Composition For Increasing Expression Of Blood Coagulation Factor Gene, Comprising Core-shell Structured Microparticles As Active Ingredient

Abstract

The present disclosure relates to a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient. When administered in vivo along with blood coagulation factor VIII gene or a variant gene thereof, the composition for increasing the expression of a blood coagulation factor gene of the present disclosure can increase the expression of the gene by at least 30%. When administered along with a gene therapeutic agent, the composition can achieve a therapeutic effect even with a very small amount of a gene, and thus is useful.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient.

BACKGROUND ART

[0002] Hemophilia is one of severe genetic disorders. Hemophilia A is an X gene-linked disease occurring in 1 in 5000 males. It arises from the mutation of human blood coagulation factor VIII (also known as factor VIII, factor 8, FVIII or F8), which is an important plasma glycoprotein in blood clotting.

[0003] Before the 1980s, patients with hemophilia received administration of blood coagulation factor VIII extracted from the plasma of other people for treatment. But, this method had severe problems such as viral infection, etc. In order to overcome this advantage, full-length factor VIII produced in CHO cells, etc. based on recombinant protein researches are used for treatment since the 1980s.

[0004] The inventors of the present disclosure have researched to develop a gene therapeutic agent capable of achieving therapeutic effect even with a small amount of a gene. In doing so, they have identified that, when core-shell structured microparticles consisting of a halogenated hydrocarbon and/or halogenated sulfur as a core and a lipid component as an outer shell are administered in vivo along with a blood coagulation factor VIII gene, the expression of the blood coagulation factor gene is increased remarkably, and have completed the present disclosure.

REFERENCES OF RELATED ART

Patent Documents

[0005] (Patent document 001) KR 10-1542752 B.

[0006] (Patent document 002) KR 10-2018-0118659 A.

DISCLOSURE

Technical Problem

[0007] The present disclosure is directed to providing a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient.

[0008] The present disclosure is also directed to providing a pharmaceutical composition for preventing or treating a bleeding disorder or bleeding, which contains the composition described above.

Technical Solution

[0009] The present disclosure provides a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient, wherein the core is a halogenated hydrocarbon, halogenated sulfur or a mixture thereof as a biocompatible gas, and the shell is a lipid or a derivative thereof, and the blood coagulation factor gene is one or more gene selected from a human blood coagulation factor VIII gene or a variant gene thereof.

[0010] In an exemplary embodiment of the present disclosure, the biocompatible gas may be selected from sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, chlorotrifluoromethane, chloropentafluoroethane, dichlorotetrafluoroethane and a mixture thereof.

[0011] In an exemplary embodiment of the present disclosure, the halogenated hydrocarbon may be a perfluorinated hydrocarbon.

[0012] In an exemplary embodiment of the present disclosure, the perfluorinated hydrocarbon may be perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane, perfluoropropene, perfluorobutene, perfluorobutadiene, perfluorobut-2-ene, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclobutane, perfluorocyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane or a mixture thereof.

[0013] In an exemplary embodiment of the present disclosure, the lipid may be one or more selected from a group consisting of a simple lipid, a phospholipid, a glyceroglycolipid, a sphingoglycolipid, a cholesterol and a cationic lipid.

[0014] In an exemplary embodiment of the present disclosure, the phospholipid may be selected from a group consisting of a phosphatidylcholine derivative, a phosphatidylethanolamine derivative, a phosphatidylserine derivative, a diacetylated phospholipid, L-.alpha.-dioleyl phosphatidylethanolamine, diolein, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, sphingomyelin, a polyethylene glycolated phospholipid, egg yolk lecithin, soy lecithin and a hydrogenated phospholipid.

[0015] In an exemplary embodiment of the present disclosure, the glyceroglycolipid may be selected from a group consisting of sulfoxyribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride and glycosyl diglyceride.

[0016] In an exemplary embodiment of the present disclosure, the sphingoglycolipid may be galactosyl cerebroside, lactosyl cerebroside or ganglioside.

[0017] In an exemplary embodiment of the present disclosure, the cationic lipid may be selected from a group consisting of 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), N-(2,3-dioleyloxypropan-1-yl)-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanamin- ium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyloxypropyl-3-diethylhydroxyethylammonium bromide (DORIE) and 3.beta.-[N--(N'N'-dimethylaminoethylhy)carbamoyl]cholesterol (DC-Chol).

[0018] In an exemplary embodiment of the present disclosure, the blood coagulation factor VIII may be composed of an amino acid sequence represented by SEQ ID NO 1, and the variant of blood coagulation factor VIII may be composed of an amino acid sequence represented by SEQ ID NO 3.

[0019] In an exemplary embodiment of the present disclosure, the composition may increase the expression of the blood coagulation factor gene by 30% or more.

[0020] The present disclosure also provides a pharmaceutical composition for preventing or treating a bleeding disorder or bleeding, which contains the composition described above and a human blood coagulation factor VIII gene or a variant gene thereof.

[0021] In an exemplary embodiment of the present disclosure, the bleeding disorder may be hemophilia A, hemophilia induced or complicated by an inhibitory antibody against blood coagulation factor VIII or blood coagulation factor Villa, or hemophilia B.

[0022] In an exemplary embodiment of the present disclosure, the bleeding disorder or bleeding may be one selected from a group consisting of neonatal coagulopathy, severe liver disease, thrombocytopenia, congenital deficiency of factor V, VII, X or XI, and von Willebrand disease having an inhibitor against von Willebrand factor.

[0023] In an exemplary embodiment of the present disclosure, the bleeding may be caused by blood loss associated with high-risk surgical procedures, traumatic blood loss, blood loss caused by bone marrow transplantation or blood loss caused by cerebral hemorrhage.

Advantageous Effects

[0024] A composition for increasing the expression of a blood coagulation factor gene of the present disclosure may increase the expression of the blood coagulation factor gene by at least 30% when administered in vivo along with blood coagulation factor VIII gene or a variant gene thereof (e.g., a polynucleotide encoding the gene or a vector including the same). Accordingly, it is useful since a therapeutic effect can be achieved with a very small amount of the gene when the composition is administered along with a gene therapeutic agent.

BRIEF DESCRIPTION OF DRAWINGS

[0025] FIG. 1 schematically illustrates a process of designing a blood coagulation factor VIII variant (F8M) according to an exemplary embodiment of the present disclosure.

[0026] FIG. 2 shows the cleavage map of a pGP vector according to an exemplary embodiment of the present disclosure.

[0027] FIG. 3 compares the expression level of the F8 protein in mouse depending on the administration of pGP-F8M (gene only), a pharmaceutical composition of a control group (F8M-JetPEI) and pharmaceutical compositions according to Example (F8M-MP1 and F8M-MP2).

[0028] FIG. 4 compares the expression level of the F9 protein in mouse depending on the administration of pGP-F9 (gene only) and pharmaceutical compositions according to Comparative Example (F9-MP1 and F9-MP2).

[0029] FIG. 5 schematically shows the domain structure constituting human blood coagulation factor VIII according to an exemplary embodiment of the present disclosure.

BEST MODE

[0030] Hereinafter, the present disclosure is described in detail.

[0031] In an aspect, the present disclosure provides a composition for increasing the expression of a blood coagulation factor gene, which contains core-shell structured microparticles as an active ingredient, wherein the core is a halogenated hydrocarbon, halogenated sulfur or a mixture thereof as a biocompatible gas, and the shell is a lipid or a derivative thereof, and the blood coagulation factor gene is one or more gene selected from a human blood coagulation factor VIII gene or a variant gene thereof.

[0032] Core

[0033] In the present disclosure, the "core" may be composed of a halogenated hydrocarbon, halogenated sulfur or a mixture thereof as a biocompatible gas.

[0034] The biocompatible gas may be sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, chlorotrifluoromethane, chloropentafluoroethane, dichlorotetrafluoroethane or a mixture thereof.

[0035] Specifically, the halogenated hydrocarbon may be a perfluorinated hydrocarbon.

[0036] The perfluorinated hydrocarbon may be perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane, perfluoropropene, perfluorobutene, perfluorobutadiene, perfluorobut-2-ene, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclobutane, perfluorocyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane or a mixture thereof.

[0037] Specifically, the biocompatible gas of the present disclosure may be sulfur hexafluoride or perfluorobutane.

[0038] Shell. In the present disclosure, the "shell" may be composed of a lipid or a derivative thereof.

[0039] The lipid may be one or more selected from a group consisting of a simple lipid, a phospholipid, a glyceroglycolipid, a sphingoglycolipid, a cholesterol and a cationic lipid.

[0040] Specifically, it may be a phospholipid.

[0041] The phospholipid may be a phosphatidylcholine derivative, a phosphatidylethanolamine derivative, a phosphatidylserine derivative, diacetylated phospholipid, L-.alpha.-dioleyl phosphatidylethanolamine, diolein, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, sphingomyelin, polyethylene glycolated phospholipid, egg yolk lecithin, soy lecithin, a hydrogenated phospholipid, etc.

[0042] The glyceroglycolipid may be sulfoxyribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride, glycosyl diglyceride, etc.

[0043] The sphingoglycolipid may be galactosyl cerebroside, lactosyl cerebroside, ganglioside, etc.

[0044] And, the cationic lipid may be 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), N-(2,3-dioleyloxypropan-1-yl)-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanamin- ium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyloxypropyl-3-diethylhydroxyethylammonium bromide (DORIE), 3.beta.-[N--(N'N'-dimethylaminoethylhy)carbamoyl]cholesterol (DC-Chol), etc.

[0045] Microparticles. The microparticles of the present disclosure are stabilized by the shell which surrounds the core gas. The shell retards the diffusion of a gas to nearby liquid and prevents fusion between the microparticles.

[0046] When administered in vivo, the microparticle retains its shape until it reaches a target cell or tissue, and releases the gas as it is destroyed near the target cell or tissue. The released gas may cause change in the cell membrane of the target cell and may facilitate the entry of the growth factor gene into the cytoplasmic environment of the target cell via the jet force of the gas.

[0047] The microparticles may have an average diameter of 1-10 .mu.m, specifically 2-8 .mu.m, more specifically 2-4 .mu.m.

[0048] Composition for increasing gene expression Recently, there have been many researches on core-shell microparticles having a gas as a core. In the previous researches, the effect of increasing gene expression was not achieved unless ultrasound was irradiated together with the microparticles.

[0049] Specifically, Sang-Chol Lee et al., Korean Circulation J 2006; 36: 32-38; "Enhancement of Gene Delivery into Mouse Skeletal Muscle with Microbubble Destruction by Low-Frequency Ultrasound" discloses that the effect of increasing gene expression is not achieved when only a luciferase gene-microparticles mixture is injected without irradiation of ultrasound.

[0050] ZP Shen et al., Gene Therapy (2008) 15, 1147-1155; "Ultrasound with microbubbles enhances gene expression of plasmid DNA in the liver via intraportal delivery" also discloses that the effect of increasing gene expression is not achieved when only a luciferase gene-microparticles mixture is injected without irradiation of ultrasound.

[0051] In addition, Xingsheng Li et al., J Ultrasound Med 2008; 27: 453-460; "Experimental Research on Therapeutic Angiogenesis Induced by Hepatocyte Growth Factor Directed by Ultrasound-Targeted Microbubble Destruction in Rats" discloses that the effect of increasing gene expression is not achieved when only a HGF gene-liposome microparticles mixture is injected without irradiation of ultrasound.

[0052] However, the inventors of the present disclosure have identified that, while studying on the use of microparticles, the expression level of a blood coagulation factor gene, particularly a blood coagulation factor VIII gene, is increased remarkably even without ultrasound irradiation when the gene is injected along with the microparticles according to the present disclosure, and have completed the present disclosure. Meanwhile, as described specifically in the test example described later, the effect of increasing gene expression was not achieved with the microparticles for blood coagulation factor genes other than the blood coagulation factor VIII gene or a variant gene thereof (e.g., blood coagulation factor IX (also known as factor IX, factor 9, FIX or F9)).

[0053] When administered in vivo along with a blood coagulation factor VIII gene or a variant gene thereof, the composition for increasing gene expression of the present disclosure can increase the expression level of the blood coagulation factor gene by at least 30%.

[0054] In the examples described below, it was verified that, when administered along with a human blood coagulation factor VIII variant gene into mouse, the composition for increasing gene expression of the present disclosure increases the expression level of the blood coagulation factor VIII gene remarkably. More specifically, it was verified that, when the composition for increasing gene expression of the present disclosure and the blood coagulation factor VIII variant gene are administered together into an animal model, the expression level of the blood coagulation factor VIII gene is increased by 40% or more. In contrast, for a blood coagulation factor IX gene, the expression of the gene was hardly increased even when the composition for increasing gene expression of the present disclosure was administered together into mouse.

[0055] That is to say, it seems that the composition for increasing gene expression of the present disclosure is effective in increasing the expression level of the human blood coagulation factor gene specifically only when administered along with one or more gene selected from human blood coagulation factor VIII gene and a variant gene thereof, from among blood coagulation factors.

[0056] The composition may further contain a pharmaceutical adjuvant such as a stabilizer, a buffer, a salt for control of osmotic pressure, an excipient, an antiseptic, etc. or other therapeutically useful substances, and may be prepared into various formulations for oral or parenteral administration, specifically for parenteral administration, according to common methods. Specifically, a formulation for parenteral administration may be typically an injection formulation in the form of an isotonic aqueous solution or suspension. Alternatively, the composition may be prepared into a powder and then suspended in a solvent immediately before administration.

[0057] In the composition for increasing gene expression of the present disclosure, the content of the microparticles may be 0.5-2,000 .mu.L/mL, specifically 1-1,000 .mu.L/mL or 5-2,000 .mu.g/mL, specifically 10-1,000 .mu.g/mL, although not being particularly limited.

[0058] If the content of the microparticles is outside the above range, the desired effect cannot be achieved.

[0059] Specifically, the composition may be administered as a mixture with a gene to achieve a better effect.

[0060] Gene

[0061] The composition for increasing gene expression according to the present disclosure may further increase the expression and efficiency of genes when administered along with the following genes.

[0062] Blood Coagulation Factor VIII

[0063] In the present disclosure, the terms "blood coagulation factor VIII", "factor VIII", "FVIII" and "F8" are used interchangeably. Mature human blood coagulation factor VIII is composed of 2351 amino acids (including signal peptides), which are arranged in a domain structure shown in FIG. 5.

[0064] In FIG. 5, a1, a2 and a3 are acidic domains. The acidic domain a3 is known to be involved in the binding of the blood coagulation factor VIII molecule to a von Willebrand factor (vWF), which plays an important role in blood coagulation. In the process of secretion, the blood coagulation factor VIII is cleaved between the B-domain and the a3 acidic domain, resulting in a heterodimeric polypeptide. The blood coagulation factor VIII heterodimer consists of a light chain (including A3, C1 and C2) and a heavy chain of variable size (including A1, A2 and B). The heavy chain is heterogeneous due to limited proteolysis in the B-domain. In case of heterodimeric B-domain-deleted blood coagulation factor VIII, the "heavy chain" includes A1 and A2 but the B-domain is deleted partially or wholly.

[0065] The amino acid sequence of mature wild-type human blood coagulation factor VIII is shown in SEQ ID NO 1. The reference of an amino acid position of a specific sequence means the position of the amino acid in the VIII wild-type protein and does not exclude the presence of mutations (e.g., deletion, insertion and/or substitution) at other positions in the sequence. A DNA sequence encoding SEQ ID NO 1 is represented by SEQ ID NO 2.

[0066] "Blood coagulation factor VIII" includes not only wild-type blood coagulation factor VIII but also derivatives of the wild-type blood coagulation factor VIII having the procoagulant activity of the wild-type blood coagulation factor VIII. The derivative may have a sequence with deletion, insertion and/or addition as compared to the amino acid sequence of the wild-type blood coagulation factor VIII. Specifically, the derivative may be a molecule of blood coagulation factor VIII with all or part of the B-domain deleted. Throughout the present disclosure, the positions amino acids always refer to the positions of individual amino acids in the full-length mature wild-type blood coagulation factor VIII (including signal peptides).

[0067] Blood Coagulation Factor VIII Variant

[0068] In the present disclosure, the term "variant" includes conservative or non-conservative substitution, insertion or deletion of an amino acid sequence, a nucleic acid sequence, etc., and such change does not substantially alter the active site or active domain that confers the biological activity of FVIII.

[0069] The blood coagulation factor VIII variant according to the present disclosure is a single-chain blood coagulation factor VIII variant in which amino acids Asp784 to Arg1671 are deleted from blood coagulation factor VIII represented by SEQ ID NO 1. The blood coagulation factor VIII variant is one in which a part of the B-domain (residues 784-1667) and a part of the a3 domain (residues 1668-1671) are deleted, and the variant exhibits enhanced protein expression and improved blood coagulation activity and stability as compared to blood coagulation factor VIII and B-domain-deleted blood coagulation factor VIII. The blood coagulation factor VIII variant has an amino acid sequence represented by SEQ ID NO 3.

[0070] The "single-chain blood coagulation factor VIII" means a blood coagulation factor VIII molecule which exists as a single polypeptide chain without being cleaved into tow chains (e.g., a heavy chain and a light chain) by proteolysis during secretion from a cell expressing the blood coagulation factor VIII molecule.

[0071] In addition, the blood coagulation factor VIII variant may be expressed as a polynucleotide encoding the amino acid sequence.

[0072] Polynucleotide

[0073] In the present disclosure, the term "polynucleotide(s)" refers to any polyribonucleotide or polydeoxyribonucleotide which may be an unmodified RNA or DNA or a modified RNA or DNA. The polynucleotide of the present invention may be a single-chain DNA or RNA. As used herein, the term "polynucleotide(s)" includes a DNA or RNA containing modified bases and/or unique bases such as inosine. It is obvious that various modifications can be made to the DNA or RNA to serve a known useful purpose. As used herein, the term "polynucleotide(s)" includes such chemically, enzymatically or metabolically modified polynucleotide(s).

[0074] Those skilled in the art will appreciate that the blood coagulation factor VIII variant may be encoded by several polynucleotides due to the degeneracy of the genetic code. In other words, a polynucleotide sequence encoding the blood coagulation factor VIII variant that can be used in the present invention is interpreted to include a nucleotide sequence showing substantial identity to the amino acid sequence.

[0075] Plasmid

[0076] When the composition for increasing gene expression according to the present disclosure is administered along with a plasmid containing a single-chain polynucleotide encoding the gene, the expression efficiency and efficacy of the gene may be increased further.

[0077] In the present disclosure, the term "plasmid" generally refers to a circular DNA molecule formed by being operably linked to a vector so that an exogenous gene can be expressed in a host cell. However, the plasmid can be used as a vector that is degraded by specific restriction enzymes by gene recombination to incorporate a desired gene. Thus, the terms plasmid and vector are used interchangeably herein, and those skilled in the art of genetic engineering will fully understand their meanings even if they are not distinguished by names.

[0078] In the present disclosure, the term "vector" refers to a DNA molecule as a carrier that can stably transport an exogenous gene into a host cell. To be a useful vector, it must be replicable, have a way to enter the host cell, and be equipped with a means to detect its presence.

[0079] Expression

[0080] Expression Vector

[0081] The composition for increasing gene expression according to the present disclosure can further increase the expression and efficiency of a gene when administered along with expression vectors including single-chain polynucleotides encoding the gene.

[0082] In the present disclosure, the term "expression" refers to generation of the gene in a cell.

[0083] In the present disclosure, the term "expression vector" refers to a vector capable of expressing a target gene in a suitable host, and means a gene construct including an essential regulatory element operably linked to express a gene insert.

[0084] In the present disclosure, the term "operably linked" means that a nucleic acid expression-regulating sequence and a polynucleotide encoding a target gene are functionally linked to perform a general function. For example, a promoter and a polynucleotide encoding the gene may be operably linked to affect the expression of the polynucleotide. The operable linkage to a recombinant vector may be prepared using a genetic recombinant technique well known in the art, and site-specific DNA cleavage and ligation may be achieved using enzymes generally known in the art.

[0085] The expression vector of the present disclosure may be prepared using a plasmid, a vector or a viral vector, although not being limited thereto. An appropriate expression vector may include an expression-regulating element such as a promoter, an operator, a start codon, a stop codon, a polyadenylation signal, an enhancer, etc. and may be prepared variously according to purposes. The promoter of the vector may be constitutive or inducible. Since a plasmid is the most commonly used form of a vector at present, the terms "plasmid" and "vector" are used sometimes interchangeably in the present disclosure. For the purpose of the present disclosure, it is preferred to use a plasmid vector. A typical plasmid vector that can be used for this purpose has a structure including (a) a replication origin for effective replication into several to hundreds of plasmid vectors per host cell and (b) a restriction enzyme site into which a fragment of foreign DNA can be inserted. Even if a proper restriction enzyme site does not exist, the vector and foreign DNA can be easily ligated using synthetic oligonucleotide adaptors or linkers according to common methods.

[0086] A vector used for overexpression of a gene according to the present disclosure may be an expression vector known in the art. A framework vector that may be used in the present disclosure may be selected from a group consisting of pCDNA3.1, pGP, pEF, pVAX, pUDK, pCK, pQE40, pT7, pET/Rb, pET28a, pET-22b(+) and pGEX, although not being particularly limited thereto. Specifically, use of a vector selected from a group consisting of pGP, pEF, pCK, pUDK and pVAX may be preferred in terms of effect.

[0087] In a specific exemplary embodiment, the expression vector of the present disclosure may be an expression vector including a pGP vector having a cleavage map of FIG. 2.

[0088] Pharmaceutical Composition

[0089] In another aspect, the present disclosure provides a pharmaceutical composition for preventing or treating a bleeding disorder or bleeding, which contains the composition for increasing gene expression of the present disclosure and the blood coagulation factor VIII gene or a variant gene thereof.

[0090] The bleeding disorder may be hemophilia A, hemophilia induced or complicated by an inhibitory antibody against blood coagulation factor VIII or blood coagulation factor Villa, or hemophilia B. In addition, the bleeding disorder or bleeding may be one selected from a group consisting of neonatal coagulopathy, severe liver disease, thrombocytopenia, congenital deficiency of factor V, VII, X or XI, and von Willebrand disease having an inhibitor against von Willebrand factor.

[0091] And, the bleeding may be one caused by blood loss associated with high-risk surgical procedures, traumatic blood loss, blood loss caused by bone marrow transplantation or blood loss caused by cerebral hemorrhage.

[0092] The pharmaceutical composition for preventing or treating a bleeding disorder or bleeding may be usefully used to prevent or treat a bleeding disorder or bleeding since it exhibits superior therapeutic effect because gene expression is increased in vivo even with a small amount of the blood coagulation factor VIII gene or a variant gene thereof.

[0093] In the pharmaceutical composition of the present disclosure, the composition for increasing gene expression and the blood coagulation factor VIII gene or a variant gene thereof may be contained with a volume ratio of 1:0.5-30 (w/v).

[0094] The pharmaceutical composition of the present disclosure may be for gene therapy.

[0095] Formulation

[0096] The pharmaceutical composition of the present disclosure may be prepared into pharmaceutical formulations for therapeutic purposes.

[0097] Pharmaceutical carriers and excipients and suitable pharmaceutical formulations are known in the art (e.g., "Pharmaceutical Formulation Development of Peptides and Proteins", Frokjaer et al., Taylor & Francis (2000) or "Handbook of Pharmaceutical Excipients", 3rd edition, Kibbe et al., Pharmaceutical Press (2000)). In particular, the pharmaceutical composition of the present disclosure may be formulated as a lyophilized form or a stable liquid form. The composition of the present disclosure may be freeze-dried through various procedures known in the art. The freeze-dried formulation is reconstituted by adding one or more pharmaceutically acceptable diluent such as sterile water for injection or sterile physiological saline.

[0098] The formulation of the composition is delivered to a subject via any pharmaceutical suitable means of administration. Various known delivery systems may be used to deliver the composition through any convenient routes. Mainly, the composition of the present disclosure is administered systemically. For systemic administration, the composition of the present disclosure is formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intraperitoneal, intracerebral, intrapulmonary, intranasal or transdermal) delivery or enteral (e.g., oral, vaginal or rectal) delivery according to common methods. The most preferred routes of administration are intravenous and intramuscular routes. These formulations can be administered continuously by infusion or by bolus injection. Some formulations encompass slow release systems.

[0099] The composition of the present disclosure is administered to a patient in a therapeutically effective dose, meaning a dose that is sufficient to produce the desired effect, preventing or lessening the severity or spread of the condition or indication being treated without reaching a dose which produces intolerable adverse effects. The exact dose depends on many factors such as the indication, formulation, mode of administration, etc. and has to be determined through preclinical and clinical trials for each respective indication.

[0100] The pharmaceutical composition of the present disclosure may be administered either alone or in combination with other therapeutic agents. These agents may be incorporated as a part of the same pharmaceutical.

[0101] Treatment Method

[0102] The present disclosure also relates to a method for treating a subject suffering from a bleeding disorder such as hemophilia A, hemophilia B or acquired hemophilia or a subject suffering from a chronic disease or liver disease. The treatment method may include a step of administering an effective amount of the pharmaceutical composition of the present disclosure to the subject.

[0103] According to an exemplary embodiment of the present disclosure, the gene of the present disclosure such as blood coagulation factor VIII gene or a variant gene thereof may be administered at a dose of 10 ng to 100 mg. When the administration of the blood coagulation factor VIII, a variant thereof or a polynucleotide encoding the same is repeated more than once, the administration dose may be the same or different for each administration.

[0104] Hereinafter, the present disclosure is described in more detail through specific examples. However, the examples are only for illustrating the present disclosure in more detail and it will be obvious to those of ordinary skill in the art that the scope of the present disclosure is not limited by them.

EXAMPLES

[0105] Preparation of Materials

[0106] Genes

[0107] Blood Coagulation Factor VIII (F8)

[0108] A gene full-length blood coagulation factor VIII (F8) represented by SEQ ID 1 was synthesized by Genscript (USA).

[0109] Variant of Blood Coagulation Factor VIII (F8M)

[0110] A full-length blood coagulation factor VIII gene represented by SEQ ID NO 1 was used as a template, and fragment 1 represented by SEQ ID NO 4 was prepared through polymerase chain reaction (PCR) using primers 1 and 2. The PCR was performed by mixing 2 .mu.L of the template DNA, 1 .mu.L of 10 pmol/.mu.L primer each, 2.5 .mu.L of 2.5 mM dNTP, 1 .mu.L of a pfu enzyme mix (Enzynomics, Korea), 2.5 .mu.L of a 10.times. buffer, and 50 .mu.L of sterilized triply distilled water. The solution was reacted for 30 seconds at 95.degree. C., 30 seconds at 60.degree. C. and 30 seconds at 72.degree. C. for 40 cycles. Using primers 3 and 4, fragment 2 represented by SEQ ID NO 5 was prepared by PCR as in the same manner as described above. Subsequently, the fragments 1 and 2 were subjected to overlapping PCR using primers 5 and 6, thereby preparing a single-chain blood coagulation factor VIII variant. In the overlapping PCR, 2 .mu.L of each DNA fragment was added, and reaction time and method were the same as described above in the PCR. FIG. 1 schematically illustrates the process of designing the blood coagulation factor VIII variant (F8M) according to an exemplary embodiment of the present disclosure.

[0111] The primers are summarized in Table 1 below.

TABLE-US-00001 TABLE 1 Primer No. Primer name Base sequence 1 F8(F) ATGCAAATAGAGCTCTCCACCTGCTTCTTT 2 F8M-1(R) TCTGACTGAAGAGTAGTATTTTCTGGAATT GTGGTGGCATTAAAT 3 F8M-2(F) CCACAATTCCAGAAAATACTACTCTTCAGT CAGATCAAGAGGAAATTGAC 4 F8(R) TCAGTAGAGGTCCTGTGCCTCGCAGCCCAG 5 F8 final(F) GCTAGCATGCAAATAGAGCTCTCCACCTGC 6 F8 final(R) GCGGCCGCTCAGTAGAGGTCCTGTGCCTCG CA

[0112] Blood Coagulation Factor IX (F9)

[0113] A gene of full-length blood coagulation factor IX (see GenBank base sequence FR846239.1) represented by SEQ ID NO 6 was synthesized by Bionics (Korea).

[0114] Plasmids (pGP)

[0115] After synthesizing pCK plasmids referring to the literature Lee et al. (Lee Y, et al. Improved expression of vascular endothelial growth factor by naked DNA in mouse skeletal muscles: implication for gene therapy of ischemic diseases. Biochem. Biophys. Res. Commun. 2000; 272(1): 230-235), PCR was conducted in the same manner described in the literature using primers 7 and 8 of Table 2 below. After reacting the obtained fragments with EcoRI enzyme at 37.degree. C. for 1 hour, DNA was purified using an Expin Gel SV (GeneAll, Korea) kit. Then, after conducting ligation for 30 minutes using T4 ligase, the DNA was incubated overnight with E. coli. Next day, after isolating DNA from the colony through mini-prep, pGP plasmids represented by SEQ ID NO 7 were obtained. FIG. 2 shows the cleavage map of the pGP vector according to an exemplary embodiment of the present disclosure.

TABLE-US-00002 TABLE 2 Primer Primer No. name Base sequence 7 pGP(F) GACGAATTCACGCGTCTCGAGGCGGCCGCTCTA GAGGGCCCGTTTAAA 8 pGP(R) GACGAATTCGTCGACGGATCCGCTAGCAAGCTT CGTGTCAAGGACGGT

Preparation Example

[0116] Preparation of Plasmid DNAs Including Genes

[0117] Each of the genes and each of the pGP plasmids prepared above were cleaved with NheI and NotI enzymes for 1 hour and fragments were separated by conducting electrophoresis on agarose gel. The separated fragments were ligated for 30 minutes using T4 ligase and then incubated overnight with E. coli. Next day, DNA was isolated from the colony through mini-prep, and then digested with NheI and NotI. The cloned DNA was incubated overnight with an E. coli supernatant digested with restriction enzymes in a 4-L flask in the presence of kanamycin. Plasmid DNAs produced using an Endofree Giga prep. kit (Qiagen, USA) were used in animal experiments. The prepared plasmid DNAs are summarized in Table 3.

TABLE-US-00003 TABLE 3 Gene Plasmid DNA Blood coagulation factor VIII (F8) pGP-F8 Blood coagulation factor VIII variant (F8M) pGP-F8M Blood coagulation factor IX (F9) pGP-F9

EXAMPLES

Example: Preparation of Pharmaceutical Composition Containing Composition for Increasinq Expression of Gene and F8M (F8M-MP1 and F8M-MP2)

[0118] Composition for Increasing Gene Expression

[0119] Core-shell structured microparticles with a reference code of 62400210, having an average diameter of about 2.5 .mu.m and composed of sulfur hexafluoride as a core and a lipid as a shell, were purchased from Bracco Imaging Korea (MP1). In addition, core-shell structured microparticles with a reference code of 646300210, having an average diameter of about 2.4-3.6 .mu.m and composed of perfluorobutane as a core and a shell including a lipid and a surfactant, were purchased from GE Healthcare Korea (MP2).

[0120] Preparation of Pharmaceutical Composition Containing Composition for Increasinq Gene Expression and F8M

[0121] Pharmaceutical compositions F8M-MP1 and F8M-MP2 were prepared by mixing 15 .mu.L of the compositions for increasing gene expression (MP1 and MP2), respectively, with the pGP-F8M prepared above (70 .mu.g/35 .mu.L).

Comparative Example: Preparation of Pharmaceutical Composition Containing Composition for Increasinq Gene Expression and F9 (F9-MP1 and F9-MP2)

[0122] Composition for Increasing Gene Expression

[0123] Compositions for increasing gene expression were prepared in the same manner as in Example.

[0124] Preparation of Pharmaceutical Composition Containing Composition for Increasing Gene Expression and F9

[0125] Pharmaceutical compositions F9-MP1 and F9-MP2 were prepared by mixing 15 .mu.L of the compositions for increasing gene expression (MP1 and MP2), respectively, with the pGP-F9 prepared above (70 .mu.g/35 .mu.L).

[0126] Control Group

[0127] Composition for Increasing Gene Expression

[0128] A suspension (corresponding to a composition for increasing gene expression) was prepared by mixing 128 .mu.L of in vivo JetPEI (Polyplus, USA) with 2 mL of 5% glucose according to the manufacturer's manual.

[0129] Preparation of Pharmaceutical Composition Containing Composition for Increasinq Gene Expression and Each Gene

[0130] A pharmaceutical compositions F8M-JetPEI was prepared by mixing 15 .mu.L of the composition with the pGP-F8M prepared above (70 .mu.g/35 .mu.L).

Test Example

Test Example: Expression Level of Protein in Mouse

[0131] Each of the pharmaceutical compositions according to the control group, example and comparative example was injected into the lower calf muscle of C57bl/6 mouse with 75 .mu.g/50 .mu.L/leg.

[0132] On day 7 after the administration, the mouse was sacrificed and the muscle at the injected area was excised. Then, total proteins were isolated after grinding the excised muscle was using liquid nitrogen and a protein extraction kit (Cell Biolabs, USA). The amounts of the isolated total proteins were measured using a DC protein assay kit (Bio-Rad laboratories, USA).

[0133] For measurement of the F8 protein, the expression level of each gene was measured using an ELISA kit (Stago Asserchrom VIII:Ag, France) for the same amount of protein. The result is shown in FIG. 3.

[0134] From FIG. 3, it can be seen that the administration of the pharmaceutical composition according to the present disclosure (Example) resulted in a statistically significantly higher expression level as compared to the administration of the gene only or the administration of the composition of the control group. Specifically, the group administered with the F8M-MP1 of Example showed 44% higher expression level as compared to group administered with the gene only (pGP-F8M), and the group administered with F8M-MP2 showed 116% higher expression level as compared to group administered with the gene only.

[0135] For measurement of the F9 protein, the expression level of each gene was measured using an ELISA kit (Abcam, USA) for the same amount of protein. The result is shown in FIG. 4.

[0136] From FIG. 4, it can be seen that the administration of the composition of Comparative Example hardly resulted in increased gene expression as compared to the administration of the gene only.

[0137] That is to say, from FIG. 3 and FIG. 4, it can be seen that the administration of the compositions according to the present disclosure (Example) results in a significantly higher expression level as compared to the administration of the gene only or the administration of the composition of the control group or comparative example.

[0138] Although the present disclosure was illustrated with the specific exemplary embodiments described above, various modifications or changes can be made thereto without departing from the subject matter and scope of the present disclosure. In addition, such modifications or changes within the subject matter of the present disclosure are included in the scope of the appended claims.

Sequence CWU 1

1

712351PRTArtificial Sequenceamino acid sequence of Factor 8 1Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu Cys Leu Leu Arg Phe1 5 10 15Cys Phe Ser Ala Thr Arg Arg Tyr Tyr Leu Gly Ala Val Glu Leu Ser 20 25 30Trp Asp Tyr Met Gln Ser Asp Leu Gly Glu Leu Pro Val Asp Ala Arg 35 40 45Phe Pro Pro Arg Val Pro Lys Ser Phe Pro Phe Asn Thr Ser Val Val 50 55 60Tyr Lys Lys Thr Leu Phe Val Glu Phe Thr Asp His Leu Phe Asn Ile65 70 75 80Ala Lys Pro Arg Pro Pro Trp Met Gly Leu Leu Gly Pro Thr Ile Gln 85 90 95Ala Glu Val Tyr Asp Thr Val Val Ile Thr Leu Lys Asn Met Ala Ser 100 105 110His Pro Val Ser Leu His Ala Val Gly Val Ser Tyr Trp Lys Ala Ser 115 120 125Glu Gly Ala Glu Tyr Asp Asp Gln Thr Ser Gln Arg Glu Lys Glu Asp 130 135 140Asp Lys Val Phe Pro Gly Gly Ser His Thr Tyr Val Trp Gln Val Leu145 150 155 160Lys Glu Asn Gly Pro Met Ala Ser Asp Pro Leu Cys Leu Thr Tyr Ser 165 170 175Tyr Leu Ser His Val Asp Leu Val Lys Asp Leu Asn Ser Gly Leu Ile 180 185 190Gly Ala Leu Leu Val Cys Arg Glu Gly Ser Leu Ala Lys Glu Lys Thr 195 200 205Gln Thr Leu His Lys Phe Ile Leu Leu Phe Ala Val Phe Asp Glu Gly 210 215 220Lys Ser Trp His Ser Glu Thr Lys Asn Ser Leu Met Gln Asp Arg Asp225 230 235 240Ala Ala Ser Ala Arg Ala Trp Pro Lys Met His Thr Val Asn Gly Tyr 245 250 255Val Asn Arg Ser Leu Pro Gly Leu Ile Gly Cys His Arg Lys Ser Val 260 265 270Tyr Trp His Val Ile Gly Met Gly Thr Thr Pro Glu Val His Ser Ile 275 280 285Phe Leu Glu Gly His Thr Phe Leu Val Arg Asn His Arg Gln Ala Ser 290 295 300Leu Glu Ile Ser Pro Ile Thr Phe Leu Thr Ala Gln Thr Leu Leu Met305 310 315 320Asp Leu Gly Gln Phe Leu Leu Phe Cys His Ile Ser Ser His Gln His 325 330 335Asp Gly Met Glu Ala Tyr Val Lys Val Asp Ser Cys Pro Glu Glu Pro 340 345 350Gln Leu Arg Met Lys Asn Asn Glu Glu Ala Glu Asp Tyr Asp Asp Asp 355 360 365Leu Thr Asp Ser Glu Met Asp Val Val Arg Phe Asp Asp Asp Asn Ser 370 375 380Pro Ser Phe Ile Gln Ile Arg Ser Val Ala Lys Lys His Pro Lys Thr385 390 395 400Trp Val His Tyr Ile Ala Ala Glu Glu Glu Asp Trp Asp Tyr Ala Pro 405 410 415Leu Val Leu Ala Pro Asp Asp Arg Ser Tyr Lys Ser Gln Tyr Leu Asn 420 425 430Asn Gly Pro Gln Arg Ile Gly Arg Lys Tyr Lys Lys Val Arg Phe Met 435 440 445Ala Tyr Thr Asp Glu Thr Phe Lys Thr Arg Glu Ala Ile Gln His Glu 450 455 460Ser Gly Ile Leu Gly Pro Leu Leu Tyr Gly Glu Val Gly Asp Thr Leu465 470 475 480Leu Ile Ile Phe Lys Asn Gln Ala Ser Arg Pro Tyr Asn Ile Tyr Pro 485 490 495His Gly Ile Thr Asp Val Arg Pro Leu Tyr Ser Arg Arg Leu Pro Lys 500 505 510Gly Val Lys His Leu Lys Asp Phe Pro Ile Leu Pro Gly Glu Ile Phe 515 520 525Lys Tyr Lys Trp Thr Val Thr Val Glu Asp Gly Pro Thr Lys Ser Asp 530 535 540Pro Arg Cys Leu Thr Arg Tyr Tyr Ser Ser Phe Val Asn Met Glu Arg545 550 555 560Asp Leu Ala Ser Gly Leu Ile Gly Pro Leu Leu Ile Cys Tyr Lys Glu 565 570 575Ser Val Asp Gln Arg Gly Asn Gln Ile Met Ser Asp Lys Arg Asn Val 580 585 590Ile Leu Phe Ser Val Phe Asp Glu Asn Arg Ser Trp Tyr Leu Thr Glu 595 600 605Asn Ile Gln Arg Phe Leu Pro Asn Pro Ala Gly Val Gln Leu Glu Asp 610 615 620Pro Glu Phe Gln Ala Ser Asn Ile Met His Ser Ile Asn Gly Tyr Val625 630 635 640Phe Asp Ser Leu Gln Leu Ser Val Cys Leu His Glu Val Ala Tyr Trp 645 650 655Tyr Ile Leu Ser Ile Gly Ala Gln Thr Asp Phe Leu Ser Val Phe Phe 660 665 670Ser Gly Tyr Thr Phe Lys His Lys Met Val Tyr Glu Asp Thr Leu Thr 675 680 685Leu Phe Pro Phe Ser Gly Glu Thr Val Phe Met Ser Met Glu Asn Pro 690 695 700Gly Leu Trp Ile Leu Gly Cys His Asn Ser Asp Phe Arg Asn Arg Gly705 710 715 720Met Thr Ala Leu Leu Lys Val Ser Ser Cys Asp Lys Asn Thr Gly Asp 725 730 735Tyr Tyr Glu Asp Ser Tyr Glu Asp Ile Ser Ala Tyr Leu Leu Ser Lys 740 745 750Asn Asn Ala Ile Glu Pro Arg Ser Phe Ser Gln Asn Ser Arg His Pro 755 760 765Ser Thr Arg Gln Lys Gln Phe Asn Ala Thr Thr Ile Pro Glu Asn Asp 770 775 780Ile Glu Lys Thr Asp Pro Trp Phe Ala His Arg Thr Pro Met Pro Lys785 790 795 800Ile Gln Asn Val Ser Ser Ser Asp Leu Leu Met Leu Leu Arg Gln Ser 805 810 815Pro Thr Pro His Gly Leu Ser Leu Ser Asp Leu Gln Glu Ala Lys Tyr 820 825 830Glu Thr Phe Ser Asp Asp Pro Ser Pro Gly Ala Ile Asp Ser Asn Asn 835 840 845Ser Leu Ser Glu Met Thr His Phe Arg Pro Gln Leu His His Ser Gly 850 855 860Asp Met Val Phe Thr Pro Glu Ser Gly Leu Gln Leu Arg Leu Asn Glu865 870 875 880Lys Leu Gly Thr Thr Ala Ala Thr Glu Leu Lys Lys Leu Asp Phe Lys 885 890 895Val Ser Ser Thr Ser Asn Asn Leu Ile Ser Thr Ile Pro Ser Asp Asn 900 905 910Leu Ala Ala Gly Thr Asp Asn Thr Ser Ser Leu Gly Pro Pro Ser Met 915 920 925Pro Val His Tyr Asp Ser Gln Leu Asp Thr Thr Leu Phe Gly Lys Lys 930 935 940Ser Ser Pro Leu Thr Glu Ser Gly Gly Pro Leu Ser Leu Ser Glu Glu945 950 955 960Asn Asn Asp Ser Lys Leu Leu Glu Ser Gly Leu Met Asn Ser Gln Glu 965 970 975Ser Ser Trp Gly Lys Asn Val Ser Ser Thr Glu Ser Gly Arg Leu Phe 980 985 990Lys Gly Lys Arg Ala His Gly Pro Ala Leu Leu Thr Lys Asp Asn Ala 995 1000 1005Leu Phe Lys Val Ser Ile Ser Leu Leu Lys Thr Asn Lys Thr Ser Asn 1010 1015 1020Asn Ser Ala Thr Asn Arg Lys Thr His Ile Asp Gly Pro Ser Leu Leu1025 1030 1035 1040Ile Glu Asn Ser Pro Ser Val Trp Gln Asn Ile Leu Glu Ser Asp Thr 1045 1050 1055Glu Phe Lys Lys Val Thr Pro Leu Ile His Asp Arg Met Leu Met Asp 1060 1065 1070Lys Asn Ala Thr Ala Leu Arg Leu Asn His Met Ser Asn Lys Thr Thr 1075 1080 1085Ser Ser Lys Asn Met Glu Met Val Gln Gln Lys Lys Glu Gly Pro Ile 1090 1095 1100Pro Pro Asp Ala Gln Asn Pro Asp Met Ser Phe Phe Lys Met Leu Phe1105 1110 1115 1120Leu Pro Glu Ser Ala Arg Trp Ile Gln Arg Thr His Gly Lys Asn Ser 1125 1130 1135Leu Asn Ser Gly Gln Gly Pro Ser Pro Lys Gln Leu Val Ser Leu Gly 1140 1145 1150Pro Glu Lys Ser Val Glu Gly Gln Asn Phe Leu Ser Glu Lys Asn Lys 1155 1160 1165Val Val Val Gly Lys Gly Glu Phe Thr Lys Asp Val Gly Leu Lys Glu 1170 1175 1180Met Val Phe Pro Ser Ser Arg Asn Leu Phe Leu Thr Asn Leu Asp Asn1185 1190 1195 1200Leu His Glu Asn Asn Thr His Asn Gln Glu Lys Lys Ile Gln Glu Glu 1205 1210 1215Ile Glu Lys Lys Glu Thr Leu Ile Gln Glu Asn Val Val Leu Pro Gln 1220 1225 1230Ile His Thr Val Thr Gly Thr Lys Asn Phe Met Lys Asn Leu Phe Leu 1235 1240 1245Leu Ser Thr Arg Gln Asn Val Glu Gly Ser Tyr Asp Gly Ala Tyr Ala 1250 1255 1260Pro Val Leu Gln Asp Phe Arg Ser Leu Asn Asp Ser Thr Asn Arg Thr1265 1270 1275 1280Lys Lys His Thr Ala His Phe Ser Lys Lys Gly Glu Glu Glu Asn Leu 1285 1290 1295Glu Gly Leu Gly Asn Gln Thr Lys Gln Ile Val Glu Lys Tyr Ala Cys 1300 1305 1310Thr Thr Arg Ile Ser Pro Asn Thr Ser Gln Gln Asn Phe Val Thr Gln 1315 1320 1325Arg Ser Lys Arg Ala Leu Lys Gln Phe Arg Leu Pro Leu Glu Glu Thr 1330 1335 1340Glu Leu Glu Lys Arg Ile Ile Val Asp Asp Thr Ser Thr Gln Trp Ser1345 1350 1355 1360Lys Asn Met Lys His Leu Thr Pro Ser Thr Leu Thr Gln Ile Asp Tyr 1365 1370 1375Asn Glu Lys Glu Lys Gly Ala Ile Thr Gln Ser Pro Leu Ser Asp Cys 1380 1385 1390Leu Thr Arg Ser His Ser Ile Pro Gln Ala Asn Arg Ser Pro Leu Pro 1395 1400 1405Ile Ala Lys Val Ser Ser Phe Pro Ser Ile Arg Pro Ile Tyr Leu Thr 1410 1415 1420Arg Val Leu Phe Gln Asp Asn Ser Ser His Leu Pro Ala Ala Ser Tyr1425 1430 1435 1440Arg Lys Lys Asp Ser Gly Val Gln Glu Ser Ser His Phe Leu Gln Gly 1445 1450 1455Ala Lys Lys Asn Asn Leu Ser Leu Ala Ile Leu Thr Leu Glu Met Thr 1460 1465 1470Gly Asp Gln Arg Glu Val Gly Ser Leu Gly Thr Ser Ala Thr Asn Ser 1475 1480 1485Val Thr Tyr Lys Lys Val Glu Asn Thr Val Leu Pro Lys Pro Asp Leu 1490 1495 1500Pro Lys Thr Ser Gly Lys Val Glu Leu Leu Pro Lys Val His Ile Tyr1505 1510 1515 1520Gln Lys Asp Leu Phe Pro Thr Glu Thr Ser Asn Gly Ser Pro Gly His 1525 1530 1535Leu Asp Leu Val Glu Gly Ser Leu Leu Gln Gly Thr Glu Gly Ala Ile 1540 1545 1550Lys Trp Asn Glu Ala Asn Arg Pro Gly Lys Val Pro Phe Leu Arg Val 1555 1560 1565Ala Thr Glu Ser Ser Ala Lys Thr Pro Ser Lys Leu Leu Asp Pro Leu 1570 1575 1580Ala Trp Asp Asn His Tyr Gly Thr Gln Ile Pro Lys Glu Glu Trp Lys1585 1590 1595 1600Ser Gln Glu Lys Ser Pro Glu Lys Thr Ala Phe Lys Lys Lys Asp Thr 1605 1610 1615Ile Leu Ser Leu Asn Ala Cys Glu Ser Asn His Ala Ile Ala Ala Ile 1620 1625 1630Asn Glu Gly Gln Asn Lys Pro Glu Ile Glu Val Thr Trp Ala Lys Gln 1635 1640 1645Gly Arg Thr Glu Arg Leu Cys Ser Gln Asn Pro Pro Val Leu Lys Arg 1650 1655 1660His Gln Arg Glu Ile Thr Arg Thr Thr Leu Gln Ser Asp Gln Glu Glu1665 1670 1675 1680Ile Asp Tyr Asp Asp Thr Ile Ser Val Glu Met Lys Lys Glu Asp Phe 1685 1690 1695Asp Ile Tyr Asp Glu Asp Glu Asn Gln Ser Pro Arg Ser Phe Gln Lys 1700 1705 1710Lys Thr Arg His Tyr Phe Ile Ala Ala Val Glu Arg Leu Trp Asp Tyr 1715 1720 1725Gly Met Ser Ser Ser Pro His Val Leu Arg Asn Arg Ala Gln Ser Gly 1730 1735 1740Ser Val Pro Gln Phe Lys Lys Val Val Phe Gln Glu Phe Thr Asp Gly1745 1750 1755 1760Ser Phe Thr Gln Pro Leu Tyr Arg Gly Glu Leu Asn Glu His Leu Gly 1765 1770 1775Leu Leu Gly Pro Tyr Ile Arg Ala Glu Val Glu Asp Asn Ile Met Val 1780 1785 1790Thr Phe Arg Asn Gln Ala Ser Arg Pro Tyr Ser Phe Tyr Ser Ser Leu 1795 1800 1805Ile Ser Tyr Glu Glu Asp Gln Arg Gln Gly Ala Glu Pro Arg Lys Asn 1810 1815 1820Phe Val Lys Pro Asn Glu Thr Lys Thr Tyr Phe Trp Lys Val Gln His1825 1830 1835 1840His Met Ala Pro Thr Lys Asp Glu Phe Asp Cys Lys Ala Trp Ala Tyr 1845 1850 1855Phe Ser Asp Val Asp Leu Glu Lys Asp Val His Ser Gly Leu Ile Gly 1860 1865 1870Pro Leu Leu Val Cys His Thr Asn Thr Leu Asn Pro Ala His Gly Arg 1875 1880 1885Gln Val Thr Val Gln Glu Phe Ala Leu Phe Phe Thr Ile Phe Asp Glu 1890 1895 1900Thr Lys Ser Trp Tyr Phe Thr Glu Asn Met Glu Arg Asn Cys Arg Ala1905 1910 1915 1920Pro Cys Asn Ile Gln Met Glu Asp Pro Thr Phe Lys Glu Asn Tyr Arg 1925 1930 1935Phe His Ala Ile Asn Gly Tyr Ile Met Asp Thr Leu Pro Gly Leu Val 1940 1945 1950Met Ala Gln Asp Gln Arg Ile Arg Trp Tyr Leu Leu Ser Met Gly Ser 1955 1960 1965Asn Glu Asn Ile His Ser Ile His Phe Ser Gly His Val Phe Thr Val 1970 1975 1980Arg Lys Lys Glu Glu Tyr Lys Met Ala Leu Tyr Asn Leu Tyr Pro Gly1985 1990 1995 2000Val Phe Glu Thr Val Glu Met Leu Pro Ser Lys Ala Gly Ile Trp Arg 2005 2010 2015Val Glu Cys Leu Ile Gly Glu His Leu His Ala Gly Met Ser Thr Leu 2020 2025 2030Phe Leu Val Tyr Ser Asn Lys Cys Gln Thr Pro Leu Gly Met Ala Ser 2035 2040 2045Gly His Ile Arg Asp Phe Gln Ile Thr Ala Ser Gly Gln Tyr Gly Gln 2050 2055 2060Trp Ala Pro Lys Leu Ala Arg Leu His Tyr Ser Gly Ser Ile Asn Ala2065 2070 2075 2080Trp Ser Thr Lys Glu Pro Phe Ser Trp Ile Lys Val Asp Leu Leu Ala 2085 2090 2095Pro Met Ile Ile His Gly Ile Lys Thr Gln Gly Ala Arg Gln Lys Phe 2100 2105 2110Ser Ser Leu Tyr Ile Ser Gln Phe Ile Ile Met Tyr Ser Leu Asp Gly 2115 2120 2125Lys Lys Trp Gln Thr Tyr Arg Gly Asn Ser Thr Gly Thr Leu Met Val 2130 2135 2140Phe Phe Gly Asn Val Asp Ser Ser Gly Ile Lys His Asn Ile Phe Asn2145 2150 2155 2160Pro Pro Ile Ile Ala Arg Tyr Ile Arg Leu His Pro Thr His Tyr Ser 2165 2170 2175Ile Arg Ser Thr Leu Arg Met Glu Leu Met Gly Cys Asp Leu Asn Ser 2180 2185 2190Cys Ser Met Pro Leu Gly Met Glu Ser Lys Ala Ile Ser Asp Ala Gln 2195 2200 2205Ile Thr Ala Ser Ser Tyr Phe Thr Asn Met Phe Ala Thr Trp Ser Pro 2210 2215 2220Ser Lys Ala Arg Leu His Leu Gln Gly Arg Ser Asn Ala Trp Arg Pro2225 2230 2235 2240Gln Val Asn Asn Pro Lys Glu Trp Leu Gln Val Asp Phe Gln Lys Thr 2245 2250 2255Met Lys Val Thr Gly Val Thr Thr Gln Gly Val Lys Ser Leu Leu Thr 2260 2265 2270Ser Met Tyr Val Lys Glu Phe Leu Ile Ser Ser Ser Gln Asp Gly His 2275 2280 2285Gln Trp Thr Leu Phe Phe Gln Asn Gly Lys Val Lys Val Phe Gln Gly 2290 2295 2300Asn Gln Asp Ser Phe Thr Pro Val Val Asn Ser Leu Asp Pro Pro Leu2305 2310 2315 2320Leu Thr Arg Tyr Leu Arg Ile His Pro Gln Ser Trp Val His Gln Ile 2325 2330 2335Ala Leu Arg Met Glu Val Leu Gly Cys Glu Ala Gln Asp Leu Tyr 2340 2345 235027056DNAArtificial Sequencenucleotide sequence of Factor 8 2atgcaaatag agctctccac ctgcttcttt ctgtgccttt tgcgattctg ctttagtgcc 60accagaagat actacctggg tgcagtggaa ctgtcatggg actatatgca aagtgatctc 120ggtgagctgc ctgtggacgc aagatttcct cctagagtgc caaaatcttt tccattcaac 180acctcagtcg tgtacaaaaa gactctgttt gtagaattca cggatcacct tttcaacatc 240gctaagccaa ggccaccctg gatgggtctg ctaggtccta ccatccaggc tgaggtttat 300gatacagtgg tcattacact taagaacatg gcttcccatc ctgtcagtct tcatgctgtt 360ggtgtatcct actggaaagc ttctgaggga gctgaatatg atgatcagac cagtcaaagg 420gagaaagaag atgataaagt cttccctggt ggaagccata catatgtctg gcaggtcctg 480aaagagaatg gtccaatggc ctctgaccca ctgtgcctta cctactcata tctttctcat 540gtggacctgg taaaagactt gaattcaggc ctcattggag ccctactagt atgtagagaa

600gggagtctgg ccaaggaaaa gacacagacc ttgcacaaat ttatactact ttttgctgta 660tttgatgaag ggaaaagttg gcactcagaa acaaagaact ccttgatgca ggatagggat 720gctgcatctg ctcgggcctg gcctaaaatg cacacagtca atggttatgt aaacaggtct 780ctgccaggtc tgattggatg ccacaggaaa tcagtctatt ggcatgtgat tggaatgggc 840accactcctg aagtgcactc aatattcctc gaaggtcaca catttcttgt gaggaaccat 900cgccaggcgt ccttggaaat ctcgccaata actttcctta ctgctcaaac actcttgatg 960gaccttggac agtttctact gttttgtcat atctcttccc accaacatga tggcatggaa 1020gcttatgtca aagtagacag ctgtccagag gaaccccaac tacgaatgaa aaataatgaa 1080gaagcggaag actatgatga tgatcttact gattctgaaa tggatgtggt caggtttgat 1140gatgacaact ctccttcctt tatccaaatt cgctcagttg ccaagaagca tcctaaaact 1200tgggtacatt acattgctgc tgaagaggag gactgggact atgctccctt agtcctcgcc 1260cccgatgaca gaagttataa aagtcaatat ttgaacaatg gccctcagcg gattggtagg 1320aagtacaaaa aagtccgatt tatggcatac acagatgaaa cctttaagac tcgtgaagct 1380attcagcatg aatcaggaat cttgggacct ttactttatg gggaagttgg agacacactg 1440ttgattatat ttaagaatca agcaagcaga ccatataaca tctaccctca cggaatcact 1500gatgtccgtc ctttgtattc aaggagatta ccaaaaggtg taaaacattt gaaggatttt 1560ccaattctgc caggagaaat attcaaatat aaatggacag tgactgtaga agatgggcca 1620actaaatcag atcctcggtg cctgacccgc tattactcta gtttcgttaa tatggagaga 1680gatctagctt caggactcat tggccctctc ctcatctgct acaaagaatc tgtagatcaa 1740agaggaaacc agataatgtc agacaagagg aatgtcatcc tgttttctgt atttgatgag 1800aaccgaagct ggtacctcac agagaatata caacgctttc tccccaatcc agctggagtg 1860cagcttgagg atccagagtt ccaagcctcc aacatcatgc acagcatcaa tggctatgtt 1920tttgatagtt tgcagttgtc agtttgtttg catgaggtgg catactggta cattctaagc 1980attggagcac agactgactt cctttctgtc ttcttctctg gatatacctt caaacacaaa 2040atggtctatg aagacacact caccctattc ccattctcag gagaaactgt cttcatgtcg 2100atggaaaacc caggtctatg gattctgggg tgccacaact cagactttcg gaacagaggc 2160atgaccgcct tactgaaggt ttctagttgt gacaagaaca ctggtgatta ttacgaggac 2220agttatgaag atatttcagc atacttgctg agtaaaaaca atgccattga accaagaagc 2280ttctcccaga attcaagaca ccctagcact aggcaaaagc aatttaatgc caccacaatt 2340ccagaaaatg acatagagaa gactgaccct tggtttgcac acagaacacc tatgcctaaa 2400atacaaaatg tctcctctag tgatttgttg atgctcttgc gacagagtcc tactccacat 2460gggctatcct tatctgatct ccaagaagcc aaatatgaga ctttttctga tgatccatca 2520cctggagcaa tagacagtaa taacagcctg tctgaaatga cacacttcag gccacagctc 2580catcacagtg gggacatggt atttacccct gagtcaggcc tccaattaag attaaatgag 2640aaactgggga caactgcagc aacagagttg aagaaacttg atttcaaagt ttctagtaca 2700tcaaataatc tgatttcaac aattccatca gacaatttgg cagcaggtac tgataataca 2760agttccttag gacccccaag tatgccagtt cattatgata gtcaattaga taccactcta 2820tttggcaaaa agtcatctcc ccttactgag tctggtggac ctctgagctt gagtgaagaa 2880aataatgatt caaagttgtt agaatcaggt ttaatgaata gccaagaaag ttcatgggga 2940aaaaatgtat cgtcaacaga gagtggtagg ttatttaaag ggaaaagagc tcatggacct 3000gctttgttga ctaaagataa tgccttattc aaagttagca tctctttgtt aaagacaaac 3060aaaacttcca ataattcagc aactaataga aagactcaca ttgatggccc atcattatta 3120attgagaata gtccatcagt ctggcaaaat atattagaaa gtgacactga gtttaaaaaa 3180gtgacacctt tgattcatga cagaatgctt atggacaaaa atgctacagc tttgaggcta 3240aatcatatgt caaataaaac tacttcatca aaaaacatgg aaatggtcca acagaaaaaa 3300gagggcccca ttccaccaga tgcacaaaat ccagatatgt cgttctttaa gatgctattc 3360ttgccagaat cagcaaggtg gatacaaagg actcatggaa agaactctct gaactctggg 3420caaggcccca gtccaaagca attagtatcc ttaggaccag aaaaatctgt ggaaggtcag 3480aatttcttgt ctgagaaaaa caaagtggta gtaggaaagg gtgaatttac aaaggacgta 3540ggactcaaag agatggtttt tccaagcagc agaaacctat ttcttactaa cttggataat 3600ttacatgaaa ataatacaca caatcaagaa aaaaaaattc aggaagaaat agaaaagaag 3660gaaacattaa tccaagagaa tgtagttttg cctcagatac atacagtgac tggcactaag 3720aatttcatga agaacctttt cttactgagc actaggcaaa atgtagaagg ttcatatgac 3780ggggcatatg ctccagtact tcaagatttt aggtcattaa atgattcaac aaatagaaca 3840aagaaacaca cagctcattt ctcaaaaaaa ggggaggaag aaaacttgga aggcttggga 3900aatcaaacca agcaaattgt agagaaatat gcatgcacca caaggatatc tcctaataca 3960agccagcaga attttgtcac gcaacgtagt aagagagctt tgaaacaatt cagactccca 4020ctagaagaaa cagaacttga aaaaaggata attgtggatg acacctcaac ccagtggtcc 4080aaaaacatga aacatttgac cccgagcacc ctcacacaga tagactacaa tgagaaggag 4140aaaggggcca ttactcagtc tcccttatca gattgcctta cgaggagtca tagcatccct 4200caagcaaata gatctccatt acccattgca aaggtatcat catttccatc tattagacct 4260atatatctga ccagggtcct attccaagac aactcttctc atcttccagc agcatcttat 4320agaaagaaag attctggggt ccaagaaagc agtcatttct tacaaggagc caaaaaaaat 4380aacctttctt tagccattct aaccttggag atgactggtg atcaaagaga ggttggctcc 4440ctggggacaa gtgccacaaa ttcagtcaca tacaagaaag ttgagaacac tgttctcccg 4500aaaccagact tgcccaaaac atctggcaaa gttgaattgc ttccaaaagt tcacatttat 4560cagaaggacc tattccctac ggaaactagc aatgggtctc ctggccatct ggatctcgtg 4620gaagggagcc ttcttcaggg aacagaggga gcgattaagt ggaatgaagc aaacagacct 4680ggaaaagttc cctttctgag agtagcaaca gaaagctctg caaagactcc ctccaagcta 4740ttggatcctc ttgcttggga taaccactat ggtactcaga taccaaaaga agagtggaaa 4800tcccaagaga agtcaccaga aaaaacagct tttaagaaaa aggataccat tttgtccctg 4860aacgcttgtg aaagcaatca tgcaatagca gcaataaatg agggacaaaa taagcccgaa 4920atagaagtca cctgggcaaa gcaaggtagg actgaaaggc tgtgctctca aaacccacca 4980gtcttgaaac gccatcaacg ggaaataact cgtactactc ttcagtcaga tcaagaggaa 5040attgactatg atgataccat atcagttgaa atgaagaagg aagattttga catttatgat 5100gaggatgaaa atcagagccc ccgcagcttt caaaagaaaa cacgacacta ttttattgct 5160gcagtggaga ggctctggga ttatgggatg agtagctccc cacatgttct aagaaacagg 5220gctcagagtg gcagtgtccc tcagttcaag aaagttgttt tccaggaatt tactgatggc 5280tcctttactc agcccttata ccgtggagaa ctaaatgaac atttgggact cctggggcca 5340tatataagag cagaagttga agataatatc atggtaactt tcagaaatca ggcctctcgt 5400ccctattcct tctattctag ccttatttct tatgaggaag atcagaggca aggagcagaa 5460cctagaaaaa actttgtcaa gcctaatgaa accaaaactt acttttggaa agtgcaacat 5520catatggcac ccactaaaga tgagtttgac tgcaaagcct gggcttattt ctctgatgtt 5580gacctggaaa aagatgtgca ctcaggcctg attggacccc ttctggtctg ccacactaac 5640acactgaacc ctgctcatgg gagacaagtg acagtacagg aatttgctct gtttttcacc 5700atctttgatg agaccaaaag ctggtacttc actgaaaata tggaaagaaa ctgcagggct 5760ccctgcaata tccagatgga agatcccact tttaaagaga attatcgctt ccatgcaatc 5820aatggctaca taatggatac actacctggc ttagtaatgg ctcaggatca aaggattcga 5880tggtatctgc tcagcatggg cagcaatgaa aacatccatt ctattcattt cagtggacat 5940gtgttcactg tacgaaaaaa agaggagtat aaaatggcac tgtacaatct ctatccaggt 6000gtttttgaga cagtggaaat gttaccatcc aaagctggaa tttggcgggt ggaatgcctt 6060attggcgagc atctacatgc tgggatgagc acactttttc tggtgtacag caataagtgt 6120cagactcccc tgggaatggc ttctggacac attagagatt ttcagattac agcttcagga 6180caatatggac agtgggcccc aaagctggcc agacttcatt attccggatc aatcaatgcc 6240tggagcacca aggagccctt ttcttggatc aaggtggatc tgttggcacc aatgattatt 6300cacggcatca agacccaggg tgcccgtcag aagttctcca gcctctacat ctctcagttt 6360atcatcatgt atagtcttga tgggaagaag tggcagactt atcgaggaaa ttccactgga 6420accttaatgg tcttctttgg caatgtggat tcatctggga taaaacacaa tatttttaac 6480cctccaatta ttgctcgata catccgtttg cacccaactc attatagcat tcgcagcact 6540cttcgcatgg agttgatggg ctgtgattta aatagttgca gcatgccatt gggaatggag 6600agtaaagcaa tatcagatgc acagattact gcttcatcct actttaccaa tatgtttgcc 6660acctggtctc cttcaaaagc tcgacttcac ctccaaggga ggagtaatgc ctggagacct 6720caggtgaata atccaaaaga gtggctgcaa gtggacttcc agaagacaat gaaagtcaca 6780ggagtaacta ctcagggagt aaaatctctg cttaccagca tgtatgtgaa ggagttcctc 6840atctccagca gtcaagatgg ccatcagtgg actctctttt ttcagaatgg caaagtaaag 6900gtttttcagg gaaatcaaga ctccttcaca cctgtggtga actctctaga cccaccgtta 6960ctgactcgct accttcgaat tcacccccag agttgggtgc accagattgc cctgaggatg 7020gaggttctgg gctgcgaggc acaggacctc tactga 705631463PRTArtificial Sequenceamino acid sequence of Factor 8 Mutant 3Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu Cys Leu Leu Arg Phe1 5 10 15Cys Phe Ser Ala Thr Arg Arg Tyr Tyr Leu Gly Ala Val Glu Leu Ser 20 25 30Trp Asp Tyr Met Gln Ser Asp Leu Gly Glu Leu Pro Val Asp Ala Arg 35 40 45Phe Pro Pro Arg Val Pro Lys Ser Phe Pro Phe Asn Thr Ser Val Val 50 55 60Tyr Lys Lys Thr Leu Phe Val Glu Phe Thr Asp His Leu Phe Asn Ile65 70 75 80Ala Lys Pro Arg Pro Pro Trp Met Gly Leu Leu Gly Pro Thr Ile Gln 85 90 95Ala Glu Val Tyr Asp Thr Val Val Ile Thr Leu Lys Asn Met Ala Ser 100 105 110His Pro Val Ser Leu His Ala Val Gly Val Ser Tyr Trp Lys Ala Ser 115 120 125Glu Gly Ala Glu Tyr Asp Asp Gln Thr Ser Gln Arg Glu Lys Glu Asp 130 135 140Asp Lys Val Phe Pro Gly Gly Ser His Thr Tyr Val Trp Gln Val Leu145 150 155 160Lys Glu Asn Gly Pro Met Ala Ser Asp Pro Leu Cys Leu Thr Tyr Ser 165 170 175Tyr Leu Ser His Val Asp Leu Val Lys Asp Leu Asn Ser Gly Leu Ile 180 185 190Gly Ala Leu Leu Val Cys Arg Glu Gly Ser Leu Ala Lys Glu Lys Thr 195 200 205Gln Thr Leu His Lys Phe Ile Leu Leu Phe Ala Val Phe Asp Glu Gly 210 215 220Lys Ser Trp His Ser Glu Thr Lys Asn Ser Leu Met Gln Asp Arg Asp225 230 235 240Ala Ala Ser Ala Arg Ala Trp Pro Lys Met His Thr Val Asn Gly Tyr 245 250 255Val Asn Arg Ser Leu Pro Gly Leu Ile Gly Cys His Arg Lys Ser Val 260 265 270Tyr Trp His Val Ile Gly Met Gly Thr Thr Pro Glu Val His Ser Ile 275 280 285Phe Leu Glu Gly His Thr Phe Leu Val Arg Asn His Arg Gln Ala Ser 290 295 300Leu Glu Ile Ser Pro Ile Thr Phe Leu Thr Ala Gln Thr Leu Leu Met305 310 315 320Asp Leu Gly Gln Phe Leu Leu Phe Cys His Ile Ser Ser His Gln His 325 330 335Asp Gly Met Glu Ala Tyr Val Lys Val Asp Ser Cys Pro Glu Glu Pro 340 345 350Gln Leu Arg Met Lys Asn Asn Glu Glu Ala Glu Asp Tyr Asp Asp Asp 355 360 365Leu Thr Asp Ser Glu Met Asp Val Val Arg Phe Asp Asp Asp Asn Ser 370 375 380Pro Ser Phe Ile Gln Ile Arg Ser Val Ala Lys Lys His Pro Lys Thr385 390 395 400Trp Val His Tyr Ile Ala Ala Glu Glu Glu Asp Trp Asp Tyr Ala Pro 405 410 415Leu Val Leu Ala Pro Asp Asp Arg Ser Tyr Lys Ser Gln Tyr Leu Asn 420 425 430Asn Gly Pro Gln Arg Ile Gly Arg Lys Tyr Lys Lys Val Arg Phe Met 435 440 445Ala Tyr Thr Asp Glu Thr Phe Lys Thr Arg Glu Ala Ile Gln His Glu 450 455 460Ser Gly Ile Leu Gly Pro Leu Leu Tyr Gly Glu Val Gly Asp Thr Leu465 470 475 480Leu Ile Ile Phe Lys Asn Gln Ala Ser Arg Pro Tyr Asn Ile Tyr Pro 485 490 495His Gly Ile Thr Asp Val Arg Pro Leu Tyr Ser Arg Arg Leu Pro Lys 500 505 510Gly Val Lys His Leu Lys Asp Phe Pro Ile Leu Pro Gly Glu Ile Phe 515 520 525Lys Tyr Lys Trp Thr Val Thr Val Glu Asp Gly Pro Thr Lys Ser Asp 530 535 540Pro Arg Cys Leu Thr Arg Tyr Tyr Ser Ser Phe Val Asn Met Glu Arg545 550 555 560Asp Leu Ala Ser Gly Leu Ile Gly Pro Leu Leu Ile Cys Tyr Lys Glu 565 570 575Ser Val Asp Gln Arg Gly Asn Gln Ile Met Ser Asp Lys Arg Asn Val 580 585 590Ile Leu Phe Ser Val Phe Asp Glu Asn Arg Ser Trp Tyr Leu Thr Glu 595 600 605Asn Ile Gln Arg Phe Leu Pro Asn Pro Ala Gly Val Gln Leu Glu Asp 610 615 620Pro Glu Phe Gln Ala Ser Asn Ile Met His Ser Ile Asn Gly Tyr Val625 630 635 640Phe Asp Ser Leu Gln Leu Ser Val Cys Leu His Glu Val Ala Tyr Trp 645 650 655Tyr Ile Leu Ser Ile Gly Ala Gln Thr Asp Phe Leu Ser Val Phe Phe 660 665 670Ser Gly Tyr Thr Phe Lys His Lys Met Val Tyr Glu Asp Thr Leu Thr 675 680 685Leu Phe Pro Phe Ser Gly Glu Thr Val Phe Met Ser Met Glu Asn Pro 690 695 700Gly Leu Trp Ile Leu Gly Cys His Asn Ser Asp Phe Arg Asn Arg Gly705 710 715 720Met Thr Ala Leu Leu Lys Val Ser Ser Cys Asp Lys Asn Thr Gly Asp 725 730 735Tyr Tyr Glu Asp Ser Tyr Glu Asp Ile Ser Ala Tyr Leu Leu Ser Lys 740 745 750Asn Asn Ala Ile Glu Pro Arg Ser Phe Ser Gln Asn Ser Arg His Pro 755 760 765Ser Thr Arg Gln Lys Gln Phe Asn Ala Thr Thr Ile Pro Glu Asn Thr 770 775 780Thr Leu Gln Ser Asp Gln Glu Glu Ile Asp Tyr Asp Asp Thr Ile Ser785 790 795 800Val Glu Met Lys Lys Glu Asp Phe Asp Ile Tyr Asp Glu Asp Glu Asn 805 810 815Gln Ser Pro Arg Ser Phe Gln Lys Lys Thr Arg His Tyr Phe Ile Ala 820 825 830Ala Val Glu Arg Leu Trp Asp Tyr Gly Met Ser Ser Ser Pro His Val 835 840 845Leu Arg Asn Arg Ala Gln Ser Gly Ser Val Pro Gln Phe Lys Lys Val 850 855 860Val Phe Gln Glu Phe Thr Asp Gly Ser Phe Thr Gln Pro Leu Tyr Arg865 870 875 880Gly Glu Leu Asn Glu His Leu Gly Leu Leu Gly Pro Tyr Ile Arg Ala 885 890 895Glu Val Glu Asp Asn Ile Met Val Thr Phe Arg Asn Gln Ala Ser Arg 900 905 910Pro Tyr Ser Phe Tyr Ser Ser Leu Ile Ser Tyr Glu Glu Asp Gln Arg 915 920 925Gln Gly Ala Glu Pro Arg Lys Asn Phe Val Lys Pro Asn Glu Thr Lys 930 935 940Thr Tyr Phe Trp Lys Val Gln His His Met Ala Pro Thr Lys Asp Glu945 950 955 960Phe Asp Cys Lys Ala Trp Ala Tyr Phe Ser Asp Val Asp Leu Glu Lys 965 970 975Asp Val His Ser Gly Leu Ile Gly Pro Leu Leu Val Cys His Thr Asn 980 985 990Thr Leu Asn Pro Ala His Gly Arg Gln Val Thr Val Gln Glu Phe Ala 995 1000 1005Leu Phe Phe Thr Ile Phe Asp Glu Thr Lys Ser Trp Tyr Phe Thr Glu 1010 1015 1020Asn Met Glu Arg Asn Cys Arg Ala Pro Cys Asn Ile Gln Met Glu Asp1025 1030 1035 1040Pro Thr Phe Lys Glu Asn Tyr Arg Phe His Ala Ile Asn Gly Tyr Ile 1045 1050 1055Met Asp Thr Leu Pro Gly Leu Val Met Ala Gln Asp Gln Arg Ile Arg 1060 1065 1070Trp Tyr Leu Leu Ser Met Gly Ser Asn Glu Asn Ile His Ser Ile His 1075 1080 1085Phe Ser Gly His Val Phe Thr Val Arg Lys Lys Glu Glu Tyr Lys Met 1090 1095 1100Ala Leu Tyr Asn Leu Tyr Pro Gly Val Phe Glu Thr Val Glu Met Leu1105 1110 1115 1120Pro Ser Lys Ala Gly Ile Trp Arg Val Glu Cys Leu Ile Gly Glu His 1125 1130 1135Leu His Ala Gly Met Ser Thr Leu Phe Leu Val Tyr Ser Asn Lys Cys 1140 1145 1150Gln Thr Pro Leu Gly Met Ala Ser Gly His Ile Arg Asp Phe Gln Ile 1155 1160 1165Thr Ala Ser Gly Gln Tyr Gly Gln Trp Ala Pro Lys Leu Ala Arg Leu 1170 1175 1180His Tyr Ser Gly Ser Ile Asn Ala Trp Ser Thr Lys Glu Pro Phe Ser1185 1190 1195 1200Trp Ile Lys Val Asp Leu Leu Ala Pro Met Ile Ile His Gly Ile Lys 1205 1210 1215Thr Gln Gly Ala Arg Gln Lys Phe Ser Ser Leu Tyr Ile Ser Gln Phe 1220 1225 1230Ile Ile Met Tyr Ser Leu Asp Gly Lys Lys Trp Gln Thr Tyr Arg Gly 1235 1240 1245Asn Ser Thr Gly Thr Leu Met Val Phe Phe Gly Asn Val Asp Ser Ser 1250 1255 1260Gly Ile Lys His Asn Ile Phe Asn Pro Pro Ile Ile Ala Arg Tyr Ile1265 1270 1275 1280Arg Leu His Pro Thr His Tyr Ser Ile Arg Ser Thr Leu Arg Met Glu 1285 1290 1295Leu Met Gly Cys Asp Leu Asn Ser Cys Ser Met Pro Leu Gly Met Glu 1300 1305 1310Ser Lys Ala Ile Ser Asp Ala Gln Ile Thr Ala Ser Ser Tyr Phe Thr 1315 1320 1325Asn Met Phe Ala Thr Trp Ser Pro Ser Lys Ala Arg Leu His Leu Gln 1330 1335 1340Gly Arg Ser Asn Ala Trp Arg Pro Gln Val Asn Asn Pro Lys Glu Trp1345 1350 1355 1360Leu Gln Val Asp Phe Gln Lys Thr Met Lys Val Thr Gly Val Thr Thr 1365 1370 1375Gln Gly Val Lys Ser Leu Leu Thr Ser Met Tyr Val Lys Glu Phe Leu 1380 1385 1390Ile Ser Ser Ser Gln Asp Gly His Gln

Trp Thr Leu Phe Phe Gln Asn 1395 1400 1405Gly Lys Val Lys Val Phe Gln Gly Asn Gln Asp Ser Phe Thr Pro Val 1410 1415 1420Val Asn Ser Leu Asp Pro Pro Leu Leu Thr Arg Tyr Leu Arg Ile His1425 1430 1435 1440Pro Gln Ser Trp Val His Gln Ile Ala Leu Arg Met Glu Val Leu Gly 1445 1450 1455Cys Glu Ala Gln Asp Leu Tyr 146042366DNAArtificial SequenceFragment 1 for factor 8 mutant 4atgcaaatag agctctccac ctgcttcttt ctgtgccttt tgcgattctg ctttagtgcc 60accagaagat actacctggg tgcagtggaa ctgtcatggg actatatgca aagtgatctc 120ggtgagctgc ctgtggacgc aagatttcct cctagagtgc caaaatcttt tccattcaac 180acctcagtcg tgtacaaaaa gactctgttt gtagaattca cggatcacct tttcaacatc 240gctaagccaa ggccaccctg gatgggtctg ctaggtccta ccatccaggc tgaggtttat 300gatacagtgg tcattacact taagaacatg gcttcccatc ctgtcagtct tcatgctgtt 360ggtgtatcct actggaaagc ttctgaggga gctgaatatg atgatcagac cagtcaaagg 420gagaaagaag atgataaagt cttccctggt ggaagccata catatgtctg gcaggtcctg 480aaagagaatg gtccaatggc ctctgaccca ctgtgcctta cctactcata tctttctcat 540gtggacctgg taaaagactt gaattcaggc ctcattggag ccctactagt atgtagagaa 600gggagtctgg ccaaggaaaa gacacagacc ttgcacaaat ttatactact ttttgctgta 660tttgatgaag ggaaaagttg gcactcagaa acaaagaact ccttgatgca ggatagggat 720gctgcatctg ctcgggcctg gcctaaaatg cacacagtca atggttatgt aaacaggtct 780ctgccaggtc tgattggatg ccacaggaaa tcagtctatt ggcatgtgat tggaatgggc 840accactcctg aagtgcactc aatattcctc gaaggtcaca catttcttgt gaggaaccat 900cgccaggcgt ccttggaaat ctcgccaata actttcctta ctgctcaaac actcttgatg 960gaccttggac agtttctact gttttgtcat atctcttccc accaacatga tggcatggaa 1020gcttatgtca aagtagacag ctgtccagag gaaccccaac tacgaatgaa aaataatgaa 1080gaagcggaag actatgatga tgatcttact gattctgaaa tggatgtggt caggtttgat 1140gatgacaact ctccttcctt tatccaaatt cgctcagttg ccaagaagca tcctaaaact 1200tgggtacatt acattgctgc tgaagaggag gactgggact atgctccctt agtcctcgcc 1260cccgatgaca gaagttataa aagtcaatat ttgaacaatg gccctcagcg gattggtagg 1320aagtacaaaa aagtccgatt tatggcatac acagatgaaa cctttaagac tcgtgaagct 1380attcagcatg aatcaggaat cttgggacct ttactttatg gggaagttgg agacacactg 1440ttgattatat ttaagaatca agcaagcaga ccatataaca tctaccctca cggaatcact 1500gatgtccgtc ctttgtattc aaggagatta ccaaaaggtg taaaacattt gaaggatttt 1560ccaattctgc caggagaaat attcaaatat aaatggacag tgactgtaga agatgggcca 1620actaaatcag atcctcggtg cctgacccgc tattactcta gtttcgttaa tatggagaga 1680gatctagctt caggactcat tggccctctc ctcatctgct acaaagaatc tgtagatcaa 1740agaggaaacc agataatgtc agacaagagg aatgtcatcc tgttttctgt atttgatgag 1800aaccgaagct ggtacctcac agagaatata caacgctttc tccccaatcc agctggagtg 1860cagcttgagg atccagagtt ccaagcctcc aacatcatgc acagcatcaa tggctatgtt 1920tttgatagtt tgcagttgtc agtttgtttg catgaggtgg catactggta cattctaagc 1980attggagcac agactgactt cctttctgtc ttcttctctg gatatacctt caaacacaaa 2040atggtctatg aagacacact caccctattc ccattctcag gagaaactgt cttcatgtcg 2100atggaaaacc caggtctatg gattctgggg tgccacaact cagactttcg gaacagaggc 2160atgaccgcct tactgaaggt ttctagttgt gacaagaaca ctggtgatta ttacgaggac 2220agttatgaag atatttcagc atacttgctg agtaaaaaca atgccattga accaagaagc 2280ttctcccaga attcaagaca ccctagcact aggcaaaagc aatttaatgc caccacaatt 2340ccagaaaata ctactcttca gtcaga 236652060DNAArtificial SequenceFragment 2 for factor 8 mutant 5ccacaattcc agaaaatact actcttcagt cagatcaaga ggaaattgac tatgatgata 60ccatatcagt tgaaatgaag aaggaagatt ttgacattta tgatgaggat gaaaatcaga 120gcccccgcag ctttcaaaag aaaacacgac actattttat tgctgcagtg gagaggctct 180gggattatgg gatgagtagc tccccacatg ttctaagaaa cagggctcag agtggcagtg 240tccctcagtt caagaaagtt gttttccagg aatttactga tggctccttt actcagccct 300tataccgtgg agaactaaat gaacatttgg gactcctggg gccatatata agagcagaag 360ttgaagataa tatcatggta actttcagaa atcaggcctc tcgtccctat tccttctatt 420ctagccttat ttcttatgag gaagatcaga ggcaaggagc agaacctaga aaaaactttg 480tcaagcctaa tgaaaccaaa acttactttt ggaaagtgca acatcatatg gcacccacta 540aagatgagtt tgactgcaaa gcctgggctt atttctctga tgttgacctg gaaaaagatg 600tgcactcagg cctgattgga ccccttctgg tctgccacac taacacactg aaccctgctc 660atgggagaca agtgacagta caggaatttg ctctgttttt caccatcttt gatgagacca 720aaagctggta cttcactgaa aatatggaaa gaaactgcag ggctccctgc aatatccaga 780tggaagatcc cacttttaaa gagaattatc gcttccatgc aatcaatggc tacataatgg 840atacactacc tggcttagta atggctcagg atcaaaggat tcgatggtat ctgctcagca 900tgggcagcaa tgaaaacatc cattctattc atttcagtgg acatgtgttc actgtacgaa 960aaaaagagga gtataaaatg gcactgtaca atctctatcc aggtgttttt gagacagtgg 1020aaatgttacc atccaaagct ggaatttggc gggtggaatg ccttattggc gagcatctac 1080atgctgggat gagcacactt tttctggtgt acagcaataa gtgtcagact cccctgggaa 1140tggcttctgg acacattaga gattttcaga ttacagcttc aggacaatat ggacagtggg 1200ccccaaagct ggccagactt cattattccg gatcaatcaa tgcctggagc accaaggagc 1260ccttttcttg gatcaaggtg gatctgttgg caccaatgat tattcacggc atcaagaccc 1320agggtgcccg tcagaagttc tccagcctct acatctctca gtttatcatc atgtatagtc 1380ttgatgggaa gaagtggcag acttatcgag gaaattccac tggaacctta atggtcttct 1440ttggcaatgt ggattcatct gggataaaac acaatatttt taaccctcca attattgctc 1500gatacatccg tttgcaccca actcattata gcattcgcag cactcttcgc atggagttga 1560tgggctgtga tttaaatagt tgcagcatgc cattgggaat ggagagtaaa gcaatatcag 1620atgcacagat tactgcttca tcctacttta ccaatatgtt tgccacctgg tctccttcaa 1680aagctcgact tcacctccaa gggaggagta atgcctggag acctcaggtg aataatccaa 1740aagagtggct gcaagtggac ttccagaaga caatgaaagt cacaggagta actactcagg 1800gagtaaaatc tctgcttacc agcatgtatg tgaaggagtt cctcatctcc agcagtcaag 1860atggccatca gtggactctc ttttttcaga atggcaaagt aaaggttttt cagggaaatc 1920aagactcctt cacacctgtg gtgaactctc tagacccacc gttactgact cgctaccttc 1980gaattcaccc ccagagttgg gtgcaccaga ttgccctgag gatggaggtt ctgggctgcg 2040aggcacagga cctctactga 206061386DNAArtificial Sequencenucleotide sequence of Factor 9 6atgcagcgcg tgaacatgat catggcagaa tcaccaggcc tcatcaccat ctgcctttta 60ggatatctac tcagtgctga atgtacagtt tttcttgatc atgaaaacgc caacaaaatt 120ctgaatcggc caaagaggta taattcaggt aaattggaag agtttgttca agggaacctt 180gagagagaat gtatggaaga aaagtgtagt tttgaagaag cacgagaagt ttttgaaaac 240actgaaagaa caactgaatt ttggaagcag tatgttgatg gagatcagtg tgagtccaat 300ccatgtttaa atggcggcag ttgcaaggat gacattaatt cctatgaatg ttggtgtccc 360tttggatttg aaggaaagaa ctgtgaatta gatgtaacat gtaacattaa gaatggcaga 420tgcgagcagt tttgtaaaaa tagtgctgat aacaaggtgg tttgctcctg tactgaggga 480tatcgacttg cagaaaacca gaagtcctgt gaaccagcag tgccatttcc atgtggaaga 540gtttctgttt cacaaacttc taagctcacc cgtgctgaga ctgtttttcc tgatgtggac 600tatgtaaatt ctactgaagc tgaaaccatt ttggataaca tcactcaaag cacccaatca 660tttaatgact tcactcgggt tgttggtgga gaagatgcca aaccaggtca attcccttgg 720caggttgttt tgaatggtaa agttgatgca ttctgtggag gctctatcgt taatgaaaaa 780tggattgtaa ctgctgccca ctgtgttgaa actggtgtta aaattacagt tgtcgcaggt 840gaacataata ttgaggagac agaacataca gagcaaaagc gaaatgtgat tcgaattatt 900cctcaccaca actacaatgc agctattaat aagtacaacc atgacattgc ccttctggaa 960ctggacgaac ccttagtgct aaacagctac gttacaccta tttgcattgc tgacaaggaa 1020tacacgaaca tcttcctcaa atttggatct ggctatgtaa gtggctgggg aagagtcttc 1080cacaaaggga gatcagcttt agttcttcag taccttagag ttccacttgt tgaccgagcc 1140acatgtcttc gatctacaaa gttcaccatc tataacaaca tgttctgtgc tggcttccat 1200gaaggaggta gagattcatg tcaaggagat agtgggggac cccatgttac tgaagtggaa 1260gggaccagtt tcttaactgg aattattagc tggggtgaag agtgtgcaat gaaaggcaaa 1320tatggaatat ataccaaggt atcccggtat gtcaactgga ttaaggaaaa aacaaagctc 1380acttaa 138673725DNAArtificial Sequencenucleotide sequence of pGP 7gttgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac 240atcaagtgta tcatatgcca agtccgcccc ctattgacgt caatgacggt aaatggcccg 300cctggcatta tgcccagtac atgaccttac gggactttcc tacttggcag tacatctacg 360tattagtcat cgctattacc atggtgatgc ggttttggca gtacaccaat gggcgtggat 420agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat gggagtttgt 480tttggcacca aaatcaacgg gactttccaa aatgtcgtaa taaccccgcc ccgttgacgc 540aaatgggcgg taggcgtgta cggtgggagg tctatataag cagagctcgt ttagtgaacc 600gtcagatcgc ctggagacgc catccacgct gttttgacct ccatagaaga caccgggacc 660gatccagcct ccgcggccgg gaacggtgca ttggaacgcg gattccccgt gccaagagtg 720acgtaagtac cgcctataga ctctataggc acaccccttt ggctcttatg catgctatac 780tgtttttggc ttggggccta tacacccccg cttccttatg ctataggtga tggtatagct 840tagcctatag gtgtgggtta ttgaccatta ttgaccactc ccctattggt gacgatactt 900tccattacta atccataaca tggctctttg ccacaactat ctctattggc tatatgccaa 960tactctgtcc ttcagagact gacacggact ctgtattttt acaggatggg gtcccattta 1020ttatttacaa attcacatat acaacaacgc cgtcccccgt gcccgcagtt tttattaaac 1080atagcgtggg atctccacgc gaatctcggg tacgtgttcc ggacatgggc tcttctccgg 1140tagcggcgga gcttccacat ccgagccctg gtcccatgcc tccagcggct catggtcgct 1200cggcagctcc ttgctcctaa cagtggaggc cagacttagg cacagcacaa tgcccaccac 1260caccagtgtg ccgcacaagg ccgtggcggt agggtatgtg tctgaaaatg agctcggaga 1320ttgggctcgc accgctgacg cagatggaag acttaaggca gcggcagaag aagatgcagg 1380cagctgagtt gttgtattct gataagagtc agaggtaact cccgttgcgg tgctgttaac 1440ggtggagggc agtgtagtct gagcagtact cgttgctgcc gcgcgcgcca ccagacataa 1500tagctgacag actaacagac tgttcctttc catgggtctt ttctgcagtc accgtccttg 1560acacgaagct tgctagcgga tccgtcgacg aattcacgcg tctcgaggcg gccgctctag 1620agggcccgtt taaacccgct gatcagcctc gactgtgcct tctagttgcc agccatctgt 1680tgtttgcccc tcccccgtgc cttccttgac cctggaaggt gccactccca ctgtcctttc 1740ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta ttctgggggg 1800tggggtgggg caggacagca agggggagga ttgggaagac aatagcaggc atgctgggga 1860gtcgaaattc agaagaactc gtcaagaagg cgatagaagg cgatgcgctg cgaatcggga 1920gcggcgatac cgtaaagcac gaggaagcgg tcagcccatt cgccgccaag ctcttcagca 1980atatcacggg tagccaacgc tatgtcctga tagcggtccg ccacacccag ccggccacag 2040tcgatgaatc cagaaaagcg gccattttcc accatgatat tcggcaagca ggcatcgcca 2100tgggtcacga cgagatcctc gccgtcgggc atgctcgcct tgagcctggc gaacagttcg 2160gctggcgcga gcccctgatg ctcttcgtcc agatcatcct gatcgacaag accggcttcc 2220atccgagtac gtgctcgctc gatgcgatgt ttcgcttggt ggtcgaatgg gcaggtagcc 2280ggatcaagcg tatgcagccg ccgcattgca tcagccatga tggatacttt ctcggcagga 2340gcaaggtgag atgacaggag atcctgcccc ggcacttcgc ccaatagcag ccagtccctt 2400cccgcttcag tgacaacgtc gagcacagct gcgcaaggaa cgcccgtcgt ggccagccac 2460gatagccgcg ctgcctcgtc ttgcagttca ttcagggcac cggacaggtc ggtcttgaca 2520aaaagaaccg ggcgcccctg cgctgacagc cggaacacgg cggcatcaga gcagccgatt 2580gtctgttgtg cccagtcata gccgaatagc ctctccaccc aagcggccgg agaacctgcg 2640tgcaatccat cttgttcaat catgcgaaac gatcctcatc ctgtctcttg atcagatctt 2700gatcccctgc gccatcagat ccttggcggc gagaaagcca tccagtttac tttgcagggc 2760ttcccaactt accagagggc gccccagctg gcaattccgg ttcgcttgct gtccataaaa 2820ccgcccagtc tagctatcgc catgtaagcc cactgcaagc tacctgcttt ctctttgcgc 2880ttgcgttttc ccttgtccag atagcccagt agctgacatt catccggggt cagcaccgtt 2940tctgcggact ggctttctac gtgaaaagga tctaggtgaa gatccttttt gataatctca 3000tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga 3060tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa 3120aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga 3180aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt 3240taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt 3300taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat 3360agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct 3420tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca 3480cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag 3540agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc 3600gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga 3660aaaacgccag caacgcggcc tttttacggt tcctgggctt ttgctggcct tttgctcaca 3720tgcgc 3725

Claims

1. A composition for increasing the expression of a blood coagulation factor gene, comprising core-shell structured microparticles as an active ingredient, wherein the core is a halogenated hydrocarbon, halogenated sulfur or a mixture thereof as a biocompatible gas, and the shell is a lipid or a derivative thereof, and the blood coagulation factor gene is one or more gene selected from a human blood coagulation factor VIII gene or a variant gene thereof.

2. The composition for increasing the expression of a blood coagulation factor gene according to claim 1, wherein the biocompatible gas is selected from sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, chlorotrifluoromethane, chloropentafluoroethane, dichlorotetrafluoroethane and a mixture thereof.

3. The composition for increasing the expression of a blood coagulation factor gene according to claim 1, wherein the halogenated hydrocarbon is a perfluorinated hydrocarbon.

4. The composition for increasing the expression of a blood coagulation factor gene according to claim 3, wherein the perfluorinated hydrocarbon is perfuoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane, perfluoropropene, perfluorobutene, perfluorobutadiene, perfluorobut-2-ene, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclobutane, perfluorocyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane or a mixture thereof.

5. The composition for increasing the expression of a blood coagulation factor gene according to claim 1, wherein the lipid is one or more selected from a group consisting of a simple lipid, a phospholipid, a glyceroglycolipid, a sphingoglycolipid, a cholesterol and a cationic lipid.

6. The composition for increasing the expression of a blood coagulation factor gene according to claim 5, wherein the phospholipid is selected from a group consisting of a phosphatidylcholine derivative, a phosphatidylethanolamine derivative, a phosphatidylserine derivative, a diacetylated phospholipid, L-.alpha.-dioleyl phosphatidylethanolamine, diolein, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, sphingomyelin, a polyethylene glycolated phospholipid, egg yolk lecithin, soy lecithin and a hydrogenated phospholipid.

7. The composition for increasing the expression of a blood coagulation factor gene according to claim 5, wherein the glyceroglycolipid is selected from a group consisting of sulfoxyribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride and glycosyl diglyceride.

8. The composition for increasing the expression of a blood coagulation factor gene according to claim 5, wherein the sphingoglycolipid is galactosyl cerebroside, lactosyl cerebroside or ganglioside.

9. The composition for increasing the expression of a blood coagulation factor gene according to claim 5, wherein the cationic lipid is selected from a group consisting of 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), N-(2,3-dioleyloxypropan-1-yl)-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-p- ropanaminium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyloxypropyl-3-diethylhydroxyethylammonium bromide (DORIE) and 3.beta.-[N--(N'N'-dimethylaminoethylhy)carbamoyl]cholesterol (DC-Chol).

10. The composition for increasing the expression of a blood coagulation factor gene according to claim 1, wherein the blood coagulation factor VIII is composed of an amino acid sequence represented by SEQ ID NO 1, and the variant of blood coagulation factor VIII is composed of an amino acid sequence represented by SEQ ID NO 3.

11. The composition for increasing the expression of a blood coagulation factor gene according to claim 1, wherein the composition increases the expression of the blood coagulation factor gene by 30% or more.

12. A pharmaceutical composition for preventing or treating a bleeding disorder or bleeding, comprising the composition according to claim 1 and a human blood coagulation factor VIII gene or a variant gene thereof.

13. The pharmaceutical composition for preventing or treating a bleeding disorder or bleeding according to claim 12, wherein the bleeding disorder is hemophilia A, hemophilia induced or complicated by an inhibitory antibody against blood coagulation factor VIII or blood coagulation factor Villa, or hemophilia B.

14. The pharmaceutical composition for preventing or treating a bleeding disorder or bleeding according to claim 12, wherein the bleeding disorder or bleeding is one of neonatal coagulopathy, severe liver disease, thrombocytopenia, congenital deficiency of factor V, VII, X or XI, and von Willebrand disease having an inhibitor against von Willebrand factor.

15. The pharmaceutical composition for preventing or treating a bleeding disorder or bleeding according to claim 12, wherein the bleeding is caused by blood loss associated with high-risk surgical procedures, traumatic blood loss, blood loss caused by bone marrow transplantation or blood loss caused by cerebral hemorrhage.

Images