U.S. patent application number 16/873630 was filed with the patent office on 2021-04-22 for ras opposite (rop) and related nucleic acid molecules that confer resistance to coleopteran and/or hemipteran pests.
The applicant listed for this patent is Dow AgroSciences LLC, Fraunhofer-Gesellschaft zur Forderung der angewandten Forschung e.V.. Invention is credited to Kanika Arora, Elane Fishilevich, Meghan Frey, Premchand Gandra, Chaoxian Geng, Eileen Knorr, Huarong Li, Kenneth E. Narva, Murugesan Rangasamy, Balaji Veeramani, Andreas Vilcinskas, Sarah Worden.
Application Number | 20210115467 16/873630 |
Document ID | / |
Family ID | 1000005316020 |
Filed Date | 2021-04-22 |
United States Patent
Application |
20210115467 |
Kind Code |
A1 |
Narva; Kenneth E. ; et
al. |
April 22, 2021 |
Ras opposite (ROP) and related nucleic acid molecules that confer
resistance to coleopteran and/or hemipteran pests
Abstract
This disclosure concerns nucleic acid molecules and methods of
use thereof for control of coleopteran and/or hemipteran pests
through RNA interference-mediated inhibition of target coding and
transcribed non-coding sequences in coleopteran and/or hemipteran
pests. The disclosure also concerns methods for making that express
nucleic acid molecules useful for the control of coleopteran and/or
hemipteran pests, and the plant cells and plants obtained
thereby.
Inventors: |
Narva; Kenneth E.;
(Zionsville, IN) ; Li; Huarong; (Zionsville,
IN) ; Geng; Chaoxian; (Zionsville, IN) ;
Arora; Kanika; (Indianapolis, IN) ; Veeramani;
Balaji; (Indianapolis, IN) ; Gandra; Premchand;
(Indianapolis, IN) ; Worden; Sarah; (Indianapolis,
IN) ; Vilcinskas; Andreas; (Giessen, DE) ;
Knorr; Eileen; (Giessen, DE) ; Fishilevich;
Elane; (Indianapolis, IN) ; Rangasamy; Murugesan;
(Zionsville, IN) ; Frey; Meghan; (Greenwood,
IN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dow AgroSciences LLC
Fraunhofer-Gesellschaft zur Forderung der angewandten Forschung
e.V. |
Indianapolis
Munchen |
IN |
US
DE |
|
|
Family ID: |
1000005316020 |
Appl. No.: |
16/873630 |
Filed: |
May 26, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14577811 |
Dec 19, 2014 |
10647994 |
|
|
16873630 |
|
|
|
|
61919322 |
Dec 20, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/14 20130101;
C12N 2310/531 20130101; Y02A 40/146 20180101; C12N 15/113 20130101;
C12N 15/8218 20130101; C12N 15/8286 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12N 15/113 20060101 C12N015/113 |
Claims
1. A method of controlling insect pests, the method comprising
expressing a nucleic acid encoding an RNA comprising at least 15
contiguous nucleotides having, over its full length, at least 80%
identity to a DNA sequence encoding at least a portion of Ras
opposite (ROP) in a plant.
2. The method according to claim 1, wherein the insect pest is a
coleopteran or a hemipteran.
3. The method according to claim 1, wherein the insect pest is
selected from the group consisting of Diabrotica virgifera
virgifera, Diabrotica barberi, Diabrotica undecimpunctata howardi,
Diabrotica virgifera zeae, Diabrotica balteata, Diabrotica
undecimpunctata tenella, Diabrotica undecimpunctata
undecimpunctata, Euschistus heros, Nezara viridula, Piezodorus
guildinii, Halyomorpha halys, Acrosternum hilare, Euschistus
serous, and Meligethes aeneus.
4. A method of controlling insect pests, the method comprising
feeding to an insect pest a food source for an insect pest, the
food source comprising an RNA at least 15 contiguous nucleotides
having, over its full length, at least 80% identity to a DNA
sequence encoding at least a portion of Ras opposite (ROP) in a
plant.
Description
PRIORITY CLAIM
[0001] This application is a division of U.S. patent application
Ser. No. 14/577,811 filed Dec. 19, 2014, now U.S. Pat. No.
10,647,994, issued May 12, 2020, which claims the benefit of the
filing date of U.S. Provisional Patent Application Ser. No.
61/919,322, filed Dec. 20, 2013, the disclosures of which are
hereby incorporated herein in their entirety by this reference.
STATEMENT ACCORDING TO 37 C.F.R. .sctn. 1.821(c) or (e)--SEQUENCE
LISTING SUBMITTED AS A TXT FILE
[0002] Pursuant to 37 C.F.R. .sctn. 1.821(c) or (e), files
containing a TXT version of the Sequence Listing has been
submitted, titled 74683-US-DIV 20210113 SeqList.txt, created Jan.
13, 2021 and 153 kb in size, the contents of which are hereby
incorporated by reference.
TECHNICAL FIELD
[0003] Field of the Invention: The present invention relates
generally to control of plant damage caused by coleopteran and
hemipteran pests. In particular embodiments, the present invention
relates to identification of target coding and non-coding
sequences, and the use of for post-transcriptionally repressing or
inhibiting expression of target coding and non-coding sequences in
the cells of a coleopteran or hemipteran pest to provide a plant
protective effect.
BACKGROUND
[0004] The western corn rootworm (WCR), Diabrotica virgifera
virgifera LeConte, is one of the most devastating corn rootworm
species in North America and is a particular concern in
corn-growing areas of the Midwestern United States. The northern
corn rootworm (NCR), Diabrotica barberi Smith and Lawrence, is a
closely-related species that co-inhabits much of the same range as
WCR. There are several other related subspecies of Diabrotica that
are significant pests in North America: the Mexican corn rootworm
(MCR), D. virgifera zeae Krysan and Smith; the southern corn
rootworm (SCR), D. undecimpunctata howardi Barber; D. balteata
LeConte; D. undecimpunctata tenella; and D. u. undecimpunctata
Mannerheim. The United States Department of Agriculture currently
estimates that corn rootworms cause $1 billion in lost revenue each
year, including $800 million in yield loss and $200 million in
treatment costs.
[0005] Both WCR and NCR eggs are deposited in the soil during the
summer. The insects remain in the egg stage throughout the winter.
The eggs are oblong, white, and less than 0.004 inch in length. The
larvae hatch in late May or early June, with the precise timing of
egg hatching varying from year to year due to temperature
differences and location. The newly hatched larvae are white worms
that are less than 0.125 inch in length. Once hatched, the larvae
begin to feed on corn roots. Corn rootworms go through three larval
instars. After feeding for several weeks, the larvae molt into the
pupal stage. They pupate in the soil, and then they emerge from the
soil as adults in July and August. Adult rootworms are about 0.25
inch in length.
[0006] Corn rootworm larvae complete development on corn and
several other species of grasses. Larvae reared on yellow foxtail
emerge later and have a smaller head capsule size as adults than
larvae reared on corn. Ellsbury et al. (2005) Environ. Entomol.
34:627-634. WCR adults feed on corn silk, pollen, and kernels on
exposed ear tips. If WCR adults emerge before corn reproductive
tissues are present, they may feed on leaf tissue, thereby slowing
plant growth and occasionally killing the host plant. However, the
adults will quickly shift to preferred silks and pollen when they
become available. NCR adults also feed on reproductive tissues of
the corn plant, but in contrast rarely feed on corn leaves.
[0007] Most of the rootworm damage in corn is caused by larval
feeding Newly hatched rootworms initially feed on fine corn root
hairs and burrow into root tips. As the larvae grow larger, they
feed on and burrow into primary roots. When corn rootworms are
abundant, larval feeding often results in the pruning of roots all
the way to the base of the corn stalk. Severe root injury
interferes with the roots' ability to transport water and nutrients
into the plant, reduces plant growth, and results in reduced grain
production, thereby often drastically reducing overall yield.
Severe root injury also often results in lodging of corn plants,
which makes harvest more difficult and further decreases yield.
Furthermore, feeding by adults on the corn reproductive tissues can
result in pruning of silks at the ear tip. If this "silk clipping"
is severe enough during pollen shed, pollination may be
disrupted.
[0008] Control of corn rootworms may be attempted by crop rotation,
chemical insecticides, biopesticides (e.g., the spore-forming
gram-positive bacterium, Bacillus thuringiensis), or a combination
thereof. Crop rotation suffers from the significant disadvantage of
placing unwanted restrictions upon the use of farmland. Moreover,
oviposition of some rootworm species may occur in soybean fields,
thereby mitigating the effectiveness of crop rotation practiced
with corn and soybean.
[0009] Chemical insecticides are the most heavily relied upon
strategy for achieving corn rootworm control. Chemical insecticide
use, though, is an imperfect corn rootworm control strategy; over
$1 billion may be lost in the United States each year due to corn
rootworm when the costs of the chemical insecticides are added to
the costs of the rootworm damage that may occur despite the use of
the insecticides. High populations of larvae, heavy rains, and
improper application of the insecticide(s) may all result in
inadequate corn rootworm control. Furthermore, the continual use of
insecticides may select for insecticide-resistant rootworm strains,
as well as raise significant environmental concerns due to the
toxicity of many of them to non-target species.
[0010] Stink bugs (Hemiptera; Pentatomidae) comprise another
important agricultural pest complex. Worldwide over 50 closely
related species of stink bugs are known to cause crop damage.
McPherson & McPherson, R. M. (2000) Stink bugs of economic
importance in America north of Mexico CRC Press. These insects are
present in a large number of important crops including maize,
soybean, fruit, vegetables, and cereals. The Neotropical brown
stink bug, Euchistus heros, the red banded stink bug, Piezodorus
guildinii, brown marmorated stink bug, Halyomorpha halys, and the
Southern green stink bug, Nezara viridula, are of particular
concern.
[0011] Stink bugs go through multiple nymph stages before reaching
the adult stage. The time to develop from eggs to adults is about
30-40 days. Multiple generations occur in warm climates resulting
in significant insect pressure.
[0012] Both nymphs and adults feed on sap from soft tissues into
which they also inject digestive enzymes causing extra-oral tissue
digestion and necrosis. Digested plant material and nutrients are
then ingested. Depletion of water and nutrients from the plant
vascular system results in plant tissue damage. Damage to
developing grain and seeds is the most significant as yield and
germination are significantly reduced.
[0013] Current management of stink bugs relies on insecticide
treatment on an individual field basis. Therefore, alternative
management strategies are urgently needed to minimize ongoing crop
losses.
[0014] European pollen beetles (EPB) are serious pests in oilseed
rape, both the larvae and adults feed on flowers and pollen. Pollen
beetle damage to the crop can cause 20-40% yield loss. The primary
pest species is Meligethes aeneus. Currently, pollen beetle control
in oilseed rape relies mainly on pyrethroids which are expected to
be phased out soon because of their environmental and regulatory
profile. Moreover, pollen beetle resistance to existing chemical
insecticides has been reported. Therefore, urgently needed are
environmentally friendly pollen beetle control solutions with novel
modes of action.
[0015] In nature, pollen beetles overwinter as adults in the soil
or under leaf litter. In spring the adults emerge from hibernation
and start feeding on flowers of weeds, and migrate onto flowering
oilseed rape plants. The eggs are laid in oilseed rape. The larvae
feed and develop in the buds and on the flowers. Late stage larvae
find a pupation site in the soil. The second generation of adults
emerge in July and August and feed on various flowering plants
before finding sites for overwintering.
[0016] RNA interference (RNAi) is a process utilizing endogenous
cellular pathways, whereby an interfering RNA (iRNA) molecule
(e.g., a double-stranded RNA (dsRNA) molecule) that is specific for
all, or any portion of adequate size, of a target gene sequence
results in the degradation of the mRNA encoded thereby. In recent
years, RNAi has been used to perform gene "knockdown" in a number
of species and experimental systems; for example, Caenorhabitis
elegans, plants, insect embryos, and cells in tissue culture. See,
e.g., Fire et al. (1998) Nature 391:806-811; Martinez et al. (2002)
Cell 110:563-574; McManus and Sharp (2002) Nature Rev. Genetics
3:737-747.
[0017] RNAi accomplishes degradation of mRNA through an endogenous
pathway including the DICER protein complex. DICER cleaves long
dsRNA molecules into short fragments of approximately 20
nucleotides, termed small interfering RNA (siRNA). The siRNA is
unwound into two single-stranded RNAs: the passenger strand and the
guide strand. The passenger strand is degraded, and the guide
strand is incorporated into the RNA-induced silencing complex
(RISC). Micro ribonucleic acid (miRNA) molecules may be similarly
incorporated into RISC. Post-transcriptional gene silencing occurs
when the guide strand binds specifically to a complementary
sequence of an mRNA molecule and induces cleavage by Argonaute, the
catalytic component of the RISC complex. This process is known to
spread systemically throughout the organism despite initially
limited concentrations of siRNA and/or miRNA in some eukaryotes
such as plants, nematodes, and some insects.
[0018] Only transcripts complementary to the siRNA and/or miRNA are
cleaved and degraded, and thus the knock-down of mRNA expression is
sequence-specific. In plants, several functional groups of DICER
genes exist. The gene silencing effect of RNAi persists for days
and, under experimental conditions, can lead to a decline in
abundance of the targeted transcript of 90% or more, with
consequent reduction in levels of the corresponding protein.
[0019] U.S. Pat. No. 7,612,194 and U.S. Patent Publication Nos.
2007/0050860, 2010/0192265, and 2011/0154545 disclose a library of
9112 expressed sequence tag (EST) sequences isolated from D. v.
virgifera LeConte pupae. It is suggested in U.S. Pat. No. 7,612,194
and U.S. Patent Publication No. 2007/0050860 to operably link to a
promoter a nucleic acid molecule that is complementary to one of
several particular partial sequences of D. v. virgifera
vacuolar-type H.sup.+-ATPase (V-ATPase) disclosed therein for the
expression of antisense RNA in plant cells. U.S. Patent Publication
No. 2010/0192265 suggests operably linking a promoter to a nucleic
acid molecule that is complementary to a particular partial
sequence of a D. v. virgifera gene of unknown and undisclosed
function (the partial sequence is stated to be 58% identical to
C56C10.3 gene product in C. elegans) for the expression of
anti-sense RNA in plant cells. U.S. Patent Publication No.
2011/0154545 suggests operably linking a promoter to a nucleic acid
molecule that is complementary to two particular partial sequences
of D. v. virgifera coatomer beta subunit genes for the expression
of anti-sense RNA in plant cells. Further, U.S. Pat. No. 7,943,819
discloses a library of 906 expressed sequence tag (EST) sequences
isolated from D. v. virgifera LeConte larvae, pupae, and dissected
midguts, and suggests operably linking a promoter to a nucleic acid
molecule that is complementary to a particular partial sequence of
a D. v. virgifera charged multivesicular body protein 4b gene for
the expression of double-stranded RNA in plant cells.
[0020] No further suggestion is provided in U.S. Pat. No.
7,612,194, and U.S. Patent Publication Nos. 2007/0050860,
2010/0192265 and 2011/0154545 to use any particular sequence of the
more than nine thousand sequences listed therein for RNA
interference, other than the several particular partial sequences
of V-ATPase and the particular partial sequences of genes of
unknown function. Furthermore, none of U.S. Pat. No. 7,612,194, and
U.S. Patent Publication Nos. 2007/0050860 and 2010/0192265, and
2011/0154545 provides any guidance as to which other of the over
nine thousand sequences provided would be lethal, or even otherwise
useful, in species of corn rootworm when used as dsRNA or siRNA.
U.S. Pat. No. 7,943,819 provides no suggestion to use any
particular sequence of the more than nine hundred sequences listed
therein for RNA interference, other than the particular partial
sequence of a charged multivesicular body protein 4b gene.
Furthermore, U.S. Pat. No. 7,943,819 provides no guidance as to
which other of the over nine hundred sequences provided would be
lethal, or even otherwise useful, in species of corn rootworm when
used as dsRNA or siRNA. U.S. Patent Application Publication No.
U.S. 2013/040173 and PCT Application Publication No. WO 2013/169923
describe the use of a sequence derived from a Diabrotica virgifera
Snf7 gene for RNA interference in maize. (Also disclosed in
Bolognesi et al. (2012) PLos ONE 7(10): e47534.
doi:10.1371/journal.pone.0047534).
[0021] The overwhelming majority of sequences complementary to corn
rootworm DNAs (such as the foregoing) are not lethal in species of
corn rootworm when used as dsRNA or siRNA. For example, Baum et al.
(2007, Nature Biotechnology 25:1322-1326), describe the effects of
inhibiting several WCR gene targets by RNAi. These authors reported
that the 8 of 26 target genes they tested were not able to provide
experimentally significant coleopteran pest mortality at a very
high iRNA (e.g., dsRNA) concentration of more than 520
ng/cm.sup.2.
SUMMARY OF THE DISCLOSURE
Overview of Several Embodiments
[0022] Disclosed herein are nucleic acid molecules (e.g., target
genes, DNAs, dsRNAs, siRNAs, miRNAs, shRNAs, and hpRNAs), and
methods of use thereof, for the control of coleopteran pests,
including, for example, D. v. virgifera LeConte (western corn
rootworm, "WCR"); D. barberi Smith and Lawrence (northern corn
rootworm, "NCR"); D. u. howardi Barber (southern corn rootworm,
"SCR"); D. v. zeae Krysan and Smith (Mexican corn rootworm, "MCR");
D. balteata LeConte; D. u. tenella; D. u. undecimpunctata
Mannerheim; Meligethes aeneus Fabricius (pollen beetle, "PB"); and
hemipteran pests, including, for example, Euschistus heros (Fabr.)
(Neotropical brown stink bug), Nezara viridula (L.) (Southern Green
Stink Bug), Piezodorus guildinii (Westwood) (red-banded stink bug)
Halyomorpha halys (brown marmorated stink bug), Acrosternum hilare
(Green Stink Bug), and Euschistus serous (Brown Stink Bug). In
particular examples, exemplary nucleic acid molecules are disclosed
that may be homologous to at least a portion of one or more native
nucleic acid sequences in a coleopteran and/or hemipteran pest.
[0023] In these and further examples, the native nucleic acid
sequence may be a target gene, the product of which may be, for
example and without limitation: involved in a metabolic process;
involved in a reproductive process; or involved in larval
development. In some examples, post-translational inhibition of the
expression of a target gene by a nucleic acid molecule comprising a
sequence homologous thereto may be lethal in coleopteran and/or
hemipteran pests, or result in reduced growth and/or reproduction.
In specific examples, a gene encoding Ras-opposite (the encoded
protein referred to herein as "ROP;" and a nucleic acid encoding
ROP referred to herein as "rop") may be selected as a target gene
for post-transcriptional silencing. In particular examples, a
target gene useful for post-transcriptional inhibition is the novel
gene rop. An isolated nucleic acid molecule comprising rop; the
complement of the nucleotide sequence encoding rop; and fragments
of any of the foregoing is, therefore, disclosed herein. Examples
of rop include, but are not limited to SEQ ID NOs:1, 115, 120, 122,
124, 126, 131, and 133.
[0024] Also disclosed are nucleic acid molecules comprising a
nucleotide sequence that encodes a polypeptide that is at least 85%
identical to an amino acid sequence within a target gene product
(for example, ROP). For example, a nucleic acid molecule may
comprise a nucleotide sequence encoding a polypeptide that is at
least 85% identical to an amino acid sequence of SEQ ID NOs:2, 116,
121, 123, 125, 127, 132, or 134 (a ROP). In particular examples, a
nucleic acid molecule comprises a nucleotide sequence encoding a
polypeptide that is at least 85% identical to an amino acid
sequence within ROP. Further disclosed are nucleic acid molecules
comprising a nucleotide sequence that is the reverse complement of
a nucleotide sequence that encodes a polypeptide at least 85%
identical to an amino acid sequence within a target gene
product.
[0025] Also disclosed are cDNA sequences that may be used for the
production of iRNA (e.g., dsRNA, siRNA, shRNA, miRNA, and hpRNA)
molecules that are complementary to all or part of a coleopteran
and/or hemipteran pest target gene, for example: rop. In particular
embodiments, dsRNAs, siRNAs, shRNA, miRNAs, and/or hpRNAs may be
produced in vitro, or in vivo by a genetically-modified organism,
such as a plant or bacterium. In particular examples, cDNA
molecules are disclosed that may be used to produce iRNA molecules
that are complementary to all or part of rop (e.g. SEQ ID NOs:1,
115, 120, 122, 124, 126, 131, and 133).
[0026] Further disclosed are means for inhibiting expression of an
essential gene in a coleopteran and/or hemipteran pest, and means
for providing coleopteran and/or hemipteran pest resistance to a
plant. Examples of a means for inhibiting expression of an
essential gene in a coleopteran and/or hemipteran pest include a
single- or double-stranded RNA molecule consisting of at least one
of SEQ ID NO:3 (Diabrotica rop region 1 or rop reg1), SEQ ID NO:4
(Diabrotica rop region 2 or rop reg2), SEQ ID NO:114 (Diabrotica
rop region v3 or rop v3), SEQ ID NO:119 (Euschistus rop region 1 or
BSB rop reg1), SEQ ID NO:128 (Meligethes rop region 1 or EPB rop
reg1), or the complement thereof. Functional equivalents of means
for inhibiting expression of an essential gene in a coleopteran
and/or hemipteran pest include single- or double-stranded RNA
molecules that are substantially homologous to all or part of rop
(for example, a WCR gene comprising SEQ ID NOs:1 or 115).
Functional equivalents of means for inhibiting expression of an
essential gene in a coleopteran and/or hemipteran pest include
single- or double-stranded RNA molecules that are substantially
homologous to all or part of rop (for example, a PB gene comprising
SEQ ID NOs:120, 122, 124, 126, 131, or 133). Another example of
means for providing coleopteran and/or hemipteran pest resistance
to a plant is a DNA molecule comprising a nucleic acid sequence
encoding a means for inhibiting expression of an essential gene in
a coleopteran and/or hemipteran pest operably linked to a promoter,
wherein the DNA molecule is capable of being integrated into the
genome of a maize or soybean plant.
[0027] Disclosed are methods for controlling a population of a
coleopteran and/or hemipteran pest, comprising providing to a
coleopteran and/or hemipteran pest an iRNA (e.g., dsRNA, siRNA,
shRNA, miRNA, and hpRNA) molecule that functions upon being taken
up by the coleopteran and/or hemipteran pest to inhibit a
biological function within the coleopteran and/or hemipteran pest.
For example, an iRNA molecule comprising all or part of a
nucleotide sequence selected from the group consisting of: SEQ ID
NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:114, SEQ ID NO:115, SEQ
ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:128, SEQ ID NO:131, and SEQ ID NO:133; the
complement of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID
NO:114, SEQ ID NO:115, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122,
SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, and SEQ
ID NO:133; a native coding sequence of a Diabrotica organism (e.g.,
WCR) or hemipteran organism (e.g. BSB) or Meligethes organism
(e.g., EPB) comprising all or part of any of SEQ ID NO:1, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:119, SEQ
ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID
NO:128, SEQ ID NO:131, and SEQ ID NO:133; the complement of a
native coding sequence of a Diabrotica organism or hemipteran
organism or Meligethes organism comprising all or part of any of
SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:114, SEQ ID
NO:115, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, and SEQ ID NO:133; a
native non-coding sequence of a Diabrotica organism or hemipteran
organism or Meligethes organism that is transcribed into a native
RNA molecule comprising all or part of any of SEQ ID NO:1, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:119, SEQ
ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID
NO:128, SEQ ID NO:131, and SEQ ID NO:133; and the complement of a
native non-coding sequence of a Diabrotica organism or hemipteran
organism or Meligethes organism that is transcribed into a native
RNA molecule comprising all or part of any of SEQ ID NO:1, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:114, SEQ ID NO:115, and SEQ ID NO:119,
SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID
NO:128, SEQ ID NO:131, and SEQ ID NO:133.
[0028] Also disclosed herein are methods wherein dsRNAs, siRNAs,
shRNAs, miRNAs, and/or hpRNAs may be provided to a coleopteran
and/or hemipteran pest in a, or in genetically-modified plant cells
expressing the dsRNAs, siRNAs, shRNAs, miRNAs, and/or hpRNAs. In
these and further examples, the dsRNAs, siRNAs, shRNAs, miRNAs,
and/or hpRNAs may be ingested by coleopteran and/or hemipteran pest
larvae. Ingestion of dsRNAs, siRNA, shRNAs, miRNAs, and/or hpRNAs
of the invention may then result in RNAi in the larvae, which in
turn may result in silencing of a gene essential for viability of
the coleopteran and/or hemipteran pest and leading ultimately to
larval mortality. Thus, methods are disclosed wherein nucleic acid
molecules comprising exemplary nucleic acid sequence(s) useful for
control of coleopteran and/or hemipteran pests are provided to a
coleopteran and/or hemipteran pest. In particular examples, the
coleopteran and/or hemipteran pest controlled by use of nucleic
acid molecules of the invention may be WCR, NCR, Meligethes aeneus,
Euchistus heros, Piezodorus guildinii, Halyomorpha halys, Nezara
viridula Acrosternum hilare, and Euschistus serous.
BRIEF DESCRIPTION OF THE FIGURES
[0029] FIG. 1 is a pictorial representation of a strategy for the
generation of dsRNA from a single transcription template.
[0030] FIG. 2 is a pictorial representation of a strategy for the
generation of dsRNA from two transcription templates.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE LISTING
[0031] The nucleic acid sequences listed in the accompanying
sequence listing are shown using standard letter abbreviations for
nucleotide bases and amino acids, as defined in 37 C.F.R. .sctn.
1.822. Only one strand of each nucleic acid sequence is shown, but
the complementary strand and reverse complementary strand are
understood as included by any reference to the displayed strand. In
the accompanying sequence listing:
[0032] SEQ ID NO:1 shows a DNA sequence of rop from Diabrotica
virgifera.
[0033] SEQ ID NO:2 shows an amino acid sequence of a ROP from
Diabrotica virgifera.
[0034] SEQ ID NO:3 shows a DNA sequence of rop reg1 (region 1) from
Diabrotica virgifera that was used for in vitro dsRNA synthesis (T7
promoter sequences at 5' and 3' ends not shown).
[0035] SEQ ID NO:4 shows a DNA sequence of rop reg2 (region 2) from
Diabrotica virgifera that was used for in vitro dsRNA synthesis (T7
promoter sequences at 5' and 3' ends not shown).
[0036] SEQ ID NO:5 shows a DNA sequence of a T7 phage promoter.
[0037] SEQ ID NO:6 shows a DNA sequence of a YFP coding region
segment that was used for in vitro dsRNA synthesis (T7 promoter
sequences at 5' and 3' ends not shown).
[0038] SEQ ID NOS:7-12 show primers used to amplify portions of a
rop sequence from Diabrotica virgifera comprising rop reg1, rop
reg2, and primers used to amplify a YFP coding region segment.
[0039] SEQ ID NO:13 presents an rop v1 from Diabrotica virgifera
hairpin-RNA-forming sequence as found in pDAB114515. Upper case
bases are rop sense strand, underlined lower case bases comprise
ST-LS1 intron, non-underlined lower case bases are rop antisense
strand.
TABLE-US-00001 TCAGCATGCTGTAAAATGCATGATATATCAGCAGAAGGCATTACAT
TGGTTGAAGATATTATGAAGAAAAGGGAACCGCTTGGTACCATGGA
AGCTGTGTACTTGATAACACCTTCAGAAAAGTCAGTTCATGCTCTT
ATGAATGACTTTGAACCACCAAGACAGATGTACAGAGGGGCACACG
TGTTTTTTACAGAAGCGTGTCCAGAC
gactagtaccggttgggaaaggtatgtttctgcttctacctttgat
atatatataataattatcactaattagtagtaatatagtatttcaa
gtatttttttcaaaataaaagaatgtagtatatagctattgctttt
ctgtagtttataagtgtgtatattttaatttataacttttctaata
tatgaccaaaacatggtgatgtgcaggttgatccgcggttag
tctggacacgcttctgtaaaaaacacgtgtgcccctctgtacatct
gtcttggtggttcaaagtcattcataagagcatgaactgacttttc
tgaaggtgttatcaagtacacagcttccatggtaccaagcggttcc
cttttcttcataatatcttcaaccaatgtaatgccttctgctgata
tatcatgcattttacagcatgctga
[0040] SEQ ID NO:14 presents an rop v3 from Diabrotica virgifera
hairpin-RNA-forming sequence as found in pDAB115770. Upper case
bases are rop sense strand, underlined lower case bases comprise
ST-LS1 intron, non-underlined lower case bases are rop antisense
strand.
TABLE-US-00002 CAAGTATGCTACGCATCTTCATCTCGCTGAAGACTGCATGAAGGCCTAT
CAGGGGTATATAGACAAGTTGTGTAAAGTTGAGCAGGATTTGGCAATGG
GAACTGATGCCGAAGGCGAGAAAATCAAGGATCACATGCGCAACATCGT
CCCCATCTTGCTAGATCCCAAAATCACCAATGAATACGATAAGAgacta
gtaccggttgggaaaggtatgtttctgcttctacctttgatatatatat
aataattatcactaattagtagtaatatagtatttcaagtatttttttc
aaaataaaagaatgtagtatatagctattgcttttctgtagtttataag
tgtgtatattttaatttataacttttctaatatatgaccaaaacatggt
gatgtgcaggttgatccgcggttatcttatcgtattcattggtgatttt
gggatctagcaagatggggacgatgttgcgcatgtgatccttgattttc
tcgccttcggcatcagttcccattgccaaatcctgctcaactttacaca
acttgtctatatacccctgataggccttcatgcagtcttcagcgagatg
aagatgcgtagcatacttg
[0041] SEQ ID NO:15 shows a YFP hairpin-RNA-forming sequence v2 as
found in pDAB110853. Upper case bases are YFP sense strand,
underlined bases comprise ST-LS1 intron, lower case, non-underlined
bases are YFP antisense strand.
TABLE-US-00003 ATGTCATCTGGAGCACTTCTCTTTCATGGGAAGATTCCTTACGTTGTGG
AGATGGAAGGGAATGTTGATGGCCACACCTTTAGCATACGTGGGAAAGG
CTACGGAGATGCCTCAGTGGGAAAGggactagtaccggttgggaaaggt
atgtttctgcttctacctttgatatatatataataattatcactaatta
gtagtaatatagtatttcaagtatttttttcaaaataaaagaatgtagt
atatagctattgcttttctgtagtttataagtgtgtatattttaattta
taacttttctaatatatgaccaaaacatggtgatgtgcaggttgatccg
cggttactttcccactgaggcatctccgtagcctttcccacgtatgcta
aaggtgtggccatcaacattcccttccatctccacaacgtaaggaatct
tcccatgaaagagaagtgctccagatgacat
[0042] SEQ ID NO:16 shows a DNA sequence comprising an ST-LS1
intron.
[0043] SEQ ID NO:17 shows a YFP coding sequence as found in
pDAB110556.
[0044] SEQ ID NO:18 shows a DNA sequence of Annexin region 1.
[0045] SEQ ID NO:19 shows a DNA sequence of Annexin region 2.
[0046] SEQ ID NO:20 shows a DNA sequence of Beta Spectrin 2 region
1.
[0047] SEQ ID NO:21 shows a DNA sequence of Beta Spectrin 2 region
2.
[0048] SEQ ID NO:22 shows a DNA sequence of mtRP-L4 region 1.
[0049] SEQ ID NO:23 shows a DNA sequence of mtRP-L4 region 2.
[0050] SEQ ID NOs:24-47 show primers used to amplify gene regions
of Annexin, Beta spectrin 2, mtRP-L4, and YFP for dsRNA
synthesis.
[0051] SEQ ID NO:48 shows a maize DNA sequence encoding a
TIP41-like protein.
[0052] SEQ ID NO:49 shows a DNA sequence of oligonucleotide
T20NV.
[0053] SEQ ID NOs:50-54 show primers and probes used to measure
maize transcript levels.
[0054] SEQ ID NO:55 shows a DNA sequence of a portion of a SpecR
coding region used for binary vector backbone detection.
[0055] SEQ ID NO:56 shows a DNA sequence of a portion of an AAD1
coding region used for genomic copy number analysis.
[0056] SEQ ID NO:57 shows a DNA sequence of a maize invertase
gene.
[0057] SEQ ID NOs:58 to 69 show sequences of primers and probes
used for gene copy number analyses.
[0058] SEQ ID NOs:70 to 111 show Diabrotica transcript sequences
that encode proteins having sequence homology to SEQ ID NO:2 by
means of a Sec 1 domain.
[0059] SEQ ID NOs:112 and 113 show primers used to amplify portions
of a Diabrotica rop sequence comprising rop v3 (region v3).
[0060] SEQ ID NO:114 shows a DNA sequence of rop region v3 from
Diabrotica virgifera (rop v3) that was used for in vitro dsRNA
synthesis (T7 promoter sequences at 5' and 3' ends not shown).
[0061] SEQ ID NO:115 shows a DNA sequence of rop from a Neotropical
Brown Stink Bug (Euschistus heros).
[0062] SEQ ID NO: 116 shows a Euschistus heros ROP protein
[0063] SEQ ID NOs: 117 and 118 show primers used to amplify a
portion of a Euschistus heros rop sequence comprising BSB_rop
reg1
[0064] SEQ ID NO:119 shows a DNA sequence of BSB_rop reg1
[0065] SEQ ID NO:120 shows a DNA sequence comprising rop from
Meligethes aeneus.
[0066] SEQ ID NO:121 shows an amino acid sequence of a ROP protein
from Meligethes aeneus.
[0067] SEQ ID NO:122 shows a DNA sequence comprising rop from
Meligethes aeneus.
[0068] SEQ ID NO:123 shows an amino acid sequence of a ROP protein
from Meligethes aeneus.
[0069] SEQ ID NO:124 shows a DNA sequence comprising rop from
Meligethes aeneus.
[0070] SEQ ID NO:125 shows an amino acid sequence of a ROP protein
from Meligethes aeneus.
[0071] SEQ ID NO:126 shows a DNA sequence comprising rop from
Meligethes aeneus.
[0072] SEQ ID NO:127 shows an amino acid sequence of a ROP protein
from Meligethes aeneus.
[0073] SEQ ID NO:128 shows a DNA sequence of rop reg1 (region 1)
from Meligethes aeneus that was used for in vitro dsRNA synthesis
(T7 promoter sequences at 5' and 3' ends not shown).
[0074] SEQ ID NOs:129 and 130 show primers used to amplify portions
of a Meligethes rop sequence comprising rop reg1 (region 1).
[0075] SEQ ID NO:131 shows a DNA sequence comprising rop-1 from
Meligethes aeneus.
[0076] SEQ ID NO:132 shows an amino acid sequence of a ROP-1
protein from Meligethes aeneus.
[0077] SEQ ID NO:133 shows a DNA sequence comprising rop-2 from
Meligethes aeneus.
[0078] SEQ ID NO:134 shows an amino acid sequence of a ROP-2
protein from Meligethes aeneus.
DETAILED DESCRIPTION
[0079] Disclosed herein are methods and compositions for control of
coleopteran and/or hemipteran pest infestations. Methods for
identifying one or more gene(s) essential to the lifecycle of a
coleopteran and/or hemipteran pest for use as a target gene for
RNAi-mediated control of a coleopteran and/or hemipteran pest
population are also provided. DNA plasmid vectors encoding one or
more dsRNA molecules may be designed to suppress one or more target
gene(s) essential for growth, survival, development, and/or
reproduction. In some embodiments, methods are provided for
post-transcriptional repression of expression or inhibition of a
target gene via nucleic acid molecules that are complementary to a
coding or non-coding sequence of the target gene in a coleopteran
and/or hemipteran pest. In these and further embodiments, a
coleopteran and/or hemipteran pest may ingest one or more dsRNA,
siRNA, shRNA, miRNA, and/or hpRNA molecules transcribed from all or
a portion of a nucleic acid molecule that is complementary to a
coding or non-coding sequence of a target gene, thereby providing a
plant-protective effect.
[0080] Thus, some embodiments involve sequence-specific inhibition
of expression of target gene products, using dsRNA, siRNA, shRNA,
miRNA and/or hpRNA that is complementary to coding and/or
non-coding sequences of the target gene(s) to achieve at least
partial control of a coleopteran and/or hemipteran pest. Disclosed
is a set of isolated and purified nucleic acid molecules comprising
a nucleotide sequence, for example, as set forth in any of SEQ ID
NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:114, SEQ ID NO:115, SEQ
ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:128, SEQ ID NO:131, and SEQ ID NO:133, and
fragments thereof. In some embodiments, a stabilized dsRNA molecule
may be expressed from this sequence, fragments thereof, or a gene
comprising one of these sequences, for the post-transcriptional
silencing or inhibition of a target gene. In certain embodiments,
isolated and purified nucleic acid molecules comprise all or part
of SEQ ID NO:1. In other embodiments, isolated and purified nucleic
acid molecules comprise all or part of SEQ ID NO:3. In yet other
embodiments, isolated and purified nucleic acid molecules comprise
all or part of SEQ ID NO:4. In still further embodiments, isolated
and purified nucleic acid molecules comprise all or part of SEQ ID
NO:114. In other embodiments, isolated and purified nucleic acid
molecules comprise all or part of SEQ ID NO:115. In yet other
embodiments, isolated and purified nucleic acid molecules comprise
all or part of SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, or SEQ ID
NO:133.
[0081] Some embodiments involve a recombinant host cell (e.g., a
plant cell) having in its genome at least one recombinant DNA
sequence encoding at least one iRNA (e.g., dsRNA) molecule(s). In
particular embodiments, the dsRNA molecule(s) may be produced when
ingested by a coleopteran and/or hemipteran pest to
post-transcriptionally silence or inhibit the expression of a
target gene in the coleopteran and/or hemipteran pest. The
recombinant DNA sequence may comprise, for example, one or more of
any of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:114, SEQ ID
NO:115, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, or SEQ ID NO:133;
fragments of any of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID
NO:114, SEQ ID NO:115, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122,
SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, or SEQ
ID NO:133 or a partial sequence of a gene comprising one or more of
SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:114, SEQ ID
NO:115, SEQ ID NO:119 SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, or SEQ ID NO:133; or
complements thereof.
[0082] Particular embodiments involve a recombinant host cell
having in its genome a recombinant nucleic acid sequence encoding
at least one iRNA (e.g., dsRNA) molecule(s) comprising all or part
of SEQ ID NOs:1, 115, 120, 122, 124, 126, 131, and/or 133. When
ingested by a coleopteran and/or hemipteran pest, the iRNA
molecule(s) may silence or inhibit the expression of a target gene
comprising SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133, in the coleopteran and/or hemipteran pest, and thereby
result in cessation of growth, development, reproduction, and/or
feeding in the coleopteran and/or hemipteran pest.
[0083] In some embodiments, a recombinant host cell having in its
genome at least one recombinant nucleic acid sequence encoding at
least one dsRNA molecule may be a transformed plant cell. Some
embodiments involve transgenic plants comprising such a transformed
plant cell. In addition to such transgenic plants, progeny plants
of any transgenic plant generation, transgenic seeds, and
transgenic plant products, are all provided, each of which
comprises recombinant nucleic acid sequence(s). In particular
embodiments, a dsRNA molecule of the invention may be expressed in
a transgenic plant cell. Therefore, in these and other embodiments,
a dsRNA molecule of the invention may be isolated from a transgenic
plant cell. In particular embodiments, the transgenic plant is a
plant selected from the group comprising coin (Zea mays), soybean
(Glycine max), and plants of the family Poaceae.
[0084] Some embodiments involve a method for modulating the
expression of a target gene in a coleopteran and/or hemipteran pest
cell. In these and other embodiments, a nucleic acid molecule may
be provided, wherein the nucleic acid molecule comprises a
nucleotide sequence encoding a dsRNA molecule. In particular
embodiments, a nucleotide sequence encoding a dsRNA molecule may be
operatively linked to a promoter, and may also be operatively
linked to a transcription termination sequence. In particular
embodiments, a method for modulating the expression of a target
gene in a coleopteran and/or hemipteran pest cell may comprise: (a)
transforming a plant cell with a vector comprising a nucleotide
sequence encoding a dsRNA molecule; (b) culturing the transformed
plant cell under conditions sufficient to allow for development of
a plant cell culture comprising a plurality of transformed plant
cells; (c) selecting for a transformed plant cell that has
integrated the vector into its genome; and (d) determining that the
selected transformed plant cell comprises the dsRNA molecule
encoded by the nucleotide sequence of the vector. A plant may be
regenerated from a plant cell that has the vector integrated in its
genome and comprises the dsRNA molecule encoded by the nucleotide
sequence of the vector.
[0085] Thus, also disclosed is a transgenic plant comprising a
vector having a nucleotide sequence encoding a dsRNA molecule
integrated in its genome, wherein the transgenic plant comprises
the dsRNA molecule encoded by the nucleotide sequence of the
vector. In particular embodiments, expression of a dsRNA molecule
in the plant is sufficient to modulate the expression of a target
gene in a cell of a coleopteran and/or hemipteran pest that
contacts the transformed plant or plant cell, for example, by
feeding on the transformed plant, a part of the plant (e.g., root)
or plant cell. Transgenic plants disclosed herein may display
resistance and/or enhanced tolerance to coleopteran and/or
hemipteran pest infestations. Particular transgenic plants may
display resistance and/or enhanced tolerance to one or more
coleopteran and/or hemipteran pests selected from the group
consisting of: WCR; NCR; SCR; MCR; D. balteata LeConte; D. u.
tenella; D. u. undecimpunctata Mannerheim, Meligethes aeneus
Fabricius, Euchistus heros, Piezodorus guildinii, Halyomorpha
halys, and Nezara viridula, Acrosternum hilare, and Euschistus
serous.
[0086] Also disclosed herein are methods for delivery of control
agents, such as an iRNA molecule, to a coleopteran and/or
hemipteran pest. Such control agents may cause, directly or
indirectly, an impairment in the ability of the coleopteran and/or
hemipteran pest to feed, grow or otherwise cause damage in a host.
In some embodiments, a method of inhibiting expression of a target
gene in a coleopteran and/or hemipteran pest may result in the
cessation of growth, development, reproduction, and/or feeding in
the coleopteran and/or hemipteran pest. In some embodiments, the
method may eventually result in death of the coleopteran and/or
hemipteran pest.
[0087] In some embodiments, compositions (e.g., a topical
composition) are provided that comprise an iRNA (e.g., dsRNA)
molecule of the invention for use in plants, animals, and/or the
environment of a plant or animal to achieve the elimination or
reduction of a coleopteran and/or hemipteran pest infestation. In
particular embodiments, the composition may be a nutritional
composition or food source to be fed to the coleopteran and/or
hemipteran pest. Some embodiments comprise making the nutritional
composition or food source available to the coleopteran and/or
hemipteran pest. Ingestion of a composition comprising iRNA
molecules may result in the uptake of the molecules by one or more
cells of the coleopteran and/or hemipteran pest, which may in turn
result in the inhibition of expression of at least one target gene
in cell(s) of the coleopteran and/or hemipteran pest. Ingestion of
or damage to a plant or plant cell by a coleopteran and/or
hemipteran pest may be limited or eliminated in or on any host
tissue or environment in which the coleopteran and/or hemipteran
pest is present by providing one or more compositions comprising an
iRNA molecule of the invention in the host of the coleopteran
and/or hemipteran pest.
[0088] The compositions and methods disclosed herein may be used
together in combinations with other methods and compositions for
controlling damage by coleopteran and/or hemipteran pests. For
example, an iRNA molecule as described herein for protecting plants
from coleopteran and/or hemipteran pests may be used in a method
comprising the additional use of one or more chemical agents
effective against a coleopteran and/or hemipteran pest,
biopesticides effective against a coleopteran and/or hemipteran
pest, crop rotation, or recombinant genetic techniques that exhibit
features different from the features of the RNAi-mediated methods
and RNAi compositions of the invention (e.g., recombinant
production of proteins in plants that are harmful to a coleopteran
and/or hemipteran pest (e.g., Bt toxins)).
II. Abbreviations
[0089] dsRNA a ribonucleic acid where at least a portion of the
ribonucleic acid is double stranded
[0090] GI growth inhibition
[0091] NCBI National Center for Biotechnology Information
[0092] gDNA genomic DNA
[0093] iRNA inhibitory ribonucleic acid
[0094] ORF open reading frame
[0095] RNAi ribonucleic acid interference
[0096] miRNA micro ribonucleic acid
[0097] siRNA small interfering ribonucleic acid
[0098] shRNA small hairpin ribonucleic acid
[0099] hpRNA hairpin containing ribonucleic acid
[0100] UTR untranslated region
[0101] WCR western corn rootworm (Diabrotica virgifera virgifera
LeConte)
[0102] NCR northern corn rootworm (Diabrotica barberi Smith and
Lawrence)
[0103] MCR Mexican corn rootworm (Diabrotica virgifera zeae Krysan
and Smith)
[0104] PCR Polymerase chain reaction
[0105] RISC RNA-induced Silencing Complex
[0106] SCR southern corn rootworm (Diabrotica undecimpunctata
howardi Barber)
[0107] BSB Neotropical brown stink bug (Euschistus heros
Fabricius)
[0108] PB Pollen beetle (Meligethes aeneus Fabricius)
III. Terms
[0109] In the description and tables which follow, a number of
terms are used. In order to provide a clear and consistent
understanding of the specification and claims, including the scope
to be given such terms, the following definitions are provided:
[0110] Coleopteran pest: As used herein, the term "coleopteran
pest" refers to insects of the genus Diabrotica, which feed upon
corn and other true grasses. In particular examples, a coleopteran
pest is selected from the list comprising D. v. virgifera LeConte
(WCR); D. barberi Smith and Lawrence (NCR); D. u. howardi (SCR); D.
v. zeae (MCR); D. balteata LeConte; D. u. tenella; D. u.
undecimpunctata Mannerheim; and Meligethes aeneus Fabricius.
[0111] Hemipteran pest: As used herein, the term "hemipteran pest"
refers to insects of the family Pentatomidae, which feed on wide
range of host plants and have piercing and sucking mouth parts. In
particular examples, a hemipteran pest is selected from the list
comprising, Euschistus heros (Fabr.) (Neotropical brown stink bug),
Nezara viridula (L.) (Southern Green Stink Bug), Piezodorus
guildinii (Westwood) (red-banded stink bug) Halyomorpha halys brown
marmorated stink bug, Acrosternum hilare (Green Stink Bug), and
Euschistus serous (Brown Stink Bug).
[0112] Contact (with an organism): As used herein, the term
"contact with" or "uptake by" an organism (e.g., a coleopteran
and/or hemipteran pest), with regard to a nucleic acid molecule,
includes internalization of the nucleic acid molecule into the
organism, for example and without limitation: ingestion of the
molecule by the organism (e.g., by feeding); contacting the
organism with a composition comprising the nucleic acid molecule;
and soaking of organisms with a solution comprising the nucleic
acid molecule.
[0113] Contig: As used herein, the term "contig" refers to a
nucleic acid sequence that is reconstructed from a set of
overlapping nucleic acid segments derived from a single genetic
source.
[0114] Corn plant: As used herein, the term "corn plant" refers to
a plant of the species, Zea mays (maize).
[0115] Encoding a dsRNA: As used herein, the term "encoding a
dsRNA" includes a gene whose RNA transcription product is capable
of forming an intramolecular dsRNA structure (e.g., a hairpin) or
intermolecular dsRNA structure (e.g., by hybridizing to a target
RNA molecule).
[0116] Expression: As used herein, "expression" of a sequence (for
example, a gene or a transgene) refers to the process by which the
coded information of a nucleic acid transcriptional unit
(including, e.g., genomic DNA or cDNA) is converted into an
operational, non-operational, or structural part of a cell, often
including the synthesis of a protein. Gene expression can be
influenced by external signals; for example, exposure of a cell,
tissue, or organism to an agent that increases or decreases gene
expression. Expression of a gene can also be regulated anywhere in
the pathway from DNA to RNA to protein. Regulation of gene
expression occurs, for example, through controls acting on
transcription, translation, RNA transport and processing,
degradation of intermediary molecules such as mRNA, or through
activation, inactivation, compartmentalization, or degradation of
specific protein molecules after they have been made, or by
combinations thereof. Gene expression can be measured at the RNA
level or the protein level by any method known in the art,
including, without limitation, northern (RNA) blot, RT-PCR, western
(immuno-) blot, or in vitro, in situ, or in vivo protein activity
assay(s).
[0117] Genetic material: As used herein, the term "genetic
material" includes all genes and nucleic acid molecules, such as
DNA and RNA.
[0118] Inhibition: As used herein, the term "inhibition," when used
to describe an effect on a coding sequence (for example, a gene),
refers to a measurable decrease in the cellular level of mRNA
transcribed from the coding sequence and/or peptide, polypeptide,
or protein product of the coding sequence. In some examples,
expression of a coding sequence may be inhibited such that
expression is approximately eliminated. "Specific inhibition"
refers to the inhibition of a target coding sequence without
consequently affecting expression of other coding sequences (e.g.,
genes) in the cell wherein the specific inhibition is being
accomplished.
[0119] Isolated: An "isolated" biological component (such as a
nucleic acid or protein) has been substantially separated, produced
apart from, or purified away from other biological components in
the cell of the organism in which the component naturally occurs
(i.e., other chromosomal and extra-chromosomal DNA and RNA, and
proteins). Nucleic acid molecules and proteins that have been
"isolated" include nucleic acid molecules and proteins purified by
standard purification methods. The term also embraces nucleic acids
and proteins prepared by recombinant expression in a host cell, as
well as chemically-synthesized nucleic acid molecules, proteins,
and peptides.
[0120] Nucleic acid molecule: As used herein, the term "nucleic
acid molecule" may refer to a polymeric form of nucleotides, which
may include both sense and anti-sense strands of RNA, cDNA, genomic
DNA, and synthetic forms and mixed polymers of the above. A
nucleotide may refer to a ribonucleotide, deoxyribonucleotide, or a
modified form of either type of nucleotide. A "nucleic acid
molecule," as used herein, is synonymous with "nucleic acid" and
"polynucleotide." A nucleic acid molecule is usually at least 10
bases in length, unless otherwise specified. By convention, the
nucleotide sequence of a nucleic acid molecule is read from the 5'
to the 3' end of the molecule. The "complement" of a nucleotide
sequence refers to the sequence, from 5' to 3', of the nucleobases
which form base pairs with the nucleobases of the nucleotide
sequence (i.e., A-T/U, and G-C). The "reverse complement" of a
nucleic acid sequence refers to the sequence, from 3' to 5', of the
nucleobases which form base pairs with the nucleobases of the
nucleotide sequence.
[0121] "Nucleic acid molecules" include single- and double-stranded
forms of DNA; single-stranded forms of RNA; and double-stranded
forms of RNA (dsRNA). The term "nucleotide sequence" or "nucleic
acid sequence" refers to both the sense and antisense strands of a
nucleic acid as either individual single strands or in the duplex.
The term "ribonucleic acid" (RNA) is inclusive of iRNA (inhibitory
RNA), dsRNA (double-stranded RNA), siRNA (small interfering RNA),
shRNA (small hairpin RNA), mRNA (messenger RNA), miRNA (microRNA),
hpRNA (hairpin RNA), tRNA (transfer RNA, whether charged or
discharged with a corresponding acylated amino acid), and cRNA
(complementary RNA). The term "deoxyribonucleic acid" (DNA) is
inclusive of cDNA, genomic DNA, and DNA-RNA hybrids. The terms
"nucleic acid segment" and "nucleotide sequence segment," or more
generally "segment," will be understood by those in the art as a
functional term that includes both genomic sequences, ribosomal RNA
sequences, transfer RNA sequences, messenger RNA sequences, operon
sequences, and smaller engineered nucleotide sequences that encode
or may be adapted to encode, peptides, polypeptides, or
proteins.
[0122] Oligonucleotide: An oligonucleotide is a short nucleic acid
polymer. Oligonucleotides may be formed by cleavage of longer
nucleic acid segments, or by polymerizing individual nucleotide
precursors. Automated synthesizers allow the synthesis of
oligonucleotides up to several hundred bases in length. Because
oligonucleotides may bind to a complementary nucleotide sequence,
they may be used as probes for detecting DNA or RNA.
Oligonucleotides composed of DNA (oligodeoxyribonucleotides) may be
used in PCR, a technique for the amplification of DNA and RNA
(reverse transcribed into a cDNA) sequences. In PCR, the
oligonucleotide is typically referred to as a "primer," which
allows a DNA polymerase to extend the oligonucleotide and replicate
the complementary strand.
[0123] A nucleic acid molecule may include either or both naturally
occurring and modified nucleotides linked together by naturally
occurring and/or non-naturally occurring nucleotide linkages.
Nucleic acid molecules may be modified chemically or biochemically,
or may contain non-natural or derivatized nucleotide bases, as will
be readily appreciated by those of skill in the art. Such
modifications include, for example, labels, methylation,
substitution of one or more of the naturally occurring nucleotides
with an analog, internucleotide modifications (e.g., uncharged
linkages: for example, methyl phosphonates, phosphotriesters,
phosphoramidates, carbamates, etc.; charged linkages: for example,
phosphorothioates, phosphorodithioates, etc.; pendent moieties: for
example, peptides; intercalators: for example, acridine, psoralen,
etc.; chelators; alkylators; and modified linkages: for example,
alpha anomeric nucleic acids, etc.). The term "nucleic acid
molecule" also includes any topological conformation, including
single-stranded, double-stranded, partially duplexed, triplexed,
hairpinned, circular, and padlocked conformations.
[0124] As used herein, with respect to DNA, the term "coding
sequence," "sequence encoding" "structural nucleotide sequence," or
"structural nucleic acid molecule" refers to a nucleotide sequence
that is ultimately translated into a polypeptide, via transcription
and mRNA, when placed under the control of appropriate regulatory
sequences. With respect to RNA, the term "coding sequence" refers
to a nucleotide sequence that is translated into a peptide,
polypeptide, or protein. The boundaries of a coding sequence are
determined by a translation start codon at the 5'-terminus and a
translation stop codon at the 3'-terminus. Coding sequences
include, but are not limited to: genomic DNA; cDNA; EST; and
recombinant nucleotide sequences.
[0125] Genome: As used herein, the term "genome" refers to
chromosomal DNA found within the nucleus of a cell, and also refers
to organelle DNA found within subcellular components of the cell.
In some embodiments of the invention, a DNA molecule may be
introduced into a plant cell such that the DNA molecule is
integrated into the genome of the plant cell. In these and further
embodiments, the DNA molecule may be either integrated into the
nuclear DNA of the plant cell, or integrated into the DNA of the
chloroplast or mitochondrion of the plant cell. The term "genome"
as it applies to bacteria refers to both the chromosome and
plasmids within the bacterial cell. In some embodiments of the
invention, a DNA molecule may be introduced into a bacterium such
that the DNA molecule is integrated into the genome of the
bacterium. In these and further embodiments, the DNA molecule may
be either chromosomally-integrated or located as or in a stable
plasmid.
[0126] Sequence identity: The term "sequence identity" or
"identity," as used herein, in the context of two nucleic acid or
polypeptide sequences, refers to the residues in the two sequences
that are the same when aligned for maximum correspondence over a
specified comparison window.
[0127] As used herein, the term "percentage of sequence identity"
may refer to the value determined by comparing two optimally
aligned sequences (e.g., nucleic acid sequences or polypeptide
sequences) over a comparison window, wherein the portion of the
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleotide or amino acid
residue occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the comparison window, and multiplying the
result by 100 to yield the percentage of sequence identity. A
sequence that is identical at every position in comparison to a
reference sequence is said to be 100% identical to the reference
sequence, and vice-versa.
[0128] Methods for aligning sequences for comparison are well-known
in the art. Various programs and alignment algorithms are described
in, for example: Smith and Waterman (1981) Adv. Appl. Math. 2:482;
Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and
Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and
Sharp (1988) Gene 73:237-244; Higgins and Sham (1989) CABIOS
5:151-153; Corpet et al. (1988) Nucleic Acids Res. 16:10881-10890;
Huang et al. (1992) Comp. Appl. Biosci. 8:155-165; Pearson et al.
(1994) Methods Mol. Biol. 24:307-331; Tatiana et al. (1999) FEMS
Microbiol. Lett. 174:247-250. A detailed consideration of sequence
alignment methods and homology calculations can be found in, e.g.,
Altschul et al. (1990) J. Mol. Biol. 215:403-410.
[0129] The National Center for Biotechnology Information (NCBI)
Basic Local Alignment Search Tool (BLAST.TM.; Altschul et al.
(1990)) is available from several sources, including the National
Center for Biotechnology Information (Bethesda, Md.), and on the
internet, for use in connection with several sequence analysis
programs. A description of how to determine sequence identity using
this program is available on the internet under the "help" section
for BLAST.TM.. For comparisons of nucleic acid sequences, the
"Blast 2 sequences" function of the BLAST.TM. (Blastn) program may
be employed using the default BLOSUM62 matrix set to default
parameters. Nucleic acid sequences with even greater similarity to
the reference sequences will show increasing percentage identity
when assessed by this method.
[0130] Specifically hybridizable/Specifically complementary: As
used herein, the terms "Specifically hybridizable" and
"Specifically complementary" are terms that indicate a sufficient
degree of complementarity such that stable and specific binding
occurs between the nucleic acid molecule and a target nucleic acid
molecule. Hybridization between two nucleic acid molecules involves
the formation of an anti-parallel alignment between the nucleic
acid sequences of the two nucleic acid molecules. The two molecules
are then able to form hydrogen bonds with corresponding bases on
the opposite strand to form a duplex molecule that, if it is
sufficiently stable, is detectable using methods well known in the
art. A nucleic acid molecule need not be 100% complementary to its
target sequence to be specifically hybridizable. However, the
amount of sequence complementarity that must exist for
hybridization to be specific is a function of the hybridization
conditions used.
[0131] Hybridization conditions resulting in particular degrees of
stringency will vary depending upon the nature of the hybridization
method of choice and the composition and length of the hybridizing
nucleic acid sequences. Generally, the temperature of hybridization
and the ionic strength (especially the Na.sup.+ and/or Mg.sup.++
concentration) of the hybridization will determine the stringency
of hybridization. The ionic strength of the wash buffer and the
wash temperature also influence stringency. Calculations regarding
hybridization conditions required for attaining particular degrees
of stringency are known to those of ordinary skill in the art, and
are discussed, for example, in Sambrook et al. (ed.) Molecular
Cloning: A Laboratory Manual, 2.sup.nd ed., vol. 1-3, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, chapters 9
and 11, and updates; and Hames and Higgins (eds.) Nucleic Acid
Hybridization, IRL Press, Oxford, 1985. Further detailed
instruction and guidance with regard to the hybridization of
nucleic acids may be found, for example, in Tijssen, "Overview of
principles of hybridization and the strategy of nucleic acid probe
assays," in Laboratory Techniques in Biochemistry and Molecular
Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2,
Elsevier, N Y, 1993; and Ausubel et al., Eds., Current Protocols in
Molecular Biology, Chapter 2, Greene Publishing and
Wiley-Interscience, N Y, 1995, and updates.
[0132] As used herein, "stringent conditions" encompass conditions
under which hybridization will occur only if there is more than 80%
sequence match between the hybridization molecule and a homologous
sequence within the target nucleic acid molecule. "Stringent
conditions" include further particular levels of stringency. Thus,
as used herein, "moderate stringency" conditions are those under
which molecules with more than 80% sequence match (i.e. having less
than 20% mismatch) will hybridize; conditions of "high stringency"
are those under which sequences with more than 90% match (i.e.
having less than 10% mismatch) will hybridize; and conditions of
"very high stringency" are those under which sequences with more
than 95% match (i.e. having less than 5% mismatch) will
hybridize.
[0133] The following are representative, non-limiting hybridization
conditions.
[0134] High Stringency condition (detects sequences that share at
least 90% sequence identity): Hybridization in 5.times.SSC buffer
at 65.degree. C. for 16 hours; wash twice in 2.times.SSC buffer at
room temperature for 15 minutes each; and wash twice in
0.5.times.SSC buffer at 65.degree. C. for 20 minutes each.
[0135] Moderate Stringency condition (detects sequences that share
at least 80% sequence identity): Hybridization in 5.times. to
6.times.SSC buffer at 65-70.degree. C. for 16-20 hours; wash twice
in 2.times.SSC buffer at room temperature for 5-20 minutes each;
and wash twice in 1.times.SSC buffer at 55-70.degree. C. for 30
minutes each.
[0136] Non-stringent control condition (sequences that share at
least 50% sequence identity will hybridize): Hybridization in
6.times.SSC buffer at room temperature to 55.degree. C. for 16-20
hours; wash at least twice in 2.times. to 3.times.SSC buffer at
room temperature to 55.degree. C. for 20-30 minutes each.
[0137] As used herein, the term "substantially homologous" or
"substantial homology," with regard to a contiguous nucleic acid
sequence, refers to contiguous nucleotide sequences that are borne
by nucleic acid molecules that hybridize under stringent conditions
to a nucleic acid molecule having the reference nucleic acid
sequence. For example, nucleic acid molecules having sequences that
are substantially homologous to a reference nucleic acid sequence
of SEQ ID NO:1 are those nucleic acid molecules that hybridize
under stringent conditions (e.g., the Moderate Stringency
conditions set forth, supra) to nucleic acid molecules having the
reference nucleic acid sequence of SEQ ID NO:1. Substantially
homologous sequences may have at least 80% sequence identity. For
example, substantially homologous sequences may have from about 80%
to 100% sequence identity, such as about 81%; about 82%; about 83%;
about 84%; about 85%; about 86%; about 87%; about 88%; about 89%;
about 90%; about 91%; about 92%; about 93%; about 94% about 95%;
about 96%; about 97%; about 98%; about 98.5%; about 99%; about
99.5%; and about 100%. The property of substantial homology is
closely related to specific hybridization. For example, a nucleic
acid molecule is specifically hybridizable when there is a
sufficient degree of complementarity to avoid non-specific binding
of the nucleic acid to non-target sequences under conditions where
specific binding is desired, for example, under stringent
hybridization conditions.
[0138] As used herein, the term "ortholog" refers to a gene in two
or more species that has evolved from a common ancestral nucleotide
sequence, and may retain the same function in the two or more
species.
[0139] As used herein, two nucleic acid sequence molecules are said
to exhibit "complete complementarity" when every nucleotide of a
sequence read in the 5' to 3' direction is complementary to every
nucleotide of the other sequence when read in the 3' to 5'
direction. A nucleotide sequence that is complementary to a
reference nucleotide sequence will exhibit a sequence identical to
the reverse complement sequence of the reference nucleotide
sequence. These terms and descriptions are well defined in the art
and are easily understood by those of ordinary skill in the
art.
[0140] Operably linked: A first nucleotide sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is in a functional relationship with the second
nucleic acid sequence. When recombinantly produced, operably linked
nucleic acid sequences are generally contiguous, and, where
necessary, two protein-coding regions may be joined in the same
reading frame (e.g., in a translationally fused ORF). However,
nucleic acids need not be contiguous to be operably linked.
[0141] The term, "operably linked," when used in reference to a
regulatory sequence and a coding sequence, means that the
regulatory sequence affects the expression of the linked coding
sequence. "Regulatory sequences," or "control elements," refer to
nucleotide sequences that influence the timing and level/amount of
transcription, RNA processing or stability, or translation of the
associated coding sequence. Regulatory sequences may include
promoters; translation leader sequences; introns; enhancers;
stem-loop structures; repressor binding sequences; termination
sequences; polyadenylation recognition sequences; etc. Particular
regulatory sequences may be located upstream and/or downstream of a
coding sequence operably linked thereto. Also, particular
regulatory sequences operably linked to a coding sequence may be
located on the associated complementary strand of a double-stranded
nucleic acid molecule.
[0142] Promoter: As used herein, the term "promoter" refers to a
region of DNA that may be upstream from the start of transcription,
and that may be involved in recognition and binding of RNA
polymerase and other proteins to initiate transcription. A promoter
may be operably linked to a coding sequence for expression in a
cell, or a promoter may be operably linked to a nucleotide sequence
encoding a signal sequence which may be operably linked to a coding
sequence for expression in a cell. A "plant promoter" may be a
promoter capable of initiating transcription in plant cells.
Examples of promoters under developmental control include promoters
that preferentially initiate transcription in certain tissues, such
as leaves, roots, seeds, fibers, xylem vessels, tracheids, or
sclerenchyma. Such promoters are referred to as "tissue-preferred."
Promoters which initiate transcription only in certain tissues are
referred to as "tissue-specific." A "cell type-specific" promoter
primarily drives expression in certain cell types in one or more
organs, for example, vascular cells in roots or leaves. An
"inducible" promoter may be a promoter which may be under
environmental control. Examples of environmental conditions that
may initiate transcription by inducible promoters include anaerobic
conditions and the presence of light. Tissue-specific,
tissue-preferred, cell type specific, and inducible promoters
constitute the class of "non-constitutive" promoters. A
"constitutive" promoter is a promoter which may be active under
most environmental conditions or in most tissue or cell types.
[0143] Any inducible promoter can be used in some embodiments of
the invention. See Ward et al. (1993) Plant Mol. Biol. 22:361-366.
With an inducible promoter, the rate of transcription increases in
response to an inducing agent. Exemplary inducible promoters
include, but are not limited to: Promoters from the ACEI system
that respond to copper; In2 gene from maize that responds to
benzenesulfonamide herbicide safeners; Tet repressor from Tn10; and
the inducible promoter from a steroid hormone gene, the
transcriptional activity of which may be induced by a
glucocorticosteroid hormone (Schena et al. (1991) Proc. Natl. Acad.
Sci. USA 88:10421-10425).
[0144] Exemplary constitutive promoters include, but are not
limited to: Promoters from plant viruses, such as the 35S promoter
from Cauliflower Mosaic Virus (CaMV); promoters from rice actin
genes; ubiquitin promoters; pEMU; MAS; maize H3 histone promoter;
and the ALS promoter, Xbal/NcoI fragment 5' to the Brassica napus
ALS3 structural gene (or a nucleotide sequence similar to said
Xbal/NcoI fragment) (U.S. Pat. No. 5,659,026).
[0145] Additionally, any tissue-specific or tissue-preferred
promoter may be utilized in some embodiments of the invention.
Plants transformed with a nucleic acid molecule comprising a coding
sequence operably linked to a tissue-specific promoter may produce
the product of the coding sequence exclusively, or preferentially,
in a specific tissue. Exemplary tissue-specific or tissue-preferred
promoters include, but are not limited to: A seed-preferred
promoter, such as that from the phaseolin gene; a leaf-specific and
light-induced promoter such as that from cab or rubisco; an
anther-specific promoter such as that from LAT52; a pollen-specific
promoter such as that from Zm13; and a microspore-preferred
promoter such as that from apg.
[0146] Soybean plant: As used herein, the term "soybean plant"
refers to a plant of the species Glycine sp., including Glycine
max.
[0147] Transformation: As used herein, the term "transformation" or
"transduction" refers to the transfer of one or more nucleic acid
molecule(s) into a cell. A cell is "transformed" by a nucleic acid
molecule transduced into the cell when the nucleic acid molecule
becomes stably replicated by the cell, either by incorporation of
the nucleic acid molecule into the cellular genome, or by episomal
replication. As used herein, the term "transformation" encompasses
all techniques by which a nucleic acid molecule can be introduced
into such a cell. Examples include, but are not limited to:
transfection with viral vectors; transformation with plasmid
vectors; electroporation (Fromm et al. (1986) Nature 319:791-793);
lipofection (Felgner et al. (1987) Proc. Natl. Acad. Sci. USA
84:7413-7417); microinjection (Mueller et al. (1978) Cell
15:579-585); Agrobacterium-mediated transfer (Fraley et al. (1983)
Proc. Natl. Acad. Sci. USA 80:4803-4807); direct DNA uptake; and
microprojectile bombardment (Klein et al. (1987) Nature
327:70).
[0148] Transgene: An exogenous nucleic acid sequence. In some
examples, a transgene may be a sequence that encodes one or both
strand(s) of a dsRNA molecule that comprises a nucleotide sequence
that is complementary to a nucleic acid molecule found in a
coleopteran and/or hemipteran pest. In further examples, a
transgene may be an antisense nucleic acid sequence, wherein
expression of the antisense nucleic acid sequence inhibits
expression of a target nucleic acid sequence. In still further
examples, a transgene may be a gene sequence (e.g., a
herbicide-resistance gene), a gene encoding an industrially or
pharmaceutically useful compound, or a gene encoding a desirable
agricultural trait. In these and other examples, a transgene may
contain regulatory sequences (e.g., a promoter) operably linked to
a coding sequence of the transgene.
[0149] Vector: A nucleic acid molecule as introduced into a cell,
for example, to produce a transformed cell. A vector may include
nucleic acid sequences that permit it to replicate in the host
cell, such as an origin of replication. Examples of vectors
include, but are not limited to: a plasmid; cosmid; bacteriophage;
or virus that carries exogenous DNA into a cell. A vector may also
be an RNA molecule. A vector may also include one or more genes,
antisense sequences, and/or selectable marker genes and other
genetic elements known in the art. A vector may transduce,
transform, or infect a cell, thereby causing the cell to express
the nucleic acid molecules and/or proteins encoded by the vector. A
vector optionally includes materials to aid in achieving entry of
the nucleic acid molecule into the cell (e.g., a liposome, protein
coating, etc.).
[0150] Yield: A stabilized yield of about 100% or greater relative
to the yield of check varieties in the same growing location
growing at the same time and under the same conditions. In
particular embodiments, "improved yield" or "improving yield" means
a cultivar having a stabilized yield of 105% to 115% or greater
relative to the yield of check varieties in the same growing
location containing significant densities of coleopteran and/or
hemipteran pests that are injurious to that crop growing at the
same time and under the same conditions.
[0151] Unless specifically indicated or implied, the terms "a,"
"an," and "the" signify "at least one," as used herein.
[0152] Unless otherwise specifically explained, all technical and
scientific terms used herein have the same meaning as commonly
understood by those of ordinary skill in the art to which this
disclosure belongs. Definitions of common terms in molecular
biology can be found in, for example, Lewin's Genes X, Jones &
Bartlett Publishers, 2009 (ISBN 10 0763766321); Krebs et al.
(eds.), The Encyclopedia of Molecular Biology, Blackwell Science
Ltd., 1994 (ISBN 0-632-02182-9); and Meyers R. A. (ed.), Molecular
Biology and Biotechnology: A Comprehensive Desk Reference, VCH
Publishers, Inc., 1995 (ISBN 1-56081-569-8). All percentages are by
weight and all solvent mixture proportions are by volume unless
otherwise noted. All temperatures are in degrees Celsius.
IV. Nucleic Acid Molecules Comprising a Coleopteran and/or
Hemipteran Pest Sequence
[0153] A. Overview
[0154] Described herein are nucleic acid molecules useful for the
control of coleopteran and/or hemipteran pests. Described nucleic
acid molecules include target sequences (e.g., native genes, and
non-coding sequences), dsRNAs, siRNAs, shRNAs, hpRNAs, and miRNAs.
For example, dsRNA, siRNA, shRNA, miRNA and/or hpRNA molecules are
described in some embodiments that may be specifically
complementary to all or part of one or more native nucleic acid
sequences in a coleopteran and/or hemipteran pest. In these and
further embodiments, the native nucleic acid sequence(s) may be one
or more target gene(s), the product of which may be, for example
and without limitation: involved in a metabolic process; involved
in a reproductive process; or involved in larval development.
Nucleic acid molecules described herein, when introduced into a
cell comprising at least one native nucleic acid sequence(s) to
which the nucleic acid molecules are specifically complementary,
may initiate RNAi in the cell, and consequently reduce or eliminate
expression of the native nucleic acid sequence(s). In some
examples, reduction or elimination of the expression of a target
gene by a nucleic acid molecule comprising a sequence specifically
complementary thereto may be lethal in coleopteran and/or
hemipteran pests, or result in reduced growth and/or
reproduction.
[0155] In some embodiments, at least one target gene in a
coleopteran and/or hemipteran pest may be selected, wherein the
target gene comprises a nucleotide sequence comprising rop (SEQ ID
NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133). In particular
examples, a target gene in a coleopteran and/or hemipteran pest is
selected, wherein the target gene comprises a novel nucleotide
sequence comprising rop (SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120,
SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ
ID NO:133).
[0156] In some embodiments, a target gene may be a nucleic acid
molecule comprising a nucleotide sequence that encodes a
polypeptide comprising a contiguous amino acid sequence that is at
least 85% identical (e.g., about 90%, about 95%, about 96%, about
97%, about 98%, about 99%, about 100%, or 100% identical) to the
amino acid sequence of a protein product of rop (SEQ ID NO:1, SEQ
ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133). A target gene may be any
nucleic acid sequence in a coleopteran and/or hemipteran pest, the
post-transcriptional inhibition of which has a deleterious effect
on the coleopteran and/or hemipteran pest, or provides a protective
benefit against the coleopteran and/or hemipteran pest to a plant.
In particular examples, a target gene is a nucleic acid molecule
comprising a nucleotide sequence that encodes a polypeptide
comprising a contiguous amino acid sequence that is at least 85%
identical, about 90% identical, about 95% identical, about 96%
identical, about 97% identical, about 98% identical, about 99%
identical, about 100% identical, or 100% identical to the amino
acid sequence of a protein product of novel nucleotide sequence SEQ
ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133.
[0157] Provided according to the invention are nucleotide
sequences, the expression of which results in an RNA molecule
comprising a nucleotide sequence that is specifically complementary
to all or part of a native RNA molecule that is encoded by a coding
sequence in a coleopteran and/or hemipteran pest. In some
embodiments, after ingestion of the expressed RNA molecule by a
coleopteran and/or hemipteran pest, down-regulation of the coding
sequence in cells of the coleopteran and/or hemipteran pest may be
obtained. In particular embodiments, down-regulation of the coding
sequence in cells of the coleopteran and/or hemipteran pest may
result in a deleterious effect on the growth, viability,
proliferation, and/or reproduction of the coleopteran and/or
hemipteran pest.
[0158] In some embodiments, target sequences include transcribed
non-coding RNA sequences, such as 5'UTRs; 3'U IRs; spliced leader
sequences; intron sequences; outron sequences (e.g., 5'UTR RNA
subsequently modified in trans splicing); donatron sequences (e.g.,
non-coding RNA required to provide donor sequences for trans
splicing); and other non-coding transcribed RNA of target
coleopteran and/or hemipteran pest genes. Such sequences may be
derived from both mono-cistronic and poly-cistronic genes.
[0159] Thus, also described herein in connection with some
embodiments are iRNA molecules (e.g., dsRNAs, siRNAs, shRNAs,
miRNAs and hpRNAs) that comprise at least one nucleotide sequence
that is specifically complementary to all or part of a target
sequence in a coleopteran and/or hemipteran pest. In some
embodiments an iRNA molecule may comprise nucleotide sequence(s)
that are complementary to all or part of a plurality of target
sequences; for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more target
sequences. In particular embodiments, an iRNA molecule may be
produced in vitro, or in vivo by a genetically-modified organism,
such as a plant or bacterium. Also disclosed are cDNA sequences
that may be used for the production of dsRNA molecules, siRNA
molecules, shRNA molecules, miRNA molecules, and/or hpRNA molecules
that are specifically complementary to all or part of a target
sequence in a coleopteran and/or hemipteran pest. Further described
are recombinant DNA constructs for use in achieving stable
transformation of particular host targets. Transformed host targets
may express effective levels of dsRNA, siRNA, shRNA, miRNA and/or
hpRNA molecules from the recombinant DNA constructs. Therefore,
also described is a plant transformation vector comprising at least
one nucleotide sequence operably linked to a heterologous promoter
functional in a plant cell, wherein expression of the nucleotide
sequence(s) results in an RNA molecule comprising a nucleotide
sequence that is specifically complementary to all or part of a
target sequence in a coleopteran and/or hemipteran pest.
[0160] In some embodiments, nucleic acid molecules useful for the
control of coleopteran and/or hemipteran pests may include: all or
part of a native nucleic acid sequence isolated from a Diabrotica,
Meligethes, or hemipteran organism comprising rop (e.g., SEQ ID
NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133); nucleotide
sequences that when expressed result in an RNA molecule comprising
a nucleotide sequence that is specifically complementary to all or
part of a native RNA molecule that is encoded by rop (e.g., SEQ ID
NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133); iRNA molecules
(e.g., dsRNAs, siRNAs, shRNAs, miRNAs and hpRNAs) that comprise at
least one nucleotide sequence that is specifically complementary to
all or part of a rop coding sequence (e.g., SEQ ID NO:1, SEQ ID
NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126,
SEQ ID NO:131, or SEQ ID NO:133); cDNA sequences that may be used
for the production of dsRNA molecules, siRNA molecules, miRNA
and/or hpRNA molecules that are specifically complementary to all
or part of pre-mRNA or mRNA by rop (e.g., SEQ ID NO:1, SEQ ID
NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126,
SEQ ID NO:131, or SEQ ID NO:133); and recombinant DNA constructs
for use in achieving stable transformation of particular host
targets, wherein a transformed host target comprises one or more of
the foregoing nucleic acid molecules.
[0161] B. Nucleic Acid Molecules
[0162] The present invention provides, inter alia, iRNA (e.g.,
dsRNA, siRNA, shRNA, miRNA and hpRNA) molecules that inhibit target
gene expression in a cell, tissue, or organ of a coleopteran and/or
hemipteran pest; and DNA molecules capable of being expressed as an
iRNA molecule in a cell or microorganism to inhibit target gene
expression in a cell, tissue, or organ of a coleopteran and/or
hemipteran pest.
[0163] Some embodiments of the invention provide an isolated
nucleic acid molecule comprising at least one (e.g., one, two,
three, or more) nucleotide sequence(s) selected from the group
consisting of: SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133; the complement of SEQ ID NO:1, SEQ ID NO:115, SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133; a fragment of at least 15 contiguous nucleotides
of SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of a fragment of at least 15 contiguous nucleotides of
SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; a native
coding sequence of a Diabrotica organism (e.g., WCR) comprising SEQ
ID NO:1; a native coding sequence of a hemipteran organism
comprising SEQ ID NO:115; a native coding sequence of a Meligethes
organism comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the complement of a
native coding sequence of a Diabrotica organism comprising SEQ ID
NO:1; the complement of a native coding sequence of a hemipteran
organism comprising SEQ ID NO:115; the complement of a native
coding sequence of a Meligethes organism comprising SEQ ID NO:120,
SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ
ID NO:133; a native non-coding sequence of a Diabrotica organism
that is transcribed into a native RNA molecule comprising SEQ ID
NO:1; a native non-coding sequence of a hemipteran organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:115; a
native non-coding sequence of a Meligethes organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:120,
SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ
ID NO:133; the complement of a native non-coding sequence of a
Diabrotica organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:1; the complement of a native non-coding
sequence of a hemipteran organism that is transcribed into a native
RNA molecule comprising SEQ ID NO:115; the complement of a native
non-coding sequence of a Meligethes organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:120, SEQ ID NO:122,
SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; a
fragment of at least 15 contiguous nucleotides of a native coding
sequence of a Diabrotica organism comprising SEQ ID NO:1; a
fragment of at least 15 contiguous nucleotides of a native coding
sequence of a hemipteran organism comprising SEQ ID NO:115; a
fragment of at least 15 contiguous nucleotides of a native coding
sequence of a Meligethes organism comprising SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133; the complement of a fragment of at least 15 contiguous
nucleotides of a native coding sequence of a Diabrotica organism
comprising SEQ ID NO:1; the complement of a fragment of at least 15
contiguous nucleotides of a native coding sequence of a hemipteran
organism comprising SEQ ID NO:115; the complement of a fragment of
at least 15 contiguous nucleotides of a native coding sequence of a
Meligethes organism comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; a fragment
of at least 15 contiguous nucleotides of a native non-coding
sequence of a Diabrotica organism that is transcribed into a native
RNA molecule comprising SEQ ID NO:1; a fragment of at least 15
contiguous nucleotides of a native non-coding sequence of a
hemipteran organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:115; a fragment of at least 15 contiguous
nucleotides of a native non-coding sequence of a Meligethes
organism that is transcribed into a native RNA molecule comprising
SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID
NO:131, or SEQ ID NO:133; the complement of a fragment of at least
15 contiguous nucleotides of a native non-coding sequence of a
Diabrotica organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:1; the complement of a fragment of at least 15
contiguous nucleotides of a native non-coding sequence of a
hemipteran organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:115, and the complement of a fragment of at
least 15 contiguous nucleotides of a native non-coding sequence of
a Meligethes organism that is transcribed into a native RNA
molecule comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133. In particular
embodiments, contact with or uptake by a coleopteran and/or
hemipteran pest of the isolated nucleic acid sequence inhibits the
growth, development, reproduction and/or feeding of the coleopteran
and/or hemipteran pest.
[0164] In some embodiments, a nucleic acid molecule of the
invention may comprise at least one (e.g., one, two, three, or
more) DNA sequence(s) capable of being expressed as an iRNA
molecule in a cell or microorganism to inhibit target gene
expression in a cell, tissue, or organ of a coleopteran and/or
hemipteran pest. Such DNA sequence(s) may be operably linked to a
promoter sequence that functions in a cell comprising the DNA
molecule to initiate or enhance the transcription of the encoded
RNA capable of forming a dsRNA molecule(s). In one embodiment, the
at least one (e.g., one, two, three, or more) DNA sequence(s) may
be derived from a nucleotide sequence comprising SEQ ID NO:1, SEQ
ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133. Derivatives of SEQ ID
NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133 include fragments of
SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133. In some
embodiments, such a fragment may comprise, for example, at least
about 15 contiguous nucleotides of SEQ ID NO:1, SEQ ID NO:115, SEQ
ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID
NO:131, or SEQ ID NO:133, or a complement thereof. Thus, such a
fragment may comprise, for example, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110,
120, 130, 140, 150, 160, 170, 180, 190, 200 or more contiguous
nucleotides of SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133, or a complement thereof. In these and further embodiments,
such a fragment may comprise, for example, more than about 15
contiguous nucleotides of SEQ ID NO:1, SEQ ID NO:115, SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133, or a complement thereof. Thus, a fragment of SEQ
ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133 may
comprise, for example, 15, 16, 17, 18, 19, 20, 21, about 25, (e.g.,
22, 23, 24, 25, 26, 27, 28, and 29), about 30, about 40, (e.g., 35,
36, 37, 38, 39, 40, 41, 42, 43, 44, and 45), about 50, about 60,
about 70, about 80, about 90, about 100, about 110, about 120,
about 130, about 140, about 150, about 160, about 170, about 180,
about 190, about 200 or more contiguous nucleotides of SEQ ID NO:1,
SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133, or a complement
thereof.
[0165] Some embodiments comprise introducing partial- or
fully-stabilized dsRNA molecules into a coleopteran and/or
hemipteran pest to inhibit expression of a target gene in a cell,
tissue, or organ of the coleopteran and/or hemipteran pest. When
expressed as an iRNA molecule (e.g., dsRNA, siRNA, shRNA, miRNA,
and hpRNA) and taken up by a coleopteran and/or hemipteran pest,
nucleic acid sequences comprising one or more fragments of SEQ ID
NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133 may cause one or
more of death, growth inhibition, change in sex ratio, reduction in
brood size, cessation of infection, and/or cessation of feeding by
a coleopteran and/or hemipteran pest. For example, in some
embodiments, a dsRNA molecule comprising a nucleotide sequence
including about 15 to about 300 or about 19 to about 25 nucleotides
that are substantially homologous to a coleopteran and/or
hemipteran pest target gene sequence and comprising one or more
fragments of a nucleotide sequence comprising SEQ ID NO:1, SEQ ID
NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126,
SEQ ID NO:131, or SEQ ID NO:133 is provided. Expression of such a
dsRNA molecule may, for example, lead to mortality and/or growth
inhibition in a coleopteran and/or hemipteran pest that takes up
the dsRNA molecule.
[0166] In certain embodiments, dsRNA molecules provided by the
invention comprise nucleotide sequences complementary to a target
gene comprising SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133 and/or nucleotide sequences complementary to a fragment of
SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133, the
inhibition of which target gene in a coleopteran and/or hemipteran
pest results in the reduction or removal of a protein or nucleotide
sequence agent that is essential for the coleopteran and/or
hemipteran pest's growth, development, or other biological
function. A selected nucleotide sequence may exhibit from about 80%
to about 100% sequence identity to SEQ ID NO:1, SEQ ID NO:115, SEQ
ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID
NO:131, or SEQ ID NO:133, a contiguous fragment of the nucleotide
sequence set forth in SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120,
SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ
ID NO:133, or the complement of either of the foregoing. For
example, a selected nucleotide sequence may exhibit about 81%;
about 82%; about 83%; about 84%; about 85%; about 86%; about 87%;
about 88%; about 89%; about 90%; about 91%; about 92%; about 93%;
about 94% about 95%; about 96%; about 97%; about 98%; about 98.5%;
about 99%; about 99.5%; or about 100% sequence identity to SEQ ID
NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133, a contiguous
fragment of the nucleotide sequence set forth in SEQ ID NO:1, SEQ
ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133, or the complement of
either of the foregoing.
[0167] In some embodiments, a DNA molecule capable of being
expressed as an iRNA molecule in a cell or microorganism to inhibit
target gene expression may comprise a single nucleotide sequence
that is specifically complementary to all or part of a native
nucleic acid sequence found in one or more target coleopteran
and/or hemipteran pest species, or the DNA molecule can be
constructed as a chimera from a plurality of such specifically
complementary sequences.
[0168] In some embodiments, a nucleic acid molecule may comprise a
first and a second nucleotide sequence separated by a "spacer
sequence." A spacer sequence may be a region comprising any
sequence of nucleotides that facilitates secondary structure
formation between the first and second nucleotide sequences, where
this is desired. In one embodiment, the spacer sequence is part of
a sense or antisense coding sequence for mRNA. The spacer sequence
may alternatively comprise any combination of nucleotides or
homologues thereof that are capable of being linked covalently to a
nucleic acid molecule.
[0169] For example, in some embodiments, the DNA molecule may
comprise a nucleotide sequence coding for one or more different RNA
molecules, wherein each of the different RNA molecules comprises a
first nucleotide sequence and a second nucleotide sequence, wherein
the first and second nucleotide sequences are complementary to each
other. The first and second nucleotide sequences may be connected
within an RNA molecule by a spacer sequence. The spacer sequence
may constitute part of the first nucleotide sequence or the second
nucleotide sequence. Expression of an RNA molecule comprising the
first and second nucleotide sequences may lead to the formation of
a dsRNA molecule of the present invention, by specific base-pairing
of the first and second nucleotide sequences. The first nucleotide
sequence or the second nucleotide sequence may be substantially
identical to a nucleic acid sequence native to a coleopteran and/or
hemipteran pest (e.g., a target gene, or transcribed non-coding
sequence), a derivative thereof, or a complementary sequence
thereto.
[0170] dsRNA nucleic acid molecules comprise double strands of
polymerized ribonucleotide sequences, and may include modifications
to either the phosphate-sugar backbone or the nucleoside.
Modifications in RNA structure may be tailored to allow specific
inhibition. In one embodiment, dsRNA molecules may be modified
through a ubiquitous enzymatic process so that siRNA molecules may
be generated. This enzymatic process may utilize an RNAse III
enzyme, such as DICER in eukaryotes, either in vitro or in vivo.
See Elbashir et al. (2001) Nature 411:494-498; and Hamilton and
Baulcombe (1999) Science 286(5441):950-952. DICER or
functionally-equivalent RNAse III enzymes cleave larger dsRNA
strands and/or hpRNA molecules into smaller oligonucleotides (e.g.,
siRNAs), each of which is typically about 19-25 nucleotides in
length. The siRNA molecules produced by these enzymes have 2 to 3
nucleotide 3' overhangs, and 5' phosphate and 3' hydroxyl termini.
The siRNA molecules generated by RNAse III enzymes are unwound and
separated into single-stranded RNA in the cell. The siRNA molecules
then specifically hybridize with RNA sequences transcribed from a
target gene, and both RNA molecules are subsequently degraded by an
inherent cellular RNA-degrading mechanism. This process may result
in the effective degradation or removal of the RNA sequence encoded
by the target gene in the target organism. The outcome is the
post-transcriptional silencing of the targeted gene. In some
embodiments, siRNA molecules produced by endogenous RNAse III
enzymes from heterologous nucleic acid molecules may efficiently
mediate the down-regulation of target genes in coleopteran and/or
hemipteran pests.
[0171] In some embodiments, a nucleic acid molecule of the
invention may include at least one non-naturally occurring
nucleotide sequence that can be transcribed into a single-stranded
RNA molecule capable of forming a dsRNA molecule in vivo through
intermolecular hybridization. Such dsRNA sequences typically
self-assemble, and can be provided in the nutrition source of a
coleopteran and/or hemipteran pest to achieve the
post-transcriptional inhibition of a target gene. In these and
further embodiments, a nucleic acid molecule of the invention may
comprise two different non-naturally occurring nucleotide
sequences, each of which is specifically complementary to a
different target gene in a coleopteran and/or hemipteran pest. When
such a nucleic acid molecule is provided as a dsRNA molecule to a
coleopteran and/or hemipteran pest, the dsRNA molecule inhibits the
expression of at least two different target genes in the
coleopteran and/or hemipteran pest.
[0172] C. Obtaining Nucleic Acid Molecules
[0173] A variety of native sequences in coleopteran and/or
hemipteran pests may be used as target sequences for the design of
nucleic acid molecules of the invention, such as iRNAs and DNA
molecules encoding iRNAs. Selection of native sequences is not,
however, a straight-forward process. Only a small number of native
sequences in the coleopteran and/or hemipteran pest will be
effective targets. For example, it cannot be predicted with
certainty whether a particular native sequence can be effectively
down-regulated by nucleic acid molecules of the invention, or
whether down-regulation of a particular native sequence will have a
detrimental effect on the growth, viability, proliferation, and/or
reproduction of the coleopteran and/or hemipteran pest. The vast
majority of native coleopteran and/or hemipteran pest sequences,
such as ESTs isolated therefrom (for example, as listed in U.S.
Pat. Nos. 7,612,194 and 7,943,819), do not have a detrimental
effect on the growth, viability, proliferation, and/or reproduction
of the coleopteran and/or hemipteran pest, such as WCR, NCR,
Meligethes aeneus, Euschistus heros, Nezara viridula, Piezodorus
guildinii, Halyomorpha halys, Acrosternum hilare, and Euschistus
serous.
[0174] Neither is it predictable which of the native sequences
which may have a detrimental effect on a coleopteran and/or
hemipteran pest are able to be used in recombinant techniques for
expressing nucleic acid molecules complementary to such native
sequences in a host plant and providing the detrimental effect on
the coleopteran and/or hemipteran pest upon feeding without causing
hams to the host plant.
[0175] In some embodiments, nucleic acid molecules of the invention
(e.g., dsRNA molecules to be provided in the host plant of a
coleopteran and/or hemipteran pest) are selected to target cDNA
sequences that encode proteins or parts of proteins essential for
coleopteran and/or hemipteran pest survival, such as amino acid
sequences involved in metabolic or catabolic biochemical pathways,
cell division, reproduction, energy metabolism, digestion, host
plant recognition, and the like. As described herein, ingestion of
compositions by a target organism containing one or more dsRNAs, at
least one segment of which is specifically complementary to at
least a substantially identical segment of RNA produced in the
cells of the target pest organism, can result in the death or other
inhibition of the target. A nucleotide sequence, either DNA or RNA,
derived from a coleopteran and/or hemipteran pest can be used to
construct plant cells resistant to infestation by the coleopteran
and/or hemipteran pests. The host plant of the coleopteran and/or
hemipteran pest (e.g., Z. mays or G. max), for example, can be
transformed to contain one or more of the nucleotide sequences
derived from the coleopteran and/or hemipteran pest as provided
herein. The nucleotide sequence transformed into the host may
encode one or more RNAs that form into a dsRNA sequence in the
cells or biological fluids within the transformed host, thus making
the dsRNA available if/when the coleopteran and/or hemipteran pest
forms a nutritional relationship with the transgenic host. This may
result in the suppression of expression of one or more genes in the
cells of the coleopteran and/or hemipteran pest, and ultimately
death or inhibition of its growth or development.
[0176] Thus, in some embodiments, a gene is targeted that is
essentially involved in the growth, development and reproduction of
a coleopteran and/or hemipteran pest. Other target genes for use in
the present invention may include, for example, those that play
important roles in coleopteran and/or hemipteran pest viability,
movement, migration, growth, development, infectivity,
establishment of feeding sites and reproduction. A target gene may,
therefore, be a housekeeping gene or a transcription factor.
Additionally, a native coleopteran and/or hemipteran pest
nucleotide sequence for use in the present invention may also be
derived from a homolog (e.g., an ortholog), of a plant, viral,
bacterial or insect gene, the function of which is known to those
of skill in the art, and the nucleotide sequence of which is
specifically hybridizable with a target gene in the genome of the
target coleopteran and/or hemipteran pest. Methods of identifying a
homolog of a gene with a known nucleotide sequence by hybridization
are known to those of skill in the art.
[0177] In some embodiments, the invention provides methods for
obtaining a nucleic acid molecule comprising a nucleotide sequence
for producing an iRNA (e.g., dsRNA, siRNA, shRNA, miRNA, and hpRNA)
molecule. One such embodiment comprises: (a) analyzing one or more
target gene(s) for their expression, function, and phenotype upon
dsRNA-mediated gene suppression in a coleopteran and/or hemipteran
pest; (b) probing a cDNA or gDNA library with a probe comprising
all or a portion of a nucleotide sequence or a homolog thereof from
a targeted coleopteran and/or hemipteran pest that displays an
altered (e.g., reduced) growth or development phenotype in a
dsRNA-mediated suppression analysis; (c) identifying a DNA clone
that specifically hybridizes with the probe; (d) isolating the DNA
clone identified in step (b); (e) sequencing the cDNA or gDNA
fragment that comprises the clone isolated in step (d), wherein the
sequenced nucleic acid molecule comprises all or a substantial
portion of the RNA sequence or a homolog thereof; and (f)
chemically synthesizing all or a substantial portion of a gene
sequence, or a siRNA, or shRNA, or miRNA or hpRNA or mRNA or
dsRNA.
[0178] In further embodiments, a method for obtaining a nucleic
acid fragment comprising a nucleotide sequence for producing a
substantial portion of an iRNA (e.g., dsRNA, siRNA, shRNA, miRNA,
and hpRNA) molecule includes: (a) synthesizing first and second
oligonucleotide primers specifically complementary to a portion of
a native nucleotide sequence from a targeted coleopteran and/or
hemipteran pest; and (b) amplifying a cDNA or gDNA insert present
in a cloning vector using the first and second oligonucleotide
primers of step (a), wherein the amplified nucleic acid molecule
comprises a substantial portion of a siRNA or miRNA or shRNA or
hpRNA or mRNA or dsRNA molecule.
[0179] Nucleic acids of the invention can be isolated, amplified,
or produced by a number of approaches. For example, an iRNA (e.g.,
dsRNA, siRNA, shRNA, miRNA, and hpRNA) molecule may be obtained by
PCR amplification of a target nucleic acid sequence (e.g., a target
gene or a target transcribed non-coding sequence) derived from a
gDNA or cDNA library, or portions thereof. DNA or RNA may be
extracted from a target organism, and nucleic acid libraries may be
prepared therefrom using methods known to those ordinarily skilled
in the art. gDNA or cDNA libraries generated from a target organism
may be used for PCR amplification and sequencing of target genes. A
confirmed PCR product may be used as a template for in vitro
transcription to generate sense and antisense RNA with minimal
promoters. Alternatively, nucleic acid molecules may be synthesized
by any of a number of techniques (See, e.g., Ozaki et al. (1992)
Nucleic Acids Research, 20: 5205-5214; and Agrawal et al. (1990)
Nucleic Acids Research, 18: 5419-5423), including use of an
automated DNA synthesizer (for example, a P. E. Biosystems, Inc.
(Foster City, Calif.) model 392 or 394 DNA/RNA Synthesizer), using
standard chemistries, such as phosphoramidite chemistry. See, e.g.,
Beaucage et al. (1992) Tetrahedron, 48: 2223-2311; U.S. Pat. Nos.
4,415,732, 4,458,066, 4,725,677, 4,973,679, and 4,980,460.
Alternative chemistries resulting in non-natural backbone groups,
such as phosphorothioate, phosphoramidate, and the like, can also
be employed.
[0180] An RNA, dsRNA, siRNA, shRNA, miRNA, or hpRNA molecule of the
present invention may be produced chemically or enzymatically by
one skilled in the art through manual or automated reactions, or in
vivo in a cell comprising a nucleic acid molecule comprising a
sequence encoding the RNA, dsRNA, siRNA, shRNA, miRNA, or hpRNA
molecule. RNA may also be produced by partial or total organic
synthesis--any modified ribonucleotide can be introduced by in
vitro enzymatic or organic synthesis. An RNA molecule may be
synthesized by a cellular RNA polymerase or a bacteriophage RNA
polymerase (e.g., T3 RNA polymerase, T7 RNA polymerase, and SP6 RNA
polymerase). Expression constructs useful for the cloning and
expression of nucleotide sequences are known in the art. See, e.g.,
U.S. Pat. Nos. 5,593,874, 5,693,512, 5,698,425, 5,712,135,
5,789,214, and 5,804,693. RNA molecules that are synthesized
chemically or by in vitro enzymatic synthesis may be purified prior
to introduction into a cell. For example, RNA molecules can be
purified from a mixture by extraction with a solvent or resin,
precipitation, electrophoresis, chromatography, or a combination
thereof. Alternatively, RNA molecules that are synthesized
chemically or by in vitro enzymatic synthesis may be used with no
or a minimum of purification, for example, to avoid losses due to
sample processing. The RNA molecules may be dried for storage or
dissolved in an aqueous solution. The solution may contain buffers
or salts to promote annealing, and/or stabilization of dsRNA
molecule duplex strands.
[0181] In certain embodiments, a dsRNA molecule may be formed by a
single self-complementary RNA strand or from two complementary RNA
strands. dsRNA molecules may be synthesized either in vivo or in
vitro. An endogenous RNA polymerase of the cell may mediate
transcription of the one or two RNA strands in vivo, or cloned RNA
polymerase may be used to mediate transcription in vivo or in
vitro. Post-transcriptional inhibition of a target gene in a
coleopteran and/or hemipteran pest may be host-targeted by specific
transcription in an organ, tissue, or cell type of the host (e.g.,
by using a tissue-specific promoter); stimulation of an
environmental condition in the host (e.g., by using an inducible
promoter that is responsive to infection, stress, temperature,
and/or chemical inducers); and/or engineering transcription at a
developmental stage or age of the host (e.g., by using a
developmental stage-specific promoter). RNA strands that form a
dsRNA molecule, whether transcribed in vitro or in vivo, may or may
not be polyadenylated, and may or may not be capable of being
translated into a polypeptide by a cell's translational
apparatus.
[0182] D. Recombinant Vectors and Host Cell Transformation
[0183] In some embodiments, the invention also provides a DNA
molecule for introduction into a cell (e.g., a bacterial cell, a
yeast cell, or a plant cell), wherein the DNA molecule comprises a
nucleotide sequence that, upon expression to RNA and ingestion by a
coleopteran and/or hemipteran pest, achieves suppression of a
target gene in a cell, tissue, or organ of the coleopteran and/or
hemipteran pest. Thus, some embodiments provide a recombinant
nucleic acid molecule comprising a nucleic acid sequence capable of
being expressed as an iRNA (e.g., dsRNA, siRNA, shRNA, miRNA, and
hpRNA) molecule in a plant cell to inhibit target gene expression
in a coleopteran and/or hemipteran pest. In order to initiate or
enhance expression, such recombinant nucleic acid molecules may
comprise one or more regulatory sequences, which regulatory
sequences may be operably linked to the nucleic acid sequence
capable of being expressed as an iRNA. Methods to express a gene
suppression molecule in plants are known, and may be used to
express a nucleotide sequence of the present invention. See, e.g.,
International PCT Publication No. WO06/073727; and U.S. Patent
Publication No. 2006/0200878 A1).
[0184] In specific embodiments, a recombinant DNA molecule of the
invention may comprise a nucleic acid sequence encoding a dsRNA
molecule. Such recombinant DNA molecules may encode dsRNA molecules
capable of inhibiting the expression of endogenous target gene(s)
in a coleopteran and/or hemipteran pest cell upon ingestion. In
many embodiments, a transcribed RNA may form a dsRNA molecule that
may be provided in a stabilized form; e.g., as a hairpin and stem
and loop structure.
[0185] In these and further embodiments, one strand of a dsRNA
molecule may be formed by transcription from a nucleotide sequence
which is substantially homologous to a nucleotide sequence
consisting of SEQ ID NO:1; the complement of SEQ ID NO:1; a
fragment of at least 15 contiguous nucleotides of SEQ ID NO:1; the
complement of a fragment of at least 15 contiguous nucleotides of
SEQ ID NO:1; a native coding sequence of a Diabrotica organism
(e.g., WCR) comprising SEQ ID NO:1; the complement of a native
coding sequence of a Diabrotica organism comprising SEQ ID NO:1; a
native non-coding sequence of a Diabrotica organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:1; the
complement of a native non-coding sequence of a Diabrotica organism
that is transcribed into a native RNA molecule comprising SEQ ID
NO:1; a fragment of at least 15 contiguous nucleotides of a native
coding sequence of a Diabrotica organism (e.g., WCR) comprising SEQ
ID NO:1; the complement of a fragment of at least 15 contiguous
nucleotides of a native coding sequence of a Diabrotica organism
comprising SEQ ID NO:1; a fragment of at least 15 contiguous
nucleotides of a native non-coding sequence of a Diabrotica
organism that is transcribed into a native RNA molecule comprising
SEQ ID NO:1; and the complement of a fragment of at least 15
contiguous nucleotides of a native non-coding sequence of a
Diabrotica organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:1.
[0186] In other embodiments, one strand of a dsRNA molecule may be
formed by transcription from a nucleotide sequence which is
substantially homologous to a nucleotide sequence consisting of SEQ
ID NO:115; the complement of SEQ ID NO:115; a fragment of at least
19 contiguous nucleotides of SEQ ID NO:115; the complement of a
fragment of at least 19 contiguous nucleotides of SEQ ID NO:115; a
native coding sequence of a hemipteran organism comprising SEQ ID
NO:115; the complement of a native coding sequence of a hemipteran
organism comprising SEQ ID NO:115; a native non-coding sequence of
a hemipteran organism that is transcribed into a native RNA
molecule comprising SEQ ID NO:115; the complement of a native
non-coding sequence of a hemipteran organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:115; a fragment of
at least 19 contiguous nucleotides of a native coding sequence of a
hemipteran organism comprising SEQ ID NO:115; the complement of a
fragment of at least 19 contiguous nucleotides of a native coding
sequence of a hemipteran organism comprising SEQ ID NO:115; a
fragment of at least 19 contiguous nucleotides of a native
non-coding sequence of a hemipteran organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:115; and the
complement of a fragment of at least 19 contiguous nucleotides of a
native non-coding sequence of a hemipteran organism that is
transcribed into a native RNA molecule comprising SEQ ID
NO:115.
[0187] In these and further embodiments, one strand of a dsRNA
molecule may be formed by transcription from a nucleotide sequence
which is substantially homologous to a nucleotide sequence
consisting of SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; the complement of SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133; a fragment of at least 15 contiguous nucleotides
of SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ
ID NO:131, or SEQ ID NO:133; the complement of a fragment of at
least 15 contiguous nucleotides of SEQ ID NO:120, SEQ ID NO:122,
SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; a
native coding sequence of a Meligethes organism (e.g., PB)
comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; the complement of a native
coding sequence of a Meligethes organism comprising SEQ ID NO:120,
SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ
ID NO:133; a native non-coding sequence of a Meligethes organism
that is transcribed into a native RNA molecule comprising SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133; the complement of a native non-coding sequence of
a Meligethes organism that is transcribed into a native RNA
molecule comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; a fragment of at
least 15 contiguous nucleotides of a native coding sequence of a
Meligethes organism (e.g., PB) comprising SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133; the complement of a fragment of at least 15 contiguous
nucleotides of a native coding sequence of a Meligethes organism
comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; a fragment of at least 15
contiguous nucleotides of a native non-coding sequence of a
Meligethes organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; and the complement of a
fragment of at least 15 contiguous nucleotides of a native
non-coding sequence of a Meligethes organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:120, SEQ ID NO:122,
SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133.
[0188] In particular embodiments, a recombinant DNA molecule
encoding a dsRNA molecule may comprise at least two nucleotide
sequence segments within a transcribed sequence, such sequences
arranged such that the transcribed sequence comprises a first
nucleotide sequence segment in a sense orientation, and a second
nucleotide sequence segment (comprising the complement of the first
nucleotide sequence segment) is in an antisense orientation,
relative to at least one promoter, wherein the sense nucleotide
sequence segment and the antisense nucleotide sequence segment are
linked or connected by a spacer sequence segment of from about five
(.about.5) to about one thousand (.about.1000) nucleotides. The
spacer sequence segment may form a loop between the sense and
antisense sequence segments. The sense nucleotide sequence segment
or the antisense nucleotide sequence segment may be substantially
homologous to the nucleotide sequence of a target gene (e.g., a
gene comprising SEQ ID NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133) or fragment thereof. In some embodiments, however, a
recombinant DNA molecule may encode a dsRNA molecule without a
spacer sequence. In embodiments, a sense coding sequence and an
antisense coding sequence may be different lengths.
[0189] Sequences identified as having a deleterious effect on
coleopteran and/or hemipteran pests or a plant-protective effect
with regard to coleopteran and/or hemipteran pests may be readily
incorporated into expressed dsRNA molecules through the creation of
appropriate expression cassettes in a recombinant nucleic acid
molecule of the invention. For example, such sequences may be
expressed as a hairpin with stem and loop structure by taking a
first segment corresponding to a target gene sequence (e.g., SEQ ID
NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133 and fragments
thereof); linking this sequence to a second segment spacer region
that is not homologous or complementary to the first segment; and
linking this to a third segment, wherein at least a portion of the
third segment is substantially complementary to the first segment.
Such a construct forms a stem and loop structure by intramolecular
base-pairing of the first segment with the third segment, wherein
the loop structure forms and comprises the second segment. See,
e.g., U.S. Patent Publication Nos. 2002/0048814 and 2003/0018993;
and International PCT Publication Nos. WO94/01550 and WO98/05770. A
dsRNA molecule may be generated, for example, in the form of a
double-stranded structure such as a stem-loop structure (e.g.,
hairpin), whereby production of siRNA targeted for a native
coleopteran and/or hemipteran pest sequence is enhanced by
co-expression of a fragment of the targeted gene, for instance on
an additional plant expressible cassette, that leads to enhanced
siRNA production, or reduces methylation to prevent transcriptional
gene silencing of the dsRNA hairpin promoter.
[0190] Embodiments of the invention include introduction of a
recombinant nucleic acid molecule of the present invention into a
plant (i.e., transformation) to achieve coleopteran and/or
hemipteran pest-inhibitory levels of expression of one or more iRNA
molecules. A recombinant DNA molecule may, for example, be a
vector, such as a linear or a closed circular plasmid. The vector
system may be a single vector or plasmid, or two or more vectors or
plasmids that together contain the total DNA to be introduced into
the genome of a host. In addition, a vector may be an expression
vector. Nucleic acid sequences of the invention can, for example,
be suitably inserted into a vector under the control of a suitable
promoter that functions in one or more hosts to drive expression of
a linked coding sequence or other DNA sequence. Many vectors are
available for this purpose, and selection of the appropriate vector
will depend mainly on the size of the nucleic acid to be inserted
into the vector and the particular host cell to be transformed with
the vector. Each vector contains various components depending on
its function (e.g., amplification of DNA or expression of DNA) and
the particular host cell with which it is compatible.
[0191] To impart coleopteran and/or hemipteran pest resistance to a
transgenic plant, a recombinant DNA may, for example, be
transcribed into an iRNA molecule (e.g., an RNA molecule that forms
a dsRNA molecule) within the tissues or fluids of the recombinant
plant. An iRNA molecule may comprise a nucleotide sequence that is
substantially homologous and specifically hybridizable to a
corresponding transcribed nucleotide sequence within a coleopteran
and/or hemipteran pest that may cause damage to the host plant
species. The coleopteran and/or hemipteran pest may contact the
iRNA molecule that is transcribed in cells of the transgenic host
plant, for example, by ingesting cells or fluids of the transgenic
host plant that comprise the iRNA molecule. Thus, expression of a
target gene is suppressed by the iRNA molecule within coleopteran
and/or hemipteran pests that infest the transgenic host plant. In
some embodiments, suppression of expression of the target gene in
the target coleopteran and/or hemipteran pest may result in the
plant being resistant to attack by the pest.
[0192] In order to enable delivery of iRNA molecules to a
coleopteran and/or hemipteran pest in a nutritional relationship
with a plant cell that has been transformed with a recombinant
nucleic acid molecule of the invention, expression (i.e.,
transcription) of iRNA molecules in the plant cell is required.
Thus, a recombinant nucleic acid molecule may comprise a nucleotide
sequence of the invention operably linked to one or more regulatory
sequences, such as a heterologous promoter sequence that functions
in a host cell, such as a bacterial cell wherein the nucleic acid
molecule is to be amplified, and a plant cell wherein the nucleic
acid molecule is to be expressed.
[0193] Promoters suitable for use in nucleic acid molecules of the
invention include those that are inducible, viral, synthetic, or
constitutive, all of which are well known in the art. Non-limiting
examples describing such promoters include U.S. Pat. No. 6,437,217
(maize RS81 promoter); U.S. Pat. No. 5,641,876 (rice actin
promoter); U.S. Pat. No. 6,426,446 (maize RS324 promoter); U.S.
Pat. No. 6,429,362 (maize PR-1 promoter); U.S. Pat. No. 6,232,526
(maize A3 promoter); U.S. Pat. No. 6,177,611 (constitutive maize
promoters); U.S. Pat. Nos. 5,322,938, 5,352,605, 5,359,142, and
5,530,196 (CaMV 35S promoter); U.S. Pat. No. 6,433,252 (maize L3
oleosin promoter); U.S. Pat. No. 6,429,357 (rice actin 2 promoter,
and rice actin 2 intron); U.S. Pat. No. 6,294,714 (light-inducible
promoters); U.S. Pat. No. 6,140,078 (salt-inducible promoters);
U.S. Pat. No. 6,252,138 (pathogen-inducible promoters); U.S. Pat.
No. 6,175,060 (phosphorous deficiency-inducible promoters); U.S.
Pat. No. 6,388,170 (bidirectional promoters); U.S. Pat. No.
6,635,806 (gamma-coixin promoter); and U.S. Patent Publication No.
2009/757,089 (maize chloroplast aldolase promoter). Additional
promoters include the nopaline synthase (NOS) promoter (Ebert et
al. (1987) Proc. Natl. Acad. Sci. USA 84(16):5745-5749) and the
octopine synthase (OCS) promoters (which are carried on
tumor-inducing plasmids of Agrobacterium tumefaciens); the
caulimovirus promoters such as the cauliflower mosaic virus (CaMV)
19S promoter (Lawton et al. (1987) Plant Mol. Biol. 9:315-324); the
CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812; the
figwort mosaic virus 35S-promoter (Walker et al. (1987) Proc. Natl.
Acad. Sci. USA 84(19):6624-6628); the sucrose synthase promoter
(Yang and Russell (1990) Proc. Natl. Acad. Sci. USA 87:4144-4148);
the R gene complex promoter (Chandler et al. (1989) Plant Cell
1:1175-1183); the chlorophyll a/b binding protein gene promoter;
CaMV 35S (U.S. Pat. Nos. 5,322,938, 5,352,605, 5,359,142, and
5,530,196); FMV 35S (U.S. Pat. Nos. 5,378,619 and 6,051,753); a
PC1SV promoter (U.S. Pat. No. 5,850,019); the SCP1 promoter (U.S.
Pat. No. 6,677,503); and AGRtu.nos promoters (GENBANK.RTM.
Accession No. V00087; Depicker et al. (1982) J. Mol. Appl. Genet.
1:561-573; Bevan et al. (1983) Nature 304:184-187).
[0194] In particular embodiments, nucleic acid molecules of the
invention comprise a tissue-specific promoter, such as a
root-specific promoter. Root-specific promoters drive expression of
operably-linked coding sequences exclusively or preferentially in
root tissue. Examples of root-specific promoters are known in the
art. See, e.g., U.S. Pat. Nos. 5,110,732; 5,459,252 and 5,837,848;
and Opperman et al. (1994) Science 263:221-3; and Hirel et al.
(1992) Plant Mol. Biol. 20:207-18. In some embodiments, a
nucleotide sequence or fragment for coleopteran and/or hemipteran
pest control according to the invention may be cloned between two
root-specific promoters oriented in opposite transcriptional
directions relative to the nucleotide sequence or fragment, and
which are operable in a transgenic plant cell and expressed therein
to produce RNA molecules in the transgenic plant cell that
subsequently may form dsRNA molecules, as described, supra. The
iRNA molecules expressed in plant tissues may be ingested by a
coleopteran and/or hemipteran pest so that suppression of target
gene expression is achieved.
[0195] Additional regulatory sequences that may optionally be
operably linked to a nucleic acid molecule of interest include 5'U
IRs that function as a translation leader sequence located between
a promoter sequence and a coding sequence. The translation leader
sequence is present in the fully-processed mRNA, and it may affect
processing of the primary transcript, and/or RNA stability.
Examples of translation leader sequences include maize and petunia
heat shock protein leaders (U.S. Pat. No. 5,362,865), plant virus
coat protein leaders, plant rubisco leaders, and others. See, e.g.,
Turner and Foster (1995) Molecular Biotech. 3(3):225-36.
Non-limiting examples of 5'UTRs include GmHsp (U.S. Pat. No.
5,659,122); PhDnaK (U.S. Pat. No. 5,362,865); AtAntl; TEV
(Carrington and Freed (1990) J. Virol. 64:1590-7); and AGRtunos
(GENBANK.RTM. Accession No. V00087; and Bevan et al. (1983) Nature
304:184-7).
[0196] Other regulatory sequences that may optionally be operably
linked to a nucleic acid molecule of interest also include 3'
non-translated sequences, 3' transcription termination regions, or
poly-adenylation regions. These are genetic elements located
downstream of a nucleotide sequence, and include polynucleotides
that provide polyadenylation signal, and/or other regulatory
signals capable of affecting transcription or mRNA processing. The
polyadenylation signal functions in plants to cause the addition of
polyadenylate nucleotides to the 3' end of the mRNA precursor. The
polyadenylation sequence can be derived from a variety of plant
genes, or from T-DNA genes. A non-limiting example of a 3'
transcription termination region is the nopaline synthase 3' region
(nos 3; Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-7).
An example of the use of different 3' nontranslated regions is
provided in Ingelbrecht et al., (1989) Plant Cell 1:671-80.
Non-limiting examples of polyadenylation signals include one from a
Pisum sativum RbcS2 gene (Ps.RbcS2-E9; Coruzzi et al. (1984) EMBO
J. 3:1671-9) and AGRtu.nos (GENBANK.RTM. Accession No. E01312).
[0197] Some embodiments may include a plant transformation vector
that comprises an isolated and purified DNA molecule comprising at
least one of the above-described regulatory sequences operatively
linked to one or more nucleotide sequences of the present
invention. When expressed, the one or more nucleotide sequences
result in one or more RNA molecule(s) comprising a nucleotide
sequence that is specifically complementary to all or part of a
native RNA molecule in a coleopteran and/or hemipteran pest. Thus,
the nucleotide sequence(s) may comprise a segment encoding all or
part of a ribonucleotide sequence present within a targeted
coleopteran and/or hemipteran pest RNA transcript, and may comprise
inverted repeats of all or a part of a targeted coleopteran and/or
hemipteran pest transcript. A plant transformation vector may
contain sequences specifically complementary to more than one
target sequence, thus allowing production of more than one dsRNA
for inhibiting expression of two or more genes in cells of one or
more populations or species of target coleopteran and/or hemipteran
pests. Segments of nucleotide sequence specifically complementary
to nucleotide sequences present in different genes can be combined
into a single composite nucleic acid molecule for expression in a
transgenic plant. Such segments may be contiguous or separated by a
spacer sequence.
[0198] In some embodiments, a plasmid of the present invention
already containing at least one nucleotide sequence(s) of the
invention can be modified by the sequential insertion of additional
nucleotide sequence(s) in the same plasmid, wherein the additional
nucleotide sequence(s) are operably linked to the same regulatory
elements as the original at least one nucleotide sequence(s). In
some embodiments, a nucleic acid molecule may be designed for the
inhibition of multiple target genes. In some embodiments, the
multiple genes to be inhibited can be obtained from the same
coleopteran and/or hemipteran pest species, which may enhance the
effectiveness of the nucleic acid molecule. In other embodiments,
the genes can be derived from different coleopteran and/or
hemipteran pests, which may broaden the range of coleopteran and/or
hemipteran pests against which the agent(s) is/are effective. When
multiple genes are targeted for suppression or a combination of
expression and suppression, a polycistronic DNA element can be
fabricated.
[0199] A recombinant nucleic acid molecule or vector of the present
invention may comprise a selectable marker that confers a
selectable phenotype on a transformed cell, such as a plant cell.
Selectable markers may also be used to select for plants or plant
cells that comprise a recombinant nucleic acid molecule of the
invention. The marker may encode biocide resistance, antibiotic
resistance (e.g., kanamycin, Geneticin (G418), bleomycin,
hygromycin, etc.), or herbicide resistance (e.g., glyphosate,
etc.). Examples of selectable markers include, but are not limited
to: a neo gene which codes for kanamycin resistance and can be
selected for using kanamycin, G418, etc.; a bar gene which codes
for bialaphos resistance; a mutant EPSP synthase gene which encodes
glyphosate resistance; a nitrilase gene which confers resistance to
bromoxynil; a mutant acetolactate synthase (ALS) gene which confers
imidazolinone or sulfonylurea resistance; and a methotrexate
resistant DHFR gene. Multiple selectable markers are available that
confer resistance to ampicillin, bleomycin, chloramphenicol,
gentamycin, hygromycin, kanamycin, lincomycin, methotrexate,
phosphinothricin, puromycin, spectinomycin, rifampicin,
streptomycin and tetracycline, and the like. Examples of such
selectable markers are illustrated in, e.g., U.S. Pat. Nos.
5,550,318; 5,633,435; 5,780,708 and 6,118,047.
[0200] A recombinant nucleic acid molecule or vector of the present
invention may also include a screenable marker. Screenable markers
may be used to monitor expression. Exemplary screenable markers
include a .beta.-glucuronidase or uidA gene (GUS) which encodes an
enzyme for which various chromogenic substrates are known
(Jefferson et al. (1987) Plant Mol. Biol. Rep. 5:387-405); an
R-locus gene, which encodes a product that regulates the production
of anthocyanin pigments (red color) in plant tissues (Dellaporta et
al. (1988) "Molecular cloning of the maize R-nj allele by
transposon tagging with Ac." In 18.sup.th Stadler Genetics
Symposium, P. Gustafson and R. Appels, eds. (New York: Plenum), pp.
263-82); a .beta.-lactamase gene (Sutcliffe et al. (1978) Proc.
Natl. Acad. Sci. USA 75:3737-41); a gene which encodes an enzyme
for which various chromogenic substrates are known (e.g., PADAC, a
chromogenic cephalosporin); a luciferase gene (Ow et al. (1986)
Science 234:856-9); an xylE gene that encodes a catechol
dioxygenase that can convert chromogenic catechols (Zukowski et al.
(1983) Gene 46(2-3):247-55); an amylase gene (Ikatu et al. (1990)
Bio/Technol. 8:241-2); a tyrosinase gene which encodes an enzyme
capable of oxidizing tyrosine to DOPA and dopaquinone which in turn
condenses to melanin (Katz et al. (1983) J. Gen. Microbiol.
129:2703-14); and an .alpha.-galactosidase.
[0201] In some embodiments, recombinant nucleic acid molecules, as
described, supra, may be used in methods for the creation of
transgenic plants and expression of heterologous nucleic acids in
plants to prepare transgenic plants that exhibit reduced
susceptibility to coleopteran and/or hemipteran pests. Plant
transformation vectors can be prepared, for example, by inserting
nucleic acid molecules encoding iRNA molecules into plant
transformation vectors and introducing these into plants.
[0202] Suitable methods for transformation of host cells include
any method by which DNA can be introduced into a cell, such as by
transformation of protoplasts (See, e.g., U.S. Pat. No. 5,508,184),
by desiccation/inhibition-mediated DNA uptake (See, e.g., Potrykus
et al. (1985) Mol. Gen. Genet. 199:183-8), by electroporation (See,
e.g., U.S. Pat. No. 5,384,253), by agitation with silicon carbide
fibers (See, e.g., U.S. Pat. Nos. 5,302,523 and 5,464,765), by
Agrobacterium-mediated transformation (See, e.g., U.S. Pat. Nos.
5,563,055; 5,591,616; 5,693,512; 5,824,877; 5,981,840; and
6,384,301) and by acceleration of DNA-coated particles (See, e.g.,
U.S. Pat. Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208,
6,399,861, and 6,403,865), etc. Techniques that are particularly
useful for transforming corn are described, for example, in U.S.
Pat. Nos. 5,591,616, 7,060,876 and 7,939,3281. Through the
application of techniques such as these, the cells of virtually any
species may be stably transformed. In some embodiments,
transforming DNA is integrated into the genome of the host cell. In
the case of multicellular species, transgenic cells may be
regenerated into a transgenic organism. Any of these techniques may
be used to produce a transgenic plant, for example, comprising one
or more nucleic acid sequences encoding one or more iRNA molecules
in the genome of the transgenic plant.
[0203] The most widely utilized method for introducing an
expression vector into plants is based on the natural
transformation system of various Agrobacterium species. A.
tumefaciens and A. rhizogenes are plant pathogenic soil bacteria
which genetically transform plant cells. The Ti and Ri plasmids of
A. tumefaciens and A. rhizogenes, respectively, carry genes
responsible for genetic transformation of the plant. The Ti
(tumor-inducing)-plasmids contain a large segment, known as T-DNA,
which is transferred to transformed plants. Another segment of the
Ti plasmid, the Vir region, is responsible for T-DNA transfer. The
T-DNA region is bordered by terminal repeats. In modified binary
vectors, the tumor-inducing genes have been deleted, and the
functions of the Vir region are utilized to transfer foreign DNA
bordered by the T-DNA border sequences. The T-region may also
contain a selectable marker for efficient recovery of transgenic
cells and plants, and a multiple cloning site for inserting
sequences for transfer such as a dsRNA encoding nucleic acid.
[0204] Thus, in some embodiments, a plant transformation vector is
derived from a Ti plasmid of A. tumefaciens (See, e.g., U.S. Pat.
Nos. 4,536,475, 4,693,977, 4,886,937, and 5,501,967; and European
Patent No. EP 0 122 791) or a Ri plasmid of A. rhizogenes.
Additional plant transformation vectors include, for example and
without limitation, those described by Herrera-Estrella et al.
(1983) Nature 303:209-13; Bevan et al. (1983) Nature 304:184-7;
Klee et al. (1985) Bio/Technol. 3:637-42; and in European Patent
No. EP 0 120 516, and those derived from any of the foregoing.
Other bacteria such as Sinorhizobium, Rhizobium, and Mesorhizobium
that interact with plants naturally can be modified to mediate gene
transfer to a number of diverse plants. These plant-associated
symbiotic bacteria can be made competent for gene transfer by
acquisition of both a disarmed Ti plasmid and a suitable binary
vector.
[0205] After providing exogenous DNA to recipient cells,
transformed cells are generally identified for further culturing
and plant regeneration. In order to improve the ability to identify
transformed cells, one may desire to employ a selectable or
screenable marker gene, as previously set forth, with the
transformation vector used to generate the transformant. In the
case where a selectable marker is used, transformed cells are
identified within the potentially transformed cell population by
exposing the cells to a selective agent or agents. In the case
where a screenable marker is used, cells may be screened for the
desired marker gene trait.
[0206] Cells that survive the exposure to the selective agent, or
cells that have been scored positive in a screening assay, may be
cultured in media that supports regeneration of plants. In some
embodiments, any suitable plant tissue culture media (e.g., MS and
N6 media) may be modified by including further substances, such as
growth regulators. Tissue may be maintained on a basic medium with
growth regulators until sufficient tissue is available to begin
plant regeneration efforts, or following repeated rounds of manual
selection, until the morphology of the tissue is suitable for
regeneration (e.g., typically about 2 weeks), then transferred to
media conducive to shoot formation. Cultures are transferred
periodically until sufficient shoot formation has occurred. Once
shoots are formed, they are transferred to media conducive to root
formation. Once sufficient roots are formed, plants can be
transferred to soil for further growth and maturation.
[0207] To confirm the presence of a nucleic acid molecule of
interest (for example, a DNA sequence encoding one or more iRNA
molecules that inhibit target gene expression in a coleopteran
and/or hemipteran pest) in the regenerating plants, a variety of
assays may be performed. Such assays include, for example:
molecular biological assays, such as Southern and northern
blotting, PCR, and nucleic acid sequencing; biochemical assays,
such as detecting the presence of a protein product, e.g., by
immunological means (ELISA and/or immuno blots) or by enzymatic
function; plant part assays, such as leaf or root assays; and
analysis of the phenotype of the whole regenerated plant.
[0208] Integration events may be analyzed, for example, by PCR
amplification using, e.g., oligonucleotide primers specific for a
nucleic acid molecule of interest. PCR genotyping is understood to
include, but not be limited to, polymerase-chain reaction (PCR)
amplification of genomic DNA derived from isolated host plant
callus tissue predicted to contain a nucleic acid molecule of
interest integrated into the genome, followed by standard cloning
and sequence analysis of PCR amplification products. Methods of PCR
genotyping have been well described (for example, Rios, G. et al.
(2002) Plant J. 32:243-53) and may be applied to genomic DNA
derived from any plant species (e.g., Z. mays or G. max) or tissue
type, including cell cultures.
[0209] A transgenic plant formed using Agrobacterium-dependent
transformation methods typically contains a single recombinant DNA
sequence inserted into one chromosome. The single recombinant DNA
sequence is referred to as a "transgenic event" or "integration
event." Such transgenic plants are hemizygous for the inserted
exogenous sequence. In some embodiments, a transgenic plant
homozygous with respect to a transgene may be obtained by sexually
mating (selfing) an independent segregant transgenic plant that
contains a single exogenous gene sequence to itself, for example a
T.sub.0 plant, to produce T.sub.1 seed. One fourth of the T.sub.1
seed produced will be homozygous with respect to the transgene.
Germinating T.sub.1 seed results in plants that can be tested for
heterozygosity, typically using an SNP assay or a thermal
amplification assay that allows for the distinction between
heterozygotes and homozygotes (i.e., a zygosity assay).
[0210] In particular embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9
or 10 or more different iRNA molecules that have a coleopteran
and/or hemipteran pest-inhibitory effect are produced in a plant
cell. The iRNA molecules (e.g., dsRNA molecules) may be expressed
from multiple nucleic acid sequences introduced in different
transformation events, or from a single nucleic acid sequence
introduced in a single transformation event. In some embodiments, a
plurality of iRNA molecules are expressed under the control of a
single promoter. In other embodiments, a plurality of iRNA
molecules are expressed under the control of multiple promoters.
Single iRNA molecules may be expressed that comprise multiple
nucleic acid sequences that are each homologous to different loci
within one or more coleopteran and/or hemipteran pests (for
example, the locus defined by SEQ ID NO:1, SEQ ID NO:115, SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133), both in different populations of the same
species of coleopteran and/or hemipteran pest, or in different
species of coleopteran and/or hemipteran pests.
[0211] In addition to direct transformation of a plant with a
recombinant nucleic acid molecule, transgenic plants can be
prepared by crossing a first plant having at least one transgenic
event with a second plant lacking such an event. For example, a
recombinant nucleic acid molecule comprising a nucleotide sequence
that encodes an iRNA molecule may be introduced into a first plant
line that is amenable to transformation to produce a transgenic
plant, which transgenic plant may be crossed with a second plant
line to introgress the nucleotide sequence that encodes the iRNA
molecule into the second plant line.
[0212] The invention also includes commodity products containing
one or more of the sequences of the present invention. Particular
embodiments include commodity products produced from a recombinant
plant or seed containing one or more of the nucleotide sequences of
the present invention. A commodity product containing one or more
of the sequences of the present invention is intended to include,
but not be limited to, meals, oils, crushed or whole grains or
seeds of a plant, or any food or animal feed product comprising any
meal, oil, or crushed or whole grain of a recombinant plant or seed
containing one or more of the sequences of the present invention.
The detection of one or more of the sequences of the present
invention in one or more commodity or commodity products
contemplated herein is de facto evidence that the commodity or
commodity product is produced from a transgenic plant designed to
express one or more of the nucleotides sequences of the present
invention for the purpose of controlling coleopteran and/or
hemipteran plant pests using dsRNA-mediated gene suppression
methods.
[0213] In some aspects, seeds and commodity products produced by
transgenic plants derived from transformed plant cells are
included, wherein the seeds or commodity products comprise a
detectable amount of a nucleic acid sequence of the invention. In
some embodiments, such commodity products may be produced, for
example, by obtaining transgenic plants and preparing food or feed
from them. Commodity products comprising one or more of the nucleic
acid sequences of the invention includes, for example and without
limitation: meals, oils, crushed or whole grains or seeds of a
plant, and any food product comprising any meal, oil, or crushed or
whole grain of a recombinant plant or seed comprising one or more
of the nucleic acid sequences of the invention. The detection of
one or more of the sequences of the invention in one or more
commodity or commodity products is de facto evidence that the
commodity or commodity product is produced from a transgenic plant
designed to express one or more of the iRNA molecules of the
invention for the purpose of controlling coleopteran and/or
hemipteran pests.
[0214] In some embodiments, a transgenic plant or seed comprising a
nucleic acid molecule of the invention also may comprise at least
one other transgenic event in its genome, including without
limitation: a transgenic event from which is transcribed an iRNA
molecule targeting a locus in a coleopteran and/or hemipteran pest
other than the one defined by SEQ ID NO:1, SEQ ID NO:115, SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133, such as, for example, one or more loci selected
from the group consisting of Cafl-180 (U.S. Patent Application
Publication No. 2012/0174258), VatpaseC (U.S. Patent Application
Publication No. 2012/0174259), Rho1 (U.S. Patent Application
Publication No. 2012/0174260), VatpaseH (U.S. Patent Application
Publication No. 2012/0198586), PPI-87B (U.S. Patent Application
Publication No. 2013/0091600), RPA70 (U.S. Patent Application
Publication No. 2013/0091601), and RPS6 (U.S. Patent Application
Publication No. 2013/0097730); a transgenic event from which is
transcribed an iRNA molecule targeting a gene in an organism other
than a coleopteran and/or hemipteran pest (e.g., a plant-parasitic
nematode); a gene encoding an insecticidal protein (e.g., a
Bacillus thuringiensis insecticidal protein, such as, for example,
Cry34Ab1 (U.S. Pat. Nos. 6,127,180, 6,340,593, and 6,624,145),
Cry35Ab1 (U.S. Pat. Nos. 6,083,499, 6,340,593, and 6,548,291), a
"Cry34/35Ab1" combination in a single event (e.g., maize event
DAS-59122-7; U.S. Pat. No. 7,323,556), Cry3A (e.g., U.S. Pat. No.
7,230,167), Cry3B (e.g., U.S. Pat. No. 8,101,826), Cry6A (e.g.,
U.S. Pat. No. 6,831,062), and combinations thereof (e.g., U.S.
Patent Application Nos. 2013/0167268, 2013/0167269, and
2013/0180016); an herbicide tolerance gene (e.g., a gene providing
tolerance to glyphosate, glufosinate, dicamba or 2,4-D (e.g., U.S.
Pat. No. 7,838,733)); and a gene contributing to a desirable
phenotype in the transgenic plant, such as increased yield, altered
fatty acid metabolism, or restoration of cytoplasmic male
sterility). In particular embodiments, sequences encoding iRNA
molecules of the invention may be combined with other insect
control or with disease resistance traits in a plant to achieve
desired traits for enhanced control of insect damage and plant
disease. Combining insect control traits that employ distinct
modes-of-action may provide protected transgenic plants with
superior durability over plants harboring a single control trait,
for example, because of the reduced probability that resistance to
the trait(s) will develop in the field.
V. Target Gene Suppression in a Coleopteran and/or Hemipteran
Pest
[0215] A. Overview
[0216] In some embodiments of the invention, at least one nucleic
acid molecule useful for the control of coleopteran and/or
hemipteran pests may be provided to a coleopteran and/or hemipteran
pest, wherein the nucleic acid molecule leads to RNAi-mediated gene
silencing in the coleopteran and/or hemipteran pest. In particular
embodiments, an iRNA molecule (e.g., dsRNA, siRNA, shRNA, miRNA,
and hpRNA) may be provided to the coleopteran and/or hemipteran
pest. In some embodiments, a nucleic acid molecule useful for the
control of coleopteran and/or hemipteran pests may be provided to a
coleopteran and/or hemipteran pest by contacting the nucleic acid
molecule with the coleopteran and/or hemipteran pest. In these and
further embodiments, a nucleic acid molecule useful for the control
of coleopteran and/or hemipteran pests may be provided in a feeding
substrate of the coleopteran and/or hemipteran pest, for example, a
nutritional composition. In these and further embodiments, a
nucleic acid molecule useful for the control of coleopteran and/or
hemipteran pests may be provided through ingestion of plant
material comprising the nucleic acid molecule that is ingested by
the coleopteran and/or hemipteran pest. In certain embodiments, the
nucleic acid molecule is present in plant material through
expression of a recombinant nucleic acid sequence introduced into
the plant material, for example, by transformation of a plant cell
with a vector comprising the recombinant nucleic acid sequence and
regeneration of a plant material or whole plant from the
transformed plant cell.
[0217] B. RNAi-Mediated Target Gene Suppression
[0218] In embodiments, the invention provides iRNA molecules (e.g.,
dsRNA, siRNA, shRNA, miRNA, and hpRNA) that may be designed to
target essential native nucleotide sequences (e.g., essential
genes) in the transcriptome of a coleopteran and/or hemipteran pest
(e.g., WCR, NCR, Meligethes aeneus, Euschistus heros, Nezara
viridula, Piezodorus guildinii, Halyomorpha halys, Acrosternum
hilare, and Euschistus serous), for example by designing an iRNA
molecule that comprises at least one strand comprising a nucleotide
sequence that is specifically complementary to the target sequence.
The sequence of an iRNA molecule so designed may be identical to
the target sequence, or may incorporate mismatches that do not
prevent specific hybridization between the iRNA molecule and its
target sequence.
[0219] iRNA molecules of the invention may be used in methods for
gene suppression in a coleopteran and/or hemipteran pest, thereby
reducing the level or incidence of damage caused by the pest on a
plant (for example, a protected transformed plant comprising an
iRNA molecule). As used herein, the term "gene suppression" refers
to any of the well-known methods for reducing the levels of protein
produced as a result of gene transcription to mRNA and subsequent
translation of the mRNA, including the reduction of protein
expression from a gene or a coding sequence including
post-transcriptional inhibition of expression and transcriptional
suppression. Post-transcriptional inhibition is mediated by
specific homology between all or a part of an mRNA transcribed from
a gene targeted for suppression and the corresponding iRNA molecule
used for suppression. Additionally, post-transcriptional inhibition
refers to the substantial and measurable reduction of the amount of
mRNA available in the cell for binding by ribosomes.
[0220] In some embodiments where an iRNA molecule is a dsRNA
molecule, the dsRNA molecule may be cleaved by the enzyme, DICER,
into short siRNA molecules (approximately 20 nucleotides in
length). The double-stranded siRNA molecule generated by DICER
activity upon the dsRNA molecule may be separated into two
single-stranded siRNAs; the "passenger strand" and the "guide
strand." The passenger strand may be degraded, and the guide strand
may be incorporated into RISC. Post-transcriptional inhibition
occurs by specific hybridization of the guide strand with a
specifically complementary sequence of an mRNA molecule, and
subsequent cleavage by the enzyme, Argonaute (catalytic component
of the RISC complex).
[0221] In other embodiments of the invention, any form of iRNA
molecule may be used. Those of skill in the art will understand
that dsRNA molecules typically are more stable than are
single-stranded RNA molecules, during preparation and during the
step of providing the iRNA molecule to a cell, and are typically
also more stable in a cell. Thus, while siRNA and miRNA molecules,
for example, may be equally effective in some embodiments, a dsRNA
molecule may be chosen due to its stability.
[0222] In particular embodiments, a nucleic acid molecule is
provided that comprises a nucleotide sequence, which nucleotide
sequence may be expressed in vitro to produce an iRNA molecule that
is substantially homologous to a nucleic acid molecule encoded by a
nucleotide sequence within the genome of a coleopteran and/or
hemipteran pest. In certain embodiments, the in vitro transcribed
iRNA molecule may be a stabilized dsRNA molecule that comprises a
stem-loop structure. After a coleopteran and/or hemipteran pest
contacts the in vitro transcribed iRNA molecule,
post-transcriptional inhibition of a target gene in the coleopteran
and/or hemipteran pest (for example, an essential gene) may
occur.
[0223] In some embodiments of the invention, expression of a
nucleic acid molecule comprising at least 15 contiguous nucleotides
of a nucleotide sequence is used in a method for
post-transcriptional inhibition of a target gene in a coleopteran
and/or hemipteran pest, wherein the nucleotide sequence is selected
from the group consisting of: SEQ ID NO:1; the complement of SEQ ID
NO:1; a fragment of at least 15 contiguous nucleotides of SEQ ID
NO:1; the complement of a fragment of at least 15 contiguous
nucleotides of SEQ ID NO:1; a native coding sequence of a
Diabrotica organism (e.g., WCR) comprising SEQ ID NO:1; the
complement of a native coding sequence of a Diabrotica organism
comprising SEQ ID NO:1; a native non-coding sequence of a
Diabrotica organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:1; the complement of a native non-coding
sequence of a Diabrotica organism that is transcribed into a native
RNA molecule comprising SEQ ID NO:1; the complement of a native
non-coding sequence of a Diabrotica organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:1; a fragment of at
least 15 contiguous nucleotides of a native coding sequence of a
Diabrotica organism (e.g., WCR) comprising SEQ ID NO:1; the
complement of a fragment of at least 15 contiguous nucleotides of a
native coding sequence of a Diabrotica organism comprising SEQ ID
NO:1; a fragment of at least 15 contiguous nucleotides of a native
non-coding sequence of a Diabrotica organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:1; and the
complement of a fragment of at least 15 contiguous nucleotides of a
native non-coding sequence of a Diabrotica organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:1. In
certain embodiments, expression of a nucleic acid molecule that is
at least 80% identical (e.g., 80%, about 81%, about 82%, about 83%,
about 84%, about 85%, about 86%, about 87%, about 88%, about 89%,
about 90%, about 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98%, about 99%, about 100%, and 100%)
with any of the foregoing may be used. In these and further
embodiments, a nucleic acid molecule may be expressed that
specifically hybridizes to an RNA molecule present in at least one
cell of a coleopteran and/or hemipteran pest.
[0224] In certain embodiments of the invention, expression of a
nucleic acid molecule comprising at least 15 contiguous nucleotides
of a nucleotide sequence is used in a method for
post-transcriptional inhibition of a target gene in a coleopteran
pest, wherein the nucleotide sequence is selected from the group
consisting of: SEQ ID NO:115; the complement of SEQ ID NO:115; a
fragment of at least 15 contiguous nucleotides of SEQ ID NO:115;
the complement of a fragment of at least 15 contiguous nucleotides
of SEQ ID NO:115; a native coding sequence of a hemipteran organism
SEQ ID NO:115; the complement of a native coding sequence of a
hemipteran organism comprising SEQ ID NO:115; a native non-coding
sequence of a hemipteran organism that is transcribed into a native
RNA molecule comprising SEQ ID NO:115; the complement of a native
non-coding sequence of a hemipteran organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:115; the complement
of a native non-coding sequence of a hemipteran organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:115; a
fragment of at least 15 contiguous nucleotides of a native coding
sequence of a hemipteran organism comprising SEQ ID NO:115; the
complement of a fragment of at least 15 contiguous nucleotides of a
native coding sequence of a hemipteran organism comprising SEQ ID
NO:115; a fragment of at least 15 contiguous nucleotides of a
native non-coding sequence of a hemipteran organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:115;
and the complement of a fragment of at least 15 contiguous
nucleotides of a native non-coding sequence of a hemipteran
organism that is transcribed into a native RNA molecule comprising
SEQ ID NO:115. In certain embodiments, expression of a nucleic acid
molecule that is at least 80% identical (e.g., 80%, about 81%,
about 82%, about 83%, about 84%, about 85%, about 86%, about 87%,
about 88%, about 89%, about 90%, about 91%, about 92%, about 93%,
about 94%, about 95%, about 96%, about 97%, about 98%, about 99%,
about 100%, and 100%) with any of the foregoing may be used. In
these and further embodiments, a nucleic acid molecule may be
expressed that specifically hybridizes to an RNA molecule present
in at least one cell of a coleopteran pest.
[0225] In some embodiments of the invention, expression of a
nucleic acid molecule comprising at least 15 contiguous nucleotides
of a nucleotide sequence is used in a method for
post-transcriptional inhibition of a target gene in a coleopteran
and/or hemipteran pest, wherein the nucleotide sequence is selected
from the group consisting of: SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; a fragment of at least 15
contiguous nucleotides of SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of a fragment of at least 15 contiguous nucleotides of
SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID
NO:131, or SEQ ID NO:133; a native coding sequence of a Meligethes
organism (e.g., EPB) comprising SEQ ID NO:120, SEQ ID NO:122, SEQ
ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of a native coding sequence of a Meligethes organism
comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; a native non-coding
sequence of a Meligethes organism that is transcribed into a native
RNA molecule comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of a native non-coding sequence of a Meligethes organism
that is transcribed into a native RNA molecule comprising SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133; the complement of a native non-coding sequence of
a Meligethes organism that is transcribed into a native RNA
molecule comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; a fragment of at
least 15 contiguous nucleotides of a native coding sequence of a
Meligethes organism (e.g., EPB) comprising SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133; the complement of a fragment of at least 15 contiguous
nucleotides of a native coding sequence of a Meligethes organism
comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; a fragment of at least 15
contiguous nucleotides of a native non-coding sequence of a
Meligethes organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; and the complement of a
fragment of at least 15 contiguous nucleotides of a native
non-coding sequence of a Meligethes organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:120, SEQ ID NO:122,
SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133. In
certain embodiments, expression of a nucleic acid molecule that is
at least 80% identical (e.g., 80%, about 81%, about 82%, about 83%,
about 84%, about 85%, about 86%, about 87%, about 88%, about 89%,
about 90%, about 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98%, about 99%, about 100%, and 100%)
with any of the foregoing may be used. In these and further
embodiments, a nucleic acid molecule may be expressed that
specifically hybridizes to an RNA molecule present in at least one
cell of a coleopteran and/or hemipteran pest.
[0226] In other embodiments, expression of at least one nucleic
acid molecule comprising at least 19 contiguous nucleotides of a
nucleotide sequence may be used in a method for
post-transcriptional inhibition of a target gene in a coleopteran
and/or hemipteran pest, wherein the nucleotide sequence is selected
from the group consisting of: SEQ ID NO:1; the complement of SEQ ID
NO:1; a fragment of at least 19 contiguous nucleotides of SEQ ID
NO:1; the complement of a fragment of at least 19 contiguous
nucleotides of SEQ ID NO:1; a native coding sequence of a
Diabrotica organism (e.g., WCR) comprising SEQ ID NO:1; the
complement of a native coding sequence of a Diabrotica organism
(e.g., WCR) comprising SEQ ID NO:1; a native non-coding sequence of
a Diabrotica organism that is transcribed into a native RNA
molecule comprising SEQ ID NO:1; the complement of a native
non-coding sequence of a Diabrotica organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:1; a fragment of at
least 19 contiguous nucleotides of a native coding sequence of a
Diabrotica organism (e.g., WCR) comprising SEQ ID NO:1; the
complement of a fragment of at least 19 contiguous nucleotides of a
native coding sequence of a Diabrotica organism comprising SEQ ID
NO:1; a fragment of at least 19 contiguous nucleotides of a native
non-coding sequence of a Diabrotica organism that is transcribed
into a native RNA molecule comprising SEQ ID NO:1; and the
complement of a fragment of at least 19 contiguous nucleotides of a
native non-coding sequence of a Diabrotica organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:1. In
certain embodiments, expression of a nucleic acid molecule that is
at least 80% identical (e.g., 80%, about 81%, about 82%, about 83%,
about 84%, about 85%, about 86%, about 87%, about 88%, about 89%,
about 90%, about 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98%, about 99%, about 100%, and 100%)
with any of the foregoing may be used. In these and further
embodiments, a nucleic acid molecule may be expressed that
specifically hybridizes to an RNA molecule present in at least one
cell of a coleopteran and/or hemipteran pest. In particular
examples, such a nucleic acid molecule may comprise a nucleotide
sequence comprising SEQ ID NO:1.
[0227] In particular embodiments, expression of at least one
nucleic acid molecule comprising at least 19 contiguous nucleotides
of a nucleotide sequence may be used in a method for
post-transcriptional inhibition of a target gene in a coleopteran
pest, wherein the nucleotide sequence is selected from the group
consisting of: SEQ ID NO:115; the complement of SEQ ID NO:115; a
fragment of at least 19 contiguous nucleotides of SEQ ID NO:115;
the complement of a fragment of at least 19 contiguous nucleotides
of SEQ ID NO:115; a native coding sequence of a hemipteran organism
comprising SEQ ID NO:115; the complement of a native coding
sequence of a hemipteran organism comprising SEQ ID NO:115; a
native non-coding sequence of a hemipteran organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:115;
the complement of a native non-coding sequence of a hemipteran
organism that is transcribed into a native RNA molecule comprising
SEQ ID NO:115; a fragment of at least 19 contiguous nucleotides of
a native coding sequence of a hemipteran organism comprising SEQ ID
NO:115; the complement of a fragment of at least 19 contiguous
nucleotides of a native coding sequence of a hemipteran organism
comprising SEQ ID NO:115; a fragment of at least 19 contiguous
nucleotides of a native non-coding sequence of a hemipteran
organism that is transcribed into a native RNA molecule comprising
SEQ ID NO:115; and the complement of a fragment of at least 19
contiguous nucleotides of a native non-coding sequence of a
hemipteran organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:115. In certain embodiments, expression of a
nucleic acid molecule that is at least 80% identical (e.g., 80%,
about 81%, about 82%, about 83%, about 84%, about 85%, about 86%,
about 87%, about 88%, about 89%, about 90%, about 91%, about 92%,
about 93%, about 94%, about 95%, about 96%, about 97%, about 98%,
about 99%, about 100%, and 100%) with any of the foregoing may be
used. In these and further embodiments, a nucleic acid molecule may
be expressed that specifically hybridizes to an RNA molecule
present in at least one cell of a coleopteran pest. In particular
examples, such a nucleic acid molecule may comprise a nucleotide
sequence comprising SEQ ID NO:115.
[0228] In other embodiments, expression of at least one nucleic
acid molecule comprising at least 19 contiguous nucleotides of a
nucleotide sequence may be used in a method for
post-transcriptional inhibition of a target gene in a coleopteran
and/or hemipteran pest, wherein the nucleotide sequence is selected
from the group consisting of: SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; a fragment of at least 19
contiguous nucleotides of SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of a fragment of at least 19 contiguous nucleotides of
SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID
NO:131, or SEQ ID NO:133; a native coding sequence of a Meligethes
organism (e.g., EPB) comprising SEQ ID NO:120, SEQ ID NO:122, SEQ
ID NO:124, or SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of a native coding sequence of a Meligethes organism
(e.g., EPB) comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; a native non-coding
sequence of a Meligethes organism that is transcribed into a native
RNA molecule comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID
NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133; the
complement of a native non-coding sequence of a Meligethes organism
that is transcribed into a native RNA molecule comprising SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133; a fragment of at least 19 contiguous nucleotides
of a native coding sequence of a Meligethes organism (e.g., EPB)
comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133; the complement of a
fragment of at least 19 contiguous nucleotides of a native coding
sequence of a Meligethes organism comprising SEQ ID NO:120, SEQ ID
NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ ID
NO:133; a fragment of at least 19 contiguous nucleotides of a
native non-coding sequence of a Meligethes organism that is
transcribed into a native RNA molecule comprising SEQ ID NO:120,
SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131, or SEQ
ID NO:133; and the complement of a fragment of at least 19
contiguous nucleotides of a native non-coding sequence of a
Meligethes organism that is transcribed into a native RNA molecule
comprising SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID
NO:126, SEQ ID NO:131, or SEQ ID NO:133. In certain embodiments,
expression of a nucleic acid molecule that is at least 80%
identical (e.g., 80%, about 81%, about 82%, about 83%, about 84%,
about 85%, about 86%, about 87%, about 88%, about 89%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98%, about 99%, about 100%, and 100%) with any of
the foregoing may be used. In these and further embodiments, a
nucleic acid molecule may be expressed that specifically hybridizes
to an RNA molecule present in at least one cell of a coleopteran
and/or hemipteran pest. In particular examples, such a nucleic acid
molecule may comprise a nucleotide sequence comprising SEQ ID
NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:131,
or SEQ ID NO:133.
[0229] It is an important feature of some embodiments of the
invention that the RNAi post-transcriptional inhibition system is
able to tolerate sequence variations among target genes that might
be expected due to genetic mutation, strain polymorphism, or
evolutionary divergence. The introduced nucleic acid molecule may
not need to be absolutely homologous to either a primary
transcription product or a fully-processed mRNA of a target gene,
so long as the introduced nucleic acid molecule is specifically
hybridizable to either a primary transcription product or a
fully-processed mRNA of the target gene. Moreover, the introduced
nucleic acid molecule may not need to be full-length, relative to
either a primary transcription product or a fully processed mRNA of
the target gene.
[0230] Inhibition of a target gene using the iRNA technology of the
present invention is sequence-specific; i.e., nucleotide sequences
substantially homologous to the iRNA molecule(s) are targeted for
genetic inhibition. In some embodiments, an RNA molecule comprising
a nucleotide sequence identical to a portion of a target gene
sequence may be used for inhibition. In these and further
embodiments, an RNA molecule comprising a nucleotide sequence with
one or more insertion, deletion, and/or point mutations relative to
a target gene sequence may be used. In particular embodiments, an
iRNA molecule and a portion of a target gene may share, for
example, at least from about 80%, at least from about 81%, at least
from about 82%, at least from about 83%, at least from about 84%,
at least from about 85%, at least from about 86%, at least from
about 87%, at least from about 88%, at least from about 89%, at
least from about 90%, at least from about 91%, at least from about
92%, at least from about 93%, at least from about 94%, at least
from about 95%, at least from about 96%, at least from about 97%,
at least from about 98%, at least from about 99%, at least from
about 100%, and 100% sequence identity. Alternatively, the duplex
region of a dsRNA molecule may be specifically hybridizable with a
portion of a target gene transcript. In specifically hybridizable
molecules, a less than full length sequence exhibiting a greater
homology compensates for a longer, less homologous sequence. The
length of the nucleotide sequence of a duplex region of a dsRNA
molecule that is identical to a portion of a target gene transcript
may be at least about 15, 16, 7, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 35, 40, 45, 50, 100, 200, 300, 400, 500, or at
least about 1000 bases. In some embodiments, a sequence of greater
than 15 to 100 nucleotides may be used. In other embodiments, a
sequence of greater than 100 to 200 nucleotides may be used. In
particular embodiments, a sequence of greater than about 200 to 300
nucleotides may be used. In alternative embodiments, a sequence of
greater than 300 to 500 nucleotides may be used. In particular
embodiments, a sequence of greater than about 500 to 1000
nucleotides may be used, depending on the size of the target
gene.
[0231] In certain embodiments, expression of a target gene in a
coleopteran and/or hemipteran pest may be inhibited by at least
10%; at least 33%; at least 50%; or at least 80% within a cell of
the coleopteran and/or hemipteran pest, such that a significant
inhibition takes place. Significant inhibition refers to inhibition
over a threshold that results in a detectable phenotype (e.g.,
cessation of growth, cessation of feeding, cessation of
development, induced mortality, etc.), or a detectable decrease in
RNA and/or gene product corresponding to the target gene being
inhibited. Although in certain embodiments of the invention
inhibition occurs in substantially all cells of the coleopteran
and/or hemipteran pest, in other embodiments inhibition occurs only
in a subset of cells expressing the target gene.
[0232] In some embodiments, transcriptional suppression in a cell
is mediated by the presence of a dsRNA molecule exhibiting
substantial sequence identity to a promoter DNA sequence or the
complement thereof, to effect what is referred to as "promoter
trans suppression." Gene suppression may be effective against
target genes in a coleopteran and/or hemipteran pest that may
ingest or contact such dsRNA molecules, for example, by ingesting
or contacting plant material containing the dsRNA molecules. dsRNA
molecules for use in promoter trans suppression may be specifically
designed to inhibit or suppress the expression of one or more
homologous or complementary sequences in the cells of the
coleopteran and/or hemipteran pest. Post-transcriptional gene
suppression by antisense or sense oriented RNA to regulate gene
expression in plant cells is disclosed in U.S. Pat. Nos. 5,107,065,
5,231,020, 5,283,184, and 5,759,829.
[0233] C. Expression of iRNA Molecules Provided to a Coleopteran
and/or Hemipteran Pest
[0234] Expression of iRNA molecules for RNAi-mediated gene
inhibition in a coleopteran and/or hemipteran pest may be carried
out in any one of many in vitro or in vivo formats. The iRNA
molecules may then be provided to a coleopteran and/or hemipteran
pest, for example, by contacting the iRNA molecules with the pest,
or by causing the pest to ingest or otherwise internalize the iRNA
molecules. Some embodiments of the invention include transformed
host plants of a coleopteran and/or hemipteran pest, transformed
plant cells, and progeny of transformed plants. The transformed
plant cells and transformed plants may be engineered to express one
or more of the iRNA molecules, for example, under the control of a
heterologous promoter, to provide a pest-protective effect. Thus,
when a transgenic plant or plant cell is consumed by a coleopteran
and/or hemipteran pest during feeding, the pest may ingest iRNA
molecules expressed in the transgenic plants or cells. The
nucleotide sequences of the present invention may also be
introduced into a wide variety of prokaryotic and eukaryotic
microorganism hosts to produce iRNA molecules. The term
"microorganism" includes prokaryotic and eukaryotic species, such
as bacteria and fungi.
[0235] Modulation of gene expression may include partial or
complete suppression of such expression. In another embodiment, a
method for suppression of gene expression in a coleopteran and/or
hemipteran pest comprises providing in the tissue of the host of
the pest a gene-suppressive amount of at least one dsRNA molecule
formed following transcription of a nucleotide sequence as
described herein, at least one segment of which is complementary to
an mRNA sequence within the cells of the coleopteran and/or
hemipteran pest. A dsRNA molecule, including its modified form such
as an siRNA, shRNA, miRNA, or hpRNA molecule, ingested by a
coleopteran and/or hemipteran pest in accordance with the
invention, may be at least from about 80%, about 81%, about 82%,
about 83%, about 84%, about 85%, about 86%, about 87%, about 88%,
about 89%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98%, about 99%, about 100%,
or 100% identical to an RNA molecule transcribed from a nucleic
acid molecule comprising a nucleotide sequence comprising SEQ ID
NO:1, SEQ ID NO:115, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124,
SEQ ID NO:126, SEQ ID NO:131, or SEQ ID NO:133. Isolated and
substantially purified nucleic acid molecules including, but not
limited to, non-naturally occurring nucleotide sequences and
recombinant DNA constructs for providing dsRNA molecules of the
present invention are, therefore, provided, which suppress or
inhibit the expression of an endogenous coding sequence or a target
coding sequence in the coleopteran and/or hemipteran pest when
introduced thereto.
[0236] Particular embodiments provide a delivery system for the
delivery of iRNA molecules for the post-transcriptional inhibition
of one or more target gene(s) in a coleopteran and/or hemipteran
plant pest and control of a population of the coleopteran and/or
hemipteran plant pest. In some embodiments, the delivery system
comprises ingestion of a host transgenic plant cell or contents of
the host cell comprising RNA molecules transcribed in the host
cell. In these and further embodiments, a transgenic plant cell or
a transgenic plant is created that contains a recombinant DNA
construct providing a stabilized dsRNA molecule of the invention.
Transgenic plant cells and transgenic plants comprising nucleic
acid sequences encoding a particular iRNA molecule may be produced
by employing recombinant DNA technologies (which basic technologies
are well-known in the art) to construct a plant transformation
vector comprising a nucleotide sequence encoding an iRNA molecule
of the invention (e.g., a stabilized dsRNA molecule); to transform
a plant cell or plant; and to generate the transgenic plant cell or
the transgenic plant that contains the transcribed iRNA
molecule.
[0237] To impart coleopteran and/or hemipteran pest resistance to a
transgenic plant, a recombinant DNA molecule may, for example, be
transcribed into an iRNA molecule, such as a dsRNA molecule, an
siRNA molecule, an shRNA molecule, an miRNA molecule, or an hpRNA
molecule. In some embodiments, an RNA molecule transcribed from a
recombinant DNA molecule may form a dsRNA molecule within the
tissues or fluids of the recombinant plant. Such a dsRNA molecule
may be comprised in part of a nucleotide sequence that is identical
to a corresponding nucleotide sequence transcribed from a DNA
sequence within a coleopteran and/or hemipteran pest of a type that
may infest the host plant. Expression of a target gene within the
coleopteran and/or hemipteran pest is suppressed by the ingested
dsRNA molecule, and the suppression of expression of the target
gene in the coleopteran and/or hemipteran pest results in, for
example, cessation of feeding by the coleopteran and/or hemipteran
pest, with an ultimate result being, for example, that the
transgenic plant is protected from further damage by the
coleopteran and/or hemipteran pest. The modulatory effects of dsRNA
molecules have been shown to be applicable to a variety of genes
expressed in pests, including, for example, endogenous genes
responsible for cellular metabolism or cellular transformation,
including house-keeping genes; transcription factors;
molting-related genes; and other genes which encode polypeptides
involved in cellular metabolism or normal growth and
development.
[0238] For transcription from a transgene in vivo or an expression
construct, a regulatory region (e.g., promoter, enhancer, silencer,
and polyadenylation signal) may be used in some embodiments to
transcribe the RNA strand (or strands). Therefore, in some
embodiments, as set forth, supra, a nucleotide sequence for use in
producing iRNA molecules may be operably linked to one or more
promoter sequences functional in a plant host cell. The promoter
may be an endogenous promoter, normally resident in the host
genome. The nucleotide sequence of the present invention, under the
control of an operably linked promoter sequence, may further be
flanked by additional sequences that advantageously affect its
transcription and/or the stability of a resulting transcript. Such
sequences may be located upstream of the operably linked promoter,
downstream of the 3' end of the expression construct, and may occur
both upstream of the promoter and downstream of the 3' end of the
expression construct.
[0239] Some embodiments provide methods for reducing the damage to
a host plant (e.g., a corn or soybean plant) caused by a
coleopteran and/or hemipteran pest that feeds on the plant, wherein
the method comprises providing in the host plant a transformed
plant cell expressing at least one nucleic acid molecule of the
invention, wherein the nucleic acid molecule(s) functions upon
being taken up by the coleopteran and/or hemipteran pest to inhibit
the expression of a target sequence within the coleopteran and/or
hemipteran pest, which inhibition of expression results in
mortality, reduced growth, and/or reduced reproduction of the
coleopteran and/or hemipteran pest, thereby reducing the damage to
the host plant caused by the coleopteran and/or hemipteran pest. In
some embodiments, the nucleic acid molecule(s) comprise dsRNA
molecules. In these and further embodiments, the nucleic acid
molecule(s) comprise dsRNA molecules that each comprise more than
one nucleotide sequence that is specifically hybridizable to a
nucleic acid molecule expressed in a coleopteran and/or hemipteran
pest cell. In some embodiments, the nucleic acid molecule(s)
consist of one nucleotide sequence that is specifically
hybridizable to a nucleic acid molecule expressed in a coleopteran
and/or hemipteran pest cell.
[0240] In other embodiments, a method for increasing the yield of a
corn or soybean crop is provided, wherein the method comprises
introducing into a corn or soybean plant at least one nucleic acid
molecule of the invention; cultivating the corn or soybean plant to
allow the expression of an iRNA molecule comprising the nucleic
acid sequence, wherein expression of an iRNA molecule comprising
the nucleic acid sequence inhibits coleopteran and/or hemipteran
pest growth and/or coleopteran and/or hemipteran pest damage,
thereby reducing or eliminating a loss of yield due to coleopteran
and/or hemipteran pest infestation. In some embodiments, the iRNA
molecule is a dsRNA molecule. In these and further embodiments, the
nucleic acid molecule(s) comprise dsRNA molecules that each
comprise more than one nucleotide sequence that is specifically
hybridizable to a nucleic acid molecule expressed in a coleopteran
and/or hemipteran pest cell. In some embodiments, the nucleic acid
molecule(s) consists of one nucleotide sequence that is
specifically hybridizable to a nucleic acid molecule expressed in a
coleopteran and/or hemipteran pest cell.
[0241] In particular embodiments, a method for modulating the
expression of a target gene in a coleopteran and/or hemipteran pest
is provided, the method comprising: transforming a plant cell with
a vector comprising a nucleic acid sequence encoding at least one
nucleic acid molecule of the invention, wherein the nucleotide
sequence is operatively-linked to a promoter and a transcription
termination sequence; culturing the transformed plant cell under
conditions sufficient to allow for development of a plant cell
culture including a plurality of transformed plant cells; selecting
for transformed plant cells that have integrated the nucleic acid
molecule into their genomes; screening the transformed plant cells
for expression of an iRNA molecule encoded by the integrated
nucleic acid molecule; selecting a transgenic plant cell that
expresses the iRNA molecule; and feeding the selected transgenic
plant cell to the coleopteran and/or hemipteran pest. Plants may
also be regenerated from transformed plant cells that express an
iRNA molecule encoded by the integrated nucleic acid molecule. In
some embodiments, the iRNA molecule is a dsRNA molecule. In these
and further embodiments, the nucleic acid molecule(s) comprise
dsRNA molecules that each comprise more than one nucleotide
sequence that is specifically hybridizable to a nucleic acid
molecule expressed in a coleopteran and/or hemipteran pest cell. In
some embodiments, the nucleic acid molecule(s) consists of one
nucleotide sequence that is specifically hybridizable to a nucleic
acid molecule expressed in a coleopteran and/or hemipteran pest
cell.
[0242] iRNA molecules of the invention can be incorporated within
the seeds of a plant species (e.g., corn or soybean), either as a
product of expression from a recombinant gene incorporated into a
genome of the plant cells, or incorporated into a coating or seed
treatment that is applied to the seed before planting. A plant cell
comprising a recombinant gene is considered to be a transgenic
event. Also included in embodiments of the invention are delivery
systems for the delivery of iRNA molecules to coleopteran and/or
hemipteran pests. For example, the iRNA molecules of the invention
may be directly introduced into the cells of a coleopteran and/or
hemipteran pest. Methods for introduction may include direct mixing
of iRNA with plant tissue from a host for the coleopteran and/or
hemipteran pest, as well as application of compositions comprising
iRNA molecules of the invention to host plant tissue. For example,
iRNA molecules may be sprayed onto a plant surface. Alternatively,
an iRNA molecule may be expressed by a microorganism, and the
microorganism may be applied onto the plant surface, or introduced
into a root or stem by a physical means such as an injection. As
discussed, supra, a transgenic plant may also be genetically
engineered to express at least one iRNA molecule in an amount
sufficient to kill the coleopteran and/or hemipteran pests known to
infest the plant. iRNA molecules produced by chemical or enzymatic
synthesis may also be formulated in a manner consistent with common
agricultural practices, and used as spray-on products for
controlling plant damage by a coleopteran and/or hemipteran pest.
The formulations may include the appropriate stickers and wetters
required for efficient foliar coverage, as well as UV protectants
to protect iRNA molecules (e.g., dsRNA molecules) from UV damage.
Such additives are commonly used in the bioinsecticide industry,
and are well known to those skilled in the art. Such applications
may be combined with other spray-on insecticide applications
(biologically based or otherwise) to enhance plant protection from
coleopteran and/or hemipteran pests.
[0243] All references, including publications, patents, and patent
applications, cited herein are hereby incorporated by reference to
the extent they are not inconsistent with the explicit details of
this disclosure, and are so incorporated to the same extent as if
each reference were individually and specifically indicated to be
incorporated by reference and were set forth in its entirety
herein. The references discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the inventors are not entitled to antedate such disclosure by
virtue of prior invention.
[0244] The following EXAMPLES are provided to illustrate certain
particular features and/or aspects. These EXAMPLES should not be
construed to limit the disclosure to the particular features or
aspects described.
EXAMPLES
Example 1
[0245] Identification of Candidate Target Genes
[0246] Multiple stages of WCR (Diabrotica virgifera virgifera
LeConte) development were selected for pooled transcriptome
generation to provide candidate target gene sequences for control
by RNAi transgenic plant insect resistance technology.
[0247] In one exemplification, total RNA was isolated from about
0.9 gm whole first-instar WCR larvae; (4 to 5 days post-hatch; held
at 16.degree. C.), and purified using the following phenol/TRI
REAGENT-based method (MOLECULAR RESEARCH CENTER, Cincinnati,
Ohio):
[0248] Larvae were homogenized at room temperature in a 15 mL
homogenizer with 10 mL of TRI REAGENT.RTM. until a homogenous
suspension was obtained. Following 5 min. incubation at room
temperature, the homogenate was dispensed into 1.5 mL microfuge
tubes (1 mL per tube), 200 .mu.L of chloroform was added, and the
mixture was vigorously shaken for 15 seconds. After allowing the
extraction to sit at room temperature for 10 min, the phases were
separated by centrifugation at 12,000.times.g at 4.degree. C. The
upper phase (comprising about 0.6 mL) was carefully transferred
into another sterile 1.5 mL tube, and an equal volume of room
temperature isopropanol was added. After incubation at room
temperature for 5 to 10 min, the mixture was centrifuged 8 min at
12,000.times.g (4.degree. C. or 25.degree. C.).
[0249] The supernatant was carefully removed and discarded, and the
RNA pellet was washed twice by vortexing with 75% ethanol, with
recovery by centrifugation for 5 min at 7,500.times.g (4.degree. C.
or 25.degree. C.) after each wash. The ethanol was carefully
removed, the pellet was allowed to air-dry for 3 to 5 min, and then
was dissolved in nuclease-free sterile water. RNA concentration was
determined by measuring the absorbance (A) at 260 nm and 280 nm. A
typical extraction from about 0.9 gm of larvae yielded over 1 mg of
total RNA, with an A260/A280 ratio of 1.9. The RNA thus extracted
was stored at -80.degree. C. until further processed.
[0250] RNA quality was determined by running an aliquot through a
1% agarose gel. The agarose gel solution was made using autoclaved
10.times.TAE buffer (Tris-acetate EDTA; 1.times. concentration is
0.04 M Tris-acetate, 1 mM EDTA (ethylenediamine tetra-acetic acid
sodium salt), pH 8.0) diluted with DEPC (diethyl
pyrocarbonate)-treated water in an autoclaved container.
1.times.TAE was used as the running buffer. Before use, the
electrophoresis tank and the well-forming comb were cleaned with
RNASE AWAY.RTM. (INVITROGEN INC., Carlsbad, Calif.). Two .mu.L of
RNA sample were mixed with 8 .mu.L of TE buffer (10 mM Tris HCl pH
7.0; 1 mM EDTA) and 10 .mu.L of RNA sample buffer (NOVAGEN.RTM.
Catalog No 70606; EMD4 Bioscience, Gibbstown, N.J.). The sample was
heated at 70.degree. C. for 3 min, cooled to room temperature, and
5 .mu.L (containing 1 .mu.g to 2 .mu.g RNA) were loaded per well.
Commercially available RNA molecular weight markers were
simultaneously run in separate wells for molecular size comparison.
The gel was run at 60 volts for 2 hr.
[0251] A normalized cDNA library was prepared from the larval total
RNA by a commercial service provider (EUROFINS MWG Operon,
Huntsville, Ala.), using random priming. The normalized larval cDNA
library was sequenced at 1/2 plate scale by GS FLX 454 Titanium.TM.
series chemistry at EUROFINS MWG Operon, which resulted in over
600,000 reads with an average read length of 348 bp. 350,000 reads
were assembled into over 50,000 contigs. Both the unassembled reads
and the contigs were converted into BLASTable databases using the
publicly available program, FORMATDB (available from NCBI).
[0252] Total RNA and normalized cDNA libraries were similarly
prepared from materials harvested at other WCR developmental
stages. A pooled transcriptome library for target gene screening
was constructed by combining cDNA library members representing the
various developmental stages.
[0253] Candidate genes for RNAi targeting were selected using
information regarding lethal RNAi effects of particular genes in
other insects such as Drosophila and Hemipteran. These genes were
hypothesized to be essential for survival and growth in coleopteran
and/or hemipteran insects. Selected target gene homologs were
identified in the transcriptome sequence database as described
below. Full-length or partial sequences of the target genes were
amplified by PCR to prepare templates for double-stranded RNA
(dsRNA) production.
[0254] TBLASTN searches using candidate protein coding sequences
were run against BLASTable databases containing the unassembled
Diabrotica sequence reads or the assembled contigs. Significant
hits to a Diabrotica sequence (defined as better than e.sup.-20 for
contigs homologies and better than e.sup.-10 for unassembled
sequence reads homologies) were confirmed using BLASTX against the
NCBI non-redundant database. The results of this BLASTX search
confirmed that the Diabrotica homolog candidate gene sequences
identified in the TBLASTN search indeed comprised Diabrotica genes,
or were the best hit to the non-Diabrotica candidate gene sequence
present in the Diabrotica sequences. In most cases, Hemipteran
candidate genes which were annotated as encoding a protein gave an
unambiguous sequence homology to a sequence or sequences in the
Diabrotica transcriptome sequences. In a few cases, it was clear
that some of the Diabrotica contigs or unassembled sequence reads
selected by homology to a non-Diabrotica candidate gene overlapped,
and that the assembly of the contigs had failed to join these
overlaps. In those cases, SEQUENCHER.RTM. v4.9 (GENE CODES
CORPORATION, Ann Arbor, Mich.) was used to assemble the sequences
into longer contigs.
[0255] A candidate target gene encoding Diabrotica rop (SEQ ID
NO:1) was identified as a gene that may lead to coleopteran pest
mortality, inhibition of growth, inhibition of development, or
inhibition of reproduction in WCR.
[0256] Genes with Homology to WCR Rop
[0257] ROP contains a conserved domain of the Sec1 family
(pfam00995). Sec1 family proteins are known to be involved in
synaptic transmission and general secretion. Other Diabrotica
virgifera proteins that also contain this domain may share
structural and/or functional properties, and thus a gene that
encodes one of these proteins may comprise a candidate target gene
that may lead to coleopteran pest mortality, inhibition of growth,
inhibition of development, or inhibition of reproduction in
WCR.
[0258] In Drosophila melanogaster, genes encoding Ras and Ras
opposite (rop) are divergently transcribed from a bidirectional
promoter (Harrison et al., (1995) Genetics 139:1701-1709). The 68
kDa ROP protein shares sequence homology with Saccharomyces
cerevisiae proteins SLT1, SEC1 and SLP1, all of which are involved
in vesicle trafficking among yeast cellular compartments (Salzberg
et al., (1993) Development 117:1309-1319). Further, ROP regulates
neurotransmitter release in a dosage-dependent manner (Wu et al.,
(1998) EMBO Journal 17:127-139). rop dsRNA transgenes can be
combined with other dsRNA molecules to provide redundant RNAi
targeting and synergistic RNAi effects. Transgenic corn events
expressing dsRNA that targets rop are useful for preventing root
feeding damage by corn rootworm. rop dsRNA transgenes represent new
modes of action for combining with Bacillus thuringiensis
insecticidal protein technology in Insect Resistance Management
gene pyramids to mitigate against the development of rootworm
populations resistant to either of these rootworm control
technologies.
[0259] Full-length or partial clones of sequences of a Diabrotica
candidate gene, rop, were used to generate PCR amplicons for dsRNA
synthesis.
[0260] SEQ ID NO:1 shows a 4816 bp DNA sequence of Diabrotica
rop.
[0261] SEQ ID NO:3 shows a 392 bp DNA sequence of rop reg1.
[0262] SEQ ID NO:4 shows a 627 bp DNA sequence of rop reg2.
[0263] SEQ ID NO:114 shows a 201 bp DNA sequence of rop v3.
Example 2
[0264] Amplification of Target Genes to Produce dsRNA
[0265] Primers were designed to amplify portions of coding regions
of each target gene by PCR. (See Table 1 and SEQ ID NOs:112 and
113). Where appropriate, a T7 phage promoter sequence
(TTAATACGACTCACTATAGGGAGA; SEQ ID NO:5) was incorporated into the
5' ends of the amplified sense or antisense strands. See Table 1.
Total RNA was extracted from WCR, and first-strand cDNA was used as
template for PCR reactions using opposing primers positioned to
amplify all or part of the native target gene sequence. dsRNA was
also amplified from a DNA clone comprising the coding region for a
yellow fluorescent protein (YFP) (SEQ ID NO:6; Shagin et al. (2004)
Mol. Biol. Evol. 21(5):841-50).
TABLE-US-00004 TABLE 1 Primers and Primer Pairs used to amplify
portions of coding regions of exemplary rop target gene and YFP
negative control gene. SEQ Gene Primer ID ID ID NO: Sequence Pair 1
rop ROP-F1T7 7 TTAATACGA reg1 CTCACTATA GGGAGAACC ATGGCGTTA
AAGAACCAA G ROP-R1T7 8 TTAATACGA CTCACTATA GGGAGAGGG TGGTGGCAC
AAGGTACT Pair 2 rop ROP-F2T7 9 TTAATACGA reg2 CTCACTATA GGGAGACTC
GACCGAGGT TTCGAC ROP-R2T7 10 TTAATACGA CTCACTATA GGGAGATAA
CTGAAGGTT GGCGATGGT C Pair 3 YFP YFP-F_T7 11 TTAATACGA CTCACTATA
GGGAGACAC CATGGGCTC CAGCGGCGC CC YFP-R_T7 12 TTAATACGA CTCACTATA
GGGAGAAGA TCTTGAAGG CGCTCTTCA GG
Example 3
[0266] RNAi Constructs
[0267] Template preparation by PCR and dsRNA synthesis. A strategy
used to provide specific templates for rop and YFP dsRNA production
is shown in FIG. 1. Template DNAs intended for use in rop dsRNA
synthesis were prepared by PCR using the primer pairs in Table 1
and (as PCR template) first-strand cDNA prepared from total RNA
isolated from WCR first-instar larvae. For each selected rop and
YFP target gene region, PCR amplifications introduced a T7 promoter
sequence at the 5' ends of the amplified sense and antisense
strands (the YFP segment was amplified from a DNA clone of the YFP
coding region). The two PCR amplified fragments for each region of
the target genes were then mixed in approximately equal amounts,
and the mixture was used as transcription template for dsRNA
production. See FIG. 1. The sequences of the dsRNA templates
amplified with the particular primer pairs were: SEQ ID NO:3 (rop
reg1), SEQ ID NO:4 (rop reg2), SEQ ID NO:114 (rop v3), and YFP (SEQ
ID NO:6). Double-stranded RNA for insect bioassay was synthesized
and purified using an AMBION.RTM. MEGASCRIPT.RTM. RNAi kit
following the manufacturer's instructions (INVITROGEN). The
concentrations of dsRNAs were measured using a NANODROP.RTM. 8000
spectrophotometer (THERMO SCIENTIFIC, Wilmington, Del.).
[0268] Construction of plant transformation vectors. Entry vectors
(pDAB112649 and pDAB115766) harboring a target gene construct for
hairpin formation comprising segments of rop (SEQ ID NO:1) were
assembled using a combination of chemically synthesized fragments
(DNA2.0, Menlo Park, Calif.) and standard molecular cloning
methods. Intramolecular hairpin formation by RNA primary
transcripts was facilitated by arranging (within a single
transcription unit) two copies of a target gene segment in opposite
orientation to one another, the two segments being separated by an
ST-LS1 intron sequence (SEQ ID NO:16) (Vancanneyt et al. (1990)
Mol. Gen. Genet. 220(2):245-50). Thus, the primary mRNA transcript
contains the two rop gene segment sequences as large inverted
repeats of one another, separated by the intron sequence. A copy of
a maize ubiquitin 1 promoter (U.S. Pat. No. 5,510,474) was used to
drive production of the primary mRNA hairpin transcript, and a
fragment comprising a 3' untranslated region from a maize
peroxidase 5 gene (ZmPer5 3'UTR v2; U.S. Pat. No. 6,699,984) was
used to terminate transcription of the hairpin-RNA-expressing
gene.
[0269] Entry vector pDAB112649 comprises a rop v1 hairpin-RNA
construct (SEQ ID NO:13) that comprises a segment of rop (SEQ ID
NO:1)
[0270] Entry vector pDAB115766 comprises a rop v3 hairpin-RNA
construct (SEQ ID NO:14) that comprises a segment of rop (SEQ ID
NO:1) distinct from that found in pDAB112649.
[0271] Entry vectors pDAB112649 and pDAB115766 described above were
used in standard GATEWAY.RTM. recombination reactions with a
typical binary destination vector (pDAB109805) to produce rop
hairpin RNA expression transformation vectors for
Agrobacterium-mediated maize embryo transformations (pDAB114515 and
pDAB115770), respectively).
[0272] A negative control binary vector, pDAB110853, which
comprises a gene that expresses a YFP hairpin dsRNA, was
constructed by means of standard GATEWAY.RTM. recombination
reactions with a typical binary destination vector (pDAB109805) and
entry vector pDAB101670. Entry Vector pDAB101670 comprises a YFP
hairpin sequence (SEQ ID NO:15) under the expression control of a
maize ubiquitin 1 promoter (as above) and a fragment comprising a
3' untranslated region from a maize peroxidase 5 gene (as
above).
[0273] Binary destination vector pDAB109805 comprises a herbicide
resistance gene (aryloxyalknoate dioxygenase; AAD-1 v3) (U.S. Pat.
No. 7,838,733(B2), and Wright et al. (2010) Proc. Natl. Acad. Sci.
U.S.A. 107:20240-5) under the regulation of a sugarcane bacilliform
badnavirus (ScBV) promoter (Schenk et al. (1999) Plant Molec. Biol.
39:1221-30). A synthetic 5'UTR sequence, comprised of sequences
from a Maize Streak Virus (MSV) coat protein gene 5'UTR and intron
6 from a maize Alcohol Dehydrogenase 1 (ADH1) gene, is positioned
between the 3' end of the SCBV promoter segment and the start codon
of the AAD-1 coding region. A fragment comprising a 3' untranslated
region from a maize lipase gene (ZmLip 3'UTR; U.S. Pat. No.
7,179,902) was used to terminate transcription of the AAD-1
mRNA.
[0274] A further negative control binary vector, pDAB110556, which
comprises a gene that expresses a YFP protein, was constructed by
means of standard GATEWAY.RTM. recombination reactions with a
typical binary destination vector (pDAB9989) and entry vector
pDAB100287. Binary destination vector pDAB9989 comprises a
herbicide resistance gene (aryloxyalknoate dioxygenase; AAD-1 v3)
(as above) under the expression regulation of a maize ubiquitin 1
promoter (as above) and a fragment comprising a 3' untranslated
region from a maize lipase gene (ZmLip 3'UTR; as above). Entry
Vector pDAB100287 comprises a YFP coding region (SEQ ID NO:17)
under the expression control of a maize ubiquitin 1 promoter (as
above) and a fragment comprising a 3' untranslated region from a
maize peroxidase 5 gene (as above).
[0275] SEQ ID NO:13 presents an rop v1 hairpin-RNA-forming sequence
as found in pDAB114515.
[0276] SEQ ID NO:14 presents an rop v3 hairpin-RNA-forming sequence
as found in pDAB115770.
Example 4
[0277] Insect Diet Bioassays
[0278] Sample preparation and bioassays A number of dsRNA molecules
(including those corresponding to rop reg1 (SEQ ID NO:3), rop reg2
(SEQ ID NO:4), and rop v3 (SEQ ID NO:114) were synthesized and
purified using a MEGASCRIPT.RTM. RNAi kit. The purified dsRNA
molecules were prepared in TE buffer, and all bioassays contained a
control treatment consisting of this buffer, which served as a
background check for mortality or growth inhibition of WCR
(Diabrotica virgifera virgifera LeConte). The concentrations of
dsRNA molecules in the bioassay buffer were measured using a
NANODROP.RTM. 8000 spectrophotometer (THERMO SCIENTIFIC,
Wilmington, Del.).
[0279] Samples were tested for insect activity in bioassays
conducted with neonate insect larvae on artificial insect diet. WCR
eggs were obtained from CROP CHARACTERISTICS, INC. (Farmington,
Minn.).
[0280] The bioassays were conducted in 128-well plastic trays
specifically designed for insect bioassays (C-D INTERNATIONAL,
Pitman, N.J.). Each well contained approximately 1.0 mL of an
artificial diet designed for growth of coleopteran insects. A 60
.mu.L aliquot of dsRNA sample was delivered by pipette onto the
surface of the diet of each well (40 .mu.L/cm.sup.2). dsRNA sample
concentrations were calculated as the amount of dsRNA per square
centimeter (ng/cm.sup.2) of surface area (1.5 cm.sup.2) in the
well. The treated trays were held in a fume hood until the liquid
on the diet surface evaporated or was absorbed into the diet.
[0281] Within a few hours of eclosion, individual larvae were
picked up with a moistened camel hair brush and deposited on the
treated diet (one or two larvae per well). The infested wells of
the 128-well plastic trays were then sealed with adhesive sheets of
clear plastic, and vented to allow gas exchange. Bioassay trays
were held under controlled environmental conditions (28.degree. C.,
.about.40% Relative Humidity, 16:8 (Light:Dark)) for 9 days, after
which time the total number of insects exposed to each sample, the
number of dead insects, and the weight of surviving insects were
recorded. Average percent mortality and average growth inhibition
were calculated for each treatment. Growth inhibition (GI) was
calculated as follows:
GI=[1-(TWIT/TNIT)/(TWIBC/TNIBC)] [0282] where TWIT is the Total
Weight of live Insects in the Treatment; [0283] TNIT is the Total
Number of Insects in the Treatment; [0284] TWIBC is the Total
Weight of live Insects in the Background Check (Buffer control);
and [0285] TNIBC is the Total Number of Insects in the Background
Check (Buffer control).
[0286] Statistical analysis was done using JMP.RTM. software (SAS,
Cary, N.C.).
[0287] LC.sub.50 (Lethal Concentration) is defined as the dosage at
which 50% of the test insects are killed. GI.sub.50 (Growth
Inhibition) is defined as the dosage at which the mean growth (e.g.
live weight) of the test insects is 50% of the mean value seen in
Background Check samples.
[0288] Replicated bioassays demonstrated that ingestion of
particular samples resulted in a surprising and unexpected
mortality and growth inhibition of corn rootworm larvae.
Example 5
[0289] Screening of Candidate Target Genes
[0290] Synthetic dsRNA designed to inhibit target gene sequences
identified in EXAMPLE 1 caused mortality and growth inhibition when
administered to WCR in diet-based assays. rop reg1, rop reg2, and
rop v3 were observed to exhibit greatly increased efficacy in this
assay over other dsRNAs screened.
[0291] Replicated bioassays demonstrated that ingestion of dsRNA
preparations derived from rop reg1, rop reg2, and rop v3 each
resulted in mortality and/or growth inhibition of western corn
rootworm larvae. Table 2 and Table 3 show the results of diet-based
feeding bioassays of WCR larvae following 9-day exposure to these
dsRNAs, as well as the results obtained with a negative control
sample of dsRNA prepared from a yellow fluorescent protein (YFP)
coding region (SEQ ID NO:6).
TABLE-US-00005 TABLE 2 Results of rop dsRNA diet feeding assays
obtained with western corn rootworm larvae after 9 days of feeding.
ANOVA analysis found significance differences in Mean % Mortality
and Mean % Growth Inhibition (GI). Means were separated using the
Tukey-Kramer test. Mean Mean Dose (% Mortality) .+-. (GI) .+-. Gene
Name (ng/cm.sup.2) No. Rows SEM* SEM rop reg1 500 4 83.23 .+-. 1.75
A 0.90 .+-. 0.01 A rop reg2 500 4 86.37 .+-. 5.54 A 0.88 .+-. 0.10
A rop v3 500 14 79.84 .+-. 4.16 A 0.94 .+-. 0.02 A TE** 0 4 13.23
.+-. 2.81 B 0.00 .+-. 0.00 B WATER 0 4 9.01 .+-. 2.8 B 0.0 .+-.
0.00 B YFP*** 500 4 8.82 .+-. 5.63 B 0.09 .+-. 0.08 B *SEM =
Standard Error of the Mean. Letters in parentheses designate
statistical levels. Levels not connected by same letter are
significantly different (P < 0.05). **TE = Tris HCl (10 mM) plus
EDTA (1 mM) buffer, pH 8. ***YFP = Yellow Fluorescent Protein
TABLE-US-00006 TABLE 3 Summary of oral potency of rop dsRNA on WCR
larvae (ng/cm.sup.2). Gene Name LC.sub.50 Range GI.sub.50 Range rop
reg1 20.4 13.63 to 30.11 5.91 4.29 to 8.15 rop reg2 29.67 19.32 to
45.41 7.07 2.15 to 23.22 rop v3 25.35 18.46 to 34.47 10.06 6.32 to
16.00
[0292] It has previously been suggested that certain genes of
Diabrotica spp. may be exploited for RNAi-mediated insect control.
See U.S. Patent Publication No. 2007/0124836, which discloses 906
sequences, and U.S. Pat. No. 7,614,924, which discloses 9,112
sequences. However, it was determined that many genes suggested to
have utility for RNAi-mediated insect control are not efficacious
in controlling Diabrotica. It was also determined that sequences
rop reg1, rop reg2, and rop v3 each provide surprising and
unexpected superior control of Diabrotica, compared to other genes
suggested to have utility for RNAi-mediated insect control.
[0293] For example, Annexin, Beta spectrin 2, and mtRP-L4 were each
suggested in U.S. Pat. No. 7,614,924 to be efficacious in
RNAi-mediated insect control. SEQ ID NO:18 is the DNA sequence of
Annexin region 1 (Reg 1), and SEQ ID NO:19 is the DNA sequence of
Annexin region 2 (Reg 2). SEQ ID NO:20 is the DNA sequence of Beta
spectrin 2 region 1 (Reg 1), and SEQ ID NO:21 is the DNA sequence
of Beta spectrin 2 region 2 (Reg2). SEQ ID NO:22 is the DNA
sequence of mtRP-L4 region 1 (Reg 1), and SEQ ID NO:23 is the DNA
sequence of mtRP-L4 region 2 (Reg 2). A YFP sequence (SEQ ID NO:6)
was also used to produce dsRNA as a negative control.
[0294] Each of the aforementioned sequences was used to produce
dsRNA by the methods of EXAMPLE 3. The strategy used to provide
specific templates for dsRNA production is shown in FIG. 2.
Template DNAs intended for use in dsRNA synthesis were prepared by
PCR using the primer pairs in Table 4 and (as PCR template)
first-strand cDNA prepared from total RNA isolated from WCR
first-instar larvae. (YFP was amplified from a DNA clone.) For each
selected target gene region, two separate PCR amplifications were
performed. The first PCR amplification introduced a T7 promoter
sequence at the 5' end of the amplified sense strands. The second
reaction incorporated the T7 promoter sequence at the 5' ends of
the antisense strands. The two PCR amplified fragments for each
region of the target genes were then mixed in approximately equal
amounts, and the mixture was used as transcription template for
dsRNA production. See FIG. 2. Double-stranded RNA was synthesized
and purified using an AMBION.RTM. MEGAscript.RTM. RNAi kit
following the manufacturer's instructions (INVITROGEN). The
concentrations of dsRNAs were measured using a NANODROP.RTM. 8000
spectrophotometer (THERMO SCIENTIFIC, Wilmington, Del.). and the
dsRNAs were each tested by the same diet-based bioassay methods
described above. Table 4 lists the sequences of the primers used to
produce the Annexin Reg1, Annexin Reg2, Beta spectrin 2 Reg1, Beta
spectrin 2 Reg2, mtRP-L4 Reg1, and mtRP-L4 Reg2 dsRNA molecules.
YFP primer sequences for use in the method depicted in FIG. 2. are
also listed in Table 4. Table 5 presents the results of diet-based
feeding bioassays of WCR larvae following 9-day exposure to these
dsRNA molecules. Replicated bioassays demonstrated that ingestion
of these dsRNAs resulted in no mortality or growth inhibition of
western corn rootworm larvae above that seen with control samples
of TE buffer, Water, or YFP protein.
TABLE-US-00007 TABLE 4 Primers and Primer Pairs used to amplify
portions of coding regions of genes. SEQ Gene ID (Region) Primer ID
NO: Sequence Pair Annexin Ann-F1_T7 24 TTAATACGAC 4 (Reg 1)
TCACTATAGG GAGAGCTCCA ACAGTGGTTC CTTATC Annexin Ann-R1 25
CTAATAATTC (Reg 1) TTTTTTAATG TTCCTGAGG Pair Annexin Ann-F1 26
GCTCCAACAG 5 (Reg 1) TGGTTCCTTA TC Annexin Ann-R1_T7 27 TTAATACGAC
(Reg 1) TCACTATAGG GAGACTAATA ATTCTTTTTT AATGTTCCTG AGG Pair
Annexin Ann-F2_T7 28 TTAATACGAC 6 (Reg 2) TCACTATAGG GAGATTGTTA
CAAGCTGGAG AACTTCTC Annexin Ann-R2 29 CTTAACCAAC (Reg 2) AACGGCTAAT
AAGG Pair Annexin Ann-F2 30 TTGTTACAAG 7 (Reg 2) CTGGAGAACT TCTC
Annexin Ann-R2T7 31 TTAATACGA (Reg 2) CTCACTATA GGGAGACTT AACCAACAA
CGGCTAATA AGG Pair Beta-spect2 Betasp2-F1_ 32 TTAATACGA 8 (Reg 1)
T7 CTCACTATA GGGAGAAGA TGTTGGCTG CATCTAGAG AA Beta-spect2
Betasp2-R1 33 GTCCATTCG (Reg 1) TCCATCCAC TGCA Pair Beta-spect2
Betasp2-F1 34 AGATGTTGG 9 (Reg 1) CTGCATCTA GAGAA Beta-spect2
Betasp2-R1_ 35 TTAATACGA (Reg 1) T7 CTCACTATA GGGAGAGTC CATTCGTCC
ATCCACTGC A Pair Beta-spect2 Betasp2-F2_ 36 TTAATACGA 10 (Reg 2) T7
CTCACTATA GGGAGAGCA GATGAACAC CAGCGAGAA A Beta-spect2 Betasp2-R2 37
CTGGGCAGC (Reg 2) TTCTTGTTT CCTC Pair Beta-spect2 Betasp2-F2 38
GCAGATGAA 11 (Reg 2) CACCAGCGA GAAA Beta-spect2 Betasp2-R2_ 39
TTAATACGA (Reg 2) T7 CTCACTATA GGGAGACTG GGCAGCTTC TTGTTTCCT C Pair
mtRP-L4 L4-F1_T7 40 TTAATACGA 12 (Reg 1) CTCACTATA GGGAGAAGT
GAAATGTTA GCAAATATA ACATCC mtRP-L4 L4-R1 41 ACCTCTCAC (Reg 1)
TTCAAATCT TGACTTTG Pair mtRP-L4 L4-F1 42 AGTGAAATG 13 (Reg 1)
TTAGCAAAT ATAACATCC mtRP-L4 L4-R1_T7 43 TTAATACGA (Reg 1) CTCACTATA
GGGAGAACC TCTCACTTC AAATCTTGA CTTTG Pair mtRP-L4 L4-F2T7 44
TTAATACGA 14 (Reg 2) CTCACTATA GGGAGACAA AGTCAAGAT TTGAAGTGA GAGGT
mtRP-L4 L4-R2 45 CTACAAATA (Reg 2) AAACAAGAA GGACCCC Pair mtRP-L4
L4-F2 46 CAAAGTCAA 15 (Reg 2) GATTTGAAG TGAGAGGT mtRP-L4 L4-R2_T7
47 TTAATACGA (Reg 2) CTCACTATA GGGAGACTA CAAATAAAA CAAGAAGGA
CCCC
TABLE-US-00008 TABLE 5 Results of diet feeding assays obtained with
western corn rootworm larvae after 9 days. Mean Live Larval Mean
Dose Weight Mean % Growth Gene Name (ng/cm.sup.2) (mg) Mortality
Inhibition Annexin-Reg 1 1000 0.545 0 -0.262 Annexin-Reg 2 1000
0.565 0 -0.301 Beta spectrin2 Reg 1 1000 0.340 12 -0.014 Beta
spectrin2 Reg 2 1000 0.465 18 -0.367 mtRP-L4 Reg 1 1000 0.305 4
-0.168 mtRP-L4 Reg 2 1000 0.305 7 -0.180 TE buffer* 0 0.430 13
0.000 Water 0 0.535 12 0.000 YFP** 1000 0.480 9 -0.386 *TE = Tris
HCl (10 mM) plus EDTA (1 mM) buffer, pH 8. **YFP = Yellow
Fluorescent Protein
Example 6
[0295] Production of Transgenic Maize Tissues Comprising
Insecticidal Hairpin dsRNAs
[0296] Agrobacterium-Mediated Transformation
[0297] Transgenic maize cells, tissues, and plants that produce one
or more insecticidal dsRNA molecules (for example, at least one
dsRNA molecule including a dsRNA molecule targeting a gene
comprising rop; SEQ ID NO:1) through expression of a chimeric gene
stably-integrated into the plant genome were produced following
Agrobacterium-mediated transformation. Maize transformation methods
employing superbinary or binary transformation vectors are known in
the art, as described, for example, in U.S. Pat. No. 8,304,604,
which is herein incorporated by reference in its entirety.
Transformed tissues were selected by their ability to grow on
Haloxyfop-containing medium and were screened for dsRNA production,
as appropriate. Portions of such transformed tissue cultures may be
presented to neonate corn rootworm larvae for bioassay, essentially
as described in EXAMPLE 4.
[0298] Agrobacterium Culture Initiation Glycerol stocks of
Agrobacterium strain DAt13192 cells (WO 2012/016222A2) harboring a
binary transformation vector pDAB114515, pDAB115770, pDAB110853 or
pDAB110556 described above (EXAMPLE 3) were streaked on AB minimal
medium plates (Watson, et al., (1975) J. Bacteriol. 123:255-264)
containing appropriate antibiotics and were grown at 20.degree. C.
for 3 days. The cultures were then streaked onto YEP plates (gm/L:
yeast extract, 10; Peptone, 10; NaCl 5) containing the same
antibiotics and were incubated at 20.degree. C. for 1 day.
[0299] Agrobacterium culture On the day of an experiment, a stock
solution of Inoculation Medium and acetosyringone was prepared in a
volume appropriate to the number of constructs in the experiment
and pipetted into a sterile, disposable, 250 mL flask. Inoculation
Medium (Frame et al. (2011) Genetic Transformation Using Maize
Immature Zygotic Embryos. IN Plant Embryo Culture Methods and
Protocols: Methods in Molecular Biology. T. A. Thorpe and E. C.
Yeung, (Eds), Springer Science and Business Media, LLC. pp 327-341)
contained: 2.2 gm/L MS salts; 1.times.ISU Modified MS Vitamins
(Frame et al., ibid.) 68.4 gm/L sucrose; 36 gm/L glucose; 115 mg/L
L-proline; and 100 mg/L myo-inositol; at pH 5.4.) Acetosyringone
was added to the flask containing Inoculation Medium to a final
concentration of 200 .mu.M from a 1 M stock solution in 100%
dimethyl sulfoxide and the solution was thoroughly mixed.
[0300] For each construct, 1 or 2 inoculating loops-full of
Agrobacterium from the YEP plate were suspended in 15 mL of the
Inoculation Medium/acetosyringone stock solution in a sterile,
disposable, 50 mL centrifuge tube, and the optical density of the
solution at 550 nm (OD.sub.550) was measured in a
spectrophotometer. The suspension was then diluted to OD.sub.550 of
0.3 to 0.4 using additional Inoculation Medium/acetosyringone
mixture. The tube of Agrobacterium suspension was then placed
horizontally on a platform shaker set at about 75 rpm at room
temperature and shaken for 1 to 4 hours while embryo dissection was
performed.
[0301] Ear sterilization and embryo isolation Maize immature
embryos were obtained from plants of Zea mays inbred line B104
(Hanauer et al. (1997) Crop Science 37:1405-1406) grown in the
greenhouse and self- or sib-pollinated to produce ears. The ears
were harvested approximately 10 to 12 days post-pollination. On the
experimental day, de-husked ears were surface-sterilized by
immersion in a 20% solution of commercial bleach (ULTRA CLOROX.RTM.
Germicidal Bleach, 6.15% sodium hypochlorite; with two drops of
TWEEN 20) and shaken for 20 to 30 min, followed by three rinses in
sterile deionized water in a laminar flow hood. Immature zygotic
embryos (1.8 to 2.2 mm long) were aseptically dissected from each
ear and randomly distributed into microcentrifuge tubes containing
2.0 mL of a suspension of appropriate Agrobacterium cells in liquid
Inoculation Medium with 200 .mu.M acetosyringone, into which 2
.mu.L of 10% BREAK-THRU.RTM. S233 surfactant (EVONIK INDUSTRIES;
Essen, Germany) had been added. For a given set of experiments,
embryos from pooled ears were used for each transformation.
[0302] Agrobacterium co-cultivation Following isolation, the
embryos were placed on a rocker platform for 5 minutes. The
contents of the tube were then poured onto a plate of
Co-cultivation Medium, which contained 4.33 gm/L MS salts;
1.times.ISU Modified MS Vitamins; 30 gm/L sucrose; 700 mg/L
L-proline; 3.3 mg/L Dicamba in KOH (3,6-dichloro-o-anisic acid or
3,6-dichloro-2-methoxybenzoic acid); 100 mg/L myo-inositol; 100
mg/L Casein Enzymatic Hydrolysate; 15 mg/L AgNO.sub.3; 200 .mu.M
acetosyringone in DMSO; and 3 gm/L GELZAN.TM., at pH 5.8. The
liquid Agrobacterium suspension was removed with a sterile,
disposable, transfer pipette. The embryos were then oriented with
the scutellum facing up using sterile forceps with the aid of a
microscope. The plate was closed, sealed with 3M.RTM.
MICROPORE.RTM. medical tape, and placed in an incubator at
25.degree. C. with continuous light at approximately 60 .mu.mol
m.sup.-2 s.sup.-1 of Photosynthetically Active Radiation (PAR).
[0303] Callus Selection and Regeneration of Transgenic Events
Following the Co-Cultivation period, embryos were transferred to
Resting Medium, which was composed of 4.33 gm/L MS salts;
1.times.ISU Modified MS Vitamins; 30 gm/L sucrose; 700 mg/L
L-proline; 3.3 mg/L Dicamba in KOH; 100 mg/L myo-inositol; 100 mg/L
Casein Enzymatic Hydrolysate; 15 mg/L AgNO.sub.3; 0.5 gm/L MES
(2-(N-morpholino)ethanesulfonic acid monohydrate; PHYTOTECHNOLOGIES
LABR.; Lenexa, Kans.); 250 mg/L Carbenicillin; and 2.3 gm/L
GELZAN.TM.; at pH 5.8. No more than 36 embryos were moved to each
plate. The plates were placed in a clear plastic box and incubated
at 27.degree. C. with continuous light at approximately 50 .mu.mol
m.sup.-2 s.sup.-1 PAR for 7 to 10 days. Callused embryos were then
transferred (<18/plate) onto Selection Medium I, which was
comprised of Resting Medium (above) with 100 nM R-Haloxyfop acid
(0.0362 mg/L; for selection of calli harboring the AAD-1 gene). The
plates were returned to clear boxes and incubated at 27.degree. C.
with continuous light at approximately 50 .mu.mol m.sup.-2 s.sup.-1
PAR for 7 days. Callused embryos were then transferred
(<12/plate) to Selection Medium II, which is comprised of
Resting Medium (above) with 500 nM R-Haloxyfop acid (0.181 mg/L).
The plates were returned to clear boxes and incubated at 27.degree.
C. with continuous light at approximately 50 .mu.mol m.sup.2
s.sup.-1 PAR for 14 days. This selection step allowed transgenic
callus to further proliferate and differentiate.
[0304] Proliferating, embryogenic calli were transferred
(<9/plate) to Pre-Regeneration medium. Pre-Regeneration Medium
contained 4.33 gm/L MS salts; 1.times.ISU Modified MS Vitamins; 45
gm/L sucrose; 350 mg/L L-proline; 100 mg/L myo-inositol; 50 mg/L
Casein Enzymatic Hydrolysate; 1.0 mg/L AgNO.sub.3; 0.25 gm/L MES;
0.5 mg/L naphthaleneacetic acid in NaOH; 2.5 mg/L abscisic acid in
ethanol; 1 mg/L 6-benzylaminopurine; 250 mg/L Carbenicillin; 2.5
gm/L GELZAN.TM.; and 0.181 mg/L Haloxyfop acid; at pH 5.8. The
plates were stored in clear boxes and incubated at 27.degree. C.
with continuous light at approximately 50 .mu.mol m.sup.-2 s.sup.-1
PAR for 7 days. Regenerating calli were then transferred
(<6/plate) to Regeneration Medium in PHYTA 1'RAYS.TM.
(SIGMA-ALDRICH) and incubated at 28.degree. C. with 16 hours
light/8 hours dark per day (at approximately 160 .mu.mol m.sup.-2
s.sup.-1 PAR) for 14 days or until shoots and roots developed.
Regeneration Medium contained 4.33 gm/L MS salts; 1.times.ISU
Modified MS Vitamins; 60 gm/L sucrose; 100 mg/L myo-inositol; 125
mg/L Carbenicillin; 3 gm/L GELLAN.TM. gum; and 0.181 mg/L
R-Haloxyfop acid; at pH 5.8. Small shoots with primary roots were
then isolated and transferred to Elongation Medium without
selection. Elongation Medium contained 4.33 gm/L MS salts;
1.times.ISU Modified MS Vitamins; 30 gm/L sucrose; and 3.5 gm/L
GELRITE.RTM.: at pH 5.8.
[0305] Transformed plant shoots selected by their ability to grow
on medium containing Haloxyfop were transplanted from
PHYTATRAYS.TM. to small pots filled with growing medium (PROMIX BX;
PREMIER TECH HORTICULTURE), covered with cups or HUMI-DOMES (ARCO
PLASTICS), and then hardened-off in a CONVIRON growth chamber
(27.degree. C. day/24.degree. C. night, 16-hour photoperiod, 50-70%
RH, 200 .mu.mol m.sup.-2 s.sup.-1 PAR). In some instances, putative
transgenic plantlets were analyzed for transgene relative copy
number by quantitative real-time PCR assays using primers designed
to detect the AAD1 herbicide tolerance gene integrated into the
maize genome. Further, RNA qPCR assays were used to detect the
presence of the ST-LS1 intron sequence in expressed dsRNAs of
putative transformants. Selected transformed plantlets were then
moved into a greenhouse for further growth and testing
[0306] Transfer and establishment of T.sub.0 plants in the
greenhouse for bioassay and seed production When plants reached the
V3-V4 stage, they were transplanted into IE CUSTOM BLEND
(PROFILE/METRO MIX 160) soil mixture and grown to flowering in the
greenhouse (Light Exposure Type: Photo or Assimilation; High Light
Limit: 1200 PAR; 16-hour day length; 27.degree. C. day/24.degree.
C. night).
[0307] Plants to be used for insect bioassays were transplanted
from small pots to TINUS.TM. 350-4 ROOTRAINERS.RTM.
(SPENCER-LEMAIRE INDUSTRIES, Acheson, Alberta, Canada;) (one plant
per event per ROOTRANER.RTM.). Approximately four days after
transplanting to ROOTRAINERS.RTM., plants were infested for
bioassay.
[0308] Plants of the T.sub.1 generation were obtained by
pollinating the silks of T.sub.0 transgenic plants with pollen
collected from plants of non-transgenic elite inbred line B104 or
other appropriate pollen donors, and planting the resultant seeds.
Reciprocal crosses were performed when possible.
Example 7
[0309] Molecular Analyses of Transgenic Maize Tissues
[0310] Molecular analyses (e.g. RNA qPCR) of maize tissues were
performed on samples from leaves and roots that were collected from
greenhouse grown plants on the same days that root feeding damage
was assessed.
[0311] Results of RNA qPCR assays for the Per5 3'UTR were used to
validate expression of hairpin transgenes. (A low level of Per5
3'UTR detection is expected in nontransformed maize plants, since
there is usually expression of the endogenous Per5 gene in maize
tissues.) Results of RNA qPCR assays for the ST-LS1 intron sequence
(which is integral to the formation of dsRNA hairpin molecules) in
expressed RNAs were used to validate the presence of hairpin
transcripts. Transgene RNA expression levels were measured relative
to the RNA levels of an endogenous maize gene.
[0312] DNA qPCR analyses to detect a portion of the AAD1 coding
region in genomic DNA were used to estimate transgene insertion
copy number. Samples for these analyses were collected from plants
grown in environmental chambers. Results were compared to DNA qPCR
results of assays designed to detect a portion of a single-copy
native gene, and simple events (having one or two copies of the
transgenes) were advanced for further studies in the
greenhouse.
[0313] Additionally, qPCR assays designed to detect a portion of
the spectinomycin-resistance gene (SpecR; harbored on the binary
vector plasmids outside of the T-DNA) were used to determine if the
transgenic plants contained extraneous integrated plasmid backbone
sequences.
[0314] Hairpin RNA transcript expression level: Per 5 3'UTR qPCR
Callus cell events or transgenic plants were analyzed by real time
quantitative PCR (qPCR) of the Per 5 3'UTR sequence to determine
the relative expression level of the full length hairpin
transcript, as compared to the transcript level of an internal
maize gene (SEQ ID NO:48; GENBANK.RTM. Accession No. BT069734),
which encodes a TIP41-like protein (i.e. a maize homolog of
GENBANK.RTM. Accession No. AT4G34270; having a tBLASTX score of 74%
identity). RNA was isolated using an RNAEASY.TM. 96 kit (QIAGEN,
Valencia, Calif.). Following elution, the total RNA was subjected
to a DNAsel treatment according to the kit's suggested protocol.
The RNA was then quantified on a NANODROP.RTM. 8000
spectrophotometer (THERMO SCIENTIFIC) and concentration was
normalized to 25 ng/.mu.L. First strand cDNA was prepared using a
HIGH CAPACITY cDNA SYNTHESIS KIT (INVITROGEN) in a 10 .mu.L
reaction volume with 5 .mu.L denatured RNA, substantially according
to the manufacturer's recommended protocol. The protocol was
modified slightly to include the addition of 10 .mu.L of 100 .mu.M
T20VN oligonucleotide (IDT) (SEQ ID NO:49; TTTTTTTTTTTTTTTTTTTTVN,
where V is A, C, or G, and N is A, C, G, or T/U) into the 1 mL tube
of random primer stock mix, in order to prepare a working stock of
combined random primers and oligo dT.
[0315] Following cDNA synthesis, samples were diluted 1:3 with
nuclease-free water, and stored at -20.degree. C. until
assayed.
[0316] Separate real-time PCR assays for the Per5 3' UTR and
TIP41-like transcript were performed on a LIGHTCYCLER.TM. 480
(ROCHE DIAGNOSTICS, Indianapolis, Ind.) in 10 .mu.L reaction
volumes. For the Per5 3'UTR assay, reactions were run with Primers
P5U76S (F) (SEQ ID NO:50) and P5U76A (R) (SEQ ID NO:51), and a
ROCHE UNIVERSAL PROBE.TM. (UPL76; Catalog No. 4889960001; labeled
with FAM). For the TIP41-like reference gene assay, primers TIPmxF
(SEQ ID NO:52) and TIPmxR (SEQ ID NO:53), and Probe HXTIP (SEQ ID
NO:54) labeled with HEX (hexachlorofluorescein) were used.
[0317] All assays included negative controls of no-template (mix
only). For the standard curves, a blank (water in source well) was
also included in the source plate to check for sample
cross-contamination. Primer and probe sequences are set forth in
Table 6. Reaction components recipes for detection of the various
transcripts are disclosed in Table 7, and PCR reactions conditions
are summarized in Table 8. The FAM (6-Carboxy Fluorescein Amidite)
fluorescent moiety was excited at 465 nm and fluorescence was
measured at 510 nm; the corresponding values for the HEX
(hexachlorofluorescein) fluorescent moiety were 533 nm and 580
nm.
TABLE-US-00009 TABLE 6 Primer sequences used for molecular analyses
of transcript levels in transgenic maize. SEQ Oligo- ID Target
nucleotide NO. Sequence Per5 P5U76S (F) 50 TTGTGATGTT 3'TR
GGTGGCGTAT Per5 P5U76A (R) 51 TGTTAAATAAAA 3'UTR CCCCAAAGATCG Per5
Roche NAv** Roche Diagnostics 3'UTR UPL76 Catalog Number
(FAM-Probe) 488996001 TIP41 TIPmxF 52 TGAGGGTAATG CCAACTGGTT TIP41
TIPmxR 53 GCAATGTAACCG AGTGTCTCTCAA TIP41 HXTIP 54 TTTTTGGCTTAG
(HEX-Probe) AGTTGATGGTGT ACTGATGA *TIP41-like protein. **NAv
Sequence Not Available from the supplier.
TABLE-US-00010 TABLE 7 PCR reaction recipes for transcript
detection. Per5 3'UTR TIP-like Gene Component Final Concentration
Roche Buffer 1X 1X P5U76S (F) 0.4 .mu.M 0 P5U76A (R) 0.4 .mu.M 0
Roche UPL76 (FAM) 0.2 .mu.M 0 HEXtipZM F 0 0.4 .mu.M HEXtipZM R 0
0.4 .mu.M HEXtipZMP (HEX) 0 0.2 .mu.M cDNA (2.0 .mu.L) NA NA Water
To 10 .mu.L To 10 .mu.L
TABLE-US-00011 TABLE 8 Thermocycler conditions for qPCR. TIP41-like
Gene and Per5 3'UTR Detection Process Temp Time No. Cycles Target
Activation 95.degree. C. 10 min 1 Denature 95.degree. C. 10 sec 40
Extend 60.degree. C. 40 sec Acquire/FAM or HEX 72.degree. C. 1 sec
Cool 40.degree. C. 10 sec 1
[0318] Data were analyzed using LIGHTCYCLER.TM. Software v1.5 by
relative quantification using a second derivative max algorithm for
calculation of Cq values according to the supplier's
recommendations. For expression analyses, expression values were
calculated using the .DELTA..DELTA.Ct method (i.e., 2-(Cq TARGET-Cq
REF)), which relies on the comparison of differences of Cq values
between two targets, with the base value of 2 being selected under
the assumption that, for optimized PCR reactions, the product
doubles every cycle.
[0319] Hairpin transcript size and integrity: Northern Blot Assay
In some instances, additional molecular characterization of the
transgenic plants is obtained by the use of Northern Blot (RNA
blot) analysis to determine the molecular size of the rop hairpin
RNA in transgenic plants expressing a rop hairpin dsRNA.
[0320] All materials and equipment are treated with RNAZAP
(AMBION/INVITROGEN) before use. Tissue samples (100 mg to 500 mg)
are collected in 2 mL SAFELOCK EPPENDORF tubes, disrupted with a
KLECKO.TM. tissue pulverizer (GARCIA MANUFACTURING, Visalia,
Calif.) with three tungsten beads in 1 mL of TRIZOL (INVITROGEN)
for 5 min, then incubated at room temperature (RT) for 10 min.
Optionally, the samples are centrifuged for 10 min at 4.degree. C.
at 11,000 rpm and the supernatant is transferred into a fresh 2 mL
SAFELOCK EPPENDORF tube. After 200 .mu.L of chloroform are added to
the homogenate, the tube is mixed by inversion for 2 to 5 min,
incubated at RT for 10 minutes, and centrifuged at 12,000.times.g
for 15 min at 4.degree. C. The top phase is transferred into a
sterile 1.5 mL EPPENDORF tube, 600 .mu.L of 100% isopropanol are
added, followed by incubation at RT for 10 min to 2 hr, then
centrifuged at 12,000.times.g for 10 min at 4.degree. to 25.degree.
C. The supernatant is discarded and the RNA pellet is washed twice
with 1 mL of 70% ethanol, with centrifugation at 7,500.times.g for
10 min at 4.degree. to 25.degree. C. between washes. The ethanol is
discarded and the pellet is briefly air dried for 3 to 5 min before
resuspending in 50 .mu.L of nuclease-free water.
[0321] Total RNA is quantified using the NANODROP.RTM. 8000
(THERMO-FISHER) and samples are normalized to 5 .mu.g/10 .mu.L. 10
.mu.L of glyoxal (AMBION/INVITROGEN) are then added to each sample.
Five to 14 ng of DIG RNA standard marker mix (ROCHE APPLIED
SCIENCE, Indianapolis, Ind.) are dispensed and added to an equal
volume of glyoxal. Samples and marker RNAs are denatured at
50.degree. C. for 45 min and stored on ice until loading on a 1.25%
SEAKEM GOLD agarose (LONZA, Allendale, N.J.) gel in NORTHERNMAX
10.times. glyoxal running buffer (AMBION/INVITROGEN) RNAs are
separated by electrophoresis at 65 volts/30 mA for 2 hr and 15
min.
[0322] Following electrophoresis, the gel is rinsed in 2.times.SSC
for 5 min and imaged on a GEL DOC station (BIORAD, Hercules,
Calif.), then the RNA is passively transferred to a nylon membrane
(MILLIPORE) overnight at RT, using 10.times.SSC as the transfer
buffer (20.times.SSC consists of 3 M sodium chloride and 300 mM
trisodium citrate, pH 7.0). Following the transfer, the membrane is
rinsed in 2.times.SSC for 5 minutes, the RNA is UV-crosslinked to
the membrane (AGILENT/STRATAGENE), and the membrane is allowed to
dry at RT for up to 2 days.
[0323] The membrane is prehybridized in ULTRAHYB buffer
(AMBION/INVITROGEN) for 1 to 2 hr. The probe consists of a PCR
amplified product containing the sequence of interest, (for
example, the antisense sequence portion of SEQ ID NO:13 or SEQ ID
NO:14, as appropriate) labeled with digoxygenin by means of a ROCHE
APPLIED SCIENCE DIG procedure. Hybridization in recommended buffer
is overnight at a temperature of 60.degree. C. in hybridization
tubes. Following hybridization, the blot is subjected to DIG
washes, wrapped, exposed to film for 1 to 30 minutes, then the film
is developed, all by methods recommended by the supplier of the DIG
kit.
[0324] Transgene Copy Number Determination
[0325] Maize leaf pieces approximately equivalent to 2 leaf punches
were collected in 96-well collection plates (QIAGEN). Tissue
disruption was performed with a KLECKO.TM. tissue pulverizer
(GARCIA MANUFACTURING, Visalia, Calif.) in BIOSPRINT96 AP1 lysis
buffer (supplied with a BIOSPRINT96 PLANT KIT; QIAGEN) with one
stainless steel bead. Following tissue maceration, genomic DNA
(gDNA) was isolated in high throughput format using a BIOSPRINT96
PLANT KIT and a BIOSPRINT96 extraction robot. Genomic DNA was
diluted 2:3 DNA:water prior to setting up the qPCR reaction.
[0326] qPCR analysis Transgene detection by hydrolysis probe assay
was performed by real-time PCR using a LIGHTCYCLER.RTM.480 system.
Oligonucleotides to be used in hydrolysis probe assays to detect
the ST-LS1 intron sequence (SEQ ID NO:16), or to detect a portion
of the SpecR gene (i.e. the spectinomycin resistance gene borne on
the binary vector plasmids; SEQ ID NO:55; SPC1 oligonucleotides in
Table 9), were designed using LIGHTCYCLER.RTM. PROBE DESIGN
SOFTWARE 2.0. Further, oligonucleotides to be used in hydrolysis
probe assays to detect a segment of the AAD-1 herbicide tolerance
gene (SEQ ID NO:56; GAAD1 oligonucleotides in Table 9) were
designed using PRIMER EXPRESS software (APPLIED BIOSYSTEMS). Table
9 shows the sequences of the primers and probes. Assays were
multiplexed with reagents for an endogenous maize chromosomal gene
(Invertase (SEQ ID NO:57; GENBANK.RTM. Accession No: U16123;
referred to herein as IVR1), which served as an internal reference
sequence to ensure gDNA was present in each assay. For
amplification, LIGHTCYCLER.RTM.480 PROBES MASTER mix (ROCHE APPLIED
SCIENCE) was prepared at 1.times. final concentration in a 10 .mu.L
volume multiplex reaction containing 0.4 .mu.M of each primer and
0.2 .mu.M of each probe (Table 10). A two step amplification
reaction was performed as outlined in Table 11. Fluorophore
activation and emission for the FAM- and HEX-labeled probes were as
described above; CY5 conjugates are excited maximally at 650 nm and
fluoresce maximally at 670 nm.
[0327] Cp scores (the point at which the fluorescence signal
crosses the background threshold) were determined from the real
time PCR data using the fit points algorithm (LIGHTCYCLER.RTM.
SOFTWARE release 1.5) and the Relative Quant module (based on the
.DELTA..DELTA.Ct method). Data were handled as described previously
(above; RNA qPCR).
TABLE-US-00012 TABLE 9 Sequences of primers and probes (with
fluorescent conjugate) used for gene copy number determinations and
binary vector plasmid backbone detection. SEQ ID Name NO: Sequence
GAAD1-F 61 TGTTCGGTTCCCTCTACCAA GAAD1-R 62 CAACATCCATCACCTTGACTGA
GAAD1-P (FAM) 63 CACAGAACCGTCGCTTCAGCAACA IVR1-F 64
TGGCGGACGACGACTTGT IVR1-R 65 AAAGTTTGGAGGCTGCCGT IVR1-P (HEX) 66
CGAGCAGACCGCCGTGTACTTCTACC SPC1A 67 CTTAGCTGGATAACGCCAC SPC1S 68
GACCGTAAGGCTTGATGAA TQSPEC (CY5*) 69 CGAGATTCTCCGCGCTGTAGA CY5 =
Cyanine-5
TABLE-US-00013 TABLE 10 Reaction components for gene copy number
analyses and plasmid backbone detection. Component Amt. (.mu.L)
Stock Final Conc'n 2X Buffer 5.0 2X 1X Appropriate Forward Primer
0.4 10 .mu.M 0.4 Appropriate Reverse Primer 0.4 10 .mu.M 0.4
Appropriate Probe 0.4 5 .mu.M 0.2 IVR1-Forward Primer 0.4 10 .mu.M
0.4 IVR1-Reverse Primer 0.4 10 .mu.M 0.4 IVR1-Probe 0.4 5 .mu.M 0.2
H.sub.2O 0.6 NA* NA gDNA 2.0 ND** ND Total 10.0 *NA = Not
Applicable **ND = Not Determined
TABLE-US-00014 TABLE 11 Thermocycler conditions for DNA qPCR
Genomic copy number analyses Process Temp. Time No. Cycles Target
Activation 95.degree. C. 10 min 1 Denature 95.degree. C. 10 sec 40
Extend & Acquire 60.degree. C. 40 sec FAM, HEX, or CY5 Cool
40.degree. C. 10 sec 1
Example 8
[0328] Bioassay of Transgenic Maize
[0329] In vitro Insect Bioassays Bioactivity of dsRNA of the
subject invention produced in plant cells is demonstrated by
bioassay methods. See, e.g., Baum et al. (2007) Nat. Biotechnol.
25(11):1322-1326. One is able to demonstrate efficacy, for example,
by feeding various plant tissues or tissue pieces derived from a
plant producing an insecticidal dsRNA to target insects in a
controlled feeding environment. Alternatively, extracts are
prepared from various plant tissues derived from a plant producing
the insecticidal dsRNA and the extracted nucleic acids are
dispensed on top of artificial diets for bioassays as previously
described herein. The results of such feeding assays are compared
to similarly conducted bioassays that employ appropriate control
tissues from host plants that do not produce an insecticidal dsRNA,
or to other control samples.
[0330] Insect Bioassays with Transgenic Maize Events
[0331] Two western corn rootworm larvae (1 to 3 days old) hatched
from washed eggs are selected and placed into each well of the
bioassay tray. The wells are then covered with a "PULL N' PEEL" tab
cover (BIO-CV-16, BIO-SERV) and placed in a 28.degree. C. incubator
with an 18 hr/6 hr light/dark cycle. Nine days after the initial
infestation, the larvae are assessed for mortality, which is
calculated as the percentage of dead insects out of the total
number of insects in each treatment. The insect samples are frozen
at -20.degree. C. for two days, then the insect larvae from each
treatment are pooled and weighed. The percent of growth inhibition
is calculated as the mean weight of the experimental treatments
divided by the mean of the average weight of two control well
treatments. The data are expressed as a Percent Growth Inhibition
(of the Negative Controls). Mean weights that exceed the control
mean weight are normalized to zero.
[0332] Insect bioassays in the greenhouse Western corn rootworm
(WCR, Diabrotica virgifera virgifera LeConte) eggs were received in
soil from CROP CHARACTERISTICS (Farmington, Minn.). WCR eggs were
incubated at 28.degree. C. for 10 to 11 days. Eggs were washed from
the soil, placed into a 0.15% agar solution, and the concentration
was adjusted to approximately 75 to 100 eggs per 0.25 mL aliquot. A
hatch plate was set up in a Petri dish with an aliquot of egg
suspension to monitor hatch rates.
[0333] The soil around the maize plants growing in ROOTRAINERS.RTM.
was infested with 150 to 200 WCR eggs. The insects were allowed to
feed for 2 weeks, after which time a "Root Rating" was given to
each plant. A Node-Injury Scale was utilized for grading
essentially according to Oleson et al. (2005, J. Econ. Entomol.
98:1-8). Plants which passed this bioassay were transplanted to
5-gallon pots for seed production. Transplants were treated with
insecticide to prevent further rootworm damage and insect release
in the greenhouses. Plants were hand pollinated for seed
production. Seeds produced by these plants were saved for
evaluation at the T.sub.1 and subsequent generations of plants.
[0334] Greenhouse bioassays included two kinds of negative control
plants. Transgenic negative control plants were generated by
transformation with vectors harboring genes designed to produce a
yellow fluorescent protein (YFP) or a YFP hairpin dsRNA (See
Example 4). Nontransformed negative control plants were grown from
seeds of lines 7sh382 or B104. Bioassays were conducted on two
separate dates, with negative controls included in each set of
plant materials.
[0335] Table 12 shows the combined results of molecular analyses
and bioassays for rop-hairpin plants. Examination of the bioassay
results summarized in Table 12 reveals the surprising and
unexpected observation that the majority of the transgenic maize
plants harboring constructs that express an rop hairpin dsRNA
comprising segments of SEQ ID NO:1, for example, as exemplified in
SEQ ID NO:13 and SEQ ID NO:14, are protected against root damage
incurred by feeding of western corn rootworm larvae. Twenty-two of
the 37 graded events had a root rating of 0.5 or lower. Table 13
shows the combined results of molecular analyses and bioassays for
negative control plants. Most of the plants had no protection
against WCR larvae feeding, although five of the 34 graded plants
had a root rating of 0.75 or lower. The presence of some plants
having low root ratings scores amongst the negative control plant
set is sometimes observed and reflects the variability and
difficulty of conducting this type of bioassay in a greenhouse
setting.
TABLE-US-00015 TABLE 12 Greenhouse bioassay and molecular analyses
results of rop-hairpin-expressing maize plants. Leaf Tissue Root
Tissue ST- PER5 ST- PER5 LS1 UTR LS1 UTR Root Sample ID RTL* RTL
RTL* RTL Rating rop v1 Hairpin Events 114515[1]-001.001 0.162 62.7
0.026 89.9 0.05 114515[1]-005.001 0.170 131.6 0.082 30.1 0.05
114515[1]-008.001 0.268 194.0 0.068 113.8 0.75 114515[1]-009.001
0.262 121.1 0.146 52.0 0.75 114515[1]-010.001 1.028 56.5 0.110 8.7
1 114515[1]-012.001 0.133 103.3 0.051 28.1 0.5 114515[1]-013.001
0.145 63.6 0.059 168.9 1 114515[1]-014.001 0.203 172.4 0.072 104.0
0.25 114515[1]-015.001 0.257 127.1 0.021 89.3 0.25
114515[1]-016.001 0.363 235.6 0.129 213.8 0.1 114515[1]-017.001
0.225 128.9 0.037 115.4 0.25 114515[1]-018.001 0.110 81.0 0.093
200.9 0.5 114515[1]-019.001 0.122 87.4 0.013 85.0 0.1
114515[1]-020.001 0.221 65.3 0.142 27.3 1 114515[1]-022.001 0.486
91.8 0.063 36.8 0.25 114515[1]-023.001 0.257 117.8 0.043 117.0 1
114515[1]-024.001 2.042 240.5 0.000 1.0 0.25 114515[1]-026.001
0.000 68.6 0.028 33.4 1 114515[1]-027.001 0.374 69.1 0.451 26.9 1
114515[1]-028.001 0.204 68.6 0.076 163.1 1 rop v3 Hairpin Events
115770[1]-001.001 0.227 242.2 0.113 404.5 0.01 115770[1]-002.001
0.163 128.0 0.283 404.5 0.05 115770[1]-004.001 0.174 90.5 0.222
148.1 0.05 115770[1]-005.001 0.159 143.0 0.166 96.3 0.05
115770[1]-007.001 0.072 88.0 0.274 238.9 0.01 115770[1]-008.001
0.101 117.8 0.068 68.6 0.1 115770[1]-012.001 0.920 298.2 0.146
199.5 0.5 115770[1]-014.001 2.497 467.9 5.134 424.6 0.75
115770[1]-015.001 1.310 266.9 0.179 226.0 0.75 115770[1]-018.001
0.871 245.6 0.222 238.9 0.75 115770[1]-019.001 0.959 243.9 0.366
296.1 0.5 115770[1]-020.001 0.889 252.5 0.398 369.6 0.75
115770[1]-022.001 0.824 296.1 0.176 498.0 0.1 115770[1]-024.001
0.707 333.1 0.145 261.4 0.25 115770[1]-027.001 0.566 337.8 0.312
487.8 0.75 115770[1]-028.001 0.366 166.6 0.080 121.1 0.75
115770[1]-029.001 1.125 252.5 0.268 315.2 0.5 *RTL = Relative
Transcript Level as measured against TIP4-like gene transcript
levels.
TABLE-US-00016 TABLE 13 Greenhouse bioassay and molecular analyses
results of negative control plants comprising transgenic and
nontransformed maize plants. Leaf Tissue Root Tissue ST- PER5 ST-
PER5 LS1 UTR LS1 UTR Root Sample ID RTL* RTL RTL* RTL Rating YFP
protein Events 101556[679]-10513.001 0.000 0.0 0.000 32.7 1
101556[679]-10514.001 0.173 171.3 0.240 202.3 1
101556[679]-10515.001 0.000 42.5 0.000 45.6 1 101556[679]-10516.001
0.000 18.9 0.000 65.3 0.75 101556[677]-10524.001 0.000 315.2 0.000
364.6 1 101556[677]-10525.001 0.000 184.8 0.000 95.0 1
101556[677]-10526.001 0.000 0.2 0.000 0.3 1 101556[677]-10527.001
0.000 170.1 0.000 128.0 1 101556[677]-10528.001 0.000 179.8 0.067
104.0 1 101556[677]-10529.001 0.000 98.4 0.000 38.9 1 YFP hairpin
Events 110853[8]-289.001 0.117 97.0 0.122 65.3 0.5
110853[8]-290.001 0.098 70.0 0.272 79.3 1 110853[8]-291.001 0.084
36.3 0.107 86.2 1 110853[8]-293.001 0.088 79.9 0.624 101.1 0.05
110853[8]-294.001 0.079 35.8 0.117 54.2 1 110853[8]-295.001 0.095
82.7 0.114 145.0 1 110853[8]-296.001 0.097 59.7 0.158 79.9 1
110853[8]-297.001 0.106 0.1 0.000 2.5 1 110853[8]-298.001 0.000 0.1
0.000 32.9 1 110853[8]-299.001 0.354 143.0 0.308 101.8 1
110853[8]-300.001 0.500 159.8 0.085 139.1 1 110853[8]-301.001 0.304
174.9 1.007 111.4 1 Nontransformed Plants 7sh382 0.000 0.1 0.000
0.2 0.75 7sh382 0.000 0.1 0.000 0.1 1 7sh382 0.000 0.1 0.000 6.1
NG** 7sh382 0.000 0.4 0.000 1.6 1 7sh382 0.287 0.0 0.000 ND*** 1
7sh382 0.000 0.2 0.000 0.3 0.75 B104 0.000 0.2 0.000 0.2 1 B104
0.000 0.0 0.000 0.6 1 B104 0.000 0.1 0.000 0.3 1 B104 0.000 0.4
1.000 1.0 1 B104 0.000 0.1 0.000 0.5 1 B104 0.000 0.0 0.000 205.1 1
B104 0.077 0.1 0.000 4.4 1 *RTL = Relative Transcript Level as
measured against TIP4-like gene transcript levels. **NG = Not
Graded due to small plant size. ***ND = Not Done.
Example 9
[0336] Transgenic Zea mays Comprising Coleopteran Pest
Sequences
[0337] Ten to 20 transgenic T.sub.0 Zea mays plants are generated
as described in EXAMPLE 6. A further 10-20 T.sub.1 Zea mays
independent lines expressing hairpin dsRNA for an RNAi construct
are obtained for corn rootworm challenge. Hairpin dsRNA may be
derived as set forth in SEQ ID NO:13, SEQ ID NO:14, or otherwise
further comprising SEQ ID NO:1. Additional hairpin dsRNAs may be
derived, for example, from coleopteran pest sequences such as, for
example, Cafl-180 (U.S. Patent Application Publication No.
2012/0174258), VatpaseC (U.S. Patent Application Publication No.
2012/0174259), Rho1 (U.S. Patent Application Publication No.
2012/0174260), VatpaseH (U.S. Patent Application Publication No.
2012/0198586), PPI-87B (U.S. Patent Application Publication No.
2013/0091600), RPA70 (U.S. Patent Application Publication No.
2013/0091601), or RPS6 (U.S. Patent Application Publication No.
2013/0097730). These are confirmed through RT-PCR or other
molecular analysis methods. Total RNA preparations from selected
independent T.sub.1 lines are optionally used for RT-PCR with
primers designed to bind in the ST-LS1 intron of the hairpin
expression cassette in each of the RNAi constructs. In addition,
specific primers for each target gene in an RNAi construct are
optionally used to amplify and confirm the production of the
pre-processed mRNA required for siRNA production in planta. The
amplification of the desired bands for each target gene confirms
the expression of the hairpin RNA in each transgenic Zea mays
plant. Processing of the dsRNA hairpin of the target genes into
siRNA is subsequently optionally confirmed in independent
transgenic lines using RNA blot hybridizations.
[0338] Moreover, RNAi molecules having mismatch sequences with more
than 80% sequence identity to target genes affect corn rootworms in
a way similar to that seen with RNAi molecules having 100% sequence
identity to the target genes The pairing of mismatch sequence with
native sequences to form a hairpin dsRNA in the same RNAi construct
delivers plant-processed siRNAs capable of affecting the growth,
development and viability of feeding coleopteran pests.
[0339] In planta delivery of dsRNA, siRNA shRNA, or miRNA
corresponding to target genes and the subsequent uptake by
coleopteran pests through feeding results in down-regulation of the
target genes in the coleopteran pest through RNA-mediated gene
silencing. When the function of a target gene is important at one
or more stages of development, the growth, development, and
reproduction of the coleopteran pest is affected, and in the case
of at least one of WCR, NCR, SCR, MCR, D. balteata LeConte, D. u.
tenella, and D. u. undecimpunctata Mannerheim, leads to failure to
successfully infest, feed, develop, and/or reproduce, or leads to
death of the coleopteran pest. The choice of target genes and the
successful application of RNAi is then used to control coleopteran
pests.
[0340] Phenotypic comparison of transgenic RNAi lines and
nontransformed Zea mays Target coleopteran pest genes or sequences
selected for creating hairpin dsRNA have no similarity to any known
plant gene sequence. Hence it is not expected that the production
or the activation of (systemic) RNAi by constructs targeting these
coleopteran pest genes or sequences will have any deleterious
effect on transgenic plants. However, development and morphological
characteristics of transgenic lines are compared with
nontransformed plants, as well as those of transgenic lines
transformed with an "empty" vector having no hairpin-expressing
gene. Plant root, shoot, foliage and reproduction characteristics
are compared. There is no observable difference in root length and
growth patterns of transgenic and nontransformed plants. Plant
shoot characteristics such as height, leaf numbers and sizes, time
of flowering, floral size and appearance are similar. In general,
there are no observable morphological differences between
transgenic lines and those without expression of target iRNA
molecules when cultured in vitro and in soil in the glasshouse.
Example 10
[0341] Transgenic Zea mays Comprising a Coleopteran Pest Sequence
and Additional RNAi Constructs
[0342] A transgenic Zea mays plant comprising a heterologous coding
sequence in its genome that is transcribed into an iRNA molecule
that targets an organism other than a coleopteran pest is
secondarily transformed via Agrobacterium or WHISKERS.TM.
methodologies (see Petolino and Arnold (2009) Methods Mol. Biol.
526:59-67) to produce one or more insecticidal dsRNA molecules (for
example, at least one dsRNA molecule including a dsRNA molecule
targeting a gene comprising SEQ ID NO:1). Plant transformation
plasmid vectors prepared essentially as described in EXAMPLE 3 are
delivered via Agrobacterium or WHISKERS.TM.-mediated transformation
methods into maize suspension cells or immature maize embryos
obtained from a transgenic Hi II or B104 Zea mays plant comprising
a heterologous coding sequence in its genome that is transcribed
into an iRNA molecule that targets an organism other than a
coleopteran pest.
Example 11
[0343] Transgenic Zea mays Comprising an RNAi Construct and
Additional Coleopteran Pest Control Sequences
[0344] A transgenic Zea mays plant comprising a heterologous coding
sequence in its genome that is transcribed into an iRNA molecule
that targets a coleopteran pest organism (for example, at least one
dsRNA molecule including a dsRNA molecule targeting a gene
comprising SEQ ID NO:1) is secondarily transformed via
Agrobacterium or WHISKERS.TM. methodologies (see Petolino and
Arnold (2009) Methods Mol. Biol. 526:59-67) to produce one or more
insecticidal protein molecules, for example, Cry3, or Cry34 and
Cry35Ab1 insecticidal proteins. Plant transformation plasmid
vectors prepared essentially as described in EXAMPLE 3 are
delivered via Agrobacterium or WHISKERS.TM.-mediated transformation
methods into maize suspension cells or immature maize embryos
obtained from a transgenic B104 Zea mays plant comprising a
heterologous coding sequence in its genome that is transcribed into
an iRNA molecule that targets a coleopteran pest organism.
Doubly-transformed plants are obtained that produce iRNA molecules
and insecticidal proteins for control of coleopteran pests.
Example 12
[0345] Other Diabrotica Sequences Having Homology to ROP
[0346] ROP protein (SEQ ID NO:2) contains a conserved domain of the
Sec1 family (pfam00995). Sec1 family proteins are known to be
involved in synaptic transmission and general secretion. hmmscan
was used for PFAM domain prediction in the WCR transcriptome
sequences. Protein homology analyses using a Sect domain identified
42 other Diabrotica virgifera sequences (SEQ ID NOs:70 to 111) that
encode proteins that contain a Sec1 domain and may consequently
share structural and/or functional properties with ROP protein.
Thus, the genes (i.e. SEQ ID NOs:70-111) encoding these proteins
are additional candidates for RNAi-mediated control of Diabrotica
species, including at least one of WCR, NCR, SCR, MCR, D. balteata
LeConte, D. u. tenella, and D. u. undecimpunctata Mannerheim, by
methods described herein.
Example 13
[0347] Mortality of Neotropical Brown Stink Bug (Euschistus heros)
Following Rop RNAi Injection
[0348] Insect rearing Neotropical Brown Stink Bugs (BSB; Euschistus
heros) were reared on BSB artificial diet prepared as follows (used
within two weeks of preparation). Lyophilized green beans were
blended to a fine powder in a MAGIC BULLET.RTM. blender while raw
(organic) peanuts were blended in a separate MAGIC BULLET.RTM.
blender. Blended dry ingredients were combined (weight percentages:
green beans, 35%; peanuts, 35%; sucrose, 5%; Vitamin complex (e.g.
Vanderzant Vitamin Mixture for insects, SIGMA-ALDRICH, Catalog No.
V1007), 0.9%); in a large MAGIC BULLET.RTM. blender, which was
capped and shaken well to mix the ingredients. The mixed dry
ingredients were then added to a mixing bowl. In a separate
container, water and benomyl anti-fungal agent (50 ppm; 25 .mu.L of
a 20,000 ppm solution/50 mL diet solution) were mixed well and then
added to the dry ingredient mixture. All ingredients were mixed by
hand until the solution was fully blended. The diet was shaped into
desired sizes, wrapped loosely in aluminum foil, heated for 4 hours
at 60.degree. C., then cooled and stored at 4.degree. C.
[0349] RNAi target selection Six stages of BSB development were
selected for mRNA library preparation. Total RNA was extracted from
insects frozen at -70.degree. C. and homogenized in 10 volumes of
Lysis/Binding buffer in Lysing MATRIX A 2 mL tubes (MP BIOMEDICALS,
Santa Ana, Calif.) on a FastPrep.RTM.-24 Instrument (MP
BIOMEDICALS). Total mRNA was extracted using a mirVana.TM. miRNA
Isolation Kit (AMBION; INVITROGEN) according to the manufacturer's
protocol. RNA sequencing using an Illumina.RTM. HiSeg.TM. system
(San Diego, Calif.) provided candidate target gene sequences for
use in RNAi insect control technology. HiSeg.TM. generated a total
of about 378 million reads for the six samples. The reads were
assembled individually for each sample using TRINITY assembler
software (Grabherr et al. (2011) Nature Biotech. 29:644-652). The
assembled transcripts were combined to generate a pooled
transcriptome. This BSB pooled transcriptome contains 378,457
sequences.
[0350] BSB rop ortholog identification A tBLASTn search of the BSB
pooled transcriptome was performed using as query sequence a
Drosophila ROP protein (ROP-PA; GENBANK.RTM. Accession No.
AAF47844.1). BSB rop (SEQ ID NO:115) was identified as a Brown
Stink Bug candidate target gene.
[0351] Template preparation and dsRNA synthesis cDNA was prepared
from total BSB RNA extracted from a single young adult insect
(about 90 mg) using TRIzol.RTM. Reagent (LIFE TECHNOLOGIES). The
insect was homogenized at room temperature in a 1.5 mL
microcentrifuge tube with 200 .mu.L of TRIzol.RTM. using a pellet
pestle (FISHERBRAND Catalog No. 12-141-363) and Pestle Motor Mixer
(COLE-PARMER, Vernon Hills, Ill.). Following homogenization, an
additional 800 .mu.L of TRIzol.RTM. was added, the homogenate was
vortexed, and then incubated at room temperature for five minutes.
Cell debris was removed by centrifugation and the supernatant was
transferred to a new tube. 200 .mu.L of chloroform were added and
the mixture was vortexed for 15 seconds. After allowing the
extraction to sit at room temperature for 2 to 3 min, the phases
were separated by centrifugation at 12,000.times.g at 4.degree. C.
for 15 minutes. The upper aqueous phase was carefully transferred
into another nuclease-free 1.5 mL microcentrifuge tube, and the RNA
was precipitated with 500 .mu.L of room temperature isopropanol.
After ten-minute incubation at room temperature, the mixture was
centrifuged for 10 minutes as above. The RNA pellet was rinsed with
1 mL of room-temperature 75% ethanol and centrifuged for an
additional 10 minutes as above. The RNA pellet was dried at room
temperature and resuspended in 200 .mu.L of Tris Buffer from a GFX
PCR DNA AND GEL EXTRACTION KIT (Illustra.TM.; GE HEALTHCARE LIFE
SCIENCES) using Elution Buffer Type 4 (i.e. 10 mM Tris-HCl pH8.0).
RNA concentration was determined using a NANODROP.RTM. 8000
spectrophotometer (THERMO SCIENTIFIC, Wilmington, Del.).
[0352] cDNA was reverse-transcribed from 5 .mu.g of BSB total RNA
template and oligo dT primer using a SUPERSCRIPT III FIRST-STRAND
SYNTHESIS SYSTEM.TM. for RT-PCR (INVITROGEN), following the
supplier's recommended protocol. The final volume of the
transcription reaction was brought to 100 .mu.L with nuclease-free
water.
[0353] Primers BSB_Rop-1-For (SEQ ID NO:117) and BSB_Rop-1-Rev (SEQ
ID NO:118) were used in touch-down PCR (annealing temperature
lowered from 60.degree. C. to 50.degree. C. in a 1.degree. C./cycle
decrease) with 1 .mu.L of cDNA (above) as the template. Fragments
comprising a 499 bp segment of rop (i.e. BSB rop region1; SEQ ID
NO:119) were generated during 35 cycles of PCR. The BSB_Rop primers
comprised a T7 phage promoter sequence (SEQ ID NO:5) at their 5'
ends, and thus enabled the use of BSB rop reg1 DNA fragments for
dsRNA transcription.
[0354] dsRNA was synthesized using 2 .mu.L of PCR product (above)
as the template with a MEGAscript.TM. RNAi kit (AMBION) used
according to the manufacturer's instructions. (See FIG. 1). dsRNA
was quantified on a NANODROP.RTM. 8000 spectrophotometer and
diluted to 500 ng/.mu.L in nuclease-free 0.1.times. TE buffer (1 mM
Tris HCL, 0.1 mM EDTA, pH7.4).
[0355] Injection of dsRNA into BSB hemocoel BSB were reared on
artificial diet (above) in a 27.degree. C. incubator at 65%
relative humidity and 16:8 hour light:dark photoperiod. Second
instar nymphs (each weighing 1 to 1.5 mg) were gently handled with
a small brush to prevent injury and were placed in a Petri dish on
ice to chill and immobilize the insects. Each insect was injected
with 55.2 nL of a 500 ng/.mu.L dsRNA solution (i.e. 27.6 ng dsRNA;
dosage of 18.4 to 27.6 .mu.gig body weight). Injections were
performed using a NANOJECT.TM. II injector (DRUMMOND SCIENTIFIC,
Broomhall, Pa.) equipped with an injection needle pulled from a
Drummond 3.5 inches #3-000=203-G/X glass capillary. The needle tip
was broken and the capillary was backfilled with light mineral oil,
then filled with 2 to 3 .mu.L of dsRNA. dsRNA was injected into the
abdomen of the nymphs (10 insects injected per dsRNA per trial),
and the trials were repeated on three different days. Injected
insects (5 per well) were transferred into 32-well trays (Bio-RT-32
Rearing Tray; BIO-SERV, Frenchtown, N.J.) containing a pellet of
artificial BSB diet and covered with Pull-N-Peel.TM. tabs
(BIO-CV-4; BIO-SERV). Moisture was supplied by means of 1.25 mL of
water in a 1.5 mL microcentrifuge tube with a cotton wick. The
trays were incubated at 26.5.degree. C., 60% humidity and 16:8
light:dark photoperiod. Viability counts and weights were taken on
day 7 after the injections.
[0356] Injections identified BSB rop as a lethal dsRNA target dsRNA
homologous to a YFP coding region (prepared as in EXAMPLE 2) was
used as a negative control in BSB injection experiments. As
summarized in Table 13, 27.6 ng of BSB_rop reg1 dsRNA injected into
the hemocoel of 2.sup.nd instar BSB nymphs produced high mortality
within seven days. The mortality caused by BSB_rop reg1 dsRNA was
significantly different from that seen with the same amount of
injected YFP dsRNA (negative control).
TABLE-US-00017 TABLE 13 Results of BSB_rop reg1 dsRNA injection
into the hemocoel of 2.sup.nd instar Brown Stink Bug nymphs seven
days after injection. Mean % N t-test Treatment* Mortality SEM
trials (p) BSB_rop reg1 dsRNA 90 5.8 3 6.08E-04 YFP v2 dsRNA 13 3.3
3 6.43E-01 Not injected 10 5.8 3 *Ten insects injected per trial
for each dsRNA.
Example 14
[0357] Transgenic Zea mays Comprising Hemipteran Pest Sequences
[0358] Ten to 20 transgenic T.sub.0 Zea mays plants harboring
expression vectors for nucleic acids comprising SEQ ID NO: 115
and/or SEQ ID NO 119 are generated as described in EXAMPLE 6. A
further 10-20 T.sub.1 Zea mays independent lines expressing hairpin
dsRNA for an RNAi construct are obtained for BSB challenge. Hairpin
dsRNA may be derived as set forth in SEQ ID NO:119 or otherwise
further comprising SEQ ID NO:115. These are confirmed through
RT-PCR or other molecular analysis methods. Total RNA preparations
from selected independent T.sub.1 lines are optionally used for
RT-PCR with primers designed to bind in the ST-LS1 intron of the
hairpin expression cassette in each of the RNAi constructs. In
addition, specific primers for each target gene in an RNAi
construct are optionally used to amplify and confirm the production
of the pre-processed mRNA required for siRNA production in planta.
The amplification of the desired bands for each target gene
confirms the expression of the hairpin RNA in each transgenic Zea
mays plant. Processing of the dsRNA hairpin of the target genes
into siRNA is subsequently optionally confirmed in independent
transgenic lines using RNA blot hybridizations.
[0359] Moreover, RNAi molecules having mismatch sequences with more
than 80% sequence identity to target genes affect corn rootworms in
a way similar to that seen with RNAi molecules having 100% sequence
identity to the target genes. The pairing of mismatch sequence with
native sequences to form a hairpin dsRNA in the same RNAi construct
delivers plant-processed siRNAs capable of affecting the growth,
development and viability of feeding hemipteran pests.
[0360] In planta delivery of dsRNA, siRNA, shRNA, or miRNA
corresponding to target genes and the subsequent uptake by
hemipteran pests through feeding results in down-regulation of the
target genes in the hemipteran pest through RNA-mediated gene
silencing. When the function of a target gene is important at one
or more stages of development, the growth, development, and
reproduction of the hemipteran pest is affected, and in the case of
at least one of Euchistus heros, Piezodorus guildinii, Halyomorpha
halys, Nezara viridula, Acrosternum hilare, and Euschistus serous
leads to failure to successfully infest, feed, develop, and/or
reproduce, or leads to death of the hemipteran pest. The choice of
target genes and the successful application of RNAi is then used to
control hemipteran pests.
[0361] Phenotypic comparison of transgenic RNAi lines and
nontransformed Zea mays Target hemipteran pest genes or sequences
selected for creating hairpin dsRNA have no similarity to any known
plant gene sequence. Hence it is not expected that the production
or the activation of (systemic) RNAi by constructs targeting these
hemipteran pest genes or sequences will have any deleterious effect
on transgenic plants. However, development and morphological
characteristics of transgenic lines are compared with
nontransformed plants, as well as those of transgenic lines
transformed with an "empty" vector having no hairpin-expressing
gene. Plant root, shoot, foliage and reproduction characteristics
are compared. There is no observable difference in root length and
growth patterns of transgenic and nontransformed plants. Plant
shoot characteristics such as height, leaf numbers and sizes, time
of flowering, floral size and appearance are similar. In general,
there are no observable morphological differences between
transgenic lines and those without expression of target iRNA
molecules when cultured in vitro and in soil in the glasshouse.
Example 15
[0362] Transgenic Glycine max Comprising Hemipteran Pest
Sequences
[0363] Ten to 20 transgenic T.sub.0 Glycine max plants harboring
expression vectors for nucleic acids comprising SEQ ID NO: 115
and/or SEQ ID NO 119 are generated as is known in the art,
including for example by Agrobacterium-mediated transformation, as
follows. Mature soybean (Glycine max) seeds are sterilized
overnight with chlorine gas for sixteen hours. Following
sterilization with chlorine gas, the seeds are placed in an open
container in a LAMINAR.TM. flow hood to dispel the chlorine gas.
Next, the sterilized seeds are imbibed with sterile H.sub.2O for
sixteen hours in the dark using a black box at 24.degree. C.
[0364] Preparation of split-seed soybeans. The split soybean seed
comprising a portion of an embryonic axis protocol required
preparation of soybean seed material which is cut longitudinally,
using a #10 blade affixed to a scalpel, along the hilum of the seed
to separate and remove the seed coat, and to split the seed into
two cotyledon sections. Careful attention is made to partially
remove the embryonic axis, wherein about 1/2-1/3 of the embryo axis
remains attached to the nodal end of the cotyledon.
[0365] Inoculation. The split soybean seeds comprising a partial
portion of the embryonic axis are then immersed for about 30
minutes in a solution of Agrobacterium tumefaciens (e.g., strain
EHA 101 or EHA 105) containing binary plasmid comprising SEQ ID NO:
115 and/or SEQ ID NO 119. The Agrobacterium tumefaciens solution is
diluted to a final concentration of .lamda.=0.6 OD.sub.650 before
immersing the cotyledons comprising the embryo axis.
[0366] Co-cultivation. Following inoculation, the split soybean
seed is allowed to co-cultivate with the Agrobacterium tumefaciens
strain for 5 days on co-cultivation medium (Wang, Kan.
Agrobacterium Protocols. 2. 1. New Jersey: Humana Press, 2006.
Print.) in a Petri dish covered with a piece of filter paper.
[0367] Shoot induction. After 5 days of co-cultivation, the split
soybean seeds are washed in liquid Shoot Induction (SI) media
consisting of B5 salts, B5 vitamins, 28 mg/L Ferrous, 38 mg/L
Na.sub.2EDTA, 30 g/L sucrose, 0.6 g/L MES, 1.11 mg/L BAP, 100 mg/L
TIMENTIN.TM., 200 mg/L cefotaxime, and 50 mg/L vancomycin (pH 5.7).
The split soybean seeds are then cultured on Shoot Induction I (SI
I) medium consisting of B5 salts, B5 vitamins, 7 g/L Noble agar, 28
mg/L Ferrous, 38 mg/L Na.sub.2EDTA, 30 g/L sucrose, 0.6 g/L MES,
1.11 mg/L BAP, 50 mg/L TIMENTIN.TM., 200 mg/L cefotaxime, 50 mg/L
vancomycin (pH 5.7), with the flat side of the cotyledon facing up
and the nodal end of the cotyledon imbedded into the medium. After
2 weeks of culture, the explants from the transformed split soybean
seed are transferred to the Shoot Induction II (SI II) medium
containing SI I medium supplemented with 6 mg/L glufosinate
(LIBERTY.RTM.).
[0368] Shoot elongation. After 2 weeks of culture on SI II medium,
the cotyledons are removed from the explants and a flush shoot pad
containing the embryonic axis are excised by making a cut at the
base of the cotyledon. The isolated shoot pad from the cotyledon is
transferred to Shoot Elongation (SE) medium. The SE medium consists
of MS salts, 28 mg/L Ferrous, 38 mg/L Na.sub.2EDTA, 30 g/L sucrose
and 0.6 g/L MES, 50 mg/L asparagine, 100 mg/L L-pyroglutamic acid,
0.1 mg/L IAA, 0.5 mg/L GA3, 1 mg/L zeatin riboside, 50 mg/L
TIMENTIN.TM., 200 mg/L cefotaxime, 50 mg/L vancomycin, 6 mg/L
glufosinate, 7 g/L Noble agar, (pH 5.7). The cultures are
transferred to fresh SE medium every 2 weeks. The cultures are
grown in a CONVIRON.TM. growth chamber at 24.degree. C. with an 18
h photoperiod at a light intensity of 80-90 .mu.mol/m.sup.2
sec.
[0369] Rooting. Elongated shoots which developed from the cotyledon
shoot pad are isolated by cutting the elongated shoot at the base
of the cotyledon shoot pad, and dipping the elongated shoot in 1
mg/L IBA (Indole 3-butyric acid) for 1-3 minutes to promote
rooting. Next, the elongated shoots are transferred to rooting
medium (MS salts, B5 vitamins, 28 mg/L Ferrous, 38 mg/L
Na.sub.2EDTA, 20 g/L sucrose and 0.59 g/L MES, 50 mg/L asparagine,
100 mg/L L-pyroglutamic acid 7 g/L Noble agar, pH 5.6) in phyla
trays.
[0370] Cultivation. Following culture in a CONVIRON.TM. growth
chamber at 24.degree. C., 18 h photoperiod, for 1-2 weeks, the
shoots which have developed roots are transferred to a soil mix in
a covered sundae cup and placed in a CONVIRON.TM. growth chamber
(models CMP4030 and CMP3244, Controlled Environments Limited,
Winnipeg, Manitoba, Canada) under long day conditions (16 hours
light/8 hours dark) at a light intensity of 120-150 .mu.mol/m.sup.2
sec under constant temperature (22.degree. C.) and humidity
(40-50%) for acclimatization of plantlets. The rooted plantlets are
acclimated in sundae cups for several weeks before they are
transferred to the greenhouse for further acclimatization and
establishment of robust transgenic soybean plants.
[0371] A further 10-20 T.sub.1 Glycine max independent lines
expressing hairpin dsRNA for an RNAi construct are obtained for BSB
challenge. Hairpin dsRNA may be derived as set forth in SEQ ID
NO:119 or otherwise further comprising SEQ ID NO:115. These are
confirmed through RT-PCR or other molecular analysis methods. Total
RNA preparations from selected independent T.sub.1 lines are
optionally used for RT-PCR with primers designed to bind in the
ST-LS1 intron of the hairpin expression cassette in each of the
RNAi constructs. In addition, specific primers for each target gene
in an RNAi construct are optionally used to amplify and confirm the
production of the pre-processed mRNA required for siRNA production
in planta. The amplification of the desired bands for each target
gene confirms the expression of the hairpin RNA in each transgenic
Glycine max plant. Processing of the dsRNA hairpin of the target
genes into siRNA is subsequently optionally confirmed in
independent transgenic lines using RNA blot hybridizations.
[0372] Moreover, RNAi molecules having mismatch sequences with more
than 80% sequence identity to target genes affect corn rootworms in
a way similar to that seen with RNAi molecules having 100% sequence
identity to the target genes. The pairing of mismatch sequence with
native sequences to form a hairpin dsRNA in the same RNAi construct
delivers plant-processed siRNAs capable of affecting the growth,
development and viability of feeding hemipteran pests.
[0373] In planta delivery of dsRNA, siRNA, shRNA, or miRNA
corresponding to target genes and the subsequent uptake by
hemipteran pests through feeding results in down-regulation of the
target genes in the hemipteran pest through RNA-mediated gene
silencing. When the function of a target gene is important at one
or more stages of development, the growth, development, and
reproduction of the hemipteran pest is affected, and in the case of
at least one of Euchistus heros, Piezodorus guildinii, Halyomorpha
halys, Nezara viridula, Acrosternum hilare, and Euschistus serous
leads to failure to successfully infest, feed, develop, and/or
reproduce, or leads to death of the hemipteran pest. The choice of
target genes and the successful application of RNAi is then used to
control hemipteran pests.
[0374] Phenotypic comparison of transgenic RNAi lines and
nontransformed Glycine max Target hemipteran pest genes or
sequences selected for creating hairpin dsRNA have no similarity to
any known plant gene sequence. Hence it is not expected that the
production or the activation of (systemic) RNAi by constructs
targeting these hemipteran pest genes or sequences will have any
deleterious effect on transgenic plants. However, development and
morphological characteristics of transgenic lines are compared with
nontransformed plants, as well as those of transgenic lines
transformed with an "empty" vector having no hairpin-expressing
gene. Plant root, shoot, foliage and reproduction characteristics
are compared. There is no observable difference in root length and
growth patterns of transgenic and nontransformed plants. Plant
shoot characteristics such as height, leaf numbers and sizes, time
of flowering, floral size and appearance are similar. In general,
there are no observable morphological differences between
transgenic lines and those without expression of target iRNA
molecules when cultured in vitro and in soil in the glasshouse.
Example 16
[0375] Pollen Beetle Transcriptome
[0376] Insects: Larvae and adult pollen beetles were collected from
fields with flowering rapeseed plants (Giessen, Germany). Young
adult beetles (each per treatment group: n=20; 3 replicates) were
challenged by injecting a mixture of two different bacteria
(Staphylococcus aureus and Pseudomonas aeruginosa), one yeast
(Saccharomyces cerevisiae) and bacterial LPS. Bacterial cultures
were grown at 37.degree. C. with agitation, and the optical density
was monitored at 600 nm (OD600). The cells were harvested at OD600
.about.1 by centrifugation and resuspended in phosphate-buffered
saline. The mixture was introduced ventrolaterally by pricking the
abdomen of pollen beetle imagoes using a dissecting needle dipped
in an aqueous solution of 10 mg/ml LPS (purified E. coli endotoxin;
Sigma, Taufkirchen, Germany) and the bacterial and yeast cultures.
Along with the immune challenged beetles naive beetles and larvae
were collected (n=20 per and 3 replicates each) at the same time
point.
[0377] RNA isolation: Total RNA was extracted 8 h after
immunization from frozen beetles and larvae using TriReagent
(Molecular Research Centre, Cincinnati, Ohio, USA) and purified
using the RNeasy Micro Kit (Qiagen, Hilden, Germany) in each case
following the manufacturers' guidelines. The integrity of the RNA
was verified using an Agilent 2100 Bioanalyzer and a RNA 6000 Nano
Kit (Agilent Technologies, Palo Alto, Calif., USA). The quantity of
RNA was determined using a NANODROP.RTM. ND-1000 spectrophotometer.
RNA was extracted from each of the adult immune-induced treatment
groups, adult control groups, and larval groups individually and
equal amounts of total RNA were subsequently combined in one pool
per sample (immune-challenged adults, control adults and larvae)
for sequencing.
[0378] Transcriptome information: RNA-Seq data generation and
assembly Single-read 100-bp RNA-Seq was carried out separately on 5
.mu.g total RNA isolated from immune-challenged adult beetles,
naive (control) adult beetles and untreated larvae. Sequencing was
carried out by Eurofins MWG Operon using the Illumina HiSeq-2000
platform. This yielded 20.8 million reads for the adult control
beetle sample, 21.5 million reads for the LPS-challenged adult
beetle sample and 25.1 million reads for the larval sample. The
pooled reads (67.5 million) were assembled using Velvet/Oases
assembler software (M. H. Schulz et al. (2012) Bioinformatics.
28:1086-92; Zerbino & E. Birney (2008) Genome Research.
18:821-9). The transcriptome contained 55648 sequences.
[0379] Pollen beetle rop identification: A tblastn search of the
transcriptome was used to identify matching contigs. As a query the
peptide sequence of rop from Tribohum castaneum was used
(GENBANK.RTM. NP_001164155.1). Two contigs were identified
(RGK_contig6910, RGK_contig46722). The gap between the contigs was
completed with unassembled reads using a propriety tool. GAPS
(Bonfield J K & Whitwham (2010). Bioinformatics 26: 1699-1703)
was used for verification of sequences.
Example 17
[0380] Mortality of Pollen Beetle (Meligethes aeneus) Following
Treatment with Rop RNAi
[0381] Gene-specific primers including the T7 polymerase promoter
sequence at the 5' end were used to create PCR products of
approximate 500 bp by PCR (SEQ ID NOs:129-130). PCR fragments were
cloned in the pGEM T easy vector according to the manufacturer's
protocol and sent to a sequencing company to verify the sequence.
The dsRNA was then produced by the T7 RNA polymerase
(MEGAscript.RTM. RNAi Kit, Applied Biosystems) from a PCR construct
generated from the sequenced plasmid according to the
manufacturer's protocol.
[0382] Injection of .about.100 nl dsRNA (1 ug/ul) into larvae and
adult beetles was performed with a micromanipulator under a
dissecting stereomicroscope (n=10, 3 biological replications).
Animals were anaesthetized on ice before they were affixed to
double-stick tape. Controls received the same volume of water. A
negative control dsRNA of IMPI (insect metalloproteinase inhibitor
gene of the lepidopteran Galleria mellonella) were conducted. All
controls in all stages could not be tested due to a lack of
animals.
[0383] Pollen beetles were maintained in Petri dishes with dried
pollen and a wet tissue. The larvae were reared in plastic boxes on
inflorescence of canola in an agar/water media.
TABLE-US-00018 TABLE 14 Results of adult pollen beetle injection
bioassay. % Survival Mean .+-. SD* Treatment Day 0 Day 2 Day 4 Day
6 Day 8 rop 100 .+-. 0 90 .+-. 10 87 .+-. 15 87 .+-. 15 80 .+-. 10
water 100 .+-. 0 100 .+-. 0 100 .+-. 0 100 .+-. 0 100 .+-. 0 Day 10
Day 12 Day 14 Day 16 rop 73 .+-. 6 67 .+-. 6 63 .+-. 12 53 .+-. 6
water 93 .+-. 12 90 .+-. 10 87 .+-. 12 80 .+-. 10 *Standard
deviation
TABLE-US-00019 TABLE 15 Results of larval pollen beetle injection
bioassay. % Survival Mean .+-. SD* Treatment Day 0 Day 2 Day 4 Day
6 rop 100 .+-. 0 77 .+-. 21 73 .+-. 15 43 .+-. 6 Negative control
100 .+-. 0 100 .+-. 0 97 .+-. 6 73 .+-. 21 *Standard deviation
[0384] Controls were performed on a different date due to the
limited availability of insects.
[0385] Feeding Bioassay: Beetles were kept without access to water
in empty falcon tubes 24 h before treatment. A droplet of dsRNA
(.about.5 .mu.l) was placed in a small Petri dish and 5 to 8
beetles were added to the Petri dish. Animals were observed under a
stereomicroscope and those that ingested dsRNA containing diet
solution were selected for the bioassay. Beetles were transferred
into petri dishes with dried pollen and a wet tissue. Controls
received the same volume of water. A negative control dsRNA of IMPI
(insect metalloproteinase inhibitor gene of the lepidopteran
Galleria mellonella) was conducted. All controls in all stages
could not be tested due to a lack of animals.
TABLE-US-00020 TABLE 16 Results of adult feeding bioassay. %
Survival Mean .+-. SD* Treatment Day 0 Day 2 Day 4 Day 6 Day 8 rop
100 .+-. 0 89 .+-. 10 78 .+-. 10 76 .+-. 14 60 .+-. 18 Negative
control 100 .+-. 0 93 .+-. 5.8 90 .+-. 10 87 .+-. 5.8 83 .+-. 5.8
water 100 .+-. 0 100 .+-. 0 100 .+-. 0 93 .+-. 3.8 93 .+-. 3.8 Day
10 Day 12 Day 14 Day 16 rop 51 .+-. 14 44 .+-. 10 38 .+-. 14 38
.+-. 14 Negative control 80 .+-. 10 80 .+-. 10 80 .+-. 10 77 .+-.
12 water 93 .+-. 3.8 87 .+-. 10 80 .+-. 13 80 .+-. 13 *Standard
deviation
[0386] Controls were performed on a different date due to the
limited availability of insects.
Example 18
[0387] Agrobacterium-mediated transformation of Canola (Brassica
napus) hypocotyls
[0388] Agrobacterium Preparation
[0389] The Agrobacterium strain containing a binary plasmid is
streaked out on YEP media (Bacto Peptone.TM. 20.0 gm/L and Yeast
Extract 10.0 gm/L) plates containing streptomycin (100 mg/ml) and
spectinomycin (50 mg/mL) and incubated for 2 days at 28.degree. C.
The propagated Agrobacterium strain containing the binary plasmid
is scraped from the 2-day streak plate using a sterile inoculation
loop. The scraped Agrobacterium strain containing the binary
plasmid is then inoculated into 150 mL modified YEP liquid with
streptomycin (100 mg/ml) and spectinomycin (50 mg/ml) into sterile
500 mL baffled flask(s) and shaken at 200 rpm at 28.degree. C. The
cultures are centrifuged and resuspended in M-medium (LS salts, 3%
glucose, modified B5 vitamins, 1 .mu.M kinetin, 1 .mu.M 2,4-D, pH
5.8) and diluted to the appropriate density (50 Klett Units as
measured using a spectrophotometer) prior to transformation of
canola hypocotyls.
[0390] Canola Transformation
[0391] Seed germination: Canola seeds (var. NEXERA 710.TM.) are
surface-sterilized in 10% Clorox.TM. for 10 minutes and rinsed
three times with sterile distilled water (seeds are contained in
steel strainers during this process). Seeds are planted for
germination on 1/2 MS Canola medium (1/2 MS, 2% sucrose, 0.8% agar)
contained in Phytatrays.TM. (25 seeds per Phytatray.TM.) and placed
in a Percival.TM. growth chamber with growth regime set at
25.degree. C., photoperiod of 16 hours light and 8 hours dark for 5
days of germination.
[0392] Pre-treatment: On day 5, hypocotyl segments of about 3 mm in
length are aseptically excised, the remaining root and shoot
sections are discarded (drying of hypocotyl segments is prevented
by immersing the hypocotyls segments into 10 mL of sterile
milliQ.TM. water during the excision process). Hypocotyl segments
are placed horizontally on sterile filter paper on callus induction
medium, MSK1D1 (MS, 1 mg/L kinetin, 1 mg/L 2,4-D, 3.0% sucrose,
0.7% phytagar) for 3 days pre-treatment in a Percival.TM. growth
chamber with growth regime of 22-23.degree. C., and a photoperiod
of 16 hours light, 8 hours dark.
[0393] Co-cultivation with Agrobacterium: The day before
Agrobacterium co-cultivation, flasks of YEP medium containing the
appropriate antibiotics, are inoculated with the Agrobacterium
strain containing the binary plasmid. Hypocotyl segments are
transferred from filter paper callus induction medium, MSK1D1 to an
empty 100.times.25 mm Petri.TM. dishes containing 10 mL of liquid
M-medium to prevent the hypocotyl segments from drying. A spatula
is used at this stage to scoop the segments and transfer the
segments to new medium. The liquid M-medium is removed with a
pipette and 40 mL of Agrobacterium suspension is added to the
Petri.TM. dish (500 segments with 40 mL of Agrobacterium solution).
The hypocotyl segments are treated for 30 minutes with periodic
swirling of the Petri.TM. dish so that the hypocotyl segments
remain immersed in the Agrobacterium solution. At the end of the
treatment period, the Agrobacterium solution is pipetted into a
waste beaker; autoclaved and discarded (the Agrobacterium solution
is completely removed to prevent Agrobacterium overgrowth). The
treated hypocotyls are transferred with forceps back to the
original plates containing MSK1D1 media overlaid with filter paper
(care is taken to ensure that the segments did not dry). The
transformed hypocotyl segments and non-transformed control
hypocotyl segments are returned to the Percival.TM. growth chamber
under reduced light intensity (by covering the plates with aluminum
foil), and the treated hypocotyl segments are co-cultivated with
Agrobacterium for 3 days.
[0394] Callus induction on selection medium: After 3 days of
co-cultivation, the hypocotyl segments are individually transferred
with forceps onto callus induction medium, MSK1D1H1 (MS, 1 mg/L
kinetin, 1 mg/L 2,4-D, 0.5 gm/L MES, 5 mg/L AgNO.sub.3, 300 mg/L
Timentin.TM., 200 mg/L carbenicillin, 1 mg/L Herbiace.TM., 3%
sucrose, 0.7% phytagar) with growth regime set at 22-26.degree. C.
The hypocotyl segments are anchored on the medium but are not
deeply embedded into the medium.
[0395] Selection and shoot regeneration: After 7 days on callus
induction medium, the callusing hypocotyl segments are transferred
to Shoot Regeneration Medium 1 with selection, MSB3Z1H1 (MS, 3 mg/L
BAP, 1 mg/L zeatin, 0.5 gm/L MES, 5 mg/L AgNO.sub.3, 300 mg/L
Timentin.TM., 200 mg/L carbenicillin, 1 mg/L Herbiace.TM., 3%
sucrose, 0.7% phytagar). After 14 days, the hypocotyl segments
which develop shoots are transferred to Regeneration Medium 2 with
increased selection, MSB3Z1H3 (MS, 3 mg/L BAP, 1 mg/L Zeatin, 0.5
gm/L MES, 5 mg/L AgNO.sub.3, 300 mg/l Timentin.TM., 200 mg/L
carbenicillin, 3 mg/L Herbiace.TM., 3% sucrose, 0.7% phytagar) with
growth regime set at 22-26.degree. C.
[0396] Shoot elongation: After 14 days, the hypocotyl segments that
develop shoots are transferred from Regeneration Medium 2 to shoot
elongation medium, MSMESH5 (MS, 300 mg/L Timentin.TM., 5 mg/l
Herbiace.TM., 2% sucrose, 0.7% TC Agar) with growth regime set at
22-26.degree. C. Shoots that are already elongated were isolated
from the hypocotyl segments and transferred to MSMESH5. After 14
days the remaining shoots which have not elongated in the first
round of culturing on shoot elongation medium are transferred to
fresh shoot elongation medium, MSMESH5. At this stage all remaining
hypocotyl segments which do not produce shoots are discarded.
[0397] Root induction: After 14 days of culturing on the shoot
elongation medium, the isolated shoots are transferred to MSMEST
medium (MS, 0.5 g/L MES, 300 mg/L Timentin.TM., 2% sucrose, 0.7% TC
Agar) for root induction at 22-26.degree. C. Any shoots which do
not produce roots after incubation in the first transfer to MSMEST
medium are transferred for a second or third round of incubation on
MSMEST medium until the shoots develop roots.
[0398] PCR analysis: Transformed canola hypocotyl segments which
regenerated into shoots comprising roots are further analyzed via a
PCR molecular confirmation assay. Leaf tissue is obtained from the
green shoots and tested via PCR for the presence of the pat
selectable marker gene. Any chlorotic shoots are discarded and not
subjected to PCR analysis. Samples that are identified as positive
for the presence of the pat selectable marker gene are kept and
cultured on MSMEST medium to continue development and elongation of
the shoots and roots. The samples that are identified as not
containing the pat selectable marker gene negative according to PCR
analysis are discarded.
[0399] The transformed canola plants comprising shoots and roots
that are PCR-positive for the presence of the pat selectable marker
gene are transplanted into soil in a greenhouse. After
establishment of the canola plants within soil, the canola plants
are further analyzed to quantitate the copy number of the pat gene
expression cassette via an Invader.TM. quantitative PCR assay and
Southern blotting. Transgenic T.sub.0 canola plants which are
confirmed to contain at least one copy of the pat gene expression
cassette are advanced for further analysis of the seed. The seeds
obtained from theses transgenic T.sub.0 canola plants, i.e.,
T.sub.1 canola seeds, are analyzed to detect the presences of the
target gene.
[0400] While the present disclosure may be susceptible to various
modifications and alternative forms, specific embodiments have been
described by way of example in detail herein. However, it should be
understood that the present disclosure is not intended to be
limited to the particular forms disclosed. Rather, the present
disclosure is to cover all modifications, equivalents, and
alternatives falling within the scope of the present disclosure as
defined by the following appended claims and their legal
equivalents.
Sequence CWU 1
1
13414816DNADiabrotica virgifera 1cggatttcac ggattctgcg cgtttgagac
ctttcattca tctttttgtt attgttgcgg 60aggtcaattt tttatatcgg aagacaattt
tatccaaatt tttgaaaaat ctccaattct 120gtcactgaat taggacttaa
gtggaacacc atggcgttaa agaaccaagt tggtcaaaaa 180atcatgaatg
aagtcatcaa gcacaagccc accaagaaga atgggccaac tccaggacag
240caagcccatg gggtagaatg gaggatcctt gtggtggacc agcttgccat
gaggatggtt 300tcagcatgct gtaaaatgca tgatatatca gcagaaggca
ttacattggt tgaagatatt 360atgaagaaaa gggaaccgct tggtaccatg
gaagctgtgt acttgataac accttcagaa 420aagtcagttc atgctcttat
gaatgacttt gaaccaccaa gacagatgta cagaggggca 480cacgtgtttt
ttacagaagc gtgtccagac caattattta gtaccttgtg ccaccacccc
540gtagcaaagt ttattaaaac cctaaaagaa atcaacatag cattcattcc
gactgagtca 600caggtgttct cattggattc accagacacg ttccagtgta
gctacgatcc atcattttcc 660gctgctagaa acgccaacat ggaaagaatg
gcagaacaaa ttgcgacact ctgtgcgact 720ctaggggaat acccacacgt
cagatataga actgattggg aaagaaatgt tgagctggct 780caactaattc
agcagaaatt ggacgcctat aaagccgacg aacctaccat gggagagggg
840ccggaaaagg cgagatcaca attaattatc ctcgaccgag gtttcgactg
tgtatctccc 900cttcttcacg aacttacttt ccaagcaatg gcctatgact
tactacccat agaaaatgat 960gtatataagt acgaagcatc ggctggtgtt
atgaaagaag tccttctaga cgaaaacgac 1020gagctttggg tcgatctacg
ccaccaacac atcgcggtgg tgtctcagag cgtcaccaag 1080aatctgaaga
aattcaccga ctccaaacgc atgacccaga gcgacaagca gtcgatgaag
1140gatctctcaa ccatgatcaa aaagatgccg caatatcaga aagaattgtc
caagtatgct 1200acgcatcttc atctcgctga agactgcatg aaggcctatc
aggggtatat agacaagttg 1260tgtaaagttg agcaggattt ggcaatggga
actgatgccg aaggcgagaa aatcaaggat 1320cacatgcgca acatcgtccc
catcttgcta gatcccaaaa tcaccaatga atacgataag 1380atgcgtatta
tagcattgta cgccatgacg aaaaacggca tcacagatga aaatctctcc
1440aaattggcta cccatgccca aatcaaggac aaacagacca tcgccaacct
tcagttactt 1500ggagtcaacg ttattaatga tggaggacca agaaaaaaac
aatatacagt accgcgcaaa 1560gaaagaatta cagaacaaac gtaccaaatg
tcaagatgga cacctatcat taaggatata 1620atggaggatt gcatagacga
caaactggat cagaaacact acccgtattt gagcggacga 1680gcacagtcta
cgggatacca tgcagcgccc tctagtgccc gttatggcca gtggcacaaa
1740gacagaggtc aacaagccgt gaagaacgtt cctcgactgc tcgtcttcgt
cgtgggtgga 1800atcagttttt cagagatcag gtgcgcctac gaagtgacca
acgcgcagaa gaactgggaa 1860gtcatcatcg gctcgtcgca catactcact
cccgaggact tcctaagcaa tctggcaacg 1920ttggccggct agaatcagat
gaaaaaggtt acttttaatg tacccgagta aacagtttcg 1980cagtcgtagt
ttaaaataat gtaatgagtc tttttaatcc caatttaaac atatttatat
2040agaatgactt tcgatcagta tcgaaccgtt ttctttgtta cgagagttaa
agctgttcaa 2100attatcttga aatttgtgca gaattgtcat acattaaatt
gttgcgcttc tgaaattgtt 2160gtgcaataaa agaaaatgtc taaggtgctc
aaaactcaaa gccttcgatg agtttatgat 2220tataaattga gaataaaaag
actcattgag cttaaaaagt attatttcct accctttttt 2280tgtatttttc
caatagcaga gttttttatt caatttttgc ggttattggg atattatcgc
2340tttatttaca aaattgtgta aaaggtataa aaatgacgtt tttgaggagt
cttcctgtaa 2400aattaatttc aatagtcaga gatttaccaa aaaaatattt
ttttttgttt agattttagt 2460ttcttaacat attataaaat acatcgtttt
ttttgtttta tttactgtta aagcttctat 2520attgtcttct tgaactgctg
tggcgacccc atcattgaaa acacttccaa gaacaagaac 2580acatttggct
ttttgttgta attatctttt tgggaagata tatttgagga aacagctttg
2640taattttggg tcacactagt ttttcgtttt tcattctacc cattttttgg
ttgattgttg 2700gccacactgt tctgtgtttt cggcatgaag gcatacaaac
aaaaaatgtt ccaggtgtaa 2760ctttctctgg tttttgaaaa cgtatataag
ttttctttca atagtatgaa ctatcattca 2820taaatataca tatttttgct
atcagagcat accaaatgaa gtagttctgt atttatttca 2880aacaagtaca
tttagtttat ttgttcagtt atatgtttcc atttctagta gtcttctggt
2940atctgtggct ggattttagt gtgtcaactc cagttttata acctaaccaa
acctcaccta 3000atgcaaccta acctcacata acctcaaata atataacaaa
atctctcgta gactaaccta 3060ataatgcatt ggtgtggtat gaacgattcg
gaatttgttt taattaaaga aatttttcaa 3120aaattatgta tatttatgca
aaaatcttca ttttttcttg tttacactgc tattgatatt 3180gtattcgttg
actagtctgc gtccagttgc acaaacgaca cccctaaagc tacttaacag
3240taagacgatg cttttaaatg ctttttgtgt gactggtaca tatattataa
attaagctta 3300gcgagtaatt aagaatctta tctttaaata tccagttgta
catcttacat agtgtacctc 3360ttagaatagg aaaatgtatt tttcaactgt
acctaaccaa acgcgtatag caaaaggtgt 3420agaacgtgac aaagaatagc
ataaagaagg acctgagctt gttttagtta ttcttccttc 3480aaaattagat
aatccttaaa ttaaactaga tatgtgtgct aaaaaatcat ctctggcggt
3540acagccaata gaaaagaagc tgaggaaggt ctcagatcac cgtgatcaat
tatttaagca 3600gaataatgga aaactggtcg tgagccatct aaatcttctc
tatgctatag tttaaacgta 3660ctacacctat tttcaaatca cagctttgta
ttcatgctag ctaactttgt atcatatcct 3720cagtagttta tcgtgaccta
ttttttatat atctactaaa agacaccgat agtttttcca 3780aaaaaaaaaa
cttctatttg atagaaaaat aaaaatttat cgtttacaaa ttatggtaaa
3840attatttagt tgttattatt cagcatttac aacggtacaa cgctttcttt
cagtgcagaa 3900cgagtatcaa aatcataata cgagcaaaac ttaacggagc
cccaacatat accaaccttg 3960aataacacaa aatacaacaa tttcttagat
ctggggaaaa tcgtcgaaga tttgacaatt 4020tcggccaatc agagcgccat
attgtagtca cgtgacctaa aattttccta gattccagta 4080aactggacta
ttacaggagc gataaagcat taatagcgtt atttgtgttg gctatcccga
4140agtttgattt tttatagtag tcacgatgtt tttggtcgat gaaagacttt
agacaatgat 4200tttatattcc ctactactcg ttttgccact gaatgaagca
ttttccacat tcctgttcgt 4260tttctaggaa tataagtgta aaattgactg
acaaattaca tgttttcgtt actatcatcg 4320atacatcatt ttcgtagagg
gctggatcat gcgtgggtga ttaaaataca gttgttgtac 4380gtttcttttc
gtcaccctag tcaataaagt ccttatttat gtgctagtgt ttctattatc
4440gttggtttac agcggtgtgt acatgacaag ggcgatttaa acggatctgc
gggtaaatac 4500catagacata ttatcgatag accaagctag gaatatgcca
ctcaatgcat cggggtgtaa 4560cgccaatatc aagtacggtg gtctagctat
ctttgtctgt cgtgcgagtg tgagcgtatc 4620taccaagagg tgggagtaat
ggaacgacac agacacagag gcagcggcca tcatatgcta 4680gagagagaaa
gctaagcgcc ggtagagaga gatagataga ccaccgaccc gaactgctcc
4740gcgttacgct atttttcgga cctggcctaa tctattgtgt tattatatct
atggttcaac 4800tccagtttaa ccaatg 48162593PRTDiabrotica virgifera
2Met Ala Leu Lys Asn Gln Val Gly Gln Lys Ile Met Asn Glu Val Ile1 5
10 15Lys His Lys Pro Thr Lys Lys Asn Gly Pro Thr Pro Gly Gln Gln
Ala 20 25 30His Gly Val Glu Trp Arg Ile Leu Val Val Asp Gln Leu Ala
Met Arg 35 40 45Met Val Ser Ala Cys Cys Lys Met His Asp Ile Ser Ala
Glu Gly Ile 50 55 60Thr Leu Val Glu Asp Ile Met Lys Lys Arg Glu Pro
Leu Gly Thr Met65 70 75 80Glu Ala Val Tyr Leu Ile Thr Pro Ser Glu
Lys Ser Val His Ala Leu 85 90 95Met Asn Asp Phe Glu Pro Pro Arg Gln
Met Tyr Arg Gly Ala His Val 100 105 110Phe Phe Thr Glu Ala Cys Pro
Asp Gln Leu Phe Ser Thr Leu Cys His 115 120 125His Pro Val Ala Lys
Phe Ile Lys Thr Leu Lys Glu Ile Asn Ile Ala 130 135 140Phe Ile Pro
Thr Glu Ser Gln Val Phe Ser Leu Asp Ser Pro Asp Thr145 150 155
160Phe Gln Cys Ser Tyr Asp Pro Ser Phe Ser Ala Ala Arg Asn Ala Asn
165 170 175Met Glu Arg Met Ala Glu Gln Ile Ala Thr Leu Cys Ala Thr
Leu Gly 180 185 190Glu Tyr Pro His Val Arg Tyr Arg Thr Asp Trp Glu
Arg Asn Val Glu 195 200 205Leu Ala Gln Leu Ile Gln Gln Lys Leu Asp
Ala Tyr Lys Ala Asp Glu 210 215 220Pro Thr Met Gly Glu Gly Pro Glu
Lys Ala Arg Ser Gln Leu Ile Ile225 230 235 240Leu Asp Arg Gly Phe
Asp Cys Val Ser Pro Leu Leu His Glu Leu Thr 245 250 255Phe Gln Ala
Met Ala Tyr Asp Leu Leu Pro Ile Glu Asn Asp Val Tyr 260 265 270Lys
Tyr Glu Ala Ser Ala Gly Val Met Lys Glu Val Leu Leu Asp Glu 275 280
285Asn Asp Glu Leu Trp Val Asp Leu Arg His Gln His Ile Ala Val Val
290 295 300Ser Gln Ser Val Thr Lys Asn Leu Lys Lys Phe Thr Asp Ser
Lys Arg305 310 315 320Met Thr Gln Ser Asp Lys Gln Ser Met Lys Asp
Leu Ser Thr Met Ile 325 330 335Lys Lys Met Pro Gln Tyr Gln Lys Glu
Leu Ser Lys Tyr Ala Thr His 340 345 350Leu His Leu Ala Glu Asp Cys
Met Lys Ala Tyr Gln Gly Tyr Ile Asp 355 360 365Lys Leu Cys Lys Val
Glu Gln Asp Leu Ala Met Gly Thr Asp Ala Glu 370 375 380Gly Glu Lys
Ile Lys Asp His Met Arg Asn Ile Val Pro Ile Leu Leu385 390 395
400Asp Pro Lys Ile Thr Asn Glu Tyr Asp Lys Met Arg Ile Ile Ala Leu
405 410 415Tyr Ala Met Thr Lys Asn Gly Ile Thr Asp Glu Asn Leu Ser
Lys Leu 420 425 430Ala Thr His Ala Gln Ile Lys Asp Lys Gln Thr Ile
Ala Asn Leu Gln 435 440 445Leu Leu Gly Val Asn Val Ile Asn Asp Gly
Gly Pro Arg Lys Lys Gln 450 455 460Tyr Thr Val Pro Arg Lys Glu Arg
Ile Thr Glu Gln Thr Tyr Gln Met465 470 475 480Ser Arg Trp Thr Pro
Ile Ile Lys Asp Ile Met Glu Asp Cys Ile Asp 485 490 495Asp Lys Leu
Asp Gln Lys His Tyr Pro Tyr Leu Ser Gly Arg Ala Gln 500 505 510Ser
Thr Gly Tyr His Ala Ala Pro Ser Ser Ala Arg Tyr Gly Gln Trp 515 520
525His Lys Asp Arg Gly Gln Gln Ala Val Lys Asn Val Pro Arg Leu Leu
530 535 540Val Phe Val Val Gly Gly Ile Ser Phe Ser Glu Ile Arg Cys
Ala Tyr545 550 555 560Glu Val Thr Asn Ala Gln Lys Asn Trp Glu Val
Ile Ile Gly Ser Ser 565 570 575His Ile Leu Thr Pro Glu Asp Phe Leu
Ser Asn Leu Ala Thr Leu Ala 580 585 590Gly3392DNADiabrotica
virgifera 3accatggcgt taaagaacca agttggtcaa aaaatcatga atgaagtcat
caagcacaag 60cccaccaaga agaatgggcc aactccagga cagcaagccc atggggtaga
atggaggatc 120cttgtggtgg accagcttgc catgaggatg gtttcagcat
gctgtaaaat gcatgatata 180tcagcagaag gcattacatt ggttgaagat
attatgaaga aaagggaacc gcttggtacc 240atggaagctg tgtacttgat
aacaccttca gaaaagtcag ttcatgctct tatgaatgac 300tttgaaccac
caagacagat gtacagaggg gcacacgtgt tttttacaga agcgtgtcca
360gaccaattat ttagtacctt gtgccaccac cc 3924627DNADiabrotica
virgifera 4ctcgaccgag gtttcgactg tgtatctccc cttcttcacg aacttacttt
ccaagcaatg 60gcctatgact tactacccat agaaaatgat gtatataagt acgaagcatc
ggctggtgtt 120atgaaagaag tccttctaga cgaaaacgac gagctttggg
tcgatctacg ccaccaacac 180atcgcggtgg tgtctcagag cgtcaccaag
aatctgaaga aattcaccga ctccaaacgc 240atgacccaga gcgacaagca
gtcgatgaag gatctctcaa ccatgatcaa aaagatgccg 300caatatcaga
aagaattgtc caagtatgct acgcatcttc atctcgctga agactgcatg
360aaggcctatc aggggtatat agacaagttg tgtaaagttg agcaggattt
ggcaatggga 420actgatgccg aaggcgagaa aatcaaggat cacatgcgca
acatcgtccc catcttgcta 480gatcccaaaa tcaccaatga atacgataag
atgcgtatta tagcattgta cgccatgacg 540aaaaacggca tcacagatga
aaatctctcc aaattggcta cccatgccca aatcaaggac 600aaacagacca
tcgccaacct tcagtta 627524DNAArtificial SequenceT7 phage promoter
oligonucleotide 5ttaatacgac tcactatagg gaga 246503DNAArtificial
SequencePortion of YFP coding region 6caccatgggc tccagcggcg
ccctgctgtt ccacggcaag atcccctacg tggtggagat 60ggagggcaat gtggatggcc
acaccttcag catccgcggc aagggctacg gcgatgccag 120cgtgggcaag
gtggatgccc agttcatctg caccaccggc gatgtgcccg tgccctggag
180caccctggtg accaccctga cctacggcgc ccagtgcttc gccaagtacg
gccccgagct 240gaaggatttc tacaagagct gcatgcccga tggctacgtg
caggagcgca ccatcacctt 300cgagggcgat ggcaatttca agacccgcgc
cgaggtgacc ttcgagaatg gcagcgtgta 360caatcgcgtg aagctgaatg
gccagggctt caagaaggat ggccacgtgc tgggcaagaa 420tctggagttc
aatttcaccc cccactgcct gtacatctgg ggcgatcagg ccaatcacgg
480cctgaagagc gccttcaaga tct 503746DNAArtificial SequencePCR Primer
Oligonucleotide 7ttaatacgac tcactatagg gagaaccatg gcgttaaaga accaag
46844DNAArtificial SequencePCR Primer Oligonucleotide 8ttaatacgac
tcactatagg gagagggtgg tggcacaagg tact 44942DNAArtificial
SequencePCR Primer Oligonucleotide 9ttaatacgac tcactatagg
gagactcgac cgaggtttcg ac 421046DNAArtificial SequencePCR Primer
Oligonucleotide 10ttaatacgac tcactatagg gagataactg aaggttggcg
atggtc 461147DNAArtificial SequencePCR Primer Oligonucleotide
11ttaatacgac tcactatagg gagacaccat gggctccagc ggcgccc
471247DNAArtificial SequencePCR Primer Oligonucleotide 12ttaatacgac
tcactatagg gagaagatct tgaaggcgct cttcagg 4713645DNAArtificial
SequenceROP hairpin forming sequence 13tcagcatgct gtaaaatgca
tgatatatca gcagaaggca ttacattggt tgaagatatt 60atgaagaaaa gggaaccgct
tggtaccatg gaagctgtgt acttgataac accttcagaa 120aagtcagttc
atgctcttat gaatgacttt gaaccaccaa gacagatgta cagaggggca
180cacgtgtttt ttacagaagc gtgtccagac gactagtacc ggttgggaaa
ggtatgtttc 240tgcttctacc tttgatatat atataataat tatcactaat
tagtagtaat atagtatttc 300aagtattttt ttcaaaataa aagaatgtag
tatatagcta ttgcttttct gtagtttata 360agtgtgtata ttttaattta
taacttttct aatatatgac caaaacatgg tgatgtgcag 420gttgatccgc
ggttagtctg gacacgcttc tgtaaaaaac acgtgtgccc ctctgtacat
480ctgtcttggt ggttcaaagt cattcataag agcatgaact gacttttctg
aaggtgttat 540caagtacaca gcttccatgg taccaagcgg ttcccttttc
ttcataatat cttcaaccaa 600tgtaatgcct tctgctgata tatcatgcat
tttacagcat gctga 64514607DNAArtificial SequenceROP hairpin forming
sequence 14caagtatgct acgcatcttc atctcgctga agactgcatg aaggcctatc
aggggtatat 60agacaagttg tgtaaagttg agcaggattt ggcaatggga actgatgccg
aaggcgagaa 120aatcaaggat cacatgcgca acatcgtccc catcttgcta
gatcccaaaa tcaccaatga 180atacgataag agactagtac cggttgggaa
aggtatgttt ctgcttctac ctttgatata 240tatataataa ttatcactaa
ttagtagtaa tatagtattt caagtatttt tttcaaaata 300aaagaatgta
gtatatagct attgcttttc tgtagtttat aagtgtgtat attttaattt
360ataacttttc taatatatga ccaaaacatg gtgatgtgca ggttgatccg
cggttatctt 420atcgtattca ttggtgattt tgggatctag caagatgggg
acgatgttgc gcatgtgatc 480cttgattttc tcgccttcgg catcagttcc
cattgccaaa tcctgctcaa ctttacacaa 540cttgtctata tacccctgat
aggccttcat gcagtcttca gcgagatgaa gatgcgtagc 600atacttg
60715471DNAArtificial SequenceYFP hairpin forming sequence
15atgtcatctg gagcacttct ctttcatggg aagattcctt acgttgtgga gatggaaggg
60aatgttgatg gccacacctt tagcatacgt gggaaaggct acggagatgc ctcagtggga
120aaggactagt accggttggg aaaggtatgt ttctgcttct acctttgata
tatatataat 180aattatcact aattagtagt aatatagtat ttcaagtatt
tttttcaaaa taaaagaatg 240tagtatatag ctattgcttt tctgtagttt
ataagtgtgt atattttaat ttataacttt 300tctaatatat gaccaaaaca
tggtgatgtg caggttgatc cgcggttact ttcccactga 360ggcatctccg
tagcctttcc cacgtatgct aaaggtgtgg ccatcaacat tcccttccat
420ctccacaacg taaggaatct tcccatgaaa gagaagtgct ccagatgaca t
47116225DNASolanum tuberosum 16gactagtacc ggttgggaaa ggtatgtttc
tgcttctacc tttgatatat atataataat 60tatcactaat tagtagtaat atagtatttc
aagtattttt ttcaaaataa aagaatgtag 120tatatagcta ttgcttttct
gtagtttata agtgtgtata ttttaattta taacttttct 180aatatatgac
caaaacatgg tgatgtgcag gttgatccgc ggtta 22517702DNAArtificial
SequencePlant-optimized sequence encoding YFP 17atgtcatctg
gagcacttct ctttcatggg aagattcctt acgttgtgga gatggaaggg 60aatgttgatg
gccacacctt tagcatacgt gggaaaggct acggagatgc ctcagtggga
120aaggttgatg cacagttcat ctgcacaact ggtgatgttc ctgtgccttg
gagcacactt 180gtcaccactc tcacctatgg agcacagtgc tttgccaagt
atggtccaga gttgaaggac 240ttctacaagt cctgtatgcc agatggctat
gtgcaagagc gcacaatcac ctttgaagga 300gatggcaact tcaagactag
ggctgaagtc acctttgaga atgggtctgt ctacaatagg 360gtcaaactca
atggtcaagg cttcaagaaa gatggtcatg tgttgggaaa gaacttggag
420ttcaacttca ctccccactg cctctacatc tggggtgacc aagccaacca
cggtctcaag 480tcagccttca agatctgtca tgagattact ggcagcaaag
gcgacttcat agtggctgac 540cacacccaga tgaacactcc cattggtgga
ggtccagttc atgttccaga gtatcatcac 600atgtcttacc atgtgaaact
ttccaaagat gtgacagacc acagagacaa catgtccttg 660aaagaaactg
tcagagctgt tgactgtcgc aagacctacc tt 70218218DNADiabrotica virgifera
18tagctctgat gacagagccc atcgagtttc aagccaaaca gttgcataaa gctatcagcg
60gattgggaac tgatgaaagt acaatmgtmg aaattttaag tgtmcacaac aacgatgaga
120ttataagaat ttcccaggcc tatgaaggat tgtaccaacg mtcattggaa
tctgatatca 180aaggagatac ctcaggaaca ttaaaaaaga attattag
21819424DNADiabrotica virgiferamisc_feature(393)..(395)n is a, c,
g, or t 19ttgttacaag ctggagaact tctctttgct ggaaccgaag agtcagtatt
taatgctgta 60ttctgtcaaa gaaataaacc acaattgaat ttgatattcg acaaatatga
agaaattgtt 120gggcatccca ttgaaaaagc cattgaaaac gagttttcag
gaaatgctaa acaagccatg 180ttacacctta tccagagcgt aagagatcaa
gttgcatatt tggtaaccag gctgcatgat 240tcaatggcag gcgtcggtac
tgacgataga actttaatca gaattgttgt ttcgagatct 300gaaatcgatc
tagaggaaat caaacaatgc tatgaagaaa tctacagtaa aaccttggct
360gataggatag cggatgacac atctggcgac tannnaaaag ccttattagc
cgttgttggt 420taag 42420397DNADiabrotica virgifera 20agatgttggc
tgcatctaga gaattacaca agttcttcca tgattgcaag gatgtactga 60gcagaatagt
ggaaaaacag
gtatccatgt ctgatgaatt gggaagggac gcaggagctg 120tcaatgccct
tcaacgcaaa caccagaact tcctccaaga cctacaaaca ctccaatcga
180acgtccaaca aatccaagaa gaatcagcta aacttcaagc tagctatgcc
ggtgatagag 240ctaaagaaat caccaacagg gagcaggaag tggtagcagc
ctgggcagcc ttgcagatcg 300cttgcgatca gagacacgga aaattgagcg
atactggtga tctattcaaa ttctttaact 360tggtacgaac gttgatgcag
tggatggacg aatggac 39721490DNADiabrotica virgifera 21gcagatgaac
accagcgaga aaccaagaga tgttagtggt gttgaattgt tgatgaacaa 60ccatcagaca
ctcaaggctg agatcgaagc cagagaagac aactttacgg cttgtatttc
120tttaggaaag gaattgttga gccgtaatca ctatgctagt gctgatatta
aggataaatt 180ggtcgcgttg acgaatcaaa ggaatgctgt actacagagg
tgggaagaaa gatgggagaa 240cttgcaactc atcctcgagg tataccaatt
cgccagagat gcggccgtcg ccgaagcatg 300gttgatcgca caagaacctt
acttgatgag ccaagaacta ggacacacca ttgacgacgt 360tgaaaacttg
ataaagaaac acgaagcgtt cgaaaaatcg gcagcggcgc aagaagagag
420attcagtgct ttggagagac tgacgacgtt cgaattgaga gaaataaaga
ggaaacaaga 480agctgcccag 49022330DNADiabrotica virgifera
22agtgaaatgt tagcaaatat aacatccaag tttcgtaatt gtacttgctc agttagaaaa
60tattctgtag tttcactatc ttcaaccgaa aatagaataa atgtagaacc tcgcgaactt
120gcctttcctc caaaatatca agaacctcga caagtttggt tggagagttt
agatacgata 180gacgacaaaa aattgggtat tcttgagctg catcctgatg
tttttgctac taatccaaga 240atagatatta tacatcaaaa tgttagatgg
caaagtttat atagatatgt aagctatgct 300catacaaagt caagatttga
agtgagaggt 33023320DNADiabrotica virgifera 23caaagtcaag atttgaagtg
agaggtggag gtcgaaaacc gtggccgcaa aagggattgg 60gacgtgctcg acatggttca
attagaagtc cactttggag aggtggagga gttgttcatg 120gaccaaaatc
tccaacccct catttttaca tgattccatt ctacacccgt ttgctgggtt
180tgactagcgc actttcagta aaatttgccc aagatgactt gcacgttgtg
gatagtctag 240atctgccaac tgacgaacaa agttatatag aagagctggt
caaaagccgc ttttgggggt 300ccttcttgtt ttatttgtag 3202446DNAArtificial
SequencePCR Primer Oligonucleotide 24ttaatacgac tcactatagg
gagagctcca acagtggttc cttatc 462529DNAArtificial SequencePCR Primer
Oligonucleotide 25ctaataattc ttttttaatg ttcctgagg
292622DNAArtificial SequencePCR Primer Oligonucleotide 26gctccaacag
tggttcctta tc 222753DNAArtificial SequencePCR Primer
Oligonucleotide 27ttaatacgac tcactatagg gagactaata attctttttt
aatgttcctg agg 532848DNAArtificial SequencePCR Primer
Oligonucleotide 28ttaatacgac tcactatagg gagattgtta caagctggag
aacttctc 482924DNAArtificial SequencePCR Primer Oligonucleotide
29cttaaccaac aacggctaat aagg 243024DNAArtificial SequencePCR Primer
Oligonucleotide 30ttgttacaag ctggagaact tctc 243148DNAArtificial
SequencePCR Primer Oligonucleotide 31ttaatacgac tcactatagg
gagacttaac caacaacggc taataagg 483247DNAArtificial SequencePCR
Primer Oligonucleotide 32ttaatacgac tcactatagg gagaagatgt
tggctgcatc tagagaa 473322DNAArtificial SequencePCR Primer
Oligonucleotide 33gtccattcgt ccatccactg ca 223423DNAArtificial
SequencePCR Primer Oligonucleotide 34agatgttggc tgcatctaga gaa
233546DNAArtificial SequencePCR Primer Oligonucleotide 35ttaatacgac
tcactatagg gagagtccat tcgtccatcc actgca 463646DNAArtificial
SequencePCR Primer Oligonucleotide 36ttaatacgac tcactatagg
gagagcagat gaacaccagc gagaaa 463722DNAArtificial SequencePCR Primer
Oligonucleotide 37ctgggcagct tcttgtttcc tc 223822DNAArtificial
SequencePCR Primer Oligonucleotide 38gcagatgaac accagcgaga aa
223946DNAArtificial SequencePCR Primer Oligonucleotide 39ttaatacgac
tcactatagg gagactgggc agcttcttgt ttcctc 464051DNAArtificial
SequencePCR Primer Oligonucleotide 40ttaatacgac tcactatagg
gagaagtgaa atgttagcaa atataacatc c 514126DNAArtificial SequencePCR
Primer Oligonucleotide 41acctctcact tcaaatcttg actttg
264227DNAArtificial SequencePCR Primer Oligonucleotide 42agtgaaatgt
tagcaaatat aacatcc 274350DNAArtificial SequencePCR Primer
Oligonucleotide 43ttaatacgac tcactatagg gagaacctct cacttcaaat
cttgactttg 504450DNAArtificial SequencePCR Primer Oligonucleotide
44ttaatacgac tcactatagg gagacaaagt caagatttga agtgagaggt
504525DNAArtificial SequencePCR Primer Oligonucleotide 45ctacaaataa
aacaagaagg acccc 254626DNAArtificial SequencePCR Primer
Oligonucleotide 46caaagtcaag atttgaagtg agaggt 264749DNAArtificial
SequencePCR Primer Oligonucleotide 47ttaatacgac tcactatagg
gagactacaa ataaaacaag aaggacccc 49481150DNAZea mays 48caacggggca
gcactgcact gcactgcaac tgcgaatttc cgtcagcttg gagcggtcca 60agcgccctgc
gaagcaaact acgccgatgg cttcggcggc ggcgtgggag ggtccgacgg
120ccgcggagct gaagacagcg ggggcggagg tgattcccgg cggcgtgcga
gtgaaggggt 180gggtcatcca gtcccacaaa ggccctatcc tcaacgccgc
ctctctgcaa cgctttgaag 240atgaacttca aacaacacat ttacctgaga
tggtttttgg agagagtttc ttgtcacttc 300aacatacaca aactggcatc
aaatttcatt ttaatgcgct tgatgcactc aaggcatgga 360agaaagaggc
actgccacct gttgaggttc ctgctgcagc aaaatggaag ttcagaagta
420agccttctga ccaggttata cttgactacg actatacatt tacgacacca
tattgtggga 480gtgatgctgt ggttgtgaac tctggcactc cacaaacaag
tttagatgga tgcggcactt 540tgtgttggga ggatactaat gatcggattg
acattgttgc cctttcagca aaagaaccca 600ttcttttcta cgacgaggtt
atcttgtatg aagatgagtt agctgacaat ggtatctcat 660ttcttactgt
gcgagtgagg gtaatgccaa ctggttggtt tctgcttttg cgtttttggc
720ttagagttga tggtgtactg atgaggttga gagacactcg gttacattgc
ctgtttggaa 780acggcgacgg agccaagcca gtggtacttc gtgagtgctg
ctggagggaa gcaacatttg 840ctactttgtc tgcgaaagga tatccttcgg
actctgcagc gtacgcggac ccgaacctta 900ttgcccataa gcttcctatt
gtgacgcaga agacccaaaa gctgaaaaat cctacctgac 960tgacacaaag
gcgccctacc gcgtgtacat catgactgtc ctgtcctatc gttgcctttt
1020gtgtttgcca catgttgtgg atgtacgttt ctatgacgaa acaccatagt
ccatttcgcc 1080tgggccgaac agagatagct gattgtcatg tcacgtttga
attagaccat tccttagccc 1140tttttccccc 11504922DNAArtificial
SequenceT20NV Oligonucleotidemisc_feature(22)..(22)n is a, c, g, or
t 49tttttttttt tttttttttt vn 225020DNAArtificial SequenceP5U76A (F)
PCR Primer Oligonucleotide 50ttgtgatgtt ggtggcgtat
205124DNAArtificial SequenceP5U76A (R) PCR Primer Oligonucleotide
51tgttaaataa aaccccaaag atcg 245221DNAArtificial SequenceTIPmxF PCR
Primer Oligonucleotide 52tgagggtaat gccaactggt t
215324DNAArtificial SequenceTIPmxR PCR Primer Oligonucleotide
53gcaatgtaac cgagtgtctc tcaa 245432DNAArtificial SequenceProbeHXTIP
Probe oligonucleotide 54tttttggctt agagttgatg gtgtactgat ga
3255151DNAArtificial SequencePortion of SpecR coding region
55gaccgtaagg cttgatgaaa caacgcggcg agctttgatc aacgaccttt tggaaacttc
60ggcttcccct ggagagagcg agattctccg cgctgtagaa gtcaccattg ttgtgcacga
120cgacatcatt ccgtggcgtt atccagctaa g 1515669DNAArtificial
SequencePortion of AAD1 coding region 56tgttcggttc cctctaccaa
gcacagaacc gtcgcttcag caacacctca gtcaaggtga 60tggatgttg
69574233DNAZea mays 57agcctggtgt ttccggagga gacagacatg atccctgccg
ttgctgatcc gacgacgctg 60gacggcgggg gcgcgcgcag gccgttgctc ccggagacgg
accctcgggg gcgtgctgcc 120gccggcgccg agcagaagcg gccgccggct
acgccgaccg ttctcaccgc cgtcgtctcc 180gccgtgctcc tgctcgtcct
cgtggcggtc acagtcctcg cgtcgcagca cgtcgacggg 240caggctgggg
gcgttcccgc gggcgaagat gccgtcgtcg tcgaggtggc cgcctcccgt
300ggcgtggctg agggcgtgtc ggagaagtcc acggccccgc tcctcggctc
cggcgcgctc 360caggacttct cctggaccaa cgcgatgctg gcgtggcagc
gcacggcgtt ccacttccag 420ccccccaaga actggatgaa cggttagttg
gacccgtcgc catcggtgac gacgcgcgga 480tcgttttttt cttttttcct
ctcgttctgg ctctaacttg gttccgcgtt tctgtcacgg 540acgcctcgtg
cacatggcga tacccgatcc gccggccgcg tatatctatc tacctcgacc
600ggcttctcca gatccgaacg gtaagttgtt ggctccgata cgatcgatca
catgtgagct 660cggcatgctg cttttctgcg cgtgcatgcg gctcctagca
ttccacgtcc acgggtcgtg 720acatcaatgc acgatataat cgtatcggta
cagagatatt gtcccatcag ctgctagctt 780tcgcgtattg atgtcgtgac
attttgcacg caggtccgct gtatcacaag ggctggtacc 840acctcttcta
ccagtggaac ccggactccg cggtatgggg caacatcacc tggggccacg
900ccgtctcgcg cgacctcctc cactggctgc acctaccgct ggccatggtg
cccgatcacc 960cgtacgacgc caacggcgtc tggtccgggt cggcgacgcg
cctgcccgac ggccggatcg 1020tcatgctcta cacgggctcc acggcggagt
cgtcggcgca ggtgcagaac ctcgcggagc 1080cggccgacgc gtccgacccg
ctgctgcggg agtgggtcaa gtcggacgcc aacccggtgc 1140tggtgccgcc
gccgggcatc gggccgacgg acttccgcga cccgacgacg gcgtgtcgga
1200cgccggccgg caacgacacg gcgtggcggg tcgccatcgg gtccaaggac
cgggaccacg 1260cggggctggc gctggtgtac cggacggagg acttcgtgcg
gtacgacccg gcgccggcgc 1320tgatgcacgc cgtgccgggc accggcatgt
gggagtgcgt ggacttctac ccggtggccg 1380cgggatcagg cgccgcggcg
ggcagcgggg acgggctgga gacgtccgcg gcgccgggac 1440ccggggtgaa
gcacgtgctc aaggctagcc tcgacgacga caagcacgac tactacgcga
1500tcggcaccta cgacccggcg acggacacct ggacccccga cagcgcggag
gacgacgtcg 1560ggatcggcct ccggtacgac tatggcaagt actacgcgtc
gaagaccttc tacgaccccg 1620tccttcgccg gcgggtgctc tgggggtggg
tcggcgagac cgacagcgag cgcgcggaca 1680tcctcaaggg ctgggcatcc
gtgcaggtac gtctcagggt ttgaggctag catggcttca 1740atcttgctgg
catcgaatca ttaatgggca gatattataa cttgataatc tgggttggtt
1800gtgtgtggtg gggatggtga cacacgcgcg gtaataatgt agctaagctg
gttaaggatg 1860agtaatgggg ttgcgtataa acgacagctc tgctaccatt
acttctgaca cccgattgaa 1920ggagacaaca gtaggggtag ccggtagggt
tcgtcgactt gccttttctt ttttcctttg 1980ttttgttgtg gatcgtccaa
cacaaggaaa ataggatcat ccaacaaaca tggaagtaat 2040cccgtaaaac
atttctcaag gaaccatcta gctagacgag cgtggcatga tccatgcatg
2100cacaaacact agataggtct ctgcagctgt gatgttcctt tacatatacc
accgtccaaa 2160ctgaatccgg tctgaaaatt gttcaagcag agaggccccg
atcctcacac ctgtacacgt 2220ccctgtacgc gccgtcgtgg tctcccgtga
tcctgccccg tcccctccac gcggccacgc 2280ctgctgcagc gctctgtaca
agcgtgcacc acgtgagaat ttccgtctac tcgagcctag 2340tagttagacg
ggaaaacgag aggaagcgca cggtccaagc acaacacttt gcgcgggccc
2400gtgacttgtc tccggttggc tgagggcgcg cgacagagat gtatggcgcc
gcggcgtgtc 2460ttgtgtcttg tcttgcctat acaccgtagt cagagactgt
gtcaaagccg tccaacgaca 2520atgagctagg aaacgggttg gagagctggg
ttcttgcctt gcctcctgtg atgtctttgc 2580cttgcatagg gggcgcagta
tgtagctttg cgttttactt cacgccaaag gatactgctg 2640atcgtgaatt
attattatta tatatatatc gaatatcgat ttcgtcgctc tcgtggggtt
2700ttattttcca gactcaaact tttcaaaagg cctgtgtttt agttcttttc
ttccaattga 2760gtaggcaagg cgtgtgagtg tgaccaacgc atgcatggat
atcgtggtag actggtagag 2820ctgtcgttac cagcgcgatg cttgtatatg
tttgcagtat tttcaaatga atgtctcagc 2880tagcgtacag ttgaccaagt
cgacgtggag ggcgcacaac agacctctga cattattcac 2940ttttttttta
ccatgccgtg cacgtgcagt caatccccag gacggtcctc ctggacacga
3000agacgggcag caacctgctc cagtggccgg tggtggaggt ggagaacctc
cggatgagcg 3060gcaagagctt cgacggcgtc gcgctggacc gcggatccgt
cgtgcccctc gacgtcggca 3120aggcgacgca ggtgacgccg cacgcagcct
gctgcagcga acgaactcgc gcgttgccgg 3180cccgcggcca gctgacttag
tttctctggc tgatcgaccg tgtgcctgcg tgcgtgcagt 3240tggacatcga
ggctgtgttc gaggtggacg cgtcggacgc ggcgggcgtc acggaggccg
3300acgtgacgtt caactgcagc accagcgcag gcgcggcggg ccggggcctg
ctcggcccgt 3360tcggccttct cgtgctggcg gacgacgact tgtccgagca
gaccgccgtg tacttctacc 3420tgctcaaggg cacggacggc agcctccaaa
ctttcttctg ccaagacgag ctcaggtatg 3480tatgttatga cttatgacca
tgcatgcatg cgcatttctt agctaggctg tgaagcttct 3540tgttgagttg
tttcacagat gcttaccgtc tgctttgttt cgtatttcga ctaggcatcc
3600aaggcgaacg atctggttaa gagagtatac gggagcttgg tccctgtgct
agatggggag 3660aatctctcgg tcagaatact ggtaagtttt tacagcgcca
gccatgcatg tgttggccag 3720ccagctgctg gtactttgga cactcgttct
tctcgcactg ctcattattg cttctgatct 3780ggatgcacta caaattgaag
gttgaccact ccatcgtgga gagctttgct caaggcggga 3840ggacgtgcat
cacgtcgcga gtgtacccca cacgagccat ctacgactcc gcccgcgtct
3900tcctcttcaa caacgccaca catgctcacg tcaaagcaaa atccgtcaag
atctggcagc 3960tcaactccgc ctacatccgg ccatatccgg caacgacgac
ttctctatga ctaaattaag 4020tgacggacag ataggcgata ttgcatactt
gcatcatgaa ctcatttgta caacagtgat 4080tgtttaattt atttgctgcc
ttccttatcc ttcttgtgaa actatatggt acacacatgt 4140atcattaggt
ctagtagtgt tgttgcaaag acacttagac accagaggtt ccaggagtat
4200cagagataag gtataagagg gagcagggag cag 42335825DNAArtificial
SequenceST-LS- F PCR Primer Oligonucleotide 58gtatgtttct gcttctacct
ttgat 255929DNAArtificial SequenceST-LS1- R PCR Primer
Oligonucleotide 59ccatgttttg gtcatatatt agaaaagtt
296034DNAArtificial SequenceST-LS1-P Probe Oligonucleotide
60agtaatatag tatttcaagt atttttttca aaat 346120DNAArtificial
SequenceGAAD1-F PCR Primer Oligonucleotide 61tgttcggttc cctctaccaa
206222DNAArtificial SequenceGAAD1-R PCR Primer Oligonucleotide
62caacatccat caccttgact ga 226324DNAArtificial SequenceGAAD1-P
Probe Oligonucleotide 63cacagaaccg tcgcttcagc aaca
246418DNAArtificial SequenceIVR1-F PCR Primer Oligonucleotide
64tggcggacga cgacttgt 186519DNAArtificial SequenceIVR1-R PCR Primer
Oligonucleotide 65aaagtttgga ggctgccgt 196626DNAArtificial
SequenceIVR1-P Probe Oligonucleotide 66cgagcagacc gccgtgtact tctacc
266719DNAArtificial SequenceSPC1A PCR Primer Oligonucleotide
67cttagctgga taacgccac 196819DNAArtificial SequenceSPC1S PCR Primer
Oligonucleotide 68gaccgtaagg cttgatgaa 196921DNAArtificial
SequenceTQSPEC Probe Oligonucleotide 69cgagattctc cgcgctgtag a
2170393DNADiabrotica virgifera 70catcgattgc ttgtcgcctt ggctcatgcg
tttcgattcg gtgaatttct ttaagttctg 60agttacttgt gtcgaaacga cggcgatatg
ctgatgacgc aattccaccc acaattcgtc 120gttttcgtcc agcagcacct
ccttgtcgtt ggcattcggt gccggcacaa acttgtaaac 180atcgttgacg
atgggcaaca gatcgtaggc catcgcttgt agtgtcagct cgtgtagcag
240cggcgtgaca cagtcaaagc ctcgatccaa aattaacagt tgagaacggg
ccttttcggg 300tccttcgccc attgttggct catccgcttt ataagcatcc
aatttctgtt gaatcaattg 360ggccaattca acatttcgat cccaatcgct tcg
39371240DNADiabrotica virgifera 71taaagcgtcg cgactcagtg gcgacgcaaa
gttcaaatgc acggcgctgt agagctctgc 60ggcgcagtcg gcgacgatgc gctcaatgtt
cgcagctgtc ggttcgacaa agtagatcgc 120agggacgtct gggatcgcgt
cgcgctcggc gtcaatgagc atgtggagcg tcacgccctt 180gcgccggagc
tcgtggagct tgaggatcgg cgagatgatg tcgcggcaga acttgtcgta
24072287DNADiabrotica virgifera 72gcgcgactct ctatcgccga gcaggatgcc
gtcaacgcac tcgtttacct cggcgtacgt 60atcactcgtg gaccgaatga cagggacatc
aagcgtaaga tcaagcaaaa gcccgctcag 120gacgaagaat atgacctgtc
gcgatataag ccgttgttgc gtacaatggt cgaggaacat 180gtgtctggca
aactcgacga aacactcttt ccctatgtga aggactctcc tctcgcagga
240gcgtctgctt cccccaaggt ggccgccccg cccccaacga cctctct
28773216DNADiabrotica virgifera 73gttttctcgg agtcaatatc gtatcagatg
gcaacagaaa gaagacatac accgtaccac 60gaaaggagcg catcaccgaa cacacttatc
aaatgtccag atggactccg gtcatcaaag 120acataatgga agattgcatt
gaagacaaac tggatgctcg acatttcccg ttcttggctg 180gacgcgccca
aagtactgcc tatcacgcac cgacaa 21674215DNADiabrotica virgifera
74tctccaggac gttcacaaat cctgacggat cgaagatctc cgttccgccg tatgatactc
60ttttacctgt acgcttcgcc cattcctcca agttgccata ttcaacatat cctgcgcctc
120ctacaacaaa cactgtcgac tctccgaacg ccatacgccg tggtcgccct
tgcgcgcctg 180cgcccgcacc ggaatagccc gcatttggat tgcgt
21575292DNADiabrotica virgifera 75cccggtactc ctcgtaatct cagcagcatc
ggccttgtat ttgttgagct cggcatcgat 60gtcctcggca acctctggga acggattcgc
actgttcttt gcccaaaaga agtcttttgc 120atcaaggtcg taccccttct
tcttgccatc aggaccagct actgttacgc ggttaagctt 180caacgtgagg
cagtcggaaa cgagggactg ataggtccag ccatgagaga tcatgggtac
240aaggtcaccg ttgcgatcga caagtaggag aagaggacgt tgtaggttag at
292762105DNADiabrotica virgifera 76tttttttttt taaatttaaa taaatattta
tttataaaaa taataatata tactataact 60cctgacccaa taaagcaagc tgttgtagaa
attgtttagc gttgttaaat gttgttgaac 120cataagatat cctctttgcg
ttacccgccg ttgtctttac tttcgcataa tcaactagat 180tttgatattc
aatataattt ccacctccaa caacaaaaac tatagcctct tggaatgccg
240atcgatttct gggaatttca gttaatttca gttgttttgg atctaaataa
aaatactcct 300ccatttctga actattttta aattccatga gattatcaac
tattttcgtt acgggaagat 360tatgtctctt aattactaaa tttttaactc
cttccattac aaagtttgaa ccttgtgata 420ccaacttgga aaacatatta
acagttttgg
ttccggcacc ttcatattga ttccctatcc 480cacttgccat tttagtatag
ctcttccatc ttttgatata cagcagtggt gataaatcac 540agccagcctc
ggttaaggcg ttttcatatt tgtgtaaatc gtgatccgag atatgagggg
600tacaaataaa atatattata aatagccgca atttatcttc aggtgtcccc
gctgtaggat 660ctgctaatat atccattagc agtttttcca ggccttgtgc
tttgctcatt attttctcct 720ctaattcaaa gaacgtgtct aattttctag
atttaatgca gttaagcaaa gatgtagcta 780cagaagtatg catgtcaatc
aggcgtttct tttctaataa ttgtggcaag gaattgacag 840ccgacgttat
cttagctgta ttatcagaca ccatcgtcaa agcgatatca ttttcgttat
900cgattcccat tgaacttttt agtttcttca cttccccctc tgacgatttg
tactgttcta 960actcctcctg aattgcctcg gccacggtgg gaaaaggaga
acctttgtgt gtagaccaaa 1020atttatcttt agaatccaac tcacaagatc
gactcttggc tcttgctcct ccagttggca 1080ccgactcttc aatagtaacg
cggtttagag ccaaatctaa cagatcatga gcaagtgcct 1140gataagtcca
tgtgtgatgt agcgatgttg ccatatctac gtttctatct aaaataatca
1200atagaggcct ctggaaatta aaattgccgg actgtgcgtc cgaaacaaac
aaattgtttc 1260tagtatcaaa aatattttct cgaagcttct tgtccagttt
tttggctacc atttcggctg 1320cgtttccttt aggacttcga attattggca
cagttcctaa agttacaaag actgaaaaca 1380agctgtccac tatgttgttc
ataatagcct ccatttctga atcttttata tcacctttgt 1440ttatactgta
atatgacata atatcactgt tttggtgttt taggacaaat aaatcatctt
1500ccaatgaaat gaagtttatg tattgatcat aaaccttatg aatatttgct
acgctgtttg 1560cagctattgc tgctgaagct agatcctcta atttatctct
agatatcgga gaaataaaat 1620ttaagtggta tatgtcatat gttcctcttt
ggaaatcttg acttatccta tctaaattat 1680cttctgtggc agcacaaaaa
tatattgcag gaacctctgg tattggatct ctatccgaat 1740gtaactgaac
aaacaatgta acgccttgtt ctctcaattc tttcacagaa attaagggcg
1800atataatgtc ttgccctatt ctgtcgtaaa ttaatacttt ccatacaggt
tcagaggctg 1860ataacttagt ctggggttga tttaaattta acatttgctt
tatagcattg atttgtttct 1920gtcttaaaga cgtcatagtt gaattaaagt
ttctggaaaa agttaaaaca aattaattat 1980atgtttaata tttaatatta
aaatacgtgg acttagaaac ccattcgaaa tctgtgagct 2040gtcaccgctc
ttcttaatgt caatgacgtt ctgtttcgac ttgtggaagt cttgttttgt 2100tttgg
210577315DNADiabrotica virgifera 77ctgcacggta tagtggacga ttcggatgtt
cgaaatcttt catcaacgct cgaacagact 60cctccgacgg agtgatcaaa taaacggcat
ccatggtcgg caagggttca cgttttttgt 120ggatgtcttc gaccaaagtt
atgccctcgg cgctgatgtc atgcatttta cagcacgcgg 180ataccatacg
catagccagc ttatccacta caagaatacg ccattcaaca gttggcgctt
240tgccagtagc tggcttcttc gtagctggac ccttgtagcg gatcaattaa
ttcataattt 300ttttgaccga cttgc 31578212DNADiabrotica virgifera
78cggagagacg aaatagaccg ccggtacgtc ttgcagtggt gggcgattcg aatgtagttg
60tacatggagc gtcgcaccag catctcgcaa gtcttgcacg cggagaactg ttgcaagtac
120atcctgagtt tgcgcatcga ggacgaggac cttccacaca agcggccctg
tctgtactgg 180cgtgctgcct cccgcttgcg cgcctgcttt cg
21279267DNADiabrotica virgifera 79cgccgccacc ggagagcgcc gcccggtgga
gaaccaatct tgcgagggga gaggtggcac 60gcgagtacga gagcgcggag agcgattatg
tgagcaggca ccttgctttt gctgtgcaaa 120aggtattgga agattacaaa
cggaataact ccgacttccc taaaaaatca gaccgtggtc 180gggctactct
aatcatcacg gaccgggcct tcgacatgtt cgctcctttg cttcacgaat
240tcacgtacca agcgatgtgc aatgacc 26780259DNADiabrotica virgifera
80gtgtaattaa ggactttgac ttccgacagc agtatgctgc ggcacacctg ttcttcatcg
60aagccctacc tgaacaatta cttgagaagc tattttcgtc gtccgcagag ccatacttga
120agggggtgaa agaactattc ctgaactact gggcaattga ggcacaagca
ttcactctcc 180gtaaccctgc catgtttttc agcatgtatg cgcctccaaa
gacagagaat gagttccgtt 240ctgctagaga caggctgga 25981317DNADiabrotica
virgifera 81tgtcctcaac aagatgcttc ggagtctttc cctcggcagt taggcctgtc
gcgcaacatt 60gttcgacgtt tgcaacggta ggaagcttgt ccttctcaaa tatgctcatg
cactgctccg 120ccatattaag atgaagagag aacttttcgc gcatctcctg
atattgcggt agatttgcga 180gcatgtcctt catatcgttc aaacttgccg
caccctctcc cttgaatcca gcattttctt 240ctaagaactt gttgaagtct
gccataagct tgtcgatcgc ctctcgcata tgcatgtgcc 300gaacttcggt ccaaacg
31782867DNADiabrotica virgifera 82caaaactcgg caacccctgc ccgagctcga
ttgtatatac tttctcacac cgaagaaaga 60atcagtggag cagcttatac aggatttcaa
atctgagaag aagcccactt acagatcagt 120ccatatattt tggtcgacga
gcatagctgc cgcccccgaa ttaatggagt tgattggatc 180ttgctccccc
ctcttgactc gcatcaaatc gtttgtcgat ttcaatcttc actttcgagc
240gtttgagagt cgagtgttcc atttggatct ccccttggcg ttaaggcaac
tgctgacaaa 300aaatgtgaag ctagacgaga gtttactcag actgatcgcg
gccagactcg ccacagtctg 360tatcaccatg ggtgagacac ctagcatacg
attcctcggc gacggaccac acgccgctct 420caatcgtaag gttgcacagt
acgttcaaga atactttgac agcgtcaaag tcaccggact 480caatcgaagc
aaatcagagc tgattataat cgaccgttcc atcgatgtat gcgtcatgct
540agtgcatgag tatacttatc aagccctggc ttacgacgtc ctcgaaatac
cgatctgtgt 600gccacccggc caaaaactct tgtcaaacgg agaacagcga
atggaagaca cgtattcttt 660cgtcgatccg aagaagggga acaagatgtt
tcttttgtct gaacaagacg agctgtatgt 720tagatacagg cacaagcata
ttgcctcagt aatcaccggc gtcaatgacg aactgaaaaa 780attctcaaaa
gacaacgctg ctgcgcagta caacaccaag ggggccacta aggcagaagg
840tggtgtggat gtggctcagg ccattcg 86783944DNADiabrotica virgifera
83ccagctttga attcagcgcg gatgacgaat tctggcgaag ccatcaaggg gcactttatc
60cggaggtggg cgcagacaca actagactag tcaacgaatt tcgtggtaaa cttgaattct
120tgaatagcgg ctcagcgact gacactgtga gaaacgcgct ggagatggct
ccgcacgtgc 180tagcgcaaaa gaaggcactc gatatgcaca caataattgc
tcaagcgttg tacgacgaat 240tagagaaacg atcgattcct gaatactgtc
atattgaaag cgacttgtta gacaatgtcg 300cctcgtcgag gggggttaac
tttcaggccg ttcgagatat gctagataaa ggttcacttg 360aagataagca
gcgtttgata tgctgcgtgt acaccgtgtg taaagatcaa gacgcaaaga
420tcaatagtct ctgccacctt ctcaaagtaa atgtcgccga tcctactata
atcccggcgt 480taaaatttct gaggtaccaa gatagtctag ctctcagatc
gacacaacct acttacgaca 540gtctaaagat agagagtctt gtgtcgtcta
aatcagcagc cggattaagc agtggtcaag 600cagggggcac ttcgggtaac
caaagtgctc cgaactttgg cgagtttggg aacaaagcga 660aaggatggtt
gtatcagtca ctcaagcaat tgatcaatct gaaacagaga ccaaagatcg
720tcagtttggt tgaaggacta tctcaacaag gcaaaatcag tgagcagtac
gacactctcg 780accccttggg agttcctggg gatgttcggc aaaccagtgt
gaatagtatt attcttttct 840tgctgggtgg cgcgagttac atagaagccg
aggctgctag cagatgggct actgacaatg 900gcaaaaacct gattgttggg
tctaccgctc ttctgagacc gtgc 944842274DNADiabrotica virgifera
84tgacccggca tcatagatgt tacgtagagg aaaaactgta atttgcatgt tcacgaatta
60tatacgaaaa aatagattga aacaaataag gagaacttac gatcaatcgg atttgtaaaa
120aaattatttc ataaaatatt aagaaataag tgaatttcgg gtcacgcttg
acccagtctt 180cgtactccga aggttaataa gataacgtat cacagtacaa
aatagataga aatataacat 240aactaaaaat atcgattatg gcataaatac
cacatataca aagaaaacaa aatctttaat 300ggcatcttgt ctttgagacc
aaccaagaac attaataaag cttttatttc tcaatttagc 360tggtattttt
cgcataaaag attaaaagag cgtaggaatg taatattagt tttcaataat
420ggaattcaaa aatgtcgtcc cattaatcaa cttggtagta cctattacaa
attcaacatt 480tgaatcttct tgcgtggata aaaatctcag agcagatatc
tctgcaaatg tacatccacc 540aataaagaat acaagaactg tttgtggtga
atctgaattt attatagtgt taactgatct 600ggtttcatct aaagttggac
ctggtagtaa gcctaacaca tcctgcaatt gtttagttcc 660tccagttctg
gttacatgtt ccactaatct gatactcatc ggtgcgtata tactatgaac
720gtaactaatg tctgtaggat taatttcgga agtgttttcc atggttaaac
ttaatgcttt 780tctcagaact gtgtattgtc tagtactaga ttgaagtttc
aatagtccaa ctttttccaa 840tttcgatatt gccagaaggg cctccaggcc
gtaaacctgt actagatccc ttttatagct 900ttccaaaatt ttgggcttta
atccagaact tgcgatacat tgtaaacaca ttaaccttaa 960cactttcacc
attggtttgc tctgagcgat catttcttca atgtaagcac tgggtttgtc
1020tacttctatg cagtttaaaa actcctgttc agcctgtaac gtatccaaaa
aatcataccc 1080atccgtgatt tccttaatac attccgcaat tgctgtatgt
gttgccagtt gctttttctt 1140tgccaaaatt tgaggaagtc tttgaacata
aagcttcatc tcctggacag acttttcctg 1200tgtattttcc atctgggcac
taattgcttt agcctctttt gagagataac cgcctacagc 1260attgaaattc
ttgtcccgga tgtcagcaaa aattttgtca gttgaatcta gaatcagttg
1320cttcttatct tctgataacg attctgtagt tctttcttca gtgcttaaaa
aattatcgat 1380tgggaaatag gcagttgaat tatttatacc gaaaatttca
tcaatcaatc cttcataagt 1440taactgtgta gctaaaggtg tgatcaaatc
tacagaccta tcgattaata tgatttgatc 1500aatacatgac tgttgattat
ttttcatatc ttcactgtta ttcttttctc tttgcaatct 1560aaccacaaga
tcccaaactt gcttagctgc atttcctttg ccccaaactt taggaatagt
1620tccatacatt ttttgaaggt atattatagc ttgtgctgtt tggtataaat
acgtagggtc 1680gttttcaatt gtgtactccc taaaaatact aaaaacctca
gatatttcca ttgatactaa 1740gtcagattca aatggaaaaa gctggcattt
gaattcatca attaacatta cgcttccata 1800gactccttta tgtttcaatc
tttccatgca caataagctt ttctttggta caaaaaacaa 1860atggtattgc
ttcttactgc cacttttcgt tttactgtca gcatgtacat tttgtgcaat
1920gtagtccatc agatacaatt tgggccttga gatgaagata atatgatcga
catcagtttc 1980aggtaaaggc atatttcgaa gtgggaacat cttaggagcc
tggtgctcct tgaggattgc 2040atatttggct acaagtccaa ctggtccagc
taagctgtta tcccaaacaa tgactttctt 2100accaggacat tgttctaaaa
ggtttatcag gtttgcccta gctgctgctt gaattaagga 2160tatatctact
tttccacttt gcatgtgagc catatttcac tttagccttt aacttaacta
2220taactgatca aaagaggtgg atttaaatgt ttatatttta ttctgtcact gtcg
227485575DNADiabrotica virgifera 85tgggtatcga ctccggctta gcctcttgga
agccgcagtt tctaataact ctttgatcac 60tggctcaaat cgactgagct catattgcgc
tgatttggct cgctttttat agtagtttag 120taactcttca ttcttatgta
ttttgtggac atgtttgagc gagctcgcac caggcccatt 180ctcctccgat
ttggcgtcat tggacaagtc taaagaaccg aatgtatcaa ttatctgctc
240aatctccagg gacatgcctg ctgcgcgaat cattttcttc ttatcttcag
cttgtactcc 300gtccatcatt gaaaaatata gcagcagcaa tctaaccttc
tcggtcatta tcacaccact 360tttgtcagaa acaagcttag caagctcctc
cagaatcttc aacacctgaa cagacttgcc 420gtgcttatct acccctgtcg
ctagatcctg ctctaatacg ccagctctga aaatccctgt 480ttgattgaga
gtactaaagc agctctcaga catattgata tgattcatga acttctcgag
540catttccgag tactgaggaa gagcccgaat ggcct 57586276DNADiabrotica
virgifera 86gaggattaag ttgaagtgac tgaatcagct gcgagcactt ggtcgtcaga
tttgcgaatt 60gcatgtcagt catgggcgtg acgaactgta agtcataagc catgtatttt
cgtgaagcct 120cgtcctgaag tattatggtc aggttctttt cagtcgcctc
tacgaagtac acagcacaca 180catcctcaac tgggctccgt tcagaggcta
tatgcaacat tagagtaacg ccttgctggc 240gaagttcgcc gactttcacc
accggggcga tgatca 27687260DNADiabrotica virgifera 87ggaagctgtt
gaatctgtgg tcaatggttt gatttcgttc tgcgcagcga tgcaacttcg 60gcccctgatc
aagatcccta aaaatgaagc gtcgcccgcg cgactggttg gaacaagatt
120agatgaagaa ttgcgaaaac tacaagtgcg ttttggcgat aaatttgttt
ccttatccaa 180ctcaggcaat aggagaccga tactagttct cactgatcga
acactagact ttttcacgcc 240cctatcccac agctccacat
260881929DNADiabrotica virgifera 88ttgtaataga ttttaattct aaattaacag
taaatatact tagtataatt taacaataaa 60tatttaatta cacatctttg gatagtatat
atataaagga atgtaaattt tattcaaaat 120ggatatttct tatgtttctt
gtatgtcttc taggacagtt tttagtagct tgttcgactt 180cctccaaaaa
gctcgtagag ttgtggatag tagtacctcc cagtagcaca ttaaaatttg
240gatagtttct gtttatggaa tgcactgtta atgactcctc gtaagtagca
ccacctacaa 300taaaaacaat gatgtcttgt ggtctaccat tgcttccatg
actgccaaga taaggataca 360actgttcctt aagcctgccc ttaactagat
cttccaatgt ttcatgtagg agtggtttgt 420gttgggtgta aacgttgtcc
actccactta agcctttgat aaacctttta gtgattttaa 480cagcattttc
tacattgaat aaatcgcttt gtctagcatg tgatcctgca tattctataa
540tattaacaat attcctcagc aacttgtcag gcacatttct ctttttgagt
aaatctacta 600atcctgtaat gtcattattg ttgtgatttt ggtatcttaa
ggcatacatc atcactaatt 660tgacagcgtc agtatttcta attttatcgt
tagtcaataa ttttttaata ctctgtaaat 720gagcatagta atcgttattt
tgcgaagata tttcttgttc gatttcagaa acatccaaca 780aatgatactt
gttcaccatt gagctcagtt ctccaacaac tgttacatgt ttagtgacat
840taccagacag tttcttaaac tgtggatatg attctacaaa gtttttcatg
tcggctatac 900tttctatttt ctggtgactt ttagcttttg cctggaattg
atccatcaac tgttttatat 960ttgtaccgat ttcaccatag ttcataaata
catttttggc gtaaaaagtg tcttgttcaa 1020ctgataaaac cacttctgac
agttcttttg caacacctgg cacattggac aaattaactc 1080tgttgttgta
tattgttaat aattcgtgca ccattgcttg ataagtccac tggtttagta
1140aaggtgtgat aggatcatct ctacgatcta aaataagtaa taaagagcta
ttgatctggt 1200tgaaagcaaa cagcgaagat tccttattta taacctcgtc
tattcttgag cccaaatctt 1260tacaaacatt tgagtttgct tgatacctaa
tcactggaca tttcttaaga gacagtaata 1320cagaaataat gccttggacg
cttatttgta aagcacttgg attccaactg agtgaagtca 1380aagcagcgtt
taaaccaagt gaaaacagat gtggattgac agccaaataa tccatgtaaa
1440gctcttggac ttctttaacc acctcgtgtt cgtcatgctc ggcaagaatt
ttgatatcag 1500ctttagctat tatattacta aagtagacat agtaagcacc
atacttaggg tttcgaagtt 1560ctgcacatag agcactgata ttctgttgag
tcggtctcag gaaggctaag cacttcaagt 1620aacgaagacc tgtcgagttt
gcgaagctgg gagagtctat tcgctctagt aaaaatacct 1680ctttttgttg
aatttctgat tgcccataga ccatactgat aacacttgtt gtgtctttgt
1740ccattagcag cactttcatg cccggttcgc tctcgctggt cattttgact
atataggcct 1800taattgccga tatgacgttc attttggatg cttattaaaa
ttgttttaca ctaaattaaa 1860ctgtttacaa ttttgttgta ttaagttttc
attttgcaag caaactgagc gaacttcaca 1920gtggtcgat
1929892881DNADiabrotica virgifera 89tagcgcgctc atcactgtat
gtacatacat tagtgcaata tctcaaaagt tatcaaatta 60aggccacaac atagtaataa
cattaagatg gttttatgtt atgtaatttt catgctatgc 120aagagccatg
caagacatat tatacaactg cgcatgccca catgctattt tcaagcaatt
180cctgtgctag acaaaagatt agaatgtgtt ctattttcca tgcaagttgt
tgtcaaaatt 240cttgttgtca acatagcaaa attttttagt gtagaataaa
acttttttct tgtaagttta 300aatgttatct attttgtgta ataatttctg
atttatattt gaatatattt aatgctggac 360tgaaatttct aagcgaaata
tctaaaatta atgattcaat atatttcttt tgttgccaac 420aatgaaagta
gtatctaaaa ttgcatagaa atagctttgg tgtaaacaaa ttaggctagg
480taagatatat gccatgcagg acagacttgc atagcatgaa atttacatgt
cctagatgta 540cagctgcttt taaaatatca aagaaaaact ttgtattaaa
tctatattaa aataggaagt 600gtcatgtttg aaaaaattta aagagaagac
ttcaaataac tataattcat ctaccgaaca 660gatggagtta tcatgtgaat
aaatcacaat attttttcaa aatccttaac gcactccctt 720gtacacaata
ccgatcacag acatatacaa ctttattgaa gtaagtaaat caactgttgg
780tattcaatga aataatcata cagctaccca agcaaaccat ggctgatgag
agagaccctg 840tctgtgtaaa gtttagatgg gtgtacaata catagataaa
ggggttgtca ctggccatgg 900ttcatgccag gagctatagt cacgtgaaga
tcatgcattt ttttctccgt ctcttcagta 960gactaattat agtttatgat
atgatacctt cttagagatt caaatagcta tggtgaaacc 1020aaaatttcac
aaaacaaatc atcatttggg ataatctaaa atgccttgca ttaaataatt
1080cccagtaaca actctatcac ttaaaataac aatttgtgtc cctgttagag
tttccagtaa 1140attgcaggca gctatttcag cgtaagtgac tcctccaatc
atatatataa gcaccatcct 1200attctgaaga ggatatcctc tttcatttct
taacgataga tgaccaaaca cttccaattt 1260agttctaatc tcatctaaag
gaattgaatt aagaatcatt ccagctattt gggttataag 1320aggaatgtag
ttgcctccaa atacataact ggtacatgta ggaaacttta gattcactgc
1380agtaggatca ggtgggattt gttttaaatt tttagaattg atttggctat
tacttgaact 1440aaatattgga atcttcaatt ttccttgtat atttaaacta
ttgcttgttt ctactgactc 1500tggaataaaa cctatattca gtagattatg
aaaagcaaaa ccatagctaa agccaaactg 1560atgcaagaat tttagccaga
atgttctaat ttcgctttca ctcattggct gatacagtat 1620taacagacag
aataaccgca atgttatgta tttgtcattt tctgtgttta aaacctcttc
1680caaatagttt aagtttaagg ctctatcatt gtttcttact atattatgtt
ccaccatctt 1740ctgattttcg tatctatggc ctaagatgtt gattatactt
tctgcagcct gtaaatggtt 1800tgttataaac ttcttcttgg atttagttgc
gtgtagttgt gtttgtacat attgtttaat 1860ttcatctaat gccatttccc
tggaactcat cttttctgtt tttaactctt ttgttaaatt 1920acttaaaaca
gataatactt ctgtaaaata tctattttta atgtcatagt aaatactatc
1980aacattacta tctaaactaa agttaattga ttgtttttct ggtaaaggat
tacatttcgt 2040atcaaatttt tctagtttct cttccttttt ttcacaaatc
cctgcactaa cgttgtatat 2100ctcagccagt agggctgcat atgtacctgg
agttaataat gcacttgtgt agtctatgtt 2160tctatccatt attattaagg
ctccaaaatc agattctagt ctatcagttt ctcctctgtc 2220ttcgcagcat
tgatcaaatt gagctagaac tgctttagaa tactcaccta gacataaaat
2280aaaccttggt ttacctatta caaaattgag ttgccacaag cacttggaca
aaacaggtag 2340ataagttaag tttttatata caaagagaga actgtataga
ttcggtattt cgagactcag 2400taaacttgtg tccagatgta aaggcatcca
ctggaagtga tgtattctta ttgtaccata 2460aacacctaat gcttctagtt
cattttcaaa tgcacaattg taacaaggta ctacaataat 2520gtgaaattta
ttctttactg gttgttcaat gttctcaatc tgtgatctga tctgatctac
2580tacctgttta aatactattg tatcaaaata tatcatgtaa aatacaacat
ttgatcctgc 2640atatggattt acgggttcta atttaaatat tttctctatg
ccatttcctt ttaaccatgt 2700aacaccacat actctttcca gtggcctaat
taatgatggt tctattatta aatacttcgg 2760gtttgaaacc acgtttaata
tcttggagag ttgtgctttg gatatttctt gtaaacctga 2820caattttgtt
gtaatatcca taatattatt atgtttgttg ctttttaaat ttgacaaaag 2880t
2881901042DNADiabrotica virgifera 90gaatacaatg tgttgctcta
gcgaagatgg tggtcagctt ggtaccctga atttagtcac 60ctcccttgcc ggcaaaactt
ccgacgtcac ggccaacctg gtcaaggacg cctggaacga 120gctgttgagt
gacggcaaga aggtgcccag tcctaccaac aactgctgtg tggtcattct
180agaccgatct gacgatccca tagtcccgtg tctcttgccc tggacatatt
tgggcatgat 240tcaagaatat cttaaactgg atcagtgcgg cattctaacc
ttgaccgatg ggactcaagc 300taatctatca tttagaagcg actctttttt
tcgagagaac tacaataaaa atttcggtga 360acttgcaaat ctactttcca
agccgccagc tgagacaaaa gcagatttta ccactagcct 420acacgagttt
gaaacggcca agaaagactt gagcgaatac gaactacact caaaaatact
480tcacgagata aaagatgtga ttgagaggga ccaaattttt gcggtttgga
aagtcgagca 540agatgtacta aaagcaacga caatcacgcg caacgacgcc
gtcatattag gcattgacca 600gctgactagt aatggcattg tgaaaacttc
ggcgatacat agactgatca aactgatcaa 660aatcaagtgc cggtatatac
ttggagagga ttatccggat gcagcgtgga ttaactggac 720gcctgacccc
ctagatgctc ccttaatcca ggcattctac caaaacatga cttataaagt
780cactcaccgc tttggtctac agaatagcga ttatagtcca ctcacccatc
gaataatatc 840taccttgctt aaaggtcagc tgcctccaaa gatgatcagc
agcatgccac tgaacggagt 900gtcgcccaag cacattgttg tactgattgt
gggctcggcg tacgccgctg aggcaccaca 960aaaaatgtgg accacgtctc
aggtgggcgg tctccaccct cttttgatcg attagaattt 1020ttgaacatgc
gcttcgtgtg gg 104291810DNADiabrotica virgifera
91ctttgacagc gtcaaagtca ccggactcaa tcgaagcaaa tcagagctga ttataatcga
60ccgttccatc gatgtatgcg tcatgctagt gcatgagtat acttatcaag ccctggctta
120cgacgtcctc gaaataccga tctgtgtgcc acccggccaa aaactcttgt
caaacggaga 180acagcgaatg gaagacacgt attctttcgt cgatccgaag
aaggggaaca agatgtttct 240tttgtctgaa caagacgagc tgtatgttag
atacaggcac aagcatattg cctcagtaat 300caccggcgtc aatgacgaac
tgaaaaaatt ctcaaaagac aacgctgctg cgcagtacaa 360caccaagggg
gccactaagg cagaaggtgg tgtggatgtg gctcaggcca ttcgggctct
420tcctcagtac tcggaaatgc tcgagaagtt catgaatcat atcaatatgt
ctgagagctg 480ctttagtact ctcaatcaaa cagggatttt cagagctggc
gtattagagc aggatctagc 540gacaggggta gataagcacg gcaagtctgt
tcaggtgttg aagattctgg aggagcttgc 600taagcttgtt tctgacaaaa
gtggtgtgat aatgacagag aaggttagat tgctgctgct 660atatttttca
atgatggacg gagtacaagc tgaagataag aagaaaatga ttcgcgcagc
720aggcatgtcc ctggagattg agcagataat tgatacattc ggttctttag
acttgtccaa 780tgacgccaaa tcggaggaga atgggcctgg
810922866DNADiabrotica virgifera 92ctttattaaa atcttttaaa atattatttt
tgaatttgaa attgtgcaag ttatgaacgt 60agctctataa aagcacaaga atatttatca
aaaaaaacag ccataggaaa acaaagaaga 120aaaacttttc ttcatttaat
atatttatca tatttatcta ccaaattcta gatggcacaa 180tggaaaattt
gtgttatgga ttatcacaaa gggggttaat gatggaaagt ccttgaaaat
240tgtagtttca gcagtgattc atacgggtcg cactataccg tcacggattt
cacggattct 300gcgcgtttga gacctttcat tcatcttttt gttattgttg
cggaggtcaa ttttttatat 360cggaagacaa ttttatccaa atttttgaaa
aatctccaat tctgtcactg aattaggact 420taagtggaac accatggcgt
taaagaacca agttggtcaa aaaatcatga atgaagtcat 480caagcacaag
cccaccaaga agaatgggcc aactccagga cagcaagccc atggggtaga
540atggaggatc cttgtggtgg accagcttgc catgaggatg gtttcagcat
gctgtaaaat 600gcatgatata tcagcagaag gcattacatt ggttgaagat
attatgaaga aaagggaacc 660gcttggtacc atggaagctg tgtacttgat
aacaccttca gaaaagtcag ttcatgctct 720tatgaatgac tttgaaccac
caagacagat gtacagaggg gcacacgtgt tttttacaga 780agcgtgtcca
gaccaattat ttagtacctt gtgccaccac cccgtagcaa agtttattaa
840aaccctaaaa gaaatcaaca tagcattcat tccgactgag tcacaggtgt
tctcattgga 900ttcaccagac acgttccagt gtagctacga tccatcattt
tccgctgcta gaaacgccaa 960catggaaaga atggcagaac aaattgcgac
actctgtgcg actctagggg aatacccaca 1020cgtcagatat agaactgatt
gggaaagaaa tgttgagctg gctcaactaa ttcagcagaa 1080attggacgcc
tataaagccg acgaacctac catgggagag gggccggaaa aggcgagatc
1140acaattaatt atcctcgacc gaggtttcga ctgtgtatct ccccttcttc
acgaacttac 1200tttccaagca atggcctatg acttactacc catagaaaat
gatgtatata agtacgaagc 1260atcggctggt gttatgaaag aagtccttct
agacgaaaac gacgagcttt gggtcgatct 1320acgccaccaa cacatcgcgg
tggtgtctca gagcgtcacc aagaatctga agaaattcac 1380cgactccaaa
cgcatgaccc agagcgacaa gcagtcgatg aaggatctct caaccatgat
1440caaaaagatg ccgcaatatc agaaagaatt gtccaagtat gctacgcatc
ttcatctcgc 1500tgaagactgc atgaaggcct atcaggggta tatagacaag
ttgtgtaaag ttgagcagga 1560tttggcaatg ggaactgatg ccgaaggcga
gaaaatcaag gatcacatgc gcaacatcgt 1620ccccatcttg ctagatccca
aaatcaccaa tgaatacgat aagatgcgta ttatagcatt 1680gtacgccatg
acgaaaaacg gcatcacaga tgaaaatctc tccaaattgg ctacccatgc
1740ccaaatcaag gacaaacaga ccatcgccaa ccttcagtta cttggagtca
acgttattaa 1800tgatggagga ccaagaaaaa aacaatatac agtaccgcgc
aaagaaagaa ttacagaaca 1860aacgtaccaa atgtcaagat ggacacctat
cattaaggat ataatggagg attgcataga 1920cgacaaactg gatcagaaac
actacccgta tttgagcgga cgagcacagt ctacgggata 1980ccatgcagcg
ccctctagtg cccgttatgg ccagtggcac aaagacagag gtcaacaagc
2040cgtgaagaac gttcctcgac tgctcgtctt cgtcgtgggt ggaatcagtt
tttcagagat 2100caggtgcgcc tacgaagtga ccaacgcgca gaagaactgg
gaagtcatca tcggctcgtc 2160gcacatactc actcccgagg acttcctaag
caatctggca acgttggccg gctagaatca 2220gatgaaaaag gttactttta
atgtacccga gtaaacagtt tcgcagtcgt agtttaaaat 2280aatgtaatga
gtctttttaa tcccaattta aacatattta tatagaatga ctttcgatca
2340gtatcgaacc gttttctttg ttacgagagt taaagctgtt caaattatct
tgaaatttgt 2400gcagaattgt catacattaa attgttgcgc ttctgaaatt
gttgtgcaat aaaagaaaat 2460gtctaaggtg ctcaaaactc aaagccttcg
atgagtttat gattataaat tgagaataaa 2520aagactcatt gagcttaaaa
agtattattt cctacccttt ttttgtattt ttccaatagc 2580agagtttttt
attcaatttt tgcggttatt gggatattat cgctttattt acaaaattgt
2640gtaaaaggta taaaaatgac gtttttgagg agtcttcctg taaaattaat
ttcaatagtc 2700agagatttac caaaaaaata tttttttggg ttaagatttt
agtttcttaa catattataa 2760aatacatcgt tttttttgtt ttatttactg
ttaaagcttc tatattgtct tcttgaactg 2820ctgtggcgac cccatcattg
aaaacacttc caagaacaag aacaca 286693265DNADiabrotica virgifera
93atcaagatcc ctaagaatga agcgtcgccc gcgcgactgg ttggaacaag attagatgaa
60gaattgcgaa aactacaagt gcgttttggc gataaatttg tttccttatc caactcaggc
120aataggagac cgatactagt tctcactgat cgaacactag actttttcac
gcccctatcc 180cacagctcca catacgaggc tctactacac gattgcttcg
gtataaaatt gaattggatt 240caaataaatg aaagcaaata tgaac
26594258DNADiabrotica virgifera 94cagatttgcg aattgcatgt cagtcatggg
cgtgacgaac tgtaagtcat aagccgtgta 60ttttcgtgaa gccacgtcct gaagtattat
ggtcaggttc ttttcagtcg cctctacgaa 120gtacacagca cacacatcct
caactgggct ccgttcagag gctatatgca acattagagt 180aacgccttgc
tggcgaagtt cgccgacttt caccaccggg gcgatgatca tttgcgaacg
240gtcgtcatat atgagaat 25895423DNADiabrotica virgifera 95gccgaacgga
tttcgctgaa gctgatgccg ccgaggcaga aaagaataac cttgggcttg 60tccgttgtat
tcgcgtttcg agctagattt gctaaatttt gatcgtctac gggcgaaacg
120tctgaacttt cccagtccca atcaaattga gttgcgcgaa tgcgtcctcc
gtgagaattg 180ttttgagtag cgacgtagcc tccgaaatcg ggatcttgta
gatatgggga tcgactccgg 240cttagcctct tggaagccgc agtttctaat
aactctttga tcactggctc aaatcgactg 300agctcatatt gcgctgattt
ggctcgcttt ttatagtagt ttagtaactc ttcattctta 360tgtattttgt
ggacatgttt gagcgagctc gcaccaggcc cattctcctc cgatttggcg 420tca
42396209DNADiabrotica virgifera 96ctcctcatct tttgtttttg cgctgttcaa
tgcccaatag gtatgctcct tctgcatccc 60aagactaaaa agatcgggct ccgtgacgat
gaagttgagg tattggtcgt aaacttgtgc 120aatttgttcc gaggtgcctg
cagcagctgt ttgcgcggca aagtcctcca gaaggggtcg 180gggtatcgag
gagaggaagt tgagatggg 209974816DNADiabrotica virgifera 97cggatttcac
ggattctgcg cgtttgagac ctttcattca tctttttgtt attgttgcgg 60aggtcaattt
tttatatcgg aagacaattt tatccaaatt tttgaaaaat ctccaattct
120gtcactgaat taggacttaa gtggaacacc atggcgttaa agaaccaagt
tggtcaaaaa 180atcatgaatg aagtcatcaa gcacaagccc accaagaaga
atgggccaac tccaggacag 240caagcccatg gggtagaatg gaggatcctt
gtggtggacc agcttgccat gaggatggtt 300tcagcatgct gtaaaatgca
tgatatatca gcagaaggca ttacattggt tgaagatatt 360atgaagaaaa
gggaaccgct tggtaccatg gaagctgtgt acttgataac accttcagaa
420aagtcagttc atgctcttat gaatgacttt gaaccaccaa gacagatgta
cagaggggca 480cacgtgtttt ttacagaagc gtgtccagac caattattta
gtaccttgtg ccaccacccc 540gtagcaaagt ttattaaaac cctaaaagaa
atcaacatag cattcattcc gactgagtca 600caggtgttct cattggattc
accagacacg ttccagtgta gctacgatcc atcattttcc 660gctgctagaa
acgccaacat ggaaagaatg gcagaacaaa ttgcgacact ctgtgcgact
720ctaggggaat acccacacgt cagatataga actgattggg aaagaaatgt
tgagctggct 780caactaattc agcagaaatt ggacgcctat aaagccgacg
aacctaccat gggagagggg 840ccggaaaagg cgagatcaca attaattatc
ctcgaccgag gtttcgactg tgtatctccc 900cttcttcacg aacttacttt
ccaagcaatg gcctatgact tactacccat agaaaatgat 960gtatataagt
acgaagcatc ggctggtgtt atgaaagaag tccttctaga cgaaaacgac
1020gagctttggg tcgatctacg ccaccaacac atcgcggtgg tgtctcagag
cgtcaccaag 1080aatctgaaga aattcaccga ctccaaacgc atgacccaga
gcgacaagca gtcgatgaag 1140gatctctcaa ccatgatcaa aaagatgccg
caatatcaga aagaattgtc caagtatgct 1200acgcatcttc atctcgctga
agactgcatg aaggcctatc aggggtatat agacaagttg 1260tgtaaagttg
agcaggattt ggcaatggga actgatgccg aaggcgagaa aatcaaggat
1320cacatgcgca acatcgtccc catcttgcta gatcccaaaa tcaccaatga
atacgataag 1380atgcgtatta tagcattgta cgccatgacg aaaaacggca
tcacagatga aaatctctcc 1440aaattggcta cccatgccca aatcaaggac
aaacagacca tcgccaacct tcagttactt 1500ggagtcaacg ttattaatga
tggaggacca agaaaaaaac aatatacagt accgcgcaaa 1560gaaagaatta
cagaacaaac gtaccaaatg tcaagatgga cacctatcat taaggatata
1620atggaggatt gcatagacga caaactggat cagaaacact acccgtattt
gagcggacga 1680gcacagtcta cgggatacca tgcagcgccc tctagtgccc
gttatggcca gtggcacaaa 1740gacagaggtc aacaagccgt gaagaacgtt
cctcgactgc tcgtcttcgt cgtgggtgga 1800atcagttttt cagagatcag
gtgcgcctac gaagtgacca acgcgcagaa gaactgggaa 1860gtcatcatcg
gctcgtcgca catactcact cccgaggact tcctaagcaa tctggcaacg
1920ttggccggct agaatcagat gaaaaaggtt acttttaatg tacccgagta
aacagtttcg 1980cagtcgtagt ttaaaataat gtaatgagtc tttttaatcc
caatttaaac atatttatat 2040agaatgactt tcgatcagta tcgaaccgtt
ttctttgtta cgagagttaa agctgttcaa 2100attatcttga aatttgtgca
gaattgtcat acattaaatt gttgcgcttc tgaaattgtt 2160gtgcaataaa
agaaaatgtc taaggtgctc aaaactcaaa gccttcgatg agtttatgat
2220tataaattga gaataaaaag actcattgag cttaaaaagt attatttcct
accctttttt 2280tgtatttttc caatagcaga gttttttatt caatttttgc
ggttattggg atattatcgc 2340tttatttaca aaattgtgta aaaggtataa
aaatgacgtt tttgaggagt cttcctgtaa 2400aattaatttc aatagtcaga
gatttaccaa aaaaatattt ttttttgttt agattttagt 2460ttcttaacat
attataaaat acatcgtttt ttttgtttta tttactgtta aagcttctat
2520attgtcttct tgaactgctg tggcgacccc atcattgaaa acacttccaa
gaacaagaac 2580acatttggct ttttgttgta attatctttt tgggaagata
tatttgagga aacagctttg 2640taattttggg tcacactagt ttttcgtttt
tcattctacc cattttttgg ttgattgttg 2700gccacactgt tctgtgtttt
cggcatgaag gcatacaaac aaaaaatgtt ccaggtgtaa 2760ctttctctgg
tttttgaaaa cgtatataag ttttctttca atagtatgaa ctatcattca
2820taaatataca tatttttgct atcagagcat accaaatgaa gtagttctgt
atttatttca 2880aacaagtaca tttagtttat ttgttcagtt atatgtttcc
atttctagta gtcttctggt 2940atctgtggct ggattttagt gtgtcaactc
cagttttata acctaaccaa acctcaccta 3000atgcaaccta acctcacata
acctcaaata atataacaaa atctctcgta gactaaccta 3060ataatgcatt
ggtgtggtat gaacgattcg gaatttgttt taattaaaga aatttttcaa
3120aaattatgta tatttatgca aaaatcttca ttttttcttg tttacactgc
tattgatatt 3180gtattcgttg actagtctgc gtccagttgc acaaacgaca
cccctaaagc tacttaacag 3240taagacgatg cttttaaatg ctttttgtgt
gactggtaca tatattataa attaagctta 3300gcgagtaatt aagaatctta
tctttaaata tccagttgta catcttacat agtgtacctc 3360ttagaatagg
aaaatgtatt tttcaactgt acctaaccaa acgcgtatag caaaaggtgt
3420agaacgtgac aaagaatagc ataaagaagg acctgagctt gttttagtta
ttcttccttc 3480aaaattagat aatccttaaa ttaaactaga tatgtgtgct
aaaaaatcat ctctggcggt 3540acagccaata gaaaagaagc tgaggaaggt
ctcagatcac cgtgatcaat tatttaagca 3600gaataatgga aaactggtcg
tgagccatct aaatcttctc tatgctatag tttaaacgta 3660ctacacctat
tttcaaatca cagctttgta ttcatgctag ctaactttgt atcatatcct
3720cagtagttta tcgtgaccta ttttttatat atctactaaa agacaccgat
agtttttcca 3780aaaaaaaaaa cttctatttg atagaaaaat aaaaatttat
cgtttacaaa ttatggtaaa 3840attatttagt tgttattatt cagcatttac
aacggtacaa cgctttcttt cagtgcagaa 3900cgagtatcaa aatcataata
cgagcaaaac ttaacggagc cccaacatat accaaccttg 3960aataacacaa
aatacaacaa tttcttagat ctggggaaaa tcgtcgaaga tttgacaatt
4020tcggccaatc agagcgccat attgtagtca cgtgacctaa aattttccta
gattccagta 4080aactggacta ttacaggagc gataaagcat taatagcgtt
atttgtgttg gctatcccga 4140agtttgattt tttatagtag tcacgatgtt
tttggtcgat gaaagacttt agacaatgat 4200tttatattcc ctactactcg
ttttgccact gaatgaagca ttttccacat tcctgttcgt 4260tttctaggaa
tataagtgta aaattgactg acaaattaca tgttttcgtt actatcatcg
4320atacatcatt ttcgtagagg gctggatcat gcgtgggtga ttaaaataca
gttgttgtac 4380gtttcttttc gtcaccctag tcaataaagt ccttatttat
gtgctagtgt ttctattatc 4440gttggtttac agcggtgtgt acatgacaag
ggcgatttaa acggatctgc gggtaaatac 4500catagacata ttatcgatag
accaagctag gaatatgcca ctcaatgcat cggggtgtaa 4560cgccaatatc
aagtacggtg gtctagctat ctttgtctgt cgtgcgagtg tgagcgtatc
4620taccaagagg tgggagtaat ggaacgacac agacacagag gcagcggcca
tcatatgcta 4680gagagagaaa gctaagcgcc ggtagagaga gatagataga
ccaccgaccc gaactgctcc 4740gcgttacgct atttttcgga cctggcctaa
tctattgtgt tattatatct atggttcaac 4800tccagtttaa ccaatg
4816982664DNADiabrotica virgifera 98ttttgttatt gttgcggagg
tcaatttttt atatcggaag acaattttat ccaaattttt 60gaaaaatctc caattctgtc
actgaattag gacttaagtg gaacaccatg gcgttaaaga 120accaagttgg
tcaaaaaatc atgaatgaag tcatcaagca caagcccacc aagaagaatg
180ggccaactcc aggacagcaa gcccatgggg tagaatggag gatccttgtg
gtggaccagc 240ttgccatgag gatggtttca gcatgctgta aaatgcatga
tatatcagca gaaggcatta 300cattggttga agatattatg aagaaaaggg
aaccgcttgg taccatggaa gctgtgtact 360tgataacacc ttcagaaaag
tcagttcatg ctcttatgaa tgactttgaa ccaccaagac 420agatgtacag
aggggcacac gtgtttttta cagaagcgtg tccagaccaa ttatttagta
480ccttgtgcca ccaccccgta gcaaagttta ttaaaaccct aaaagaaatc
aacatagcat 540tcattccgac tgagtcacag gtattgacaa ttgcttaaaa
tcacctaaag gtatgcttgt 600tgtttttcac gttcaaatac taacctacta
actcagtctt tgtctgctct tgtatattcg 660ccttttccta ctaacattat
gaaaaatgta atatctgtgc gattttgttt aaatgtggtc 720tgaattgttg
ttttgtctaa cagtatgccc ggaggaactg ttcaatgagc tctgcaagtc
780ttgtgcggcc agaaaaatta agactctcaa ggaaatcaac attgcgttct
tgccgtatga 840gtctcaggtg ttctcattgg attcaccaga cacgttccag
tgtagctacg atccatcatt 900ttccgctgct agaaacgcca acatggaaag
aatggcagaa caaattgcga cactctgtgc 960gactctaggg gaatacccac
acgtcagata tagaactgat tgggaaagaa atgttgagct 1020ggctcaacta
attcagcaga aattggacgc ctataaagcc gacgaaccta ccatgggaga
1080ggggccggaa aaggcgagat cacaattaat tatcctcgac cgaggtttcg
actgtgtatc 1140tccccttctt cacgaactta ctttccaagc aatggcctat
gacttactac ccatagaaaa 1200tgatgtatat aagtacgaag catcggctgg
tgttatgaaa gaagtccttc tagacgaaaa 1260cgacgagctt tgggtcgatc
tacgccacca acacatcgcg gtggtgtctc agagcgtcac 1320caagaatctg
aagaaattca ccgactccaa acgcatgacc cagagcgaca agcagtcgat
1380gaaggatctc tcaaccatga tcaaaaagat gccgcaatat cagaaagaat
tgtccaagta 1440tgctacgcat cttcatctcg ctgaagactg catgaaggcc
tatcaggggt atatagacaa 1500gttgtgtaaa gttgagcagg atttggcaat
gggaactgat gccgaaggcg agaaaatcaa 1560ggatcacatg cgcaacatcg
tccccatctt gctagatccc aaaatcacca atgaatacga 1620taagatgcgt
attatagcat tgtacgccat gacgaaaaac ggcatcacag atgaaaatct
1680ctccaaattg gctacccatg cccaaatcaa ggacaaacag accatcgcca
accttcagtt 1740acttggagtc aacgttatta atgatggagg accaagaaaa
aaacaatata cagtaccgcg 1800caaagaaaga attacagaac aaacgtacca
aatgtcaaga tggacaccta tcattaagga 1860tataatggag gattgcatag
acgacaaact ggatcagaaa cactacccgt atttgagcgg 1920acgagcacag
tctacgggat accatgcagc gccctctagt gcccgttatg gccagtggca
1980caaagacaga ggtcaacaag ccgtgaagaa cgttcctcga ctgctcgtct
tcgtcgtggg 2040tggaatcagt ttttcagaga tcaggtgcgc ctacgaagtg
accaacgcgc agaagaactg 2100ggaagtcatc atcggctcgt cgcacatact
cactcccgag gacttcctaa gcaatctggc 2160aacgttggcc ggctagaatc
agatgaaaaa ggttactttt aatgtacccg agtaaacagt 2220ttcgcagtcg
tagtttaaaa taatgtaatg agtcttttta atcccaattt aaacatattt
2280atatagaatg actttcgatc agtatcgaac cgttttcttt gttacgagag
ttaaagctgt 2340tcaaattatc ttgaaatttg tgcagaattg tcatacatta
aattgttgcg cttctgaaat 2400tgttgtgcaa taaaagaaaa tgtctaaggt
gctcaaaact caaagccttc gatgagttta 2460tgattataaa ttgagaataa
aaagactcat tgagcttaaa aagtattatt tcctaccctt 2520tttttgtatt
tttccaatag cagagttttt tattcaattt ttgcggttat tgggatatta
2580tcgctttatt tacaaaattg tgtaaaaggt ataaaaatga cgtttttgag
gagtcttcct 2640gtaaaattaa tttcaatagt caga 266499275DNADiabrotica
virgifera 99ctcaaggttc atcgtttgtt atggaaggtg tgaagaattt agtggtgaaa
cgacacaatc 60ttcctgttac caaaattacc gaacaattga tggaatgccg gactggtggc
gatatagacg 120attatttgta tttggatccc aaattgttga aaggtggcga
cattgtcccg aaaaatcgtg 180ctccatttca ggatgcagtt gtgtttatgg
ttggaggtgg taattacatt gaatatcaga 240atttggtgga ctttataaag
caaaaacaat catca 275100254DNADiabrotica virgifera 100atgctgaggg
tgagaagata aaagatcata tgcgcaacat tgtgcccatt ctactagaag 60cgtcgatctc
caactacgat aaagttcgaa tcatcgccct ctacgtgatg atcaaaaacg
120gaatatccga agagaatttg atgaaattgt tcacccacgc tcagatcggc
ccgaaggaac 180aggatatggt gcgaaatctt agttttctcg gagtcaatat
cgtatcagat ggcaacagaa 240agaagacata cacg 254101342DNADiabrotica
virgifera 101cacaaaggat aaattttgga aaacacacaa aggaagtccg tttccaacgg
ttgccgaggc 60tattcaagaa gagctggaat cgtatcgcag ctcagaagat gagataaaga
aattgaaaac 120ttcgatggga attgacggcg aaacggagat agcctattcg
atggtaaatg acaacacaga 180gaaattaacg aatgcagtga actcgttgcc
acagctgatg gaaaagaaac gactgatcga 240catgcatacg aaaatagcga
cgtccatttt gaattacatt aagtcgagac gtttggactc 300gttttttgaa
ctagaggaaa aaattatgtc gaaactggcg ct 3421022124DNADiabrotica
virgifera 102tctacaactt gacgacagtg acagaataaa atataaacat ttaaatccac
ctcttttgat 60cagttatagt taagttaaag gctaaagtga aatatggctc acatgcaaag
tggaaaagta 120gatatatcct taattcaagc agcagctagg gcaaacctga
taaacctttt agaacaatgt 180cctggtaaga aagtcattgt ttgggataac
agcttagctg gaccagttgg acttgtagcc 240aaatatgcaa tcctcaagga
gcaccaggct cctaagatgt tcccacttcg aaatatgcct 300ttacctgaaa
ctgatgtcga tcatattatc ttcatctcaa ggcccaaatt gtatctgatg
360gactacattg cacaaaatgt acatgctgac agtaaaacga aaagtggcag
taagaagcaa 420taccatttgt tttttgtacc aaagaaaagc ttattgtgca
tggaaagatt gaaacataaa 480ggagtctatg gaagcgtaat gttaattgat
gaattcaaat gccagctttt tccatttgaa 540tctgacttag tatcaatgga
aatatctgag gtttttaggg agtacacaat tgaaaacgac 600cctacgtatt
tataccaaac agcacaagct ataatatacc ttcaaaaaat gtatggaact
660attcctaaag tttggggcaa aggaaatgca gctaagcaag tttgggatct
tgtggttaga 720ttgcaaagag aaaagaataa cagtgaagat atgaaaaata
atcaacagtc atgtattgat 780caaatcatat taatcgatag gtctgtagat
ttgatcacac ctttagctac acagttaact 840tatgaaggat tgattgatga
aattttcggt ataaataatt caactgccta tttcccaatc 900gataattttt
taagcactga agaaagaact acagaatcgt tatcagaaga taagaagcaa
960ctgattctag attcaactga caaaattttt gctgacatcc gggacaagaa
tttcaatgct 1020gtaggcggtt atctctcaaa agaggctaaa gcaattagtg
cccagatgga aaatacacag 1080gaaaagtctg tccaggagat gaagctttat
gttcaaagac ttcctcaaat tttggcaaag 1140aaaaagcaac tggcaacaca
tacagcaatt
gcggaatgta ttaaggaaat cacggatggg 1200tatgattttt tggatacgtt
acaggctgaa caggagtttt taaactgcat agaagtagac 1260aaacccagtg
cttacattga agaaatgatc gctcagagca aaccaatggt gaaagtgtta
1320aggttaatgt gtttacaatg tatcgcaagt tctggattaa agcccaaaat
tttggaaagc 1380tataaaaggg atctagtaca ggtttacggc ctggaggccc
ttctggcaat atcgaaattg 1440gaaaaagttg gactattgaa acttcaatct
agtactagac aatacacagt tctgagaaaa 1500gcattaagtt taaccatgga
aaacacttcc gaaattaatc ctacagacat tagttacgtt 1560catagtatat
acgcaccgat gagtatcaga ttagtggaac atgtaaccag aactggagga
1620actaaacaat tgcaggatgt gttaggctta ctaccaggtc caactttaga
tgaaaccaga 1680tcagttaaca ctataataaa ttcagattca ccacaaacag
ttcttgtatt ctttattggt 1740ggatgtacat ttgcagaagt aactaacatt
gtgcattact ttaacaaaaa ttactaattt 1800cttcgtttca gatatctgct
ctgagatttt tatccacgca agaagattca aatgttgaat 1860ttgtaatagg
tactaccaag ttgattaatg ggacgacatt tttgaattcc attattgaaa
1920actaatatta cattcctacg ctcttttaat cttttatgcg aaaaatacca
gctaaattga 1980gaaataaaag ctttattaat gttcttggtt ggtctcaaag
acaagatgcc attaaagatt 2040ttattttctt tgtatatgtg gtatttatgc
cataatcgat atttttagtt atgttatatt 2100tctatctatt ttgtactgtg atac
2124103478DNADiabrotica virgifera 103aagacgagaa ggttttaagg
gctatttgcg agcgattggt ctcagtgtgt gcgaccttgg 60aagaataccc gtacgttcga
tataaggctg accagcctcg tatggagcaa ctcgctcagc 120tgtttcaagc
caaaatgaac gagttcgtcg caaaaaatga tgcatttaca tacgcaacga
180accgagggac gctcttcttt attgatcgtg gtcaggattt agttgcacca
atgatgcatg 240agagcacttt tcaggctatg atttacgact tgatcgacgt
caacgaagag cagatcacat 300atccagctga aacgaactca ggaacagtga
tgaaaacagc gtttctaaat gaaaacgaca 360agttttggat tgaatatcgt
catacacata ttgcaaaggt tagcgaagag attggcaaac 420gaatggcgca
gttgtcgtca tcaaatgctg ggacgtcact cgggaaaggc aagtcaac
478104288DNADiabrotica virgifera 104gcttcctatg cagagcttcg
tacaatttac gagttgcgtc aatccgaaaa acgagatatc 60attctaggag cgacctcgtt
catcaaaccg aaggcatttg tcgacgcact gtctgtgctt 120catgaagcga
atcccacctc aaaccctccg ccagttggtc gtggtgctga tgtgacgcct
180ttaagcagtg cagagattca tgtactggtg gagaatcaaa ctaaaccagc
gagttcaggg 240actccctttg agaaaattgg tggcgaaggc tccaagacct cttccttc
288105699DNADiabrotica virgifera 105ggcgcgatgg caaaggtcgt
gtacgacatg atggcgcact tcaagcgcga gcaagaggtc 60gctgggaatc cgatcggcgt
cctcgatccc gagatcgaca cgctcgtgct cttggaccgg 120actgtggacc
tcgcgacgcc gatgtgtacg ccactgacgt acgaaggctt gttggacgag
180atcctgagca tcacgcatgg cttcatcaca gtcgacgccg agctcattgc
ggaagacagt 240gagagcagtc ctagctctgg tcctagtggt ccgagtggca
agaaagtgtc gatcccactc 300aactcgaacg acaagctgta cgcggacgtg
cgcgactacc acgtcgagcg cttgggcatg 360acgctccagc agcaagcgca
cgacatccgc gcgcgctacg acgagttccg gaagaaccgc 420gacgcgtcga
tcagcgagat ccgcgagttc gtcaagcgca ttccagggct caagcagaac
480taccagtcgc tcatgcagca catcaacttg gctgagctca tcaagaaaac
gacggacaac 540aaggcgttcc gggacctcaa agtcgccgag cacgcgatgc
tcatgggcga aacgatcttc 600gagcagctcg aagagcgcat tggcttccag
gacccgatcc tcagtgtctt gcgtcagctc 660tgtctccagt cggtcacgag
cggcggcatc aaatccaag 699106270DNADiabrotica virgifera 106ttgtggcctg
aaggcgcgtg gagatcgtcc cgcgtgtatc acctggcccc gaagattgct 60gtataagccg
gtgctagagt cttggcagca caatggacgt gatcgtagca gtgcggcagt
120atctggagaa ggtcataaat gaccctcaga tcgatggcat gaaggctcta
ctgctcgatg 180cagacaccac gacggtgatc tcgatggtga tgtcgcagtc
gcatattcta cagcgggaag 240tctttttggt agagcaggtt gacgcgtccc
270107317DNADiabrotica virgifera 107gagcctgggt attaaaaaga
gaaggaattt cgaattattt tgtagacgtt tttaagaaga 60aacacacctg agactcatac
ggcaagaacg caatgttgat ttccttgaga gtcttaattt 120ttctggccgc
acaagacttg cagagctcat tgaacagttc ctccgggcat actgttagac
180aaaacaacaa ttcagaccac atttaaacaa aatcgcacag atattacatt
tttcataatg 240ttagtaggaa aaggcgaata tacaagagca gacaaagact
gagttagtag gttagtattt 300gaacgtgaaa aacaaca 317108258DNADiabrotica
virgifera 108cgcatggtcg cggagcagct cagcaacttg atccgcgagc acttgtcggc
gcgcaatggc 60gtctttagcg aaggcagcgt gtcgttccag cgcccagtgc tgatcatcat
ggaccgcaac 120gaagacctcg cgtcgagtct ccaccacccg tcgacgtacc
aagcgctcgt tgacgacatg 180ctcaagatcc agatgaaccg cgtgaaagtg
acagtcaaga cgtccagtgg tgcgaatggc 240agtgacggca atggcagc
258109696DNADiabrotica virgifera 109cgccgccaca aacgaagacg
agcatctttt cgccaccaaa tgtgtctttg tccgcatcag 60gctttcctgg ttttggttgc
actttcttgc ggagtgagat cgggcccctt ttcttgctgt 120catctaaagc
tgatgccgat ccgagaggcg gcgcaatgat atacggatag tcgtgttcat
180tcaaagtgtt cttcagcgct tgcttcagga ctgacttaat atgtggttca
tatctcgcat 240tggaatactc aacttgttca gccttcaatg ctgctttctt
gatgtcttcc gaagatagag 300aactgttgcc gttctgcgtg taaagtgcag
caccgccaac tgcaaccaga ttactcattg 360cccagtcata cttctgtgat
agatttgcag cctggataat tttctttttc tcgtggtcct 420tcattgtgtc
ttgcgtcaac gaaaatacca tagctactcg aaatttatcc gcctcggata
480gcttcggatc tttgaacagg tcctcaagct gcttagtcag tattgcgtgc
ttgattttct 540tcccggattc gtcaacacca gtcgccatgg tttgctcaat
gttagatgcc tcaaggaggc 600ttgattttgt aaatataccc atagcatttc
ctgcgagcca caggtgctga gaaagttttc 660caagcatctc tctgtattcg
ggcagctccc gtaatg 6961101565DNADiabrotica virgifera 110cttcagcggt
cagagctttt tgtggtcgta cttccagttg gcagctgacg atcgcccatc 60gccgcgctcc
agtccatacg catccgcgat ctctgcgaga tatgaggttg agttgtggat
120gaatgtgccg cccaagatga tgcgttggcc ggagatagca agtttctgat
tcaactcggc 180caccttcgtg gcctcctcaa acgtgacacc accacagatg
aacacaataa tgtcacgaac 240cttcttgatg ccaggtgtgg tcgtaccgtt
cacgatacca aactcgttgt cgagcaagtt 300gcccttgaca atcagctcga
ggtggcgaat gagaggtggc acatgctgtg cgtatacgtt 360cggaacacct
tgcacgcctt gtgtcatggc acgcatgaac ttcttgaggc cacgatcgcc
420gtagagatcg ccagaccgca cgttcgcacc tccatacttg aggaacgtgt
ccacaagtgc 480cacacgctct gatggcaaac ccgaggcaga caacagatct
ttcacaactt tgacttgcac 540agagctgttg gcttcgtacc gcagcacgta
caaaattgca agtcgcaact tgtttagcgg 600cttgatctga gcattcttga
gctttgacac aaggtctttg aagtgtgaat tgtgatcatc 660accacaagct
agctcctgct caagttgact gacgtccatg agcccatcta cttccaccag
720acgtgccagc tcacccatga gcgtcacatg cttggacacg gcaactgact
gcgagcggaa 780tgctggataa ttgtccacga aacgctgcat gtcctcaata
gacacgatat tttcgtgtgt 840ttgtgtcttg gcctggtatt cgtcgaccat
cttcttgact gccatgccca gatcaccgaa 900gttggcgtac aagtgtttct
cgaagaagct gtcagacgtg gtcgaaagca cgagctctgt 960catgtcctta
cgcactcctg gagcgttttt catgtcgaca cggttctcat ttagctctag
1020cagttcatga accatggctt gatatgtcca ctgactcaag agcggggtca
ctgggtcatc 1080tcgacgatcg aggacgtaga gcaatggcat gacttccgga
cgacggaaat caaataaacc 1140gtcttgctca agctgcatgc gtgcggagac
ctctcgcgca agcttttcag caatttcaga 1200gcccttttga tatctgatag
ttggacgctt cttcaatgcg agtagcactg acagcagccc 1260ttcgacgctt
cggttgaaaa ggtgtgtggc cttagctggc aaagctgcgc tagtattggt
1320gacgactcct gcagtcgctg gtgtagatgc tgaagcaccg tgccccttaa
tgctcatcgc 1380gacagtgcca cgcaagttga aatgaaacaa cgtgtcgttc
actgcgagga agtccgcgta 1440gtattcctgg atttgatgaa tcacctcctt
ctcgtccgct tcagcaagtc gctcgagcag 1500ctcaactggt agaatattcg
tgaagaagat gtggtattgg ccatacttgg gattcttgag 1560ttcct
1565111340DNADiabrotica virgifera 111gcgaggaggc gcggcaaagg
acaccaggaa gaaggccacc tcgctcaaga cccagaccag 60ggtgcggtcg accaagggca
aggacagaat cgacggtgac gcggaggacc tgggtcccag 120ggtcatcgtg
ttcgtcgctg gtggtatcac ccactctgaa atccgttccg cctaccagct
180cttcgacaag agggaggtga tcatcggagg cacgtccatc ctgaccccac
acaagttcac 240ctcgtatttt cattggattc tcctgacact tttcaatgtt
tttacgatcc gagctttgcc 300gccgctcgaa atgccaatat ggaacgaatg
gctgaacaaa 34011247DNAArtificial SequenceROPv3FT7 Primer
Oligonucleotide 112ttaatacgac tcactatagg gagacaagta tgctacgcat
cttcatc 4711350DNAArtificial SequenceROPv33RT7 Primer
Oligonucleotide 113ttaatacgac tcactatagg gagatcttat cgtattcatt
ggtgattttg 50114191DNADiabrotica virgifera 114caagtatgct acgcatcttc
atctcgctga agactgcatg aaggcctatc aggggtatat 60agacaagttg tgtaaagttg
agcaggattt ggcaatggga actgatgccg aaggcgagaa 120aatcaaggat
cacatgcgca acatcgtccc catcttgcta gatcccaaaa tcaccaatga
180atacgataag a 1911152238DNAEuschistus heros 115tacctctcct
ggctatattc aacaaagtta ctcaaacaat gagttatggt atctggagaa 60gtgtaacaag
tgcttaccgc aattgagtag tgttctgata caggagtgat agggttagac
120cagaccagtt tgacacttga cacaaacgag tgaaaatggc gctgaaagct
ctcgttggtc 180aaaaaattat gaacgatgcg atcaggcaaa agaaaaaagg
gaaagaggta gagtggagag 240tccttgtcgt ggatcagcta gcgatgcgga
tgatctctgc ttgctgtaaa atgcatgaaa 300tttctgccga gggcttaacg
attgttgaag acattaataa aaagagggag ccacttccat 360caatggaagc
tgtttatcta ataaccccga gtgaaaaatc cgtacatgcc ttgatgaacg
420attttgcctc accgaatcgt atcatgtaca aagctgccca tgtctatttc
acagaagtat 480gtcaggagga actatttaac gagctgtgca aatcgtatgc
atcgagaaag attaaaacgc 540tgaaagagat caacattgct tttttgccat
acgagagcca ggtgttttcc cttgatgctc 600cagaaacatt ccagtgcttc
tacaacccat cattggctaa cagccgactt gctaatatgg 660agcgtattgc
agaacagata gccacattgt gcgccacgct tggtgaatac ccatctgtca
720gatataggag tgattttgat aaaaatgtag aattagctca gatagtgcag
cagaaattgg 780atgcctacaa agctgatgaa cctacaatgg gtgaagggcc
tgaaaaatct cgttcccaat 840tgttgatcct tgatcgaggt tttgatgcag
tttctcctct tcttcacgaa ctcactcttc 900aggcaatggc ctatgatctt
cttccaattg agaatgatgt atataagtat gaagctactg 960ctggagctcc
ggagaaagaa gtattgttag atgaaaatga tgaattatgg gtagaactac
1020gccatcagca tattgctgtt gtctcacaga atgtcacaaa gaacctgaag
aaattcaccg 1080agtctaagag aatgccacaa ggagacaaac agtcaatgag
ggatctcagt caaatgatta 1140aaaagatgcc acaatatcag aaagaactta
gcaagtattc cactcattta caccttgcgg 1200aagattgtat gaatgcttat
cagggccatg ttgataagct ctgcaaggtt gagcaggatt 1260tggcaatggg
taccgacgct gaaggagaac gtataaagga ccacatgaga aatattgttc
1320cgatactcct tgaccaatcc gtatctaatt atgacaaaat gaggatcatc
cttctgtata 1380cattgtcaaa gaatggtatt tctgaggaaa acttgaacaa
actcgttcaa cacgctcaga 1440tccagccaca cgagaagcag gccatcgtca
acctaggaaa tcttggccta aatgttgttg 1500ttgatggtac tcgtataaag
aagccatacg taccccctcg taaagagcgt atcacagaac 1560aaacttacca
gatgtctcgt tggactcctg tcataaagga tcttatggag gactgtatag
1620atgacaagct cgacctcaaa cacttcccct ttctcgccgg tagggctgcc
tcttctggat 1680atcatgctcc tgccagcgtg cgatatggac actggcacaa
agataagggc cagcagaccg 1740tgaagaatgt gcctcgaatc atcgtcttca
tcatcggtgg tatgagcttc tcagagatcc 1800gatgtgccta tgaagttacc
aatgctgtca aaaattggga ggtgataatt ggttcttcac 1860atatcctgac
acctgaagac ttcctaagta acctcgccaa cttgagcaac tagagaatgg
1920actgattgtt agtcagcgta gtcactctcg ttcttatttg gtacacactc
aaatgtgata 1980atgtaaaatt atgtagcttc atttaaactt aggaacggca
cgctcttaaa agtttacttc 2040tttgttatgt gtatcgtgta gagaaaaaca
cattacttct ttcataaaat gtgtatatct 2100actgaggcat actttaagga
taggtatcct agatatcagt tattatttgt ttttatctgt 2160gaaagattag
aattactttt gtagttaaca gtttagcggt gttcattgca tgtaatatta
2220tatatttaag tattgttt 2238116585PRTEuschistus heros 116Met Ala
Leu Lys Ala Leu Val Gly Gln Lys Ile Met Asn Asp Ala Ile1 5 10 15Arg
Gln Lys Lys Lys Gly Lys Glu Val Glu Trp Arg Val Leu Val Val 20 25
30Asp Gln Leu Ala Met Arg Met Ile Ser Ala Cys Cys Lys Met His Glu
35 40 45Ile Ser Ala Glu Gly Leu Thr Ile Val Glu Asp Ile Asn Lys Lys
Arg 50 55 60Glu Pro Leu Pro Ser Met Glu Ala Val Tyr Leu Ile Thr Pro
Ser Glu65 70 75 80Lys Ser Val His Ala Leu Met Asn Asp Phe Ala Ser
Pro Asn Arg Ile 85 90 95Met Tyr Lys Ala Ala His Val Tyr Phe Thr Glu
Val Cys Gln Glu Glu 100 105 110Leu Phe Asn Glu Leu Cys Lys Ser Tyr
Ala Ser Arg Lys Ile Lys Thr 115 120 125Leu Lys Glu Ile Asn Ile Ala
Phe Leu Pro Tyr Glu Ser Gln Val Phe 130 135 140Ser Leu Asp Ala Pro
Glu Thr Phe Gln Cys Phe Tyr Asn Pro Ser Leu145 150 155 160Ala Asn
Ser Arg Leu Ala Asn Met Glu Arg Ile Ala Glu Gln Ile Ala 165 170
175Thr Leu Cys Ala Thr Leu Gly Glu Tyr Pro Ser Val Arg Tyr Arg Ser
180 185 190Asp Phe Asp Lys Asn Val Glu Leu Ala Gln Ile Val Gln Gln
Lys Leu 195 200 205Asp Ala Tyr Lys Ala Asp Glu Pro Thr Met Gly Glu
Gly Pro Glu Lys 210 215 220Ser Arg Ser Gln Leu Leu Ile Leu Asp Arg
Gly Phe Asp Ala Val Ser225 230 235 240Pro Leu Leu His Glu Leu Thr
Leu Gln Ala Met Ala Tyr Asp Leu Leu 245 250 255Pro Ile Glu Asn Asp
Val Tyr Lys Tyr Glu Ala Thr Ala Gly Ala Pro 260 265 270Glu Lys Glu
Val Leu Leu Asp Glu Asn Asp Glu Leu Trp Val Glu Leu 275 280 285Arg
His Gln His Ile Ala Val Val Ser Gln Asn Val Thr Lys Asn Leu 290 295
300Lys Lys Phe Thr Glu Ser Lys Arg Met Pro Gln Gly Asp Lys Gln
Ser305 310 315 320Met Arg Asp Leu Ser Gln Met Ile Lys Lys Met Pro
Gln Tyr Gln Lys 325 330 335Glu Leu Ser Lys Tyr Ser Thr His Leu His
Leu Ala Glu Asp Cys Met 340 345 350Asn Ala Tyr Gln Gly His Val Asp
Lys Leu Cys Lys Val Glu Gln Asp 355 360 365Leu Ala Met Gly Thr Asp
Ala Glu Gly Glu Arg Ile Lys Asp His Met 370 375 380Arg Asn Ile Val
Pro Ile Leu Leu Asp Gln Ser Val Ser Asn Tyr Asp385 390 395 400Lys
Met Arg Ile Ile Leu Leu Tyr Thr Leu Ser Lys Asn Gly Ile Ser 405 410
415Glu Glu Asn Leu Asn Lys Leu Val Gln His Ala Gln Ile Gln Pro His
420 425 430Glu Lys Gln Ala Ile Val Asn Leu Gly Asn Leu Gly Leu Asn
Val Val 435 440 445Val Asp Gly Thr Arg Ile Lys Lys Pro Tyr Val Pro
Pro Arg Lys Glu 450 455 460Arg Ile Thr Glu Gln Thr Tyr Gln Met Ser
Arg Trp Thr Pro Val Ile465 470 475 480Lys Asp Leu Met Glu Asp Cys
Ile Asp Asp Lys Leu Asp Leu Lys His 485 490 495Phe Pro Phe Leu Ala
Gly Arg Ala Ala Ser Ser Gly Tyr His Ala Pro 500 505 510Ala Ser Val
Arg Tyr Gly His Trp His Lys Asp Lys Gly Gln Gln Thr 515 520 525Val
Lys Asn Val Pro Arg Ile Ile Val Phe Ile Ile Gly Gly Met Ser 530 535
540Phe Ser Glu Ile Arg Cys Ala Tyr Glu Val Thr Asn Ala Val Lys
Asn545 550 555 560Trp Glu Val Ile Ile Gly Ser Ser His Ile Leu Thr
Pro Glu Asp Phe 565 570 575Leu Ser Asn Leu Ala Asn Leu Ser Asn 580
58511750DNAArtificial SequenceBSB_ROP-1-For PCR Primer
Oligonucleotde 117ttaatacgac tcactatagg gagagaagat tgtatgaatg
cttatcaggg 5011845DNAArtificial SequenceBSB_ROP-1-Rev PCR Primer
Oligonucleotide 118ttaatacgac tcactatagg gagacgctgg caggagcatg
atatc 45119499DNAEuschistus heros 119gaagattgta tgaatgctta
tcagggccat gttgataagc tctgcaaggt tgagcaggat 60ttggcaatgg gtaccgacgc
tgaaggagaa cgtataaagg accacatgag aaatattgtt 120ccgatactcc
ttgaccaatc cgtatctaat tatgacaaaa tgaggatcat ccttctgtat
180acattgtcaa agaatggtat ttctgaggaa aacttgaaca aactcgttca
acacgctcag 240atccagccac acgagaagca ggccatcgtc aacctaggaa
atcttggcct aaatgttgtt 300gttgatggta ctcgtataaa gaagccatac
gtaccccctc gtaaagagcg tatcacagaa 360caaacttacc agatgtctcg
ttggactcct gtcataaagg atcttatgga ggactgtata 420gatgacaagc
tcgacctcaa acacttcccc tttctcgccg gtagggctgc ctcttctgga
480tatcatgctc ctgccagcg 4991202550DNAMeligethes aeneus
120tttgacattt aatgataatt gtgcagtggg tgctattaaa aattatattg
tttaaatagg 60tagttaaaat attataaaat attgttagag tgttcatcac aaattatatg
caatatggcg 120ttaaaaggac aagttgggca aaaaattatg aacgaggtaa
taaagcataa accaaagaaa 180aatggacccg ctcatggagt ggaatggaga
gttttggttg tggatcaact tgccatgaga 240atggtttcag cctgttgtaa
aatgcacgat atttcagctg agggcatcac attggttgaa 300gatataaaca
agaaaagaga acccttaaac accatggaag caatatatct aataacacca
360tctgaaaaat ctgttcactc actgatgaac gattttgaat cgccaagact
tatgtacaaa 420ggggcacatg tattttttac tgaagtctgt cccgaagaac
tcttcaatga gttgtgtaaa 480tcttgtgctg caaggaaaat taaaacgcta
aaggaaatca acattgcctt cttgccctat 540gaatcacagg tgttttcttt
ggactgccca gaaacattcc aatgcagtta tgatcctgct 600atggaagcag
ccagaaatgc aaacatggag agaatggcag aacaaattgc tacattgtgt
660gcaactctgg gagaataccc ttcagtaaga taccgaagtg attgggaacg
caacgtggaa 720ctagcgcaga tgattcagca aaagttggat gcctataaag
cggatgagcc cacaatggga 780gaggggcctg aaaaagcgag atcgcaactt
ttgattcttg accgcggctt cgactgcgta 840tcacccatgc tgcacgaact
tacattccag gcaatggcct acgatttgct gccaatcgaa 900aacgacgtgt
acaaatatga agcttcagcg ggagtattta aggaagtgtt gctcgacgaa
960aacgacgagt tatgggtaga attacgacat cagcatatcg ctgtagtgtc
gcagagtgtg 1020acgaaaaact tgaagaaatt taccgattca aaacgaatga
cccaaagtga taaacaatca 1080atgaaagatc tgtcacaaat gattaagaaa
atgccccaat atcaaaagga gttatctaaa 1140tatgctacac acttgcatct
tgctgaagac tgcatgaaat cttaccaagg atatgttgac 1200aaattatgta
aagttgaaca agacctagca atgggtacag atgcagaagg agaaaaaatt
1260aaagaccata tgcgtaacat cgtaccgatt ttacttgatc caaaaataac
aaacgaatat 1320gacaaaatga gaataattgc tctatatgca atgattaaaa
atggcataac cgacgaaaat
1380ttatcaaaac ttgctactca tgcccaaata aaagacaaac aaactattgc
taatttgcaa 1440ttcttgggag ttaatgttat caatgatggt gggaaccgga
aaaaaccgta ttcggtgcca 1500agaaaagagc gtattactga acaaacgtat
caaatgtcta gatggacgcc tgtaattaag 1560gatattatgg aagacgctat
tgaagataaa ttagatcaaa aacactttcc atttttagct 1620ggccgagcgc
aaaccagtgc ttaccacgcc ccaacaagtg ctcgatatgg tcattggcat
1680aaagacaagg cccagcagac agtgaaaaat gtgcccagaa taattgtctt
cattgttgga 1740ggcatgagtt tttcagaaat cagatgtgcg tatgaggtaa
caaacgccca aaaaaattgg 1800gaggtcatta ttggatcctc caacattttg
actccccaaa gttttcttaa ggatttaaac 1860actcttacag tctaggattc
aggaaaaaaa gttactttta atatacctga taattaaaaa 1920tgctttcgtc
atgtgaattt gattgcttaa gataaatggt tagttttact ggaattttta
1980attgtagttg acattttgag atatttgtac ctactaacgt taaaaatgtg
cagacctaag 2040caagatatta caatataatc ttggatgcta gtctatcttc
cctttctaaa aataactttt 2100atttttaata attataattc tggattgaaa
aataaaatgt atgtaaagta cttaagggaa 2160ctgattattt tttttatttt
ttaagttgag cagtctcaca caaacaatac attactcgtg 2220cgccagcgca
cttcatagac ttctaaaaaa aacattgggt ataaaaaact gttctcaatt
2280tactaacgga acatttaaat ttattttaag cccctaagct ttaattatta
aaaattgtat 2340aaatgttgtt agaaataaag taagttttca aaggcgttat
ataaatgttt agcgtgttat 2400ggcgtttaac accataattc aaaaatatca
aatatttaaa gttatttatc acgtttttat 2460tgttatttct tgttataagt
agttttttag atacttaaac ttgtattgta ttcagtattt 2520cttttcaata
gttatacatg tattatattc 2550121586PRTMeligethes aeneus 121Met Ala Leu
Lys Gly Gln Val Gly Gln Lys Ile Met Asn Glu Val Ile1 5 10 15Lys His
Lys Pro Lys Lys Asn Gly Pro Ala His Gly Val Glu Trp Arg 20 25 30Val
Leu Val Val Asp Gln Leu Ala Met Arg Met Val Ser Ala Cys Cys 35 40
45Lys Met His Asp Ile Ser Ala Glu Gly Ile Thr Leu Val Glu Asp Ile
50 55 60Asn Lys Lys Arg Glu Pro Leu Asn Thr Met Glu Ala Ile Tyr Leu
Ile65 70 75 80Thr Pro Ser Glu Lys Ser Val His Ser Leu Met Asn Asp
Phe Glu Ser 85 90 95Pro Arg Leu Met Tyr Lys Gly Ala His Val Phe Phe
Thr Glu Val Cys 100 105 110Pro Glu Glu Leu Phe Asn Glu Leu Cys Lys
Ser Cys Ala Ala Arg Lys 115 120 125Ile Lys Thr Leu Lys Glu Ile Asn
Ile Ala Phe Leu Pro Tyr Glu Ser 130 135 140Gln Val Phe Ser Leu Asp
Cys Pro Glu Thr Phe Gln Cys Ser Tyr Asp145 150 155 160Pro Ala Met
Glu Ala Ala Arg Asn Ala Asn Met Glu Arg Met Ala Glu 165 170 175Gln
Ile Ala Thr Leu Cys Ala Thr Leu Gly Glu Tyr Pro Ser Val Arg 180 185
190Tyr Arg Ser Asp Trp Glu Arg Asn Val Glu Leu Ala Gln Met Ile Gln
195 200 205Gln Lys Leu Asp Ala Tyr Lys Ala Asp Glu Pro Thr Met Gly
Glu Gly 210 215 220Pro Glu Lys Ala Arg Ser Gln Leu Leu Ile Leu Asp
Arg Gly Phe Asp225 230 235 240Cys Val Ser Pro Met Leu His Glu Leu
Thr Phe Gln Ala Met Ala Tyr 245 250 255Asp Leu Leu Pro Ile Glu Asn
Asp Val Tyr Lys Tyr Glu Ala Ser Ala 260 265 270Gly Val Phe Lys Glu
Val Leu Leu Asp Glu Asn Asp Glu Leu Trp Val 275 280 285Glu Leu Arg
His Gln His Ile Ala Val Val Ser Gln Ser Val Thr Lys 290 295 300Asn
Leu Lys Lys Phe Thr Asp Ser Lys Arg Met Thr Gln Ser Asp Lys305 310
315 320Gln Ser Met Lys Asp Leu Ser Gln Met Ile Lys Lys Met Pro Gln
Tyr 325 330 335Gln Lys Glu Leu Ser Lys Tyr Ala Thr His Leu His Leu
Ala Glu Asp 340 345 350Cys Met Lys Ser Tyr Gln Gly Tyr Val Asp Lys
Leu Cys Lys Val Glu 355 360 365Gln Asp Leu Ala Met Gly Thr Asp Ala
Glu Gly Glu Lys Ile Lys Asp 370 375 380His Met Arg Asn Ile Val Pro
Ile Leu Leu Asp Pro Lys Ile Thr Asn385 390 395 400Glu Tyr Asp Lys
Met Arg Ile Ile Ala Leu Tyr Ala Met Ile Lys Asn 405 410 415Gly Ile
Thr Asp Glu Asn Leu Ser Lys Leu Ala Thr His Ala Gln Ile 420 425
430Lys Asp Lys Gln Thr Ile Ala Asn Leu Gln Phe Leu Gly Val Asn Val
435 440 445Ile Asn Asp Gly Gly Asn Arg Lys Lys Pro Tyr Ser Val Pro
Arg Lys 450 455 460Glu Arg Ile Thr Glu Gln Thr Tyr Gln Met Ser Arg
Trp Thr Pro Val465 470 475 480Ile Lys Asp Ile Met Glu Asp Ala Ile
Glu Asp Lys Leu Asp Gln Lys 485 490 495His Phe Pro Phe Leu Ala Gly
Arg Ala Gln Thr Ser Ala Tyr His Ala 500 505 510Pro Thr Ser Ala Arg
Tyr Gly His Trp His Lys Asp Lys Ala Gln Gln 515 520 525Thr Val Lys
Asn Val Pro Arg Ile Ile Val Phe Ile Val Gly Gly Met 530 535 540Ser
Phe Ser Glu Ile Arg Cys Ala Tyr Glu Val Thr Asn Ala Gln Lys545 550
555 560Asn Trp Glu Val Ile Ile Gly Ser Ser Asn Ile Leu Thr Pro Gln
Ser 565 570 575Phe Leu Lys Asp Leu Asn Thr Leu Thr Val 580
5851222550DNAMeligethes aeneus 122tttgacattt aatgataatt gtgcagtggg
tgctattaaa aattatattg tttaaatagg 60tagttaaaat attataaaat attgttagag
tgttcatcac aaattatatg caatatggcg 120ttaaaaggac aagttgggca
aaaaattatg aacgaggtaa taaagcataa accaaagaaa 180aatggacccg
ctcatggagt ggaatggaga gttttggttg tggatcaact tgccatgaga
240atggtttcag cctgttgtaa aatgcacgat atttcagctg agggcatcac
attggttgaa 300gatataaaca agaaaagaga acccttaaac accatggaag
caatatatct aataacacca 360tctgaaaaat ctgttcactc actgatgaac
gattttgaat cgccaagact tatgtacaaa 420ggggcacatg tattttttac
tgaagcatgc cctgataatt tatttcaaaa attgtctcaa 480catccagtag
tgaaatatat taaaacttgt aaagaaatca acattgcatt tataccaaat
540gaatcacagg tgttttcttt ggactgccca gaaacattcc aatgcagtta
tgatcctgct 600atggaagcag ccagaaatgc aaacatggag agaatggcag
aacaaattgc tacattgtgt 660gcaactctgg gagaataccc ttcagtaaga
taccgaagtg attgggaacg caacgtggaa 720ctagcgcaga tgattcagca
aaagttggat gcctataaag cggatgagcc cacaatggga 780gaggggcctg
aaaaagcgag atcgcaactt ttgattcttg accgcggctt cgactgcgta
840tcacccatgc tgcacgaact tacattccag gcaatggcct acgatttgct
gccaatcgaa 900aacgacgtgt acaaatatga agcttcagcg ggagtattta
aggaagtgtt gctcgacgaa 960aacgacgagt tatgggtaga attacgacat
cagcatatcg ctgtagtgtc gcagagtgtg 1020acgaaaaact tgaagaaatt
taccgattca aaacgaatga cccaaagtga taaacaatca 1080atgaaagatc
tgtcacaaat gattaagaaa atgccccaat atcaaaagga gttatctaaa
1140tatgctacac acttgcatct tgctgaagac tgcatgaaat cttaccaagg
atatgttgac 1200aaattatgta aagttgaaca agacctagca atgggtacag
atgcagaagg agaaaaaatt 1260aaagaccata tgcgtaacat cgtaccgatt
ttacttgatc caaaaataac aaacgaatat 1320gacaaaatga gaataattgc
tctatatgca atgattaaaa atggcataac cgacgaaaat 1380ttatcaaaac
ttgctactca tgcccaaata aaagacaaac aaactattgc taatttgcaa
1440ttcttgggag ttaatgttat caatgatggt gggaaccgga aaaaaccgta
ttcggtgcca 1500agaaaagagc gtattactga acaaacgtat caaatgtcta
gatggacgcc tgtaattaag 1560gatattatgg aagacgctat tgaagataaa
ttagatcaaa aacactttcc atttttagct 1620ggccgagcgc aaaccagtgc
ttaccacgcc ccaacaagtg ctcgatatgg tcattggcat 1680aaagacaagg
cccagcagac agtgaaaaat gtgcccagaa taattgtctt cattgttgga
1740ggcatgagtt tttcagaaat cagatgtgcg tatgaggtaa caaacgccca
aaaaaattgg 1800gaggtcatta ttggatcctc caacattttg actccccaaa
gttttcttaa ggatttaaac 1860actcttacag tctaggattc aggaaaaaaa
gttactttta atatacctga taattaaaaa 1920tgctttcgtc atgtgaattt
gattgcttaa gataaatggt tagttttact ggaattttta 1980attgtagttg
acattttgag atatttgtac ctactaacgt taaaaatgtg cagacctaag
2040caagatatta caatataatc ttggatgcta gtctatcttc cctttctaaa
aataactttt 2100atttttaata attataattc tggattgaaa aataaaatgt
atgtaaagta cttaagggaa 2160ctgattattt tttttatttt ttaagttgag
cagtctcaca caaacaatac attactcgtg 2220cgccagcgca cttcatagac
ttctaaaaaa aacattgggt ataaaaaact gttctcaatt 2280tactaacgga
acatttaaat ttattttaag cccctaagct ttaattatta aaaattgtat
2340aaatgttgtt agaaataaag taagttttca aaggcgttat ataaatgttt
agcgtgttat 2400ggcgtttaac accataattc aaaaatatca aatatttaaa
gttatttatc acgtttttat 2460tgttatttct tgttataagt agttttttag
atacttaaac ttgtattgta ttcagtattt 2520cttttcaata gttatacatg
tattatattc 2550123586PRTMeligethes aeneus 123Met Ala Leu Lys Gly
Gln Val Gly Gln Lys Ile Met Asn Glu Val Ile1 5 10 15Lys His Lys Pro
Lys Lys Asn Gly Pro Ala His Gly Val Glu Trp Arg 20 25 30Val Leu Val
Val Asp Gln Leu Ala Met Arg Met Val Ser Ala Cys Cys 35 40 45Lys Met
His Asp Ile Ser Ala Glu Gly Ile Thr Leu Val Glu Asp Ile 50 55 60Asn
Lys Lys Arg Glu Pro Leu Asn Thr Met Glu Ala Ile Tyr Leu Ile65 70 75
80Thr Pro Ser Glu Lys Ser Val His Ser Leu Met Asn Asp Phe Glu Ser
85 90 95Pro Arg Leu Met Tyr Lys Gly Ala His Val Phe Phe Thr Glu Ala
Cys 100 105 110Pro Asp Asn Leu Phe Gln Lys Leu Ser Gln His Pro Val
Val Lys Tyr 115 120 125Ile Lys Thr Cys Lys Glu Ile Asn Ile Ala Phe
Ile Pro Asn Glu Ser 130 135 140Gln Val Phe Ser Leu Asp Cys Pro Glu
Thr Phe Gln Cys Ser Tyr Asp145 150 155 160Pro Ala Met Glu Ala Ala
Arg Asn Ala Asn Met Glu Arg Met Ala Glu 165 170 175Gln Ile Ala Thr
Leu Cys Ala Thr Leu Gly Glu Tyr Pro Ser Val Arg 180 185 190Tyr Arg
Ser Asp Trp Glu Arg Asn Val Glu Leu Ala Gln Met Ile Gln 195 200
205Gln Lys Leu Asp Ala Tyr Lys Ala Asp Glu Pro Thr Met Gly Glu Gly
210 215 220Pro Glu Lys Ala Arg Ser Gln Leu Leu Ile Leu Asp Arg Gly
Phe Asp225 230 235 240Cys Val Ser Pro Met Leu His Glu Leu Thr Phe
Gln Ala Met Ala Tyr 245 250 255Asp Leu Leu Pro Ile Glu Asn Asp Val
Tyr Lys Tyr Glu Ala Ser Ala 260 265 270Gly Val Phe Lys Glu Val Leu
Leu Asp Glu Asn Asp Glu Leu Trp Val 275 280 285Glu Leu Arg His Gln
His Ile Ala Val Val Ser Gln Ser Val Thr Lys 290 295 300Asn Leu Lys
Lys Phe Thr Asp Ser Lys Arg Met Thr Gln Ser Asp Lys305 310 315
320Gln Ser Met Lys Asp Leu Ser Gln Met Ile Lys Lys Met Pro Gln Tyr
325 330 335Gln Lys Glu Leu Ser Lys Tyr Ala Thr His Leu His Leu Ala
Glu Asp 340 345 350Cys Met Lys Ser Tyr Gln Gly Tyr Val Asp Lys Leu
Cys Lys Val Glu 355 360 365Gln Asp Leu Ala Met Gly Thr Asp Ala Glu
Gly Glu Lys Ile Lys Asp 370 375 380His Met Arg Asn Ile Val Pro Ile
Leu Leu Asp Pro Lys Ile Thr Asn385 390 395 400Glu Tyr Asp Lys Met
Arg Ile Ile Ala Leu Tyr Ala Met Ile Lys Asn 405 410 415Gly Ile Thr
Asp Glu Asn Leu Ser Lys Leu Ala Thr His Ala Gln Ile 420 425 430Lys
Asp Lys Gln Thr Ile Ala Asn Leu Gln Phe Leu Gly Val Asn Val 435 440
445Ile Asn Asp Gly Gly Asn Arg Lys Lys Pro Tyr Ser Val Pro Arg Lys
450 455 460Glu Arg Ile Thr Glu Gln Thr Tyr Gln Met Ser Arg Trp Thr
Pro Val465 470 475 480Ile Lys Asp Ile Met Glu Asp Ala Ile Glu Asp
Lys Leu Asp Gln Lys 485 490 495His Phe Pro Phe Leu Ala Gly Arg Ala
Gln Thr Ser Ala Tyr His Ala 500 505 510Pro Thr Ser Ala Arg Tyr Gly
His Trp His Lys Asp Lys Ala Gln Gln 515 520 525Thr Val Lys Asn Val
Pro Arg Ile Ile Val Phe Ile Val Gly Gly Met 530 535 540Ser Phe Ser
Glu Ile Arg Cys Ala Tyr Glu Val Thr Asn Ala Gln Lys545 550 555
560Asn Trp Glu Val Ile Ile Gly Ser Ser Asn Ile Leu Thr Pro Gln Ser
565 570 575Phe Leu Lys Asp Leu Asn Thr Leu Thr Val 580
5851243746DNAMeligethes aeneus 124gttgatattg ttgttgaggg ggttgatatt
gttgttgagg gggttgatat tgttgtggat 60caacttgcca tgagaatggt ttcagcctgt
tgtaaaatgc acgatatttc agctgagggc 120atcacattgg ttgaagatat
aaacaagaaa agagaaccct taaacaccat ggaagcaata 180tatctaataa
caccatctga aaaatctgtt cactcactga tgaacgattt tgaatcgcca
240agacttatgt acaaaggggc acatgtattt tttactgaag tctgtcccga
agaactcttc 300aatgagttgt gtaaatcttg tgctgcaagg aaaattaaaa
cgctaaagga aatcaacatt 360gccttcttgc cctatgaatc acaggtgttt
tctttggact gcccagaaac attccaatgc 420agttatgatc ctgctatgga
agcagccaga aatgcaaaca tggagagaat ggcagaacaa 480attgctacat
tgtgtgcaac tctgggagaa tacccttcag taagataccg aagtgattgg
540gaacgcaacg tggaactagc gcagatgatt cagcaaaagt tggatgccta
taaagcggat 600gagcccacaa tgggagaggg gcctgaaaaa gcgagatcgc
aacttttgat tcttgaccgc 660ggcttcgact gcgtatcacc catgctgcac
gaacttacat tccaggcaat ggcctacgat 720ttgctgccaa tcgaaaacga
cgtgtacaaa tatgaagctt cagcgggagt atttaaggaa 780gtgttgctcg
acgaaaacga cgagttatgg gtagaattac gacatcagca tatcgctgta
840gtgtcgcaga gtgtgacgaa aaacttgaag aaatttaccg attcaaaacg
aatgacccaa 900agtgataaac aatcaatgaa agatctgtca caaatgatta
agaaaatgcc ccaatatcaa 960aaggagttat ctaaatatgc tacacacttg
catcttgctg aagactgcat gaaatcttac 1020caaggatatg ttgacaaatt
atgtaaagtt gaacaagacc tagcaatggg tacagatgca 1080gaaggagaaa
aaattaaaga ccatatgcgt aacatcgtac cgattttact tgatccaaaa
1140ataacaaacg aatatgacaa aatgagaata attgctctat atgcaatgat
taaaaatggc 1200ataaccgacg aaaatttatc aaaacttgct actcatgccc
aaataaaaga caaacaaact 1260attgctaatt tgcaattctt gggagttaat
gttatcaatg atggtgggaa ccggaaaaaa 1320ccgtattcgg tgccaagaaa
agagcgtatt actgaacaaa cgtatcaaat gtctagatgg 1380acgcctgtaa
ttaaggatat tatggaagac gctattgaag ataaattaga tcaaaaacac
1440tttccatttt tagctggccg agcgcaaacc agtgcttacc acgccccaac
aagtgctcga 1500tatggtcatt ggcataaaga caaggcccag cagacagtga
aaaatgtgcc cagaataatt 1560gtcttcattg ttggaggcat gagtttttca
gaaatcagat gtgcgtatga ggtaacaaac 1620gcccaaaaaa attgggaggt
cattattgga tcctccaaca ttttgactcc ccaaagtttt 1680cttaaggatt
taaacactct tacagtctag gattcaggaa aaaaagttac ttttaatata
1740cctgataatt aaaaatgctt tcgtcatgtg aatttgattg cttaagataa
atggttagtt 1800ttactggaat ttttaattgt agttgacatt ttgagatatt
tgtacctact aacgttaaaa 1860atgtgcagac ctaagcaaga tattacaata
taatcttgga tgctagtcta tcttcccttt 1920ctaaaaataa cttttatttt
taataattat aattctggat tgaaaaataa aatgtatgta 1980aagtacttaa
gggaactgat tatttttttt attttttaag ttgagcagtc tcacacaaac
2040aatacattac tcgtgcgcca gcgcacttca tagacttcta aaaaaaacat
tgggtataaa 2100aaactgttct caatttacta acggaacatt taaatttatt
ttaagcccct aagctttaat 2160tattaaaaat tgtataaatg ttgttagaaa
taaagtaagt tttcaaaggc gttatataaa 2220tgtttagcgt gttatggcgt
ttaacaccat aattcaaaaa tatcaaatat ttaaagttat 2280ttatcacgtt
tttattgtta tttcttgtta taagtagttt tttagatact taaacttgta
2340ttgtattcag tatttctttt caatagttat acatgtattt tttttttttt
taatttagca 2400aaattaaaat tgtcaatttt attaagatat agtatagtat
tttgtctttt taagacaaaa 2460tgtaacataa ttaaatttta tccgaattca
taaaaatatt gttgttcctt tcatgacaaa 2520gtggccaagt ccagttttat
ttaaaaatgt aatacaaaat atagctgctt ttaacacaga 2580atactgtaca
taaaatctac ctaaaaaata cagtgtgctt tattgacaac aaatgtaatt
2640ttttgtatat atgcagacac caccactact ggacttggta atccaattct
cataaaagga 2700atcttataag attcctatat atattatgtt aaagtaaggt
tgtggttcta tctcatcttg 2760agagaataat aatttttacc ttgttacacc
actccaaaaa aatgcctgat tatacaaaat 2820tggcaacaaa aactatggat
acaagttatt tcagtaactt ataactattg taatgctata 2880atggtaccta
caaaaaagaa aagcccactt accacactac tatagtaggc tttataaagc
2940ctttgttttt atattaggtt tgtacagggt gaatcacaac tttcatcccg
gacaacaatc 3000gggatttcct ggtgaagtca tgatgatatc acaacgtgat
tttttttatc acgctgtgat 3060atcctgagtg catacacatg cttcatccca
gtgatatcat gtagaactca cggtgtgata 3120tttgcaaaat tttcgcatgc
gtatgagccc tgcgaactgc gaatttaaaa cctagtttgt 3180tattcctatt
acaccgttat aatttataaa acgttgtttg catatcacga atgttgtccg
3240ggttcaatta attagtttat ttcttgaatg acaacattcg tgatattcat
acgaacatca 3300cgtcgtgatt ttcacaaatt ttattcatac tgatatcata
cggaagtcac cgcgtgataa 3360ataaaaatca tacgaacgtc acgtcgtgat
tttcacaaat tttattcata cggacatcat 3420ccggatgtca ctgcgtgaga
aataaaaatc atgtcgtgat tttttatgcc atcgctgttt 3480gcgattgacc
gatggcacaa aaaatcatgt cgtgattttt tatgccaacg gtgtttggat
3540aatcattttt gcgctgcgtt cgtacactaa gagaaaaatt atgttgaatc
aacagttttt 3600gcggttaaat actttcaaaa tcatgtcgtg ttttttaggc
caccggtcaa tcgcaaacag 3660cgatggcaca aaaaatcacg acatgatttt
gaaagtattt aaccgcaaaa actgttgatt 3720caacataatt tttctcttag tgtacg
3746125569PRTMeligethes aeneus 125Val Asp Ile Val Val Glu Gly Val
Asp Ile Val Val Glu Gly Val Asp1 5 10 15Ile Val Val Asp Gln Leu Ala
Met Arg Met Val Ser Ala Cys Cys Lys 20 25 30Met His Asp Ile Ser
Ala
Glu Gly Ile Thr Leu Val Glu Asp Ile Asn 35 40 45Lys Lys Arg Glu Pro
Leu Asn Thr Met Glu Ala Ile Tyr Leu Ile Thr 50 55 60Pro Ser Glu Lys
Ser Val His Ser Leu Met Asn Asp Phe Glu Ser Pro65 70 75 80Arg Leu
Met Tyr Lys Gly Ala His Val Phe Phe Thr Glu Val Cys Pro 85 90 95Glu
Glu Leu Phe Asn Glu Leu Cys Lys Ser Cys Ala Ala Arg Lys Ile 100 105
110Lys Thr Leu Lys Glu Ile Asn Ile Ala Phe Leu Pro Tyr Glu Ser Gln
115 120 125Val Phe Ser Leu Asp Cys Pro Glu Thr Phe Gln Cys Ser Tyr
Asp Pro 130 135 140Ala Met Glu Ala Ala Arg Asn Ala Asn Met Glu Arg
Met Ala Glu Gln145 150 155 160Ile Ala Thr Leu Cys Ala Thr Leu Gly
Glu Tyr Pro Ser Val Arg Tyr 165 170 175Arg Ser Asp Trp Glu Arg Asn
Val Glu Leu Ala Gln Met Ile Gln Gln 180 185 190Lys Leu Asp Ala Tyr
Lys Ala Asp Glu Pro Thr Met Gly Glu Gly Pro 195 200 205Glu Lys Ala
Arg Ser Gln Leu Leu Ile Leu Asp Arg Gly Phe Asp Cys 210 215 220Val
Ser Pro Met Leu His Glu Leu Thr Phe Gln Ala Met Ala Tyr Asp225 230
235 240Leu Leu Pro Ile Glu Asn Asp Val Tyr Lys Tyr Glu Ala Ser Ala
Gly 245 250 255Val Phe Lys Glu Val Leu Leu Asp Glu Asn Asp Glu Leu
Trp Val Glu 260 265 270Leu Arg His Gln His Ile Ala Val Val Ser Gln
Ser Val Thr Lys Asn 275 280 285Leu Lys Lys Phe Thr Asp Ser Lys Arg
Met Thr Gln Ser Asp Lys Gln 290 295 300Ser Met Lys Asp Leu Ser Gln
Met Ile Lys Lys Met Pro Gln Tyr Gln305 310 315 320Lys Glu Leu Ser
Lys Tyr Ala Thr His Leu His Leu Ala Glu Asp Cys 325 330 335Met Lys
Ser Tyr Gln Gly Tyr Val Asp Lys Leu Cys Lys Val Glu Gln 340 345
350Asp Leu Ala Met Gly Thr Asp Ala Glu Gly Glu Lys Ile Lys Asp His
355 360 365Met Arg Asn Ile Val Pro Ile Leu Leu Asp Pro Lys Ile Thr
Asn Glu 370 375 380Tyr Asp Lys Met Arg Ile Ile Ala Leu Tyr Ala Met
Ile Lys Asn Gly385 390 395 400Ile Thr Asp Glu Asn Leu Ser Lys Leu
Ala Thr His Ala Gln Ile Lys 405 410 415Asp Lys Gln Thr Ile Ala Asn
Leu Gln Phe Leu Gly Val Asn Val Ile 420 425 430Asn Asp Gly Gly Asn
Arg Lys Lys Pro Tyr Ser Val Pro Arg Lys Glu 435 440 445Arg Ile Thr
Glu Gln Thr Tyr Gln Met Ser Arg Trp Thr Pro Val Ile 450 455 460Lys
Asp Ile Met Glu Asp Ala Ile Glu Asp Lys Leu Asp Gln Lys His465 470
475 480Phe Pro Phe Leu Ala Gly Arg Ala Gln Thr Ser Ala Tyr His Ala
Pro 485 490 495Thr Ser Ala Arg Tyr Gly His Trp His Lys Asp Lys Ala
Gln Gln Thr 500 505 510Val Lys Asn Val Pro Arg Ile Ile Val Phe Ile
Val Gly Gly Met Ser 515 520 525Phe Ser Glu Ile Arg Cys Ala Tyr Glu
Val Thr Asn Ala Gln Lys Asn 530 535 540Trp Glu Val Ile Ile Gly Ser
Ser Asn Ile Leu Thr Pro Gln Ser Phe545 550 555 560Leu Lys Asp Leu
Asn Thr Leu Thr Val 5651263504DNAMeligethes aeneus 126gttgatattg
ttgttgaggg ggttgatatt gttgttgagg gggttgatat tgttgtggat 60caacttgcca
tgagaatggt ttcagcctgt tgtaaaatgc acgatatttc agctgagggc
120atcacattgg ttgaagatat aaacaagaaa agagaaccct taaacaccat
ggaagcaata 180tatctaataa caccatctga aaaatctgtt cactcactga
tgaacgattt tgaatcgcca 240agacttatgt acaaaggggc acatgtattt
tttactgaag catgccctga taatttattt 300caaaaattgt ctcaacatcc
agtagtgaaa tatattaaaa cttgtaaaga aatcaacatt 360gcatttatac
caaatgaatc acaggtgttt tctttggact gcccagaaac attccaatgc
420agttatgatc ctgctatgga agcagccaga aatgcaaaca tggagagaat
ggcagaacaa 480attgctacat tgtgtgcaac tctgggagaa tacccttcag
taagataccg aagtgattgg 540gaacgcaacg tggaactagc gcagatgatt
cagcaaaagt tggatgccta taaagcggat 600gagcccacaa tgggagaggg
gcctgaaaaa gcgagatcgc aacttttgat tcttgaccgc 660ggcttcgact
gcgtatcacc catgctgcac gaacttacat tccaggcaat ggcctacgat
720ttgctgccaa tcgaaaacga cgtgtacaaa tatgaagctt cagcgggagt
atttaaggaa 780gtgttgctcg acgaaaacga cgagttatgg gtagaattac
gacatcagca tatcgctgta 840gtgtcgcaga gtgtgacgaa aaacttgaag
aaatttaccg attcaaaacg aatgacccaa 900agtgataaac aatcaatgaa
agatctgtca caaatgatta agaaaatgcc ccaatatcaa 960aaggagttat
ctaaatatgc tacacacttg catcttgctg aagactgcat gaaatcttac
1020caaggatatg ttgacaaatt atgtaaagtt gaacaagacc tagcaatggg
tacagatgca 1080gaaggagaaa aaattaaaga ccatatgcgt aacatcgtac
cgattttact tgatccaaaa 1140ataacaaacg aatatgacaa aatgagaata
attgctctat atgcaatgat taaaaatggc 1200ataaccgacg aaaatttatc
aaaacttgct actcatgccc aaataaaaga caaacaaact 1260attgctaatt
tgcaattctt gggagttaat gttatcaatg atggtgggaa ccggaaaaaa
1320ccgtattcgg tgccaagaaa agagcgtatt actgaacaaa cgtatcaaat
gtctagatgg 1380acgcctgtaa ttaaggatat tatggaagac gctattgaag
ataaattaga tcaaaaacac 1440tttccatttt tagctggccg agcgcaaacc
agtgcttacc acgccccaac aagtgctcga 1500tatggtcatt ggcataaaga
caaggcccag cagacagtga aaaatgtgcc cagaataatt 1560gtcttcattg
ttggaggcat gagtttttca gaaatcagat gtgcgtatga ggtaacaaac
1620gcccaaaaaa attgggaggt cattattgga tcctccaaca ttttgactcc
ccaaagtttt 1680cttaaggatt taaacactct tacagtctag gattcaggaa
aaaaagttac ttttaatata 1740cctgataatt aaaaatgctt tcgtcatgtg
aatttgattg cttaagataa atggttagtt 1800ttactggaat ttttaattgt
agttgacatt ttgagatatt tgtacctact aacgttaaaa 1860atgtgcagac
ctaagcaaga tattacaata taatcttgga tgctagtcta tcttcccttt
1920ctaaaaataa cttttatttt taataattat aattctggat tgaaaaataa
aatgtatgta 1980aagtacttaa gggaactgat tatttttttt attttttaag
ttgagcagtc tcacacaaac 2040aatacattac tcgtgcgcca gcgcacttca
tagacttcta aaaaaaacat tgggtataaa 2100aaactgttct caatttacta
acggaacatt taaatttatt ttaagcccct aagctttaat 2160tattaaaaat
tgtataaatg ttgttagaaa taaagtaagt tttcaaaggc gttatataaa
2220tgtttagcgt gttatggcgt ttaacaccat aattcaaaaa tatcaaatat
ttaaagttat 2280ttatcacgtt tttattgtta tttcttgtta taagtagttt
tttagatact taaacttgta 2340ttgtattcag tatttctttt caatagttat
acatgtattt tttttttttt taatttagca 2400aaattaaaat tgtcaatttt
attaagatat agtatagtat tttgtctttt taagacaaaa 2460tgtaacataa
ttaaatttta tccgaattca taaaaatatt gttgttcctt tcatgacaaa
2520gtggccaagt ccagttttat ttaaaaatgt aatacaaaat atagctgctt
ttaacacaga 2580atactgtaca taaaatctac ctaaaaaata cagtgtgctt
tattgacaac aaatgtaatt 2640ttttgtatat atgcagacac caccactact
ggacttggta atccaattct cataaaagga 2700atcttataag attcctatat
atattatgtt aaagtaaggt tgtggttcta tctcatcttg 2760agagaataat
aatttttacc ttgttacacc actccaaaaa aatgcctgat tatacaaaat
2820tggcaacaaa aactatggat acaagttatt tcagtaactt ataactattg
taatgctata 2880atggtaccta caaaaaagaa aagcccactt accacactac
tatagtaggc tttataaagc 2940ctttgttttt atattaggtt tgtacagggt
gaatcacaac tttcatcccg gacaacaatc 3000gggatttcct ggtgaagtca
tgatgatatc acaacgtgat tttttttatc acgctgtgaa 3060atcctgagtg
catacacatg cttcatccca gtgatatcat gtagaactca cggtgtgata
3120tttgcaaaat gttcgcatgc ctatgagacc tgcgaactgc gaatttaaaa
cctagtttgt 3180tattcatatt acaccgttat aatttataaa acgttgtttg
catatcacga atgttgtccg 3240ggttcaatta aaaaggatat ttcaaaaaaa
aacaaaacgt gaacgttttg aacgcagggc 3300tcatatattc ctgatattca
tacgaacatc atgtcgtgat tttttacaaa ttttattcaa 3360actgataaca
tacggaagtc accgtgtgat aaatgaaaat aatacgaatg tcacgtcgtg
3420attttcacac ggacatcatc cggatgtcac tgcgtgagaa atgaaaatca
tgtcgtgatt 3480ttttatgcca acagtgtttg gata 3504127569PRTMeligethes
aeneus 127Val Asp Ile Val Val Glu Gly Val Asp Ile Val Val Glu Gly
Val Asp1 5 10 15Ile Val Val Asp Gln Leu Ala Met Arg Met Val Ser Ala
Cys Cys Lys 20 25 30Met His Asp Ile Ser Ala Glu Gly Ile Thr Leu Val
Glu Asp Ile Asn 35 40 45Lys Lys Arg Glu Pro Leu Asn Thr Met Glu Ala
Ile Tyr Leu Ile Thr 50 55 60Pro Ser Glu Lys Ser Val His Ser Leu Met
Asn Asp Phe Glu Ser Pro65 70 75 80Arg Leu Met Tyr Lys Gly Ala His
Val Phe Phe Thr Glu Ala Cys Pro 85 90 95Asp Asn Leu Phe Gln Lys Leu
Ser Gln His Pro Val Val Lys Tyr Ile 100 105 110Lys Thr Cys Lys Glu
Ile Asn Ile Ala Phe Ile Pro Asn Glu Ser Gln 115 120 125Val Phe Ser
Leu Asp Cys Pro Glu Thr Phe Gln Cys Ser Tyr Asp Pro 130 135 140Ala
Met Glu Ala Ala Arg Asn Ala Asn Met Glu Arg Met Ala Glu Gln145 150
155 160Ile Ala Thr Leu Cys Ala Thr Leu Gly Glu Tyr Pro Ser Val Arg
Tyr 165 170 175Arg Ser Asp Trp Glu Arg Asn Val Glu Leu Ala Gln Met
Ile Gln Gln 180 185 190Lys Leu Asp Ala Tyr Lys Ala Asp Glu Pro Thr
Met Gly Glu Gly Pro 195 200 205Glu Lys Ala Arg Ser Gln Leu Leu Ile
Leu Asp Arg Gly Phe Asp Cys 210 215 220Val Ser Pro Met Leu His Glu
Leu Thr Phe Gln Ala Met Ala Tyr Asp225 230 235 240Leu Leu Pro Ile
Glu Asn Asp Val Tyr Lys Tyr Glu Ala Ser Ala Gly 245 250 255Val Phe
Lys Glu Val Leu Leu Asp Glu Asn Asp Glu Leu Trp Val Glu 260 265
270Leu Arg His Gln His Ile Ala Val Val Ser Gln Ser Val Thr Lys Asn
275 280 285Leu Lys Lys Phe Thr Asp Ser Lys Arg Met Thr Gln Ser Asp
Lys Gln 290 295 300Ser Met Lys Asp Leu Ser Gln Met Ile Lys Lys Met
Pro Gln Tyr Gln305 310 315 320Lys Glu Leu Ser Lys Tyr Ala Thr His
Leu His Leu Ala Glu Asp Cys 325 330 335Met Lys Ser Tyr Gln Gly Tyr
Val Asp Lys Leu Cys Lys Val Glu Gln 340 345 350Asp Leu Ala Met Gly
Thr Asp Ala Glu Gly Glu Lys Ile Lys Asp His 355 360 365Met Arg Asn
Ile Val Pro Ile Leu Leu Asp Pro Lys Ile Thr Asn Glu 370 375 380Tyr
Asp Lys Met Arg Ile Ile Ala Leu Tyr Ala Met Ile Lys Asn Gly385 390
395 400Ile Thr Asp Glu Asn Leu Ser Lys Leu Ala Thr His Ala Gln Ile
Lys 405 410 415Asp Lys Gln Thr Ile Ala Asn Leu Gln Phe Leu Gly Val
Asn Val Ile 420 425 430Asn Asp Gly Gly Asn Arg Lys Lys Pro Tyr Ser
Val Pro Arg Lys Glu 435 440 445Arg Ile Thr Glu Gln Thr Tyr Gln Met
Ser Arg Trp Thr Pro Val Ile 450 455 460Lys Asp Ile Met Glu Asp Ala
Ile Glu Asp Lys Leu Asp Gln Lys His465 470 475 480Phe Pro Phe Leu
Ala Gly Arg Ala Gln Thr Ser Ala Tyr His Ala Pro 485 490 495Thr Ser
Ala Arg Tyr Gly His Trp His Lys Asp Lys Ala Gln Gln Thr 500 505
510Val Lys Asn Val Pro Arg Ile Ile Val Phe Ile Val Gly Gly Met Ser
515 520 525Phe Ser Glu Ile Arg Cys Ala Tyr Glu Val Thr Asn Ala Gln
Lys Asn 530 535 540Trp Glu Val Ile Ile Gly Ser Ser Asn Ile Leu Thr
Pro Gln Ser Phe545 550 555 560Leu Lys Asp Leu Asn Thr Leu Thr Val
565128401DNAMeligethes aeneus 128ggactgccca gaaacattcc aatgcagtta
tgatcctgct atggaagcag ccagaaatgc 60aaacatggag agaatggcag aacaaattgc
tacattgtgt gcaactctgg gagaataccc 120ttcagtaaga taccgaagtg
attgggaacg caacgtggaa ctagcgcaga tgattcagca 180aaagttggat
gcctataaag cggatgagcc cacaatggga gaggggcctg aaaaagcgag
240atcgcaactt ttgattcttg accgcggctt cgactgcgta tcacccatgc
tgcacgaact 300tacattccag gcaatggcct acgatctgct gccaatcgaa
aacgacgtgt acaaatatga 360agcttcagcg ggagtattta aggaagtgtt
gctcgacgaa a 40112945DNAArtificial SequenceForward primer to
amplify Rop reg1 129taatacgact cactataggg agatttcgtc gagcaacact
tcctt 4513044DNAArtificial SequenceReverse primer to amplify Rop
reg 1 130taatacgact cactataggg agaggactgc ccagaaacat tcca
441312487DNAMeligethes aeneus 131aggtgttttc tttggactgc ccagaaacat
tccaatgcag ttatgatcct gctatggaag 60cagccagaaa tgcaaacatg gagagaatgg
cagaacaaat tgctacattg tgtgcaactc 120tgggagaata cccttcagta
agataccgaa gtgattggga acgcaacgtg gaactagcgc 180agatgattca
gcaaaagttg gatgcctata aagcggatga gcccacaatg ggagaggggc
240ctgaaaaagc gagatcgcaa cttttgattc ttgaccgcgg cttcgactgc
gtatcaccca 300tgctgcacga acttacattc caggcaatgg cctacgattt
gctgccaatc gaaaacgacg 360tgtacaaata tgaagcttca gcgggagtat
ttaaggaagt gttgctcgac gaaaacgacg 420agttatgggt agaattacga
catcagcata tcgctgtagt gtcgcagagt gtgacgaaaa 480acttgaagaa
atttaccgat tcaaaacgaa tgacccaaag tgataaacaa tcaatgaaag
540atctgtcaca aatgattaag aaaatgcccc aatatcaaaa ggagttatct
aaatatgcta 600cacacttgca tcttgctgaa gactgcatga aatcttacca
aggatatgtt gacaaattat 660gtaaagttga acaagaccta gcaatgggta
cagatgcaga aggagaaaaa attaaagacc 720atatgcgtaa catcgtaccg
attttacttg atccaaaaat aacaaacgaa tatgacaaaa 780tgagaataat
tgctctatat gcaatgatta aaaatggcat aaccgacgaa aatttatcaa
840aacttgctac tcatgcccaa ataaaagaca aacaaactat tgctaatttg
caattcttgg 900gagttaatgt tatcaatgat ggtgggaacc ggaaaaaacc
gtattcggtg ccaagaaaag 960agcgtattac tgaacaaacg tatcaaatgt
ctagatggac gcctgtaatt aaggatatta 1020tggaagacgc tattgaagat
aaattagatc aaaaacactt tccattttta gctggccgag 1080cgcaaaccag
tgcttaccac gccccaacaa gtgctcgata tggtcattgg cataaagaca
1140aggcccagca gacagtgaaa aatgtgccca gaataattgt cttcattgtt
ggaggcatga 1200gtttttcaga aatcagatgt gcgtatgagg taacaaacgc
ccaaaaaaat tgggaggtca 1260ttattggatc ctccaacatt ttgactcccc
aaagttttct taaggattta aacactctta 1320cagtctagga ttcaggaaaa
aaagttactt ttaatatacc tgataattaa aaatgctttc 1380gtcatgtgaa
tttgattgct taagataaat ggttagtttt actggaattt ttaattgtag
1440ttgacatttt gagatatttg tacctactaa cgttaaaaat gtgcagacct
aagcaagata 1500ttacaatata atcttggatg ctagtctatc ttccctttct
aaaaataact tttattttta 1560ataattataa ttctggattg aaaaataaaa
tgtatgtaaa gtacttaagg gaactgatta 1620ttttttttat tttttaagtt
gagcagtctc acacaaacaa tacattactc gtgcgccagc 1680gcacttcata
gacttctaaa aaaaacattg ggtataaaaa actgttctca atttactaac
1740ggaacattta aatttatttt aagcccctaa gctttaatta ttaaaaattg
tataaatgtt 1800gttagaaata aagtaagttt tcaaaggcgt tatataaatg
tttagcgtgt tatggcgttt 1860aacaccataa ttcaaaaata tcaaatattt
aaagttattt atcacgtttt tattgttatt 1920tcttgttata agtagttttt
tagatactta aacttgtatt gtattcagta tttcttttca 1980atagttatac
atgtattata ttctacaata aatttagcaa aattaaaatt gtcaatttta
2040ttaagatata gtatagtatt ttgtcttttt aagacaaaat gtaacataat
taaattttat 2100ccgaattcat aaaaatattg ttgttccttt catgacaaag
tggccaagtc cagttttatt 2160taaaaatgta atacaaaata tagctgcttt
taacacagaa tactgtacat aaaatctacc 2220taaaaaatac agtgtgcttt
attgacaaca aatgtaattt tttgtatata tgcagacacc 2280accacactgg
acttggtaat ccaattctca taaaaggaat cttatatgtt aaagtaaggt
2340tgtggttcat ctcatcttga gagaataata atttttacct tgttacacca
ctccaaaaaa 2400atgcctgatt atacaaaatt ggcaacaaaa actatggata
caagttattt cagtaactta 2460taactattgt aatgctataa tggtacc
2487132441PRTMeligethes aeneus 132Val Phe Ser Leu Asp Cys Pro Glu
Thr Phe Gln Cys Ser Tyr Asp Pro1 5 10 15Ala Met Glu Ala Ala Arg Asn
Ala Asn Met Glu Arg Met Ala Glu Gln 20 25 30Ile Ala Thr Leu Cys Ala
Thr Leu Gly Glu Tyr Pro Ser Val Arg Tyr 35 40 45Arg Ser Asp Trp Glu
Arg Asn Val Glu Leu Ala Gln Met Ile Gln Gln 50 55 60Lys Leu Asp Ala
Tyr Lys Ala Asp Glu Pro Thr Met Gly Glu Gly Pro65 70 75 80Glu Lys
Ala Arg Ser Gln Leu Leu Ile Leu Asp Arg Gly Phe Asp Cys 85 90 95Val
Ser Pro Met Leu His Glu Leu Thr Phe Gln Ala Met Ala Tyr Asp 100 105
110Leu Leu Pro Ile Glu Asn Asp Val Tyr Lys Tyr Glu Ala Ser Ala Gly
115 120 125Val Phe Lys Glu Val Leu Leu Asp Glu Asn Asp Glu Leu Trp
Val Glu 130 135 140Leu Arg His Gln His Ile Ala Val Val Ser Gln Ser
Val Thr Lys Asn145 150 155 160Leu Lys Lys Phe Thr Asp Ser Lys Arg
Met Thr Gln Ser Asp Lys Gln 165 170 175Ser Met Lys Asp Leu Ser Gln
Met Ile Lys Lys Met Pro Gln Tyr Gln 180 185 190Lys Glu Leu Ser Lys
Tyr Ala Thr His Leu His Leu Ala Glu Asp Cys 195 200 205Met Lys Ser
Tyr Gln Gly Tyr Val Asp Lys Leu Cys Lys Val Glu Gln 210 215 220Asp
Leu Ala Met Gly Thr Asp Ala Glu Gly Glu Lys Ile Lys Asp His225 230
235 240Met Arg Asn Ile Val Pro Ile Leu Leu Asp Pro Lys Ile Thr
Asn
Glu 245 250 255Tyr Asp Lys Met Arg Ile Ile Ala Leu Tyr Ala Met Ile
Lys Asn Gly 260 265 270Ile Thr Asp Glu Asn Leu Ser Lys Leu Ala Thr
His Ala Gln Ile Lys 275 280 285Asp Lys Gln Thr Ile Ala Asn Leu Gln
Phe Leu Gly Val Asn Val Ile 290 295 300Asn Asp Gly Gly Asn Arg Lys
Lys Pro Tyr Ser Val Pro Arg Lys Glu305 310 315 320Arg Ile Thr Glu
Gln Thr Tyr Gln Met Ser Arg Trp Thr Pro Val Ile 325 330 335Lys Asp
Ile Met Glu Asp Ala Ile Glu Asp Lys Leu Asp Gln Lys His 340 345
350Phe Pro Phe Leu Ala Gly Arg Ala Gln Thr Ser Ala Tyr His Ala Pro
355 360 365Thr Ser Ala Arg Tyr Gly His Trp His Lys Asp Lys Ala Gln
Gln Thr 370 375 380Val Lys Asn Val Pro Arg Ile Ile Val Phe Ile Val
Gly Gly Met Ser385 390 395 400Phe Ser Glu Ile Arg Cys Ala Tyr Glu
Val Thr Asn Ala Gln Lys Asn 405 410 415Trp Glu Val Ile Ile Gly Ser
Ser Asn Ile Leu Thr Pro Gln Ser Phe 420 425 430Leu Lys Asp Leu Asn
Thr Leu Thr Val 435 4401332635DNAMeligethes aeneus 133taaaaaaata
aaagttttct gtcagtgcat acttattgac tttttaaatg tggcatcctt 60gcattcctat
ttgacattta atgataattg tgcagtgggt gctattaaaa attatattgt
120ttaaataggt agttaaaata ttataaaata ttgttagagt gttcatcaca
aattatatgc 180aatatggcgt taaaaggaca agttgggcaa aaaattatga
acgaggtaat aaagcataaa 240ccaaagaaaa atggacccgc tcatggagtg
gaatggagag ttttggttgt ggatcaactt 300gccatgagaa tggtttcagc
ctgttgtaaa atgcacgata tttcagctga gggcatcaca 360ttggttgaag
atataaacaa gaaaagagaa cccttaaaca ccatggaagc aatatatcta
420ataacaccat ctgaaaaatc tgttcactca ctgatgaacg attttgaatc
gccaagactt 480atgtacaaag gggcacatgt attttttact gaagcatgcc
ctgataattt atttcaaaaa 540ttgtctcaac atccagtagt gaaatatatt
aaaacttgta aagaaatcaa cattgcattt 600ataccaaatg aatcacaggt
gttttctttg gactgcccag aaacattcca atgcagttat 660gatcctgcta
tggaagcagc cagaaatgca aacatggaga gaatggcaga acaaattgct
720acattgtgtg caactctggg agaataccct tcagtaagat accgaagtga
ttgggaacgc 780aacgtggaac tagcgcagat gattcagcaa aagttggatg
cctataaagc ggatgagccc 840acaatgggag aggggcctga aaaagcgaga
tcgcaacttt tgattcttga ccgcggcttc 900gactgcgtat cacccatgct
gcacgaactt acattccagg caatggccta cgatttgctg 960ccaatcgaaa
acgacgtgta caaatatgaa gcttcagcgg gagtatttaa ggaagtgttg
1020ctcgacgaaa acgacgagtt atgggtagaa ttacgacatc agcatatcgc
tgtagtgtcg 1080cagagtgtga cgaaaaactt gaagaaattt accgattcaa
aacgaatgac ccaaagtgat 1140aaacaatcaa tgaaagatct gtcacaaatg
attaagaaaa tgccccaata tcaaaaggag 1200ttatctaaat atgctacaca
cttgcatctt gctgaagact gcatgaaatc ttaccaagga 1260tatgttgaca
aattatgtaa agttgaacaa gacctagcaa tgggtacaga tgcagaagga
1320gaaaaaatta aagaccatat gcgtaacatc gtaccgattt tacttgatcc
aaaaataaca 1380aacgaatatg acaaaatgag aataattgct ctatatgcaa
tgattaaaaa tggcataacc 1440gacgaaaatt tatcaaaact tgctactcat
gcccaaataa aagacaaaca aactattgct 1500aatttgcaat tcttgggagt
taatgttatc aatgatggtg ggaaccggaa aaaaccgtat 1560tcggtgccaa
gaaaagagcg tattactgaa caaacgtatc aaatgtctag atggacgcct
1620gtaattaagg atattatgga agacgctatt gaagataaat tagatcaaaa
acactttcca 1680tttttagctg gccgagcgca aaccagtgct taccacgccc
caacaagtgc tcgatatggt 1740cattggcata aagacaaggc ccagcagaca
gtgaaaaatg tgcccagaat aattgtcttc 1800attgttggag gcatgagttt
ttcagaaatc agatgtgcgt atgaggtaac aaacgcccaa 1860aaaaattggg
aggtcattat tggatcctcc aacattttga ctccccaaag ttttcttaag
1920gatttaaaca ctcttacagt ctaggattca ggaaaaaaag ttacttttaa
tatacctgat 1980aattaaaaat gctttcgtca tgtgaatttg attgcttaag
ataaatggtt agttttactg 2040gaatttttaa ttgtagttga cattttgaga
tatttgtacc tactaacgtt aaaaatgtgc 2100agacctaagc aagatattac
aatataatct tggatgctag tctatcttcc ctttctaaaa 2160ataactttta
tttttaataa ttataattct ggattgaaaa ataaaatgta tgtaaagtac
2220ttaagggaac tgattatttt ttttattttt taagttgagc agtctcacac
aaacaataca 2280ttactcgtgc gccagcgcac ttcatagact tctaaaaaaa
acattgggta taaaaaactg 2340ttctcaattt actaacggaa catttaaatt
tattttaagc ccctaagctt taattattaa 2400aaattgtata aatgttgtta
gaaataaagt aagttttcaa aggcgttata taaatgttta 2460gcgtgttatg
gcgtttaaca ccataattca aaaatatcaa atatttaaag ttatttatca
2520cgtttttatt gttatttctt gttataagta gttttttaga tacttaaact
tgtattgtat 2580tcagtatttc ttttcaatag ttatacatgt attatattct
acaataaatt tagca 2635134586PRTMeligethes aeneus 134Met Ala Leu Lys
Gly Gln Val Gly Gln Lys Ile Met Asn Glu Val Ile1 5 10 15Lys His Lys
Pro Lys Lys Asn Gly Pro Ala His Gly Val Glu Trp Arg 20 25 30Val Leu
Val Val Asp Gln Leu Ala Met Arg Met Val Ser Ala Cys Cys 35 40 45Lys
Met His Asp Ile Ser Ala Glu Gly Ile Thr Leu Val Glu Asp Ile 50 55
60Asn Lys Lys Arg Glu Pro Leu Asn Thr Met Glu Ala Ile Tyr Leu Ile65
70 75 80Thr Pro Ser Glu Lys Ser Val His Ser Leu Met Asn Asp Phe Glu
Ser 85 90 95Pro Arg Leu Met Tyr Lys Gly Ala His Val Phe Phe Thr Glu
Ala Cys 100 105 110Pro Asp Asn Leu Phe Gln Lys Leu Ser Gln His Pro
Val Val Lys Tyr 115 120 125Ile Lys Thr Cys Lys Glu Ile Asn Ile Ala
Phe Ile Pro Asn Glu Ser 130 135 140Gln Val Phe Ser Leu Asp Cys Pro
Glu Thr Phe Gln Cys Ser Tyr Asp145 150 155 160Pro Ala Met Glu Ala
Ala Arg Asn Ala Asn Met Glu Arg Met Ala Glu 165 170 175Gln Ile Ala
Thr Leu Cys Ala Thr Leu Gly Glu Tyr Pro Ser Val Arg 180 185 190Tyr
Arg Ser Asp Trp Glu Arg Asn Val Glu Leu Ala Gln Met Ile Gln 195 200
205Gln Lys Leu Asp Ala Tyr Lys Ala Asp Glu Pro Thr Met Gly Glu Gly
210 215 220Pro Glu Lys Ala Arg Ser Gln Leu Leu Ile Leu Asp Arg Gly
Phe Asp225 230 235 240Cys Val Ser Pro Met Leu His Glu Leu Thr Phe
Gln Ala Met Ala Tyr 245 250 255Asp Leu Leu Pro Ile Glu Asn Asp Val
Tyr Lys Tyr Glu Ala Ser Ala 260 265 270Gly Val Phe Lys Glu Val Leu
Leu Asp Glu Asn Asp Glu Leu Trp Val 275 280 285Glu Leu Arg His Gln
His Ile Ala Val Val Ser Gln Ser Val Thr Lys 290 295 300Asn Leu Lys
Lys Phe Thr Asp Ser Lys Arg Met Thr Gln Ser Asp Lys305 310 315
320Gln Ser Met Lys Asp Leu Ser Gln Met Ile Lys Lys Met Pro Gln Tyr
325 330 335Gln Lys Glu Leu Ser Lys Tyr Ala Thr His Leu His Leu Ala
Glu Asp 340 345 350Cys Met Lys Ser Tyr Gln Gly Tyr Val Asp Lys Leu
Cys Lys Val Glu 355 360 365Gln Asp Leu Ala Met Gly Thr Asp Ala Glu
Gly Glu Lys Ile Lys Asp 370 375 380His Met Arg Asn Ile Val Pro Ile
Leu Leu Asp Pro Lys Ile Thr Asn385 390 395 400Glu Tyr Asp Lys Met
Arg Ile Ile Ala Leu Tyr Ala Met Ile Lys Asn 405 410 415Gly Ile Thr
Asp Glu Asn Leu Ser Lys Leu Ala Thr His Ala Gln Ile 420 425 430Lys
Asp Lys Gln Thr Ile Ala Asn Leu Gln Phe Leu Gly Val Asn Val 435 440
445Ile Asn Asp Gly Gly Asn Arg Lys Lys Pro Tyr Ser Val Pro Arg Lys
450 455 460Glu Arg Ile Thr Glu Gln Thr Tyr Gln Met Ser Arg Trp Thr
Pro Val465 470 475 480Ile Lys Asp Ile Met Glu Asp Ala Ile Glu Asp
Lys Leu Asp Gln Lys 485 490 495His Phe Pro Phe Leu Ala Gly Arg Ala
Gln Thr Ser Ala Tyr His Ala 500 505 510Pro Thr Ser Ala Arg Tyr Gly
His Trp His Lys Asp Lys Ala Gln Gln 515 520 525Thr Val Lys Asn Val
Pro Arg Ile Ile Val Phe Ile Val Gly Gly Met 530 535 540Ser Phe Ser
Glu Ile Arg Cys Ala Tyr Glu Val Thr Asn Ala Gln Lys545 550 555
560Asn Trp Glu Val Ile Ile Gly Ser Ser Asn Ile Leu Thr Pro Gln Ser
565 570 575Phe Leu Lys Asp Leu Asn Thr Leu Thr Val 580 585
* * * * *