U.S. patent application number 16/498369 was filed with the patent office on 2021-04-15 for shrna expression cassette, polynucleotide sequence carrying same, and application thereof.
The applicant listed for this patent is Beijing SoloBio Genetechnology Company Ltd., STAIDSON (BEIJING) BIOPHARMACEUTICALS CO., LTD.. Invention is credited to Lixin JIANG, Chao WANG, Tingting ZHANG.
Application Number | 20210108197 16/498369 |
Document ID | / |
Family ID | 1000005330975 |
Filed Date | 2021-04-15 |
![](/patent/app/20210108197/US20210108197A1-20210415-D00001.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00002.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00003.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00004.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00005.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00006.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00007.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00008.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00009.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00010.png)
![](/patent/app/20210108197/US20210108197A1-20210415-D00011.png)
View All Diagrams
United States Patent
Application |
20210108197 |
Kind Code |
A1 |
WANG; Chao ; et al. |
April 15, 2021 |
SHRNA EXPRESSION CASSETTE, POLYNUCLEOTIDE SEQUENCE CARRYING SAME,
AND APPLICATION THEREOF
Abstract
An shRNA expression cassette, a polynucleotide sequence carrying
the same, and an use thereof. In an order of 5' to 3', the shRNA
expression cassette sequentially includes a DNA sequence for
expressing the shRNA and a stuffer sequence, and a sequence length
of the shRNA expression cassette sequence is proximate to a length
of a wild-type AAV genome.
Inventors: |
WANG; Chao; (Beijing,
CN) ; ZHANG; Tingting; (Beijing, CN) ; JIANG;
Lixin; (Beijing, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
STAIDSON (BEIJING) BIOPHARMACEUTICALS CO., LTD.
Beijing SoloBio Genetechnology Company Ltd. |
Beijing
Beijing |
|
CN
CN |
|
|
Family ID: |
1000005330975 |
Appl. No.: |
16/498369 |
Filed: |
March 26, 2018 |
PCT Filed: |
March 26, 2018 |
PCT NO: |
PCT/CN2018/080480 |
371 Date: |
September 26, 2019 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 31/20 20180101;
C12N 2750/14152 20130101; C12N 2750/14143 20130101; C12N 15/86
20130101; C12N 2330/51 20130101; C12N 7/00 20130101; C12N
2750/14171 20130101; C12N 2310/531 20130101; A61K 35/76 20130101;
C12N 15/113 20130101; C12N 2310/14 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 7/00 20060101 C12N007/00; A61K 35/76 20060101
A61K035/76; C12N 15/86 20060101 C12N015/86; A61P 31/20 20060101
A61P031/20 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 31, 2017 |
CN |
201710210863.5 |
Claims
1. An shRNA expression cassette, wherein in an order of 5' to 3',
the shRNA expression cassette sequentially comprises a DNA sequence
for expressing the shRNA and a stuffer sequence, wherein a sequence
length of the shRNA expression cassette is proximate to a length of
a wild-type AAV genome; and the stuffer sequence is optionally a
human non-coding sequence.
2-29. (canceled)
30. The shRNA expression cassette of claim 1, wherein the human
non-coding sequence is selected from a sequence fragment or a
combination of a plurality of sequence fragments of an intron
sequence of human factor IX, a sequence of human cosmid C346 or an
HPRT-intron sequence.
31. The shRNA expression cassette of claim 1, wherein the human
non-coding sequence is a sequence fragment of the HPRT-intron
sequence.
32. The shRNA expression cassette of claim 1, wherein the sequence
length of the shRNA expression cassette is 3.2 kb to 5.2 kb,
optionally 3.8 kb to 5.1 kb and said shRNA expression cassette is
configured for expression by a single-stranded AAV viral vector or
is configured for expression directly.
33. The shRNA expression cassette of claim 1, wherein the sequence
length of the shRNA expression cassette is configured for
expression by a double-stranded AAV viral vector and said sequence
length of the shRNA expression cassette is half of the sequence
length of the shRNA expression cassette that is expressed by using
a single-stranded AAV viral vector or if used directly.
34. The shRNA expression cassette of claim 1, wherein a 5' end of
the DNA sequence for expressing the shRNA in the shRNA expression
cassette comprises a promoter.
35. The shRNA expression cassette of claim 34, wherein the promoter
comprises an RNA polymerase II promoter or an RNA polymerase III
promoter.
36. The shRNA expression cassette of claim 35, wherein the RNA
polymerase II promoter is a tissue-specific promoter; optionally,
the RNA polymerase II promoter is a liver-specific promoter;
optionally the liver-specific promoter is LP1 promoter, ApoE/hAAT
promoter, DC172 promoter, DC190 promoter, ApoA-I promoter, TBG
promoter, LSP1 or HD-IFN promoter.
37. The shRNA expression cassette of claim 35, wherein the RNA
polymerase III promoter is a U6 promoter, an H1 promoter, or a 7SK
promoter; optionally, the RNA polymerase III promoter is an H1
promoter.
38. The shRNA expression cassette of claim 1, wherein the DNA
sequence for expressing the shRNA is a DNA sequence for expressing
any shRNA useful for treating diseases; optionally, the DNA
sequence for expressing any shRNA useful for treating diseases is
one or more selected from SEQ ID No: 1 to SEQ ID No: 3 in the
Sequence Listing.
39. A polynucleotide sequence, carrying the shRNA expression
cassette of claim 1, wherein both ends of the shRNA expression
cassette are Adeno-Associated Virus (AAV) terminal inverted repeat
sequences, respectively.
40. The polynucleotide sequence of claim 39, wherein the AAV
terminal inverted repeat sequence is selected from different
serotypes of AAVs, optionally the AAV terminal inverted repeat
sequence is selected from any serotype of AAVs in clades A-F or
AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or any of
hybrid/chimeric types thereof, optionally the AAV terminal inverted
repeat sequence is derived from the AAV2 serotype.
41. The polynucleotide sequence of claim 40, wherein the sequence
length between the two terminal inverted repeat sequences in the
polynucleotide sequence is optionally 3.2 kb to 5.2 kb; when trs in
one terminal inverted repeat sequence is engineered, and a Rep
protein cleavage site mutation caused by insertion, deletion, or
substitution cannot be efficiently cleaved, the sequence length
between the two inverted repeat sequences is optionally half of 3.2
kb to 5.2 kb.
42. The polynucleotide sequence of claim 39, wherein a 5' end
inverted repeat sequence in the polynucleotide sequence deletes a D
sequence, and the sequence length between the two terminal inverted
repeat sequences in the polynucleotide sequence is optionally half
of 4.6 kb to 5.1 kb.
43. A recombinant vector plasmid, carrying the shRNA expression
cassette of claim 1, or a polynucleotide sequence carrying the
shRNA expression cassette.
44. The recombinant vector plasmid of claim 43, wherein the
recombinant vector plasmid is an adeno-associated virus vector.
45. The recombinant vector plasmid of claim 44, wherein the
adeno-associated virus vector is of the AAV2/8 type, in which a
capsid protein of the adeno-associated virus vector is from
serotype VIII, and a terminal inverted repeat sequence of the
adeno-associated virus vector is from serotype II.
46. An shRNA, expressed by the shRNA expression cassette of claim
1, or a polynucleotide sequence carrying the shRNA expression
cassette, or a recombinant vector plasmid carrying the shRNA
expression cassette or the polynucleotide sequence.
47. A host cell comprising the recombinant vector plasmid of claim
43.
48. The host cell of claim 47, wherein the host cell is selected
from one or more of Escherichia coli, HEK293 cell line, HEK293T
cell line, HEK293A cell line, HEK293S cell line, HEK293FT cell
line, HEK293F cell line, HEK293H cell line, HeLa cell line, SF9
cell line, SF21 cell line, SF900 cell line, and BHK cell line.
49. A viral particle, comprising the recombinant vector plasmid of
claim 43, or a vector genome of the recombinant vector plasmid of a
host that comprises the recombinant vector plasmid.
50. The viral particle of claim 49, wherein the viral particle is
non-selectively or selectively expressed in liver tissue or liver
cancer cell.
51. An isolated and engineered cell, wherein the cell expresses or
comprises the shRNA expression cassette of claim 1, a
polynucleotide sequence carrying the shRNA expression cassette, a
recombinant vector plasmid carrying the shRNA expression cassette
or the polynucleotide sequence, or a viral particle comprising the
recombinant vector plasmid.
52. The engineered cell of claim 51, wherein the cell is a
mammalian cell, optionally a human cell, or even optionally a human
stem cell or hepatocyte.
53. A pharmaceutical composition, comprising an active ingredient
and a pharmaceutically acceptable excipient, wherein the active
ingredient is selected from one or more of the shRNA expression
cassette of claim 1, a polynucleotide sequence carrying the shRNA
expression cassette, a recombinant vector plasmid carrying the
shRNA expression cassette or the polynucleotide sequence, an shRNA
expressed by the shRNA expression cassette, a viral particle
comprising the recombinant vector plasmid, and an isolated and
engineered cell expressing or comprising the shRNA expression
cassette.
54. The pharmaceutical composition of claim 53, wherein the
pharmaceutical composition is an injection comprising a
pharmaceutically acceptable excipient and the active
ingredient.
55. A method of using the shRNA expression cassette of claim 1, a
polynucleotide sequence carrying the shRNA expression cassette, a
recombinant vector plasmid carrying the shRNA expression cassette
or the polynucleotide sequence, an shRNA expressed by the shRNA
expression cassette, a virus particle comprising the recombinant
vector plasmid, or an isolated and engineered cell expressing or
comprising the shRNA expression cassette for prevention and
treatment of hepatitis B, acquired immunodeficiency syndrome, for
treatment of Duchenne muscular dystrophy (DMD), and for treatment
of hypercholesterolemia comprising: administering the shRNA
expression cassette, the polynucleotide sequence carrying the shRNA
expression cassette, the recombinant vector plasmid carrying the
shRNA expression cassette or the polynucleotide sequence, the shRNA
expressed by the shRNA expression cassette, the virus particle
comprising the recombinant vector plasmid, or the isolated and
engineered cell expressing or comprising the shRNA expression
cassette to a subject in need thereof.
56. A vector preparation system for packaging the recombinant
vector plasmid of claim 43, wherein the vector preparation system
is a conventional AAV vector preparation system comprising a
two-plasmid packaging system, a three-plasmid packaging system, a
baculovirus packaging system, and an AAV packaging system using Ad
or HSV as a helper virus.
57. The vector preparation system of claim 56, wherein the
three-plasmid packaging system comprises a plasmid
pscAAV-H1-shRNA-Stuffer, a plasmid pHelper, and a plasmid
pAAV-R2CX; wherein the plasmid pHelper provides E2A, E4 and VA
regions of adenovirus; the plasmid pAAV-R2CX provides a sequence
comprising a rep gene and a cap gene; the plasmid
pscAAV-H1-shRNA-Stuffer comprises a polynucleotide sequence
carrying an shRNA expression cassette wherein in an order of 5' to
3', the shRNA expression cassette sequentially comprises a DNA
sequence for expressing the shRNA and a stuffer sequence, and a
sequence length of the shRNA expression cassette is proximate to a
length of a wild-type AAV genome; and the stuffer sequence is
optionally a human non-coding sequence, X refers to an AAV serotype
name corresponding to a source of Cap gene constituting the
pAAV-R2CX recombinant vector plasmid.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims a priority to Chinese Patent
Application No. 201710210863.5 filed on Mar. 31, 2017, the
disclosures of which are incorporated in their entirety by
reference herein.
TECHNICAL FIELD
[0002] The present disclosure relates to an shRNA expression
cassette, a polynucleotide sequence carrying the same, and use
thereof, and belongs to the fields of biotechnology and gene
therapy.
BACKGROUND
[0003] Small interfering RNA (siRNA), sometimes called short
interfering RNA or silencing RNA, is a double-stranded RNA having
20 to 25 nucleotides in length and has many different use in
biology. When the siRNA targeting the target gene is designed into
a hairpin structure to be introduced into the body, the hairpin
structure expresses and forms shRNA, in which shRNA is an
abbreviation of short hairpin RNA, and includes two short inverted
repeat sequences. It is currently known that shRNA is mainly
involved in the phenomenon of RNA interference (RNAi), and
regulates gene expression in a specific manner. In addition, it is
also involved in some RNAi-related reaction pathways, for example
antiviral mechanisms or changes in chromatin structure. After shRNA
enters the cell, it is unwound by the RNA helicase in host cell
into a sense RNA strand and an antisense RNA strand, in which the
antisense RNA strand binds to some enzymes in the body to form a
silencing complex RISC (RNA-induced silencing complex) which
recognizes and combines with the mRNA containing its complementary
sequence. At this time, a phenomenon, in which RISC has the
function of nuclease and is capable of cleaving and degrading mRNA,
thereby suppressing the expression of a corresponding gene, is
called RNA interference (RNAi).
[0004] ShRNA features include gene sequence specificity,
efficiency, and hereditability. ShRNA is easy to be degraded after
entering the cell, and the half-life is short. It is difficult to
penetrate the cell membrane and vascular endothelium, and the
transfection efficiency is limited. The amount of shRNA entering
the cell is not controlled, and it is easy to accumulate in the
spleen. An efficient vehicle or delivery route is required to
deliver exogenous shRNA into an organism. One method is to deliver
directly using a chemical modification method, such as lipofection
and PEG modification, and the shRNA can be directly introduced into
the cell to inhibit the expression of a specific gene without
cloning into a vector. The method of plasmid or viral
vector-mediated expression of shRNA in vivo shows advantages over
using the shRNA expression cassette directly. The dsRNA sequence
corresponding to the shRNA is cloned into a plasmid vector or a
viral vector containing a suitable promoter, then the cell is
transfected with the plasmid or infected with the virus, and the
desired shRNA is formed through transcription under the control of
the promoter, and thus plays a role in sustainably generating siRNA
in vivo.
[0005] Adeno-associated virus (AAV) is a member of the parvovirus
family, is a non-enveloped single-stranded linear DNA virus, and
has many advantages as a gene therapy vector, such as high
infection efficiency, a wide range of infection, and high safety
for long-term expression, etc. It is used clinically to treat
tumors, retinal disease, arthritis, AIDS, heart failure, muscular
dystrophy, nervous system disease, and a variety of other genetic
defect diseases. However, since the shRNA involved in the present
disclosure is very short, only a few tens of bp, packaging
efficiency and expression amount are the problems when it is
expressed using the AAV viral vector.
SUMMARY
[0006] Some embodiments of the present disclosure provide an shRNA
expression cassette, a polynucleotide sequence carrying the shRNA
expression cassette, a recombinant vector plasmid carrying the
polynucleotide sequence, an shRNA, a host, a virus particle, an
isolated engineered cell, a pharmaceutical composition, their use
in the preparation of a medicament for prevention and treatment of
hepatitis B, acquired immunodeficiency syndrome, for treatment of
Duchenne muscular dystrophy (DMD), and for treatment of
hypercholesterolemia, and a vector preparation system for the
recombinant vector plasmid.
[0007] The expression cassette of the present disclosure is
expanded by using a stuffer sequence, such that the length of the
expression cassette sequence is proximate to the length of the
wild-type AAV genome. The expression cassette or the polynucleotide
sequence carrying the same when expressed by using an AAV viral
vector is capable of ensuring the yield of virus packaging. After
extensive experiments, it was found that when the stuffer sequence
is located at the 3' end of the shRNA sequence, the expression
cassette or the polynucleotide sequence carrying the same is
expressed by using the AAV viral vector, it not only guarantees the
viral packaging yield, but also increases the expression level of
the target gene shRNA, thereby improving the therapeutic effect of
the drug.
[0008] According to an aspect of the present disclosure, the
present disclosure provides an shRNA expression cassette, in which
in an order of 5' to 3', the shRNA expression cassette sequentially
includes a DNA sequence for expressing the shRNA and a stuffer
sequence, and a sequence length of the shRNA expression cassette is
proximate to a length of a wild-type AAV genome. The stuffer
sequence is optionally a human non-coding sequence.
[0009] Optionally, the human non-coding sequence is inert or
innocuous, and does not have function or activity. In various
particular aspects, the human non-coding sequence is not a sequence
encoding a protein or polypeptide, unlike any of the following
substances: shRNA, AAV terminal inverted repeat (ITR) sequence,
promoter, replication origin, polyadenylation sequence, and the
like.
[0010] The human non-coding sequence is selected from a sequence
fragment or a combination of a plurality of sequence fragments of
an intron sequence of human Factor IX (GenBank: K02402.1), an
intron I fragment of human Factor IX, a sequence of human cosmid
C346 or the HPRT-intron sequence at positions 1704-14779 (GenBank:
M26434.1); even is optionally a sequence fragment of the
HPRT-intron sequence at positions 1704-14779 (GenBank: M26434.1).
The length of the human non-coding sequence can be adjusted
according to different AAV packaging capacity or other
requirements, and is not limited to a fixed length.
[0011] Optionally, the sequence length of the expression cassette
that is expressed by using a single-stranded AAV viral vector or
used directly is 3.2 kb to 5.2 kb, optionally 3.8 kb to 5.1 kb, and
even optionally 3.8 kb to 4.6 kb and 4.6 kb to 5.1 kb, especially
optionally 4.6 kb.
[0012] Even optionally, the sequence length of the shRNA expression
cassette that is expressed by using a double-stranded AAV viral
vector is half of the sequence length of the shRNA expression
cassette that is expressed by using the single-stranded AAV viral
vector or used directly. Optionally, it is half of 3.2 kb to 5.2
kb, optionally half of 3.8 kb to 5.1 kb, or even optionally half of
3.8 kb to 4.6 kb or 4.6 kb to 5.1 kb, especially optionally half of
4.6 kb, i.e., 2.3 kb.
[0013] In the shRNA expression cassette of the present disclosure,
the 5' end of the DNA sequence for expressing the shRNA contains a
promoter, the promoter may be a promoter from any source, and the
promoter includes one or more selected from an RNA polymerase II
promoter and an RNA polymerase III promoter. The RNA polymerase II
promoter is a commonly used promoter, such as CAG promoter, CMV
promoter, SV40 promoter, EF1 promoter, Ub promoter. As for
different pathological tissues or cells, tissue or cell-specific
promoters, such as LP1 promoter, CK1 promoter, DC172 promoter,
DC190 promoter, ApoE/hAAT promoter, ApoA-I promoter, TBG promoter,
LSP1 promoter, HD-IFN promoter, etc., may be selected according to
specific pathological characteristics. In order to ensure high
efficient expression of the target gene shRNA, the promoter may be
a promoter or a combination of a plurality of promoters; and the
promoter may be a mutant or chimera engineered according to the
actual situation. Further, the promoter is selected from at least
one of the RNA polymerase III promoters, and the RNA polymerase III
promoter is a U6 promoter, an H1 promoter, or a 7SK promoter; and
particularly optionally, the promoter is an H1 promoter.
[0014] The DNA sequence for expressing the shRNA is a DNA sequence
for expressing any shRNA useful for treating diseases. Optionally,
the DNA sequence for expressing any shRNA useful for treating
diseases is one or more selected from SEQ ID No: 1 to SEQ ID No: 3
in the Sequence Listing. For example, it may be a DNA sequence for
expressing an shRNA for treating HBV disease, a DNA sequence for
expressing an shRNA for treating an HIV disease, optionally a DNA
sequence for expressing an shRNA for treating Duchenne muscular
dystrophy (DMD), a DNA sequence for expressing an shRNA for
treating hypercholesterolemia, etc.
[0015] For example, 1) the DNA sequence for expressing any shRNA
for treating the HBV disease, in which the target sequence of the
shRNA may be composed of 19 to 23 nt fragments in the following DNA
sequence, such as
TABLE-US-00001 (1) (SEQ ID No: 7) catcctgctgctatgcctcat (2) (SEQ ID
No: 8) aaggtatgttgcccgtttgtcc (3) (SEQ ID No: 9)
cctattgattggaaagtatgtcaaa (4) (SEQ ID No: 10)
tcgccaacttacaaggcctttct (5) (SEQ ID No: 11) tgtgctgccaactggatcct
(6) (SEQ ID No: 12) ccgtgtgcacttcgcttcacct (7) (SEQ ID No: 13)
ggaggctgtaggcataaattggtctgt (8) (SEQ ID No: 14)
ggagtgtggattcgcactcct
[0016] 2) The DNA sequence for expressing the shRNA for treating
the HIV disease, in which the target sequence of shRNA may be
composed of 19 to 23 nt fragments of the following RNA sequence,
such as
TABLE-US-00002 (1) (SEQ ID No: 15) aucaaugaggaagcugcagaaugg (2)
(SEQ ID No: 16) gggaagugacauagcaggaacuacuag (3) (SEQ ID No: 17)
uaaauaaaauaguaagaauguauagcccu (4) (SEQ ID No: 18)
uaugggguaccugugugga (5) (SEQ ID No: 19) gccaauucccauacauuauugugc
(6) (SEQ ID No: 20) uuaaauggcagucuagcagaa (7) (SEQ ID No: 21)
accacacacaaggcuacuucccugau (8) (SEQ ID No: 22)
acacccccuagcauuucaucac (9) (SEQ ID No: 23)
ggauggugcuucaagcuaguaccaguu
[0017] 3) The DNA sequence for expressing the shRNA for treating
Duchenne muscular dystrophy (DMD), in which the target sequence of
the shRNA may be composed of 19 to 23 nt fragments of the following
RNA sequence, such as
TABLE-US-00003 (1) (SEQ ID No: 24) ugaguaucaucgugugaaag (2) (SEQ ID
No: 25) uccuuucaucucugggcuc (3) (SEQ ID No: 26)
aacuuccucuuuaacagaaaagcauac (4) (SEQ ID No: 27)
aacuuccucuuuaacagaaaagcauac (5) (SEQ ID No: 28)
caaggaaguuggcauuucaa
[0018] 4) The DNA sequence for expressing the shRNA for treating
hypercholesterolemia, in which the target sequence of the shRNA is
composed of 19 to 23 nt fragments of the following RNA sequence,
such as
TABLE-US-00004 (1) (SEQ ID No: 29) uuccgaauaaacuccaggc (2) (SEQ ID
No: 30) aaccgcaguucuuuguagg (3) (SEQ ID No: 31) uugguauucagugugauga
(4) (SEQ ID No: 32) ucaucacacugaauaccaa
[0019] The DNA sequence for expressing the shRNA may be a
combination of DNA sequences simultaneously expressing two or more
shRNA, and the combination may be a combination of two DNA
sequences expressing shRNA or a combination of three DNA sequences
expressing shRNA, but not limited to two or three DNA sequences.
The two DNA sequences expressing shRNA adjacent to each other may
be directly linked or linked by a linker; and the expressed
shRNA-targeted therapeutic targets may be a single target or
multiple targets.
[0020] The present disclosure provides a polynucleotide sequence
carrying the shRNA expression cassette, in which both ends of the
shRNA expression cassette are AAV-terminal inverted repeat
sequences, respectively.
[0021] The AAV terminal inverted repeat sequence is selected from
different serotypes of AAVs, optionally the AAV terminal inverted
repeat sequence is selected from any serotype of AAVs in clades A-F
or AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or any of
hybrid/chimeric types thereof, optionally the AAV terminal inverted
repeat sequence is derived from the AAV2 serotype. Among them, the
terminal inverted repeat sequences can be engineered, deleted or
truncated at the corresponding positions, and the above methods can
be used in combination.
[0022] In the polynucleotide sequence of the present disclosure,
the sequence length between the two terminal inverted repeat
sequences is 3.2 kb to 5.2 kb, optionally 3.8 kb to 5.1 kb, and
even optionally 3.8 kb to 4.6 kb, 4.6 kb to 5.1 kb, especially
optionally 4.6 kb. When trs in one terminal inverted repeat
sequence is engineered, and the Rep protein restriction site
mutation caused by insertion, deletion, or substitution cannot be
efficiently cleaved, the sequence length between the two inverted
repeat sequences is half of 3.2 kb to 5.2 kb, optionally half of
3.8 kb to 5.1 kb, or even optionally half of 3.8 kb to 4.6 kb or
4.6 kb to 5.1 kb, especially optionally half of 4.6 kb, i.e., 2.3
kb.
[0023] Optionally, a 5' end inverted repeat sequence in the
polynucleotide sequence deletes a D sequence, and the sequence
length between the two ITRs of the polynucleotide sequence may be
half of 4.6 kb to 5.1 kb, or even optionally half of the 4.6
kb.
[0024] The present disclosure provides a recombinant vector plasmid
carrying the above shRNA expression cassette or polynucleotide
sequence.
[0025] The polynucleotide sequences described in the present
disclosure may be commercially synthesized, and may be constructed
into a recombinant vector plasmid by a molecular cloning
method.
[0026] The recombinant vector plasmid is selected from an
adeno-associated viral vector.
[0027] Optionally, the adeno-associated virus vector is of various
serotypes, such as any serotype of AAVs in clades A-F (see the
publication of WO200533321), specifically AAV1 (GenBank:
AF063497.1), AAV2 (GenBank: AF043303.1), AAV3 (GenBank: U48704.1),
AAV4 (GenBank: NC_001829), AAV5 (GenBank: NC_006152), AAV6
(GenBank: AF028704), AAV7 (GenBank: AF513851), AAV8 (GenBank:
AF513852), AAV9 (GenBank: AY530579) or the hybrid/chimeric type
thereof.
[0028] Even optionally, the adeno-associated virus vector is of the
AAV2/8 type, in which a capsid protein of the adeno-associated
virus vector is from serotype VIII, and a terminal inverted repeat
sequence of the adeno-associated virus vector genome is from
serotype II. The nucleotide sequence of the present disclosure
completely matched with the base sequence of the HBV genomic target
is inserted between the two terminal inverted repeat sequences to
form a gene therapy drug that targets liver cells, and the
expression product efficiently and specifically inhibits HBV
replication.
[0029] The adeno-associated virus vector is finally packaged as a
virus. When the ITRs on both sides of the polynucleotide sequence
is selected from the normal AAV serotype ITR, the sequence packaged
into the virus is single-stranded, and the virus is called
single-stranded AAV; and when any one of ITRs causes the mutation
of the Rep protein restriction site by insertion, deletion, or
substitution to be unable to be efficiently cleaved, the sequence
packaged into the virus is double-stranded, and the virus is called
double-stranded AAV
[0030] The present disclosure also provides an shRNA, in which the
shRNA is expressed by the shRNA expression cassette or the
polynucleotide sequence or the recombinant vector plasmid described
above.
[0031] The present disclosure also provides a host, in which the
host includes the recombinant vector plasmid of the present
disclosure. The host is one or more selected from Escherichia coli,
HEK293 cell line, HEK293T cell line, HEK293A cell line, HEK293S
cell line, HEK293FT cell line, HEK293F cell line, HEK293H cell
line, HeLa cell line, SF9 cell line, SF21 cell line, SF900 cell
line, and BHK cell line.
[0032] The present disclosure also provides a viral particle,
including the recombinant vector plasmid described above or a
vector genome of the recombinant vector plasmid in a host. The
viral particle is non-selectively or selectively expressed in liver
tissue or liver cancer cell.
[0033] The present disclosure also relates to an isolated and
engineered cell that expresses or includes the shRNA expression
cassette, polynucleotide sequence, recombinant vector plasmid, and
viral particle described above. The cell is an engineered cell into
which a vector genome of the recombinant vector plasmid provided in
the present disclosure or in a host is introduced, including
prokaryotic cells and eukaryotic cells (such as fungal cells,
insect cells, plant cells, animal cells), optionally mammalian
cells, optionally human cells, and optionally human liver cells and
stem cells.
[0034] The present disclosure also relates to tissues and
organisms, such as animals, including the above cell.
[0035] The present disclosure also relates to a pharmaceutical
composition including the above cell.
[0036] The present disclosure also provides a pharmaceutical
composition, including an active ingredient and a pharmaceutically
acceptable excipient, in which the active ingredient is one or more
selected from the shRNA expression cassette, the polynucleotide
sequence carrying the shRNA expression cassette, the shRNA, the
recombinant vector plasmid, the viral particle or the isolated and
engineered cell of the present disclosure.
[0037] The pharmaceutical composition is an injection including a
pharmaceutically acceptable excipient and the above active
ingredient.
[0038] The present disclosure also provides use of the shRNA
expression cassette, the polynucleotide sequence carrying the shRNA
expression cassette or the recombinant vector plasmid or the shRNA,
the host, the virus particle or the isolated and engineered cell
described above in the preparation of a medicament for prevention
and treatment of hepatitis B, acquired immunodeficiency syndrome,
for treatment of Duchenne muscular dystrophy (DMD), and for
treatment of hypercholesterolemia.
[0039] Conventional AAV vector preparation systems can be used for
packaging the recombinant vector plasmids of the present
disclosure, such as a two-plasmid packaging system, a three-plasmid
packaging system, a baculovirus packaging system and an AAV
packaging system using Ad or HSV as a helper virus. Among them, the
three-plasmid packaging system includes a plasmid
pscAAV-H1-shRNA-Stuffer, a plasmid pHelper, and a plasmid
pAAV-R2CX; in which the plasmid pHelper provides E2A, E4 and VA
regions of adenovirus; the plasmid pAAV-R2CX provides a sequence
including a rep gene and a cap gene; the plasmid
pscAAV-H1-shRNA-Stuffer contains the above polynucleotide
sequence.
[0040] Among them, X refers to an AAV serotype name corresponding
to a source of Cap gene constituting the pAAV-R2CX recombinant
vector plasmid.
[0041] The present disclosure also provides a method for preparing
the viral vector of the present disclosure by using the preparation
system described above.
[0042] The present disclosure has the following advantageous
effects:
[0043] 1. The shRNA expression cassette of the present disclosure
uses AAV virus as a vector for delivery, such that shRNA can exert
a long-acting effect; as compared with naked shRNA or other
chemically modified shRNA, AAV selected as a vector has a lower
immunogenicity, and is safe and non-pathogenic; naked shRNA has no
obvious tissue cell preference in vivo, but different serotypes of
AAVs have obvious tissue targeting, which can greatly improve the
efficacy of shRNA drugs.
[0044] 2. The shRNA expression cassette provided by the present
disclosure selects a suitable stuffer sequence, such that the
sequence length of shRNA expression cassette is proximate to the
length of the AAV wild type genome, so that when the AAV viral
vector is selected for carrying, the packaging efficiency is
ensured to be the highest; when the stuffer sequence is located at
the 3' end of the shRNA sequence and the expression cassette or the
polynucleotide sequence carrying the same is expressed by AAV viral
vector, it not only guarantees the viral packaging yield, but also
greatly improves the expression level of the target gene of shRNA,
thereby improving the therapeutic effect of the drug.
[0045] The disclosure will be further described in conjunction with
the following drawings and the detailed description, which are not
to be construed as a limitation to the present disclosure. Any
equivalent substitution in the art in accordance with the content
of the present disclosure belongs to the protection scope of the
present disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0046] FIG. 1 is a plasmid map of pSNAV2.0-H1-shRNA1.
[0047] FIG. 2 is a plasmid map of pSNAV2.0-H1-shRNA1-intron.
[0048] FIG. 3 is a plasmid map of pSNAV2.0-H1-shRNA1-intron1.
[0049] FIG. 4 is a plasmid map of pSNAV2.0-H1-shRNA1-intron2.
[0050] FIG. 5 is a plasmid map of pSNAV2.0-H-shRNA1-intron3.
[0051] FIG. 6 is a plasmid map of pSNAV2.0-H1-shRNA1-intron4.
[0052] FIG. 7 is a plasmid map of pSNAV2.0-H-shRNA1-intron5.
[0053] FIG. 8 is a plasmid map of pSNAV2.0-H1-shRNA1-intron6.
[0054] FIG. 9 is a plasmid map of pSNAV2.0-H-shRNA1-intron7.
[0055] FIG. 10 is a plasmid map of pSNAV2.0-H1-shRNA1-intron8.
[0056] FIG. 11 is a plasmid map of pSC-H1-shRNA2.
[0057] FIG. 12 is a plasmid map of pSC-H1-shRNA2-intron'.
[0058] FIG. 13 is a plasmid map of pSC-H1-shRNA2-intron1'.
[0059] FIG. 14 is a plasmid map of pSC-H1-shRNA2-intron2'.
[0060] FIG. 15 is a plasmid map of pSC-H1-shRNA2-intron3'.
[0061] FIG. 16 is a plasmid map of pSC-H-shRNA2-intron4'.
[0062] FIG. 17 is a plasmid map of pSC-H1-shRNA2-intron5'.
[0063] FIG. 18 is a plasmid map of pSC-H1-shRNA2-intron6'.
[0064] FIG. 19 is a plasmid map of pSNAV2.0-shRNA1-shRNA3.
[0065] FIG. 20 is a plasmid map of
pSNAV2.0-shRNA1-shRNA3-intron1''.
[0066] FIG. 21 is a plasmid map of
pSNAV2.0-shRNA1-shRNA3-intron2''.
[0067] FIG. 22 is a plasmid map of
pSNAV2.0-shRNA1-shRNA3-intron3''.
[0068] FIG. 23 is a Quantitative real-time PCR detection result 1
of HBV in Example 2.
[0069] FIG. 24 is a Quantitative real-time PCR detection result 2
of HBV in Example 2.
[0070] FIG. 25 is a Quantitative real-time PCR detection result 3
of HBV in Example 2.
[0071] FIG. 26 is a Quantitative real-time PCR detection result 1
of HBV in Example 4.
[0072] FIG. 27 is a Quantitative real-time PCR detection result 2
of HBV in Example 4.
[0073] FIG. 28 is a Quantitative real-time PCR detection result 3
of HBV in Example 4.
[0074] FIG. 29 is a Quantitative real-time PCR detection result 1
of HBV in Example 5.
[0075] FIG. 30 is a Quantitative real-time PCR detection result 2
of HBV in Example 5.
[0076] FIG. 31 is a Quantitative real-time PCR detection result 3
of HBV in Example 5.
[0077] FIG. 32 is a detection result 1 in Example 6.
[0078] FIG. 33 is a detection result 2 in Example 6.
[0079] FIG. 34 is a detection result 3 in Example 6.
[0080] FIG. 35 is a detection result 4 in Example 6.
[0081] FIG. 36 is a detection result 5 in Example 6.
[0082] FIG. 37 is a detection result 6 in Example 6.
[0083] FIG. 38 is a detection result 7 in Example 6.
[0084] FIG. 39 is a detection result 8 in Example 6.
[0085] FIG. 40 is a detection result of HBsAg in Example 8.
[0086] FIG. 41 is a detection result of HBV DNA in Example 8.
DETAILED DESCRIPTION
Example 1: Effect of Single-Stranded AAV Packaging Capacity on
Yield
[0087] 1. Packaging Plasmid Construction:
[0088] Plasmid vector construction was carried out according to
"Molecular Cloning", pSNAV2.0-CMV-EGFP (purchased from Benyuan
Zhengyang Gene Technology Co., Ltd., Beijing) was a shuttle plasmid
used for single-stranded AAV packaging. Using HhoI and SalI as
restriction sites, the H1 promoter (GenBank: X16612) and the DNA
sequence for expressing shRNA1 (SEQ ID No: 1, hereinafter
abbreviated as shRNA1 in the description of the plasmid) were
synthesized to replace the CMV-EGFP sequence of pSNAV2.0-CMV-EGFP.
The EcoRV restriction site was introduced by site-directed
mutagenesis to form plasmid pSNAV2.0-H1-shRNA1, and the plasmid map
is shown in FIG. 1. Plasmid construction methods are conventional
methods in the art (Xiao Xiao, Juan Li, and Richard Jude Samulski.
Production of high-titer recombinant adeno-associated virus vectors
in the absence of helper adenovirus. J. Virol. 1998, 72(3):
2224.).
[0089] The pSNAV2.0-H1-shRNA1 plasmid was used as the backbone
plasmid, and the stuffer sequence intron was synthesized and
constructed into the 3' end of the DNA sequence for expressing
shRNA1 through using the restriction sites of BgII and SalI as the
insertion sites to form pSNAV2.0-H1-shRNA1-intron plasmid, in which
intron was derived from HPRT-intron (GenBank: M26434.1) at
positions 2161-3860 (1.7 kb), and the plasmid map is shown in FIG.
2.
[0090] The pSNAV2.0-H1-shRNA1 plasmid was used as the backbone
plasmid, and the stuffer sequence intron1 was synthesized and
constructed into the 3' end of the DNA sequence for expressing
shRNA1 through using the restriction sites of BgII and SalI as the
insertion sites to form pSNAV2.0-H1-shRNA1-intron1 plasmid, in
which intron1 was derived from HPRT-intron (GenBank: M26434.1) at
positions 2161-5360 (3.2 kb), and the plasmid map is shown in FIG.
3.
[0091] The pSNAV2.0-H1-shRNA1 plasmid was used as the backbone
plasmid, and the stuffer sequence intron2 was synthesized and
constructed into the 3' end of the DNA sequence for expressing
shRNA1 through using the restriction sites of BgII and SalI as the
insertion sites to form pSNAV2.0-H1-shRNA1-intron2 plasmid, in
which intron2 was derived from HPRT-intron (GenBank: M26434.1) at
positions 2161-6160 (4.0 kb), and the plasmid map is shown in FIG.
4.
[0092] The pSNAV2.0-H1-shRNA1 plasmid was used as the backbone
plasmid, and the stuffer sequence intron3 was synthesized and
constructed into the 3' end of the DNA sequence for expressing
shRNA1 through using the restriction sites of BgII and SalI as the
insertion sites to form pSNAV2.0-H1-shRNA1-intron3 plasmid, in
which intron3 was derived from HPRT-intron (GenBank: M26434.1) at
positions 2161-6660 (4.5 kb), and the plasmid map is shown in FIG.
5.
[0093] The pSNAV2.0-H1-shRNA1 plasmid was used as the backbone
plasmid, and the stuffer sequence intron4 was synthesized and
constructed into the 3' end of the DNA sequence for expressing
shRNA1 through using the restriction sites of BgII and SalI as the
insertion sites to form pSNAV2.0-H1-shRNA1-intron4 plasmid, in
which intron4 was derived from HPRT-intron (GenBank: M26434.1) at
positions 2161-7560 (5.4 kb), and the plasmid map is shown in FIG.
6.
[0094] Other packaging plasmids also include pR2C8 and AAV helper,
which encode a Rep protein derived from AAV2 and a Cap protein
derived from AAV8; and Ad Helper provides the minimal Ad moiety
required for AAV replication. Plasmid construction methods are
conventional methods in the art. (See Gao G P, Alvira M R, Wang L,
Calcedo R, Johnston J, Wilson J M. Novel adeno-associated viruses
from rhesus monkeys as vectors for human gene theraph. Proc Natl
Acad Sci USA, 2002 Sep. 3; 99(18): 11854-9).
[0095] 2. Virus Packaging and Purification
[0096] The present disclosure uses HEK293 cells (purchased from
ATCC) as a production cell line, and a conventional three-plasmid
packaging system to produce an AAV viral vector. The experimental
methods used are all conventional methods in the art. (See Xiao
Xiao, Juan Li, and Richard Jude Samulski. Production of high-titer
"recombinant adeno-associated virus vectors in the absence of
helper adenovirus. J. Virol. 1998, 72(3): 2224;).
[0097] 3. Genome Titer Detection
[0098] An appropriate amount of purified AAV sample was taken to
prepare a DNase I digestion reaction mixture according to the
following table (Table 1-1). The DNase I digestion reaction mixture
was incubated at 37.degree. C. for 30 min, and incubated at
75.degree. C. for 10 min, and DNase I was inactivated.
TABLE-US-00005 TABLE 1-1 AAV sample 5 ul 10 .times. Dnase I buffer
5 ul Dnase I 1 ul Rnase-free water 39 ul total 50 ul
[0099] After the treated AAV purified sample was diluted by an
appropriate multiple, the Q-PCR reaction system was prepared
according to the following table (Table 1-2), and the detection was
carried out according to the following procedure.
TABLE-US-00006 TABLE 1-2 Reaction system Reaction procedure
Standard/sample 5 ul 50.degree. C. 2 min 1 cycle Upstream primer
(10 uM) 0.5 ul 95.degree. C. 10 min Downstream primer (10 uM) 0.5
ul 95.degree. C. 15 sec 40 cycles Probe (10 uM) 0.5 ul 60.degree.
C. 30 sec Taqman PCR Mix (2.times.) 10 ul 37.degree. C. 1 sec 1
cycle ddH.sub.2O 3.5 ul
[0100] The list of promoter H1 primer probes used therein is shown
as follows:
TABLE-US-00007 TABLE 1-3 Upstream ATCAACCCGCTCCAAGGAAT SEQ ID No: 4
in primer Sequence Listing Downstream AACACATAGCGACATGCAAA SEQ ID
No: 5 in primer TATTG Sequence Listing Taqman CCCAGTGTCACTAGGCGGGA
SEQ ID No: 6 in probe ACACC Sequence Listing
[0101] The results of packaging yield are shown in Table 2-1
below:
TABLE-US-00008 TABLE 2-1 Package Genome Length Titer Plasmid Name
Virus Vector Name (kb) (vg/ml) pSNAV2.0-H1-shRNA1
ssAAV2/8-H1-shRNA1 0.6 6.90E+10 pSNAV2.0-H1-shRNA1-intron
ssAAV2/8-H1-shRNA1-intron 2.3 7.20E+11 pSNAV2.0-H1-shRNA1-intron1
ssAAV2/8-H1-shRNA1-intron1 3.8 5.05E+12 pSNAV2.0-H1-shRNA1-intron2
ssAAV2/8-H1-shRNA1-intron2 4.6 7.13E+12 pSNAV2.0-H1-shRNA1-intron3
ssAAV2/8-H1-shRNA1-intron3 5.1 7.02E+12 pSNAV2.0-H1-shRNA1-intron4
ssAAV2/8-H1-shRNA1-intron4 6.0 9.41E+9
[0102] As shown in Table 2-1 above, under the circumstance having
the same packaging conditions, the same package scale and the same
final product volume, when the package length was in the range of
3.2 to 5.2 kb, the packaging yield could meet the demand.
Specifically, when the package sequence length was proximate to the
length of the wild type AAV (4.6 kb), i.e., the package length was
4.6 kb and 5.1 kb, the packaging yield was the highest; when the
package sequence length was gradually lower than 3.8 kb, the
packaging yield began to decrease but basically met demand; and
when the package sequence length was 1.5 times the length of the
wild type, the packaging yield reduced significantly.
Example 2: Effect of the Insertion Position of the Stuffer Sequence
on the Expression of the Target Gene, Taking a Single-Stranded AAV
Vector as an Example
[0103] 1. Packaging Plasmid Construction
[0104] The results of Example 1 demonstrate that when the package
length of the single-stranded AAV virus vector was proximate to the
length of the wild type AAV, the viral vector yield could be
ensured. Therefore, the efficacy of different structures which were
constructed by adjusting the length and position of the stuffer
sequence were compared to non-stuffer insertion structure. The
packaged-sequence lengths were kept 4.6 kb when stuffer sequences
were inserted. For the construction of ssAAV2/8-H1-shRNA1-intron2
plasmid vector, see Example 1.
[0105] The pSNAV2.0-H1-shRNA1 plasmid was used as the backbone
plasmid, and the stuffer sequence derived from HPRT-intron
(GenBank: M26434.1) at positions 2161-6160 (4.0 kb) was synthesized
and constructed into the 5' end of the H1 promoter sequence through
using restriction sites of EcoRV and XhoI as insertion sites to
form pSNAV2.0-H1-shRNA1-intron5 plasmid, and the plasmid map is
shown in FIG. 7.
[0106] The pSNAV2.0-H1-shRNA1 plasmid was used as the backbone
plasmid, and the stuffer sequence was synthesized segmentally. The
sequence derived from HPRT-intron (GenBank: M26434.1) at positions
2161-4160 (2.0 kb) was constructed into the 5' end of the H1
promoter sequence through using the restriction sites of EcoRV and
XhoI as insertion sites; and the sequence derived from HPRT-intron
(GenBank: M26434.1) at positions 4161-6160 (2.0 kb) was constructed
into the 3' end of the DNA sequence for expressing shRNA1 through
using the restriction sites of BglII and SalI as the insertion
sites to form pSNAV2.0-H1-shRNA1-intron6 plasmid, and the plasmid
map is shown in FIG. 8.
[0107] The pSNAV2.0-H-shRNA1 plasmid was used as the backbone
plasmid, and the stuffer sequence was synthesized segmentally. The
sequence derived from HPRT-intron (GenBank: M26434.1) at positions
2161-2660 (0.5 kb) was constructed into the 5' end of the H1
promoter sequence through using the restriction sites of EcoRV and
XhoI as the insertion sites; and the sequence derived from
HPRT-intron (GenBank: M26434.1) at positions 2961-5960 (3.5 kb) was
constructed into the 3' end of the DNA sequence for expressing
shRNA1 through using the restriction sites of BglII and SalI as the
insertion sites to form pSNAV2. 0-H1-shRNA1-intron7 plasmid, and
the plasmid map is shown in FIG. 9.
[0108] The pSNAV2.0-H1-shRNA plasmid was used as the backbone
plasmid, and the stuffer sequence was synthesized segmentally. The
sequence derived from HPRT-intron (GenBank: M26434.1) at positions
2161-5660 (3.5 kb) was constructed into the 5' end of the H1
promoter sequence through using the restriction sites of EcoRV and
XhoI as the insertion sites; and the sequence derived from
HPRT-intron (GenBank: M26434.1) at positions 5661-6160 (0.5 kb) was
constructed into the 3' end of the DNA sequence for expressing
shRNA1 through using the restriction sites of BglII and SalI as the
insertion sites to form pSNAV2.0-H1-shRNA1-intron8 plasmid, and
plasmid map is shown in FIG. 10. Other packaging plasmids further
include pR2C8 and Helper, and the construction methods, please see
Example 1.
[0109] 2. Virus packaging and purification
[0110] See Example 1, "2. Virus packaging and purification".
[0111] 3. Genome titer detection
[0112] See Example 1, "3, Genomic titer detection", and the
experimental results are shown in Table 2-2.
TABLE-US-00009 TABLE 2-2 Package Genome Length Titer Plasmid Name
Virus Vector Name (kb) (vg/ml) pSNAV2.0-H1-shRNA1
ssAAV2/8-H1-shRNA1 0.6 3.23E+11 pSNAV2.0-H1-shRNA1-intron2
ssAAV2/8-H1-shRNA1-intron2 4.6 7.50E+12 pSNAV2.0-H1-shRNA1-intron5
ssAAV2/8-H1-shRNA1-intron5 4.6 7.85E+12 pSNAV2.0-H1-shRNA1-intron6
ssAAV2/8-H1-shRNA1-intron6 4.6 7.64E+12 pSNAV2.0-H1-shRNA1-intron7
ssAAV2/8-H1-shRNA1-intron7 4.6 7.90E+12 pSNAV2.0-H1-shRNA1-intron8
ssAAV2/8-H1-shRNA1-intron8 4.6 7.12E+12
[0113] The results of the experiment showed that the yields of the
5 groups of AAV viral vector were comparable. As long as the length
of the packaging sequence was close to the full length of the
wild-type AAV genome, the insertion position of the stuffer
sequence had no effect on the packaging efficiency.
[0114] 4. Expression and Detection of Target shRNA
[0115] HepG2.2.15 cell infection experiments were performed with
the above 5 groups of virus samples at the same multiplicity of
infection (MOI), and the virus infection method was a conventional
method in the art. (For specific experimental methods, see Grieger
J C, Choi V W, Samulski R J. Production and characterization of
adneo-associated viral vectors. Nat Protoc. 2006; 1(3): 1412-28.).
After 24 hours of infection, the supernatant of the cell culture
was harvested every 24 hours. After continuous sampling for 4
times, the drug efficacy related indexes were tested. In this
example, the detection indexes were HbsAg, HbeAg, and HBV DNA in
the cell culture supernatant after infection, and the expression of
the three indexes was compared with the three indexes of the
uninfected HepG2.2.15 cell culture supernatant. The antibody
detection method is a double antibody sandwich method (see the
instructions of Beijing Wantai Biopharmaceutical Kit for details).
The HBV DNA detection method is a Quantitative real-time PCR
method, which is a conventional operation method (see the
instructions of QIAGEN Test Kit for details). The results are shown
in FIGS. 23 to 25 and Table 2-3.
[0116] The results showed that when the stuffer sequence was all
located at the 3' end of the DNA sequence for expressing shRNA1,
the drug had the strongest inhibitory effect on HBV. As can be seen
from the data results in the table, ssAAV2/8-H1-shRNA1-intron2 was
statistically significant relative to the other examples,
P<0.01.
TABLE-US-00010 TABLE 2-3 HBsAg-ELISA Detection Result D0 D1 D2 D3
D4 NC (blank cell) 1 1 1 1 1 ssAAV2/8-H1-shRNA1 1 0.786521 0.652158
0.56321 0.42153 ssAAV2/8-H1-shRNA1-intron2 1 0.48058 0.102326
0.037761 0.017355 ssAAV2/8-H1-shRNA1-intron5 1 0.752658 0.58173
0.409618 0.3049 ssAAV2/8-H1-shRNA1-intron6 1 0.553575 0.299765
0.106104 0.072074 ssAAV2/8-H1-shRNA1-intron7 1 0.437662 0.285195
0.142352 0.074649 ssAAV2/8-H1-shRNA1-intron8 1 0.496668 0.39661
0.239312 0.124853 HBeAg-ELISA Detection Result D0 D1 D2 D3 D4 NC
(blank cell) 1 1 1 1 1 ssAAV2/8-H1-shRNA1 1 0.919418 0.88009
0.831681 0.769969 ssAAV2/8-H1-shRNA1-intron2 1 0.744395 0.609283
0.316461 0.211221 ssAAV2/8-H1-shRNA1-intron5 1 0.919418 0.86009
0.731681 0.729969 ssAAV2/8-H1-shRNA1-intron6 1 0.889595 0.803174
0.524138 0.487348 ssAAV2/8-H1-shRNA1-intron7 1 0.892424 0.823163
0.45785 0.361416 ssAAV2/8-H1-shRNA1-intron8 1 0.857871 0.766679
0.431736 0.249484 HBV DNA Detection Result D0 D1 D2 D3 D4 NC (blank
cell) 1 1 1 1 1 ssAAV2/8-H1-shRNA1 1 1.024779 0.89806 0.816933
0.434332 ssAAV2/8-H1-shRNA1-intron2 1 0.601239 0.533708 0.290499
0.054281 ssAAV2/8-H1-shRNA1-intron5 1 0.924779 0.709806 0.616933
0.334332 ssAAV2/8-H1-shRNA1-intron6 1 0.819469 0.631767 0.337065
0.158961 ssAAV2/8-H1-shRNA1-intron7 1 0.794513 0.663432 0.368956
0.1379 ssAAV2/8-H1-shRNA1-intron8 1 0.904425 0.556691 0.406397
0.282021
Example 3: Effect of Double-Stranded AAV Packaging Capacity on
Yield
[0117] 1. Packaging Plasmid Construction:
[0118] Plasmid vector construction was carried out according to
"Molecular Cloning", pSC-CMV-EGFP was ashuttle plasmid used for
double-stranded AAV packaging. Using BglII and XhoJ as restriction
sites, the H1 promoter and the DNA sequence for expressing shRNA2
(SEQ ID No: 2, hereinafter abbreviated as shRNA2 in the description
of the plasmid) were synthesized to replace the CMV-EGFP sequence
of pSC-CMV-EGFP. The EcoRV restriction site was introduced by
site-directed mutagenesis to form plasmid pSC-H1-shRNA, and the
plasmid map is shown in FIG. 11. The pSC-CMV-EGFP plasmid
construction method is a conventional method in the art (see the
corresponding pAAV-hrGFP vector construction in Wu, J, Zhao, W,
Zhong, L, Han, Z, Li, B, Ma, W et al. (2007). Self-complementary
recombinant adeno-associated viral vectors: packaging capacity and
the role of rep proteins in vector purity. Hum Gene Ther. 2007, 18:
171-182.).
[0119] The pSC-H1-shRNA2 plasmid was used as the backbone plasmid,
and the stuffer sequence intron was synthesized and constructed
into the 3' end of the DNA sequence for expressing shRNA2 through
using the restriction sites of BgII and HindIII as the insertion
sites to form pSC-H1-shRNA2-intron' plasmid, in which intron' was
derived from HPRT-intron (GenBank: M26434.1) at positions 2161-3060
(0.9 kb), and the plasmid map is shown in FIG. 12.
[0120] The pSC-H1-shRNA2 plasmid was used as the backbone plasmid,
and the stuffer sequence intron1' was synthesized and constructed
into the 3' end of the DNA sequence for expressing shRNA2 through
using the restriction sites of BgII and HindIII as the insertion
sites to form pSC-H1-shRNA2-intron1' plasmid, in which intron1' was
derived from HPRT-intron (GenBank: M26434.1) at positions 2161-3460
(1.3 kb), and the plasmid map is shown in FIG. 13.
[0121] The pSC-H1-shRNA2 plasmid was used as the backbone plasmid,
and the stuffer sequence intron2' was synthesized and constructed
into the 3' end of the DNA sequence for expressing shRNA2 through
using the restriction sites of BgII and HindIII as the insertion
sites to form pSC-H1-shRNA2-intron2' plasmid, in which intron2' was
derived from HPRT-intron (GenBank: M26434.1) at positions 2161-3860
(1.7 kb), and the plasmid map is shown in FIG. 14.
[0122] The pSC-H1-shRNA2 plasmid was used as the backbone plasmid,
and the stuffer sequence intron6' was synthesized and constructed
into the 3' end of the shRNA2 expression cassette through using the
restriction sites of BglII and HindIII as the insertion sites to
form the pSC-H1-shRNA2-intron3' plasmid, in which intron6' was
derived from HPRT-intron (GenBank: M26434.1) at positions 2161-4160
(2.0 kb), and the plasmid map is shown in FIG. 15.
[0123] The pSC-H1-shRNA2 plasmid was used as the backbone plasmid,
and the stuffer sequence intron3' was synthesized and constructed
into the 3' end of the DNA sequence for expressing shRNA2 through
using the restriction sites of BgII and HindIII as the insertion
sites to form pSC-H1-shRNA2-intron4' plasmid, in which intron4 was
derived from HPRT-intron (GenBank: M26434.1) at positions 2161-4860
(2.7 kb), and the plasmid map is shown in FIG. 16.
[0124] Other packaging plasmids further include pR2C8 and Helper,
and the construction methods, please see Example 1.
[0125] 2. See Example 1, "2. Virus packaging and purification".
[0126] 3. Genome titer detection
[0127] For the experimental method, see Example 1, "3. Genome titer
detection". The results of packaging yield are shown in Table
2-4:
TABLE-US-00011 TABLE 2-4 Package Genome Length Titer Plasmid Name
Virus Vector Name (kb) (vg/ml) pSC-H1-shRNA2 scAAV2/8-H1-shRNA2 0.6
5.20E+10 pSC-H1-shRNA2-intron' scAAV2/8-H1-shRNA2-intron' 1.5
5.62E+11 pSC-H1-shRNA2-intron1' scAAV2/8-H1-shRNA2-intron1' 1.9
4.56E+12 pSC-H1-shRNA2-intron2' scAAV2/8-H1-shRNA2-intron2' 2.3
4.32E+12 pSC-H1-shRNA2-intron3' scAAV2/8-H1-shRNA2-intron3' 2.6
4.66E+12 pSC-H1-shRNA2-intron4' scAAV2/8-H1-shRNA2-intron4' 3.3
3.82E+10
[0128] The results showed that when the length of the packaging
sequence was proximate to half of the length of the wild-type AAV
genome, i.e., the packaging length was 1.9 kb, 2.3 kb and 2.6 kb,
the packaging yield was the highest; when the length of the
packaging sequence was proximate to a quarter of the length of the
wild type AAV genome or less, the packaging yield began to decrease
significantly; and when the length of the packaging sequence was
proximate to 1.5 times the length of the wild type AAV genome, the
packaging yield was also very low.
Example 4: Effect of the Insertion Position of the Stuffer Sequence
on the Expression of the Target Gene of shRNA, Taking a
Double-Stranded AAV Vector as an Example
[0129] 1. Packaging plasmid construction:
[0130] The results of Example 3 demonstrated that when the
packaging length of the double-stranded AAV viral vector was
proximate to half of the length of the wild-type AAV genome, and
the viral vector yield could be ensured. Therefore, the efficacy of
different structures which were constructed by adjusting the length
and position of the stuffer sequence were compared to non-stuffer
insertion structure. The packaged-sequence lengths were kept 4.6 kb
when stuffer sequences were inserted. For the construction of
scAAV2/8-H1-shRNA2-intron2' plasmid vector, see Example 3.
[0131] The pSC-H1-shRNA2 plasmid was used as the backbone plasmid,
and a stuffer sequence derived from HPRT-intron (GenBank: M26434.1)
at positions 2161-3860 (1.7 kb) was synthesized and constructed
into the 5' end of the H1 promoter sequence through using the
restriction sites of EcoRV and XhoI as insertion sites to form
pSC-H1-shRNA2-intron5', and the plasmid map is shown in FIG.
17.
[0132] The pSC-H1-shRNA2 plasmid was used as the backbone plasmid,
and the stuffer sequence was synthesized segmentally. The sequence
derived from HPRT-intron (GenBank: M26434.1) at positions 2161-3010
(0.85 kb) was constructed into the 5' end of the H1 promoter
sequence through using the restriction sites of EcoRV and XhoI as
the insertion sites; and the sequence derived from HPRT-intron
(GenBank: M26434.1) at positions 3011-3860 (0.85 kb) was
constructed into the 3' end of the DNA sequence for expressing
shRNA2 through using the restriction sites of BglII and SalI as the
insertion sites to form pSC-H1-shRNA2-intron6' plasmid, and the
plasmid map is shown in FIG. 18.
[0133] Other packaging plasmids further include pR2C8 and Helper,
and the construction methods, please see Example 1.
[0134] 2. See Example 1, "2. Virus packaging and purification".
[0135] 3. Genome titer detection
[0136] For the detailed experimental method, see Example 1, "3.
Genome titer detection". The experimental results are shown in
Table 2-5.
TABLE-US-00012 TABLE 2-5 Package Genome Length Titer Plasmid Name
Virus Vector Name (kb) (vg/ml) pSC-H1-shRNA2 scAAV2/8-H1-shRNA2 0.6
5.61E+12 pSC-H1-shRNA2-intron2' scAAV2/8-H1-shRNA2-intron2' 2.3
5.50E+12 pSC-H1-shRNA2-intron5' scAAV2/8-H1-shRNA2-intron5' 2.3
5.85E+12 pSC-H1-shRNA2-intron6' scAAV2/8-H1-shRNA2-intron6' 2.3
5.64E+12
[0137] The results of the experiment showed that the yield of 3
groups of the AAV viral vectors were comparable. As long as the
length of the packaging sequence was close to the full length of
the wild-type AAV genome, the insertion position of the stuffer
sequence had no effect on the packaging efficiency.
[0138] 4. Expression and detection of target gene
[0139] For the experimental method, see Example 2 "4. Expression
and detection of target gene"
[0140] The detection results are shown in FIGS. 26 to 28 and Table
2-6.
TABLE-US-00013 TABLE 2-6 HbsAg-ELISA Detection Result D0 D1 D2 D3
D4 NC (blank cell) 1 1 1 1 1 scAAV2/8-H1-shRNA2 1 0.616521 0.542158
0.50321 0.42243 scAAV2/8-H1-shRNA2-intron2' 1 0.32058 0.122326
0.037761 0.0163 scAAV2/8-H1-shRNA2-intron5' 1 0.552658 0.45173
0.409618 0.304 scAAV2/8-H1-shRNA2-intron6' 1 0.453575 0.299765
0.106104 0.06134 HbeAg-ELISA Detection Result D0 D1 D2 D3 D4 NC
(blank cell) 1 1 1 1 1 scAAV2/8-H1-shRNA2 1 0.719418 0.68019
0.631681 0.6009 scAAV2/8-H1-shRNA2-intron2' 1 0.604395 0.5192
0.32046 0.198625 scAAV2/8-H1-shRNA2-intron5' 1 0.709418 0.66029
0.631681 0.529969 scAAV2/8-H1-shRNA2-intron6' 1 0.689595 0.54031
0.524128 0.48704 HBV DNA Detection Result D0 D1 D2 D3 D4 NC (blank
cell) 1 1 1 1 1 scAAV2/8-H1-shRNA2 1 0.824634 0.70801 0.516223
0.434332 scAAV2/8-H1-shRNA2-intron2' 1 0.501239 0.4387 0.240419
0.054281 scAAV2/8-H1-shRNA2-intron5' 1 0.724701 0.58982 0.51671
0.334332 scAAV2/8-H1-shRNA2-intron6' 1 0.61941 0.591701 0.327015
0.158961
[0141] The results showed that when the stuffer sequence was all
located at the 3' end of the DNA sequence for expressing shRNA2,
its drug had the strongest inhibitory effect on HBV. As can be seen
from the data results in the table, ssAAV2/8-H1-shRNA2-intron2 was
statistically significant relative to the other examples,
P<0.01.
Example 5: Effect of the Insertion Position of the Stuffer Sequence
on the Expression of the Target Gene of a Double Expression
Cassette, Taking a Single-Stranded AAV Vector as an Example
[0142] 1. Packaging Plasmid Construction:
[0143] In this example, the pSNAV2.0-H1-shRNA1 was used as a
backbone plasmid, and the U6 promoter and the DNA sequence for
expressing shRNA3 (SEQ ID No: 3, hereinafter abbreviated as shRNA3
in the description of the plasmid) were synthesized and inserted
into the 3' end of the DNA sequence for expressing shRNA3 to form
the pSNAV2.0-shRNA1-shRNA3 plasmid, and the plasmid map is shown in
FIG. 19. The stuffer sequence was derived from the HPRT-intron
sequence at positions 2161-5880 (GenBank: M26434.1), and the length
and position of the stuffer sequence were adjusted to ensure that
the AAV package length was always 4.6 kb.
[0144] The pSNAV2.0-shRNA1-shRNA3 plasmid was used as the backbone
plasmid, and a stuffer sequence derived from HPRT-intron (GenBank:
M26434.1) at positions 2161-5880 (3.8 kb) was synthesized and
constructed into the 5' end of the H1 promoter sequence through
using the restriction sites of EcoRV and XhoI as insertion sites to
form pSNAV2.0-shRNA1-shRNA3-intron1'', and the plasmid map is shown
in FIG. 20.
[0145] The pSNAV2.0-shRNA1-shRNA3 plasmid was used as the backbone
plasmid, and the stuffer sequence derived from HPRT-intron
(GenBank: M26434.1) at positions 2161-5880 (3.8 kb) was synthesized
and constructed into the 3' end of the DNA sequence for expressing
shRNA3 through using the restriction sites of BgII and SalI as the
restriction sites to form pSNAV2.0-shRNA1-shRNA3-intron2'' plasmid,
and the plasmid map is shown in FIG. 21.
[0146] The pSNAV2.0-shRNA1-shRNA3 plasmid was used as the backbone
plasmid, and the stuffer sequence was synthesized segmentally. The
sequence derived from HPRT-intron (GenBank M26434.1) at positions
2161-4020 (1.9 kb) was constructed into the 5' end of the H1
promoter sequence through using the restriction sites of EcoRV and
XhoI as the insertion sites; and the sequence derived from
HPRT-intron (GenBank M26434.1) at positions 4021-5880 (1.9 kb) was
constructed into the 3' end of the DNA sequence for expressing
shRNA3 through using the restriction sites of BglII and SalI as the
insertion sites to form pSNAV2.0-shRNA-shRNA3-intron3'', and
plasmid map is shown in FIG. 22;
[0147] Other packaging plasmids further include pR2C8 and Helper,
and the construction methods, please see Example 1.
[0148] 2. See Example 1, "2. Virus packaging and purification".
[0149] 3. Genome titer detection
[0150] For the detailed experimental method, see Example 1, "3.
Genome titer detection". The experimental results are shown in
Table 2-7.
TABLE-US-00014 TABLE 2-7 Package Genome Length Titer Plasmid Name
Virus Vector Name (kb) (vg/ml) pSNAV2.0-shRNA1-shRNA3-intron1''
ssAAV2/8-shRNA1-shRNA3-intron1'' 4.6 6.53E+12
pSNAV2.0-shRNA1-shRNA3-intron2'' ssAAV2/8-shRNA1-shRNA3-intron2''
4.6 6.82E+12 pSNAV2.0-shRNA1-shRNA3-intron3''
ssAAV2/8-shRNA1-shRNA3-intron3'' 4.6 6.64E+12
[0151] The results of the experiment showed that the yield of the 3
groups of the AAV viral vectors were comparable. As long as the
length of the packaging sequence was close to the full length of
the wild-type AAV genome, the insertion position of the stuffer
sequence had no effect on the packaging efficiency.
[0152] 4. Expression and Detection of Target Gene
[0153] See Example 2 "4. Expression and detection of target
gene"
[0154] The detection results are shown in FIGS. 29 to 31 and Table
2-8.
TABLE-US-00015 TABLE 2-8 HbsAg-ELISA Detection Result D0 D1 D2 D3
D4 NC (blank cell) 1 1 1 1 1 ssAAV2/8-shRNA1-shRNA3-intron1'' 1
0.730654 0.51113 0.302461 0.211049 ssAAV2/8-shRNA1-shRNA3-intron2''
1 0.45057 0.10112 0.027862 0.015342
ssAAV2/8-shRNA1-shRNA3-intron3'' 1 0.503505 0.227565 0.102107
0.062175 HbeAg-ELISA Detection Result D0 D1 D2 D3 D4 NC (blank
cell) 1 1 1 1 1 ssAAV2/8-shRNA1-shRNA3-intron1'' 1 0.81041 0.76119
0.630601 0.529762 ssAAV2/8-shRNA1-shRNA3-intron2'' 1 0.64039
0.53528 0.30606 0.111025 ssAAV2/8-shRNA1-shRNA3-intron3'' 1
0.709091 0.623104 0.42453 0.384341 HBV DNA Detection Result D0 D1
D2 D3 D4 NC (blank cell) 1 1 1 1 1 ssAAV2/8-shRNA1-shRNA3-intron1''
1 0.724712 0.6097 0.51153 0.300382 ssAAV2/8-shRNA1-shRNA3-intron2''
1 0.501215 0.433711 0.270494 0.043271
ssAAV2/8-shRNA1-shRNA3-intron3'' 1 0.709407 0.581564 0.307165
0.152945
[0155] The results showed that when the stuffer sequence was all
located at the 3' end of the DNA sequence for expressing shRNA3,
the drug had the strongest inhibitory effect on HBV. As can be seen
from the data results in the table,
ssAAV2/8-shRNA1-shRNA3-intron2'' was statistically significant
relative to the other examples, P<0.01.
Example 6: Effect of the Insertion Position of the Stuffer Sequence
on the Expression of the Target Gene in Multi-Serotype AAV
Vector
[0156] 1. Packaging Plasmid Construction:
[0157] Shuttle plasmid pSNAV2.0-H1-shRNA1-intron5 (corresponding to
ssAAV-H1-shRNA1-intron5 virus packaging),
pSNAV2.0-H1-shRNA1-intron2 (corresponding to
ssAAV-H1-shRNA1-intron2 virus packaging),
pSNAV2.0-H1-shRNA1-intron6 (corresponding to
ssAAV-H1-shRNA1-intron6 virus packaging) have been constructed, see
Example 2 "Packaging Plasmid Construction" for details. The
structural plasmid was pR2C2, or pR2C3, or pR2C5, or pR2C7, or
pR2MH31, or pR2MH39, or pR2MH43, or pR2MH47, or pR2MH31. The
different serotype-derived cap genes were synthesized products,
thus pR2C8 plasmid cap gene were replaced (where MH31, MH39, MH43,
MH47 were from U.S. Pat. No. 9,186,419). A helper plasmid is also
needed and its construction methods is the same as Example 1
[0158] 2. See Example 1, "2. Virus packaging and purification".
[0159] 3. Genome titer detection
[0160] For the experimental method, see Example 1, "3. Genome titer
detection". The experimental results are shown in Table 2-9.
TABLE-US-00016 TABLE 2-9 Package Genome Length Titer Virus Vector
Name (kb) (vg/ml) ssAAV2/2-H1-shRNA1-intron5 4.6 6.50E+12
ssAAV2/2-H1-shRNA1-intron2 4.6 6.85E+12 ssAAV2/2-H1-shRNA1-intron6
4.6 6.64E+12 ssAAV2/3-H1-shRNA1-intron5 4.6 6.95E+12
ssAAV2/3-H1-shRNA1-intron2 4.6 6.10E+12 ssAAV2/3-H1-shRNA1-intron6
4.6 6.94E+12 ssAAV2/5-H1-shRNA1-intron5 4.6 6.40E+12
ssAAV2/5-H1-shRNA1-intron2 4.6 6.30E+12 ssAAV2/5-H1-shRNA1-intron6
4.6 6.60E+12 ssAAV2/7-H1-shRNA1-intron5 4.6 6.43E+12
ssAAV2/7-H1-shRNA1-intron2 4.6 6.11E+12 ssAAV2/7-H1-shRNA1-intron6
4.6 6.17E+12 ssAAV2/MH31-H1-shRNA1-intron5 4.6 6.51E+12
ssAAV2/MH31-H1-shRNA1-intron2 4.6 6.75E+12
ssAAV2/MH31-H1-shRNA1-intron6 4.6 6.44E+12
ssAAV2/MH39-H1-shRNA1-intron5 4.6 6.55E+12
ssAAV2/MH39-H1-shRNA1-intron2 4.6 6.18E+12
ssAAV2/MH39-H1-shRNA1-intron6 4.6 6.24E+12
ssAAV2/MH43-H1-shRNA1-intron5 4.6 6.43E+12
ssAAV2/MH43-H1-shRNA1-intron2 4.6 6.39E+12
ssAAV2/MH43-H1-shRNA1-intron6 4.6 6.67E+12
ssAAV2/MH47-H1-shRNA1-intron5 4.6 6.34E+12
ssAAV2/MH47-H1-shRNA1-intron2 4.6 6.81E+12
ssAAV2/MH47-H1-shRNA1-intron6 4.6 6.67E+12
[0161] The experiment results show that the yield of AAV viral
vectors in the same serotype of 3 groups were comparable. As long
as the length of the packaging sequence was proximate to the full
length of the wild-type AAV genome, the insertion position of the
stuffer sequence had no effect on the packaging efficiency.
[0162] 4. Expression and detection of target gene
[0163] See Example 2 "4. Expression and detection of target
gene".
[0164] The detection results are shown in FIGS. 31 to 38 and Table
2-10.
TABLE-US-00017 TABLE 2-10 HbsAg-ELISA Detection Result D0 D1 D2 D3
D4 NC (blank cell) 1 1 1 1 1 ssAAV2/2-H1-shRNA1-intron5 1 0.930675
0.610601 0.333202 0.203432 ssAAV2/2-H1-shRNA1-intron2 1 0.730533
0.259904 0.178197 0.084962 ssAAV2/2-H1-shRNA1-intron6 1 0.862387
0.380989 0.20192 0.15791 ssAAV2/3-H1-shRNA1-intron5 1 0.88453
0.535058 0.442984 0.188561 ssAAV2/3-H1-shRNA1-intron2 1 0.852413
0.345115 0.116186 0.033372 ssAAV2/3-H1-shRNA-intron6 1 0.817118
0.43886 0.207146 0.124495 ssAAV2/5-H1-shRNA-intron5 1 0.909219
0.75665 0.468068 0.434745 ssAAV2/5-H1-shRNA1-intron2 1 0.893479
0.499484 0.332277 0.211844 ssAAV2/5-H1-shRNA1-intron6 1 0.829574
0.676569 0.311333 0.272052 ssAAV2/7-H1-shRNA1-intron5 1 0.88453
0.735058 0.542984 0.338561 ssAAV2/7-H1-shRNA1-intron2 1 0.700769
0.57327 0.411992 0.212092 ssAAV2/7-H1-shRNA1-intron6 1 0.742381
0.680966 0.50184 0.482693 ssAAV2/MH31-H1-shRNA1-intron5 1 0.83067
0.412621 0.233202 0.213435 ssAAV2/MH31-H1-shRNA1-intron2 1 0.730531
0.25152 0.078197 0.054962 ssAAV2/MH31-H1-shRNA1-intron6 1 0.722307
0.36095 0.10195 0.082791 ssAAV2/MH39-H1-shRNA1-intron5 1 0.78453
0.235058 0.142984 0.108561 ssAAV2/MH39-H1-shRNA1-intron2 1 0.752401
0.145115 0.017156 0.030071 ssAAV2/MH39-H1-shRNA1-intron6 1 0.81711
0.33886 0.247142 0.12175 ssAAV2/MH43-H1-shRNA1-intron5 1 0.699219
0.55665 0.268068 0.189474 ssAAV2/MH43-H1-shRNA1-intron2 1 0.693479
0.299484 0.132277 0.011844 ssAAV2/MH43-H1-shRNA1-intron6 1 0.729574
0.376569 0.171333 0.053205 ssAAV2/MH47-H1-shRNA1-intron5 1 0.88453
0.53515 0.442984 0.238501 ssAAV2/MH47-H1-shRNA1-intron2 1 0.740769
0.37121 0.111992 0.012152 ssAAV2/MH47-H1-shRNA1-intron6 1 0.742381
0.58191 0.30184 0.182623
[0165] The results showed that as compared with the 3 structural
AAV viral vectors in the same serotype, when the stuffer sequence
was all located at the 3' end of the DNA sequence for expressing
shRNA1, the drug had the strongest inhibitory effect on HBV. As can
be seen from the data results, the drug with a structure in which
the stuffer sequence was all located at the 3' end of the shRNA was
statistically significant relative to the other examples,
P<0.01.
Example 7: Preparation Method of Two Viral Vectors
[0166] The present disclosure also provides two other methods for
packaging the virus, and the AAV viral vector when packaged is not
limited to the above packaging methods.
[0167] 1. Adenovirus (Adv)-assisted packaging method: the packaging
system must include pSNAV2.0-H1-shRNA1, pAAV2/8, and Ad5 virus
solution. The cell line used in the packaging method was HeLa
cells. After 24 hours of transfection with the two plasmids, the
cells were auxiliary infected with Ad5 to obtain
ssAAV2/8-H1-shRNA1. (See, in particular, J Y Dong, P D Fan, Raymond
A, Frizzell. Quantitative analysis of the packaging capacity of
recombinant adeno-associated virus. Human Gene Therapy, 1996,
7:2101-2112. and Example 1). ssAAV2/8-H1-shRNA1-intron,
ssAAV2/8-H1-shRNA1-intron1, ssAAV2/8-H1-shRNA1-intron2,
ssAAV2/8-H1-shRNA1-intron3, ssAAV2/8-H1-shRNA1-Intron4, and
ssAAV2/8-H1-shRNA1 were sequentially synthesized according to the
same method. See Example 1 for subsequent viral purification and
detection methods.
[0168] 2. Baculovirus packaging system: this method needs to
construct three plasmids pFBD-cap8, pFBD-rep2, pFB-shRNA1
(pFB-shRNA1 original vector pFB-EGFP, engineered according to
"Molecular Cloning") respectively. They were transformed into
DH10Bac competent cells to form three bacmid Bac-cap8, Bac-rep2,
and Bac-GFP. Then, SF9 cells were infected respectively to obtain a
baculovirus containing three gene expression cassettes. SF9 cells
were simultaneously infected with three baculoviruses to produce
ssAAV2/8-H1-shRNA1. (For specific methods, see Haifeng Chen. Intron
splicing-mediated expression of AAV rep and cap genes and
production of AAV vectors in insect cells. Mol Ther. 2008 May;
16(5): 924-30. and Example 1). ssAAV2/8-H1-shRNA1-intron,
ssAAV2/8-H1-shRNA1-intron1, ssAAV2/8-H1-shRNA1-intron2,
ssAAV2/8-H1-shRNA1-intron3, ssAAV2/8-H1-shRNA1-Intron4, and
ssAAV2/8-H1-shRNA1 were sequentially synthesized according to the
same method. See Example 1 for subsequent viral purification and
detection methods.
[0169] This method can also be modified to construct cap and rep
into the same baculovirus, and finally form two baculovirus
co-infections to achieve the purpose of producing AAV.
TABLE-US-00018 TABLE 2-11 Package Genome Packing Length Titer Virus
Vector Name Method (kb) (vg/ml) ssAAV2/8-H1-shRNA1 Ad-assisted 0.6
6.6E+9 two plasmids packaging ssAAV2/8-H1-shRNA1-intron Ad-assisted
2.3 6.03E+10 two plasmids packaging ssAAV2/8-H1-shRNA1-intron1
Ad-assisted 3.8 6.25E+11 two plasmids packaging
ssAAV2/8-H1-shRNA1-intron2 Ad-assisted 4.6 6.78E+11 two plasmids
packaging ssAAV2/8-H1-shRNA1-intron3 Ad-assisted 5.1 6.62E+11 two
plasmids packaging ssAAV2/8-H1-shRNA1-intron4 Ad-assisted 6.0
5.99E+8 two plasmids packaging ssAAV2/8-H1-shRNA1 Baculovirus 0.6
7.12E+11 packaging ssAAV2/8-H1-shRNA1-intron Baculovirus 2.3
7.65E+12 packaging ssAAV2/8-H1-shRNA1-intron1 Baculovirus 3.8
7.44E+13 packaging ssAAV2/8-H1-shRNA1-intron2 Baculovirus 4.6
7.32E+13 packaging ssAAV2/8-H1-shRNA1-intron3 Baculovirus 5.1
7.58E+13 packaging ssAAV2/8-H1-shRNA1-intron4 Baculovirus 6.0
6.95E+10 packaging
[0170] The above experimental results showed that no matter which
virus packaging system was selected, the appropriate length of the
stuffer sequence was selected, such that the length of the
packaging sequence was proximate to the length of the AAV wild type
genome, that was 3.8 kb to 5.1 kb, and the high packaging
efficiency could be ensured.
Example 8: In Vivo Pharmacodynamic Experiment
[0171] Two drugs having two structures scAAV2/8-H1-shRNA2-intron2
and scAAV2/8-H1-shRNA2-intron5 were compared with the commercial
drugs lamivudine and entecavir for evaluating in vivo efficacy. The
administration mode was intravenous injection, and 14 days was a
blood collection period. After separating serum samples, HBsAg and
HBV DNA were detected. The grouping of animal experiments is shown
as follows:
TABLE-US-00019 HBV transgenic BALB/c Number of Dose animals Group
Drug administration (vg/animal) (n) 1 DPBS 0.2 6 ml/animal 2
Lamivudine (LAM) 150 mg/kg 6 3 Entecavir (ETV) 3.2 mg/kg 6 4
scAAV2/8-H1-shRNA2-intron2 3 .times. 10.sup.10 6 5
scAAV2/8-H1-shRNA2-intron5 1.5 .times. 10.sup.11 6
[0172] The experiment was conducted for total of 26 days (38
weeks). For the experimental method, see Example 2 "4. Expression
and detection of target gene" The detection results are shown in
FIG. 40 and Table 2-12 (BsAg detection), and FIG. 41 and Table 2-13
(BV DNA detection).
TABLE-US-00020 TABLE 2-12 BlooD collection time Sample grouping D 0
D 14 D 28 D 35 D 49 D 70 D 98 D 126 D 154 D 182 D 210 D 238 D 266
DPBS 1 0.87 0.84 1.09 0.89 1.07 0.97 1.02 0.36 0.5 0.61 0.27 0.44
LAM 1 0.98 0.96 1.23 1.21 1.01 1.19 1.46 0.66 0.76 1.16 0.5 0.54
ETV 1 1.51 1.55 1.8 1.4 1.33 1.34 1.48 0.75 0.81 1.57 0.83 0.94
scAAV2/8-H1- 1 0.04 0.07 0.09 0.1 0.07 0.11 0.14 0.11 0.14 0.13
0.07 0.05 shRNA2-intron2 scAAV2/8-H1- 1 0.07 0.03 0.04 0.04 0.17
0.12 0.17 0.15 0.18 0.09 0.03 0.05 shRNA2-intron5
TABLE-US-00021 TABLE 2-13 D 0 D 14 D 28 D 35 D 49 D 70 D 98 D 126 D
154 D 182 D 210 D 238 D 266 DPBS 1 1.13 2.85 2 2.18 2.1 2.72 1.02
1.68 3.23 3.27 4.77 4.02 LAM 1 0.69 0.87 0.72 0.68 1.26 0.41 0.24
0.56 0.8 0.28 0.26 0.07 ETV 1 8.68 1.24 1.08 1.25 3.93 1.05 0.72
1.06 3.33 5.5 2.96 1.55 scAAV2/8-H1- 1 1.17 1.58 0.8 0.57 1.71 0.51
0.32 0.42 0.8 1.11 0.88 1.04 shRNA2-intron2 scAAV2/8-H1- 1 0.7 1.02
0.96 1.21 2.9 0.63 0.56 0.55 1.63 2.87 2.36 1.2 shRNA2-intron5
[0173] As can be seen from the above, when the dose of
scAAV2/8-H1-shRNA2-intron5 was 5 times that of
scAAV2/8-H1-shRNA2-intron2, the two drugs had equivalent levels of
inhibition on HBsAg in the serum of model animals. After D14, the
inhibitory effect reached the strongest, and the inhibition lasted
until D266 days. The pharmacodynamic effects of the two drugs
having two structures were stronger than those of the commercial
drugs, in which the drug having the structure of
scAAV2/8-H1-shRNA2-intron2 had the same level of inhibition on HBV
DNA in the serum of the model animal as the dose of lamivudine, and
the drug having the structure of scAAV2/8-H1-shRNA2-intron5 had a
slightly lower level of inhibition on HBV DNA in the serum of the
model animal.
Sequence CWU 1
1
32151DNAArtificial SequenceArtificial Primar 1cctattgatt ggaaagtatg
tttcaagaga acatactttc caatcaatag g 51247DNAArtificial
SequenceArtificial Primar 2gtgtgcactt cgcttcacct tcaagagagg
tgaagcgaag tgcacac 47347DNAArtificial SequenceArtificial Primar
3ggtatgttgc ccgtttgtct tcaagagaga caaacgggca acatacc
47420DNAArtificial SequenceArtificial Primar 4atcaacccgc tccaaggaat
20525DNAArtificial SequenceArtificial Primar 5aacacatagc gacatgcaaa
tattg 25625DNAArtificial SequenceArtificial Primar 6cccagtgtca
ctaggcggga acacc 25721DNAArtificial SequenceArtificial Primar
7catcctgctg ctatgcctca t 21822DNAArtificial SequenceArtificial
Primar 8aaggtatgtt gcccgtttgt cc 22925DNAArtificial
SequenceArtificial Primar 9cctattgatt ggaaagtatg tcaaa
251023DNAArtificial SequenceArtificial Primar 10tcgccaactt
acaaggcctt tct 231120DNAArtificial SequenceArtificial Primar
11tgtgctgcca actggatcct 201222DNAArtificial SequenceArtificial
Primar 12ccgtgtgcac ttcgcttcac ct 221327DNAArtificial
SequenceArtificial Primar 13ggaggctgta ggcataaatt ggtctgt
271421DNAArtificial SequenceArtificial Primar 14ggagtgtgga
ttcgcactcc t 211524RNAArtificial SequenceArtificial Primar
15aucaaugagg aagcugcaga augg 241627RNAArtificial SequenceArtificial
Primar 16gggaagugac auagcaggaa cuacuag 271729RNAArtificial
SequenceArtificial Primar 17uaaauaaaau aguaagaaug uauagcccu
291819RNAArtificial SequenceArtificial Primar 18uaugggguac
cugugugga 191924RNAArtificial SequenceArtificial Primar
19gccaauuccc auacauuauu gugc 242021RNAArtificial SequenceArtificial
Primar 20uuaaauggca gucuagcaga a 212126RNAArtificial
SequenceArtificial Primar 21accacacaca aggcuacuuc ccugau
262223RNAArtificial SequenceArtificial Primar 22acagccgccu
agcauuucau cac 232327RNAArtificial SequenceArtificial Primar
23ggauggugcu ucaagcuagu accaguu 272420RNAArtificial
SequenceArtificial Primar 24ugaguaucau cgugugaaag
202519RNAArtificial SequenceArtificial Primar 25uccuuucauc
ucugggcuc 192627RNAArtificial SequenceArtificial Primar
26aacuuccucu uuaacagaaa agcauac 272727RNAArtificial
SequenceArtificial Primar 27aacuuccucu uuaacagaaa agcauac
272820RNAArtificial SequenceArtificial Primar 28caaggaaguu
ggcauuucaa 202919RNAArtificial SequenceArtificial Primar
29uuccgaauaa acuccaggc 193019RNAArtificial SequenceArtificial
Primar 30aaccgcaguu cuuuguagg 193119RNAArtificial
SequenceArtificial Primar 31uugguauuca gugugauga
193219RNAArtificial SequenceArtificial Primar 32ucaucacacu
gaauaccaa 19
* * * * *