U.S. patent application number 17/083815 was filed with the patent office on 2021-05-20 for hybrid multi-step nucleic acid amplification.
The applicant listed for this patent is Labrador Diagnostics LLC. Invention is credited to Zahra Kamila Belhocine, Josephine Lee, Pranav Patel, Aaron Richardson, Scott Tabakman, Indira Wu.
Application Number | 20210147910 17/083815 |
Document ID | / |
Family ID | 1000005371148 |
Filed Date | 2021-05-20 |
View All Diagrams
United States Patent
Application |
20210147910 |
Kind Code |
A1 |
Patel; Pranav ; et
al. |
May 20, 2021 |
HYBRID MULTI-STEP NUCLEIC ACID AMPLIFICATION
Abstract
Improved methods for amplifying target nucleic acid sequences
are provided by 1) first amplifying the number of copies of target
nucleic acid sequences in a sample by a first nucleic acid
amplification method, and then 2) applying a second nucleic
amplification method to the amplified sample, or aliquot thereof,
further amplifying the number of copies of target sequences. In
embodiments, a first nucleic acid amplification method is a
thermocycling method, and a second nucleic acid amplification
method is an isothermal method.
Inventors: |
Patel; Pranav; (Fremont,
CA) ; Wu; Indira; (San Jose, CA) ; Richardson;
Aaron; (Palo Alto, CA) ; Belhocine; Zahra Kamila;
(Fremont, CA) ; Lee; Josephine; (Hayward, CA)
; Tabakman; Scott; (Palo Alto, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Labrador Diagnostics LLC |
Healdsburg |
CA |
US |
|
|
Family ID: |
1000005371148 |
Appl. No.: |
17/083815 |
Filed: |
October 29, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15664769 |
Jul 31, 2017 |
10822648 |
|
|
17083815 |
|
|
|
|
62369179 |
Jul 31, 2016 |
|
|
|
62368904 |
Jul 29, 2016 |
|
|
|
62368961 |
Jul 29, 2016 |
|
|
|
62368995 |
Jul 29, 2016 |
|
|
|
62369006 |
Jul 29, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/686 20130101;
C12Q 1/6806 20130101 |
International
Class: |
C12Q 1/686 20060101
C12Q001/686; C12Q 1/6806 20060101 C12Q001/6806 |
Claims
1. A method for amplifying a target nucleic acid sequence in a
sample, comprising: first amplifying the number of copies of one or
more target nucleic acid sequences in the sample by a first nucleic
acid amplification method; and next further amplifying the number
of copies of said one or more target nucleic acid sequences in the
sample, or an aliquot thereof, by a second nucleic amplification
method.
2. The method of claim 1, wherein said first nucleic acid
amplification method comprises a thermocycling nucleic acid
amplification method.
3. The method of claim 1, wherein said second nucleic acid
amplification method comprises an isothermal nucleic amplification
method.
4. The method of claim 1, wherein said first nucleic acid
amplification method comprises a thermocycling nucleic acid
amplification method, and said second nucleic acid amplification
method comprises an isothermal nucleic amplification method.
5. The method of claim 1, wherein said first nucleic acid
amplification method comprises a polymerase chain reaction (PCR)
nucleic acid amplification method.
6. The method of claim 1, wherein said second nucleic acid
amplification method comprises an isothermal nucleic
amplification.
7. The method of claim 5, wherein the nucleic acid amplified by the
PCR amplification method comprises DNA.
8. The method of claim 5, wherein the nucleic acid amplified by the
PCR amplification method comprises RNA.
9. The method of claim 1, wherein primers used in the amplification
methods are directed to a single target nucleic acid sequence, and
its complement.
10. The method of claim 1, wherein primers used in the
amplification methods are directed to a plurality of target nucleic
acid sequences, and complements thereof.
11. A method for detecting a first genetic element and a second
genetic element on a common nucleic acid molecule, the method
comprising: performing a first nucleic acid amplification reaction
using a first primer and a second primer, wherein both the first
primer and the second primer are phosphorylated on the 5' end of
the primer, wherein the first primer is complementary to the first
genetic element, wherein the second primer is complementary to the
second genetic element, and wherein a first reaction product is
formed, wherein the first reaction product contains at least a
portion of the first genetic element and at least a portion of the
second genetic element, wherein the least a portion of the first
genetic element and at least a portion of the second genetic
element are separated from each other in the first reaction product
by X number of nucleotides; incubating the first reaction product
with a ligase enzyme, to form at least a first ligation product
containing the first reaction product, wherein within the first
ligation product a copy of the at least a portion of the first
genetic element and a copy of the at least a portion of the second
genetic element are separated from each other by less than X number
of nucleotides; performing a second nucleic acid amplification
reaction using a third primer and a fourth primer, wherein the
third primer is complementary to the first genetic element, and
wherein the fourth primer is complementary to the second genetic
element, wherein a second reaction product is formed; detecting the
second reaction product; and using a cut-off time to end said
detecting of the second reaction product.
12. A method for amplifying a polynucleotide template, the method
comprising: A) generating multiple copies of a polynucleotide
template in a polymerase chain reaction (PCR) amplification
reaction mixture, wherein the sample is derived from capillary
whole blood wherein the PCR amplification reaction mixture
comprises a first PCR amplification reaction primer and a second
PCR amplification reaction primer, wherein in the PCR amplification
reaction mixture, the first PCR amplification reaction primer
anneals to the polynucleotide template and the second PCR
amplification reaction primer anneals to a polynucleotide which is
complementary to the polynucleotide template, and wherein in the
PCR amplification reaction mixture, multiple copies of a PCR
amplification reaction product are formed, wherein the PCR
amplification reaction product is a double-stranded nucleic acid
molecule comprising a first strand and a second strand, and wherein
a first strand of the PCR amplification reaction product is a copy
of the polynucleotide template; B) incubating copies of the
polynucleotide template in a non-thermocycling reaction mixture
comprising a non-thermocycling reaction first primer and a
non-thermocycling reaction second primer, wherein: the
polynucleotide template comprises a first portion, a second portion
and a third portion, wherein the third portion is situated in the
polynucleotide template between the first portion and the second
portion; the first primer comprises a first region and a second
region, wherein the second region of the first primer is
complementary to the first portion of the polynucleotide template;
and the second primer comprises a first region and a second region,
wherein the second region of the second primer is complementary to
a sequence in the PCR amplification reaction product second strand
which is complementary to the second portion of the polynucleotide
template, the first region of the second primer is complementary to
the first region of the first primer, and the first region of the
second primer is complementary to the third portion of the
polynucleotide template.
13. The method of claim 12, wherein the first portion and second
portion of the polynucleotide template are each between 6 and 30
nucleotides in length.
14. The method of claim 12, wherein the third portion of the
polynucleotide template is between 4 and 14 nucleotides in
length.
15. The method of claim 12, wherein the number of copies of the
polynucleotide template in the non-thermocycling reaction mixture
is increased at least 10-fold within 60 minutes of initiation of
the method.
16. The method of claim 12, wherein a concatemer strand comprising
at least three copies of the polynucleotide template is generated
during the incubation of the non-thermocycling reaction
mixture.
17. A vessel, comprising therein any one or more components of a
reaction mixture provided in claim 11.
18. A kit, comprising therein any one or more components of a
reaction mixture provided in claim 11.
Description
CROSS-REFERENCE
[0001] This application claims priority to U.S. Applications Nos.
62/368,961 filed Jul. 29, 2016, 62/368,995 filed Jul. 29, 2016,
62/369,006 filed Jul. 29, 2016, 62/369,179 filed Jul. 31, 2016, and
62/368,904 filed Jul. 29, 2016. All of the foregoing applications
and patents are incorporated herein by reference in their entirety
for all purposes.
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 16, 2017, is named 3043_201_SL.txt and is 9,540 bytes in
size.
BACKGROUND
[0003] While multiple techniques for the amplification of nucleic
acids are known, current techniques suffer from various limitations
such as in relation to the speed, sensitivity, and/or specificity
of target nucleic acid amplification. Accordingly, improved nucleic
acid amplification techniques are needed.
INCORPORATION BY REFERENCE
[0004] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
SUMMARY
[0005] Applicant discloses improved methods for amplifying one or
more target nucleic acid sequences in a sample. Target nucleic
acids may be DNA sequences, or may be RNA sequences. Improved
nucleic acid amplification methods disclosed herein comprise
utilizing two different nucleic acid amplification methods
sequentially. In embodiments, a first nucleic amplification method
is applied to a sample, amplifying the number of copies of one or
more target nucleic acid sequences in the sample; followed by
application of a second nucleic amplification method to the sample,
or aliquot thereof, further amplifying the number of copies of one
or more target nucleic acid sequences in the sample. In
embodiments, any two nucleic amplification methods may be performed
sequentially, wherein a first nucleic amplification method is
applied to a sample, and then a second nucleic amplification method
is applied to that sample, or an aliquot thereof, after
amplification by the first nucleic amplification method. In
embodiments, an improved nucleic acid amplification method
comprises first utilizing a thermocycling amplification method, and
then utilizing a non-thermocycling (e.g., an isothermal)
amplification method, to amplify a target nucleic acid sequence, or
to amplify a plurality of target nucleic acid sequences, in a
sample. In embodiments, a first nucleic amplification method
comprises a polymerase chain reaction (PCR) amplification method.
Suitable PCR methods include two-step PCR, and include 3-step PCR
methods. In embodiments where the target nucleic acid is RNA,
reverse transcriptase PCR (rtPCR) may be used. In embodiments, a
second nucleic amplification method comprises an isothermal nucleic
acid amplification method as described in International Application
No. PCT/US14/30028, filed Mar. 15, 2014; in International
Application No. PCT/US14/30034, filed Mar. 15, 2014; in
International Application No. PCT/US14/56151, filed Sep. 17, 2014;
in International Application No. PCT/US14/30036, filed Mar. 15,
2014; or in International Application No. PCT/US15/50811, filed
Sep. 17, 2015, each of which applications are hereby incorporated
by reference herein in their entirety for all purposes.
[0006] Accordingly, a method for amplifying a target nucleic acid
sequence in a sample comprises: amplifying the number of copies of
one or more target nucleic acid sequences in the sample by a first
nucleic acid amplification method; and then further amplifying the
number of copies of said one or more target nucleic acid sequences
in the sample, or an aliquot thereof, by a second nucleic
amplification method. In embodiments, a method for amplifying a
target nucleic acid sequence in a sample comprises: amplifying the
number of copies of one or more target nucleic acid sequences in
the sample by a thermocycling nucleic acid amplification method;
and then further amplifying the number of copies of said one or
more target nucleic acid sequences in the sample, or an aliquot
thereof, by a non-thermocycling (e.g., an isothermal) nucleic
amplification method. In embodiments, a method for amplifying a
target nucleic acid sequence in a sample comprises: amplifying the
number of copies of one or more target nucleic acid sequences in
the sample by a polymerase chain reaction (PCR) nucleic acid
amplification method; and then further amplifying the number of
copies of said one or more target nucleic acid sequences in the
sample, or an aliquot thereof, by an isothermal nucleic
amplification method selected from an isothermal nucleic
amplification method as described in International Application No.
PCT/US14/30028, filed Mar. 15, 2014; in International Application
No. PCT/US14/30034, filed Mar. 15, 2014; in International
Application No. PCT/US14/56151, filed Sep. 17, 2014; in
International Application No. PCT/US14/30036, filed Mar. 15, 2014;
or in International Application No. PCT/US15/50811, filed Sep. 17,
2015.
[0007] In further embodiments, a method for amplifying a target
nucleic acid sequence in a sample comprises: contacting a sample
with a primer, or set of primers which hybridize to a target
nucleic acid sequence; amplifying the number of copies of said
target nucleic acid sequence in the sample by a first nucleic acid
amplification method; and then further amplifying the number of
copies of said target nucleic acid sequences in the sample, or an
aliquot thereof, by a second nucleic amplification method. Further
embodiments include contacting a sample with a plurality of
primers, or a plurality of sets of primers, which hybridize to a
plurality of target nucleic acid sequences; amplifying the number
of copies of said target nucleic acid sequence in the sample by a
first nucleic acid amplification method; and then further
amplifying the number of copies of said target nucleic acid
sequences in the sample, or an aliquot thereof, by a second nucleic
amplification method.
[0008] In further embodiments, an improved nucleic acid
amplification method comprises first utilizing a non-thermocycling
(e.g., an isothermal) amplification method to amplify a target
nucleic acid sequence, or to amplify a plurality of target nucleic
acid sequences, in a sample, and then second applying a
thermocycling amplification method to the amplified sample, or
aliquot thereof, to further amplify a target nucleic acid sequence,
or to amplify a plurality of target nucleic acid sequences, in the
sample.
[0009] Accordingly, Applicant discloses herein methods, devices,
systems, implements (e.g., vessels), and kits for performing
nucleic acid amplification. In embodiments, such methods, devices,
systems, implements (e.g., vessels), and kits for performing
nucleic acid amplification include methods, devices, systems,
implements (e.g., vessels), and kits for amplification of nucleic
acids from a sample, such as a clinical sample. In embodiments, a
portion (e.g., an aliquot) of a sample may be used to provide a
nucleic acid for amplification. In embodiments, such a sample may
be a blood, urine, saliva, or other clinical sample, or a portion
(e.g., an aliquot) of a blood, urine, saliva, or other clinical
sample.
[0010] Accordingly, in embodiments, Applicant discloses a method
for amplifying a target nucleic acid sequence in a sample,
comprising:
[0011] first amplifying the number of copies of one or more target
nucleic acid sequences in the sample by a first nucleic acid
amplification method; and next further amplifying the number of
copies of said one or more target nucleic acid sequences in the
sample, or an aliquot thereof, by a second nucleic amplification
method. In embodiments of such methods, said first nucleic acid
amplification method comprises a thermocycling nucleic acid
amplification method. In embodiments of such methods, said second
nucleic acid amplification method comprises an isothermal nucleic
amplification method. In embodiments of such methods, said first
nucleic acid amplification method comprises a thermocycling nucleic
acid amplification method, and said second nucleic acid
amplification method comprises an isothermal nucleic amplification
method. In embodiments of such methods, said first nucleic acid
amplification method comprises a polymerase chain reaction (PCR)
nucleic acid amplification method. In embodiments of such methods,
the nucleic acid amplified by the PCR amplification method
comprises DNA. In embodiments of such methods, the nucleic acid
amplified by the PCR amplification method comprises RNA. In
embodiments, the nucleic acid may include uracil, and in
embodiments may include dideoxyuracil (e.g., may include
dideoxyuracil in place of a thymine during amplification). In
embodiments of such methods, said second nucleic acid amplification
method comprises an isothermal nucleic amplification method.
[0012] In embodiments of the methods disclosed herein, primers used
in the amplification methods are directed to a single target
nucleic acid sequence, and its complement. In embodiments of the
methods disclosed herein, primers used in the amplification methods
are directed to a plurality of target nucleic acid sequences, and
complements thereof.
[0013] Accordingly, in embodiments, Applicant discloses a method
for detecting a first genetic element and a second genetic element
on a common nucleic acid molecule, the method comprising:
[0014] performing a first nucleic acid amplification reaction using
a first primer and a second primer, wherein both the first primer
and the second primer are phosphorylated on the 5' end of the
primer, wherein the first primer is complementary to the first
genetic element, wherein the second primer is complementary to the
second genetic element, and wherein a first reaction product is
formed, wherein the first reaction product contains at least a
portion of the first genetic element and at least a portion of the
second genetic element, wherein the least a portion of the first
genetic element and at least a portion of the second genetic
element are separated from each other in the first reaction product
by X number of nucleotides;
[0015] incubating the first reaction product with a ligase enzyme,
to form at least a first ligation product containing the first
reaction product, wherein within the first ligation product a copy
of the at least a portion of the first genetic element and a copy
of the at least a portion of the second genetic element are
separated from each other by less than X number of nucleotides;
[0016] performing a second nucleic acid amplification reaction
using a third primer and a fourth primer, wherein the third primer
is complementary to the first genetic element, and wherein the
fourth primer is complementary to the second genetic element,
wherein a second reaction product is formed; and
[0017] detecting the second reaction product.
[0018] Accordingly, in embodiments, Applicant discloses a method
for amplifying a polynucleotide template, the method
comprising:
[0019] A) generating multiple copies of a polynucleotide template
in a polymerase chain reaction (PCR) amplification reaction
mixture, wherein the PCR amplification reaction mixture comprises a
first PCR amplification reaction primer and a second PCR
amplification reaction primer, wherein in the PCR amplification
reaction mixture, the first PCR amplification reaction primer
anneals to the polynucleotide template and the second PCR
amplification reaction primer anneals to a polynucleotide which is
complementary to the polynucleotide template, and wherein in the
PCR amplification reaction mixture, multiple copies of a PCR
amplification reaction product are formed, wherein the PCR
amplification reaction product is a double-stranded nucleic acid
molecule comprising a first strand and a second strand, and wherein
a first strand of the PCR amplification reaction product is a copy
of the polynucleotide template;
[0020] B) incubating copies of the polynucleotide template in a
non-thermocycling reaction mixture comprising a non-thermocycling
reaction first primer and a non-thermocycling reaction second
primer, wherein:
[0021] the polynucleotide template comprises a first portion, a
second portion and a third portion, wherein the third portion is
situated in the polynucleotide template between the first portion
and the second portion;
[0022] the first primer comprises a first region and a second
region, wherein the second region of the first primer is
complementary to the first portion of the polynucleotide template;
and
[0023] the second primer comprises a first region and a second
region, wherein the second region of the second primer is
complementary to a sequence in the PCR amplification reaction
product second strand which is complementary to the second portion
of the polynucleotide template, the first region of the second
primer is complementary to the first region of the first primer,
and the first region of the second primer is complementary to the
third portion of the polynucleotide template.
[0024] In embodiments of the methods disclosed herein, the first
portion and second portion of the polynucleotide template are each
between 6 and 30 nucleotides in length. In embodiments of such
methods, the third portion of the polynucleotide template is
between 4 and 14 nucleotides in length. In embodiments of the
methods disclosed herein, the number of copies of the
polynucleotide template in the non-thermocycling reaction mixture
is increased at least 10-fold within 60 minutes of initiation of
the method. In embodiments of the methods disclosed herein, a
concatemer strand comprising at least three copies of the
polynucleotide template is generated during the incubation of the
non-thermocycling reaction mixture.
[0025] Applicants further disclose herein a vessel, and vessels,
comprising therein any one or more components of a reaction mixture
provided herein. Applicants further disclose herein a kit, and
kits, comprising therein any one or more components of a reaction
mixture provided herein.
[0026] The assays and methods disclosed herein may be performed on
a device, or on a system, for processing a sample. The assays and
methods disclosed herein can be readily incorporated into and used
in an automated assay device, and in an automated assay system. For
example, systems as disclosed herein may include a communication
assembly for transmitting or receiving a protocol based on the
analyte to be detected (e.g., one or more nucleic acid markers
indicative of a virus, a bacterium, or other target) or based on
other analytes to be detected by the device or system. In
embodiments, an assay protocol may be changed based on optimal
scheduling of a plurality of assays to be performed by a device, or
may be changed based on results previously obtained from a sample
from a subject, or based on results previously obtained from a
different sample from the subject. In embodiments, a communication
assembly may comprise a channel for communicating information from
said device to a computer, said wherein said channel is selected
from a computer network, a telephone network, a metal communication
link, an optical communication link, and a wireless communication
link. In embodiments, systems as disclosed herein may transmit
signals to a central location, or to an end user, and may include a
communication assembly for transmitting such signals. Systems as
disclosed herein may be configured for updating a protocol as
needed or on a regular basis.
[0027] Devices and systems configured to measure nucleic acid
markers (e.g., which may be indicative of a virus, a bacterium, or
other target) in a sample of blood according to a method disclosed
herein may be configured to determine from analysis of a portion of
a sample (e.g., a sample of blood, urine, sputum, tears, or other
sample) that comprises a volume of no more than about 1000 .mu.L,
or no more than about 500 .mu.L, no more than about 250 .mu.L, or
no more than about 150 .mu.L, or no more than about 100 .mu.L, or
no more than about 50 .mu.L, or, in embodiments, wherein the volume
of the sample comprises no more than about 25 .mu.L, or comprises
no more than about 10 .mu.L, or wherein said sample of blood
comprises less than about 10 .mu.L. Such devices may be configured
to measure target levels, or to detect the presence or absence of a
target in a sample, in less than about one hour, or, in
embodiments, in less than about 40 minutes, or in less than about
30 minutes.
[0028] Devices disclosed herein may be configured to perform an
assay for the measurement of a target nucleic acid and also to
perform an assay for the measurement of another analyte in the
blood sample. Devices disclosed herein may be configured to perform
an assay for the measurement of a target nucleic acid molecule, and
also to perform an assay comprising the measurement of a
morphological characteristic of a blood cell in the blood sample.
Devices disclosed herein may be configured to perform an assay for
the measurement of a target nucleic acid molecule and also to
perform an assay comprising the measurement of another blood
analyte, e.g., a vitamin, a hormone, a drug or metabolite of a
drug, or other analyte. Such devices may be configured wherein the
assays, or the order of performance of assays, that are performed
by said device may be altered by communication with another
device.
[0029] Applicants also disclose systems comprising a device as
disclosed herein. In embodiments, the system comprises a device
that is configured to perform an assay for the measurement of a
target nucleic acid molecule and also to perform an assay for the
measurement of another analyte in the sample. In embodiments, the
system comprises a device that is configured to perform an assay
for the measurement of a target nucleic acid molecule and also to
perform an assay for the measurement of a morphological
characteristic of a cell in the sample. In embodiments of such a
system, assays, or the order of performance of assays, that are
performed by said device may be altered by communication with
another device.
[0030] Methods, systems, devices, kits, and compositions disclosed
herein provide rapid assays which require only small amounts of
sample, such as only small amounts of blood, urine, tears, sweat,
tissue, or other sample. Device and systems disclosed herein are
configured to perform such rapid assays which require only small
amounts of sample, such as samples or sample portions having
volumes of less than about 250 .mu.L, or less than about 200 .mu.L,
or less than about 150 .mu.L, or less than about 100 .mu.L.
Accordingly, the methods, compositions, devices, and systems
provide rapid tests, which require only small biological samples,
and thus provide advantages over other methods, compositions,
assays, devices, and systems.
[0031] Applicant discloses herein compositions comprising one or
more of reagents, including primers, nucleotides, dyes, buffers,
and other reagents useful for methods disclosed herein. Applicant
discloses herein vessels for use in assay devices, assay systems,
including automated assay devices, automated assay systems (which
may also be termed sample analysis devices and systems, and
automated sample analysis devices and systems) useful for methods
disclosed herein. Applicant discloses herein implements, tools, and
disposables for use in assay devices, assay systems, including
automated assay devices and automated assay systems useful for
methods disclosed herein. Applicant discloses herein vessels
containing one or more of reagents, including primers, nucleotides,
dyes, and other reagents useful for methods disclosed herein.
Applicant discloses herein kits including compositions comprising
one or more of reagents, including primers, nucleotides, dyes,
buffers, and other reagents useful for methods disclosed herein;
kits including vessels for use in assay devices, assay systems,
including automated assay devices and automated assay systems
useful for methods disclosed herein; and kits including
compositions and vessels for use in assay devices, assay systems,
including automated assay devices and automated assay systems
useful for methods disclosed herein.
[0032] Methods, systems, devices, kits, and compositions disclosed
herein provide advantages including greater sensitivity than other
methods. Methods, systems, devices, kits, and compositions
disclosed herein provide advantages including improved ability to
multiplex two or more amplification reactions in a single nucleic
amplification device or system (which may be or include, e.g.,
automated assay devices, automated assay systems, which may also be
termed sample analysis devices and systems, and automated sample
analysis devices and systems). Methods, systems, devices, kits, and
compositions disclosed herein provide advantages including improved
ability to amplify two, three, or more target nucleic acids in a
single vessel in a first nucleic acid amplification step, and
follow up with steps directed to individual target nucleic acids in
multiple individual vessels in multiple second nucleic acid
amplification steps. Methods, systems, devices, kits, and
compositions disclosed herein provide advantages including improved
ability to amplify, detect, or identify, and combinations thereof,
single nucleotide polymorphisms (SNPs) in target nucleic acids.
Methods, systems, devices, kits, and compositions disclosed herein
provide advantages including improved ability to perform PCR
without use of dyes in a first nucleic acid amplification step, and
to follow up with a second nucleic acid amplification step
comprising the use of dyes, for detecting target nucleic acids
pursuant to a second nucleic acid amplification step; for example,
such methods systems, devices, kits, and compositions may be useful
for detection of SNPs.
[0033] Methods, systems, devices, kits, and compositions disclosed
herein provide advantages including the ability to utilize samples
with less pre-processing than might otherwise be required. Methods,
systems, devices, kits, and compositions disclosed herein provide
advantages including the ability to dilute samples to a greater
amount of dilution than might otherwise be required. Methods,
systems, devices, kits, and compositions disclosed herein provide
advantages including reducing susceptibility to contamination by
humans (e.g., operator) other than the subject than might otherwise
occur. Methods, systems, devices, kits, and compositions disclosed
herein provide advantages including the ability to apply these
techniques to the analysis of nasal swabs, where other methods
might require nasopharyngeal swabs.
[0034] Other goals and advantages of the invention will be further
appreciated and understood when considered in conjunction with the
following description and accompanying drawings. While the
following description may contain specific details describing
particular embodiments of the invention, these should not be
construed as limitations to the scope of the invention but rather
as exemplifications of possible embodiments. For each aspect of the
invention, many changes and modifications can be made within the
scope of the invention without departing from the spirit
thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] In the drawings,
[0036] FIG. 1 shows exemplary results according to a method
provided herein.
[0037] FIG. 2 shows exemplary results according to a method
provided herein.
[0038] FIG. 3 shows exemplary results according to a method
provided herein.
[0039] FIG. 4 shows exemplary results according to a method
provided herein.
[0040] FIG. 5 shows exemplary results according to a method
provided herein.
[0041] FIG. 6 depicts exemplary primer sequences which may be used
with a method provided herein. Figure discloses SEQ ID NOS 22-31,
respectively, in order of appearance.
[0042] FIG. 7 is a general schematic of method provided herein.
[0043] FIG. 8 are exemplary primer sequences which may be used with
a method provided herein. Figure discloses SEQ ID NOS 32-33,
respectively, in order of appearance.
[0044] FIG. 9 shows results from a method provided herein.
[0045] FIG. 10 shows primer sequences used for a method provided
herein. Figure discloses SEQ ID NOS 34-39, respectively, in order
of appearance.
[0046] FIG. 11A shows a histogram plot for cut-off determination
for ZNAT.
[0047] FIG. 11B shows a Table for ZNAT results interpretation.
[0048] FIG. 12 provides a standard curve showing the quantification
of three ZIKV lysates using qRT-PCR to convert plaque-forming units
(PFU) and half-maximal tissue culture infective dose (TCID.sub.50)
to genomic copies for three different ZIKV lysates.
[0049] FIG. 13 shows results of analytical sensitivity
determinations of ZNAT.
[0050] FIG. 14 provides a table showing the results of in silico
analyses of ZNAT primers against sequenced Zika virus strains.
[0051] FIG. 15 shows, in Table form, the results of
reactivity/inclusivity analysis of ZNAT in serum samples.
[0052] FIG. 16 provides a table showing in silico analysis of Zika
preliminary amplification and isothermal primers against prevalent
diseases with Zika-like onset symptoms.
[0053] FIG. 17 provides a table showing the results of in silico
mismatch analyses of ZNAT primers against potentially
cross-reacting organisms.
[0054] FIG. 18 provides a table showing cross-reactivity and the
results of interfering substances analyses of ZNAT in serum.
[0055] FIG. 19 shows a table listing the results of ZNAT tests
against possible interfering substances in serum.
[0056] FIG. 20 provides a table showing the results of analyses of
run-to-run contamination of ZNAT in serum.
[0057] FIG. 21 provides a table showing the results of concordance
studies using ZNAT. Concordance studies results for SPU, CDC
RT-PCR, and altona RealStar.RTM. assays. Positive and negative
percent agreement (PPA and NPA, respectively) values were
determined from results that were in agreement between the ZNAT
assay run using the SPU and the combined CDC RT-PCR and altona
assays for venous serum samples and capillary whole blood
samples.
[0058] FIG. 22 shows a schematic illustration and a perspective
image of a nucleic acid amplification (NAA) detector and
thermocycler module as disclosed herein, and includes a schematic
illustration of a cross-section of a photodetection system for
detecting fluorescence generated by nucleic acid amplification, and
further includes (as an inset) an idealized illustration of a plot
of fluorescence generated over time (typically as numbers of
cycles) by such amplification.
[0059] FIG. 23A shows a listing of exemplary steps of methodology
for a NAA Zika Assay as disclosed herein.
[0060] FIG. 23B shows a listing of performance characteristics of a
NAA Zika Assay as disclosed herein, using venous serum samples.
[0061] FIG. 24 shows a listing of analytical sensitivity (limit of
detection (LoD)) of a NAA Zika Assay as disclosed herein.
[0062] FIG. 25 shows a listing of analytical specificity of a NAA
Zika Assay as disclosed herein.
[0063] FIG. 26 shows a further listing of analytical specificity of
a NAA Zika Assay as disclosed herein.
[0064] FIG. 27A shows a listing of inclusivity of a NAA Zika Assay
as disclosed herein.
[0065] FIG. 27B shows a listing of data demonstrating no
significant carry-over between different samples when analyzed
using automated sample analysis devices and the NAA Zika Assay as
disclosed herein.
[0066] FIG. 28 shows a clinical study overview of a NAA Zika Assay
as disclosed herein.
[0067] FIG. 29 shows a comparison (as percent agreement) of a NAA
Zika Assay as disclosed herein with CDC RT-PCR with confirmation by
altona RealStar.RTM..
[0068] FIG. 30 lists some descriptive characteristics of a clinical
study using the NAA Zika Assay nucleic acid amplification methods
disclosed herein.
[0069] FIG. 31 provides a table listing data demonstrating that the
results of a clinical study using the NAA Zika Assay nucleic acid
amplification methods disclosed herein are consistent with results
of comparative assays.
[0070] It is noted that the drawings and elements therein are not
necessarily drawn to shape or scale. For example, the shape or
scale of elements of the drawings may be simplified or modified for
ease or clarity of presentation. It should further be understood
that the drawings and elements therein are for exemplary
illustrative purposes only, and not be construed as limiting in any
way.
DETAILED DESCRIPTION
[0071] This application hereby incorporates by reference for all
purposes and in their entirety the following patent applications:
U.S. Provisional Patent Application No. 62/051,912, filed Sep. 17,
2014; U.S. Provisional Patent Application No. 62/051,945, filed
Sep. 17, 2014; U.S. Provisional Patent Application No. 62/068,603,
filed Oct. 24, 2014; U.S. Provisional Patent Application No.
62/068,605, filed Oct. 24, 2014; U.S. Provisional Patent
Application No. 62/151,358, filed Apr. 22, 2015; U.S. Provisional
Patent Application No. 61/908,027, filed Nov. 22, 2013; U.S.
Provisional Patent Application No. 62/001,050, filed May 20, 2014;
and U.S. Provisional Patent Application No. 61/800,606, filed Mar.
15, 2013; U.S. Non-Provisional patent application Ser. No.
14/214,850, filed Mar. 15, 2014; International Patent Application
No. PCT/US14/30034, filed Mar. 15, 2014; International Patent
Application No. PCT/US14/56151, filed Sep. 17, 2014; International
Application No. PCT/US15/50811, filed Sep. 17, 2015; International
Application No. PCT/US15/50822, filed Sep. 17, 2015; and U.S.
Non-Provisional patent application Ser. No. 15/087,840, filed Mar.
31, 2016.
[0072] Provided herein are devices, systems and methods for
amplification of nucleic acids. Various features described herein
may be applied to any of the particular embodiments set forth below
or for any other types systems for or involving nucleic acid
amplification. Systems and methods described herein may be applied
as a standalone system or method, or as part of an integrated
system or method. It shall be understood that different aspects of
the disclosed systems and methods can be appreciated individually,
collectively, or in combination with each other.
[0073] In embodiments, a method provided herein may be performed as
follows. A polynucleotide template may be amplified in a first
amplification reaction, wherein the first amplification reaction is
a thermocycling nucleic acid amplification reaction (e.g., a
polymerase chain reaction (PCR)). In the first amplification
reaction, a nucleic acid amplification reaction product may be
generated (e.g., a PCR amplification reaction product may be
generated). Amplification reaction product generated by the first
amplification reaction may then be amplified in a second
amplification reaction, wherein the second amplification reaction
is a non-thermocycling nucleic acid amplification reaction (e.g.,
an isothermal nucleic acid amplification reaction).
[0074] In embodiments, a method provided herein may be performed as
follows. A polynucleotide template may be amplified in a first
amplification reaction, wherein the first amplification reaction is
a polymerase chain reaction (PCR) reaction. In the first
amplification reaction, a PCR amplification reaction product may be
generated. The PCR amplification reaction product may be a
double-stranded nucleic acid molecule comprising a first strand and
a second strand, and wherein a first strand of the PCR
amplification reaction product is a copy of the polynucleotide
template. Next, the PCR reaction product (which comprises a copy of
the polynucleotide template) may be used as a template in a
non-thermocycling amplification reaction as provided in
PCT/US14/56151, in order to generate a non-thermocycling reaction
product as described in PCT/US14/56151. Such non-thermocycling
reaction products may include concatemers. In embodiments of this
method involving a PCR amplification reaction followed by a
non-thermocycling amplification reaction, only the
non-thermocycling reaction products are detected (not the PCR
reaction products). In embodiments, the non-thermocycling reaction
products are detected in real-time as they are formed. In
embodiments, a method of PCT/US14/56151 may involve a first primer
and a second primer. In embodiments, the first primer of a method
of PCT/US14/56151 contains a first region and a second region,
wherein the first region comprises a 5' end of the primer, the
second region comprises a 3' end of the primer, and the second
region is complementary to a least a portion of a first strand of a
double-stranded nucleic acid template (i.e. a double-stranded
nucleic acid molecule, such as a PCR amplification reaction
product). In embodiments, the second primer of a method of
PCT/US14/56151 contains a first region and a second region, wherein
the first region comprises a 5' end of the primer and is
complementary to the first region of the first primer, the second
region comprises a 3' end of the primer, and wherein the second
region is complementary to a least a portion of a second strand of
the double-stranded nucleic acid template. In embodiments, the
second region of a first primer of a method of PCT/US14/56151 may
anneal to a first strand of a PCR amplification reaction product in
methods herein in the same way as a first PCR amplification
reaction primer anneals to a polynucleotide template strand in PCR
amplification reactions provided herein, and the second region of a
second primer of a method of PCT/US14/56151 may anneal to a second
strand of a PCR amplification reaction product as provided in
methods herein in the same way as a second PCR amplification
reaction primer anneals to a polynucleotide which is complementary
to the polynucleotide template in PCR amplification reaction
methods provided herein.
[0075] In further, alternative embodiments, a method provided
herein may be performed as follows. A polynucleotide template may
be amplified in a first amplification reaction, wherein the first
amplification reaction is a non-thermocycling nucleic acid
amplification reaction (e.g., an isothermal nucleic acid
amplification reaction). In the first amplification reaction, a
nucleic acid amplification reaction product may be generated.
Amplification reaction product generated by the first amplification
reaction may then be amplified in a second amplification reaction,
wherein the second amplification reaction is a thermocycling
nucleic acid amplification reaction (e.g., a PCR reaction).
[0076] The methods disclosed herein may be performed by assay
devices and assay systems, including automated assay devices and
automated assay systems (which may also be termed sample analysis
devices and systems, and automated sample analysis devices and
systems).
Definitions
[0077] As used herein, a "polynucleotide" refers to a polymeric
chain containing two or more nucleotides. "Polynucleotides"
includes primers, oligonucleotides, nucleic acid strands, etc. A
polynucleotide may contain standard or non-standard nucleotides.
Typically, a polynucleotide contains a 5' phosphate at one terminus
("5' terminus") and a 3' hydroxyl group at the other terminus ("3'
terminus) of the chain. The most 5' nucleotide of a polynucleotide
may be referred to herein as the "5' terminal nucleotide" of the
polynucleotide. The most 3' nucleotide of a polynucleotide may be
referred to herein as the "3' terminal nucleotide" of the
polynucleotide.
[0078] The term "downstream" as used herein in the context of a
polynucleotide containing a 5' terminal nucleotide and a 3'
terminal nucleotide refers to a position in the polynucleotide
which is closer to the 3' terminal nucleotide than a reference
position in the polynucleotide. For example, in a primer having the
sequence: 5' ATAAGC 3', the "G" is downstream from the "T" and all
of the "A"s.
[0079] The term "upstream" as used herein in the context of a
polynucleotide containing a 5' terminal nucleotide and a 3'
terminal nucleotide, refers to a position in the polynucleotide
which is closer to the 5' terminal nucleotide than a reference
position in the polynucleotide. For example, in a primer having the
sequence: 5' ATAAGC 3', the "T" is upstream from the "G", the "C",
and the two "A"s closest to the "G".
[0080] As used herein, "nucleic acid" includes both
deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) molecules,
including DNA and RNA containing non-standard nucleotides. A
"nucleic acid" contains at least one polynucleotide (a "nucleic
acid strand"). A "nucleic acid" may be single-stranded or
double-stranded. Acronyms and abbreviations related to nucleic
acids as used herein have their standard meanings (e.g., "mRNA"
refers to messenger RNA, "ssDNA" refers to single-stranded DNA,
"dsDNA" refers to double-stranded DNA, etc.).
[0081] As used herein "cDNA" refers to DNA molecules
("complementary DNA") produced by reverse transcription of an RNA
molecule. Such reverse transcription produces a DNA molecule having
a nucleotide sequence that is the same as the nucleotide sequence
of that RNA molecule, with the exception that where the RNA
molecule has a uracil moiety (U) the DNA molecule has instead a
thymine (T). A cDNA produced by reverse transcription of an RNA
molecule is complementary to the complement of that RNA
molecule.
[0082] The term "primer" as used herein refers to a polynucleotide,
whether occurring naturally as in a purified restriction digest or
produced synthetically, which is capable of acting as a point of
initiation of synthesis when placed under conditions in which
synthesis of a primer extension product which is complementary to a
nucleic acid strand is induced, i.e., in the presence of
nucleotides and an inducing agent such as DNA polymerase and at a
suitable temperature and pH. The primer is preferably single
stranded for maximum efficiency in amplification, but may
alternatively be double stranded. If double stranded, the primer is
first treated to separate its strands before being used to prepare
extension products. Preferably, the primer is a
poly-deoxyribonucleotide. The primer must be sufficiently long to
prime the synthesis of extension products in the presence of the
inducing agent. The exact lengths of the primers will depend on
many factors, including temperature, source of primer and use of
the method. For example, for diagnostics applications, depending on
the complexity of the target sequence, the polynucleotide primer
typically contains about 10-30 or more nucleotides, or about 15-25
or more nucleotides, although it may contain fewer nucleotides. For
other applications, the polynucleotide primer is typically shorter,
e.g., 7-15 nucleotides. Such short primer molecules generally
require cooler temperatures to form sufficiently stable hybrid
complexes with template.
[0083] As used herein, when a first polynucleotide is described as
"annealed", "annealing" or the like to a second polynucleotide, the
entirety of the first polynucleotide or any portion thereof may
anneal to the second polynucleotide, and vice versa.
[0084] The "Tm" indicates the annealing temperature for a
particular primer set; a primer set may have a different Tm than
other primer sets, or may have the same Tm as another primer set.
In many cases, Tm is typically between about 45.degree. C. to about
80.degree. C., or between about 50.degree. C. to about 75.degree.
C.
[0085] As used herein, "reverse transcriptase" (RT) refers to an
enzyme which can be used to produce a DNA molecule that is
complementary to a RNA molecule. The act of producing such a DNA
molecule from an RNA template is termed "reverse transcription".
Where a target nucleic acid is a RNA molecule, and DNA is desired
(e.g., for use with PCR amplification methods), a cDNA molecule
corresponding to the target RNA may be generated by reverse
transcription.
[0086] As used herein, a "concatemer" refers to a nucleic acid
molecule which contains within it two or more copies of a
particular nucleic acid, wherein the copies are linked in series.
Within the concatemer, the copies of the particular nucleic acid
may be linked directly to each other, or they may be indirectly
linked (e.g. there may be nucleotides between the copies of the
particular nucleic acid). In an example, the particular nucleic
acid may be that of a double-stranded nucleic acid template, such
that a concatemer may contain two or more copies of the
double-stranded nucleic acid template. In another example, the
particular nucleic acid may be that of a polynucleotide template,
such that a concatemer may contain two or more copies of the
polynucleotide template.
[0087] As used herein, a "target" nucleic acid or molecule refers
to a nucleic acid of interest. A target nucleic acid/molecule may
be of any type, including single-stranded or double stranded DNA or
RNA (e.g. mRNA).
[0088] As used herein, "complementary" sequences refer to two
nucleotide sequences which, when aligned anti-parallel to each
other, contain multiple individual nucleotide bases which can pair
with each other according to standard base-pairing rules (e.g. A-T,
G-C, or A-U), such that molecules containing the sequences can
specifically anneal to each other. It is not necessary for every
nucleotide base in two sequences to be capable of pairing with each
other for the sequences to be considered "complementary". Sequences
may be considered complementary, for example, if at least 30%, 40%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%
of the nucleotide bases in two sequences can pair with each other
when the sequences are optimally aligned for complementation. In
addition, sequences may still be considered "complementary" when
the total lengths of the two sequences are significantly different
from each other. For example, a primer of 15 nucleotides may be
considered "complementary" to a longer polynucleotide containing
hundreds of nucleotides if multiple individual nucleotide bases of
the primer can pair with nucleotide bases in the longer
polynucleotide when the primer is aligned anti-parallel to a
particular region of the longer polynucleotide. Additionally,
"complementary" sequences may contain one or more nucleotide
analogs or nucleobase analogs. As used herein, "perfectly
complementary" or "perfect complementation" or the like refers two
sequences which are 100% complementary to each other (i.e. where
there are no mis-matches between the nucleotides of the sequences
when the sequences are paired for maximum complementation).
[0089] "Identical" or "identity," as used herein in the context of
two or more polypeptide or polynucleotide sequences, can mean that
the sequences have a specified percentage of residues that are the
same over a specified region. The percentage can be calculated by
optimally aligning the two sequences, comparing the two sequences
over the specified region, determining the number of positions at
which the identical residue occurs in both sequences to yield the
number of matched positions, dividing the number of matched
positions by the total number of positions in the specified region,
and multiplying the result by 100 to yield the percentage of
sequence identity. In cases where the two sequences are of
different lengths or the alignment produces one or more staggered
ends and the specified region of comparison includes only a single
sequence, the residues of the single sequence are included in the
denominator but not the numerator of the calculation.
[0090] "Homology" or "homologous" as used herein in the context of
two or more polypeptide or polynucleotide sequences, can mean that
the sequences have a specified percentage of residues that are
either i) the same, or ii) conservative substitutions of the same
residue, over a specified region. Conservative substitutions
include substitutions of one amino acid by an amino acid of the
same group, and include substitutions of one amino acid by an amino
acid as an exemplary or as a preferred substitution as known in the
art. In determining homology of two sequences, identical residues
and homologous residues are given equal weight. The percentage can
be calculated by optimally aligning the two sequences, comparing
the two sequences over the specified region, determining the number
of positions at which either identical or homologous residues occur
in both sequences to yield the number of matched positions,
dividing the number of matched positions by the total number of
positions in the specified region, and multiplying the result by
100 to yield the percentage of sequence homology. In cases where
the two sequences are of different lengths or the alignment
produces one or more staggered ends and the specified region of
comparison includes only a single sequence, the residues of the
single sequence are included in the denominator but not the
numerator of the calculation.
[0091] As used herein, in the context of two or more polymeric
molecules (e.g. nucleic acids, proteins), "corresponds to",
"corresponding to", and the like refers to polymeric molecules or
portions thereof which have the same or similar sequence of
component elements (e.g. nucleotides, amino acids). For example, if
a first nucleic acid is described as containing a region which
"corresponds to" the sequence of a second nucleic acid, the
relevant region of the first nucleic acid has a nucleotide sequence
which is the same or similar to the sequence of the second nucleic
acid.
[0092] As used herein, the term "isolated" as applied to proteins,
nucleic acids, or other biomolecules refers to a molecule that has
been purified or separated from a component of its
naturally-occurring environment (e.g. a protein purified from a
cell in which it was naturally produced). An "isolated" molecule
may be in contact with other molecules (for example, as part of a
reaction mixture). As used herein, "isolated" molecules also
include recombinantly-produced proteins or nucleic acids which have
an amino acid or nucleotide sequence which occurs naturally.
"Isolated" nucleic acids include polypeptide-encoding nucleic acid
molecules contained in cells that ordinarily express the
polypeptide where, for example, the nucleic acid molecule is at a
chromosomal location different from that of natural cells. In some
embodiments, "isolated" polypeptides are purified to at least 50%,
60%, 70%, 80%, 90%, 95%, 98%, or 100% homogeneity as evidenced by
SDS-PAGE of the polypeptides followed by Coomassie blue, silver, or
other protein staining method.
[0093] As used herein, a nucleic acid molecule which is described
as containing the "sequence" of a template or other nucleic acid
may also be considered to contain the template or other nucleic
acid itself (e.g. a molecule which is described as containing the
sequence of a template may also be described as containing the
template), unless the context clearly dictates otherwise.
[0094] As used herein, when a first polynucleotide is described as
"annealed", "annealing" or the like to a second polynucleotide, the
entirety of the first polynucleotide or any portion thereof may
anneal to the second polynucleotide, and vice versa.
[0095] As used herein, a reference to "treating" a given object to
a condition or other object or the like refers to directly or
indirectly exposing the given object to the recited condition or
other object. Thus, while a "treating" step may involve a distinct
related action (e.g. adding an enzyme to a vessel, shaking a
vessel, etc.), not every "treating" step requires a distinct
related action. For example, a reaction involving one or more
reagents can be set up in a vessel, and once the reaction has been
initiated, multiple events or steps may occur in the vessel without
further human or mechanical intervention with the contents of the
vessel. One or more of these multiple events or steps in the vessel
may be described as "treating" an object in the vessel, even if no
separate intervention with the contents of the vessel occurs after
the initiation of the reaction.
[0096] As used herein, the term "Zika" refers to Zika virus, and
the acronym "ZIKV" also refers to Zika virus. ZIKV is a member of
the Flavivirus genus of viruses (family Flaviviridae). Other
members of the genus include dengue virus (DENV), West Nile Virus
(WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV),
and tick-borne encephalitic virus (TBEV). Flaviviruses have a
single-strand, positive-sense RNA genome that serves both as a
genome and messenger RNA. The RNA genome is translated into a
single polyprotein that is proteolytically cleaved into three
structural proteins (capsid, prM, and envelope) and non-structural
proteins NS1 to NS5. The virion contains a nucleocapsid composed of
the capsid protein (C) and the RNA genome, surrounded by an
icosahedral shell comprising both the envelope (E) glycoprotein and
membrane (M) protein or the precursor membrane (prM) protein
anchored in a lipid membrane.
[0097] A composition may include a buffer. Buffers include, without
limitation, phosphate, citrate, ammonium, acetate, carbonate,
tris(hydroxymethyl)aminomethane (TRIS), 3-(N-morpholino)
propanesuifonic acid (MOPS), 3-morpholino-2-hydroxypropanesulfonic
acid (MOPSO), 2-(N-morpholino)ethanesulfonic acid (MES),
N-(2-Acetamido)-iminodiacetic acid (ADA),
piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES),
N-(2-Acetamido)-2-aminoethanesulfonic acid (ACES), cholamine
chloride, N,N-Bis(2-hydroxyethyl)-2-aminoethanesulfonic acid (BES),
2-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic
acid (TES), 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid
(HEPES), acetamidoglycine, tricine
(N-(2-Hydroxy-1,1-bis(hydroxymethyl)ethyl)glycine), glycinamide,
and bicine (2-(Bis(2-hydroxyethyl)amino)acetic acid) buffers.
Buffers include other organic acid buffers in addition to the
phosphate, citrate, ammonium, acetate, and carbonate buffers
explicitly mentioned herein.
[0098] An article of manufacture may comprise a container; and a
composition contained within the container, wherein the composition
comprises a nucleic acid molecule (such as, e.g., a primer directed
to a target related to ZIKV). An article of manufacture may
comprise a container; and a composition contained within the
container, wherein the composition comprises a nucleic acid
molecule (such as, e.g., a primer directed to a target related to
ZIKV). An article of manufacture may comprise a container; and a
composition contained within the container, wherein the composition
comprises a nucleic acid molecule (such as, e.g., a primer directed
to a target related to ZIKV). The containers may be formed from a
variety of materials such as glass or plastic, and may have a
sterile access port (for example the container may be an
intravenous solution bag or a vial having a stopper pierceable by a
hypodermic injection needle). The article of manufacture may
further comprise a label or package insert on or associated with
the container indicating that the composition may be used to detect
the presence of a nucleic acid molecule (such as, e.g., a primer
directed to a target related to ZIKV) in a sample.
Hybrid Nucleic Acid Amplification Methods
[0099] In embodiments, provided herein is method for amplification
of a target nucleic acid, wherein the method includes at least two
different nucleic acid amplification processes. In embodiments, a
target nucleic acid may be first be amplified by a first nucleic
acid amplification method which involves thermocycling, and then
some or all of the target nucleic acid amplified in the
thermocycling reaction may then be used for a second nucleic acid
amplification reaction, wherein the second nucleic acid
amplification reaction is an isothermal amplification reaction. For
example, a target nucleic acid may be first amplified in a
polymerase chain reaction ("PCR") amplification reaction
(described, for example, in U.S. Pat. No. 4,683,202). PCR
amplification methods are thermocycling amplification methods.
[0100] Then, following amplification by a PCR method, some or all
of the amplified target nucleic acid from the PCR reaction may be
used in an isothermal nucleic acid amplification reaction, such as
is described in, for example, any of International Application No.
PCT/US14/30028, filed Mar. 15, 2014, International Application No.
PCT/US14/30034, filed Mar. 15, 2014, International Application No.
PCT/US14/56151, filed Sep. 17, 2014, or International Application
No. PCT/US14/30036, filed Mar. 15, 2014, are each herein
incorporated by reference in their entirety for all purposes. For
brevity hereafter, the isothermal nucleic acid amplification
methods described in PCT/US14/30028, in PCT/US14/30034, in
PCT/US14/56151, and in PCT/US14/30036 are collectively termed "NAA"
methods.
[0101] The present methods improve (i.e., lower) the limit of
detection (LOD) of nucleic acid amplification assays. That is, the
presence of smaller numbers of target nucleic acid sequences in a
sample can be detected when pre-amplification by thermal-cycling
methods are applied to the sample, and then isothermal nucleic acid
amplification methods are applied, as compared to when isothermal
methods are applied to a sample without such pre-amplification. As
few as 1 copy per microliter of target nucleic acid has been
detected in samples using PCR followed by NAA methods.
PCR Methods
[0102] Polymerase chain reaction ("PCR") methods (see, e.g. U.S.
Pat. No. 4,683,202) are popular methods for the amplification of
nucleic acids. PCR methods are in vitro methods that can be used to
amplify specific polynucleotide sequences, including genomic DNA,
single-stranded cDNA, and mRNA among others. As described in U.S.
Pat. Nos. 4,683,202, 4,683,195, and 4,800,159 (hereby incorporated
herein by reference), PCR typically comprises treating separate
complementary strands of a target nucleic acid with two
polynucleotide primers to form complementary primer extension
products on both strands that act as templates for synthesizing
copies of the desired nucleic acid sequences. By repeating the
separation and synthesis steps in an automated system, essentially
exponential duplication of the target sequences can be
achieved.
[0103] To successfully perform a PCR reaction, the reaction must be
performed at multiple different temperatures. This requires
hardware or other mechanisms for repeatedly changing the
temperature of the PCR reaction. In embodiments where the target
nucleic acid is RNA, reverse transcription PCR (rtPCR) may be
used.
[0104] As used herein, PCR refers to any of the nucleic acid
amplification methods in which a target nucleic acid (typically a
double-stranded deoxyribonucleic acid) is exposed to a thermostable
DNA polymerase during multiple thermal cycles, and in which
multiple copies of the target nucleic acid (typically including
copies of nucleic acid sequences disposed between a first target
region on one strand of a double-stranded target nucleic acid and a
second target region on the complementary strand of a
double-stranded target nucleic acid) are produced, amplifying the
target nucleic acid. Thermal cycles typically include low
temperature portions (typically at temperatures between about
40.degree. C. and about 59.degree. C., or between about 45.degree.
C. and about 55.degree. C.), intermediate temperature portions
(typically at temperatures between about 60.degree. C. and about
74.degree. C.), and higher temperature portions (typically at
temperatures between about 75.degree. C. and about 99.degree. C.,
or between about 80.degree. C. and about 95.degree. C.). For
example, some PCR reactions include a) incubation of a mixture
including target molecules and primers at high temperature (e.g.,
about 90.degree. C. to about 95.degree. C.) to denature the target
DNA; b) cooling the mixture to an intermediate temperature (e.g.,
about 50.degree. C. to about 60.degree. C.) to allow annealing
between the primers and target DNA; and c) in the presence of DNA
polymerase, generating extensions of the primers (e.g., by action
of the polymerase at, e.g. temperatures of about 65.degree. C. to
about 75.degree. C.); and repeating this cycle of steps a), b), and
c). Steps a), b), and c) together may be termed a "thermal
cycle".
[0105] Amplification occurs with each thermal cycle, and, following
multiple cycles, significant amplification of the target nucleic
acid molecule produces large numbers of DNA copies of the target
sequence. PCR requirements include a DNA polymerase (e.g., a
thermostable DNA polymerase), deoxynucleotides (typically as
deoxynucleotide tri-phosphates ("dNTPs") such as dATP, dTTP, dGTP,
and dCTP), and appropriate buffer solutions. Where a target nucleic
acid is an RNA target, reverse transcriptase (RT) may be used to
produce a DNA copy of the RNA, and PCR applied to the DNA
copies.
[0106] Reverse transcription PCR (RT-PCR) refers to methods for
amplifying RNA targets, in which copy DNA molecules (cDNAs) are
produced from RNA target polynucleotides by application of reverse
transcriptase, and PCR is applied to the cDNA copies to amplify the
cDNA copies for detection and/or amplification of the target
polynucleotide. RT-PCR requirements include a reverse
transcriptase, a DNA polymerase (e.g., a thermostable DNA
polymerase), deoxynucleotides (typically as dNTPs such as dATP,
dTTP, dGTP, and dCTP), and appropriate buffer solutions.
[0107] Real-time PCR refers to PCR amplification methods in which
the progress, or extent, of target amplification is monitored
during the course of the assay (e.g., at each thermal cycle).
Progress of the amplification reactions may be monitored, for
example, detecting the amount of fluorescence or absorbance of
reporter molecules. Suitable reporter molecules include
intercalating dyes (which are detectable when bound to
double-stranded DNA, or to the minor groove of DNA, such as
ethidium bromide and SYBR Green dye); fluorogenic probes, such as
self-quenching dyes, or dye pairs (the pairs including a dye and a
quencher) attached to primers (which fluoresce when the primer is
bound to target, but do not produce significant fluorescence when
not hybridized to target nucleic acid molecules); and other
reporter molecules.
[0108] As used herein, "rRT-PCR" refers to reverse-transcription
real-time PCR. rRT-PCR is real-time PCR applied to RNA targets,
using reverse-transcription PCR to amplify nucleic acids based on
RNA target molecules, and monitoring the amplification using
real-time PCR methods. Reverse-transcription PCR methods provide
the DNA substrate required for PCR by contacting a sample, under
the appropriate conditions, with a reverse transcriptase and
producing cDNA copies of RNA molecules in the sample.
NAA Methods
[0109] It will be understood that complete description of the
isothermal nucleic acid amplification methods termed herein "NAA
methods" is to be found in U.S. Patent Application Publication
2014/0295440, in U.S. Patent Application Publication 2015/0140567,
in U.S. Patent Application Publication 2016/0060673, in U.S. Patent
Application Publication 2016-0060674, in U.S. Patent Application
Publication 2016/0076069, and in U.S. Patent Application
Publication 2016/0201148 (each of which is hereby incorporated by
reference in theirs entireties); however, these methods are also
briefly summarized in the following.
[0110] NAA methods of nucleic acid amplification may be applied to
double-stranded DNA. However, target nucleic acid molecules need
not be limited to double-stranded DNA targets; for example,
double-stranded DNA for use in NAA methods described herein may be
prepared from viral RNA, or mRNA, or other single stranded RNA
target sources, by reverse transcriptase. In further example,
double-stranded DNA for use in NAA methods described herein may be
prepared from single-stranded DNA targets by DNA polymerase. Such
methods may be applied as an initial step, prior to application of
the NAA methods discussed below.
[0111] Amplification of a double-stranded DNA target, for example,
begins with a primary double-stranded DNA to be amplified (termed
the "primary nucleic acid" in the following). The primary nucleic
acid contains a target region termed a template region; the
template region has a template sequence. Such a double-stranded
template region contains a first DNA strand and a complementary
second DNA strand, and includes a 5' terminal nucleotide in one
strand and a 3' terminal nucleotide in the other strand that are
complementary to each other.
[0112] A first primer and a second primer are provided which each
have template-binding regions and tail regions; the primer
template-binding regions are complementary to the target template
regions. The tail regions of the primers may contain three
components: a) the 5' terminal nucleotide of the primer, b) an
innermost nucleotide, wherein the innermost nucleotide is
downstream from the 5' terminal nucleotide, and c) a middle section
between the 5' terminal nucleotide and the innermost nucleotide,
comprising one or more nucleotides. In addition, at least portions
of the two primer tail regions may be complementary to each other
when properly aligned.
[0113] It should be noted that although the tail region of the
second primer may contain a nucleotide sequence which is
complementary to the nucleotide sequence of the tail region of the
first primer, typically, products formed by the annealing of the
first primer and second primer are not desirable or useful for
methods or compositions provided herein. Accordingly, in some
embodiments, steps may be taken to minimize the formation of first
primer--second primer annealed products. Such steps may include,
for example, not pre-incubating a first primer and a second primer
under conditions where the primers may anneal for an extended
period of time before initiating a method provided herein.
[0114] The primary nucleic acid may be treated with a polymerase
and a first copy of the first primer under conditions such that the
template-binding region of the first copy of the first primer
anneals to the first strand of the nucleic acid template. Under
these conditions, an extension product of the first copy of the
first primer is formed. The polymerase, which may have strand
displacement activity, may catalyze the formation of the extension
product of the first copy of the first primer. The first copy of
the first primer may be covalently linked to the synthesized
extension product, such that the first copy of the first primer
(which is complementary to the first strand of the nucleic acid
template) becomes part of the molecule described herein as the
"extension product of the first copy of the first primer." The
template-binding region but not the tail region of the first copy
of the first primer anneals to the first strand of the nucleic acid
template. Examples of conditions suitable for polymerase-based
nucleic acid synthesis are known in the art and are provided, for
example, in Molecular Cloning: A Laboratory Manual, M. R. Green and
J. Sambrook, Cold Spring Harbor Laboratory Press (2012), which is
incorporated by reference herein in its entirety.
[0115] The extension product of the first copy of the first primer
may be treated with a polymerase (which may have strand
displacement activity) and with the second primer under conditions
such that the template-binding region of the second primer anneals
to the extension product of the first copy of the first primer. In
this way, an extension product of the second primer may be formed.
The polymerase may displace the first strand of the nucleic acid
template from the extension product of the first copy of the first
primer during the synthesis of the extension product of the second
primer. The second primer may be covalently linked to the
synthesized extension product, such that the second primer becomes
part of the molecule described herein as the "extension product of
the second primer." The extension product of the second primer is
complementary to the extension product of the first copy of the
first primer. The template-binding region but not the tail region
of the second primer may anneal to the extension product of the
first copy of the first primer when the second primer anneals to
the extension product of the first copy of the first primer.
[0116] The extension product of the second primer may be treated
with a polymerase (which may have strand displacement activity) and
a second copy of the first primer so as to form an extension
product of the second copy of the first primer. During the
generation of the extension product of the second copy of the first
primer, the second copy of the first primer may be covalently
linked to the synthesized extension product, such that the second
copy of the first primer becomes part of the molecule described
herein as the "extension product of the second copy of the first
primer." The extension product of the second copy of the first
primer is complementary to the extension product of the second
primer.
[0117] Generation of the extension product of the second copy of
the first primer may result in the generation of a molecule
comprising the extension product of the second copy of the first
primer and the extension product of the second primer, which may be
referred to herein as the "secondary nucleic acid." A secondary
nucleic acid may comprise the 3' terminal region of the extension
product of the second primer (and the complement thereof) and may
comprise the 3' terminal region of the extension product of the
second copy of the first primer (and the complement thereof).
Secondary nucleic acid molecules include sequences of the template
region adjacent to tail sequences. In embodiments, double-stranded
nucleic acids are produced in which complementary template and tail
region sequences line up. In practice, multiple copies (e.g., two
or more) of the secondary nucleic acid are produced by any process
whereby a nucleic acid having the general structure of the
secondary nucleic acid may be generated, including by practice of
NAA methods discussed herein.
[0118] Thus, pairs of copies of the secondary nucleic acid may be
provided. Further numbers of copies may then be generated, for
example, by repetition of the foregoing steps and methods. For
example, the full process as described above for generating a
secondary nucleic acid from a primary nucleic acid may be repeated
two times, in order to generate a two pairs of copies of the
secondary nucleic acid; further repetitions may be performed to
amplify the number of copies further, e.g., to exponentially
amplify the number of copies (e.g., by powers of two).
[0119] In addition, since the secondary nucleic acid molecules
include sequences of the template region adjacent to tail
sequences, partially double-stranded nucleic acids may be produced
in which tail region sequences hybridize and line up. Since these
tail region sequences are attached to single-stranded template
regions, a cross-over structure having two nucleic acid strands
together held by the hybridized tail region sequences is produced.
These cross-over structures may be extended by a polymerase to form
extension products of both component strands. These extension
products which may be referred to as "concatemer strands." Two
concatemer strands may be annealed together, and may be
collectively referred to as a concatemer; such concatemers may
contain two or more copies of the nucleic acid template.
[0120] In some embodiments, even longer concatemers may be formed.
For example, concatemers may anneal together; or two concatemer
molecules may form a cross-over structure similar to those formed
by the shorter molecules termed concatemer strands, as discussed
above, followed by a larger concatemer molecule containing four
copies of the nucleic acid template. In another example, a
secondary nucleic acid and a concatemer may form a cross-over
structure, followed by a larger concatemer molecule containing
three copies of the nucleic acid template. In some embodiments,
multiple different concatemers of multiple different lengths may be
simultaneously generated.
[0121] Thus, concatemers generated according to such methods may be
of any length of nucleotides. In some embodiments, concatemer
molecules generated herein may be at least 30, 40, 50, 60, 70, 80,
90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000,
1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000,
15,000, 20,000, or 25,000 nucleotides in length. Concatemers
generated according to such methods may contain any number of
copies of a nucleic acid template. In some embodiments, concatemer
molecules generated herein may contain at least 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40,
45, 50, 60, 70, 80, 90, or 100 copies of a nucleic acid template.
Further examples are provided, and greater detail of these and
other examples, is provided in U.S. Patent Application 61/800,606,
filed Mar. 15, 2013.
Detection of Reactions
[0122] Progress of a method provided herein may be monitored in
multiple different ways. In one embodiment, a reaction may be
assayed for a nucleic acid amplification product (e.g. for the
level of the product or the rate of its generation). In another
embodiment, a reaction may be assayed for the activity of a
polymerase along a nucleic acid template (e.g. for movement of a
polymerase along a template strand). Thus, in some embodiments,
events of a method provided herein may observed due to the
accumulation of product from a method (which may be during or after
completion of steps of the method), or due to detectable events
occurring during the steps of a method.
[0123] The presence of amplified nucleic acids can be assayed, for
example, by detection of reaction products (amplified nucleic acids
or reaction by-products) or by detection of probes associated with
the reaction progress.
[0124] In some embodiments, reaction products may be identified by
staining the products with a dye. In some embodiments, a dye may
have greater fluorescence when bound to a nucleic acid than when
not bound to a nucleic acid. In some embodiments, a dye may
intercalate with a double-stranded nucleic acid or it may bind to
an external region of a nucleic acid. Nucleic acid dyes that may be
used with methods and compositions provided herein include, for
example, cyanine dyes, PicoGreen.RTM., OliGreen.RTM.,
RiboGreen.RTM., SYBR.RTM. dyes, SYBR.RTM. Gold, SYBR.RTM. Green I,
SYBR.RTM. Green II, ethidium bromide, dihydroethidium,
BlueView.TM., TOTO.RTM. dyes, TO-PRO.RTM. dyes, POPO.RTM. dyes,
YOYO.RTM. dyes, BOBO.RTM. dyes, JOJO.RTM. dyes, LOLO.RTM. dyes,
SYTOX.RTM. dyes, SYTO.RTM. dyes, propidium iodide, hexidium iodide,
methylene blue, DAPI, acridine orange, quinacrine, acridine dimers,
9-amino-6-chloro-2-methoxyacridine, bisbenzimide dyes, Hoechst
dyes, 7-aminoactinomycin D, actinomycin D, hydroxystilbamidine,
pyronin Y, Diamond.TM. dye, GelRed.TM., GelGreen.TM. and LDS
751.
[0125] Methods of detecting the presence of a target marker, such
as, e.g. a virus such as a flu virus, a bacterium such as a
Staphylococcus aureus bacterium, or other biological target may be
detected in a sample are disclosed herein, wherein the presence of
a plurality of possible targets are tested from a single sample
within a short period of time. In embodiments, the plurality of
possible targets comprise at least 5 possible targets, or at least
10 possible targets, or at least 15 possible targets, or at least
20 possible targets, or at least 25 possible targets, or at least
30 possible targets, or at least 35 possible targets, or at least
40 possible targets, or at least 45 possible targets, or at least
50 possible targets, or at least 55 possible targets, or at least
60 possible targets, or at least 64 possible targets, or at least
65 possible targets, or more. In embodiments, a short period of
time is a period of time that is five hours or less, or is four
hours or less, or is three hours or less, or is two hours or less,
or is one hour or less, or is 50 minutes or less, or is 40 minutes
or less, or is 30 minutes or less, or is 20 minutes or less, or is
10 minutes or less, or is 5 minutes or less.
[0126] In some embodiments, reaction products may be identified by
analysis of turbidity of amplification reactions for example, where
increased turbidity is correlated with formation of reaction
products and reaction by-products (e.g. pyrophosphate complexed
with magnesium).
[0127] In some embodiments, reaction products may be identified by
separating a reaction performed according to a method herein by gel
electrophoresis, followed by staining of the gel with a dye for
nucleic acids. The dye may be any nucleic acid dye disclosed herein
or otherwise known in the art.
[0128] In some embodiments, any method or composition known in the
art for the detection of nucleic acids or processes associated with
the generation of nucleic acids may be used with methods and
compositions provided herein.
[0129] In some embodiments, a nucleic acid probe which contains a
nucleotide sequence complementary to a portion of a nucleic acid
template strand (or strand having a similar or identical sequence)
and which contains one or both of a fluorescent reporter
(fluorophore) and a quencher are included in a reaction provided
herein.
[0130] In an example, a nucleic acid probe may contain a
fluorescent reporter at its 5' or 3' terminus, and a quencher at
the other terminus.
[0131] In another example, a nucleic acid probe may contain a
fluorescent reporter at its 5' or 3' terminus, and it may be
annealed to a nucleic acid primer containing a quencher. The
nucleic acid primer containing a quencher may contain the quencher
at a position in the primer such that when the nucleic acid probe
is annealed to the primer, the fluorescent reporter is
quenched.
[0132] In probes containing a fluorescent reporter and quencher
pair, the fluorescent reporter and quencher may be selected so that
the quencher can effectively quench the reporter. In some
embodiments, a fluorescent reporter is paired with a quencher where
the emission maximum of the fluorescent reporter is similar to the
absorption maximum of the quencher. Fluorphores that may be used as
the fluorescent reporter include, for example, CAL Fluor Gold, CAL
Fluor Orange, Quasar 570, CAL Fluor Red 590, CAL Fluor Red 610, CAL
Fluor Red 610, CAL Fluor Red 635, Quasar 670 (Biosearch
Technologies), VIC, NED (Life Technologies), Cy3, Cy5, Cy5.5 (GE
Healthcare Life Sciences), Oyster 556, Oyster 645 (Integrated DNA
Technologies), LC red 610, LC red 610, LC red 640, LC red 670, LC
red 705 (Roche Applied Science), Texas red, FAM, TET, HEX, JOE,
TMR, and ROX. Quenchers that may be used include, for example,
DDQ-I, DDQ-II (Eurogentec), Eclipse (Epoch Biosciences), Iowa Black
FQ, Iowa Black RQ (Integrated DNA Technologies), BHQ-1, BHQ-2,
BHQ-3 (Biosearch Technologies), QSY-7, QSY-21 (Molecular Probes),
and Dabcyl.
[0133] In some embodiments, a method provided herein may be
monitored in an apparatus containing a light source and an optical
sensor. In some situations, the reaction may be positioned in the
path of light from the light source, and light absorbed by the
sample (e.g. in the case of a turbid reaction), scattered by the
sample (e.g. in the case of a turbid reaction), or emitted by the
sample (e.g. in the case of a reaction containing a fluorescent
molecule) may be measured.
[0134] In embodiments, the sample may be diluted prior to testing
for the presence of a plurality of disease-causing agents. In
embodiments, such dilution of a sample is greater for subjects who
have a condition which indicates they may have higher levels of
disease-causing agents than subject who do not have that condition,
or than subjects who have a different condition.
Systems and Devices for Detection of Targets in Samples
[0135] The assays and methods disclosed herein may be performed on
a device, or on a system, for processing a sample. In embodiments,
Applicants disclose herein systems and devices suitable for use in
performing methods disclosed herein. The assays and methods
disclosed herein can be readily incorporated into and used in
device for processing a sample, or a system for processing a
sample, which may be an automated assay device, or may be an
automated assay system. Such a device, and such a system, may be
useful for the practice of the methods disclosed herein. For
example, a device may be useful for receiving a sample. A device
may be useful for preparing, or for processing a sample. A device
may be useful for performing an assay on a sample. A device may be
useful for obtaining data from a sample. A device may be useful for
transmitting data obtained from a sample. A device may be useful
for disposing of a sample following processing or assaying of a
sample.
[0136] A device may be part of a system, a component of which may
be an automated assay device. A device may be an automated assay
device. An automated assay device may be configured to facilitate
collection of a sample, prepare a sample for a clinical test, or
effect a chemical reaction with one or more reagents or other
chemical or physical processing, as disclosed herein. An automated
assay device may be configured to obtain data from a sample. An
automated assay device may be configured to transmit data obtained
from a sample. An automated assay device may be configured to
analyze data from a sample. An automated assay device may be
configured to communicate with another device, or a laboratory, or
an individual affiliated with a laboratory, to analyze data
obtained from a sample.
[0137] An automated assay device may be configured to be placed in
or on a subject. An automated assay device may be configured to
accept a sample from a subject, either directly or indirectly. A
sample may be, for example, a blood sample (e.g., a sample obtained
from a fingerstick, or from venipuncture, or an arterial blood
sample), a urine sample, a biopsy sample, a tissue slice, stool
sample, or other biological sample; a water sample, a soil sample,
a food sample, an air sample; or other sample. A blood sample may
comprise, e.g., whole blood, plasma, or serum. An automated assay
device may receive a sample from the subject through a housing of
the device. The sample collection may occur at a sample collection
site, or elsewhere. The sample may be provided to the device at a
sample collection site.
[0138] In some embodiments, an automated assay device may be
configured to accept or hold a cartridge. In some embodiments, an
automated assay device may comprise a cartridge. The cartridge may
be removable from the automated assay device. In some embodiments,
a sample may be provided to the cartridge of the automated assay
device. Alternatively, a sample may be provided to another portion
of an automated assay device. The cartridge and/or device may
comprise a sample collection unit that may be configured to accept
a sample.
[0139] A cartridge may include a sample, and may include reagents
for use in processing or testing a sample, disposables for use in
processing or testing a sample, or other materials. Following
placement of a cartridge on, or insertion of a cartridge into, an
automated assay device, one or more components of the cartridge may
be brought into fluid communication with other components of the
automated assay device. For example, if a sample is collected at a
cartridge, the sample may be transferred to other portions of the
automated assay device. Similarly, if one or more reagents are
provided on a cartridge, the reagents may be transferred to other
portions of the automated assay device, or other components of the
automated assay device may be brought to the reagents. In some
embodiments, the reagents or components of a cartridge may remain
on-board the cartridge. In some embodiments, no fluidics are
included that require tubing or that require maintenance (e.g.,
manual or automated maintenance).
[0140] A sample or reagent may be transferred to a device, such as
an automated assay device. A sample or reagent may be transferred
within a device. Such transfer of sample or reagent may be
accomplished without providing a continuous fluid pathway from
cartridge to device. Such transfer of sample or reagent may be
accomplished without providing a continuous fluid pathway within a
device. In embodiments, such transfer of sample or reagent may be
accomplished by a sample handling system (e.g., a pipette); for
example, a sample, reagent, or aliquot thereof may be aspirated
into an open-tipped transfer component, such as a pipette tip,
which may be operably connected to a sample handling system which
transfers the tip, with the sample, reagent, or aliquot thereof
contained within the tip, to a location on or within the automated
assay device. The sample, reagent, or aliquot thereof can be
deposited at a location on or within the automated assay device.
Sample and reagent, or multiple reagents, may be mixed using a
sample handling system in a similar manner. One or more components
of the cartridge may be transferred in an automated fashion to
other portions of the automated assay device, and vice versa.
[0141] A device, such as an automated assay device, may have a
fluid handling system. A fluid handling system may perform, or may
aid in performing, transport, dilution, extraction, aliquotting,
mixing, and other actions with a fluid, such as a sample. In some
embodiments, a fluid handling system may be contained within a
device housing. A fluid handling system may permit the collection,
delivery, processing and/or transport of a fluid, dissolution of
dry reagents, mixing of liquid and/or dry reagents with a liquid,
as well as collection, delivery, processing and/or transport of
non-fluidic components, samples, or materials. The fluid may be a
sample, a reagent, diluent, wash, dye, or any other fluid that may
be used by the device, and may include, but not limited to,
homogenous fluids, different liquids, emulsions, suspensions, and
other fluids. A fluid handling system, including without limitation
a pipette, may also be used to transport vessels (with or without
fluid contained therein) around the device. The fluid handling
system may dispense or aspirate a fluid. The sample may include one
or more particulate or solid matter floating within a fluid.
[0142] In embodiments, a fluid handling system may comprise a
pipette, pipette tip, syringe, capillary, or other component. The
fluid handling system may have portion with an interior surface and
an exterior surface and an open end. The fluid handling system may
comprise a pipette, which may include a pipette body and a pipette
nozzle, and may comprise a pipette tip. A pipette tip may or may
not be removable from a pipette nozzle. In embodiments, a fluid
handling system may use a pipette mated with a pipette tip; a
pipette tip may be disposable. A tip may form a fluid-tight seal
when mated with a pipette. A pipette tip may be used once, twice,
or more times. In embodiments, a fluid handling system may use a
pipette or similar device, with or without a pipette tip, to
aspirate, dispense, mix, transport, or otherwise handle the fluid.
The fluid may be dispensed from the fluid handling system when
desired. The fluid may be contained within a pipette tip prior to
being dispensed, e.g., from an orifice in the pipette tip. In
embodiments, or instances during use, all of the fluid may be
dispensed; in other embodiments, or instances during use, a portion
of the fluid within a tip may be dispensed. A pipette may
selectively aspirate a fluid. The pipette may aspirate a selected
amount of fluid. The pipette may be capable of actuating stirring
mechanisms to mix the fluid within the tip or within a vessel. The
pipette may incorporate tips or vessels creating continuous flow
loops for mixing, including of materials or reagents that are in
non-liquid form. A pipette tip may also facilitate mixture by
metered delivery of multiple fluids simultaneously or in sequence,
such as in 2-part substrate reactions.
[0143] The fluid handling system may include one or more
fluidically isolated or hydraulically independent units. For
example, the fluid handling system may include one, two, or more
pipette tips. The pipette tips may be configured to accept and
confine a fluid. The tips may be fluidically isolated from or
hydraulically independent of one another. The fluid contained
within each tip may be fluidically isolated or hydraulically
independent from one fluids in other tips and from other fluids
within the device. The fluidically isolated or hydraulically
independent units may be movable relative to other portions of the
device and/or one another. The fluidically isolated or
hydraulically independent units may be individually movable. A
fluid handling system may comprise one or more base or support. A
base or support may support one or more pipette or pipette units. A
base or support may connect one or more pipettes of the fluid
handling system to one another.
[0144] An automated assay device may be configured to perform
processing steps or actions on a sample obtained from a subject.
Sample processing may include sample preparation, including, e.g.,
sample dilution, division of a sample into aliquots, extraction,
contact with a reagent, filtration, separation, centrifugation, or
other preparatory or processing action or step. An automated assay
device may be configured to perform one or more sample preparation
action or step on the sample. Optionally, a sample may be prepared
for a chemical reaction and/or physical processing step. A sample
preparation action or step may include one or more of the
following: centrifugation, separation, filtration, dilution,
enriching, purification, precipitation, incubation, pipetting,
transport, chromatography, cell lysis, cytometry, pulverization,
grinding, activation, ultrasonication, micro column processing,
processing with magnetic beads, processing with nanoparticles, or
other sample preparation action or steps. For example, sample
preparation may include one or more step to separate blood into
serum and/or particulate fractions, or to separate any other sample
into various components. Sample preparation may include one or more
step to dilute and/or concentrate a sample, such as a blood sample,
or other biological samples. Sample preparation may include adding
an anti-coagulant or other ingredients to a sample. Sample
preparation may also include purification of a sample. In
embodiments, all sample processing, preparation, or assay actions
or steps are performed by a single device. In embodiments, all
sample processing, preparation, or assay actions or steps are
performed within a housing of a single device. In embodiments, most
sample processing, preparation, or assay actions or steps are
performed by a single device, and may be performed within a housing
of a single device. In embodiments, many sample processing,
preparation, or assay actions or steps are performed by a single
device, and may be performed within a housing of a single device.
In embodiments, sample processing, preparation, or assay actions or
steps may be performed by more than one device.
[0145] An automated assay device may be configured to run one or
more assay on a sample, and to obtain data from the sample. An
assay may include one or more physical or chemical treatments, and
may include running one or more chemical or physical reactions. An
automated assay device may be configured to perform one, two or
more assays on a small sample of bodily fluid. One or more chemical
reaction may take place on a sample having a volume, as described
elsewhere herein. For example one or more chemical reaction may
take place in a pill having less than femtoliter volumes. In an
instance, the sample collection unit is configured to receive a
volume of the bodily fluid sample equivalent to a single drop or
less of blood or interstitial fluid. In embodiments, the volume of
a sample may be a small volume, where a small volume may be a
volume that is less than about 1000 .mu.L, or less than about 500
.mu.L, or less than about 250 .mu.L, or less than about 150 .mu.L,
or less than about 100 .mu.L, or less than about 75 .mu.L, or less
than about 50 .mu.L, or less than about 40 .mu.L, or less than
about 20 .mu.L, or less than about 10 .mu.L, or other small volume.
In embodiments, all sample assay actions or steps are performed on
a single sample. In embodiments, all sample assay actions or steps
are performed by a single device. In embodiments, all sample assay
actions or steps are performed within a housing of a single device.
In embodiments, most sample assay actions or steps are performed by
a single device, and may be performed within a housing of a single
device. In embodiments, many sample assay actions or steps are
performed by a single device, and may be performed within a housing
of a single device. In embodiments, sample processing, preparation,
or assay actions or steps may be performed by more than one
device.
[0146] An automated assay device may be configured to perform a
plurality of assays on a sample. In embodiments, an automated assay
device may be configured to perform a plurality of assays on a
single sample. In embodiments, an automated assay device may be
configured to perform a plurality of assays on a single sample,
where the sample is a small sample. For example, a small sample may
have a sample volume that is a small volume of less than about 1000
.mu.L, or less than about 500 .mu.L, or less than about 250 .mu.L,
or less than about 150 .mu.L, or less than about 100 .mu.L, or less
than about 75 .mu.L, or less than about 50 .mu.L, or less than
about 40 .mu.L, or less than about 20 .mu.L, or less than about 10
.mu.L, or other small volume. An automated assay device may be
capable of performing multiplexed assays on a single sample. A
plurality of assays may be run simultaneously; may be run
sequentially; or some assays may be run simultaneously while others
are run sequentially. One or more control assays and/or calibrators
(e.g., including a configuration with a control of a calibrator for
the assay/tests) can also be incorporated into the device; control
assays and assay on calibrators may be performed simultaneously
with assays performed on a sample, or may be performed before or
after assays performed on a sample, or any combination thereof. In
embodiments, all sample assay actions or steps are performed by a
single device. In embodiments, all of a plurality of assay actions
or steps are performed within a housing of a single device. In
embodiments, most sample assay actions or steps, of a plurality of
assays, are performed by a single device, and may be performed
within a housing of a single device. In embodiments, many sample
assay actions or steps, of a plurality of assays, are performed by
a single device, and may be performed within a housing of a single
device. In embodiments, sample processing, preparation, or assay
actions or steps may be performed by more than one device.
[0147] In embodiments, all of a plurality of assays may be
performed in a short time period. In embodiments, such a short time
period comprises less than about three hours, or less than about
two hours, or less than about one hour, or less than about 40
minutes, or less than about 30 minutes, or less than about 25
minutes, or less than about 20 minutes, or less than about 15
minutes, or less than about 10 minutes, or less than about 5
minutes, or less than about 4 minutes, or less than about 3
minutes, or less than about 2 minutes, or less than about 1 minute,
or other short time period.
[0148] An automated assay device may perform nucleic acid assays,
including isothermal nucleic acid assays (e.g., assays for
detecting and measuring nucleic acid targets in a sample, including
DNA and RNA targets). In embodiments, an automated assay device may
perform nucleic acid assays as disclosed in U.S. patent application
Ser. No. 14/183,503, filed Feb. 18, 2014; U.S. patent application
Ser. No. 14/214,850, filed Mar. 15, 2014; International Patent
Application PCT/US2014/030034, filed Mar. 15, 2014; and in
International Patent Application PCT/US2014/056151, filed Sep. 17,
2014. An automated assay device may perform antibody assays,
including enzyme-linked immunosorbent assays (ELISA), and other
assays for detecting and measuring the amounts of proteins
(including antibodies), peptides, and small molecules in samples.
An automated assay device may perform general chemistry assays,
including electrolyte assays (e.g., assays for detecting and
measuring the amounts of electrolytes such as sodium and potassium
in a sample).
[0149] An automated assay device may be configured to detect one or
more signals relating to the sample. An automated assay device may
be configured to identify one or more properties of the sample. For
instance, the automated assay device may be configured to detect
the presence or concentration of one analyte or a plurality of
analytes or a disease condition in the sample (e.g., in or through
a bodily fluid, secretion, tissue, or other sample). Alternatively,
the automated assay device may be configured to detect a signal or
signals that may be analyzed to detect the presence or
concentration of one or more analytes (which may be indicative of a
disease condition) or a disease condition in the sample. The
signals may be analyzed on board the device, or at another
location. Running a clinical test may or may not include any
analysis or comparison of data collected.
[0150] A chemical reaction or other processing step may be
performed, with or without the sample. Examples of steps, tests, or
assays that may be prepared or run by the device may include, but
are not limited to immunoassay, nucleic acid assay, receptor-based
assay, cytometric assay, colorimetric assay, enzymatic assay,
electrophoretic assay, electrochemical assay, spectroscopic assay,
chromatographic assay, microscopic assay, topographic assay,
calorimetric assay, turbidmetric assay, agglutination assay,
radioisotope assay, viscometric assay, coagulation assay, clotting
time assay, protein synthesis assay, histological assay, culture
assay, osmolarity assay, and/or other types of assays,
centrifugation, separation, filtration, dilution, enriching,
purification, precipitation, pulverization, incubation, pipetting,
transport, cell lysis, or other sample preparation action or steps,
or combinations thereof. Steps, tests, or assays that may be
prepared or run by the device may include imaging, including
microscopy, cytometry, and other techniques preparing or utilizing
images. Steps, tests, or assays that may be prepared or run by the
device may further include an assessment of histology, morphology,
kinematics, dynamics, and/or state of a sample, which may include
such assessment for cells.
[0151] A device, such as an automated sample analysis device, may
be capable of performing all on-board steps (e.g., steps or actions
performed by a single device) in a short amount of time. A device
may be capable of performing all on-board steps on a single sample
in a short amount of time. For example, from sample collection from
a subject to transmitting data and/or to analysis may take about 3
hours or less, 2 hours or less, 1 hour or less, 50 minutes or less,
45 minutes or less, 40 minutes or less, 30 minutes or less, 20
minutes or less, 15 minutes or less, 10 minutes or less, 5 minutes
or less, 4 minutes or less, 3 minutes or less, 2 minutes or less,
or 1 minute or less. The amount of time from accepting a sample
within the device to transmitting data and/or to analysis from the
device regarding such a sample may depend on the type or number of
steps, tests, or assays performed on the sample. The amount of time
from accepting a sample within the device to transmitting data
and/or to analysis from the device regarding such a sample may take
about 3 hours or less, 2 hours or less, 1 hour or less, 50 minutes
or less, 45 minutes or less, 40 minutes or less, 30 minutes or
less, 20 minutes or less, 15 minutes or less, 10 minutes or less, 5
minutes or less, 4 minutes or less, 3 minutes or less, 2 minutes or
less, or 1 minute or less.
[0152] A device may be configured to prepare a sample for disposal,
or to dispose of a sample, such as a biological sample, following
processing or assaying of a sample.
[0153] In embodiments, an automated assay device may be configured
to transmit data obtained from a sample. In embodiments, an
automated assay device may be configured to communicate over a
network. An automated assay device may include a communication
module that may interface with the network. An automated assay
device may be connected to the network via a wired connection or
wirelessly. The network may be a local area network (LAN) or a wide
area network (WAN) such as the Internet. In some embodiments, the
network may be a personal area network. The network may include the
cloud. The automated assay device may be connected to the network
without requiring an intermediary device, or an intermediary device
may be required to connect an automated assay device to a network.
An automated assay device may communicate over a network with
another device, which may be any type of networked device,
including but not limited to a personal computer, server computer,
or laptop computer; personal digital assistants (PDAs) such as a
Windows CE device; phones such as cellular phones, smartphones
(e.g., iPhone, Android, Blackberry, etc.), or location-aware
portable phones (such as GPS); a roaming device, such as a
network-connected roaming device; a wireless device such as a
wireless email device or other device capable of communicating
wireless with a computer network; or any other type of network
device that may communicate possibly over a network and handle
electronic transactions. Such communication may include providing
data to a cloud computing infrastructure or any other type of data
storage infrastructure which may be accessed by other devices.
[0154] An automated assay device may provide data regarding a
sample to, e.g., a health care professional, a health care
professional location, such as a laboratory, or an affiliate
thereof. One or more of a laboratory, health care professional, or
subject may have a network device able to receive or access data
provided by the automated assay device. An automated assay device
may be configured to provide data regarding a sample to a database.
An automated assay device may be configured to provide data
regarding a sample to an electronic medical records system, to a
laboratory information system, to a laboratory automation system,
or other system or software. An automated assay device may provide
data in the form of a report.
[0155] A laboratory, device, or other entity or software may
perform analysis on data regarding a sample in real-time. A
software system may perform chemical analysis and/or pathological
analysis, or these could be distributed amongst combinations of
lab, clinical, and specialty or expert personnel. Analysis may
include qualitative and/or quantitative evaluation of a sample.
Data analysis may include a subsequent qualitative and/or
quantitative evaluation of a sample. Optionally, a report may be
generated based on raw data, pre-processed data, or analyzed data.
Such a report may be prepared so as to maintain confidentiality of
the data obtained from the sample, the identity and other
information regarding the subject from whom a sample was obtained,
analysis of the data, and other confidential information. The
report and/or the data may be transmitted to a health care
professional. Data obtained by an automated assay device, or
analysis of such data, or reports, may be provided to a database,
an electronic medical records system, to a laboratory information
system (LIS), to a laboratory automation system (LAS), or other
system or software.
[0156] An example of an integrated system disclosed herein
comprises an integrated system for providing testing and diagnosis
of a subject suspected of suffering from a disease, said system
comprising a means for obtaining a sample (which may include, e.g.,
a sample collection device comprising a lancet, a syringe, a needle
and tube, or other blood collection device; or a nasal swab, a
mouth swab (e.g., a cheek swab), a throat swab, a vaginal swab, or
other swab, and fluid in which to immerse the swab following
contacting the swab with a subject); a cartridge comprising
reagents for assays for the disease; a device for running a
plurality of assays for detecting a plurality of diseases; a
device/means for displaying/communicating the detection of one or
more of said diseases. Such integrated systems may be configured
for uses wherein the sample is a small volume sample; for uses
wherein detection is performed in a short period of time; or for
uses both wherein the sample is a small volume sample and wherein
detection is performed in a short period of time.
[0157] Another example of an integrated system disclosed herein
comprises an integrated system for providing testing and diagnosis
of a subject suspected of suffering from a respiratory disorder,
said system comprising a means for obtaining a sample (which may
include, e.g., a nasal swab, a throat swab, a mouth swab (e.g., a
cheek swab), a vaginal swab, or other swab, and fluid in which to
immerse the swab following contacting the swab with a subject); a
cartridge comprising reagents for assays for respiratory disorders;
a device for running a plurality of assays for detecting a
plurality of respiratory disorders; a device/means for
displaying/communicating the detection of one or more of said
respiratory disorders. Such integrated systems may be configured
for uses wherein the sample is a small volume sample; for uses
wherein detection is performed in a short period of time; or for
uses both wherein the sample is a small volume sample and wherein
detection is performed in a short period of time.
[0158] A further example of an integrated system disclosed herein
comprises an integrated system for providing testing, diagnosis,
and prescription of a subject suspected of suffering from a
respiratory disorder, said system comprising a means for obtaining
a sample (which may include, e.g., a nasal swab, a throat swab, a
mouth swab (e.g., a cheek swab), a vaginal swab, or other swab, and
fluid in which to immerse the swab following contacting the swab
with a subject); a cartridge comprising reagents for assays for
respiratory disorders; a device for running a plurality of assays
for detecting a plurality of respiratory disorders; a device/means
for displaying/communicating the detection of one or more of said
respiratory disorders; and means for providing a prescription for
the treatment of a respiratory disorder detected in said sample.
Such integrated systems may be configured for uses wherein the
sample is a small volume sample; for uses wherein detection is
performed in a short period of time; or for uses both wherein the
sample is a small volume sample and wherein detection is performed
in a short period of time.
[0159] A yet further example of an integrated system as disclosed
herein comprises an integrated system for providing testing,
diagnosis, prescription, and treatment of a subject suspected of
suffering from a respiratory disorder, said system comprising a
means for obtaining a sample (which may include, e.g., a nasal
swab, a throat swab, a mouth swab (e.g., a cheek swab), a vaginal
swab, or other swab, and fluid in which to immerse the swab
following contacting the swab with a subject); a cartridge
comprising reagents for assays for respiratory disorders; a device
for running a plurality of assays for detecting a plurality of
respiratory disorders; a device/means for displaying/communicating
the detection of one or more of said respiratory disorders; means
for providing a prescription for the treatment of a respiratory
disorder detected in said sample; and means for
providing/selling/delivering a treatment (drug/pill/shot) to said
subject pursuant to said prescription. Such integrated systems may
be configured for uses wherein the sample is a small volume sample;
for uses wherein detection is performed in a short period of time;
or for uses both wherein the sample is a small volume sample and
wherein detection is performed in a short period of time.
[0160] Description and disclosure of examples of reagents, assays,
methods, kits, devices, and systems which may use, or be used with,
the methods, devices, and systems disclosed herein may be found,
for example, in U.S. Pat. Nos. 8,088,593; 8,380,541; 8,435,738;
8,475,739; 8,840,838; U.S. patent application Ser. No. 14/183,503,
filed Feb. 18, 2014; U.S. patent application Ser. No. 13/933,035,
filed Jul. 1, 2013; U.S. patent application Ser. No. 13/769,820,
filed Feb. 18, 2013; U.S. patent application Ser. No. 14/183,503,
filed Feb. 18, 2014; Patent application Ser. No. 14/214,850, filed
Mar. 15, 2014; International Patent Application PCT/US2014/030034,
filed Mar. 15, 2014; International Patent Application
PCT/US2014/056151, filed Sep. 17, 2014; U.S. patent application
Ser. No. 13/769,798, filed Feb. 18, 2013; U.S. patent application
Ser. No. 13/769,779, filed Feb. 18, 2013; U.S. patent application
Ser. No. 13/244,947 filed Sep. 26, 2011; PCT/US2012/57155, filed
Sep. 25, 2012; U.S. application Ser. No. 13/244,946, filed Sep. 26,
2011; U.S. patent application Ser. No. 13/244,949, filed Sep. 26,
2011; and U.S. application Ser. No. 13/945,202, filed Jul. 18,
2013, the disclosures of which patents and patent applications are
all hereby incorporated by reference in their entireties.
EXAMPLES
[0161] The following examples are offered for illustrative purposes
only, and are not intended to limit the present disclosure in any
way.
Example 1
[0162] Thermocycling pre-amplification methods include any suitable
thermocycling method, including PCR, reverse-transcriptase PCR
(rtPCR), and other PCR methods. Two-step PCR methods include
methods with steps of incubating at a first temperature (e.g.,
between about 38-45.degree. C., or about 42.degree. C.); incubating
at a second, raised temperature (e.g., between about 90-105.degree.
C., or about 98.degree. C.); thermal cycling between two
temperatures where the two temperatures are a) a second, raised
temperature (e.g., between about 90-105.degree. C., or about
98.degree. C.) and b) a lower, annealing temperature (Tm, e.g.,
between about 50.degree. C. to about 80.degree. C.); and then
incubating at a third, lower temperature (e.g., a temperature
between about 65.degree. C. to about 75.degree. C.). Three-step PCR
methods include methods with steps of incubating at a first
temperature (e.g., between about 38-45.degree. C., or about
42.degree. C.); incubating at a second, raised temperature (e.g.,
between about 90-105.degree. C., or about 98.degree. C.); thermal
cycling between three temperatures where the three temperatures are
a) a second, raised temperature (e.g., between about 90-105.degree.
C., or about 98.degree. C.) and b) a lower, annealing temperature
(Tm, e.g., between about 50.degree. C. to about 80.degree. C.); and
c) a third, lower temperature (e.g., a temperature between about
65.degree. C. to about 75.degree. C.); and then, an incubation at a
third, lower temperature (e.g., a temperature between about
65.degree. C. to about 75.degree. C.). Following the last
incubation at the third, lower temperature, the amplified sample
may be used immediately, or may be stored (e.g., at 4.degree. C.)
until needed.
[0163] A method as provided herein was performed as follows:
[0164] PCR thermal cycling was performed on a sample, where the
sample was subjected to thermal cycling as follows:
[0165] 1) incubated for 30 minutes at 42.degree. C., then
[0166] 2) incubated at 98.degree. C. for 2 minutes, followed by
[0167] 3) 35 repeated thermal cycles as follows: [0168] i) 10
seconds at 98.degree. Cm, followed by [0169] ii) 15 seconds at Tm
.degree. C., followed by [0170] iii) 15 seconds at 72.degree. C.;
and then, after the 35 cycles,
[0171] 4) incubated for 2 minutes at 72.degree. C.
[0172] In alternative embodiments, the number of repeated cycles in
step 3) above may be altered; for example, the number of repeated
cycles may be reduced to, e.g., 30, or 25, or 20, or fewer cycles.
In other alternative embodiments, the number of repeated cycles in
step 3) above may be increased, e.g., to 40, or 45, or 50, or more
cycles. In alternative embodiments, step iii) above may be
shortened to less than 15 seconds, or may be eliminated altogether.
Where step iii) is eliminated, the PCR method becomes a "two-step"
PCR method.
[0173] Following the above steps 1 to 4, the amplified sample can
be immediately used for isothermal amplification (e.g., by NAA
methods) or may be stored at 4.degree. C. until needed. Steps 1) to
4) take approximately one hour to complete. The "Tm" indicates the
annealing temperature for a particular primer set; a primer set may
have a different Tm than other primer sets, or may have the same Tm
as another primer set. In many cases, Tm is typically between about
50.degree. C. to about 75.degree. C. For example, in the
experiments shown in the figures, Tm was 62.degree. C. for
RLX3539/40 primers, and was 72.degree. C. for RLX3547/48
primers.
[0174] Primers directed to nucleic acid sequences present in Ebola
virus were developed and synthesized. Two primer sets were used in
the experiments disclosed herein. Experiments were performed in
order to determine the limit of detection (LOD) of target Ebola
virus nucleic acid target sequences. These experiments were
performed with both pre-amplification primer sets RLX3539/40 and
RLX3547/48. For the primer set RLX3539/40, an annealing temperature
of 61.degree. C. was used. An annealing temperature of 62.degree.
C. may also be used with this primer set. An annealing temperature
of 71.degree. C. was used for primer set RLX3547/48.
[0175] In embodiments, the primers used for the PCR and the NAA
methods may be nested primers, where the nucleic acid targets of
one set of primers are internal to (encompassed within) the nucleic
acid sequences amplified by the other set of primers. For example,
primers used for NAA amplification may be targeted to nucleic acid
sequences that are amplified during PCR amplification, i.e., the
NAA target nucleic acids are internal to the target nucleic acids
to which the PCR primers hybridize.
[0176] Primer set RLX3539/40 had the following nucleic acid
sequence:
TABLE-US-00001 RLX3539 (SEQ ID NO: 1) TGCCAACTTATCATACAGGC RLX3540
(SEQ ID NO: 2) GACTGCGCCACTTTCC
[0177] Primer set RLX3547/48 had the following nucleic acid
sequence:
TABLE-US-00002 RLX3547 (SEQ ID NO: 3) TGCCAACTTATCATACAGGCCTT
RLX3548 (SEQ ID NO: 4) TGCCCTTCCAAATACTTGACTGCGCCA
[0178] In the "pre-amplification" experiments shown in the figures,
rtPCR was used to amplify RNA target nucleic acids in a sample;
target nucleic acids were included with PCR reagents to a final
concentration of 10.sup.3, 10.sup.2, 10, 5, and 1 copy per
microliter (4), and PCR amplification performed; 2.5 .mu.L of the
resulting reagent, following the amplification, was combined with
NAA reagents and isothermal NAA amplification performed. In the
"control--no pre-amplification" experiments, target nucleic acids
were included with NAA reagents to a final concentration of
10.sup.3, 10.sup.2, 10, 5, and 1 copy per microliter (4), and
isothermal NAA amplification was performed. As shown in the
figures, these methods combining PCR pre-amplification with NAA
isothermal amplification were able to achieve an LoD of 1 copy/4
(shown as "1c/uL" in the figures); such an LoD means there were 5
copies/RT PCR reaction. See results below for both primers
sets.
[0179] Detection of target is indicated by the inflection time
measured in the NAA assay (note that "NTC" (no-template control)
shows an inflection, but at much later times than a specific signal
detected for target sequences). Primer set RLX3539/40 was used for
the RT-PCR pre-amplification in the experiments shown in FIGS. 1
and 2. As shown in FIG. 1, target nucleic acid sequences were
detected in 20 minutes or less for all copy numbers in samples with
RT-PCR pre-amplification (left five columns, displaying inflection
times for 10.sup.3, 10.sup.2, 10, 5, and 1 copy per microliter
(4)). In contrast, the inflection times for control experiments
(NAA assays without RT-PCR pre-amplification, shown on the right)
were all greater than about 35 minutes (all but one were greater
than 60 minutes; the shortest inflection time being for the
greatest number of copies (10.sup.3 copies/.mu.L). Thus, target
nucleic acid sequences in samples were more readily detected by the
isothermal NAA methods as disclosed herein when the sample was
first "pre-amplified" by PCR (results labeled "pre-amplification"),
than by the NAA isothermal methods alone.
[0180] FIG. 2 shows some raw output of the experiments summarized
in FIG. 1. The traces shown in FIG. 2 are from NAA assays performed
following pre-amplification, with relative fluorescence shown in
the vertical direction, and time (as "cycles", where a cycle is
about 60 to 90 seconds, i.e., approximately about one minute) in
the horizontal direction.
[0181] Primer set RLX3547/48 was used for the RT-PCR
pre-amplification in the experiments shown in FIGS. 3, 4, and 5. As
shown in FIG. 3, target nucleic acid sequences were detected in
about 30 minutes or less for all copy numbers in samples with
RT-PCR pre-amplification (left five columns, displaying inflection
times for 10.sup.3, 10.sup.2, 10, 5, and 1 copy per microliter
(4)). In contrast, the inflection times for control experiments
(NAA assays without RT-PCR pre-amplification, shown on the right)
were all greater than about 35 minutes, and all but one, for
10.sup.3 copies/.mu.L, were greater than 60 minutes. Thus, in these
experiments as well, when the sample was first "pre-amplified" by
PCR, target nucleic acid sequences in samples were more readily
detected by the isothermal NAA methods than by the NAA isothermal
methods alone.
[0182] FIG. 4 shows some raw output from the NAA assays with
pre-amplification (summarized in FIG. 3), with relative
fluorescence shown in the vertical direction, and time (as
"cycles", where a cycle is about 60 to 90 seconds, i.e.,
approximately about one minute) in the horizontal direction. In
contrast, FIG. 5 shows some raw output from the NAA assays with no
pre-amplification (summarized in FIG. 3), with relative
fluorescence shown in the vertical direction, and time (as
"cycles", where a cycle is about 60 to 90 seconds, i.e.,
approximately about one minute) in the horizontal direction.
Comparison of the traces in FIG. 4 and FIG. 5 illustrates the
reduced time for detection (shorter inflection time) when NAA
isothermal methods are preceded by RT-PCR as compared to the time
for detection (inflection time) for NAA isothermal methods alone
(in the absence of RT-PCR pre-amplification).
Example 2
[0183] In one non-limiting example, rapid identification of acute
and established HIV infection using a single test that is capable
of detecting HIV nucleic acids, antibodies, and antigens can have a
dramatic impact on public health by helping patients with positive
HIV results obtain the care and services they need faster. In one
embodiment, a single test for HIV is provided that is capable of
detecting HIV nucleic acids, antibodies, and antigens (for both
diagnostic and prognostic use), is simple to use on specimens,
processed or unprocessed, capable of either or both qualitative and
quantitative applications, may be performed in 5 hrs or less, 4 hrs
or less, 3 hrs or less, 2 hrs or less, or 60 minutes or less, and
suitable for commercial distribution.
[0184] In one embodiment, an HIV test of the invention tests for
all of the following from a sample obtained from a subject in a
single device or with the housing of one device: HIV-1 RNA, HIV-2
RNA, p24 antigen, HIV-1 antibodies, and HIV-2 antibodies. Thus, the
HIV test of the invention is also capable of differentiating
between HIV-1 and HIV-2 infection. In one embodiment, a simplified
sixth-generation HIV test comprises performing all the following
tests from one small sample: HIV-1 RNA, HIV-2 RNA, p24 antigen,
HIV-1 IgG, HIV-2 IgG, HIV-1 IgM, and HIV-2 IgM.
[0185] In one non-limiting example, the sample may be between about
100 to about 200 microliters of blood (venous or capillary). In
another non-limiting example, the small sample may be between about
10 to about 100 microliters of blood (venous or capillary). In some
embodiments, the blood is pre-processed so that the sample being
tested is plasma. In some embodiments, the blood is pre-processed
so that the sample being tested is serum. In some embodiments, the
blood is pre-processed so that the sample being tested is diluted
blood. In some embodiments, the sample being tested is undiluted
blood. In some embodiments, the pre-processing occurs on a device
separate from the sample processing device. Optionally, the
pre-processing and sample processing both occur in one device or
within the housing of one device. In an embodiment, the HIV-1 RNA,
HIV-2 RNA, p24 antigen, HIV-1 antibodies, and HIV-2 antibodies are
tested from a single sample obtained from the subject.
[0186] In one non-limiting example, by combining nucleic acid
testing and serological testing, this embodiment of the test will
provide information to detect acute infections as well as for
established infections. Optionally, this HIV test is fully
automated and will have on-board quality controls (QC) that are
processed in parallel with the patient sample. In one embodiment of
the on-board QC, the on-board quality controls will include
positive and negative controls as well as the human RNaseP gene to
act as a positive control with human clinical specimens to indicate
that adequate isolation of nucleic acid resulted from the
extraction of the clinical specimen. In one non-limiting example
the QC reagents and consumables are contained in the same cartridge
that has the reagents and consumables for the HIV test.
[0187] In one non-limiting example, this HIV test is designed to be
run from a capillary whole-blood sample. Optionally, in a still
further embodiment, it should be understood that the test can be
configured to run on capillary or venous whole blood, serum, or
plasma. In one embodiment, the test is processed automatically by a
sample processing without any user intervention. In one embodiment,
the test is processed automatically by a sample processing without
any user intervention after loading of the sample into the device.
Given the ease of sample collection, the ease of running the
sample, the high sensitivity/high specificity nucleic acid,
antigen, and serologic testing, this embodiment of the test can be
used for rapid diagnosis and differentiation of HIV-1 and HIV-2
infections.
[0188] By way of one non-limiting example, the steps of processing
a sample may comprise [0189] a. RNA extraction from the sample by a
beads-based method is performed; [0190] b. Reverse transcription
(RT) is performed; [0191] c. Pre-amplification is performed through
a series of polymerase chain reaction (PCR) amplification cycles,
[0192] d. Isothermal amplification and detection are performed;
[0193] e. Immunoassays to detect p24, HIV-1 antibodies, and HIV-2
antibodies are performed in parallel to the above nucleic acid
testing; [0194] f. On-board controls are processed in parallel to
the sample processing on the instrument.
[0195] The immunoassays may be direct or indirect immunoassays and
may be an ELISA (enzyme-linked immunosorbent assay). For example,
p24 may be detecting using an antibody-sandwich immunoassay using a
monoclonal antibody specific for p24. The HIV test of the invention
may also be capable of detecting IgG, IgM, or both, antibodies of
HIV-1 and HIV-2. In a particular embodiment, the test of the
invention is capable of detecting both IgG and IgM antibodies of
HIV-1 and HIV-2. In a non-limiting example, both the IgG and IgM
antibodies are detected using antigen sandwich immunoassays for
HIV-1 and HIV-2. In an embodiment, the immunoassays are capable of
distinguishing between HIV-1 and HIV-2 antibodies by, for example,
using antigens specific for HIV-1 and HIV-2, respectively. In
another embodiment, the HIV tests are capable of distinguishing
between antigen reactivity and antibody reactivity by, for example,
using different detection reagents, performing the assays
separately from one another, and/or different detection methods.
The capture reagent (eg. antigen, antibody, etc.) may be
immobilized on a solid support, including but not limited to,
beads, surface of wells, and inside assay tips.
[0196] Further, although many of embodiments herein describe
nucleic acid amplification using an isothermal technique, it should
be understood that other nucleic acid amplification techniques such
as PCR, qPCR, nested PCR, or other nucleic acid detection
techniques are not excluded. In another embodiment, the test is
capable of distinguishing between HIV-1 and HIV-2 RNA by using
primers that are specific to HIV-1 and HIV-2, respectively.
[0197] In one non-limiting example, raw data from the testing is
transmitted to a data analyzer for interpretation. In one
embodiment, the data analyzer is not at the same location as the
device that processes the sample using the above steps. Optionally,
other embodiments may have the data analyzer in the same location
as the sample processor. Optionally, other embodiments may combine
the data analyzer and the sample processor in the same device. It
should also be understood that in some embodiments, the raw data is
in the form of voltage, current, numeric, electronic, optical,
digital, or other non-final value that, if intercepted by another
party or device, is meaningless unless the intercepting party or
device has conversion information or an algorithm to convert such
raw data or other readout into health measurements.
[0198] In one embodiment, test cartridges are stored refrigerated
(4-8.degree. C.) prior to use. Optionally, the test cartridges are
stored refrigerated (2-10.degree. C.) prior to use. In one
embodiment, the test uses a single cartridge that provides all
reagents and consumables used for at least the nucleic acid testing
and serological testing. Optionally, the combined test uses a
single cartridge that provides all reagents and consumables used
for the nucleic acid testing, antibody testing, and antigen
testing. Optionally, the combined test uses a single cartridge that
provides all reagents and consumables used for the nucleic acid
testing, antibody testing, and antigen testing on blood and a
tissue sample contained in the cartridge. Optionally, the combined
test uses a single cartridge that provides all reagents and
consumables used for the nucleic acid testing, antibody testing,
and antigen testing on blood and a sample on a nasal swab contained
in the cartridge. Optionally, the combined test uses a single
cartridge that provides all reagents and consumables used for the
nucleic acid testing, antibody testing, and antigen testing on
blood and a sample on a throat swab contained in the cartridge.
Optionally, the combined test uses a single cartridge that provides
all reagents and consumables used for the nucleic acid testing,
antibody testing, and antigen testing on capillary blood.
Optionally, the combined test uses a single cartridge that provides
all reagents and consumables used for the nucleic acid testing,
antibody testing, and antigen testing on diluted capillary blood.
Optionally, the combined test uses a single cartridge that provides
all reagents and consumables used for the nucleic acid testing,
antibody testing, and antigen testing on diluted venous blood.
Optionally, the combined test uses a single cartridge that provides
all reagents and consumables used for the nucleic acid testing,
antibody testing, and antigen testing on venous blood.
[0199] The HIV test, as described in one embodiment herein, can be
deployed at urgent care centers with trained and certified medical
staff on-site to perform finger-stick tests and collect samples.
Optionally, some may have these test available at locations at
retail pharmacies, retail stores, or other locations accessible at
location that subjects may visit for other purposes (shopping or
the like) during hours when regular doctor offices are closed or
even when the doctor offices are open.
[0200] In one embodiment, fully automated production facilities can
support the production of tests in extremely high volumes
(sufficient for processing tens of millions of samples).
[0201] In one non-limiting example, the sensitivity of the HIV test
will be comparable to if not more sensitive than other FDA-approved
nucleic acid tests such as the Abbott RealTime HIV-1 test. In one
embodiment, the limit of detection (LOD) may be as low as 5, 8, 10,
15, 20, 50, 100, 500, or 1000 HIV copies in a sample.
[0202] In one embodiment herein, the nucleic acid tests are
highly-sensitive for low copy number sensitivity that can be used
for rapid diagnosis during acute infection. By way of non-limiting
example, the nucleic acid tests in this embodiment are specific to
HIV-1 Group M (A-H) and Group 0, and HIV-2 subtypes A and B,
respectively.
[0203] In one embodiment of the test herein, the turnaround time
may be a run time that is less than 60 minutes. The traditional
turnaround time for existing nucleic acid testing is 6.5 hours (3.5
hours for extraction and 3 hours for amplification and detection)
for individual or pooled nucleic acid testing.
[0204] In terms of CLIA status and test complexity, given the ease
of sample collection, on-board QC, automated sample processing, and
automated analysis and results interpretation, the HIV may be
configured for a CLIA waiver or similar waiver from other
regulatory body regarding test complexity, while some may opt to
run it through CLIA certified or other regulatory agency certified
laboratories.
[0205] The embodiments herein may dramatically improve the ability
to rapidly identify acute and established HIV infection through
simplified nucleic acid tests for detecting and quantifying HIV,
and thus allow patients to receive care and services faster.
[0206] In some embodiments, the HIV test uses a quantitative
nucleic acid amplification process. Optionally, some embodiments
may use a qualitative nucleic acid amplification process.
Example 3 MRSA DETECTION
[0207] Methicillin-resistant Staphylococcus aureus (MRSA) is a type
of Staphylococcus aureus (S. aureus) which can cause infection in
humans and is resistant to beta-lactam antibiotics. As a result of
its resistance to certain antibiotics, MRSA infections can be
difficult to treat.
[0208] S. aureus bacteria typically become methicillin-resistant
through acquiring the mecA gene. The mecA gene is typically located
in the staphyloccal cassette chromosome mec (SCCmec), which is a
multi-gene, transferrable genomic element. Different types of
SCCmec exist, with known SCCmec types ranging in size from
approximately 21,000-67,000 nucleotides in length. Generally,
within each type of SCCmec, the mecA gene is surrounded by other
genes or elements which are other components of the SCCmec. In MRSA
bacteria, SCCmec containing the mecA gene is integrated into the S.
aureus chromosome.
[0209] In order identify and control MRSA bacteria, effective
reagents and methods for MRSA detection are needed.
[0210] Provided herein are systems and methods for MRSA detection.
Various features described herein may be applied to any of the
particular embodiments set forth below or for any other types
systems for or involving MRSA detection. Systems and methods
described herein may be applied as a standalone system or method,
or as part of an integrated system or method. It shall be
understood that different aspects of the disclosed systems and
methods can be appreciated individually, collectively, or in
combination with each other.
[0211] Prior methods for MRSA detection typically separately test a
sample for the mecA gene and for genetic material from the S.
aureus chromosome. If both the mecA gene and S. aureus genetic
material are found in the sample, a presumptive conclusion is made
that MRSA is present. However, this conclusion might not be
accurate, because the mecA gene can exist outside of S. aureus (as
part of the SCCmec, which is transferrable between organisms).
Thus, a sample that contains both the mecA gene and S. aureus might
not actually contain MRSA; instead, it may contain non-MRSA S.
aureus bacteria, and a different bacteria or free genetic element
which contains the mecA gene. This situation thus may give rise to
a false-positive identification of MRSA in a sample.
[0212] Methods and compositions provided herein address the above
problem, and provide methods and compositions for identifying the
mecA gene in a S. aureus chromosome (and thus, true MRSA).
[0213] One approach to identifying a mecA gene in a S. aureus
chromosome might be to perform, for example, polymerase chain
reaction (PCR), where the PCR reaction would contain a sample which
might contain MRSA bacteria or MRSA genetic material, and wherein
one of the primers for the PCR reaction would anneal to portion of
the mecA gene and the other primer for the PCR reaction would
anneal to a portion of the S. aureus chromosome. If such a PCR
reaction yielded a reaction product, it would indicate that both
the mecA gene and genetic material from the S. aureus chromosome
were on the same strand (and thus, that the sample contained true
MRSA bacteria). However, typically this approach is not effective,
because in most MRSA bacteria, the mecA gene is many thousands of
nucleotides away from genetic material of the S. aureus chromosome.
This is due to the fact that in MRSA, the mecA gene is integrated
into the S. aureus chromosome as part of the SCCmec, and the mecA
gene is typically in an inner portion of the SCCmec, surrounded on
both sides by thousands of additional nucleic acids of the SCCmec
insert. The relatively large nucleotide distance between the mecA
gene and the S. aureus chromosome in most MRSA strains generally
results in the poor performance of traditional PCR reactions as
described above (e.g. with one primer annealing to a portion of the
mecA gene and the other primer annealing to a portion of the S.
aureus chromosome), as traditional PCR and many other nucleic acid
amplification techniques are not very effective at amplifying
relatively long nucleotide sequences.
[0214] Multiple different types of SCCmec have been identified. For
instance, the position of the mecA gene may differ between the
different SCCmec types; the content of the SCCmec elements may
differ between the different SCCmec types, and the locations in the
S. aureus chromosome where the SCCmec are inserted (e.g. attL and
attR) may differ between the different SCCmec types. The mecA gene
when present in a S. aureus chromosome is typically separated from
S. aureus genetic material by thousands or even tens of thousands
of nucleotides.
[0215] Provided herein are improved methods and compositions for
identifying the mecA gene in a S. aureus chromosome (and thus, true
MRSA).
[0216] In embodiments, methods provided herein comprise at least
two steps: 1) a step to generate a nucleic acid strand wherein at
least a portion of the mecA gene and the S. aureus chromosome are
in close physical proximity to each other within the strand; and 2)
a step to perform a nucleic acid amplification method using at
least a first primer, a second primer and the nucleic acid strand
of step 1), wherein the first primer anneals to a portion of the
mecA gene and the second primer anneals to a portion of the S.
aureus chromosome, and where an amplification product is generated
which includes portions of both the mecA gene and the S. aureus
chromosome.
[0217] In embodiments of systems and methods provided herein, a S.
aureus chromosome or portion thereof containing a SCCmec cassette
containing a mecA gene 200 may be provided (referred to as a "MRSA
chromosome"). The MRSA chromosome 200 may be incubated with a first
primer and a second primer, wherein the first primer is
complementary to a portion of the mecA gene (or, optionally, other
element of the SCCmec cassette), and the second primer is
complementary to a portion of the S. aureus chromosome. In
addition, one or both of the primers is phosphorylated at the 5'
end. The MRSA chrosomosome is incubated in a first DNA
amplification reaction with a DNA polymerase having high
processivity. An exemplary DNA polymerase with high processivity is
phi29 polymerase. The first DNA amplification reaction may be, for
instance, an isothermal method. By use of a DNA polymerase with
high processivity, at least a small amount of amplification product
202 may be generated. The amplification product from this reaction
202 will contain both S. aureus and mecA genetic material, but
typically, only a small amount of amplified material 202 will be
generated. This amplified material 202 is generally difficult to
detect, due to the small amount generated. Accordingly, the
amplified material 202 is then incubated with a DNA ligase, which
can ligate amplification products 202 together due to the phosphate
groups on the 5' end of the primers used for the amplification
reaction. Incubation of the amplified material 202 with a ligase
may result in two general types of ligation products: a)
concatemers 204 formed by the end-to-end ligation of two or more
amplification products 202; or b) circularized products 206 formed
by the ligation of one end of an amplification product 202 to the
other end of the same amplification product 202. With both types of
ligation products (204 and 206), the mecA gene is brought into
close physical proximity with S. aureus genetic material (e.g.
attR, orfX). Accordingly, both types of ligation products are
suitable templates for nucleic acid amplification methods which are
most effective at amplification of relatively small amplicons (e.g.
2000 nucleotides or less). Thus, the next step of a method provided
herein involves using the ligation products for a second nucleic
acid amplification step. This second nucleic acid amplification
step will use at least a first primer which anneals to a portion of
the mecA gene (or optionally, another portion of the SCCmec
cassett), and a second primer which anneals to S. aureus genetic
material. Various nucleic acid amplification methods may be used
for the second nucleic acid amplification step, such as PCR or an
amplification method as described in PCT/US14/56151, filed Sep. 17,
2014, which is hereby incorporated by reference in its entirety for
all purposes. In embodiments, the first primer and second primer of
the second nucleic acid amplification step are different than the
first primer and second primer of the first nucleic acid
amplification step (which produced product 202). In embodiments,
the first primer and second primer of the second nucleic acid
amplification step have an opposite orientation as compared to the
first primer and second primer of the first nucleic acid
amplification step. In embodiments, the first primer and second
primer of the second nucleic acid amplification step are the same
as the first primer and second primer of the first nucleic acid
amplification step.
[0218] FIG. 6 provides exemplary primer sequences which may be used
with a method provided herein.
[0219] In embodiments, all of the steps of methods provided herein
may be permitted to occur simultaneously in the same vessel (e.g.
all reagents for methods provided herein may be provided in the
same vessel at the same time).
[0220] In addition to being used for the detection of true MRSA
bacteria, the method provided herein may also be used for the
detection of other genetic elements in other species or molecules,
in which, for example, there are two or more genetic elements which
may be on a common nucleic acid strand or part of a common
molecule, but for which the elements are separated from each other
by a large nucleotide distance. The general approach as provided
herein (i.e. to perform a first amplification reaction, followed by
a ligation reaction, followed by a second amplification reaction)
may be used for a wide range of genetic elements which present a
similar structural problem.
[0221] In addition, in embodiments, the first amplification
reaction provided herein may be omitted, if multiple copies of a
molecule containing genetic elements of interest are already
present, and such molecules may be ligated together to form
structures in which the elements of interest may be readily
amplified by, for example, as PCR or an amplification method as
described in PCT/US14/56151.
Example 4 SNP Detection
[0222] Within Hepatitis C genotype 1a, there is a polymorphic site
Q80K in the protease gene, NS3, that is associated with treatment
failure with the protease inhibitor boceprevir, which otherwise can
be effective in blocking peptide maturation in the virus. Assessing
the Q80 polymorphism in the NS3 gene in patients with subtype 1a
can be an important part of formulating a treatment plan.
[0223] Accordingly, improved reagents and methods for assessing the
Q80 polymorphism are needed. In addition, improved reagents and
methods for assessing other SNPs are needed.
[0224] Provided herein are systems and methods for assessing SNPs.
Various features described herein may be applied to any of the
particular embodiments set forth below or for any other types
systems for or involving assessing SNPs. Systems and methods
described herein may be applied as a standalone system or method,
or as part of an integrated system or method. It shall be
understood that different aspects of the disclosed systems and
methods can be appreciated individually, collectively, or in
combination with each other.
[0225] In embodiments, provided herein are compositions and methods
for evaluating a SNP, mutation, or other nucleotide of interest in
a target sequence. In some situations, a target sequence may have
multiple different polymorphisms which surround the position of the
nucleotide of interest. For example, the nucleotide of interest may
be located in the 60.sup.th nucleotide position of a target
sequence of 150 nucleotides (with the 5' most nucleotide being in
the first position, the nucleotide next to the 5' most nucleotide
being in the second position, etc.).
[0226] In embodiments, a nucleotide of interest may be evaluated
through use of a method for SNP detection as provided in
PCT/US14/56151, filed Sep. 17, 2014, which is hereby incorporated
by reference in its entirety for all purposes. In such a method, a
primer pair is used to amplify a target nucleic acid containing the
nucleotide of interest, wherein each primer contains a tail/first
region and a template-binding/second region. In embodiments, the
tail of the/first region of the second primer of the primer pair is
complementary to a portion of the target nucleic acid including the
nucleotide of interest. In a method as disclosed in PCT/US14/56151,
the identity of a nucleotide of interest may be determined, for
example, by comparing the rate or amount of amplification of a
target nucleic acid containing the nucleotide of interest by one or
more primer pairs having slightly different nucleotide sequences in
the first/tail region of the primer (typically by just a single
nucleotide difference between the primer pairs).
[0227] However, in some situations, it may be difficult to perform
a method for SNP detection as provided in PCT/US14/56151, if there
is a lot of sequence variance in the target nucleic acid one or
more positions near the nucleotide of interest. Such positions, for
example, may be in the region corresponding to the template-binding
regions of the first and/or second primer. If the primers as
described in PCT/US14/56151 for SNP detection are not able to
readily bind to a target nucleic acid sequence, the method
disclosed therein may not be effective for SNP detection.
[0228] Accordingly, provided herein are compositions and methods
which facilitate the identification of SNPs. In a first step, a
region of a target nucleic acid containing the nucleotide of
interest is amplified by a first amplification reaction (such as
PCR), to generate a first amplification product. In this first
amplification reaction, relatively long primer pairs (e.g. each
primer contains at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 80, 90, or 100 nucleotides) are used to amplify the target
nucleic acid. The long primers may tolerate relatively large
amounts of sequence diversity in the template-binding regions (i.e.
because the primers are long, they may still anneal to a target
sequence, even if multiple nucleotides are mis-matched).
Importantly, in the first amplification reaction, neither of the
primers is to anneal to the exact position of the nucleotide/SNP of
interest (i.e. the primers should only anneal to areas near the SNP
of interest). This is because with methods provided herein, it is
not desirable to change the identity of the nucleotide/SNP of
interest (since it is desired to identify the nucleotide/SNP of
interest). Once a first amplification product is generated in the
first amplification reaction, the first amplification product will
have a generally known nucleotide sequence (as a result of knowing
the nucleotide sequence of the primers used in the first
amplification reaction to generate the first amplification
product). However, the identity of the nucleotide/SNP of interest
will still be unknown in the first amplification product, since
neither of the primers used in the first amplification reaction
annealed to the location of the nucleotide/SNP of interest. The
first amplification product may then incubated with primers as
provided in PCT/US14/56151 for SNP detection. These primers may be
designed to have regions that are complementary to sequences that
are known to be present in the first amplification product, based
on the fact that the first amplification product was generated
through use of primers of known sequences. The identity of a
SNP/nucleotide of interest may then be determined as described in
PCT/US14/56151.
[0229] FIG. 7 provides a general schematic of a method provided
herein. A nucleic acid strand 100 containing a target nucleic acid
102 may be provided. The target nucleic acid 102 may contain
multiple polymorphisms/variant nucleotides 104. The target nucleic
acid 102 also contains a nucleotide/SNP of interest 106. The target
nucleic acid is incubated with a first primer 112 and second 114
primer, in order to generate a first amplification product 120. The
first amplification product 120 will have a generally known
nucleotide sequence, since it was amplified with the first primer
112 and second primer 114 (which have known nucleotide sequences).
During the process of generating the first amplification product
120, the multiple polymorphisms/variant nucleotides 104 are
replaced by the nucleotides of the first primer 112 and second
primer 114. However, the first amplification product 120 still has
an unknown nucleotide/SNP of interest 106. The first amplification
product 120 may then be used in a method as described in
PCT/US14/56151 for SNP detection.
[0230] In embodiments, methods provided herein may be used to
assess a SNP in the polymorphic site Q80K in the Hepatitis C
protease gene, NS3. FIG. 8 provides exemplary primer sequences
which may be used as part of a method for assessing the Q80K site.
Methods provided herein may be used to assess SNPs in many
different target nucleic acids, wherein the target nucleic acids
have a high level of sequence variability.
[0231] FIG. 9 provides results from steps of a method performed as
described herein. FIG. 10 provides primer sequences used for the
experiments of FIG. 9. In addition, nucleotide sequences also used
for the results of FIG. 9 were as follows:
[0232] T255Q sequence:
TABLE-US-00003 SEQ ID NO: 5)
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTATACC
AATGTAGACCAAGACCTCGTGGGCTGGCCCGCTCCTCAAGGTGCCCGCTCA
TTGACACCCTGCACCTGCG.
[0233] T255K sequence:
TABLE-US-00004 (SEQ ID NO: 6)
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTATACC
AATGTAGACAAAGACCTCGTGGGCTGGCCCGCTCCTCAAGGTGCCCGCTCA
TTGACACCCTGCACCTGCG
[0234] In embodiments, all of the steps of methods provided herein
may be permitted to occur simultaneously in the same vessel (e.g.
all reagents for methods provided herein may be provided in the
same vessel at the same time).
Example 5 Zika Virus Detection
[0235] Zika virus (ZIKV) has received global scrutiny following an
outbreak in South America, causing a spectrum of neurologic
complications including microcephaly. Current ZIKV diagnostic
procedures begin with initial observation of clinical symptoms,
including any combination of fever, conjunctivitis, and rash. The
range of ZIKV RNA concentrations in sera of symptomatic patients is
about 900 to about 729,000 copies/mL, as detected by rRT-PCR
(Lanciotti, et al., Emerg Infect Dis. 2008; 14(8):1232-1239). ZIKV
rRT-PCR dan also detect ZIKV in urine and saliva for up to two
additional weeks after ZIKV becomes undetectable in blood (Zhang,
et al., Lancet Infect Dis. 2016; 16(6):641-642; Barzon, et al.,
Euro Surveill. 2016; 21(10)).
[0236] This Example provides a ZIKV nucleic acid amplification test
(ZNAT) that detects ZIKV RNA in capillary EDTA whole blood (CWB)
samples and venous serum samples.
[0237] Methods: The Zika nucleic acid amplification test system
(ZNAT) uses nested primers in two sequential reactions that
comprise RT-PCR amplification followed by isothermal amplification
and detection. This test is performed using a single-use cartridge
that is processed on a fully automated, transportable device (an
automated, diagnostic platform) with fully integrated sample
preparation and processing capabilities. The test system can
process and amplify nucleic acid from venous serum or capillary
whole blood, requires minimal handling, and is complete in about 2
hours. The analytical performance of the ZNAT was compared to the
Centers for Disease Control and Prevention (CDC) and altona
Diagnostics Zika RT-PCR tests (altona assay) using serum and
capillary whole blood (CWB) samples from the Dominican Republic,
Colombia, and United States, including from symptomatic and
pregnant subjects.
[0238] Results: The ZNAT had analytical sensitivities of 320 and
480 genomic copies/mL for capillary whole blood and serum,
respectively. The ZNAT detected multiple Zika strains, including
the current South American PRVABC59 strain and two African strains.
The test did not cross-react with other flaviviruses or pathogens
that produce Zika-like symptoms. The ZNAT successfully detected
Zika virus in both venous serum and capillary blood of symptomatic
patients from the Dominican Republic and Colombia. When compared to
results from both the CDC Zika RT-PCR and altona Diagnostics
RealStar.RTM. assays, ZNAT exhibited 100% sensitivity (67 of 67
samples [95% CI 94.6-100]) with 95.6% specificity (109 of 114
samples [95% confidence interval (CI) 90.1-98.6]) for serum samples
and 98.0% sensitivity (50 of 51 samples [95% CI 89.7-99.7]) and
100.0% specificity (56 of 56 samples [95% CI 93.6-100.0]) for
capillary whole blood samples.
[0239] The ZNAT performance is equivalent to existing Zika
diagnostics. These results demonstrate that ZNAT can provide rapid
and accurate results and can provide efficient diagnostic testing
in regions of immediate need without requiring the presence or
intervention of molecular-biology trained technicians. The
combination of capillary collection and shipping technology with
low cost nucleic acid analysis facilitates effective screening in
remote locations otherwise difficult to access.
Materials and Methods
[0240] ZNAT workflow: Disposable, barcoded test cartridges
contained all necessary assay reagents and consumables. Sample
collection units (SCUs, Theranos, Palo Alto, Calif.) containing CWB
or serum were inserted into test cartridges (see next section) and
the cartridges were inserted into the sample processing unit (SPU),
which is an automated sample analysis device. The fully automated
SPU processed blood samples for RNA extraction and nucleic acid
amplification. Reagents and consumables used for the test were
returned back into the cartridge upon assay completion; the assay
cartridge was then ejected and retrieved by trained personnel and
disposed of as bio-hazardous waste. The run time for analysis
(e.g., from time of sample insertion into the automated sample
analysis device to the analytical result was approximately 2
hours.
[0241] Specimen collection: Venous blood was collected using
standard procedures into serum separator tubes (BD Biosciences
#367987, Franklin Lakes, N.J.) by trained phlebotomists and then
centrifuges at 1300.times.g for 15 minutes. Capillary whole blood
(CWB) was collected after fingersticks with disposable lancets (BD
Biosciences #366593, Franklin Lakes, N.J.), and with EDTA-coated
Sample Collection Devices (SCDs) (Theranos, Palo Alto, Calif.);
SCDs contained detachable SCUs. Serum was obtained from 102
symptomatic subjects from the Dominican Republic (D.R.) and
Colombia (Boca Biolistics, Pompano Beach, Fla.; Allied Research
Society, Miami Lakes, Fla.). Matched subject CWB, serum, and urine
samples were obtained from 30 subjects from the D.R (Boca
Biolistics, Pompano Beach, Fla.). Serum samples from 25 febrile
U.S. patients were obtained from commercial vendors (Access
Biologicals LLC, Vista, Calif.). 78 serum and 77 CWB samples were
obtained from Zika-asymptomatic U.S. volunteers. All samples were
collected after written, informed consent with approval from an
ethics committee.
[0242] ZNAT assay workflow: All necessary assay reagents and
consumables were assembled in disposable, barcoded assay
cartridges. SCUs containing serum or capillary whole blood were
inserted into assay cartridges (see next section) and the
cartridges were inserted into the SPU. The sample-to-result
fully-automated SPU extracted RNA from samples and performed
nucleic acid amplification. Reagents and consumables used for the
assay were returned back into the cartridge upon assay completion;
the assay cartridge was then ejected and disposed of as
bio-hazardous waste.
[0243] Blood sample preparation for ZNAT: Each SCU, comprised of
two identical storage vessels, contained a total of 160 .mu.L of
CWB or serum. As necessary, live ZIKV (strain PRVABC59, Centers for
Disease Control, Atlanta, Ga.) was added into CWB or serum blood
samples. ZIKV was added manually for serum samples or automatically
within SPUs for CWB samples. The SPU also added MS2 bacteriophage
to the serum and CWB samples to serve as a positive control for
sample preparation/RNA extraction and thermal cycling-based
amplification.
[0244] For CWB samples with added ZIKV, ZIKV stocks at 27.7.times.
the desired concentration, diluted in Tris-EDTA (TE) buffer pH 8.0
(IDT DNA, Coralville, Iowa) with 1 U/.mu.L of RNase-inhibitor
(Thermos, Palo Alto, Calif.), were manually pipetted into a
specified vessel within the ZNAT cartridge before insertion into a
SPU. Within the SPU, the device spiked 3 .mu.L of 27.7.times.ZIKV
stock into each of the two vessels of the SCU, with each containing
approximately 80 .mu.L of CWB to yield a 1:27.7 dilution. For
venous serum samples with added ZIKV, live ZIKV was diluted with
serum matrix and then manually pipetted to yield the desired, final
concentration. 80 .mu.L of venous serum with added ZIKV was then
manually dispensed into each vessel of an SCU, placed into a ZNAT
cartridge.
[0245] SPU operation and functionality: SPUs were equipped with all
necessary mechanical and software components to process ZNAT assay
cartridges, including the ability to automate the ZIKV RNA
extraction, nucleic acid amplification, and detection processes.
These components include an automated, multi-channel liquid
handling system, centrifuge, thermal-cycler, 64-well isothermal
heat block with an optical sensor and detector laser-emitting diode
per well, and network functionality. SPUs were completely enclosed
instruments except for a retractable cartridge insertion door and
filtered intake/exhaust vents. SPUs were controlled through a
touch-screen user interface and were remotely monitored using a
secured network connection. ZIKV diagnostic results were
transmitted to secured, encrypted, remote servers, collectively
known as the Theranos Laboratory Automation System (TLAS), and data
retrieved by trained personnel.
[0246] Automated RNA extraction from blood samples: Both serum and
CWB samples were first centrifuged and then serum and plasma,
respectively, were subjected to lysis, RNA capture onto magnetic
beads, washing, and then RNA elution into water.
[0247] The SPU added MS2 bacteriophage positive control (Theranos,
Palo Alto, Calif.), lithium chloride (Sigma-Aldrich, St. Louis,
Mo.), and iodoacetic acid (Santa Cruz Biotechnology, Santa Cruz,
Calif.) to blood or serum samples to yield final concentrations of
18.75 plaque-forming units (PFU)/mL, 300 mM, and 150 mM,
respectively. Both lithium chloride and iodoacetic acid served as
RNase inhibitors. Samples were centrifuged on board the SPU at
1,448 RCF (relative centrifugal force) for 4 min, and 75 .mu.L of
supernatant (e.g. plasma in the case of whole blood samples)
underwent RNA extraction. Both ZIKV and MS2 bacteriophage in plasma
or serum were lysed for 5 min in 450 .mu.L of RNA-extraction
lysis/binding buffer (Thermo Fisher, Waltham, Mass.) with 36 .mu.M
beta-mercaptoethanol (.beta.ME), followed by RNA capture via
incubation with 30 .mu.L magnetic beads (Zymo Research, Irvine,
Calif.). Beads were captured with a sleeved, magnetic rod and
washed in commercial, proprietary wash buffers: 225 .mu.L of wash-1
buffer for 3 min, and 225 .mu.L of wash-2 buffer for 3 min (Thermo
Fisher, Waltham Mass.). ZIKV and MS2 RNAs from the magnetic beads
were eluted in 50 .mu.L DNase/RNase-free water (Teknova, Hollister,
Calif.).
[0248] MS2 phage preparation: C3000 bacteria was grown in #271-L
media (Luria Bertani medium containing 2% glucose, 53 mM
CaCl.sub.2, and 0.02% thiamine (vitamin B12) and infected with MS2
bacteriophage (ATCC #15597-B1.TM., Manassas, Va.) over #271 soft
agar media using standard procedures. After 18 h, soft agar media
harboring bacteria and phage particles was collected and passed
through a 0.2 .mu.m filter. MS2 phage particles were purified
through precipitation with 4% PEG8000 and 0.5 M NaCl. MS2 phage
particles were pelleted by centrifugation at 6,500.times.g,
followed by resuspension in TMSG buffer (10 mM Tris pH 7.5, 100 mM
NaCl, 1 mM MgCl.sub.2, 0.1% gelatin, 0.05% NaN.sub.3) and storage
at 4.degree. C.
[0249] Automated preliminary amplification: The liquid handling
system within the SPU added 40 .mu.L of extracted RNA to 60 .mu.L
of preliminary amplification master mix. Template-negative,
DNase/RNase-free water was used in a separate parallel reaction as
a negative control. Reaction vessels were overlaid with mineral oil
(Sigma, St. Louis, Mo.) and transferred by the sample handling
system of the SPU to a thermal-cycling module in the SPU to
commence RT-PCR.
[0250] The preliminary amplification mix yielded final
concentrations of 1.times. Phusion High-Fidelity buffer (New
England Biolabs #B0518S, Ipswich, Mass.), 0.25 mM dNTP, 0.975 mM
MgCl.sub.2, 0.008 mg/mL reverse-transcriptase (RT, Theranos, Palo
Alto, Calif.), 1.25 mg/mL DNA polymerase (D-Pol, Theranos, Palo
Alto, Calif.), 0.8 .mu.M of each pre-amp primer against ZIKV, and
0.8 .mu.M of each pre-amp primer against MS2 phage. Thermal-cycling
parameters started with 42.degree. C. for 3 min for the reverse
transcription reactions. Preliminary amplification utilized one
cycle of a denaturation step at 94.degree. C. for 84 sec, annealing
step at 62.degree. C. for 33 seconds, extension step at 72.degree.
C. for 32 seconds followed by 30 cycles of 94.degree. C. for 5
seconds, 62.degree. C. for 15 seconds and 72.degree. C. for 8
seconds.
[0251] Automated isothermal amplification and detection: Primer
pairs contained pair-wise complementary 5' ends that resulted in
amplicons containing 5' overhangs. These overhangs facilitated the
generation of fluorescently detectable concatemers. Three .mu.L of
pre-amplified product (see above) for both sample and negative
control were added by the automated liquid handling system into
separate wells containing 22 .mu.L of isothermal reaction mix
against ZIKV or MS2. ZIKV DNA target amplicon, at 1.times.10.sup.6
copies/mL, was used as an isothermal-specific positive control in a
separate well. Assays were invalid if any controls failed (see FIG.
11B, which presents a Table for ZNAT results interpretation).
[0252] Isothermal reaction mixes contained a final concentration of
0.64% Tween.RTM.-20 (Sigma, St. Louis, Mo.), 160 mM Tris-HCl pH 7.9
(Teknova, Hollister, Calif.), 80 mM Mg(CH.sub.3COO)2 (Sigma, St.
Louis, Mo.), 400 mM CH.sub.3COOK (Sigma, St. Louis, Mo.), 8 mM
dithiothreitol (DTT) (Teknova, Hollister, Calif.), 400 mM betaine
(Sigma, St. Louis, Mo.), 2 .mu.M SYTO.RTM.-59 (Thermo Fisher,
Waltham, Mass.), 1.6 mM dNTP mix (Sigma, St. Louis, Mo.), 0.097
.mu.M Bst DNA polymerase (Theranos, Palo Alto, Calif.), and 1 .mu.M
each of forward and reverse primers (Theranos, Palo Alto, Calif.).
Isothermal reactions were overlaid with a melted wax solution
comprised of equal parts of 80% isododecane mixture (Alfa Aesar,
Ward Hill, Mass.) and melted paraffin wax (Sigma, St. Louis, Mo.)
that solidified at room temperature (approximately 22.degree. C.)
but melted into an optically-clear liquid after 1 min at 56.degree.
C. The isothermal reaction is conducted at 56.degree. C. during
which SYTO.RTM.-59 relative fluorescence unit (RFU) measurements
were taken every minute for 35 minutes within the isothermal module
of the SPU. Inflection time calculations were determined from sets
of four consecutive time points (t.sub.0, t.sub.1, t.sub.2,
t.sub.3). If the difference in signal (As) between adjacent time
points within a set of time points were greater than a pre-defined
threshold, then to was determined as the inflection time.
[0253] Zika target sequence for ZNAT: A 101 base-pair region within
the Zika polyprotein gene was selected as the target sequence using
in-house software algorithms and multiple sequence alignments of
available Zika polyprotein gene sequences. This target sequence
includes:
TABLE-US-00005 (SEQ ID NO: 7)
AAGCCTACCTTGACAAGCAATCAGACACTCAATATGTCTGCAAAAGAACGT
TAGTGGACAGAGGCTGGGGAAATGGATGTGGACTTTTTGGCAAAGGGAGC
[0254] Notably, this target sequence is present in the genome of
Zika strains in the current Brazilian outbreak (e.g. GenBank
accession #KU991811, b.p. 1179-1239).
[0255] Primers for ZNAT: Two pairs of primers were designed and
synthesized de novo (Thermos, Palo Alto, Calif.) for each target
sequence, where one pair was used for preliminary amplification
(pre-amplification) via thermocycling and another pair was used for
isothermal amplification and detection. Pre-amplification primer
pairs were chosen according to their performance at an annealing
temperature of 61.5.degree. C. and screened from several primer
pairs suggested by in-house software according to given target
sequence inputs. Potential isothermal primer pairs were chosen by
screening >100 possible primer pairs as suggested by proprietary
software, which also determines the most appropriate tail-ends of
each primer. Primers were further narrowed down by their
specificity in amplifying only the target sequence within human
genomic backgrounds without amplifying any target-independent
products. The following primers were used:
[0256] Pre-Amplification:
TABLE-US-00006 Zika Forward: (SEQ ID NO: 8)
5'-AAGCCTACCTTGACAAGC-3' Zika Reverse: (SEQ ID NO: 9)
5'-GCTCCCTTTGCCAAAAAG-3' MS2 phage Forward: (SEQ ID NO: 10)
5'-ACCAGCATCCGTAGCCTTATT-3' MS2 phage Reverse: (SEQ ID NO: 11)
5'-GGACCGCGTGTCTGATCC-3'
[0257] Isothermal Amplification and Detection:
TABLE-US-00007 Zika Forward: (SEQ ID NO: 12)
5'-TTTCCCCATCAGACACTCAATATGT-3' Zika Reverse: (SEQ ID NO: 13)
5'-TGGGGAAAGCCAAAAAGTCCACA-3' MS2 phage Forward: (SEQ ID NO: 14)
5'-GTGCCCCAGTTCTCCAACGG-3' MS2 phage Reverse: (SEQ ID NO: 15)
5'-TGGGGCACTTGTAAGGCGCTGC-3'
[0258] In-silico analysis of Zika pre-amplification and isothermal
primers: Primer-BLAST (NIH NCBI) was employed as previously
published, utilizing the publically available "nr" nucleotide
sequence database (Ye J, Coulouris G, Zaretskaya I, Cutcutache I,
Rozen S, Madden T L. Primer-BLAST: a tool to design target-specific
primers for polymerase chain reaction. BMC Bioinformatics. 2016;
13: 134; Yoshida A, Nagashima S, Ansai T, Tachibana M, Kato H,
Watari H, et al. Loop-mediated isothermal amplification method for
rapid detection of the periodontopathic bacteria Porphyromonas
gingivalis, Tannerella forsythia, and Treponema denticola. J Clin
Microbiol. 2005; 43(5): 2418-24). Cross reactivity against each
organism was tested explicitly by entering its taxonomy id. Primers
with six or more mismatches were constituted as non-reactive.
Furthermore, OligoAnalyzer 3.1 (IDT) was used to estimate the
decrease in Tm due to mismatches at specific sites. To get a lower
bound estimate of the effect of six mismatches, we took the
mutation with the smallest influence on Tm at each site, and then
sorted by Tm change. The sum of the .DELTA.Tm for the 6 mutations
with the least effect was 15.1.degree. C., at which point we
anticipate <1% of the oligonucleotides to be annealed to a
target with these six mismatches at the temperature and conditions
of the isothermal reaction.
[0259] Analytical sensitivity study: The analytical sensitivity
study determined the limit of detection (LoD) of ZNAT based on
inflection time. The cut-off for the inflection time was defined as
the time before .gtoreq.95% of the NTC (no template control)
inflections occurred while also being after .gtoreq.90% of the
inflection times for ZIKV samples at 1.times. the limit of
detection (LoD). A total of 33 replicates of positive Zika samples
at 320 copies/mL (10 PFU/mL) (1.times. Limit of Detection (LoD)
based on the preliminary LoD of 10 PFU/mL) and 40 false positive
ZIKV inflections from negative controls among greater than 1,500
assay runs were compiled and considered during determination of the
cut-off time. The limit of detection was deemed the lowest viral
concentration level corresponding to a detection rate of 95%.
Inflections were considered positive as long as they occurred
before the cut-off time; the lowest concentration displaying a 100%
ZIKV detection rate from at least six replicates was further
evaluated by precision testing with 20 or more additional test
replicates. Standard qRT-PCR methods with SYBR.TM. Green Master Mix
(Thermo Fisher Scientific #4367659, Waltham Mass.) and de novo
synthesized ZIKV gene standards were used to determine a conversion
factor from PFU/mL to copies/mL (1 PFU=32.6 copies) for the
PRVABC59 strain.
[0260] Inclusivity: Two commercially available ZIKV strains,
DakArdD 41662 and MR 766 (Zeptometrix, Buffalo, N.Y.), were tested
in ZNAT using SPUs; using the CDC Zika RT-PCR methods; and using an
in-house Zika RT-PCR assay at a concentration of 2.times.LoD in
serum.
[0261] Analytical specificity: A total of 11 pathogens were tested
for cross-reactivity based on their taxonomic position (other
members of the genus Flavivirus with high sequence homology to
ZIKV) and prevalence in South America, including pathogens causing
diseases with symptoms such as fever, conjunctivitis, and rash. The
11 pathogens and nine potential interfering substances found in
blood were tested in triplicate, added into serum with or without
added ZIKV at 2.times.LoD. Potential blood interfering substances
were diluted in their respective diluents and stored at 10.times.
the tested concentration with the exception of the triglyceride
mix. The triglyceride mix was stored as a 70.times. stock because
further dilution would require the solvent methanol, which inhibits
the ZNAT. The interfering substance stocks were diluted 1:10, or
1:70 for the triglyceride mix, into serum when generating the serum
samples for testing.
[0262] Nucleic acids were either extracted from cultured viral
stocks obtained from commercial vendors or used as inactivated
virus. Cross-reactants were added to specific vessel in the
cartridge, which then were automatically added into the
lysis/binding reaction within SPUs at various concentrations. For
10.times. and 70.times. stock preparations, the following
interfering substances were diluted as: bilirubin in DMSO;
cholesterol in ethanol, gamma globulin in 0.9% NaCl, and human
genomic DNA (hgDNA) in TE buffer pH 8.0 (IDT DNA, Coralville,
Iowa), and all other potential interfering substances were diluted
in DNase/RNase-free water (Teknova, Hollister, Calif.). The
substances bilirubin, cholesterol, gamma-globulin, hemoglobin,
hgDNA, and triglycerides, were chosen because they are components
of human blood and have the potential to interfere with the assay
if they are not removed by the sample prep process. The substances
EDTA, heparin lithium salt, and sodium citrate are common
anti-coagulants used when collecting blood samples. All substance
test concentrations, with the exception of the anticoagulants, were
recommended by the Clinical Laboratory Standards Institute (CLSI)
guideline EP7-A2: Interference Testing Clinical Chemistry. Ten
viruses and one parasite tested for analytical specificity were
obtained from Zeptometrics and ATCC and all interfering substances
we obtained from Sigma-Aldrich. The nucleic acids of nine viruses
(excluding parvovirus) and one parasite were extracted from
cultured material obtained from vendors using the QIAcube.RTM.
automated sample prep device using the QIAGEN QIAamp Viral Mini Kit
(Qiagen, Hilden, Germany). The purified nucleic acids were
quantified through qRT-PCR. Serial ten-fold dilutions of a
synthetic RNA or DNA template of known concentration was used to
prepare standards for qRT-PCR. Each of the lysates were diluted 10,
100, and 1000 fold from respective stocks. Purified samples were
tested in parallel with the standards. Ten-fold serial dilutions of
synthetic RNA standards determined a standard curve. Lysates
concentrations were determined by extrapolating the concentration
values in copies/mL from the standard curve.
[0263] CDC RT-PCR assay: Based on the protocol provided by CDC
(TaqMan Real Time RT-PCR Protocol--25 .mu.L), several modifications
were made by CDC to the previously published methods by Lanciotti
et al. These include the usage of 5 .mu.L of RNA extract instead of
10 .mu.L. Each of the two assays within the CDC RT-PCR test
utilized two separate sets of primers and probes. Each assay
utilized RNA extracted from the same blood specimen within two test
wells per assay. Positive ZIKV test results were defined by all
four test wells yielding Ct values <38. The CDC Zika RT-PCR
protocol notes that their test includes two primer/probe sets for
the detection of Zika virus RNA. The first set detects all known
genotypes of Zika virus; the second, modified set
Zika4481/4507cFAM/4552c is specific for Zika virus Asian genotype
currently circulating in the Western Hemisphere and is specified
below:
TABLE-US-00008 Zika4481 (SEQ ID NO: 16) CTGTGGCATGAACCCAATAG
Zika4507cFAM (SEQ ID NO: 17) CCACGCTCCAGCTGCAAAGG Zika4552c (SEQ ID
NO: 18) ATCCCATAGAGCACCACTCC
[0264] Statistical Analyses: 95% confidence intervals (CIs) on PPA
and NPA were computed according to equations 15 & 15B under
section 10.2.2 in CLSI EP12 A2E guidelines.
[0265] In-house Zika rRT-PCR assay: Serum samples were processed
according to manufacturer's instructions using the QIAcube
workstation (Qiagen, Valencia, Calif.). RT-PCR reactions were
prepared by adding 1.times.qPCR Assay QuantiTect Probe RT-PCR
master-mix (Qiagen, Valencia, Calif.), 1 .mu.M Zika forward primer
(GACATGGCTTCGGACAG (SEQ ID NO: 19)), 1 .mu.M Zika reverse primer
(ATATTGAGTGTCTGATTGCTTG (SEQ ID NO: 20)), 0.15 .mu.M Zika probe (5'
FAM TGCCCAACACAAGGTGAAGCC Dabcyl 3' (SEQ ID NO: 21)), 0.25 .mu.M
enzyme mix (Qiagen, Valencia, Calif.), 5 .mu.L template. Reactions
were run using the following thermocycling program, and monitored
in the FAM channel: Reverse transcription step at 50.degree. C. for
30 min, denaturation at 95.degree. C. for 15 sec, followed by 45
cycles of 95.degree. C. for 15 sec, 60.degree. C. for 1 min on the
Bio Rad CFX96 Touch.TM. Real Time PCR Detection System (Bio Rad,
Hercules, Calif.).
[0266] Run-to-run (Carry-over) contamination assessment for ZNAT:
Ten consecutive runs were performed on each of five SPUs, where
each run alternated between serum samples with ZIKV at
1.3.times.10.sup.7 genomic copies/mL or without ZIKV.
[0267] Clinical study: ZIKV detection rates in blood samples
obtained from Colombia, Dominican Republic, and U.S., including
from Zika-symptomatic subjects, were compared between the ZNAT and
CDC ZIKV RT-PCR assay. Discordant results between the two assays
were further tested with the altona Diagnostics GmbH RealStar.RTM.
Zika Virus RT-PCR ("altona Diagnostics RealStar.RTM.") method
(altona Diagnostics, Hamburg, Germany). CDC ZIKV RT-PCR was
performed following a modified CDC protocol using serum (Lanciotti
R S, Kosoy O L, Laven J J, Velez J O, Lambert A J, Johnson A J, et
al. Genetic and serologic properties of Zika virus associated with
an epidemic, Yap State, Micronesia, 2007. Emerg Infect Dis. 2008;
14(8): 1232-9). The altona Diagnostics RealStar.RTM. assay was
performed as per manufacturer protocol, using serum or urine. ZIKV
RNA extraction was performed on the Qiacube automated device
(Qiagen, Hilden, Germany). Thermal-cycling and fluorescent
detection was performed on the Bio-Rad C1000 Touch.TM. with
CFX96.TM. Optical Reaction Module (Bio-Rad, Hercules, Calif.).
Results
[0268] Analytical sensitivity of ZNAT: The cut-off time of the
assay was determined to be the time point before which any
inflection was deemed a positive test result (i.e. ZIKV
inflection). ZIKV inflection times <40 min were obtained from
both true- and false-positives. True-positives comprised 27 serum
samples with ZIKV added at 1.times. of the preliminary LoD while 40
false-positives were collected from >1,500 preliminary test
assays. All ZIKV inflections were plotted as a histogram (FIG.
11A). The histogram shown in FIG. 11A is a histogram plot for
Cut-off determination for ZNAT, showing a histogram of ZIKV
inflections <40 minutes from totals of 40 and 27 venous serum
samples, with added ZIKV at 10 plaque-forming units (PFU)/ml
(1.times.LoD (LoD=limit of detection)) or without ZIKV (no template
control (NTC)). Receiver operating characteristic (ROC) curve
analyses identified 27.0 min as a cut-off time allowing >90%
sensitivity (true-positive detection rate) and >95% specificity
(true-negatives exclusion rate) in serum samples (FIG. 11A).
[0269] ZNAT analytical sensitivity was determined by ZIKV (strain
PRVABC59 from the CDC) at various concentrations in serum,
including 0, 1, 5, 15, 30, and 60 PFU/mL with equivalent genomic
copies of 0, 32, 160, 480, 960, and 1920 copies/mL respectively at
n=6 replicates each. 15 PFU/mL (480 copies/mL) was the lowest
concentration in serum at which 100% of the results were positive
and was further confirmed as the final LoD when it yielded a 95%
ZIKV detection rate for 20 additional replicates (FIG. 13, showing
analytical sensitivity determination of ZNAT). This method was
similarly applied to CWB, which established 10 PFU/mL (320
copies/mL) as the final LoD for yielding 95% positive ZIKV
detection rate for 20 replicates (FIG. 13). Taking initial viral
titers into consideration, qRT-PCR determined that 10 and 15 PFU/mL
corresponded to approximately 327 and 490 copies/mL, respectively
(FIG. 12, showing quantification of three ZIKV lysates). As shown
in FIG. 12, qRT-PCR was used to convert plaque-forming units (PFU)
and half-maximal tissue culture infective dose (TCID.sub.50) values
to number of copies for three different ZIKV lysates. Ten-fold
serial dilutions of synthetic RNA standards (indicated by circles)
were used to determine a standard curve. Lysates of unknown
concentrations tested in parallel are indicated by crosses.
[0270] Inclusivity of ZNAT: In silico analyses were conducted using
109 sequences from 38 publicly available (as of Jun. 1, 2016) ZIKV
strains to determine whether ZNAT PCR primer pairs contained
complementary sequences. Complete complementation was observed for
31 strains, suggesting that the ZNAT primers should detect these
ZIKV strains. The remaining seven strains exhibited at least one
base pair mismatch within the primer binding sites, indicating
these strains may have decreased detection rates due to incomplete
primer-target DNA binding (FIG. 14, a table showing the results of
in silico analyses of ZNAT primers against sequenced Zika virus
strains). Two of these seven strains, ArD157995 and MR 766,
possessed at least two base pair mismatches within primer binding
sites (FIG. 14). Of these two mismatch-containing strains, only MR
766 was commercially available to test ZNAT. ZNAT successfully
detected both MR 766 and another commercial strain that did not
contain any mismatches, DakArD 41662, at 960 copies/mL, in serum
samples. In contrast, the CDC ZIKV RT-PCR assay failed to detect
either strain in serum samples (FIG. 16). However, Theranos Zika
RT-PCR primers successfully detected both strains in the same RNA
extracts that the CDC Zika RT-PCR assay failed to detect, ruling
out the possibility that the CDC Zika RT-PCR non-detections were
due to faulty RNA extraction (FIG. 15, showing, in Table form,
reactivity/inclusivity analysis of ZNAT in serum). The
concentrations tested for these two strains corresponded to
approximately 2.times. equivalents of the LoD for the CDC ZIKV
(PRVABC59) strain, or 980 copies/mL (FIG. 12).
[0271] Analytical specificity of ZNAT: During primer design, in
silico analyses suggested that cross-reactivity against large
panels of pathogens with similar genetic sequences or ZIKV-like
clinical symptoms was unlikely due to the presence of multiple base
pair mismatches between ZNAT primers and target priming sequences
(FIG. 16 (a table showing in silico analysis of Zika preliminary
amplification and isothermal primers against prevalent diseases
with Zika-like onset symptoms) and FIG. 17 (a table showing in
silico mismatch analysis of ZNAT primers against potentially
cross-reacting organisms)). A panel of organisms bearing
significant genetic homology or clinical similarity with ZIKV was
tested using ZNAT within serum samples. Tested organisms did not
produce any false results when tested using serum samples with or
without 2.times.LoD ZIKV, respectively (FIG. 18, a table showing
results of cross-reactivity and interfering substance analyses of
ZNAT in serum).
[0272] Interfering substances analysis of ZNAT: High concentrations
of common components in whole blood, such as cholesterol or
hemoglobin, can potentially interfere with assays such as the ZNAT.
These components were tested with added ZIKV at 0 or 30 PFU/mL (960
copies/mL) (0 or 2.times.LoD) in serum. No tested component
contributed any observable change in ZIKV detection at 960
copies/mL (2.times.LoD), or any false positives at 0 copies/mL
(0.times.LoD) of ZIKV (FIG. 19). In addition, the organisms
previously tested for cross-reactivity (above) did not produce any
false negatives in samples containing 2.times.LoD ZIKV (FIG.
19).
[0273] Run-to-run (carry-over) contamination analysis of ZNAT: To
investigate whether sample or amplicon contaminants carried over
between consecutive ZNAT device tests, five SPU devices were used
in five rounds of paired ZNAT assays. Each round of paired assays
consisted of an initial assay of a sample containing high titer
ZIKV (4.times.10.sup.5 PFU/mL, which is 1.3.times.10.sup.7
copies/mL) followed by an assay of a sample lacking ZIKV (0 PFU/mL,
which is 0 copies/mL), with all assays utilizing serum. No
false-positives were detected for any of the five SPU devices for
any of the ZIKV-negative serum samples. This suggested that
run-to-run carry-over contamination did not occur, or was not
significant (FIG. 20, a table showing the results of analyses of
run-to-run contamination of ZNAT in serum).
[0274] Concordance studies: Serum samples were obtained from 78
U.S. subjects and 102 Dominican Republic and Colombian subjects. Of
the samples obtained from Zika-endemic areas, 69 subjects were
symptomatic patients whose Zika status were unknown, and 33 were
febrile subjects known to be negative on the CDC ZIKV RT-PCR assay.
ZIKV was not detected by either the ZNAT or the CDC assays in 78
serum samples from either healthy or febrile subjects from the
U.S., where ZIKV infections are currently rare (FIG. 21, a table
showing the results of clinical studies using ZNAT). Of the 69
samples that were clinically unknown, the ZNAT detected ZIKV in
samples from 39 of 69 subjects, whereas the CDC ZIKV RT-PCR assay
detected ZIKV in samples from 17 of 69 subjects (FIG. 21). Samples
from the 22 discordant results that were ZNAT positive but CDC ZIKV
RT-PCR assay negative were further tested with the FDA EUA-approved
altona Diagnostics RealStar.RTM. ZIKV RT-PCR assay. The altona
Diagnostics assay detected ZIKV in samples from 17 of the 22
discordant sample results (FIG. 21). Furthermore, to gauge the
robustness of the ZNAT, the 33 additional serum samples from
febrile subjects collected in Colombia, that were first tested as
ZIKV-negative by the CDC assay, were tested with exogenously-added
ZIKV at different concentrations. The CDC and ZNAT assays yielded
100% ZIKV detection rates for all 33 samples containing exogenously
added ZIKV at 480, 960, and 2400 copies/mL (15, 30, and 75 PFU/mL)
(FIG. 21).
[0275] To calculate the positive and negative percent agreement
(PPA and NPA, respectively), test results from the combined CDC
RT-PCR with altona assays were used as the reference results.
Therefore, the combined CDC RT-PCR and altona assays determined 67
total subjects to be ZIKV-positive (CDC RT-PCR assay detected ZIKV
in 17 of 69 subjects, altona confirmed an additional 17 subjects to
be ZIKV-positive, and the CDC RT-PCR assay detected all 33 samples
with exogenously added ZIKV). The Minilab ZNAA assay likewise
detected ZIKV in the same 67 subjects or samples. As the Minilab
ZNAA assay detected ZIKV 39 of 69 subjects, five more than the
combined CDC RT-PCR and altona assays, these five test results were
considered Minilab ZNAA false positives when calculating NPA. When
comparing the ZNAT to the CDC Zika RT-PCR assay with confirmation
of discrepancies by the altona Diagnostics assay, the ZNAT
demonstrated 100% sensitivity (67 of 67 samples [95% CI 94.6-100])
with 95.6% specificity (109 of 114 samples [95% CI 90.1-98.6]) for
serum samples (FIG. 21).
[0276] Concordance studies were also performed with CWB samples
from 77 U.S. and 30 Dominican Republic subjects. As both CDC Zika
RT-PCR and altona Diagnostics assays were not cleared for use with
capillary whole blood, matched-subject serum and urine specimens
were obtained in addition to capillary whole blood samples from
Dominican Republic subjects. Specimens from 52 healthy, U.S.
subjects tested ZIKV-negative by both the ZNAT and CDC ZIKV RT-PCR
assays (FIG. 21). Specimens from 25 additional healthy, U.S.
subjects were also prepared with added ZIKV were tested on both the
ZNAT and CDC Zika RT-PCR assays. The ZNAT detected ZIKV in 24 of 25
CWB samples with added ZIKV while the CDC Zika RT-PCR assay
detected ZIKV in 23 of 25 matched-subject serum samples (FIG. 21).
The two samples with added ZIKV that tested ZIKV-positive by ZNAT
and ZIKV-negative by CDC RT-PCR testing were confirmed to be
ZIKV-positive by altona Diagnostics RealStar.RTM. testing (FIG.
21).
[0277] Additionally, the ZNAT detected ZIKV in 26 of 30 CWB samples
from Dominican Republic subjects with Zika-like clinical symptoms
while the CDC Zika RT-PCR assay detected ZIKV in only 5 of 30
matched-subject serum samples (FIG. 21). Samples from all 21
discordant results were confirmed to be ZIKV-positive when using
the altona Diagnostics assay on either matched-subject serum or
urine samples (FIG. 21). In 10 of these 21 subjects, the altona
Diagnostics assay did not detect ZIKV in the serum, but did detect
ZIKV in the subject-matched urine samples. The combined CDC RT-PCR
and altona assays determined 51 total subjects to be ZIKV-positive
(the CDC RT-PCR assay detected ZIKV in 5 Dominican Republic
subjects, altona confirmed an additional 21 Dominican Republic
subjects to be ZIKV-positive, and the CDC RT-PCR assay detected all
25 samples with exogenously added ZIKV), while the Minilab ZNAA
assay detected ZIKV in all of the donor-matched capillary whole
blood samples with the exception of one sample from a healthy
subject with added ZIKV. When comparing the ZNAT to the CDC Zika
RT-PCR assay with discordant subject results confirmed by the
altona Diagnostics assay, the ZNAT displayed 98.0% sensitivity (50
of 51 samples [95% CI 89.7-99.7]) and 100.0% specificity (56 of 56
samples [95% CI 93.5-100.0]) for CWB samples.
[0278] Discussion
[0279] A novel sample-to-result diagnostic assay was developed to
detect ZIKV in both venous serum and CWB samples. This assay was
performed using a single-use cartridge run on a transportable,
fully-automated diagnostic platform (the SPU). The analytical
performance of the ZIKV assay was characterized in several studies.
Namely, the assay performance was not affected by high
concentrations of common, potentially interfering substances, did
not demonstrate cross-reactivity with genetically-homologous or
clinically-similar pathogens, detected multiple ZIKV strains, and
showed no carry-over contamination from high viral load ZIKV
samples. The assay had an LoD of 320 and 480 copies/mL for CWB and
serum, respectively. The ZNAT has a LoD that is at least similar to
the CDC ZIKV RT-PCR assay. Indeed, the ZNAT identified ZIKV in more
symptomatic subjects from Zika-prevalent areas than did the CDC
ZIKV RT-PCR test. Of these 22 samples, 17 were subsequently
confirmed as ZIKV-positive using a third, FDA-approved, altona
Diagnostics RealStar.RTM. ZIKV RT-PCR assay (FIG. 21). ZNAT also
detected ZIKV in samples from symptomatic subjects that the altona
Diagnostics assay failed to detect as having ZIKV, which suggests
that ZNAT either has greater sensitivity, is more inclusive for
Zlka strains, or has lower specificity than the altona Diagnostics
assay. However, the complete lack of false positive results among
the serum and CWB samples collected from healthy or febrile U.S.
subjects and tested by ZNAT argues against a lack of
specificity.
[0280] ZNAT detected ZIKV in capillary whole blood specimens from
21 subjects while the CDC ZIKV RT-PCR assay did not detect ZIKV in
matched-subject serum specimens from the same subjects. All 21
patients were confirmed ZIKV-positive when their respective serum
or urine samples were tested by the altona Diagnostics assay (FIG.
21). While ZNAT detected in these 21 CWB specimens, the altona
Diagnostics assay detected ZIKV in 11 of 21 serum specimens. The
altona Diagnostics assay only confirmed the remaining 10 patients
to be ZIKV-positive when their urine specimens were tested.
[0281] The present example demonstrates that the ZNAT can detect
ZIKV in CWB with sensitivities similar to serum, thereby obviating
a need for venipuncture. Implementing fingerstick phlebotomy to
provide CWB samples that can be stably transported will aid in
expanding ZIKV diagnostics, particularly in centralized testing
locations and for pregnant women and neonates. Rapid ZIKV testing
with increased accessibility can help women better prepare for
pregnancies and guide expectant mothers in managing their
pregnancies. Combining protein-based or antibody-based, serologic
ZIKV tests in parallel with ZNAT diagnostics in the same platform
may distinguish active from cleared ZIKV infections.
[0282] FIG. 22--The Nucleic Acid Amplification based assays were
run on the detection system shown in this figure. This part of the
module opens to contain 64 discrete wells, capable of running 64
discrete reactions including controls for a given assay. The
thermocycler module is on the bottom left, and above it is an
isothermal detector. The diagram on the right of FIG. 22 shows a
cross-section of the isothermal detector. The fluorescence based
isothermal detector (shown at the upper left of the figure) has
dimensions of 2.5 inches high by 5.4 inches wide by 13.1 inches
long. The thermocycler module (shown at the lower left of the
figure) has dimensions of 3.9 inches high by 5.7 inches wide by 8.5
inches long. There are series of sample vessels in the middle where
the path of the excitation LED can shine through the sample and be
detected as a fluorescent signal. Nucleic Acid Amplification-based
assays may use a thermocycler module as shown on the bottom left of
FIG. 22; a fluorescence-based isothermal detection module is shown
above the thermocycler module. The fluorescence-based isothermal
detection module is capable of running 64 separate, distinct
reactions, including controls for a given assay.
[0283] A cross sectional diagram overview of the isothermal
detector is shown on the right of FIG. 22. A series of sample
vessels are shown in the middle row where the light path of the
excitation LEDs shines through the sample and then may be detected
as a fluorescent signal by an array of photodetectors at the
bottom. For the Zika assay, measurements are taken every minute for
35 minutes in order to detect an inflection point in the
fluorescent signal. An image depicting an idealized plot of
fluorescence measurements taken periodically during the course of
multiple thermal cycles is shown as an inset in FIG. 22.
[0284] FIG. 23A provides information regarding a novel isothermal
nucleic acid amplification method for use with sample analysis
devices and systems. In embodiments using automated sample analysis
devices and systems as disclosed herein, all of the sample prep may
be automated and performed on board automated sample analysis
devices using a magnetic bead based extraction method performed
using a sample handling systems or a fluid handling system as
disclosed herein. The amplification method is a combination of a
thermal cycle based pre-amplification step, and then an isothermal
amplification and detection step, according to methods disclosed
herein. The high sensitivity is driven in part by a highly
efficient on-board sample extraction process. Primers were designed
using multisequence gene alignment.
[0285] The assay method employed by the automated assay device for
the Zika assay is an isothermal nucleic acid amplification method
according to the methods disclosed herein which requires 75
microliters of plasma or serum. All of the sample prep was
automated on the automated assay device and performed using a
magnetic bead-based extraction method. The assay method used a
combination of a PCR-based pre-amplification step, followed by an
isothermal amplification and detection step. The high sensitivity
of the assay was driven in part by a highly efficient automated
on-board sample extraction process performed by the automated assay
device. The primers used in the nucleic acid amplification Zika
assay were designed from a consensus of a multi-sequence alignment
of all Zika strains deposited in GenBank. The selected gene target
was a 100-base pair region within the highly conserved polyprotein
gene.
[0286] As shown in FIG. 23B, Applicant presents results for
analytical sensitivity, specificity, and inclusivity to show the
robustness of the platform. Additionally, a clinical study was
performed to demonstrate concordance with reference methods.
[0287] As shown in FIG. 24 the Zika assay sensitivity is shown here
using a Zika strain from the Centers for Disease Control (CDC) that
is of Asian lineage from the recent Zika outbreak. The LoD was
determined by testing Zika virus across a range of concentrations
in serum, from 0 to 1920 copies per mL. The LoD was determined to
be 480 copies/mL and was verified by testing 20 additional
replicates. For reference this is twice as sensitive as the
published LoD for the CDC Zika test.
[0288] As shown in FIG. 25, Applicant tested a panel of organisms
that are genetically or clinically similar to Zika, at very high
concentrations, both in the absence and presence of the Zika virus,
in order to confirm the analytical specificity of the assay. As
shown in the middle columns, there was no cross reactivity for any
of the organisms tested. These organisms did not cause any
significant interference with the detection of Zika virus, as shown
in the columns to the right.
[0289] As shown in FIG. 26, there was no cross-reactivity or
interference detected for any of the common potentially interfering
substances, as listed in the Table shown in FIG. 6.
[0290] Inclusivity data is shown in FIG. 27A, illustrating results
from the NAA Zika test and the CDC assay. As shown in FIG. 27A, the
NAA Zika test was able to detect these two additional Zika virus
strains (of African lineage) while the CDC test did not.
[0291] The assays carried out using the methods and devices
disclosed herein showed no significant carry-over between runs of
testing on the same device. In these carryover studies, samples
were tested with very high concentrations of Zika virus and then
run a using negative control sample. As shown in FIG. 27B, no false
positives were detected for any of the negative controls,
demonstrating no carry-over or cross contamination between runs.
This illustrates an advantage of the single-use cartridge format
disclosed herein, in which a cartridge with completely sealed
consumables is provided to the automated sample analysis device,
and in which the sample, which is also provided in the cartridge,
does not come in direct contact with the instrument but is instead
provided on, and carried by, the cartridge.
[0292] As shown in FIG. 28, samples were collected from 181
subjects, from South America and the U.S., in order to evaluate
clinical performance of the assays. 78 of the subjects were from
the US--both healthy and febrile, and 103 were from the Dominican
Republic and Colombia and presented with Zika symptoms. In order to
ensure there were enough positive samples to compute percent
agreements, the 39 naturally positive samples were supplemented
with 33 additional samples to which Zika virus was added. To
calculate percent agreement, the NAA Zika assay was compared to the
CDC RT-PCR assay and also to the altona kit, which has received
emergency use authorization (EUA).
[0293] FIG. 29 provides a comparison between the NAA Zika Assay and
the CDC RT-PCR, with confirmation by the altona assay for both
negative and positive percent agreement along with the 95%
confidence interval. The NAA Zika assay shows a high level of
concordance with the reference methods. These results demonstrate
that the automated sample analysis devices disclosed herein can
automatically perform molecular testing with fully integrated assay
and results processing, comparable to methods that require highly
trained personnel.
[0294] FIG. 30 provides an overview of some of the criteria of a
clinical study performed using the NAA Zika Assay disclosed herein
on capillary blood samples. Capillary samples were prospectively
collected from healthy or symptomatic subjects in the US or
Dominican Republic, respectively, and shipped in small containers
(Nanotainer.TM.) to the United States for analysis on the automated
sample analysis devices ("minilabs") as disclosed herein. Capillary
whole blood samples were tested on 20 minilabs while venous serum
and urine samples were tested using the CDC or Altona methods.
[0295] As shown in FIG. 31, the NAA Zika Assay using capillary
whole blood samples on the miniLab showed a high level of
concordance with the comparator methods. There was only a single
sample with added Zika virus that was detected as negative by CDC
but positive by Altona that was detected by the miniLab NAA Zika
test as negative. The NAA Zika Assay performed using the miniLab is
believed to be the only Zika test that can use capillary blood.
[0296] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. For example, a feature of one embodiment
may be combined with a feature of another embodiment, whether such
combination is described herein or not. It should also be
understood that while the invention provided herein has been
described herein using a limited number of terms and phrases for
purposes of expediency, the invention could also be described using
other terms and phrases not provided herein which also accurately
describe the invention.
[0297] Additionally, although some embodiments herein may describe
the initial thermal cycling as a "PCR" process, many embodiments
herein may perform only a thermal cycling style processing and not
any type of detection during the initial "PCR" process. In
embodiments, it should be understood that other processes that
provide an increased number of copy numbers may be used for the
initial sample enrichment. The term "initial" as used in the
examples herein does not necessarily imply that it is the first
step, but merely that it occurs before one or more follow-up
detection step(s). Some embodiments may view this as a
pre-amplification step. Some embodiments may view this as a sample
enrichment step.
[0298] In embodiments, it should also be understood that the
initial thermal cycling process may be performed on a bulk portion
and/or common portion of the sample with a plurality of different
binder types therein (ebola, malaria, etc. . . . ) for a plurality
of different loci, wherein post-thermal cycling, the process may be
processed for more specific detection such as but not limited to
DNA amplification or other detection processing currently known or
may be developed in the future. In such embodiments where there is
bulk processing of sample with a plurality of different binders, it
should be understood that detection in the initial stage, although
not specifically excluded, such detection is generally not done due
the variety of different binders in the sample that may or may not
yield actionable data. In embodiments, the hybrid process can be
configured to detect many targets from a single common sample that
is enriched, wherein the targets may be at least 5 or more. In
embodiments, the process may detect many targets from a single
sample, wherein the targets may be at least 7 or more. In
embodiments, the process may detect many targets from a single
sample, wherein the targets may be at least 10 or more. In
embodiments, the process may detect many targets from a single
sample, wherein the targets may be at least 20 or more.
[0299] In embodiments, the hybrid process herein may improve
sensitivity of the isothermal process, at least in part due to the
increase in copy numbers from the initial thermal cycling, but also
provides better specificity than PCR specificity, in part because
of the use of at least two different primers (for example, primer
in thermal cycling process and primer in the isothermal process).
In embodiments, the initial process may be coarser for the thermal
cycling step for enriching for the target(s) and not necessarily
for detection during the initial processing. In embodiments, the
initial processing may create non-specific product (along with
creating more copies of the target material) and the processing of
the sample in subsequent step provides at least a second layer of
detection that is more specific for the desired target(s) but
having the benefit of more copies to detect due to the enrichment
from the initial step (even if creating some non-specific product
in the process). In embodiments, the secondary or other later
detection process of the hybrid process may be viewed as an end
point detection that is sequence specific. In embodiments, the
hybrid process may be better than either a PCR process or
isothermal process individually in terms of sensitivity and
specificity
[0300] In embodiments, some may use parallel track processing
wherein at least one portion of the initial sample is processed
along one track using the hybrid process and at least another
portion is processed on at least one other track such as but not
limited to another PCR process or an isothermal detection process.
Because it may be the case that it is unknown if the sample has
sufficient copy numbers of a target in the sample, some situations
may occur where pre-amplification is not needed for detection to
occur in one of the non-hybrid processing tracks, particularly if
copy numbers are sufficient without sample enrichment. If one track
returns a signal sooner, the process may be stopped earlier if a
sufficient response is received on one track that reduces the need
to continue detection along one of the other parallel tracks. In
embodiments, a sample processing device may include at least one
thermal cycler and at least one non-cycling heater. Optionally,
some embodiments may have multiple thermal cyclers wherein at one
can be controlled not to cycle. In embodiments, some embodiments
may have a thermal cycler with fewer wells, chambers, or vessels
for thermal cycling that the subsequent detection process, but
optionally, each may be configured to hold larger volumes than the
wells of the follow-on detection method. Thus, one embodiment may
have one or two wells, chambers, or vessels for thermal cycling and
at least 10 or more wells, chambers, or vessels for the follow-on
detection, where each well, chamber, or vessel may be more specific
for certain loci. In such an embodiment, a division of the sample
into smaller aliquots may occur after the initial thermal cycling
step that enriches the sample. In one embodiments, a control sample
may also be thermal cycled for control purposes.
[0301] It should be understood that as used in the description
herein and throughout the claims that follow, the meaning of "a,"
"an," and "the" includes plural reference unless the context
clearly dictates otherwise. For example, a reference to "an assay"
may refer to a single assay or multiple assays. Also, as used in
the description herein and throughout the claims that follow, the
meaning of "in" includes "in" and "on" unless the context clearly
dictates otherwise. The appended claims are not to be interpreted
as including means-plus-function limitations, unless such a
limitation is explicitly recited in a given claim using the phrase
"means for." As used in the description herein and through the
claims that follow, a first object described as containing "at
least a portion" of a second object may contain the full amount
of/the complete second object.
[0302] As used in the description herein and throughout the claims
that follow, the terms "comprise", "include", and "contain" and
related tenses are inclusive and open-ended, and do not exclude
additional, unrecited elements or method steps. Also, the presence
of broadening words and phrases such as "one or more," "at least,"
"but not limited to" or other like phrases in some instances shall
not be read to mean that the narrower case is intended or required
in instances where such broadening phrases may be absent. Finally,
as used in the description herein and throughout the claims that
follow, the meaning of "or" includes both the conjunctive and
disjunctive unless the context expressly dictates otherwise. Thus,
the term "or" includes "and/or" unless the context expressly
dictates otherwise.
[0303] This document contains material subject to copyright
protection. The copyright owner (Applicant herein) has no objection
to facsimile reproduction by anyone of the patent documents or the
patent disclosure, as they appear in the US Patent and Trademark
Office patent file or records, but otherwise reserves all copyright
rights whatsoever. The following notice shall apply: Copyright
2013-16 Thermos, Inc.
Sequence CWU 1
1
39120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1tgccaactta tcatacaggc 20216DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2gactgcgcca ctttcc 16323DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3tgccaactta tcatacaggc ctt
23427DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4tgcccttcca aatacttgac tgcgcca 275121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
5ggaacgagga ccatcgcatc acccaagggt cctgttatcc agatgtatac caatgtagac
60caagacctcg tgggctggcc cgctcctcaa ggtgcccgct cattgacacc ctgcacctgc
120g 1216121DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 6ggaacgagga ccatcgcatc acccaagggt
cctgttatcc agatgtatac caatgtagac 60aaagacctcg tgggctggcc cgctcctcaa
ggtgcccgct cattgacacc ctgcacctgc 120g 1217101DNAZika virus
7aagcctacct tgacaagcaa tcagacactc aatatgtctg caaaagaacg ttagtggaca
60gaggctgggg aaatggatgt ggactttttg gcaaagggag c 101818DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8aagcctacct tgacaagc 18918DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9gctccctttg ccaaaaag
181021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10accagcatcc gtagccttat t 211118DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11ggaccgcgtg tctgatcc 181225DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 12tttccccatc agacactcaa tatgt
251323DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13tggggaaagc caaaaagtcc aca 231420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14gtgccccagt tctccaacgg 201522DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 15tggggcactt gtaaggcgct gc
221620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16ctgtggcatg aacccaatag 201720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
17ccacgctcca gctgcaaagg 201820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 18atcccataga gcaccactcc
201917DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19gacatggctt cggacag 172022DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
20atattgagtg tctgattgct tg 222121DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 21tgcccaacac aaggtgaagc c
212220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22gaaccaacgc atgacccaag 202319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23ttgaaccaac gcatgaccc 192420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 24cagacgaaaa agcaccagaa
202521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 25gcaccagaaa atatgagcga c 212620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
26atccggtact gcagaactca 202720DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 27gcaaatccgg tactgcagaa
202820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 28attggcaaat ccggtactgc 202920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
29ggcagacaaa ttgggtggtt 203021DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 30gccaatgacg aatacaaagt c
213122DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 31taatagccat catcatgttt gg 223260DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32ggaacgagga ccatcgcatc acccaagggt cctgttatcc agatgtatac caatgtagac
603359DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 33cgcaggtgca gggtgtcaat gagcgggcac cttgaggagc
gggccagccc acgaggtct 593424DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 34tttgtctaaa gggtcctgtt atcc
243520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 35tagacaaaca gcccacgagg 203623DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
36tttgtctagt tatccagatg tat 233723DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 37tagacaaacc agcccacgag gtc
233824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 38tcttggtcca agggtcctgt tatc 243923DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
39gaccaagaag ggtgtcaatg agc 23
* * * * *