER INFORMATION: Xaa may be beta-alanine <400>
SEQUENCE: 46 Arg Phe Phe Arg Phe Phe Arg Phe Phe Arg Xaa Xaa 1 5 10
<210> SEQ ID NO 47 <211> LENGTH: 10 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: (RFF)3RG Cell-Penetrating Peptide
<400> SEQUENCE: 47 Arg Phe Phe Arg Phe Phe Arg Phe Phe Arg 1
5 10 <210> SEQ ID NO 48 <211> LENGTH: 7 <212>
TYPE: PRT <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: R6G Cell-Penetrating
Peptide <400> SEQUENCE: 48 Arg Arg Arg Arg Arg Arg Gly 1 5
<210> SEQ ID NO 49 <211> LENGTH: 6 <212> TYPE:
PRT <213> ORGANISM: artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: R6 Cell-Penetrating Peptide
<400> SEQUENCE: 49 Arg Arg Arg Arg Arg Arg 1 5 <210>
SEQ ID NO 50 <211> LENGTH: 11 <212> TYPE: DNA
<213> ORGANISM: Escherichia coli <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(7)
<223> OTHER INFORMATION: n may be thymidine or uracil
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: n may be
thymidine or uracil <400> SEQUENCE: 50 ggcaanncca n 11
<210> SEQ ID NO 51 <211> LENGTH: 11 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic peptide <400>
SEQUENCE: 51 Arg Phe Phe Arg Phe Phe Arg Phe Phe Arg Gly 1 5 10
* * * * *