U.S. patent application number 16/629604 was filed with the patent office on 2021-05-13 for compositions and methods for treatment of cancers harboring an h3k27m mutation.
The applicant listed for this patent is The Board of Trustees of the Leland Stanford Junior University. Invention is credited to Crystal Mackall, Robbie Majzner, Michelle Monje-Deisseroth, Christopher Mount.
Application Number | 20210137979 16/629604 |
Document ID | / |
Family ID | 1000005357775 |
Filed Date | 2021-05-13 |
![](/patent/app/20210137979/US20210137979A1-20210513\US20210137979A1-2021051)
United States Patent
Application |
20210137979 |
Kind Code |
A1 |
Monje-Deisseroth; Michelle ;
et al. |
May 13, 2021 |
COMPOSITIONS AND METHODS FOR TREATMENT OF CANCERS HARBORING AN
H3K27M MUTATION
Abstract
The invention relates to immunotherapeutic treatment of cancer.
In particular, the invention relates to methods of treating cancer
carrying a histone H3K27M (H3K27M) mutation (e.g., diffuse midline
glioma with H3K27M mutation) using immunotherapeutic compositions
comprising immune cells engineered to express GD2-specific chimeric
antigen receptors.
Inventors: |
Monje-Deisseroth; Michelle;
(Stanford, CA) ; Majzner; Robbie; (Stanford,
CA) ; Mackall; Crystal; (Stanford, CA) ;
Mount; Christopher; (Stanford, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Board of Trustees of the Leland Stanford Junior
University |
Stanford |
CA |
US |
|
|
Family ID: |
1000005357775 |
Appl. No.: |
16/629604 |
Filed: |
July 12, 2018 |
PCT Filed: |
July 12, 2018 |
PCT NO: |
PCT/US18/41839 |
371 Date: |
January 9, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62531872 |
Jul 12, 2017 |
|
|
|
62651406 |
Apr 2, 2018 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 45/06 20130101;
C07K 16/3084 20130101; A61K 35/17 20130101; A61P 35/00
20180101 |
International
Class: |
A61K 35/17 20060101
A61K035/17; A61K 45/06 20060101 A61K045/06; C07K 16/30 20060101
C07K016/30; A61P 35/00 20060101 A61P035/00 |
Claims
1. A method of treating an individual having cancer characterized
by a histone H3 K27M (H3K27M) mutation comprising administering to
the individual an effective amount of immune cells genetically
modified to express a chimeric antigen receptor (CAR) specific for
ganglioside GD2 (GD2).
2. The method of claim 1, wherein the cancer characterized by a
histone H3 K27M (H3K27M) mutation is a glioma.
3. The method of claim 2, wherein the glioma is diffuse intrinsic
pontine glioma (DIPG).
4. The method of claim 1, wherein the cancer characterized by a
histone H3 K27M (H3K27M) mutation is diffuse midline glioma.
5. The method of claim 1, wherein the immune cells are T cells.
6. The method of claim 1, wherein the immune cells are natural
killer (NK) T cells.
7. The method of claim 1, wherein the chimeric antigen receptor
(CAR) specific for GD2 comprises an antigen binding domain of an
antibody selected from the group consisting of 14G2a, ch14.18,
hu14.18K322A, m3F8, hu3F8-IgG1, hu3F8-IgG4, HM3F8, and DMAb-20.
8. The method of claim 7, wherein the antigen binding domain is a
single-chain variable fragment (scFv).
9. The method of claim 7, wherein the chimeric antigen receptor
(CAR) specific for GD2 further comprises a T cell transmembrane
domain, a T cell receptor signaling domain, and/or at least one
co-stimulatory domain.
10. The method of claim 9, wherein the co-stimulatory domain
comprises part or all of one or more of CD28, OX40/CD134,
4-1BB/CD137/TNFRSF9, FcERI.gamma., ICOS/CD278, ILRB/CD122,
IL-2RG/CD132, and CD40.
11. The method of claim 1, wherein the chimeric antigen receptor
(CAR) specific for GD2 comprises an antigen binding domain
containing heavy and light chain variable regions (scFv) that bind
with specificity to the GD2 epitope:
GalNAc.beta.1-4(NeuAc.alpha.2-8NeuAc.alpha.2-3)Gal.
12. The method of claim 1, wherein the CAR comprises the 14G2a
scFv.
13. A method of treating or delaying the progression of cancer in a
patient, wherein the cancer is characterized by a histone H3 K27M
(H3K27M) mutation, comprising: a) obtaining a biological sample
comprising cancer cells from the patient; b) determining the
presence or absence of an H3K27M mutation within the cancer cells;
and c) administering to the patient a therapeutically effective
amount of a composition comprising T cells genetically modified to
express a chimeric antigen receptor (CAR) specific for ganglioside
GD2 (GD2) if the cancer cells are characterized as having an H3K27M
mutation.
14. The method of claim 13, wherein the cancer is selected from the
group consisting of diffuse intrinsic pontine glioma (DIPG) and
diffuse midline glioma.
15. The method of claim 13, wherein the administering reduces the
number of H3K27M positive cancer cells in the patient.
16. The method of claim 13, wherein the administering reduces
and/or clears tumor burden in the patient.
17. The method of claim 13, further comprising administering to the
patient one or more anticancer agents and/or one or more
chemotherapeutic agents.
18. The method of claim 13, wherein the administering occurs
before, at the same time, and/or after the patient receives
radiation therapy.
19. A therapeutically effective amount of a composition comprising
T cells genetically modified to express chimeric antigen receptor
(CAR) specific for ganglioside GD2 (GD2) for use in treating or
delaying the progression of cancer in a subject, wherein the cancer
harbors a histone H3 K27M (H3K27M) mutation.
20. The composition for use of claim 19, further comprising one or
more anticancer agents and/or one or more chemotherapeutic
agents.
21. The composition for use of claim 19, wherein the subject is
selected from the group consisting of a subject with diffuse
intrinsic pontine glioma (DIPG) and a subject with diffuse midline
glioma.
22. The composition for use of claim 19, wherein the composition
comprising T cells genetically modified to express a chimeric
antigen receptor (CAR) specific for GD2 provides one or more of the
followings effects: reduces the number of H3K27M positive cancer
cells in the patient. reduces and/or clears tumor burden in the
patient.
23. A kit comprising a medicament comprising T cells genetically
modified to express a chimeric antigen receptor (CAR) specific for
GD2 and an optional pharmaceutically acceptable carrier, and a
package insert comprising instructions for administration of the
medicament for treating or delaying progression of cancer in an
individual.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present invention claims the priority benefit of U.S.
Provisional Patent Application 62/651,406, filed Apr. 2, 2018, and
U.S. Provisional Patent Application 62/531,872, filed Jul. 12,
2017, each of which is incorporated by reference in their
entireties.
FIELD OF THE INVENTION
[0002] The present invention relates to the immunotherapeutic
treatment of cancer. In particular, the invention relates to
methods of treating cancer carrying a histone H3 K27M (H3K27M)
mutation (e.g., glioma with H3K27M mutation) using
immunotherapeutic compositions comprising immune cells engineered
to express GD2-specific chimeric antigen receptors. Compositions
and methods of the invention find use in both clinical and research
settings, for example, within the fields of biology, immunology,
medicine, and oncology.
BACKGROUND
[0003] Cancer is one of the most devastating diseases both in terms
of human life opportunity loss and health care cost. It also
presents unmet clinical needs. Cancer is typically treated with
surgery, chemotherapy, radiation therapy, or a combination thereof.
These treatments, however, often have significant side effects
including immune system suppression, destruction of normal cells in
the body, autoimmunity, aberrant cellular metabolism, and even
metastasis and the onset of secondary cancer.
[0004] Diffuse intrinsic pontine glioma (DIPG) and other histone H3
K27M (H3K27M) mutated midline gliomas are examples of extremely
aggressive and universally fatal pediatric cancers. While much
progress has been achieved characterizing the molecular origins of
these tumors, improvements in clinical management have remained
elusive, with median survival for DIPG remaining approximately 10
months. Immunotherapy agents including checkpoint inhibitors have
provided substantial clinical benefit in numerous adult cancers
refractory to traditional therapies, but these agents have not yet
demonstrated conclusive benefit in childhood cancers such as
DIPG.
SUMMARY
[0005] The present invention relates to the immunotherapeutic
treatment of cancer. In particular, the invention relates to
methods of treating cancers carrying a histone H3 K27M (H3K27M)
mutation (e.g., a DIPG with an H3K27M mutation) using
immunotherapeutic compositions comprising immune cells engineered
to express GD2-specific chimeric antigen receptors (GD2 CARs).
[0006] As described herein, new targets and strategies for
immunotherapy have been identified for H3K27M mutated cancers
(e.g., diffuse gliomas (e.g., diffuse midline glioma and diffuse
intrinsic pontine glioma (DIPG))). In particular, the invention
identified significant and remarkably high levels of
disialoganglioside GD2 expression occurring in the context of
diffuse glioma.
[0007] Accordingly, in one aspect, a method of treating cancer
characterized by an H3K27M mutation is provided, the method
comprising administering to an individual (e.g., a patient) having
such a cancer an effective amount of immune cells genetically
modified to express a chimeric antigen receptor (CAR) specific for
GD2. In certain embodiments, the cancer is a glioma. In some
embodiments, the glioma is diffuse intrinsic pontine glioma (DIPG).
In other embodiments, the cancer is diffuse midline glioma.
However, the invention is not so limited. Indeed, any cancer having
an H3K27M mutation may be treated with the compositions and methods
described herein.
[0008] In certain embodiments, the immune cells genetically
modified to express a chimeric antigen receptor (CAR) specific for
GD2 are T cells. The invention is not limited by the type of T cell
so modified. In some embodiments, the T cells are CD3+ T cells
(e.g., a combination of CD4+ and CD8+ T cells). In certain
embodiments, the T cells are CD8+ T cells. In other embodiments,
the T cells are CD4+ T cells. In some embodiments, the T cells are
natural killer (NK) T cells. In some embodiments, the T cells are
gamma delta T cells. In some embodiments, the T cells are a
combination of CD4+ and CD8 T+ cells (e.g., that are CD3+). In
certain embodiments, the T cells are memory T cells (e.g.,
tissue-resident memory T (Trm) cells, stem memory TSCM cells, or
virtual memory T cells). In certain embodiments, the T cells are a
combination of CD8+ T cells, CD4+ T cells, NK T cells, memory T
cells, and/or gamma delta T cells. In some embodiments, the
modified immune cells are cytokine-induced killer cells.
[0009] In certain embodiments, the CAR expressed in immune cells is
any CAR that specifically recognizes GD2 (e.g., that binds with
specificity to an epitope of GD2 (e.g.,
GalNAc.beta.1-4(NeuAc.alpha.2-8NeuAc.alpha.2-3)Gal)). The invention
is not limited by the type of GD2-specific CAR. Indeed, any CAR
that binds with specificity to GD2 may be used to genetically
modify (e.g., to be expressed in) immune cells. Exemplary CARs
include, but are not limited to, CAR that includes the GD2 binding
domain of a GD2-specific antibody such as, but not limited to,
14G2a, ch14.18, hu14.18K322A, m3F8, hu3F8-IgG1, hu3F8-IgG4, HM3F8,
and DMAb-20. In certain embodiments, the antigen binding domain is
a single-chain variable fragment (scFv) containing heavy and light
chain variable regions that recognize or specifically bind an
epitope of GD2. In some embodiments, the CAR further comprises a
transmembrane domain (e.g., a T cell transmembrane domain (e.g., a
CD28 transmembrane domain)) and a signaling domain comprising one
or more immunoreceptor tyrosine-based activation motifs
(ITAMs)(e.g., a T cell co-receptor signaling domain (e.g., a
CD3-zeta chain (CD3.zeta.)). In some embodiments, the CAR comprises
one or more co-stimulatory domains (e.g., domains that provide a
second signal to stimulate T cell activation. The invention is not
limited by the type of co-stimulatory domain. Indeed, any
co-stimulatory domain known in the art may be used including, but
not limited to, CD28, OX40/CD134, 4-1BB/CD137/TNFRSF9,
Fc.epsilon.RI.gamma., ICOS/CD278, ILRB/CD122, IL-2RG/CD132, and
CD40. In certain embodiments, the co-stimulatory domain is
4-1BB.
[0010] In certain embodiments, the present invention provides that
exposure of animals (e.g., humans) suffering from cancers
characterized by H3K27M-expressing cells (e.g., a DIPG with
H3K27M-expressing cells) to therapeutically effective amounts of
immunotherapeutic compositions comprising immune cells genetically
modified to express GD2-specific CAR inhibits the growth of such
H3K27M-expressing cancer cells or supporting cells outright and/or
renders such cells as a population more susceptible to other
treatments (e.g., the cell death-inducing activity of cancer
therapeutic drugs or radiation therapies).
[0011] The present invention contemplates that the methods and
compositions thereof described herein satisfy a long-felt but unmet
medical need for the treatment of pediatric brain cancers,
particularly those cancer types characterized by H3K27M-expressing
cells, either when administered as a monotherapy (e.g., to kill
cancer cells, and/or induce cell growth inhibition, apoptosis
and/or cell cycle arrest in cancer cells), or when administered in
a temporal relationship with additional agent(s) (e.g., in
combination therapies), such as other cell death-inducing or cell
cycle-disrupting cancer therapeutic drugs or radiation therapies
(e.g., to render a greater proportion of the cancer cells
susceptible to executing the apoptosis program compared to the
corresponding proportion of cells in an animal treated only with
the cancer therapeutic drug or radiation therapy alone).
[0012] Accordingly, in certain embodiments, the invention provides
methods of treating or delaying the progression of cancer in a
patient, wherein the cancer is characterized by a histone H3 K27M
(H3K27M) mutation, the methods comprising: obtaining a biological
sample comprising cancer cells from the patient; determining the
presence or absence of an H3K27M mutation within the cancer cells;
and administering to the patient a therapeutically effective amount
of a composition comprising T cells genetically modified to express
a chimeric antigen receptor (CAR) specific for GD2 if the cancer
cells are characterized as having H3K27M mutation. In certain
embodiments, the therapeutically effective amount of the
genetically modified T cell composition comprising GD2-specific CAR
T cells reduces the number of H3K27M positive cancer cells in the
patient following such treatment. In certain embodiments, the
therapeutically effective amount of the genetically modified T cell
composition comprising GD2-specific CAR T cells reduces and/or
clears the tumor burden in the patient following such treatment. In
certain embodiments, the administering occurs before, at the same
time, and/or after the patient receives radiation therapy. In
certain embodiments, the method further comprises administering to
the patient one or more anticancer agents and/or one or more
chemotherapeutic agents. In certain embodiments, combination
treatment of a patient with a therapeutically effective amount of T
cells genetically modified to express a chimeric antigen receptor
(CAR) specific for GD2 and a course of an anticancer agent produces
a greater tumor response and clinical benefit in such patient
compared to those treated with the modified T cells or anticancer
drugs/radiation alone. Since the doses for all approved anticancer
drugs and radiation treatments are known, the present invention
contemplates the various combinations of them with the modified T
cells.
[0013] In certain embodiments, the invention provides a
therapeutically effective amount of a composition (e.g., an
immunotherapeutic composition) comprising T cells genetically
modified to express a chimeric antigen receptor (CAR) specific for
GD2 (e.g., for use in treating or delaying the progression of
cancer in a subject (e.g., wherein the cancer harbors a histone H3
K27M (H3K27M) mutation)). As described herein, the composition may
further comprise one or more anticancer agents and/or one or more
chemotherapeutic agents. The invention also provides the use of the
composition to induce cell cycle arrest and/or apoptosis in
H3K27M-expressing cells (e.g., DIPG characterized by
H3K27M-expressing cells). The invention also relates to the use of
the compositions for sensitizing cells to additional agent(s), such
as inducers of apoptosis and/or cell cycle arrest, and
chemoprotection of normal cells through the induction of cell cycle
arrest prior to treatment with chemotherapeutic agents.
Compositions of the invention are useful for the treatment,
amelioration, or prevention of disorders, such as any type of
cancer characterized by H3K27M-expressing cells (e.g., DIPG
characterized by H3K27M-expressing cells) and additionally any
cells responsive to induction of apoptotic cell death (e.g.,
disorders characterized by dysregulation of apoptosis, including
hyperproliferative diseases such as cancer). In certain
embodiments, the compositions can be used to treat, ameliorate, or
prevent a cancer characterized by H3K27M-expressing cells (e.g.,
DIPG characterized by H3K27M-expressing cells) that additionally is
characterized by resistance to cancer therapies (e.g., those cancer
cells which are chemoresistant, radiation resistant, hormone
resistant, and the like). The invention also provides
pharmaceutical compositions comprising the composition (e.g.,
immunotherapeutic compositions) comprising T cells genetically
modified to express a chimeric antigen receptor (CAR) specific for
GD2 in a pharmaceutically acceptable carrier.
[0014] The invention further provides kits comprising one or more
of the described compositions (e.g., immunotherapeutic
compositions) comprising T cells genetically modified to express a
chimeric antigen receptor (CAR) specific for GD2 for use according
to the description provided herein. For example, in certain
embodiments, the invention provides kits comprising one or more of
the described compositions (e.g., immunotherapeutic compositions)
comprising T cells genetically modified to express a chimeric
antigen receptor (CAR) specific for GD2 and instructions for
administering the composition to an animal (e.g., diagnosed as
having an H3K27M cancer). The kits may optionally contain other
therapeutic agents, e.g., anticancer agents or apoptosis-modulating
agents. In some embodiments, the kit comprises a medicament
comprising T cells genetically modified to express a chimeric
antigen receptor (CAR) specific for GD2, an optional
pharmaceutically acceptable carrier, and a package insert
comprising instructions for administration of the medicament for
treating or delaying progression of cancer in an individual.
DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 shows the identification of GD2 overexpression in
DIPG. FIG. 1A shows flow cytometry-based screening of cell surface
antigens in patient-derived DIPG cell cultures. Four independent
low-passage (<12) cultures derived from donated post-mortem DIPG
patients were expanded under serum-free neurosphere-forming culture
conditions, and surface antigens were profiled using a panel of 284
monoclonal antibodies (BD Lyoplate). After gating to remove
doublets and dead cells, median fluorescence intensity (MFI) of
live cells (viability >80% in all assays) stained with target
antigen was divided by the MFI of live cells stained with the
corresponding isotype control and Log 10-scaled (See FIG. 3). FIG.
1B shows that assessment of hit overlap between screened cultures
identified a total of 36 hits present at an MFI of at least 10
times isotype control in all screened cultures. FIG. 1C shows flow
cytometry staining of histone H3 WT pediatric high grade glioma
cultures VU-DIPG10, diagnosed as a DIPG, and pcGBM2, which arose in
cortex, display markedly lower GD2 expression levels compared to
histone H3 K27M DIPGs. FIG. 1D shows double immunohistochemistry of
primary DIPG tumor specimens utilizing an antibody against mutant
H3K27M to identify tumor cells and mouse anti-GD2 (14g2a) revealing
extensive local GD2 expression in primary DIPG (scale bar=100
microns). FIG. 1E depicts a schematic of the GD2-directed 14g2a
scFv; 4-1BB; CD3z CAR T cell and control constructs used to
evaluate efficacy against DIPG. FIG. 1F shows incubation of DIPG
cells with GD2-CAR T cells achieves potent DIPG cell lysis at low
effector:target (E:T) ratios, compared to minimal lysis rates under
most conditions in the presence of CD19-CAR T cells. FIG. 1G shows
incubation of GD2-CAR T cells with DIPG cultures induced
substantial cytokine (IFN-g and IL-2) generation compared to
minimal production by CD19-CAR T cells. In contrast, VU-DIPG 10, an
H3 WT line not expressing GD2 (see FIG. 1C), did not trigger
cytokine production by GD2-CAR T cells. FIG. 1H shows Cas9-mediated
deletion of GD2 synthase eliminates GD2 expression in DIPG
cultures. FIG. 1H(a) SU-DIPG13 cells electroporated with Cas9-gRNA
complexes eliminated GD2 surface expression FIG. 1H(b) following an
.about.45 bp deletion at the gRNA target site (two-tailed T test of
variance-covariance matrix of standard errors between modeled indel
traces and parent sequence, implemented in Tracking of Indels by
Decomposition webtool). As a control, gRNA targeting the AAVS1
locus were used. FIG. 1H(c) shows that Cell Trace Violet
proliferation assay performed on GD2-CAR T cells following in vitro
incubation with the GD2-negative line VUMC-10 or GD2-high SU-DIPG13
demonstrated antigen-specific proliferation of GD2-CAR T cells.
FIG. 1I shows GD2-CAR T-cells do not produce substantial levels of
IFN-gamma or IL-2 following co-culture with H3K27M GD2neg line
generated using CRISPR/Cas9 to knockout GD2 synthase compared with
unmodified control cells or Cas9 targeting the control AAVS1 locus.
FIG. 1J depicts pathway analysis of ganglioside enzyme expression.
Transcription of target ganglioside synthesis pathway enzymes was
assessed by semiquantitative RT-PCR. A biosynthesis flow diagram is
provided where the average expression value (2-dCt(HPRT) of key
pathway enzymes (genes in boldface) across each culture of the
given genotype is shown, and the arrow size is scaled to the
average expression in H3F3A K27M cultures. Across the majority of
H3F3A K27M cultures, expression of ganglioside synthesis enzymes
upstream of GD2 was substantially increased compared to H3WT
pediatric high-grade glioma (pHGG) cultures. Across all cultures,
B3GALT4 expression was minimal compared to upstream genes,
indicating potentially limited rates of GD2 to GD1b conversion. A
heatmap and bar graph representation of expression values for
individual cultures in each H3 genotype category (3 biological
replicates each with technical duplicates) is provided. Primers
utilized for qPCR expression analysis are shown in Example 1, Table
2.
[0016] FIG. 2 shows that GD2-targeting CAR immunotherapy achieved
potent and lasting antitumor response in DIPG orthotopic
xenografts. FIG. 2A depicts bioluminescence imaging of NSG mice
xenografted with luciferase expressing SU-DIPG 6 into the pons (map
for all images: radiance, min=(5.times.10.sup.4),
max=(5.times.10.sup.6)) and infused intravenously with
(1.times.10.sup.7) GD2-CAR or CD19-CAR T cells as designated.
Transduction efficiency was evaluated by flow cytometry with
anti-idiotype antibodies prior to administration and was routinely
>70%. Between 14 and 28 days post-treatment (DPT), a dramatic
and universal antitumor response was observed in GD2-CAR treated
mice, while no spontaneous regression was observed in those treated
with CD19-CAR T cells. FIG. 2B shows tumor burden over time
expressed as fold change in flux. FIG. 2C shows quantification of
H3K27M+ tumor cell density within infiltrated brainstem regions of
SU-DIPG6 GD2-CAR vs. CD19-CAR T-cell treated mice. Within GD2-CAR
T-cell-treated SU-DIPG6 xenografts, approximately 36 H3K27M+ cells
remaining per mouse were identified in the sampled volume, compared
with approximately 18,596 cells per mouse in the sampled volume of
CD19-CAR T-cell treated controls. FIG. 2D shows a representative
immunofluorescence confocal microscopy of CD19-CAR and GD2-CAR
treated SU-DIPG6 tumors staining for the mutant histone H3K27M.
FIGS. 2e-2i show GD2-CAR activity in a second patient-derived
orthotopic xenograft model of DIPG, SU DIPG13FL. FIGS. 2e and 2f
show bioluminescent imaging over time as above. FIG. 2g is a
representative immunofluorescent confocal microscopy of SU-DIPG13FL
xenografts treated with CD19- or GD2-CAR T-cells and shows
clearance of H3K27M+ tumor cells. FIG. 2h shows tiled
immunofluorescence images across engrafted regions. FIG. 2I shows
quantification of H3K27M+ tumor cell density within infiltrated
brainstem regions of SU DIPG13FL. In SU-DIPG13FL xenografts,
approximately 32 total H3K27M+ cells remained in the sampled volume
of each GD2-CAR T-cell treated mouse, compared to approximately
31,953 cells per mouse in the sampled volume of CD19-CAR T-cell
treated controls. Data as shown are mean.+-.SEM. ****p<0.0001,
***p<0.001, **p<0.01, *p<0.05 by unpaired 2-tailed
Student's t-test with Holm-Sidak correction for multiple
comparisons applied for bioluminescence imaging data. Scale
bars=100 microns.
[0017] FIG. 3 shows that a single intravenous dose of GD2-CAR T
cells cleared luciferase-expressing patient-derived DIPG xenografts
to background bioluminescence levels. FIG. 3(a) shows SU-DIPG6 and
SU-DIPG13FL xenograft tumor burden monitored by in vivo
bioluminescence imaging (as shown in FIG. 2). To assess whether
tumor clearance was complete by this measure, matched region of
interest (ROI) measurements of total flux were made over the
tumor-bearing region and an uninvolved area of the animal's flank.
Fold change above background was then computed as the ratio of
tumor ROI flux to background ROI flux (SU-DIPG6 n=10 CD19-CAR, 11
GD2-CAR; SU-DIPG13-FL n=13 CD19-CAR, 14 GD2-CAR). A ratio of 1
therefore indicated clearance of tumor luminescence signal to
background levels, which was achieved in both models by DPT40
(*=p<0.05, **=p<0.01, ***=p<0.0001, 2-tailed Student's t
test with Holm-Sidak correction for multiple comparisons). FIG. 2
(b) shows that no statistically significant difference in initial
tumor burden as assessed by in vivo bioluminescence imaging existed
between animals in CD19-CAR or GD2-CAR treated cohorts of SU-DIPG6,
SU-DIPG13FL, or additional H3K27M+ DMG cultures SU-pSCG1 and
QCTB-R059 (two-way ANOVA with Tukey correction for multiple
comparisons, n.s.=not significant at .alpha.=0.05). Scatter points
indicate individual mice, bars indicate mean, and error bars
indicate SEM.
[0018] FIG. 4 shows selective pressure of GD2 CAR T cell therapy in
DIPG xenografts. Immunofluorescent staining for GD2 (clone 14g2a)
in CD19 or GD2-CAR T cell-treated SU-DIPG13FL xenografts
demonstrated selective pressure of GD2-CAR T cell therapy during
the acute phase of tumoricidal activity. By DPT14, when the vast
majority of parenchymal tumor had been cleared in GD2 CAR T
cell-treated animals, the small number of remaining GFP+ tumor
cells did not co-stain for GD2. Scale bar represents 10 microns.
Total n given for each chart indicates number of cells assessed
across 2 animals for each CAR/timepoint combination.
[0019] FIG. 5 shows DIPG cultures express GD2 at homogenously high
levels relative to other GD2-positive tumor cell lines. FIG. 5A
shows flow cytometry staining for GD2 (clone 14g2a) on the surface
of DIPG cultures revealed stronger and more uniform expression
relative to cells derived from other malignancies under
investigation for GD2-targeting immunotherapies, including
neuroblastoma (KCNR, CHLA136, CHLA255), osteosarcoma (143B,
MG63-3), and Ewing sarcoma (TC32, EW8). FIG. 5B shows quantitative
estimates of GD2 surface expression obtained using fluorescent bead
standards (Quantibrite, BD) for DIPG and other cancer lines.
[0020] FIG. 6 shows that GD2-CAR T-cell therapy improves survival
in DIPG orthotopic xenografts. FIG. 6A shows survival analysis of
GD2-CAR T-cell treated orthotopic xenografts in SU DIPG-13P*, a
particularly aggressive patient-derived xenograft model of DIPG
that is lethal within one month of engraftment, revealed a robust
survival improvement in GD2-CAR T-cell treated animals (p<0.0001
Log-rank (Mantel-Cox) test, n=22 CD19-CAR and 23 GD2 CAR across 3
independent cohorts (See FIG. 7)). While CD19-CAR T-cell treated
xenografts were universally lethal by study endpoint, all GD2-CAR
T-cell-treated animals that survived the acute toxicity of therapy
survived to study endpoint at which time they manifested GVHD-like
symptoms (See FIG. 8). FIG. 6B shows hematoxylin-eosin staining of
SU-DIPG13P* xenografts at DPT50 demonstrated clearance by GD2-CAR
T-cells of highly-infiltrative parenchymal tumor observed
throughout the brain in CD19-CAR T-cell-treated controls and normal
gross tissue architecture. FIG. 6C shows hematoxylin-eosin staining
of SU-DIPG6 GD2-CAR T cell-treated xenograft analyzed at DPT14
demonstrated ventriculomegaly but histologically normal-appearing
neurons in cortex, hippocampus, and brainstem (inset images). FIG.
6D shows fluorescence microscopy of DPT7 SU-DIPG13FL xenografts
revealed intravenously-administered GD2-CAR-mCherry T-cells
infiltrating the engrafted tumor. FIG. 6E shows representative
image of infiltrating GD2-CAR-mCherry T cells at DPT14 in a
SU-DIPG13FL xenografted medulla demonstrated spatial association
with Iba1+ macrophages. FIG. 6F shows representative image of
GD2-CAR mCherry T-cell-mediated tumor cell killing with apoptosis
of GFP+ tumor cells as evidenced by co-localization with cleaved
caspase 3+. FIG. 6G shows tumoricidal activity occurs in proximity
to non-apoptotic NeuN+ neurons in the xenografted pons, shown at
DPT7 (See FIG. 10). FIG. 6H shows representative images of
GD2-CAR-mCherry T-cells infiltrating the parenchyma of SU-DIPG13FL
xenografts during the period of acute antitumor activity (see FIG.
9).
[0021] FIG. 7 shows the survival benefit of GD2 CAR T cell therapy
assessed in three independent cohorts of SU-DIPG13P* xenografts.
Combined cohort data and statistical analysis is presented. In 1/3
cohorts (Cohort 2), several deaths in GD2 CAR T cell-treated
animals were observed acutely, from DPT8-13. Animals were as
follows: Cohort 1 CD19-CAR, 5 GD2-CAR, Cohort 2 CD19-CAR, 10
GD2-CAR, Cohort 3 CD19-CAR, 9 GD2-CAR.
[0022] FIG. 8 shows that onset of xenogeneic graft-versus-host
disease limits duration of monitoring in GD2-CAR T cell-treated
patient derived xenograft models. Adoptive transfer of human T
cells to NSG mice has been shown to result in graft versus host
disease. FIG. 8A shows that in SU-DIPG13P* xenografts, mice treated
with CD19-CART cells display extensive signs of neurological
impairment at endpoint consistent with tumor progression, including
paralysis and aberrant motor behavior; however, classical signs of
GvHD such as hair loss are absent at this timepoint. At this
timepoint, animals treated with GD2-CAR T cells appear normal. FIG.
8B shows hematoxylin/eosin staining of skin specimens from CD19
CAR-treated animals at DPT14 appear grossly normal. FIG. 8C shows
that by DPT50, GD2-CAR treated animals exhibit extensive hair loss,
and FIG. 8D shows hematoxylin/eosin staining of skin specimens
reveals extensive lymphocytic infiltrate of dermis and epidermal
hyperplasia, consistent with the onset of GvHD. Scale bars for
H&E images are 100 um.
[0023] FIG. 9 shows that labeled GD2 CAR T cells invade tumor site
during period of antitumor activity. Human T cells bearing a CAR
fused at the Cterminus with mCherry were tracked in histological
specimens of DIPG xenografts euthanized at the indicated
timepoints. DIPG13-FL stably transduced with a lentiviral
GFP-luciferase construct were engrafted into the pons of P2 NSG
mice and treated with a single intravenous dose of 1.times.10.sup.7
GD2-CAR-mCherry or CD19-CAR-mCherry T cells. Bioluminescence
imaging was used to randomize animals with equivalent initial tumor
burden into GD2- or CD19-CAR groups. Representative fluorescence
micrographs of medullary tumor burden are shown. GD2-CAR-mCherry T
cells infiltrate the tumor parenchyma as early as DPT7. By this
time point, meningeal tumor has been cleared in the GD2-CARmCherry
group but parenchymal tumor burden remains. By contrast,
CD19-CARmCherry T cells do not achieve significant tumor clearing,
although scattered CD19-CAR-mCherry cells can be identified within
the tissue parenchyma. DPT7 and 14 images from GD2-CAR-mCherry
animals are presented in FIG. 6H; they are shown again in FIG. 9
for comparison with matched CD19-CAR-mCherry images. Scale bar
represents 500 um.
[0024] FIG. 10 shows cleaved caspase-3 staining of GD2-CAR T cell
treated DIPG xenografts. FIG. 10A shows immunofluorescence
microscopy of DIPG13-FL xenografts treated with a single
intravenous dose of GD2-CAR T cells, euthanized at DPT 7 and
stained for the neuronal marker NeuN and the apoptosis marker
cleaved caspase 3 (CCasp3). FIG. 10B shows immunofluorescence
micrograph of antitumor activity in the cerebellum demonstrating
intact granule layer neurons in the presence of local antitumor
activity. FIG. 10C shows that out of the total population of
CCasp3+ cells identified in GD2-CAR T cell-treated xenografts,
<2% co-stain for NeuN.
[0025] FIG. 11 shows that GD2 CAR T-cell therapy effectively clears
multiple types of midline H3K27M mutant pediatric diffuse midline
gliomas and is associated with toxicity in thalamic xenografts.
FIG. 11A shows anatomic sites of origin of H3K27M+ DMGs. FIGS. 11B
and 11C show that patient-derived culture models of H3K27M mutant
tumors that arose in the thalamus (QCTB-R059) and spinal cord
(SU-pSCG1) highly and uniformly express GD2 as assessed by
flowcytometry (FIG. 11B) and induce antigen-dependent secretion of
IFN.gamma. and IL-2 when incubated with GD2 or CD19-CAR T-cells in
vitro (FIG. 11C). FIGS. 11D and 11E show SU-pSCG1 cells stably
transduced to express GFP and luciferase were engrafted into the
medulla of NSG mice and treated with intravenous infusion of
1.times.107 GD2-CAR T-cells or CD19-CAR T-cells, and substantial
clearance of engrafted tumor was observed by DPT14. FIG. 11F shows
quantification of H3K27M+ cells remaining in SU-pSCG1 xenografts at
study endpoint revealed near complete clearance of engrafted tumor
in GD2-CAR T cell treated animals compared to CD19-CAR T-cell
controls. FIG. 11G shows tiled immunofluorescence images across
affected regions (GFP, H3K27M, and DAPI). FIGS. 11H and 11I show
the H3K27M mutant patient-derived cell culture QCTB-R059 was
orthotopically engrafted into the thalamus of NSG mice and treated
by systemic administration of GD2 or CD19-CAR T-cells as described
for SU-pSCG1. Tumor burden over time as determined by
bioluminescence imaging illustrated marked reduction by DPT 14, and
histological clearance in surviving animals at DPT 30 (see FIG.
12). FIG. 11J provides a diagram showing the risk for 3rd
ventricular compression and herniation through the tentorium
cerebelli accompanying inflammation in the thalamus. FIG. 11K shows
GD2-CAR T-cell therapy-associated deaths in mice with thalamic
xenografts observed by DPT14 indicating a potential hazard of
immunotherapy for midline tumors. Data as shown are mean.+-.SEM.
***p<0.001, *p<0.05 by unpaired 2-tailed Student's t-test
with Holm-Sidak correction for multiple comparisons.
[0026] FIG. 12 shows GD2 CAR-T cell therapy achieves histological
clearance of tumor burden in surviving QCTB-R059 thalamic H3K27M
xenografts. Representative images from CD19 and GD2-CAR T cell
treated animals demonstrate clearance of GFP-expressing tumor
cells. No region of substantial residual tumor burden could be
identified.
[0027] FIG. 13 shows cell surface antigens screened in
patient-derived DIPG cultures. The surface marker expression from
BD Lyoplate panel (median fluorescence intensity over isotype
control) is shown.
DEFINITIONS
[0028] For purposes of interpreting this specification, the
following definitions will apply and whenever appropriate, terms
used in the singular will also include the plural and vice versa.
In the event that any definition set forth below conflicts with any
document incorporated herein by reference, the definition set forth
below shall control.
[0029] As used herein the terms "disease" and "pathologic
condition" are used interchangeably, unless indicated otherwise
herein, to describe a deviation from the condition regarded as
normal or average for members of a species or group (e.g., humans),
and which is detrimental to an affected individual under conditions
that are not inimical to the majority of individuals of that
species or group. Such a deviation can manifest as a state, signs,
and/or symptoms (e.g., diarrhea, nausea, fever, pain, blisters,
boils, rash, immune suppression, inflammation, etc.) that are
associated with any impairment of the normal state of a subject or
of any of its organs or tissues that interrupts or modifies the
performance of normal functions. A disease or pathological
condition may be caused by or result from contact with a
microorganism (e.g., a pathogen or other infective agent (e.g., a
virus or bacteria)), may be responsive to environmental factors
(e.g., malnutrition, industrial hazards, and/or climate), may be
responsive to an inherent or latent defect in the organism (e.g.,
genetic anomalies) or to combinations of these and other
factors.
[0030] The terms "host," "subject," or "patient" are used
interchangeably herein to refer to an individual to be treated by
(e.g., administered) the compositions and methods of the present
invention. Subjects include, but are not limited to, mammals (e.g.,
murines, simians, equines, bovines, porcines, canines, felines, and
the like), and most preferably includes humans. In the context of
the invention, the term "subject" generally refers to an individual
who will be administered or who has been administered one or more
compositions of the present invention (e.g., genetically modified
immune cells described herein).
[0031] The terms "buffer" or "buffering agents" refer to materials
that when added to a solution cause the solution to resist changes
in pH.
[0032] The terms "reducing agent" and "electron donor" refer to a
material that donates electrons to a second material to reduce the
oxidation state of one or more of the second material's atoms.
[0033] The term "monovalent salt" refers to any salt in which the
metal (e.g., Na, K, or Li) has a net 1+ charge in solution (i.e.,
one more proton than electron).
[0034] The term "divalent salt" refers to any salt in which a metal
(e.g., Mg, Ca, or Sr) has a net 2+ charge in solution (i.e., two
more protons than electrons).
[0035] The terms "chelator" or "chelating agent" refer to any
materials having more than one atom with a lone pair of electrons
that are available to bond to a metal ion.
[0036] The term "solution" refers to an aqueous or non-aqueous
mixture.
[0037] A "disorder" is any condition or disease that would benefit
from treatment with a composition or method of the invention. This
includes chronic and acute disorders including those pathological
conditions which predispose the mammal to the disorder in question.
Non-limiting examples of disorders to be treated herein include
conditions such as cancer.
[0038] The terms "cell proliferative disorder," and "proliferative
disorder" refer to disorders that are associated with some degree
of abnormal cell proliferation. For example, a "hyperproliferative
disorder or disease" is a disease or disorder caused by excessive
growth of cells. In one embodiment, the cell proliferative disorder
is cancer.
[0039] As used herein, the terms "cancer" and "tumor" refer to a
cell that exhibits a loss of growth control or tissue of
uncontrolled growth or proliferation of cells. Cancer and tumor
cells generally are characterized by a loss of contact inhibition,
may be invasive, and may display the ability to metastasize. The
present invention is not limited by the type of cancer or the type
of treatment (e.g., prophylactically and/or therapeutically
treated). Indeed, a variety of cancers may be treated with
compositions and methods described herein including, but not
limited to, brain cancer or other cancers of the central nervous
system (e.g., diffuse midline glioma or diffuse intrinsic pontine
glioma (DIPG, a highly aggressive glial tumor found at the base of
the brain, see, e.g., Louis et al., Acta Neuropathol (2016)
131:803-820), melanomas, lymphomas, epithelial cancer, breast
cancer, ovarian cancer, endometrial cancer, colorectal cancer, lung
cancer, renal cancer, melanoma, kidney cancer, prostate cancer,
sarcomas, carcinomas, and/or a combination thereof.
[0040] "Metastasis" as used herein refers to the process by which a
cancer spreads or transfers from the site of origin to other
regions of the body with the development of a similar cancerous
lesion at the new location. A "metastatic" or "metastasizing" cell
is one that loses adhesive contacts with neighboring cells and
migrates via the bloodstream or lymph from the primary site of
disease to invade neighboring body structures.
[0041] The term "anticancer agent" as used herein, refer to any
therapeutic agents (e.g., chemotherapeutic compounds and/or
molecular therapeutic compounds), antisense therapies, radiation
therapies, or surgical interventions, used in the treatment of
hyperproliferative diseases such as cancer (e.g., in mammals, e.g.,
in humans).
[0042] An "effective amount" refers to an amount effective, at
dosages and for periods of time necessary, to achieve a desired
therapeutic or prophylactic result.
[0043] The term "therapeutically effective amount," as used herein,
refers to that amount of the therapeutic agent sufficient to result
in amelioration of one or more symptoms of a disorder, or prevent
advancement of a disorder, or cause regression of the disorder. For
example, with respect to the treatment of cancer, in one
embodiment, a therapeutically effective amount will refer to the
amount of a therapeutic agent that decreases the rate of tumor
growth (e.g., reduces and/or clears tumor burden in the patient
(e.g., reduces the number of H3K27M positive cancer cells in a
patient)), decreases tumor mass, decreases the number of
metastases, decreases tumor progression, or increases survival time
by at least 5%, at least 10%, at least 15%, at least 20%, at least
25%, at least 30%, at least 35%, at least 40%, at least 45%, at
least 50%, at least 55%, at least 60%, at least 65%, at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
95%, or at least 100%.
[0044] The terms "sensitize" and "sensitizing," as used herein,
refer to making, through the administration of a first agent, an
animal or a cell within an animal more susceptible, or more
responsive, to the biological effects (e.g., promotion or
retardation of an aspect of cellular function including, but not
limited to, cell division, cell growth, proliferation, invasion,
angiogenesis, necrosis, or apoptosis) of a second agent. The
sensitizing effect of a first agent on a target cell can be
measured as the difference in the intended biological effect (e.g.,
promotion or retardation of an aspect of cellular function
including, but not limited to, cell growth, proliferation,
invasion, angiogenesis, or apoptosis) observed upon the
administration of a second agent with and without administration of
the first agent. The response of the sensitized cell can be
increased by at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 60%, at
least about 70%, at least about 80%, at least about 90%, at least
about 100%, at least about 150%, at least about 200%, at least
about 250%, at least 300%, at least about 350%, at least about
400%, at least about 450%, or at least about 500% over the response
in the absence of the first agent.
[0045] As used herein, the terms "purified" or "to purify" refer to
the removal of contaminants or undesired compounds from a sample or
composition. As used herein, the term "substantially purified"
refers to the removal of from about 70 to 90%, up to 100%, of the
contaminants or undesired compounds from a sample or
composition.
[0046] As used herein, the terms "administration" and
"administering" refer to the act of giving a composition of the
present invention to a subject. Exemplary routes of administration
to the human body include, but are not limited to, through the eyes
(ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs
(inhalant), oral mucosa (buccal), ear, rectal, by injection (e.g.,
intravenously, subcutaneously, intraperitoneally, intratumorally,
etc.), topically, and the like.
[0047] As used herein, the terms "co-administration" and
"co-administering" refer to the administration of at least two
agent(s) (e.g., genetically modified immune cells and one or more
other agents--e.g., anti-cancer agents) or therapies to a subject.
In some embodiments, the co-administration of two or more agents or
therapies is concurrent. In other embodiments, a first
agent/therapy is administered prior to a second agent/therapy. In
some embodiments, co-administration can be via the same or
different route of administration. Those of skill in the art
understand that the formulations and/or routes of administration of
the various agents or therapies used may vary. The appropriate
dosage for co-administration can be readily determined by one
skilled in the art. In some embodiments, when agents or therapies
are co-administered, the respective agents or therapies are
administered at lower dosages than appropriate for their
administration alone. Thus, co-administration is especially
desirable in embodiments where the co-administration of the agents
or therapies lowers the requisite dosage of a potentially harmful
(e.g., toxic) agent(s), and/or when co-administration of two or
more agents results in sensitization of a subject to beneficial
effects of one of the agents via co-administration of the other
agent.
[0048] The terms "pharmaceutically acceptable" or
"pharmacologically acceptable," as used herein, refer to
compositions that do not substantially produce adverse reactions
(e.g., toxic, allergic or other immunologic reactions) when
administered to a subject.
[0049] As used herein, the term "pharmaceutically acceptable
carrier" refers to any of the standard pharmaceutical carriers
including, but not limited to, phosphate buffered saline solution,
water, and various types of wetting agents (e.g., sodium lauryl
sulfate), any and all solvents, dispersion media, coatings, sodium
lauryl sulfate, isotonic and absorption delaying agents,
disintegrants (e.g., potato starch or sodium starch glycolate),
polyethylene glycol, and the like. The compositions also can
include stabilizers and preservatives. Examples of carriers,
stabilizers and adjuvants have been described and are known in the
art (see, e.g., Martin, Remington's Pharmaceutical Sciences, 15th
Ed., Mack Publ. Co., Easton, Pa. (1975), incorporated herein by
reference).
[0050] As used herein, the term "pharmaceutically acceptable salt"
refers to any salt (e.g., obtained by reaction with an acid or a
base) of a composition of the present invention that is
physiologically tolerated in the target subject. "Salts" of the
compositions of the present invention may be derived from inorganic
or organic acids and bases. Examples of acids include, but are not
limited to, hydrochloric, hydrobromic, sulfuric, nitric,
perchloric, fumaric, maleic, phosphoric, glycolic, lactic,
salicylic, succinic, toluene-p-sulfonic, tartaric, acetic, citric,
methanesulfonic, ethanesulfonic, formic, benzoic, malonic,
sulfonic, naphthalene-2-sulfonic, benzenesulfonic acid, and the
like. Other acids, such as oxalic, while not in themselves
pharmaceutically acceptable, may be employed in the preparation of
salts useful as intermediates in obtaining the compositions of the
invention and their pharmaceutically acceptable acid addition
salts. Examples of bases include, but are not limited to, alkali
metal (e.g., sodium) hydroxides, alkaline earth metal (e.g.,
magnesium) hydroxides, ammonia, and compounds of formula NW4+,
wherein W is C1-4 alkyl, and the like.
[0051] Examples of salts include, but are not limited to: acetate,
adipate, alginate, aspartate, benzoate, benzenesulfonate,
bisulfate, butyrate, citrate, camphorate, camphorsulfonate,
cyclopentanepropionate, digluconate, dodecylsulfate,
ethanesulfonate, fumarate, flucoheptanoate, glycerophosphate,
hemisulfate, heptanoate, hexanoate, chloride, bromide, iodide,
2-hydroxyethanesulfonate, lactate, maleate, methanesulfonate,
2-naphthalenesulfonate, nicotinate, oxalate, palmoate, pectinate,
persulfate, phenylpropionate, picrate, pivalate, propionate,
succinate, tartrate, thiocyanate, tosylate, undecanoate, and the
like. Other examples of salts include anions of the compounds of
the present invention compounded with a suitable cation such as
Na+, NH4+, and NW4+ (wherein W is a C1-4 alkyl group), and the
like. For therapeutic use, salts of the compounds of the present
invention are contemplated as being pharmaceutically acceptable.
However, salts of acids and bases that are non-pharmaceutically
acceptable may also find use, for example, in the preparation or
purification of a pharmaceutically acceptable compound.
[0052] For therapeutic use, salts of the compositions of the
present invention are contemplated as being pharmaceutically
acceptable. However, salts of acids and bases that are
non-pharmaceutically acceptable may also find use, for example, in
the preparation or purification of a pharmaceutically acceptable
composition.
[0053] As used herein, the term "at risk for disease" refers to a
subject that is predisposed to experiencing a particular disease.
This predisposition may be genetic (e.g., a particular genetic
tendency to experience the disease, such as heritable disorders),
or due to other factors (e.g., environmental conditions, exposures
to detrimental compounds present in the environment, etc.). Thus,
it is not intended that the present invention be limited to any
particular risk (e.g., a subject may be "at risk for disease"
simply by being exposed to and interacting with other people), nor
is it intended that the present invention be limited to any
particular disease (e.g., cancer).
[0054] As used herein, the term "kit" refers to any delivery system
for delivering materials. In the context of immunotherapeutic
agents, such delivery systems include systems that allow for the
storage, transport, or delivery of immunogenic agents and/or
supporting materials (e.g., written instructions for using the
materials, etc.) from one location to another. For example, kits
include one or more enclosures (e.g., boxes) containing the
relevant immunotherapeutic agents (e.g., genetically modified
immune cells and/or supporting materials). As used herein, the term
"fragmented kit" refers to delivery systems comprising two or more
separate containers that each contain a subportion of the total kit
components. The containers may be delivered to the intended
recipient together or separately. For example, a first container
may contain a composition comprising an immunotherapeutic
composition for a particular use, while a second container contains
a second agent (e.g., a chemotherapeutic agent). Indeed, any
delivery system comprising two or more separate containers that
each contains a subportion of the total kit components are included
in the term "fragmented kit." In contrast, a "combined kit" refers
to a delivery system containing all of the components of an
immunogenic agent needed for a particular use in a single container
(e.g., in a single box housing each of the desired components). The
term "kit" includes both fragmented and combined kits.
[0055] As used herein, the term "immunoglobulin" or "antibody"
refer to proteins that bind a specific antigen. Immunoglobulins
include, but are not limited to, polyclonal, monoclonal, chimeric,
and humanized antibodies, as well as Fab fragments and F(ab')2
fragments of the following classes: IgG, IgA, IgM, IgD, IgE, and
secreted immunoglobulins (sIg). Immunoglobulins generally comprise
two identical heavy chains and two light chains. However, the terms
"antibody" and "immunoglobulin" also encompass single chain
antibodies and two chain antibodies.
[0056] The "variable region" or "variable domain" of an antibody
refers to the amino-terminal domains of the heavy or light chain of
the antibody. The variable domain of the heavy chain may be
referred to as "VH." The variable domain of the light chain may be
referred to as "VL." These domains are generally the most variable
parts of an antibody and contain the antigen-binding sites.
[0057] "Single-chain Fv" or "scFv" antibody fragments comprise the
VH and VL domains of antibody, wherein these domains are present in
a single polypeptide chain. Generally, the scFv polypeptide further
comprises a polypeptide linker between the VH and VL domains which
enables the scFv to form the desired structure for antigen binding.
For a review of scFv, see, e.g., Pluckthun, in The Pharmacology of
Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds.,
(Springer-Verlag, New York, 1994), pp. 269-315.
[0058] As used herein, the term "antigen-binding protein" refers to
proteins that bind to a specific antigen. "Antigen-binding
proteins" include, but are not limited to, immunoglobulins,
including polyclonal, monoclonal, chimeric, and humanized
antibodies; Fab fragments, F(ab')2 fragments, and Fab expression
libraries; and single chain antibodies.
[0059] The term "epitope" as used herein refers to that portion of
an antigen that makes contact with a particular immunoglobulin.
[0060] The terms "specific binding" or "specifically binding" when
used in reference to the interaction of an antibody (or a portion
thereof (e.g., scFv) and a protein or peptide means that the
interaction is dependent upon the presence of a particular
structure (e.g., the antigenic determinant or epitope) on the
protein; in other words the antibody (or a portion thereof (e.g.,
scFv) is recognizing and binding to a specific protein structure
rather than to proteins in general. For example, if an antibody is
specific for epitope "A," the presence of a protein containing
epitope A (or free, unlabeled A) in a reaction containing labeled
"A" and the antibody will reduce the amount of labeled A bound to
the antibody.
[0061] As used herein, the terms "non-specific binding" and
"background binding" when used in reference to the interaction of
an antibody and a protein or peptide refer to an interaction that
is not dependent on the presence of a particular structure (i.e.,
the antibody is binding to proteins in general rather that a
particular structure such as an epitope).
[0062] As used herein, the term "subject suspected of having
cancer" refers to a subject that presents one or more symptoms
indicative of a cancer (e.g., a noticeable lump or mass) or is
being screened for a cancer (e.g., during a routine physical). A
subject suspected of having cancer may also have one or more risk
factors for developing cancer. A subject suspected of having cancer
has generally not been tested for cancer. However, a "subject
suspected of having cancer" encompasses an individual who has
received a preliminary diagnosis (e.g., a CT scan showing a mass)
but for whom a confirmatory test (e.g., biopsy and/or histology)
has not been done or for whom the type and/or stage of cancer is
not known. The term further includes people who previously had
cancer (e.g., an individual in remission). A "subject suspected of
having cancer" is sometimes diagnosed with cancer and is sometimes
found to not have cancer.
[0063] As used herein, the term "subject diagnosed with a cancer"
refers to a subject who has been tested and found to have cancerous
cells. The cancer may be diagnosed using any suitable method,
including but not limited to, biopsy, x-ray, blood test, etc.
[0064] As used herein, the term "post-surgical tumor tissue" refers
to cancerous tissue (e.g., organ tissue) that has been removed from
a subject (e.g., during surgery).
[0065] As used herein, the term "subject at risk for cancer" refers
to a subject with one or more risk factors for developing a
specific cancer. Risk factors include, but are not limited to,
gender, age, genetic predisposition, environmental exposure, and
previous incidents of cancer, preexisting non-cancer diseases, and
lifestyle.
[0066] As used herein, the term "characterizing cancer in a
subject" refers to the identification of one or more properties of
a cancer sample in a subject, including but not limited to, the
presence of benign, pre-cancerous or cancerous tissue and the stage
of the cancer.
[0067] As used herein, the term "characterizing tissue in a
subject" refers to the identification of one or more properties of
a tissue sample (e.g., including but not limited to, the presence
of cancerous tissue, the presence of pre-cancerous tissue that is
likely to become cancerous, and the presence of cancerous tissue
that is likely to metastasize).
[0068] As used herein, the term "stage of cancer" refers to a
qualitative or quantitative assessment of the level of advancement
of a cancer. Criteria used to determine the stage of a cancer
include, but are not limited to, the size of the tumor, whether the
tumor has spread to other parts of the body and where the cancer
has spread (e.g., within the same organ or region of the body or to
another organ).
[0069] As used herein, the term "primary tumor cell" refers to a
cancer cell that is isolated from a tumor in a mammal and has not
been extensively cultured in vitro.
[0070] As used herein, the terms "treatment", "therapeutic use", or
"medicinal use" refer to any and all uses of compositions and
methods of the invention that remedy a disease state or symptoms,
or otherwise prevent, hinder, retard, or reverse the progression of
disease or other undesirable symptoms in any way whatsoever. For
example, the terms "treatment of cancer" or "treatment of tumor" or
grammatical equivalents herein are meant the suppression,
regression, or partial or complete disappearance of a pre-existing
cancer or tumor. The definition is meant to include any diminution
in the size, aggressiveness, or growth rate of a pre-existing
cancer or tumor.
[0071] As used herein, the terms "improved therapeutic outcome" and
"enhanced therapeutic efficacy," relative to cancer refers to a
slowing or diminution of the growth of cancer cells or a solid
tumor, or a reduction in the total number of cancer cells or total
tumor burden. An "improved therapeutic outcome" or "enhanced
therapeutic efficacy" means there is an improvement in the
condition of the individual according to any clinically acceptable
criteria, including reversal of an established tumor, an increase
in life expectancy or an improvement in quality of life.
[0072] As used herein, the term "gene transfer system" refers to
any means of delivering a composition comprising a nucleic acid
sequence to a cell or tissue. For example, gene transfer systems
include, but are not limited to, vectors (e.g., retroviral,
adenoviral, lentiviral, adeno-associated viral, and other nucleic
acid-based delivery systems), microinjection of naked nucleic acid,
polymer-based delivery systems (e.g., liposome-based and metallic
particle-based systems), biolistic injection, and the like. As used
herein, the term "viral gene transfer system" refers to gene
transfer systems comprising viral elements (e.g., intact viruses,
modified viruses and viral components such as nucleic acids or
proteins) to facilitate delivery of the sample to a desired cell or
tissue. Non-limiting examples of viral gene transfer systems useful
in the compositions and methods of the invention are lentiviral-
and retroviral-gene transfer systems.
[0073] As used herein, the term "site-specific recombination target
sequences" refers to nucleic acid sequences that provide
recognition sequences for recombination factors and the location
where recombination takes place.
[0074] As used herein, the term "nucleic acid molecule" refers to
any nucleic acid containing molecule, including but not limited to,
DNA or RNA. The term encompasses sequences that include any of the
known base analogs of DNA and RNA including, but not limited to,
4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine,
pseudoisocytosine, 5-(carboxyhydroxylmethyl)-uracil,
5-fluorouracil, 5-bromouracil,
5-carboxymethylaminomethyl-2-thiouracil,
5-carboxymethylaminomethyluracil, dihydrouracil, inosine,
N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-methyladenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxy-aminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
oxybutoxosine, pseudouracil, queosine, 2 thiocytosine, 5-methyl-2
thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
N-uracil-5-oxyacetic acid methylester, and 2,6-diaminopurine.
[0075] The term "gene" refers to a nucleic acid (e.g., DNA)
sequence that comprises coding sequences necessary for the
production of a polypeptide, precursor, or RNA (e.g., mRNA, rRNA,
tRNA). The polypeptide can be encoded by a full length coding
sequence or by any portion of the coding sequence so long as the
desired activity or functional properties (e.g., enzymatic
activity, ligand binding, signal transduction, immunogenicity,
etc.) of the full-length gene product or fragment thereof are
retained. The term also encompasses the coding region of a
structural gene and the sequences located adjacent to the coding
region on both the 5' and 3' ends for a distance of about 1 kb or
more on either end such that the gene corresponds to the length of
the full-length mRNA. Sequences located 5' of the coding region and
present on the mRNA are referred to as 5' non-translated sequences.
Sequences located 3' or downstream of the coding region and present
on the mRNA are referred to as 3' non-translated sequences. The
term "gene" encompasses both cDNA and genomic forms of a gene. A
genomic form or clone of a gene contains the coding region
interrupted with non-coding sequences termed "introns" or
"intervening regions" or "intervening sequences." Introns are
segments of a gene that are transcribed into nuclear RNA (hnRNA);
introns may contain regulatory elements such as enhancers. Introns
are removed or "spliced out" from the nuclear or primary
transcript; introns therefore are absent in the messenger RNA
(mRNA) transcript. The mRNA specifies the sequence or order of
amino acids in a nascent polypeptide during translation (e.g.,
protein synthesis).
[0076] As used herein, the term "heterologous gene" refers to a
gene that is not in its natural environment. For example, a
heterologous gene includes a gene from one species introduced into
another species. A heterologous gene also includes a gene native to
an organism that has been altered in some way (e.g., mutated, added
in multiple copies, linked to non-native regulatory sequences,
etc.). Heterologous genes are distinguished from endogenous genes
in that the heterologous gene sequences are typically joined to DNA
sequences that are not found naturally associated with the gene
sequences in the chromosome or are associated with portions of the
chromosome not found in nature (e.g., genes expressed in loci where
the gene is not normally expressed).
[0077] As used herein, the term "gene expression" refers to the
process of converting genetic information encoded in a gene into
RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of
the gene (i.e., via the enzymatic action of an RNA polymerase), and
for protein encoding genes, into protein through "translation" of
mRNA. Gene expression can be regulated at many stages in the
process. "Up-regulation" or "activation" refers to regulation that
increases the production of gene expression products (i.e., RNA or
protein), while "down-regulation" or "repression" refers to
regulation that decrease production. Molecules (e.g., transcription
factors) that are involved in up-regulation or down-regulation are
often called "activators" and "repressors," respectively.
[0078] In addition to containing introns, genomic forms of a gene
may also include sequences located on both the 5' and 3' end of the
sequences that are present on the RNA transcript. These sequences
are referred to as "flanking" sequences or regions (these flanking
sequences are located 5' or 3' to the non-translated sequences
present on the mRNA transcript). The 5' flanking region may contain
regulatory sequences such as promoters and enhancers that control
or influence the transcription of the gene. The 3' flanking region
may contain sequences that direct the termination of transcription,
post-transcriptional cleavage and polyadenylation.
[0079] As used herein, the terms "nucleic acid molecule encoding,"
"DNA sequence encoding," and "DNA encoding" refer to the order or
sequence of deoxyribonucleotides along a strand of deoxyribonucleic
acid. The order of these deoxyribonucleotides determines the order
of amino acids along the polypeptide (protein) chain. The DNA
sequence thus codes for the amino acid sequence.
[0080] As used herein, the terms "an oligonucleotide having a
nucleotide sequence encoding a gene" and "polynucleotide having a
nucleotide sequence encoding a gene," means a nucleic acid sequence
comprising the coding region of a gene or in other words the
nucleic acid sequence that encodes a gene product. The coding
region may be present in a cDNA, genomic DNA or RNA form. When
present in a DNA form, the oligonucleotide or polynucleotide may be
single-stranded (i.e., the sense strand) or double-stranded.
Suitable control elements such as enhancers/promoters, splice
junctions, polyadenylation signals, etc. may be placed in close
proximity to the coding region of the gene if needed to permit
proper initiation of transcription and/or correct processing of the
primary RNA transcript. Alternatively, the coding region utilized
in the expression vectors of the present invention may contain
endogenous enhancers/promoters, splice junctions, intervening
sequences, polyadenylation signals, etc. or a combination of both
endogenous and exogenous control elements.
[0081] The terms "in operable combination," "in operable order,"
and "operably linked" as used herein refer to the linkage of
nucleic acid sequences in such a manner that a nucleic acid
molecule capable of directing the transcription of a given gene
and/or the synthesis of a desired protein molecule is produced. The
term also refers to the linkage of amino acid sequences in such a
manner so that a functional protein is produced.
[0082] The term "isolated" when used in relation to a nucleic acid,
as in "an isolated oligonucleotide" or "isolated polynucleotide"
refers to a nucleic acid sequence that is identified and separated
from at least one component or contaminant with which it is
ordinarily associated in its natural source. Isolated nucleic acid
is such present in a form or setting that is different from that in
which it is found in nature. In contrast, non-isolated nucleic
acids as nucleic acids such as DNA and RNA found in the state they
exist in nature. For example, a given DNA sequence (e.g., a gene)
is found on the host cell chromosome in proximity to neighboring
genes; RNA sequences, such as a specific mRNA sequence encoding a
specific protein, are found in the cell as a mixture with numerous
other mRNAs that encode a multitude of proteins. However, isolated
nucleic acid encoding a given protein includes, by way of example,
such nucleic acid in cells ordinarily expressing the given protein
where the nucleic acid is in a chromosomal location different from
that of natural cells, or is otherwise flanked by a different
nucleic acid sequence than that found in nature. The isolated
nucleic acid, oligonucleotide, or polynucleotide may be present in
single-stranded or double-stranded form. When an isolated nucleic
acid, oligonucleotide or polynucleotide is to be utilized to
express a protein, the oligonucleotide or polynucleotide will
contain at a minimum the sense or coding strand (i.e., the
oligonucleotide or polynucleotide may be single-stranded), but may
contain both the sense and anti-sense strands (i.e., the
oligonucleotide or polynucleotide may be double-stranded).
[0083] As used herein, the term "purified" or "to purify" refers to
the removal of components (e.g., contaminants) from a sample. For
example, antibodies are purified by removal of contaminating
non-immunoglobulin proteins; they are also purified by the removal
of immunoglobulin that does not bind to the target molecule. The
removal of non-immunoglobulin proteins and/or the removal of
immunoglobulins that do not bind to the target molecule results in
an increase in the percent of target-reactive immunoglobulins in
the sample. In another example, recombinant polypeptides are
expressed in bacterial host cells and the polypeptides are purified
by the removal of host cell proteins; the percent of recombinant
polypeptides is thereby increased in the sample.
[0084] "Amino acid sequence" and terms such as "polypeptide" or
"protein" are not meant to limit the amino acid sequence to the
complete, native amino acid sequence associated with the recited
protein molecule.
[0085] The term "native protein" as used herein to indicate that a
protein does not contain amino acid residues encoded by vector
sequences; that is, the native protein contains only those amino
acids found in the protein as it occurs in nature. A native protein
may be produced by recombinant means or may be isolated from a
naturally occurring source.
[0086] As used herein the term "portion" when in reference to a
protein (as in "a portion of a given protein") refers to fragments
of that protein. The fragments may range in size from four amino
acid residues to the entire amino acid sequence minus one amino
acid.
[0087] The term "vector," as used herein, is intended to refer to a
nucleic acid molecule capable of transporting another nucleic acid
to which it has been linked. One type of vector is a "plasmid,"
which refers to a circular double stranded DNA into which
additional DNA segments may be ligated. Another type of vector is a
phage vector. Another type of vector is a viral vector, wherein
additional DNA segments may be ligated into the viral genome.
Certain vectors are capable of autonomous replication in a host
cell into which they are introduced (e.g., bacterial vectors having
a bacterial origin of replication and episomal mammalian vectors).
Lentiviral vectors or retroviral vectors may be used (e.g., to
introduce DNA encoding CAR constructs into cells (e.g., T cells)).
Other vectors (e.g., non-episomal mammalian vectors) can be
integrated into the genome of a host cell upon introduction into
the host cell, and thereby are replicated along with the host
genome. Moreover, certain vectors are capable of directing the
expression of genes to which they are operatively linked. Such
vectors are referred to herein as "recombinant expression vectors,"
or simply, "expression vectors." In general, expression vectors of
utility in recombinant DNA techniques are often in the form of
plasmids. In the present specification, "plasmid" and "vector" may
be used interchangeably as the plasmid is the most commonly used
form of vector. Non-limiting examples of vectors useful in the
compositions and methods of the invention include lentiviral and
retroviral vectors. Lentiviral vectors include, but are not limited
to, human, simian, and feline immunodeficiency virus (HIV, SIV, and
FIV, respectively) vectors.
[0088] The term "expression vector" as used herein refers to a
recombinant DNA molecule containing a desired coding sequence and
appropriate nucleic acid sequences necessary for the expression of
the operably linked coding sequence in a particular host organism.
Nucleic acid sequences necessary for expression in prokaryotes
usually include a promoter, an operator (optional), and a ribosome
binding site, often along with other sequences. Eukaryotic cells
are known to utilize promoters, enhancers, and termination and
polyadenylation signals.
[0089] The term "transfection" as used herein refers to the
introduction of foreign DNA into eukaryotic cells. Transfection may
be accomplished by a variety of means known to the art including
calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated
transfection, polybrene-mediated transfection, electroporation,
microinjection, liposome fusion, lipofection, protoplast fusion,
retroviral infection, and biolistics.
[0090] The term "stable transfection" or "stably transfected"
refers to the introduction and integration of foreign DNA into the
genome of the transfected cell. The term "stable transfectant"
refers to a cell that has stably integrated foreign DNA into the
genomic DNA. The term "transient transfection" or "transiently
transfected" refers to the introduction of foreign DNA into a cell
where the foreign DNA fails to integrate into the genome of the
transfected cell. The foreign DNA persists in the nucleus of the
transfected cell (e.g., for several days). During this time the
foreign DNA is subject to the regulatory controls that govern the
expression of endogenous genes in the chromosomes. The term
"transient transfectant" refers to cells that have taken up foreign
DNA but have failed to integrate this DNA.
[0091] As used herein, the term "selectable marker" refers to the
use of a gene that encodes an enzymatic activity that confers the
ability to grow in medium lacking what would otherwise be an
essential nutrient; in addition, a selectable marker may confer
resistance to an antibiotic or drug upon the cell in which the
selectable marker is expressed. Selectable markers may be
"dominant"; a dominant selectable marker encodes an enzymatic
activity that can be detected in any eukaryotic cell line. Examples
of dominant selectable markers include the bacterial
aminoglycoside-3'-phosphotransferase gene (also referred to as the
neo gene) that confers resistance to the drug G418 in mammalian
cells, the bacterial hygromycin G phosphotransferase (hyg) gene
that confers resistance to the antibiotic hygromycin and the
bacterial xanthine-guanine phosphoribosyl transferase gene (also
referred to as the gpt gene) that confers the ability to grow in
the presence of mycophenolic acid. Other selectable markers are not
dominant in that their use must be in conjunction with a cell line
that lacks the relevant enzyme activity. Examples of non-dominant
selectable markers include the thymidine kinase (tk) gene that is
used in conjunction with tk-negative (tk.sup.-)cell lines, the CAD
gene that is used in conjunction with CAD-deficient cells and the
mammalian hypoxanthine-guanine phosphoribosyl transferase (hprt)
gene that is used in conjunction with hprt-negative (hprt.sup.-)
cell lines. A review of the use of selectable markers in mammalian
cell lines is provided in Sambrook, J. et al., Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press,
New York (1989) pp. 16.9-16.15.
[0092] As used herein, the term "in vitro" refers to an artificial
environment and to processes or reactions that occur within an
artificial environment. In vitro environments can consist of, but
are not limited to, test tubes and cell culture. The term "in vivo"
refers to the natural environment (e.g., an animal or a cell) and
to processes or reaction that occur within a natural
environment.
[0093] As used herein, the term "cell culture" refers to any in
vitro culture of cells. Included within this term are continuous
cell lines (e.g., with an immortal phenotype), primary cell
cultures, transformed cell lines, finite cell lines (e.g.,
non-transformed cells), and any other cell population maintained in
vitro.
[0094] As used herein, the term "sample" is used in its broadest
sense. In one sense, it is meant to include a specimen or culture
obtained from any source, as well as biological and environmental
samples. Biological samples may be obtained from animals (including
humans) and encompass fluids, solids, tissues, and gases.
Biological samples include blood products, such as plasma, serum
and the like. Such examples are not however to be construed as
limiting the sample types applicable to the present invention.
DETAILED DESCRIPTION OF EMBODIMENTS
[0095] Histone H3 is one of the five main histone proteins involved
in the structure of chromatin in eukaryotic cells. Featuring a main
globular domain and a long N-terminal tail, H3 is involved with the
structure of the nucleosomes of the "beads on a string" structure.
The N-terminal tail of histone H3 protrudes from the globular
nucleosome core and can undergo several different types of
epigenetic modifications that influence cellular processes. These
modifications include the covalent attachment of methyl or acetyl
groups to lysine and arginine amino acids and the phosphorylation
of serine or threonine. Histone variant H3.3 is typically enriched
in active chromatin.
[0096] Tumors with histone H3 K27M (H3K27M) mutations are highly
lethal. They predominantly occur in children and present as midline
brain tumors or spinal tumors. Despite dozens of clinical trials
over the last 30 years, standard therapy is limited to radiation
therapy and the vast majority of patients die of their disease
within 18 months of diagnosis. Thus, currently available treatments
for H3K27M tumors are unsatisfactory. Except for radiation therapy,
no other antineoplastic therapy has demonstrated benefit in these
diseases.
[0097] For example, diffuse intrinsic pontine glioma (DIPG) and
other histone H3 K27M (H3K27M) mutated midline gliomas are
extremely aggressive and universally fatal. While much progress has
been achieved characterizing the molecular origins of these tumors,
improvements in clinical management have remained elusive, with
median survival for DIPG remaining approximately 10 months.
Immunotherapy agents including checkpoint inhibitors have produced
substantial benefit in numerous adult cancers refractory to
traditional therapies, but these agents have not yet demonstrated
conclusive benefit in sporadic childhood cancers, likely due to the
paucity of non-synonymous somatic mutations in these diseases (see,
e.g., Majzner et al., Cancer Cell, 2017. 31(4): p. 476-485.
Adoptive cell transfer of chimeric antigen receptor-expressing
(CAR-expressing) T cells has demonstrated activity in B cell
malignancies and central nervous system (CNS) malignancies.
[0098] Historically, pediatric diffuse gliomas were grouped with
their adult counterparts, despite known differences in behavior
between pediatric and adult gliomas with similar histological
appearances. Information on the distinct underlying genetic
abnormalities in pediatric diffuse gliomas is beginning to allow
the separation of some entities from histologically similar adult
counterparts. One narrowly defined group of tumors primarily
occurring in children is characterized by K27M mutations in the
histone H3 gene H3F3A, or less commonly in the related HIST1H3B
gene, a diffuse growth pattern, and a midline location (e.g.,
thalamus, brain stem, and spinal cord). This newly defined entity
is termed diffuse midline glioma, H3K27M-mutant and includes tumors
previously referred to as diffuse intrinsic pontine glioma
(DIPG).
[0099] GD2 is a disialoganglioside highly expressed in several
pediatric and adult cancers, including neuroblastoma. GD2 is widely
expressed during fetal development but among normal post-natal
tissues its expression is limited to low levels of expression on
osteoprogenitors, brain, peripheral nerves and skin melanocytes.
Because of its high surface expression on tumor cells and low
expression on normal tissues, GD2 has been a target for the
development of immunotherapeutic monoclonal antibodies. Starting
from these encouraging clinical results, anti-GD2 antibody therapy
is included in many frontline protocols for neuroblastoma.
GD2-based monoclonal antibody (mAb) therapies are unlikely to
benefit patients with H3K27M tumors because mAbs do not efficiently
traffic into the CNS.
[0100] Experiments were conducted during development of embodiments
of the invention in an effort to identify new targets and
strategies for immunotherapy in DIPG and other histone H3 K27M
(H3K27M) mutated cancers (e.g., midline gliomas). Cell surface
antigens in patient-derived DIPG cultures were screened for
potential immunotherapeutic targets (see, e.g., Examples 1 and 2).
Significant overlap between independent patient-derived cultures
identified a core group of surface markers conserved across DIPG
patients (see, e.g., Example 2 and FIGS. 1A and 1B). From these
common targets, the disialoganglioside GD2 was identified as
commonly expressed at significantly higher levels on each of the
patient-derived DIPG cultures screened. Additional experiments
identified that significant and remarkably high levels of GD2
expression occurred in all H3K27M gliomas examined, as well as
those with the less common HIST1H3B K27M mutant, whereas pediatric
high grade gliomas (pHGG) harboring wild type histone H3 displayed
significantly lower GD2 expression (see, e.g., Examples 1 and 2 and
FIG. 1C).
[0101] Further experiments were performed in an effort to determine
whether transcriptional perturbations resulting from the H3K27M
mutation might be linked to increased GD2 expression. Expression of
ganglioside synthesis enzymes in a panel of patient-derived DIPG
and pHGG cultures identified consistently higher expression of
upstream ganglioside synthesis enzymes in cultures bearing the
H3K27M mutation (see, e.g., Example 2 and FIG. 1J). Thus, in one
embodiment, the invention provides that GD2 overexpression results
from upregulation of ganglioside synthesis pathway component genes
in H3K27M mutant tumor relative to H3 WT pHGGs.
[0102] Additionally, double immunostaining of primary human DIPG
tissue for H3K27M to identify infiltrating malignant cells and GD2
identified local expression of GD2 in the native tumor context
(see, e.g., Example 2 and FIG. 1D). Accordingly, in one embodiment,
the invention provides the identification of a heretofore unknown
target for therapeutic intervention of H3K27M tumors (e.g.,
GD2).
[0103] GD2-targeting immunotherapies are currently under clinical
and preclinical investigation in several diseases, including
neuroblastoma, osteosarcoma, and melanoma (see, e.g., Thomas et
al., PLoS One, 2016. 11(3): p. e0152196; Long et al., Nature
Medicine, 2015. 21(6): p. 581-590; Long et al., Cancer Immunology
Research, 2016. 4(10): p. 869-880; Yu et al., N Engl J Med, 2010.
363(14): p. 1324-34; Perez Horta et al., Immunotherapy, 2016. 8(9):
p. 1097-117; Heczey et al, Molecular Therapy). Unlike mAbs which do
not efficiently cross the blood-brain barrier, activated CAR T
cells efficiently infiltrate the CNS following adoptive
transfer.
[0104] Further experiments were conducted during development of
embodiments of the invention in an effort to assess and
characterize the ability GD2-targeted, engineered immune cells as a
potential therapeutic intervention for H3K27M tumors (see, e.g.,
Examples 3-5). Human GD2-targeting chimeric antigen receptor (CAR)
T cells were generated and tested. GD2-dependent cell killing and
cytokine secretion was observed upon exposure to patient-derived
DIPG cultures relative to Mock or CD19-directed CART cells (see,
e.g., Example 3). Moreover, potent antitumor efficacy was observed
using GD2-directed CAR T cells delivered by adoptive cell transfer
in patient-derived DIPG orthotopic xenografts (see, e.g., Example
4).
[0105] CAR T-cell therapy effectively cleared multiple types of
midline H3K27M mutant pediatric diffuse midline gliomas (see, e.g.,
Example 5). Clearance of the gliomas was associated with toxicity
in thalamic xenografts.
[0106] In one aspect, the invention provides novel methods for the
treatment of H3K27M-positive (H3K27M+) cancers/tumors using
modified immune cells engineered to express a CAR targeting GD2. In
various aspects of the invention, methods of treating a H3K27M
cancer/tumors are provided, the methods comprising administering to
a patient having such a cancer or tumor an effective amount of
immune cells engineered to express a CAR targeting GD2. In certain
embodiments, the H3K27M cancer is DIPG. In another embodiment, the
H3K27M cancer is diffuse midline glioma.
[0107] In certain embodiments, the presence of significantly
elevated levels of GD2 present on the surface of H3K27M
cancers/tumors results in efficacious treatment (e.g., killing
and/or inhibition of progression) of H3K27M cancers/tumors with
GD2-directed CAR T cells. For example, the efficacy of the GD2 CAR
in H3K27M cancers/tumors appeared to be driven largely by the
homogeneously high expression of the target antigen in H3K27M
mutant DIPG (See FIG. 1C), which was consistently higher than that
present on GD2+ neuroblastoma and sarcoma cell lines. Although an
understanding of a mechanism is not needed to practice the present
invention and while the present invention is not limited to any
particular mechanism, homogeneously high expression of the target
GD2 antigen on H3K27M cancers/tumors is related to the efficacy of
treatment of H3K27M cancer/tumors with GD2-specific CAR T
cells.
[0108] In certain embodiments, the invention provides methods of
treating (e.g., inhibiting growth of and/or killing) H3K27M tumors
using immune cells (e.g., T cells (e.g., CD3+ T cells)) genetically
engineered to express a receptor that recognizes GD2 (e.g., on the
surface of the H3K27M gliomas) and transmit a signal that activates
the immune cell to induce expansion of the immune cell and/or tumor
killing. A non-limiting example of a receptor is a chimeric antigen
receptor (CAR) that incorporates an scFv derived from a mAb that
recognizes GD2, as well as a transmembrane domain, and one or more
intracellular signaling domains. The CAR may be further engineered
to incorporate other signaling elements that facilitate expansion
of the engineered cells following encounter with the GD2 antigen as
well elements that enable long-term persistence of the engineered
cells. The invention further provides compositions comprising the
genetically engineered cells (e.g., immunotherapeutic compositions
produced and administered in sufficient quantity to reach the
H3K27M tumors in the central nervous system).
[0109] Compositions and methods described herein find use in
treating any cancer/tumor harboring a somatic mutation of the
histone H3 (H3) gene H3F3A at lysine 27 (e.g., Lys27Met or K27M
(H3K27M)). Examples of cancers harboring H3K27M mutations that may
be treated with the compositions and methods of the present
invention include, but are not limited to, diffuse intrinsic
pontine glioma (DIPG) and/or diffuse midline glioma.
GD2 Specific Chimeric Antigen Receptor (CAR) Construction and
Expression.
[0110] Chimeric antigen receptors (CARs) are recombinant receptor
constructs comprising an extracellular antigen-binding domain
(e.g., a single-chain variable fragment (scFv) derived from an
antibody) joined to a hinge/spacer peptide, a transmembrane domain,
and further linked to an intracellular signaling domain (e.g., an
intracellular T cell signaling domain of a T cell receptor). Immune
cells (e.g., T cells) genetically modified to express CARs display
the specificity of an antibody (e.g., they are not
MHC/HLA-restricted) with the functionality of effector cells (e.g.,
cytotoxic and/or memory functions of T cells).
[0111] The invention is not limited by the chimeric antigen
receptor (CAR) specific for GD2 expressed in immune cells (e.g.,
the CAR construct used in methods of the invention). In one
embodiment, the CAR comprises a fusion protein of the variable
regions of the heavy (VH) and light chains (VL) (e.g., a single
chain variable fragment (scFv)) of an immunoglobulin that binds
with specificity to GD2. In a further embodiment, the
immunoglobulin binds with specificity to the GD2 epitope
GalNAc.beta.1-4(NeuAc.alpha.2-8NeuAc.alpha.2-3)Gal. Those of
ordinary skill in the art know that scFv is a fusion protein of the
variable regions of the heavy (VH) and light chains (VL) of
immunoglobulins, connected with a linker peptide (e.g., of about 10
to about 25 amino acids). The invention is not limited by the type
of linker. In some embodiments, the linker is rich in glycine
(e.g., for flexibility). In some embodiments, the linker comprises
serine and/or threonine (e.g., for solubility). In some
embodiments, the linker comprises a portion rich in glycine and a
portion comprising serine and/or threonine.
[0112] Any antibody/immunoglobulin that binds with specificity to
GD2 may be used to construct a CAR (e.g., using VH and VL regions
to construct a fusion protein, scFv) for expression in immune cells
(e.g., used in therapeutic methods of the invention). Examples of
such antibodies/immunoglobulins include, but are not limited to,
14G2a, ch14.18, hu14.18K322A, m3F8, hu3F8-IgG1, hu3F8-IgG4, HM3F8,
UNITUXIN, DMAb-20 or any other antibody that binds with specificity
to GD2 (e.g., known or described in the art, or yet to be
identified). In one embodiment, the CAR comprises a 14g2a scFv. A
GD2 CAR may comprise a receptor incorporating variants within scFv
of an anti-GD2 antibody (e.g., 14g2a scFv) generated to enhance
affinity and/or diminish tonic signaling. The GD2 CAR may
incorporate variable lengths of the hinge regions (e.g., between
the scFv and the signaling domains) and/or varying transmembrane
domains. The invention is not limited by the transmembrane domain
used. Indeed, any transmembrane domain may be used including, but
not limited to, all or part of the transmembrane domain of CD3-zeta
chain (CD3.zeta.), CD28, OX40/CD134, 4-1BB/CD137/TNFRSF9,
Fc.epsilon.RI.gamma., ICOS/CD278, ILRB/CD122, IL-2RG/CD132, or
CD40.
[0113] A CAR construct of the invention may include an
intracellular signaling domain (e.g., CD3 zeta of a native T cell
receptor complex and/or other signaling domain (e.g., a MyD88
signaling domain)) that transduces the event of ligand binding to
an intracellular signal (e.g., that activates (e.g., partially) the
immune cell (e.g., T lymphocyte)). Absent co-stimulatory signals,
receptor-ligand biding is often insufficient for full activation
and proliferation of the immune cell (e.g., T cell). Thus, a CAR
construct may include one or more co-stimulatory domains (e.g.,
that provide a second signal to stimulate full immune cell (e.g., T
cell) activation). In one embodiment, a co-stimulatory domain is
used that increases CAR immune T cell cytokine production. In
another embodiment, a co-stimulatory domain is used that
facilitates immune cell (e.g., T cell) replication. In still
another embodiment, a co-stimulatory domain is used that prevents
CAR immune cell (e.g., T cell) exhaustion. In another embodiment, a
co-stimulatory domain is used that increases immune cell (e.g., T
cell) antitumor activity. In still a further embodiment, a
co-stimulatory domain is used that enhances survival of CAR immune
cells (e.g., T cells) (e.g., post-infusion into patients).
Exemplary co-stimulatory domains include, but are not limited to,
all or part of (e.g., the endodomain portion of) the co-stimulatory
molecules of B7-1/CD80; CD28; B7-2/CD86; CTLA-4; B7-H1/PD-L1;
ICOS/CD278; ILRB/CD122; IL-2RG/CD132; B7-H2; PD-1; B7-H3; PD-L2;
B7-H4; PDCD6; BTLA; 4-1BB/TNFRSF9/CD137; Fc.epsilon.RI.gamma.; CD40
Ligand/TNFSF5; 4-1BB Ligand/TNFSF9; GITR/TNFRSF18;
BAFF/BLyS/TNFSF13B; GITR Ligand/TNFSF18; BAFF R/TNFRSF13C;
HVEM/TNFRSF14; CD27/TNFRSF7; LIGHT/TNFSF14; CD27 Ligand/TNFSF7;
OX40/TNFRSF4; CD30/TNFRSF8; OX40 Ligand/TNFSF4; CD30 Ligand/TNFSF8;
TACl/TNFRSF13B; CD40/TNFRSF5; 2B4/CD244/SLAMF4; CD84/SLAMF5;
BLAME/SLAMF8; CD229/SLAMF3; CD2 CRACC/SLAMF7; CD2F-10/SLAMF9;
NTB-A/SLAMF6; CD48/SLAMF2; SLAM/CD150; CD58/LFA-3; CD2; Ikaros;
CD53; Integrin alpha 4/CD49d; CD82/Kai-1; Integrin alpha 4 beta 1;
CD90/Thy1; Integrin alpha 4 beta 7/LPAM-1; CD96; LAG-3; CD160;
LMIR1/CD300A; CRTAM; TCL1A; DAP12; TIM-1/KIM-1/HAVCR;
Dectin-1/CLEC7A; TIM-4; DPPIV/CD26; TSLP; EphB6; TSLP R; and
HLA-DR. In one embodiment, a CAR construct expressed in immune
cells used in methods of the invention includes a CD28 endodomain,
a 4-1BB endodomain, and/or an OX40 endodomain. In certain
embodiments, a CAR construct specific for GD2 of the invention
comprises an scFv of an antibody that binds with specificity to GD2
(e.g., 14g2a), a transmembrane domain (e.g., of CD8), T cell
receptor intracellular signaling domain (e.g., CD3 zeta) and at
least one co-stimulatory domain (e.g., 4-1BB).
[0114] The invention is not limited by the type of immune cells
genetically modified to express GD2-specific CARs. Exemplary immune
cells include, but are not limited to, T cells, NK cells, effector
cells such as gamma delta T cells, memory T cells, macrophages, and
cytokine induced killer cells. In one embodiment, the immune cells
are CD4+ and/or CD 8+ T cells (e.g., that are CD3+).
[0115] The invention is not limited by the means of genetically
expressing CARs in immune cells. Indeed, any means known in the art
and/or described herein may be used. Non-limiting examples of
methods of genetically engineering immune cells include, but are
not limited to, retrovirus- or lentivirus-mediated transduction,
transduction with transposase-based systems for gene integration,
CRISPR/Cas9-mediated gene integration, non-integrating vectors such
as RNA or adeno-associated viruses, or other methods described
herein. The engineered immune cells product may incorporate
unselected T cells or other immune cells, or T cell subsets
selected for greater expansion or persistence capacity. In order to
diminish toxicity, incorporation of elements that allow killing of
cells engineered to express the GD2 targeted signaling molecule may
be incorporated. In order to diminish toxicity and/or enhance
efficacy, incorporation of elements that allow regulation of
protein expression in engineered cells may be included.
Therapeutic Methods, Compositions, and Combination Therapy.
[0116] In certain embodiments, the invention also provides methods
for treating or delaying the progression of cancer in an individual
comprising administering to the individual an effective amount of
immune cells genetically modified to express GD2-specific CARs
(e.g., GD2 CAR T cells). In some embodiments, the treatment results
in a sustained response in the individual after cessation of the
treatment. The methods described herein may find use in treating
conditions where enhanced immunogenicity is desired such as
increasing tumor immunogenicity for the treatment of cancer. Also
provided herein are methods of enhancing immune function in an
individual having cancer comprising administering to the individual
an effective amount of immune cells genetically modified to express
GD2-specific CARs (e.g., GD2 CAR T cells). Any immune cell (e.g.,
any T cell (e.g., a CD3+ T cell)) genetically modified to express a
GD2-specific CAR known in the art or described herein may be used
in these methods. In some embodiments, the individual is a
human.
[0117] In some embodiments, the individual has cancer that is
resistant (e.g., has been demonstrated to be resistant) to one or
more other forms of anti-cancer treatment (e.g., chemotherapy,
immunotherapy, etc.). In some embodiments, resistance includes
recurrence of cancer or refractory cancer. Recurrence may refer to
the reappearance of cancer, in the original site or a new site,
after treatment. In some embodiments, resistance includes
progression of the cancer during treatment with chemotherapy. In
some embodiments, resistance includes cancer that does not respond
to traditional or conventional treatment with a chemotherapeutic
agent. The cancer may be resistant at the beginning of treatment or
it may become resistant during treatment. In some embodiments, the
cancer is at early stage or at late stage.
[0118] In certain embodiments, the invention provides that exposure
of animals (e.g., humans) suffering from cancers/tumors
characterized by H3K27M-expressing cells (e.g., DIPG characterized
by H3K27M-expressing cells) to therapeutically effective amounts of
immunotherapeutic compositions comprising immune cells genetically
modified to express GD2-specific CARs (e.g., that target and kill
GD2 expressing tumors) inhibits the growth of such
H3K27M-expressing cancer cells outright and/or renders such cells
as a population more susceptible to cancer therapeutic drugs or
radiation therapies (e.g., to the cell death-inducing activity
thereof). The immunotherapeutic compositions and methods of the
invention can be used for the treatment, amelioration, or
prevention of disorders, such as any type of cancer characterized
by H3K27M-expressing cells (e.g., DIPG characterized by
H3K27M-expressing cells).
[0119] In certain embodiments, immunotherapeutic compositions
comprising immune cells genetically modified to express
GD2-specific CARs are used to treat, ameliorate, or prevent a
cancer characterized by H3K27M-expressing cells (e.g., DIPG
characterized by H3K27M-expressing cells) that additionally is
characterized by resistance to one or more conventional cancer
therapies (e.g., those cancer cells which are chemoresistant,
radiation resistant, hormone resistant, and the like). In certain
embodiments, the cancer is DIPG. In other embodiments, the cancer
is a diffuse midline glioma. As described herein, any immune cell
genetically modified to express a GD2-specific CAR may be used in
the immunotherapeutic compositions and methods of the
invention.
[0120] Immunotherapeutic compositions (e.g., comprising immune
cells genetically modified to express GD2-specific CARs) and
methods of the invention may be used to induce cytotoxic activities
against tumor cells and/or to promote cell survival and function
(e.g., survival and function of the modified immune cells). For
example, immunotherapeutic compositions and methods of the
invention can be used to induce interleukin-2 (IL-2) to promote T
cell survival; to induce Fas Ligand (FasL) and/or tumor necrosis
factor-related apoptosis inducing ligand (TRAIL) (e.g., to induce
tumor cell apoptosis); and/or to induce interferon (IFN)-gamma
(e.g., to activate the innate immune response (e.g., against
cancer)). In some embodiments, compositions and methods of the
invention are used to induce cell cycle arrest and/or apoptosis and
also to potentiate the induction of cell cycle arrest and/or
apoptosis either alone or in response to additional apoptosis
induction signals. In some embodiments, immune cells genetically
modified to express GD2-specific CARs sensitize H3K27M-expressing
cancer cells to induction of cell cycle arrest and/or apoptosis,
including cells that are normally resistant to such inducing
stimuli. In other embodiments, immune cells genetically modified to
express GD2-specific CARs are used to induce apoptosis in any
disorder characterized by the presence of H3K27M-expressing cancer
cells (e.g., DIPG and/or diffuse midline glioma characterized by
the presence of H3K27M cancer cells) that can be treated,
ameliorated, or prevented by the induction of apoptosis.
[0121] In some embodiments, the compositions and methods of the
present invention are used to treat diseased cells, tissues,
organs, or pathological conditions and/or disease states in an
animal (e.g., a mammalian patient including, but not limited to,
humans and companion animals). In this regard, various diseases and
pathologies characterized by the presence of H3K27M cells are
amenable to treatment or prophylaxis using the present methods and
compositions. In some embodiments, cancer cells being treated are
metastatic. In other embodiments, the cancer cells being treated
are resistant to anticancer agents. In other embodiments, the
disorder is any disorder having cells characterized by the presence
of the H3K27M mutation.
[0122] Some embodiments of the present invention provide methods
for administering an effective amount of immune cells genetically
modified to express GD2-specific CARs and at least one additional
therapeutic agent (including, but not limited to, chemotherapeutic
antineoplastics, apoptosis-modulating agents, antimicrobials,
antivirals, antifungals, and anti-inflammatory agents) and/or
therapeutic technique (e.g., surgical intervention, and/or
radiotherapies). In a particular embodiment, the additional
therapeutic agent(s) is an anticancer agent. For example, although
significant tumor clearance was achieved using the
immunotherapeutic compositions and methods of the invention,
persistence of small numbers of tumor cells negative for GD2
expression (e.g., by immunofluorescence staining) indicated that in
addition to the immunotherapeutic T cell compositions of the
invention, in some embodiments, multimodal or combination therapy
using any one or more cancer treatments described herein may be
useful together with immunotherapeutic T cell compositions of the
invention in order to reduce and/or avoid antigen escape (see, for
example, FIG. 4).
[0123] A number of suitable anticancer agents are contemplated for
use in, or in combination with, the methods of the present
invention. Indeed, the present invention contemplates, but is not
limited to, administration of numerous anticancer agents such as:
agents that induce apoptosis; polynucleotides (e.g., anti-sense,
ribozymes, siRNA); polypeptides (e.g., enzymes and antibodies);
biological mimetics; alkaloids; alkylating agents; antitumor
antibiotics; antimetabolites; hormones; platinum compounds;
monoclonal or polyclonal antibodies (e.g., antibodies conjugated
with anticancer drugs, toxins, defensins), toxins; radionuclides;
biological response modifiers (e.g., interferons (e.g.,
IFN-.alpha.) and interleukins (e.g., IL-2)); adoptive immunotherapy
agents; hematopoietic growth factors; agents that induce tumor cell
differentiation (e.g., all-trans-retinoic acid); gene therapy
reagents (e.g., antisense therapy reagents and nucleotides); tumor
vaccines; angiogenesis inhibitors; proteosome inhibitors: NF-KB
modulators; anti-CDK compounds; HDAC inhibitors; and the like.
Numerous other examples of chemotherapeutic compounds and
anticancer therapies suitable for co-administration with the
disclosed compounds are known to those skilled in the art.
[0124] In certain embodiments, anticancer agents comprise agents
that induce or stimulate apoptosis. Agents that induce apoptosis
include, but are not limited to, radiation (e.g., X-rays, gamma
rays, UV); tumor necrosis factor (TNF)-related factors (e.g., TNF
family receptor proteins, TNF family ligands, TRAIL, antibodies to
TRAIL-R1 or TRAIL-R2); kinase inhibitors (e.g., epidermal growth
factor receptor (EGFR) kinase inhibitor, vascular growth factor
receptor (VGFR) kinase inhibitor, fibroblast growth factor receptor
(FGFR) kinase inhibitor, platelet-derived growth factor receptor
(PDGFR) kinase inhibitor, and Bcr-Abl kinase inhibitors (such as
GLEEVEC.RTM.)); antisense molecules; antibodies (e.g.,
HERCEPTIN.RTM., RITUXAN.RTM., ZEVALIN.RTM., and AVASTIN.RTM.);
anti-estrogens (e.g., raloxifene and tamoxifen); anti-androgens
(e.g., flutamide, bicalutamide, finasteride, aminoglutethamide,
ketoconazole, and corticosteroids); cyclooxygenase 2 (COX-2)
inhibitors (e.g., celecoxib, meloxicam, NS-398, and non-steroidal
anti-inflammatory drugs (NSAIDs)); anti-inflammatory drugs (e.g.,
butazolidin, DECADRON.RTM., DELTASONE.RTM., dexamethasone,
dexamethasone intensol, DEXONE, HEXADROL.RTM., hydroxychloroquine,
METICORTEN.RTM., ORADEXON.RTM., ORASONE, oxyphenbutazone,
PEDIAPRED.RTM., phenylbutazone, PLAQUENIL.RTM., prednisolone,
prednisone, PRELONE.RTM., and TANDEARIL); and cancer
chemotherapeutic drugs (e.g., irinotecan (CAMPTOSAR.RTM.), CPT-11,
fludarabine (FLUDARA.RTM.), dacarbazine (DTIC), dexamethasone,
mitoxantrone, MYLOTARG, VP-16, cisplatin, carboplatin, oxaliplatin,
5-FU, doxorubicin, gemcitabine, bortezomib, gefitinib, bevacizumab,
TAXOTERE.RTM. or TAXOL.RTM.); cellular signaling molecules;
ceramides and cytokines; staurosporine, and the like.
[0125] In still other embodiments, the compositions and methods of
the present invention are used together with at least one
anti-hyperproliferative or antineoplastic agent selected from
alkylating agents, antimetabolites, and natural products (e.g.,
herbs and other plant and/or animal derived compounds).
[0126] Alkylating agents suitable for use in the present
compositions and methods include, but are not limited to: 1)
nitrogen mustards (e.g., mechlorethamine, cyclophosphamide,
ifosfamide, melphalan (L-sarcolysin); and chlorambucil); 2)
ethylenimines and methylmelamines (e.g., hexamethylmelamine and
thiotepa); 3) alkyl sulfonates (e.g., busulfan); 4) nitrosoureas
(e.g., carmustine (BCNU); lomustine (CCNU); semustine
(methyl-CCNU); and streptozocin (streptozotocin)); and 5) triazenes
(e.g., dacarbazine (DTIC;
dimethyltriazenoimid-azolecarboxamide).
[0127] In some embodiments, antimetabolites suitable for use in the
present compositions and methods include, but are not limited to:
1) folic acid analogs (e.g., methotrexate (amethopterin)); 2)
pyrimidine analogs (e.g., fluorouracil (5-fluorouracil; 5-FU),
floxuridine (fluorodeoxyuridine; FudR), and cytarabine (cytosine
arabinoside)); and 3) purine analogs (e.g., mercaptopurine
(6-mercaptopurine; 6-MP), thioguanine (6-thioguanine; TG), and
pentostatin (2'-deoxycoformycin)).
[0128] In still further embodiments, chemotherapeutic agents
suitable for use in the compositions and methods of the present
invention include, but are not limited to: 1) vinca alkaloids
(e.g., vinblastine (VBL), vincristine); 2) epipodophyllotoxins
(e.g., etoposide and teniposide); 3) antibiotics (e.g.,
dactinomycin (actinomycin D), daunorubicin (daunomycin;
rubidomycin), doxorubicin, bleomycin, plicamycin (mithramycin), and
mitomycin (mitomycin C)); 4) enzymes (e.g., L-asparaginase); 5)
biological response modifiers (e.g., interferon-alfa); 6) platinum
coordinating complexes (e.g., cisplatin (cis-DDP) and carboplatin);
7) anthracenediones (e.g., mitoxantrone); 8) substituted ureas
(e.g., hydroxyurea); 9) methylhydrazine derivatives (e.g.,
procarbazine (N-methylhydrazine; MIH)); 10) adrenocortical
suppressants (e.g., mitotane (o,p'-DDD) and aminoglutethimide); 11)
adrenocorticosteroids (e.g., prednisone); 12) progestins (e.g.,
hydroxyprogesterone caproate, medroxyprogesterone acetate, and
megestrol acetate); 13) estrogens (e.g., diethylstilbestrol and
ethinyl estradiol); 14) antiestrogens (e.g., tamoxifen); 15)
androgens (e.g., testosterone propionate and fluoxymesterone); 16)
antiandrogens (e.g., flutamide): and 17) gonadotropin-releasing
hormone analogs (e.g., leuprolide).
[0129] Any oncolytic agent that is routinely used in a cancer
therapy context may also be used in the compositions and methods of
the present invention. For example, the U.S. Food and Drug
Administration maintains a formulary of oncolytic agents approved
for use in the United States. International counterpart agencies to
the U.S. F.D.A. maintain similar formularies.
[0130] Anticancer agents further include compounds which have been
identified to have anticancer activity. Examples include, but are
not limited to, 3-AP, 12-O-tetradecanoylphorbol-13-acetate, 17AAG,
852A, ABI-007, ABR-217620, ABT-751, ADI-PEG 20, AE-941, AG-013736,
AGRO100, alanosine, AMG 706, antibody G250, antineoplastons,
AP23573, apaziquone, APC8015, atiprimod, ATN-161, atrasenten,
azacitidine, BB-10901, BCX-1777, bevacizumab, BG00001,
bicalutamide, BMS 247550, bortezomib, bryostatin-1, buserelin,
calcitriol, CCI-779, CDB-2914, cefixime, cetuximab, CG0070,
cilengitide, clofarabine, combretastatin A4 phosphate, CP-675,206,
CP-724,714, CpG 7909, curcumin, decitabine, DENSPM,
doxercalciferol, E7070, E7389, ecteinascidin 743, efaproxiral,
eflornithine, EKB-569, enzastaurin, erlotinib, exisulind,
fenretinide, flavopiridol, fludarabine, flutamide, fotemustine,
FR901228, G17DT, galiximab, gefitinib, genistein, glufosfamide,
GTI-2040, histrelin, HKI-272, homoharringtonine, HSPPC-96,
hu14.18-interleukin-2 fusion protein, HuMax-CD4, iloprost,
imiquimod, infliximab, interleukin-12, IPI-504, irofulven,
ixabepilone, lapatinib, lenalidomide, lestaurtinib, leuprolide,
LMB-9 immunotoxin, lonafarnib, luniliximab, mafosfamide, MB07133,
MDX-010, MLN2704, monoclonal antibody 3F8, monoclonal antibody
J591, motexafin, MS-275, MVA-MUC1-IL2, nilutamide,
nitrocamptothecin, nolatrexed dihydrochloride, nolvadex, NS-9,
O6-benzylguanine, oblimersen sodium, ONYX-015, oregovomab, OSI-774,
panitumumab, paraplatin, PD-0325901, pemetrexed, PHY906,
pioglitazone, pirfenidone, pixantrone, PS-341, PSC 833, PXD101,
pyrazoloacridine, R115777, RAD001, ranpirnase, rebeccamycin
analogue, rhuAngiostatin protein, rhuMab 2C4, rosiglitazone,
rubitecan, S-1, S-8184, satraplatin, SB-, 15992, SGN-0010, SGN-40,
sorafenib, SR31747A, ST1571, SU011248, suberoylanilide hydroxamic
acid, suramin, talabostat, talampanel, tariquidar, temsirolimus,
TGFa-PE38 immunotoxin, thalidomide, thymalfasin, tipifarnib,
tirapazamine, TLK286, trabectedin, trimetrexate glucuronate,
TroVax, UCN-1, valproic acid, vinflunine, VNP40101M, volociximab,
vorinostat, VX-680, ZD1839, ZD6474, zileuton, and zosuquidar
trihydrochloride.
[0131] For a more detailed description of anticancer agents and
other therapeutic agents, those skilled in the art are referred to
any number of instructive manuals including, but not limited to,
the Physician's Desk Reference and to Goodman and Gilman's
"Pharmaceutical Basis of Therapeutics" tenth edition, Eds. Hardman
et al., 2002.
[0132] The present invention provides methods for administering
compositions and methods of the invention with (e.g., before,
during, or after) radiation therapy. The invention is not limited
by the types, amounts, or delivery and administration systems used
to deliver the therapeutic dose of radiation to an animal. For
example, the animal may receive photon radiotherapy, particle beam
radiation therapy, other types of radiotherapies, and combinations
thereof. In some embodiments, the radiation is delivered to the
animal using a linear accelerator. In still other embodiments, the
radiation is delivered using a gamma knife.
[0133] The source of radiation can be external or internal to the
animal. External radiation therapy is most common and involves
directing a beam of high-energy radiation to a tumor site through
the skin using, for instance, a linear accelerator. While the beam
of radiation is localized to the tumor site, it is nearly
impossible to avoid exposure of normal, healthy tissue. However,
external radiation is usually well tolerated by animals. Internal
radiation therapy involves implanting a radiation-emitting source,
such as beads, wires, pellets, capsules, particles, and the like,
inside the body at or near the tumor site including the use of
delivery systems that specifically target cancer cells (e.g., using
particles attached to cancer cell binding ligands). Such implants
can be removed following treatment, or left in the body inactive.
Types of internal radiation therapy include, but are not limited
to, brachytherapy, interstitial irradiation, intracavity
irradiation, radioimmunotherapy, and the like.
[0134] The animal may optionally receive radiosensitizers (e.g.,
metronidazole, misonidazole, intra-arterial Budr, intravenous
iododeoxyuridine (IudR), nitroimidazole,
5-substituted-4-nitroimidazoles, 2H-isoindolediones,
[[(2-bromoethyl)-amino]methyl]-nitro-1H-imidazole-1-ethanol,
nitroaniline derivatives, DNA-affinic hypoxia selective cytotoxins,
halogenated DNA ligand, 1,2,4 benzotriazine oxides,
2-nitroimidazole derivatives, fluorine-containing nitroazole
derivatives, benzamide, nicotinamide, acridine-intercalator,
5-thiotretrazole derivative, 3-nitro-1,2,4-triazole,
4,5-dinitroimidazole derivative, hydroxylated texaphrins,
cisplatin, mitomycin, tiripazamine, nitrosourea, mercaptopurine,
methotrexate, fluorouracil, bleomycin, vincristine, carboplatin,
epirubicin, doxorubicin, cyclophosphamide, vindesine, etoposide,
paclitaxel, heat (hyperthermia), and the like), radioprotectors
(e.g., cysteamine, aminoalkyl dihydrogen phosphorothioates,
amifostine (WR 2721), IL-1, IL-6, and the like). Radiosensitizers
enhance the killing of tumor cells. Radioprotectors protect healthy
tissue from the harmful effects of radiation.
[0135] Any type of radiation can be administered to an animal, so
long as the dose of radiation is tolerated by the animal without
unacceptable negative side-effects. Suitable types of radiotherapy
include, for example, ionizing (electromagnetic) radiotherapy
(e.g., X-rays or gamma rays) or particle beam radiation therapy
(e.g., high linear energy radiation). Ionizing radiation is defined
as radiation comprising particles or photons that have sufficient
energy to produce ionization, i.e., gain or loss of electrons (as
described in, for example, U.S. Pat. No. 5,770,581 incorporated
herein by reference in its entirety). The effects of radiation can
be at least partially controlled by the clinician. In one
embodiment, the dose of radiation is fractionated for maximal
target cell exposure and reduced toxicity.
[0136] In one embodiment, the total dose of radiation administered
to an animal is about 0.01 Gray (Gy) to about 100 Gy. In another
embodiment, about 10 Gy to about 65 Gy (e.g., about 15 Gy, 20 Gy,
25 Gy, 30 Gy, 35 Gy, 40 Gy, 45 Gy, 50 Gy, 55 Gy, or 60 Gy) are
administered over the course of treatment. While in some
embodiments a complete dose of radiation can be administered over
the course of one day, the total dose is ideally fractionated and
administered over several days. Desirably, radiotherapy is
administered over the course of at least about 3 days, e.g., at
least 5, 7, 10, 14, 17, 21, 25, 28, 32, 35, 38, 42, 46, 52, or 56
days (about 1-8 weeks). Accordingly, a daily dose of radiation will
comprise approximately 1-5 Gy (e.g., about 1 Gy, 1.5 Gy, 1.8 Gy, 2
Gy, 2.5 Gy, 2.8 Gy, 3 Gy, 3.2 Gy, 3.5 Gy, 3.8 Gy, 4 Gy, 4.2 Gy, or
4.5 Gy), or 1-2 Gy (e.g., 1.5-2 Gy). The daily dose of radiation
should be sufficient to induce destruction of the targeted cells.
If stretched over a period, in one embodiment, radiation is not
administered every day, thereby allowing the animal to rest and the
effects of the therapy to be realized. For example, radiation
desirably is administered on 5 consecutive days, and not
administered on 2 days, for each week of treatment, thereby
allowing 2 days of rest per week. However, radiation can be
administered 1 day/week, 2 days/week, 3 days/week, 4 days/week, 5
days/week, 6 days/week, or all 7 days/week, depending on the
animal's responsiveness and any potential side effects. Radiation
therapy can be initiated at any time in the therapeutic period. In
one embodiment, radiation is initiated in week 1 or week 2, and is
administered for the remaining duration of the therapeutic period.
For example, radiation is administered in weeks 1-6 or in weeks 2-6
of a therapeutic period comprising 6 weeks for treating, for
instance, a solid tumor. Alternatively, radiation is administered
in weeks 1-5 or weeks 2-5 of a therapeutic period comprising 5
weeks. These exemplary radiotherapy administration schedules are
not intended, however, to limit the present invention.
[0137] Antimicrobial therapeutic agents may also be used as
therapeutic agents in the present invention. Any agent that can
kill, inhibit, or otherwise attenuate the function of microbial
organisms may be used, as well as any agent contemplated to have
such activities. Antimicrobial agents include, but are not limited
to, natural and synthetic antibiotics, antibodies, inhibitory
proteins (e.g., defensins), antisense nucleic acids, membrane
disruptive agents and the like, used alone or in combination.
Indeed, any type of antibiotic may be used including, but not
limited to, antibacterial agents, antiviral agents, antifungal
agents, and the like.
[0138] In some embodiments of the present invention, immune cells
(e.g., T cells (e.g., CD8 and/or CD4 T cells)) genetically modified
to express GD2-specific CARs and one or more therapeutic agents or
anticancer agents are administered to an animal under one or more
of the following conditions: at different periodicities, at
different durations, at different concentrations, by different
administration routes, etc. In some embodiments, immune cells
(e.g., T cells (e.g., CD8 and/or CD4 T cells)) genetically modified
to express GD2-specific CARs are administered prior to the
therapeutic or anticancer agent, e.g., 0.5, 1, 2, 3, 4, 5, 10, 12,
18 hours or more, 1, 2, 3, 4, 5, 6 or more days, or 1, 2, 3, 4, 5,
6 or more weeks prior to the administration of the therapeutic or
anticancer agent. In some embodiments, immune cells (e.g., T cells
(e.g., CD8 and/or CD4 T cells)) genetically modified to express
GD2-specific CARs are administered after the therapeutic or
anticancer agent, e.g., 0.5, 1, 2, 3, 4, 5, 10, 12, 18 or more
hours, 1, 2, 3, 4, 5, 6 or more days, or 1, 2, 3, 4, 5, 6, or more
weeks after the administration of the anticancer agent. In some
embodiments, immune cells (e.g., T cells (e.g., CD8 and/or CD4 T
cells)) genetically modified to express GD2-specific CARs and the
therapeutic or anticancer agent are administered concurrently but
on different schedules, e.g., modified immune cells are
administered daily while the therapeutic or anticancer agent is
administered once a week, once every two weeks, once every three
weeks, once every four weeks, or more. In other embodiments,
modified immune cells are administered once a week while the
therapeutic or anticancer agent is administered daily, once a week,
once every two weeks, once every three weeks, once every four
weeks, or more.
[0139] Compositions within the scope of this invention include all
compositions wherein the immune cells (e.g., T cells (e.g., CD8
and/or CD4 T cells)) genetically modified to express GD2-specific
CARs are contained in an amount which is effective to achieve its
intended purpose. While individual needs vary, determination of
optimal ranges of effective amounts of each component is within the
skill of the art. In one non-limiting example, immune cells (e.g.,
T cells (e.g., CD8 and/or CD4 T cells)) genetically modified to
express GD2-specific CARs may be administered to mammals, e.g.
humans, in order to provide the human between 1000 and 10.sup.10
modified immune cells per day (e.g., for treating cancer). In
another embodiment, between 1000 and 10.sup.10 modified immune
cells are administered to treat, ameliorate, or prevent cancer
(e.g., prevent metastasis, recurrence, and/or progression of
cancer). The unit dose may be administered in one or more
administrations one or more times daily (e.g., for 1, 2, 3, 4, 5,
6, or more days or weeks).
[0140] Modified immune cells may be administered as part of a
pharmaceutical preparation containing suitable pharmaceutically
acceptable carriers comprising excipients and auxiliaries which
facilitate processing and/or administration of the modified cells
into preparations which can be used pharmaceutically. Modified
immune cells and/or pharmaceutical preparations containing the
same, or other treatments used in concurrently therewith, may be
administered intravenously, intramuscularly, subcutaneously,
intratumorally, intraperitoneally, intrathecally, or
intraventricularly. An effective amount of modified immune cells
and/or pharmaceutical preparations containing the same may be
administered for prevention or treatment of disease. The
appropriate dosage may be determined based on the type of disease
to be treated, the type of modified immune cell, the severity and
course of the disease, the clinical condition of the individual,
the individual's clinical history and response to the treatment,
and the discretion of the attending physician.
[0141] The efficacy of any of the methods described herein (e.g.,
treatment with immune cells engineered to express a CAR targeting
GD2 alone in in combination with one or more chemotherapeutic
agents described herein) may be tested in various models known in
the art, such as clinical or pre-clinical models. Suitable
pre-clinical models are exemplified herein. Other models of H3K27M
mutant cancers/tumors may be used. For any exemplary model, after
developing tumors, mice are randomly recruited into treatment
groups receiving treatment or control treatment. Tumor size (e.g.,
tumor volume) is measured during the course of treatment, and
overall survival rate is also monitored.
[0142] In some embodiments, a sample is obtained prior to treatment
with immune cells engineered to express a CAR targeting GD2 (e.g.,
alone or in combination with another therapy described herein). In
some embodiments, the sample is a tissue sample (e.g.,
formalin-fixed and paraffin-embedded (FFPE), archival, fresh or
frozen). In some embodiments, the sample is whole blood. In some
embodiments, the whole blood comprises immune cells, circulating
tumor cells and any combinations thereof.
[0143] In some embodiments, presence of the H3K27M mutation is
evaluated in a tumor or tumor sample. As used herein, a tumor or
tumor sample may encompass part or all of the tumor area occupied
by tumor cells. In some embodiments, a tumor or tumor sample may
further encompass tumor area occupied by tumor associated
intratumoral cells and/or tumor associated stroma (e.g., contiguous
peri-tumoral desmoplastic stroma). Tumor-associated intratumoral
cells and/or tumor associated stroma may include areas of immune
infiltrates immediately adjacent to and/or contiguous with the main
tumor mass.
[0144] Presence and/or expression levels/amount of a biomarker
(e.g., H3K27M) can be determined qualitatively and/or
quantitatively based on any suitable criterion known in the art,
including but not limited to DNA, mRNA, cDNA, proteins, protein
fragments and/or gene copy number. In certain embodiments, presence
and/or expression levels/amount of a biomarker in a first sample is
increased or elevated as compared to presence/absence and/or
expression levels/amount in a second sample. In certain
embodiments, presence/absence and/or expression levels/amount of a
biomarker in a first sample is decreased or reduced as compared to
presence and/or expression levels/amount in a second sample. In
certain embodiments, the second sample is a reference sample,
reference cell, reference tissue, control sample, control cell, or
control tissue. Additional disclosures for determining
presence/absence and/or expression levels/amount of a gene are
described herein.
[0145] Presence and/or expression level/amount of various
biomarkers in a sample can be analyzed by a number of
methodologies, many of which are known in the art and understood by
the skilled artisan, including, but not limited to,
immunohistochemistry ("IHC"), Western blot analysis,
immunoprecipitation, molecular binding assays, ELISA, ELIFA,
fluorescence activated cell sorting ("FACS"), MassARRAY,
proteomics, quantitative blood based assays (as for example serum
ELISA), biochemical enzymatic activity assays, in situ
hybridization, Southern analysis, Northern analysis, whole genome
sequencing, polymerase chain reaction ("PCR") including
quantitative real time PCR ("qRT-PCR") and other amplification type
detection methods, such as, for example, branched DNA, SISBA, TMA
and the like), RNA-Seq, FISH, microarray analysis, gene expression
profiling, and/or serial analysis of gene expression ("SAGE"), as
well as any one of the wide variety of assays that can be performed
by protein, gene, and/or tissue array analysis. Typical protocols
for evaluating the status of genes and gene products are found, for
example in Ausubel et al., eds., 1995, Current Protocols In
Molecular Biology, Units 2 (Northern Blotting), 4 (Southern
Blotting), 15 (Immunoblotting) and 18 (PCR Analysis). Multiplexed
immunoassays such as those available from Rules Based Medicine or
Meso Scale Discovery ("MSD") may also be used.
[0146] In alternative methods, the sample may be contacted with an
antibody specific for biomarker under conditions sufficient for an
antibody-biomarker complex to form, and then detecting said
complex. The presence of the biomarker may be detected in a number
of ways, such as by Western blotting and ELISA procedures for
assaying a wide variety of tissues and samples, including plasma or
serum. A wide range of immunoassay techniques using such an assay
format are available, see, e.g., U.S. Pat. Nos. 4,016,043,
4,424,279 and 4,018,653. These include both single-site and
two-site or "sandwich" assays of the non-competitive types, as well
as in the traditional competitive binding assays. These assays also
include direct binding of a labeled antibody to a target
biomarker.
[0147] Presence and/or expression level/amount of a selected
biomarker in a tissue or cell sample may also be examined by way of
functional or activity-based assays. For instance, if the biomarker
is an enzyme, one may conduct assays known in the art to determine
or detect the presence of the given enzymatic activity in the
tissue or cell sample.
[0148] In certain embodiments, the samples are normalized for both
differences in the amount of the biomarker assayed and variability
in the quality of the samples used, and variability between assay
runs. Such normalization may be accomplished by detecting and
incorporating the expression of certain normalizing biomarkers,
including well known housekeeping genes. Alternatively,
normalization can be based on the mean or median signal of all of
the assayed genes or a large subset thereof (global normalization
approach). On a gene-by-gene basis, measured normalized amount of a
subject tumor mRNA or protein is compared to the amount found in a
reference set. Normalized expression levels for each mRNA or
protein per tested tumor per subject can be expressed as a
percentage of the expression level measured in the reference set.
The presence and/or expression level/amount measured in a
particular subject sample to be analyzed will fall at some
percentile within this range, which can be determined by methods
well known in the art.
[0149] In one embodiment, the sample is a clinical sample. In
another embodiment, the sample is used in a diagnostic assay. In
some embodiments, the sample is obtained from a primary or
metastatic tumor. Tissue biopsy is often used to obtain a
representative piece of tumor tissue. Alternatively, tumor cells
can be obtained indirectly in the form of tissues or fluids that
are known or thought to contain the tumor cells of interest. Genes
or gene products can be detected from cancer or tumor tissue or
from other body samples such as urine, sputum, serum or plasma. The
same techniques discussed above for detection of target genes or
gene products in cancerous samples can be applied to other body
samples. Cancer cells may be sloughed off from cancer lesions and
appear in such body samples. By screening such body samples, a
simple early diagnosis can be achieved for these cancers. In
addition, the progress of therapy can be monitored more easily by
testing such body samples for target genes (biomarker) or gene
products.
[0150] In certain embodiments, a reference sample, reference cell,
reference tissue, control sample, control cell, or control tissue
is a single sample or combined multiple samples from the same
subject or individual that are obtained at one or more different
time points than when the test sample is obtained. For example, a
reference sample, reference cell, reference tissue, control sample,
control cell, or control tissue is obtained at an earlier time
point from the same subject or individual than when the test sample
is obtained. Such reference sample, reference cell, reference
tissue, control sample, control cell, or control tissue may be
useful if the reference sample is obtained during initial diagnosis
of cancer and the test sample is later obtained when the cancer
becomes metastatic.
[0151] In certain embodiments, a reference sample, reference cell,
reference tissue, control sample, control cell, or control tissue
is a combined multiple samples from one or more healthy individuals
who are not the subject or individual. In certain embodiments, a
reference sample, reference cell, reference tissue, control sample,
control cell, or control tissue is a combined multiple samples from
one or more individuals with a disease or disorder (e.g., cancer)
who are not the subject or individual. In certain embodiments, a
reference sample, reference cell, reference tissue, control sample,
control cell, or control tissue is pooled RNA samples from normal
tissues or pooled plasma or serum samples from one or more
individuals who are not the subject or individual. In certain
embodiments, a reference sample, reference cell, reference tissue,
control sample, control cell, or control tissue is pooled RNA
samples from tumor tissues or pooled plasma or serum samples from
one or more individuals with a disease or disorder (e.g., cancer)
who are not the subject or individual.
[0152] In some embodiments, the sample is a tissue sample from the
individual. In some embodiments, the tissue sample is a tumor
tissue sample (e.g., biopsy tissue). In some embodiments, the
tissue sample is CNS tissue. In some embodiments, the tissue sample
is brain tissue (e.g., glial tissue).
[0153] A tumor sample may be obtained from a subject by any method
known in the art, including without limitation a biopsy, endoscopy,
or surgical procedure. In some embodiments, a tumor sample may be
prepared by methods such as freezing, fixation (e.g., by using
formalin or a similar fixative), and/or embedding in paraffin wax.
In some embodiments, a tumor sample may be sectioned. In some
embodiments, a fresh tumor sample (i.e., one that has not been
prepared by the methods described above) may be used. In some
embodiments, a tumor sample may be prepared by incubation in a
solution to preserve mRNA and/or protein integrity.
[0154] In some embodiments, responsiveness to treatment may refer
to any one or more of: extending survival (including overall
survival and progression free survival); resulting in an objective
response (including a complete response or a partial response); or
improving signs or symptoms of cancer. In some embodiments,
responsiveness may refer to improvement of one or more factors
according to the published set of RECIST guidelines for determining
the status of a tumor in a cancer patient, i.e., responding,
stabilizing, or progressing. For a more detailed discussion of
these guidelines, see Eisenhauer et al., Eur J Cancer 2009; 45:
228-47; Topalian et al., N Engl J Med 2012; 366:2443-54; Wolchok et
al., Clin Can Res 2009; 15:7412-20; and Therasse, P., et al. J.
Natl. Cancer Inst. 92:205-16 (2000). A responsive subject may refer
to a subject whose cancer(s) show improvement, e.g., according to
one or more factors based on RECIST criteria. A non-responsive
subject may refer to a subject whose cancer(s) do not show
improvement, e.g., according to one or more factors based on RECIST
criteria.
[0155] Conventional response criteria may not be adequate to
characterize the anti-tumor activity of immunotherapeutic agents,
which can produce delayed responses that may be preceded by initial
apparent radiological progression, including the appearance of new
lesions. Therefore, modified response criteria have been developed
that account for the possible appearance of new lesions and allow
radiological progression to be confirmed at a subsequent
assessment. Accordingly, in some embodiments, responsiveness may
refer to improvement of one of more factors according to
immune-related response criteria2 (irRC). See, e.g., Wolchok et
al., Clin Can Res 2009; 15:7412-20. In some embodiments, new
lesions are added into the defined tumor burden and followed, e.g.,
for radiological progression at a subsequent assessment. In some
embodiments, presence of non-target lesions are included in
assessment of complete response and not included in assessment of
radiological progression. In some embodiments, radiological
progression may be determined only on the basis of measurable
disease and/or may be confirmed by a consecutive assessment >4
weeks from the date first documented.
[0156] Therapy utilizing modified immune cells of the invention,
e.g., CAR T-cells, effectively cleared multiple types of midline
H3K27M mutant pediatric diffuse midline gliomas. However, in some
instances, the robustness of the immune response leading to
reduction and/or clearance of tumor/cancer may be associated with
subsequent neuroinflammation in neuroanatomical locations
intolerant of swelling (see, e.g., Richman et al., Cancer Immunol.
Res. (2018) 6(1); published online Nov. 27, 2017). For example, the
thalamus, located just above the cerebellum tentorial notch, is a
precarious location for edema, particularly when already expanded
by tumor, and swelling in this location can precipitate
hydrocephalus from third ventricular compression, increased
intracranial pressure and lethal transtentorial herniation.
[0157] Accordingly, in some embodiments, clinical monitoring and/or
neurointensive management of edema is utilized together with
immunotherapeutic compositions and methods of the invention in
order to achieve successful clinical results. The invention is not
limited by the type of monitoring or the type of management
utilized. Indeed, any means of monitoring cranial inflammation
and/or swelling may be used. In like manner, any means of managing
cranial inflammation and/or swelling may be used. In one
non-limiting example, monitoring for hydrocephalus and/or signs of
increased intracranial pressure is performed during inpatient
monitoring with frequent neurological and fundoscopic exams and/or
neuroimaging. In some embodiments, neurosurgical interventions,
such as intraventricular shunt placement for relief of
hydrocephalus or even craniectomy for decompression, is utilized to
support patients through tumoricidal neuroinflammation.
[0158] The specification is considered to be sufficient to enable
one skilled in the art to practice the invention. Various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
from the foregoing description and fall within the scope of the
appended claims. All publications, patents, and patent applications
cited herein are hereby incorporated by reference in their entirety
for all purposes.
EXAMPLES
[0159] The following examples are illustrative, but not limiting,
of the compounds, compositions, and methods of the present
invention. Other suitable modifications and adaptations of the
variety of conditions and parameters normally encountered in
clinical therapy and which are obvious to those skilled in the art
are within the spirit and scope of the invention.
Example 1
Materials and Methods
[0160] DIPG/DMG Cultures.
[0161] Patient-derived glioma cell cultures were generated as
previously described (see, e.g., Lin and Monje, J Vis Exp,
2017(121)). Briefly, postmortem tumor tissue was dissociated
mechanically and enzymatically (Liberase DH, Roche) prior to
separation of myelin and debris by sucrose centrifugation.
Neurosphere-generating cultures were maintained in serum-free media
supplemented with B27 (ThermoFisher), EGF, FGF, PDGF-AA, PDGF-BB
(Shenandoah Biotechnology), and Heparin (StemCell Technologies).
All cultures were validated and monitored by STR-fingerprinting
(See Table 1, below) and verified to be mycoplasma-free within the
previous 6 months (MycoAlert Plus, Lonza).
TABLE-US-00001 TABLE 1 Cell line STR fingerprinting Cell Histone
STR Fingerprint Culture Status AMEL CSF1PO1 D135317 D152639 D21S11
D5S818 D7S820 TH01 TPOX vWA SU-DIPG6 H3F3A X/X 10/11 11/ 8/13 29/31
10/12 8/9 7/8 8/11 17/18 K27M SU- H3F3A X/X 9/10 11/12 11/12 30/OL
12/12 9/9 6/7 OL/8 .sup. 13/18 DIPG13 K27M (overload) SU- H3F3A X/Y
13/13 9/9 9/12 28/29 11/11 8/8 7/7 8/11 18/19 DIPG17 K27M SU- H3F3A
X/Y 10/11 13/14 9/13 30/30 11/12 10/10 9.3/9.3 8/11 17/18 DIPG19
K27M SU- HIST1H3B X/Y 11/12 8/13 10/10 30/32 10/11 8/9 6/5 8/12
16/19 DIPG21 K27M SU- H3F3A X, X 12, 12 8, 11 12, 13 30, 35 11, 13
10, 12 9, 9 7, 8 14, 16 DIPG25 K27M SU- H3F3A X, Y 11, 12 9, 12 10,
12 .sup. 30, 33.2 11, 11 9, 12 6, 6 8, 11 16, 17 DIPG27 K27M SU-
HIST1H3B X, Y 11, 12 8, 10 10, 12 30, 30 10, 12 10, 12 8, 9 8, 11
14, 14 DIPG33 K27M SU- H3F3A X, X 10, 12 12, 13 9, 12 31.2, 32.2
12, 12 10, 13 6, 7 8, 8 15, 16 DIPG35 K27M VUMC- H3 WT X, X 10, 11
13, 13 11, 12 30, 30 10, 13 12, 12 7, 9 8, 11 15, 19 DIPG10 SU- H3
WT X/Y 10/11 11/ 9/11 28/30.2 11/ 11/12 9.3/ 8/12 17/16 pcGBM2 SU-
H3F3A X/Y 10/12 12/ 11/12 28/29 11/12 10/ 9.3/ 8/11 16/18 pSCG1
K27M QCTB- H3F3A X/X 12, 13 12/ 11/ .sup. 29, 31.2 12/ 8, 11 9/ 11,
13 13, 16 R059 K27M
SU-DIPG6 and SU-DIPG13 have been previously referenced and are
identical to SU-DIPG-VI and SU-DIPG-XIII, respectively.
[0162] Cell Surface Screening.
[0163] Cell surface markers present on DIPG cell cultures were
screened using a panel of monoclonal antibodies against human cell
surface markers (Lyoplate, BD Biosciences). Low passage (<12)
DIPG cultures expanded from tumor tissue collected at autopsy in
serum-free, neurosphere forming conditions were allotted to 96 well
plates and blocked with 1 .mu.g of goat IgG per million cells to
reduce nonspecific binding of secondary antibodies subsequently
used in the assay. Cells were then incubated sequentially with
primary and secondary antibodies with intermediate wash steps
according to the manufacturer's instructions. Dead cells were then
labeled with a Live/Dead violet stain (ThermoFisher), and following
washes cells were fixed in 1% PFA for 10 minutes at room
temperature. The following day, stained cells were analyzed by flow
cytometry. Doublets and dead cells were excluded by gating, and the
median fluorescence intensity of antibody labeling for each target
on the panel was normalized to the median fluorescence intensity
(MFI) for the matched isotype control.
[0164] Immunohistochemistry and Light Microscopy.
[0165] Primary DIPG patient tumor samples were fixed overnight in
4% paraformaldehyde/PBS upon arrival, and then transferred to 30%
sucrose until the tissue samples sank (2-3 days). Tissues were then
transferred to cryomolds and embedded in OCT (TissueTek). 10 micron
cryosections were generated on a cryostat (Leica), and endogenous
peroxidase activity was neutralized (Bloxall, Vector Laboratories)
prior to permeabilization (0.3% Triton X-100, TBS) and blocking (5%
horse serum, Vector Laboratories). Sequential double
immunohistochemistry was conducted for H3K27M (Abcam ab190631,
1:1000, 1 hr RT) and GD2 (14g2a, BD, 1:500, 1 hr at RT). H3K27M was
developed with a polymer-based peroxidase secondary (ImmPRESS VR
anti-rabbit IgG, Vector Laboratories, 30 minutes at RT) and DAB
substrate (BD, 45 seconds at RT). Under these conditions, H3K27M+
cells could be routinely identified in multiple tissues confirmed
to bear both H3F3A and HISTH1B3 mutations by Sanger sequencing.
After quenching the DAB substrate development in TBS and staining
with the 14g2a primary antibody, GD2 signal was developed using a
polymer-based alkaline phosphatase secondary (ImmPRESS AP
anti-mouse IgG, Vector Laboratories, 30 minutes at RT) and blue
alkaline phosphatase substrate (Vector Blue AP substrate kit,
Vector Laboratories, 150 seconds at RT). AP development was
quenched in TBS, and samples were mounted and imaged (Zeiss
AxioObserver). For hematoxylin-eosin staining, mice were deeply
anesthetized by intraperitoneal injection of tribromoethanol and
perfused transcardially with cold PBS, brains were removed and
fixed overnight in 4% paraformaldehyde/PBS. Brains were then
transferred to 70% ethanol and subsequently embedded in paraffin,
sectioned, and stained with hematoxylin/eosin. H&E histology
was then analyzed.
[0166] Immunofluorescence and Confocal Microscopy.
[0167] Mice were deeply anesthetized with tribromoethanol (Avertin)
before being perfused transcardially with cold PBS. Brains and
other tissues of interest were then removed and fixed overnight in
4% PFA/PBS before being transferred to 30% sucrose and allowed to
sink (2-3 days). Serial 40 micron coronal sections were then cut on
a freezing microtome and floated in a tissue cryoprotectant
solution (glycerol, ethylene glycol, phosphate buffer) before
storage at -20.degree. C. Serial sections were then stained
overnight at 4C. Primary antibodies used were: rabbit anti-H3K27M
(Abcam, 1:1000), rabbit anti-cleaved caspase-3 (Cell Signaling
Technology, 9661, 1:250), mouse anti-NeuN (Millipore, MAB377,
1:500), and rabbit Iba1 (Wako, 019-19741, 1:500). Secondary
antibodies raised in donkey and conjugated with AlexaFluor 594 or
647 were used at 4C overnight to detect primary labeling (Jackson
ImmunoResearch, 1:500). Mounted samples were imaged by confocal
microscopy (Zeiss LSM710), and acquired Z stacks through the tumor
region were flattened by maximum intensity projection (ImageJ). To
quantify tumor cell density, cells within the borders of
infiltrating tumor in acquired micrographs were counted and
normalized to the tumor area (ImageJ), and the sum of all cells was
normalized to the total area investigated across 3-4 sections for
each animal in a 1:12 series.
[0168] RT-qPCR.
[0169] Cultures were plated in triplicate under standard growth
conditions and harvested in Trizol 24 hours later. After DNAse
treatment, extracted RNA was reverse transcribed (Maxima first
strand, ThermoFisher) and utilized as template for qPCR reactions
(Maxima SYBR green, ThermoFisher). Primers utilized are listed in
Table 2, below.
TABLE-US-00002 TABLE 2 Primers used for RT-PCR SEQ SEQ ID ID Gene
Primer NO: Primer NO: B4GALNT1 ACTGGTCACT 1 GCGGGTGTCT 8 TACAGCAGCC
TATGCGGATA B3GALT4 GGTTTTGCAC 2 AGGCCACTGC 9 AGCGAGGAAG TCCTCTGATA
ST3GAL5_1 CACACCCTGA 3 TCAAGGTCAG 10 ACCAGTTCGA ACAGTGGTGC ST8SIA1
AGAGCATGTG 4 ATCCCACCAT 11 GTATGACGGG TTCCCACCAC ST8SIA5 ATTAAGAGAG
5 CCTCAGCTCC 12 GCCTCCAGTT AGGCATCTTG TG B4GALT6 CCATACCTCC 6
CATGACCCCC 13 CCTGTCCAGA TGGCTCAAT HPRT1 CTGGCGTCGT 7 TCTCGAGCAA 14
GATTAGTGAT GACGTTCAGT
No-template and RT-controls did not significantly amplify.
[0170] CAR Construction, Retroviral Vector Production and T Cell
Transduction.
[0171] GD2.BBz and CD19.BBz CAR retroviral vectors were constructed
(see, e.g., Lynn et al., Blood, 2015. 125(22):p. 3466-76). GD2.BBz
and CD19.BBz CAR-encoding retroviral supernatants were produced via
transient transfection of the 293GP cell line (see, e.g., Haso et
al., Blood, 2013. 121(7): p. 1165-74). Briefly, 293GP cells were
transfected on poly-d-lysine coated plates via Lipofectamine 2000
(Life Technologies) with the plasmids encoding the CARs and the
RD114 envelope protein. Supernatants were collected 48 and 72 hours
after transfection. Isolated human T-cells were activated with
anti-CD3/CD28 beads (Life Technologies) in a 3:1 bead:cell ratio
with 40 IU/ml IL-2 for 3 days. Activated T cells were then
retrovirally transduced on days 3 and 4 (see, e.g., Long et al.,
Nat Med, 2015. 21(6): p. 581-90) using Retronectin (Takara) coated
plates, and cultured in 300 IU/ml IL-2. Anti-CD3/CD28 beads were
removed on day 5. Media and IL-2 were changed every 2-3 days.
Transduction efficiencies were checked by flow cytometry with the
1A7 anti-idiotype antibody (see, e.g., Sen et al., J Immunother,
1998. 21(1): p. 75-83) for the GD2.BBz CAR and with the FMC63
anti-idiotype antibody 136.20.1 (see, e.g., Jena et al., PLoS One,
2013. 8(3): p. e57838) or Protein L (Pierce) for the CD19.BBz
CAR.
[0172] In Vitro Cytokine Generation and Cell Killing.
[0173] Standard luciferase based assays were carried out to
evaluate CART cell cytolytic ability (see, e.g., Lynn et al.,
Blood, 2015. 125(22):p. 3466-76). Firefly luciferase expressing
target tumor cells (10,000 per well) were co-incubated with CAR T
cells for 24 hours at effector-to-target (E:T) ratios ranging from
10:1 to 1:1. The STEADY-GLO Luciferase Assay System (Promega) was
used to measure residual luciferase activity from remaining
targets, and lysis was calculated as follows: percent
lysis=100-[[(average signal from T cell-treated wells)/(average
signal from untreated target wells)].times.100].
[0174] Cytokine production by CAR T-cells in vitro was evaluated by
co-incubation of CAR+ T-cells with target tumor cells at a 1:1
ratio (100,000 cells each), with CAR+ T-cell counts incorporating
the transduction efficiency as assessed by anti idiotype staining
and flow cytometry. The total number of T-cells used for the
control CD19-4-1BBz CAR T-cells matched the number used for the
GD2-4-1BBz CAR T-cells to ensure that the total number of T-cells
remained consistent across groups. After 24 hours, supernatants
were harvested and cytokine levels measured by ELISA for IL-2 and
IFN-gamma (BioLegend).
[0175] T-Cell Proliferation.
[0176] GD2-CAR T-cells on Day 15 of culture were labeled with Cell
Trace Violet (ThermoFisher) according to manufacturer protocol.
Labeled GD2-CAR T-cells were either incubated with no tumor,
VUMC-DIPG10 (GD2 negative, H3K27M negative) or SU-DIPG13 (GD2
positive, H3K27M positive). After five days of incubation, cells
were collected and analyzed by flow cytometry for proliferation.
Analysis was performed on CAR+ T-cells only as identified by
anti687 idiotype staining.
[0177] Orthotopic Xenograft Generation and Treatment.
[0178] Orthotopic DIPG xenografts were generated (see, e.g., Grasso
et al., Nat Med, 2015. 21(6): p. 555-9). All in vivo experiments
were approved by the Stanford University Institutional Care and Use
Committee and performed in accordance with institutional
guidelines. Animals were housed according to institutional
guidelines with free access to food and water on a 12-hour
light/dark cycle. Briefly, patient-derived DIPG cell cultures
previously transduced with a lentivirus expressing eGFP and firefly
luciferase driven by the CMV promoter were infused by stereotaxic
injector (Stoelting) into the pons (coordinates lambda AP-3 mm,
DV-3 mm) of cold anesthetized newborn (P0-2) NSG mice (Jax).
Orthotopic pediatric spinal cord glioma xenografts were generated
by stereotaxic injection of SU-pSCG1 transduced with a lentivirus
expressing eGFP and firefly luciferase driven by the CAG promoter
into the medulla of isoflurane anesthetized P35 NSG mice
(coordinates lambda ML+0.7 mm, AP-3.5 mm, DV-4.5 mm, 600 k cells).
Orthotopic thalamic glioma xenografts were generated by stereotaxic
injection of QCTB-R059 transduced with a lentivirus expressing eGFP
and firefly luciferase driven by the CMV promoter into the thalamus
of isoflurane-anesthetized P35 NSG mice (coordinates bregma ML+0.8
mm, AP-1 mm, DV -3.5 mm, 600 k cells). Tumors were then allowed to
develop for 60 days. Prior to treatment, tumor burden was assessed
by in vivo luminescence imaging (IVIS Spectrum, PerkinElmer), and
total flux was calculated by included software (Living Image,
Perkin Elmer) as the radiance through standard circular ROIs
centered on the animal's head. Paired background regions were
quantified using circular ROIs over the animal's flank where no
significant luminescence was detected above background. Animals
were rank-ordered by tumor burden and distributed sequentially into
GD2 or CD19-CAR treatment groups, such that populations of
equivalent initial tumor burden underwent each arm of therapy.
Initial burden assessed in this manner was equivalent across
treatment groups and engrafted cell lines (see FIG. 3). SU-DIPG13P*
cells were injected into the pons of isoflurane-anesthetized P35
NSG mice (coordinates lambda ML+1 mm, AP-0.8 mm, DV-5 mm, 600 k
cells) and allowed to develop for 14 days before T-cell
administration. CAR T-cells with concentrations adjusted to deliver
1.times.10.sup.7 transduced cells in 200 microliters of PBS
(assessed by idiotype staining using flow cytometry, routinely
>60%) were then administered by intravenous injection into the
tail vein of animals. Where transduction efficiencies varied
between GD2-CARs and CD19-CARs, the concentration of CD19-CAR cells
was adjusted to match the total dose of human T-cells present in
the GD2-CAR infusion. Tumor burden was monitored longitudinally by
in vivo luminescence imaging. Due to the nature of GD2-CAR
response, blinding in initial cohorts was deemed ineffective and
subsequently not performed. All images were scaled to display
minimum flux intensity as 5.times.10.sup.4 and maximum as
5.times.10.sup.6, then images of individual animals were arranged
with like treated animals in the cohort for display in the FIGS.
Trial endpoint at 50 days post treatment was determined in initial
cohorts where substantial hair loss, reduced activity, and weight
loss in both GD2-CAR and CD19-CAR groups that triggered morbidity
criteria for euthanasia.
[0179] CRISPR/Cas9-Mediated Deletion of GD2 Synthase.
[0180] Deletion of GD2 synthase (B4GALNT1) in SU-DIPG13 cells was
accomplished by electroporation of DIPG13 with Cas9:sgRNA
ribonucleoprotein complexes as described (See Hendel et al., Nat
Biotechnol 33, 985-989 (2015)). Briefly, guide RNAs targeting exon1
of B4GALNT1 (CGUCCCGGGUGCUCGCGUAC (SEQ ID NO: 15) and
CCGGCUACCUCUUGCGCCGU (SEQ ID NO: 16), Synthego) were incubated with
Cas9 nuclease to form ribonucleoprotein complexes and
electroporated with an Amaxa 4-D nucleofector (SE Buffer, program
DS-112). In parallel, a control gRNA targeting the AAVS1 locus46
(GGGGCCACUAGGGACAGGAU (SEQ ID NO: 17)) was electroporated with Cas9
nuclease as a ribonucleoprotein complex using identical parameters.
GD2-negative cells electroporated with B4GALNT1-targeting gRNAs
were isolated by FACS sorting, and deletion was confirmed by Sanger
sequencing and TIDE analysis. (see Nucleic Acids Res 42, e168
(2014)).
[0181] Statistics and Reproducibility.
[0182] Statistical tests were conducted using Prism (GraphPad)
software unless otherwise indicated. Gaussian distribution was
confirmed by the Shapiro-Wilk normality test. For parametric data,
unpaired, two-tailed Student's t-tests and one-way ANOVA with
Tukey's post hoc tests to further examine pairwise differences were
used. For survival analysis, a log-rank (Mantel-Cox) test was used.
A level of P<0.05 was used to designate significant differences.
On the basis of the variance of xenograft growth in control mice,
at least 3 mice per treatment group were used to give 80% power to
detect an effect size of 20% with a significance level of 0.05. For
all animal experiments, the number of independent mice used is
shown in the FIG. or listed in the brief description of the
drawings. For each of the five patient-derived xenograft models
used, at least two independent cohorts were tested (i.e.
independent litters of mice on different days with independent
batches of cells.) For cytokine and in vitro cell killing
experiments, n=3 and experiments were repeated twice.
Example 2
Identification of the Overexpression of Disialoganglioside GD2 in
Histone H3 K27M (H3K27M) Mutated Diffuse Intrinsic Pontine Glioma
(DIPG)
[0183] In order to identify potential targets for immunotherapy
(e.g., CAR T cell therapy) in DIPG, cell surface antigens (see FIG.
13) were screened in patient-derived DIPG cultures (See FIG. 1A).
Significant overlap between independent patient-derived cultures
(see FIG. 1B) indicated conservation of a core group of surface
markers across DIPG patients. From these common targets, the
disialoganglioside GD2 was identified as commonly expressed at high
levels on each of the four patient-derived DIPG cultures screened.
Hit validation by flow cytometry confirmed uniform and remarkably
high levels of GD2 expression in all H3K27M DIPG cultures examined,
including both those with the H3F3A K27M mutation and the less
common HIST1H3B K27M mutation (see FIG. 1C, Wu et al., Nature
Genetics, 2012. 44(3): p. 251-253; Khuong-Quang et al., Acta
Neuropathol, 2012. 124(3): p. 439-47; and Schwartzentruber et al.,
Nature, 2012. 482(7384): p. 226-31). Intriguingly, GD2 expression
was identified as being far lower in histone H3 WT pediatric
high-grade gliomas (pHGG), including a case diagnosed as DIPG (See
FIG. 1C).
[0184] In order to assess whether transcriptional perturbations
resulting from the H3K27M mutation might be linked to increased GD2
expression, gene expression of ganglioside synthesis enzymes was
profiled in a panel of patient-derived DIPG and pHGG cultures and
consistently higher expression of upstream ganglioside synthesis
enzymes was found in cultures bearing the H3K27M mutation (see FIG.
1J). Double immunostaining of primary human DIPG tissue for H3K27M
to identify infiltrating malignant cells and GD2 confirmed local
expression of GD2 in the native tumor context (see FIG. 1D).
Example 3
[0185] GD2-Dependent Cell Killing of DIPG Cells with GD2-CAR T
Cells
[0186] Human GD2-targeting CAR T cells were generated employing a
14g2a scFv and 4-1BBz costimulatory domain (see FIG. 1E and Long et
al., Nature Medicine, 2015. 21(6): p. 581-590). Significant
GD2-dependent cell killing (see FIG. 1F) and cytokine generation
(see FIG. 1G) was observed upon exposure to patient derived DIPG
cultures relative to control CD19-CAR T-cells incorporating 4-1BBz
(CD19-CAR). Notably, GD2-directed CAR T cells did not produce
significant cytokines or induce cell killing when exposed to the
H3WT, GD2-negative VU-DIPG10 patient-derived DIPG culture, thereby
demonstrating therapeutic specificity of GD2-CARs toward H3K27M
DIPG.
[0187] To further confirm the targeting specificity of GD2-CAR
T-cells, CRISPR-Cas9-mediated deletion of GD2 synthase (B4GALNT1)
in patient-derived DIPG cells was used to generate GD2 knockout
DIPG cells (see FIGS. 1H(a), 1H(b) and 1H(c)). Loss of GD2 antigen
expression eliminated cytokine production by the GD2-CAR T-cells in
comparison to untreated or DIPG cells electroporated with a control
guide sequence targeting the AAVS1 locus (see FIG. 1I). These data
indicate specific reactivity of GD2-CAR T-cells to H3K27M+ glioma
cells.
Example 4
In Vivo Efficacy of GD2-Directed CAR T Cells Against DIPG
[0188] In order to evaluate the in vivo efficacy of GD2-directed
CAR T cells against DIPG, orthotopic mouse xenografts of DIPG
cultures derived from post-mortem patient tissue were prepared and
then transduced with a luciferase-expressing construct to enable
longitudinal monitoring of tumor burden. The xenograft models
faithfully recapitulate the diffusely infiltrating histology of
DIPG (see, e.g., Monje et al. Proc Natl Acad Sci USA 108, 4453-4458
(2011); and Qin et al., Cell 170, 845-859 e819 (2017). Mice were
distributed by initial tumor burden into equivalent treatment and
control groups before receiving 1.times.107 GD2-CAR or CD19-CAR
T-cells by a single intravenous injection 7-8 weeks after
establishment of pontine xenografts. Within 40 days post-treatment
(DPT), marked reductions in tumor burden were observed across two
independent GD2-CAR T-cell treated cohorts of mice bearing SU-DIPG6
xenografts (see FIG. 2A and Grasso et al., Nat Med 21, 555-559
(2015)). Similar results were observed in a second patient-derived
xenograft model, SU-DIPG13FL30 (See FIG. 2e). All GD2-CAR treated
animals demonstrated complete tumor clearance by bioluminescence
imaging (See FIG. 3). By contrast, no mice in the CD19-CAR T-cell
control groups exhibited significant tumor regression. At 50 DPT
brains were harvested, and immunostaining for the mutant histone
H3K27M--present in all engrafted tumor cells--revealed that GD2-CAR
treated tumors had been largely eradicated (see FIGS.
2C,D,G,H,I).
[0189] The small number of H3K27M+ tumor cells that remain after
treatment were negative for GD2 by immunostaining (see FIG. 4). The
data evidences that the potency of the GD2-CAR T cells was driven
by the high expression of the target antigen in H3K27M mutant DIPG,
which was observed to be consistently higher than that present on
GD2+ neuroblastoma and sarcoma cell lines (see FIG. 5).
[0190] Most patient-derived orthotopic DIPG xenograft models
require many months for lethality, limiting the ability to monitor
survival benefit due to development of xenogeneic graft versus host
disease (GVHD) after treatment with human T cells (see, Ali et al.,
PLoS One 7, e44219 (2012)). SU-DIPG-13P* was therefore used as it
is a model that exhibits a dense pattern of growth histologically
(see, Nagaraja et al., Cancer Cell 31, 635-652 e636 (2017)), and is
consistently lethal within one month. Substantial improvement in
survival was observed in GD2-CAR treated animals compared with
CD19-CAR treated controls (see FIG. 6A). However, in one out of
three independent cohorts, lethal toxicity occurred in several
GD2-CAR T-cell treated animals, while all GD2-CAR T-cell treated
animals in the other cohorts survived to endpoint (see FIG. 7).
GD2-CAR treated animals that survived the initial phase of glioma
clearance returned to a visibly healthy state indistinguishable
from untreated immunodeficient mice until the onset of GVHD
symptoms 4+ weeks after CAR administration that invariably
triggered endpoint criteria (see FIG. 8). Histologic analysis of
the brains of endpoint GD2-CAR treated animals revealed clearance
of this high-burden tumor while surrounding neural tissues appeared
grossly normal (see FIG. 6B)
[0191] In order to better understand the etiology of
treatment-related toxicity in these DIPG xenograft models, the
brains of treated SU-DIPG6 xenograft bearing mice were acutely
examined at DPT14 (FIG. 3c). GD2-CAR treatment was accompanied by a
widespread inflammatory infiltrate involving brain parenchyma,
meninges and ventricles that was most prominent in the brainstem.
Ventriculomegaly was observed, consistent with hydrocephalus.
Histologically normal appearing neurons were observed to be present
throughout the pons, hippocampus, and cortex of GD2-CAR
T-cell-treated animals with no evidence of neuronal cell killing
nor other tissue destruction in this model (See FIG. 6C). Thus,
neuropathological evaluation indicated that the toxicity described
above resulted from brainstem inflammation and hydrocephalus due to
fourth ventricular compression during the tumor-clearing interval
and not on-target, off-tumor toxicity of GD2-CAR T-cells.
[0192] To visualize CAR T-cell infiltration into the parenchyma and
tumor, GD2-4-1BBz-mCherry and CD19-4-1BBz-mCherry fusion constructs
were generated (see FIG. 6D). By DPT7, GD2-CAR T-cells were
extensively distributed throughout the leptomeninges of treated
animals, leptomeningeal tumor has been largely eradicated, and few
mCherry+ cells were present within the brain parenchyma (see FIG.
6H and FIG. 9). By DPT14, mCherry+ GD2-CAR T-cells had widely
infiltrated throughout the parenchyma and numerous foci of Iba1+
macrophages (see FIG. 6E) were present in the xenografted site,
along with extensive apoptotic cleaved caspase 3+ cells (see FIG.
6F). Notably, very few cleaved caspase 3+ apoptotic cells were
neurons as identified by NeuN double immunostaining (10 total
apoptotic neurons identified across 4 mice (see FIG. 6G and FIG.
10). By DPT21, mCherry+ GD2-CAR T-cells remained present throughout
the CNS; whereas few CD19-CAR T-cells infiltrated the parenchyma
(see FIG. 9). This indicated that intravenously administered
GD2-CAR T-cells enter through the meningeal lymphatic system (see
Louveau et al., Nature 523, 337-341 (2015)), then subsequently
infiltrate brain parenchyma. Given that resolution of tumor
clearance and ventriculomegaly temporally coincide in treated
animals, The data also indicate that antigen specific antitumor
activity, rather than on-target, off-tumor cell killing, likely
precipitates neuroinflammation and edema during active tumoricidal
activity that resulted in hydrocephalus.
Example 5
[0193] CAR T-Cell Therapy Effectively Clears Multiple Types of
Midline H3K27M Mutant Pediatric Diffuse Midline Gliomas but is
Associated with Toxicity in Thalamic Xenografts
[0194] Recent WHO criteria place DIPG within a larger
classification of diffuse midline gliomas (DMG) expressing the
H3K27M mutation (see FIG. 11A, and Louis et al., Acta Neuropathol
131, 803-820 (2016)). In patient-derived cultures of pediatric
H3K27M thalamic (QCTB-R059, derived from resection), and spinal
cord (SU-pSCG1, derived post-mortem) DMGs, GD2 is also highly and
uniformly expressed (see FIG. 11B) and triggers IFN.gamma. and IL-2
production by GD2-CAR T-cells (see FIG. 11C). In order to determine
if neuroanatomical site of disease could impact outcomes of CAR
T-cell therapy, and to explore in vivo GD2-CAR T-cell efficacy in
these H3K27M DMGs, patient-derived orthotopic xenograft models of
spinal cord (SUpSCG1) and thalamic (QCTB-R059) glioma were
generated. When engrafted in the medulla to avoid the paralysis
induced by injection into the spinal cord, widespread SUpSCG1
growth was observed throughout the CNS (see FIG. 11D). Systemic
administration of GD2-CAR T-cells achieved potent and lasting
tumor-clearing in the spinal cord glioma xenograft model, assessed
both by longitudinal bioluminescence imaging (see FIGS. 11D and
11E) and endpoint histology, where approximately 16 residual
H3K27M+ cells per animal remained across the sampled volume of 3
GD2-CAR T-cell treated animals (see FIGS. 11F and 11G) No mice from
this cohort died during the tumor-clearing phase.
[0195] To evaluate efficacy in H3K27M thalamic glioma, QCTB-R059
cells were engrafted orthotopically in the thalamus (see FIG. 11H).
Tumor clearance was observed in this model (see FIGS. 11H, 11I and
FIG. 12) on a similar time scale as observed for DIPG and spinal
cord tumors above. However substantial toxicity occurred in GD2-CAR
T-cell treated animals during the period of maximal therapeutic
effect (see FIG. 11K) The results were reminiscent of
"pseudoprogression", well described following immunotherapy with
checkpoint inhibitors (see Wolchok et al., Clin Cancer Res 15,
7412-7420 (2009)) and highlight a potential drawback of a robust
immunotherapeutic response and subsequent neuroinflammation in
neuroanatomical locations intolerant of swelling.
[0196] All publications and patents mentioned in the above
specification are herein incorporated by reference. Various
modifications and variations of the described method and system of
the invention will be apparent to those skilled in the art without
departing from the scope and spirit of the invention. Although the
invention has been described in connection with specific preferred
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention that are obvious to those skilled in relevant fields are
intended to be within the scope of the following claims.
Sequence CWU 1
1
17120DNAArtificial sequenceSynthetic 1actggtcact tacagcagcc
20220DNAArtificial sequenceSynthetic 2ggttttgcac agcgaggaag
20320DNAArtificial sequenceSynthetic 3cacaccctga accagttcga
20420DNAArtificial sequenceSynthetic 4agagcatgtg gtatgacggg
20522DNAArtificial sequenceSynthetic 5attaagagag gcctccagtt tg
22620DNAArtificial sequenceSynthetic 6ccatacctcc cctgtccaga
20720DNAArtificial sequenceSynthetic 7gcgggtgtct tatgcggata
20820DNAArtificial sequenceSynthetic 8aggccactgc tcctctgata
20920DNAArtificial sequenceSynthetic 9tcaaggtcag acagtggtgc
201020DNAArtificial sequenceSynthetic 10atcccaccat ttcccaccac
201120DNAArtificial sequenceSynthetic 11cctcagctcc aggcatcttg
201219DNAArtificial sequenceSynthetic 12catgaccccc tggctcaat
191320DNAArtificial sequenceSynthetic 13tctcgagcaa gacgttcagt
201420DNAArtificial sequenceSynthetic 14gcgggtgtct tatgcggata
201520RNAArtificial sequenceSynthetic 15cgucccgggu gcucgcguac
201620RNAArtificial sequenceSynthetic 16ccggcuaccu cuugcgccgu
201720RNAArtificial sequenceSynthetic 17ggggccacua gggacaggau
20
* * * * *