U.S. patent application number 16/999851 was filed with the patent office on 2021-04-29 for method for diagnosing and assessing endometriosis.
The applicant listed for this patent is McMaster University. Invention is credited to Warren G Foster.
Application Number | 20210123910 16/999851 |
Document ID | / |
Family ID | 1000005387705 |
Filed Date | 2021-04-29 |
![](/patent/app/20210123910/US20210123910A1-20210429\US20210123910A1-2021042)
United States Patent
Application |
20210123910 |
Kind Code |
A1 |
Foster; Warren G |
April 29, 2021 |
METHOD FOR DIAGNOSING AND ASSESSING ENDOMETRIOSIS
Abstract
A method of detecting the expression level of miRNA markers in a
biological sample obtained from a mammal is provided. The method
incudes the steps of i) detecting the expression level of one or
more miRNA markers selected from the group of miR-199a-3p,
miR-143-3p, miR-340-5p, let-7b-5p, miR-21-5p, miR-17-5p, miR-20a-5p
and miR-103a-3p, in the biological sample; ii) detecting the
expression level of at least one miRNA reference marker selected
from miR-148b-3p and miR-30e-5p in the biological sample; and iii)
normalizing the expression level of the miRNA marker(s) against the
expression level of the miRNA reference marker in the sample and in
a control. The method is useful for the diagnosis of endometriosis,
monitoring of patient response to treatment, and assessment of
disease progression and/or severity.
Inventors: |
Foster; Warren G; (Hamilton,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
McMaster University |
Hamilton |
|
CA |
|
|
Family ID: |
1000005387705 |
Appl. No.: |
16/999851 |
Filed: |
August 21, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62890896 |
Aug 23, 2019 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/5308 20130101;
A61K 45/06 20130101; G01N 2496/00 20130101; G01N 2800/364
20130101 |
International
Class: |
G01N 33/53 20060101
G01N033/53; A61K 45/06 20060101 A61K045/06 |
Claims
1. A method of detecting the expression level of miRNA markers in a
biological sample obtained from a mammal comprising: i) detecting
the expression level of one or more miRNA markers selected from the
group of miR-199a-3p, miR-143-3p, miR-340-5p, let-7b-5p, miR-21-5p,
miR-17-5p, miR-20a-5p and miR-103a-3p, in the biological sample;
ii) detecting the expression level of at least one miRNA reference
marker selected from miR-148b-3p and miR-30e-5p in the biological
sample; and iii) normalizing the expression level of the miRNA
marker(s) against the expression level of the miRNA reference
marker in the sample and in a control.
2. The method of claim 1, wherein the mammal is a human female.
3. The method of claim 1, wherein the expression level of the miRNA
markers and miRNA reference markers is determined using RT-PCR.
4. The method of claim 3, wherein the expression level of the miRNA
reference marker, miR-148b-3p, is detected using a primer having
the sequence, ucagugcaucacagaacuuugu, and the miRNA reference
marker, miR-30e-5p, is detected using a primer having the sequence,
uguaaacauccuugacuggaa.
5. The method of claim 1, wherein the expression level of both of
the miRNA reference markers, miR-148b-3p and hsa-miR-30e-5p, is
detected.
6. The method of claim 1, wherein the expression level of the one
or more miRNA markers is detected using a primer, wherein
miR-340-5p is detected using the primer, uuauaaagcaaugagacugauu
(SEQ ID NO: 1); let-7b-5p is detected using the primer,
ugagguaguagguugugugguu (SEQ ID NO: 2); miR-21-5p is detected using
the primer, uagcuuaucagacugauguuga (SEQ ID NO: 3); miR-17-5p is
detected using the primer, caaagugcuuacagugcagguag (SEQ ID NO: 4);
miR-20a-5p is detected using the primer, uaaagugcuuauagugcagguag
(SEQ ID NO: 5); miR-103a-3p is detected using the primer,
agcagcauuguacagggcuauga (SEQ ID NO: 6); miR-199a-3p is detected
using the primer, acaguagucugcacauugguua (SEQ ID NO: 7); and
miR-143-3p is detected using the primer, ugagaugaagcacuguagcuc (SEQ
ID NO: 8).
7. The method of claim 1, wherein the control is obtained from
mammals that do not have endometriosis.
8. A method of diagnosing endometriosis in a mammal comprising: i)
detecting the expression level of at least 5 miRNA markers selected
from the group of miR-199a-3p, miR-143-3p, miR-340-5p, let-7b-5p,
miR-21-5p, miR-17-5p, miR-20a-5p and miR-103a-3p, in a biological
sample obtained from the mammal; ii) detecting the expression level
of an miRNA reference marker selected from miR-148b-3p and
miR-30e-5p in the biological sample obtained from the mammal; iii)
normalize the expression level of the miRNA markers based on the
expression level of the miRNA reference marker in the sample and in
a control; and iv) diagnosing the mammal with endometriosis when
the normalized expression levels of the miRNA markers are less than
the expression level of the miRNA markers in the control.
9. The method according to claim 8, wherein the miRNA markers
comprise miR-199a-3p, miR-143-3p, miR-340-5p, let-7b-5p, miR-21-5p,
miR-17-5p, miR-20a-5p and miR-103a-3p.
10. The method according to claim 8, wherein the miRNA markers
comprise miR-17-5p, miR-20a-5p, miR-199a-3p, miR-143-3p, and
let-7b-5p.
11. The method according to claim 8, wherein the expression level
of both miRNA reference markers, miR-148b-3p and miR-30e-5p, is
detected.
12. The method according to 8, wherein the biological sample is
selected from the group consisting of blood, serum, plasma, urine,
peritoneal fluid, uterine fluid and endometrial tissue.
13. The method of claim 8, wherein the expression level of the
miRNA markers and miRNA reference markers is determined using
RT-PCR.
14. The method of claim 8, wherein the expression level of the
miRNA reference marker, miR-148b-3p, is detected using a primer
having the sequence, ucagugcaucacagaacuuugu, and the miRNA
reference marker, miR-30e-5p, is detected using a primer having the
sequence, uguaaacauccuugacuggaa.
15. The method of claim 8, wherein the expression level of the one
or more miRNA markers is detected using a primer, wherein
miR-340-5p is detected using the primer, uuauaaagcaaugagacugauu
(SEQ ID NO: 1); let-7b-5p is detected using the primer,
ugagguaguagguugugugguu (SEQ ID NO: 2); miR-21-5p is detected using
the primer, uagcuuaucagacugauguuga (SEQ ID NO: 3); miR-17-5p is
detected using the primer, caaagugcuuacagugcagguag (SEQ ID NO: 4);
miR-20a-5p is detected using the primer, uaaagugcuuauagugcagguag
(SEQ ID NO: 5); miR-103a-3p is detected using the primer,
agcagcauuguacagggcuauga (SEQ ID NO: 6); miR-199a-3p is detected
using the primer, acaguagucugcacauugguua (SEQ ID NO: 7); and
miR-143-3p is detected using the primer, ugagaugaagcacuguagcuc (SEQ
ID NO: 8).
16. The method of claim 8, additionally comprising the step of
treating a mammal diagnosed with endometriosis with a treatment
selected from pain medication, hormone therapy,
gonadotropin-releasing hormone (Gn-RH) agonists and/or antagonists
and steroid treatment.
17. A kit for use in a method as defined in claim 8 comprising PCR
primers for at least 3 miRNA markers selected from the group of
miR-199a-3p, miR-143-3p, miR-340-5p, let-7b-5p, miR-21-5p,
miR-17-5p, miR-20a-5p and miR-103a-3p, and an miRNA reference
marker selected from miR-148b-3p and hsa-miR-30e-5p.
18. The kit of claim 17, wherein the miRNA marker primers are
selected from uuauaaagcaaugagacugauu (SEQ ID NO: 1);
ugagguaguagguugugugguu (SEQ ID NO: 2); uagcuuaucagacugauguuga (SEQ
ID NO: 3); caaagugcuuacagugcagguag (SEQ ID NO: 4);
uaaagugcuuauagugcagguag (SEQ ID NO: 5); agcagcauuguacagggcuauga
(SEQ ID NO: 6); acaguagucugcacauugguua (SEQ ID NO: 7); and
ugagaugaagcacuguagcuc (SEQ ID NO: 8), and the primer for the miRNA
reference marker is selected from ucagugcaucacagaacuuugu and
uguaaacauccuugacuggaa.
19. A biochip comprising a surface adhered to which at least 3
miRNA markers selected from uuauaaagcaaugagacugauu (SEQ ID NO: 1);
ugagguaguagguugugugguu (SEQ ID NO: 2); uagcuuaucagacugauguuga (SEQ
ID NO: 3); caaagugcuuacagugcagguag (SEQ ID NO: 4);
uaaagugcuuauagugcagguag (SEQ ID NO: 5); agcagcauuguacagggcuauga
(SEQ ID NO: 6); acaguagucugcacauugguua (SEQ ID NO: 7); and
ugagaugaagcacuguagcuc (SEQ ID NO: 8), and a primer for the miRNA
reference marker selected from ucagugcaucacagaacuuugu and
uguaaacauccuugacuggaa.
Description
FIELD OF INVENTION
[0001] The present invention generally relates to methods for
detecting miRNA in a biological sample, and more particularly
relates to methods useful in the diagnosis of gynecological
disorders, in particular, endometriosis.
BACKGROUND OF THE INVENTION
[0002] Endometriosis is a common chronic and benign, estrogen
dependent gynecological disorder with a prevalence of 1-10% of
women of reproductive age and 35-50% of women with infertility and
pelvic pain (Giudice 2010; Tamaresis et al. 2014; Burney and
Giudice 2012). Endometriosis is characterized by pain and
infertility arising from the growth of endometrial stromal cells
and glands outside the uterine cavity (Giudice 2010). The lack of a
diagnostic blood test leads to diagnostic delays of on average 7
years (Nnoaham et al. 2011; Fuldeore et al. 2015) with laparoscopy,
either alone or in combination with histopathological evidence of
endometrial stroma and glands, remaining the gold standard for the
diagnosis of endometriosis (Fadhlaoui et al. 2015). Laparoscopy is
an expensive and invasiveness procedure whose risks, although rare,
are serious. Consequently, diagnostic markers of endometriosis have
been sought to provide more timely access to appropriate effective
treatment alternatives for endometriosis. However, no clinical
marker of endometriosis, either alone or in combination, has
provided adequate sensitivity or specificity for the diagnosis of
endometriosis (May et al. 2010; May et al. 2011; Fassbender et al.
2015; Nisenblat et al. 2016). Thus, the search for suitable
diagnostic markers of endometriosis remains a high but unmet
research priority (Rogers et al. 2017).
[0003] Recently, several groups (Cosar et al. 2016; Cho et al.
2015; Wang et al. 2013; Jia et al. 2013; Nothnick et al. 2017;
Rekker et al. 2015; Bashti et al. 2018; Nisenblat et al. 2019) have
explored the potential of circulating microRNA (miRNA) levels for
the diagnosis of endometriosis. miRNAs are single stranded RNA that
are 21-25 nucleotides in length, which act as post transcriptional
silencers of gene expression by degradation of their target RNAs
(Bartel 2004). miRNA are present in body fluids including blood,
either contained in exosomes or bound to protein complexes which
makes them more stable than circulating hormone or cytokine
concentrations and therefore better candidate markers of a diseases
(Shah et al. 2013). One miRNA can target several genes, or one gene
can be targeted by different miRNAs (Bartel 2009). Circulating
levels of miRNAs are dysregulated in several different cancers (Jia
et al. 2012; Wang et al. 2012; Sueta et al. 2017) and endometriosis
(Cosar et al. 2016; Cho et al. 2015; Wang et al. 2013; Jia et al.
2013; Nothnick et al. 2017; Rekker et al. 2015; Bashti et al. 2018;
Nisenblat et al. 2019). While circulating levels of multiple miRNA
differed significantly between women with endometriosis compared to
controls, the results have largely not been reproduceable, and
thus, miRNA appears to have limited potential for use as diagnostic
markers of endometriosis (Nisenblat et al. 2019). However, prior
studies suffer from the use of unvalidated reference material to
normalize results, and failure to control for hemolysis (a factor
known to adversely affect the reliability of results).
Consequently, the potential of miRNA for effective diagnosis of
endometriosis remains unresolved.
[0004] Diagnostic delay, cost, surgical risk, and poor correlation
between symptoms and extent of disease are the basis for arguments
to shift from surgical to clinical diagnosis (Agarwal et al. 2019;
Taylor et al. 2018). Thus, there remains an uregent and unmet need
for methods suitable to replace laparoscopy as the diagnostic
standard for endometriosis to reduce the number of women needing
laparoscopy, permit earlier detection of endometriosis and enable
women more timely access to effective treatment options that
attenuate disease severity and complications. Moreover, reduced
need for diagnostic laparoscopy will mitigate surgical risks and
reduce the health care costs associated with caring for women with
endometriosis.
SUMMARY OF THE INVENTION
[0005] The present application discloses methods and kits for
detecting the level of specific miRNAs in a mammalian sample. The
method is useful for the diagnosis of endometriosis, monitoring of
patient response to treatment, and assessment of disease
progression and/or severity.
[0006] Thus, in one aspect of the invention, a method of detecting
the expression level of miRNA markers in a biological sample
obtained from a mammal is provided, comprising:
[0007] i) detecting the expression level of one or more miRNA
markers selected from the group of miR-199a-3p, miR-143-3p,
miR-340-5p, let-7b-5p, miR-21-5p, miR-17-5p, miR-20a-5p and
miR-103a-3p, in a biological sample obtained from the mammal;
[0008] ii) detecting the expression level of at least one miRNA
reference marker selected from miR-148b-3p and hsa-miR-30e-5p in
the biological sample obtained from the mammal; and
[0009] iii) normalizing the expression level of the miRNA marker(s)
against the expression level of the miRNA reference marker in the
sample and in a control.
[0010] In another aspect of the invention, a method of diagnosing
endometriosis in a mammal is provided comprising:
[0011] i) detecting the expression level of at least 3 miRNA
markers selected from the group of miR-199a-3p, miR-143-3p,
miR-340-5p, let-7b-5p, miR-21-5p, miR-17-5p, miR-20a-5p and
miR-103a-3p, in a biological sample obtained from the mammal;
[0012] ii) detecting the expression level of an miRNA reference
marker selected from miR-148b-3p and hsa-miR-30e-5p in the
biological sample obtained from the mammal;
[0013] iii) normalizing the expression level of the miRNA markers
based on the expression level of miRNA reference markers in the
sample and in a control; and
[0014] iv) diagnosing the mammal with endometriosis when the
normalized expression levels of the miRNA markers are less than the
expression level of the miRNA markers in the control.
[0015] In another aspect of the application, provided is a kit
comprising primers for miRNA markers and controls, and optionally
instructions for use in the method disclosed herein.
[0016] Other features and advantages of aspects and embodiments of
the present invention will become apparent from the following
detailed description and figures.
BRIEF DESCRIPTION OF THE FIGURES
[0017] FIG. 1 shows a) box plots of the median crossing point (Cp)
values with the 25th and 75th percentile for cel-miR-39 (used as an
extraction control), RNU6 and miR-16, reference markers others have
used to normalize miR results, and a panel of reference miRNA
(hsa-miR-425, 148b, and 30e) alone and combined with cel-miR-39
(arrow). Whiskers depict the 5th and 95th percentiles. Data bars
with ** were significantly different with p<0.001. The reference
miRNAs (hsa-miR-425, 148b, and 30e) were stably expressed and more
abundant than alternative reference miRNA (RNU6 or miR-16).
hsa-miR-425, 148b, and 30e were stably expressed in women with and
without endometriosis and used a reference miRNA to quantify
differential expression of circulating miRNA. b) Circulating levels
of reference miRNA used to standardize circulating levels of target
miRNA were stably expressed in both women from the control group
and in women with endometriosis. From analyses, hsa-miR-148b and
30e were the most reliable reference miRNA available to measure
normalized circulating miRNA levels and therefore were selected to
discriminate between women with endometriosis and controls in
exemplary embodiments of the application.
[0018] FIG. 2 shows the relative levels of eight different miRNA
(has-miR-199-3p, has-miR-143-3p, has-miR-340-5p, has-let-7b-5p,
has-miR-21-5p, has-miR-17-5p, has-miR-20a-5p, has-miR-103-3p) in
the plasma of women with surgically confirmed endometriosis and a
control group of women without endometriosis; the corresponding
area under the curve (AUC), sensitivity, specificity, positive
predictive value (PPV) and negative predictive value (NPV) are also
depicted for each miRNA that was differently expressed in women
with endometriosis compared to the control population.
[0019] FIG. 3 shows the Receiver Operator Characteristic curve for
each miRNA studied in exemplary embodiments of the application.
[0020] FIG. 4 shows the Receiver Operator Characteristic curves for
the combination of the eight miRNA with circulating levels that
were significantly different in women with endometriosis compared
to controls in exemplary embodiments of the application.
[0021] FIG. 5 shows the Receiver Operator Characteristic curves for
the combination of the five miRNA with circulating levels that were
significantly different in women with endometriosis compared to
controls with sensitivity and specificity of 0.96 and 0.79,
respectively, in exemplary embodiments of the application.
DETAILED DESCRIPTION OF THE INVENTION
[0022] In one aspect, a method of detecting the expression level of
miRNA markers in a biological sample obtained from a mammal is
provided, comprising: i) detecting the expression level of one or
more miRNA markers selected from the group of miR-199a-3p,
miR-143-3p, miR-340-5p, let-7b-5p, miR-21-5p, miR-17-5p, miR-20a-5p
and miR-103a-3p, in a biological sample obtained from the mammal;
ii) detecting the expression level of at least one miRNA reference
marker selected from miR-148b-3p and hsa-miR-30e-5p in the
biological sample obtained from the mammal; and iii) normalizing
the expression level of the miRNA marker(s) against the expression
level of the miRNA reference marker in the sample and in a control.
The method has been determined to be useful to diagnose
endometriosis in the mammal. The detection of lower expression
levels of the miRNA markers as compared to the miRNA controls is
indicative of endometriosis. In some embodiments, the miRNA markers
are circulating miRNA.
[0023] The term "mammal" is used herein to refer to both human and
non-human mammals including non-human primates and domestic
animals, e.g. cats, dogs and the like, livestock and undomesticated
animals.
[0024] The term "biological sample" as used herein is meant to
encompass any mammalian fluid or tissue sample that may contain
nucleic acids, such as miRNA. Suitable biological samples include,
but are not limited to: saliva, tears, sweat, blood (including
menses), serum, plasma, urine, peritoneal fluid, uterine fluid or
biopsied endometrial tissue. Any of these samples may be obtained
from the mammal in a manner well-established in the art.
[0025] The sequences of the miRNA markers to be detected in methods
of the present invention are readily available from relevant
sequence databases, e.g. NCBI and/or other sequence databases,
including both human and corresponding non-human sequences.
[0026] To conduct the present method, a suitable biological
sample(s) is obtained from a female mammal, and it is analyzed to
determine the expression level of selected miRNA markers in the
sample. As one of skill in the art will appreciate, the expression
level of each biomarker may be determined using one of several
techniques established in the art, including methods of quantifying
nucleic acids, such as PCR-based techniques, microarrays, gene
expression systems, and Northern or Southern blotting
techniques.
[0027] In one embodiment, PCR-based techniques (such as RT-PCR),
and Northern or Southern blotting techniques which generally
include the application of gel electrophoresis to isolate the
target nucleic acid, followed by hybridization with specific
labeled nucleic acid probes or primers. Primers for use in these
methods are designed based on the miRNA marker sequences to
specifically bind with the target miRNA, and comprise a
complementary sequence to a region of the target miRNA, or comprise
a complementary sequence to the full-length miRNA. Preferred primer
sequences for each miRNA marker comprise the following
sequences:
TABLE-US-00001 miR-340-5p, (SEQ ID NO: 1) uuauaaagcaaugagacugauu;
let-7b-5p, (SEQ ID NO: 2) ugagguaguagguugugugguu; miR-21-5p, (SEQ
ID NO: 3) uagcuuaucagacugauguuga; miR-17-5p, (SEQ ID NO: 4)
caaagugcuuacagugcagguag; miR-20a-5p, (SEQ ID NO: 5)
uaaagugcuuauagugcagguag; miR-103a-3p, (SEQ ID NO: 6)
agcagcauuguacagggcuauga; miR-199a-3p, (SEQ ID NO: 7)
acaguagucugcacauugguua; and miR-143-3p, (SEQ ID NO: 8)
ugagaugaagcacuguagcuc.
[0028] Quantitative reverse transcription PCR (RT-qPCR) to detect
expression levels of miRNA markers may comprise one or two steps.
Generally, the method comprises transcribing of the RNA into
complementary DNA (cDNA) by reverse transcriptase. The cDNA is then
used as the template for the qPCR reaction. One-step assays combine
reverse transcription and PCR in a single tube and buffer, using a
reverse transcriptase along with a DNA polymerase, and
sequence-specific PCR primers. In two-step assays, the reverse
transcription and PCR steps are performed in separate tubes, with
different optimized buffers, reaction conditions, and priming
strategies.
[0029] Suitable labels for use are well-known, and include, for
example, fluorescent, phosphorescent and luminescent (e.g.
chemiluminescent or bioluminescent) compounds, dyes, particles such
as colloidal gold chemiluminescent and radioactive labels.
[0030] The expression level of the selected miRNA markers in a
given sample may be detected individually or together using, for
example, biochip array technology. Generally, biochip arrays
provide a means to simultaneously determine the level of multiple
miRNA markers in a given sample. These arrays may utilize RT-PCR
technology and, thus, the biochip may be modified to incorporate
suitable primers.
[0031] Once the expression level of selected miRNA markers in a
biological sample of a mammal has been determined, these expression
levels are normalized based on the expression level of reference
miRNAs, i.e. miRNAs that are not differentially expressed in
mammals with endometriosis versus mammals without endometriosis
(control), in both the sample and a control. As one of skill in the
art will appreciate, control values may be of an individual mammal
that does not have endometriosis, or more likely, will be based on
the expression levels in a population that does not have
endometriosis. In some embodiments, the reference miRNA is selected
from hsa-miR-148b-3p and hsa-miR-30e-5p. In other embodiments, the
reference miRNA is hsa-miR-148b-3p and hsa-miR-30e-5p.
[0032] The expression level of reference miRNAs is detected using
the same methods used to detect the miRNA target sequences.
PCR-based techniques (such as RT-PCR) are used in one embodiment
using primers designed based on the miRNA marker sequences of the
reference miRNA, including a complementary sequence to a region of
the reference miRNA or to the full-length miRNA. Preferred primer
sequences for each miRNA marker comprise the following
sequences:
TABLE-US-00002 miR-148b-3p (SEQ ID NO: 9) ucagugcaucacagaacuuugu
miR-30e-5p (SEQ ID NO: 10) uguaaacauccuugacuggaa
[0033] In a method of diagnosing endometriosis in a mammal,
normalized expression levels of miRNA markers are compared to
control expression levels of miRNA markers. A mammal is diagnosed
with endometriosis when the expression levels of miRNA markers are
detected and are less than the expression level of the miRNA marker
control levels, e.g. at least about 10%, 20% 30%, 40% or 50% less
than the expression level of the miRNA marker control expression
levels.
[0034] Thus, a method of diagnosing endometriosis in a mammal is
provided comprising: i) detecting the expression level of at least
3 miRNA markers selected from the group of miR-199a-3p, miR-143-3p,
miR-340-5p, let-7b-5p, miR-21-5p, miR-17-5p, miR-20a-5p and
miR-103a-3p, in a biological sample obtained from the mammal; ii)
detecting the expression level of at least one miRNA reference
markers selected from miR-148b-3p and hsa-miR-30e-5p in the
biological sample obtained from the mammal; iii) normalize the
expression level of the miRNA markers based on the expression level
of miRNA reference markers in the sample and in a control; and iv)
diagnosing the mammal with endometriosis when the normalized
expression levels of the miRNA markers are less than the expression
level of the miRNA markers in the control.
[0035] In another embodiment, the miRNA markers comprise
miR-199a-3p, miR-143-3p, miR-340-5p, let-7b-5p, miR-21-5p,
miR-17-5p, miR-20a-5p and miR-103a-3p. In one preferred embodiment,
the miRNA markers comprise miR-17-5p, miR-20a-5p, miR-199a-3p,
miR-143-3p, and let-7b-5p. In another preferred embodiment, the
miRNA markers consist of miR-17-5p, miR-20a-5p, miR-199a-3p,
miR-143-3p, and let-7b-5p.
[0036] The present invention also provides a method of diagnosing
the stage or severity of endometriosis, including lesion analysis.
The greater the decrease in the expression level of the miRNA
markers in comparison to the control expression level of the miRNA
markers, the more severe the disease. Thus, a lesser decrease in
the expression level of miRNA markers in comparison to control
levels is indicative of stage I-II of endometriosis, e.g. a
decrease in miRNA marker expression in the range of 10-30% in
comparison to the expression level of miRNA marker controls.
Greater decreases in miRNA marker expression levels in comparison
to miRNA marker control expression levels (e.g. decreases of
greater than about 50%) is indicative of more severe disease, i.e.
stage III-IV endometriosis.
[0037] Disease progression may also be monitored using the present
method to detect miRNA marker expression levels over time. If the
marker expression levels do not change or increase over time, this
indicates that the disease is not progressing. If marker expression
levels are decreasing over time in comparison to control levels,
this is indicative of disease progression.
[0038] Once a mammal has been diagnosed with endometriosis, the
mammal can then be appropriately treated. In mild cases, the
appropriate treatment may be administration of a pain medication,
such as nonsteroidal anti-inflammatory drugs (NSAIDs), e.g.
ibuprofen or naproxen, to address painful cramps. Alternatively,
hormone therapy may be utilized to address the pain mild to
moderate endometriosis, including, hormonal contraceptives (birth
control pills, patches and vaginal rings); gonadotropin-releasing
hormone (Gn-RH) agonists and antagonists to block the production of
ovarian-stimulating hormones, lowering estrogen levels and
preventing menstruation, optionally in combination with a low dose
of estrogen or progestin to decrease menopausal side effects;
progestin therapy, e.g. such as an intrauterine device
(Mirena.TM.), contraceptive implant or contraceptive injection
(Depo-Provera.TM.); and steroid treatment (e.g. danazol) to
suppress the growth of the endometrium. For severe endometriosis,
treatment by surgery is appropriate.
[0039] In another aspect, a method to monitor response by a mammal
to treatment for endometriosis, including surgical or drug therapy
(e.g. hormone therapy), is also provided. The method of monitoring
a mammal following treatment of endometriosis comprises:
determining the normalized expression level of selected miRNA
markers in a sample from the mammal obtained prior to treatment
(pre-treatment) and in a sample obtained following treatment
(post-treatment). If the expression level of the miRNA markers in
the pre-treatment sample shows a greater decrease in comparison to
the expression level of the miRNA marker controls than the decrease
of the miRNA marker expression level in the post-treatment sample
in comparison to the miRNA marker control expression levels, this
indicates that the mammal is responding to the treatment.
[0040] Disease recurrence may also be monitored in a mammal
previously successfully treated for endometriosis using a method in
accordance with the invention. A method as used to diagnose
endometriosis in a first instance would be applicable.
[0041] In a further embodiment of the invention, a kit for use in
detecting endometriosis is provided comprising reactants for the
specific identification of selected miRNA markers, e.g. including
specific PCR primers for at least 3 miRNA markers selected from the
group of miR-199a-3p, miR-143-3p, miR-340-5p, let-7b-5p, miR-21-5p,
miR-17-5p, miR-20a-5p and miR-103a-3p, and an miRNA reference
marker selected from miR-148b-3p and hsa-miR-30e-5p. In preferred
embodiments, the kit comprises primers for the miRNA markers,
miR-17-5p, miR-20a-5p, miR-199a-3p, miR-143-3p, and let-7b-5p, or
primers for the miRNA markers, miR-199a-3p, miR-143-3p, miR-340-5p,
let-7b-5p, miR-21-5p, miR-17-5p, miR-20a-5p and miR-103a-3p, as
well as primers for the miRNA reference markers, miR-148b-3p and
miR-30e-5p.
[0042] The kit may be provided in the form of a biochip which
incorporates the primers for the selected miRNA markers at
pre-defined sites on a surface, e.g. bound to a suitable surface
onto which sample may be applied and detection of target miRNA
markers and reference markers may be detected. The primers may each
be associated with an indicator such that in the presence of the
targeted miRNA marker or reference marker, a detectable product or
signal is released, as above. The biochip may be adapted for use
with a blood sample, e.g. from a finger prick, or a menses
sample.
[0043] In another embodiment, a biochip adapted for the
electrochemical detection of circulating target miRNA markers is
provided. miRNA marker-specific primers are bonded to circuits,
e.g. an electrode, in a silicone microchip. When a target miRNA
from a sample binds to its specific primer, it alters the voltage
potential measured across the probe resulting in a measurable
electrical output that is detectable by transducers in the device
and which is proportional to the concentration of the miRNA marker
in the sample.
I. Definitions
[0044] Unless otherwise indicated, the definitions and embodiments
described in this and other sections are intended to be applicable
to all embodiments and aspects of the present application herein
described for which they are suitable as would be understood by a
person skilled in the art.
[0045] In understanding the scope of the present application, the
term "comprising" and its derivatives, as used herein, are intended
to be open ended terms that specify the presence of the stated
features, elements, components, groups, integers, and/or steps, but
do not exclude the presence of other unstated features, elements,
components, groups, integers and/or steps. The foregoing also
applies to words having similar meanings such as the terms,
"including", "having" and their derivatives. The term "consisting"
and its derivatives, as used herein, are intended to be closed
terms that specify the presence of the stated features, elements,
components, groups, integers, and/or steps, but exclude the
presence of other unstated features, elements, components, groups,
integers and/or steps. The term "consisting essentially of", as
used herein, is intended to specify the presence of the stated
features, elements, components, groups, integers, and/or steps as
well as those that do not materially affect the basic and novel
characteristic(s) of features, elements, components, groups,
integers, and/or steps.
[0046] Terms of degree such as "substantially", "about" and
"approximately" as used herein mean a reasonable amount of
deviation of the modified term such that the end result is not
significantly changed. These terms of degree should be construed as
including a deviation of at least .+-.5% of the modified term if
this deviation would not negate the meaning of the word it
modifies.
[0047] As used in this application, the singular forms "a", "an"
and "the" include plural references unless the content clearly
dictates otherwise.
[0048] The term "and/or" as used herein means that the listed items
are present, or used, individually or in combination. In effect,
this term means that "at least one of" or "one or more" of the
listed items is used or present.
[0049] Embodiments of the invention are described by reference to
the following Example(s) which are not to be construed as
limiting.
Example 1
[0050] Next generation sequencing (NGS) is a well established
method used for unbiased screening for the differential expression
of genes and miRNA. Using NGS, a panel of 24 novel candidate miRNA
were identified that were differentially expressed in plasma from
women with surgically confirmed endometriosis compared to a
population of women without surgical evidence of endometriosis.
Quantitative real time-polymerase chain reaction (qRT-PCR) was used
to validate differential expression of miRNA identified by NGS in a
novel cohort of women with surgically confirmed endometriosis.
[0051] miRseq NGS of plasma samples on four pooled groups of
samples collected during the early follicular phase as follows: 1)
women (n=5) with Stage I-II endometriosis; 2) women (n=5) with
Stage III-IV endometriosis; 3) women without endometriosis
(controls, n=5); and 4) women without endometriosis but endometrial
pathologies (e.g. adenomyosis, myomas, leiomyomas) (n=5). From this
preliminary study, plasma levels of 69 candidate miRNAs were
differentially expressed in women with endometriosis compared to
the control group.
[0052] Results from NGS were subsequently validated using qRT-PCR
to quantify novel candidate miRNA levels in 45 women with (n=30) or
without (n=15) surgically confirmed endometriosis. Twenty miRNAs
identified by NGS were differentially expressed (p 0.01 and 2 fold
change) in cases vs. controls by qRT-PCR. Additional miRNAs were
determined to be differentially expressed in endometrial tissue of
women with endometriosis compared to controls and included to yield
a final panel of 25 candidate miRNAs for further evaluation as
shown in Table 1.
TABLE-US-00003 TABLE 1 List of candidate miRNA biomarkers and
controls # miRNA ID Assay Catalog # miRNA markers 1 hsa-miR-150-5p
YP00204660 of endometriosis 2 hsa-miR-199a-3p YP00204536 evaluated
in 3 hsa-miR-143-3p YP00205992 this study 4 hsa-miR-199a-5p
YP00204494 5 hsa-miR-335-3p YP00205613 6 hsa-miR-381-3p YP00205887
7 hsa-miR-224-5p YP00204641 8 hsa-miR-340-5p YP00206068 9
hsa-let-7d-3p YP00205627 10 hsa-miR-92a-3p YP00204258 11
hsa-miR-221-3p YP00204532 12 hsa-miR-486-5p YP00204001 13
hsa-let-7b-5p YP00204750 14 hsa-miR-122-5p YP00205664 15
hsa-miR-21-5p YP00204230 16 hsa-miR-133a-3p YP00204788 17
hsa-miR-148a-5p YP00204188 18 hsa-let-7a-3p YP00206084 19 put-miR-5
YCP0043333 20 put-miR-27 YCP0043336 21 hsa-miR-125b-5p YP00205713
22 hsa-miR-17-5p YP00204771 23 hsa-miR-20a-5p YP00204292 24
hsa-miR-3613-5p YP02119046 25 hsa-miR-103a-3p YP00204063 Reference
26 hsa-miR-30e-5p YP00204714 miRNA 27 hsa-miR-148b-3p YP00204047
Extraction 28 cel-miR-39-3p YP00203952 control Template 29 unisp3
YP02119288 control 30 unisp6 YP00203954
Example 2
[0053] Plasma samples from another unique cohort of women with
surgically confirmed endometriosis (n=53) and disease-free controls
(n=53) were collected for the validation study. Because lysis of
red blood cells and even small amounts of hemolysis can confound
results, plasma samples were checked for hemolysis using
spectrophotometry. Absorbance results 0.2 indicated absence of
hemolysis. In addition, as a further check for hemolysis, qRT-PCR
was used to determine the ratio of miR-23a and miR-451. Cycle
quantification 7.0 for miR-23a and miR-451 was considered to
indicate lack of hemolysis, and samples having this Cq were
included for candidate miRNA analysis.
[0054] miRNA signatures were quantified by qRT-PCR in
hemolysis-free plasma samples of cases (n=25) and controls (n=28)
using miRCURY LNA miRNA assay. Custom PCR panels were prepared and
included candidate miRNA marker primers and miRNA reference primers
for extraction, cDNA synthesis, and qPCR efficiency.
[0055] A group of three candidate reference miRNA with levels that
were believed to be stable across all women with endometriosis and
controls, namely, hsa-miR-103a-3p, hsa-miR-148b-3p and
hsa-miR-30e-5p, were also found not to be influenced by the course
of the menstrual cycle. By further checking expression differences
between two groups for each of these candidate reference miRNAs,
hsa-miR-103a-3p was found to be differentially expressed in women
with endometriosis compared to the control group of women without
endometriosis, and thus, was excluded as a control. Therefore, two
miRNAs (hsa-miR-148b-3p and hsa-miR-30e-5p) were chosen as internal
reference miRNA. Reference miRNAs with stable and equivalent plasma
levels in women with endometriosis and controls were used to
standardize/normalize circulating plasma miRNA results in which
confounding from hemolysis was excluded.
[0056] FIG. 1 shows a comparison of the reference miRNA used to
standardize circulating levels of target miRNA to discriminate
between women with endometriosis and controls, using reference
miRNA (has-miR-148-3p and has-miR-30e-5p) that expressed at
equivalent levels in the plasma of women with surgically confirmed
endometriosis and a control group of women without endometriosis.
In FIG. 1a, box plots are shown to compare the median crossing
point (Cp) values with the 25th and 75th percentile for cel-miR-39
(used as an extraction control), and different reference miRNA
including RNU6 and miR-16 used by other investigators to normalize
miR results, and reference miRNA (hsa-miR-425, 148b, and 30e) alone
and combined with cel-miR-39 (arrow). Whiskers depict the 5th and
95th percentiles. Data bars with ** were significantly different
with p<0.001. In comparison to reference miRNA used by other
investigators (RNU6 and miR-16), reference miRNAs hsa-miR-425,
148b, and 30e were stably expressed and more abundant than
alternative reference miRNA (RNU6 or miR-16). Therefore,
hsa-miR-425,148b, and 30e were stably expressed in women with and
without endometriosis and hsa-miR-148b and 30e as reference miRNA
to quantify differential expression of circulating miRNA.
[0057] In FIG. 1b, circulating levels of reference miRNA used to
standardize circulating levels of target miRNA were shown to be
stably expressed in both women from the control group and in women
with endometriosis. In particular, the mean Cq values for
hsa-miR-148b-3p and hsa-miR-30e-5p showed no significant
differences between women with endometriosis and the control group
(p=0.894). The Cq value or cycle quantification value is the PCR
cycle number at which the sample's reaction curve intersects the
threshold line. This value expresses how many cycles it takes to
detect a real signal from the sample. Real-Time PCR runs will have
a reaction curve for each sample, and therefore many Cq values. The
mean Cq value for the combination of hsa-miR-148b-3p,
hsa-miR-30e-5p and hsa-miR-103a-3p was (p=0.838). However, the
plasma levels of hsa-miR-103a-3p was significantly different
between the two groups (p=0.007) when it was compared to three
candidate reference gene average Cq values (including its own) or
when it was compared to the other two candidate reference gene mean
Cq values. Consequently, hsa-miR-103a-3p was excluded as a
reference gene but included in all subsequent comparisons as a
candidate marker of endometriosis. Furthermore, the mean Cq values
of the two reference miRNAs (hsa-miR-148b-3p and hsa-miR-30e-5p)
were used as reference miRNAs (in FIG. 1) to standardize miRNA
results in women with endometriosis compared to the control
group.
[0058] Differences in miRNA expression between cases and controls
was determined by the Mann-Whitney U test with a p value 0.05,
considered significant. Circulating levels of eight miRNAs
(miR-199a-3p, miR-143-3p, miR-340-5p, let-7b-5p, miR-21-5p,
miR-17-5p, miR-20a-5p, miR-103a-3p) were determined to be
significantly lower in cases compared to controls. FIG. 2 shows a
comparison of the miRNA levels for each of the eight-target miRNA
in this diagnostic panel) which were significantly different in
women with endometriosis compared to control samples.
[0059] In order to define the diagnostic potential of each of the
eight miRNAs with significantly different plasma levels, ROC curves
were generated. FIG. 3 demonstrates a Receiver Operator
Characteristic (ROC) for each of the eight-target miRNAs in the
endometriosis diagnostic panel. The sensitivity and specificity for
individual miRNAs (miR-199a-3p, 0.84 and 0.61; miR-143-3p, 0.44 and
1.00; miR-340-5p, 0.88 and 0.54; let-7b-5p, 0.60 and 0.71;
miR-21-5p, 1.0 and 0.36; miR-17-5p, 0.84 and 0.86; miR-20a-5p, 0.76
and 0.76; and miR-103a-3p, 0.72 and 0.75) ranged between 0.44-1.00
and 0.36-1.00, respectively.
[0060] Sensitivity and specificity, and PPV and NPV, of a panel
including all 8 miRNAs, was determined. FIG. 4 shows the combined
ROC for all eight-target miRNA in the diagnostic panel. Logistic
regression of delta Cq values followed by ROC curve analysis for
the eight miRNAs with plasma levels that differed between cases
compared to controls produced AUC, optimal Youden Index, cut off,
sensitivity, specificity, PPV and NPV for each combination. It was
found that the combination of all eight miRNAs provided AUC of
0.9486, sensitivity and specificity of 0.92 and 0.86, with PPV and
NPV of 0.85 and 0.92, respectively.
[0061] Narrowing the panel by combining five miRNAs (miR-17-5p,
miR-20a-5p, miR-199a-3p, miR-143-3p, and let-7b-5p) produced
produced an epigenetic signature with sensitivity and specificity
of 0.96 and 0.79 with PPV and NPV values of 0.80 and 0.96,
respectively. FIG. 5 shows the combined ROC for five-target miRNA
in the diagnostic panel.
[0062] Therefore, several miRNAs were found to be differentially
expressed in the plasma of women with endometriosis compared to a
control population of women without endometriosis. Furthermore, the
combination of five specific miRNAs identified in this application
had sensitivity and specificity equivalent to laparoscopy in the
diagnosis of endometriosis and can be used as a replacement test to
diagnosis endometriosis, reducing the need for laparoscopy and
mitigating surgical risk in this patient population.
[0063] While the present application has been described with
reference to examples, it is to be understood that the scope of the
claims should not be limited by the embodiments set forth in the
examples but should be given the broadest interpretation consistent
with the description as a whole.
[0064] All publications, patents and patent applications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety. Where a term in the present application
is found to be defined differently in a document incorporated
herein by reference, the definition provided herein is to serve as
the definition for the term.
REFERENCES
[0065] Agarwal S K, Chapron C, Giudice L C, Laufer M R, Leyland N,
Missmer S A, Singh S S, and Taylor H S. Clinical diagnosis of
endometriosis: a call to action. Am J Obstet Gynecol 2019: 220;
354.e351-354.e312. [0066] Bartel D P. MicroRNAs: genomics,
biogenesis, mechanism, and function. Cell 2004: 116; 281-297.
[0067] Bartel D P. MicroRNAs: target recognition and regulatory
functions. cell 2009: 136; 215-233. [0068] Bashti O, Noruzinia M,
Garshasbi M, and Abtahi M. miR-31 and miR-145 as Potential
Non-Invasive Regulatory Biomarkers in Patients with Endometriosis.
Cell J 2018: 20; 293. [0069] Bockaj M, Fung B, Tsoulis M, Foster W
G, and Soleymani L. Method for Electrochemical Detection of Brain
Derived Neurotrophic Factor (BDNF) in Plasma. Anal Chem 2018: 90;
8561-8566. [0070] Burney R O and Giudice L C. Pathogenesis and
pathophysiology of endometriosis. Fertility and sterility 2012: 98;
511-519. [0071] Cho S, Mutlu L, Grechukhina O, and Taylor H S.
Circulating microRNAs as potential biomarkers for endometriosis.
Fertil Steril 2015: 103; 1252-1260 e1251. [0072] Cosar E,
Mamillapalli R, Ersoy G S, Cho S, Seifer B, and Taylor H S. Serum
microRNAs as diagnostic markers of endometriosis: a comprehensive
array-based analysis. Fertil Steril 2016. [0073] Fadhlaoui A,
Gillon T, Lebbi I, Bouquet de Joliniere J, and Feki A.
Endometriosis and vesico-sphincteral disorders. Frontiers in
surgery 2015: 2; 23. [0074] Fassbender A, Burney R O, O D F,
D'Hooghe T, and Giudice L. Update on Biomarkers for the Detection
of Endometriosis. Biomed Res Int 2015: 2015; 130854. [0075]
Fuldeore M, Yang H, Du E X, Soliman A M, Wu E Q, and Winkel C.
Healthcare utilization and costs in women diagnosed with
endometriosis before and after diagnosis: a longitudinal analysis
of claims databases. Fertility and sterility 2015: 103; 163-171.
Giudice LC. Endometriosis. New England Journal of Medicine 2010:
362; 2389-2398. [0076] Jia S-z, Yang Y, Lang J, Sun P, and Leng J.
Plasma miR-17-5p, miR-20a and miR-22 are down-regulated in women
with endometriosis. Human reproduction 2012: 28; 322-330. [0077]
Jia S Z, Yang Y, Lang J, Sun P, and Leng J. Plasma miR-17-5p,
miR-20a and miR-22 are down-regulated in women with endometriosis.
Hum. Reprod. 2013: 28; 322-330. [0078] May K E, Conduit-Hulbert S
A, Villar J, Kirtley S, Kennedy S H, and Becker C M. Peripheral
biomarkers of endometriosis: a systematic review. Hum. Reprod.
Update. 2010: 16; 651-674. [0079] May K E, Villar J, Kirtley S,
Kennedy S H, and Becker C M. Endometrial alterations in
endometriosis: a systematic review of putative biomarkers. Hum.
Reprod. Update. 2011: 17; 637-653. [0080] Nisenblat V, Bossuyt P M,
Shaikh R, Farquhar C, Jordan V, Scheffers C S, Mol B W, Johnson N,
and Hull M L. Blood biomarkers for the non-invasive diagnosis of
endometriosis. Cochrane Database Syst Rev 2016: 5; CD012179. [0081]
Nisenblat V, Sharkey D J, Wang Z, Evans S F, Healey M, Ohlsson
Teague E M C, Print C G, Robertson S A, and Hull M L. Plasma
microRNAs display limited potential as diagnostic tools for
endometriosis. J Clin Endocrinol Metab 2019. [0082] Nnoaham K E,
Hummelshoj L, Webster P, d'Hooghe T, de Cicco Nardone F, de Cicco
Nardone C, Jenkinson C, Kennedy S H, Zondervan K T, and Study
WERFG. Impact of endometriosis on quality of life and work
productivity: a multicenter study across ten countries. Fertility
and sterility 2011: 96; 366-373. e368. [0083] Nothnick W B, Falcone
T, Joshi N, Fazleabas A T, and Graham A. Serum miR-451a Levels Are
Significantly Elevated in Women With Endometriosis and
Recapitulated in Baboons (Papio anubis) With Experimentally-Induced
Disease. Reprod Sci 2017: 24; 1195-1202. [0084] Rekker K, Saare M,
Roost A M, Kaart T, Soritsa D, Karro H, Soritsa A, Simon C,
Salumets A, and Peters M. Circulating miR-200-family micro-RNAs
have altered plasma levels in patients with endometriosis and vary
with blood collection time. Fertil Steril 2015: 104; 938-946 e932.
[0085] Rogers P A, Adamson G D, Al-Jefout M, Becker C M, D'Hooghe
T.sub.M, Dunselman G A, Fazleabas A, Giudice L C, Home A W, Hull M
L, et al. Research Priorities for Endometriosis. Reprod Sci 2017:
24; 202-226. [0086] Shah D K, Correia K F, Vitonis A F, and Missmer
S A. Body size and endometriosis: results from 20 years of
follow-up within the Nurses' Health Study II prospective cohort.
Hum. Reprod. 2013. [0087] Sueta A, Yamamoto Y, Tomiguchi M,
Takeshita T, Yamamoto-Ibusuki M, and Iwase H. Differential
expression of exosomal miRNAs between breast cancer patients with
and without recurrence. Oncotarget 2017: 8; 69934-69944. [0088]
Tamaresis J S, Irwin J C, Goldfien G A, Rabban J T, Burney R O,
Nezhat C, DePaolo L V, and Giudice L C. Molecular classification of
endometriosis and disease stage using high-dimensional genomic
data. Endocrinology 2014: 155; 4986-4999. [0089] Taylor H S,
Adamson G D, Diamond M P, Goldstein S R, Home A W, Missmer S A,
Snabes M C, Surrey E, and Taylor R N. An evidence-based approach to
assessing surgical versus clinical diagnosis of symptomatic
endometriosis. Int J Gynaecol Obstet 2018: 142; 131-142. [0090]
Wang M, Gu H, Wang S, Qian H, Zhu W, Zhang L, Zhao C, Tao Y, and Xu
W. Circulating miR-17-5p and miR-20a: molecular markers for gastric
cancer. Molecular medicine reports 2012: 5; 1514-1520. [0091] Wang
W-T, Zhao Y-N, Han B-W, Hong S-J, and Chen Y-Q. Circulating
microRNAs identified in a genome-wide serum microRNA expression
analysis as noninvasive biomarkers for endometriosis. The Journal
of Clinical Endocrinology & Metabolism 2013: 98; 281-289.
Sequence CWU 1
1
10122RNAHomo sapiens 1uuauaaagca augagacuga uu 22222RNAHomo sapiens
2ugagguagua gguugugugg uu 22322RNAHomo sapiens 3uagcuuauca
gacugauguu ga 22423RNAHomo sapiens 4caaagugcuu acagugcagg uag
23523RNAHomo sapiens 5uaaagugcuu auagugcagg uag 23623RNAHomo
sapiens 6agcagcauug uacagggcua uga 23722RNAHomo sapiens 7acaguagucu
gcacauuggu ua 22821RNAHomo sapiens 8ugagaugaag cacuguagcu c
21922RNAHomo sapiens 9ucagugcauc acagaacuuu gu 221021RNAHomo
sapiens 10uguaaacauc cuugacugga a 21
* * * * *