U.S. patent application number 17/099140 was filed with the patent office on 2021-03-25 for compositions and methods for the treatment of cancer using a tet2 engineered t cell therapy.
This patent application is currently assigned to PACT PHARMA, INC.. The applicant listed for this patent is PACT PHARMA, INC.. Invention is credited to Michael M. Dubreuil, Alex Franzusoff, John Gagnon, Kyle Jacoby, Stefanie Mandl-Cashman, Barbara Sennino.
Application Number | 20210085720 17/099140 |
Document ID | / |
Family ID | 1000005286470 |
Filed Date | 2021-03-25 |
![](/patent/app/20210085720/US20210085720A1-20210325-D00000.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00001.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00002.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00003.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00004.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00005.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00006.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00007.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00008.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00009.TIF)
![](/patent/app/20210085720/US20210085720A1-20210325-D00010.TIF)
View All Diagrams
United States Patent
Application |
20210085720 |
Kind Code |
A1 |
Sennino; Barbara ; et
al. |
March 25, 2021 |
COMPOSITIONS AND METHODS FOR THE TREATMENT OF CANCER USING A TET2
ENGINEERED T CELL THERAPY
Abstract
Compositions comprising and methods for the treatment of cancer
using a neoTCR based cell therapy with a knockout of the expression
of the TET2 gene.
Inventors: |
Sennino; Barbara; (San
Francisco, CA) ; Jacoby; Kyle; (Emeryville, CA)
; Mandl-Cashman; Stefanie; (San Francisco, CA) ;
Dubreuil; Michael M.; (Palo Alto, CA) ; Gagnon;
John; (San Francisco, CA) ; Franzusoff; Alex;
(El Granada, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PACT PHARMA, INC. |
South San Francisco |
CA |
US |
|
|
Assignee: |
PACT PHARMA, INC.
South San Francisco
CA
|
Family ID: |
1000005286470 |
Appl. No.: |
17/099140 |
Filed: |
November 16, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US2020/030704 |
Apr 30, 2020 |
|
|
|
17099140 |
|
|
|
|
62841748 |
May 1, 2019 |
|
|
|
62841753 |
May 1, 2019 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 14/7051 20130101;
C12N 15/113 20130101; C12N 9/22 20130101; A61K 35/17 20130101; C12N
2310/20 20170501; C12N 5/0636 20130101 |
International
Class: |
A61K 35/17 20060101
A61K035/17; C07K 14/725 20060101 C07K014/725; C12N 5/0783 20060101
C12N005/0783; C12N 9/22 20060101 C12N009/22; C12N 15/113 20060101
C12N015/113 |
Claims
1. A composition comprising an effective amount of a cell
comprising: a. an exogenous patient-derived T cell receptor (TCR)
recognizing a neoantigen; and b. a gene disruption of a TET2
locus.
2. The composition of claim 1, wherein the gene disruption
comprises a missense mutation, a nonsense mutation, a
non-frameshift deletion, a frameshift deletion, a non-frameshift
insertion, a frameshift insertion, or any combination thereof.
3. The composition of claim 1, wherein the gene disruption of the
TET2 locus results in a non-functional TET2 protein or in a
knockout of the TET2 gene expression.
4. The composition of claim 1, wherein the cell further comprises a
gRNA and a Cas9 nuclease.
5. The composition of claim 4, wherein the gRNA comprises a
nucleotide sequence set forth in SEQ ID NO.1, SEQ ID NO.2, SEQ ID
NO.3, SEQ ID NO.4, or SEQ ID NO.5.
6. The composition of claim 1, wherein the gene disruption of the
TET2 locus enhances cell persistence or memory cell
differentiation.
7. The composition of claim 1, wherein the cell is a primary
cell.
8. The composition of claim 1, wherein the cell is a
patient-derived cell.
9. The composition of claim 1, wherein the cell is a T cell.
10. The composition of claim 9, wherein the T cell is a. CD45RA+,
CD62L+, CD28+, CD95-, CCR7+, and CD27+; b. CD45RA+, CD62L+, CD28+,
CD95+, CD27+, CCR7+; or c. CD45RO+, CD62L+, CD28+, CD95+, CCR7+,
CD27+, CD127+.
11. The composition of claim 1, wherein the exogenous TCR comprises
a signal sequence, a first and second 2A sequence, and a TCR
polypeptide sequence.
12. The composition of claim 1, wherein the neoantigen is a patient
specific neoantigen.
13. The composition of claim 1, wherein the exogenous
patient-derived TCR is integrated in an endogenous TRAC or TRBC
locus.
14. The composition of claim 1, further comprising a
pharmaceutically acceptable excipient.
15. The composition of claim 1, further comprising a
cryopreservation agent, serum albumin, and a crystalloid
solution.
16. The composition of claim 1, further comprising Plasma-Lyte A,
HSA, and CryoStor CS10.
17. A method of modifying a cell, the method comprising: a.
introducing into the cell a non-viral homologous recombination (HR)
template nucleic acid sequence comprising i. first and second
homology arms homologous to first and second target nucleic acid
sequences, and ii. a patient derived T cell receptor (TCR) gene
sequences positioned between the first and second homology arms; b.
recombining the HR template nucleic acid into an endogenous locus
of the cell; and c. disrupting a TET2 locus of the cell.
18. The method of claim 17, wherein the HR template comprises a
first P2A-coding sequence positioned upstream of the TCR gene
sequence and a second P2A-coding sequence positioned downstream of
the TCR gene sequence, wherein the first and second P2A-coding
sequences code for the same amino acid sequence that are
codon-diverged relative to each other.
19. The method of claim 18, wherein the HR template comprises a
sequence coding for the amino acid sequence Gly Ser Gly positioned
immediately upstream of the P2A-coding sequences, a sequence coding
for a Furin cleavage site positioned upstream of the second
P2A-coding sequence, and a signal sequence positioned between the
first P2A-coding sequence and the TCR gene sequence.
20. The method of claim 17, wherein the first and second homology
arms are each from about 300 bases to about 2,000 bases in
length.
21. The method of claim 18, wherein the HR template comprises a
second TCR sequence positioned between the second P2A-coding
sequence and the second homology arm.
22. The method of claim 21, wherein the HR template comprises: a. a
first signal sequence positioned between the first P2A-coding
sequence and the first TCR gene sequence; and b. a second signal
sequence positioned between the second P2A-coding sequence and the
second TCR gene sequence; wherein the first and the second signal
sequences encode for the same amino acid sequence and are codon
diverged relative to each other.
23. The method of claim 17, wherein the HR template is a circular
DNA or a linear DNA.
24. The method of claim 17, wherein the introducing occurs via
electroporation.
25. The method of claim 17, wherein the recombining comprises: a.
cleavage of the endogenous locus by a Cas9/gRNA ribonucleoprotein;
and b. recombination of the HR template nucleic acid sequence into
the endogenous locus by homology directed repair.
26. The method of claim 17, wherein the disrupting comprises
cleavage of the TET2 locus by a Cas9/gRNA ribonucleoprotein.
27. The method of claim 26, wherein the gRNA comprises a sequence
set forth in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, or
SEQ ID NO.5.
28. A method of treating cancer in a subject in need thereof, the
method comprising administering a therapeutically effective amount
of a cell comprising: a. an exogenous patient-derived T cell
receptor (TCR) recognizing a neoantigen; and b. a gene disruption
of a TET2 locus.
29. The method of claim 28, wherein prior to administering the
therapeutically effective amount of cells, a non-myeloablative
lymphodepletion regimen is administered to the subject.
30. The method of claim 28, wherein the cancer is selected from the
group consisting of follicular lymphoma, leukemia, multiple
myeloma, melanoma, thoracic cancer, lung cancer, ovarian cancer,
breast cancer, pancreatic cancer, head and neck cancer, prostate
cancer, gynecological cancer, central nervous system cancer,
cutaneous cancer, HPV+ cancer, esophageal cancer, thyroid cancer,
gastric cancer, hepatocellular cancer, cholangiocarcinomas, renal
cell cancers, testicular cancer, sarcomas, and colorectal cancer.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Continuation of International Patent
Application No.: PCT/US20/30704 filed on Apr. 30, 2020, which
claims priority to U.S. Provisional Application No. 62/841,748,
filed on May 1, 2019, and U.S. Provisional Application No.
62/841,753, filed on May 1, 2019, the content of each of which is
incorporated in ints entirety, and to each of which priority is
claimed.
SEQUENCE LISTINGS
[0002] The instant application contains a Sequence Listings which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 16, 2020, is named 0875200170SL.txt and is 13,915 bytes in
size.
BACKGROUND OF THE INVENTION
[0003] Tet methylcytosine dioxygenase 2 (TET2) is a gene that
encodes the protein methylcytosine dioxygenase that catalyzes the
conversion of methylcytosine to 5-hydroxymethylcytosine. The
encoded protein appears to be involved in myelopoiesis, and defects
in this gene have been associated with several myeloproliferative
disorders. However, the exact function of the protein is
unknown.
[0004] The TET2 gene is found on the cytogenetic location 4q24 (the
long (q) arm of chromosome 4 at position 24). Other names for the
TET2 gene include F1120032, KIAA1546, MGC125715, probably
methylcytosine dioxygenase TET2, probably methylcytosine
dioxygenase TET2 isoform a, probably methylcytosine dioxygenase
TET2 isoform b, tet oncogene family member 2, and TET2_HUMAN.
[0005] Based on the function of similar proteins, researchers
believe the TET2 protein is involved in regulating the process of
transcription, which is the first step in protein production.
Although this protein is found throughout the body, it may play a
particularly important role in the production of blood cells from
hematopoietic stem cells. These stem cells are located within the
bone marrow and have the potential to develop into red blood cells,
white blood cells, and platelets. The TET2 protein appears to act
as a tumor suppressor, preventing cells from growing and dividing
in an uncontrolled way. For example, somatic TET2 mutations are
frequently observed in myelodysplastic syndromes (MDS),
myeloproliferative neoplasms (MPN), MDS/MPN overlap syndromes
including chronic myelomonocytic leukemia (CMML), acute myeloid
leukemias (AML) and secondary AML (sAML).
[0006] It has also been suggested that TET2 mutations have
prognostic value in cytogenetically normal acute myeloid leukemia
(CN-AML). "Nonsense" and "frameshift" mutations in this gene are
associated with poor outcome on standard therapies in this
otherwise favorable-risk patient subset. Loss of function TET2
mutations may also have a possible causal role in
atherogenesis.
[0007] TET2 may also be a candidate for active DNA demethylation,
the catalytic removal of the methyl group added to the fifth carbon
on the cytosine base
[0008] Some gene mutations are acquired during a person's lifetime
and are present only in certain cells. These changes, which are
called somatic mutations, are not inherited. Somatic mutations in
the TET2 gene have been identified in a small number of people with
essential thrombocythemia, which is a condition characterized by
high numbers of platelets in the blood. Platelets are the blood
cells involved in blood clotting. TET2 gene mutations alter the
TET2 protein in different ways; however, all of them appear to
result in a nonfunctional protein. The role these mutations play in
the development of essential thrombocythemia is unknown.
[0009] Somatic mutations in the TET2 gene are associated with
polycythemia vera, a disorder characterized by uncontrolled blood
cell production. These mutations are thought to result in a
nonfunctional protein. Mutations in this gene have been found in
approximately 16 percent of people with polycythemia vera. It is
unclear what role these mutations play in the development of
polycythemia vera.
[0010] Somatic mutations in the TET2 gene are associated with
primary myelofibrosis. This condition is characterized by scar
tissue (fibrosis) in the bone marrow, the tissue that produces
blood cells. It is unclear what role the TET2 gene mutations play
in the development of primary myelofibrosis.
[0011] Somatic TET2 gene mutations are also associated with certain
types of cancer of blood-forming cells (leukemia) and a disease of
the blood and bone marrow called myelodysplastic syndrome. These
mutations are thought to result in a nonfunctional TET2 protein. A
loss of TET2 protein in hematopoietic stem cells may lead to
uncontrolled growth and division of these cells. Researchers are
working to determine exactly what role TET2 gene mutations play in
the development of bone marrow disorders.
[0012] TET2 mutations have also been shown to be associated with
myeloid neoplasia.
[0013] TET2-disruption in CAR T cells have also been shown to be
associated with cancer remission in subjects and long-term CAR T
cell survival post-infusion (Fraietta et al., 2018, Nature,
558(7709), 307-312). Specifically, TET2-disrupted CART cells
modified by viral editing methods were identified in a patient with
remission and accounted for nearly all edited cells two (2) months
post profusion.
[0014] Cell therapies designed to express a NeoTCR with a
concurrent knockout or knockdown of the TET2 gene have not been
previously pursued. Furthermore, there is an unmet need to develop
cell therapies that have long persistence times and/or ideally full
engraftment as memory stem cells in order to allow for cell
therapies to be single or infrequently dosed therapies.
[0015] However, given the endogenous suppression of TET2 and its
inherent anti-tumor activity, therapies that modulate the
expression of TET2 on T cells need to be engineered precisely in
order to prevent oncogenic phenotypes of such therapies.
[0016] Accordingly, there is an unmet need of a cell therapy that
can specifically target tumors through NeoTCR engagement and that
persist for extended periods of time within the patient post
infusion. Such therapies are that include a knockout or knockdown
TET2 that is specific to T cells are described herein.
SUMMARY OF THE INVENTION
[0017] The present inventions described herein provide for cells
that were engineered to modulate the endogenous expression of the
TET2 gene.
[0018] In certain embodiments, the presently disclosed subject
matter provides a cell, comprising an exogenous T cell receptor
(TCR), and a gene disruption of a TET2 locus. In certain
embodiments, the gene disruption comprises a substitution, a
deletion, an insertion, or any combination thereof. In certain
embodiments, the gene disruption comprises a missense mutation, a
nonsense mutation, a non-frameshift deletion, a frameshift
deletion, a non-frameshift insertion, a frameshift insertion, or
any combination thereof. In certain embodiments, the gene
disruption of the TET2 locus results in a non-functional TET2
protein. In certain embodiments, the gene disruption of the TET2
locus results in knockout of the TET2 gene expression.
[0019] In certain embodiments, the cell comprises a gRNA and a Cas9
nuclease. In certain embodiments, the gRNA comprises a nucleotide
sequence set forth in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID
NO.4, or SEQ ID NO.5.
[0020] In certain embodiments, the gene disruption of the TET2
locus enhances cell persistence. In certain embodiments, the gene
disruption of the TET2 locus enhances memory cell
differentiation.
[0021] In certain embodiments, the cell is a primary cell. In
certain embodiments, the cell is a patient-derived cell. In certain
embodiments, the cell is a lymphocyte. In certain embodiments, the
cell is a T cell. In certain embodiments, the cell is CD45RA+,
CD62L+, CD28+, CD95-, CCR7+, and CD27+. In certain embodiments, the
cell is CD45RA+, CD62L+, CD28+, CD95+, CD27+, CCR7+. In certain
embodiments, the cell is CD45RO+, CD62L+, CD28+, CD95+, CCR7+,
CD27+, CD127+.
[0022] In certain embodiments, the exogenous TCR is a patient
derived TCR. In certain embodiments, the exogenous TCR comprises a
signal sequence, a first and second 2A sequence, and a TCR
polypeptide sequence. In certain embodiments, the exogenous TCR
recognizes a cancer antigen. In certain embodiments, the cancer
antigen is a neoantigen. In certain embodiments, the cancer antigen
is a patient specific antigen.
[0023] In certain embodiments, the presently disclosed subject
matter provides a cell modified by a process, the process
comprising introducing into a cell a homologous recombination (HR)
template nucleic acid sequence, recombining the HR template nucleic
acid into an endogenous locus of the cell, and disrupting a TET2
locus of the cell. In certain embodiments, the HR template
comprises first and second homology arms homologous to first and
second target nucleic acid sequences, and a TCR gene sequence
positioned between the first and second homology arms. In certain
embodiments, the HR template comprises a first 2A-coding sequence
positioned upstream of the TCR gene sequence and a second 2A-coding
sequence positioned downstream of the TCR gene sequence, wherein
the first and second 2A-coding sequences code for the same amino
acid sequence that are codon-diverged relative to each other. In
certain embodiments, the 2A-coding sequence is a P2A-coding
sequence. In certain embodiments, a sequence coding for the amino
acid sequence Gly Ser Gly is positioned immediately upstream of the
2A-coding sequences. In certain embodiments, the HR template
comprises a sequence coding for a Furin cleavage site positioned
upstream of the second 2A-coding sequence.
[0024] In certain embodiments, the first and second homology arms
are each from about 300 bases to about 2,000 bases in length. In
certain embodiments, the first and second homology arms are each
from about 600 bases to about 2,000 bases in length. In certain
embodiments, the HR template further comprises a signal sequence
positioned between the first 2A-coding sequence and the TCR gene
sequence. In certain embodiments, the HR template comprises a
second TCR sequence positioned between the second 2A-coding
sequence and the second homology arm.
[0025] In certain embodiments, the HR template comprises a first
signal sequence positioned between the first 2A-coding sequence and
the first TCR gene sequence, and a second signal sequence
positioned between the second 2A-coding sequence and the second TCR
gene sequence, wherein the first and the second signal sequences
encode for the same amino acid sequence and are codon diverged
relative to each other. In certain embodiments, the signal sequence
is a human growth hormone signal sequence.
[0026] In certain embodiments, the HR template is non-viral. In
certain embodiments, the HR template is a circular DNA. In certain
embodiments, the HR template is a linear DNA. In certain
embodiments, the introducing occurs via electroporation.
[0027] In certain embodiments, the recombining comprises cleavage
of the endogenous locus by a nuclease, and recombination of the HR
template nucleic acid sequence into the endogenous locus by
homology directed repair. In certain embodiments, the nuclease is a
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
family nuclease, or derivative thereof. In certain embodiments, the
nuclease comprises a gRNA.
[0028] In certain embodiments, the disrupting comprises introducing
a substitution, a deletion, an insertion, or any combination
thereof. In certain embodiments, the disrupting comprises
introducing a missense mutation, a nonsense mutation, a
non-frameshift deletion, a frameshift deletion, a non-frameshift
insertion, a frameshift insertion, or any combination thereof. In
certain embodiments, the disrupting results in a non-functional
TET2 protein. In certain embodiments, the disrupting results in
knockout of the TET2 gene expression.
[0029] In certain embodiments, the disrupting comprises cleavage of
the TET2 locus by a nuclease. In certain embodiments, the nuclease
is a Clustered Regularly Interspaced Short Palindromic Repeats
(CRISPR) family nuclease, or derivative thereof. In certain
embodiments, the nuclease comprises a gRNA. In certain embodiments,
the gRNA comprises a sequence set forth in SEQ ID NO.1, SEQ ID
NO.2, SEQ ID NO.3, SEQ ID NO.4, or SEQ ID NO.5. In certain
embodiments, the nuclease is expressed by a vector. In certain
embodiments, the gRNA is expressed by a vector. In certain
embodiments, the vector is a viral vector. In certain embodiments,
the vector is a non-viral vector.
[0030] In certain embodiments, the disrupting of the TET2 locus
enhances cell persistence. In certain embodiments, the disrupting
of the TET2 locus enhances memory cell differentiation.
[0031] In certain embodiments, the cell is a primary cell. In
certain embodiments, the cell is a patient-derived cell. In certain
embodiments, the cell is a lymphocyte. In certain embodiments, the
cell is a T cell. In certain embodiments, the T cell is a
patient-derived cell. In certain embodiments, the cell is a young T
cell. In certain embodiments, the cell is CD45RA+, CD62L+, CD28+,
CD95-, CCR7+, and CD27+. In certain embodiments, the cell is
CD45RA+, CD62L+, CD28+, CD95+, CD27+, CCR7+. In certain
embodiments, the cell is CD45RO+, CD62L+, CD28+, CD95+, CCR7+,
CD27+, CD127+.
[0032] In certain embodiments, the endogenous locus is within an
endogenous TCR gene. In certain embodiments, the TCR gene sequence
encodes for a TCR that recognizes a tumor antigen. In certain
embodiments, the tumor antigen is a neoantigen. In certain
embodiments, the tumor antigen is a patient specific neoantigen. In
certain embodiments, the TCR gene sequence is a patient specific
TCR gene sequence.
[0033] In certain embodiments, the process further comprises
culturing the cell. In certain embodiments, the culturing is
conducted in the presence of at least one cytokine. In certain
embodiments, the culturing is conducted in the presence of IL2,
IL7, IL15, or any combination thereof. In certain embodiments, the
culturing is conducted in the presence of IL7 and IL15.
[0034] In certain embodiments, the presently disclosed subject
matter provides a method of modifying a cell, the method comprising
introducing into a cell a homologous recombination (HR) template
nucleic acid sequence, recombining the HR template nucleic acid
into an endogenous locus of the cell, and disrupting a TET2 locus
of the cell. In certain embodiments, the HR template comprises
first and second homology arms homologous to first and second
target nucleic acid sequences, and a TCR gene sequence positioned
between the first and second homology arms. In certain embodiments,
the HR template comprises a first 2A-coding sequence positioned
upstream of the TCR gene sequence and a second 2A-coding sequence
positioned downstream of the TCR gene sequence, wherein the first
and second 2A-coding sequences code for the same amino acid
sequence that are codon-diverged relative to each other. In certain
embodiments, the 2A-coding sequence is a P2A-coding sequence. In
certain embodiments, a sequence coding for the amino acid sequence
Gly Ser Gly is positioned immediately upstream of the 2A-coding
sequences. In certain embodiments, the HR template comprises a
sequence coding for a Furin cleavage site positioned upstream of
the second 2A-coding sequence.
[0035] In certain embodiments, the first and second homology arms
are each from about 300 bases to about 2,000 bases in length. In
certain embodiments, the first and second homology arms are each
from about 600 bases to about 2,000 bases in length. In certain
embodiments, the HR template further comprises a signal sequence
positioned between the first 2A-coding sequence and the TCR gene
sequence. In certain embodiments, the HR template comprises a
second TCR sequence positioned between the second 2A-coding
sequence and the second homology arm.
[0036] In certain embodiments, the HR template comprises a first
signal sequence positioned between the first 2A-coding sequence and
the first TCR gene sequence, and a second signal sequence
positioned between the second 2A-coding sequence and the second TCR
gene sequence, wherein the first and the second signal sequences
encode for the same amino acid sequence and are codon diverged
relative to each other. In certain embodiments, the signal sequence
is a human growth hormone signal sequence.
[0037] In certain embodiments, the HR template is non-viral. In
certain embodiments, the HR template is a circular DNA. In certain
embodiments, the HR template is a linear DNA. In certain
embodiments, the introducing occurs via electroporation.
[0038] In certain embodiments, the recombining comprises cleavage
of the endogenous locus by a nuclease, and recombination of the HR
template nucleic acid sequence into the endogenous locus by
homology directed repair. In certain embodiments, the nuclease is a
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
family nuclease, or derivative thereof. In certain embodiments, the
nuclease comprises a gRNA.
[0039] In certain embodiments, the disrupting comprises introducing
a substitution, a deletion, an insertion, or any combination
thereof. In certain embodiments, the disrupting comprises
introducing a missense mutation, a nonsense mutation, a
non-frameshift deletion, a frameshift deletion, a non-frameshift
insertion, a frameshift insertion, or any combination thereof. In
certain embodiments, the disrupting results in a non-functional
TET2 protein. In certain embodiments, the disrupting results in
knockout of the TET2 gene expression.
[0040] In certain embodiments, the disrupting comprises cleavage of
the TET2 locus by a nuclease. In certain embodiments, the nuclease
is a Clustered Regularly Interspaced Short Palindromic Repeats
(CRISPR) family nuclease, or derivative thereof. In certain
embodiments, the nuclease comprises a gRNA. In certain embodiments,
the gRNA comprises a sequence set forth in SEQ ID NO.1, SEQ ID
NO.2, SEQ ID NO.3, SEQ ID NO.4, or SEQ ID NO.5. In certain
embodiments, the nuclease is expressed by a vector. In certain
embodiments, the gRNA is expressed by a vector. In certain
embodiments, the vector is a viral vector. In certain embodiments,
the vector is a non-viral vector.
[0041] In certain embodiments, the disrupting of the TET2 locus
enhances cell persistence. In certain embodiments, the disrupting
of the TET2 locus enhances memory cell differentiation.
[0042] In certain embodiments, wherein the cell is a primary cell.
In certain embodiments, the cell is a patient-derived cell. In
certain embodiments, the cell is a lymphocyte. In certain
embodiments, the cell is a T cell. In certain embodiments, the T
cell is a patient-derived cell. In certain embodiments, the cell is
a young T cell. In certain embodiments, the cell is CD45RA+,
CD62L+, CD28+, CD95-, CCR7+, and CD27+. In certain embodiments, the
cell is CD45RA+, CD62L+, CD28+, CD95+, CD27+, CCR7+. In certain
embodiments, the cell is CD45RO+, CD62L+, CD28+, CD95+, CCR7+,
CD27+, CD127+.
[0043] In certain embodiments, the endogenous locus is within an
endogenous TCR gene. In certain embodiments, the TCR gene sequence
encodes for a TCR that recognizes a tumor antigen. In certain
embodiments, the tumor antigen is a neoantigen. In certain
embodiments, the tumor antigen is a patient specific neoantigen. In
certain embodiments, the TCR gene sequence is a patient specific
TCR gene sequence.
[0044] In certain embodiments, the method further comprises
culturing the cell. In certain embodiments, the culturing is
conducted in the presence of at least one cytokine. In certain
embodiments, the culturing is conducted in the presence of IL2,
IL7, IL15, or any combination thereof. In certain embodiments, the
culturing is conducted in the presence of IL7 and IL15.
[0045] In certain embodiments, the presently disclosed subject
matter provides a method of treating cancer in a subject in need
thereof, the method comprising administering a therapeutically
effective amount of a cell disclosed herein. In certain
embodiments, prior to administering the therapeutically effective
amount of cells provided herein, a non-myeloablative
lymphodepletion regimen is administered to the subject. In certain
embodiments, the cancer is a solid tumor. In certain embodiments,
the cancer is liquid tumor. In certain embodiments, the solid tumor
is selected from the group consisting of melanoma, thoracic cancer,
lung cancer, ovarian cancer, breast cancer, pancreatic cancer, head
and neck cancer, prostate cancer, gynecological cancer, central
nervous system cancer, cutaneous cancer, HPV+ cancer, esophageal
cancer, thyroid cancer, gastric cancer, hepatocellular cancer,
cholangiocarcinomas, renal cell cancers, testicular cancer,
sarcomas, and colorectal cancer. In certain embodiments, the liquid
tumor is selected from the group consisting of follicular lymphoma,
leukemia, and multiple myeloma.
[0046] In certain embodiments, the presently disclosed subject
matter provides a composition comprising an effective amount of a
cell disclosed herein. In certain embodiments, the composition is a
pharmaceutical composition that further comprises a
pharmaceutically acceptable excipient. In certain embodiments, the
composition is administered to a patient in need thereof for the
treatment of cancer. In certain embodiments, the composition
comprises a cryopreservation agent. In certain embodiments, the
composition comprises serum albumin. In certain embodiments, the
composition comprises Plasma-Lyte A, HSA, and CryoStor CS10.
[0047] In certain embodiments, the presently disclosed subject
matter provides a kit comprising a cell, reagents for performing a
method, or a composition disclosed herein. In certain embodiments,
the kit further comprises written instructions for treating a
cancer.
BRIEF DESCRIPTION OF THE DRAWINGS
[0048] FIG. 1 provides a high-level diagram of the knock-out and
knock-in at the endogenous TCR locus and the knock-out of the TET2
gene accomplished by the gene editing technology described
herein.
[0049] FIGS. 2A-2C show an example of a NeoE TCR cassette and gene
editing methods that can be used to make NeoTCR Products. FIG. 2A
shows a schematic representing the general targeting strategy used
for integrating neoantigen-specific TCR constructs (neoTCRs) into
the TCR.alpha. locus. FIGS. 2B and 2C show a neoantigen-specific
TCR construct design used for integrating a NeoTCR into the
TCR.alpha. locus wherein the cassette is shown with signal
sequences ("SS"), protease cleavage sites ("P"), and 2A peptides
("2A"). FIG. 2B shows a target TCR.alpha. locus (endogenous TRAC,
top panel) and its CRISPR Cas9 target site (horizontal stripes,
cleavage site designated by the arrow), and the circular plasmid HR
template (bottom panel) with the polynucleotide encoding the
neoTCR, which is located between left and right homology arms
("LHA" and "RHA" respectively) prior to integration. FIG. 2C shows
the integrated neoTCR in the TCR.alpha. locus (top panel), the
transcribed and spliced neoTCR mRNA (middle panel), and translation
and processing of the expressed neoTCR (bottom panel).
[0050] FIG. 3 shows the results of an In-Out PCR confirming precise
target integration of the NeoE TCR cassette. Agarose gels show the
results of a PCR using primers specific to the NeoE TCR cassette
and relative site generate products of the expected size only for
cells treated with both nuclease and DNA template
(knock-out-knock-in (KOKI) and knock-out-knock-in-knock-out
(KOKIKO)), demonstrating site-specific and precise integration.
[0051] FIG. 4A shows results from a FACS experiment showing that
the endogenous TCR has reduced signal and that there is a strong
NeoE TCR signal in cells that were electroporated with the NeoE TCR
cassette. FIG. 4B shows the results from a series of multiple
transfection experiments with the NeoE TCR cassette showing a high
degree of reproducibility between experiments.
[0052] FIGS. 5A-5E depict five (5) exemplary RNP knockout
strategies for knocking out the TET2 gene. FIGS. 5A and 5E depict
sgRNAs that target the negative strand. FIGS. 5B, 5C, and 5D depict
sgRNAs that target the positive strand.
[0053] FIGS. 6A and 6B show agarose gels of amplified DNA extracted
from lysed TET2 gRNA-Cas9 RNP edited CD4 and CD8 T cells. The
primers used for the amplification are provided in Table 3. FIG. 6A
shows PCR amplicons that were uncut. FIG. 6B shows PCR amplicons
that were cut by incubation with T7 endonuclease I (NEB). The lanes
of both FIG. 6A and FIG. 6B are: 1. Marker, 2. WT (TET2_Fwd1,
TET2_Rev1), 3. WT (TET2_Fwd2, TET2_Rev2), 4. gRNA1 (TET2_Fwd1,
TET2_Rev1), 5. gRNA2 (TET2_Fwd2, TET2_Rev2), 6. gRNA3 (TET2_Fwd2,
TET2_Rev2), 7. gRNA4 (TET2_Fwd1, TET2_Rev1), 8. gRNA5 (TET2_Fwd1,
TET2_Rev1).
[0054] FIGS. 7A-7E show that coverage of the PCR amplicons was
robust for all amplicons surrounding the guide site. FIG. 7A shows
results of gRNA 1 (SEQ ID NO:1). FIG. 7B shows results of gRNA 4
(SEQ ID NO:4). FIG. 7C shows results of gRNA 5 (SEQ ID NO:5). FIG.
7D shows results of gRNA 3 (SEQ ID NO:3). FIG. 7E shows results of
gRNA 2 (SEQ ID NO:2).
[0055] FIGS. 8A and 8B show that sgRNA 3 (SEQ ID NO:3) provides the
best disruption of TET2 and does not interfere with the neoTCR gene
editing and the insertion of a neoTCR. FIG. 8A shows the indel
characterization and FIG. 8B shows the gene editing (insertion of
the neoTCR) rates. The gene editing insertion of the neoTCR as
provided in FIG. 8B is measured by dextramer binding to the gene
edited cells. Because the dextramer specifically binds to the
neoTCR, binding is a direct correlation to neoTCR expression.
[0056] FIG. 9 shows that there is no appreciable reduction in 5-hmC
in the absence of TET2 (i.e., in TET2 Products) with or without
1.5h stimulation with cognate comPACT plate coating. Anti-5-hmC
antibody staining of samples resting or stimulated for 1.5h with
cognate comPACT (EXP19001222) was detected using flow
cytometry.
[0057] FIG. 10 shows the TET2 Products had the equivalent
expression of the TCF7 and TBET transcription factors as NeoTCR
Products (i.e., cells that did not have a TET2 deletion). The cells
used in this flow cytometry experiment were resting edited
cells.
[0058] FIGS. 11A and 11B show that TET2 Disruption by gRNA3 results
in reduced terminal effector differentiation as evidenced by
percent IFN.gamma.+ cells (FIG. 11A) and percent CD107a+ cells
(FIG. 11B).
[0059] As shown in FIGS. 12A and 12B, there are no differences
between the tumor cell killing ability of TET2 Products and NeoTCR
Products kept in culture for 14-15 days. IncuCyte assays with
PACT035-TCR089 neoTCR edited T cells with and without TET2 gRNA3
were co-cultured with SW620 COX6C-R20Q tumor cells (FIG. 12A) or
SW620 tumor cells lacking the COX6C-R20Q mutation (FIG. 12B). The
R20Q mutation directly correlates with TCR089 such that TCR089 is
designed to kill cells that express the R20Q mutation.
[0060] FIGS. 13A and 13B show that TET2 Products maintain killing
activity longer than NeoTCR Products (cells without a knockout of
the TET2 gene). NeoTCR Products (PACT035-TCR089 as shown in the
figures) and TET2 Products (PACT035-TCR089 TET2 gRNA 3 as shown in
the figures) were kept in culture for 30 days before being tested.
IncuCyte assays with NeoTCR Products (PACT035-TCR089) and TET2
Products (PACT035-TCR089 TET2 gRNA 3) were co-cultured with SW620
COX6C-R20Q tumor cells (FIG. 13A) or SW620 tumor cells lacking the
COX6C-R20Q mutation (FIG. 13B).
[0061] FIGS. 14A and 14B shows that TET2 disruption enhances CD8
memory cell differentiation. Geometric mean fluorescence intensity
of surface markers associated with memory and exhaustion among CD8+
dextramer+neoTCR edited T cells with or without TET2 gRNA3
stimulated with cognate comPACT for 7 days is shown for NeoTCR
Products (PACT035-TCR089 as shown in the figures) and TET2 Products
(PACT035-TCR089 TET2 gRNA 3 as shown in the figures). The CCR7 and
CD27 plots shown in the FIGS. 14A and 14B show that TET2
distruption enhances CD8 memory cell differentiation. Specifically,
CCR7 and CD27 are highly expressed on central memory CD8 T cells.
The fact that the TET2 Cells increase the expression (higher MFI)
compared to NeoTCR Cells is represents this effect.
[0062] FIGS. 15A-15D show that expression of TOX (FIGS. 15B and
15D) and TCF7 (FIGS. 15A and 15C) were unchanged between NeoTCR
Products (PACT035-TCR089 as shown in the figures) and TET2 Products
(PACT035-TCR089 TET2 gRNA 3 as shown in the figures). Frequency of
TCF7+(FIGS. 15A and 15C) and TOX+(FIGS. 15B and 15D) CD8+
dextramer+ T cells in response to comPACT stimulation for 7 days
(FIGS. 15A and 15B) or stimulation for 7 days followed by
re-stimulation on fresh comPACT coated plates for 2 additional days
(FIGS. 15C and 15D).
DETAILED DESCRIPTION
Definitions
[0063] Unless defined otherwise, all technical and scientific terms
used herein have the meaning commonly understood by a person
skilled in the art. The following references provide one of skill
with a general definition of many of the terms used in the
presently disclosed subject matter: Singleton et al., Dictionary of
Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge
Dictionary of Science and Technology (Walker ed., 1988); The
Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer
Verlag (1991); and Hale & Marham, The Harper Collins Dictionary
of Biology (1991). As used herein, the following terms have the
meanings ascribed to them below, unless specified otherwise.
[0064] It is understood that aspects and embodiments of the
invention described herein include "comprising," "consisting," and
"consisting essentially of" aspects and embodiments. The terms
"comprises" and "comprising" are intended to have the broad meaning
ascribed to them in U.S. Patent Law and can mean "includes",
"including" and the like.
[0065] As used herein, the term "about" or "approximately" means
within an acceptable error range for the particular value as
determined by one of ordinary skill in the art, which will depend
in part on how the value is measured or determined, i.e., the
limitations of the measurement system. For example, "about" can
mean within 3 or more than 3 standard deviations, per the practice
in the art. Alternatively, "about" can mean a range of up to 20%,
e.g., up to 10%, up to 5%, or up to 1% of a given value.
Alternatively, particularly with respect to biological systems or
processes, the term can mean within an order of magnitude, e.g.,
within 5-fold or within 2-fold, of a value.
[0066] The terms "Cancer" and "Tumor" are used interchangeably
herein. As used herein, the terms "Cancer" or "Tumor" refer to all
neoplastic cell growth and proliferation, whether malignant or
benign, and all pre-cancerous and cancerous cells and tissues. The
terms are further used to refer to or describe the physiological
condition in mammals that is typically characterized by unregulated
cell growth/proliferation. Cancer can affect a variety of cell
types, tissues, or organs, including but not limited to an organ
selected from the group consisting of bladder, bone, brain, breast,
cartilage, glia, esophagus, fallopian tube, gallbladder, heart,
intestines, kidney, liver, lung, lymph node, nervous tissue,
ovaries, pancreas, prostate, skeletal muscle, skin, spinal cord,
spleen, stomach, testes, thymus, thyroid, trachea, urogenital
tract, ureter, urethra, uterus, and vagina, or a tissue or cell
type thereof. Cancer includes cancers, such as sarcomas,
carcinomas, or plasmacytomas (malignant tumor of the plasma cells).
Examples of cancer include, but are not limited to, those described
herein. The terms "Cancer" or "Tumor" and "Proliferative Disorder"
are not mutually exclusive as used herein.
[0067] "Dextramer" as used herein means a multimerized
neoepitope-HLA complex that specifically binds to its cognate
NeoTCR.
[0068] As used herein, the terms "neoantigen", "neoepitope" or
"neoE" refer to a newly formed antigenic determinant that arises,
e.g., from a somatic mutation(s) and is recognized as "non-self" A
mutation giving rise to a "neoantigen", "neoepitope" or "neoE" can
include a frameshift or non-frameshift indel, missense or nonsense
substitution, splice site alteration (e.g., alternatively spliced
transcripts), genomic rearrangement or gene fusion, any genomic or
expression alterations, or any post-translational
modifications.
[0069] "NeoTCR" and "NeoE TCR" as used herein mean a
neoepitope-specific T cell receptor that is introduced into a T
cell, e.g., by gene editing methods.
[0070] "NeoTCR cells" as used herein means one or more cells
precision engineered to express one or more NeoTCRs. In certain
embodiments, the cells are T cells. In certain embodiments, the T
cells are CD8+ and/or CD4+ T cells. In certain embodiments, the
CD8+ and/or CD4+ T cells are autologous cells from the patient for
whom a NeoTCR Product will be administered. The terms "NeoTCR
cells" and "NeoTCR-P1 T cells" and "NeoTCR-P1 cells" are used
interchangeably herein. As used herein, NeoTCR cells are not
engineered to knockout expression of the TET2 gene.
[0071] "NeoTCR Product" as used herein means a pharmaceutical
formulation comprising one or more NeoTCR cells. NeoTCR Product
consists of autologous precision genome-engineered CD8+ and CD4+ T
cells. Using a targeted DNA-mediated non-viral precision genome
engineering approach, expression of the endogenous TCR is
eliminated and replaced by a patient-specific NeoTCR isolated from
peripheral CD8+ T cells targeting the tumor-exclusive neoepitope.
In certain embodiments, the resulting engineered CD8+ or CD4+ T
cells express NeoTCRs on their surface of native sequence, native
expression levels, and native TCR function. The sequences of the
NeoTCR external binding domain and cytoplasmic signaling domains
are unmodified from the TCR isolated from native CD8+ T cells.
Regulation of the NeoTCR gene expression is driven by the native
endogenous TCR promoter positioned upstream of where the NeoTCR
gene cassette is integrated into the genome. Through this approach,
native levels of NeoTCR expression are observed in unstimulated and
antigen-activated T cell states.
[0072] The NeoTCR Product manufactured for each patient represents
a defined dose of autologous CD8+ and/or CD4+ T cells that are
precision genome engineered to express a single neoE-specific TCR
cloned from neoE-specific CD8+ T cells individually isolated from
the peripheral blood of that same patient.
[0073] As used herein, NeoTCR Products are not engineered to
knockout expression of the TET2 gene.
[0074] "NeoTCR Viral Product" as used herein has the same
definition of NeoTCR Product except that the genome engineering is
performed using viral mediated methods.
[0075] "Pharmaceutical Formulation" refers to a preparation which
is in such form as to permit the biological activity of an active
ingredient contained therein to be effective, and which contains no
additional components which are unacceptably toxic to a subject to
which the formulation would be administered. For clarity, DMSO at
quantities used in a NeoTCR Product is not considered unacceptably
toxic.
[0076] A "subject," "patient," or an "individual" for purposes of
treatment refers to any animal classified as a mammal, including
humans, domestic and farm animals, and zoo, sports, or pet animals,
such as dogs, horses, cats, cows, etc. Preferably, the mammal is
human.
[0077] "TCR" as used herein means T cell receptor.
[0078] "TET2" is a gene that encodes the protein methylcytosine
dioxygenase that catalyzes the conversion of methylcytosine to
5-hydroxymethylcytosine. TET2 is also referred to as Tet
methylcytosine dioxygenase 2, FU20032, KIAA1546, MGC125715,
probably methylcytosine dioxygenase TET2, probably mehtvic tosine
dioxygenase TET2 isoform a, probably methylcytosine dioxygenase
TET2 isoform b, tet oncogene family member 2, and TET2_HUMAN.
[0079] "TET2 cells" as used herein means one or more cells
precision engineered to express one or more NeoTCRs and a knockout
of the TET2 gene. In certain embodiments, the cells are T cells. In
certain embodiments, the T cells are CD8+ and/or CD4+ T cells. In
certain embodiments, the CD8+ and/or CD4+ T cells are autologous
cells from the patient for whom a TET2 Product will be
administered.
[0080] "TET2 NeoTCR Product" as used herein means a product
comprising TET2 cells.
[0081] "Treat," "Treatment," and "treating" are used
interchangeably and as used herein mean obtaining beneficial or
desired results including clinical results. Desirable effects of
treatment include, but are not limited to, preventing occurrence or
recurrence of disease, alleviation of symptoms, diminishment of any
direct or indirect pathological consequences of the disease,
preventing metastasis, decreasing the rate of disease progression,
amelioration or palliation of the disease state, and remission or
improved prognosis. In some embodiments, the TET2 Products of this
disclosure are used to delay development of a proliferative
disorder (e.g., cancer) or to slow the progression of such
disease.
[0082] "Treat," "Treatment," and "treating" are used
interchangeably and as used herein mean obtaining beneficial or
desired results including clinical results. Desirable effects of
treatment include, but are not limited to, preventing occurrence or
recurrence of disease, alleviation of symptoms, diminishment of any
direct or indirect pathological consequences of the disease,
preventing metastasis, decreasing the rate of disease progression,
amelioration or palliation of the disease state, and remission or
improved prognosis. In some embodiments, the TET2 Products of the
disclosure is used to delay the development of a proliferative
disorder (e.g., cancer) or to slow the progression of such
disease.
[0083] The term "tumor antigen" as used herein refers to an antigen
(e.g., a polypeptide) that is uniquely or differentially expressed
on a tumor cell compared to a normal or non-neoplastic cell. In
certain embodiments, a tumor antigen includes any polypeptide
expressed by a tumor that is capable of activating or inducing an
immune response via an antigen-recognizing receptor or capable of
suppressing an immune response via receptor-ligand binding.
[0084] "2A" and "2A peptide" are used interchangeably herein and
mean a class of 18-22 amino acid long, viral, self-cleaving
peptides that are able to mediate cleavage of peptides during
translation in eukaryotic cells.
[0085] Four well-known members of the 2A peptide class are T2A,
P2A, E2A, and F2A. The T2A peptide was first identified in the
Thosea asigna virus 2A. The P2A peptide was first identified in the
porcine teschovirus-1 2A. The E2A peptide was first identified in
the equine rhinitis A virus. The F2A peptide was first identified
in the foot-and-mouth disease virus.
[0086] The self-cleaving mechanism of the 2A peptides is a result
of ribosome skipping the formation of a glycyl-prolyl peptide bond
at the C-terminus of the 2A. Specifically, the 2A peptides have a
C-terminal conserved sequence that is necessary for the creation of
steric hindrance and ribosome skipping. The ribosome skipping can
result in one of three options: 1) successful skipping and
recommencement of translation resulting in two cleaved proteins
(the upstream of the 2A protein which is attached to the complete
2A peptide except for the C-terminal proline and the downstream of
the 2A protein which is attached to one proline at the N-terminal;
2) successful skipping but ribosome fall-off that results in
discontinued translation and only the protein upstream of the 2A;
or 3) unsuccessful skipping and continued translation (i.e., a
fusion protein).
[0087] The term "endogenous" as used herein refers to a nucleic
acid molecule or polypeptide that is normally expressed in a cell
or tissue.
[0088] The term "exogenous" as used herein refers to a nucleic acid
molecule or polypeptide that is not endogenously present in a cell.
The term "exogenous" would therefore encompass any recombinant
nucleic acid molecule or polypeptide expressed in a cell, such as
foreign, heterologous, and over-expressed nucleic acid molecules
and polypeptides. By "exogenous" nucleic acid is meant a nucleic
acid not present in a native wild-type cell; for example an
exogenous nucleic acid may vary from an endogenous counterpart by
sequence, by position/location, or both. For clarity, an exogenous
nucleic acid may have the same or different sequence relative to
its native endogenous counterpart; it may be introduced by genetic
engineering into the cell itself or a progenitor thereof, and may
optionally be linked to alternative control sequences, such as a
non-native promoter or secretory sequence.
[0089] "Young" or "Younger" or "Young T cell" as it relates to T
cells means memory stem cells (T.sub.MSC) and central memory cells
(T.sub.CM). These cells have T cell proliferation upon specific
activation and are competent for multiple cell divisions. They also
have the ability to engraft after re-infusion, to rapidly
differentiate into effector T cells upon exposure to their cognate
antigen and target and kill tumor cells, as well as to persist for
ongoing cancer surveillance and control.
Neotcr Products
[0090] In some embodiments, using the gene editing technology and
neoTCR isolation technology described in PCT/US2020/017887 and
PCT/US2019/025415, which are incorporated herein in their
entireties, NeoTCRs are cloned in autologous CD8+ and CD4+ T cells
from the same patient with cancer by precision genome engineered
(using a DNA-mediated (non-viral) method as described in FIGS.
2A-2C) to express the neoTCR. In other words, the NeoTCRs are tumor
specific and identified in cancer patients. These NeoTCRs are then
cloned and the cloned NeoTCRs are inserted into the cancer
patient's T cells. NeoTCR expressing T cells are then expanded in a
manner that preserves a "young" T cell phenotypes, resulting in a
NeoTCR-P1 product (i.e., a NeoTCR Product) in which the majority of
the T cells exhibit T memory stem cell and T central memory
phenotypes.
[0091] These `young` or `younger` or less-differentiated T cell
phenotypes are described to confer improved engraftment potential
and prolonged persistence post-infusion. Thus, the administration
of NeoTCR Product, consisting significantly of `young` T cell
phenotypes, has the potential to benefit patients with cancer,
through improved engraftment potential, prolonged persistence
post-infusion, and rapid differentiation into effector T cells to
eradicate tumor cells throughout the body.
[0092] Ex vivo mechanism-of-action studies were also performed with
NeoTCR Product manufactured with T cells from patients with cancer.
Comparable gene editing efficiencies and functional activities, as
measured by antigen-specificity of T cell killing activity,
proliferation, and cytokine production, were observed demonstrating
that the manufacturing process described herein is successful in
generating product with T cells from patients with cancer as
starting material.
[0093] In certain embodiments, the NeoTCR Product manufacturing
process involves electroporation of dual ribonucleoprotein species
of CRISPR-Cas9 nucleases bound to guide RNA sequences, with each
species targeting the genomic TCR.alpha. and the genomic TCR.beta.
loci. The specificity of targeting Cas9 nucleases to each genomic
locus has been previously described in the literature as being
highly specific. Comprehensive testing of the NeoTCR Product was
performed in vitro and in silico analyses to survey possible
off-target genomic cleavage sites, using COSMID and GUIDE-seq,
respectively. Multiple NeoTCR Product or comparable cell products
from healthy donors were assessed for cleavage of the candidate
off-target sites by deep sequencing, supporting the published
evidence that the selected nucleases are highly specific.
[0094] Further aspects of the precision genome engineering process
have been assessed for safety. No evidence of genomic instability
following precision genome engineering was found in assessing
multiple NeoTCR Products by targeted locus amplification (TLA) or
standard FISH cytogenetics. No off-target integration anywhere into
the genome of the NeoTCR sequence was detected. No evidence of
residual Cas9 was found in the cell product.
[0095] The comprehensive assessment of the NeoTCR Product and
precision genome engineering process indicates that the NeoTCR
Product will be well tolerated following infusion back to the
patient.
[0096] The genome engineering approach described herein enables
highly efficient generation of bespoke NeoTCR T cells (i.e., NeoTCR
Products) for personalized adoptive cell therapy for patients with
solid and liquid tumors. Furthermore, the engineering method is not
restricted to the use in T cells and has also been applied
successfully to other primary cell types, including natural killer
and hematopoietic stem cells.
TET2 Products
[0097] In some embodiments, the NeoTCR Products described above are
further modified to knock out TET2 expression from the cells of the
product (i.e., a TET2 Product). Specifically, using the gene
editing technology and neoTCR isolation technology described in
PCT/US2020/017887 and PCT/US2019/025415, which are incorporated
herein in their entireties, NeoTCRs are cloned in autologous CD8+
and CD4+ T cells from the same patient with cancer by precision
genome engineered (using a DNA-mediated (non-viral) method as
described in FIGS. 2A-2C) to express the neoTCR.
[0098] In certain embodiments, the TET2 gene is disrupted using a
gRNA to knockout expression of TET2 in the same reaction as the
reaction used to knock out the TCR.beta. and insertion of the
neoTCR.alpha. and neoTCR.beta. (see FIG. 1). In certain
embodiments, the knock out the TCR.beta., insertion of the
neoTCR.alpha. and neoTCR.beta., and knockout of TET2 are performed
concurrently in the same reaction.
[0099] In certain embodiments, the TET2 gene is disrupted using a
gRNA to knockout expression of TET2 in a different reaction as the
reaction used to knock out the TCR.beta. and insertion of the
neoTCR.alpha. and neoTCR.beta. (see FIG. 1). In certain
embodiments, the knockout of the TCR.beta. and insertion of the
neoTCR.alpha. and neoTCR.beta. are performed in separate and
consecutive reactions from the knockout of TET2. In certain
embodiments, the knockout of the TCR.beta. and insertion of the
neoTCR.alpha. and neoTCR.beta. are performed in a first reaction
and the knockout of TET2 is performed in a second reaction. In
certain embodiments, the knockout of TET2 is performed in a first
reaction and the knockout of the TCR.beta. and insertion of the
neoTCR.alpha. and neoTCR.beta. are performed in a second
reaction.
[0100] In some embodiments, the TET2 Products comprise cells that
were engineered to express one or more NeoTCRs using viral methods
(i.e., NeoTCR Viral Product) and a knockout of the TET2 gene. In
certain embodiments, the cells of the NeoTCR Viral Product are
further engineered to knockout the TET2 gene using non-viral
methods. In certain embodiments, the cells of the NeoTCR Viral
Product are further engineered to knockout the TET2 gene using
viral methods.
[0101] The TET2 Product manufacturing process involves
electroporation of 1) dual ribonucleoprotein species of CRISPR-Cas9
nucleases bound to guide RNA sequences, with each species targeting
the genomic TCR.alpha. and the genomic TCR.beta. loci, and 2) a
ribonucleoprotein species of CRISPR-Cas9 nucleases bound to guide
RNA sequences that target the TET2 gene. The specificity of
targeting Cas9 nucleases to each genomic locus has been previously
described in the literature as being highly specific. Comprehensive
testing of the TET2 Product can be performed in vitro and in silico
analyses to survey possible off-target genomic cleavage sites,
using COSMID and GUIDE-seq, respectively. In certain embodiments,
testing can be performed using COSMID-based in silico prediction of
off-targets and GUIDE-seq-based in vitro prediction of off-targets,
followed by testing of those putative off-targets by targeted deep
sequencing.
[0102] In certain embodiments, TET2 cells are expanded in a manner
that preserves a "young" T cell phenotypes, resulting in a TET2
Product in which the majority of the T cells exhibit T memory stem
cell and T central memory phenotypes
[0103] These `young` or `younger` or less-differentiated T cell
phenotypes are described to confer improved engraftment potential
and prolonged persistence post-infusion. Thus, the administration
of TET2 Product, consisting significantly of `young` T cell
phenotypes, has the potential to benefit patients with cancer,
through improved engraftment potential, prolonged persistence
post-infusion, and rapid differentiation into effector T cells to
eradicate tumor cells throughout the body.
[0104] In certain embodiments, the TET2 cells of the TET2 Products
predominantly comprise memory stem cells (Tmsc) and/or central
memory cells (Tcm). In certain embodiments, at least 25% of the
TET2 cells of the TET2 Products comprise memory stem cells (Tmsc)
and/or central memory cells (Tcm). In certain embodiments, at least
30% of the TET2 cells of the TET2 Products comprise memory stem
cells (Tmsc) and/or central memory cells (Tcm). In certain
embodiments, at least 35% of the TET2 cells of the TET2 Products
comprise memory stem cells (Tmsc) and/or central memory cells
(Tcm). In certain embodiments, at least 40% of the TET2 cells of
the TET2 Products comprise memory stem cells (Tmsc) and/or central
memory cells (Tcm). In certain embodiments, at least 45% of the
TET2 cells of the TET2 Products comprise memory stem cells (Tmsc)
and/or central memory cells (Tcm). In certain embodiments, at least
50% of the TET2 cells of the TET2 Products comprise memory stem
cells (Tmsc) and/or central memory cells (Tcm). In certain
embodiments, at least 55% of the TET2 cells of the TET2 Products
comprise memory stem cells (Tmsc) and/or central memory cells
(Tcm). In certain embodiments, at least 60% of the TET2 cells of
the TET2 Products comprise memory stem cells (Tmsc) and/or central
memory cells (Tcm). In certain embodiments, at least 65% of the
TET2 cells of the TET2 Products comprise memory stem cells (Tmsc)
and/or central memory cells (Tcm). In certain embodiments, at least
70% of the TET2 cells of the TET2 Products comprise memory stem
cells (Tmsc) and/or central memory cells (Tcm). In certain
embodiments, at least 75% of the TET2 cells of the TET2 Products
comprise memory stem cells (Tmsc) and/or central memory cells
(Tcm). In certain embodiments, greater than 75% of the TET2 cells
of the TET2 Products comprise memory stem cells (Tmsc) and/or
central memory cells (Tcm). Tmsc are characterized as cells that
are CD45RA+CD62L+, CD28+CD95+, and CCR7+CD27+. Tcm are
characterized as cells that are CD45RO+CD62L+, CD28+CD95+, and
CCR7+CD27+CD127+. Both Tmsc and Tcm are characterized as having
weak effector T cell function, robust proliferation, robust
engraftment, and long telomeres.
Methods of Producing TET2 Products with a Young Phenotype
[0105] In certain embodiments, the present disclosure relates, in
part, on the production of engineered "young" T cells. In certain
embodiments, the present disclosure comprises methods for producing
antigen-specific cells, e.g., T cells, ex vivo, comprising
activating, engineering, and expanding antigen-specific cells
originally obtained from a subject or isolated from such
sample.
[0106] In certain embodiments, the methods for activating cells
comprise the steps of activating the TCR/CD3 complex. For example,
without limitation, the T cells can be incubated and/or cultured
with CD3 agonists, CD28 agonists, or a combination thereof.
[0107] In certain embodiments, engineered activated
antigen-specific cells, e.g., engineered activated T cells, can be
expanded by culturing the engineered activated antigen-specific
cells, e.g., T cells, with cytokines, chemokine, soluble peptides,
or combination thereof. In certain embodiments, the engineered
activated antigen-specific cells, e.g., engineered activated T
cells, can be cultured with one or more cytokines. In certain
embodiments, the cytokines can be IL2, IL7, IL15, or combinations
thereof. For example, engineered activated antigen-specific cells,
e.g., engineered activated T cells, can be cultured with IL7 and
IL15. In certain embodiments, the cytokine used in connection with
the engineered activated antigen-specific cell, e.g., engineered
activated T cell, culture can be present at a concentration from
about 1 .mu.g/ml to about 1 g/ml, from about 1 ng/ml to about 1
g/ml, from about 1 .mu.g/ml to about 1 g/ml, or from about 1 mg/ml
to about 1 g/ml, and any values in between.
Pharmaceutical Formulations.
[0108] Pharmaceutical formulations of the TET2 Product are prepared
by combining the TET2 cells in a solution that can preserve the
`young` phenotype of the cells in a cryopreserved state. Table 1
provides an example of one such pharmaceutical formulation.
Alternatively, pharmaceutical formulations of the TET2 Product can
be prepared by combining the TET2 cells in a solution that can
preserve the `young` phenotype of the cells without the need to
freeze or cryopreserve the product (i.e., the TET2 Product is
maintained in an aqueous solution or as a non-frozen/cryopreserved
cell pellet).
[0109] Additional pharmaceutically acceptable carriers, buffers,
stabilizers, and/or preservatives can also be added to the
cryopreservation solution or the aqueous storage solution (if the
TET2 Product is not cryopreserved). Any cryopreservation agent
and/or media can be used to cryopreserve the TET2 Product,
including but not limited to CryoStor, CryoStor CS5, CELLBANKER,
and custom cryopreservation media that optionally include DMSO.
Gene-Editing Methods
[0110] In certain embodiments, the present disclosure involves, in
part, methods of engineering human cells, e.g., engineered T cells
or engineered human stem cells. In certain embodiments, such
engineering involves genome editing. For example, but not by way of
limitation, such genome editing can be accomplished with nucleases
targeting one or more endogenous loci, e.g., TCR alpha (TCR.alpha.)
locus and TCR beta (TCR.beta.) locus, along with the TET2 locus. In
certain embodiments, the nucleases can generate single-stranded DNA
nicks or double-stranded DNA breaks in an endogenous target
sequence. In certain embodiments, the nuclease can target coding or
non-coding portions of the genome, e.g., exons, introns. In certain
embodiments, the nucleases contemplated herein comprise homing
endonuclease, meganuclease, megaTAL nuclease, transcription
activator-like effector nuclease (TALEN), zinc-finger nuclease
(ZFN), and clustered regularly interspaced short palindromic
repeats (CRISPR)/Cas nuclease. In certain embodiments, the
nucleases can themselves be engineered, e.g., via the introduction
of amino acid substitutions and/or deletions, to increase the
efficiency of the cutting activity.
[0111] In certain embodiments, a CRISPR/Cas nuclease system is used
to engineer human cells. In certain embodiments, the CRISPR/Cas
nuclease system comprises a Cas nuclease and one or more RNAs that
recruit the Cas nuclease to the endogenous target sequence, e.g.,
single guide RNA. In certain embodiments, the Cas nuclease and the
RNA are introduced in the cell separately, e.g. using different
vectors or compositions, or together, e.g., in a polycistronic
construct or a single protein-RNA complex. In certain embodiments,
the Cas nuclease is Cas9 or Cas12a. In certain embodiments, the
Cas9 polypeptide is obtained from a bacterial species including,
without limitation, Streptococcus pyogenes or Neisseria
menengitidis. Additional examples of CRISPR/Cas systems are known
in the art. See Adli, Mazhar. "The CRISPR tool kit for genome
editing and beyond." Nature communications vol. 9,1 1911 (2018),
herein incorporated by reference for all that it teaches.
[0112] In certain embodiments, genome editing occurs at one or more
genome loci that regulate immunological responses. In certain
embodiments, the loci include, without limitation, TCR alpha
(TCR.alpha.) locus, TCR beta (TCR.beta.) locus, TCR gamma
(TCR.gamma.), TCR delta (TCR.delta.), and TET2. In certain
embodiments, one of the loci is the TET2 locus.
[0113] In certain embodiments, genome editing is performed by using
non-viral delivery systems. For example, a nucleic acid molecule
can be introduced into a cell by administering the nucleic acid in
the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci.
U.S.A. 84:7413, 1987; Ono et al., Neuroscience Letters 17:259,
1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et
al., Methods in Enzymology 101:512, 1983),
asialoorosomucoid-polylysine conjugation (Wu et al., Journal of
Biological Chemistry 263:14621, 1988; Wu et al., Journal of
Biological Chemistry 264:16985, 1989), or by micro-injection under
surgical conditions (Wolff et al., Science 247:1465, 1990). Other
non-viral means for gene transfer include transfection in vitro
using calcium phosphate, DEAE dextran, electroporation, and
protoplast fusion. Liposomes can also be potentially beneficial for
delivery of DNA into a cell. Transplantation of normal genes into
the affected tissues of a subject can also be accomplished by
transferring a normal nucleic acid into a cultivatable cell type ex
vivo (e.g., an autologous or heterologous primary cell or progeny
thereof), after which the cell (or its descendants) are injected
into a targeted tissue or are injected systemically.
[0114] In certain embodiments, genome editing is performed by using
viral delivery systems. In certain embodiments, the viral methods
include targeted integration (including but not limited to AAV) and
random integration (including but not limited to lentiviral
approaches). In certain embodiments, the viral delivery would be
accomplished without integration of the nuclease. In such
embodiments, the viral delivery system can be Lentiflash or another
similar delivery system.
Homology Recombination Templates
[0115] In certain embodiments, the present disclosure provides
genome editing of a cell by introducing and recombining a
homologous recombination (HR) template nucleic acid sequence into
an endogenous locus of a cell. In certain embodiments, the HR
template nucleic acid sequence is linear. In certain embodiments,
the HR template nucleic acid sequence is circular. In certain
embodiments, the circular HR template can be a plasmid, minicircle,
or nanoplasmid. In certain embodiments, the HR template nucleic
acid sequence comprises a first and a second homology arms. In
certain embodiments, the homology arms can be of about 300 bases to
about 2,000 bases. For example, each homology arm can be 1,000
bases. In certain embodiments, the homology arms can be homologous
to a first and second endogenous sequences of the cell. In certain
embodiments, the endogenous locus is a TCR locus. For example, the
first and second endogenous sequences are within a TCR alpha locus
or a TCR beta locus. In certain embodiments, the HR template
comprises a TCR gene sequences. In non-limiting embodiments, the
TCR gene sequence is a patient specific TCR gene sequence. In
non-limiting embodiments, the TCR gene sequence is tumor-specific.
In non-limiting embodiments, the TCR gene sequence can be
identified and obtained using the methods described in
PCT/US2020/017887, the content of which is herein incorporated by
reference. In certain embodiments, the HR template comprises a TCR
alpha gene sequence and a TCR beta gene sequence.
[0116] In certain embodiments, the HR template is a polycistronic
polynucleotide. In certain embodiments, the HR template comprises
sequences encoding for flexible polypeptide sequences (e.g.,
Gly-Ser-Gly sequence). In certain embodiments, the HR template
comprises sequences encoding an internal ribosome entry site
(IRES). In certain embodiments, the HR template comprises a 2A
peptide (e.g., P2A, T2A, E2A, and F2A). Additional information on
the HR template nucleic acids and methods of modifying a cell
thereof can be found in International Patent Application no.
PCT/US2018/058230, the content of which is herein incorporated by
reference.
Methods of Treatment
[0117] The presently disclosed subject matter provides methods for
inducing and/or increasing an immune response in a subject in need
thereof. The TET2 Products can be used for treating and/or
preventing a cancer in a subject. The TET2 Products can be used for
prolonging the survival of a subject suffering from a cancer. The
TET2 Products can also be used for treating and/or preventing a
cancer in a subject. The TET2 Products can also be used for
reducing tumor burden in a subject. Such methods comprise
administering the TET2 Products in an amount effective or a
composition (e.g., a pharmaceutical composition) comprising thereof
to achieve the desired effect, be it palliation of an existing
condition or prevention of recurrence. For treatment, the amount
administered is an amount effective in producing the desired
effect. An effective amount can be provided in one or a series of
administrations. An effective amount can be provided in a bolus or
by continuous perfusion.
[0118] In certain embodiments, an effective amount of the TET2
Products are delivered through intravenous (IV) administration. In
certain embodiments, the TET2 Products are delivered through IV
administration in a single administration. In certain embodiments,
the TET2 Products are delivered through IV administration in
multiple administrations. In certain embodiments, the TET2 Products
are delivered through IV administration in two or more
administrations. In certain embodiments, the TET2 Products are
delivered through IV administration in two administrations. In
certain embodiments, the TET2 Products are delivered through IV
administration in three administrations.
[0119] The presently disclosed subject matter provides methods for
treating and/or preventing cancer in a subject. In certain
embodiments, the method comprises administering an effective amount
of the TET2 Products to a subject having cancer.
[0120] Non-limiting examples of cancer include blood cancers (e.g.
leukemias, lymphomas, and myelomas), ovarian cancer, breast cancer,
bladder cancer, brain cancer, colon cancer, intestinal cancer,
liver cancer, lung cancer, pancreatic cancer, prostate cancer, skin
cancer, stomach cancer, glioblastoma, throat cancer, melanoma,
neuroblastoma, adenocarcinoma, glioma, soft tissue sarcoma, and
various carcinomas (including prostate and small cell lung cancer).
Suitable carcinomas further include any known in the field of
oncology, including, but not limited to, astrocytoma, fibrosarcoma,
myxosarcoma, liposarcoma, oligodendroglioma, ependymoma,
medulloblastoma, primitive neural ectodermal tumor (PNET),
chondrosarcoma, osteogenic sarcoma, pancreatic ductal
adenocarcinoma, small and large cell lung adenocarcinomas,
chordoma, angiosarcoma, endotheliosarcoma, squamous cell carcinoma,
bronchoalveolarcarcinoma, epithelial adenocarcinoma, and liver
metastases thereof, lymphangiosarcoma, lymphangioendotheliosarcoma,
hepatoma, cholangiocarcinoma, synovioma, mesothelioma, Ewing's
tumor, rhabdomyosarcoma, colon carcinoma, basal cell carcinoma,
sweat gland carcinoma, papillary carcinoma, sebaceous gland
carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, bile duct
carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms'
tumor, testicular tumor, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, meningioma, neuroblastoma, retinoblastoma,
leukemia, multiple myeloma, Waldenstrom's macroglobulinemia, and
heavy chain disease, breast tumors such as ductal and lobular
adenocarcinoma, squamous and adenocarcinomas of the uterine cervix,
uterine and ovarian epithelial carcinomas, prostatic
adenocarcinomas, transitional squamous cell carcinoma of the
bladder, B and T cell lymphomas (nodular and diffuse) plasmacytoma,
acute and chronic leukemias, malignant melanoma, soft tissue
sarcomas and leiomyosarcomas. In certain embodiments, the cancer is
selected from the group consisting of blood cancers (e.g.
leukemias, lymphomas, and myelomas), ovarian cancer, prostate
cancer, breast cancer, bladder cancer, brain cancer, colon cancer,
intestinal cancer, liver cancer, lung cancer, pancreatic cancer,
prostate cancer, skin cancer, stomach cancer, glioblastoma, and
throat cancer. In certain embodiments, the presently disclosed
young T cells and compositions comprising thereof can be used for
treating and/or preventing blood cancers (e.g., leukemias,
lymphomas, and myelomas) or ovarian cancer, which are not amenable
to conventional therapeutic interventions.
[0121] In certain embodiments, the cancer is a solid cancer or a
solid tumor. In certain embodiments, the solid tumor or solid
cancer is selected from the group consisting of glioblastoma,
prostate adenocarcinoma, kidney papillary cell carcinoma, sarcoma,
ovarian cancer, pancreatic adenocarcinoma, rectum adenocarcinoma,
colon adenocarcinoma, esophageal carcinoma, uterine corpus
endometrioid carcinoma, breast cancer, skin cutaneous melanoma,
lung adenocarcinoma, stomach adenocarcinoma, cervical and
endocervical cancer, kidney clear cell carcinoma, testicular germ
cell tumors, and aggressive B-cell lymphomas.
[0122] The subjects can have an advanced form of disease, in which
case the treatment objective can include mitigation or reversal of
disease progression, and/or amelioration of side effects. The
subjects can have a history of the condition, for which they have
already been treated, in which case the therapeutic objective will
typically include a decrease or delay in the risk of
recurrence.
[0123] Suitable human subjects for therapy typically comprise two
treatment groups that can be distinguished by clinical criteria.
Subjects with "advanced disease" or "high tumor burden" are those
who bear a clinically measurable tumor. A clinically measurable
tumor is one that can be detected on the basis of tumor mass (e.g.,
by palpation, CAT scan, sonogram, mammogram or X-ray; positive
biochemical or histopathologic markers on their own are
insufficient to identify this population). A pharmaceutical
composition is administered to these subjects to elicit an
anti-tumor response, with the objective of palliating their
condition. Ideally, reduction in tumor mass occurs as a result, but
any clinical improvement constitutes a benefit. Clinical
improvement includes decreased risk or rate of progression or
reduction in pathological consequences of the tumor.
Articles of Manufacture
[0124] The TET2 Products can be used in combination with articles
of manufacture. Such articles of manufacture can be useful for the
prevention or treatment of proliferative disorders (e.g., cancer).
Examples of articles of manufacture include but are not limited to
containers (e.g., infusion bags, bottles, storage containers,
flasks, vials, syringes, tubes, and IV solution bags) and a label
or package insert on or associated with the container. The
containers may be made of any material that is acceptable for the
storage and preservation of the TET2 cells within the TET2
Products. In certain embodiments, the container may be an
intravenous solution bag or a vial having a stopper pierceable by a
hypodermic injection needle. For example, the container may be a
CryoMACS freezing bag. The label or package insert indicates that
the TET2 Products are used for treating the condition of choice and
the patient of origin. The patient is identified on the container
of the TET2 Product because the TET2 Products is made from
autologous cells and engineered as a patient-specific and
individualized treatment.
[0125] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein.
[0126] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; and 2) a second
container with the same TET2 Product as the first container
contained therein. Optionally, additional containers with the same
TET2 Product as the first and second containers may be prepared and
made. Optionally, additional containers containing a composition
comprising a different cytotoxic or otherwise therapeutic agent may
also be combined with the containers described above.
[0127] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; and 2) a second
container with a composition contained therein, wherein the
composition comprises a further cytotoxic or otherwise therapeutic
agent.
[0128] The article of manufacture may comprise: 1) a first
container with two TET2 Products contained therein; and 2) a second
container with a composition contained therein, wherein the
composition comprises a further cytotoxic or otherwise therapeutic
agent.
[0129] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; 2) a second
container with a second TET2 Product contained therein; and 3)
optionally a third container with a composition contained therein,
wherein the composition comprises a further cytotoxic or otherwise
therapeutic agent. In certain embodiments, the first and second
TET2 Products are different TET2 Products. In certain embodiments,
the first and second TET2 Products are the same TET2 Products.
[0130] The article of manufacture may comprise: 1) a first
container with three TET2 Products contained therein; and 2)
optionally a second container with a composition contained therein,
wherein the composition comprises a further cytotoxic or otherwise
therapeutic agent.
[0131] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; 2) a second
container with a second TET2 Product contained therein; 3) a third
container with a third TET2 Product contained therein; and 4)
optionally a fourth container with a composition contained therein,
wherein the composition comprises a further cytotoxic or otherwise
therapeutic agent. In certain embodiments, the first, second, and
third TET2 Products are different TET2 Products. In certain
embodiments, the first, second, and third TET2 Products are the
same TET2 Products. In certain embodiments, two of the first,
second, and third TET2 Products are the same TET2 Products.
[0132] The article of manufacture may comprise: 1) a first
container with four TET2 Products contained therein; and 2)
optionally a second container with a composition contained therein,
wherein the composition comprises a further cytotoxic or otherwise
therapeutic agent.
[0133] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; 2) a second
container with a second TET2 Product contained therein; 3) a third
container with a third TET2 Product contained therein; 4) a fourth
container with a fourth TET2 Product contained therein; and 5)
optionally a fifth container with a composition contained therein,
wherein the composition comprises a further cytotoxic or otherwise
therapeutic agent. In certain embodiments, the first, second,
third, and fourth TET2 Products are different TET2 Products. In
certain embodiments, the first, second, third, and fourth TET2
Products are the same TET2 Products. In certain embodiments, two of
the first, second, third, and fourth TET2 Products are the same
TET2 Products. In certain embodiments, three of the first, second,
third, and fourth TET2 Products are the same TET2 Products.
[0134] The article of manufacture may comprise: 1) a first
container with five or more TET2 Products contained therein; and 2)
optionally a second container with a composition contained therein,
wherein the composition comprises a further cytotoxic or otherwise
therapeutic agent.
[0135] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; 2) a second
container with a second TET2 Product contained therein; 3) a third
container with a third TET2 Product contained therein; 4) a fourth
container with a fourth TET2 Product contained therein; 5) a fifth
container with a fifth TET2 Product contained therein; 6)
optionally a sixth or more additional containers with a sixth or
more TET2 Product contained therein; and 7) optionally an
additional container with a composition contained therein, wherein
the composition comprises a further cytotoxic or otherwise
therapeutic agent. In certain embodiments, the all of the
containers of TET2 Products are different TET2 Products. In certain
embodiments, all of the containers of TET2 Products are the same
TET2 Products. In certain embodiments, there can be any combination
of same or different TET2 Products in the five or more containers
based on the availability of detectable TET2s in a patient's tumor
sample(s), the need and/or desire to have multiple TET2 Products
for the patient, and the availability of any one TET2 Product that
may require or benefit from one or more container.
[0136] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; 2) a second
container with a second TET2 Product contained therein; and 3) a
third container with a third TET2 Product contained therein.
[0137] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; 2) a second
container with a second TET2 Product contained therein; 3) a third
container with a third TET2 Product contained therein; and 4)
optionally a fourth container with a fourth TET2 Product contained
therein.
[0138] The article of manufacture may comprise: 1) a first
container with a TET2 Product contained therein; 2) a second
container with a second TET2 Product contained therein; 3) a third
container with a third TET2 Product contained therein; 4) a fourth
container with a fourth TET2 Product contained therein; and 5)
optionally a fifth container with a fourth TET2 Product contained
therein.
[0139] The article of manufacture may comprise a container with one
TET2 Product contained therein. The article of manufacture may
comprise a container with two TET2 Products contained therein. The
article of manufacture may comprise a container with three TET2
Products contained therein. The article of manufacture may comprise
a container with four TET2 Products contained therein. The article
of manufacture may comprise a container with five TET2 Products
contained therein.
[0140] The article of manufacture may comprise 1) a first container
with one TET2 Product contained therein, and 2) a second container
with two TET2 Products contained therein. The article of
manufacture may comprise 1) a first container with two TET2
Products contained therein, and 2) a second container with one TET2
Product contained therein. In the examples above, a third and/or
fourth container comprising one or more additional TET2 Products
may be included in the article of manufacture. Additionally, a
fifth container comprising one or more additional TET2 Products may
be included in the article of manufacture.
[0141] Furthermore, any container of TET2 Product described herein
can be split into two, three, or four separate containers for
multiple time points of administration and/or based on the
appropriate dose for the patient.
[0142] In certain embodiments, the TET2 Products are provided in a
kit. The kit can, by means of non-limiting examples, contain
package insert(s), labels, instructions for using the TET2
Product(s), syringes, disposal instructions, administration
instructions, tubing, needles, and anything else a clinician would
need in order to properly administer the TET2 Product(s).
Therapeutic Compositions and Methods of Manufacturing
[0143] As described herein, plasmid DNA-mediated precision genome
engineering process for Good Manufacturing Practice (GMP)
manufacturing of TET2 Product was developed. Targeted integration
of the patient-specific neoTCR was accomplished by electroporating
CRISPR endonuclease ribonucleoproteins (RNPs) together with the
personalized neoTCR gene cassette, encoded by the plasmid DNA. In
addition to the neoTCR, the TET2 knockout was accomplished by
electroporating CRISPR endonuclease ribonucleoproteins (RNPs) that
target the TET2 locus.
[0144] The TET2 Product can be formulated into a drug product using
the clinical manufacturing process. Under this process, the TET2
Product is cryopreserved in CryoMACS Freezing Bags. One or more
bags may be shipped to the site for each patient depending on
patient needs. The product is composed of apheresis-derived,
patient-autologous, CD8 and CD4 T cells that have been precision
genome engineered to express one or more autologous neoTCRs
targeting a neoepitope complexed to one of the endogenous HLA
receptors presented exclusively on the surface of that patient's
tumor cells.
[0145] The final product will contain 5% dimethyl sulfoxide (DMSO),
human serum albumin, and Plasma-Lyte. The final cell product will
contain the list of components provided in Table 1.
TABLE-US-00001 TABLE 1 Composition of the TET2 Product Component
Specification/Grade Total nucleated NeoTCR cells cGMP manufactured
Plasma-Lyte A USP Human Serum Albumin in 0.02-0.08M USP sodium
caprylate and sodium tryptophanate CryoStor CS10 cGMP manufactured
with USP grade materials
Compositions and Vectors
[0146] The presently disclosed subject matter provides compositions
comprising cells (e.g., immunoresponsive cells) disclosed
herein.
[0147] In certain embodiments, the presently disclosed subject
matter provides nucleic acid compositions comprising a
polynucleotide encoding the NeoTCR disclosed herein. In certain
embodiments, the nucleic acid compositions disclosed herein
comprise a polynucleotide encoding a nuclease for the gene
disruption of a TET2 locus. In certain embodiments, the nucleic
acid compositions disclosed herein comprise a Cas nuclease and a
gRNA for the gene disruption of a TET2 locus. In certain
embodiments, the gRNA has a sequence comprising the nucleotide
sequence set forth in SEQ ID NOs: 1-5. Also provided are cells
comprising such nucleic acid compositions.
[0148] In certain embodiments, the nucleic acid composition further
comprises a promoter that is operably linked to the nuclease for
the gene disruption of a TET2 locus.
[0149] In certain embodiments, the promoter is endogenous or
exogenous. In certain embodiments, the exogenous promoter is
selected from the group consisting of an elongation factor (EF)-1
promoter, a CMV promoter, a SV40 promoter, a PGK promoter, a long
terminal repeat (LTR) promoter and a metallothionein promoter. In
certain embodiments, the promoter is an inducible promoter. In
certain embodiments, the inducible promoter is selected from the
group consisting of a NFAT transcriptional response element (TRE)
promoter, a CD69 promoter, a CD25 promoter, an IL-2 promoter, an
IL-12 promoter, a p40 promoter, and a Bcl-xL promoter.
[0150] The compositions and nucleic acid compositions can be
administered to subjects or and/delivered into cells by art-known
methods or as described herein. Genetic modification of a cell
(e.g., a T cell) can be accomplished by transducing a substantially
homogeneous cell composition with a recombinant DNA construct. In
certain embodiments, a retroviral vector (either a gamma-retroviral
vector or a lentiviral vector) is employed for the introduction of
the DNA construct into the cell. For example, a polynucleotide
encoding a nuclease for the gene disruption of a TET2 locus can be
cloned into a viral vector and expression can be driven from its
endogenous promoter, or from a promoter specific for a target cell
type of interest. Non-viral vectors may be used as well.
[0151] Possible methods of transduction also include direct
co-culture of the cells with producer cells, e.g., by the method of
Bregni, et al. (1992) Blood 80:1418-1422, or culturing with viral
supernatant alone or concentrated vector stocks with or without
appropriate growth factors and polycations, e.g., by the method of
Xu, et al. (1994) Exp. Hemat. 22:223-230; and Hughes, et al. (1992)
J. Clin. Invest. 89:1817.
[0152] Other transducing viral vectors can be used to modify a
cell. In certain embodiments, the chosen vector exhibits high
efficiency of infection and stable integration and expression (see,
e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et
al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal
of Virology 71:6641-6649, 1997; Naldini et al., Science
272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci.
U.S.A. 94:10319, 1997). Other viral vectors that can be used
include, for example, adenoviral, lentiviral, and adena-associated
viral vectors, vaccinia virus, a bovine papilloma virus, or a
herpes virus, such as Epstein-Barr Virus (also see, for example,
the vectors of Miller, Human Gene Therapy 15-14, 1990; Friedman,
Science 244:1275-1281, 1989; Eglitis et al., BioTechniques
6:608-614, 1988; Tolstoshev et al., Current Opinion in
Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991;
Cornetta et al., Nucleic Acid Research and Molecular Biology
36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood
Cells 17:407-416, 1991; Miller et al., Biotechnology 7:980-990,
1989; LeGal La Salle et al., Science 259:988-990, 1993; and
Johnson, Chest 107:77S-83S, 1995). Retroviral vectors are
particularly well developed and have been used in clinical settings
(Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al.,
U.S. Pat. No. 5,399,346).
[0153] Non-viral approaches can also be employed for genetic
modification of a cell. For example, a nucleic acid molecule can be
introduced into a cell by administering the nucleic acid in the
presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci.
U.S.A. 84:7413, 1987; Ono et al., Neuroscience Letters 17:259,
1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et
al., Methods in Enzymology 101:512, 1983),
asialoorosomucoid-polylysine conjugation (Wu et al., Journal of
Biological Chemistry 263:14621, 1988; Wu et al., Journal of
Biological Chemistry 264:16985, 1989), or by micro-injection under
surgical conditions (Wolff et al., Science 247:1465, 1990). Other
non-viral means for gene transfer include transfection in vitro
using calcium phosphate, DEAE dextran, electroporation, and
protoplast fusion. Liposomes can also be potentially beneficial for
delivery of DNA into a cell. Transplantation of normal genes into
the affected tissues of a subject can also be accomplished by
transferring a normal nucleic acid into a cultivatable cell type ex
vivo (e.g., an autologous or heterologous primary cell or progeny
thereof), after which the cell (or its descendants) are injected
into a targeted tissue or are injected systemically.
[0154] Polynucleotide therapy methods can be directed from any
suitable promoter (e.g., the human cytomegalovirus (CMV), simian
virus 40 (SV40), or metallothionein promoters), and regulated by
any appropriate mammalian regulatory element or intron (e.g. the
elongation factor 1a enhancer/promoter/intron structure). For
example, if desired, enhancers known to preferentially direct gene
expression in specific cell types can be used to direct the
expression of a nucleic acid. The enhancers used can include,
without limitation, those that are characterized as tissue- or
cell-specific enhancers. Alternatively, if a genomic clone is used
as a therapeutic construct, regulation can be mediated by the
cognate regulatory sequences or, if desired, by regulatory
sequences derived from a heterologous source, including any of the
promoters or regulatory elements described above.
[0155] The resulting cells can be grown under conditions similar to
those for unmodified cells, whereby the modified cells can be
expanded and used for a variety of purposes.
Kits
[0156] The presently disclosed subject matter provides kits for
inducing and/or enhancing an immune response and/or treating and/or
preventing a cancer or a pathogen infection in a subject. In
certain embodiments, the kit comprises an effective amount of
presently disclosed cells or a pharmaceutical composition
comprising thereof. In certain embodiments, the kit comprises a
sterile container; such containers can be boxes, ampules, bottles,
vials, tubes, bags, pouches, blister-packs, or other suitable
container forms known in the art. Such containers can be made of
plastic, glass, laminated paper, metal foil, or other materials
suitable for holding medicaments.
[0157] If desired, the cells and/or nucleic acid molecules are
provided together with instructions for administering the cells or
nucleic acid molecules to a subject having or at risk of developing
a cancer or pathogen or immune disorder. The instructions generally
include information about the use of the composition for the
treatment and/or prevention of a neoplasm or a pathogen infection.
In certain embodiments, the instructions include at least one of
the following: description of the therapeutic agent; dosage
schedule and administration for treatment or prevention of a
cancer, pathogen infection, or immune disorder or symptoms thereof;
precautions; warnings; indications; counter-indications;
over-dosage information; adverse reactions; animal pharmacology;
clinical studies; and/or references. The instructions may be
printed directly on the container (when present), or as a label
applied to the container, or as a separate sheet, pamphlet, card,
or folder supplied in or with the container. The resulting cells
can be grown under conditions similar to those for unmodified
cells, whereby the modified cells can be expanded and used for a
variety of purposes.
EXEMPLARY EMBODIMENTS
[0158] A. In certain non-limiting embodiments, the presently
disclosed subject matter provides for a cell, comprising an
exogenous T cell receptor (TCR), and a gene disruption of a TET2
locus.
[0159] A1. The foregoing cell of A, wherein the gene disruption
comprises a substitution, a deletion, an insertion, or any
combination thereof.
[0160] A2. The foregoing cell of A or A1, wherein the gene
disruption comprises a missense mutation, a nonsense mutation, a
non-frameshift deletion, a frameshift deletion, a non-frameshift
insertion, a frameshift insertion, or any combination thereof.
[0161] A3. The foregoing cell of A-A2, wherein the gene disruption
of the TET2 locus results in a non-functional TET2 protein.
[0162] A4. The foregoing cell of A-A3, wherein the gene disruption
of the TET2 locus results in knockout of the TET2 gene
expression.
[0163] A5. The foregoing cell of A-A4, comprising a gRNA and a Cas9
nuclease.
[0164] A6. The foregoing cell of A5, wherein the gRNA comprises a
nucleotide sequence set forth in SEQ ID NO.1, SEQ ID NO.2, SEQ ID
NO.3, SEQ ID NO.4, or SEQ ID NO.5.
[0165] A7. The foregoing cell of A-A6, wherein the gene disruption
of the TET2 locus enhances cell persistence.
[0166] A8. The foregoing cell of A-A7, wherein the gene disruption
of the TET2 locus enhances memory cell differentiation.
[0167] A9. The foregoing cell of A-A8, wherein the cell is a
primary cell.
[0168] A10. The foregoing cell of A-A9, wherein the cell is a
patient-derived cell.
[0169] A11. The foregoing cell of A-A10, wherein the cell is a
lymphocyte.
[0170] A12. The foregoing cell of A-A11, wherein the cell is a T
cell.
[0171] A13. The foregoing cell of A12, wherein the cell is CD45RA+,
CD62L+, CD28+, CD95-, CCR7+, and CD27+.
[0172] A14. The foregoing cell of A12, wherein the cell is CD45RA+,
CD62L+, CD28+, CD95+, CD27+, CCR7+.
[0173] A15. The foregoing cell of A12, wherein the cell is CD45RO+,
CD62L+, CD28+, CD95+, CCR7+, CD27+, CD127+.
[0174] A16. The foregoing cell of A-A15, wherein the exogenous TCR
is a patient-derived TCR.
[0175] A17. The foregoing cell of A-A16, wherein the exogenous TCR
comprises a signal sequence, a first and second 2A sequence, and a
TCR polypeptide sequence.
[0176] A18. The foregoing cell of A-A17, wherein the exogenous TCR
recognizes a cancer antigen.
[0177] A19. The foregoing cell of A18, wherein the cancer antigen
is a neoantigen.
[0178] A20. The foregoing cell of A18, wherein the cancer antigen
is a patient specific antigen.
[0179] B. In certain non-limiting embodiments, the presently
disclosed subject matter provides for a cell modified by a process,
the process comprising introducing into a cell a homologous
recombination (HR) template nucleic acid sequence; recombining the
HR template nucleic acid into an endogenous locus of the cell; and
disrupting a TET2 locus of the cell.
[0180] B1. The foregoing cell of B, wherein the HR template
comprises first and second homology arms homologous to first and
second target nucleic acid sequences; and a TCR gene sequence
positioned between the first and second homology arms.
[0181] B2. The foregoing cell of B or B1, wherein the HR template
comprises a first 2A-coding sequence positioned upstream of the TCR
gene sequence and a second 2A-coding sequence positioned downstream
of the TCR gene sequence, wherein the first and second 2A-coding
sequences code for the same amino acid sequence that are
codon-diverged relative to each other.
[0182] B3. The foregoing cell of B2, wherein the 2A-coding sequence
is a P2A-coding sequence.
[0183] B4. The foregoing cell of B2 or B3, wherein a sequence
coding for the amino acid sequence Gly Ser Gly is positioned
immediately upstream of the 2A-coding sequences.
[0184] B5. The foregoing cell of B-B4, wherein the HR template
comprises a sequence coding for a Furin cleavage site positioned
upstream of the second 2A-coding sequence.
[0185] B6. The foregoing cell of B1-B5, wherein the first and
second homology arms are each from about 300 bases to about 2,000
bases in length.
[0186] B7. The foregoing cell of B1-B5, wherein the first and
second homology arms are each from about 600 bases to about 2,000
bases in length.
[0187] B8. The foregoing cell of B2-B7, wherein the HR template
further comprises a signal sequence positioned between the first
2A-coding sequence and the TCR gene sequence.
[0188] B9. The foregoing cell of B2-B8, wherein the HR template
comprises a second TCR sequence positioned between the second
2A-coding sequence and the second homology arm.
[0189] B10. The foregoing cell of B9, wherein the HR template
comprises a first signal sequence positioned between the first
2A-coding sequence and the first TCR gene sequence; and a second
signal sequence positioned between the second 2A-coding sequence
and the second TCR gene sequence; wherein the first and the second
signal sequences encode for the same amino acid sequence and are
codon diverged relative to each other.
[0190] B11. The foregoing cell of B8 or B10, wherein the signal
sequence is a human growth hormone signal sequence.
[0191] B12. The foregoing cell of B-B11, wherein the HR template is
non-viral.
[0192] B13. The foregoing cell of B-B12, wherein the HR template is
a circular DNA.
[0193] B14. The foregoing cell of B-B12, wherein the HR template is
a linear DNA.
[0194] B15. The foregoing cell of B-B14, wherein the introducing
occurs via electroporation.
[0195] B16. The foregoing cell of B-B15, wherein the recombining
comprises cleavage of the endogenous locus by a nuclease; and
recombination of the HR template nucleic acid sequence into the
endogenous locus by homology directed repair.
[0196] B17. The foregoing cell of B16, wherein the nuclease is a
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
family nuclease, or derivative thereof.
[0197] B18. The foregoing cell of B17, further comprising a
gRNA.
[0198] B19. The foregoing cell of B-B18, wherein the disrupting
comprises introducing a substitution, a deletion, an insertion, or
any combination thereof.
[0199] B20. The foregoing cell of B-B19, wherein the disrupting
comprises introducing a missense mutation, a nonsense mutation, a
non-frameshift deletion, a frameshift deletion, a non-frameshift
insertion, a frameshift insertion, or any combination thereof.
[0200] B21. The foregoing cell of B-B20, wherein the disrupting
results in a non-functional TET2 protein.
[0201] B22. The foregoing cell of B-B21, wherein the disrupting
results in knockout of the TET2 gene expression.
[0202] B23. The foregoing cell of B-B22, wherein the disrupting
comprises cleavage of the TET2 locus by a nuclease.
[0203] B24. The foregoing cell of B23, wherein the nuclease is a
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
family nuclease, or derivative thereof.
[0204] B25. The foregoing cell of B24, further comprising a
gRNA.
[0205] B26. The foregoing cell of B25, wherein the gRNA comprises a
sequence set forth in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID
NO.4, or SEQ ID NO.5.
[0206] B27. The foregoing cell of B23-B26, wherein the nuclease is
expressed by a vector.
[0207] B28. The foregoing cell of B25-B27, wherein the gRNA is
expressed by a vector.
[0208] B29. The foregoing cell of B27 or B28, wherein the vector is
a viral vector.
[0209] B30. The foregoing cell of B27 or B28, wherein the vector is
a non-viral vector.
[0210] B31. The foregoing cell of B-B30, wherein the disrupting of
the TET2 locus enhances cell persistence.
[0211] B32. The foregoing cell of B-B31, wherein the disrupting of
the TET2 locus enhances memory cell differentiation.
[0212] B33. The foregoing cell of B-B32, wherein the cell is a
primary cell.
[0213] B34. The foregoing cell of B-B33, wherein the cell is a
patient-derived cell.
[0214] B35. The foregoing cell of B-B34, wherein the cell is a
lymphocyte.
[0215] B36. The foregoing cell of B-B35, wherein the cell is a T
cell.
[0216] B37. The foregoing cell of B36, wherein the T cell is a
patient-derived cell.
[0217] B38. The foregoing cell of B-B37, wherein the cell is a
young T cell.
[0218] B39. The foregoing cell of B38, wherein the cell is CD45RA+,
CD62L+, CD28+, CD95-, CCR7+, and CD27+.
[0219] B40. The foregoing cell of B38, wherein the cell is CD45RA+,
CD62L+, CD28+, CD95+, CD27+, CCR7+.
[0220] B41. The foregoing cell of B38, wherein the cell is CD45RO+,
CD62L+, CD28+, CD95+, CCR7+, CD27+, CD127+.
[0221] B42. The foregoing cell of B-B41, wherein the endogenous
locus is within an endogenous TCR gene.
[0222] B43. The foregoing cell of B1-B42, wherein the TCR gene
sequence encodes for a TCR that recognizes a tumor antigen.
[0223] B44. The foregoing cell of B43, wherein the tumor antigen is
a neoantigen.
[0224] B45. The foregoing cell of B43, wherein the tumor antigen is
a patient specific neoantigen.
[0225] B46. The foregoing cell of B1-B45, wherein the TCR gene
sequence is a patient specific TCR gene sequence.
[0226] B47. The foregoing cell of B-B46, wherein the process
further comprises culturing the cell.
[0227] B48. The foregoing cell of B47, wherein the culturing is
conducted in the presence of at least one cytokine.
[0228] B49. The foregoing cell of B47 or B48, wherein the culturing
is conducted in the presence of IL2, IL7, IL15, or any combination
thereof.
[0229] B50. The foregoing cell of B47 or B48, wherein the culturing
is conducted in the presence of IL7 and IL15.
[0230] C. In certain non-limiting embodiments, the presently
disclosed subject matter provides for a method of modifying a cell,
the method comprising: introducing into a cell a homologous
recombination (HR) template nucleic acid sequence; recombining the
HR template nucleic acid into an endogenous locus of the cell; and
disrupting a TET2 locus of the cell.
[0231] C1. The foregoing method of C, wherein the HR template
comprises: first and second homology arms homologous to first and
second target nucleic acid sequences; and a TCR gene sequence
positioned between the first and second homology arms.
[0232] C2. The foregoing method of C or C1, wherein the HR template
comprises a first 2A-coding sequence positioned upstream of the TCR
gene sequence and a second 2A-coding sequence positioned downstream
of the TCR gene sequence, wherein the first and second 2A-coding
sequences code for the same amino acid sequence that are
codon-diverged relative to each other.
[0233] C3. The foregoing method of C1 or C2, wherein the 2A-coding
sequence is a P2A-coding sequence.
[0234] C4. The foregoing method of C2 or C3, wherein a sequence
coding for the amino acid sequence Gly Ser Gly is positioned
immediately upstream of the 2A-coding sequences.
[0235] C5. The foregoing method of C2-C4, wherein the HR template
comprises a sequence coding for a Furin cleavage site positioned
upstream of the second 2A-coding sequence.
[0236] C6. The foregoing method of C1-05, wherein the first and
second homology arms are each from about 300 bases to about 2,000
bases in length.
[0237] C7. The foregoing method of C1-C6, wherein the first and
second homology arms are each from about 600 bases to about 2,000
bases in length.
[0238] C8. The foregoing method of C2-C7, wherein the HR template
further comprises a signal sequence positioned between the first
2A-coding sequence and the TCR gene sequence.
[0239] C9. The foregoing method of C2-C8, wherein the HR template
comprises a second TCR sequence positioned between the second
2A-coding sequence and the second homology arm.
[0240] C10. The foregoing method of C9, wherein the HR template
comprises: a first signal sequence positioned between the first
2A-coding sequence and the first TCR gene sequence; and a second
signal sequence positioned between the second 2A-coding sequence
and the second TCR gene sequence; wherein the first and the second
signal sequences encode for the same amino acid sequence and are
codon diverged relative to each other.
[0241] C11. The foregoing method of C8 or C10, wherein the signal
sequence is a human growth hormone signal sequence.
[0242] C12. The foregoing method of C1-C11, wherein the HR template
is non-viral.
[0243] C13. The foregoing method of C-C12, wherein the HR template
is a circular DNA.
[0244] C14. The foregoing method of C-C13, wherein the HR template
is a linear DNA.
[0245] C15. The foregoing method of C-C14, wherein the introducing
occurs via electroporation.
[0246] C16. The foregoing method of C-C15, wherein the recombining
comprises cleavage of the endogenous locus by a nuclease; and
recombination of the HR template nucleic acid sequence into the
endogenous locus by homology directed repair.
[0247] C17. The foregoing method of C16, wherein the nuclease is a
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
family nuclease, or derivative thereof.
[0248] C18. The foregoing method of C17, further comprising a
gRNA.
[0249] C19. The foregoing method of C-C18, wherein the disrupting
comprises introducing a substitution, a deletion, an insertion, or
any combination thereof.
[0250] C20. The foregoing method of C-C19, wherein the disrupting
comprises introducing a missense mutation, a nonsense mutation, a
non-frameshift deletion, a frameshift deletion, a non-frameshift
insertion, a frameshift insertion, or any combination thereof.
[0251] C21. The foregoing method of C-C20, wherein the disrupting
results in a non-functional TET2 protein.
[0252] C22. The foregoing method of C-C21, wherein the disrupting
results in knockout of the TET2 gene expression.
[0253] C23. The foregoing method of C-C22, wherein the disrupting
comprises cleavage of the TET2 locus by a nuclease.
[0254] C24. The foregoing method of C23, wherein the nuclease is a
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
family nuclease, or derivative thereof.
[0255] C25. The foregoing method of C24, further comprising a
gRNA.
[0256] C26. The foregoing method of C25, wherein the gRNA comprises
a sequence set forth in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ
ID NO.4, or SEQ ID NO.5.
[0257] C27. The foregoing method of C23-C26, wherein the nuclease
is expressed by a vector.
[0258] C28. The foregoing method of C25-C27, wherein the gRNA is
expressed by a vector.
[0259] C29. The foregoing method of C27 or C28, wherein the vector
is a viral vector.
[0260] C30. The foregoing method of C27-C29, wherein the vector is
a non-viral vector.
[0261] C31. The foregoing method of C-C30, wherein the disrupting
of the TET2 locus enhances cell persistence.
[0262] C32. The foregoing method of C-C31, wherein the disrupting
of the TET2 locus enhances memory cell differentiation.
[0263] C33. The foregoing method of C-C32, wherein the cell is a
primary cell.
[0264] C34. The foregoing method of C-C32, wherein the cell is a
patient-derived cell.
[0265] C35. The foregoing method of C-C32, wherein the cell is a
lymphocyte.
[0266] C36. The foregoing method of C-C32, wherein the cell is a T
cell.
[0267] C37. The foregoing method of C36, wherein the T cell is a
patient-derived cell.
[0268] C38. The foregoing method of C-C32, wherein the cell is a
young T cell.
[0269] C39. The foregoing method of C38, wherein the cell is
CD45RA+, CD62L+, CD28+, CD95-, CCR7+, and CD27+.
[0270] C40. The foregoing method of C38, wherein the cell is
CD45RA+, CD62L+, CD28+, CD95+, CD27+, CCR7+.
[0271] C41. The foregoing method of C38, wherein the cell is
CD45RO+, CD62L+, CD28+, CD95+, CCR7+, CD27+, CD127+.
[0272] C42. The foregoing method of C-C41, wherein the endogenous
locus is within an endogenous TCR gene.
[0273] C43. The foregoing method of C1-C42, wherein the TCR gene
sequence encodes for a TCR that recognizes a tumor antigen.
[0274] C44. The foregoing method of C43, wherein the tumor antigen
is a neoantigen.
[0275] C45. The foregoing method of C43, wherein the tumor antigen
is a patient specific neoantigen.
[0276] C46. The foregoing method of C1-C45, wherein the TCR gene
sequence is a patient specific TCR gene sequence.
[0277] C47. The foregoing method of C-C46, wherein the method
further comprises culturing the cell.
[0278] C48. The foregoing method of C47, wherein the culturing is
conducted in the presence of at least one cytokine.
[0279] C49. The foregoing method of C47 or C48, wherein the
culturing is conducted in the presence of IL2, IL7, IL15, or any
combination thereof.
[0280] C50. The foregoing method of C47 or C48, wherein the
culturing is conducted in the presence of IL7 and IL15.
[0281] D. In certain non-limiting embodiments, the presently
disclosed subject matter provides for a method of treating cancer
in a subject in need thereof, the method comprising administering a
therapeutically effective amount of a cell of any one of A-A20 or
B-B50.
[0282] D1. The foregoing method of D, wherein prior to
administering the therapeutically effective amount of cells, a
non-myeloablative lymphodepletion regimen is administered to the
subject.
[0283] D2. The foregoing method of D or D1, wherein the cancer is a
solid tumor.
[0284] D3. The foregoing method of D or D1, wherein the cancer is a
liquid tumor.
[0285] D4. The foregoing method of D2, wherein the solid tumor is
selected from the group consisting of melanoma, thoracic cancer,
lung cancer, ovarian cancer, breast cancer, pancreatic cancer, head
and neck cancer, prostate cancer, gynecological cancer, central
nervous system cancer, cutaneous cancer, HPV+ cancer, esophageal
cancer, thyroid cancer, gastric cancer, hepatocellular cancer,
cholangiocarcinomas, renal cell cancers, testicular cancer,
sarcomas, and colorectal cancer.
[0286] D5. The foregoing method of D3, wherein the liquid tumor is
selected from the group consisting of follicular lymphoma,
leukemia, and multiple myeloma.
[0287] E. In certain non-limiting embodiments, the presently
disclosed subject matter provides for a composition comprising an
effective amount of a cell of any one of A-A20 or B-B50.
[0288] E1. The foregoing composition of E, wherein the composition
is a pharmaceutical composition that further comprises a
pharmaceutically acceptable excipient.
[0289] E2. The foregoing composition of E or E1, wherein the
composition is administered to a patient in need thereof for the
treatment of cancer.
[0290] E3. The foregoing composition of E-E2, wherein the
composition comprises a cryopreservation agent.
[0291] E4. The foregoing composition of E-E3, wherein the
composition comprises serum albumin.
[0292] E5. The foregoing composition of E-E4, wherein the
composition comprises Plasma-Lyte A, HSA, and CryoStor CS10.
[0293] F. In certain non-limiting embodiments, the presently
disclosed subject matter provides for a kit comprising the cell of
any one of A-A20 or B-B50, reagents for performing the method of
any one of C-C50, or a composition of any one of E-E5.
[0294] F1. The foregoing kit of F, wherein the kit further
comprises written instructions for treating a cancer.
EXAMPLES
[0295] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way. Efforts have been made to ensure
accuracy with respect to numbers used (e.g., amounts, temperatures,
etc.), but some experimental error and deviation should, of course,
be allowed for.
[0296] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of protein chemistry,
biochemistry, recombinant DNA techniques and pharmacology, within
the skill of the art. Such techniques are explained fully in the
literature. See, e.g., T. E. Creighton, Proteins: Structures and
Molecular Properties (W.H. Freeman and Company, 1993); A. L.
Lehninger, Biochemistry (Worth Publishers, Inc., current addition);
Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd
Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan
eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences,
18th Edition (Easton, Pa.: Mack Publishing Company, 1990); Carey
and Sundberg Advanced Organic Chemistry 3rd Ed. (Plenum Press) Vols
A and B(1992).
[0297] Provided herein are examples of engineering T cells to
express a NeoTCR and knockout the expression of TET2 to create a
personalized adoptive T cell therapy (i.e., a TET2 Product) which
is composed of apheresis-derived, patient-autologous, CD8 and CD4 T
cells that have been precision genome engineered to express an
autologous T cell receptor targeting a neoepitope presented
exclusively on the surface of the patient's tumor cells (neoTCR),
wherein the TET2 Product comprises T cells with a young
phenotype.
Example 1. Target Integration of the NeoTCR
[0298] Neoepitope-specific TCRs identified by the imPACT Isolation
Technology described in PCT/US2020/17887 (which is herein
incorporated by reference in its entirety) were used to generate
homologous recombination (HR) DNA templates. These HR templates
were transfected into primary human T cells in tandem with
site-specific nucleases (see FIGS. 2A-2C, and FIG. 3). The
single-step non-viral precision genome engineering resulted in the
seamless replacement of the endogenous TCR with the patient's
neoepitope-specific TCR, expressed by the endogenous promoter. The
TCR expressed on the surface is entirely native in sequence.
[0299] The precision of neoTCR-T cell genome engineering was
evaluated by Targeted Locus Amplification (TLA) for off-target
integration hot spots or translocations, and by next generation
sequencing based off-target cleavage assays and found to lack
evidence of unintended outcomes.
[0300] As shown in FIGS. 2A-2C, constructs containing genes of
interest were inserted into endogenous loci. This was accomplished
with the use of homologous repair templates containing the coding
sequence of the gene of interest flanked by left and right HR arms.
In addition to the HR arms, the gene of interest was sandwiched
between 2A peptides, a protease cleavage site that is upstream of
the 2A peptide to remove the 2A peptide from the upstream
translated gene of interest, and signal sequences (FIG. 2B). Once
integrated into the genome, the gene of interested expression gene
cassette was transcribed as single messenger RNA. During the
translation of this gene of interest in messenger RNA, the flanking
regions were unlinked from the gene of interest by the
self-cleaving 2A peptide and the protease cleavage site was cleaved
for the removal of the 2A peptide upstream from the translated gene
of interest (FIG. 2C). In addition to the 2A peptide and protease
cleavage site, a gly-ser-gly (GSG) linker was inserted before each
2A peptide to further enhance the separation of the gene of
interest from the other elements in the expression cassette.
[0301] It was determined that P2A peptides were superior to other
2A peptides for NeoTCR and TET2 Products because of its efficient
cleavage. Accordingly, two (2) P2A peptides and codon divergence
were used to express the gene of interest without introducing any
exogenous epitopes from remaining amino acids on either end of the
gene of interest from the P2A peptide. The benefit of the gene
edited cell having no exogenous epitopes (i.e., no flanking P2A
peptide amino acids on either side of the gene of interest) is that
immunogenicity is drastically decreased and there is less
likelihood of a patient infused with a NeoTCR and TET2 Products
containing the gene edited cell to have an immune reaction against
the gene edited cell.
[0302] As described in PCT/US/2018/058230, NeoTCRs were integrated
into the TCR.alpha. locus of T cells. Specifically, a homologous
repair template containing a NeoTCR coding sequence flanked by left
and right HR Arms was used. In addition, the endogenous TCR.beta.
locus was disrupted leading to the expression of only TCR sequences
encoded by the NeoTCR construct. The general strategy was applied
using circular HR templates as well as with linear templates.
[0303] The neoantigen-specific TCR construct design is diagrammed
in FIGS. 3A and 3B. The target TCR.alpha. locus (Ca) is shown along
with the plasmid HR template, and the resulting edited sequence and
downstream mRNA/protein products are shown. The target TCR.alpha.
locus (endogenous TRAC) and its CRISPR Cas9 target site (horizontal
stripe, cleavage site designated by arrow) are shown (FIG. 3A). The
circular plasmid HR template with the polynucleotide encoding the
NeoTCR, which is located between left and right homology arms
("LHA" and "RHA" respectively), is shown (FIG. 3A). The region of
the TRAC introduced by the HR template that was codon optimized is
shown (vertical stripe). The TCR.beta. constant domain was derived
from TRBC2, which is indicated as being functionally equivalent to
TRBC1. Other elements in the NeoTCR cassette include: 2A=2A
ribosome skipping element (by way of non-limiting example, the 2A
peptides used in the cassette are both P2A sequences that are used
in combination with codon divergence to eliminate any otherwise
occurring non-endogenous epitopes in the translated product);
P=protease cleavage site upstream of 2A that removes the 2A tag
from the upstream TCR.beta. protein (by way of non-limiting example
the protease cleavage site can be a furin protease cleavage site);
SS=signal sequences (by way of non-limited example the protease
cleavage site can be a human growth hormone signal sequence). The
HR template of the NeoTCR expression gene cassette includes two
flanking homology arms to direct insertion into the TCR.alpha.
genomic locus targeted by the CRISPR Cas9 nuclease RNP with the
TCR.alpha. guide RNA. These homology arms (LHA and RHA) flank the
neoE-specific TCR sequences of the NeoTCR expression gene cassette.
While the protease cleavage site used in this example was a furin
protease cleavage site, any appropriate protease cleavage site
known to one of skill in the art could be used. Similarly, while
HGH was the signal sequence chosen for this example, any signal
sequence known to one of skill in the art could be selected based
on the desired trafficking and used.
[0304] Once integrated into the genome (FIG. 2C), the NeoTCR
expression gene cassette is transcribed as a single messenger RNA
from the endogenous TCR.alpha. promoter, which still includes a
portion of the endogenous TCR.alpha. polypeptide from that
individual T cell (FIG. 2C). During ribosomal polypeptide
translation of this single NeoTCR messenger RNA, the NeoTCR
sequences are unlinked from the endogenous, CRISPR-disrupted
TCR.alpha. polypeptide by self-cleavage at a P2A peptide (FIG. 2C).
The encoded NeoTCR.alpha. and NeoTCR.beta. polypeptides are also
unlinked from each other through cleavage by the endogenous
cellular human furin protease and a second self-cleaving P2A
sequence motifs included in the NeoTCR expression gene cassette
(FIG. 2C). The NeoTCR.alpha. and NeoTCR.beta. polypeptides are
separately targeted by signal leader sequences (derived from the
human growth hormone, HGH) to the endoplasmic reticulum for
multimer assembly and trafficking of the NeoTCR protein complexes
to the T cell surface. The inclusion of the furin protease cleavage
site facilitates the removal of the 2A sequence from the upstream
TCR.beta. chain to reduce potential interference with TCR.beta.
function. Inclusion of a gly-ser-gly linker before each 2A (not
shown) further enhances the separation of the three
polypeptides.
[0305] Additionally, three repeated protein sequences are codon
diverged within the HR template to promote genomic stability. The
two P2A are codon diverged relative to each other, as well as the
two HGH signal sequences relative to each other, within the TCR
gene cassette to promote stability of the introduced NeoTCR
cassette sequences within the genome of the ex vivo engineered T
cells. Similarly, the re-introduced 5' end of TRAC exon 1 (vertical
stripe) reduces the likelihood of the entire cassette being lost
over time through the removal of intervening sequence of two direct
repeats.
[0306] In addition to NeoTCR Products, this method can be used for
any TET2 Product.
[0307] FIG. 3 shows the results of an In-Out PCR confirming precise
target integration of the NeoE TCR cassette. Agarose gels show the
results of a PCR using primers specific to the integration cassette
and site generate products of the expected size only for cells
treated with both nuclease and DNA template (KOKI and KOKIKO),
demonstrating site-specific and precise integration.
[0308] Furthermore, Targeted Locus Amplification (TLA) was used to
confirm the specificity of targeted integration. Crosslinking,
ligation, and use of primers specific to the NeoTCR insert were
used to obtain sequences around the site(s) of integration. The
reads mapped to the genome are binned in 10 kb intervals.
Significant read depths were obtained only around the intended site
the integration site on chromosome 14, showing no evidence of
common off-target insertion sites.
[0309] Antibody staining for endogenous TCR and peptide-HLA
staining for neoTCR reveals that the engineering results in high
frequency knock-in of the NeoTCR, with some TCR-cells and few WT T
cells remaining (FIG. 4A). Knock-in is evidenced by neoTCR
expression in the absence of an exogenous promoter. Engineering was
carried out multiple times using the same neoTCR with similar
results (FIG. 4B). Therefore, efficient and consistent expression
of the NeoTCR and knockout of the endogenous TCR in engineered T
cells was achieved.
Example 2. Generation of TET2 Knockout NeoTCR-P1 T Cells
[0310] Materials and Methods. T cells were transfected with gRNAs
targeting the first exon of TET2 as Cas9 RNPs along with the TRA
and TRB gRNA-Cas9 RNPs as described in Example 1 and in
PCT/US2020/17887 (which is herein incorporated by reference in its
entirety), resulting in disruption of the endogenous TET2 coding
sequence and reduced TET2 protein expression (i.e., a TET2
Product).
[0311] T cell Isolation and Editing. TET2 Products were made by
first isolating CD4 and CD8 T cells from leukopaks of donors and
then transfecting the cells with the TCR.alpha. and TCR.beta. gRNAs
(using the NeoTCR integration methods disclosed in Example 1) along
with a TET2 gRNA to knockout the TET2 gene. While any gRNA that
specifically binds to TET2, disrupts the TET2 gene, and knocks out
the TET2 gene expression can be used, the exemplary gRNAs provided
in Table 2 were used herein. sgRNA 1 and 5 are negative strand
sgRNAs and sgRNAs 2-4 are positive strand sgRNAs.
TABLE-US-00002 TABLE 2 Exemplary Primers for Regions Flanking the
gRNA sgRNA 1 CCTCCCATTTGCCAGACAGAACC SEQ ID FIG. 5A NO: 1 sgRNA 2
TTAAGGGAAGTGAAAATAGAGGG SEQ ID FIG. 5B NO: 2 sgRNA 3
GGAATGACATACAGACTGCAGGG SEQ ID FIG. 5C NO: 3 sgRNA 4
GATAGAACCAACCATGTTGAGGG SEQ ID FIG. 5D NO: 4 sgRNA 5
CCAACCATGTTGAGGGCAACAGA SEQ ID FIG. 5E NO: 5
[0312] gRNA Selection and Reactions. TET2 gRNA-Cas9 RNP edited CD4
and CD8 T cells described above (i.e., TET2 Products) were lysed
and DNA was extracted. Regions flanking the gRNA target sites were
amplified via PCR using the exemplary primers provided in Table 3.
Alternatively, redesigned primers with more specificity or
alternate primers designed to accomplish the amplification could
also be used. PCR amplicons were then incubated with T7
endonuclease I (NEB) and resulting products were run on agarose
gels (FIGS. 6A and 6B).
TABLE-US-00003 TABLE 3 Exemplary Primers for Regions Flanking the
gRNA TET2_1 Fwd GATCAGGAGGAGGCACAGTG SEQ ID NO: 6 TET2_1 Rev
AGGAGCCCAGAGAGAGAAGG SEQ ID NO: 7 TET2_2 Fwd GTTTCTGCCTCTTCCGTGGA
SEQ ID NO: 8 TET2_2 Rev TGTTGGGGGCACAAGATCTC SEQ ID NO: 9
[0313] The TET2_1 Fwd primer (SEQ ID NO:6) was used for analyzing
sgRNA indels for sgRNA 1 (SEQ ID NO:1), 4 (SEQ ID NO:4), and 5 (SEQ
ID NO:5). The expected product size for this reaction is 849
bp.
[0314] The TET2_1 Rev primer (SEQ ID NO:7) was used for analyzing
sgRNA indels for sgRNA 1 (SEQ ID NO:1), 4 (SEQ ID NO:4), and 5 (SEQ
ID NO:5). The expected product size for this reaction is 849
bp.
[0315] The TET2_2 Fwd primer (SEQ ID NO: 8) was used for analyzing
sgRNA indels for sgRNA 2 (SEQ ID NO:2) and 3 (SEQ ID NO:3). The
expected product size for this reaction is 1032 bp.
[0316] The TET2_2 Rev primer (SEQ ID NO:9) was used for analyzing
sgRNA indels for sgRNA (SEQ ID NO:2) and 3 (SEQ ID NO:3). The
expected product size for this reaction is 1032 bp.
[0317] The optimal gRNA was determined by assessing the TET2 knock
out (KO) via a T7 endonuclease I (T7EI) assay to detect
non-perfectly annealed PCR products. Further characterization of
loss of gene expression was determined by qPCR quantification of
TET2 mRNA and Western blot for TET2 protein in neoTCR T cells
nucleofected with TET2 gRNA. T cells untreated with TET2 gRNA were
used as a negative control for TET2 gene and protein expression.
The T7EI assay quantified the gRNA targeting efficiency by
measuring the fraction of the PCR product that was cleaved by the
T7EI enzyme. TET2 mRNA transcript abundance was determined by qPCR.
TET2 protein abundance was determined via Western blot using an
anti-TET2 antibody. Successful knock out of the TET2 gene resulted
in reduced mRNA and protein levels in the TET2 Products compared to
that of the NeoTCR Products.
[0318] crispr-dav
(https://github.com/pinetreel/crispr-dav/blob/master/Install-and-Run.md#d-
escription-of-files-created-by-prepare runpl-script) analysis was
performed to identify the most efficient gRNA for generating
outframe indels. Coverage of the PCR amplicons was robust for all
amplicons surrounding the guide site. See, FIGS. 7A-7E.
[0319] Five distinct guide RNAs were designed to target the first
coding exon of TET2 and robustly edit and lead to >70% out of
frame indels as assessed by the T7E1 cutting efficiency assay as
well as PCR amplicon DNA transposon-based sequencing (FIGS. 8A and
8B).
[0320] To confirm loss of TET2 activity, intracellular staining of
5-hmC using a polyclonal anti-5hmC antibody (Active Motif; 1 ug/mL;
Cat No 39791) was performed. Specifically, the 5-hmC Flow Cytometry
experiment was performed as follows: 1) 200K T cells from WT and
each gRNA nucleofected sample were stimulated for 1.5h on a plate
coated PACT035 comPACT, 2) samples were then harvest and stained
for Live/Dead and then fixed with BD ICS Fix/Perm followed by 2
washes and resuspension in Staining Buffer, 3) the cells were
permeabilized for 15 min in Perm Buffer, 4) the cells were treated
with DNaseI (300 ug/mL) in Perm Buffer for 3 hr at 37 C (wanted to
treat for 1 hr), 5) the cells were washed 2.times. with Perm
Buffer, 6) the cells were stained with anti-5-hmC (1 ug/mL) in Perm
Buffer for 30 min at 4 C, 7) the cells were washed 2.times. with
Perm Buffer, 8) the cells were stained with anti-Rabbit IgG-AF647
(5 uL/50 uL) for 30 min at 4 C, 9) the cells were 2.times. with
Perm Buffer, and 10) the cells were resuspend in 200 uL for
processing with a flow cytometer.
[0321] The 5-hmC staining showed that there were no appreciable
differences in 5-hmC state of resting TET2 Products v. stimulated
TET2 Products. No appreciable reduction in 5-hmC was observed in
the absence of TET2 with or without 1.5h stimulation with cognate
comPACT plate coating. See FIG. 9.
[0322] To further characterize the effects of TET2 disruption,
ATAC-seq (as described in Buenrostro et al., 2013, N. Methods,
10(12) 1213-1218) was performed on the TET2 Products to determine
the genome-wide chromatin state of the cells.
[0323] TCF7 and TBET staining of the resting TET2 Products was also
performed (FIG. 10). It was shown that knocking out TET2 had no
effect on the expression of the TCF7 and TBET transcription
factors.
[0324] The ability of TET2 Products to produce IFN.gamma. was
tested (FIG. 11A). It was determined that knocking out TET2 reduced
the frequency of IFN.gamma. producing T cells compared to NeoTCR
Products.
[0325] TET2 Products were tested to determine if the number of
CD107a+ cells would be affected by the knockout (FIG. 11B). It was
determined that knocking out TET2 reduced the frequency of CD107a+
T cells compared to NeoTCR Products.
[0326] Multiple rounds of IncuCyte experiments were performed using
TET2 Products (the "PACT-035-TCR089" cells) and NeoTCR Products
(the "PACT035-TCR089 TET2 gRNA3" cells) (FIGS. 12A and 12B). In
these experiments, 14 day post gene editing cells and >30 day
post gene editing cells from the TET2 Products and NeoTCR Products
were used. It was observed that the >30 day TET2 Product cells
were more effective killers than the >30 day NeoTCR Product
cells (data not shown), however, there were no differences between
14 day cells of both products (FIGS. 12A and 12B). In both cases,
controls were performed and the TET2 Product cells and NeoTCR
Product cells did not kill SW620 cells lacking the COX6C R20Q
mutation. These IncuCyte experiments demonstrate that the number of
days post gene editing of cells to engineer a TET2 deficiency
affects the phenotype of the cells.
[0327] TET2 disruption enhances CD8 memory cell differentiation
(Carty et al., 2018; Fraietta et al., 2018, Nature, 558(7709),
307-312). The phenotypic state of the edited cells was assessed via
flow cytometry after staining with antibodies against CCR7 and
CD27. Based on these experiments, it was shown that TET2 Products
are enriched for expression of CCR7 and CD27 as compared to control
T cells and NeoTCR Products indicating that TET2 Products comprise
Tcm T cells.
[0328] CD27 is a member of the TNF receptor family. It is also
constitutively expressed on central memory T (Tcm) and naive T
cells (Tn). To determine if the TET2 Product cells had a
memory-like phenotype, the TET2 Product cells were stimulated for 7
days via cognate comPACT coating. This stimulation revealed an
increased frequency of cells expressing CD27 (FIG. 14B) and CCR7
(FIG. 14A) among TET2 Product cells. In other words, the TET2
Product cells were shown to have a memory-like phenotype.
[0329] Cytokine and granzyme assays were performed on the TET2
Products. Specifically, intracellular staining and detection via
flow cytometry and neoantigen-specific killing assays were
performed. The results of these experiments showed that TET2
Products produce higher levels of effector cytokines and release
more cytotoxic granules than cells that express TET2 (e.g., NeoTCR
Products).
[0330] Lastly, the expression of TOX and TCF7 were characterized in
NeoTCR Product cells and TET2 Product cells. It was shown that both
TOX and TCF7 expression were unchanged between NeoTCR Product cells
and TET2 Product cells at 1) resting state, 2) 7 days following
stimulation, and 3) 9 days following stimulation. See FIGS.
15A-15D).
Example 3. Methods and Materials Used for the Generation of TET2
Products
[0331] Materials and Methods. T cells were transfected with gRNAs
targeting the first exon of TET2 as Cas9 RNPs along with the TRA
and TRB gRNA-Cas9 RNPs as described in Example 1 and in
PCT/US2020/17887 (which is herein incorporated by reference in its
entirety), resulting in disruption of the endogenous TET2 coding
sequence and reduced TET2 protein expression.
[0332] T cell Isolation and Editing. CD4 and CD8 T cells were
isolated from healthy donor PBMCs. By means of example, isolation
of such cells can be achieved using the Miltenyi Prodigy or
Miltenyi MACS separation columns according to the manufacturers'
instructions. Positively-selected CD4 and CD8 T cells (for example,
using Miltenyi antibodies and isolation column) were used fresh or
cryopreserved in 1% human serum albumin, 49% plasmalyte (Baxter),
and 50% CS10 (Sigma). Cryopreserved cells were thawed, washed in
TexMACS (Miltenyi)+10% human AB serum (Valley Biomedical), and
seeded at a density of 2.times.106 cells per mL in TexMACS+3% human
AB serum (culture medium). One day after thawing, or immediately if
used fresh, the cells were washed and re-seeded at a density of
1.46.times.106 cells per mL in culture medium+12.5 ng/mL IL7+12.5
ng/mL IL15+1:17.5 ratio of TransACT T cell activation reagent (all
reagents from Miltenyi) by volume. Two days after activation, T
cells were electroporated with a plasmid comprising the NeoTCR of
interest.
[0333] comPACT and comPACT-Dextramer preparation.
Neoantigen-specific peptide-HLA complex polypeptides (i.e., each a
"comPACT") were prepared according to the method as described in
PCT/US2019/025415, hereby incorporated by reference in its
entirety. A comPACT-dextramer complex was made for the labeling of
neoTCR expressing T cells. Biotinylated comPACT protein was
incubated with a streptavidin-conjugated fluorophore for 10 min at
room temperature (RT). Biotin-40-dextran (NANOCS) was added to the
mixture and incubated at RT for an additional 10 minutes. The
comPACT-Dextramers were stored at 4.degree. C.
[0334] Confirmation of comPACT binding to neoTCR edited T cells. T
cells were stained for flow cytometry on the indicated days. Cells
were first stained with viability dye for 20 minutes at 4.degree.
C., then washed and stained with the comPACT-dextramer for 10
minutes at 4.degree. C. Surface antibodies (anti-CD8.alpha.,
anti-CD8.beta., anti-CD4) were added to the suspension of cells and
comPACT-dextramer, and the cells were incubated for an additional
20 minutes at 4.degree. C. Cells were then washed and fixed in
intracellular fixation buffer (BD Biosciences). All cells were
acquired on an Attune NxT Flow Cytometer (ThermoFisher Scientific)
and data was analyzed with either FCS Express or FlowJo.
[0335] Cytometric Bead Array (CBA). Streptavidin coated plates
(Eagle Biosciences) were washed 3 times with wash buffer (PBS
supplemented with 1% BSA and 0.05% tween20) and then coated with
comPACTs at different concentrations ranging from 100-0.01 ng/well.
Wells with no comPACTs and wells coated with mismatched comPACTs as
used as controls. The plates were incubated for 2 hr at room
temperature, washed three times with wash buffer, and then washed
three times with TexMACS supplemented with 3% human AB serum to
remove the tween20. T cells were given two washes with TexMACS
supplemented with 3% human AB serum and resuspended at 1 million
cells/mL in TexMACS supplemented with 3% human AB serum and
1.times. penicillin-streptomycin solution. T cells were plated onto
the comPACT coated plate at 100 .mu.L/well and incubated at
37.degree. C., 5% CO2. After 24h the supernatant was collected, and
the cytokine concentrations were analyzed using the BD Cytometric
Bead Array (CBA) Human Th1/Th2 Cytokine Kit II (Catalog No. 551809)
following the manufacturer's protocol. Capture beads were mixed
with culture supernatant, incubated with the detection reagent for
3 hr at RT protected from light, washed, and resuspended in wash
buffer. Samples were assayed on an Attune NxT Flow Cytometer and
data analyzed with FlowJo. The EC50 represents the concentration of
cognate comPACT that elicits 50% of the maximum response and was
calculated utilizing a least-squares fit of IFN.gamma. secretion
over a range of comPACT concentrations.
[0336] Intracellular Staining. T cells were stained for flow
cytometry on the indicated days. T cells were first stained with
viability dye for 20 minutes at 4.degree. C., then washed and
incubated with surface antibodies (anti-CD8.alpha., anti-CD8.beta.,
anti-CD4) for an additional 20 minutes at 4.degree. C. T cells were
then washed and permeabilized for intracellular staining. T cells
were stained with anti-2A peptide or with anti-IFN.gamma.,
anti-TNF, or anti-IL2 in permeabilization buffer for 20 minutes at
4.degree. C. T cells were fixed in intracellular fixation buffer
(BD Biosciences). Samples were assayed on an Attune NxT Flow
Cytometer (ThermoFisher Scientific) and data analyzed with either
FCS Express or FlowJo.
[0337] T cell Proliferation Assay. Edited CD4 and CD8 T cells were
labeled with the e450 proliferation dye (eBioscience) according to
the manufacturer's instructions. Labeled cells were stimulated on
comPACT coated plates with a range of concentrations as described
above. T cells were harvested over 48-96 hours and analyzed for
proliferation as measured by dilution of the e450 dye.
[0338] T cell Killing Assay. HLA-matched cell lines were pulsed
with the cognate neoantigen peptide or mismatched peptide for 1h at
37.degree. C., 5% CO2. The cells were washed 3 times with media to
remove any unbound peptide and then co-cultured with edited CD4 and
CD8 T cells that are labeled with the e450 proliferation dye
described above. Co-cultures were incubated for 48h at 37.degree.
C. with 5% CO2 before harvest. Cells were washed and stained with a
fixable viability dye to determine killing efficiency. The e450
proliferation dye is used to distinguish edited T cells from target
cells.
[0339] While the present invention has been described at some
length and with some particularity with respect to the several
described embodiments, it is not intended that it should be limited
to any such particulars or embodiments or any particular
embodiment, but it is to be construed with references to the
appended claims so as to provide the broadest possible
interpretation of such claims in view of the prior art and,
therefore, to effectively encompass the intended scope of the
invention.
[0340] All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety. In case of conflict, the present specification, including
definitions, will control. In addition, section headings, the
materials, methods, and examples are illustrative only and not
intended to be limiting.
Sequence CWU 1
1
13123DNAArtificial SequenceTET sgRNA 1cctcccattt gccagacaga acc
23223DNAArtificial SequencesgRNA 2ttaagggaag tgaaaataga ggg
23323DNAArtificial SequencesgRNA 3ggaatgacat acagactgca ggg
23423DNAArtificial SequencesgRNA 4gatagaacca accatgttga ggg
23523DNAArtificial SequencesgRNA 5ccaaccatgt tgagggcaac aga
23620DNAArtificial SequenceForward primer 6gatcaggagg aggcacagtg
20720DNAArtificial SequenceReverse primer 7aggagcccag agagagaagg
20820DNAArtificial SequenceForward primer 8gtttctgcct cttccgtgga
20920DNAArtificial SequenceReverse primer 9tgttgggggc acaagatctc
20104421DNAHomo sapiens 10ctccatctca aaaaaaaaaa aaaaaaagct
actgcagtag atcaggagga ggcacagtga 60taaagagaag atctgagcta tgaagtggca
gtcaagatga ttaaaggaat atataggaag 120tacagttgat agaacttagc
aagtgattag gtaaatgaag tgctagagaa aataaagggg 180atatttttca
attgttttta gcattttggc aaaaaattat ttaggaatga aattgatgct
240agtaactaag agtatgaact tcccacatta gctggtaatt ttgatcaccc
ttgttctcca 300tgaccataaa tattttagag ttgctatgaa gacaagaatg
tttatttcct gagtagctgt 360cagttgtcac tatgaaacat gaaaataaat
atcagtttgc tatgtctagg tattccgata 420tttatccaca attattcctt
aagatatatt agtattttta tagatagata gatagataga 480tagaaataaa
cacattttaa tttttgtttc catgctcttt agaattcaac tagagggcag
540ccttgtggat ggccccgaag caagcctgat ggaacaggat agaaccaacc
atgttgaggg 600caacagacta agtccattcc tgataccatc acctcccatt
tgccagacag aacctctggc 660tacaaagctc cagaatggaa gcccactgcc
tgagagagct catccagaag taaatggaga 720caccaagtgg cactctttca
aaagttatta tggaataccc tgtatgaagg gaagccagaa 780tagtcgtgtg
agtcctgact ttacacaaga aagtagaggg tattccaagt gtttgcaaaa
840tggaggaata aaacgcacag ttagtgaacc ttctctctct gggctccttc
agatcaagaa 900attgaaacaa gaccaaaagg ctaatggaga aagacgtaac
ttcggggtaa gccaagaaag 960aaatccaggt gaaagcagtc aaccaaatgt
ctccgatttg agtgataaga aagaatctgt 1020gagttctgta gcccaagaaa
atgcagttaa agatttcacc agtttttcaa cacataactg 1080cagtgggcct
gaaaatccag agcttcagat tctgaatgag caggagggga aaagtgctaa
1140ttaccatgac aagaacattg tattacttaa aaacaaggca gtgctaatgc
ctaatggtgc 1200tacagtttct gcctcttccg tggaacacac acatggtgaa
ctcctggaaa aaacactgtc 1260tcaatattat ccagattgtg tttccattgc
ggtgcagaaa accacatctc acataaatgc 1320cattaacagt caggctacta
atgagttgtc ctgtgagatc actcacccat cgcatacctc 1380agggcagatc
aattccgcac agacctctaa ctctgagctg cctccaaagc cagctgcagt
1440ggtgagtgag gcctgtgatg ctgatgatgc tgataatgcc agtaaactag
ctgcaatgct 1500aaatacctgt tcctttcaga aaccagaaca actacaacaa
caaaaatcag tttttgagat 1560atgcccatct cctgcagaaa ataacatcca
gggaaccaca aagctagcgt ctggtgaaga 1620attctgttca ggttccagca
gcaatttgca agctcctggt ggcagctctg aacggtattt 1680aaaacaaaat
gaaatgaatg gtgcttactt caagcaaagc tcagtgttca ctaaggattc
1740cttttctgcc actaccacac caccaccacc atcacaattg cttctttctc
cccctcctcc 1800tcttccacag gttcctcagc ttccttcaga aggaaaaagc
actctgaatg gtggagtttt 1860agaagaacac caccactacc ccaaccaaag
taacacaaca cttttaaggg aagtgaaaat 1920agagggtaaa cctgaggcac
caccttccca gagtcctaat ccatctacac atgtatgcag 1980cccttctccg
atgctttctg aaaggcctca gaataattgt gtgaacagga atgacataca
2040gactgcaggg acaatgactg ttccattgtg ttctgagaaa acaagaccaa
tgtcagaaca 2100cctcaagcat aacccaccaa tttttggtag cagtggagag
ctacaggaca actgccagca 2160gttgatgaga aacaaagagc aagagattct
gaagggtcga gacaaggagc aaacacgaga 2220tcttgtgccc ccaacacagc
actatctgaa accaggatgg attgaattga aggcccctcg 2280ttttcaccaa
gcggaatccc atctaaaacg taatgaggca tcactgccat caattcttca
2340gtatcaaccc aatctctcca atcaaatgac ctccaaacaa tacactggaa
attccaacat 2400gcctgggggg ctcccaaggc aagcttacac ccagaaaaca
acacagctgg agcacaagtc 2460acaaatgtac caagttgaaa tgaatcaagg
gcagtcccaa ggtacagtgg accaacatct 2520ccagttccaa aaaccctcac
accaggtgca cttctccaaa acagaccatt taccaaaagc 2580tcatgtgcag
tcactgtgtg gcactagatt tcattttcaa caaagagcag attcccaaac
2640tgaaaaactt atgtccccag tgttgaaaca gcacttgaat caacaggctt
cagagactga 2700gccattttca aactcacacc ttttgcaaca taagcctcat
aaacaggcag cacaaacaca 2760accatcccag agttcacatc tccctcaaaa
ccagcaacag cagcaaaaat tacaaataaa 2820gaataaagag gaaatactcc
agacttttcc tcacccccaa agcaacaatg atcagcaaag 2880agaaggatca
ttctttggcc agactaaagt ggaagaatgt tttcatggtg aaaatcagta
2940ttcaaaatca agcgagttcg agactcataa tgtccaaatg ggactggagg
aagtacagaa 3000tataaatcgt agaaattccc cttatagtca gaccatgaaa
tcaagtgcat gcaaaataca 3060ggtttcttgt tcaaacaata cacacctagt
ttcagagaat aaagaacaga ctacacatcc 3120tgaacttttt gcaggaaaca
agacccaaaa cttgcatcac atgcaatatt ttccaaataa 3180tgtgatccca
aagcaagatc ttcttcacag gtgctttcaa gaacaggagc agaagtcaca
3240acaagcttca gttctacagg gatataaaaa tagaaaccaa gatatgtctg
gtcaacaagc 3300tgcgcaactt gctcagcaaa ggtacttgat acataaccat
gcaaatgttt ttcctgtgcc 3360tgaccaggga ggaagtcaca ctcagacccc
tccccagaag gacactcaaa agcatgctgc 3420tctaaggtgg catctcttac
agaagcaaga acagcagcaa acacagcaac cccaaactga 3480gtcttgccat
agtcagatgc acaggccaat taaggtggaa cctggatgca agccacatgc
3540ctgtatgcac acagcaccac cagaaaacaa aacatggaaa aaggtaacta
agcaagagaa 3600tccacctgca agctgtgata atgtgcagca aaagagcatc
attgagacca tggagcagca 3660tctgaagcag tttcacgcca agtcgttatt
tgaccataag gctcttactc tcaaatcaca 3720gaagcaagta aaagttgaaa
tgtcagggcc agtcacagtt ttgactagac aaaccactgc 3780tgcagaactt
gatagccaca ccccagcttt agagcagcaa acaacttctt cagaaaagac
3840accaaccaaa agaacagctg cttctgttct caataatttt atagagtcac
cttccaaatt 3900actagatact cctataaaaa atttattgga tacacctgtc
aagactcaat atgatttccc 3960atcttgcaga tgtgtaggta agtgccagaa
atgtactgag acacatggcg tttatccaga 4020attagcaaat ttatcttcag
atatgggatt ttccttcttt ttttaaatct tgagtctggc 4080agcaatttgt
aaaggctcat aaaaatctga agcttacatt ttttgtcaag ttaccgatgc
4140ttgtgtcttg tgaaagagaa cttcacttac atgcagtttt tccaaaagaa
ttaaataatc 4200gtgcatgttt atttttccct ctcttcagat cctgtaaaat
ttgaatgtat ctgttttaga 4260tcaattcgcc tatttagctc tttgtatatt
atctcctgga gagacagcta ggcagcaaaa 4320aaacaatcta ttaaaatgag
aaaataacga ccataggcag tctaatgtac gaactttaaa 4380tattttttaa
ttcaaggtaa aatatattag tttcacaaga t 442111522DNAHomo sapiens
11ctccatctca aaaaaaaaaa aaaaaaagct actgcagtag atcaggagga ggcacagtga
60taaagagaag atctgagcta tgaagtggca gtcaagatga ttaaaggaat atataggaag
120tacagttgat agaacttagc aagtgattag gtaaatgaag tgctagagaa
aataaagggg 180atatttttca attgttttta gcattttggc aaaaaattat
ttaggaatga aattgatgct 240agtaactaag agtatgaact tcccacatta
gctggtaatt ttgatcaccc ttgttctcca 300tgaccataaa tattttagag
ttgctatgaa gacaagaatg tttatttcct gagtagctgt 360cagttgtcac
tatgaaacat gaaaataaat atcagtttgc tatgtctagg tattccgata
420tttatccaca attattcctt aagatatatt agtattttta tagatagata
gatagataga 480tagaaataaa cacattttaa tttttgtttc catgctcttt ag
52212444DNAHomo sapiens 12gtaagtgcca gaaatgtact gagacacatg
gcgtttatcc agaattagca aatttatctt 60cagatatggg attttccttc tttttttaaa
tcttgagtct ggcagcaatt tgtaaaggct 120cataaaaatc tgaagcttac
attttttgtc aagttaccga tgcttgtgtc ttgtgaaaga 180gaacttcact
tacatgcagt ttttccaaaa gaattaaata atcgtgcatg tttatttttc
240cctctcttca gatcctgtaa aatttgaatg tatctgtttt agatcaattc
gcctatttag 300ctctttgtat attatctcct ggagagacag ctaggcagca
aaaaaacaat ctattaaaat 360gagaaaataa cgaccatagg cagtctaatg
tacgaacttt aaatattttt taattcaagg 420taaaatatat tagtttcaca agat
444133455DNAHomo sapiens 13aattcaacta gagggcagcc ttgtggatgg
ccccgaagca agcctgatgg aacaggatag 60aaccaaccat gttgagggca acagactaag
tccattcctg ataccatcac ctcccatttg 120ccagacagaa cctctggcta
caaagctcca gaatggaagc ccactgcctg agagagctca 180tccagaagta
aatggagaca ccaagtggca ctctttcaaa agttattatg gaataccctg
240tatgaaggga agccagaata gtcgtgtgag tcctgacttt acacaagaaa
gtagagggta 300ttccaagtgt ttgcaaaatg gaggaataaa acgcacagtt
agtgaacctt ctctctctgg 360gctccttcag atcaagaaat tgaaacaaga
ccaaaaggct aatggagaaa gacgtaactt 420cggggtaagc caagaaagaa
atccaggtga aagcagtcaa ccaaatgtct ccgatttgag 480tgataagaaa
gaatctgtga gttctgtagc ccaagaaaat gcagttaaag atttcaccag
540tttttcaaca cataactgca gtgggcctga aaatccagag cttcagattc
tgaatgagca 600ggaggggaaa agtgctaatt accatgacaa gaacattgta
ttacttaaaa acaaggcagt 660gctaatgcct aatggtgcta cagtttctgc
ctcttccgtg gaacacacac atggtgaact 720cctggaaaaa acactgtctc
aatattatcc agattgtgtt tccattgcgg tgcagaaaac 780cacatctcac
ataaatgcca ttaacagtca ggctactaat gagttgtcct gtgagatcac
840tcacccatcg catacctcag ggcagatcaa ttccgcacag acctctaact
ctgagctgcc 900tccaaagcca gctgcagtgg tgagtgaggc ctgtgatgct
gatgatgctg ataatgccag 960taaactagct gcaatgctaa atacctgttc
ctttcagaaa ccagaacaac tacaacaaca 1020aaaatcagtt tttgagatat
gcccatctcc tgcagaaaat aacatccagg gaaccacaaa 1080gctagcgtct
ggtgaagaat tctgttcagg ttccagcagc aatttgcaag ctcctggtgg
1140cagctctgaa cggtatttaa aacaaaatga aatgaatggt gcttacttca
agcaaagctc 1200agtgttcact aaggattcct tttctgccac taccacacca
ccaccaccat cacaattgct 1260tctttctccc cctcctcctc ttccacaggt
tcctcagctt ccttcagaag gaaaaagcac 1320tctgaatggt ggagttttag
aagaacacca ccactacccc aaccaaagta acacaacact 1380tttaagggaa
gtgaaaatag agggtaaacc tgaggcacca ccttcccaga gtcctaatcc
1440atctacacat gtatgcagcc cttctccgat gctttctgaa aggcctcaga
ataattgtgt 1500gaacaggaat gacatacaga ctgcagggac aatgactgtt
ccattgtgtt ctgagaaaac 1560aagaccaatg tcagaacacc tcaagcataa
cccaccaatt tttggtagca gtggagagct 1620acaggacaac tgccagcagt
tgatgagaaa caaagagcaa gagattctga agggtcgaga 1680caaggagcaa
acacgagatc ttgtgccccc aacacagcac tatctgaaac caggatggat
1740tgaattgaag gcccctcgtt ttcaccaagc ggaatcccat ctaaaacgta
atgaggcatc 1800actgccatca attcttcagt atcaacccaa tctctccaat
caaatgacct ccaaacaata 1860cactggaaat tccaacatgc ctggggggct
cccaaggcaa gcttacaccc agaaaacaac 1920acagctggag cacaagtcac
aaatgtacca agttgaaatg aatcaagggc agtcccaagg 1980tacagtggac
caacatctcc agttccaaaa accctcacac caggtgcact tctccaaaac
2040agaccattta ccaaaagctc atgtgcagtc actgtgtggc actagatttc
attttcaaca 2100aagagcagat tcccaaactg aaaaacttat gtccccagtg
ttgaaacagc acttgaatca 2160acaggcttca gagactgagc cattttcaaa
ctcacacctt ttgcaacata agcctcataa 2220acaggcagca caaacacaac
catcccagag ttcacatctc cctcaaaacc agcaacagca 2280gcaaaaatta
caaataaaga ataaagagga aatactccag acttttcctc acccccaaag
2340caacaatgat cagcaaagag aaggatcatt ctttggccag actaaagtgg
aagaatgttt 2400tcatggtgaa aatcagtatt caaaatcaag cgagttcgag
actcataatg tccaaatggg 2460actggaggaa gtacagaata taaatcgtag
aaattcccct tatagtcaga ccatgaaatc 2520aagtgcatgc aaaatacagg
tttcttgttc aaacaataca cacctagttt cagagaataa 2580agaacagact
acacatcctg aactttttgc aggaaacaag acccaaaact tgcatcacat
2640gcaatatttt ccaaataatg tgatcccaaa gcaagatctt cttcacaggt
gctttcaaga 2700acaggagcag aagtcacaac aagcttcagt tctacaggga
tataaaaata gaaaccaaga 2760tatgtctggt caacaagctg cgcaacttgc
tcagcaaagg tacttgatac ataaccatgc 2820aaatgttttt cctgtgcctg
accagggagg aagtcacact cagacccctc cccagaagga 2880cactcaaaag
catgctgctc taaggtggca tctcttacag aagcaagaac agcagcaaac
2940acagcaaccc caaactgagt cttgccatag tcagatgcac aggccaatta
aggtggaacc 3000tggatgcaag ccacatgcct gtatgcacac agcaccacca
gaaaacaaaa catggaaaaa 3060ggtaactaag caagagaatc cacctgcaag
ctgtgataat gtgcagcaaa agagcatcat 3120tgagaccatg gagcagcatc
tgaagcagtt tcacgccaag tcgttatttg accataaggc 3180tcttactctc
aaatcacaga agcaagtaaa agttgaaatg tcagggccag tcacagtttt
3240gactagacaa accactgctg cagaacttga tagccacacc ccagctttag
agcagcaaac 3300aacttcttca gaaaagacac caaccaaaag aacagctgct
tctgttctca ataattttat 3360agagtcacct tccaaattac tagatactcc
tataaaaaat ttattggata cacctgtcaa 3420gactcaatat gatttcccat
cttgcagatg tgtag 3455
* * * * *
References