U.S. patent application number 17/120037 was filed with the patent office on 2021-04-08 for variant libraries of the immunological synapse and synapse and synthesis thereof.
The applicant listed for this patent is Twist Bioscience Corporation. Invention is credited to Siyuan CHEN, Anthony COX.
Application Number | 20210102198 17/120037 |
Document ID | / |
Family ID | 1000005290077 |
Filed Date | 2021-04-08 |
![](/patent/app/20210102198/US20210102198A1-20210408-D00001.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00002.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00003.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00004.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00005.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00006.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00007.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00008.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00009.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00010.png)
![](/patent/app/20210102198/US20210102198A1-20210408-D00011.png)
View All Diagrams
United States Patent
Application |
20210102198 |
Kind Code |
A1 |
COX; Anthony ; et
al. |
April 8, 2021 |
VARIANT LIBRARIES OF THE IMMUNOLOGICAL SYNAPSE AND SYNAPSE AND
SYNTHESIS THEREOF
Abstract
Disclosed herein are methods for the generation of highly
accurate nucleic acid libraries encoding for predetermined variants
of a nucleic acid sequence. The nucleic acid sequence may encode
for all or part of a reference domain of a CAR. The degree of
variation may be complete, resulting in a saturated variant
library, or less than complete, resulting in a non-saturating
library of variants. The variant nucleic acid libraries described
herein may be designed for further processing by transcription or
translation. The variant nucleic acid libraries described herein
may be designed to generate variant RNA, DNA and/or protein
populations. Further provided herein are method for identifying
variant species with increased or decreased activities, with
applications in regulating biological functions and the design of
therapeutics for treatment or reduction of a disease, such as
cancer.
Inventors: |
COX; Anthony; (Mountain
View, CA) ; CHEN; Siyuan; (San Mateo, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Twist Bioscience Corporation |
South San Francisco |
CA |
US |
|
|
Family ID: |
1000005290077 |
Appl. No.: |
17/120037 |
Filed: |
December 11, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15921537 |
Mar 14, 2018 |
10894959 |
|
|
17120037 |
|
|
|
|
62471810 |
Mar 15, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6806 20130101;
C12N 15/1093 20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10; C12Q 1/6806 20060101 C12Q001/6806 |
Claims
1. A nucleic acid library, the nucleic acid library comprising at
least 10,000 nucleic acids, wherein each nucleic acid encodes for a
preselected variant of a reference sequence that encodes for a
chimeric antigen receptor or a functional domain thereof.
2. The nucleic acid library of claim 1, wherein the functional
domain of the chimeric antigen receptor comprises an antigen
recognition domain, a hinge domain, a transmembrane domain, or an
intracellular domain.
3. The nucleic acid library of claim 1, wherein the library
comprises at least 1,000,000 nucleic acids.
4. The nucleic acid library of claim 1, wherein each nucleic acid
is 100 bases to 2000 bases in length.
5. The nucleic acid library of claim 1, wherein each nucleic acid
is attached to a vector sequence.
6. The nucleic acid library of claim 5, wherein the vector sequence
is a viral vector sequence.
7. A nucleic acid library, the nucleic acid library comprising a
plurality of nucleic acids, wherein each nucleic acid encodes for a
preselected variant of a reference sequence that encodes for a
chimeric antigen receptor or a functional domain thereof, wherein
the plurality of nucleic acids comprises all variations for at
least two positions in the reference sequence, and wherein the at
least two positions encode sequences from 5 to 20 different
codons.
8. The nucleic acid library of claim 7, wherein the functional
domain of the chimeric antigen receptor comprises an antigen
recognition domain, a hinge domain, a transmembrane domain, or an
intracellular domain.
9. The nucleic acid library of claim 7, wherein the plurality of
nucleic acids comprises all variations for 2, 3, 4, or 5 positions
in the reference sequence.
10. The nucleic acid library of claim 7, wherein the at least two
positions encode sequences from 10 to 20 different codons.
11. The nucleic acid library of claim 7, wherein the at least two
positions encode sequences for about 10 different codons.
12. The nucleic acid library of claim 7, wherein each nucleic acid
is 100 bases to 2000 bases in length.
13. An oligonucleotide library, the oligonucleotide library
comprising at least 10,000 oligonucleotides, wherein each
oligonucleotide encodes for a preselected variant of a reference
sequence that encodes for a region of a chimeric antigen receptor,
wherein the region comprises a portion of an antigen recognition
domain, a hinge domain, a transmembrane domain, or an intracellular
domain.
14. The oligonucleotide library of claim 13, wherein the library
comprises at least 1,000,000 oligonucleotides.
15. The oligonucleotide library of claim 13, wherein each
oligonucleotide is 12 to 500 bases in length.
16. The oligonucleotide library of claim 13, wherein each
oligonucleotide is attached to a vector sequence.
17. An oligonucleotide library, the oligonucleotide library
comprising a plurality of oligonucleotides, wherein each
oligonucleotide encodes for a preselected variant of a reference
sequence that encodes for a region of a chimeric antigen receptor,
wherein the region comprises a portion of an antigen recognition
domain, a hinge domain, a transmembrane domain, or an intracellular
domain, wherein each oligonucleotide is at least 12 bases in
length, wherein the plurality of oligonucleotides comprises all
variations for at least two positions in the reference sequence,
and wherein the at least two positions encode sequences from 5 to
20 different codons.
18. The oligonucleotide library of claim 17, wherein the plurality
of oligonucleotides comprises all variations for 2, 3, 4, or 5
positions.
19. The oligonucleotide library of claim 17, wherein the at least
two positions encode sequences from 10 to 20 different codons.
20. The oligonucleotide library of claim 17, wherein the at least
two positions encode sequences for about 10 different codons.
21. The oligonucleotide library of claim 17, wherein each
oligonucleotide is 12 to 500 bases in length.
22. A nucleic acid library comprising at least 400 nucleic acids,
wherein a first plurality of the at least 400 nucleic acids encodes
for a variant of a reference sequence that encodes for an antigen
recognition domain, and wherein a second plurality of the at least
400 nucleic acids encodes for a variant of a reference sequence
that encodes for a hinge domain, a transmembrane domain, or an
intracellular domain of a chimeric antigen receptor (CAR).
23. The nucleic acid library of claim 22, wherein each nucleic acid
is at least 100 bases in length.
24. The nucleic acid library of claim 22, wherein each nucleic acid
is 100 to 2000 bases in length.
25. The nucleic acid library of claim 22, wherein the first
plurality of the at least 400 nucleic acids comprises all
variations for at least two positions in the reference
sequence.
26. The nucleic acid library of claim 22, wherein the first
plurality of the at least 400 nucleic acids comprises all
variations for 2, 3, 4, or 5 positions in the reference
sequence.
27. The nucleic acid library of claim 22, wherein the second
plurality of the at least 400 nucleic acids comprises all
variations for at least two positions in the reference
sequence.
28. The nucleic acid library of claim 22, wherein the second
plurality of the at least 400 nucleic acids comprises all
variations for 2, 3, 4, or 5 positions in the reference
sequence.
29. The nucleic acid library of claim 25, wherein the at least two
positions encode sequences from 5 to 20 different codons.
30. The nucleic acid library of claim 25, wherein the at least two
positions encode sequences from 10 to 20 different codons.
31. The nucleic acid library of claim 25, wherein the at least two
positions encode sequences for about 10 different codons.
Description
CROSS-REFERENCE
[0001] This application is a divisional of U.S. patent application
Ser. No. 15/921,537, filed on Mar. 14, 2018, which claims benefit
of U.S. Provisional Patent Application No. 62/471,810 filed on Mar.
15, 2017, which are incorporated herein by reference in their
entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Mar. 9, 2018, is named 44854-733_401_SL.txt and is 19,476 bytes
in size.
BACKGROUND
[0003] The cornerstone of synthetic biology is the design, build,
and test process--an iterative process that requires DNA, to be
made accessible for rapid and affordable generation and
optimization of these custom pathways and organisms. In the design
phase, the A, C, T and G nucleotides that constitute DNA are
formulated into the various gene sequences that would comprise the
locus or the pathway of interest, with each sequence variant
representing a specific hypothesis that will be tested. These
variant gene sequences represent subsets of sequence space, a
concept that originated in evolutionary biology and pertains to the
totality of sequences that make up genes, genomes, transcriptome
and proteome.
[0004] Many different variants are typically designed for each
design-build-test cycle to enable adequate sampling of sequence
space and maximize the probability of an optimized design. Though
straightforward in concept, process bottlenecks around speed,
throughput and quality of conventional synthesis methods dampen the
pace at which this cycle advances, extending development time. The
inability to sufficiently explore sequence space due to the high
cost of acutely accurate DNA and the limited throughput of current
synthesis technologies remains the rate-limiting step.
[0005] Beginning with the build phase, two processes are
noteworthy: oligonucleotide synthesis and gene synthesis.
Historically, synthesis of different gene variants was accomplished
through molecular cloning. While robust, this approach is not
scalable. Early chemical gene synthesis efforts focused on
producing a large number of oligonucleotides with overlapping
sequence homology. These were then pooled and subjected to multiple
rounds of polymerase chain reaction (PCR), enabling concatenation
of the overlapping oligonucleotides into a full length double
stranded gene. A number of factors hinder this method, including
time-consuming and labor-intensive construction, requirement of
high volumes of phosphoramidites, an expensive raw material, and
production of nanomole amounts of the final product, significantly
less than required for downstream steps, and a large number of
separate oligonucleotides required one 96 well plate to set up the
synthesis of one gene.
[0006] Synthesizing oligonucleotides on microarrays provided a
significant increase in the throughput of gene synthesis. A large
number of oligonucleotides could be synthesized on the microarray
surface, then cleaved off and pooled together. Each oligonucleotide
destined for a specific gene contains a unique barcode sequence
that enabled that specific subpopulation of oligonucleotides to be
depooled and assembled into the gene of interest. In this phase of
the process, each subpool is transferred into one well in a 96 well
plate, increasing throughput to 96 genes. While this is two orders
of magnitude higher in throughput than the classical method, it
still does not adequately support the design, build, test cycles
that require thousands of sequences at one time due to a lack of
cost efficiency and slow turnaround times. Thus, there is a need
for more efficient generation of variant sequence libraries.
[0007] The immune system has the ability to seek and destroy
harmful cells. T cells play an important role in such a process. As
such, therapies comprising genetically modified T cells to teach
the immune system to recognize and eliminate malignant cells are
alternative therapies that may be used to treat diseases such as
cancer. In particular, genetically modified T cells that express
chimeric antigen receptors (CARs) may be designed to target
deleterious cells, such as cancer cells. However, CAR therapies
require further optimization due to their ability to cause
undesirable effects such as on-target off-tumor toxicity,
autoimmunity, host-graft toxicity, and sometimes death. Thus, there
is a need for improved compositions and methods for cancer
therapies utilizing CAR therapies.
INCORPORATION BY REFERENCE
[0008] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
BRIEF SUMMARY
[0009] Provided herein are nucleic acid libraries, wherein the
nucleic acid library comprises at least 10,000 nucleic acids,
wherein each nucleic acid encodes for a preselected variant of a
reference sequence that encodes for a chimeric antigen receptor or
a functional domain thereof. Further provided herein are nucleic
acid libraries, wherein the functional domain of the chimeric
antigen receptor comprises an antigen recognition domain, a hinge
domain, a transmembrane domain, or an intracellular domain. Further
provided herein are nucleic acid libraries, wherein the library
comprises at least 1,000,000 nucleic acids. Further provided herein
are nucleic acid libraries, wherein each nucleic acid is 100 bases
to 2000 bases in length. Further provided herein are nucleic acid
libraries, wherein each nucleic acid is attached to a vector
sequence. Further provided herein are nucleic acid libraries,
wherein the vector sequence is a viral vector sequence.
[0010] Provided herein are nucleic acid libraries, wherein the
nucleic acid library comprises a plurality of nucleic acids,
wherein each nucleic acid encodes for a preselected variant of a
reference sequence that encodes for a chimeric antigen receptor or
a functional domain thereof, wherein the plurality of nucleic acids
comprises all variations for at least two positions in the
reference sequence, and wherein the at least two positions encode
sequences from 5 to 20 different codons. Further provided herein
are nucleic acid libraries, wherein the functional domain of the
chimeric antigen receptor comprises an antigen recognition domain,
a hinge domain, a transmembrane domain, or an intracellular domain.
Further provided herein are nucleic acid libraries, wherein the
plurality of nucleic acids comprises all variations for 2, 3, 4, or
5 positions in the reference sequence. Further provided herein are
nucleic acid libraries, wherein the at least two positions encode
sequences from 10 to 20 different codons. Further provided herein
are nucleic acid libraries, wherein the at least two positions
encode sequences for about 10 different codons. Further provided
herein are nucleic acid libraries, wherein each nucleic acid is 100
bases to 2000 bases in length.
[0011] Provided herein are oligonucleotide libraries, the
oligonucleotide library comprising at least 10,000
oligonucleotides, wherein each oligonucleotide encodes for a
preselected variant of a reference sequence that encodes for a
region of a chimeric antigen receptor, wherein the region comprises
a portion of an antigen recognition domain, a hinge domain, a
transmembrane domain, or an intracellular domain. Further provided
herein are oligonucleotide libraries, wherein the library comprises
at least 1,000,000 oligonucleotides. Further provided herein are
oligonucleotide libraries, wherein each oligonucleotide is 12 to
500 bases in length. Further provided herein are oligonucleotide
libraries, wherein each oligonucleotide is attached to a vector
sequence.
[0012] Provided herein are oligonucleotide libraries, wherein the
oligonucleotide library comprises a plurality of oligonucleotides,
wherein each oligonucleotide encodes for a preselected variant of a
reference sequence that encodes for a region of a chimeric antigen
receptor, wherein the region comprises a portion of an antigen
recognition domain, a hinge domain, a transmembrane domain, or an
intracellular domain, wherein each oligonucleotide is at least 12
bases in length, wherein the plurality of oligonucleotides
comprises all variations for at least two positions in the
reference sequence, and wherein the at least two positions encode
sequences from 5 to 20 different codons. Further provided herein
are oligonucleotide libraries, wherein the plurality of
oligonucleotides comprises all variations for 2, 3, 4, or 5
positions. Further provided herein are oligonucleotide libraries,
wherein the at least two positions encode sequences from 10 to 20
different codons. Further provided herein are oligonucleotide
libraries, wherein the at least two positions encode sequences for
about 10 different codons. Further provided herein are
oligonucleotide libraries, wherein each oligonucleotide is 12 to
500 bases in length.
[0013] Provided herein are nucleic acid libraries comprising at
least 400 nucleic acids, wherein a first plurality of the at least
400 nucleic acids encodes for a variant of a reference sequence
that encodes for an antigen recognition domain, and wherein a
second plurality of the at least 400 nucleic acids encodes for a
variant of a reference sequence that encodes for a hinge domain, a
transmembrane domain, or an intracellular domain of a chimeric
antigen receptor (CAR). Further provided herein are nucleic acid
libraries, wherein each nucleic acid is at least 100 bases in
length. Further provided herein are nucleic acid libraries, wherein
each nucleic acid is 100 to 2000 bases in length. Further provided
herein are nucleic acid libraries, wherein the first plurality of
the at least 400 nucleic acids comprises all variations for at
least two positions in the reference sequence. Further provided
herein are nucleic acid libraries, wherein the first plurality of
the at least 400 nucleic acids comprises all variations for 2, 3,
4, or 5 positions in the reference sequence. Further provided
herein are nucleic acid libraries, wherein the second plurality of
the at least 400 nucleic acids comprises all variations for at
least two positions in the reference sequence. Further provided
herein are nucleic acid libraries, wherein the second plurality of
the at least 400 nucleic acids comprises all variations for 2, 3,
4, or 5 positions in the reference sequence. Further provided
herein are nucleic acid libraries, wherein the at least two
positions encode sequences from 5 to 20 different codons. Further
provided herein are nucleic acid libraries, wherein the at least
two positions encode sequences from 10 to 20 different codons.
Further provided herein are nucleic acid libraries, wherein the at
least two positions encode sequences for about 10 different
codons.
[0014] Provided herein are methods of synthesizing a nucleic acid
library, comprising: (a) providing a first set of preselected
oligonucleotide sequences encoding for at least 400 sequences of a
chimeric antigen receptor gene or gene fragment, wherein each
sequence comprises at least one variation of at least two
preselected codons for an amino acid residue in an antigen
recognition domain; (b) synthesizing the first set of preselected
oligonucleotide sequences; and (c) screening a first activity for
proteins encoded by the first set of oligonucleotide sequences,
wherein the first activity is specificity, avidity, affinity,
stability, or expression. Further provided herein are methods of
synthesizing a nucleic acid library, wherein the antigen is a
cancer antigen. Further provided herein are methods of synthesizing
a nucleic acid library, wherein the cancer antigen is MAGE A3, MAGE
A12, MAGE A2, MAGE A6, NY-ESO-1, or CEA. Further provided herein
are methods of synthesizing a nucleic acid library, wherein each
sequence comprises up to 100 variations at preselected codons for
amino acid residues in the antigen recognition domain. Further
provided herein are methods of synthesizing a nucleic acid library,
wherein each sequence comprises up to 30 variations at preselected
codons for amino acid residues in the antigen recognition domain.
Further provided herein are methods of synthesizing a nucleic acid
library further comprising (a) providing a second set of
preselected oligonucleotide sequences encoding for at least one
sequence of a chimeric antigen receptor gene or gene fragment,
where each sequence comprises at least one variation at a
preselected codon for an amino acid residue in the chimeric antigen
receptor in a hinge domain, a transmembrane domain, or an
intracellular domain; (b) synthesizing the second set of
preselected oligonucleotide sequences; and (c) screening a second
activity for proteins encoded by the second set of oligonucleotide
sequences, wherein the second activity is specificity, avidity,
affinity, stability, or expression, and wherein the second activity
is different from the first activity.
[0015] Provided herein is an oligonucleotide library, the library
comprising at least 10,000 variant oligonucleotides, wherein each
variant oligonucleotide is at least 12 bases in length, wherein
each variant oligonucleotide encodes for a variant of a reference
sequence that encodes for an antigen recognition domain, a hinge
domain, a transmembrane domain, or an intracellular domain of a
chimeric antigen receptor, and wherein at least 80% of the variant
oligonucleotides have no errors compared to the predetermined
sequences without correcting errors. Further provided herein is an
oligonucleotide library wherein the library comprises at least
1,000,000 variant oligonucleotides. Further provided herein is an
oligonucleotide library, wherein each variant oligonucleotide is 20
to 500 bases in length. Further provided herein is an
oligonucleotide library wherein at least 90% of the variant
oligonucleotides have no errors compared to the predetermined
sequences without correcting errors.
[0016] Provided herein is a nucleic acid library, the library
comprising at least 10,000 variant nucleic acids, wherein each
variant nucleic acid encodes for a variant of a reference sequence
for a chimeric antigen receptor, wherein the variation occurs in
the sequence for an antigen recognition domain, a hinge domain, a
transmembrane domain, or an intracellular domain of a chimeric
antigen receptor, and wherein at least 70% of the variant nucleic
acids have no errors compared to the predetermined sequences
without correcting errors. Further provided herein is a nucleic
acid library wherein the library comprises about 10,000,000 variant
nucleic acids. Further provided herein is a nucleic acid library
wherein each variant nucleic acid is 600 to 3000 bases in length.
Further provided herein is a nucleic acid library wherein each
variant nucleic acid is attached to a vector sequence. Further
provided herein is a nucleic acid library wherein the vector
sequence is a viral vector sequence.
[0017] Provided herein is a method for nucleic acid synthesis, the
method comprising: providing predetermined sequences encoding for a
plurality of non-identical oligonucleotides, wherein each of the
non-identical oligonucleotides is at least 20 bases in length, and
wherein the plurality of non-identical oligonucleotides encodes for
up to 19 variants for each of at least 2 codons compared to at
least one reference sequence, wherein the at least one reference
sequence encodes for a region of an antigen recognition domain, a
hinge domain, a transmembrane domain, or an intracellular domain of
a chimeric antigen receptor; providing a structure having a
surface, wherein the surface comprises clusters of loci for
oligonucleotide extension, each cluster comprising 50 to 500 loci;
synthesizing the plurality of non-identical oligonucleotides,
wherein each of the non-identical oligonucleotides extends from a
separate locus; and performing an amplification reaction to
assemble a library of variant nucleic acids, wherein the
amplification reaction comprises mixing the plurality of
non-identical oligonucleotides from a single cluster with a DNA
polymerase and the at least one reference sequence. Further
provided herein is a method wherein each cluster further comprises
additional oligonucleotides, and wherein the plurality of
non-identical oligonucleotides and the additional oligonucleotides
within said cluster collectively encode for a single gene and
variants thereof. Further provided herein is a method wherein the
surface of the structure comprises at least 6000 of the clusters.
Further provided herein is a method wherein at least 80% of the
variant nucleic acids have no errors compared to the predetermined
sequences without correcting errors. Further provided herein is a
method wherein at least 90% of the variant nucleic acids have no
errors compared to the predetermined sequences without correcting
errors. Further provided herein is a method wherein a replicate of
each non-identical oligonucleotide extends from the surface at up
to 5 loci. Further provided herein is a method wherein a replicate
of each non-identical oligonucleotide extends from the surface at
up to 3 loci. Further provided herein is a method wherein the
plurality of non-identical oligonucleotides encodes for up to 19
variants for each of at least 3 codons compared to at least one
reference sequence. Further provided herein is a method further
comprising expressing the variant nucleic acid library, wherein
expression of the variant nucleic acid library provides for a
variant protein having improved affinity, improved gene expression,
improved avidity, improved stability, or improved target
specificity compared to the expression product of the reference
sequence.
[0018] Provided herein is a method for nucleic acid synthesis, the
method comprising: providing predetermined sequences encoding for a
plurality of non-identical oligonucleotides, wherein each of the
non-identical oligonucleotides is at least 20 bases in length, and
wherein the plurality of non-identical oligonucleotides encodes for
up to 19 variants for each of at least 2 codons compared to at
least one reference sequence, wherein the at least one reference
sequence encodes for an epitope to a chimeric antigen receptor;
providing a structure having a surface, wherein the surface
comprises clusters of loci for oligonucleotide extension, each
cluster comprising 50 to 500 loci; synthesizing the plurality of
non-identical oligonucleotides, wherein each of the non-identical
oligonucleotides extends from a separate locus; and performing an
amplification reaction to assemble a library of variant nucleic
acids, wherein the amplification reaction comprises mixing the
plurality of non-identical oligonucleotides from a single cluster
with a DNA polymerase and the at least one reference sequence.
Further provided herein is a method wherein the surface of the
structure comprises at least 6000 of the clusters. Further provided
herein is a method wherein at least about 80% of the variant
nucleic acids have no errors compared to the predetermined
sequences without correcting errors. Further provided herein is a
method wherein at least about 90% of the variant nucleic acids have
no errors compared to the predetermined sequences without
correcting errors. Further provided herein is a method wherein a
replicate of each non-identical oligonucleotide extends from the
surface at up to 5 loci. Further provided herein is a method
wherein a replicate of each non-identical oligonucleotide extends
from the surface at up to 3 loci. Further provided herein is a
method wherein the plurality of non-identical oligonucleotides
encodes for up to 19 variants for each of at least 3 codons
compared to at least one reference sequence. Further provided
herein is a method further comprising expressing the variant
nucleic acid library, wherein expression of the variant nucleic
acid library provides for a variant peptide having improved
affinity, improved gene expression, improved avidity, improved
stability, or improved target specificity compared to the
expression product of the reference sequence. Further provided
herein is a method wherein the at least one reference sequence
encodes for the epitope to a chimeric antigen receptor and also for
an epitope to a surface protein expressed by a non-lymphoid
cell.
[0019] Provided herein is a method for nucleic acid synthesis of
nucleic acid libraries for optimization assays, the method
comprising: providing a first set of predetermined sequences
encoding for a first plurality of non-identical oligonucleotides,
wherein each of the non-identical oligonucleotides is at least 20
bases in length, and wherein the first plurality of non-identical
oligonucleotides encodes for up to 19 variants for each of at least
3 codons compared to at least one reference sequence, wherein the
at least one reference sequence encodes for a region of an antigen
recognition domain, a hinge domain, a transmembrane domain, or an
intracellular domain of a chimeric antigen receptor; providing a
second set of predetermined sequences encoding for a second
plurality of non-identical oligonucleotides, wherein each of the
second non-identical oligonucleotides is at least 20 bases in
length, and wherein the second plurality of non-identical
oligonucleotides encodes for up to 19 variants for each of at least
3 codons compared to at least one reference sequence, wherein the
at least one reference sequence encodes for an epitope to the
chimeric antigen receptor; providing a structure having a surface,
wherein the surface comprises clusters of loci for oligonucleotide
extension, each cluster comprising 50 to 500 loci; synthesizing
both the first plurality of non-identical oligonucleotides and the
second plurality of non-identical oligonucleotides, wherein each
non-identical oligonucleotides extends from a separate locus; and
performing an amplification reaction to assemble a first library of
nucleic acids, wherein the amplification reaction comprises mixing
the first plurality of non-identical oligonucleotides from a single
cluster with a DNA polymerase and the at least one reference
sequence; performing an amplification reaction to assemble a second
library of variant nucleic acids, wherein the amplification
reaction comprises mixing the second plurality of non-identical
oligonucleotides from a single cluster with a DNA polymerase and
the at least one reference sequence. Further provided herein is a
method further comprising screening purified protein expression
products of the second library of variant nucleic acids against a
library of cells expressing the first library of variant nucleic
acids, wherein the library of cells comprises populations of cells,
each population of cells expressing a different protein expression
product encoded by the first library of variant nucleic acids.
Further provided herein is a method wherein the at least one
reference sequence for an epitope to the chimeric antigen receptor
also encodes for an epitope to a surface protein expressed by a
non-lymphoid cell.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] FIGS. 1A-1D depict a process workflow for the synthesis of
variant biological molecules incorporating a PCR mutagenesis
step.
[0021] FIGS. 2A-2D depict a process workflow for the generation of
a nucleic acid comprising a nucleic acid sequence which differs
from a reference nucleic acid sequence at a single predetermined
codon site.
[0022] FIGS. 3A-3F depict an alternative workflow for the
generation of a set of nucleic acid variants from a template
nucleic acid, with each variant comprising a different nucleic acid
sequence at a single codon position. Each variant nucleic acid
encodes for a different amino acid at their single codon position,
the different codons represented by X, Y, and Z.
[0023] FIGS. 4A-4E depict a reference amino acid sequence (FIG. 4A)
having a number of amino acids, each residue indicated by a single
circle, and variant amino acid sequences (FIGS. 4B, 4C, 4D, &
4E) generated using methods described herein. The reference amino
acid sequence and variant sequences are encoded by nucleic acids
and variants thereof generated by processes described herein.
[0024] FIGS. 5A-5B depict a reference amino acid sequence (FIG. 5A)
and a library of variant amino acid sequences (FIG. 5B), each
variant comprising a single residue variant (indicated by an "X").
The reference amino acid sequence and variant sequences are encoded
by nucleic acids and variants thereof generated by processes
described herein. FIG. 5A discloses SEQ ID NO: 42 and FIG. 5B
discloses SEQ ID NOS 43-49, respectively, in order of
appearance.
[0025] FIGS. 6A-6B depict a reference amino acid sequence (FIG. 6A)
and a library of variant amino acid sequences (FIG. 6B), each
variant comprising two sites of single position variants. Each
variant is indicated by differently patterned circles. The
reference amino acid sequence and variant sequences are encoded by
nucleic acids and variants thereof generated by processes described
herein.
[0026] FIGS. 7A-7B depict a reference amino acid sequence (FIG. 7A)
and a library of variant amino acid sequences (FIG. 7B), each
variant comprising a stretch of amino acids (indicated by a box
around the circles), each stretch having three sites of position
variants (encoding for histidine) differing in sequence from the
reference amino acid sequence. The reference amino acid sequence
and variant sequences are encoded by nucleic acids and variants
thereof generated by processes described herein.
[0027] FIGS. 8A-8B depict a reference amino acid sequence (FIG. 8A)
and a library of variant amino acid sequences (FIG. 8B), each
variant comprising two stretches of amino acid sequence (indicated
by a box around the circles), each stretch having one site of
single position variants (illustrated by the patterned circles)
differing in sequence from reference amino acid sequence. The
reference amino acid sequence and variant sequences are encoded by
nucleic acids and variants thereof generated by processes described
herein.
[0028] FIGS. 9A-9B depict a reference amino acid sequence (FIG. 9A)
and a library of amino acid sequence variants (FIG. 9B), each
variant comprising a stretch of amino acids (indicated by patterned
circles), each stretch having a single site of multiple position
variants differing in sequence from the reference amino acid
sequence. In this illustration, 5 positions are varied where the
first position has a 50/50 K/R ratio; the second position has a
50/25/25 V/L/S ratio, the third position has a 50/25/25 Y/R/D
ratio, the fourth position has an equal ratio for all amino acids,
and the fifth position has a 75/25 ratio for G/P. The reference
amino acid sequence and variant sequences are encoded by nucleic
acids and variants thereof generated by processes described
herein.
[0029] FIGS. 10A-10C illustrate generations of chimeric antigen
receptors (CARs). CARs comprise an extracellular single chain
variable fragment (scFv), a hinge domain (H), a transmembrane
domain (TM), and an intracellular domain. An intracellular domain
of a first generation CAR comprises CD.zeta. alone (FIG. 10A). An
intracellular domain of a second generation CAR comprises a
costimulatory domain and CD3.zeta. (FIG. 10B). An intracellular
domain of a third generation CAR comprises two costimulatory
domains and CD3.zeta. (FIG. 10C). In FIGS. 10D-10E, various CAR
binding arrangements are illustrated.
[0030] FIG. 11 depicts an exemplary number of variants produced by
interchanging sections of two expression cassettes (e.g.,
promotors, open reading frames, and terminators) to generate a
variant library of expression cassettes.
[0031] FIG. 12 presents a diagram of steps demonstrating an
exemplary process workflow for gene synthesis as disclosed
herein.
[0032] FIG. 13 illustrates an example of a computer system.
[0033] FIG. 14 is a block diagram illustrating an architecture of a
computer system.
[0034] FIG. 15 is a diagram demonstrating a network configured to
incorporate a plurality of computer systems, a plurality of cell
phones and personal data assistants, and Network Attached Storage
(NAS).
[0035] FIG. 16 is a block diagram of a multiprocessor computer
system using a shared virtual address memory space.
[0036] FIG. 17 depicts a BioAnalyzer plot of PCR reaction products
resolved by gel electrophoresis.
[0037] FIG. 18 depicts an electropherogram showing 96 sets of PCR
products, each set of PCR products differing in sequence from a
wild-type template nucleic acid at a single codon position, where
the single codon position of each set is located at a different
site in the wild-type template nucleic acid sequence. Each set of
PCR products comprises 19 variant nucleic acids, each variant
encoding for a different amino acid at their single codon
position.
DETAILED DESCRIPTION
[0038] The present disclosure employs, unless otherwise indicated,
conventional molecular biology techniques, which are within the
skill of the art. Unless defined otherwise, all technical and
scientific terms used herein have the same meaning as is commonly
understood by one of ordinary skill in the art.
[0039] Definitions
[0040] Throughout this disclosure, numerical features are presented
in a range format. It should be understood that the description in
range format is merely for convenience and brevity and should not
be construed as an inflexible limitation on the scope of any
embodiments. Accordingly, the description of a range should be
considered to have specifically disclosed all the possible
subranges as well as individual numerical values within that range
to the tenth of the unit of the lower limit unless the context
clearly dictates otherwise. For example, description of a range
such as from 1 to 6 should be considered to have specifically
disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5,
from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual
values within that range, for example, 1.1, 2, 2.3, 5, and 5.9.
This applies regardless of the breadth of the range. The upper and
lower limits of these intervening ranges may independently be
included in the smaller ranges, and are also encompassed within the
disclosure, subject to any specifically excluded limit in the
stated range. Where the stated range includes one or both of the
limits, ranges excluding either or both of those included limits
are also included in the disclosure, unless the context clearly
dictates otherwise.
[0041] The terminology used herein is for the purpose of describing
particular embodiments only and is not intended to be limiting of
any embodiment. As used herein, the singular forms "a," "an" and
"the" are intended to include the plural forms as well, unless the
context clearly indicates otherwise. It will be further understood
that the terms "comprises" and/or "comprising," when used in this
specification, specify the presence of stated features, integers,
steps, operations, elements, and/or components, but do not preclude
the presence or addition of one or more other features, integers,
steps, operations, elements, components, and/or groups thereof. As
used herein, the term "and/or" includes any and all combinations of
one or more of the associated listed items.
[0042] Unless specifically stated or obvious from context, as used
herein, the term "about" in reference to a number or range of
numbers is understood to mean the stated number and numbers +/-10%
thereof, or 10% below the lower listed limit and 10% above the
higher listed limit for the values listed for a range.
[0043] The term "nucleic acid" encompasses double- or
triple-stranded nucleic acids, as well as single-stranded
molecules. In double- or triple-stranded nucleic acids, the nucleic
acid strands need not be coextensive (i.e., a double-stranded
nucleic acid need not be double-stranded along the entire length of
both strands). Nucleic acid sequences, when provided, are listed in
the 5' to 3' direction, unless stated otherwise. Methods described
herein provide for the generation of isolated nucleic acids.
Methods described herein additionally provide for the generation of
isolated and purified nucleic acids.
[0044] As used herein, the terms "preselected sequence,"
"predefined sequence" or "predetermined sequence" are used
interchangeably. The terms mean that the sequence of the polymer is
known and chosen before synthesis or assembly of the polymer. In
particular, various aspects of the invention are described herein
primarily with regard to the preparation of nucleic acids
molecules, the sequence of the oligonucleotide or polynucleotide
being known and chosen before the synthesis or assembly of the
nucleic acid molecules.
[0045] Provided herein are methods and compositions for production
of synthetic (i.e. de novo synthesized or chemically synthesized)
polynucleotides. The term oligonucleotide, oligo, oligonucleic
acid, and polynucleotide are defined to be synonymous throughout.
Libraries of synthesized polynucleotides described herein may
comprise a plurality of polynucleotides collectively encoding for
one or more genes or gene fragments. In some instances, the
polynucleotide library comprises coding or non-coding sequences. In
some instances, the polynucleotide library encodes for a plurality
of cDNA sequences. Reference gene sequences from which the cDNA
sequences are based may contain introns, whereas cDNA sequences
exclude introns. Polynucleotides described herein may encode for
genes or gene fragments from an organism. Exemplary organisms
include, without limitation, prokaryotes (e.g., bacteria) and
eukaryotes (e.g., mice, rabbits, humans, and non-human primates).
In some instances, the polynucleotide library comprises one or more
polynucleotides, each of the one or more polynucleotides encoding
sequences for multiple exons. Each polynucleotide within a library
described herein may encode a different sequence, i.e.,
non-identical sequence. In some instances, each polynucleotide
within a library described herein comprises at least one portion
that is complementary to a sequence of another polynucleotide
within the library. Polynucleotide sequences described herein may,
unless stated otherwise, comprise DNA or RNA.
[0046] Provided herein are methods and compositions for production
of synthetic (i.e. de novo synthesized) genes. Libraries comprising
synthetic genes may be constructed by a variety of methods
described in further detail elsewhere herein, such as PCA, non-PCA
gene assembly methods or hierarchical gene assembly, combining
("stitching") two or more double-stranded oligonucleotides to
produce larger DNA units (i.e., a chassis). Libraries of large
constructs may involve oligonucleotides that are at least 1, 1.5,
2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90,
100, 125, 150, 175, 200, 250, 300, 400, 500 kb long or longer. The
large constructs may be bounded by an independently selected upper
limit of about 5000, 10000, 20000 or 50000 base pairs. The
synthesis of any number of polypeptide-segment encoding nucleotide
sequences, including sequences encoding non-ribosomal peptides
(NRPs), sequences encoding non-ribosomal peptide-synthetase (NRPS)
modules and synthetic variants, polypeptide segments of other
modular proteins, such as antibodies, polypeptide segments from
other protein families, including non-coding DNA or RNA, such as
regulatory sequences e.g. promoters, transcription factors,
enhancers, siRNA, shRNA, RNAi, miRNA, small nucleolar RNA derived
from microRNA, or any functional or structural DNA or RNA unit of
interest. The following are non-limiting examples of
polynucleotides: coding or non-coding regions of a gene or gene
fragment, intergenic DNA, loci (locus) defined from linkage
analysis, exons, introns, messenger RNA (mRNA), transfer RNA,
ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA
(shRNA), micro-RNA (miRNA), small nucleolar RNA, ribozymes,
complementary DNA (cDNA), which is a DNA representation of mRNA,
usually obtained by reverse transcription of messenger RNA (mRNA)
or by amplification; DNA molecules produced synthetically or by
amplification, genomic DNA, recombinant polynucleotides, branched
polynucleotides, plasmids, vectors, isolated DNA of any sequence,
isolated RNA of any sequence, nucleic acid probes, and primers.
cDNA encoding for a gene or gene fragment referred to herein, may
comprise at least one region encoding for exon sequence(s) without
an intervening intron sequence found in the corresponding genomic
sequence. Alternatively, the corresponding genomic sequence to a
cDNA may lack an intron sequence in the first place.
[0047] Chimeric Antigen Receptor
[0048] Chimeric antigen receptors (CARs) are generally engineered
receptors that recognize a particular antigen such as an antigen
whose epitope is unique to cancer cells. Referring to FIGS.
10A-10C, CARs comprise an antigen recognition domain derived from a
single chain antibody (scFv), a hinge domain (H) or spacer, a
transmembrane domain (TM) that anchors the CAR to the plasma
membrane, and an intracellular domain that mediates T cell
activation. An intracellular domain of a first generation CAR
comprises CD3.zeta. (FIG. 10A). An intracellular domain of a second
generation CAR comprises a costimulatory domain and CD3.zeta. (FIG.
10B). An intracellular domain of a third generation CAR comprises
two costimulatory domains and CD3.zeta. (FIG. 10C). Exemplary CAR
binding schematics are depicted in FIGS. 10D-10E. The CAR may be
expressed in a lymphoid cell, e.g., a T cell, and an epitope to the
CAR may be expressed in a non-lymphoid cell, or in an in vitro
matrix, such as a bead, gel or column. See e.g., FIG. 10D. In some
arrangements, the CAR is capable of binding to an epitope of a
"linker" protein or peptide, which is able to also serve as an
epitope to a surface protein of another surface, e.g., a cell,
bead, gel or column. See e.g., FIG. 10E.
[0049] Engineering Variance in Chimeric Antigen Receptor
[0050] Provided herein are methods for synthesis of variant nucleic
acid libraries, wherein each variant nucleic acid encodes for a
sequence that is varied in comparison to a reference domain within
a CAR. For example, the varied sequence is a nucleic acid sequence
that encodes for an antigen recognition domain, a hinge domain, a
transmembrane domain, or an intracellular domain. In some
instances, the intracellular domain comprises a signaling domain.
In some instances, the intracellular domain further comprises a
costimulatory domain. In some instances, the variant nucleic acid
libraries comprise variant sequences that encode for all domains of
a CAR. The resulting nucleic acid library may be an oligonucleotide
library, gene fragment library, or gene library. In some instances,
the nucleic acid library is expressed in cells to generate a
variant protein library.
[0051] Variant nucleic acid libraries generated by methods
disclosed herein may encode for an antigen recognition domain. An
antigen recognition domain may comprise a single chain variable
fragment (scFv). In some instances, an antigen recognition domain
comprises F(ab').sub.2, Fab', Fab, or Fv. Variant nucleic acid
libraries that encode for antigen recognition domains may be
designed and synthesized for a particular tumor antigen. Exemplary
tumor antigens include, but are not limited to, .alpha.-Folate
receptor, BCMA, CAIX, CD123, CD138, CD171, CD19, CD20, CD22, CD30,
CD33, CD44, CD44v7/8, CEA, cMET, DNAM-1, EDB-F, EGFR, EGFRvIII,
EGP-2, EGP-40, EpCAM, FAP, Folate-binding Protein, GD2, GD3,
glypican-3, h5T4, HER2, HER3, IL-13, IL-13R-a2, kappa light chain,
KDR, Lewis Y, LMP-1, MAGE-A1, mesothelin, MUC-1, MUC-16, PSCA,
PSMA, ROR1, TAG-72, VEGFR, and VEGFR2. In some instances, about 25,
50, 100, 250, 500, 1000, or more than 1000 common coding gene
sequences of an antigen recognition domain is selected for
variation. Variation may include designing of at least 25, 50, 100,
250, 500, 1000, 2000, 5000, 10000, 20000, 50000, 100000, or more
than 100000 variants for each of the common coding gene sequences
selected.
[0052] The hinge domain and transmembrane domain may connect the
antigen recognition domain to the intracellular domains and anchor
the CAR in the T cell membrane. In some instances, variant nucleic
acid libraries are generated that encode for the hinge domain.
Exemplary hinge domains are immunoglobulin (e.g., IgG1, IgG2, IgG3,
IgG4, IgA1, IgA2, IgM, IgD or IgE), CH2CH3 region of immunoglobulin
and optionally portions of CD3, and CD8.alpha.. In some cases,
variant nucleic acid libraries are generated that encode for the
transmembrane domain.
[0053] Variant nucleic acid libraries generated by methods
disclosed herein may comprise sequences that are varied to an
intracellular domain. In some instances, the intracellular domain
comprises a costimulatory domain. In some instances, variant
nucleic acid libraries comprise sequences that are varied to a
reference costimulatory domain of a CAR. Exemplary costimulatory
domains include, but not limited to, CD8, CD27, CD28, 4-1BB
(CD137), ICOS, DAP10, OX40 (CD134) or fragments or combinations
thereof. In some instances, about 100, 250, 500, 1000, or more than
1000 common coding gene sequences of a costimulatory domain is
selected for variation. Variation includes designing of at least
about 500, 1000, 2000, 5000, 10000, 20000, 50000, 100000, or more
than 100000 variants for each of the common coding gene sequences
selected. Exemplary costimulatory domain sequences are shown in
Table 1.
TABLE-US-00001 TABLE 1 Costimulatory Domains SEQ ID Accession Name
NO Number Nucleic Acid Sequence Human 24 AAL40933.1
ATGAAGTCAGGCCTCTGGTATTTCTTTCTCTTCTG ICOS
CTTGCGCATTAAAGTTTTAACAGGAGAAATCAATG
GTTCTGCCAATTATGAGATGTTTATATTTCACAAC
GGAGGTGTACAAATTTTATGCAAATATCCTGACAT
TGTCCAGCAATTTAAAATGCAGTTGCTGAAAGGGG
GGCAAATACTCTGCGATCTCACTAAGACAAAAGGA
AGTGGAAACACAGTGTCCATTAAGAGTCTGAAATT
CTGCCATTCTCAGTTATCCAACAACAGTGTCTCTT
TTTTTCTATACAACTTGGACCATTCTCATGCCAAC
TATTACTTCTGCAACCTATCAATTTTTGATCCTCC
TCCTTTTAAAGTAACTCTTACAGGAGGATATTTGC
ATATTTATGAATCACAACTTTGTTGCCAGCTGAAG
TTCTGGTTACCCATAGGATGTGCAGCCTTTGTTGT
AGTCTGCATTTTGGGATGCATACTTATTTGTTGGC
TTACAAAAAAGAAGTATTCATCCAGTGTGCACGAC
CCTAACGGTGAATACATGTTCATGAGAGCAGTGAA
CACAGCCAAAAAATCTAGACTCACAGATGTGACCC TATAA Human 25 BAG60249.1.
ATGGTATCACATCGGTATCCTCGAATTCAAAGTAT OX40
CAAAGTACAATTTACCGAATATAAGAAGGAGAAA
GGTTTCATCCTCACTTCCCAAAAGGAGGATGAAAT
CATGAAGGTGCAGAACAACTCAGTCATCATCAAC
TGTGATGGGTTTTATCTCATCTCCCTGAAGGGCTA
CTTCTCCCAGGAAGTCAACATTAGCCTTCATTACC
AGAAGGATGAGGAGCCCCTCTTCCAACTGAAGAA
GGTCAGGTCTGTCAACTCCTTGATGGTGGCCTCTC
TGACTTACAAAGACAAAGTCTACTTGAATGTGACC
ACTGACAATACCTCCCTGGATGACTTCCATGTGAA
TGGCGGAGAACTGATTCTTATCCATCAAAATCCTG GTGAATTCTGTGTCCTTTGA Human 26
AAR05440.1 ATGGGAAACAGCTGTTACAACATAGTAGCCACTCT 4-1BB
GTTGCTGGTCCTCAACTTTGAGAGGACAAGATCAT (CD137)
TGCAGGATCCTTGTAGTAACTGCCCAGCTGGTACA
TTCTGTGATAATAACAGGAATCAGATTTGCAGTCC
CTGTCCTCCAAATAGTTTCTCCAGCGCAGGTGGAC
AAAGGACCTGTGACATATGCAGGCAGTGTAAAGG
TGTTTTCAGGACCAGGAAGGAGTGTTCCTCCACCA
GCAATGCAGAGTGTGACTGCACTCCAGGGTTTCAC
TGCCTGGGGGCAGGATGCAGCATGTGTGAACAGG
ATTGTAAACAAGGTCAAGAACTGACAAAAAAAGG
TTGTAAAGACTGTTGCTTTGGGACATTTAACGATC
AGAAACGTGGCATCTGTCGACCCTGGACAAACTG
TTCTTTGGATGGAAAGTCTGTGCTTGTGAATGGGA
CGAAGGAGAGGGACGTGGTCTGTGGACCATCTCC
AGCCGACCTCTCTCCGGGAGCATCCTCTGTGACCC
CGCCTGCCCCTGCGAGAGAGCCAGGACACTCTCC
GCAGATCATCTCCTTCTTTCTTGCGCTGACGTCGA
CTGCGTTGCTCTTCCTGCTGTTCTTCCTCACGCTC
CGTTTCTCTGTTGTTAAACGGGGCAGAAAGAAACT
CCTGTATATATTCAAACAACCATTTATGAGACCAG
TACAAACTACTCAAGAGGAAGATGGCTGTAGCTGC
CGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACT GTGA Human 27 AAR84239.1
ATGGCACGGCCACATCCCTGGTGGCTGTGCGTTCT CD27
GGGGACCCTGGTGGGGCTCTCAGCTACTCCAGCCC
CCAAGAGCTGCCCAGAGAGGCACTACTGGGCTCA
GGGAAAGCTGTGCTGCCAGATGTGTGAGCCAGGA
ACATTCCTCGTGAAGGACTGTGACCAGCATAGAA
AGGCTGCTCAGTGTGATCCTTGCATACCGGGGGTC
TCCTTCTCTCCTGACCACCACACCCGGCCCCACTG
TGAGAGCTGTCGGCACTGTAACTCTGGTCTTCTCG
TTCGCAACTGCACCATCACTGCCAATGCTGAGTGT
GCCTGTCGCAATGGCTGGCAGTGCAGGGACAAGG
AGTGCACCGAGTGTGATCCTCTTCCAAACCCTTCG
CTGACCGCTCGGTCGTCTCAGGCCCTGAGCCCACA
CCCTCAGCCCACCCACTTACCTTATGTCAGTGAGA
TGCTGGAGGCCAGGACAGCTGGGCACATGCAGAC
TCTGGCTGACTTCAGGCAGCTGCCTGCCCGGACTC
TCTCTACCCACTGGCCACCCCAAAGATCCCTGTGC
AGCTCCGATTTTATTCGCATCCTTGTGATCTTCTC
TGGAATGTTCCTTGTTTTCACCCTGGCCGGGGCCC
TGTTCCTCCATCAACGAAGGAAATATAGATCAAAC
AAAGGAGAAAGTCCTGTGGAGCCTGCAGAGCCTT
GTCGTTACAGCTGCCCCAGGGAGGAGGAGGGCAG
CACCATCCCCATCCAGGAGGATTACCGAAAACCG GAGCCTGCCTGCTCCCCCTGA Human 28
AAB04637.1 ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCT CD8
GGCCTTGCTGCTCCACGCCGCCAGGCCGAGCCAGT alpha
TCCGGGTGTCGCCGCTGGATCGGACCTGGAACCTG
GGCGAGACAGTGGAGCTGAAGTGCCAGGTGCTGC
TGTCCAACCCGACGTCGGGCTGCTCGTGGCTCTTC
CAGCCGCGCGGCGCCGCCGCCAGTCCCACCTTCCT
CCTATACCTCTCCCAAAACAAGCCCAAGGCGGCC
GAGGGGCTGGACACCCAGCGGTTCTCGGGCAAGA
GGTTGGGGGACACCTTCGTCCTCACCCTGAGCGAC
TTCCGCCGAGAGAACGAGGGCTACTATTTCTGCTC
GGCCCTGAGCAACTCCATCATGTACTTCAGCCACT
TCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACG
ACGCCAGCGCCGCGACCACCAACACCGGCGCCCA
CCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAG
GCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACA
CGAGGGGGCTGGACTTCGCCTGTGATATCTACATC
TGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCT
CCTGTCACTGGTTATCACCCTTTACTGCAACCACA
GGAACCGAAGACGTGTTTGCAAATGTCCCCGGCCT
GTGGTCAAATCGGGAGACAAGCCCAGCCTTTCGG CGAGATACGTCTAA Human 29
AAD47911.1 ATGATCCATCTGGGTCACATCCTCTTCCTGCTTTT DAP10
GCTCCCAGTGGCTGCAGCTCAGACGACTCCAGGAG
AGAGATCATCACTCCCTGCCTTTTACCCTGGCACT
TCAGGCTCTTGTTCCGGATGTGGGTCCCTCTCTCT
GCCGCTCCTGGCAGGCCTCGTGGCTGCTGATGCGG
TGGCATCGCTGCTCATCGTGGGGGCGGTGTTCCTG
TGCGCACGCCCACGCCGCAGCCCCGCCCAAGAAGA
TGGCAAAGTCTACATCAACATGCCAGGCAGGGGCT GA
[0054] Variant nucleic acid libraries as described herein may
comprise variants of the intracellular domain. In some instances,
the intracellular domain comprises a signaling domain. In some
instances, variant nucleic acid libraries generated by methods
disclosed herein comprise sequences that are varied when compared
to the signaling domain. In some instances, the signaling domain
comprises an immunoreceptor tyrosine-based activation motif (ITAM).
In some instances, the signaling domain comprises a domain derived
from TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3
epsilon, CD5, CD22, CD79a, CD79b or CD66d. In some cases, the
signaling domain for T-cell activation comprises a domain derived
from CD3.zeta.. In some instances, about 100, 250, 500, 1000, or
more than 1000 common coding gene sequences of a signaling domain
for T cell activation is selected for variation. Variation includes
designing of at least about 500, 1000, 2000, 5000, 10000, 20000,
50000, 100000, or more than 100000 variants for each of the common
coding gene sequences selected. Exemplary signaling domain
sequences are shown in Table 2.
TABLE-US-00002 TABLE 2 Signaling Domain Sequences SEQ ID Accession
Name NO Number Nucleic Acid Sequence Human 30 AAI13831.1
ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCT CD3
ATCATTCTTCTTCAAGGTACTTTGGCCCAGTCAATCAAA gamma
GGAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGAT
GGTTCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAAT
ATCACATGGTTTAAAGATGGGAAGATGATCGGCTTCCTA
ACTGAAGATAAAAAAAAATGGAATCTGGGAAGTAATGCC
AAGGACCCTCGAGGGATGTATCAGTGTAAAGGATCACAG
AACAAGTCAAAACCACTCCAAGTGTATTACAGAATGTGT
CAGAACTGCATTGAACTAAATGCAGCCACCATATCTGGC
TTTCTCTTTGCTGAAATCGTCAGCATTTTCGTCCTTGCT
GTTGGGGTCTACTTCATTGCTGGACAGGATGGAGTTCGC
CAGTCGAGAGCTTCAGACAAGCAGACTCTGTTGCCCAAT
GACCAGCTCTACCAGCCCCTCAAGGATCGAGAAGATGAC
CAGTACAGCCACCTTCAAGGAAACCAGTTGAGGAGGAAT TGA Human 31 EAW67364.1
ATGCAGTCGGGCACTCACTGGAGAGTTCTGGGCCTCTGC CD3
CTCTTATCAGTTGGCGTTTGGGGGCAAGATGGTAATGAA epsilon
GAAATGGGTGGTATTACACAGACACCATATAAAGTCTCC
ATCTCTGGAACCACAGTAATATTGACATGCCCTCAGTAT
CCTGGATCTGAAATACTATGGCAACACAATGATAAAAAC
ATAGGCGGTGATGAGGATGATAAAAACATAGGCAGTGAT
GAGGATCACCTGTCACTGAAGGAATTTTCAGAATTGGAG
CAAAGTGGTTATTATGTCTGCTACCCCAGAGGAAGCAAA
CCAGAAGATGCGAACTTTTATCTCTACCTGAGGGCAAGA
GTGTGTGAGAACTGCATGGAGATGGATGTGATGTCGGTG
GCCACAATTGTCATAGTGGACATCTGCATCACTGGGGGC
TTGCTGCTGCTGGTTTACTACTGGAGCAAGAATAGAAAG
GCCAAGGCCAAGCCTGTGACACGAGGAGCGGGTGCTGGC
GGCAGGCAAAGGGGACAAAACAAGGAGAGGCCACCACCT
GTTCCCAACCCAGACTATGAGCCCATCCGGAAAGGCCAG
CGGGACCTGTATTCTGGCCTGAATCAGAGACGCATCTGA Human 32 AAB20812.1
ATGCCTGGGGGTCCAGGAGTCCTCCAAGCTCTGCCTGCC CD79
ACCATCTTCCTCCTCTTCCTGCTGTCTGCTGTCTACCTG alpha
GGCCCTGGGTGCCAGGCCCTGTGGATGCACAAGGTCCCA
GCATCATTGATGGTGAGCCTGGGGGAAGACGCCCACTTC
CAATGCCCGCACAATAGCAGCAACAACGCCAACGTCACC
TGGTGGCGCGTCCTCCATGGCAACTACACGTGGCCCCCT
GAGTTCTTGGGCCCGGGCGAGGACCCCAATGGTACGCTG
ATCATCCAGAATGTGAACAAGAGCCATGGGGGCATATAC
GTGTGCCGGGTCCAGGAGGGCAACGAGTCATACCAGCAG
TCCTGCGGCACCTACCTCCGCGTGCGCCAGCCGCCCCCC
AGGCCCTTCCTGGACATGGGGGAGGGCACCAAGAACCGA
ATCATCACAGCCGAGGGGATCATCCTCCTGTTCTGCGCG
GTGGTGCCTGGGACGCTGCTGCTGTTCAGGAAACGATGG
CAGAACGAGAAGCTCGGGTTGGATGCCGGGGATGAATAT
GAAGATGAAAACCTTTATGAAGGCCTGAACCTGGACGAC
TGCTCCATGTATGAGGACATCTCCCGGGGCCTCCAGGGC
ACCTACCAGGATGTGGGCAGCCTCAACATAGGAGATGTC CAGCTGGAGAAGCCGTGA Human 33
NM_000626.3 AGGGGACAGGCTGCAGCCGGTGCAGTTACACGTTTTCCT CD79
CCAAGGAGCCTCGGACGTTGTCACGGGTTTGGGGTCGGG beta
GACAGAGCGGTGACCATGGCCAGGCTGGCGTTGTCTCCT
GTGCCCAGCCACTGGATGGTGGCGTTGCTGCTGCTGCTC
TCAGCTGAGCCAGTACCAGCAGCCAGATCGGAGGACCGG
TACCGGAATCCCAAAGGTAGTGCTTGTTCGCGGATCTGG
CAGAGCCCACGTTTCATAGCCAGGAAACGGGGCTTCACG
GTGAAAATGCACTGCTACATGAACAGCGCCTCCGGCAAT
GTGAGCTGGCTCTGGAAGCAGGAGATGGACGAGAATCCC
CAGCAGCTGAAGCTGGAAAAGGGCCGCATGGAAGAGTCC
CAGAACGAATCTCTCGCCACCCTCACCATCCAAGGCATC
CGGTTTGAGGACAATGGCATCTACTTCTGTCAGCAGAAG
TGCAACAACACCTCGGAGGTCTACCAGGGCTGCGGCACA
GAGCTGCGAGTCATGGGATTCAGCACCTTGGCACAGCTG
AAGCAGAGGAACACGCTGAAGGATGGTATCATCATGATC
CAGACGCTGCTGATCATCCTCTTCATCATCGTGCCTATC
TTCCTGCTGCTGGACAAGGATGACAGCAAGGCTGGCATG
GAGGAAGATCACACCTACGAGGGCCTGGACATTGACCAG
ACAGCCACCTATGAGGACATAGTGACGCTGCGGACAGGG
GAAGTGAAGTGGTCTGTAGGTGAGCACCCAGGCCAGGAG
TGAGAGCCAGGTCGCCCCATGACCTGGGTGCAGGCTCCC
TGGCCTCAGTGACTGCTTCGGAGCTGCCTGGCTCATGGC
CCAACCCCTTTCCTGGACCCCCCAGCTGGCCTCTGAAGC
TGGCCCACCAGAGCTGCCATTTGTCTCCAGCCCCTGGTC
CCCAGCTCTTGCCAAAGGGCCTGGAGTAGAAGGACAACA
GGGCAGCAACTTGGAGGGAGTTCTCTGGGGATGGACGGG
ACCCAGCCTTCTGGGGGTGCTATGAGGTGATCCGTCCCC
ACACATGGGATGGGGGAGGCAGAGACTGGTCCAGAGCCC
GCAAATGGACTCGGAGCCGAGGGCCTCCCAGCAGAGCTT
GGGAAGGGCCATGGACCCAACTGGGCCCCAGAAGAGCCA
CAGGAACATCATTCCTCTCCCGCAACCACTCCCACCCCA
GGGAGGCCCTGGCCTCCAGTGCCTTCCCCCGTGGAATAA
ACGGTGTGTCCTGAGAAACCACACAAAAAAAA Human 34 AAY57330.1
ATGAAGTGGAAGGCGCTTTTCACCGCGGCCATCCTGCAG CD3
GCACAGTTGCCGATTACAGAGGCACAGAGCTTTGGCCTG zeta
CTGGATCCCAAACTCTGCTACCTGCTGGATGGAATCCTC
TTCATCTATGGTGTCATTCTCACTGCCTTGTTCCTGAGA
GTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAG
CAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGA
CGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGC
CGGGACCCTGAGATGGGGGGAAAGCCGCAGAGAAGGAAG
AACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGAT
AAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGC
GAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAG
GGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTT
CACATGCAGGCCCTGCCCCCTCGCTAA
[0055] Methods provided herein for the synthesis of a variant
nucleic acid library that is varied in comparison to a reference
domain within a CAR may include: de novo synthesis of a variant
library of primer oligonucleotides followed by PCR mutagenesis, or
de novo synthesis of multiple fragments of the variant version for
annealing and assembly including polymerase chain assembly.
[0056] A nucleic acid library as described herein may comprise a
plurality of nucleic acids that are varied in comparison to a
reference domain within a reference CAR, and variation is generated
by de novo synthesis of a variant library of primer
oligonucleotides followed by PCR mutagenesis. In some instances,
oligonucleotides are synthesized on a surface, wherein each
oligonucleotide encodes for a predetermined sequence. In some
instances, the predetermined sequence is a predetermined variant of
a reference nucleic acid sequence that encodes for an antigen
recognition domain, a hinge domain, a transmembrane domain, or an
intracellular domain of a CAR. In some instances, oligonucleotide
primers are de novo synthesized for use in a series of PCR
reactions to generate a library of oligonucleotide variants of a
reference nucleic acid sequence that encodes for an antigen
recognition domain, a hinge domain, a transmembrane domain, or an
intracellular domain of a CAR. In some instances, the
oligonucleotide primers are used for amplification from a reference
nucleic acid sequence to produce a library of variant nucleic acids
encoding for an antigen recognition domain, a hinge domain, a
transmembrane domain, or an intracellular domain of a CAR.
[0057] In some instances, a variant nucleic acid library varied in
comparison to a reference domain within a CAR is generated by de
novo synthesis of multiple fragments of the variant version of the
common sequence for annealing and assembly including polymerase
chain assembly. In some instances, a surface is used for de novo
synthesis of multiple fragments of a nucleic acid sequence, wherein
at least one of the fragments is synthesized in multiple versions.
The nucleic acid sequence may be a variant of a reference nucleic
acid sequence that encodes for an antigen recognition domain, a
hinge domain, a transmembrane domain, or an intracellular domain of
a CAR. In some instances, the fragments are subject to
hybridization to generate a CAR variant library. In some instances,
the synthesized fragments are amplified and subject to ligation or
hybridization to generate a CAR variant library.
[0058] In some instances, a CAR variant library comprises nucleic
acid sequences that encode for an antigen recognition domain, a
hinge domain, a transmembrane domain, or an intracellular domain
including a stimulatory domain or a signaling domain of a CAR. In
some instances, a CAR variant library comprises nucleic acid
sequences that encodes for a single domain of a CAR. In some
instances, a CAR variant library comprises nucleic acid sequences
that encodes for multiple domains of a CAR. For example, a CAR
variant library comprises nucleic acid sequences that encode for
all domains of a CAR.
[0059] Libraries comprising nucleic acids encoding for variant CARs
as described herein comprise various lengths of amino acids when
translated. In some instances, the length of each of the amino acid
fragments or average length of the amino acid synthesized may be at
least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145,
150, or more than 150 amino acids. In some instances, the length of
the amino acid is in a range of about 15 to 150, 20 to 145, 25 to
140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to
110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In
some instances, the length of the amino acid is in a range of about
22 to about 75 amino acids.
[0060] A number of variant sequences for the at least one region of
the CAR chain for variation are de novo synthesized using methods
as described herein. In some instances, a number of variant
sequences is de novo synthesized for an antigen recognition domain,
a hinge domain, a transmembrane domain, or an intracellular domain
of a CAR. In some instances, a number of variant sequences is de
novo synthesized for a stimulatory domain or a signaling domain of
a CAR. The number of variant sequences may be at least or about 5,
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,
95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375,
400, 425, 450, 475, 500, or more than 500 sequences. In some
instances, the number of variant sequences is at least or about
500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000,
20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000,
100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000,
800,000, 900,000, 1 million, or more than 1 million sequences. In
some instances, the number of variant sequences is in a range of
about 10 to 500, 25 to 475, 50 to 450, 75 to 425, 100 to 400, 125
to 375, 150 to 350, 175 to 325, 200 to 300, 225 to 375, 250 to 350,
or 275 to 325 sequences.
[0061] Provided herein are variant nucleic acids encoding for
variant CARs, wherein the variant CARs are antigen specific. In
some instances, the antigen is involved in or associated with a
disease, disorder, or condition. For example, the antigen is
associated with a proliferative disease, a tumorous disease, an
inflammatory disease, an immunological disorder, an autoimmune
disease, an infectious disease, a viral disease, an allergic
reaction, a parasitic reaction, a graft-versus-host disease or a
host-versus-graft disease. In some instances, the antigen is an
antigen expressed on a tumor cell. In some instances, an antigen is
associated with a pathogen such as a virus or bacterium.
[0062] In some instances, the variant CARs recognize antigens that
are tissue-restricted. For example, the variant CARs are restricted
non-vital cell lineages or tissues. In some instances, the variant
CARs recognize antigens from mutated gene products.
[0063] Provided herein are variant CAR libraries, wherein the
variant CARs encode for variants in an antigen binding interface.
In some instances, residues for variation are preselected or
predicted residues that contact an antigen. In some instances, the
antigen binding interface is the antigen recognition domain. In
some instances, residues for variation are preselected or predicted
residues located in the binding pocket.
[0064] Variant CAR libraries as described herein comprise one or
more mutations in a library. In some instances, the CAR variant
libraries are single variant libraries comprising variants at a
single site across the library. In some instances, the CAR variant
libraries are multiple variant libraries comprising variants at a
number of sites. In some instances, the number of sites is 2, 3, 4,
5, 6, 7, 8, 9, 10, or more than 10 sites.
[0065] Provided here are libraries where one or more preselected
codons in a CAR gene or gene fragment encode for variant amino acid
residues to generate variation in resulting variant CAR protein
libraries. In some instances, up to 10, 20, 30, 40, 50, 60, 70, 80,
90, or 100 amino acid residues are varied. In some instances, up to
30 amino acid residues are varied. In some instances, up to 5 amino
acid residues are varied. In some instances, up to 100, 200, 300,
400, 500, 600, 700, 800, 900, 1000, or more than 1000 amino acid
residues are varied. In some instances, at least or about 10, 20,
30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues are varied.
In some instances, at least or about 100, 200, 300, 400, 500, 600,
700, 800, 900, 1000, or more than 1000 amino acid residues are
varied. In some instances, all amino acid residues in a preselected
region are varied. In some instances, variant CAR libraries are
highly diverse. In some instances, the libraries comprise at least
or about 10{circumflex over ( )}6, 10{circumflex over ( )}8,
10{circumflex over ( )}9, 10{circumflex over ( )}10, 10{circumflex
over ( )}11, 10{circumflex over ( )}12, or 10{circumflex over (
)}13 variants. In some instances, the libraries comprise at least
or about 10{circumflex over ( )}9 variants.
[0066] Subsequent to synthesis of variant nucleic acid libraries
encoding for a reference domain within a CAR, variant nucleic acid
libraries may be inserted into a vector sequence. In some
instances, the vector sequence is expressed (e.g., by
electroporation, transfection, or transduction) in cells and
functional consequences are determined. CAR domains that may be
varied are an antigen recognition domain, a hinge domain, a
transmembrane domain, or an intracellular domain. In some
instances, the intracellular domain comprises a signaling domain or
a costimulatory domain. In some instances, the variant nucleic acid
libraries comprise variant sequences that encode for all domains of
a CAR. Functional consequences that may be measured include binding
affinity and binding strength. In some instances, variant nucleic
acid libraries generated by methods disclosed herein result in
increased binding strength of an antigen recognition domain to a
tumor antigen associated with a particular cancer of interest. The
cancer may be a solid cancer or a hematologic cancer. In some
instances, the cancer is bladder cancer, lung cancer, brain cancer,
melanoma, breast cancer, Non-Hodgkin lymphoma, cervical cancer,
ovarian cancer, colorectal cancer, pancreatic cancer, esophageal
cancer, prostate cancer, kidney cancer, skin cancer, leukemia,
thyroid cancer, liver cancer, or uterine cancer. Exemplary antigens
for use in binding assays include, without limitation, those
provided in Table 3.
TABLE-US-00003 TABLE 3 Antigens Antigen SEQ peptide Protein ID name
Sequence NO Disease Target CD19 KVSAVTLAY 35 B-cell malignancy CD20
RPKSNIVLL 36 B-cell malignancy CEA IMIGVLVGV 37 Metastatic
colorectal peptide cancer HER2 IISAVVGIL 38 Breast cancer, lung
cancer, prostate cancer, glioma NY-ESO- SLLMWITQV 39 Many cancers 1
including melanoma and sarcoma PSMA KYADKIYSI 40 Prostate
cancer
[0067] Variant nucleic acid libraries generated using methods
described herein may be screened to select a modified CAR domain
sequence providing for a protein complex with improved affinity
(measure of the strength of interaction between an epitope and an
antibody's antigen binding site) for a tumor antigen. Additional
functional considerations, such as variant gene expression,
avidity, stability, and target cell (i.e. cancer cell) specificity
may also be assessed. In some instances, the increased specificity
of a CAR provides for reduced cross-reactivity to non-cancer
associated antigens compared to a reference non-variant CAR. In
some instances, the variant CAR libraries are screened for
localization within a cell. In some instances, the variant CAR
libraries are screened to identify properly localized variant
CARs.
[0068] Increased specificity of a variant CAR to a tumor antigen
may result in decreased toxicity. Toxicity in some instances that
results include cytokine release syndrome (CRS), macrophage
activation syndrome (MAS), on-target off-tumor toxicity,
autoimmunity, host-graft toxicity, neurotoxicity, and tumor lysis
syndrome. Variant nucleic acid libraries encoding for an antigen
recognition domain may be inserted into a vector sequence,
expressed in cells, and screened for functional consequences such
as decreased toxicity. For example, variant nucleic acid libraries
are screened for increased cytokine (e.g., interleukin-6 (IL-6),
interferon-.gamma., tumor necrosis factor, IL-2,
IL-2--receptor-.alpha., IL-8, and IL-10) release from cells or
increased cytokine expression as a measure of CRS.
[0069] In some instances, variant nucleic acid libraries generated
using methods described herein are screened to select a modified
CAR domain sequence providing for improved T cell function or
improved T cell activation. In some instances, variant CARs are
used to screen T cell pathways affecting cell growth, survival,
cellular differentiation, cell death, or intracellular signaling
modulation. For example, the serine/threonine kinase Akt has been
shown to improve T-cell function and survival resulting in
resistance to tumor inhibitory mechanisms. In some cases, variant
CARs are used to screen T cell pathways that improve resistance to
tumor inhibitory mechanisms. In some instances, variant CARs
generated using methods described herein result in enhanced immune
response towards a target cell such as a cancer cell. For example,
a variant CAR may increase cytotoxic activity of a cytotoxic cell
(e.g., a Natural Killer cell or cytotoxic T lymphocyte) towards a
target cell such as a cancer cell. In some instances, variant CARs
generated using methods described herein result in enhanced immune
response towards a target cell such as a cancer cell, thus
resulting in increased death of a cancer cell.
[0070] In some instances, variant CAR libraries that are expressed
in cells are used to identify variant CARs with improved variant
gene expression, avidity, stability, affinity, or specificity. For
example, a first variant CAR library is generated that comprises
improved specificity to a tumor antigen. In some instances,
following identification of variant CARs with improved gene
expression, avidity, stability, affinity, or specificity, those
variant CARs are further varied to produce a second library of
variant CARs with a second improvement. For example, variant CARs
with improved specificity are further varied to identify variants
further comprising improved stability. In some instances, the
second library comprises variants in a same region as the first
library. In some instances, the second library comprises variants
in a different region of the first library. For example, the first
library may comprise variants in an antigen recognition domain of
the CAR and the second library may comprise variants in a hinge
domain, a transmembrane domain, or an intracellular domain of the
CAR. In some instances, a number of variant CAR libraries are
generated. In some instances, the number of variant CAR libraries
is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more than 12
variant libraries. In some instances, the variant libraries
comprise at least or about 10.sup.1, 10.sup.2, 10.sup.3, 10.sup.4,
10.sup.5, or 10.sup.6 variants. In some instances, each of the
variant libraries independently has improvements in gene
expression, avidity, stability, affinity, or specificity.
[0071] Variant CAR libraries may be engineered into cells and
introduced into a subject. In some instances, the cells are
autologous, meaning derived from a subject's own cells.
Alternately, cells expressing variant CARs are allogeneic, meaning
derived from another subject with a similar tissue type. In some
instances, cells are tailored to the subject. In some instances,
cells are compatible with local tissue.
[0072] In some instances, variant nucleic acid libraries as
described herein comprise about 50-100000, 100-75000, 250-50000,
500-25000, 1000-15000, 2000-10000, or 4000-8000 sequences. In some
instances, variant nucleic acid libraries comprise 500 sequences.
In some cases, variant nucleic acid libraries comprise 5000
sequences. In some instances, variant nucleic acid libraries
comprise 15000 sequences. In some cases, variant nucleic acid
libraries comprise at least 50, 100, 150, 500, 1000, 2000, 5000,
10000, 20000, 50000, 100000, 200000, 400000, 800000, 1000000, or
more than 1000000 sequences. Variant nucleic acid libraries may
comprise at most 50, 100, 500, 1000, 2000, 5000, 10000, 20000,
50000, 100000, 200000, 400000, 800000, or1000000 sequences. The
total variant library may result in 10{circumflex over ( )}6,
10{circumflex over ( )}8, 10{circumflex over ( )}10, 10{circumflex
over ( )}11, 10{circumflex over ( )}12, 10{circumflex over ( )}13
or more different nucleic acids.
[0073] In some cases, the length of each of the oligonucleotide
fragments or average length of the oligonucleotides synthesized may
be at least or about at least 10, 15, 20, 25, 30, 35, 40, 45, 50,
100, 150, 200, 300, 400, 500, 2000 nucleotides, or more. The length
of each of the oligonucleotide fragments or average length of the
oligonucleotides synthesized may be at most or about at most 2000,
500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17,
16, 15, 14, 13, 12, 11, 10 nucleotides, or less. The length of each
of the oligonucleotide fragments or average length of the
oligonucleotides synthesized may fall from 10-2000, 10-500, 9-400,
11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35,
19-25.
[0074] Variant Library Synthesis
[0075] Methods described herein provide for synthesis of a library
of oligonucleotides each encoding for a predetermined variant of at
least one predetermined reference nucleic acid sequence. In some
instances, the oligonucleotides synthesized herein are isolated,
purified, or isolated and purified. In some cases, the
predetermined reference sequence is a nucleic acid sequence
encoding for a protein, and the variant library comprises sequences
encoding for variation of at least a single codon such that a
plurality of different variants of a single residue in the
subsequent protein encoded by the synthesized nucleic acid are
generated by standard translation processes. The synthesized
specific alterations in the nucleic acid sequence may be introduced
by incorporating nucleotide changes into overlapping or blunt ended
oligonucleotide primers. Alternatively, a population of
oligonucleotides may collectively encode for a long nucleic acid
(e.g., a gene) and variants thereof. In this arrangement, the
population of oligonucleotides may be hybridized and subject to
standard molecular biology techniques to form the long nucleic acid
(e.g., a gene) and variants thereof. When the long nucleic acid
(e.g., a gene) and variants thereof are expressed in cells, a
variant protein library is generated. Similarly, provided here are
methods for synthesis of variant libraries encoding for RNA
sequences (e.g., miRNA, shRNA, and mRNA) or DNA sequences (e.g.,
enhancer, promoter, UTR, and terminator regions). In some
instances, the sequences are exon sequences or coding sequences. In
some instances, the sequences do not comprise intron sequences.
Also provided here are downstream applications for variants
selected out of the libraries synthesized using methods described
here. Downstream applications include identification of variant
nucleic acid or protein sequences with enhanced biologically
relevant functions, e.g., biochemical affinity, enzymatic activity,
changes in cellular activity, and for the treatment or prevention
of a disease state.
[0076] Synthesis Followed by PCR Mutagenesis
[0077] A first process for synthesis of a variant library of
oligonucleotides is for PCR mutagenesis (saturating or
non-saturating) methods. In this workflow, a plurality of
oligonucleotides is synthesized, wherein each oligonucleotide
encodes for a predetermined sequence which is a predetermined
variant of a reference nucleic acid sequence. Referring to the
figures, an exemplary workflow in depicted in FIGS. 1A-1D, wherein
oligonucleotides are generated on a surface. FIG. 1A depicts an
expansion view of a single cluster of a surface with 121 loci. Each
oligonucleotide depicted in FIG. 1B is a primer that may be used
for amplification from a reference nucleic acid sequence to produce
a library of variant long nucleic acids, FIG. 1C. The library of
variant long nucleic acids is then, optionally, subject to
transcription and or translation to generate a variant RNA or
protein library, FIG. 1D. In this exemplary illustration, a device
having a substantially planar surface used for de novo synthesis of
oligonucleotides is depicted, FIG. 1A. In some instances, the
device comprises a cluster of loci, wherein each locus is a site
for oligonucleotide extension. In some instances, a single cluster
comprises all the oligonucleotide variants needed to generate a
desired variant sequence library. In an alternative arrangement, a
plate comprises a field of loci which are not segregated into
clusters.
[0078] In some instances, oligonucleotides synthesized within a
cluster (e.g., as seen in FIG. 1A) are amplified by PCR. Such an
arrangement may provide for improved oligonucleotide representation
compared to amplification of non-identical oligonucleotides across
an entire plate without a clustered arrangement. In some instances,
amplification of oligonucleotides synthesized on surfaces of loci
within a cluster overcomes negative effects on representation due
to repeated synthesis of large oligonucleotide populations having
oligonucleotides with heavy GC content. In some instances, a
cluster described herein, comprises about 50-1000, 75-900, 100-800,
125-700, 150-600, 200-500, 50-500 or 300-400 discrete loci. In some
instances, a loci is a spot, well, microwell, channel, or post. In
some instances, each cluster has at least 1.times., 2.times.,
3.times., 4.times., 5.times., 6.times., 7.times., 8.times.,
9.times., 10.times., or more redundancy of separate features
supporting extension of oligonucleotides having an identical
sequence. In some instances, 1.times. redundancy means not having
oligonucleotides with the same sequence.
[0079] A de novo synthesized oligonucleotide library described
herein may comprise a plurality of oligonucleotides, each with at
least one variant sequence at a first position, position "x", and
each variant oligonucleotide is used as a primer in a first round
of PCR to generate a first extension product. In this example,
position "x" in a first oligonucleotide 220 encodes for a variant
codon sequence, i.e., one of 19 possible variants from a reference
sequence. See FIG. 2A. A second oligonucleotide 225 comprising a
sequence overlapping that of the first oligonucleotide is also used
as a primer in a separate round of PCR to generate a second
extension product. In addition, outer primers 215, 230 may be used
for amplification of a fragment from a long nucleic acid sequence.
The resultant amplification products are fragments of the long
nucleic acid sequence 235, 240. See FIG. 2B. The fragments of the
long nucleic acid sequence 235, 240 are then hybridized, and
subject to an extension reaction to form a variant of the long
nucleic acid 245. See FIG. 2C. The overlapping ends of the first
and second extension products may serve as a primer of a second
round of PCR, thereby generating a third extension product (FIG.
2D) that contains the variant. To increase the yield, the variant
of the long nucleic acid is amplified in a reaction including a DNA
polymerase, amplification reagents, and the outer primers 215, 230.
In some instances, the second oligonucleotide comprises a sequence
adjacent to, but not including, the variant site. In an alternative
arrangement, a first oligonucleotide is generated that has a region
that overlaps with a second oligonucleotide. In this scenario, the
first oligonucleotide is synthesized with variation at a single
codon for up to 19 variants. The second oligonucleotide does not
comprise a variant sequence. Optionally, a first population
comprises the first oligonucleotide variants and additional
oligonucleotides encoding for variants at a different codon site.
Alternatively, the first oligonucleotide and the second
oligonucleotide may be designed for blunt end ligation.
[0080] An alternative mutagenesis PCR method is depicted in FIGS.
3A-3F. In such a process, a template nucleic acid molecule 300
comprising a first and second strand 305, 310 is amplified in a PCR
reaction containing a first primer 315 and a second primer 320
(FIG. 3A). The amplification reaction includes uracil as a
nucleotide reagent. A uracil-labeled extension product 325 (FIG.
3B) is generated, optionally purified, and serves as a template for
a subsequent PCR reaction using a first oligonucleotide 335 and a
plurality of second oligonucleotides 330 to generate first
extension products 340 and 345 (FIGS. 3C-3D). In this process, a
plurality of second oligonucleotide 330 comprises oligonucleotides
encoding for variant sequences (denoted as X, Y, and Z, in FIG.
3C). The uracil-labeled template nucleic acid is digested by a
uracil-specific excision reagent, e.g., USER digest available
commercially from New England Biolabs. Variant 335 and different
codons 330 with variants X, Y, and Z are added and a limited PCR
step is performed to generate FIG. 3D. After the uracil-containing
template is digested, the overlapping ends of the extension
products serve to prime a PCR reaction with the first extension
products 340 and 345 acting as primers in combination with a first
outer primer 350 and a second outer primer 355, thereby generating
a library of nucleic acid molecules 360 containing a plurality of
variants X, Y, and Z at the variant site FIG. 3F.
[0081] De Novo Synthesis of a Population With Variant and
Non-Variant Portions of a Long Nucleic Acid
[0082] In a second process for synthesis of a variant library, a
surface is used for de novo synthesis of multiple fragments of a
long nucleic acid, wherein at least one of the fragments is
synthesized in multiple versions, each version being of a different
variant sequence. In this arrangement, all of the fragments needed
to assemble a library of variant long range nucleic acids are de
novo synthesized. The synthesized fragments may have overlapping
sequence such that, following synthesis, the fragment library is
subject to hybridization. Following hybridization, an extension
reaction may be performed to fill in any complementary gaps.
[0083] Alternatively, the synthesized fragments may be amplified
with primers and then subject to either blunt end ligation or
overlapping hybridization. In some instances, the device comprises
a cluster of loci, wherein each locus is a site for oligonucleotide
extension. In some instances, a single cluster comprises all the
oligonucleotide variants and other fragment sequences of a
predetermined long nucleic acid to generate a desired variant
nucleic acid sequence library. The cluster may comprise about 50 to
500 loci. In some arrangements, a cluster comprises greater than
500 loci.
[0084] Each individual oligonucleotide in the first oligonucleotide
population may be generated on a separate, individually addressable
locus of a cluster. One oligonucleotide variant may be represented
by a plurality of individually addressable loci. Each variant in
the first oligonucleotide population may be represented 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more times. In some instances, each variant
in the first oligonucleotide population is represented at 3 or less
loci. In some instances, each variant in the first oligonucleotide
population is represented at two loci. In some instances, each
variant in the first oligonucleotide population is represented at
only a single locus.
[0085] Methods are provided herein to generate nucleic acid
libraries with reduced redundancy. In some instances, variant
oligonucleotides may be generated without the need to synthesize
the variant oligonucleotide more than 1 time to obtain the desired
variant oligonucleotide. In some instances, the present disclosure
provides methods to generate variant oligonucleotides without the
need to synthesize the variant oligonucleotide more than 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, or more times to generate the desired variant
oligonucleotide.
[0086] Variant oligonucleotides may be generated without the need
to synthesize the variant oligonucleotide at more than 1 discrete
site to obtain the desired variant oligonucleotide. The present
disclosure provides methods to generate variant oligonucleotides
without the need to synthesize the variant oligonucleotide at more
than 1 site, 2 sites, 3 sites, 4 sites, 5 sites, 6 sites, 7 sites,
8 sites, 9 sites, or 10 sites. In some instances, an
oligonucleotide is synthesized in at most 6, 5, 4, 3, 2, or 1
discrete sites. The same oligonucleotide may be synthesized in 1,
2, or 3 discrete loci on a surface.
[0087] In some instances, the amount of loci representing a single
variant oligonucleotide is a function of the amount of nucleic acid
material required for downstream processing, e.g., an amplification
reaction or cellular assay. In some instances, the amount of loci
representing a single variant oligonucleotide is a function of the
available loci in a single cluster.
[0088] Provided herein are methods for generation of a library of
oligonucleotides comprising variant oligonucleotides differing at a
plurality of sites in a reference nucleic acid. In such cases, each
variant library is generated on an individually addressable locus
within a cluster of loci. It will be understood that the number of
variant sites represented by the oligonucleotide library will be
determined by the number of individually addressable loci in the
cluster and the number of desired variants at each site. In some
instances, each cluster comprises about 50 to 500 loci. In some
instances, each cluster comprises 100 to 150 loci.
[0089] In an exemplary arrangement, 19 variants are represented at
a variant site corresponding to codons encoding for each of the 19
possible variant amino acids. In another exemplary case, 61
variants are represented at a variant site corresponding to
triplets encoding for each of the 19 possible variant amino acids.
In a non-limiting example, a cluster comprises 121 individually
addressable loci. In this example, an oligonucleotide population
comprises 6 replicates each of a single-site variant (6
replicates.times.1 variant site.times.19 variants=114 loci), 3
replicates each of a double-site variant (3 replicates.times.2
variant sites.times.19 variants=114 loci), or 2 replicates each of
a triple-site variant (2 replicates.times.3 variant sites.times.19
variants=114 loci). In some instances, an oligonucleotide
population comprises variants at four, five, six or more than six
variant sites.
[0090] Provided herein are methods and compositions for production
of synthetic (i.e. de novo synthesized or chemically synthesized)
oligonucleotides. Libraries of synthesized oligonucleotides
described herein may comprise a plurality of oligonucleotides
collectively encoding for one or more genes or gene fragments. In
some instances, the oligonucleotide library comprises coding or
non-coding sequences. In some instances, the oligonucleotide
library encodes for a plurality of cDNA sequences. In some
instances, the oligonucleotide library comprises one or more
oligonucleotides, each of the one or more oligonucleotides encoding
sequences for multiple exons. Each oligonucleotide within a library
described herein may encode a different sequence, i.e.,
non-identical sequence. In some instances, each oligonucleotide
within a library described herein comprises at least one portion
that is complementary to a sequence of another oligonucleotide
within the library. Oligonucleotide sequences described herein may,
unless stated otherwise, comprise DNA or RNA.
[0091] Provided herein are methods and compositions for production
of synthetic (i.e. de novo synthesized) genes. Libraries comprising
synthetic genes may be constructed by a variety of methods
described in further detail elsewhere herein, such as PCA, non-PCA
gene assembly methods or hierarchical gene assembly, combining
("stitching") two or more double-stranded oligonucleotides to
produce larger DNA units (i.e., a chassis). Libraries of large
constructs may involve oligonucleotides that are at least 1, 1.5,
2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90,
100, 125, 150, 175, 200, 250, 300, 400, 500 kb long or longer. The
large constructs may be bound by an independently selected upper
limit of about 5000, 10000, 20000 or 50000 base pairs. The
synthesis of any number of polypeptide-segment encoding nucleotide
sequences may include sequences encoding non-ribosomal peptides
(NRPs), sequences encoding non-ribosomal peptide-synthetase (NRPS)
modules and synthetic variants, polypeptide segments of other
modular proteins, such as antibodies, polypeptide segments from
other protein families, including non-coding DNA or RNA, such as
regulatory sequences e.g. promoters, transcription factors,
enhancers, siRNA, shRNA, RNAi, miRNA, small nucleolar RNA derived
from microRNA, or any functional or structural DNA or RNA unit of
interest. The following are non-limiting examples of
oligonucleotides: coding or non-coding regions of a gene or gene
fragment, intergenic DNA, loci (locus) defined from linkage
analysis, exons, introns, messenger RNA (mRNA), transfer RNA,
ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA
(shRNA), micro-RNA (miRNA), small nucleolar RNA, ribozymes, cDNA,
which is a DNA representation of mRNA, usually obtained by reverse
transcription of messenger RNA (mRNA) or by amplification; DNA
molecules produced synthetically or by amplification, genomic DNA,
recombinant oligonucleotides, branched oligonucleotides, plasmids,
vectors, isolated DNA of any sequence, isolated RNA of any
sequence, nucleic acid probes, and primers. In the context of cDNA,
the term gene or gene fragment refers to a DNA nucleic acid
sequence comprising at least one region encoding for exon sequences
without an intervening intron sequence.
[0092] In various embodiments, methods and compositions described
herein relate to a library of genes. The gene library may comprise
a plurality of subsegments. In one or more subsegments, the genes
of the library may be covalently linked together. In one or more
subsegments, the genes of the library may encode for components of
a first metabolic pathway with one or more metabolic end products.
In one or more subsegments, genes of the library may be selected
based on the manufacturing process of one or more targeted
metabolic end products. The one or more metabolic end products may
comprise a biofuel. In one or more subsegments, the genes of the
library may encode for components of a second metabolic pathway
with one or more metabolic end products. The one or more end
products of the first and second metabolic pathways may comprise
one or more shared end products. In some cases, the first metabolic
pathway comprises an end product that is manipulated in the second
metabolic pathway.
[0093] Codon Variation
[0094] Variant oligonucleotide libraries described herein may
comprise a plurality of oligonucleotides, wherein each
oligonucleotide encodes for a variant codon sequence compared to a
reference nucleic acid sequence. In some instances, each
oligonucleotide of a first oligonucleotide population contains a
variant at a single variant site. In some instances, the first
oligonucleotide population contains a plurality of variants at a
single variant site such that the first oligonucleotide population
contains more than one variant at the same variant site. The first
oligonucleotide population may comprise oligonucleotides
collectively encoding multiple codon variants at the same variant
site. The first oligonucleotide population may comprise
oligonucleotides collectively encoding up to 19 or more codons at
the same position. The first oligonucleotide population may
comprise oligonucleotides collectively encoding up to 60 variant
triplets at the same position, or the first oligonucleotide
population may comprise oligonucleotides collectively encoding up
to 61 different triplets of codons at the same position. Each
variant may encode for a codon that results in a different amino
acid during translation. Table 4 provides a listing of each codon
possible (and the representative amino acid) for a variant
site.
TABLE-US-00004 TABLE 4 List of codons and amino acids One Three
letter letter Amino Acids code code Codons Alanine A Ala GCA GCC
GCG GCT Cysteine C Cys TGC TGT Aspartic acid D Asp GAC GAT Glutamic
acid E Glu GAA GAG Phenylalanine F Phe TTC TTT Glycine G Gly GGA
GGC GGG GGT Histidine H His CAC CAT Isoleucine I Iso ATA ATC ATT
Lysine K Lys AAA AAG Leucine L Leu TTA TTG CTA CTC CTG CTT
Methionine M Met ATG Asparagine N Asn AAC AAT Proline P Pro CCA CCC
CCG CCT Glutamine Q Gln CAA CAG Arginine R Arg AGA AGG CGA CGC CGG
CGT Serine S Ser AGC AGT TCA TCC TCG TCT Threonine T Thr ACA ACC
ACG ACT Valine V Val GTA GTC GTG GTT Tryptophan W Trp TGG Tyrosine
Y Tyr TAC TAT
[0095] Provided herein are nucleic acid libraries that may comprise
a plurality of nucleic acids, wherein each nucleic acid encodes for
a variant codon sequence compared to a reference nucleic acid
sequence. In some instances, each nucleic acid of a first nucleic
acid population contains a variant at a single variant site. In
some instances, the first nucleic acid population contains a
plurality of variants at a single variant site such that the first
nucleic acid population contains more than one variant at the same
variant site. The first nucleic acid population may comprise
nucleic acids collectively encoding multiple codon variants at the
same variant site. The first oligonucleotide population may
comprise nucleic acids collectively encoding up to 19 or more
codons at the same position. The first nucleic acid population may
comprise nucleic acids collectively encoding up to 60 variant
triplets at the same position, or the first nucleic acid population
may comprise oligonucleotides collectively encoding up to 61
different triplets of codons at the same position. Each variant may
encode for a codon that results in a different amino acid during
translation.
[0096] An oligonucleotide population may comprise varied
oligonucleotides collectively encoding up to 20 codon variations at
multiple positions. In such cases, each oligonucleotide in the
population comprises variation for codons at more than one position
in the same oligonucleotide. In some instances, each
oligonucleotide in the population comprises variation for codons at
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20 or more codons in a single oligonucleotide. In some instances,
each variant long nucleic acid comprises variation for codons at 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codons in a single
long nucleic acid. In some instances, the variant oligonucleotide
population comprises variation for codons at 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30 or more codons in a single oligonucleotide.
In some instances, the variant oligonucleotide population comprises
variation for codons in at least about 10, 20, 30, 40, 50, 60, 70,
80, 90, 100 or more codons in a single long nucleic acid.
[0097] Provided herein are processes where a second oligonucleotide
population is generated on a second cluster containing a plurality
of individually addressable loci. The second oligonucleotide
population may comprise a plurality of second oligonucleotides that
are constant for each codon position (i.e., encode the same amino
acid at each position). The second oligonucleotide may overlap with
at least a portion of the first oligonucleotides. In some
instances, the second oligonucleotides do not contain the variant
site represented on the first oligonucleotides. Alternatively, the
second oligonucleotide population may comprise a plurality of
second oligonucleotides that contain at least one variant for one
or more codon positions.
[0098] Provided herein are methods for synthesizing a library of
oligonucleotides where a single population of oligonucleotides is
generated comprising variants at multiple codon positions. A first
oligonucleotide population may be generated on a first cluster
containing a plurality of individually addressable loci. In such
cases, the first oligonucleotide population comprises variants at
different codon positions. In some instances, the different sites
are consecutive (i.e., encoding consecutive amino acids). For
example, the first oligonucleotide population comprises variants in
two consecutive codon positions, encoding up to 19 variants at a
position. In some instances, the first oligonucleotide population
comprises variants in two consecutive codon positions, encoding
from about 1 to about 19 variants at a position. In some instances,
about 38 oligonucleotides are synthesized. In some instances, the
oligonucleotides comprising variants in two consecutive codon
positions comprise a range of about 36 to about 66 bases in length.
A first oligonucleotide population may comprise varied
oligonucleotides collectively encoding up to 19 codon variants at
the same, or additional variant site. A first oligonucleotide
population may include a plurality of first oligonucleotides that
contains up to 19 variants at position x, up to 19 variants at
position y, and up to 19 variants at position z. In such an
arrangement, each variant encodes a different amino acid such that
up to 19 amino acid variants are encoded at each of the different
variant sites. In an additional instance, a second oligonucleotide
population is generated on a second cluster containing a plurality
of individually addressable loci. The second oligonucleotide
population may comprise a plurality of second oligonucleotides that
are constant for each codon position (i.e., encode the same amino
acid at each position). The second oligonucleotides may overlap
with at least a portion of the first oligonucleotides. The second
oligonucleotides may not contain the variant site represented on
the first oligonucleotides.
[0099] Variant nucleic acid libraries generated by processes
described herein provide for the generation of variant protein
libraries. In a first exemplary arrangement, a template
oligonucleotide encodes for a sequence that, when transcribed and
translated, results in a reference amino acid sequence (FIG. 4A)
having a number of codon positions, indicated by a single circle.
Oligonucleotide variants of the template may be generated using
methods described herein. In some instances, a single variant is
present in the oligonucleotide, resulting in a single amino acid
sequence (FIG. 4B). In some instances, more than one variant is
present in the oligonucleotide, wherein the variants are separated
by one or more codons, resulting in a protein with spacing between
variant residues (FIG. 4C). In some instances, more than one
variant is present in the oligonucleotide, wherein the variants are
sequential and adjacent or consecutive to one another, resulting in
spaced variant stretches of residues (FIG. 4D). In some instances,
two stretches of variants are present in the oligonucleotide,
wherein each stretch of variants comprises sequential and adjacent
or consecutive variants (FIG. 4E).
[0100] Provided herein are methods to generate a library of
oligonucleotide variants, wherein each variant comprises a single
position codon variant. In one instance, a template oligonucleotide
has a number of codon positions wherein exemplary amino acid
residues are indicated by circles with their respective one letter
code protein codon, FIG. 5A. FIG. 5B depicts a library of amino
acid variants encoded by a library of variant nucleic acids,
wherein each variant comprises a single position variant, indicated
by an "X", located at a different single site. A first position
variant has any codon to replace alanine, a second variant with any
codon encoded by the library of variant nucleic acids to replace
tryptophan, a third variant with any codon to replace isoleucine, a
fourth variant with any codon to replace lysine, a fifth variant
with any codon to replace arginine, a sixth variant with any codon
to replace glutamic acid, and a seventh variant with any codon to
replace glutamine. When all or less than all codon variants are
encoded by the variant nucleic acid library, a resulting
corresponding population of amino acid sequence variants is
generated following protein expression (i.e., standard cellular
events of DNA transcription followed by translation and processing
events).
[0101] In some arrangements, a library is generated with multiple
sites of single position variants. As depicted in FIG. 6A, a
wild-type template is provided. FIG. 6B depicts the resultant amino
acid sequence with two sites of single position codon variants,
wherein each codon variant encoding for a different amino acid is
indicated by differently patterned circles.
[0102] Provided herein are methods to generate a library having a
stretch of multiple site, single position variants. Each stretch of
oligonucleotide or nucleic acid may have 1, 2, 3, 4, 5, or more
variants. Each stretch of oligonucleotide or nucleic acid may have
at least 1 variant. Each stretch of oligonucleotide or nucleic acid
may have at least 2 variants. Each stretch of oligonucleotide or
nucleic acid may have at least 3 variants. For example, a stretch
of 5 oligonucleotides or nucleic acids may have 1 variant. A
stretch of 5 oligonucleotides or nucleic acids may have 2 variants.
A stretch of 5 oligonucleotides or nucleic acids may have 3
variants. A stretch of 5 oligonucleotides or nucleic acids may have
4 variants. For example, a stretch of 4 oligonucleotides or nucleic
acids may have 1 variant. A stretch of 4 oligonucleotides or
nucleic acids may have 2 variants. A stretch of 4 oligonucleotides
or nucleic acids may have 3 variants. A stretch of 4
oligonucleotides or nucleic acids may have 4 variants.
[0103] In some instances, single position variants may all encode
for the same amino acid, e.g. a histidine. As depicted in FIG. 7A,
a reference amino acid sequence is provided. In this arrangement, a
stretch of an oligonucleotide encodes for multiple sites of single
position variants and, when expressed, results in an amino acid
sequence having all single position variants encoding for a
histidine, FIG. 7B. In some embodiments, a variant library
synthesized by methods described herein does not encode for more
than 4 histidine residues in a resultant amino acid sequence.
[0104] In some instances, a variant library of nucleic acids
generated by methods described herein provides for expression of
amino acid sequences having separate stretches of variation. A
template amino acid sequence is depicted in FIG. 8A. A stretch of
oligonucleotides may have only 1 variant codon in two stretches
and, when expressed, result in an amino acid sequence depicted in
FIG. 8B. Variants are depicted in FIG. 8B by the differently
patterned circles to indicate variation in amino acids at different
positions in a single stretch.
[0105] Provided herein are methods and devices to synthesize
oligonucleotide or nucleic acid libraries with 1, 2, 3, or more
codon variants, wherein the variant for each site is selectively
controlled. The ratio of two amino acids for a single site variant
may be about 1:100, 1:50, 1:10, 1:5, 1:3, 1:2, 1:1. The ratio of
three amino acids for a single site variant may be about 1:1:100,
1:1:50, 1:1:20, 1:1:10, 1:1:5, 1:1:3, 1:1:2, 1:1:1, 1:10:10, 1:5:5,
1:3:3, or 1:2:2. FIG. 9A depicts a wild-type reference amino acid
sequence encoded by a wild-type nucleic acid sequence. FIG. 9B
depicts a library of amino acid variants, wherein each variant
comprising a stretch of sequence (indicated by the patterned
circles), wherein each position may have a certain ratio of amino
acids in the resultant variant protein library. The resultant
variant protein library is encoded by a variant nucleic acid
library generated by methods described herein. In this
illustration, 5 positions are varied: the first position 900 has a
50/50 K/R ratio; the second position 910 has a 50/25/25 V/L/S
ratio, the third position 920 has a 50/25/25 Y/R/D ratio, the
fourth position 930 has an equal ratio for all 20 amino acids, and
the fifth position 940 has a 75/25 ratio for G/P. The ratios
described herein are exemplary only.
[0106] Variation in Expression Cassettes
[0107] In some instances, a synthesized variant library is
generated which encodes for a portion of an expression construct.
Exemplary portions of an expression construct include the promoter,
open reading frame, and termination region. In some instances, the
expression construct encodes for one, two, three or more expression
cassettes. An oligonucleotide library may be generated, encoding
for codon variation at a single site or multiple sites in separate
regions that make up portions of an expression construct cassette,
as depicted in FIG. 11. To generate a two construct expressing
cassette, variant oligonucleotides were synthesized encoding at
least a portion of a variant sequence of a first promoter 1110,
first open reading frame 1120, first terminator 1130, second
promoter 1140, second open reading frame 1150, or second terminator
sequence 1160. After rounds of amplification, as described in
previous examples, a library of 1,024 expression constructs was
generated. FIG. 11 provides but one example arrangement. In some
instances, additional regulator sequences, such as untranslated
regulatory region (UTR) or an enhancer region, are also included in
an expression cassette referred to herein. An expression cassette
may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more components for
which variant sequences are generated by methods described herein.
In some instances, the expression construct comprises more than one
gene in a multicistronic vector. In one example, the synthesized
DNA nucleic acids are inserted into viral vectors (e.g., a
lentivirus) and then packaged for transduction into cells, or
non-viral vectors for transfer into cells, followed by screening
and analysis.
[0108] Expression vectors for inserting nucleic acids disclosed
herein comprise mammalian cells, e.g., human, non-human primate,
pig, rabbit and mouse. Exemplary expression vectors include,
without limitation, mammalian expression vectors:
pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG,
pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV-FLAG(R)-6His ("6His"
disclosed as SEQ ID NO: 41), pCEP4 pDEST27, pSF-CMV-Ub-KrYFP,
pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1 Vector, pEF1a-tdTomato Vector,
pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag(m), and
pSF-CMV-PURO-NH2-CMYC. Nucleic acids synthesized by methods
described herein may be transferred into cells by various methods
known in the art, including, without limitation, transfection,
transduction, and electroporation. Exemplary cellular functions
tested include, without limitation, changes in cellular
proliferation, death, migration/adhesion, metabolic, and
cell-signaling activity.
[0109] Highly Parallel Nucleic Acid Synthesis
[0110] Provided herein is a platform approach utilizing
miniaturization, parallelization, and vertical integration of the
end-to-end process from oligonucleotide synthesis to gene assembly
within nanowells on silicon to create a revolutionary synthesis
platform. Devices described herein provide, with the same footprint
as a 96-well plate, a silicon synthesis platform capable of
increasing throughput by a factor of up to 1,000 or more compared
to traditional synthesis methods, with production of up to
approximately 1,000,000 or more oligonucleotides, or 10,000 or more
genes in a single highly-parallelized run.
[0111] With the advent of next-generation sequencing, high
resolution genomic data has become an important factor for studies
that delve into the biological roles of various genes in both
normal biology and disease pathogenesis. At the core of this
research is the central dogma of molecular biology and the concept
of "residue-by-residue transfer of sequential information." Genomic
information encoded in the DNA is transcribed into a message that
is then translated into the protein that is the active product
within a given biological pathway.
[0112] Another exciting area of study is on the discovery,
development and manufacturing of therapeutic molecules focused on a
highly-specific cellular target. High diversity DNA sequence
libraries are at the core of development pipelines for targeted
therapeutics. Gene mutants are used to express proteins in a
design, build, and test protein engineering cycle that ideally
culminates in an optimized gene for high expression of a protein
with high affinity for its therapeutic target. As an example,
consider the binding pocket of a receptor. The ability to test all
sequence permutations of all residues within the binding pocket
simultaneously will allow for a thorough exploration, increasing
chances of success. Saturation mutagenesis, in which a researcher
attempts to generate all possible mutations at a specific site
within the receptor, represents one approach to this development
challenge. Though costly and time and labor-intensive, it enables
each variant to be introduced into each position. In contrast,
combinatorial mutagenesis, where a few selected positions or short
stretch of DNA may be modified extensively, generates an incomplete
repertoire of variants with biased representation.
[0113] To accelerate the drug development pipeline, a library with
the desired variants available at the intended frequency in the
right position available for testing--in other words, a precision
library, enables reduced costs as well as turnaround time for
screening. Provided herein are methods for synthesizing nucleic
acid synthetic variant libraries which provide for precise
introduction of each intended variant at the desired frequency. To
the end user, this translates to the ability to not only thoroughly
sample sequence space but also be able to query these hypotheses in
an efficient manner, reducing cost and screening time. Genome-wide
editing may elucidate important pathways, libraries where each
variant and sequence permutation may be tested for optimal
functionality, and thousands of genes may be used to reconstruct
entire pathways and genomes to re-engineer biological systems for
drug discovery.
[0114] In a first example, a drug itself may be optimized using
methods described herein. For example, to improve a specified
function of an antibody, a variant oligonucleotide library encoding
for a portion of the antibody is designed and synthesized. A
variant oligonucleotide library for the antibody may then be
generated by processes described herein (e.g., PCR mutagenesis
followed by insertion into a vector). The antibody is then
expressed in a production cell line and screened for enhanced
activity. Example screens include examining modulation in binding
affinity to an antigen, stability, or effector function (e.g.,
ADCC, complement, or apoptosis). Exemplary regions to optimize the
antibody include, without limitation, the Fc region, Fab region,
variable region of the Fab region, constant region of the Fab
region, variable domain of the heavy chain or light chain (V.sub.H
or V.sub.L), and specific complementarity-determining regions
(CDRs) of V.sub.H or V.sub.L.
[0115] Nucleic acid libraries synthesized by methods described
herein may be expressed in various cells associated with a disease
state. Cells associated with a disease state include cell lines,
tissue samples, primary cells from a subject, cultured cells
expanded from a subject, or cells in a model system. Exemplary
cells include without limitation, prokaryotic and eukaryotic cells.
Exemplary eukaryotic cells include, without limitation, animal,
plant, and fungal cells. Exemplary animal cells include, without
limitation, insect, fish and mammalian cells. Exemplary mammalian
cells include mouse, human, and primate cells. Exemplary model
systems include, without limitation, plant and animal models of a
disease state. Exemplary animals include, without limitation, mice,
rabbits, primates, fish, and insects. Exemplary plants include,
without limitation, a monocot and dicot. Exemplary plants also
include, without limitation, microalgae, kelp, cyanobacteria, and
green, brown and red algae, wheat, tobacco, and corn, rice, cotton,
vegetables, and fruit.
[0116] To identify a variant molecule associated with prevention,
reduction or treatment of a disease state, a variant nucleic acid
library described herein is expressed in a cell associated with a
disease state, or one in which a cell a disease state may be
induced. In some instances, an agent is used to induce a disease
state in cells. Exemplary tools for disease state induction
include, without limitation, a Cre/Lox recombination system, LPS
inflammation induction, and streptozotocin to induce hypoglycemia.
The cells associated with a disease state may be cells from a model
system or cultured cells, as well as cells from a subject having a
particular disease condition. Exemplary disease conditions include
a bacterial, fungal, viral, autoimmune, or proliferative disorder
(e.g., cancer). In some instances, the variant nucleic acid library
is expressed in the model system, cell line, or primary cells
derived from a subject, and screened for changes in at least one
cellular activity. Exemplary cellular activities include, without
limitation, proliferation, cycle progression, cell death, adhesion,
migration, reproduction, cell signaling, energy production, oxygen
utilization, metabolic activity, and aging, response to free
radical damage, or any combination thereof.
[0117] Substrates
[0118] Provided herein are substrates comprising a plurality of
clusters, wherein each cluster comprises a plurality of loci that
support the attachment and synthesis of oligonucleotides. The term
"locus" as used herein refers to a discrete region on a structure
which provides support for oligonucleotides encoding for a single
predetermined sequence to extend from the surface. In some
instances, a locus is on a two dimensional surface, e.g., a
substantially planar surface. In some instances, a locus refers to
a discrete raised or lowered site on a surface e.g., a well,
microwell, channel, or post. In some instances, a surface of a
locus comprises a material that is actively functionalized to
attach to at least one nucleotide for oligonucleotide synthesis, or
preferably, a population of identical nucleotides for synthesis of
a population of oligonucleotides. In some instances,
oligonucleotide refers to a population of oligonucleotides encoding
for the same nucleic acid sequence. In some instances, a surface of
a device is inclusive of one or a plurality of surfaces of a
substrate.
[0119] Average error rates for oligonucleotides synthesized within
a library using the systems and methods provided may be less than 1
in 1000, less than 1 in 1250, less than 1 in 1500, less than 1 in
2000, less than 1 in 3000 or less often. In some instances, average
error rates for oligonucleotides synthesized within a library using
the systems and methods provided are less than 1/500, 1/600, 1/700,
1/800, 1/900, 1/1000, 1/1100, 1/1200, 1/1250, 1/1300, 1/1400,
1/1500, 1/1600, 1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or less. In
some instances, average error rates for oligonucleotides
synthesized within a library using the systems and methods provided
are less than 1/1000.
[0120] In some instances, aggregate error rates for
oligonucleotides synthesized within a library using the systems and
methods provided are less than 1/500, 1/600, 1/700, 1/800, 1/900,
1/1000, 1/1100, 1/1200, 1/1250, 1/1300, 1/1400, 1/1500, 1/1600,
1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or less compared to the
predetermined sequences. In some instances, aggregate error rates
for oligonucleotides synthesized within a library using the systems
and methods provided herein are less than 1/500 or less compared to
the predetermined sequences. In some instances, aggregate error
rates for oligonucleotides synthesized within a library using the
systems and methods provided are less than 1/500, 1/600, 1/700,
1/800, 1/900, or 1/1000. In some instances, aggregate error rates
for oligonucleotides synthesized within a library using the systems
and methods provided are less than 1/1000.
[0121] In some instances, an error correction enzyme may be used
for oligonucleotides synthesized within a library using the systems
and methods provided herein. In some instances, aggregate error
rates for oligonucleotides with error correction may be less than
1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1100, 1/1200, 1/1300,
1/1400, 1/1500, 1/1600, 1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or
less compared to the predetermined sequences. In some instances,
aggregate error rates with error correction for oligonucleotides
synthesized within a library using the systems and methods provided
may be less than 1/500, 1/600, 1/700, 1/800, 1/900, or 1/1000. In
some instances, aggregate error rates with error correction for
oligonucleotides synthesized within a library using the systems and
methods provided may be less than 1/1000.
[0122] Error rate may limit the value of gene synthesis for the
production of libraries of gene variants. With an error rate of
1/300, about 0.7% of the clones in a 1500 base pair gene will be
correct. As most of the errors from oligonucleotide synthesis
result in frame-shift mutations, over 99% of the clones in such a
library will not produce a full-length protein. Reducing the error
rate by 75% would increase the fraction of clones that are correct
by a factor of 40. The methods and compositions of the disclosure
allow for fast de novo synthesis of large oligonucleotide and gene
libraries with error rates that are lower than commonly observed
gene synthesis methods both due to the improved quality of
synthesis and the applicability of error correction methods that
are enabled in a massively parallel and time-efficient manner.
Accordingly, libraries may be synthesized with base insertion,
deletion, substitution, or total error rates that are under 1/300,
1/400, 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1250, 1/1500,
1/2000, 1/2500, 1/3000, 1/4000, 1/5000, 1/6000, 1/7000, 1/8000,
1/9000, 1/10000, 1/12000, 1/15000, 1/20000, 1/25000, 1/30000,
1/40000, 1/50000, 1/60000, 1/70000, 1/80000, 1/90000, 1/100000,
1/125000, 1/150000, 1/200000, 1/300000, 1/400000, 1/500000,
1/600000, 1/700000, 1/800000, 1/900000, 1/1000000, or less, across
the library, or across more than 80%, 85%, 90%, 93%, 95%, 96%, 97%,
98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of
the library. The methods and compositions of the disclosure further
relate to large synthetic oligonucleotide and gene libraries with
low error rates associated with at least 30%, 40%, 50%, 60%, 70%,
75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%,
99.9%, 99.95%, 99.98%, 99.99%, or more of the oligonucleotides or
genes in at least a subset of the library to relate to error free
sequences in comparison to a predetermined/preselected sequence. In
some instances, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%,
90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%,
99.98%, 99.99%, or more of the oligonucleotides or genes in an
isolated volume within the library have the same sequence. In some
instances, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%,
93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%,
99.99%, or more of any oligonucleotides or genes related with more
than 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or
more similarity or identity have the same sequence. In some
instances, the error rate related to a specified locus on an
oligonucleotide or gene is optimized. Thus, a given locus or a
plurality of selected loci of one or more oligonucleotides or genes
as part of a large library may each have an error rate that is less
than 1/300, 1/400, 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000,
1/1250, 1/1500, 1/2000, 1/2500, 1/3000, 1/4000, 1/5000, 1/6000,
1/7000, 1/8000, 1/9000, 1/10000, 1/12000, 1/15000, 1/20000,
1/25000, 1/30000, 1/40000, 1/50000, 1/60000, 1/70000, 1/80000,
1/90000, 1/100000, 1/125000, 1/150000, 1/200000, 1/300000,
1/400000, 1/500000, 1/600000, 1/700000, 1/800000, 1/900000,
1/1000000, or less. In various instances, such error optimized loci
may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90,
100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000,
2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 30000,
50000, 75000, 100000, 500000, 1000000, 2000000, 3000000 or more
loci. The error optimized loci may be distributed to at least 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500,
600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000,
7000, 8000, 9000, 10000, 30000, 75000, 100000, 500000, 1000000,
2000000, 3000000 or more oligonucleotides or genes.
[0123] The error rates may be achieved with or without error
correction. The error rates may be achieved across the library, or
across more than 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%,
99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the
library.
[0124] Provided herein are structures that may comprise a surface
that supports the synthesis of a plurality of oligonucleotides
having different predetermined sequences at addressable locations
on a common support. In some instances, a device provides support
for the synthesis of more than 2,000; 5,000; 10,000; 20,000;
30,000; 50,000; 75,000; 100,000; 200,000; 300,000; 400,000;
500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000;
1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000;
3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more
non-identical oligonucleotides. In some instances, the device
provides support for the synthesis of more than 2,000; 5,000;
10,000; 20,000; 30,000; 50,000; 75,000; 100,000; 200,000; 300,000;
400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000;
1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000;
3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000
or more oligonucleotides encoding for distinct sequences. In some
instances, at least a portion of the oligonucleotides have an
identical sequence or are configured to be synthesized with an
identical sequence.
[0125] Provided herein are methods and devices for manufacture and
growth of oligonucleotides about 5, 10, 20, 30, 40, 50, 60, 70, 80,
90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375,
400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200,
1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 bases in length.
In some instances, the length of the oligonucleotide formed is
about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175,
200, or 225 bases in length. An oligonucleotide may be at least 5,
10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 bases in length. An
oligonucleotide may be from 10 to 225 bases in length, from 12 to
100 bases in length, from 20 to 150 bases in length, from 20 to 130
bases in length, from 30 to 100 bases in length, or from 30 to 70
bases in length.
[0126] In some instances, oligonucleotides are synthesized on
distinct loci of a substrate, wherein each locus supports the
synthesis of a population of oligonucleotides. In some instances,
each locus supports the synthesis of a population of
oligonucleotides having a different sequence than a population of
oligonucleotides grown on another locus. In some instances, the
loci of a device are located within a plurality of clusters. In
some instances, a device comprises at least 10, 500, 1000, 2000,
3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000,
13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters.
In some instances, a device comprises more than 2,000; 5,000;
10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000;
700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000;
1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000;
1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000;
800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000;
1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000;
4,500,000; 5,000,000; or 10,000,000 or more distinct loci. In some
instances, a device comprises about 10,000 distinct loci. The
amount of loci within a single cluster is varied in different
instances. In some instances, each cluster includes 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150,
200, 300, 400, 500 or more loci. In some instances, each cluster
includes about 50-500 loci. In some instances, each cluster
includes about 100-200 loci. In some instances, each cluster
includes about 100-150 loci. In some instances, each cluster
includes about 109, 121, 130 or 137 loci. In some instances, each
cluster includes about 19, 20, 61, 64 or more loci.
[0127] The number of distinct oligonucleotides synthesized on a
device may be dependent on the number of distinct loci available in
the substrate. In some instances, the density of loci within a
cluster of a device is at least or about 1 locus per mm.sup.2, 10
loci per mm.sup.2, 25 loci per mm.sup.2, 50 loci per mm.sup.2, 65
loci per mm.sup.2, 75 loci per mm.sup.2, 100 loci per mm.sup.2, 130
loci per mm.sup.2, 150 loci per mm.sup.2, 175 loci per mm.sup.2,
200 loci per mm.sup.2, 300 loci per mm.sup.2, 400 loci per
mm.sup.2, 500 loci per mm.sup.2, 1,000 loci per mm.sup.2 or more.
In some instances, a device comprises from about 10 loci per
mm.sup.2 to about 500 mm.sup.2, from about 25 loci per mm.sup.2 to
about 400 mm.sup.2, from about 50 loci per mm.sup.2 to about 500
mm.sup.2, from about 100 loci per mm.sup.2 to about 500 mm.sup.2,
from about 150 loci per mm.sup.2 to about 500 mm.sup.2, from about
10 loci per mm.sup.2 to about 250 mm.sup.2, from about 50 loci per
mm.sup.2 to about 250 mm.sup.2, from about 10 loci per mm.sup.2 to
about 200 mm.sup.2, or from about 50 loci per mm.sup.2 to about 200
mm.sup.2. In some instances, the distance from the centers of two
adjacent loci within a cluster is from about 10 um to about 500 um,
from about 10 um to about 200 um, or from about 10 um to about 100
um. In some instances, the distance from two centers of adjacent
loci is greater than about 10 um, 20 um, 30 um, 40 um, 50 um, 60
um, 70 um, 80 um, 90 um or 100 um. In some instances, the distance
from the centers of two adjacent loci is less than about 200 um,
150 um, 100 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or
10 um. In some instances, each locus has a width of about 0.5 um, 1
um, 2 um, 3 um, 4 um, 5 um, 6 um, 7 um, 8 um, 9 um, 10 um, 20 um,
30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um or 100 um. In some
instances, each locus has a width of about 0.5 um to 100 um, about
0.5 um to 50 um, about 10 um to 75 um, or about 0.5 um to 50
um.
[0128] In some instances, the density of clusters within a device
is at least or about 1 cluster per 100 mm.sup.2, 1 cluster per 10
mm.sup.2, 1 cluster per 5 mm.sup.2, 1 cluster per 4 mm.sup.2, 1
cluster per 3 mm.sup.2, 1 cluster per 2 mm.sup.2, 1 cluster per 1
mm.sup.2, 2 clusters per 1 mm.sup.2, 3 clusters per 1 mm.sup.2, 4
clusters per 1 mm.sup.2, 5 clusters per 1 mm.sup.2, 10 clusters per
1 mm.sup.2, 50 clusters per 1 mm.sup.2 or more. In some instances,
a device comprises from about 1 cluster per 10 mm.sup.2 to about 10
clusters per 1 mm.sup.2. In some instances, the distance from the
centers of two adjacent clusters is less than about 50 um, 100 um,
200 um, 500 um, 1000 um, or 2000 um or 5000 um. In some instances,
the distance from the centers of two adjacent clusters is from
about 50 um to about 100 um, from about 50 um to about 200 um, from
about 50 um to about 300 um, from about 50 um to about 500 um, and
from about 100 um to about 2000 um. In some instances, the distance
from the centers of two adjacent clusters is from about 0.05 mm to
about 50 mm, from about 0.05 mm to about 10 mm, from about 0.05 mm
to about 5 mm, from about 0.05 mm to about 4 mm, from about 0.05 mm
to about 3 mm, from about 0.05 mm to about 2 mm, from about 0.1 mm
to 10 mm, from about 0.2 mm to 10 mm, from about 0.3 mm to about 10
mm, from about 0.4 mm to about 10 mm, from about 0.5 mm to 10 mm,
from about 0.5 mm to about 5 mm, or from about 0.5 mm to about 2
mm. In some instances, each cluster has a diameter or width along
one dimension of about 0.5 to 2 mm, about 0.5 to 1 mm, or about 1
to 2 mm. In some instances, each cluster has a diameter or width
along one dimension of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2,
1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm. In some instances, each
cluster has an interior diameter or width along one dimension of
about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5,
1.6, 1.7, 1.8, 1.9 or 2 mm.
[0129] Structures for oligonucleotide synthesis for use with
devices, compositions, systems, and methods as described herein
comprise a variety of sizes. A device may be about the size of a
standard 96 well plate, for example from about 100 and 200 mm by
about 50 and 150 mm. In some instances, a device has a diameter
less than or equal to about 1000 mm, 500 mm, 450 mm, 400 mm, 300
mm, 250 nm, 200 mm, 150 mm, 100 mm or 50 mm. In some instances, the
diameter of a device is from about 25 mm to 1000 mm, from about 25
mm to about 800 mm, from about 25 mm to about 600 mm, from about 25
mm to about 500 mm, from about 25 mm to about 400 mm, from about 25
mm to about 300 mm, or from about 25 mm to about 200. Non-limiting
examples of device size include about 300 mm, 200 mm, 150 mm, 130
mm, 100 mm, 76 mm, 51 mm and 25 mm. In some instances, a device has
a planar surface area of at least about 100 mm.sup.2; 200 mm.sup.2;
500 mm.sup.2; 1,000 mm.sup.2; 2,000 mm.sup.2; 5,000 mm.sup.2;
10,000 mm.sup.2; 12,000 mm.sup.2; 15,000 mm.sup.2; 20,000 mm.sup.2;
30,000 mm.sup.2; 40,000 mm.sup.2; 50,000 mm.sup.2 or more. In some
instances, the thickness of a device is from about 50 mm to about
2000 mm, from about 50 mm to about 1000 mm, from about 100 mm to
about 1000 mm, from about 200 mm to about 1000 mm, or from about
250 mm to about 1000 mm. Non-limiting examples of device thickness
include 275 mm, 375 mm, 525 mm, 625 mm, 675 mm, 725 mm, 775 mm and
925 mm. In some instances, the thickness of a device varies with
diameter and depends on the composition of the substrate. For
example, a device comprising materials other than silicon has a
different thickness than a silicon device of the same diameter.
Device thickness may be determined by the mechanical strength of
the material used and the device must be thick enough to support
its own weight without cracking during handling. In some instances,
a structure comprises a plurality of devices described herein.
[0130] Surface Materials
[0131] Provided herein is a device comprising a surface, wherein
the surface is modified to support oligonucleotide synthesis at
predetermined locations and with a resulting low error rate, a low
dropout rate, a high yield, and a high oligo representation. In
some embodiments, surfaces of a device for oligonucleotide
synthesis provided herein are fabricated from a variety of
materials capable of modification to support a de novo
oligonucleotide synthesis reaction. In some cases, the devices are
sufficiently conductive, e.g., are able to form uniform electric
fields across all or a portion of the device. A device described
herein may comprise a flexible material. Exemplary flexible
materials include, without limitation, modified nylon, unmodified
nylon, nitrocellulose, and polypropylene. A device described herein
may comprise a rigid material. Exemplary rigid materials include,
without limitation, glass, fuse silica, silicon, silicon dioxide,
silicon nitride, plastics (for example, polytetrafluoroethylene,
polypropylene, polystyrene, polycarbonate, and blends thereof, and
metals (for example, gold, platinum). Devices disclosed herein may
be fabricated from a material comprising silicon, polystyrene,
agarose, dextran, cellulosic polymers, polyacrylamides,
polydimethylsiloxane (PDMS), glass, or any combination thereof. In
some cases, a device disclosed herein is manufactured with a
combination of materials listed herein or any other suitable
material known in the art.
[0132] In some cases, a device disclosed herein comprises a silicon
dioxide base and a surface layer of silicon oxide. Alternatively,
the device may have a base of silicon oxide. A surface of the
device provided here may be textured, resulting in an increase in
overall surface area for oligonucleotide synthesis. Devices
disclosed herein may comprise at least 5%, 10%, 25%, 50%, 80%, 90%,
95%, or 99% silicon. A device disclosed herein may be fabricated
from a silicon on insulator (SOI) wafer.
[0133] Substrates, devices and reactors provided herein are
fabricated from any variety of materials suitable for the methods
and compositions described herein. In certain instances, device
materials are fabricated to exhibit a low level of nucleotide
binding. In some instances, device materials are modified to
generate distinct surfaces that exhibit a high level of nucleotide
binding. In some instances, device materials are transparent to
visible and/or UV light. In some instances, device materials are
sufficiently conductive, e.g., are able to form uniform electric
fields across all or a portion of a substrate. In some instances,
conductive materials are connected to an electric ground. In some
instances, the device is heat conductive or insulated. In some
instances, the materials are chemical resistant and heat resistant
to support chemical or biochemical reactions, for example
oligonucleotide synthesis reaction processes. In some instances, a
device comprises flexible materials. Flexible materials include,
without limitation, modified nylon, unmodified nylon,
nitrocellulose, polypropylene, and the like. In some instances, a
device comprises rigid materials. Rigid materials include, without
limitation, glass, fuse silica, silicon, silicon dioxide, silicon
nitride, plastics (for example, polytetraflouroethylene,
polypropylene, polystyrene, polycarbonate, and blends thereof, and
the like), and metals (for example, gold, platinum, and the like).
In some instances, a device is fabricated from a material
comprising silicon, polystyrene, agarose, dextran, cellulosic
polymers, polyacrylamides, polydimethylsiloxane (PDMS), glass, or
any combination thereof. In some instances, a device is
manufactured with a combination of materials listed herein or any
other suitable material known in the art.
[0134] Surface Architecture
[0135] Provided herein are devices comprising raised and/or lowered
features. One benefit of having such features is an increase in
surface area to support oligonucleotide synthesis. In some
instances, a device having raised and/or lowered features is
referred to as a three-dimensional substrate. In some instances, a
three-dimensional device comprises one or more channels. In some
instances, one or more loci comprise a channel. In some instances,
the channels are accessible to reagent deposition via a deposition
device such as an oligonucleotide synthesizer. In some instances,
reagents and/or fluids collect in a larger well in fluid
communication with one or more channels. For example, a device
comprises a plurality of channels corresponding to a plurality of
loci with a cluster, and the plurality of channels are in fluid
communication with one well of the cluster. In some methods, a
library of oligonucleotides is synthesized in a plurality of loci
of a cluster.
[0136] In some instances, the structure is configured to allow for
controlled flow and mass transfer paths for oligonucleotide
synthesis on a surface. In some instances, the configuration of a
device allows for the controlled and even distribution of mass
transfer paths, chemical exposure times, and/or wash efficacy
during oligonucleotide synthesis. In some instances, the
configuration of a device allows for increased sweep efficiency,
for example by providing sufficient volume for growing an
oligonucleotide such that the excluded volume by the growing
oligonucleotide does not take up more than 50, 45, 40, 35, 30, 25,
20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1%, or less of
the initially available volume that is available or suitable for
growing the oligonucleotide. In some instances, a three-dimensional
structure allows for managed flow of fluid to allow for the rapid
exchange of chemical exposure.
[0137] Provided herein are methods to synthesize an amount of DNA
of 1 fM, 5 fM, 10 fM, 25 fM, 50 fM, 75 fM, 100 fM, 200 fM, 300 fM,
400 fM, 500 fM, 600 fM, 700 fM, 800 fM, 900 fM, 1 pM, 5 pM, 10 pM,
25 pM, 50 pM, 75 pM, 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600
pM, 700 pM, 800 pM, 900 pM, or more. In some instances, an
oligonucleotide library may span the length of about 1%, 2%, 3%,
4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or
100% of a gene. A gene may be varied up to about 1%, 2%, 3%, 4%,
5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or
100%.
[0138] Non-identical oligonucleotides may collectively encode a
sequence for at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100% of a gene. In some
instances, an oligonucleotide may encode a sequence of 50%, 60%,
70%, 80%, 85%, 90%, 95%, or more of a gene. In some instances, an
oligonucleotide may encode a sequence of 80%, 85%, 90%, 95%, or
more of a gene.
[0139] In some instances, segregation is achieved by physical
structure. In some instances, segregation is achieved by
differential functionalization of the surface generating active and
passive regions for oligonucleotide synthesis. Differential
functionalization is also achieved by alternating the
hydrophobicity across the device surface, thereby creating water
contact angle effects that cause beading or wetting of the
deposited reagents. Employing larger structures may decrease
splashing and cross-contamination of distinct oligonucleotide
synthesis locations with reagents of the neighboring spots. In some
instances, a device, such as an oligonucleotide synthesizer, is
used to deposit reagents to distinct oligonucleotide synthesis
locations. Substrates having three-dimensional features are
configured in a manner that allows for the synthesis of a large
number of oligonucleotides (e.g., more than about 10,000) with a
low error rate (e.g., less than about 1:500, 1:1000, 1:1500,
1:2,000; 1:3,000; 1:5,000; or 1:10,000). In some instances, a
device comprises features with a density of about or greater than
about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130,
140, 150, 160, 170, 180, 190, 200, 300, 400 or 500 features per
mm.sup.2.
[0140] A well of a device may have the same or different width,
height, and/or volume as another well of the substrate. A channel
of a device may have the same or different width, height, and/or
volume as another channel of the substrate. In some instances, the
width of a cluster is from about 0.05 mm to about 50 mm, from about
0.05 mm to about 10 mm, from about 0.05 mm to about 5 mm, from
about 0.05 mm to about 4 mm, from about 0.05 mm to about 3 mm, from
about 0.05 mm to about 2 mm, from about 0.05 mm to about 1 mm, from
about 0.05 mm to about 0.5 mm, from about 0.05 mm to about 0.1 mm,
from about 0.1 mm to 10 mm, from about 0.2 mm to about 10 mm, from
about 0.3 mm to about 10 mm, from about 0.4 mm to about 10 mm, from
about 0.5 mm to about 10 mm, from about 0.5 mm to about 5 mm, or
from about 0.5 mm to about 2 mm. In some instances, the width of a
well comprising a cluster is from about 0.05 mm to about 50 mm,
from about 0.05 mm to about 10 mm, from about 0.05 mm to about 5
mm, from about 0.05 mm to about 4 mm, from about 0.05 mm to about 3
mm, from about 0.05 mm to about 2 mm, from about 0.05 mm to about 1
mm, from about 0.05 mm to about 0.5 mm, from about 0.05 mm to about
0.1 mm, from about 0.1 mm to about 10 mm, from about 0.2 mm to
about 10 mm, from about 0.3 mm to about 10 mm, from about 0.4 mm to
about 10 mm, from about 0.5 mm to about 10 mm, from about 0.5 mm to
about 5 mm, or from about 0.5 mm to about 2 mm. In some instances,
the width of a cluster is less than or about 5 mm, 4 mm, 3 mm, 2
mm, 1 mm, 0.5 mm, 0.1 mm, 0.09 mm, 0.08 mm, 0.07 mm, 0.06 mm or
0.05 mm. In some instances, the width of a cluster is from about
1.0 to about 1.3 mm. In some instances, the width of a cluster is
about 1.150 mm. In some instances, the width of a well is less than
or about 5 mm, 4 mm, 3 mm, 2 mm, 1 mm, 0.5 mm, 0.1 mm, 0.09 mm,
0.08 mm, 0.07 mm, 0.06 mm or 0.05 mm. In some instances, the width
of a well is from about 1.0 to about 1.3 mm. In some instances, the
width of a well is about 1.150 mm. In some instances, the width of
a cluster is about 0.08 mm. In some instances, the width of a well
is about 0.08 mm. The width of a cluster may refer to clusters
within a two-dimensional or three-dimensional substrate.
[0141] In some instances, the height of a well is from about 20 um
to about 1000 um, from about 50 um to about 1000 um, from about 100
um to about 1000 um, from about 200 um to about 1000 um, from about
300 um to about 1000 um, from about 400 um to about 1000 um, or
from about 500 um to about 1000 um. In some instances, the height
of a well is less than about 1000 um, less than about 900 um, less
than about 800 um, less than about 700 um, or less than about 600
um.
[0142] In some instances, a device comprises a plurality of
channels corresponding to a plurality of loci within a cluster,
wherein the height or depth of a channel is from about 5 um to
about 500 um, from about 5 um to about 400 um, from about 5 um to
about 300 um, from about 5 um to about 200 um, from about 5 um to
about 100 um, from about 5 um to about 50 um, or from about 10 um
to about 50 um. In some instances, the height of a channel is less
than 100 um, less than 80 um, less than 60 um, less than 40 um or
less than 20 um.
[0143] In some instances, the diameter of a channel, locus (e.g.,
in a substantially planar substrate) or both channel and locus
(e.g., in a three-dimensional device wherein a locus corresponds to
a channel) is from about 1 um to about 1000 um, from about 1 um to
about 500 um, from about 1 um to about 200 um, from about 1 um to
about 100 um, from about 5 um to about 100 um, or from about 10 um
to about 100 um, for example, about 90 um, 80 um, 70 um, 60 um, 50
um, 40 um, 30 um, 20 um or 10 um. In some instances, the diameter
of a channel, locus, or both channel and locus is less than about
100 um, 90 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or
10 um. In some instances, the distance from the center of two
adjacent channels, loci, or channels and loci is from about 1 um to
about 500 um, from about 1 um to about 200 um, from about 1 um to
about 100 um, from about 5 um to about 200 um, from about 5 um to
about 100 um, from about 5 um to about 50 um, or from about 5 um to
about 30 um, for example, about 20 um.
[0144] Surface Modifications
[0145] In various instances, surface modifications are employed for
the chemical and/or physical alteration of a surface by an additive
or subtractive process to change one or more chemical and/or
physical properties of a device surface or a selected site or
region of a device surface. For example, surface modifications
include, without limitation, (1) changing the wetting properties of
a surface, (2) functionalizing a surface, i.e., providing,
modifying or substituting surface functional groups, (3)
defunctionalizing a surface, i.e., removing surface functional
groups, (4) otherwise altering the chemical composition of a
surface, e.g., through etching, (5) increasing or decreasing
surface roughness, (6) providing a coating on a surface, e.g., a
coating that exhibits wetting properties that are different from
the wetting properties of the surface, and/or (7) depositing
particulates on a surface.
[0146] In some instances, the addition of a chemical layer on top
of a surface (referred to as an adhesion promoter) facilitates
structured patterning of loci on a surface of a substrate.
Exemplary surfaces for application of adhesion promotion include,
without limitation, glass, silicon, silicon dioxide and silicon
nitride. In some instances, the adhesion promoter is a chemical
with a high surface energy. In some instances, a second chemical
layer is deposited on a surface of a substrate. In some instances,
the second chemical layer has a low surface energy. In some
instances, surface energy of a chemical layer coated on a surface
supports localization of droplets on the surface. Depending on the
patterning arrangement selected, the proximity of loci and/or area
of fluid contact at the loci are alterable.
[0147] In some instances, a device surface, or resolved loci, onto
which nucleic acids or other moieties are deposited, e.g., for
oligonucleotide synthesis, are smooth or substantially planar
(e.g., two-dimensional) or have irregularities, such as raised or
lowered features (e.g., three-dimensional features). In some
instances, a device surface is modified with one or more different
layers of compounds. Such modification layers of interest include,
without limitation, inorganic and organic layers such as metals,
metal oxides, polymers, small organic molecules and the like.
Non-limiting polymeric layers include peptides, proteins, nucleic
acids or mimetics thereof (e.g., peptide nucleic acids and the
like), polysaccharides, phospholipids, polyurethanes, polyesters,
polycarbonates, polyureas, polyamides, polyetheyleneamines,
polyarylene sulfides, polysiloxanes, polyimides, polyacetates, and
any other suitable compounds described herein or otherwise known in
the art. In some instances, polymers are heteropolymeric. In some
instances, polymers are homopolymeric. In some instances, polymers
comprise functional moieties or are conjugated.
[0148] In some instances, resolved loci of a device are
functionalized with one or more moieties that increase and/or
decrease surface energy. In some instances, a moiety is chemically
inert. In some instances, a moiety is configured to support a
desired chemical reaction, for example, one or more processes in an
oligonucleotide synthesis reaction. The surface energy, or
hydrophobicity, of a surface is a factor for determining the
affinity of a nucleotide to attach onto the surface. In some
instances, a method for device functionalization may comprise: (a)
providing a device having a surface that comprises silicon dioxide;
and (b) silanizing the surface using, a suitable silanizing agent
described herein or otherwise known in the art, for example, an
organofunctional alkoxysilane molecule.
[0149] In some instances, the organofunctional alkoxysilane
molecule comprises dimethylchloro-octodecyl-silane,
methyldichloro-octodecyl-silane, trichloro-octodecyl-silane,
trimethyl-octodecyl-silane, triethyl-octodecyl-silane, or any
combination thereof. In some instances, a device surface comprises
functionalized with polyethylene/polypropylene (functionalized by
gamma irradiation or chromic acid oxidation, and reduction to
hydroxyalkyl surface), highly crosslinked
polystyrene-divinylbenzene (derivatized by chloromethylation, and
aminated to benzylamine functional surface), nylon (the terminal
aminohexyl groups are directly reactive), or etched with reduced
polytetrafluoroethylene. Other methods and functionalizing agents
are described in U.S. Pat. No. 5,474,796, which is herein
incorporated by reference in its entirety.
[0150] In some instances, a device surface is functionalized by
contact with a derivatizing composition that contains a mixture of
silanes, under reaction conditions effective to couple the silanes
to the device surface, typically via reactive hydrophilic moieties
present on the device surface. Silanization generally covers a
surface through self-assembly with organofunctional alkoxysilane
molecules.
[0151] A variety of siloxane functionalizing reagents may further
be used as currently known in the art, e.g., for lowering or
increasing surface energy. The organofunctional alkoxysilanes may
be classified according to their organic functions.
[0152] Provided herein are devices that may contain patterning of
agents capable of coupling to a nucleoside. In some instances, a
device may be coated with an active agent. In some instances, a
device may be coated with a passive agent. Exemplary active agents
for inclusion in coating materials described herein include,
without limitation, N-(3-triethoxysilylpropyl)-4-hydroxybutyramide
(HAPS), 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane,
(3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane,
3-glycidoxypropyltrimethoxysilane (GOPS),
3-iodo-propyltrimethoxysilane, butyl-aldehydr-trimethoxysilane,
dimeric secondary aminoalkyl siloxanes,
(3-aminopropyl)-diethoxy-methylsilane,
(3-aminopropyl)-dimethyl-ethoxysilane, and
(3-aminopropyl)-trimethoxysilane,
(3-glycidoxypropyl)-dimethyl-ethoxysilane,
glycidoxy-trimethoxysilane, (3-mercaptopropyl)-trimethoxysilane,
3-4 epoxycyclohexyl-ethyltrimethoxysilane, and
(3-mercaptopropyl)-methyl-dimethoxysilane, allyl
trichlorochlorosilane, 7-oct-1-enyl trichlorochlorosilane, or bis
(3-trimethoxysilylpropyl) amine.
[0153] Exemplary passive agents for inclusion in a coating material
described herein include, without limitation,
perfluorooctyltrichlorosilane;
tridecafluoro-1,1,2,2-tetrahydrooctyl)trichlorosilane; 1H, 1H, 2H,
2H-fluorooctyltriethoxysilane (FOS);
trichloro(1H,1H,2H,2H-perfluorooctyl)silane;
tert-butyl-[5-fluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)indol-
-1-yl]-dimethyl-silane; CYTOP.TM.; Fluorinert.TM.;
perfluoroctyltrichlorosilane (PFOTCS);
perfluorooctyldimethylchlorosilane (PFODCS);
perfluorodecyltriethoxysilane (PFDTES);
pentafluorophenyl-dimethylpropylchloro-silane (PFPTES);
perfluorooctyltriethoxysilane; perfluorooctyltrimethoxysilane;
octylchlorosilane; dimethylchloro-octodecyl-silane;
methyldichloro-octodecyl-silane; trichloro-octodecyl-silane;
trimethyl-octodecyl-silane; triethyl-octodecyl-silane; or
octadecyltrichlorosilane.
[0154] In some instances, a functionalization agent comprises a
hydrocarbon silane such as octadecyltrichlorosilane. In some
instances, the functionalizing agent comprises
11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane,
(3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane,
glycidyloxypropyl/trimethoxysilane and
N-(3-triethoxysilylpropyl)-4-hydroxybutyramide.
[0155] Oligonucleotide Synthesis
[0156] Methods of the current disclosure for oligonucleotide
synthesis may include processes involving phosphoramidite
chemistry. In some instances, oligonucleotide synthesis comprises
coupling a base with phosphoramidite. Oligonucleotide synthesis may
comprise coupling a base by deposition of phosphoramidite under
coupling conditions, wherein the same base is optionally deposited
with phosphoramidite more than once, i.e., double coupling.
Oligonucleotide synthesis may comprise capping of unreacted sites.
In some instances, capping is optional. Oligonucleotide synthesis
may also comprise oxidation or an oxidation step or oxidation
steps. Oligonucleotide synthesis may comprise deblocking,
detritylation, and sulfurization. In some instances,
oligonucleotide synthesis comprises either oxidation or
sulfurization. In some instances, between one or each step during
an oligonucleotide synthesis reaction, the device is washed, for
example, using tetrazole or acetonitrile. Time frames for any one
step in a phosphoramidite synthesis method may be less than about 2
min, 1 min, 50 sec, 40 sec, 30 sec, 20 sec and 10 sec.
[0157] Oligonucleotide synthesis using a phosphoramidite method may
comprise a subsequent addition of a phosphoramidite building block
(e.g., nucleoside phosphoramidite) to a growing oligonucleotide
chain for the formation of a phosphite triester linkage.
Phosphoramidite oligonucleotide synthesis proceeds in the 3' to 5'
direction. Phosphoramidite oligonucleotide synthesis allows for the
controlled addition of one nucleotide to a growing nucleic acid
chain per synthesis cycle. In some instances, each synthesis cycle
comprises a coupling step. Phosphoramidite coupling involves the
formation of a phosphite triester linkage between an activated
nucleoside phosphoramidite and a nucleoside bound to the substrate,
for example, via a linker. In some instances, the nucleoside
phosphoramidite is provided to the device activated. In some
instances, the nucleoside phosphoramidite is provided to the device
with an activator. In some instances, nucleoside phosphoramidites
are provided to the device in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70,
80, 90, 100-fold excess or more over the substrate-bound
nucleosides. In some instances, the addition of nucleoside
phosphoramidite is performed in an anhydrous environment, for
example, in anhydrous acetonitrile. Following addition of a
nucleoside phosphoramidite, the device is optionally washed. In
some instances, the coupling step is repeated one or more
additional times, optionally with a wash step between nucleoside
phosphoramidite additions to the substrate. In some instances, an
oligonucleotide synthesis method used herein comprises 1, 2, 3 or
more sequential coupling steps. Prior to coupling, in many cases,
the nucleoside bound to the device is de-protected by removal of a
protecting group, where the protecting group functions to prevent
polymerization. A common protecting group is 4,4'-dimethoxytrityl
(DMT).
[0158] Following coupling, phosphoramidite oligonucleotide
synthesis methods optionally comprise a capping step. In a capping
step, the growing oligonucleotide is treated with a capping agent.
A capping step is useful to block unreacted substrate-bound 5'-OH
groups after coupling from further chain elongation, preventing the
formation of oligonucleotides with internal base deletions.
Further, phosphoramidites activated with 1H-tetrazole may react, to
a small extent, with the O6 position of guanosine. Without being
bound by theory, upon oxidation with I.sub.2/water, this side
product, possibly via O6-N7 migration, may undergo depurination.
The apurinic sites may end up being cleaved in the course of the
final deprotection of the oligonucleotide thus reducing the yield
of the full-length product. The O6 modifications may be removed by
treatment with the capping reagent prior to oxidation with
I.sub.2/water. In some instances, inclusion of a capping step
during oligonucleotide synthesis decreases the error rate as
compared to synthesis without capping. As an example, the capping
step comprises treating the substrate-bound oligonucleotide with a
mixture of acetic anhydride and 1-methylimidazole. Following a
capping step, the device is optionally washed.
[0159] In some instances, following addition of a nucleoside
phosphoramidite, and optionally after capping and one or more wash
steps, the device bound growing oligonucleotide is oxidized. The
oxidation step comprises the phosphite triester is oxidized into a
tetracoordinated phosphate triester, a protected precursor of the
naturally occurring phosphate diester internucleoside linkage. In
some instances, oxidation of the growing oligonucleotide is
achieved by treatment with iodine and water, optionally in the
presence of a weak base (e.g., pyridine, lutidine, collidine).
Oxidation may be carried out under anhydrous conditions using, e.g.
tert-Butyl hydroperoxide or
(1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a
capping step is performed following oxidation. A second capping
step allows for device drying, as residual water from oxidation
that may persist may inhibit subsequent coupling. Following
oxidation, the device and growing oligonucleotide is optionally
washed. In some instances, the step of oxidation is substituted
with a sulfurization step to obtain oligonucleotide
phosphorothioates, wherein any capping steps may be performed after
the sulfurization. Many reagents are capable of the efficient
sulfur transfer, including but not limited to
3-(Dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione,
DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage
reagent, and N,N,N'N'-Tetraethylthiuram disulfide (TETD).
[0160] In order for a subsequent cycle of nucleoside incorporation
to occur through coupling, the protected 5' end of the device bound
growing oligonucleotide is removed so that the primary hydroxyl
group is reactive with a next nucleoside phosphoramidite. In some
instances, the protecting group is DMT and deblocking occurs with
trichloroacetic acid in dichloromethane. Conducting detritylation
for an extended time or with stronger than recommended solutions of
acids may lead to increased depurination of solid support-bound
oligonucleotide and thus reduces the yield of the desired
full-length product. Methods and compositions of the disclosure
described herein provide for controlled deblocking conditions
limiting undesired depurination reactions. In some instances, the
device bound oligonucleotide is washed after deblocking. In some
instances, efficient washing after deblocking contributes to
synthesized oligonucleotides having a low error rate.
[0161] Methods for the synthesis of oligonucleotides typically
involve an iterating sequence of the following steps: application
of a protected monomer to an actively functionalized surface (e.g.,
locus) to link with either the activated surface, a linker or with
a previously deprotected monomer; deprotection of the applied
monomer so that it is reactive with a subsequently applied
protected monomer; and application of another protected monomer for
linking. One or more intermediate steps include oxidation or
sulfurization. In some instances, one or more wash steps precede or
follow one or all of the steps.
[0162] Methods for phosphoramidite-based oligonucleotide synthesis
comprise a series of chemical steps. In some instances, one or more
steps of a synthesis method involve reagent cycling, where one or
more steps of the method comprise application to the device of a
reagent useful for the step. For example, reagents are cycled by a
series of liquid deposition and vacuum drying steps. For substrates
comprising three-dimensional features such as wells, microwells,
channels and the like, reagents are optionally passed through one
or more regions of the device via the wells and/or channels.
[0163] Methods and systems described herein relate to
oligonucleotide synthesis devices for the synthesis of
oligonucleotides. The synthesis may be in parallel. For example, at
least or about at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50,
100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700,
750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000 or more
oligonucleotides may be synthesized in parallel. The total number
oligonucleotides that may be synthesized in parallel may be from
2-100000, 3-50000, 4-10000, 5-1000, 6-900, 7-850, 8-800, 9-750,
10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350,
18-300, 19-250, 20-200, 21-150,22-100, 23-50, 24-45, 25-40, 30-35.
Those of skill in the art appreciate that the total number of
oligonucleotides synthesized in parallel may fall within any range
bound by any of these values, for example 25-100. The total number
of oligonucleotides synthesized in parallel may fall within any
range defined by any of the values serving as endpoints of the
range. Total molar mass of oligonucleotides synthesized within the
device or the molar mass of each of the oligonucleotides may be at
least or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750,
1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000,
50000, 75000, 100000 picomoles, or more. The length of each of the
oligonucleotides or average length of the oligonucleotides within
the device may be at least or about at least 10, 15, 20, 25, 30,
35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides, or more.
The length of each of the oligonucleotides or average length of the
oligonucleotides within the device may be at most or about at most
500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17,
16, 15, 14, 13, 12, 11, 10 nucleotides, or less. The length of each
of the oligonucleotides or average length of the oligonucleotides
within the device may fall from 10-500, 9-400, 11-300, 12-200,
13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25. Those of skill
in the art appreciate that the length of each of the
oligonucleotides or average length of the oligonucleotides within
the device may fall within any range bound by any of these values,
for example 100-300. The length of each of the oligonucleotides or
average length of the oligonucleotides within the device may fall
within any range defined by any of the values serving as endpoints
of the range.
[0164] Methods for oligonucleotide synthesis on a surface provided
herein allow for synthesis at a fast rate. As an example, at least
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70,
80, 90, 100, 125, 150, 175, 200 nucleotides per hour, or more are
synthesized. Nucleotides include adenine, guanine, thymine,
cytosine, uridine building blocks, or analogs/modified versions
thereof. In some instances, libraries of oligonucleotides are
synthesized in parallel on a substrate. For example, a device
comprising about or at least about 100; 1,000; 10,000; 30,000;
75,000; 100,000; 1,000,000; 2,000,000; 3,000,000; 4,000,000; or
5,000,000 resolved loci is able to support the synthesis of at
least the same number of distinct oligonucleotides, wherein each
oligonucleotide encoding a distinct sequence is synthesized on a
resolved locus. In some instances, a library of oligonucleotides is
synthesized on a device with low error rates described herein in
less than about three months, two months, one month, three weeks,
15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours or
less. In some instances, larger nucleic acids assembled from an
oligonucleotide library synthesized with a low error rate using the
substrates and methods described herein are prepared in less than
about three months, two months, one month, three weeks, 15, 14, 13,
12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours or less.
[0165] In some instances, methods described herein provide for
generation of a library of oligonucleotides comprising variant
oligonucleotides differing at a plurality of codon sites. In some
instances, an oligonucleotide may have 1 site, 2 sites, 3 sites, 4
sites, 5 sites, 6 sites, 7 sites, 8 sites, 9 sites, 10 sites, 11
sites, 12 sites, 13 sites, 14 sites, 15 sites, 16 sites, 17 sites
18 sites, 19 sites, 20 sites, 30 sites, 40 sites, 50 sites, or more
of variant codon sites.
[0166] In some instances, the one or more sites of variant codon
sites may be adjacent. In some instances, the one or more sites of
variant codon sites may not be adjacent and separated by 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, or more codons.
[0167] In some instances, an oligonucleotide may comprise multiple
sites of variant codon sites, wherein all the variant codon sites
are adjacent to one another, forming a stretch of variant codon
sites. In some instances, an oligonucleotide may comprise multiple
sites of variant codon sites, wherein none the variant codon sites
are adjacent to one another. In some instances, an oligonucleotide
may comprise multiple sites of variant codon sites, wherein some
the variant codon sites are adjacent to one another, forming a
stretch of variant codon sites, and some of the variant codon sites
are not adjacent to one another.
[0168] Referring to the Figures, FIG. 12 illustrates an exemplary
process workflow for synthesis of nucleic acids (e.g., genes) from
shorter oligonucleotides. The workflow is divided generally into
phases: (1) de novo synthesis of a single stranded oligonucleotide
library, (2) joining oligonucleotides to form larger fragments, (3)
error correction, (4) quality control, and (5) shipment. Prior to
de novo synthesis, an intended nucleic acid sequence or group of
nucleic acid sequences is preselected. For example, a group of
genes is preselected for generation.
[0169] Once large oligonucleotides for generation are selected, a
predetermined library of oligonucleotides is designed for de novo
synthesis. Various suitable methods are known for generating high
density oligonucleotide arrays. In the workflow example, a device
surface layer 1201 is provided. In the example, chemistry of the
surface is altered in order to improve the oligonucleotide
synthesis process. Areas of low surface energy are generated to
repel liquid while areas of high surface energy are generated to
attract liquids. The surface itself may be in the form of a planar
surface or contain variations in shape, such as protrusions or
microwells which increase surface area. In the workflow example,
high surface energy molecules selected serve a dual function of
supporting DNA chemistry, as disclosed in International Patent
Application Publication WO/2015/021080, which is herein
incorporated by reference in its entirety.
[0170] In situ preparation of oligonucleotide arrays is generated
on a solid support and utilizes single nucleotide extension process
to extend multiple oligomers in parallel. A material deposition
device, such as an oligonucleotide synthesizer, is designed to
release reagents in a step wise fashion such that multiple
oligonucleotides extend, in parallel, one residue at a time to
generate oligomers with a predetermined nucleic acid sequence 1202.
In some instances, oligonucleotides are cleaved from the surface at
this stage. Cleavage includes gas cleavage, e.g., with ammonia or
methylamine.
[0171] The generated oligonucleotide libraries are placed in a
reaction chamber. In this exemplary workflow, the reaction chamber
(also referred to as "nanoreactor") is a silicon coated well,
containing PCR reagents and lowered onto the oligonucleotide
library 1203. Prior to or after the sealing 1204 of the
oligonucleotides, a reagent is added to release the
oligonucleotides from the substrate. In the exemplary workflow, the
oligonucleotides are released subsequent to sealing of the
nanoreactor 1205. Once released, fragments of single stranded
oligonucleotides hybridize in order to span an entire long range
sequence of DNA. Partial hybridization 1205 is possible because
each synthesized oligonucleotide is designed to have a small
portion overlapping with at least one other oligonucleotide in the
pool.
[0172] After hybridization, a PCA reaction is commenced. During the
polymerase cycles, the oligonucleotides anneal to complementary
fragments and gaps are filled in by a polymerase. Each cycle
increases the length of various fragments randomly depending on
which oligonucleotides find each other. Complementarity amongst the
fragments allows for forming a complete large span of double
stranded DNA 1206.
[0173] After PCA is complete, the nanoreactor is separated from the
device 1207 and positioned for interaction with a device having
primers for PCR 1208. After sealing, the nanoreactor is subject to
PCR 1209 and the larger nucleic acids are amplified. After PCR
1210, the nanochamber is opened 1211, error correction reagents are
added 1212, the chamber is sealed 1213 and an error correction
reaction occurs to remove mismatched base pairs and/or strands with
poor complementarity from the double stranded PCR amplification
products 1214. The nanoreactor is opened and separated 1215. Error
corrected product is next subject to additional processing steps,
such as PCR and molecular bar coding, and then packaged 1222 for
shipment 1223.
[0174] In some instances, quality control measures are taken. After
error correction, quality control steps include for example
interaction with a wafer having sequencing primers for
amplification of the error corrected product 1216, sealing the
wafer to a chamber containing error corrected amplification product
1217, and performing an additional round of amplification 1218. The
nanoreactor is opened 1219 and the products are pooled 1220 and
sequenced 1221. After an acceptable quality control determination
is made, the packaged product 1222 is approved for shipment
1223.
[0175] In some instances, a nucleic acid generated by a workflow
such as that in FIG. 12 is subject to mutagenesis using overlapping
primers disclosed herein. In some instances, a library of primers
is generated by in situ preparation on a solid support and utilize
single nucleotide extension process to extend multiple oligomers in
parallel. A deposition device, such as an oligonucleotide
synthesizer, is designed to release reagents in a step wise fashion
such that multiple oligonucleotides extend, in parallel, one
residue at a time to generate oligomers with a predetermined
nucleic acid sequence 1202.
[0176] Computer Systems
[0177] Any of the systems described herein, may be operably linked
to a computer and may be automated through a computer either
locally or remotely. In various instances, the methods and systems
of the disclosure may further comprise software programs on
computer systems and use thereof. Accordingly, computerized control
for the synchronization of the dispense/vacuum/refill functions
such as orchestrating and synchronizing the material deposition
device movement, dispense action and vacuum actuation are within
the bounds of the disclosure. The computer systems may be
programmed to interface between the user specified base sequence
and the position of a material deposition device to deliver the
correct reagents to specified regions of the substrate.
[0178] The computer system 1300 illustrated in FIG. 13 may be
understood as a logical apparatus that can read instructions from
media 1311 and/or a network port 1305, which can optionally be
connected to server 1309 having fixed media 1312. The system, such
as shown in FIG. 13 can include a CPU 1301, disk drives 1303,
optional input devices such as keyboard 1315 and/or mouse 1316 and
optional monitor 1307. Data communication may be achieved through
the indicated communication medium to a server at a local or a
remote location. The communication medium may include any means of
transmitting and/or receiving data. For example, the communication
medium may be a network connection, a wireless connection or an
internet connection. Such a connection may provide for
communication over the World Wide Web. It is envisioned that data
relating to the present disclosure may be transmitted over such
networks or connections for reception and/or review by a party 1322
as illustrated in FIG. 13.
[0179] FIG. 14 is a block diagram illustrating a first example
architecture of a computer system 1400 that may be used in
connection with example instances of the present disclosure. As
depicted in FIG. 14, the example computer system may include a
processor 1402 for processing instructions. Non-limiting examples
of processors include: Intel Xeon.TM. processor, AMD Opteron.TM.
processor, Samsung 32-bit RISC ARM 1176JZ(F)-S v1.0.TM. processor,
ARM Cortex-A8 Samsung S5PC100.TM. processor, ARM Cortex-A8 Apple
A4.TM. processor, Marvell PXA 930.TM. processor, or a
functionally-equivalent processor. Multiple threads of execution
may be used for parallel processing. In some instances, multiple
processors or processors with multiple cores may also be used,
whether in a single computer system, in a cluster, or distributed
across systems over a network comprising a plurality of computers,
cell phones, and/or personal data assistant devices.
[0180] As illustrated in FIG. 14, a high speed cache 1404 may be
connected to, or incorporated in, the processor 1402 to provide a
high speed memory for instructions or data that have been recently,
or are frequently, used by processor 1402. The processor 1402 is
connected to a north bridge 1406 by a processor bus 1408. The north
bridge 1406 is connected to random access memory (RAM) 1410 by a
memory bus 1412 and manages access to the RAM 1410 by the processor
1402. The north bridge 1406 is also connected to a south bridge
1414 by a chipset bus 1416. The south bridge 1414 is, in turn,
connected to a peripheral bus 1418. The peripheral bus may be, for
example, PCI, PCI-X, PCI Express, or other peripheral bus. The
north bridge and south bridge are often referred to as a processor
chipset and manage data transfer between the processor, RAM, and
peripheral components on the peripheral bus 1418. In some
alternative architectures, the functionality of the north bridge
may be incorporated into the processor instead of using a separate
north bridge chip. In some instances, system 1400 may include an
accelerator card 1422 attached to the peripheral bus 1418. The
accelerator may include field programmable gate arrays (FPGAs) or
other hardware for accelerating certain processing. For example, an
accelerator may be used for adaptive data restructuring or to
evaluate algebraic expressions used in extended set processing.
[0181] Software and data are stored in external storage 1424 and
may be loaded into RAM 1410 and/or cache 1404 for use by the
processor. The system 1400 includes an operating system for
managing system resources; non-limiting examples of operating
systems include: Linux, Windows.TM., MACOS.TM., BlackBerry OS.TM.,
iOS.TM., and other functionally-equivalent operating systems, as
well as application software running on top of the operating system
for managing data storage and optimization in accordance with
example instances of the present disclosure. In this example,
system 1400 also includes network interface cards (NICs) 1420 and
1421 connected to the peripheral bus for providing network
interfaces to external storage, such as Network Attached Storage
(NAS) and other computer systems that may be used for distributed
parallel processing.
[0182] FIG. 15 is a diagram showing a network 1500 with a plurality
of computer systems 1502a, and 1502b, a plurality of cell phones
and personal data assistants 1502c, and Network Attached Storage
(NAS) 1504a, and 1504b. In example instances, systems 1502a, 1502b,
and 1502c may manage data storage and optimize data access for data
stored in Network Attached Storage (NAS) 1504a and 1504b. A
mathematical model may be used for the data and be evaluated using
distributed parallel processing across computer systems 1502a, and
1502b, and cell phone and personal data assistant systems 1502c.
Computer systems 1502a, and 1502b, and cell phone and personal data
assistant systems 1502c may also provide parallel processing for
adaptive data restructuring of the data stored in Network Attached
Storage (NAS) 1504a and 1504b. FIG. 15 illustrates an example only,
and a wide variety of other computer architectures and systems may
be used in conjunction with the various instances of the present
disclosure. For example, a blade server may be used to provide
parallel processing. Processor blades may be connected through a
back plane to provide parallel processing. Storage may also be
connected to the back plane or as Network Attached Storage (NAS)
through a separate network interface. In some example instances,
processors may maintain separate memory spaces and transmit data
through network interfaces, back plane or other connectors for
parallel processing by other processors. In other instances, some
or all of the processors may use a shared virtual address memory
space.
[0183] FIG. 16 is a block diagram of a multiprocessor computer
system 1600 using a shared virtual address memory space in
accordance with an example instance. The system includes a
plurality of processors 1602a-f that may access a shared memory
subsystem 1604. The system incorporates a plurality of programmable
hardware memory algorithm processors (MAPs) 1606a-fin the memory
subsystem 1604. Each MAP 1606a-f may comprise a memory 1608a-f and
one or more field programmable gate arrays (FPGAs) 1610a-f. The MAP
provides a configurable functional unit and particular algorithms
or portions of algorithms may be provided to the FPGAs 1610a-f for
processing in close coordination with a respective processor. For
example, the MAPs may be used to evaluate algebraic expressions
regarding the data model and to perform adaptive data restructuring
in example instances. In this example, each MAP is globally
accessible by all of the processors for these purposes. In one
configuration, each MAP may use Direct Memory Access (DMA) to
access an associated memory 1608a-f, allowing it to execute tasks
independently of, and asynchronously from the respective
microprocessor 1602a-f. In this configuration, a MAP may feed
results directly to another MAP for pipelining and parallel
execution of algorithms.
[0184] The above computer architectures and systems are examples
only, and a wide variety of other computer, cell phone, and
personal data assistant architectures and systems may be used in
connection with example instances, including systems using any
combination of general processors, co-processors, FPGAs and other
programmable logic devices, system on chips (SOCs), application
specific integrated circuits (ASICs), and other processing and
logic elements. In some instances, all or part of the computer
system may be implemented in software or hardware. Any variety of
data storage media may be used in connection with example
instances, including random access memory, hard drives, flash
memory, tape drives, disk arrays, Network Attached Storage (NAS)
and other local or distributed data storage devices and
systems.
[0185] In example instances, the computer system may be implemented
using software modules executing on any of the above or other
computer architectures and systems. In other instances, the
functions of the system may be implemented partially or completely
in firmware, programmable logic devices such as field programmable
gate arrays (FPGAs) as referenced in FIG. 16, system on chips
(SOCs), application specific integrated circuits (ASICs), or other
processing and logic elements. For example, the Set Processor and
Optimizer may be implemented with hardware acceleration through the
use of a hardware accelerator card, such as accelerator card 1422
illustrated in FIG. 14.
[0186] The following examples are set forth to illustrate more
clearly the principle and practice of embodiments disclosed herein
to those skilled in the art and are not to be construed as limiting
the scope of any claimed embodiments. Unless otherwise stated, all
parts and percentages are on a weight basis.
EXAMPLES
[0187] The following examples are given for the purpose of
illustrating various embodiments of the disclosure and are not
meant to limit the present disclosure in any fashion. The present
examples, along with the methods described herein are presently
representative of preferred embodiments, are exemplary, and are not
intended as limitations on the scope of the disclosure. Changes
therein and other uses which are encompassed within the spirit of
the disclosure as defined by the scope of the claims will occur to
those skilled in the art.
Example 1: Functionalization of a Device Surface
[0188] A device was functionalized to support the attachment and
synthesis of a library of oligonucleotides. The device surface was
first wet cleaned using a piranha solution comprising 90%
H.sub.2SO.sub.4 and 10% H.sub.2O.sub.2 for 20 minutes. The device
was rinsed in several beakers with DI water, held under a DI water
gooseneck faucet for 5 min, and dried with N.sub.2. The device was
subsequently soaked in NH.sub.4OH (1:100; 3 mL:300 mL) for 5 min,
rinsed with DI water using a handgun, soaked in three successive
beakers with DI water for 1 min each, and then rinsed again with DI
water using the handgun. The device was then plasma cleaned by
exposing the device surface to O.sub.2. A SAMCO PC-300 instrument
was used to plasma etch O.sub.2 at 250 watts for 1 min in
downstream mode.
[0189] The cleaned device surface was actively functionalized with
a solution comprising
N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P
vapor deposition oven system with the following parameters: 0.5 to
1 torr, 60 min, 70.degree. C., 135.degree. C. vaporizer. The device
surface was resist coated using a Brewer Science 200X spin coater.
SPR.TM. 3612 photoresist was spin coated on the device at 2500 rpm
for 40 sec. The device was pre-baked for 30 min at 90.degree. C. on
a Brewer hot plate. The device was subjected to photolithography
using a Karl Suss MA6 mask aligner instrument. The device was
exposed for 2.2 sec and developed for 1 min in MSF 26A. Remaining
developer was rinsed with the handgun and the device soaked in
water for 5 min. The device was baked for 30 min at 100.degree. C.
in the oven, followed by visual inspection for lithography defects
using a Nikon L200. A descum process was used to remove residual
resist using the SAMCO PC-300 instrument to O.sub.2 plasma etch at
250 watts for 1 min.
[0190] The device surface was passively functionalized with a 100
.mu.L solution of perfluorooctyltrichlorosilane mixed with 10 .mu.L
light mineral oil. The device was placed in a chamber, pumped for
10 min, and then the valve was closed to the pump and left to stand
for 10 min. The chamber was vented to air. The device was resist
stripped by performing two soaks for 5 min in 500 mL NMP at
70.degree. C. with ultrasonication at maximum power (9 on Crest
system). The device was then soaked for 5 min in 500 mL isopropanol
at room temperature with ultrasonication at maximum power. The
device was dipped in 300 mL of 200 proof ethanol and blown dry with
N.sub.2. The functionalized surface was activated to serve as a
support for oligonucleotide synthesis.
Example 2: Synthesis of a 50-mer Sequence on an Oligonucleotide
Synthesis Device
[0191] A two dimensional oligonucleotide synthesis device was
assembled into a flowcell, which was connected to a flowcell
(Applied Biosystems (ABI394 DNA Synthesizer"). The two-dimensional
oligonucleotide synthesis device was uniformly functionalized with
N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest) was used to
synthesize an exemplary oligonucleotide of 50 bp ("50-mer
oligonucleotide") using oligonucleotide synthesis methods described
herein.
[0192] The sequence of the 50-mer was as described in SEQ ID NO.:
20. 5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTT
TTT3' (SEQ ID NO.: 20), where # denotes Thymidine-succinyl hexamide
CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable
linker enabling the release of oligos from the surface during
deprotection.
[0193] The synthesis was done using standard DNA synthesis
chemistry (coupling, capping, oxidation, and deblocking) according
to the protocol in Table 5 and an ABI synthesizer.
TABLE-US-00005 TABLE 5 Synthesis Protocol General DNA Synthesis
Table 5 Process Name Process Step Time (sec) WASH (Acetonitrile
Acetonitrile System Flush 4 Wash Flow) Acetonitrile to Flowcell 23
N2 System Flush 4 Acetonitrile System Flush 4 DNA BASE ADDITION
Activator Manifold Flush 2 (Phosphoramidite + Activator to Flowcell
6 Activator Flow) Activator + 6 Phosphoramidite to Flowcell
Activator to Flowcell 0.5 Activator + 5 Phosphoramidite to Flowcell
Activator to Flowcell 0.5 Activator + 5 Phosphoramidite to Flowcell
Activator to Flowcell 0.5 Activator + 5 Phosphoramidite to Flowcell
Incubate for 25 sec 25 WASH (Acetonitrile Acetonitrile System Flush
4 Wash Flow) Acetonitrile to Flowcell 15 N2 System Flush 4
Acetonitrile System Flush 4 DNA BASE ADDITION Activator Manifold
Flush 2 (Phosphoramidite + Activator to Flowcell 5 Activator Flow)
Activator + 18 Phosphoramidite to Flowcell Incubate for 25 sec 25
WASH (Acetonitrile Acetonitrile System Flush 4 Wash Flow)
Acetonitrile to Flowcell 15 N2 System Flush 4 Acetonitrile System
Flush 4 CAPPING (CapA + B, CapA + B to Flowcell 15 1:1, Flow) WASH
(Acetonitrile Acetonitrile System Flush 4 Wash Flow) Acetonitrile
to Flowcell 15 Acetonitrile System Flush 4 OXIDATION (Oxidizer
Oxidizer to Flowcell 18 Flow) WASH (Acetonitrile Acetonitrile
System Flush 4 Wash Flow) N2 System Flush 4 Acetonitrile System
Flush 4 Acetonitrile to Flowcell 15 Acetonitrile System Flush 4
Acetonitrile to Flowcell 15 N2 System Flush 4 Acetonitrile System
Flush 4 Acetonitrile to Flowcell 23 N2 System Flush 4 Acetonitrile
System Flush 4 DEBLOCKING (Deblock Deblock to Flowcell 36 Flow)
WASH (Acetonitrile Acetonitrile System Flush 4 Wash Flow) N2 System
Flush 4 Acetonitrile System Flush 4 Acetonitrile to Flowcell 18 N2
System Flush 4.13 Acetonitrile System Flush 4.13 Acetonitrile to
Flowcell 15
[0194] The phosphoramidite/activator combination was delivered
similar to the delivery of bulk reagents through the flowcell. No
drying steps were performed as the environment stays "wet" with
reagent the entire time.
[0195] The flow restrictor was removed from the ABI 394 synthesizer
to enable faster flow. Without flow restrictor, flow rates for
amidites (0.1M in ACN), Activator, (0.25M Benzoylthiotetrazole
("BTT"; 30-3070-xx from GlenResearch) in ACN), and Ox (0.02M I2 in
20% pyridine, 10% water, and 70% THF) were roughly .about.100
uL/sec, for acetonitrile ("ACN") and capping reagents (1:1 mix of
CapA and CapB, wherein CapA is acetic anhydride in THF/Pyridine and
CapB is 16% 1-methylimidizole in THF), roughly .about.200 uL/sec,
and for Deblock (3% dichloroacetic acid in toluene), roughly
.about.300 uL/sec (compared to .about.50 uL/sec for all reagents
with flow restrictor). The time to completely push out Oxidizer was
observed, the timing for chemical flow times was adjusted
accordingly and an extra ACN wash was introduced between different
chemicals. After oligonucleotide synthesis, the chip was
deprotected in gaseous ammonia overnight at 75 psi. Five drops of
water were applied to the surface to recover oligonucleotides. The
recovered oligonucleotides were then analyzed on a BioAnalyzer
small RNA chip (data not shown).
Example 3: Synthesis of a 100-mer Sequence on an Oligonucleotide
Synthesis Device
[0196] The same process as described in Example 2 for the synthesis
of the 50-mer sequence was used for the synthesis of a 100-mer
oligonucleotide ("100-mer oligonucleotide"; 5'
CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATG
CTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3', where #
denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244
from ChemGenes); SEQ ID NO.: 21) on two different silicon chips,
the first one uniformly functionalized with
N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE and the second one
functionalized with 5/95 mix of 11-acetoxyundecyltriethoxysilane
and n-decyltriethoxysilane, and the oligonucleotides extracted from
the surface were analyzed on a BioAnalyzer instrument (data not
shown).
[0197] All ten samples from the two chips were further PCR
amplified using a forward (5'ATGCGGGGTTCTCATCATC3'; SEQ ID NO.: 22)
and a reverse (5'CGGGATCCTTATCGTCATCG3; SEQ ID NO.: 23) primer in a
50 uL PCR mix (25 uL NEB Q5 mastermix, 2.5 uL 10 uM Forward primer,
2.5 uL 10 uM Reverse primer, 1 uL oligonucleotide extracted from
the surface, and water up to 50 uL) using the following
thermalcycling program: [0198] 98.degree. C., 30 sec [0199]
98.degree. C., 10 sec; 63.degree. C., 10 sec; 72.degree. C., 10
sec; repeat 12 cycles [0200] 72.degree. C., 2 min
[0201] The PCR products were also run on a BioAnalyzer (data not
shown), demonstrating sharp peaks at the 100-mer position. Next,
the PCR amplified samples were cloned, and Sanger sequenced. Table
6 summarizes the results from the Sanger sequencing for samples
taken from spots 1-5 from chip 1 and for samples taken from spots
6-10 from chip 2.
TABLE-US-00006 TABLE 6 Sequencing Results Spot Error rate Cycle
efficiency 1 1/763 bp 99.87% 2 1/824 bp 99.88% 3 1/780 bp 99.87% 4
1/429 bp 99.77% 5 1/1525 bp 99.93% 6 1/1615 bp 99.94% 7 1/531 bp
99.81% 8 1/1769 bp 99.94% 9 1/854 bp 99.88% 10 1/1451 bp 99.93%
[0202] Thus, the high quality and uniformity of the synthesized
oligonucleotides were repeated on two chips with different surface
chemistries. Overall, 89%, corresponding to 233 out of 262 of the
100-mers that were sequenced were perfect sequences with no
errors.
[0203] Finally, Table 7 summarizes error characteristics for the
sequences obtained from the oligonucleotides samples from spots
1-10.
TABLE-US-00007 TABLE 7 Error Characteristics Sample ID/Spot no.
OSA_0046/1 OSA_0047/2 OSA_0048/3 OSA_0049/4 OSA_0050/5 Total 32 32
32 32 32 Sequences Sequencing 25 of 28 27 of 27 26 of 30 21 of 23
25 of 26 Quality Oligo Quality 23 of 25 25 of 27 22 of 26 18 of 21
24 of 25 ROI Match 2500 2698 2561 2122 2499 Count ROI 2 2 1 3 1
Mutation ROI Multi 0 0 0 0 0 Base Deletion ROI Small 1 0 0 0 0
Insertion ROI Single 0 0 0 0 0 Base Deletion Large 0 0 1 0 0
Deletion Count Mutation: 2 2 1 2 1 G > A Mutation: 0 0 0 1 0 T
> C ROI Error 3 2 2 3 1 Count ROI Error Err: ~1 Err: ~1 Err: ~1
Err: ~1 Err: ~1 Rate in 834 in 1350 in 1282 in 708 in 2500 ROI
Minus MP Err: ~1 MP Err: ~1 MP Err: ~1 MP Err: ~1 MP Err: ~1 Primer
in 763 in 824 in 780 in 429 in 1525 Error Rate Sample ID/Spot no.
OSA_0051/6 OSA_0052/7 OSA_0053/8 OSA_0054/9 OSA_0055/10 Total 32 32
32 32 32 Sequences Sequencing 29 of 30 27 of 31 29 of 31 28 of 29
25 of 28 Quality Oligo Quality 25 of 29 22 of 27 28 of 29 26 of 28
20 of 25 ROI Match 2666 2625 2899 2798 2348 Count ROI 0 2 1 2 1
Mutation ROI Multi 0 0 0 0 0 Base Deletion ROI Small 0 0 0 0 0
Insertion ROI Single 0 0 0 0 0 Base Deletion Large 1 1 0 0 0
Deletion Count Mutation: 0 2 1 2 1 G > A Mutation: 0 0 0 0 0 T
> C ROI Error 1 3 1 2 1 Count ROI Error Err: ~1 Err: ~1 Err: ~1
Err: ~1 Err: ~1 Rate in 2667 in 876 in 2900 in 1400 in 2349 ROI
Minus MP Err: ~1 MP Err: ~1 MP Err: ~1 MP Err: ~1 MP Err: ~1 Primer
in 1615 in 531 in 1769 in 854 in 1451 Error Rate
Example 4: Generation of a Nucleic Acid Library by Single-Site,
Single Position Mutagenesis
[0204] Oligonucleotide primers were de novo synthesized for use in
a series of PCR reactions to generate a library of oligonucleotide
variants of a template nucleic acid, see FIGS. 2A-2D. Four types of
primers were generated in FIG. 2A: an outer 5' primer 215, an outer
3' primer 230, an inner 5' primer 225, and an inner 3' primer 220.
The inner 5' primer/first oligonucleotide 220 and an inner 3'
primer/second oligonucleotide 225 were generated using an
oligonucleotide synthesis method as generally outlined in Table 6.
The inner 5' primer/first oligonucleotide 220 represents a set of
up to 19 primers of predetermined sequence, where each primer in
the set differs from another at a single codon, in a single site of
the sequence.
[0205] Oligonucleotide synthesis was performed on a device having
at least two clusters, each cluster having 121 individually
addressable loci.
[0206] The inner 5' primer 225 and the inner 3' primer 220 were
synthesized in separate clusters. The inner 5' primer 225 was
replicated 121 times, extending on 121 loci within a single
cluster. For inner 3' primer 220, each of the 19 primers of variant
sequences were each extended on 6 different loci, resulting in the
extension of 114 oligonucleotides on 114 different loci.
[0207] Synthesized oligonucleotides were cleaved from the surface
of the device and transferred to a plastic vial. A first PCR
reaction was performed, using fragments of the long nucleic acid
sequence 235, 240 to amplify the template nucleic acid, as
illustrated in FIG. 2B. A second PCR reaction was performed using
primer combination and the products of the first PCR reaction as a
template, as illustrated in FIGS. 2C-2D. Analysis of the second PCR
products was conducted on a BioAnalyzer, as shown in the trace of
FIG. 17.
Example 5: Generation of a Nucleic Acid Library Comprising 96
Different Sets of Single Position Variants
[0208] Four sets of primers, as generally shown in FIG. 2A and
addressed in Example 2, were generated using de novo
oligonucleotide synthesis. For the inner 5' primer 220, 96
different sets of primers were generated, each set of primers
targeting a different single codon positioned within a single site
of the template nucleic acid. For each set of primers, 19 different
variants were generated, each variant comprising a codon encoding
for a different amino acid at the single site. Two rounds of PCR
were performed using the generated primers, as generally shown in
FIGS. 2A-2D and described in Example 2. The 96 sets of
amplification products were visualized in an electropherogram (FIG.
18), which was used to calculate a 100% amplification success
rate.
Example 6: Generation of a Nucleic Acid Library Comprising 500
Different Sets of Single Position Variants
[0209] Four sets of primers, as generally shown in FIG. 2A and
addressed in Example 2, were generated using de novo
oligonucleotide synthesis. For the inner 5' primer 220, 500
different sets of primers were generated, each set of primers
targeting a different single codon positioned within a single site
of the template nucleic acid. For each set of primers, 19 different
variants were generated, each variant comprising a codon encoding
for a different amino acid at the single site. Two rounds of PCR
were performed using the generated primers, as generally shown in
FIG. 2A and described in Example 2. Electropherograms display each
of the 500 sets of PCR products having a population of nucleic
acids with 19 variants at a different single site (data not shown).
A comprehensive sequencing analysis of the library showed a greater
than 99% success rate across preselected codon mutations (sequence
trace and analysis data not shown).
Example 7: Single-Site Mutagenesis Primers For 1 Position
[0210] An example of codon variation design is provided in Table 8
for Yellow Fluorescent Protein. In this case, a single codon from a
50-mer of the sequence is varied 19 times. Variant nucleic acid
sequence is indicated by bold letters. The wild type primer
sequence is:
TABLE-US-00008 (SEQ ID NO.: 1)
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT.
In this case, the wild type codon encodes for valine, indicated by
underline in SEQ ID NO.: 1. Therefore the 19 variants below exclude
a codon encoding for valine. In an alternative example, if all
triplets are to be considered, then all 60 variants would be
generated, including an alternative sequence for the wild type
codon.
TABLE-US-00009 TABLE 8 Variant Sequences SEQ ID Variant NO. Variant
sequence codon 2 atgTTTAGCAAGGGCGAGGAGC F TGTTCACCGGGGTGGTGCCCAT 3
atgTTAAGCAAGGGCGAGGAGC L TGTTCACCGGGGTGGTGCCCAT 4
atgATTAGCAAGGGCGAGGAGC I TGTTCACCGGGGTGGTGCCCAT 5
atgTCTAGCAAGGGCGAGGAGC S TGTTCACCGGGGTGGTGCCCAT 6
atgCCTAGCAAGGGCGAGGAGC P TGTTCACCGGGGTGGTGCCCAT 7
atgACTAGCAAGGGCGAGGAGC T TGTTCACCGGGGTGGTGCCCAT 8
atgGCTAGCAAGGGCGAGGAGC A TGTTCACCGGGGTGGTGCCCAT 9
atgTATAGCAAGGGCGAGGAGC Y TGTTCACCGGGGTGGTGCCCAT 10
atgCATAGCAAGGGCGAGGAGC H TGTTCACCGGGGTGGTGCCCAT 11
atgCAAAGCAAGGGCGAGGAGC Q TGTTCACCGGGGTGGTGCCCAT 12
atgAATAGCAAGGGCGAGGAGC N TGTTCACCGGGGTGGTGCCCAT 13
atgAAAAGCAAGGGCGAGGAGC K TGTTCACCGGGGTGGTGCCCAT 14
atgGATAGCAAGGGCGAGGAGC D TGTTCACCGGGGTGGTGCCCAT 15
atgGAAAGCAAGGGCGAGGAGC E TGTTCACCGGGGTGGTGCCCAT 16
atgTGTAGCAAGGGCGAGGAGC C TGTTCACCGGGGTGGTGCCCAT 17
atgTGGAGCAAGGGCGAGGAGC W TGTTCACCGGGGTGGTGCCCAT 18
atgCGTAGCAAGGGCGAGGAGC R TGTTCACCGGGGTGGTGCCCAT 19
atgGGTAGCAAGGGCGAGGAGC G TGTTCACCGGGGTGGTGCCCAT
Example 8: Single Site, Dual Position Nucleic Acid Variants
[0211] De novo oligonucleotide synthesis was performed under
conditions similar to those described in Example 2. A single
cluster on a device was generated which contained synthesized
predetermined variants of a nucleic acid for 2 consecutive codon
positions at a single site, each position being a codon encoding
for an amino acid. In this arrangement, 19 variants/per position
were generated for 2 positions with 3 replicates of each nucleic
acid, resulting in 114 nucleic acids synthesized.
Example 9: Multiple Site, dual Position Nucleic Acid Variants
[0212] De novo oligonucleotide synthesis was performed under
conditions similar to those described in Example 2. A single
cluster on a device was generated which contained synthesized
predetermined variants of a nucleic acid for 2 non-consecutive
codon positions, each position being a codon encoding for an amino
acid. In this arrangement, 19 variants/per position were generated
for 2 positions.
Example 10: Single Stretch, triple Position Nucleic Acid
Variants
[0213] De novo oligonucleotide synthesis was performed under
conditions similar to those described in Example 2. A single
cluster on a device was generated which contained synthesized
predetermined variants of a reference nucleic acid for 3
consecutive codon positions. In the 3 consecutive codon position
arrangement, 19 variants/per position were generated for 3
positions with 2 replicates of each nucleic acid, and resulted in
114 nucleic acids synthesized.
Example 11: Multiple Site, triple Position Nucleic Acid
Variants
[0214] De novo oligonucleotide synthesis was performed under
conditions similar to those described in Example 2. A single
cluster on a device was generated which contains synthesized
predetermined variants of a reference nucleic acid for at least 3
non-consecutive codon positions. Within a predetermined region, the
location of codons encoding for 3 histidine residues were
varied.
Example 12: Multiple Site, multiple Position Nucleic Acid
Variants
[0215] De novo oligonucleotide synthesis was performed under
conditions similar to those described in Example 2. A single
cluster on a device was generated which contained synthesized
predetermined variants of a reference nucleic acid for 1 or more
codon positions in 1 or more stretches. Five positions were varied
in the library. The first position encoded codons for a resultant
50/50 K/R ratio in the expressed protein; the second position
encoded codons for a resultant 50/25/25 V/L/S ratio in the
expressed protein, the third position encoded codons for a
resultant a 50/25/25 Y/R/D ratio in the expressed protein, the
fourth position encoded codons for a resultant an equal ratio for
all amino acids in the expressed protein, and the fifth position
encoded codons for a resultant a 75/25 G/P ratio in the expressed
protein.
Example 13: Modular Plasmid Components For Expressing Diverse
Peptides
[0216] A nucleic acid library is generated as in Examples 4-6 and
8-12, encoding for codon variation at a single site or multiple
sites for each of separate regions that make up portions of an
expression construct cassette, as depicted in FIG. 11. To generate
a two construct expressing cassette, variant oligonucleotides were
synthesized encoding at least a portion of a variant sequence of a
first promoter 1110, first open reading frame 1120, first
terminator 1130, second promoter 1140, second open reading frame
1150, or second terminator sequence 1160. After rounds of
amplification, as described in previous examples, a library of
1,024 expression constructs is generated.
Example 14: Multiple Site, Single Position Variants
[0217] A nucleic acid library is generated as in Examples 4-6 and
8-12, encoding for codon variation at a single site or multiple
sites in a region encoding for at least a portion of nucleic acid.
A library of oligonucleotide variants is generated, wherein the
library consists of multiple site, single position variants. See,
for example, FIG. 6B.
Example 15: Variant Library Synthesis
[0218] De novo oligonucleotide synthesis is performed under
conditions similar to those described in Example 2. At least 30,000
non-identical oligonucleotides are de novo synthesized, wherein
each of the non-identical oligonucleotides encodes for a different
codon variant of an amino acid sequence. The synthesized at least
30,000 non-identical oligonucleotides have an aggregate error rate
of less than 1 in 1:000 bases compared to predetermined sequences
for each of the at least 30,000 non-identical oligonucleotides. The
library is used for PCR mutagenesis of a long nucleic acid and at
least 30,000 non-identical variant nucleic acids are formed.
Example 16: Cluster-Based Variant Library Synthesis
[0219] De novo oligonucleotide synthesis is performed under
conditions similar to those described in Example 2. A single
cluster on a device is generated which contained synthesized
predetermined variants of a reference oligonucleotide for 2 codon
positions. In the 2 consecutive codon position arrangement, 19
variants/per position were generated for the 2 positions with 2
replicates of each oligonucleotide, and resulted in 38
oligonucleotides synthesized. Each variant sequence is 40 bases in
length. In the same cluster, additional non-variant oligonucleotide
sequences are generated, where the additional non-variant
oligonucleotides and the variant oligonucleotides collective encode
for 38 variants of the coding sequence of a gene. Each of the
oligonucleotides has at least one region reverse complementary to
another of the oligonucleotides. The oligonucleotides in the
cluster are released by gaseous ammonia cleavage. A pin comprising
water contacts the cluster, picks up the oligonucleotides, and
moves the oligonucleotides to a small vial. The vial also contains
DNA polymerase reagents for a polymerase cycling assembly (PCA)
reaction. The oligonucleotides anneal, gaps are filled in by an
extension reaction, and resultant double-stranded DNA molecules are
formed, forming a variant nucleic acid library. The variant nucleic
acid library is, optionally, subjected to restriction enzyme is
then ligated into expression vectors.
Example 17: Generation of a Variant Nucleic Acid Library
[0220] CAR variant libraries are generated, as described in
Examples 8-16, to have variance in an antigen recognition domain, a
hinge domain, a transmembrane domain, or an intracellular domain
compared to a reference sequence. Alternatively, CAR variant
libraries are also generated to have variance in all domains of a
CAR. The CAR variant libraries are screened against a known tumor
antigen. Variant sequences that result in increased T cell
activation and/or T cell binding are identified. The tumor antigen
may be expressed on a primary cultured cell, non-primary cultured
cell, or in a non-cellular setting, such as on a plate, beads,
slurry, or column.
Example 18: Expression and Screening of a Variant CAR Library
[0221] The library of variant CAR genes described in Example 17 are
transferred into mammalian cells to generate a library of cell
populations, each cell population expressing a different CAR
variant protein. The protein library is screened for CAR complexes
with improved affinity (measure of the strength of interaction
between an epitope and an antibody's antigen binding site) for a
tumor antigen, such as HER2 or NY-ESO-1. Additional functional
considerations, such as variant gene expression, avidity (measure
of the overall strength of an antibody-antigen complex), stability,
and target specificity are also assessed.
Example 19: Manufacturing and Delivery of Engineered T Cells
[0222] T cells are harvested from a subject diagnosed with cancer
and are genetically engineered with a CAR selected after performing
analysis in Example 18. After a brief period of in vitro expansion
and passing of product-specific release criteria, the engineered
T-cells are administered to the same subject.
Example 20: Variant Peptide Library
[0223] A nucleic acid library is generated as in Examples 4-6 and
8-12, encoding for codon variation at a single site or multiple
sites for common tumor antigens. After rounds of amplification, as
described in previous examples, libraries of 1,024 expression
constructs for each of the antigen variants are generated. The
libraries are transferred into mammalian cells to generate a
library of cell populations and are screened for improved binding
affinity and target specificity.
Example 21: Variant Peptide Library and Variant Library of CARs
[0224] A nucleic acid is generated as in Examples 4-6 and 8-12,
encoding for codon variation at a single site or multiple sites for
an antigen recognition domain of a CAR. A nucleic acid library is
generated as in Example 20, encoding for codon variation at a
single site or multiple sites for common tumor antigens. After
rounds of amplification, as described in previous examples,
libraries of 1,024 expression constructs for each of the CAR
variants and the antigen variants are generated. The libraries are
transferred into mammalian cells to generate a library of cell
populations and are screened for improved binding affinity and
target specificity.
Example 22: Variant CARs
[0225] A nucleic acid library is generated as in Examples 4-6 and
8-12 to generate nucleic acids encoding for variant CARs. Variants
are generated at three sites to generate a library comprising about
10.sup.3 variant CARs.
[0226] The variant CARs are screened in vitro against tumor
antigens for specificity of the variant CARs to the tumor antigen.
Variant CARs that are highly specific for the tumor antigen are
then further variegated to generate a second library. The second
library comprises variation in residues located in the hinge
domain, the transmembrane domain, or the intracellular domain of
the CAR. The second library is expressed in cells and screened in
vitro for a second improvement, for example, avidity, stability,
affinity, or expression.
[0227] Select CAR genes or gene fragment variants having desired
features after screening products from the first and/or second
variant libraries are selected for development of a potential
therapeutic.
[0228] While preferred embodiments of the present disclosure have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
disclosure. It should be understood that various alternatives to
the embodiments of the disclosure described herein may be employed
in practicing the disclosure. It is intended that the following
claims define the scope of the disclosure and that methods and
structures within the scope of these claims and their equivalents
be covered thereby.
Sequence CWU 1
1
49144DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1atggtgagca agggcgagga gctgttcacc ggggtggtgc ccat
44244DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2atgtttagca agggcgagga gctgttcacc
ggggtggtgc ccat 44344DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 3atgttaagca
agggcgagga gctgttcacc ggggtggtgc ccat 44444DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 4atgattagca agggcgagga gctgttcacc ggggtggtgc ccat
44544DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 5atgtctagca agggcgagga gctgttcacc
ggggtggtgc ccat 44644DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 6atgcctagca
agggcgagga gctgttcacc ggggtggtgc ccat 44744DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7atgactagca agggcgagga gctgttcacc ggggtggtgc ccat
44844DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 8atggctagca agggcgagga gctgttcacc
ggggtggtgc ccat 44944DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 9atgtatagca
agggcgagga gctgttcacc ggggtggtgc ccat 441044DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 10atgcatagca agggcgagga gctgttcacc ggggtggtgc ccat
441144DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 11atgcaaagca agggcgagga gctgttcacc
ggggtggtgc ccat 441244DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 12atgaatagca
agggcgagga gctgttcacc ggggtggtgc ccat 441344DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 13atgaaaagca agggcgagga gctgttcacc ggggtggtgc ccat
441444DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 14atggatagca agggcgagga gctgttcacc
ggggtggtgc ccat 441544DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 15atggaaagca
agggcgagga gctgttcacc ggggtggtgc ccat 441644DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 16atgtgtagca agggcgagga gctgttcacc ggggtggtgc ccat
441744DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 17atgtggagca agggcgagga gctgttcacc
ggggtggtgc ccat 441844DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 18atgcgtagca
agggcgagga gctgttcacc ggggtggtgc ccat 441944DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 19atgggtagca agggcgagga gctgttcacc ggggtggtgc ccat
442062DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 20agacaatcaa ccatttgggg tggacagcct
tgacctctag acttcggcat tttttttttt 60tt 6221112DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
21cgggatcctt atcgtcatcg tcgtacagat cccgacccat ttgctgtcca ccagtcatgc
60tagccatacc atgatgatga tgatgatgag aaccccgcat tttttttttt tt
1122219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22atgcggggtt ctcatcatc 192320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23cgggatcctt atcgtcatcg 2024600DNAHomo sapiens 24atgaagtcag
gcctctggta tttctttctc ttctgcttgc gcattaaagt tttaacagga 60gaaatcaatg
gttctgccaa ttatgagatg tttatatttc acaacggagg tgtacaaatt
120ttatgcaaat atcctgacat tgtccagcaa tttaaaatgc agttgctgaa
aggggggcaa 180atactctgcg atctcactaa gacaaaagga agtggaaaca
cagtgtccat taagagtctg 240aaattctgcc attctcagtt atccaacaac
agtgtctctt tttttctata caacttggac 300cattctcatg ccaactatta
cttctgcaac ctatcaattt ttgatcctcc tccttttaaa 360gtaactctta
caggaggata tttgcatatt tatgaatcac aactttgttg ccagctgaag
420ttctggttac ccataggatg tgcagccttt gttgtagtct gcattttggg
atgcatactt 480atttgttggc ttacaaaaaa gaagtattca tccagtgtgc
acgaccctaa cggtgaatac 540atgttcatga gagcagtgaa cacagccaaa
aaatctagac tcacagatgt gaccctataa 60025402DNAHomo sapiens
25atggtatcac atcggtatcc tcgaattcaa agtatcaaag tacaatttac cgaatataag
60aaggagaaag gtttcatcct cacttcccaa aaggaggatg aaatcatgaa ggtgcagaac
120aactcagtca tcatcaactg tgatgggttt tatctcatct ccctgaaggg
ctacttctcc 180caggaagtca acattagcct tcattaccag aaggatgagg
agcccctctt ccaactgaag 240aaggtcaggt ctgtcaactc cttgatggtg
gcctctctga cttacaaaga caaagtctac 300ttgaatgtga ccactgacaa
tacctccctg gatgacttcc atgtgaatgg cggagaactg 360attcttatcc
atcaaaatcc tggtgaattc tgtgtccttt ga 40226768DNAHomo sapiens
26atgggaaaca gctgttacaa catagtagcc actctgttgc tggtcctcaa ctttgagagg
60acaagatcat tgcaggatcc ttgtagtaac tgcccagctg gtacattctg tgataataac
120aggaatcaga tttgcagtcc ctgtcctcca aatagtttct ccagcgcagg
tggacaaagg 180acctgtgaca tatgcaggca gtgtaaaggt gttttcagga
ccaggaagga gtgttcctcc 240accagcaatg cagagtgtga ctgcactcca
gggtttcact gcctgggggc aggatgcagc 300atgtgtgaac aggattgtaa
acaaggtcaa gaactgacaa aaaaaggttg taaagactgt 360tgctttggga
catttaacga tcagaaacgt ggcatctgtc gaccctggac aaactgttct
420ttggatggaa agtctgtgct tgtgaatggg acgaaggaga gggacgtggt
ctgtggacca 480tctccagccg acctctctcc gggagcatcc tctgtgaccc
cgcctgcccc tgcgagagag 540ccaggacact ctccgcagat catctccttc
tttcttgcgc tgacgtcgac tgcgttgctc 600ttcctgctgt tcttcctcac
gctccgtttc tctgttgtta aacggggcag aaagaaactc 660ctgtatatat
tcaaacaacc atttatgaga ccagtacaaa ctactcaaga ggaagatggc
720tgtagctgcc gatttccaga agaagaagaa ggaggatgtg aactgtga
76827783DNAHomo sapiens 27atggcacggc cacatccctg gtggctgtgc
gttctgggga ccctggtggg gctctcagct 60actccagccc ccaagagctg cccagagagg
cactactggg ctcagggaaa gctgtgctgc 120cagatgtgtg agccaggaac
attcctcgtg aaggactgtg accagcatag aaaggctgct 180cagtgtgatc
cttgcatacc gggggtctcc ttctctcctg accaccacac ccggccccac
240tgtgagagct gtcggcactg taactctggt cttctcgttc gcaactgcac
catcactgcc 300aatgctgagt gtgcctgtcg caatggctgg cagtgcaggg
acaaggagtg caccgagtgt 360gatcctcttc caaacccttc gctgaccgct
cggtcgtctc aggccctgag cccacaccct 420cagcccaccc acttacctta
tgtcagtgag atgctggagg ccaggacagc tgggcacatg 480cagactctgg
ctgacttcag gcagctgcct gcccggactc tctctaccca ctggccaccc
540caaagatccc tgtgcagctc cgattttatt cgcatccttg tgatcttctc
tggaatgttc 600cttgttttca ccctggccgg ggccctgttc ctccatcaac
gaaggaaata tagatcaaac 660aaaggagaaa gtcctgtgga gcctgcagag
ccttgtcgtt acagctgccc cagggaggag 720gagggcagca ccatccccat
ccaggaggat taccgaaaac cggagcctgc ctgctccccc 780tga 78328708DNAHomo
sapiens 28atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca
cgccgccagg 60ccgagccagt tccgggtgtc gccgctggat cggacctgga acctgggcga
gacagtggag 120ctgaagtgcc aggtgctgct gtccaacccg acgtcgggct
gctcgtggct cttccagccg 180cgcggcgccg ccgccagtcc caccttcctc
ctatacctct cccaaaacaa gcccaaggcg 240gccgaggggc tggacaccca
gcggttctcg ggcaagaggt tgggggacac cttcgtcctc 300accctgagcg
acttccgccg agagaacgag ggctactatt tctgctcggc cctgagcaac
360tccatcatgt acttcagcca cttcgtgccg gtcttcctgc cagcgaagcc
caccacgacg 420ccagcgccgc gaccaccaac accggcgccc accatcgcgt
cgcagcccct gtccctgcgc 480ccagaggcgt gccggccagc ggcggggggc
gcagtgcaca cgagggggct ggacttcgcc 540tgtgatatct acatctgggc
gcccttggcc gggacttgtg gggtccttct cctgtcactg 600gttatcaccc
tttactgcaa ccacaggaac cgaagacgtg tttgcaaatg tccccggcct
660gtggtcaaat cgggagacaa gcccagcctt tcggcgagat acgtctaa
70829282DNAHomo sapiens 29atgatccatc tgggtcacat cctcttcctg
cttttgctcc cagtggctgc agctcagacg 60actccaggag agagatcatc actccctgcc
ttttaccctg gcacttcagg ctcttgttcc 120ggatgtgggt ccctctctct
gccgctcctg gcaggcctcg tggctgctga tgcggtggca 180tcgctgctca
tcgtgggggc ggtgttcctg tgcgcacgcc cacgccgcag ccccgcccaa
240gaagatggca aagtctacat caacatgcca ggcaggggct ga 28230549DNAHomo
sapiens 30atggaacagg ggaagggcct ggctgtcctc atcctggcta tcattcttct
tcaaggtact 60ttggcccagt caatcaaagg aaaccacttg gttaaggtgt atgactatca
agaagatggt 120tcggtacttc tgacttgtga tgcagaagcc aaaaatatca
catggtttaa agatgggaag 180atgatcggct tcctaactga agataaaaaa
aaatggaatc tgggaagtaa tgccaaggac 240cctcgaggga tgtatcagtg
taaaggatca cagaacaagt caaaaccact ccaagtgtat 300tacagaatgt
gtcagaactg cattgaacta aatgcagcca ccatatctgg ctttctcttt
360gctgaaatcg tcagcatttt cgtccttgct gttggggtct acttcattgc
tggacaggat 420ggagttcgcc agtcgagagc ttcagacaag cagactctgt
tgcccaatga ccagctctac 480cagcccctca aggatcgaga agatgaccag
tacagccacc ttcaaggaaa ccagttgagg 540aggaattga 54931624DNAHomo
sapiens 31atgcagtcgg gcactcactg gagagttctg ggcctctgcc tcttatcagt
tggcgtttgg 60gggcaagatg gtaatgaaga aatgggtggt attacacaga caccatataa
agtctccatc 120tctggaacca cagtaatatt gacatgccct cagtatcctg
gatctgaaat actatggcaa 180cacaatgata aaaacatagg cggtgatgag
gatgataaaa acataggcag tgatgaggat 240cacctgtcac tgaaggaatt
ttcagaattg gagcaaagtg gttattatgt ctgctacccc 300agaggaagca
aaccagaaga tgcgaacttt tatctctacc tgagggcaag agtgtgtgag
360aactgcatgg agatggatgt gatgtcggtg gccacaattg tcatagtgga
catctgcatc 420actgggggct tgctgctgct ggtttactac tggagcaaga
atagaaaggc caaggccaag 480cctgtgacac gaggagcggg tgctggcggc
aggcaaaggg gacaaaacaa ggagaggcca 540ccacctgttc ccaacccaga
ctatgagccc atccggaaag gccagcggga cctgtattct 600ggcctgaatc
agagacgcat ctga 62432681DNAHomo sapiens 32atgcctgggg gtccaggagt
cctccaagct ctgcctgcca ccatcttcct cctcttcctg 60ctgtctgctg tctacctggg
ccctgggtgc caggccctgt ggatgcacaa ggtcccagca 120tcattgatgg
tgagcctggg ggaagacgcc cacttccaat gcccgcacaa tagcagcaac
180aacgccaacg tcacctggtg gcgcgtcctc catggcaact acacgtggcc
ccctgagttc 240ttgggcccgg gcgaggaccc caatggtacg ctgatcatcc
agaatgtgaa caagagccat 300gggggcatat acgtgtgccg ggtccaggag
ggcaacgagt cataccagca gtcctgcggc 360acctacctcc gcgtgcgcca
gccgcccccc aggcccttcc tggacatggg ggagggcacc 420aagaaccgaa
tcatcacagc cgaggggatc atcctcctgt tctgcgcggt ggtgcctggg
480acgctgctgc tgttcaggaa acgatggcag aacgagaagc tcgggttgga
tgccggggat 540gaatatgaag atgaaaacct ttatgaaggc ctgaacctgg
acgactgctc catgtatgag 600gacatctccc ggggcctcca gggcacctac
caggatgtgg gcagcctcaa cataggagat 660gtccagctgg agaagccgtg a
681331280DNAHomo sapiens 33aggggacagg ctgcagccgg tgcagttaca
cgttttcctc caaggagcct cggacgttgt 60cacgggtttg gggtcgggga cagagcggtg
accatggcca ggctggcgtt gtctcctgtg 120cccagccact ggatggtggc
gttgctgctg ctgctctcag ctgagccagt accagcagcc 180agatcggagg
accggtaccg gaatcccaaa ggtagtgctt gttcgcggat ctggcagagc
240ccacgtttca tagccaggaa acggggcttc acggtgaaaa tgcactgcta
catgaacagc 300gcctccggca atgtgagctg gctctggaag caggagatgg
acgagaatcc ccagcagctg 360aagctggaaa agggccgcat ggaagagtcc
cagaacgaat ctctcgccac cctcaccatc 420caaggcatcc ggtttgagga
caatggcatc tacttctgtc agcagaagtg caacaacacc 480tcggaggtct
accagggctg cggcacagag ctgcgagtca tgggattcag caccttggca
540cagctgaagc agaggaacac gctgaaggat ggtatcatca tgatccagac
gctgctgatc 600atcctcttca tcatcgtgcc tatcttcctg ctgctggaca
aggatgacag caaggctggc 660atggaggaag atcacaccta cgagggcctg
gacattgacc agacagccac ctatgaggac 720atagtgacgc tgcggacagg
ggaagtgaag tggtctgtag gtgagcaccc aggccaggag 780tgagagccag
gtcgccccat gacctgggtg caggctccct ggcctcagtg actgcttcgg
840agctgcctgg ctcatggccc aacccctttc ctggaccccc cagctggcct
ctgaagctgg 900cccaccagag ctgccatttg tctccagccc ctggtcccca
gctcttgcca aagggcctgg 960agtagaagga caacagggca gcaacttgga
gggagttctc tggggatgga cgggacccag 1020ccttctgggg gtgctatgag
gtgatccgtc cccacacatg ggatggggga ggcagagact 1080ggtccagagc
ccgcaaatgg actcggagcc gagggcctcc cagcagagct tgggaagggc
1140catggaccca actgggcccc agaagagcca caggaacatc attcctctcc
cgcaaccact 1200cccaccccag ggaggccctg gcctccagtg ccttcccccg
tggaataaac ggtgtgtcct 1260gagaaaccac acaaaaaaaa 128034495DNAHomo
sapiens 34atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc
gattacagag 60gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg
aatcctcttc 120atctatggtg tcattctcac tgccttgttc ctgagagtga
agttcagcag gagcgcagac 180gcccccgcgt accagcaggg ccagaaccag
ctctataacg agctcaatct aggacgaaga 240gaggagtacg atgttttgga
caagagacgt ggccgggacc ctgagatggg gggaaagccg 300cagagaagga
agaaccctca ggaaggcctg tacaatgaac tgcagaaaga taagatggcg
360gaggcctaca gtgagattgg gatgaaaggc gagcgccgga ggggcaaggg
gcacgatggc 420ctttaccagg gtctcagtac agccaccaag gacacctacg
acgcccttca catgcaggcc 480ctgccccctc gctaa 495359PRTHomo sapiens
35Lys Val Ser Ala Val Thr Leu Ala Tyr1 5369PRTHomo sapiens 36Arg
Pro Lys Ser Asn Ile Val Leu Leu1 5379PRTHomo sapiens 37Ile Met Ile
Gly Val Leu Val Gly Val1 5389PRTHomo sapiens 38Ile Ile Ser Ala Val
Val Gly Ile Leu1 5399PRTHomo sapiens 39Ser Leu Leu Met Trp Ile Thr
Gln Val1 5409PRTHomo sapiens 40Lys Tyr Ala Asp Lys Ile Tyr Ser Ile1
5416PRTArtificial SequenceDescription of Artificial Sequence
Synthetic 6xHis tag 41His His His His His His1 5427PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 42Ala
Trp Ile Lys Arg Glu Gln1 5437PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptideMOD_RES(1)..(1)Any amino acid
43Xaa Trp Ile Lys Arg Glu Gln1 5447PRTArtificial
SequenceDescription of Artificial Sequence Synthetic
peptideMOD_RES(2)..(2)Any amino acid 44Ala Xaa Ile Lys Arg Glu Gln1
5457PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptideMOD_RES(3)..(3)Any amino acid 45Ala Trp Xaa Lys
Arg Glu Gln1 5467PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptideMOD_RES(4)..(4)Any amino acid 46Ala Trp
Ile Xaa Arg Glu Gln1 5477PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptideMOD_RES(5)..(5)Any amino acid
47Ala Trp Ile Lys Xaa Glu Gln1 5487PRTArtificial
SequenceDescription of Artificial Sequence Synthetic
peptideMOD_RES(6)..(6)Any amino acid 48Ala Trp Ile Lys Arg Xaa Gln1
5497PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptideMOD_RES(7)..(7)Any amino acid 49Ala Trp Ile Lys
Arg Glu Xaa1 5
* * * * *