Methods Of Determining Levels Of Exposure To Radiation And Uses Thereof
Chowdhury; Dipanjan ; et al.
Patent Application Summary
U.S. patent application number 17/005548 was filed with the patent office on 2021-03-18 for methods of determining levels of exposure to radiation and uses thereof. The applicant listed for this patent is Albert Einstein College of Medicine, Inc., Dana-Farber Cancer Institute, Inc.. Invention is credited to Dipanjan Chowdhury, Chandan Guha.
| Application Number | 20210079467 17/005548 |
| Document ID | / |
| Family ID | 1000005248129 |
| Filed Date | 2021-03-18 |
View All Diagrams
| United States Patent Application | 20210079467 |
| Kind Code | A1 |
| Chowdhury; Dipanjan ; et al. | March 18, 2021 |
METHODS OF DETERMINING LEVELS OF EXPOSURE TO RADIATION AND USES THEREOF
Abstract
Provided herein are methods of determining a subject's level of exposure to radiation and methods of determining a subject's risk of subsequent development of radiation disease or risk of poor prognosis from radiation exposure that include determining a level of one or more miRNAs selected from the group consisting of mouse and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, in a sample including a biological fluid from the subject.
| Inventors: | Chowdhury; Dipanjan; (Brookline, MA) ; Guha; Chandan; (Bronx, NY) | ||||||||||
| Applicant: |
|
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Family ID: | 1000005248129 | ||||||||||
| Appl. No.: | 17/005548 | ||||||||||
| Filed: | August 28, 2020 |
Related U.S. Patent Documents
| Application Number | Filing Date | Patent Number | ||
|---|---|---|---|---|
| 15546337 | Jul 26, 2017 | 10801065 | ||
| PCT/US2016/017187 | Feb 9, 2016 | |||
| 17005548 | ||||
| 62114456 | Feb 10, 2015 | |||
| Current U.S. Class: | 1/1 |
| Current CPC Class: | C12Q 1/6883 20130101; C12Q 2600/178 20130101; C12Q 2600/158 20130101; C12Q 1/6876 20130101; G01N 33/5088 20130101 |
| International Class: | C12Q 1/6876 20060101 C12Q001/6876; C12Q 1/6883 20060101 C12Q001/6883; G01N 33/50 20060101 G01N033/50 |
Goverment Interests
STATEMENT OF FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under grant numbers AI101897, CA142698, and A1091175 awarded by The National Institutes of Health. The government has certain rights in the invention.
Claims
1.-59. (canceled)
60. A method of determining the efficacy of a treatment for reducing radiation-induced damage administered to a human subject exposed to a significant dose of radiation, the method comprising: (a) determining a first level of one or more miRNAs in a first serum sample obtained from the human subject exposed to a significant dose radiation at a first time point, wherein the one or more miRNAs is selected from the group consisting of miR-130a-3p, miR-150-5p, miR-142-5p, miR-706, miR-342-3p, miR-136-5p, miR-17-3p, miR-126-3p, miR-322-3p, miR-34b-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p; (b) after the first time point and before a second time point, administering the treatment for reducing radiation-induced damage to the human subject; (c) determining a second level of the one or more miRNAs of step (a) in a second serum sample obtained from the human subject at the second time point; and (d) determining the efficacy of the treatment for reducing radiation-induced damage administered to the human subject based on a comparison of the second level(s) of the one or more miRNAs to the first level(s) of the one or more miRNAs, wherein one or more of (i) an elevation in the second level of one or more of miR-136-5p, miR-322-3p, miR-142-5p, miR-706, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, and (ii) a decrease in the second level of one or more of miR-130a-3p, miR-126-3p, miR-34b6-3p, miR-30a-3p, and miR-30c-5p, as compared to the first level(s) of one or more of miR-136-5p, miR-322-3p, miR-142-5p, miR-706, miR-150-5p, miR-342-3p, miR-187-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-130a-3p, miR-126-3p, miR-34b-3p, miR-30a-3p, and miR-30c-5p, indicates that the treatment for reducing radiation-induced damage administered to the human subject was effective.
61.-64. (canceled)
65. The method of claim 60, wherein the treatment for reducing radiation-induced damage is selected from the group consisting of: cytokines, potassium iodide, Prussian blue, diethylenetriamine pentaacetic acid, bone marrow transplantation, blood transfusion, and surgery to remove damaged tissues.
66. The method of claim 65, wherein the cytokines are selected from the group consisting of granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim.
67. The method of claim 60, wherein the first and second level(s) of the one or more miRNAs in the first and second serum samples are determined in steps (a) and (c) by amplifying the miRNAs present in the first and second serum samples to generate amplification products, contacting the amplified products to a substrate, and detecting the amplified products bound to the substrate.
68.-80. (canceled)
81. The method of claim 60, wherein the method further comprises administering an alternate treatment to the human subject when the treatment for reducing radiation-induced damage is determined as not being effective.
82. The method of claim 60, wherein the method further comprises administering one or more additional doses of the treatment for reducing radiation-induced damage when the treatment for reducing radiation-induced damage is determined as being effective.
83. A method of treating a human subject in need thereof, the method comprising: (a) determining a level of one or more miRNAs selected from the group consisting of miR-130a-3p, miR-150-5p, miR-142-5p, miR-706, miR-342-3p, miR-17-3p, miR-126-3p, miR-322-3p, miR-136-5p, miR-34b-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a serum sample from the human subject, wherein the serum sample is obtained from the human subject after a possible exposure of the human subject to radiation; (b) comparing the level(s) of the one or more miRNAs in the serum sample from the human subject to reference level(s) of the one or more miRNAs, wherein the reference level(s) of the one or more miRNAs are levels of the one or more miRNAs in a reference serum sample from a human subject not exposed to radiation; (c) determining that (i) the human subject's exposure to radiation is sublethal when the level of miR-130a-3p is increased, or the level of miR-142-5p, miR-706, miR-150-5p, or miR-342-3p is decreased in the serum sample from the human subject compared to the reference level(s) of the one or more miRNAs; (ii) the human subject's exposure to radiation is high and not lethal when the level of miR-34b-3p, miR-126-3p, miR-322-3p, or miR-136-5p is increased or the level of miR-17-3p is decreased in the serum sample from the human subject compared to the reference level(s) of the one or more miRNAs; or (iii) the human subject's exposure to radiation is lethal when the level of miR-30a-3p or miR-30c-3p are increased, or the level of miR-187-3p, miR-194-5p, or miR-27a-3p is decreased in the serum sample compared to the reference level(s) of the one or more miRNAs; (d) selecting for the human subject (1) a treatment for reducing damage induced by a sublethal dose of radiation if the human subject's exposure is determined to be sublethal in step (c), (2) a treatment for reducing damage induced by a high and not lethal dose of radiation if the human subject's exposure is determined to be high and not lethal in step (c), or (3) a treatment for reducing damage induced by a lethal dose of radiation if the human subject's exposure is determined to be lethal in step (c); and (e) administering the treatment of step (d) to the human subject.
84. The method of claim 83, wherein the treatment is selected from the group consisting of: administration of one or more of a cytokine, potassium iodide, Prussian blue, and diethylenetriamine pentaacetic acid, bone marrow transplantation, blood transfusion, and surgery to remove damaged tissues.
85. The method of claim 84, wherein the cytokine is selected from the group consisting of granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim.
86. The method of claim 83, wherein the serum sample is obtained from the human subject within 30 minutes to 96 hours after the possible exposure of the human subject to radiation.
87. The method of claim 83, wherein the sublethal dose of radiation is less than or equal to 2 Gy of radiation; the high and not lethal dose of radiation is greater than 2 Gy to about 6 Gy; and the lethal dose of radiation is greater than about 6.5 Gy.
88. A method of treating a human subject in need thereof, wherein the human subject is or has previously been determined to have an increased serum level of miR-130a-3p, miR-126-3p, miR-322-3p, miR-136-5p, miR-34b-3p, or miR-30c-5p or a decreased serum level of miR-142-5p, miR-706, miR-150-5p, miR-342-3p, miR-17-3p, or miR-194-5p relative to a reference level of the miRNA, wherein the reference level of the miRNA is a level of the miRNA in a reference serum sample from a human subject not exposed to radiation, the method comprising administering to the human subject a treatment for radiation disease.
89. The method of claim 88, wherein the treatment for radiation disease is selected from the group consisting of: administration of one or more of a cytokine, potassium iodide, Prussian blue, and diethylenetriamine pentaacetic acid, bone marrow transplantation, blood transfusion, and surgery to remove damaged tissues.
90. The method of claim 89, wherein the cytokine is selected from the group consisting of granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim.
91. The method of claim 88, wherein the serum level of miR-130a-3p, miR-126-3p, miR-322-3p, miR-136-5p, miR-34b-3p, and miR-30c-5p, miR-142-5p, miR-706, miR-150-5p, miR-342-3p, miR-17-3p, or miR-194-5p is from a serum sample obtained from the human subject within 30 minutes to 96 hours after possible exposure of the human subject to radiation.
92. The method of claim 88, wherein the treatment is for radiation disease caused by exposure to a sublethal, high and not lethal, or lethal dose of radiation.
93. The method of claim 92, wherein the sublethal dose of radiation is less than or equal to 2 Gy of radiation; the high and not lethal dose of radiation is greater than 2 Gy to about 6 Gy; and the lethal dose of radiation is greater than about 6.5 Gy.
94. A method of treating a human subject in need thereof, the method comprising: (a) determining a level of one or more miRNAs selected from the group consisting of miR-130a-3p, miR-136-5p, miR-150-5p, miR-142-5p, miR-706, miR-322-3p, miR-342-3p, miR-17-3p, miR-126-3p, miR-34b-3p, miR-194-5p, and miR-30c-5p in a serum sample from the human subject; (b) comparing the levels of the one or more miRNAs in the serum sample from the human subject to reference levels of the one or more miRNAs, wherein the reference levels of the one or more miRNAs are levels of the one or more miRNAs in a reference serum sample from a human subject not exposed to radiation; (c) determining that the level of the one or more miRNAs miR-130a-3p, miR-126-3p, miR-34b-3p, and miR-30c-5p is increased and the level of the one or more miRNAs miR-142-5p, miR-706, miR-150-5p, miR-342-3p, miR-17-3p, and miR-194-5p, is decreased in the serum sample from the human subject compared to the reference levels of the one or more miRNAs; (d) selecting a treatment for reducing damage induced by radiation for the human subject; and (e) administering the treatment for reducing damage induced by radiation to the human subject.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional and claims priority to U.S. patent application Ser. No. 15/546,337, filed on Jul. 26, 2017 which is a U.S. National Stage application of International Application No. PCT/US2016/017187, filed Feb. 9, 2016, which claims the benefit of priority of U.S. Provisional Application No. 62/114,456, filed Feb. 10, 2015. The contents of all of the prior applications are incorporated herein by reference in their entirety.
SEQUENCE LISTING
[0003] This application incorporates by reference the Computer Readable Form (CRF) of a Sequence Listing in ASCII text format submitted via EFS-Web. The Sequence Listing text file submitted via EFS-Web, entitled 00530-0321002SEQ.txt, was created on Aug. 27, 2020, and is 39 KB bytes in size.
TECHNICAL FIELD
[0004] This invention relates generally to the fields of medicine and radiation biology.
BACKGROUND
[0005] Radiation disease, also known as acute radiation syndrome (ARS), is caused by exposure to a large dose of radiation often over a short period of time. The symptoms of radiation disease include, but are not limited to, nausea, vomiting, diarrhea, headache, fever, skin damage, loss of bone marrow stem cells, internal bleeding, and possibly death. The severity and onset of symptoms depend upon the amount of radiation absorbed by the body. In general, greater doses of radiation result in a more rapid onset of severe radiation disease in a subject.
[0006] MicroRNAs (miRNAs) are small non-coding RNAs, typically about 19-22 nucleotides in size, that play important roles in the regulation of gene expression and various biological processes, such as cell cycle control. MiRNAs have been implicated in a number of diseases and are detected in biological fluids, such as serum.
SUMMARY
[0007] The present disclosure is based, at least in part, on the discovery that specific changes in the serum levels of specific miRNAs occur in subjects that have been exposed to total body irradiation, and that the changes in the levels of these specific miRNAs are radiation dose-dependent and correlate with a subject's risk of subsequent development of radiation disease, a subject's risk of poor prognosis from radiation exposure, and the efficacy of a treatment for reducing radiation-induced damage in a subject exposed to a significant dose of radiation (e.g., when the treatment for reducing radiation-induced damage in a subject is administered before or after total body irradiation). These specific miRNAs can include, e.g., one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In view of these discoveries, provided herein are methods of determining a subject's level of exposure to radiation, methods of determining whether a subject has been exposed to a radiation dose of 2 Gy or more, methods of determining a subject's risk of poor prognosis from radiation exposure, methods of determining a subject's risk of subsequent development of radiation disease, methods of selecting a treatment for reducing radiation-induced damage for a subject, methods of selecting a subject for treatment of radiation disease, methods of triaging a plurality of subjects exposed to or suspected of having been exposed to radiation, and methods of determining the efficacy of a treatment administered to a subject exposed to a significant dose of radiation, that include, e.g., determining a level of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from a subject. Also provided are kits that comprise, consist, or consist essentially of at least one nucleic acid that comprises, consists, or consists essentially of a sequence (e.g., a sequence to between 5 to 20 nucleotides or between 5 to 15 nucleotides) that is complementary to one or more of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, and miR-126-3p.
[0008] Provided herein are methods for determining a subject's level of exposure to radiation that include: (a) determining a level of three or more miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from the subject; (b) comparing the level(s) of the one or more miRNAs in the sample to reference levels of the three or more miRNAs; and (c) determining the subject's level of exposure to radiation based on the comparison of the levels of the three or more miRNAs in the sample to the reference levels of the three or more miRNAs. In some embodiments of any of the methods described herein, the subject is a mouse, and the three or more miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In some embodiments of any of the methods described herein, (i) three or more of: an elevated level of one or more of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference levels, indicates that the subject's exposure to radiation is equal to or less than 2 Gy; (ii) three or more of an elevated level of one or more of miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference levels, indicates that the subject's exposure to radiation is between greater than 2 Gy and about 6.5 Gy; or (iii) three or more of: an elevated level of one or more of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference levels, indicates that the subject's exposure to radiation is greater than about 6.5 Gy. In some embodiments of any of the methods described herein, in (i) the reference levels are the level(s) of mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; in (ii) the reference levels are the levels of mouse miR-17-3p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and in (iii) the reference levels are the levels of mouse miR-30a-3p, miR-30c-5p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to about 2 Gy of radiation, or a subject exposed to about 6.5 Gy of radiation.
[0009] In some embodiments of any of the methods described herein, the subject is a human, and the three or more miRNAs are selected from the group of human homologues of mouse miRNAs miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In some embodiments of any of the methods described herein, (i) three or more of: an elevated level of one or more of the human homologue of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference levels, indicates that the subject's exposure to radiation is equal to or less than 2 Gy; (ii) three or more of: an elevated level of one or more of the human homologue of mouse miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference levels, indicates that the subject's exposure to radiation is between greater than 2 Gy and about 6.5 Gy; or (iii) three or more of: an elevated level of one or more of the human homologue of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologue of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference levels, indicates that the subject's exposure to radiation is greater than about 6.5 Gy. In some embodiments of any of the methods described herein, in (i) the reference levels are the levels of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; in (ii) the reference levels are the levels of the human homologues of mouse miR-17-3p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and in (iii) the reference levels are the levels of the human homologues of mouse miR-30a-3p, miR-30c-5p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in a sample includuing a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to about 2 Gy of radiation, or a subject exposed to about 6.5 Gy of radiation.
[0010] Some embodiments of any of the methods described herein further include administering a treatment to the subject based on the subject's determined level of exposure to radiation.
[0011] Also provided are methods of determining whether a subject has been exposed to a radiation dose of 2 Gy or more that include: (a) determining a level of one or more miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p, and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p in a sample including a biological fluid from the subject; (b) comparing the level(s) of the one or more miRNAs in the sample with a reference level(s) of the one or more miRNAs; and (c) determining whether the subject has been exposed to a radiation dose of 2 Gy or more based on the comparison of the level(s) of the one or more miRNAs in the sample with the reference level(s) of the one or more miRNAs. In some embodiments of any of the methods described herein, the subject is a mouse and the one or more miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p. In some embodiments of any of the methods described herein, one or more of: an elevated level of one or more of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p, and/or a decreased level of one or more of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p in the sample, as compared to the reference level(s), indicates that the subject has been exposed to 2 Gy or more radiation. In some embodiments of any of the methods described herein, (i) the reference level(s) for mouse miR-130a-3p, miR-150-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-1966-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p are the level(s) of mouse miR-130a-3p, miR-150-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-1966-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; (ii) the reference level for mouse miR-17-3p is the level of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and (iii) the reference level(s) for mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p are the level(s) of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation, or a subject exposed to about 6.5 Gy radiation.
[0012] In some embodiments of any of the methods described herein, the subject is a human and the one or more miRNAs are selected from the group of human homologues of miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p. In some embodiments of any of the methods described herein, one or more of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p, and/or a decreased level of one or more of the human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to reference level(s), indicates that the subject has been exposed to 2 Gy or more radiation. In some embodiments of any of the methods described herein, (i) the reference level(s) for the human homologues of mouse miR-130a-3p, miR-150-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-1966-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p are the level(s) of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-1966-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; (ii) the reference level for the human homologues of mouse miR-17-3p is the level of the human homologues of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and (iii) the reference level(s) for the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p are the level(s) of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation, or a subject exposed to about 6.5 Gy radiation.
[0013] Some embodiments of any of the methods described herein further include administering a treatment for reducing radiation-induced damage to the subject determined to have been exposed to 2 Gy or more radiation.
[0014] Also provided are methods of determining a subject's risk of poor prognosis from radiation exposure that include: (a) determining a level of three or more miRNAs in a sample including a biological fluid from the subject; (b) comparing the levels of the three or more miRNAs in the sample to reference levels of the three or more miRNAs; and (c) determining the subject's risk of poor prognosis from radiation exposure based on the comparison of the levels of the three or more miRNAs in the sample to the reference levels of the three or more miRNAs. Also provided are methods of assessing a subject's risk of subsequent development of radiation disease, where the subject has been exposed or is suspected of being exposed, to a significant dose of radiation that include: (a) determining a level of three or more miRNAs in a sample including a biological fluid from the subject; (b) comparing the levels of the three or more miRNAs in the sample to reference levels of the three or more miRNAs; and (c) determining the subject's risk of subsequent radiation disease based on the comparison of the levels of the three or more miRNAs in the sample to the reference levels of the three or more miRNAs.
[0015] In some embodiments of any of the methods described herein, the subject is a mouse, and the three or more miRNAs are selected from the group of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In some embodiments of any of the methods described herein, (i) three or more of: an elevated level of one or more of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference levels, indicates that the subject's risk of poor prognosis is moderate; (ii) three or more of: an elevated level of one or more of mouse miR-34b-3p, miR-126-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference levels, indicates that the subject's risk of poor prognosis is high; or (iii) three or more of: an elevated level of one or more of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s), indicates that the subject's risk of poor prognosis is very high.
[0016] In some embodiments of any of the methods described herein, the subject is a mouse, and the three or more miRNAs are selected from the group of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In some embodiments of any of the methods described herein, (i) three or more of: an elevated level of one or more of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference levels, indicates that the subject's risk of subsequent development of radiation disease is moderate; (ii) three or more of: an elevated level of one or more of mouse miR-34b-3p, miR-126-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference levels, indicates that the subject's risk of subsequent development of radiation disease is high; or (iii) three or more of: an elevated level of one or more of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference levels, indicates that the subject's risk of subsequent development of radiation disease is very high.
[0017] In some embodiments of any of the methods described herein, in (i) the reference levels are the levels of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-196b-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; in (ii) the reference levels are the levels of mouse miR-34b-3p, miR-126-3p, miR-17-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and in (iii) the reference levels are the levels of mouse miR-30a-3p, miR-30c-5p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to about 2 Gy of radiation, or a subject exposed to about 6.5 Gy of radiation.
[0018] In some embodiments of any of the methods described herein, the subject is a human, and the three or more miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In some embodiments of any of the methods described herein, (i) three or more of: an elevated level of one or more of the human homologue of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or and a decreased level of one or more of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference levels, indicates that the subject's risk of poor prognosis is moderate; (ii) three or more of: an elevated level of one or more of the human homologues of mouse miR-34b-3p, miR-126-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference levels, indicates that the subject's risk of poor prognosis is high; or (iii) three or more of: an elevated level of one or more of the human homologues of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference levels, indicates that the subject's risk of poor prognosis is very high.
[0019] In some embodiments of any of the methods described herein, the subject is a human, and the three or more miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In some embodiments of any of the methods described herein, (i) three or more of: an elevated level of one or more of the human homologue of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference levels, indicates that the subject's risk of subsequent development of radiation disease is moderate; (ii) three or more of: an elevated level of one or more of the human homologues of mouse miR-34b-3p, miR-126-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one of more of the human homologue of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference levels, indicates that the subject's risk of subsequent development of radiation disease is high; or (iii) three or more of: an elevated level of one or more of the human homologues of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s), indicates that the subject's risk of subsequent development of radiation disease is very high.
[0020] In some embodiments of any of the methods described herein, in (i) the reference levels are the levels of the human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-196b-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; in (ii) the reference levels are the levels of the human homologues of mouse miR-34b-3p, miR-126-3p, miR-17-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and in (iii) the reference levels are the levels of the human homologues of mouse miR-30a-3p, miR-30c-5p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to about 2 Gy of radiation, or a subject exposed to about 6.5 Gy of radiation.
[0021] Some embodiments of any of the methods described herein further include (d) hospitalizing a subject identified as having a very high risk or a high risk of poor prognosis from radiation exposure, or treating a subject identified as having a moderate risk of poor prognosis from radiation exposure on an outpatient basis. Some embodiments of any of the methods described herein further include (d) hospitalizing a subject identified as having a very high risk or high risk of subsequent development of radiation disease, or treating a subject identified as having a moderate risk of subsequent development of radiation disease on an outpatient basis.
[0022] Also provided are methods of selecting a treatment for a subject that include (a) determining a level of one or more miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in a sample including a biological fluid from the subject; (b) comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs; and (c) selecting a treatment for reducing radiation-induced damage for a subject based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0023] Also provided are methods of selecting a subject for treatment of radiation disease that include: (a) determining a level of one or more miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in a sample including a biological fluid from the subject; (b) comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs; and (c) selecting a subject for treatment of radiation disease based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0024] In some embodiments of any of the methods described herein, the subject is a mouse and the one or more miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p. In some embodiments of any of the methods described herein, a treatment for reducing radiation-induced damage is selected for a subject having one or more of: an elevated level of one or more of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s).
[0025] In some embodiments of any of the methods described herein, the subject is a mouse and the one or more miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p. In some embodiments of any of the methods described herein, a subject having one or more of: an elevated level of one or more of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s), is selected for treatment of radiation disease, or a subject not having one or more of: an elevated level of one or more of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s), is not selected for treatment of radiation disease.
[0026] In some embodiments of any of the methods described herein, (i) the reference level(s) for mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p are the level(s) of mouse miR-130a-3p and miR-150-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; (ii) the reference level for mouse miR-17-3p is the level of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and (iii) the reference level(s) for mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p are the level(s) or mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to about 2G of radiation, or exposed to about 6.5 Gy of radiation.
[0027] In some embodiments of any of the methods described herein, the subject is a human and the one or more miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p. In some embodiments of any of the methods described herein, a treatment for reducing radiation-induced damage is selected for a subject having one or more of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s).
[0028] In some embodiments of any of the methods described herein, the subject is a human and the one or more miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p. In some embodiments of any of the methods described herein, a subject having one or more of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s), is selected for treatment of radiation disease, or a subject not having one or more of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s), is not selected for treatment of radiation disease.
[0029] In some embodiments of any of the methods described herein, (i) the reference level(s) for the human homologues of mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p are the level(s) of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; (ii) the reference level for the human homologues of mouse miR-17-3p is the level of the human homologues of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and (iii) the reference level(s) for the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p are the level(s) of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to about 2 Gy of radiation, or exposed to about 6.5 Gy of radiation.
[0030] In some embodiments of any of the methods described herein, the treatment for reducing radiation-induced damage is selected from the group of: administration of one or more of a cytokine, potassium iodide, Prussian blue, and diethylenetriamine pentaacetic acid, bone marrow transplantation, blood transfusion, and surgery to remove damaged tissues. In some embodiments of any of the methods described herein, the cytokine is selected from the group of granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim. In some embodiments of any of the methods described herein, the selected treatment includes inpatient treatment. Some embodiments of any of the methods described herein further include administering the selected treatment to the subject.
[0031] In some embodiments of any of the methods described herein, the subject has been identified as being exposed to radiation or is suspected of having been exposed to radiation. In some embodiments of any of the methods described herein, the subject is or was previously at a location having or suspected of having had a significant level of radiation. In some embodiments of any of the methods described herein, the location is the site of a nuclear attack, the site of radiation release from a nuclear weapon, a nuclear energy facility, a nuclear waste facility, or a nuclear medicine facility. In some embodiments of any of the methods described herein, the sample is obtained from the subject within 30 minutes to 96 hours after the subject's possible exposure to radiation.
[0032] Also provided herein are methods of triaging a plurality of subjects exposed or suspected of being exposed to radiation that include, for each subject in the plurality: (a) determining a level of three or more miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p and human homologues of one or more of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from the subject; (b) comparing the levels of the three or more miRNAs in the sample to reference levels of the three or more miRNAs; and (c) triaging the subject based on the comparison of the levels of the three or more miRNAs in the sample to the reference levels of the three or more miRNAs.
[0033] In some embodiments of any of the methods described herein, the subject is a mouse and the three or more miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In some embodiments of any of the methods described herein, (i) a subject having three or more of: an elevated level of one or more of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference levels, is given low priority in triaging; (ii) a subject having three or more of: an elevated level of one or more of mouse miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference levels, is given medium priority in triaging; or (iii) a subject having three or more of: an elevated level of one or more of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference levels, is given high priority in triaging. In some embodiments of any of the methods described herein, (i) the reference levels for mouse miR-130a-3p, miR-150-5p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-196b-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p are the levels of mouse miR-130a-3p, miR-150-5p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-196b-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; (ii) the reference levels for mouse miR-17-3p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p are the levels of mouse miR-17-3p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and (iii) the reference levels for mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p are the levels of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to about 2G of radiation, or exposed to about 6.5 Gy of radiation.
[0034] In some embodiments of any of the methods described herein, the subject is a human and the three or more miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In some embodiments of any of the methods described herein, (i) a subject having three or more of: an elevated level of one or more of the human homologue of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference levels, is given low priority in triaging; (ii) a subject having three or more of: an elevated level of one or more of the human homologue of mouse miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference levels, is given medium priority in triaging; or (iii) a subject having three or more of: an elevated level of one or more of the human homologues of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference levels, is given high priority in triaging. In some embodiments of any of the methods described herein, (i) the reference levels for the human homologues of mouse miR-130a-3p, miR-150-5p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-196b-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p are the levels of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, miR-196b-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; (ii) the reference levels for the human homologues of mouse miR-17-3p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p are the levels of the human homologues of mouse miR-17-3p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-196b-5p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or a subject exposed to about 2 Gy of radiation; and (iii) the reference levels for the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p are the levels of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to about 2G of radiation, or a subject exposed to about 6.5 Gy of radiation.
[0035] In some embodiments of any of the methods described herein, at least two of the plurality of subjects are or were previously at a location having or suspected of having had a significant level of radiation. In some embodiments of any of the methods described herein, the location is the site of a nuclear attack, the site of radiation release from a nuclear weapon, a nuclear energy facility, a nuclear waste facility, or a nuclear medicine facility.
[0036] Also provided herein are methods of determining the efficacy of a treatment administered to a subject exposed to a significant dose of radiation that include: (a) determining a first level of one or more miRNAs in a sample including a biological fluid obtained from the subject exposed to a significant dose radiation a first time point; (b) after the first time point and before a second time point, administering a treatment for reducing radiation-induced damage to the subject; (c) determining a second level of the one or more miRNAs in a sample comprising a biological fluid obtained from the subject at the second time point; and (d) determining the efficacy of the treatment administered to the subject based on a comparison of the second level(s) of the one or more miRNAs to the first level(s) of the one or more miRNAs.
[0037] In some embodiments of any of the methods described herein, the subject is a mouse, and the one or more miRNAs are selected from the group of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p. In some embodiments of any of the methods described herein, one or more of: an elevation in the second level of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, and/or a decrease in the second level of one or more of mouse miR-130a-3p, miR-126-3p, miR-346-3p, miR-30a-3p, and miR-30c-5p, as compared to the first level(s) of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-18'7-3p, miR-194-5p, miR-27a-3p, miR-130a-3p, miR-126-3p, miR-346-3p, miR-30a-3p, and miR-30c-5p, indicates that the treatment administered to the subject was effective.
[0038] In some embodiments of any of the methods described herein, the subject is a human, and the one or more miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p. In some embodiments of any of the methods described herein, one or more of: an elevation in the second level of one or more of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, and/or a decrease in the second level of one or more of the human homologues of mouse miR-130a-3p, miR-126-3p, miR-346-3p, miR-30a-3p, and miR-30c-5p, as compared to the first level(s) of one or more of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-130a-3p, miR-126-3p, miR-346-3p, miR-30a-3p, and miR-30c-5p, indicates that the treatment administered to the subject was effective.
[0039] In some embodiments of any of the methods described herein, the treatment for reducing radiation-induced damage is selected from the group of: cytokines, potassium iodide, Prussian blue, diethylenetriamine pentaacetic acid, bone marrow transplantation, blood transfusion, and surgery to remove damaged tissues. In some embodiments of any of the methods described herein, the cytokines are selected from the group of granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim.
[0040] In some embodiments of any of the methods described herein, the first and second level(s) of the one or more miRNAs in the samples are determined in steps (a) and (c) by amplifying the miRNAs present in the sample(s) to generate amplification products, contacting the amplified products to a substrate, and detecting the amplified products bound to the substrate.
[0041] Also provided are methods for determining the efficacy of a treatment for reducing radiation-induced damage in a subject exposed to a significant level of radiation that include: (a) determining a level of one or more miRNAs in a sample including a biological fluid from a subject previously exposed to a significant level of radiation and thereafter administered a treatment for reducing radiation-induced damage; (b) comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs; and (c) determining efficacy of the treatment for reducing radiation-induced damage in the subject based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0042] In some embodiments of any of the methods described herein, the subject is a mouse and the one or more miRNAs are selected from the group of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p. In some embodiments of any of the methods described herein, one or more of: an elevated level of one or more of mouse miR-130a-3p, miR-34-3p, miR-126-3p, miR-30a-3p, and miR-30c-5p, and/or a decreased level of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, in the sample, as compared to the reference level(s), indicates that treatment was not effective, or a non-elevated level of mouse miR-130a-3p, miR-34-3p, miR-126-3p, miR-30a-3p, and miR-30c-5p, and a non-decreased level of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, in the sample, as compared to the reference level(s), indicates that treatment was effective. In some embodiments of any of the methods described herein, the reference level(s) for mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p are the level(s) of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to a significant level of radiation and not administered a treatment or not administered an effective treatment, or a control subject that was exposed to a significant level of radiation and administered an effective treatment.
[0043] In some embodiments of any of the methods described herein, the subject is a human and the one or more miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p. In some embodiments of any of the methods described herein, one or more of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-34-3p, miR-126-3p, miR-30a-3p, and miR-30c-5p, and/or a decreased level of one or more of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, in the sample, as compared to the reference level(s), indicates that treatment was not effective, or a non-elevated level of the human homologues of mouse miR-130a-3p, miR-34-3p, miR-126-3p, miR-30a-3p, and miR-30c-5p, and a non-decreased level of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, in the sample, as compared to the reference level(s), indicates that treatment was effective. In some embodiments of any of the methods described herein, the reference level(s) for the human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p, are the level(s) of the reference level(s) of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to a significant level of radiation and not administered a treatment or not administered an effective treatment, or a control subject that was exposed to a significant level of radiation and administered an effective treatment.
[0044] In some embodiments of any of the methods described herein, the biological fluid is selected from the group of: blood, plasma, serum, saliva, or urine. In some embodiments of any of the methods described herein, the level(s) of the one or more miRNAs in the sample is determined in step (a) by amplifying the miRNAs present in the sample to generate amplification products, contacting the amplified products to a substrate, and detecting the amplified products bound to the substrate.
[0045] Also provided are kits consisting or consisting essentially of one or more of: (i) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-130a-3p; (ii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-150-5p; (iii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-17-3p; (iv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-187-3p; (v) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-194-5p; (vi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-27a-3p; (vii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-30a-3p; and (viii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-30c-5p.
[0046] Some embodiments of any of the kits described herein further include one or more of: (ix) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-142-5p; (x) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-342-3p; (xi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-34b-3p; (xii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-126-3p; (xiii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-320-3p; (xiv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-136-5p; (xv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-33-5p; (xvi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-142a-3p; (xvii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-706; (xviii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-375-3p; (xix) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-29a-5p; (xx) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-193a-3p; (xxi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-99b-5p; (xxii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-151-3p; (xxiii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-let-7d-3p; (xxiv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-486-5p; (xxv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-423-5p; (xxvi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-30b-5p; (xxvii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-191-5p; (xxviii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-497a-5p; (xxix) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-32-5p; (xxx) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-214-5p; (xxxi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-326-3p; (xxxii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-1195; (xxxiii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-122-5p; (xxxiv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-1839-3p; (xxxv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-500-3p; (xxxvi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-30e-3p; (xxxvii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-322-3p; (xxxviii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-709; (xxxix) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-486a-3p; (xxxx) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-133a-3p; (xxxxi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-676-3p; (xxxxii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-744-5p; (xxxxiii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-29a-3p; (xxxxiv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-1839-5p; (xxxxv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-30a-5p; (xxxxvi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-199b-5p; (xxxxvii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-125a-5p; (xxxxviii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-133b-3p; (il) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-24-3p; (1) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-21a-5p; (li) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-503-5p; (lii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-328-3p; (liii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-let-7g-5p; (liv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-362-3p; (lv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-199a-5p; (lvi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-15a-3p; (lvii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-139-5p; (lviii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-149-5p; (lix) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-29b-3p; (lx) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-1a-3p; (lxi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-23b-3p; (lxii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-215-5p; (lxiii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-204-5p; (lxiv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-200b-5p; (lxv) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-25-3p; (lxvi) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-338-3p; and (lxvii) at least one nucleic acid including a sequence that is complementary to all or a part of the sequence of the human homolog of mouse miR-196b-5p.
[0047] In some embodiments of any of the kits described herein, one or more of the nucleic acid of (i) through (lxvii) is bound to a substrate. In some embodiments of any of the kits described herein, the substrate is a chip, slide, or film.
[0048] As used herein, the word "a" before a noun represents one or more of the particular noun. For example, the phrase "a level" represents "one or more levels."
[0049] The term "subject" means any mammal, e.g., such as a human, a monkey, a mouse, a rat, a rabbit, or a goat. A subject can be, e.g., a subject suspected of being exposed to a significant dose of radiation or a subject known to have been exposed to a significant dose of radiation. Additional examples of subjects are described herein.
[0050] The term "biological fluid" refers to any fluid produced by the body of a subject (e.g., any of the subjects described herein). Non-limiting examples of biological fluids include serum, plasma, blood, urine, feces, saliva, lymph, sweat, tears, bile, cerebrospinal fluid, chyle, aqueous humour, endolymph, perilymph, exudate, and mucus.
[0051] The phrase "level of exposure to radiation" represents the cumulative dose of radiation that a subject has been exposed to during a specific period of time (e.g., a period of time that includes a suspected or confirmed leakage of a high level of radiation into the environment or includes a suspected or confirmed exposure of a subject to a high level of radiation). For example, a specific period of time can include a period of time between about 1 minute and about four weeks, between about 1 minute to about three weeks, between about 5 minutes to about two weeks, between about 1 minute to about one week, between about 1 minute to about 6 days, between about 1 minute to about 5 days, between about 1 minute to about 4 days, between about 1 minute to about 3 days, between about 1 minute to about 2 days, between about 1 minute to about 1 day, between about 1 minute to about 12 hours, between about 1 minute to about 6 hours, between about 1 minute to about 4 hours, between about 1 minute to about 3 hours, between about 1 minute to about 2 hours, between about 1 minute to about 1 hour, between about 1 minute to about 30 minutes, between about 1 minute to about 20 minutes, between about 1 minute to about 15 minutes, between about 1 minute to about 10 minutes, or between about 1 minute to about 5 minutes. In some examples, a period of time can includes a suspected or confirmed leakage of a high level of radiation into the environment, e.g., as a result of detonation of a nuclear bomb, a leakage of a high level of radiation from a nuclear energy facility, irradiation of the body of a subject having a disease (e.g., cancer) in order to treat the disease (e.g., cancer), or as a result of working or living near a nuclear energy facility or a nuclear waste site.
[0052] The phrase "significant dose of radiation" is art known and refers to a cumulative dose of radiation over a specific period of time (e.g., a period of time that includes a suspected or confirmed leakage of a high level of radiation into the environment or includes a suspected or confirmed exposure of a subject to a high level of radiation) that is greater than a cumulative dose of background radiation from radioisotopes in the natural environment (e.g., radioisotopes present in the earth and radioisotopes present in the earth's atmosphere) that a subject has been exposed to over a similar control period of time (e.g., a period of time that does not include a suspected or confirmed leakage of a high level of radiation into the environment and does not include a suspected or confirmed exposure of a subject to a high level of radiation).
[0053] The phrase "treatment for reducing radiation-induced damage" is art known and means a treatment administered to a subject for the purpose of reducing the number, severity, development, and/or rate of development of one or more (e.g., two, three, four, or five) symptoms of radiation disease in a subject. Examples of symptoms of radiation disease are described herein. Non-limiting examples of treatments for reducing radiation-induced damage are described herein. Additional examples of treatments for reducing radiation-induced damage are known in the art. Exemplary methods for determining the efficacy of treatment for reducing radiation-induced damage in a subject exposed to a significant dose of radiation are also provided herein.
[0054] The phrase "risk of poor prognosis from radiation exposure" is art known and means a subject's risk of developing a severe form of radiation disease in the future (e.g., between 1 day and 5 years, between 1 day and 4 years, between 1 day and 3 years, between 1 day and 2 years, between 1 day and 1 year, between 1 day and 10 months, between 1 day and 8 months, between 1 day and 6 months, between 1 day and 5 months, between 1 day and 4 months, between 1 day and 3 months, between 1 day and 2 months, between 1 day and 7 weeks, between 1 day and 6 weeks, between 1 day and 5 weeks, between 1 day and 1 month, between 1 day and 3 weeks, between 1 day and 2 weeks, or between 1 day and 1 week) as compared to the risk in a control subject (e.g., a subject not exposed to a significant dose of radiation). Symptoms of a severe form of radiation disease include, e.g., one or more of a decrease in the number of bone marrow stromal cells, a decrease in the number of hematopoietic progenitor cells (HPCs), a decrease in the number of hematopoietic stem cells (HSCs), a decrease in the number of T-cells, a decrease in the number of B-cells, a decrease in the number of neutrophils, a decrease in the level of platelets, a decrease in the level of hemoglobin, a decrease in the complete blood count (CBC), a decrease in the colony-forming units in culture (CFU-C), a decrease in the bone marrow mononuclear cells (BM-MNCs), a decrease in total white blood cell count, an increase in the risk of infection, and an increased in the risk of death, e.g., as compared to the numbers/levels of bone marrow stromal cells, HPCs, HSCs, T-cells, B-cells, neutrophils, platelets, hemoglobin, CBC, CFUs, CFU-C, BM-MNCs, and total white blood cell count, and the risk of infection and risk of death in a control subject (e.g., a subject not exposed to a significant dose of radiation). Exemplary methods of determining a subject's risk of poor prognosis from radiation exposure are described herein.
[0055] The phrase "risk of subsequent development of radiation disease" is art known and means a subject's later risk (e.g., between 1 day and 5 years, between 1 day and 4 years, between 1 day and 3 years, between 1 day and 2 years, between 1 day and 1 year, between 1 day and 10 months, between 1 day and 8 months, between 1 day and 6 months, between 1 day and 5 months, between 1 day and 4 months, between 1 day and 3 months, between 1 day and 2 months, between 1 day and 7 weeks, between 1 day and 6 weeks, between 1 day and 5 weeks, between 1 day and 1 month, between 1 day and 3 weeks, between 1 day and 2 weeks, or between 1 day and 1 week) of developing radiation disease as compared to the risk in a control subject (e.g., a subject not exposed to a significant dose of radiation) (e.g., over a similar time period). Exemplary methods for determining a subject's risk of subsequent development of radiation disease are described herein.
[0056] The term "triaging" is art known and means evaluating a plurality of subjects in order to prioritize the subjects for treatment by a physician. Triaging can, e.g., be based on the severity of each subject's exposure to radiation (e.g., as determined using any of the methods described herein). Exemplary methods for triaging a plurality of subjects having been exposed or suspected of having been exposed to radiation are described herein.
[0057] The phrase "efficacy of treatment" is art known and means the absence or a reduction in the level of one or more (e.g., two, three, or four) of the number, severity, development, and/or rate of development of one or more (e.g., two, three, four, or five) symptoms of radiation disease in a subject and/or the absence or a reduction in a subject's risk of subsequent development of radiation disease (e.g., as compared to a subject that has been exposed to a similar level of radiation and has received a different treatment or no treatment). Exemplary methods for determining the efficacy of a treatment for reducing radiation-induced damage in a subject are described herein.
[0058] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0059] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
DESCRIPTION OF DRAWINGS
[0060] FIG. 1 is a Kaplan-Meier survival curve of C57BL/6J male mice (n=20 per group) exposed to 0 Gy- (control), 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The data were analyzed by Log-rank (Mantel-Cox) test.
[0061] FIG. 2 is a graph showing the total white blood cell count in C57BL/6J mice at 1 day, 7 days, 15 days, or 30 days after 0 Gy- (control), 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation (n=5 mice per group per time point).
[0062] FIG. 3 is a graph showing the hemoglobin levels in C57BL/6J mice at 1 day, 7 days, 15 days, or 30 days after 0 Gy- (control), 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation (n=5 mice per group per time point).
[0063] FIG. 4 is a graph showing the platelet levels in C57BL/6J mice at 1 day, 7 days, 15 days, or 30 days after 0 Gy- (control), 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation (n=5 mice per group per time point).
[0064] FIG. 5 is a schematic of an experiment where C57BL/6J mice were exposed to total body irradiation at 0 Gy- (control), 2 Gy-, 6.5 Gy-, or 8 Gy-, and sacrificed 24 hours, 7 days, 15 days, 30 days, or 3 months later. Bone marrow was collected from each sacrificed mouse and the levels of bone marrow-mononuclear cells (BM-MNCs), colony forming units in culture (CFU-C), lineage-negative, Sca1-positive, c-kit-negative (LSK.sup.-) cells, and LKS.sup.+ cells were determined in the collected bone marrow.
[0065] FIG. 6 is a graph showing the number of bone marrow mononuclear cells (BM-MNCs) in millions per hind limb in bone marrow collected from mice 24 hours after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.01, **; p<0.001, ***; not significant, n.s.
[0066] FIG. 7 is a graph showing the number of BM-MNCs (in millions) per hind limb in bone marrow collected from mice 7 days after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.001, ***; not significant, n.s.
[0067] FIG. 8 is a graph showing the number of BM-MNCs (in millions) per hind limb in bone marrow collected from mice 15 days after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.01, **; p<0.001, ***; not significant, n.s.
[0068] FIG. 9 is a graph showing the number of BM-MNCs (in millions) per hind limb in bone marrow collected from mice one month after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.001, ***; not significant, n.s.
[0069] FIG. 10 is a graph showing the number of BM-MNCs (in millions) per hind limb in bone marrow collected from mice three months after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. Not significant, n.s.
[0070] FIG. 11 is a graph showing the number of colony forming units in culture (CFU-Cs) (in thousands) per hind limb in bone marrow collected from mice 24 hours after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.01, **; not significant, n.s.
[0071] FIG. 12 is a graph showing the number of CFU-Cs (in thousands) per hind limb in bone marrow collected from mice 7 days after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.01, **; p<0.001, ***; not significant, n.s.
[0072] FIG. 13 is a graph showing the number of CFU-Cs (in thousands) per hind limb in bone marrow collected from mice 15 days after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.01, **; not significant, n.s.
[0073] FIG. 14 is a graph showing the number of CFU-Cs (in thousands) per hind limb in bone marrow collected from mice one month after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.01, **.
[0074] FIG. 15 is a graph showing the number of CFU-Cs (in thousands) per hind limb in bone marrow collected from mice three months after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. Not significant, n.s.
[0075] FIG. 16 is a graph showing the number of lineage-negative, Sca1-positive, c-kit-negative (LSK.sup.-) cells (in thousands) per hind limb in bone marrow collected from mice 24 hours after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.01, **; not significant, n.s.
[0076] FIG. 17 is a graph showing the number of LSK.sup.- cells (in thousands) per hind limb in bone marrow collected from mice 7 days after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.01, **; not significant, n.s.
[0077] FIG. 18 is a graph showing the number of LSK.sup.- cells (in thousands) per hind limb in bone marrow collected from mice 15 days after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.001, ***; p<0.0001, ****; not significant, n.s.
[0078] FIG. 19 is a graph showing the number of LSK.sup.- cells (in thousands) per hind limb in bone marrow collected from mice one month after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.01, **; p<0.001, ***.
[0079] FIG. 20 is a graph showing the number of LSK.sup.- cells (in thousands) per hind limb in bone marrow collected from mice three months after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.01, **; not significant, n.s.
[0080] FIG. 21 is a graph showing the number of LSK.sup.+ cells (in thousands) per hind limb in bone marrow collected from mice 24 hours after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.01, **; not significant, n.s.
[0081] FIG. 22 is a graph showing the number of LSK.sup.+ cells (in thousands) per hind limb in bone marrow collected from mice 7 days after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.01, **; p<0.001, ***; not significant, n.s.
[0082] FIG. 23 is a graph showing the number of LSK.sup.+ cells (in thousands) per hind limb in bone marrow collected from mice 15 days after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.001, ***; not significant, n.s.
[0083] FIG. 24 is a graph showing the number of LW.sup.+ cells (in thousands) per hind limb in bone marrow collected from mice one month after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.05, *; p<0.01, **.
[0084] FIG. 25 is a graph showing the number of LW.sup.+ cells (in thousands) per hind limb in bone marrow collected from mice three months after 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation. The error bars represent .+-.standard error of the mean. All pairwise comparisons were performed by one-way ANOVA followed by Tukey's test. The horizontal bars with asterisks represent statistically significant comparisons. P<0.01, **; p<0.001, ***; not significant, n.s.
[0085] FIG. 26 is a schematic of an experiment where CD 45.2.sup.+ bone marrow is collected from mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation, the LKS.sup.+ cells were isolated from the bone marrow by fluorescence-assisted cell sorting (FACS), 2000 sorted LKS.sup.+ cells or 500,000 whole bone marrow cells were mixed with CD45.1.sup.+ bone marrow support cells from non-experimentally-irradiated mice, the mixture transplanted into lethally-irradiated CD 45.1.sup.+ recipient mice (n=5 per group), and the chimerism of CD45.1.sup.+ and CD45.2.sup.+ leukocytes determined at 1 and 4 months after transplantation of the mixture into the lethally-irradiated recipient mice.
[0086] FIG. 27 shows a set of three, two-dimensional FACS profiles of stained bone marrow collected from donor CD45.2.sup.+ mice three months after their exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation (and later used to sort LKS.sup.+ or whole bone marrow cells for transplantation). Each horizontal set of three, two-dimensional FACS profiles show, from left to right, the total scatter (side scatter and forward scatter), lineage.sup.-, and LKS.sup.+ gates. For LKS (lineage, cKit, Sca1) staining to visualize hematopoietic precursor cells and hematopoietic stem cells, whole bone marrow was stained with biotinylated anti-lineage cocktail (anti-Mac1, Gr-1, CD3e, B220, and Ter119), APC-conjugated anti-cKit (clone 2B8), and PECy7-conjugated anti-Sca1 (clone D7) antibodies. Following primary antibody staining, the cells were washed and incubated in PE-conjugated streptavidin secondary antibody to visualize lineage positive cells. All primary and secondary antibodies were obtained from BD Biosciences.
[0087] FIG. 28 is a pair of graphs showing the number of donor-derived (CD45.2.sup.+) LKS.sup.+ cells and the number of donor-derived (CD45.2.sup.+) whole bone marrow cells in the peripheral blood of lethally-irradiated CD45.1.sup.+ recipient mice one month after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells or 500,000 whole bone marrow cells obtained from a CD45.2.sup.+ donor mouse three months after exposure to 0 Gy-, 2 Gy-, or 6.5-Gy irradiation, and (2) bone marrow support cells from non-irradiated CD45.1.sup.+ mice. The error bars represent .+-.the standard error of the mean. All pairwise comparisons were computed using one-way ANOVA followed by Tukey's test. Asterisks represent statistically significant comparisons. P<0.01, **; p<0.001, ***; p<0.0001, ****.
[0088] FIG. 29 is a pair of graphs showing the number of donor-derived (CD45.2.sup.+) LKS.sup.+ cells and the number of donor-derived (CD45.2.sup.+) whole bone marrow cells in the peripheral blood of lethally-irradiated CD45.1.sup.+ recipient mice four months after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells or 500,000 whole bone marrow cells obtained from a CD45.2.sup.+ donor mouse three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy- total body irradiation, and (2) bone marrow support cells from non-irradiated CD45.1.sup.+ mice. The error bars represent .+-.the standard error of the mean. All pairwise comparisons were computed using one-way ANOVA followed by Tukey's test. Asterisks represent statistically significant comparisons. P<0.001, ***; p<0.0001, ****.
[0089] FIG. 30 is three sets of two-dimensional FACS profiles of total leukocytes, T-cells, B-cells, and myeloid cells (recipient leukocytes, CD45.1.sup.+; T-cells, CD3e; B-cells, B220.sup.+; and myeloid cells, Mac1/Gr1.sup.+) (top to bottom, respectively) in the peripheral blood of recipient mice one month after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells collected from donor CD45.2.sup.+ mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation (left to right, respectively) and (2) 250,000 CD45.1.sup.+ bone marrow support cells (right panels, middle panels, and left panels, respectively).
[0090] FIG. 31 is a graph showing the percentage of donor-derived CD45.2.sup.+ T-cells in a recipient CD45.1.sup.+ mouse one month after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells collected from donor CD45.2.sup.+ mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Error bars represent .+-.the standard error of the mean. All pairwise comparisons were computed using one-way ANOVA followed by Tukey's test. Asterisks represent significant comparisons. P<0.001, ***; p<0.0001, ****.
[0091] FIG. 32 is a graph showing the percentage of donor-derived CD45.2.sup.+ B-cells in a recipient CD45.1.sup.+ mouse one month after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells collected from donor CD45.2.sup.+ mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Error bars represent .+-.the standard error of the mean. All pairwise comparisons were computed using one-way ANOVA followed by Tukey's test. Asterisks represent significant comparisons. P<0.01, **.
[0092] FIG. 33 is a graph showing the percentage of donor-derived CD45.2.sup.+ myeloid cells in a recipient CD45.1.sup.+ mouse one month after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells collected from donor CD45.2.sup.+ mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Error bars represent .+-.the standard error of the mean. All pairwise comparisons were computed using one-way ANOVA followed by Tukey's test. Asterisks represent significant comparisons. P<0.0001, ****.
[0093] FIG. 34 is three sets of two-dimensional FACS profiles of total leukocytes, T-cells, B-cells, and myeloid cells (recipient leukocytes, CD45.1.sup.+; T-cells, CD3e; B-cells, B220.sup.+; and myeloid cells, Mac1/Gr1.sup.+) (top to bottom, respectively) in the peripheral blood of recipient CD45.1.sup.+ mice four months after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells collected from donor CD45.2.sup.+ mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation (left to right, respectively) and (2) 250,000 CD45.1.sup.+ bone marrow support cells.
[0094] FIG. 35 is a graph showing the percentage of donor-derived CD45.2.sup.+ T-cells in a recipient CD45.1.sup.+ mouse four months after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells collected from donor CD45.2.sup.+ mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Error bars represent .+-.the standard error of the mean. All pairwise comparisons were computed using one-way ANOVA followed by Tukey's test. Asterisks represent significant comparisons. P<0.001, ***; p<0.0001, ****.
[0095] FIG. 36 is a graph showing the percentage of donor-derived CD45.2.sup.+ B-cells in a recipient CD45.1.sup.+ mouse four months after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells collected from donor CD45.2.sup.+ mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Error bars represent .+-.the standard error of the mean. All pairwise comparisons were computed using one-way ANOVA followed by Tukey's test. Asterisks represent significant comparisons. P<0.01, **.
[0096] FIG. 37 is a graph showing the percentage of donor-derived CD45.2.sup.+ myeloid cells in a recipient CD45.1.sup.+ mouse four months after transplantation with a mixture of (1) 2000 sorted LKS.sup.+ cells collected from donor CD45.2.sup.+ mice three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Error bars represent .+-.the standard error of the mean. All pairwise comparisons were computed using one-way ANOVA followed by Tukey's test. Asterisks represent significant comparisons. P<0.0001, ****.
[0097] FIG. 38 is a pair of graphs of the percentage of donor-derived CD45.2.sup.+ T-cells in the peripheral blood of a recipient CD45.1.sup.+ mouse one month (left graph) or four months (right graph) after transplantation with a mixture of (1) 500,000 bone marrow support cells from a donor CD45.2.sup.+ mouse three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Asterisks represent statistically significant comparisons. One-way ANOVA followed by Tukey's test for multiple comparisons was used to assess statistical significance. P<0.05, *; p<0.01, **; p<0.0001, ****; not significant, n.s.
[0098] FIG. 39 is a pair of graphs of the percentage of donor-derived CD45.2.sup.+ B-cells in the peripheral blood of a recipient CD45.1.sup.+ mouse one month (left graph) or four months (right graph) after transplantation with a mixture of (1) 500,000 whole bone marrow cells from a donor CD45.2.sup.+ mouse three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Asterisks represent statistically significant comparisons. One-way ANOVA followed by Tukey's test for multiple comparisons was used to assess statistical significance. P<0.01, **; p<0.0001, ****.
[0099] FIG. 40 is a pair of graphs of the percentage of donor-derived CD45.2.sup.+ myeloid cells in the peripheral blood of a recipient CD45.1.sup.+ mouse one month (left graph) or four months (right graph) after transplantation with a mixture of (1) 500,000 whole bone marrow cells from a donor CD45.2.sup.+ mouse three months after exposure to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and (2) 250,000 CD45.1.sup.+ bone marrow support cells. Asterisks represent statistically significant comparisons. One-way ANOVA followed by Tukey's test for multiple comparisons was used to assess statistical significance. P<0.01, **; p<0.001, ***; p<0.0001, ****; not significance, n.s.
[0100] FIG. 41 is a heatmap showing the changes in expression levels of serum miRNAs that are significantly altered in samples from mice exposed to 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation as compared to non-irradiated controls (0 Gy). Hierarchical clustering was performed to depict the relationship between the samples.
[0101] FIG. 42 is a heatmap showing the changes in expression levels of serum miRNAs that are significantly altered in samples from mice exposed to 2 Gy-total body irradiation as compared to non-irradiated controls (0 Gy). Hierarchical clustering was performed to depict the relationship between the samples. Normalization of profiling data was performed by computing the global mean of 170 miRNAs expressed in all samples.
[0102] FIG. 43 is a graph showing the relative levels of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-706, and miR-342-3p in serum samples harvested from mice 24 hours after exposure to 0 Gy- or 2 Gy-whole body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *; p<0.01, **; p<0.001, ***; p<0.0001, ****; not significant, n.s.
[0103] FIG. 44 is a graph showing the relative levels of mouse miR-130a-3p in serum samples harvested from mice 24 hours or 7 days after exposure to 0 Gy- or 2 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *.
[0104] FIG. 45 is a graph showing the relative levels of mouse miR-142-5p in serum samples harvested from mice 24 hours or 7 days after exposure to 0 Gy- or 2 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *.
[0105] FIG. 46 is a graph showing the relative levels of mouse miR-150-5p in serum samples harvested from mice 24 hours or 7 days after exposure to 0 Gy- or 2 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *.
[0106] FIG. 47 is a graph showing the relative levels of mouse miR-706 in serum samples harvested from mice 24 hours or 7 days after exposure to 0 Gy- or 2 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean.
[0107] FIG. 48 is a graph showing the relative levels of mouse miR-342-3p in serum samples harvested from mice 24 hours or 7 days after exposure to 0 Gy- or 2 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. The asterisk represents a statistically significant comparison. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *.
[0108] FIG. 49 is a heatmap showing the changes in expression levels of miRNAs that are significantly altered in serum samples from mice exposed to 6.5 Gy-total body irradiation as compared to mice exposed to 2 Gy-total body irradiation. Hierarchical clustering was performed to depict the relationship between the samples. Normalization of profiling data was performed by computing the global mean of 170 miRNAs expressed in all serum samples.
[0109] FIG. 50 is a graph showing the relative levels of mouse miR-34b-3p, miR-322-3p, miR-126-3p, miR-17-3p, and miR-136-5p in serum samples harvested from mice 24 hours after exposure to 2 Gy- or 6.5 Gy-whole body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.001, ***; p<0.0001, ****; not significant, n.s.
[0110] FIG. 51 is a graph showing the relative levels of mouse miR-17-3p in serum samples harvested from mice 24 hours or 7 days after exposure to 2 Gy- or 6.5 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Statistical significance was assessed using two-tailed Student's t test. P<0.01, **; p<0.05, *.
[0111] FIG. 52 is a graph showing the relative levels of mouse miR-126-3p in serum samples harvested from mice 24 hours or 7 days after exposure to 2 Gy- or 6.5 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Statistical significance was assessed using two-tailed Student's t test. P<0.01, **.
[0112] FIG. 53 is a graph showing the relative levels of mouse miR-322-3p in serum samples harvested from mice 24 hours or 7 days after exposure to 2 Gy- or 6.5 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean.
[0113] FIG. 54 is a graph showing the relative levels of mouse miR-34b-3p in serum samples harvested from mice 24 hours or 7 days after exposure to 2 Gy- or 6.5 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Statistical significance was assessed using two-tailed Student's t test. P<0.001, ***; p<0.05, *.
[0114] FIG. 55 is a graph showing the relative levels of mouse miR-136-5p in serum samples harvested from mice 24 hours or 7 days after exposure to 2 Gy- or 6.5 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean.
[0115] FIG. 56 is a heatmap showing the changes in the expression levels of miRNAs that are significantly altered in serum samples from mice exposed to 8.0 Gy-total body irradiation as compared to mice exposed to 6.5 Gy-total body irradiation. Hierarchical clustering was performed to depict the relationship between the samples. Normalization of profiling data was performed by computing the global mean of 170 miRNAs expressed in all serum samples.
[0116] FIG. 57 is a graph showing the relative levels of mouse miR-187-3p, miR-194-5p, and miR-27a-3p in serum samples harvested from mice 24 hours after exposure to 6.5 Gy- or 8 Gy-whole body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.01, **; p<0.001, ****.
[0117] FIG. 58 is a graph showing the relative levels of mouse miR-30a-3p and miR-30c-5p in serum samples harvested from mice 24 hours after exposure to 6.5 Gy- or 8 Gy-whole body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. The asterisk represents a statistically significant comparison. Statistical significance was assessed using two-tailed Student's t test. P<0.01, **.
[0118] FIG. 59 is a graph showing the relative levels of mouse miR-187-3p in samples harvested from mice 24 hours, 3 days, or 7 days after exposure to 6.5 Gy- or 8 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. The asterisk represents a statistically significant comparison. Statistical significance was assessed using two-tailed Student's t test. P<0.001, ***.
[0119] FIG. 60 is a graph showing the relative levels of mouse miR-194-5p in serum samples harvested from mice 24 hours, 3 days, or 7 days after exposure to 6.5 Gy- or 8 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *; p<0.001, ***.
[0120] FIG. 61 is a graph showing the relative levels of mouse miR-30c-5p in serum samples harvested from mice 24 hours, 3 days, or 7 days after exposure to 6.5 Gy- or 8 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *; P<0.001, ***.
[0121] FIG. 62 is a graph showing the relative levels of mouse miR-27a-3p in samples harvested from mice 24 hours, 3 days, or 7 days after exposure to 6.5 Gy- or 8 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. Asterisks represent statistically significant comparisons. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *; p<0.01, **.
[0122] FIG. 63 is a graph showing the relative levels of mouse miR-30a-3p in serum samples harvested from mice 24 hours, 3 days, or 7 days after exposure to 6.5 Gy- or 8 Gy-total body irradiation. The data are representative of three experiments. Error bars represent .+-.the standard error of the mean. The asterisk represents a statistically significant comparison. Statistical significance was assessed using two-tailed Student's t test. P<0.05, *.
[0123] FIG. 64 is a schematic of an experiment where mice are intraperitoneally administered saline or amifostine (250 mg/kg) 24 hours prior to exposure to 0 Gy- to 8 Gy-total body irradiation, serum collected from the mice 24 hours later, and the expression levels of serum miRNAs determined.
[0124] FIG. 65 is a Kaplan-Meier survival curve of mice treated with saline 24 hours prior to exposure to 0 Gy- to 8 Gy-total body irradiation, or mice treated with amifostine (250 mg/kg) 24 hours prior to exposure to 0 Gy- to 8 Gy-total body irradiation. The asterisk represents a statistically significant comparison. P>0.05, *.
[0125] FIG. 66 is a graph showing the levels of mouse miR-187-3p in serum from mice treated with saline 24 hours prior to exposure to 0 Gy- or 8 Gy-total body irradiation, or in serum from mice treated with amifostine (250 mg/kg) 24 hours prior to exposure to 0 Gy- to 8 Gy-total body irradiation. Serum was collected 48 hours after administration of saline or amifostine to the mice. The data shown are the mean.+-.the standard error of the mean. Statistical significance was measured by one-way ANOVA followed by Dunnett's test. The asterisk identifies a statistically significant comparison. P<0.05, *.
[0126] FIG. 67 is a graph showing the levels of mouse miR-194-5p in serum from mice treated with saline 24 hours prior to exposure to 0 Gy- or 8 Gy-total body irradiation, or mice treated with amifostine (250 mg/kg) 24 hours prior to exposure to 0 Gy- to 8 Gy-total body irradiation. Serum was collected 48 hours after administration of saline or amifostine to the mice. The data shown are the mean.+-.the standard error of the mean. Statistical significance was measured by one-way ANOVA followed by Dunnett's test. The asterisk identifies a statistically significant comparison. P<0.001, ***.
[0127] FIG. 68 is a graph showing the levels of mouse miR-27a-3p in serum from mice treated with saline 24 hours prior to exposure to 0 Gy- or 8 Gy-total body irradiation, or mice treated with amifostine (250 mg/kg) 24 hours prior to exposure to 0 Gy- to 8 Gy-total body irradiation. Serum was collected 48 hours after administration of saline or amifostine to the mice. The data shown are the mean.+-.the standard error of the mean. Statistical significance was measured by one-way ANOVA followed by Dunnett's test. The asterisk identifies a statistically significant comparison. P<0.05, *.
[0128] FIG. 69 is a graph showing the levels of mouse miR-30a-3p in serum from mice treated with saline 24 hours prior to exposure to 0 Gy- or 8 Gy-total body irradiation, or mice treated with amifostine (250 mg/kg) 24 hours prior to exposure to 0 Gy- to 8 Gy-total body irradiation. Serum was collected 48 hours after administration of saline or amifostine to the mice. The data shown are the mean.+-.the standard error of the mean. Statistical significance was measured by one-way ANOVA followed by Dunnett's test. The asterisk identifies a statistically significant comparison. P<0.0001, ****.
[0129] FIG. 70 is a graph showing the levels of mouse miR-30c-5p in serum from mice treated with saline 24 hours prior to exposure to 0 Gy- or 8 Gy-total body irradiation, or mice treated with amifostine (250 mg/kg) 24 hours prior to exposure to 0 Gy- to 8 Gy-total body irradiation. Serum was collected 48 hours after administration of saline or amifostine to the mice. The data shown are the mean.+-.the standard error of the mean. Statistical significance was measured by one-way ANOVA followed by Dunnett's test. The asterisk identifies a statistically significant comparison. P<0.05, *.
[0130] FIG. 71 is a graph showing the comparison of the relative expression ratios of miRNAs in serum samples from mice exposed to 6.5 Gy- or 8.0 Gy-from two separate experiments (the data in FIGS. 56-53 and FIGS. 59-65).
[0131] FIG. 72 is a Kaplan-Meier survival curve of mice treated with saline 45 minutes prior to exposure to 0 Gy- to 8.5 Gy-total body irradiation, or mice treated with amifostine (200 mg/kg) 45 minutes prior to exposure to 0 Gy- to 8.5 Gy-total body irradiation. Ten mice were included in each group. The asterisk represents a statistically significant comparison. P<0.0001, ****.
[0132] FIG. 73 is a graph showing the levels of mouse miR-187-3p in serum from mice exposed to 0 Gy- or 8.5 Gy-total body irradiation 45 minutes after administration of saline or 200 mg/kg amifostine. The mean.+-.the standard error of the mean are shown. The asterisk represents a statistically significant comparison. P<0.01, **. Statistical significance was measured by one-way ANOVA followed by Dunnett's test.
[0133] FIG. 74 is a graph showing the levels of mouse miR-194-5p in serum from mice exposed to 0 Gy- or 8.5 Gy-total body irradiation 45 minutes after administration of saline or 200 mg/kg amifostine. The mean.+-.the standard error of the mean are shown. The asterisk represents a statistically significant comparison. P<0.01, **. Statistical significance was measured by one-way ANOVA followed by Dunnett's test.
[0134] FIG. 75 is a graph showing the levels of mouse miR-27a-3p in serum from mice exposed to 0 Gy- or 8.5 Gy-total body irradiation 45 minutes after administration of saline or 200 mg/kg amifostine. The mean.+-.the standard error of the mean are shown. The asterisk represents a statistically significant comparison. P<0.01, **. Statistical significance was measured by one-way ANOVA followed by Dunnett's test.
[0135] FIG. 76 is a graph showing the levels of mouse miR-30a-3p in serum from mice exposed to 0 Gy- or 8.5 Gy-total body irradiation 45 minutes after administration of saline or 200 mg/kg amifostine. The mean.+-.the standard error of the mean are shown. The asterisk represents a statistically significant comparison. P<0.001, ***. Statistical significance was measured by one-way ANOVA followed by Dunnett's test.
[0136] FIG. 77 is a graph showing the levels of mouse miR-30c-5p in serum from mice exposed to 0 Gy- or 8.5 Gy-total body irradiation 45 minutes after administration of saline or 200 mg/kg amifostine. The mean.+-.the standard error of the mean are shown. The asterisk represents a statistically significant comparison. P<0.01, **. Statistical significance was measured by one-way ANOVA followed by Dunnett's test.
[0137] FIG. 78 is a Kaplan-Meier survival curve of mice exposed to 0 Gy-total body irradiation and untreated, or mice exposed to 10.4 Gy-total body irradiation and left untreated or treated with two doses with 2 million bone marrow stromal cells per mouse (24 hours and 72 hours after total body irradiation). Survival was monitored for up to 30 days. The asterisk represents a statistically significant comparison. P<0.01, **.
[0138] FIG. 79 is a graph showing the levels of mouse miR-150-5p in mice exposed to 0 Gy-total body irradiation and untreated, or mice exposed to 10.4 Gy-total body irradiation and left untreated or treated with two doses of 2 million bone marrow stromal cells per mouse (24 hours and 72 hours after total body irradiation). Serum samples were obtained 48 hours after the second administration of bone marrow stromal cells. The mean.+-.the standard error of the mean are shown. Statistical significance assessed using one-way ANOVA followed by Tukey's test for multiple comparisons. Asterisks identify statistically significant comparisons. P<0.05, *; p<0.01, **; not significant, n.s.
[0139] FIG. 80 is a graph showing the levels of mouse miR-27a-3p in mice exposed to 0 Gy-total body irradiation and untreated, or mice exposed to 10.4 Gy-total body irradiation and left untreated or treated with two doses of 2 million bone marrow stromal cells per mouse (24 hours and 72 hours after total body irradiation). Serum samples were obtained 48 hours after the second administration of bone marrow stromal cells. The mean.+-.the standard error of the mean are shown. Statistical significance assessed using one-way ANOVA followed by Tukey's test for multiple comparisons. Asterisks identify statistically significant comparisons. P<0.05, *; p<0.001, ***; not significant, n.s.
[0140] FIG. 81 is a graph showing the levels of mouse miR-30a-3p in mice exposed to 0 Gy-total body irradiation and untreated, or mice exposed to 10.4 Gy-total body irradiation and left untreated or treated with two doses of 2 million bone marrow stromal cells per mouse (24 hours and 72 hours after total body irradiation). Serum samples were obtained 48 hours after the second administration of bone marrow stromal cells. The mean.+-.the standard error of the mean are shown. Statistical significance assessed using one-way ANOVA followed by Tukey's test for multiple comparisons. Asterisks identify statistically significant comparisons. P<0.05, *; p<0.001, ***; not significant, n.s.
[0141] FIG. 82 is a graph showing the levels of mouse miR-30c-5p in mice exposed to 0 Gy-total body irradiation and untreated, or mice exposed to 10.4 Gy-total body irradiation and left untreated or treated with two doses of 2 million bone marrow stromal cells per mouse (24 hours and 72 hours after total body irradiation). Serum samples were obtained 48 hours after the second administration of bone marrow stromal cells. The mean.+-.the standard error of the mean are shown. Statistical significance assessed using one-way ANOVA followed by Tukey's test for multiple comparisons. Asterisks identify statistically significant comparisons. P<0.01, **; not significant, n.s.
[0142] FIG. 83 is a graph showing the levels of mouse miR-187-3p in mice exposed to 0 Gy-total body irradiation and untreated, or mice exposed to 10.4 Gy-total body irradiation and left untreated or treated with two doses of 2 million bone marrow stromal cells per mouse (24 hours and 72 hours after total body irradiation). Serum samples were obtained 48 hours after the second administration of bone marrow stromal cells. The mean.+-.the standard error of the mean are shown. Statistical significance assessed using one-way ANOVA followed by Tukey's test for multiple comparisons. Asterisks identify statistically significant comparisons. P<0.01, **; p<0.001, ***; not significant, n.s.
[0143] FIG. 84 is a graph showing the levels of mouse miR-194-3p in mice exposed to 0 Gy-total body irradiation and untreated, or mice exposed to 10.4 Gy-total body irradiation and left untreated or treated with two doses of 2 million bone marrow stromal cells per mouse (24 hours and 72 hours after total body irradiation). Serum samples were obtained 48 hours after the second administration of bone marrow stromal cells. The mean.+-.the standard error of the mean are shown. Statistical significance assessed using one-way ANOVA followed by Tukey's test for multiple comparisons. Asterisks identify statistically significant comparisons. P<0.05, *; not significant, n.s.
[0144] FIG. 85 is a graph showing the number of BM-MNCs (in millions) per hind limb in untreated control humanized mice and in humanized mice treated with saline or amifostine prior to irradiation with 4.0 Gy or 4.5 Gy of total body irradiation.
[0145] FIG. 86 is a graph showing the number of CD45 positive cells (in hundred thousands) per hind limb in untreated control humanized mice and in humanized mice treated with saline or amifostine prior to irradiation with 4.0 Gy or 4.5 Gy of total body irradiation.
[0146] FIG. 87 is a graph showing the number of CFU-Cs per hind limb in untreated control humanized mice and in humanized mice treated with saline or amifostine prior to irradiation with 4.0 Gy or 4.5 Gy of total body irradiation.
[0147] FIG. 88 is a graph showing the relative level of miR-150-5p in serum of humanized mice treated with saline or amifostine, irradiated with 4.0 Gy or 4.5 Gy of total body irradiation, and allowed to recover for 24 hours, as compared to the level of miR-150-5p in the serum of untreated control humanized mice.
[0148] FIG. 89 is a graph showing the relative level of miR-187-3p in serum of humanized mice treated with saline or amifostine, irradiated with 4.0 Gy or 4.5 Gy of total body irradiation, and allowed to recover for 24 hours, as compared to the level of miR-187-3p in the serum of untreated control humanized mice.
[0149] FIG. 90 is a graph showing the relative level of miR-27a-3p in serum of humanized mice treated with saline or amifostine, irradiated with 4.0 Gy or 4.5 Gy of total body irradiation, and allowed to recover for 24 hours, as compared to the level of miR-27a-3p in the serum of untreated control humanized mice.
[0150] FIG. 91 is a graph showing the relative level of miR-30a-3p in serum of humanized mice treated with saline or amifostine, irradiated with 4.0 Gy or 4.5 Gy of total body irradiation, and allowed to recover for 24 hours, as compared to the level of miR-30a-3p in the serum of untreated control humanized mice.
[0151] FIG. 92 is a graph showing the relative level of miR-30c-5p in serum of humanized mice treated with saline or amifostine, irradiated with 4.0 Gy or 4.5 Gy of total body irradiation, and allowed to recover for 24 hours, as compared to the level of miR-30c-5p in the serum of untreated control humanized mice.
[0152] FIG. 93 is a graph showing the relative level of miR-194-5p in serum of humanized mice treated with saline or amifostine, irradiated with 4.0 Gy or 4.5 Gy of total body irradiation, and allowed to recover for 24 hours, as compared to the level of miR-194-5p in the serum of untreated control humanized mice.
DETAILED DESCRIPTION
[0153] Subjects exposed to tissue damaging levels of radiation often do not experience some symptoms of radiation disease until one to three weeks, and it is difficult for medical professionals to quickly estimate a subject's level of exposure to radiation. Often, a subject's level of exposure to radiation is determined once the subject's begins to show signs and symptoms of radiation disease (e.g., as a result of damage to hematopoietic system or gastrointestinal system). In order to increase the efficacy of a treatment for reducing radiation-induced damage, the treatment must be administered shortly after the subject has been exposed to a significant level of radiation.
[0154] Provided herein are methods of determining a subject's level of exposure to radiation, methods of determining whether a subject has been exposed to a radiation dose of 2 Gy or more, methods of determining a subject's risk of poor prognosis from radiation exposure, methods of determining a subject's risk of subsequent development of radiation disease, methods of selecting a treatment for reducing radiation-induced damage for a subject, methods of selecting a subject for treatment of radiation disease, methods of triaging a plurality of subjects exposed or suspected of being exposed to radiation, and methods of determining the efficacy of a treatment (e.g., a treatment for reducing radiation-induced damage) administered to a subject exposed to a significant dose of radiation that are based on the discovery that changes in the serum levels of specific miRNAs (e.g., changes in the serum levels of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) of, e.g., mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p) occur in subjects that have been exposed to total body irradiation, and that the changes in the levels of these specific miRNAs are radiation dose-dependent and also correlate with a subject's future risk of developing radiation disease, a subject's future risk of poor prognosis from radiation exposure, and the effectiveness of a treatment (e.g., a treatment for reducing radiation-induced damage) in a subject exposed to radiation (e.g., a subject exposed to a significant level of radiation). Also provided are kits that can be used, e.g., to perform any of the methods described herein.
[0155] The methods and kits provided herein allow for a physician to quickly (e.g., between 30 minutes and 48 hours, between 30 minutes and 36 hours, between 30 minutes and 24 hours, between 30 minutes and 20 hours, between 30 minutes and 15 hours, between 30 minutes and 12 hours, between 30 minutes and 10 hours, between 30 minutes and 8 hours, between 30 minutes and 6 hours, between 30 minutes and 4 hours, between 30 minutes and 3 hours, or between 30 minutes and 2 hours) and accurately determine a subject's exposure to radiation. The methods and kits provided herein also allow for a physician to quickly (e.g., between 30 minutes and 48 hours, between 30 minutes and 36 hours, between 30 minutes and 24 hours, between 30 minutes and 20 hours, between 30 minutes and 15 hours, between 30 minutes and 12 hours, between 30 minutes and 10 hours, between 30 minutes and 8 hours, between 30 minutes and 6 hours, between 30 minutes and 4 hours, between 30 minutes and 3 hours, or between 30 minutes and 2 hours) triage subjects exposed or suspected of being exposed to radiation, and to quickly (e.g., between 30 minutes and 48 hours, between 30 minutes and 36 hours, between 30 minutes and 24 hours, between 30 minutes and 20 hours, between 30 minutes and 15 hours, between 30 minutes and 12 hours, between 30 minutes and 10 hours, between 30 minutes and 8 hours, between 30 minutes and 6 hours, between 30 minutes and 4 hours, between 30 minutes and 3 hours, or between 30 minutes and 2 hours) select an appropriate treatment for a subject (e.g., a subject suspected of or known to have been exposed to radiation).
[0156] Exemplary aspects of the methods and kits provided herein are described below. As one of skill in the art would appreciate, the various aspects of the methods and kits described below can be used in any combination.
Radiation Disease
[0157] Radiation disease is a disease caused by exposure to a significant dose of radiation. As used herein, "radiation" refers to the following types of radiation: x-radiation, gamma-radiation, alpha particle radiation, beta particle radiation, and neutron radiation (e.g., a dose of radiation of 1 Gy or more, a dose of radiation of 1.5 Gy or more, a dose of radiation of 2 Gy or more, a dose of radiation of 2.5 Gy or more, or a dose of radiation of 3 Gy or more). The severity of radiation disease in a subject depends on the level of radiation the subject was exposed to. Radiation disease often is typified by damage to the subject's hematopoietic system (Mauch et al., Int. J. Radiat. Oncol. Biol. Phys. 31:1319-1339, 1995), but subjects with radiation disease can also have damage to their gastrointestinal tract and cerebrovascular system (Waselenko et al., Ann. Intern. Med. 140:1037-1051, 2004). Damage to the subject's hematopoietic system can result, e.g., in a rapid decrease in the levels of lymphocytes (T-cells and/or B-cells), bone marrow stromal cells, neutrophils, platelets, BM-MSCs, CFU-Cs, HPCs, and HSCs, and a decrease in total white blood cell count (WBC) and complete blood count (CBC). The decrease in the levels of these cells and cell counts can result in an increased risk of infection in the subject. Exposure to high doses of radiation can result in a severe, non-recoverable bone marrow damage, which results in pancytopenia (due to the complete loss of hematopoietic stem cells in the subject) and death. A 2 Gy- to 6 Gy-dose of radiation results in damage to the hematopoietic system of a subject, the symptoms of which appear in a few weeks to 2 months after the subject's exposure to radiation. At higher doses of radiation of about 8 Gy to about 12 Gy, lethal gastrointestinal and bone marrow toxicity is observed and death is probable in one to three weeks (Waselenko et al., Ann. Intern. Med. 140:1037-1051, 2004; Coleman et al., Science 304:693-694, 2004).
[0158] Non-limiting examples of symptoms of radiation disease can include nausea and vomiting, loss of appetite, diarrhea, headache, fever, fatigue and weakness, purpura, hemorrhage, increased risk of infections, hair loss, cognitive impairment, electrolyte disturbance, shock, seizures, tremor, ataxia, decreased levels of platelets, decreased levels of neutrophils, decreased levels of B-cells, decreased levels of T-cells, decreased levels of bone marrow stromal cells, decreased levels of CFU-Cs, decreased levels of CBCs, decreased levels of WBCs, decreased levels of BM-MNCs, decreased levels of HPCs (e.g., LKS.sup.- cells), decreased levels of HSCs (e.g., LKS.sup.+ cells), decreased levels of hemoglobin, and lung fibrosis. Methods for detecting the levels of platelets, neutrophils, B-cells, T-cells, CFU-Cs, BM-MNCs, HPCs, HSCs, and hemoglobin, and CBCs and WBCs are well known in the art. Exemplary methods for determining the levels of B-cells, T-cells, CFU-Cs, BM-MNCs, HPCs, and HSCs, and determining CMCs are also described herein.
[0159] A subject having radiation sickness can have, e.g., present with, one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or fifteen) of any of the symptoms of radiation disease described herein (in any combination), e.g., at substantially the same time, or at different times following exposure to a significant dose of radiation.
[0160] Once diagnosed, a subject having radiation disease is typically first decontaminated before treatment by a physician. The decontamination can include the removal of articles of clothing that contain a radioactive isotope. The decontamination can also include removing radioactive isotopes from a subject's skin and endothelium.
[0161] After decontamination, a subject can be administered a treatment for reducing radiation-induced damage (e.g., one or more of any of the exemplary treatments for reducing radiation-induced damage described herein).
Subjects
[0162] A subject as described herein can be a male or a female. The subject can be a juvenile (e.g., an infant or toddler) or an adult. Where the subjects is a juvenile, he or she may be between 1 day and 18 years old, inclusive (e.g., between 1 day and 17 years old, between 1 day and 16 years old, between 1 day and 15 years old, between 1 day and 14 years old, between 1 day and 13 years old, between 1 day and 12 years old, between 1 day and 11 years old, between 1 day and 10 years old, between 1 day and 9 years old, between 1 day and 8 years old, between 1 day and 7 years old, between 1 day and 6 years old, between 1 day and 5 years old, between 1 day and 4 years old, between 1 day and 3 years old, between 1 day and 2 years old, between 1 day and 1 year old, between 1 day and 6 months old, between 6 months and 4 years old, between 1 month and 5 years old, between 3 years and 13 years old, or between 13 years and 18 years old). When the subject is an adult, the subject may be, e.g., between 18 to 20 years old, inclusive, or at least or about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or at least or about 100 years old.
[0163] In some embodiments of any of the methods described herein, the subject has been exposed or is suspected of having been exposed to a significant dose of radiation. In some embodiments of any of the methods described herein, the subject has been identified as being exposed to radiation (e.g., a significant dose of radiation) or as being likely to have been exposed to radiation (e.g., a significant dose of radiation). In some embodiments, the subject has a disease (e.g., cancer) and has been irradiated with a significant dose of radiation in order to treat the disease (e.g., a tumor) in the subject. In some embodiments of any of the methods described herein, the subject is or was previously at a location having or suspected of having a significant level of radiation (e.g., the site of a nuclear attack or a site proximal to the site of a nuclear attack, the site of radiation release from a nuclear weapon or site proximal to the site of radiation release from a nuclear weapon, a nuclear energy facility or a site proximal to a nuclear energy facility, a nuclear waste facility or proximal to a nuclear waste facility, or a nuclear medicine facility or a site proximal to a nuclear medicine facility). In some examples of any of the methods described herein, the subject has already been diagnosed as having radiation disease or having been exposed to a significant level of radiation (e.g., using any of the methods provided herein).
[0164] In some embodiments of any of the methods described herein, the sample including a biological fluid is obtained from the subject within 5 minutes to one week (e.g., within 5 minutes to six days, within 5 minutes to five days, within 5 minutes to 96 hours, within 5 minutes to three days, within 5 minutes to two days, within 5 minutes to one day, within 5 minutes to 20 hours, within 5 minutes to 16 hours, within 5 minutes to 12 hours, within 5 minutes to 10 hours, within 5 minutes to 8 hours, within 5 minutes to 6 hours, within 5 minutes to 4 hours, within 5 minutes to 3 hours, within 5 minutes to 2 hours, within 10 minutes to one week, within 10 minutes to six days, within 10 minutes to five days, within 10 minutes to 96 hours, within 10 minutes to three days, within 10 minutes to two days, within 10 minutes to one day, within 10 minutes to 20 hours, within 10 minutes to 16 hours, within 10 minutes to 12 hours, within 10 minutes to 10 hours, within 10 minutes to 8 hours, within 10 minutes to 6 hours, within 10 minutes to 4 hours, within 10 minutes to 3 hours, within 10 minutes to 2 hours, within 20 minutes to one week, within 20 minutes to six days, within 20 minutes to five days, within 20 minutes to 96 hours, within 20 minutes to three days, within 20 minutes to two days, within 20 minutes to one day, within 20 minutes to 20 hours, within 20 minutes to 16 hours, within 20 minutes to 12 hours, within 20 minutes to 10 hours, within 20 minutes to 8 hours, within 20 minutes to 6 hours, within 20 minutes to 4 hours, within 20 minutes to 3 hours, within 20 minutes to 2 hours, within 30 minutes to one week, within 30 minutes to six days, within 30 minutes to five days, within 30 minutes to 96 hours, within 30 minutes to three days, within 30 minutes to two days, within 30 minutes to one day, within 30 minutes to 20 hours, within 30 minutes to 16 hours, within 30 minutes to 12 hours, within 30 minutes to 10 hours, within 30 minutes to 8 hours, within 30 minutes to 6 hours, within 30 minutes to 4 hours, within 30 minutes to 3 hours, within 30 minutes to 2 hours, within 1 hour to one week, within 1 hour to six days, within 1 hour to five days, within 1 hour to 96 hours, within 1 hour to three days, within 1 hour to two days, within 1 hour to one day, within 1 hour to 20 hours, within 1 hour to 16 hours, within 1 hour to 12 hours, within 1 hour to 10 hours, within 1 hour to 8 hours, within 1 hour to 6 hours, within 1 hour to 4 hours, within 1 hour to 3 hours, or within 1 hour to 2 hours). In some embodiments of any of the methods described herein, the sample includes a biological fluid selected from the group of blood, plasma, serum, saliva, or urine. Some embodiments of any of the methods described herein further include obtaining a sample including a biological fluid (e.g., serum) from a subject.
MiRNAs and Methods of Determining Levels of miRNAs
[0165] The methods described herein include determining a level(s) of one or more of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p in a sample(s) including a biological fluid from a subject.
[0166] The sequences of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p are well known in the art. Exemplary sequences for mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p are listed below.
TABLE-US-00001 Mouse miR-130a-3p (mmu-miR-130a-3p) (SEQ ID NO: 19) CAGUGCAAUGUUAAAAGGGCAU Mouse miR-150-5p (mmu-miR-150-3p) (SEQ ID NO: 20) UCUCCCAACCCUUGUACCAGUG Mouse miR-17-3p (mmu-miR-17-3p) (SEQ ID NO: 21) ACUGCAGUGAGGGCACUUGUAG Mouse miR-187-3p (mmu-miR-187-3p) (SEQ ID NO: 22) UCGUGUCUUGUGUUGCAGCCGG Mouse miR-194-5p (mmu-miR-194-5p) (SEQ ID NO: 23) UGUAACAGCAACUCCAUGUGGA Mouse miR-27a-3p (mmu-miR-27a-3p) (SEQ ID NO: 24) UUCACAGUGGCUAAGUUCCGC Mouse miR-30a-3p (mmu-miR-30a-3p) (SEQ ID NO: 25) CUUUCAGUCGGAUGUUUGCAGC Mouse miR-30c-5p (mmu-miR-30c-5p) (SEQ ID NO: 26) UGUAAACAUCCUACACUCUCAGC Mouse miR-142-5p (mmu-miR-142-5p) (SEQ ID NO: 27) CAUAAAGUAGAAAGCACUACU Mouse miR-342-3p (mmu-miR-342-3p) (SEQ ID NO: 28) UCUCACACAGAAAUCGCACCCGU Mouse miR-34b-3p (mmu-miR-34b-3p) (SEQ ID NO: 29) AAUCACUAACUCCACUGCCAUC Mouse miR-126-3p (mmu-miR-126-3p) (SEQ ID NO: 30) UCGUACCGUGAGUAAUAAUGCG Mouse miR-320-3p (mmu-miR-320-3p) (SEQ ID NO: 31) AAAAGCUGGGUUGAGAGGGCGA Mouse miR-136-5p (mmu-miR-136-5p) (SEQ ID NO: 32) ACUCCAUUUGUUUUGAUGAUGG Mouse miR-33-5p (mmu-miR-33-5p) (SEQ ID NO: 33) GUGCAUUGUAGUUGCAUUGCA Mouse miR-142a-3p (mmu-miR-142a-3p) (SEQ ID NO: 34) UGUAGUGUUUCCUACUUUAUGGA Mouse miR-706 (mmu-miR-706) (SEQ ID NO: 35) AGAGAAACCCUGUCUCAAAAAA Mouse miR-375-3p (mmu-miR-375-3p) (SEQ ID NO: 36) UUUGUUCGUUCGGCUCGCGUGA Mouse miR-29a-5p (mmu-miR-29a-5p) (SEQ ID NO: 37) ACUGAUUUCUUUUGGUGUUCAG Mouse miR-193a-3p (mmu-miR-193a-3p) (SEQ ID NO: 38) AACUGGCCUACAAAGUCCCAGU Mouse miR-99b-5p (mmu-miR-99b-5p) (SEQ ID NO: 39) CACCCGUAGAACCGACCUUGCG Mouse miR-151-3p (mmu-miR-151-3p) (SEQ ID NO: 40) CUAGACUGAGGCUCCUUGAGG Mouse miR-let-7d-3p (mmu-miR-let-7d-3p) (SEQ ID NO: 41) CUAUACGACCUGCUGCCUUUCU Mouse miR-486-5p (mmu-miR-486-5p) (SEQ ID NO: 42) UCCUGUACUGAGCUGCCCCGAG Mouse miR-423-5p (mmu-miR-423-5p) (SEQ ID NO: 43) UGAGGGGCAGAGAGCGAGACUUU Mouse miR-30b-5p (mmu-miR-30b-5p) (SEQ ID NO: 44) UGUAAACAUCCUACACUCAGCU Mouse miR-191-5p (mmu-miR-191-5p) (SEQ ID NO: 45) CAACGGAAUCCCAAAAGCAGCUG Mouse miR-497a-5p (mmu-miR-497a-5p) (SEQ ID NO: 46) CAGCAGCACACUGUGGUUUGUA Mouse miR-32-5p (mmu-miR-32-5p) (SEQ ID NO: 47) UAUUGCACAUUACUAAGUUGCA Mouse miR-214-5p (mmu-miR-214-5p) (SEQ ID NO: 48) UGCCUGUCUACACUUGCUGUGC Mouse miR-326-3p (mmu-miR-326-3p) (SEQ ID NO: 49) CCUCUGGGCCCUUCCUCCAGU Mouse miR-1195 (mmu-miR-1195) (SEQ ID NO: 50) UGAGUUCGAGGCCAGCCUGCUCA Mouse miR-122-5p (mmu-miR-122-5p) (SEQ ID NO: 51) UGGAGUGUGACAAUGGUGUUUG Mouse miR-1839-3p (mmu-miR-1839-3p) (SEQ ID NO: 52) AGACCUACUUAUCUACCAACAGC Mouse miR-500-3p (mmu-miR-500-3p) (SEQ ID NO: 53) AAUGCACCUGGGCAAGGGUUCA Mouse miR-30e-3p (mmu-miR-30e-3p) (SEQ ID NO: 54) CUUUCAGUCGGAUGUUUACAGC Mouse miR-322-3p (mmu-miR-322-3p) (SEQ ID NO: 55) AAACAUGAAGCGCUGCAACAC Mouse miR-709 (mmu-miR-709) (SEQ ID NO: 56) GGAGGCAGAGGCAGGAGGA Mouse miR-486a-3p (mmu-miR-486a-3p) (SEQ ID NO: 57) CGGGGCAGCUCAGUACAGGAU Mouse miR-133a-3p (mmu-miR-133a-3p) (SEQ ID NO: 58) UUUGGUCCCCUUCAACCAGCUG Mouse miR-676-3p (mmu-miR-676-3p) (SEQ ID NO: 59) CCGUCCUGAGGUUGUUGAGCU Mouse miR-744-5p (mmu-miR-744-5p) (SEQ ID NO: 60) UGCGGGGCUAGGGCUAACAGCA Mouse miR-29a-3p (mmu-miR-29a-3p) (SEQ ID NO: 61) UAGCACCAUCUGAAAUCGGUUA Mouse miR-1839-5p (mmu-miR-1839-5p) (SEQ ID NO: 62) AAGGUAGAUAGAACAGGUCUUG Mouse miR-30a-5p (mmu-miR-30a-5p) (SEQ ID NO: 63) UGUAAACAUCCUCGACUGGAAG Mouse miR-199b-5p (mmu-miR-199b-5p) (SEQ ID NO: 64) CCCAGUGUUUAGACUACCUGUUC Mouse miR-125a-5p (mmu-miR-125a-5p) (SEQ ID NO: 65) UCCCUGAGACCCUUUAACCUGUGA Mouse miR-133b-3p (mmu-miR-133b-3p) (SEQ ID NO: 66) UUUGGUCCCCUUCAACCAGCUA Mouse miR-24-3p (mmu-miR-24-3p) (SEQ ID NO: 67) UGGCUCAGUUCAGCAGGAACAG Mouse miR-21a-5p (mmu-miR-21a-5p) (SEQ ID NO: 68) UAGCUUAUCAGACUGAUGUUGA Mouse miR-503-5p (mmu-miR-503-5p) (SEQ ID NO: 69) UAGCAGCGGGAACAGUACUGCAG Mouse miR-328-3p (mmu-miR-328-3p) (SEQ ID NO: 70) CUGGCCCUCUCUGCCCUUCCGU Mouse miR-let-7g-5p (mmu-miR-let-7g-5p) (SEQ ID NO: 71) UGAGGUAGUAGUUUGUACAGUU Mouse miR-362-3p (mmu-miR-362-3p) (SEQ ID NO: 72) AACACACCUGUUCAAGGAUUCA Mouse miR-199a-5p (mmu-miR-199a-5p) (SEQ ID NO: 73) CCCAGUGUUCAGACUACCUGUUC Mouse miR-15a-3p (mmu-miR-15a-3p) (SEQ ID NO: 74) CAGGCCAUACUGUGCUGCCUCA Mouse miR-139-5p (mmu-miR-139-5p) (SEQ ID NO: 75) UCUACAGUGCACGUGUCUCCAG Mouse miR-149-5p (mmu-miR-149-5p) (SEQ ID NO: 76) UCUGGCUCCGUGUCUUCACUCCC Mouse miR-29b-3p (mmu-miR-29b-3p) (SEQ ID NO: 77) UAGCACCAUUUGAAAUCAGUGUU Mouse miR-1a-3p (mmu-miR-1a-3p) (SEQ ID NO: 78 UGGAAUGUAAAGAAGUAUGUAU Mouse miR-23b-3p (mmu-miR-23b-3p) (SEQ ID NO: 79) AUCACAUUGCCAGGGAUUACC Mouse miR-215-5p (mmu-miR-215-5p) (SEQ ID NO: 80) AUGACCUAUGAUUUGACAGAC Mouse miR-204-5p (mmu-miR-204-5p) (SEQ ID NO: 81)
UUCCCUUUGUCAUCCUAUGCCU Mouse miR-200b-5p (mmu-miR-200b-5p) (SEQ ID NO: 82) CAUCUUACUGGGCAGCAUUGGA Mouse miR-25-3p (mmu-miR-25-3p) (SEQ ID NO: 83) CAUUGCACUUGUCUCGGUCUGA Mouse miR-338-3p (mmu-miR-338-3p) (SEQ ID NO: 84) UCCAGCAUCAGUGAUUUUGUUG Mouse miR-196b-5p (mmu-miR-196b-5p) (SEQ ID NO: 85) UAGGUAGUUUCCUGUUGUUGGG
[0167] A variety of websites are available which allow for the identification of human homologues (or other mammalian homologues) of a mouse miRNA based on sequence identity or a high degree of sequence similarity between the mouse and human miRNA sequences (e.g., the miRBase website). For example, exemplary human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p were identified by performing a sequence alignment between each mouse miRNA and a database of human miRNAs. An exemplary human homologue identified for each of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p is listed below, along with an alignment of the cDNA of the exemplary human homologue with the cDNA of its corresponding mouse miRNA.
[0168] Given the high level of nucleotide sequence homology between the miRNAs of two very taxonomically different mammals (e.g., humans and mice) (see below), it is understood that other mammals (e.g., non-human primates (such as chimpanzees, monkeys, gorillas, and baboons), bovine mammals, horses, dogs, cats, sheep, goats, rabbits, guinea pigs, rats, hamsters, and gerbils) would have miRNA homologues that are identical, or almost identical (e.g., greater than 90%, about 95%, or greater than 95% identical) to the mouse and human miRNAs whose nucleotide sequences are provided below.
TABLE-US-00002 Human miR-130a-3p (hsa-miR-130a-3p) (SEQ ID NO: 86) CAGUGCAAUGUUAAAAGGGCAU Alignment of Mouse and Human miR-130a-3p (100 % Identical) 1 CAGTGCAATGTTAAAAGGGCAT 22 Mouse mmu-miR-130a-3p cDNA (SEQ ID NO: 87) |||||||||||||||||||||| 1 CAGTGCAATGTTAAAAGGGCAT 22 Human hsa-miR-130a-3p cDNA (SEQ ID NO: 88) Human miR-150-5p (hsa-miR-150-5p) (SEQ ID NO: 89) UCUCCCAACCCUUGUACCAGUG Alignment of Mouse and Human miR-150-5p (100 % Identical) 1 TCTCCCAACCCTTGTACCAGTG 22 Mouse mmu-miR-150-5p cDNA (SEQ ID NO: 90) |||||||||||||||||||||| 1 TCTCCCAACCCTTGTACCAGTG 22 Human hsa-miR-150-5p cDNA (SEQ ID NO: 91) Human miR-17-3p (hsa-miR-17-3p) (SEQ ID NO: 92) ACUGCAGUGAAGGCACUUGUAG Alignment of Mouse and Human miR-17-3p (95% Identical) 1 ACTGCAGTGAGGGCACTTGTAG 22 Mouse mmu-miR-17-3p cDNA (SEQ ID NO: 93) |||||||||| ||||||||||| 1 ACTGCAGTGAAGGCACTTGTAG 22 Human hsa-miR-17-3p cDNA (SEQ ID NO: 94) Human miR-187-3p (hsa-miR-187-3p) (SEQ ID NO: 95) UCGUGUCUUGUGUUGCAGCCGG Alignment of Mouse and Human miR-187-3p (100% identical) 1 TCGTGTCTTGTGTTGCAGCCGG 22 Mouse mmu-miR-187-3p cDNA (SEQ ID NO: 96) |||||||||||||||||||||| 1 TCGTGTCTTGTGTTGCAGCCGG 22 Human hsa-miR-187-3p cDNA (SEQ ID NO: 97) Human miR-194-5p (hsa-miR-194-5p) (SEQ ID NO: 98) UGUAACAGCAACUCCAUGUGGA Alignment of Mouse and Human miR-194-5p (100%) 1 TGTAACAGCAACTCCATGTGGA 22 Mouse mmu-miR-194-5p cDNA (SEQ ID NO: 99) |||||||||||||||||||||| 1 TGTAACAGCAACTCCATGTGGA 22 Human hsa-miR-194-5p cDNA (SEQ ID NO: 100) Human miR-27a-3p (hsa-miR-27a-3p) (SEQ ID NO: 101) UUCACAGUGGCUAAGUUCCGC Alignment of Mouse and Human miR-27a-3p (100% identical) 1 TTCACAGTGGCTAAGTTCCGC 21 Mouse mmu-miR-27a-3p cDNA (SEQ ID NO: 102) |||||||||||||||||||||| 1 TTCACAGTGGCTAAGTTCCGC 21 Human hsa-miR-27a-3p cDNA (SEQ ID NO: 103) Human miR-30a-3p (hsa-miR-30a-3p) (SEQ ID NO: 104) CUUUCAGUCGGAUGUUUGCAGC Alignment of Mouse and Human miR-30a-3p (100% identical) 1 CTTTCAGTCGGATGTTTGCAGC 22 Mouse mmu-miR-30a-3p cDNA (SEQ ID NO: 105) |||||||||||||||||||||| 1 CTTTCAGTCGGATGTTTGCAGC 22 Human hsa-miR-30a-3p cDNA (SEQ ID NO: 106) Human miR-30c-5p (hsa-miR-30c-5p) (SEQ ID NO: 107) UGUAAACAUCCUACACUCUCAGC Alignment of Mouse and Human miR-30c-5p (100% identical) 1 TGTAAACATCCTACACTCTCAGC 23 Mouse mmu-miR-30c-5p cDNA (SEQ ID NO: 108) ||||||||||||||||||||||| 1 TGTAAACATCCTACACTCTCAGC 23 Human hsa-miR-30c-5p cDNA (SEQ ID NO: 109) Human miR-142-5p (hsa-miR-142-5p) (SEQ ID NO: 110) CAUAAAGUAGAAAGCACUACU Alignment of Mouse and Human miR-142-5p (100% identical) 1 CATAAAGTAGAAAGCACTACT 21 Mouse mmu-miR-142-5p cDNA (SEQ ID NO: 111) ||||||||||||||||||||| 1 CATAAAGTAGAAAGCACTACT 21 Human hsa-miR-142-5p cDNA (SEQ ID NO: 112) Human miR-342-3p (hsa-miR-342-3p) (SEQ ID NO: 113) UCUCACACAGAAAUCGCACCCGU Alignment of Mouse and Human miR-342-3p (100% identical) 1 TCTCACACAGAAATCGCACCCGT 23 Mouse mmu-miR-342-3p cDNA (SEQ ID NO: 114) ||||||||||||||||||||||| 1 TCTCACACAGAAATCGCACCCGT 23 Human hsa-miR-342-3p cDNA (SEQ ID NO: 115) Human miR-34b-3p (hsa-miR-34b-3p) (SEQ ID NO: 116) CAAUCACUAACUCCACUGCCAU Alignment of Mouse and Human miR-34b-3p (100% identical) 1 AATCACTAACTCCACTGCCAT 21 Mouse mmu-miR-34b-3p cDNA (SEQ ID NO: 117) ||||||||||||||||||||| 2 AATCACTAACTCCACTGCCAT 22 Human hsa-miR-34b-3p cDNA (SEQ ID NO: 118) Human miR-126-3p (hsa-miR-126-3p) (SEQ ID NO: 119) UCGUACCGUGAGUAAUAAUGCG Alignment of Mouse and Human miR-126-3p (100% identical) 1 TCGTACCGTGAGTAATAATGCG 22 Mouse mmu-miR-126-3p cDNA (SEQ ID NO: 120) |||||||||||||||||||||| 1 TCGTACCGTGAGTAATAATGCG 22 Human hsa-miR-126-3p cDNA (SEQ ID NO: 121) Human homologue of mouse miR-320-3p (hsa-miR-320a) (SEQ ID NO: 122) AAAAGCUGGGUUGAGAGGGCGA Alignment of Mouse miR-320-3p and Human miR-320a (100% identical) 1 AAAAGCTGGGTTGAGAGGGCGA 22 Mouse mmu-miR-320-3p cDNA (SEQ ID NO: 123) |||||||||||||||||||||| 1 AAAAGCTGGGTTGAGAGGGCGA 22 Human hsa-miR-320a cDNA (SEQ ID NO: 124) Human miR-136-5p (hsa-miR-136-5p) (SEQ ID NO: 125) ACUCCAUUUGUUUUGAUGAUGGA Alignment of Mouse and Human miR-136-5p (100% identical) 1 ACTCCATTTGTTTTGATGATGG 22 Mouse mmu-miR-136-5p cDNA (SEQ ID NO: 126) |||||||||||||||||||||| 1 ACTCCATTTGTTTTGATGATGG 22 Human hsa-miR-136-5p cDNA (SEQ ID NO: 127) Human homologue of mouse miR-33-5p (hsa-miR-33a-5p) (SEQ ID NO: 128) GUGCAUUGUAGUUGCAUUGCA Alignment of Mouse miR-33-5p and Human miR-33a-5p (100% identical) 1 GTGCATTGTAGTTGCATTGCA 21 Mouse mmu-miR-33-5p cDNA (SEQ ID NO: 129) ||||||||||||||||||||| 1 GTGCATTGTAGTTGCATTGCA 21 Human hsa-miR-33a-5p cDNA (SEQ ID NO: 130) Human homologue of mouse miR-142a-3p (hsa-miR-142-3p) (SEQ ID NO: 131) UGUAGUGUUUCCUACUUUAUGGA Alignment of Mouse miR-142a-3p and Human miR-142a-3p (100% identical) 1 TGTAGTGTTTCCTACTTTATGGA 23 Mouse mmu-miR-142a-3p cDNA (SEQ ID NO: 132) ||||||||||||||||||||||| 1 TGTAGTGTTTCCTACTTTATGGA 23 Human hsa-miR-142-3p cDNA (SEQ ID NO: 133) Human homologue of mouse miR-375-3p (hsa-miR-375) (SEQ ID NO: 134) UUUGUUCGUUCGGCUCGCGUGA Alignment of Mouse miR-375-3p and Human miR-375 (100% identical) 1 TTTGTTCGTTCGGCTCGCGTGA 22 Mouse mmu-miR-375-3p cDNA (SEQ ID NO: 135) |||||||||||||||||||||| 1 TTTGTTCGTTCGGCTCGCGTGA 22 Human hsa-miR-375 cDNA (SEQ ID NO: 136) Human miR-29a-5p (hsa-miR-29a-5p) (SEQ ID NO: 137) ACUGAUUUCUUUUGGUGUUCAG Alignment of Mouse and Human miR-29a-5p (100% identical) 1 ACTGATTTCTTTTGGTGTTCAG 22 Mouse mmu-miR-29a-5p cDNA (SEQ ID NO: 138) |||||||||||||||||||||| 1 ACTGATTTCTTTTGGTGTTCAG 22 Human hsa-miR-29a-5p cDNA (SEQ ID NO: 139) Human miR-193a-3p (hsa-miR-193a-3p) (SEQ ID NO: 140) AACUGGCCUACAAAGUCCCAGU Alignment of Mouse and Human miR-193a-3p (100% identical) 1 AACTGGCCTACAAAGTCCCAGT 22 Mouse mmu-miR-193a-3p cDNA (SEQ ID NO: 141) |||||||||||||||||||||| 1 AACTGGCCTACAAAGTCCCAGT 22 Human hsa-miR-193a-3p cDNA (SEQ ID NO: 142) Human miR-99b-5p (hsa-miR-99b-5p) (SEQ ID NO: 143) CACCCGUAGAACCGACCUUGCG Alignment of Mouse and Human miR-99b-5p (100% identical) 1 CACCCGTAGAACCGACCTTGCG 22 Mouse mmu-miR-99b-5p cDNA (SEQ ID NO: 144) |||||||||||||||||||||| 1 CACCCGTAGAACCGACCTTGCG 22 Human hsa-miR-99b-5p cDNA (SEQ ID NO: 145) Human homologue of mouse miR-151-3p (hsa-miR-151a-3p) (SEQ ID NO: 146) CUAGACUGAAGCUCCUUGAGG Alignment of Mouse miR-151-3p and Human miR-151a-3p (95% identical) 1 CTAGACTGAGGCTCCTTGAGG 21 Mouse mmu-miR-151-3p cDNA (SEQ ID NO: 147) ||||||||| |||||||||||| 1 CTAGACTGAAGCTCCTTGAGG 21 Human hsa-miR-151a-3p cDNA (SEQ ID NO: 148) Human miR-let-7d-3p (hsa-miR-let-7d-3p) (SEQ ID NO: 149) CUAUACGACCUGCUGCCUUUCU Alignment of Mouse and Human miR-let-7d-3p (100% identical) 1 CTATACGACCTGCTGCCTTTCT 22 Mouse mmu-miR-let-7d-3p cDNA (SEQ ID NO: 150) |||||||||||||||||||||| 1 CTATACGACCTGCTGCCTTTCT 22 Human hsa-miR-let-7d-3p cDNA (SEQ ID NO: 151) Human miR-486-5p (hsa-miR-486-5p) (SEQ ID NO: 152) UCCUGUACUGAGCUGCCCCGAG Alignment of Mouse and Human miR-486-5p (100% identical) 1 TCCTGTACTGAGCTGCCCCGAG 22 Mouse mmu-miR-486-5p cDNA (SEQ ID NO: 153) |||||||||||||||||||||| 1 TCCTGTACTGAGCTGCCCCGAG 22 Human hsa-miR-486-5p cDNA (SEQ ID NO: 154) Human miR-423-5p (hsa-miR-423-5p) (SEQ ID NO: 155) UGAGGGGCAGAGAGCGAGACUUU Alignment of Mouse and Human miR-423-5p (100% identical) 1 TGAGGGGCAGAGAGCGAGACTTT 23 Mouse mmu-miR-423-5p cDNA (SEQ ID NO: 156) ||||||||||||||||||||||| 1 TGAGGGGCAGAGAGCGAGACTTT 23 Human hsa-miR-423-5p cDNA (SEQ ID NO: 157) Human miR-30b-5p (hsa-miR-30b-5p) (SEQ ID NO: 158) UGUAAACAUCCUACACUCAGCU Alignment of Mouse and Human miR-30b-5p (100% identical) 1 TGTAAACATCCTACACTCAGCT 22 Mouse mmu-miR-30b-5p cDNA (SEQ ID NO: 159) |||||||||||||||||||||| 1 TGTAAACATCCTACACTCAGCT 22 Human hsa-miR-30b-5p cDNA (SEQ ID NO: 160) Human miR-191-5p (hsa-miR-191-5p) (SEQ ID NO: 161) CAACGGAAUCCCAAAAGCAGCUG Alignment of Mouse and Human miR-191-5p (100% identical) 1 CAACGGAATCCCAAAAGCAGCTG 23 Mouse mmu-miR-191-5p cDNA (SEQ ID NO: 162) ||||||||||||||||||||||| 1 CAACGGAATCCCAAAAGCAGCTG 23 Human hsa-miR-191-5p cDNA (SEQ ID NO: 163) Human homologue of mouse miR-497a-5p (hsa-miR-497) (SEQ ID NO: 164) CAGCAGCACACUGUGGUUUGU Alignment of Mouse and Human miR-497a-5p (100% identical) 1 CAGCAGCACACTGTGGTTTGT 21 Mouse mmu-miR-497a-5p cDNA (SEQ ID NO: 165) ||||||||||||||||||||| 1 CAGCAGCACACTGTGGTTTGT 21 Human hsa-miR-497 cDNA (SEQ ID NO: 166) Human miR-32-5p (hsa-miR-32-5p) (SEQ ID NO: 167) UAUUGCACAUUACUAAGUUGCA Alignment of Mouse and Human miR-32-5p (100% identical) 1 TATTGCACATTACTAAGTTGCA 22 Mouse mmu-miR-32-5p cDNA (SEQ ID NO: 168)
|||||||||||||||||||||| 1 TATTGCACATTACTAAGTTGCA 22 Human hsa-miR-32-5p cDNA (SEQ ID NO: 169) Human miR-214-5p (hsa-miR-214-5p) (SEQ ID NO: 170) UGCCUGUCUACACUUGCUGUGC Alignment of Mouse and Human miR-214-5p (100% identical) 1 TGCCTGTCTACACTTGCTGTGC 22 Mouse mmu-miR-214-5p cDNA (SEQ ID NO: 171) |||||||||||||||||||||| 1 TGCCTGTCTACACTTGCTGTGC 22 Human hsa-miR-214-5p cDNA (SEQ ID NO: 172) Human miR-326-3p (hsa-miR-326-3p) (SEQ ID NO: 173) CCUCUGGGCCCUUCCUCCAG Alignment of Mouse and Human miR-326-3p (100% identical) 1 CCTCTGGGCCCTTCCTCCAG 20 Mouse mmu-miR-326-3p cDNA (SEQ ID NO: 174) |||||||||||||||||||| 1 CCTCTGGGCCCTTCCTCCAG 20 Human hsa-miR-326-3p cDNA (SEQ ID NO: 175) Human miR-122-5p (hsa-miR-122-5p) (SEQ ID NO: 176) UGGAGUGUGACAAUGGUGUUUG Alignment of Mouse and Human miR-122-5p (100% identical) 1 TGGAGTGTGACAATGGTGTTTG 22 Mouse mmu-miR-122-5p cDNA (SEQ ID NO: 177) |||||||||||||||||||||| 1 TGGAGTGTGACAATGGTGTTTG 22 Human hsa-miR-122-5p cDNA (SEQ ID NO: 178) Human homologue of mouse miR-500-3p (hsa-miR-502-3p) (SEQ ID NO: 179) AAUGCACCUGGGCAAGGAUUCA Alignment of Mouse miR-500-3p and Human miR-502-3p (95% identical) 1 AATGCACCTGGGCAAGGGTTCA 22 Mouse mmu-miR-500-3p cDNA (SEQ ID NO: 180) |||||||||||||||||||||| 1 AATGCACCTGGGCAAGGATTCA 22 Human hsa-miR-502-3p cDNA (SEQ ID NO: 181) Human miR-30e-3p (hsa-miR-30e-3p) (SEQ ID NO: 182) CUUUCAGUCGGAUGUUUACAGC Alignment of Mouse and Human miR-30e-3p (100% identical) 1 CTTTCAGTCGGATGTTTACAGC 22 Mouse mmu-miR-30e-3p cDNA (SEQ ID NO: 183) |||||||||||||||||||||| 1 CTTTCAGTCGGATGTTTACAGC 22 Human hsa-miR-30e-3p cDNA (SEQ ID NO: 184) Human homologue of mouse miR-322-3p (hsa-miR-424-3p) (SEQ ID NO: 185) AAACAUGAAGCGCUGCAACAC Alignment of Mouse and Human miR-322-3p (88% identical) 1 AAACATGAAGCGCTGC 16 Mouse mmu-miR-322-3p cDNA (SEQ ID NO: 186) |||| ||| ||||||| 3 AAACGTGAGGCGCTGC 18 Human hsa-miR-424-3p cDNA (SEQ ID NO: 187) Human homologue of mouse miR-709 (hsa-miR-1910-3p) (SEQ ID NO: 188) GAGGCAGAAGCAGGAUGACA Alignment of Mouse miR-709 and Human miR-1910-3p (93% identical) 2 GAGGCAGAGGCAGGA 16 Mouse mmu-miR-709 cDNA (SEQ ID NO: 189) |||||||| |||||| 1 GAGGCAGAAGCAGGA 15 Human hsa-miR-1910-3p cDNA (SEQ ID NO: 190) Human homolog of mouse miR-486a-3p (hsa-miR-486-3p) (SEQ ID NO: 191) CGGGGCAGCUCAGUACAGGAU Alignment of Mouse miR-486a-3p and Human miR-486-3p (100% identical) 1 CGGGGCAGCTCAGTACAGGAT 21 Mouse mmu-miR-486a-3p cDNA (SEQ ID NO: 192) ||||||||||||||||||||| 1 CGGGGCAGCTCAGTACAGGAT 21 Human hsa-miR-486-3p cDNA (SEQ ID NO: 193) Human miR-133a-3p (hsa-miR-133a-3p) (SEQ ID NO: 194) UUUGGUCCCCUUCAACCAGCUG Alignment of Mouse and Human miR-133a-3p (100% identical) 1 TTTGGTCCCCTTCAACCAGCTG 22 Mouse mmu-miR-133a-3p cDNA (SEQ ID NO: 195) |||||||||||||||||||||| 1 TTTGGTCCCCTTCAACCAGCTG 22 Human hsa-miR-133a-3p cDNA (SEQ ID NO: 196) Human miR-676-3p (hsa-miR-676-3p) (SEQ ID NO: 197) CUGUCCUAAGGUUGUUGAGUU Alignment of Mouse and Human miR-676-3p (94% identical) 3 GTCCTGAGGTTGTTGAG 19 Mouse mmu-miR-676-3p cDNA (SEQ ID NO: 198) ||||| ||||||||||| 3 GTCCTAAGGTTGTTGAG 19 Human hsa-miR-676-3p cDNA (SEQ ID NO: 199) Human miR-744-5p (hsa-miR-744-5p) (SEQ ID NO: 200) UGCGGGGCUAGGGCUAACAGCA Alignment of Mouse and Human miR-744-5p (100% identical) 1 TGCGGGGCTAGGGCTAACAGCA 22 Mouse mmu-miR-744-5p cDNA (SEQ ID NO: 201) |||||||||||||||||||||| 1 TGCGGGGCTAGGGCTAACAGCA 22 Human hsa-miR-744-5p cDNA (SEQ ID NO: 202) Human miR-29a-3p (hsa-miR-29a-3p) (SEQ ID NO: 203) UAGCACCAUCUGAAAUCGGUUA Alignment of Mouse and Human miR-29a-3p (100% identical) 1 TAGCACCATCTGAAATCGGTTA 22 Mouse mmu-miR-29a-3p cDNA (SEQ ID NO: 204) |||||||||||||||||||||| 1 TAGCACCATCTGAAATCGGTTA 22 Human hsa-miR-29a-3p cDNA (SEQ ID NO: 205) Human miR-30a-5p (hsa-miR-30a-5p) (SEQ ID NO: 206) UGUAAACAUCCUCGACUGGAAG Alignment of Mouse and Human miR-30a-5p (100% identical) 1 TGTAAACATCCTCGACTGGAAG 22 Mouse mmu-miR-30a-5p cDNA (SEQ ID NO: 207) |||||||||||||||||||||| 1 TGTAAACATCCTCGACTGGAAG 22 Human hsa-miR-30a-5p cDNA (SEQ ID NO: 208) Human miR-199b-5p (hsa-miR-199b-5p) (SEQ ID NO: 209) CCCAGUGUUUAGACUAUCUGUUC Alignment of Mouse and Human miR-199b-5p (100% identical) 1 CCCAGTGTTTAGACTACCTGTTC 23 Mouse mmu-miR-199b-5p cDNA (SEQ ID NO: 210) |||||||||||||||||||||| 1 CCCAGTGTTTAGACTATCTGTTC 23 Human hsa-miR-199b-5p cDNA (SEQ ID NO: 211) Human miR-125a-5p (hsa-miR-125a-5p) (SEQ ID NO: 212) UCCCUGAGACCCUUUAACCUGUGA Alignment of Mouse and Human miR-125a-5p (100% identical) 1 TCCCTGAGACCCTTTAACCTGTGA 24 Human hsa-miR-125a-5p cDNA (SEQ ID NO: 213) |||||||||||||||||||||||| 1 TCCCTGAGACCCTTTAACCTGTGA 24 Mouse mma-miR-125a-5p cDNA (SEQ ID NO: 214) Human homologue of mouse miR-133b-3p (hsa-miR-133b) (SEQ ID NO: 215) UUUGGUCCCCUUCAACCAGCUA Alignment of Mouse and Human miR-133b-3p (100% identical) 1 TTTGGTCCCCTTCAACCAGCTA 22 Mouse mmu-miR-133b-g3p cDNA (SEQ ID NO: 216) |||||||||||||||||||||| 1 TTTGGTCCCCTTCAACCAGCTA 22 Human mmu-miR-133b cDNA (SEQ ID NO: 217) Human miR-24-3p (hsa-miR-24-3p) (SEQ ID NO: 218) UGGCUCAGUUCAGCAGGAACAG Alignment of Mouse and Human miR-24-3p (100% identical) 1 TGGCTCAGTTCAGCAGGAACAG 22 Mouse mmu-miR-24-3p cDNA (SEQ ID NO: 219) |||||||||||||||||||||| 1 TGGCTCAGTTCAGCAGGAACAG 22 Human hsa-miR-24-3p cDNA (SEQ ID NO: 220) Human homologue of mouse miR-21a-5p (hsa-miR-21-5p) (SEQ ID NO: 221) UAGCUUAUCAGACUGAUGUUGA Alignment of Mouse miR-21a-5p and Human miR-21-5p (100% identical) 1 TAGCTTATCAGACTGATGTTGA 22 Mouse mmu-miR-21a-5p cDNA (SEQ ID NO: 222) |||||||||||||||||||||| 1 TAGCTTATCAGACTGATGTTGA 22 Human hsa-miR-21-5p cDNA (SEQ ID NO: 223) Human miR-503-5p (hsa-miR-503-5p) (SEQ ID NO: 224) UAGCAGCGGGAACAGUUCUGCAG Alignment of Mouse and Human miR-503-5p (100% identical) 1 TAGCAGCGGGAACAGTACTGCAG 23 Mouse mmu-miR-503-5p cDNA (SEQ ID NO: 225) |||||||||||||||| ||||| 1 TAGCAGCGGGAACAGTTCTGCAG 23 Human hsa-miR-503-5p cDNA (SEQ ID NO: 226) Human miR-328-3p (hsa-miR-328-3p) (SEQ ID NO: 227) CUGGCCCUCUCUGCCCUUCCGU Alignment of Mouse and Human miR-328-3p (100% identical) 1 CTGGCCCTCTCTGCCCTTCCGT 22 Mouse mmu-miR-328-3p cDNA (SEQ ID NO: 228) |||||||||||||||||||||| 1 CTGGCCCTCTCTGCCCTTCCGT 22 Human hsa-miR-328-3p cDNA (SEQ ID NO: 229) Human miR-let-7g-5p (hsa-miR-let-7g-5p) (SEQ ID NO: 230) UGAGGUAGUAGUUUGUACAGUU Alignment of Mouse and Human miR-let-7g-5p (100% identical) 1 TGAGGTAGTAGTTTGTACAGTT 22 Mouse mmu-miR-let-7g-5p cDNA (SEQ ID NO: 231) |||||||||||||||||||||| 1 TGAGGTAGTAGTTTGTACAGTT 22 Human hsa-miR-let-7g-5p cDNA (SEQ ID NO: 232) Human miR-362-3p (hsa-miR-362-3p) (SEQ ID NO: 233) AACACACCUAUUCAAGGAUUCA Alignment of Mouse and Human miR-362-3p (95% identical) 1 AACACACCTGTTCAAGGATTCA 22 Mouse mmu-miR-362-3p cDNA (SEQ ID NO: 234) ||||||||| |||||||||||| 1 AACACACCTATTCAAGGATTCA 22 Human hsa-miR-362-3p cDNA (SEQ ID NO: 235) Human miR-199a-5p (hsa-miR-199a-5p) (SEQ ID NO: 236) CCCAGUGUUCAGACUACCUGUUC Alignment of Mouse and Human miR-199a-5p (100% identical) 1 CCCAGTGTTCAGACTACCTGTTC 23 Mouse mmu-miR-199a-5p cDNA (SEQ ID NO: 237) ||||||||||||||||||||||| 1 CCCAGTGTTCAGACTACCTGTTC 23 Human hsa-miR-199a-5p cDNA (SEQ ID NO: 238) Human miR-15a-3p (hsa-miR-15a-3p) (SEQ ID NO: 239) CAGGCCAUAUUGUGCUGCCUCA Alignment of Mouse and Human miR-15a-3p (95% identical) 1 CAGGCCATACTGTGCTGCCTCA 22 Mouse mmu-miR-15a-3p cDNA (SEQ ID NO: 240) ||||||||| |||||||||||| 1 CAGGCCATATTGTGCTGCCTCA 22 Human hsa-miR-15a-3p cDNA (SEQ ID NO: 241) Human miR-139-5p (hsa-miR-139-5p) (SEQ ID NO: 242) UCUACAGUGCACGUGUCUCCAGU Alignment of Mouse and Human miR-139-5p (100% identical 1 TCTACAGTGCACGTGTCTCCAG 22 Mouse mmu-miR-139-5p cDNA (SEQ ID NO: 243 |||||||||||||||||||||| 1 TCTACAGTGCACGTGTCTCCAG 22 Human hsa-miR-139-5p cDNA (SEQ ID NO: 244) Human miR-149-5p (hsa-miR-149-5p) (SEQ ID NO: 245) UCUGGCUCCGUGUCUUCACUCCC Alignment of Mouse and Human miR-149-5p (100% identical) 1 TCTGGCTCCGTGTCTTCACTCCC 23 Mouse mmu-miR-149-5p cDNA (SEQ ID NO: 246) ||||||||||||||||||||||| 1 TCTGGCTCCGTGTCTTCACTCCC 23 Human hsa-miR-149-5p cDNA (SEQ ID NO: 247) Human miR-29b-3p (hsa-miR-29b-3p) (SEQ ID NO: 248) UAGCACCAUUUGAAAUCAGUGUU Alignment of Mouse and Human miR-29b-3p (100% identical) 1 TAGCACCATTTGAAATCAGTGTT 23 Mouse mmu-miR-29b-3p cDNA (SEQ ID NO: 249) ||||||||||||||||||||||| 1 TAGCACCATTTGAAATCAGTGTT 23 Human hsa-miR-23b-3p cDNA (SEQ ID NO: 250) Human homologue of mouse miR-1a-3p (hsa-miR-1-3p) (SEQ ID NO: 251) UGGAAUGUAAAGAAGUAUGUAU
Alignment of Mouse and Human miR-1a-3p) 1 TGGAATGTAAAGAAGTATGTAT 22 Mouse mmu-miR-1a-3p cDNA (SEQ ID NO: 252) |||||||||||||||||||||| 1 TGGAATGTAAAGAAGTATGTAG 22 Human hsa-miR-1-3p cDNA (SEQ ID NO: 253) Human miR-23b-3p (hsa-miR-23b-3p) (SEQ ID NO: 254) AUCACAUUGCCAGGGAUUACC Alignment of Mouse and Human miR-23b-3p (100% identical) 1 ATCACATTGCCAGGGATTACC 21 Mouse mmu-miR-23b-3p cDNA (SEQ ID NO: 255) ||||||||||||||||||||| 1 ATCACATTGCCAGGGATTACC 21 Human hsa-miR-23b-3p cDNA (SEQ ID NO: 256) Human miR-215-5p (hsa-miR-215-5p) (SEQ ID NO: 257) AUGACCUAUGAAUUGACAGAC Alignment of Mouse and Human miR-215-5p (95% identical) 1 ATGACCTATGATTTGACAGAC 21 Mouse mmu-miR-215-5p cDNA (SEQ ID NO: 258) ||||||||||| ||||||||| 1 ATGACCTATGAATTGACAGAC 21 Human hsa-miR-215-5p cDNA (SEQ ID NO: 259) Human miR-204-5p (hsa-miR-204-5p) (SEQ ID NO: 260) UUCCCUUUGUCAUCCUAUGCCU Alignment of Mouse and Human miR-204-5p (100% identical) 1 TTCCCTTTGTCATCCTATGCCT 22 Mouse mmu-miR-204-5p cDNA (SEQ ID NO: 261) |||||||||||||||||||||| 1 TTCCCTTTGTCATCCTATGCCT 22 Human hsa-204-5p cDNA (SEQ ID NO: 262) Human miR-200b-5p (hsa-miR-200b-5p) (SEQ ID NO: 263) CAUCUUACUGGGCAGCAUUGGA Alignment of Mouse and Human miR-200b-5p (100% identical) 1 CATCTTACTGGGCAGCATTGGA 22 Mouse mmu-miR-200b-5p cDNA (SEQ ID NO: 264) |||||||||||||||||||||| 1 CATCTTACTGGGCAGCATTGGA 22 Human hsa-miR-200b-5p cDNA (SEQ ID NO: 265) Human miR-25-3p (hsa-miR-25-3p) (SEQ ID NO: 266) CAUUGCACUUGUCUCGGUCUGA Alignment of Mouse and Human miR-25-3p (100% identical) 1 CATTGCACTTGTCTCGGTCTGA 22 Mouse mmu-miR-25-3p cDNA (SEQ ID NO: 267) |||||||||||||||||||||| 1 CATTGCACTTGTCTCGGTCTGA 22 Human hsa-miR-25-3p cDNA (SEQ ID NO: 268) Human miR-338-3p (hsa-miR-338-3p) (SEQ ID NO: 269) UCCAGCAUCAGUGAUUUUGUUG Alignment of Mouse and Human miR-338-3p (100% identical) 1 TCCAGCATCAGTGATTTTGTTG 22 Mouse mmu-miR-338-3p cDNA (SEQ ID NO: 270) |||||||||||||||||||||| 1 TCCAGCATCAGTGATTTTGTTG 22 Human hsa-miR-338-3p cDNA (SEQ ID NO: 271) Human miR-196b-5p (hsa-miR-196b-5p) (SEQ ID NO: 272) UAGGUAGUUUCCUGUUGUUGGG Alignment of Mouse and Human miR-196b-5p (100% identical) 1 TAGGTAGTTTCCTGTTGTTGGG 22 Mouse mmu-miR-196b-5p cDNA (SEQ ID NO: 273) |||||||||||||||||||||| 1 TAGGTAGTTTCCTGTTGTTGGG 22 Human hsa-miR-196b-5p cDNA (SEQ ID NO: 274)
[0169] A variety of methods for isolating miRNA from blood or serum are known in the art. Not all methods of detecting and/or measuring miRNAs include isolating relevant miRNAs from a blood or serum sample. See, e.g., Shaffer et al., Li et al., Anal. Biochem. 431:69-75, 2012. A variety of methods for determining the presence or absence, or a level of a target miRNA are well-known in the art. For example, the presence or absence, or level(s) of one or more miRNAs in a sample(s) can be determined by amplifying the miRNAs present in the sample(s) to generate amplification products, contacting the amplified products to a substrate, and detecting the amplified products bound to the substrate. For example, the presence or absence, or levels of a target miRNA can be determined using quantitative RT-PCR (qPCR) using stem-loop reverse transcriptase primers combined with TaqMan PCR (Applied Biosystems, Foster City, Calif.) analysis (Chen et al., Nucleic Acids Res. 33:e179, 2005; Liang et al., BMC Genomics 8:166, 2007), qPCR with locked nucleic acid primers (Exiqon, Vedbaek, Denmark) (Raymond et al., RNA 11:1737-1744, 2005), qPCR using poly(A) tailing (Qiagen, Valencia, Calif.) (RT miRNA qPCR Assay), high-throughput sequencing of small RNA libraries (Landgraf et al., Cell 129:1401-1414, 2007), and microarray analysis (Mattie et al., Mol. Cancer 5:24, 2006; Bloomston et al., JAMA 297:1901-1908, 2007; Porkka et al., Cancer Res. 67:6130-6135, 2007; Calin et al., Proc. Natl. Acad. Sci. U.S.A. 101:11755-11760, 2004; Volinia et al., Proc. Natl. Acad. Sci. U.S.A. 103:2257-2261, 2006; Wang et al., RNA 13:151-159, 2007). Additional exemplary methods for determining the presence or absence, or a level of miRNA in a sample, including a biological fluid, are described herein.
Treatments for Reducing Radiation-Induced Damage
[0170] A variety of treatments for reducing radiation-induced damage are known in the art. Non-limiting examples of treatments for reducing radiation-induced damage include administering one or more of a cytokine (e.g., granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim), potassium iodide, Prussian blue, and diethylenetriamine pentaacetic acid to a subject exposed to a significant level of radiation, and/or performing bone marrow transplantation, blood transfusion, and/or surgery to remove damaged tissues from a subject exposed to a significant level of radiation. In some examples, treatment for reducing radiation-induced damage includes administering of two or more doses of one or more of a cytokine (e.g., granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim), potassium iodide, Prussian blue, and diethylenetriamine pentaacetic acid to a subject exposed to a significant level of radiation. In some examples, treatment for reducing radiation-induced damage includes performing one or more bone marrow transplantations and/or one or more blood transfusions on a subject exposed to a significant level of radiation. In some examples, treatment for reducing radiation-induced damage includes hospitalizing a subject exposed to a significant level of radiation. In some embodiments, treatment for reducing radiation-induced damage includes performing outpatient treatment on a subject determined to have been exposed to a low dose of radiation (e.g., less than 2 Gy, less than 1.5 Gy, less than 1 Gy, less than 0.5 Gy of radiation).
[0171] Some embodiments of any of the methods described herein further include administering a treatment for reducing radiation-induced damage (e.g., any of the treatments for reducing radiation-induced damage described herein) to the subject.
Methods of Determining a Subject's Level of Exposure to Radiation
[0172] Provided herein are methods of determining a subject's level of exposure to radiation that include determining a level of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p in a sample including biological fluid from the subject; comparing the level(s) of the one or more miRNAs in the sample to a reference level(s) of the one or more miRNAs; and determining the subject's level of exposure to radiation based on the comparison of the level(s) of one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0173] In some examples, the reference level(s) is the level(s) of the one or more miRNAs in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to 0.2 Gy or less of radiation, a subject exposed to 0.4 Gy or less of radiation, a subject exposed to 0.6 Gy or less of radiation, a subject exposed to 0.8 Gy or less of radiation, or a subject exposed to 1 Gy or less of radiation. Additional examples of reference levels of the one or more miRNAs are described below.
[0174] In some examples, the subject is a mouse and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of: mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In these examples, e.g., one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference level(s) (e.g., the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation), indicates that the subject's exposure to radiation is equal to or less than 2 Gy; one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference level(s) (e.g., a level in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), indicates that the subject's exposure to radiation is between greater than 2 Gy and about 6.5 Gy; and/or one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s) (e.g., the level(s) of in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation), indicates that the subject's exposure to radiation is greater than about 6.5 Gy.
[0175] In some examples, the subject is a human, and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In these examples, e.g., one or more one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue or mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference level(s) (e.g., the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation), indicates that the subject's exposure to radiation is equal to or less than 2 Gy; one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue of mouse miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference level(s) (e.g., a level in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), indicates that the subject's exposure to radiation is between greater than 2 Gy and about 6.5 Gy; and/or one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologue of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s) (e.g., the level(s) of in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation), indicates that the subject's exposure to radiation is greater than about 6.5 Gy.
[0176] The level(s) of the one or more miRNAs can be measured using any of the methods described herein or known in the art. The subject can be any subject described herein or known in the art.
[0177] Some examples of these methods include administering (and optionally both selecting and administering) a treatment to the subject based on the subject's determined level of exposure to radiation. For example, the methods can include hospitalizing a subject determined to have been exposed to greater than 2 Gy of radiation (e.g., about or greater than 6.5 Gy of radiation, or greater than 8 Gy of radiation), or treating a subject determined to have been exposed to about 2 Gy or less of radiation on an outpatient basis.
[0178] Some examples further include recording the subject's determined exposure to radiation into the subject's clinical file (e.g., a computer readable medium). Some examples further include communicating the subject's determined exposure to radiation to a governmental agency or a health organization. Some examples further include informing and isolating a subject determined to have been exposed to greater than 2 Gy of radiation (e.g., about or greater than 6.5 Gy of radiation, or about or greater than 8 Gy of radiation). Some examples further include informing one or more of the subject's physician, family, and employer of the subject's determined exposure to radiation. Some examples further include triaging a subject based on his or her determined exposure to radiation.
Methods of Determining Whether a Subject has been Exposed to 2 Gy or More of Radiation
[0179] Also provided herein are methods of determining whether a subject has been exposed to a radiation dose of 2 Gy or more that include determining a level of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p in a sample including a biological fluid from the subject; comparing the level(s) of the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) miRNAs in the sample with reference level(s) of the one or more miRNAs; and determining whether the subject has been exposed to a radiation dose of 2 Gy or more based on the comparison of the level(s) of the one or more mRNAs in the sample with the reference level(s) of the one or more miRNAs.
[0180] In some examples, the reference level(s) is the level(s) of the one or more miRNAs in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to 0.2 Gy or less of radiation, a subject exposed to 0.4 Gy or less of radiation, a subject exposed to 0.6 Gy or less of radiation, a subject exposed to 0.8 Gy or less of radiation, or a subject exposed to 1 Gy or less of radiation. Additional examples of reference levels of the one or more miRNAs are described below.
[0181] In some examples, the subject is a mouse and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p. In these examples, one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p, and/or and a decreased level of one or more of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p in the sample, as compared to the reference level(s) (e.g., any of the reference levels described herein), indicates that the subject has been exposed to 2 Gy or more of radiation. For example, the reference level(s) for mouse miR-130a-3p, miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p are the level(s) of mouse miR-130a-5p, miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; the reference level for mouse miR-17-3p is the level of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation; and/or the reference level(s) for mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p is the level(s) of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation.
[0182] In some examples, the subject is a human and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p. In these examples, one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p, and/or a decreased level of one or more of the human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p in the sample, as compared to the reference level(s) (e.g., any of the reference levels described herein), indicates that the subject has been exposed to 2 Gy or more of radiation. For example, the reference level(s) for the human homologues of mouse miR-130a-3p and miR-150-5p are the levels of the human homologues of mouse miR-130a-5p, miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; the reference level for the human homologue of mouse miR-17-3p is the level of the human homologue of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation; and/or the reference level(s) for the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p are the levels of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation.
[0183] The level(s) of the one or more miRNAs can be measured using any of the methods described herein or known in the art. The subject can be any subject described herein or known in the art.
[0184] Some examples of these methods include administering (and optionally both selecting and administering) a treatment for reducing radiation-induced damage to the subject determined to have been exposed to 2 Gy or more of radiation. For example, the methods include hospitalizing a subject determined to have been exposed to greater than 2 Gy of radiation (e.g., about or greater than 6.5 Gy of radiation, or greater than 8 Gy of radiation), and/or performing bone marrow transplantation, performing blood transfusion, administering a cytokine (e.g., any of the cytokines described herein) and/or performing surgery to remove damaged tissues on a subject determined to have been exposed to 2 Gy or more of radiation.
[0185] Some examples further include recording the determination that the subject has been exposed to 2 Gy or more of radiation into the subject's clinical file (e.g., a computer readable medium). Some examples further include communicating the determination that the subject has been exposed to 2 Gy or more of radiation to a governmental agency or a health organization. Some examples further include informing and isolating a subject determined to have been exposed to 2 Gy or more of radiation (e.g., about or greater than 6.5 Gy of radiation, or greater than 8 Gy of radiation). Some examples further include informing one or more of the subject's physician, family, and employer of the determination that the subject has been exposed to 2 Gy or more of radiation. Some examples further include triaging a subject based on the determination that the subject has been exposed to 2 Gy or more of radiation.
Methods of Determining a Subject's Risk of Poor Prognosis from Radiation Exposure
[0186] Also provided are methods of determining a subject's risk of poor prognosis from radiation exposure that include determining a level of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs in a sample including a biological fluid from a subject; comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs; and determining the subject's risk of poor prognosis from radiation exposure based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0187] In some examples, the reference level(s) is the level(s) of the one or more miRNAs in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to 0.2 Gy or less of radiation, a subject exposed to 0.4 Gy or less of radiation, a subject exposed to 0.6 Gy or less of radiation, a subject exposed to 0.8 Gy or less of radiation, or a subject exposed to 1 Gy or less of radiation. Additional examples of reference levels of the one or more miRNAs are described below.
[0188] In some examples, the subject is a mouse, and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In these examples, one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference level(s) (e.g., the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation), indicates that the subject's risk of poor prognosis from radiation exposure is moderate (e.g., less than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to a dose of between greater than 2 Gy and about 6.5 Gy and less than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to a dose of greater than about 6.5 Gy); one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-34b-3p, miR-126-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference level(s) (e.g., a level in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), indicates that the subject's risk of poor prognosis from radiation exposure is high (e.g., greater than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to 2 Gy or less of radiation and less than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to greater than about 6.5 Gy (e.g., about 8 Gy or more) radiation); and/or one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s) (e.g., the level(s) of in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation), indicates that the subject's risk of poor prognosis from radiation exposure is very high (e.g., greater than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to 2 Gy or less of radiation and greater than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to about 6.5 Gy of radiation).
[0189] In some examples, the subject is a human, and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of the human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In these examples, one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference level(s) (e.g., the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation), indicates that the subject's risk of poor prognosis from radiation exposure is moderate (e.g., less than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to a dose of between greater than 2 Gy and about 6.5 Gy and less than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to a dose of greater than about 6.5 Gy); one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue of mouse miR-34b-3p, miR-126-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference level(s) (e.g., a level in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), indicates that the subject's risk of poor prognosis from radiation exposure is high (e.g., greater than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to 2 Gy or less of radiation and less than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to greater than about 6.5 Gy (e.g., about 8 Gy or more) radiation); and/or one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologue of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s) (e.g., the level(s) of in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation), indicates that the subject's risk of poor prognosis from radiation exposure is very high (e.g., greater than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to 2 Gy or less of radiation and greater than the risk of poor prognosis from radiation exposure in a subject determined to have been exposed to about 6.5 Gy of radiation).
[0190] The level(s) of the one or more miRNAs can be measured using any of the methods described herein or known in the art. The subject can be any subject described herein. Some examples of these methods include administering (and optionally both selecting and administering) a treatment for reducing radiation-induced damage to the subject identified as having a very high risk or high risk of poor prognosis from radiation exposure. For example, the methods can include hospitalizing a subject identified as having a very high risk or high risk of poor prognosis from radiation exposure, and/or performing bone marrow transplantation and/or performing blood transfusion, and/or administering a cytokine (e.g., any of the cytokines described herein), and/or performing surgery to remove damaged tissues on a subject identified as having a very high risk or high risk of poor prognosis from radiation exposure. Some embodiments further include treating a subject identified as having a moderate risk of poor prognosis from radiation exposure on an outpatient basis.
[0191] Some examples further include recording the subject's identified risk of poor prognosis from radiation exposure in the subject's clinical file (e.g., a computer readable medium). Some examples further include communicating the subject's identified risk of poor prognosis from radiation exposure to a governmental agency or a health organization. Some examples further include informing and isolating a subject identified as having a very high risk or high risk of poor prognosis from radiation exposure. Some examples further include informing one or more of the subject's physician, family, and employer of the subject's identified risk of poor prognosis from radiation exposure. Some examples further include triaging a subject based on his or her identified risk of poor prognosis from radiation exposure.
[0192] Poor prognosis from radiation exposure can include one or more of death resulting from radiation exposure (e.g., death within 1 day to 5 years, 1 day to 4 years, 1 day to 3 years, 1 day to 2 years, 1 day to 1 year, 1 day to 6 months, 1 day to 2 months, 1 day to 7 weeks, 1 day to 6 weeks, 1 day to 5 weeks, 1 day to 4 weeks, 1 day to 3 weeks, 1 day to 2 weeks, or 1 day to 1 week), hospitalization resulting from radiation exposure (e.g., death within 1 day to 5 years, 1 day to 4 years, 1 day to 3 years, 1 day to 2 years, 1 day to 1 year, 1 day to 6 months, 1 day to 2 months, 1 day to 7 weeks, 1 day to 6 weeks, 1 day to 5 weeks, 1 day to 4 weeks, 1 day to 3 weeks, 1 day to 2 weeks, or 1 day to 1 week), leukopenia resulting from radiation exposure, infection resulting from radiation exposure, requirement of bone marrow transplantation, and requirement of surgery to remove damaged tissues.
Methods of Assessing a Subject's Risk of Subsequent Development of Radiation Disease
[0193] Also provided are methods of assessing a subject's risk of subsequent development of radiation disease that include determining a level of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs in a sample including a biological fluid from a subject; comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs; and determining the subject's risk of subsequent development of radiation disease based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0194] In some examples, the reference level(s) is the level(s) of the one or more miRNAs in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to 0.2 Gy or less of radiation, a subject exposed to 0.4 Gy or less of radiation, a subject exposed to 0.6 Gy or less of radiation, a subject exposed to 0.8 Gy or less of radiation, or a subject exposed to 1 Gy or less of radiation. Additional examples of reference levels of the one or more miRNAs are described below.
[0195] In some examples, the subject is a mouse, and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In these examples, one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference level(s) (e.g., the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation), indicates that the subject's risk of subsequent development of radiation disease is moderate (e.g., less than the risk of subsequent development of radiation disease in a subject determined to have been exposed to a dose of between greater than 2 Gy and about 6.5 Gy and less than the risk of subsequent development of radiation disease in a subject determined to have been exposed to a dose of greater than about 6.5 Gy); one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-34b-3p, miR-126-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference level(s) (e.g., level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), indicates that the subject's risk of subsequent development of radiation disease is high (e.g., greater than the risk of subsequent development of radiation disease in a subject determined to have been exposed to 2 Gy or less of radiation and less than the risk of subsequent development of radiation disease in a subject determined to have been exposed to greater than about 6.5 Gy (e.g., about 8 Gy or more) radiation)); and/or one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s) (e.g., the level(s) of in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation), indicates that the subject's risk of subsequent development of radiation disease is very high (e.g., greater than the risk of subsequent development of radiation disease in a subject determined to have been exposed to 2 Gy or less of radiation and greater than the risk of subsequent development of radiation disease in a subject determined to have been exposed to about 6.5 Gy of radiation).
[0196] In some examples, the subject is a human, and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of the human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In these examples, one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference level(s) (e.g., the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation), indicates that the subject's risk of subsequent development of radiation disease is moderate (e.g., less than the risk of subsequent development of radiation disease in a subject determined to have been exposed to a dose of between greater than 2 Gy and about 6.5 Gy and less than the risk of subsequent development of radiation disease in a subject determined to have been exposed to a dose of greater than about 6.5 Gy); one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue of mouse miR-34b-3p, miR-126-3p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologue of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference level(s) (e.g., level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), indicates that the subject's risk of subsequent development of radiation disease is high (e.g., greater than the risk of subsequent development of radiation disease in a subject determined to have been exposed to 2 Gy or less of radiation and less than the risk of subsequent development of radiation disease in a subject determined to have been exposed to greater than about 6.5 Gy (e.g., about 8 Gy or more) radiation)); and/or one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologue of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologue of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s) (e.g., the level(s) of in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation), indicates that the subject's risk of subsequent development of radiation disease is very high (e.g., greater than the risk of subsequent development of radiation disease in a subject determined to have been exposed to 2 Gy or less of radiation and greater than the risk of subsequent development of radiation disease in a subject determined to have been exposed to about 6.5 Gy of radiation).
[0197] The level(s) of the one or more miRNAs can be measured using any of the methods described herein or known in the art. The subject can be any subject described herein or known in the art.
[0198] Some examples of these methods include administering (and optionally both selecting and administering) a treatment for reducing radiation-induced damage to the subject identified as having a very high risk or high risk of subsequent development of radiation disease. For example, the methods can include hospitalizing a subject identified as having a very high risk or high risk of subsequent development of radiation disease, and/or performing bone marrow transplantation, performing blood transfusion, administering a cytokine (e.g., any of the cytokines described herein) and/or performing surgery to remove damaged tissues on a subject identified as having a very high risk or high risk of subsequent development of radiation disease. Some embodiments further include treating a subject identified as having a moderate risk of subsequent development of radiation disease on an outpatient basis.
[0199] Some examples further include recording the subject's identified risk of subsequent development of radiation disease in the subject's clinical file (e.g., a computer readable medium). Some examples further include communicating the subject's identified risk of subsequent development of radiation disease to a governmental agency or a health organization. Some examples further include informing and isolating a subject identified as having a very high risk or high risk of subsequent development of radiation disease. Some examples further include informing one or more of the subject's physician, family, and employer of the subject's identified risk of subsequent development of radiation disease. Some examples further include triaging a subject based on his or her identified risk of subsequent development of radiation disease.
Methods of Selecting a Treatment for a Subject
[0200] Also provided herein are methods of selecting a treatment for a subject that include determining a level(s) of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p, in a sample including a biological fluid from the subject; comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs; and selecting a treatment for reducing radiation-induced damage (e.g., any of the exemplary treatments for reducing radiation-induced damage described herein or known in the art) for a subject based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0201] Non-limiting examples of treatments for reducing radiation-induced damage include administration of one or more of a cytokine (e.g., granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim), potassium iodide, Prussian blue, and diethylenetriamine pentaacetic acid, and performance of bone marrow transplantation, blood transfusion, and surgery to remove damaged tissues. In some examples, the selected treatment includes inpatient treatment.
[0202] In some examples, the reference level(s) is the level(s) of the one or more miRNAs in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to 0.2 Gy or less of radiation, a subject exposed to 0.4 Gy or less of radiation, a subject exposed to 0.6 Gy or less of radiation, a subject exposed to 0.8 Gy or less of radiation, or a subject exposed to 1 Gy or less of radiation. Additional examples of reference levels of the one or more miRNAs are described below.
[0203] In some examples, the subject is a mouse and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p. In some examples, a treatment for reducing radiation-induced damage is selected for a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s) (e.g., any of the reference levels described herein). In some examples, a treatment for reducing radiation-induced damage is not selected for a subject having a non-elevated level of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and a non-decreased level of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s) (e.g., any of the reference levels described herein). In some examples, the reference level(s) for mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p is the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; the reference level for mouse miR-17-3p is the level of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation; and/or the reference level(s) of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p is the level(s) of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation.
[0204] In some examples, the subject is a human and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p. In some examples, a treatment for reducing radiation-induced damage is selected for a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s) (e.g., any of the reference levels described herein). In some examples, a treatment for reducing radiation-induced damage is not selected for a subject having a non-elevated level of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and a non-decreased level of the human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s) (e.g., any of the reference levels described herein). In some examples, the reference level(s) for the human homologues of mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p is the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; the reference level for the human homologue of mouse miR-17-3p is the level of the human homologue of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation; and/or the reference level(s) of the human homologue of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p is the level(s) of the human homologue of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation.
[0205] The level(s) of the one or more miRNAs can be measured using any of the methods described herein or known in the art. The subject can be any subject described herein or known in the art.
[0206] Some embodiments of any of the methods described herein further include administering the selected treatment to the subject.
[0207] Some examples further include recording the selected treatment in the subject's clinical file (e.g., a computer readable medium). Some examples further include communicating the selected treatment to a governmental agency or a health organization. Some examples further include informing a subject of the treatment selected for him or her. Some examples further include informing one or more of the subject's physician, family, and employer of the treatment selected for the subject.
Methods of Selecting a Subject for Treatment
[0208] Also provided herein are methods of selecting a subject for treatment of radiation disease that include determining a level(s) of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p and human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p, in a sample including a biological fluid from the subject; comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs (e.g., any of the exemplary reference levels described herein); and selecting a subject for treatment of radiation disease based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0209] Non-limiting examples of treatments for radiation disease (e.g., a treatment for reducing radiation-induced damage) include administration of one or more of a cytokine (e.g., granulocyte colony-stimulating factor, filgrastim, and pegfilgrastim), potassium iodide, Prussian blue, and diethylenetriamine pentaacetic acid, and/or performance of bone marrow transplantation, blood transfusion, and/or surgery to remove tissues damaged by radiation exposure. In some examples, treatment for radiation disease includes inpatient treatment.
[0210] In some examples, the reference level(s) is the level(s) of the one or more miRNAs in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to 0.2 Gy or less of radiation, a subject exposed to 0.4 Gy or less of radiation, a subject exposed to 0.6 Gy or less of radiation, a subject exposed to 0.8 Gy or less of radiation, or a subject exposed to 1 Gy or less of radiation. Additional examples of reference levels of the one or more miRNAs are described below.
[0211] In some examples, the subject is a mouse and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p. In some examples, a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s) (e.g., any of the reference levels described herein) is selected for treatment of radiation disease; or a subject not having an elevated level of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and not having a decreased level of one or more of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s) (e.g., any of the reference levels described herein) is not selected for treatment of radiation disease. In some examples, the reference levels for mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p is the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; the reference level for mouse miR-17-3p is the level of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation; and/or the reference level(s) of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p is the level(s) of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation.
[0212] In some examples, the subject is a human and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p. In some examples, a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more the human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s) (e.g., any of the reference levels described herein) is selected for treatment of radiation disease; or a subject not having an elevated level of the human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and not having a decreased level of one or more of the human homologues of mouse miR-150-5p, miR-17-3p, miR-18'7-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p in the sample, as compared to reference level(s) (e.g., any of the reference levels described herein) is not selected for treatment of radiation disease. In some examples, the reference level(s) of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-320-3p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-142-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, and miR-338-3p is the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation; the reference level of the human homologue of mouse miR-17-3p is the level of the human homologue of mouse miR-17-3p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation; and/or the reference level(s) of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p is the level(s) of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation.
[0213] The level(s) of the one or more miRNAs can be measured using any of the methods described herein or known in the art. The subject can be any subject described herein or known in the art.
[0214] Some embodiments of any of the methods described herein further include administering a treatment for radiation disease (e.g., any of the treatments for reducing radiation-induced damage) to the subject selected for treatment of radiation disease. Some examples further include recording in the subject's clinical file (e.g., a computer readable medium) that he or she has been selected for treatment of radiation disease or has not been selected for treatment of radiation disease. Some examples further include communicating to a governmental agency or a health organization that the subject has been selected for treatment of radiation disease or has not been selected for treatment of radiation disease. Some examples further include informing the subject that he or she has been selected for treatment of radiation disease or that he or she has not been selected for treatment of radiation disease. Some examples further include informing one or more of the subject's physician, family, and employer that the subject has been selected for treatment of radiation disease or that the subject has not been selected for treatment of radiation disease.
Methods of Triaging Subjects Exposed or Suspected of Being Exposed to Radiation
[0215] Also provided herein are methods of triaging a plurality of subjects exposed or suspected of being exposed to radiation that include determining a level of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p and human homologues of one or more of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p in a sample including a biological fluid from the subject; comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs (e.g., any of the reference levels described herein); and triaging the subject based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0216] In some examples, the reference level(s) is the level(s) of the one or more miRNAs in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to 0.2 Gy or less of radiation, a subject exposed to 0.4 Gy or less of radiation, a subject exposed to 0.6 Gy or less of radiation, a subject exposed to 0.8 Gy or less of radiation, or a subject exposed to 1 Gy or less of radiation. Additional examples of reference levels of the one or more miRNAs are described below.
[0217] In some examples, the subject is a mouse and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In such examples, a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference level(s) (e.g., the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation), is given low priority in triaging (e.g., subjects having high priority and medium priority are seen by a physician or treated before subjects having low priority); a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference level(s), (e.g., a level in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), is given medium priority in triaging (e.g., subjects having high priority are seen by a physician or treated before subjects having medium priority, and subjects having medium priority are seen by a physician or treated before subjects having low priority); and/or a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s) (e.g., a level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), is given high priority in triaging (e.g., subjects having high priority are seen by a physician or treated before subjects having medium or low priority).
[0218] In some examples, the subject is a human and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) miRNAs are selected from the group of the human homologues of mouse miR-130a-3p, miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, miR-30c-5p, miR-142-5p, miR-320-3p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-126-3p, miR-706, miR-375-3p, miR-29a-5p, miR-193a-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-1195, miR-122-5p, miR-1839-3p, miR-500-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-29a-3p, miR-1839-5p, miR-30a-5p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-15a-3p, miR-139-5p, miR-149-5p, miR-29b-3p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p. In such examples, a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologues of mouse miR-130a-3p, miR-136-5p, miR-30c-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-17-3p, miR-29a-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologues of mouse miR-150-5p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-30a-3p, miR-194-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, miR-204-5p, and miR-187-3p in the sample, as compared to the reference level(s) (e.g., the level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation), is given low priority in triaging (e.g., subjects having high priority and medium priority are seen by a physician or treated before subjects having low priority); a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologues of mouse miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-30a-3p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, miR-25-3p, and miR-196b-5p, and/or a decreased level of one or more of the human homologues of mouse miR-17-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-194-5p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-27a-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-29b-3p, miR-215-5p, miR-187-3p, and miR-338-3p in the sample, as compared to the reference level(s), (e.g., a level in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), is given medium priority in triaging (e.g., subjects having high priority are seen by a physician or treated before subjects having medium priority, and subjects having medium priority are seen by a physician or treated before subjects having low priority); and/or a subject having one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64) of: an elevated level of one or more of the human homologues of mouse miR-30a-3p, miR-30c-5p, miR-320-3p, miR-30c-5p, miR-126-3p, miR-375-3p, miR-99b-5p, miR-151-3p, miR-let-7d-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-1195, miR-1839-3p, miR-30e-3p, miR-322-3p, miR-709, miR-486a-3p, miR-133a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-328-3p, miR-let-7g-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-204-5p, miR-200b-5p, and miR-25-3p, and/or a decreased level of one or more of the human homologues of mouse miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-150-5p, miR-136-5p, miR-33-5p, miR-142a-3p, miR-706, miR-29a-5p, miR-193a-3p, miR-497a-5p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-32-5p, miR-214-5p, miR-326-3p, miR-122-5p, miR-500-3p, miR-29a-3p, miR-199b-5p, miR-21a-5p, miR-503-5p, miR-362-3p, miR-199a-5p, miR-15a-3p, miR-17-3p, miR-130a-3p, miR-29b-3p, miR-215-5p, miR-338-3p, and miR-196b-5p in the sample, as compared to the reference level(s) (e.g., a level(s) in a sample including a biological fluid from a subject not exposed to a significant dose of radiation or exposed to about 2 Gy or exposed to about 2 Gy or less of radiation), is given high priority in triaging (e.g., subjects having high priority are seen by a physician or treated before subjects having medium or low priority).
[0219] The level(s) of the one or more miRNAs can be measured using any of the methods described herein or known in the art. The subject can be any subject described herein or known in the art. In some examples, the plurality of subjects are subjects in an emergency room or housed in an emergency trauma facility.
[0220] Some embodiments of any of the methods described herein further include administering a treatment (e.g., any of the treatments for reducing radiation-induced damage) to a subject given high priority in triaging. Some examples further include recording into a computer system that the subject has been given low, medium, or high priority in triaging. Some examples further include communicating to a governmental agency or a health organization that the subject has been given low, medium, or high priority in triaging. Some examples further include informing the subject that he or she has been given low, medium, or high priority in triaging. Some examples further include informing one or more of the subject's physician, family, and employer that the subject has been given low, medium, or high priority in triaging.
Methods of Determining Efficacy of a Treatment Administered to a Subject Exposed or Suspected of being Exposed to a Significant Dose of Radiation
[0221] Also provided are methods of determining the efficacy of a treatment administered to a subject exposed to a significant dose of radiation that include (a) determining a first level of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) miRNAs in a sample including a biological fluid obtained from the subject exposed to a significant dose of radiation at a first time point; (b) after the first time point and before a second time point, administering a treatment for reducing radiation-induced damage to the subject (e.g., any of the treatments for reducing radiation-induced damage described herein); (c) determining a second level of the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) miRNAs in a sample including a biological fluid obtained from the subject at the second time point; and (d) determining the efficacy of the treatment administered to the subject based on a comparison of the second level(s) of the one or more miRNAs to the first level(s) of the one or more miRNAs.
[0222] In some examples, the subject is a mouse and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) miRNAs are selected from the group of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p. In some examples, one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve) of: an elevation in the second level of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, and/or a decrease in the second level of one or more of mouse miR-130a-3p, miR-126-3p, miR-346-3p, miR-30a-3p, and miR-30c-5p, as compared to the first level(s) of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-130a-3p, miR-126-3p, miR-346-3p, miR-30a-3p, and miR-30c-5p, indicates that the treatment administered to the subject was effective.
[0223] In some examples, the subject is a human and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) miRNAs are selected from the group of human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p. In some examples, one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve) of: an elevation in the second level of one or more of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, and/or a decrease in the second level of one or more of the human homologues of mouse miR-130a-3p, miR-126-3p, miR-346-3p, miR-30a-3p, and miR-30c-5p, as compared to the first level(s) of one or more of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-130a-3p, miR-126-3p, miR-346-3p, miR-30a-3p, and miR-30c-5p, indicates that the treatment administered to the subject was effective.
[0224] Also provided are methods including determining the efficacy of a treatment for reducing radiation-induced damage in a subject exposed to a significant level of radiation that includes (a) determining a level of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) miRNAs in a sample including a biological fluid from a subject previously exposed to a significant level of radiation and thereafter administered a treatment for reducing radiation-induced damage; (b) comparing the level(s) of the one or more miRNAs in the sample to reference level(s) of the one or more miRNAs (e.g., any of the reference levels described herein); and (c) determining the efficacy of the treatment for reducing radiation-induced damage in the subject based on the comparison of the level(s) of the one or more miRNAs in the sample to the reference level(s) of the one or more miRNAs.
[0225] Non-limiting examples of treatments for reducing radiation-induced damage is selected from the group of cytokines (e.g., granulocyte colony-stimulating factor, fligrastim, and pegfilgrastim), potassium iodide, Prussian blue, diethylenetriamine pentaacetic acid, bone marrow transplantation, blood transfusion, and surgery to remove damaged tissues.
[0226] In some examples, the reference level(s) is the level(s) of the one or more miRNAs in a sample including a biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to 0.2 Gy or less of radiation, a subject exposed to 0.4 Gy or less of radiation, a subject exposed to 0.6 Gy or less of radiation, a subject exposed to 0.8 Gy or less of radiation, or a subject exposed to 1 Gy or less of radiation. Additional examples of reference levels of the one or more miRNAs are described below.
[0227] In some examples, the subject is a mouse and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) mRNAs are selected from the group of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p. In some examples, one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve) of: an elevated level of one or more of mouse miR-130a-3p, miR-34-3p, miR-126-3p, miR-30a-3p, and miR-30c-5p, and/or a decreased level of one or more of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, in the sample, as compared to the reference level(s) (e.g., levels in a sample including biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to a significant level of radiation and not administered a treatment or not administered an effective treatment, a subject exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or a subject exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation or levels in a sample including a biological fluid from a control subject that was exposed to a significant level of radiation and administered an effective treatment), indicates that treatment was not effective; or one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) of a non-elevated level of mouse miR-130a-3p, miR-34-3p, miR-126-3p, miR-30a-3p, and miR-30c-5p, and a non-decreased level of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, in the sample, as compared to the reference level(s) (e.g., levels in a sample including biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to a significant level of radiation and not administered a treatment or not administered an effective treatment, a subject exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or a subject exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation or levels in a sample including a biological fluid from a control subject that was exposed to a significant level of radiation and administered an effective treatment), indicates that treatment was effective.
[0228] In some examples, the subject is a human and the one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) mRNAs are selected from the group of the human homologues of mouse miR-130a-3p, miR-142-5p, miR-150-5p, miR-342-3p, miR-34b-3p, miR-126-3p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p. In some examples, one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve) of: an elevated level of one or more of the human homologue of mouse miR-130a-3p, miR-34-3p, miR-126-3p, miR-30a-3p, and miR-30c-5p, and/or a decreased level of one or more of the human homologue of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, in the sample, as compared to the reference level(s) (e.g., levels in a sample including biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to a significant level of radiation and not administered a treatment or not administered an effective treatment, a subject exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or a subject exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation or levels in a sample including a biological fluid from a control subject that was exposed to a significant level of radiation and administered an effective treatment), indicates that treatment was not effective; or one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) of a non-elevated level of the human homologues of mouse miR-130a-3p, miR-34-3p, miR-126-3p, miR-30a-3p, and miR-30c-5p, and a non-decreased level of the human homologues of mouse miR-142-5p, miR-150-5p, miR-342-3p, miR-17-3p, miR-187-3p, miR-194-5p, and miR-27a-3p, in the sample, as compared to the reference level(s) (e.g., levels in a sample including biological fluid from a subject not exposed to a significant dose of radiation, a subject exposed to a significant level of radiation and not administered a treatment or not administered an effective treatment, a subject exposed to about 2 Gy or exposed to about 2 Gy or less of radiation, or a subject exposed to about 6.5 Gy or exposed to about 6.5 Gy or less of radiation or levels in a sample including a biological fluid from a control subject that was exposed to a significant level of radiation and administered an effective treatment), indicates that treatment was effective.
[0229] The level(s) of the one or more miRNAs can be measured using any of the methods described herein or known in the art. For example, the first and second level(s) of the one or more miRNAs in the samples are determined in steps (a) and (c) by amplifying the miRNAs present in the sample(s) to generate amplification products, contacting the amplified products to a substrate, and detecting the amplified products bound to the substrate. The subject can be any subject described herein or known in the art.
[0230] Some embodiments further include administering one or more additional doses of a treatment identified as being effective. Some embodiments, where the treatment was identified as not being effective, further include administering an alternate treatment to the subject.
Methods of Treating a Subject Having Radiation Disease
[0231] Also provided are methods of treating a subject having radiation disease (e.g., a subject that has been identified or has been diagnosed as having radiation disease) or a subject identified as having been exposed to a significant level of radiation (e.g., using any of the methods described herein) that include administering a therapeutically effective dose of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, twenty or more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34) of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p, and human homologues of mouse miR-150-5p, miR-17-3p, miR-187-3p, miR-194-5p, miR-27a-3p, miR-142-5p, miR-320-3p, miR-142a-3p, miR-126-3p, miR-706, miR-29a-5p, miR-let-7d-3p, miR-497a-5p, miR-214-5p, miR-1195, miR-122-5p, miR-500-3p, miR-322-3p, miR-133a-3p, miR-29a-3p, miR-199b-5p, miR-125a-5p, miR-133b-3p, miR-24-3p, miR-362-3p, miR-199a-5p, miR-342-3p, miR-34b-3p, miR-139-5p, miR-149-5p, miR-1a-3p, miR-23b-3p, miR-215-5p, and miR-204-5p, and/or a therapeutically effective dose of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty of more) (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) of an inhibitory nucleic acid that decreases the levels of one or more of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p, and human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p in a subject. Non-limiting examples of an inhibitory nucleic acid include siRNAs, shRNAs, and antisense nucleic acids which contain a sequence that is complementary to a sequence present in one of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p, and human homologues of mouse miR-130a-3p, miR-30a-3p, miR-30c-5p, miR-136-5p, miR-375-3p, miR-193a-3p, miR-151-3p, miR-486-5p, miR-423-5p, miR-30b-5p, miR-191-5p, miR-32-5p, miR-326-3p, miR-1839-3p, miR-709, miR-486a-3p, miR-676-3p, miR-744-5p, miR-1839-5p, miR-30a-5p, miR-21a-5p, miR-503-5p, miR-328-3p, miR-let-7g-5p, miR-15a-3p, miR-29b-3p, miR-200b-5p, miR-25-3p, miR-338-3p, and miR-1966-5p.
Kits
Also provided herein are kits that consist or consist essentially of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, or 67) of: (i) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-130a-3p; (ii) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-150-5p; (iii) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-17-3p; (iv) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-187-3p; (v) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-194-5p; (vi) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-27a-3p; (vii) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-30a-3p; (viii) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-30c-5p; (ix) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-142-5p; (x) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-342-3p; (xi) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-34b-3p; (xii) at least one nucleic acid including a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-126-3p; (xiii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-320-3p; (xiv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-136-5p; (xv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-33-5p; (xvi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-142a-3p; (xvii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-706; (xviii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-375-3p; (xix) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-29a-5p; (xx) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-193a-3p; (xxi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-99b-5p; (xxii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-151-3p; (xxiii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-let-7d-3p; (xxiv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-486-5p; (xxv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-423-5p; (xxvi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-30b-5p; (xxvii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-191-5p; (xxviii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-497a-5p; (xxix) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-32-5p; (xxx) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-214-5p; (xxxi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-326-3p; (xxxii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-1195; (xxxiii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-122-5p; (xxxiv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-1839-3p; (xxxv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-500-3p; (xxxvi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-30e-3p; (xxxvii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-322-3p; (xxxviii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-709; (xxxix) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-486a-3p; (xxxx) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-133a-3p; (xxxxi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-676-3p; (xxxxii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-744-5p; (xxxxiii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-29a-3p; (xxxxiv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-1839-5p; (xxxxv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-30a-5p; (xxxxvi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-199b-5p; (xxxxvii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-125a-5p; (xxxxviii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-133b-3p; (il) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-24-3p; (1) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-21a-5p; (li) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-503-5p; (lii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-328-3p; (liii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-let-7g-5p; (liv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-362-3p; (lv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-199a-5p; (lvi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-15a-3p; (lvii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-139-5p; (lviii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-149-5p; (lix) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-29b-3p; (lx) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-1a-3p; (lxi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-23b-3p; (lxii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-215-5p; (lxiii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-204-5p; (lxiv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-200b-5p; (lxv) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-25-3p; (lxvi) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-338-3p; and (lxvii) at least one nucleic acid comprising a sequence (e.g., a sequence of between about 5 nucleotides to 25 nucleotides) that is complementary to all or a part of the sequence of the human homolog of mouse miR-196b-5p.
[0233] The at least one nucleic acid can include an alternate backbone chemistry, such as phosphothioate bond-based chemistries, and alternative nucleoside residues, such as modified residues, that are capable of pairing with multiple nucleoside base residues.
[0234] In some examples, one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve) of the nucleic acid of (i) through (lxvii) is bound to a substrate (e.g., a glass chip, a chip or microchip, slides, a bead, or a film). Some examples of the kits further include one or more nucleic acids that act as spiked in DNA or RNA loading controls. Non-limiting examples of spiked in DNA or RNA loading controls are described in the Examples, and additional examples are well known in the art. Some examples of the kits further include instructions to performing any of the methods described herein.
[0235] In some embodiments, the one or more nucleic acids of (i) through (lxvii) bound to a substrate is an array. Arrays typically contain addressable moieties that can detect the presence of an entity in a sample including a biological fluid, e.g., via the binding event.
[0236] In some examples, the substrate in the kits can be a surface-derivatized glass or silica, or a polymer membrane surface (see e.g., Guo, et al., Nucleic Acids Res. 22:5456-5465, 1994; Maskos et al., Nucleic Acids Res. 20:1679-1684, 1992; and Southern, et al., Nucleic Acids Res. 22:1368-1373, 1994). Modification of the surface of the substrate can be accomplished any of the techniques known in the art. For example, siliceous or metal oxide surfaces can be derivatized with bifunctional silanes, i.e., silanes having a first functional group enabling covalent binding to the surface (e.g., Si-halogen or Si-alkoxy group, as in --SiCl.sub.3 or --Si(OCH.sub.3).sub.3, respectively) and a second functional group that can impart the desired chemical and/or physical modifications to the surface to covalently or non-covalently attach the one or more nucleic acids of (i) through (lxvii). Silylated derivatizations and other surface derivatizations are known in the art (see, e.g., U.S. Pat. Nos. 5,624,711; 5,266,222; and 5,137,765). Other processes for preparing arrays are described in U.S. Pat. No. 6,649,348.
[0237] Polymer array synthesis is also described extensively in the literature including in the following: WO 00/58516 and U.S. Pat. Nos. 5,143,854; 5,242,974; 5,252,743; 5,324,633; 5,384,261; 5,405,783; 5,424,186; 5,451,683; 5,482,867; 5,491,074; 5,527,681; 5,550,215; 5,571,639; 5,578,832; 5,593,839; 5,599,695; 5,624,711; 5,631,734; 5,795,716; 5,831,070; 5,837,832; 5,856,101; 5,858,659; 5,936,324; 5,968,740; 5,974,164; 5,981,185; 5,981,956; 6,025,601; 6,033,860; 6,040,193; 6,090,555; 6,136,269; 6,269,846; 6,428,752; 5,412,087; 6,147,205; 6,262,216; 6,310,189; 5,889,165; and 5,959,098, and WO 99/36760 and WO 01/58593.
EXAMPLES
[0238] Several general protocols are described below, which may be used in any of the methods described herein and do not limit the scope of the invention described in the claims.
Example 1. Characterization of Hematopoietic Injury in C57BL/6J Mice Following Exposure to Different Doses of Total Body Irradiation
[0239] An initial set of experiments was performed to test the effect of total body irradiation on the hematopoietic system in mice.
Materials and Methods
Mice and Total Body Irradiation
[0240] C57BL/6J male mice (10 weeks old) were obtained from Jackson Labs (Bar Harbor, Me.) and the mice were used in the experiments at an age of 12-13 weeks. Animals were exposed to total body irradiation in an irradiation pie cage (Braintree Scientific, Briantree, Mass.) at various doses. Irradiation was performed using a .sup.137Cs source (Gamma Cell.RTM. 40 Exactor, Best Theratronics, Ottawa, Ontario).
Bone Marrow Harvest and Flow Cytometry
[0241] Bone marrow was harvested as per protocols described in Parmar et al. (Stem Cells 28:1186-1195, 2010). Briefly, animals were dissected to isolate the femurs and tibia from the mouse hind limb. The extracted bones were flushed with a 23-gauge needle using Hank's Balanced Salt Solution (HBSS, Life Technologies, Grand Island, N.Y.) supplemented with 2% fetal bovine serum (FBS) and 1% 10 mM HEPES (Life Technologies) to obtain bone marrow. The cells were then passed through an 18 gauge needle to obtain a single cell suspension. The bone marrow mononuclear cell count (BM-MNC) was determined by counting cells using 3% acetic acid with methylene blue solution (Stem Cell Technologies, Vancouver, British Columbia). For LKS (lineage, cKit, Sca1) staining to visualize hematopoietic progenitor cells (HPCs) and hematopoietic stem cells (HSCs), whole bone marrow was stained with biotinylated anti-lineage cocktail (anti-Mac1, Gr-1, CD3e, B220, and Ter119), APC-conjugated anti-cKit (clone 2B8), and PECy7-conjugated anti-Sca1 (clone D7) antibodies. Following primary antibody staining, the cells were washed and incubated in PE-conjugated streptavidin secondary antibody to visualize lineage-positive cells. All primary and secondary antibodies were obtained from BD Biosciences (San Jose, Calif.). The samples were acquired using an LSR Fortessa instrument (Becton Dickinson, Franklin Lakes, N.J.) and data was analyzed using FlowJo software (TreeStar, Ashland, Oreg.).
Colony Assays
[0242] To assess colony-forming ability, whole bone marrow isolated after flushing mouse femurs and tibiae was plated in 12-well plates at a density of 20,000 to 100,000 cells/well in methylcellulose medium (Methocult CF M3434, Stem Cell Technologies, Vancouver, British Columbia) containing recombinant murine IL-3, recombinant murine IL-6, and recombinant human erythropoietin. Cells from all samples were plated in triplicates and incubated at 37.degree. C. in 5% CO.sub.2 for 7 days at which time hematopoietic colonies formed (colony-forming units in culture, CFU-Cs) were scored.
Complete Blood Counts (CBCs)
[0243] Blood collection for CBCs (100 .mu.L) was performed by retro-orbital bleeding after anesthesia in EDTA-coated tubes (BD Biosciences, San Jose, Calif.). CBCs were recorded with a Hemavet 950 FS hematology analyzer (Drew Scientific, Dallas, Tex.).
Results
[0244] The data in FIG. 1 show that mice exposed to 2 Gy- or 6.5 Gy-total body radiation survive, while the majority of mice exposed to 8 Gy-total body irradiation (65%) are not viable. Thus, 2 Gy and 6.5 Gy were chosen as the sub-lethal low and sub-lethal high doses, respectively, and 8 Gy was considered the lethal dose for subsequent experiments. Complete blood count of peripheral blood showed a reduction in white blood cells (WBCs), red blood cells (RBCs), platelets, and hemoglobin at all tested doses of irradiation (FIGS. 2-4). By day 7, severe lymphopenia and anemia are observed in the 6.5 Gy- and 8 Gy-irradiated mice and there was no significant difference in the peripheral blood parameters at day 15 between the two cohorts of animals (FIGS. 2-4).
[0245] Decrease in bone marrow cellularity is an important measure of injury caused to the hematopoietic system following irradiation. At 24 hours post-radiation, a radiation dose-dependent reduction in the cellularity of bone marrow was observed. A dose of 2 Gy caused a .about.2.5-fold decrease in BM-BMCs relative to non-irradiated controls while at higher doses, an 8-10-fold reduction decrease was observed (FIGS. 6-10). By day 7 and day 15, a complete recovery of BM-MNCs was observed in mice exposed to 2 Gy of radiation, whereas the BM-MNC count remained very low and indistinguishable for the mice exposed to 6.5 Gy and 8 Gy of radiation, respectively. The mice exposed to 6.5 Gy of radiation showed significant recovery of BM-MNCs by 30 days, and a complete recovery of BM-MNCs by 3 months (FIGS. 6-10).
[0246] The CFU-C count following irradiation was significantly decreased for all doses, and the 6.5 Gy- and 8 Gy-cohorts were indistinguishable, both with very low CFU-C counts at day 15 (FIGS. 11-15). At subsequent time points, the bone marrow from both the 2 Gy- and 6.5 Gy-groups displayed improvement in hematopoietic progenitor cell function, but mice in the 8 Gy-group failed to recover. Flow cytometry was used to evaluate the bone marrow hematopoietic progenitor cell population in control and irradiated mice. The LKS.sup.- (lineage.sup.-, c-Kit+, Sca-1.sup.-) population is enriched in hematopoietic progenitor cells (HPCs) and the LKS.sup.+ (lineage.sup.-, c-Kit+, Sca-1.sup.+) population is enriched in hematopoietic stem cells (HSCs). A severe reduction in the HPC content was observed at 24 hours after total body irradiation in all of the irradiated groups (FIGS. 16-20). The kinetics of recovery for the HPC population (LKS.sup.- cells) in the weeks and months after total body irradiation was similar to the CFU-C levels (FIGS. 11-20). The numbers of HPCs in the 6.5 Gy- and 8 Gy-irradiated mice remained comparably low and indistinguishable at 15 days after total body irradiation. The data reveal that dose dependent hematopoietic injury occurs after total body irradiation, but animals exposed to sub-lethal high- (6.5 Gy) or lethal (8 Gy)-total body irradiation doses remain largely indistinguishable up to 15 days post-total body irradiation.
[0247] The data described above show that sub-lethal doses of total body irradiation cause a severe reduction, but not complete depletion of HPCs in the 2 Gy- and 6.5 Gy-irradiated animals. A similar trend in the HSC population (LKS.sup.+ cells) was observed, with a striking ablation until 7 days in all total body irradiation cohorts, and detectable recovery at the 15-day time point occurs in the 2 Gy-irradiated animals (FIGS. 21-25). On the other hand, HSC levels in the 6.5 Gy- and 8 Gy-irradiated animals at 15 days post-total body irradiation remained significantly low. These data show that sub-lethal doses of total body irradiation cause permanent damage to stem cells, which can lead to stem cell senescence and a decrease in the engraftment potential of HSCs.
Example 2. Residual HSCs in Sub-Lethally Irradiated Mice Retain the Capacity to Repopulate Bone Marrow
[0248] A set of experiments were performed to determine whether recovered residual HSCs from 2 Gy- or 6.5 Gy-irradiated mice would be able to repopulate the hematopoietic system.
Materials and Methods
[0249] The methods used to irradiate mice, collect bone marrow, perform flow cytometry, and determine CFU-Cs and CBCs are described in Example 1.
HSC and Bone Marrow Transplantation
[0250] Short-term and long-term repopulating ability was assessed by transplantation of either sorted HSCs or unfractionated whole bone marrow from donor mice (C56BL/6J CD45.2 congenic) into lethally irradiated (10 Gy) recipients (B6.SJL-Ptprc.sup.a Pep3.sup.b/BoyJ CD45.1 congenic) as described in Parmar et al. (Stem Cells 28:1886-1195, 2010). Donor mice were exposed to 0 Gy-, 2 Gy-, or 6.5 Gy-total body irradiation and allowed to recover for three months, at which time the animals were sacrificed, and bone marrow was isolated by flushing, and HSCs were sorted using a FACS Aria (BD Biosciences, San Jose, Calif.). For transplants involving sorted HSCs, a total of 2000 LKS.sup.+ cells from CD45.2.sup.+ donor mice were mixed with 250,000 CD45.1.sup.+ bone marrow support cells and injected intravenously to a lethally irradiated CD45.1 recipient mouse. For transplants involving unfractionated bone marrow, a total of 500,000 whole bone marrow cells from CD45.2.sup.+ donor mice were mixed with 250,000 CD45.1.sup.+ bone marrow support cells and injected intravenously to lethally an irradiated CD45.1.sup.+ recipient mouse. Five mice were transplanted per total body irradiation dose group for the HSC transplants, while four mice were transplanted per total body irradiation dose group for the whole bone marrow transplants. Peripheral blood samples were collected at 1 month and four months post-transplantation and were used to assess short-term and long-term repopulation of cells in the recipient mouse, respectively. Donor cell chimerism in recipients was assessed by staining peripheral blood with FITC-conjugated anti-CD45.2 (clone 104) and PE-conjugated anti-CD45.1 (clone A20) antibodies. To measure the extent of multi-lineage reconstitution, the percentage of donor-derived (CD45.2.sup.+) B-cells, T-cells, and myeloid cells are calculated by co-staining with PE-conjugated anti-B220 (clone RA3-6B2), PE-anti-CD3e (clone 145-2C11), and PE-anti-Mac1/anti-Gr1 (clones M1/70 and RB6-8C5), respectively. All antibodies were obtained from BD Biosciences (San Jose, Calif.). The stained samples were analyzed using a LSR Fortessa instrument (Becton Dickinson, Franklin Lakes, N.J.) and FlowJo software (TreeStar, Ashland, Oreg.).
Results
[0251] HSC transplantation studies were performed to determine whether the recovered residual HSCs from 2 Gy- or 6.5 Gy-irradiated samples would be able to repopulate the hematopoietic system of a lethally radiated mouse. Specifically, engraftment of HSCs from CD45.2.sup.+ donor mice (harvested three-months following irradiation with 2 Gy or 6.5 Gy) were transplanted into lethally irradiated CD45.1.sup.+ recipient mice, and peripheral blood chimerism was determined at 1 month and 4 months post-transplantation (FIGS. 26-29). Donor cell engraftment (total leukocytes) at 1 month and 4 months post-transplantation showed an approximate 4-fold decrease in the irradiated recipients transplanted with sorted HSCs from the 2 Gy-irradiated donors. Moreover, a 10-20-fold decrease was observed in recipients transplanted with HSCs from 6.5 Gy-irradiated donor mice as compared to a control (FIGS. 28 and 29). When multi-lineage reconstitution of T-cells, B-cells, and myeloid cells was investigated, a similar defect in peripheral blood chimerism was observed (FIGS. 30-37). Competitive repopulation assays performed with unfractionated whole bone marrow showed similar defects in the chimerism of total leukocytes (FIGS. 28 and 29), and lineage-restricted cells in peripheral blood (FIGS. 38-40). Taken together, these data suggest that although most of the HSCs in sub-lethally-irradiated animals are severely impaired in their repopulating potential, rare functional HSCs do exist and maintain the hematopoietic system in sub-lethally-irradiated animals. The ability of mice exposed to sub-lethal doses of radiation to remain viable may be due to the reconstitution potential of the residual functional HSCs.
Example 3. Radiation Dose-Specific Serum miRNAs
[0252] A set of radiation dose-specific serum miRNAs were identified.
Materials and Methods
Serum Preparation
[0253] Peripheral blood was collected by retro-orbital bleeding after anesthesia. Up to 200 .mu.t of blood was collected in DNAse/RNAse-free Eppendorf tubes and incubated at room temperature for 2 hours to allow clotting. Blood samples were then centrifuged in an Eppendorf 5415C centrifuge at 14000 RPM (15996 g) for 5 minutes at room temperature. The supernatant was collected and re-centrifuged at the above conditions to remove any remaining cellular contamination. The resulting supernatant (serum) was stored in aliquots at -80.degree. C.
Murine mRNA Profiling
[0254] A miRCURY LNA.TM. Universal RT miRNA PCR Rodent Panel 1 &II kit containing 742 assays was used to profile miRNAs differentially expressed in mouse serum from animals exposed to 0 Gy (control), 2 Gy, 6.5 Gy, or 8 Gy doses of total body irradiation (Exiqon, Vedbaek, Denmark). Ten mice were profiled per group for a total of 40 samples. On average, 339 miRNAs were detected per sample, with at least 170 miRNAs detected in each samples, and 68 of these miRNAs were identified as being differentially expressed with a p value below 0.05. The data quality for samples across different groups was determined by comparing the number of detected miRNAs with overall Cp values, and was found to be very similar. Normalization of the data was performed using the global mean of 170 of the most-commonly expressed miRNAs in all samples. The levels of a set of RNA and DNA spiked-in controls and hemolysis controls were also determined in order to ascertain the technical performance of each sample. Spiked-in controls were also used throughout the study for profiling and validation. RNA spiked-in controls were also used to test the efficiency of the cDNA synthesis reaction, while DNA spiked-in controls were also used to test the efficiency of the qPCR amplification. In order to negate the possibility of hemolysis, .DELTA.Cp for miR-451 (expressed in red blood cells) and miR-23a-3p (relatively stable in serum) was computed for each sample as previously reported (Blondal et al., Methods 59:S1-S6, 2013). .DELTA.Cp values lower than 7 suggest minimal levels of red blood cell contamination.
RNA Extraction and cDNA Synthesis
[0255] Total RNA was isolated from serum samples by using the miRCURY.TM. RNA Isolation Kit--Biofluids from 50 .mu.L mouse serum as per the manufacturer's manual. Total RNA was eluted in 50 .mu.L mouse serum as per the manufacturer's manual. Total RNA was eluted in 50 .mu.L of RNAse-free H.sub.2O and stored at -80.degree. C. Per the manufacturer's recommendations, input volumes for serum RNA were optimized for the cDNA synthesis reaction. cDNA was synthesized in 10 .mu.L reactions using the Universal cDNA Synthesis Kit II and was diluted 50-fold in RNAse/DNAse-free H.sub.2O for use in quantitative PCR. The reagents for RNA extraction and cDNA synthesis were obtained from Exiqon (Vedbaek, Denmark).
Quantitative PCR
[0256] Diluted cDNA was subjected to quantitative PCR analysis in Pick-N-Mix plates designed in a 96-well format. SYBR.RTM. Green qPCR MasterMix was mixed 1:1 with diluted cDNA and added to specific wells in pre-designed Pick-N-Mix plates containing dried-down LNA primers specific for selected miRNAs (see Table 1 for a list of miRNA target sequences). The Pick-N-Mix plates also contained a number of controls including miR-101a and miR-19b (normalization controls), UniSp6 (proprietary RNA spiked-in control), and UniSp3 (proprietary DNA spiked-in control). Built-in interpolate calibrator (IPC) reactions were used to control for inter-plate variability. Pick-N-Mix qPCR plates were run on an Applied Biosystems 7500 FAST Real-Time PCR System. The data were generally normalized using miR-101a. However, normalization using miR-19b levels produced similar results. MiR-451 and miR-23a levels were used to assess the extent of hemolysis. All reagents used for quantitative PCR were obtained from Exiqon (Vedbaek, Denmark).
TABLE-US-00003 TABLE 1 Target Sequences of Individual miRNAs Detected in Pick-N-Mix Plates (SEQ ID NOs: 1-18) miRNA Target Sequence Control miRNA mmu-miR-101a-3p UACAGUACUGUGAUAACUGAA Control miRNA mmu-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA RNA Spike-in UniSp6 Exiqon Proprietary Sequence DNA Spike-in UniSp3 Exiqon Proprietary Sequence 0 Gy v. 2 Gy Signature mmu-miR-130a-3p CAGUGCAAUGUUAAAAGGGCAU mmu-miR-142-5p CAUAAAGUAGAAAGCACUACU mmu-miR-150-5p UCUCCCAACCCUUGUACCAGUG mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA mmu-miR-342-3p UCUCACACAGAAAUCGCACCCGU 2Gy v. 6.5 Gy Signature mmu-miR-34b-3p AAUCACUAACUCCACUGCCAUC mmu-miR-322-3p AAACAUGAAGCGCUGCAACAC mmu-miR-126-3p UCGUACCGUGAGUAAUAAUGCG mmu-miR-17-3p ACUGCAGUGAGGGCACUUGUAG mmu-miR-136-5p ACUCCAUUUGUUUUGAUGAUGG 6.5 Gy v. 8 Gy Signature mmu-miR-187-3p UCGUGUCUUGUGUUGCAGCCGG mmu-miR-194-5p UGUAACAGCAACUCCAUGUGGA mmu-miR-27a-3p UUCACAGUGGCUAAGUUCCGC mmu-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA mmu-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC mmu-miR-30c-5p UGUAAACAUCCUACACUCUCAGC
Statistical Analysis
[0257] MicroRNA Profiling: Normalization of miRNA serum levels was performed using 170 commonly expressed miRNAs. Analysis of variance (ANOVA) was used to determine which miRNAs differed significantly between groups. To adjust for multiple comparisons testing, the Benjamini-Hochberg correction was applied. A threshold of p<0.05 in ANOVA was selected as the level of statistical significance. MiRNAs with p values of <0.05 in ANOVA was used in hierarchical-clustering analysis to visualize expression patterns. Differentially-expressed miRNAs were tested in pairwise comparisons with a Benjamini-Hochberg adjusted Student's t-test to determine between-group differences.
[0258] Power Analysis: Power analysis was performed using the Hierarchical Clustering Explorer 3.5 tool (Seo et al., Bioinformatics 22:808-814, 2006). The number of samples was estimated to be sufficient to provide statistical power of at least 80% needed to obtain a p value of less than 0.01 for differentially expressed miRNAs with a fold change of 0>1.5 or <0.67 in between group comparisons. The p value threshold was lowered from 0.05 to account for multi-group post-hoc testing. A sample size of 10 per group was thus calculated to allow us to confirm statistically significant differences for the top 95 differentially expressed miRNAs with the predetermined effect sizes. P levels lower than 0.05 were considered as statistically significant.
Results
[0259] Serum miRNAs were profiled in mice 24 hours after exposure to 0 Gy-, 2 Gy-, 6.5 Gy-, or 8 Gy-total body irradiation (10 mice per group). A comparison of expression levels revealed eight miRNAs that allow for the discrimination between samples from control mice and samples from irradiated mice (FIG. 41). Signatures pertaining to specific comparisons between radiation groups are presented in FIGS. 42-53. All miRNAs represented in the heatmaps were found to be statistically significant (p<0.05). Significance between the groups was computed using analysis of variance (ANOVA) corrected for multiple hypothesis testing.
[0260] Relative to samples from control mice, the samples from mice irradiated with 2 Gy show a significant drop in complete blood counts (CBCs) and BM-MNC counts at 24 hours post-irradiation, but these blood cell values were almost completely restored by 7 days. However, the HPC and HSC counts remained significantly lower in samples from 2 Gy-irradiated mice as compared to samples from the control mice at 7 days (FIGS. 11-25).
[0261] The miRNA profiling data show that five serum miRNAs were effective in distinguishing between the control or 2 Gy-irradiated mice 24 hours after radiation exposure (FIGS. 42 and 43). MiR-130a-3p was increased in the 2 Gy-irradiated mice as compared to the levels in the control mice, while the levels of miR-150-5p, miR-142-5p, miR-706, and miR-342-3p were decreased in the 2 Gy-irradiated mice as compared to the levels in the control mice. This signature was validated using an independent set of animals that were left untreated or exposed to a total body irradiation dose of 2 Gy, and the miRNA levels determined in samples collected from the mice at 24 hours post-irradiation. The serum miRNA pattern continues to distinguish the control mice from the 2 Gy-irradiated mice when the samples were collected 7 days after irradiation (FIGS. 44-48). These data are also consistent with the diminished numbers of HSCs and HPCs in the 2 Gy-irradiated cohort at 7 days post-irradiation. As BM-MNC counts a week after radiation exposure are not significantly different in the control mice and the 2 Gy-irradiated mice, these data suggest that serum miRNA expression can be used to quantitatively and accurately identify individuals exposed to 2 Gy radiation.
[0262] A subsequent set of experiments was performed to determine whether miRNA expression levels can be used to distinguish between patients that have been exposed to a low sub-lethal or high sub-lethal doses of radiation. The data show that the levels of five different miRNAs, miR-136-5p, miR-17-3p, miR-126-3p, miR-322-3p, and miR-34b-3p, can be used to accurately distinguish between individuals exposed to a low sub-lethal or high sub-lethal doses of radiation (FIGS. 49-55).
[0263] Similar to the untreated- and 2 Gy-irradiated mice, analysis of hematopoietic damage is unable to differentiate between animals exposed to high sub-lethal (6.5 Gy) irradiation and lethal (8 Gy) total body irradiation (FIGS. 1 and 5-29). The data in FIGS. 56-58 show that the levels of specific serum miRNAs can also be used to accurately differentiate between 6.5 Gy- and 8.0 Gy-irradiated mice by using samples obtained as early as 24 hours after irradiation (FIGS. 56-58). The levels of miR-187-3p, miR-194-5p, and miR-27a-3p were decreased in the 8 Gy-irradiated mice as compared to the levels in the 6.5 Gy-irradiated mice, while the levels of miR-30a and miR-30c were increased in the 8 Gy-irradiated mice as compared to the levels in the 6.5 Gy-irradiated mice (FIGS. 56-58).
[0264] An additional set of experiments were performed to determine whether levels of the identified miRNAs can be used to accurately identify the dose of radiation that mice have been exposed to when the serum samples are collected at later time points, e.g., 24 hours, three days, and one week after irradiation. In these experiments, mice were treated to a total body irradiation dose of 6.5 Gy or 8 Gy. Consistent with the above described data, the levels of serum miRNAs can be used to distinguish between lethal-versus sub-lethal-doses of radiation (FIGS. 59-63). Serum levels of miR-30a-3p and miR-30c-5p continued to differentiate between the 6.5 Gy- and 8.0 Gy-irradiated mice when samples were collected at three days and seven days post-irradiation (FIGS. 59-63).
[0265] Table 2 shows the fold change in the levels of 68 serum miRNAs in 2 Gy-, 6.5 Gy-, or 8 Gy-irradiated mice as compared to non-experimentally irradiated mice.
[0266] In sum, these data show that the levels of the different specific miRNAs described in this Example (in the text or figures) can be used to determine the level or dose of radiation that a subject has been exposed to.
TABLE-US-00004 TABLE 2 Fold Changes in 68 Different miRNAs in Mice Irradiated with 2 Gy-, 6.5 Gy-, or 8 Gy- Total Body Irradiation as Compared to Untreated Mice Benjamini-Hochberg Fold Change miRNA Rank Corrected p-value 2 Gy vs 0 Gy 6.5 Gy vs 0 Gy 8 Gy vs 0 Gy mmu-miR-142-5p 1 6.14552E-10 0.74424399 0.549934615 0.467752484 mmu-miR-150-5p 2 6.41729E-10 0.33485287 0.360400719 0.346659291 mmu-miR-320-3p 3 6.83112E-06 0.96224966 1.187536684 1.32071546 mmu-miR-136-5p 4 8.17096E-06 1.03771902 0.464873503 0.411761228 mmu-miR-33-5p 5 4.8463E-05 1.00605562 0.547886821 0.412110487 mmu-miR-142-3p 6 4.8463E-05 0.91027254 0.578995013 0.512969604 mmu-miR-30c-5p 7 0.000365421 1.04125706 1.124307627 1.374873802 mmu-miR-126-3p 8 0.000365421 0.96088497 1.52362955 1.397680627 mmu-miR-706 9 0.000466025 0.39885132 0.355518689 0.633605238 mmu-miR-375-3p 10 0.000466244 1.23386818 2.136008605 2.283729398 mmu-miR-29a-5p 11 0.000466244 0.88815734 0.965287846 0.709055154 mmu-miR-193a-3p 12 0.000529968 1.16807721 0.648857482 0.436360524 mmu-miR-99b-5p 13 0.000529968 0.99604663 1.343865649 1.512510076 mmu-miR-30a-3p 14 0.001068664 0.98962715 1.062153376 1.586158278 mmu-miR-194-5p 15 0.001068664 0.81191712 0.610441938 0.445697163 mmu-miR-151-3p 16 0.001068664 1.13039179 1.466557685 1.309094574 mmu-let-7d-3p 17 0.001068664 0.97075842 1.220688226 1.202449856 mmu-miR-486-5p 18 0.001406802 1.18781032 1.463315368 2.065511432 mmu-miR-423-5p 19 0.001406802 1.04859246 1.296138995 1.433861551 mmu-miR-30b-5p 20 0.002090685 1.03949322 1.118894183 1.226753205 mmu-miR-191-5p 21 0.002342556 1.13886399 1.431738514 1.633205493 mmu-miR-497-5p 22 0.003354593 0.93721128 0.749399546 0.620269054 mmu-miR-32-5p 23 0.003528045 1.08012807 0.628353232 0.60521677 mmu-miR-214-5p 24 0.003991952 0.7250106 0.703128367 0.472213492 mmu-miR-326-3p 25 0.005363873 1.23852539 0.851291436 0.795937744 mmu-miR-1195 26 0.00547774 0.96775855 1.091070893 1.828845971 mmu-miR-122-5p 27 0.00547774 0.9331905 0.347893687 0.148560227 mmu-miR-1839-3p 28 0.006649678 1.31726438 1.533746054 2.030902658 mmu-miR-500-3p 29 0.007061575 0.98538558 0.798727717 0.576675503 mmu-miR-30e-3p 30 0.00842863 0.99620407 1.118186905 1.447594383 mmu-miR-191-5p 31 0.008475716 1.11075355 1.336579832 1.549260059 mmu-miR-322-3p 32 0.008828838 0.84830107 1.319445753 1.179301198 mmu-miR-709 33 0.012398254 1.17074719 1.283596703 2.015808092 mmu-miR-486-3p 34 0.012398254 1.15572492 1.26343094 2.007373735 mmu-miR-133a-3p 35 0.01300781 0.8577409 1.808599164 2.388619602 mmu-miR-676-3p 36 0.013062937 1.02467973 1.200464931 1.261017633 mmu-miR-744-5p 37 0.013450652 1.11874039 1.206177008 1.300646391 mmu-miR-27a-3p 38 0.013750505 0.897455 0.907534042 0.701532751 mmu-miR-29a-3p 39 0.014568628 0.93057734 0.846667907 0.759548456 mmu-miR-1839-5p 40 0.014568628 1.08694504 1.276875982 1.316700195 mmu-miR-30a-5p 41 0.014568628 1.05482542 1.181824227 1.346126285 mmu-miR-199b-5p 42 0.016705178 0.86410859 0.513797016 0.632615767 mmu-miR-125a-5p 43 0.022628544 0.95885072 1.091894886 1.262232335 mmu-miR-133b-3p 44 0.024815118 0.87153511 1.658615981 2.115999503 mmu-miR-24-3p 45 0.024815118 0.98024783 1.184038592 1.119192515 mmu-miR-21a-5p 46 0.024815118 1.11453515 0.83129145 0.789893731 mmu-miR-503-5p 47 0.024815118 1.17062491 0.805712381 0.783530294 mmu-miR-328-3p 48 0.024815118 1.13325302 1.308132313 1.338479397 mmu-let-7g-5p 49 0.024815118 1.0988627 1.139369002 1.416967729 mmu-miR-362-3p 50 0.024815118 0.88814566 0.804011505 0.662542946 mmu-miR-199a-5p 51 0.025154963 0.90437047 0.601503597 0.631100613 mmu-miR-342-3p 52 0.02747761 0.74026498 1.131865806 1.05831998 mmu-miR-34b-3p 53 0.028987297 0.72634533 1.610402809 1.543163375 mmu-miR-15a-3p 54 0.028987297 1.1168344 0.719823542 0.588058284 mmu-miR-139a-5p 55 0.033183048 0.89176006 1.179771672 1.070031762 mmu-miR-17-3p 56 0.033183048 1.20541903 0.631158748 0.880193062 mmu-miR-130a-3p 57 0.033183048 1.23030213 0.993397276 0.942905848 mmu-miR-149-5p 58 0.033183048 0.91083128 1.293986617 1.527284883 mmu-miR-29b-3p 59 0.033183048 1.02341004 0.816190497 0.738902258 mmu-miR-1a-3p 60 0.035135178 0.70860665 1.329943292 2.129491746 mmu-miR-23b-3p 61 0.036567207 0.96591806 1.179012129 1.113184704 mmu-miR-215-5p 62 0.036567207 0.74514845 0.695719558 0.474670243 mmu-miR-204b-5p 63 0.040650135 0.85603509 1.631185521 1.807800285 mmu-miR-187-3p 64 0.041980065 0.938443632 0.938443632 0.562868937 mmu-miR-200b-5p 65 0.041980065 1.1873809 1.538043311 1.668073737 mmu-miR-25-3p 66 0.041980065 1.0929659 1.170620915 1.537301555 mmu-miR-338-3p 67 0.046950851 1.09509996 0.857254876 0.812354606 mmu-miR-196b-5p 68 0.049109597 1.31602496 1.065034064 0.733581783
Example 4. Serum miRNAs Predict Severity of Radiation Disease
[0267] An experiment was performed to test whether the levels of the specific miRNAs described in these Examples can be used to predict the severity of radiation disease in a subject.
Materials and Methods
[0268] Irradiation, serum collection, and miRNA profiling were performed as described in Example 3.
Radioprotection with Amifostine
[0269] Saline or amifostine was given to mice intraperitoneally at 250 mg/kg body weight 24 hours prior to 0 Gy- or 8 Gy-total body irradiation in a first set of experiments. In a second set of experiments, mice were left untreated or mice were administered saline or 200 mg/kg amifostine 45 minutes prior to 0 Gy- or 8.5 Gy-total body irradiation. Serum was collected from all mice at 24 hours after irradiation or a time point in the non-irradiated mice that would correspond to 24 hours after irradiation in the treated mice.
Statistical Analysis
[0270] Validation with real-time qPCR: One-way ANOVA was used to confirm global significance. Dunnett's post-hoc testing procedure was used to compare miRNA levels in the irradiated+saline-group against three other experimental groups. Univariate comparisons were performed using the Student's t-test or the Student's t-test for paired samples. Pearson's correlation coefficient was used for correlation testing. Survival analysis was performed using the log-rank (Mantel-Cox) test.
Results
[0271] Cohorts of mice were treated with saline or amifostine 24-hours prior to exposure to 8 Gy-total body irradiation, and sera were collected 24 hours post-irradiation (FIG. 64). To confirm the protective effect of amifostine on the survival of the lethally-irradiated mice, Kaplan-Meier analysis was performed on the same set of animals (FIG. 65). While all mice injected with saline and irradiated with 8 Gy died at about day 70, animals administered amifostine prior to 8 Gy-irradiation displayed a 50 percent improvement in survival (n=8 per group; p=0.0452). The sera collected from these mice at 24 hours after irradiation show that the levels of miRNAs are significantly altered when comparing the differences between the groups and when the 8 Gy-irradiated+saline-administered group was compared to the other three groups (Table 3). The serum miRNA signature responded to amifostine treatment only in the context of lethal radiation (FIGS. 66-70). The degree of change in response to radiation and amifostine was however of different magnitude for each miRNA. MiR-194-5p and miR-30a-3p displayed the most dramatic alterations, while miR-187-3p, miR-27a, and miR-30c-3p showed more moderate changes (FIGS. 66-70). The analysis in FIG. 71 shows a very high correlation (r=0.94; p=0.02) indicates that the five miRNAs (miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p) can serve as markers of risk of poor prognosis from radiation exposure (e.g., risk of mortality from radiation exposure) and markers of risk of developing radiation disease.
TABLE-US-00005 TABLE 4 Statistical Comparison of the Saline Treated and 8 Gy- Irradiated Mice Data to the Other Experimental Groups miRNA CT + Saline CT + Ami 8 Gy + Ami miR-187-3p IR 0.0085 0.0266 0.0360 miR-194-5p IR <0.0001 <0.0001 0.0001 miR-30a-3p IR <0.0001 <0.0001 <0.0001 miR-27a-3p IR 0.0066 0.0048 0.0108 miR-30c-5p IR 0.0001 0.0002 0.0414
[0272] An additional set of experiments was performed to test whether the levels of miR-187-3p, miR-194-5p, miR-30a-3p, miR-27a-3p, and miR-30c-5p can be used to predict a subject's future risk of developing radiation disease. In these experiments, mice where either left untreated or were administered saline or 200 mg/kg amifostine 45 minutes prior to 0 Gy- or 8 Gy-irradiation.
[0273] The data show that mice administered 200 mg/kg amifostine 45 minutes prior to 8.5-Gy-total body irradiation had prolonged survival than mice who received saline 45 minutes prior to 8.5 Gy-total body irradiation (FIG. 72). The data show a significant difference in the levels of miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p in mice administered saline and 45 minutes later treated with 8.5 Gy-total body irradiation as compared to mice administered amifostine and 45 minutes later treated with 8.5 Gy-total body irradiation (FIGS. 73-77, respectively). These data indicate that the levels of miR-187-3p, miR-194-5p, miR-27a-3p, miR-30a-3p, and miR-30c-5p can be used to determine a subject's risk of poor prognosis from radiation exposure and can also be used to predict a subject's risk of subsequently developing radiation disease.
Example 5. Serum miRNAs can Indicate Effective Treatment of Radiation Disease
[0274] An additional set of experiments was performed to determine whether levels of miRNAs can indicate effective treatment in a subject previously exposed to total body irradiation.
Materials and Methods
[0275] Irradiation, serum collection, and miRNA profiling were performed as described in Example 3.
Treatment with Bone Marrow Transplantation after Irradiation
[0276] In this set of experiments, C57BL/6J mice were left untreated (n=5), were treated with 10.4 Gy-total body irradiation and left untreated (n=5), or were treated with 10.4 Gy-total body irradiation and administered two doses of 2 million bone marrow stromal cells (BMASC) per mouse at 24 hours and 72 hours after irradiation (n=5).
Results
[0277] The data show that mice administered two doses of 2 million bone marrow stromal cells after 10.4 Gy-total body irradiation had prolonged survival than mice who did not receive bone marrow stromal cells after 10.4 Gy-total body irradiation (FIG. 78). The data show a significant difference in the levels of miR-150, miR-27a, miR-30a, miR-30c, miR-187-3p, and miR-194-3p in mice that received 10.4 Gy-total body irradiation and no bone marrow stromal cells as compared to mice that received two transplants of bone marrow stromal cells after 10.4 Gy-total body irradiation (FIGS. 79-84, respectively). These data show that the levels of miR-150, miR-27a, miR-30a, miR-30c, miR-187-3p, and miR-194-3p can be used to determine the efficacy of a treatment for reducing radiation-induced damage administered to a subject previously exposed to a significant level of radiation.
Example 6. Validation of Serum miRNA Signature in Humanized Mice
[0278] A set of experiments was performed to verify if the same miRNA(s) could be used to determine a human's level of exposure to radiation. These experiments utilized a humanized mouse model.
Materials and Methods
[0279] Irradiation, serum collection, and miRNA profiling were performed as described in Example 3.
[0280] HuCD34.sup.+"humanized" NSG mice were obtained from Jackson Labs, Bar Harbor, ME. These mice were generated by irradiating each mouse at 1.4 Gy to deplete their bone marrow and injecting each mouse with CD34.sup.+ human HSC. Each mouse was tested for engraftment of human CD45.sup.+ cells and murine CD45.sup.+ cells at 12 weeks following transplantation. Prior to the experiments described herein, the presence of human CD45.sup.+ cells was confirmed in the peripheral blood and bone marrow from untreated control mice using an anti-human CD45 FITC antibody.
[0281] The HuCD34.sup.+ mice were treated with saline or amifostine (200 mg/kg of body weight 45 min-1 hr before radiation exposure) and were subsequently treated with 4 Gy to 4.5 Gy of total body irradiation, or were left untreated. Following these treatments, total bone cellularity and the levels of serum miRNAs were determined in the mice. Both CD45 staining of peripheral blood and engraftment analysis of bone marrow was performed when animals became moribund (between 9-14 days after total body radiation) and were sacrificed. The mice were irradiated at approximately 12 weeks after initial assessment of engraftment.
Results
[0282] The initial engraftment percentages of human CD45.sup.+ cells in the peripheral blood and bone marrow were determined (prior to administration of saline or amifostine, and prior to experimental irradiation). The percentage of human CD45.sup.+ cells in the bone marrow of two exemplary untreated control humanized mice was 71.8% and 63% respectively, and the percentage of human CD45.sup.+ cells in the peripheral blood of two exemplary untreated control humanized mice was 83.2% and 70.6%, respectively.
[0283] The humanized mice were treated with saline or amifostine, and subsequently treated with 4.0 Gy to 4.5 Gy of total body irradiation, or were left untreated (control group). The percentage of human CD45 positive cell engraftment, the percentage of human CD45 positive cells in the peripheral blood, the bone marrow cellularity, the human CD45 positive cell number, and the CFU-Cs were determined in each mouse, and the levels of six serum miRNAs were also determined. The percentage of human CD45 positive cell engraftment and the percentage of human CD45 positive cells in the peripheral blood of the mice are shown in Tables 4 and 5 below.
TABLE-US-00006 TABLE 4 Percentage of Human CD45 Positive Cell Engraftment in Human CD34-positive NSG Humanized Mice % hCD45+ engraftment Mouse # in mouse peripheral blood Treatment 1 75.2 TBI + Saline 2 49.8 TBI + Saline 3 52.1 TBI + Saline 4 60.2 TBI + Saline 5 50.9 TBI + Saline 6 65 TBI + Saline 7 55.8 TBI + Saline 8 58.2 TBI + Amifostine 9 52.5 TBI + Amifostine 10 62.1 TBI + Amifostine 11 74.3 TBI + Amifostine 12 67.5 TBI + Amifostine 13 52.1 TBI + Amifostine 14 49.6 TBI + Amifostine 15 61.4 TBI + Amifostine 16 51.8 Control 17 50.8 Control 18 55.9 Control 19 58.8 Control 20 65.8 Control
TABLE-US-00007 TABLE 5 Peripheral Blood CBC Levels in Human CD34-positive NSG Humanized Mice CBC at euthanesia Group Mouse # WBC (K/uL) RBC (M/uL) Hb (g/dL) HCT (%) PLT (K/uL) TBI + 2 1.20 0.24 1.90 1.60 20 Saline 5 1.30 0.19 2.80 1.20 4 7 0.56 1.64 2.80 3.00 88 Avg 1.02 0.69 2.50 1.93 37.33 SEM 0.23 0.48 0.30 0.55 25.75 TBI + 8 1.28 2.55 4.80 17.00 213 Amifostine 9 1.19 1.65 3.20 11.00 44 13 1.20 2.92 4.80 4.80 56 Avg 1.22 2.37 4.27 10.93 104.33 SEM 0.03 0.38 0.53 3.52 54.44 Control 16 1.20 4.75 11.00 38.50 345 17 1.32 5.35 10.50 39.60 609 18 2.16 5.66 12.40 42.20 686 19 1.77 5.89 11.60 45.30 645 20 1.44 5.41 10.70 40.60 577 Avg 1.58 5.41 11.24 41.24 572.40 SEM 0.17 0.19 0.34 1.18 59.69
[0284] The data in FIGS. 85-87 show that treatment of the humanized mice with amifostine prior to irradiation results in an increase in the total bone marrow cellularity, the number of human CD45 positive cells in the bone marrow, and the number of CFU-Cs as compared to the corresponding levels in a mouse administered saline prior to irradiation.
[0285] The data in FIGS. 88-93 show that several miRNAs show a similar change in serum levels in response to irradiation. These data indicate that the levels of the miRNAs described herein can be used to determine a human's level of exposure to radiation and the effectiveness of a treatment administered to a subject exposed to radiation.
OTHER EMBODIMENTS
[0286] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Sequence CWU 1
1
274121RNAMus musculus 1uacaguacug ugauaacuga a 21223RNAMus musculus
2ugugcaaauc caugcaaaac uga 23322RNAMus musculus 3cagugcaaug
uuaaaagggc au 22421RNAMus musculus 4cauaaaguag aaagcacuac u
21522RNAMus musculus 5ucucccaacc cuuguaccag ug 22622RNAMus musculus
6agagaaaccc ugucucaaaa aa 22723RNAMus musculus 7ucucacacag
aaaucgcacc cgu 23822RNAMus musculus 8aaucacuaac uccacugcca uc
22921RNAMus musculus 9aaacaugaag cgcugcaaca c 211022RNAMus musculus
10ucguaccgug aguaauaaug cg 221122RNAMus musculus 11acugcaguga
gggcacuugu ag 221222RNAMus musculus 12acuccauuug uuuugaugau gg
221322RNAMus musculus 13ucgugucuug uguugcagcc gg 221422RNAMus
musculus 14uguaacagca acuccaugug ga 221521RNAMus musculus
15uucacagugg cuaaguuccg c 211622RNAMus musculus 16uagcaccauc
ugaaaucggu ua 221722RNAMus musculus 17cuuucagucg gauguuugca gc
221823RNAMus musculus 18uguaaacauc cuacacucuc agc 231922RNAMus
musculus 19cagugcaaug uuaaaagggc au 222022RNAMus musculus
20ucucccaacc cuuguaccag ug 222122RNAMus musculus 21acugcaguga
gggcacuugu ag 222222RNAMus musculus 22ucgugucuug uguugcagcc gg
222322RNAMus musculus 23uguaacagca acuccaugug ga 222421RNAMus
musculus 24uucacagugg cuaaguuccg c 212522RNAMus musculus
25cuuucagucg gauguuugca gc 222623RNAMus musculus 26uguaaacauc
cuacacucuc agc 232721RNAMus musculus 27cauaaaguag aaagcacuac u
212823RNAMus musculus 28ucucacacag aaaucgcacc cgu 232922RNAMus
musculus 29aaucacuaac uccacugcca uc 223022RNAMus musculus
30ucguaccgug aguaauaaug cg 223122RNAMus musculus 31aaaagcuggg
uugagagggc ga 223222RNAMus musculus 32acuccauuug uuuugaugau gg
223321RNAMus musculus 33gugcauugua guugcauugc a 213423RNAMus
musculus 34uguaguguuu ccuacuuuau gga 233522RNAMus musculus
35agagaaaccc ugucucaaaa aa 223622RNAMus musculus 36uuuguucguu
cggcucgcgu ga 223722RNAMus musculus 37acugauuucu uuugguguuc ag
223822RNAMus musculus 38aacuggccua caaaguccca gu 223922RNAMus
musculus 39cacccguaga accgaccuug cg 224021RNAMus musculus
40cuagacugag gcuccuugag g 214122RNAMus musculus 41cuauacgacc
ugcugccuuu cu 224222RNAMus musculus 42uccuguacug agcugccccg ag
224323RNAMus musculus 43ugaggggcag agagcgagac uuu 234422RNAMus
musculus 44uguaaacauc cuacacucag cu 224523RNAMus musculus
45caacggaauc ccaaaagcag cug 234622RNAMus musculus 46cagcagcaca
cugugguuug ua 224722RNAMus musculus 47uauugcacau uacuaaguug ca
224822RNAMus musculus 48ugccugucua cacuugcugu gc 224921RNAMus
musculus 49ccucugggcc cuuccuccag u 215023RNAMus musculus
50ugaguucgag gccagccugc uca 235122RNAMus musculus 51uggaguguga
caaugguguu ug 225223RNAMus musculus 52agaccuacuu aucuaccaac agc
235322RNAMus musculus 53aaugcaccug ggcaaggguu ca 225422RNAMus
musculus 54cuuucagucg gauguuuaca gc 225521RNAMus musculus
55aaacaugaag cgcugcaaca c 215619RNAMus musculus 56ggaggcagag
gcaggagga 195721RNAMus musculus 57cggggcagcu caguacagga u
215822RNAMus musculus 58uuuggucccc uucaaccagc ug 225921RNAMus
musculus 59ccguccugag guuguugagc u 216022RNAMus musculus
60ugcggggcua gggcuaacag ca 226122RNAMus musculus 61uagcaccauc
ugaaaucggu ua 226222RNAMus musculus 62aagguagaua gaacaggucu ug
226322RNAMus musculus 63uguaaacauc cucgacugga ag 226423RNAMus
musculus 64cccaguguuu agacuaccug uuc 236524RNAMus musculus
65ucccugagac ccuuuaaccu guga 246622RNAMus musculus 66uuuggucccc
uucaaccagc ua 226722RNAMus musculus 67uggcucaguu cagcaggaac ag
226822RNAMus musculus 68uagcuuauca gacugauguu ga 226923RNAMus
musculus 69uagcagcggg aacaguacug cag 237022RNAMus musculus
70cuggcccucu cugcccuucc gu 227122RNAMus musculus 71ugagguagua
guuuguacag uu 227222RNAMus musculus 72aacacaccug uucaaggauu ca
227323RNAMus musculus 73cccaguguuc agacuaccug uuc 237422RNAMus
musculus 74caggccauac ugugcugccu ca 227522RNAMus musculus
75ucuacagugc acgugucucc ag 227623RNAMus musculus 76ucuggcuccg
ugucuucacu ccc 237723RNAMus musculus 77uagcaccauu ugaaaucagu guu
237822RNAMus musculus 78uggaauguaa agaaguaugu au 227921RNAMus
musculus 79aucacauugc cagggauuac c 218021RNAMus musculus
80augaccuaug auuugacaga c 218122RNAMus musculus 81uucccuuugu
cauccuaugc cu 228222RNAMus musculus 82caucuuacug ggcagcauug ga
228322RNAMus musculus 83cauugcacuu gucucggucu ga 228422RNAMus
musculus 84uccagcauca gugauuuugu ug 228522RNAMus musculus
85uagguaguuu ccuguuguug gg 228622RNAHomo sapiens 86cagugcaaug
uuaaaagggc au 228722DNAMus musculus 87cagtgcaatg ttaaaagggc at
228822DNAHomo sapiens 88cagtgcaatg ttaaaagggc at 228922RNAHomo
sapiens 89ucucccaacc cuuguaccag ug 229022DNAMus musculus
90tctcccaacc cttgtaccag tg 229122DNAHomo sapiens 91tctcccaacc
cttgtaccag tg 229222RNAHomo sapiens 92acugcaguga aggcacuugu ag
229322DNAMus musculus 93actgcagtga gggcacttgt ag 229422DNAHomo
sapiens 94actgcagtga aggcacttgt ag 229522RNAHomo sapiens
95ucgugucuug uguugcagcc gg 229622DNAMus musculus 96tcgtgtcttg
tgttgcagcc gg 229722DNAHomo sapiens 97tcgtgtcttg tgttgcagcc gg
229822RNAHomo sapiens 98uguaacagca acuccaugug ga 229922DNAMus
musculus 99tgtaacagca actccatgtg ga 2210022DNAHomo sapiens
100tgtaacagca actccatgtg ga 2210121RNAHomo sapiens 101uucacagugg
cuaaguuccg c 2110221DNAMus musculus 102ttcacagtgg ctaagttccg c
2110321DNAHomo sapiens 103ttcacagtgg ctaagttccg c 2110422RNAHomo
sapiens 104cuuucagucg gauguuugca gc 2210522DNAMus musculus
105ctttcagtcg gatgtttgca gc 2210622DNAHomo sapiens 106ctttcagtcg
gatgtttgca gc 2210723RNAHomo sapiens 107uguaaacauc cuacacucuc agc
2310823DNAMus musculus 108tgtaaacatc ctacactctc agc 2310923DNAHomo
sapiens 109tgtaaacatc ctacactctc agc 2311021RNAHomo sapiens
110cauaaaguag aaagcacuac u 2111121DNAMus musculus 111cataaagtag
aaagcactac t 2111221DNAHomo sapiens 112cataaagtag aaagcactac t
2111323RNAHomo sapiens 113ucucacacag aaaucgcacc cgu 2311423DNAMus
musculus 114tctcacacag aaatcgcacc cgt 2311523DNAHomo sapiens
115tctcacacag aaatcgcacc cgt 2311622RNAHomo sapiens 116caaucacuaa
cuccacugcc au 2211721DNAMus musculus 117aatcactaac tccactgcca t
2111821DNAHomo sapiens 118aatcactaac tccactgcca t 2111922RNAHomo
sapiens 119ucguaccgug aguaauaaug cg 2212022DNAMus musculus
120tcgtaccgtg agtaataatg cg 2212122DNAHomo sapiens 121tcgtaccgtg
agtaataatg cg 2212222RNAHomo sapiens 122aaaagcuggg uugagagggc ga
2212322DNAMus musculus 123aaaagctggg ttgagagggc ga 2212422DNAHomo
sapiens 124aaaagctggg ttgagagggc ga 2212523RNAHomo sapiens
125acuccauuug uuuugaugau gga 2312622DNAMus musculus 126actccatttg
ttttgatgat gg 2212722DNAHomo sapiens 127actccatttg ttttgatgat gg
2212821RNAHomo sapiens 128gugcauugua guugcauugc a 2112921DNAMus
musculus 129gtgcattgta gttgcattgc a 2113021DNAHomo sapiens
130gtgcattgta gttgcattgc a 2113123RNAHomo sapiens 131uguaguguuu
ccuacuuuau gga 2313223DNAMus musculus 132tgtagtgttt cctactttat gga
2313323DNAHomo sapiens 133tgtagtgttt cctactttat gga 2313422RNAHomo
sapiens 134uuuguucguu cggcucgcgu ga 2213522DNAMus musculus
135tttgttcgtt cggctcgcgt ga 2213622DNAHomo sapiens 136tttgttcgtt
cggctcgcgt ga 2213722RNAHomo sapiens 137acugauuucu uuugguguuc ag
2213822DNAMus musculus 138actgatttct tttggtgttc ag 2213922DNAHomo
sapiens 139actgatttct tttggtgttc ag 2214022RNAHomo sapiens
140aacuggccua caaaguccca gu 2214122DNAMus musculus 141aactggccta
caaagtccca gt 2214222DNAHomo sapiens 142aactggccta caaagtccca gt
2214322RNAHomo sapiens 143cacccguaga accgaccuug cg 2214422DNAMus
musculus 144cacccgtaga accgaccttg cg 2214522DNAHomo sapiens
145cacccgtaga accgaccttg cg 2214621RNAHomo sapiens 146cuagacugaa
gcuccuugag g 2114721DNAMus musculus 147ctagactgag gctccttgag g
2114821DNAHomo sapiens 148ctagactgaa gctccttgag g 2114922RNAHomo
sapiens 149cuauacgacc ugcugccuuu cu 2215022DNAMus musculus
150ctatacgacc tgctgccttt ct 2215122DNAHomo sapiens 151ctatacgacc
tgctgccttt ct 2215222RNAHomo sapiens 152uccuguacug agcugccccg ag
2215322DNAMus musculus 153tcctgtactg agctgccccg ag 2215422DNAHomo
sapiens 154tcctgtactg agctgccccg ag 2215523RNAHomo sapiens
155ugaggggcag agagcgagac uuu 2315623DNAMus musculus 156tgaggggcag
agagcgagac ttt 2315723DNAHomo sapiens 157tgaggggcag agagcgagac ttt
2315822RNAHomo sapiens 158uguaaacauc cuacacucag cu 2215922DNAMus
musculus 159tgtaaacatc ctacactcag ct 2216022DNAHomo sapiens
160tgtaaacatc ctacactcag ct 2216123RNAHomo sapiens 161caacggaauc
ccaaaagcag cug 2316223DNAMus musculus 162caacggaatc ccaaaagcag ctg
2316323DNAHomo sapiens 163caacggaatc ccaaaagcag ctg 2316421RNAHomo
sapiens 164cagcagcaca cugugguuug u 2116521DNAMus musculus
165cagcagcaca ctgtggtttg t 2116621DNAHomo sapiens 166cagcagcaca
ctgtggtttg t 2116722RNAHomo sapiens 167uauugcacau uacuaaguug ca
2216822DNAMus musculus 168tattgcacat tactaagttg ca 2216922DNAHomo
sapiens 169tattgcacat tactaagttg ca 2217022RNAHomo sapiens
170ugccugucua cacuugcugu gc 2217122DNAMus musculus 171tgcctgtcta
cacttgctgt gc 2217222DNAHomo sapiens 172tgcctgtcta cacttgctgt gc
2217320RNAHomo sapiens 173ccucugggcc cuuccuccag 2017420DNAMus
musculus 174cctctgggcc cttcctccag 2017520DNAHomo sapiens
175cctctgggcc cttcctccag 2017622RNAHomo sapiens 176uggaguguga
caaugguguu ug 2217722DNAMus musculus 177tggagtgtga caatggtgtt tg
2217822DNAHomo sapiens 178tggagtgtga caatggtgtt tg 2217922RNAHomo
sapiens 179aaugcaccug ggcaaggauu ca 2218022DNAMus musculus
180aatgcacctg ggcaagggtt ca 2218122DNAHomo sapiens 181aatgcacctg
ggcaaggatt ca 2218222RNAHomo sapiens 182cuuucagucg gauguuuaca gc
2218322DNAMus musculus 183ctttcagtcg gatgtttaca gc 2218422DNAHomo
sapiens 184ctttcagtcg gatgtttaca gc 2218521RNAHomo sapiens
185aaacaugaag cgcugcaaca c 2118616DNAMus musculus 186aaacatgaag
cgctgc 1618716DNAHomo sapiens 187aaacgtgagg cgctgc 1618820RNAHomo
sapiens 188gaggcagaag caggaugaca 2018915RNAMus musculus
189gaggcagagg cagga
1519015RNAHomo sapiens 190gaggcagaag cagga 1519121RNAHomo sapiens
191cggggcagcu caguacagga u 2119221DNAMus musculus 192cggggcagct
cagtacagga t 2119321DNAHomo sapiens 193cggggcagct cagtacagga t
2119422RNAHomo sapiens 194uuuggucccc uucaaccagc ug 2219522DNAMus
musculus 195tttggtcccc ttcaaccagc tg 2219622DNAHomo sapiens
196tttggtcccc ttcaaccagc tg 2219721RNAHomo sapiens 197cuguccuaag
guuguugagu u 2119817DNAMus musculus 198gtcctgaggt tgttgag
1719917DNAHomo sapiens 199gtcctaaggt tgttgag 1720022RNAHomo sapiens
200ugcggggcua gggcuaacag ca 2220122DNAMus musculus 201tgcggggcta
gggctaacag ca 2220222DNAHomo sapiens 202tgcggggcta gggctaacag ca
2220322RNAHomo sapiens 203uagcaccauc ugaaaucggu ua 2220422DNAMus
musculus 204tagcaccatc tgaaatcggt ta 2220522DNAHomo sapiens
205tagcaccatc tgaaatcggt ta 2220622RNAHomo sapiens 206uguaaacauc
cucgacugga ag 2220722DNAMus musculus 207tgtaaacatc ctcgactgga ag
2220822DNAHomo sapiens 208tgtaaacatc ctcgactgga ag 2220923RNAHomo
sapiens 209cccaguguuu agacuaucug uuc 2321023DNAMus musculus
210cccagtgttt agactacctg ttc 2321123DNAHomo sapiens 211cccagtgttt
agactatctg ttc 2321224RNAHomo sapiens 212ucccugagac ccuuuaaccu guga
2421324DNAHomo sapiens 213tccctgagac cctttaacct gtga 2421424DNAMus
musculus 214tccctgagac cctttaacct gtga 2421522RNAHomo sapiens
215uuuggucccc uucaaccagc ua 2221622DNAMus musculus 216tttggtcccc
ttcaaccagc ta 2221722DNAHomo sapiens 217tttggtcccc ttcaaccagc ta
2221822RNAHomo sapiens 218uggcucaguu cagcaggaac ag 2221922DNAMus
musculus 219tggctcagtt cagcaggaac ag 2222022DNAHomo sapiens
220tggctcagtt cagcaggaac ag 2222122RNAHomo sapiens 221uagcuuauca
gacugauguu ga 2222222DNAMus musculus 222tagcttatca gactgatgtt ga
2222322DNAHomo sapiens 223tagcttatca gactgatgtt ga 2222423RNAHomo
sapiens 224uagcagcggg aacaguucug cag 2322523DNAMus musculus
225tagcagcggg aacagtactg cag 2322623DNAHomo sapiens 226tagcagcggg
aacagttctg cag 2322722RNAHomo sapiens 227cuggcccucu cugcccuucc gu
2222822DNAMus musculus 228ctggccctct ctgcccttcc gt 2222922DNAHomo
sapiens 229ctggccctct ctgcccttcc gt 2223022RNAHomo sapiens
230ugagguagua guuuguacag uu 2223122DNAMus musculus 231tgaggtagta
gtttgtacag tt 2223222DNAHomo sapiens 232tgaggtagta gtttgtagag tt
2223322RNAHomo sapiens 233aacacaccua uucaaggauu ca 2223422DNAMus
musculus 234aacacacctg ttcaaggatt ca 2223522DNAHomo sapiens
235aacacaccta ttcaaggatt ca 2223623RNAHomo sapiens 236cccaguguuc
agacuaccug uuc 2323723DNAMus musculus 237cccagtgttc agactacctg ttc
2323823DNAHomo sapiens 238cccagtgttc agactacctg ttc 2323922RNAHomo
sapiens 239caggccauau ugugcugccu ca 2224022DNAMus musculus
240caggccatac tgtgctgcct ca 2224122DNAHomo sapiens 241caggccatat
tgtgctgcct ca 2224223RNAHomo sapiens 242ucuacagugc acgugucucc agu
2324322DNAMus musculus 243tctacagtgc acgtgtctcc ag 2224422DNAHomo
sapiens 244tctacagtgc acgtgtctcc ag 2224523RNAHomo sapiens
245ucuggcuccg ugucuucacu ccc 2324623DNAMus musculus 246tctggctccg
tgtcttcact ccc 2324723DNAHomo sapiens 247tctggctccg tgtcttcact ccc
2324823RNAHomo sapiens 248uagcaccauu ugaaaucagu guu 2324923DNAMus
musculus 249tagcaccatt tgaaatcagt gtt 2325023DNAHomo sapiens
250tagcaccatt tgaaatcagt gtt 2325122RNAHomo sapiens 251uggaauguaa
agaaguaugu au 2225222DNAMus musculus 252tggaatgtaa agaagtatgt at
2225322DNAHomo sapiens 253tggaatgtaa agaagtatgt at 2225421RNAHomo
sapiens 254aucacauugc cagggauuac c 2125521DNAMus musculus
255atcacattgc cagggattac c 2125621DNAHomo sapiens 256atcacattgc
cagggattac c 2125721RNAHomo sapiens 257augaccuaug aauugacaga c
2125821DNAMus musculus 258atgacctatg atttgacaga c 2125921DNAHomo
sapiens 259atgacctatg aattgacaga c 2126022RNAHomo sapiens
260uucccuuugu cauccuaugc cu 2226122DNAMus musculus 261ttccctttgt
catcctatgc ct 2226222DNAHomo sapiens 262ttccctttgt catcctatgc ct
2226322RNAHomo sapiens 263caucuuacug ggcagcauug ga 2226422DNAMus
musculus 264catcttactg ggcagcattg ga 2226522DNAHomo sapiens
265catcttactg ggcagcattg ga 2226622RNAHomo sapiens 266cauugcacuu
gucucggucu ga 2226722DNAMus musculus 267cattgcactt gtctcggtct ga
2226822DNAHomo sapiens 268cattgcactt gtctcggtct ga 2226922RNAHomo
sapiens 269uccagcauca gugauuuugu ug 2227022DNAMus musculus
270tccagcatca gtgattttgt tg 2227122DNAHomo sapiens 271tccagcatca
gtgattttgt tg 2227222RNAHomo sapiens 272uagguaguuu ccuguuguug gg
2227322DNAMus musculus 273taggtagttt cctgttgttg gg 2227422DNAHomo
sapiens 274taggtagttt cctgttgttg gg 22
Patent Diagrams and Documents
D00001
D00002
D00003
D00004
D00005
D00006
D00007
D00008
D00009
D00010
D00011
D00012
D00013
D00014
D00015
D00016
D00017
D00018
D00019
D00020
D00021
D00022
D00023
D00024
D00025
D00026
D00027
D00028
D00029
D00030
D00031
D00032
D00033
D00034
D00035
D00036
D00037
D00038
D00039
D00040
D00041
D00042
S00001
XML
uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.
While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.
All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.
| 