U.S. patent application number 17/020098 was filed with the patent office on 2021-03-18 for methods of inducing metabolic maturation of human pluripotent stem cells-derived hepatocytes.
The applicant listed for this patent is Yissum Research Development Company of the Hebrew University of Jerusalem Ltd.. Invention is credited to Yishai Avior, Gahl Levy, Yaakov Nahmias, Michal Zimerman.
Application Number | 20210077444 17/020098 |
Document ID | / |
Family ID | 1000005251441 |
Filed Date | 2021-03-18 |
![](/patent/app/20210077444/US20210077444A1-20210318-D00001.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00002.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00003.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00004.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00005.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00006.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00007.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00008.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00009.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00010.png)
![](/patent/app/20210077444/US20210077444A1-20210318-D00011.png)
View All Diagrams
United States Patent
Application |
20210077444 |
Kind Code |
A1 |
Nahmias; Yaakov ; et
al. |
March 18, 2021 |
Methods of Inducing Metabolic Maturation of Human Pluripotent Stem
Cells-Derived Hepatocytes
Abstract
Provided are methods of increasing metabolic maturation of an
immature hepatocyte, by contacting an immature hepatocyte which
expresses alpha-fetoprotein (AFP) and albumin with an effective
amount of a fatty acid or a small molecule selected from the group
consisting of: an amphipathic carboxylic acid Thiazolidinedione
(TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4,
GW 7647, Perfluorooctanesulfonic Acid, Perfluorooctanoic Acid,
CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil. Also
provided are isolated hepatocytes and uses thereof.
Inventors: |
Nahmias; Yaakov;
(Rishon-LeZion, IL) ; Zimerman; Michal; (Caesarea,
IL) ; Levy; Gahl; (Ramat-Gan, IL) ; Avior;
Yishai; (Rosh HaAyin, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Yissum Research Development Company of the Hebrew University of
Jerusalem Ltd. |
Jerusalem |
|
IL |
|
|
Family ID: |
1000005251441 |
Appl. No.: |
17/020098 |
Filed: |
September 14, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15459139 |
Mar 15, 2017 |
10772863 |
|
|
17020098 |
|
|
|
|
62308372 |
Mar 15, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/201
20130101 |
International
Class: |
A61K 31/201 20060101
A61K031/201 |
Claims
1-27. (canceled)
28. An isolated cell population of metabolically mature hepatocytes
wherein one or more hepatocyte cells exhibit Cytochrome P450 3A4
(CYP3A4) activity which oxidizes at least 1 pmol of
7-benzyloxy-4-trifluoromethylcoumarin (BFC) per minute per
milligram of cellular protein and an alpha-fetoprotein (AFP)
activity of at least 60 .mu.g/day/mg cellular protein as assayed by
ELISA when cultured in the presence of a culture medium which
comprises Insulin-Transferrin-Selenium (ITS), Glutamax,
Dexamethasone, hepatocyte growth factor (HGF), Oleic acid and
9CLA.
29. (canceled)
30. An isolated population of cells as claimed in claim 28, wherein
at least 50% of the cells exhibit said activities.
31-32. (canceled)
33. The isolated hepatocyte population of claim 28, wherein said
hepatocyte population is characterized by nuclear expression of
pregnane X receptor (PXR).
34-37. (canceled)
38. The isolated hepatocyte population of claim 28, obtained from
an immature hepatocyte which produces at least 1 .mu.g to 25 .mu.g
Albumin/ml/mg cellular protein and cannot differentiate into bile
duct cells.
39. The isolated hepatocyte population of claim 28, wherein said
hepatocyte is distinguishable from an adult hepatocyte by at least
the expression of AFP.
40. The hepatocyte population of claim 28, wherein the hepatocyte
contains an increased mitochondrial mass per cell as compared to
the mitochondrial mass in a control immature hepatocyte.
41. The metabolically mature hepatocyte population of claim 38,
wherein said immature hepatocytes exhibit an alpha-fetoprotein
(AFP).sup.+/Albumin.sup.+/CYP347.sup.+/SOX2.sup.-/OCT4.sup.-
expression signature.
42. The metabolically mature hepatocyte population of claim 28,
wherein the mature hepatocytes exhibit an
albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup-
.+/HNF4.alpha..sup.+ expression signature.
43. An isolated cell population of metabolically mature hepatocytes
generated from immature hepatocytes contacted with one or more of a
PXR agonist, a fatty acid or a small molecule selected from the
group consisting of: an amphipathic carboxylic acid,
Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544,
GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid,
Perfluorooctanoic Acid, CP-775146, CP-865520, UNII-999KY5ZIGB, and
Gemfibrozil, said contacting increasing the metabolic maturation of
the immature hepatocyte, said agonist causing increased
mitochondrial mass and mitochondrial proliferation rate per cell
when compared to untreated immature hepatocytes.
44. The isolated metabolically mature hepatocytes of claim 43,
where the PXR agonist is a small molecule, a bile acid and a
steroid, contact with said agonist increasing expression of CYP3A4
and CYP2C9 by at least two-fold.
45. The metabolically mature hepatocyte population of claim 43,
wherein the mature hepatocytes exhibit an
albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup-
.+/HNF4.alpha..sup.+ expression signature.
46. The metabolically mature hepatocyte population of claim 44,
wherein the mature hepatocytes exhibit an
albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup-
.+/HNF4.alpha..sup.+ expression signature.
Description
RELATED APPLICATION
[0001] This application claims the benefit of priority under 35 USC
119(e) of U.S. Provisional Patent Application No. 62/308,372 filed
on Mar. 15, 2016, the contents of which are incorporated herein by
reference in their entirety.
[0002] The work leading to this invention has received funding from
the European Research Council under the European Union's Seventh
Framework Programme (FP7/2007-2013)/ERC grant agreement no.
[248417].
SEQUENCE LISTING STATEMENT
[0003] The ASCII file, entitled 69429SequenceListing.txt, created
on Mar. 15, 2017, comprising 169,445 bytes, submitted concurrently
with the filing of this application is incorporated herein by
reference.
FIELD AND BACKGROUND OF THE INVENTION
[0004] The present invention, in some embodiments thereof, relates
to methods of increasing metabolic maturation of immature
hepatocytes and isolated hepatocytes resulting thereof.
[0005] The liver is the largest internal organ in the human body,
and is responsible for protein synthesis as well as glucose, lipid
and nitrogen homeostasis. Transformation of lipid metabolites is
primarily carried out by the cytochrome P450 (CYP450) family of
monooxygenases, which is also responsible for the transformation of
most xenobiotics, often as a first step for conjugation and
secretion of water-soluble metabolites (Guengerich 2007). Due to
these metabolic functions the organ is particularly sensitive to
drug-induced liver injury (DILI), a leading cause of acute liver
failure and post-market drug withdrawals (Kaplowitz 2005). Liver
toxicity and drug metabolism are therefore a major focus of
pharmaceutical and cosmetic industry compound development.
[0006] The low concordance between animal studies and clinical data
(Olson, Betton et al. 2000, Gottmann, Kramer et al. 2001) and the
low metabolic activity of hepatic cell lines necessitates the use
of primary human hepatocytes for drug metabolism and toxicity
studies (LeCluyse 2001). However, primary human hepatocytes are
scarce, do not proliferate and rapidly lose their metabolic
functions in vitro (Guillouzo 1998, Hewitt, Lechon et al. 2007).
The recent development of micro-fabricated or oxygenated
co-cultures was shown to support primary cell activity for several
weeks in culture (Nahmias, Berthiaume et al. 2007, Khetani and
Bhatia 2008, Kidambi, Yarmush et al. 2009, Shulman and Nahmias
2013), but did little to attenuate the need for functional cells.
It is the scarcity in primary human hepatocytes that drives the
current focus in hepatic cell differentiation. Although a few cell
types can be coaxed into hepatic like cells (Schwartz, Reyes et al.
2002, Lue, Lin et al. 2010, Stock, Bruckner et al. 2010, Zhu,
Rezvani et al. 2014), it is thought that only pluripotent stem
cells (PSC) may provide the full gamete of mature hepatic function
(Duan, Ma et al. 2010).
[0007] Indeed, several groups already reported the differentiation
of hepatocyte-like cells from embryonic or induced pluripotent stem
cells (Song, Cai et al. 2009, Duan, Ma et al. 2010, Si-Tayeb, Noto
et al. 2010, Chen, Tseng et al. 2012, Roelandt, Vanhove et al.
2013, Shan et al. 2013, Chen et al. 2015). While these groups
focused on albumin production, hepatocyte-like cells still display
fetal markers such as .alpha.-fetoprotein (AFP) and lack the
inducibility and function of most mature CYP450 enzymes, such as
CYP3A4. In fact, recent attempts to use hPSC-derived hepatocytes in
drug toxicity screening garnered a poor correlation with primary
human hepatocytes, showing an R.sup.2 of 0.49 (Szkolnicka,
Farnworth et al. 2014). Interestingly, fetal markers such as AFP
and CYP3A7 were shown to decrease only after birth, with a gradual
increase in CYP3A4 expression taking place only during the first
year of life (Lacroix, Sonnier et al. 1997, Guengerich 2007). These
in vivo results suggest that post-partum cues may drive the final
maturation step of liver cells.
[0008] Postnatal maturation of mitochondria is another key limiting
factor in the derivation of functional hepatocytes. Fetal
hepatocytes rely on placenta-transferred carbohydrates and
anaerobic glycolysis (Hommes, 1973; Hommes, 1975), while postnatal
functional and structural maturation of over 1400 mitochondria in
liver cells enables much higher metabolic rates (Pollak, 1980).
[0009] Therefore, recently, mitochondrial biogenesis and metabolism
emerged as important factors in evaluating hepatic maturity and
functionality in vitro (Yue Yu, 2012; Anais Waneta, 2014).
[0010] The liver microenvironment changes significantly by the
transition from placental to enteral nutrition (Morelli 2008).
Fatty acids from breastfeeding become the primary energy source,
while gut colonization exposes the liver to bacterial-derived
secondary metabolites, such as litocholic acid (LCA) and
menaquinone-4 (MK4). LCA is a secondary bile acid, produced by
intestinal bacteria, and shown to activate the pregnane X receptor
(PXR), a nuclear receptor controlling the expression of CYP450
enzymes such as CYP2C9 and CYP3A4 (Staudinger, Goodwin et al.
2001). Vitamin K is a group of essential fat-soluble vitamins,
whose active metabolite MK4 (vitamin K.sub.2) is synthesized by
colon bacteria (Conly and Stein 1992).
[0011] Prenatal levels of vitamin K are low due to poor placental
travel (Shearer, Rahim et al. 1982), and it is regularly
administered to newborns immediately after birth to prevent vitamin
K deficiency that leads to fatal bleeding (Shearer 2009). MK4 was
also shown to activate PXR, primarily in bone cells (Tabb, Sun et
al. 2003, Ichikawa, Horie-Inoue et al. 2006).
[0012] Intestinal microbial colonization in newborns is also
influenced by the lipid rich diet (Morelli, 2008; DA, 2014).
Bifidobacterium and lactobacillus thrive on breast milk glycans and
lactate, respectively, thus becoming predominant during the
lactation period (Conway, 1997; Haarman, 2005; Haarman, 2006; Sela,
2014). Both strains metabolize one of the main unsaturated fatty
acid in the human breast milk, linoleic acid (LA) (Finley, 1985,
Supplement table 1), to conjugated linoleic acid (CLA), mainly to
cis-9,trans-11-octadecadienoic acid 18:2 (9CLA), which is known for
its bioactive properties (Halade, 2009; Halade, 2010; Poirier,
2006; Reynolds, 2010; Choi, 2007). 9CLA enhances hepatic
mitochondrial function in rats (Choi, 2007) and acts as a high
affinity ligand of Peroxisome proliferator-activated receptor,
isoform a (PPAR.alpha.) (Moya-Camarena, 1999). PPAR.alpha. is a
lipid activated nuclear receptor whose expression and activity
increase significantly during the suckling period (Beck, 1992;
Panadero, 2000).
[0013] Additional background art includes U.S. Patent Application
Publication US 20070213282 A1 [Peroxisome proliferator-activated
receptor (PPAR) activator, and drugs, supplements, functional foods
and food additives using the same]; Tashiro K., et al., 2009 (Stem
Cells 27: 1802-1811); Inamura M et al. 2011 (Mol. Therapy,
19:400-407); Sullivan G J., et al. 2011 (Hepatology 51: 329-335);
Si-Tayeb K., et al., 2010 (Hepatology 51: 297-305); Song Z., et al.
2009 (Cell Research 19: 1233-1242); Shan J., et al., 2013 (Nature
Chemical Biology 9: 514-521); Kai-Ting Chen et al., 2014 (Journal
of Hepatology, Elsevier, 2014, 61 (6), pp. 1276-1286); Parmentier J
H 1997 (Biochemical Pharmacology 54: 889-898); Gruppuso P A., et
al. 2000 (Biochimica et Biophysica Acta 1494:242-247); Esmaeli S.,
et al. 2014 (Cell Biochemistry and Function 32: 410-419); Chen J.,
et al., 2016 (Scientific Reports 6: 18841 DOI: 10.1038/srep18841);
Stier H., et al., 1998 (Differentiation 64: 55-66).
SUMMARY OF THE INVENTION
[0014] According to an aspect of some embodiments of the present
invention there is provided a method of increasing metabolic
maturation of an immature hepatocyte, the method comprising
contacting an immature hepatocyte which expresses alpha-fetoprotein
(AFP) and albumin with an effective amount of a fatty acid or a
small molecule selected from the group consisting of: an
amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643
(Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647,
Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146,
CP-865520, UNII-999KY5ZIGB, and Gemfibrozil, thereby increasing the
metabolic maturation of the immature hepatocyte.
[0015] According to an aspect of some embodiments of the present
invention there is provided a method of treating a subject
diagnosed with a pathology characterized by immature hepatocytes,
the method comprising administering to the subject an effective
amount of a fatty acid or a small molecule selected from the group
consisting of: an amphipathic carboxylic acid, Thiazolidinedione
(TZD), WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4,
GW 7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID,
CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil, thereby
increasing the metabolic maturation of the immature hepatocytes and
treating the subject.
[0016] According to an aspect of some embodiments of the present
invention there is provided a method of increasing metabolic
maturation of an immature hepatocyte, the method comprising
contacting an immature hepatocyte which expresses alpha-fetoprotein
(AFP) and albumin with a medium being devoid of an IL6 ligand and
which comprises an effective amount of a PXR agonist selected from
the group consisting of: a small molecule, a bile acid, and a
steroid, thereby increasing the metabolic maturation of the
immature hepatocyte, wherein said effective amount of said PXR
agonist increases the expression of a PXR target gene selected from
the group consisting of: CYP3A4 and CYP2C9 by at least 2-folds.
[0017] According to an aspect of some embodiments of the present
invention there is provided a method of treating a subject
diagnosed with a pathology characterized by immature hepatocytes,
the method comprising administering to the subject a pharmaceutical
composition comprising an effective amount of a PXR agonist
selected from the group consisting of: a small molecule, a bile
acid, and a steroid, wherein said pharmaceutical composition is
devoid of an IL6 ligand, wherein said effective amount of said PXR
agonist increases the expression of a PXR target gene selected from
the group consisting of: CYP3A4 and CYP2C9 by at least 2-folds,
thereby increasing the metabolic maturation of said immature
hepatocytes and treating the subject.
[0018] According to an aspect of some embodiments of the present
invention there is provided an isolated hepatocyte characterized by
a Cytochrome P450 3A4 (CYP3A4) activity which is capable of
oxidizing at least 1 pmol of 7-benzyloxy-4-trifluoromethylcoumarin
(BFC) per minute per milligram of cellular protein and an alpha
feto-protein (AFP) activity of at least 60 .mu.g/day/mg cellular
protein as assayed by ELISA when cultured in the presence of a
culture medium which comprises Insulin-Transferrin-Selenium (ITS),
Glutamax, Dexamethasone, hepatocyte growth factor (HGF), Oleic acid
and 9CLA.
[0019] According to an aspect of some embodiments of the present
invention there is provided an isolated hepatocyte obtainable by
the method according to the method of some embodiments of the
invention.
[0020] According to an aspect of some embodiments of the present
invention there is provided an isolated population of cells wherein
at least 50% of the cells comprise the isolated hepatocyte of some
embodiments of the invention.
[0021] According to an aspect of some embodiments of the present
invention there is provided a method of screening a compound for
liver toxicity, comprising:
[0022] (a) incubating the isolated population of cells of some
embodiments of the invention with the compound for a pre-determined
time period, and;
[0023] (b) determining percentage of a parameter indicative of
liver toxicity following the pre-determined time period, thereby
screening the compound for the liver toxicity.
[0024] According to an aspect of some embodiments of the present
invention there is provided a kit for screening a compound for
liver toxicity comprising the isolated population of cells of some
embodiments of the invention and at least one agent capable of
detecting a toxicological end-point selected from the group
consisting of: steatosis, cholestasis and apoptosis.
[0025] According to an aspect of some embodiments of the present
invention there is provided a nutrition formula for an infant
comprising 9CLA.
[0026] According to some embodiments of the invention, the
effective amount of said PXR agonist causes differentiation of said
immature hepatocyte into a mature hepatocyte.
[0027] According to some embodiments of the invention, the mature
hepatocyte is characterized by an
albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4-/SOX2.sup.-/A1AT.sup.+/HN-
F4.alpha..sup.+ expression signature.
[0028] According to some embodiments of the invention, the
effective amount of said PXR agonist is provided in a concentration
of at least half maximal effective concentration (EC.sub.50) of
said PXR agonist.
[0029] According to some embodiments of the invention, the PXR
agonist is selected from the group consisting of: a small molecule
and a bile acid.
[0030] According to some embodiments of the invention, the small
molecule is selected from the group consisting of: Rifampicin,
T0901317, SR12813, mevastatin, rifaximin, hyperforin, meclizine,
paclitaxel, atorvastatin, pregnenolone-16alpha-carbonitrile,
Butamben and 24(S),25-Epoxycholesterol.
[0031] According to some embodiments of the invention, the bile
acid is selected from the group consisting of lithocholic acid,
cholic acid, chenodeoxycholic acid, deoxycholic acid, and
ursodeoxycholic acid, or a derivative thereof.
[0032] According to some embodiments of the invention, the steroid
is selected from the group consisting of progesterone,
17.alpha.-hydroxyprogesterone, 17.alpha.-hydroxypregnenolone,
5.alpha.-dihydroprogesterone, 5.beta.-dihydroprogesterone,
allopregnanolone, corticosterone, cyproterone acetate,
spironolactone, dexamethasone, and mifepristone.
[0033] According to some embodiments of the invention, the
contacting or the administering is performed in an absence of an
IL6 ligand.
[0034] According to some embodiments of the invention, the fatty
acid is non-conjugated.
[0035] According to some embodiments of the invention, a
concentration of the non-conjugated is at least 50 .mu.M.
[0036] According to some embodiments of the invention, the immature
hepatocyte is characterized by an alpha-feto protein
(AFP)+/Albumin+/CYP3A7+/SOX2-/OCT4- expression signature.
[0037] According to some embodiments of the invention, the immature
hepatocyte does not differentiate into bile duct cells.
[0038] According to some embodiments of the invention, the method
resulting in a mature hepatocyte characterized by an
albumin+/CY3A4+/E-cadherin+/OCT4-/SOX2-/A1AT+/HNF4.alpha.+
expression signature.
[0039] According to some embodiments of the invention, the IL6
ligand is selected from the group consisting of oncostatin M (OSM),
interleukin 6 (IL6), leukemia inhibitory factor (LIF), leptin (OB),
Cardiotrophin-1/CT-1, CLC, CNTF, G-CSF, IL-11, IL-31, and
Ncuropoictin/NP.
[0040] According to some embodiments of the invention, the immature
hepatocyte is obtained by an in vitro differentiation of a
pluripotent stem cell.
[0041] According to some embodiments of the invention, the immature
hepatocyte is obtained by an in vitro differentiation of a
hepatoblast.
[0042] According to some embodiments of the invention, the in vitro
differentiation of the hepatoblast is performed by culturing the
hepatoblast for a pre-determined time period in a culture medium
which comprises an IL6 ligand.
[0043] According to some embodiments of the invention, prior to
formation of the hepatoblast the fatty acid and/or the small
molecule are absent from a culture comprising the hepatoblast.
[0044] According to some embodiments of the invention, the
non-conjugated fatty acid is selected from the group consisting of
oleic acid (OA), Palmitic Acid and linoleic acid (LA).
[0045] According to some embodiments of the invention, the
non-conjugated fatty acid is selected from the group consisting of
oleic acid (OA) and linoleic acid (LA).
[0046] According to some embodiments of the invention, the
non-conjugated fatty acid is oleic acid (OA).
[0047] According to some embodiments of the invention, the
non-conjugated fatty acid is linoleic acid (LA).
[0048] According to some embodiments of the invention, the
non-conjugated fatty acid is Palmitic Acid.
[0049] According to some embodiments of the invention, the fatty
acid is a conjugated fatty acid.
[0050] According to some embodiments of the invention, the
conjugated fatty acid is provided at a concentration of at least 50
.mu.M.
[0051] According to some embodiments of the invention, the
conjugated fatty acid is provided at a concentration of 50-200
.mu.M.
[0052] According to some embodiments of the invention, the
conjugated fatty acid is 9-cis, 11-trans conjugated linoleic acid
(9CLA).
[0053] According to some embodiments of the invention, the
conjugated fatty acid is selected from the group consisting of a
conjugated linoleic acid which comprises two conjugated double
bonds, a conjugated linoleic acid which comprises three conjugated
double bonds, 9E,11Z,15E-octadeca-9,11,15-trienoic acid (Rumclcnic
acid), 9E,11Z,13Z,15E-octadeca-9,11,13,15-tetraenoic acid
(.alpha.-Parinaric acid), all trans-octadeca-9,11,13,15-tretraenoic
acid (.beta.-Parinaric) acid, and 5Z,8Z,10E,12E,14Z-eicosanoic acid
(Bosseopentaenoic acid).
[0054] According to some embodiments of the invention, the fatty
acid is an omega 3 polyunsaturated fatty acid.
[0055] According to some embodiments of the invention, the
amphipathic carboxylic acid comprises a fibrate.
[0056] According to some embodiments of the invention, the fibrate
is selected from the group consisting of Fenofibrate, Bezafibrate,
Ciprofibrate, Clofibrate, Gemfibrozil, Fenofibrate, and
Clinofibrate.
[0057] According to some embodiments of the invention, the
Thiazolidinedione is selected from the group consisting of
Pioglitazone, Rosiglitazone, Lobeglitazone, Troglitazone,
Ciglitazone, Darglitazone, Englitazone, Netoglitazone and
Rivoglitazone.
[0058] According to some embodiments of the invention, the
metabolic maturation comprises an increase in a mitochondrial mass
per cell as compared to the mitochondrial mass in a control
immature hepatocyte.
[0059] According to some embodiments of the invention, the increase
in the mitochondrial mass comprises an increase in a proliferation
rate of the mitochondria as compared to a proliferation rate of the
mitochondria in a control immature hepatocyte.
[0060] According to some embodiments of the invention, the
metabolic maturation comprises an increase in a maturation state of
the mitochondria as compared to a maturation state of a control
immature hepatocyte.
[0061] According to some embodiments of the invention, the immature
hepatocyte is from a newborn human individual.
[0062] According to some embodiments of the invention, the
hepatoblast is obtainable by a method which comprises:
[0063] (a) culturing undifferentiated pluripotent stem cells in a
medium which comprises activin A, B27, Wnt3A and hepatocyte growth
factor (HGF) to thereby obtain cells characteristics of a
definitive endoderm, and subsequently;
[0064] (b) culturing the cells characteristics of the definitive
endoderm in a culture medium which comprises Dimethyl sulfoxide
(DMSO), to thereby obtain the hepatoblast.
[0065] According to some embodiments of the invention, wherein step
(b) further comprises passaging the cells at least once in the
culture medium which comprises the DMSO.
[0066] According to some embodiments of the invention, the
hepatocyte is characterized by a Cytochrome P450 3A4 (CYP3A4)
activity which is capable of oxidizing at least 1 pmol of
7-benzyloxy-4-trifluoromethylcoumarin (BFC) per minute per
milligram of cellular protein.
[0067] According to some embodiments of the invention, the
hepatocyte is characterized by an alpha feto-protein (AFP)
production of at least 60 microgram per day per milligram cellular
protein as determined by an ELISA.
[0068] According to some embodiments of the invention, the
hepatocyte is characterized by nuclear expression of PXR.
[0069] According to some embodiments of the invention, the liver
toxicity comprises steatosis.
[0070] According to some embodiments of the invention, the
steatosis is assayable using the LipidTox neutral lipid stain.
[0071] According to some embodiments of the invention, the liver
toxicity comprises cholestasis.
[0072] According to some embodiments of the invention, the
cholestasis is assayable using the CDFDA staining.
[0073] According to some embodiments of the invention, the liver
toxicity comprises apoptosis.
[0074] According to some embodiments of the invention, the
apoptosis is assayable using the TUNEL assay.
[0075] According to some embodiments of the invention, the
nutrition formula being suitable for infant(s) born by
C-section.
[0076] Unless otherwise defined, all technical and/or scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which the invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of
embodiments of the invention, exemplary methods and/or materials
are described below. In case of conflict, the patent specification,
including definitions, will control. In addition, the materials,
methods, and examples are illustrative only and are not intended to
be necessarily limiting.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0077] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawings will be provided by the Office upon
request and payment of the necessary fee.
[0078] Some embodiments of the invention are herein described, by
way of example only, with reference to the accompanying drawings.
With specific reference now to the drawings in detail, it is
stressed that the particulars shown are by way of example and for
purposes of illustrative discussion of embodiments of the
invention. In this regard, the description taken with the drawings
makes apparent to those skilled in the art how embodiments of the
invention may be practiced.
[0079] In the drawings:
[0080] FIGS. 1A-H demonstrate the differentiation of human
embryonic stem cell (hESC) derived hepatocytes according to the
method of some embodiments of the invention. FIG. 1A--Schematic of
a four-stage protocol used to control hepatocyte differentiation.
Note that in the last stage (stage 4, days 12-16) the medium is
devoid of oncostatin-M (OSM). FIG. 1B--Phase and immunofluorescence
micrographs of differentiating 13 human embryonic stem cells.
Differentiating cells undergo distinct morphological changes (Phase
images, top row) and progress through defined transcriptional
states toward hepatocytes. FIGS. 1C-E--qRT-PCR analyses. FIG.
1C--qRT-PCR analysis of transcription factors maintaining
pluripotency (OCT4 and SOX2); FIG. 1D--qRT-PCR analysis of
transcription factors regulating hepatic differentiation (SOX17,
GATA4, FOXA2 and HNF4A); FIG. 1E--qRT-PCR analysis of key liver
proteins (AFP, albumin and A1AT).
[0081] The results show that the pluripotency factors disappear by
day 8 (FIG. 1C), followed by a transient expression of endodermal
genes (FIG. 1D) and the gradual appearance of hepatocyte specific
proteins (FIG. 1E). FIG. 1F--Flow cytometry of cells at day 3
(endoderm) shows that 41% of the cells express definitive endoderm
markers CXCR4 and SOX17. FIG. 1G--Flow cytometry profile of cells
at day 7 (hepatoblasts) shows that 83% of the cells express
standard hepatoblast markers, HNF4A and FOXA2. FIG. 1H--Flow
cytometry of cells after 16 days of differentiation (hepatocytes)
shows that 83% of the cells are positive for both albumin and
HNF4A. The following abbreviations were used: Wnt3A, Wingless-Type
MMTV Integration Site Family, Member 3A; HGF, hepatic growth
factor; DMSO, Dimethyl sulfoxide; DEX, Dexamethasone; OSM,
oncostatin-M; FGF2, fibroblast growth factor-2; OCT4,
octamer-binding transcription factor 4; SOX17, SRY (sex determining
region Y)-box 17; GATA4, GATA binding protein 4; FOXA2, forkhead
box protein A2; HNF4A, hepatocyte nuclear factor 4-alpha; SOX2, SRY
(sex determining region Y)-box 2; AFP, alpha-fetoprotein; A1AT,
alpha 1-antitrypsin.
[0082] FIGS. 2A-I demonstrate that LCA and MK4 drive PXR dependent
hepatic maturation. FIGS. 2A-B--Quantitative reverse-transcriptase
polymerase chain reaction (qRT-PCR) analysis of nuclear receptors,
drug transporters, and phase I drug metabolism enzymes in
hESC-derived hepatocytes (hESC-H D16), adult primary human
hepatocytes (PHH), and HepG2 cells. hESC-derived hepatocytes show
similar expression of CAR and FXR, when compared to PHHs, while
expressing lower levels of PXR, CYP3A4, and CYP2C9 that are still
substantially higher than that of HepG2 cells (FIG. 2A).
hESC-derived hepatocytes show a higher PPAR.alpha. expression than
PHHs, but comparable expression of albumin and A1AT (FIG. 2B). FIG.
2C Molecular structures of Lithocholine Acid (LCA) and Vitamin K2
(MK4). FIGS. 2D-E--qRT-PCR analyses of hESC-derived hepatocytes
exposed to increasing concentrations of LCA (FIG. 2D) or MK4 (FIG.
2E) during the final maturation step (days 12-16). LCA induced an
exponential response, reaching 5- to 73-fold induction in PXR and
its CYP2C9 and CYP3A4 target genes. MK4 supplementation had little
effect on hESC-derived hepatocyte gene expression. FIG. 2F--qRT-PCR
analysis of hESC-derived hepatocytes cultured with 10 .mu.M of LCA,
10 .mu.M of MK4, or 10 .mu.M of both compounds during the final
maturation step. Cells show a synergistic effect, with PXR induced
by 3.7-fold by the combination of LCA and MK4, compared to 1.3- and
1.9-fold for LCA and MK4, respectively. FIG. 2G--PXR-copGFP
reporter activity in hESC-derived hepatocytes. Differentiated cells
that were cultured in the presence of LCA and MK4 show a
significant increase in PXR activity. FIG. 2H--A histogram
depicting quantification of immunofluorescence analysis of PXR
showing a 3-fold increase in nuclear localization of PXR in cells
cultured with LCA and MK4, compared to standard differentiation.
FIG. 2I--Addition of silibinin, a PXR inhibitor, to the final
maturation step (days 12-16) of hESC-derived hepatocytes blocks the
effect of LCA and MK4 supplementation. *P<0.05; **P<0.01.
Abbreviations: MDR1/P-gp, multi-drug resistance protein; MRP3,
multidrug resistance-associated protein; PXR, pregnane X receptor;
FXR, farnesoid X receptor; CAR, constitutive androstane receptor;
MK4, Menatetrenone-4 (Vitamin K.sub.2); MDR1, multidrug resistance
protein 1; MRP3, multidrug resistance-associated protein 3; OATP2,
organic anion-transporting polypeptide-2; PPARA, peroxisome
proliferator-activated receptor alpha.
[0083] FIGS. 3A-F depict morphology, secretome and RNA-Seq analysis
of hepatic maturation in the presence of 10 .mu.M LCA and 10 .mu.M
MK4. FIG. 3A--hESC-derived hepatocytes (hESC-H) show a homogenous
perinuclear albumin and CYP3A4 staining, clear HNF-4.alpha. nuclear
localization, and lateral E-cadherin staining. White arrows
indicate binuclear cells, a trait of PHHs (top). FIG. 3B--CDFDA
staining shows functional bile canaliculi (arrows), whereas some
no-polarized cells show diffused green CDF. FIG. 3C Graph depicting
the dynamics of albumin, AFP, and ApoB100 secretion during hepatic
differentiation. hESC-derived hepatocyte production of albumin and
ApoB100 steadily increased during LCA and MK4 treatment and, by day
16, was not significantly different from PHHs. In contrast, AFP
showed 22% decrease during the end of the differentiation period
(P<0.05). FIG. 3D--Unsupervised hierarchical clustering using
Spearman's rank correlation of 2,925 differentially expressed genes
analyzed using RNA-Seq shows that hESC-H treated with LCA and MK4
(LCA/MK4) cluster closer to PHHs than to FHHs than untreated hESC-H
controls (control). Representative heat map of 75 differential
genes is shown as well. FIG. 3E--RNA abundance of adult liver
markers ASGR1, CYP3A4, and GPT1/ALT was higher in treated than
untreated hESC-H. FIG. 3F--RNA abundance of fetal liver markers
CYP3A7 and RFC3 was higher in untreated than treated hESC-H.
[0084] FIGS. 4A-F demonstrate that hESC-derived hepatocytes
(hESC-H) exhibit inducible CYP450 and accurate toxicological
response. FIG. 4A--Log-scale CYP450 activity of hESC-H treated with
LCA and MK4 (LCA/MK4), compared to untreated hESC-H (control),
adult primary human hepatocytes (PHHs), and HepG2 cells. hESC-H
treated with LCA and MK4 exhibit higher CYP450 activity than HepG2
and untreated cells. Fetal CYP1A activity is higher than PHHs when
measuring EROD breakdown. MFC and BFC breakdown in differentiated
cells is lower than primary cells, but higher than untreated hESC-H
(P<0.05) FIG. 4B--Induction of CYP450 activity in hESC-H treated
with LCA and MK4 in response to 72 hours of stimulation with AhR
agonist omeprazole (purple bars) or PXR agonist rifampicin (orange
bars). Omeprazole preferentially induced CYP1A (P=0.012; n=3),
whereas rifampicin shows a clear induction of MFC metabolism
(P=0.048; n=3). FIG. 4C--PXR and CYP450 gene expression analysis in
hESC-derived hepatocytes after 2% DMSO treatment. Exposure of
differentiated cells to DMSO increased expression of all CYP450
enzymes measured. FIG. 4D--Dose-dependent toxicity curves and
TC.sub.50 values of different compounds obtained from 24-hour dose
response in hESC-H treated with LCA and MK4 (red circles). Although
generally considered safe, melatonin showed clear toxicity in
differentiated cells, albeit at high concentrations. FIG.
4E--TC.sub.50 values of different compounds obtained from 24-hour
dose response in PHH and HepG2 cells, compared with the values
obtained from LCA- and MK4-treated hESC-H (LCA/MK4) and untreated
cells. Normalized TC.sub.50 toxicity profile generated for hESC-H
treated with LCA and MK4 was not significantly different from
primary cells (P=0.13; n=3), whereas HepG2 profile was
significantly different (P=0.04; n=3). FIG. 4F--Comparison of
TC.sub.50 values between PHHs and hESC-H treated with LCA and MK4
(red circles) and untreated cells (green squares). hESC-H treated
with LCA and MK4 showed a striking correlation of R.sup.2=0.94 to
the perfect 45-degree angle (dotted line), compared to R.sup.2=0.19
for untreated cells. Abbreviation: N.A., not appreciable.
[0085] FIGS. 5A-I demonstrate that hESC-derived hepatocytes
(hESC-H) show accurate prediction of toxicological endpoints.
Differentiation of 13 hESC-derived hepatocytes was carried out in
the presence of LCA and MK4. FIGS. 5A-F--Fluorescence
quantification of toxicological endpoints in hESC-derived
hepatocytes exposed to TC20 concentrations. FIGS.
5A-B--Intracellular lipid accumulation (stcatosis) in hESC-derived
hepatocytes after a 24-hour exposure to steatosis-causing drugs,
measured by LipidTOX. Exposure to amiodarone, acetylsalicylic acid
(aspirin) or valproic acid caused similar and significant increase
in lipid accumulation (P<0.001). FIGS. 5C-D--Loss of cell
polarization and bile secretion (cholestasis) after a 24-hour
exposure to cholestasis-causing drugs, evaluated by CDFDA.
Troglitazone, chlorpromazine (thorazine), and cyclosporine A caused
a significant, 14-fold loss of epithelial polarization
(P<0.003). FIGS. 5E-F--Apoptosis of hESC-derived hepatocytes
after a 24-hour exposure to apoptosis-causing drugs, measured by
TUNEL. Diclofenac, acetaminophen, and aflatoxin B.sub.1 caused a
significant increase in DNA fragmentation, compared to control
(P<0.02). FIGS. 5G-I--Exposure to TC.sub.20 concentration of
melatonin caused a significant (P<0.006) increase in
intracellular lipid accumulation, while not affecting bile
secretion or cell viability. Abbreviation: r.u., relative
units.
[0086] FIGS. 6A-J demonstrate that oleic acid (OA) and linoleic
acid (LA) induce hESC derived hepatocytes maturation. FIG.
6A--images (on the left) and histograms (on the right) depicting
GFP based nuclear receptor activity reporters revealing a dose
dependent increase in the activation of PPAR.alpha., LXR.alpha. and
PXR and no change in the activation of FXR in response to rising
concentrations of oleic acid (OA) and linoleic acid (LA). The
images on the left show expression of PPAR.alpha., LXR.alpha., PXR
and FXR in the absence ("control, 0 .mu.M) or presence of OA and LA
("OA+LA" at 125 .mu.M of OA and LA) fatty acids. The histogram,
show the dose dependent increase to 62 .mu.M, 125 .mu.M and 250
.mu.M of the OA and LA fatty acids. FIG. 6B--qRT-PCR analysis of
nuclear receptors and their target genes in response to different
fatty acid concentrations. These results correlate to those of the
activity reporter assay, i.e. a dose dependence expression of the
LXR, PPAR and PXR nuclear receptor and their target genes is
observed. *p<0.05, **p<0.01. FIG. 6C--Albumin and AFP
immunostaining after differentiation following a four day treatment
with OA and LA. Albumin (green label), AFP (red label) and Hoechst
(nuclear staining, blue label). FIG. 6D--Microscopic quantification
of albumin and AFP positive cells. OA and LA induced a
dose-dependent increase in albumin and decrease in AFP up to 125
.mu.M. FIG. 6E--Apoptosis increased at fatty acid concentrations
above 125 .mu.M, suggesting an optimal concentration of about 100
.mu.M OA and LA. FIG. 6F--qRT-PCR analysis of hESC-derived cells
cultured with 100 .mu.M OA and 100 .mu.M LA or OA+LA and PPAR
antagonist GW9662 during the final maturation step. Cells show a
significant PPAR dependent expression of lipid metabolism genes and
albumin. FIG. 6G--hESC derived hepatocytes (hESC-H) showed 2-fold
increase in albumin secretion following treatment with 100 .mu.M OA
and LA, an that was blocked by PPAR inhibitor GW9662. FIG. 6H
Histogram (FIG. 6I) a 7% increase in nuclear localization in cells
cultured with OA and LA, and a 50% increase in nuclear localization
when 100 .mu.M LA was replaced with 100 .mu.M 9CLA, compared to un
treated cells. GW9662 treatment leads to a significant decrease in
nuclear localization reversing fatty acids effect. FIG. 6I--qRT-PCR
analysis of PXR and its CYP450 target genes. Supporting
PPAR-dependent PXR activation, CYP3A4 and CYP2C9 gene expression
increased significantly in response to 9CLA and were down-regulated
after GW9662 treatment. FIG. 6J--CYP450 activity of hESC-H treated
with 100 M OA and LA, or 100 .mu.M OA and 9CLA, compared to
untreated hESC-H (control), adult human hepatocytes (hepatocytes),
and HepG2 cells. hESC-H treated with OA and 9CLA exhibit higher
CYP450 activity than HepG2 and untreated cells. MFC and BFC
breakdown in differentiated cells is lower than primary cells, but
higher than control.
[0087] FIGS. 7A-J demonstrate that hESC-derived hepatocytes exhibit
PPAR-dependent increase in mitochondrial mass in response to fatty
acids. FIG. 7A--TEM representative pictures of hESC-derived control
cells, OA+LA treated and OA+9CLA treated cells. All cells were
metabolically active with large amounts of stored glycogen (dark
dotes), rough and smooth ER and mitochondria. Treated cells had
more lipid droplets and their mitochondria had a narrower
morphology compared to control (black arrows). Bar=2000 nm. FIGS.
7B-C--TEM based measurements of average mitochondria diameter (FIG.
7B) and cellular and nuclear area (FIG. 7C). Similar to postnatal
mitochondria development, treated cells were bigger and the average
mitochondria diameter was reduced. FIG. 7D--HSP60/Actin/Hoechst
immunofluorescence (IF) staining, and CellProfiler analysis (black
and white) of mitochondrial network. FIGS. 7E-H--Quantification of
minor (FIG. 7E) and major (FIG. 7F) mitochondria axis length,
eccentricity (FIG. 7G) and HSP60 relative expression (FIG. 7H),
according to IF analyses. Treated cells exhibit a more elongated
and less fragmented morphology indicating the development of a
mature mitochondrial network. Treatment with GW9662 reversed the
effect. Mitochondria mass increased by 20% (p<0.001). FIG.
7I--Apoptosis remained unchanged in all treatments indicating that
the morphological alteration were not a result of cell death. FIG.
7J--qRT-PCR of key genes in mitochondria biogenesis, fusion and
fission supporting molecular mechanism underlie morphological
changes. Selected key regulatory genes in mitochondrial function
and morphology were all up-regulated in a PPAR dependent manner,
with MFN2 increasing more significantly increasing the
fusion/fission ratio.
[0088] FIGS. 8A-B demonstrate that fatty acids dramatically
increase mitochondrial activity of hESC-derived hepatocytes. FIGS.
8A-B--Dynamic OCR measurements during mitochondrial stress test
(Seahorse Biosciences) (FIG. 8A) and histogram summary of fluxes
(FIG. 8B). Treatment with 100 .mu.M OA and LA increased basal
respiration, ATP production and maximal respiration of hESC-H.
Replacing LA with 9CLA showed further increase, reaching 60% of
primary human hepatocytes. Results are presented as mean.+-.s.d
*p<0.05, **p<0.01.
[0089] FIG. 9 is a histogram depicting the generalization of the
hPSC-H protocol across multiple cell lines. qRT-PCR analysis of
hepatocyte differentiation protocol on Day 16, using hESC lines 13
(Technion), H9 (WiCell), and HuES8 (Harvard) as well as hiPSC lines
12F2 (HUJI) and U21 (KUL). Results are normalized to the hESC 13
line reported (FIGS. 1A-H-3A-F).
[0090] FIG. 10 is a schematic model for proposed mechanism
demonstrating that microbial-derived bile acid LCA and 9CLA affect
hepatocyte maturation through parallel pathways controlled by
nuclear receptors PXR and PPARA, respectively.
[0091] FIGS. 11A-B depict schematic illustrations of the
differentiation method according to some embodiments of the
invention.
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0092] The present invention, in some embodiments thereof, relates
to methods of increasing metabolic maturation of immature
hepatocytes and isolated hepatocytes resulting thereof.
[0093] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not
necessarily limited in its application to the details of
construction and the arrangement of the components and/or methods
set forth in the following description and/or illustrated in the
drawings and/or the Examples. The invention is capable of other
embodiments or of being practiced or carried out in various
ways.
[0094] Due to recent developments in Pluripotent Stem Cell (PSC)
hepatic differentiation and maturation, PSC-derived hepatocytes are
now considered a reliable cellular alternative for drug development
and clinical applications. The present inventors have previously
shown that post-partum microbial-derived cues, litocholic acid and
vitamin K.sub.2, can drive the metabolic maturation of hESC-derived
and fetal hepatocytes by activating PXR (Avior, 2015).
[0095] The present inventors report a four-step 16 to 18 day
differentiation protocol to produce a homogenous culture of
hPSC-derived hepatocytes. The present inventors have uncovered that
the addition of oleic acid (OA) and LA to the last stage of PSC
differentiation induces a dose-dependent activation of key hepatic
nuclear receptors, PPAR, PXR and LXR, essential for the metabolic
functionality of the mature hepatocyte. Further supporting the
fatty acid-induced maturation, albumin expression increased in a
PPAR dependent manner concurrently with a decrease in
alpha-fetoprotein (AFP) expression. Replacing LA with microbial
derived 9CLA promoted an additional PPAR-dependent PXR activation,
increasing nuclear localization by 30% and up-regulating CYP450
gene expression and activity. Functional and morphological analyses
performed to evaluate the influence of fatty acids, showed a PPAR
dependent increase in mitochondrial function, biogenesis and
fusion, resulting in a significant increase in mitochondrial mass
and the relevant metabolic fluxes, which are critical for proper
hepatocyte function. This work provides fresh insights into the
role of postnatal nutritional cues in hepatic maturation and
mitochondrial development via the activation of lipid regulated
PPAR. This work sheds light on the tight link between nutrition,
gut colonization and cellular developmental processes that underlie
haptic maturation.
[0096] According to an aspect of some embodiments of the invention
there is provided a method of increasing metabolic maturation of an
immature hepatocyte, the method comprising contacting an immature
hepatocyte which expresses alpha-fetoprotein (AFP) and albumin with
an effective amount of a fatty acid or a small molecule selected
from the group consisting of: an amphipathic carboxylic acid,
Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544,
GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid,
PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and
Gemfibrozil, thereby increasing the metabolic maturation of the
immature hepatocyte.
[0097] It should be noted that the fatty acid or a small molecule
selected from the group consisting of: an amphipathic carboxylic
acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic Acid), GW409544,
GW6471, Leukotriene B4, GW 7647, Perfluorooctanesulfonic Acid,
PERFLUOROOCTANOIC ACID, CP-775146, CP-865520, UNII-999KY5ZIGB, and
Gemfibrozil are capable of activating the PPAR.alpha. (peroxisome
proliferator-activated receptor alpha) and optionally the
PPAR.gamma. (peroxisome proliferator-activated receptor gamma).
[0098] PPAR is subfamily of the nuclear receptor superfamily of
transcription factors, plays important roles in lipid and glucose
metabolism, and has been implicated in obesity-related metabolic
diseases such as hyperlipidemia, insulin resistance, and coronary
artery disease.
[0099] PPAR.alpha. (peroxisome proliferator-activated receptor
alpha) is a fatty acid-activated member of the PPAR subfamily. It
is expressed primarily in metabolic tissues (brown adipose tissue,
liver, kidney) but elevated levels are also present in the
digestive (jejunum, ileum, colon, gall bladder) and cardiopulmonary
(aorta, heart) systems (Sher T, et al. 1993; "cDNA cloning,
chromosomal mapping, and functional characterization of the human
peroxisome proliferator activated receptor". Biochemistry 32
5598-604).
[0100] PPAR.gamma. (peroxisome proliferator-activated receptor
gamma) is a fatty acid-activated member of the PPAR subfamily. It
is expressed at low levels in most physiological systems, including
the central nervous system (CNS), endocrine system,
gastrointestinal system, reproductive system, cardiopulmonary
system and metabolic tissues, but is most highly expressed in brown
and white adipose tissue (Elbrecht A, et al. 1996; "Molecular
cloning, expression and characterization of human peroxisome
proliferator activated receptors gamma 1 and gamma 2". Biochem.
Biophys. Res. Commun. 224 431-7 V).
[0101] The phrase "immature hepatocyte" refers to a hepatocyte cell
which expresses alpha-fetoprotein and produces albumin. It should
be noted that an immature hepatocyte is also characterized by the
expression of cytochrome 3A7 (CYP3A7).
[0102] According to some embodiments of the invention, the immature
hepatocyte is characterized by an alpha-fetoprotein
(AFP)*/Albumin*/CYP3A7*/SOX2-/OCT4-expression signature.
[0103] According to some embodiments of the invention, the immature
hepatocyte is characterized by production of at least 1 g
Albumin/ml/mg cellular protein (e.g., 1.5 g albumin per ml per mg
cellular protein).
[0104] According to some embodiments of the invention, the immature
hepatocyte is characterized by production of at least 25 .mu.g
AFP/ml/mg cellular protein (e.g., 37 .mu.g AFP/ml/mg cellular
protein).
[0105] According to some embodiments of the invention, the immature
hepatocyte does not differentiate into bile duct cells.
[0106] According to some embodiments of the invention, the
metabolic maturation comprises an increase in a mitochondrial mass
per cell as compared to the mitochondrial mass in a control
immature hepatocyte.
[0107] As used herein the phrase "mitochondria mass" refers to
number of mature mitochondria per cell.
[0108] According to some embodiments of the invention, the increase
in the mitochondrial mass comprises an increase in a proliferation
rate of the mitochondria as compared to a proliferation rate of the
mitochondria in a control immature hepatocyte.
[0109] According to some embodiments of the invention, the
proliferation of the mitochondria comprises biogenesis, fission
and/or fusion of the mitochondria.
[0110] According to some embodiments of the invention, the
metabolic maturation comprises an increase in a maturation state of
the mitochondria as compared to a maturation state of a control
immature hepatocyte.
[0111] It should be that a mature mitochondria refers to elongated,
cristae-rich mitochondria organelle connected in network, which
express mitochondrial proteins such as HSP60.
[0112] According to some embodiments of the invention, the immature
hepatocyte is from a newborn human individual.
[0113] According to some embodiments of the invention, the immature
hepatocyte is obtained by an in vitro differentiation of a
pluripotent stem cell.
[0114] As used herein the term "fatty acid" refers to a carboxylic
acid with an aliphatic chain.
[0115] According to some embodiments of the invention, the
aliphatic chain comprises an even number of carbon atoms. For
example, the aliphatic chain of the fatty acid can include between
4 to 28 carbon atoms.
[0116] The aliphatic compounds can be saturated (saturated fatty
acid) joined by single bonds (alkanes), or an unsaturated
(unsaturated fatty acid), with double bonds (alkenes) or triple
bonds (alkynes). Besides hydrogen, other elements can be bound to
the carbon chain, the most common being oxygen, nitrogen, sulfur,
and chlorine.
[0117] It should be noted that a fatty acid is not a steroid based
molecule. Thus, fatty acid with an aliphatic chain is entirely
different from a bile acid such as lithocholic acid, which includes
aromatic rings in the backbone.
[0118] According to some embodiments of the invention, the
derivative of the fatty acid is a prostaglandin molecule.
Prostaglandins are lipids derived from fatty acids (they have one
5-carbon ring). Each prostaglandin contains 20 carbon atoms,
including a 5-carbon ring.
[0119] According to some embodiments of the invention, the fatty
acid is non-conjugated.
[0120] According to some embodiments of the invention, the
concentration of the non-conjugated fatty acid is at least 50
.mu.M, e.g., at least 55 .mu.M, e.g., at least 60 .mu.M, e.g., at
least 65 .mu.M, e.g., at least 70 .mu.M, e.g., at least 75 .mu.M,
e.g., at least 80 .mu.M, e.g., at least 85 .mu.M, e.g., at least 90
.mu.M, e.g., at least 95 .mu.M, e.g., at least 100 .mu.M, e.g., at
least 105 .mu.M, e.g., between 80-150 .mu.M, e.g., between 80-120
.mu.M, e.g., 90-110 .mu.M. e.g., about 100 .mu.M.
[0121] According to some embodiments of the invention, the
concentration of the non-conjugated fatty acid does not exceed 240
.mu.M.
[0122] According to some embodiments of the invention, the
non-conjugated fatty acid is selected from the group consisting of
oleic acid (OA), Palmitic Acid and linoleic acid (LA).
[0123] According to some embodiments of the invention, the fatty
acid is a conjugated fatty acid.
[0124] According to some embodiments of the invention, the
conjugated fatty acid is provided at a concentration of at least 50
.mu.M, e.g., at least 55 .mu.M, e.g., at least 60 .mu.M, e.g., at
least 65 .mu.M, e.g., at least 70 .mu.M, e.g., at least 75 .mu.M,
e.g., at least 80 .mu.M, e.g., at least 85 .mu.M, e.g., at least 90
.mu.M, e.g., at least 95 .mu.M, e.g., at least 100 .mu.M, e.g., at
least 105 .mu.M, e.g., at least 110 .mu.M, e.g., at least 115
.mu.M, e.g., at least 120 .mu.M, e.g., at least 125 .mu.M, e.g., at
least 130 .mu.M, e.g., at least 135 .mu.M, e.g., at least 140
.mu.M, e.g., at least 145 .mu.M, e.g., at least 150 .mu.M, e.g., at
least 155 .mu.M, e.g., at least 160 .mu.M, e.g., at least 165
.mu.M, e.g., at least 170 .mu.M, e.g., at least 175 .mu.M, e.g., at
least 180 .mu.M, e.g., at least 185 .mu.M, e.g., at least 190
.mu.M, e.g., at least 200 .mu.M, e.g., between 80-150 .mu.M, e.g.,
between 80-120 .mu.M, e.g., 90-110 .mu.M. e.g., about 100
.mu.M.
[0125] According to some embodiments of the invention, the
concentration of the conjugated fatty acid does not exceed 240
.mu.M.
[0126] According to some embodiments of the invention, the
conjugated fatty acid is provided at a concentration of 50-200
.mu.M.
[0127] According to some embodiments of the invention, the
conjugated fatty acid is 9-cis, 11-trans conjugated linoleic acid
(9CLA).
[0128] According to some embodiments of the invention, the
conjugated fatty acid is selected from the group consisting of a
conjugated linoleic acid which comprises two conjugated double
bonds, a conjugated linoleic acid which comprises three conjugated
double bonds, 9E,11Z,15E-octadeca-9,11,15-trienoic acid (Rumelenic
acid), 9E,11Z,13Z,15E-octadeca-9,11,13,15-tetraenoic acid
(.alpha.-Parinaric acid), all trans-octadeca-9,11,13,15-tretraenoic
acid (.beta.-Parinaric) acid, and 5Z,8Z,10E,12E,14Z-eicosanoic acid
(Bosseopentaenoic acid).
[0129] According to some embodiments of the invention, the
conjugated linoleic acid which comprises two conjugated double
bonds is selected from the group consisting of
9Z,11E-octadeca-9,11-dienoic acid (Rumenic acid or Bovinic acid)
and 10E,12Z-octadeca-10,12-dienoic acid (10CLA).
[0130] According to some embodiments of the invention, the
conjugated linoleic acid which comprises three conjugated double
bonds is selected from the group consisting of
8E,10E,12Z-octadecatrienoic acid (.alpha.-Calendic acid),
8E,10E,12E-octadecatrienoic acid (.beta.-Calendic acid),
8Z,10E,12Z-octadecatrienoic acid (Jacaric acid),
9Z,11E,13E-octadeca-9,11,13-trienoic acid (.alpha.-Eleostearic
acid), 9E,11E,13E-octadeca-9,11,13-trienoic acid
(.beta.-Eleostearic acid), 9Z,11Z,13E-octadeca-9,11,13-trienoic
acid (Catalpic acid), and 9Z,11E,13Z-octadeca-9,11,13-trienoic acid
(Punicic acid).
[0131] According to some embodiments of the invention, the fatty
acid is an omega 3 polyunsaturated fatty acid.
[0132] According to some embodiments of the invention, the omega 3
polyunsaturated fatty acid is selected from the group consisting of
all-cis 7,10,13-hexadecatrienoic acid (Hexadecatrienoic acid
(HTA)), all-cis-9,12,15-octadecatrienoic acid (Alpha-linolenic acid
(ALA)), all-cis-6,9,12,15,-octadccatctracnoic acid (Stearidonic
acid (SDA)), all-cis-11,14,17-eicosatrienoic acid (Eicosatrienoic
acid (ETE)), all-cis-8,11,14,17-eicosatetraenoic acid
(Eicosatetraenoic acid (ETA)),
all-cis-5,8,11,14,17-eicosapentaenoic acid (Eicosapentaenoic acid
(EPA, Timnodonic acid)), all-cis-6,9,12,15,18-heneicosapentaenoic
acid (Heneicosapentaenoic acid (HPA)),
all-cis-7,10,13,16,19-docosapentaenoic acid (Docosapentaenoic acid
(DPA, Clupanodonic acid)), all-cis-4,7,10,13,16,19-docosahexaenoic
acid (Docosahexaenoic acid (DHA, Cervonic acid)),
all-cis-9,12,15,18,21-tetracosapentaenoic acid (Tetracosapentaenoic
acid), and all-cis-6,9,12,15,18,21-tetracosahexaenoic acid
(Tetracosahexaenoic acid (Nisinic acid)).
[0133] According to some embodiments of the invention, the
amphipathic carboxylic acid comprises a fibrate.
[0134] Fibrates are amphipathic carboxylic acids, which are
metabolized by CYP3A4. In addition, fibrates are known for their
ability to activate PPAR (peroxisome proliferator-activated
receptors), a group of nuclear receptors, especially
PPAR.alpha..
[0135] According to some embodiments of the invention, the fibrate
is provided at a concentration in the range of 5 nM to 120 .mu.M,
e.g., from 50 nM to 100 .mu.M, e.g., from 100 nM to 50 .mu.M, e.g.,
from 1 .mu.M to 50 .mu.M, e.g., in the range of 5-30 .mu.M, e.g.,
in the range of 5-25 .mu.M, e.g., about 5 .mu.M, about 10 .mu.M,
about 15 .mu.M, about 20 .mu.M.
[0136] According to some embodiments of the invention, the fibrate
is selected from the group consisting of Fenofibrate (e.g. TriCor),
Bezafibrate (e.g. Bezalip), Ciprofibrate (e.g. Modalim),
Clofibrate, Gemfibrozil (e.g. Lopid), and Clinofibrate (e.g.
Lipoclin).
[0137] According to some embodiments of the invention, the
concentration of fenofibrate is between 10-30 .mu.M, e.g., about 20
.mu.M.
[0138] According to some embodiments of the invention, the
concentration of WY14643 is between 5-20 .mu.M, e.g., about 10
.mu.M.
[0139] According to some embodiments of the invention, the
concentration of GW7647 is between 5-20 .mu.M, e.g., about 10
.mu.M.
[0140] Thiazolidinediones (also known as "Glitazones") are a class
of medications that act by activating PPARs (peroxisome
proliferator-activated receptors), with greatest specificity for
PPAR.gamma. (PPAR-gamma, PPARG). The endogenous ligands for these
receptors are free fatty acids (FFAs) and cicosanoids.
[0141] According to some embodiments of the invention, the
Thiazolidinedione is provided at a concentration in the range of
about 20 nM to about 120 .mu.M, e.g., from 50 nM to 100 .mu.M,
e.g., from 100 nM to 50 .mu.M, e.g., from 1 .mu.M to 50 .mu.M,
e.g., in the range of 0.5-30 .mu.M, e.g., in the range of 0.5-25
.mu.M, e.g., about 0.5 .mu.M, about 1 .mu.M, about 5 .mu.M, about
10 .mu.M, about 15 .mu.M.
[0142] According to some embodiments of the invention, the
Thiazolidinedione is selected from the group consisting of
Pioglitazone (Actos), Rosiglitazone (Avandia), Lobeglitazone
(Dulie), Troglitazone (Rezulin), Ciglitazone, Darglitazone,
Englitazone, Netoglitazone, and Rivoglitazone.
[0143] According to some embodiments of the invention, the
concentration of rosiglitazone is between 1-10 .mu.M, e.g., about 5
.mu.M.
[0144] According to some embodiments of the invention, the
concentration of troglitazone is between 0.5-10 .mu.M, e.g., about
0.5-5 .mu.M, e.g., about 1 .mu.M.
[0145] According to some embodiments of the invention, the method
further comprising contacting the immature hepatocyte with insulin
and/or dexamethasone.
[0146] As used herein the term "insulin" refers to the mature
insulin polypeptide having A chain and B chain, which are
covalently linked via two disulfide bonds. Also known as CAS Number
11061-68-0; EC Number 234-279-7; MDL number MFCD00131380. The
precursor polypeptide preproinsulin is cleaved to remove the
precursor signal peptide, and then the proinsulin is
post-translationally cleaved into three peptides: the B chain and A
chain peptides, which are covalently linked via two disulfide bonds
to form insulin, and C-peptide. Binding of insulin to the insulin
receptor (INSR) stimulates glucose uptake. There are 4 polypeptide
variants, encoding the same protein: variant 1 [GenBank Accession
No. NM_000207.2 (SEQ ID NO: 81), GenBank Accession No. NP_000198.1
(SEQ ID NO: 82)], variant 2 [GenBank Accession No. NM_001185097.1
(SEQ ID NO: 83), GenBank Accession No. NP_001172026.1 (SEQ ID NO:
84)]; variant 3 [GenBank Accession No. NM_001185098.1 (SEQ ID NO:
85), GenBank Accession No. NP_001172027.1 (SEQ ID NO: 86)]; and
variant 4 [GenBank Accession No. NM_001291897.1 (SEQ ID NO: 87),
GenBank Accession No. NP_001278826.1 (SEQ ID NO: 88)]. Insulin can
be provided from various suppliers such as Sigma-Aldrich (e.g.,
recombinant human insulin Catalogue Number 91077C).
[0147] According to some embodiments of the invention, the insulin
is provided at a concentration of 2.5.times.10-5 IU/mL to 1 IU/mL,
e.g., between 0.1 IU/mL to about 0.5 IU/mL, e.g., about 0.24 IU/mL.
It should be noted that IU/mL is an abbreviation of "International
Units Per Millilitre (milliliter)".
[0148] Dexamethasone is a corticosteroid medication which can be
obtained from various suppliers such as Ark Pharm, Inc.,
Sigma-Aldrich, Parchem, and AvaChem Scientific.
[0149] According to some embodiments of the invention, the
dexamethasone is provided at a concentration of about 4 nM to about
100 .mu.M, e.g., between 4 nM to about 200 nM, e.g., between 50-150
nM, e.g., between 70-120 nM, e.g., about 100 nM.
[0150] According to some embodiments of the invention, the method
further comprising contacting the immature hepatocyte with basic
fibroblast growth factor.
[0151] Basic fibroblast growth factor (also known as bFGF, FGF2 or
FGF-.beta.) is a member of the fibroblast growth factor family.
BFGF [(e.g., human bFGF polypeptide GenBank Accession No.
NP_001997.5 (SEQ ID NO:69); human bFGF polynucleotide GenBank
Accession No. NM_002006.4 (SEQ ID NO:70)] can be obtained from
various commercial sources such as Cell Sciences.RTM., Canton,
Mass., USA (e.g., Catalogue numbers CRF001A and CRF001B),
Invitrogen Corporation products, Grand Island N.Y., USA (e.g.,
Catalogue numbers: PHG0261, PHG0263, PHG0266 and PHG0264),
ProSpec-Tany TechnoGene Ltd. Rehovot, Israel (e.g., Catalogue
number: CYT-218), and Sigma, St Louis, Mo., USA (e.g., catalogue
number: F0291).
[0152] According to some embodiments of the invention, the BFGF is
provided at a concentration of 0.1-100 ng/ml, e.g., about 0.2-80
ng/ml, e.g., about 0.4-70 ng/ml. e.g., about 0.5-60 ng/ml, e.g.,
about 0.8-50 ng/ml, e.g., between about 1 ng/ml to about 40 ng/ml,
e.g., about 1-10 ng/ml, e.g., about 2-8 ng/ml. e.g., about 3-6
ng/ml, e.g., about 4-5 ng/ml. e.g., about 4 ng/ml.
[0153] According to some embodiments of the invention, the method
further comprising contacting the immature hepatocyte with
hepatocyte growth factor (HGF).
[0154] Hepatocyte growth factor (HGF) is a protein that binds to
the hepatocyte growth factor receptor to regulate cell growth, cell
motility and morphogenesis in numerous cell and tissue types.
Alternative splicing results in multiple transcript variants, at
least one of which encodes a preproprotein that is proteolytically
processed to generate alpha and beta chains, which form the mature
heterodimer. HGF is secreted by mesenchymal cells and acts as a
multi-functional cytokine on cells of mainly epithelial origin.
Transcription of the HGF gene (Gene ID: 3082) results in 5
isoforms: HGF isoform 1 preproprotein [mRNA GenBank Accession No.
NM_000601.5 (SEQ ID NO: 71), polypeptide GenBank Accession No.
NP_000592.3 (SEQ ID NO:72); HGF isoform 2 precursor [mRNA GenBank
Accession No. NM_001010931.2 (SEQ ID NO: 73), polypeptide GenBank
Accession No. NP_001010931.1 (SEQ ID NO: 74)], HGF isoform 3
preproprotein [mRNA GenBank Accession No. NM_001010932.2 (SEQ ID
NO: 75), polypeptide GenBank Accession No. NP_001010932.1 (SEQ ID
NO:76)], HGF isoform 4 precursor [mRNA GenBank Accession No.
NM_001010933.2 (SEQ ID NO: 77), polypeptide GenBank Accession No.
NP_001010933.1 (SEQ ID NO: 78)], HGF isoforn 5 precursor [mRNA
GenBank Accession No. NM_001010934.2 (SEQ ID NO: 79), polypeptide
GenBank Accession No. NP_001010934.1 (SEQ ID NO: 80)]. Known
suppliers of HGF include PeproTech.RTM. Rocky Hill, N.J. USA [e.g.,
recombinant human HGF (HEK293 derived), Catalogue Number 100-39H],
LSBio LifSpan BioSciences, Inc. [e.g., recombinant human HGF
Catalogue Number LS-G27264] and ThermoFisher SCIENTIFIC [e.g., HGF
Recombinant Human Protein Catalogue Number PHG0254].
[0155] According to some embodiments of the invention, the HGF is
provided at a concentration of 0.1 ng/mL to 100 ng/mL, e.g., about
0.2-80 ng/ml, e.g., about 0.4-70 ng/ml. e.g., about 0.5-60 ng/ml,
e.g., about 0.8-50 ng/ml, e.g., between about 1 ng/ml to about 40
ng/ml, e.g., about 1-30 ng/ml, e.g., about 2-20 ng/ml. e.g., about
3-15 ng/ml, e.g., about 4-15 ng/ml. e.g., about 10 ng/ml.
[0156] Any of the proteinaceous factors used by the method of some
embodiments of the invention (e.g., the insulin, bFGF, HGF) can be
recombinantly expressed or biochemically synthesized. In addition,
naturally occurring proteinaceous factors such as bFGF can be
purified from biological samples (e.g., from human serum, cell
cultures) using methods well known in the art. It should be noted
that for the preparation of an animal contaminant-free culture
medium the proteinaceous factor is preferably purified from a human
source or is recombinantly expressed.
[0157] Biochemical synthesis of the proteinaceous factors of the
present invention (e.g., the insulin, bFGF, HGF) can be performed
using standard solid phase techniques. These methods include
exclusive solid phase synthesis, partial solid phase synthesis
methods, fragment condensation and classical solution
synthesis.
[0158] Recombinant expression of the proteinaccous factors of the
present invention can be generated using recombinant techniques
such as described by Bitter et al., (1987) Methods in Enzymol.
153:516-544, Studier et al. (1990) Methods in Enzymol. 185:60-89,
Brisson et al. (1984) Nature 310:511-514, Takamatsu et al. (1987)
EMBO J. 6:307-311, Coruzzi et al. (1984) EMBO J. 3:1671-1680,
Brogli et al., (1984) Science 224:838-843, Gurley et al. (1986)
Mol. Cell. Biol. 6:559-565 and Weissbach & Weissbach, 1988,
Methods for Plant Molecular Biology, Academic Press, NY, Section
VIII, pp 421-463. Specifically, the IL6RIL6 chimera can be
generated as described in PCT publication WO 99/02552 to Revel M.,
et al. and Chebath J, et al., 1997, which are fully incorporated
herein by reference.
[0159] Methods of synthesizing the fatty acids, bile acids,
steroids, amphipathic carboxylic acids, Thiazolidinediones (TZD),
WY-14643 (Pirinixic Acids), GW409544, GW6471, Leukotriene B4, GW
7647, Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID,
CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil are known in
the art. According to some embodiments of the invention, the method
is performed in-vitro.
[0160] According to some embodiments of the invention, contacting
or administering the effective amount of the fatty acid or the
small molecule selected from the group consisting of: an
amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643
(Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647,
Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146,
CP-865520, UNII-999KY5ZIGB, and Gemfibrozil is performed in the
absence of an IL6 ligand.
[0161] It should be noted that the phrase "absence of the IL6
ligand" does not exclude presence of trace concentrations of the
IL6 ligand, i.e., below 5 ng/ml. Thus, for example, the method of
increasing the metabolic maturation of an immature hepatocyte or
the method of treating the subject diagnosed with the pathology
characterized by immature hepatocytes can be performed by
contacting or administering an effective amount of the fatty acid
or the small molecule selected from the group consisting of: an
amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643
(Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647,
Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146,
CP-865520, UNII-999KY5ZIGB, and Gemfibrozil in the presence of a
trace concentration of an IL6 ligand.
[0162] According to some embodiments of the invention, the trace
concentration of the IL6 ligand does not exceed 5 ng/ml of the IL6
ligand, e.g., does not exceed 4 ng/ml of the IL6 ligand, e.g., does
not exceed 3 ng/ml of the IL6 ligand, e.g., does not exceed 2 ng/ml
of the IL6 ligand, e.g., does not exceed 1 ng/ml of the IL6 ligand,
e.g., does not exceed 0.1 ng/ml of the IL6 ligand, e.g., does not
exceed 0.05 ng/ml of the IL6 ligand, e.g., does not exceed 0.01
ng/ml of the IL6 ligand.
[0163] According to some embodiments of the invention, the IL6
ligand is selected from the group consisting of oncostatin M (OSM)
or a functional equivalent thereof, interleukin 6 (IL6) or a
functional equivalent thereof, leukemia inhibitory factor (LIF) or
a functional equivalent thereof, leptin (OB) or a functional
equivalent thereof, Cardiotrophin-1/CT-1 or a functional equivalent
thereof, CLC or a functional equivalent thereof, CNTF or a
functional equivalent thereof, G-CSF or a functional equivalent
thereof, IL-11 or a functional equivalent thereof, IL-31 or a
functional equivalent thereof, and Neuropoietin/NP or a functional
equivalent thereof.
[0164] According to some embodiments of the invention, the IL6
ligand is selected from the group consisting of oncostatin M (OSM),
interleukin 6 (IL6), leukemia inhibitory factor (LIF), leptin (OB),
Cardiotrophin-1/CT-1, CLC, CNTF, G-CSF, IL-11, IL-31, and
Neuropoietin/NP.
[0165] According to some embodiments of the invention, the IL6
ligand is oncostatin M (OSM).
[0166] According to some embodiments of the invention, the immature
hepatocyte is obtained by an in vitro differentiation of an
hepatoblast.
[0167] The phrase "hepatoblast" refers to an hepatocyte-like cell
which expresses alpha-fetoprotein but not albumin.
[0168] According to some embodiments of the invention, the in vitro
differentiation of the hepatoblast is performed by culturing the
hepatoblast for a pre-determined time period in a culture medium
which comprises an IL6 ligand.
[0169] According to some embodiments of the invention, prior to
formation of the hepatoblast the fatty acid and/or the small
molecule are absent from a culture comprising the hepatoblast.
[0170] According to some embodiments of the invention, the culture
medium which comprises the IL6 ligand further comprises
dexamethasone, basic fibroblast growth factor (FGF2) and
insulin.
[0171] Thus, the method of some embodiments of the invention can be
used to generate mature hepatocytes, which can be used in various
therapeutic applications.
[0172] According to an aspect of some embodiments of the invention
there is provided a method of treating a subject diagnosed with a
pathology characterized by immature hepatocytes, the method
comprising administering to the subject an effective amount of a
fatty acid or a small molecule selected from the group consisting
of: an amphipathic carboxylic acid, Thiazolidinedione (TZD),
WY-14643 (Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW
7647, Perfluorooctanesulfonic Acid, Perfluorooctanoic Acid,
CP-775146, CP-865520, UNII-999KY5ZIGB, and Gemfibrozil, thereby
increasing the metabolic maturation of the immature hepatocytes and
treating the subject.
[0173] The term "treating" refers to inhibiting, preventing or
arresting the development of a pathology (disease, disorder or
condition) and/or causing the reduction, remission, or regression
of a pathology. Those of skill in the art will understand that
various methodologies and assays can be used to assess the
development of a pathology, and similarly, various methodologies
and assays may be used to assess the reduction, remission or
regression of a pathology.
[0174] As used herein, the term "subject" includes mammals,
preferably human beings at any age which suffer from the pathology.
Preferably, this term encompasses individuals who are at risk to
develop the pathology.
[0175] Non-limiting examples of pathologies characterized by an
immature hepatocyte include, hyperbilirubinemia (newborn jaundice),
as well as pre-term infants, infants born by C-section and the
like.
[0176] As described in the Examples section which follows, the
present inventors have uncovered that the metabolic maturation of
the immature hepatocyte can be also increased using PXR agonist
under conditions devoid of an IL6 ligand.
[0177] According to an aspect of some embodiments of the invention
there is provided a method of increasing metabolic maturation of an
immature hepatocyte, the method comprising contacting an immature
hepatocyte which expresses alpha-fetoprotein (AFP) and albumin with
a medium which is devoid of an IL6 ligand and which comprises an
effective amount of a PXR agonist selected from the group
consisting of: a small molecule, a bile acid, and a steroid,
thereby increasing the metabolic maturation of the immature
hepatocyte, wherein the effective amount of the PXR agonist
increases the expression of a PXR target gene selected from the
group consisting of: CYP3A4 and CYP2C9 by at least 2-folds.
[0178] As used herein the term "PXR" refers to the pregnane X
receptor (PXR) (also known as NR1/2), a nuclear receptor
controlling the expression of CYP450 enzymes such as CYP2C9 and
CYP3A4.
[0179] The primary function of the PXR nuclear receptor is to sense
the presence of foreign toxic substances and in response up
regulate the expression of proteins involved in the detoxification
and clearance of these substances from the body. PXR is a
transcriptional regulator of the cytochrome P450 gene CYP3A4,
binding to the response element of the CYP3A4 promoter as a
heterodimer with the 9-cis retinoic acid receptor RXR.
[0180] PXR is activated by a large number of endogenous and
exogenous chemicals including steroids (e.g., progesterone,
17.alpha.-hydroxyprogesterone, 17.alpha.-hydroxypregnenolone,
5.alpha.-dihydroprogesterone, 5.beta.-dihydroprogesterone,
allopregnanolone, corticosterone, cyproterone acetate,
spironolactone, dexamethasone, mifepristone), antibiotics (e.g.,
rifampicin, rifaximin), antimycotics, bile acids, hyperforin (a
constituent of the herbal antidepressant St. John's Wort), and many
herbal and other compounds (e.g., meclizine, paclitaxel).
[0181] As used herein the phrase "bile acid" refers to a steroid
acid found predominantly in the bile of mammals and other
vertebrates.
[0182] A steroid is an organic compound with four rings arranged in
a specific configuration. The steroid core structure is composed of
seventeen carbon atoms, bonded in four "fused" rings: three
six-member cyclohexane rings and one five-member cyclopentane ring.
Steroids vary by the functional groups attached to this four-ring
core and by the oxidation state of the rings. Sterols are forms of
steroids with a hydroxyl group at position three and a skeleton
derived from cholestane. They can also vary more markedly by
changes to the ring structure (for example, ring scissions which
produce secosteroids such as vitamin D3).
[0183] Examples of steroids include, but are not limited to the
dietary lipid cholesterol, the sex hormones estradiol and
testosterone and the anti-inflammatory drug dexamethasone. Steroids
have two principal biological functions: certain steroids (such as
cholesterol) are important components of cell membranes which alter
membrane fluidity, and many steroids are signaling molecules which
activate steroid hormone receptors. Hundreds of steroids are found
in plants, animals and fungi. All steroids are manufactured in
cells from the sterols lanosterol (animals and fungi) or
cycloartenol (plants). Lanosterol and cycloartenol are derived from
the cyclization of the triterpene squalene.
[0184] Non-limiting examples of bile acids which can be used
according to the method of some embodiments of the invention
include, lithocolic acid (LCA), Chenodeoxycholic acid (CDCA),
cholic acid, deoxycholic acid, ursodeoxycholic acid, or their
derivatives.
[0185] According to some embodiments of the invention, the bile
acid is lithocolic acid (LCA).
[0186] According to some embodiments of the invention, the bile
acid is Chenodeoxycholic acid (CDCA).
[0187] According to some embodiments of the invention, the bile
acid is provided at a concentration range of 1 .mu.M to about 250
.mu.M, e.g., between about 1 .mu.M to about 200 M, e.g., in the
range of 2-20 .mu.M, e.g., 5-15 .mu.M, e.g., 7-12 .mu.M, e.g.,
about 10 .mu.M; additionally or alternatively in the range of
50-200 .mu.M, e.g., 70-150 .mu.M, e.g., 80-120 .mu.M, e.g., about
100 .mu.M.
[0188] According to some embodiments of the invention, the
concentration of lithocolic acid (LCA) is between 1-20 .mu.M, e.g.,
about 5-15 .mu.M, e.g., about 10 .mu.M.
[0189] According to some embodiments of the invention, the
concentration of Chenodeoxycholic acid (CDCA) is between 50-200
.mu.M, e.g., 70-150 .mu.M, e.g., 80-120 .mu.M, e.g., about 100
.mu.M.
[0190] According to some embodiments of the invention, the PXR
agonist small molecule is selected from the group consisting of:
Rifampicin, T0901317, SR12813, mevastatin, rifaximin, hyperforin,
meclizine, paclitaxel, atorvastatin,
pregnenolone-16alpha-carbonitrile, Butamben and
24(S),25-Epoxycholesterol.
[0191] According to some embodiments of the invention, the
concentration of the small molecule PXR agonist is from about 50 nM
to about 100 .mu.M, e.g., from about 100 nM to about 80 .mu.M,
e.g., from 500 nM to about 80 .mu.M, e.g., from about 700 nM to
about 70 .mu.M, e.g., from about 1 .mu.M to about 50 .mu.M, e.g.,
about 1-5 .mu.M, e.g., about 10-60 .mu.M, e.g., about 1 .mu.M,
e.g., about 50 .mu.M.
[0192] According to some embodiments of the invention, the
concentration of SR12813 is about 0.5-5 .mu.M, e.g., about 0.8-4
.mu.M, e.g., about 0.8-2 .mu.M, e.g., about 1 .mu.M.
[0193] According to some embodiments of the invention, the
concentration of rifampicin is about 1-60 .mu.M, e.g., about 5-50
.mu.M, e.g., about 10-30 .mu.M, e.g., about 20-30 .mu.M, e.g.,
about 25 .mu.M.
[0194] According to some embodiments of the invention, the PXR
agonist steroid is selected from the group consisting of
progesterone, 17.alpha.-hydroxyprogesterone,
17.alpha.-hydroxypregnenolone, 5.alpha.-dihydroprogesterone,
5.beta.-dihydroprogesterone, allopregnanolone, corticosterone,
cyproterone acetate, spironolactone, dexamethasone, and
mifepristone.
[0195] According to some embodiments of the invention, the
concentration of the steroid PXR agonist is in the range of about 1
.mu.M to about 100 .mu.M, e.g., about 1-50 M, e.g., about 1-30
.mu.M, e.g., about 1-20 .mu.M, e.g., about 1-10 .mu.M, e.g., about
5 .mu.M, e.g., about 7 .mu.M.
[0196] According to some embodiments of the invention, the
effective amount of the PXR agonist causes differentiation of said
immature hepatocyte into a mature hepatocyte.
[0197] Methods of monitoring the differentiation state of an
hepatocyte are known in the art, and include for example RNA
detection methods (e.g., RT-PCR, quantitative RT-PCR, in situ
hybridization, in-situ RT-PCR), proteins detection methods [e.g.,
Enzyme linked immunosorbent assay (ELISA); Western blot;
Radio-immunoassay (RIA); Fluorescence activated cell sorting
(FACS); Immunohistochemical analysis; Immuno-fluorescence analysis;
in situ activity assay; in vitro activity assays] and morphological
evaluations.
[0198] According to some embodiments of the invention, the mature
hepatocyte is characterized by an
albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup-
.+/HNF4.alpha..sup.+ expression signature.
[0199] According to some embodiments of the invention, the
effective amount of the PXR agonist is provided in a concentration
of at least half maximal effective concentration (EC.sub.50) of the
PXR agonist.
[0200] According to some embodiments of the invention, the PXR
agonist is selected from the group consisting of: a small molecule
and a bile acid.
[0201] It should be noted that the increase in the level of
expression of the PXR target genes is compared to the level of
expression of the PXR target genes in a control immature hepatocyte
before being treated by the method of some embodiments of the
invention using identical assay conditions.
[0202] According to some embodiments of the invention the increase
in the level of expression of the PXR target gene is by at least
2-folds, e.g., at least 3-folds, e.g., at least 4-folds, e.g., at
least 5-folds, e.g., at least 6-folds, e.g., at least 7-folds,
e.g., at least 8-folds, e.g., at least 9-folds, e.g., at least
10-folds, e.g., at least 11-folds, e.g., at least 12-folds, e.g.,
at least 13-folds, e.g., at least 14-folds, e.g., at least
15-folds, e.g., at least 16-folds or more as compared to the level
of expression of the PXR target gene before being subjected to the
conditions of the method of some embodiments of the invention using
identical assay conditions.
[0203] Methods of detecting the level of expression of the PXR
target gene CYP3A4 and CYP2C9 in a cell are known in the art and
include for example, RNA and/or protein detection methods, using
for example, an antibody specifically bindable to the CYP3A4 or
CYP2C9 protein, or with a probe specifically hybridizable with the
CYP3A4 or CYP2C9 RNA sequence.
[0204] For example, the level of CYP3A4 can be detected using any
of the following antibodies: Anti-CYP3A4/Cytochrome P450 3A4
Antibody (clone 3H8) LS-C169171 (LSBio, LifeSpan BioSciences, Inc);
Anti-CYP3A4/Cytochrome P450 3A4 Antibody (Biotin) LS-C36104
(LSBio); Anti-CYP3A4/Cytochrome P450 3A4 Antibody IHC-plus.TM.
LS-B12328 (LSBio).
[0205] For example, the level of CYP2C9 can be detected using any
of the following antibodies: CYP2C9 polyclonal antibody
(ThermoFisher Scientific, Catalogue numbers PA5-15037; PA5-15046;
or PA1-84219), or anti-CYP2C9 antibody (Cytochrome P450, Family 2,
Subfamily C, Polypeptide 9) (Middle Region)
(Antibodies-online(dot)com, Cat. No. ABIN360247).
[0206] According to an aspect of some embodiments of the invention,
there is provided a method of treating a subject diagnosed with a
pathology characterized by immature hepatocytes, the method
comprising administering to the subject a pharmaceutical
composition comprising an effective amount of a PXR agonist
selected from the group consisting of: a small molecule, a bile
acid, and a steroid, wherein said pharmaceutical composition is
devoid of an IL6 ligand, wherein said effective amount of said PXR
agonist increases the expression of a PXR target gene selected from
the group consisting of: CYP3A4 and CYP2C9 by at least 2-folds,
thereby increasing the metabolic maturation of said immature
hepatocytes and treating the subject.
[0207] According to an aspect of some embodiments of the invention,
there is provided an isolated immature hepatocyte obtainable by the
in vitro method of some embodiments of the invention and being
characterized by an alpha-fetoprotein
(AFP).sup.+/Albumin.sup.+/CYP3A7.sup.+/SOX2.sup.-/OCT4.sup.-
expression signature, production of at least 1 .mu.g Albumin/ml/mg
cellular protein and production of at least 25 .mu.g AFP/ml/mg
cellular protein.
[0208] Methods of determining the level of expression of AFP,
albumin, CYP3A7, SOX2 or OCT4 are well known in the art and include
RNA and/or protein detection methods. Suitable antibodies include,
but are not limited to, Anti-alpha 1 Fetoprotein antibody [AFP-01]
(ab3980; abeam); Anti-Albumin antibody [EPSISR1] (ab137885; abcam);
CYP3A7 Monoclonal Antibody (F19 P2 H2) (ThermoFisher Scientific
Catalogue number MA3-034); Anti-Sox2 Antibody (Chemicon, AB5603);
or Anti-POU5F1/OCT4 Antibody IHC-plus.TM. LS-B4194 (LSBio LifeSpan
BioScience, Inc.).
[0209] According to some embodiments of the invention, the
hepatoblast is obtainable by a method which comprises:
[0210] (a) culturing undifferentiated pluripotent stem cells in a
medium which comprises activin A, B27, Wnt3A and hepatocyte growth
factor (HGF) to thereby obtain cells characteristics of a
definitive endoderm, and subsequently;
[0211] (b) culturing the cells characteristics of the definitive
endoderm in a culture medium which comprises Dimethyl sulfoxide
(DMSO), to thereby obtain the hepatoblasts.
[0212] According to some embodiments of the invention, step (b) of
the method of obtaining the hepatoblast further comprises passaging
the cells at least once in the culture medium which comprises the
DMSO.
[0213] According to an aspect of some embodiments of the invention
there is provided an isolated hepatoblast obtainable by the method
of some embodiments of the invention.
[0214] According to some embodiments of the invention, the method
of increasing metabolic maturation of the immature hepatocyte
results in a mature hepatocyte characterized by an
albumin.sup.+/CY3A4.sup.+/E-cadherin.sup.+/OCT4.sup.-/SOX2.sup.-/A1AT.sup-
.+/HNF4.alpha..sup.+ expression signature.
[0215] Methods of determining the level of expression of albumin,
CY3A4, E-cadherin, SOX2, OCT4, A1AT, or HNF4a are well known in the
art and include RNA and/or protein detection methods. Suitable
antibodies include, but are not limited to, Anti-Albumin antibody
[EPSISR1] (ab137885; abeam); Anti-Cytochrome P450 3A4 (CYP3A4)
antibody (ab135813, abeam); Anti-E Cadherin antibody (ab15148,
abeam); Anti-Sox2 Antibody (Chemicon, AB5603); Anti-POU5F1/OCT4
Antibody IHC-plus.TM. LS-B4194 (LSBio LifeSpan BioScience, Inc.);
Anti-alpha 1 Antitrypsin (A1AT) antibody [G11] (ab9400, abcam);
Anti-HNF-4-alpha (HNF4a) antibody [K9218]-ChIP Grade (ab41898,
abeam); or HNF-4a Antibody (H-171) (Santa Cruz catalogue number:
sc-8987).
[0216] According to some embodiments of the invention, the mature
hepatocyte is capable of producing at least 10 .mu.g albumin per
milliliter per milligram of cellular protein, e.g., at least 15
.mu.g albumin/ml/mg cellular protein.
[0217] According to an aspect of some embodiments of the invention
there is provided an isolated hepatocyte obtainable by the method
according to the method of some embodiments of the invention.
[0218] According to an aspect of some embodiments of the invention,
there is provided an isolated hepatocyte characterized by a
Cytochrome P450 3A4 (CYP3A4) activity which is capable of oxidizing
at least 1 pmol of 7-benzyloxy-4-trifluoromethylcoumarin (BFC) per
minute per milligram of cellular protein and an alpha feto-protein
(AFP) activity of at least 60 .mu.g/day/mg cellular protein as
assayed by ELISA when cultured in the presence of a culture medium
which comprises Insulin-Transferrin-Selenium (ITS), Glutamax,
Dexamethasone, hepatocyte growth factor (HGF), Oleic acid and
9CLA.
[0219] According to some embodiments of the invention, the isolated
hepatocyte of some embodiments of the invention is characterized by
a Cytochrome P450 3A4 (CYP3A4) activity which is capable of
oxidizing at least 1 pmol of 7-benzyloxy-4-trifluoromethylcoumarin
(BFC) per minute per milligram of cellular protein.
[0220] According to some embodiments of the invention, the isolated
hepatocyte of some embodiments of the invention is characterized by
an alpha-fetoprotein (AFP) production of at least 60 microgram per
day per milligram cellular protein as determined by an ELISA.
[0221] According to some embodiments of the invention, the isolated
hepatocyte of some embodiments of the invention is characterized by
nuclear expression of PXR.
[0222] It should be noted that the isolated hepatocyte of some
embodiments of the invention is distinguishable from an adult
hepatocyte by at least the expression of AFP.
[0223] The phrase "adult hepatocyte" refers to an hepatocyte cell
which produces albumin and which does not express alpha-fetoprotein
(AFP). It should be noted that an adult hepatocyte is also
characterized by the expression of cytochrome 3A4 (CYP3A4).
[0224] According to an aspect of some embodiments of the invention,
there is provided an isolated population of cells wherein at least
about 50% of the cells comprise the isolated hepatocyte of some
embodiments of the invention.
[0225] According to some embodiments of the invention, at least
about 55%, at least about 56%, at least about 57%, at least about
58%, at least about 59%, at least about 60%, at least about 61%, at
least about 62%, at least about 63%, at least about 64%, at least
about 65%, at least about 66%, at least about 67%, at least about
68%, at least about 69%, at least about 70%, e.g., at least 71%,
72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%,
85% of the cells in the population are the isolated hepatocytes of
some embodiments of the invention.
[0226] According to an aspect of some embodiments of the invention
there is provided a method of screening a compound for liver
toxicity, comprising:
[0227] (a) incubating the isolated population of cells of some
embodiments of the invention with the compound for a pre-determined
time period;
[0228] (b) determining percentage of a parameter indicative of
liver toxicity following the pre-determined time period, thereby
screening the compound for the liver toxicity.
[0229] According to some embodiments of the invention, the liver
toxicity comprises steatosis.
[0230] According to some embodiments of the invention, the
steatosis is assayable using the LipidTox neutral lipid stain.
[0231] According to some embodiments of the invention, the liver
toxicity comprises cholestasis.
[0232] According to some embodiments of the invention, the
cholestasis is assayable using the CDFDA
(5(6)-carboxy-2',7'-dichlorofluorescein diacetate) staining.
[0233] According to some embodiments of the invention, the liver
toxicity comprises apoptosis.
[0234] According to some embodiments of the invention, the
apoptosis is assayable using the Terminal deoxynucleotidyl
transferase dUTP nick end labeling TUNEL assay.
[0235] According to an aspect of some embodiments of the invention
there is provided a kit for screening a compound for liver toxicity
comprising the isolated population of cells of some embodiments of
the invention and at least one agent capable of detecting a
toxicological end-point selected from the group consisting of:
steatosis, cholestasis and apoptosis.
[0236] According to an aspect of some embodiments of the invention
there is provided a nutrition formula for an infant comprising
9CLA.
[0237] According to some embodiments of the invention the nutrition
formula is an infant formula.
[0238] According to some embodiments of the invention, the
concentration of the 9CLA in the nutrition formula is between about
70 mg/100 kJ to about 330 mg/100 kJ of formula.
[0239] According to some embodiments of the invention, the
concentration of the 9CLA in the nutrition formula is between about
400-800 mg 9CLA per 100 ml of ready-to-use nutrition formula, e.g.,
between about 500-700 mg 9CLA per 100 ml of ready-to-use nutrition
formula, e.g., about 500-650 mg 9CLA per 100 ml of ready-to-use
nutrition formula.
[0240] According to some embodiments of the invention, the
concentration of the 9CLA in the nutrition formula is between about
3-5 grams 9CLA per 100 grams of powder of the nutrition formula,
e.g., between about 3.5-4.5 grams 9CLA per 100 grams of powder of
the nutrition formula, e.g., between about 3.8-4.2 grams 9CLA per
100 grams of powder of the nutrition formula.
[0241] According to some embodiments of the invention, the
nutrition formula is for use in a subject having a pathology
characterized by immature hepatocytes, such as hyperbilirubinemia
(newborn jaundice), pre-term infants, infants born by C-section and
the like.
[0242] According to some embodiments of the invention, the
nutrition formula of some embodiments of the invention is suitable
for infants born by C-section (Caesarean section).
[0243] According to some embodiments of the invention, the
nutrition formula of some embodiments of the invention is suitable
for a non-breast fed infant.
[0244] According to some embodiments of the invention, the
nutrition formula of some embodiments of the invention is suitable
for at least the first week(s) of life, e.g., for at least one week
of life, e.g., for at least two, at least three, for at least four,
for at least five weeks of life.
[0245] The nutrition formula can be in a form of a powder that
comprises 9CLA and can be combined with a liquid, such as water, to
produce a milk-like beverage to be used by a subject in need
thereof, or it can be in a liquid form (e.g., ready to use solution
or suspension), e.g., for use by a subject diagnosed by or having a
pathology characterized by immature hepatocytes.
[0246] According to some embodiments of the invention, the powder
and resulting beverage have a balanced amino acid profile suitable
for dietary management of individuals diagnosed by or having a
pathology characterized by immature hepatocytes.
[0247] The nutrition formula of some embodiments of the invention
may also include (a) complementary essential amino acids which are
a mixture of tyrosine, arginine, tryptophan, leucine and histidine
and, in combination, provide a balanced amino acid profile and (b)
a carbohydrate source, which typically includes non-reducing sugars
to minimize/reduce browning potential.
[0248] The nutrition formula of some embodiments of the invention
may also include (a) complementary essential amino acids which are
a mixture of tyrosine, arginine, tryptophan, leucine and histidine
and, in combination, provide a balanced amino acid profile; (b) a
carbohydrate source, which typically includes non-reducing sugars
to minimize/reduce browning potential; and (c) a fat (lipid/oil)
source.
[0249] The nutrition formula of some embodiments of the invention
can further comprise vitamins and minerals, such as vitamins and
minerals in sufficient quantities to meet the daily requirement for
each.
[0250] The nutrition formula of some embodiments of the invention
may also include (a) complementary essential amino acids which are
a mixture of tyrosine, arginine, tryptophan, leucine and histidine
and, in combination, provide a balanced amino acid profile; (b) a
carbohydrate source, which typically includes non-reducing sugars
to minimize/reduce browning potential; (c) a fat (lipid/oil) source
[e.g., PUFA (Polyunsaturated fatty acids) such as DHA
(Docosahexaenoic acid) and ARA (Arachidonic Acid)]; and typically,
but optionally, (d) vitamins and minerals, such as vitamins and
minerals in sufficient quantities to meet the daily requirements
for each.
[0251] In addition, the nutrition formula typically, but
optionally, includes flavors, which can be natural or artificial or
a combination of both; coloring agents, which can be natural or
artificial or a combination of both; sweetener, which can be
natural or artificial or a combination of both; gelling agents,
thickening agents, stabilizing agents, sequestrants, emulsifiers or
a combination of two or more of gelling agents, thickening agents,
stabilizing agents, sequestrants, emulsifiers, each of which can be
natural or artificial or a combination of both.
[0252] Table 1, herein below, provides sequence information of the
polypeptides/polynucleotides used in the methods of some
embodiments of the invention.
TABLE-US-00001 TABLE 1 SEQ Representative SEQ Representative ID
GenBank ID GenBank NO: Accession No. of NO: Accession of the mRNA
of No. of the encoding the the Protein name protein protein protein
mRNA Alpha-fetoprotein NP_001125.1 1 NM_001134.2 12 (AFP)
cytochrome 3A7 NP_000756.3 2 NM_000765.4 13 (CYP3A7) cytochrome
P450 family 3 subfamily A member 7 cytochrome 3A4 NP_001189784.1 3
NM_001202855.2 14 (CYP3A4) cytochrome P450 family 3 subfamily A
member 4 isoform 2 cytochrome 3A4 NP_059488.2 4 NM_017460.5 15
(CYP3A4) cytochromc P450 family 3 subfamily A member 4 isoform 1
insulin NP_000198.1 65 NM_000207.2 66 basic fibroblast NP_001997.5
67 NM_002006.4 68 growth factor hepatocyte NP_000592.3 5
NM_000601.5 16 growth factor (HGF) isoform 1 hepatocyte
NP_001010931.1 6 NM_001010931.2 17 growth factor (HGF) isoform 2
hepatocyte NP_001010932.1 7 NM_001010932.2 18 growth factor (HGF)
isoform 3 hepatocyte NP_001010933.1 8 NM_001010933.2 19 growth
factor (HGF) isoform 4 hepatocyte NP_001010934.1 9 NM_001010934.2
20 growth factor (HGF) isoform 5 HSP60 (heat NP_002147.2 10
NM_002156.4 21 shock protein family D (Hsp60) member 1) variant 1
HSP60 (heat NP_955472.1 11 NM_199440.1 22 shock protein family D
(Hsp60) member 1) variant 2
[0253] Table 2 hereinbelow provides a non-limiting list of
conjugated fatty acids which can be used according to some
embodiments of the invention.
TABLE-US-00002 TABLE 2 Conjugated Fatty acids Common name Lipid
name Chemical name Conjugated Linoleic Acids (two conjugated double
bonds) Rumenic acid 18:2 (n-7) 9Z,11E-octadeca-9,11-dienoic acid
18:2 (n-6) 10E,12Z-octadeca-9,11-dienoic acid Conjugated Linolenic
Acids (three conjugated double bonds) .alpha.-Calendic acid 18:3
(n-6) 8E,10E,12Z-octadecatrienoic acid .beta.-Calendic acid 18:3
(n-6) 8E,10E,12E-octadecatrienoic acid Jacaric acid 18:3 (n-6)
8Z,10E,12Z-octadecatrienoic acid .alpha.-Eleostearic 18:3 (n-5)
9Z,11E,13E-octadeca-9,11,13- acid trienoic acid .beta.-Eleostearic
18:3 (n-5) 9E,11E,13E-octadeca-9,11,13- acid trienoic acid Catalpic
acid 18:3 (n-5) 9Z,11Z,13E-octadeca-9,11,13- trienoic acid Punicic
acid 18:3 (n-5) 9Z,11E,13Z-octadeca-9,11,13- trienoic acid Other
Rumelenic acid 18:3 (n-3) 9E,11Z,15E-octadeca-9,11,15- trienoic
acid .alpha.-Parinaric acid 18:4 (n-3) 9E,11Z,13Z,15E-octadeca-
9,11,13,15-tetraenoic acid .beta.-Parinaric acid 18:4 (n-3) all
trans-octadeca-9,11,13,15- tretraenoic acid Bosscopcntacnoic 20:5
(n-6) 5Z,8Z,10E,12E,14Z-cicosanoic acid acid Table 2: List of
conjugated fatty acids
[0254] Table 3 hereinbelow, provides a non-limiting list of omega 3
polyunsaturated fatty acids which can be used according to some
embodiments of the invention.
TABLE-US-00003 TABLE 3 List of omega 3 polyunsaturated fatty acids
Common name Lipid name Chemical name Hexadecatrienoic acid 16:3
(n-3) all-cis 7,10,13-hexadecatrienoic (HTA) acid Alpha-linolenic
acid 18:3 (n-3) all-cis-9,12,15-octadecatrienoic (ALA) acid
Stearidonic acid 18:4 (n-3) all-cis-6,9,12,15- (SDA)
octadecatetraenoic acid Eicosatrienoic acid 20:3 (n-3)
all-cis-11,14,17-eicosatrienoic (ETE) acid Eicosatetraenoic 20:4
(n-3) all-cis-8,11,14,17- acid (ETA) eicosatetraenoic acid
Eicosapentaenoic 20:5 (n-3) all-cis-5,8,11,14,17- acid (EPA,
Timnodonic eicosapentaenoic acid acid) Heneicosapentaenoic 21:5
(n-3) all-cis-6,9,12,15,18- acid (HPA) heneicosapentaenoic acid
Docosapentaenoic 22:5 (n-3) all-cis-7,10,13,16,19- acid (DPA,
Clupanodonic docosapentaenoic acid acid) Docosahexaenoic 22:6 (n-3)
all-cis-4,7,10,13,16,19- acid (DHA, Cervonic acid) docosahexaenoic
acid Tetracosapentaenoic 24:5 (n-3) all-cis-9,12,15,18,21- acid
tetracosapentaenoic acid Tetracosahexaenoic 24:6 (n-3)
all-cis-6,9,12,15,18,21- acid (Nisinic acid) tetracosahexaenoic
acid
[0255] Table 4 hereinbelow, provides a non-limiting list of small
molecules which are ligands or agonist of PPARA.
TABLE-US-00004 TABLE 4 Small molecules which are ligands or agonist
of PPARA Name Description CAS Registry ID GW409544 L-tyrosinc
analog (Synonyms GW 9544) GW6471 An extended amide analog
436159-64-7 Pirinixic acid Hypolipidemic drug 50892-23-4 (Synonyms
WY-14643) Leukotriene B4 biologically active lipid 71160-24-2
mediator GW 7647 Selective PPARA agonist 265129-71-3
Perfluorooctanesulfonic Fluorosurfactant 1763-23-1 Acid (Synonyms
PFOS) PERFLUOROOCTANOIC Fluorosurfactant 335-67-1 ACID (Synonyms
PFOA) CP-775146 Not Available PubChem ID 10410059 CP-865520 Not
Available PubChem ID 10050146 UNII-999KY5ZIGB Not Available
702681-67-2 Gemfibrozil fibric acid derivative 25812-30-0 (Synonyms
Decrelip; Jezil; Lipur; Lopid)
[0256] The agents described hereinabove for increasing metabolic
maturation of an immature hepatocyte can be administered to an
organism per se, or in a pharmaceutical composition where it is
mixed with suitable carriers or excipients.
[0257] As used herein a "pharmaceutical composition" refers to a
preparation of one or more of the active ingredients described
herein with other chemical components such as physiologically
suitable carriers and excipients. The purpose of a pharmaceutical
composition is to facilitate administration of a compound to an
organism.
[0258] Herein the term "active ingredient" refers to the agents
accountable for the biological effect [e.g., a fatty acid; a small
molecule selected from the group consisting of: an amphipathic
carboxylic acid, Thiazolidinedione (TZD), WY-14643 (Pirinixic
Acid), GW409544, GW6471, Leukotriene B4, GW 7647,
Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146,
CP-865520, UNII-999KY5ZIGB, and Gemfibrozil; a PXR agonist selected
from the group consisting of: a small molecule, a bile acid, and a
steroid].
[0259] Hereinafter, the phrases "physiologically acceptable
carrier" and "pharmaceutically acceptable carrier" which may be
interchangeably used refer to a carrier or a diluent that does not
cause significant irritation to an organism and does not abrogate
the biological activity and properties of the administered
compound. An adjuvant is included under these phrases.
[0260] Herein the term "excipient" refers to an inert substance
added to a pharmaceutical composition to further facilitate
administration of an active ingredient. Examples, without
limitation, of excipients include calcium carbonate, calcium
phosphate, various sugars and types of starch, cellulose
derivatives, gelatin, vegetable oils and polyethylene glycols.
[0261] Techniques for formulation and administration of drugs may
be found in "Remington's Pharmaceutical Sciences," Mack Publishing
Co., Easton, Pa., latest edition, which is incorporated herein by
reference.
[0262] Suitable routes of administration may, for example, include
oral, rectal, transmucosal, especially transnasal, intestinal or
parenteral delivery, including intramuscular, subcutaneous and
intramedullary injections as well as intrathecal, direct
intraventricular, intracardiac, e.g., into the right or left
ventricular cavity, into the common coronary artery, intravenous,
intraperitoneal, intranasal, or intraocular injections.
[0263] Alternately, one may administer the pharmaceutical
composition in a local rather than systemic manner, for example,
via injection of the pharmaceutical composition directly into a
tissue region of a patient.
[0264] The term "tissue" refers to part of an organism consisting
of cells designed to perform a function or functions. Examples
include, but are not limited to, brain tissue, retina, skin tissue,
hepatic tissue, pancreatic tissue, bone, cartilage, connective
tissue, blood tissue, muscle tissue, cardiac tissue brain tissue,
vascular tissue, renal tissue, pulmonary tissue, gonadal tissue,
hematopoietic tissue.
[0265] Pharmaceutical compositions of some embodiments of the
invention may be manufactured by processes well known in the art,
e.g., by means of conventional mixing, dissolving, granulating,
dragee-making, levigating, emulsifying, encapsulating, entrapping
or lyophilizing processes.
[0266] Pharmaceutical compositions for use in accordance with some
embodiments of the invention thus may be formulated in conventional
manner using one or more physiologically acceptable carriers
comprising excipients and auxiliaries, which facilitate processing
of the active ingredients into preparations which, can be used
pharmaceutically. Proper formulation is dependent upon the route of
administration chosen.
[0267] For injection, the active ingredients of the pharmaceutical
composition may be formulated in aqueous solutions, preferably in
physiologically compatible buffers such as Hank's solution,
Ringer's solution, or physiological salt buffer. For transmucosal
administration, penetrants appropriate to the barrier to be
permeated are used in the formulation. Such penetrants are
generally known in the art.
[0268] For oral administration, the pharmaceutical composition can
be formulated readily by combining the active compounds with
pharmaceutically acceptable carriers well known in the art. Such
carriers enable the pharmaceutical composition to be formulated as
tablets, pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions, and the like, for oral ingestion by a patient.
Pharmacological preparations for oral use can be made using a solid
excipient, optionally grinding the resulting mixture, and
processing the mixture of granules, after adding suitable
auxiliaries if desired, to obtain tablets or dragee cores. Suitable
excipients are, in particular, fillers such as sugars, including
lactose, sucrose, mannitol, or sorbitol; cellulose preparations
such as, for example, maize starch, wheat starch, rice starch,
potato starch, gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or
physiologically acceptable polymers such as polyvinylpyrrolidone
(PVP). If desired, disintegrating agents may be added, such as
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof such as sodium alginate.
[0269] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, titanium dioxide, lacquer
solutions and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0270] Pharmaceutical compositions which can be used orally,
include push-fit capsules made of gelatin as well as soft, sealed
capsules made of gelatin and a plasticizer, such as glycerol or
sorbitol. The push-fit capsules may contain the active ingredients
in admixture with filler such as lactose, binders such as starches,
lubricants such as talc or magnesium stearate and, optionally,
stabilizers. In soft capsules, the active ingredients may be
dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. All formulations for oral administration
should be in dosages suitable for the chosen route of
administration.
[0271] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0272] For administration by nasal inhalation, the active
ingredients for use according to some embodiments of the invention
are conveniently delivered in the form of an aerosol spray
presentation from a pressurized pack or a nebulizer with the use of
a suitable propellant, e.g., dichlorodifluoromethane,
trichlorofluoromethane, dichloro-tetrafluoroethane or carbon
dioxide. In the case of a pressurized aerosol, the dosage unit may
be determined by providing a valve to deliver a metered amount.
Capsules and cartridges of, e.g., gelatin for use in a dispenser
may be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0273] The pharmaceutical composition described herein may be
formulated for parenteral administration, e.g., by bolus injection
or continuous infusion. Formulations for injection may be presented
in unit dosage form, e.g., in ampoules or in multidose containers
with optionally, an added preservative. The compositions may be
suspensions, solutions or emulsions in oily or aqueous vehicles,
and may contain formulatory agents such as suspending, stabilizing
and/or dispersing agents.
[0274] Pharmaceutical compositions for parenteral administration
include aqueous solutions of the active preparation in
water-soluble form. Additionally, suspensions of the active
ingredients may be prepared as appropriate oily or water based
injection suspensions. Suitable lipophilic solvents or vehicles
include fatty oils such as sesame oil, or synthetic fatty acids
esters such as ethyl oleate, triglycerides or liposomes. Aqueous
injection suspensions may contain substances, which increase the
viscosity of the suspension, such as sodium carboxymethyl
cellulose, sorbitol or dextran. Optionally, the suspension may also
contain suitable stabilizers or agents which increase the
solubility of the active ingredients to allow for the preparation
of highly concentrated solutions.
[0275] Alternatively, the active ingredient may be in powder form
for constitution with a suitable vehicle, e.g., sterile,
pyrogen-free water based solution, before use.
[0276] The pharmaceutical composition of some embodiments of the
invention may also be formulated in rectal compositions such as
suppositories or retention enemas, using, e.g., conventional
suppository bases such as cocoa butter or other glycerides.
[0277] Pharmaceutical compositions suitable for use in context of
some embodiments of the invention include compositions wherein the
active ingredients are contained in an amount effective to achieve
the intended purpose. More specifically, a therapeutically
effective amount means an amount of active ingredients [e.g., a
fatty acid; a small molecule selected from the group consisting of:
an amphipathic carboxylic acid, Thiazolidinedione (TZD), WY-14643
(Pirinixic Acid), GW409544, GW6471, Leukotriene B4, GW 7647,
Perfluorooctanesulfonic Acid, PERFLUOROOCTANOIC ACID, CP-775146,
CP-865520, UNII-999KY5ZIGB, and Gemfibrozil; a PXR agonist selected
from the group consisting of: a small molecule, a bile acid, and a
steroid] effective to prevent, alleviate or ameliorate symptoms of
a disorder (e.g., a pathology characterized by an immature
hepatocyte) or prolong the survival of the subject being
treated.
[0278] Determination of a therapeutically effective amount is well
within the capability of those skilled in the art, especially in
light of the detailed disclosure provided herein.
[0279] For any preparation used in the methods of the invention,
the therapeutically effective amount or dose can be estimated
initially from in vitro and cell culture assays. For example, a
dose can be formulated in animal models to achieve a desired
concentration or titer. Such information can be used to more
accurately determine useful doses in humans.
[0280] Toxicity and therapeutic efficacy of the active ingredients
described herein can be determined by standard pharmaceutical
procedures in vitro, in cell cultures or experimental animals. The
data obtained from these in vitro and cell culture assays and
animal studies can be used in formulating a range of dosage for use
in human. The dosage may vary depending upon the dosage form
employed and the route of administration utilized. The exact
formulation, route of administration and dosage can be chosen by
the individual physician in view of the patient's condition. (See
e.g., Fingl, et al., 1975, in "The Pharmacological Basis of
Therapeutics", Ch. 1 p.1).
[0281] Dosage amount and interval may be adjusted individually to
provide tissue levels of the active ingredient are sufficient to
induce or suppress the biological effect (minimal effective
concentration, MEC). The MEC will vary for each preparation, but
can be estimated from in vitro data. Dosages necessary to achieve
the MEC will depend on individual characteristics and route of
administration. Detection assays can be used to determine plasma
concentrations.
[0282] Depending on the severity and responsiveness of the
condition to be treated, dosing can be of a single or a plurality
of administrations, with course of treatment lasting from several
days to several weeks or until cure is effected or diminution of
the disease state is achieved.
[0283] The amount of a composition to be administered will, of
course, be dependent on the subject being treated, the severity of
the affliction, the manner of administration, the judgment of the
prescribing physician, etc.
[0284] Compositions of some embodiments of the invention may, if
desired, be presented in a pack or dispenser device, such as an FDA
approved kit, which may contain one or more unit dosage forms
containing the active ingredient. The pack may, for example,
comprise metal or plastic foil, such as a blister pack. The pack or
dispenser device may be accompanied by instructions for
administration. The pack or dispenser may also be accommodated by a
notice associated with the container in a form prescribed by a
governmental agency regulating the manufacture, use or sale of
pharmaceuticals, which notice is reflective of approval by the
agency of the form of the compositions or human or veterinary
administration. Such notice, for example, may be of labeling
approved by the U.S. Food and Drug Administration for prescription
drugs or of an approved product insert. Compositions comprising a
preparation of the invention formulated in a compatible
pharmaceutical carrier may also be prepared, placed in an
appropriate container, and labeled for treatment of an indicated
condition, as is further detailed above.
[0285] Compositions of some embodiments of the invention, including
the agents, the pharmaceutical compositions, and/or the nutrition
formula of some embodiments of the invention may be included in an
article of manufacture preferably along with appropriate
instructions for use and labels indicating FDA approval, Food and
Agriculture Organization of the United Nations approval, and/or the
World Health Organization approval for use in treating a subject
having immature hepatocytes.
[0286] As used herein the term "about" refers to .+-.10%
[0287] The terms "comprises", "comprising", "includes",
"including", "having" and their conjugates mean "including but not
limited to".
[0288] The term "consisting of" means "including and limited
to".
[0289] The term "consisting essentially of" means that the
composition, method or structure may include additional
ingredients, steps and/or parts, but only if the additional
ingredients, steps and/or parts do not materially alter the basic
and novel characteristics of the claimed composition, method or
structure.
[0290] As used herein, the singular form "a", "an" and "the"
include plural references unless the context clearly dictates
otherwise. For example, the term "a compound" or "at least one
compound" may include a plurality of compounds, including mixtures
thereof.
[0291] Throughout this application, various embodiments of this
invention may be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual numbers within that range, for example, 1, 2, 3,
4, 5, and 6. This applies regardless of the breadth of the
range.
[0292] Whenever a numerical range is indicated herein, it is meant
to include any cited numeral (fractional or integral) within the
indicated range. The phrases "ranging/ranges between" a first
indicate number and a second indicate number and "ranging/ranges
from" a first indicate number "to" a second indicate number are
used herein interchangeably and are meant to include the first and
second indicated numbers and all the fractional and integral
numerals therebetween.
[0293] As used herein the term "method" refers to manners, means,
techniques and procedures for accomplishing a given task including,
but not limited to, those manners, means, techniques and procedures
either known to, or readily developed from known manners, means,
techniques and procedures by practitioners of the chemical,
pharmacological, biological, biochemical and medical arts.
[0294] When reference is made to particular sequence listings, such
reference is to be understood to also encompass sequences that
substantially correspond to its complementary sequence as including
minor sequence variations, resulting from, e.g., sequencing errors,
cloning errors, or other alterations resulting in base
substitution, base deletion or base addition, provided that the
frequency of such variations is less than 1 in 50 nucleotides,
alternatively, less than 1 in 100 nucleotides, alternatively, less
than 1 in 200 nucleotides, alternatively, less than 1 in 500
nucleotides, alternatively, less than 1 in 1000 nucleotides,
alternatively, less than 1 in 5,000 nucleotides, alternatively,
less than 1 in 10,000 nucleotides.
[0295] It is understood that any Sequence Identification Number
(SEQ ID NO) disclosed in the instant application can refer to
either a DNA sequence or a RNA sequence, depending on the context
where that SEQ ID NO is mentioned, even if that SEQ ID NO is
expressed only in a DNA sequence format or a RNA sequence format.
For example, SEQ ID NO: 12 is expressed in a DNA sequence format
(e.g., reciting T for thymine), but it can refer to either a DNA
sequence that corresponds to an alpha-fetoprotein nucleic acid
sequence, or the RNA sequence of an alpha-fetoprotein RNA molecule
nucleic acid sequence. Similarly, though some sequences are
expressed in a RNA sequence format (e.g., reciting U for uracil),
depending on the actual type of molecule being described, it can
refer to either the sequence of a RNA molecule comprising a dsRNA,
or the sequence of a DNA molecule that corresponds to the RNA
sequence shown. In any event, both DNA and RNA molecules having the
sequences disclosed with any substitutes are envisioned.
[0296] It is appreciated that certain features of the invention,
which are, for clarity, described in the context of separate
embodiments, may also be provided in combination in a single
embodiment. Conversely, various features of the invention, which
are, for brevity, described in the context of a single embodiment,
may also be provided separately or in any suitable subcombination
or as suitable in any other described embodiment of the invention.
Certain features described in the context of various embodiments
are not to be considered essential features of those embodiments,
unless the embodiment is inoperative without those elements.
[0297] Various embodiments and aspects of the present invention as
delineated hereinabove and as claimed in the claims section below
find experimental support in the following examples.
EXAMPLES
[0298] Reference is now made to the following examples, which
together with the above descriptions illustrate some embodiments of
the invention in a non limiting fashion.
[0299] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in
Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989);
Perbal, "A Practical Guide to Molecular Cloning", John Wiley &
Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A
Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory
Press, New York (1998); methodologies as set forth in U.S. Pat.
Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057;
"Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E.,
ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan
J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical
Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn.
(1994); Mishell and Shiigi (eds), "Selected Methods in Cellular
Immunology", W. H. Freeman and Co., New York (1980); available
immunoassays are extensively described in the patent and scientific
literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153;
3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654;
3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219;
5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J.,
ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins
S. J., eds. (1985); "Transcription and Translation" Hames, B. D.,
and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R.
I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986);
"A Practical Guide to Molecular Cloning" Perbal, B., (1984) and
"Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols:
A Guide To Methods And Applications", Academic Press, San Diego,
Calif. (1990); Marshak et al., "Strategies for Protein Purification
and Characterization--A Laboratory Course Manual" CSHL Press
(1996); all of which are incorporated by reference as if fully set
forth herein. Other general references are provided throughout this
document. The procedures therein are believed to be well known in
the art and are provided for the convenience of the reader. All the
information contained therein is incorporated herein by
reference.
[0300] General Materials and Experimental Methods
[0301] Cells and Cell Cultures--I3 hESCs (Amit M, et al. Clonally
derived human embryonic stem cell lines maintain pluripotency and
proliferative potential for prolonged periods of culture. Dev Biol
2000; 227:271-278) or HUES8 hESC were grown in a feeder-independent
system (i.e., in suspension cultures) as previously described (Amit
M, et al. Suspension culture of undifferentiated human embryonic
and induced pluripotent stem cells. Stem Cell Rev 2010; 6:248-259).
In brief, cells were removed from culture dishes using collagenase
type IV, separated into small clumps using 200 .mu.l tips, and
cultured in suspension in 58 mm Petri dishes at a cell density of
1-5.times.10.sup.6 cells/ml. The Petri dishes were kept static in
an incubator at 37.degree. C. in 5% CO.sub.2. After 3 passages of
adaptation to suspension, cells were transferred to spinner flasks,
with a speed of 75 RPM. Culture medium was changed every other day,
and the cells were diluted in a ratio of 1:4 every 5-7 days. The
cells were kept in culture medium (Y10F) consisting of 85% DMEM/F12
(Biological Industries, Beit Haemek, Israel), 15% knockout serum
replacement, 2 mM L-glutamine, 0.1 mM .beta.-mercaptoethanol, 1%
non-essential amino acid stock, 500 U/mL penicillin and 1 mg/mL
streptomycin (Sigma-Aldrich, St. Louis, Mo.), 10 ng/ml bFGF
(R&D systems, Minneapolis, Minn.) and supplemented with 100
.mu.g/ml IL6-IL6 receptor chimera.
[0302] Prior to differentiation, 13 hESC or HUES8 hESC were
cultured on growth factor reduced Matrigel.TM. (BD Biosciences, San
Jose, Calif.) in mTeSR-1 media (Stemcell technologies, Vancouver,
Canada) supplemented with 500 U/mL penicillin and 1 mg/mL
streptomycin (Biological Industries, Beit Haemek, Israel). Cells
were passaged using Accutase.TM. (Sigma Aldrich, St Louis,
Mo.).
[0303] Cryopreserved human hepatocytes (Gibco, Lot number Hu8132)
were thawed and plated on growth factor reduced Matrigel.TM. in
Hepatocyte Maintenance Medium (HMM) per manufacturer instructions
(Lonza, Cologne, Germany).
[0304] Human Subjects--All protocols involving human tissue were
reviewed and exempted by the Hebrew University of Jerusalem and
Weill Cornell Medical College Institutional Review Boards.
[0305] hESC Hepatic Differentiation--The first steps of the
differentiation protocol are similar to those previously reported
by Hay et al. (Hay D C, et al. Highly efficient differentiation of
hESCs to functional hepatic endoderm requires ActivinA and Wnt3a
signaling. Proc Natl Acad Sci USA 2008; 105:12301-12306) and Chen
et al. (Chen Y F, et al. Rapid generation of mature hepatocyte-like
cells from human induced pluripotent stem cells by an efficient
three-step protocol. Hepatology 2012; 55:1193-1203), each of which
is fully incorporated herein by reference in its entirety.
[0306] In brief, cells were seeded on Matrigel.TM.-coated plates in
mTeSR-1 medium and allowed to reach 50% confluence.
[0307] Stage 1: In the first three days, cells were cultured in
RPMI-1640, supplemented with B27 supplement (Gibco, Grand Island,
N.Y.), 100 ng/ml activin A (R&D Systems, Minneapolis, Minn.),
50 ng/ml Wnt3A (R&D Systems) and 10 ng/ml HGF (hepatocyte
growth factor) (PeproTech, London, UK).
[0308] Stage 2: In the following four days, cells were cultured in
KnockOut DMEM (Gibco) supplemented with 20% KnockOut serum
replacement (Gibco), 1% non-essential amino acids (Biological
Industries, Beit Haemek, Israel), 1 mM L-glutamine (Biological
Industries), 0.1 mM 2-mercaptoethanol (Sigma Aldrich) and 1% DMSO
(Sigma Aldrich).
[0309] Stage 3: In the subsequent five days, cells were cultured in
Iscove's modified Dulbecco's medium (IMDM) (Biological Industries)
supplemented with 20 ng/ml oncostatin M (R&D Systems), 4 ng/ml
FGF2 (PeproTech), Insulin-Transferrin-Selenium (ITS) supplement
(Sigma Aldrich) and 0.5 .mu.M Dexamethasone (Sigma Aldrich).
[0310] The last stage of differentiation (stage 4) was performed
according to the method published in Avior Y., et al., 2015
("Microbial-derived lithocholic acid and vitamin K2 drive the
metabolic maturation of pluripotent stem cells-derived and fetal
hepatocytes". Hepatology. 2015 July; 62(1):265-78. Epub 2015 Apr.
22, which is fully incorporated herein by its entirety) as follows:
In the last differentiation step, cells were cultured in RPMI-1640
supplemented with 0.5 .mu.M Dexamethasone, 10 ng/ml HGF and ITS+3
supplement (which includes 16.7 .mu.M of LA and OA) (Sigma
Aldrich). Final differentiation step was also carried out with 10
.mu.M LCA (Sigma Aldrich) and 10 .mu.M Vitamin K.sub.2 (MK4) as
described in the text (Sigma Aldrich).
[0311] Alternatively, the last stage of differentiation (stage 4)
was performed as follows: In the last step, cells were cultured in
Williams' medium E (Sigma Aldrich) supplemented with 0.5 .mu.M
Dexamethasone, 10 ng/ml HGF (hepatocyte growth factor) and ITS
supplement (Sigma Aldrich). Final differentiation step (days 12 to
16) was also carried out with different concentrations of Oleic
acid-Albumin from bovine serum (Sigma Aldrich) and linoleic
acid-Albumin from bovine serum (Sigma Aldrich). As indicated in the
experimental results below, in some experiments linoleic acid was
replaced with 9-cis, 11-trans Conjugated linoleic acid (9CLA,
Sigma) and 50 .mu.M BSA (bovine serum albumin) was added.
Additional details are provided in Tables 5 and 6 herein below.
[0312] It should be noted that the optimal concentrations of OA was
100 .mu.M; the optimal concentration of 9CLA was 100 .mu.M; and the
optimal concentration of LA was 100 .mu.M.
TABLE-US-00005 TABLE 5 Materials for hPSCs differentiation Catalog
Materials for hPSC differentiation Company number PBS Sigma D8537
RPMI-1640 Gibco 21875-034 Penicillin Streptomycin Biological
Industries 03-031-1C (Pen Strep) B27 supplement Gibco 17504044
Activin-A R&D 338-AC Wnt-3A R&D 5036-WN-010 HGF Peprotech
100-39 K/O DMEM Gibco 10829018 K/O Serum Gibco 10828-028
L-Alanyl-L-Glutamin (Glutamax) Biological Industries 030221B Non
Essential Amino Biological Industries 01-340-1B Acids (NEAA) DMSO
(Dimethyl sulfoxide) Sigma D4540 .beta.-Mercaptoethanol Sigma M6250
Iscove's Modified Dulbecco's Biological Industries 01-058-1A Media
(IMDM) ITS Sigma I3146 Dexamethasone Sigma D4902 Oncostatin-M (OSM)
R&D 295-OM basic-FGF (FGF2) Peprotech 100-18B Williams Medium E
Sigma W1878 Oleic acid-albumin Sigma O3008 Linoleic acid-albumin
Sigma L9530 9-cis, 11-trans, conjugated Sigma 16413 linoleic acid
(9CLA) Table 5. List of materials for hESC differentiation
TABLE-US-00006 TABLE 6 Exemplary culture media for specific
differentiation stages of human pluripotent stem cells towards
hepatocytes # Media Stage Days Changes Media Components S1
Endodermal 1-3 3 RPMI 1640 medium, Induction Pen/Strep (100 U), B27
(1X), Act-A (100 ng/ml), Wnt-3a (50 ng/ml), HGF (10 ng/ml) S2
Hepatic 4-7 4 K/O DMEM medium, Specification Pen/Strep (100 U), K/O
Serum (20%), Glutamax (2 mM), NEAA (1%), DMSO (1%),
.beta.-Mercaptoethanol (0.1 mM) S3 Hepatic 8-12 5 IMDM medium,
Differentiation Pen/Strep (100 U), ITS (1X), Dexamethasone (0.5
.mu.M), Oncostatin M (20 ng/ml), bFGF (4 ng/ml) S4 Hepatic 13-16 4
Williams Medium E or Maturation RPMI 1640 medium, Pen/Strep (100
U), ITS (1X), Glutamax (2 mM), Dexamethasone (0.5 .mu.M), HGF (10
ng/ml), Oleic acid (100 .mu.M), 9CLA (100 .mu.M). Table 6. hESC
differentiation protocol.
[0313] Sub-culturing of the cells between day 5 to 10--The present
inventors have incorporated a sub-culture step on Day 8 of the
differentiation method in order to increase proliferation growth
and increase differentiation by minimizing contact inhibition. The
hESC-H can only be sub-cultured between days 5 to 10 without loss
of function such as AFP expression. Cells were washed with PBS and
trypsinized off the surface following 2-5 minutes incubation at
37.degree. C. in 5% CO.sub.2. Cell suspension was diluted in DMEM
containing 10% FBS and centrifuged at 300 g for 5 minutes. Cell
pellet was resuspended in 2.sup.nd stage medium and cells were
seeded at 50% confluence on Matrigel coated dished.
[0314] Hepatic Differentiation Protocol which Includes the
Subculturing Step:
[0315] Table 7 hereinbelow, summarizes the reagents used in the
differentiation protocol
TABLE-US-00007 TABLE 7 Catalogue Reagent Supplier number PBS Sigma
D8537 RPMI-1640 Gibco 21875-034 Penicillin Streptomycin Biological
Industries 03-031-1C (Pen Strep) B27 supplement Gibco 17504044
Activin-A R&D 338-AC Wnt-3A R&D 5036-WN-010 HGF Peprotech
100-39 K/O DMEM Gibco 10829018 K/O Serum Gibco 10828-028
L-Alanyl-L-Glutamin (Glutamax) Biological Industries 030221B Non
Essential Amino Biological Industries 01-340-1B Acids (NEAA) DMSO
Sigma D4540 .beta.-Mercaptoethanol Sigma M6250 Growth Factor
Reduced Matrigel BD Biosciences 356230 DMEM Gibco 11965092 Fetal
Bovine Serum (FBS) Biological Industries Iscove's Modified
Biological Industries 01-058-1A Dulbecco's Media (IMDM) ITS Sigma
I3146 Dexamethasone Sigma D4902 Oncostatin-M (OSM) R&D 295-OM
basic-FGF (FGF2) Peprotech 100-18B Williams Medium E Sigma W1878
Oleic acid-albumin Sigma O3008 Linoleic acid-albumin Sigma L9530
9-cis, 11-trans, conjugated Sigma 16413 linoleic acid (9CLA)
[0316] The Differentiation Protocol was as Follows:
[0317] Day 0: Once pluripotent cell culture, passaged with Accutase
as single cells, reach 50-60% confluence (which is about 2-3 days
if the cells were seeded at a confluence of 20-30%), the cells were
washed twice with PBS and then the S1 Medium was added.
[0318] Days 1-2: S1 medium was replaced daily with afresh S1
medium;
[0319] Day 3: The cells were washed twice with PBS and a
freshly-made warm S2 medium was added;
[0320] Days 4-6: The S2 medium was replaced daily with a fresh S2
medium;
[0321] Day 7: Sub-culturing stage: When the cells reached over 90%
confluence, the cells were passaged as follows. For a 6-well plate
(about 10.sup.6 cells), the wells were washed with PBS, and then
with 0.5 ml trypsin for a 2-5 minutes incubation at 37.degree. C.
5% CO.sub.2. Then, 1 ml of DMEM medium containing 10% FBS was added
to dilute the trypsin, followed by a gentle pipetting of the
suspension to obtain single cells. The cells were centrifuged for 5
minutes at 300 g, the medium was removed and the cells were
re-suspended in S2 medium. The cells were seeded in a 1:2 or 1:3
ratio on Matrigel coated plates. It should be noted that Trypsin
usually dissociates the differentiated cells into single cells, but
still some clumps remain. According to this method, the clumps were
gently broken using a 5 ml pipet and the cells were evenly
distributed between the wells. The use of the 1 ml tip was avoided
when sub-culturing.
[0322] Day 8: In case some cell death was visible, the plates were
washed once with PBS before proceeding to S2 medium change.
[0323] Day 9: The cells were washed twice with PBS and a freshly
made warm S3 medium was added.
[0324] Days 10-13: The S3 medium was replaced daily with a fresh S3
medium.
[0325] Day 14: The cells were washed twice with PBS and a freshly
made warm S4 medium was added.
[0326] Days 15-17: The S4 medium was replaced daily with a fresh S4
medium.
[0327] Day 18: At this stage, cell density is about 10 times higher
than in day 7. Meaning that in a 6 well there were 5*10.sup.6 cells
at day 18.
[0328] Fluorescence-Activated Cell Sorting (FACS)--Cells were
harvested using TrypLE Select (Gibco) and spun down for 5 minutes,
then suspended in PBS buffer containing 5% FBS and the conjugated
antibodies. Cells were then incubated for 1 hour at room
temperature and were washed three times in buffer. Analysis was
performed in FACSAria II cell sorter (BD Biosciences).
[0329] Quantitative Real Time Polymerase Chain Reaction
(qRT-PCR)--RNA was isolated and purified using RNeasy mini kit
(Qiagen) or NucleoSpin RNA kit (Macherey-Nagel), according to
manufacturer protocol. cDNA samples were synthesized using qScriptc
DNA Super Mix (Quanta BioSciences), according to manufacturer
protocol. 1 .mu.g of purified RNA was used for each reaction, with
concentration and purity determined by a ND-1000 spectrophotometer
(NanoDrop Technologies). Each reaction was diluted to reach a
concentration of 10 ng/.mu.L. Gene expression analysis was carried
out utilizing KAPA SYBR FAST Universal 2X PCR Master Mix
(KapaBiosystems, Wilmington, Mass.) on BioRad CFX96 Real-Time
System, according to manufacturer protocol. Gene transcription was
evaluated using the .DELTA..DELTA.Ct method normalized to UBC1 and
RPL32 as housekeeping genes (Table 8, hereinbelow).
TABLE-US-00008 TABLE 8 PCR primers Table 8. Alphabetical list of
qRT-PCR primers and sequence identifiers. Gene SEQ ID SEQ ID Name
Forward 5'-3' NO: Reverse 3'-5' NO: ABCG5 TCTGTTTCCCGTGCT 23
CCCAGCGTCCAGTAGCA 24 GCGAG CAC AFP CCTACAATTCTTCTT 25
AGTAACAGTTATGGCTT 26 TGGGCT GGA Albumin GGAATGCTGCCATG 27
CCTTCAGTTTACTGGAG 28 GAGATCTGC ATCG BAAT CTCCAAAGGCCAGC 29
CAGCCCACCCAAACCAC 30 CTGACT CAA CPT1.alpha. GCCTCGTATGTGAG 31
CCCATTCGTAGCCTTTG 32 GCAAA GTA CYP3A4 Purchased from Qiagen
Purchased from Qiagen (QT00067396) (Q100067396) FIS1 AAAGTACGTCCGCG
33 TCCGATGAGTCCGGCCA 34 GGTTGC GT FoxA2 GGGAGCGGTGAAGA 35
TCATGTTGCTCACGGAG 36 TGGA GAGTA FXR Purchased from IDT Purchased
from IDT (Hs.PT.56a.27354436) (Hs.PT.56a.27354436) LXR.alpha.
GCCGAGTTTGCCTTG 37 TCCGGAGGCTCACCAGT 38 CTCA TTC MFN2
AAGGTGAAGCGCAA 39 CCCCCAGCTGCTCAAAA 40 TGTCCCT ATGC PGC1.alpha.
TGCTCTGTGTCACTG 41 GGGCAAAGAGGCTGGTC 42 TGGATTGG TTCA PPAR.alpha.
Purchased from Qiagen Purchased from Qiagen (QT00017451)
(Q100017451) PXR CTCACCTCCAGGTTT 43 CTCCTTGATCGATCCTTT 44 GCTTC GC
OCT4 TCTCCAGGTTGCCTC 45 GTGGAGGAAGCTGACA 46 TCACT ACAA OTC
TCGAGCCAATACTG 47 CTTCTGGGAGGACATCC 48 CATCTG TTG SERPINA1
ACGAGACAGAAGAC 49 CCCTCTGGATCCACTGC 50 GGCATT TT SLC22A1
CCCCACATTCGTCAG 51 AGGTGCCCGAGGGTTCT 52 CGGTGT GAGG Sox17
GGCGCAGCAGAATC 53 CCACGACTTGCCCAGCA 54 CAGA T Sox2 GCTTAGCCTCGTCGA
55 AACCCCAAGATGCACAA 56 TGAAC CTC UBC1 CGGGTGTGGCACAG 57
TGCATTGTCAAGTGACG 58 CTAGTT ATCAC FIS1 AAAGTACGTCCGCG 59
TCCGATGAGTCCGGCCA 60 GGTTGC GT CYP2C9 Purchased from IDT Purchased
from IDT (Hs.PT.56a.858384) (Hs.PT.56a.858384)
[0330] Immunofluorescence Staining--Cultured cells were fixed using
4% paraformaldehyde for 15 minutes at room temperature. Cells were
then permeabilized in PBS blocking buffer containing 2% BSA and
0.25% Triton X-100 for one hour at room temperature, and incubated
with primary antibodies for another hour (Table 9, hereinbelow).
Following washes, cells were incubated with secondary antibodies
for 1 hour at room temperature in blocking buffer (Table 10,
hereinbelow). Hoechst staining was performed using bisBenzimide
H33342 for 2 minutes. Imaging was performed on a Zeiss LSM 700
confocal microscope.
TABLE-US-00009 TABLE 9 Primary antibodies used for
immunofluorescence analysis Antibody Host Company Catalog #
Dilution AFP Rabbit Cell Marque 203A-16 1:100 Albumin Chicken ICL
CAL80A 1:100 FoxA2 Rabbit Abeam AB40874 1:100 Gata4 Rabbit Abeam
AB84593 1:100 HNF4a Goat Santa Cruz SC6556 1:100 HSP60 (k-19) Goat
Santa Cruz SC-1722 1:100 OCT3/4 Rabbit Santa Cruz SC9081 1:100 PXR
Rabbit Santa Cruz SC25381 1:100 Sox17 Goat R&D AF1924 1:100
Table 9. Primary antibodies source and dilutions
TABLE-US-00010 TABLE 10 Secondary antibodies used for
immunofluorescence analysis Reactive Dilu- Sp. Host Fluorophore
Company Catalog # tion Rabbit Donkey AlexaFluor 488 Jackson
715-546-150 1:100 Goat Donkey AlexaFluor 647 Jackson 705-606-147
1:100 Goat Donkey AlexaFluor 488 Jackson 705-546-147 1:100 Rabbit
Donkey AlexaFluor 594 Jackson 711-585-152 1:100 Chicken Donkey
AlexaFluor 488 Jackson 703-545-155 1:100 Table 10. Secondary
antibodies source and dilutions
[0331] Nuclear Receptors Cop-GFP Activity Reporter Constructs
[0332] PXR Cop-GFP Activity Reporter: PXR-luciferase reporter
construct was a kind gift of Chris Liddle (University of Sydney)
(Goodwin B, et al. The Orphan Human Pregnane X Receptor Mediates
the Transcriptional Activation of CYP3A4 by Rifampicin through a
Distal Enhancer Module. Molecular Pharmacology 1999; 56:1329-1339).
The reporter contains a CYP3A4 promoter element and a distal
enhancer containing PXR response elements (TGAACTTGCTGACCC; SEQ ID
NO: 61), digested out with Acc65 and HindIII. PXRE fragment was
blunt end ligated to pGreenFire1 vector (System Biosciences,
Mountain View, Calif.) containing copGFP reporter using EcoRI-BamHI
digestion.
[0333] LXR Cop-GFP Activity Reporter: LXR Cop-GFP lentiviral
reporter vector was purchased from System Biosciences (SBI). The
reporter contains four LXR response elements
(GGGTTACTGGCGGTCATTGTA; SEQ ID NO: 62) upstream of a minimal CMV
promoter driving Cop-GFP.
[0334] PPAR.sub.a, Cop-GFP Activity Reporter: mCMV-GFP lentiviral
vector was purchased from System Biosciences (SBI) and digested
with EcoRI-BamHI to remove the minimal CMV promoter. The promoter
fragment of the human CPT1A 5'-untranslated region (from -562 to
+1890) that contains a PPAR response element (TACCTTTCCCCTACTTTTC;
SEQ ID NO: 63) was amplified from genomic DNA by PCR using forward
and reverse oligonucleotides. The forward primer contained EcoRI
restriction site and the reverse primer contained a BamHI
restriction site. The PCR product was sub-cloned into the digested
lentiviral vector.
[0335] FXR Cop-GFP Activity Reporter: mCMV-GFP lentiviral vector
was purchased from System Biosciences (SBI) and digested with
XbaI-BamHI. The vector was cloned with a PCR amplified BSEP
promoter element (GGGACATTGATCCT; SEQ ID NO: 64).
[0336] Lentivirus was prepared by transfecting 293T cells with one
of the copGFP lentiviral reporter constructs together with pGAG-pol
and pVSVG in a ratio of 3:2:1.
[0337] A total of 12 g DNA was diluted in Optimen.TM. (Invitrogen),
vortexed, and supplemented with 25 .mu.L of polyethylenimine, and
added drop-wise to the cells. Following 10 minutes incubation at
room temperature the mix was added drop-wise to the cells. Two days
later, media was collected and filtered through a 0.2 .mu.m syringe
filter and concentrated in an Vivaspin 20 filter device (Satorium,
Goettingen, Germany) or in an Amicon Ultra-15 filter device
(Millipore). The device was spun at 3000.times.g for 10 to 15
minutes concentrating supernatant 10-fold. For 4 days, during the
maturation stage of ESC-derived hepatocyte differentiation, medium
was mixed with 1:10 of the concentrated virus and 1:1000 polybrene
and added to the differentiating cells. In the last day of
differentiation, nuclear receptor activity (PXR) was quantified
using Zeiss LSM 700 microscope.
[0338] Albumin and AFP Production--Culture media samples were
collected daily and stored at -80.degree. C. Albumin and AFP
concentrations were analyzed using Human Albumin ELISA quantitation
set (Bethyl laboratories, Montgomery, Tex.) and Human AFP
(alpha-fetoprotein) Quantikine ELISA kit (R&D Systems,
Minneapolis, Minn.), according to manufacturer directions. ApoB100
concentration was analyzed using ALerCHEK, Inc. (Portland, Me.),
total human ApoB-100 ELISA kit as previously described (Goldwasser,
2011). Data was normalized to total cellular protein utilizing the
Bradford assay.
[0339] Cytochrome P450 Activity and Induction--CYP1A activity was
evaluated utilizing EROD (ethoxyresorufin-o-deethylase) as
previously described (Behnia, 2000). To assess CYP3A4 and CYP2C9
activity, the present inventors used a method described by Donato
et al. (Donato, 2004). Briefly, cultures were incubated with 100
.mu.M BFC (7-benzyloxy-4-trifluoromethylcoumarinat), or 10 .mu.M
MFC (7-methoxy-4-trifluoromethylcoumarin) for 1 hour at 37.degree.
C. Supernatant samples were collected every 30 minutes for 2.5
hours. The reactions were stopped by collection of the incubation
medium. Metabolite conjugates formed via phase II activity were
hydrolyzed by incubation of medium samples with
.beta.-glucuronidase/arylsulfatase for 2 hours at 37.degree. C.
Samples were diluted 1:1 in quenching solution and HFC
(7-hydroxy-4-trifluoromethylcoumarin), the respective fluorescent
metabolite formation, was measured at the appropriate wavelengths
(410/510) and normalized to total protein determined by
Bradford.
[0340] To evaluate CYP450 induction, cultures were incubated with
25 .mu.M rifampicin, a PXR agonist, or 50 .mu.M omeprazole, an AhR
agonist, dissolved in culture medium for 72 hours. CYP450 activity
was quantified as described above at the end of the stimulation
period.
[0341] Functional Polarization Assay--hESC--derived hepatocytes
were incubated for 30 minutes with
5(6)-carboxy-2',7'-dichlorofluorescein diacetate (CDFDA). Cultures
were subsequently washed with ice-cold PBS containing calcium and
magnesium and imaging was performed on a Zeiss LSM 700 confocal
microscope.
[0342] Assessment of Cellular Toxicity--Cultured cells were exposed
to different concentrations of compounds dissolved in culture
medium for 24 hours at 37.degree. C. Cell viability was determined
utilizing LIVE/DEAD Cytotoxicity kit (Molecular Probes, Eugene,
Oreg.) according to manufacturer instructions. In brief, cultures
were incubated with 2 .mu.M Calcein AM and 3 .mu.M ethidium
homodimer-1 for 25 minutes. Hydrolysis by functional intracellular
esterases causes live cells to fluoresce green, while the punctured
membranes of dead cells permit ethidium homodimer-1 to bind DNA and
fluoresce red. Cellular viability was calculated by live to dead
ratio and normalized to negative control. TC.sub.50 values were
quantified using GraphPad Prism software (La Jolla, Calif.).
[0343] Toxicological Endpoint Assays (Apoptosis, Cholestasis,
Steatosis)--Toxicological endpoints were evaluated for nine
hepatotoxic compounds at TC.sub.20 values identified above.
Quantitation of apoptotic cells was performed utilizing DeadEnd.TM.
fluorometric TUNEL System (Promega, Madison, Wis.) according to
manufacturer instructions. In brief, hESC-derived hepatocytes were
treated with 1.4 mM acetaminophen, 300 .mu.M diclofenac or 2 .mu.M
aflatoxin B.sub.1 for 24 hours, and subsequently fixed in 4%
paraformaldehyde. Cell were permeabilized and exposed to
fluorescein-12-dUTP and terminal deoxynucleotidyl transferase
(TdT), dying apoptotic nuclei green. The reaction was subsequently
stopped and the cells counterstained for DAPI. A percent apoptotic
nucleus was calculated by dividing the number of TUNEL to DAPI
positive nuclei.
[0344] Quantification of intracellular lipids was performed using
LipidTOX.TM. Green Neutral Lipid Stain (Molecular Probes).
Differentiated cells were incubated with 135 M amiodarone, 2 mM
acetylsalicylic acid or 60 .mu.M valproic acid for 24 hours. Cells
were treated with 1 .mu.M LipidTOX.TM. and 1 .mu.g/mL Hoechst 33342
for 20 minutes, and washed with PBS. Staining intensity was
normalized to negative control. Hepatic cholestasis was quantified
using the CDFDA staining described above. hESC-derived hepatocytes
were incubated with 45 .mu.M chlorpromazine, 575 .mu.M cyclosporine
A or 80 .mu.M troglitazone for 24 hours. Cells were treated with 2
.mu.g/mL CD-FDA, and 1 g/mL Hoechst 33342 for 30 minutes.
Incubation media was removed and cultures washed with ice-cold PBS
containing calcium and magnesium. The number of green CDF particles
was normalized to the number of Hoechst nuclei as an indicator of
functional bile canaliculi. Particle and nuclei counting was
performed utilizing the ImageJ particle analyzer.
[0345] Transmission Electron Microscopy (TEM)--For the TEM
analysis, cell were seeded in a plastic 8 chamber slide (Lab-Tek)
and fixed in 2.5% Glutaraldeyde, 2% paraformaldehyde in 0.1 M
Cacodylate buffer (pH 7.4) for 2 hours at room temp and incubatedat
4.degree. C. overnight. Cells were then rinsed 4 times, 10 minutes
each, in cacodylate buffer and post fixed and stained with 1%
osmium tetroxide, 1.5% potassium ferricyanide in 0.1 M cacodylate
buffer for 1 hour. Cells were then washed 4 times in cacodylate
buffer followed by dehydration in increasing concentrations of
ethanol consisting of 30%, 50%, 70%, 80%, 90%, 95%, for 10 minutes
each step followed by 100% anhydrous ethanol 3 times, 20 minutes
each. Following dehydration, the cells were infiltrated with
increasing concentrations of Agar 100 resin in ethanol, consisting
of 25, 50, 75, and 100% resin for 16 hours each step. The cells
then were embedded in fresh resin and let polymerize in an oven at
60.degree. C. for 48 hours. Embedded cells in blocks were sectioned
with a diamond knife on an LKB 3 microtome and ultrathin sections
(80 nm) were collected onto 200 Mesh, thin bar copper grids. The
sections on grids were sequentially stained with Uranyl acetate and
Lead citrate for 10 minutes each and viewed with Tecnai 12 TEM 100
kV (Phillips, Eindhoven, The Netherlands) equipped with MegaView II
CCD camera. Mitochondria diameter and cell/nuclei size were
measured manually using Analysis.RTM. version 3.0 software
(SoftImaging System GmbH, Munstar, Germany).
[0346] Oxygen consumption and mitochondria function evaluation
using Sea Horse--The extracellular flux analyzer XFp (Seahorse
Biosience, North Billerica, Mass.) was used to measure the oxygen
consumption rate (OCR) and extracellular acidification rate (ECAR)
at the end of the maturation differentiation stage (day 18). Cells
were harvest using Trypsin at the last day of differentiation,
centrifuge for 5 minutes at 90 g, re-suspended with control medium
(no fatty acids) and seeded on a 1% Matrigel coated Seahorse XFp
cell culture miniplates (Seahorse Bioscience) in a density of
10,000 cells per well and cultured for an additional 24 hours.
Mitochondrial Stress Test assay was conducted per manufacturer
instructions. Briefly, cells were incubated in unbuffered XF Base
Medium supplemented with 2 mM Glutamine, 1 mM sodium pyruvate, and
10 mM glucose (pH 7.4) for 1 hour at 37.degree. C. in a non-C2
incubator. Oxygen consumption was measured by the XFp Extracellular
Flux Analyzer (Seahorse Biosciences). Mitochondrial function was
profiled by successive injections of 1 M oligomycin, 0.5 .mu.M
Carbonyl cyanide-4 (trifluoromethoxy) phenylhydrazone (FCCP), and a
mixture of 0.5 .mu.M antimycin A and 0.5 .mu.M rotenone. Data are
presented normalized to 10.sup.3 cells as determined by Hoechst DNA
content assay.
Example 1
[0347] Derivation of Hepatocytes from Pluripotent Stem Cells
[0348] Experimental Results
[0349] Rapid Derivation of Human Embryonic Stem Cell (hESC) derived
Hepatocytes--The present inventors developed a four-step hepatic
differentiation protocol that included postpartum development (FIG.
1A). SRY (sex determining region Y)-box 17 (SOX17)-positive
definitive endoderm emerged on the first 3 days of culture (FIGS.
1B-E), with pluripotent markers octamer-binding transcription
factor 4 (OCT4) and SOX2 disappearing by day 7 on both gene and
protein levels. Transient expression of GATA-binding protein 4
(GATA4) and forkhead box protein A2 (FOXA2) marked the emergence of
hepatoblasts on gene and protein levels (FIGS. 1B-E).
Fluorescence-activated cell sorting analysis revealed a relatively
homogenous population, with 83% of cells positive for both HNF-4
and FOXA2 (FIG. 1G). Stimulation with OSM and basic fibroblast
growth factor (FGF2) directed hepatoblasts to the parenchymal fate.
The fetal-like hepatocyte population showed a significant
expression of AFP and alpha 1 antitrypsin (A1AT), with minor
expression of albumin (FIGS. 1B-E). Finally, this protocol mimicked
the postpartum environment by removing OSM [Kamiya A, et al. FEBS
Lett 2001; 492:90-94] and exposing cells to 16.7 .mu.M of oleic and
linoleic acid (fatty acids) (FIG. 1A), promoting a dramatic
increase in albumin expression, with an associated decrease of AFP
expression (FIG. 1E). Ninety-six percent of differentiated cells
were positive for albumin, and 83% were positive for both albumin
and HNF-4.alpha. expression (FIG. 1H). The protocol was robust,
producing similar results by qRT-PCR in HuES8 and H9 hESCs as well
as hiPSC lines 12F2 and U21 on day 16 of differentiation (FIGS.
6A-J).
[0350] hESC-derived hepatocytes show low PXR-dependent CYP450
expression--The present inventors compared the expression patterns
of hESC-derived hepatocytes to primary human hepatocytes (PHH) and
HepG2 cells cultured under the same conditions (FIGS. 2A-B). Gene
expression of blood proteins albumin and A1AT, was not
significantly different from primary cells (FIG. 2B). Similarly the
expression of hepatic nuclear receptors HNF4c, farnesoid X receptor
(FXR), and constitutive androstane receptor (CAR) was equivalent to
primary cells, with fatty acid-activated peroxisome
proliferator-activated receptor alpha (PPAR.alpha.) showing an
expected 2-fold increase over primary cells (FIGS. 2A-B). However,
expression of PXR was 4% of PHH expression levels, and its targets,
CYP2C9 and CYP3A4, were 4- and 8-fold lower than controls (FIGS.
2A-B). Notably, AhR target CYP1A2 and PPAR target CYP2D6 showed
higher levels of expression (FIGS. 2A-B). These results suggest
that lack of proper PXR activation is responsible for the minimal
expression of CYP2C9 and CYP3A4 in the hESC-derived
hepatocytes.
Example 2
LCA and MK4 Drive PXR-Dependent Hepatic Maturation
[0351] Experimental Results
[0352] LCA and MK4 drive PXR-dependent Hepatic Maturation--LCA and
MK4 are secondary metabolites previously shown to activate PXR
[Staudinger J L, et al. Proc. Natl. Acad. Sci. U.S.A. 2001;
98:3369-3374; Tabb M M, et al. J Biol Chem 2003; 278:43919-43927;
Ichikawa T, et al. J Biol Chem 2006; 281:16927-16934]. When added
to the last stage of differentiation, LCA caused a dose-dependent
induction of PXR, CAR, CYP2C9, and CYP3A4 expression (P<0.05;
n=3; FIG. 2D). At 50 .mu.M, LCA induced PXR, CAR, CYP2C9, and
CYP3A4 by 10-, 16-, 5-, and 73-fold, respectively. At this
concentration, CYP3A4 expression was 9-fold higher than primary
hepatocytes and LCA showed mild toxicity. Therefore, subsequent
differentiation was carried out at 10 .mu.M of LCA. In contrast,
addition of MK4 to the last stage of differentiation showed no
significant effect (FIG. 2E). However, addition of 10 .mu.M of both
LCA and MK4 had a synergistic effect, up-regulating expression of
CAR and PXR by 3- and 3.6-fold (P<0.05), while increasing
expression of CYP3A4 and CYP2C9 by 3- to 4-fold (P<0.01),
respectively (FIG. 2F).
[0353] To validate activation of PXR, the present inventors
infected hESCs with a lentivirus reporter containing multiple
repeats of the PXR response element upstream of a destabilized
CopGFP (ppluGFP2). CopGFP expression was observable in fetal-like
hepatocytes on day 12 of differentiation, but showed an additional
3-fold increase in activity by day 16 (P<0.004; FIG. 2G).
Addition of LCA and MK4 showed an additional 1.5-fold increase in
basal PXR activity (P<0.0001). Immunofluorescence staining
showed that 70.+-.12% of hESC-derived hepatocytes treated with LCA
and MK4 exhibited nuclear localization of PXR, compared with
20.+-.8% for untreated cells (P<0.01; FIG. 2H). Finally,
addition of silibinin, a recently identified PXR inhibitor [Mooiman
K D, et al. Drug Metab Dispos 2013; 41:1494-1504] to hESC-derived
hepatocytes during treatment with LCA and MK4 reversed their
effect, leading to a dose-dependent inhibition of PXR, CYP3A4, and
CYP2C9 (P<0.01; FIG. 2I).
[0354] Taken together, these results demonstrate that LCA and MK4
up-regulate the nuclear receptor, PXR, and its target, CYP450,
genes in hESC-derived hepatocytes. In addition, the present
inventors further validated the synergistic activity of LCA and MK4
in fetal human hepatocytes [Avior Y et al. Hepatology 2015].
Example 3
Protein Expression and Functional Polarization
[0355] Experimental Results
[0356] Protein Expression and Functional Polarization--Epithelial
polarization is a critical function of hepatocytes, which secrete
bile acids and modified drug metabolites by apical bile canaliculi
[Kidambi S, et al. Proc Natl Acad Sci USA 2009; 106:15714-15719;
Khetani S R et al. Nat Biotechnol 2008; 26:120-126]. By day 16 of
differentiation, in the presence of LCA and MK4, cells acquired
homogenous cuboidal morphology and displayed granular perinuclear
staining for albumin and CYP3A4, as well as a strong nuclear
staining for HNF-4.alpha. (FIG. 3A). A small fraction of cells
became binucleated (arrows). To evaluate bile canaliculi function,
cells were treated with CDFDA, which was metabolized to fluorescent
CDF and secreted to bile canaliculi by active multidrug
resistance-associated protein 2 (MRP2). Approximately 85% of cells
showed functional bile canaliculi (arrows), with isolated clusters
showing cytoplasmic CDF staining (FIG. 3B, right).
[0357] Finally, secretion of albumin, AFP, and ApoB100 was tracked
throughout differentiation. Albumin and ApoB100 production
escalated from day 12 onward, reaching 13.2 .mu.g/mL of albumin
(P=0.359; n=3) and 1.0 .mu.g/mL of ApoB100 (P=0.774; n=3), not
significantly different from isolated primary hepatocytes (FIG. 3C,
dashed line). In contrast, AFP production declined by 22% from day
14 onward (P<0.02; n=3; FIG. 3C).
[0358] RNA-Sequencing analysis shows that LCA and MK4 drive hepatic
maturation--To explore the extent of characteristic fetal and
mature expression, the present inventors carried out RNA sequencing
(RNA-Seq) analysis on LCA- and MK4-treated hESC-derived hepatocytes
(LCA/MK4), comparing them to untreated controls (control). RNA was
similarly isolated from adult PHHs and fetal human hepatocytes
(FHHs). Unsupervised Spearman's correlation of 2,925 genes (FIG.
3D) showed that LCA- and MK4-treated cells cluster closer to adult
than to fetal hepatocytes. Expression of mature factors asialoglyco
protein receptor 1 (ASGR1), CYP3A4, and glutamic-pyruvate
transaminase/alanine aminotransferase (GPT1/ALT) were higher in
treated than untreated cells (FIG. 3E), whereas fetal makers CYP3A7
and replication factor C3 (RFC3) were lower (FIG. 3F).
Example 4
CYP450 Activity and Induction in HESC-Derived Hepatocytes
[0359] Experimental Results
[0360] CYP450 Activity and Induction in hESC-Derived
Hepatocytes--To evaluate CYP450 activity in hESC-derived
hepatocytes differentiated in the presence of LCA and MK4, the
present inventors monitored the metabolism of EROD, a CYP1A
substrate [Behnia K, et al. Tissue Eng 2000; 6:467-479] and that of
BFC and MFC, nonspecific substrates metabolized by CYP3A4, 2E1, and
2C9 [Donato M T, et al. Drug Metab Dispos 2004; 32:699-706]. As
expected, fetal CYP1A activity was 2-fold higher in hESC-derived
hepatocytes than primary cells (FIG. 4A). However, treatment with
LCA and MK4 caused a 3- and 2-fold increase in BFC and MFC
metabolism, compared to untreated cells, respectively
(P<0.05).
[0361] Importantly, CYP450 activity in LCA- and MK4-treated
hESC-derived hepatocytes was inducible by classical agonists.
Omeprazole, an agonist of AhR, which regulates CYP1A, induced EROD
and BFC metabolism by 9- and 3-fold, respectively (FIG. 4B).
Rifampicin, an agonist of PXR, which regulates CYP3A4 and 2C9,
induced BFC and MFC metabolism by 2- and 10-fold, respectively
(FIG. 4B). Finally, the present inventors exposed cells to 2% DMSO,
a nonspecific treatment that induces CYP450 expression in primary
cells. Expression of PXR and most CYP450 enzymes which were checked
increased from 2- to 6-fold (FIG. 4C). Together, the data show that
LCA and MK4 induced functional CYP450 regulation at a substantial
fraction of primary hepatocyte potential.
Example 5
Uses of HESC-Derived Hepatocytes for Prediction of Acute
Toxicity
[0362] Experimental Results
[0363] hESC-derived hepatocytes demonstrate accurate prediction of
acute toxicity--Application of hESC-derived hepatocytes for
predictive toxicology was suggested by several groups, but thus far
demonstrated poor correlation to primary cells [Szkolnicka D, et
al. Stem Cells Transl Medicine 2014; 3:141-148]. To test the
ability of LCA- and MK4-treated hESC-derived hepatocytes to predict
hepatotoxic effects, the present inventors tested nine compounds
that display different toxicological endpoints (e.g., cholestasis)
and three control compounds generally regarded as safe.
Differentiation was adapted to 96-well plates (General Materials
and Experimental Methods above). Cells were exposed to increasing
concentrations of compounds on day 16, and viability was quantified
using fluorescence Live/Dead staining after 24 hours of exposure
(FIG. 4D). Results are summarized as TC.sub.50, the concentration
causing 50% cell death (FIG. 4D). Dose-dependence curves showed a
classical sigmoidal response characteristic of toxic metabolite
formation. Importantly, a normalized TC.sub.50 toxicity profile
generated for LCA- and MK4-treated hESC-derived hepatocytes was not
significantly different from primary cells (P=0.13; n=3), whereas
HepG2 profile was significantly different (P=0.04; n=3; FIG.
4E).
[0364] Remarkably, TC.sub.50 values of LCA- and MK4-treated
hESC-derived hepatocytes showed a striking correlation to primary
cells, with an R.sup.2=0.94 to the 45-degree angle (dotted line),
compared to R.sup.2=0.65 for HepG2 cells and an R.sup.2=0.19 for
untreated cells (FIG. 4F).
[0365] Surprisingly, whereas menthol and mannitol controls showed
no adverse effects, the hormone, melatonin, demonstrated a clear
toxicity at a TC.sub.50 value of 0.7.+-.0.2 mM. This concentration
is 2 orders of magnitude higher than the standard 5- to 10-mg dose
marking melatonin as safe (FIG. 4D). Based on these data, the
accuracy of these predictions ranges from 92% to 100%.
[0366] Accurate Prediction of Toxicological Endpoints--To
demonstrate the ability of hESC-derived hepatocytes to predict the
precise toxicological response, the present inventors evaluated
toxicological endpoints of the nine hepatotoxic compounds defined
above at TC.sub.20 concentrations to minimize the effect of cell
death (FIGS. 5A-I).
[0367] Steatosis was evaluated using LipidTox neutral lipid stain.
After 48 hours of exposure, cultures treated with amiodarone,
acetylsalicylic acid (aspirin), or valproic acid showed a 25- to
26-fold increase in intracellular lipids, compared to control
(P<0.001; n=4; FIGS. 5A-B).
[0368] Cholestasis was evaluated by CDFDA staining. After 24 hours
of exposure, cultures treated with troglitazone, chlorpromazine
(thorazine), or cyclosporine A showed a 13- to 30-fold decrease in
number of CDF-positive bile canaliculi, compared to control
(P<0.003; n=4; FIGS. 5C-D).
[0369] Finally, apoptosis was evaluated using the TUNEL assay.
After 24 hours of exposure, cultures treated with diclofenac,
acetaminophen (Tylenol), or aflatoxin B1 showed a 3- to 4-fold
increase in percent of apoptotic nuclei, compared to control
(P<0.02; n=4; FIGS. 5E-F).
[0370] Taken together, the data demonstrate that hESC-derived
hepatocytes can be utilized to predict appropriate toxicological
end-points with high sensitivity.
[0371] Finally, the present inventors sought to identify the
toxicological mechanism underlying the observed toxicity of
melatonin. Melatonin did not affect the number of functional bile
canaliculi at TC.sub.20 concentration (P<0.4; n=4; FIGS. 5G-I).
In contrast, melatonin caused a significant 30-fold increase in
lipid accumulation (P<0.006; n=4), suggesting that the hormone
might cause steatosis at high concentration or prolonged use.
Example 6
Generalized Protocol for Hepatocyte Derivation from Varying Human
Pluripotent Stem Cell Lines
[0372] Experimental Results
[0373] Sub-culture and general derivation of human pluripotent stem
cell (hPSC) derived hepatocytes--Human embryonic stem cells (hESC)
and human induced pluripotent stem cells (hiPSC) from several
sources were expanded in a feeder-independent culture. When cells
reached 50% confluence, the present inventors induced hepatic
differentiation using the protocol described in Avior, 2015, yet
with significant improvements. Fast growing cell lines reached
confluence and stopped differentiating at a fetal stage due to
contact inhibition. Therefore, present inventors added a
sub-culture step on day 8 of endoderm induction, that permits
better control of cell density, by defining 30% confluence
post-seeding. The protocol was extended to 18 days, by starting
stage 3 on day 10 as shown in FIG. 11B.
Example 7
Fatty Acids Oleic Acid and Linoleic Acid Increase Human Embryonic
Stem Cell Derived Hepatocyte Maturation
[0374] Experimental Results
[0375] OA and LA drive nuclear receptors activation--Nuclear
receptors are ligand-activated transcription factors that play a
critical role in the regulation of metabolic processes and mature
liver function (Clavia Ruth Wooton-Kee, 2010; Panadero, 2000;
Lacroix, 1997). Fatty acids were previously found to activate
certain nuclear receptors in the adult liver, suggesting they might
play a similar role in their fetal induction during the transition
from glucose-rich placental to lipid-rich enteral nutrition (Finley
et al, 1985, summarized in Table 11, hereinbelow);
Fernando-Warnakulasuriya, 1981).
TABLE-US-00011 TABLE 11 Fatty acid composition of human breast milk
Percentage in fat fraction (%) Common name C12:0 6 Lauric C14:0 8
C16:0 23 Palmitic C18:0 8 Stearic C18:1 .omega.9 32 Oleic C18:2
.omega.6 17 Linoleic C18:3 .omega.3 1.6 .alpha.-linoleic C20:4
.omega.6 0.1 Arachidonic (AA) C22:6 .omega.3 0.3 Docosahexaenoic
(DHA) Table 11. Fatty acid composition of human breast milk (Values
are obtained from Finley et al., 1985, which is fully incorporated
herein by reference).
[0376] Oleic acid (OA) and linoleic acid (LA) were added to the
last stage of differentiation [days 13-16 (when differentiation did
not include a step of sub-culturing) or days 15-18 (when the
differentiation included a step of sub-culture)]. Exposure to OA
and LA induced a dose-dependent activation of PPAR.alpha. response
element (PPRE), LXR.alpha. response element (LXRE) and PXR response
element (PXRE), but not of FXR response element (FXRE) (p<0.01)
(FIG. 6A). NR activation was validated by infecting hESC with a set
of lentivirus activity reporters as described in the "GENERAL
MATERIALS AND EXPERIMENTAL METHODS" herein above at the last four
days of differentiation (FIG. 6A). Gene expression analysis showed
similar induction of the nuclear receptor and a classical target
gene reaching a maximum induction between 62 to 125 .mu.M (FIG.
6B).
[0377] OA and LA drive hepatocyte maturation--Albumin and AFP are
positive and negative markers of hepatocyte maturity, respectively.
Differentiation in the presence of OA and LA produced a
dose-dependent correlation with albumin increasing by 45% and AFP
decreasing by 30% at 125 .mu.M (FIGS. 6C-D). Concentrations of 250
.mu.M and above caused a toxic effect leading to decrease
differentiation (FIGS. 6B-E).
[0378] Finally, a 24-hours treatment with GW9662, a
PPAR.alpha./.gamma. antagonist, inhibited the expression of genes
involved in lipid metabolism and caused a significant decrease in
albumin gene expression and production (n=5, p<0.05), reducing
them back to control levels (FIGS. 6F-G). Taken together, these
results demonstrate that OA and LA promote the metabolic maturity
of hESC-derived hepatocytes via nuclear receptors activation with
PPAR having a key regulatory role in the hepatic metabolic profile
and albumin expression.
[0379] OA and LA promote PPAR dependent PXR Activation--Each NR
regulates the expression and activity of other transcription
factors, forming a network of interactions regulating metabolic and
developmental processes. The activation of lipid metabolism
regulator, PPAR, by OA and LA at the last stage of differentiation
also induced the expression, activity and nuclear localization of
PXR in hESC-derived hepatocytes (FIGS. 6A, 6B and 6H-I).
Surprisingly, when replacing LA with its microbial derived isomer,
9CLA, an additional 40% increase in PXR nuclear localization
(p<0.0001) was detected (FIGS. 6H-I). Increased activity of PXR
was supported by the increase in CYP3A4 and CYP2C9 gene expression
and activity (FIGS. 6H and 6I). PXR nuclear localization and
activation was down-regulated by the PPAR antagonist, GW9662,
supported by fluorescent microscopy and gene expression (FIGS.
6H-I).
Example 8
Effect of the Fatty Acids on Mitochondria Development in
Esc-Derived Hepatic Cell
[0380] Experimental Results
[0381] OA and LA promote hepatic mitochondria development via PPAR
activation--Primary hepatocytes maintain a network of over 1400
mitochondria, whose maturation and activity is essential for
hepatic function (Yue Yu, 2012; Valcarce C, 1988; E G white, 1939).
Transmission electron microscopy (TEM) showed clear
ultra-structural changes induced by differentiation of hESC-derived
hepatocyte with OA and LA, or OA and 9CLA compared to control (FIG.
7A). Treatment with fatty acids caused the accumulation of lipid
droplets (FIG. 7A) and increase cell size by 80% for OA and LA
treatment compared to control (p<0.01; FIG. 7C). Mitochondria
decreased in diameter by 20-30%, acquiring elongated morphology
indicative of network formation (FIG. 7B).
[0382] Confocal imaging of mitochondrial protein HSP60 showed
similar results (FIG. 7D) with a highly branched network of
mitochondria appearing primarily during OA and 9CLA treatment.
Indeed, image analysis showed a 20% decrease in mitochondria minor
axis (i.e. diameter), a 12% increase in mitochondria major axis
(i.e. length), and a 7% increase in eccentricity (FIGS. 7D-H).
[0383] PPAR.alpha. is known to regulate the expression of PGC1a and
MFN2, essential for proper mitochondria biogenesis and fusion
(Chen, 2003; Chen, 2005). To evaluate the molecular mechanism
underlying the morphological changes, expression of key biogenesis,
fusion and fission regulators was evaluated. Fatty acid treatment
increase MFN2 expression by 70% with FIS1 increasing only by 20%,
validating the increase in fusion to fission ratio (FIG. 7J).
Elongation and narrowing of mitochondria was reversed by GW9662,
supported by the decrease in PGC1, MFN2 and FIS1 gene expression
and indicates on a PPAR.alpha.-dependent mechanism involved in
regulating mitochondria morphology (FIGS. 7E-G and FIG. 7J).
[0384] OA and LA increase mitochondrial function--Hepatocyte
mitochondrial activity defines the metabolic ability of the cells.
To evaluate mitochondrial function the present inventors used the
XFp extracellular flux analyzer (Seahorse Biosience, North
Billerica, Mass.). The machine measures oxygen consumption rate
(OCR) during the sequential addition of toxins and inhibitors to
specifically quantify basal respiration, oxidative phosphorylation
and mitochondrial mass. The present inventors show that oxidative
phosphorylation (ATP production) increase by 2-folds following OA
and LA addition, and by 2.7-fold increase in response to OA and
9CLA (p<0.05) (FIGS. 8A-B). Interestingly, induction of
mitochondrial function by OA and 9CLA resulted in about half of the
efficacy compared to human hepatocytes (FIGS. 8A-B).
[0385] Analysis and Discussion
[0386] Scarcity of human hepatocytes and batch-to-batch variability
has increased interest in hESC and hiPSC-derived hepatocytes for
both clinical and toxicological applications. In this work the
present inventors present a rapid 16 to 18-day protocol for
differentiation of hESC-derived hepatocytes. Like other groups,
previous protocols produced a relatively homogenous induction of
albumin and HNF4a (FIGS. 1A-H), but with high AFP expression
levels, low CYP450 activity (Si-Tayeb 2010; Chen 2012; Roelandt
2013) and under-developed mitochondria (Yu, 2012; wanet, 2014;
Avior, 2015). The limited hepatic function could be a result of
failing to include postnatal developmental in current
differentiation protocols. Recently the present inventors presented
the hepatic-maturing influence of bacteria derived, lithocoloc acid
(LCA) and vitamin K.sub.2(MK4), via PXR activation, suggesting a
crucial role of postnatal cues in hepatic development (Avior et al.
2015).
[0387] Here the present inventors demonstrate the inductive role of
postnatal nutritional cues, oleic acid (OA) and linoleic acid (LA)
and that of the naturally occurring gut microbiota derived LA
isomer, 9CLA, in promoting hepatic maturation and mitochondrial
development via PPAR activation.
[0388] Hepatocytes play a central role in lipid, cholesterol and
xenobiotics metabolism, as such they are highly metabolic. Relying
on external cues to promote their functions, nuclear receptors act
as sensors for many metabolites and nutrients consumed in the diet,
and act as metabolic regulators in the liver. Post-partum, a
variety of functional adaptations are essential for maintaining
metabolic homeostasis. The arrest of placental circulation,
consequently results in changes in hepatic NR activity and
expression (RI, 2000; Roux C, 2000; Panadero, 2000; Lacroix, 1997).
The present inventors found that addition of OA and LA during the
last stage of hESC differentiation promoted the metabolic maturity
of the cells by inducing the activation of key metabolic
NRs-PPAR.alpha., LXR.alpha. and PXR (FIGS. 6A-I). Replacing LA with
microbial derived 9CLA promoted an additional maturation by
inducing a PPAR dependent-PXR activation (FIGS. 6H-J).
[0389] Mitochondrial development is closely linked to pluripotency,
differentiation and proliferation (Wanet 2014). Pluripotent
blastomeres, before implantation, and ESC possess small and
underdeveloped mitochondria, which rely on anaerobic respiration.
Upon cellular differentiation and commitment, functional and
morphological changes that define the mature mitochondria occur.
Mitochondria acquire an elongated morphology with swollen cristae
and dense matrices, and cells gain a more efficient aerobic
metabolism that result in an increase in ATP production and oxygen
consumption (Valcarce C, 1988; Cuezva J M, 1990; J K, 1975;
Jakovcic S, 1971; J. M. Facucho-Oliveira and J. C. St. John, 2009).
Hepatocytes, having high metabolic activity, require high content
of mitochondria to satisfy cellular energetic demand. Therefore,
development and maturation of mitochondria must go hand in hand
with hepatic maturation. Although the role of mitochondria in
energy production and hepatic metabolic functionality is well
documented, only few studies evaluated mitochondrial development in
differentiated hepatocytes. Wanet and colleagues (Wanet, 2014)
provide detailed characterization and kinetics of mitochondrial
respiration, biogenesis and morphological changes during
differentiation, elucidating the role of mitochondrial biogenesis
and function in the regulation of hepatic differentiation (Wanet,
2014). In the work of Yu, the morphological and functional changes
of differentiated hiPSC were compared to primary hepatocytes,
highlighting the insufficient maturity of the cells. The present
inventors attribute this significant difference in mitochondrial
function to post-partum development.
[0390] Fatty acids are poorly transferred through the placenta and
gut microbial population is considered to emerge only at birth.
Research focusing on the microbiota has defined the metabolic and
physiological roles bacteria play within the mutualistic
relationship (Gakuhei, 2010; Redondo-lopez, 1990) and the role of
nutritional composition on the developing microbiota
(Redondo-lopez, 1990). The present inventors have uncovered that
9CLA, produced by neonatal bacteria populations, has a role in
promoting hepatic maturation and mitochondria development via PPAR
activation in hESC-derived hepatocytes (FIGS. 6A-J-8A-B). The
increase in maturation markers and mitochondria function
demonstrate, and further support, that there is a tight link
between nutrition, gut bacteria populations and hepatic cellular
development.
[0391] Mitochondrial development and metabolic maturation of
differentiated pluripotent cells are a general concern not only in
hepatic differentiation but also in differentiation of other cell
types. Myocytes and pancreatic beta-cells, for example, are highly
dependent on mitochondria function for their proper functionality
and in order to meet their energy demands (Asa, 2007; Maechler,
2010). The inducible effect of OA, LA and especially that of
microbial derived, 9CLA, on NR activation and mitochondrial
development should be tested in other differentiation protocols and
could assist in promoting maturation and full functionality.
[0392] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims.
[0393] All publications, patents and patent applications mentioned
in this specification are herein incorporated in their entirety by
reference to the specification, to the same extent as if each
individual publication, patent or patent application was
specifically and individually indicated to be incorporated herein
by reference. In addition, citation or identification of any
reference in this application shall not be construed as an
admission that such reference is available as prior art to the
present invention. To the extent that section headings are used,
they should not be construed as necessarily limiting.
REFERENCES
Additional References are Cited in Text
[0394] 1. A M Z. StemBook, 2008. [0395] 2. V B S. Hepatic function
and physiology in the newborn. Seminars in Neonatology 2003;
8:337-346. [0396] 3. Morelli L. Postnatal Development of Intestinal
Microflora as Influenced by Infant Nutrition. J. Nutr. September
2008; 138:1791S-1795S. [0397] 4. D A. SDaM. The marriage of
nutrigenomics with the microbiome: the case of infant-associated
bifidobacteria and milk. American Society for Nutrition 2014;
99:679S-703S. [0398] 5. P L C. Development of intestinal
microbiota. Gastrointestinal Microbiology 1997; 2:3-38. [0399] 6.
Knol MHaJ. Quantitative Real-Time PCR Assays To Identify and
Quantify Fecal Bifidobacterium Species in Infants Receiving a
Prebiotic Infant Formula. APPLIED ANDENVIRONMENTALMICROBIOLOGY
2005:2318-2324. [0400] 7. Finley D A L B, Dewey K G, Grivetti L E.
Breast milk composition: fat content and fatty acid composition in
vegetarians and non-vegetarians. Am J ClinNutr. 1985; 41:787-800.
[0401] 8. G. V. Halade MMR, and G. Fernandes, ". "Effect of CLA
isomers and their mixture on aging C57B1/6J mice." European Journal
of Nutrition 2009; 48:409-418. [0402] 9. G. V. Halade MMR, and G.
Fernandes, ". Differential effects of conjugated linoleic acid
isomers in insulin-resistant female C57B1/6J mice," Journal of
Nutritional Biochemistry, 2010; 21:332-337. [0403] 10. H. Poirier
JSS, R. J. Kim, and M. A. Lazar, "Nutri-tional supplementation with
trans-10, cis-12-conjugated linoleic acid induces inflammation of
white adipose tissue," Diabetes 2006; 55:1634-1641. [0404] 11. C.
M. Reynolds and H. M. Roche. Conjugated linoleic acid and
inflammatory cell signalling," Prostaglandins Leukotrienes and
Essential Fatty Acids 2010; 82:199-204. [0405] 12. J. S. Choi IUK,
M. H. Jung, and J. Song, ". Effects of three different conjugated
linoleic acid preparations on insulin signalling, fat oxidation and
mitochondrial function in rats fed a high-fat diet,". British
Journal of Nutrition, 2007; 98:264-275. [0406] 13. Finlay B S, I.
Russell, S. Gut Microbiota in Health and Disease. Physiol Rev 2010;
90:859-904. [0407] 14. Moya-Camarena S Y VdHJ, Belury M A.
Conjugated linoleic acid activates peroxisome
proliferator-activated receptor alpha and beta subtypes but does
not induce hepatic peroxisome proliferation in Sprague-Dawley rats.
BiochimBiophys Acta 1999; 1436:331-342. [0408] 15. Beck Fea. The
ontogeny of peroxisome-proliferator-activated receptor gene
expression in the mouse and rat. Proceedings. Biological
sciences/The Royal Society 1992; 247:83-87. [0409] 16. Panadero M,
Herrera, E. & Bocos, C. Peroxisome proliferator-activated
receptor-alpha expression in rat liver during postnatal
development. Biochimie 2000; 82:723-726. [0410] 17. F A H.
Energetic aspects of late fetal and neonatal metabolism Academic
Press, 1975. [0411] 18. HommesFA KGaBA. The regulation of ATP
synthesis in fetal rat liver. Enzyme 1973:351. [0412] 19. R. PLaS.
The transport and accumulation of adenine nucleotides during
mitochondrial biogenesis. Biochem J.192:75-83 (1980). 1980;
192:75-83. [0413] 20. Yue Yu H L, Yasuhiro Ikeda, Bruce P. Amiot,
Piero Rinaldo, Stephen A. Duncan, Scott L. Nyberg. Hepatocyte-like
cells differentiated from human induced pluripotent stem cells:
Relevance to cellular therapies Stem Cell Research 2012; 9:196-207.
[0414] 21. Anais Waneta NmR, Mehdi Najarb, Etienne Sokalc, Thierry
Arnoulda, Mustapha Najimic, Patricia Renarda, Mitochondrial
remodeling in hepatic differentiation and dedifferentiation. The
International Journal of Biochemistry & Cell Biology 2014;
54:174-185. [0415] 22. Avior Y L G, Zimmerman M, Kitsberg D,
Schwartz R, Sadeh R, Moussaieff A, Cohen M, Itskovitz-Eldor J,
Nahmias Y. Microbial-Derived Lithocholic Acid and Vitamin K2 Drive
the Metabolic Maturation of Pluripotent Stem Cells-Derived and
Fetal Hepatocytes. hepatology 2015; 62:265-278. [0416] 23. G J
Fernando-Warnakulasuriya JES, S C Frost and M A Wells. Studies on
fat digestion, absorption, and transport in the suckling rat. I.
Fatty acid composition and concentrations of major lipid
components. The Journal of Lipid Research 1981; 22:668-374. [0417]
24. Clavia Ruth Wooton-Kee DJC, Antony T Athippozhy, Tianyong Zhao,
Brett R Jones, and Mary Vore. Mechanisms for increased expression
of cholesterol 7.alpha.-hydroxylase (Cyp7al) in lactating rats
Hepatology 2010; 51:277-285. [0418] 25. Lacroix D, Sonnier, M.,
Moncion, A., Cheron, G. & Cresteil, T. Expression of CYP3A in
the human liver--evidence that the shift between CYP3A7 and CYP3A4
occurs immediately after birth. European journal of
biochemistry/FEBS 1997; 247:625-634. [0419] 26. Esmacli S AA,
Soleimani M, Rahbarizadeh F, Frouzandch-Moghadam M. The role of
albumin and PPAR-.alpha. in differentiation-dependent change of
fatty acid profile during differentiation of mesenchymal stem cells
to hepatocyte-like cells. Cell Biochem Funct 2014; 32:410. [0420]
27. Mochizuki K M H, Kawai H, et al. Possible role of fatty acids
in milk as the regulator of the expression of cytosolic binding
proteins for fatty acids and vitamin A through PPAR.alpha. in
developing rats. J Nutr Sci Vitaminol 2007; 53:515-521. [0421] 28.
Avior Y, Bomze, D., Ramon, O. & Nahmias, Y. Flavonoids as
dietary regulators of nuclear receptor activity. Food &
function 2013; 4:831-844. [0422] 29. Valcarce C N R, Encabo P,
Locches E, Satrustegui J and Cuezva J M. Postnatal Development of
Rat LiverMitochondrial Functions. The Journal of Biological
Chemistry 1988; 263:7767-7775. [0423] 30. E G. W. Some observations
on the liver of the pig: the hepatic lobule and liver cell during
post-natal growth. J Anat. 1939; 73:365-386. [0424] 31. Chen H C A,
Chan D C. Disruption of fusion results in mitochondrial
heterogeneity and dysfunction. J Biol Chem. 2005; 280:26185-26192.
[0425] 32. Hsiuchen Chen SAD, Andrew J. Ewald, Erik E. Griffin,
Scott E. Fraser, and David C. Chan. Mitofusins Mfn1 and Mfn2
coordinately regulate mitochondrial fusion and are essential for
embryonic development. J Cell Biol. 2003; 160:189-200. [0426] 33.
Si-Tayeb K, Lemaigre, F. P. & Duncan, S. A. Organogenesis and
Development of the Liver. Developmental Cell 2010; 18 175-189
[0427] 34. Chen Y-Fea. Rapid generation of mature hepatocyte-like
cells from human induced pluripotent stem cells by an efficient
three-step protocol. Hepatology 2012; 55:1193-1203. [0428] 35.
Roelandt P, Vanhove, J. & Verfaillie, C. Directed
differentiation of pluripotent stem cells to functional
hepatocytes. Methods Mol Biol 2013; 997:141-147. [0429] 36. R I. K.
Inborn errors of cholesterol biosynthesis. Adv Pediatr 2000;
47:1-52. [0430] 37. Roux C W C, Mulliez N, Gaoua W, Cormier V,
Chevy F, D. aC. Role of cholesterol in embryonic development. Am J
Clin Nutr 2000; 71 suppl:1270S-12795. [0431] 38. Cuezva J M V C,
Luis A M, Izquierdo J M, Alconada A and Chamorro M. Postnatal
Mitochondrial Differentiation in the Newborn Rat.Endocrine and
Biochemical Development of the Fetus and Neonate. Reproductive
Biology 1990:113-135. [0432] 39. J K P. The maturation of the inner
membrane of foetal rat liver mitochondria. An example of a positive
feedback mechanism. BIOCHEMICAL JOURNAL 1975; 150:477-488. [0433]
40. Jakovcic S H J, Getz G S, Rabinowitz M and Swift H.
Mitochondrial Development in Liver of Foetal and Newborn Rats.
Biochem J 1971; 121:341-347. [0434] 41. Facucho-Oliveira J M SJJ.
The relationship between pluripotency and mitochondrial DNA
proliferation during early embryo development and embryonic stem
cell differentiation. Stem Cell Rev. 2009; 5:140-158. [0435] 42.
Gakuhei Son M K, and Ian N. Hines. Contribution of Gut Bacteria to
Liver Pathbiology. Gastroenterology Research and Practice 2010.
[0436] 43. Redondo-Lopez V C R, Sobel J D. Emerging role of
lacto-bacilli in the control and maintenance of the vaginal
bacterial microflora. Rev Infect Dis 1990; 12:856-872. [0437] 44.
.ANG.sa B. Gustafsson RAG. Heart mitochondria: gates of life and
death Cardiovascular Research 2007. [0438] 45. Maechler P L N,
Casimir M, Vetterli L, Frigerio F, Brun T. Role of mitochondria in
beta-cell function and dysfunction. Adv Exp Med Biol. 2010;
654:193-216. [0439] 46. Guengerich F P. Cytochrome P450 and
Chemical Toxicology. Chemical Research in Toxicology 2007;
21:70-83. [0440] 47. Kaplowitz N. Idiosyncratic drug
hepatotoxicity. Nat Rev Drug Discov 2005; 4:489-499. [0441] 48.
Gottmann E, Kramer S, Pfahringer B, Helma C. Data quality in
predictive toxicology: reproducibility of rodent carcinogenicity
experiments. Environ Health Perspect 2001; 109:509-514. [0442] 49.
Olson H, Betton G, Robinson D, Thomas K, Monro A, Kolaja G, Lilly
P, et al. Concordance of the toxicity of pharmaceuticals in humans
and in animals. Regul Toxicol Pharmacol 2000; 32:56-67. [0443] 50.
LeCluyse E L. Human hepatocyte culture systems for the in vitro
evaluation of cytochrome P450 expression and regulation. Eur J
Pharm Sci 2001; 13:343-368. [0444] 51. Guillouzo A. Liver cell
models in vitro toxicology. Environ Health Perspect 1998; 106 Suppl
2:511-532. [0445] 52. Hewitt N J, Lechon M J, Houston J B, Hallifax
D, Brown H S, Maurel P, Kenna J G, et al. Primary hepatocytes:
current understanding of the regulation of metabolic enzymes and
transporter proteins, and pharmaceutical practice for the use of
hepatocytes in metabolism, enzyme induction, transporter,
clearance, and hepatotoxicity studies. Drug Metab Rev 2007;
39:159-234. [0446] 53. Nahmias Y, Berthiaume F, Yarmush M L.
Integration of technologies for hepatic tissue engineering. Adv
Biochem Eng Biotechnol 2007; 103:309-329. [0447] 54. Kidambi S,
Yarmush R S, Novik E, Chao P, Yarmush M L, Nahmias Y.
Oxygen-mediated enhancement of primary hepatocyte metabolism,
functional polarization, gene expression, and drug clearance. Proc
Natl Acad Sci USA 2009; 106:15714-15719. [0448] 55. Khetani S R,
Bhatia S N. Microscale culture of human liver cells for drug
development. Nat Biotechnol 2008; 26:120-126. [0449] 56. Shulman M,
Nahmias Y. Long-term culture and coculture of primary rat and human
hepatocytes. Methods Mol Biol 2013; 945:287-302. [0450] 57.
Schwartz R E, Reyes M, Koodie L, Jiang Y, Blackstad M, Lund T,
Lenvik T, et al. Multipotent adult progenitor cells from bone
marrow differentiate into functional hepatocyte-like cells. J Clin
Invest 2002; 109:1291-1302. [0451] 58. Stock P, Bruckner S,
Ebensing S, Hempel M, Dollinger M M, Christ B. The generation of
hepatocytes from mesenchymal stem cells and engraftment into murine
liver. Nat Protoc 2010; 5:617-627. [0452] 59. Lue J, Lin G, Ning H,
Xiong A, Lin C S, Glenn J S. Transdifferentiation of
adipose-derived stem cells into hepatocytes: a new approach. Liver
Int 2010; 30:913-922. [0453] 60. Zhu S, Rezvani M, Harbell J,
Mattis A N, Wolfe A R, Benet L Z, Willenbring H, et al. Mouse liver
repopulation with hepatocytes generated from human fibroblasts.
Nature 2014. [0454] 61. Duan Y, Ma X, Zou W, Wang C, Bahbahan I S,
Ahuja T P, Tolstikov V, et al. Differentiation and characterization
of metabolically functioning hepatocytes from human embryonic stem
cells. Stem Cells 2010; 28:674-686. [0455] 62. Song Z, Cai J, Liu
Y, Zhao D, Yong J, Duo S, Song X, et al. Efficient generation of
hepatocyte-like cells from human induced pluripotent stem cells.
Cell Res 2009; 19:1233-1242. [0456] 63. Si-Tayeb K, Noto F K,
Nagaoka M, Li J, Battle M A, Duris C, North P E, et al. Highly
efficient generation of human hepatocyte-like cells from induced
pluripotent stem cells. Hepatology 2010; 51:297-305. [0457] 64.
Chen Y F, Tseng C Y, Wang H W, Kuo H C, Yang V W, Lee O K. Rapid
generation of mature hepatocyte-like cells from human induced
pluripotent stem cells by an efficient three-step protocol.
Hepatology 2012; 55:1193-1203. [0458] 65. Roelandt P, Vanhove J,
Verfaillie C. Directed differentiation of pluripotent stem cells to
functional hepatocytes. Methods Mol Biol 2013; 997:141-147. [0459]
66. Szkolnicka D, Farnworth S L, Lucendo-Villarin B, Storck C, Zhou
W, Ircdalc J P, Flint 0, et al. Accurate Prediction of Drug-Induced
Liver Injury Using Stem Cell-Derived Populations. Stem Cells
Translational Medicine 2014; 3:141-148. [0460] 67. Lacroix D,
Sonnier M, Moncion A, Cheron G, Cresteil T. Expression of CYP3A in
the human liver--evidence that the shift between CYP3A7 and CYP3A4
occurs immediately after birth. Eur J Biochem 1997; 247:625-634.
[0461] 68. Morelli L. Postnatal development of intestinal
microflora as influenced by infant nutrition. J Nutr 2008;
138:17915-17955. [0462] 69. Staudinger J L, Goodwin B, Jones S A,
Hawkins-Brown D, MacKenzie K I, LaTour A, Liu Y, et al. The nuclear
receptor PXR is a lithocholic acid sensor that protects against
liver toxicity. Proc Natl Acad Sci USA 2001; 98:3369-3374. [0463]
70. Conly J M, Stein K. The production of menaquinones (vitamin K2)
by intestinal bacteria and their role in maintaining coagulation
homeostasis. Prog Food Nutr Sci 1992; 16:307-343. [0464] 71.
Shearer M J, Rahim S, Barkhan P, Stimmler L. Plasma vitamin K1 in
mothers and their newborn babies. Lancet 1982; 2:460-463. [0465]
72. Shearer M J. Vitamin K deficiency bleeding (VKDB) in early
infancy. Blood Rev 2009; 23:49-59. [0466] 73. Tabb M M, Sun A, Zhou
C, Grun F, Errandi J, Romero K, Pham H, et al. Vitamin K2
regulation of bone homeostasis is mediated by the steroid and
xenobiotic receptor SXR. J Biol Chem 2003; 278:43919-43927. [0467]
74. Ichikawa T, Horie-Inoue K, Ikeda K, Blumberg B, Inoue S.
Steroid and xenobiotic receptor SXR mediates vitamin K2-activated
transcription of extracellular matrix-related genes and collagen
accumulation in osteoblastic cells. J Biol Chem 2006;
281:16927-16934. [0468] 75. Amit M, Chebath J, Margulets V, Laevsky
I, Miropolsky Y, Shariki K, Peri M, et al. Suspension culture of
undifferentiated human embryonic and induced pluripotent stem
cells. Stem Cell Rev 2010; 6:248-259. [0469] 76. Amit M, Carpenter
M K, Inokuma M S, Chiu C P, Harris C P, Waknitz M A,
Itskovitz-Eldor J, et al. Clonally derived human embryonic stem
cell lines maintain pluripotency and proliferative potential for
prolonged periods of culture. Dev Biol 2000; 227:271-278. [0470]
77. Kamiya A, Kinoshita T, Miyajima A. Oncostatin M and hepatocyte
growth factor induce hepatic maturation via distinct signaling
pathways. FEBS Lett 2001; 492:90-94. [0471] 78. Donato M T, Jimenez
N, Castell J V, Gomez-Lechon M J. Fluorescence-based assays for
screening nine cytochrome P450 (P450) activities in intact cells
expressing individual human P450 enzymes. Drug Metab Dispos 2004;
32:699-706. [0472] 79. Roelandt P, Obeid S, Paeshuyse J, Vanhove J,
Van Lommel A, Nahmias Y, Nevens F, et al. Human pluripotent stem
cell-derived hepatocytes support complete replication of hepatitis
C virus. Journal of Hepatology 2012; 57:246-251. [0473] 80. Takebe
T, Sekine K, Enomura M, Koike H, Kimura M, Ogaeri T, Zhang R-R, et
al. Vascularized and functional human liver from an iPSC-derived
organ bud transplant. Nature 2013; advance online publication.
[0474] 81. Si-Tayeb K, Noto F, Nagaoka M, Li J, Battle M, Duris C,
North P, et al. Highly efficient generation of human
hepatocyte-like cells from induced pluripotent stem cells.
Hepatology 2010; 51:297-305.
[0475] 82. Chen Y-F, Tseng C-Y, Wang H-W, Kuo H-C, Yang V W, Lee O
K. Rapid generation of mature hepatocyte-like cells from human
induced pluripotent stem cells by an efficient three-step protocol.
Hepatology 2012; 55:1193-1203. [0476] 83. Beulens J W, Booth S L,
van den Heuvel E G, Stoecklin E, Baka A, Vermeer C. The role of
menaquinones (vitamin K(2)) in human health. Br J Nutr 2013;
110:1357-1368. [0477] 84. Makishima M, Okamoto A Y, Repa J J, Tu H,
Learned R M, Luk A, Hull M V, et al. Identification of a nuclear
receptor for bile acids. Science 1999; 284:1362-1365. [0478] 85.
Avior Y, Bomze D, Ramon O, Nahmias Y. Flavonoids as dietary
regulators of nuclear receptor activity. Food Funct 2013;
4:831-844. [0479] 86. Gronlund M M, Lehtonen O P, Eerola E, Kero P.
Fecal microflora in healthy infants born by different methods of
delivery: permanent changes in intestinal flora after cesarean
delivery. J Pediatr Gastroenterol Nutr 1999; 28:19-25. [0480] 87.
Hopkins M J, Macfarlane G T, Furrie E, Fite A, Macfarlane S.
Characterisation of intestinal bacteria in infant stools using
real-time PCR and northern hybridisation analyses. FEMS Microbiol
Ecol 2005; 54:77-85. [0481] 88. Hay D C, Fletcher J, Payne C,
Terrace J D, Gallagher R C, Snoeys J, Black J R, et al. Highly
efficient differentiation of hESCs to functional hepatic endoderm
requires ActivinA and Wnt3a signaling. Proc Natl Acad Sci USA 2008;
105:12301-12306. [0482] 89. Goodwin B, Hodgson E, Liddle C. The
Orphan Human Pregnane X Receptor Mediates the Transcriptional
Activation of CYP3A4 by Rifampicin through a Distal Enhancer
Module. Molecular Pharmacology 1999; 56:1329-1339. [0483] 90.
Behnia K, Bhatia S, Jastromb N, Balis U, Sullivan S, Yarmush M,
Toner M. Xenobiotic metabolism by cultured primary porcine
hepatocytes. Tissue Eng 2000; 6:467-479.
Sequence CWU 1
1
881609PRThomo sapiens 1Met Lys Trp Val Glu Ser Ile Phe Leu Ile Phe
Leu Leu Asn Phe Thr1 5 10 15Glu Ser Arg Thr Leu His Arg Asn Glu Tyr
Gly Ile Ala Ser Ile Leu 20 25 30Asp Ser Tyr Gln Cys Thr Ala Glu Ile
Ser Leu Ala Asp Leu Ala Thr 35 40 45Ile Phe Phe Ala Gln Phe Val Gln
Glu Ala Thr Tyr Lys Glu Val Ser 50 55 60Lys Met Val Lys Asp Ala Leu
Thr Ala Ile Glu Lys Pro Thr Gly Asp65 70 75 80Glu Gln Ser Ser Gly
Cys Leu Glu Asn Gln Leu Pro Ala Phe Leu Glu 85 90 95Glu Leu Cys His
Glu Lys Glu Ile Leu Glu Lys Tyr Gly His Ser Asp 100 105 110Cys Cys
Ser Gln Ser Glu Glu Gly Arg His Asn Cys Phe Leu Ala His 115 120
125Lys Lys Pro Thr Pro Ala Ser Ile Pro Leu Phe Gln Val Pro Glu Pro
130 135 140Val Thr Ser Cys Glu Ala Tyr Glu Glu Asp Arg Glu Thr Phe
Met Asn145 150 155 160Lys Phe Ile Tyr Glu Ile Ala Arg Arg His Pro
Phe Leu Tyr Ala Pro 165 170 175Thr Ile Leu Leu Trp Ala Ala Arg Tyr
Asp Lys Ile Ile Pro Ser Cys 180 185 190Cys Lys Ala Glu Asn Ala Val
Glu Cys Phe Gln Thr Lys Ala Ala Thr 195 200 205Val Thr Lys Glu Leu
Arg Glu Ser Ser Leu Leu Asn Gln His Ala Cys 210 215 220Ala Val Met
Lys Asn Phe Gly Thr Arg Thr Phe Gln Ala Ile Thr Val225 230 235
240Thr Lys Leu Ser Gln Lys Phe Thr Lys Val Asn Phe Thr Glu Ile Gln
245 250 255Lys Leu Val Leu Asp Val Ala His Val His Glu His Cys Cys
Arg Gly 260 265 270Asp Val Leu Asp Cys Leu Gln Asp Gly Glu Lys Ile
Met Ser Tyr Ile 275 280 285Cys Ser Gln Gln Asp Thr Leu Ser Asn Lys
Ile Thr Glu Cys Cys Lys 290 295 300Leu Thr Thr Leu Glu Arg Gly Gln
Cys Ile Ile His Ala Glu Asn Asp305 310 315 320Glu Lys Pro Glu Gly
Leu Ser Pro Asn Leu Asn Arg Phe Leu Gly Asp 325 330 335Arg Asp Phe
Asn Gln Phe Ser Ser Gly Glu Lys Asn Ile Phe Leu Ala 340 345 350Ser
Phe Val His Glu Tyr Ser Arg Arg His Pro Gln Leu Ala Val Ser 355 360
365Val Ile Leu Arg Val Ala Lys Gly Tyr Gln Glu Leu Leu Glu Lys Cys
370 375 380Phe Gln Thr Glu Asn Pro Leu Glu Cys Gln Asp Lys Gly Glu
Glu Glu385 390 395 400Leu Gln Lys Tyr Ile Gln Glu Ser Gln Ala Leu
Ala Lys Arg Ser Cys 405 410 415Gly Leu Phe Gln Lys Leu Gly Glu Tyr
Tyr Leu Gln Asn Ala Phe Leu 420 425 430Val Ala Tyr Thr Lys Lys Ala
Pro Gln Leu Thr Ser Ser Glu Leu Met 435 440 445Ala Ile Thr Arg Lys
Met Ala Ala Thr Ala Ala Thr Cys Cys Gln Leu 450 455 460Ser Glu Asp
Lys Leu Leu Ala Cys Gly Glu Gly Ala Ala Asp Ile Ile465 470 475
480Ile Gly His Leu Cys Ile Arg His Glu Met Thr Pro Val Asn Pro Gly
485 490 495Val Gly Gln Cys Cys Thr Ser Ser Tyr Ala Asn Arg Arg Pro
Cys Phe 500 505 510Ser Ser Leu Val Val Asp Glu Thr Tyr Val Pro Pro
Ala Phe Ser Asp 515 520 525Asp Lys Phe Ile Phe His Lys Asp Leu Cys
Gln Ala Gln Gly Val Ala 530 535 540Leu Gln Thr Met Lys Gln Glu Phe
Leu Ile Asn Leu Val Lys Gln Lys545 550 555 560Pro Gln Ile Thr Glu
Glu Gln Leu Glu Ala Val Ile Ala Asp Phe Ser 565 570 575Gly Leu Leu
Glu Lys Cys Cys Gln Gly Gln Glu Gln Glu Val Cys Phe 580 585 590Ala
Glu Glu Gly Gln Lys Leu Ile Ser Lys Thr Arg Ala Ala Leu Gly 595 600
605Val2503PRThomo sapiens 2Met Asp Leu Ile Pro Asn Leu Ala Val Glu
Thr Trp Leu Leu Leu Ala1 5 10 15Val Ser Leu Ile Leu Leu Tyr Leu Tyr
Gly Thr Arg Thr His Gly Leu 20 25 30Phe Lys Lys Leu Gly Ile Pro Gly
Pro Thr Pro Leu Pro Phe Leu Gly 35 40 45Asn Ala Leu Ser Phe Arg Lys
Gly Tyr Trp Thr Phe Asp Met Glu Cys 50 55 60Tyr Lys Lys Tyr Arg Lys
Val Trp Gly Ile Tyr Asp Cys Gln Gln Pro65 70 75 80Met Leu Ala Ile
Thr Asp Pro Asp Met Ile Lys Thr Val Leu Val Lys 85 90 95Glu Cys Tyr
Ser Val Phe Thr Asn Arg Arg Pro Phe Gly Pro Val Gly 100 105 110Phe
Met Lys Asn Ala Ile Ser Ile Ala Glu Asp Glu Glu Trp Lys Arg 115 120
125Ile Arg Ser Leu Leu Ser Pro Thr Phe Thr Ser Gly Lys Leu Lys Glu
130 135 140Met Val Pro Ile Ile Ala Gln Tyr Gly Asp Val Leu Val Arg
Asn Leu145 150 155 160Arg Arg Glu Ala Glu Thr Gly Lys Pro Val Thr
Leu Lys His Val Phe 165 170 175Gly Ala Tyr Ser Met Asp Val Ile Thr
Ser Thr Ser Phe Gly Val Ser 180 185 190Ile Asp Ser Leu Asn Asn Pro
Gln Asp Pro Phe Val Glu Asn Thr Lys 195 200 205Lys Leu Leu Arg Phe
Asn Pro Leu Asp Pro Phe Val Leu Ser Ile Lys 210 215 220Val Phe Pro
Phe Leu Thr Pro Ile Leu Glu Ala Leu Asn Ile Thr Val225 230 235
240Phe Pro Arg Lys Val Ile Ser Phe Leu Thr Lys Ser Val Lys Gln Ile
245 250 255Lys Glu Gly Arg Leu Lys Glu Thr Gln Lys His Arg Val Asp
Phe Leu 260 265 270Gln Leu Met Ile Asp Ser Gln Asn Ser Lys Asp Ser
Glu Thr His Lys 275 280 285Ala Leu Ser Asp Leu Glu Leu Met Ala Gln
Ser Ile Ile Phe Ile Phe 290 295 300Ala Gly Tyr Glu Thr Thr Ser Ser
Val Leu Ser Phe Ile Ile Tyr Glu305 310 315 320Leu Ala Thr His Pro
Asp Val Gln Gln Lys Val Gln Lys Glu Ile Asp 325 330 335Thr Val Leu
Pro Asn Lys Ala Pro Pro Thr Tyr Asp Thr Val Leu Gln 340 345 350Leu
Glu Tyr Leu Asp Met Val Val Asn Glu Thr Leu Arg Leu Phe Pro 355 360
365Val Ala Met Arg Leu Glu Arg Val Cys Lys Lys Asp Val Glu Ile Asn
370 375 380Gly Met Phe Ile Pro Lys Gly Val Val Val Met Ile Pro Ser
Tyr Val385 390 395 400Leu His His Asp Pro Lys Tyr Trp Thr Glu Pro
Glu Lys Phe Leu Pro 405 410 415Glu Arg Phe Ser Lys Lys Asn Lys Asp
Asn Ile Asp Pro Tyr Ile Tyr 420 425 430Thr Pro Phe Gly Ser Gly Pro
Arg Asn Cys Ile Gly Met Arg Phe Ala 435 440 445Leu Val Asn Met Lys
Leu Ala Leu Val Arg Val Leu Gln Asn Phe Ser 450 455 460Phe Lys Pro
Cys Lys Glu Thr Gln Ile Pro Leu Lys Leu Arg Phe Gly465 470 475
480Gly Leu Leu Leu Thr Glu Lys Pro Ile Val Leu Lys Ala Glu Ser Arg
485 490 495Asp Glu Thr Val Ser Gly Ala 5003502PRThomo sapiens 3Met
Ala Leu Ile Pro Asp Leu Ala Met Glu Thr Trp Leu Leu Leu Ala1 5 10
15Val Ser Leu Val Leu Leu Tyr Leu Tyr Gly Thr His Ser His Gly Leu
20 25 30Phe Lys Lys Leu Gly Ile Pro Gly Pro Thr Pro Leu Pro Phe Leu
Gly 35 40 45Asn Ile Leu Ser Tyr His Lys Gly Phe Cys Met Phe Asp Met
Glu Cys 50 55 60His Lys Lys Tyr Gly Lys Val Trp Gly Phe Tyr Asp Gly
Gln Gln Pro65 70 75 80Val Leu Ala Ile Thr Asp Pro Asp Met Ile Lys
Thr Val Leu Val Lys 85 90 95Glu Cys Tyr Ser Val Phe Thr Asn Arg Arg
Pro Phe Gly Pro Val Gly 100 105 110Phe Met Lys Ser Ala Ile Ser Ile
Ala Glu Asp Glu Glu Trp Lys Arg 115 120 125Leu Arg Ser Leu Leu Ser
Pro Thr Phe Thr Ser Gly Lys Leu Lys Glu 130 135 140Met Val Pro Ile
Ile Ala Gln Tyr Gly Asp Val Leu Val Arg Asn Leu145 150 155 160Arg
Arg Glu Ala Glu Thr Gly Lys Pro Val Thr Leu Lys Asp Val Phe 165 170
175Gly Ala Tyr Ser Met Asp Val Ile Thr Ser Thr Ser Phe Gly Val Asn
180 185 190Ile Asp Ser Leu Asn Asn Pro Gln Asp Pro Phe Val Glu Asn
Thr Lys 195 200 205Lys Leu Leu Arg Phe Asp Phe Leu Asp Pro Phe Phe
Leu Ser Ile Ile 210 215 220Phe Pro Phe Leu Ile Pro Ile Leu Glu Val
Leu Asn Ile Cys Val Phe225 230 235 240Pro Arg Glu Val Thr Asn Phe
Leu Arg Lys Ser Val Lys Arg Met Lys 245 250 255Glu Ser Arg Leu Glu
Asp Thr Gln Lys His Arg Val Asp Phe Leu Gln 260 265 270Leu Met Ile
Asp Ser Gln Asn Ser Lys Glu Thr Glu Ser His Lys Ala 275 280 285Leu
Ser Asp Leu Glu Leu Val Ala Gln Ser Ile Ile Phe Ile Phe Ala 290 295
300Gly Tyr Glu Thr Thr Ser Ser Val Leu Ser Phe Ile Met Tyr Glu
Leu305 310 315 320Ala Thr His Pro Asp Val Gln Gln Lys Leu Gln Glu
Glu Ile Asp Ala 325 330 335Val Leu Pro Asn Lys Ala Pro Pro Thr Tyr
Asp Thr Val Leu Gln Met 340 345 350Glu Tyr Leu Asp Met Val Val Asn
Glu Thr Leu Arg Leu Phe Pro Ile 355 360 365Ala Met Arg Leu Glu Arg
Val Cys Lys Lys Asp Val Glu Ile Asn Gly 370 375 380Met Phe Ile Pro
Lys Gly Val Val Val Met Ile Pro Ser Tyr Ala Leu385 390 395 400His
Arg Asp Pro Lys Tyr Trp Thr Glu Pro Glu Lys Phe Leu Pro Glu 405 410
415Arg Phe Ser Lys Lys Asn Lys Asp Asn Ile Asp Pro Tyr Ile Tyr Thr
420 425 430Pro Phe Gly Ser Gly Pro Arg Asn Cys Ile Gly Met Arg Phe
Ala Leu 435 440 445Met Asn Met Lys Leu Ala Leu Ile Arg Val Leu Gln
Asn Phe Ser Phe 450 455 460Lys Pro Cys Lys Glu Thr Gln Ile Pro Leu
Lys Leu Ser Leu Gly Gly465 470 475 480Leu Leu Gln Pro Glu Lys Pro
Val Val Leu Lys Val Glu Ser Arg Asp 485 490 495Gly Thr Val Ser Gly
Ala 5004503PRThomo sapiens 4Met Ala Leu Ile Pro Asp Leu Ala Met Glu
Thr Trp Leu Leu Leu Ala1 5 10 15Val Ser Leu Val Leu Leu Tyr Leu Tyr
Gly Thr His Ser His Gly Leu 20 25 30Phe Lys Lys Leu Gly Ile Pro Gly
Pro Thr Pro Leu Pro Phe Leu Gly 35 40 45Asn Ile Leu Ser Tyr His Lys
Gly Phe Cys Met Phe Asp Met Glu Cys 50 55 60His Lys Lys Tyr Gly Lys
Val Trp Gly Phe Tyr Asp Gly Gln Gln Pro65 70 75 80Val Leu Ala Ile
Thr Asp Pro Asp Met Ile Lys Thr Val Leu Val Lys 85 90 95Glu Cys Tyr
Ser Val Phe Thr Asn Arg Arg Pro Phe Gly Pro Val Gly 100 105 110Phe
Met Lys Ser Ala Ile Ser Ile Ala Glu Asp Glu Glu Trp Lys Arg 115 120
125Leu Arg Ser Leu Leu Ser Pro Thr Phe Thr Ser Gly Lys Leu Lys Glu
130 135 140Met Val Pro Ile Ile Ala Gln Tyr Gly Asp Val Leu Val Arg
Asn Leu145 150 155 160Arg Arg Glu Ala Glu Thr Gly Lys Pro Val Thr
Leu Lys Asp Val Phe 165 170 175Gly Ala Tyr Ser Met Asp Val Ile Thr
Ser Thr Ser Phe Gly Val Asn 180 185 190Ile Asp Ser Leu Asn Asn Pro
Gln Asp Pro Phe Val Glu Asn Thr Lys 195 200 205Lys Leu Leu Arg Phe
Asp Phe Leu Asp Pro Phe Phe Leu Ser Ile Thr 210 215 220Val Phe Pro
Phe Leu Ile Pro Ile Leu Glu Val Leu Asn Ile Cys Val225 230 235
240Phe Pro Arg Glu Val Thr Asn Phe Leu Arg Lys Ser Val Lys Arg Met
245 250 255Lys Glu Ser Arg Leu Glu Asp Thr Gln Lys His Arg Val Asp
Phe Leu 260 265 270Gln Leu Met Ile Asp Ser Gln Asn Ser Lys Glu Thr
Glu Ser His Lys 275 280 285Ala Leu Ser Asp Leu Glu Leu Val Ala Gln
Ser Ile Ile Phe Ile Phe 290 295 300Ala Gly Tyr Glu Thr Thr Ser Ser
Val Leu Ser Phe Ile Met Tyr Glu305 310 315 320Leu Ala Thr His Pro
Asp Val Gln Gln Lys Leu Gln Glu Glu Ile Asp 325 330 335Ala Val Leu
Pro Asn Lys Ala Pro Pro Thr Tyr Asp Thr Val Leu Gln 340 345 350Met
Glu Tyr Leu Asp Met Val Val Asn Glu Thr Leu Arg Leu Phe Pro 355 360
365Ile Ala Met Arg Leu Glu Arg Val Cys Lys Lys Asp Val Glu Ile Asn
370 375 380Gly Met Phe Ile Pro Lys Gly Val Val Val Met Ile Pro Ser
Tyr Ala385 390 395 400Leu His Arg Asp Pro Lys Tyr Trp Thr Glu Pro
Glu Lys Phe Leu Pro 405 410 415Glu Arg Phe Ser Lys Lys Asn Lys Asp
Asn Ile Asp Pro Tyr Ile Tyr 420 425 430Thr Pro Phe Gly Ser Gly Pro
Arg Asn Cys Ile Gly Met Arg Phe Ala 435 440 445Leu Met Asn Met Lys
Leu Ala Leu Ile Arg Val Leu Gln Asn Phe Ser 450 455 460Phe Lys Pro
Cys Lys Glu Thr Gln Ile Pro Leu Lys Leu Ser Leu Gly465 470 475
480Gly Leu Leu Gln Pro Glu Lys Pro Val Val Leu Lys Val Glu Ser Arg
485 490 495Asp Gly Thr Val Ser Gly Ala 5005728PRThomo sapiens 5Met
Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10
15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln
20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys
Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys
Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn
Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys
Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser
Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu
Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg
Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys
Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser
Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170
175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser
180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys
Ser Glu 195 200 205Val Glu Cys Met Thr Cys Asn Gly Glu Ser Tyr Arg
Gly Leu Met Asp 210 215 220His Thr Glu Ser Gly Lys Ile Cys Gln Arg
Trp Asp His Gln Thr Pro225 230 235 240His Arg His Lys Phe Leu Pro
Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255Asp Asn Tyr Cys Arg
Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265 270Thr Leu Asp
Pro His Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys 275 280 285Ala
Asp Asn Thr Met Asn Asp Thr Asp Val Pro Leu Glu Thr Thr Glu 290 295
300Cys Ile Gln Gly Gln Gly Glu Gly Tyr Arg Gly Thr Val Asn Thr
Ile305 310 315 320Trp Asn Gly Ile Pro Cys Gln Arg Trp Asp Ser Gln
Tyr Pro His Glu 325 330 335His Asp Met Thr Pro Glu Asn Phe Lys Cys
Lys Asp Leu Arg Glu Asn 340
345 350Tyr Cys Arg Asn Pro Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr
Thr 355 360 365Asp Pro Asn Ile Arg Val Gly Tyr Cys Ser Gln Ile Pro
Asn Cys Asp 370 375 380Met Ser His Gly Gln Asp Cys Tyr Arg Gly Asn
Gly Lys Asn Tyr Met385 390 395 400Gly Asn Leu Ser Gln Thr Arg Ser
Gly Leu Thr Cys Ser Met Trp Asp 405 410 415Lys Asn Met Glu Asp Leu
His Arg His Ile Phe Trp Glu Pro Asp Ala 420 425 430Ser Lys Leu Asn
Glu Asn Tyr Cys Arg Asn Pro Asp Asp Asp Ala His 435 440 445Gly Pro
Trp Cys Tyr Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys 450 455
460Pro Ile Ser Arg Cys Glu Gly Asp Thr Thr Pro Thr Ile Val Asn
Leu465 470 475 480Asp His Pro Val Ile Ser Cys Ala Lys Thr Lys Gln
Leu Arg Val Val 485 490 495Asn Gly Ile Pro Thr Arg Thr Asn Ile Gly
Trp Met Val Ser Leu Arg 500 505 510Tyr Arg Asn Lys His Ile Cys Gly
Gly Ser Leu Ile Lys Glu Ser Trp 515 520 525Val Leu Thr Ala Arg Gln
Cys Phe Pro Ser Arg Asp Leu Lys Asp Tyr 530 535 540Glu Ala Trp Leu
Gly Ile His Asp Val His Gly Arg Gly Asp Glu Lys545 550 555 560Cys
Lys Gln Val Leu Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly 565 570
575Ser Asp Leu Val Leu Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp
580 585 590Phe Val Ser Thr Ile Asp Leu Pro Asn Tyr Gly Cys Thr Ile
Pro Glu 595 600 605Lys Thr Ser Cys Ser Val Tyr Gly Trp Gly Tyr Thr
Gly Leu Ile Asn 610 615 620Tyr Asp Gly Leu Leu Arg Val Ala His Leu
Tyr Ile Met Gly Asn Glu625 630 635 640Lys Cys Ser Gln His His Arg
Gly Lys Val Thr Leu Asn Glu Ser Glu 645 650 655Ile Cys Ala Gly Ala
Glu Lys Ile Gly Ser Gly Pro Cys Glu Gly Asp 660 665 670Tyr Gly Gly
Pro Leu Val Cys Glu Gln His Lys Met Arg Met Val Leu 675 680 685Gly
Val Ile Val Pro Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly 690 695
700Ile Phe Val Arg Val Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile
Ile705 710 715 720Leu Thr Tyr Lys Val Pro Gln Ser 7256290PRThomo
sapiens 6Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His
Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala
Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys
Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile
Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys
Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val
Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser
Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp
Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly
Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser
Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150
155 160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn
Tyr 165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys
Phe Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile
Pro Gln Cys Ser Glu 195 200 205Val Glu Cys Met Thr Cys Asn Gly Glu
Ser Tyr Arg Gly Leu Met Asp 210 215 220His Thr Glu Ser Gly Lys Ile
Cys Gln Arg Trp Asp His Gln Thr Pro225 230 235 240His Arg His Lys
Phe Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255Asp Asn
Tyr Cys Arg Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265
270Thr Leu Asp Pro His Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys
275 280 285Glu Thr 2907723PRThomo sapiens 7Met Trp Val Thr Lys Leu
Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu Leu
Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg Arg
Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu Ile
Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn Thr
Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75
80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys
85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu
Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile
Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr
Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser
Ser Met Ile Pro His Glu His145 150 155 160Ser Tyr Arg Gly Lys Asp
Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg 165 170 175Gly Glu Glu Gly
Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu Val Arg 180 185 190Tyr Glu
Val Cys Asp Ile Pro Gln Cys Ser Glu Val Glu Cys Met Thr 195 200
205Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp His Thr Glu Ser Gly
210 215 220Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro His Arg His
Lys Phe225 230 235 240Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp
Asp Asn Tyr Cys Arg 245 250 255Asn Pro Asp Gly Gln Pro Arg Pro Trp
Cys Tyr Thr Leu Asp Pro His 260 265 270Thr Arg Trp Glu Tyr Cys Ala
Ile Lys Thr Cys Ala Asp Asn Thr Met 275 280 285Asn Asp Thr Asp Val
Pro Leu Glu Thr Thr Glu Cys Ile Gln Gly Gln 290 295 300Gly Glu Gly
Tyr Arg Gly Thr Val Asn Thr Ile Trp Asn Gly Ile Pro305 310 315
320Cys Gln Arg Trp Asp Ser Gln Tyr Pro His Glu His Asp Met Thr Pro
325 330 335Glu Asn Phe Lys Cys Lys Asp Leu Arg Glu Asn Tyr Cys Arg
Asn Pro 340 345 350Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr Asp
Pro Asn Ile Arg 355 360 365Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys
Asp Met Ser His Gly Gln 370 375 380Asp Cys Tyr Arg Gly Asn Gly Lys
Asn Tyr Met Gly Asn Leu Ser Gln385 390 395 400Thr Arg Ser Gly Leu
Thr Cys Ser Met Trp Asp Lys Asn Met Glu Asp 405 410 415Leu His Arg
His Ile Phe Trp Glu Pro Asp Ala Ser Lys Leu Asn Glu 420 425 430Asn
Tyr Cys Arg Asn Pro Asp Asp Asp Ala His Gly Pro Trp Cys Tyr 435 440
445Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys Pro Ile Ser Arg Cys
450 455 460Glu Gly Asp Thr Thr Pro Thr Ile Val Asn Leu Asp His Pro
Val Ile465 470 475 480Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val
Asn Gly Ile Pro Thr 485 490 495Arg Thr Asn Ile Gly Trp Met Val Ser
Leu Arg Tyr Arg Asn Lys His 500 505 510Ile Cys Gly Gly Ser Leu Ile
Lys Glu Ser Trp Val Leu Thr Ala Arg 515 520 525Gln Cys Phe Pro Ser
Arg Asp Leu Lys Asp Tyr Glu Ala Trp Leu Gly 530 535 540Ile His Asp
Val His Gly Arg Gly Asp Glu Lys Cys Lys Gln Val Leu545 550 555
560Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly Ser Asp Leu Val Leu
565 570 575Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp Phe Val Ser
Thr Ile 580 585 590Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu Lys
Thr Ser Cys Ser 595 600 605Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile
Asn Tyr Asp Gly Leu Leu 610 615 620Arg Val Ala His Leu Tyr Ile Met
Gly Asn Glu Lys Cys Ser Gln His625 630 635 640His Arg Gly Lys Val
Thr Leu Asn Glu Ser Glu Ile Cys Ala Gly Ala 645 650 655Glu Lys Ile
Gly Ser Gly Pro Cys Glu Gly Asp Tyr Gly Gly Pro Leu 660 665 670Val
Cys Glu Gln His Lys Met Arg Met Val Leu Gly Val Ile Val Pro 675 680
685Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly Ile Phe Val Arg Val
690 695 700Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile Ile Leu Thr Tyr
Lys Val705 710 715 720Pro Gln Ser8285PRThomo sapiens 8Met Trp Val
Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His
Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg
Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40
45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val
50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly
Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg
Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val
Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys
Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr
Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln
Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser Tyr Arg
Gly Lys Asp Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg 165 170 175Gly
Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu Val Arg 180 185
190Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu Val Glu Cys Met Thr
195 200 205Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp His Thr Glu
Ser Gly 210 215 220Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro His
Arg His Lys Phe225 230 235 240Leu Pro Glu Arg Tyr Pro Asp Lys Gly
Phe Asp Asp Asn Tyr Cys Arg 245 250 255Asn Pro Asp Gly Gln Pro Arg
Pro Trp Cys Tyr Thr Leu Asp Pro His 260 265 270Thr Arg Trp Glu Tyr
Cys Ala Ile Lys Thr Cys Glu Thr 275 280 2859210PRThomo sapiens 9Met
Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10
15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln
20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys
Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys
Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn
Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys
Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser
Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu
Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg
Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys
Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155 160Ser
Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170
175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser
180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys
Ser Glu 195 200 205Gly Lys 21010573PRThomo sapiens 10Met Leu Arg
Leu Pro Thr Val Phe Arg Gln Met Arg Pro Val Ser Arg1 5 10 15Val Leu
Ala Pro His Leu Thr Arg Ala Tyr Ala Lys Asp Val Lys Phe 20 25 30Gly
Ala Asp Ala Arg Ala Leu Met Leu Gln Gly Val Asp Leu Leu Ala 35 40
45Asp Ala Val Ala Val Thr Met Gly Pro Lys Gly Arg Thr Val Ile Ile
50 55 60Glu Gln Ser Trp Gly Ser Pro Lys Val Thr Lys Asp Gly Val Thr
Val65 70 75 80Ala Lys Ser Ile Asp Leu Lys Asp Lys Tyr Lys Asn Ile
Gly Ala Lys 85 90 95Leu Val Gln Asp Val Ala Asn Asn Thr Asn Glu Glu
Ala Gly Asp Gly 100 105 110Thr Thr Thr Ala Thr Val Leu Ala Arg Ser
Ile Ala Lys Glu Gly Phe 115 120 125Glu Lys Ile Ser Lys Gly Ala Asn
Pro Val Glu Ile Arg Arg Gly Val 130 135 140Met Leu Ala Val Asp Ala
Val Ile Ala Glu Leu Lys Lys Gln Ser Lys145 150 155 160Pro Val Thr
Thr Pro Glu Glu Ile Ala Gln Val Ala Thr Ile Ser Ala 165 170 175Asn
Gly Asp Lys Glu Ile Gly Asn Ile Ile Ser Asp Ala Met Lys Lys 180 185
190Val Gly Arg Lys Gly Val Ile Thr Val Lys Asp Gly Lys Thr Leu Asn
195 200 205Asp Glu Leu Glu Ile Ile Glu Gly Met Lys Phe Asp Arg Gly
Tyr Ile 210 215 220Ser Pro Tyr Phe Ile Asn Thr Ser Lys Gly Gln Lys
Cys Glu Phe Gln225 230 235 240Asp Ala Tyr Val Leu Leu Ser Glu Lys
Lys Ile Ser Ser Ile Gln Ser 245 250 255Ile Val Pro Ala Leu Glu Ile
Ala Asn Ala His Arg Lys Pro Leu Val 260 265 270Ile Ile Ala Glu Asp
Val Asp Gly Glu Ala Leu Ser Thr Leu Val Leu 275 280 285Asn Arg Leu
Lys Val Gly Leu Gln Val Val Ala Val Lys Ala Pro Gly 290 295 300Phe
Gly Asp Asn Arg Lys Asn Gln Leu Lys Asp Met Ala Ile Ala Thr305 310
315 320Gly Gly Ala Val Phe Gly Glu Glu Gly Leu Thr Leu Asn Leu Glu
Asp 325 330 335Val Gln Pro His Asp Leu Gly Lys Val Gly Glu Val Ile
Val Thr Lys 340 345 350Asp Asp Ala Met Leu Leu Lys Gly Lys Gly Asp
Lys Ala Gln Ile Glu 355 360 365Lys Arg Ile Gln Glu Ile Ile Glu Gln
Leu Asp Val Thr Thr Ser Glu 370 375 380Tyr Glu Lys Glu Lys Leu Asn
Glu Arg Leu Ala Lys Leu Ser Asp Gly385 390 395 400Val Ala Val Leu
Lys Val Gly Gly Thr Ser Asp Val Glu Val Asn Glu 405 410 415Lys Lys
Asp Arg Val Thr Asp Ala Leu Asn Ala Thr Arg Ala Ala Val 420 425
430Glu Glu Gly Ile Val Leu Gly Gly Gly Cys Ala Leu Leu Arg Cys Ile
435 440 445Pro Ala Leu Asp Ser Leu Thr Pro Ala Asn Glu Asp Gln Lys
Ile Gly 450 455 460Ile Glu Ile Ile Lys Arg Thr Leu Lys Ile Pro Ala
Met Thr Ile Ala465 470 475 480Lys Asn Ala Gly Val Glu Gly Ser Leu
Ile Val Glu Lys Ile Met Gln 485 490 495Ser Ser Ser Glu Val Gly Tyr
Asp Ala Met Ala Gly Asp Phe Val Asn 500 505 510Met Val Glu Lys Gly
Ile Ile Asp Pro Thr Lys Val Val Arg Thr Ala 515 520 525Leu Leu Asp
Ala Ala Gly Val Ala Ser Leu Leu Thr Thr Ala Glu Val 530 535 540Val
Val Thr Glu Ile Pro Lys Glu Glu Lys Asp Pro Gly Met Gly Ala545 550
555 560Met Gly Gly Met Gly Gly Gly Met Gly Gly Gly Met Phe 565
57011573PRThomo sapiens
11Met Leu Arg Leu Pro Thr Val Phe Arg Gln Met Arg Pro Val Ser Arg1
5 10 15Val Leu Ala Pro His Leu Thr Arg Ala Tyr Ala Lys Asp Val Lys
Phe 20 25 30Gly Ala Asp Ala Arg Ala Leu Met Leu Gln Gly Val Asp Leu
Leu Ala 35 40 45Asp Ala Val Ala Val Thr Met Gly Pro Lys Gly Arg Thr
Val Ile Ile 50 55 60Glu Gln Ser Trp Gly Ser Pro Lys Val Thr Lys Asp
Gly Val Thr Val65 70 75 80Ala Lys Ser Ile Asp Leu Lys Asp Lys Tyr
Lys Asn Ile Gly Ala Lys 85 90 95Leu Val Gln Asp Val Ala Asn Asn Thr
Asn Glu Glu Ala Gly Asp Gly 100 105 110Thr Thr Thr Ala Thr Val Leu
Ala Arg Ser Ile Ala Lys Glu Gly Phe 115 120 125Glu Lys Ile Ser Lys
Gly Ala Asn Pro Val Glu Ile Arg Arg Gly Val 130 135 140Met Leu Ala
Val Asp Ala Val Ile Ala Glu Leu Lys Lys Gln Ser Lys145 150 155
160Pro Val Thr Thr Pro Glu Glu Ile Ala Gln Val Ala Thr Ile Ser Ala
165 170 175Asn Gly Asp Lys Glu Ile Gly Asn Ile Ile Ser Asp Ala Met
Lys Lys 180 185 190Val Gly Arg Lys Gly Val Ile Thr Val Lys Asp Gly
Lys Thr Leu Asn 195 200 205Asp Glu Leu Glu Ile Ile Glu Gly Met Lys
Phe Asp Arg Gly Tyr Ile 210 215 220Ser Pro Tyr Phe Ile Asn Thr Ser
Lys Gly Gln Lys Cys Glu Phe Gln225 230 235 240Asp Ala Tyr Val Leu
Leu Ser Glu Lys Lys Ile Ser Ser Ile Gln Ser 245 250 255Ile Val Pro
Ala Leu Glu Ile Ala Asn Ala His Arg Lys Pro Leu Val 260 265 270Ile
Ile Ala Glu Asp Val Asp Gly Glu Ala Leu Ser Thr Leu Val Leu 275 280
285Asn Arg Leu Lys Val Gly Leu Gln Val Val Ala Val Lys Ala Pro Gly
290 295 300Phe Gly Asp Asn Arg Lys Asn Gln Leu Lys Asp Met Ala Ile
Ala Thr305 310 315 320Gly Gly Ala Val Phe Gly Glu Glu Gly Leu Thr
Leu Asn Leu Glu Asp 325 330 335Val Gln Pro His Asp Leu Gly Lys Val
Gly Glu Val Ile Val Thr Lys 340 345 350Asp Asp Ala Met Leu Leu Lys
Gly Lys Gly Asp Lys Ala Gln Ile Glu 355 360 365Lys Arg Ile Gln Glu
Ile Ile Glu Gln Leu Asp Val Thr Thr Ser Glu 370 375 380Tyr Glu Lys
Glu Lys Leu Asn Glu Arg Leu Ala Lys Leu Ser Asp Gly385 390 395
400Val Ala Val Leu Lys Val Gly Gly Thr Ser Asp Val Glu Val Asn Glu
405 410 415Lys Lys Asp Arg Val Thr Asp Ala Leu Asn Ala Thr Arg Ala
Ala Val 420 425 430Glu Glu Gly Ile Val Leu Gly Gly Gly Cys Ala Leu
Leu Arg Cys Ile 435 440 445Pro Ala Leu Asp Ser Leu Thr Pro Ala Asn
Glu Asp Gln Lys Ile Gly 450 455 460Ile Glu Ile Ile Lys Arg Thr Leu
Lys Ile Pro Ala Met Thr Ile Ala465 470 475 480Lys Asn Ala Gly Val
Glu Gly Ser Leu Ile Val Glu Lys Ile Met Gln 485 490 495Ser Ser Ser
Glu Val Gly Tyr Asp Ala Met Ala Gly Asp Phe Val Asn 500 505 510Met
Val Glu Lys Gly Ile Ile Asp Pro Thr Lys Val Val Arg Thr Ala 515 520
525Leu Leu Asp Ala Ala Gly Val Ala Ser Leu Leu Thr Thr Ala Glu Val
530 535 540Val Val Thr Glu Ile Pro Lys Glu Glu Lys Asp Pro Gly Met
Gly Ala545 550 555 560Met Gly Gly Met Gly Gly Gly Met Gly Gly Gly
Met Phe 565 570122057DNAhomo sapiens 12atattgtgct tccaccactg
ccaataacaa aataactagc aaccatgaag tgggtggaat 60caattttttt aattttccta
ctaaatttta ctgaatccag aacactgcat agaaatgaat 120atggaatagc
ttccatattg gattcttacc aatgtactgc agagataagt ttagctgacc
180tggctaccat attttttgcc cagtttgttc aagaagccac ttacaaggaa
gtaagcaaaa 240tggtgaaaga tgcattgact gcaattgaga aacccactgg
agatgaacag tcttcagggt 300gtttagaaaa ccagctacct gcctttctgg
aagaactttg ccatgagaaa gaaattttgg 360agaagtacgg acattcagac
tgctgcagcc aaagtgaaga gggaagacat aactgttttc 420ttgcacacaa
aaagcccact ccagcatcga tcccactttt ccaagttcca gaacctgtca
480caagctgtga agcatatgaa gaagacaggg agacattcat gaacaaattc
atttatgaga 540tagcaagaag gcatcccttc ctgtatgcac ctacaattct
tctttgggct gctcgctatg 600acaaaataat tccatcttgc tgcaaagctg
aaaatgcagt tgaatgcttc caaacaaagg 660cagcaacagt tacaaaagaa
ttaagagaaa gcagcttgtt aaatcaacat gcatgtgcag 720taatgaaaaa
ttttgggacc cgaactttcc aagccataac tgttactaaa ctgagtcaga
780agtttaccaa agttaatttt actgaaatcc agaaactagt cctggatgtg
gcccatgtac 840atgagcactg ttgcagagga gatgtgctgg attgtctgca
ggatggggaa aaaatcatgt 900cctacatatg ttctcaacaa gacactctgt
caaacaaaat aacagaatgc tgcaaactga 960ccacgctgga acgtggtcaa
tgtataattc atgcagaaaa tgatgaaaaa cctgaaggtc 1020tatctccaaa
tctaaacagg tttttaggag atagagattt taaccaattt tcttcagggg
1080aaaaaaatat cttcttggca agttttgttc atgaatattc aagaagacat
cctcagcttg 1140ctgtctcagt aattctaaga gttgctaaag gataccagga
gttattggag aagtgtttcc 1200agactgaaaa ccctcttgaa tgccaagata
aaggagaaga agaattacag aaatacatcc 1260aggagagcca agcattggca
aagcgaagct gcggcctctt ccagaaacta ggagaatatt 1320acttacaaaa
tgcgtttctc gttgcttaca caaagaaagc cccccagctg acctcgtcgg
1380agctgatggc catcaccaga aaaatggcag ccacagcagc cacttgttgc
caactcagtg 1440aggacaaact attggcctgt ggcgagggag cggctgacat
tattatcgga cacttatgta 1500tcagacatga aatgactcca gtaaaccctg
gtgttggcca gtgctgcact tcttcatatg 1560ccaacaggag gccatgcttc
agcagcttgg tggtggatga aacatatgtc cctcctgcat 1620tctctgatga
caagttcatt ttccataagg atctgtgcca agctcagggt gtagcgctgc
1680aaacgatgaa gcaagagttt ctcattaacc ttgtgaagca aaagccacaa
ataacagagg 1740aacaacttga ggctgtcatt gcagatttct caggcctgtt
ggagaaatgc tgccaaggcc 1800aggaacagga agtctgcttt gctgaagagg
gacaaaaact gatttcaaaa actcgtgctg 1860ctttgggagt ttaaattact
tcaggggaag agaagacaaa acgagtcttt cattcggtgt 1920gaacttttct
ctttaatttt aactgattta acactttttg tgaattaatg aaatgataaa
1980gacttttatg tgagatttcc ttatcacaga aataaaatat ctccaaatgt
ttccttttca 2040aaaaaaaaaa aaaaaaa 2057132099DNAhomo sapiens
13aatcactgct gtgcagggca ggaaagctcc acacacacag cccagcaaac agcagcacgc
60tgctgaaaaa aagactcaga ggagagagat aaggaaggaa agtagtgatg gatctcatcc
120caaacttggc cgtggaaacc tggcttctcc tggctgtcag cctgatactc
ctctatctat 180atggaacccg tacacatgga ctttttaaga agcttggaat
tccagggccc acacctctgc 240cttttttggg aaatgctttg tccttccgta
agggctattg gacgtttgac atggaatgtt 300ataaaaagta tagaaaagtc
tggggtattt atgactgtca acagcctatg ctggctatca 360cagatcccga
catgatcaaa acagtgctag tgaaagaatg ttattctgtc ttcacaaacc
420ggaggccttt cgggccagtg ggatttatga aaaatgccat ctctatagct
gaggatgaag 480aatggaagag aatacgatca ttgctgtctc caacattcac
cagcggaaaa ctcaaggaga 540tggtccctat cattgcccag tatggagatg
tgttggtgag aaatctgagg cgggaagcag 600agacaggcaa gcctgtcacc
ttgaaacacg tctttggggc ctacagcatg gatgtgatca 660ctagcacatc
atttggagtg agcatcgact ctctcaacaa tccacaagac ccctttgtgg
720aaaacaccaa gaagctttta agatttaatc cattagatcc attcgttctc
tcaataaaag 780tctttccatt ccttacccca attcttgaag cattaaatat
cactgtgttt ccaagaaaag 840ttataagttt tctaacaaaa tctgtaaaac
agataaaaga aggtcgcctc aaagagacac 900aaaagcaccg agtggatttc
cttcagctga tgattgactc tcagaattca aaagactctg 960agacccacaa
agctctgtct gatctggagc tcatggccca atcaattatc tttatttttg
1020ctggctatga aaccacgagc agtgttctct ccttcattat atatgaactg
gccactcacc 1080ctgatgtcca gcagaaagtg cagaaggaaa ttgatacagt
tttacccaat aaggcaccac 1140ccacctatga tactgtgcta cagttggagt
atcttgacat ggtggtgaat gaaacactca 1200gattattccc agttgctatg
agacttgaga gggtctgcaa aaaagatgtt gaaatcaatg 1260ggatgtttat
tcccaaaggg gtggtggtga tgattccaag ctatgttctt catcatgacc
1320caaagtactg gacagagcct gagaagttcc tccctgaaag gttcagtaaa
aagaacaagg 1380acaacataga tccttacata tacacaccct ttggaagtgg
acccagaaac tgcattggca 1440tgaggtttgc tctcgtgaac atgaaacttg
ctctagtcag agtccttcag aacttctcct 1500tcaaaccttg taaagaaaca
cagatccccc tgaaattacg ctttggagga cttcttctaa 1560cagaaaaacc
cattgttcta aaggctgagt caagggatga gaccgtaagt ggagcctgat
1620ttccctaagg acttctggtt tgctctttaa gaaagctgtg ccccagaaca
ccagagacct 1680caaattactt tacaaataga accctgaaat gaagacgggc
ttcatccaat gtgctgcata 1740aataatcagg gattctgtac gtgcattgtg
ctctctcatg gtctgtatag agtgttatac 1800ttggtaatat agaggagatg
accaaatcag tgctggggaa gtagatttgg cttctctgct 1860tctcatagga
ctatctccac cacccccagt tagcaccatt aactcctcct gagctctgat
1920aacataatta acatttctca ataatttcaa ccacaatcat taataaaaat
aggaattatt 1980ttgatggctc taacagtgac atttatatca tgtgttatat
ctgtagtatt ctatagtaag 2040ctttatatta agcaaatcaa taaaaacctc
tttacaaaag taaaaaaaaa aaaaaaaaa 2099142789DNAhomo sapiens
14aatcactgct gtgcagggca ggaaagctcc atgcacatag cccagcaaag agcaacacag
60agctgaaagg aagactcaga ggagagagat aagtaaggaa agtagtgatg gctctcatcc
120cagacttggc catggaaacc tggcttctcc tggctgtcag cctggtgctc
ctctatctat 180atggaaccca ttcacatgga ctttttaaga agcttggaat
tccagggccc acacctctgc 240cttttttggg aaatattttg tcctaccata
agggcttttg tatgtttgac atggaatgtc 300ataaaaagta tggaaaagtg
tggggctttt atgatggtca acagcctgtg ctggctatca 360cagatcctga
catgatcaaa acagtgctag tgaaagaatg ttattctgtc ttcacaaacc
420ggaggccttt tggtccagtg ggatttatga aaagtgccat ctctatagct
gaggatgaag 480aatggaagag attacgatca ttgctgtctc caaccttcac
cagtggaaaa ctcaaggaga 540tggtccctat cattgcccag tatggagatg
tgttggtgag aaatctgagg cgggaagcag 600agacaggcaa gcctgtcacc
ttgaaagacg tctttggggc ctacagcatg gatgtgatca 660ctagcacatc
atttggagtg aacatcgact ctctcaacaa tccacaagac ccctttgtgg
720aaaacaccaa gaagctttta agatttgatt ttttggatcc attctttctc
tcaataatct 780ttccattcct catcccaatt cttgaagtat taaatatctg
tgtgtttcca agagaagtta 840caaatttttt aagaaaatct gtaaaaagga
tgaaagaaag tcgcctcgaa gatacacaaa 900agcaccgagt ggatttcctt
cagctgatga ttgactctca gaattcaaaa gaaactgagt 960cccacaaagc
tctgtccgat ctggagctcg tggcccaatc aattatcttt atttttgctg
1020gctatgaaac cacgagcagt gttctctcct tcattatgta tgaactggcc
actcaccctg 1080atgtccagca gaaactgcag gaggaaattg atgcagtttt
acccaataag gcaccaccca 1140cctatgatac tgtgctacag atggagtatc
ttgacatggt ggtgaatgaa acgctcagat 1200tattcccaat tgctatgaga
cttgagaggg tctgcaaaaa agatgttgag atcaatggga 1260tgttcattcc
caaaggggtg gtggtgatga ttccaagcta tgctcttcac cgtgacccaa
1320agtactggac agagcctgag aagttcctcc ctgaaagatt cagcaagaag
aacaaggaca 1380acatagatcc ttacatatac acaccctttg gaagtggacc
cagaaactgc attggcatga 1440ggtttgctct catgaacatg aaacttgctc
taatcagagt ccttcagaac ttctccttca 1500aaccttgtaa agaaacacag
atccccctga aattaagctt aggaggactt cttcaaccag 1560aaaaacccgt
tgttctaaag gttgagtcaa gggatggcac cgtaagtgga gcctgaattt
1620tcctaaggac ttctgctttg ctcttcaaga aatctgtgcc tgagaacacc
agagacctca 1680aattactttg tgaatagaac tctgaaatga agatgggctt
catccaatgg actgcataaa 1740taaccgggga ttctgtacat gcattgagct
ctctcattgt ctgtgtagag tgttatactt 1800gggaatataa aggaggtgac
caaatcagtg tgaggaggta gatttggctc ctctgcttct 1860cacgggacta
tttccaccac ccccagttag caccattaac tcctcctgag ctctgataag
1920agaatcaaca tttctcaata atttcctcca caaattatta atgaaaataa
gaattatttt 1980gatggctcta acaatgacat ttatatcaca tgttttctct
ggagtattct ataagtttta 2040tgttaaatca ataaagacca ctttacaaaa
gtattatcag atgctttcct gcacattaag 2100gagaaatcta tagaactgaa
tgagaaccaa caagtaaata tttttggtca ttgtaatcac 2160tgttggcgtg
gggcctttgt cagaactaga atttgattat taacataggt gaaagttaat
2220ccactgtgac tttgcccatt gtttagaaag aatattcata gtttaattat
gccttttttg 2280atcaggcaca gtggctcacg cctgtaatcc tagcagtttg
ggaggctgag ccgggtggat 2340cgcctgaggt caggagttca agacaagcct
ggcctacatg gttgaaaccc catctctact 2400aaaaatacac aaattagcta
ggcatggtgg actcgcctgt aatctcacta cacaggaggc 2460tgaggcagga
gaatcacttg aacctgggag gcggatgttg aagtgagctg agattgcacc
2520actgcactcc agtctgggtg agagtgagac tcagtcttaa aaaaatatgc
ctttttgaag 2580cacgtacatt ttgtaacaaa gaactgaagc tcttattata
ttattagttt tgatttaatg 2640ttttcagccc atctcctttc atatttctgg
gagacagaaa acatgtttcc ctacacctct 2700tgcattccat cctcaacacc
caactgtctc gatgcaatga acacttaata aaaaacagtc 2760gattggtcaa
ttgattgagc aataagcct 2789152792DNAhomo sapiens 15aatcactgct
gtgcagggca ggaaagctcc atgcacatag cccagcaaag agcaacacag 60agctgaaagg
aagactcaga ggagagagat aagtaaggaa agtagtgatg gctctcatcc
120cagacttggc catggaaacc tggcttctcc tggctgtcag cctggtgctc
ctctatctat 180atggaaccca ttcacatgga ctttttaaga agcttggaat
tccagggccc acacctctgc 240cttttttggg aaatattttg tcctaccata
agggcttttg tatgtttgac atggaatgtc 300ataaaaagta tggaaaagtg
tggggctttt atgatggtca acagcctgtg ctggctatca 360cagatcctga
catgatcaaa acagtgctag tgaaagaatg ttattctgtc ttcacaaacc
420ggaggccttt tggtccagtg ggatttatga aaagtgccat ctctatagct
gaggatgaag 480aatggaagag attacgatca ttgctgtctc caaccttcac
cagtggaaaa ctcaaggaga 540tggtccctat cattgcccag tatggagatg
tgttggtgag aaatctgagg cgggaagcag 600agacaggcaa gcctgtcacc
ttgaaagacg tctttggggc ctacagcatg gatgtgatca 660ctagcacatc
atttggagtg aacatcgact ctctcaacaa tccacaagac ccctttgtgg
720aaaacaccaa gaagctttta agatttgatt ttttggatcc attctttctc
tcaataacag 780tctttccatt cctcatccca attcttgaag tattaaatat
ctgtgtgttt ccaagagaag 840ttacaaattt tttaagaaaa tctgtaaaaa
ggatgaaaga aagtcgcctc gaagatacac 900aaaagcaccg agtggatttc
cttcagctga tgattgactc tcagaattca aaagaaactg 960agtcccacaa
agctctgtcc gatctggagc tcgtggccca atcaattatc tttatttttg
1020ctggctatga aaccacgagc agtgttctct ccttcattat gtatgaactg
gccactcacc 1080ctgatgtcca gcagaaactg caggaggaaa ttgatgcagt
tttacccaat aaggcaccac 1140ccacctatga tactgtgcta cagatggagt
atcttgacat ggtggtgaat gaaacgctca 1200gattattccc aattgctatg
agacttgaga gggtctgcaa aaaagatgtt gagatcaatg 1260ggatgttcat
tcccaaaggg gtggtggtga tgattccaag ctatgctctt caccgtgacc
1320caaagtactg gacagagcct gagaagttcc tccctgaaag attcagcaag
aagaacaagg 1380acaacataga tccttacata tacacaccct ttggaagtgg
acccagaaac tgcattggca 1440tgaggtttgc tctcatgaac atgaaacttg
ctctaatcag agtccttcag aacttctcct 1500tcaaaccttg taaagaaaca
cagatccccc tgaaattaag cttaggagga cttcttcaac 1560cagaaaaacc
cgttgttcta aaggttgagt caagggatgg caccgtaagt ggagcctgaa
1620ttttcctaag gacttctgct ttgctcttca agaaatctgt gcctgagaac
accagagacc 1680tcaaattact ttgtgaatag aactctgaaa tgaagatggg
cttcatccaa tggactgcat 1740aaataaccgg ggattctgta catgcattga
gctctctcat tgtctgtgta gagtgttata 1800cttgggaata taaaggaggt
gaccaaatca gtgtgaggag gtagatttgg ctcctctgct 1860tctcacggga
ctatttccac cacccccagt tagcaccatt aactcctcct gagctctgat
1920aagagaatca acatttctca ataatttcct ccacaaatta ttaatgaaaa
taagaattat 1980tttgatggct ctaacaatga catttatatc acatgttttc
tctggagtat tctataagtt 2040ttatgttaaa tcaataaaga ccactttaca
aaagtattat cagatgcttt cctgcacatt 2100aaggagaaat ctatagaact
gaatgagaac caacaagtaa atatttttgg tcattgtaat 2160cactgttggc
gtggggcctt tgtcagaact agaatttgat tattaacata ggtgaaagtt
2220aatccactgt gactttgccc attgtttaga aagaatattc atagtttaat
tatgcctttt 2280ttgatcaggc acagtggctc acgcctgtaa tcctagcagt
ttgggaggct gagccgggtg 2340gatcgcctga ggtcaggagt tcaagacaag
cctggcctac atggttgaaa ccccatctct 2400actaaaaata cacaaattag
ctaggcatgg tggactcgcc tgtaatctca ctacacagga 2460ggctgaggca
ggagaatcac ttgaacctgg gaggcggatg ttgaagtgag ctgagattgc
2520accactgcac tccagtctgg gtgagagtga gactcagtct taaaaaaata
tgcctttttg 2580aagcacgtac attttgtaac aaagaactga agctcttatt
atattattag ttttgattta 2640atgttttcag cccatctcct ttcatatttc
tgggagacag aaaacatgtt tccctacacc 2700tcttgcattc catcctcaac
acccaactgt ctcgatgcaa tgaacactta ataaaaaaca 2760gtcgattggt
caattgattg agcaataagc ct 2792166002DNAhomo sapiens 16gaggaaagga
gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc
agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat
120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag
gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag
cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg
tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga
caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac
taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga
420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca
ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg
gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg
aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt
aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa
atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt
720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga
ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta
cgaagtctgt gacattcctc 840agtgttcaga agttgaatgc atgacctgca
atggggagag ttatcgaggt ctcatggatc 900atacagaatc aggcaagatt
tgtcagcgct gggatcatca gacaccacac cggcacaaat 960tcttgcctga
aagatatccc gacaagggct ttgatgataa ttattgccgc aatcccgatg
1020gccagccgag gccatggtgc tatactcttg accctcacac ccgctgggag
tactgtgcaa 1080ttaaaacatg cgctgacaat actatgaatg acactgatgt
tcctttggaa acaactgaat 1140gcatccaagg tcaaggagaa ggctacaggg
gcactgtcaa taccatttgg aatggaattc 1200catgtcagcg ttgggattct
cagtatcctc acgagcatga catgactcct gaaaatttca 1260agtgcaagga
cctacgagaa aattactgcc gaaatccaga tgggtctgaa tcaccctggt
1320gttttaccac tgatccaaac atccgagttg gctactgctc ccaaattcca
aactgtgata 1380tgtcacatgg acaagattgt tatcgtggga atggcaaaaa
ttatatgggc aacttatccc 1440aaacaagatc tggactaaca tgttcaatgt
gggacaagaa catggaagac ttacatcgtc 1500atatcttctg ggaaccagat
gcaagtaagc tgaatgagaa ttactgccga aatccagatg 1560atgatgctca
tggaccctgg tgctacacgg gaaatccact cattccttgg gattattgcc
1620ctatttctcg ttgtgaaggt
gataccacac ctacaatagt caatttagac catcccgtaa 1680tatcttgtgc
caaaacgaaa caattgcgag ttgtaaatgg gattccaaca cgaacaaaca
1740taggatggat ggttagtttg agatacagaa ataaacatat ctgcggagga
tcattgataa 1800aggagagttg ggttcttact gcacgacagt gtttcccttc
tcgagacttg aaagattatg 1860aagcttggct tggaattcat gatgtccacg
gaagaggaga tgagaaatgc aaacaggttc 1920tcaatgtttc ccagctggta
tatggccctg aaggatcaga tctggtttta atgaagcttg 1980ccaggcctgc
tgtcctggat gattttgtta gtacgattga tttacctaat tatggatgca
2040caattcctga aaagaccagt tgcagtgttt atggctgggg ctacactgga
ttgatcaact 2100atgatggcct attacgagtg gcacatctct atataatggg
aaatgagaaa tgcagccagc 2160atcatcgagg gaaggtgact ctgaatgagt
ctgaaatatg tgctggggct gaaaagattg 2220gatcaggacc atgtgagggg
gattatggtg gcccacttgt ttgtgagcaa cataaaatga 2280gaatggttct
tggtgtcatt gttcctggtc gtggatgtgc cattccaaat cgtcctggta
2340tttttgtccg agtagcatat tatgcaaaat ggatacacaa aattatttta
acatataagg 2400taccacagtc atagctgaag taagtgtgtc tgaagcaccc
accaatacaa ctgtctttta 2460catgaagatt tcagagaatg tggaatttaa
aatgtcactt acaacaatcc taagacaact 2520actggagagt catgtttgtt
gaaattctca ttaatgttta tgggtgtttt ctgttgtttt 2580gtttgtcagt
gttattttgt caatgttgaa gtgaattaag gtacatgcaa gtgtaataac
2640atatctcctg aagatacttg aatggattaa aaaaacacac aggtatattt
gctggatgat 2700aaagatttca tgggaaaaaa aatcaattaa tctgtctaag
ctgctttctg atgttggttt 2760cttaataatg agtaaaccac aaattaaatg
ttattttaac ctcaccaaaa caatttatac 2820cttgtgtccc taaattgtag
ccctatatta aattatatta catttcatat gctatatgtt 2880atagttcatt
catttctctt caccatgtat cctgcaatac tggtacacga acacactttt
2940tacaaaacca catacccatg tacacatgcc taggtacaca tgtgcatgca
ctacagttta 3000aattatggtg tacctaatgt aacccctaaa tattttagaa
gtatgtacct atagttttac 3060ctcaaaaaaa ccagaaatct ctaaagacca
gtagaaatat taaaaaatga tgcaagatca 3120aaatgattag ctaattctcc
atacataatc tgcagatgat cttctttggt tggcatttca 3180ggtgtggcca
tcacccagag ttaaataaca cctaatctag gtgtttacat gtattcatta
3240tcctagttat ttcatgtagt ttctaattct taaaggaaag agggtaatag
ttctatttgt 3300gtaatttgtt tcctccaaac ttaaggccac ttatttacac
aagatatttg tagatctatt 3360ttcctaaagc atttcttaag tgctcagatc
agtatctaat tgaagaagtt taaaagtgtt 3420ttggtcatta aaaatgtact
taaataggtt aaatctaagc cttgctgctg tgattggctt 3480ctagctcact
gcctttaaat tttaaaaaat ttaagaggaa aatttccaag tctccaaagt
3540tttataaata cccttcatca agtcatgcat taaagtatat attggagaaa
aaaataaaaa 3600tacttttctc aacctggaag attttagcct aataaagctt
ttttgaagta aaagacaact 3660tgtaaaagga aagaaactag tttgtctcaa
ctctgtattc atttattttt tttttgaagt 3720agagtggaat ctgttgaatc
agatatttta tcaagatatg tttatttttt cttatttcat 3780tttacaaagt
tcactcctaa tgccatatgt aacagacatt taaattttgt gttctgtata
3840acagccaaat tatcatattt atcattgtat ttgtcatgct tagctaaaga
tcatgtattt 3900gttgagaaat agaataacaa aaagtaatag gataggcttt
gaatttttgc agaaatcttc 3960ctgtacaaaa cacctttaaa aataattttt
tgaatggtgt gaatccagta gtcccatttc 4020tctgacttag ttttcttgag
tgatttttat caaggccaag tccccaaaca attccctacc 4080agctctttag
agtactgttc aatctggact aaaatggttt taagtttatg gagagcttag
4140tccacagaat atagggcggc gagtccagaa atgcttatac aatttttttt
tcataataag 4200atatgtgctg gcatcaagaa acttaaagtg gaagcaaaaa
gacatccaac tagttgctgg 4260tctctatcat cttatctgat ggtatttcta
ttttccttat ataatacacc attttagtaa 4320gaactcctag aaatttcaag
agcatattgc caaaatataa agtatatttc atagtttctt 4380ctggctgaac
cagtgaaatt ttattattgc atattaatga tatttgtaaa acttttataa
4440aaattgtcat aattttaaat actcacattt taaaaatact tctttaatga
ctcttcctct 4500aaatttcctg gaaatacaga taaagattag ctagatacaa
gatacagcta agtatttaga 4560cattttgagg ctagtatttt tcattttatt
aaaggctaaa aacaatacca ccaataaatc 4620atcaaacaaa ccgtacaaag
taattctctc tttgggaggc tcctttcgtg atagagggac 4680atgggtggaa
ttgacaatga aacttagatg aacaaggtcc atgttatttt aggtggtaga
4740acagggtaga gtcatgtcat tatttgctgg tggaagacac tatttaccag
gtgttctttg 4800ctgaataaat cattaaacat ttttaaaaat ccaacaatcc
actttatttt gtgtcattga 4860caaaaggatc ttttaaatca gaaggtttca
atgcaatttt tggtttggct gtttgaataa 4920tggttatgta ctgttataat
tgtagacatt ttctcacgtc taccaggaat tgaagtgtaa 4980aactaaaata
tttttcataa tgcctctgcc gtgcagaagg aatgataatc cttttgtata
5040cttctttaat tttattgtaa aatgtgtaat gacttttacc tatatgctgt
gggcaggtcc 5100tcagtaaaat ctattgagtc aatttctagt attaacaggc
ttttgcttgc tatctaagtg 5160tttcaaatta tgggaagtgt gagacactgg
aaggcaagaa aattaacaat aatggcatgt 5220gatagcaaaa ttgtatttca
cttattcctg tgaatatttc ttgttggtac caatggtact 5280gtacaaagtg
aatgttatag ccacaacatt ctcttgaaaa gaacactgtc aagaagtggg
5340aaattgctgt caggcatttc attgttgttt ttaaactttt ttaaaagaaa
tactggtttt 5400gcaatataga gatcatgtgg taaagaattt taataagatc
ttatactaaa aagccttaaa 5460tcaatttatt gagattcaaa aaatactatt
ataattaatt acatcccata catataggca 5520aactcattta aaaaataaaa
ctaattttgg taaaagtaca tggcctttgt ttttaaaata 5580cataatttta
aaataaatca cttgtcatga taaagtccaa aaagaagtta tcattcaaca
5640ttcaactaag gttggagcta agaatttact aatacaaaaa aagttaaaat
tttttggacc 5700atatatatct tgacagtgta acttttaagt aggttcattt
ccatttgcac agaaagtttc 5760tgtctttagg aaactgaaaa tgaaatactg
tggatgctat gactgtttgt cttgtatgta 5820aataggaaat taataagctg
cctattgagt ggtatagctg tatgcttacc caaaaaaggg 5880aacactgtgg
ttatgacttg tattataaac tttctgtagt taataaagtt gttattttta
5940taaccatgat tatattatta ttattaataa aatattttat caaaatgaaa
aaaaaaaaaa 6000aa 6002171369DNAhomo sapiens 17gaggaaagga gggggctgga
agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat
ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc
tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca
180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg
tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca
tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa
gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc
aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga
ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca
480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc
aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct
ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca
gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc
tggagttcca tgataccaca cgaacacagc tttttgcctt 720cgagctatcg
gggtaaagac ctacaggaaa actactgtcg aaatcctcga ggggaagaag
780ggggaccctg gtgtttcaca agcaatccag aggtacgcta cgaagtctgt
gacattcctc 840agtgttcaga agttgaatgc atgacctgca atggggagag
ttatcgaggt ctcatggatc 900atacagaatc aggcaagatt tgtcagcgct
gggatcatca gacaccacac cggcacaaat 960tcttgcctga aagatatccc
gacaagggct ttgatgataa ttattgccgc aatcccgatg 1020gccagccgag
gccatggtgc tatactcttg accctcacac ccgctgggag tactgtgcaa
1080ttaaaacatg cgagacataa catgggctct caactgatgg tgaacttctt
ctggtgagtg 1140acagaggctg cagtgaagaa taatgagtct aatagaagtt
tatcacagat gtctctaatc 1200tttatagctg atccctacct ctctcgctgt
ctttgtaccc agcctgcatt ctgtttcgat 1260ctgtctttta gcagtccata
caatcatttt tctacatgct ggcccttacc tagcttttct 1320gaatttacaa
taaaaactat tttttaacgt gaaaaaaaaa aaaaaaaaa 1369185987DNAhomo
sapiens 18gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt
cttaccgtaa 60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc
tcatcgcaat 120aaaaagcagc tcagagccga ctggctcttt taggcactga
ctccgaacag gattctttca 180cccaggcatc tcctccagag ggatccgcca
gcccgtccag cagcaccatg tgggtgacca 240aactcctgcc agccctgctg
ctgcagcatg tcctcctgca tctcctcctg ctccccatcg 300ccatccccta
tgcagaggga caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat
360cagcaaagac taccctaatc aaaatagatc cagcactgaa gataaaaacc
aaaaaagtga 420atactgcaga ccaatgtgct aatagatgta ctaggaataa
aggacttcca ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac
aatgcctctg gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa
tttggccatg aatttgacct ctatgaaaac aaagactaca 600ttagaaactg
catcattggt aaaggacgca gctacaaggg aacagtatct atcactaaga
660gtggcatcaa atgtcagccc tggagttcca tgataccaca cgaacacagc
tatcggggta 720aagacctaca ggaaaactac tgtcgaaatc ctcgagggga
agaaggggga ccctggtgtt 780tcacaagcaa tccagaggta cgctacgaag
tctgtgacat tcctcagtgt tcagaagttg 840aatgcatgac ctgcaatggg
gagagttatc gaggtctcat ggatcataca gaatcaggca 900agatttgtca
gcgctgggat catcagacac cacaccggca caaattcttg cctgaaagat
960atcccgacaa gggctttgat gataattatt gccgcaatcc cgatggccag
ccgaggccat 1020ggtgctatac tcttgaccct cacacccgct gggagtactg
tgcaattaaa acatgcgctg 1080acaatactat gaatgacact gatgttcctt
tggaaacaac tgaatgcatc caaggtcaag 1140gagaaggcta caggggcact
gtcaatacca tttggaatgg aattccatgt cagcgttggg 1200attctcagta
tcctcacgag catgacatga ctcctgaaaa tttcaagtgc aaggacctac
1260gagaaaatta ctgccgaaat ccagatgggt ctgaatcacc ctggtgtttt
accactgatc 1320caaacatccg agttggctac tgctcccaaa ttccaaactg
tgatatgtca catggacaag 1380attgttatcg tgggaatggc aaaaattata
tgggcaactt atcccaaaca agatctggac 1440taacatgttc aatgtgggac
aagaacatgg aagacttaca tcgtcatatc ttctgggaac 1500cagatgcaag
taagctgaat gagaattact gccgaaatcc agatgatgat gctcatggac
1560cctggtgcta cacgggaaat ccactcattc cttgggatta ttgccctatt
tctcgttgtg 1620aaggtgatac cacacctaca atagtcaatt tagaccatcc
cgtaatatct tgtgccaaaa 1680cgaaacaatt gcgagttgta aatgggattc
caacacgaac aaacatagga tggatggtta 1740gtttgagata cagaaataaa
catatctgcg gaggatcatt gataaaggag agttgggttc 1800ttactgcacg
acagtgtttc ccttctcgag acttgaaaga ttatgaagct tggcttggaa
1860ttcatgatgt ccacggaaga ggagatgaga aatgcaaaca ggttctcaat
gtttcccagc 1920tggtatatgg ccctgaagga tcagatctgg ttttaatgaa
gcttgccagg cctgctgtcc 1980tggatgattt tgttagtacg attgatttac
ctaattatgg atgcacaatt cctgaaaaga 2040ccagttgcag tgtttatggc
tggggctaca ctggattgat caactatgat ggcctattac 2100gagtggcaca
tctctatata atgggaaatg agaaatgcag ccagcatcat cgagggaagg
2160tgactctgaa tgagtctgaa atatgtgctg gggctgaaaa gattggatca
ggaccatgtg 2220agggggatta tggtggccca cttgtttgtg agcaacataa
aatgagaatg gttcttggtg 2280tcattgttcc tggtcgtgga tgtgccattc
caaatcgtcc tggtattttt gtccgagtag 2340catattatgc aaaatggata
cacaaaatta ttttaacata taaggtacca cagtcatagc 2400tgaagtaagt
gtgtctgaag cacccaccaa tacaactgtc ttttacatga agatttcaga
2460gaatgtggaa tttaaaatgt cacttacaac aatcctaaga caactactgg
agagtcatgt 2520ttgttgaaat tctcattaat gtttatgggt gttttctgtt
gttttgtttg tcagtgttat 2580tttgtcaatg ttgaagtgaa ttaaggtaca
tgcaagtgta ataacatatc tcctgaagat 2640acttgaatgg attaaaaaaa
cacacaggta tatttgctgg atgataaaga tttcatggga 2700aaaaaaatca
attaatctgt ctaagctgct ttctgatgtt ggtttcttaa taatgagtaa
2760accacaaatt aaatgttatt ttaacctcac caaaacaatt tataccttgt
gtccctaaat 2820tgtagcccta tattaaatta tattacattt catatgctat
atgttatagt tcattcattt 2880ctcttcacca tgtatcctgc aatactggta
cacgaacaca ctttttacaa aaccacatac 2940ccatgtacac atgcctaggt
acacatgtgc atgcactaca gtttaaatta tggtgtacct 3000aatgtaaccc
ctaaatattt tagaagtatg tacctatagt tttacctcaa aaaaaccaga
3060aatctctaaa gaccagtaga aatattaaaa aatgatgcaa gatcaaaatg
attagctaat 3120tctccataca taatctgcag atgatcttct ttggttggca
tttcaggtgt ggccatcacc 3180cagagttaaa taacacctaa tctaggtgtt
tacatgtatt cattatccta gttatttcat 3240gtagtttcta attcttaaag
gaaagagggt aatagttcta tttgtgtaat ttgtttcctc 3300caaacttaag
gccacttatt tacacaagat atttgtagat ctattttcct aaagcatttc
3360ttaagtgctc agatcagtat ctaattgaag aagtttaaaa gtgttttggt
cattaaaaat 3420gtacttaaat aggttaaatc taagccttgc tgctgtgatt
ggcttctagc tcactgcctt 3480taaattttaa aaaatttaag aggaaaattt
ccaagtctcc aaagttttat aaataccctt 3540catcaagtca tgcattaaag
tatatattgg agaaaaaaat aaaaatactt ttctcaacct 3600ggaagatttt
agcctaataa agcttttttg aagtaaaaga caacttgtaa aaggaaagaa
3660actagtttgt ctcaactctg tattcattta tttttttttt gaagtagagt
ggaatctgtt 3720gaatcagata ttttatcaag atatgtttat tttttcttat
ttcattttac aaagttcact 3780cctaatgcca tatgtaacag acatttaaat
tttgtgttct gtataacagc caaattatca 3840tatttatcat tgtatttgtc
atgcttagct aaagatcatg tatttgttga gaaatagaat 3900aacaaaaagt
aataggatag gctttgaatt tttgcagaaa tcttcctgta caaaacacct
3960ttaaaaataa ttttttgaat ggtgtgaatc cagtagtccc atttctctga
cttagttttc 4020ttgagtgatt tttatcaagg ccaagtcccc aaacaattcc
ctaccagctc tttagagtac 4080tgttcaatct ggactaaaat ggttttaagt
ttatggagag cttagtccac agaatatagg 4140gcggcgagtc cagaaatgct
tatacaattt ttttttcata ataagatatg tgctggcatc 4200aagaaactta
aagtggaagc aaaaagacat ccaactagtt gctggtctct atcatcttat
4260ctgatggtat ttctattttc cttatataat acaccatttt agtaagaact
cctagaaatt 4320tcaagagcat attgccaaaa tataaagtat atttcatagt
ttcttctggc tgaaccagtg 4380aaattttatt attgcatatt aatgatattt
gtaaaacttt tataaaaatt gtcataattt 4440taaatactca cattttaaaa
atacttcttt aatgactctt cctctaaatt tcctggaaat 4500acagataaag
attagctaga tacaagatac agctaagtat ttagacattt tgaggctagt
4560atttttcatt ttattaaagg ctaaaaacaa taccaccaat aaatcatcaa
acaaaccgta 4620caaagtaatt ctctctttgg gaggctcctt tcgtgataga
gggacatggg tggaattgac 4680aatgaaactt agatgaacaa ggtccatgtt
attttaggtg gtagaacagg gtagagtcat 4740gtcattattt gctggtggaa
gacactattt accaggtgtt ctttgctgaa taaatcatta 4800aacattttta
aaaatccaac aatccacttt attttgtgtc attgacaaaa ggatctttta
4860aatcagaagg tttcaatgca atttttggtt tggctgtttg aataatggtt
atgtactgtt 4920ataattgtag acattttctc acgtctacca ggaattgaag
tgtaaaacta aaatattttt 4980cataatgcct ctgccgtgca gaaggaatga
taatcctttt gtatacttct ttaattttat 5040tgtaaaatgt gtaatgactt
ttacctatat gctgtgggca ggtcctcagt aaaatctatt 5100gagtcaattt
ctagtattaa caggcttttg cttgctatct aagtgtttca aattatggga
5160agtgtgagac actggaaggc aagaaaatta acaataatgg catgtgatag
caaaattgta 5220tttcacttat tcctgtgaat atttcttgtt ggtaccaatg
gtactgtaca aagtgaatgt 5280tatagccaca acattctctt gaaaagaaca
ctgtcaagaa gtgggaaatt gctgtcaggc 5340atttcattgt tgtttttaaa
cttttttaaa agaaatactg gttttgcaat atagagatca 5400tgtggtaaag
aattttaata agatcttata ctaaaaagcc ttaaatcaat ttattgagat
5460tcaaaaaata ctattataat taattacatc ccatacatat aggcaaactc
atttaaaaaa 5520taaaactaat tttggtaaaa gtacatggcc tttgttttta
aaatacataa ttttaaaata 5580aatcacttgt catgataaag tccaaaaaga
agttatcatt caacattcaa ctaaggttgg 5640agctaagaat ttactaatac
aaaaaaagtt aaaatttttt ggaccatata tatcttgaca 5700gtgtaacttt
taagtaggtt catttccatt tgcacagaaa gtttctgtct ttaggaaact
5760gaaaatgaaa tactgtggat gctatgactg tttgtcttgt atgtaaatag
gaaattaata 5820agctgcctat tgagtggtat agctgtatgc ttacccaaaa
aagggaacac tgtggttatg 5880acttgtatta taaactttct gtagttaata
aagttgttat ttttataacc atgattatat 5940tattattatt aataaaatat
tttatcaaaa tgaaaaaaaa aaaaaaa 5987191354DNAhomo sapiens
19gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa
60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat
120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag
gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag
cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg
tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga
caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac
taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga
420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca
ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg
gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg
aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt
aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa
atgtcagccc tggagttcca tgataccaca cgaacacagc tatcggggta
720aagacctaca ggaaaactac tgtcgaaatc ctcgagggga agaaggggga
ccctggtgtt 780tcacaagcaa tccagaggta cgctacgaag tctgtgacat
tcctcagtgt tcagaagttg 840aatgcatgac ctgcaatggg gagagttatc
gaggtctcat ggatcataca gaatcaggca 900agatttgtca gcgctgggat
catcagacac cacaccggca caaattcttg cctgaaagat 960atcccgacaa
gggctttgat gataattatt gccgcaatcc cgatggccag ccgaggccat
1020ggtgctatac tcttgaccct cacacccgct gggagtactg tgcaattaaa
acatgcgaga 1080cataacatgg gctctcaact gatggtgaac ttcttctggt
gagtgacaga ggctgcagtg 1140aagaataatg agtctaatag aagtttatca
cagatgtctc taatctttat agctgatccc 1200tacctctctc gctgtctttg
tacccagcct gcattctgtt tcgatctgtc ttttagcagt 1260ccatacaatc
atttttctac atgctggccc ttacctagct tttctgaatt tacaataaaa
1320actatttttt aacgtgaaaa aaaaaaaaaa aaaa 1354202102DNAhomo sapiens
20gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa
60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat
120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag
gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag
cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg
tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga
caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac
taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga
420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca
ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg
gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg
aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt
aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa
atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt
720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga
ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta
cgaagtctgt gacattcctc 840agtgttcaga aggtaaataa acctgaatgc
catgtgggcc attctattcc ccctatgtgt 900agaactgtaa ctcacattaa
aggttaacag caacgaatca atcataacaa atatgttgtt 960cgtgcaaatg
caactacaaa taattattta aacattttta tacaatgttt ttaaaactgt
1020tggattatca ccagattaat gcaaaataac agagcgagtt atcagtttga
atttcaacac 1080tgcctgagac atccctctgg ggaaagtgaa agagagggtt
tacttaccta ctgtcttgag 1140ctcacatacc tcaaaatcta ctactgtgtg
gcacctgaaa ggagttgaat gaagcttagc 1200ctttcattag caatgttaat
tctattcaac cagcacctgc ttccacagaa attctgtcca 1260aactatcatg
aagtggtgtg acaagggtat atggacccag aagataatac aatataagaa
1320gggatcactg gaagcttgac cccatgcaca ttttggtgaa aatgtgccta
gaatcaaatg 1380tgacacgtag gctggaactg agtaccattc agaataggat
ctgaagagat caaagcaatg 1440gagaccacca aactgtcttg aaggcatgtc
tatggacctt aagtccatgt ctatgttttc 1500agctcttctc acagcataaa
agggcattgt ccttactttt gcagtggaaa actgaatggc 1560tgacaagatg
gaagagtaac catttcagca ttgtatgtgg tttcattttt cttagttatc
1620tggctactga atagccggat ttttcagttc tgtcagaaac tctaaatttc
caaaaatcta 1680agtgaaacat ggatgaaact ctgttagaaa attgttagga
ttttggagta tttggggagg 1740gggactactg gaatgctgtc caagttttat
actaagatat cttacctgtt tgttattaac
1800caaatatttt taaaaatatt tcctccataa atattcattt aatattaggt
tgatatttat 1860cacataaaaa gtaaaggcta ctgttagcta attgtcacag
agaaggattt gttttctgtt 1920gttagtgaat ttgaaatcct tgactttatg
tgctacagcc agttccatct ctgtttgtaa 1980attcttactt tccattccat
atcatattct gttccctata acctcttcat tgttttcttt 2040tcttttaaaa
ataataaact tttctatgat caaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2100aa
2102212339DNAhomo sapiens 21acgcggtgcc gcggggcggg agtagaggcg
gagggagggg acacgggctc attgcggtgt 60gcgccctgca ctctgtccct cactcgccgc
cgacgacctg tctcgccgag cgcacgcctt 120gccgccgccc cgcagaaatg
cttcggttac ccacagtctt tcgccagatg agaccggtgt 180ccagggtact
ggctcctcat ctcactcggg cttatgccaa agatgtaaaa tttggtgcag
240atgcccgagc cttaatgctt caaggtgtag accttttagc cgatgctgtg
gccgttacaa 300tggggccaaa gggaagaaca gtgattattg agcagagttg
gggaagtccc aaagtaacaa 360aagatggtgt gactgttgca aagtcaattg
acttaaaaga taaatacaaa aacattggag 420ctaaacttgt tcaagatgtt
gccaataaca caaatgaaga agctggggat ggcactacca 480ctgctactgt
actggcacgc tctatagcca aggaaggctt cgagaagatt agcaaaggtg
540ctaatccagt ggaaatcagg agaggtgtga tgttagctgt tgatgctgta
attgctgaac 600ttaaaaagca gtctaaacct gtgaccaccc ctgaagaaat
tgcacaggtt gctacgattt 660ctgcaaacgg agacaaagaa attggcaata
tcatctctga tgcaatgaaa aaagttggaa 720gaaagggtgt catcacagta
aaggatggaa aaacactgaa tgatgaatta gaaattattg 780aaggcatgaa
gtttgatcga ggctatattt ctccatactt tattaataca tcaaaaggtc
840agaaatgtga attccaggat gcctatgttc tgttgagtga aaagaaaatt
tctagtatcc 900agtccattgt acctgctctt gaaattgcca atgctcaccg
taagcctttg gtcataatcg 960ctgaagatgt tgatggagaa gctctaagta
cactcgtctt gaataggcta aaggttggtc 1020ttcaggttgt ggcagtcaag
gctccagggt ttggtgacaa tagaaagaac cagcttaaag 1080atatggctat
tgctactggt ggtgcagtgt ttggagaaga gggattgacc ctgaatcttg
1140aagacgttca gcctcatgac ttaggaaaag ttggagaggt cattgtgacc
aaagacgatg 1200ccatgctctt aaaaggaaaa ggtgacaagg ctcaaattga
aaaacgtatt caagaaatca 1260ttgagcagtt agatgtcaca actagtgaat
atgaaaagga aaaactgaat gaacggcttg 1320caaaactttc agatggagtg
gctgtgctga aggttggtgg gacaagtgat gttgaagtga 1380atgaaaagaa
agacagagtt acagatgccc ttaatgctac aagagctgct gttgaagaag
1440gcattgtttt gggagggggt tgtgccctcc ttcgatgcat tccagccttg
gactcattga 1500ctccagctaa tgaagatcaa aaaattggta tagaaattat
taaaagaaca ctcaaaattc 1560cagcaatgac cattgctaag aatgcaggtg
ttgaaggatc tttgatagtt gagaaaatta 1620tgcaaagttc ctcagaagtt
ggttatgatg ctatggctgg agattttgtg aatatggtgg 1680aaaaaggaat
cattgaccca acaaaggttg tgagaactgc tttattggat gctgctggtg
1740tggcctctct gttaactaca gcagaagttg tagtcacaga aattcctaaa
gaagagaagg 1800accctggaat gggtgcaatg ggtggaatgg gaggtggtat
gggaggtggc atgttctaac 1860tcctagacta gtgctttacc tttattaatg
aactgtgaca ggaagcccaa ggcagtgttc 1920ctcaccaata acttcagaga
agtcagttgg agaaaatgaa gaaaaaggct ggctgaaaat 1980cactataacc
atcagttact ggtttcagtt gacaaaatat ataatggttt actgctgtca
2040ttgtccatgc ctacagataa tttattttgt atttttgaat aaaaaacatt
tgtacattcc 2100tgatactggg tacaagagcc atgtaccagt gtactgcttt
caacttaaat cactgaggca 2160tttttactac tattctgtta aaatcaggat
tttagtgctt gccaccacca gatgagaagt 2220taagcagcct ttctgtggag
agtgagaata attgtgtaca aagtagagaa gtatccaatt 2280atgtgacaac
ctttgtgtaa taaaaatttg tttaaagtta aaaaaaaaaa aaaaaaaaa
2339222319DNAhomo sapiens 22gccccgacgc gcaccgcgat tcgccccaag
ggccctgcgc aggacgctga cgcgaagact 60cggaggcgga agaaaaaagg agctgtttct
aggcttttct aggcgcccag ccgagaaatg 120cttcggttac ccacagtctt
tcgccagatg agaccggtgt ccagggtact ggctcctcat 180ctcactcggg
cttatgccaa agatgtaaaa tttggtgcag atgcccgagc cttaatgctt
240caaggtgtag accttttagc cgatgctgtg gccgttacaa tggggccaaa
gggaagaaca 300gtgattattg agcagagttg gggaagtccc aaagtaacaa
aagatggtgt gactgttgca 360aagtcaattg acttaaaaga taaatacaaa
aacattggag ctaaacttgt tcaagatgtt 420gccaataaca caaatgaaga
agctggggat ggcactacca ctgctactgt actggcacgc 480tctatagcca
aggaaggctt cgagaagatt agcaaaggtg ctaatccagt ggaaatcagg
540agaggtgtga tgttagctgt tgatgctgta attgctgaac ttaaaaagca
gtctaaacct 600gtgaccaccc ctgaagaaat tgcacaggtt gctacgattt
ctgcaaacgg agacaaagaa 660attggcaata tcatctctga tgcaatgaaa
aaagttggaa gaaagggtgt catcacagta 720aaggatggaa aaacactgaa
tgatgaatta gaaattattg aaggcatgaa gtttgatcga 780ggctatattt
ctccatactt tattaataca tcaaaaggtc agaaatgtga attccaggat
840gcctatgttc tgttgagtga aaagaaaatt tctagtatcc agtccattgt
acctgctctt 900gaaattgcca atgctcaccg taagcctttg gtcataatcg
ctgaagatgt tgatggagaa 960gctctaagta cactcgtctt gaataggcta
aaggttggtc ttcaggttgt ggcagtcaag 1020gctccagggt ttggtgacaa
tagaaagaac cagcttaaag atatggctat tgctactggt 1080ggtgcagtgt
ttggagaaga gggattgacc ctgaatcttg aagacgttca gcctcatgac
1140ttaggaaaag ttggagaggt cattgtgacc aaagacgatg ccatgctctt
aaaaggaaaa 1200ggtgacaagg ctcaaattga aaaacgtatt caagaaatca
ttgagcagtt agatgtcaca 1260actagtgaat atgaaaagga aaaactgaat
gaacggcttg caaaactttc agatggagtg 1320gctgtgctga aggttggtgg
gacaagtgat gttgaagtga atgaaaagaa agacagagtt 1380acagatgccc
ttaatgctac aagagctgct gttgaagaag gcattgtttt gggagggggt
1440tgtgccctcc ttcgatgcat tccagccttg gactcattga ctccagctaa
tgaagatcaa 1500aaaattggta tagaaattat taaaagaaca ctcaaaattc
cagcaatgac cattgctaag 1560aatgcaggtg ttgaaggatc tttgatagtt
gagaaaatta tgcaaagttc ctcagaagtt 1620ggttatgatg ctatggctgg
agattttgtg aatatggtgg aaaaaggaat cattgaccca 1680acaaaggttg
tgagaactgc tttattggat gctgctggtg tggcctctct gttaactaca
1740gcagaagttg tagtcacaga aattcctaaa gaagagaagg accctggaat
gggtgcaatg 1800ggtggaatgg gaggtggtat gggaggtggc atgttctaac
tcctagacta gtgctttacc 1860tttattaatg aactgtgaca ggaagcccaa
ggcagtgttc ctcaccaata acttcagaga 1920agtcagttgg agaaaatgaa
gaaaaaggct ggctgaaaat cactataacc atcagttact 1980ggtttcagtt
gacaaaatat ataatggttt actgctgtca ttgtccatgc ctacagataa
2040tttattttgt atttttgaat aaaaaacatt tgtacattcc tgatactggg
tacaagagcc 2100atgtaccagt gtactgcttt caacttaaat cactgaggca
tttttactac tattctgtta 2160aaatcaggat tttagtgctt gccaccacca
gatgagaagt taagcagcct ttctgtggag 2220agtgagaata attgtgtaca
aagtagagaa gtatccaatt atgtgacaac ctttgtgtaa 2280taaaaatttg
tttaaagtta aaaaaaaaaa aaaaaaaaa 23192320DNAArtificial
sequenceSingle strand DNA oligonucleotide 23tctgtttccc gtgctgcgag
202420DNAArtificial sequenceSingle strand DNA oligonucleotide
24cccagcgtcc agtagcacac 202521DNAArtificial sequenceSingle strand
DNA oligonucleotide 25cctacaattc ttctttgggc t 212620DNAArtificial
sequenceSingle strand DNA oligonucleotide 26agtaacagtt atggcttgga
202723DNAArtificial sequenceSingle strand DNA oligonucleotide
27ggaatgctgc catggagatc tgc 232821DNAArtificial sequenceSingle
strand DNA oligonucleotide 28ccttcagttt actggagatc g
212920DNAArtificial sequenceSingle strand DNA oligonucleotide
29ctccaaaggc cagcctgact 203020DNAArtificial sequenceSingle strand
DNA oligonucleotide 30cagcccaccc aaaccaccaa 203119DNAArtificial
sequenceSingle strand DNA oligonucleotide 31gcctcgtatg tgaggcaaa
193220DNAArtificial sequenceSingle strand DNA oligonucleotide
32cccattcgta gcctttggta 203320DNAArtificial sequenceSingle strand
DNA oligonucleotide 33aaagtacgtc cgcgggttgc 203419DNAArtificial
sequenceSingle strand DNA oligonucleotide 34tccgatgagt ccggccagt
193518DNAArtificial sequenceSingle strand DNA oligonucleotide
35gggagcggtg aagatgga 183622DNAArtificial sequenceSingle strand DNA
oligonucleotide 36tcatgttgct cacggaggag ta 223719DNAArtificial
sequenceSingle strand DNA oligonucleotide 37gccgagtttg ccttgctca
193820DNAArtificial sequenceSingle strand DNA oligonucleotide
38tccggaggct caccagtttc 203921DNAArtificial sequenceSingle strand
DNA oligonucleotide 39aaggtgaagc gcaatgtccc t 214021DNAArtificial
sequenceSingle strand DNA oligonucleotide 40cccccagctg ctcaaaaatg c
214123DNAArtificial sequenceSingle strand DNA oligonucleotide
41tgctctgtgt cactgtggat tgg 234221DNAArtificial sequenceSingle
strand DNA oligonucleotide 42gggcaaagag gctggtcttc a
214320DNAArtificial sequenceSingle strand DNA oligonucleotide
43ctcacctcca ggtttgcttc 204420DNAArtificial sequenceSingle strand
DNA oligonucleotide 44ctccttgatc gatcctttgc 204520DNAArtificial
sequenceSingle strand DNA oligonucleotide 45tctccaggtt gcctctcact
204620DNAArtificial sequenceSingle strand DNA oligonucleotide
46gtggaggaag ctgacaacaa 204720DNAArtificial sequenceSingle strand
DNA oligonucleotide 47tcgagccaat actgcatctg 204820DNAArtificial
sequenceSingle strand DNA oligonucleotide 48cttctgggag gacatccttg
204920DNAArtificial sequenceSingle strand DNA oligonucleotide
49acgagacaga agacggcatt 205019DNAArtificial sequenceSingle strand
DNA oligonucleotide 50ccctctggat ccactgctt 195121DNAArtificial
sequenceSingle strand DNA oligonucleotide 51ccccacattc gtcagcggtg t
215221DNAArtificial sequenceSingle strand DNA oligonucleotide
52aggtgcccga gggttctgag g 215318DNAArtificial sequenceSingle strand
DNA oligonucleotide 53ggcgcagcag aatccaga 185418DNAArtificial
sequenceSingle strand DNA oligonucleotide 54ccacgacttg cccagcat
185520DNAArtificial sequenceSingle strand DNA oligonucleotide
55gcttagcctc gtcgatgaac 205620DNAArtificial sequenceSingle strand
DNA oligonucleotide 56aaccccaaga tgcacaactc 205720DNAArtificial
sequenceSingle strand DNA oligonucleotide 57cgggtgtggc acagctagtt
205822DNAArtificial sequenceSingle strand DNA oligonucleotide
58tgcattgtca agtgacgatc ac 225920DNAArtificial sequenceSingle
strand DNA oligonucleotide 59aaagtacgtc cgcgggttgc
206019DNAArtificial sequenceSingle strand DNA oligonucleotide
60tccgatgagt ccggccagt 196115DNAArtificial sequencePXR response
element 61tgaacttgct gaccc 156221DNAArtificial sequenceLXR response
elements 62gggttactgg cggtcattgt a 216319DNAArtificial sequencePPAR
response element 63tacctttccc ctacttttc 196414DNAArtificial
sequenceBSEP promoter element 64gggacattga tcct 1465110PRThomo
sapiens 65Met Ala Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu
Ala Leu1 5 10 15Trp Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His
Leu Cys Gly 20 25 30Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly
Glu Arg Gly Phe 35 40 45Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu
Asp Leu Gln Val Gly 50 55 60Gln Val Glu Leu Gly Gly Gly Pro Gly Ala
Gly Ser Leu Gln Pro Leu65 70 75 80Ala Leu Glu Gly Ser Leu Gln Lys
Arg Gly Ile Val Glu Gln Cys Cys 85 90 95Thr Ser Ile Cys Ser Leu Tyr
Gln Leu Glu Asn Tyr Cys Asn 100 105 11066469DNAhomo sapiens
66agccctccag gacaggctgc atcagaagag gccatcaagc agatcactgt ccttctgcca
60tggccctgtg gatgcgcctc ctgcccctgc tggcgctgct ggccctctgg ggacctgacc
120cagccgcagc ctttgtgaac caacacctgt gcggctcaca cctggtggaa
gctctctacc 180tagtgtgcgg ggaacgaggc ttcttctaca cacccaagac
ccgccgggag gcagaggacc 240tgcaggtggg gcaggtggag ctgggcgggg
gccctggtgc aggcagcctg cagcccttgg 300ccctggaggg gtccctgcag
aagcgtggca ttgtggaaca atgctgtacc agcatctgct 360ccctctacca
gctggagaac tactgcaact agacgcagcc cgcaggcagc cccacacccg
420ccgcctcctg caccgagaga gatggaataa agcccttgaa ccagcaaaa
46967288PRThomo sapiens 67Met Val Gly Val Gly Gly Gly Asp Val Glu
Asp Val Thr Pro Arg Pro1 5 10 15Gly Gly Cys Gln Ile Ser Gly Arg Gly
Ala Arg Gly Cys Asn Gly Ile 20 25 30Pro Gly Ala Ala Ala Trp Glu Ala
Ala Leu Pro Arg Arg Arg Pro Arg 35 40 45Arg His Pro Ser Val Asn Pro
Arg Ser Arg Ala Ala Gly Ser Pro Arg 50 55 60Thr Arg Gly Arg Arg Thr
Glu Glu Arg Pro Ser Gly Ser Arg Leu Gly65 70 75 80Asp Arg Gly Arg
Gly Arg Ala Leu Pro Gly Gly Arg Leu Gly Gly Arg 85 90 95Gly Arg Gly
Arg Ala Pro Glu Arg Val Gly Gly Arg Gly Arg Gly Arg 100 105 110Gly
Thr Ala Ala Pro Arg Ala Ala Pro Ala Ala Arg Gly Ser Arg Pro 115 120
125Gly Pro Ala Gly Thr Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala
130 135 140Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His
Phe Lys145 150 155 160Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly
Phe Phe Leu Arg Ile 165 170 175His Pro Asp Gly Arg Val Asp Gly Val
Arg Glu Lys Ser Asp Pro His 180 185 190Ile Lys Leu Gln Leu Gln Ala
Glu Glu Arg Gly Val Val Ser Ile Lys 195 200 205Gly Val Cys Ala Asn
Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu 210 215 220Leu Ala Ser
Lys Cys Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu225 230 235
240Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp
245 250 255Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser
Lys Thr 260 265 270Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met
Ser Ala Lys Ser 275 280 285686774DNAhomo sapiens 68cggccccaga
aaacccgagc gagtaggggg cggcgcgcag gagggaggag aactgggggc 60gcgggaggct
ggtgggtgtg gggggtggag atgtagaaga tgtgacgccg cggcccggcg
120ggtgccagat tagcggacgc ggtgcccgcg gttgcaacgg gatcccgggc
gctgcagctt 180gggaggcggc tctccccagg cggcgtccgc ggagacaccc
atccgtgaac cccaggtccc 240gggccgccgg ctcgccgcgc accaggggcc
ggcggacaga agagcggccg agcggctcga 300ggctggggga ccgcgggcgc
ggccgcgcgc tgccgggcgg gaggctgggg ggccggggcc 360ggggccgtgc
cccggagcgg gtcggaggcc ggggccgggg ccgggggacg gcggctcccc
420gcgcggctcc agcggctcgg ggatcccggc cgggccccgc agggaccatg
gcagccggga 480gcatcaccac gctgcccgcc ttgcccgagg atggcggcag
cggcgccttc ccgcccggcc 540acttcaagga ccccaagcgg ctgtactgca
aaaacggggg cttcttcctg cgcatccacc 600ccgacggccg agttgacggg
gtccgggaga agagcgaccc tcacatcaag ctacaacttc 660aagcagaaga
gagaggagtt gtgtctatca aaggagtgtg tgctaaccgt tacctggcta
720tgaaggaaga tggaagatta ctggcttcta aatgtgttac ggatgagtgt
ttcttttttg 780aacgattgga atctaataac tacaatactt accggtcaag
gaaatacacc agttggtatg 840tggcactgaa acgaactggg cagtataaac
ttggatccaa aacaggacct gggcagaaag 900ctatactttt tcttccaatg
tctgctaaga gctgatttta atggccacat ctaatctcat 960ttcacatgaa
agaagaagta tattttagaa atttgttaat gagagtaaaa gaaaataaat
1020gtgtatagct cagtttggat aattggtcaa acaatttttt atccagtagt
aaaatatgta 1080accattgtcc cagtaaagaa aaataacaaa agttgtaaaa
tgtatattct cccttttata 1140ttgcatctgc tgttacccag tgaagcttac
ctagagcaat gatctttttc acgcatttgc 1200tttattcgaa aagaggcttt
taaaatgtgc atgtttagaa acaaaatttc ttcatggaaa 1260tcatatacat
tagaaaatca cagtcagatg tttaatcaat ccaaaatgtc cactatttct
1320tatgtcattc gttagtctac atgtttctaa acatataaat gtgaatttaa
tcaattcctt 1380tcatagtttt ataattctct ggcagttcct tatgatagag
tttataaaac agtcctgtgt 1440aaactgctgg aagttcttcc acagtcaggt
caattttgtc aaacccttct ctgtacccat 1500acagcagcag cctagcaact
ctgctggtga tgggagttgt attttcagtc ttcgccaggt 1560cattgagatc
catccactca catcttaagc attcttcctg gcaaaaattt atggtgaatg
1620aatatggctt taggcggcag atgatataca tatctgactt cccaaaagct
ccaggatttg 1680tgtgctgttg ccgaatactc aggacggacc tgaattctga
ttttatacca gtctcttcaa 1740aaacttctcg aaccgctgtg tctcctacgt
aaaaaaagag atgtacaaat caataataat 1800tacactttta gaaactgtat
catcaaagat tttcagttaa agtagcatta tgtaaaggct 1860caaaacatta
ccctaacaaa gtaaagtttt caatacaaat tctttgcctt gtggatatca
1920agaaatccca aaatattttc ttaccactgt aaattcaaga agcttttgaa
atgctgaata 1980tttctttggc tgctacttgg aggcttatct acctgtacat
ttttggggtc agctcttttt 2040aacttcttgc tgctcttttt cccaaaaggt
aaaaatatag attgaaaagt taaaacattt 2100tgcatggctg cagttccttt
gtttcttgag ataagattcc aaagaactta gattcatttc 2160ttcaacaccg
aaatgctgga ggtgtttgat cagttttcaa gaaacttgga atataaataa
2220ttttataatt caacaaaggt tttcacattt tataaggttg atttttcaat
taaatgcaaa 2280tttgtgtggc aggattttta ttgccattaa catatttttg
tggctgcttt ttctacacat 2340ccagatggtc cctctaactg ggctttctct
aattttgtga tgttctgtca ttgtctccca 2400aagtatttag gagaagccct
ttaaaaagct gccttcctct accactttgc tggaaagctt 2460cacaattgtc
acagacaaag atttttgttc caatactcgt tttgcctcta tttttcttgt
2520ttgtcaaata gtaaatgata tttgcccttg cagtaattct actggtgaaa
aacatgcaaa 2580gaagaggaag tcacagaaac atgtctcaat tcccatgtgc
tgtgactgta gactgtctta 2640ccatagactg tcttacccat cccctggata
tgctcttgtt ttttccctct aatagctatg 2700gaaagatgca tagaaagagt
ataatgtttt aaaacataag gcattcgtct gccatttttc 2760aattacatgc
tgacttccct tacaattgag atttgcccat aggttaaaca tggttagaaa
2820caactgaaag cataaaagaa aaatctaggc cgggtgcagt ggctcatgcc
tatattccct 2880gcactttggg aggccaaagc aggaggatcg cttgagccca
ggagttcaag accaacctgg 2940tgaaaccccg tctctacaaa aaaacacaaa
aaatagccag gcatggtggc gtgtacatgt 3000ggtctcagat acttgggagg
ctgaggtggg agggttgatc acttgaggct gagaggtcaa 3060ggttgcagtg
agccataatc gtgccactgc agtccagcct aggcaacaga gtgagacttt
3120gtctcaaaaa aagagaaatt ttccttaata agaaaagtaa tttttactct
gatgtgcaat 3180acatttgtta ttaaatttat tatttaagat ggtagcacta
gtcttaaatt gtataaaata 3240tcccctaaca tgtttaaatg tccattttta
ttcattatgc tttgaaaaat aattatgggg 3300aaatacatgt ttgttattaa
atttattatt aaagatagta gcactagtct taaatttgat 3360ataacatctc
ctaacttgtt taaatgtcca tttttattct ttatgtttga aaataaatta
3420tggggatcct atttagctct tagtaccact aatcaaaagt tcggcatgta
gctcatgatc 3480tatgctgttt ctatgtcgtg gaagcaccgg atgggggtag
tgagcaaatc tgccctgctc 3540agcagtcacc atagcagctg actgaaaatc
agcactgcct gagtagtttt gatcagttta 3600acttgaatca ctaactgact
gaaaattgaa tgggcaaata agtgcttttg tctccagagt 3660atgcgggaga
cccttccacc tcaagatgga tatttcttcc ccaaggattt caagatgaat
3720tgaaattttt aatcaagata gtgtgcttta ttctgttgta ttttttatta
ttttaatata 3780ctgtaagcca aactgaaata acatttgctg ttttataggt
ttgaagaaca taggaaaaac 3840taagaggttt tgtttttatt tttgctgatg
aagagatatg tttaaatatg ttgtattgtt 3900ttgtttagtt acaggacaat
aatgaaatgg agtttatatt tgttatttct attttgttat 3960atttaataat
agaattagat tgaaataaaa tataatggga aataatctgc agaatgtggg
4020ttttcctggt gtttccctct gactctagtg cactgatgat ctctgataag
gctcagctgc 4080tttatagttc tctggctaat gcagcagata ctcttcctgc
cagtggtaat acgatttttt 4140aagaaggcag tttgtcaatt ttaatcttgt
ggataccttt atactcttag ggtattattt 4200tatacaaaag ccttgaggat
tgcattctat tttctatatg accctcttga tatttaaaaa 4260acactatgga
taacaattct tcatttacct agtattatga aagaatgaag gagttcaaac
4320aaatgtgttt cccagttaac tagggtttac tgtttgagcc aatataaatg
tttaactgtt 4380tgtgatggca gtattcctaa agtacattgc atgttttcct
aaatacagag tttaaataat 4440ttcagtaatt cttagatgat tcagcttcat
cattaagaat atcttttgtt ttatgttgag 4500ttagaaatgc cttcatatag
acatagtctt tcagacctct actgtcagtt ttcatttcta 4560gctgctttca
gggttttatg aattttcagg caaagcttta atttatacta agcttaggaa
4620gtatggctaa tgccaacggc agtttttttc ttcttaattc cacatgactg
aggcatatat 4680gatctctggg taggtgagtt gttgtgacaa ccacaagcac
tttttttttt tttaaagaaa 4740aaaaggtagt gaatttttaa tcatctggac
tttaagaagg attctggagt atacttaggc 4800ctgaaattat atatatttgg
cttggaaatg tgtttttctt caattacatc tacaagtaag 4860tacagctgaa
attcagagga cccataagag ttcacatgaa aaaaatcaat ttatttgaaa
4920aggcaagatg caggagagag gaagccttgc aaacctgcag actgcttttt
gcccaatata 4980gattgggtaa ggctgcaaaa cataagctta attagctcac
atgctctgct ctcacgtggc 5040accagtggat agtgtgagag aattaggctg
tagaacaaat ggccttctct ttcagcattc 5100acaccactac aaaatcatct
tttatatcaa cagaagaata agcataaact aagcaaaagg 5160tcaataagta
cctgaaacca agattggcta gagatatatc ttaatgcaat ccattttctg
5220atggattgtt acgagttggc tatataatgt atgtatggta ttttgatttg
tgtaaaagtt 5280ttaaaaatca agctttaagt acatggacat ttttaaataa
aatatttaaa gacaatttag 5340aaaattgcct taatatcatt gttggctaaa
tagaataggg gacatgcata ttaaggaaaa 5400ggtcatggag aaataatatt
ggtatcaaac aaatacattg atttgtcatg atacacattg 5460aatttgatcc
aatagtttaa ggaataggta ggaaaatttg gtttctattt ttcgatttcc
5520tgtaaatcag tgacataaat aattcttagc ttattttata tttccttgtc
ttaaatactg 5580agctcagtaa gttgtgttag gggattattt ctcagttgag
actttcttat atgacatttt 5640actatgtttt gacttcctga ctattaaaaa
taaatagtag atacaatttt cataaagtga 5700agaattatat aatcactgct
ttataactga ctttattata tttatttcaa agttcattta 5760aaggctacta
ttcatcctct gtgatggaat ggtcaggaat ttgttttctc atagtttaat
5820tccaacaaca atattagtcg tatccaaaat aacctttaat gctaaacttt
actgatgtat 5880atccaaagct tctcattttc agacagatta atccagaagc
agtcataaac agaagaatag 5940gtggtatgtt cctaatgata ttatttctac
taatggaata aactgtaata ttagaaatta 6000tgctgctaat tatatcagct
ctgaggtaat ttctgaaatg ttcagactca gtcggaacaa 6060attggaaaat
ttaaattttt attcttagct ataaagcaag aaagtaaaca cattaatttc
6120ctcaacattt ttaagccaat taaaaatata aaagatacac accaatatct
tcttcaggct 6180ctgacaggcc tcctggaaac ttccacatat ttttcaactg
cagtataaag tcagaaaata 6240aagttaacat aactttcact aacacacaca
tatgtagatt tcacaaaatc cacctataat 6300tggtcaaagt ggttgagaat
atatttttta gtaattgcat gcaaaatttt tctagcttcc 6360atcctttctc
cctcgtttct tctttttttg ggggagctgg taactgatga aatcttttcc
6420caccttttct cttcaggaaa tataagtggt tttgtttggt taacgtgata
cattctgtat 6480gaatgaaaca ttggagggaa acatctactg aatttctgta
atttaaaata ttttgctgct 6540agttaactat gaacagatag aagaatctta
cagatgctgc tataaataag tagaaaatat 6600aaatttcatc actaaaatat
gctattttaa aatctatttc ctatattgta tttctaatca 6660gatgtattac
tcttattatt tctattgtat gtgttaatga ttttatgtaa aaatgtaatt
6720gcttttcatg agtagtatga ataaaattga ttagtttgtg ttttcttgtc tccc
67746940PRThomo sapiens 69Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu
Ala Leu Glu Gly Ser Leu1 5 10 15Gln Lys Arg Gly Ile Val Glu Gln Cys
Cys Thr Ser Ile Cys Ser Leu 20 25 30Tyr Gln Leu Glu Asn Tyr Cys Asn
35 40706774DNAhomo sapiens 70cggccccaga aaacccgagc gagtaggggg
cggcgcgcag gagggaggag aactgggggc 60gcgggaggct ggtgggtgtg gggggtggag
atgtagaaga tgtgacgccg cggcccggcg 120ggtgccagat tagcggacgc
ggtgcccgcg gttgcaacgg gatcccgggc gctgcagctt 180gggaggcggc
tctccccagg cggcgtccgc ggagacaccc atccgtgaac cccaggtccc
240gggccgccgg ctcgccgcgc accaggggcc ggcggacaga agagcggccg
agcggctcga 300ggctggggga ccgcgggcgc ggccgcgcgc tgccgggcgg
gaggctgggg ggccggggcc 360ggggccgtgc cccggagcgg gtcggaggcc
ggggccgggg ccgggggacg gcggctcccc 420gcgcggctcc agcggctcgg
ggatcccggc cgggccccgc agggaccatg gcagccggga 480gcatcaccac
gctgcccgcc ttgcccgagg atggcggcag cggcgccttc ccgcccggcc
540acttcaagga ccccaagcgg ctgtactgca aaaacggggg cttcttcctg
cgcatccacc 600ccgacggccg agttgacggg gtccgggaga agagcgaccc
tcacatcaag ctacaacttc 660aagcagaaga gagaggagtt gtgtctatca
aaggagtgtg tgctaaccgt tacctggcta 720tgaaggaaga tggaagatta
ctggcttcta aatgtgttac ggatgagtgt ttcttttttg 780aacgattgga
atctaataac tacaatactt accggtcaag gaaatacacc agttggtatg
840tggcactgaa acgaactggg cagtataaac ttggatccaa aacaggacct
gggcagaaag 900ctatactttt tcttccaatg tctgctaaga gctgatttta
atggccacat ctaatctcat 960ttcacatgaa agaagaagta tattttagaa
atttgttaat gagagtaaaa gaaaataaat 1020gtgtatagct cagtttggat
aattggtcaa acaatttttt atccagtagt aaaatatgta 1080accattgtcc
cagtaaagaa aaataacaaa agttgtaaaa tgtatattct cccttttata
1140ttgcatctgc tgttacccag tgaagcttac ctagagcaat gatctttttc
acgcatttgc 1200tttattcgaa aagaggcttt taaaatgtgc atgtttagaa
acaaaatttc ttcatggaaa 1260tcatatacat tagaaaatca cagtcagatg
tttaatcaat ccaaaatgtc cactatttct 1320tatgtcattc gttagtctac
atgtttctaa acatataaat gtgaatttaa tcaattcctt 1380tcatagtttt
ataattctct ggcagttcct tatgatagag tttataaaac agtcctgtgt
1440aaactgctgg aagttcttcc acagtcaggt caattttgtc aaacccttct
ctgtacccat 1500acagcagcag cctagcaact ctgctggtga tgggagttgt
attttcagtc ttcgccaggt 1560cattgagatc catccactca catcttaagc
attcttcctg gcaaaaattt atggtgaatg 1620aatatggctt taggcggcag
atgatataca tatctgactt cccaaaagct ccaggatttg 1680tgtgctgttg
ccgaatactc aggacggacc tgaattctga ttttatacca gtctcttcaa
1740aaacttctcg aaccgctgtg tctcctacgt aaaaaaagag atgtacaaat
caataataat 1800tacactttta gaaactgtat catcaaagat tttcagttaa
agtagcatta tgtaaaggct 1860caaaacatta ccctaacaaa gtaaagtttt
caatacaaat tctttgcctt gtggatatca 1920agaaatccca aaatattttc
ttaccactgt aaattcaaga agcttttgaa atgctgaata 1980tttctttggc
tgctacttgg aggcttatct acctgtacat ttttggggtc agctcttttt
2040aacttcttgc tgctcttttt cccaaaaggt aaaaatatag attgaaaagt
taaaacattt 2100tgcatggctg cagttccttt gtttcttgag ataagattcc
aaagaactta gattcatttc 2160ttcaacaccg aaatgctgga ggtgtttgat
cagttttcaa gaaacttgga atataaataa 2220ttttataatt caacaaaggt
tttcacattt tataaggttg atttttcaat taaatgcaaa 2280tttgtgtggc
aggattttta ttgccattaa catatttttg tggctgcttt ttctacacat
2340ccagatggtc cctctaactg ggctttctct aattttgtga tgttctgtca
ttgtctccca 2400aagtatttag gagaagccct ttaaaaagct gccttcctct
accactttgc tggaaagctt 2460cacaattgtc acagacaaag atttttgttc
caatactcgt tttgcctcta tttttcttgt 2520ttgtcaaata gtaaatgata
tttgcccttg cagtaattct actggtgaaa aacatgcaaa 2580gaagaggaag
tcacagaaac atgtctcaat tcccatgtgc tgtgactgta gactgtctta
2640ccatagactg tcttacccat cccctggata tgctcttgtt ttttccctct
aatagctatg 2700gaaagatgca tagaaagagt ataatgtttt aaaacataag
gcattcgtct gccatttttc 2760aattacatgc tgacttccct tacaattgag
atttgcccat aggttaaaca tggttagaaa 2820caactgaaag cataaaagaa
aaatctaggc cgggtgcagt ggctcatgcc tatattccct 2880gcactttggg
aggccaaagc aggaggatcg cttgagccca ggagttcaag accaacctgg
2940tgaaaccccg tctctacaaa aaaacacaaa aaatagccag gcatggtggc
gtgtacatgt 3000ggtctcagat acttgggagg ctgaggtggg agggttgatc
acttgaggct gagaggtcaa 3060ggttgcagtg agccataatc gtgccactgc
agtccagcct aggcaacaga gtgagacttt 3120gtctcaaaaa aagagaaatt
ttccttaata agaaaagtaa tttttactct gatgtgcaat 3180acatttgtta
ttaaatttat tatttaagat ggtagcacta gtcttaaatt gtataaaata
3240tcccctaaca tgtttaaatg tccattttta ttcattatgc tttgaaaaat
aattatgggg 3300aaatacatgt ttgttattaa atttattatt aaagatagta
gcactagtct taaatttgat 3360ataacatctc ctaacttgtt taaatgtcca
tttttattct ttatgtttga aaataaatta 3420tggggatcct atttagctct
tagtaccact aatcaaaagt tcggcatgta gctcatgatc 3480tatgctgttt
ctatgtcgtg gaagcaccgg atgggggtag tgagcaaatc tgccctgctc
3540agcagtcacc atagcagctg actgaaaatc agcactgcct gagtagtttt
gatcagttta 3600acttgaatca ctaactgact gaaaattgaa tgggcaaata
agtgcttttg tctccagagt 3660atgcgggaga cccttccacc tcaagatgga
tatttcttcc ccaaggattt caagatgaat 3720tgaaattttt aatcaagata
gtgtgcttta ttctgttgta ttttttatta ttttaatata 3780ctgtaagcca
aactgaaata acatttgctg ttttataggt ttgaagaaca taggaaaaac
3840taagaggttt tgtttttatt tttgctgatg aagagatatg tttaaatatg
ttgtattgtt 3900ttgtttagtt acaggacaat aatgaaatgg agtttatatt
tgttatttct attttgttat 3960atttaataat agaattagat tgaaataaaa
tataatggga aataatctgc agaatgtggg 4020ttttcctggt gtttccctct
gactctagtg cactgatgat ctctgataag gctcagctgc 4080tttatagttc
tctggctaat gcagcagata ctcttcctgc cagtggtaat acgatttttt
4140aagaaggcag tttgtcaatt ttaatcttgt ggataccttt atactcttag
ggtattattt 4200tatacaaaag ccttgaggat tgcattctat tttctatatg
accctcttga tatttaaaaa 4260acactatgga taacaattct tcatttacct
agtattatga aagaatgaag gagttcaaac 4320aaatgtgttt cccagttaac
tagggtttac tgtttgagcc aatataaatg tttaactgtt 4380tgtgatggca
gtattcctaa agtacattgc atgttttcct aaatacagag tttaaataat
4440ttcagtaatt cttagatgat tcagcttcat cattaagaat atcttttgtt
ttatgttgag 4500ttagaaatgc cttcatatag acatagtctt tcagacctct
actgtcagtt ttcatttcta 4560gctgctttca gggttttatg aattttcagg
caaagcttta atttatacta agcttaggaa 4620gtatggctaa tgccaacggc
agtttttttc ttcttaattc cacatgactg aggcatatat 4680gatctctggg
taggtgagtt gttgtgacaa ccacaagcac tttttttttt tttaaagaaa
4740aaaaggtagt gaatttttaa tcatctggac tttaagaagg attctggagt
atacttaggc 4800ctgaaattat atatatttgg cttggaaatg tgtttttctt
caattacatc tacaagtaag 4860tacagctgaa attcagagga cccataagag
ttcacatgaa aaaaatcaat ttatttgaaa 4920aggcaagatg caggagagag
gaagccttgc aaacctgcag actgcttttt gcccaatata 4980gattgggtaa
ggctgcaaaa cataagctta attagctcac atgctctgct ctcacgtggc
5040accagtggat agtgtgagag aattaggctg tagaacaaat ggccttctct
ttcagcattc 5100acaccactac aaaatcatct tttatatcaa cagaagaata
agcataaact aagcaaaagg 5160tcaataagta cctgaaacca agattggcta
gagatatatc ttaatgcaat ccattttctg 5220atggattgtt acgagttggc
tatataatgt atgtatggta ttttgatttg tgtaaaagtt 5280ttaaaaatca
agctttaagt acatggacat ttttaaataa aatatttaaa gacaatttag
5340aaaattgcct taatatcatt gttggctaaa tagaataggg gacatgcata
ttaaggaaaa 5400ggtcatggag aaataatatt ggtatcaaac aaatacattg
atttgtcatg atacacattg 5460aatttgatcc aatagtttaa ggaataggta
ggaaaatttg gtttctattt ttcgatttcc 5520tgtaaatcag tgacataaat
aattcttagc ttattttata tttccttgtc ttaaatactg 5580agctcagtaa
gttgtgttag gggattattt ctcagttgag actttcttat atgacatttt
5640actatgtttt gacttcctga ctattaaaaa taaatagtag atacaatttt
cataaagtga 5700agaattatat aatcactgct ttataactga ctttattata
tttatttcaa agttcattta 5760aaggctacta ttcatcctct gtgatggaat
ggtcaggaat ttgttttctc atagtttaat 5820tccaacaaca atattagtcg
tatccaaaat aacctttaat gctaaacttt actgatgtat 5880atccaaagct
tctcattttc agacagatta atccagaagc agtcataaac agaagaatag
5940gtggtatgtt cctaatgata ttatttctac taatggaata aactgtaata
ttagaaatta 6000tgctgctaat tatatcagct ctgaggtaat ttctgaaatg
ttcagactca gtcggaacaa 6060attggaaaat ttaaattttt attcttagct
ataaagcaag aaagtaaaca cattaatttc 6120ctcaacattt ttaagccaat
taaaaatata aaagatacac accaatatct tcttcaggct 6180ctgacaggcc
tcctggaaac ttccacatat ttttcaactg cagtataaag tcagaaaata
6240aagttaacat aactttcact aacacacaca tatgtagatt tcacaaaatc
cacctataat 6300tggtcaaagt ggttgagaat atatttttta gtaattgcat
gcaaaatttt tctagcttcc 6360atcctttctc cctcgtttct tctttttttg
ggggagctgg taactgatga aatcttttcc 6420caccttttct cttcaggaaa
tataagtggt tttgtttggt taacgtgata cattctgtat 6480gaatgaaaca
ttggagggaa acatctactg aatttctgta atttaaaata ttttgctgct
6540agttaactat gaacagatag aagaatctta cagatgctgc tataaataag
tagaaaatat 6600aaatttcatc actaaaatat gctattttaa aatctatttc
ctatattgta tttctaatca 6660gatgtattac tcttattatt tctattgtat
gtgttaatga ttttatgtaa aaatgtaatt 6720gcttttcatg agtagtatga
ataaaattga ttagtttgtg ttttcttgtc tccc 6774716002DNAhomo sapiens
71gaggaaagga gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa
60gagggagttc agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat
120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag
gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag
cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg
tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga
caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac
taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga
420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca
ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg
gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg
aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt
aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa
atgtcagccc tggagttcca tgataccaca cgaacacagc tttttgcctt
720cgagctatcg gggtaaagac ctacaggaaa actactgtcg aaatcctcga
ggggaagaag 780ggggaccctg gtgtttcaca agcaatccag aggtacgcta
cgaagtctgt gacattcctc 840agtgttcaga agttgaatgc atgacctgca
atggggagag ttatcgaggt ctcatggatc 900atacagaatc aggcaagatt
tgtcagcgct gggatcatca gacaccacac cggcacaaat 960tcttgcctga
aagatatccc gacaagggct ttgatgataa ttattgccgc aatcccgatg
1020gccagccgag gccatggtgc tatactcttg accctcacac ccgctgggag
tactgtgcaa 1080ttaaaacatg cgctgacaat actatgaatg acactgatgt
tcctttggaa acaactgaat 1140gcatccaagg tcaaggagaa ggctacaggg
gcactgtcaa taccatttgg aatggaattc 1200catgtcagcg ttgggattct
cagtatcctc acgagcatga catgactcct gaaaatttca 1260agtgcaagga
cctacgagaa aattactgcc gaaatccaga tgggtctgaa tcaccctggt
1320gttttaccac tgatccaaac atccgagttg gctactgctc ccaaattcca
aactgtgata 1380tgtcacatgg acaagattgt tatcgtggga atggcaaaaa
ttatatgggc aacttatccc 1440aaacaagatc tggactaaca tgttcaatgt
gggacaagaa catggaagac ttacatcgtc 1500atatcttctg ggaaccagat
gcaagtaagc tgaatgagaa ttactgccga aatccagatg 1560atgatgctca
tggaccctgg tgctacacgg gaaatccact cattccttgg gattattgcc
1620ctatttctcg ttgtgaaggt gataccacac ctacaatagt caatttagac
catcccgtaa 1680tatcttgtgc caaaacgaaa caattgcgag ttgtaaatgg
gattccaaca cgaacaaaca 1740taggatggat ggttagtttg agatacagaa
ataaacatat ctgcggagga tcattgataa 1800aggagagttg ggttcttact
gcacgacagt gtttcccttc tcgagacttg aaagattatg 1860aagcttggct
tggaattcat gatgtccacg gaagaggaga tgagaaatgc aaacaggttc
1920tcaatgtttc ccagctggta tatggccctg aaggatcaga tctggtttta
atgaagcttg 1980ccaggcctgc tgtcctggat gattttgtta gtacgattga
tttacctaat tatggatgca 2040caattcctga aaagaccagt tgcagtgttt
atggctgggg ctacactgga ttgatcaact 2100atgatggcct attacgagtg
gcacatctct atataatggg aaatgagaaa tgcagccagc 2160atcatcgagg
gaaggtgact ctgaatgagt ctgaaatatg tgctggggct gaaaagattg
2220gatcaggacc atgtgagggg gattatggtg gcccacttgt ttgtgagcaa
cataaaatga 2280gaatggttct tggtgtcatt gttcctggtc gtggatgtgc
cattccaaat cgtcctggta 2340tttttgtccg agtagcatat tatgcaaaat
ggatacacaa aattatttta acatataagg 2400taccacagtc atagctgaag
taagtgtgtc tgaagcaccc accaatacaa ctgtctttta 2460catgaagatt
tcagagaatg tggaatttaa aatgtcactt acaacaatcc taagacaact
2520actggagagt catgtttgtt gaaattctca ttaatgttta tgggtgtttt
ctgttgtttt 2580gtttgtcagt gttattttgt caatgttgaa gtgaattaag
gtacatgcaa gtgtaataac 2640atatctcctg aagatacttg aatggattaa
aaaaacacac aggtatattt gctggatgat 2700aaagatttca tgggaaaaaa
aatcaattaa tctgtctaag ctgctttctg atgttggttt 2760cttaataatg
agtaaaccac aaattaaatg ttattttaac ctcaccaaaa caatttatac
2820cttgtgtccc taaattgtag ccctatatta aattatatta catttcatat
gctatatgtt 2880atagttcatt catttctctt caccatgtat cctgcaatac
tggtacacga acacactttt 2940tacaaaacca catacccatg tacacatgcc
taggtacaca tgtgcatgca ctacagttta 3000aattatggtg tacctaatgt
aacccctaaa tattttagaa gtatgtacct atagttttac 3060ctcaaaaaaa
ccagaaatct ctaaagacca gtagaaatat taaaaaatga tgcaagatca
3120aaatgattag ctaattctcc atacataatc tgcagatgat cttctttggt
tggcatttca 3180ggtgtggcca tcacccagag ttaaataaca
cctaatctag gtgtttacat gtattcatta 3240tcctagttat ttcatgtagt
ttctaattct taaaggaaag agggtaatag ttctatttgt 3300gtaatttgtt
tcctccaaac ttaaggccac ttatttacac aagatatttg tagatctatt
3360ttcctaaagc atttcttaag tgctcagatc agtatctaat tgaagaagtt
taaaagtgtt 3420ttggtcatta aaaatgtact taaataggtt aaatctaagc
cttgctgctg tgattggctt 3480ctagctcact gcctttaaat tttaaaaaat
ttaagaggaa aatttccaag tctccaaagt 3540tttataaata cccttcatca
agtcatgcat taaagtatat attggagaaa aaaataaaaa 3600tacttttctc
aacctggaag attttagcct aataaagctt ttttgaagta aaagacaact
3660tgtaaaagga aagaaactag tttgtctcaa ctctgtattc atttattttt
tttttgaagt 3720agagtggaat ctgttgaatc agatatttta tcaagatatg
tttatttttt cttatttcat 3780tttacaaagt tcactcctaa tgccatatgt
aacagacatt taaattttgt gttctgtata 3840acagccaaat tatcatattt
atcattgtat ttgtcatgct tagctaaaga tcatgtattt 3900gttgagaaat
agaataacaa aaagtaatag gataggcttt gaatttttgc agaaatcttc
3960ctgtacaaaa cacctttaaa aataattttt tgaatggtgt gaatccagta
gtcccatttc 4020tctgacttag ttttcttgag tgatttttat caaggccaag
tccccaaaca attccctacc 4080agctctttag agtactgttc aatctggact
aaaatggttt taagtttatg gagagcttag 4140tccacagaat atagggcggc
gagtccagaa atgcttatac aatttttttt tcataataag 4200atatgtgctg
gcatcaagaa acttaaagtg gaagcaaaaa gacatccaac tagttgctgg
4260tctctatcat cttatctgat ggtatttcta ttttccttat ataatacacc
attttagtaa 4320gaactcctag aaatttcaag agcatattgc caaaatataa
agtatatttc atagtttctt 4380ctggctgaac cagtgaaatt ttattattgc
atattaatga tatttgtaaa acttttataa 4440aaattgtcat aattttaaat
actcacattt taaaaatact tctttaatga ctcttcctct 4500aaatttcctg
gaaatacaga taaagattag ctagatacaa gatacagcta agtatttaga
4560cattttgagg ctagtatttt tcattttatt aaaggctaaa aacaatacca
ccaataaatc 4620atcaaacaaa ccgtacaaag taattctctc tttgggaggc
tcctttcgtg atagagggac 4680atgggtggaa ttgacaatga aacttagatg
aacaaggtcc atgttatttt aggtggtaga 4740acagggtaga gtcatgtcat
tatttgctgg tggaagacac tatttaccag gtgttctttg 4800ctgaataaat
cattaaacat ttttaaaaat ccaacaatcc actttatttt gtgtcattga
4860caaaaggatc ttttaaatca gaaggtttca atgcaatttt tggtttggct
gtttgaataa 4920tggttatgta ctgttataat tgtagacatt ttctcacgtc
taccaggaat tgaagtgtaa 4980aactaaaata tttttcataa tgcctctgcc
gtgcagaagg aatgataatc cttttgtata 5040cttctttaat tttattgtaa
aatgtgtaat gacttttacc tatatgctgt gggcaggtcc 5100tcagtaaaat
ctattgagtc aatttctagt attaacaggc ttttgcttgc tatctaagtg
5160tttcaaatta tgggaagtgt gagacactgg aaggcaagaa aattaacaat
aatggcatgt 5220gatagcaaaa ttgtatttca cttattcctg tgaatatttc
ttgttggtac caatggtact 5280gtacaaagtg aatgttatag ccacaacatt
ctcttgaaaa gaacactgtc aagaagtggg 5340aaattgctgt caggcatttc
attgttgttt ttaaactttt ttaaaagaaa tactggtttt 5400gcaatataga
gatcatgtgg taaagaattt taataagatc ttatactaaa aagccttaaa
5460tcaatttatt gagattcaaa aaatactatt ataattaatt acatcccata
catataggca 5520aactcattta aaaaataaaa ctaattttgg taaaagtaca
tggcctttgt ttttaaaata 5580cataatttta aaataaatca cttgtcatga
taaagtccaa aaagaagtta tcattcaaca 5640ttcaactaag gttggagcta
agaatttact aatacaaaaa aagttaaaat tttttggacc 5700atatatatct
tgacagtgta acttttaagt aggttcattt ccatttgcac agaaagtttc
5760tgtctttagg aaactgaaaa tgaaatactg tggatgctat gactgtttgt
cttgtatgta 5820aataggaaat taataagctg cctattgagt ggtatagctg
tatgcttacc caaaaaaggg 5880aacactgtgg ttatgacttg tattataaac
tttctgtagt taataaagtt gttattttta 5940taaccatgat tatattatta
ttattaataa aatattttat caaaatgaaa aaaaaaaaaa 6000aa 600272728PRThomo
sapiens 72Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His
Val Leu1 5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala
Glu Gly Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys
Ser Ala Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile
Lys Thr Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys
Thr Arg Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val
Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser
Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp
Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly
Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser
Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150
155 160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn
Tyr 165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys
Phe Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile
Pro Gln Cys Ser Glu 195 200 205Val Glu Cys Met Thr Cys Asn Gly Glu
Ser Tyr Arg Gly Leu Met Asp 210 215 220His Thr Glu Ser Gly Lys Ile
Cys Gln Arg Trp Asp His Gln Thr Pro225 230 235 240His Arg His Lys
Phe Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255Asp Asn
Tyr Cys Arg Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265
270Thr Leu Asp Pro His Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys
275 280 285Ala Asp Asn Thr Met Asn Asp Thr Asp Val Pro Leu Glu Thr
Thr Glu 290 295 300Cys Ile Gln Gly Gln Gly Glu Gly Tyr Arg Gly Thr
Val Asn Thr Ile305 310 315 320Trp Asn Gly Ile Pro Cys Gln Arg Trp
Asp Ser Gln Tyr Pro His Glu 325 330 335His Asp Met Thr Pro Glu Asn
Phe Lys Cys Lys Asp Leu Arg Glu Asn 340 345 350Tyr Cys Arg Asn Pro
Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr 355 360 365Asp Pro Asn
Ile Arg Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys Asp 370 375 380Met
Ser His Gly Gln Asp Cys Tyr Arg Gly Asn Gly Lys Asn Tyr Met385 390
395 400Gly Asn Leu Ser Gln Thr Arg Ser Gly Leu Thr Cys Ser Met Trp
Asp 405 410 415Lys Asn Met Glu Asp Leu His Arg His Ile Phe Trp Glu
Pro Asp Ala 420 425 430Ser Lys Leu Asn Glu Asn Tyr Cys Arg Asn Pro
Asp Asp Asp Ala His 435 440 445Gly Pro Trp Cys Tyr Thr Gly Asn Pro
Leu Ile Pro Trp Asp Tyr Cys 450 455 460Pro Ile Ser Arg Cys Glu Gly
Asp Thr Thr Pro Thr Ile Val Asn Leu465 470 475 480Asp His Pro Val
Ile Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val 485 490 495Asn Gly
Ile Pro Thr Arg Thr Asn Ile Gly Trp Met Val Ser Leu Arg 500 505
510Tyr Arg Asn Lys His Ile Cys Gly Gly Ser Leu Ile Lys Glu Ser Trp
515 520 525Val Leu Thr Ala Arg Gln Cys Phe Pro Ser Arg Asp Leu Lys
Asp Tyr 530 535 540Glu Ala Trp Leu Gly Ile His Asp Val His Gly Arg
Gly Asp Glu Lys545 550 555 560Cys Lys Gln Val Leu Asn Val Ser Gln
Leu Val Tyr Gly Pro Glu Gly 565 570 575Ser Asp Leu Val Leu Met Lys
Leu Ala Arg Pro Ala Val Leu Asp Asp 580 585 590Phe Val Ser Thr Ile
Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu 595 600 605Lys Thr Ser
Cys Ser Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile Asn 610 615 620Tyr
Asp Gly Leu Leu Arg Val Ala His Leu Tyr Ile Met Gly Asn Glu625 630
635 640Lys Cys Ser Gln His His Arg Gly Lys Val Thr Leu Asn Glu Ser
Glu 645 650 655Ile Cys Ala Gly Ala Glu Lys Ile Gly Ser Gly Pro Cys
Glu Gly Asp 660 665 670Tyr Gly Gly Pro Leu Val Cys Glu Gln His Lys
Met Arg Met Val Leu 675 680 685Gly Val Ile Val Pro Gly Arg Gly Cys
Ala Ile Pro Asn Arg Pro Gly 690 695 700Ile Phe Val Arg Val Ala Tyr
Tyr Ala Lys Trp Ile His Lys Ile Ile705 710 715 720Leu Thr Tyr Lys
Val Pro Gln Ser 725731369DNAhomo sapiens 73gaggaaagga gggggctgga
agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat
ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc
tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca
180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg
tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca
tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa
gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc
aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga
ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca
480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc
aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct
ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca
gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc
tggagttcca tgataccaca cgaacacagc tttttgcctt 720cgagctatcg
gggtaaagac ctacaggaaa actactgtcg aaatcctcga ggggaagaag
780ggggaccctg gtgtttcaca agcaatccag aggtacgcta cgaagtctgt
gacattcctc 840agtgttcaga agttgaatgc atgacctgca atggggagag
ttatcgaggt ctcatggatc 900atacagaatc aggcaagatt tgtcagcgct
gggatcatca gacaccacac cggcacaaat 960tcttgcctga aagatatccc
gacaagggct ttgatgataa ttattgccgc aatcccgatg 1020gccagccgag
gccatggtgc tatactcttg accctcacac ccgctgggag tactgtgcaa
1080ttaaaacatg cgagacataa catgggctct caactgatgg tgaacttctt
ctggtgagtg 1140acagaggctg cagtgaagaa taatgagtct aatagaagtt
tatcacagat gtctctaatc 1200tttatagctg atccctacct ctctcgctgt
ctttgtaccc agcctgcatt ctgtttcgat 1260ctgtctttta gcagtccata
caatcatttt tctacatgct ggcccttacc tagcttttct 1320gaatttacaa
taaaaactat tttttaacgt gaaaaaaaaa aaaaaaaaa 136974290PRThomo sapiens
74Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1
5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly
Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala
Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr
Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg
Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp
Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser
Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr
Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly
Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile
Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155
160Ser Phe Leu Pro Ser Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr
165 170 175Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe
Thr Ser 180 185 190Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro
Gln Cys Ser Glu 195 200 205Val Glu Cys Met Thr Cys Asn Gly Glu Ser
Tyr Arg Gly Leu Met Asp 210 215 220His Thr Glu Ser Gly Lys Ile Cys
Gln Arg Trp Asp His Gln Thr Pro225 230 235 240His Arg His Lys Phe
Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255Asp Asn Tyr
Cys Arg Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265 270Thr
Leu Asp Pro His Thr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys 275 280
285Glu Thr 290755987DNAhomo sapiens 75gaggaaagga gggggctgga
agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat
ctttccagtt aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc
tcagagccga ctggctcttt taggcactga ctccgaacag gattctttca
180cccaggcatc tcctccagag ggatccgcca gcccgtccag cagcaccatg
tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg tcctcctgca
tctcctcctg ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa
gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc
aaaatagatc cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga
ccaatgtgct aatagatgta ctaggaataa aggacttcca ttcacttgca
480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg gttccccttc
aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg aatttgacct
ctatgaaaac aaagactaca 600ttagaaactg catcattggt aaaggacgca
gctacaaggg aacagtatct atcactaaga 660gtggcatcaa atgtcagccc
tggagttcca tgataccaca cgaacacagc tatcggggta 720aagacctaca
ggaaaactac tgtcgaaatc ctcgagggga agaaggggga ccctggtgtt
780tcacaagcaa tccagaggta cgctacgaag tctgtgacat tcctcagtgt
tcagaagttg 840aatgcatgac ctgcaatggg gagagttatc gaggtctcat
ggatcataca gaatcaggca 900agatttgtca gcgctgggat catcagacac
cacaccggca caaattcttg cctgaaagat 960atcccgacaa gggctttgat
gataattatt gccgcaatcc cgatggccag ccgaggccat 1020ggtgctatac
tcttgaccct cacacccgct gggagtactg tgcaattaaa acatgcgctg
1080acaatactat gaatgacact gatgttcctt tggaaacaac tgaatgcatc
caaggtcaag 1140gagaaggcta caggggcact gtcaatacca tttggaatgg
aattccatgt cagcgttggg 1200attctcagta tcctcacgag catgacatga
ctcctgaaaa tttcaagtgc aaggacctac 1260gagaaaatta ctgccgaaat
ccagatgggt ctgaatcacc ctggtgtttt accactgatc 1320caaacatccg
agttggctac tgctcccaaa ttccaaactg tgatatgtca catggacaag
1380attgttatcg tgggaatggc aaaaattata tgggcaactt atcccaaaca
agatctggac 1440taacatgttc aatgtgggac aagaacatgg aagacttaca
tcgtcatatc ttctgggaac 1500cagatgcaag taagctgaat gagaattact
gccgaaatcc agatgatgat gctcatggac 1560cctggtgcta cacgggaaat
ccactcattc cttgggatta ttgccctatt tctcgttgtg 1620aaggtgatac
cacacctaca atagtcaatt tagaccatcc cgtaatatct tgtgccaaaa
1680cgaaacaatt gcgagttgta aatgggattc caacacgaac aaacatagga
tggatggtta 1740gtttgagata cagaaataaa catatctgcg gaggatcatt
gataaaggag agttgggttc 1800ttactgcacg acagtgtttc ccttctcgag
acttgaaaga ttatgaagct tggcttggaa 1860ttcatgatgt ccacggaaga
ggagatgaga aatgcaaaca ggttctcaat gtttcccagc 1920tggtatatgg
ccctgaagga tcagatctgg ttttaatgaa gcttgccagg cctgctgtcc
1980tggatgattt tgttagtacg attgatttac ctaattatgg atgcacaatt
cctgaaaaga 2040ccagttgcag tgtttatggc tggggctaca ctggattgat
caactatgat ggcctattac 2100gagtggcaca tctctatata atgggaaatg
agaaatgcag ccagcatcat cgagggaagg 2160tgactctgaa tgagtctgaa
atatgtgctg gggctgaaaa gattggatca ggaccatgtg 2220agggggatta
tggtggccca cttgtttgtg agcaacataa aatgagaatg gttcttggtg
2280tcattgttcc tggtcgtgga tgtgccattc caaatcgtcc tggtattttt
gtccgagtag 2340catattatgc aaaatggata cacaaaatta ttttaacata
taaggtacca cagtcatagc 2400tgaagtaagt gtgtctgaag cacccaccaa
tacaactgtc ttttacatga agatttcaga 2460gaatgtggaa tttaaaatgt
cacttacaac aatcctaaga caactactgg agagtcatgt 2520ttgttgaaat
tctcattaat gtttatgggt gttttctgtt gttttgtttg tcagtgttat
2580tttgtcaatg ttgaagtgaa ttaaggtaca tgcaagtgta ataacatatc
tcctgaagat 2640acttgaatgg attaaaaaaa cacacaggta tatttgctgg
atgataaaga tttcatggga 2700aaaaaaatca attaatctgt ctaagctgct
ttctgatgtt ggtttcttaa taatgagtaa 2760accacaaatt aaatgttatt
ttaacctcac caaaacaatt tataccttgt gtccctaaat 2820tgtagcccta
tattaaatta tattacattt catatgctat atgttatagt tcattcattt
2880ctcttcacca tgtatcctgc aatactggta cacgaacaca ctttttacaa
aaccacatac 2940ccatgtacac atgcctaggt acacatgtgc atgcactaca
gtttaaatta tggtgtacct 3000aatgtaaccc ctaaatattt tagaagtatg
tacctatagt tttacctcaa aaaaaccaga 3060aatctctaaa gaccagtaga
aatattaaaa aatgatgcaa gatcaaaatg attagctaat 3120tctccataca
taatctgcag atgatcttct ttggttggca tttcaggtgt ggccatcacc
3180cagagttaaa taacacctaa tctaggtgtt tacatgtatt cattatccta
gttatttcat 3240gtagtttcta attcttaaag gaaagagggt aatagttcta
tttgtgtaat ttgtttcctc 3300caaacttaag gccacttatt tacacaagat
atttgtagat ctattttcct aaagcatttc 3360ttaagtgctc agatcagtat
ctaattgaag aagtttaaaa gtgttttggt cattaaaaat 3420gtacttaaat
aggttaaatc taagccttgc tgctgtgatt ggcttctagc tcactgcctt
3480taaattttaa aaaatttaag aggaaaattt ccaagtctcc aaagttttat
aaataccctt 3540catcaagtca tgcattaaag tatatattgg agaaaaaaat
aaaaatactt ttctcaacct 3600ggaagatttt agcctaataa agcttttttg
aagtaaaaga caacttgtaa aaggaaagaa 3660actagtttgt ctcaactctg
tattcattta tttttttttt gaagtagagt ggaatctgtt 3720gaatcagata
ttttatcaag atatgtttat tttttcttat ttcattttac aaagttcact
3780cctaatgcca tatgtaacag acatttaaat tttgtgttct gtataacagc
caaattatca 3840tatttatcat tgtatttgtc atgcttagct aaagatcatg
tatttgttga gaaatagaat 3900aacaaaaagt aataggatag gctttgaatt
tttgcagaaa tcttcctgta caaaacacct 3960ttaaaaataa ttttttgaat
ggtgtgaatc cagtagtccc atttctctga cttagttttc 4020ttgagtgatt
tttatcaagg ccaagtcccc aaacaattcc ctaccagctc tttagagtac
4080tgttcaatct ggactaaaat ggttttaagt ttatggagag cttagtccac
agaatatagg 4140gcggcgagtc cagaaatgct tatacaattt ttttttcata
ataagatatg tgctggcatc 4200aagaaactta aagtggaagc aaaaagacat
ccaactagtt gctggtctct atcatcttat 4260ctgatggtat ttctattttc
cttatataat acaccatttt agtaagaact cctagaaatt 4320tcaagagcat
attgccaaaa tataaagtat atttcatagt ttcttctggc tgaaccagtg
4380aaattttatt attgcatatt aatgatattt gtaaaacttt tataaaaatt
gtcataattt 4440taaatactca cattttaaaa atacttcttt aatgactctt
cctctaaatt tcctggaaat 4500acagataaag attagctaga tacaagatac
agctaagtat ttagacattt tgaggctagt 4560atttttcatt
ttattaaagg ctaaaaacaa taccaccaat aaatcatcaa acaaaccgta
4620caaagtaatt ctctctttgg gaggctcctt tcgtgataga gggacatggg
tggaattgac 4680aatgaaactt agatgaacaa ggtccatgtt attttaggtg
gtagaacagg gtagagtcat 4740gtcattattt gctggtggaa gacactattt
accaggtgtt ctttgctgaa taaatcatta 4800aacattttta aaaatccaac
aatccacttt attttgtgtc attgacaaaa ggatctttta 4860aatcagaagg
tttcaatgca atttttggtt tggctgtttg aataatggtt atgtactgtt
4920ataattgtag acattttctc acgtctacca ggaattgaag tgtaaaacta
aaatattttt 4980cataatgcct ctgccgtgca gaaggaatga taatcctttt
gtatacttct ttaattttat 5040tgtaaaatgt gtaatgactt ttacctatat
gctgtgggca ggtcctcagt aaaatctatt 5100gagtcaattt ctagtattaa
caggcttttg cttgctatct aagtgtttca aattatggga 5160agtgtgagac
actggaaggc aagaaaatta acaataatgg catgtgatag caaaattgta
5220tttcacttat tcctgtgaat atttcttgtt ggtaccaatg gtactgtaca
aagtgaatgt 5280tatagccaca acattctctt gaaaagaaca ctgtcaagaa
gtgggaaatt gctgtcaggc 5340atttcattgt tgtttttaaa cttttttaaa
agaaatactg gttttgcaat atagagatca 5400tgtggtaaag aattttaata
agatcttata ctaaaaagcc ttaaatcaat ttattgagat 5460tcaaaaaata
ctattataat taattacatc ccatacatat aggcaaactc atttaaaaaa
5520taaaactaat tttggtaaaa gtacatggcc tttgttttta aaatacataa
ttttaaaata 5580aatcacttgt catgataaag tccaaaaaga agttatcatt
caacattcaa ctaaggttgg 5640agctaagaat ttactaatac aaaaaaagtt
aaaatttttt ggaccatata tatcttgaca 5700gtgtaacttt taagtaggtt
catttccatt tgcacagaaa gtttctgtct ttaggaaact 5760gaaaatgaaa
tactgtggat gctatgactg tttgtcttgt atgtaaatag gaaattaata
5820agctgcctat tgagtggtat agctgtatgc ttacccaaaa aagggaacac
tgtggttatg 5880acttgtatta taaactttct gtagttaata aagttgttat
ttttataacc atgattatat 5940tattattatt aataaaatat tttatcaaaa
tgaaaaaaaa aaaaaaa 598776723PRThomo sapiens 76Met Trp Val Thr Lys
Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu
Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg
Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu
Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn
Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75
80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys
85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu
Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile
Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr
Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser
Ser Met Ile Pro His Glu His145 150 155 160Ser Tyr Arg Gly Lys Asp
Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg 165 170 175Gly Glu Glu Gly
Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu Val Arg 180 185 190Tyr Glu
Val Cys Asp Ile Pro Gln Cys Ser Glu Val Glu Cys Met Thr 195 200
205Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp His Thr Glu Ser Gly
210 215 220Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro His Arg His
Lys Phe225 230 235 240Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp
Asp Asn Tyr Cys Arg 245 250 255Asn Pro Asp Gly Gln Pro Arg Pro Trp
Cys Tyr Thr Leu Asp Pro His 260 265 270Thr Arg Trp Glu Tyr Cys Ala
Ile Lys Thr Cys Ala Asp Asn Thr Met 275 280 285Asn Asp Thr Asp Val
Pro Leu Glu Thr Thr Glu Cys Ile Gln Gly Gln 290 295 300Gly Glu Gly
Tyr Arg Gly Thr Val Asn Thr Ile Trp Asn Gly Ile Pro305 310 315
320Cys Gln Arg Trp Asp Ser Gln Tyr Pro His Glu His Asp Met Thr Pro
325 330 335Glu Asn Phe Lys Cys Lys Asp Leu Arg Glu Asn Tyr Cys Arg
Asn Pro 340 345 350Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr Asp
Pro Asn Ile Arg 355 360 365Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys
Asp Met Ser His Gly Gln 370 375 380Asp Cys Tyr Arg Gly Asn Gly Lys
Asn Tyr Met Gly Asn Leu Ser Gln385 390 395 400Thr Arg Ser Gly Leu
Thr Cys Ser Met Trp Asp Lys Asn Met Glu Asp 405 410 415Leu His Arg
His Ile Phe Trp Glu Pro Asp Ala Ser Lys Leu Asn Glu 420 425 430Asn
Tyr Cys Arg Asn Pro Asp Asp Asp Ala His Gly Pro Trp Cys Tyr 435 440
445Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys Pro Ile Ser Arg Cys
450 455 460Glu Gly Asp Thr Thr Pro Thr Ile Val Asn Leu Asp His Pro
Val Ile465 470 475 480Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val
Asn Gly Ile Pro Thr 485 490 495Arg Thr Asn Ile Gly Trp Met Val Ser
Leu Arg Tyr Arg Asn Lys His 500 505 510Ile Cys Gly Gly Ser Leu Ile
Lys Glu Ser Trp Val Leu Thr Ala Arg 515 520 525Gln Cys Phe Pro Ser
Arg Asp Leu Lys Asp Tyr Glu Ala Trp Leu Gly 530 535 540Ile His Asp
Val His Gly Arg Gly Asp Glu Lys Cys Lys Gln Val Leu545 550 555
560Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly Ser Asp Leu Val Leu
565 570 575Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp Phe Val Ser
Thr Ile 580 585 590Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu Lys
Thr Ser Cys Ser 595 600 605Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile
Asn Tyr Asp Gly Leu Leu 610 615 620Arg Val Ala His Leu Tyr Ile Met
Gly Asn Glu Lys Cys Ser Gln His625 630 635 640His Arg Gly Lys Val
Thr Leu Asn Glu Ser Glu Ile Cys Ala Gly Ala 645 650 655Glu Lys Ile
Gly Ser Gly Pro Cys Glu Gly Asp Tyr Gly Gly Pro Leu 660 665 670Val
Cys Glu Gln His Lys Met Arg Met Val Leu Gly Val Ile Val Pro 675 680
685Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly Ile Phe Val Arg Val
690 695 700Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile Ile Leu Thr Tyr
Lys Val705 710 715 720Pro Gln Ser771354DNAhomo sapiens 77gaggaaagga
gggggctgga agagagtaaa gggctgttgt taaacagttt cttaccgtaa 60gagggagttc
agacctagat ctttccagtt aatcacacaa caaacttagc tcatcgcaat
120aaaaagcagc tcagagccga ctggctcttt taggcactga ctccgaacag
gattctttca 180cccaggcatc tcctccagag ggatccgcca gcccgtccag
cagcaccatg tgggtgacca 240aactcctgcc agccctgctg ctgcagcatg
tcctcctgca tctcctcctg ctccccatcg 300ccatccccta tgcagaggga
caaaggaaaa gaagaaatac aattcatgaa ttcaaaaaat 360cagcaaagac
taccctaatc aaaatagatc cagcactgaa gataaaaacc aaaaaagtga
420atactgcaga ccaatgtgct aatagatgta ctaggaataa aggacttcca
ttcacttgca 480aggcttttgt ttttgataaa gcaagaaaac aatgcctctg
gttccccttc aatagcatgt 540caagtggagt gaaaaaagaa tttggccatg
aatttgacct ctatgaaaac aaagactaca 600ttagaaactg catcattggt
aaaggacgca gctacaaggg aacagtatct atcactaaga 660gtggcatcaa
atgtcagccc tggagttcca tgataccaca cgaacacagc tatcggggta
720aagacctaca ggaaaactac tgtcgaaatc ctcgagggga agaaggggga
ccctggtgtt 780tcacaagcaa tccagaggta cgctacgaag tctgtgacat
tcctcagtgt tcagaagttg 840aatgcatgac ctgcaatggg gagagttatc
gaggtctcat ggatcataca gaatcaggca 900agatttgtca gcgctgggat
catcagacac cacaccggca caaattcttg cctgaaagat 960atcccgacaa
gggctttgat gataattatt gccgcaatcc cgatggccag ccgaggccat
1020ggtgctatac tcttgaccct cacacccgct gggagtactg tgcaattaaa
acatgcgaga 1080cataacatgg gctctcaact gatggtgaac ttcttctggt
gagtgacaga ggctgcagtg 1140aagaataatg agtctaatag aagtttatca
cagatgtctc taatctttat agctgatccc 1200tacctctctc gctgtctttg
tacccagcct gcattctgtt tcgatctgtc ttttagcagt 1260ccatacaatc
atttttctac atgctggccc ttacctagct tttctgaatt tacaataaaa
1320actatttttt aacgtgaaaa aaaaaaaaaa aaaa 135478285PRThomo sapiens
78Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1
5 10 15Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly
Gln 20 25 30Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala
Lys Thr 35 40 45Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr
Lys Lys Val 50 55 60Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg
Asn Lys Gly Leu65 70 75 80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp
Lys Ala Arg Lys Gln Cys 85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser
Ser Gly Val Lys Lys Glu Phe 100 105 110Gly His Glu Phe Asp Leu Tyr
Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly
Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140Ser Gly Ile
Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His145 150 155
160Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg
165 170 175Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu
Val Arg 180 185 190Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu Val
Glu Cys Met Thr 195 200 205Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met
Asp His Thr Glu Ser Gly 210 215 220Lys Ile Cys Gln Arg Trp Asp His
Gln Thr Pro His Arg His Lys Phe225 230 235 240Leu Pro Glu Arg Tyr
Pro Asp Lys Gly Phe Asp Asp Asn Tyr Cys Arg 245 250 255Asn Pro Asp
Gly Gln Pro Arg Pro Trp Cys Tyr Thr Leu Asp Pro His 260 265 270Thr
Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys Glu Thr 275 280
285792102DNAhomo sapiens 79gaggaaagga gggggctgga agagagtaaa
gggctgttgt taaacagttt cttaccgtaa 60gagggagttc agacctagat ctttccagtt
aatcacacaa caaacttagc tcatcgcaat 120aaaaagcagc tcagagccga
ctggctcttt taggcactga ctccgaacag gattctttca 180cccaggcatc
tcctccagag ggatccgcca gcccgtccag cagcaccatg tgggtgacca
240aactcctgcc agccctgctg ctgcagcatg tcctcctgca tctcctcctg
ctccccatcg 300ccatccccta tgcagaggga caaaggaaaa gaagaaatac
aattcatgaa ttcaaaaaat 360cagcaaagac taccctaatc aaaatagatc
cagcactgaa gataaaaacc aaaaaagtga 420atactgcaga ccaatgtgct
aatagatgta ctaggaataa aggacttcca ttcacttgca 480aggcttttgt
ttttgataaa gcaagaaaac aatgcctctg gttccccttc aatagcatgt
540caagtggagt gaaaaaagaa tttggccatg aatttgacct ctatgaaaac
aaagactaca 600ttagaaactg catcattggt aaaggacgca gctacaaggg
aacagtatct atcactaaga 660gtggcatcaa atgtcagccc tggagttcca
tgataccaca cgaacacagc tttttgcctt 720cgagctatcg gggtaaagac
ctacaggaaa actactgtcg aaatcctcga ggggaagaag 780ggggaccctg
gtgtttcaca agcaatccag aggtacgcta cgaagtctgt gacattcctc
840agtgttcaga aggtaaataa acctgaatgc catgtgggcc attctattcc
ccctatgtgt 900agaactgtaa ctcacattaa aggttaacag caacgaatca
atcataacaa atatgttgtt 960cgtgcaaatg caactacaaa taattattta
aacattttta tacaatgttt ttaaaactgt 1020tggattatca ccagattaat
gcaaaataac agagcgagtt atcagtttga atttcaacac 1080tgcctgagac
atccctctgg ggaaagtgaa agagagggtt tacttaccta ctgtcttgag
1140ctcacatacc tcaaaatcta ctactgtgtg gcacctgaaa ggagttgaat
gaagcttagc 1200ctttcattag caatgttaat tctattcaac cagcacctgc
ttccacagaa attctgtcca 1260aactatcatg aagtggtgtg acaagggtat
atggacccag aagataatac aatataagaa 1320gggatcactg gaagcttgac
cccatgcaca ttttggtgaa aatgtgccta gaatcaaatg 1380tgacacgtag
gctggaactg agtaccattc agaataggat ctgaagagat caaagcaatg
1440gagaccacca aactgtcttg aaggcatgtc tatggacctt aagtccatgt
ctatgttttc 1500agctcttctc acagcataaa agggcattgt ccttactttt
gcagtggaaa actgaatggc 1560tgacaagatg gaagagtaac catttcagca
ttgtatgtgg tttcattttt cttagttatc 1620tggctactga atagccggat
ttttcagttc tgtcagaaac tctaaatttc caaaaatcta 1680agtgaaacat
ggatgaaact ctgttagaaa attgttagga ttttggagta tttggggagg
1740gggactactg gaatgctgtc caagttttat actaagatat cttacctgtt
tgttattaac 1800caaatatttt taaaaatatt tcctccataa atattcattt
aatattaggt tgatatttat 1860cacataaaaa gtaaaggcta ctgttagcta
attgtcacag agaaggattt gttttctgtt 1920gttagtgaat ttgaaatcct
tgactttatg tgctacagcc agttccatct ctgtttgtaa 1980attcttactt
tccattccat atcatattct gttccctata acctcttcat tgttttcttt
2040tcttttaaaa ataataaact tttctatgat caaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 2100aa 210280210PRThomo sapiens 80Met Trp Val Thr Lys
Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu1 5 10 15Leu His Leu Leu
Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30Arg Lys Arg
Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45Thr Leu
Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60Asn
Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu65 70 75
80Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys
85 90 95Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu
Phe 100 105 110Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile
Arg Asn Cys 115 120 125Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr
Val Ser Ile Thr Lys 130 135 140Ser Gly Ile Lys Cys Gln Pro Trp Ser
Ser Met Ile Pro His Glu His145 150 155 160Ser Phe Leu Pro Ser Ser
Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr 165 170 175Cys Arg Asn Pro
Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser 180 185 190Asn Pro
Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu 195 200
205Gly Lys 21081469DNAhomo sapiens 81agccctccag gacaggctgc
atcagaagag gccatcaagc agatcactgt ccttctgcca 60tggccctgtg gatgcgcctc
ctgcccctgc tggcgctgct ggccctctgg ggacctgacc 120cagccgcagc
ctttgtgaac caacacctgt gcggctcaca cctggtggaa gctctctacc
180tagtgtgcgg ggaacgaggc ttcttctaca cacccaagac ccgccgggag
gcagaggacc 240tgcaggtggg gcaggtggag ctgggcgggg gccctggtgc
aggcagcctg cagcccttgg 300ccctggaggg gtccctgcag aagcgtggca
ttgtggaaca atgctgtacc agcatctgct 360ccctctacca gctggagaac
tactgcaact agacgcagcc cgcaggcagc cccacacccg 420ccgcctcctg
caccgagaga gatggaataa agcccttgaa ccagcaaaa 46982110PRThomo sapiens
82Met Ala Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu1
5 10 15Trp Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys
Gly 20 25 30Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg
Gly Phe 35 40 45Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu
Gln Val Gly 50 55 60Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser
Leu Gln Pro Leu65 70 75 80Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly
Ile Val Glu Gln Cys Cys 85 90 95Thr Ser Ile Cys Ser Leu Tyr Gln Leu
Glu Asn Tyr Cys Asn 100 105 11083495DNAhomo sapiens 83agccctccag
gacaggctgc atcagaagag gccatcaagc aggtctgttc caagggcctt 60tgcgtcagat
cactgtcctt ctgccatggc cctgtggatg cgcctcctgc ccctgctggc
120gctgctggcc ctctggggac ctgacccagc cgcagccttt gtgaaccaac
acctgtgcgg 180ctcacacctg gtggaagctc tctacctagt gtgcggggaa
cgaggcttct tctacacacc 240caagacccgc cgggaggcag aggacctgca
ggtggggcag gtggagctgg gcgggggccc 300tggtgcaggc agcctgcagc
ccttggccct ggaggggtcc ctgcagaagc gtggcattgt 360ggaacaatgc
tgtaccagca tctgctccct ctaccagctg gagaactact gcaactagac
420gcagcccgca ggcagcccca cacccgccgc ctcctgcacc gagagagatg
gaataaagcc 480cttgaaccag caaaa 49584110PRThomo sapiens 84Met Ala
Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu1 5 10 15Trp
Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys Gly 20 25
30Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe
35 40 45Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val
Gly 50 55 60Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln
Pro Leu65 70 75 80Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val
Glu Gln Cys Cys 85 90 95Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn
Tyr Cys Asn 100 105 11085648DNAhomo sapiens 85agccctccag gacaggctgc
atcagaagag gccatcaagc aggtctgttc caagggcctt 60tgcgtcaggt gggctcagga
ttccagggtg gctggacccc
aggccccagc tctgcagcag 120ggaggacgtg gctgggctcg tgaagcatgt
gggggtgagc ccaggggccc caaggcaggg 180cacctggcct tcagcctgcc
tcagccctgc ctgtctccca gatcactgtc cttctgccat 240ggccctgtgg
atgcgcctcc tgcccctgct ggcgctgctg gccctctggg gacctgaccc
300agccgcagcc tttgtgaacc aacacctgtg cggctcacac ctggtggaag
ctctctacct 360agtgtgcggg gaacgaggct tcttctacac acccaagacc
cgccgggagg cagaggacct 420gcaggtgggg caggtggagc tgggcggggg
ccctggtgca ggcagcctgc agcccttggc 480cctggagggg tccctgcaga
agcgtggcat tgtggaacaa tgctgtacca gcatctgctc 540cctctaccag
ctggagaact actgcaacta gacgcagccc gcaggcagcc ccacacccgc
600cgcctcctgc accgagagag atggaataaa gcccttgaac cagcaaaa
64886110PRThomo sapiens 86Met Ala Leu Trp Met Arg Leu Leu Pro Leu
Leu Ala Leu Leu Ala Leu1 5 10 15Trp Gly Pro Asp Pro Ala Ala Ala Phe
Val Asn Gln His Leu Cys Gly 20 25 30Ser His Leu Val Glu Ala Leu Tyr
Leu Val Cys Gly Glu Arg Gly Phe 35 40 45Phe Tyr Thr Pro Lys Thr Arg
Arg Glu Ala Glu Asp Leu Gln Val Gly 50 55 60Gln Val Glu Leu Gly Gly
Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu65 70 75 80Ala Leu Glu Gly
Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys 85 90 95Thr Ser Ile
Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 100 105 11087529DNAhomo
sapiens 87agccctccag gacaggctgc atcagaagag gccatcaagc aggtctgttc
caagggcctt 60tgcgtcaggt gggctcagga ttccagggtg gctggacccc agatcactgt
ccttctgcca 120tggccctgtg gatgcgcctc ctgcccctgc tggcgctgct
ggccctctgg ggacctgacc 180cagccgcagc ctttgtgaac caacacctgt
gcggctcaca cctggtggaa gctctctacc 240tagtgtgcgg ggaacgaggc
ttcttctaca cacccaagac ccgccgggag gcagaggacc 300tgcaggtggg
gcaggtggag ctgggcgggg gccctggtgc aggcagcctg cagcccttgg
360ccctggaggg gtccctgcag aagcgtggca ttgtggaaca atgctgtacc
agcatctgct 420ccctctacca gctggagaac tactgcaact agacgcagcc
cgcaggcagc cccacacccg 480ccgcctcctg caccgagaga gatggaataa
agcccttgaa ccagcaaaa 5298870PRThomo sapiens 88Met Ala Leu Trp Met
Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu1 5 10 15Trp Gly Pro Asp
Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys Gly 20 25 30Ser His Leu
Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe 35 40 45Phe Tyr
Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly 50 55 60Gln
Val Glu Leu Gly Gly65 70
* * * * *