U.S. patent application number 16/997304 was filed with the patent office on 2021-04-15 for products and methods for treatment of familial amyotrophic lateral sclerosis.
The applicant listed for this patent is LUDWIG INSTITUTE FOR CANCER RESEARCH, RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL. Invention is credited to Don W. Cleveland, Kevin Foust, Brian K. Kaspar.
Application Number | 20210108209 16/997304 |
Document ID | / |
Family ID | 1000005293241 |
Filed Date | 2021-04-15 |
View All Diagrams
United States Patent
Application |
20210108209 |
Kind Code |
A1 |
Kaspar; Brian K. ; et
al. |
April 15, 2021 |
Products and Methods for Treatment of Familial Amyotrophic Lateral
Sclerosis
Abstract
The present invention relates to RNA-based methods for
inhibiting the expression of the superoxide dismutase 1 (SOD-1)
gene. Recombinant adeno-associated viruses of the invention deliver
DNAs encoding RNAs that knock down the expression of SOD-1. The
methods have application in the treatment of amyotrophic lateral
sclerosis.
Inventors: |
Kaspar; Brian K.;
(Westerville, OH) ; Foust; Kevin; (Columbus,
OH) ; Cleveland; Don W.; (La Jolla, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL
LUDWIG INSTITUTE FOR CANCER RESEARCH |
Columbus
Zurich |
OH |
US
CH |
|
|
Family ID: |
1000005293241 |
Appl. No.: |
16/997304 |
Filed: |
August 19, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16041381 |
Jul 20, 2018 |
10793861 |
|
|
16997304 |
|
|
|
|
14914861 |
Feb 26, 2016 |
|
|
|
PCT/US2014/052753 |
Aug 26, 2014 |
|
|
|
16041381 |
|
|
|
|
61870585 |
Aug 27, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Y 115/01001 20130101;
C12N 2750/14143 20130101; C12N 15/86 20130101; C12N 2310/14
20130101; A61K 31/7105 20130101; C12N 2320/32 20130101; C12N
2750/14043 20130101; C12N 2310/531 20130101; C12N 9/0089 20130101;
C12N 15/1137 20130101; C12N 7/00 20130101; A61K 9/0019
20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 9/02 20060101 C12N009/02; C12N 15/86 20060101
C12N015/86; A61K 9/00 20060101 A61K009/00; A61K 31/7105 20060101
A61K031/7105; C12N 7/00 20060101 C12N007/00 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under U.S.
National Institutes of Health R21-NS067238, NS027036, ROI NS064492
and RC2 NS69476-01. The Government has certain rights in the
invention.
Claims
1-3. (canceled)
4. A method of delivering a SOD1 shRNA-encoding DNA, to a subject
in need thereof, comprising administering to the subject a
recombinant adeno-associated virus comprising the SOD1
shRNA-encoding DNA, a sequence selected from the group consisting
of: TABLE-US-00005 (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ
ID NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3)
CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ
ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6)
GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ
ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9)
GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ
ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12)
GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ
ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 16)
TCGAGCAGAAGGAAAGTAA, (SEQ ID NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID
NO: 18) TCACTCTCAGGAGACCATT, and (SEQ ID NO: 19)
GCTTTAAAGTACCTGTAGT;
wherein the recombinant adeno-associated virus genome lacks rep and
cap genes.
5-11. (canceled)
12. The method of claim 4, wherein the subject has amyotrophic
lateral sclerosis (ALS).
13. The method of claim 12, wherein the ALS is associated with one
or more SOD1 mutations.
14. The method of claim 4, wherein the adeno-associated virus
further comprises an H1 promoter operably linked to the SOD1
shRNA-encoding DNA.
15. The method of claim 14, wherein the H1 promoter comprises
nucleotides 966 to 1064 of SEQ ID NO:20.
16. The method of claim 4, wherein the virus genome is a
self-complementary genome.
17. The method of claim 4, wherein the recombinant adeno-associated
virus is an rAAV2, rAAV9 or rAAVrh74 virus.
18. The method of claim 17, wherein the recombinant
adeno-associated virus is rAAV9.
19. The method of claim 4, wherein the adeno-associated virus
further comprises a stuffer sequence.
20. The method of claim 19, wherein the stuffer sequence comprises
SEQ ID NO: 22.
21. The method of claim 4, wherein the SOD1 shRNA-encoding DNA
comprises SEQ ID NO: 4.
22. The method of claim 4, wherein the SOD1 shRNA-encoding DNA
comprises, from 5' to 3': a) nucleotides 104-123 of SEQ ID NO: 21;
b) a stem loop; and c) nucleotides 133-152 of SEQ ID NO: 21.
23. The method of claim 4, wherein recombinant adeno-associated
virus is administered by parenteral, intravenous, intrathecal
introcerebroventricular, or cisterna magna administration.
24. The method of claim 23, wherein the recombinant
adeno-associated virus is administered by intrathecal
administration.
25. The method of claim 24, wherein the intrathecal administration
is by lumbar puncture.
26. A superoxide dismutase 1 (SOD1) shRNA-encoding DNA comprising:
TABLE-US-00006 (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ ID
NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3)
CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ
ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6)
GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ
ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9)
GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ
ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12)
GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ
ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 16)
TCGAGCAGAAGGAAAGTAA, (SEQ ID NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID
NO: 18) TCACTCTCAGGAGACCATT, or (SEQ ID NO: 19)
GCTTTAAAGTACCTGTAGT.
27. A DNA plasmid comprising a recombinant adeno-associated virus
genome comprising a superoxide dismutase 1 (SOD1) shRNA-encoding
DNA comprising a sequence selected from the group consisting of:
TABLE-US-00007 (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ ID
NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3)
CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ
ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6)
GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ
ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9)
GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ
ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12)
GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ
ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 16)
TCGAGCAGAAGGAAAGTAA, (SEQ ID NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID
NO: 18) TCACTCTCAGGAGACCATT, and (SEQ ID NO: 19)
GCTTTAAAGTACCTGTAGT,
wherein the recombinant adeno-associated virus genome lacks rep and
cap genes.
28. A packaging cell comprising the DNA plasmid of claim 27.
Description
[0001] The present application is a continuation of U.S. patent
application Ser. No. 16/041,381, filed Jul. 20, 2018, which is a
continuation of U.S. patent application Ser. No. 14/914,861, filed
on Feb. 26, 2016, now abandoned, which is a national phase filing
of U.S. International Patent Application No. PCT/US14/52753, filed
on Aug. 26, 2014, which claims priority benefit of U.S. Provisional
Application No. 61/870,585, filed Aug. 27, 2013, all of which are
incorporated by reference herein in their entirety.
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0003] Incorporated by reference in its entirety is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: 14,350 byte ACII
(Text) file named "47886PCT_SeqListing.txt," created on Aug. 26,
2014.
FIELD OF THE INVENTION
[0004] The present invention relates to RNA-based methods for
inhibiting the expression of the superoxide dismutase 1 (SOD-1)
gene. Recombinant adeno-associated viruses of the invention deliver
DNAs encoding RNAs that knock down the expression of SOD-1. The
methods have application in the treatment of amyotrophic lateral
sclerosis (ALS).
BACKGROUND
[0005] ALS is an adult-onset, rapidly progressive and fatal
neurodegenerative disease, characterized by selective degeneration
of both upper and lower motor neurons. First characterized by
Charcot in 1869, ALS is responsible for one in every 2000 deaths,
affecting nearly 5 out of 100,000 individuals. ALS occurs when
specific nerve cells in the brain and spinal cord that control
voluntary movement degenerate. Within two to five years after
clinical onset, the loss of these motor neurons leads to
progressive atrophy of skeletal muscles, which results in loss of
muscular function resulting in paralysis, speech deficits, and
death due to respiratory failure.
[0006] Most ALS cases have no clear genetic linkage and are
referred to as sporadic, but in 10% of instances disease is
familial with dominant inheritance. Twenty percent of familial
cases are caused by mutations in the enzyme superoxide dismutase 1
(SOD1), with over 140 distinct mutations identified to date.sup.1,
2. Many efforts to identify how mutations alter the function of
SOD1 have produced a consensus view that SOD1 mutants acquire one
or more toxicities, whose nature still remains controversial.sup.3,
but there is clear evidence that a proportion of mutant SOD1 is
misfolded and subsequently aggregates.sup.4, 5. SOD1 aggregates
are, in fact, one of the histological hallmarks of SOD1-related ALS
cases.sup.4.
[0007] In the past 20 years, multiple animal models expressing
mutant forms of human SOD1 have been generated. These models
recapitulate the hallmarks of ALS, developing age-dependent motor
axon degeneration and accompanying muscle denervation, glial
inflammation and subsequent motor neuron loss. Selective gene
excision experiments have determined that mutant SOD1 expression
within motor neurons themselves contributes to disease onset and
early disease progression.sup.6, as does mutant synthesis in
NG2.sup.+ cells.sup.7 that are precursors to oligodendrocytes.
However, mutant SOD1 protein expression in microglia and astrocytes
significantly drives rapid disease progression.sup.6, 8, findings
which have lead to the conclusion that ALS pathophysiology is
non-cell autonomous.sup.3.
[0008] Further, astrocytes have been found to be toxic to motor
neurons in multiple in vitro models where mutant forms of human
SOD1 were overexpressed.sup.9-11. A recent study derived astrocytes
from post-mortem spinal cords of ALS patients with or without SOD1
mutations. In all cases, astrocytes from sporadic ALS patients were
as toxic to motor neurons as astrocytes carrying genetic mutations
in SOD.sup.12. Even more strikingly, reduction of SOD1 in
astrocytes derived from both sporadic and familial ALS patients
decreased astrocyte-derived toxicity that is selective for motor,
but not GABA, neurons. This remarkable finding, along with reports
that misfolded SOD1 inclusions are found in the spinal cords of
familial as well as some sporadic ALS patients.sup.13,14, 15, has
provided strong evidence for a pathogenic role of wild-type SOD1 in
sporadic ALS.
[0009] Despite the insights that SOD1 mutant-expressing animal
models have provided for understanding mechanisms involved in motor
neuron degeneration, their utility for the development of
therapeutic approaches has been questioned.sup.16, as no drug with
a reported survival benefit in mutant SOD1.sup.G93A mice has been
effective in clinical trials with sporadic ALS patients. In all but
one case the drugs taken to human trial had been reported only to
extend mutant SOD1 mouse survival when applied presymptomatically,
and even then to provide a survival benefit solely by delaying
disease onset with no benefit in slowing disease progression. The
one exception to this was riluzole, which like the human situation,
modestly extended survival of mutant SOD1.sup.G93A mice and did so
by slowing disease progression.sup.17. Recognizing that success at
human trial will require slowing of disease progression, the SOD1
mutant mice have perfectly predicted the success of riluzole and
the failure of efficacy of each other drug attempted in human
trial. What has been missing are additional therapies that affect
disease progression in these mice.
[0010] Thus, riluzole is the only drug currently approved by the
FDA as a therapy for ALS, providing a modest survival
benefit.sup.21. For the 20% of familial cases caused by mutation in
SOD1, attempts at improving therapy by reducing synthesis of SOD1
have been the focus of multiple therapeutic development approaches.
Antisense oligonucleotides and viral delivered RNA interference
(RNAi) were tested in rat.sup.22 and mouse models.sup.23-25 that
develop fatal paralysis from overexpressing human SOD1.sup.G93A.
Antisense oligonucleotides infused at disease onset produced SOD1
reduction and a modest slowing of disease progression.sup.22.
Direct CSF infusion of antisense oligonucleotides has been tested
clinically.sup.26, leading to encouraging results in terms of
tolerability and safety, but without significant reduction in SOD1
levels at the low dosages utilized. In each of the prior viral
studies.sup.23-25, SOD1 knockdown was achieved before disease onset
by direct injection into the nervous system or taking advantage of
axonal retrograde transport when a virus was injected
intramuscularly.sup.23, 24. These studies led to varying degrees of
success in extending survival or improving motor performance,
depending on the time of treatment as well as level of SOD1
knockdown achieved in the spinal cord. Although these studies
provided important proof of principle, the approaches were far from
being readily translated into clinical strategies. Indeed, there
have been controversial reports surrounding these initial viral
mediated SOD1 suppression studies.sup.23, 24, 27-29.
[0011] Adeno-associated virus (AAV) vectors have been used in a
number of recent clinical trials for treatment of neurological
disorders [Kaplitt et al., Lancet 369: 2097-2105 (2007); Marks et
al., Lancet Neurol 7: 400-408 (2008); Worgall et al., Hum Gene Ther
(2008)].
[0012] AAV is a replication-deficient parvovirus, the
single-stranded DNA genome of which is about 4.7 kb in length
including 145 nucleotide inverted terminal repeat (ITRs). The
nucleotide sequence of the AAV serotype 2 (AAV2) genome is
presented in Srivastava et al., J Virol, 45: 555-564 (1983) as
corrected by Ruffing et al., J Gen Virol, 75: 3385-3392 (1994).
Cis-acting sequences directing viral DNA replication (rep),
encapsidation/packaging and host cell chromosome integration are
contained within the ITRs. Three AAV promoters (named p5, p19, and
p40 for their relative map locations) drive the expression of the
two AAV internal open reading frames encoding rep and cap genes.
The two rep promoters (p5 and p19), coupled with the differential
splicing of the single AAV intron (at nucleotides 2107 and 2227),
result in the production of four rep proteins (rep 78, rep 68, rep
52, and rep 40) from the rep gene. Rep proteins possess multiple
enzymatic properties that are ultimately responsible for
replicating the viral genome. The cap gene is expressed from the
p40 promoter and it encodes the three capsid proteins VP1, VP2, and
VP3. Alternative splicing and non-consensus translational start
sites are responsible for the production of the three related
capsid proteins. A single consensus polyadenylation site is located
at map position 95 of the AAV genome. The life cycle and genetics
of AAV are reviewed in Muzyczka, Current Topics in Microbiology and
Immunology, 158: 97-129 (1992).
[0013] AAV possesses unique features that make it attractive as a
vector for delivering foreign DNA to cells, for example, in gene
therapy. AAV infection of cells in culture is noncytopathic, and
natural infection of humans and other animals is silent and
asymptomatic. Moreover, AAV infects many mammalian cells allowing
the possibility of targeting many different tissues in vivo.
Moreover, AAV transduces slowly dividing and non-dividing cells,
and can persist essentially for the lifetime of those cells as a
transcriptionally active nuclear episome (extrachromosomal
element). The AAV proviral genome is infectious as cloned DNA in
plasmids which makes construction of recombinant genomes feasible.
Furthermore, because the signals directing AAV replication, genome
encapsidation and integration are contained within the ITRs of the
AAV genome, some or all of the internal approximately 4.3 kb of the
genome (encoding replication and structural capsid proteins,
rep-cap) may be replaced with foreign DNA such as a gene cassette
containing a promoter, a DNA of interest and a polyadenylation
signal. The rep and cap proteins may be provided in trans. Another
significant feature of AAV is that it is an extremely stable and
hearty virus. It easily withstands the conditions used to
inactivate adenovirus (56 to 65.degree. C. for several hours),
making cold preservation of AAV less critical. AAV may even be
lyophilized. Finally, AAV-infected cells are not resistant to
superinfection.
[0014] Multiple serotypes of AAV exist and offer varied tissue
tropism. Known serotypes include, for example, AAV1, AAV2, AAV3,
AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAVrh74.
Advances in the delivery of AAV6 and AAV8 have made possible the
transduction by these serotypes of skeletal and cardiac muscle
following simple systemic intravenous or intraperitoneal
injections. See Pacak et al., Circ. Res., 99(4): 3-9 (1006) and
Wang et al., Nature Biotech., 23(3): 321-8 (2005). The use of AAV
to target cell types within the central nervous system has involved
surgical intraparenchymal injection. See, Kaplitt et al., supra;
Marks et al., supra and Worgall et al., supra. Regarding the use of
AAV to target cell types within the nervous system, see
International Publication No. WO 2010/071832. International
Publication Nos. WO 2009/043936 and WO 2009/013290 state they
relate to delivering genes to the central nervous system.
International Publication No. WO 2011/133890 states it relates to
recombinant adeno-associated viruses useful for targeting
transgenes to central nervous system tissue.
[0015] There thus remains a need in the art for methods and
materials for treatment of ALS.
SUMMARY
[0016] The present invention provides products and methods useful
for reducing mutant SOD1 protein levels in subjects in need
thereof. The invention provides AAV-mediated delivery of RNAs
including, but not limited to short hairpin RNAs, to reduce
synthesis of ALS-causing human SOD1 mutants in subjects in need
thereof. Recombinant AAV (rAAV) contemplated by the invention
include, but are not limited to, rAAV9, rAAV2 and rAAVrh74.
Delivery routes contemplated by the invention include, but are not
limited to, systemic delivery and intrathecal delivery. Use of the
methods and products of the invention is indicated, for example, in
treating ALS.
DETAILED DESCRPTION
[0017] In one aspect, the invention provides rAAV genomes
comprising one or more AAV ITRs flanking a polynucleotide encoding
one or more RNAs (including, but not limited to, small hairpin
RNAs, antisense RNAs and/or microRNAs) that target mutant SOD1
polynucleotides. The examples describe the use of exemplary rAAV
encoding small hairpin RNAs (shRNAs). In the rAAV genomes, the
shRNA-encoding polynucleotide is operatively linked to
transcriptional control DNA, specifically promoter DNA that is
functional in target cells. Commercial providers such as Ambion
Inc. (Austin, Tex.), Darmacon Inc. (Lafayette, Colo.), InvivoGen
(San Diego, Calif.), and Molecular Research Laboratories, LLC
(Herndon, Va.) generate custom inhibitory RNA molecules. In
addition, commercially kits are available to produce custom siRNA
molecules, such as SILENCER.TM. siRNA Construction Kit (Ambion
Inc., Austin, Tex.) or psiRNA System (InvivoGen, San Diego,
Calif.). In some embodiments, the rAAV genome comprises a DNA
encoding a SOD1 shRNA such as:
TABLE-US-00001 (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ ID
NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3)
CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA
(''shRNA 130'' or ''SOD1 shRNA'' herein), (SEQ ID NO: 5)
GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6) GGTCTGGCCTATAAAGTAGTC, (SEQ
ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ ID NO: 8)
GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9) GCCTGCATGGATTCCATGTTC, (SEQ
ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ ID NO: 11)
GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12) GGAGATAATACAGCAGGCTGT, (SEQ
ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ ID NO: 14)
GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA,
(SEQ ID NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3)
CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ
ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6)
GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ
ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9)
GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ
ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12)
GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ
ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 15)
TCATCAATTTCGAGCAGAA, (SEQ ID NO: 16) TCGAGCAGAAGGAAAGTAA, (SEQ ID
NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID NO: 18) TCACTCTCAGGAGACCATT,
or (SEQ ID NO: 19) GCTTTAAAGTACCTGTAGT.
[0018] The rAAV genomes of the invention lack AAV rep and cap DNA.
AAV DNA in the rAAV genomes (e.g., ITRs) may be from any AAV
serotype for which a recombinant virus can be derived including,
but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4,
AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11. The
nucleotide sequences of the genomes of the AAV serotypes are known
in the art. For example, the complete genome of AAV-1 is provided
in GenBank Accession No. NC_002077; the complete genome of AAV-2 is
provided in GenBank Accession No. NC_001401 and Srivastava et al.,
J. Virol., 45: 555-564 {1983); the complete genome of AAV-3 is
provided in GenBank Accession No. NC_1829; the complete genome of
AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5
genome is provided in GenBank Accession No. AF085716; the complete
genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at
least portions of AAV-7 and AAV-8 genomes are provided in GenBank
Accession Nos. AX753246 and AX753249, respectively; the AAV-9
genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004);
the AAV-10 genome is provided in Mol. Ther., 13(1): 67-76 (2006);
and the AAV-11 genome is provided in Virology, 330(2): 375-383
(2004). The AAVrh74 genome is provided in International Publication
No. WO 2013/078316.
[0019] In another aspect, the invention provides DNA plasmids
comprising rAAV genomes of the invention. The DNA plasmids are
transferred to cells permissible for infection with a helper virus
of AAV (e.g., adenovirus, E1-deleted adenovirus or herpesvirus) for
assembly of the rAAV genome into infectious viral particles.
Techniques to produce rAAV particles, in which an AAV genome to be
packaged, rep and cap genes, and helper virus functions are
provided to a cell are standard in the art. Production of rAAV
requires that the following components are present within a single
cell (denoted herein as a packaging cell): a rAAV genome, AAV rep
and cap genes separate from (i.e., not in) the rAAV genome, and
helper virus functions. The AAV rep and cap genes may be from any
AAV serotype for which recombinant virus can be derived and may be
from a different AAV serotype than the rAAV genome ITRs, including,
but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4,
AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11. Production of
pseudotyped rAAV is disclosed in, for example, WO 01/83692 which is
incorporated by reference herein in its entirety. In various
embodiments, AAV capsid proteins may be modified to enhance
delivery of the recombinant vector. Modifications to capsid
proteins are generally known in the art. See, for example, US
20050053922 and US 20090202490, the disclosures of which are
incorporated by reference herein in their entirety.
[0020] A method of generating a packaging cell is to create a cell
line that stably expresses all the necessary components for AAV
particle production. For example, a plasmid (or multiple plasmids)
comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and
cap genes separate from the rAAV genome, and a selectable marker,
such as a neomycin resistance gene, are integrated into the genome
of a cell. AAV genomes have been introduced into bacterial plasmids
by procedures such as GC tailing (Samulski et al., 1982, Proc.
Natl. Acad. S6. USA, 79:2077-2081), addition of synthetic linkers
containing restriction endonuclease cleavage sites (Laughlin et
al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation
(Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The
packaging cell line is then infected with a helper virus such as
adenovirus. The advantages of this method are that the cells are
selectable and are suitable for large-scale production of rAAV.
Other examples of suitable methods employ adenovirus or baculovirus
rather than plasmids to introduce rAAV genomes and/or rep and cap
genes into packaging cells.
[0021] General principles of rAAV production are reviewed in, for
example, Carter, 1992, Current Opinions in Biotechnology, 1533-539;
and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol.,
158:97-129). Various approaches are described in Ratschin et al.,
Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad.
Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251
(1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski
et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al. (1989,
J. Virol., 63:3822-3828); U.S. Pat. No. 5,173,414; WO 95/13365 and
corresponding U.S. Pat. No. 5,658,776; WO 95/13392; WO 96/17947;
PCT/US98/18600; WO 97/09441 (PCT/US96/14423); WO 97/08298
(PCT/US96/13872); WO 97/21825 (PCT/US96/20777); WO 97/06243
(PCT/FR96/01064); WO 99/11764; Perrin et al. (1995) Vaccine
13:1244-1250; Paul et al. (1993) Human Gene Therapy 4:609-615;
Clark et al. (1996) Gene Therapy 3:1124-1132; U.S. Pat. Nos.
5,786,211; 5,871,982; and 6,258,595. Single-stranded rAAV are
specifically contemplated. The foregoing documents are hereby
incorporated by reference in their entirety herein, with particular
emphasis on those sections of the documents relating to rAAV
production.
[0022] The invention thus provides packaging cells that produce
infectious rAAV. In one embodiment packaging cells may be stably
transformed cancer cells such as HeLa cells, 293 cells and PerC.6
cells (a cognate 293 line). In another embodiment, packaging cells
are cells that are not transformed cancer cells such as low passage
293 cells (human fetal kidney cells transformed with E1 of
adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells
(human fetal fibroblasts), Vero cells (monkey kidney cells) and
FRhL-2 cells (rhesus fetal lung cells).
[0023] In still another aspect, the invention provides rAAV (i.e.,
infectious encapsidated rAAV particles) comprising a rAAV genome of
the invention. In some embodiments, the rAAV genome is a
self-complementary genome. The genomes of the rAAV lack AAV rep and
cap DNA, that is, there is no AAV rep or cap DNA between the ITRs
of the genomes. Embodiments include, but are not limited to, the
exemplary rAAV including a genome encoding the SOD1 shRNA named
"AAV-SOD1-shRNA." A sequence including the AAV-SOD1-shRNA genome is
set out below as an inverted sequence from a plasmid used in
production.
TABLE-US-00002 FEATURES Location/Qualifiers misc_feature 662..767
/gene = ''mutated ITR'' /SECDrawAs = ''Region'' /SECStyleId = 1 CDS
complement(901..965) /gene = ''SOD shRNA'' /SECDrawAs = ''Gene''
/SECStyleId = 1 misc_feature complement(966..1064) /gene = ''H1''
/SECDrawAs = ''Region'' /SECStyleId = 1 misc_feature 1224..1503
/gene = ''CMV enhancer'' /SECDrawAs = ''Region'' /SECStyleId = 1
misc_feature 1510..1779 /gene = ''B-Actin promoter'' /product =
''Chicken'' /SECDrawAs = ''Region'' /SECStyleId = 1 misc_feature
1845..1875 /gene = ''SV40 late_19s_int'' /SECDrawAs = ''Region''
/SECStyleId = 1 misc_feature 1845..1941 /gene =
''modSV40_late_6s_int'' /SECDrawAs = ''Region'' /SECStyleId = 1 CDS
2015..2734 /gene = ''GFP'' /SECDrawAs = ''Gene'' /SECStyleId = 1
misc_feature 2783..2929 /gene = ''BGHpA'' /SECDrawAs = ''Region''
/SECStyleId = 1 misc_feature 3009..3149 /gene = ''ITR'' /SECDrawAs
= ''Region'' /SECStyleId = 1 misc_feature 3983..4843 /gene = ''amp
r'' /SECDrawAs = ''Region'' /SECStyleId = 1 misc_feature 4997..5618
/gene = ''pBR322 ori'' /SECDrawAs = ''Region'' /SECStyleId = 1 (SEQ
ID NO: 20) 1 gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc
agctgattct 61 aacgaggaaa gcacgttata cgtgctcgtc aaagcaacca
tagtacgcgc cctgtagcgg 121 cgcattaagc gcggcgggtg tggtggttac
gcgcagcgtg accgctacac ttgccagcgc 181 cctagcgccc gctcctttcg
ctttcttccc ttcctttctc gccacgttcg ccggctttcc 241 ccgtcaagct
ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct 301
cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt gggccatcgc cctgatagac
361 ggtttttcgc cctttgacgt tggagtccac gttctttaat agtggactct
tgttccaaac 421 tggaacaaca ctcaacccta tctcggtcta ttcttttgat
ttataaggga ttttgccgat 481 ttcggcctat tggttaaaaa atgagctgat
ttaacaaaaa tttaacgcga attttaacaa 541 aatattaacg cttacaattt
aaatatttgc ttatacaatc ttcctgtttt tggggctttt 601 ctgattatca
accggggtac atatgattga catgctagtt ttacgattac cgttcatcgc 661
cctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc gggcgacctt
721 tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggaat
tcacgcgtgg 781 atctgaattc aattcacgcg tggtacctac actttatgct
tccggctcgt atgttgtgtg 841 gaattgtgag cggataacaa tttcacacag
gaaacagcta tgaccatgat tacgccaagc 901 tttccaaaaa agcatggatt
ccatgttcat gatctcttga atcatgaaca tggaatccat 961 ggatccgagt
ggtctcatac agaacttata agattcccaa atccaaagac atttcacgtt 1021
tatggtgatt tcccagaaca catagcgaca tgcaaatatg aattcactgg ccgtcgtttt
1081 acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg
cagcacatcc 1141 ccctttcgcc agctggcgta atagcgaaga ggcccgcacc
gatcgccctt cccaacagtt 1201 gcgcagcctg tggtacctct ggtcgttaca
taacttacgg taaatggccc gcctggctga 1261 ccgcccaacg acccccgccc
attgacgtca ataatgacgt atgttcccat agtaacgcca 1321 atagggactt
tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca 1381
gtacatcaag tgtatcatat gccaagtacg ccccctattg acgtcaatga cggtaaatgg
1441 cccgcctggc attatgccca gtacatgacc ttatgggact ttcctacttg
gcagtacatc 1501 tactcgaggc cacgttctgc ttcactctcc ccatctcccc
cccctcccca cccccaattt 1561 tgtatttatt tattttttaa ttattttgtg
cagcgatggg ggcggggggg gggggggggc 1621 gcgcgccagg cggggcgggg
cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg 1681 cggcagccaa
tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc 1741
ggcggcccta taaaaagcga agcgcgcggc gggcgggagc gggatcagcc accgcggtgg
1801 cggcctagag tcgacgagga actgaaaaac cagaaagtta actggtaagt
ttagtctttt 1861 tgtcttttat ttcaggtccc ggatccggtg gtggtgcaaa
tcaaagaact gctcctcagt 1921 ggatgttgcc tttacttcta ggcctgtacg
gaagtgttac ttctgctcta aaagctgcgg 1981 aattgtaccc gcggccgatc
caccggtcgc caccatggtg agcaagggcg aggagctgtt 2041 caccggggtg
gtgcccatcc tggtcgagct ggacggcgac gtaaacggcc acaagttcag 2101
cgtgtccggc gagggcgagg gcgatgccac ctacggcaag ctgaccctga agttcatctg
2161 caccaccggc aagctgcccg tgccctggcc caccctcgtg accaccctga
cctacggcgt 2221 gcagtgcttc agccgctacc ccgaccacat gaagcagcac
gacttcttca agtccgccat 2281 gcccgaaggc tacgtccagg agcgcaccat
cttcttcaag gacgacggca actacaagac 2341 ccgcgccgag gtgaagttcg
agggcgacac cctggtgaac cgcatcgagc tgaagggcat 2401 cgacttcaag
gaggacggca acatcctggg gcacaagctg gagtacaact acaacagcca 2461
caacgtctat atcatggccg acaagcagaa gaacggcatc aaggtgaact tcaagatccg
2521 ccacaacatc gaggacggca gcgtgcagct cgccgaccac taccagcaga
acacccccat 2581 cggcgacggc cccgtgctgc tgcccgacaa ccactacctg
agcacccagt ccgccctgag 2641 caaagacccc aacgagaagc gcgatcacat
ggtcctgctg gagttcgtga ccgccgccgg 2701 gatcactctc ggcatggacg
agctgtacaa gtaaagcggc catcaagctt atcgataccg 2761 tcgactagag
ctcgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt 2821
tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa
2881 taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct
ggggggtggg 2941 gtggggcagg acagcaaggg ggaggattgg gaagacaata
gcaggcatgc tggggagaga 3001 tcgatctgag gaacccctag tgatggagtt
ggccactccc tctctgcgcg ctcgctcgct 3061 cactgaggcc gggcgaccaa
aggtcgcccg acgcccgggc tttgcccggg cggcctcagt 3121 gagcgagcga
gcgcgcagag agggagtggc cccccccccc ccccccccgg cgattctctt 3181
gtttgctcca gactctcagg caatgacctg atagcctttg tagagacctc tcaaaaatag
3241 ctaccctctc cggcatgaat ttatcagcta gaacggttga atatcatatt
gatggtgatt 3301 tgactgtctc cggcctttct cacccgtttg aatctttacc
tacacattac tcaggcattg 3361 catttaaaat atatgagggt tctaaaaatt
tttatccttg cgttgaaata aaggcttctc 3421 ccgcaaaagt attacagggt
cataatgttt ttggtacaac cgatttagct ttatgctctg 3481 aggctttatt
gcttaatttt gctaattctt tgccttgcct gtatgattta ttggatgttg 3541
gaatcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatatg
3601 gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagcccc
gacacccgcc 3661 aacacccgct gacgcgccct gacgggcttg tctgctcccg
gcatccgctt acagacaagc 3721 tgtgaccgtc tccgggagct gcatgtgtca
gaggttttca ccgtcatcac cgaaacgcgc 3781 gagacgaaag ggcctcgtga
tacgcctatt tttataggtt aatgtcatga taataatggt 3841 ttcttagacg
tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt 3901
tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca
3961 ataatattga aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc
ttattccctt 4021 ttttgcggca ttttgccttc ctgtttttgc tcacccagaa
acgctggtga aagtaaaaga 4081 tgctgaagat cagttgggtg cacgagtggg
ttacatcgaa ctggatctca acagcggtaa 4141 gatccttgag agttttcgcc
ccgaagaacg ttttccaatg atgagcactt ttaaagttct 4201 gctatgtggc
gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat 4261
acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga
4321 tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata
acactgcggc 4381 caacttactt ctgacaacga tcggaggacc gaaggagcta
accgcttttt tgcacaacat 4441 gggggatcat gtaactcgcc ttgatcgttg
ggaaccggag ctgaatgaag ccataccaaa 4501 cgacgagcgt gacaccacga
tgcctgtagc aatggcaaca acgttgcgca aactattaac 4561 tggcgaacta
cttactctag cttcccggca acaattaata gactggatgg aggcggataa 4621
agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc
4681 tggagccggt gagcgtgggt ctcgcggtat cattgcagca ctggggccag
atggtaagcc 4741 ctcccgtatc gtagttatct acacgacggg gagtcaggca
actatggatg aacgaaatag 4801 acagatcgct gagataggtg cctcactgat
taagcattgg taactgtcag accaagttta 4861 ctcatatata ctttagattg
atttaaaact tcatttttaa tttaaaagga tctaggtgaa 4921 gatccttttt
gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc 4981
gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat
5041 ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc
cggatcaaga 5101 gctaccaact ctttttccga aggtaactgg cttcagcaga
gcgcagatac caaatactgt 5161 ccttctagtg tagccgtagt taggccacca
cttcaagaac tctgtagcac cgcctacata 5221 cctcgctctg ctaatcctgt
taccagtggc tgctgccagt ggcgataagt cgtgtcttac 5281 cgggttggac
tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg 5341
ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg
5401 tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt
atccggtaag 5461 cggcagggtc ggaacaggag agcgcacgag ggagcttcca
gggggaaacg cctggtatct 5521 ttatagtcct gtcgggtttc gccacctctg
acttgagcgt cgatttttgt gatgctcgtc
5581 aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt
tcctggcctt 5641 ttgctggcct tttgctcaca tgttctttcc tgcgttatcc
cctgattctg tggataaccg 5701 tattaccgcc tttgagtgag ctgataccgc
tcgccgcagc cgaacgaccg agcgcagcga 5761 gtcagtgagc gaggaagcgg
aagagc
The SOD shRNA nucleotides 901-965 comprise the entire hairpin
sequence including the sense and antisense arms, stem loop and
termination sequence. The sequence in a forward orientation (with
target sequences against SOD1 underlined) is:
TABLE-US-00003 (SEQ ID NO: 21) 5'
AATTCATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAAC
GTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACT
CGGATCCATGGATTCCATGTTCATGATTCAAGAGATCATGAACATGGAAT
CCATGCTTTTTTGGAAA 3'
[0024] The rAAV of the invention may be purified by methods
standard in the art such as by column chromatography or cesium
chloride gradients. Methods for purifying rAAV vectors from helper
virus are known in the art and include methods disclosed in, for
example, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999);
Schenpp and Clark, Methods Mol. Med., 69: 427-443 (2002); U.S. Pat.
No. 6,566,118 and WO 98/09657.
[0025] In another aspect, the invention contemplates compositions
comprising rAAV of the present invention. Compositions of the
invention comprise rAAV in a pharmaceutically acceptable carrier.
The compositions may also comprise other ingredients such as
diluents and adjuvants. Acceptable carriers, diluents and adjuvants
are nontoxic to recipients and are preferably inert at the dosages
and concentrations employed, and include buffers such as phosphate,
citrate, or other organic acids; antioxidants such as ascorbic
acid; low molecular weight polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including glucose, mannose, or dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as Tween, pluronics or polyethylene glycol
(PEG).
[0026] Titers of rAAV to be administered in methods of the
invention will vary depending, for example, on the particular rAAV,
the mode of administration, the treatment goal, the individual, and
the cell type(s) being targeted, and may be determined by methods
standard in the art. Titers of rAAV may range from about
1.times.10.sup.2, about 1.times.10.sup.3, about 1.times.10.sup.4,
about 1.times.10.sup.5, about 1.times.10.sup.6, about
1.times.10.sup.7, about 1.times.10.sup.8, about 1.times.10.sup.9,
about 1.times.10.sup.10, about 1.times.10.sup.11, about
1.times.10.sup.12, about 1.times.10.sup.13 to about
1.times.10.sup.14 or more DNase resistant particles (DRP) per ml.
Dosages may also be expressed in units of viral genomes (vg).
Dosages may also vary based on the timing of the administration to
a human. These dosages of rAAV may range from about
1.times.10.sup.4, about 1.times.10.sup.5, about 1.times.10.sup.6,
about 1.times.10.sup.7, about 1.times.10.sup.8, about
1.times.10.sup.9, about 1.times.10.sup.10, about 1.times.10.sup.11,
about 1.times.10.sup.12, about 1.times.10.sup.13, about
1.times.10.sup.14, about 1.times.10.sup.15, about 1.times.10.sup.16
or more viral genomes per kilogram body weight in an adult. For a
neonate, the dosages of rAAV may range from about 1.times.10.sup.4,
about 3.times.10.sup.4, about 1.times.10.sup.5, about
3.times.10.sup.5, about 1.times.10.sup.6, about 3.times.10.sup.6,
about 1.times.10.sup.7, about 3.times.10.sup.7, about
1.times.10.sup.8, about 3.times.10.sup.8, about 1.times.10.sup.9,
about 3.times.10.sup.9, about 1.times.10.sup.10, about
3.times.10.sup.10, about 1.times.10.sup.11, about
3.times.10.sup.11, about 1.times.10.sup.12, about
3.times.10.sup.12, about 1.times.10.sup.13, about
3.times.10.sup.13, about 1.times.10.sup.14, about
3.times.10.sup.14, about 1.times.10.sup.15, about
3.times.10.sup.15, about 1.times.10.sup.16, about 3.times.10.sup.16
or more viral genomes per kilogram body weight.
[0027] In another aspect, the invention contemplates compositions
comprising rAAV of the present invention. Compositions of the
invention comprise rAAV in a pharmaceutically acceptable carrier.
The compositions may also comprise other ingredients such as
diluents and adjuvants. Acceptable carriers, diluents and adjuvants
are nontoxic to recipients and are preferably inert at the dosages
and concentrations employed, and include buffers such as phosphate,
citrate, or other organic acids; antioxidants such as ascorbic
acid; low molecular weight polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including glucose, mannose, or dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as Tween, pluronics or polyethylene glycol
(PEG).
[0028] In still another aspect, the invention provides methods of
transducing a target cell with a rAAV of the invention, in vivo or
in vitro. The in vivo methods comprise the step of administering an
effective dose, or effective multiple doses, of a composition
comprising a rAAV of the invention to a subject, a subject
(including a human being), in need thereof. If the dose is
administered prior to onset/development of a disorder/disease, the
administration is prophylactic. If the dose is administered after
the onset/development of a disorder/disease, the administration is
therapeutic. In embodiments of the invention, an effective dose is
a dose that alleviates (eliminates or reduces) at least one symptom
associated with the disorder/disease state being treated, that
slows or prevents progression to a disorder/disease state, that
slows or prevents progression of a disorder/disease state, that
diminishes the extent of disease, that results in remission
(partial or total) of disease, and/or that prolongs survival. An
example of a disease contemplated for treatment with methods of the
invention is ALS. "Treatment" according to the invention thus
alleviates (eliminates or reduces) at least one symptom associated
with the disorder/disease state being treated (for example, weight
loss is eliminated or reduced by at least 10%, 11%, 12%, 13%, 14%,
15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or greater), that
slows or prevents progression to (onset/development) of a
disorder/disease state, that slows or prevents progression of a
disorder/disease state, that diminishes the extent of disease, that
results in remission (partial or total) of disease, and/or that
prolongs survival. In some embodiments, survival is prolonged by at
least 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or
greater.
[0029] Combination therapies are also contemplated by the
invention. Combination as used herein includes both simultaneous
treatment or sequential treatments. Combinations of methods of the
invention with standard medical treatments (e.g., riluzole) are
specifically contemplated, as are combinations with novel
therapies.
[0030] Administration of an effective dose of the compositions may
be by routes standard in the art including, but not limited to,
systemic intramuscular, parenteral, intravenous, oral, buccal,
nasal, pulmonary, intracranial, intrathecal, intraosseous,
intraocular, rectal, or vaginal. Route(s) of administration and
serotype(s) of AAV components of the rAAV (in particular, the AAV
ITRs and capsid protein) of the invention may be chosen and/or
matched by those skilled in the art taking into account the
infection and/or disease state being treated and the target
cells/tissue(s) that are to express the SOD1 shRNAs. In some
embodiments, the route of administration is systemic. In some,
embodiments the route of administration is intrathecal. In some,
embodiments the route of administration is introcerebroventricular.
In some, embodiments the route of administration is cisterna magna.
In some, embodiments the route of administration is by lumbar
puncture.
[0031] Transduction of cells with rAAV of the invention results in
sustained expression of SOD1 shRNAs. In another aspect, the present
invention thus provides methods of administering/delivering rAAV
which express SOD1 shRNA to a subject, preferably a human being.
The term "transduction" is used to refer to the
administration/delivery of SOD1 shRNAs to a recipient cell either
in vivo or in vitro, via a replication-deficient rAAV of the
invention resulting in expression of a SOD1 shRNA by the recipient
cell.
[0032] Thus, the invention provides methods of administering an
effective dose (or doses, administered essentially simultaneously
or doses given at intervals) of rAAV that encode SOD1 shRNAs to a
subject in need thereof.
[0033] In one aspect, the invention provides methods of delivering
a polynucleotide encoding an shRNA of the invention across the BBB
comprising systemically administering a rAAV with a genome
including the polynucleotide to a subject. In some embodiments, the
rAAV genome is a self complementary genome. In other embodiments,
the rAAV genome is a single-stranded genome. In some embodiments,
the rAAV is a rAAV9. In some embodiments, the rAAV is a rAAV2. In
some embodiments, the rAAV is a rAAVrh74.
[0034] In some embodiments, the methods systemically deliver
polynucleotides across the BBB to the central and/or peripheral
nervous system. Accordingly, a method is provided of delivering a
polynucleotide to the central nervous system comprising
systemically administering a rAAV with a self-complementary genome
including the genome to a subject. In some embodiments, the
polynucleotide is delivered to brain. In some embodiments, the
polynucleotide is delivered to the spinal cord. Also provided is a
method of delivering a polynucleotide to the peripheral nervous
system comprising systemically administering a rAAV with a
self-complementary genome including the polynucleotide to a subject
is provided. In some embodiments, the polynucleotide is delivered
to a lower motor neuron. In some embodiments, the rAAV genome is a
self complementary genome. In other embodiments, the rAAV genome is
a single-stranded genome. In some embodiments, the rAAV is a rAAV9.
In some embodiments, the rAAV is a rAAV2. In some embodiments, the
rAAV is a rAAVrh74.
[0035] In another aspect, the invention provides methods of
delivering a polynucleotide to the central nervous system of a
subject in need thereof comprising intrathecal delivery of rAAV
with a genome including the polynucleotide. In some embodiments,
the rAAV genome is a self complementary genome. In other
embodiments, the rAAV genome is a single-stranded genome. In some
embodiments, the rAAV is a rAAV9. In some embodiments, the rAAV is
a rAAV2. In some embodiments, the rAAV is a rAAVrh74. In some
embodiments, a non-ionic, low-osmolar contrast agent is also
delivered to the subject, for example, iobitridol, iohexol,
iomeprol, iopamidol, iopentol, iopromide, ioversol or ioxilan.
[0036] Embodiments of the invention employ rAAV to deliver
polynucleotides to nerve, glial cells and endothelial cells. In
some embodiments, the nerve cell is a lower motor neuron and/or an
upper motor neuron. In some embodiments, the glial cell is a
microglial cell, an oligodendrocyte and/or an astrocyte. In other
aspects the rAAV is used to deliver a polynucleotide to a Schwann
cell.
BRIEF DESCRPTION OF THE DRAWINGS
[0037] FIGS. 1A-1U. AAV9 transduction pattern and persistence in
SOD1.sup.G93A mice. SOD1.sup.G93A mice were injected intravenously
with AAV9-CB-GFP at P1, P21 and euthanized 21 days post injection
(n=3 per time point). Spinal cords were examined for GFP, ChAT
(motor neuron marker) and GFAP (astrocyte marker) expression.
Temporal vein injection of AAV9-CB-GFP at P1 resulted in efficient
transduction of motor neurons and glia in SOD1.sup.G93A mice (FIGS.
1A, 1F, 1K, and 1P). Tail vein injection at P21 (FIG. 1B, FIG. 1G,
FIG. 1L, FIG. 1Q) predominantly targeted astrocytes with few GFP
positive motor neurons. To test the persistence of transduced
cells, AAV9-CB-GFP was intravenously injected at P1 and P21 in
SOD1.sup.G93A animals that were sacrificed at end stage
(.about.P130). Immunofluorescence analysis of lumbar ventral horn
(FIG. 1C, FIG. 1D, FIG. 1H, FIG. 1I, FIG. 1M, FIG. 1N, FIG. 1R,
FIG. 1S) demonstrated that GFP expression was maintained in
astrocytes throughout the disease course. To determine whether SOD1
mediated inflammation and damage would affect AAV9 transduction, we
intravenously injected SOD1.sup.G93A mice at P85 and harvested
their spinal cords at endstage. There was no difference observed in
the transduction pattern of SOD1.sup.G93A mice treated at P21 or
P85. Insets in (FIG. 1R, FIG. 1S, FIG. 1T) show co-localization
between GFP and GFAP signal. (FIG. 1U) Quantification of transduced
cells in ALS spinal cords (for each group tissues were analyzed
from 3 animals). GFP and ChAT columns show numbers of cells
counted. Bars=100 .mu.m. AAV, adeno-associated virus; P1, postnatal
day 1; P21, postnatal day 21; P85, postnatal day 85; GFP, green
fluorescent protein; ChAT, choline acetyltransferase; GFAP, glial
fibrillary acidic protein.
[0038] FIGS. 2A-2E. shRNA constructs show efficient reduction of
human SOD1 protein in vitro and in vivo. (FIG. 2A) Sequence
alignments between human and mouse SOD1 for the regions targeted by
the 4 different shRNA constructs tested. (FIG. 2B) shRNA sequences
were cloned into an H1 expression construct and transiently
transfected into 293 cells. Lysates were collected 72 hours post
transfection and analyzed by western blot. (FIG. 2C) Quantification
of in vitro suppression of human SOD1 from three separate transient
transfections showed >50% reduction in SOD1. (FIG. 2D) shRNA 130
was packaged into AAV9 and injected into SOD1.sup.93A mice at
either P1 or P21. Spinal cords (n=3 per time point) were harvested
three weeks post injection and analyzed by western blot for human
SOD1 protein levels. (FIG. 2E) Quantification of in vivo
suppression of human SOD1 within the spinal cord of ALS mice. P1
and P21 injected spinal cords showed 60% and 45% reductions in
mutant SOD1 protein, respectively. hSOD1, human superoxide
dismutase 1; mSOD1, mouse superoxide dismutase 1; GAPDH,
glyceraldehyde 3 phosphate dehydrogenase.
[0039] FIGS. 3A-3H. Intravenous delivery of AAV9-SOD1-shRNA
improves survival and motor performance in SOD1.sup.G93A mice.
SOD1.sup.G93A mice received a single intravenous injection of
AAV9-SOD1-shRNA at P1 (n=6, green), P21 (n=9, red) or P85 (n=5,
blue). Treated mice were monitored up to end stage and compared
with non-injected control SOD1.sup.G93A mice (n=15, gray). (FIG.
3A, FIG. 3B, FIG. 3C) AAV9-SOD1-shRNA injection into P1
SOD1.sup.G93A mice significantly delayed median disease onset 39.5
days compared to control animals (unnjected, 103 d; P1, 142.5 d;
p<0.05). Injection in P21 (red) or P85 (blue) ALS animals had no
effect on disease onset (P21, 110 d; P85, 105 d). However,
AAV9-SOD1-shRNA administered at P1, P21 or P85 all significantly
extended median survival (FIG. 3B, FIG. 3E) (uninjected, 132 d; P1,
183.5 d P21, 171 d; P85, 162 d; all comparisons to control
p<0.001). The P21 group had a significant extension in median
disease duration (FIG. 3D) indicating a slowing of disease
(uninjected, 29.5 d; P1, 41 d; P21, 49 d; P85, 40 d; Wilcoxon
Signed Rank Test p=0.06, 0.01 and 0.12, respectively). (FIG. 3F,
FIG. 3G, FIG. 3H) P1 and P21 treated animals maintained their
weights, had better hind limb grip strength and rotarod performance
when compared to age-matched controls, indicating treated animals
retained muscle tone and motor function during their prolonged
survival. Lines between bars in (c-e) indicate statistically
significant differences. *p<0.05. P1, postnatal day 1; P21,
postnatal day 21; P85, postnatal day 85.
[0040] FIGS. 4A-4T. Intravenous injection of AAV9-SOD1-shRNA
reduces mutant protein in spinal cords of SOD1.sup.G93A mice. (FIG.
4A, FIG. 4B, FIG. 4C, FIG. 4D) Images of lumbar spinal cord
sections from uninjected (FIG. 4A), P1 injected (FIG. 4B), P21
injected (FIG. 4C) and P85 injected (FIG. 4D) mice were captured
with identical microscope settings to qualitatively show SOD1
levels at end stage. SOD1 levels inversely correlate with survival.
(FIG. 4E, FIG. 4F, FIG. 4G, FIG. 4H, FIG. 4I, FIG. 4J, FIG. 4K,
FIG. 4L, FIG. 4M, FIG. 4N, FIG. 4O, FIG. 4P, FIG. 4Q, FIG. 4R, FIG.
4S, FIG. 4T) Co-labeling for GFP, ChAT and SOD1 shows that AAV9
transduced motor neurons had reduced SOD1 expression (arrows) while
cells that lacked GFP maintained high levels of mutant protein
(arrowheads). As described in FIG. 1u, higher MN transduction and
corresponding SOD1 reduction was observed in P1 injected mice (FIG.
4I, FIG. 4J, FIG. 4K, FIG. 4L) as compared to P21 injected (FIG.
4M, FIG. 4N, FIG. 4O, FIG. 4P) and P85 injected (FIG. 4Q, FIG. 4R,
FIG. 4S, FIG. 4T) mice. Bar=100 .mu.m. P1, postnatal day 1; P21,
postnatal day 21; P85, postnatal day 85; SOD1, superoxide dismutase
1; GFP, green fluorescent protein; ChAT, choline
acetyltransferase.
[0041] FIGS. 5A-5G. AAV9-SOD1-shRNA improves survival and motor
performance in SOD1.sup.G37R mice treated after disease onset.
(FIG. 5A) There was no difference in median disease onset between
AAV9-SOD1-shRNA and control treated mice. (average age at
treatment=215 d versus median onset of 194 d control and 197 d
treated; Log Rank Test p=0.46). (FIG. 5B, FIG. 5F) Median survival
of AAV9-SOD1-shRNA treated SOD1.sup.G37R mice (n=25) was
significantly extended versus control mice (n=21). (control, n=21,
392 d; SOD1 shRNA, n=25, 478.5 d; Log Rank Test p<0.0001) (FIG.
5C, FIG. 5D, FIG. 5E). The early phase of disease was significantly
slowed by 73 days in treated mice as compared to control mice
(control, 89 d; SOD1 shRNA, 162 d; p<0.0001 Wilcoxon Signed Rank
Test) while the late phase of disease showed a non-significant
slowing (control, 63 d; SOD1 shRNA, 81 d; p=0.14 Wilcoxon Signed
Rank Test). Together this amounted to a 66 day increase in median
disease duration (control, 173 d; SOD1 shRNA, 239 d; p<0.0001
Wilcoxon Signed Rank Test). (FIG. 5G) A trend to improved hind limb
grip strength appeared in AAV9-SOD1-shRNA treated mice compared to
control mice.
[0042] FIGS. 6A-6P. Intravenous injection of AAV9 in adult
SOD1.sup.G37R mice targets astrocytes and motor neurons within the
spinal cord. (FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D, FIG. 6E, FIG. 6F,
FIG. 6G, FIG. 6H) Immunofluorescence analysis revealed neuronal as
well as glial transduction in both AAV9-CB-GFP (FIG. 6A, FIG. 6B,
FIG. 6C, FIG. 6D) and AAV9-SOD1-shRNA treated (FIG. 6E, FIG. 6F,
FIG. 6G, FIG. 6H) mice. (FIG. 6, FIG. 6J, FIG. 6K, FIG. 6L, FIG.
6M, FIG. 6N, FIG. 6O, FIG. 6P) Human SOD1 levels appeared reduced
in AAV9-SOD1-shRNA treated mice (FIG. 6O) compared with AAV9-GFP
treated mice (FIG. 6K). Bar=100 .mu.m. GFP, green fluorescent
protein; ChAT, choline acetyltransferase; GFAP, glial fibrillary
acidic protein; SOD1, superoxide dismutase 1.
[0043] FIGS. 7A-7H. Intrathecal infusion of AAV9-SOD1-shRNA in
non-human primates leads to efficient reduction in SOD1 levels.
(FIG. 7A) A myelogram shortly after intrathecal infusion of
AAV9-SOD1-shRNA mixed with contrast shows proper delivery into the
subarachnoid space of a cynomolgus macaque. Arrows show diffusion
of the contrast agent along the entire spinal cord. (FIG. 7B)
Lumbar spinal cord sections from treated monkeys (n=3) were
harvested two weeks post injection and stained for GFP using DAB
staining. Sections had widespread GFP expression throughout the
grey and white matter. (FIG. 7C, FIG. 7D, FIG. 7E)
Immunofluorescence analysis of the lumbar spinal cord sections
showed robust GFP (FIG. 7C) expression within ChAT (FIG. 7D)
positive cells indicating motor neuron transduction (FIG. 7E,
merge). (FIG. 7F) Western blot analysis of the lumbar spinal cords
showed significant reduction in SOD1 levels in AAV9-SOD1-shRNA
injected animals as compared to controls. (FIG. 7G) In vivo
quantification of SOD1 knockdown in monkey lumbar spinal cord
homogenate (n=3) showed an 87% reduction in animals that received
AAV9-SOD1-shRNA compared to uninjected controls. (FIG. 7H) Laser
capture microdissection was used to collect motor neurons or
surrounding neuropil from injected and control lumbar monkey
sections. Collected cells were analyzed for SOD1 levels by qRT-PCR.
Motor neurons collected from AAV9-SOD1-shRNA animals (n=3) had a
95.+-.3% reduction in SOD1 RNA. Non-neurons had a 66.+-.9%
reduction in SOD1 RNA in AAV9-SOD1-shRNA treated animals. Scale
Bars: b=100 .mu.m; e=50 .mu.m. SOD1: Superoxide dismutase 1.
[0044] FIGS. 8A-8E. Lumbar intrathecal infusion of AAV9-SOD1-shRNA
leads to efficient transduction of motor neurons and non-neuronal
cells in the cervical, thoracic and lumbar cord resulting in
reduction of SOD1. (FIG. 8A, FIG. 8B, FIG. 8C) Immunofluorescence
analysis of the three segments of the spinal cord; cervical (FIG.
8A), thoracic (FIG. 8B) and lumbar (FIG. 8C), showed robust GFP
(green) expression within Chat (red) positive cells indicating
motor neuron transduction. (FIG. 8D) GFP+/Chat+ cell counts show a
caudal to rostral gradient of motor neuron transduction ranging
from 85% of transduced cells in the lumbar region to more than 50%
in the cervical region. (FIG. 8E) SOD1 mRNA levels in cervical,
thoracic and lumbar cord section homogenates analyzed by qRT-PCR
show significant reduction in SOD1 transcript, consistently with
motor neuron transduction. SOD1 levels were normalized to
.beta.-actin and AAV9-SOD1-shRNA injected animals were compared to
an AAV9-CB-GFP injected control. Scale bars: (FIG. 8A, FIG. 8B,
FIG. 8C)=50 .mu.m; Error bars: (FIG. 8D, FIG. 8E)=SD.
[0045] FIGS. 9A-B. Design of a clinical SOD1 shRNA construct. (FIG.
9A) Original AAV SOD1 shRNA construct contains shRNA sequence
against human SOD1 under H1 promoter followed by the expression
cassette for GFP which includes CMV enhancer, CBA promoter,
modified SV40 intron, and GFP transgene sequence followed by bGH
PolyA terminator. SOD1 shRNA expression cassette and GFP expression
cassette are flanked by AAV2 ITRs which ensures the packaging of
the complete flanked sequence in AAV9 capsid. (FIG. 9B) In clinical
SOD1 shRNA construct, the GFP expression cassette is replaced by a
stuffer element that contains tandem, noncoding sequences from FDA
approved DNA vaccines. ITR: inverted terminal repeats; shRNA, small
hairpin RNA; SOD1, superoxide dismutase 1; CMV, cytomegalo virus
enhancer; CBA, Chicken .beta.-actin promoter; GFP, green
fluorescent protein; bGH pA, bovine growth hormone poly A
terminator.
[0046] FIG. 10. Schematic of clinical SOD1 shRNA construct.
Different restriction sites are placed in the clinical SOD1 shRNA
construct that allow the cloning of multiple shRNA expression
cassettes while maintaining the total distance between the two
ITRs.
[0047] FIGS. 11A-11J. In vitro transfection of clinical SOD1 shRNA
construct efficiently reduces human SOD1 protein in HEK293 cells.
Representative microscopic fields showing bright-field images of
non-transfected control (FIG. 11A), AAV SOD1 shRNA transfected
(FIG. 11B) and shuttle vector pJet SOD1 shRNA transfected (FIG.
11C, FIG. 11D) HEK 293 cells, 72 hrs post transfection.
Corresponding fluorescence images reveal the lack of GFP
fluorescence from pJet SOD1 shRNA transfected HEK 293 cells (FIG.
11G, FIG. 11H) as compared to AAV SOD1 shRNA transfected cells
(FIG. 11F). (FIG. 11I) Western blot analysis of the cell lysates
confirms the efficient knockdown of human SOD1 protein in pJet SOD1
shRNA transfected cells as compared to the non-transfected control
cells. Immunoblot analysis also confirms removal of GFP transgene
from pJet SOD1 shRNA construct. (FIG. 11J) Quantification of the in
vitro downregulation of SOD1 by pJet SOD1 shRNA. pJet SOD1 shRNA
reduces the protein levels of human SOD1 by almost 50% in HEK293
cells as compared to control. This reduction is similar to that
achieved with AAV SOD1 shRNA construct.
[0048] FIG. 12. Schematic of cloning strategy for clinical AAV SOD1
shRNA vector. Clinical SOD1 shRNA construct was cloned into AAV CB
MCS vector using Kpn1/SPh1 sites. Kpn1/SPh1 double digest of AAV CB
MCS plasmid results in the release of the complete transgene
expression cassette from this vector which is further replaced with
clinical SOD1 shRNA construct carrying SOD1 shRNA expression
cassette and stuffer sequence.
[0049] FIGS. 13A-13H. Clinical AAV SOD1 shRNA efficiently reduces
human SOD1 levels in vitro. HEK293 cells were transfected with
clinical AAV SOD1 shRNA plasmid by Calcium phosphate method.
Representative microscopic fields showing brightfield images of
non-transfected control, AAV SOD1 shRNA and Clinical AAV SOD1 shRNA
transfected cells respectively, 72 hrs post-transfection (FIG. 13A,
FIG. 13B, FIG. 13C). Successful removal of GFP from clinical AAV
SOD1 shRNA was confirmed by lack of GFP expression in Clinical AAV
SOD1 shRNA transfected cells (FIG. 13F, FIG. 13G. (FIG. 13G)
Western blot analysis of cell lysates, harvested 72 hrs
post-transfection confirmed efficient downregulation of SOD1 in
clinical AAV SOD1 shRNA transfected cells as compared to control.
AAV SOD1 shRNA was used as a positive control. (FIG. 13H)
Quantification of the in vitro knockdown of SOD1 by clinical AAV
SOD1 shRNA.
[0050] Figures S1A-SF. AAV9-shRNA-SOD1 administration is well
tolerated in WT mice. Female and male WT animals were injected with
AAV9-SOD1-shRNA at P1 or P21 and monitored up to 6 months of age.
(Figure S1A, Figure SB) Both male and female treated mice showed
steady increase in body mass as compared to control animals.
(Figure S1C, Figure S1D) Rotarod performance and (Figure S1E,
Figure S1F) hind limb grip strength were not affected by P1 or P21
treatment in both groups as compared to respective controls. n=5
per group. WT, wild type; P1, postnatal day 1; P21, postnatal day
21.
[0051] Figures S2A-S2W. Hematology and Serum Chemistry of
AAV9-SOD1-shRNA treated WT animals. (Figure S2A, Figure S2B, Figure
S2C, Figure S2D, Figure S2E, Figure S2 F, Figure S2G, Figure S2H,
Figure S2I, Figure S2J, Figure S2K, Figure S2L, Figure S2M) Blood
was collected from P1 (green) or P21 (red) treated and control
(gray) WT animals at 150 days of age for hematology studies. No
significant differences were observed between treated and control
animals. (Figure S2N, Figure S2O, Figure S2P, Figure S2Q, Figure
S2R, Figure S2S, Figure S2T, Figure S2U, Figure S2V, Figure S2W)
Serum samples collected at 180 days of age from the same mice
showed no significant differences in serum chemistry profile.
Mean.+-.SEM. n=5 per group. P1, postnatal day 1; P21, postnatal day
21.
[0052] Figures S3A-S3H. AAV9-SOD1-shRNA treatment in SOD1.sup.G93A
mice reduces astrogliosis. End stage sections from control and
AAV9-SOD1-shRNA treated animals were harvested and stained for
GFAP, an astrocyte activation marker. P1 (Figure S3B) and P85
(Figure S3D) injected mice showed reduced levels of astrogliosis as
compared to control (Figure S3A) mice while P21 (Figure S3C)
injected mice showed the maximum reduction. This was consistent
with the percent astrocyte transduction achieved in these mice
(FIG. 1u). However, no effect was observed on microglia reactivity
(Figure S3E, Figure S3F, Figure S3G, Figure S3H). Bar=100 .mu.m.
P1, postnatal day 1; P21, postnatal day 21; P85, postnatal day
85.
[0053] Figures S4A-S4B. Intravenous injection of AAV9-SOD1-shRNA
efficiently reduces levels of mutant SOD1 protein in spinal cords
of SOD1.sup.G37R mice. (Figure S4A) Following disease onset,
AAV9-CB-GFP or AAV9-SOD1-shRNA was injected in SOD1.sup.G37R mice
and spinal cords were harvested at end stage and analyzed by
western blot for human SOD1 protein levels. (Figure S4B)
Quantification of a) shows suppression of human SOD1 within the
spinal cord of SOD1.sup.G37R mice (n=4 per group). hSOD1, human
superoxide dismutase 1; GAPDH, glyceraldehyde 3 phosphate
dehydrogenase.
[0054] Figures S5A-S5B shRNA 130 efficiently reduces the levels of
monkey SOD1 in vitro. (Figure S5A) Sequence alignment of the region
targeted by SOD1 shRNA 130 and a single mismatch with the monkey
sequence. Monkey sequence corresponds to SOD1 sequence from Rhesus
monkey (NM 001032804.1), Cynomolgus monkey (sequenced in-house) and
African green monkey. (Figure S5B) The shRNA 130 expression
cassette was cloned into lentiviral vector and used to infect Cos-7
cells. Lysates were analyzed 72 hours post infection by qRT PCR for
SOD1. shRNA 130 reduced SOD1 transcript levels by 75% in Cos-7
cells.
EXAMPLES
[0055] The present invention is illustrated by the following
examples. While the present invention has been described in terms
of various embodiments and examples, it is understood that
variations and improvements will occur to those skilled in the art.
Therefore, only such limitations as appear in the claims should be
placed on the invention.
Example 1
AAV9 Transduction Pattern and Persistence in SOD1.sup.G93A Mice
[0056] We first evaluated the efficiency of AAV9 transduction in
the SOD1.sup.G93A mouse model that develops fatal paralytic
disease. High copy SOD1.sup.G93A mice were obtained from Jackson
Laboratories (Bar Harbor, Me.) and bred within the Kaspar lab.
Animals were genotyped before the treatment to obtain SOD1.sup.G93A
expressing mice and their wild type littermates. Only female mice
were included in the SOD1.sup.G93A experiments. Animals were
injected intravenously at postnatal day 1 or day 21 (to be referred
to as P1 and P21, respectively) with self-complementary AAV9
expressing GFP from the CMV enhancer/beta-actin (CB) promoter
(AAV9-CB-GFP) (n=3 per group). Three weeks post-injection, animals
were sacrificed, and spinal cords examined for GFP expression (FIG.
1A, FIG. 1B, FIG. 1C, FIG. 1D, FIG. 1E, FIG. 1F, FIG. 1G, FIG. 1H,
FIG. 1I, FIG. 1J, FIG. 1K, FIG. 1L, FIG. 1M, FIG. 1N, FIG. 1O, FIG.
1P, FIG. 1Q, FIG. 1R, FIG. 1S, FIG. 1T, FIG. 1U).
[0057] All procedures with animals described herein were performed
in accordance with the NIH Guidelines and approved by the Research
Institute at Nationwide Children's Hospital (Columbus, Ohio),
University of California (San Diego, Calif.) or Mannheimer
Foundation (Homestead, Fla.) Institutional Animal Care and Use
Committees.
[0058] Transduction efficiency was high in SOD1.sup.G93A astrocytes
with GFP expressed in 34.+-.2% and 54.+-.3%, respectively, of P1
and P21 injected spinal grey matter astrocytes (defined by
immunoreactivity for GFAP). This efficiency was similar to our
previous report of 64.+-.1% in P21 injected wild type
animals.sup.18. Motor neurons were a prominent cell type transduced
at all levels of the spinal cords of P1 injected SOD1.sup.G93A
animals (62.+-.1%), compared with significantly lower targeting to
motor neurons in P21 injected animals (8.+-.1%).
[0059] Although we have previously reported that transduced
astrocytes in wild type spinal cords persist with continued GFP
accumulation for at least 7 weeks post injection.sup.18, longevity
of mutant SOD1 astrocytes (and their continued synthesis of genes
encoded by the AAV9 episome) during active ALS-like disease was
untested. Therefore, SOD1.sup.G93A mice were injected at P1 and P21
with AAV9-CB-GFP and followed to end-stage (.about.P130, n=3 per
group) (FIGS. 1c,d,h,i,m,n,r,s). Immunofluorescent examination of
the end-stage SOD1.sup.G93A spinal cords from animals injected at
P1 and P21 showed a comparable number of GFP-expressing astrocytes
as were found 21 days after AAV9 injection (P1: 42.+-.2%, P21:
61.+-.2%). These data are consistent with survival of transduced
astrocytes for the duration of disease (.about.110 days post
injection at P21) in SOD1.sup.G93A mice and that AAV9-encoded gene
expression is maintained.
[0060] Further, recognizing that SOD1 mutant mediated damage,
including astrocytic and microglial activation and early changes in
the blood brain barrier develop during disease in mice in SOD1
mutant mice.sup.20, we tested if this damage affected AAV9
transduction. SOD1.sup.G93A mice were injected at P85 with
AAV9-CB-GFP and sacrificed at endstage (n=3) (FIGS. 1e,j,o,t).
Analysis of the spinal cords revealed that the transduction pattern
seen in P85 animals was similar to P21 treated animals with
astrocytes as the predominant cell type transduced at all levels
(51.+-.6% GFP+/GFAP+ cells in lumbar grey matter).
Example 2
[0061] Development of an shRNA Sequence Specific for Human SOD1
[0062] To specifically target the human SOD1 mRNA, four shRNA
constructs targeting human SOD1 were generated and obtained from
the Life Technologies design tool. The constructs that had a
minimum of four base mismatches compared to the mouse mRNA sequence
(FIG. 2A). The base numbers for the human sequences shown
correspond to record number CCDS33536.1 in the NCBI CCDS database.
These constructs were cloned in pSilencer 3.1 (Genscript) under the
human H1 promoter and tested in vitro. shRNA 130 along with H1
promoter was further cloned into an AAV vector along with a
reporter GFP under Chicken Beta-Actin promoter to identify the
transduced cells. Human 293 cells were transfected with each
cassette. The HEK-293 cells were maintained in IMDM medium
containing 10% FBS, 1% L-glutamine and 1% penicillin/streptomycin.
Upon reaching .about.60% confluence, cells were transfected with
pSilencer 3.1 containing the shRNAs being tested. Protein lysates
were prepared 72 hours post transfection and analyzed for SOD1
levels by western blot. All four sequences reduced SOD1 protein
levels by >50% (FIG. 2B, FIG. 2C
[0063] shRNA130 was selected for further experiments because it
produced the most consistent knockdown across three separate
transfection experiments. It was cloned into a self-complementary
AAV9 vector that also contained a GFP gene whose expression would
identify transduced cells (referred to as AAV9-SOD1-shRNA).
Self-complementary AAV9-SOD1-shRNA was produced by transient
transfection procedures using a double-stranded AAV2-ITR-based
CB-GFP vector, with a plasmid encoding Rep2Cap9 sequence as
previously described along with an adenoviral helper plasmid
pHelper (Stratagene, Santa Clara, Calif.) in 293 cells.sup.18.
[0064] To confirm that the shRNA could suppress accumulation of
human SOD1, SOD1.sup.G93A mice (n=3) were injected intravenously
with AAV9-SOD1-shRNA at either P1 or P21. For neonatal mouse
injections, postnatal day 1-2 SOD1.sup.G3A pups were utilized.
Total volume of 50 .mu.l containing 5.times.10.sup.11 DNAse
resistant viral particles of AAV9-SOD1-shRNA (Virapur LLC, San
Diego, Calif.) was injected via temporal vein as previously
described.sup.18. A correct injection was verified by noting
blanching of the vein. After the injection, pups were returned to
their cage. Animals were euthanized three weeks post injection and
the spinal cords were harvested and analyzed by immunoblotting for
both human (mutant) and murine (wild-type) SOD1 protein. P1 and P21
injected spinal cords showed 60% and 45% reductions in mutant SOD1
protein, respectively (FIGS. 2d,e). Murine SOD1 levels remained
unchanged in response to human SOD1 knockdown.
Example 3
AAV9-SOD1-shRNA is Safe and Well Tolerated in Wild Type Mice
[0065] To determine whether high dose AAV9-SOD1-shRNA would be
safe, normal mice of both sexes were intravenously injected at P1
or P21 (P1=5 males, 5 females at 5.times.10.sup.11 vg; P21=5 males,
5 females at 2.times.10.sup.12 vector genomes (vg)) and then
monitored up to 6 months of age. Both P1 and P21 injected mice
showed a steady increase in body mass similar to untreated mice
(Figure S1A-S1F). Weekly behavioral tests observed no significant
differences between injected and control groups in motor skills
(measured by rotarod) as well as in hind limb grip strength. At 150
and 180 days of age, blood samples were collected. Complete and
differential blood counts of both treated and untreated groups
showed similar blood chemistry parameters (Figure S2). Serum
samples from both groups showed no significant differences in the
levels of alkaline phosphatase, creatinine, blood urea nitrogen,
potassium, sodium and chloride. Finally, all the animals were
sacrificed at the age of 180 days. Histopathological analyses by a
pathologist blinded to treatment group revealed no significant
alterations in the AAV9-SOD1-shRNA treated animals compared to
uninjected controls (data not shown). We conclude that both
administration of AAV9 and sustained shRNA expression were
apparently safe and well tolerated.
Example 4
Extended Survival of SOD1.sup.G93A Mice from
AAV9 Mediated Reduction in Mutant SOD1 Even when Initiated
Mid-Disease
[0066] To test the efficacy of AAV9-mediated SOD1 reduction, we
treated cohorts of SOD1.sup.G93A mice with a single intravenous
injection of AAV9-SOD1-shRNA before (P1, 5.times.10.sup.11 vg, n=6
and P21, 2.times.10.sup.12 vg, n=9) or after (P85, 3.times.10.sup.2
vg, n=5) onset, recognizing that many astrocytes, but few motor
neurons, would be transduced at the two later time points. For
adult tail vein injections, animals were placed in a restraint that
positioned the mouse tail in a lighted, heated groove. The tail was
swabbed with alcohol then injected intravenously with
AAV9-SOD1-shRNA.
[0067] Onset of disease (measured by weight loss from
denervation-induced muscle atrophy) was significantly delayed by a
median of 39.5 days (FIG. 3A, FIG. 3C; uninjected, 103 d; P1, 142.5
d; p<0.05, Wilcoxon Signed Rank Test) in the P1 injected cohort,
but was not affected by either of the later injections (P21, 110 d;
P85, 105 d). P1 and P21 treated animals maintained their weights,
had better rotarod performance and hind limb grip strength when
compared to age-matched controls, indicating treated animals
maintained muscle tone and motor function during their prolonged
survival (FIG. 3F, FIG. 3G, FIG. 3H). Survival was significantly
extended by AAV9 injection at all three ages, yielding survival
times 30-51.5 days beyond that of uninjected SOD1.sup.93A mice
(uninjected, 132 d; P1, 183.5 d; P21, 171 d; P85, 162 d; Log-Rank
Test p=<0.0001, 0.0003 and 0.001, respectively) (FIG. 3B, FIG.
3E). Defining disease duration as the time from onset to end-stage
revealed that the P21 treatment group had significantly increased
duration, indicative of slowed disease progression, compared to
uninjected controls (uninjected, 29.5 d; P21, 49 d; Wilcoxon Signed
Rank Test p=0.01), with trends toward slowed progression in animals
injected at the other two ages (P1, 41 d; P85, 40 d; p=0.06 and
0.12, respectively) (FIG. 3D). The lower percentage of targeted
non-neuronal cells at P1 versus those targeted at P21 (FIG. 1U)
suggests that a minimum number of non-neuronal cells must be
targeted to slow disease progression in the fast progressive
SOD1.sup.G93A model (FIG. 1U).
Example 5
Reduction of Mutant SOD1 in AAV9 Infected Cells in Treated
SOD1.sup.G93A Mice
[0068] Indirect immunofluorescence with an antibody that recognizes
human, but not mouse SOD1, was used to determine accumulated mutant
SOD1 levels in end-stage spinal cords of treated and control mice.
Human SOD1 levels in end-stage spinal cord sections inversely
correlated with increased survival (FIG. 4A, FIG. 4B, FIG. 4C, FIG.
4D). At end-stage, P1 (FIG. 4B), P21 (FIG. 4C) and P85 (FIG. 4D)
AAV9-SOD1-shRNA injected animals had lower levels of mutant SOD1
when compared with uninjected SOD1.sup.G93A animals (FIG. 4A). SOD1
expression within transduced motor neurons (identified by GFP and
ChAT expressing cells) was reduced compared to surrounding neurons
that had not been transduced to express viral encoded GFP (FIG. 4H,
FIG. 4L, FIG. 4P, FIG. 4T; arrows versus arrowheads). Moreover,
immunofluorescence imaging of end-stage spinal cords revealed
corresponding reduction in astrogliosis, but no difference in
microgliosis in AAV9-SOD1-shRNA treated animals versus controls
(Figures S3A-S3H).
Example 6
Therapeutic Slowing of Disease Progression with Peripheral
Injection of AAV9 after Onset
[0069] To determine if AAV9-mediated mutant SOD1 reduction would
slow disease progression, a cohort of SOD1.sup.G37R mice.sup.6 were
injected intravenously with AAV9-SOD1-shRNA after disease onset
(average age at treatment=215 d versus median onset of 197 d in
treated animals; Log Rank Test p=0.46; FIG. 5A). loxSOD1.sup.G37R
ALS mice, carrying a human mutant SOD1.sup.G37R transgene flanked
by lox p sites under its endogenous promoter, were maintained in as
previously described.sup.37. A combination of AAV9-CB-GFP (n=9) and
uninjected (n=12) littermates were used as controls.
[0070] Post hoc analysis showed no differences between GFP and
uninjected animals, therefore the groups were compiled as "control"
in FIGS. 5A-5G. Animals were evaluated weekly for body weight and
hind limb grip strength and monitored until end-stage.
AAV9-SOD1-shRNA treatment after disease onset significantly
extended median survival by 86.5 days over control animals
(control, n=21, 392 d; SOD1 shRNA, n=25, 478.5 d; Log Rank Test
p<0.0001). Early disease duration, defined by the time from peak
weight to 10% weight loss, was significantly slowed (control, 89 d;
SOD1 shRNA treated mice, 162 days; Wilcoxon Signed Rank Test
p<0.01; FIG. 5C). A continuing trend toward slowing of later
disease (10% weight loss to end stage) was also seen (control, 63
d; SOD1 shRNA treated mice, 81 d; Wilcoxon Signed Rank Test
p=0.1389; FIG. 5D). Overall disease duration following
AAV9-SOD1-shRNA therapy rose to 239 d after disease onset versus
173 d in control mice (Wilcoxon Signed Rank Test p<0.0001; FIG.
5E). Consistent with the slowed progression, AAV9 therapy
maintained grip strength relative to control SOD1 mutant animals
(FIG. 5g). The 86.5 day extension in survival surpassed the 62 day
extension seen in transgenic studies that used astrocyte-specific
Cre expression to inactivate the mutant SOD1.sup.G37R
transgene.sup.8, presumably reflecting efficient AAV9 transduction
of astrocytes after peripheral delivery and the possible
transduction of other cell types (especially microglia.sup.6) whose
synthesis of mutant SOD1 accelerates disease progression.
[0071] Histological examination of end-stage SOD1.sup.G37R treated
animals revealed similar levels of intraspinal cell transduction in
animals treated with AAV9-SOD1-shRNA or AAV9-GFP (FIGS. 6A-6P). GFP
expression was predominantly observed within motor neurons and
astrocytes of both groups, and SOD1 expression was detectably
decreased only in animals that received AAV9-SOD1-shRNA (FIG. 6K,
FIG. 6O). Immunoblotting of whole spinal cord extracts from end
stage SOD1.sup.G37R mice revealed an 80% reduction in hSOD1 protein
levels in AAV9-SOD1-shRNA treated animals compared to controls
(Figures S4A-S4B).
Example 7
AAV9 Mediated Suppression of SOD1 in Non-Human Primates
[0072] To test whether SOD1 levels could be efficiently lowered
using AAV9 in the non-human primate spinal cord, AAV9 was injected
intrathecally via lumbar puncture. This method was chosen over
systemic delivery to decrease the amount of virus required and to
minimize any effects from reduction of SOD1 in peripheral tissues.
One year old cynomolgus macaques (Macaca fascicularis) with average
body weight of 2 kg were used for this study at the Mannheimer
Foundation. Regular monitoring of overall health and body weight
was performed prior and after the injections to assess the welfare
of the animals.
[0073] Sequencing of cDNA copied from mRNA isolated from African
Green Monkey (COS cells) and the Cynomolgus macaque verified that
the 130 shRNA had a single base mismatch to either sequence (Figure
S5A-S5B). The 130 shRNA expression cassette was inserted into a
lentiviral vector which was then used to transduce COS cells. Cos-7
cells were maintained in DMEM with 10% FBS and 1%
penicillin/streptomycin. Cells were infected with a lentiviral
vector expressing SOD1 shRNA 130 under the H1 promoter and RFP
under CMV promoter. RNA was extracted from infected and
non-infected cells 72 hours post infection using an RNAeasy Kit
(Qiagen). cDNA was prepared using RT.sup.2 First strand synthesis
kit (SABiosciences). SOD1 transcript levels were analyzed by
qRT-PCR which revealed that the monkey SOD1 mRNA was reduced by
.about.75% in 130 shRNA transduced cells compared to mock
transduced control cells (Figure S5A-S5B).
[0074] The AAV9-SOD1-shRNA virus (1.times.10.sup.13 vg/kg) was
infused along with contrast agent via lumbar puncture into the
subarachnoid space of three male cynomolgus macaques and one
control subject was injected with AAV9-CB-GFP (1.times.10.sup.13
vg/kg) (FIG. 7A). Each intrathecal injection was performed by
lumbar puncture into the subarachnoid space of the lumbar thecal
sac. AAV9 was resuspended with omnipaque (iohexol), an iodinated
compound routinely used in the clinical setting. Iohexol is used to
validate successful subarachnoid space cannulation and was
administered at a dose of 100 mg/Kg. The subject was placed in the
lateral decubitus position and the posterior midline injection site
at .about.L4/5 level identified (below the conus of the spinal
cord). Under sterile conditions, a spinal needle with stylet was
inserted and subarachnoid cannulation was confirmed with the flow
of clear CSF from the needle. In order to decrease the pressure in
the subarachnoid space, 0.8 ml of CSF was drained, immediately
followed by injection with a mixture containing 0.7 mL iohexol (300
mg/ml formulation) mixed with 2.1 mL of virus (2.8 ml total).
[0075] No side effects from the treatments were identified. Two
weeks post injection, the spinal cords were harvested for analysis
of GFP expression and SOD1 RNA levels. GFP expression was seen
broadly in neuronal and astrocytic cells throughout the grey and
white matter of the lumbar spinal cord, the area closest to the
site of injection (FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E).
Immunoblotting of extracts of lumbar spinal cord revealed 87%
reduction in monkey SOD1 protein levels (FIG. 7F, FIG. 7G). Laser
capture microdissection was then used to isolate total RNA from
motor neurons as well as from glia in the nearby neuropil. Analysis
by quantitative RT-PCR using primers specific for monkey SOD1 (and
normalized to actin) confirmed a 95.+-.3% knockdown in the motor
neuron pool and a 66.+-.9% knockdown in the neuropil pool when
compared to samples from a control animal (FIG. 7H).
[0076] Next we examined the level of cell transduction throughout
the spinal cord including cervical, thoracic and lumbar segments.
GFP was found to be expressed broadly within all sections analyzed
(FIG. 8A-8C). Motor neuron counts revealed a caudal to rostral
gradient in cell transduction, with the cervical region showing
more than 50% of GFP/Chat+ motor neurons, increasing to 65% in the
thoracic region and reaching a remarkable 80% in the lumbar region
(FIG. 8D). In order to determine the overall level of SOD1
knockdown achieved with this transduction pattern, qRT-PCR for SOD1
was performed on whole section homogenates from cervical, thoracic
and lumbar cord segments. The results confirmed robust SOD1
reduction at all three spinal cord levels, ranging from a 60%
decrease in the cervical segment, a 70% decrease in the thoracic
region and an 88% decrease in the lumbar region (FIG. 8E),
consistent with the proportion of cells transduced in each
region.
DISCUSSION
[0077] The examples above show that intravenous administration of
AAV9-SOD1-shRNA is safe and well tolerated in wild type mice, with
the absence of adverse effects after long-term assessment. This
approach have achieved one of the longest extensions in survival
ever reported in the rapidly progressive SOD1.sup.G93A mouse model
of ALS (increasing survival by 39% when treatment is initiated at
birth). Even more encouraging, markedly slowed disease progression
is seen even when AAV9 therapy to reduce mutant SOD1 synthesis is
applied after disease onset in SOD1.sup.G37R mice, thereby
significantly extending survival. Thus, the vascular delivery
paradigm in mice represents a proof of concept that mutant SOD1
knockdown after disease onset can be beneficial in both rapid and
more slowly progressive models of ALS at clinically relevant points
in disease. Together, these data show that robust targeting and
suppression of SOD1 levels via AAV9-mediated delivery of shRNA is
effective in slowing disease progression in mouse models of ALS,
critically even when treatment is initiated after onset.
[0078] Multiple recent studies have brought forward the hypothesis
that wild-type SOD1 may contribute through misfolding to the
pathogenic mechanism(s) that underlie sporadic ALS through a
pathway similar to that triggered by mutant SOD1.sup.14, 30-32
Included in this body of evidence is our own demonstration that
astrocytes produced from sporadic ALS patients are toxic to
co-cultured motor neurons and that toxicity is alleviated by
siRNA-mediated reduction in wild type SOD1.sup.30. This evidence
creates the potential that a proportion of sporadic ALS patients
could also benefit from an AAV9-mediated SOD1 reduction approach
that we have demonstrated to be effective in slowing disease
progression in mice that develop fatal, ALS-like disease from
expressing ALS-causing mutations in SOD1.
[0079] Finally, for translation of an AAV9-mediated suppression of
SOD1 synthesis to the human setting, we have determined that
infusion directly into the CSF at the lumbar level in a non-human
primate produce substantial SOD1 reduction by targeting both motor
neurons and non-neuronal cells. This outcome provides strong
support for extending these efforts to an adult human by direct
injection into CSF, as previously proposed.sup.33, 34, so as to 1)
limit the cost of viral production, 2) reduce the possibility that
chronic suppression of SOD1 in the periphery may have deleterious
consequences, and 3) reduce viral exposure to the peripheral immune
system.sup.33. These data strongly indicate AAV9-SOD1-shRNA as a
treatment for ALS.
Techniques/Methods Used in Examples 1-7
[0080] Perfusion and Tissue Processing. Control and treated
SOD1.sup.G93A mice were sacrificed at either 21 days post injection
or at endstage for immunohistochemical analysis. Animals were
anesthetized with xylazene/ketamine cocktail, transcardially
perfused with 0.9% saline, followed by 4% paraformaldehyde. Spinal
cords were harvested, cut into blocks of tissue 5-6 mm in length,
and then cut into 40 .mu.m thick transverse sections on a vibratome
(Leica, Bannockburn, Ill.). Serial sections were kept in a 96-well
plate that contained 4% paraformaldehyde and were stored at
4.degree. C. End stage loxSOD1.sup.G37R mice were anesthetized
using isoflurane and perfused with 4% paraformaldehyde. Spinal cord
segments, including cervical, thoracic and lumbar segments were
dissected. Following cryoprotection with 20% sucrose/4%
paraformaldehyde overnight, spinal cords were frozen in isopentane
at -65.degree. C., and serial 30 .mu.m coronal sections were
collected free floating using sliding microtome.
[0081] For safety studies, P1, P21 treated and control wild type
mice were sacrificed at 180 days of age. Animals were anesthetized
using xylazene/ketamine cocktail and perfused with 0.9% saline.
Different tissues were removed and stored in 10% buffered formalin.
These tissues were further processed, blocked and mounted for
hematoxilin & eosin staining by the Nationwide Children's
Hospital Morphology Core.
[0082] Cynomolgus monkeys injected with virus were euthanized 2
weeks post injection. Animals were anesthetized with sodium
pentobarbital at the dose of 80-100 mg/kg intravenously and
perfused with saline solution. Brain and spinal cord dissection
were performed immediately and tissues were processed either for
nucleic acid isolation (snap frozen) or post-fixed in 4%
paraformaldehyde and subsequently cryoprotected with 30% sucrose
and frozen in isopentane at -65.degree. C. 12 .mu.m coronal
sections were collected from lumbar cord using a cryostat for free
floating immunostaining.
[0083] Immunohistochemistry. Mouse spinal cords were stained as
floating sections. Tissues were washed three-times for 10 minutes
each in TBS, then blocked in a solution containing 10% donkey
serum, 1% Triton X-100 and 1% penicillin/streptomycin for two hours
at room temperature. All the antibodies were diluted with the
blocking solution. Primary antibodies used were as follows: rabbit
anti-GFP (1:400, Invitrogen, Carlsbad, Calif.), rabbit anti-SOD1
(1:200, Cell signaling, Danvers, Mass.), goat anti-ChAT (1:50
Millipore, Billerica, Mass.), mouse anti-GFAP (1:200, Millipore,
Billerica, Mass.), chicken anti GFAP (1:400, Abcam, Cambridge,
Mass.), and rabbit anti-Iba1 (1:400, Wako, Richmond Va.). Tissues
were incubated in primary antibody at 4.degree. C. for 48-72 hours
then washed three times with TBS. After washing, tissues were
incubated for 2 hours at room temperature in the appropriate FITC-,
Cy3-, or Cy5-conjugated secondary antibodies (1:200 Jackson
Immunoresearch, Westgrove, Pa.) and DAPI (1:1000, Invitrogen,
Carlsbad, Calif.). Tissues were then washed three times with TBS,
mounted onto slides then coverslipped with PVA-DABCO. All images
were captured on a Zeiss-laser-scanning confocal microscope.
[0084] For DAB staining, monkey spinal cord sections were washed
three times in TBS, blocked for 2 h at RT in 10% donkey serum and
1% Triton X-100. Sections were then incubated overnight at
4.degree. C. with rabbit anti-GFP primary antibody (1:1000
Invitrogen, Carlsbad, Calif.) diluted in blocking buffer. The
following day, tissues were washed with TBS 3 times, incubated with
biotinylated secondary antibody anti-rabbit (1:200 Jackson
Immunoresearch, Westgrove, Pa.) in blocking buffer for 30 min at
RT, washed 3 times in TBS and incubated for 30 min at RT with ABC
(Vector, Burlingame, Calif.). Sections were then washed for 3 times
in TBS and incubated for 2 min with DAB solution at RT and washed
with distilled water. These were then mounted onto slides and
covered with coverslips in mounting medium. All images were
captured with the Zeiss Axioscope.
[0085] Motor neuron and astrocyte quantification. For MN
quantification, serial 40 .mu.m thick lumbar spinal cord sections,
each separated by 480 .mu.m, were labeled as described for GFP and
ChAT expression. Stained sections were serially mounted on slides
from rostral to caudal, then coverslipped. Sections were evaluated
using confocal microscopy (Zeiss) with a 40.times. objective and
simultaneous FITC and Cy3 filters. The total number of ChAT
positive cells found in the ventral horns with defined soma was
tallied by careful examination through the entire z-extent of the
section. GFP labeled cells were quantified in the same manner,
while checking for co-localization with ChAT. For astrocyte
quantification, as with MNs, serial sections were stained for GFP,
GFAP and then mounted. Using confocal microscopy with a 63.times.
objective and simultaneous FITC and Cy5 filters, random fields in
the ventral horns of lumbar spinal cord sections from tail vein
injected animals were selected. The total numbers of GFP and GFAP
positive cells were counted from a minimum of at least 24-fields
per animal while focusing through the entire z extent of the
section. Spinal cord sections of 3 animals per group were examined
for MN and astrocyte quantification.
[0086] Immunoblot analysis. Spinal cords were harvested from P1,
P21 injected and control SOD1.sup.G93A mice 21 days post injection
and from treated and control monkeys 2 weeks post injection of
AAV9-SOD1-shRNA. Spinal cords were homogenized and protein lysates
were prepared using T-Per (Pierce) with protease inhibitor
cocktail. Samples were resolved on SDS-PAGE according to
manufacturer's instructions. Primary antibodies used were rabbit
anti-SOD1 (1:750, Cell signaling, Danvers, Mass.) mouse anti-SOD1
(1:750, Millipore, Billerica, Mass.), rabbit anti-SOD1 (1:1000,
Abcam, Cambridge, Mass.), rabbit anti-Actin (1:1000, Abcam,
Cambridge, Mass.) and mouse anti-GAPDH (1:1000, Millipore,
Billerica, Mass.). Secondary antibodies used were anti-rabbit HRP
(1:10000-1:50000) and anti-mouse HRP (1:10000). Densitometric
analysis was performed using Image J software.
[0087] Laser Capture Microdissection. 12 .quadrature.m lumbar
spinal cord frozen sections were collected onto PEN membrane slides
(Zeiss, Munich, Germany) and stained with 1% Cresyl violet (Sigma,
St. Louis, Mo.) in methanol. Sections were air dried and stored at
-80.degree. C. After thawing, motor neurons were collected within
30 min from staining using the laser capture microdissector PALM
Robo3 Zeiss) using the following settings: Cut energy: 48, LPC
energy: 20, Cut focus: 80/81, LPC focus: 1, Position speed: 100,
Cut speed: 50. About 500 MNs were collected per animal.
Non-neuronal cells from the ventral horn were collected from the
same sections after collecting the motor neurons.
[0088] qRT-PCR. RNA from laser captured cells or whole spinal cord
sections from the cervical, thoracic and lumbar segments was
isolated using the RNaqueous Micro Kit (Ambion, Grand Island, N.Y.)
according to manufacturer's instructions. RNA was then
reverse-transcribed into cDNA using the RT.sup.2 HT First Strand
Kit (SABiosciences, Valencia, Calif.). 12.5 ng RNA were used in
each Q-PCR reaction using SyBR Green (Invitrogen, Carlsbad, Calif.)
to establish the relative quantity of endogenous monkey SOD1
transcript in animals who had received the AAV9-SOD1-shRNA compared
to animals who had received only AAV9-GFP. Each sample was run in
triplicate and relative concentration calculated using the ddCt
values normalized to endogenous actin transcript.
[0089] Behavior and Survival Analysis. Treated and control
SOD1.sup.G93A mice were monitored for changes in body mass twice a
week. loxSOD1.sup.G37R mice were weighed on a weekly basis. Motor
coordination was recorded using a rotarod instrument (Columbus
Instruments, Columbus, Ohio). Each weekly session consisted of
three trials on the accelerating rotarod beginning at 5 rpm/min.
The time each mouse remained on the rod was registered. Both
SOD1.sup.G93A and loxSOD1.sup.G37R mice were subjected to weekly
assessment of hindlimb grip strength using a grip strength meter
(Columbus Instruments, Columbus, Ohio). Each weekly session
consisted of 3 (SOD1.sup.G93A mice) or 5 (loxSOD1.sup.G37R mice)
tests per animal. Survival analysis was performed using
Kaplan-Meier survival analysis. End stage was defined as an
artificial death point when animals could no longer "right"
themselves within 30 sec after being placed on its back. Onset and
disease progression were determined from retrospective analysis of
the data. Disease onset is defined as the age at which the animal
reached its peak weight. Disease duration is defined as the time
period between disease onset and end stage. Early disease duration
is the period between peak weight and loss of 10% of body weight
while late disease duration is defined as the period between 10%
loss of body weight until disease end stage. Due to shorter life
span of SOD1.sup.G93A animals, we did not assess the distinction
between the early and late progression.
[0090] For toxicity analysis following injection at P1 or P21,
treated and control WT mice were subjected to behavioral analysis
starting at .about.30 days of age and monitored up to 6 months.
Body mass was recorded weekly while rotarod performance and
hindlimb grip strength were recorded biweekly.
[0091] Hematology and Serum Studies. Blood samples were collected
in (K2) EDTA microtainer tubes (BD) from treated and control WT
mice at 150 days of age by mandibular vein puncture. The same
animals were bled at 180 days of age and blood was collected in
serum separator microtainer tubes. The blood was allowed to clot
for an hour and was then centrifuged at 10,000 rpm for 5 minutes.
The clear upper phase (serum) was collected and frozen at
-80.degree. C. Hematological and serum analysis were conducted by
Ani Lytics Inc, Gaithersburg, Md.
[0092] Statistical analysis. All statistical tests were performed
using the GraphPad Prism (San Diego, Calif.) software package.
Kaplan Meier survival analyses were analyzed by the Log Rank Test.
Comparisons of median disease durations and survival times were
analyzed by the Wilcoxon Signed Rank Test.
Example 8
Development of a Clinical SOD1 shRNA Construct
[0093] The AAV SOD1 shRNA vector described in Example 2 carries
shRNA against human SOD1 sequence under the H1 promoter (FIG. 9A).
The same vector also contains a GFP expression cassette which
expresses GFP under a CBA promoter. The other regulatory elements
present in this cassette include CMV enhancer, SV40 intron and bGH
PolyA terminator sequence. We show herein that AAV9 SOD1 shRNA
administration results in efficient SOD1 downregulation along with
robust expression of GFP in vitro as well as in vivo. No
significant alterations were observed after the long term
assessment of wild-type mice administered with AAV9 SOD1 shRNA.
These results suggested that there are no evident off-target
effects due to the long-term expression of SOD1 shRNA as well as
overexpression of GFP. Although we did not find GFP toxicity in our
mice, several reports have shown the adverse effects of GFP
overexpression in vitro and in vivo. Therefore, to eliminate the
possibility of GFP toxicity altogether, the SOD1 shRNA construct of
Example 2 was modified by replacing the GFP expression cassette
with a non-coding stuffer sequence while maintaining the size of
the total DNA construct flanked by the ITRs (FIG. 9B). This is
important as the distance between the two ITR sequences greatly
affects the packaging capacity of the flanked construct into AAV9
capsids[321-324].
[0094] To date, none of the FDA approved stuffer sequences are
readily available. There are, however, several plasmid backbones
that are approved by FDA for the human administration. Small DNA
fragments were picked from these plasmids which do not correspond
to any essential DNA sequences necessary for selection and
replication of the plasmid or the elements of the transcriptional
units. The plasmid backbones are listed in Table 1. The DNA
elements from different plasmids were arranged in tandem to
generate a complete, 1607 bp stuffer sequence (SEQ ID NO: 22).
Finally, a DNA construct containing the SOD1 shRNA expression
cassette, followed by the stuffer sequence was synthesized from
Genscript.
TABLE-US-00004 TABLE 1 Plasmid ClinicalTrials.gov Backbone
Condition Intervention Phase Identifier pVax1 Early Stage Non-
Recombinant DNA- 1 NCT00062907 Small pVAX/L523S Cell Lung Cancer
pCDNA3 Chronic Hepatitis B DNA vaccine 1, 2 NCT00536627 pCMVS2.S
pUCMV3 Stage III Ovarian pUMVC3-hIGFBP-2 1 NCT01322802 Epithelial
Cancer multi-epitope plasmid Stage III Ovarian DNA vaccine Germ
Cell Tumor Stage IV Ovarian Epithelial Cancer Stage IV Ovarian Germ
Cell Tumor pBK- Prostate Cancer NY-ESO-1 plasmid 1 NCT00199849 CMV
Bladder Cancer DNA Cancer Vaccine Non-Small Cell Lung Cancer
Esophageal Cancer Sarcoma pGA2 HIV Infections pGA2/JS2 Plasmid DNA
1 NCT00043511 Vaccine
[0095] Clinical SOD1 shRNA construct has shRNA against human SOD1
under H1 promoter which is followed by the non-coding stuffer
sequence. This construct is designed in such a way that multiple
shRNA expression cassettes can be added to the final vector by
simultaneous removal of the stuffer sequence. Restriction
endonuclease sites have been added to the stuffer sequence so that
a part of the stuffer can be removed when another shRNA expression
cassette is added (FIG. 10). This simultaneous removal and addition
of DNA sequences would help maintaining the optimal size of the
whole construct between the ITRs (.about.2.0 kb) to achieve
efficient packaging.
[0096] Clinical SOD1 shRNA construct from Genscript was cloned into
pJet1.2 shuttle vector via EcoRV. This parental clone was screened
using various restriction endonucleases designed within the
construct to confirm the correct clone. Kpn1/Sph1 double digestion
of pJet SOD1 shRNA confirmed the presence of the complete construct
(2023 bp) while Xba1 digestion confirmed the presence of SOD1 shRNA
expression cassette (414 bp) and the stuffer element, along with
pJet backbone (.about.3000 bp). EcoRV/Pme1 double digestion also
revealed the presence of stuffer element.
Example 9
Clinical SOD1 shRNA Efficiently Reduces Human SOD1 Protein Levels
In Vitro
[0097] To determine the efficacy of the de novo synthesized SOD1
shRNA construct to downregulate SOD1 levels, HEK293 cells were
transfected with pJet SOD1 shRNA plasmid using Calcium Phosphate
method. AAV SOD1 shRNA plasmid was used as a positive control.
Immunofluorescence analysis of HEK293 cells, 72 hrs post
transfection revealed the lack of native GFP fluorescence from pJet
SOD1 shRNA transfected cells as compared to AAV9 SOD1 shRNA
transfected cells. Immunoblot analysis of cell lysates from these
cells further confirmed the successful replacement of GFP from pJet
SOD1 shRNA plasmid. Importantly, pJet SOD1 shRNA resulted in
efficient downregulation of SOD1 protein levels (>50%), similar
to AAV SOD1 shRNA plasmid. See FIG. 11A-11J.
Example 10
Generation of Clinical AAV SOD1 shRNA
[0098] Clinical SOD1 shRNA construct was further cloned into an
AAV.CB.MCS vector using Kpn1/Sph1 sites to generate clinical AAV
SOD1 shRNA plasmid (FIG. 12). AAV.CB.MCS was generated from
AAV.CB.GFP plasmid obtained from merion Scientific by replacing GFP
with a multiple cloning site (MCS). Cloning of clinical SOD1 shRNA
construct at Kpn1/Sph1 sites puts it between the two AAV2 ITRs
which facilitates the packaging of the construct in AAV9 viral
capsids. See FIG. 12.
[0099] Clinical AAV SOD1 shRNA plasmid was screened with
restriction endonucleases to confirm the presence of SOD1 shRNA
expression cassette (Xba1 digest), stuffer sequence (EcoRV/Pme1
double digest) and also intact ITR sequences (Sma1 digest).
Example 11
Clinical AAV SOD1 shRNA Efficiently Reduces Human SOD1 Protein
Levels In Vitro
[0100] Clinical AAV SOD1 shRNA plasmid was transfected in HEK293
cells to determine its knockdown efficiency. Similar to the pJet
SOD1 shRNA plasmid, clinical AAV SOD1 shRNA transfected cells were
devoid of any GFP expression as evident by immunofluorescence (FIG.
13A-F) and immunoblot assay (FIG. 13G). More importantly, clinical
AAV SOD1 shRNA efficiently reduced human SOD1 protein levels in
HEK293 cells by more than 50% (FIG. 13G, FIG. 13H). Altogether,
these results confirmed the successful generation of clinical AAV
SOD1 shRNA vector with functional SOD1 shRNA expression cassette
and complete removal of the transgene expression cassette.
DOCUMENTS REFERENCED
[0101] 1. Da Cruz, S. & Cleveland, D. W. Understanding the role
of TDP-43 and FUS/TLS in ALS and beyond. Curr Opin Neurobiol 21,
904-919 (2011). [0102] 2. Rosen, D. R. et al. Mutations in Cu/Zn
superoxide dismutase gene are associated with familial amyotrophic
lateral sclerosis. Nature 362, 59-62 (1993). [0103] 3. Ilieva, H.,
Polymenidou, M. & Cleveland, D. W. Non-cell autonomous toxicity
in neurodegenerative disorders: ALS and beyond. The Journal of cell
biology 187, 761-772 (2009). [0104] 4. Chattopadhyay, M. &
Valentine, J. S. Aggregation of copper-zinc superoxide dismutase in
familial and sporadic ALS. Antioxidants & redox signaling 11,
1603-1614 (2009). [0105] 5. Prudencio, M., Hart, P. J., Borchelt,
D. R. & Andersen, P. M. Variation in aggregation propensities
among ALS-associated variants of SOD1: correlation to human
disease. Human molecular genetics 18, 3217-3226 (2009). [0106] 6.
Boillee, S. et al. Onset and progression in inherited ALS
determined by motor neurons and microglia. Science 312, 1389-1392
(2006). [0107] 7. Kang, S. H. et al. Degeneration and impaired
regeneration of gray matter oligodendrocytes in amyotrophic lateral
sclerosis. Nature neuroscience 16, 571-579 (2013). [0108] 8.
Yamanaka, K. et al. Astrocytes as determinants of disease
progression in inherited amyotrophic lateral sclerosis. Nature
neuroscience 11, 251-253 (2008). [0109] 9. Di Giorgio, F. P.,
Boulting, G. L., Bobrowicz, S. & Eggan, K. C. Human embryonic
stem cell-derived motor neurons are sensitive to the toxic effect
of glial cells carrying an ALS-causing mutation. Cell Stem Cell 3,
637-648 (2008). [0110] 10. Di Giorgio, F. P., Carrasco, M. A.,
Siao, M. C., Maniatis, T. & Eggan, K. Non-cell autonomous
effect of glia on motor neurons in an embryonic stem cell-based ALS
model. Nature neuroscience 10, 608-614 (2007). [0111] 11.
Marchetto, M. C. et al. Non-cell-autonomous effect of human SOD1
G37R astrocytes on motor neurons derived from human embryonic stem
cells. Cell Stem Cell 3, 649-657 (2008). [0112] 12.
Haidet-Phillips, A. M. et al. Astrocytes from familial and sporadic
ALS patients are toxic to motor neurons. Nat Biotechnol 29, 824-828
(2011). [0113] 13. Bosco, D. A. et al. Wild-type and mutant SOD1
share an aberrant conformation and a common pathogenic pathway in
ALS. Nature neuroscience 13, 1396-1403 (2010). [0114] 14.
Pokrishevsky, E. et al. Aberrant localization of FUS and TDP43 is
associated with misfolding of SOD1 in amyotrophic lateral
sclerosis. PloS one 7, e35050 (2012). [0115] 15. Forsberg, K. et
al. Novel antibodies reveal inclusions containing non-native SOD1
in sporadic ALS patients. PLoS One 5, e11552 (2010). [0116] 16.
Aggarwal, S. & Cudkowicz, M. ALS drug development: reflections
from the past and a way forward. Neurotherapeutics: the journal of
the American Society for Experimental NeuroTherapeutics 5, 516-527
(2008). [0117] 17. Gurney, M. E. et al. Benefit of vitamin E,
riluzole, and gabapentin in a transgenic model of familial
amyotrophic lateral sclerosis. Ann Neurol 39, 147-157 (1996).
[0118] 18. Foust, K. D. et al. Intravascular AAV9 preferentially
targets neonatal neurons and adult astrocytes. Nature biotechnology
27, 59-65 (2009). [0119] 19. Duque, S. et al. Intravenous
administration of self-complementary AAV9 enables transgene
delivery to adult motor neurons. Mol Ther 17, 1187-1196 (2009).
[0120] 20. Zhong, Z. et al. ALS-causing SOD1 mutants generate
vascular changes prior to motor neuron degeneration. Nature
neuroscience 11, 420-422 (2008). [0121] 21. Miller, R. G.,
Mitchell, J. D. & Moore, D. H. Riluzole for amyotrophic lateral
sclerosis (ALS)/motor neuron disease (MND). Cochrane Database Syst
Rev 3, CD001447 (2012). [0122] 22. Smith, R. A. et al. Antisense
oligonucleotide therapy for neurodegenerative disease. The Journal
of clinical investigation 116, 2290-2296 (2006). [0123] 23. Raoul,
C. et al. Lentiviral-mediated silencing of SOD1 through RNA
interference retards disease onset and progression in a mouse model
of ALS. Nat Med 11, 423-428 (2005). [0124] 24. Ralph, G. S. et al.
Silencing mutant SOD1 using RNAi protects against neurodegeneration
and extends survival in an ALS model. Nat Med 11, 429-433 (2005).
[0125] 25. Miller, T. M. et al. Virus-delivered small RNA silencing
sustains strength in amyotrophic lateral sclerosis. Annals of
neurology 57, 773-776 (2005). [0126] 26. Miller, T. M. et al. An
antisense oligonucleotide against SOD1 delivered intrathecally for
patients with SOD1 familial amyotrophic lateral sclerosis: a phase
1, randomised, first-in-man study. Lancet neurology 12, 435-442
(2013). [0127] 27. Towne, C., Raoul, C., Schneider, B. L. &
Aebischer, P. Systemic AAV6 delivery mediating RNA interference
against SOD1: neuromuscular transduction does not alter disease
progression in fALS mice. Mol Ther 16, 1018-1025 (2008). [0128] 28.
Towne, C., Setola, V., Schneider, B. L. & Aebischer, P.
Neuroprotection by gene therapy targeting mutant SOD1 in individual
pools of motor neurons does not translate into therapeutic benefit
in fALS mice. Mol Ther 19, 274-283 (2011). [0129] 29. Mandel, R.
J., Lowenstein, P. R. & Byrne, B. J. AAV6-mediated gene
silencing fALS short. Mol Ther 19, 231-233 (2011). [0130] 30.
Synofzik, M. et al. Mutant superoxide dismutase-1 indistinguishable
from wild-type causes ALS. Human molecular genetics 21, 3568-3574
(2012). [0131] 31. Guareschi, S. et al. An over-oxidized form of
superoxide dismutase found in sporadic amyotrophic lateral
sclerosis with bulbar onset shares a toxic mechanism with mutant
SOD1. Proc Natl Acad Sci USA 109, 5074-5079 (2012). [0132] 32.
Haidet-Phillips, A. M. et al. Astrocytes from familial and sporadic
ALS patients are toxic to motor neurons. Nat Biotechnol 29, 824-828
(2011). [0133] 33. Bevan, A. K. et al. Systemic gene delivery in
large species for targeting spinal cord, brain, and peripheral
tissues for pediatric disorders. Mol Ther 19, 1971-1980 (2011).
[0134] 34. Gray, S. J. et al. Preclinical differences of
intravascular AAV9 delivery to neurons and glia: a comparative
study of adult mice and nonhuman primates. Mol Ther 19, 1058-1069
(2011). [0135] 35. Lioy, D. T. et al. A role for glia in the
progression of Rett's syndrome. Nature 475, 497-500 (2011). [0136]
36. Miranda, C. J. et al. Aging brain microenvironment decreases
hippocampal neurogenesis through Wnt-mediated survivin signaling.
Aging Cell 11, 542-552 (2012). [0137] 37. Yamanaka, K. et al.
Mutant SOD1 in cell types other than motor neurons and
oligodendrocytes accelerates onset of disease in ALS mice. Proc
Natl Acad Sci USA 105, 7594-7599 (2008).
[0138] All documents referred to in this application, including
priority documents, are hereby incorporated by reference in their
entirety with particular attention to the content for which they
are referred.
Sequence CWU 1
1
22126DNAArtificial SequenceSynthetic Polynucleotide 1gcatcatcaa
tttcgagcag aaggaa 26223DNAArtificial SequenceSynthetic
Polynucleotide 2gaagcattaa aggactgact gaa 23323DNAArtificial
SequenceSynthetic Polynucleotide 3ctgactgaag gcctgcatgg att
23420DNAArtificial SequenceSynthetic Polynucleotide 4catggattcc
atgttcatga 20521DNAArtificial SequenceSynthetic Polynucleotide
5gcatggattc catgttcatg a 21621DNAArtificial SequenceSynthetic
Polynucleotide 6ggtctggcct ataaagtagt c 21721DNAArtificial
SequenceSynthetic Polynucleotide 7gggcatcatc aatttcgagc a
21821DNAArtificial SequenceSynthetic Polynucleotide 8gcatcatcaa
tttcgagcag a 21921DNAArtificial SequenceSynthetic Polynucleotide
9gcctgcatgg attccatgtt c 211021DNAArtificial SequenceSynthetic
Polynucleotide 10ggaggtctgg cctataaagt a 211121DNAArtificial
SequenceSynthetic Polynucleotide 11gattccatgt tcatgagttt g
211221DNAArtificial SequenceSynthetic Polynucleotide 12ggagataata
cagcaggctg t 211321DNAArtificial SequenceSynthetic Polynucleotide
13gctttaaagt acctgtagtg a 211421DNAArtificial SequenceSynthetic
Polynucleotide 14gcattaaagg actgactgaa g 211519DNAArtificial
SequenceSynthetic Polynucleotide 15tcatcaattt cgagcagaa
191619DNAArtificial SequenceSynthetic Polynucleotide 16tcgagcagaa
ggaaagtaa 191719DNAArtificial SequenceSynthetic Polynucleotide
17gcctgcatgg attccatgt 191819DNAArtificial SequenceSynthetic
Polynucleotide 18tcactctcag gagaccatt 191919DNAArtificial
SequenceSynthetic Polynucleotide 19gctttaaagt acctgtagt
19205786DNAArtificial SequenceSynthetic Polynucleotide 20gcccaatacg
caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctgattct 60aacgaggaaa
gcacgttata cgtgctcgtc aaagcaacca tagtacgcgc cctgtagcgg
120cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg accgctacac
ttgccagcgc 180cctagcgccc gctcctttcg ctttcttccc ttcctttctc
gccacgttcg ccggctttcc 240ccgtcaagct ctaaatcggg ggctcccttt
agggttccga tttagtgctt tacggcacct 300cgaccccaaa aaacttgatt
agggtgatgg ttcacgtagt gggccatcgc cctgatagac 360ggtttttcgc
cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac
420tggaacaaca ctcaacccta tctcggtcta ttcttttgat ttataaggga
ttttgccgat 480ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa
tttaacgcga attttaacaa 540aatattaacg cttacaattt aaatatttgc
ttatacaatc ttcctgtttt tggggctttt 600ctgattatca accggggtac
atatgattga catgctagtt ttacgattac cgttcatcgc 660cctgcgcgct
cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc gggcgacctt
720tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggaat
tcacgcgtgg 780atctgaattc aattcacgcg tggtacctac actttatgct
tccggctcgt atgttgtgtg 840gaattgtgag cggataacaa tttcacacag
gaaacagcta tgaccatgat tacgccaagc 900tttccaaaaa agcatggatt
ccatgttcat gatctcttga atcatgaaca tggaatccat 960ggatccgagt
ggtctcatac agaacttata agattcccaa atccaaagac atttcacgtt
1020tatggtgatt tcccagaaca catagcgaca tgcaaatatg aattcactgg
ccgtcgtttt 1080acaacgtcgt gactgggaaa accctggcgt tacccaactt
aatcgccttg cagcacatcc 1140ccctttcgcc agctggcgta atagcgaaga
ggcccgcacc gatcgccctt cccaacagtt 1200gcgcagcctg tggtacctct
ggtcgttaca taacttacgg taaatggccc gcctggctga 1260ccgcccaacg
acccccgccc attgacgtca ataatgacgt atgttcccat agtaacgcca
1320atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc
ccacttggca 1380gtacatcaag tgtatcatat gccaagtacg ccccctattg
acgtcaatga cggtaaatgg 1440cccgcctggc attatgccca gtacatgacc
ttatgggact ttcctacttg gcagtacatc 1500tactcgaggc cacgttctgc
ttcactctcc ccatctcccc cccctcccca cccccaattt 1560tgtatttatt
tattttttaa ttattttgtg cagcgatggg ggcggggggg gggggggggc
1620gcgcgccagg cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg
agaggtgcgg 1680cggcagccaa tcagagcggc gcgctccgaa agtttccttt
tatggcgagg cggcggcggc 1740ggcggcccta taaaaagcga agcgcgcggc
gggcgggagc gggatcagcc accgcggtgg 1800cggcctagag tcgacgagga
actgaaaaac cagaaagtta actggtaagt ttagtctttt 1860tgtcttttat
ttcaggtccc ggatccggtg gtggtgcaaa tcaaagaact gctcctcagt
1920ggatgttgcc tttacttcta ggcctgtacg gaagtgttac ttctgctcta
aaagctgcgg 1980aattgtaccc gcggccgatc caccggtcgc caccatggtg
agcaagggcg aggagctgtt 2040caccggggtg gtgcccatcc tggtcgagct
ggacggcgac gtaaacggcc acaagttcag 2100cgtgtccggc gagggcgagg
gcgatgccac ctacggcaag ctgaccctga agttcatctg 2160caccaccggc
aagctgcccg tgccctggcc caccctcgtg accaccctga cctacggcgt
2220gcagtgcttc agccgctacc ccgaccacat gaagcagcac gacttcttca
agtccgccat 2280gcccgaaggc tacgtccagg agcgcaccat cttcttcaag
gacgacggca actacaagac 2340ccgcgccgag gtgaagttcg agggcgacac
cctggtgaac cgcatcgagc tgaagggcat 2400cgacttcaag gaggacggca
acatcctggg gcacaagctg gagtacaact acaacagcca 2460caacgtctat
atcatggccg acaagcagaa gaacggcatc aaggtgaact tcaagatccg
2520ccacaacatc gaggacggca gcgtgcagct cgccgaccac taccagcaga
acacccccat 2580cggcgacggc cccgtgctgc tgcccgacaa ccactacctg
agcacccagt ccgccctgag 2640caaagacccc aacgagaagc gcgatcacat
ggtcctgctg gagttcgtga ccgccgccgg 2700gatcactctc ggcatggacg
agctgtacaa gtaaagcggc catcaagctt atcgataccg 2760tcgactagag
ctcgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt
2820tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt
cctttcctaa 2880taaaatgagg aaattgcatc gcattgtctg agtaggtgtc
attctattct ggggggtggg 2940gtggggcagg acagcaaggg ggaggattgg
gaagacaata gcaggcatgc tggggagaga 3000tcgatctgag gaacccctag
tgatggagtt ggccactccc tctctgcgcg ctcgctcgct 3060cactgaggcc
gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg cggcctcagt
3120gagcgagcga gcgcgcagag agggagtggc cccccccccc ccccccccgg
cgattctctt 3180gtttgctcca gactctcagg caatgacctg atagcctttg
tagagacctc tcaaaaatag 3240ctaccctctc cggcatgaat ttatcagcta
gaacggttga atatcatatt gatggtgatt 3300tgactgtctc cggcctttct
cacccgtttg aatctttacc tacacattac tcaggcattg 3360catttaaaat
atatgagggt tctaaaaatt tttatccttg cgttgaaata aaggcttctc
3420ccgcaaaagt attacagggt cataatgttt ttggtacaac cgatttagct
ttatgctctg 3480aggctttatt gcttaatttt gctaattctt tgccttgcct
gtatgattta ttggatgttg 3540gaatcgcctg atgcggtatt ttctccttac
gcatctgtgc ggtatttcac accgcatatg 3600gtgcactctc agtacaatct
gctctgatgc cgcatagtta agccagcccc gacacccgcc 3660aacacccgct
gacgcgccct gacgggcttg tctgctcccg gcatccgctt acagacaagc
3720tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac
cgaaacgcgc 3780gagacgaaag ggcctcgtga tacgcctatt tttataggtt
aatgtcatga taataatggt 3840ttcttagacg tcaggtggca cttttcgggg
aaatgtgcgc ggaaccccta tttgtttatt 3900tttctaaata cattcaaata
tgtatccgct catgagacaa taaccctgat aaatgcttca 3960ataatattga
aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt
4020ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga
aagtaaaaga 4080tgctgaagat cagttgggtg cacgagtggg ttacatcgaa
ctggatctca acagcggtaa 4140gatccttgag agttttcgcc ccgaagaacg
ttttccaatg atgagcactt ttaaagttct 4200gctatgtggc gcggtattat
cccgtattga cgccgggcaa gagcaactcg gtcgccgcat 4260acactattct
cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga
4320tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata
acactgcggc 4380caacttactt ctgacaacga tcggaggacc gaaggagcta
accgcttttt tgcacaacat 4440gggggatcat gtaactcgcc ttgatcgttg
ggaaccggag ctgaatgaag ccataccaaa 4500cgacgagcgt gacaccacga
tgcctgtagc aatggcaaca acgttgcgca aactattaac 4560tggcgaacta
cttactctag cttcccggca acaattaata gactggatgg aggcggataa
4620agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg
ctgataaatc 4680tggagccggt gagcgtgggt ctcgcggtat cattgcagca
ctggggccag atggtaagcc 4740ctcccgtatc gtagttatct acacgacggg
gagtcaggca actatggatg aacgaaatag 4800acagatcgct gagataggtg
cctcactgat taagcattgg taactgtcag accaagttta 4860ctcatatata
ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa
4920gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt
tccactgagc 4980gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat
cctttttttc tgcgcgtaat 5040ctgctgcttg caaacaaaaa aaccaccgct
accagcggtg gtttgtttgc cggatcaaga 5100gctaccaact ctttttccga
aggtaactgg cttcagcaga gcgcagatac caaatactgt 5160ccttctagtg
tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata
5220cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt
cgtgtcttac 5280cgggttggac tcaagacgat agttaccgga taaggcgcag
cggtcgggct gaacgggggg 5340ttcgtgcaca cagcccagct tggagcgaac
gacctacacc gaactgagat acctacagcg 5400tgagctatga gaaagcgcca
cgcttcccga agggagaaag gcggacaggt atccggtaag 5460cggcagggtc
ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct
5520ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt
gatgctcgtc 5580aggggggcgg agcctatgga aaaacgccag caacgcggcc
tttttacggt tcctggcctt 5640ttgctggcct tttgctcaca tgttctttcc
tgcgttatcc cctgattctg tggataaccg 5700tattaccgcc tttgagtgag
ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga 5760gtcagtgagc
gaggaagcgg aagagc 578621164DNAArtificial SequenceSynthetic
Polynucleotide 21aattcatatt tgcatgtcgc tatgtgttct gggaaatcac
cataaacgtg aaatgtcttt 60ggatttggga atcttataag ttctgtatga gaccactcgg
atccatggat tccatgttca 120tgattcaaga gatcatgaac atggaatcca
tgcttttttg gaaa 164221607DNAArtificial SequenceSynthetic
Polynucleotide 22tctagaggct cgagaagata tcaactgcag cttctactgg
gcggttttat ggacagcaag 60cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt
gggaagccct gcaaagtaaa 120ctggatggct ttctcgccgc caaggatctg
atggcgcagg ggatcaagct ctgatcaaga 180gacaggatga ggatcgtttc
gcgttcttga ctcttcgcga tgtacgggcc agatatacgc 240gttgacattg
attattgact agttattaat agtaatcaat tacggggtca ttagttcata
300gcccatatat ggagttccgc ctgcagggac gtcgacggat cgggagatct
cccgatcccc 360tatctgctcc ctgcttgtgt gttggaggtc gctgagtagt
gcgcgagcaa aatttaagct 420acaacaaggc aaggcttgac cgacaattgc
atgaagaatc tgcttagggt taggcgtttt 480gcgctgcttc gcggcgcgcc
ttttaaggca gttattggtg cccttaaacg cctggtgcta 540cgcctgaata
agtgataata agcggatgaa tggcagaaat tcgccggatc tttgtgaagg
600aaccttactt ctgtggtgtg acataattgg acaaactacc tacagagatt
taaagctcta 660atgtaagcag acagttttat tgttcatgat gatatatttt
tatcttgtgc aatgtaacat 720cagagatttt gagacacaac gtggctttcc
cccccccccc ctagggtggg cgaagaactc 780cagcatgaga tccccgcgct
ggaggatcat ccagccggcg tcccggaaaa cgattccgaa 840gcccaacctt
tcatagaagg cggcggtgga atcgaaatct cgtgatggca ggttgggcgt
900cgcttggtcg gtcatttcga accccagagt cccgctcagg gcgcgccggg
ggggggggcg 960ctgaggtctg cctcgtgaag aaggtgttgc tgactcatac
caggcctgaa tcgccccatc 1020atccagccag aaagtgaggg agccacggtt
gatgagagct ttgttgtagg tggaccagtc 1080ctgcaggagc ataaagtgta
aagcctgggg tgcctaatga gtgagctaac tcacattaat 1140tgcgttgcgc
tcactgcccg ctttccagtc gggaaacctg tcgtgcccgc ccagtctagc
1200tatcgccatg taagcccact gcaagctacc tgctttctct ttgcgcttgc
gttttccctt 1260gtccagatag cccagtagct gacattcatc cggggtcagc
accgtttctg cggactggct 1320ttctacgtgt ctggttcgag gcgggatcag
ccaccgcggt ggcggcctag agtcgacgag 1380gaactgaaaa accagaaagt
taactggcct gtacggaagt gttacttctg ctctaaaagc 1440tgcggaattg
tacccgcggc cgatccaccg gtcgccacca gcggccatca agcacgttat
1500cgataccgtc gactagagct cgctgatcag tggggggtgg ggtggggcag
gacagcaagg 1560gggaggattg ggaagacaat agcagctgca gaagtttaaa cgcatgc
1607
* * * * *