U.S. patent application number 17/115743 was filed with the patent office on 2021-04-15 for rnai-mediated inhibition of hif1a for treatment of ocular angiogenesis.
The applicant listed for this patent is Arrowhead Pharmaceuticals, Inc.. Invention is credited to David P. Bingaman, Jon E. Chatterton.
Application Number | 20210108206 17/115743 |
Document ID | / |
Family ID | 1000005300140 |
Filed Date | 2021-04-15 |
![](/patent/app/20210108206/US20210108206A1-20210415-C00001.png)
![](/patent/app/20210108206/US20210108206A1-20210415-D00001.png)
United States Patent
Application |
20210108206 |
Kind Code |
A1 |
Chatterton; Jon E. ; et
al. |
April 15, 2021 |
RNAi-MEDIATED INHIBITION OF HIF1A FOR TREATMENT OF OCULAR
ANGIOGENESIS
Abstract
RNA interference is provided for inhibition of HIF1A mRNA
expression for treating patients with ocular angiogenesis,
particularly for treating retinal edema, diabetic retinopathy,
sequela associated with retinal ischemia, posterior segment
neovascularization (PSNV), and neovascular glaucoma, and for
treating patients at risk of developing such conditions.
Inventors: |
Chatterton; Jon E.; (Fort
Worth, TX) ; Bingaman; David P.; (Weatherford,
TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Arrowhead Pharmaceuticals, Inc. |
Pasadena |
CA |
US |
|
|
Family ID: |
1000005300140 |
Appl. No.: |
17/115743 |
Filed: |
December 8, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
17003305 |
Aug 26, 2020 |
|
|
|
17115743 |
|
|
|
|
16877764 |
May 19, 2020 |
|
|
|
17003305 |
|
|
|
|
16784402 |
Feb 7, 2020 |
|
|
|
16877764 |
|
|
|
|
16667345 |
Oct 29, 2019 |
|
|
|
16784402 |
|
|
|
|
16512744 |
Jul 16, 2019 |
|
|
|
16667345 |
|
|
|
|
16404795 |
May 7, 2019 |
|
|
|
16512744 |
|
|
|
|
16259107 |
Jan 28, 2019 |
|
|
|
16404795 |
|
|
|
|
16193617 |
Nov 16, 2018 |
|
|
|
16259107 |
|
|
|
|
15470060 |
Mar 27, 2017 |
|
|
|
16193617 |
|
|
|
|
14566234 |
Dec 10, 2014 |
|
|
|
15470060 |
|
|
|
|
13904431 |
May 29, 2013 |
8940887 |
|
|
14566234 |
|
|
|
|
13474405 |
May 17, 2012 |
8471000 |
|
|
13904431 |
|
|
|
|
13113782 |
May 23, 2011 |
|
|
|
13474405 |
|
|
|
|
12706014 |
Feb 16, 2010 |
7981870 |
|
|
13113782 |
|
|
|
|
11642016 |
Dec 19, 2006 |
|
|
|
12706014 |
|
|
|
|
60754956 |
Dec 29, 2005 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2320/31 20130101;
A61K 31/7105 20130101; C12N 15/1136 20130101; C12N 2310/14
20130101; C12N 2310/321 20130101; C12N 15/113 20130101; A61K 9/0048
20130101; C12N 2320/30 20130101; A61K 31/713 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 31/7105 20060101 A61K031/7105; A61K 9/00 20060101
A61K009/00; A61K 31/713 20060101 A61K031/713 |
Claims
1. A composition for attenuating expression of a hypoxia-inducible
factor-la (HIF1A) gene, the composition comprising an interfering
RNA having a length of 19 to 49 nucleotides, wherein the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence identity with
UAUGUGGAAGUGGCAACUG (SEQ ID NO: 53).
2. The composition of claim 1, wherein the interfering RNA is
single-stranded, a shRNA, a double-stranded siRNA, or a miRNA.
3. The composition of claim 2, wherein at least one of the
nucleotides of the interfering RNA is modified on its base portion,
sugar portion, or phosphate portion.
4. The composition of claim 3, wherein at least one of the
nucleotides of the interfering RNA has a 2'-O-methyl
modification.
5. The composition of claim 3, wherein the interfering RNA
comprises a region of at least 15, 16, 17, 18, or 19 contiguous
nucleotides of UAUGUGGAAGUGGCAACUG (SEQ ID NO: 53).
6. The composition of claim 3, wherein the interfering RNA is a
double-stranded siRNA comprising a first strand and a second
strand, and wherein each strand of the double-stranded siRNA has a
length of 19 to 49 nucleotides.
7. The composition of claim 6, wherein the first strand of the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence identity with
UAUGUGGAAGUGGCAACUG (SEQ ID NO: 53), and the second strand of the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence identity with
CAGUUGCCACUUCCACAUA (SEQ ID NO: 52).
8. The composition of claim 7, wherein at least one of the
nucleotides of the first stand and at least one of the nucleotides
of the second strand of the interfering RNA is modified on its base
portion, sugar portion, or phosphate portion.
9. The composition of claim 1, wherein the composition further
comprises a second interfering RNA having a length of 19 to 49
nucleotides and comprising a region of at least 13 contiguous
nucleotides having at least 90% complementarity to, or at least 90%
sequence identity with, the penultimate 13 nucleotides of the 3'
end of an mRNA corresponding to any one of SEQ ID NO: 3, and SEQ ID
NO:9-SEQ ID NO:51.
10. A method of attenuating expression of HIF1A mRNA in a subject,
the method comprising administering to the subject an effective
amount of the composition of claim 1, wherein the expression of
HIF1A mRNA is thereby attenuated.
11. The method of claim 10, wherein the interfering RNA is
single-stranded, a shRNA, a double-stranded siRNA, or a miRNA.
12. The method of claim 11, wherein at least one of the nucleotides
of the interfering RNA is modified on its base portion, sugar
portion, or phosphate portion.
13. The method of claim 12, wherein at least one of the nucleotides
of the interfering RNA has a 2'-O-methyl modification.
14. The method of claim 12, wherein the interfering RNA comprises a
region of at least 15, 16, 17, 18, or 19 contiguous nucleotides of
UAUGUGGAAGUGGCAACUG (SEQ ID NO: 53).
15. The method of claim 12, wherein the interfering RNA is a
double-stranded siRNA comprising a first strand and a second
strand, and wherein each strand of the double-stranded siRNA has a
length of 19 to 49 nucleotides.
16. The method of claim 15, wherein the first strand of the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence identity with
UAUGUGGAAGUGGCAACUG (SEQ ID NO: 53), and the second strand of the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence identity with
CAGUUGCCACUUCCACAUA (SEQ ID NO: 52).
17. The method of claim 10, the method further comprising
administering to the subject an effective amount of a second
interfering RNA having a length of 19 to 49 nucleotides and
comprising a region of at least 13 contiguous nucleotides having at
least 90% complementarity to, or at least 90% sequence identity
with, the penultimate 13 nucleotides of the 3' end of an mRNA
corresponding to any one of SEQ ID NO: 3, and SEQ ID NO:9-SEQ ID
NO:51.
18. The method of claim 10, wherein the composition is administered
via a topical, intravitreal, transcleral, periocular, conjunctival,
subtenon, intracameral, subretinal, subconjunctival, retrobulbar,
or intracanalicular route.
19. The method of claim 16, wherein the composition is administered
via a topical, intravitreal, transcleral, periocular, conjunctival,
subtenon, intracameral, subretinal, subconjunctival, retrobulbar,
or intracanalicular route.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 17/003,305, filed Aug. 26, 2020 which is a
continuation of U.S. patent application Ser. No. 16/877,764, filed
May 19, 2020 which is a continuation of U.S. patent application
Ser. No. 16/784,402, filed Feb. 7, 2020 which is a continuation of
U.S. patent application Ser. No. 16/667,345, filed Oct. 29, 2019
which is a continuation of U.S. patent application Ser. No.
16/512,744, filed Jul. 16, 2019, which is a continuation of U.S.
patent application Ser. No. 16/404,795, filed May 7, 2019, which is
a continuation of U.S. patent application Ser. No. 16/259,107,
filed Jan. 28, 2019, which is a continuation of U.S. patent
application Ser. No. 16/193,617, filed Nov. 16, 2018, which is a
continuation of Ser. No. 15/470,060, filed Mar. 27, 2017, which is
a continuation of Ser. No. 14/566,234, filed Dec. 10, 2014, which
is a divisional of U.S. patent application Ser. No. 13/904,431
filed May 29, 2013 (now U.S. Pat. No. 8,940,887), which is a
divisional of U.S. patent application Ser. No. 13/474,405 filed May
17, 2012, (now U.S. Pat. No. 8,471,000), which is a divisional of
U.S. patent application Ser. No. 13/113,782 filed May 23, 2011 (now
abandoned), which is a divisional of U.S. patent Ser. No.
12/706,014 filed Feb. 16, 2010 (now U.S. Pat. No. 7,981,870), which
claims benefit to U.S. patent application Ser. No. 11/642,016 filed
Dec. 19, 2006 (now abandoned), which claims benefit to U.S.
Provisional Patent Application Ser. No. 60/754,956 filed on Dec.
29, 2005, the disclosure of each of which is specifically
incorporated by reference herein.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of interfering
RNA compositions for inhibition of expression of hypoxia-inducible
factor-la (HIF-la), the protein encoded by HIF1A mRNA, in ocular
angiogenesis, including those cellular changes resulting from the
transcription factor activity of HIF-la that lead directly or
indirectly to ocular neovasularization, retinal edema, diabetic
retinopathy, sequela associated with retinal ischemia, posterior
segment neovascularization, and neovascular glaucoma, for
example.
BACKGROUND OF THE INVENTION
[0003] Diabetic retinopathy (DR) is an eye disease that develops in
diabetes due to changes in the cells that line blood vessels, i.e.
the retinal microvascular endothelium. During diabetes mellitus,
hyperglycemia can cause damage in a number of ways. For example,
glucose, or a metabolite of glucose, binds to the amino groups of
proteins, leading to tissue damage. In addition, excess glucose
enters the polyol pathway resulting in accumulations of sorbitol.
Sorbitol cannot be metabolized by the cells of the retina and can
contribute to high intracellular osmotic pressure, intracellular
edema, impaired diffusion, tissue hypoxia, capillary cell damage,
and capillary weakening. Diabetic retinopathy involves thickening
of capillary basement membranes which may in turn prevent
pericytes, the predominant perivascular cell type in retinal
capillaries, from contacting endothelial cells. Pericyte and
endothelial cell death occurs through an apoptotic mechanism during
diabetic retinopathy, where the loss of pericytes likely increases
the permeability of the capillaries and leads to breakdown of the
blood-retina barrier and blood flow dysregulation. Weakened
capillaries lead to aneurysm formation and further leakage. These
effects of hyperglycemia can also impair neuronal functions in the
retina. DR is associated with retinal microaneurysms, hemorrhages,
exudates, and retinitis proliferans, i.e., massive neovascular and
connective tissue growth on the inner surface of the retina.
Diabetic retinopathy may be of the background type, progressively
characterized by microaneurysms; intraretinal punctate hemorrhages;
yellow, waxy exudates; cotton-wool patches; and macular edema. This
is an early stage of diabetic retinopathy termed nonproliferative
diabetic retinopathy.
[0004] As the diabetes-induced microvascular pathology progress,
retinal capillaries eventually become occluded and lead to
multifocal areas of ischemia hypoxia within the retina. Hypoxic
conditions in the non-perfused tissue causes an increase in
HIF-1.alpha. levels. The resulting changes in HIF-1-mediated gene
expression elicits the production of growth factors capable of
stimulating abnormal new blood vessel growth from existing vessels
(angiogenesis). These pathologic new blood vessels grow into the
vitreous and can cause loss of sight, a condition called
proliferative diabetic retinopathy (PDR), since the new blood
vessels are fragile and tend to leak blood into the eye. The
proliferative type of DR is characterized by neovascularization of
the retina and optic disk which may project into the vitreous,
proliferation of fibrous tissue, vitreous hemorrhage, and retinal
detachment.
[0005] Neovascularization also occurs in a type of glaucoma called
neovascular glaucoma in which increased intraocular pressure is
caused by growth of connective tissue and new blood vessels upon
the trabecular meshwork. Neovascular glaucoma is a form of
secondary glaucoma caused by neovascularization in the chamber
angle.
[0006] Posterior segment neovascularization (PSNV) is a
vision-threatening pathology responsible for the two most common
causes of acquired blindness in developed countries: exudative
age-related macular degeneration (AMD) and PDR. Until recently, the
only approved treatments for PSNV that occurs during exudative AMD
were laser photocoagulation or photodynamic therapy with
VISUDYNE.TM.. Both therapies involve occlusion of affected
vasculature, which results in permanent, laser-induced damage to
the retina, and does not address the underlying cause of
neovascularization. Recurrence of neovascularization from the same
area is common. For patients with PDR, surgical interventions with
vitrectomy and removal of preretinal membranes are the only options
currently available, as well as a laser therapy called panretinal
photocoagulation to prevent the production of more new vessels.
[0007] Current pharmaceutical efforts have focused on inhibiting
the effects of potent angiogenic factors such as VEGF, a gene that
is regulated by HIF-1. Recently, intravitreal injection of
LUCENTIS.TM., an anti-VEGF antibody fragment, was approved for
treatment of AMD. This antibody fragment was designed to bind to
and inhibit VEGF to inhibit the formation of new blood vessels.
Lucentis is also in clinical trials for the treatment of diabetic
macular edema. Other approaches include the use of small
interfering RNA targeting VEGF or its receptor.
[0008] Disruption of the interaction between the HIF-1
transcription factor and the hypoxia response element in oxygen
sensitive promoters using conventional small molecule inhibitors is
likely to be very difficult. Like VEGF, HIF1A is not considered to
be "druggable" in the classical sense. Furthermore, the silencing
of individual downstream effectors of HIF-1, such as VEGF or
RTP801, may only partially block neovascularization.
[0009] The present invention addresses the above-cited problems and
provides interfering RNAs targeting HIF1A, the transcriptional
control gene for downstream genes involved in angiogenesis and
vascular permeability (edema).
SUMMARY OF THE INVENTION
[0010] The present invention is directed to interfering RNAs that
silence HIF1A mRNA expression, thus decreasing transcriptional
activity of HIF-1 inducible genes and treating ocular angiogenesis
by effecting a lowering of ocular pre-angiogenic and angiogenic
cellular activity.
[0011] The term "ocular angiogenesis," as used herein, includes
ocular pre-angiogenic conditions and ocular angiogenic conditions,
and includes those cellular changes resulting from the expression
of HIF1-inducible genes that lead directly or indirectly to ocular
angiogenesis, ocular neovasularization, retinal edema, diabetic
retinopathy, sequela associated with retinal ischemia, PSNV, and
neovascular glaucoma, for example. The interfering RNAs of the
invention are useful for treating patients with ocular
angiogenesis, ocular neovasularization, retinal edema, diabetic
retinopathy, sequela associated with retinal ischemia, posterior
segment neovascularization (PSNV), and neovascular glaucoma, or
patients at risk of developing such conditions, for example.
[0012] An embodiment of the present invention provides a method of
attenuating expression of an HIF1A target mRNA in a subject. The
method comprises administering to the subject a composition
comprising an effective amount of interfering RNA having a length
of 19 to 49 nucleotides and a pharmaceutically acceptable carrier.
In one embodiment, administration is to an eye of the subject for
attenuating expression of an ocular angiogenesis target in a
human.
[0013] In one embodiment of the invention, the interfering RNA
comprises a sense nucleotide strand, an antisense nucleotide strand
and a region of at least near-perfect contiguous complementarity of
at least 19 nucleotides. Further, the antisense strand hybridizes
under physiological conditions to a portion of an mRNA
corresponding to SEQ ID NO:1 or SEQ ID NO:2 which are the sense
cDNA sequences encoding HIF1A variant 1 and variant 2, respectively
(GenBank accession no. NM_001530 and NM_181054, respectively). The
antisense strand has a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides with the hybridizing
portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:2,
respectively. The administration of such a composition attenuates
the expression of an HIF1A target of the subject.
[0014] In one embodiment of the invention, an interfering RNA is
designed to target an mRNA corresponding to SEQ ID NO:1 comprising
nucleotide 411, 580, 583, 868, 869, 1099, 1100, 1242, 1302, 1371,
1396, 1559, 1560, 1809, 2085, 2087, 2105, 2138, 2256, 2358, 2422,
2636, 2666, 2743, 2858, 2861, 3135, 3544, 3554, 1943, 1791, 2351,
or 1408.
[0015] In another embodiment of the invention, an interfering RNA
is designed to target an mRNA corresponding to SEQ ID NO:2
comprising nucleotide 2360, 2411, 2420, 2536, 2539, 2545, 2616,
2731, 2734, 3008, or 3427.
[0016] The present invention further provides for administering a
second interfering RNA to a subject in addition to a first
interfering RNA. The method comprises administering to the subject
a second interfering RNA having a length of 19 to 49 nucleotides
and comprising a sense nucleotide strand, an antisense nucleotide
strand, and a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides; wherein the antisense
strand of the second interfering RNA hybridizes under physiological
conditions to a second portion of mRNA corresponding to SEQ ID NO:1
or SEQ ID NO:2 and the antisense strand has a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides
with the second hybridizing portion of mRNA corresponding to SEQ ID
NO:1 or SEQ ID NO:2, respectively. Further, a third, fourth, or
fifth, etc. interfering RNA may be administered in a similar
manner.
[0017] Another embodiment of the invention is a method of
attenuating expression of HIF1A in a subject comprising
administering to the subject a composition comprising an effective
amount of single-stranded interfering RNA having a length of 19 to
49 nucleotides and a pharmaceutically acceptable carrier.
[0018] For attenuating expression of HIF1A, the single-stranded
interfering RNA hybridizes under physiological conditions to a
portion of mRNA corresponding to SEQ ID NO:1 comprising nucleotide
411, 580, 583, 868, 869, 1099, 1100, 1242, 1302, 1371, 1396, 1559,
1560, 1809, 2085, 2087, 2105, 2138, 2256, 2358, 2422, 2636, 2666,
2743, 2858, 2861, 3135, 3544, 3554, 1943, 1791, 2351, or 1408, and
the interfering RNA has a region of at least near-perfect
contiguous complementarity of at least 19 nucleotides with the
hybridizing portion of mRNA corresponding to SEQ ID NO:1. In
another embodiment, for attenuating expression of HIF1A, the
single-stranded interfering RNA hybridizes under physiological
conditions to a portion of mRNA corresponding to SEQ ID NO:2
comprising nucleotide 2360, 2411, 2420, 2536, 2539, 2545, 2616,
2731, 2734, 3008, or 3427. Expression of HIF1A is thereby
attenuated.
[0019] A further embodiment of the invention is a method of
treating ocular angiogenesis in a subject in need thereof. The
method comprises administering to an eye of the subject a
composition comprising an effective amount of interfering RNA
having a length of 19 to 49 nucleotides and a pharmaceutically
acceptable carrier, the interfering RNA comprising a sense
nucleotide strand, an antisense nucleotide strand, and a region of
at least near-perfect contiguous complementarity of at least 19
nucleotides. The antisense strand hybridizes under physiological
conditions to a portion of mRNA corresponding to SEQ ID NO:1 or SEQ
ID NO:2 and has a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides with the hybridizing
portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:2,
respectively. The ocular angiogenesis is treated thereby.
[0020] Another embodiment of the invention is a method of treating
ocular angiogenesis in a subject in need thereof, the method
comprising administering to an eye of the subject a composition
comprising an effective amount of interfering RNA having a length
of 19 to 49 nucleotides and a pharmaceutically acceptable carrier,
the interfering RNA comprising a region of at least 13 contiguous
nucleotides having at least 90% sequence complementarity to, or at
least 90% sequence identity with, the penultimate 13 nucleotides of
the 3' end of an mRNA corresponding to any one of SEQ ID NO:3 and
SEQ ID NO:9-SEQ ID NO:51, wherein the ocular angiogenesis is
treated thereby.
[0021] Another embodiment of the invention is a method of
attenuating expression of an HIF1A target mRNA in a subject,
comprising administering to the subject a composition comprising an
effective amount of interfering RNA having a length of 19 to 49
nucleotides and a pharmaceutically acceptable carrier, where the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence complementarity to, or at
least 90% sequence identity with, the penultimate 13 nucleotides of
the 3' end of an mRNA corresponding to any one of SEQ ID NO:3 and
SEQ ID NO:9-SEQ ID NO:51.
[0022] In a further embodiment of the present invention, the region
of contiguous nucleotides is a region of at least 14 contiguous
nucleotides having at least 85% sequence complementarity to, or at
least 85% sequence identity with, the penultimate 14 nucleotides of
the 3' end of an mRNA corresponding to the sequence of the sequence
identifier. In yet another embodiment of the invention, the region
of contiguous nucleotides is a region of at least 15, 16, 17, or 18
contiguous nucleotides having at least 80% sequence complementarity
to, or at least 80% sequence identity with, the penultimate 15, 16,
17, or 18 nucleotides, respectively, of the 3' end of an mRNA
corresponding to the sequence identified by the sequence
identifier.
[0023] A further embodiment of the invention is a method of
treating ocular angiogenesis in a subject in need thereof, the
method comprising administering to the subject a composition
comprising a double stranded siRNA molecule that down regulates
expression of a HIF1A gene via RNA interference, wherein each
strand of the siRNA molecule is independently about 19 to about 27
nucleotides in length; and one strand of the siRNA molecule
comprises a nucleotide sequence having substantial complementarity
to an mRNA corresponding to the HIF1A gene, respectively, so that
the siRNA molecule directs cleavage of the mRNA via RNA
interference.
[0024] A composition comprising interfering RNA having a length of
19 to 49 nucleotides and having a nucleotide sequence of any one of
SEQ ID NO:3, and SEQ ID NO:9-SEQ ID NO:51, or a complement thereof,
and a pharmaceutically acceptable carrier is an embodiment of the
present invention. In one embodiment, the interfering RNA is
isolated. The term "isolated" means that the interfering RNA is
free of its total natural mileau.
[0025] Another embodiment of the invention is a composition
comprising a double stranded siRNA molecule that down regulates
expression of a HIF1A gene via RNA interference, wherein each
strand of the siRNA molecule is independently about 19 to about 27
nucleotides in length; and one strand of the siRNA molecule
comprises a nucleotide sequence has substantial complementarity to
an mRNA corresponding to the HIF1A gene, respectively, so that the
siRNA molecule directs cleavage of the mRNA via RNA
interference.
[0026] Use of any of the embodiments as described herein in the
preparation of a medicament for attenuating expression of HIF1A
mRNA is also an embodiment of the present invention.
BRIEF DESCRIPTION OF THE DRAWING
[0027] The FIGURE provides a HIF-la western blot of HeLa cells
transfected with HIF1A siRNAs #1, #3, #5, and #6, and a RISC-free
control siRNA, each at 10 nM, 1 nM, and 0.1 nM; a non-targeting
control siRNA (NTC2) at 10 nM; and a buffer control (-siRNA). The
arrows indicate the positions of the 93-kDa HIF-1.alpha. protein
and the 42-kDa actin protein bands.
DETAILED DESCRIPTION OF THE INVENTION
[0028] RNA interference (RNAi) is a process by which
double-stranded RNA (dsRNA) is used to silence gene expression.
While not wanting to be bound by theory, RNAi begins with the
cleavage of longer dsRNAs into small interfering RNAs (siRNAs) by
an RNaseIII-like enzyme, dicer. SiRNAs are dsRNAs that are usually
about 19 to 28 nucleotides, or 20 to 25 nucleotides, or 21 to 22
nucleotides in length and often contain 2-nucleotide 3' overhangs,
and 5' phosphate and 3' hydroxyl termini. One strand of the siRNA
is incorporated into a ribonucleoprotein complex known as the
RNA-induced silencing complex (RISC). RISC uses this siRNA strand
to identify mRNA molecules that are at least partially
complementary to the incorporated siRNA strand, and then cleaves
these target mRNAs or inhibits their translation. Therefore, the
siRNA strand that is incorporated into RISC is known as the guide
strand or the antisense strand. The other siRNA strand, known as
the passenger strand or the sense strand, is eliminated from the
siRNA and is at least partially homologous to the target mRNA.
Those of skill in the art will recognize that, in principle, either
strand of an siRNA can be incorporated into RISC and function as a
guide strand. However, siRNA design (e.g., decreased siRNA duplex
stability at the 5' end of the antisense strand) can favor
incorporation of the antisense strand into RISC.
[0029] RISC-mediated cleavage of mRNAs having a sequence at least
partially complementary to the guide strand leads to a decrease in
the steady state level of that mRNA and of the corresponding
protein encoded by this mRNA. Alternatively, RISC can also decrease
expression of the corresponding protein via translational
repression without cleavage of the target mRNA. Other RNA molecules
and RNA-like molecules can also interact with RISC and silence gene
expression. Examples of other RNA molecules that can interact with
RISC include short hairpin RNAs (shRNAs), single-stranded siRNAs,
microRNAs (miRNAs), and dicer-substrate 27-mer duplexes. The term
"siRNA" as used herein refers to a double-stranded interfering RNA
unless otherwise noted. Examples of RNA-like molecules that can
interact with RISC include RNA molecules containing one or more
chemically modified nucleotides, one or more deoxyribonucleotides,
and/or one or more non-phosphodiester linkages. For purposes of the
present discussion, all RNA or RNA-like molecules that can interact
with RISC and participate in RISC-mediated changes in gene
expression will be referred to as "interfering RNAs." SiRNAs,
shRNAs, miRNAs, and dicer-substrate 27-mer duplexes are, therefore,
subsets of "interfering RNAs."
[0030] Interfering RNA of embodiments of the invention appear to
act in a catalytic manner for cleavage of target mRNA, i.e.,
interfering RNA is able to effect inhibition of target mRNA in
substoichiometric amounts. As compared to antisense therapies,
significantly less interfering RNA is required to provide a
therapeutic effect under such cleavage conditions.
[0031] The present invention relates to the use of interfering RNA
to inhibit the expression of hypoxia-inducible factor 1A (HIF1A),
thus interfering with transcription of a number of genes that would
otherwise be induced in response to reduced oxygen tension.
According to the present invention, interfering RNAs as set forth
herein, provided exogenously or expressed endogenously, are
particularly effective at silencing of HIF1A mRNA.
[0032] Nucleic acid sequences cited herein are written in a 5' to
3' direction unless indicated otherwise. The term "nucleic acid,"
as used herein, refers to either DNA or RNA or a modified form
thereof comprising the purine or pyrimidine bases present in DNA
(adenine "A," cytosine "C," guanine "G," thymine "T") or in RNA
(adenine "A," cytosine "C," guanine "G," uracil "U"). Interfering
RNAs provided herein may comprise "T" bases, particularly at 3'
ends, even though "T" bases do not naturally occur in RNA. "Nucleic
acid" includes the terms "oligonucleotide" and "polynucleotide" and
can refer to a single-stranded molecule or a double-stranded
molecule. A double-stranded molecule is formed by Watson-Crick base
pairing between A and T bases, C and G bases, and between A and U
bases. The strands of a double-stranded molecule may have partial,
substantial or full complementarity to each other and will form a
duplex hybrid, the strength of bonding of which is dependent upon
the nature and degree of complementarity of the sequence of
bases.
[0033] An mRNA sequence is readily deduced from the sequence of the
corresponding DNA sequence. For example, SEQ ID NO:1 provides the
sense strand sequence of DNA corresponding to the mRNA for HIF1A
variant 1. The mRNA sequence is identical to the DNA sense strand
sequence with the "T" bases replaced with "U" bases. Therefore, the
mRNA sequence of HIF1A variant 1 is known from SEQ ID NO:1 and the
mRNA sequence of HIF1A variant 2 is known from SEQ ID NO:2.
[0034] Hypoxia-Inducible Factor-1 mRNA (HIF1A variant 1 and variant
2): Hypoxia-inducible factor (HIF-1) is a transcription factor that
is responsible for changes in expression in a number of genes in
response to reduced oxygen tension. HIF-1 is a heterodimer composed
of alpha and beta subunits encoded by HIF1A and ARNT, respectively.
At least two HIF-1-inducible genes have been implicated in
pathological neovascularization in the retina including VEGF and
RTP801 (REDD1). Therefore, inhibition of expression of HIF1A is
provided herein to attenuate transcription of such genes and
activity of the gene products.
[0035] The GenBank database of the National Center for
Biotechnology Information at ncbi.nlm.nih.gov provides the DNA
sequence for HIF1A variant 1 as accession no. NM_001530, provided
in the "Sequence Listing" as SEQ ID NO:1. SEQ ID NO:1 provides the
sense strand sequence of DNA that corresponds to the mRNA encoding
HIF1A variant 1 (with the exception of "T" bases for "U" bases).
The coding sequence for HIF1A variant 1 is from nucleotides
285-2765.
[0036] Equivalents of the above-cited HIF1A variant 1 mRNA sequence
are alternative splice forms, allelic forms, isozymes, or a cognate
thereof. A cognate is an HIF1A mRNA from another mammalian species
that is homologous to SEQ ID NO:1 (an ortholog).
[0037] The GenBank database of the National Center for
Biotechnology Information at ncbi.nlm.nih.gov provides the DNA
sequence for HIF1A variant 2 as accession no. NM_181054, provided
in the "Sequence Listing" as SEQ ID NO:2. SEQ ID NO:2 provides the
sense strand sequence of DNA that corresponds to the mRNA encoding
HIF1A variant 2 (with the exception of "T" bases for "U" bases).
The coding sequence for HIF1A variant 2 is from nucleotides
285-2492.
[0038] Equivalents of the above-cited HIF1A variant 2 mRNA sequence
are alternative splice forms, allelic forms, isozymes, or a cognate
thereof. A cognate is an HIF1A variant 2 mRNA from another
mammalian species that is homologous to SEQ ID NO:2 (an
ortholog).
[0039] Attenuating expression of an mRNA: The phrase, "attenuating
expression of an mRNA," as used herein, means administering or
expressing an amount of interfering RNA (e.g., an siRNA) to reduce
translation of the target mRNA into protein, either through mRNA
cleavage or through direct inhibition of translation. The reduction
in expression of the target mRNA or the corresponding protein is
commonly referred to as "knock-down" and is reported relative to
levels present following administration or expression of a
non-targeting control RNA (e.g., a non-targeting control siRNA).
Knock-down of expression of an amount including and between 50% and
100% is contemplated by embodiments herein. However, it is not
necessary that such knock-down levels be achieved for purposes of
the present invention. In one embodiment, a single interfering RNA
targeting the HIF1A mRNA is administered to decrease production of
HIF1A. In other embodiments, two or more interfering RNAs targeting
the HIF1A target are administered to decrease expression. In still
other embodiments, a first interfering RNA targeting the HIF1A
variant 1 target and a second interfering RNA targeting the HIF1A
variant 2 target are administered to decrease HIF1A expression.
[0040] Knock-down is commonly assessed by measuring the mRNA levels
using quantitative polymerase chain reaction (qPCR) amplification
or by measuring protein levels by western blot or enzyme-linked
immunosorbent assay (ELISA). Analyzing the protein level provides
an assessment of both mRNA cleavage as well as translation
inhibition. Further techniques for measuring knock-down include RNA
solution hybridization, nuclease protection, northern
hybridization, gene expression monitoring with a microarray,
antibody binding, radioimmunoassay, and fluorescence activated cell
analysis.
[0041] Inhibition of targets cited herein is also inferred in a
human or mammal by observing an improvement in an ocular
angiogenesis symptom such as improvement in retinal edema, diabetic
retinopathy, retinal ischemia, or in posterior segment
neovascularization (PSNV), for example.
[0042] Interfering RNA: In one embodiment of the invention,
interfering RNA (e.g., siRNA) has a sense strand and an antisense
strand, and the sense and antisense strands comprise a region of at
least near-perfect contiguous complementarity of at least 19
nucleotides. In a further embodiment of the invention, interfering
RNA (e.g., siRNA) has a sense strand and an antisense strand, and
the antisense strand comprises a region of at least near-perfect
contiguous complementarity of at least 19 nucleotides to a target
sequence of HIF1A mRNA, and the sense strand comprises a region of
at least near-perfect contiguous identity of at least 19
nucleotides with a target sequence of HIF1A mRNA, respectively. In
a further embodiment of the invention, the interfering RNA
comprises a region of at least 13, 14, 15, 16, 17, or 18 contiguous
nucleotides having percentages of sequence complementarity to or,
having percentages of sequence identity with, the penultimate 13,
14, 15, 16, 17, or 18 nucleotides, respectively, of the 3' end of
the corresponding target sequence within an mRNA.
[0043] The length of each strand of the interfering RNA comprises
19 to 49 nucleotides, and may comprise a length of 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides.
[0044] The antisense strand of an siRNA is the active guiding agent
of the siRNA in that the antisense strand is incorporated into
RISC, thus allowing RISC to identify target mRNAs with at least
partial complementary to the antisense siRNA strand for cleavage or
translational repression.
[0045] In embodiments of the present invention, interfering RNA
target sequences (e.g., siRNA target sequences) within a target
mRNA sequence are selected using available design tools.
Interfering RNAs corresponding to a HIF1A target sequence are then
tested by transfection of cells expressing the target mRNA followed
by assessment of knockdown as described above.
[0046] Techniques for selecting target sequences for siRNAs are
provided by Tuschl, T. et al., "The siRNA User Guide," revised May
6, 2004, available on the Rockefeller University web site; by
Technical Bulletin #506, "siRNA Design Guidelines," Ambion Inc. at
Ambion's web site; and by other web-based design tools at, for
example, the Invitrogen, Dharmacon, Integrated DNA Technologies,
Genscript, or Proligo web sites. Initial search parameters can
include G/C contents between 35% and 55% and siRNA lengths between
19 and 27 nucleotides. The target sequence may be located in the
coding region or in the 5' or 3' untranslated regions of the
mRNA.
[0047] An embodiment of a 19-nucleotide DNA target sequence common
to HIF1A variant 1 and HIV1A variant 2 is present at nucleotides
411 to 429 of SEQ ID NO:1:
TABLE-US-00001 SEQ ID NO: 3 5'- CAGTTGCCACTTCCACATA -3'.
An siRNA of the invention for targeting a corresponding mRNA
sequence of SEQ ID NO:3 and having 21-nucleotide strands and a
2-nucleotide 3' overhang is:
TABLE-US-00002 SEQ ID NO: 4 5'-CAGUUGCCACUUCCACAUANN -3' SEQ ID NO:
5 3'- NNGUCAACGGUGAAGGUGUAU -5'.
Each "N" residue can be any nucleotide (A, C, G, U, T) or modified
nucleotide. The 3' end can have a number of "N" residues between
and including 1, 2, 3, 4, 5, and 6. The "N" residues on either
strand can be the same residue (e.g., UU, AA, CC, GG, or TT) or
they can be different (e.g., AC, AG, AU, CA, CG, CU, GA, GC, GU,
UA, UC, or UG). The 3' overhangs can be the same or they can be
different. In one embodiment, both strands have a 3'UU
overhang.
[0048] An siRNA of the invention for targeting a corresponding mRNA
sequence of SEQ ID NO:3 and having 21-nucleotide strands and a 3'UU
overhang on each strand is:
TABLE-US-00003 SEQ ID NO: 6 5'- CAGUUGCCACUUCCACAUAUU -3' SEQ ID
NO: 7 3'- UUGUCAACGGUGAAGGUGUAU -5'.
The interfering RNA may also have a 5' overhang of nucleotides or
it may have blunt ends. An siRNA of the invention for targeting a
corresponding mRNA sequence of SEQ ID NO:3 and having 19-nucleotide
strands and blunt ends is:
TABLE-US-00004 SEQ ID NO: 52 5'- CAGUUGCCACUUCCACAUA -3' SEQ ID NO:
53 3'- GUCAACGGUGAAGGUGUAU -5'.
[0049] The strands of a double-stranded interfering RNA (e.g., an
siRNA) may be connected to form a hairpin or stem-loop structure
(e.g., an shRNA). An shRNA of the invention targeting a
corresponding mRNA sequence of SEQ ID NO:1 and having a 19 bp
double-stranded stem region and a 3'UU overhang is:
##STR00001##
N is a nucleotide A, T, C, G, U, or a modified form known by one of
ordinary skill in the art. The number of nucleotides N in the loop
is a number between and including 3 to 23, or 5 to 15, or 7 to 13,
or 4 to 9, or 9 to 11, or the number of nucleotides N is 9. Some of
the nucleotides in the loop can be involved in base-pair
interactions with other nucleotides in the loop. Examples of
oligonucleotide sequences that can be used to form the loop include
5'-UUCAAGAGA-3' (Brummelkamp, T. R. et al. (2002) Science 296: 550)
and 5'-UUUGUGUAG-3' (Castanotto, D. et al. (2002) RNA 8:1454). It
will be recognized by one of skill in the art that the resulting
single chain oligonucleotide forms a stem-loop or hairpin structure
comprising a double-stranded region capable of interacting with the
RNAi machinery.
[0050] The siRNA target sequence identified above can be extended
at the 3' end to facilitate the design of dicer-substrate 27-mer
duplexes. Extension of the 19-nucleotide DNA target sequence (SEQ
ID NO:3) identified in the HIF1A DNA sequence (SEQ ID NO:1) by 6
nucleotides yields a 25-nucleotide DNA target sequence present at
nucleotides 411 to 435 of SEQ ID NO:1:
TABLE-US-00005 SEQ ID NO:54 5'- CAGTTGCCACTTCCACATAATGTGA -3'.
A dicer-substrate 27-mer duplex of the invention for targeting a
corresponding mRNA sequence of SEQ ID NO:54 is:
TABLE-US-00006 SEQ ID NO: 55 5'- CAGUUGCCACUUCCACAUAAUGUGA -3' SEQ
ID NO: 56 3'- UUGUCAACGGUGAAGGUGUAUUACACU -5'.
The two nucleotides at the 3' end of the sense strand (i.e., the GA
nucleotides of SEQ ID NO:55) may be deoxynucleotides for enhanced
processing. Design of dicer-substrate 27-mer duplexes from 19-21
nucleotide target sequences, such as provided herein, is further
discussed by the Integrated DNA Technologies (IDT) website and by
Kim, D.-H. et al., (February, 2005) Nature Biotechnology 23:2;
222-226.
[0051] When interfering RNAs are produced by chemical synthesis,
phosphorylation at the 5' position of the nucleotide at the 5' end
of one or both strands (when present) can enhance siRNA efficacy
and specificity of the bound RISC complex but is not required since
phosphorylation can occur intracellularly.
[0052] Table 1 lists examples of HIF1A variant 1 and variant 2 DNA
target sequences of SEQ ID NO:1 and SEQ ID NO:2, respectively, from
which siRNAs of the present invention are designed in a manner as
set forth above. HIF1A encodes hypoxia-inducible factor 1 alpha, as
noted above.
TABLE-US-00007 TABLE 1 HIF1A Target Sequences for siRNAs HIFLA
variant 1 and # of Starting variant 2 Target Nucleotide with SEQ
Sequences reference to ID in Common SEQ ID NO: 1 NO:
CAGTTGCCACTTCCACATA 411 3 TTGTTATGGTTCTCACAGA 580 9
TTATGGTTCTCACAGATGA 583 10 CAGGCCACATTCACGTATA 868 11
AGGCCACATTCACGTATAT 869 12 GCCGCTCAATTTATGAATA 1099 13
CCGCTCAATTTATGAATAT 1100 14 CAAGCAACTGTCATATATA 1242 15
TACGTTGTGAGTGGTATTA 1302 16 CCGGTTGAATCTTCAGATA 1371 17
TGACTCAGCTATTCACCAA 1396 18 TGAGGAAGTACCATTATAT 1559 19
GAGGAAGTACCATTATATA 1560 20 AGTTCACCTGAGCCTAATA 1809 21
GTATTCCAGCAGACTCAAA 2085 22 ATTCCAGCAGACTCAAATA 2087 23
ACAAGAACCTACTGCTAAT 2105 24 TGCCACCACTGATGAATTA 2138 25
CCATATAGAGATACTCAAA 2256 26 TCTGTCGCTTTGAGTCAAA 2358 27
TGCAGAATGCTCAGAGAAA 2422 28 GGACACAGATTTAGACTTG 1943 48
GATGGAAGCACTAGACAAA 1791 49 CGTGTTATCTGTCGCTTTG 2351 50
TCACCAAAGTTGAATCAGA 1408 51 # of Starting HIFLA variant 1
Nucleotide with SEQ Target reference to ID Sequence SEQ ID NO: 1
NO: GCAATCAATGGATGAAAGT 2636 29 GCTGACCAGTTATGATTGT 2666 30
GAGCTTTGGATCAAGTTAA 2743 31 TGGCTACAATACTGCACAA 2858 32
CTACAATACTGCACAAACT 2861 33 ATGATCATAGGCAGTTGAA 3135 34
CTATGTAGTTGTGGAAGTT 3544 35 GTGGAAGTTTATGCTAATA 3554 36 # of
Starting HIFLA variant 2 Nucleotide SEQ Target with reference ID
Sequence to SEQ ID NO: 2 NO: TGTCGCTTTGAGTCAAAGA 2360 37
GATACTAGCTTTGCAGAAT 2411 38 TTTGCAGAATGCTCAGAGA 2420 39
ACAGCTGACCAGTTATGAT 2536 40 GCTGACCAGTTATGATTGT 2539 41
CAGTTATGATTGTGAAGTT 2545 42 GAGCTTTGGATCAAGTTAA 2616 43
TGGCTACAATACTGCACAA 2731 44 CTACAATACTGCACAAACT 2734 45
ATGATCATAGGCAGTTGAA 3008 46 GTGGAAGTTTATGCTAATA 3427 47
[0053] As cited in the examples above, one of skill in the art is
able to use the target sequence information provided in Table 1 to
design interfering RNAs having a length shorter or longer than the
sequences provided in the table and by referring to the sequence
position in SEQ ID NO:1 or SEQ ID NO:2 and adding or deleting
nucleotides complementary or near complementary to SEQ ID NO:1 or
SEQ ID NO:2 respectively.
[0054] The target RNA cleavage reaction guided by siRNAs and other
forms of interfering RNA is highly sequence specific. In general,
siRNA containing a sense nucleotide strand identical in sequence to
a portion of the target mRNA and an antisense nucleotide strand
exactly complementary to a portion of the target mRNA are siRNA
embodiments for inhibition of mRNAs cited herein. However, 100%
sequence complementarity between the antisense siRNA strand and the
target mRNA, or between the antisense siRNA strand and the sense
siRNA strand, is not required to practice the present invention.
Thus, for example, the invention allows for sequence variations
that might be expected due to genetic mutation, strain
polymorphism, or evolutionary divergence.
[0055] In one embodiment of the invention, the antisense strand of
the siRNA has at least near-perfect contiguous complementarity of
at least 19 nucleotides with the target mRNA. "Near-perfect," as
used herein, means the antisense strand of the siRNA is
"substantially complementary to," and the sense strand of the siRNA
is "substantially identical to" at least a portion of the target
mRNA. "Identity," as known by one of ordinary skill in the art, is
the degree of sequence relatedness between nucleotide sequences as
determined by matching the order and identity of nucleotides
between the sequences. In one embodiment, the antisense strand of
an siRNA having 80% and between 80% up to 100% complementarity, for
example, 85%, 90% or 95% complementarity, to the target mRNA
sequence are considered near-perfect complementarity and may be
used in the present invention. "Perfect" contiguous complementarity
is standard Watson-Crick base pairing of adjacent base pairs. "At
least near-perfect" contiguous complementarity includes "perfect"
complementarity as used herein. Computer methods for determining
identity or complementarity are designed to identify the greatest
degree of matching of nucleotide sequences, for example, BLASTN
(Altschul, S. F., et al. (1990) J. Mol. Biol. 215:403-410).
[0056] The term "percent identity" describes the percentage of
contiguous nucleotides in a first nucleic acid molecule that is the
same as in a set of contiguous nucleotides of the same length in a
second nucleic acid molecule. The term "percent complementarity"
describes the percentage of contiguous nucleotides in a first
nucleic acid molecule that can base pair in the Watson-Crick sense
with a set of contiguous nucleotides in a second nucleic acid
molecule.
[0057] The relationship between a target mRNA (sense strand) and
one strand of an siRNA (the sense strand) is that of identity. The
sense strand of an siRNA is also called a passenger strand, if
present. The relationship between a target mRNA (sense strand) and
the other strand of an siRNA (the antisense strand) is that of
complementarity. The antisense strand of an siRNA is also called a
guide strand.
[0058] The penultimate base in a nucleic acid sequence that is
written in a 5' to 3' direction is the next to the last base, i.e.,
the base next to the 3' base. The penultimate 13 bases of a nucleic
acid sequence written in a 5' to 3' direction are the last 13 bases
of a sequence next to the 3' base and not including the 3' base.
Similarly, the penultimate 14, 15, 16, 17, or 18 bases of a nucleic
acid sequence written in a 5' to 3' direction are the last 14, 15,
16, 17, or 18 bases of a sequence, respectively, next to the 3'
base and not including the 3' base.
[0059] The phrase "a region of at least 13 contiguous nucleotides
having at least 90% sequence complementarity to, or at least 90%
sequence identity with, the penultimate 13 nucleotides of the 3'
end of an mRNA corresponding to any one of (a sequence identifier)"
allows a one nucleotide substitution. Two nucleotide substitutions
(i.e., 11/13=85% identity/complementarity) are not included in such
a phrase.
[0060] In one embodiment of the invention, the region of contiguous
nucleotides is a region of at least 14 contiguous nucleotides
having at least 85% sequence complementarity to, or at least 85%
sequence identity with, the penultimate 14 nucleotides of the 3'
end of an mRNA corresponding to the sequence identified by each
sequence identifier. Two nucleotide substitutions (i.e., 12/14=86%
identity/complementarity) are included in such a phrase.
[0061] In a further embodiment of the invention, the region of
contiguous nucleotides is a region of at least 15, 16, 17, or 18
contiguous nucleotides having at least 80% sequence complementarity
to, or at least 80% sequence identity with, the penultimate 14
nucleotides of the 3' end of an mRNA corresponding to the sequence
of the sequence identifier. Three nucleotide substitutions are
included in such a phrase.
[0062] The target sequence in the mRNAs corresponding to SEQ ID
NO:1 or SEQ ID NO:2 may be in the 5' or 3' untranslated regions of
the mRNA as well as in the coding region of the mRNA.
[0063] One or both of the strands of double-stranded interfering
RNA may have a 3' overhang of from 1 to 6 nucleotides, which may be
ribonucleotides or deoxyribonucleotides or a mixture thereof. The
nucleotides of the overhang are not base-paired. In one embodiment
of the invention, the interfering RNA comprises a 3' overhang of TT
or UU. In another embodiment of the invention, the interfering RNA
comprises at least one blunt end. The termini usually have a 5'
phosphate group or a 3' hydroxyl group. In other embodiments, the
antisense strand has a 5' phosphate group, and the sense strand has
a 5' hydroxyl group. In still other embodiments, the termini are
further modified by covalent addition of other molecules or
functional groups.
[0064] The sense and antisense strands of the double-stranded siRNA
may be in a duplex formation of two single strands as described
above or may be a single molecule where the regions of
complementarity are base-paired and are covalently linked by a
hairpin loop so as to form a single strand. It is believed that the
hairpin is cleaved intracellularly by a protein termed dicer to
form an interfering RNA of two individual base-paired RNA
molecules.
[0065] Interfering RNAs may differ from naturally-occurring RNA by
the addition, deletion, substitution or modification of one or more
nucleotides. Non-nucleotide material may be bound to the
interfering RNA, either at the 5' end, the 3' end, or internally.
Such modifications are commonly designed to increase the nuclease
resistance of the interfering RNAs, to improve cellular uptake, to
enhance cellular targeting, to assist in tracing the interfering
RNA, to further improve stability, or to reduce the potential for
activation of the interferon pathway. For example, interfering RNAs
may comprise a purine nucleotide at the ends of overhangs.
Conjugation of cholesterol to the 3' end of the sense strand of an
siRNA molecule by means of a pyrrolidine linker, for example, also
provides stability to an siRNA. [0001] Further modifications
include a 3' terminal biotin molecule, a peptide known to have
cell-penetrating properties, a nanoparticle, a peptidomimetic, a
fluorescent dye, or a dendrimer, for example.
[0066] Nucleotides may be modified on their base portion, on their
sugar portion, or on the phosphate portion of the molecule and
function in embodiments of the present invention. Modifications
include substitutions with alkyl, alkoxy, amino, deaza, halo,
hydroxyl, thiol groups, or a combination thereof, for example.
Nucleotides may be substituted with analogs with greater stability
such as replacing a ribonucleotide with a deoxyribonucleotide, or
having sugar modifications such as 2' OH groups replaced by 2'
amino groups, 2' O-methyl groups, 2' methoxyethyl groups, or a
2'-O, 4'-C methylene bridge, for example. Examples of a purine or
pyrimidine analog of nucleotides include a xanthine, a
hypoxanthine, an azapurine, a methylthioadenine, 7-deaza-adenosine
and O- and N-modified nucleotides. The phosphate group of the
nucleotide may be modified by substituting one or more of the
oxygens of the phosphate group with nitrogen or with sulfur
(phosphorothioates). Modifications are useful, for example, to
enhance function, to improve stability or permeability, or to
direct localization or targeting.
[0067] There may be a region or regions of the antisense
interfering RNA strand that is (are) not complementary to a portion
of SEQ ID NO:1 or SEQ ID NO:2. Non-complementary regions may be at
the 3', 5' or both ends of a complementary region or between two
complementary regions.
[0068] Interfering RNAs may be generated exogenously by chemical
synthesis, by in vitro transcription, or by cleavage of longer
double-stranded RNA with dicer or another appropriate nuclease with
similar activity. Chemically synthesized interfering RNAs, produced
from protected ribonucleoside phosphoramidites using a conventional
DNA/RNA synthesizer, may be obtained from commercial suppliers such
as Ambion Inc. (Austin, Tex.), Invitrogen (Carlsbad, Calif.), or
Dharmacon (Lafayette, Colo.). Interfering RNAs are purified by
extraction with a solvent or resin, precipitation, electrophoresis,
chromatography, or a combination thereof, for example.
Alternatively, interfering RNA may be used with little if any
purification to avoid losses due to sample processing.
[0069] Interfering RNAs can also be expressed endogenously from
plasmid or viral expression vectors or from minimal expression
cassettes, for example, PCR generated fragments comprising one or
more promoters and an appropriate template or templates for the
interfering RNA. Examples of commercially available plasmid-based
expression vectors for shRNA include members of the pSilencer
series (Ambion, Austin, Tex.) and pCpG-siRNA (InvivoGen, San Diego,
Calif.). Viral vectors for expression of interfering RNA may be
derived from a variety of viruses including adenovirus,
adeno-associated virus, lentivirus (e.g., HIV, FIV, and EIAV), and
herpes virus. Examples of commercially available viral vectors for
shRNA expression include pSilencer adeno (Ambion, Austin, Tex.) and
pLenti6/BLOCK-iT.TM.-DEST (Invitrogen, Carlsbad, Calif.). Selection
of viral vectors, methods for expressing the interfering RNA from
the vector and methods of delivering the viral vector are within
the ordinary skill of one in the art. Examples of kits for
production of PCR-generated shRNA expression cassettes include
Silencer Express (Ambion, Austin, Tex.) and siXpress (Minis,
Madison, Wis.). A first interfering RNA may be administered via in
vivo expression from a first expression vector capable of
expressing the first interfering RNA and a second interfering RNA
may be administered via in vivo expression from a second expression
vector capable of expressing the second interfering RNA, or both
interfering RNAs may be administered via in vivo expression from a
single expression vector capable of expressing both interfering
RNAs.
[0070] Interfering RNAs may be expressed from a variety of
eukaryotic promoters known to those of ordinary skill in the art,
including pol III promoters, such as the U6 or H1 promoters, or pol
II promoters, such as the cytomegalovirus promoter. Those of skill
in the art will recognize that these promoters can also be adapted
to allow inducible expression of the interfering RNA.
[0071] Hybridization under Physiological Conditions: In certain
embodiments of the present invention, an antisense strand of an
interfering RNA hybridizes with an mRNA in vivo as part of the RISC
complex.
[0072] "Hybridization" refers to a process in which single-stranded
nucleic acids with complementary or near-complementary base
sequences interact to form hydrogen-bonded complexes called
hybrids. Hybridization reactions are sensitive and selective. In
vitro, the specificity of hybridization (i.e., stringency) is
controlled by the concentrations of salt or formamide in
prehybridization and hybridization solutions, for example, and by
the hybridization temperature; such procedures are well known in
the art. In particular, stringency is increased by reducing the
concentration of salt, increasing the concentration of formamide,
or raising the hybridization temperature.
[0073] For example, high stringency conditions could occur at about
50% formamide at 37.degree. C. to 42.degree. C. Reduced stringency
conditions could occur at about 35% to 25% formamide at 30.degree.
C. to 35.degree. C. Examples of stringency conditions for
hybridization are provided in Sambrook, J., 1989, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. Further examples of stringent
hybridization conditions include 400 mM NaCl, 40 mM PIPES pH 6.4, 1
mM EDTA, 50.degree. C. or 70.degree. C. for 12-16 hours followed by
washing, or hybridization at 70.degree. C. in 1.times.SSC or
50.degree. C. in 1.times.SSC, 50% formamide followed by washing at
70.degree. C. in 0.3.times.SSC, or hybridization at 70.degree. C.
in 4.times.SSC or 50.degree. C. in 4.times.SSC, 50% formamide
followed by washing at 67.degree. C. in 1.times.SSC. The
temperature for hybridization is about 5-10.degree. C. less than
the melting temperature (T.sub.m) of the hybrid where T.sub.m is
determined for hybrids between 19 and 49 base pairs in length using
the following calculation: T.sub.m.degree. C.=81.5+16.6
(log.sub.10[Na+])+0.41 (% G+C)-(600/N) where N is the number of
bases in the hybrid, and [Na+] is the concentration of sodium ions
in the hybridization buffer.
[0074] The above-described in vitro hybridization assay provides a
method of predicting whether binding between a candidate siRNA and
a target will have specificity. However, in the context of the RISC
complex, specific cleavage of a target can also occur with an
antisense strand that does not demonstrate high stringency for
hybridization in vitro.
[0075] Single-stranded interfering RNA: As cited above, interfering
RNAs ultimately function as single strands. Single-stranded (ss)
interfering RNA has been found to effect mRNA silencing, albeit
less efficiently than double-stranded siRNA. Therefore, embodiments
of the present invention also provide for administration of a ss
interfering RNA that hybridizes under physiological conditions to a
portion of SEQ ID NO:1 or SEQ ID NO:2 and has a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides
with the hybridizing portion of SEQ ID NO:1 or SEQ ID NO:2,
respectively. The ss interfering RNA has a length of 19 to 49
nucleotides as for the ds siRNA cited above. The ss interfering RNA
has a 5' phosphate or is phosphorylated in situ or in vivo at the
5' position. The term "5' phosphorylated" is used to describe, for
example, polynucleotides or oligonucleotides having a phosphate
group attached via ester linkage to the C5 hydroxyl of the sugar
(e.g., ribose, deoxyribose, or an analog of same) at the 5' end of
the polynucleotide or oligonucleotide.
[0076] SS interfering RNAs are synthesized chemically or by in
vitro transcription or expressed endogenously from vectors or
expression cassettes as for ds interfering RNAs. 5' Phosphate
groups may be added via a kinase, or a 5' phosphate may be the
result of nuclease cleavage of an RNA. Delivery is as for ds
interfering RNAs. In one embodiment, ss interfering RNAs having
protected ends and nuclease resistant modifications are
administered for silencing. SS interfering RNAs may be dried for
storage or dissolved in an aqueous solution. The solution may
contain buffers or salts to inhibit annealing or for
stabilization.
[0077] Hairpin interfering RNA: A hairpin interfering RNA is a
single molecule (e.g., a single oligonucleotide chain) that
comprises both the sense and antisense strands of an interfering
RNA in a stem-loop or hairpin structure (e.g., a shRNA). For
example, shRNAs can be expressed from DNA vectors in which the DNA
oligonucleotides encoding a sense interfering RNA strand are linked
to the DNA oligonucleotides encoding the reverse complementary
antisense interfering RNA strand by a short spacer. If needed for
the chosen expression vector, 3' terminal T's and nucleotides
forming restriction sites may be added. The resulting RNA
transcript folds back onto itself to form a stem-loop
structure.
[0078] Mode of administration: Interfering RNA may be delivered via
aerosol, buccal, dermal, intradermal, inhaling, intramuscular,
intranasal, intraocular, intrapulmonary, intravenous,
intraperitoneal, nasal, ocular, oral, otic, parenteral, patch,
subcutaneous, sublingual, topical, or transdermal administration,
for example.
[0079] Interfering RNA may be delivered directly to the eye by
ocular tissue injection such as periocular, conjunctival, subtenon,
intracameral, intravitreal, intraocular, subretinal,
subconjunctival, retrobulbar, or intracanalicular injections; by
direct application to the eye using a catheter or other placement
device such as a retinal pellet, intraocular insert, suppository or
an implant comprising a porous, non-porous, or gelatinous material;
by topical ocular drops or ointments; or by a slow release device
in the cul-de-sac or implanted adjacent to the sclera
(transscleral) or within the eye. Intracameral injection may be
through the cornea into the anterior chamber to allow the agent to
reach the trabecular meshwork. Intracanalicular injection may be
into the venous collector channels draining Schlemm's canal or into
Schlemm's canal.
[0080] Subject: A subject in need of treatment for ocular
angiogenesis or at risk for developing ocular angiogenesis is a
human or other mammal having ocular angiogenesis or at risk of
having ocular angiogenesis associated with undesired or
inappropriate expression or activity of HIF1A as cited herein.
Ocular structures associated with such disorders may include the
eye, retina, choroid, lens, cornea, trabecular meshwork, iris,
optic nerve, optic nerve head, sclera, anterior or posterior
segments, or ciliary body, for example. A subject may also be an
ocular cell, cell culture, organ or an ex vivo organ or tissue.
[0081] Formulations and Dosage: Pharmaceutical formulations
comprise interfering RNAs, or salts thereof, of the invention up to
99% by weight mixed with a physiologically acceptable carrier
medium such as water, buffer, saline, glycine, hyaluronic acid,
mannitol, and the like.
[0082] Interfering RNAs of the present invention are administered
as solutions, suspensions, or emulsions. The following are examples
of possible formulations embodied by this invention.
TABLE-US-00008 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Hydroxypropylmethylcellulose 0.5 Sodium chloride
0.8 Benzalkonium Chloride 0.01 EDTA 0.01 NaOH/HCl qs pH 7.4
Purified water (RNase-free) qs 100 mL Interfering RNA up to 99;
0.1-99; 0.1-50; 0.5-10.0 Phosphate Buffered Saline 1.0 Benzalkonium
Chloride 0.01 Polysorbate 80 0.5 Purified water (RNase-free) q.s.
to 100% Interfering RNA up to 99; 0.1-99; 0.1-50; 0.5-10.0
Monobasic sodium phosphate 0.05 Dibasic sodium phosphate 0.15
(anhydrous) Sodium chloride 0.75 Disodium EDTA 0.05 Cremophor EL
0.1 Benzalkonium chloride 0.01 HCl and/or NaOH pH 7.3-7.4 Purified
water (RNase-free) q.s. to 100% Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Phosphate Buffered Saline 1.0
Hydroxypropyl-.beta.-cyclodextrin 4.0 Purified water (RNase-free)
q.s. to 100%
[0083] Generally, an effective amount of the interfering RNAs of
embodiments of the invention results in an extracellular
concentration at the surface of the target cell of from 100 pM to 1
.mu.M, or from 1 nM to 100 nM, or from 5 nM to about 50 nM, or to
about 25 nM. The dose required to achieve this local concentration
will vary depending on a number of factors including the delivery
method, the site of delivery, the number of cell layers between the
delivery site and the target cell or tissue, whether delivery is
local or systemic, etc. The concentration at the delivery site may
be considerably higher than it is at the surface of the target cell
or tissue. Topical compositions are delivered to the surface of the
target organ one to four times per day, or on an extended delivery
schedule such as daily, weekly, bi-weekly, monthly, or longer,
according to the routine discretion of a skilled clinician. The pH
of the formulation is about pH 4-9, or pH 4.5 to pH 7.4.
[0084] Therapeutic treatment of patients with interfering RNAs
directed against HIF1A mRNA is expected to be beneficial over small
molecule treatments by increasing the duration of action, thereby
allowing less frequent dosing and greater patient compliance.
[0085] An effective amount of a formulation may depend on factors
such as the age, race, and sex of the subject, the severity of the
ocular angiogenesis, the rate of target gene transcript/protein
turnover, the interfering RNA potency, and the interfering RNA
stability, for example. In one embodiment, the interfering RNA is
delivered topically to a target organ and reaches the
HIF1A-containing tissue such as the retina or optic nerve head at a
therapeutic dose thereby ameliorating an ocular
angiogenesis-associated disease process.
[0086] Acceptable carriers: An acceptable carrier refers to those
carriers that cause at most, little to no ocular irritation,
provide suitable preservation if needed, and deliver one or more
interfering RNAs of the present invention in a homogenous dosage.
An acceptable carrier for administration of interfering RNA of
embodiments of the present invention include the cationic
lipid-based transfection reagents TransIT.RTM.-TKO (Minis
Corporation, Madison, Wis.), LIPOFECTIN.RTM., Lipofectamine,
OLIGOFECTAMINE.TM. (Invitrogen, Carlsbad, Calif.), or
DHARMAFECT.TM. (Dharmacon, Lafayette, Colo.); polycations such as
polyethyleneimine; cationic peptides such as Tat, polyarginine, or
Penetratin (Antp peptide); or liposomes. Liposomes are formed from
standard vesicle-forming lipids and a sterol, such as cholesterol,
and may include a targeting molecule such as a monoclonal antibody
having binding affinity for endothelial cell surface antigens, for
example. Further, the liposomes may be PEGylated liposomes.
[0087] The interfering RNAs may be delivered in solution, in
suspension, or in bioerodible or non-bioerodible delivery devices.
The interfering RNAs can be delivered alone or as components of
defined, covalent conjugates. The interfering RNAs can also be
complexed with cationic lipids, cationic peptides, or cationic
polymers; complexed with proteins, fusion proteins, or protein
domains with nucleic acid binding properties (e.g., protamine); or
encapsulated in nanoparticles or liposomes. Tissue- or
cell-specific delivery can be accomplished by the inclusion of an
appropriate targeting moiety such as an antibody or antibody
fragment.
[0088] For ophthalmic delivery, an interfering RNA may be combined
with ophthalmologically acceptable preservatives, co-solvents,
surfactants, viscosity enhancers, penetration enhancers, buffers,
sodium chloride, or water to form an aqueous, sterile ophthalmic
suspension or solution. Solution formulations may be prepared by
dissolving the interfering RNA in a physiologically acceptable
isotonic aqueous buffer. Further, the solution may include an
acceptable surfactant to assist in dissolving the inhibitor.
Viscosity building agents, such as hydroxymethyl cellulose,
hydroxyethyl cellulose, methylcellulose, polyvinylpyrrolidone, or
the like may be added to the compositions of the present invention
to improve the retention of the compound.
[0089] In order to prepare a sterile ophthalmic ointment
formulation, the interfering RNA is combined with a preservative in
an appropriate vehicle, such as mineral oil, liquid lanolin, or
white petrolatum. Sterile ophthalmic gel formulations may be
prepared by suspending the interfering RNA in a hydrophilic base
prepared from the combination of, for example, CARBOPOL.RTM.-940
(BF Goodrich, Charlotte, N.C.), or the like, according to methods
known in the art. VISCOAT.RTM. (Alcon Laboratories, Inc., Fort
Worth, Tex.) may be used for intraocular injection, for example.
Other compositions of the present invention may contain penetration
enhancing agents such as cremephor and TWEEN.RTM. 80
(polyoxyethylene sorbitan monolaureate, Sigma Aldrich, St. Louis,
Mo.), in the event the interfering RNA is less penetrating in the
eye.
[0090] Kits: Embodiments of the present invention provide a kit
that includes reagents for attenuating the expression of an mRNA as
cited herein in a cell. The kit contains an siRNA or an shRNA
expression vector. For siRNAs and non-viral shRNA expression
vectors the kit also contains a transfection reagent or other
suitable delivery vehicle. For viral shRNA expression vectors, the
kit may contain the viral vector and/or the necessary components
for viral vector production (e.g., a packaging cell line as well as
a vector comprising the viral vector template and additional helper
vectors for packaging). The kit may also contain positive and
negative control siRNAs or shRNA expression vectors (e.g., a
non-targeting control siRNA or an siRNA that targets an unrelated
mRNA). The kit also may contain reagents for assessing knockdown of
the intended target gene (e.g., primers and probes for quantitative
PCR to detect the target mRNA and/or antibodies against the
corresponding protein for western blots). Alternatively, the kit
may comprise an siRNA sequence or an shRNA sequence and the
instructions and materials necessary to generate the siRNA by in
vitro transcription or to construct an shRNA expression vector.
[0091] A pharmaceutical combination in kit form is further provided
that includes, in packaged combination, a carrier means adapted to
receive a container means in close confinement therewith and a
first container means including an interfering RNA composition and
an acceptable carrier. Such kits can further include, if desired,
one or more of various conventional pharmaceutical kit components,
such as, for example, containers with one or more pharmaceutically
acceptable carriers, additional containers, etc., as will be
readily apparent to those skilled in the art. Printed instructions,
either as inserts or as labels, indicating quantities of the
components to be administered, guidelines for administration,
and/or guidelines for mixing the components, can also be included
in the kit.
[0092] The ability of interfering RNA to knock-down the levels of
endogenous target gene expression in, for example, a human ocular
cell line is evaluated in vitro as follows. Transformed human cells
are plated 24 h prior to transfection in standard growth medium
(e.g., DMEM supplemented with 10% fetal bovine serum). Transfection
is performed using Dharmafect 1 (Dharmacon, Lafayette, Colo.)
according to the manufacturer's instructions at interfering RNA
concentrations ranging from 0.1 nM-100 nM. Non-targeting control
siRNA and lamin A/C siRNA (Dharmacon) are used as controls. Target
mRNA levels are assessed by qPCR 24 h post-transfection using, for
example, TAQMAN.RTM. forward and reverse primers and a probe set
that encompasses the target site (Applied Biosystems, Foster City,
Calif.). Target protein levels may be assessed approximately 72 h
post-transfection (actual time dependent on protein turnover rate)
by western blot, for example. Standard techniques for RNA and/or
protein isolation from cultured cells are well-known to those
skilled in the art. To reduce the chance of non-specific,
off-target effects, the lowest possible concentration of
interfering RNA should be used that will produce the desired level
of knock-down in target gene expression.
[0093] The ability of interfering RNAs of the present invention to
knock-down levels of HIF1A protein expression is further
exemplified in Example 1 as follows.
Example 1
Interfering RNA for Specifically Silencing HIF1A
[0094] The present study examines the ability of HIF1A-interfering
RNA to knock down the levels of endogenous HIF-1.alpha. protein
expression in cultured HeLa cells.
[0095] Transfection of HeLa cells was accomplished using standard
in vitro concentrations (0.1-10 nM) of HIF1A siRNAs, siCONTROL
RISC-free siRNA #1, or siCONTROL Non-targeting siRNA #2 (NTC2) and
DHARMAFECT.RTM. #1 transfection reagent (Dharmacon, Lafayette,
Colo.). All siRNAs were dissolved in 1.times. siRNA buffer, an
aqueous solution of 20 mM KCl, 6 mM HEPES (pH 7.5), 0.2 mM
MgCl.sub.2. Control samples included a buffer control in which the
volume of siRNA was replaced with an equal volume of 1.times. siRNA
buffer (-siRNA). Forty-eight hours after transfection, the cells
were treated with 100 .mu.M CoCl.sub.2 for 4 h to induce HIF-la
protein expression, and western blots were performed to assess
HIF-la level. The HIF1A siRNAs are double-stranded interfering RNAs
having specificity for the following targets: siHIF1A #1 targets
SEQ ID NO:48; siHIF1A #3 targets SEQ ID NO:49; siHIF1A #5 targets
SEQ ID NO:50; siHIF1A #6 targets SEQ ID NO:51. As shown by the data
of the FIGURE, each of the four HIF1A siRNAs reduced HIF-la protein
expression significantly at 10 nM relative to the control siRNAs.
However, siHIF1A #3 and siHIF1A #6 also silenced HIF-1.alpha.
protein expression significantly at 0.1 nM, indicating that these
HIF1A siRNAs are particularly effective relative to siHIF1A #1 and
siHIF1A #5.
[0096] The references cited herein, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated by reference.
[0097] Those of skill in the art, in light of the present
disclosure, will appreciate that obvious modifications of the
embodiments disclosed herein can be made without departing from the
spirit and scope of the invention. All of the embodiments disclosed
herein can be made and executed without undue experimentation in
light of the present disclosure. The full scope of the invention is
set out in the disclosure and equivalent embodiments thereof. The
specification should not be construed to unduly narrow the full
scope of protection to which the present invention is entitled.
[0098] As used herein and unless otherwise indicated, the terms "a"
and "an" are taken to mean "one", "at least one" or "one or more".
Sequence CWU 1
1
5613958DNAHomo sapiens 1gtgctgcctc gtctgagggg acaggaggat caccctcttc
gtcgcttcgg ccagtgtgtc 60gggctgggcc ctgacaagcc acctgaggag aggctcggag
ccgggcccgg accccggcga 120ttgccgcccg cttctctcta gtctcacgag
gggtttcccg cctcgcaccc ccacctctgg 180acttgccttt ccttctcttc
tccgcgtgtg gagggagcca gcgcttaggc cggagcgagc 240ctgggggccg
cccgccgtga agacatcgcg gggaccgatt caccatggag ggcgccggcg
300gcgcgaacga caagaaaaag ataagttctg aacgtcgaaa agaaaagtct
cgagatgcag 360ccagatctcg gcgaagtaaa gaatctgaag ttttttatga
gcttgctcat cagttgccac 420ttccacataa tgtgagttcg catcttgata
aggcctctgt gatgaggctt accatcagct 480atttgcgtgt gaggaaactt
ctggatgctg gtgatttgga tattgaagat gacatgaaag 540cacagatgaa
ttgcttttat ttgaaagcct tggatggttt tgttatggtt ctcacagatg
600atggtgacat gatttacatt tctgataatg tgaacaaata catgggatta
actcagtttg 660aactaactgg acacagtgtg tttgatttta ctcatccatg
tgaccatgag gaaatgagag 720aaatgcttac acacagaaat ggccttgtga
aaaagggtaa agaacaaaac acacagcgaa 780gcttttttct cagaatgaag
tgtaccctaa ctagccgagg aagaactatg aacataaagt 840ctgcaacatg
gaaggtattg cactgcacag gccacattca cgtatatgat accaacagta
900accaacctca gtgtgggtat aagaaaccac ctatgacctg cttggtgctg
atttgtgaac 960ccattcctca cccatcaaat attgaaattc ctttagatag
caagactttc ctcagtcgac 1020acagcctgga tatgaaattt tcttattgtg
atgaaagaat taccgaattg atgggatatg 1080agccagaaga acttttaggc
cgctcaattt atgaatatta tcatgctttg gactctgatc 1140atctgaccaa
aactcatcat gatatgttta ctaaaggaca agtcaccaca ggacagtaca
1200ggatgcttgc caaaagaggt ggatatgtct gggttgaaac tcaagcaact
gtcatatata 1260acaccaagaa ttctcaacca cagtgcattg tatgtgtgaa
ttacgttgtg agtggtatta 1320ttcagcacga cttgattttc tcccttcaac
aaacagaatg tgtccttaaa ccggttgaat 1380cttcagatat gaaaatgact
cagctattca ccaaagttga atcagaagat acaagtagcc 1440tctttgacaa
acttaagaag gaacctgatg ctttaacttt gctggcccca gccgctggag
1500acacaatcat atctttagat tttggcagca acgacacaga aactgatgac
cagcaacttg 1560aggaagtacc attatataat gatgtaatgc tcccctcacc
caacgaaaaa ttacagaata 1620taaatttggc aatgtctcca ttacccaccg
ctgaaacgcc aaagccactt cgaagtagtg 1680ctgaccctgc actcaatcaa
gaagttgcat taaaattaga accaaatcca gagtcactgg 1740aactttcttt
taccatgccc cagattcagg atcagacacc tagtccttcc gatggaagca
1800ctagacaaag ttcacctgag cctaatagtc ccagtgaata ttgtttttat
gtggatagtg 1860atatggtcaa tgaattcaag ttggaattgg tagaaaaact
ttttgctgaa gacacagaag 1920caaagaaccc attttctact caggacacag
atttagactt ggagatgtta gctccctata 1980tcccaatgga tgatgacttc
cagttacgtt ccttcgatca gttgtcacca ttagaaagca 2040gttccgcaag
ccctgaaagc gcaagtcctc aaagcacagt tacagtattc cagcagactc
2100aaatacaaga acctactgct aatgccacca ctaccactgc caccactgat
gaattaaaaa 2160cagtgacaaa agaccgtatg gaagacatta aaatattgat
tgcatctcca tctcctaccc 2220acatacataa agaaactact agtgccacat
catcaccata tagagatact caaagtcgga 2280cagcctcacc aaacagagca
ggaaaaggag tcatagaaca gacagaaaaa tctcatccaa 2340gaagccctaa
cgtgttatct gtcgctttga gtcaaagaac tacagttcct gaggaagaac
2400taaatccaaa gatactagct ttgcagaatg ctcagagaaa gcgaaaaatg
gaacatgatg 2460gttcactttt tcaagcagta ggaattggaa cattattaca
gcagccagac gatcatgcag 2520ctactacatc actttcttgg aaacgtgtaa
aaggatgcaa atctagtgaa cagaatggaa 2580tggagcaaaa gacaattatt
ttaataccct ctgatttagc atgtagactg ctggggcaat 2640caatggatga
aagtggatta ccacagctga ccagttatga ttgtgaagtt aatgctccta
2700tacaaggcag cagaaaccta ctgcagggtg aagaattact cagagctttg
gatcaagtta 2760actgagcttt ttcttaattt cattcctttt tttggacact
ggtggctcac tacctaaagc 2820agtctattta tattttctac atctaatttt
agaagcctgg ctacaatact gcacaaactt 2880ggttagttca atttttgatc
ccctttctac ttaatttaca ttaatgctct tttttagtat 2940gttctttaat
gctggatcac agacagctca ttttctcagt tttttggtat ttaaaccatt
3000gcattgcagt agcatcattt taaaaaatgc acctttttat ttatttattt
ttggctaggg 3060agtttatccc tttttcgaat tatttttaag aagatgccaa
tataattttt gtaagaaggc 3120agtaaccttt catcatgatc ataggcagtt
gaaaaatttt tacacctttt ttttcacatt 3180ttacataaat aataatgctt
tgccagcagt acgtggtagc cacaattgca caatatattt 3240tcttaaaaaa
taccagcagt tactcatgga atatattctg cgtttataaa actagttttt
3300aagaagaaat tttttttggc ctatgaaatt gttaaacctg gaacatgaca
ttgttaatca 3360tataataatg attcttaaat gctgtatggt ttattattta
aatgggtaaa gccatttaca 3420taatatagaa agatatgcat atatctagaa
ggtatgtggc atttatttgg ataaaattct 3480caattcagag aaatcatctg
atgtttctat agtcactttg ccagctcaaa agaaaacaat 3540accctatgta
gttgtggaag tttatgctaa tattgtgtaa ctgatattaa acctaaatgt
3600tctgcctacc ctgttggtat aaagatattt tgagcagact gtaaacaaga
aaaaaaaaat 3660catgcattct tagcaaaatt gcctagtatg ttaatttgct
caaaatacaa tgtttgattt 3720tatgcacttt gtcgctatta acatcctttt
tttcatgtag atttcaataa ttgagtaatt 3780ttagaagcat tattttagga
atatatagtt gtcacagtaa atatcttgtt ttttctatgt 3840acattgtaca
aatttttcat tccttttgct ctttgtggtt ggatctaaca ctaactgtat
3900tgttttgtta catcaaataa acatcttctg tggaccagga aaaaaaaaaa aaaaaaaa
395823812DNAHomo sapiens 2gtgctgcctc gtctgagggg acaggaggat
caccctcttc gtcgcttcgg ccagtgtgtc 60gggctgggcc ctgacaagcc acctgaggag
aggctcggag ccgggcccgg accccggcga 120ttgccgcccg cttctctcta
gtctcacgag gggtttcccg cctcgcaccc ccacctctgg 180acttgccttt
ccttctcttc tccgcgtgtg gagggagcca gcgcttaggc cggagcgagc
240ctgggggccg cccgccgtga agacatcgcg gggaccgatt caccatggag
ggcgccggcg 300gcgcgaacga caagaaaaag ataagttctg aacgtcgaaa
agaaaagtct cgagatgcag 360ccagatctcg gcgaagtaaa gaatctgaag
ttttttatga gcttgctcat cagttgccac 420ttccacataa tgtgagttcg
catcttgata aggcctctgt gatgaggctt accatcagct 480atttgcgtgt
gaggaaactt ctggatgctg gtgatttgga tattgaagat gacatgaaag
540cacagatgaa ttgcttttat ttgaaagcct tggatggttt tgttatggtt
ctcacagatg 600atggtgacat gatttacatt tctgataatg tgaacaaata
catgggatta actcagtttg 660aactaactgg acacagtgtg tttgatttta
ctcatccatg tgaccatgag gaaatgagag 720aaatgcttac acacagaaat
ggccttgtga aaaagggtaa agaacaaaac acacagcgaa 780gcttttttct
cagaatgaag tgtaccctaa ctagccgagg aagaactatg aacataaagt
840ctgcaacatg gaaggtattg cactgcacag gccacattca cgtatatgat
accaacagta 900accaacctca gtgtgggtat aagaaaccac ctatgacctg
cttggtgctg atttgtgaac 960ccattcctca cccatcaaat attgaaattc
ctttagatag caagactttc ctcagtcgac 1020acagcctgga tatgaaattt
tcttattgtg atgaaagaat taccgaattg atgggatatg 1080agccagaaga
acttttaggc cgctcaattt atgaatatta tcatgctttg gactctgatc
1140atctgaccaa aactcatcat gatatgttta ctaaaggaca agtcaccaca
ggacagtaca 1200ggatgcttgc caaaagaggt ggatatgtct gggttgaaac
tcaagcaact gtcatatata 1260acaccaagaa ttctcaacca cagtgcattg
tatgtgtgaa ttacgttgtg agtggtatta 1320ttcagcacga cttgattttc
tcccttcaac aaacagaatg tgtccttaaa ccggttgaat 1380cttcagatat
gaaaatgact cagctattca ccaaagttga atcagaagat acaagtagcc
1440tctttgacaa acttaagaag gaacctgatg ctttaacttt gctggcccca
gccgctggag 1500acacaatcat atctttagat tttggcagca acgacacaga
aactgatgac cagcaacttg 1560aggaagtacc attatataat gatgtaatgc
tcccctcacc caacgaaaaa ttacagaata 1620taaatttggc aatgtctcca
ttacccaccg ctgaaacgcc aaagccactt cgaagtagtg 1680ctgaccctgc
actcaatcaa gaagttgcat taaaattaga accaaatcca gagtcactgg
1740aactttcttt taccatgccc cagattcagg atcagacacc tagtccttcc
gatggaagca 1800ctagacaaag ttcacctgag cctaatagtc ccagtgaata
ttgtttttat gtggatagtg 1860atatggtcaa tgaattcaag ttggaattgg
tagaaaaact ttttgctgaa gacacagaag 1920caaagaaccc attttctact
caggacacag atttagactt ggagatgtta gctccctata 1980tcccaatgga
tgatgacttc cagttacgtt ccttcgatca gttgtcacca ttagaaagca
2040gttccgcaag ccctgaaagc gcaagtcctc aaagcacagt tacagtattc
cagcagactc 2100aaatacaaga acctactgct aatgccacca ctaccactgc
caccactgat gaattaaaaa 2160cagtgacaaa agaccgtatg gaagacatta
aaatattgat tgcatctcca tctcctaccc 2220acatacataa agaaactact
agtgccacat catcaccata tagagatact caaagtcgga 2280cagcctcacc
aaacagagca ggaaaaggag tcatagaaca gacagaaaaa tctcatccaa
2340gaagccctaa cgtgttatct gtcgctttga gtcaaagaac tacagttcct
gaggaagaac 2400taaatccaaa gatactagct ttgcagaatg ctcagagaaa
gcgaaaaatg gaacatgatg 2460gttcactttt tcaagcagta ggaattattt
agcatgtaga ctgctggggc aatcaatgga 2520tgaaagtgga ttaccacagc
tgaccagtta tgattgtgaa gttaatgctc ctatacaagg 2580cagcagaaac
ctactgcagg gtgaagaatt actcagagct ttggatcaag ttaactgagc
2640tttttcttaa tttcattcct ttttttggac actggtggct cactacctaa
agcagtctat 2700ttatattttc tacatctaat tttagaagcc tggctacaat
actgcacaaa cttggttagt 2760tcaatttttg atcccctttc tacttaattt
acattaatgc tcttttttag tatgttcttt 2820aatgctggat cacagacagc
tcattttctc agttttttgg tatttaaacc attgcattgc 2880agtagcatca
ttttaaaaaa tgcacctttt tatttattta tttttggcta gggagtttat
2940ccctttttcg aattattttt aagaagatgc caatataatt tttgtaagaa
ggcagtaacc 3000tttcatcatg atcataggca gttgaaaaat ttttacacct
tttttttcac attttacata 3060aataataatg ctttgccagc agtacgtggt
agccacaatt gcacaatata ttttcttaaa 3120aaataccagc agttactcat
ggaatatatt ctgcgtttat aaaactagtt tttaagaaga 3180aatttttttt
ggcctatgaa attgttaaac ctggaacatg acattgttaa tcatataata
3240atgattctta aatgctgtat ggtttattat ttaaatgggt aaagccattt
acataatata 3300gaaagatatg catatatcta gaaggtatgt ggcatttatt
tggataaaat tctcaattca 3360gagaaatcat ctgatgtttc tatagtcact
ttgccagctc aaaagaaaac aataccctat 3420gtagttgtgg aagtttatgc
taatattgtg taactgatat taaacctaaa tgttctgcct 3480accctgttgg
tataaagata ttttgagcag actgtaaaca agaaaaaaaa aatcatgcat
3540tcttagcaaa attgcctagt atgttaattt gctcaaaata caatgtttga
ttttatgcac 3600tttgtcgcta ttaacatcct ttttttcatg tagatttcaa
taattgagta attttagaag 3660cattatttta ggaatatata gttgtcacag
taaatatctt gttttttcta tgtacattgt 3720acaaattttt cattcctttt
gctctttgtg gttggatcta acactaactg tattgttttg 3780ttacatcaaa
taaacatctt ctgtggacca gg 3812319DNAArtificialTarget Sequence
3cagttgccac ttccacata 19421DNAArtificialsense strand with
3'NNmisc_RNA(1)..(19)ribonucleotidesmisc_feature(20)..(21)any, A,
T/U, C, G 4caguugccac uuccacauan n 21521DNAArtificialAntisense
strand with
3'NNmisc_RNA(1)..(19)ribonucleotidesmisc_feature(20)..(21)any, A,
T/U, C, G 5uauguggaag uggcaacugn n 21621RNAArtificialSense Strand
6caguugccac uuccacauau u 21721RNAArtificialAntisense Strand
7uauguggaag uggcaacugu u 21848DNAArtificialHairpin duplex with
loopmisc_RNA(1)..(19)ribonucleotidesmisc_feature(20)..(27)any, A,
T/U, C, Gmisc_feature(28)..(48)ribonucleotides 8caguugccac
uuccacauan nnnnnnnuau guggaagugg caacuguu 48919DNAArtificialTarget
Sequence 9ttgttatggt tctcacaga 191019DNAArtificialTarget Sequence
10ttatggttct cacagatga 191119DNAArtificialTarget Sequence
11caggccacat tcacgtata 191219DNAArtificialTarget Sequence
12aggccacatt cacgtatat 191319DNAArtificialTarget Sequence
13gccgctcaat ttatgaata 191419DNAArtificialTarget Sequence
14ccgctcaatt tatgaatat 191519DNAArtificialTarget Sequence
15caagcaactg tcatatata 191619DNAArtificialTarget Sequence
16tacgttgtga gtggtatta 191719DNAArtificialTarget Sequence
17ccggttgaat cttcagata 191819DNAArtificialTarget Sequence
18tgactcagct attcaccaa 191919DNAArtificialTarget Sequence
19tgaggaagta ccattatat 192019DNAArtificialTarget Sequence
20gaggaagtac cattatata 192119DNAArtificialTarget Sequence
21agttcacctg agcctaata 192219DNAArtificialTarget Sequence
22gtattccagc agactcaaa 192319DNAArtificialTarget Sequence
23attccagcag actcaaata 192419DNAArtificialTarget Sequence
24acaagaacct actgctaat 192519DNAArtificialTarget Sequence
25tgccaccact gatgaatta 192619DNAArtificialTarget Sequence
26ccatatagag atactcaaa 192719DNAArtificialTarget Sequence
27tctgtcgctt tgagtcaaa 192819DNAArtificialTarget Sequence
28tgcagaatgc tcagagaaa 192919DNAArtificialTarget Sequence
29gcaatcaatg gatgaaagt 193019DNAArtificialTarget Sequence
30gctgaccagt tatgattgt 193119DNAArtificialTarget Sequence
31gagctttgga tcaagttaa 193219DNAArtificialTarget Sequence
32tggctacaat actgcacaa 193319DNAArtificialTarget Sequence
33ctacaatact gcacaaact 193419DNAArtificialTarget Sequence
34atgatcatag gcagttgaa 193519DNAArtificialTarget Sequence
35ctatgtagtt gtggaagtt 193619DNAArtificialTarget Sequence
36gtggaagttt atgctaata 193719DNAArtificialTarget Sequence
37tgtcgctttg agtcaaaga 193819DNAArtificialTarget Sequence
38gatactagct ttgcagaat 193919DNAArtificialTarget Sequence
39tttgcagaat gctcagaga 194019DNAArtificialTarget Sequence
40acagctgacc agttatgat 194119DNAArtificialTarget Sequence
41gctgaccagt tatgattgt 194219DNAArtificialTarget Sequence
42cagttatgat tgtgaagtt 194319DNAArtificialTarget Sequence
43gagctttgga tcaagttaa 194419DNAArtificialTarget Sequence
44tggctacaat actgcacaa 194519DNAArtificialTarget Sequence
45ctacaatact gcacaaact 194619DNAArtificialTarget Sequence
46atgatcatag gcagttgaa 194719DNAArtificialTarget Sequence
47gtggaagttt atgctaata 194819DNAArtificialTarget Sequence
48ggacacagat ttagacttg 194919DNAArtificialTarget Sequence
49gatggaagca ctagacaaa 195019DNAArtificialTarget Sequence
50cgtgttatct gtcgctttg 195119DNAArtificialTarget Sequence
51tcaccaaagt tgaatcaga 195219RNAArtificialSense Strand 52caguugccac
uuccacaua 195319RNAArtificialAntisense Strand 53uauguggaag
uggcaacug 195425DNAArtificialSense Strand 54cagttgccac ttccacataa
tgtga 255525RNAArtificialSense Strand 55caguugccac uuccacauaa uguga
255627RNAArtificialAntisense Strand 56ucacauuaug uggaaguggc aacuguu
27
* * * * *