U.S. patent application number 17/091203 was filed with the patent office on 2021-03-11 for methods for the treatment and diagnosis of alzheimer's disease and traumatic brain injuries.
The applicant listed for this patent is Centre National de la Recherche Scientifique - CNRS, INSERM (Institut National de la Sante et de la Recherche Medicale), Universite Pierre et Marie Curie (Paris 6). Invention is credited to Hawa Camara, Thierry Leveillard, Jose-Alain Sahel.
Application Number | 20210069346 17/091203 |
Document ID | / |
Family ID | 1000005225870 |
Filed Date | 2021-03-11 |
![](/patent/app/20210069346/US20210069346A1-20210311-D00001.png)
![](/patent/app/20210069346/US20210069346A1-20210311-D00002.png)
United States Patent
Application |
20210069346 |
Kind Code |
A1 |
Leveillard; Thierry ; et
al. |
March 11, 2021 |
Methods for the Treatment and Diagnosis of Alzheimer's Disease and
Traumatic Brain Injuries
Abstract
The invention relates to the use of HNRNPC-expressing vectors
for preventing and/or treating a tauopathy, such as Alzheimer's
disease. The invention relates to methods for detecting a risk of
developing a tauopathy such Alzheimer's disease in a patient,
comprising the step of detecting the level of HNRNPC in a
biological sample obtained from said patient.
Inventors: |
Leveillard; Thierry; (Paris,
FR) ; Sahel; Jose-Alain; (Paris, FR) ; Camara;
Hawa; (Paris, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
INSERM (Institut National de la Sante et de la Recherche
Medicale)
Centre National de la Recherche Scientifique - CNRS
Universite Pierre et Marie Curie (Paris 6) |
Paris
Paris
Paris |
|
FR
FR
FR |
|
|
Family ID: |
1000005225870 |
Appl. No.: |
17/091203 |
Filed: |
November 6, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15580970 |
Dec 8, 2017 |
10857239 |
|
|
PCT/EP2016/063362 |
Jun 10, 2016 |
|
|
|
17091203 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2267/0312 20130101;
A61P 25/28 20180101; C12Q 2600/158 20130101; A01K 2227/105
20130101; C12Q 2600/118 20130101; G01N 2800/2821 20130101; A61K
48/00 20130101; G01N 33/6896 20130101; C07K 14/4711 20130101; G01N
2333/46 20130101; C12Q 1/6883 20130101 |
International
Class: |
A61K 48/00 20060101
A61K048/00; G01N 33/68 20060101 G01N033/68; C07K 14/47 20060101
C07K014/47; A61P 25/28 20060101 A61P025/28; C12Q 1/6883 20060101
C12Q001/6883 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 12, 2015 |
EP |
15305913.4 |
Claims
1. An expression vector comprising a nucleic acid encoding
heterogeneous nuclear ribonuclear protein C (HNRNPC).
2. The expression vector according to claim 1, wherein said
expression vector is an adeno-associated vector (AAV).
3. A method for preventing and/or treating a tauopathy in a patient
in need thereof, comprising administering a therapeutically
effective amount of the expression vector of claim 1.
4. (canceled)
5. A pharmaceutical composition comprising an expression vector
according to claim 1 and a pharmaceutically acceptable
excipient.
6-11. (canceled)
12. A method for predicting a risk of developing a tauopathy in a
patient comprising the step of detecting the Nxnl2 v2/(v1+v2)
expression ratio in a biological sample obtained from said patient.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to methods for the treatment
and diagnosis of tauopathies such as Alzheimer's disease and
traumatic brain injuries.
BACKGROUND OF THE INVENTION
[0002] Alzheimer's disease accounts for 60% to 70% of cases of
dementia. It is a chronic neurodegenerative disease that usually
starts slowly and gets worse over time. The most common early
symptom is difficulty in remembering recent events (short-term
memory loss). As the disease advances, symptoms can include:
problems with language, disorientation (including easily getting
lost), mood swings, loss of motivation, not managing self-care, and
behavioural issues. As a person's condition declines, she or he
often withdraws from family and society. Gradually, bodily
functions are lost, ultimately leading to death. Although the speed
of progression can vary, the average life expectancy following
diagnosis is three to nine years.
[0003] In 2010, there were between 21 and 35 million people
worldwide with Alzheimer's disease. With the aging of the
population, in developed countries, Alzheimer's disease is one of
the most financially costly diseases.
[0004] In the brains of patients suffering from Alzheimer's
disease, Tau protein (a microtubule-associated protein that has a
role in assembly and stabilization of microtubules) was found to be
hyperphosphorylated, leading to aggregation of the protein and to a
decrease in TAU binding to microtubules resulting in cell death.
Phosphorylated TAU is also toxic to neuronal cells.
[0005] Other neurodegenerative diseases associated with the
pathologial aggregation of tau have been reported, and are
collectively designated as "tauopathies".
[0006] Progress is being made in understanding the mechanisms
underlying tauopathies such as Alzheimer's disease.
[0007] However, there remains a need in the art for efficient
therapies and for biomarkers of the disease that would enable the
detection of the disease at a very early stage.
SUMMARY OF THE INVENTION
[0008] The present invention relates to methods for the treatment
and diagnosis of tauopathies such as Alzheimer's disease and
traumatic brain injuries. More particularly, the present invention
is based on the discovery that the splicing silencer, HNRNPC, plays
a role in the aberrant splicing of the NXNL2 gene in the brain of
patients suffering from Alzheimer's disease and that said aberrant
splicing is associated with Alzheimer's disease.
[0009] In one aspect, the invention relates to an expression vector
comprising a nucleic acid encoding heterogeneous nuclear
ribonuclear protein C (HNRNPC).
[0010] The invention also relates to an expression vector
comprising a nucleic acid encoding HNRNPC for use in a method for
preventing and/or treating a tauopathy.
[0011] The invention also relates to a pharmaceutical composition
comprising an expression vector comprising a nucleic acid encoding
HNRNPC.
[0012] In another aspect, the invention also relates to a method
for detecting a risk of developing a tauopathy in a patient
comprising the step of detecting the level of HNRNPC in a sample
obtained from said patient.
DETAILED DESCRIPTION OF THE INVENTION
Expression Vectors, Pharmaceutical Composition and Therapeutic
Methods of the Invention
[0013] In one aspect, the invention relates to an expression vector
comprising a nucleic acid encoding heterogeneous nuclear
ribonuclear protein C (HNRNPC).
[0014] As used herein, the term "HNRNPC" or "heterogeneous nuclear
ribonuclear protein C" refers to the RNA-binding protein encoded by
the HNRNPC gene and identified by Stone et al. (JBC, 2002, 277,
15621-8). It encompasses both isoforms, HNRNPC1 and HNRNPC2, which
differ by 13 amino acids.
[0015] The invention also relates to an expression vector
comprising a nucleic acid encoding HNRNPC for use in a method for
preventing and/or treating a tauopathy. The invention also relates
to a pharmaceutical composition comprising an expression vector
comprising a nucleic acid encoding HNRNPC.
[0016] As used herein, the term "tauopathy" has its general meaning
in the art. It refers to the class of neurodegenerative diseases
associated with the pathological aggregation of tau protein in the
brain. Tauopathies include, but are not limited to, Alzheimer's
disease, traumatic brain injury, frontotemporal dementia, including
the subtype of frontotemporal dementia and Parkinsonism linked to
chromosome 17 (FTDP-17), progressive supranuclear palsy,
corticobasal degeneration, Pick's disease, and agyrophilic grain
disease.
[0017] In a particular embodiment, said tauopathy is selected from
the group consisting of Alzheimer's disease and traumatic brain
injury.
[0018] As used herein, the terms "prevention", "prevent",
"preventing" refer to the fact of stopping/delaying the occurrence
of tauopathy, reducing of the risk of tauopathy, or slowing down
the development of said tauopathy. It can also refer to the
prevention or slowing down of one or more symptoms of tauopathy
(such as the pathological aggregation of tau protein).
[0019] As used herein, the terms "expression vector" refer to a
nucleic acid molecule capable of directing the expression of a
given nucleic acid sequence which is operatively linked to an
expression control sequence or promoter. In particular, an
expression vector according to the invention is a vector which
enables the expression of a given nucleic acid sequence into the
protein encoded by said nucleic acid sequence in a eukaryotic host
cell. The promoter of said expression vector is typically a
eukaryotic promoter.
[0020] The expression vector(s) of the present invention can be a
plasmid or a viral vector. A plasmid is a circular double-stranded
DNA loop that is capable of autonomous replication. A viral vector
is a nucleic acid molecule which comprises viral sequences which
can be packaged into viral particles. A variety of viral vectors
are known in the art and may be adapted to the practice of this
invention, including e.g., adenovirus, AAV, retrovirus, hybrid
adeno-AAV, lentivirus and others. By carrying out routine
experimentation, the skilled person in the art can chose from the
variety of available vectors, those which are suitable for carrying
out the method of the invention.
[0021] In a particular embodiment, the expression vector is an
adeno-associated vector (AAV).
[0022] AAVs have been extensively described in the art as suitable
vectors for gene delivery.
[0023] Indeed, AAVs are non-pathogenic and display a broad range of
tissue specificity. Typically, AAVs according to the present
invention are AAVs that are able to target the nucleic acid
encoding HNRNPC to the brain.
[0024] Examples include, but are not limited to, AAV2, AAV2/8,
AAV9, and AAV7m8.
[0025] The expression vector of the invention may be combined with
pharmaceutically acceptable excipients, and optionally
sustained-release matrices, such as biodegradable polymers, to form
therapeutic compositions.
[0026] "Pharmaceutically" or "pharmaceutically acceptable" refers
to molecular entities and compositions that do not produce an
adverse, allergic or other untoward reaction when administered to a
mammal, especially a human, as appropriate. A pharmaceutically
acceptable carrier or excipient refers to a non-toxic solid,
semi-solid or liquid filler, diluent, encapsulating material or
formulation auxiliary of any type.
[0027] In the pharmaceutical compositions of the present invention
for oral, sublingual, subcutaneous, intramuscular, intravenous,
transdermal, local or mucosal administration, the active principle,
alone or in combination with another active principle, can be
administered in a unit administration form, as a mixture with
conventional pharmaceutical supports, to animals and human beings.
Suitable unit administration forms comprise oral-route forms such
as tablets, gel capsules, powders, granules and oral suspensions or
solutions, sublingual and buccal administration forms, aerosols,
implants, subcutaneous, transdermal, topical, intraperitoneal,
intramuscular, intravenous, subdermal, transdermal, intrathecal and
intranasal administration forms and rectal administration
forms.
[0028] Preferably, the pharmaceutical compositions contain vehicles
which are pharmaceutically acceptable for a formulation capable of
being injected. These may be in particular isotonic, sterile,
saline solutions (monosodium or disodium phosphate, sodium,
potassium, calcium or magnesium chloride and the like or mixtures
of such salts), or dry, especially freeze-dried compositions which
upon addition, depending on the case, of sterilized water or
physiological saline, permit the constitution of injectable
solutions.
[0029] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions or dispersions; formulations including
sesame oil, peanut oil or aqueous propylene glycol; and sterile
powders for the extemporaneous preparation of sterile injectable
solutions or dispersions. In all cases, the form must be sterile
and must be fluid to the extent that easy syringability exists. It
must be stable under the conditions of manufacture and storage and
must be preserved against the contaminating action of
microorganisms, such as bacteria and fungi.
[0030] Solutions comprising compounds of the invention as free base
or pharmacologically acceptable salts can be prepared in water
suitably mixed with a surfactant, such as hydroxypropylcellulose.
Dispersions can also be prepared in glycerol, liquid polyethylene
glycols, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations contain a
preservative to prevent the growth of microorganisms.
[0031] Sterile injectable solutions are prepared by incorporating
the expression vector in the required amount in the appropriate
solvent with one or several of the other ingredients enumerated
above, as required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum-drying and freeze-drying techniques which
yield a powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof.
[0032] Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms, such as the type of injectable
solutions described above, but drug release capsules and the like
can also be employed.
[0033] For parenteral administration in an aqueous solution, for
example, the solution should be suitably buffered if necessary and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, subcutaneous and
intraperitoneal administration. In this connection, sterile aqueous
media which can be employed will be known to those of skill in the
art in light of the present disclosure. For example, one dosage
could be dissolved in 1 ml of isotonic NaCl solution and either
added to 1,000 ml of hypodermoclysis fluid or injected at the
proposed site of infusion. Some variation in dosage will
necessarily occur depending on the condition of the subject being
treated. The person responsible for administration will, in any
event, determine the appropriate dose for the individual
subject.
[0034] In addition to the compounds of the invention formulated for
parenteral administration, such as intravenous or intramuscular
injection, other pharmaceutically acceptable forms include, e.g.
tablets or other solids for oral administration; liposomal
formulations; time release capsules; and any other form currently
used.
[0035] In a particular embodiment, the expression vector comprising
a nucleic acid encoding HNRNPC is administered in combination with
another active agent.
[0036] Typically, the expression vector can be administered in
combination with an agent used to prevent tauopathy, such as
anti-oxidant agent. Suitable anti-oxidant agents include, but are
not limited to, natural antioxidants such as ascorbic acid (AA,
E300) and tocopherols (E306), as well as synthetic antioxidants
such as propyl gallate (PG, E310), tertiary butylhydroquinone
(TBHQ), butylated hydroxyanisole (BHA, E320) and butylated
hydroxytoluene (BHT, E321).
[0037] Typically, the agent used to prevent tauopathy can include,
but is not limited to, cholinesterase inhibitors such as donepezil,
galantamine and rivastigmine, and NMDA antagonists such as
memantine.
[0038] Typically, the expression vector and the other active agent
can be formulated separately. Alternatively, they can be formulated
together in a pharmaceutical composition.
Diagnostic Methods of the Invention
[0039] In another aspect, the invention also relates to a method
for detecting a risk of developing a tauopathy in a patient
comprising the step of detecting the level of HNRNPC in a sample
obtained from said patient.
[0040] As used herein, the term "patient" denotes a mammal, such as
a rodent, a feline, a canine, a bovine, an equine, a sheep, a
porcine and a primate. Preferably, a patient according to the
invention is a human.
[0041] The biological sample suitable for carrying out the
invention may be a body fluid, such as serum, plasma, blood or
urine. It may also be a brain biopsy or a cerebrospinal fluid
sample.
[0042] As used herein, the expression `level of HNRNPC" has its
general meaning in the art. It can refer to the enzymatic activity
of HNRNPC, to the amount of HNRNPC protein or the amount of mRNA
encoding HNRNPC in said biological sample. As used herein, a
"decreased level of HNRNPC" is a level of HNRNPC which is lower
than that observed in the general population. A level of HNRNPC is
deemed to be lower than the general population, when it is lower
than the normal by a factor 1.5, preferably 2, even more preferably
2, 3 . . . 10, or when it is not detectable.
[0043] In one embodiment, the level of HNRNPC can refer to level of
HNRNPC enzymatic activity, i.e. to the capacity to regulate the
splicing of the Nxn12 gene. In one aspect, the invention therefore
relates to a method for detecting a predisposition to tauopathy in
a patient comprising the step of detecting the level of HNRNPC
enzymatic activity in a biological sample obtained from said
patient.
[0044] Typically, the enzymatic activity of HNRNPC can be measured
according to available enzymatic tests. Suitable enzymatic tests of
HNRNPC levels can include, but are not limited to the measurement
of the effect of HNRNPC on the splicing of the Nxnl2 gene
products.
[0045] Indeed, the inventors have shown than the level of HNRNPC
was correlated with the amount of aberrant alternatively spliced
RdCVF2Lv2.
[0046] Without wishing to be bound by theory, it is thought that
the introduction of a retrotransposon (AluSx) 3' to the NXNL2 gene
in primate lineage results by exonisation in the production of
aberrant alternatively spliced transcript NXNL2v2 with exon 2'
instead of exon 2 that is translated as a protein RdCVF2Lv2 that is
no longer able to interact with TAU contrarily to RdCVF2Lv1. This
mechanism is called exonisation.
[0047] The inventors have shown that NXN2Lv2 is predominantly
expressed in the brain of patients suffering from Alzheimer's
disease as compared to age-matched controls.
[0048] Typically, one can measure the Nxn12 v2/(v1+v2) expression
ratio by carrying out the following test: [0049] The total RNA from
frozen brain specimens is purified by cesium chloride
centrifugation (Delyfer et al., 2013). The quantification is done
using Nanodrop 2000 (Thermo Scientific). The ratio of absorbance
260/280 nm is used to control protein contaminations. The integrity
of the RNA is controlled using a Bioanalyzer (Bioanalyzer 2100,
Agilent). The RNA is validated when the ratio of the two bands
corresponding to the ribosomal RNA 28 Svedberg (S) and 18S is 2/1
and when the RNA integrity number (RIN) is close to 10. cDNA is
produced using Superscript 11 reverse transcriptase kit (Life
Technologie) using 2.5 .mu.g of RNA. PCR is performed using
specific primers. Data is normalized with the expression of the
ribosomal RPS6 gene.
[0050] The sequences of the primers are as follows:
TABLE-US-00001 NXNL2v1 F: (SEQ ID No. 1) AAGTGGTCTTCGTGTAGCC
NXNL2v1 R: (SEQ ID No. 2) CCTCTTCCTCAGCTCATGCC NXNL2v2 F: (SEQ ID
No. 3) GCCTGGCTGGCGCTG NXNL2v2 R: (SEQ ID No. 4)
AGGCTAAGGCTAGTTCCTCA RPS6 F: (SEQ ID No. 5) TGCATTGTGGATGCAAATCT
RPS6 R: (SEQ ID No. 6) CTGGCGGACATCATCTTCTT
[0051] In a particular embodiment, the invention relates to a
method for predicting a risk of developing a tauopathy in a patient
comprising the step of detecting the Nxnl2 v2/(v1+v2) expression
ratio in a biological sample obtained from said patient. Typically,
an increase in said ratio compared to a standard ratio observed in
a control population or in the general population is associated
with an increased risk of developing a tauopathy.
[0052] Typically, the level of HNRNPC activity is deemed to be
decreased if the level of HNRNPC activity measured the patient's
sample is below a certain threshold.
[0053] In another embodiment, the level of HNRNPC is the level of
the HNRNPC protein found in the biological sample.
[0054] In one aspect, the invention therefore relates to a method
for detecting a predisposition to tauopathy in a patient comprising
the step of detecting the level of the HNRNPC protein in a
biological sample obtained from said patient.
[0055] In a particular embodiment, the methods of the invention
comprise contacting the biological HNRNPC protein present in the
biological sample. The binding partner may be an antibody that may
be polyclonal or monoclonal, preferably monoclonal. In another
embodiment, the binding partner may be an aptamer.
[0056] Polyclonal antibodies of the invention or a fragment thereof
can be raised according to known methods by administering the
appropriate antigen or epitope to a host animal selected, e.g.,
from pigs, cows, horses, rabbits, goats, sheep, and mice, among
others. Various adjuvants known in the art can be used to enhance
antibody production. Although antibodies useful in practicing the
invention can be polyclonal, monoclonal antibodies are
preferred.
[0057] Monoclonal antibodies of the invention or a fragment thereof
can be prepared and isolated using any technique that provides for
the production of antibody molecules by continuous cell lines in
culture. Techniques for production and isolation include but are
not limited to the hybridoma technique originally described by
Kohler and Milstein (1975); the human B-cell hybridoma technique
(Cote et al., 1983); and the EBV-hybridoma technique (Cole et al.
1985).
[0058] Alternatively, techniques described for the production of
single chain antibodies (see e.g. U.S. Pat. No. 4,946,778) can be
adapted to produce anti-HNRNPC single chain antibodies. Antibodies
useful in practicing the present invention also include anti-HNRNPC
fragments including but not limited to F(ab')2 fragments, which can
be generated by pepsin digestion of an intact antibody molecule,
and Fab fragments, which can be generated by reducing the disulfide
bridges of the F(ab')2 fragments. Alternatively, Fab and/or scFv
expression libraries can be constructed to allow rapid
identification of fragments having the desired specificity to
HNRNPC. For example, phage display of antibodies may be used. In
such a method, single-chain Fv (scFv) or Fab fragments are
expressed on the surface of a suitable bacteriophage, e. g., M13.
Briefly, spleen cells of a suitable host, e. g., mouse, that has
been immunized with a protein are removed. The coding regions of
the VL and VH chains are obtained from those cells that are
producing the desired antibody against the protein. These coding
regions are then fused to a terminus of a phage sequence. Once the
phage is inserted into a suitable carrier, e. g., bacteria, the
phage displays the antibody fragment. Phage display of antibodies
may also be provided by combinatorial methods known to those
skilled in the art. Antibody fragments displayed by a phage may
then be used as part of an immunoassay.
[0059] Antibodies against HNRNPC are available for example from
name: Anti-hnRNP C1+C2 antibody (4F4) Mouse monoclonal (Abeam ref:
ab10294)
[0060] In another embodiment, the binding partner may be an
aptamer. Aptamers arc a class of molecule that represents an
alternative to antibodies in term of molecular recognition.
Aptamers are oligonucleotide or oligopeptide sequences with the
capacity to recognize virtually any class of target molecules with
high affinity and specificity. Such ligands may be isolated through
Systematic Evolution of Ligands by EXponential enrichment (SELEX)
of a random sequence library, as described in Tuerk C. 1997. The
random sequence library is obtainable by combinatorial chemical
synthesis of DNA. In this library, each member is a linear
oligomer, eventually chemically modified, of a unique sequence.
Possible modifications, uses and advantages of this class of
molecules have been reviewed in Jayasena S. D., 1999. Peptide
aptamers consist of conformationally constrained antibody variable
regions displayed by a platform protein, such as E. coli
Thioredoxin A, that are selected from combinatorial libraries by
two hybrid methods (Colas et al., 1996).
[0061] The binding partners of the invention, such as antibodies or
aptamers, may be labelled with a detectable molecule or substance,
such as a fluorescent molecule, a radioactive molecule or any
others labels known in the art. Labels are known in the art that
generally provide (either directly or indirectly) a signal.
[0062] As used herein, the term "labelled", with regard to the
antibody, is intended to encompass direct labelling of the antibody
or aptamer by coupling (i.e., physically linking) a detectable
substance, such as a radioactive agent or a fluorophore (e.g.
fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or
Indocyanine (Cy5)) to the antibody or aptamer, as well as indirect
labelling of the probe or antibody by reactivity with a detectable
substance. An antibody or aptamer of the invention may be labelled
with a radioactive molecule by any method known in the art. For
example radioactive molecules include but are not limited
radioactive atom for scintigraphic studies such as I123, I124,
In111, Re186, Re188.
[0063] The aforementioned assays generally involve the binding of
the binding partner (ie. antibody or aptamer) to a solid support.
Solid supports which can be used in the practice of the invention
include substrates such as nitrocellulose (e. g., in membrane or
microtiter well form); polyvinylchloride (e. g., sheets or
microtiter wells); polystyrene latex (e.g., beads or microtiter
plates); polyvinylidine fluoride; diazotized paper; nylon
membranes; activated beads, magnetically responsive beads, and the
like.
[0064] The level of the HNRNPC protein may be measured by using
standard immunodiagnostic techniques, including immunoassays such
as competition, direct reaction, or sandwich type assays. Such
assays include, but are not limited to, agglutination tests;
enzyme-labelled and mediated immunoassays, such as ELISAs;
biotin/avidin type assays; radioimmunoassays;
immunoelectrophoresis; immunoprecipitation.
[0065] More particularly, an ELISA method can be used, wherein the
wells of a microtiter plate are coated with a set of antibodies
against HNRNPC. The biological sample is then added to the coated
wells. After a period of incubation sufficient to allow the
formation of antibody-antigen complexes, the plate(s) can be washed
to remove unbound moieties and a detectably labelled secondary
binding molecule added. The secondary binding molecule is allowed
to react with any captured sample marker protein, the plate washed
and the presence of the secondary binding molecule detected using
methods well known in the art.
[0066] In a particular embodiment, the method for detecting a risk
of developing a tauopathy according to the present invention
comprises the step of detecting a fragment of HNRNPC by
semi-quantitative Western blot in a cerebrospinal fluid sample
obtained from said patient.
[0067] Similar approaches have been successfully carried out for
other biomarkers of neurodegenerative disease (see Huhmer et al.,
2006).
[0068] In an alternative embodiment, the level of HNRNPC can be
measured by measuring the amount of messenger RNA (mRNA) encoding
HNRNPC.
[0069] In one aspect, the invention therefore relates to a method
for detecting a risk of developing a tauopathy in a patient
comprising the step of detecting the level of mRNA encoding HNRNPC
in a biological sample obtained from said patient.
[0070] Typically, said method can comprise a step of isolating
total RNA or total mRNA from said biological sample, prior to the
detection of the level of mRNA encoding HNRNPC.
[0071] The skilled person in the art knows how to carry out such
isolating steps using standard procedures.
[0072] Methods for detecting the presence of mRNA are well known in
the art. For example the nucleic acid contained in the samples is
first extracted according to standard methods, for example using
lytic enzymes or chemical solutions or extracted by
nucleic-acid-binding resins following the manufacturer's
instructions. The extracted mRNA is then detected by hybridization
(e. g., Northern blot analysis) and/or amplification (e.g.,
RT-PCR). In a preferred embodiment, the expression of the HNRNPC
gene or is detected by RT-PCR, preferably quantitative or
semi-quantitative RT-PCR, even more preferably real-time
quantitative or semi-quantitative RT-PCR.
[0073] Other methods of amplification include ligase chain reaction
(LCR), transcription-mediated amplification (TMA), strand
displacement amplification (SDA) and nucleic acid sequence based
amplification (NASBA).
[0074] Nucleic acids having at least 10 nucleotides and exhibiting
sequence complementarity or homology to the mRNA of interest herein
find utility as hybridization probes or amplification primers. It
is understood that such nucleic acids need not be identical, but
arc typically at least about 80% identical to the homologous region
of comparable size, more preferably 85% identical and even more
preferably 90-95% identical. In certain embodiments, it will be
advantageous to use nucleic acids in combination with appropriate
means, such as a detectable label, for detecting hybridization. A
wide variety of appropriate indicators are known in the art
including, fluorescent, radioactive, enzymatic or other ligands (e.
g. avidin/biotin).
[0075] Probes typically comprise single-stranded nucleic acids of
between 10 to 1000 nucleotides in length, for instance of between
10 and 800, more preferably of between 15 and 700, typically of
between 20 and 500. Primers typically are shorter single-stranded
nucleic acids, of between 10 to 25 nucleotides in length, designed
to perfectly or almost perfectly match a nucleic acid of interest,
to be amplified. The probes and primers are "specific" to the
nucleic acids they hybridize to, i.e. they preferably hybridize
under high stringency hybridization conditions (corresponding to
the highest melting temperature Tm, e.g., 50% formamide, 5.times.
or 6.times.SCC. SCC is a 0.15 M NaCl, 0.015 M Na-citrate).
[0076] The nucleic acid primers or probes used in the above
amplification and detection method may be assembled as a kit. Such
a kit includes consensus primers and molecular probes. A preferred
kit also includes the components necessary to determine if
amplification has occurred. The kit may also include, for example,
PCR buffers and enzymes; positive control sequences, reaction
control primers; and instructions for amplifying and detecting the
specific sequences.
[0077] In a preferred embodiment, said kit comprises
oligonucleotides for determining the level of HNRNPC mRNA by
quantitative PCR. Typically, said kit can comprise oligonucleotides
specific for the HNRNPC mRNA and internal normalization
oligonucleotides (housekeeping genes).
[0078] In a further embodiment, the level of HNRNPC can be assayed
indirectly by genotyping the HNRNPC gene.
[0079] In one aspect, the invention therefore relates to a method
for detecting a risk of developing a tauopathy in a patient
comprising the step of detecting the level of HNRNPC in a
biological sample obtained from said patient, wherein said level of
HNRNPC is assayed indirectly by genotyping the HNRNPC gene.
[0080] Typically, said method can comprise a step of isolating DNA
from said biological sample, prior to the detection of mutations in
the gene encoding HNRNPC. The skilled person in the art knows how
to carry out such isolating steps using standard procedures.
[0081] A decreased expression of the HNRNPC gene resulting in lower
levels of HNRNPC-encoding mRNA and/or lower levels of HNRNPC
protein can be due to mutations in the HNRNPC promoter or in the
HNRNPC coding sequence. Alternatively, certain decreased activity
of HNRNPC can be due to mutations in the coding sequence which do
not influence the expression levels.
[0082] As used herein, the expression "risk of developing a
tauopathy" refers to a patient's susceptibility or proneness to
develop a tauopathy of any type.
[0083] Said risk of developing a tauopathy may be purely hereditary
predisposition (inherited mutation for example) or acquired
(spontaneous mutations, epigenetic regulations etc.). It has been
shown that certain environmental conditions (such as exposure to
oxidative stress) increase the risk for a patient of developing a
taupoathy. A "risk of developing a tauopathy" can be defined as an
increased risk of developing a tauopathy, when compared to the
general population.
[0084] The invention will be further described by the following
examples and figures, which are not intended to limit the scope of
the protection defined by the claims.
FIGURE LEGENDS
[0085] FIG. 1: Decreased expression of the splicing inhibitor
protein HNRNPC in the brain of Alzheimer patients.
[0086] Western blot of HNRNPC1/C2 on brain protein extracts
obtained from patients suffering from Alzheimer's disease (lanes 13
to 22) and age-matched controls (lanes 1 to 12).
[0087] The two bands correspond to the two isoforms C1 and C2 of
the HNRNPC protein.
[0088] FIG. 2: Correlation between the expression of HNRPNC and
that of NX1VL2v2.
[0089] The ratio of expression v1/(v1+v2) transcripts of the NXNL2
gene is correlated to the level of expression of HNRNPC in brain
samples obtained from patients suffering from Alzheimer's disease.
The dashed line represents the regression curve (R2=0,7513) based
on the values obtained for Alzheimer patients, with the exclusion
of 2 patients who presented a different profile (see the 2 circles
with a v2/(v1+v2) ratio around 0.2).
[0090] The expression levels of isoforms NXNL2v1 and NXNL2v2 were
assessed by quantitative RT-PCR.
EXAMPLES
[0091] The inventors have demonstrated the involvement of the Nxnl2
gene in Alzheimer's disease, based the abnormal behavior of the
Nrnl2-/- mouse. The aged Nxnl2-/- mice have visual and olfactory
deficit (Jaillard et al., 2012), but interestingly, these mice have
cognitive deficits that can be scored at 2 months of age before the
animals show visual and olfactory dysfunction (Jaillard et al.,
Manuscript in preparation). These phenotypes were not observed in
the Nxnl1-/- mouse in agreement with its expression restricted to
the retina. The Nxnl2-/- mouse is hyperactive as demonstrated by
the open field test, and has increased anxiety as shown by the
elevated plus maze test. This mouse has additional deficits in
working memory seen in the Y maze test, contextual memory deficit
as seen in fear conditioning, and in spatial memory in the Morris
water maze test. However, this mouse has no motor deficit as judged
by the rotarod test. The Morris water maze is a standard method for
evaluation of spatial learning and memory ability, and reflects
cognitive defects directly associated with dysfunction of the
hippocampus. [0092] As for RdCVFL, one of the products of the Nxnl1
gene, TAU interacts with the thioredoxin-like protein RdCVF2L, and
not with the trophic factor RdCVF2. RdCVF2L inhibits TAU
phosphorylation. By 18 months of age, astrogliosis can be observed
in the hippocampus of the Nxnl2-/- brain. At the same age, the
analysis of whole brain extracts shows presence of aggregates of
TAU as seen by filter binding assay, as well as oligomeric forms of
TAU. While the expression of TAU is not modified by the
inactivation of the Nxnl2 gene, TAU is phosphorylated in the brain
of the Nxnl2-/- mouse as shown using two distinct anti-phosphoTAU
antibodies, AT8 and AT100. Interestingly, the expression of NXNL2
is reduced by 48% in the frontal cortex of patients deceased from
Alzheimer's disease as compared to age-matched controls. [0093] The
expression of the NXNL2 gene in brain specimens of from patients
deceased from Alzheimer's disease was investigated and compared to
control specimens. The inventors observed that the NXNL2 gene in
human brain tissues expressed an additional and unsuspected
splicing isoform. Based on these observations we studied splicing
regulation of the NXNL2 gene. The introduction of a retrotransposon
(AluSx) in reverse orientation, 3' to the NXNL2 gene in primate
lineage results in exonisation in the production of aberrant
alternatively spliced transcript NXNL2v2 with exon 2' coming from
the AluSx sequence instead of the normal exon 2. This transcript is
translated as a protein RdCVF2Lv2 that is no longer able to
interact with TAU contrarily to RdCVF2Lv1. Splice site selection
occurs through the coordinated recognition of multiple
cis-elements: the branch point, the 5' splice site (donor site),
the polypyrimidine tract (PPT), the 3' splice site (acceptor site),
and a variety of auxiliary elements (Hertel, 2014). NXNL2v2
expression pattern results from the very efficient PPT rich in
thymidines, provided by the AluSx sequence in reverse orientation.
This mechanism is called exonisation and is known to be regulated
by the splicing inhibitor factor HNRNPC (Zarnack et al., 2013).
NXN2Lv2 is predominantly expressed in the brain of Alzheimer's
disease patients as compared to age-matched and examined control
brain specimens. The inventors observed a reduction of the
expression of HNRPPC in the cortex of Alzheimer patients that is
correlated with the ratio of expression (v2/v1+v2). They confirmed
the reduction of the expression of HNRNPC by immunohistochemistry.
Interestingly, in HEK293 cells the oxidative agent diamide
increases the ratio of expression (v2/v1+v2). Furthermore, the
inventors found that diamide treatment results in the nuclear
exclusion of HNRNPC. 2D gel electrophoresis showed that this agent
induces a post-translational modification of the HNRNPC protein,
most likely by an inhibitory phosphorylation (Stone and Collins,
2002). The increased exonisation of the NXNL2 genes by oxidative
stress raises the ratio (v2/v1+v2) and consequently the relative
expression of the RdCVF2Lv2 that is no longer able to interact with
TAU (Camara et al., Manuscript in preparation). This is a clear
demonstration of an epigenetic mechanism of Alzheimer's disease
progression, where the reduction of HNRNPC level will alter the
expression of many genes with an Alu retrotransposon.
[0094] In conclusion, the inventors have shown that the splicing
inhibitor HNRNPC is down-regulated in the brain tissue of patients
suffering from Alzheimer's disease, compared to age-matched control
patients (FIG. 1).
[0095] They have also demonstrated, using transient transfection of
siRNA directed against HNRNPC, that the diminution of the
expression of HNRNPC induces an increase of NXNLv2 (data not
shown).
[0096] The ratio of expression v1/(v1+v2) is correlated to the
level of expression of HNRNPC (FIG. 2).
REFERENCES
[0097] Throughout this application, various references describe the
state of the art to which this invention pertains. The disclosures
of these references are hereby incorporated by reference into the
present disclosure. [0098] Camara, H., Argentini, M., Clerin, E.,
Blond, F., Ferracane, V., Milllet-Puel, G., Ait-Ali, N., Kole, C.,
Sahel, J. A., and Leveillard, T. (Manuscript in preparation).
Aberrant exonisation on the Nucleoredoxin-like 2 gene, a epigenetic
mechanism in Alzheimer's disease [0099] Delyfer, M. N., Ait-Ali,
N., Camara, H., Clerin, E., Korobelnik, J. F., Sahel, J. A., and
Leveillard, T. (2013). Transcriptomic Analysis of Human Retinal
Surgical Specimens Using jouRNAI. Journal of visualized
experiments: JoVE. [0100] Hertel, K. J. (2014). Spliceosomal
pre-mRNA splicing methods and protocols (New York u.a.: Humana
Press). [0101] Huhmer et al. (2006). Protein analysis in human
cerebrospinal fluid: Physiological aspects, current progress and
future challenges. Disease markers 22, 3-26. [0102] Jaillard, C.,
Mouret, A., Niepon, M. L., Clerin, E., Yang, Y., Lee-Rivera, I.,
Ait-Ali, N., Millet-Puel, G., Cronin, T., Sedmak, T., et al.
(2012). Nxnl2 splicing results in dual functions in neuronal cell
survival and maintenance of cell integrity. Human molecular
genetics 21, 2298-2311. [0103] Jaillard, C., Ouechtati, F., Clerin,
E., Niepon, M. L., Meziane, H., Fridlich, R., Lambert, J. C.,
Amouyel, P., Sahel, J. A., and Leveillard, T. (Manuscript in
preparation). The inactivation of the Nxn12 gene in the mouse
reveals its implication in Alzheimer's disease.
[0104] Liu, N., Dai, Q., Zheng, G., He, C., Parisien, M., and Pan,
T. (2015). N(6)-methyladenosine-dependent RNA structural switches
regulate RNA-protein interactions. Nature 518, 560-564. [0105]
Stone, J. R., and Collins, T. (2002). Rapid phosphorylation of
heterogeneous nuclear ribonucleoprotein C1/C2 in response to
physiologic levels of hydrogen peroxide in human endothelial cells.
The Journal of biological chemistry 277, 15621-15628. [0106]
Zarnack, K., Konig, J., Tajnik, M., Martincorena, I., Eustermann,
S., Stevant, I., Reyes, A., Anders, S., Luscombe, N. M., and Ule,
J. (2013). Direct competition between hnRNP C and U2AF65 protects
the transcriptome from the exonization of Alu elements. Cell 152,
453-466.
Sequence CWU 1
1
6119DNAHomo sapiens 1aagtggtctt cgtgtagcc 19220DNAHomo sapiens
2cctcttcctc agctcatgcc 20315DNAHomo sapiens 3gcctggctgg cgctg
15420DNAHomo sapiens 4aggctaaggc tagttcctca 20520DNAHomo sapiens
5tgcattgtgg atgcaaatct 20620DNAHomo sapiens 6ctggcggaca tcatcttctt
20
* * * * *