U.S. patent application number 17/090746 was filed with the patent office on 2021-03-25 for n-glycosylation.
The applicant listed for this patent is Danmarks Tekniske Universitet, University of Copenhagen. Invention is credited to Carsten Behrens, Eric Bennett, Henrik Clausen, Adnan Fevzi Halim, Shamim Herbert Rahman, Malene Bech Vester-Christensen, Zhang Yang.
Application Number | 20210087587 17/090746 |
Document ID | / |
Family ID | 1000005264033 |
Filed Date | 2021-03-25 |
View All Diagrams
United States Patent
Application |
20210087587 |
Kind Code |
A1 |
Clausen; Henrik ; et
al. |
March 25, 2021 |
N-Glycosylation
Abstract
The present invention relates to a mammalian cell comprising a
gene encoding a polypeptide of interest, wherein the polypeptide of
interest is expressed comprising one or more posttranslational
modification patterns. These modifications are useful for example
in glycoprotein production where the antibodies with the
modifications have an enhanced antibody-dependent cell-mediated
cytotoxicity (ADCC). The present invention also relates to methods
for producing the glycoproteins and compositions comprising the
glycoproteins, and their uses.
Inventors: |
Clausen; Henrik; (Holte,
DK) ; Yang; Zhang; (Vanlose, DK) ; Halim;
Adnan Fevzi; (Malmo, SE) ; Bennett; Eric;
(Kgs. Lyngby, DK) ; Behrens; Carsten; (Copenhagen
N, DK) ; Vester-Christensen; Malene Bech; (Vedb.ae
butted.k, DK) ; Rahman; Shamim Herbert; (Valby,
DK) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Copenhagen
Danmarks Tekniske Universitet |
Kobenhavn K
Kgs. Lyngby |
|
DK
DK |
|
|
Family ID: |
1000005264033 |
Appl. No.: |
17/090746 |
Filed: |
November 5, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15534735 |
Jun 9, 2017 |
10858671 |
|
|
PCT/DK2015/050391 |
Dec 11, 2015 |
|
|
|
17090746 |
|
|
|
|
62091056 |
Dec 12, 2014 |
|
|
|
62193403 |
Jul 16, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 2317/56 20130101;
C12N 2501/24 20130101; C12N 2511/00 20130101; C07K 2317/24
20130101; C07K 16/464 20130101; C12N 2501/724 20130101; C12P 21/005
20130101; C12N 15/907 20130101; C07K 14/505 20130101 |
International
Class: |
C12N 15/90 20060101
C12N015/90; C12P 21/00 20060101 C12P021/00; C07K 14/505 20060101
C07K014/505; C07K 16/46 20060101 C07K016/46 |
Claims
1. (canceled)
2. A mammalian cell, wherein the sialyltransferase genes, St3gal4
and St3gal6 are inactivated in the cell.
3. The cell according to claim 2, wherein the genes are inactivated
using zinc finger nucleases, TALENs, or CRISPR/Cas9.
4. The cell according to claim 2, wherein B3gnt2 is additionally
inactivated.
5. The cell according to claim 2, wherein Fut8 is additionally
inactivated.
6. The cell according to claim 2, wherein mgat4A/4B and/or mgat5
are additionally inactivated.
7. The cell according to claim 6, wherein mgat2 is additionally
knocked out.
8. The cell according to claim 6, wherein ST6GAL1 and/or ST6GAL2
have been knocked in.
9. The cell according to claim 2, wherein mgat4B and mgat5 are
additionally inactivated
10. The cell according to claim 9, wherein mgat2 is additionally
knocked out.
11. The cell according to claim 9, wherein ST6GAL1 and/or ST6GAL2
have been knocked in.
12. The cell according to claim 2, wherein mgat2 is additionally
inactivated.
13. The cell according to claim 12, wherein ST6GAL1 and/or ST6GAL2
has been knocked in.
14. The cell according to claim 2 wherein ST6GAL1 and/or ST6GAL2
has been knocked in.
15. The cell according to claim 14, wherein B3gnt2 is additionally
inactivated.
16. The cell according to claim 2, wherein mgat5 is additionally
inactivated.
17. The cell according to claim 16, wherein the ST6GAL1 and/or
ST6GAL2 has been knocked in.
18. The cell according to claim 2, wherein cosmc is additionally
inactivated.
19. The cell according to claim 2, wherein the cell is a CHO, NS0,
SP2/0, YB2/0, CHO-K1, CHO-DXB11, CHO-DG44, CHO-S, HEK293, HUVEC,
HKB, or PER-C6 cell.
20. The cell according to claim 9, wherein the cell is a CHO
cell.
21. The cell according to claim 2, further comprising EPO, an IgG
antibody, a protein involved in hemostasis, or a coagulation
factor.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S. patent
application Ser. No. 15/534,735, filed on Jun. 9, 2017, which is
the U.S. National Phase Application of PCT International
Application No. PCT/DK2015/050391, filed on Dec. 11, 2015,
designating the United States of America and published in the
English language, which claims the benefit of priority to U.S.
Provisional Application No. 62/091,056, filed on Dec. 12, 2014, and
U.S. Provisional Application No. 62/193,403, filed on Jul. 16,
2015. The disclosures of the above-referenced applications are
hereby expressly incorporated by reference in their entireties.
REFERENCE TO SEQUENCE LISTING
[0002] A Sequence Listing submitted as an ASCII text file vis
EFS-Web is hereby incorporated by reference in accordance with 35
U.S.C. .sctn. 1.52(e). The name of the ASCII text file for the
Sequence Listing is SeqListing-AERA008-003D3.TXT, which was created
on Nov. 5, 2020 and is 16,900 bytes in size.
TECHNICAL FIELD OF THE INVENTION
[0003] The present invention relates to a mammalian cell comprising
a gene encoding a polypeptide of interest, wherein the polypeptide
of interest is expressed comprising one or more posttranslational
modification patterns. These modifications are useful for example
in antibody production where the antibodies with the modifications
have an enhanced antibody-dependent cell-mediated cytotoxicity
(ADCC). These modifications are useful for example in improvement
of pharmacokinetic properties, i.e. by attaching PEG or HEP chains
to proteins. The present invention also relates to methods for
producing the glycoproteins and compositions comprising the
glycoproteins, as well as genome engineering, cell culture, protein
production, and protein glycosylation. and their uses.
BACKGROUND OF THE INVENTION
[0004] Glycoprotein biologics is the fastest growing class of
therapeutics, and most of these can only be produced recombinantly
in mammalian cells with capacity for human-like glycosylation. The
Chinese hamster ovary (CHO) cell has gained a leading role as host
cell for recombinant production of glycoprotein therapeutics mainly
because it produces rather simple N-glycans with branching and
capping similar to what is produced in some human cells.
[0005] Notably, CHO produce complex-type heterogenous N-glycans
with bi-, tri-, and tetraantennary structures with core
.alpha.6Fucose (Fuc), a minor amount of poly-N-Acetyllactosamine
(poly-LacNAc) mainly on the .alpha.1,6 arm of tetraantennary
structures, and exclusive capping of LacNAc with .alpha.2,3 linked
neuraminic acid (NeuAc).
[0006] CHO does not generally produce the non-human and in man
immunogenic capping structures, such as N-glycolylneuraminic acid
(NeuGc) or .alpha.3Gal, although the occurrence of these have been
reported perhaps as a result of gene induction. N-glycosylation may
vary for different proteins as well as for different glycosites in
individual proteins, and e.g. IgG antibodies are produced with
truncated N-glycan structures at the conserved Asn297 glycosite
(biantennary structures with core .alpha.6Fuc, limited LacNAc, and
NeuAc capping).
[0007] A major concern with CHO is the substantial heterogeneity in
N-glycan processing, which can be difficult to control during
bioprocessing and can pose issues for bioactivity as well as
biosafety.
[0008] Thus, a major activity in bioprocessing of therapeutics is
devoted to glycan analysis and control of fermentation to achieve
consistency.
[0009] Substantial efforts in the last two decades have been
devoted to genetic glycoengineering of CHO cells with the aims to
expand the capacity for glycosylation, reduce heterogeneity, and
improve or alter especially sialylation.
[0010] These studies have essentially all used random integration
of cDNAs encoding glycosyltransferases and experienced problems
with stability, consistency, and predictability of the introduced
glycosylation capacity. The major obstacle has been the need to
rely on overexpression of glycosyltransferases and competition with
the endogenous expressed enzymes because of lack of simple methods
to knock these out in cell lines.
[0011] Thus, only very few such glycoengineered CHO cells have
reached production of clinical therapeutics. One successful
glycoengineering strategy has, however, emerged after the discovery
that IgGs without core .alpha.6Fuc on the Asn297 N-glycan exhibits
markedly higher Antibody-Dependent Cell Cytotoxicity (ADCC).
[0012] Thus, through a tour-de-force using two rounds of homologous
recombination both alleles of the fut8 gene encoding the .alpha.
6fucosyltransferase controlling core fucosylation was knocked out
in CHO, and at least one therapeutic IgG produced in CHO without
the fut8 gene is now in clinical use.
[0013] More recently, the fut8 gene was knocked out using precise
gene editing with Zinc finger nuclease (ZFN) gene targeting with a
fraction of time and resources spent.
[0014] The emergence of precise gene editing technologies for
knockout (KO) and knockin (KI) have opened up for an entirely
different level of speed and ease with which stable genetic
manipulation of host cell lines to remove and introduce
glycosyltransferase genes can be achieved, and this will
undoubtedly impact engineering of mammalian host cell factories for
recombinant production of therapeutics.
[0015] Thus, there is a need for mammalian, and especially CHO
cells, that have specific glycosylation patterns with or without
sialylation.
GTf Genes
[0016] Mammalian cells have a large number of glycosyltransferase
genes and over 200 distinct genes have been identified and their
catalytic properties and functions in glycosylation processes
partially determined (Ohtsubo and Marth 2006; Lairson, Henrissat et
al. 2008; Bennett, Mandel et al. 2012; Schachter 2014). These genes
are classified in homologous gene families with related structural
folds in the CAZy database (www.cazy.org). The encoded
glycosyltransferases catalyse different steps in the biosynthesis
of glycosphingolipids, glycoproteins, GPI-anchors, and
proteoglycans (together termed glycoconjugates), as well as
oligosaccharides found in mammalian cells. Enormous diversity
exists in the structures of glycans on these molecules, and
biosynthetic pathways for different types of glycans have been
worked out (Kornfeld and Kornfeld 1985; Tarp and Clausen 2008;
Bennett, Mandel et al. 2012; Schachter 2014), although our
understanding of which glycosyltransferase enzyme(s) that catalyze
a particular linkage in the biosynthesis of the diverse set of
glycoconjugates produced in a mammalian cell is not complete.
Glycosylation in cells is a non-template driven process that relies
on a number of factors many of which are unknown for producing the
many different glycoconjugates and glycan structures with a high
degree of fidelity and differential expression and regulation in
cells. These factors may include: expression of the
glycosyltransferase proteins; the subcellular topology and
retention in the ER-Golgi secretory pathway, the synthesis,
transport into, and availability of sugar nucleotide donors in the
secretory pathway; availability of acceptor substrates; competing
glycosyltransferases; divergence and/or masking of glycosylation
pathways that affect availability of acceptor substrates and/or
result in different structures; and the general growth conditions
and nutritional state of cells.
GTf Isoenzymes
[0017] A number of the glycosyltransferase genes have high degree
of sequence similarity and these have been classified into
subfamilies encoding closely related putative isoenzymes, which
have been shown to or predicted to serve related or similar
functions in biosynthesis of glycans in cells (Tsuji, Datta et al.
1996; Amado, Almeida et al. 1999; Narimatsu 2006; Bennett, Mandel
et al. 2012). Examples of such subfamilies include the polypeptide
GalNAc-transferases (GalNAc-T1 to 20), .alpha.2,3sialyltransferases
(ST3Gal-I to VI), .alpha.2,6sialyltransferases (ST6Gal-I and II),
.alpha.2,6sialyltransferases (ST6GalNAc-I to VI),
.alpha.2,8sialyltransferases (ST8Sia-I to VI),
.beta.4galactosyltransferases (B4Gal-T1 to 7),
.beta.3galactosyltransferases (B3Gal-T1 to 6),
.beta.3GlcNAc-transferases (B3GnT1 to 5),
.beta.6GlcNAc-transferases (C2GnT1-7 and IGnT2A to C),
.beta.4GalNAc-transferases (B4GalNAc-T1 to 4),
.beta.3glucuronyltransferase (B3GlcUA-1 to 3),
.alpha.3/4-fucosyltransferases (FUT1 to 11), O-fucosyltransferases
(O-POFUT 1 and 2), O-glucosyltransferases (O-GLUT 1 and 2),
.beta.4GlcNAc-transferases (MGAT4A to C),
.beta.6GlcNAc-transferases (MGAT5 and 5B), and hyaluronan synthases
(HAS1 to 3) (Hansen, Lind-Thomsen et al. 2014) (See TABLE 1 for
overview of genes and proteins including nomenclature used).
GTf Subfamily Functions
[0018] These subfamilies of isoenzymes are generally poorly
characterized and the functions of individual isoenzymes unclear.
In most cases the function of isoforms are predicted from in vitro
enzyme analysis with artificial substrates and these predictions
have often turned out to be wrong or partially incorrect (Marcos,
Pinho et al. 2004). Isoenzymes may have different or partially
overlapping functions or may be able to provide partial or complete
backup in biosynthesis of glycan structures in cells in the absence
of one or more related glycosyltransferases. It is therefore not
possible to reliably predict how deficiency of a particular gene in
these subfamilies will affect the glycosylation pathways and glycan
structures produced on the different glycoconjugates in a cell and
in-vitro state may not reflect in vivo state. Moreover, even more
isolated glycosyltransferase genes that are not found to be part of
such subfamilies, may have unknown functions in glycosylation or
capacities for such unknown functions in the absence of other
glycosyltransferase genes.
Knowledge from Knockout Animals--Poor Predictability of
Phenotype
[0019] This has been particularly evident in studies of knockout
mice with deficiency in glycosyltransferase genes that are members
of homologous subfamilies, where surprising changes or lack of
apparent changes in glycosylation have been observed (Angata, Lee
et al. 2006).
[0020] For example, mice with targeted elimination of the
.beta.4Galt1 gene encoding the .beta.4Gal-T1 isoenzyme (one of 7
members of .beta.Galactosyltransferase family) demonstrated partial
loss of protein .beta.4galactosylation, with a shift from type 2
chains (Gal .beta.1-4GlcNAc .beta.3-R) to type 1 chain (Gal
.beta.1-3GlcNAc .beta.3-R) (Kotani, Asano et al. 2004). A
corresponding sialylation pattern with repression of dominant
.alpha.2,6 and increased .alpha.2,3sialylation characteristic of
type 1 chains was observed. Phenotypically, the mice survived to
term but exhibited growth retardation and problematic
differentiation of epithelia as well as endocrine insufficiencies
(Asano, Furukawa et al. 1997).
[0021] The same lack of global phenotype is seen when eliminating
single members of the large family of sialyltransferases
responsible for glycan sialylation (Angata, Lee et al. 2006). For
example, mice deficient in sialylation of core 1 O-glycans
catalyzed by the ST3Gal-I enzyme are grossly normal, but exhibit a
marked decrement in the number of CD8+ T cells in peripheral
compartments. ST3Gal-I is one of six other members of the ST3Gal
sialyltransferase family, and mice deficient in other of the family
members are also mostly without gross phenotypes. One exception is
mice lacking ST3Gal-IV that presents with a severe bleeding
disorder due to lack of sialylation and exposed galactose residues
on von Willebrand Factor and hence its clearance from circulating.
In addition these mice present with a leukocyte adhesion defect
with diminished P and E-Selectin ligand activation. Similarly,
elimination of individual polypeptide GalNAc-Ts from the GALNT gene
family that initiates GalNAc-type O-glycosylation only yield very
discrete phenotypes that are often difficult to predict (Bennett,
Mandel et al. 2012). The same is the case for targeted inactivation
of the several GlcNAc-transferases that catalyze the branching of
O-linked glycans. For example loss of Core2 GlcNAc-T1 cause only
few overt abnormalities, although an effect on E-, P-, and
L-selectin functions is seen. Unexpectedly, a compensatory
elongation of core 1 glycans was found in Core2 GlcNAc-TI knock out
mice rescuing the phenotype in high endothelia venules (Stone,
Ismail et al. 2009).
[0022] However, in some cases knockout leads to complete loss of a
particular glycosylation capacity. In the case of O-glycosylation
the core1 synthase, elimination of the C1GALT1, appears to result
in complete loss of elongated core1 O-glycans (Wang, Ju et al.
2010), showing that this particular glycosylation function may only
be carried out by one enzyme. However, detailed analysis of the
function of such isolated genes may often be difficult if the
deficiency leads to early embryonic lethality, as is the case for
knockout of C1GALT1. Another similar example is the elimination of
the GlcCer synthase (UGCG), which cause the elimination of all
complex glycosphingolipids based on LacCer and embryonic lethality
(Jennemann, Sandhoff et al. 2005). This is also the case in the
production of N-linked glycans. In various knockout animals with
complete or almost complete lack of N-linked glycans gross
phenotypes are seen with no or limited viability (Stone, Ismail et
al. 2009). Most pronounced is the effect by loss of the UDP-GlcNAc:
dolichol phosphate N-acetylglucosmaine-1-1phosphate transferase
(GPT) essential for the initiation of the oligosaccharide precursor
in N-linked glycosylation, which causes a complete lack of N-linked
glycosylation and lack of viability beyond embryonic stage E5.5 of
gestation. Similar severe phenotypes are observed by the loss of
Mgat1-/- encoded GnT1 glycosyltransferase that catalyzes the
essential step in conversion of high mannose to hybrid and complex
structures (Ioffe and Stanley 1994; Schachter 2014). The knockout
mice become unviable at midgestation (E9.5-E10.5) with morphogenic
abnormalities including defects in neural tube formation ad
vascularization.
[0023] Elimination of other enzymes functioning in the branching of
N-linked glycans demonstrated murine phenotypes of variable
severity. Elimination of GlcNAc-TII that catalyzes the formation of
complex N-glycans in the subsequent step following GlcNAc-I and
.alpha.Mannosidases, demonstrate limited viability in mice,
although differences has been observed dependent on the genetic
background (Freeze 2001). Interestingly, an unpredicted increased
level of Lewis structures has been observed by a compensatory
increase in bisecting GlcNAc structures catalyzed by GlcNAc-TIII
encoded by Mgat3 (Wang, Schachter et al. 2002). In contrast to the
elimination of Mgat1 and Mgat2 elimination of Mgat3 and Mgat4a
encoding GlcNAc-TIVa are both viable without overt phenotypes. The
phenotype of Mgat4b KO mice is currently unclear. A number of
studies have examined the effect of elimination of Mgat5 encoding
the GlcNAc-V transferase. Although no overt phenotype is observed
in younger mice, it has become clear that GlcNAc-V catalyzed
tetra-antennary glycans are important for the regulation of T-cell
activation, leukocyte recruitment in inflammation, as well as other
signaling pathways. It is thus clear that complete elimination of
core elements of specific glycans causes severe phenotypes, whereas
elimination of branching and trimming enzymes often produce
unpredictable changes in glycan structures and functional
consequences.
[0024] Cross-breeding of knockout mice have resulted in mice
deficient in up to two glycosyltransferase genes. For example,
breeding mice deficient in the sialyltransferases ST8Sia-I (GD3
synthase) and the .beta.4GlcNAcT (GD2 synthase), which are both
important for glycosphingolipid biosynthesis, caused a complete
lack of all types of complex glycosphingolipids. These double
mutant mice were still viable but had a high mortality rate due to
extreme sensitivity to audiogenic induced seizures (Kawai, Allende
et al. 2001). Other examples of targeted elimination of two
glycosyltransferases are the loss of both Fut1 and Fut2. These
double knock out animals present without any clear phenotypes.
Furthermore, mice have been generated with targeted inactivation of
both Fut4 and Fut7. These mice again do not display any obvious
phenotypes, except for a complete lack of E-, P- and L-selectin
ligand activity on leukocytes.
Knowledge from Knockout Cell Lines
[0025] In contrast to our knowledge of the effects of knockout of
glycosyltransferase genes in animals and model organisms, very
little information exist as to the effects of knockout of
glycosyltransferase genes in mammalian cell lines. For human cell
lines only a few spontaneous mutants of glycosyltransferase genes
have been identified. For example the colon cancer cell line LSC
derived from LS174T has a mutation in the COSMC chaperone that
leads to misfolded and non-functional core1 synthase C1GalT (Ju,
Lanneau et al. 2008). COSMC was originally proposed to encode a
core1 synthase glycosyltransferase due to its homology to the
C1GALT1 gene, however, it is now believed to be a private chaperone
for C1GalT required for folding (Wang, Ju et al. 2010). The COSMC
gene is also mutated in the human lymphoblastoid Jurkat cell line
(Ju, Lanneau et al. 2008; Steentoft, Vakhrushev et al. 2011). For
non-human cell lines there is essentially only information from
Chinese hamster ovary (CHO) cell lines, although a similar murine
cancer cell line with spontaneous mutation in the COSMC gene has
been found. A series of CHO cell lines (Lec cell lines) with
deficiency in one glycosyltransferase gene was originally generated
by random mutagenesis follow by lectin selection, and the isolated
lectin-resistant mutant clones were later shown to have defined
mutations in the glycosyltransferase genes MGAT1 (Lec1), MGAT5
(Lec4), and B4GALT1 (Lec20) (Patnaik and Stanley 2006). A number of
the mutant CHO lines have also been found to have mutations in
non-glycosyltransferase genes affecting glycosylation such as
CMP-NANA synthase (Patnaik and Stanley 2006) and C4-Glc/GlcNAc
epimerase (Kingsley, Kozarsky et al. 1986). Most of the CHO lines
with mutations in glycosyltransferase genes have been found to have
partial losses of the relevant glycosylation activity, although
loss of the MGAT5 gene was found to completely abrogate synthesis
of tetraantennary N-glycans (North, Huang et al. 2010). The latter
suggests that only one glycosyltransferase gene encoding
.beta.6GlcNAc-transferase activity leading to tetraantennary
N-glycan branching exist in CHO and that the homologous gene MGAT5C
does not serve as functional backup. The MGAT5C gene has been shown
to be involved in branching of O-Man O-glycans instead, although
some overlapping function could be predicted or expected based on
the sequence similarities of the two MGAT5 genes.
Knockout of Glycosylation Genes in Cell Lines
[0026] The limited information of effects of knockout of
glycosyltransferase genes in cell lines is partly due to past
difficulties with making knockouts in cell lines before the recent
advent of precise gene editing technologies (Steentoft, Bennett et
al. 2014). Thus, until recently essentially only one
glycosyltransferase gene, FUT8, had been knocked out in a directed
approach using two rounds of homologous recombination in a
tour-de-force effort. The conventional gene disruption by
homologous recombination is typically a very laborious process as
evidenced by this knockout of FUT8 in CHO, as over 100,000 clonal
cell lines were screened to identify a few growing FUT8-/- clones
(Yamane-Ohnuki, Kinoshita et al. 2004) (U.S. Pat. No. 7,214,775).
With the advent of the Zinc finger nuclease (ZFN) gene targeting
strategy it has become less laborious to disrupt genes. This was
demonstrated by knockout of the FUT8 gene in a CHO cell line, where
additional two other genes unrelated to glycosylation were also
effectively targeted (Malphettes, Freyvert et al. 2010).
[0027] More recently, the CRISPR/Cas9 editing strategy has emerged
and this editing strategy was also used to knockout the FUT8 gene
(Ronda, Pedersen et al. 2014). Moreover, knockout of the mgat1 gene
was carried out by ZFN targeting in CHO, which rendered the CHO
line incapable of making complex type N-glycans, and all
N-glycoproteins were produced with only high-mannose type
structures (Sealover, Davis et al. 2013) (US20140349341). Finally,
ZFNs have been used to knockout the Ggta1 gene (US 20130004992),
which encodes an .beta.3Gal-T that forms the xenoantigen
Gal.alpha.1-3Gal.beta.1-4GlcNAc epitope that is highly immunogenic
in man because the human GGTA1 gene is a pseudogene and thus this
particular glycostructure does not occur in man. In all the cases
with directed knockout of glycosyltransferase genes the targeted
genes had been shown previously to serve non-redundant unique
functions, and it could be expected with reasonable reliability
that the knockout would result in CHO cells without the particular
glycosylation capacity performed by the encoded enzyme. However, as
discussed previously most glycogenes exist in subfamilies of close
homologs and the cellular function and role in glycosylation of the
encoded isoenzymes of these paralogs are largely unknown and
unpredictable. Furthermore, loss of any glycosylation capacity may
provide acceptor substrates for unrelated and unpredictable
glycosyltransferase producing different glycan structures than
predicted (Holmes, Ostrander et al. 1987).
[0028] It is thus clear that genetic engineering of the
glycosylation genes in mammalian cells and animals are prone to
substantial uncertainty, and thus identifying the optimal
engineering targets for a given protein will require extensive
experimental efforts. Some guide may be found from results of in
vitro determined substrate specificities of recombinant expressed
enzymes, which are most often performed with truncated secreted
forms of the enzymes. While these assays provide general
information of the donor sugar and the most simple acceptor
substrates, these assays often do not provide intricate acceptor
substrate specificities regarding more complex acceptors and the
type of glycoconjugate they work on. A number of isoenzymes have
been shown to function with small artificial acceptor substrates in
in vitro assays or in some cases with large libraries of glycan
acceptors. However, predictions of in vivo functions in cells based
on these studies have often been erroneous as found for e.g.
ST6GalNAc-II (Marcos, Bennett et al. 2011).
[0029] It is worth to note in this context that knock down of
glycosyltransferase genes using different siRNA silencing
strategies largely have produced highly doubtful information. In
general knock down of genes in metabolic pathways where the encoded
enzymes often are not limiting require highly efficient knock down
to produce discernable effects. Furthermore the siRNA technology is
not 100% efficient, which inevitably results in some heterogeneity
of the glycostructures. For production of biopharmaceuticals even a
low % of an undesired glycoform require extensive analysis and
control.
[0030] Moreover, glycosyltransferases are resident ER and Golgi
enzymes with slow turnover, and it is very difficult to
sufficiently reduce enzyme levels to affect glycosylation to a
detectable extend, and it is essentially impossible to completely
abrogate specific glycosylation capacities with siRNA strategies in
mammalian cells.
[0031] Nevertheless, some studies have reported effects of knock
down of glycosylation capacities with resulting biological
phenomena in cells despite residual enzyme levels (often confirmed
by western blots). While some of these studies may have observed
effects related to off-targeting of the silencing strategies used,
it is clear that only complete knockout of the relevant
glycosylation genes can confirm these results unambiguously and
examples of obvious erroneous results have appeared. Knock down of
the GALNT6 gene involved in O-glycosylation of proteins in a breast
cancer cell line resulted in loss of surface expression of the
cancer-associated mucin MUC1 (Bennett, Mandel et al. 2012).
However, MUC1 is expressed on the surface of many cells including
CHO, which do not express the GALNT6, and it is therefore not
likely that partial loss of the encoded GalNAc-T6 enzyme should
have such profound effects on MUC1 expression. Thus, it is clear
that silencing screening strategies are not reliable to probe
cellular in vivo functions of glycosyltransferase genes in order to
identify their role in glycosylation and to evaluate potential
partial or complete functional redundancies in distinct
glycosylation pathways.
Overexpression of Glycosylation Genes in Cell Lines
[0032] Further noteworthy in this context is that transient or
stable overexpression of a glycosyltransferase gene in a cell most
often result in only partial changes in the glycosylation pathways
in which the encoded enzyme is involved. A number of studies have
attempted to overexpress e.g. the core2 C2GnT1 enzyme in CHO to
produce core2 branched O-glycans, the ST6Gal-I sialyltransferase to
produce .alpha.2,6 linked sialic acid capping on N-glycoproteins
(El Mai, Donadio-Andrei et al. 2013), and the ST6GalNAc-1
sialyltransferase to produce .alpha.2,6linked sialic acid on
O-glycoproteins forming the cancer-associated glycan STn (Sewell,
Backstrom et al. 2006). However, in all these studies heterogeneous
and often unstable glycosylation characteristics in transfected
cell lines have been obtained. This is presumably partly due to
competing endogenous glycosyltransferase activities whether acting
with the same substrates or diverging pathway substrates. Other
factors may also explain the heterogeneous glycosylation
characteristics. This includes the availability and competition for
donor substrates and possible interference with other mechanisms
required for the endogenous glycosylation machinery including e.g.
subcellular topology and organization of glycosyltransferases,
coordinated functions of glycosyltransferases, as well as
availability of co-factors, chaperones, and other unknown factors
required for efficient glycosylation.
Function of Glycosylation on Proteins
[0033] Glycosylation of proteins is an essential and highly
conserved process in all mammalian cells, and the repertoire of
glycosyltransferase genes available in mammalian cells is almost
identical with well-defined orthologous relationships clarified
(Hansen, Lind-Thomsen et al. 2014). Only a few glycosyltransferase
genes have been inactivated through evolution in man, such as the
xenoantigen .alpha.3galactosyltransferase gene, GGTA1, and the
Forssman .alpha.3GalNAc-transferase gene, while the human has
gained a few new glycosyltransferase activities by introducing
polymorphisms, such as for the blood group ABO
.alpha.3Gal/GalNAc-transferase gene. Despite these minor
differences in glycosyltransferases acting in the final capping of
glycan structures, most of the glycosylation pathways in mammalian
cells are identical and can be inferred from one mammalian cell to
another with regards to functions of the glycosyltransferases
expressed. Proteins entering the ER-Golgi secretory pathway in
mammalian cells can undergo N-glycosylation as well as a variety of
different types of O-glycosylation (Hansen, Lind-Thomsen et al.
2014). Proteins may also be cleaved and linked by a GPI anchor.
Glycosylation affects proteins in a number of ways. Glycosylation
can direct folding with quality control for ER exit and transport
and secretion, and glycosylation can direct conformation and
function of proteins as well as sensitivity for proteolytic
processing and/or degradation. Glycosylation is particularly
important for recombinant protein therapeutics produced in
mammalian cells, and glycans may affect production of proteins,
provide solubility and stability to proteins, affect bioactivity,
biodistribution and/or circulatory half-life of proteins, and
direct proteins to specific carbohydrate-binding receptors. It is
therefore important to consider the glycosylation capacity of host
cells used for production of recombinant therapeutics for
production of effective therapeutics.
Recombinant Production of Therapeutics
[0034] Glycoprotein biologics is the fastest growing class of
therapeutics (Walsh 2010), and most of these can only be produced
recombinantly in mammalian cells with capacity for human-like
glycosylation. The Chinese hamster ovary cell has gained a leading
role as host cell for recombinant production of glycoprotein
therapeutics mainly because it produces rather simple N-glycans
with branching and capping similar to what is produced in some
human cells (Walsh 2014). Notably, CHO produce heterogeneous
complex-type N-glycans with bi-, tri-, and tetraantennary
structures with core .alpha.6Fucose, a minor amount of
poly-N-Acetyllactosamine (poly-LacNAc) mainly on the .alpha.1,6 arm
of tetraantennary structures, and exclusive capping of LacNAc with
.alpha.2,3-linked neuraminic acid (NeuAc) (North, Huang et al.
2010). CHO does not generally produce the non-human and in man
immunogenic capping structures, such as N-glycolylneuraminic acid
(NeuGc) or .alpha.3Gal, although the occurrence of these may be a
result of gene induction (Bosques, Collins et al. 2010; North,
Huang et al. 2010). N-glycosylation may vary for different proteins
as well as for different glycosites in individual proteins, and
e.g. IgG antibodies are produced with truncated N-glycan
structures. A major concern with CHO is the substantial
heterogeneity in N-glycan processing, which can be difficult to
control during bioprocessing and can pose issues for bioactivity as
well as biosafety. Thus a major activity in bioprocessing of
therapeutics is devoted to glycan analysis and control of
fermentation to achieve consistency (Walsh 2010).
[0035] The generic CHO cell lines produce N-glycans with a variable
mixture of bi, tri, and tetraantennary structures with a high
degree of .alpha.6fucosylation, and a minor degree of poly-LacNAc
structures and capping with .alpha.2,3NeuAc on most glycoproteins
(Sasaki, Bothner et al. 1987). Moreover, some N-glycosylation sites
in proteins may have incomplete stoichiometry. For IgG CHO produces
only biantennary N-glycans with low galactosylation and sialylation
at the conserved Asn297 site.
[0036] O-glycans of the GalNAc-type are produced with the core1
structure with .alpha.2,3NeuAc and partial .alpha.2,6 (to GalNAc)
sialylation (Fukuda, Sasaki et al. 1989), and variable
stoichiometry are also found. A CHO cell line with inactivated
cosmc has been produced and this cell line produce only GalNAc
O-glycans structures (Yang, Halim et al. 2014). O-glycans of other
types have not been studied and it is only known that O-glycans of
the Fuc-type are elongated by LacNAc and capped with
.alpha.2,3NeuAc.
[0037] There are no mammalian cell lines including CHO available
that can produce a single homogenous N-glycan antennae species,
neither biantennary N-glycans, triantennary N-glycans, or
tetraantennary N-glycans. Also lacking are cells that do not
produce small amounts of heterogeneous poly-LacNAc structures on
antennary branches. Moreover, cells capable of producing N-glycans
with homogenous .alpha.2,6NeuAc capping are not available, and most
plasma proteins in human are capped by .alpha.2,6NeuAc and not
.alpha.2,3NeuAc as produced by CHO and many other mammalian cell
lines.
[0038] Genetic engineering of CHO cells with respect to knockout of
glycosyltransferase genes are limited to single isolated genes.
There are no examples of stacked inactivation of multiple
glycosyltransferase genes in mammalian cells including CHO lines.
Moreover, there have been no examples of stacked inactivation of
multiple glycosyltransferase genes encoding isoenzymes with
potential related functions in protein glycosylation. Since many
steps in protein glycosylation involve families of isoenzymes and
their in vivo functions in cells are largely unknown, it is
furthermore not possible to predict which genes to inactivate
and/or introduce to obtain many of the glycosylation capacities
preferred for recombinant glycoprotein therapeutics.
[0039] Substantial efforts in the last two decades have been
devoted to genetic glycoengineering of CHO cells with the aims to
expand the capacity for glycosylation, reduce heterogeneity, and
improve or alter especially sialylation (Sinclair and Elliott 2005;
Walsh and Jefferis 2006). These studies build on decades of work
deciphering the biosynthetic pathways and genes involved in
N-glycosylation (Kornfeld and Kornfeld 1985; Schachter 1991), and
have essentially all used random integration of cDNAs encoding
glycosyltransferases and experienced problems with stability,
consistency, and predictability of the introduced glycosylation
capacity (Kramer, Klausing et al. 2010). The major obstacle has
been the need to rely on overexpression of glycosyltransferases
with resulting competition by endogenous expressed enzymes. It has
been difficult to perform directed knockout of genes in cell lines
in silencing strategies, but for glycosyltransferase genes success
has been achieved with a strategy based on random CHO mutagenesis
followed by lectin-resistant selection (Patnaik and Stanley 2006).
However, these CHO mutant cells in general do not have
glycosylation characteristics preferable for recombinant
therapeutics, they may also contain other unknown mutations in the
CHO genome and none of them have been used for production of
clinical therapeutics.
[0040] The discovery of the importance of core .alpha.6Fucosylation
of the Asn297 N-glycan on IgGs for Antibody-Dependent Cell
Cytotoxicity (ADCC) (Shinkawa, Nakamura et al. 2003), motivated the
need to produce CHO cells with this glycosylation capacity and CHO
lines with inactivated fut8 gene are now available for production
of IgG antibodies. Moreover, CHO lines with inactivation of the
ggtal gene or the mgat1 gene have been generated.
[0041] However, so far engineering of CHO has not been able to deal
with the more common problems of heterogeneity in glycosylation,
insufficient sialylation, and introduction of new glycosylation
capacities such as more human-like sialylation (.alpha.2,6NeuAc).
Currently, the bioprocessing industry of recombinant production of
glycoprotein therapeutics has only the one generic CHO cell line
with its natural glycosylation capacity available for expression
with the exception of the above mentioned examples of which only
the fut8 knockout line is of value for classical therapeutics.
SUMMARY OF THE INVENTION
[0042] The present invention relates to a mammalian cell comprising
a gene encoding a polypeptide of interest, wherein the polypeptide
of interest is expressed comprising one or more posttranslational
modification patterns.
[0043] An object of the present invention relates to a cell
comprising one or more glycosyltransferase genes that have been
inactivated. The cell has new and/or more homogeneous stable
glycosylation capacities.
[0044] In one embodiment of the present invention the cell
comprises two or more glycosyltransferase genes that have been
inactivated.
[0045] In one embodiment of the present invention comprises these
posttranslational modification patterns homogenous biantennary
N-glycans with or without .alpha.2,3NeuAc capping, or with or
without .alpha.2,6NeuAc capping.
[0046] Another object of the present invention relates to a cell
comprising one or more glycosyltransferase genes that have been
introduced stably by site-specific gene or non-site-specific
knockin and with new and/or more homogeneous glycosylation
capacities.
[0047] In one embodiment of the present invention the cell
comprises two or more glycosyltransferase that have been introduced
stably by site-specific or non-site-specific gene knockin.
[0048] An embodiment of the present invention relates to a cell
comprising one or more glycosyltransferase genes introduced stably
by site-specific or non-site-specific gene knockin, and furthermore
comprising one or more endogenous glycosyltransferase genes that
have been inactivated by knockout, and with improved and/or novel
and/or more homogeneous glycosylation capacities.
[0049] A further aspect of the present invention relates to a cell
comprising two or more glycosyltransferase genes encoding
isoenzymes with partial overlapping glycosylation functions in the
same biosynthetic pathway and/or same biosynthetic step
inactivated, and for which inactivation of two or more of these
genes is required for loss of said glycosylation functions in the
cell.
[0050] In one embodiment of the present invention the cell
comprises one or more glycosyltransferase genes inactivated to
block and truncate one or more glycosylation pathways.
[0051] A further aspect of the present invention relates to a cell
comprising two or more glycosyltransferase genes inactivated to
block and truncate one or more glycosylation pathways.
[0052] In one embodiment of the present invention the cell
comprises targeted inactivation of one or more glycosyltransferase
genes for which no transcripts are detectable.
[0053] A further aspect of the present invention relates to a cell
comprising targeted inactivation of one or more glycosyltransferase
genes for which no protein products are detectable.
[0054] Another aspect of the present invention relates to a cell
comprising targeted inactivation of one or more glycosyltransferase
genes for which no protein products with intact cytosolic and/or
transmembrane region is detectable.
[0055] In one embodiment of the present invention the cell is a
mammalian cell or an insect cell.
[0056] In another embodiment of the present invention the cell is
derived from Chinese hamster ovary or from human kidney.
[0057] In a further embodiment of the present invention the cell is
selected from the group consisting of CHO, NS0, SP2/0, YB2/0,
CHO-K1, CHO-DXB11, CHO-DG44, CHO-S, HEK293, HUVEC, HKB, PER-C6,
NS0, or derivatives of any of these cells. In one embodiment of the
present invention is the cell a CHO cell.
[0058] In another embodiment of the present invention the cell
furthermore encodes an exogenous protein of interest.
[0059] In yet another embodiment of the present invention the
protein of interest is an antibody, an antibody fragment, such as a
Fab fragment, an Fc domain of an antibody, or a polypeptide.
[0060] In yet another embodiment of the present invention the
protein of interest is a coagulation factor such as coagulation
factor II (FII), coagulation factor V (FV), coagulation factor VII
(FVIIa), coagulation factor VIII (FVIII), coagulation factor IX
(FIX), coagulation factor X (FX), or coagulation factor XIII
(FXIII).
[0061] In a further embodiment of the present invention is the
antibody is an IgG antibody.
[0062] In one embodiment of the present invention is the
polypeptide erythropoietin (EPO), a protein involved in hemostasis,
including a coagulation factor.
[0063] In another embodiment of the present invention is the
glycosyltransferase any one or more of the genes listed in Table 1,
2 or 3.
[0064] In a further embodiment of the present invention is the
glycosyltransferase that is inactivated a glycosyltransferase gene
that is not involved in the biosynthesis of the glycans on a
particular glycoprotein produced recombinantly in said cell.
[0065] In one embodiment of the present invention are the
glycosyltransferases that are inactivated working in the same
glycosylation pathway.
[0066] In another embodiment of the present invention are the
glycosyltransferases that are inactivated working in the same
glycosylation step.
[0067] In yet another embodiment of the present invention are the
glycosyltransferases that are inactivated working in consecutive
biosynthetic steps.
[0068] In one embodiment of the present invention are the
glycosyltransferases that are inactivated retained in the same
subcellular topology.
[0069] In another embodiment of the present invention are the
glycosyltransferases that are inactivated having similar amino acid
sequence.
[0070] In a further embodiment of the present invention are the
glycosyltransferases that are inactivated belonging to the CAZy
family.
[0071] In yet another embodiment of the present invention are the
glycosyltransferases that are inactivated belonging to same
subfamily of isoenzymes in a CAZy family.
[0072] In one embodiment of the present invention are the
glycosyltransferases that are inactivated having similar structural
retention signals (transmembrane sequence and length).
[0073] In another embodiment of the present invention are the
glycosyltransferase genes functioning in the same glycosylation
pathway inactivated, and wherein they are not involved in the same
glycosylation step.
[0074] In a further embodiment of the present invention are the
glycosyltransferase genes functioning in the same glycosylation
pathway inactivated, and wherein they are involved in the same
glycosylation step.
[0075] In one embodiment of the present invention is the
glycosylation made more homogenous.
[0076] In another embodiment of the present invention is the
glycosylation non-sialylated.
[0077] In yet another embodiment of the present invention is the
glycosylation non-galactosylated.
[0078] In one embodiment of the present invention comprises the
glycosylation biantennary N-glycans.
[0079] In another embodiment of the present invention does the
glycosylation not comprise poly-LacNAc.
[0080] In yet another embodiment of the present invention is the
glycosylation any combination without fucose.
[0081] In a further embodiment of the present invention has FUT8
been knocked out.
[0082] In one embodiment of the present invention has B4galt1 been
knocked out allowing generation of more homogeneous N-glycans
without galactose.
[0083] In another embodiment of the present invention has B4galt1
and fut8 been knocked out allowing generation of more homogeneous
N-glycans without galactose and fucose.
[0084] One aspect of the present invention relates to a method for
inactivation of one or more glycosyltransferase genes in a
mammalian cell, the method comprising the step of inactivation of
one or more glycosyltransferase genes in a mammalian cell, and
determining that said gene inactivation can not result in protein
product with a transmembrane retention signal, and/or stem region,
and/or part of a catalytic domain.
[0085] Another aspect of the present invention relates to a method
for the production of a cell that can generate recombinant
glycoproteins that do not carry specific glycans, the method
comprising the step of inactivation of one or more
glycosyltransferase genes in a cell, wherein the one or more
glycosyltransferase genes are involved in the biosynthesis of the
specific glycans, and determining that said gene inactivation can
not result in protein product with a transmembrane retention
signal, and/or stem region, and/or part of a catalytic domain.
[0086] One aspect of the present invention relates to a method for
producing a glycoproteins having modified glycan profile wherein
the cell producing the glycoprotein has more than one modification
of one or more glycosyltransferase genes.
[0087] In one embodiment of the present invention has the cells
been modified by glycosyltransferase gene knock-out and/or knock-in
of an exogeneous DNA sequence coding for a glycosyltransferase.
[0088] One aspect of the present invention relates to a method for
producing a glycoprotein having a simple glycan profile, the method
comprising inactivation of one or more glycosyltransferases, and/or
knockin of one or more glycosyltransferases, or a combination
hereof in a cell, and expression of a protein in said cell.
[0089] Another aspect of the present invention relates to a method
for generating glycoproteins with improving glycosylation
efficiency, the method comprising the step of inactivation of one
or more glycosyltransferase genes to block and truncate one or more
glycosylation pathways.
[0090] A further aspect of the present invention relates to a
method for the production of recombinant glycoproteins that do not
have specific types of glycosylation, the method comprising the
step of inactivating two or more glycosyltransferase genes to block
and truncate one or more glycosylation pathways.
[0091] One aspect of the present invention relates to a method for
the production of recombinant glycoproteins, comprising the step of
generating a mammalian cell with specific glycosylation
properties.
[0092] A further aspect of the present invention relates to a
glycoprotein obtainable from a method according to the present
invention.
[0093] In one embodiment of the present invention has the
glycostructure outcome one or more of the following changes
selected from the group consisting of simpler glycan structure,
more homogeneous product, more sialic acids per molecule,
non-sialylated, non-galactosylated, more homogeneous bi-antennary,
more homogeneous monoantennary, more homogeneous triantennary, more
homogeneous without poly-LacNAc, higher productivity in cell
culture, new stable homogeneous glycosylation capacities, more
human glycostructure, more homogeneous glycosylation and improved
ADCC targeting of IgG, modified fucose level, no fucose, improved
substrate for generating glycoconjugates.
[0094] One aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
homogeneous glycoconjugate produced from a glycoprotein having a
simplified glycan profile.
[0095] Another aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
homogeneous glycoprotein conjugate comprising a polymer selected
from, PEG, HEP, XTEN, PSA, HES.
[0096] A further aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
homogeneous PEGylated protein conjugate produced from a protein
variant according to the invention having a simplified glycan
profile.
[0097] Another aspect of the present invention relates to a
glycoprotein according to the present invention, which is a protein
conjugate according to the invention comprising FII, FV, FVIIa,
FVIII, FIX, FX, FXIII, a Fab fragment of an antibody, or a Fc
domain of an antibody.
[0098] A further aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
protein-protein conjugate produced from a glycoprotein with a
simplified glycan profile.
[0099] In one embodiment of the present invention is the
glycoprotein according to the present invention a protein-protein
conjugate produced from a glycoprotein with a simplified glycan
profile comprising a Fab fragment and one of either FII, FV, FVIIa,
FVIII, FIX, FX or FXIII.
[0100] In another embodiment of the present invention is the
glycoprotein according to the present invention a protein-protein
conjugate produced from a glycoprotein with a simplified glycan
profile comprising a Fc Domain and one of either FII, FV, FVIIa,
FVIII, FIX, FX or FXIII.
[0101] In a further embodiment of the present invention is the
glycoprotein according to the present invention a homogeneous
PEGylated EPO conjugate produced from an EPO variant having a
simplified glycan profile.
[0102] One aspect of the present invention relates to the use of
recombinant glycoproteins comprising monoantennary N-glycans for
enzymatic modification of polypeptides.
BRIEF DESCRIPTION OF THE FIGURES
[0103] FIG. 1A-F shows ZFN knockout screen in CHO to define key
glycosyltransferase genes involved in N-glycosylation using human
EPO as reporter. FIG. 1A: Graphic depiction of a common
tetraantennary N-glycan with poly-LacNAc on the .beta.6-antenna and
capping by sialic acids. Arrows indicate glycosyltransferase genes
with potential roles in biosynthesis of each step. Designations for
monosaccharides according to the Consortium for Functional
Glycomics are indicated. FIG. 1B: Glycoprofiling of EPO expressed
in CHO GS WT cells. MALDI-TOF spectra of PNGase F released
permethylated N-glycans with labeling of four major species. FIG.
1C Glycoprofiling of EPO expressed in CHO GS cells with KO of genes
involved in tri- and tetraantennary biosynthesis, showing that
triple KO of mgat4A/4B/5 results in homogeneous biantennary
N-glycans with a minor amount of poly-LacNAc (lower panel). FIG. 1D
Glycoprofiling with KO of .beta.4galactosyltransferase genes
involved in LacNAc biosynthesis, showing that only B4galt1 KO alone
produced substantial albeit partial loss of galactosylation, while
only stacked KO of B4galt1/3 resulted in near complete loss of
galactosylation. FIG. 1E Glycoprofiling with KO of two
.beta.3GlcNAc-transferase genes with claimed roles in poly-LacNAc
biosynthesis, showing that KO of B3gnt2 results in complete loss of
poly-LacNAc. FIG. 1F Glycoprofiling with KO of three
.alpha.2,3sialyltransferase genes with claimed roles in
N-glycosylation, showing that only the double KO of st3gal4/6
resulted in complete loss of sialic acid capping.
[0104] FIG. 2A-B shows De novo design of sialylation capacity in
CHO GS by ZFN targeted knockin. FIG. 2A Glycoprofiling of EPO
expressed in WT, double st3gal4/6 KO, and st3gal4/6 KO with ST6GAL1
KI, showing that the range of tetraantannary N-glycan structures
produced in WT CHO regain sialylation to same degree after KI of
ST6GAL1. FIG. 2B Glycoprofiling of EPO with triple mgat4A/4B/5 and
B3gnt2 KO, showing complete loss of poly-LacNAc on biantennary
N-glycans. Glycoprofiling of mgat4A/4B/5 and st3gal4/6 KO without
and with KI of ST6GAL1, showing complete loss of sialic acid
capping on biantennary N-glycans and complete de novo capping by
.alpha.2,6 sialic acid on biantennary N-glycans, respectively.
[0105] FIG. 3 shows graphic depiction of the design matrix for
genetic engineering of CHO N-glycosylation capacity to produce
homogeneous biantennary N-glycans with .alpha.2,3NeuAc capping,
without sialylation, and with .alpha.2,3NeuAc capping on EPO.
Additional KO of fut8 would result in loss of core
fucosylation.
[0106] FIG. 4 shows expression profiling of selected
glycosyltransferase genes by RNAseq in CHO. RNAseq analysis was
performed on two common CHO lines (CHO-K1, CHO-GS) and two
independent CHO GS triple mgat4A/4B/5 KO clones (cl #1, cl #2). The
reported RNAseq analysis of CHO K1 is included, and this was
largely identical to our analyses except that the relative
expression levels were higher. Importantly, a few genes including
mgat4b reported previously not to be expressed in CHO K1, were
found in the present study to be expressed, and mgat4b was found to
be essential for the glycoengineering experiments reported here.
Another important observation was that the expression profiles of
glycogenes in the two triple KO clones analyses were identical to
those of the parental CHO lines, providing evidence that the
precise gene editing does not alter expression of other glycogenes
even for functional compensatory reasons. For more conclusive
evaluation of this we clearly need to obtain broader RNAseq data
for all mutant clones.
[0107] FIG. 5A-B shows Immunocytology of CHO knockout clones with
mutations related to N-glycan branching and poly-LacNAc
biosynthesis. FIG. 5A: The L-PHA lectin was used to specifically
probe .beta.6 branching of N-glycans and only KO of mgat5 produced
(mgat4A/4b/5) altered L-PHA labeling, while the control lectin ConA
binding all types of N-glycans was unaffected. This confirms that
MGAT4A and 4B forms the .beta.4 branch, while MGAT5 forms the
.beta.6 branch, and hence supports the interpretation of the mass
spec data presented in FIG. 1c regarding branch assignments. FIG.
5B: A similar strategy was used to probe for poly-LacNAc with the
LEL, where only KO of B3gnt2 resulted in loss of labeling. This
data also support the interpretation of the mass spec data
presented in FIG. 2 regarding assignment of LacNAc's to biantennary
structures.
[0108] FIG. 6A-B shows immunocytology of CHO knockout clones with
mutations related to LacNAc formation. FIG. 6A: The MAb 1B2 was
used to label presence of LacNAc after removal of sialic acids by
neuraminidase pretreatment. Analysis of KO of B4galt1-4 in CHO GS
WT with heterogeneous branching showed that KO of B4galt1 reduced
labeling, while only stacked KO of B4galt1/3 completely abolished
labeling. FIG. 6B: The same analysis of KO of B4galt1-4 in CHO GS
engineered with homogenous biantennary N-glycans (KO of
mgat4A/4B/5) showed that KO of B4galt1 alone essentially abolished
MAb 1B2 labeling, indicating that .beta.4Gal-T1 is the main enzyme
responsible for galactosylation of biantennary N-glycans. This
finding is expected to have implications for recombinant production
of therapeutic IgGs in CHO, since these proteins in general are
produced with biantennary N-glycans with limited
galactosylation.
[0109] FIG. 7A-B shows immunocytology of CHO knockout and knockin
clones related to sialylation. FIG. 7A: The MAb 1B2 was used to
label exposure of LacNAc as a result of loss of sialylation
capacity, and this demonstrated that KO of st3gal3 and st3gal6 did
not affect labeling substantially, while KO of st3galt4 and stacked
KO of st3galt4/6 resulted in strong labeling. This suggests that
the ST3Gal-IV enzyme is the main sialyltransferase responsible for
.alpha.2,3sialylation of N-glycans. Furthermore, de novo
introduction of human ST6Gal-1 in the stacked st3galt4/6 KO clone
completely abolished MAb 1B2 labeling demonstrating efficient
sialylation by this enzyme. FIG. 7B: To confirm the de novo
introduction of human ST6Gal-1 resulted in .alpha.2,6sialylation we
used the lectin SNA, which did not label CHO WT cells as expected
and only labeled after introduction of ST6GAL1. This result
supports the mass spec interpretations presented in FIG. 2.
[0110] FIG. 8A-B shows analysis of targeted knockin of ST6GAL1 by
junction PCR. FIG. 8A We used a modified Obligare targeted KI
strategy utilizing two inverted ZFN binding sites flanking the
ST6GAL1 gene in donor plasmid. 5 ' and 3' junction PCR confirmed
targeted integration into the Safeharbor #1 site in the CHO clone
with st3gal4/6 KO. FIG. 8B 5 ' and 3' junction PCR confirmed
targeted integration in the CHO clone with st3gal4/6/mgat4A/4B/5
KO. The status of allelic copy number of integration was determined
by WT allelic PCR. The presence of desired band in WT allelic PCR
indicates the presence of Safeharbor #1 site without the
integration of targeted KI of gene of interest on at least one of
the allele. The results showed biallelic integration of st6gal1 to
Safeharbor #1 site in st3gal4/6 KO and monoallelic integration to
mgat4A/4B/5/st3gal4/6 KO, respectively.
[0111] FIG. 9 shows SDS-PAGE Coomassie analysis of purified
recombinant EPO expressed in CHO clones. Approximately 1 .mu.g of
purified EPO based on OD was loaded.
[0112] FIG. 10 shows glycoprofiling of EPO produced in CHO-GS WT,
B3gnt2/mgat4A/4B/5, and st3gal4/6/mgat4A/4B/5 KO with KI of
ST6Gal-I, showing complete loss of poly-LacNAc on biantennary
N-glycans, and complete de novo capping by .alpha.2,6 sialic acid
on biantennary N-glycans without poly-LacNAc. Negative ion ESI-MS
glycoprofilling was used to validate MALDI-TOF based glycan
profiling data.
[0113] FIG. 11A-B shows negative ion ESI-MS/MS of the precoursor
ions as m/z 1183.92 (sialyllated biantennary N-glycan with core
fucose) from EPO produced in CHO with (FIG. 11A) mgat4A/4B/5 KO and
with (FIG. 11B) both mgat4A/4B/5 and st3gal4/6 KO and KI of
ST6Gal-I. The presence of the diagnostic fragmen ions at m/z 306.12
indicates .alpha.2,6 terminal sialylation.
[0114] FIG. 12A-G. A graphic depiction of the human CAZy GT
families involved in the biosynthesis of the major mammalian
glycoconjugates and their different glycosylaton pathways. The
common mammalian glycan structures are depicted for (FIG. 12A)
O-glycans including O-GalNAc, O-GlcNAc, O-Fuc, O-Glc, O-Man, O-Xyl;
(FIG. 12B) N-glycans; (FIG. 12C) GPI-anchors; (FIG. 12D) C-glycans;
(FIG. 12E) glycospingolipids; (FIG. 12F) hyaloronan and (FIG. 12G)
hydroxy-lysine. Designations for monosaccharides according to the
Consortium for Functional Glycomics are indicated.
[0115] FIG. 13 A1-4 and FIG. 13 B-E graphic representation of the
different glycan structures and glycosylation pathways found in CHO
cell lines with designations of glycosyltransferase genes expressed
in CHO cell lines and their predicted role in biostynthic steps.
The genes are assigned to the major confirmed or putative functions
in the O-glycosylation (O-GalNAc (A1), O-Man (A2), and O-Fuc,
O-Glc, O-GlcNAc, O-Xyl (A3)) and N-glycosylation pathways relevant
for recombinant glycoprotein therapeutics today. (FIG. 13A1-4)
O-GalNAc glycosylation pathway with extended core 1, core 2, core
3, and core 4 structures; (FIG. 13B) N-glycosylation pathway; (FIG.
13C) glycosphingolipid biosynthetic pathways; (FIG. 13D) C-glycan,
and (FIG. 13E) GPI-anchors. The CAZy families of
glycosyltransferase (GT genes are notated and GT genes expressed in
CHO cell lines are shown. Glycan structures not synthesized in CHO
are boxed. Designations for monosaccharides according to the
Consortium for Functional Glycomics are indicated.
[0116] FIG. 14A-B Graphic depictions of all genes encoding
isoenzymes with potential to regulate N-glycosylation branching,
elongation, and terminal capping expressed in CHO. The depiction
shows the knockout screen of glycosyltransferase genes involved in
N-glycosylation in CHO using human EPO as recombinant expressed
reporter glycoprotein. (FIG. 14A) The common tetraantennary
N-glycan with poly-LacNAc on the .beta.6-antenna and capping by
sialic acids is shown, the knockout genes are boxed, and genes not
expressed in the CHO cells are annotated. Note that human ST6Gal-I
(ST6GAL1) has been introduced by ZFN-mediated knock-in.
Designations for monosaccharides according to the Consortium for
Functional Glycomics (CFG) are indicated. (FIG. 14B) Schematic
depiction of the actual nuclease targeted regions relative to the
predicted general domain structure of type II glycosyltransferase
proteins (upper panel) and the targeted exon for each gene
numbering the respective genes from first coding exon (lower
panel). The exon structure depiction only includes the first
targeted exons and does not include all exons for all genes.
[0117] FIG. 15 Glycoprofiling of EPO expressed in CHO WT cells.
MALDI-TOF spectra of PNGase F released permethylated N-glycans with
predicted structures for the four major species.
[0118] FIG. 16A-B Glycoprofiling of EPO expressed in CHO cells with
KO of genes involved in complex type N-glycan biosynthesis and
antennary formation, showing that double KO of mgat4B/5 (FIG. 16B)
and triple KO of mgat4A/4B/5 (FIG. 16B) results in homogeneous
biantennary N-glycans with a minor amount of poly-LacNAc. Since
single KO of mgat4A (FIG. 16A) had minor effects compared to WT it
is likely that minor amounts of triantennary structures are present
in the double mgat4B/5 KO.
[0119] FIG. 17 Glycoprofiling with KO of B4galt1/2/3/4 genes
involved in LacNAc biosynthesis, showing that only B4galt1 KO alone
produced substantial albeit partial loss of galactosylation, while
only stacked KO of B4galt1/3 resulted in near complete loss of
galactosylation, while stacked KO of B4galt1/3 resulted in near
complete loss of galactosylation. Stacked KO of B4galt1/2/3
resulted in essentially complete loss of galactosylation.
[0120] FIG. 18A-B Glycoprofiling with KO of three
.beta.3GlcNAc-transferase genes showing that KO of B3gnt2 results
in complete loss of poly-LacNAc, whereas KO of B3gnt1 and B3gnt1
had no effects. Lower PANEL shows that KO of B3gnt2 in combination
with mgat4A/4B/5 results in complete loss of poly-LacNAc on
biantennary structures.
[0121] FIG. 19 Glycoprofiling with KO of three
.alpha.2,3sialyltransferase genes with claimed roles in
N-glycosylation, showing that only the double KO of st3gal4/6
resulted in complete loss of sialic acid capping.
[0122] FIG. 20 Immunoflourescense cytology with ConA and L-PHA
lectin staining showing loss of L-PHA with knockout of mgat5.
[0123] FIG. 21A-B Immunoflourescense cytology with a monoclonal
antibody (clone 1B2) to LacNAc. Panel (FIG. 21A) shows surprisingly
that only stacked KO of B4galt1/3, and not B4galt1/2/4, abolished
galactosylation. Panel (FIG. 21B) shows that KO of B4galt1 in
CHO-GS with KO of mgat4A/4B/5 eliminated immunoreactivity for
LacNAc while KO of B4galt2, 3, and 4 in the same CHO-GS had no
substantial effects.
[0124] FIG. 22 Recombinant expression of a therapeutic IgG in CHO
with KO of B4galt1 resulted in homogenous biantennary N-glycans
without galactosylation. Glycoprofiling of IgG produced in CHO WT
and B4galt1 KO showing essentially complete loss of the incomplete
galactosylation and sialylation characteristic for the conserved
N-glycan at Asn297. KO of B4galt1 in combination with fut8 resulted
in N-glycans without galactosylation and fucose.
[0125] FIG. 23 Immunoflourescense cytology with LEL lectin shows
that B3gnt2 is the key gene controlling the LacNAc initiation in
CHO cells.
[0126] FIG. 24 Immunoflourescense cytology with monoclonal antibody
to LacNAc (1B2). Knockout of St3gal3, St3gal4, and St3gal6
individually using immunocytology to evaluate exposure of LacNAc
shows that only KO of St3gal4 produced substantial exposure of
LacNAc.
[0127] FIG. 25A-B Glycoprofiling of EPO expressed in CHO with KO of
mgat4a/4b/5 and ZFN-mediated knockin of human ST6GAL1. Panel A
(FIG. 25A) shows profiling of EPO with homogenous .alpha.2,6NeuAc
capping of the complete range of N-glycan antennary structures.
Also shown is KI of ST6GAL1 in CHO with KO of mgat4a/4b/5/B3gnt2,
which produced more homogeneous tetraantennary structures. Panel B
(FIG. 25B) shows profiling with additional KO of mgat4a/4b/5 where
EPO is produced with homogenous biantennary N-glycans capped by
.alpha.2,6NeuAc. Also shown are KI of human ST3Gal-4 in combination
with KO of st3gal4/6/mgat4a/4b/5/B3gnt2 where EPO is produced with
homogeneous biantennary N-glycans without poly-LacNAc and capped by
.alpha.2,3NeuAc.
[0128] FIG. 26A-B Negative ion ESI-MS/MS of the precursor ions at
m/z 1183.92 (sialylated biantennary N-glycan with core fucose) from
EPO produced in CHO with (FIG. 26A) Mgat4a/4b/5 KO and with (FIG.
26B) both Mgat4a/4b/5 and st3gal4/6 KO and KI of ST6GAL1. The
presence of the diagnostic fragment ions at m/z 306.12 demonstrates
the presence of .alpha.2,6 terminal sialylation.
[0129] FIG. 27A-B Analysis of targeted KI of ST6GAL1 by junction
PCR. Panel A shows that a modified ObLiGaRe targeted KI strategy
utilizing two inverted ZFN binding sites flanking the ST6GAL1 full
open reading frame in donor plasmid was used. 5' and 3' junction
PCR confirmed targeted integration into the Safeharbor #1 site in
the CHO clone with st3gal4/6 KO. FIG. 27B 5 ' and 3' junction PCR
confirmed targeted integration in the CHO clone with
st3gal4/6/mgat4a/4b/5 KO. The status of allelic copy number of
integration was determined by WT allelic PCR. The presence of
desired band in WT allelic PCR indicates the presence of Safeharbor
#1 site without the integration of targeted KI of gene of interest
on at least one of the allele. The results showed biallelic
integration of ST6Gal-I at Safeharbor #1 site in the CHO st3gal4/6
KO clone and monoallelic integration in the mgat4a/4b/5/St3gal4/6
KO clone. The ObLiGaRe KI strategy was highly efficient with
approximately 30-50% single cloned cells expressing ST6GAL1 as
evaluated by antibody and lectin immunocytology.
[0130] FIG. 28 Graphic depiction of the genetic deconstruction of
N-glycosylation in CHO established using EPO as N-glycoprotein
reporter. Several KO CHO lines have potential for production of
glycoprotein therapeutics with more homogenous glycosylation (e.g.
biantennary .alpha.2,3-sialylated N-glycans for EPO, and
biantennary non-galactosylated/sialylated with and without core Fuc
for IgG. Examples of reconstruction based on KI are shown producing
homogenous .alpha.2,6-sialylation after KO of
.alpha.2,3-sialylation capacities with either WT N-glycan branching
heterogeneity or homogenous biantennary structure, homogeneous
.alpha.2,3-sialylation after KO of endogeneous sialylation, and
homogeneous tetranatennary structures with .alpha.2,6-sialylation
after KO of endogeneous branching and sialylation capacities.
Reconstruction may address homogeneity as shown, but also
branching, poly-LacNAc elongation, and any type of capping as
indicated.
[0131] FIG. 29 Glycoprofiling of EPO expressed in CHO with KO of
Cosmc to eliminate O-GalNAc elongation with Gal and NeuAc showing
improved capacity for sialic acid capping of N-glycans at all three
N-glycosites present in EPO, when compared to WT as shown in FIG.
15.
[0132] FIG. 30A-D Glycoprofiling of EPO expressed in CHO with KO of
B4galT7 to eliminate O-Xyl elongation with Gal (Figure A) and
Pomgnt1 to eliminate O-Man elongation with Gal and NeuAc (Figure B)
showing enhanced capacity for sialic acid capping of N-glycans at
all three N-glycosites present in EPO. Figure C illustrates
glycoprofiling of EPO expressed in double KO of B4galt7 and
pomgnt1, and Figure D illustrates glycoprofiling of EPO expressed
in triple KO of B4galt7, pomgnt1, and cosmc showing the same
improved capacity for sialic acid capping of N-glycans in EPO.
[0133] FIG. 31 Glycoprofiling of EPO expressed in CHO with KO of
B4galT4 to eliminate a galactosyltransferase paralog not utilized
for N-glycans and this glycosylation pathway showing improved
capacity for sialic acid capping of N-glycans at all three
N-glycosites present in EPO.
[0134] FIG. 32 Glycoprofiling of EPO expressed in CHO with KO of
mgat2 showing loss of tetra and triantennary N-glycan structures
and appearance of mono and biantennary N-glycans with galactose and
NeuAc capping (PANEL B), and without sialic acid capping with KO of
st3gal4/6 (PANEL C). Further KO of mgat4A/4B/5 resulted in
monoantennary structures with minor amounts of poly-LacNAc (PANELS
D and E). Reintroduction of human mgat4A and mgat5 in combination
with ST6Gal-I resulted in loss of monoantennary N-glycans and
restoration of tri and tetraantennary structures (PANELS H and
I).
[0135] FIG. 33 SDS-PAGE gel analysis of glycoPEGylation reactions
of recombinant wildtype EPO-Myc-His6 and recombinant EPO-Myc-His6
with monoantennary N-glycans. Lanes contained: (1) HiMark Standard,
(2) ST3Gal3, (3) Sialidase, (4) wt hEPO, wt EPO-Myc-His6
glycoPEGylated with ST3Gal-III and (5) 1.times., (6) 5.times., (7)
10.times., (8) 25.times., (9) 50.times. 10 kDa-PSC reagent
respectively, (10) EPO-Myc-His6 glycosylation variant and
EPO-Myc-His6 glycosylation variant glycoPEGylated with ST3Gal-III
and (11) 1.times., (12) 5.times., (13) 10.times., (14) 25.times.,
(15) 50.times. 10 kDa-PSC reagent. Bands above approximately 160 kD
indicates GlycoPegylation with more than two PEG chains at one or
more N-glycans.
[0136] FIG. 34A-B Quantification of number of attached PEG chains
by densitometry of SDS-PAGE gels. (Figure A) Product profile of
enzymatic 10 kDa-GlycoPEGylation reaction with EPO-Myc-His6
produced in ordinary CHO cell lines. (Figure B) Product profile of
enzymatic 10 kDa-GlycoPEGylation reaction with EPO-Myc-His6
produced in Mgat2/4a/4b/5 KO CHO cell lines. Figures A and B were
obtained by densitometry measurements on lane 9 and lane 15 in FIG.
33, respectively
[0137] FIG. 35 Glycoprofiling of EPO expressed in CHO cells with KO
of B3gnt2 stacked with KO of Cosmc/Pomgnt1/B4galt7 (this latter
triple KO is seen in FIG. 30D) (top panel), double KO of B4galt5
and B4galt6 (second panel), double KO's of Mgat2 and Mgat4B (third
panel) and double KO of Mgat2 and Mgat5 (lower panel). Compared to
background (see FIG. 30D) KO of B3gnt2 abolishes polyLacNac. KO of
B4galt5 and B4galt6 gives more LacNac when comparing with wt EPO
(FIG. 31). The two last panels with double KO's of Mgat2/4b or
Mgat2/5 both show that monoantennary can be obtained with double
KO's so KO of four genes Mgat2/4A/4B/5 is not needed (compare with
FIG. 32D).
[0138] FIG. 36 Glycoprofiling of IgG expressed in CHO cells with KO
of Mgat2 (top), double KO of St3Gal4/6 (middle) or KO of B4galt1/3
stacked onto Cosmc/Fut8 (lower panel). The Mgat2 KO results in
homogeneous mono antennary structure and higher degree of
sialylation than wt IgG (compare with FIG. 22). St3gal4/6 KO gives
higher galactosylation (compare with FIG. 22). Double KO of B4galt1
and B4galt3 show more homogenous N-glycans without galactose than
obtained with single ko of B4galt1 (compare with FIG. 22, lower
panel).
[0139] The present invention will now be described in more detail
in the following.
DETAILED DESCRIPTION OF THE INVENTION
[0140] Sugar chains of glycoproteins are roughly divided into two
types, namely a sugar chain which binds to asparagine
(N-glycoside-linked sugar chain) and a sugar chain which binds to
other amino acid such as serine, threonine (O-glycoside-linked
sugar chain), based on the binding form to the protein moiety.
[0141] The sugar chain terminus which binds to asparagine is called
a reducing end, and the opposite side is called a non-reducing end.
It is known that the N-glycoside-linked sugar chain includes a high
mannose type in which mannose alone binds to the non-reducing end
of the core structure; a complex type in which the non-reducing end
side of the core structure has at least one parallel branches of
galactose-N-acetylglucosamine (hereinafter referred to as
"Gal-GlcNAc") and the non-reducing end side of Gal-GlcNAc has a
structure of sialic acid, bisecting N-acetylglucosamine or the
like; a hybrid type in which the non-reducing end side of the core
structure has branches of both of the high mannose type and complex
type.
[0142] In general, most of the humanized antibodies of which
application to medicaments is in consideration are prepared using
genetic recombination techniques and produced using Chinese hamster
ovary tissue-derived CHO cell as the host cell. As described above,
the sugar chain structure play important roles for the structure,
function, size, circulatory half-life, and pharmacokinetic
behaviour of glycoprotein drugs. Moreover, the sugar structure
plays a remarkably important role in the effector function of
antibodies and differences are observed in the sugar chain
structure of glycoproteins expressed by host cells, development of
a host cell which can be used for the production of an antibody
having higher effector function is desired.
[0143] To support production of a growing number of
biopharmaceutical glycoproteins there is a need for development of
new mammalian cell lines and preferably CHO derived cell lines with
different glycosylation capacities and characteristics.
[0144] Moreover there is a need to develop design matrices for
individual glycosylation pathways involving gene inactivation
and/or stable gene introduction that will enable generation of
tailored mammalian cell lines with different and more homogenous
glycosylation capacities and characteristics.
[0145] Further there is a need to develop mammalian cell lines and
preferably CHO derived cell lines with inactivation of two or more
glycosyltransferase genes that can produce recombinant
glycoproteins with different glycosylation than their natural
counterpart. More particularly there is a need to develop such cell
lines with inactivation of two or more glycosyltransferase genes
encoding isoenzymes with related functions in the same
glycosylation pathway being for example the N-glycosylation
pathway. Further, there is a need to develop such cell lines with
inactivation of two or more glycosyltransferase genes encoding
enzymes with unrelated functions in the same glycosylation
pathway.
[0146] Further there is a need to introduce one or more
glycosyltransferases into cell lines and preferably CHO derived
cell lines to obtain desirable glycosylation capacities including
homogeneous and novel capacities. Such introduction of
glycosyltransferase(s) may be combined with inactivation of one or
more of the endogenous glycosyltransferase genes.
[0147] An object of the present invention is to provide a modified
cell with genetically engineered stable capacity for production of
a therapeutic protein, and that produces said protein with glycan
chains with defined structures, and/or more homogenous glycan
structures, and/or with improved bioactivity.
[0148] This invention discloses an inactivation and deconstruction
screen of glycosyltransferase genes in CHO that provides a design
matrix for engineering a cell with a multitude of well-defined
glycosylation capacities. Moreover the invention provides
reconstruction designs for de novo engineering a multitude of
desired and/or novel well-defined glycosylation capacities by
combining one or more glycosyltransferase gene inactivation and
introduction events in a cell to improve production of recombinant
glycoprotein therapeutics.
[0149] This invention discloses cell lines with inactivation of two
or more glycosyltransferase genes and with new glycosylation
capacities that enables improvements for recombinant production of
protein therapeutics.
[0150] In one aspect, ZFN targeting designs for inactivation of
glycosyltransferase genes are provided.
[0151] In another aspect, TALEN targeting designs for inactivation
of glycosyltransferase genes are provided.
[0152] In yet another aspect, CRISPR/Cas9 based targeting for
inactivation of glycosyltransferase genes are provided.
[0153] In certain embodiments, the invention provides cell lines
with inactivation of two or more glycosyltransferase genes encoding
isoenzymes with partially overlapping glycosylation functions in
the same glycosylation pathway, and for which inactivation of two
or more of these genes is required for loss of said glycosylation
functions in the cell.
[0154] In certain embodiments, the invention provides cell lines
with inactivation of two or more glycosyltransferase genes encoding
isoenzymes with partially overlapping glycosylation functions in
the same glycosylation pathway and biosynthetic step, and for which
inactivation of two or more of these genes is required for loss of
said glycosylation functions in the cell.
[0155] In certain embodiments, the invention provides cell lines
with inactivation of two or more glycosyltransferase genes encoding
isoenzymes with no overlapping glycosylation functions in the same
glycosylation pathway, and for which inactivation of two or more of
these genes is required for loss of said glycosylation functions in
the cell.
[0156] In another embodiment, the invention provides cell lines
with inactivation of two or more glycosyltransferase genes encoding
enzymes with unrelated glycosylation functions in the same
glycosylation pathway, and for which inactivation of two or more
genes is required for abolishing said glycosylation functions in
the cell.
[0157] In another embodiment, the invention provides cell lines
with inactivation of two or more glycosyltransferase genes encoding
enzymes with unrelated glycosylation functions in different
glycosylation pathways, and for which inactivation of two or more
genes is required for desirable glycosylation functions in the
cell.
[0158] In another embodiment, the disclosure provides a design
matrix to identify which glycosyltransferase gene inactivation(s)
that are required for obtaining specific desirable N-glycosylation
capacities in a cell line.
[0159] In another embodiment, the disclosure provides a design
matrix for two or more glycosyltransferase gene inactivation(s)
required for obtaining specific desirable N-glycosylation
capacities in a cell line.
[0160] In yet another embodiment, this invention provides
compositions for partial or complete knockout of
glycosyltransferase genes, individually and in relevant
combinations that encode enzymes involved in biosynthesis of
N-glycans on proteins and are members of homologous subfamilies
with potential redundant functions in a cell line. The disclosed
compositions provide a design matrix for knockout combinations of
glycosyltransferase genes that will generate mammalian cell lines
with a variety of well-defined and homogeneous N-glycosylation
capacities that are useful for production of recombinant
glycoproteins such as antibodies, erythropoietin, and other
therapeutic glycoproteins with improved and/or more consistent
N-glycosylation.
[0161] In yet another embodiment, this invention provides a design
matrix for one or more glycosyltransferase gene inactivation(s)
required for obtaining N-glycosylation capacities in a mammalian
cell line that are useful for recombinant production of
glycoproteins that can be directly modified enzymatically with
galactosyltransferase and/or sialyltransferase enzymes in vitro
post production.
[0162] In yet another embodiment, the disclosure provides a design
matrix for single or multiple glycosyltransferase gene
inactivations required to obtain specific desirable N-glycosylation
capacities that are advantageous for de novo stable introduction of
one or more glycosyltransferases and function of these without
direct competition from endogenous glycosyltransferase activities
in a cell line.
[0163] In yet another embodiment, the disclosure provides a design
matrix for single or multiple glycosyltransferase gene
inactivations required to obtain specific desirable N-glycosylation
capacities that are advantageous for de novo stable introduction of
one or more glycosyltransferases and to induce improved and/or more
homogenous glycosylation properties in a cell line.
[0164] The present inventors have first employed a ZFN-mediated
knockout screen in CHO to explore the potential for engineering
N-glycosylation of recombinant glycoproteins. Many steps in the
N-glycan biosynthetic pathway are potentially catalyzed by multiple
isoenzymes, which leave genetic engineering unpredictable (FIG.
1a). Dissection of the in vivo functions of each of these
isoenzymes is required to construct a matrix for design
options.
[0165] Thus, an object of the present invention is to provide a
cell capable of expressing a gene encoding a polypeptide of
interest, wherein the polypeptide of interest is expressed
comprising one or more of the posttranslational modification
patterns:
a) eliminated .beta.4-branched tetraantennary N-glycans, b)
eliminated .beta.6-branched tetraantennary structures, c)
elimination of L-PHA lectin labelling, d) homogenous biantennary
N-glycans, e) abolished galactosylation on N-glycans, f)
elimination of poly-LacNAc, g) heterogeneous tetraantennary
N-glycans without trace of sialylation, h) biantennary N-glycans
without sialylation, i) lack of sialic acid, j) uncapped LacNAc
termini, k) homogenous biantennary N-glycans capped by
.alpha.2,6NeuAc, l) homogenous .alpha.2,6NeuAc capping, or m)
homogenous biantennary N-glycans capped by .alpha.2,3NeuAc.
[0166] One, two, three, four, five, six, seven, eight, nine, ten,
eleven, twelve, or more of these effect can be combined to generate
specific posttranslational modification patterns.
[0167] The genes involved in this highly complex machinery have
been examined by the present inventors (see the examples) and
effects have been identified.
[0168] Thus, in one aspect of the present invention is one or more
of the group selected from mgat4A, mgat4B, mgat4C, mgat5, mgat5B,
B4galt1, B4galt2, B4galt3, B4galt4, B3gnt1, B3gnt2, B3gnt8,
st3gal3, st3gal4, and st3gal6 involved in the posttranslational
modification patterns.
[0169] In another aspect of the present invention are one or more
of these genes knocked out (KO) or in (KI).
[0170] In one aspect of the present invention mgat4A/4B is knocked
out in the cell to eliminate .beta.4-branched tetraantennary
N-glycans.
[0171] In another aspect of the present invention mgat5 is knocked
out in the cell to eliminate .beta.6-branched tetraantennary
structures.
[0172] In yet another aspect of the present invention mgat5 is
knocked out in the cell leading to loss of L-PHA lectin
labelling.
[0173] In a further aspect of the present invention mgat4A, mgat4B
and mgat5 are knocked out in the cell leading to homogenous
biantennary N-glycans.
[0174] In another aspect of the present invention B4galt1/3 is
knocked out in the cell leading to abolished galactosylation on
N-glycans.
[0175] In a further aspect of the present invention B3gnt2 is
knocked out in the cell leading to elimination of poly-LacNAc.
[0176] In another aspect of the present invention st3gal4 and
st4gal6 are knocked out in the cell leading to heterogeneous
tetraantennary N-glycans without trace of sialylation.
[0177] In another aspect of the present invention st3gal4, st3gal6,
mgat4A, mgat4B, and mgat5 are knocked out in the cell leading to
biantennary N-glycans without sialylation, but increase in
poly-LacNAc.
[0178] In another aspect of the present invention st3gal3, st3gal4,
and st3gal6 are knocked out in the cell leading to complete lack of
sialic acid.
[0179] In yet another aspect of the present invention st3gal4 and 6
are knocked out in the cell leading to uncapped LacNAc termini
thereby allowing de novo engineering of recombinant glycoproteins
with .alpha.2,6NeuAc capping.
[0180] In a further aspect of the present invention are st3gal4,
st3gal6, mgat4A, mgat4B, mgat5 knocked out in the cell leading to
homogenous biantennary N-glycans capped by .alpha.2,6NeuAc.
[0181] In yet another aspect b4galt1 is knocked out in a cell
leading to loss of galactosylation and a homogenous N-glycan on the
conserved N-glycan site of IgG when expressed recombinantly.
[0182] ST6GAL1 introduced (knock in, KI) with KO of st3gal4/6
produces the complete range of N-glycan antennary structures with
normal degree of NeuAc capping (FIG. 2a).
[0183] ST6GAL1 introduced with additional KO of mgat4A/4B/5
produces glycoproteins with homogenous biantennary N-glycans capped
by .alpha.2,6NeuAc (FIG. 2b).
[0184] De novo introduction of ST6GAL1 abrogates the minor amounts
of poly-LacNAc formed on biantennary structures when sialylation is
eliminated (FIG. 2b).
[0185] Thus, KI of ST6GAL1 can be used in combination with any one
or more of the knockouts described herein.
[0186] In the present context is NeuAc also known as neuraminic
acid.
[0187] Thus, an aspect of the present invention relates to a
protein expressed in a cell, wherein the posttranslational
modification pattern comprises homogenous biantennary N-glycans
with or without .alpha.2,3NeuAc capping or with and without
.alpha.2,6NeuAc capping.
[0188] Knockout means full or partial impairment of the function of
the gene of interest.
[0189] In one aspect of the present invention is one or more of the
above mentioned genes knocked out using zinc finger nucleases ZFN.
ZFNs can be used for inactivation of a FUT8 gene or any of the
other genes disclosed herein. ZFNs comprise a zinc finger protein
(ZFP) and a nuclease (cleavage) domain.
[0190] In yet another embodiment, this invention provides CHO cell
lines with different well-defined N-glycosylation capacities that
enable recombinant production of glycoprotein therapeutics with
N-glycans comprised of biantennary N-glycans with or without
poly-LacNAc, and with or without .alpha.2,3NeuAc capping.
[0191] In yet another embodiment, this invention provides cell
lines with different well-defined N-glycosylation capacities that
enable recombinant production of glycoprotein therapeutics with
N-glycans comprised of either biantennary, triantennary, or
tetraantennary N-glycans with or without poly-LacNAc, and with or
without .alpha.2,6NeuAc capping.
[0192] In yet another embodiment, this invention provides cell
lines that enable production of glycoproteins with homogeneous
N-glycans without sialic acid capping, which enables direct
enzymatic modification of N-glycans by sialyltransferases in vitro
postproduction.
[0193] In yet another embodiment, this invention provides cell
lines that enable production of glycoproteins with homogeneous
N-glycans without galactose and sialic acid capping, which enables
direct enzymatic modification of N-glycans by
galactosyltransferases in vitro postproduction.
[0194] In yet another embodiment, this invention provides cell
lines that enable production of glycoproteins with homogeneous
N-glycans of biantennary status without sialic acid capping, which
enables direct enzymatic modification of N-glycans by
sialyltransferases in vitro postproduction.
[0195] In yet another embodiment, this invention provides cell
lines that enable production of glycoproteins with homogeneous
N-glycans of monoantennary status with or without sialic acid
capping, which enables direct enzymatic modification of one
N-glycan by sialyltransferases in vitro postproduction.
[0196] In yet another aspect, also provided is an isolated cell
comprising any of the proteins and/or polynucleotides as described
herein. In certain embodiments, one or more glycosyltransferase
genes are inactivated (partially or fully) in the cell. Any of the
cells described herein may include additional genes that have been
inactivated, for example, using zinc finger nucleases, TALENs
and/or CRISPR/Cas9 designed to bind to a target site in the
selected gene. In certain embodiments, provided herein are cells or
cell lines in which two or more glycosyltransferase genes have been
inactivated, and cells or cell lines in which one or more
glycosyltransferase genes have been inactivated and one or more
glycosyltransferases introduced.
[0197] In yet another embodiment, this invention provides cell
lines with inactivation of undesirable glycosylation pathways for
optimized production of glycoproteins with desirable glycosylation
features. In certain embodiments inactivation of one or more
biosynthetic steps in protein O-glycosylation pathways (O-GalNAc,
O-Xyl, O-Man, and glycolipid) are obtained individually or in
combination to improve the sugar nucleotide pool available for
desirable glycosylation features.
[0198] In one embodiment, this invention provides a cell with
inactivation of the second step in the O-GalNAc glycosylation
pathway, and that produces truncated O-GalNAc O-glycans without
sialic acid capping and with improved capacity for sialic acid
capping of N-glycans.
[0199] In one embodiment, this invention provides a cell with
inactivation of the second step in the O-Xyl glycosylation pathway,
and that produces truncated O-Xyl O-glycans without proteoglycan
chains and with improved capacity for galactosylation, poly-LacNAc,
branching and sialic acid capping of N-glycans.
[0200] In one embodiment, this invention provides a cell with
inactivation of the second step in the O-Man glycosylation pathway,
and that produces truncated O-Man O-glycans without sialic acid
capping and with improved capacity for galactosylation,
poly-LacNAc, branching of N-glycans and sialic acid capping of
N-glycans.
[0201] In one embodiment, this invention provides a cell with
inactivation of the second step in the O-Man, O-Xyl and O-GalNAc
glycosylation pathways, and that produces truncated O-Man, O-Xyl,
and O-GalNAc O-glycans and with improved capacity for
galactosylation, poly-LacNAc, branching of N-glycans and/or sialic
acid capping of N-glycans.
[0202] In one embodiment, this invention provides a cell with
inactivation mgat2, mgat4A, mgat4B, and mgat5, produce
erythropoietin with N-glycans having homogenous monoantennary
structures, and are suitable for more homogeneous
glycomodification.
[0203] For example, cell lines as described herein having
inactivated mgat2, mgat4A, mgat4B, mgat5, st3gal4 and 6 genes,
produce erythropoietin with N-glycans having homogenous
monoantennary structures without sialic acid capping, and are
suitable for more homogeneous glycomodification.
Inactivation of Unnecessary Glycosyltransferases to Improve
Desirable Glycosylation Pathways
[0204] In yet another embodiment, this invention provides cell
lines with inactivation of undesirable glycosylation enzymes to
enhance capacity and/or fidelity of desirable glycosylation
features. In certain embodiments cell lines with activation of one
or more sialyltransferases, and/or galactosyltransferases, and/or
GlcNAc-transferases, not functioning in a desirable glycosylation
pathway such as for example N-glycosylation are provided.
[0205] In one embodiment, this invention provides a cell with
inactivation of a .beta.4galactosyltransferase (.beta.4Gal-T7) with
little or no function in the N-glycosylation pathway, and improved
capacity for galactosylation, polyLacNAc and sialic acid capping of
N-glycans.
[0206] In one embodiment, this invention provides a cell with
inactivation of a sialyltransferase with little or no function in
the N-glycosylation pathway, and improved capacity for
galactosylation and sialic acid capping of N-glycans.
[0207] In one embodiment, this invention provides a cell with
inactivation of a .beta.3galactosyltransferase (C1GalT1) with
little or no function in the N-glycosylation pathway, and improved
capacity for galactosylation and sialic acid capping of
N-glycans.
[0208] In one embodiment, this invention provides a cell with
inactivation of a .beta.4galactosyltransferase with little or no
function in the N-glycosylation pathway, and improved capacity for
galactosylation and sialic acid capping of N-glycans.
[0209] In one embodiment, this invention provides a cell with
inactivation of a .beta.2GlcNAc-transferase (POMGnT1) with little
or no function in the N-glycosylation pathway, and improved
capacity for galactosylation and sialic acid capping of
N-glycans.
[0210] In one embodiment, this invention provides a cell with
inactivation of a .beta.3galactosyltransferase (C1GalT1), and/or a
.beta.2GlcNAc-transferase (POMGnT1), and/or a
.beta.4galactosyltransferase (.beta.4Gal-T7) with little or no
function in the N-glycosylation pathway, and improved capacity for
galactosylation and sialic acid capping of N-glycans.
[0211] In one embodiment, this invention provides a cell with
inactivation of a .beta.4galactosyltransferase (.beta.4Gal-T4) with
little or no function in the N-glycosylation pathway, and improved
capacity for galactosylation and sialic acid capping of
N-glycans.
[0212] In addition, methods of using the zinc finger proteins and
fusions thereof in methods of inactivating glycosyltransferase
genes in a cell or cell line are provided. In certain embodiments,
inactivating one or more glycosyltransferase genes results in a
cell line, which can produce recombinant proteins at higher levels
or in which one or more activities (functions) of the proteins are
increased as compared to proteins produced in cells where the
gene(s) is not inactivated.
[0213] Thus, in another aspect, provided herein are methods for
inactivating one or more cellular glycosyltransferase genes (e.g.,
endogenous mgat1, mgat2, mgat3, mgat4A, mgat4B, mgat4C, mgat5,
mgat5B, B4galt1, B4galt2, B4galt3, B4galt4, B3gnt1, B3gnt2, B3gnt8,
st3gal3, st3gal4, st3gal6, fut8 genes) in a cell, by use of methods
comprising genome perturbation, gene-editing and/or gene disruption
capability such as nucleic acid vector systems related to Clustered
Regularly Interspaced Short Palindromic Repeats (CRISPR) and
components thereof, nucleic acid vector systems encoding fusion
proteins comprising zinc finger DNA-binding domains (ZF) and at
least one cleavage domain or at least one cleavage half-domain
(ZFN) and/or nucleic acid vector systems encoding a first
transcription activator-like (TAL) effector endonuclease monomer
and a nucleic acid encoding a second cleavage domain or at least
one cleavage half-domain (TALEN).
[0214] Introduction into a cell of either of the above mentioned
nucleic acid cleaving agents (CRISPR, TALEN, ZFN) are capable of
specifically cleaving a glycosyltransferase gene target site as a
result of cellular introduction of: (1) a nucleic acid encoding
pair of either ZF or TAL glycosyltransferase gene target binding
proteins each fused to said a nucleic acid cleaving moiety, wherein
at least one of said ZF or TAL polypeptides is capable of
specifically binding to a nucleotide sequence located upstream from
said target cleavage site, and the other ZF or TAL protein is
capable of specifically binding to a nucleotide sequence located
downstream from the target cleavage site, whereby each of the zinc
finger proteins are independently bound to and surround the nucleic
acid target followed by target nucleic acid disruption by double
stranded breakage mediated by the fused endonuclease cleaving
moieties, (2) a nucleotide sequence encoding a CRISPR-Cas system
guide RNA that hybridizes glycosyltransferase gene target sequence,
and b) a second nucleotide sequence encoding a Type-II Cas9
protein, wherein components (a) and (b) are located on same or
different vectors of the system, wherein the guide RNA is comprised
of a chimeric RNA and includes a guide sequence and a
trans-activating cr (tracr) sequence, whereby the guide RNA targets
the glycosyltransferase gene target sequence and the Cas9 protein
cleaves the glycosyltransferase gene target site.
[0215] In yet another embodiment, this invention provides cell
lines with inactivation of one or more glycosyltransferase genes
and with stable introduction of one or more glycosyltransferases to
enhance fidelity of desirable glycosylation features and/or
introduce improved glycosylation features and/or novel
glycosylation features.
[0216] In certain embodiments cell lines with inactivation of one
or more sialyltransferases, and/or galactosyltransferases, and/or
glucosyltransferases, and/or GlcNAc-transferases, and/or
GalNAc-transferases, and/or xylosyl-transferase, and/or
glucuronosyltransferases, mannosyltransferases, and/or
fucosyltransferases, and in which one or more glycosyltransferases
have been stably introduced are provided.
[0217] For example, cell lines as described herein having
inactivated st3gal4 and 6 genes and in which the human ST6Gal-I
sialyltransferase has been introduced, produce erythropoietin with
N-glycans homogenous capped by .alpha.2,6NeuAc and are more
human-like.
[0218] For example, cell lines as described herein having
inactivated mgat4A, mgat4B, mgat5, st3gal4 and 6 genes and in which
the human ST6Gal-I sialyltransferase has been introduced, produce
erythropoietin with biantennary N-glycans homogenously capped by
.alpha.2,6NeuAc and are more human-like.
[0219] For example, cell lines as described herein having
inactivated mgat4A, mgat4B, mgat5, st3gal4 and 6 genes and in which
the human MGAT4A and ST6Gal-I have been introduced, produce
erythropoietin with triantennary N-glycans homogenously capped by
.alpha.2,6NeuAc and are more human-like.
[0220] For example, cell lines as described herein having
inactivated mgat4A, mgat4B, mgat5, st3gal4 and 6 genes and in which
MGAT4A, MGAT5 and ST6Gal-I have been introduced, produce
erythropoietin with tetraantennary N-glycans homogenously capped by
.alpha.2,6NeuAc and are more human-like.
[0221] There are a number of methods available for introduction of
exogenous genes such as glycosyltransferase genes in mammalian
cells and selecting stable clonal cell lines that harbor and
express the gene of interest. Typically the gene of interest is
co-transfected with a selection marker gene that favors cell lines
expressing the selection marker under certain defined media culture
conditions. The media could contain an inhibitor of the selection
marker protein or the media composition could stress cell
metabolism and thus require increased expression of the selection
marker. The selection marker gene may be present on same plasmid as
gene of interest or on another plasmid.
[0222] In one embodiment, introduction of one or more exogenous
glycosyltransferase(s) is performed by plasmid transfection with a
plasmid encoding constitutive promotor driven expression of both
the glycosyltransferase gene and a selectable antibiotic marker,
where the selectable marker could also represent an essential gene
not present in the host cell such as GS system (Sigma/Lonza),
and/or separate plasmids encoding the constitutive promotor driven
glycosyltransferase gene or the selectable marker. For example,
plasmids encoding ST6GalNAc-I and Zeocin have been transfected into
cells and stable ST6Gal-I expressing lines have been selected based
on zeocin resistance
[0223] In another embodiment, introduction of one or more exogenous
glycosyltransferase(s) is performed by site-directed
nuclease-mediated insertion.
[0224] In one embodiment, a method for stably expressing at least
one product of an exogenous nucleic acid sequence in a cell by
introduction of double stranded breaks at the PPP1R12C or Safe
Harbor #1 genomic locus using ZFN nucleic acid cleaving agents and
an exogenous nucleic acid sequence that by a homology dependent
manner or via compatible flanking ZFN cutting overhangs is inserted
into the cleavage site and expressed. Safe Harbor sites are sites
in the genome that upon manipulation do not lead to any obvious
cellular or phenotypic consequences. In addition to the
aforementioned sites, several other sites have been identified such
as Safe Harbor #2, CCR5 and Rosa26. Besides ZFN technology, TALEN
and CRISPR tools can also provide for integrating exogenous
sequences into cell lines or genomes in a precise manner. In doing
so it should be should be evaluated; i) to what extend epigenetic
silencing and ii) what the desired expression level of the gene of
interest should be. In the examples enclosed herein, site-specific
integration of human glycosyltransferases e.g. ST6Gal-I, MGAT4A, or
MGAT5, using the ObLiGaRe insertion strategy is based on a CMV
expression driven insulator flanked vector design.
[0225] In yet another aspect, the disclosure provides a method of
producing a recombinant protein of interest in a host cell, the
method comprising the steps of: (a) providing a host cell
comprising two or more endogenous glycosyltransferase genes; (b)
inactivating the endogenous glycosyltransferase genes of the host
cell by any of the methods described herein; and (c) introducing an
expression vector comprising a transgene, the transgene comprising
a sequence encoding a protein of interest, into the host cell,
thereby producing the recombinant protein. In certain embodiments,
the protein of interest comprises e.g. erythropoietin or an
antibody, e.g., a monoclonal antibody.
[0226] In yet another aspect, the disclosure provides a method of
producing a recombinant protein of interest in a cell, the method
comprising the steps of: (a) providing a cell comprising one or
more endogenous glycosyltransferase gene; (b) inactivating the
endogenous glycosyltransferase gene(s) of the host cell; (c)
introducing one or more glycosyltransferase gene(s) in the cell by
any of the methods described herein;
and (d) introducing an expression vector comprising a transgene,
the transgene comprising a sequence encoding a protein of interest,
into the cell, thereby producing the recombinant protein. In
certain embodiments, the protein of interest comprises e.g.
erythropoietin or an antibody, e.g., a monoclonal antibody.
[0227] Another aspect of the disclosure encompasses a method for
producing a recombinant protein with a more homogeneous and/or
human-like and/or novel and/or functionally beneficial
glycosylation pattern. The method comprises expressing the protein
in a mammalian cell line deficient in two or more
glycosyltransferase genes and/or deficient in one or more
glycosyltransferase genes combined with one or more gained
glycosyltransferase genes. In one specific embodiment, the cell
line is a Chinese hamster ovary (CHO) cell line. In one embodiment,
the cell line comprises inactivated chromosomal sequences encoding
any endogenous glycosyltransferases. In one embodiment, the
inactivated chromosomal sequences encoding any endogenous
glycosyltransferases is monoallelic and the cell line produces a
reduced amount of said glycosyltransferases. In another embodiment,
the inactivated chromosomal sequences encoding encoding any
endogenous glycosyltransferases are biallelic, and the cell line
produces no measurable said glycosyltransferases. In another
embodiment, the recombinant protein has more homogeneous and/or
human-like and/or novel and/or functionally beneficial
glycosylation pattern. In one embodiment, the recombinant protein
has at least one property that is improved relative to a similar
recombinant protein produced by a comparable cell line not
deficient in said endogenous glycosyltransferases, for example,
reduced immunogenicity, increased bioavailability, increased
efficacy, increased stability, increased solubility, improved
half-life, improved clearance, improved pharmacokinetics, and
combinations thereof. The recombinant protein can be any protein,
including a therapeutic protein. Exemplary proteins include those
selected from but not limited to an antibody, an antibody fragment,
a growth factor, a cytokine, a hormone, a lysosomal enzyme, a
clotting factor, a gonadotropin and functional fragment or variants
thereof.
[0228] The disclosure may also be used to identify target genes for
modification and use this knowledge to glycoengineer an existing
mammalian cell line previously transfected with DNA coding for the
protein of interest.
[0229] In any of the cells and methods described herein, the cell
or cell line can be a COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44,
CHO-DUXB11, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK,
NS0, SP2/0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T),
and PERC6.
[0230] Cell lines as described herein can also be used to produce
other N-glycoproteins including without intend for limitation for
example .alpha.1-antitrypsin, gonadotropins, lysosomal targeted
enzyme proteins (e.g. Glycocerebrosidase, alpha-Galactosidase,
alpha-glucosidase, sulfatases, glucuronidase, iduronidase). Known
human glycosyltransferase genes are assembled in homologous gene
families in the CAZy database and these families are further
assigned to different glycosylation pathways in Hansen et al.
(Hansen, Lind-Thomsen et al. 2014). TABLE 1 lists all human
glycosyltransferase genes in CAZy GT families with NCBI Gene IDs
and assignment of confirmed or putative functions in biosynthesis
of different mammalian glycoconjugates (N-glycans, O-GalNAc,
O-GlcNAc, O-Glc, O-Gal, O-Fuc, O-Xyl, O-Man, C-Man,
Glycosphingolipids, Hyaluronan, and GPI anchors). FIG. 1 further
graphically depicts confirmed and putative roles of the human CAZy
GT families in biosynthesis of different glycoconjugates.
TABLE-US-00001 TABLE 1 Human GTf genes CAZy Gene Map family.sup.(1)
ID.sup.(2) Symbol.sup.(3) Description.sup.(4) location.sup.(5) GT32
53947 A4GALT .alpha.1,4-galactosyltransferase 22q13.2 GT32 51146
A4GNT .alpha.1,4-N- 3p14.3 acetylglucosaminyltransferase GT6 28 ABO
ABO blood group 9q34.2 GT33 56052 ALG1 chitobiosyldiphosphodolichol
16p13.3 .beta.-mannosyltransferase GT59 84920 ALG10
.alpha.1,2-glucosyltransferase 12p11.1 GT59 144245 ALG10B
.alpha.1,2-glucosyltransferase 12q12 GT4 440138 ALG11
.alpha.1,2-mannosyltransferase 13q14.2 GT22 79087 ALG12
.alpha.1,6-mannosyltransferase 22q13.33 GT1 79868 ALG13 UDP-N- Xq23
acetylglucosaminyltransferase subunit GT1 199857 ALG14 UDP-N-
1p21.3 acetylglucosaminyltransferase subunit GT33 200810 ALG1L
chitobiosyldiphosphodolichol 3q21.2 .beta.-mannosyltransferase-like
GT33 644974 ALG1L2 chitobiosyldiphosphodolichol 3q22.1
.beta.-mannosyltransferase-like 2 GT4 85365 ALG2
.alpha.1,3/1,6-mannosyltransferase 9q22.33 GT58 10195 ALG3
.alpha.1,3-mannosyltransferase 3q27.1 GT2 29880 ALG5
dolichyl-phosphate 13q13.3 .beta.-glucosyltransferase GT57 29929
ALG6 .alpha.1,3-glucosyltransferase 1p31.3 GT57 79053 ALG8
.alpha.1,3-glucosyltransferase 11q14.1 GT22 79796 ALG9
.alpha.1,2-mannosyltransferase 11q23 GT31 8706 B3GALNT1
.beta.1,3-N- 3q25 acetylgalactosaminyltransferase 1 GT31 148789
B3GALNT2 .beta.1,3-N- 1q42.3 acetylgalactosaminyltransferase 2 GT31
8708 B3GALT1 UDP-Ga1: .beta.GlcNAc .beta. 2q24.3
1,3-galactosyltransferase, polypeptide 1 GT31 8707 B3GALT2 UDP-Gal:
.beta.GlcNAc 1q31 .beta.1,3-galactosyltransferase, polypeptide 2
GT31 8705 B3GALT4 UDP-Gal: .beta.GlcNAc- 6p21.3
.beta.1,3-galactosyltransferase, polypeptide 4 GT31 10317 B3GALT5
UDP-Gal: .beta.GlcNAc- 21q22.3 .beta.1,3-galactosyltransferase,
polypeptide 5 GT31 126792 B3GALT6 UDP-Gal: .beta.Gal-.beta.1,3-
1p36.33 galactosyltransferase polypeptide 6 GT31 145173 B3GALTL
.beta.1,3-galactosyltransferase-like 13q12.3 GT43 27087 B3GAT1
.beta.1,3-glucuronyltransferase 1 11q25 GT43 135152 B3GAT2
.beta.1,3-glucuronyltransferase 2 6q13 GT43 26229 B3GAT3
.beta.1,3-glucuronyltransferase 3 11q12.3 GT49 11041 B3GNT1
UDP-GlcNAc:.beta.Gal .beta.1,3-N- 11q13.2
acetylglucosaminyltransferase 1 GT31 10678 B3GNT2 UDP-GlcNAc:
.beta.Gal .beta.1,3-N- 2p15 acetylglucosaminyltransferase 2 GT31
10331 B3GNT3 UDP-GlcNAc: .beta.Gal .beta.1,3-N- 19p13.1
acetylglucosaminyltransferase 3 GT31 79369 B3GNT4 UDP-GlcNAc:
.beta.Gal .beta.1,3-N- 12q24 acetylglucosaminyltransferase 4 GT31
84002 B3GNT5 UDP-GlcNAc: .beta.Gal .beta.1,3-N- 3q28
acetylglucosaminyltransferase 5 GT31 192134 B3GNT6 UDP-GlcNAc:
.beta.Gal .beta.1,3-N- 11q13.4 acetylglucosaminyltransferase 6 GT31
93010 B3GNT7 UDP-GlcNAc: .beta.Gal .beta.1,3-N- 2q37.1
acetylglucosaminyltransferase 7 GT31 374907 B3GNT8 UDP-GlcNAc:
.beta.Gal .beta.1,3-N- 19q13.2 acetylglucosaminyltransferase 8 GT31
84752 B3GNT9 UDP-GlcNAc: .beta.Gal .beta.1,3-N- 16q22.1
acetylglucosaminyltransferase 9 GT2 146712 B3GNTL1 UDP-GlcNAc:
.beta.Gal .beta.1,3-N- 17q25.3 acetylglucosaminyltransferase- like
1 GT12 2583 B4GALNT1 .beta.1,4-N-acetyl-galactosaminyl 12q13.3
transferase 1 GT12 124872 B4GALNT2
.beta.1,4-N-acetyl-galactosaminyl 17q21.32 transferase 2 GT7 283358
B4GALNT3 .beta.1,4-N-acetyl-galactosaminyl 12p13.33 transferase 3
GT7 338707 B4GALNT4 .beta.1,4-N-acetyl-galactosaminyl 11p15.5
transferase 4 GT7 2683 B4GALT1 UDP-Gal: .beta.GlcNAc .beta.1,4-
9p13 galactosyltransferase, polypeptide 1 GT7 8704 B4GALT2 UDP-Gal:
.beta.GlcNAc .beta.1,4- 1p34-p33 galactosyltransferase, polypeptide
2 GT7 8703 B4GALT3 UDP-Gal: .beta.GlcNAc .beta.1,4- 1q21-q23
galactosyltransferase, polypeptide 3 GT7 8702 B4GALT4 UDP-Gal:
.beta.GlcNAc .beta.1,4- 3q13.3 galactosyltransferase, polypeptide 4
GT7 9334 B4GALT5 UDP-Gal: .beta.GlcNAc .beta.1,4- 20q13.1-
galactosyltransferase, q13.2 polypeptide 5 GT7 9331 B4GALT6
UDP-Gal: .beta.GlcNAc .beta.1,4- 18q11 galactosyltransferase,
polypeptide 6 GT7 11285 B4GALT7 xylosylprotein .beta.1,4- 5q35.2-
galactosyltransferase, q35.3 polypeptide 7 GT31 56913 C1GALT1 core
1 synthase, 7p21.3 galactosyltransferase 1 GT31 29071 C1GALT1C1
C1GALT1-specific chaperone 1 Xq24 GT25 51148 CERCAM cerebral
endothelial cell 9q34.11 adhesion molecule GT7/31 79586 CHPF
chondroitin polymerizing factor 2q35 GT7/31 54480 CHPF2 chondroitin
polymerizing factor 2 7q36.1 GT7/31 22856 CHSY1 chondroitin sulfate
synthase 1 15q26.3 GT7/31 337876 CHSY3 chondroitin sulfate synthase
3 5q23.3 GT25 79709 COLGALT1 collagen .beta. (1-O) 19p13.11
galactosyltransferase 1 GT25 23127 COLGALT2 collagen .beta. (1-O)
1q25 galactosyltransferase 2 GT7 55790 CSGALNACT1 chondroitin
sulfate N- 8p21.3 acetylgalactosaminyltransferase 1 GT7 55454
CSGALNACT2 chondroitin sulfate N- 10q11.21
acetylgalactosaminyltransferase 2 GT2 8813 DPM1 dolichyl-phosphate
20q13.13 mannosyltransferase polypeptide 1 GTnc 23333 DPY19L1
dpy-19-like 1 (C. elegans) 7p14.3- p14.2 GTnc 283417 DPY19L2
dpy-19-like 2 (C. elegans) 12q14.2 GTnc 147991 DPY19L3 dpy-19-like
3 (C. elegans) 19q13.11 GTnc 286148 DPY19L4 dpy-19-like 4 (C.
elegans) 8q22.1 GT61 285203 EOGT EGF domain-specific O-linked N-
3p14.1 acetylglucosamine transferase GT47/64 2131 EXT1 exostosin
glycosyltransferase 1 8q24.11 GT47/64 2132 EXT2 exostosin
glycosyltransferase 2 11p12-p11 GT47/64 2134 EXTL1 exostosin-like
1p36.1 glycosyltransferase 1 GT64 2135 EXTL2 exostosin-like 1p21
glycosyltransferase 2 GT47/64 2137 EXTL3 exostosin-like 8p21
glycosyltransferase 3 GTnc 79147 FKRP fukutin related protein
19q13.32 GTnc 2218 FKTN Fukutin 9q31-q33 GT11 2523 FUT1
fucosyltransferase 1, 19q13.3 H blood group GT10 84750 FUT10
fucosyltransferase 10, .alpha.1,3 8p12 fucosyltransferase GT10
170384 FUT11 fucosyltransferase 11, .alpha.1,3 10q22.2
fucosyltransferase GT11 2524 FUT2 fucosyltransferase 2 secretor
19q13.3 status include GT10 2525 FUT3 fucosyltransferase 3, Lewis
19p13.3 blood group GT10 2526 FUT4 fucosyltransferase 4, .alpha.1,3
11q21 fucosyltransferase, myeloid- specific GT10 2527 FUT5
fucosyltransferase 5, .alpha.1,3 19p13.3 fucosyltransferase GT10
2528 FUT6 fucosyltransferase 6, .alpha.1,3 19p13.3
fucosyltransferase GT10 2529 FUT7 fucosyltransferase 7, .alpha.1,3
9q34.3 fucosyltransferase GT23 2530 FUT8 fucosyltransferase 8,
.alpha.1,6 14q24.3 fucosyltransferase GT10 10690 FUT9
fucosyltransferase 9, .alpha.1,3 6q16 fucosyltransferase GT27 2589
GALNT1 polypeptide N- 18q12.1 acetylgalactosaminyltransferase 1
GT27 55568 GALNT10 polypeptide N- 5q33.2
acetylgalactosaminyltransferase 10 GT27 63917 GALNT11 polypeptide
N- 7q36.1 acetylgalactosaminyltransferase 11 GT27 79695 GALNT12
polypeptide N- 9q22.33 acetylgalactosaminyltransferase 12 GT27
114805 GALNT13 polypeptide N- 2q24.1
acetylgalactosaminyltransferase 13 GT27 79623 GALNT14 polypeptide
N- 2p23.1 acetylgalactosaminyltransferase 14 GT27 117248 GALNT15
polypeptide N- 3p25.1 acetylgalactosa minyltransferase 15 GT27
57452 GALNT16 polypeptide N- 14q24.1 acetylgalactosa
minyltransferase 16 GT27 374378 GALNT18 polypeptide N- 11p15.3
acetylgalactosa minyltransferase 18 GT27 2590 GALNT2 polypeptide N-
1q41-q42 acetylgalactosa minyltransferase 2 GT27 2591 GALNT3
polypeptide N- 2q24-q31 acetylgalactosa minyltransferase 3 GT27
8693 GALNT4 polypeptide N- 12q21.33 acetylgalactosa
minyltransferase 4 GT27 11227 GALNT5 polypeptide N- 2q24.1
acetylgalactosa minyltransferase 5 GT27 11226 GALNT6 polypeptide N-
12q13 acetylgalactosa minyltransferase 6 GT27 51809 GALNT7
polypeptide N- 4q31.1 acetylgalactosa minyltransferase 7 GT27 26290
GALNT8 polypeptide N- 12p13.3 acetylgalactosa minyltransferase 8
GT27 50614 GALNT9 polypeptide N- 12q24.33 acetylgalactosa
minyltransferase 9 GT27 168391 GALNTL5 polypeptide N- 7q36.1
acetylgalactosaminyltransferase- GT27 442117 GALNTL6 polypeptide N-
4q34.1 acetylgalactosaminyltransferase- GT6 26301 GBGT1 globoside
.alpha.1,3-N- 9q34.13- acetylgalactosaminyltransferase 1 q34.3 GT14
2650 GCNT1 glucosaminyl (N-acetyl) 9q13 transferase 1, core 2 GT14
2651 GCNT2 glucosaminyl (N-acetyl) 6p24.2 transferase 2,
I-branching enzyme GT14 9245 GCNT3 glucosaminyl (N-acetyl) 15q21.3
transferase 3, mucin type GT14 51301 GCNT4 glucosaminyl (N-acetyl)
5q12 transferase 4, core 2 GT14 644378 GCNT6 glucosaminyl
(N-acetyl) 6p24.2 transferase 6 GT14 140687 GCNT7 glucosaminyl
(N-acetyl) 20q13.2 transferase family member 7 GT6 2681 GGTA1P
glycoprotein, .alpha.- 9q33.2 galactosyltransferase 1 pseudogene
GT4 144423 GLT1D1 glycosyltransferase 1 domain 12q24.33 containing
1 GT6 360203 GLT6D1 glycosyltransferase 6 domain 9q34.3 containing
1 GT8 55830 GLT8D1 glycosyltransferase 8 domain 3p21.1 containing 1
GT8 83468 GLT8D2 glycosyltransferase 8 domain 12q containing 2 GT4
79712 GTDC1 glycosyltransferase-like domain 2q22.3 containing 1 GT8
283464 GXYLT1 glucoside xylosyltransferase 1 12q12 GT8 727936
GXYLT2 glucoside xylosyltransferase 2 3p13 GT8 2992 GYG1 glycogenin
1 3q24- q25.1 GT8 8908 GYG2 glycogenin 2 Xp22.3 GT8/49 120071
GYLTL1B glycosyltransferase-like 1B, 11p11.2 LARGE2 GT3 2997 GYS1
glycogen synthase 1 (muscle) 19q13.3 GT3 2998 GYS2 glycogen
synthase 2 (liver) 12p12.2 GT2 3036 HAS1 hyaluronan synthase 1
19q13.4 GT2 3037 HAS2 hyaluronan synthase 2 8q24.12 GT2 3038 HAS3
hyaluronan synthase 3 16q22.1 GT90 79070 KDELC1 KDEL
(Lys-Asp-Glu-Leu) 13q33 containing 1 like- glycosyltransferase
GT8/49 9215 LARGE .beta.1,3-xylosyltransferase 22q12.3 GT31 3955
LFNG O-fucosylpeptide 3-.beta.N- 7p22.2
acetylglucosaminyltransferase GT31 4242 MFNG O-fucosylpeptide
3-.beta.N- 22q12 acetylglucosaminyltransferase GT13 4245 MGAT1
mannosyl .alpha.1,3glycoprotein 5q35 .beta.1,2N-
acetylglucosaminyltransferase GT16 4247 MGAT2 mannosyl
.alpha.1,6glycoprotein .beta.2N- 14q21
acetylglucosaminyltransferase GT17 4248 MGAT3 mannosyl
.beta.1,4glycoprotein 22q13.1 .beta.1,4N-
acetylglucosaminyltransferase GT54 11320 MGAT4A mannosyl
.alpha.1,3glycoprotein 2q12 .beta.1,4N-
acetylglucosaminyltransferase GT54 11282 MGAT4B mannosyl
.alpha.1,3glycoprotein 5q35 .beta.1,4N-
acetylglucosaminyltransferase GT54 25834 MGAT4C mannosyl
.alpha.1,3glycoprotein 12q21 .beta.1,4N-
acetylglucosaminyltransferase GT18 4249 MGAT5 mannosyl
.alpha.1,6glycoprotein 2q21.3 .beta.1,6N-
acetylglucosaminyltransferase GT18 146664 MGAT5B mannosyl
.alpha.1,6glycoprotein 17q25.2 .beta.-1,6-N-acetyl-
glucosaminyltransferase, isozyme B GT41 8473 OGT O-linked
N-acetylglucosamine Xq13 (GlcNAc) transferase GT4 5277 PIGA
phosphatidylinositol glycan Xp22.1 anchor biosynthesis, class A
GT22 9488 PIGB phosphatidylinositol glycan 15q21.3 anchor
biosynthesis, class B GT50 93183 PIGM phosphatidylinositol glycan
1q23.2 anchor biosynthesis, class M GT76 55650 PIGV
phosphatidylinositol glycan 1p36.11 anchor biosynthesis, class V
GT22 80235 PIGZ phosphatidylinositol glycan 3q29 anchor
biosynthesis, class Z GTnc 8985 PLOD3 procollagen-lysine, 2- 7q22
oxoglutarate 5-dioxygenase 3 GT65 23509 POFUT1 O-fucosyltransferase
1 20q11 GT68 23275 POFUT2 O-fucosyltransferase 2 21q22.3 GT90 56983
POGLUT1 O-glucosyltransferase 1 3q13.33 GT13 55624 POMGNT1 O-linked
mannose N- 1p34.1 acetylglucosaminyltransferase 1, .beta.1,2 GT61
84892 POMGNT2 O-linked mannose N- 3p22.1
acetylglucosaminyltransferase 2, .beta.1,4 GT39 10585 POMT1
O-mannosyltransferase 1 9q34.1 GT39 29954 POMT2
O-mannosyltransferase 2 14q24 GT35 5834 PYGB phosphorylase,
glycogen; brain 20p11.21 GT35 5836 PYGL phosphorylase, glycogen,
liver 14q21-q22 GT35 5837 PYGM phosphorylase, glycogen, 11q12-
muscle q13.2 GT31 5986 RFNG O-fucosylpeptide 3.beta.N- 17q25
acetylglucosaminyltransferase GT29 6482 ST3GAL1 .beta.-galactoside
.alpha.-2,3- 8q24.22 sialyltransferase 1 GT29 6483 ST3GAL2
.beta.-galactoside .alpha.-2,3- 16q22.1 sialyltransferase 2 GT29
6487 ST3GAL3 .beta.-galactoside .alpha.-2,3- 1p34.1
sialyltransferase 3 GT29 6484 ST3GAL4 .beta.-galactoside
.alpha.-2,3- 11q24.2 sialyltransferase 4 GT29 8869 ST3GAL5
.beta.-galactoside .alpha.-2,3- 2p11.2 sialyltransferase 5 GT29
10402 ST3GAL6 .beta.-galactoside .alpha.-2,3- 3q12.1
sialyltransferase 6 GT29 6480 ST6GAL1 .beta.-galactosamide
.alpha.-2,6- 3q27-q28 sialyltranferase 1 GT29 84620 ST6GAL2
.beta.-galactosamide .alpha.-2,6- 2q11.2- sialyltranferase 2 q12.1
GT29 55808 ST6GALNAC1 .alpha.-N-acetyl-neuraminyl-2,3-.beta.-
17q25.1 galactosyl-1,3-N- acetylgalactosaminide .alpha.-2,6-
sialyltransferase 1 GT29 10610 ST6GALNAC2
.alpha.-N-acetyl-neuraminy1-2,3-.beta.- 17q25.1 galactosyl-1,3)-N-
acetylgalactosaminide .alpha.-2,6- sialyltransferase 2 GT29 256435
ST6GALNAC3 .alpha.-N-acetyl-neuraminyl-2,3-.beta.- 1p31.1
galactosyl-1,3)-N- acetylgalactosaminide .alpha.-2,6-
sialyltransferase 3 GT29 27090 ST6GALNAC4
.alpha.-N-acetyl-neuraminyl-2,3-.beta.- 9q34 galactosyl-1,3-N-
acetylgalactosaminide .alpha.-2,6- sialyltransferase 4 GT29 81849
ST6GALNAC5 .alpha.-N-acetyl-neuraminyl-2,3-.beta.- 1p31.1
galactosyl-1,3-N- acetylgalactosaminide .alpha.-2,6-
sialyltransferase 5 GT29 30815 ST6GALNAC6
.alpha.-N-acetyl-neuraminyl-2,3-.beta.- 9q34.11 galactosyl-1,3-N-
acetylgalactosaminide .alpha.-2,6- sialyltransferase 6 GT29 6489
ST8SIA1 .alpha.-N-acetyl-neuraminide .alpha.-2,8- 12p12.1-
sialyltransferase 1 p11.2 GT29 8128 ST8SIA2
.alpha.-N-acetyl-neuraminide .alpha.-2,8- 15q26 sialyltransferase 2
GT29 51046 ST8SIA3 .alpha.-N-acetyl-neuraminide .alpha.-2,8-
18q21.31 sialyltransferase 3 GT29 7903 ST8SIA4
.alpha.-N-acetyl-neuraminide .alpha.-2,8- 5q21 sialyltransferase 4
GT29 29906 ST8SIA5 .alpha.-N-acetyl-neuraminide .alpha.-2,8-
18q21.1 sialyltransferase 5 GT29 338596 ST8SIA6
.alpha.-N-acetyl-neuraminide .alpha.-2,8- 10p12.33
sialyltransferase 6 GT66 3703 S7T3A subunit of the 11q23.3
oligosaccharyltransferase complex (catalytic) GT66 201595 S7T38
subunit of the 3p23 oligosaccharyltransferase complex (catalytic)
GTnc 10329 TMEM5 transmembrane protein 5 12q14.2 GT21 7357 ST8SIA
UDP-glucose ceramide 9q31 glucosyltransferase GT24 56886 UGGT1
UDP-glucose glycoprotein 2q14.3 glucosyltransferase 1 GT24 55757
UGGT2 UDP-glucose glycoprotein 13q32.1 glucosyltransferase 2 GT1
54658 UGT1A1 UDP glucuronosyltransferase 1 2q37 family, polypeptide
A1 GT1 54575 UGT1A10 UDP glucuronosyltransferase 1 2q37 family,
polypeptide A10 GT1 54659 UGT1A3 UDP glucuronosyltransferase 1 2q37
family, polypeptide A3 GT1 54657 UGT1A4 UDP glucuronosyltransferase
1 2q37 family, polypeptide A4 GT1 54579 UGT1A5 UDP
glucuronosyltransferase 1 2q37 family, polypeptide AS GT1 54578
UGT1A6 UDP glucuronosyltransferase 1 2q37 family, polypeptide A6
GT1 54577 UGT1A7 UDP glucuronosyltransferase 1 2q37 family,
polypeptide A7 GT1 54576 UGT1A8 UDP glucuronosyltransferase 1 2q37
family, polypeptide A8 GT1 54600 UGT1A9 UDP glucuronosyltransferase
1 2q37 family, polypeptide A9 GT1 10941 UGT2A1 UDP
glucuronosyltransferase 2 4q13 family, polypeptide A1 GT1 79799
UGT2A3 UDP glucuronosyltransferase 2 4q13.2 family, polypeptide A3
GT1 7365 UGT2B10 UDP glucuronosyltransferase 2 4q13.2 family,
polypeptide B10 GT1 10720 UGT2B11 UDP glucuronosyltransferase 2
4q13.2 family, polypeptide B11 GT1 7366 UGT2B15 UDP
glucuronosyltransferase 2 4q13 family, polypeptide B15 GT1 7367
UGT2B17 UDP glucuronosyltransferase 2 4q13 family, polypeptide B17
GT1 54490 UGT2B28 UDP glucuronosyltransferase 2 4q13.2 family,
polypeptide B28 GT1 7363 UGT2B4 UDP glucuronosyltransferase 2 4q13
family, polypeptide B4 GT1 7364 UGT2B7 UDP glucuronosyltransferase
2 4q13 family, polypeptide B7 GT1 133688 UGT3A1 UDP
glycosyltransferase 3 5p13.2 family, polypeptide A1 GT1 167127
UGT3A2 UDP glycosyltransferase 3 5p13.2 family, polypeptide A2 GT1
7368 UGT8 UDP glycosyltransferase 8 4q26 GT27 64409 WBSCR17
Williams-Beuren syndrome 7q11.23 chromosome region 17 GT8 152002
XXYLT1 xyloside xylosyltransferase 1 3q29 GT14 64131 XYLT1
xylosyltransferase I 16p12.3 GT14 64132 XYLT2 xylosyltransferase II
17q21.33 .sup.(1)GT classification system (Lombard et al. (2013).
Nucl Acid Res 42:D1P:D490-D495) .sup.(2)gene symbol .sup.(3)Gene ID
GenBank .sup.(4)Protein name UniProt .sup.(5)Human chromosomal
position (hg19)
[0231] Most of the corresponding orthologous CHO
glycosyltransferase genes were previously assigned in connection
with the recent sequencing of the CHO genome (Xu, Nagarajan et al.
2011), but some genes were wrongly assigned or missed. The current
set of orthologous glycosyltransferase genes in human and CHO are
listed in TABLE 2.
TABLE-US-00002 TABLE 2 Chinese hamster (Cricetulus griseus) GTfs
genes CAZy family.sup.(1) Symbol.sup.(2) Gene ID.sup.(3)
Description.sup.(4) GT1 Alg13 100754023
UDP-N-acetylglucosaminyltransferase subunit GT1 Alg14 100773644
UDP-N-acetylglucosaminyltransferase subunit GT1 Ugt1a1 100755423
UDP-glucuronosyltransferase 1-6 GT1 Ugt2a1 100762963 UDP
glucuronosyltransferase 2 family, polypeptide A1, complex locus GT1
Ugt2a3 100762673 UDP-glucuronosyltransferase 2A3 GT2 Alg5 100769679
ALG5, dolichyl-phosphate .beta.- glucosyltransferase GT2 B3gntl1
100751193 UDP-GlcNAc:.beta.Gal .beta.-1,3-N-
acetylglucosaminyltransferase-like 1 GT2 Dpm1 100689420
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic
subunit GT2 Has2 100751055 hyaluronan synthase 2 GT2 Has2 100751055
hyaluronan synthase 2 GT2 Has3 100757895 hyaluronan synthase 3 GT3
Gys1 100769788 glycogen synthase 1 (muscle) GT3 Gys2 100770628
glycogen synthase 2 (liver) GT4 Alg11 100771009
.alpha.-1,2-mannosyltransferase GT4 Alg2 100768412
.alpha.-1,3/1,6-mannosyltransferase GT4 Glt1d1 100761757
glycosyltransferase 1 domain containing 1 GT4 Gtdc1 100752161
glycosyltransferase-like domain containing 1 GT4 Piga 100773712
phosphatidylinositol glycan anchor biosynthesis, class A GT6 Abo
100772592 ABO blood group GT6 Gbgt1 100771256 globoside
.alpha.-1,3-N- acetylgalactosaminyltransferase 1 GT7 B4galnt3
100756528 .beta.-1,4-N-acetyl-galactosaminyl transferase 3 GT7
B4galnt4 100758404 .beta.-1,4-N-acetyl-galactosaminyl transferase 4
GT7 B4galt1 100689430 UDP-Gal:.beta.GlcNAc .beta.1,4-
galactosyltransferase, polypeptide 1 GT7 B4galt2 100689434
UDP-Gal:.beta.GlcNAc .beta.1,4- galactosyltransferase, polypeptide
2 GT7 B4galt3 100689346 UDP-Gal:.beta.GlcNAc .beta.1,4-
galactosyltransferase, polypeptide 3 GT7 B4galt4 100689435
UDP-Gal:.beta.GlcNAc .beta.1,4- galactosyltransferase, polypeptide
4 GT7 B4galt5 100689347 UDP-Gal:.beta.GlcNAc .beta.1,4-
galactosyltransferase, polypeptide 5 GT7 B4galt6 100689438
UDP-Gal:.beta.GlcNAc .beta.1,4- galactosyltransferase, polypeptide
6 GT7 B4galt7 100769652 xylosylprotein .beta.1,4-
galactosyltransferase, polypeptide 7 GT7/ Chpf 100765856
chondroitin polymerizing factor GT31 GT7/ Chsy1 100770803
chondroitin sulfate synthase 1 GT31 GT7/ Chsy3 100767985
chondroitin sulfate synthase 3 GT31 GT7 Csgalnact1 100754969
chondroitin sulfate N- acetylgalactosaminyltransferase 1 GT7
Csgalnact2 100770830 chondroitin sulfate N-
acetylgalactosaminyltransferase 2 GT8 Glt8d1 100762757
glycosyltransferase 8 domain containing 1 GT8 Glt8d2 100772458
glycosyltransferase 8 domain containing 2 GT8 Gxylt1 100760543
glucoside xylosyltransferase 1 GT8 Gxylt2 100758512 glucoside
xylosyltransferase 2 GT8 Gyg1 100751671 glycogenin 1 GT8/49 Gyltl1b
100750932 glycosyltransferase-like 1B GT8/49 Large 100765249
like-glycosyltransferase GT8 Xxylt1 100760146 xyloside
xylosyltransferase 1 GT10 Fut10 100760260 fucosyltransferase 10
(.alpha. (1,3) fucosyltransferase) GT10 Fut11 100758336
fucosyltransferase 11 (.alpha. (1,3) fucosyltransferase) GT10 Fut4
100754814 fucosyltransferase 4 (.alpha. (1,3) fucosyltransferase,
myeloid-specific) GT10 Fut6a 100689084 .alpha.1,3
fucosyltransferase 6A GT10 Fut6b 100689083 .alpha.1,3
fucosyltransferase 6B GT10 Fut7 100772214 .alpha.1,3
fucosyltransferase GT10 Fut9 100689036 .alpha.1,3
fucosyltransferase GT11 Fut1 100757047 galactoside
2.alpha.-L-fucosyltransferase, H blood group GT11 Fut2 100751185
fucosyltransferase 2 GT12 B4galnt1 100764682
.beta.1,4-N-acetyl-galactosaminyl transferase 1 GT12 B4galnt2
100760696 .beta.1,4-N-acetyl-galactosaminyl transferase 2 GT13
Mgat1 100682529 mannosyl (.alpha.-1,3-)-glycoprotein (.beta.1,2-
N-acetylglucosaminyltransferase GT13 Pomgnt1 100772511 protein
O-linked mannose N- acetylglucosaminyltransferase 1 (.beta.1,2-)
GT14 Gcnt1 100767124 glucosaminyl (N-acetyl) transferase 1, core 2
GT14 Gcnt3 100774815 glucosaminyl (N-acetyl) transferase 3, mucin
type GT14 Gcnt4 100757239 glucosaminyl (N-acetyl) transferase 4,
core 2 GT14 Gcnt7 100760777 glucosaminyl (N-acetyl) transferase
family member 7 GT14 Xylt1 100756878 xylosyltransferase I GT14
Xylt2 100759604 xylosyltransferase II GT16 Mgat2 100753385 mannosyl
(.alpha.-1,6-)-glycoprotein .beta.-1,2-
N-acetylglucosaminyltransferase GT17 Mgat3 100689076 mannosyl
(.beta.-1,4-)-glycoprotein .beta.-1,4-
N-acetylglucosaminyltransferase GT18 Mgat5 100760162 mannosyl
(.alpha.-1,6-)-glycoprotein .beta.-1,6-
N-acetyl-glucosaminyltransferase GT18 Mgat5b 100771275 mannosyl
(.alpha.-1,6-)-glycoprotein .beta.-1,6-
N-acetyl-glucosaminyltransferase GT21 Ugcg 100689432 UDP-glucose
ceramide glucosyltransferase GT22 Alg12 100770096
.alpha.-1,6-mannosyltransferase GT22 Alg9 100755062
.alpha.-1,2-mannosyltransferase GT22 Pigb 100768002
phosphatidylinositol glycan anchor biosynthesis, class B GT22 Pigz
100750622 phosphatidylinositol glycan anchor biosynthesis, class Z
GT23 Fut8 100751648 .alpha.1,6 fucosyltransferase) GT24 Uggt1
100773968 UDP-glucose glycoprotein glucosyltransferase 1 GT24 Uggt2
100762273 UDP-glucose glycoprotein glucosyltransferase 2 GT25
Cercam 100765284 cerebral endothelial cell adhesion molecule GT25
Colgalt1 100774081 collagen .beta.(1-O)galactosyltransferase 1 GT25
Colgalt2 100764465 collagen .beta.(1-O)galactosyltransferase 2 GT27
Galnt1 100763868 polypeptide N- acetylgalactosaminyltransferase 1
GT27 Galnt10 100768523 polypeptide N-
acetylgalactosaminyltransferase 10 GT27 Galnt11 100758359
polypeptide N- acetylgalactosaminyltransferase 11 GT27 Galnt12
100772146 polypeptide N- acetylgalactosaminyltransferase 12 GT27
Galnt13 100768831 polypeptide N- acetylgalactosaminyltransferase 13
GT27 Galnt14 100759781 polypeptide N-
acetylgalactosaminyltransferase 14 GT27 Galnt15 100766936
polypeptide N- acetylgalactosaminyltransferase 15 GT27 Galnt16
100764829 polypeptide N- acetylgalactosaminyltransferase 16 GT27
Galnt18 100767393 polypeptide N- acetylgalactosaminyltransferase 18
GT27 Galnt2 100767525 polypeptide N-
acetylgalactosaminyltransferase 2 GT27 Galnt3 100753226 polypeptide
N- acetylgalactosaminyltransferase 3 GT27 Galnt4 100765247
polypeptide N- acetylgalactosaminyltransferase 4 GT27 Galnt5
100757219 polypeptide N- acetylgalactosaminyltransferase 5 GT27
Galnt6 100751126 polypeptide N- acetylgalactosaminyltransferase 6
GT27 Galnt6 100751126 polypeptide N-
acetylgalactosaminyltransferase 6 GT27 Galnt7 100762043 polypeptide
N- acetylgalactosaminyltransferase 7 GT27 Galnt8 100764127
polypeptide N- acetylgalactosaminyltransferase 8 GT27 Galnt9
100773797 polypeptide N- acetylgalactosaminyltransferase 9 GT27
Galnt15 100767659 polypeptide N-
acetylgalactosaminyltransferase-like 5 GT27 Galnt16 100761752
polypeptide N- acetylgalactosaminyltransferase-like 6 GT27 Wbscr17
100750837 Williams-Beuren syndrome chromosome region 17 GT29
St3gal1 100754088 .beta.-galactoside .alpha.-2,3-sialyltransferase
1 GT29 St3gal1 100754088 .beta.-galactoside
.alpha.-2,3-sialyltransferase 1 GT29 St3gal2 100767717
.beta.-galactoside .alpha.-2,3-sialyltransferase 2 GT29 St3gal2
100767717 .beta.-galactoside .alpha.-2,3-sialyltransferase 2 GT29
St3gal3 100689187 .beta.-galactoside .alpha.-2,3-sialyltransferase
3 GT29 St3gal4 100689440 .beta.-galactoside
.alpha.-2,3-sialyltransferase 4 GT29 St3gal5 100754838
.beta.-galactoside .alpha.-2,3-sialyltransferase 5 GT29 St3gal6
100771326 .beta.-galactoside .alpha.-2,3-sialyltransferase 6 GT29
St6gal1 100689389 .beta.-galactosamide .alpha.-2,6-
sialyltranferase 1 GT29 St6gal2 100763756 .beta.-galactosamide
.alpha.-2,6- sialyltranferase 2 GT29 St6galnac1 100763224
.alpha.-N-acetylgalactosaminide .alpha.-2,6- sialyltransferase 1
GT29 St6galnac3 100762285
(.alpha.-N-acetyl-neuraminyl-2,3.beta.-galactosyl-
1,3)-N-acetylgalactosaminide .alpha.-2,6- sialyltransferase 3 GT29
St6galnac4 100759065
(.alpha.-N-acetyl-neuraminyl-2,3.beta.-galactosyl-
1,3)-N-acetylgalactosaminide .alpha.-2,6- sialyltransferase 4 GT29
St6galnac5 100759381
(.alpha.-N-acetyl-neuraminyl-2,3.beta.-galactosyl-
1,3)-N-acetylgalactosaminide .alpha.-2,6- sialyltransferase 5 GT29
St6galnac6 100757138
(.alpha.-N-acetyl-neuraminyl-2,3.beta.-galactosyl-
1,3)-N-acetylgalactosaminide .alpha.-2,6- sialyltransferase 6 GT29
St8sia1 100768920 .alpha.-N-acetyl-neuraminide .alpha.-2,8-
sialyltransferase 1 GT29 St8sia2 100759559
.alpha.-N-acetyl-neuraminide .alpha.-2,8- sialyltransferase 2 GT29
St8sia3 100764454 .alpha.-N-acetyl-neuraminide .alpha.-2,8-
sialyltransferase 3 GT29 St8sia4 100689217
.alpha.-N-acetyl-neuraminide .alpha.-2,8- sialyltransferase 4 GT29
St8sia5 100750766 .alpha.-N-acetyl-neuraminide .alpha.-2,8-
sialyltransferase 5 GT29 St8sia6 100774188
.alpha.-N-acetyl-neuraminide .alpha.-2,8- sialyltransferase 6 GT31
B3galnt1 100756438 .beta.-1,3-N-acetylgalactosaminyltransferase 1
(globoside blood group) GT31 B3galnt2 100768564
.beta.-1,3-N-acetylgalactosaminyltransferase 2 GT31 B3galt1
100761765 UDP-Gal:.beta.GlcNAc .beta.1,3- galactosyltransferase,
polypeptide 1 GT31 B3galt2 100766715 UDP-Gal:.beta.GlcNAc
.beta.1,3- galactosyltransferase, polypeptide 2 GT31 B3galt4
100751197 UDP-Gal:.beta.GlcNAc .beta.1,3- galactosyltransferase,
polypeptide 4 GT31 B3galt5 100755714 UDP-Gal:.beta.GlcNAc
.beta.1,3- galactosyltransferase, polypeptide 5 GT31 B3galt6
100767598 UDP-Gal:.beta.Gal .beta.1,3- galactosyltransferase
polypeptide 6 GT31 B3galt1 100759864
.beta.1,3-galactosyltransferase-like GT31 B3gnt2 100766691
UDP-GlcNAc:.beta.Gal .beta.-1,3-N- acetylglucosaminyltransferase 2
GT31 B3gnt3 100773213 UDP-GlcNAc:.beta.Gal .beta.-1,3-N-
acetylglucosaminyltransferase 3 GT31 B3gnt4 100769077
UDP-GlcNAc:.beta.Gal .beta.-1,3-N- acetylglucosaminyltransferase 4
GT31 B3gnt5 100757919 UDP-GlcNAc:.beta.Gal .beta.-1,3-N-
acetylglucosaminyltransferase 5 GT31 B3gnt6 100768656
UDP-GlcNAc:.beta.Gal .beta.-1,3-N- acetylglucosaminyltransferase 6
GT31 B3gnt7 100760456 UDP-GlcNAc:.beta.Gal .beta.-1,3-N-
acetylglucosaminyltransferase 7 GT31 B3gnt8 103160327
UDP-GlcNAc:.beta.Gal .beta.-1,3-N- acetylglucosaminyltransferase 8
GT31 B3gnt9 103159649 UDP-GlcNAc:.beta.Gal .beta.-1,3-N-
acetylglucosaminyltransferase 9 GT31 C1galt1 100761169
glycoprotein-N-acetylgalactosamine 3- .beta.-galactosyltransferase,
1 GT31 C1galt1c1 100751243 C1GALT1-specific chaperone 1 GT31 Lfng
100762397 O-fucosylpeptide 3-.beta.-N-
acetylglucosaminyltransferase GT31 Mfng 100762875 O-fucosylpeptide
3-.beta.-N- acetylglucosaminyltransferase GT31 Rfng 100771257
O-fucosylpeptide 3-.beta.-N- acetylglucosaminyltransferase GT32
A4galt 100770462 .alpha.-1,4-galactosyltransferase GT32 A4gnt
100771969 .alpha.-1,4-N-acetylglucosaminyltransferase GT33 Alg1
100773731 chitobiosyldiphosphodolichol .beta.- mannosyltransferase
GT35 Pygb 100769186 phosphorylase, glycogen; brain GT35 Pygm
100757350 phosphorylase, glycogen, muscle GT39 Pomt1 100755033
protein-O-mannosyltransferase 1 GT39 Pomt2 100764752
protein-O-mannosyltransferase 2 GT41 Ogt 100768670 O-linked
N-acetylglucosamine (GlcNAc) transferase GT43 B3gat1 100750701
.beta.-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) GT43
B3gat2 100756696 .beta.-1,3-glucuronyltransferase 2
(glucuronosyltransferase S) GT43 B3gat3 100689419
.beta.-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
GT47/ Ext1 100689334 exostosin glycosyltransferase 1 64 GT47/ Ext2
100751585 exostosin glycosyltransferase 2 64 GT47/ Extl1 100770000
exostosin-like glycosyltransferase 1 64 GT47/ Extl3 100751999
exostosin-like glycosyltransferase 3 64 GT49 B3gnt1 100762253
UDP-GlcNAc:.beta.Gal .beta.-1,3-N- acetylglucosaminyltransferase 1
GT50 Pigm 100764842 phosphatidylinositol glycan anchor
biosynthesis, class M GT54 Mgat4a 100766200 mannosyl
(.alpha.-1,3-)-glycoprotein .beta.-1,4-
N-acetylglucosaminyltransferase GT54 Mgat4b 100768637 mannosyl
(.alpha.-1,3-)-glycoprotein .beta.-1,4-
N-acetylglucosaminyltransferase GT54 Mgat4c 100760589 mannosyl
(.alpha.-1,3-)-glycoprotein .beta.-1,4-
N-acetylglucosaminyltransferase GT57 Alg6 100753783
.alpha.-1,3-glucosyltransferase GT57 Alg8 100766150
.alpha.-1,3-glucosyltransferase GT58 Alg3 100772003
.alpha.-1,3-mannosyltransferase GT61 Eogt 100757071 EGF
domain-specific O-linked N- acetylglucosamine (GlcNAc) transferase
GT61 Pomgnt2 100770708 protein O-linked mannose N-
acetylglucosaminyltransferase 2 (.beta.1,4-) GT64 Ext12 100761218
exostosin-like glycosyltransferase 2 GT65 Pofut1 100753417 protein
O-fucosyltransferase 1 GT66 Stt3a 100751391 subunit of the
oligosaccharyltransferase complex (catalytic) GT66 Stt3b 100752084
subunit of the oligosaccharyltransferase complex (catalytic) GT68
Pofut2 100765129 protein O-fucosyltransferase 2 GT90 Kdelc1
100763723 KDEL (Lys-Asp-Glu-Leu) containing 1 GT90 Poglut1
100760325 protein O-glucosyltransferase 1 GTnc Dpy19l1 100765722
dpy-19-like 1 (C. elegans) GTnc Dpy19l2 100752353 dpy-19-like 2 (C.
elegans) GTnc Dpy19l3 100756435 dpy-19-like 3 (C. elegans) GTnc
Dpy19l4 100759810 dpy-19-like 4 (C. elegans) GTnc Fktn 100761516
fukutin GTnc Plod3 100768993 procollagen-lysine, 2-oxoglutarate 5-
dioxygenase 3 GTnc Tmem5 100757873 transmembrane protein 5 --
Dpagt1 100689054 dolichyl-phosphate (UDP-N- acetylglucosamine) N-
acetylglucosaminephosphotransferase 1 .sup.(1)GT classification
system (Lombard et al. (2013). Nucl Acid Res 42: D1P: D490-D495)
.sup.(2)gene symbol HGNC .sup.(3)Gene ID GenBank .sup.(4)Protein
name UniProt
[0232] Similarly the transcriptome data for a CHO-K1 clone reported
in Xu et al. (Xu, Nagarajan et al. 2011) missed several
glycosyltransferase genes. We therefore performed RNA sequencing
analysis of a panel of CHO lines including ones with ZFN mediated
knockout of glycosyltransferase genes to assess the expression of
all glycosyltransferase genes in CHO. TABLE 3 provides a list of
the expression levels of all assigned CHO glycosyltransferase
genes, and a few qualitative differences in expression levels were
found compared to those reported previously (Xu, Nagarajan et al.
2011).
TABLE-US-00003 TABLE 3 Comparison of GTfs expression levels from
RNA_seq data for CHO-GS and CHO-K1 CHO- CHO-K1 RNA_seq CAZy GTf
genes (hGTfs GS_ depth family from Table 1)* FPKM**.sup.(4) (Xu et
al 2011)**.sup.(4) GT1 Alg13 13 na GT1 Alg14 27 55 GT1
Ugt1a1-10.sup.(,21 63 96 GT1 Ugt2a1.sup.(1) 0 0 GT1 Ugt2a3.sup.(1)
0 na GT1 Ugt2b10.sup.(1) na 0 GT1 Ugt2b11.sup.(1) na na GT1
Ugt2b15.sup.(1) na na GT1 Ugt2b17.sup.(1) na na GT1 Ugt2b28.sup.(1)
na 0 GT1 Ugt2b4.sup.(1) na na GT1 Ugt2b7.sup.(1) na na GT1
Ugt3a1.sup.(1) na na GT1 Ugt3a2.sup.(1) na na GT1 Ugt8 na 0 GT2
Alg5 53 71 GT2 B3gntl1 11 na GT2 Dpm1 85 78 GT2 Has1 na na GT2 Has2
0 0 GT2 Has3 0 2 GT3 Gys1 47 na GT3 Gys2 0 na GT4 Alg11 16 20 GT4
Alg2 19 52 GT4 Glt1d1 0 na GT4 Gtdc1 10 na GT4 Piga 8 9 GT6 Abo 0
na GT6 Gbgt1 4 na GT6 Ggta1p na na GT6 Glt6d1 na na GT7 B4galnt3 0
0 GT7 B4galnt4 0 0 GT7 B4galt1 15 36 GT7 B4galt2 38 41 GT7 B4galt3
25 74 GT7 B4galt4 19 28 GT7 B4galt5 14 71 GT7 B4galt6 8 71 GT7
B4galt7 31 169 GT7/31 Chpf 53 332 GT7/31 Chpf2 na 130 GT7/31 Chsy1
26 0 GT7/31 Chys3 na na GT7 Csgalnact1 0 0 GT7 Csgalnact2 9 0 GT8
Glt8d1 20 na GT8 Glt8d2 0 na GT8 Gxylt1 10 na GT8 Gxylt2 0 na GT8
Gyg 72 na GT8 Gyg2 na na GT8/49 Gyltl1b 0 0 GT8/49 Large 14 22 GT8
Xxylt1 70 na GT10 Fut10 0 0 GT10 Fut11 5 0 GT10 Fut4 0 0 GT10 Fut5
na 0 GT10 Fut6a 0 0 GT10 Fut6b 0 0 GT10 Fut7 0 0 GT10 Fut9 0 0 GT11
Fut1 0 0 GT11 Fut2 0 0 GT12 B4galnt1 0 0 GT12 B4galnt2 0 0 GT13
Mgat1 24 61 GT13 Pomgnt1 64 101 GT14 Gcnt1 0 0 GT14 Gcnt2 0 na GT14
Gcnt3 0 0 GT14 Gcnt4 0 0 GT14 Gcnt6 na na GT14 Gcnt7 0 na GT14
Xylt1 0 0 GT14 Xylt2 11 6 GT16 Mgat2 29 138 GT17 Mgat3 0 0 GT18
Mgat5 13 20 GT18 Mgat5b 0 0 GT21 Ugcg 40 na GT22 Alg12 34 69 GT22
Alg9 25 98 GT22 Pigb 24 75 GT22 Pigz 0 na GT23 Fut8 18 166 GT24
Uggt1 27 0 GT24 Uggt2 6 95 GT25 Cercam 7 na GT25 Glt25d1/Colgalt1
129 0 GT25 Glt25d2/Colgalt2 0 0 GT27 Galnt1 39 0 GT27 Galnt10 9 na
GT27 Galnt11 32 63 GT27 Galnt12 0 0 GT27 Galnt13 2 0 GT27 Galnt14 0
0 GT27 Galnt15/l2 0 0 GT27 Galnt16/l1 0 0 GT27 Galnt18 0 0 GT27
Galnt19/l3(Wbscr17) 0 63 GT27 Galnt2 60 324 GT27 Galnt3 0 0 GT27
Galnt4 3 na GT27 Galnt5 0 0 GT27 Galnt6 0 0 GT27 Galnt7 30 44 GT27
Galnt8 0 0 GT27 Galnt9 0 0 GT27 Galnt20/l5 0 0 GT27 Galnt17/l6 0 na
GT29 St3gal1 54 195 GT29 St3gal2 17 28 GT29 St3gal3 13 75 GT29
St3gal4 44 33 GT29 St3gal5 21 44 GT29 St3gal6 13 29 GT29 St6gal1 0
0 GT29 St6gal2 0 na GT29 St6galnac1 0 0 GT29 St6galnac2 0 0 GT29
St6galnac3 0 0 GT29 St6galnac4 24 67 GT29 St6galnac5 0 0 GT29
St6galnac6 18 25 GT29 St8sia1 0 0 GT29 St8sia2 0 0 GT29 St8sia3 0 0
GT29 St8sia4 3 0 GT29 St8sia5 0 0 GT29 St8sia6 0 0 GT31 B3galnt1 12
37 GT31 B3galnt2 30 0 GT31 B3galt1 1 0 GT31 B3galt2 0 0 GT31
B3galt4 2 16 GT31 B3galt5 0 0 GT31 B3galt6 5 42 GT31 B3galtl 19 na
GT31 B3gnt2 42 189 GT31 B3gnt3 0 0 GT31 B3gnt4 0 0 GT31 B3gnt5 0 0
GT31 B3gnt6 0 0 GT31 B3gnt7 0 0 GT31 B3gnt9 na na GT31 B3gntl1 11 0
GT31 C1galt1 15 26 GT31 C1galt1c1 26 120 GT31 Lfng 5 24 GT31 Mfng 0
0 GT31 Rfng 9 158 GT32 A4galt 0 0 GT32 A4gnt 0 0 GT33 Alg1 13 41
GT33 Alg1l na na GT33 Alg1l2 na na GT35 Pygb 61 na GT35 Pygl na na
GT35 Pygm 1 na GT39 Pomt1 15 0 GT39 Pomt2 9 0 GT41 Ogt 14 39 GT43
B3gat1 0 0 GT43 B3gat2 0 0 GT43 B3gat3 23 31 GT47/64 Ext1 21 83
GT47/64 Ext2 43 136 GT47/64 Extl1 9 2 GT47/64 Extl3 24 79 GT49
B3gnt1 32 0 GT50 Pigm 6 54 GT54 Mgat4a 0 0 GT54 Mgat4b 37 0 GT54
Mgat4c 0 na GT57 Alg6 19 22 GT57 Alg8 18 22 GT58 Alg3 15 38 GT59
Alg10 na 0 GT59 Alg10b na 0 GT61 Eogt 6 0 GT61 Pomgnt2 10 na GT64
Extl2 31 179 GT65 Pofut1 44 126 GT66 Stt3a 71 0 GT66 Stt3b 85 0
GT68 Pofut2 68 15 GT76 Pigv na na GT90 Kdelc1 26 na GT90 Poglut1 22
na -- Dpagt1.sup.(3) 40 59 GTnc Dpy19l1 25 na GTnc Dpy19l2 0 na
GTnc Dpy19l3 11 na GTnc Dpy19l4 5 na GTnc Fkrp na na GTnc Fktn 16
na GTnc Plod3 61 na GTnc Tmem5 49 na *a total of 208 hGTfs are
reduced to 200 plus Dpagt1 (a non GTf gene) resulting in total 201
genes included in the RNA_seq data comparison **the expression
levels are not directly comparable that the CHO-GS data is FRKP and
for the CHO-K1 data (Xu et al. 2011) depth of reads are takes as a
measure for expression, na denoted genes not analyzed due to
missing annotations .sup.(1)the Ugt1a and Ugt2a/b genes are very
heterogeneous among primates and rodents, and generally encodes the
rodent genomes larger and more heterogeneous set of
glucuronyltransferase genes .sup.(2)the Ugt1a1-10 represent one
locus with 9 genes, these have been combine into on gene in the RNA
seq data analysis .sup.(3)Dgagt1 is not included in the list of
human GTfs .sup.(4)na--not analyzed
[0233] To explore the functions of individual glycosyltransferase
genes putatively involved in N-glycosylation, the present invention
employed a ZFN-mediated KO screen in a CHO-GS cell line (Sigma),
and also in other cell lines. The present invention designed a KO
screen to dissect in vivo functions of all genes encoding
isoenzymes with potential to regulate N-glycosylation branching,
elongation, and terminal capping expressed in CHO (FIG. 14).
[0234] The present invention probed the effects of the knockout
screen on N-glycosylation capacity by recombinant expression of
human erythropoietin (EPO) in CHO mutant cell lines and analysis of
glycosylation of purified EPO by release of N-glycans and profiling
using MALDI-TOF. EPO was used as reporter for the N-glycosylation
capacity because this is one of the best characterized
N-glycoproteins produced in CHO having three N-glycans with mainly
tetraantennary structure, low level of poly-LacNAc, and .alpha.2,3
sialic acid capping (FIG. 15) (Sasaki, Ochi et al. 1988). EPO
expressed in the unmodified CHO-GS production line grown in
suspension in protein-free medium was glycosylated essentially
identical to past reports of EPO produced in CHO-K1 (FIG. 15).
Moreover, the glycosylation profile was essentially identical to
therapeutic products of EPO produced in CHO and claimed for in drug
filings (Sasaki, Bothner et al. 1987).
[0235] The present invention used ZFNs, TALENs and CRISPR/Cas9 to
target and knockout 19 glycosyltransferase genes (FIG. 14A)
involved in N-glycan branching (Mgat1/2/3/4A/413/4C/5/5B) (FIG. 5,
FIG. 21B), galactosylation (B4galt1/2/3/4 (FIG. 17), poly-LacNAc
elongation (B3gnt1/2/8) (FIG. 18), terminal capping by sialylation
(st3gal3/4/6) (FIG. 19), and core fucosylation (fut8) (FIG.
22).
[0236] N-glycan antennary status--The biosynthetic control of the
N-glycan antennary status was explored first. MGAT1 and 2 each
control formation of one of the two .beta.2 branches in biantennary
N-glycans, while potential partial functional redundancy is
predicted for tri- and tetraantennary branch formation by
MGAT4A/4B/4C (.beta.4-branch) and MGAT5/5B (.beta.6-branch),
respectively. Only MGAT4B and 5 were found to be substantially
expressed in CHO as evaluated by RNAseq results (TABLE 3), however,
surprisingly, targeting the Mgat4a gene had a clear effect although
minor, and only targeting both Mgat4a/4b completely eliminated
.beta.4-branched tetraantennary N-glycans (FIG. 16A-B).
[0237] Targeting Mgat5 in contrast eliminated L-PHA lectin labeling
of cells (FIG. 20) and .beta.6-branched tetraantennary structures
(FIG. 5), which is in agreement with studies of the Lec4 mutant
(Patnaik and Stanley 2006; North, Huang et al. 2010). Moreover,
stacking KO of Mgat4a/4b/5 produced almost homogenous biantennary
N-glycans with a minor amount of poly-LacNAc (FIG. 16B), which is
also found as a minor component in wildtype (WT) cells (North,
Huang et al. 2010).
[0238] Control of LacNAc-CHO cells express all seven known
.beta.4galactosyltransferases (TABLE 3), and our understanding of
the in vivo functions of these isoenzymes is poor. Only B4galt1-4
are expected to serve functions in N-glycosylation and they have
been suggested to have preferences for different N-glycan branches.
The current invention first screened individual KO of B4galt1-4 in
CHO-GS WT, and confirmed that B4galt1 appeared to have the major
role in LacNAc formation using EPO as reporter molecule (FIG. 17).
Thus, the invention could only assess contributions of the other
isoforms in stacked combinations with KO of B4galt1. Probing
stacked combinations by immunocytology with an antibody to LacNAc
show surprisingly that only stacked KO of B4galt1/3, and not
B4galt1/2/4, appeared to abolish galactosylation (FIG. 10). In
agreement with this the invention found that EPO expressed in
B4galt1/3 but not B4galt1/2 stacked KO clones had substantial
reduction (>90%) in galactosylation (FIG. 17).
[0239] The invention further tested stacked KO of individual
B4galt's in CHO-GS Mgat4a/4b/5 KO cell lines with homogeneous
biantennary N-glycans, and found that KO of B4galt1 eliminated
immunoreactivity for LacNAc while KO of B4galt2, 3, and 4 had no
substantial effects (FIG. 21A-B). This suggested that the B4galt1
encoded galactosyltransferase isoform is the major or only
isoenzyme capable of transferring Gal to biantennary N-glycans,
while the other isoforms also function with tri- and tetraantennary
N-glycans. To further test this the invention included a human
therapeutic IgG as a recombinant expressed reporter molecule (FIG.
22). Human IgGs most often only has one N-glycan in the conserved
region at Asn297, and this site is generally only glycosylated with
biantennary N-glycans with variable and heterogeneous degrees of
galactosylation and sialylation. Some IgG molecules have additional
N-glycan sites in the variable regions and these are usually
glycosylated with more complex tri and tetraantennary N-glycans
structures with efficient galactosylation and capping by sialic
acids. Importantly, recombinant expression of an IgG in CHO-GS with
KO of B4galt1 resulted in homogenous biantennary N-glycans without
galactosylation (FIG. 22). Since CHO only produces IgG with
biantennary structures normally, it follows that only knockout of
B4galt1 is required to achieve this. This demonstrates that the
inherent heterogeneity found in N-glycosylation on therapeutic
monoclonal antibodies can be eliminated by use of this modified CHO
cell line.
[0240] Since CHO produce a high degree of .alpha.6Fuc on N-glycans
and elimination of this glycosylation can be achieved by knockout
of FUT8, it is clear that the combinations of knockout of
Mgat4a/4b/5, B4galt1, and Fut8 as well as stacked KO of B4galt1 and
Fut8, will generate CHO clones producing homogenous N-glycans
without .alpha.6Fuc. Such production cell lines will be important
for producing therapeutic IgG antibodies with enhanced ADCC.
[0241] Control of poly-LacNAc--Poly-LacNAc on N-glycans has
consistently been found to be incomplete and heterogeneous (Fukuda,
Sasaki et al. 1989; Takeuchi, Inoue et al. 1989; North, Huang et
al. 2010). CHO cells generally produce low amounts of poly-LacNAc
on N-glycans and mainly on tetraantennary structures on the
.beta.6-branch controlled by MGAT5 (North, Huang et al. 2010).
Biosynthesis of poly-LacNAc on N-glycans is poorly understood and
three genes, B3gnt1, B3gnt2 and B3gnt8, are candidates (Narimatsu
2006). Using single gene KO of B3gnt1, B3gnt2, and B3gnt8 with LEL
lectin immunocytology the current invention identified B3gnt2 as
the key gene controlling the LacNAc initiation in CHO cells (FIG.
23), and EPO expressed in CHO with KO of B3gnt2 but not B3gnt1 were
devoid of poly-LacNAc (FIG. 18). Moreover, KO of B3gnt2 in CHO with
additional KO of Mgat4a/4b/5 resulted in EPO with homogenous
biantennary N-glycans without poly-LacNAc (FIG. 18). It was
surprising that B3GNT1 did not play a role as the gene was
originally identified by expression cloning as the poly-LacNAc
synthase (Sasaki, Kurata-Miura et al. 1997), although this gene was
later shown to also function in O-mannosylation (Bao, Kobayashi et
al. 2009). Surprisingly, KO of B3gnt8 did not weaken the LEL Lectin
immunocytology. B3gnt8 was previously shown to form heterodimer in
vitro with B3gnt2 and activate the enzyme activity of B3gnt2.
[0242] Control of sialylation--CHO produce exclusively .alpha.2,3
linked NeuAc capping of N-glycans (Watson, Bhide et al. 1994). A
few reports have suggested the presence of minor amounts of
.alpha.2,6NeuAc as well as NeuGc, and genes for synthesis of both
the .alpha.2,6linkage and CMP-NeuGc are found in CHO but these are
not normally expressed (TABLE 3). Nevertheless, either or both
genes may be inactivated by the current invention and in previous
reports (US patent US20130004992). All six known st3gal1-6
sialyltransferases are expressed in CHO cells (TABLE 3) and the
roles of each of these in sialylation of N-glycans are poorly
understood (Tsuji, Datta et al. 1996). The sialyltransferase genes
st3gal3, st3gal4, and st3gal6 were first targeted individually
using immunocytology to evaluate exposure of LacNAc, and it was
found that only KO of st3gal4 produced substantial exposure of
LacNAc (FIG. 24). Analysis of EPO expressed in single and stacked
KO clones showed that loss of st3gal4 and 6 produced substantial
exposure. In CHO WT KO of st3gal4/6 resulted in EPO with
heterogeneous tetraantennary N-glycans without sialylation (FIG.
19).
[0243] Using the current invention it was shown KO of St3gal4/6 in
combination with Mgat4a/4b/5 interestingly produced biantennary
N-glycans without sialylation but increase in poly-LacNAc (FIG.
25). Thus, CHO with st3gal4/6 KO can produce EPO with uncapped
LacNAc termini and this opens for the first time for de novo
engineering of recombinant glycoproteins with .alpha.2,6NeuAc
capping without competition by endogenous .alpha.2,3sialylation (El
Mai, Donadio-Andrei et al. 2013).
[0244] Monoantennary N-glycans--Using the current invention we also
probed the effect of mgat2 KO alone and in combination with
Mgat4a/4b/5 and st3gal4/6 (FIG. 32). KO of mgat2 alone produced a
mixture of mono and biantennary N-glycan structures, and in further
combination with Mgat4a/4b/5 homogeneous monoantennary N-glycans.
To confirm that the monoantennary N-glycan was linked .beta.1-2 to
the .alpha.1-3Man branch controlled by mgat1, we reintroduced by
knockin human MGAT4A as well as MGAT4A and 5 in combination
together with ST6Gal-I, which resulted in tri and tetraantennary
N-glycans, respectively (FIG. 32)
Reconstruction of Homogeneous Glycosylation
[0245] The present invention further provides strategies to develop
mammalian cell lines with defined and/or more homogenous
glycosylation capacities that serves as template for de novo
engineering of desirable glycosylation capacities by introduction
of one or more glycosyltransferases using site-directed gene
insertions and/or classical random transfection of cDNA and/or
genomic constructs. The strategy involves inactivating
glycosyltransferase genes to obtain a homogenous glycosylation
capacity in a particular desirable type of glycosylation, for
example using the deconstruction matrix developed herein for
N-glycosylation, and for example but not limited to inactivation of
the St3gal4 and sialyltransferase genes in a cell and obtaining a
cell without sialic acid capping of N-glycans. In such a cell the
de novo introduction of one or more new glycosylation capacities
that utilize the more homogenous truncated glycan product obtained
by one or more glycosyltransferase gene inactivation events, will
provide for non-competitive glycosylation and more homogeneous
glycosylation by the de novo introduced glycosyltransferases. For
example but not limited to introduction of a
.alpha.2,6sialyltransferase such as ST6GAL1 into a mammalian cell
with inactivated St3gal4 and St3gal6 sialyltransferase genes. The
general principle of the strategy is to simplify glycosylation of a
particular pathway, e.g. N-glycosylation, to a point with
reasonable homogeneous glycan structures being produced in the
mammalian cell in which one or more glycosyltransferase gene
inactivation events has been introduced in a deconstruction process
as provided in the present invention for N-glycosylation. Taking
such mammalian cell with deconstructed and simplified glycosylation
capacity, and introduce de novo desirable glycosylation capacities
that build on the glycan structures produced by the
deconstruction.
[0246] Reconstruction of N-Glycan Sialylation by Targeted
Knockin--De Novo Design of .alpha.2,6NeuAc Capping
[0247] Most glycoproteins in circulation in man are capped with
.alpha.2,6NeuAc (El Mai, Donadio-Andrei et al. 2013), while
essentially all recombinant therapeutics are produced with
.alpha.2,3NeuAc in CHO, HEK293 and other current production cell
lines. It is therefore clearly desirable to obtain mammalian cell
lines like CHO with capacity for production of more human-like
glycoproteins with homogeneous .alpha.2,6NeuAc capping. A number of
research groups have approached this and attempted to produce
stable CHO cells capable of producing homogenous N-glycans with
.alpha.2,6NeuAc capping without success (El Mai, Donadio-Andrei et
al. 2013).
[0248] To demonstrate the perspectives for reconstruction and de
novo glycoengineering enabled by our KO deconstruction screen, CHO
clones capable of producing homogenous .alpha.2,6NeuAc capping were
generated (FIG. 25). To circumvent past problems with random
plasmid integration (El Mai, Donadio-Andrei et al. 2013), ZFN
targeted knockin (KI) of ST6GAL1 with a modified ObLiGaRe strategy
into a SafeHarbor integration site was used (Maresca, Lin et al.
2013). This strategy also does not involve or need antibiotic
selection or maintenance for cloning and stability, which is
important for potential in production of recombinant therapeutics
for clinical use. Human ST6GAL1 introduced in CHO with KO of
St3gal4/6 produced the complete range of N-glycan antennary
structures with normal degree of NeuAc capping (FIG. 25), and when
introduced in CHO with additional KO of Mgat4a/4b/5, EPO was
produced with homogenous biantennary N-glycans capped by
.alpha.2,6NeuAc (FIG. 25). That the introduced sialylation was
indeed .alpha.2,6-linked NeuAc and not .alpha.2,3-linked was
confirmed by negative ion ESI-MS/MS as described in FIG. 15.
[0249] Surprisingly, de novo introduction of ST6Gal-I abrogated the
minor amounts of poly-LacNAc formed on biantennary structures in
CHO with KO of Mgat4a/4b/5 (FIG. 25). Knockout of B3gnt2 was
required to eliminate poly-LacNAc in CHO WT and in CHO with KO of
Mgat4a/4b/5 (FIG. 18). This example clearly demonstrates the
intricate interplay between glycosyltransferases using the same
acceptor substrate, and how different glycosylation reactions may
out compete each other in unpredictable ways. Thus, it is possible
to introduce capacity for .alpha.2,6NeuAc sialylation without
competing .alpha.2,3sialylation, and to reconstruct a CHO cell
capable of producing sialylated N-glycoproteins with homogeneous
.alpha.2,6NeuAc capping either with the normal repertoire of
N-glycan branching or with homogeneous biantennary N-glycans.
Construction of Monoantennary N-Glycans Suitable for Homogeneous
Enzymatic Glycomodification
[0250] Enzymatic glycopegylation and other modifications of
proteins is a well-established method for site-specific attachments
of poly-ethylene glycol (PEG) chains or other compounds to prolong
half-life of drugs (DeFrees, Wang et al. 2006). Site-specific
glycomodification of N-glycans using an
.alpha.2,3-sialyltransferase to introduce the modification through
a modified CMP-NeuAc substrate relies on i) a purified recombinant
expressed glycoprotein with one or more N-glycans; ii) removal of
sialic acids capping the N-glycans on the glycoprotein using a
recombinant neuraminidase; and iii) transfer of the modified sialic
acid to exposed galactose residues on the N-glycans using a
recombinant sialyltransferase and the modified donor substrate.
N-glycans on recombinant glycoproteins have varying degree of bi,
tri and tetra antennary structures and desialylation of recombinant
glycoproteins expose multiple galactose residues from each
antennary structure, which results in substantial heterogeneity in
the enzymatic glycomodification process. To overcome the
desialylation step we produced a number of CHO engineering designs
that produce N-glycans without sialic acid capping (FIGS. 19, 25,
and 32), and these would enable direct enzymatic glycomodification
without pretreatment with neuraminidase to remove sialic acids. To
overcome the heterogeneity induced by multiple exposed galactose
acceptor sites for enzymatic transfer on each multiantennary
N-glycan we targeted mgat2 to block formation of biantennary
structures, but KO of mgat2 alone did not as originally expected
generate homogeneous monoantennary structures (FIG. 32). Instead
about 50% was still biantennary, but combined with KO of
mgat4A/4B/5 rather homogeneous monoantennary structures were
obtained. The only detectable heterogeneity was associated with
poly-LacNAc, which does not provide exposure of multiple galactose
residues (FIG. 18).
[0251] Rather homogeneous mono-antennary structure may also be
accomplished by the following double KO's: KO of Mgat2/4B or KO of
Mgat2/5. (FIG. 35).
[0252] For IgG antibody a homogeneous mono antennary structure and
higher degree of sialylation may be obtained by KO of Mgat2 (FIG.
36).
Knockout of Unnecessary Glycosylation Pathways
[0253] The methods of the invention allowed investigating if
inactivation of different O-glycosylation pathways would affect
cell viability and glycosylation efficiencies of non-targeted
glycosylation pathways. We first abrogated the Core1 elongation
pathway of O-GalNAc glycosylation as described previously (Yang,
Halim et al. 2014) by inactivation of the Cosmc chaperone for the
core1 synthase, C1Gal-T1, which leads to CHO cells capable of
producing EPO with truncated O-GalNAc glycosylation limited to a
single GalNAc residue without sialylation at the single
O-glycosite. CHO WT produces O-glycans with both .alpha.2,3 and
.alpha.2,6 sialic acid capping and O-GalNAc glycosylation is one of
the most abundant type of protein glycosylation in a cell, and
hence demanding on the sugar nucleotide pool. In line with this we
found that EPO produced in CHO with inactivation of Cosmc and
O-glycan elongation, produced EPO with improved sialic acid capping
of N-glycans at all three N-glycosites present in EPO (FIG. 29)
[0254] Applying methods of current invention the elongation pathway
of O-Man glycosylation was targeted by inactivation of Pomgnt1,
which encodes the .beta.2GlcNAc-transferase synthesizing the major
elongation pathway of O-Man glycans (ref PNAS). Proteins like
dystroglycan expressed in mammalian cells, including CHO (Yang,
Halim et al. 2014), have dense coverage of the O-Man
tetrasaccharide
(NeuAc.alpha.2,3Gal.beta.1,4GlcNAc.beta.1,2Man.alpha.). When EPO
was expressed in a CHO cell with inactivation of Pomgnt1 the degree
of galactose, polyLacNac and sialic acid capping was enhanced (FIG.
30).
[0255] The current invention was applied to inactivate the
elongation pathway of O-Xyl glycosylation by KO of B4galt7, which
encodes the 34Galactosyltransferase synthesizing the second step in
the linker region required for proteoglycan biosynthesis (Almeida,
Levery et al. 1999). CHO cells produce proteoglycans and have
efficient capacities for producing these on e.g. exogenously
supplied saccharides. When EPO was expressed in a CHO cell with
inactivation of B4galt7 the degree of galactose, poly-LacNac and
sialic acid capping was enhanced (FIG. 30)
[0256] Current invention was also used to inactivate combinations
of two or three genes controlling O-GalNAc, O-Man, and O-Xyl
glycosylation pathways. Specifically CHO cells were generated with
inactivation of both B4galt7 and Pomgnt1, and with inactivation of
B4galt7, Pomgnt1, and Cosmc. When EPO was expressed in such CHO
cell lines with inactivation of two or three types of
O-glycosylation pathways the degree of galactose and sialic acid
capping was enhanced.
[0257] These results clearly demonstrate that the capacity for more
homogeneous glycosylation of recombinant expressed proteins in
mammalian cells such as CHO can be improved by inactivation of
unnecessary glycosylation pathways that utilize the common sugar
nucleotide donor pools and other parts of the general cells
metabolic and glycosylation capacities. It is known to the skilled
in the art that inactivation of other genes listed in TABLES 1 and
2 in the above glycosylation pathways or other glycosylation
pathways will have similar effects and may be desirable engineering
events alone or in combination with any of the genetic engineering
performed herein or conceivable from the glycosylation pathways
outlined in FIG. 13.
[0258] The general principle for selection of optimal inactivation
strategies with the aim to direct use of sugar nucleotides in a
mammalian host cell for glycosylation pathways that are relevant
for recombinant production of a given glycoprotein, is to block
non-relevant glycosylation pathways at an early step in the
biosynthetic pathway where a single gene inactivation results in
truncated glycan structures preferably without elongation and
capping by sialic acid, and/or galactose, and/or GlcNAc. Examples
are provided for inactivation of three distinct types of
O-glycosylation by targeting the second step in their biosynthesis
to avoid and/or limit use of CMP-NeuAc, UDP-Gal and UDP-GlcNAc for
elongation of these pathways. It is evident that many other genes
listed in Table 2 with assigned biosynthetic steps for the
different glycosylation pathways in the mammalian CHO cell, may be
targeted by inactivation to achieve the same or similar effects on
the use of donor sugar nucleotides with consideration of the
effects the inactivation has on the glycosylation pathway and the
altered glycan structures.
Knockout of Unnecessary Glycosyltransferases
[0259] ER-Golgi resident glycosyltransferases are retained to
function in the secretory pathway by a variety of partly known
functions including kin-recognition, type and length of
transmembrane region, interactions through the stem region (Colley
1997), and through COP-I vesicle retrograde transport presumably
dependent on the cytosolic tails and TMs of the glycosyltransferase
proteins by e.g. GOLPH3 (Eckert, Reckmann et al. 2014). When
glycosyltransferases are not retained in their natural position in
the secretory pathway, they may function different and adversely in
glycosylation, and when glycosyltransferases loose their retention,
e.g. by proteolytic cleavage in the stem region they become
secreted and released with little or no influence left on the
glycosylation processes in cells. With the many
glycosyltransferases expressed in any given mammalian cell, and
e.g. at least over 60 in CHO cells (TABLE 3), we hypothesized that
there would be common mechanisms of retention of groups and/or
classes of enzymes. A group or class of enzymes could be
constituted without intention of limitations e.g. enzymes working
in the same pathway, and/or in consecutive biosynthetic steps,
and/or enzymes retained in the same subcellular topology, and/or
enzymes having similar amino acid sequence and/or structural
retention signals. The latter could without intention of
limitations e.g. be found in homologous isoenzymes given that they
have similar sequences, related catalytic properties, and at least
in some cases have been shown to have similar subcellular
topologies (Rottger, White et al. 1998). One such group of
isoenzymes is the 34galactosyltransferases of which especially
B4GAL-T1, T2, T3 and T4 have the highest degree of sequence
similarity and related functions (Amado, Almeida et al. 1999;
Togayachi, Sato et al. 2006). The understanding of the in vivo
functions of these four enzymes is poor and all have ben shown to
produce the Gal.beta.1-4GlcNAc linkage in vitro. As shown herein
.beta.4Galt1 and 3 appear to be the main
.beta.4galactosyltransferases involved in N-glycosylation, and
previous studies have demonstrated that B4GALT4 primarily has roles
in glycolipid biosynthesis and/or in sulfated glycans (Schwientek,
Almeida et al. 1998). We therefore generated CHO cells with
inactivation of B4galt4 in CHO WT as well as combined with
inactivation of mgat4a/4b/5. Expression of EPO in CHO cells with
inactivation of B4galt4 alone resulted in increased tetraantennary
N-glycans with more complete sialic acid capping (FIG. 17). KO of
B3gnt2 resulted in EPO glycostructures without poly LacNac (FIG.
35) whereas KO of B4galt5/6 gave more polyLacNac (FIG. 35). Along
these lines IgG produced in CHO cells in which St3gal4/6 has been
knocked out have higher galactosylation (FIG. 36). These results
clearly demonstrate that the capacity for more homogeneous
glycosylation of recombinant expressed proteins in mammalian cells
such as CHO can be improved by inactivation of unnecessary
glycosyltransferases that may compete for mechanisms directing
ER-Golgi residence and/or utilize the common sugar nucleotide donor
pools and other parts of the general metabolic and glycosylation
capacities in a mammalian cell.
[0260] These results clearly demonstrate that the capacity for more
homogeneous glycosylation of recombinant expressed proteins in
mammalian cells such as CHO can be improved by inactivation of
unnecessary glycosylation pathways that utilize the common sugar
nucleotide donor pools and other parts of the general cells
metabolic and glycosylation capacities. It is known to the skilled
in the art that inactivation of other genes listed in TABLES 1 and
2 in the above glycosylation pathways or other glycosylation
pathways will have similar effects and may be desirable engineering
events alone or in combination with any of the genetic engineering
performed herein or conceivable from the glycosylation pathways
outlined in FIG. 13.
Knockout of Posttranslational N-Glycosylation Capacity
[0261] The oligosaccharyltransferase complex initiating
N-glycosylation of proteins consists of eight proteins of which one
subunit involves two paralogous genes, STT3A and STT3B. Studies
have suggested that an oligosaccharyltransferase complex containing
the STT3A subunit primarily function in co-translational
N-glycosylation, while an oligosaccharyltransferase complex
containing the STT3B subunit primarily function in
post-translational N-glycosylation. We hypothesized that the
fidelity and stoichiometry of co-translational N-glycosylation
naturally is better than that of post-translational
N-glycosylation. Many recombinantly expressed glycoproteins have
N-glycosites that are poorly utilized resulting in incomplete
N-glycan occupancy (stoichiometry) and/or N-glycan processing
(structure). We therefore next generated CHO cells with
inactivation of Stt3b as well as CHO cells with combined
inactivation of the Mgat4A/4B/5 genes. These CHO cells have
improved capacity for producing homogenous glycoproteins with
higher degree of N-glycan stoichiometry and/or glycan structures
when proteins with naturally poorly utilized N-glycosites are
expressed.
Knockout Targeting Strategy
[0262] It is clear to the known in the art that inactivation of a
glycosyltransferase gene can have a multitude of outcomes and
effects on the transcript and/or protein product translated from
this. Targeted inactivation experiments performed herein involved
PCR and sequencing of the introduced alterations in the genes as
well as RNAseq analysis of clones to determine whether a transcript
was formed and if potential novel splice variations introduced new
protein structures. Moreover, methods for determining presence of
protein from such transcripts are available and include mass
spectrometry and SDS-PAGE Western blot analysis with relevant
antibodies detecting the most N-terminal region of the protein
products.
[0263] The targeting constructs were generally designed to target
the first 1/3 of the open reading frame (ORF) of the coding regions
but other regions were targeted as well FIG. 14B. For most clones
selected, out of frame mutations (Indels) that introduced stop or
non-sense codons with the same exon were selected. This would be
expected to produce truncated proteins if any protein at all and
without the catalytic domain and hence enzymatic activity. The
majority of KO clones exhibited insertions and/or deletions
(indels) in the range of .+-.20 bps, and most targeted genes were
present with two alleles, while some (mgat4B and mgat5) were
present with 1 or 3 alleles, respectively (TABLE 4). In a few cases
larger deletions were found and these disrupted one or more exons
and exon/intron boundaries also resulting in truncated
proteins.
[0264] Most ER-Golgi glycosyltransferases share the common type 2
transmembrane structure with a short cytosolic tail that may direct
retrograde trafficking and residence time, a non-cleaved signal
peptide containing a hydrophobic transmembrane .alpha.-helix domain
for retention in the ER-Golgi membrane, a variable length stem or
stalk region believed to displace the catalytic domain into the
lumen of the ER-Golgi, and a C-terminal catalytic domain required
for enzymatic function (Colley 1997). Only polypeptide
GalNAc-transferases have an additional C-terminal lectin domain
(Bennett, Mandel et al. 2012). The genomic organization of
glycosyltransferase genes varies substantially with some genes
having a single coding exon and others more than 10-15 coding
exons, although few glycosyltransferase genes produce different
splice variants encoding different protein products.
[0265] Inactivation of glycosyltransferase genes in the early
coding regions may thus have a multitude of effects on transcript
and protein products if these are made: i) one or more transcripts
may be unstable and rapidly degraded resulting in little or no
transcript and/or protein; ii) one or more transcripts may be
stable but not or only poorly translated resulting in little or no
protein translation; iii) one or more transcripts may be stable and
translated resulting in protein translation; iv) one or more
transcripts may result in protein translation but protein products
are degraded due to e.g. truncations and/or misfolding; v) one or
more transcripts may result in protein translation and stable
protein products that are truncated and enzymatically inactive; and
vi) one or more transcripts may result in protein translation and
stable protein products that are truncated but have enzymatic
activity.
[0266] It is evident for the skilled in the art that gene
inactivation that lead to protein products with enzymatic activity
is undesirable, and these event are easily screened for by the
methods used in the present invention, e.g. but not limited to
lectin/antibody labeling and glycoprofiling of proteins expressed
in mutant cell lines.
[0267] However, it is desirable to eliminate potential truncated
protein products that may be expressed from mutated transcripts as
these may have undesirable affects on glycosylation capacity. Thus,
truncated protein products from type 2 glycosyltransferase genes
containing part of or entire part of the cytosolic, and/or the
transmembrane retention signal, and/or the stem region, and/or part
of the catalytic domain may exert a number of effects on
glycosylation in cells. For example, the cytosolic tail may compete
for COP-I retrograde trafficking of Golgi resident proteins
(Eckert, Reckmann et al. 2014), the transmembrane domain may
compete for localization in ER-Golgi and potential normal
associations and/or aggregations of proteins, and the stem region
as well as part of an inactive catalytic domain may have similar
roles or part of roles in normal associations and/or aggregations
of proteins in ER-Golgi. Such functions and other unknown ones may
affect specific glycosylation pathways that the enzymes are
involved in, specific functions of isoenzymes, or more generally
glycosylation capacities of a cell. While these functions and
effects are unknown and unpredictable today, it is an inherent part
of the present invention that selection of mammalian cell clones
with inactivated glycosyltransferase genes includes selection of
editing events that do not produce truncated protein products.
[0268] It is evident that the KO deconstruction screen performed
identifies the key glycogenes that control decisive steps in
N-glycosylation of proteins in CHO and provides a design matrix for
genetic deconstruction of N-glycosylation capacity to desirable
homogeneous structures that can serve as starting points for
reconstruction of improved, novel and/or more homogenous
glycosylation capacities by stable introduction of one or more
glycosyltransferase genes. FIG. 28 provides general examples of
N-glycan scaffolds that can be produced by the deconstruction
design matrix, which serves as platforms for reconstruction of
desirable more homogenous glycosylation capacities. The value of
this strategy of combined deconstruction and reconstruction is
clearly exemplified here by the design of CHO cells with capacity
for production of EPO with homogeneous biantennary N-glycans with
.alpha.2,3 and for the first time homogenous .alpha.2,6-sialic acid
capped N-glycans. These CHO lines complement and clearly extend the
milestone efforts performed previously to establish glycoengineered
yeast with capacity for production of EPO with homogenous
biantennary N-glycans as well as the tour-de-force chemical
synthesis of EPO with biantennary N-glycans (Hamilton, Davidson et
al. 2006; Wang, Dong et al. 2013). More specifically, the produced
CHO lines enable production of EPO and other glycoproteins in a
proven mammalian host cell with well-established protein folding
and processing capabilities and decades long safety profile for
human therapeutics.
[0269] It is further evident from the KO deconstruction screen
performed here that the CHO cell has remarkable plasticity and
tolerance for glycoengineering. The glycosylation capacities
achieved by KO's in CHO were found to be stable and consistent in
production of recombinant glycoproteins, and it is expected that
these CHO engineered CHO lines will perform similar to CHO WT in
bioprocessing. Furthermore, the reconstruction of glycosylation
capacities by KI exemplified by introduction of ST6Gal-1 without
competing .alpha.2,3sialyltransferases demonstrates that stable and
consistent glycoengineering can be achieved by the deconstruction
and reconstruction strategy invented here, and this should be
applicable to other desirable glycosylation capacities. This
includes rebuilding endogenous glycosylation capacities of CHO WT,
which are inconsistent and heterogenous such as for example
N-glycan multi-antennary branch formation (tri and tetra antennary)
and poly-LacNAc chains. Other examples include improving capacity
for capping N-glycans on IgG. Furthermore, the engineering design
matrix is expected to be transferable to any CHO host line as well
as established production lines. Moreover, the engineering design
matrix is expected to be transferable to any mammalian cell line
with due expansion depending on existence of more complex
glycosylation capacities. The panel of CHO cells generated here
will enable dissection and de novo reconstruction design of
N-glycosylation for any protein therapeutics. Moreover, this panel
of CHO cells can be used to produce therapeutic glycoproteins with
an array of different glycoforms, which for the first time will
enable experimental evaluation of the biological properties of
defined glycoforms and make rational selection of optimal designs.
The panel of CHO cells produced here enables direct testing of the
functional effects of specific N-glycan structures on any
therapeutic glycoprotein, which will provide guidance for the
optimal design of a glycoprotein drug. Thus, using the panel of CHO
cells the effect of N-glycan branching, poly-LacNAc extension, and
type of sialylation can be addressed in a systematic fashion. These
effects for example include protein secretion, stability, yield,
circulatory half-life in blood, biodistribution, bioactivity, and
general pharmacokinetic properties of relevance for therapeutic
drugs. The CHO panel will also enable e.g. design of de novo
glycoprotein therapeutics, where introduction of N-glycans are used
to enhance circulatory half-life without interfering with
biological activity. In this instance the effect of position, size
and structure of N-glycans introduced can be mapped in detail in
order to design new glycoprotein biologics with optimal
pharmacokinetic properties. The present invention thus provides a
new era for the biggest producer of glycoprotein therapeutics, the
CHO cell.
[0270] An object of the present invention relates to a cell
comprising one or more glycosyltransferase genes that have been
inactivated.
[0271] In one embodiment the cell has new and/or more homogeneous
stable glycosylation capacities.
[0272] In another embodiment of the present invention the cell
comprises two or more glycosyltransferase genes that have been
inactivated.
[0273] In another embodiment of the present invention the cell
comprises one or more glycosyltransferase genes that have been
introduced stably by site-specific gene or non-site-specific
knockin and with new and/or more homogeneous glycosylation
capacities.
[0274] Another object of the present invention relates to a cell
comprising one or more glycosyltransferase genes that have been
introduced stably by site-specific gene or non-site-specific
knockin. The cell may have new and/or more homogeneous
glycosylation capacities.
[0275] In one embodiment of the present invention the cell
comprises two or more glycosyltransferase that have been introduced
stably by site-specific or non-site-specific gene knockin.
[0276] An embodiment of the present invention relates to a cell
comprising one or more glycosyltransferase genes introduced stably
by site-specific or non-site-specific gene knockin, and furthermore
comprising one or more endogenous glycosyltransferase genes that
have been inactivated by knockout, and with improved and/or novel
and/or more homogeneous glycosylation capacities.
[0277] A further aspect of the present invention relates to a cell
comprising two or more glycosyltransferase genes encoding
isoenzymes with partial overlapping glycosylation functions in the
same biosynthetic pathway and/or same biosynthetic step
inactivated, and for which inactivation of two or more of these
genes is required for loss of said glycosylation functions in the
cell.
[0278] In one embodiment of the present invention the cell
comprises one or more glycosyltransferase genes inactivated to
block and truncate one or more glycosylation pathways.
[0279] In another embodiment of the present invention, the cell
comprises two or more glycosyltransferase genes inactivated to
block and truncate one or more glycosylation pathways.
[0280] In one embodiment of the present invention the cell
comprises targeted inactivation of one or more glycosyltransferase
genes for which no transcripts are detectable.
[0281] A further aspect of the present invention relates to a cell
comprising targeted inactivation of one or more glycosyltransferase
genes for which no protein products are detectable.
[0282] Another aspect of the present invention relates to a cell
comprising targeted inactivation of one or more glycosyltransferase
genes for which no protein products with intact cytosolic and/or
transmembrane region is detectable.
[0283] In another embodiment of the present invention is the
glycosyltransferase any one or more of the genes listed in Table 1,
2 or 3.
[0284] In a further embodiment of the present invention is the
glycosyltransferase that is inactivated a glycosyltransferase gene
that is not involved in the biosynthesis of the glycans on a
particular glycoprotein produced recombinantly in said cell.
[0285] In one embodiment of the present invention are the
glycosyltransferases that are inactivated working in the same
glycosylation pathway.
[0286] In another embodiment of the present invention are the
glycosyltransferases that are inactivated working in the same
glycosylation step.
[0287] In yet another embodiment of the present invention are the
glycosyltransferases that are inactivated working in consecutive
biosynthetic steps.
[0288] In one embodiment of the present invention are the
glycosyltransferases that are inactivated retained in the same
subcellular topology.
[0289] In another embodiment of the present invention are the
glycosyltransferases that are inactivated having similar amino acid
sequence.
[0290] In a further embodiment of the present invention are the
glycosyltransferases that are inactivated belonging to the CAZy
family.
[0291] In yet another embodiment of the present invention are the
glycosyltransferases that are inactivated belonging to same
subfamily of isoenzymes in a CAZy family.
[0292] In one embodiment of the present invention are the
glycosyltransferases that are inactivated having similar structural
retention signals (transmembrane sequence and length).
[0293] In another embodiment of the present invention are the
glycosyltransferase genes functioning in the same glycosylation
pathway inactivated, and wherein they are not involved in the same
glycosylation step.
[0294] In a further embodiment of the present invention are the
glycosyltransferase genes functioning in the same glycosylation
pathway inactivated, and wherein they are involved in the same
glycosylation step.
[0295] In a further embodiment of the present invention has FUT8
been knocked out.
[0296] In one embodiment of the present invention the cell or cell
line is a mammalian cell or cell line, or an insect cell or cell
line.
[0297] In another embodiment of the present invention the cell is
derived from Chinese hamster ovary or from human kidney.
[0298] In a further embodiment of the present invention the cell is
selected from the group consisting of CHO, NS0, SP2/0, YB2/0,
CHO-K1, CHO-DXB11, CHO-DG44, CHO-S, HEK293, HUVEC, HKB, PER-C6,
NS0, or derivatives of any of these cells.
[0299] In one embodiment of the present invention is the cell a CHO
cell.
[0300] In another embodiment of the present invention encodes the
cell furthermore an exogenous protein of interest.
[0301] In yet another embodiment of the present invention is the
protein of interest an antibody, an antibody fragment, or a
polypeptide.
[0302] In a further embodiment of the present invention is the
antibody is an IgG antibody.
[0303] In one embodiment of the present invention is the
polypeptide EPO, a protein involved in hemostasis, including a
coagulation factor.
[0304] In one embodiment of the present invention is the
glycosylation made more homogenous.
[0305] In another embodiment of the present invention is the
glycosylation non-sialylated.
[0306] In yet another embodiment of the present invention is the
glycosylation non-galactosylated.
[0307] In one embodiment of the present invention comprises the
glycosylation biantennary N-glycans.
[0308] In another embodiment of the present invention does the
glycosylation not comprise poly-LacNAc.
[0309] In yet another embodiment of the present invention is the
glycosylation any combination without fucose.
[0310] In one embodiment of the present invention has B4galt1 been
knocked out allowing generation of more homogeneous N-glycans
without galactose.
[0311] In another embodiment of the present invention has B4galt1
and fut8 been knocked out allowing generation of more homogeneous
N-glycans without galactose and fucose.
[0312] In yet another embodiment of the present invention has
B4galt1 and B4galt3 been knocked out resulting in more homogeneous
N-glycans without galactose than obtained with single ko of B4galt1
or B4galt3 (FIG. 36).
[0313] In one embodiment of the present invention, the cell has
knockout of one or more of the glycosyl transferase genes selected
from the group consisting of mgat1, mgat2, mgat4A, mgat4B, mgat4C,
mgat5 and mgat5B.
[0314] In another embodiment of the present invention, the cell has
knockout of one or more of the glycosyltransferase genes selected
from the group consisting of mgat4A, mgat4B, and mgat4C.
[0315] In a further embodiment of the present invention, the cell
has knockout of mgat4A, mgat4B, and mgat4C.
[0316] In another embodiment of the present invention, the cell has
knockout of mgat5 and/or mgat5B.
[0317] In yet another embodiment of the present invention, the cell
has knockout of mgat5 and mgat5B.
[0318] In one embodiment of the present invention, the cell has
knockout of one or more of the galatosylation genes selected from
the group consisting of B4gal1, B4gal2, B4gal3 and B4 gal.
[0319] In another embodiment of the present invention, B4gal1 or
B4gal3, or B4gal1 and B4gal3 has been knocked out.
[0320] In a further embodiment of the present invention, the cell
has knockout of one or more of the poly-LacNAc elongation genes
selected from the group consisting of B3gnt1, B3gnt2 and
B3gnt8.
[0321] In yet another embodiment of the present invention, B3gnt2
has been knocked out.
[0322] In one embodiment of the present invention, B3gnt2, mgat4A,
mgat4B and mgat5 have been knocked out.
[0323] In another embodiment of the present invention, the cell has
knockout of one or more of the sialyltransferase genes selected
from the group consisting of ST3gal3, ST3gal4 and ST3gal6.
[0324] In yet another embodiment of the present invention, ST3gal3,
ST3gal4 and
[0325] ST3gal6 have been knocked out.
[0326] In a further embodiment of the present invention, ST3gal4
and ST3gal6 have been been knocked out.
[0327] In one embodiment of the present invention, ST3gal4,
ST3gal6, mgat4A, mgat4B and mgat5 have been knocked out.
[0328] In another embodiment of the present invention, ST6gal1 has
been knocked in and ST3gal4 and ST3gal6 have been knocked out.
[0329] In yet another embodiment of the present invention, ST6gal1
has been knocked in and ST3gal4, ST3gal6, mgat4A, mgat4B and mgat5
have been knocked out.
[0330] In one embodiment of the present invention, mgat2, ST3gal4,
and ST3gal6 have been knocked out.
[0331] In another embodiment of the present invention, mgat2,
mgat4A, mgat4B and mgat5 have been knocked out.
[0332] In yet another embodiment of the present invention, mgat2,
ST3gal4, ST3gal6, mgat4A, mgat4B, and mgat5 have been knocked
out.
[0333] In a further embodiment of the present invention has mgat2
been knocked out with and without knockout of mgat4A and/or mgat4B
and/or mgat5 allowing production of N-glycans with monoantennary
structure.
[0334] In yet another embodiment of the present invention has mgat2
been knocked out with and without knockout of mgat4A and/or mgat4B
and/or mgat5 in combination with knockout of sialyltransferases
allowing production of N-glycans with monoantennary structure and
without sialic acid capping.
[0335] In one embodiment of the present invention has mgat2 been
knocked out with and without knockout of mgat4A and/or mgat4B
and/or mgat5 in combination with KO of sialyltransferases and
B3gnt2 allowing production N-glycans with monoantennary structure
and without sialic acid capping and without poly-LacNAc.
[0336] One aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
homogeneous glycoconjugate produced from a glycoprotein having a
simplified glycan profile.
[0337] An object of the present invention is to provide a cell
capable of expressing a gene encoding a polypeptide of interest,
wherein the polypeptide of interest is expressed comprising one or
more posttranslational modification patterns.
[0338] In one embodiment of the present invention is the
posttranslational modification pattern a glycosylation.
[0339] The optimal glycoform of a glycoprotein may be identified by
the following process:
[0340] (i) producing a plurality of different glycoforms of said
glycoprotein by expressing in cell lines harboring at least one
novel glycosylation capacity for example by harboring two or more
modifications of GT gene expression levels, and (ii) determination
of the activity of the different glyco forms in comparison with a
reference glycoprotein in (a) suitable bioassay(s); and (iii)
selection of the glycoform with the higher/highest activity and
determination of the production cell genotype fingerprint which is
correlated with the higher/highest activity level of said
glycoprotein.
[0341] The above described process allows the identification of the
optimal glycoform of a glycoprotein. For those skilled in the art
by using the genotype fingerprint identified in (iii) may generate
an efficient engineered cell line with the optimal genotype for
producing glycoprotein with said glycoform.
[0342] Another aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
homogeneous glycoprotein conjugate comprising a polymer selected
from, PEG, HEP, XTEN, PSA, HES.
[0343] A further aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
homogeneous PEGylated protein conjugate produced from a protein
variant according to the invention having a simplified glycan
profile.
[0344] Another aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
homogeneous PEGylated EPO conjugate produced from an EPO variant
having a simplified glycan profile.
[0345] One aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
simplified enzymatic glycoPEGylation process using glycoengineered
EPO variants that provides high yield of di- and triPEGylated EPO
forms.
[0346] Another aspect of the present invention relates to a
glycoprotein according to the present invention, which is a protein
conjugate according to the invention comprising FII, FV, FVIIa,
FVIII, FIX, FX, FXIII, a Fab fragment of an antibody, or a Fc
domain of an antibody.
[0347] A further aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
protein-protein conjugate produced from a glycoprotein with a
simplified glycan profile.
[0348] In one embodiment of the present invention is the
glycoprotein according to the present invention a protein-protein
conjugate produced from a glycoprotein with a simplified glycan
profile comprising a Fab fragment and one of either FII, FV, FVIIa,
FVIII, FIX, FX or FXIII.
[0349] In another embodiment of the present invention is the
glycoprotein according to the present invention a protein-protein
conjugate produced from a glycoprotein with a simplified glycan
profile comprising a Fc Domain and one of either FII, FV, FVIIa,
FVIII, FIX, FX or FXIII.
[0350] In a further embodiment of the present invention is the
glycoprotein according to the present invention a homogeneous
PEGylated EPO conjugate produced from an EPO variant having a
simplified glycan profile.
[0351] One aspect of the present invention relates to the use of
recombinant glycoproteins comprising monoantennary N-glycans for
enzymatic modification of polypeptides.
[0352] One aspect of the present invention relates to a method for
inactivation of one or more glycosyltransferase genes in a
mammalian cell, the method comprising the step of inactivation of
one or more glycosyltransferase genes in a mammalian cell, and
determining that said gene inactivation can not result in protein
product with a transmembrane retention signal, and/or stem region,
and/or part of a catalytic domain.
[0353] Another aspect of the present invention relates to a method
for the production of a cell that can generate recombinant
glycoproteins that do not carry specific glycans, the method
comprising the step of inactivation of one or more
glycosyltransferase genes in a cell, wherein the one or more
glycosyltransferase genes are involved in the biosynthesis of the
specific glycans, and determining that said gene inactivation can
not result in protein product with a transmembrane retention
signal, and/or stem region, and/or part of a catalytic domain.
[0354] A further aspect of the present invention relates to a
method for the production of di- and triPEGylated EPO
glycoproteins, the method comprising the step of enzymatic
glycoPEGylation of glycoengineered polypeptides variants, such as
EPO variants.
[0355] One aspect of the present invention relates to a method for
producing a glycoproteins having modified glycan profile wherein
the cell producing the glycoprotein has more than one modification
of one or more glycosyltransferase genes.
[0356] In one embodiment of the present invention has the cells
been modified by glycosyltransferase gene knock-out and/or knock-in
of an exogeneous DNA sequence coding for a glycosyltransferase.
[0357] In one embodiment of the present invention is Cosmc knocked
in or knocked out.
[0358] One aspect of the present invention relates to a method for
producing a glycoprotein having a simple glycan profile, the method
comprising inactivation of one or more glycosyltransferases, and/or
knockin of one or more glycosyltransferases, or a combination
hereof in a cell, and expression of a protein in said cell.
[0359] Another aspect of the present invention relates to a method
for generating glycoproteins with improving glycosylation
efficiency, the method comprising the step of inactivation of one
or more glycosyltransferase genes to block and truncate one or more
glycosylation pathways.
[0360] A further aspect of the present invention relates to a
method for the production of recombinant glycoproteins that do not
have specific types of glycosylation, the method comprising the
step of inactivating two or more glycosyltransferase genes to block
and truncate one or more glycosylation pathways.
[0361] One aspect of the present invention relates to a method for
the production of recombinant glycoproteins, comprising the step of
generating a mammalian cell with specific glycosylation
properties.
[0362] In one embodiment of the present invention is the specific
glycosylation property the capacity for monoantennary N-glycan
synthesis.
[0363] A further aspect of the present invention relates to a
glycoprotein obtainable from a method according to the present
invention.
[0364] In one embodiment of the present invention has the
glycostructure outcome one or more of the following changes
selected from the group consisting of simpler glycan structure,
more homogeneous product, more sialic acids per molecule,
non-sialylated, non-galactosylated, more homogeneous bi-antennary,
more homogeneous monoantennary, more homogeneous triantennary, more
homogeneous without poly-LacNAc, higher productivity in cell
culture, new stable homogeneous glycosylation capacities, more
human glycostructure, more homogeneous glycosylation and improved
ADCC targeting of IgG, modified fucose level, no fucose, improved
substrate for generating glycoconjugates.
[0365] In another aspect of the present invention is one or more of
the above mentioned genes knocked out using transcription
activator-like effector nucleases (TALENs).
[0366] TALENs are artificial restriction enzymes generated by
fusing a TAL effector DNA binding domain to a DNA cleavage
domain.
[0367] In yet another aspect of the present invention is one or
more of the above mentioned genes knocked out using CRISPRs
(clustered regularly interspaced short palindromic repeats).
[0368] CRISPRs are DNA loci containing short repetitions of base
sequences. Each repetition is followed by short segments of "spacer
DNA" from previous exposures to a virus.
[0369] CRISPRs are often associated with cas genes that code for
proteins related to CRISPRs. The CRISPR/Cas system is a prokaryotic
immune system that confers resistance to foreign genetic elements
such as plasmids and phages and provides a form of acquired
immunity.
[0370] CRISPR spacers recognize and cut these exogenous genetic
elements in a manner analogous to RNAi in eukaryotic organisms.
[0371] The CRISPR/Cas system is used for gene editing (adding,
disrupting or changing the sequence of specific genes) and gene
regulation in species throughout the tree of life. By delivering
the Cas9 protein and appropriate guide RNAs into a cell, the
organism's genome can be cut at any desired location.
[0372] In a further embodiment of the present invention the
mammalian cell does or does not have .alpha.-1,6-fucosyltransferase
activity.
[0373] The cell of the present invention may by a cell that does
not comprise the gene of interest to be expressed or the cell may
comprise the gene of interest to be expressed. The cell that does
not comprise the gene of interest to be expressed is usually called
"a naked cell".
[0374] The host cell of the present invention may be any host, so
long as it can express an antibody molecule. Examples include a
yeast cell, an animal cell, an insect cell, a plant cell and the
like.
[0375] In one embodiment of the present invention is the cell
selected from the group consisting of CHO, NS0, SP2/0, YB2/0,
YB2/3HL.P2.G11.16Ag.20, NS0, SP2/0-Ag14, BHK cell derived from a
syrian hamster kidney tissue, antibody-producing hybridoma cell,
human leukemia cell line (Namalwa cell), an embryonic stem cell,
and fertilized egg cell.
[0376] In a preferred embodiment of the present invention is the
cell a CHO cell.
[0377] The cell can be an isolated cell or in cell culture or a
cell line.
[0378] The protein of interest can be various types of protein, and
in particular proteins that benefit from being expressed as
glycoproteins
[0379] In a preferred embodiment the protein is erythropoietin
(EPO).
[0380] In another embodiment is the protein
.alpha.1-antitrypsin.
[0381] In one aspect of the present invention is the protein a
recombinant blood factor.
[0382] In one embodiment of the present invention is the
recombinant blood factor selected from the group consisting of one
or more of factor VIII, factor IX, factor XIII A-subunit, thrombin,
and factor VIIa.
[0383] In yet another embodiment of the present invention the
protein of interest is a coagulation factor such as coagulation
factor II (FII), coagulation factor V (FV), coagulation factor VII
(FVIIa), coagulation factor VIII (FVIII), coagulation factor IX
(FIX), coagulation factor X (FX), or coagulation factor XIII
(FXIII).
[0384] In one aspect of the present invention is the protein human
growth hormone.
[0385] In yet another embodiment of the present invention is the
protein of interest an antibody, an antibody fragment, such as a
Fab fragment, an Fc domain of an antibody, or a polypeptide.
[0386] A further aspect of the present invention relates to a
method for producing an enzymatically modified glycoprotein,
comprising the step of generating a cell with specific
glycosylation properties, and the enzymatically modification of
interest.
[0387] In one embodiment of the present invention is the
enzymatically modification a polymer.
[0388] In another embodiment of the present invention is the
enzymatically modification a conjugation to another protein.
[0389] Another aspect of the present invention relates to a
glycoprotein according to the present invention, which is a
homogeneous glycoprotein conjugate comprising a polymer.
[0390] The glycoprotein can be enzymatically modified with the
polymer, and the glycoprotein can be produced by the cell according
to the present invention.
[0391] In one aspect of the present invention is the protein a
recombinant thrombolytic, anticoagulant or another blood-related
product.
[0392] In one embodiment of the present invention is the
recombinant thrombolytic, anticoagulant or another blood-related
product selected from the group consisting of one or more of tissue
plasminogen activator (tPA), hirudin, antithrombin, plasmin, plasma
kallikrein inhibitor, and activated protein C.
[0393] In one aspect of the present invention is the protein a
recombinant hormone.
[0394] In one embodiment of the present invention is the
recombinant hormone selected from the group consisting of one or
more of insulin, insulin degludec, human growth hormone,
somatropin, pegvisomant, follicle-stimulating hormone, follitropin
alfa, corifollitropin alfa, follitropin beta, metreleptin,
liraglutide, parathyroid hormone, lutropin, teriparatide,
nesiritide, and glucagon.
[0395] In one aspect of the present invention is the protein a
recombinant growth hormone.
[0396] In one embodiment of the present invention is the
recombinant growth hormone selected from the group consisting of
one or more of EPO, filgrastim, sargramostim, mecaserim, and
palifermin.
[0397] In one aspect of the present invention is the protein a
Recombinant interferon, interleukin or tumor necrosis factor.
[0398] In one embodiment of the present invention is the
Recombinant interferon, interleukin or tumor necrosis factor
selected from the group consisting of one or more of interferon
alfa, PEGinterferon alfa, PEGinterferon alfa-2a, PEGinterferon
alfa, interferon beta-1b, algulcosidase alfa, and laronidase.
[0399] In one aspect of the present invention is the protein an
antigen or vaccine component.
[0400] In one aspect of the present invention is the protein of the
present invention relevant for a disease or disorder selected from
the group consisting of one or more of Hemophilia A, Hemophilia B,
Acute myocardial infarction, heparinassociated thrombocytopenia,
venous thrombosis, Symptomatic vitreomacular adhesion/vitreomacular
traction, Acute angioedema, Hereditary antithrombin deficiency,
Hereditary angioedema, sepsis, diabetes, diabetes mellitus, Growth
failure/growth hormone deficiency, infertility/subfertility, Type 2
diabetes, Osteoporosis, Hypoglycemia, Paget's disease, cancer,
Anemia, Neutropenia, Hepatitis C, and Hyperuricemia, Rheumatoid
arthritis, hepatitis A and B, Arthritis, colitis, Crohn's,
psoriasis, ankylosing spondylitis, Ulcerative colitis.
[0401] In one embodiment of the present invention the protein is an
antibody.
[0402] In a preferred embodiment of the present invention is the
antibody an IgG antibody.
[0403] In the present invention, the antibody molecule includes any
molecule, so long as it comprises the Fc region of an antibody.
Examples include an antibody, an antibody fragment, a fusion
protein comprising an Fc region, and the like.
[0404] The antibody is a protein which is produced in the living
body by immune reaction as a result of exogenous antigen
stimulation and has an activity to specifically bind to the
antigen. Examples of the antibody include an antibody secreted by a
hybridoma cell prepared from a spleen cell of an animal immunized
with an antigen; an antibody prepared by a genetic recombination
technique, namely an antibody obtained by introducing an antibody
gene-inserted antibody expression vector into a host cell; and the
like. Specific examples include an antibody produced by a
hybridoma, a humanized antibody, a human antibody and the like.
[0405] A hybridoma is a cell which is obtained by cell fusion
between a B cell obtained by immunizing a mammal other than human
with an antigen and a myeloma cell derived from mouse or the like
and can produce a monoclonal antibody having the desired antigen
specificity.
[0406] Examples of the humanized antibody include a human chimeric
antibody, a human CDR-grafted antibody and the like.
[0407] A human chimeric antibody is an antibody which comprises an
antibody heavy chain variable region (hereinafter referred to as
"HV" or "VH", the heavy chain being "H chain") and an antibody
light chain variable region (hereinafter referred to as "LV" or
"VL", the light chain being "L chain"), both of an animal other
than human, a human antibody heavy chain constant region
(hereinafter also referred to as "CH") and a human antibody light
chain constant region (hereinafter also referred to as "CL"). As
the animal other than human, any animal such as mouse, rat,
hamster, rabbit or the like can be used, so long as a hybridoma can
be prepared therefrom.
[0408] The human chimeric antibody can be produced by obtaining
cDNA's encoding VH and VL from a monoclonal antibody-producing
hybridoma, inserting them into an expression vector for host cell
having genes encoding human antibody CH and human antibody CL to
thereby construct a human chimeric antibody expression vector, and
then introducing the vector into a host cell to express the
antibody.
[0409] As the CH of human chimeric antibody, any CH can be used, so
long as it belongs to human immunoglobulin (hereinafter referred to
as "hIg") can be used. But those belonging to the hIgG class are
preferable and any one of the subclasses belonging to the hIgG
class, such as hIgG1, hIgG2, hIgG3 and hIgG4, can be used. Also, as
the CL of human chimeric antibody, any CL can be used, so long as
it belongs to the hIg class, and those belonging to the .kappa.
class or .lamda. class can also be used.
[0410] A human CDR-grafted antibody is an antibody in which amino
acid sequences of CDR's of VH and VL of an antibody derived from an
animal other than human are grafted into appropriate positions of
VH and VL of a human antibody.
[0411] The human CDR-grafted antibody can be produced by
constructing cDNA's encoding V regions in which CDR's of VH and VL
of an antibody derived from an animal other than human are grafted
into CDR's of VH and VL of a human antibody, inserting them into an
expression vector for host cell having genes encoding human
antibody CH and human antibody CL to thereby construct a human
CDR-grafted antibody expression vector, and then introducing the
expression vector into a host cell to express the human CDR-grafted
antibody.
[0412] As the CH of human CDR-grafted antibody, any CH can be used,
so long as it belongs to the hIg, but those of the hIgG class are
preferable and any one of the subclasses belonging to the hIgG
class, such as hIgG1, hIgG2, hIgG3 and hIgG4, can be used. Also, as
the CL of human CDR-grafted antibody, any CL can be used, so long
as it belongs to the hIg class, and those belonging to the .kappa.
class or .lamda. class can also be used.
[0413] A human antibody is originally an antibody naturally
existing in the human body, but it also includes antibodies
obtained from a human antibody phage library, a human
antibody-producing transgenic animal and a human antibody-producing
transgenic plant, which are prepared based on the recent advance in
genetic engineering, cell engineering and developmental engineering
techniques.
[0414] Regarding the antibody existing in the human body, a
lymphocyte capable of producing the antibody can be cultured by
isolating a human peripheral blood lymphocyte, immortalizing it by
its infection with EB virus or the like and then cloning it, and
the antibody can be purified from the culture.
[0415] The human antibody phage library is a library in which
antibody fragments such as Fab, single chain antibody and the like
are expressed on the phage surface by inserting a gene encoding an
antibody prepared from a human B cell into a phage gene. A phage
expressing an antibody fragment having the desired antigen binding
activity can be recovered from the library, using its activity to
bind to an antigen-immobilized substrate as the marker. The
antibody fragment can be converted further into a human antibody
molecule comprising two full B chains and two full L chains by
genetic engineering techniques.
[0416] A human antibody-producing transgenic non-human animal is an
animal in which a human antibody gene is introduced into cells.
Specifically, a human antibody-producing transgenic animal can be
prepared by introducing a human antibody gene into ES cell of a
mouse, transplanting the ES cell into an early stage embryo of
other mouse and then developing it. By introducing a human chimeric
antibody gene into a fertilized egg and developing it, the
transgenic animal can be also prepared. Regarding the preparation
method of a human antibody from the human antibody-producing
transgenic animal, the human antibody can be produced and
accumulated in a culture by obtaining a human antibody-producing
hybridoma by a hybridoma preparation method usually carried out in
mammals other than human and then culturing it.
[0417] Examples of the transgenic non-human animal include cattle,
sheep, goat, pig, horse, mouse, rat, fowl, monkey, rabbit and the
like.
[0418] Another aspect of the present invention relates to a method
for producing an antibody composition, which comprises culturing
the mammalian cell according to the present invention in a medium
to produce and accumulate an antibody composition in the culture;
and recovering the antibody composition from the culture
[0419] Also, in the present invention, it is preferable that the
antibody is an antibody which recognizes a tumor-related antigen,
an antibody which recognizes an allergy- or inflammation-related
antigen, an antibody which recognizes circulatory organ
disease-related antigen, an antibody which recognizes an autoimmune
disease-related antigen or an antibody which recognizes a viral or
bacterial infection-related antigen, and a human antibody which
belongs to the IgG class is preferable.
[0420] An antibody fragment is a fragment which comprises the Fc
region of an antibody. Examples of the antibody fragment include an
H chain monomer, an H chain dimer and the like.
[0421] A fusion protein comprising an Fc region is a composition in
which an antibody comprising the Fc region of an antibody or the
antibody fragment is fused with a protein such as an enzyme, a
cytokine or the like.
[0422] One embodiment of the present invention relates to a
composition comprising the antibody of the present invention, also
referred to as antibody composition.
[0423] In one embodiment of the present invention shows the
antibody or antibody composition high ADCC activity.
[0424] In the present invention, the ADCC activity is a cytotoxic
activity in which an antibody bound to a cell surface antigen on a
tumor cell in the living body activate an effector cell through an
Fc receptor existing on the antibody Fc region and effector cell
surface and thereby obstruct the tumor cell and the like.
[0425] The antibody composition of the present invention has potent
antibody-dependent cell-mediated cytotoxic activity (ADCC). An
antibody having potent antibody-dependent cell-mediated cytotoxic
activity is useful for preventing and treating various diseases
including cancers, inflammatory diseases, immune diseases such as
autoimmune diseases, allergies and the like, circulatory organ
diseases and viral or bacterial infections.
[0426] In the case of cancers, namely malignant tumors, cancer
cells grow. General anti-tumor agents inhibit the growth of cancer
cells. In contrast, an antibody having potent antibody-dependent
cell-mediated cytotoxic activity can treat cancers by injuring
cancer cells through its cell killing effect, and therefore, it is
more effective as a therapeutic agent than the general anti-tumor
agents.
[0427] In immune diseases such as inflammatory diseases, autoimmune
diseases, allergies and the like, in vivo reactions of the diseases
are induced by the release of a mediator molecule by immunocytes,
so that the allergy reaction can be inhibited by eliminating
immunocytes using an antibody having potent antibody-dependent
cell-mediated cytotoxic activity.
[0428] Examples of the circulatory organ diseases include
arteriosclerosis and the like. The arteriosclerosis is treated
using balloon catheter at present, but circulatory organ diseases
can be prevented and treated by inhibiting growth of arterial cells
in restructure after treatment using an antibody having potent
antibody-dependent cell-mediated cytotoxic activity.
[0429] Various diseases including viral and bacterial infections
can be prevented and treated by inhibiting proliferation of cells
infected with a virus or bacterium using an antibody having potent
antibody-dependent cell-mediated cytotoxic activity.
[0430] The glycoproteins of the present invention may there for be
use to treat immune diseases, cancer viral or bacterial infections
or other diseases or disorders mentioned above.
[0431] The medicament comprising the glycoprotein composition of
the present invention can be administered as a therapeutic agent
alone, but generally, it is preferable to provide it as a
pharmaceutical formulation produced by an appropriate method well
known in the technical field of manufacturing pharmacy, by mixing
it with at least one pharmaceutically acceptable carrier.
[0432] It is desirable to select a route of administration which is
most effective in treatment. Examples include oral administration
and parenteral administration, such as buccal, tracheal, rectal,
subcutaneous, intramuscular, intravenous or the like. In an
antibody preparation, intravenous administration is preferable.
[0433] The dosage form includes sprays, capsules, tablets,
granules, syrups, emulsions, suppositories, injections, ointments,
tapes and the like.
[0434] Examples of the pharmaceutical preparation suitable for oral
administration include emulsions, syrups, capsules, tablets,
powders, granules and the like.
[0435] Liquid preparations, such as emulsions and syrups, can be
produced using, as additives, water; saccharides, such as sucrose,
sorbitol, fructose, etc.; glycols, such as polyethylene glycol,
propylene glycol, etc.; oils, such as sesame oil, olive oil,
soybean oil, etc.; antiseptics, such as p-hydroxybenzoic acid
esters, etc.; flavors, such as strawberry flavor, peppermint, etc.;
and the like.
[0436] Capsules, tablets, powders, granules and the like can be
produced using, as additive, fillers, such as lactose, glucose,
sucrose, mannitol, etc.; disintegrating agents, such as starch,
sodium alginate, etc.; lubricants, such as magnesium stearate,
talc, etc.; binders, such as polyvinyl alcohol,
hydroxypropylcellulose, gelatin, etc.; surfactants, such as fatty
acid ester, etc.; plasticizers, such as glycerine, etc.; and the
like.
[0437] Examples of the pharmaceutical preparation suitable for
parenteral administration include injections, suppositories, sprays
and the like.
[0438] Injections may be prepared using a carrier, such as a salt
solution, a glucose solution, a mixture of both thereof or the
like. Also, powdered injections can be prepared by freeze-drying
the antibody composition in the usual way and adding sodium
chloride thereto.
[0439] Suppositories may be prepared using a carrier such as cacao
butter, hydrogenated fat, carboxylic acid or the like.
[0440] Also, sprays may be prepared using the antibody composition
as such or using a carrier which does not stimulate the buccal or
airway mucous membrane of the patient and can facilitate absorption
of the antibody composition by dispersing it as fine particles.
[0441] Examples of the carrier include lactose, glycerol and the
like. Depending on the properties of the antibody composition and
the carrier, it is possible to produce pharmaceutical preparations
such as aerosols, dry powders and the like. In addition, the
components exemplified as additives for oral preparations can also
be added to the parenteral preparations.
[0442] Although the clinical dose or the frequency of
administration varies depending on the objective therapeutic
effect, administration method, treating period, age, body weight
and the like, it is usually 10 .mu.g/kg to 20 mg/kg per day and per
adult.
[0443] It should be noted that embodiments and features described
in the context of one of the aspects of the present invention also
apply to the other aspects of the invention.
Definitions
General Glycobiology
[0444] Basic glycobiology principles and definitions are described
in Varki et al. Essentials of Glycobiology, 2nd edition, 2009.
[0445] "N-glycosylation" refers to the attachment of the sugar
molecule oligosaccharide known as glycan to a nitrogen atom residue
of a protein
[0446] "O-glycosylation" refers to the attachment of a sugar
molecule to an oxygen atom in an amino acid residue in a
protein.
[0447] "Galactosylation" means enzymatic addition of a galactose
residue to lipids, carbohydrates or proteins.
[0448] "Sialylation" is the enzymatic addition of a neuraminic acid
residue.
[0449] "Neuraminic acid" is a 9-carbon monosaccharide, a derivative
of a ketononose.
[0450] "Monoantennary" N-linked glycan is a engineered N-glycan
consist of the N-glycan core
(Man.alpha.1-6(Man.alpha.1-3)Man.beta.1-4GlcNAc.beta.1-4GlcNAc.beta.1-Asn-
-X-Ser/Thr) that elongated with a single GlcNAc residue linked to
C-2 and of the mannose .alpha.1-3. The single GlcNAc residue can be
further elongated for example with Gal or Gal and NeuAc
residues.
[0451] "Biantennary" N-linked glycan is the simplest of the complex
N-linked glycans consist of the N-glycan core
(Man.alpha.1-6(Man.alpha.1-3)Man.beta.1-4GlcNAc.beta.1-4GlcNAc.beta.1-Asn-
-X-Ser/Thr) elongated with two GlcNAc residues linked to C-2 and of
the mannose .alpha.1-3 and the mannose .alpha.1-6. This core
structure can then be elongated or modified by various glycan
structures.
[0452] "Triantennary" N-linked glycans are formed when an
additional GlcNAc residue is added to either the C-4 of the core
mannose .alpha.1-3 or the C-6 of the core mannose .alpha.1-6 of the
bi-antennary core structure. This structure can then be elongated
or modified by various glycan structures.
[0453] "Tetratantennary" N-linked glycans are formed when two
additional GlcNAc residues are added to either the C-4 of the core
mannose .alpha.1-3 or the C-6 of the core mannose .alpha.1-6 of the
bi-antennary core structure. This core structure can then be
elongated or modified by various glycan structures.
[0454] "Poly-LacNAc" poly-N-acetyllactosamine
([Gal.beta.1-4GlcNAc]n; n 2.)
[0455] "Glycoprofiling" means characterization of glycan structures
resident on a biological molecule or cell.
[0456] "Glycosylation pathway" refers to assembly of
monosaccharides into a group of related complex carbohydrate
structures by the stepwise action of enzymes, known as
glycosyltransferases. Glycosylation pathways in mammalian cells are
classified as N-linked protein glycosylation, different O-linked
protein glycosylation (O-GalNAc, O-GlcNAc, O-Fuc, O-Glc, O-Xyl,
O-Gal), different series of glycosphingolipids, and
GPI-anchors.
[0457] "Biosynthetic Step" means the addition of a monosaccharide
to a glycan structure.
[0458] "Glycosyltransferases" are enzymes that catalyze the
formation of the glycosidic linkage to form a glycoside. These
enzymes utilize `activated` sugar phosphates as glycosyl donors,
and catalyze glycosyl group transfer to a nucleophilic group,
usually an alcohol. The product of glycosyl transfer may be an O-,
N-, S-, or C-glycoside; the glycoside may be part of a
monosaccharide, oligosaccharide, or polysaccharide.
[0459] "Glycosylation capacity" means the ability to produce an
amount of a specific glycan structure by a given cell or a given
glycosylation process.
[0460] "HEP" is an abbreviation for heparosan. Heparosan (HEP) is a
natural sugar polymer comprising (-GlcUA-1,4-GlcNAc-1,4-) re-peats.
It belongs to the glycosaminoglycan polysaccharide family and is a
negatively charged polymer at physiological pH. It can be found in
the capsule of certain bacteria's but it is also found in higher
vertebrate where it serves as precursor for the natural polymers
heparin and heparan sulphate.
[0461] "PEG" is an abbreviation for polyethylene glycol. PEG
polymers are generally used for increasing the half-life of
therapeutic molecule. With their high hydrodynamic volume, PEG
polymers increases the effective size of drugs and thus slows their
clearance from the bloodstream via kidney filtration or by
shielding the protein drug towards clearance receptors and
proteolytical degradation.
[0462] "XTEN" is well defined peptide sequences based on a limited
subset of amino acids, and assembled into longer repeating
sequences. XTEN also increases the size of therapeutic molecules
and prolongs their presence in the bloodstream. "GlycoPEGylation"
is the process of covalently attaching PEG to glycans of a protein
of interest.
[0463] "Enzymatic GlycoPEGylation" is the process of covalently
attaching PEG to glycans of a protein of interest using a
glycosyltransferase and suitable PEGylated glycosyl transfer
groups, such as PEGylated NeuAc-CMP molecules.
[0464] "Glycoconjugate" is a macromolecule that contains
monosaccharides covalently linked to proteins or lipids
[0465] "Simple.RTM. glycan structure" is a glycan structure
containing fewer monosaccharides and/or having lower mass and/or
having fewer antennae.
[0466] "Human like glycosylation" means having glycan structures
resembling those of human cells. Examples including more sialic
acids with .alpha.2,6 linkage (more .alpha.2,6 sialyltransferase
enzyme) and/or less sialic acids with .alpha.2,3 linkage and/or
more N-acetylneuraminic acid (Neu5Ac) and/or less
N-glycolylneuraminic acid (Neu5Gc).
[0467] "Cleavage" refers to the breakage of the covalent backbone
of a DNA molecule. Cleavage can be initiated by a variety of
methods including, but not limited to, enzymatic or chemical
hydrolysis of a phosphodiester bond. Both single-stranded cleavage
and double-stranded cleavage are possible, and double-stranded
cleavage can occur as a result of two distinct single-stranded
cleavage events. DNA cleavage can result in the production of
either blunt ends or staggered ends. In certain embodiments, fusion
polypeptides are used for targeted double-stranded DNA
cleavage.
[0468] "Deconstruction" means obtaining cells producing a simpler
glycan structures by single or stacked knock out of
glycosyltransferases. Deconstruction of a glycosylation pathway
means KO of glycosyltransferases involved in each step in
biosynthesis and identification of glycosyltransferases controlling
each biosynthetic step.
[0469] "Reconstruction" refers to inserting exogeneous gene(s) into
cells or activation of endogenous silent gene(s) to obtain more
complex glycan structures. Typically target cells are producing
simple glycan structures as result of deconstruction.
[0470] "Modified glycan profile" refers to change in number, type
or position of oligosaccharides in glycans on a given
glycoprotein.
[0471] More "homogeneous glycosylation" or "homogeneous stable
glycosylation capacities" means that the proportion of identical
glycan structures observed by glycoprofiling a given protein
expressed in one cell is larger than the proportion of identical
glycan structures observed by glycoprofiling the same protein
expressed in another cell. A more homogeneous glycosylation may be
obtained by knock-in and/or knock-out of one or more
glycosyltransferase genes in a cell. An example of such a
modification could be knock-out of B4galt1 to generate more
homogeneous N-glycans without galactose. Additional knock-out of
fut8 allows production of more homogeneous N-glycans without
galactose and fucose. Overall, this type of knock-in and/or
knock-out modifications can result in changes of the glycostructure
outcome of the modified cell, such as the non-limiting list of
simpler glycan structure, more homogeneous product, more sialic
acids per molecule, non-sialylated, non-galactosylated, more
homogeneous bi-antennary, more homogeneous monoantennary, more
homogeneous triantennary, more homogeneous glycosylation without
poly-LacNAc, higher productivity in cell culture, new stable
homogeneous glycosylation capacities, more human glycostructure,
more homogeneous glycosylation and improved ADCC targeting of IgG,
modified fucose level, no fucose, and improved substrate for
generating glycoconjugates.
[0472] General DNA, mol. biol. Any of various techniques used for
separating and recombining segments of DNA or genes, commonly by
use of a restriction enzyme to cut a DNA fragment from donor DNA
and inserting it into a plasmid or viral DNA. Using these
techniques, DNA coding for a protein of interest is
recombined/cloned (using PCR and/or restriction enzymes and DNA
ligases or ligation independent methods such as USER cloning) into
a plasmid (known as an expression vector), which can subsequently
be introduced into a cell by transfection using a variety of
transfection methods such as calcium phosphate transfection,
electroporation, microinjection and liposome transfection. Overview
and supplementary information and methods for constructing
synthetic DNA sequences, insertion into plasmid vectors and
subsequent transfection into cells can be found in Ausubel et al,
2003 and/or Sambrook & Russell, 2001.
[0473] "Gene" refers to a DNA region (including exons and introns)
encoding a gene product, as well as all DNA regions which regulate
the production of the gene product, whether or not such regulatory
sequences are adjacent to coding and/or transcribed sequences or
situated far away from the gene which function they regulate.
Accordingly, a gene includes, but is not necessarily limited to,
promoter sequences, terminators, translational regulatory sequences
such as ribosome binding sites and internal ribosome entry sites,
enhancers, silencers, insulators, boundary elements, replication
origins, matrix attachment sites, and locus control regions.
[0474] "Targeted gene modifications", "gene editing" or "genome
editing"Gene editing or genome editing refer to a process by which
a specific chromosomal sequence is changed. The edited chromosomal
sequence may comprise an insertion of at least one nucleotide, a
deletion of at least one nucleotide, and/or a substitution of at
least one nucleotide. Generally, genome editing inserts, replaces
or removes nucleic acids from a genome using artificially
engineered nucleases such as Zinc finger nucleases (ZFNs),
Transcription Activator-Like Effector Nucleases (TALENs), the
CRISPR/Cas system, and engineered meganuclease re-engineered homing
endonucleases. Genome editing principles are described in Steentoft
et al and gene editing methods are described in references therein
and also broadly used and thus known to person skilled in the
art.
[0475] "Endogenous" sequence/gene/protein refers to a chromosomal
sequence or gene or protein that is native to the cell or
originating from within the cell or organism analyzed
[0476] "Exogenous" sequence or gene refers to a chromosomal
sequence that is not native to the cell, or a chromosomal sequence
whose native chromosomal location is in a different location in a
chromosome or originating from outside the cell or organism
analyzed
[0477] "Inactivated chromosomal sequence" refer to genome sequence
that has been edited resulting in loss of function of a given gene
product. The gene is said to be knocked out.
[0478] "Heterologous" refers to an entity that is not native to the
cell or species of interest.
[0479] The terms "nucleic acid" and "polynucleotide" refer to a
deoxyribonucleotide or ribonucleotide polymer, in linear or
circular conformation, and in either single- or double-stranded
form. For the purposes of the present disclosure, these terms are
not to be construed as limiting with respect to the length of a
polymer. The terms can encompass known analogs of natural
nucleotides, as well as nucleotides that are modified in the base,
sugar and/or phosphate moieties (e.g., phosphorothioate backbones).
In general, an analog of a particular nucleotide has the same
base-pairing specificity; i.e., an analog of A will base-pair with
T.
[0480] The term "nucleotide" refers to deoxyribonucleotides or
ribonucleotides. The nucleotides may be standard nucleotides (i.e.,
adenosine, guanosine, cytidine, thymidine, and uridine) or
nucleotide analogs. A nucleotide analog refers to a nucleotide
having a modified purine or pyrimidine base or a modified ribose
moiety. A nucleotide analog may be a naturally occurring nucleotide
(e.g., inosine) or a non-naturally occurring nucleotide.
[0481] The terms "polypeptide" and "protein" are used
interchangeably to refer to a polymer of amino acid residues. These
terms may also refer to glycosylated variants of the "polypeptide"
or "protein", also termed "glycoprotein". "polypeptide", "protein"
and "glycoprotein" is used interchangeably throughout this
disclosure.
[0482] The term "recombination" refers to a process of exchange of
genetic information between two polynucleotides. For the purposes
of this disclosure, "homologous recombination" refers to the
specialized form of such exchange that takes place, for example,
during repair of double-strand breaks in cells. This process
requires sequence similarity between the two polynucleotides, uses
a "donor" or "exchange" molecule to template repair of a "target"
molecule (i.e., the one that experienced the double-strand break),
and is variously known as "non-crossover gene conversion" or "short
tract gene conversion," because it leads to the transfer of genetic
information from the donor to the target. Without being bound by
any particular theory, such transfer can involve mismatch
correction of heteroduplex DNA that forms between the broken target
and the donor, and/or "synthesis-dependent strand annealing," in
which the donor is used to resynthesize genetic information that
will become part of the target, and/or related processes. Such
specialized homologous recombination often results in an alteration
of the sequence of the target molecule such that part or all of the
sequence of the donor polynucleotide is incorporated into the
target polynucleotide.
[0483] As used herein, the terms "target site" or "target sequence"
refer to a nucleic acid sequence that defines a portion of a
chromosomal sequence to be edited and to which a targeting
endonuclease is engineered to recognize, bind, and cleave.
[0484] "Targeted integration" is the method by which exogenous
nucleic acid elements are specifically integrated into defined loci
of the cellular genome. Target specific double stranded breaks are
introduced in the genome by genome editing nucleases that allow for
integration of exogenously delivered donor nucleic acid element
into the double stranded break site. Thereby the exogenously
delivered donor nuclei acid element is stably integrated into the
defined locus of the cellular genome.
[0485] Sequence identity Techniques for determining nucleic acid
and amino acid sequence identity are known in the art. Typically,
such techniques include determining the nucleotide sequence of the
mRNA for a gene and/or determining the amino acid sequence encoded
thereby, and comparing these sequences to a second nucleotide or
amino acid sequence. Genomic sequences can also be determined and
compared in this fashion. In general, identity refers to an exact
nucleotide-to-nucleotide or amino acid-to-amino acid correspondence
of two polynucleotides or polypeptide sequences, respectively. Two
or more sequences (polynucleotide or amino acid) can be compared by
determining their percent identity. The percent identity of two
sequences, whether nucleic acid or amino acid sequences, is the
number of exact matches between two aligned sequences divided by
the length of the shorter sequences and multiplied by 100. An
approximate alignment for nucleic acid sequences is provided by the
local homology algorithm of Smith and Waterman, Advances in Applied
Mathematics 2:482-489 (1981). This algorithm can be applied to
amino acid sequences by using the scoring matrix developed by
Dayhoff, Atlas of Protein Sequences and Structure, M. O. Dayhoff
ed., 5 suppl. 3:353-358, National Biomedical Research
Foundation,
[0486] Washington, D.C., USA, and normalized by Gribskov, Nucl.
Acids Res. 14(6):6745-6763 (1986). An exemplary implementation of
this algorithm to determine percent identity of a sequence is
provided by the Genetics Computer Group (Madison, Wis.) in the
"BestFit" utility application. Other suitable programs for
calculating the percent identity or similarity between sequences
are generally known in the art, for example, another alignment
program is BLAST, used with default parameters. For example, BLASTN
and BLASTP can be used using the following default parameters:
genetic code=standard; filter=none; strand=both; cutoff=60;
expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by
=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank
CDS translations+Swiss protein+Spupdate+PIR. Details of these
programs can be found on the GenBank website. With respect to
sequences described herein, the range of desired degrees of
sequence identity is approximately 80% to 100% and any integer
value therebetween. Typically the percent identities between
sequences are at least 70-75%, preferably 80-82%, more preferably
85-90%, even more preferably 92%, still more preferably 95%, and
most preferably 98% sequence identity.
[0487] All patent and non-patent references cited in the present
application, are hereby incorporated by reference in their
entirety.
[0488] The invention will now be described in further details in
the following non-limiting examples.
EXAMPLES
[0489] The purpose of the following examples are given as an
illustration of various embodiments of the invention and are thus
not meant to limit the present invention in any way. Along with the
present examples the methods described herein are presently
representative of preferred embodiments, are exemplary, and are not
intended as limitations on the scope of the invention. Changes
therein and other uses which are encompassed within the spirit of
the invention as defined by the scope of the claims will occur to
those skilled in the art.
Example 1--Deconstruction of N-Glycosylation in CHO Cells
Introductory Paragraph
[0490] The Chinese hamster ovary cell (CHO) is the cell factory of
choice for recombinant production of biological therapeutics. CHO
is capable of handling many posttranslational modifications needed
for production of bioactive proteins, and has a generic capacity
for glycosylation of proteins compatible with human use.
Glycosylation has wide ranges of effects on production, product
consistency, solubility, stability, bioactivity, and circulatory
half-life of protein therapeutics, and availability of a single
generic CHO production platform is a limiting factor for design and
development of biologics. This example shows a comprehensive
knockout screen of glycosyltransferase genes involved in
N-glycosylation in CHO that defines the key enzymes controlling
antennary branching, elongation, and sialylation. A panel of stably
engineered CHO lines with designer glycosylation capacities such as
homogenous biantennary glycans with and without .alpha.2,3 and
.alpha.2,6 sialic acid capping was established. The screen
demonstrates great plasticity for CHO glycoengineering and provides
clear pathways for custom designs.
Introduction
[0491] Glycoprotein biologics is the fastest growing class of
therapeutics, and most of these can only be produced recombinantly
in mammalian cells with capacity for human-like glycosylation. The
Chinese hamster ovary (CHO) cell has gained a leading role as host
cell for recombinant production of glycoprotein therapeutics mainly
because it produces rather simple N-glycans with branching and
capping similar to what is produced in some human cells.
[0492] Notably, CHO produce complex-type heterogenous N-glycans
with bi-, tri-, and tetraantennary structures with core .alpha.
6Fucose (Fuc), a minor amount of poly-N-Acetyllactosamine
(poly-LacNAc) mainly on the .alpha.1,6 arm of tetraantennary
structures, and exclusive capping of LacNAc with .alpha.2,3 linked
neuraminic acid (NeuAc) (See FIG. 1a). CHO does not generally
produce the non-human and in man immunogenic capping structures,
such as N-glycolylneuraminic acid (NeuGc) or .alpha.3Gal, although
the occurrence of these have been reported perhaps as a result of
gene induction. N-glycosylation may vary for different proteins as
well as for different glycosites in individual proteins, and e.g.
IgG antibodies are produced with truncated N-glycan structures at
the conserved Asn297 glycosite (biantennary structures with core
.alpha.6Fuc, limited LacNAc, and NeuAc capping). A major concern
with CHO is the substantial heterogeneity in N-glycan processing,
which can be difficult to control during bioprocessing and can pose
issues for bioactivity as well as biosafety. Thus, a major activity
in bioprocessing of therapeutics is devoted to glycan analysis and
control of fermentation to achieve consistency.
[0493] Substantial efforts in the last two decades have been
devoted to genetic glycoengineering of CHO cells with the aims to
expand the capacity for glycosylation, reduce heterogeneity, and
improve or alter especially sialylation.
[0494] These studies have essentially all used random integration
of cDNAs encoding glycosyltransferases and experienced problems
with stability, consistency, and predictability of the introduced
glycosylation capacity. The major obstacle has been the need to
rely on overexpression of glycosyltransferases and competition with
the endogenous expressed enzymes because of lack of simple methods
to knock these out in cell lines. Thus, to our knowledge such
glycoengineered CHO cells have not reached production of clinical
therapeutics. One successful glycoengineering strategy has,
however, emerged after the discovery that IgGs without core .alpha.
6Fuc on the Asn297 N-glycan exhibits markedly higher
Antibody-Dependent Cell Cytotoxicity (ADCC).
[0495] Thus, through a tour-de-force using two rounds of homologous
recombination both alleles of the fut8 gene encoding the .alpha.
6fucosyltransferase controlling core fucosylation was knocked out
in CHO, and at least one therapeutic IgG produced in CHO without
the fut8 gene is now in clinical use. More recently, the fut8 gene
was knocked out using precise gene editing with Zinc finger
nuclease (ZFN) gene targeting with a fraction of time and resources
spent. The emergence of precise gene editing technologies for
knockout (KO) and knockin (KI) have opened up for an entirely
different level of speed and ease with which stable genetic
manipulation of host cell lines to remove and introduce
glycosyltransferase genes can be achieved, and this will
undoubtedly impact engineering of mammalian host cell factories for
recombinant production of therapeutics.
[0496] Here, we first employed a ZFN-mediated knockout screen in
CHO to explore the potential for engineering N-glycosylation of
recombinant glycoproteins. Many steps in the N-glycan biosynthetic
pathway are potentially catalyzed by multiple isoenzymes, which
leave genetic engineering unpredictable (FIG. 1a). Dissection of
the in vivo functions of each of these isoenzymes is required to
construct a matrix for design options. The KO screen included all
genes encoding isoenzymes with potential to regulate
N-glycosylation branching, elongation, and terminal capping
expressed in CHO. The expression of the relevant genes in CHO GS
was assessed by quantitative next generation RNA sequencing
(RNAseq) (FIG. 4). The strategy has only been made possible with
the recent sequencing of the CHO genome and analysis of the CHO-K1
transcriptome. We targeted individual genes and most relevant
stacked combinations.
[0497] We used a total of 15 ZFNs targeting glycosyltransferase
genes (FIG. 1a) involved in antennary branching (mgat4A/4B/4C/5/5B)
(FIG. 1c), galactosylation (B4galt1/2/3/4 (FIG. 1d), poly-LacNAc
elongation (B3gnt1/2/8) (FIG. 1e), and terminal capping by
sialylation (st3gal3/4/6) (FIG. 1f). We utilized recently developed
methods for enriching KO clones by FACS (GFP/Crimson tagged ZFNs)
and high throughput screening by an amplicon labelling strategy
(IDAA). The majority of KO clones exhibited insertions and/or
deletions (indels) in the range of .+-.20 bps, and most targeted
genes were present with two alleles, while some (mgat4B and mgat5)
were present with 1 or 3 alleles, respectively. To monitor effects
of the glycogene KO screen we used stable recombinant expression of
human erythropoietin (EPO), since this protein has three N-glycans
with mainly tetraantennary structures, low level of poly-LacNAc,
and .alpha.2,3 sialic acid capping (FIG. 1b), and is one of the
best characterized N-glycoproteins produced in CHO. The engineering
was performed in the CHO-GS production line (Sigma) grown in
suspension in protein-free medium, and EPO expressed in the
wildtype cell was found to be glycosylated similar to what has been
reported in the past with other CHO lines (FIG. 1b).
[0498] No apparent consistent morphology or growth phenotypic
characteristics were noted apart from subtle clone variations. On
average 5-50 clones for each were screened by ELISA and clones with
the highest expression were selected. The final purification yields
ranging from 0.2 mgs/L to 6.2 mgs/L, but this variation is mainly
if not fully ascribable to chance and the limited number of clones
screened for each KO clone. The selected CHO WT clone produced
final yields of 0.9 mgs/L, while e.g. the KO clone
mgat4A/4B/5/B3gnt2 with four deleted genes produced 3.4 mgs/L.
Control of N-Glycan Antennary Status
[0499] MGAT1 and 2 each control formation of one of the two P2
branches in biantennary N-glycans, while potential partial
functional redundancy is predicted for tri- and tetraantennary
branch formation by MGAT4A/4B/4C (.beta.4 branch) and MGAT5/5B
(.beta.6 branch), respectively. Only mgat4B and 5 appear to be
expressed in CHO (FIG. 4). Targeting mgat4A had minor effect while
targeting both mgat4A/4B almost eliminated .beta.4-branched
tetraantennary N-glycans (FIG. 1c). Targeting mgat5 in contrast
completely eliminated .beta.6-branched tetraantennary structures
(FIG. 1c) as well as L-PHA lectin labeling of cells (FIG. 5), which
is in agreement with previous studies of lectin-resistant CHO
mutants lacking mgat5. Stacking KO of mgat4A/4B and 5 produced
homogenous biantennary N-glycans on EPO (FIG. 1c). A minor amount
of poly-LacNAc on the biantennary N-glycans was, however, still
found, and this is also found as a minor component in wildtype
cells.
Control of LacNAc
[0500] CHO express all seven known .beta.4galactosyltransferases
and our understanding of the in vivo functions of these isoenzymes
is poor, but only B4Gal-T1-4 are expected to serve functions in
N-glycosylation. We first screened individual KO clones for
B4galt1-4, and found that B4Gal-T1 appeared to have the major role
(FIG. 1d). Thus, contributions of the other isoforms could only be
assessed in stacked combinations with KO of B4galt1. We probed
stacked combinations by immunocytology with an antibody to LacNAc
showing that only stacked KO of B4galt1/3, but not B4galt1/2/4,
appeared to abolish galactosylation (Supplementary FIG. 3). In
agreement with this we found that EPO expressed in B4galt1/3 but
not B4galt1/2 stacked KO clones had substantial reduction (>90%)
in of galactosylation on N-glycans (FIG. 1d). However, complete
loss of galactosylation capacity on EPO may require KO of three or
more genes.
Control of Poly-LacNAc
[0501] While poly-LacNAc on N-glycans can confer superior
circulatory half-life properties to e.g. EPO, this modification is
always incomplete and one of the most heterogeneous and difficult
to control for product consistency. CHO cells generally produce low
amounts of poly-LacNAc on N-glycans and mainly on tetraantennary
structures on the .beta.6arm controlled by MGAT5. Biosynthesis of
poly-LacNAc on N-glycans is poorly understood and three genes may
be involved, B3gnt1, B3gnt2, and B3gnt8. We screened single gene KO
of B3gnt1, B3gnt2, and B3gnt8 with lectin immunocytology using the
LEL lectin that recognize poly-LacNAc, and identified B3gnt2 as the
key gene controlling the LacNAc initiation in CHO cells (FIG. 5B).
In agreement with this, EPO expressed in CHO clones with KO of
B3gnt2 and not B3gnt1, resulted in elimination of the minor
fraction of poly-LacNAc on EPO (FIG. 1e).
Control of Sialylation
[0502] CHO produce almost exclusively .alpha.2,3 linked NeuAc
capping of N-glycans. All six known ST3Gal transferases are
expressed in CHO cells (FIG. 4) and the roles of each of these in
sialylation of N-glycans are poorly understood, but candidates are
mainly the ST3Gal-III, ST3Gal-IV, and ST3Gal-VI isoforms. We first
targeted these three genes individually using immunocytology to
evaluate exposure of LacNAc and found that only KO of st3gal4
produced substantial effects (FIG. 7). Analysis of EPO expressed in
single and stacked KO clones, showed that loss of st3gal4 and 6
both produced substantial effects, while we found two patterns in
clones with KO of st3gal4/6. In WT background KO of st3gal4/6
produced EPO with heterogeneous tetraantennary N-glycans without
trace of sialylation (FIG. 1f). KO of st3gal4/6 in combination with
mgat4A/4B/5 produced biantennary N-glycans without sialylation but
increase in poly-LacNAc (FIG. 2b), or in one clone no increase in
poly-LacNAc but minor amounts of a mono-sialylated biantennary
N-glycan. It is thus possible that targeting of st3gal3/4/6 may be
required for complete lack of sialic acid. Regardless, CHO clones
without st3gal4 and 6 produced EPO with uncapped LacNAc termini and
this opens for de novo engineering of recombinant glycoproteins
with .alpha.2,6NeuAc capping.
[0503] Custom glycoengineering of CHO to produce .alpha.2,6NeuAc
capped N-glycans Most glycoproteins in circulation are capped with
.alpha.2,6NeuAc, while essentially all recombinant therapeutics are
produced with .alpha.2,3NeuAc. It has been of longstanding interest
to produce CHO cells capable of producing homogenous N-glycans with
.alpha.2,6NeuAc capping. To demonstrate the perspectives for de
novo glycoengineering provided by our KO screen, we generated CHO
clones capable of producing homogenous .alpha.2,6NeuAc capping
(FIG. 2). To circumvent past problems with random plasmid
integration, we used ZFN targeted knockin (KI) of ST6Gal-I with a
modified Obligare strategy into a SafeHarbor integration site.
Human ST6GAL1 introduced in CHO with KO of st3gal4/6 produced the
complete range of N-glycan antennary structures with normal degree
of NeuAc capping (FIG. 2a), and when introduced in CHO with
additional KO of mgat4A/4B/5 EPO was produced with homogenous
biantennary N-glycans capped by .alpha.2,6NeuAc (FIG. 2b).
Interestingly, de novo introduction of ST6GAL1 also abrogated the
minor amounts of poly-LacNAc formed on biantennary structures when
sialylation was eliminated (FIG. 2b), demonstrating that KO of
B3gnt2 as well was unnecessary. Thus, we could introduce capacity
for .alpha.2,6NeuAc sialylation and produce a CHO cell capable of
producing N-glycoproteins with homogenous .alpha.2,6NeuAc capping.
The Obligare KI strategy was highly efficient with approximately
30-50% single cloned cells expressing ST6Gal-I as evaluated by
antibody and lectin immunocytology (FIG. 7), while relying on
ZFN-mediated homologous recombination did not produce successful
targeted integration in CHO cells. The ST6GAL1 KI clones were
stable for over 20 passages as evaluated by immunocytology with SNA
lectin and 1B2 MAb (not shown).
[0504] In summary, the KO screen performed identifies the key
glycogenes controlling decisive steps in N-glycosylation of
proteins in CHO (FIG. 3), and demonstrates remarkable plasticity in
tolerance for glycoengineering without evidence of unexpected
compensatory changes in glycosylation. We provide design strategies
for generation of CHO host cells with homogeneous biantennary
N-glycans with and without sialylation that will serve as platforms
for de novo build up of desired glycosylation capacities. The
matrix provides general guidance for custom design of the
N-glycosylation capacity of CHO, which likely can be used for any
CHO host line and even established production lines. We demonstrate
the feasibility of de novo engineering of homogenous glycosylation
capacities by introducing .alpha.2,6sialylation in CHO by a precise
KI strategy in CHO lines with KO of endogenous
.alpha.2,3sialyltransferase genes. The panel of CHO cells generated
will enable dissection and de novo design of N-glycosylation for
any protein therapeutics, and production of a diverse array of
glycoforms of therapeutic proteins will enable simple evaluation
and selection of optimal design. The advent of precise gene
engineering clearly holds promise for a new era for the biggest
producer of glycoprotein therapeutics today, the CHO cell.
Methods
[0505] ZFN targeting of glycogenes in CHO cells. All gene targeting
was performed in the CHOZN GS-/- (Glutamine Synthase) clone
produced by ZFN KO and provided by Sigma-Aldrich, St. Louis, Mo.,
or in CHO-K1 obtained from ATCC. All CHO media, supplements and
other reagents used were obtained from Sigma-Aldrich unless
otherwise specified. CHO GS cells were maintained as suspension
cultures in EX-CELL CHO CD Fusion serum-free media, supplemented
with 4 mM L-glutamine. Cells were seeded at 0.5.times.10.sup.6
cells/mL in T25 flask (NUNC, Denmark) one day prior to
transfection. 2.times.10.sup.6 cells and 2 .mu.g endotoxin free
plasmid DNA of each ZFN (Sigma, USA) were used for transfection.
Each ZFN were tagged with GFP and Crimson by a 2A linker.
Transfections were conducted by electroporation using Amaxa kit V
and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland).
Electroporated cells were subsequently placed in 3 mL growth media
in a 6-well plate. Cells were moved to 30.degree. C. for a 24 h
cold shock. 72 h post nucleofection the 10-15% highest labelled
cell pool for both GFP and Crimson were enriched by FACS. Cells
were single cell FACS sorted again one week later to obtain single
clones in round bottom 96 well plates. KO clones were identified by
insertion deletion analysis (IDAA) as recently described, as well
as when possible by immunocytology with appropriate lectins and
monoclonal antibodies. Selected clones were further verified by
TOPO for in detail characterization of mutations introduced. The
strategy enabled fast screening and selection of KO clones with
frameshift mutations, and on average we selected 2-5 clones from
each targeting event. RNAseq analysis of CHO clones was performed
by BGI.
[0506] Recombinant expression of human EPO in CHO cells. An
expression construct containing the entire coding sequence of human
EPO cloned into pcDNA3.1/myc-His (C-terminal tags) was synthesised
by Genewiz, USA. EPO is a 166 amino acid protein with N-glycans at
Asn24, Asn38, and Asn83. CHO cells were co-transfected with EPO and
GFP plasmids, followed by a FACS to enrich clones expressing GFP.
Stable transfectants were selected in 0.4 mg/ml Zeocin
(Invitrogen), Positive stable clones were screened by direct
enzyme-linked immunosorbent assays (ELISA) using monoclonal
anti-His antibody (C-Term)-HRP antibody (Invitrogen). His-tagged
recombinant human EPO was purified by nickel affinity purification
(Invitrogen, US). Media was mixed 3:1 (v/v) in 4.times. binding
buffer (200 mM Tris, pH8.0, 1.2 M NaCl) and applied to 0.3 ml
packed NiNTA agarose (Invitrogen), pre-equilibrated in binding
buffer (50 mM Tris, pH 8.0, 300 mM NaCl). The column was washed
with binding buffer and then bound protein was eluted with binding
buffer with additional 250 mM imidazole. Fractions containing EPO
were determined by SDS-PAGE and further purified on a reverse-phase
HPLC purification with a Jupiter C4 column (5 .mu.m, 300 .ANG.,
column 250.times.4.6 mm) (Phenomenex), using 0.1% trifluoroacetic
acid (TFA) and a gradient of 10-100% acetonitrile. Purity was
evaluated by Coomassie staining of SDS-PAGE gels and proteins
quantified by BCA Protein Assay Kit (Thermo Scientific).
[0507] N-glycan profiling of recombinant EPO in CHO clones.
Approximately 25 .mu.g purified EPO was digested by 2 U PNGase F
(Roche Diagnostics, Mannheim, Germany) in 50 mM ammonium
bicarbonate at 37.degree. C. for overnight. Released N-glycans were
separated from rhEPO using in-house packed Stagetips (Empore
disk-C18, 3M) and incubated in 100 mM ammonium acetate, pH 5.0 for
60 min at 22.degree. C. The N-glycans were dried in glass vials and
permethylated as described previously. Permethylated N-glycans were
extracted with chloroform and desalted by washing the organic phase
repeatedly with deionized water. The organic phase was evaporated
over a stream of nitrogen gas and the permethylated N-glycans were
dissolved in 20 .mu.L 50% methanol. Finally, 1 .mu.L sample was
co-crystalized with 1 .mu.L matrix composed of 2,5-dihydroxybenzoic
acid (10 mg/ml) in 70% (v/v) acetonitrile, 0.1% (v/v)
trifluoroacetic acid and 2.5 mM sodium acetate. Permethylated
N-glycans were analyzed by positive mode MALDI-TOF (Autoflex Speed,
BrukerDaltronics, Bremen) operated in the reflector mode with data
acquisition in them/z 1000-7000 mass range.
Example 2
Determining the Glycosyltransferase Repertoire Expressed in a
Mammalian CHO Cell Line.
[0508] CHO-K1 was obtained from ATCC and CHO-GS (CHOZN GS.sup.-/-
(Glutamine Synthase) clone produced by ZFN KO) was obtained from
Sigma-Aldrich, St. Louis, Mo. All CHO media, supplements and other
reagents used were obtained from Sigma-Aldrich unless otherwise
specified. CHO-GS ells were maintained as suspension cultures in
EX-CELL CHO CD Fusion serum and animal component free media,
supplemented with 4 mM L-glutamine. CHO cells were seeded at
0.25.times.10.sup.6 cells/ml in 6 well plate and harvested at
exponential phase 48 h post inoculation for total RNA extraction
with RNeasy mini kit (Qiagen). RNA integrity and quality were
checked by 2100-Bioanalyser (Agilent Technologies). Library
construction and next generation sequencing was performed using
Illumina HiSeq 2000 System (Illumina, USA) under standard
conditions as recommended by the RNASeq service provider. The
aligned data was used to calculate the distribution of reads on CHO
reference genes and coverage analysis was performed. Only alignment
results that passed QC were used for downstream gene expression
analysis.
[0509] RNAseq analysis was performed on two common CHO lines
(CHO-K1, CHO-GS) and two independent CHO-GS triple mgat4a/4b/5 KO
clones (ZFN91-1C8, ZFN91-2A6) (TABLE 3). The reported RNAseq
analysis of CHO-K1 was included for reference, and this was largely
similar to our analyses except that the relative expression levels
were higher. Importantly, a few genes including e.g. galnt1 and
mgat4b, which was reported not to be expressed in CHO-K1 previously
(Xu, Nagarajan et al. 2011), were found to be expressed. Moreover,
in the case of mgat4b this gene was found to be essential for the
glycoengineering experiments carried out here.
[0510] An important observation of the analysis of CHO
transcriptomes was that the expression profiles of glycogenes in
the two triple KO clones analyses were identical to those of the
parental CHO lines, demonstrating that the targeted ko gene editing
performed in the CHO cell lines did not alter expression of other
glycosyltransferase genes.
Example 3
Gene Inactivation of Glycosyltransferase Genes in the
N-Glycosylation Pathway (Deconstruction).
[0511] All the glycosyltransferase gene targeted inactivation were
performed in CHO-GS and/or in CHO-K1 and cells were grown as
described in Example 2. Cells were seeded at 0.5.times.10.sup.6
cells/mL in T25 flask (NUNC, Denmark) one day prior to
transfection. 2.times.10.sup.6 cells and 2 .mu.g endotoxin free
plasmid DNA of each ZFN (Sigma, USA) were used for transfection.
Each ZFN was tagged with GFP and Crimson by a 2A linker (Duda,
Lonowski et al. 2014). Transfections were conducted by
electroporation using Amaxa kit V and program U24 with Amaxa
Nucleofector 2B (Lonza, Switzerland). Electroporated cells were
subsequently plated in 3 mL growth media in a 6-well plate. Cells
were moved to 30.degree. C. for a 24 h cold shock. 72 h post
nucleofection the 10-15% highest labeled cell pool for both GFP and
Crimson were enriched by FACS. We utilized recent developed methods
for enriching KO clones by FACS (GFP/Crimson tagged ZFNs) (Duda,
Lonowski et al. 2014) and high throughput screening by an amplicon
labeling strategy (IDAA) (Zhang, Steentoft et al. submitted). Cells
were single cell FACS sorted again one week later to obtain single
clones in round bottom 96 well plates. KO clones were identified by
IDAA, and when possible also by immunocytology with appropriate
lectins and monoclonal antibodies. Selected clones were further
verified by TOPO cloning of PCR products (Invitrogen, US) for in
detail Sanger sequencing characterization of mutations introduced
in individual TOPO clones. The strategy enabled fast screening and
selection of KO clones with appropriate inactivation mutations as
outlined herein, and on average we selected 2-5 clones from each
targeting event.
[0512] The majority of KO clones exhibited out of frame causing
insertions and/or deletions (indels) in the range of .+-.20 bps,
and most targeted genes were present with two alleles, while some
(mgat4B and mgat5) were present with 1 or 3 alleles, respectively
(TABLE 4).
[0513] TABLE 4 lists all individual and stacked glycosyltransferase
gene inactivation events and the order (ancestry line) of stacking
of glycosyltransferase gene inactivation in cells to produce a
deconstruction matrix of the N-glycosylation pathway.
Example 4
Gene Insertion of Glycosyltransferase Genes in the N-Glycosylation
Pathway (Reconstruction).
[0514] Target specific integration (knockin/KI) was directed
towards the CHO Safe Harbor #1 locus (S. Bahr et al., BMC
Proceedings 2013, 7(Suppl 6):P3.doi:10.1186/1753-6561-7-S6-P3). A
modified ObLiGaRe strategy (33) was used where two inverted ZFN
binding sites flank the donor plasmid gene of interest to be
knocked in. Firstly a shuttle vector designated ObLiGaRe-2X-Ins was
synthesized (TABLE 5). ObLiGaRe-2X-Ins was designed in such a way,
that any cDNA sequence encoding protein of interest can be inserted
into a multiple cloning site where transcription is driven by CMV
IE promotor and a BgH terminator. In order to minimize epigenetic
silencing, two insulator elements flanking the transcription unit
were inserted. In addition an AAVS1 "landing pad" was included at
the 3' end of ObLiGaRe-2X-Ins just upstream of the 3' inverted ZFN
binding site. A full ST6GAL1 open reading frame was inserted
directionally into ObLiGaRe-2X-Ins generating
ObLiGaRe-2X-Ins-ST6GAL1 (TABLE 5). Transfection and sorting of
clones were performed as described in EXAMPLES 2 and 3. Clones were
initially screened by positive SNA lectin staining and selected
clones further analyzed by ' and 3' junction PCR to confirm correct
targeted integration event into Safeharbor #1 site in the CHO
st3gal4/6 KO clones. The allelic copy number of integration was
determined by WT allelic PCR. Subsequently, full human MGAT4A open
reading frame was inserted directionally into 2nd allele of Safe
Harbor #1 in ST6GAL1 KI clone, followed by inserting full human
MGAT5 to AAVS1 "landing pad", which was included at the 3' end of
ObLiGaRe-2X-Ins just upstream of the 3' inverted ZFN binding site
(TABLE 5).
Example 5
Recombinant Production of Human EPO and IgG in Gene Edited
Mammalian CHO Cells.
[0515] Expression constructs containing the entire coding sequence
of human EPO and a therapeutic IgG cloned into pcDNA3.1/myc-His
(C-terminal tags) and pBUDCE4.1 (Invitrogen), respectively, were
synthesized by Genewiz, USA. EPO is a 166 amino acid protein with
N-glycans at Asn24, Asn38, and Asn83, and IgG has a single N-glycan
at Asn297, respectively. Wt or KO CHO cells were transfected with
EPO or IgG and maintained at 37.degree. C. as suspension cultures
in EX-CELL CHO CD Fusion serum-free media, supplemented with 4 mM
L-glutamine and 400 ug/ml Zeocin in 5% CO.sub.2 incubator. Clones
were scaled up and grown in T75 flasks at a seeding density of
0.5.times.10.sup.6 cells/ml, and harvested 72 h or 96 h later. Cell
viability was higher than 90% in all reporter expressing clones and
viable cell density are between 2-3.times.10.sup.6 cells/ml upon
harvest. Cells were removed by centrifugation at 300 g for 5 min,
and the supernatant were stored at -80.degree. C. His-tagged
recombinant human EPO was purified by nickel affinity purification
(Invitrogen, US). Media was mixed 3:1 (v/v) in 4.times. binding
buffer (200 mM Tris, pH 8.0, 1.2 M NaCl) and applied to 0.3 ml
packed NiNTA agarose (Invitrogen), pre-equilibrated in binding
buffer (50 mM Tris, pH 8.0, 300 mM NaCl). The column was washed
with binding buffer and then bound protein was eluted with binding
buffer with additional 250 mM imidazole. Fractions containing EPO
were determined by SDS-PAGE and further purified on a reverse-phase
HPLC purification with a Jupiter C4 column (5 .mu.m, 300 .ANG.,
column 250.times.4.6 mm) (Phenomenex), using 0.1% trifluoroacetic
acid (TFA) and a gradient of 10-100% acetonitrile. IgG was purified
by HiTrap.TM. Protein G HP (GE Healthcare, US)
pre-equilibrated/washed in PBS and eluted with 0.1 M Glycine (pH
2.7). Purity of protein was evaluated by Coomassie staining of
SDS-PAGE gels, and proteins were quantified by BCA Protein Assay
Kit (Thermo Scientific, Rockford, US).
Example 6
N-Glycan Profiling of Purified EPO and IgG.
[0516] Approximately 25 .mu.g purified EPO was digested with 2 U
PNGase F (Roche Diagnostics, Mannheim, Germany) in 50 mM ammonium
bicarbonate at 37.degree. C. for overnight. For IgG, 35 .mu.g
samples were initially digested (overnight, 37.degree. C.) with
trypsin in 50 mM ammonium bicarbonate, and then heated at
95.degree. C. for 15 min and cooled to RT before PNGase F digestion
as above. Released N-glycans were separated from intact EPO or IgG
tryptic digest using in-house packed Stagetips (Empore disk-C18,
3M) and incubated in 100 mM ammonium acetate, pH 5.0 for 60 min at
22.degree. C. The N-glycans were split in three equal aliquots.
One-third was dried in glass vials and permethylated as described
previously (Ciucanu and Costello 2003) and the remainder was saved
for the native N-glycan analysis. Permethylated N-glycans were
extracted with chloroform and desalted by washing the organic phase
repeatedly with deionized water. The organic phase was evaporated
over a stream of nitrogen gas and the permethylated N-glycans were
dissolved in 20 .mu.L 50% (v/v) methanol. Finally, 1 .mu.L sample
was co-crystalized with 1 .mu.L matrix composed of
2,5-dihydroxybenzoic acid (10 mg/ml) in 70% (v/v) acetonitrile,
0.1% (v/v) trifluoroacetic acid and 2.5 mM sodium acetate.
Permethylated N-glycans were analyzed by positive mode MALDI-TOF
(Autoflex Speed, BrukerDaltronics, Bremen) operated in the
reflector mode with data acquisition (2000 shots/spot) in the m/z
1000-7000 mass range. Glycan compositional analysis of all spectra
was performed by the SysBioWare platform and is presented in
Supplementary Table 4 (Vakhrushev, Dadimov et al. 2009). Released
native N-glycans were reconstituted in MeOH/H.sub.2O (1/1; v/v,
containing 50 mM Ammonium bicarbonate) at the concentration of 0.5
pmol/.mu.l and analyzed on an OrbiTrap Fusion MS (Thermo San Hose,
USA). Samples were directly infused via EASY-Spray and analysed by
negative ion mode. Flow rate was set to 500 nl/min, spray voltage
1,900-2,100 V, and ion transfer tube temperature 275.degree. C.
Precursor ions were selected (isolation width, m/z 3) and subjected
to HCD fragmentation at 35% normalized collision energy (default
charge state, z=2). All spectra were recorded at resolution
120,000.
Example 7
[0517] Inactivation of Glycosyltransferase Genes by Tandem Single
Stranded Oligo Deoxy Nucleotide (ssODN)/ZFN Precise Multi Exon Gene
Editing.
[0518] In this example, gene inactivation is performed by
eliminating exons encoding the N-terminal cytoplasmic tail,
transmembrane region, and parts of the stem region of the targeted
glycosyltransferase gene. The target region deletion is mediated by
use of the tandem single stranded oligo deoxy nucleotide
(ssODN)/ZFN approach (Duda, Lonowski et al. 2014). The ZFN target
site is selected in or as close as possible around the sequence
coding for the transmembrane region of the glycosyltransferase. As
an example CHO mgat4a is targeted using CHO mgat4a ComposR ZFN's
(Sigma) and an ssODN possessing 60 bp homology arm sequences
flanking the 5' UTR region including translational start site and
3' flanking mgat4a exon2 ZFN target site (mgata ssODN:
TABLE-US-00004 gagagagattggtcttgcttgtcatcaccaacgtatgaaccagtgtgatg
gtgaaatgagtcGCCGTGCAGGAGCAGCAACTAACGGAAGTAACACTGCA
TTGACTACATTTTCAGGTAC)
(5' UTR region shown in lower case, partial ZFN cut site in lower
case italics and 3' flanking exons 2 ZFN binding site in upper
case), thus removing the exon 1-2 encoding cytoplasmic tail,
transmembrane domain and stem of mgat4a. Gene inactivation is
performed in CHO-GS as described in Example 2 including mgata
ssODN. Transfections were conducted by electroporation using Amaxa
kit V and program U24 with Amaxa Nucleofector 2B (Lonza,
Switzerland). Electroporated cells were subsequently placed in 3 mL
growth media in a 6-well plate. Cells were moved to 30.degree. C.
for a 24 h cold shock. 72 h post nucleofection the 10-15% highest
labeled cell pool for both GFP and Crimson were enriched by FACS.
Cells were single cell FACS sorted again one week later to obtain
single clones in round bottom 96 well plates. Enrichment of KO
clones was performed by FACS (GFP/Crimson tagged ZFNs). Clones are
analyzed by PCR using primers
TABLE-US-00005 Mgataex1F (5'-TATCCACTGTGTTGCTTGCTG-3')/ Mgataex2R
(5'-Actgctcttccagaggtcctg d-3'),
only detecting correctly target deleted clones. Mono/bi-allelic
targeting was determined by PCR wt allele presence detection using
primers Mgataex2F (5'-gaacgccttcgaatagctgaacatagg-3')/Mgataex2R.
Genetic PCR results are validated by Southern blot analysis using
an intron2 specific probe detecting correct removal of 37KBp
intron1 target region carrying diagnostic KpnI sites.
Example 8
Inactivation of Glycosyltransferase Genes by Multi-Exon Dual
CRISPR/Cas9 Gene Editing.
[0519] Gene inactivation is ensured by removal of exons encoding
the cytoplasmic tail/transmembrane and parts of the stem encoded
sequences of the desired gene needed to be inactivated. Target
region deletion is mediated by use of a pairs of CRISPR/Cas9-gRNAs
targeting the flanking regions encoding Mgat4a signal sequence,
transmembrane anchoring and stem-regions. CHO Mgat4a is targeted
using CHO Mgat4a CRISPR/Cas9 gRNA's Mgat4aEx1gRNA
(5'-GGTATACCACATGGCAAAATGGG-3') specific for exon1 and
Mgat4aEx2gRNA (5'-GTCCAACAGTTTCGCCGTGCAGG-3') specific for exon2.
Both gRNA's were cloned into the BbsI (NEB, USA) gRNA target site
of px458 (Addgene, USA) encoding GFP tagged S. pyogenes Cas9 and U6
promoter driven gRNA cassette, generating
px458-CRISPR-Mgat4aex1gRNA and px458-CRISPR-Mgat4aex2gRNA. Precise
gene editing by nucleofection using Zug of these CRISPR/Cas9-Mgat4a
editing tools and target selection validation was performed in
CHO-GS cells as described in Examples 3 and 7.
Example 9
Enzymatic GlycoPEGylation of Glycoproteins Monoantennary
N-Glycans.
[0520] KO of mgat2 in combination with mgat4a/4b/5 in CHO cells
resulted in homogeneous monoantennary N-glycans when EPO was
expressed (FIG. 32). Reintroduction of human MGAT4A as well as
MGAT4A and 5 in combination by knockin resulted in tri and
tetraantennary N-glycans, respectively (FIG. 32), demonstrating
that the monoantennary N-glycan obtained is linked .beta.1-2 to the
.alpha.1-3Man branch controlled by mgat1. Enzymatic glycopegylation
or transfer of other compounds by sialyltransferases and
CMP-(PEG)NeuAc or relevant modified donor was tested using EPO as
an example (FIGS. 33-34).
[0521] Material and MethodsGlycovariants of EPO-Myc-His6 were
produced in CHO with KO mgat2/4a/4b/5 and purified on a nickel-NTA
column and buffer exchanged into 100 mM Tris, 150 mM NaCl, 0.005%
NaN3, pH 7.2 buffer as described in Example 4. Wild type
EPO-Myc-His6 with normal glycosylation profile was produced in non
modified CHO cells and in similar way purified on a nickel-NTA
column before buffer exchanged into 100 mM Tris, 150 mM NaCl,
0.005% NaN3, pH 7.2 buffer. Protein concentrations were determined
by NanoDrop Lite Spectrophotometer (Thermo Scientific.TM.).
Sialyltransferase (ST3Gal-III; 1.35 U/ml) in 20 mM HEPES, 120 mM
NaCl, 50% glycerol, pH 7.0 was obtained from FujiFilm Diosynth
Biotechnologies, Japan. Sialidase (Artherobacter urifaciens) was
produced at Novo Nordisk A/S and used as a 200 U/ml solution in 20
mM HEPES, 120 mM NaCl, 50% glycerol, pH 7.0. Support bound
neuraminidase (Clostridium perfringens) on agarose was obtained
from Sigma (Cat. #N5254-10UN). The resin was washed extensively in
MilliQ water before use. 10k-PSC
(cytidine-5'-monophosphoryl-[5-(N-10
kDa-methoxypolyoxyethylene-oxycarboxamido)glycylamido-3,5-dideoxy-D-glyce-
ro-n-galacto-2-nonulopyranosuronate], Lot: 3605-A-R0-01-61-1) was
obtained from Albany Molecular Research, Inc, Albany, N.Y. 12203,
US. 10k-PSC was produced as described in WO03031464. The
tris-buffer used in examples below contained 50 mM tris-HCl, 150 mM
NaCl, pH 7.6.
[0522] SDS-PAGE gel electrophoresis was performed on NuPage precast
gels (NuPage 7 Tris-Acetate Gel, 15 wells, Invitrogen cat. No.
EA03555BOX) using NuPage Tris-Acetate SDS Running buffer
(Invitrogen cat. No. #LA0041). Samples (0.15 mg/ml) were added
NuPage Sample Reducing Agent (Invitrogen cat. No. NP0004) and LDS
sample buffer (Invitrogen cat. No. NP0008) and heated to 70.degree.
C. for 10 min before gel loading. HiMark HMW (Invitrogen cat. No.
LC6060) was used as standard. Electrophoresis was performed at 150
V, 120 mA & 25 W for 60 min. Gels were stained with SimplyBlue
SafeStain (Invitrogen cat. No. LC5688) according to Invitrogen
protocols. Coomasie stained gels were analysed by densitometry
using GelQuant software and methods described previously (Rehbein
and Schwalbe 2015) (FIG. 34).
[0523] HPLC analysis of GlycoPEGylated EPO-Myc-His6 conjugates of
the invention was performed as follows. Samples were analysed in
non-reduced form. A Zorbax 300SB-C3 column (4.6.times.50 mm; 3.5 um
Agilent, Cat. No.: 865973-909) was used. Column was operated at
30.degree. C. 2.5 ug sample was injected, and column eluted with a
water (A)-acetonitrile (B) solvent system containing 0.1%
trifluoroacetic acid. The gradient program was as follows: 0 min
(25% B); 4 min (25% B); 14 min (46% B); 35 min (52% B); 40 min (90%
B); 40.1 min (25% B).
[0524] Enzymatic glycoPEGylation of EPO-Myc-His6 variants was
performed by either an one-pot method using sialidase in
combination with ST3Gal-III, or by a sequential method where the
EPO-Myc-His6 variant was first reacted with agarose-neuraminidase
gel for 3 h at 25.degree. C., then after transferring the
supernatant to a fresh vial reacted with the ST3Gal-III and PSC
reagent. The one-pot method relies on the fact that Artherobacter
urifaciens sialidase is unable to desialylate PEGylated sialosides.
Use of recombinant glycoproteins with monoantennary N-glycans
without sialic acid capping as invented eliminates the need for
prior desialylation.
GlycoPEGylation of Recombinant Human Erythropoietin--Recombinant
Wildtype
[0525] EPO-Myc-His6 produced in CHO cell lines was dissolved in 100
mM Tris, 150 mM NaCl, 0.005% NaN3 (pH 7.2) to a concentration of
1.17 mg/ml. 10k-PSC reagent (2.0 mg) was dissolved in 100 ul 50 mM
Tris-HCl, 150 mM NaCl (pH 7.6) to a concentration of 20 mg/ml.
ST3Gal-III and AUS were both dissolved in 20 mM HEPES, 120 mM NaCl,
50% glycerol, pH 7.0 to a volumetric concentration of 1.35 U/ml and
200 U/ml respectively. Reagents were mixed according to scheme
below:
TABLE-US-00006 Unit Exp. 1 Exp. 2 Exp. 3 Exp. 4 Exp. 5 wtEPO ug 10
10 10 10 10 10k-PSC eq 1 5 10 25 50 ST3Gal3 mU/ug 0.196 0.196 0.196
0.196 0.196 wtEPO Sialidase U/ml 5 5 5 5 5 Tris buffer ul 9.0 8.4
7.6 5.3 1.3 Final volume ul 28.45 28.45 28.45 28.45 28.45 Final
mg/ml 0.35 0.35 0.35 0.35 0.35 [wtEPO]
[0526] Reactions were incubated for 18 h at 32.degree. C. Samples
were then analysed by HPLC and SDS-PAGE (FIG. 33, lanes 5-9).
[0527] GlycoPEGylation of erythropoietin produced in CHO cells with
KO of mgat2/4A/4B/5--Recombinant wtEPO-Myc-His6 glycosylation
variant produced in Mgat2/4a/4b/5 knock-out CHO cell line was
dissolved in 100 mM Tris, 150 mM NaCl, pH 7.2 to a concentration of
0.585 mg/ml. 10k-PSC reagent (2.0 mg) was dissolved in 100 ul 50 mM
Tris-HCl, 150 mM NaCl, pH 7.6 to a concentration of 20 mg/ml.
ST3GalIII and AUS were both dissolved in 20 mM HEPES, 120 mM NaCl,
50% glycerol, pH 7.0 to a volumetric concentration of 1.35 U/ml and
200 U/ml respectively. Reagents were mixed according to scheme
below:
TABLE-US-00007 Unit Exp. 1 Exp. 2 Exp. 3 Exp. 4 Exp. 5 EPO-Myc- ug
10 10 10 10 10 His6 10k-PSC eq 1 5 10 25 50 ST3Gal3 mU/ 0.196 0.196
0.196 0.196 0.196 ug EPO Sialidase U/ml 5 5 5 5 5 Tris buffer ul
9.0 8.4 7.6 5.3 1.3 Final volume ul 28.45 28.45 28.45 28.45 28.45
Final [EPO] mg/ml 0.35 0.35 0.35 0.35 0.35
[0528] Reactions were incubated for 18 h at 32.degree. C. Samples
were then analysed by HPLC and SDS-PAGE (FIG. 22, lanes 11-15).
[0529] Two step glycoPEGylation reaction of recombinant human
erythropoietin--EPO-Myc-His6 (272 ug) in 100 mM Tris, 150 mM NaCl,
0.005% NaN3, pH 7.2 (0.214 mg/ml) was treated with prewashed
immobilized sialidase (150 ul suspension, 150 mU) for 3 h at room
temperature. Resin was then removed by filtration. The filtrate was
analysed by LC-MS to confirm formation of asialo EPO-Myc-His6 in
monoantennary N-glycan form (calculated mass 25,464.97 Da, analysis
25,465.30 Da).
TABLE-US-00008 Calc. average mass Found Assignment 26921.23 Da
26921.53 Da Penta sialylated EPO-myc-His6 containing 3 mono
antennary N-glycanes and one O- glycan 26629.98 Da 26630.34 Da
Tetra sialylated EPO-myc-His6 containing 3 mono antennary
N-glycanes and one O- glycan 26338.72 Da 26339.16 Da Tri sialylated
EPO-myc-His6 containing 3 mono antennary N-glycanes and one O-
glycan 25464.97 Da 25465.30 Da Desialylated (neuraminidase treated)
EPO-myc-His6 containing 3 mono antennary N-glycanes and one
O-glycan
[0530] The filtrate was then added 10k-PSC reagent dissolved in 100
ul 50 mM Tris-HCl, 150 mM NaCl, pH 7.6. ST3Gal-III and AUS were
both dissolved in 20 mM HEPES, 120 mM NaCl, 50% glycerol, pH 7.0 to
a volumetric concentration of 1.35 U/ml and 200 U/ml respectively.
Reagents were mixed according to scheme below:
TABLE-US-00009 Unit Exp. 1 Exp. 2 Exp. 3 Exp. 4 Exp. 5 asialo EPO-
ug 20 20 20 20 20 Myc-His6 10k-PSC eq 1 3 5 10 20 St3Gal3 mU/ug
0.196 0.196 0.196 0.196 0.196 EPO Tris buffer ul 14.0 12.5 11.0 7.4
0 Final volume ul 117.6 117.6 117.6 117.6 117.6 Final EPO mg/ml
0.17 0.17 0.17 0.17 0.17
[0531] Reactions were incubated for 20 h at 32.degree. C. Samples
were then analysed by HPLC and SDS-PAGE.
Further Tables
TABLE-US-00010 [0532] TABLE 4 ZFN design and sequence analysis of
CHO glycoengineered clones. Clone Inser & Del Alignments KO:
mgat4A mgat4A-WT ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt-------------
tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle1 -5 bp
TTCTGAGTTGAATGCCATTGTCCAACAg------------------
CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle2 +13 bp
TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcG
CCGTGCAGGAGCAGCAACTAACGGAAG KO: mgat4A/4B mgat4A-WT ZFN
TTCTGAGTTGAATGCCATTGTCCAACAgtt-------------
tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle1 -5 bp
TTCTGAGTTGAATGCCATTGTCCAACAg------------------
CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle2 +13 bp
TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC
AGGAGCAGCAACTAACGGAAG mgat4B-WT ZFN
GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT mgat4B-alle1 -7 bp
GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT KO: mgat5 mgat5-WT ZFN
GGGGGATGATGCTTCTGCACTTCACCATCCAg--------------
cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle1 +14 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAgcaTGAATTCTAGATGAgcgG
ACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle2 -1 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAg---------------
agcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle3 +61 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAgcag-----(+61 bp)--
cgGACTCAGCCTGAGAGCAGCTCCATGTT KO: mgat4A/4B/5 mgat4A-WT ZFN
TTCTGAGTTGAATGCCATTGTCCAACAgtt-------------
tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle1 -5 bp
TTCTGAGTTGAATGCCATTGTCCAACAg------------------
CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle2 +13 bp
TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC
AGGAGCAGCAACTAACGGAAG mgat4B-WT ZFN
GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT mgat4B-alle1 -7 bp
GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT mgat5-WT ZFN
GGGGGATGATGCTTCTGCACTTCACCATCCAg----
cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle1 +4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG
AGAGCAGCTCCATGTT mgat5-alle2 -4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAg--------
gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle3 -16 bp
GGGGGATGATGCTTCTGCACTTC--------------------
CTCAGCCTGAGAGCAGCTCCATGTT KO: B3gnt1 B3gnt1-WT ZFN
TGCAGCTGCTCTACCTGTC-----------gctgcTCTCCGGACTGCACG B3gnt1-alle1 +11
bp TGCAGCTGCTCTACCTGTCgcagcTGCTCTACCTGTCTCCGGACTGCACG B3gnt1-alle2
-5 bp TGCAGCTGCTCTACCTGTC----------------TCTCCGGACTGCACG KO: B3gnt2
B3gnt2-WT ZFN TTCAGCCCTTCCcgggcGTACTGGAACAGAGAGCA B3gnt2-alle1 -1
bp TTCAGCCCTTCC-gggcGTACTGGAACAGAGAGCA B3gnt2-alle2 -4 bp
TTCAGCCCTTCCcg----TACTGGAACAGAGAGCA KO: B4galt1 B4galt1-WT ZFN
TGCATCCGGTCCTACAGCgccagc----AACTGGACTATGGTA B4galt1-alle1 +4 bp
TGCATCCGGTCCTACAGCgccagcCAGCAACTGGACTATGGTA KO: B4galt2 B4galt2-WT
ZFN CAGCCCCGCCACTTTgcc-----------atcGCCATGGACAAGTTTGGCT
B4galt2-alle1 +73 bp CAGCCCCGCCACTTTgcc--(+73
bp)--atcGCCATGGACAAGTTTGGCT KO: B4galt3 B4galt3-WT ZFN
CTAGCCCTCAAGTCAGGAtgt-----tgCGGAGGCTGCTGGAGAGG B4galt3-alle1 +5 bp
CTAGCCCTCAAGTCAGGAtgtCGTGTtgCGGAGGCTGCTGGAGAGG B4galt3-alle2 +2 bp
CTAGCCCTCAAGTCAGGAtgt---tgCCCGGAGGCTGCTGGAGAGG KO: B4galt4
B4galt4-WT ZFN AACTGGGACTGCTTTat----attcCACGATGTGGACCTGGTG
B4galt4-alle1 +1 bp AACTGGGACTGCTTTat---TattcCACGATGTGGACCTGGTG
BRgalt4-alle2 +4 bp AACTGGGACTGCTTTatattTATTcCACGATGTGGACCTGGTG KO:
B4galt1/2 B4galt1-WT ZFN
TGCATCCGGTCCTACAGCgccagc----AACTGGACTATGGTA B4galt1-alle1 +4 bp
TGCATCCGGTCCTACAGCgccagcCAGCAACTGGACTATGGTA B4galt2-WT ZFN
CAGCCCCGCCACTTTgccatcGCCATGGACAAGTTTGGCT B4galt2-alle1 -8 bp
CAGCCCCGCCAC--------cGCCATGGACAAGTTTGGCT B4galt2-alle2 -14 bp
CAGCCC--------------cGCCATGGACAAGTTTGGCT KO: st3Gal3 st3Gal3-WT ZFN
CTCTCTCTTTGTCCTTGCtggcttCAAATGGCAGGACTTCAAG st3Gal3-alle1 -5 bp
CTCTCTCTTTGTCCTTGCt-----CAAATGGCAGGACTTCAAG st3Gal3-alle2 -1 bp
CTCTCTCTTTGTCCTTGCtggct-CAAATGGCAGGACTTCAAG KO: st3Gal4 st3Gal4-WT
ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC st3Gal4-alle1
+4 bp GGCAGCCTCCAGTGTCGTCgttgtTTGTgTTGTGGTGGGGAATGGGC st3Gal4-alle2
-4 bp GGCAGCCTCCAGTGTCGTCg--------gTTGTGGTGGGGAATGGGC KO: st3Gal6
st3Gal6-WT ZFN CGGTACCTCTGATTTTGCTttgccCTATGGGACAAGGCC
st3Gal6-alle1 -4 bp CGGTACCTCTGATTTTGCTt----CTATGGGACAAGGCC
st3Gal6-alle2 -22 bp CGGTACCTCTGA----------------------AGGCC KO:
st3Gal3/4 st3Gal3-WT ZFN
CTCTCTCTTTGTCCTTGCtggcttCAAATGGCAGGACTTCAAG st3Gal3-alle1 -5 bp
CTCTCTCTTTGTCCTTGCt-----CAAATGGCAGGACTTCAAG st3Gal3-alle2 -1 bp
CTCTCTCTTTGTCCTTGCtggct-CAAATGGCAGGACTTCAAG st3Gal4-WT ZFN
GGCAGCCTCCAGTGTCGTCgttgt-----gTTGTGGTGGGGAATGGGC st3Gal4-alle1 -4
bp GGCAGCCTCCAGTGTCGTCg---------gTTGTGGTGGGGAATGGGC st3Gal4-alle2
+5 bp GGCAGCCTCCAGTGTCGTCgACACGttgtgTTGTGGTGGGGAATGGGC KO:
st3Gal4/6 st3Gal4-WT ZFN
GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC st3Gal4-alle1 +4 bp
GGCAGCCTCCAGTGTCGTCgttgtTTGTgTTGTGGTGGGGAATGGGC st3Gal4-alle2 -4 bp
GGCAGCCTCCAGTGTCGTCg--------gTTGTGGTGGGGAATGGGC st3Gal6-WT ZFN
CGGTACCTCTGATTTTGCT-ttgccCTATGGGACAAGGCC st3Gal6-alle1 +1 bp
CGGTACCTCTGATTTTGCTTttgccCTATGGGACAAGGCC st3Gal6-alle2 -7 bp
CGGTACCTCTGATTTTG--------CTATGGGACAAGGCC KO: B3gnt2/mgat4/A/4B/5
mgat4A-WT ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt-------------
tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle1 -5 bp
TTCTGAGTTGAATGCCATTGTCCAACAg------------------
CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle2 +13 bp
TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC
AGGAGCAGCAACTAACGGAAG mgat4B-WT ZFN
GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT mgat4B-alle1 -7 bp
GCCCTCCAGCAGCCCTCTG-------GATGATCCTGGAGTT mgat5-WT ZFN
GGGGGATGATGCTTCTGCACTTCACCATCCAg----
cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle1 +4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG
AGAGCAGCTCCATGTT mgat5-alle2 -4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAg--------
gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle3 -16 bp
GGGGGATGATGCTTCTGCACTTC--------------------
CTCAGCCTGAGAGCAGCTCCATGTT B3gnt2-WT ZFN
TTCAGCCCTTCC--cgggcGTACTGGAACAGAGAGCA B3gnt2-alle1 +2 bp
TTCAGCCCTTCCCCcgggcGTACTGGAACAGAGAGCA B3gnt2-alle2 +1 bp
TTCAGCCCTTCCC-cgggcGTACTGGAACAGAGAGCA KO: st3Gal4/6/mgat4A/4B/5
mgat4A-WT ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt-------------
tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle1 -5 bp
TTCTGAGTTGAATGCCATTGTCCAACAg------------------
CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle2 +13 bp
TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC
AGGAGCAGCAACTAACGGAAG mgat4B-WT ZFN
GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT mgat4B-alle1 -7 bp
GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT mgat5-WT ZFN
GGGGGATGATGCTTCTGCACTTCACCATCCAg----
cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle1 +4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG
AGAGCAGCTCCATGTT mgat5-alle2 -4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAg--------
gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle3 -16 bp
GGGGGATGATGCTTCTGCACTTC--------------------
CTCAGCCTGAGAGCAGCTCCATGTT st3Gal4-WT ZFN
GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC st3Gal4-alle1 -5 bp
GGCAGCCTCCAGTGTCGTCgttgt---------gGTGGGGAATGGGC st3Gal4-alle2 +4 bp
GGCAGCCTCCAGTGTCGTCgTTGTttgtgTTGTGGTGGGGAATGGGC st3Gal46-WT ZFN
CGGTACCTCTGATTTTGCTttgccCTATGGGACAAGGCC st3Gal6-alle1 -4 bp
CGGTACCTCTGATTTTGCTt----CTATGGGACAAGGCC st3Gal6-alle2 -2 bp
CGGTACCTCTGATTTTGCTttg--CTATGGGACAAGGCC KI: ST6GAL1/KO: st3gal4/6
st3Gal4-WT ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC
st3Gal4-alle1 +4 bp GGCAGCCTCCAGTGTCGTCgttgtTTGTgTTGTGGTGGGGAATGGGC
st3Gal4-alle2 -4 bp GGCAGCCTCCAGTGTCGTCg--------gTTGTGGTGGGGAATGGGC
st3Gal4-WT ZFN CGGTACCTCTGATTTTGCT-ttgccCTATGGGACAAGGCC
st3Gal6-alle1 +1 bp CGGTACCTCTGATTTTGCTTttgccCTATGGGACAAGGCC
st3Gal6-alle2 -7 bp CGGTACCTCTGATTTTG--------CTATGGGACAAGGCC KI:
ST6GAL1/KO: st3Gal4/ 6/mgat4A/4B/5 mgat4A-WT ZFN
TTCTGAGTTGAATGCCATTGTCCAACAgtt-------------
tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle1 -5 bp
TTCTGAGTTGAATGCCATTGTCCAACAg------------------
CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle2 +13 bp
TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC
AGGAGCAGCAACTAACGGAAG mgat4B-WT ZFN
GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT mgat4B-alle1 -7 bp
GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT mgat5-WT ZFN
GGGGGATGATGCTTCTGCACTTCACCATCCAg----
cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle1 +4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG
AGAGCAGCTCCATGTT mgat5-alle2 -4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAg--------
gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle3 -16 bp
GGGGGATGATGCTTCTGCACTTC--------------------
CTCAGCCTGAGAGCAGCTCCATGTT st3Gal4-WT ZFN
GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC st3Gal4-alle1 -5 bp
GGCAGCCTCCAGTGTCGTCgttgt---------gGTGGGGAATGGGC st3Gal4-alle2 +4 bp
GGCAGCCTCCAGTGTCGTCgTTGTttgtgTTGTGGTGGGGAATGGGC st3Gal6-WT ZFN
CGGTACCTCTGATTTTGCTttgccCTATGGGACAAGGCC st3Gal6-alle1 -4 bp
CGGTACCTCTGATTTTGCTg----CTATGGGACAAGGCC st3Gal6-alle2 -2 bp
CGGTACCTCTGATTTTGCTttg--CTATGGGACAAGGCC KO: mgat2 mgat2-WT ZFN
TCCTTTGTCGCCCATTGCTgctccagaggacgaagCCGCAGGCGGCCACCAC GA mgat2-alle1
-4 bp TCCTTTGTCGCCCATTGCTgctcc---- gacgaagccgcaggcggccaccacga KO:
mgat2/stgal4/6 mgat2-WT TALEN
TCCTTTGTCGCCCATTGCTgctccagaggacgaagCCGCAGGCGGCCACCAC GA mgat2-alle1
-4 bp TCCTTTGTCGCCCATTGCTgctccag---- cgaagCCGCAGGCGGCCACCACGA
st3Gal4-WT ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC
st3Gal4-alle1 +4 bp GGCAGCCTCCAGTGTCGTCgttgtTTGTgTTGTGGTGGGGAATGGGC
st3Gal4-alle2 -4 bp GGCAGCCTCCAGTGTCGTCg--------gTTGTGGTGGGGAATGGGC
st3Gal6-WT ZFN CGGTACCTCTGATTTTGCT-ttgccCTATGGGACAAGGCC
st3Gal6-alle1 +1 bp CGGTACCTCTGATTTTGCTTttgccCTATGGGACAAGGCC
st3Gal6-alle2 -7 bp CGGTACCTCTGATTTTG--------CTATGGGACAAGGCC KO:
mgat2/mgat4A/4B/5 mgat2-WT TALEN
TCCTTTGTCGCCCATTGCTgctccagaggacgaagCCGCAGGCGGCCACCAC GA mgat2-alle1
-4 bp TCCTTTGTCGCCCATTGCTgctccag---- cgaagCCGCAGGCGGCCACCACGA
mgat4A-WT ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt-------------
tcGCCGTGCAGGAGCAGCAACTAACGGAAG magt4-alle1 -5 bp
TTCTGAGTTGAATGCCATTGTCCAACAg------------------
CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle2 +13 bp
TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC
AGGAGCAGCAACTAACGGAAG mgat4B-WT ZFN
GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT mgat4B-alle1 -7 bp
GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT mgat5-WT ZFN
GGGGGATGATGCTTCTGCACTTCACCATCCAg----
cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle1 +4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG
AGAGCAGCTCCATGTT mgat5-alle2 -4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAg--------
gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle3 -16 bp
GGGGGATGATGCTTCTGCACTTC--------------------
CTCAGCCTGAGAGCAGCTCCATGTT KO: mgat2/st3gal4/6/ mgat4A/4B/5 mgat2-WT
TALEN TCCTTTGTCGCCCATTGCTgctccagaggacgaagCCGCAGGCGGCCACCAC GA
mgat2-alle1 -5 bp TCCTTTGTCGCCCATTGCTgctcca-----
cgaaGCCGCAGGCGGCCACCACGA mgat4A-WT ZFN
TTCTGAGTTGAATGCCATTGTCCAACAgtt-------------
tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle1 -5 bp
TTCTGAGTTGAATGCCATTGTCCAACAg------------------
CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-alle2 +13 bp
TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC
AGGAGCAGCAACTAACGGAAG mgat4B-WT ZFN
GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT mgat4B-alle1 -7 bp
GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT mgat5-WT ZFN
GGGGGATGATGCTTCTGCACTTCACCATCCAg----
cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle1 +4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG
AGAGCAGCTCCATGTT mgat5-alle2 -4 bp
GGGGGATGATGCTTCTGCACTTCACCATCCAg--------
gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-alle3 -16 bp
GGGGGATGATGCTTCTGCACTTC--------------------
CTCAGCCTGAGAGCAGCTCCATGTT st3Gal4-WT ZFN
GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC st3Gal4-alle1 -5 bp
GGCAGCCTCCAGTGTCGTCgttgt---------gGTGGGGAATGGGC st3Gal4-alle2 +4 bp
GGCAGCCTCCAGTGTCGTCgTTGTttgtgTTGTGGTGGGGAATGGGC st3Gal6-WT ZFN
CGGTACCTCTGATTTTGCTttgccCTATGGGACAAGGCC st3Gal6-alle1 -4 bp
CGGTACCTCTGATTTTGCTt----CTATGGGACAAGGCC st3Gal6-alle2 -2 bp
CGGTACCTCTGATTTTGCTtg--CTATGGGACAAGGCC KO: fut8 fut8-WT CRISPR
CAAATACTTGATCCGTCCACAACCT-TGGCTGGAAAGGGAA fut8-alle1 -1 bp
CAAATACTTGATCCGTCCACAACC--TGGCTGGAAAGGGAA fut8-alle2 +1 bp
CAAATACTTGATCCGTCCACAACCTTTGGCTGGAAAGGGAA KO: fut8/B4galt1 fut8-WT
CRISPR CAAATACTTGATCCGTCCACAACCT-TGGCTGGAAAGGGAA fut8-alle1 -4 bp
CAAATACTTGATCCGTCCACAA-----GGCTGGAAAGGGAA fut8-alle2 +1 bp
CAAATACTTGATCCGTCCACAACCTTTGGCTGGAAAGGGAA B4galt1-WT ZFN
TGCATCCGGTCCTACAGCgccagc----AACTGGACTATGGTA B4galt1-alle1 +4 bp
TGCATCCGGTCCTACAGCgccagcCAGCAACTGGACTATGGTA KO: mgat3 mgat3-WT ZFN
TTCCTGGACCACTTCCCAcccggt----------GGCCGGCAGGATGGC mgat3-alle1 -21
bp TTCCTGGACCACT-------------------------------ATGGC mgat3-alle2
+293 bp TTCCTGGACCACTGATACcc--+293 bp--cggtGGCCGGCAGGATGGC KO:
mgat4C mgat4C-WT ZFN ATACTTCAGACTATtatgtAATGCTCGAAGATGATGTT
mgat4C-alle1 -13 bp ATACTTCAGACT-------------CGAAGATGATGTT
mgat4C-alle2 -8 bp ATACTTCAGACTAT--------GCTCGAAGATGATGTT KO:
mgat5B mgat5B-WT ZFN CGTGGCGCCCTCCGCAAGatgagtGACCTGCTGGAGCTG
mgat5B-alle1 -7 bp CAGCTCCAGCAGGT-------CTTGCGGAGGGCGCCACG
mgat5B-alle2 -5 bp CAGCTCCAGCAGGT-----ATCTTGCGGAGGGCGCCACG KO:
B3gnt8 B3gnt8-WT TALEN
TGGTCCAGAGATAGCTAATgaagcttctagggtgGAGAAGCTGGGGCTGCTG A B3gnt8-alle1
-17 bp TGGTCCAGAGG----------------- AGGGTGGAGAAGCTGGGGCTGCTGA KO:
mgat1 mgat1-WT ZFN AACAAGTTCAAGTTCccagcaGCTGTGGTAGTGGAGGAC
mgat1-alle1 -2 bp AACAAGTTCAAGTTCc--gcaGCTGTGGTAGTGGAGGAC
[0533] Gene targeting region underlined.
TABLE-US-00011 TABLE 5
tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccg
gagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccg
tcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatg
cggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaata
ccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccatt
caggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctat
tacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggta
acgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaatt
cgagctcggtaccaagcttggttgcatgctgtccggagtctcagcgttat
accagaagtgacctgggtcggggaagactatagtgtcacctaaatctcta
gagcccttcattaggcgcgccaatcccattgcaaattctacaaaaggagt
gtttcccaactgctctatcaagaggaatgttgcacactgtgacctgaatg
caaacatcacacgcgccagcagagaggaagaagagaggcttccctgaccg
ggaatcgaacccgggccgcggcggtgagagcgccgaatcctaaccactag
accaccagggagcacgcgccaaagctcaatgagctataattatccccttg
gaaaacctacaaaaacagtgtttcaaaactgctctgtgaaaagggacctt
tgctagcacgcggcgccaggcaaaacgtgggcacgctgcgttggccggga
atcgaacccgggtcaactgcttggaaggcagctatgctcaccactatacc
accaacgcgcacacgcgccagcagattctacgggaagagtgtttcaaaac
tgctctatcaagagaaatgttccaccttgtgtgtggaatgcagccatcac
acgcgtccatgaaagggcttaattaagatatcgtttaaacgtcgacctgc
agaggccggcggataactagctgatcgcggaatcctgtccctaggccacc
cactgtggggtgcccttcattaggcgcgccaatcccattgcaaattctac
aaaaggagtgtttcccaactgctctatcaagaggaatgttgcacactgtg
acctgaatgcaaacatcacacgcgccagcagagaggaagaagagaggctt
ccctgaccgggaatcgaacccgggccgcggcggtgagagcgccgaatcct
aaccactagaccaccagggagcacgcgccaaagctcaatgagctataatt
atccccttggaaaacctacaaaaacagtgtttcaaaactgctctgtgaaa
agggacctttgctagcacgcggcgccaggcaaaacgtgggcacgctgcgt
tggccgggaatcgaacccgggtcaactgcttggaaggcagctatgctcac
cactataccaccaacgcgcacacgcgccagcagattctacgggaagagtg
tttcaaaactgctctatcaagagaaatgttccaccttgtgtgtggaatgc
agccatcacacgcgtccatgaaagggcggttgcatgctgtccggagtctc
agcgttataccagaagtgacctgggtcggggaagaaaagcttcatggtca
tagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacat
acgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagct
aactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaac
ctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcgg
tttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgct
cggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaata
cggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaa
aggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttt
tccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagt
cagaggtggcgaaacccgacaggactataaagataccaggcgtttccccc
tggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggat
acctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctca
cgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctg
tgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaact
atcgtcttgagtccaacccggtaagacacgacttatcgccactggcagca
gccactggtaacaggattagcagagcgaggtatgtaggcggtgctacaga
gttcttgaagtggtggcctaactacggctacactagaagaacagtatttg
gtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagc
tcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttg
caagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttga
tcttttctacggggtctgacgctcagtggaacgaaaactcacgttaaggg
attttggtcatgagattatcaaaaaggatcttcacctagatccttttaaa
ttaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggt
ctgacagttagaaaaactcatcgagcatcaaatgaaactgcaatttattc
atatcaggattatcaataccatatttttgaaaaagccgtttctgtaatga
aggagaaaactcaccgaggcagttccataggatggcaagatcctggtatc
ggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccc
tcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactga
atccggtgagaatggcaaaagtttatgcatttctttccagacttgttcaa
caggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccg
ttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgtt
aaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaacactg
ccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacc
tggaatgctgttttcccagggatcgcagtggtgagtaaccatgcatcatc
aggagtacggataaaatgcttgatggtcggaagaggcataaattccgtca
gccagtttagtctgaccatctcatctgtaacatcattggcaacgctacct
ttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcg
atagattgtcgcacctgattgcccgacattatcgcgagcccatttatacc
catataaatcagcatccatgttggaatttaatcgcggcctagagcaagac
gtttcccgttgaatatggctcatactcttcctttttcaatattattgaag
catttatcagggttattgtctcatgagcggatacatatttgaatgtattt
agaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgcca
cctgacgtctaagaaaccattattatcatgacattaacctataaaaatag
gcgtatcacgaggccctttcgtc
Sequence CWU 1
1
60139DNAArtificial Sequencemgat1-WT 1aacaagttca agttcccagc
agctgtggta gtggaggac 39237DNAArtificial Sequencemgat1-alle1
2aacaagttca agttccgcag ctgtggtagt ggaggac 37354DNAArtificial
Sequencemgat2-WT 3tcctttgtcg cccattgctg ctccagagga cgaagccgca
ggcggccacc acga 54449DNAArtificial Sequencemgat2-alle1 4tcctttgtcg
cccattgctg ctccacgaag ccgcaggcgg ccaccacga 49539DNAArtificial
Sequencemgat3-WT 5ttcctggacc acttcccacc cggtggccgg caggatggc
39618DNAArtificial Sequencemgat3-alle1 6ttcctggacc actatggc
18720DNAArtificial Sequencemgat3-alle2 (N-terminus) 7ttcctggacc
actgataccc 20819DNAArtificial Sequencemgat3-alle2 (C-terminus)
8cggtggccgg caggatggc 19960DNAArtificial Sequencemgat4A-WT
9ttctgagttg aatgccattg tccaacagtt tcgccgtgca ggagcagcaa ctaacggaag
601055DNAArtificial Sequencemgat4A-alle1 10ttctgagttg aatgccattg
tccaacagcc gtgcaggagc agcaactaac ggaag 551173DNAArtificial
Sequencemgat4A-alle2 11ttctgagttg aatgccattg tccaacagtt gaattctaga
tgatcgccgt gcaggagcag 60caactaacgg aag 731241DNAArtificial
Sequencemgat4B-WT 12gccctccagc agccctctga ggactggatg atcctggagt t
411334DNAArtificial Sequencemgat4B-alle1 13gccctccagc agccctctgg
atgatcctgg agtt 341438DNAArtificial Sequencemgat4C-WT 14atacttcaga
ctattatgta atgctcgaag atgatgtt 381525DNAArtificial
Sequencemgat4C-alle1 15atacttcaga ctcgaagatg atgtt
251630DNAArtificial Sequencemgat4C-alle2 16atacttcaga ctatgctcga
agatgatgtt 301764DNAArtificial Sequencemgat5-WT 17gggggatgat
gcttctgcac ttcaccatcc agcagcggac tcagcctgag agcagctcca 60tgtt
641878DNAArtificial Sequencemgat5-alle1 18gggggatgat gcttctgcac
ttcaccatcc agcatgaatt ctagatgagc ggactcagcc 60tgagagcagc tccatgtt
781963DNAArtificial Sequencemgat5-alle2 19gggggatgat gcttctgcac
ttcaccatcc agagcggact cagcctgaga gcagctccat 60gtt
632035DNAArtificial Sequencemgat5-alle3 (N-terminus) 20gggggatgat
gcttctgcac ttcaccatcc agcag 352129DNAArtificial Sequencemgat5-alle3
(C-terminus) 21cggactcagc ctgagagcag ctccatgtt 292239DNAArtificial
Sequencemgat5B-WT 22cgtggcgccc tccgcaagat gagtgacctg ctggagctg
392332DNAArtificial Sequencemgat5B-alle1 23cagctccagc aggtcttgcg
gagggcgcca cg 322434DNAArtificial Sequencemgat5B-alle2 24cagctccagc
aggtatcttg cggagggcgc cacg 342539DNAArtificial SequenceB3gnt1-WT
25tgcagctgct ctacctgtcg ctgctctccg gactgcacg 392650DNAArtificial
SequenceB3gnt1-alle1 26tgcagctgct ctacctgtcg cagctgctct acctgtctcc
ggactgcacg 502734DNAArtificial SequenceB3gnt1-alle2 27tgcagctgct
ctacctgtct ctccggactg cacg 342835DNAArtificial SequenceB3gnt2-WT
28ttcagccctt cccgggcgta ctggaacaga gagca 352934DNAArtificial
SequenceB3gnt2-alle1 29ttcagccctt ccgggcgtac tggaacagag agca
343031DNAArtificial SequenceB3gnt2-alle2 30ttcagccctt cccgtactgg
aacagagagc a 313139DNAArtificial SequenceB4galt1-WT 31tgcatccggt
cctacagcgc cagcaactgg actatggta 393243DNAArtificial
SequenceB4galt1-alle1 32tgcatccggt cctacagcgc cagccagcaa ctggactatg
gta 433340DNAArtificial SequenceB4galt2-WT 33cagccccgcc actttgccat
cgccatggac aagtttggct 403418DNAArtificial SequenceB4galt2-alle1
(N-terminus) 34cagccccgcc actttgcc 183522DNAArtificial
SequenceB4galt2-alle1 (C-terminus) 35atcgccatgg acaagtttgg ct
223641DNAArtificial SequenceB4galt3-WT 36ctagccctca agtcaggatg
ttgcggaggc tgctggagag g 413746DNAArtificial SequenceB4galt3-alle1
37ctagccctca agtcaggatg tcgtgttgcg gaggctgctg gagagg
463843DNAArtificial SequenceB4galt3-alle2 38ctagccctca agtcaggatg
ttgcccggag gctgctggag agg 433939DNAArtificial SequenceB4galt4-WT
39aactgggact gctttatatt ccacgatgtg gacctggtg 394040DNAArtificial
SequenceB4galt4-alle1 40aactgggact gctttattat tccacgatgt ggacctggtg
404143DNAArtificial SequenceB4galt4-alle2 41aactgggact gctttatatt
tattccacga tgtggacctg gtg 434243DNAArtificial Sequencest3Gal3-WT
42ctctctcttt gtccttgctg gcttcaaatg gcaggacttc aag
434338DNAArtificial Sequencest3Gal3-alle1 43ctctctcttt gtccttgctc
aaatggcagg acttcaag 384442DNAArtificial Sequencest3Gal3-alle2
44ctctctcttt gtccttgctg gctcaaatgg caggacttca ag
424543DNAArtificial Sequencest3Gal4-WT 45ggcagcctcc agtgtcgtcg
ttgtgttgtg gtggggaatg ggc 434647DNAArtificial Sequencest3Gal4-alle1
46ggcagcctcc agtgtcgtcg ttgtttgtgt tgtggtgggg aatgggc
474739DNAArtificial Sequencest3Gal4-alle2 47ggcagcctcc agtgtcgtcg
gttgtggtgg ggaatgggc 394839DNAArtificial Sequencest3Gal6-WT
48cggtacctct gattttgctt tgccctatgg gacaaggcc 394935DNAArtificial
Sequencest3Gal6-alle1 49cggtacctct gattttgctt ctatgggaca aggcc
355017DNAArtificial Sequencest3Gal6-alle2 50cggtacctct gaaggcc
175140DNAArtificial Sequencefut8-WT 51caaatacttg atccgtccac
aaccttggct ggaaagggaa 405239DNAArtificial Sequencefut8-alle1
52caaatacttg atccgtccac aacctggctg gaaagggaa 395341DNAArtificial
Sequencefut8-alle2 53caaatacttg atccgtccac aacctttggc tggaaaggga a
4154120DNAArtificial SequencessODN with 60bp homology arm sequences
54gagagagatt ggtcttgctt gtcatcacca acgtatgaac cagtgtgatg gtgaaatgag
60tcgccgtgca ggagcagcaa ctaacggaag taacactgca ttgactacat tttcaggtac
1205521DNAArtificial SequenceMgataex1F 55tatccactgt gttgcttgct g
215621DNAArtificial SequenceMgataex2R 56actgctcttc cagaggtcct g
215727DNAArtificial SequenceMgataex2F 57gaacgccttc gaatagctga
acatagg 275823DNAArtificial SequenceMgat4aEx1gRNA 58ggtataccac
atggcaaaat ggg 235923DNAArtificial SequenceMgat4aEx2gRNA
59gtccaacagt ttcgccgtgc agg 23603873DNAArtificial SequenceShuttle
vector 60tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg
gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg
tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga
gcagattgta ctgagagtgc 180accatatgcg gtgtgaaata ccgcacagat
gcgtaaggag aaaataccgc atcaggcgcc 240attcgccatt caggctgcgc
aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300tacgccagct
ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
360tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt
accaagcttg 420gttgcatgct gtccggagtc tcagcgttat accagaagtg
acctgggtcg gggaagacta 480tagtgtcacc taaatctcta gagcccttca
ttaggcgcgc caatcccatt gcaaattcta 540caaaaggagt gtttcccaac
tgctctatca agaggaatgt tgcacactgt gacctgaatg 600caaacatcac
acgcgccagc agagaggaag aagagaggct tccctgaccg ggaatcgaac
660ccgggccgcg gcggtgagag cgccgaatcc taaccactag accaccaggg
agcacgcgcc 720aaagctcaat gagctataat tatccccttg gaaaacctac
aaaaacagtg tttcaaaact 780gctctgtgaa aagggacctt tgctagcacg
cggcgccagg caaaacgtgg gcacgctgcg 840ttggccggga atcgaacccg
ggtcaactgc ttggaaggca gctatgctca ccactatacc 900accaacgcgc
acacgcgcca gcagattcta cgggaagagt gtttcaaaac tgctctatca
960agagaaatgt tccaccttgt gtgtggaatg cagccatcac acgcgtccat
gaaagggctt 1020aattaagata tcgtttaaac gtcgacctgc agaggccggc
ggataactag ctgatcgcgg 1080aatcctgtcc ctaggccacc cactgtgggg
tgcccttcat taggcgcgcc aatcccattg 1140caaattctac aaaaggagtg
tttcccaact gctctatcaa gaggaatgtt gcacactgtg 1200acctgaatgc
aaacatcaca cgcgccagca gagaggaaga agagaggctt ccctgaccgg
1260gaatcgaacc cgggccgcgg cggtgagagc gccgaatcct aaccactaga
ccaccaggga 1320gcacgcgcca aagctcaatg agctataatt atccccttgg
aaaacctaca aaaacagtgt 1380ttcaaaactg ctctgtgaaa agggaccttt
gctagcacgc ggcgccaggc aaaacgtggg 1440cacgctgcgt tggccgggaa
tcgaacccgg gtcaactgct tggaaggcag ctatgctcac 1500cactatacca
ccaacgcgca cacgcgccag cagattctac gggaagagtg tttcaaaact
1560gctctatcaa gagaaatgtt ccaccttgtg tgtggaatgc agccatcaca
cgcgtccatg 1620aaagggcggt tgcatgctgt ccggagtctc agcgttatac
cagaagtgac ctgggtcggg 1680gaagaaaagc ttcatggtca tagctgtttc
ctgtgtgaaa ttgttatccg ctcacaattc 1740cacacaacat acgagccgga
agcataaagt gtaaagcctg gggtgcctaa tgagtgagct 1800aactcacatt
aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc
1860agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt
gggcgctctt 1920ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg
gctgcggcga gcggtatcag 1980ctcactcaaa ggcggtaata cggttatcca
cagaatcagg ggataacgca ggaaagaaca 2040tgtgagcaaa aggccagcaa
aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt 2100tccataggct
ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
2160gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc
ctcgtgcgct 2220ctcctgttcc gaccctgccg cttaccggat acctgtccgc
ctttctccct tcgggaagcg 2280tggcgctttc tcatagctca cgctgtaggt
atctcagttc ggtgtaggtc gttcgctcca 2340agctgggctg tgtgcacgaa
ccccccgttc agcccgaccg ctgcgcctta tccggtaact 2400atcgtcttga
gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta
2460acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag
tggtggccta 2520actacggcta cactagaaga acagtatttg gtatctgcgc
tctgctgaag ccagttacct 2580tcggaaaaag agttggtagc tcttgatccg
gcaaacaaac caccgctggt agcggtggtt 2640tttttgtttg caagcagcag
attacgcgca gaaaaaaagg atctcaagaa gatcctttga 2700tcttttctac
ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca
2760tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga
agttttaaat 2820caatctaaag tatatatgag taaacttggt ctgacagtta
gaaaaactca tcgagcatca 2880aatgaaactg caatttattc atatcaggat
tatcaatacc atatttttga aaaagccgtt 2940tctgtaatga aggagaaaac
tcaccgaggc agttccatag gatggcaaga tcctggtatc 3000ggtctgcgat
tccgactcgt ccaacatcaa tacaacctat taatttcccc tcgtcaaaaa
3060taaggttatc aagtgagaaa tcaccatgag tgacgactga atccggtgag
aatggcaaaa 3120gtttatgcat ttctttccag acttgttcaa caggccagcc
attacgctcg tcatcaaaat 3180cactcgcatc aaccaaaccg ttattcattc
gtgattgcgc ctgagcgaga cgaaatacgc 3240gatcgctgtt aaaaggacaa
ttacaaacag gaatcgaatg caaccggcgc aggaacactg 3300ccagcgcatc
aacaatattt tcacctgaat caggatattc ttctaatacc tggaatgctg
3360ttttcccagg gatcgcagtg gtgagtaacc atgcatcatc aggagtacgg
ataaaatgct 3420tgatggtcgg aagaggcata aattccgtca gccagtttag
tctgaccatc tcatctgtaa 3480catcattggc aacgctacct ttgccatgtt
tcagaaacaa ctctggcgca tcgggcttcc 3540catacaatcg atagattgtc
gcacctgatt gcccgacatt atcgcgagcc catttatacc 3600catataaatc
agcatccatg ttggaattta atcgcggcct agagcaagac gtttcccgtt
3660gaatatggct catactcttc ctttttcaat attattgaag catttatcag
ggttattgtc 3720tcatgagcgg atacatattt gaatgtattt agaaaaataa
acaaataggg gttccgcgca 3780catttccccg aaaagtgcca cctgacgtct
aagaaaccat tattatcatg acattaacct 3840ataaaaatag gcgtatcacg
aggccctttc gtc 3873
* * * * *