U.S. patent application number 17/097705 was filed with the patent office on 2021-04-01 for method of identifying disease risk factors.
The applicant listed for this patent is Zinfandel Pharmaceuticals, Inc.. Invention is credited to Allen D. Roses.
Application Number | 20210095345 17/097705 |
Document ID | / |
Family ID | 1000005266247 |
Filed Date | 2021-04-01 |
![](/patent/app/20210095345/US20210095345A1-20210401-D00001.png)
![](/patent/app/20210095345/US20210095345A1-20210401-D00002.png)
![](/patent/app/20210095345/US20210095345A1-20210401-D00003.png)
![](/patent/app/20210095345/US20210095345A1-20210401-D00004.png)
![](/patent/app/20210095345/US20210095345A1-20210401-D00005.png)
![](/patent/app/20210095345/US20210095345A1-20210401-D00006.png)
![](/patent/app/20210095345/US20210095345A1-20210401-D00007.png)
![](/patent/app/20210095345/US20210095345A1-20210401-D00008.png)
![](/patent/app/20210095345/US20210095345A1-20210401-D00009.png)
United States Patent
Application |
20210095345 |
Kind Code |
A1 |
Roses; Allen D. |
April 1, 2021 |
METHOD OF IDENTIFYING DISEASE RISK FACTORS
Abstract
Provided herein is a method for identifying a genetic variant
that is associated with development of a condition of interest
(e.g., Alzheimer's disease), and genetic variants so identified.
Methods of treatment with an active agent (e.g., with a particular
active agent and/or at an earlier age) is also provided, upon
detecting a genetic variant described herein. In some embodiments,
the genetic variant is a deletion/insertion polymorphism (DIP) of
the TOMM40 gene. Kits for determining if a subject is at increased
risk of developing late onset Alzheimer's disease is also provided.
Kits for determining if a subject is responsive to treatment for a
condition of interest with an active agent are further
provided.
Inventors: |
Roses; Allen D.; (Chapel
Hill, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Zinfandel Pharmaceuticals, Inc. |
Research Triangle Park |
NC |
US |
|
|
Family ID: |
1000005266247 |
Appl. No.: |
17/097705 |
Filed: |
November 13, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16021261 |
Jun 28, 2018 |
10865449 |
|
|
17097705 |
|
|
|
|
14332867 |
Jul 16, 2014 |
|
|
|
16021261 |
|
|
|
|
13058724 |
Apr 14, 2011 |
8815508 |
|
|
PCT/US2009/053373 |
Aug 11, 2009 |
|
|
|
14332867 |
|
|
|
|
61088203 |
Aug 12, 2008 |
|
|
|
61186673 |
Jun 12, 2009 |
|
|
|
61224647 |
Jul 10, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2600/156 20130101;
C12Q 2600/172 20130101; C12Q 2600/106 20130101; C12Q 2600/118
20130101; C12Q 1/6883 20130101 |
International
Class: |
C12Q 1/6883 20060101
C12Q001/6883 |
Claims
1. A method of determining increased risk for development of
Alzheimer's disease in a subject, comprising: (a) detecting from a
biological sample containing DNA taken from said subject the
presence or absence of a genetic variant of the TOMM40 gene
associated with increased or decreased risk of Alzheimer's disease,
wherein said variant is a deletion/insertion polymorphism (DIP) in
intron 6 or intron 9 of the TOMM40 gene; and (b) determining said
subject is at increased or decreased risk of Alzheimer's disease
when said genetic variant is present or absent.
2. The method of claim 1, wherein said detecting comprises PCR
amplification and/or DNA sequencing.
3. The method of claim 1, further comprising detecting an Apo E
genotype of the subject, and wherein said determining said subject
is at increased or decreased risk of Alzheimer's disease is further
based upon the Apo E genotype.
4. The method of claim 1, further comprising the step of: (c)
administering an anti-Alzheimer's disease active agent to said
subject in a treatment effective amount when said subject is
determined to be at increased risk of Alzheimer's disease.
5. The method of claim 4, wherein said administering step is
carried out in said subject at an earlier age when said subject is
determined to be at increased risk by the presence or absence of
said genetic variant as compared to a subject in which said genetic
variant is not present or absent.
6. The method of claim 4, wherein said active agent is selected
from the group consisting of acetylcholinesterase inhibitors, NMDA
receptor antagonists, peroxisome proliferator-activated receptor
agonists or modulators, antibodies, fusion proteins, therapeutic
RNA molecules, and combinations thereof.
7. The method of claim 4, wherein said active agent is a peroxisome
proliferator-activated receptor agonist or modulator.
8. The method of claim 4, wherein said active agent is a
thiazolidinedione.
9. The method of claim 1, wherein said genetic variant of the
TOMM40 is a poly-T DIP length at rs10524523.
10. A method of treating a subject for Alzheimer's disease
comprising: administering an anti-Alzheimer's disease active agent
to said subject in a treatment-effective amount, said administering
carried out at an earlier age when said subject carries a genetic
variant of the TOMM40 gene associated with increased risk of
Alzheimer's disease as compared to a corresponding subject who does
not carry said genetic variant, wherein said genetic variant of the
TOMM40 is a deletion/insertion polymorphism (DIP) in intron 6 or
intron 9 of the TOMM40 gene.
11. The method of claim 10, wherein said active agent is selected
from the group consisting of acetylcholinesterase inhibitors, NMDA
receptor antagonists, peroxisome proliferator-activated receptor
agonists or modulators, antibodies, fusion proteins, therapeutic
RNA molecules, and combinations thereof.
12. The method of claim 10, wherein said active agent is a
peroxisome proliferator-activated receptor agonist or
modulator.
13. The method of claim 10, wherein said active agent is a
thiazolidinedione.
14. The method of claim 10, wherein said genetic variant of the
TOMM40 gene is a poly-T DIP length at rs10524523.
15. A kit comprising: (A) at least one reagent to specifically
detect a poly-T length at rs10524523 of the TOMM40 gene from a
biological sample containing DNA from a human subject; (B) buffers,
enzymes and reagents for amplifying the DNA via primer-directed
amplification; and (C) optionally, instructions for use in
amplifying a region of the TOMM40 gene comprising the poly-T at
rs10524523.
16. The kit of claim 15, wherein the at least one reagent comprises
a nucleic acid for the primer-directed amplification.
17. The kit of claim 15, wherein said kit further comprises: (D) at
least one reagent to specifically detect an ApoE 3, ApoE 4, or ApoE
2 allele from the biological sample.
18. The kit of claim 17, wherein the at least one reagent to
specifically detect an ApoE 3, ApoE 4, or ApoE 2 allele comprises a
nucleic acid for a primer-directed amplification of a region of the
ApoE isoform.
19. The kit of claim 17, wherein the at least one reagent to
specifically detect an ApoE 3, ApoE 4, or ApoE 2 allele comprises
an antibody that selectively binds an ApoE isoform, or an
oligonucleotide probe that selectively binds to DNA encoding an
ApoE isoform.
20. The kit of claim 19, wherein the antibody or oligonucleotide
probe is labeled with a detectable group.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/021,261, filed Jun. 28, 2018, now allowed,
which is a continuation of U.S. patent application Ser. No.
14/332,867, filed Jul. 16, 2014, now abandoned, which is a
continuation of U.S. patent application Ser. No. 13/058,724, filed
Apr. 14, 2011, now U.S. Pat. No. 8,815,508, which is a national
stage of International Patent Application No. PCT/US2009/053373,
filed Aug. 11, 2009, which claims the benefit of U.S. Provisional
Application No. 61/088,203, filed Aug. 12, 2008, U.S. Provisional
Application No. 61/186,673, filed Jun. 12, 2009, and U.S.
Provisional Application No. 61/224,647, filed Jul. 10, 2009, the
disclosures of each of which is incorporated by reference herein in
its entirety.
STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING
[0002] A Sequence Listing in ASCII text format, submitted under 37
C.F.R. .sctn. 1.821, entitled 9719-2CT3_ST25.txt, 9,979 bytes in
size, generated on Nov. 10, 2020, and filed via EFS-Web, is
provided in lieu of a paper copy. This Sequence Listing is
incorporated by reference into the specification for its
disclosures.
FIELD OF THE INVENTION
[0003] The present invention relates to the field of genomics,
genetics, pharmacogenetics, and bioinformatics, including genome
analysis and the study of DNA sequence variation. The invention
also relates to studies of association between variations in DNA
sequences and anticipation of an individual's susceptibility to a
particular disease, disorder, or condition and/or response to a
particular drug or treatment.
BACKGROUND OF THE INVENTION
[0004] The search for genetic markers associated with complex
diseases is ongoing. Genome-wide scanning studies with SNP arrays
continue to highlight the ApoE region as the most important area
for investigation in the study of Alzheimer's disease (Coon et al.,
J. Clin. Psychiatry 68: 613-8 (2007); Li et al., Arch. Neurol. 65:
45-53 (2007)).
[0005] The ApoE 4 isoform has previously been strongly associated
with increased risk of developing late-onset Alzheimer's disease.
(Pericak-Vance et al., Am. J. Hum. Genet. 48, 1034-50 (1991);
Martin et al., 2000, U.S. Pat. No. 6,027,896 to Roses, et al., U.S.
Pat. No. 5,716,828 to Roses et al.) The relationship is dose
dependent (Yoshizawa et al., 1994; Schellenberg, 1995). That is to
say, a carrier of two ApoE 4 alleles is more likely to develop
late-onset Alzheimer's disease (LOAD) than a carrier of only one
ApoE 4 allele, and at an earlier age (Corder et al., Science 261,
921-3 (1993)).
[0006] Nevertheless, E4 alleles only account for roughly 50% of
hereditary Alzheimer's disease. One explanation is that ApoE 4 is
merely serving as a surrogate marker for something in linkage
disequilibrium nearby. Alternatively, considering the recent
discovery of a mechanistic role for ApoE 4 in mitochondrial
toxicity, the negative effects of ApoE 4 may be abrogated or
exacerbated by another gene product encoded nearby (Chang et al.,
2005).
[0007] As ApoE status is also associated with risk for coronary
artery disease and likely also a host of other diseases and
disorders, the implications of the study of the ApoE region are not
limited to Alzheimer's disease, but are potentially far-reaching
(Mahley et al., Proc. Natl. Acad. Sci. USA 103: 5644-51 (2006)).
More broadly, the examination of variant sequences for processes or
pathways surrounding genes in linkage disequilibrium with other
genetic regions known to be involved in complex disease processes
will provide valuable information in deciphering the mechanisms of
those diseases.
SUMMARY OF THE INVENTION
[0008] Provided herein is a method for identifying a genetic
variant that is associated with development of a condition of
interest (e.g., earlier or later onset of a disease of interest),
comprising: (a) determining from biological samples containing DNA
the nucleotide sequences carried by a plurality of individual human
subjects at a genetic locus of interest, wherein subjects include
both (i) subjects affected with the condition of interest and (ii)
subjects unaffected with the condition of interest; (b) identifying
genetic variants at said genetic locus from nucleotide sequences
observed in said plurality of subjects (e.g., using a multiple
sequence alignment analysis); (c) mapping said genetic variants by
constructing a phylogenetic tree of said nucleotide sequences of
said subjects, said tree comprising branches that identify variant
changes between said subjects (e.g., variant changes on the same
cistron); (d) examining the genetic variants represented as
branches in said tree and determining the ratio of affected and
unaffected subjects to identify those changes that lead to a
changed ratio of affected to unaffected subjects (preferably
wherein the starting point is the genetic variant representing the
greatest number of subjects); and then (e) identifying a genetic
variant or group of variants (a haplotype) where the ratio of
affected to unaffected subjects is substantially different from one
or more adjacent variants on said tree (e.g., at least 5, 10, 15,
20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90%
different) to thereby identify a genetic variant associated with
the development of said condition of interest.
[0009] In some embodiments, all subjects carry a same known
polymorphism that is associated with the condition of interest.
[0010] In some embodiments, the condition of interest is a
neurodegenerative disease, a metabolic disease (e.g.,
dyslipidemia), a cardiovascular disease, a psychiatric disorder, or
cancer. In some embodiments, the disease of interest is a disease
in which ApoE and/or TOMM40 are implicated in disease
pathogenesis.
[0011] In some embodiments, the condition of interest is associated
with increased or decreased mitochondrial dysfunction. In some
embodiments, the condition of interest is schizophrenia. In some
embodiments, the condition of interest is coronary artery disease.
In some embodiments, the condition of interest is diabetes
mellitus, type II. In some embodiments, the condition of interest
is Parkinson's disease. In some embodiments, the condition of
interest is Alzheimer's disease.
[0012] In some embodiments, the known polymorphism risk factor is
the Apolipoprotein E allele (e.g., ApoE 2, ApoE 3 or ApoE 4).
[0013] In some embodiments, the genetic locus of interest is in
linkage disequilibrium with the known polymorphism. In some
embodiments, the genetic locus of interest is on the same
chromosome and less than 10, 20, 30, 40, or 50 kilobases away from
the known polymorphism. In some embodiments, the genetic locus is
TOMM40.
[0014] Also provided is a method of determining increased risk for
development of a condition of interest, comprising: (a) determining
from a biological sample containing DNA a genetic variant
identified by the method of any of the preceding paragraphs carried
by an individual subject; and then (b) determining the subject is
at increased risk for development of the condition of interest when
the genetic variant is present.
[0015] Further provided is a method of determining increased risk
for development of Alzheimer's disease in a subject (e.g., a
subject carrying at least one Apo E3 allele), comprising: (a)
detecting from a biological sample containing DNA taken from the
subject the presence or absence of a genetic variant of the TOMM40
gene associated with increased or decreased risk of Alzheimer's
disease; and (b) determining the subject is at increased or
decreased risk of Alzheimer's disease when the genetic variant is
present or absent.
[0016] In some embodiments, it is determined whether the subject is
an Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4, or E4/E4 subject. In some
embodiments, it is determined whether the subject is an Apo E3/E3
or E3/E4 subject.
[0017] In some embodiments, the method further includes the step
of: (c) administering an anti-Alzheimer's disease active agent to
the subject in a treatment effective amount when the subject is
determined to be at increased risk of Alzheimer's disease.
[0018] In some embodiments, the administering step is carried out
in the subject at an earlier age when the subject is determined to
be at increased risk by the presence or absence of the genetic
variant as compared to a subject in which the genetic variant is
not present or absent (e.g., for an ApoE 4/4 subject, beginning at
age 45, 46, 47, 48, 49, 50, 51, 52, or 53, and continuously through
each year thereafter, rather than beginning at age 55 or more; for
an ApoE 4/3 subject, at age 50, 51, 52, 53, 54, 55, 56, 57, or 58,
and continuously through each year thereafter, rather than
beginning at age 60 or more; for an ApoE 3/3 subject, at age 55,
56, 57, 58, 59, 60, 61, 62, or 63, and continuously through each
year thereafter, rather than beginning at age 65 or more; and for
an ApoE 2/3 subject, at age 60, 61, 62, 63, 64, 65, 66, 67, or 68,
and continuously through each year thereafter, rather than
beginning at age 70 or more).
[0019] In some embodiments, the active agent is selected from the
group consisting of acetylcholinesterase inhibitors, NMDA receptor
antagonists, PPAR agonists or modulators (e.g., drugs in the
thiazolidinedione or glitazar classes), antibodies, fusion
proteins, therapeutic RNA molecules, and combinations thereof. In
some embodiments, the active agent is rosiglitazone or a
pharmaceutically acceptable salt thereof.
[0020] In some embodiments, the genetic variant of the TOMM40 is a
variant listed in Table 1 as set forth below.
[0021] Also provided is a method of treating a subject (e.g., a
subject having at least one ApoE 3) allele for Alzheimer's disease
by administering an anti-Alzheimer's disease active agent to the
subject in a treatment-effective amount; the improvement
comprising: administering the active agent to the subject at an
earlier age when the subject carries a genetic variant of the
TOMM40 gene associated with increased risk of Alzheimer's disease
as compared to a corresponding subject who does not carry the
genetic variant (e.g., for an ApoE 4/4 subject, beginning at age
45, 46, 47, 48, 49, 50, 51, 52, or 53, and continuously through
each year thereafter, rather than beginning at age 55 or more; for
an ApoE 4/3 subject, at age 50, 51, 52, 53, 54, 55, 56, 57, or 58,
and continuously through each year thereafter, rather than
beginning at age 60 or more; for an ApoE 3/3 subject, at age 55,
56, 57, 58, 59, 60, 61, 62, or 63, and continuously through each
year thereafter, rather than beginning at age 65 or more; and for
an ApoE 2/3 subject, at age 60, 61, 62, 63, 64, 65, 66, 67, or 68,
and continuously through each year thereafter, rather than
beginning at age 70 or more).
[0022] In some embodiments, the subject is an Apo E2/E2, E2/E3,
E2/E4, E3/E3, E3/E4, E4/E4 subject. In some embodiments, the
subject is an Apo E3/E3 or E3/E4 subject.
[0023] In some embodiments, the active agent is selected from the
group consisting of acetylcholinesterase inhibitors, NMDA receptor
antagonists, PPAR agonists or modulators (e.g., drugs in the
thiazolidinedione or glitazar classes), antibodies, fusion
proteins, therapeutic RNA molecules, and combinations thereof. In
some embodiments, the active agent is rosiglitazone or a
pharmaceutically acceptable salt thereof.
[0024] In some embodiments, the genetic variant of the TOMM40 gene
is a deletion/insertion polymorphism (DIP). In some embodiments,
the DIP is an insertion polymorphism. In some embodiments, the DIP
is poly-T deletion/insertion polymorphism (e.g., between 5 and 100,
or 10 and 80, or 20 and 50 bp poly-T).
[0025] In some embodiments, the genetic variant of the TOMM40 is a
variant listed in Table 1 as set forth below. In some embodiments,
the DIP is rs10524523, rs10602329 or DIP3. In some embodiments, the
DIP is rs10524523.
[0026] Further provided is a method of treatment for a condition of
interest, wherein the condition of interest is associated with ApoE
and/or TOMM40, for a patient in need thereof, the method including
the steps: (a) determining the presence or absence of a genetic
variant identified by the method of paragraph 1-12 carried by an
individual subject to generate a genetic profile of the patient;
and then, if the profile is indicative of the patient being
responsive to an active agent, (b) administering the active agent
to the subject in a treatment effective amount to treat the
condition of interest.
[0027] In some embodiments, the active agent is selected from the
group consisting of acetylcholinesterase inhibitors, NMDA receptor
antagonists, PPAR agonists or modulators (e.g., drugs in the
thiazolidinedione or glitazar classes), antibodies, fusion
proteins, therapeutic RNA molecules, and combinations thereof. In
some embodiments, the active agent is rosiglitazone or a
pharmaceutically acceptable salt thereof.
[0028] In some embodiments, the genetic variant of the TOMM40 gene
is a deletion/insertion polymorphism (DIP). In some embodiments,
the DIP is an insertion polymorphism. In some embodiments, the DIP
is poly-T deletion/insertion polymorphism (e.g., between 5 and 100,
or 10 and 80, or 20 and 50 bp poly-T insertion).
[0029] In some embodiments, the genetic variant of the TOMM40 is a
variant of TOMM40 listed in Table 1 as set forth below. In some
embodiments, the DIP is rs10524523, rs10602329 or DIP3. In some
embodiments, the DIP is rs10524523.
[0030] Also provided is a method of treatment for Alzheimer's
disease in a subject, including: (a) detecting from a biological
sample containing DNA taken from the subject the presence or
absence of a genetic variant of the TOMM40 gene associated with
responsiveness to an active agent; and, if the genetic variant is
present, (b) administering the active agent to the subject in a
treatment effective amount to treat the Alzheimer's disease.
[0031] In some embodiments, the subject carries at least one ApoE 3
allele. In some embodiments, the subject is an Apo E3/E3 or E3/E4
subject.
[0032] In some embodiments, the active agent is selected from the
group consisting of acetylcholinesterase inhibitors, NMDA receptor
antagonists, PPAR agonists or modulators (e.g., drugs in the
thiazolidinedione or glitazar classes), antibodies, fusion
proteins, therapeutic RNA molecules, and combinations thereof. In
some embodiments, the active agent is rosiglitazone or a
pharmaceutically acceptable salt thereof.
[0033] In some embodiments, the genetic variant of the TOMM40 gene
is a deletion/insertion polymorphism (DIP). In some embodiments,
the DIP is an insertion polymorphism. In some embodiments, the DIP
is poly-T deletion/insertion polymorphism (e.g., between 5 and 100,
or 10 and 80, or 20 and 50 bp poly-T).
[0034] In some embodiments, the genetic variant of the TOMM40 gene
is a variant listed in Table 1 as set forth below. In some
embodiments, the DIP is rs10524523, rs10602329 or DIP3. In some
embodiments, the DIP is rs10524523.
[0035] Further provided is the use of an anti-Alzheimer's disease
active agent for the preparation of a medicament for carrying out a
method of treatment for Alzheimer's disease in accordance with the
paragraphs set forth above. Also provided is the use of an
anti-Alzheimer's disease active agent for carrying out a method of
treatment for Alzheimer's disease.
[0036] A method of determining a prognosis for a patient at risk
for developing Alzheimer's disease is provided, including obtaining
a patient profile, wherein the obtaining a patient profile
includes: detecting the presence or absence of at least one ApoE
allele in a biological sample of the patient, and detecting the
presence or absence of at least one TOMM40 deletion/insertion
polymorphism (DIP) located in intron 6 or intron 9 of the TOMM40
gene, and then, converting the patient profile into the prognosis,
wherein the presence of the ApoE allele and the presence of the at
least one TOMM40 DIP polymorphism identifies the patient as a
patient at risk for developing Alzheimer's disease.
[0037] In some embodiments, the DIP is an insertion polymorphism.
In some embodiments, the DIP is poly-T deletion/insertion
polymorphism (e.g., between 5 and 100, or 10 and 80, or 20 and 50
poly-T).
[0038] In some embodiments, the DIP is rs10524523, rs10602329 or
DIP3. In some embodiments, the DIP is rs10524523.
[0039] In some embodiments, the method further includes detecting
whether the subject is an Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4,
E4/E4 subject. In some embodiments, the subject is an Apo E3/E3 or
E3/E4 subject.
[0040] Also provided is a method for stratifying a subject into a
subgroup of a clinical trial of a therapy for the treatment of
Alzheimer's disease, the method including: detecting the presence
or absence of at least one ApoE allele in a biological sample of
the patient, and detecting the presence or absence of at least one
TOMM40 deletion/insertion polymorphism (DIP) located in intron 6 or
intron 9 of the TOMM40 gene, wherein the subject is stratified into
the subgroup for the clinical trial of the therapy based upon the
presence or absence of the at least one ApoE and/or TOMM40 DIP
allele.
[0041] In some embodiments, the DIP is an insertion polymorphism.
In some embodiments, the DIP is poly-T insertion polymorphism
(e.g., between 5 and 100, or 10 and 80, or 20 and 50 poly-T
insertion).
[0042] In some embodiments, the DIP is rs10524523, rs10602329 or
DIP3. In some embodiments, the DIP is rs10524523.
[0043] In some embodiments, the method further includes detecting
whether the subject is an Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4,
E4/E4 subject. In some embodiments, the subject is an Apo E3/E3 or
E3/E4 subject.
[0044] Further provided is a method for identifying a patient in a
clinical trial of a treatment for Alzheimer's disease including: a)
identifying a patient diagnosed with Alzheimer's disease; and b)
determining a prognosis for the patient diagnosed with Alzheimer's
disease comprising obtaining a patient profile, wherein the patient
profile comprises i) detecting the presence or absence of at least
one ApoE allele in a biological sample of the patient, ii)
detecting the presence or absence of at least one TOMM40
deletion/insertion polymorphism (DIP) located in intron 6 or intron
9 of the TOMM40 gene, and converting the patient profile into the
prognosis, the prognosis including a prediction of whether the
patient is a candidate for the clinical trial for the treatment of
Alzheimer's disease.
[0045] In some embodiments, the DIP is an insertion polymorphism.
In some embodiments, the DIP is poly-T deletion/insertion
polymorphism (e.g., between 5 and 100, or 10 and 80, or 20 and 50
poly-T).
[0046] In some embodiments, the DIP is rs10524523, rs10602329 or
DIP3. In some embodiments, the DIP is rs10524523.
[0047] In some embodiments, the method further includes detecting
whether the subject is an Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4,
E4/E4 subject. In some embodiments, the subject is an Apo E3/E3 or
E3/E4 subject.
[0048] A kit for determining if a subject is at increased risk of
developing late onset Alzheimer's disease is provided, including:
(A) at least one reagent that specifically detects ApoE 3, ApoE 4,
or ApoE 2, wherein the reagent is selected from the group
consisting of antibodies that selectively bind ApoE 3, ApoE 4, or
ApoE 2, and oligonucleotide probes that selectively bind to DNA
encoding the same; (B) at least one reagent that specifically
detects the presence or absence of at least one TOMM40
deletion/insertion polymorphism (DIP) located in intron 6 or intron
9 of the TOMM40 gene; and (C) instructions for determining that the
subject is at increased risk of developing late onset Alzheimer's
disease by: (i) detecting the presence or absence of an ApoE
isoform in the subject with the at least one reagent; (ii)
detecting the presence or absence of at least one TOMM40
deletion/insertion polymorphism (DIP) located in intron 6 or intron
9 of the TOMM40 gene; and (iii) observing whether or not the
subject is at increased risk of developing late onset Alzheimer's
disease by observing if the presence of ApoE isoform and the TOMM40
DIP is or is not detected with the at least one reagent, wherein
the presence of the ApoE isoform and the TOMM40 DIP indicates the
subject is at increased risk of developing late onset Alzheimer's
disease.
[0049] In some embodiments, the at least one reagent and the
instructions are packaged in a single container.
[0050] In some embodiments, the DIP is an insertion polymorphism.
In some embodiments, the DIP is poly-T deletion/insertion
polymorphism (e.g., between 5 and 100, or 10 and 80, or 20 and 50
poly-T).
[0051] In some embodiments, the DIP is rs10524523, rs10602329 or
DIP3. In some embodiments, the DIP is rs10524523.
[0052] In some embodiments, the determining step further includes
detecting whether the subject is an Apo E2/E2, E2/E3, E2/E4, E3/E3,
E3/E4, or E4/E4 subject. In some embodiments, the subject is an Apo
E3/E3 or E3/E4 subject.
[0053] A kit is provided for determining if a subject is responsive
to treatment for a condition of interest, wherein the condition of
interest is associated with ApoE and/or TOMM40, with an active
agent, the kit including: (A) at least one reagent that
specifically detects ApoE 3, ApoE 4, or ApoE 2, wherein the reagent
is selected from the group consisting of antibodies that
selectively bind ApoE 3, ApoE 4, or ApoE 2, and oligonucleotide
probes that selectively bind to DNA encoding the same; (B) at least
one reagent that specifically detects the presence or absence of at
least one TOMM40 deletion/insertion polymorphism (DIP) located in
intron 6 or intron 9 of the TOMM40 gene; and (C) instructions for
determining that the subject is responsive to treatment for the
condition of interest with the active agent of interest by: (i)
detecting the presence or absence of an ApoE isoform in the subject
with the at least one reagent; (ii) detecting the presence or
absence of at least one TOMM40 deletion/insertion polymorphism
(DIP) located in intron 6 or intron 9 of the TOMM40 gene; and (iii)
determining whether or not the subject is responsive to treatment
by observing if the presence of the ApoE isoform and the TOMM40 DIP
is or is not detected with the at least one reagent, wherein the
presence of ApoE 3 and the TOMM40 DIP indicates that the subject is
responsive to the treatment with the active agent.
[0054] In some embodiments, the at least one reagent and the
instructions are packaged in a single container.
[0055] In some embodiments, the DIP is an insertion polymorphism.
In some embodiments, the DIP is poly-T deletion/insertion
polymorphism (e.g., between 5 and 100, or 10 and 80, or 20 and 50
bp poly-T).
[0056] In some embodiments, the DIP is rs10524523, rs10602329 or
DIP3. In some embodiments, the DIP is rs10524523.
[0057] In some embodiments, the determining step further includes
detecting whether the subject is an Apo E2/E2, E2/E3, E2/E4, E3/E3,
E3/E4, or E4/E4 subject. In some embodiments, the subject is an Apo
E3/E3 or E3/E4 subject.
[0058] It will be understood that all of the foregoing embodiments
can be combined in any way and/or combination. The foregoing and
other objects and aspects of the present invention are explained in
greater detail in the drawings provided herewith and in the
specification set forth below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] FIG. 1 shows a general flowchart for identifying a genetic
variant in a predetermined region of genomic sequence in a genetic
locus of interest, which may be associated with a condition of
interest, according to some embodiments.
[0060] FIG. 2 shows a graph of the mean age of onset of Alzheimer's
disease as a function of the inheritance of the five common ApoE
genotypes, and representing ApoE 4 as a risk factor for Alzheimer's
disease (1993).
[0061] FIG. 3 shows Regions A, B, and C on Chromosome 19, which are
exemplary genetic loci of interest. The TOMM40 gene is in close
proximity to the ApoE gene and encodes a 40 kD protein directed to
the outer mitochondrial membrane. TOMM40 interacts with ApoE
directly in regulation of mitochondrial protein import, and a
present hypothesis is that the presence of a particular TOMM40
variant(s) exacerbates the increased risk for Alzheimer's disease
associated with the dose-dependent presence of the ApoE 3
allele.
[0062] FIG. 4 shows the phylogenetic tree that is formed using the
sequence data for the AS case/control cohort of subjects. `A` and
`B` refer to the two major clades that arise from the first branch
point. The lengths of the various alleles of rs10524523 (523) in
each of the terminal clades of this tree are indicated. The APOE
allele that is linked in cis to each rs10524523 length allele is
also indicated.
[0063] FIG. 5 is a schematic diagram of the phylogenetic tree based
on Region B constructed for TOMM40, showing the percentages of ApoE
phenotypes in two major groupings, or clades, of the TOMM40
variants in this region.
[0064] FIG. 6 is a schematic overview of the TOMM40 ApoE locus
including an LD plot showing haplotype blocks and regions subject
to primary sequencing in the exploratory (R1) (23 Kb) and
confirmatory (R2) (10 Kb) studies (NCBI Build 36.3). The LD plot is
shown for Hapmap data (CEU analysis panel), solid spine haplotype
block definition, r.sup.2 values with D'/LOD color scheme
represented by different line characteristics.
[0065] FIGS. 7A and 7B show representations of the phylogenetic
trees with separation of variants. FIG. 7A: SNP variants, clade A
vs. B, E6-E11) represent TOMM40 exons and vertical lines indicate
the approximate locations of the SNPs. Separation of the two main
branches has strong bootstrap support (973/1000). FIG. 7B:
rs10524523 length polymorphisms. Descriptive statistics are
provided for each group of length polymorphisms. Several long
haplotypes that formed individual outgroups, in the tree or very
small clades, are in the group identified as `Remainder.`
[0066] FIGS. 8A to 8C present histograms of the length of the
rs10524523 length polymorphism stratified by ApoE genotypes 3/3
(FIG. 8A), 3/4 (FIG. 8B), and 4/4 (FIG. 8C). N=210 haplotypes (AS
cohort).
[0067] FIG. 9 shows the association between AD age of onset and
length of the rs10524523 polymorphism for AD patients with onset
between 60 and 86 years. Box plots indicate the 95% range (vertical
lines), median (horizontal line in box) and interquartile range
(box).
DETAILED DESCRIPTION
[0068] The present invention is explained in greater detail below.
This description is not intended to be a detailed catalog of all
the different ways in which the invention may be implemented, or
all of the features that may be added to the instant invention. For
example, features illustrated with respect to one embodiment may be
incorporated into other embodiments, and features illustrated with
respect to a particular embodiment may be deleted from that
embodiment. In addition, numerous variations and additions to the
various embodiments suggested herein will be apparent to those
skilled in the art in light of the instant disclosure which do not
depart from the instant invention. Hence, the following
specification is intended to illustrate some particular embodiments
of the invention, and not to exhaustively specify all permutations,
combinations and variations thereof.
[0069] As used in the description of the invention and the appended
claims, the singular forms "a", "an" and "the" are intended to
include the plural forms as well, unless the context clearly
indicates otherwise. Also, as used herein, "and/or" refers to and
encompasses any and all possible combinations of one or more of the
listed items, as well as the lack of combinations when interpreted
in the alternative ("or").
[0070] The present invention is directed to methods for revealing
genetic variation in regions of particular interest for complex
diseases and disorders. It also relates to the discovery of the
most informative genetic markers on the basis of associations with
phenotype information. In one embodiment, the invention may be used
to locate genetic markers associated with susceptibility to a
particular disease, disorder, or condition. In another embodiment,
data regarding subject response to a candidate treatment or drug
may be included in a phylogenetic analysis for the location of
genetic markers associated with a beneficial response to that
treatment or drug (i.e., pharmacogenetics). The methods can be
applied on any data set of genetic variation from a particular
locus. See FIG. 1 for a flowchart of the approach to finding
genetic risk factors according to the present invention.
[0071] In one aspect, the analysis of the genetic variation is
based on variant sequence data. In a second aspect, the structure
is uncovered using diploid genotype data, thereby avoiding the need
to either experimentally or computationally infer the component
haplotypes (see, e.g., U.S. Pat. No. 6,027,896 to Roses et al.). In
another aspect, the present method can be applied onto
uncharacterized allelic variation that results from the
interrogation of a target nucleic acid with an experimental
procedure that provides a record of the sequence variation present
but does not actually provide the entire sequence. The underlying
structure of genetic variation is also useful for the deduction of
the constituent haplotypes from diploid genotype data.
[0072] It is preferred and contemplated that the methods described
herein be used in conjunction with other clinical diagnostic
information known or described in the art which are used in
evaluation of subjects with diseases or disorders (e.g., those
believed to involve mitochondrial dysfunction (e.g. Alzheimer's
disease or other neurodegenerative diseases)) or for evaluation of
subjects suspected to be at risk for developing such disease. The
invention is also applicable for discovery of genetic risk factors
for other complex diseases, disorders, or conditions.
[0073] The disclosures of all United States patent references cited
herein are hereby incorporated by reference herein in their
entirety.
1. Definitions. The Following Definitions are Used Herein
[0074] "Condition of interest" refers to a specific condition,
disease, or disorder designated for phylogenetic study and/or
subsequent diagnosis or prognosis. "Condition" as used herein
includes, but is not limited to, conditions associated with ApoE
and/or TOMM40 and/or mitochondrial dysfunction, e.g.,
neurodegenerative diseases, metabolic diseases, psychiatric
disorders, and cancer.
[0075] Examples of conditions in which ApoE and/or TOMM40 have been
implicated include, but are not limited to, cardiovascular disease;
metabolic disease; neurodegenerative disease; neurological trauma
or disease; autoimmune disease (e.g., multiple sclerosis (Pinholt
M, et al. Apo E in multiple sclerosis and optic neuritis: the apo
E-epsilon4 allele is associated with progression of multiple
sclerosis. Mult Scler. 11:511-5 (2005); Masterman, T. &
Hillert, J. The telltale scan: APOE .epsilon.4 in multiple
sclerosis. Lancet Neurol. 3: 331 (2004), neuropsychiatric systemic
lupus erythematosus (Pullmann Jr. R, et al. Apolipoprotein E
polymorphism in patients with neuropsychiatric SLE. Clin Rheumatol.
23: 97-101 (2004)), etc.)); viral infection (e.g., liver disease
associated with hepatitis C infection (Wozniak Mass., t al,
Apolipoprotein E- 4 protects against severe liver disease caused by
hepatitis C virus. Hepatol. 36: 456-463 (2004)), HIV disease (Burt
T D, et al. Apolipoprotein (apo) E4 enhances HIV-1 cell entry in
vitro, and the APOE epsilon4/epsilon4 genotype accelerates HIV
disease progression. Proc Natl Acad Sci USA. 105:8718-23 (2008)),
etc.)); hip fracture/osteoporosis (Pluijm S M, et al. Effects of
gender and age on the association of apolipoprotein E epsilon4 with
bone mineral density, bone turnover and the risk of fractures in
older people. Osteoporos Int 13: 701-9 (2002)); mitochondrial
diseases (Chang S, et al. Lipid- and receptor-binding regions of
apolipoprotein E4 fragments act in concert to cause mitochondrial
dysfunction and neurotoxicity. Proc Natl Acad Sci USA. 102:18694-9
(2005)); aging (Schachter F, et al. Genetic associations with human
longevity at the APOE and ACE loci. Nat Genet. 6:29-32 (1994); Rea
I M, et al., Apolipoprotein E alleles in nonagenarian subjects in
the Belfast Elderly Longitudinal Free-living Ageing Study
(BELFAST). Mech. Aging and Develop. 122: 1367-1372 (2001));
inflammation (Li L, et al., Infection induces a positive acute
phase apolipoprotein E response from a negative acute phase gene:
role of hepatic LDL receptors. J Lipid Res. 49:1782-93 (2008)); and
memory dysfunction (Caselli R J, et al. Longitudinal modeling of
age-related memory decline and the APOE epsilon4 effect. N Engl J
Med. 361:255-63 (2009)).
[0076] "Cardiovascular disease" as used herein refers to a disease
involving the heart and/or blood vessels, including, but not
limited to, coronary artery disease (Song Y, et al. Meta-analysis:
apolipoprotein E genotypes and risk for coronary heart disease. Ann
Intern Med. 141:137-47 (2004); Bennet A M, et al., Association of
apolipoprotein E genotypes with lipid levels and coronary risk.
JAMA 298:1300-11 (2007)), atherosclerosis (Norata G D, et al.
Effects of PCSK9 variants on common carotid artery intima media
thickness and relation to ApoE alleles. Atherosclerosis (2009) Jun.
27. [Epub ahead of print], doi:10.1016/j.atherosclerosis
2009.06.023; Paternoster L, et al. Association Between
Apolipoprotein E Genotype and Carotid Intima-Media Thickness May
Suggest a Specific Effect on Large Artery Atherothrombotic Stroke.
Stroke 39:48-54 (2008)), ischemic heart disease (Schmitz F, et al.,
Robust association of the APOE 4 allele with premature myocardial
infarction especially in patients without hypercholesterolaemia:
the Aachen study. Eur. J Clin. Investigation 37: 106-108 (2007)),
vascular disease such as ischemic stroke (Peck G, et al. The
genetics of primary haemorrhagic stroke, subarachnoid haemorrhage
and ruptured intracranial aneurysms in adults. PLoS One. 3:e3691
(2008); Paternoster L, et al. Association Between Apolipoprotein E
Genotype and Carotid Intima-Media Thickness May Suggest a Specific
Effect on Large Artery Atherothrombotic Stroke. Stroke 39:48-54
(2008)), vascular dementia (Bang O Y, et al. Important link between
dementia subtype and apolipoprotein E: a meta-analysis. Yonsei Med
J. 44:401-13 (2003); Baum L, et al. Apolipoprotein E epsilon4
allele is associated with vascular dementia. Dement Geriatr Cogn
Disord. 22:301-5 (2006)), etc.
[0077] "Neurodegenerative disease" as used herein refers to
Alzheimer's disease (Corder E H, et al. Gene dose of apolipoprotein
E type 4 allele and the risk of Alzheimer's disease in late onset
families. Science 261:921-3 (1993); Corder E H, et al. There is a
pathologic relationship between ApoE-epsilon 4 and Alzheimer's
disease. Arch Neural. 52:650-1 (1995)), Parkinson's disease (Huang
X, et al. Apolipoprotein E and dementia in Parkinson disease: a
meta-analysis. Arch Neurol. 63:189-93 (2006); Huang X et al.
APOE-[epsilon]2 allele associated with higher prevalence of
sporadic Parkinson disease. Neurology 62:2198-202 (2004); Martinez,
M. et al. Apolipoprotein E4 is probably responsible for the
chromosome 19 linkage peak for Parkinson's disease. Am. J. Med.
Genet. B Neuropsychiatr. Genet. 136B, 172-174 (2005)), Huntington's
disease, and a plurality of less common diseases and disorders
which cause neurons to decline, e.g., age-related macular
degeneration (Thakkinstian A, et al. Association between
apolipoprotein E polymorphisms and age-related macular
degeneration: A HuGE review and meta-analysis. Am J Epidemiol.
164:813-22 (2006); Bojanowski C M, et al. An apolipoprotein E
variant may protect against age-related macular degeneration
through cytokine regulation. Environ Mol Mutagen. 47:594-602
(2006)).
[0078] "Neurological trauma or disease" includes, but is not
limited to, outcome after head injury (Zhou W, et al. Meta-analysis
of APOE4 allele and outcome after traumatic brain injury. J
Neurotrauma. 25:279-90 (2008); Lo T Y, et al. Modulating effect of
apolipoprotein E polymorphisms on secondary brain insult and
outcome after childhood brain trauma. Childs Nery Syst. 25:47-54
(2009)), migraine (Gupta R, et al. Polymorphism in apolipoprotein E
among migraineurs and tension-type headache subjects. J Headache
Pain. 10:115-20 (2009)), vasogenic edema (James M L, et al.
Apolipoprotein E modifies neurological outcome by affecting
cerebral edema but not hematoma size after intracerebral hemorrhage
in humans. J Stroke Cerebrovasc Dis. 18:144-9 (2009); James M L, et
al. Pharmacogenomic effects of apolipoprotein e on intracerebral
hemorrhage. Stroke 40:632-9 (2009)), etc.
[0079] "Metabolic disease" as used herein includes, but is not
limited to, dyslipidemia (Willer C J, et al. Newly identified loci
that influence lipid concentrations and risk of coronary artery
disease. Nat Genet. 40:161-9 (2008); Bennet A M, et al.,
Association of apolipoprotein E genotypes with lipid levels and
coronary risk. JAMA 298:1300-11 (2007)), end stage renal disease
(Oda H, et al. Apolipoprotein E polymorphism and renal disease.
Kidney Int Suppl. 71:S25-7 (1999); Hubacek J A, et al.
Apolipoprotein E Polymorphism in Hemodialyzed Patients and Healthy
Controls. Biochem Genet. (2009) Jun. 30. [Epub ahead of print] DOI
10.1007/s10528-009-9266-y.), chronic kidney disease (Yoshida T, et
al. Association of a polymorphism of the apolipoprotein E gene with
chronic kidney disease in Japanese individuals with metabolic
syndrome. Genomics 93:221-6 (2009); Leiva E, et al. Relationship
between Apolipoprotein E polymorphism and nephropathy in type-2
diabetic patients. Diabetes Res Clin Pract. 78:196-201 (2007)),
gallbladder disease (Boland L L, et al. Apolipoprotein E genotype
and gallbladder disease risk in a large population-based cohort.
Ann Epidemiol. 16:763-9 (2006); Andreotti G, et al. Polymorphisms
of genes in the lipid metabolism pathway and risk of biliary tract
cancers and stones: a population-based case-control study in
Shanghai, China. Cancer Epidemiol Biomarkers Prev. 17:525-34
(2008)), diabetes mellitus (type II) (Elosua R, et al. Obesity
Modulates the Association among APOE Genotype, Insulin, and Glucose
in Men. Obes Res. 11:1502-1508 (2003); Moreno J A, et al. The
Apolipoprotein E Gene Promoter (-219G/T) Polymorphism Determines
Insulin Sensitivity in Response to Dietary Fat in Healthy Young
Adults. J. Nutr. 135:2535-2540 (2005)), metabolic syndrome,
cholelithiasis (Abu Abeid S, et al. Apolipoprotein-E genotype and
the risk of developing cholelithiasis following bariatric surgery:
a clue to prevention of routine prophylactic cholecystectomy. Obes
Surg. 12:354-7 (2002)), etc.
[0080] "Psychiatric Disorder" as used herein refers to
schizophrenia (Kampman O, et al. Apolipoprotein E polymorphism is
associated with age of onset in schizophrenia. J Hum Genet.
49:355-9 (2004); Dean B. et al., Plasma apolipoprotein E is
decreased in schizophrenia spectrum and bipolar disorder.
Psychiatry Res. 158:75-78 (2008)), obsessive compulsive disorder
(OCD), addictive behavior (smoking addiction, alcohol addiction,
etc.), bipolar disorder (Dean B. et al., Plasma apolipoprotein E is
decreased in schizophrenia spectrum and bipolar disorder.
Psychiatry Res. 158:75-78 (2008)), and other diseases, disorders,
or conditions of a psychiatric nature.
[0081] "Development of a condition" as used herein refers to either
an initial diagnosis of a disease, disorder, or other medical
condition, or exacerbation of an existing disease, disorder, or
medical condition for which the subject has already been
diagnosed.
[0082] "Diagnosis" or "prognosis" as used herein refers to the use
of information (e.g., genetic information or data from other
molecular tests on biological samples, signs and symptoms, physical
exam findings, cognitive performance results, etc.) to anticipate
the most likely outcomes, timeframes, and/or response to a
particular treatment for a given disease, disorder, or condition,
based on comparisons with a plurality of individuals sharing common
nucleotide sequences, symptoms, signs, family histories, or other
data relevant to consideration of a patient's health status.
[0083] "Biological sample" as used herein refers to a material
suspected of containing a nucleic acid of interest. Biological
samples containing DNA include hair, skin, cheek swab, and
biological fluids such as blood, serum, plasma, sputum, lymphatic
fluid, semen, vaginal mucus, feces, urine, spinal fluid, and the
like. Isolation of DNA from such samples is well known to those
skilled in the art.
[0084] A "subject" according to some embodiments is an individual
whose genotype(s) or haplotype(s) are to be determined and recorded
in conjunction with the individual's condition (i.e., disease or
disorder status) and/or response to a candidate drug or treatment.
Nucleotide sequences from a plurality of subjects are used to
construct a phylogenetic tree, and then analogous nucleotide
sequences from an individual subject may be compared to those on
the phylogenetic tree for diagnostic or prognostic purposes.
[0085] "Gene" as used herein means a segment of DNA that contains
all the information for the regulated biosynthesis of an RNA
product, including promoters, exons, introns, and other
untranslated regions that control expression.
[0086] "Genetic locus" or "locus" as used herein means a location
on a chromosome or DNA molecule, often corresponding to a gene or a
physical or phenotypic feature or to a particular nucleotide or
stretch of nucleotides. Loci is the plural form of locus.
[0087] "Amplification," as applied to nucleic acids herein refers
to any method that results in the formation of one or more copies
of a nucleic acid, where preferably the amplification is
exponential. One such method for enzymatic amplification of
specific sequences of DNA is known as the polymerase chain reaction
(PCR), as described by Saiki et al., 1986, Science 230:1350-1354.
Primers used in PCR normally vary in length from about 10 to 50 or
more nucleotides, and are typically selected to be at least about
15 nucleotides to ensure sufficient specificity. The double
stranded fragment that is produced is called an "amplicon," and may
vary in length from as few as about 30 nucleotides, to 20,000 or
more.
[0088] A "marker" or "genetic marker" as used herein is a known
variation of a DNA sequence at a particular locus. The variation
may be present in an individual due to mutation or inheritance. A
genetic marker may be a short DNA sequence, such as a sequence
surrounding a single base-pair change (single nucleotide
polymorphism, SNP), or a long one, like minisatellites. Markers can
be used to study the relationship between an inherited disease and
its genetic cause (for example, a particular mutation of a gene
that results in a defective or otherwise undesirable form of
protein).
[0089] A "genetic risk factor" as used herein means a genetic
marker that is associated with increased susceptibility to a
condition, disease, or disorder. It may also refer to a genetic
marker that is associated with a particular response to a selected
drug or treatment of interest.
[0090] "Associated with" as used herein means the occurrence
together of two or more characteristics more often than would be
expected by chance alone. An example of association involves a
feature on the surface of white blood cells called HLA (HLA stands
for human leukocyte antigen). A particular HLA type, HLA type B-27,
is associated with an increased risk for a number of diseases
including ankylosing spondylitis. Ankylosing spondylitis is 87
times more likely to occur in people with HLA B-27 than in the
general population.
[0091] A subject "at increased risk of developing a condition" due
to a genetic risk factor is one who is predisposed to the
condition, has genetic susceptibility for the condition, and/or is
more likely to develop the condition than subjects in which the
genetic risk factor is absent. For example, a subject who is "at
increased risk of developing Alzheimer's disease" due to the
presence of one or two ApoE 4 alleles is more likely to develop
Alzheimer's disease than a subject who does not carry an ApoE 4
allele.
[0092] "Polymorphism" as used herein refers to the existence of two
or more different nucleotide sequences at a particular locus in the
DNA of the genome. Polymorphisms can serve as genetic markers and
may also be referred to as genetic variants. Polymorphisms include
nucleotide substitutions, insertions, deletions and
microsatellites, and may, but need not, result in detectable
differences in gene expression or protein function. A polymorphic
site is a nucleotide position within a locus at which the
nucleotide sequence varies from a reference sequence in at least
one individual in a population.
[0093] A "deletion/insertion polymorphism" or "DIP" as used herein
is an insertion of one or more nucleotides in one version of a
sequence relative to another. If it is known which of the alleles
represent minor alleles, the term "deletion" is used when the minor
allele is a deletion of a nucleotide, and the term "insertion" is
used when the minor allele is an addition of a nucleotide. The term
"deletion/insertion polymorphism" is also used when there are
multiple forms or lengths and the minor allele is not apparent. For
example, for the poly-T polymorphisms described herein, multiple
lengths of polymorphisms are observed.
[0094] "Polymorphism data" as used herein means information
concerning one or more of the following for a specific gene:
location of polymorphic sites; sequence variation at those sites;
frequency of polymorphisms in one or more populations; the
different genotypes and/or haplotypes determined for the gene;
frequency of one or more of these genotypes and/or haplotypes in
one or more populations; and any known association(s) between a
trait and a genotype or a haplotype for the gene.
[0095] "Haplotype" as used herein refers to a genetic variant or
combination of variants carried on at least one chromosome in an
individual. A haplotype often includes multiple contiguous
polymorphic loci. All parts of a haplotype as used herein occur on
the same copy of a chromosome or haploid DNA molecule. Absent
evidence to the contrary, a haplotype is presumed to represent a
combination of multiple loci that are likely to be transmitted
together during meiosis. Each human carries a pair of haplotypes
for any given genetic locus, consisting of sequences inherited on
the homologous chromosomes from two parents. These haplotypes may
be identical or may represent two different genetic variants for
the given locus. Haplotyping is a process for determining one or
more haplotypes in an individual. Haplotyping may include use of
family pedigrees, molecular techniques and/or statistical
inference.
[0096] A "variant," "variance," or "genetic variant" as used
herein, refers to a specific isoform of a haplotype in a
population, the specific form differing from other forms of the
same haplotype in the sequence of at least one, and frequently more
than one, variant sites or nucleotides within the sequence of the
gene. The sequences at these variant sites that differ between
different alleles of a gene are termed "gene sequence variants,"
"alleles," "variances" or "variants." The term "alternative form"
refers to an allele that can be distinguished from other alleles by
having at least one, and frequently more than one, variant sites
within the gene sequence. Other terms known in the art to be
equivalent to "variances" or "variants" include mutations and
single nucleotide polymorphisms (SNPs). Reference to the presence
of a variance or variances means particular variances, i.e.,
particular nucleotides at particular polymorphic sites, rather than
just the presence of any variance in the gene.
[0097] "Isoform" as used herein means a particular form of a gene,
mRNA, cDNA or the protein encoded thereby, distinguished from other
forms by its particular sequence and/or structure. For example, the
ApoE 4 isoform of apolipoprotein E as opposed to the ApoE2 or ApoE
3 isoforms.
[0098] "Cistron" as used herein means a section of DNA found on a
single chromosome that contains the genetic code for a single
polypeptide and functions as a hereditary unit. A cistron includes
exons, introns, and regulatory elements related to a single
functional unit (i.e., a gene). The term derives from the classic
cis-trans test for determining whether genetic elements were able
to functionally interact regardless of whether they were located on
the same DNA molecule ("trans" complementation) or only when they
were located on the same DNA molecule ("cis" acting elements).
[0099] The term "genotype" in the context of this invention refers
to the particular allelic form of a gene, which can be defined by
the particular nucleotide(s) present in a nucleic acid sequence at
a particular site(s). Genotype may also indicate the pair of
alleles present at one or more polymorphic loci. For diploid
organisms, such as humans, two haplotypes make up a genotype.
[0100] Genotyping is any process for determining a genotype of an
individual, e.g., by nucleic acid amplification, antibody binding,
or other chemical analysis. The resulting genotype may be unphased,
meaning that the sequences found are not known to be derived from
one parental chromosome or the other.
[0101] "Linkage disequilibrium" as used herein means the non-random
association of alleles at two or more loci. Linkage disequilibrium
describes a situation in which some combinations of alleles or
genetic markers occur more or less frequently in a population than
would be expected from a random formation of haplotypes from
alleles based on their frequencies. Non-random associations between
polymorphisms at different loci are measured by the degree of
linkage disequilibrium.
[0102] "Multiple sequence alignment" or "MSA" as used herein means
alignment of three or more nucleotide sequences from genomic DNA
derived from a plurality of individuals to determine homology and
heterology between the sequences. In general, the input set of
query sequences are assumed to have an evolutionary relationship by
which they share a lineage and are descended from a common
ancestor. Computer algorithms are most often used to perform the
analysis of aligned sequences.
[0103] Some embodiments of the present invention are described with
reference to block diagrams illustrating methods (e.g., FIG. 1),
which may include steps implemented by a computer and/or computer
program products. It will be understood that each block of the
block diagrams and/or operational illustrations, and combinations
of blocks in the block diagrams and/or operational illustrations,
can be implemented by analog and/or digital hardware, and/or
computer program instructions. These computer program instructions
may be provided to a processor of a general purpose computer,
special purpose computer, ASIC, and/or other programmable data
processing apparatus, such that the instructions, which execute via
the processor of the computer and/or other programmable data
processing apparatus, create means for implementing the
functions/acts specified in the block diagrams and/or operational
illustrations. Accordingly, it will be appreciated that the block
diagrams and operational illustrations support apparatus, methods
and computer program products.
[0104] Other software, such as an operating system, also may be
included. It will be further appreciated that the functionality of
the multiple sequence alignment module, mapping module and/or other
modules described herein may be embodied, at least in part, using
discrete hardware components, one or more Application Specific
Integrated Circuits (ASIC) and/or one or more special purpose
digital processors and/or computers.
[0105] "Mapping" as used herein means creating a phylogenetic tree
by assigning a node to each new nucleotide sequence variant
observed, connecting that node to another node representing a known
sequence carried by the same individual on the same chromosome or
cistron, and counting the numbers of each type of subject
represented at each node. See FIG. 4 for an example of a
phylogenetic tree developed in this manner.
[0106] "Phylogenetic" means related to the study of evolutionary
connections among various groups of organisms or individuals within
a species. Before genetic information was readily available,
phylogeny was based mostly on phenotypic observation. "Phylogenetic
mapping" as used herein means using DNA sequence data to connect
related sequence variants carried by a plurality of individuals in
order to determine evolutionary connections and the chronology of
divergence. A "phylogenetic tree" is the result of mapping the
connections between variants.
[0107] "Node" as used herein means a polymorphism data point on a
phylogenetic tree representing an actual variant sequence carried
by at least one subject. A node is connected by a branch to another
node representing a variant sequence carried by the same individual
on the same chromosome and in the same cistron but at a different
genetic locus within the cistron. The presence of a node indicates
that at least one subject carried both the sequence indicated by
the node as well as the sequence represented by the neighboring
node to which it is connected by a branch.
[0108] "Branch" as used herein means a connection between two nodes
representing two distinct variant sequences or haplotypes, wherein
the two variants are located on the same chromosome and in the same
cistron from an individual subject. "Branching point" means any
node from which more than two branches extend, but it is especially
used herein to refer to a root node from which three or more nodes
extend. A "root node" represents the genetic sequence of a common
evolutionary ancestor from which genetic divergence has generated
the variety of nearby sequence variants represented by the
connected nodes.
[0109] "Iteratively" as used herein refers to repetitive
calculation of values for each character in a series. For example,
each node on a phylogenetic tree is analyzed to calculate the ratio
of the number of subjects affected with a condition of interest
(such as Alzheimer's disease) to control unaffected subjects; this
ratio is compared with the connected nodes to locate correlations
with increased or decreased risk for developing a disease,
disorder, or condition of interest. A substantial change in this
ratio between one node and the next indicates the presence of a
variant that either increases or decreases the risk of earlier
disease onset. "Iteratively examining the genetic variants" means
beginning the analysis with nodes representing the sequences shared
by the greatest numbers of individual subjects and successively
analyzing the nodes connected by branches extending from that node,
followed by the second level of nodes, and so on. The analysis then
moves overall from the roots of the tree toward the outer branches
and nodes of the tree.
[0110] "Treatment" as used herein includes any drug, procedure,
lifestyle change, or other adjustment introduced in attempt to
effect a change in a particular aspect of a subject's health (i.e.
directed to a particular disease, disorder, or condition).
[0111] "Drug" as used herein refers to a chemical entity or
biological product, or combination of chemical entities or
biological products, administered to a person to treat or prevent
or control a disease or condition. The term "drug" as used herein
is synonymous with the terms "medicine," "medicament," "therapeutic
intervention," or "pharmaceutical product." Most preferably the
drug is approved by a government agency for treatment of at least
one specific disease or condition.
[0112] "Disease," "disorder," and "condition" are commonly
recognized in the art and designate the presence of signs and/or
symptoms in an individual or patient that are generally recognized
as abnormal and/or undesirable. Diseases or conditions may be
diagnosed and categorized based on pathological changes. The
disease or condition may be selected from the types of diseases
listed in standard texts such as Harrison's Principles of Internal
Medicine, 1997, or Robbins Pathologic Basis of Disease, 1998.
[0113] "Mitochondrial dysfunction" as used herein means any
detrimental abnormalities of the mitochondria within a cell or
cells. Some diseases, disorders, or conditions presently known in
the art to be associated with mitochondrial dysfunction include
Alzheimer's disease, Parkinson's disease, and other
neurodegenerative diseases, ischemia-reperfusion injury in stroke
and heart attack, epilepsy, diabetes, and aging. Many other
diseases, disorders, and conditions have been associated with
mitochondrial dysfunction in the art. Indeed, the mitochondrion is
critical for proper functioning of most cell types, and
mitochondrial decline often leads to cell death. This mitochondrial
dysfunction causes cell damage and death by compromising ATP
production, disrupting calcium homeostasis and increasing oxidative
stress. Furthermore, mitochondrial damage can lead to apoptotic
cell death by causing the release of cytochrome c and other
pro-apoptotic factors into the cytoplasm (for review, see Wallace,
1999; Schapira, 2006). Regarding a specific example found herein,
the ApoE 3 and ApoE 4 isoforms are hypothesized to cause
mitochondrial dysfunction through interactions with TOMM40. Some
TOMM40 variants may act synergistically with ApoE 3 isoform to
accelerate mitochondrial decline. This mitochondrial mechanism is
believed to contribute to many complex genetic diseases, disorders,
and conditions.
[0114] "Subjects" as used herein are preferably, but not limited
to, human subjects. The subjects may be male or female and may be
of any race or ethnicity, including, but not limited to, Caucasian,
African-American, African, Asian, Hispanic, Indian, etc. The
subjects may be of any age, including newborn, neonate, infant,
child, adolescent, adult, and geriatric. Subjects may also include
animal subjects, particularly mammalian subjects such as canines,
felines, bovines, caprines, equines, ovines, porcines, rodents
(e.g., rats and mice), lagomorphs, primates (including non-human
primates), etc., screened for veterinary medicine or pharmaceutical
drug development purposes.
[0115] "Treat," "treating," or "treatment" as used herein refers to
any type of measure that imparts a benefit to a patient afflicted
with a disease, including improvement in the condition of the
patient (e.g., in one or more symptoms), delay in the onset or
progression of the disease, etc.
[0116] "Late-onset Alzheimer's disease" or "LOAD" as used herein is
known in the art, and is the classification used if the Alzheimer's
disease has an onset or is diagnosed after the age of 65. It is the
most common form of Alzheimer's disease.
2. Methods for Identifying Genetic Variants
[0117] While lists of associations derived from genome-wide scans
are useful, they are generally inadequate to explain disease
complexity. Families, pathways, and interactions of genes can
provide specificities. High-resolution variance mapping may reveal
answers to complex genetic interactions. This is particularly
applicable where one known genetic risk factor which does not
itself entirely explain an association to the disease, disorder, or
condition of interest may present an excellent candidate genetic
locus for more detailed investigations. Furthermore,
pharmacogenetics, while useful for drug development, can also
extend biological relevance. The analysis of sequence data from
large numbers of individuals to discover variances in the gene
sequence between individuals in a population will result in
detection of a greater fraction of all the variants in the
population.
[0118] The initial sequence information to be analyzed by the
method of the present invention is derived from the genomic DNA of
a plurality of subjects. The organism can be any organism for which
multiple sequences are available, but is preferably from human. In
identifying new variances it is often useful to screen different
population groups based on race, ethnicity, gender, and/or
geographic origin because particular variances may differ in
frequency between such groups. Most preferably, for diseases or
disorders believed to be multigenic (genetically complex
diseases/disorders), the phenotypes represented by the subject
population are from the extremes of a spectrum. Biological samples
containing DNA may be blood, semen, cheek swab, etc. Isolation of
DNA from such samples is well known in the art.
[0119] In some embodiments, the invention relates to the analysis
of nucleotide sequence data from a plurality of subjects having at
least one known risk factor for a given disease, disorder, or
condition (genetic or otherwise). The nucleotide sequences are
analyzed to generate haplotype data, and the haplotypes or genetic
variants are then mapped onto a phylogenetic tree to demonstrate
the evolution of the sequences represented. By comparing this tree
to phenotype data about the plurality of subjects, a prognosis or
diagnosis is possible for an individual subject carrying haplotypes
observed on the phylogenetic tree.
[0120] In other embodiments, the invention relates to the fields of
pharmacogenetics and pharmacogenomics and the use of genetic
haplotype information to predict an individual's susceptibility to
disease and/or their response to a particular drug or drugs, so
that drugs tailored to genetic differences of population groups may
be developed and/or administered to individuals with the
appropriate genetic profile.
[0121] Nucleotide sequence information is derived from genomic DNA.
Genomic sequence data used may be obtained from clinical or
non-human animals or from cultured cells or isolated tissue
studies. The organism can be any organism for which multiple
sequences are available, but is preferably from human. In
identifying new variances it is often useful to screen different
population groups based on race, ethnicity, gender, and/or
geographic origin because particular variances may differ in
frequency between such groups. Most preferably, for diseases or
disorders believed to be multigenic (genetically complex
diseases/disorders), the phenotypes represented by the subject
population are extreme opposites.
[0122] Biological samples containing DNA may be blood, semen, cheek
swab, etc. Isolation of DNA from such samples is well known in the
art. Methods for determining DNA sequence at a particular genetic
locus of interest are also known in the art. Automated sequencing
is now widely available and requires only an isolated DNA sample
and at least one primer that is specifically designed to recognize
a highly conserved sequence within or in close proximity to the
genetic locus of interest.
[0123] According to some embodiments, a defined genetic region or
locus of interest (e.g., defined by a set of forward and reverse
PCR primers) is carefully sequenced from a cohort of people
inclusive of patients who are well characterized for a particular
disorder.
[0124] A consensus sequence is determined, and all observed
sequence variants for a given genetic locus are compiled into a
list. Loci having the greatest number of observed variants
represent evolutionary divergence from a common ancestor. As such,
these loci are connected in cis to loci having only one or very few
observed variants. During initial phases of investigation at least,
it is preferred that populations be parsed into groups of subjects
sharing a common general phenotype representing similar ancestry.
Otherwise, analysis of these data through construction of
phylogenetic trees will require a prohibitively large number of
subjects.
3. Multiple Sequence Alignments
[0125] Determining the presence of a particular variance or
plurality of variances in a gene or gene region in a population can
be performed in a variety of ways, all of which involve locating a
particular genetic locus by targeting sequences within the region
of interest that are known to be highly conserved. From the highly
conserved locus, the contiguous sequences are easily obtained
through one of many techniques well-known in the art.
[0126] The first step in analyzing parallel DNA sequences from a
plurality of subjects is multiple sequence alignment ("MSA"). MSA
is typically used to display sequence alignment from homologous
samples with polymorphic differences within genes or gene regions
to show conserved areas and variant sequences. MSAs of the sequence
information obtained at the locus of interest may be constructed
using one or more various known techniques and publicly available
software, and are publicly available from many sources including
the Internet. Methods for analyzing multiple sequence alignments
known in the art include, e.g., those described in U.S. Pat. No.
6,128,587 to Sjolander; U.S. Pat. No. 6,291,182 to Schork et al.;
and U.S. Pat. No. 6,401,043 to Stanton et al.
4. Phylogenetic Trees and Analysis
[0127] Various methods for construction of "phylogenetic trees" are
known in the art (See, e.g., Sanderson, 2008). Sun et al. used
"haplotype block" analyses to study associations between toll-like
receptor (TLR) variants and prostate cancer (2005) and Bardel et
al. (2005) used a cladistic analysis approach to investigate
associations between CARD15 gene variants and Crohn's disease.
However, neither utilized genetic loci previously associated with
the disease to investigate linkages.
[0128] Phylogenetic trees according to some embodiments may be
constructed with a topology in which haplotype sequence variants
observed in individual human subjects studied form nodes
(representing each sequence observed in the data) on a tree. Nodes
may be joined to other nodes, and the common ancestor is found at
the branching site, common root or root node of the tree. A
phylogenetic tree reflects the evolutionary relationship between
genetic loci for which data are analyzed (see Sanderson, 2008;
Tzeng, 2005; Seltman, 2003). FIG. 4 shows a detailed phylogenetic
tree constructed for Region B of the genetic locus shown in FIG.
3.
[0129] The starting point for phylogenetic tree estimation is
generally an MSA (see above). Multiple software applications are
available for constructing phylogenetic trees based on sequence
data. See, e.g., U.S. Pat. Nos. 7,127,466 and 6,532,467 to
Brocklebank, et al. The basic premise is that a genetic locus
exhibiting many variants is represented by these variants connected
in cis. Polymorphisms create branching points (nodes) in the tree
that define groups of related sequences or haplotypes.
[0130] The phylogenetic tree is utilized for information by
iteratively examining ratios of subjects affected with a condition
to unaffected control subjects; the calculations begin with nodes
observed in the greatest numbers of subjects and move toward the
periphery of the tree to nodes observed in fewer subjects. The goal
is to locate a branching point, branch, or node where there is
substantial change in the ratio of subjects affected with the
condition of interest to unaffected control subjects. Such a
branching point represents the evolutionary divergence of higher
risk subjects from lower risk subjects or vice versa.
[0131] Statistical analysis of the phylogenetic tree generated may
be performed in accordance with the methods known in the art. One
art-recognized method is the calculation of bootstrap confidence
levels (see Efron et al., Proc. Natl. Acad. Sci. USA 93,
13429-13434 (1996)).
5. Patient Evaluation
[0132] Once a phylogenetic tree has been generated for a particular
genetic locus, an individual subject may be evaluated by comparing
their DNA sequence to the sequences that comprise the phylogenetic
tree. The presence of haplotypes or sequence variants corresponding
with regions of the tree representing subjects with higher
incidence of the condition of interest (i.e., higher ratios of
subjects affected with the disease or disorder to unaffected
control subjects) would mean that the individual subject is also at
increased risk. Conversely, substantially lower ratios correspond
to reduced risk of developing the condition of interest.
[0133] Phylogenetic trees may also be analyzed based upon
responsiveness of the condition of interest to treatment with an
active agent or treatment method of interest according to some
embodiments.
6. APOE and TOMM40
[0134] ApoE phenotypes and genotypes are well known in the art. The
established nomenclature system as well as the phenotypes and
genotypes for ApoE are described in, for example, Zannis et al.,
1982, which is incorporated by reference herein.
[0135] TOMM40 (The Outer Mitochondrial Membrane channel subunit, 40
kDa) phenotypes and genotypes are also known. TOMM40 functions as a
channel-forming subunit of the translocase found in mitochondrial
membrane that is essential for protein import into
mitochondria.
[0136] Genome-wide association scanning data from studies of
Alzheimer's disease patients have unequivocally identified the
linkage disequilibrium region that contains the apolipoprotein E
(ApoE) gene. The ApoE 4 variant has been widely replicated as a
confirmed susceptibility gene since the initial publications in
1993 (see, e.g., Corder et al.). However, the genome-wide
association scanning data resulted in a remarkable "coincidence"
observed in cell biology studies involving the co-localization ApoE
and TOMM40 to the outer mitochondrial membrane. This other gene,
TOMM40, was first encountered during studies modeling linkage
disequilibrium around ApoE in 1998. The polymorphisms were located
adjacent to ApoE within a small linkage disequilibrium region.
[0137] ApoE co-localizes to the outer mitochondrial membrane,
suggesting isoform-specific interactions leading to a potential
role for ApoE-induced mitochondrial apoptosis as an early step in
Alzheimer's disease expression. Biological data have demonstrated
that the proportion of mobile mitochondria in neuronal cell
culture, as well as the speed at which they move and the distance
that they traverse, are factors affecting increased mitochondrial
apoptosis. Phylogenetic data suggest an independent genetic effect
on the development of Alzheimer's disease for TOMM40.
[0138] ApoE binds specifically to mitochondria in human neuronal
cultures (Chang, 2005), and sequencing of this linkage
disequilibrium region in hundreds of Alzheimer's disease patients
and matched controls, combined with mapping the genetic variant
evolution of TOMM40, defines a region of particular interest for
ApoE-TOMM40 interactions, as shown in FIG. 3. These evolutionary
data further support the genetic association between ApoE and
TOMM40, and suggest that mitochondrial dysfunction could be
responsible for neuronal death occurring slowly over many years.
The age of onset distribution for Alzheimer's disease (see, e.g.,
U.S. Pat. No. 6,027,896 to Roses et al.) might reflect the
inheritance of tightly linked variants of two biochemically
interacting proteins that lead to the clinical expression of
disease.
[0139] As detailed herein, the interaction between multiple
haplotypes of TOMM40 variants and ApoE alleles contribute to
Alzheimer's disease pathogenesis; in particular, haplotypes of
TOMM40 in linkage to the E 3 allele of ApoE contribute to disease
pathogenesis. Several of the TOMM40 gene variants evolved only
cis-linked to ApoE 3. (Similarly, specific TOMM40 variants may have
evolved cis-linked to ApoE 4 or ApoE 2.) Thus, any added genetic
effect of the TOMM40 variants segregates independently of ApoE 4
but the two variant protein products may functionally interact, in
trans, to produce a given observable phenotype or trait. Thus, any
added genetic effect of the TOMM40 variants segregates
independently from ApoE 4. This "coincidence" of adjacent
interacting genes may account for the extraordinarily significant
statistical association data found in all Alzheimer's disease
genome-wide association scanning studies. It is of interest to note
that the initial commercially available genome-wide association
scanning platforms did not contain any ApoE polymorphisms, but were
identified with TOMM40 and ApoC1 SNPs--but the region is virtually
always referred to as the "ApoE region."
[0140] These data, which combine disease genetics and putative
molecular mechanisms of pathogenesis, can also be viewed within a
pharmacogenetics context. Because of the strong genetic effect of
inheriting an ApoE 4 allele, ApoE 4 has been referred to as a
complex susceptibility gene for more than a decade. Consistent
replications of the age of onset distributions as a function of
ApoE genotype confirm that the role of ApoE 3 inheritance is not
totally benign, but is a lower risk factor observed at a slower
rate of disease onset. There are genetic variants of TOMM40 that
are located only on DNA strands containing ApoE 3 in the linkage
disequilibrium regions (Roses et al., unpublished data), and thus
not in Hardy-Weinberg equilibrium as was required for SNPs in
genome-wide association panels. Evolutionary changes in TOMM40
sequences that are cis-linked only to ApoE 3 act to increase the
risk of Alzheimer's disease associated with ApoE 3, while other
variants of TOMM40 cis-linked to ApoE 3 decrease the risk
associated with ApoE 3. An independent genetic test would be to
determine whether those TOMM40 polymorphisms associated with less
Alzheimer's disease segregate at a later age in age of onset
distribution plots for ApoE 3 containing genotypes [ApoE 3/3 or
ApoE 4/3].
[0141] Detecting the presence or absence of ApoE 2, 3 or 4, and/or
TOMM40 haplotypes or of DNA encoding the same (including, in some
embodiments, the number of alleles for each) in a subject may be
carried out either directly or indirectly by any suitable means. A
variety of techniques are known to those skilled in the art. All
generally involve the step of collecting a sample of biological
material containing either DNA or protein from the subject, and
then detecting whether or not the subject possesses the haplotype
of interest. For example, the detecting step with respect to ApoE
may be carried out by collecting an ApoE sample from the subject
(for example, from cerebrospinal fluid, or any other fluid or
tissue containing ApoE), and then determining the presence or
absence of an ApoE 2, 3, or 4 isoform in the ApoE sample (e.g., by
isoelectric focusing or immunoassay).
[0142] Determining the presence or absence of DNA encoding an ApoE
and/or TOMM40 isoform may be carried out by direct sequencing of
the genomic DNA region of interest, with an oligonucleotide probe
labeled with a suitable detectable group, and/or by means of an
amplification reaction such as a polymerase chain reaction or
ligase chain reaction (the product of which amplification reaction
may then be detected with a labeled oligonucleotide probe or a
number of other techniques). Further, the detecting step may
include the step of detecting whether the subject is heterozygous
or homozygous for the gene encoding an ApoE and/or TOMM40
haplotype. Numerous different oligonucleotide probe assay formats
are known which may be employed to carry out the present invention.
See, e.g., U.S. Pat. No. 4,302,204 to Wahl et al.; U.S. Pat. No.
4,358,535 to Falkow et al.; U.S. Pat. No. 4,563,419 to Ranki et
al.; and U.S. Pat. No. 4,994,373 to Stavrianopoulos et al.
(applicants specifically intend that the disclosures of all U.S.
Patent references cited herein be incorporated herein by
reference).
[0143] In some embodiments, detection may include multiplex
amplification of the DNA (e.g., allele-specific fluorescent PCR).
In some embodiments, detection may include hybridization to a
microarray (a chip, beads, etc.). In some embodiments, detection
may include sequencing appropriate portions of the gene containing
the haplotypes sought to be detected. In some embodiments,
haplotypes that change susceptibility to digestion by one or more
endonuclease restriction enzymes may be used for detection. For
example, restriction fragment length polymorphism (RFLP), which
refers to the digestion pattern when various restriction enzymes
are applied to DNA, may be used. In some embodiments, the presence
of one or more haplotypes can be determined by allele specific
amplification. In some embodiments, the presence of haplotypes can
be determined by primer extension. In some embodiments, the
presence of haplotypes can be determined by oligonucleotide
ligation. In some embodiments, the presence of haplotypes can be
determined by hybridization with a detectably labeled probe. See,
e.g., U.S. Patent Application Publication No. 2008/0153088 to Sun
et al.; Kobler et al., Identification of an 11T allele in the
polypyrimidine tract of intron 8 of the CFTR gene, Genetics in
Medicine 8(2):125-8 (2006); Costa et al., Multiplex Allele-Specific
Fluorescent PCR for Haplotyping the IVS8 (TG)m(T)n Locus in the
CFTR Gene, Clin. Chem., 54:1564-1567 (2008); Johnson et al., A
Comparative Study of Five Technologically Diverse CFTR Testing
Platforms, J. Mol. Diagnostics, 9(3) (2007); Pratt et al.,
Development of Genomic Reference Materials for Cystic Fibrosis
Genetic Testing, J. Mol. Diagnostics, 11:186-193 (2009).
[0144] Amplification of a selected, or target, nucleic acid
sequence may be carried out by any suitable means on DNA isolated
from biological samples. See generally D. Kwoh and T. Kwoh, 1990.
Examples of suitable amplification techniques include, but are not
limited to, polymerase chain reaction, ligase chain reaction,
strand displacement amplification (see generally Walker et al.,
1992a; Walker et al., 1992b), transcription-based amplification
(see Kwoh et al., 1989), self-sustained sequence replication (or
"35R") (see Guatelli et al., 1990), the Q.beta. replicase system
(see Lizardi et al., 1988), nucleic acid sequence-based
amplification (or "NASBA") (see Lewis, 1992), the repair chain
reaction (or "RCR") (see Lewis, supra), and boomerang DNA
amplification (or "BDA") (see Lewis, supra). Polymerase chain
reaction is currently preferred.
[0145] DNA amplification techniques such as the foregoing can
involve the use of a probe, a pair of probes, or two pairs of
probes which specifically bind to DNA encoding ApoE 4, but do not
bind to DNA encoding ApoE 2 or ApoE 3 under the same hybridization
conditions, and which serve as the primer or primers for the
amplification of the ApoE 4 DNA or a portion thereof in the
amplification reaction. Likewise, one may use a probe, a pair of
probes, or two pairs of probes which specifically bind to DNA
encoding ApoE 2, but do not bind to DNA encoding ApoE 3 or ApoE 4
under the same hybridization conditions, and which serve as the
primer or primers for the amplification of the ApoE 2 DNA or a
portion thereof in the amplification reaction; and one may use a
probe, a pair of probes, or two pairs of probes which specifically
bind to DNA encoding ApoE 3, but do not bind to DNA encoding ApoE 2
or ApoE 4 under the same hybridization conditions, and which serve
as the primer or primers for the amplification of the ApoE 3 DNA or
a portion thereof in the amplification reaction.
[0146] Similarly, one may use a probe, a pair of probes, or two
pairs of probes which specifically bind to DNA encoding a TOMM40
haplotype of interest, but do not bind to other TOMM40 haplotypes
under the same hybridization conditions, and which serve as the
primer or primers for the amplification of the TOMM40 DNA or a
portion thereof in the amplification reaction.
[0147] In general, an oligonucleotide probe which is used to detect
DNA encoding ApoE and/or TOMM40 haplotypes is an oligonucleotide
probe which binds to DNA encoding the haplotype of interest, but
does not bind to DNA encoding other haplotypes under the same
hybridization conditions. The oligonucleotide probe is labeled with
a suitable detectable group, such as those set forth below in
connection with antibodies.
[0148] Polymerase chain reaction (PCR) may be carried out in
accordance with known techniques. See, e.g., U.S. Pat. Nos.
4,683,195; 4,683,202; 4,800,159; and 4,965,188. In general, PCR
involves, first, treating a nucleic acid sample (e.g., in the
presence of a heat stable DNA polymerase) with one oligonucleotide
primer for each strand of the specific sequence to be detected
under hybridizing conditions so that an extension product of each
primer is synthesized which is complementary to each nucleic acid
strand, with the primers sufficiently complementary to each strand
of the specific sequence to hybridize therewith so that the
extension product synthesized from each primer, when it is
separated from its complement, can serve as a template for
synthesis of the extension product of the other primer, and then
treating the sample under denaturing conditions to separate the
primer extension products from their templates if the sequence or
sequences to be detected are present. These steps are cyclically
repeated until the desired degree of amplification is obtained.
Detection of the amplified sequence may be carried out by adding to
the reaction product an oligonucleotide probe capable of
hybridizing to the reaction product (e.g., an oligonucleotide probe
of the present invention), the probe carrying a detectable label,
and then detecting the label in accordance with known techniques,
or by direct visualization on a gel.
[0149] When PCR conditions allow for amplification of all ApoE
allelic types, the types can be distinguished by hybridization with
allelic specific probe, by restriction endonuclease digestion, by
electrophoresis on denaturing gradient gels, or other techniques. A
PCR protocol for determining the ApoE genotype is described in
Wenham et al. (1991), incorporated by reference herein. Examples of
primers effective for amplification and identification of the ApoE
isoforms are described therein. Primers specific for the ApoE
polymorphic region (whether ApoE 4, E3 or E2) can be employed. In
Wenham, for example, PCR primers are employed which amplify a 227
bp region of DNA that spans the ApoE polymorphic sites (codons 112
and 158, which contain nucleotides 3745 and 3883). The amplified
fragments are then subjected to restriction endonuclease CfoI which
provides different restriction fragments from the six possible ApoE
genotypes which may be recognizable on an electrophoresis gel. See
also, Hixon et al. (1990); Houlston et al. (1989) Wenham et al.
(1991); and Konrula et al. (1990) for additional methods, all of
which are incorporated by reference herein.
[0150] In addition to Alzheimer's disease, there are several other
genetically complex diseases and disorders for which the methods of
the present invention provide advantages over existing analyses.
For example, data from multiple type 2 diabetes mellitus genetic
studies support the view that very large clinical case/control
series will be necessary to provide statistical significance for
loci defined by genome-wide association studies.
7. Active Agents, Compositions and Treatment
[0151] As noted above, phylogenetic trees created using the methods
detailed herein may also be analyzed based upon responsiveness of
the condition of interest to treatment with an active agent or
treatment method of interest according to some embodiments, and
treatment decisions for a subject or patient may be based upon
specific genetic variants identified.
[0152] Active agents. Active agents include those known for
treatment of a condition of interest, and are inclusive of
anti-Alzheimer's disease active agents, including, but are not
limited to, acetylcholinesterase inhibitors, NMDA receptor
antagonists, and peroxisome proliferator-activated receptor (PPAR)
agonists or modulators, including but not limited to those drugs in
the thiazolidinedione or glitazar classes. The active agent could
also be a biopharmaceutical product, for example an antibody (e.g.,
monoclonal, polyclonal, derivatives of or modified antibodies such
as Domain Antibodies.TM., Bapineuzumab, etc.), fusion proteins or
therapeutic RNA molecules. The active agent could also be a
combination of any of these products.
[0153] Examples of acetylcholinesterase inhibitors include, but are
not limited to, donepezil (commercially available as ARICEPT),
galantamine (commercially available as RAZADYNE), and rivastigmine
(commercially available as EXELON) and the pharmaceutically
acceptable salts thereof. Additional examples include, but are not
limited to, those described in U.S. Pat. Nos. 6,303,633; 5,965,569;
5,595,883; 5,574,046; and 5,171,750 (the disclosures of all U.S.
Patent references cited herein are to be incorporated by reference
herein in their entirety).
[0154] Examples of NMDA receptor antagonists include, but are not
limited to, memantine (commercially available as AKATINOL, AXURA,
EBIXIA/ABIXIA, MEMOX and NAMENDA) and the pharmaceutically
acceptable salts thereof. Additional examples include, but are not
limited to, those described in U.S. Pat. Nos. 6,956,055; 6,828,462;
6,642,267; 6,432,985; and 5,990126.
[0155] Examples of thiazolidinediones include, but are not limited
to, rosiglitazone (commercially available as AVANDIA) and the
pharmaceutically acceptable salts thereof. Additional examples
include, but are not limited to:
5-(4-[2-(N-methyl-N-(2-benzothiazolyl)amino)ethoxy]benzyl)-2,4-thiazolidi-
ne dione;
5-(4-[2-(N-methyl-N-(2-benzothiazolyl)amino)ethoxy]benzylidene)--
2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-(2-benzoxazolyl)amino)ethoxy]benzyl)-2,4-thiazolidine-
dione;
5-(4-[2-(N-methyl-N-(2-benzoxazolyl)amino)ethoxy]benzylidene)-2,4-t-
hiazolidinedione;
5-(4-[2-(N-methyl-N-(2-pyrimidinyl)amino)ethoxy]benzyl)-2,4-thiazolidined-
ione;
5-(4-[2-(N-methyl-N-(2-pyrimidinyl)amino)ethoxy]benzylidene)-2,4-thi-
azolidinedione;
5-(4-[2-(N-methyl-N-[2-(4,5-dimethylthiazolyl)]amino)
ethoxy]benzyl)-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4,5-dimethylthiazolyl)]amino)
ethoxy]benzylidene)-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-(2-thiazolyl)amino)ethoxy]benzyl)-2,4-thiazolidinedio-
ne; 5-(4-[2-(N-methyl-N-(2-thiazolyl)amino)
ethoxy]benzylidene)-2,4-thiazolidinedione;
5-[4-(2-(N-methyl-N-(2-(4-phenylthiazolyl))amino)
ethoxy)benzyl]-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-(2-(4-phenylthiazolyl))amino)
ethoxy]benzylidene)-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4-phenyl-5-methylthiazolyl)]amino)
ethoxy]benzyazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4-phenyl-5-methylthiazolyl)]amino)
ethoxy]benzylidene)-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4-methyl-5-phenylthiazolyl)]amino)ethoxy]benzyl)--
2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4-methyl-5-phenylthiazolyl)]amino)
ethoxy]benzylidene)-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4-methylthiazolyl)]amino)
ethoxy]benzyl)-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4-methylthiazolyl)]amino)
ethoxy]benzylidene)-2,4-thiazolidinedione;
5-[4-(2-(N-methyl-N-[2-(5-phenyloxazolyl)]amino)
ethoxy)benzyl]-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(5-phenyloxazolyl)]amino)
ethoxy]benzylidene)-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4,5-dimethyloxazolyl)]amino)
ethoxy]benzyl)-2,4-thiazolidinedione;
5-(4-[2-(N-methyl-N-[2-(4,5-dimethyloxazolyl)]amino)
ethoxy]benzylidene)-2,4-thiazolidinedione;
5-[4-(2-(2-pyrimidinylamino)ethoxy)benzyl]-2,4-thiazolidinedione;
5-[4-(2-(2-pyrimidinylamino)ethoxy)benzylidene]-2,4-thiazolidinedione;
5-(4-[2-(N-acetyl-N-(2-pyrimidinyl)amino)ethoxy]benzyl)-2,4-thiazolidined-
ione; 5-(4-(2-(N-(2-benzothiazolyl)-N-benzylamino)
ethoxy)benzylidene)-2,4-thiazolidinedione;
5-(4-(2-(N-(2-benzothiazolyl)-N-benzylamino)ethoxy)benzyl)-2,4-thiazolidi-
nedione;
5-(4-[3-(N-methyl-N-(2-benzoxazolyl)amino)propoxy]benzyl)-2,4-thi-
azolidinedione;
5-(4-[3-(N-methyl-N-(2-benzoxazolyl)amino)propoxy]benzylidene)-2,4-thiazo-
lidinedione;
5-(4-[2-(N-methyl-N-(2-pyridyl)amino)ethoxy]benzyl)-2,4-thiazolidinedione-
; 5-(4
[2-(N-methyl-N-(2-pyridyl)amino)ethoxy]benzylidene)-2,4-thiazolidin-
edione;
5-(4-[4-(N-methyl-N-(2-benzoxazolyl)amino)butoxy]benzylidene)-2,4--
thiazolidinedione;
5-(4-[4-(N-methyl-N-(2-benzoxazolyl)amino)butoxy]benzyl)-2,4-thiazolidine-
dione;
5-(4-[2-(N-(2-benzoxazolyl)amino)ethoxy]benzylidene)2,4-thiazolidin-
edione;
5-(4-[2-(N-(2-benzoxazolyl)amino)ethoxy]benzyl)-2,4-thiazolidinedi-
one;
5-(4-[2-(N-isopropyl-N-(2-benzoxazolyl)amino)ethoxy]benzyl)-2,4-thiaz-
olidinedione, and pharmaceutically acceptable salts thereof. See,
e.g., U.S. Pat. No. 5,002,953.
[0156] The active agents disclosed herein can, as noted above, be
prepared in the form of their pharmaceutically acceptable salts.
Pharmaceutically acceptable salts are salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects. Examples of such salts are (a)
acid addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; and salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
(b) salts formed from elemental anions such as chlorine, bromine,
and iodine, and (c) salts derived from bases, such as ammonium
salts, alkali metal salts such as those of sodium and potassium,
alkaline earth metal salts such as those of calcium and magnesium,
and salts with organic bases such as dicyclohexylamine and
N-methyl-D-glucamine.
[0157] Active agents can be administered as prodrugs. "Prodrugs" as
used herein refers to those prodrugs of the compounds of the
present invention which are, within the scope of sound medical
judgment, suitable for use in contact with the tissues of humans
and lower animals without undue toxicity, irritation, allergic
response and the like, commensurate with a reasonable risk/benefit
ratio, and effective for their intended use, as well as the
zwitterionic forms, where possible, of the compounds of the
invention. The term "prodrug" refers to compounds that are rapidly
transformed in vivo to yield the parent compound of the above
formulae, for example, by hydrolysis in blood. A thorough
discussion is provided in T. Higuchi and V. Stella, Prodrugs as
Novel delivery Systems, Vol. 14 of the A.C.S. Symposium Series and
in Edward B. Roche, ed., Bioreversible Carriers in Drug Design,
American Pharmaceutical Association and Pergamon Press, 1987, both
of which are incorporated by reference herein. See also U.S. Pat.
No. 6,680,299 Examples include a prodrug that is metabolized in
vivo by a subject to an active drug having an activity of active
compounds as described herein, wherein the prodrug is an ester of
an alcohol or carboxylic acid group, if such a group is present in
the compound; an acetal or ketal of an alcohol group, if such a
group is present in the compound; an N-Mannich base or an imine of
an amine group, if such a group is present in the compound; or a
Schiff base, oxime, acetal, enol ester, oxazolidine, or
thiazolidine of a carbonyl group, if such a group is present in the
compound, such as described in U.S. Pat. Nos. 6,680,324 and
6,680,322.
[0158] Compositions. The active agents described above may be
formulated for administration in a pharmaceutical carrier in
accordance with known techniques. See, e.g., Remington, The Science
And Practice of Pharmacy (9.sup.th Ed. 1995). In the manufacture of
a pharmaceutical formulation according to the invention, the active
compound (including the physiologically acceptable salts thereof)
is typically admixed with, inter alia, an acceptable carrier. The
carrier must, of course, be acceptable in the sense of being
compatible with any other ingredients in the formulation and must
not be deleterious to the patient. The carrier may be a solid or a
liquid, or both, and is preferably formulated with the compound as
a unit-dose formulation, for example, a tablet, which may contain
from 0.01 or 0.5% to 95% or 99% by weight of the active compound.
One or more active compounds may be incorporated in the
formulations of the invention, which may be prepared by any of the
well known techniques of pharmacy comprising admixing the
components, optionally including one or more accessory
ingredients.
[0159] The formulations of the invention include those suitable for
oral, rectal, topical, buccal (e.g., sub-lingual), vaginal,
parenteral (e.g., subcutaneous, intramuscular, intradermal, or
intravenous), topical (i.e., both skin and mucosal surfaces,
including airway surfaces) and transdermal administration, although
the most suitable route in any given case will depend on the nature
and severity of the condition being treated and on the nature of
the particular active compound which is being used.
[0160] Formulations suitable for oral administration may be
presented in discrete units, such as capsules, cachets, lozenges,
or tablets, each containing a predetermined amount of the active
compound; as a powder or granules; as a solution or a suspension in
an aqueous or non-aqueous liquid; or as an oil-in-water or
water-in-oil emulsion. Such formulations may be prepared by any
suitable method of pharmacy which includes the step of bringing
into association the active compound and a suitable carrier (which
may contain one or more accessory ingredients as noted above). In
general, the formulations of the invention are prepared by
uniformly and intimately admixing the active compound with a liquid
or finely divided solid carrier, or both, and then, if necessary,
shaping the resulting mixture. For example, a tablet may be
prepared by compressing or molding a powder or granules containing
the active compound, optionally with one or more accessory
ingredients. Compressed tablets may be prepared by compressing, in
a suitable machine, the compound in a free-flowing form, such as a
powder or granules optionally mixed with a binder, lubricant, inert
diluent, and/or surface active/dispersing agent(s). Molded tablets
may be made by molding, in a suitable machine, the powdered
compound moistened with an inert liquid binder.
[0161] Formulations suitable for buccal (sub-lingual)
administration include lozenges comprising the active compound in a
flavored base, usually sucrose and acacia or tragacanth; and
pastilles comprising the compound in an inert base such as gelatin
and glycerin or sucrose and acacia.
[0162] Formulations of the present invention suitable for
parenteral administration comprise sterile aqueous and non-aqueous
injection solutions of the active compound(s), which preparations
are preferably isotonic with the blood of the intended recipient.
These preparations may contain anti-oxidants, buffers,
bacteriostats and solutes which render the formulation isotonic
with the blood of the intended recipient. Aqueous and non-aqueous
sterile suspensions may include suspending agents and thickening
agents. The formulations may be presented in unit\dose or
multi-dose containers, for example sealed ampoules and vials, and
may be stored in a freeze-dried (lyophilized) condition requiring
only the addition of the sterile liquid carrier, for example,
saline or water-for-injection immediately prior to use.
Extemporaneous injection solutions and suspensions may be prepared
from sterile powders, granules and tablets of the kind previously
described. For example, in one aspect of the present invention,
there is provided an injectable, stable, sterile composition
comprising an active agent(s), or a salt thereof, in a unit dosage
form in a sealed container. The compound or salt is provided in the
form of a lyophilizate which is capable of being reconstituted with
a suitable pharmaceutically acceptable carrier to form a liquid
composition suitable for injection thereof into a subject. The unit
dosage form typically comprises from about 10 mg to about 10 grams
of the compound or salt. When the compound or salt is substantially
water-insoluble, a sufficient amount of emulsifying agent which is
physiologically acceptable may be employed in sufficient quantity
to emulsify the compound or salt in an aqueous carrier. One such
useful emulsifying agent is phosphatidyl choline.
[0163] Formulations suitable for topical application to the skin
preferably take the form of an ointment, cream, lotion, paste, gel,
spray, aerosol, or oil. Carriers which may be used include
petroleum jelly, lanoline, polyethylene glycols, alcohols,
transdermal enhancers, and combinations of two or more thereof.
[0164] Formulations suitable for transdermal administration may be
presented as discrete patches adapted to remain in intimate contact
with the epidermis of the recipient for a prolonged period of time.
Formulations suitable for transdermal administration may also be
delivered by iontophoresis (see, for example, Pharmaceutical
Research 3 (6):318 (1986)) and typically take the form of an
optionally buffered aqueous solution of the active compound.
Suitable formulations comprise citrate or bis\tris buffer (pH 6) or
ethanol/water and contain from 0.1 to 0.2M active ingredient.
[0165] In addition to active compound(s), the pharmaceutical
compositions may contain other additives, such as pH-adjusting
additives. In particular, useful pH-adjusting agents include acids,
such as hydrochloric acid, bases or buffers, such as sodium
lactate, sodium acetate, sodium phosphate, sodium citrate, sodium
borate, or sodium gluconate. Further, the compositions may contain
microbial preservatives. Useful microbial preservatives include
methylparaben, propylparaben, and benzyl alcohol. The microbial
preservative is typically employed when the formulation is placed
in a vial designed for multidose use. Of course, as indicated, the
pharmaceutical compositions of the present invention may be
lyophilized using techniques well known in the art.
[0166] Dosage. The therapeutically effective dosage of any specific
active agent, the use of which is in the scope of present
invention, will vary somewhat from compound to compound, and
patient to patient, and will depend upon the condition of the
patient and the route of delivery. For oral administration, a total
daily dosage of from 1, 2 or 3 mg, up to 30, 40 or 50 mg, may be
used, given as a single daily dose or divided into two or three
daily doses.
[0167] Treatment. Genetic variants as described herein or
discovered using the methods as taught herein may be used to
determine the course of treatment of a patient afflicted with a
condition (e.g., a condition associated with ApoE and/or TOMM40),
by, e.g., determining which active agent and/or course of treatment
to administer based upon the presence or absence of the genetic
variant or variants. The presence or absence of the genetic
variants may indicate efficacy of an active agent and/or course of
treatment for the patient, predict age of onset for a condition,
indicate preferred dose regimens, etc. A genetic profile may be
generated for a patient, and the profile consulted to determine
whether the patient is among a group of patients that are likely to
be responsive to a particular active agent.
[0168] Instructions for use may be packaged with or otherwise
associated with an active agent indicating recommendations for
treatment, time to treatment, dose regimens, etc., based upon the
presence or absence of the genetic variants.
8. Methods of Determining a Prediction of Disease Risk or a
Prognosis
[0169] To determine a prediction of disease risk for a
non-symptomatic individual or a prognosis (the prospect of
affliction or disease course as anticipated from the usual course
of disease or peculiarities of the case) according to some
embodiments of the present invention, diagnostic data, including
the patient's diagnosis or medical history and genetic data, such
as the patient's genotype (e.g., ApoE and/or TOMM40 genotype), may
be processed to provide therapeutic options and outcome
predictions. Processing may include obtaining a "patient profile"
such as the collection of a patient's medical history including age
and gender, genotyping of the loci of interest (e.g., using
appropriately designed primers and using an RT-PCR or PCR
amplification step and/or phenotyping, e.g., using an
antibody-mediated method or enzymatic test), and statistical or
other analyses that converts this raw data into a prognosis. The
prognosis may include a prediction of a patient's age of disease
onset, response to drug therapy, time to treatment, treatment
efficacy, etc. In some embodiments, the prognosis may include the
use of a computer software program to analyze patient data and run
statistical cross-checks against relational databases in order to
convert the patient data or profile to a prognosis.
[0170] A "patient profile" includes data and/or materials
pertaining to the patient for whom the predictive and/or prognostic
analysis is being performed. Data may include information on the
patient's diagnosis, age, gender, and/or genotype. The patient
profile may also include materials from the patient such as blood,
serum protein samples, cerebrospinal fluid, or purified RNA or
DNA.
9. Genotype Stratification in Clinical Trials
[0171] Detection of a genotype taught herein or as determined with
the methods herein can be used in conducting a clinical trial in
like manner as other genotype information is used to conduct a
clinical trial, such as described in, e.g., U.S. Pat. Nos.
6,573,049 6,368,797 and 6,291,175.
[0172] In some embodiments, such methods advantageously stratify or
permit the refinement of the patient population (e.g., by division
of the population into one or more subgroups) so that advantages of
particular treatment regimens can be more accurately detected,
particularly with respect to particular sub-populations of patients
with particular genotypes. In some embodiments, such methods
comprise administering a test active agent or therapy to a
plurality of subjects (a control or placebo therapy typically being
administered to a separate but similarly characterized plurality of
subjects) and detecting the presence or absence of a genotype
(e.g., ApoE and/or TOMM40) as described above in the plurality of
subjects. The genotype may be detected before, after, or
concurrently with the step of administering the test therapy. The
influence of one or more detected alleles on the test therapy can
then be determined on any suitable parameter or potential treatment
outcome or consequence, including, but not limited to, the efficacy
of said therapy, lack of side effects of the therapy, etc.
[0173] A clinical trial can be set up to test the efficacy of test
compounds to treat any number of diseases for which a particular
genotype has been determined to be associated, for subjects who are
diagnosed with the disease or are at risk for developing the
disease. If subjects are genotyped after the completion of a
clinical trial, the analyses may still be aimed at determining a
relationship between a treatment for a disease and the allele to be
assessed for efficacy. Alternatively, if a symptomatic or
asymptomatic subject has not yet been diagnosed with the disease
but has been determined to be at risk of developing the disease, a
similar clinical trial to the clinical trial described above may be
carried out.
[0174] The underlying biological mechanisms may also be considered
when designing the treatment groups. For example, the ApoE 4
(1-272) fragment binds to mitochondria, decreases mitochondrial
cellular dynamics and decreases synaptogenesis more than ApoE 3
(1-272). Rosiglitazone, a drug candidate for the treatment of
Alzheimer's disease, increases mitogenesis and increases
synaptogenesis--opposing the effects of ApoE fragment binding--for
ApoE 3 greater than with ApoE 4. Therefore, the drug or treatment
candidate (e.g., rosiglitazone) may be selected based upon an
underlying mechanism of action as it relates to the genetic markers
used for the stratifications (e.g., ApoE 2, E 3, E 4 and/or TOMM40
variants).
[0175] Assessment of the efficacy of a drug chosen for the trial
may include monitoring the subject over a period of time and
analyzing the delay of onset of the disease and the intensity of
the disease at the time of onset, as well as measuring the onset of
symptoms which are associated with the disease. A drug that, in a
clinical trial, eliminates or delays the onset of the disease, or
reduces the symptoms of the disease may be a beneficial drug to use
in patients diagnosed with the disease or at risk of developing the
disease. Test compounds which may be used in such trials include
the agents as described above, including those previously approved
for clinical use and new compounds not yet approved for use, or
approved for treating a particular disease. Thus, in some
embodiments the clinical trial may include the optimization of drug
administration, including dosage, timing of administration,
toxicities or side effects, route of administration, and efficacy
of the treatment.
10. Kits Useful for the Detection of Genotype Variants at Loci of
Interest
[0176] Kits for determining if a subject is at increased risk of
developing a disease, developing a disease at an earlier age of
onset, and/or a candidate for a particular treatment, where the
disease is associated with ApoE and/or TOMM40 (e.g., late onset
Alzheimer's disease), are provided herein. The kits include at
least one reagent specific for detecting for the presence or
absence of an ApoE and/or TOMM40 variant as described herein, and
may include instructions to aid in determining whether the subject
is at increased risk of developing the disease. The kit may
optionally include a nucleic acid for detection of an ApoE gene
(e.g., ApoE 2, ApoE 3 and/or ApoE 4) or instructions for
isoelectric focusing methods for detecting the ApoE genotype;
and/or a nucleic acid for detection of a TOMM40 variant as
described herein. In some embodiments, the kit may optionally
include one or more antibodies which binds to ApoE 2, ApoE 3, ApoE
4, or to isoforms of TOMM40. The test kit may be packaged in any
suitable manner, typically with all elements in a single container
along with a sheet of printed instructions for carrying out the
test.
[0177] In some embodiments, the kit may optionally contain buffers,
enzymes, and reagents for amplifying the genomic nucleic acids via
primer-directed amplification. The kit also may include one or more
devices for detecting the presence or absence of particular
haplotypes in the amplified nucleic acid. Such devices may include
one or more probes that hybridize to a haplotype nucleic acid,
which may be attached to a bio-chip or microarray device, such as
any of those described in U.S. Pat. No. 6,355,429. The bio-chip or
microarray device optionally has at least one capture probe
attached to a surface that can hybridize to a haplotype sequence.
In preferred embodiments, the bio-chip or microarray contains
multiple probes, and most preferably contains at least one probe
for a haplotype sequence which, if present, would be amplified by a
set of flanking primers. For example, if five pairs of flanking
primers are used for amplification, the device would contain at
least one haplotype probe for each amplified product, or at least
five probes. The kit also preferably includes instructions for
using the components of the kit.
[0178] The present invention is explained in greater detail in the
following non-limiting Examples.
Example 1: Construction of Phylogenetic Trees
[0179] All of the known genome-wide scanning studies demonstrate
extremely significant p values around the apolipoproteinC1
[ApoC1]locus. (Mahley et al., Proc. Natl. Acad. Sci. USA 103:
5644-51 (2006), Coon et al., J. Clin. Psychiatry 68: 613-8 (2007);
Li et al., Arch. Neurol. 65: 45-53 (2007)). Of equal importance is
that each series identified a "favored" borderline significant
candidate gene outside of the ApoE linkage disequilibrium area, but
these favored candidate genes were different in each study. TOMM40
is near ApoC1 and in linkage disequilibrium with ApoE. Interactions
between ApoE 3 or ApoE 4 and different TOMM40 isoforms are believed
to be associated with increased or decreased risk of developing
Alzheimer's disease within an earlier age range. Age of onset
curves for Apo 4/4, 3/4, 3/3, 2/4, and 2/3 genotypes is shown in
FIG. 2, indicating a range of risk for earlier development of the
disease, depending upon the ApoE profile. ApoE alone does not
appear to explain all of the data in these age of onset curves,
however.
[0180] Various methods for polymorphic profiling of Alzheimer's
disease risk associated with the different ApoE alleles have been
proposed (see, e.g., U.S. Application of Cox et al., No.
20060228728; U.S. Application of Li and Grupe, No. 20080051318). A
phylogenetic approach to the ApoE 4 puzzle is demonstrated
herein.
[0181] Biological samples, DNA isolation, amplification of loci of
interest. A total of 340 subjects included 135 Alzheimer's disease
cases and 99 age-matched controls in Group A as well as 57 cases
and 49 controls in Group B. All subjects carried the ApoE genotypes
previously associated with higher risk for earlier disease onset
(i.e. 3/3, 3/4, or 4/4). Biological samples containing DNA were
collected from all subjects. Genomic DNA was then isolated
according to conventional methods for sequencing of genetic loci on
Chromosome 19.
[0182] FIG. 3 shows the genetic regions on Chromosome 19 targeted
for study using genome-wide scanning data from multiple reports.
The region is encompassed within GenBank reference sequence
AF050154. Software was used to generate multiple sequence
alignments for variant loci (e.g., ClustalW2, European
Bioinformatics Institute). Subsequently, the multiple sequence
alignments were analyzed using software for developing phylogenetic
trees (e.g., MEGA version 2.1, Center for Evolutionary Functional
Genomics, TREEVOLVE, Department of Zoology, University of Oxford,
or parsimony-based construction software such as PAUP, Sinauer
Associates). Statistical analyses may be performed with, e.g.,
Genetic Data Analysis (GDA: Software for the Analysis of Discrete
Genetic Data, The Bioinformatics Research Center of North Carolina
State University). The results of Region B analysis are
demonstrated in the phylogenetic tree of FIG. 4.
[0183] Each piece of data in FIG. 4 represents an observed sequence
variant. These variants may be nucleotide substitutions,
insertions, deletions, or microsatellites and may or may not result
in detectable differences in gene expression or protein function.
Each node represents a variant (or a number of variants) that
occurs on more than one chromosome. Adjacent nodes define the
boundaries of sequences that are in cis, and therefore more likely
to be inherited as a unit, in the region of interest on a subject's
chromosome. Nodes that precede the greatest number of subsequent
nodes represent evolutionarily ancestral variants from which
genetic divergence has occurred over time.
[0184] The presence of haplotypes or sequence variants
corresponding with regions of the tree representing subjects with
substantially higher incidence of Alzheimer's disease (i.e., higher
ratios of subjects affected with the disease to unaffected control
subjects) would mean that the individual subject is also at
increased risk. Conversely, substantially lower ratios correspond
to reduced risk of developing Alzheimer's disease.
[0185] TOMM40 interacts with ApoE directly in regulation of
mitochondrial protein import, and a present hypothesis is that the
expression of a particular TOMM40 variant(s) exacerbates the
relatively moderate risk for Alzheimer's disease associated with
the dose-dependent presence of the ApoE 3 allele. Such a TOMM40
variant is discovered within Region B using the methods of the
present invention.
[0186] Testing new drugs on human subjects carries immense risk
(see Kenter and Cohen, Lancet, 368: 1387-91 (2006)). The use of
phylogenetic trees to anticipate individual response to a drug or
treatment of interest has potential to alleviate that risk
significantly. Preliminary studies indicated that rosiglitazone
(Avandia) may have genetic-profile specific efficacy in the
treatment of Alzheimer's disease (see Risner et al., The
Pharmacogenomics Journal 6, 246-254 (2006); Brodbeck et al., Proc.
Nat. Acad. Sci. 105, 1343-6 (2008)). Phase II clinical trial data
indicate that Alzheimer's disease patients without an ApoE 4 allele
responded better to rosiglitazone than patients who carry either 1
or 2 ApoE 4 alleles (data not shown). This supports the hypothesis
that variants identified with the methods taught herein may be used
to anticipate individual response to treatment based upon
genotype.
Example 2: Identification of TOMM40 Variants of Interest
[0187] 174 sequences (2 from each of 87 subjects) were aligned
using the CLUSTAL X program (version 2.0.10, Larkin et al., Clustal
W and Clustal X version 2.0. Bioinformatics, 23:2947-2948 (2007)).
The multiple sequence alignment was used to construct a
phylogenetic tree using a neighbor joining algorithm (Saitou and
Nei, The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol. Evol. Biol., 4:406-425 (1987)) as
implemented on the European Bioinformatics Institute (EBI)
website.
[0188] The resulting phylogenetic tree has a structure of two major
groups (A, B) at the first divergence. The ApoE genotype
frequencies for these groups are tabulated and shown in FIG. 5. It
is clear that group B contains subject-haplotypes of primarily
.epsilon.3/.epsilon.3 and .epsilon.3/.epsilon.4 ApoE genotypes and
almost no .epsilon.4/.epsilon.4. Group A contains almost all of the
subject haplotypes with the .epsilon.4/.epsilon.4 genotype.
[0189] The list of polymorphisms generated by the SNP discovery
platform (Polymorphic) were used to identify specific variants in
the TOMM40 gene that separated the data into the two groups. A
likelihood ratio test was used to identify significant variants
with a p value less than 0.005.
[0190] The list of variants is summarized in Table 1. In the table,
the term "deletion" is used when the minor allele is a deletion of
a nucleotide, and the term "insertion" is used when the minor
allele is an addition of a nucleotide. The term "deletion/insertion
polymorphism" is used when there are more than two possible forms
and the minor allele is not apparent. For example, for the poly-T
polymorphisms, there are multiple length polymorphisms observed.
The second column of the table provides information on the
identities of the specific alleles associated with the variant that
divide the sequences into the two groups. For example, T>A
indicates that the T allele segregates sequences into group "A" on
the phylogenetic tree. When two alleles are listed, e.g. G>B;
A>A, each allele uniquely segregates the sequence data into the
two groups, while when a single allele is listed it is associated
with the predominate separation of the data, and the remaining
allele does not uniquely separate the data into a homogenous group,
but instead a mixture of both groups.
TABLE-US-00001 TABLE 1 TOMM40 variants associated with groups on
phylogenetic tree that distribute by ApoE genotype. Genomic
Location UCSC (NCBI Classi- Variant Allele > tree group Build
36.3) Function fication 50,092,565 T > A 50,092,565 Intron 6
single 50,092,587 T > A 50,092,587 Intron 6 single rs8106922 G
> B; A > A 50,093,506 Intron 6 single rs34896370, T12_C_T15,
50,093,609 Intron 6 complex rs55821237, T12_C_T16, rs56290633
T13_C_T14, T13_C_T15, T13_C_T16 > A; T14_C_T14, T14_C_T15 > B
rs34878901 T > B; C > A 50,094,317 Intron 6 single rs35568738
C > B 50,094,558 Intron 6 single rs10602329 T16, 17, 18 > A
50,094,716 Intron 6 insertion/ T14, 15 > B deletion 50,094,733
->A 50,094,733 Intron 7 insertion rs10524523 T12, 14, 15,
50,094,889 Intron 6 insertion/ 16, 17 > B deletion T21, 22, 26,
27, 28, 29, 30, 31, 32, 33, 34 35, 36 > A rs1160985 T > B; C
> A 50,095,252 Intron 6 single 50,095,506 T > A 50,095,506
Intron 6 single rs760136 A > A; G > B 50,095,698 Intron 6
single rs1160984 T > B 50,095,764 Intron 6 single rs741780 C
> B; T > A 50,096,271 Intron 8 single rs405697 A > A
50,096,531 Intron 9 single 50,096,647 ->A 50,096,647 Intron 9
deletion (DIP3) 50,096,697 C > A 50,096,697 Intron 9 single
rs1038025 C > B; T > A 50,096,812 Intron 9 single rs1038026 G
> B; A > A 50,096,902 Intron 9 single rs1305062 C > B; G
> A 50,097,361 Intron 9 single rs34215622 G > B; ->A
50,098,378 Exon 10 insertion rs10119 A > A 50,098,513 Exon 10
single rs7259620 G > A; A > B 50,099,628 unknown single
Example 3: Two Distinct Forms of ApoE 3: Those Linked to TOMM40
Haplotypes that Increase Risk and Decrease Age of Onset, and Those
that Decrease Risk
[0191] The association of apolipoprotein E (ApoE) genotypes,
particularly ApoE .epsilon.4 (ApoE 4), with the risk and age of
onset of Alzheimer's disease (AD) remains the most confirmed
genetic association for any complex disease. Estimates of the
heritability of ApoE 4 for late onset AD range from 58% to 79%, and
the population attributable risk due to the ApoE 4 allele is
between 20% and 70%. These estimates suggest that other genetic
variants and/or interactions between variants incur additional
disease risk and modify age of onset distributions.
[0192] Genome wide scan association results for AD have
consistently reproduced the extraordinary association of the LD
region containing ApoE. TOMM40, the protein translocase of the
outer mitochondrial membrane, is in high LD with ApoE, and codes
for the membrane channel through which cytoplasmic peptides and
proteins traverse in order to synthesize new mitochondria. Our
objectives were to identify additional haplotypes within the LD
region that increase the estimates of heritability.
[0193] Methods: We examined the LD region containing both ApoE and
TOMM40 using deep (10.times.) primary sequencing in AD patients and
controls. We performed phylogenetic analyses of the LD region
covering TOMM40 and ApoE in 66 patients and 66 age-matched controls
with respect to risk and age of onset distribution.
[0194] Conclusion: We found that unique and distinct inherited
families of different TOMM40 variants are located on the same
genomic interval as ApoE 3, but not on the ApoE 4-containing
genomic interval, and can either increase or decrease the age of
risk distribution of AD. Therefore, the genetic inheritance of
these TOMM40 variants are independent of the inheritance of ApoE 4,
effectively providing a differentiation of two distinct forms of
ApoE 3: those linked to TOMM40 haplotypes that increase risk and
decrease age of onset, and those that decrease risk. These data
increase the accuracy of genetic age of onset risk, dependent on
age, ApoE and
[0195] TOMM40 genotypes and provide the opportunity to define high
risk of AD over the next 5-7 years, versus lower risk of AD.
Example 4: Analysis of Three Identified TOMM40 DIP Variants
[0196] Three of the TOMM40 variants identified in this application
are deletion/insertion polymorphisms (DIPs) located in intron 6 or
intron 9. These DIPs are identified as rs10524523 and rs10602329 in
the National Center for Biotechnology Information dbSNP database,
and a previously undescribed polymorphism, designated as DIP3.
These polymorphisms are located at chr19:50,094,889,
chr19:50,094,731, and chr19:50,096,647, respectively, according to
NCBI build 36. This invention describes the identification of these
DIPs using phylogenetic analysis of the TOMM40 gene, specifically
of a 10 Kb fragment of the gene, and that the DIPs are associated
with different evolutionary groups determined by phylogenetic
analysis. This invention further discloses the utility of these
DIPs for (1) determining risk of a healthy person for developing
Alzheimer's disease in the future, and (2) for predicting age of
onset of AD within an approximately 8 year time-frame.
[0197] The three DIP polymorphisms characterized herein correspond
to different lengths of DIP poly-T repeats in the TOMM40 gene. The
association of DIP poly-T variants with disease risk has
precedence. For example a poly-T variant in intron 8 of the cystic
fibrosis transmembrane conductance regulator (CFTR) gene is
associated with skipping of exon 9 and the development of cystic
fibrosis (Groman et al., Am J Hum Genet 74(1):176-9 (2004)). Herein
is disclosed: (1) use of the novel method--phylogenetic association
analysis (described above)--to identify DIPs that are predictive of
disease risk and/or differences in age of disease onset, (2) the
identity of three specific DIPs associated with differences in AD
age of onset and AD risk, (3) the use of these SNPs individually,
together, or with other sequence variants in TOMM40 or ApoE to
diagnose disease or predict or determine disease characteristics
such as age of disease onset, disease prognosis, disease sub-types,
disease severity, and also to analyze or determine the response to
drugs.
[0198] Phylogenetic analysis reveals the distribution of rs10524523
and rs10602329 DIPs into two different clades. This analysis
reveals that shorter poly-T lengths at these loci map to the
phylogenetically-identified clades in group B, the group that also
comprises higher percentages of ApoE .epsilon.3/.epsilon.3 genotype
subjects, effectively few (0%) ApoE .epsilon.4/.epsilon.4 subjects
and lower case/control ratios (i.e., AD disease risk) (FIG. 5). The
association between DIP length and phylogenetic group is
statistically significant (p<0.0001) by the likelihood ratio
test or Pearson Chi-square test.
[0199] Due to the genomic architecture, the high linkage
disequilibrium and the evolutionary relationships as indicated the
phylogenetic analysis, between the two genes, and the putative
physical interaction between the two gene products, the influence
of TOMM40 genotype is likely to extend to other diseases that are
influenced by ApoE genotype. These diseases include, but are not
limited to, Parkinson's disease, Multiple sclerosis, cardiovascular
disease, dyslipidemia, recovery from traumatic brain injury,
recovery from brain ischemic events, response to anaesthetics, and
response to drugs used to treat AD and the diseases listed
here.
[0200] These polymorphisms could also be used in drug discovery
efforts for the screening of compounds useful for treating diseases
influenced by variations in TOMM40 or ApoE protein or gene
variants.
[0201] In addition, the variants may influence or determine
therapies based on specifically targeted biopharmaceuticals as
exemplified by monoclonal antibodies and siRNA molecules.
[0202] The DIP polymorphisms in TOMM40 that are disclosed herein
can be identified from an individual's DNA sample using many
different molecular nucleotide analysis methodologies, including,
but not limited to, DNA sequencing with the primers denoted in
Table 4 listed below.
Example 5: Longer Poly-T Tracts at rs10524523 are Significantly
Correlated with Earlier Age of Onset of LOAD
[0203] Phylogenetic analysis has been used to identify genomic
relationships between low frequency genetic variants and to cluster
evolutionarily related haplotypes (Hahn et al. Population genetic
and phylogenetic evidence for positive selection on regulatory
mutations at the factor VII locus in humans. Genetics 167, 867-77
(2004)). This methodology was employed to explore the ApoE-TOMM40
LD block for the existence of novel risk determinants for LOAD. In
an exploratory study, 23 Kb of DNA containing the TOMM40 and ApoE
genes were amplified and sequenced, and phase-resolved haplotypes
were determined, for 72 LOAD cases and 60 age-matched controls (Li
et al. Candidate single-nucleotide polymorphisms from a genomewide
association study of Alzheimer disease. Arch Neurol 65, 45-53
(2008)). It was possible to construct a distinct phylogenetic tree
for 10 Kb, encoding exons 2-10, of this region. Two clades (A and
B) were distinguished with strong bootstrap support (98%, 1000
replicates). There was a significant difference in the distribution
of the ApoE genotypes between the two clades of TOMM40 haplotypes
on this phylogenetic tree, suggesting that this region could be
functionally significant. Both clades contained subjects with the
.epsilon.3/.epsilon.3 genotype, but 98% of all clade B haplotypes
occurred in cis with the ApoE .epsilon.3 allele
(P=1.2.times.10.sup.18, Fisher's exact test, two-tailed).
[0204] The phylogenetic structure of this 10 Kb region of TOMM40,
the ApoE .epsilon.3-specific inheritance of particular haplotypes,
and the identify of the clade-specific polymorphisms were
subsequently confirmed in two independent LOAD case/control
cohorts, including one cohort with autopsy-confirmed AD status and
age of disease onset data. The association between the two clades
and disease risk and age of disease onset, where the data was
available, was also explored for these two cohorts. The first
cohort (AS) comprised AD cases (n=74) and controls (n=31)
ascertained at the Arizona Alzheimer's Disease Research Center
(ADRC). The second cohort (DS) was assembled at the Duke Bryan ADRC
and comprised ApoE .epsilon.3/.epsilon.4 subjects only (40
autopsy-confirmed cases with known age of disease onset and 33
controls) (Table 2). Although DNA sequencing was successful for a
subset of the DS cohort who had disease onset from 50 to 68 years
of age, association analyses were limited to a subset of patients
who developed AD after the age of 60.
TABLE-US-00002 TABLE 2 Cohort compositions. The number of cases and
controls, mean age, and percentage that are female are shown for
each series. Mean age is given as age-at-diagnosis of AD for cases
and age-at-examination for controls. The standard deviation from
the mean is given in parenthesis. n % Females Con- Mean Age (SD)
Con- Series Cases trols Cases Controls Cases trols AS 74 31 81.7
(8.01) 77 (8.93) 56.3 46.7 DS 40 33 69.3 (8.3) 71.9 (7.5) 70
66.7
[0205] A phylogenetic tree of similar structure to that generated
in the exploratory study was developed with strong bootstrap
support (97%, 1000 replicates) for the AS cohort. ApoE
.epsilon.4/.epsilon.4 subjects occurred only in clade A (98%
separation between groups, P=2.0.times.10.sup.4 Fisher's exact
test, two-tailed), while the remaining ApoE genotypes were
distributed between clades A and B (FIG. 6). That is, ApoE
.epsilon.4 was always in LD with clade A variants whereas ApoE
.epsilon.3 occurred in both clade A and clade B haplotypes.
Examination of the distribution of the few ApoE
.epsilon.2/.epsilon.4 subjects on the phylogenetic tree suggests
that ApoE .epsilon.2-TOMM40 haplotypes share a similar evolutionary
history with ApoE.epsilon.3-TOMM40 haplotypes (data not shown). To
verify the phylogenetic structure using a separate method, and to
ensure that recombination within the genetic interval did not
confound the phylogenetic tree structure developed for the AS
cohort, haplotype networks were also constructed using statistical
parsimony (TCS version 1.21 (Clement et al. TCS: a computer program
to estimate gene genealogies. Mol Ecol 9, 1657-9 (2000))). The
major subject-haplotype clusters derived from the two methods
(maximum parsimony and TCS) were congruent.
[0206] Clade A was more frequently associated with AD cases than
was clade B (OR=1.44, 95% CI=0.76-2.70). ApoE .epsilon.3/.epsilon.4
heterozygotes (n=36) were analyzed to estimate disease risk
associated with clade A haplotypes while controlling for the effect
of ApoE .epsilon.4. There was a trend to higher incidence of LOAD
for the subset that was homozygous for TOMM40 clade A relative to
the subset that was heterozygous for clade A and clade B (OR=1.36,
95% CI=0.40-4.61) and thus it was postulated that at least some of
the TOMM40 variants which define clade A confer ApoE
.epsilon.4-independent risk of LOAD.
[0207] Analysis of the AS cohort sequence data identified 39
polymorphic sites in the TOMM40 10 Kb region, of which there were
30 parsimony-informative sites (at least two different nucleotides,
each represented in at least two sequences). Of the 30
parsimony-informative sites, 18 had a minor allele frequency
(MAF)>0.10 and six SNPs were outside the boundary of the TOMM40
gene. 10 SNPs occurred exclusively in the context of ApoE
.epsilon.3 (P=6.07.times.10.sup.-5.degree., Fisher's exact test,
two-tailed, n=210) and were never observed in ApoE
.epsilon.4/.epsilon.4 homozygous subjects (n=16). The majority of
the 63-specific TOMM40 variants were located in intronic
regions.
[0208] FIGS. 7A and 7B illustrate the 10 SNPs and 6
insertion/deletion polymorphisms that distinguish TOMM40 clades A
and B (at P<0.001) for the ApoE .epsilon.3/63 subjects from the
AS cohort. These polymorphisms were tested individually and as
haplotypes for association with LOAD risk (Table 3). The odds
ratios for disease risk for each clade B allele, in all cases the
minor allele, suggest that the clade B alleles are protective of AD
risk in the AS cohort, however, in each case the association
narrowly missed significance. To account for the effect of ApoE
.epsilon.4 on the odds ratios reported in Table 3, a balanced set
of 48 AD cases and 48 AD controls was constructed by selecting
sequences at random from ApoE .epsilon.3/.epsilon.4 subjects from
the pooled AS and DS cohorts. Single SNPs again were not
significantly associated with LOAD in this balanced data set.
However, the minor alleles of four of the SNPs (rs8106922,
rs1160985, rs760136, rs741780) that distinguish TOMM40 clade B were
assayed previously in three LOAD case/control genome-wide
association studies and were found to be protective of disease risk
(OR<1 in each case), which is consistent with the trend observed
in our study (Abraham et al. A genome-wide association study for
late-onset Alzheimer's disease using DNA pooling. BMC Med Genomics
1, 44 (2008); Carrasquillo et al. Genetic variation in PCDH11X is
associated with susceptibility to late-onset Alzheimer's disease.
Nat Genet 41, 192-198 (2009); Takei et al. Genetic association
study on in and around the ApoE in late-onset Alzheimer disease in
Japanese. Genomics 93, 441-448 (2009)).
TABLE-US-00003 TABLE 3 Descriptive statistics and allelic and
genotypic association results for the individual SNPs. clade B MAF
MAF MAF LOAD LOAD Control Control SNP ID Position Allele allele
(all) (cases) (controls) (M) (m) (M) (m) All ApoE genotypes
rs1038025 50096812 T/c c 0.31 0.28 0.37 106 41 39 23 rs1038026
50096902 A/g g 0.31 0.28 0.37 106 41 39 23 rs1160985 50095252 C/t t
0.30 0.28 0.37 107 41 39 23 rs1305062 50097361 G/c c 0.28 0.26 0.31
106 38 43 19 rs34215622 50098378 --/g g 0.28 0.26 0.34 110 38 40 21
rs34878901 50094317 C/t t 0.26 0.25 0.28 105 35 44 17 rs7259620
50099628 G/a a 0.30 0.27 0.37 108 40 39 23 rs741780 50096271 T/c c
0.30 0.28 0.37 107 41 39 23 rs760136 50095698 A/g g 0.30 0.28 0.37
107 41 39 23 rs8106922 50093506 A/g g 0.28 0.26 0.31 109 39 43 19
APOE .epsilon.3/e4 rs1038025 50096812 T/c c 0.28 0.25 0.38 68 28 63
33 rs1305062 50097361 G/c c 0.27 0.24 0.38 69 25 64 32 rs34215622
50098378 --/g g 0.28 0.25 0.38 70 26 64 32 rs34878901 50094317 C/t
t 0.24 0.20 0.38 69 25 61 31 rs8106922 50093506 A/g g 0.28 0.25
0.38 70 25 64 32 LOAD LOAD LOAD Control Control Control 95% CI 95%
CI SNP ID (MM) (Mm) (mm) (MM) (Mm) (mm) OR lower upper All ApoE
genotypes rs1038025 40 27 7 11 17 3 0.66 0.35 1.23 rs1038026 40 27
7 11 17 3 0.66 0.35 1.23 rs1160985 40 27 7 11 17 3 0.65 0.34 1.19
rs1305062 43 24 7 13 17 1 0.81 0.42 1.56 rs34215622 42 26 6 12 17 2
0.66 0.35 1.25 rs34878901 45 23 6 15 15 1 0.86 0.44 1.70 rs7259620
41 26 7 11 17 3 0.63 0.33 1.18 rs741780 40 27 7 11 17 3 0.65 0.34
1.19 rs760136 40 27 7 11 17 3 0.65 0.34 1.19 rs8106922 42 25 7 13
17 1 0.81 0.42 1.55 APOE .epsilon.3/e4 rs1038025 22 24 2 17 29 2
0.79 0.43 1.45 rs1305062 25 21 2 17 30 1 0.72 0.39 1.35 rs34215622
24 22 2 17 30 1 0.74 0.40 1.38 rs34878901 25 21 2 18 29 1 0.71 0.38
1.34 rs8106922 25 21 2 17 30 1 0.71 0.38 1.33
[0209] Another polymorphism that distinguished the two clades and,
therefore, two groups of ApoE .epsilon.3 haplotypes, was a poly-T
variant (rs10524523) located in intron 6 of TOMM40. On ApoE
.epsilon.4 chromosomes, the variant was relatively long, with a
narrow, unimodal distribution of lengths (21-30 T residues,
mean=26.78, s.d.=2.60, n=32), whereas on ApoE .epsilon.3
chromosomes, a bimodal distribution of lengths was evident with
peaks at 15.17 (s.d.=0.85, n=36) and 33.15 (s.d.=2.09, n=55) T
residues (FIGS. 8A to 8C). Longer poly-T lengths (T>=27)
segregated almost exclusively into clade A, the higher risk clade,
in the AS cohort (P=7.6.times.10.sup.46, n=210, Fisher's exact
test, two-tailed). The case/control ratio for the category
containing the two, most common, shorter lengths (15 or 16 T
residues) was 1.46 (95% CI=1.25-1.75), and the case/control ratio
for the longer length category (28, 29, 33 and 34 T residues) was
2.02 (95% CI=1.13-2.87). This data showed a trend to an association
between the longer rs10524523 poly-T length and AD (OR=1.38, 95%
CI=0.80-2.39).
[0210] While there were only trends toward association of TOMM40
haplotypes or individual polymorphisms with LOAD for the AS cohort,
there was a significant association between poly-T length category
of rs10524523 and age of LOAD onset. This was tested using the DS
cohort of autopsy-confirmed ApoE .epsilon.3/.epsilon.4 subjects for
whom there was disease onset data. Longer poly-T alleles (>=27 T
residues) were significantly associated with onset of disease at a
much younger age (70.5 years+/-1.2 versus 77.6 years+/-2.1, P=0.02,
n=34) (FIG. 5).
[0211] This polymorphism, therefore, significantly impacted age of
disease onset for individuals who carry an ApoE .epsilon.3 allele.
Three other poly-T length polymorphisms located in intron 6
(rs34896370, rs56290633 and rs10602329) also distinguish clades A
and B, but these polymorphisms were not associated with age of
disease onset. Similarly, there was no relationship between
haplotypes of clade-distinguishing SNPs and age of LOAD, or for the
single SNP, rs8106922, which had been significantly associated with
AD risk in three genome-wide association studies (Abraham et al. A
genome-wide association study for late-onset Alzheimer's disease
using DNA pooling. BMC Med Genomics 1, 44 (2008); Carrasquillo et
al. Genetic variation in PCDH11X is associated with susceptibility
to late-onset Alzheimer's disease. Nat Genet 41, 192-198 (2009);
Takei et al. Genetic association study on in and around the ApoE in
late-onset Alzheimer disease in Japanese. Genomics 93, 441-448
(2009)) (data not shown).
[0212] We conclude that longer poly-T tracts at rs10524523 are
significantly correlated with earlier age of onset of LOAD. The
length of this variant is relatively homogeneous, and relatively
long, on ApoE .epsilon.4 chromosomes, whereas there are two
categories of poly-T lengths linked to ApoE .epsilon.3. ApoE
.epsilon.2 chromosomes also appear to carry variable-length poly-T
repeats similar to .epsilon.3 chromosomes, but further
investigation is needed to verify this preliminary finding and to
determine if the poly-T repeat impacts the very late age of disease
onset for carriers of ApoE .epsilon.2.
[0213] While it is possible that there are other variants that
influence age of onset of LOAD for individuals who are not
homozygous for ApoE .epsilon.4, the length of the poly-T
polymorphism in TOMM40 intron 6 appears to be the most powerful
genetic predictor in this linkage region and should be validated
prospectively. These data suggest that ApoE genotype-stratified age
of onset curves (Corder et al. Gene dose of apolipoprotein E type 4
allele and the risk of Alzheimer's disease in late onset families.
Science 261, 921-3 (1993); Li et al. Candidate single-nucleotide
polymorphisms from a genomewide association study of Alzheimer
disease. Arch Neurol 65, 45-53 (2008)) are, in reality, sets of
curves with each curve reflecting a specific interaction of linked
polymorphisms in ApoE and TOMM40. Therefore, these data add
resolution to the prediction of age of LOAD onset, within a 5-7
year window, for individuals over 60 years of age. The study to
validate the association of ApoE genotypes and TOMM40 haplotypes or
rs10524523 with age of disease onset is currently being planned.
This study will be a prospective, 5 year, population-based study
conducted in several ethnic groups, and will be combined with a
prevention or delay of disease onset drug trial.
Methods
[0214] The two cohorts analyzed in this study were from the Arizona
Alzheimer's Disease Research Center (ADRC), Phoenix, Ariz. and the
Duke Bryan ADRC, Durham, N.C. All subjects were of European
descent. The Arizona and Duke studies were approved by
institutional review boards and appropriate informed consent was
obtained from all participants. Age and gender data for the cases
and controls in each cohort are shown in Table 2. For the Duke
cohort, the age of disease onset was determined retrospectively and
disease diagnosis was confirmed by autopsy.
[0215] Samples were plated on 96 well plates for long-range PCR and
DNA sequencing at Polymorphic DNA Technologies (Alameda,
Calif.).
[0216] Long-range PCR was performed using Takara La. Taq Polymerase
(Takara Mirus Bio). The reaction mix and PCR conditions were the
same as those recommended by the manufacturer. PCR was conducted in
a 50 .mu.L volume with 2.5 U of LA Taq and 200-400 ng human genomic
DNA. Thermocycling was carried out with the following conditions:
94.degree. C., 1 min for 1 cycle; 94.degree. C., 30 sec; 57.degree.
C., 30 sec; 68.degree. C., 9 min for 14 cycles; 94.degree. C., 30
sec; 5TC, 30 sec; 68.degree. C., 9 min+15 sec/cycle for 16 cycles;
72.degree. C., 10 min for 1 cycle. Primers for long-range PCR are
shown in Table 4.
TABLE-US-00004 TABLE 4 Forward and reverse sequencing primers are
listed. The shaded row indicates the forward and reverse primers
used for long-range PCR of R2 (FIG. 2) Forward Primers Reverse
Primers Primer Primer Position in Position in UCSC Primer Cloned
PCR UCSC Primer Cloned PCR Coordinate Product SEQ Coordinate
Product SEQ (of 3'-end (of 3'-end ID (of 3'-end (of 3'-end ID
Sequence of primer) of primer) NO: Sequence of primer) of primer)
NO: AACTCAGAGGCCAGAGATTC 50,092,429 25 1 AACAGCCTAATCCCAGCACAT
50,101,560 9,156 2 TAAGT TTAC CAGGAAACAGCTATGAC 50,092,292 -112 3
CCCACTGGTTGTTGA 50,093,034 630 4 GTGTGATGGTGATTCAAC 50,093,038 634
5 GAATAGGGGCCTTTCA 50,093,282 878 6 CTGCAGGTATGAAAG 50,093,287 883
7 CAATCTCCTAGGGTGC 50,093,512 1108 8 GTCTCTGCAGATGTG 50,093,601
1197 9 CGGAAGTTGCAGTAAG 50,093,706 1302 10 TACTGCAACTTCCGC
50,093,722 1318 11 AAGGTCAAGGTTACACT 50,094,318 1914 12
TCTCTGTTGCCCACG 50,094,289 1885 13 ACAAGCCTAGGTGACAT 50,094,790
2386 14 CCCAACTAATTTTTGTATTCG 50,094,609 2205 15 CCTGTAATCCCAGCTAT
50,095,002 2598 16 ACATTTGTGGCCTGTAC 50,095,129 2725 17
TCATCTCTCTGTGAACCTAA 50,095,324 2920 18 CCACATGGGCTTGTGT 50,095,603
3199 19 GGCAAAATGACGATCAGT 50,095,804 3400 20 CCCAGATGCCCAAATC
50,096,082 3678 21 GCAGCACCAGCTAGT 50,096,218 3814 22
AACTCTGAGTGGATGTG 50,096,471 4067 23 GATGGTCTCAATCTCCTTA 50,096,620
4216 24 CTATAGTCCCAACTACTGA 50,096,730 4326 25 TTTTTTCCAAGCATAAAACA
50,096,863 4459 26 TAGTA AGTCCCCGCTACTTA 50,097,080 4676 27
GGGGATGGACAAAGCT 50,097,268 4864 28 ACCACAGGTGTATGCC 50,097,451
5047 29 TGAAAAGCCCTCTAGAC 50,097,898 5494 30 GAACAGATTCATCCGCA
50,097,864 5460 31 CACCCACGATCCAGTT 50,098,141 5737 32
TGTGGATAGCAACTGGAT 50,098,148 5744 33 CAAAGCCACACTGAAACTT
50,098,231 5827 34 GGGATTCTGAGTAGCA 50,098,469 6065 35
CAGAATCCTGCGT 50,098,526 6122 36 TGCTGCCTTAAGTCCG 50,098,937 6533
37 ACACTTGAGAAAACGG 50,098,797 6393 38 CTGGGGTCAGCTGAT 50,099,350
6946 39 ACAAAGTCCTCTATAGCC 50,099,077 6673 40
TGAAACATCTGGGATTTATAAC 50,099,679 7275 41 TAACCTGGGGTTGGTT
50,099,429 7025 42 CTGGAAACCACAATACC 50,099,990 7586 43
AAGTTCCTTTGCTCATCAG 50,099,829 7425 44 ATCTCGGCTCACTGTA 50,100,261
7857 45 GCAAGAGGGAGACTGT 50,100,207 7803 46 GTCAAAAGACCTCTATGC
50,100,739 8335 47 TGTGCCTGGATGAATGTA 50,100,567 8163 48
AGGACTCCACGAGT 50,101,197 8793 49 TGAGCTCATCCCCGT 50,100,960 8556
50 CCGTGTTCCATTTATGAG 50,101,328 8924 51 GTAAAACGACGGCCAG
50,101,681 9277 52
[0217] PCR products were run on a 0.8% agarose gel, visualized by
crystal violet dye, compared to size standards, cut out of the gel,
and extracted with purification materials included with the TOPO XL
PCR Cloning kit (Invitrogen). Long-range PCR products were cloned
into a TOPO XL PCR cloning vector. This system uses a TA cloning
vector and is recommended for inserts of up to 10 kb. Per the
manufacturer's instructions, electro-competent cells (from the same
kit) were transformed by the vector, plated in the presence of
antibiotic, and incubated. Ten clones from each plate were picked
and cultured in a 96-well format.
[0218] Diluted cultures were transferred to a denaturing buffer
that was part of the TempliPhi DNA Sequencing Template
Amplification kit (GE HealthCare/Amersham Biosciences). This buffer
causes the release of plasmid DNA but not bacterial DNA. Cultures
were heated, cooled, spun, and transferred to fresh plates
containing the TempliPhi enzyme and other components. This mixture
was incubated at 30.degree. C. for 18 hours to promote
amplification of the plasmid templates. These products were then
spun and heated to 65.degree. C. to destroy the enzyme.
[0219] Plasmid templates were used in DNA sequencing reactions
using the Big Dye, version 3.1 sequencing kit (Applied Biosystems).
For each reaction, an appropriate sequencing primer (Table 4) was
used that was designed to anneal to a unique location of the
template. Cycle sequencing was carried out with an annealing
temperature of 50.degree. C., an elongation temperature of
60.degree. C., and a denaturation temperature of 96.degree. C., for
a total of 30 cycles. Sequencing reaction products were run on an
ABI 3730XL DNA sequencer with a 50 cm capillary array using
standard run mode.
[0220] A proprietary sequencing analysis program called `Agent`
(developed by Celera) was used to align sequencing reads to the
appropriate reference sequence, and produce `contigs` associated
with each clone. The system provides estimated quality scores for
all bases for which there is any variation for any of the samples.
The sequencing report for each sample was analyzed for the presence
of SNPs that were correlated in one haplotype pattern for one
subset of clones and in a different haplotype pattern for the
remaining clones. A reference file for the region of interest was
prepared by listing the known variations for that region publicly
available from NCBI dbSNP. A genotype file for the region of
interest was created by searching each subject's haplotype report
for all variations between the known reference sequence and the
consensus haplotype sequences.
[0221] The magnitude of the length-reading error for the poly-T
variants (e.g., rs10524523) was estimated by examining the observed
lengths from the 10 clones that were prepared for samples that had
a single haplotype. For a typical sample with short poly-T length
of 16, the standard deviation for the 10 clones was 0.97. For a
typical sample with longer poly-T length, e.g., 27, the standard
deviation was 1.58.
[0222] Phylogenetic analysis was conducted. A multiple sequence
alignment of the sequences was performed using the ClustalW2
(version 2.0.10) program using default parameters. Manual
adjustment of the alignments was completed using Genedoc (version
2.7.000). Phylogenetic trees were constructed using Bayesian,
maximum likelihood and distance-based reconstructions. The
phylogenetic tree construction software used was Paup* (version
4.0b10), ClustalX2 (neighbor-joining methods, version 2.0.10) and
Mr. Bayes (version 3.1.2).
[0223] Tree-bisection and reconnection branch swapping were used in
all methods. The best fitting model of sequence evolution was
estimated using the Modeltest program (version 3.7) which provided
estimates for the following key determinants: rate matrix, shape of
the gamma distribution and proportion of invariant sites. Bootstrap
analysis was performed using 1000 replicates to determine
statistical support for specific tree morphology.
[0224] Haplotype networks were also constructed from the sequence
data using the program TCS (version 1.21 (Clement et al. TCS: a
computer program to estimate gene genealogies. Mol Ecol 9, 1657-9
(2000))) to compare the phylogenetic trees to cladograms estimated
using statistical parsimony. The phylogenetic trees and haplotype
networks were constructed twice, with gaps treated as missing data
for the first instance and as a fifth character for the second
instance. Nucleotide diversity in the region of interest was
calculated using DnaSP (version 5.00.02 (Librado et al. DnaSP v5: a
software for comprehensive analysis of DNA polymorphism data.
Bioinformatics 25, 1451-2 (2009))).
[0225] After construction of the phylogenetic trees, the haplotype
network, and completion of the analysis of nucleotide diversity in
the region of interest, the results from the different methods were
compared and reconciled to a consensus tree. Groups of sequences
sharing a recent disease mutation were presumed to segregate more
closely on the phylogenetic tree, however, sporadic cases due to
phenocopies, dominance and epistasis can introduce noise into the
phenotype-haplotype relationship (Tachmazidou et al. Genetic
association mapping via evolution-based clustering of haplotypes.
PLoS Genet 3, el 11 (2007)).
[0226] However, sporadic cases due to phenocopies, dominance and
epistasis can introduce noise into the phenotype-haplotype
relationship. This phylogenetic analysis focused on a high-level
aggregation of clades in order to minimize these effects. The
clades determined at the first split in the phylogenetic tree were
used to test the hypothesis that TOMM40 subject-haplotypes from
clade `B` were associated with onset of AD at a later age than
subject-haplotypes from clade `A`, (each subject contributed two
haplotypes to the AD age of onset association signal). The number
of tests of association that are performed using this approach was
orders of magnitude less than in typical genome-wide association
studies since the phylogenetic analysis identified categories of
evolutionarily-related subject-haplotypes. If the tests of
association confirmed that the different clades classified the
subject-haplotype data by age of onset, further statistical
analysis was done to identify the variants that separated the
sequences into each clade. Effectively, this analysis assessed the
significance of each variant as a factor that influences age of
onset using a series of one-degree of freedom tests guided by the
tree structure. The phylogenetic analyses were conducted using
single nucleotide and insertion/deletion polymorphisms. The
statistical tests of association were adjusted with a Bonferroni
correction for the number of polymorphic sites included in the
analysis.
[0227] Haplotype reports from the Polymorphic analysis software and
reports from DnaSP software (version 5.00.02 (Librado et al. DnaSP
v5: a software for comprehensive analysis of DNA polymorphism data.
Bioinformatics 25, 1451-2 (2009))) were used for subsequent
statistical analyses. We analyzed individual TOMM40 SNP variants,
TOMM40 haplotypes and length of poly-T repeats for association with
LOAD risk for the AS cohort and LOAD age of onset for the DS
cohort. Differences in the proportions of specific TOMM40 alleles
associated with each ApoE allele or ApoE genotype were compared
using Fisher's exact test (two-tailed). Starting with 30
parsimony-informative sites and a=0.05, a Bonferroni correction for
the significance of a specific allelic association would require a
P value of 0.001. Odds ratios (OR) were calculated as the (number
of minor alleles in cases/number of minor alleles in
controls)/(number of major alleles in cases/number of major alleles
in controls) and reported with 95% confidence interval. Means for
defined LOAD age of onset groups were compared by t tests,
two-tailed. A standard F test on group variances was performed to
determine whether the t test was calculated assuming equal or
unequal variances. Statistical analysis was completed using JMP
software (version 8, SAS Institute, Cary, N.C.).
[0228] Accession Codes: GenBank: TOMM40, translocase of outer
mitochondrial membrane 40 homolog, 10452; ApoE, apolipoprotein E,
348
[0229] The foregoing is illustrative of the present invention, and
is not to be construed as limiting thereof. The invention is
defined by the following claims, with equivalents of the claims to
be included therein.
Sequence CWU 1
1
52125DNAArtificialLong range PCR primer 1aactcagagg ccagagattc
taagt 25225DNAArtificialLong range PCR primer 2aacagcctaa
tcccagcaca tttac 25317DNAArtificialSequencing primer 3caggaaacag
ctatgac 17415DNAArtificialSequencing primer 4cccactggtt gttga
15518DNAArtificialSequencing primer 5gtgtgatggt gattcaac
18616DNAArtificialSequencing primer 6gaataggggc ctttca
16715DNAArtificialSequencing primer 7ctgcaggtat gaaag
15816DNAArtificialSequencing primer 8caatctccta gggtgc
16915DNAArtificialSequencing primer 9gtctctgcag atgtg
151016DNAArtificialSequencing primer 10cggaagttgc agtaag
161115DNAArtificialSequencing primer 11tactgcaact tccgc
151217DNAArtificialSequencing primer 12aaggtcaagg ttacact
171315DNAArtificialSequencing primer 13tctctgttgc ccacg
151417DNAArtificialSequencing primer 14acaagcctag gtgacat
171521DNAArtificialSequencing primer 15cccaactaat ttttgtattc g
211617DNAArtificialSequencing primer 16cctgtaatcc cagctat
171717DNAArtificialSequencing primer 17acatttgtgg cctgtac
171820DNAArtificialSequencing primer 18tcatctctct gtgaacctaa
201916DNAArtificialSequencing primer 19ccacatgggc ttgtgt
162018DNAArtificialSequencing primer 20ggcaaaatga cgatcagt
182116DNAArtificialSequencing primer 21cccagatgcc caaatc
162215DNAArtificialSequencing primer 22gcagcaccag ctagt
152317DNAArtificialSequencing primer 23aactctgagt ggatgtg
172419DNAArtificialSequencing primer 24gatggtctca atctcctta
192519DNAArtificialSequencing primer 25ctatagtccc aactactga
192625DNAArtificialSequencing primer 26ttttttccaa gcataaaaca tagta
252715DNAArtificialSequencing primer 27agtccccgct actta
152816DNAArtificialSequencing primer 28ggggatggac aaagct
162916DNAArtificialSequencing primer 29accacaggtg tatgcc
163017DNAArtificialSequencing primer 30tgaaaagccc tctagac
173117DNAArtificialSequencing primer 31gaacagattc atccgca
173216DNAArtificialSequencing primer 32cacccacgat ccagtt
163318DNAArtificialSequencing primer 33tgtggatagc aactggat
183419DNAArtificialSequencing primer 34caaagccaca ctgaaactt
193516DNAArtificialSequencing primer 35gggattctga gtagca
163613DNAArtificialSequencing primer 36cagaatcctg cgt
133716DNAArtificialSequencing primer 37tgctgcctta agtccg
163816DNAArtificialSequencing primer 38acacttgaga aaacgg
163915DNAArtificialSequencing primer 39ctggggtcag ctgat
154018DNAArtificialSequencing primer 40acaaagtcct ctatagcc
184122DNAArtificialSequencing primer 41tgaaacatct gggatttata ac
224216DNAArtificialSequencing primer 42taacctgggg ttggtt
164317DNAArtificialSequencing primer 43ctggaaacca caatacc
174419DNAArtificialSequencing primer 44aagttccttt gctcatcag
194516DNAArtificialSequencing primer 45atctcggctc actgta
164616DNAArtificialSequencing primer 46gcaagaggga gactgt
164718DNAArtificialSequencing primer 47gtcaaaagac ctctatgc
184818DNAArtificialSequencing primer 48tgtgcctgga tgaatgta
184914DNAArtificialSequencing primer 49aggactccac gagt
145015DNAArtificialSequencing primer 50tgagctcatc cccgt
155118DNAArtificialSequencing primer 51ccgtgttcca tttatgag
185216DNAArtificialSequencing primer 52gtaaaacgac ggccag 16
* * * * *