U.S. patent application number 17/033443 was filed with the patent office on 2021-04-29 for compositions and methods for treating spinal muscular atrophy.
The applicant listed for this patent is Genzyme Corporation. Invention is credited to Seng H. CHENG, Catherine R. O'RIORDAN, Marco A. PASSINI, Lamya S. SHIHABUDDIN.
Application Number | 20210121523 17/033443 |
Document ID | / |
Family ID | 1000005324426 |
Filed Date | 2021-04-29 |
United States Patent
Application |
20210121523 |
Kind Code |
A1 |
PASSINI; Marco A. ; et
al. |
April 29, 2021 |
COMPOSITIONS AND METHODS FOR TREATING SPINAL MUSCULAR ATROPHY
Abstract
The present provides methods for treating spinal muscular
atrophy using a self-complementary recombinant adeno-associated
virus (rAAV) viral particle comprising a transgene expressing SMN.
In one aspect, the viral particles are administered in the spinal
column or cisterna magna in a human subject; for example, a
pediatric human subject. Viral particles comprising AAV9 capsids
are contemplated.
Inventors: |
PASSINI; Marco A.;
(Northborough, MA) ; SHIHABUDDIN; Lamya S.;
(Brighton, MA) ; O'RIORDAN; Catherine R.;
(Bridgewater, NJ) ; CHENG; Seng H.; (Natick,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Genzyme Corporation |
Cambridge |
MA |
US |
|
|
Family ID: |
1000005324426 |
Appl. No.: |
17/033443 |
Filed: |
September 25, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14888385 |
Feb 8, 2016 |
10821154 |
|
|
PCT/US2013/039163 |
May 1, 2013 |
|
|
|
17033443 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/1709 20130101;
A61K 48/0058 20130101; C12N 2750/14143 20130101; A61K 9/0085
20130101; A61K 48/00 20130101; C12N 2750/14141 20130101; A61K
9/0019 20130101; A61K 48/0075 20130101; C12N 2750/14171
20130101 |
International
Class: |
A61K 38/17 20060101
A61K038/17; A61K 48/00 20060101 A61K048/00; A61K 9/00 20060101
A61K009/00 |
Claims
1. A method for treating spinal muscular atrophy in a primate with
spinal muscular atrophy, comprising administering to the spinal
cord and/or cisterna magna of the primate at least
1.times.10.sup.12 genome copies of a recombinant adeno-associated
virus (rAAV) viral particle comprising a vector encoding a primate
SMN; wherein the rAAV viral particle comprises an AAV1, AAV2, AAV3,
AAV4, AAVS, AAV6, AAV7, AAV8, AAVrh8, AAV10, AAVrh10, AAV11, or
AAV12 serotype capsid.
2. A method for ameliorating a symptom of spinal muscular atrophy
in a primate, comprising administering to the spinal cord and/or
cisterna magna of the primate at least 1.times.10.sup.12 genome
copies of a recombinant adeno-associated virus (rAAV) viral
particle comprising a vector encoding a primate SMN; wherein the
rAAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAVS,
AAV6, AAV7, AAV8, AAVrh8, AAV10, AAVrh10, AAV11, or AAV12 serotype
capsid.
3. The method of claim 2, wherein the symptom of spinal muscular
atrophy is one or more of muscle wasting, inability to achieve
motor milestones, inability to sit, inability to walk, paralysis,
respiratory dysfunction, bulbar dysfunction, motor neuron cell loss
and neuromuscular junction pathology.
4. A method for delivering a heterologous transgene encoding a
primate SMN in a motor neuron in a primate with spinal muscular
atrophy, comprising administering to the spinal cord and/or
cisterna magna of the primate at least 1.times.10.sup.12 genome
copies of a recombinant adeno-associated virus (rAAV) viral
particle comprising a vector encoding a primate SMN; wherein the
rAAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAVS,
AAV6, AAV7, AAV8, AAVrh8, AAV10, AAVrh10, AAV11, or AAV12 serotype
capsid.
5. The method of claim 4, wherein at least 10-30% of the motor
neurons in the lumbar, thoracic and cervical regions of the spinal
cord are transduced and/or wherein at least 30% of SMN wild type
levels are generated throughout the spinal cord.
6. (canceled)
7. The method of claim 4, wherein the rAAV is administered via
direct injection into the spinal cord, via intrathecal injection,
or via intracisternal injection.
8-9. (canceled)
10. The method of claim 4, wherein the rAAV is administered to one
or more of a lumbar subarachnoid space, thoracic subarachnoid space
and a cervical subarachnoid space of the spinal cord or the
cisterna magna.
11. (canceled)
12. The method of any one of claim 4, wherein at least
3.5.times.10.sup.11 genome copies per kg body weight, at least
3.5.times.10.sup.12 genome copies per kg body weight, at least
5.times.10.sup.12 genome copies per kg body weight, or at least
5.times.10.sup.13 genome copies per kg body weight of rAAV is
administered to the primate; or wherein at least
2.5.times.10.sup.12 genome copies or at least 1.25.times.10.sup.13
genome copies are administered to the primate.
13-20. (canceled)
21. The method of claim 4, wherein the vector comprises AAV1, AAV2,
AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10,
AAV11, or AAV12 serotype inverted terminal repeats (ITRs).
22-26. (canceled)
27. The method of claim 4, wherein the vector is a
self-complimenting vector.
28-29. (canceled)
30. The method of claim 4, wherein the vector encodes a SMN-1
transgene operably linked to a promoter.
31. The method of claim 30, wherein the promoter is capable of
expressing the SMN-1 transgene in neurons of the spinal cord.
32. (canceled)
33. The method of claim 4, wherein the promoter comprises a human
.beta.-glucuronidase promoter or a cytomegalovirus enhancer linked
to a chicken .beta.-actin promoter.
34-35. (canceled)
36. The method of claim 4, wherein the vector comprises a
polynucleotide encoding the amino acid sequence of SEQ ID NO:1.
37-38. (canceled)
39. The method of claim 4, wherein the primate is a human.
40. The method of claim 39, wherein the human is a pediatric
subject or a young adult.
41-46. (canceled)
47. The method of any one of claim 4, wherein the rAAV viral
particle is in a pharmaceutical composition.
48. (canceled)
Description
FIELD OF THE INVENTION
[0001] The present invention relates to AAV vectors and methods of
using AAV vectors for treating spinal muscular atrophy.
BACKGROUND OF THE INVENTION
[0002] Spinal muscular atrophy (SMA) is an autosomal recessive
neuromuscular disorder caused by mutations in the survival motor
neuron 1 (SMN1) gene. Resultant deficiency in the encoded 294-amino
acid SMN protein leads to presentation of a spectrum of disease
characteristics. These include progressive muscular weakness and
atrophy, respiratory insufficiency and premature death resulting
from the degeneration of motor neurons in the spinal cord. Disease
severity is inversely correlated with the copy number of a
paralogue gene, SMN2, by virtue of the ability of this ancillary
gene to direct the production of approximately 10-20% functional
SMN.
[0003] Based on the current understanding for the underlying
molecular basis of the disease, a number of therapeutic strategies
aimed at increasing the levels of functional SMN in the more
disease-prone cells are being considered.
[0004] However, despite the development of these therapeutic
strategies, successful translation of these concepts to clinical
efficacy has remained difficult. Therefore, there is a need for
developing further compositions and methods to treat spinal
muscular atrophy in human patients.
BRIEF SUMMARY OF THE INVENTION
[0005] In some aspects, the invention provides methods for treating
spinal muscular atrophy in a primate, comprising administering to
the spinal cord and/or cisterna magna of the primate at least
1.times.10.sup.12 genome copies of a recombinant adeno-associated
virus (rAAV) viral particle comprising a vector encoding a primate
SMN.
[0006] In some aspects, the invention provides methods for
ameliorating a symptom of spinal muscular atrophy in a primate,
comprising administering to the spinal cord and/or cisterna magna
of the primate at least 1.times.10.sup.12 genome copies of a
recombinant adeno-associated virus (rAAV) viral particle comprising
a vector encoding a primate SMN. In some embodiments, the symptom
of spinal muscular atrophy is one or more of muscle wasting ,
inability to achieve motor milestones, inability to sit, inability
to walk, paralysis, respiratory dysfunction, bulbar dysfunction,
motor neuron cell loss and neuromuscular junction pathology.
[0007] In some aspects, the invention provides methods for
delivering a heterologous transgene encoding a primate SMN in a
motor neuron in a primate, comprising administering to the spinal
cord and/or cisterna magna of the primate at least
1.times.10.sup.12 genome copies of a recombinant adeno-associated
virus (rAAV) viral particle comprising a vector encoding a primate
SMN.
[0008] In some embodiments of the above aspects, at least 10-30% of
the motor neurons in the lumbar, thoracic and cervical regions of
the spinal cord are transduced. In some embodiments, more than
about any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%. 70%, 75% or 100% of motor neurons throughout the spinal
cord are transduced. In some embodiments, at least 30% of SMN wild
type levels are generated throughout the spinal cord. In some
embodiments of the invention, administration to the spinal cord
and/or cisterna magna of an AAV viral particle comprising a
transgene encoding a primate SMN results in expression of at least
about any of 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95% or 100% of levels of SMN expression in a
normal individual.
[0009] In some embodiments of the above aspects, the rAAV is
administered via direct injection into the spinal cord, via
intrathecal injection, or via intracisternal injection. In some
embodiments, the rAAV is administered to more than one location of
the spinal cord or cisterna magna. In some embodiments, the rAAV is
administered to more than one location of the spinal cord. In some
embodiments, the rAAV is administered to one or more of a lumbar
subarachnoid space, thoracic subarachnoid space and a cervical
subarachnoid space of the spinal cord. In some embodiments, the
rAAV is administered to the cisterna magna. In some embodiments,
multiple injections of the rAAV are simultaneous or sequential. In
some embodiments, sequential injections are within one, two, three,
six, nine, twelve or 24 hours of each other.
[0010] In some embodiments of the above aspects, at least
3.5.times.10.sup.11 genome copies per kg body weight of rAAV is
administered to the primate. In further embodiments, at least
3.5.times.10.sup.12 genome copies per kg body weight of rAAV is
administered to the primate. In some embodiments, at least
5.times.10.sup.12 genome copies per kg body weight of rAAV is
administered to the primate. In further embodiments, at least
5.times.10.sup.13 genome copies per kg body weight of AAV is
administered to the primate. In some embodiments, at least
2.5.times.10.sup.12 genome copies are administered to the primate.
In other embodiments, at least 1.25.times.10.sup.13 genome copies
are administered to the primate.
[0011] In some embodiments of the above aspects, the AAV viral
particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7,
AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, or AAV12 serotype
capsid. In further embodiments, the rAAV viral particle comprises
an AAV serotype 9 capsid. In some embodiments, the rAAV viral
particle comprises an AAV serotype capsid from Clades A-F.
[0012] In some embodiments of the above aspects, the vector
comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8,
AAV9, AAV10, AAVrh10, AAV11, or AAV12 serotype inverted terminal
repeats (ITRs). In further embodiments, the vector comprises AAV
serotype 2 ITRs. In other embodiments, the rAAV viral particle
comprises an AAV serotype capsid from Clades A-F. In further
embodiments, the ITR and the capsid are derived from the same AAV
serotype. In other embodiments, the ITR and the capsid are derived
from different AAV serotypes. In some embodiments of the invention,
the rAAV viral particle comprises an AAV-9 capsid, and wherein the
vector comprises AAV2 ITRs.
[0013] In some embodiments of the above aspects, the vector is a
self-complimenting vector. In some embodiments, the vector
comprises a first heterologous polynucleotide sequence encoding a
SMN-1 transgene and a second heterologous polynucleotide sequence
encoding a complement of the SIM-1 transgene, wherein the first
heterologous polynucleotide sequence can form intrastrand base
pairs with the second polynucleotide sequence along most or all of
its length. In further embodiments. the first heterologous
polynucleotide sequence and the second heterologous polynucleotide
sequence are linked by a mutated AAV ITR. wherein the mutated AAV
ITR comprises a deletion of the D region and comprises a mutation
of the terminal resolution sequence.
[0014] In some embodiments of the above aspects, the SMN-1
transgene is operably linked to a promoter. In further embodiments,
the promoter is capable of expressing the SMN-1 transgene in
neurons of the spinal cord. In other embodiments, the promoter is
capable of expressing the SMN-1 transgene in motor neurons of the
spinal cord. In yet further embodiments, the promoter comprises a
human .beta.-glucuronidase promoter or a cytomegalovirus enhancer
linked to a chicken .beta.-actin promoter.
[0015] In some embodiments of the above aspects, the SMN-1
transgene is a human SMN-1 transgene. In further embodiments, the
SMN comprises the amino acid sequence of SEQ ID NO:1. In further
embodiments, the vector comprises a polynucleotide encoding the
amino acid sequence of SEQ ID NO:1. In other embodiments, the
polynucleotide comprises the nucleic acid sequence of SEQ ID NO:2,
SEQ ID NO:3 or SEQ ID NO:4. In other embodiments, the AAV viral
particle comprises a recombinant viral genome derived from the
polynucleotide of SEQ ID NO:5 or SEQ ID NO:6.
[0016] In some embodiments of the above aspects, the primate is a
human. In further embodiments, the human is a pediatric subject. In
other embodiments, the human is a young adult. In some embodiments,
the human has spinal muscular atrophy. In some embodiments, the
primate has a mutation in the endogenous SMN-1 gene. In some
embodiments, the primate has a partial deletion of the endogenous
SMN 1 gene. In some embodiments, the primate has a complete
deletion of the endogenous SMN-1 gene. In some embodiments, the
expression of the mutant SMN-1 gene in spinal cord or brain of the
primate is deficient compared to expression of SMN-1 in a primate
with a wild-type SMN-1 gene.
[0017] In some embodiments of the above aspects, the rAAV viral
particle is in a pharmaceutical composition. In some embodiments,
the pharmaceutical composition further comprises a pharmaceutically
acceptable carrier.
[0018] It is to be understood that one, some, or all of the
properties of the various embodiments described herein may be
combined to form other embodiments of the present invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. All publications, patents, and patent applications
cited herein are hereby incorporated by reference in their entirety
for all purposes.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 shows the amino acid sequence of SMN protein (SEQ ID
NO:1).
[0020] FIG. 2 shows a non-optimized nucleic acid sequence of hSMN 1
(SEQ ID
[0021] FIG. 3 shows an optimized nucleic acid sequence of hSMN 1
(SEQ ID NO:3).
[0022] FIG. 4 shows an optimized nucleic acid sequence of hSMN1
(SEQ ID NO:4).
[0023] FIG. 5 shows a plasmid map of pscAAV-GUSB hSMN1.
[0024] FIG. 6 shows the nucleic acid sequence for pscAAV-GUSB hSMN1
(SEQ ID NO:5).
[0025] FIG. 7 shows a plasmid map of pscAAV-minCBA hSMN1.
[0026] FIG. 8 shows the nucleic acid sequence for pscAAV-minCBA
hSMN1 (SEQ ID NO:6).
[0027] FIG. 9 shows a series of graphs that demonstrate the effect
of viral dose on SMN levels and efficacy in SMA mice, A) Western
blot analysis of tissue homogenates from the lumbar, thoracic, and
cervical regions showed a dose response with the highest dose
producing the greatest level of SMN. B) Co-localization studies of
hSMN and the motor neuron marker, ChAT on frozen tissue sections
allowed for a determination of the efficiency of motor neuron
transduction in the lumbar and thoracic segments. However, the low
levels of hSMN, regardless of dose, noted in the cervical cord
precluded scoring motor neuron transduction in this region. C) The
number of motor neurons (ChAT-positive) per hemisphere for all
three spinal cord regions. D) The average cross-sectional areas of
myofibers from the quadriceps, intercostal, and diaphragm.
Statistics *p<0.05; **p<0.01; ***p<0.001.
[0028] FIG. 10 shows a series of immunohistochemistry images
demonstrating the efficiency of scAAV9-hSMN1-mediated transduction
of motor neurons in SMA mice. A subset of cells in the ventral horn
of the lumbar region stained positively for SMN (left column) and
were co-localized in cells that also stained positively for ChAT
(middle column) as indicated by the merged picture (right column).
A) Sections from animals that had been treated with 5e10 genome
copies (gc), B) 1e10 gc and C) 1e9 gc. D) Untreated SMA mice did
not contain detectable levels of SMN immuno-positive cells. Scale
bar, 0.25 mm.
[0029] FIG. 11 shows the effect of viral dose on motor function and
survival in SMA mice. Graphs showing A) measurements of grip
strengths, B) righting reflexes, and C) body weights, at 14 days
(left column) and 175 days (right column) post-injection. D) The
Kaplan-Meier survival curve showed median survival of 153 days
(P<0.0001), 70 days (P<0.0001), and 18 days (P>0.05) for
SMA mice treated with doses of 5e10 gc (n=20), 1e10 gc (n=23), 1e9
gc (n=16) of scAAV9-hSMN1, respectively. Control SMA mice treated
with matched volumes of saline (n=21.) produced a median survival
of 17 days. Statistics: *p<0.05; **p<0.01:***p<0.001.
[0030] FIG. 12 shows intrathecal delivery of scAAV9-eGFP into
juvenile farm pigs. A) At 35 days post-treatment with either saline
or scAAV9-eGFP, the pig spinal cord was dissected in its entirety
and each segment identified. B) Analysis of lumbar segment 2 (L2)
from the saline-treated pig showed no GFP expression. C and D) In
contrast, scAAV9-eGFP treated pigs showed robust expression of GFP
in the ventral horn, as exemplified by C) L2 and D) cervical
segment 8 (C8). E-G) Double IHC staining with ChAT showed a
co-localization of GFP with ChAT signal in E) C8, F) thoracic
segment 8 (T8), and G) L2. H) A comprehensive analysis of the
double-labeled cells along the rostro-caudal axis of the spinal
cord showed that many of the segments had 10-30% motor neuron
transduction. Scale bars: 0.2 mm (B-D), 0.1 mm (E-G).
[0031] FIG. 13 shows intrathecal delivery of scAAV9-eGFP into
juvenile cynomolgus monkeys. A) Analysis of frozen tissue sections
from animals administered saline did not produce detectable GFP
staining. In contrast, monkeys treated with either a combination of
B) cisterna magna and lumbar injections or C) cisterna magna alone
injections of scAAV9-eGFP resulted in robust GFP staining in the
ventral horn of lumbar segment 6. Double IHC for D) GFP and E) ChAT
showed robust co-localization of signal in large cell bodies of the
ventral horn of L6. Robust GFP expression was observed throughout
the ventral horn of the spinal cord as evidenced by (G and K)
cervical segment 6, (H and L) thoracic segment 3, (I and M) lumbar
segment 1, and (J and N) sacral segment 2 of monkeys that received
either (G-J) the combination cisterna magna and lumbar or (K-N)
cisterna magna alone injections. O) A comprehensive quantitation
showed motor neuron transduction efficiencies of between 15 and 50%
in monkeys treated by cisterna magna injections alone. P) This
value was greater in animals treated with the combination cisterna
magna and lumbar injections, which showed a motor neuron
transduction rate of 25-75%. Scale bars: 0.5 mm (A-F), 0.1 mm
(H-N).
[0032] FIG. 14 shows that intrathecal delivery of scAAV9-eGFP into
monkeys resulted in transduction of dorsal root ganglia and brain.
Shown are the (A, D) dorsal root ganglia of the cervical, (B, E)
thoracic, and (C, F) lumbar segments from animals treated by (A-C)
the combination cisterna magna and lumbar injections or (D-F)
cisterna magna alone. (G, H) Positive GFP immuno-staining was also
observed in the brain of both treatment groups, especially in the
cerebral cortex and cerebellum. G-I) A representative sample
showing GFP expression (G) in the cerebral cortex of monkeys
treated by the combination protocol and (H) in the cerebellum of
monkeys treated by cisterna magna alone. I) The saline treated
monkey was negative for GFP expression. Scale bars: 0.5 mm (A-F),
0.25 mm (G-I).
DETAILED DESCRIPTION
[0033] The present invention provides, inter alia, compositions and
methods for treating spinal muscular atrophy in a subject. The
methods comprise delivering of a recombinant adeno-associated virus
(rAAV) vector encoding SMN into the spinal cord and/or cisterna
magna (e.g., intrathecal delivery). In some embodiments of the
invention, the AAV vector is a self-complementing vector for
efficient expression of the therapeutic transgene. In some aspects,
the methods ameliorate one or more symptoms of spinal muscular
atrophy including but not limited to muscle wasting, paralysis,
respiratory dysfunction, motor neuron cell loss and neuromuscular
junction pathology.
I. General Techniques
[0034] The techniques and procedures described or referenced herein
are generally well understood and commonly employed using
conventional methodology by those skilled in the art, such as, for
example, the widely utilized methodologies described in Molecular
Cloning: A Laboratory Manual (Sambrook et al., 4.sup.th ed., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2012);
Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds.,
2003); the series Methods in Enzymology (Academic Press, Inc.); PCR
2: A Practical Approach (M. J. MacPherson, B.D. flames and G.R.
Taylor eds., i 995); Antibodies, A Laboratory Manual (Harlow and
Lane, eds., 1988); Culture of Animal Cells: A Manual of Basic
Technique and Specialized Applications (R. I. Freshney, 6.sup.th
ed., J. Wiley and Sons, 2010); Oligonucleotide Synthesis (M. J.
Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell
Biology: A Laboratory Notebook (J. E. Cellis, ed., Academic Press,
1998); Introduction to Cell and Tissue Culture (J. P. Mather and P.
E. Roberts, Plenum Press, 1998); Cell and Tissue Culture:
Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell,
eds., J. Wiley and Sons, 1993-8); Handbook of Experimental
Immunology (D. M. Weir and C. C. Blackwell, eds., 1996); Gene
Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos,
eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al.,
eds., 1994); Current Protocols in Immunology (J. E. Coligan et al.,
eds., 1991); Short Protocols in Molecular Biology (Ausubel et al.,
eds., J. Wiley and Sons, 2002); Immunobiology (C. A. Janeway et
al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical
Approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal
Antibodies: A Practical Approach (P. Shepherd and C. Dean, eds.,
Oxford University Press, 2000); Using Antibodies: A Laboratory
Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press,
1999); The Antibodies (M. Zanetti and J. D. Capra, eds., Harwood
Academic Publishers, 1995); and Cancer: Principles and Practice of
Oncology (V. T. DeVita et al., eds., J. B. Lippincott Company,
2011).
II. Definitions
[0035] A "vector," as used herein, refers to a recombinant plasmid
or virus that comprises a nucleic acid to be delivered into a host
cell, either in vitro or in vivo.
[0036] The term "polynucleotide" or "nucleic acid" as used herein
refers to a polymeric form of nucleotides of any length, either
ribonucleotides or deoxyribonucleotides. Thus, this term includes,
but is not limited to, single-, double- or multi-strandedDNA or
RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising
purine and pyrimidine bases, or other natural, chemically or
biochemically modified, non-natural, or derivatized nucleotide
bases. The backbone of the polynucleotide can comprise sugars and
phosphate groups (as may typically be found in RNA or DNA), or
modified or substituted sugar or phosphate groups. Alternatively,
the backbone of the polynucleotide can comprise a polymer of
synthetic subunits such as phosphoramidates and thus can be a
oligodeoxynucleoside phosphoramidate (P-NH.sub.2) or a mixed
phosphoramidate-phosphodiester oligomer. In addition, a
double-stranded polynucleotide can be obtained from the single
stranded polynucleotide product of chemical synthesis either by
synthesizing the complementary strand and annealing the strands
under appropriate conditions, or by synthesizing the complementary
strand de novo using a DNA polymerase with an appropriate
primer.
[0037] The terms "polypeptide" and "protein" are used
interchangeably to refer to a polymer of amino acid residues, and
are not limited to a minimum length. Such polymers of amino acid
residues may contain natural or non-natural amino acid residues,
and include, but are not limited to, peptides, oligopeptides,
dimers, trimers, and multimers of amino acid residues. Both
full-length proteins and fragments thereof are encompassed by the
definition. The terms also include post-expression modifications of
the polypeptide, for example, glycosylation, sialylation,
acetylation, phosphorylation, and the like. Furthermore, for
purposes of the present invention, a "polypeptide" refers to a
protein which includes modifications, such as deletions, additions,
and substitutions (generally conservative in nature), to the native
sequence, as long as the protein maintains the desired activity.
These modifications may be deliberate, as through site-directed
mutagenesis, or may be accidental, such as through mutations of
hosts which produce the proteins or errors due to PCR
amplification.
[0038] A "recombinant viral vector" refers to a recombinant
polynucleotide vector comprising one or more heterologous sequences
(i.e., nucleic acid sequence not of viral origin). In the case of
recombinant AAV vectors, the recombinant nucleic acid is flanked by
at least one, preferably two, inverted terminal repeat sequences
(ITRs).
[0039] A "recombinant AAV vector (rAAV vector)" refers to a
polynucleotide vector comprising one or more heterologous sequences
(i.e., nucleic acid sequence not of AAV origin) that are flanked by
at least one, preferably two, AAV inverted terminal repeat
sequences (ITRs). Such rAAV vectors can be replicated and packaged
into infectious viral particles when present in a host cell that
has been infected with a suitable helper virus (or that is
expressing suitable helper functions) and that is expressing AAV
rep and cap gene products (i.e. AAV Rep and Cap proteins). When a
rAAV vector is incorporated into a larger polynucleotide (e.g.,in a
chromosome or in another vector such as a plasmid used for cloning
or transfection), then the rAAV vector may be referred to as a
"pro-vector" which can be "rescued" by replication and
encapsidation in the presence of AAV packaging functions and
suitable helper functions. An rAAV vector can be in any of a number
of forms, including, but not limited to, plasmids, linear
artificial chromosomes, complexed with lipids, encapsulated within
liposomes, and, most preferable, encapsidated in a viral particle,
particularly an AAV particle. A rAAV vector can be packaged into an
AAV virus capsid to generate a "recombinant adeno-associated viral
particle (rAAV particle)".
[0040] "Heterologous" means derived from a genotypically distinct
entity from that of the rest of the entity to which it is compared
or into which it is introduced or incorporated. For example, a
polynucleotide introduced by genetic engineering techniques into a
different cell type is a heterologous polynucleotide (and, when
expressed, can encode a heterologous polypeptide). Similarly, a
cellular sequence (e.g., a gene or portion thereof) that is
incorporated into a viral vector, is a heterologous nucleotide
sequence with respect to the vector.
[0041] The term "transgene" refers to a polynucleotide that is
introduced into a cell and is capable of being transcribed into RNA
and optionally, translated and/or expressed under appropriate
conditions. In aspects, it confers a desired property to a cell
into which it was introduced, or otherwise leads to a desired
therapeutic or diagnostic outcome. In another aspect, it may be
transcribed into a molecule that mediates RNA interference, such as
siRNA.
[0042] The terms "genome particles (gp)," "genome equivalents," or
"genome copies" as used in reference to a viral titer, refer to the
number of virions containing the recombinant AAV DNA genome,
regardless of infectivity or functionality. The number of genome
particles in a particular vector preparation can be measured by
procedures such as described in the Examples herein, or for
example, in Clark et al. (1999) Hum. Gene Ther., 10:1031-1039;
Veldwijk et al. (2002) Mol. Ther., 6:272-278.
[0043] The terms "infection unit (iu)," "infectious particle," or
"replication unit," as used in reference to a viral titer, refer to
the number of infectious and replication-competent recombinant AAV
vector particles as measured by the infectious center assay, also
known as replication center assay, as described, for example, in
McLaughlin et al. (1988) J. Virol., 62:1963-1973.
[0044] The term "transducing unit (tu)" as used in reference to a
viral titer, refers to the number of infectious recombinant AAV
vector particles that result in the production of a functional
transgene product as measured in functional assays such as
described in Examples herein, or for example, in Xiao et al. (1997)
Exp. Neurobiol., 144:113-124; or in Fisher et al. (1996) J. Virol.,
70:520-532 (LFU assay).
[0045] An "inverted terminal repeat" or "ITR" sequence is a term
well understood in the art and refers to relatively short sequences
found at the termini of viral genomes which are in opposite
orientation.
[0046] An "AAV inverted terminal repeat (ITR)" sequence, a term
well-understood in the art, is an approximately 145-nucleotide
sequence that is present at both termini of the native
single-stranded AAV genome. The outermost 125 nucleotides of the
ITR can be present in either of two alternative orientations,
leading to heterogeneity between different AAV genomes and between
the two ends of a single AAV genome. The outermost 125 nucleotides
also contains several shorter regions of self-complementarity
(designated A. A', B, B', C,C'and D regions), allowing intrastrand
base-pairing to occur within this portion of the ITR.
[0047] A "terminal resolution sequence" or "trs" is a sequence in
the D region of the AAV ITR that is cleaved by AAV rep proteins
during viral DNA replication. A mutant terminal resolution sequence
is refractory to cleavage by AAV rep proteins.
[0048] A "helper virus" for AAV refers to a virus that allows AAV
(which is a defective parvovirus) to be replicated and packaged by
a host cell. A number of such helper viruses have been identified,
including adenoviruses, herpesviruses and poxviruses such as
vaccinia. The adenoviruses encompass a number of different
subgroups, although Adenovirus type 5 of subgroup C (Ad5) is most
commonly used. Numerous adenoviruses of human, non-human mammalian
and avian origin are known and are available from depositories such
as the ATCC. Viruses of the herpes family, which are also available
from depositories such as ATCC, include, for example, herpes
simplex viruses (HSV), Epstein-Barr viruses (EBV),
cytomegaloviruses (CMV) and pseudorabies viruses (PRV).
[0049] "Percent (%) sequence identity" with respect to a reference
polypeptide or nucleic acid sequence is defined as the percentage
of amino acid residues or nucleotides in a candidate sequence that
are identical with the amino acid residues or nucleotides in the
reference polypeptide or nucleic acid sequence, after aligning the
sequences and introducing gaps, if necessary, to achieve the
maximum percent sequence identity, and not considering any
conservative substitutions as part of the sequence identity.
Alignment for purposes of determining percent amino acid or nucleic
acid sequence identity can be achieved in various ways that are
within the skill in the art, for instance, using publicly available
computer software programs. for example, those described in Current
Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supp.
30, section 7.7.18, Table 7.7.1, and including BLAST, BLAST-2,
ALIGN or Megalign (DNASTAR) software. A preferred alignment program
is ALIGN Plus (Scientific and Educational Software, Pennsylvania).
Those skilled in the art can determine appropriate parameters for
measuring alignment, including any algorithms needed to achieve
maximal alignment over the full length of the sequences being
compared. For purposes herein, the % amino acid sequence identity
of a given amino acid sequence A to, with, or against a given amino
acid sequence B (which can alternatively be phrased as a given
amino acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows: 100 times the fraction X/Y, where X is
the number of amino acid residues scored as identical matches by
the sequence alignment program in that program's alignment of A and
B, and where Y is the total number of amino acid residues in B. It
will be appreciated that where the length of amino acid sequence A
is not equal to the length of amino acid sequence 8, the % amino
acid sequence identity of A to B will not equal the % amino acid
sequence identity of B to A. For purposes herein, the % nucleic
acid sequence identity of a given nucleic acid sequence C to, with,
or against a given nucleic acid sequence D (which can alternatively
be phrased as a given nucleic acid sequence C that has or comprises
a certain % nucleic acid sequence identity to, with, or against a
given nucleic acid sequence D) is calculated as follows: 100 times
the fraction W/Z, where W is the number of nucleotides scored as
identical matches by the sequence alignment program in that
program's alignment of C and D, and where Z is the total number of
nucleotides in D. It will be appreciated that where the length of
nucleic acid sequence C is not equal to the length of nucleic acid
sequence D, the % nucleic acid sequence identity of C to D will not
equal the % nucleic acid sequence identity of D to C.
[0050] An "isolated" molecule (e.g., nucleic acid or protein) or
cell means it has been identified and separated and/or recovered
from a component of its natural environment.
[0051] An "effective amount" is an amount sufficient to effect
beneficial or desired results, including clinical results (e.g.,
amelioration of symptoms, achievement of clinical endpoints, and
the like). An effective amount can be administered in one or more
administrations. In terms of a disease state, an effective amount
is an amount sufficient to ameliorate, stabilize, or delay
development of a disease.
[0052] An "individual" or "subject" is a mammal. Mammals include,
but are not limited to, domesticated animals (e.g., cows, sheep,
cats, dogs, and horses), primates (e.g., humans and non-human
primates such as monkeys), rabbits, and rodents (e.g., mice and
rats). In certain embodiments, the individual or subject is a
human.
[0053] As used herein, "treatment" is an approach for obtaining
beneficial or desired clinical results. For purposes of this
invention, beneficial or desired clinical results include, but are
not limited to, alleviation of symptoms, diminishment of extent of
disease, stabilized (e.g., not worsening) state of disease,
preventing spread (e.g., metastasis) of disease, delay or slowing
of disease progression, amelioration or palliation of the disease
state, and remission (whether partial or total), whether detectable
or undetectable. "Treatment" can also mean prolonging survival as
compared to expected survival if not receiving treatment.
[0054] Reference to "about" a value or parameter herein includes
(and describes) embodiments that are directed to that value or
parameter per se. For example, description referring to "about X"
includes description of "X."
[0055] As used herein, the singular form of the articles "a," "an,"
and "the" includes plural references unless indicated otherwise.
For example, the phrase "a rAAV particle" includes one or more rAAV
particles.
[0056] It is understood that aspects and embodiments of the
invention described herein include "comprising," "consisting,"
and/or "consisting essentially of" aspects and embodiments.
III. Methods to Treat Spinal Muscular Atrophy
[0057] In some aspects, the invention provides methods and
compositions for treating spinal muscular atrophy (SMA) in a
primate comprising administering to the spinal cord and/or cisterna
magna of the primate an effective amount of rAAV viral particles
comprising a vector encoding a primate SMN. The methods can be used
for treating a human with SMA, e.g.,a pediatric subject. to improve
the pathologies associated with spinal muscular atrophy. In some
embodiments, the viral particle comprises an AAV serotype 9 capsid
(AAV9 capsid) and AAV2 inverted terminal repeats. In some
embodiments, the viral particle comprises a recombinant
self-complementing vector genome for efficient expression of the
transgene in motor neurons upon viral transduction. In some
embodiments, at least 1.times.10.sup.12 genome copies are
administered to the primate.
[0058] In some aspects, the invention provides methods and
compositions for ameliorating a symptom of SMA, comprising
administration to the spinal cord and/or cisterna magna of a
primate an effective amount of rAAV viral particles comprising a
vector encoding a primate SMN. In some embodiments the symptoms of
SMA include, but is not limited to, muscle wasting, paralysis,
bulbar and respiratory dysfunction, motor neuron cell loss and
neuromuscular junction pathology. For example, the methods can be
used for ameliorating one or more symptoms in a human with SMA,
e.g.,a pediatric subject with SMA. Amelioration of the symptoms of
SMA can be measured by improved motor muscle action potential,
achieved milestones, decreased dependency on ventilation, increased
quality of life and longevity. For example, improvement can be
measured by less dependence on ventilation and cough assistance
machines, or the use of feeding tubes. Improvement can also be
measured by gross motor functions such as sitting unaided, head
control and the ability to walk. Increases in motor unit number
estimation (MUNE), improvement in compound motor action potential
(CMAP), increase in Hammersmith functional motor score (HFMS),
improvement in pulmonary functional tests (FVC), and improvement of
gross muscle physiology using MRI imaging, alone or in combination
are indicative of therapeutic efficacy. Milestones can be measured
with respect to the subject before the treatment of the invention,
in comparison with non-treated peers, or in comparison with
historical records.
[0059] In some aspects of the invention, the methods and
compositions are used for the treatment of humans with SMA. SMA may
be caused by mutations in the SMN1 gene that encodes the SMN
protein. In some embodiments of the invention, the methods are used
to treat humans with a mutation in the SMN1 gene and/or in the SMN
protein. In some embodiments, the expression of functional SMN in
motor neurons is deficient compared to the expression of SMN in
motor neurons of a human without SMA. In some embodiments, the
expression of SMN is deficient in motor neurons of the brain and/or
spinal cord.
[0060] There are three types of SMA in terms of disease severity
which are related to the expression of SMN2 in the subject. Type I
SMA is characterized by early onset (<6 months of age, with
death typically <3years of age) and a SMN2 copy number of 1-2.
Type I SMA subjects never achieve the ability to sit and have
respiratory and bulbar dysfunction. Type II SMA onset is typically
between 6 and 18 months of age, with death typically at <30-40
years of age. Type II SMA is typically associated with a SMN2 copy
number of 2-3. Type II subjects never achieve the ability to walk
and eventually succumb to respiratory dysfunction. Type III SMA
onset is typically at >18 months of age with death at >60
years of age. Type III SMA is associated with a SMN2 copy number of
3-4. Type Ill patients are often confined to a wheelchair by
teenage and have no respiratory dysfunction.
[0061] In some embodiments, the invention provides methods for
treating a human with Type 1 SMA. In some embodiments, the
invention provides methods for treating a human with Type II SMA.
In some embodiments, the invention provides methods for treating a
human with Type HI SMA. In some embodiments, the invention provides
methods for treating a human with Type I or Type II SMA. In some
embodiments, the invention provides methods for treating a human
with Type II or Type III SMA. In some embodiments the invention
provides methods for treating a human wherein the human has an smn2
copy number of 1-2, 2-3 or 3-4.
[0062] SMN2 mRNA may be identified by a NCBI RefSeq number selected
from the group consisting of NM_017411.3, NM_022875.2, NM_022876.2,
and NM_022877.2.
[0063] In some embodiments, the invention provides methods for
treating a pediatric human subject with SMA. In some embodiments,
the pediatric human subject is less than any one of 2 months of
age, 3 months of age, 4 months of age, 5 months of age, 6 months of
age, 7 months of age, 8 months of age, 9 months of age, 10 months
of age, 11 months of age, 12 months of age, 13 months of age, 14
months of age, 15 months of age, 16 months of age, 17 months of
age, 18 months of age, 1 year of age, 2 years of age, 3 years of
age, 4 years of age, 5 years of age, 6 years of age, 7 years of
age, 8 years of age, 9 years of age, 10 years of age, 11 years of
age, 12 years of age, 13 years of age, 14 years of age, 15 years of
age, 16 years of age, 17 years of age, 18 years of age. In some
embodiments, the human subject is greater than 18 years of age.
[0064] In some aspects, the invention provides methods to deliver a
heterologous transgene encoding a primate SMN to a motor neuron in
a primate, the method comprising administering to the spinal cord
or cisterna magna of the primate, an effective amount of rAAV viral
particles comprising vector encoding the primate SMNI transgene.
The administration delivers the transgene product to the motor
neuron's cellular environment, where the SMN mediates a beneficial
effect on the cell and surrounding cells. In some embodiments the
motor neurons are in the spinal cord of the primate. In some
embodiments, the invention provides methods to deliver a transgene
expressing human SMN to motor neurons are in the spinal cord of a
human.
[0065] In some embodiments, the administration to the spinal cord
and/or cisterna magna of an effective amount of rAAV viral
particles comprising a vector encoding a primate SMN transduces
motor neurons at the vertebrate section site of administration. In
some embodiments, more than about any of 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%. 70%, 75% or 100% of motor
neurons are transduced. In some embodiments, more than about any of
5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75% or 100% of motor neurons throughout the spinal cord are
transduced (e.g., throughout the lumbar, thoracic, and cervical
regions). Methods to identify motor neurons transduced by AAV
expressing SMN are known in the art; for example,
immunohistochemistry can be used to detect expression of SMN using
an anti-SMN antibody and motor neurons can be identified using an
anti-choline acetyl transferase (ChAT) antibody. In some
embodiments, more than about any of 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50%. 55%, 60%, 65%, 70%, 75% or 100% of motor
neurons are transduced in an animal model of SMA, e.g.,a mouse
model of SMA, or in a nonhuman primate.
[0066] In some embodiments, the transduction of motor neurons
following administration to the spinal cord and/or cisterna magna
of a primate an effective amount of AAV viral particles comprising
a vector encoding a primate SMN results in the expression of SMN to
provide benefit to a primate with SMA. For example, reconstituting
SMN levels to 20-30% wild type levels in the spinal cord is
sufficient to provide some level of therapeutic benefit in a mouse
model of SMA. In some embodiments of the invention, administration
to the spinal cord and/or cisterna magna of an AAV viral particle
comprising a transgene encoding a primate SMN results in expression
of at least about any of 20%, 25%, 30%. 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of levels of SMN
expression in a normal individual. Methods to measure expression of
SMN are known in the art; for example, using an anti-SMN antibody.
For example, the expression of SMN can be measured in a mouse model
of SMA.
[0067] in some embodiments of the invention, the methods comprise
administration to the spinal cord and/or cisterna magna of a
primate an effective amount of AAV viral particles comprising a
vector encoding a primate SMN for treating a primate, e.g.,a human,
with SMA. In some embodiments, the composition is injected to one
or more intrathecal spaces in the spinal cord and or in the
cisterna magna to allow expression of SMN in motor neurons. In some
embodiments, the composition is injected into the cisterna magna.
In some embodiments, the composition is injected into the
subarachnoid space of the spinal column at one or more locations in
the cervical, thoracic, lumbar or sacral regions of the spinal
cord. In some embodiments, the composition is injected into any one
of one, two, three, four, five, six, seven, eight, nine, ten or
more than ten locations in the subarachnoid space of the spinal
cord. In some embodiments, the composition is injected to the
cisterna magna and the spinal cord. In some embodiments, the
composition is injected to the cisterna magna and into any one of
one, two, three, four, five, six, seven, eight, nine, ten or more
than ten locations in the subarachnoid space of the spinal cord. In
some embodiments, the composition is injected into the subarachnoid
space of the spinal cord using a catheter or other devices for
intrathecal injection known in the art.
[0068] In some embodiments the rAAV viral particles are
administered to more than one location simultaneously or
sequentially. In some embodiment, multiple injections of rAAV viral
particles are no more than one hour, two hours, three hours, four
hours, five hours, six hours, nine hours, twelve hours or 24 hours
apart.
[0069] The human brain structure can be correlated to similar
structures in the brain of another mammal. Most mammals, including
humans and rodents, show a similar topographical organization of
the entorhinal hippocampus projections, with neurons in the lateral
part of both the lateral and medial entorhinal cortex projecting to
the dorsal part or septal pole of the hippocampus, whereas the
projection to the ventral hippocampus originates primarily from
neurons in medial parts of the entorhinal cortex (Principles of
Neural Science, 4th ed., eds Kandel et al., McGraw Hill, 1991; The
Rat Nervous System, 2nd ed., ed. Paxinos, Academic Press, 1995).
Furthermore, layer II cells of the entorhinal cortex project to the
dentate gyrus, and they terminate in the outer two thirds of the
molecular layer of the dentate gyrus. The axons from layer III
cells project bilaterally to the cornu ammonis areas CA1 and CA3 of
the hippocampus, terminating in the stratum lacunose molecular
layer. Moreover. one of ordinary skill in the art would readily
know how to identify structures in the human brain, see, e.g., The
Human Brain: Surface, Three Dimensional Sectional Anatomy With MRI,
and Blood Supply, 2nd ed., eds. Deuteron et al., Springer Vela,
1999: Atlas of the Human Brain, eds. Mai et al., Academic Press;
1997; and Co Planar Sterotaxic Atlas of the Human Brain: 3
Dimensional Proportional System: An Approach to Cerebral Imaging,
eds, Tamarack et al., Thyme Medical Pub., 1988. For identification
of structures in the mouse brain, see, e.g., The Mouse Brain in
Sterotaxic Coordinates, 2nd ed., Academic Press, 2000.
[0070] In some embodiments, the methods comprise administration to
the spinal cord and/or cisterna magna of a primate an effective
amount of AAV viral particles comprising a vector encoding a
primate SMN. In some embodiments, the viral titer of the
composition is at least about any of 5.times.10.sup.12,
6.times.10.sup.12, 7.times.10.sup.12, 8.times.10.sup.12,
9.times.10.sup.12, 10.times.10.sup.12, 11.times.10.sup.12,
15.times.10.sup.12, 20.times.10.sup.12, 25.times.10.sup.12,
30.times.10.sup.12, or 50.times.10.sup.12 genome copies/mL. In some
embodiments, the viral titer of the composition is about any of
5.times.10.sup.12 to 6.times.10.sup.12, 6.times.10.sup.12 to
7.times.10.sup.12, 7.times.10.sup.12 to 8.times.10.sup.12,
8.times.10.sup.12 to 9.times.10.sup.12, 9.times.10.sup.12 to
10.times.10.sup.12, 10.times.10.sup.12 to 10.times.10.sup.12,
10.times.10.sup.12 to 15.times.10.sup.12, 15.times.10.sup.12 to
20.times.10.sup.12, 20.times.10.sup.12 to 25.times.10.sup.12,
25.times.10.sup.12 to 30.times.10.sup.12, 30.times.10.sup.12 to
50.times.10.sup.12 , or 50.times.10.sup.12 to 100.times.10.sup.12
genome copies/mL. In some embodiments, the viral titer of the
composition is about any of 5.times.10.sup.12 to
10.times.10.sup.12, 10.times.10.sup.12 to 25.times.10.sup.12, or
25.times.10.sup.12 to 50.times.10.sup.12 genome copies/mL. In some
embodiments, the viral titer of the composition is at least about
any of 5.times.10.sup.9, 6.times.10.sup.9, 7.times.10.sup.9,
8.times.10.sup.9, 9.times.10.sup.9, 10.times.10.sup.9,
11.times.10.sup.9, 15.times.10.sup.9, 20.times.10.sup.9,
25.times.10.sup.9, 30.times.10.sup.9, or 50.times.10.sup.9
transducing units /mL. In some embodiments, the viral titer of the
composition is about any of 5.times.10.sup.9 to 6.times.10.sup.9,
6.times.10.sup.9 to 7.times.10.sup.9, 7.times.10.sup.9 to
8.times.10.sup.9, 8.times.10.sup.9 to 9.times.10.sup.9,
9.times.10.sup.9 to 10.times.10.sup.9, 10.times.10.sup.9 to
11.times.10.sup.9, 11.times.10.sup.9 to 15.times.10.sup.9,
15.times.10.sup.9 to 20.times.10.sup.9, 20.times.10.sup.9 to
25.times.10.sup.9, 25.times.10.sup.9 to 30.times.10.sup.9,
30.times.10.sup.9 to 50.times.10.sup.9 or 50.times.10.sup.9 to
100.times.10.sup.9 transducing units /mL. In some embodiments, the
viral titer of the composition is about any of 5.times.10.sup.9 to
10.times.10.sup.9, 10.times.10.sup.9 to 15.times.10.sup.0,
15.times.10.sup.9 to 25.times.10.sup.9, or 25.times.10.sup.9 to
50.times.10.sup.9 transducing units /mL. In some embodiments, the
viral titer of the composition is at least any of about
5.times.10.sup.10, 6.times.10.sup.10, 7.times.10.sup.10,
8.times.10.sup.10, 9.times.10.sup.10, 10.times.10.sup.10,
11.times.10.sup.10, 15.times.10.sup.10, 20.times.10.sup.10,
25.times.10.sup.10, 30.times.10.sup.10, 40.times.10.sup.10, or
50.times.10.sup.10 infectious units/mL. In some embodiments. the
viral titer of the composition is at least any of about
5.times.10.sup.10 to 6.times.10.sup.10, 6.times.10.sup.10 to
7.times.10.sup.10, 7.times.10.sup.10 to 8.times.10.sup.10,
8.times.10.sup.10 to 9.times.10.sup.10, 9.times.10.sup.10 to
10.times.10.sup.10, 10.times.10.sup.10 to 11.times.10.sup.10,
11.times.10.sup.10 to 15.times.10.sup.10, 15.times.10.sup.10 to
20.times.10.sup.10, 20.times.10.sup.10 to 25.times.10.sup.10,
25.times.10.sup.10 to 30.times.10.sup.10, 30.times.10.sup.10 to
40.times.10.sup.10, 40.times.10.sup.10 to 50.times.10.sup.10, or
50.times.10.sup.10 to 100.times.10.sup.10 infectious units/mL. In
some embodiments, the viral titer of the composition is at least
any of about 5.times.10.sup.10 to 10.times.10.sup.10,
10.times.10.sup.10 to 15.times.10.sup.10, 15.times.10.sup.10 to
25.times.10.sup.10, or 25.times.10.sup.10 to 50.times.10.sup.10
infectious units/mL. In further embodiments, the administration of
a high titer AAV composition is accomplished by direct injection
into the spinal cord, intrathecal injection, and/or injection to
the cisterna magna of primate, e.g., a human with SMA.
[0071] In some embodiments, the methods comprise administration to
the spinal cord and/or cisterna magna of a primate (e.g., a human)
an effective amount of AAV viral particles comprising a vector
encoding a primate SMN to a primate. In some embodiments, the dose
of viral particles administered to the primate is at least about
any of 1.times.10.sup.11, 2.times.10.sup.11, 3.times.10.sup.11,
4.times.10.sup.11, 5.times.10.sup.11, 6.times.10.sup.11,
7.times.10.sup.11, 8.times.10.sup.11, 9.times.10.sup.11,
1.times.10.sup.12, 2.times.10.sup.12, 3.times.10.sup.12,
4.times.10.sup.12, 5.times.10.sup.12, 6.times.10.sup.12,
7.5.times.10.sup.12, or 1.times.10.sup.13 genome copies/kg of body
weight. In some embodiments, the dose of viral particles
administered to the primate is about any of 1.times.10.sup.11 to
2.times.10.sup.11, 2.times.10.sup.11 to 3.times.10.sup.11,
3.times.10.sup.11 to 4.times.10.sup.11, 4.times.10.sup.11 to
5.times.10.sup.11, 5.times.10.sup.11 to 6.times.10.sup.11,
6.times.10.sup.11 to 7.times.10.sup.11, 7.times.10.sup.11 to
8.times.10.sup.11, 8.times.10.sup.11 to 9.times.10.sup.11,
9.times.10.sup.11 to 1.times.10.sup.12, 1.times.10.sup.12 to
2.times.10.sup.12, 2.times.10.sup.12 to 3.times.10.sup.12,
3.times.10.sup.12 to 4.times.10.sup.12, 4.times.10.sup.12 to
5.times.10.sup.12, or 5.times.10.sup.12 to 10.times.10.sup.12
genome copies/kg of body weight. In some embodiments, the dose of
viral particles administered to the primate is about any of
1.times.10.sup.11 to 5.times.10.sup.11, 5.times.10.sup.11 to
1.times.10.sup.12, or 1.times.10.sup.12 to 5.times.10.sup.12 genome
copies/kg of body weight.
[0072] In some embodiments, the methods comprise administration to
the spinal cord and/or cisterna magna of a primate (e.g.,a human)
an effective amount of AAV viral particles comprising a vector
encoding a primate SMN to a primate. In some embodiments, the total
amount of viral particles administered to the primate is at least
about any of 1.times.10.sup.12, 2.times.10.sup.12,
3.times.10.sup.12, 4.times.10.sup.12, 5.times.10.sup.12,
6.times.10.sup.12, 7.times.10.sup.12, 8.times.10.sup.12,
9.times.10.sup.12, 1.times.10.sup.13, 2.times.10.sup.13,
3.times.10.sup.13, 4.times.10.sup.13, 5.times.10.sup.13,
6.times.10.sup.13, 7.times.10.sup.13, 8.times.10.sup.13,
9.times.10.sup.13, 1.times.10.sup.14 genome copies. In some
embodiments, the total amount of viral particles administered to
the primate is about any of 1.times.10.sup.12 to 2.times.10.sup.12,
2.times.10.sup.12 to 3.times.10.sup.12, 3.times.10.sup.12 to
4.times.10.sup.12, 4.times.10.sup.12 to 5.times.10.sup.12,
5.times.10.sup.12 to 6.times.10.sup.12, 6.times.10.sup.12 to
7.times.10.sup.12, 7.times.10.sup.12 to 8.times.10.sup.12,
8.times.10.sup.12 to 9.times.10.sup.12, 9.times.10.sup.12 to
1.times.10.sup.13, 1.times.10.sup.13 to 2.times.10.sup.13,
2.times.10.sup.13 to 3.times.10.sup.13, 3.times.10.sup.13 to
4.times.10.sup.13, 4.times.10.sup.13 to 5.times.10.sup.13,
5.times.10.sup.13 to 6.times.10.sup.13, 6.times.10.sup.13 to
7.times.10.sup.13, 7.times.10.sup.13 to 8.times.10.sup.13,
8.times.10.sup.13 to 9.times.10.sup.13, 9.times.10.sup.13 to
1.times.10.sup.14 genome copies. In some embodiments, the total
amount of viral particles administered to the primate is about any
of 1.times.10.sup.12 to 5.times.10.sup.12, 5.times.10.sup.12 to
1.times.10.sup.13, 1.times.10.sup.13 to 5.times.10.sup.13, or
5.times.10.sup.13 to 1.times.10.sup.14 genome copies.
[0073] In some embodiments of the invention, the volume of the
composition injected to the cisterna magna or subarachnoid space of
the spinal column is more than about any one of 1 .mu.l, 10 .mu.l,
100 .mu.l, 1 mL, 2 mL, 3 mL, 4 mL, 5 mL, 6 mL, 7 mL, 8 mL, 9 mL, 10
mL, 25 mL or 50 mL, or any amount therebetween.
[0074] In some embodiments of the invention, the total amount of
viral particles are administered to more than one location. For
example, a total dose of 3.times.10.sup.13 genome copies can be
administered by injecting 1.times.10.sup.13 genome copies to the
cisterna magna, 1.times.10.sup.13 genome copies to a thoracic
subarachnoid space, and 1.times.10.sup.13 genome copies to a lumbar
subarachnoid space. In some embodiments, the viral particles are
evenly distributed between injection locations. In some
embodiments, the viral particles are not evenly distributed between
injection sites; e.g., 2.times.10.sup.13 genome copies to the
cisterna magna and 1.times.10.sup.13 genome copies to a lumbar
subarachnoid space.
[0075] Compositions of the invention (e.g., AAV viral particles
comprising a transgene encoding a primate SMN) can be used either
alone or in combination with one or more additional therapeutic
agents for treating SMA. The interval between sequential
administration can be in terms of at least (or, alternatively, less
than) minutes, hours, or days.
IV. Expression Constructs
Survival Motor Neuron (SMN) Nucleic Acid and Protein
[0076] Two SMN genes are present on chromosome 5q13, the SMN1 gene
and the SMN2 gene. The coding sequence of SMN2 differs from the
SMN1 sequence by five nucleotides. Although there is a difference
in the nucleic acid sequence, the amino acid sequence remains
unaltered. However, a single nucleotide difference from cystine (C)
to thymine (T) in exon 7 of SMN2 results in alternative splicing of
SMN2 transcripts. The SMN2 gene is found exclusively in humans,
while the SMN1 gene is found in human as well as non-human primates
such as the chimpanzee. See Rochette et al., Human Genetics, 2001,
108(3):255-266. The SMN1 gene encodes for the SMN protein which is
particularly abundant in motor neurons of the spinal cord but found
at reduced levels in subjects with spinal muscular atrophy (SMA),
an autosomal recessive disorder that results from homozygous
mutations or deletions in the SMN1gene. See Coovert et al, Hum Mol
Genet, 1997, 6(8):1205-14 and Fallini et al, Brain Res., 2012,
1462:81-92 for a review on the role of SMN in SMA, which are hereby
incorporated by reference in their entirety.
[0077] The present invention provides an isolated nucleic acid
(e.g., a transgene) that encodes an SMN protein, wherein the
isolated nucleic acid can be packaged in any AAV viral particle
described herein. Accordingly, in one aspect, the invention
provides for an isolated nucleic acid encoding an SMN protein from
a primate such as a human. In some embodiments, the isolated
nucleic acid encodes an SMN protein from a primate taxonomy
selected from the group consisting of a family Tarsiidae, family
Callitrichidae, family Cebidae, family Aotidae, family Pitheciidae,
family Atelidae, family Cercopithecidae, family Hylobatidae, and
family Hominidae. In some embodiments, the isolated nucleic acid
encodes an SMN protein from a primate selected from the group
consisting of a Homo sapien, a Macaca mulatta, a Pan troglodytes, a
Papio anubis, a Nomascus leucogenys, a Ponga abelii, a Gorilla
gorilla, a Saimiri holiviensis, and a Pan paniscus. In some
embodiments, the isolated nucleic acid encodes an SMN1 mRNA
identified by a NCB1 Reference Sequence (RefSeq) number selected
from the group consisting of NM_000344.3, NM_022874.2,
NM_001260664.1, and NM_001131470.2. In some embodiments, the
isolated nucleic acid encodes an SMN protein identified by a NCB1
RefSeq number selected from the group consisting of NP_000335.1,
NP_075012.1, NP_001247593.1, XP_001156488.1, XP_001156435.1,
XP_001156259.1, XP_001156201.1, XP_003266089.1, XP_003266087.1,
XP_003266086.1, XP_003266090.1, NP_001124942.1, XP_004058779.1,
XP_003925817.1, XP_003925818.1, XP_003925819.1, XP_003806815.1,
XP_003806816.1, XP_003806817.1, and XP_003806818.1. In some
embodiments, the isolated nucleic acid (e.g., the transgene)
encodes an SMN protein comprising the amino acid sequence of SEQ ID
NO: 1. In some embodiments, the isolated nucleic acid (e.g., the
transgene) comprises the nucleic acid sequence selected from the
group consisting of SEQ ID NOs:2-4.
[0078] Amino acid sequence variants of any SMN protein provided
herein are also contemplated. In some embodiments, the amino acid
variant of an SMN protein is a naturally occurring variant of SMN.
In some embodiments, the biological properties of the SMN protein
can be improved by altering the amino acid sequence encoding the
protein. Amino acids sequence variants of an SMN protein can be
prepared by introducing appropriate modifications into the nucleic
acid sequence encoding the protein or by introducing the
modification by peptide synthesis. Such modifications include, for
example, deletions from, insertions into, and/or substitutions
within the amino acid sequence of the SMN protein. Also
contemplated herein are amino acid sequence variants of any SMN
protein that arise from natural mutations (e.g., natural selection)
in the nucleic acid encoding the protein. Accordingly, provided
herein are isolated nucleic acids encoding variants of an SMN
protein, wherein the isolated nucleic acid can be packaged (e.g.,
as a transgene) in any AAV viral particle described herein. In some
embodiments, the isolated nucleic acid encodes an SMN protein
variant comprising an amino acid sequence with at least 85%, at
least 86%, at least 87%, at least 88%, at least 89%, at least 90%,
at least 91%, at least 92%, at least 93%, at least 94%, at least
95%, at least 96%, at least 97%, at least 98%, or at least 99%
sequence identity to the amino acid sequence of any SMN protein
described herein (e.g., human SMN protein). In some embodiments,
the isolated nucleic acid encodes an SMN protein variant comprising
an amino acid sequence with at least 85%, at least 86%, at least
87%, at least 88%, at least 89%, at least 90%, at least 91%, at
least 92%, at least 93%, at least 94%, at least 95%, at least 96%,
at least 97%, at least 98%, or at least 99% sequence identity to an
amino acid sequence of SEQ ID NO:1. In some embodiments, the
isolated nucleic acid encoding SMN comprises mutations conferring
one, two, three, four, five, six, seven, eight, nine or ten amino
acid substitutions while maintaining its biological function in
motor neurons. In some embodiments, the resulting SMN protein can
express wild-type levels of activity. In some embodiments, the
resulting SMN protein is expressed at wild-type levels.
[0079] Isolated nucleic acid molecules encoding an SMN protein
(e.g., an SMN protein) can be obtained by cloning or produced
synthetically, or any combinations thereof. The nucleic acid can be
triple-stranded, double-stranded or single-stranded, or any
combination thereof. Any portion of at least one strand of the DNA
can be the coding strand, also known as the sense strand, or it can
be the non-coding strand, also referred to as the anti-sense
strand. The isolated nucleic acids can he obtained from biological
sources using any number of cloning methodologies known to those of
skill in the art. The isolated nucleic acids can also be prepared
by direct chemical synthesis by known methods. Nucleic acids
encoding an SMN protein can be prepared by a variety of methods
known in the art including, but not limited to, isolation from a
natural source or preparation by oligonucleotide-mediated
mutagenesis, site-directed mutagenesis, PCR mutagenesis, and
cassette mutagenesis of an earlier prepared variant or a
non-variant version of the SMN protein. See Molecular Cloning: A
Laboratory Manual (Sambrook et al., 4.sup.th ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2012) and
Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds.,
2003).
[0080] in some embodiments, the transgene (e.g., the ,SMN1
transgene) is operably linked to a promoter. Exemplary promoters
include, but are not limited to, the cytomegalovirus (CMV)
immediate early promoter, the RSV LTR, the MoMLV LTR, the
phosphoglycerate kinase-1 (PGK) promoter, a simian virus 40 (SV40)
promoter and a CK6 promoter, a transthyretin promoter (TTR), a TK
promoter, a tetracycline responsive promoter (TRE), an HBV
promoter, an hAAT promoter, a LSP promoter, chimeric liver-specific
promoters (LSPs), the E2F promoter, the telomerase (hTERT)
promoter; the cytomegalovirus enhancer/chicken beta-actin/Rabbit
.beta.-globin promoter (CAG promoter; Niwa et al., Gene, 1991,
108(2):193-9) and the elongation factor 1-alpha promoter
(EF1-alpha) promoter (Kim et al., Gene, 1990, 91(2):217-23 and Guo
et al., Gene Ther., 1996, 3(9):802-10). In some embodiments, the
promoter comprises a human .beta.-glucuronidase promoter or a
cytomegalovirus enhancer linked to a chicken .beta.-actin promoter.
The promoter can be a constitutive, inducible or repressible
promoter. In some embodiments, the transgene encodes any SMN
protein described herein (e.g., primate SMN) and is operable linked
to a promoter. In some embodiments, the transgene encodes a human
SMN protein and is operable linked to a promoter. In some
embodiments, the transgene encodes a human SMN protein comprising
the amino acid sequence of SEQ ID NO:1 and is operable linked to a
promoter. In some embodiments, the transgene comprises a nucleic
acid sequence selected from the group consisting of SEQ ID NOs:2-4
and is operable linked to a promoter.
[0081] Recombinant Viral Vector
[0082] The present invention contemplates the use of a recombinant
viral genome for introduction of one or more nucleic acid sequences
encoding for an SMN protein described herein for packaging into an
AAV viral particle. The recombinant viral genome may include any
element to establish the expression of an SMN protein, for example,
a promoter, an SMN1 transgene, an ITR, a ribosome binding element,
terminator, enhancer, selection marker, intron, polyA signal,
and/or origin of replication. In some embodiments, the recombinant
viral genome is derived from the nucleic acid of SEQ ID NO:5. In
some embodiments, the recombinant viral genome is derived from the
nucleic acid of SEQ ID NO:6.
V. Viral Particles and Methods of Producing Viral Particles rAAV
Viral Particles
[0083] In some embodiments, the viral particle is a recombinant AAV
particle comprising a nucleic acid comprising a sequence encoding
an SMN protein (e.g., human SMN protein) described herein flanked
by one or two ITRs. The nucleic acid is encapsidated in the AAV
particle. The AAV particle also comprises capsid proteins. In some
embodiments, the nucleic acid comprises the protein coding
sequence(s) of interest (e.g., a transgene encoding an SMN protein)
operatively linked components in the direction of transcription,
control sequences including transcription initiation and
termination sequences, thereby forming an expression cassette. The
expression cassette is flanked on the 5' and 3' end by at least one
functional AAV ITR sequences. By "functional AAV ITR sequences" it
is meant that the ITR sequences function as intended for the
rescue, replication and packaging of the AAV virion. See Davidson
et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003,
77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16:10-16, all
of which are incorporated herein in their entirety by reference.
For practicing some aspects of the invention, the recombinant
vectors comprise at least all of the sequences of AAV essential for
encapsidation and the physical structures for infection by the
rAAV. AAV ITRs for use in the vectors of the invention need not
have a wild-type nucleotide sequence (e.g., as described in Kotin,
Hum. Gene Ther., 1994, 5:793-801), and may be altered by the
insertion, deletion or substitution of nucleotides or the AAV ITRs
may be derived from any of several AAV serotypes. More than 40
serotypes of AAV are currently known, and new serotypes and
variants of existing serotypes continue to be identified. See Gao
et al., PNAS, 2002, 99(18): 11854-6; Gao et al., PNAS, 2003,
100(10):6081-6; and Bossis et al., J. Virol., 2003,
77(12):6799-810. Use of any AAV serotype is considered within the
scope of the present invention. In some embodiments, a rAAV vector
is a vector derived from an AAV serotype, including without
limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9,
AAVrh.8, AAVrh.10, AAV 11, or AAV12 or the like. In some
embodiments, the nucleic acid in the AAV comprises an ITR of AAV1,
AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9, AAVrh.8, AAVrh.10,
AAV 11, AAV12 or the like. In some embodiments, the nucleic acid in
the AAV further encodes any one or more SMN protein (e.g., human
SMN protein) as described herein. For example, the nucleic acid in
the AAV can comprise at least one ITR of any AAV serotype
contemplated herein and can further encode an SMN protein
comprising the amino acid of SEQ ID NO:1. In some embodiments, the
nucleic acid in the AAV can comprise at least one ITR of any AAV
serotype contemplated herein and the nucleic acid sequence selected
from the group consisting of SEQ ID NOs:2-4. In some embodiments,
the nucleic acid in the AAV comprises the nucleic acid sequence
selected from the group consisting of SEQ ID NOs:2-4, and is
flanked by at least one AAV ITR. In some embodiments. a nucleic
acid encoding an SMN protein comprising the amino acid sequence of
SEQ ID NO:1, and is flanked by at least ITR. In some embodiments,
the nucleic acid in the AAV comprises the nucleic acid sequence
selected from the group consisting of SEQ ID NOs:5 and 6. In
further embodiments, the rAAV particle comprises capsid proteins of
AAV1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9, AAVrh.8,
AAVrh.10, AAV 11, AAV12 or the like. In further embodiments, the
rAAV particle comprises capsid proteins of an AAV serotype from
Clades A-F (Gao, et al. J. Virol. 2004, 78(12):6381). In some
embodiments, the nucleic acid in the AAV comprises the nucleic acid
sequence selected from the group consisting of SEQ ID NOs:2-4, and
is flanked by at least one AAV2 ITR.
[0084] Different AAV serotypes are used to optimize transduction of
particular target cells or to target specific cell types within a
particular target tissue (e.g., a diseased tissue). A rAAV particle
can comprise viral proteins and viral nucleic acids of the same
serotype or a mixed serotype. For example, a rAAV particle can
comprise AAV9 capsid proteins and at least one AAV2 ITR or it can
comprise AAV2 capsid proteins and at least one AAV9 ITR. In yet
another example, a rAAV particle can comprise capsid proteins from
both AAV9 and AAV2, and further comprise at least one AAV2 ITR. Any
combination of AAV serotypes for production of a rAAV particle is
provided herein as if each combination had been expressly stated
herein. In some embodiments, the invention provides rAAV particles
comprising AAV9 capsid proteins and a nucleic acid encoding a
primate SMN, e.g.,a human SMN, flanked by at least one AAV2
ITR.
Self-Complementary ARV Viral Genomes
[0085] In some aspects, the invention provides viral particles
comprising a recombinant self-complementing genome. AAV viral
particles with self-complementing genomes and methods of use of
self-complementing AAV genomes are described in U.S. Pat. Nos.
6,596,535; 7,125,717; 7,765,583; 7,785,888; 7,790,154; 7,846,729;
8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther
10:2105-21 11, each of which are incorporated herein by reference
in its entirety. An rAAV comprising a self-complementing genome,
will quickly form a double stranded DNA molecule by virtue of its
partially complementing sequences (e.g., complementing coding and
non-coding strands of a transgene). In some embodiments, the
invention provides an AAV viral particle comprising an AAV genome,
wherein the rAAV genome comprises a first heterologous
polynucleotide sequence (e.g., an SMN1 coding strand) and a second
heterologous polynucleotide sequence (e.g., an SMN1 noncoding or
antisense strand) wherein the first heterologous polynucleotide
sequence can form intrastrand base pairs with the second
polynucleotide sequence along most or all of its length. In some
embodiments, the first heterologous polynucleotide sequence and a
second heterologous polynucleotide sequence are linked by a
sequence that facilitates intrastrand basepairing; e.g., a hairpin
DNA structure. Hairpin structures arc known in the art, for example
in siRNA molecules. In some embodiments, the first heterologous
polynucleotide sequence and a second heterologous polynucleotide
sequence are linked by a mutated ITR (e.g.,the right ITR). In some
embodiments, the ITR comprises the polynucleotide sequence
5'--CACTCCCTCTCTGCGCGCTCGCTCGCTCACT
GAGGCCGGGCGACCAAAGGTCGCCCACGCCCGGGCTTGCCCOGGCG--3' (SEQ ID NO:7).
The mutated 1TR comprises a deletion of the D region comprising the
terminal resolution sequence. As a result, on replicating an AAV
viral genome, the rep proteins will not cleave the viral genome at
the mutated ITR and as such, a recombinant viral genome comprising
the following in 5' to 3' order will be packaged in a viral capsid:
an AAV ITR, the first heterologous polynucleotide sequence
including regulatory sequences, the mutated AAV ITR, the second
heterologous polynucleotide in reverse orientation to the first
heterologous polynucleotide and a third AAV ITR. In some
embodiments, the invention provides AAV viral particles comprising
a recombinant viral genome comprising a functional AAV2 ITR, a
first polynucleotide sequence encoding a primate SMN, a mutated
AAV2 ITR comprising a deletion of the D region and lacking a
functional terminal resolution sequence, a second polynucleotide
sequence comprising the complementary sequence to the sequence
encoding the primate SMN of the first polynucleotide sequence and a
functional AAV2 ITR. The recombinant viral genome of the viral
particles of the invention can be derived from AAV vector plasmids
comprising the polynucleotide sequences of SEQ ID NOs:5 or 6.
Production of AAV Particles
[0086] The rAAV particles can be produced using methods know in the
art. See, e.g., U.S. Pat. Nos. 6,566,118; 6,989,264; and 6,995,006.
In practicing the invention, host cells for producing rAAV
particles include mammalian cells, insect cells, plant cells,
microorganisms and yeast. Host cells can also be packaging cells in
which the AAV rep and cap genes are stably maintained in the host
cell or producer cells in which the AAV vector genome is stably
maintained. Exemplary packaging and producer cells are derived from
293, A549 or HeLa cells. AAV vectors are purified and formulated
using standard techniques known in the art.
[0087] In some aspects, a method is provided for producing any rAAV
particle as disclosed herein comprising (a) culturing a host cell
under a condition that rAAV particles are produced, wherein the
host cell comprises (i) one or more AAV package genes, wherein each
said AAV packaging gene encodes an AAV replication and/or
encapsidation protein; (ii) an rAAV pro-vector comprising a nucleic
acid encoding any SMN protein disclosed herein flanked by at least
one AAV ITR, and (iii) an AAV helper function; and (b) recovering
the rAAV particles produced by the host cell. In some embodiments,
a nucleic acid encodes an SMN protein of SEQ ID NO:1. In some
embodiments, said at least one AAV LTR is selected from the group
consisting of AAV 1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9,
AAV8rh, AAV10hr, AAV11, AAV 12 ITR or the like. In some
embodiments, said encapsidation protein is selected from the group
consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9,
AAV8rh, AAVrh10, AAV 10, AAV11, AAV12 capsid protein and the like.
In further embodiments, the rAAV particle comprises capsid proteins
of an AAV serotype from Clades A-F. In some embodiments, the rAAV
particles comprise an AAV9 capsid and a recombinant
self-complementing genome comprising AAV2 ITRs, a mutant AAV2 ITR
and a transgene encoding a primate SMN. In a further embodiment,
the rAAV particles are purified. The term "purified" as used herein
includes a preparation of rAAV particles devoid of at least some of
the other components that may also be present where the rAAV
particles naturally occur or are initially prepared from. Thus, for
example, isolated rAAV particles may be prepared using a
purification technique to enrich it from a source mixture, such as
a culture lysate or production culture supernatant. Enrichment can
be measured in a variety of ways, such as, for example, by the
proportion of DNase-resistant particles (DRPs) or genome copies
(gc) present in a solution, or by infectivity, or it can be
measured in relation to a second, potentially interfering substance
present in the source mixture, such as contaminants, including
production culture contaminants or in-process contaminants,
including helper virus, media components, and the like.
[0088] Also provided herein are pharmaceutical compositions
comprising a rAAV particle comprising a transgene encoding an SMN
protein of the invention and a pharmaceutically acceptable carrier.
The pharmaceutical compositions may be suitable for any mode of
administration described herein. A pharmaceutical composition of a
rAAV comprising a nucleic acid encoding an SMN protein described
herein can be introduced systemically, e.g., by intravenous
injection, by catheter, see U.S. Pat. No. 5,328,470, or by
stereotactic injection, Chen et al., 1994, PNAS, 91: 3054-3057.
[0089] In some embodiments, the pharmaceutical compositions
comprising a rAAV described herein and a pharmaceutically
acceptable carrier is suitable for administration to human. Such
carriers are well known in the art (see, e.g., Remington's
Pharmaceutical Sciences, 15th Edition, pp. 1035-1038 and
1570-1580). In some embodiments, the pharmaceutical compositions
comprising a rAAV described herein and a pharmaceutically
acceptable carrier is suitable for intrathecal injection. Such
pharmaceutically acceptable carriers can be sterile liquids, such
as water and oil, including those of petroleum, animal, vegetable
or synthetic origin, such as peanut oil, soybean oil, mineral oil,
and the like. Saline solutions and aqueous dextrose, polyethylene
glycol (PEG) and glycerol solutions can also be employed as liquid
carriers, particularly for injectable solutions. The pharmaceutical
composition may further comprise additional ingredients, for
example preservatives, buffers, tonicity agents, antioxidants and
stabilizers, nonionic wetting or clarifying agents,
viscosity-increasing agents, and the like. The pharmaceutical
compositions described herein can be packaged in single unit
dosages or in multidosage forms. The compositions are generally
formulated as sterile and substantially isotonic solution.
VI. Articles of Manufacture and Kits
[0090] Also provided are kits or articles of manufacture for use in
the methods described herein. In aspects, the kits comprise the
compositions described herein (e.g., rAAV particles comprising a
transgene encoding a primate SMN) in suitable packaging. Suitable
packaging for compositions (such as intrathecal compositions)
described herein are known in the art, and include, for example,
vials (such as sealed vials), vessels, ampules, bottles, jars,
flexible packaging (e.g., sealed Mylar or plastic bags), and the
like. These articles of manufacture may further be sterilized
and/or sealed.
[0091] The present invention also provides kits comprising
compositions described herein and may further comprise
instruction(s) on methods of using the composition, such as uses
described herein. The kits described herein may further include
other materials desirable from a commercial and user standpoint,
including other buffers, diluents, filters, needles, syringes, and
package inserts with instructions for performing any methods
described herein. For example, in some embodiments, the kit
comprises an rAAV comprising a transgene encoding a primate SMN for
intrathecal delivery of at least 1.times.10.sup.12 genome copies to
a primate as described herein, a pharmaceutically acceptable
carrier suitable for intrathecal injection, and one or more of: a
buffer, a diluent, a filter, a needle, a syringe, and a package
insert with instructions for performing intrathecal injections.
EXAMPLES
Example 1
Translational Fidelity of Intrathecal Delivery of scAAV9-SMN1 for
Spinal Muscular Atrophy
[0092] The potential of intrathecal delivery of a recombinant AAV
vector encoding survival motor neuron I (SMN1) as a therapeutic
approach for spinal muscular atrophy (SMA) was investigated. First,
a dose-response study in SMA mice was performed to determine the
minimum number of motor neurons that needed to be transduced for
therapeutic benefit. Second, the feasibility of widespread gene
delivery via intrathecal delivery of the recombinant viral vector
to a large mammal model, specifically juvenile pigs, was
ascertained. Third, applicability of widespread gene delivery via
intrathecal delivery of the recombinant viral vector in non-human
primates (NHP) was investigated.
[0093] Methods
Recombinant Self-Complementary AAV Vectors 0
[0094] The open reading frame of the human SMN1 was cloned into a
self-complementary AAV2-ITR plasmid that contained the 0.4 kb human
.beta.-glucuronidase promoter (FIGS. 5 and 6), and packaged into
serotype-9 capsid by triple-plasmid co-transfection to generate
scAAV9-hSMN1. For the intrathecal delivery experiments in large
animal models, the human .beta.-glucuronidase promoter was replaced
with a 0.9 kb cytomegalovirus enhancer/chicken .beta.-actin
promoter, and packaged into serotype-9 capsid by triple-plasmid
co-transfection to generate scAAV9-eGFP (FIGS. 7 and 8). The titers
of the scAAV9-hSMN1 and scAAV9-eGFP preparations were 8.3e12 and
4.3e12 genome copies (gc) per ml. respectively.
Mouse Surgeries
[0095] Breeding pairs of heterozygote SMA mice (SMN.sup.+/-,
hSMN2.sup.+/+, SMN.DELTA.7.sup.+/+) were mated as described
previously (Passini et al., 2010). On the day of birth (P.sub.0),
each pup received 3 injections (2 .mu.l at each site) into the
cerebral lateral ventricles of both hemispheres and into the lumbar
cord for a total volume of 6 .mu.l per mouse. Although this method
of delivery targeted the CNS widely, the cervical region showed a
lower level of transduction compared to the lumbar and thoracic
regions because of its relative distal location to the lumbar
injections (Passini et al.. 2010). The scAAV9-hSMN1 vector was
injected either at full strength at 5e10 gc per mouse, or diluted
in saline to deliver lower final doses of 1e10 and 1e9 gc per
mouse. All the injections were performed with a finely drawn glass
micropipette needle as previously described (Passini et al.. 2010).
Following the injections, the pups were toe-clipped and genotyped
to identify homozygote (SMN.sup.-/-, hSMN2.sup.+/+,
SMN.DELTA.7.sup.+/+), heterozygote (SMN.sup.+/-, hSMN2.sup.+/+,
SMN.DELTA.7.sup.+/+), and wild type (SMN.sup.+/+, hSMN2.sup.+/+,
SMN.DELTA.7.sup.+/+) homozygous SMA mice. Following genotyping,
only those determined to be SMA mice were retained as well as two
wild type pups (as controls), as reported previously (Passini et
al., 2011b).
Pig Surgeries
[0096] Two-month old farm pigs were obtained from Palmetto Research
Swine (Reevesville, S.C.) and observed in quarantine to ensure
health. The pigs were fasted the night before surgery and
anesthetized with isoflourane. No paralytic was used. Pigs were
positioned prone in an apparatus that has been described previously
(Federici et al 2012). This apparatus allowed the pig's abdomen to
hang free preventing abdominal pressure and consequently reducing
venous bleeding. The lumbar region was shaved, washed and draped in
the standard sterile manner. A 5 cm midline incision was performed
at L5. The paraspinous muscles were dissected free from the spinous
process and lamina. Next a single level lumbar laminectomy was
performed using an air drill and Kerrison Ronguers. The dura mater
was tented up with a single 4-0 neurolon stitch and a 4 mm incision
was made at the midline. Next, an intrathecal catheter (EDM lumbar
catheter, Medtronic Inc, Minneapolis Minn.) was advanced into the
lumbar cistern rostrally. The catheter was advanced 50 cm into the
region of the cervical spinal canal. 0.5 ml of vector was injected
at the cervical site as a bolus and the catheter was then backed
out 10 cm to the thoracic site. At this position, a second 0.5 ml
injection was performed as a bolus. Finally, the catheter was
backed out another 10 cm to the lumbar site for a third 0.5 ml
injection. Prior to removal of the catheter, a purse string suture
was placed with 4-0 nurolon. This was tightened immediately on
removal of the catheter to prevent reflux of cerebrospinal fluid.
The paraspinous muscles were re-approximated with interrupted 2-0
vicryl sutures. The fascia was closed with a running 2-0 vicryl
suture. The skin was closed with interrupted inverted 3-0 vicryl
sutures and a running 2-0 nylon stitch. Postoperatively, the
animals were observed to ensure adequate recovery from anesthesia.
Ambulation was observed over the survival period to ensure that all
animals returned to their neurological baseline.
Monkey Surgeries
[0097] Six juvenile (2-3 years of age) cynomolgus monkeys that
weighed -3.5 kg were anesthetized with ketamine (Ketaset, 7 mg/kg),
intubated and placed on inhaled isotlurance (1-3%). The back of the
neck and lumber spinal cord areas were shaved and cleaned with
povidone-iodine and alcohol. 22-gauge spinal needles were manually
guided into the intrathecal space between L4 and L5 (2 male and 1
female), and into the cisterna magna space of each animal. Correct
positioning was confirmed by the flow of cerebrospinal fluid (CSF)
from the needles with up to 1.5 ml of CSF collected into
micro-centrifuge tubes. Syringes (3 ml) and extension lines
containing scAAV9-eGFP were carefully connected to the spinal
needles and 3 ml was manually injected into each site at a rate of
1 ml/min. After completing the injections, the lines were
disconnected from the needles and positioning within the CSF space
was confirmed by the backflow of CSF into the needle huh. Needles
were then immediately removed and pressure applied to the injection
site. Animals were allowed to recover from the anesthesia and
observed daily with detailed cage side observations for 5 days
post-surgery. One female animal that received cisterna magna and
intrathecal injections had respiratory complications with a
prolonged recovery from anesthesia. This animal was euthanized 24
days after treatment due to decreased appetite and weight loss. All
other animals were euthanized as scheduled at 30 days
post-injection. All animals were deeply anesthetized and perfused
transcardially with phosphate-buffered saline and 4%
paraformaldehyde. The brain, spinal cord, dorsal root ganglia,
liver and spleen were harvested for immunohistochemical
analysis.
Western Blot Analysis
[0098] For biochemical analysis, treated and untreated mice at 16
and 58-66 days were perfused with phosphate-buffered saline (PBS),
and the spinal cords were dissected and separated into the lumbar.
thoracic and cervical segments, and then snap-frozen in liquid
nitrogen. Tissues were homogenized at a final concentration of 50
mg protein/ml using T-Per lysis buffer and a protease inhibitor
cocktail (Pierce, Rockford, Ill.). The homogenates were cleared by
centrifugation and the protein concentration was measured by BCA
assay (Pierce, Rockford. Ill.). Ten to twenty micrograms of
homogenate protein was resolved on a 4-12% SDS-PAGE, transferred to
nitrocellulose membrane, and probed with an anti-SMN monoclonal
antibody (1:5,000 BD Biosciences, San Jose, Calif.) and an
anti-.beta.-tubulin polyclonal antibody (1:750, Santa Cruz
Biotechnology, Santa Cruz, Calif.). The membranes were incubated
with infrared secondary antibodies (1:20,000, LI-COR Biosciences,
Lincoln Nebr.), and protein hands were visualized by quantitative
fluorescence using the Odyssey software (LI-COR Biosciences).
Immunohistochemistry
[0099] For histological analysis, treated and untreated mice were
first perfused with 4% paraformaldehyde (pH 7.4). The spinal cords
were then removed, placed into a 30% sucrose solution for 48-72 h,
embedded in Optimal Cutting Temperature (OCT) and cut into 10 .mu.m
frozen sections with a cryostat. Spinal cord sections were blocked
for 1 h at room temperature (RT) and then incubated with an
anti-SMN monoclonal antibody (BD Biosciences, 1:200 dilution) to
locate AAV-derived hSMN, and an anti-choline acetyl transferase
(ChAT) polyclonal antibody (Millipore; Burlington, Mass.; 1:100
dilution) to identify motor neurons. Primary antibodies were
incubated for 1 h at RT followed by an overnight incubation at
4.degree. C. in a humidified chamber. Spinal cord sections were
then incubated for 1 h at RT with either a biotinylated anti-mouse,
Cy3-conjugated anti-goat, or FITC-conjugated anti-rabbit secondary
antibody (Jackson ImmunoResearch; West Grove, Pa.; 1:250 dilution).
To increase the SMN and ChAT immuno-positive signals, a TSA signal
amplification kit (Perkin Elmer; Waltham, Mass.) or a citric acid
antigen retrieval protocol (Vector Labs; Burlingame, Calif.) were
performed according to the manufacturers' instructions. Sections
were cover-slipped with Vectashield mounting media (Vector Labs;
Burlingame, Calif.). For GFP immunostaining in pigs and NHPs,
tissue sections were incubated with a rabbit anti-eGFP antibody
(Millipore; 1:500 dilution) overnight at 4 oC, followed by a
biotinylated anti-rabbit secondary antibody (Jackson Laboratories;
1:250 dilution) for 2 hours at room temperature, and the
immuno-positive signal was visualized using a diaminobenzidine
(DAB) detection assay according to the manufacturer's protocol
(Vectorstain Kit, Vector Lab).
Motor Neuron Cell Counting
[0100] The number of ChAT immuno-positive cells was counted on 10
.mu.m coronal tissue sections. Bilateral counts were performed
along the rostrocaudal axis of the lumbar, thoracic and cervical
segments. Cells located in laminae 8 and 9 (ventral horn) of the
spinal cord that exhibited a fluorescent ChAT signal were
considered motor neurons. Approximately 8-10 different levels of
each spinal cord segment were counted to generate the overall
average number of motor neuron counts per segment for each animal.
To prevent double counting of the same cell, each section was at
least 100 .mu.m apart. Special care was also taken to compare
anatomically matched sections between different animals, and cell
counts were collected and recorded by a blinded observer.
Measurement of the Size of Myofibers
[0101] Skeletal muscles (quadriceps, intercostal, diaphragm) from
the right side of each mouse were processed by paraffin and stained
for hematoxylin-eosin to determine the myofiber cross-sectional.
Approximately 500 non-overlapping myofibers from each muscle were
randomly selected and photographed, and the cross-sectional area of
each myofiber was then measured using Metamorph (Molecular Devices,
Sunnyvale, Calif.) to generate the overall average size of the
myofiber per muscle for each animal, as previously reported
(Passini et al., 2010, 2011b).
Behavioral Tests
[0102] The righting reflex and grip strengths tests were performed
as previously described (Passini et al., 2010. 2011b). In brief,
the righting reflex test involved placing each mouse in a supine
position and then measuring the time taken for the mouse to
reposition itself onto all four paws. The grip strength test
involved placing the forelimbs and hindlimbs on a wire grid and the
mouse then gently pulled horizontally along the axis of the mesh to
record the resistance.
Statistics
[0103] For the behavioral tests, and quantitation of the number of
motor neurons and cross-sectional areas of myofibers, statistics
were performed using a one-way ANOVA and Bonferroni multiple post
hoe comparisons. The Kaplan-Meier survival curve was analyzed with
the log-rank test equivalent to the Mantel-Haenszel test. All
statistical analyses were performed with GraphPad Prism v4.0
(GraphPad Software, San Diego, Calif.). Values with p<0.05 were
considered significant.
[0104] Results
Administration of increasing amounts of scAAV9-hSMN1 into the CNS
of SMA mice effected progressively higher motor neuron cell counts
and corresponding improvements in muscle physiology.
[0105] To ascertain the number of gene-modified motor neurons
necessary to confer therapeutic efficacy in SMA mice, doses of
5e10, 1e10, and 1e9 genome copies (gc) of scAAV9-hSMN1 were
administered into the central nervous system (CNS) of the animals.
The viral vector was injected into the cerebral lateral ventricles
and the lumbar spinal cord at post-natal day 0 (P0) and the animals
were then sacrificed at 14 days post-injection (P14) for
age-matched analysis. For each dose, the spinal cord of one cohort
of mice was processed for Western blot analysis to quantitate the
levels of SMN on tissue homogenates, and the spinal cord of the
other cohort for immunohistochemistry to determine the spatial
pattern of gene expression on tissue sections.
[0106] Western blot analysis of the lumbar, thoracic and cervical
cords of SMA mice showed a dose dependent increase in SMN levels.
SMA mice injected with 5e10, 1e10 and 1e9 genome copies of
scAAV9-hSMN1 generated hSMN levels that were 70-180%, 30-100%, and
10-20% of WT levels, respectively (FIG. 9A). Untreated SMA mice had
10% WT levels of SMN throughout the spinal cord (FIG. 9A). Double
immunohistochemical (IHC) staining of tissue sections showed
co-localization of hSMN with ChAT in the ventral horn of the spinal
cord, indicating that a subset of motor neurons were transduced by
the viral vector (FIG. 10). A comprehensive analysis of the number
of doubly-stained cells in the lumbar and thoracic regions revealed
that motor neuron transduction efficiencies of 30-60%, 10-30%, and
<5% were realized with doses of 5e10, 1e10, and 1e9 gc,
respectively (FIG. 9B). Irrespective of the dose used, the
intensity of the staining for hSMN on cervical tissue sections was
very low, which made it difficult to accurately calculate the
efficiency of motor neuron transduction in this region (FIG. 9B).
Not wishing to be bound by theories, it may be that the absolute
levels of hSMN in individual cells in the cervical region
approached the limit for detection by immuno-staining but as an
aggregate (homogenate) could be detected by the more sensitive
Western blot assay.
[0107] The efficacy of administering increasing amounts of
scAAV9-hSMN1 on the pathological aberrations in the spinal cord and
skeletal muscle tissue of SMA mice was also assessed. Analysis of
the spinal cord showed that a significantly greater number of motor
neurons were observed in the lumbar, thoracic and cervical regions
of mice treated with the two highest doses (FIG. 9C).
Interestingly, at the dose of 1e10 gc, attainment of 30% WT levels
of SMN in the cervical region was associated with an increased
number of motor neuron cells (FIGS. 9A, C). Furthermore, in the
lumbar region of SMA mice treated with the lowest dose (1e9
gc/mouse), attainment of approximately 20% of WT levels of SMN was
sufficient to confer an increased number of motor neurons (FIG. 9A,
C). These data indicated that reconstituting SMN levels to
.about.20-30% WT levels in the spinal cord was sufficient to
provide some level of therapeutic benefit in SMA mice.
[0108] The quadriceps, intercostal, and diaphragm are skeletal
muscles that are innervated by motor neurons originating from the
lumbar, thoracic, and cervical regions, respectively. Measurement
of the cross-sectional areas of individual myofibers in the
quadriceps and intercostal muscles of SMA mice administered the two
highest doses showed a significant increase in their size compared
to untreated controls (FIG. 9D). In the diaphragm, a significant
increase in myofiber size was only noted in the 5e10 gc-treated
group. The intercostal muscle at 1e10 gc and the diaphragm muscle
at 5e10 both showed a significant increase in myofiber size
correlated with 70% SMN levels (FIG. 9A, D). Taken together, the
data indicate that reconstituting SMN to .about.20-30% of WT levels
was sufficient to rescue motor neurons from cell death and
increasing SMN levels to .about.70% of WT improved muscle
physiology (i.e., increasing myofiber size).
Measurement of the extent of motor neuron transduction by
scAAV9-hSMN1 required for therapeutic efficacy in SMA mice.
[0109] Animals administered increasing amounts of scAAV9-hSMN1 were
also monitored for their effects on function and survival. The grip
strength and righting reflex tests of SMA mice administered the two
highest doses showed significant and sustained improvements in
muscle strength and coordination when tested at day 14 and 175
(FIG. 11A, B). Mice administered the two highest doses also showed
significant increases in body weight when compared to those treated
with the lowest dose (1e9 gc) or untreated controls (FIG. 11C).
Importantly, treatment with scAAV9-hSMN1 resulted in a remarkable
increase in the median lifespans of the SMA mice (FIG. 11D).
Animals administered 5e10, 1e10 and leg gc exhibited median
lifespans of 153 days (+800% increase compared to saline controls,
p<0.0001), 70 days (+300%, p<0.0001), and 18 days (+6%,
p=0.1329), respectively (Fig. 11D). A dose of 1e10 gc was
sufficient to promote a significant extension in longevity, which
correlated with attainment of a minimum of 10-30% motor neuron
transduction (FIG. 9B) and 30-70% of WT levels of SMN in SMA mice
(FIG. 9A). About 10-30% motor neuron transduction was selected as a
benchmark criterion for success in intrathecal delivery studies in
large animal models.
Fidelity of intrathecal injection of scAAV9-hSMN1 at transducing
the requisite number of motor neurons in juvenile farm pigs for
efficacy.
[0110] Intrathecal administration of a scAAV9-eGFP vector in larger
animals was evaluated. The pig was chosen as one of the large
animal species because the size and morphology of its spinal cord
closely resembles that of humans, making it a reliable model for
translational research of neurosurgical approaches to the spinal
cord (Federici et al 2012). Juvenile farm pigs were injected with
scAAV9-eGFP (n=2) or saline (n=1) into the intrathecal (IT) space
to determine if widespread motor neuron transduction could be
achieved in a large spinal cord. A laminectomy was performed on L5
and a catheter was threaded to the C8 segment at which juncture
1e12 gc of scAAV9-eGFP in a volume of 0.5 ml was injected. The
catheter was then retracted back to approximately the T8 segment
and another 1e12 gc of scAAV9-eGFP was administered, and then
retracted once again to approximately the L2 segment where a third
deposit of 1e12 gc of the viral vector was made. Thus, each pig
received a total of 3e12 gc of scAAV9-eGFP in a volume of 1.5 ml.
The animals were sacrificed at 35 days post-injection and the
different sections of the spinal cord were identified and dissected
(FIG. 12A). Abundant GFP-positively stained cells were observed in
the ventral horns of the spinal cords of pigs treated with
scAAV9-eGFP but not with saline (FIG. 12B-D).
[0111] The size and location of the GFP-positive cell bodies in the
ventral horn were consistent with motor neuron transduction.
However, to confirm the identity of the GFP-positive cells and to
calculate the percentage of motor neurons transduced by
scAAV9-eGFP, double IHC was performed on every other spinal cord
segment between C2 and L6. As illustrated by the segments C8, T8,
and L2, a number of cells showed co-staining with GFP and ChAT
indicating that a subset of transduced cells were indeed motor
neurons (FIG. 12E-G). A comprehensive analysis of the entire spinal
cord showed that >10% of motor neurons were transduced in the
majority of the segments (FIG. 12H). In some segments, >30% of
the motor neurons were transduced by scAAV-eGFP (FIG. 12H). Thus,
intrathecal injection of recombinant AAV vectors into cerebrospinal
fluid of juvenile pigs, which are approximate to the size of young
humans, support the minimal level of motor neuron transduction
shown necessary for efficacy in SMA mice.
Fidelity of intrathecal injection of scAAV9-hSMN1 at transducing
the requisite number of motor neurons in juvenile monkeys for
efficacy.
[0112] To determine whether widespread motor neuron transduction
could be achieved in a large animal model that more closely
resemble young human infants, juvenile cynomolgus monkeys were
injected with scAAV9-eGFP into the intrathecal space. However,
unlike the pig injections where a catheter was threaded through the
IT space, the viral vector was injected directly into the cisterna
magna and the lumbar subarachnoid space of the non-human primate
(NHP). The selection of this approach was an attempt to eliminate
the potential for catheter entanglement during the threading
process. One cohort of monkeys (n=3) received 3 ml (1.25e13 gc) of
scAAV9-eGFP into the lumbar subarachnoid space and another 3 ml
(1.25e13 gc) into the cisterna magna for a total of 6 ml (2.5e13
gc) per monkey. A second cohort of monkeys was injected with 3 ml
(1.25e13 gc) of scAAV9-eGFP into the cisterna magna alone to
determine if widespread gene delivery could be achieved with a
single injection. All monkeys were sacrificed at 30 days
post-injection.
[0113] Analysis of tissue sections from both cohorts of monkeys
magna showed similar, robust expression of GFP in the lumbar
ventral horn (FIG. 13A-C). Co-staining for GFP and ChAT confirmed
that a subset of the transduced cells were motor neurons (FIG.
13D-F). Transduction of motor neurons was also evident in other
regions of the spinal cord including the cervical, thoracic and
sacral segments (FIG. 13G-N). A comprehensive analysis of the
monkeys treated by the combination of lumbar and cisterna magna
injections showed 25-75% motor neuron transduction in all segments
analyzed (FIG. 13P). Animals treated by cisterna magna injections
resulted in 15-50% motor neuron transduction throughout the
cervical, thoracic, and lumbar segments (FIG. 13O). Not wishing to
be bound by any theories, the increased motor neuron transduction
rate in the combination lumbar and cisterna magna group might have
been due to delivery of a larger dose of the vector to these
animals.
[0114] Other regions of the CNS were also transduced following
intrathecal delivery of scAAV9-eGFP. The dorsal root ganglia (DRG)
were genetically modified (as evidenced by expression of GFP) in
both treatment cohorts (FIG. 14A-F). Furthermore, GFP-positive
pyramidal neurons and glia cells were detected along the cerebral
cortex that spanned the pre-frontal to the occipital cortices in
both treatment cohorts (FIG. 14G, I). Purkinje cells throughout the
cerebellar cortex were also efficiently transduced in both cohorts
(FIG. 14H, I). Overall, the pattern of GFP expression in the DRG
and brain was similar between the two groups. GFP expression on
tissue sections was not detected in the liver and spleen of the
monkeys suggesting that the amount of scAAV9-eGFP that entered the
systemic circulation was low. The levels of antibodies against the
AAV9 capsid in the serum and CSF were monitored. Baseline levels of
pre-existing neutralizing antibodies (NAB) to AAV9 in the serum in
all the monkeys were low (Table 1). At 30 days post-injection, the
serum and CSF levels of anti-AAV9 NAB were significantly higher
(Table 1).
[0115] The results describe herein, indicate that intrathecal
injection of recombinant AAV vectors into the cisterna magna and
lumbar subarachnoid space in juvenile monkeys support the level of
motor neuron transduction shown to be efficacious in SMA mice.
TABLE-US-00001 TABLE 1 NAB against AAV9 in NHPs. Anti-AAV9 NAB
Anti-AAV9 NAB Anti-AAV9 NAB Anti-AAV9 NAB NHP Dose Titer in Serum
Titer in Serum Titer in CSF Titer in CSF ID Group (gc) (Baseline)
(30 d Post-inj) (Baseline) (30 d Post-inj) 39318 CM + Lumbar
2.50e13 <4 16384 <4 512 39334 CM + Lumbar 2.50e13 <4 4096
<4 32 39537 CM + Lumbar 2.50e13 <4 2048 <4 4 40370 CM
1.25e13 32 16384 <4 2048 39525 CM 1.25e13 <4 8192 <4 512
39583 CM 1.25e13 4 16384 <4 2048 NAB, neutralizing antibody; CM,
cisterna magna; CSF cerebral spinal fluid.
REFERENCES
[0116] A D., Mingozzi, F., Hui, D., Bennicelli, J. L., Wei, Z.,
Chen, Y., Bote, E., Grant, R. L., Golden, J. A., Narfstrom, K.,
Syed, N. A., Orlin, S. E., High, K. A., Maguire, A. M., and
Bennett, J. (2010). Safety and efficacy of subretinal
readministration of a viral vector in large animals to treat
congenital blindness. Sci Transl. Med. 2, e21ra16.
[0117] Avila A M, Burnett B G, Taye A A, Gabanella F, Knight M A,
Hartenstein P, Cizman Z, Di Prospero N A, Pellizzoni L, Fischbeck K
U, Sumner C J. (2007). Trichostatin A increases SMN expression and
survival in a mouse model of spinal muscular atrophy. J Clin Invest
117:659-671.
[0118] Bankiewicz, K. S., Forsayeth, J., Eberling, J. L.,
Sanchez-Pernaute, R., Pivirotto, P., Bringas, J., Herscovitch, P.,
Carson. R. E., Eckelman, W., Reutter, B., and Cunningham, J.
(2006). Long-term clinical improvement in MPTP-lesioned primates
after gene therapy with AAV-hAADC. Mol. Ther. 14, 564-570.
[0119] Bebee, T. W., Dominguez, C. E., and Chandler, D. S. (2012).
Mosue models of SMA: tools for disease characterization and
therapeutic development. Hum. Genet. 131, 1277-1293.
[0120] Bevan, A. K., Duque, S., Foust, K. D., Morales, P. R.,
Braun, L., Schmelzer, L., Chan, C. M., McCrate, M., Chicoine, L.
G., Coley, B. D., Porensky, P. N., Kolb, S. J., Mendell, J. R.,
Burghes, A. H., and Kaspar, B. K. (2011). Systemic gene delivery in
large species for targeting spinal cord, brain, and peripheral
tissues for pediatric disorders. Mol. Ther. 19, 1971-1980.
[0121] Boutin, S., Monteilhet, V., Veron, P., Leborgne, C.,
Benveniste, O., Montus, M. F., and Masurier, C. (2010). Prevalence
of serum lgG and neutralizing factors against adeno-associated
virus (AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population:
implications for gene therapy using AAV vectors. Hum. Gene Ther.
21, 704-712.
[0122] Bowerman M, Murray L M, Beauvais A. Pinheiro B, Kothary R
(2012) A critical smn threshold in mice dictates onset of an
intermediate spinal muscular atrophy phenotype associated with a
distinct neuromuscular junction pathology. Neuromuscul. Disord.
22:263-276.
[0123] Butchbach M E, Singh J. Thorsteinsdottir M, Saieva L,
Slominski E, Thurmond J, Andresson T, Zhang J, Edwards J D, Simard
L R, Pellizzoni L, Jarecki J, Burghes A H, Gurney M E. (2010)
Effects of 2,4-diaminoquinazoline derivatives on SMN expression and
phenotype in a mouse model for spinal muscular atrophy. Hum Mol
Genet. 19:454-467.
[0124] Chen, T. H. et al. (2010). Randomized, double-blind,
placebo-controlled trial of hydroxyurea in spinal muscular atrophy.
Neurology 75, 2190-2197.
[0125] Dominguez E, Marais T, Chatauret N, Benkhelifa-Ziyyat S,
Duque S, Ravassard P, Carcenac R, Astord S, Pereira de Moura A,
Voit T, Barkats M. (2011) Intravenous scAAV9 delivery of a
codon-optimized SMN1 sequence rescues SMA mice. Hum. Mol. Genet.
20, 681-693.
[0126] Duque S, Joussemet B. Riviere C, Marais T, Dubreil L, Douar
A M, Fyfe J. Moullier P, Colic M A, Barkats M. (2009) Intravenous
administration of self-complementary AAV9 enables transgene
delivery to adult motor neurons. Mol. Ther. 17, 1187-11%.
[0127] Farooq, F., Molina, F.A., Hadwen, J., MacKenzie, D.,
Witherspoon, L., Osmond, M., Holcik, M., and MacKenzie, A. (2011).
Prolactin increases SMN expression and survival in a mouse model of
severe spinal muscular atrophy via the STATS pathway. J. Clin.
Invest. 121, 3042-3050.
[0128] Federici, T., Taub, J. S., Baum, G. R., Gray, S. J.,
Grieger, J. C., Matthews, K. A., Handy, C. R., Passini, M. A.,
Samulski, R J., and Boulis., N. M. (2012). Robust spinal motor
neuron transduction following intrathecal delivery of AAV9 pigs.
Gene Ther. 19, 852-859.
[0129] Foust, K. D. et al. (2010) Rescue of the spinal muscular
atrophy phenotype in a mouse model by early postnatal delivery of
SMN. Nat. Biotech. 28, 271-274.
[0130] Garbes L, Riessland M, Holker I, Heller R, Hauke J, Trankle
C, Coras R, Blumcke I, Hahnen E, Wirth B. (2009) LBH589 induces up
to 10-fold SMN protein levels by several independent mechanisms and
is effective even in cells from SMA patients non-responsive to
valproate. Hum Mol Genet. 18:3645-3658.
[0131] Gray S J, Matagne V. Bachaboina L, Yadav S, Ojeda S R,
Samulski R J (2011) Preclinical differences of intravascular AAV9
delivery to neurons and glia: a comparative study of adult mice and
nonhuman primates. Mol Ther 19:1058-1069.
[0132] Gray S J, Kalburgi S N, McCown T J, Samulski R J (2013)
Global CNS gene delivery and evasion of anti-AAV-neutralizing
antibodies by intrathecal AAV administration in non-human primates.
Gene Therapy. Doi:10.1038/gt.2012.101.
[0133] Hamilton. G., and Gillingwater, T. H. (2012) Spinal muscular
atrophy: going beyond the motor neuron. Trends Mol. Med. (in
press).
[0134] Meier, C. R., and DiDonato, C. J. (2009). Translational
readthrough by the aminoglycoside geneticin (G418) modulated SMN
stability in vitro and improves motor function in SMA mice in vivo.
Hum. Mol. Genet. 18, 1310-1322.
[0135] Hua, Y., et al., (2008). Antisense masking of an hnRNP A1/A2
intronic splicing silencer corrects SMN2 splicing in transgenic
mice. Am. J. Hum. Genet. 82, 834-848.
[0136] Hua Y, Sahashi K, Hung G, Rigo F, Passini M A, Bennett C F,
Krainer A R. (2010). Antisense correction of SMN2 splicing in the
CNS rescues necrosis in a type III SMA mouse model. Genes Dev
24:1634-1644.
[0137] Hua Y, Sahashi K, Rigo F, Flung G, Horev G, Bennett C F.
Krainer A R. (2011) Peripheral SMN restoration is essential for
long-term rescue of a severe spinal muscular atrophy mouse model.
Nature 478:123-126.
[0138] Kolb. S. J., and Kissel. J. T. (2011) Spinal muscular
atrophy: a timely review. Arch. Neurol. 68, 979-984.
[0139] Kole, R., Krainer, A. R., and Altman, S. (2012). RNA
therapeutics: beyond RNA interference and antisense
oligonucleotides. Nature Rev. Drug Dis. 11, 125-140.
[0140] Le, T. T. et al. (2005) SMN.DELTA.7, the major product of
the centromeric survival motor neuron (SMN2) gene. extends survival
in mice with spinal muscular atrophy and associates with
full-length SMN. Hum Mol. Genet. 14, 845-857.
[0141] Lefebvre, S. et al. (1995). Identification and
characterization of a spinal muscular atrophy-determining gene.
Cell 80, 155-165.
[0142] Lewelt, A.. Newcomb, T. M., and Swoboda, K. J. (2012). New
therapeutic approaches to spinal muscular atrophy. Cum Neurol.
Neurosci. Rep. 12, 42-53.
[0143] Lorson, M. A., Spate, L. D., Samuel, M. S., Murphy, C. N.,
Lorson, C. L., Prather, R. S., and Wells, K. D. (2011). Disruption
of the survival motor neuron (SMN) gene in pigs using ssDNA.
Transgenic Res. 20, 1293-1304.
[0144] Markowitz, L A., Singh, P., and Darras, B. T. (2012). Spinal
muscular atrophy: a clinical and research update. Ped. Neurol. 46,
1-12.
[0145] Mattis, V. B., Ebert, A. D., Fosso, M. Y., Chang, C. W., and
Lorson, C. L. (2009). Delivery of a read-through inducing compound,
TC007, lessens the severity of a spinal muscular atrophy animal
model. Ilum. Mol. Genet. 18, 3906-3913.
[0146] Mercuri, E. et al (2007). Randomized, double blind,
placebo-controlled trial of phenylbutyrate in spinal muscular
atrophy. Neurology 68, 51-55.
[0147] Monani, U. R., Lorson, C. L., Parsons, D. W., Prior, T. W.,
Androphy, E. J., Burghes, A. H., and McPherson, J. D. (1999). A
single nucleotide difference that alters splicing patterns
distinguishes the SMA gene SMN I from the copy gene SMN2. Hum. Mol.
Genet. 8, 1177-1183.
[0148] Nathwani, A. C. et al. (2011). Adenovirus-associated virus
vector-mediated gene transfer in hemophilia B. N. Engl. J. Med.
365. 2357-2365.
[0149] Passini, M. A. et al. (2010) CNS-targeted gene therapy
improves survival and motor function in a mouse model of spinal
muscular atrophy. J. Clin. Invest. 120, 1253-1264.
[0150] Passini, M. A. and Cheng, S. H. (2011a). Prospects for the
gene therapy of spinal muscular atrophy. Trends Mol. Med. 17,
259-265.
[0151] Passini, M. A., et al. (2011 b). Antisense oligonucleotides
delivered to the mouse CNS ameliorate symptoms of severe spinal
muscular atrophy. Sci. Transl. Med. 3, 72ra18
[0152] Samaranch, L., Salegio, E. A., Sebastian, W. S., Kells, A.
P., Foust, K. D., Bringas, J. R., Lamarre, C., Forsayeth, J.,
Kaspar, B. K., and Bankiewicz, K. S. (2012). Adeno-associated virus
serotype 9 transduction in the central nervous system of nonhuman
primates. Hum. Gene Ther. 23, 382-389.
[0153] Singh, N. K., et al. (2006). Splicing of a critical exon of
human survival motor neuron is regulated by a unique silencer
element located in the last intron. Mol. Cell. Biol. 26,
1333-1346.
[0154] Sumner, C. J. et al. (2003). Valproic acid increases SMN
levels in spinal muscular atrophy patient cells. Ann. Neurol. 54,
647-654.
[0155] Treleaven, C. M., Tamsett, T. J., Bu, J., Fidler, J. A.,
Sardi, S. P., Hurlbut, G. D., Woodworth, L. A., Cheng, S. H.,
Passini, M. A., Shihabuddin, L. S., and Dodge, J. C. (2012). Gene
transfer to the CNS is efficacious in immune-primed mice harboring
physiologically relevant titers of anti-AAV antibodies. Mol. Ther.
20, 1713-1723.
[0156] Valori C F, Ning K, Wyles M, Mead R J, Grierson A J, Shaw P
J, Azzouz. (2010) Systemic delivery of scAAV9 expressing SMN
prolongs survival in a model of spinal muscular atrophy Sci Transl
Med. 2:35ra42.
Sequence CWU 1
1
71294PRTHomo sapiens 1Met Ala Met Ser Ser Gly Gly Ser Gly Gly Gly
Val Pro Glu Gln Glu1 5 10 15Asp Ser Val Leu Phe Arg Arg Gly Thr Gly
Gln Ser Asp Asp Ser Asp 20 25 30Ile Trp Asp Asp Thr Ala Leu Ile Lys
Ala Tyr Asp Lys Ala Val Ala 35 40 45Ser Phe Lys His Ala Leu Lys Asn
Gly Asp Ile Cys Glu Thr Ser Gly 50 55 60Lys Pro Lys Thr Thr Pro Lys
Arg Lys Pro Ala Lys Lys Asn Lys Ser65 70 75 80Gln Lys Lys Asn Thr
Ala Ala Ser Leu Gln Gln Trp Lys Val Gly Asp 85 90 95Lys Cys Ser Ala
Ile Trp Ser Glu Asp Gly Cys Ile Tyr Pro Ala Thr 100 105 110Ile Ala
Ser Ile Asp Phe Lys Arg Glu Thr Cys Val Val Val Tyr Thr 115 120
125Gly Tyr Gly Asn Arg Glu Glu Gln Asn Leu Ser Asp Leu Leu Ser Pro
130 135 140Ile Cys Glu Val Ala Asn Asn Ile Glu Gln Asn Ala Gln Glu
Asn Glu145 150 155 160Asn Glu Ser Gln Val Ser Thr Asp Glu Ser Glu
Asn Ser Arg Ser Pro 165 170 175Gly Asn Lys Ser Asp Asn Ile Lys Pro
Lys Ser Ala Pro Trp Asn Ser 180 185 190Phe Leu Pro Pro Pro Pro Pro
Met Pro Gly Pro Arg Leu Gly Pro Gly 195 200 205Lys Pro Gly Leu Lys
Phe Asn Gly Pro Pro Pro Pro Pro Pro Pro Pro 210 215 220Pro Pro His
Leu Leu Ser Cys Trp Leu Pro Pro Phe Pro Ser Gly Pro225 230 235
240Pro Ile Ile Pro Pro Pro Pro Pro Ile Cys Pro Asp Ser Leu Asp Asp
245 250 255Ala Asp Ala Leu Gly Ser Met Leu Ile Ser Trp Tyr Met Ser
Gly Tyr 260 265 270His Thr Gly Tyr Tyr Met Gly Phe Arg Gln Asn Gln
Lys Glu Gly Arg 275 280 285Cys Ser His Ser Leu Asn 2902885DNAHomo
sapiens 2atggcgatga gcagcggcgg cagtggtggc ggcgtcccgg agcaggagga
ttccgtgctg 60ttccggcgcg gcacaggcca gagcgatgat tctgacattt gggatgatac
agcactgata 120aaagcatatg ataaagctgt ggcttcattt aagcatgctc
taaagaatgg tgacatttgt 180gaaacttcgg gtaaaccaaa aaccacacct
aaaagaaaac ctgctaagaa gaataaaagc 240caaaagaaga atactgcagc
ttccttacaa cagtggaaag ttggggacaa atgttctgcc 300atttggtcag
aagacggttg catttaccca gctaccattg cttcaattga ttttaagaga
360gaaacctgtg ttgtggttta cactggatat ggaaatagag aggagcaaaa
tctgtccgat 420ctactttccc caatctgtga agtagctaat aatatagaac
agaatgctca agagaatgaa 480aatgaaagcc aagtttcaac agatgaaagt
gagaactcca ggtctcctgg aaataaatca 540gataacatca agcccaaatc
tgctccatgg aactcttttc tccctccacc accccccatg 600ccagggccaa
gactgggacc aggaaagcca ggtctaaaat tcaatggccc accaccgcca
660ccgccaccac caccacccca cttactatca tgctggctgc ctccatttcc
ttctggacca 720ccaataattc ccccaccacc tcccatatgt ccagattctc
ttgatgatgc tgatgctttg 780ggaagtatgt taatttcatg gtacatgagt
ggctatcata ctggctatta tatgggtttc 840agacaaaatc aaaaagaagg
aaggtgctca cattccttaa attaa 8853885DNAArtificial SequenceSynthetic
construct 3atggctatga gcagtggcgg ctctggcggc ggagtgcctg agcaggaaga
tagcgtgctg 60ttcagacggg gcaccggcca gagcgacgac agcgacatct gggatgacac
cgccctgatc 120aaggcctacg acaaggccgt ggccagcttc aagcacgccc
tgaagaacgg cgatatctgc 180gagacaagcg gcaagcccaa gaccaccccc
aagagaaagc ccgccaagaa gaacaagagc 240cagaagaaga ataccgccgc
ctccctgcag cagtggaaag tgggcgataa gtgcagcgcc 300atttggagcg
aggacggctg catctacccc gccacaatcg ccagcatcga cttcaagcgg
360gaaacctgcg tggtggtgta cacaggctac ggcaacagag aggaacagaa
cctgagcgac 420ctgctgagcc ccatctgcga ggtggccaac aacatcgagc
agaacgccca ggaaaacgag 480aacgagtccc aggtgtccac cgacgagagc
gagaacagca gaagccccgg caacaagagc 540gacaacatca agcctaagag
cgccccctgg aacagcttcc tgcctccccc tccaccaatg 600cctggcccta
gactgggacc tggcaagccc ggcctgaagt tcaatggccc tcctccccca
660cctccaccac caccccctca tctgctgagc tgttggctgc ccccattccc
tagcggccct 720cccatcattc ctccaccccc cccaatctgc cccgacagcc
tggatgatgc tgatgccctg 780ggctccatgc tgatctcttg gtacatgagc
ggctaccaca ccggctacta catgggcttc 840cggcagaacc agaaagaggg
ccgctgtagc cacagcctga actga 8854885DNAArtificial SequenceSynthetic
construct 4atggcgatga gcagcggtgg ttccggagga ggggtgccgg agcaggagga
ttccgtcctt 60ttcagacggg gaaccggcca gtcggacgac tcggacatct gggatgacac
cgcactgatc 120aaagcatacg ataaagcagt ggcatcgttc aagcacgccc
ttaagaatgg agacatttgc 180gaaaccagcg ggaagccaaa aactactccg
aagcgcaagc ccgccaagaa gaataagtca 240cagaagaaaa acaccgccgc
ttcgctgcaa cagtggaaag tgggcgacaa gtgctccgcg 300atctggtcag
aggatggctg catctacccg gccacgatcg cctccatcga cttcaagcgg
360gaaacttgtg tggtcgtcta cactggctac ggaaaccgcg aggaacagaa
tctcagcgat 420ctcctcagcc cgatttgtga ggtggccaac aatatcgaac
agaacgcgca agaaaacgag 480aacgagtccc aagtgtcgac tgacgaatcg
gaaaattcgc gctcaccagg aaacaagtca 540gataacatca agcccaaaag
cgcgccatgg aacagctttt tgccgccacc accacctatg 600cctggaccga
ggctgggacc gggaaagccg ggactcaaat tcaacggccc accgcctccg
660ccacctccgc ctccacccca cttgctgtcc tgctggctgc cgccatttcc
gtcgggtccg 720cctatcatcc ctcctccacc gccgatttgc cccgactcac
tcgacgatgc tgacgccctg 780gggtcaatgc tgatctcctg gtatatgtcc
ggctaccata ccggatacta catgggattc 840cggcagaacc aaaaggaagg
gagatgctcc cattcgctga attga 88551860DNAArtificial SequenceSynthetic
construct 5ggccactccc tctctgcgcg ctcgctcgct cactgaggcc gggcgaccaa
aggtcgcccg 60acgcccgggc tttgcccggg cggcctcagt gagcgagcga gcgcgcagag
agggagtggc 120caactccatc actaggggtt cctggagggg tggagtcgtg
acagatctga attcctgctg 180ggaaaagcaa gtggaggtgc tccttgaaga
aacaggggga tcccaccgat ctcaggggtt 240ctgttctggc ctgcggccct
ggatcgtcca gcctgggtcg gggtggggag cagacctcgc 300ccttatcggc
tggggctgag ggtgagggtc ccgtttcccc aaaggcctag cctggggttc
360cagccacaag ccctaccggg cagcgcccgg ccccgcccct ccaggcctgg
cactcgtcct 420caaccaagat ggcgcggatg gcttcaggcg catcacgaca
ccggcgcgtc acgcgacccg 480ccctacgggc acctcccgcg cttttcttag
cgccgcagac ggtggccgag cgggggaccg 540ggaagcatgg cccgggctgc
agctctaagg taaatataaa atttttaagt gtataatgtg 600ttaaactact
gattctaatt gtttctctct tttagattcc aacctttgga actcgaattc
660atggcgatga gcagcggcgg cagtggtggc ggcgtcccgg agcaggagga
ttccgtgctg 720ttccggcgcg gcacaggcca gagcgatgat tctgacattt
gggatgatac agcactgata 780aaagcatatg ataaagctgt ggcttcattt
aagcatgctc taaagaatgg tgacatttgt 840gaaacttcgg gtaaaccaaa
aaccacacct aaaagaaaac ctgctaagaa gaataaaagc 900caaaagaaga
atactgcagc ttccttacaa cagtggaaag ttggggacaa atgttctgcc
960atttggtcag aagacggttg catttaccca gctaccattg cttcaattga
ttttaagaga 1020gaaacctgtg ttgtggttta cactggatat ggaaatagag
aggagcaaaa tctgtccgat 1080ctactttccc caatctgtga agtagctaat
aatatagaac agaatgctca agagaatgaa 1140aatgaaagcc aagtttcaac
agatgaaagt gagaactcca ggtctcctgg aaataaatca 1200gataacatca
agcccaaatc tgctccatgg aactcttttc tccctccacc accccccatg
1260ccagggccaa gactgggacc aggaaagcca ggtctaaaat tcaatggccc
accaccgcca 1320ccgccaccac caccacccca cttactatca tgctggctgc
ctccatttcc ttctggacca 1380ccaataattc ccccaccacc tcccatatgt
ccagattctc ttgatgatgc tgatgctttg 1440ggaagtatgt taatttcatg
gtacatgagt ggctatcata ctggctatta tatgggtttt 1500agacaaaatc
aaaaagaagg aaggtgctca cattccttaa attaagaatt gcaccaccag
1560gcctgatagg ccctgtgcct tctagttgcc agccatctgt tgtttgcccc
tcccccgtgc 1620cttccttgac cctggaaggt gccactccca ctgtcctttc
ctaataaaat gaggaaattg 1680catcgcattg tctgagtagg tgtcattcta
ttctgggggg tggggtgggg caggacagca 1740agggggagga ttgggaagac
aatagcaggc atgcactagt ccactccctc tctgcgcgct 1800cgctcgctca
ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt tgcccgggcg
186062338DNAArtificial SequenceSynthetic construct 6ggccactccc
tctctgcgcg ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg 60acgcccgggc
tttgcccggg cggcctcagt gagcgagcga gcgcgcagag agggagtggc
120caactccatc actaggggtt cctggagggg tggagtcgtg acagatcaat
tcggtaccct 180agttattaat agtaatcaat tacggggtca ttagttcata
gcccatatat ggagttccgc 240gttacataac ttacggtaaa tggcccgcct
ggctgaccgc ccaacgaccc ccgcccattg 300acgtcaataa tgacgtatgt
tcccatagta acgccaatag ggactttcca ttgacgtcaa 360tgggtggact
atttacggta aactgcccac ttggcagtac atcaagtgta tcatatgcca
420agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta
tgcccagtac 480atgaccttat gggactttcc tacttggcag tacatctacg
tattagtcat cgctattacc 540atggtcgagg tgagccccac gttctgcttc
actctcccca tctccccccc ctccccaccc 600ccaattttgt atttatttat
tttttaatta ttttgtgcag cgatgggggc gggggggggg 660ggggggcgcg
cgccaggcgg ggcggggcgg ggcgaggggc ggggcggggc gaggcggaga
720ggtgcggcgg cagccaatca gagcggcgcg ctccgaaagt ttccttttat
ggcgaggcgg 780cggcggcggc ggccctataa aaagcgaagc gcgcggcggg
cgggagtcgc tgcgacgctg 840ccttcgcccc gtgccccgct ccgccgccgc
ctcgcgccgc ccgccccggc tctgactgac 900cgcgttactc ccacaggtga
gcgggcggga cggccttctc ctccgggctg taattagcgc 960ttggtttaat
gacggcttgt ttcttttctg tggctgcgtg aaagccttga ggggctccgg
1020gagctagagc ctctgctaac catgttcatg ccttcttctt tttcctacag
ctcctgggca 1080acgtgctggt tattgtgctg tctcatcatt ttggcaaaga
attttggaac tcgaattcat 1140ggcgatgagc agcggcggca gtggtggcgg
cgtcccggag caggaggatt ccgtgctgtt 1200ccggcgcggc acaggccaga
gcgatgattc tgacatttgg gatgatacag cactgataaa 1260agcatatgat
aaagctgtgg cttcatttaa gcatgctcta aagaatggtg acatttgtga
1320aacttcgggt aaaccaaaaa ccacacctaa aagaaaacct gctaagaaga
ataaaagcca 1380aaagaagaat actgcagctt ccttacaaca gtggaaagtt
ggggacaaat gttctgccat 1440ttggtcagaa gacggttgca tttacccagc
taccattgct tcaattgatt ttaagagaga 1500aacctgtgtt gtggtttaca
ctggatatgg aaatagagag gagcaaaatc tgtccgatct 1560actttcccca
atctgtgaag tagctaataa tatagaacag aatgctcaag agaatgaaaa
1620tgaaagccaa gtttcaacag atgaaagtga gaactccagg tctcctggaa
ataaatcaga 1680taacatcaag cccaaatctg ctccatggaa ctcttttctc
cctccaccac cccccatgcc 1740agggccaaga ctgggaccag gaaagccagg
tctaaaattc aatggcccac caccgccacc 1800gccaccacca ccaccccact
tactatcatg ctggctgcct ccatttcctt ctggaccacc 1860aataattccc
ccaccacctc ccatatgtcc agattctctt gatgatgctg atgctttggg
1920aagtatgtta atttcatggt acatgagtgg ctatcatact ggctattata
tgggtttcag 1980acaaaatcaa aaagaaggaa ggtgctcaca ttccttaaat
taagaattgc accaccaggc 2040ctgataggcc ctgtgccttc tagttgccag
ccatctgttg tttgcccctc ccccgtgcct 2100tccttgaccc tggaaggtgc
cactcccact gtcctttcct aataaaatga ggaaattgca 2160tcgcattgtc
tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag
2220ggggaggatt gggaagacaa tagcaggcat gcactagtcc actccctctc
tgcgcgctcg 2280ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc
ccgggctttg cccgggcg 2338778DNAArtificial SequenceSynthetic
construct 7cactccctct ctgcgcgctc gctcgctcac tgaggccggg cgaccaaagg
tcgcccacgc 60ccgggctttg cccgggcg 78
* * * * *