U.S. patent application number 17/013245 was filed with the patent office on 2021-02-25 for novel anticancer fusion protein and use thereof.
This patent application is currently assigned to KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY. The applicant listed for this patent is KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY, KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION. Invention is credited to Cherl Hyun JEONG, Min-Woo KIH, In-San KIM, Soyoun KIM, Eun Jung LEE, Yoo Soo YANG.
Application Number | 20210054047 17/013245 |
Document ID | / |
Family ID | 1000005250073 |
Filed Date | 2021-02-25 |
![](/patent/app/20210054047/US20210054047A1-20210225-D00000.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00001.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00002.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00003.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00004.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00005.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00006.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00007.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00008.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00009.png)
![](/patent/app/20210054047/US20210054047A1-20210225-D00010.png)
View All Diagrams
United States Patent
Application |
20210054047 |
Kind Code |
A1 |
KIH; Min-Woo ; et
al. |
February 25, 2021 |
NOVEL ANTICANCER FUSION PROTEIN AND USE THEREOF
Abstract
The present invention relates to a novel anticancer fusion
protein and use thereof, and more particularly, provides a fusion
protein in which a tumor necrosis factor (TNF) superfamily protein
is linked to a self-assembled protein, which is capable of forming
a protein nanocage by self-assembly of the self-assembled
protein.
Inventors: |
KIH; Min-Woo; (Seoul,
KR) ; LEE; Eun Jung; (Daegu, KR) ; YANG; Yoo
Soo; (Seoul, KR) ; JEONG; Cherl Hyun; (Seoul,
KR) ; KIM; In-San; (Seoul, KR) ; KIM;
Soyoun; (Daegu, KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY
KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION
FOUNDATION |
Seoul
Daegu |
|
KR
KR |
|
|
Assignee: |
KOREA INSTITUTE OF SCIENCE AND
TECHNOLOGY
Seoul
KR
KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION
FOUNDATION
Daegu
KR
|
Family ID: |
1000005250073 |
Appl. No.: |
17/013245 |
Filed: |
September 4, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/KR2019/002531 |
Mar 5, 2019 |
|
|
|
17013245 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 2319/01 20130101;
C07K 2319/32 20130101; C07K 14/70575 20130101; A61K 38/00 20130101;
A61P 35/00 20180101; C07K 2319/21 20130101; C07K 2319/22 20130101;
A61K 45/06 20130101 |
International
Class: |
C07K 14/705 20060101
C07K014/705; A61P 35/00 20060101 A61P035/00 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 6, 2018 |
KR |
10-2018-0026230 |
Claims
1. A fusion protein comprising a tumor necrosis factor (TNF)
superfamily protein linked to a self-assembled protein.
2. The fusion protein of claim 1, wherein the self-assembled
protein is a small heat shock protein (sHsp), ferritin, vault,
P6HRC1-SAPN, M2e-SAPN, MPER-SAPN, or a virus or bacteriophage
capsid protein.
3. The fusion protein of claim 1, wherein the self-assembled
protein is a ferritin heavy chain protein or a ferritin light chain
protein.
4. The fusion protein of claim 1, wherein the self-assembled
protein is a ferritin heavy chain protein having the amino acid
sequence of SEQ ID NO: 6.
5. The fusion protein of claim 1, wherein the TNF superfamily
protein is RAIL, CD40L (CD40 ligand), OX40L (OX40 ligand), FasL
(Fas ligand), LIGHT (tumor necrosis factor superfamily member 14),
APRIL (A proliferation-inducing ligand), TNF-.alpha. (tumor
necrosis factor alpha), TNF-.beta. (tumor necrosis factor-beta),
VEGI (vascular endothelial growth inhibitor), BAFF (B-cell
activating factor), RANKL (receptor activator of nuclear factor
kappa-B ligand), LT (lymphotoxin).alpha./LT (lymphotoxin).beta.,
TWEAK (TNF-related weak inducer of apoptosis), CD30L (CD30 ligand),
4-1BBL (4-1BB ligand), GITRL (glucocorticoid-induced TNF-related
ligand), or EDA-A (ectodysplasin A).
6. The fusion protein according to claim 1, wherein the TNF
superfamily protein is TRAIL having the amino acid sequence of SEQ
ID NO: 2.
7. The fusion protein according to claim 1, wherein the TNF
superfamily protein is fused to the N-terminus or C-terminus of the
self-assembled protein.
8. The fusion protein according to claim 1, further comprising a
linker peptide between the TNF superfamily protein and the
self-assembled protein.
9. The fusion protein according to claim 8, wherein the linker
peptide has a length of 2 to 50 amino acid residues.
10. The fusion protein according to claim 8, wherein the linker
peptide is selected from A(EAAAK).sub.4ALEA(EAAAK).sub.4A (SEQ ID
NO: 4), (G.sub.4S).sub.n (where n is an integer from 1 to 10),
(GS).sub.n (where n is an integer from 1 to 10), (GSSGGS).sub.n
(SEQ ID NO: 15, where n is an integer for 1 to 10),
KESGSVSSEQLAQFRSLD (SEQ ID NO: 16), EGKSSGSGSESKST (SEQ ID NO: 17),
GSAGSAAGSGEF (SEQ ID NO: 18), (EAAAK).sub.n (SEQ ID NO: 19, where n
is an integer from 1 to 10), CRRRRRREAEAC (SEQ ID NO: 20), GGGGGGGG
(SEQ ID NO: 21), GGGGGG (SEQ ID NO: 22), AEAAAKEAAAAKA (SEQ ID NO:
23), PAPAP (SEQ ID NO: 24), (Ala-Pro).sub.n (where n is an integer
from 1 to 10), VSQTSKLTRAETVFPDV (SEQ ID NO: 25), PLGLWA (SEQ ID
NO: 26), TRHRQPRGWE (SEQ ID NO: 27), AGNRVRRSVG (SEQ ID NO: 28),
RRRRRRRR (SEQ ID NO: 29), and GSSGGSGSSGGSGGGDEADGSRGSQKAGVDE (SEQ
ID NO: 30).
11. A protein nanocage produced by self-assembly of the fusion
protein according to claim 1.
12. A complex protein nanocage produced by self-assembly of the
fusion protein according to claim 1 encapsulating an immunogenic
cell death-inducing compound or a TNF superfamily re-sensitizer
therein.
13. The complex protein nanocage of claim 12, wherein the
immunogenic cell death-inducing compound is encapsulated therein
and is an anti-EGFR antibody, a BK channel agonist, bortezomib, the
combination of cardiac glycoside and a non-immunogenic apoptosis
inducer, cyclophosphamides, the combination of GADD34/PP1 inhibitor
and mitomycin, LV-tSMAC, Measles virus, or oxaliplatin.
14. The complex protein nanocage of claim 12, wherein the TNF
superfamily re-sensitizer is encapsulated therein and is
doxorubicin, cisplatin, gemcitabine, oxaliplatin, irinotecan,
camptothecin, celecoxib, curcumin, cinobufotalin, berberine,
LY294002, wortmannin, ABT-737, HA14-1, p53 reactivation or
induction of massive apoptosis (PRIMA-1).
15. A pharmaceutical composition for treating cancer comprising the
protein nanocage according to claim 11 as an active ingredient and
at least one pharmaceutically acceptable carrier.
16. The pharmaceutical composition according to claim 15, further
comprising at least one immunogenic cell death-inducing compound or
a TNF superfamily re-sensitizer.
17. A pharmaceutical composition for treating cancer comprising the
complex protein nanocage according to claim 12 as an active
ingredient and at least one pharmaceutically acceptable
carrier.
18. A method of treating cancer in a subject comprising
administering a therapeutically effective amount of the protein
nanocage according to claim 11 to the subject.
19. A method of treating cancer in a subject comprising
administering a therapeutically effective amount of the complex
protein nanocage according to claim 12 to the subject.
20. A method of re-sensitizing TRAIL-resistant tumor cells to
TRAIL, comprising treating the tumor cells with the complex protein
nanocage according to claim 12.
21. A method of re-sensitizing TRAIL-resistant tumor cells to
TRAIL, comprising treating the tumor cells with the protein
nanocage of claim 11 and an immunogenic cell death-inducing
compound or TNF superfamily re-sensitizer.
22. A method of treating cancer in a subject suffering from
TRAIL-resistant cancer, comprising administering a therapeutically
effective amount of the complex protein nanocage of claim 12 to the
subject.
23. A method of treating cancer in a subject suffering from
TRAIL-resistant cancer, comprising administering a therapeutically
effective amount of the protein nanocage of claim 11 and an
immunogenic cell death-inducing compound or TNF superfamily
re-sensitizer to the subject.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of international
patent application PCT/KR2019/002531 filed on Mar. 5, 2019, which
claims priority to Korean Patent Application Ser. No. 2018-0026230
filed on Mar. 6, 2018. Both of the above applications are
incorporated herein by reference in their entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 17, 2020, is named 122257-0113 ST25 201117 corrected.txt
and is 11,657 bytes in size.
TECHNICAL FIELD
[0003] The present invention relates to a novel anticancer fusion
protein and use thereof.
BACKGROUND
[0004] Tumor necrosis factor (TNF) ligand and receptor superfamily
play an important role in the regulation of haematopoiesis,
morphogenesis and immune response, and development of TNF-targeted
therapeutics is currently the subject of interest. The TNF super
family consists of 27 ligands and shares the extracellular TNF
homology domain (THD) that induces the formation of structural
features, non-covalent homo-trimers (D. W. Banner et al., Cell,
(3): 431-445, 1993). Given that the endogenous TNF ligand exists as
a homo-trimer and that the trimer induces the activation of
downstream signaling of the receptor, the formation of the trimer
structure is an important factor for its stability and biological
function. Tumor necrosis factor-related apoptosis-inducing ligand
(TRAIL), one of the TNF super families, is bound to TRAIL R1 (death
receptor 4, DR4), TRAIL R2 (kill receptor 5, DR5), TRAIL R3 (decoy
receptor 1, DcR1), TRAIL R4 (decoy receptor 2, DcR2), and
osteoprotegerin, which are members of the TNFR super family 5 (A.
Almasan et al., Cell Mol. Life Sci. 66(6): 981-993, 2009). Among
these receptors, DR4 and DR5 contain a cytoplasmic `death domain`
(DD) and induce apoptosis in cells. In particular, unlike other
apoptosis-inducing ligands (ie, Fas-ligand), TRAIL has been proven
to be more effective in selectively inducing apoptosis of tumor
cells. Based on preclinical studies, TRAIL agonists exhibit marked
anti-tumor activity in various tumor types but have no or limited
effect on normal cells (A. Ashkenazi et al., J. Clin. Invest. 104
(2): 155-162, 1999). Therefore, TRAIL can be considered a preferred
anticancer agent due to its tumor-specific apoptotic activity.
[0005] However, recent clinical trials of TRAIL-based therapeutics
(e.g., circularly permuted 8 TRAIL (CPT), AGP350, and dulanermin)
exhibit no effectual anti-tumor activity toward cancer patients
(Herbst et al., J. Clin. Oncol. 2010, 28(17): 2839-2846, 2010;
Soria et al., J. Clin. Oncol. 28(9): 1527-33, 2010; Geng et al.,
Am. J. Hematol. 89(11): 1037-1042, 2014; Leng et al., Chin. J.
Cancer 35: 86, 2016; Leng et al., Cancer Chemother. Pharmacol.
79(6): 1141-1149, 2017). There are some possible explanations for
the failure of TRAIL-based therapeutics, but the predominant
factors are 1) low apoptotic potency owing to the inability of
TRAIL to form its native homo-trimeric complex structure, which is
essential for activation of DR4- and DR5-mediated downstream
signaling, 2) poor stability and pharmacokinetics, and 3)
resistance to TRAIL-mediated apoptosis in various tumor cell types
(Zhang et al., FEBS Let. 482(3): 193-199, 2000; Zhang et al.,
Cancer Gene Ther. 12(3): 228-237, 2005; Saraei et al., Biomed.
Pharmacother. 2018, 107: 1010-1019, 2018; Geismann et al., Cell
Death Dis. 5(10): e1455, 2014; Zhang et al., Gene 627: 420-427,
2017).
[0006] The present invention has been devised to solve various
problems including the above-mentioned problems, thus an object of
the present invention is to provide a novel anti-cancer fusion
protein capable of maximizing the efficiency of cancer
immunotherapy showing effective anticancer activity. However, these
problems are exemplary, and the scope of the present invention is
not limited thereto.
SUMMARY OF THE INVENTION
[0007] In an aspect of the present invention, there is provided a
fusion protein in which a tumor necrosis factor superfamily protein
is linked to a self-assembled protein.
[0008] In another aspect of the present invention, there is
provided a protein nanocage produced by self-assembly of the fusion
protein.
[0009] In another aspect of the present invention, there is
provided a complex protein nanocage produced by self-assembly of
the fusion protein and encapsulated with an immunogenic
apoptosis-inducing compound therein.
[0010] In another aspect of the present invention, there is
provided a pharmaceutical composition for treating cancer
comprising the protein nanocage as an active ingredient and at
least one pharmaceutically acceptable carrier.
[0011] In another aspect of the present invention, there is
provided a method of treating cancer in a subject comprising
administering a therapeutically effective amount of the protein
nanocage to the subject.
[0012] In another aspect of the present invention, there is
provided a method of re-sensitizing TRAIL-resistant tumor cells to
TRAIL, comprising treating the tumor cells with a complex protein
nanocage as described herein with an immunogenic cell
death-inducing compound or a TNF superfamily re-sensitizer
encapsulated therein or with a protein nanocage as described herein
and an immunogenic cell death-inducing compound or TNF superfamily
re-sensitizer.
[0013] In another aspect of the present invention, there is
provided a method of treating cancer in a subject suffering from
TRAIL-resistant cancer, comprising administering a therapeutically
effective amount of a complex protein nanocage as described herein
with an immunogenic cell death-inducing compound or a TNF
superfamily re-sensitizer encapsulated therein, or administering a
therapeutically effective amount of a protein nanocage as described
herein and an immunogenic cell death-inducing compound or TNF
superfamily re-sensitizer to the subject.
Effect of the Invention
[0014] According to an embodiment of the present invention made as
described above, it is possible to implement a novel anticancer
fusion protein production effect capable of maximizing the
efficiency of cancer immunotherapy showing high anticancer activity
by effectively inducing apoptosis of tumor cells. Of course, the
scope of the present invention is not limited by these effects.
BRIEF DESCRIPTION OF DRAWINGS
[0015] FIG. 1 is a schematic diagram showing the similarity of the
trimeric structure and distance between each C-terminus of the TNF
super family. The 3D protein structure was generated using RasMol
(v 2.7.2) and the distance between C terminal atoms was calculated
using Pymol. Blue balls indicate the C-terminus of the TNF super
family ligand.
[0016] FIG. 2A-2B represent the design of a TTPN showing a
natural-like trimer TRAIL complex on the ferritin surface, and show
a schematic diagram showing the 3D protein structure of the
extracellular domain (eco-domain) of the TRAIL trimer complex (FIG.
2A) and a schematic diagram showing the human ferritin heavy chain
(hFTH-H) nanocage (PDB 2FHA) (FIG. 2B), the bold blue part
represents the triaxial symmetric structure, and the blue and red
spheres are the C-terminus of TRAIL and the N-terminus of the human
ferritin subunit, respectively.
[0017] FIG. 3 is a diagram showing the design of a TTPN showing a
natural-like trimer TRAIL complex on the ferritin surface, and a
schematic plasmid vector and dimensions of the TTPN. The C-terminus
of the extracellular domain of the domain TRAIL (purple) was fused
to the N-terminus of the human ferritin subunit (gray) by a linker
peptide (blue).
[0018] FIG. 4A4C represent an analysis of the TTPN of the present
invention, and show a photograph representing the SDS-page analysis
of the expressed TTPNs (FIG. 4A); a SDS-PAGE gel photograph of TTPN
and wtFTN (FIG. 4B); and a Western blot analysis of purified TTPN
(FIG. 4C):
[0019] Black arrow: TTPN of theoretical molecular weight (48
kDa);
[0020] M: protein marker;
[0021] IS: insoluble fraction; and
[0022] S: Soluble fraction of E. coli cell lysate.
[0023] FIG. 5A-5B represent the physicochemical properties of the
TTPNs of the present invention, and show a graph representing the
elution profile of size exclusion chromatography (FIG. 5A); and a
series of histograms representing size distribution of
nanoparticles prepared by self-assembling using dynamic light
scattering (DLS) analysis of wtFTN (FIG. 5B, left) and TTPN (FIG.
5B, right).
[0024] FIG. 6 is a series of transmission electron microscopic
(TEM) images of purified wtFTN (left) and TTPN (right) showing the
physicochemical properties of the TTPNs of the present invention,
showing a spherical cage structure.
[0025] FIG. 7 is a series of photographs showing the
physicochemical properties of the TTPNs of the present invention
and showing the average 2D class of TTPN processed representatively
on a negative-stained electron microscope.
[0026] FIG. 8 is a series of histograms showing different
expression levels of TRAIL receptors on the surface of tumor cells,
HEK293T, HT29 and HepG2 cells.
[0027] FIG. 9 is a graph showing the relative mean fluorescence
intensity (MFI) compared to the IgG control group showing different
expression levels of TRAIL receptors on the surface of tumor cells,
HEK293T, HT29 and HepG2 cells.
[0028] FIG. 10 is a series of histograms showing representative
flow cytometric histogram analysis results of HEK293T, HT29, and
HepG2 cells treated with 400 nM TTPN and wtFTN as an analysis of
the possibility of binding TTPN to tumor cells and normal
cells.
[0029] FIG. 11 is a graph showing the results of analyzing the
binding potential of TTPN to tumor cells and normal cells from the
flow cytometric plot of FIG. 10 to analyze the binding potential of
TPPNs to cancer cells and normal cells. Data represent mean
fluorescence intensity (MFI).+-.SEM of at least 3 independent
experiments (*: p<0.05, **: p<0.01 and ***: p<0.001 vs.
only cell control, ns: not significant, Student's t-test).
[0030] FIG. 12 is a histogram showing the binding specificity of
TTPN to the TRAIL receptor on the tumor surface as a result of
analyzing the possibility of binding TTPNs to tumor cells and
normal cells. HepG2 cells sensitive to TRAIL were pre-blocked with
anti-DR4, DR5, DcR1, and DcR2 antibodies and then cultured with 400
nM TTPN.
[0031] FIG. 13 is a graph representing an analysis of the binding
potential of TTPNs to tumor cells and normal cells, showing the
quantification of the specific binding ability calculated from the
flow cytometric plots including FIGS. 11 and 12.
[0032] FIG. 14 is a series of fluorescence microscopic images
representing the binding potential of TTPNs to tumor cells and
normal cells. HepG2 cells treated with TTPN and wtFTN. HepG2 cells
were treated with 50 nM TTPN and wtFTN, treated with anti-ferritin
heavy chain and Alexa 488 antibody (green), and the nuclei were
counterstained with Hoechst (blue). Scale bar: 100 .mu.m.
[0033] FIG. 15 is a photograph showing the stability of TTPN and
mTRAIL by analyzing the improved binding kinetics and affinity for
DR4 and DR5 and the stability of TTPN. 15 mg/mL TTPN and wtFTN were
incubated in PBS buffer for 24 hours after purification.
[0034] FIG. 16 is a graph analyzing the results of monitoring the
stability of TTPN and mTRAIL (10 mg/mL) for 1 month as an analysis
of improved binding kinetics and affinity for DR4 and DR5 and the
stability of TTPN. Data represent the mean.+-.SEM of at least 3
independent experiments (*: p<0.05, **: p<0.01, and ***:
p<0.001 vs mTRAIL, uniformity with Tukey post-hoc test. ANOVA
analysis).
[0035] FIG. 17 is a graph representing cell viability according to
treatment with TTPN and mTRAIL. HepG2 cells were cultured for 24
hours in the presence of different concentrations of mTRAIL and
TTPN, and analyzed with a cell counting kit (CCK-8).
[0036] FIG. 18 is a graph analyzing the apoptotic activity of TTPN
and mTRAIL against HEK293T normal cells in vitro.
[0037] FIG. 19 is a series of histograms representing flow
cytometry analysis of TRAIL-mediated apoptosis of HepG2 cells as an
analysis of in vitro TTPN-mediated apoptosis on
TRAIL-sensitive-HepG2 cells. Cells were incubated for 24 hours in
the presence of different concentrations of mTRAIL and TTPN and
analyzed by Annexin V/PI double staining.
[0038] FIG. 20 is a graph showing the proportion of Annexin-V
positive cells among TRAIL-sensitive HepG2 cells.
[0039] FIG. 21 is a graph showing the analysis of in vitro
TTPN-mediated apoptosis of TRAIL-sensitive HepG2 cells, and
analysis of the proportion of Annexin-V positive cells calculated
in the flow cytometry plot including FIG. 18. Data represent the
mean.+-.SEM of at least 3 independent experiments (*: p<0.05,
**: p<0.01 and ***: p<0.001 vs. buffer control, one-way ANOVA
analysis along with Tukey's post-test).
[0040] FIG. 22A-22D are described herein. FIG. 22A is a schematic
diagram of the process for preparing DOX-TTPNs based on the 3D
protein structure of the ecto-domain of the TRAIL trimeric complex
(PDB 1DG6) and human ferritin heavy chain (hFTN-H) nanocages (PDB
2FHA); FIG. 22B is a graph representing fluorescence intensity of
TTPN (0.3 mg/ml) before and after encapsulation of DOX with
excitation and emission at 470 and 565.about.650 nm, respectively;
FIG. 22C is a size-exclusion chromatography elution profile of
DOX-TTPNs showing successful encapsulation of DOX into TTPNs (TTPN
absorbance .lamda., 280 nm; DOX absorbance .lamda., 480 nm); and
FIG. 22D is a histogram representing DLS analysis of DOX-TTPNs
showing no significant difference in size compared with empty
TTPNs.
[0041] FIG. 23 is a graph showing in vitro stability of TTPNs and
DOX-TTPNs.
[0042] FIG. 24A-24C represent a result of observing after
intravenous injection of wtFTN, mTRAIL, and TTPN labeled with Cy5.5
into a HepG2 tumor bearing mouse model in order to analyze ex vivo
delivery efficiency of intravenous TTPNs to the tumor, and show an
ex vivo near-infrared fluorescence (NIRF) image of excised major
organs including liver, lung, spleen, kidney, heart, intestine and
tumor 24 hours after intravenous injection of wtFTN, mTRAIL and
TTPN, respectively (FIG. 24A); a series of ex vivo tumor
near-infrared fluorescence (NIRF) images (FIG. 24B); and a graph
representing the quantitative near-infrared fluorescence intensity
of the excised tumor indicated in B are shown (FIG. 24C).
[0043] FIG. 25 is a graph analyzing the anti-tumor effect of
TTPN-mediated apoptosis on tumor growth of HepG2 tumor-bearing
mice. TTPN-, wtFTN-, mTRAIL-, and buffer-treated mice were analyzed
for tumor growth rates. After tumor volume reached .about.80-100
mm.sup.3, mice were treated with TTPN (23 mg/kg), wtFTN (10 mg/kg,
corresponding to molecules of ferritin within 23 mg/kg of TTPN),
mTRAIL (12 mg/kg, corresponding to molecules of TRAILs within 23
mg/kg of TTPN) or buffer (control) was administered 6 times every 2
times via intravenous inoculation (n=6 mice/group).
[0044] FIG. 26 is a representative picture of TTPN- and
buffer-treated mice 25 days after tumor inoculation (HepG2 tumor on
the left side, scale bar=1 cm).
[0045] FIG. 27 is a photograph showing a tumor excised at the end
of the experiment in FIG. 25.
[0046] FIG. 28 is a graph representing the weight of the excised
tumors at the end of the experiment of FIG. 25.
[0047] FIG. 29 is a series of representative fluorescence
microscopic images showing apoptosis in tumor sections of TTPN and
wtFTN treated mice using TUNEL analysis.
[0048] FIG. 30 is a graph showing the results of quantitative
analysis of apoptotic cells in tumor tissue slices analyzed by
fluorescence images including FIG. 29 by ImageJ software. Data
represent mean.+-.SEM (*: p<0.05, **: p<0.01, and ***:
p<0.001 vs buffer control, NS is not significant, one-way ANOVA
analysis with Tukey's post-test).
[0049] FIG. 31 is a representative series of SPR sensograms for
mTRAIL and TTPN bound to immobilized DR4 and DR5, respectively. The
concentration of injected analyte is displayed.
[0050] FIG. 32 is a series of fluorescence microscopic images
representing time-course tracking of DOX-TTPNs within HT29 tumor
cells. Cells were incubated with 40 nM Cy5-conjugated DOX-TTPNs and
analyzed by confocal microscopy at different time points (panels
A-D). Representative images showing the distribution of Cy5-TTPNs
(green) and DOX (red) at 0 min (panel A), 30 min (panel B), 1 h
(panel C), and 2 h (panel C). Nuclei were counterstained with DAPI
(blue). Scale bars: 25 .mu.m.
[0051] FIG. 33A-33C are described herein. FIG. 33A is a graph
representing cell viability of HT29 cells, determined using CCK
assays, after treatment with equal molar concentrations of
DOX-TTPNs, DOX-FTNs, free DOX (equivalent to the DOX dose in
DOX-TTPNs), or empty TTPNs (equivalent to the number of moles of
TRAIL in DOX-TTPNs) for 24 h; FIG. 33B is a graph representing cell
viability of MCF7 cells, determined using CCK assays, after
treatment with equal molar concentrations of DOX-TTPNs, DOX-FTNs,
free DOX (equivalent to the DOX dose in DOX-TTPNs), or empty TTPNs
(equivalent to the number of moles of TRAIL in DOX-TTPNs) for 24 h;
and FIG. 33C is a series of representative flow cytometry
histograms showing DOX-TTPN-induced apoptosis of HT29 cells at low
molar concentrations of DOX-TTPNs. Cells were incubated with the
indicated preparation for 24 h, and then analyzed for staining of
the early apoptosis marker, annexin V (red, DOX-TTPNs; blue, empty
TTPNs; gray, free DOX; black, buffer) Data represent means.+-.SEM
(***P<0.001, compared to buffer control with the exception of
over-proliferation; Student's t test).
[0052] FIG. 34A-34C represent in vitro re-sensitization effect of
DOX-TTPNs in HT29 cells: analysis of the levels of TRAIL-mediated,
apoptosis-related proteins, shows a representative Western blot
analysis of the pro-apoptotic proteins, cleaved caspase-8
(Cl-caspase-8) and Cl-caspase-3; apoptosis-initiator, caspase-8;
and anti-apoptotic proteins, Bax-xL, c-FLIPL/S, XIAP. Cells were
treated with DOX-TTPNs, empty TTPNs, free DOX, or buffer for 24 h
and cell lysates were examined by Western blotting (FIG. 34A); a
representative Western blot analysis showing DR5 levels in
time-course tracking experiments (FIG. 34B) and a schematic diagram
showing intracellular delivery of DOX through the DR5-mediated
endocytosis pathway (FIG. 34C).
[0053] FIG. 35A-35D are described herein. FIG. 35A is a graph
representing tumor growth rate in HT29 tumor-bearing mice treated
with DOX-TTPNs, DOX-FTNs, empty TTPNs, free DOX or buffer. After
tumor volumes reached 80-100 mm.sup.3, mice were treated with
DOX-TTPNs (30 mg/kg; equivalent to a DOX dose of 0.4 mg/kg),
DOX-FTNs (15 mg/kg; equivalent to the number of moles of ferritin
in a dose of TTPNs), empty TTPNs (30 mg/kg; equivalent to the
number of moles of TRAIL in a dose of TTPNs), DOX (0.4 mg/kg), or
buffer (control) five times every 2 d via intravenous injection
(n=6 mice/group); FIG. 35B is a series of representative pictures
of DOX-TTPN- and buffer-treated mice on day 25 post-tumor
challenge. (HT29 tumors on left flank); FIG. 35C is a series of
representative fluorescence microscopic images of apoptotic cells
in TUNEL-stained tumor sections from mice treated with DOXTTPNs,
DOX-FTNs, empty TTPNs, free DOX or buffer; and FIG. 35D is a graph
representing quantification of apoptotic cells in tumor sections,
determined by analysis of fluorescence images in C using ImageJ
software. Data represent means.+-.SEM (*P<0.05, compared with
buffer control; Student's t test). Scale bars: 50 .mu.m.
DETAILED DESCRIPTION OF THE INVENTION
Definition of Terms
[0054] The term "nanocage" as used herein refers to hollow
nanoparticles, which include inorganic nanocages and organic
nanocages. Inorganic nanocage is hollow and porous gold
nanoparticles produced by reacting silver nanoparticles with
chloroauric acid (HAuCl.sub.4) in boiling water and organic
nanoparticles include protein nanocages, which are nanocages
produced by self-assembly of self-assembled proteins such as
ferritin.
[0055] The term "complex nanocage" as used herein refers to a
nanocage in which a specific material is loaded in an empty space
of the nanocage. For example, when doxorubicin, an anticancer
agent, is loaded inside a protein nanocage composed of ferritin
heavy-chain protein, it becomes a doxorubicin complex protein
nanocage. "Doxorubicin complex nanocage" may be used herein as the
same meaning as "doxorubicin-loaded nanocage", "doxorubicin complex
protein nanocage", or "doxorubicin-loaded protein nanocage".
[0056] The term "tumor necrosis factor-related apoptosis-inducing
ligand (TRAIL)" as used herein refers to a protein that functions
as a ligand that induces apoptosis process called apoptosis. TRAIL
is a type of cytokine produced and secreted by most normal tissue
cells. It usually induces apoptosis in tumor cells by binding to
specific tumor receptors.
[0057] The term "trimeric TRAIL-presenting nanocage" (hereinafter
referred to as "TTPN") as used herein refers to a protein nanocage
that presents TRAIL as a natural-like homo-trimeric structure on
the surface. The TTPN is designed and manufactured by the
inventors.
[0058] The term "TNF superfamily" as used herein refers to a super
family of cytokines that can induce apoptosis. The tumor necrosis
factor (TNF, formerly known as TNF.alpha.) is the most well-known
member of this class, and TNF is a monocyte-derived cellular toxin
associated with tumor regression, septic shock and cachexia.
[0059] The term "TNF superfamily re-sensitizer" as used herein
refers to a compound or composition that plays a role of restoring
sensitivity to the TNF superfamily of tumor cells resistant to the
TNF superfamily.
[0060] The term "immunogenic cell death" refers to a type of cell
death caused by cell growth inhibitors such as anthracyclines,
taxan-based chemotherapeutic agents, oxaliplatin and bortezomib,
radiotherapy or photodynamic therapy. Unlike general apoptosis, the
immunogenic cell death can induce an effective anticancer immune
response through activation of dendritic cells and activation of
specific T cell responses thereby. A substance inducing immunogenic
cell death is called an immunogenic cell death inducer or an
immunogenic cell death-inducing compound. The immunogenic cell
death and the immunogenic cell death-inducing compounds are well
described in a prior art (Kroemer et al., Annu. Rev. Immunol., 31:
51-72, 2013). This document is incorporated herein by reference in
its entirety.
[0061] The term "therapeutically effective amount" as used herein
refers to an amount sufficient to significantly ameliorate the
symptoms of a disease when administered to a subject in need of
treatment. The "therapeutically effective amount" can be
appropriately selected according to the cell or individual selected
by a person skilled in the art. "Therapeutically effective amount"
can be determined according to the degree of disease, age, weight,
health, sex, susceptibility to drugs, administration time,
administration route and excretion rate, treatment period, methods
of preparing composition used, and other factors well-known in the
art including drugs used in combination with. The effective amount
may be about 0.5 .mu.g to about 2 g, about 1 .mu.g to about 1 g,
about 10 .mu.g to about 500 mg, about 100 .mu.g to about 100 mg, or
about 1 mg to about 50 mg per composition.
BEST MODES
[0062] In an aspect of the present invention, there is provided a
fusion protein in which a tumor necrosis factor (TNF) superfamily
protein is linked to a self-assembled protein.
[0063] With regard to the fusion protein, the TNF superfamily
protein may be TRAIL, CD40L (CD40 ligand), OX40L (OX40 ligand),
FasL (Fas ligand), LIGHT (tumor necrosis factor superfamily member
14), APRIL (A proliferation-inducing ligand), TNF-.alpha. (tumor
necrosis factor alpha), TNF-.beta. (tumor necrosis factor-beta),
VEGI (vascular endothelial growth inhibitor), BAFF (B-cell
activating factor), RANKL (receptor activator of nuclear factor
kappa-B ligand), LT (lymphotoxin).alpha./LT (lymphotoxin).beta.,
TWEAK (TNF-related weak inducer of apoptosis), CD30L (CD30 ligand),
4-1BBL (4-1BB ligand), GITRL (glucocorticoid-induced TNF-related
ligand), or EDA-A (ectodysplasin A).
[0064] In an embodiment of the present invention, TRAIL was used,
but other TNF superfamily proteins forming homologous trimers may
also be used by adjusting the type and size of the linker according
to the size.
[0065] With regard to the fusion protein, the self-assembled
protein may be a small heat shock protein (sHsp), ferritin, vault,
P6HRC1-SAPN, M2e-SAPN, MPER-SAPN, or a virus or bacteriophage
capsid protein. The ferritin may be a ferritin heavy chain protein
or a ferritin light chain protein. In one embodiment of the present
invention, the ferritin heavy chain protein was used as the
self-assembled protein, but other self-assembled proteins capable
of forming a spherical nanocage by self-assembly thereof may also
be used. In this case, by controlling the type and size of the
linker according to the size of the self-assembled protein, it is
possible to maintain the triaxial symmetric structure of the
prepared protein nanocage.
[0066] Accordingly, in an aspect of the present invention, there is
provided a fusion protein in which TRAIL is linked to a ferritin
protein.
[0067] With regard to the fusion protein, the TRAIL may be linked
to the N-terminus or C-terminus of the ferritin protein, and may
further include a linker peptide between the ferritin protein and
TRAIL.
[0068] with regard to the fusion protein, the length of the linker
peptide may be 2 to 50 aa, and the linker peptide may be selected
from the group consisting of A(EAAAK).sub.4ALEA(EAAAK).sub.4A (SEQ
ID NO: 4), (G.sub.4S).sub.n (where n is an integer from 1 to 10),
(GS).sub.n (where n is an integer from 1 to 10), (GSSGGS).sub.n
(SEQ ID NO: 15, where n is an integer from 1 to 10),
KESGSVSSEQLAQFRSLD (SEQ ID NO: 16), EGKSSGSGSESKST (SEQ ID NO: 17),
GSAGSAAGSGEF (SEQ ID NO: 18), (EAAAK).sub.n (SEQ ID NO: 19, where n
is an integer from 1 to 10), CRRRRRREAEAC (SEQ ID NO: 20), GGGGGGGG
(SEQ ID NO: 21), GGGGGG (SEQ ID NO: 22), AEAAAKEAAAAKA (SEQ ID NO:
23), PAPAP (SEQ ID NO: 24), (Ala-Pro).sub.n (where n is an integer
from 1 to 10), VSQTSKLTRAETVFPDV (SEQ ID NO: 25), PLGLWA (SEQ ID
NO: 26), TRHRQPRGWE (SEQ ID NO: 27), AGNRVRRSVG (SEQ ID NO: 28),
RRRRRRRR (SEQ ID NO: 29), and GSSGGSGSSGGSGGGDEADGSRGSQKAGVDE (SEQ
ID NO: 30). As described above, the length of the linker may be
appropriately adjusted according to the type and size of the
self-assembled protein and/or the TNF superfamily protein.
[0069] In another aspect of the present invention, there is
provided a protein nanocage produced by self-assembly of the fusion
protein.
[0070] In another aspect of the present invention, there is
provided a complex protein nanocage produced by self-assembly of
the fusion protein and encapsulation of an immunogenic cell
death-inducing compound or a TNF superfamily re-sensitizer
therein.
[0071] With regard to the complex protein nanocage, the immunogenic
cell death-inducing compound may be an anti-EGFR antibody, a BK
channel agonist, bortezomib, the combination of cardiac glycoside
and a non-immunogenic apoptosis inducer, cyclophosphamides, the
combination of GADD34/PP1 inhibitor and mitomycin, LV-tSMAC,
Measles virus, or oxaliplatin.
[0072] With regard to the complex protein nanocage, the TNF
superfamily re-sensitizer may be doxorubicin, cisplatin,
gemcitabine, oxaliplatin, irinotecan, camptothecin, celecoxib,
curcumin, cinobufotalin, berberine, LY294002, wortmannin, ABT-737,
HA14-1, or p53 reactivation or induction of massive apoptosis
(PRIMA-1).
[0073] In another aspect of the present invention, there is
provided a pharmaceutical composition for treating cancer
comprising the protein nanocage or the complex protein nanocage as
described herein as an active ingredient and at least one
pharmaceutically acceptable carrier.
[0074] The pharmaceutical composition for cancer treatment may
further include an immunogenic cell death-inducing compound or a
TNF superfamily re-sensitizer. The immunogenic cell death-inducing
compound may be an anti-EGFR antibody, a BK channel agonist,
bortezomib, the combination of cardiac glycoside and a
non-immunogenic apoptosis inducer, cyclophosphamides, the
combination of GADD34/PP1 inhibitor and mitomycin, LV-tSMAC,
Measles virus, or oxaliplatin. The TNF superfamily re-sensitizer
may be doxorubicin, cisplatin, gemcitabine, oxaliplatin,
irinotecan, camptothecin, celecoxib, curcumin, cinobufotalin,
berberine, LY294002, wortmannin, ABT-737, HA14-1, or p53
reactivation or induction of massive apoptosis (PRIMA-1).
[0075] In another aspect of the present invention, there is
provided a method of treating cancer in a subject comprising
administering a therapeutically effective amount of the protein
nanocage or the complex protein nanocage as described herein to the
subject.
[0076] In another aspect of the present invention, there is
provided a method of re-sensitizing TRAIL-resistant tumor cells to
TRAIL, comprising treating the tumor cells with a complex protein
nanocage as described herein, comprising a protein nanocage
produced by self-assembly of a fusion protein as described herein
and an immunogenic cell death-inducing compound or a TNF
superfamily re-sensitizer encapsulated therein, or with a protein
nanocage as described herein and an immunogenic cell death-inducing
compound or TNF superfamily re-sensitizer.
[0077] In another aspect of the present invention, there is
provided a method of treating cancer in a subject suffering from
TRAIL-resistant cancer, comprising administering a therapeutically
effective amount of a complex protein nanocage as described herein,
comprising a protein nanocage produced by self-assembly of a fusion
protein as described herein and an immunogenic cell death-inducing
compound or a TNF superfamily re-sensitizer encapsulated therein,
or administering a therapeutically effective amount of a protein
nanocage as described herein and an immunogenic cell death-inducing
compound or TNF superfamily re-sensitizer to the subject.
[0078] The therapeutically effective amount may vary depending on
the type of the subject's (patient's) affected area, the
application site, the number of treatments, the treatment time, the
formulation, the subject's (patient's) condition, the type of
adjuvant, and the like. The amount used is not particularly
limited, but may be 0.01 .mu.g/kg/day to 10 mg/kg/day. The daily
dose may be administered once a day, or divided into 2-3 times a
day at appropriate intervals, or intermittently administered at
intervals of several days.
[0079] The active agent of the present invention may be present in
the composition in an amount of 0.1-100% by weight based on the
total weight of the composition, which may further include suitable
carriers, excipients, and diluents commonly used in the preparation
of pharmaceutical compositions. In addition, solid or liquid
additives for preparation may be used in the preparation of
pharmaceutical compositions. The additive for formulation may be
either organic or inorganic. Examples of excipients include
lactose, sucrose, sucrose, glucose, cornstarch, starch, talc,
sorbit, crystalline cellulose, dextrin, kaolin, calcium carbonate,
and silicon dioxide. As a binder, for example, polyvinyl alcohol,
polyvinyl ether, ethyl cellulose, methyl cellulose, gum arabic,
tragacanth, gelatin, shellac, hydroxypropyl cellulose,
hydroxypropyl methyl cellulose, calcium citrate, dextrin and
pectin. Examples of the lubricant include magnesium stearate, talc,
polyethylene glycol, silica, and hydrogenated vegetable oil. Any
colorant that is permitted to be added to pharmaceuticals can be
used. These tablets and granules can be appropriately coated with a
sugar coat, gelatin coating, or other necessary. In addition,
preservatives, antioxidants, and the like may be added as
necessary.
[0080] The pharmaceutical composition of the present invention may
be prepared in any formulation conventionally prepared in the art
(for example, Remington's Pharmaceutical Science, the latest
edition; Mack Publishing Company, Easton Pa.), and the form of the
formulation is not particularly limited. Exemplary formulations are
described in Remington's Pharmaceutical Science, 15.sup.th Edition,
1975, Mack Publishing Company, Easton, Pa. 18042 (Chapter 87:
Blaug, Seymour). These and other such formulation are well known
for all pharmaceutical chemistry.
[0081] The pharmaceutical composition of the present invention may
be administered orally or parenterally, preferably wherein
parenteral administration is by intravenous injection, subcutaneous
injection, intracerebroventricular injection, intracerebrospinal
fluid injection, intramuscular injection or intraperitoneal
injection.
[0082] Tumor necrosis factor-related apoptosis-inducing ligand
(TRAIL), which is one of the TNF superfamily, may bind to a TNFR
superfamily member including TRAIL R1 (death receptor 4, DR4),
TRAIL R2 (death receptor 5, DR5), TRAIL R3 (decoy receptor 1,
DcR1), TRAIL R4 (decoy receptor 2, DcR2), and osteoprotegerin.
Among these receptors, DR4 and DR5 contain a cytoplasmic `death
domain` (DD) and induce apoptosis of cells. In particular, unlike
other apoptosis-inducing ligands (i.e., Fas-ligands), TRAIL has
proven to be more effective in selectively inducing apoptosis of
tumor cells. Based on preclinical studies, TRAIL agonists showed
remarkable anti-tumor activity in various tumor types, but no or
limited effects on normal cells. Thus, TRAIL can be considered a
desirable anticancer agent due to its tumor-specific apoptotic
activity. Like other members of the TNF superfamily, endogenous
TRAIL exists as a homo-trimeric complex that is critical for
stability, solubility and bioactivity. According to recent studies,
several types of trimer preparations of recombinant TRAIL have been
reported to improve biological properties such as stability,
delivery and cytotoxic activity against tumors (i.e., FLAG and its
tag-mediated crosslinking; linking it to the Fc portion of IgG;
fusion of trimerization domains such as leucine zippers or
isoleucine zippers; conjugated to nanoparticles; stabilization of
trimers with cations, etc.) (D. Merino et al., Expert Opin. Ther.
Targets. 11: 1299-1314, 2007).
[0083] When expressed in the form of a recombinant protein by
linking a TNF superfamily protein such as TRAIL to a self-assembled
protein such as a ferritin heavy chain with a linker peptide, it
was confirmed that a protein nanocage could present the TNF
superfamily ligand as active homo-trimers on the surface of the
protein nanocage, by adjusting the length of the linker peptide.
Further, it was confirmed that the protein nanocage alone or a
complex protein nanocage prepared by encapsulating an immunogenic
cell death-inducing compound such as doxorubicin in the protein
nanocage can promote the death of tumor cells in cancer model mice
when administrated to the cancer model mice. In addition, it was
confirmed that the complex protein nanocage comprising the protein
nanocage and an immunogenic cell death inducer encapsulated therein
according to an embodiment of the present invention restored
sensitivity of TRAIL-resistant cancer cells to TRAIL. Moreover, the
effect of the present invention was achieved even with a
significantly lower dose (even 0.4 mg/kg) of doxorubin compared to
conventional combination TRAIL and anticancer drug therapy using,
e.g., 1.5 to 7 mg/kg of anticancer drug. Thus, the complex protein
nanocage according to an embodiment of the present invention showed
an unexpected prominent and enhanced effect over the prior art.
[0084] Hereinafter, the present invention will be described in more
detail through examples. However, the present invention is not
limited to the examples disclosed below, but can be implemented in
various different forms, and the following embodiments are intended
to complete the disclosure of the present invention, and fully
inform the scope of the invention to those of ordinary skill in the
art.
General Methods
Design and Biosynthesis of TTPNs
[0085] For the generation of wtFTN, mTRAIL and TTPN, gene clones
were prepared through polymerase chain reaction (PCR) amplification
using appropriate primers; i) N-NdeI-6.times.His
tag-(hFTH)-HindIII-C; ii) N-NdeI-(TRAIL 95-281)-BamHI; iii)
N-NdeI-(TRAIL.sub.95-281)-BamHI-linker-XhoI-(hFTH)-HindIII-C;
polynucleotides encoding hFTH (SEQ ID NO: 5) and TRAIL (SEQ ID NO:
1), respectively, were cloned using a cDNA clone (Sino Biological
Inc., China), and a polynucleotide encoding a linker peptide
A(EAAAK).sub.4ALEA(EAAAK).sub.4A (SEQ ID NO: 3) was cloned through
expansion PCR amplification using appropriate primers. The gene
clone was ligated with the vector for construction of the
expression vector (pET28a for wtFTN and TTPN, pT7 for wtFTN):
pT7-wtFTN, pET28a-mTRAIL, pET28a-TTPN. After complete sequencing,
the expression vector was transformed with E. coli strain BL21(DE3)
[F-ompT hsdSB(rB-mB-)] with ampicillin (for pT7) or kanamycin (for
pET28a).
[0086] Cells transformed with wtFTN, mTRAIL and TTPN constructs
were grown to OD.sub.600=0.6 level at 37.degree. C. in LB medium
containing appropriate antibiotics (ampicillin for wtFTN, mTRAIL,
and kanamycin for TTPN) and protein expression was induced with 0.5
mM IPTG, and grown at 20.degree. C. for 16 hours. After growth, the
cells were obtained by centrifugation, and the pellet was
resuspended in a lysis buffer (0.5 M Tris-HCl (pH 7.4), 150 mM
NaCl, 10 mM imidazole, 1 mM PMSF), and homogenized with a
sonicator. The recombinant protein was purified through a Ni-NTA
chromatography step, and after synthesis and purification, the
soluble protein was stored in a storage buffer (0.5 M Tris-HCl, 150
mM NaCl, pH 7.4).
TABLE-US-00001 TABLE 1 Primers used for the present invention
Primer nucleotide sequence (5'->3') SEQ ID NO: wtFTN F
CATATGCATCACCATCACCATCACACGACC 7 wtFTN R AAGCTTTTAGCTTTCATTATCACT 8
mTRAIL F CATATGACCTCTGAGGAAACCATT 9 mTRAIL R
GGATCCTTAGCCAACTAAAAAGGCCCC 10 TTPN 1 CATATGACCTCTGAGGAAACCATT 11
TTPN 2 CTCGAGACGACCGCGTCCACCTCGCAG 12 TTPN 3
GGATCCGCCAACTAAAAAGGCCCCAAA 13 TTPN 4 AAGCTTTTAGCTTTCATTATCACT
14
Design and Synthesis of DOX-TTPN
[0087] DOX (Sigma-Aldrich) was pre-incubated with CuCl.sub.2 at a
2:1 molecular ratio of DOX to Cu.sup.2+ at room temperature for 20
min, as described previously. TTPNs were incubated with Cu(II)-DOX
solution (1:200 molecular ratio of TTPNs to DOX) at 4.degree. C.
overnight. Free DOX was removed by dialysis and the encapsulation
of DOX into TTPNs was analyzed by SEC using a Superdex 200 column
(GE Healthcare). The amount of loaded DOX in TTPNs was determined
by measuring fluorescence intensity of DOX using a DS-11 FX+
Fluorometer (DeNovix). After the disassembly process of DOX-TTPNs
by mixing with 0.5 N HCl for 1 hour, the number of DOX molecules
was quantified relatively using a standard curve of DOX
fluorescence intensity.
Analysis of Physicochemical Properties of TTPN
[0088] Size Exclusion Chromatography (SEC) and Dynamic Light
Scattering (DLS) Analysis
[0089] Purified protein samples (Superdex 200 10/300, GL column)
were applied to a size exclusion chromatography analyzer (SEC, Akta
100 purifier) to determine purity and molecular weight. The elution
profile of TTPN was monitored by measuring the absorbance at 280 nm
compared to wtFTN. The hydrodynamic sizes of TTPN and wtFTN were
analyzed by dynamic light scattering analysis (DLS) and zeta
potential measured using Zetasizer Nano ZS (Malvern Instruments,
Ltd., UK).
[0090] Transmission Electron Microscopy (TEM) and Dynamic Light
Scattering Analysis
[0091] TEM analyses of TTPN and wtFTN were imaged by bio
transmission electron microscopy (Hitachi). TTPN and wtFTN (0.1
mg/ml) were placed on carbon film 200 copper grid (Electron
Microscopy Science) and negatively stained using 2% ammonium
molybdate. The hydrodynamic sizes of TTPN-DOX and TTPN were
analyzed by dynamic light scattering (DLS) using a Zetasizer Nano
ZS system (Malvern Instruments, Ltd., UK), as previously described
(Zidi et al., Med. Oncol. 2010, 27(2): 185-198, 2010).
[0092] Analysis of In Vitro Stability of DOX-TTPN and TTPN
[0093] The stability of TTPN, DOX-TTPN and mTRAIL was investigated
by measuring changes of concentration in a suitable buffer
solution. DOX-TTPN and TTPN (8 mg/mL) in microcentrifuge tubes were
monitored for one month at 4.degree. C. At predetermined times,
aggregated proteins were collected at 13,000 rpm for 10 minutes,
and the concentration of soluble DOX-TTPN and TTPN in the
supernatant was measured using absorbance in UV280.
In Vitro Binding Property of TTPNs
Tumor Cell Culture
[0094] Human colorectal adenocarcinoma cell line (HT29),
hepatocellular carcinoma cell line (HepG2), and breast cancer cell
line (MCF7) were provided from the Korean Cell Line Bank. The tumor
cells were cultured in RPMI-1640 media supplemented with 10% fetal
bovine serum (FBS) and 1% antibiotic antimycotic (AA).
Analysis of Cell-Binding of TTPNs
[0095] TRAIL receptor expression was evaluated on various cell
surfaces. Specifically, HepG2, HT29, and HEK293T cells
(2.times.10.sup.5) were cultured with four types of anti-human
TRAIL receptor antibodies (R&D system, MAB347, MAB6311,
MAB6301, MAB633). For cell binding analysis to the TRAIL receptor,
various cells were treated with 400 nM TTPN or wtFTN in a buffer
solution at 4.degree. C. for 20 minutes, followed by treatment with
anti-ferritin antibody (ab65080) and anti-rabbit Alexa fluor 488
secondary antibody (Jackson Immunoresearch). Nanocage bound cells
were detected with an Accuri.TM. C6 flow cytometer (BD Biosciences)
and analyzed using FlowJo_V10 software (FlowJo). The binding
specificity of TTPN to TRAIL receptor was analyzed by blocking
experiments by pre-culture of anti-human TRAIL receptor antibodies
and cells at 4.degree. C. for 20 minutes. In addition, for
fluorescence microscopy analysis, HepG2 cells were plated on 35-mm
glass-bottom dishes, treated with 50 nM of TTPN or wtFTN buffer,
and cultured with the same antibody as described above. Thereafter,
the cells were fixed with 4% paraformaldehyde and stained with
Hoechst 33258 before analysis for cell binding detection in a
fluorescence microscope (Nikon Eclipse Ti, Nikon). Data were
analyzed using LAS AF Lite software (Leica).
[0096] Surface Plasmon Resornace (SPR) Analysis
[0097] Binding experiments of TTPN and mTRAIL to TRAIL receptors
DR4 and DR5 were analyzed at 25.degree. C. using a surface plasmon
resonance apparatus (SR7500 DC, Reichert Inc., NY, USA). DR4 and
DR5-fc chimeric proteins (R&D systems 347-DR-100, 631-T2-100)
were immobilized on the surface of the Planar Protein A sensor chip
(Reichert, 13206069) and the receptors were coated at a level of
300 to 500 resonance units. SPR kinetic titrations were performed
by adding 250 .mu.l of TTPN and mTRAIL with different
concentrations in the range of 1.56 to 400 nM and 0.1 to 25.6
.mu.M, respectively, increasing by four times. Each analyte was run
at 50 .mu.L/min using running and sample buffer (0.5 M Tris-HCl (pH
7.4), 150 mM NaCl, 0.005% Tween 20), and binding of the ligand to
the receptor was performed and monitored in real time. For
titration sensorgrams, a simple 1:1 Langmuir interaction model
(A+BAB) was applied using the data analysis program Scrubber 2.0
(BioLogic Software, Australia, and KaleidaGraph Software,
Australia) and CLAMP software.
[0098] Time-Corse Tracking Analysis of DOX-TTPN
[0099] The efficiency of DOX-TTPN intracellular delivery was
investigated using in vitro time-course tracking studies of
Cy5.5-conjugated DOX-TTPNs. For conjugation of Cy5.5, Cy5.5-NHS
were incubated with DOX-TTPNs at 24:1 molar ratio, followed by
removal of free Cy5.5 using an Amicon Ultra Centrifugal Filter
(Millipore), as previously described (Kih et al., Biomaterials 180:
67-77, 2018). After collecting a to sample, HT29 cells were
incubated with 40 nM Cy5-conjugated DOX-TTPNs for 30 minutes, 1
hour and 2 hours; after cell fixation, nuclei were stained with
DAPI and images were analyzed by confocal fluorescence microscopy
(Leica).
In Vitro Apoptosis Analysis of TTPN
[0100] Cell Viability Analysis
[0101] Cytotoxicity analysis was performed using mTRAIL, TTPN and
wtFTN as a control. Specifically, HepG2 cells or HEK293T cells were
plated on a 96-well plate, and mTRAIL, TTPN, and wtFTN were added
to each well the next day at an increased concentration from 0 to
32 .mu.M. After culturing for 24 hours, cell viability was measured
using a cell counting kit (CCK)-8 assay (Dojindo Molecular
Technologies, Gaithersburg, Md.). The plate was then read with an
absorbance microplate reader (Spectramax 340, Molecular Devices
Corporation) at a wavelength of 450 nm and 50% effective by
regression analysis using SigmaPlot software (Systat Software,
Inc., San Jose, Calif.). The concentration value was
calculated.
[0102] In Vitro Apoptosis Analysis
[0103] HepG2, HT29, or MCF7 cells (1.5.times.10.sup.4) were
cultured in a 96-well plate for 1 day, after which DOX-TTPNs,
DOX-FTNs, free DOX, empty TTPNs, or buffer was added to each well.
After 24 hours, cell viability was measured using a CCK-8 assay
(Dojindo Molecular Technologies) according to the manufacturer's
instructions. For analysis of early apoptosis, HT29 cells in 6-18
well culture plate were treated with DOX-TTPNs, free DOX, empty
TTPNs, or buffer for 24 hours. Thereafter, cells were incubated
with Alexa Fluor 488-conjugated annexin V (Invitrogen) 20 for 15
minutes, then analyzed using an Accuri.TM. C6 flow cytometer (BD
Biosciences) and FlowJo 21 v10 software.
[0104] Animals
[0105] Male BALB/c nude mice (6-7 weeks old; 20 g) were purchased
from Orient Bio Inc. (Seongnam, Korea). All mice were used at 7-9
weeks old after a period of stabilization. Mice were grouped
randomly before xenograft, and all animals used in experiments were
analyzed. All experiments using live animals were performed in
compliance with the relevant laws and institutional guidelines of
Korea Institute of Science and Technology (KIST) with the approval
of relevant institutional committees.
[0106] In Vivo Tumor Targeting and Biodistribution of TTPN
[0107] The delivery efficiency of TTPN to the tumor
microenvironment was investigated by performing an in vivo
biodistribution study (n=4 mice/group) of Cy5.5-labeled TTPN using
the eXplore Optix System (Advanced Research Technologies Inc.,
USA). Particularly, for Cy5.5 binding, TTPN, wtFTN, and mTRAIL were
cultured with Cy5.5-Maleimide (Bioacts, Korea) at a molar ratio of
1:24 in a sample buffer, and then cultured at 4.degree. C. for 16
hours. Free-Cy5.5 was separated by ultrafiltration (Amicon Ultra
100 K, Millipore), and the fluorescence intensity of the
Cy5.5-labeled protein was measured using a fluorescence microplate
reader (Infinite M200 Pro, TECAN, Austria). Thereafter, the same
concentration and fluorescence intensity of Cy5.5-labeled TTPN,
wtFTN or mTRAIL were injected intravenously into BALB/c nude mice
bearing HepG2 tumors via tail vein. The fluorescence intensity of
all samples was adjusted to the same value based on the data
obtained using a fluorescence microplate reader. To analyze the
fluorescence intensity of tumors, the Analysis Workstation software
(Advanced Research Technologies Inc.) was used to calculate total
photons per centimeter per steradian (p/s/cm.sup.2/sr) in the
region of interest (ROI). At 24 hours post-injection, the mice were
sacrificed, and tumors and major organs including liver, lung,
spleen, kidney and heart were excised and analyzed in the same
manner as described above.
[0108] In Vivo Antitumor Efficacy and TUNEL Analysis
[0109] In the evaluation of the anti-tumor effect of the present
invention, BALB/c nude male mice (6-7 weeks old) were used as an
animal model. Particularly, HT29 cells (5.times.10.sup.6) and HepG2
cells (5.times.10.sup.6) were subcutaneously inoculated into the
left dorsal flank of BALB/c nude mice, respectively. After a volume
of tumors reached .about.80-100 mm.sup.3, mice were randomly
divided into the 14 following five treatment groups (6 mice/group);
DOX-TTPNs, DOX-FTNs, free DOX, empty TTPNs, and buffer. Mice were
intravenously injected five times, once every 2 days, and volume of
tumors was determined as 1/2(Length.times.Width.sup.2). Apoptotic
cell death in tumor tissues was analyzed using TUNEL staining (In
situ Cell Death Detection kit; Roche), and cells were stained with
DAPI (4',6-diamidino-2-phenylindole), as previously described (Kih
et al., Biomaterials 180: 67-77, 2018). Apoptotic cells were
visualized under a Nikon Eclipse Ti microscope (Nikon) and
quantified as the number of TUNEL-positive cells per total number
of cells using ImageJ software. After 21 days from injecting tumor
cells, tumor tissues were excised from the experimental mice, and
cryo-sections (3.5 .mu.m) were fixed with 10% neutral buffered
formalin and paraffin-embedded tissue blocks.
[0110] Western Blot Analysis
[0111] After incubating HT29 cells with 50 nM DOX-TTPNs, DOX-FTNs,
free DOX, or buffer for 24 hours, cells were lysed with
radioimmunoprecipitation assay (RIPA) buffer (Cell Signaling
Technology) and the concentration of proteins was measured using a
DC protein assay kit (Bio-Rad). Equal amounts of proteins (30
.mu.g) were resolved by SDS-PAGE and transferred to nitrocellulose
membranes. After blocking with 5% skim milk in Tris-buffered saline
containing 0.1% Tween-20 (TBST), membranes were incubated first
with anti-Cl-PARP, anti-Cl-caspase-6, anti-cFLIP, anti-Bcl-xL,
anti-XIAP, anti-Cl-caspase-3, or anti-GAPDH primary antibody (Cell
Signaling Technology), and then with anti-mouse or anti-rabbit
secondary antibodies (Sigma-Aldrich), as appropriate.
Immunoreactive proteins were visualized using enhanced
chemiluminescence (ECL) chemical reagents (Bio-Rad) and ChemiDoc
(Bio-Rad), and were analyzed using ImageJ software.
[0112] Data Analysis
[0113] All data are presented as means.+-.standard error of the
mean (SEM). The statistical analysis was determined by Student's
t-test. P values of less than 0.05 were considered statistically
significant.
Example 1: Design of Trimer TRAIL-Expressed Ferritin Nanocage
[0114] In order to develop a nature-mimetic delivery platform for
providing a stable homologous trimer of recombinant TRAIL, the
present inventors used ferritin heavy chain nanocages as a scaffold
for structure-based design of trivalent ligands. Human ferritin
heavy chains self-assemble into a constant 24-subunit structure and
form a spherical cage-like architecture. Nanocages not only have
the desired physical properties, but the surface can be manipulated
to obtain specificity by active proteins or small molecules through
simple genetic and chemical modification (Jutz et al., Chem. Rev.
115: 1653-1701, 2015).
[0115] Over the past 20 years, the application potential of
ferritin nanocages in drug and vaccine delivery, diagnostics, and
biomineralization scaffolds has been extensively evaluated. Based
on the crystal structure analysis, given the 4-3-2 axisymmetric
structure of the ferritin nanocage, the N-terminus of the nanocage
is gathered in a threefold axis and exposed to the outer surface of
the shell. Accordingly, the present inventors investigated the
presentation of trimeric TRAIL in ferritin nanocages by structural
combination based on the analysis of the three-dimensional
structure. First, it was determined how the trimeric TRAIL could be
presented as native-like conformations around the triple axis on
the surface of the ferritin nanocage. When the distance between the
ferritin N-terminus (Asp.sub.5) of the triple axis is 28 .ANG. and
the distance between the TRAIL foreign domain C-terminus
(Leu.sub.228) of the triple axis is 8.4 .ANG. (FIGS. 1 and 2A-2B),
the trimer TRAIL C-terminus cannot coincide with the N-terminus of
the ferritin subunit around each triaxial on the nanocage surface.
Thus, a linker with rigid and flexible sectors was designed to
compensate for the distance between the ferritin N-terminus and the
TRAIL C-terminus and form a geometry consistent with the TRAIL
homo-trimer on the nanocage surface. As shown in FIGS. 2A-2B and 3,
the extracellular-domain of TRAIL was genetically fused to the
human ferritin heavy chain by adding a linker. Three of the
N-terminal-fused TRAILs on the triple axis of ferritin form a
trimer-like structure on the surface of the ferritin nanocage. As
the 24 monomeric ferritin subunits are self-assembled into a cage
structure, a total of 8 natural-like TRAIL homo-trimers can be
displayed on the surface of the ferritin nanocage. In general,
other members of the TNF superfamily have similar structures and
distances between each C-terminus (FIG. 1). Thus, using a similar
approach, ferritin nanocages with 4-3-2 axial symmetry can be used
as scaffolds to display other members of the TNF superfamily
ligand.
Example 2: Biosynthesis and Physicochemical Properties of TTPN
[0116] The present inventors determined that the designed TTPN
(Trimeric TRAIL-Presenting Nanocage) was successfully expressed as
a soluble recombinant protein in E. coli through SDS-PAGE and
Western blot analysis (FIG. 4A-4C). Self-assembly of TTPN was
evaluated through size exclusion chromatography and dynamic light
scattering analysis (DLS) through high-speed protein liquid
chromatography (FPLC, FIG. 5A-5B). The size exclusion
chromatography of TTPN showed a prominent peak in the elution
profile, indicating that the nanocage was well formed. As shown in
FIG. 5B, the TTPN formed as described above is slightly larger than
the wild type ferritin nanocage (wtFTN). TTPN forms nano-sized
particles having an average size of 25.85 nm measured by dynamic
light scattering (DLS) analysis. In addition, the properties of
TTPN were also confirmed by transmission electron microscopy (TEM)
images (FIGS. 6 and 7). The TTPN had a uniform spherical nano-sized
particle structure with an average size of 24-28 nm, which is
slightly larger than wtFTN. On the other hand, using negative dye
transmission electron microscopy to observe the morphology more
clearly, TTPN clearly showed visible spikes protruding from the
spherical core, whereas wtFTN showed smooth spherical particles. As
a result of performing a two-dimensional class analysis on a TEM
image by randomly selecting a single particle, it was found that
the spikes were distributed in an average of 4 to 6 arms on the
surface of the nanocage, suggesting that TRAIL trimer spikes were
formed and decorated the surface of the nanocage. Based on the
above data, the present inventors have succeeded in designing and
generating a TTPN that presents a trimeric TRAIL-like complex in a
natural structure on a self-assembled nanocage as a symmetric
structure.
Example 3: Binding Kinetics, Affinity and Stability of TTPN
[0117] To confirm whether TTPN targets the TRAIL receptor on the
surface of tumor cells, the binding ability of TTPN in HepG2
hepatocellular carcinoma, HT29 colon carcinoma and HEK293T cells
was evaluated in vitro. HepG2 cells are known to express a greater
amount of DR4/DR5 than DcR1/DcR2. As a result of actual analysis,
the expression levels of DR4/DR5 and DcR1/DcR2 were nearly
5.46/4.63 and 2.26/2.31 fold, respectively, relative to the IgG
control (FIGS. 8 and 9). As a control, analysis results for HT29
cells and HEK293T cells known to be resistant to TRAIL show low
levels of DR4/DR5 expression as shown in FIGS. 10 and 11. As shown
in FIGS. 10 and 11, TTPN had a greater effect than wtFTN in binding
on the surface of HepG2 cells. Since HepG2 cells had high
expression of DR4 and DR5, the target specificity of TTPN was
higher in HepG2 cells than in HT29 and HEK293T cells. In addition,
considering that the binding of TTPN is reduced by pre-incubation
with four anti-TRAIL receptor antibodies, TTPN specifically binds
to TRAIL receptors on the surface of tumor cells (FIGS. 12 to
14).
[0118] In addition, in order to confirm the binding kinetics and
affinity of TTPN, DR4 and DR5 immobilized on a sensor chip through
protein A and Fc domains were used to compare with the monomeric
TRAIL (mTRAIL) extracellular domain. Surface plasmon resonance
(SPR) analysis was performed (FIG. 31). As shown in FIG. 31, mTRAIL
binds DR4 and DR5 with low affinity as expected, whereas TTPN binds
to both receptors with sub-nanomolar affinities. The K.sub.D value
of TTPN significantly decreased by 330 times compared to DR4 and 37
times compared to DR5 compared to mTRAIL (see Tables 2 and 3). In
both receptors, higher binding and lower dissociation rates were
observed than mTRAIL, suggesting that the cluster structure of
TRAIL, which is well formed on the surface of TTPN, is easily
recognized by its receptors, very similar to the homo-trimeric
structure in nature.
TABLE-US-00002 TABLE 2 Summary of Surface Plasmon Resonance (SPR)
Assays for Affinity and Kinetics of TTPN Binding to Immobilized DR4
DR4-Fc ka (M.sup.-1 S.sup.-1) kd (s.sup.-1) K.sub.D (M) mTRAIL 8.68
(.+-.7.12) 10.sup.2 5.27 (.+-.2.14) 10.sup.-5 2.47 (.+-.2.27)
10.sup.-7 TTPN 3.23 (.+-.0.26) 10.sup.4 2.42 (.+-.0.48) 10.sup.-5
7.47 (.+-.1.21) 10.sup.-10
TABLE-US-00003 TABLE 3 Summary of Surface Plasmon Resonance (SPR)
analysis for the affinity and kinetics of TTPN binding to
immobilized DR5 DR5-Fc ka (M.sup.-1 S.sup.-1) kd (s.sup.-1) K.sub.D
(M) mTRAIL 1.48 (.+-.0.12) 10.sup.3 3.87 (.+-.1.13) 10.sup.-5 2.54
(.+-.0.56) 10.sup.-8 TTPN 6.62 (.+-.4.19) 10.sup.4 1.49 (.+-.1.13)
10.sup.-5 6.82 (.+-.5.72) 10.sup.-10
[0119] The affinity K.sub.D was determined from the formula of
K.sub.D=kd/ka. Results are based on representative sensorgrams
obtained from saturation binding reactions averaged over at least
three independent runs of SPR measurements (FIG. 31).
[0120] In addition, the present inventors also investigated the in
vitro stability of TTPN, because many TRAIL variants developed
previously showed liver toxicity problems and instability in
solution and rapid aggregation at high concentration in clinical
studies according to previous reports, thus, limiting the dosage.
However, in the present invention, surprisingly, as shown in FIG.
15, mTRAIL precipitated and aggregated rapidly, while TTPN
exhibited remarkably improved stability. In addition, the amount of
mTRAIL in the soluble form rapidly dropped to 57% of the initial
concentration within 2 days, but more than 90% of the TTPN was
still maintained in the soluble form after 1 month (FIG. 16).
Overall, the nanocage particle structure of the natural-like trimer
TRAIL of the invention substantially improved the recognition
ability by improved affinity and stability, which supports the
inventors' concept that TTPN according to an embodiment of the
present invention can be a promising apoptosis agent for tumor
cells.
Example 4: In Vitro Apoptosis Ability of TTPN
[0121] In order to evaluate the TRAIL-mediated apoptosis capacity
of TTPN, the present inventors first measured the cell viability of
HepG2, HT29 and HEK293T cells against mTRAIL, TTPN and wtFTN as a
control. Cells were treated with TTPN, mTRAIL and wtFTN for 24
hours and cell viability was measured using Cell Counting Kit-8
(CCK-8). As shown in FIG. 17, TTPN showed concentration-dependent
apoptosis in TRAIL-sensitive HepG2 cells. On the other hand, it is
assumed that the low apoptosis rate of HEK293T cells related to
TTPN is due to the low levels of TRAIL receptors (DR4 and DR5)
expressed in the HEK293T cells (FIG. 18).
[0122] In particular, HepG2 cells reached 50% apoptosis with a low
concentration of 13.4 nM TTPN (IC.sub.50), whereas the IC.sub.50 in
mTRAIL-treated cells was 405 nM, which is a concentration 30 times
higher than that of TTPN. In addition, to investigate whether
apoptosis induced by TTPN is induced by the pro-apoptosis pathway
of tumor cells, fluorescence-activated cell sorting (FACS) using
double staining of Annexin V/propidium iodide (PI) was performed.
Analyzing apoptosis by fluorescence-activated cell sorting)
analysis, concentration-dependent apoptosis in HepG2 cells was
observed as Annexin V/PI double positive cells (FIG. 19). In
addition, Annexin V-positive cells showing initial apoptosis were
significantly detected in 0.4 nM TTPN, but no substantial detection
of Annexin V-positive cells was observed until treatment with 25 nM
mTRAIL (FIG. 20). The percentage (%) of surviving tumor cells for
Annexin V/PI double negative signal (PI: marker of late apoptosis
and necrosis) of TTPN-treated group was lower than mTRAIL-treated
group, significantly [94.3% (not significant) for 0.4 nM mTRAIL,
83.5% (p<0.05) for 0.4 nM TTPN; 12.0% (p<0.001) for 100 nM
TTNP and 82.9% (p<0.001) for 100 nM mTRAIL, respectively] (FIG.
21). Thus, the above results suggest that nanocage particles of
natural trimer-like TRAIL in TTPN increase the apoptotic effect,
which is consistent with the observed increased affinity and
stability of TTPN.
Example 5: Preparation, Physicochemical Characterization, and
Stability of DOX-Loaded TTPNs
[0123] 5-1: Design of DOX-TTPNs
[0124] To overcome the resistance of TRAIL-mediated apoptosis, the
present inventors applied the additional strategy of using
doxorubicin (DOX) as a re-sensitizing agent. A number of studies
have demonstrated that radiotherapy and anticancer
chemotherapeutics, such as cisplatin, doxorubicin and tunicamycin,
when combined with TRAIL monotherapy, can re-sensitize
TRAIL-resistant tumor cells in vitro and in vivo (Refaat et al.,
Oncol. Lett. 7(5): 1327-1332, 2014; Oh et al., J. Control. Release
2015, 220(Pt B): 671-681, 2015; Zinonos et al., Anticancer Res.
34(12): 7007-7020, 2014). Among these chemotherapeutic drugs, DOX
acts by regulating TRAIL receptor (i.e., DR5) levels and pro- and
anti-apoptotic proteins at points within intrinsic and extrinsic
apoptotic pathways; thus, combined treatment with DOX and TRAIL may
amplify TRAIL-induced apoptosis (Zinonos et al., Anticancer Res.
34(12): 7007-7020, 2014; Bae et al., Biomaterials 33(5): 1536-1546,
2012). Notably, the present inventors took advantage of the ability
of DOX to form a stable complex with a metal cation to create
Cu-DOX, which is easily encapsulated into the inner cavity of the
ferritin nanocage. Ferritin nanocages are cellular iron storage
proteins that allow encapsulation of metal-complexed molecules.
These properties give DOX-loaded ferritin nanocages a therapeutic
advantage over free drug.
[0125] 5-2: Preparation and Characterization of DOX-TTPNs
[0126] The present inventors demonstrated encapsulation of
metal-complexed DOX in TTPNs, termed DOX-TTPNs (FIG. 22A), which
represent a further improvement and optimization of ferritin
nanocage platforms described in previous studies (Kih et al.,
Biomaterials 180: 67-77, 2018; Lee et al., Adv. Mater. 30(10):
1705581, 2018). DOX-TTPNs were prepared by pre-complexation of DOX
with Cu.sup.2+ and incubation with TTPNs, followed by removal of
free DOX. The loading efficiency of DOX into TTPNs was determined
by size-exclusion chromatography (SEC) and measuring the
fluorescence intensity of DOX in TTPNs. As shown in FIG. 22B, the
elution profile of DOX-TTPNs exhibited two prominent peaks at 280
nm and 480 nm, each with a similar elution time, indicating that
DOX is well-encapsulated within TTPNs. DOX-TTPNs showed no
significant difference in diameter compared with TTPNs before DOX
encapsulation (FIG. 22C). The amount of incorporated DOX was
determined to be .about.30.+-.6 molecules per TTPN, whereas
wild-type ferritin encapsulates up to 40 molecules of DOX in its
inner cavity. Given that a three-fold channel has been proposed as
the primary passageway for metal ions in ferritin, fewer molecules
of DOX are deposited in TTPNs, which present TRAIL in its
three-fold axis, than in wild-type ferritin (Laghaei et al.,
Proteins 81(6): 1042-1050, 2013). Taken together, these findings
suggest that, although the loading efficiency of DOX in TTPNs was
slightly reduced compared to wild-type ferritin, the present
inventors successfully developed a nanocage therapeutic that not
only carries TRAIL in its native-like trimeric complex structure
but also delivers DOX to re-sensitize TRAIL-resistant tumor
cells.
[0127] Next, to verify the stability of DOX-TTPNs, the present
inventors monitored their solubility for 1 month. Several
TRAIL-based therapeutics have been shown to exhibit low stability
and accelerated aggregation at high concentrations, limiting dosing
and causing adverse effects such as hepatotoxicity in clinical
studies (Soria et al., J. Clin. Oncol. 28(9): 1527-1533, 2010).
Importantly, TTPNs showed excellent stability compared with the
monomer form of TRAIL; more than 90% stability of TTPN observed
over 1 month, whereas almost 50% monomer form of TRAIL exhibited
rapid aggregation within 21 days (Kih et al., Biomaterials 180:
67-77, 2018). Consistent with stability of TTPNs, the amount of
DOX-TTPNs in soluble form retained more than 90% of their initial
value over 1 month, indicating that DOX-TTPNs were remarkably
stable (FIG. 23).
Example 6: In Vivo Apoptosis Ability and Anti-Tumor Effect of
TTPN
[0128] The present inventors investigated the efficacy of TTPN as
an anti-tumor agent in HepG2 tumor-bearing mice. Specifically, in
order to investigate the delivery efficiency to tumors before
observing the anti-tumor effect of TTPN, Cy5.5-labeled TTPN,
mTRAIL, and wtFTN were injected intravenously into HepG2
tumor-bearing mice, followed by near-infrared fluorescence (NIRF)
imaging. Biodistribution and delivery to tumor tissues were
observed. As shown in FIG. 24A-24C, the fluorescence intensity of
tumors of mice injected with TTPN was higher than that of wtFTN and
mTRAIL. TTPN is more stable than wtFTN and mTRAIL at the tumor site
and accumulated more and stayed longer than wtFTN and mTRAIL due to
both the interaction with the TRAIL receptor overexpressed in tumor
cells and the passive effect through increased permeability and
retention (EPR).
[0129] In addition, the tumor growth inhibitory effect of
intravenously injected TTPN was evaluated compared with mTRAIL and
wtFTN. To this end, HepG2 cells were transplanted into mice as
xenografts and the tumor size reached a volume of 80.about.100
mm.sup.3, and then TTPN (23 mg/kg), mTRAIL (12 mg/kg) or wtFTN (10
mg/kg, corresponding to the molecules of ferritin in the TTPN dose)
were administered every 2 days. As shown in FIGS. 25 to 28, tumor
growth rate was significantly suppressed in mice injected with TTPN
compared to mice injected with other agents tested. TTPN inhibited
the tumor volume by 80.52%, which was 3.1 times higher than the
effect of a 24-fold molar amount of mTRAIL (25.98% reduction in
tumor volume). In addition, to investigate whether tumor growth
inhibition by TTPN is induced by apoptosis-inducing activity on
tumor cells, tumor tissues from the treated mice were analyzed. On
the 15.sup.th day after the first injection, mice were euthanized,
and apoptosis of tumor tissues was analyzed using terminal
deoxynucleotidyl transferase dUTP nick end labeling (TUNEL)
staining. TTPN significantly increased apoptosis and TUNEL-positive
cells in tumor tissues compared to mTRAIL-treated cells (FIG. 29).
In addition, quantification of TUNEL-positive tumor cells treated
with TTPN (84.4%) showed a significant increase in the number of
apoptotic cells compared to treatment with mTRAIL (18.9%) (FIG.
30). Due to the improved affinity of TRAIL to the TRAIL receptor,
the high affinity, and the high apoptosis ability of TTPN, tumor
growth was continuously suppressed through strong induction of
tumor cell apoptosis.
Example 7: In Vitro Intracellular Delivery and Pro-Apoptotic
Efficacy of DOX-TTPNs
[0130] Activation of DRs by TRAIL often leads to clathrin-dependent
endocytosis. In particular, it has been reported that trimeric or
multimeric TRAIL accelerates the rate of DR5-mediated
internalization of cargo via endocytosis by .about.2-fold over 2
hours. TTPNs, which mimic the naturally occurring TRAIL
homo-trimeric structure, are readily recognized by TRAIL receptors,
as evidenced by their up to 330-fold increased affinity for DR4 and
DR5 compared with monomeric TRAIL. The present inventors thus
hypothesized that DOX-TTPNs would provide efficient DR5-mediated
intracellular delivery of re-sensitizing drugs by virtue of the
native-like trimeric TRAIL structure on the nanocage surface,
thereby exerting a synergistic effect in re-sensitized
TRAIL-resistant cells.
[0131] To test this hypothesis, the present inventors first
investigated the intracellular delivery of DOX in DOX-TTPNs by
analyzing the time-course of DOX-TTPNs internalization within HT29
cells. HT29 cells were incubated with Cy5.5 surface-labeled
DOX-TTPNs and then analyzed by fluorescence microscopy. As shown in
FIG. 32, DOX-TTPNs bound to the membrane of HT29 cells, and then
were distributed to both cytoplasm and membranes. Specifically,
after binding of TTPNs to HT29 cells, DOX was localized to the cell
membrane at an early time point, and then was rapidly released and
localized in the cytoplasm and nuclei. These data indicate that
rapid binding of DOX-TTPNs to HT29 cells via DRs leads to
endocytosis of DOX-TTPNs followed by intracellular DOX release,
suggesting the potential of DOX-TTPNs to re-sensitize cells to
TRAIL-induced apoptosis.
[0132] To demonstrate that intracellular DOX released by DOX-TTPNs
re-sensitizes TRAIL-resistant cells, the present inventors
monitored cell growth in HT29 and MCF7 cells treated with
DOX-TTPNs; empty TTPNs, free DOX, and DOX-FTNs (DOX-loaded
wild-type ferritin) were used as controls. Cells in each group were
incubated for 24 hours, and cell viability was analyzed using a
cell counting kit (CCK)-8. Treatment with DOX-TTPNs induced a
robust apoptotic response and caused concentration-dependent cell
death in both HT29 and MCF7 cells (FIGS. 33A and 33B).
Notwithstanding their much lower potency compared with DOX-TTPNs,
free DOX and DOX-FTNs also induced cell death at a very high
concentration owing to their chemotherapeutic activity. Notably,
treatment with 250 nM DOX-TTPNs (DOX concentration, 3.5 .mu.g/ml)
caused 87% cell death in HT29 cells compared with controls, whereas
the same dose of free DOX and DOX-FTNs caused 36% and 39% cell
death relative to controls, respectively. Additionally, because
MCF7 cells express lower levels of death receptors, as noted above,
and are relatively more resistant to TRAIL than HT29 cells (Zhang
et al., Mol. Cancer Res. 6(12): 1861-1871, 2008), a higher
concentration of therapeutics (250 nM; p<0.001) was required to
induce a similar percentage (40%) of cell death relative to
controls compared with HT29 cells (48% of controls at 62.5 nM;
p<0.001).
[0133] An analysis of cell apoptosis using annexin V staining with
fluorescence-activated cell sorting (FACS) revealed synergy between
TTPN and DOX. Annexin V is an early apoptosis marker that detects
and binds externalized phosphatidylserine, an early event in the
apoptotic process, thereby providing a more sensitive indicator of
apoptosis than CCK analyses. HT29 cells were treated with low
concentrations of DOX-TTPNs, free DOX, and empty TTPNs under the
same conditions described above, and annexin V-positive cells were
analyzed. As shown in FIG. 33C, the early apoptotic cell profile
following treatment with DOX or empty TTPNs essentially mirrored
that of untreated cells, indicating that DOX or empty TTPN alone
were ineffective in inducing apoptosis. In contrast, treatment with
DOX-TTPNs induced early apoptosis at concentrations as low as 0.06
nM (DOX concentration, 8.4 pg/ml). These results indicate that
DOX-TTPNs efficiently deliver DOX intracellularly in tumor cells
via death receptors, and successfully re-sensitize resistant cells
to TRAIL-mediated apoptosis.
Example 8: Mechanism of DOX-TTPN-Induced Re-Sensitization of
TRAIL-Resistant Tumor Cells
[0134] To explore the mechanisms underlying the ability of
DOX-TTPNs to re-sensitize TRAIL-resistant tumors, the present
inventors analyzed expression levels of the TRAIL receptor and
several pro- and anti-apoptosis proteins. Previous studies have
reported that TRAIL-induced apoptosis is regulated at the TRAIL
receptor level, and at points within the extrinsic pathway via
activation of death-inducing signaling complex (DISC) and the
intrinsic (mitochondrial) pathway through activation of caspase-9
via the release of cytochrome c from mitochondria (Tummers et al.,
Immunol. Rev. 2017, 277(1): 76-89, 2017; Wang et al., Curr. Pharm.
Des. 2014, 20(42): 6714-6122, 2014). Therefore, as indicated above,
resistance to TRAIL is achieved through negative regulation of
death receptors and death agonists and up-regulation of death
antagonists [IAP (inhibitors of apoptosis) family proteins and
anti-apoptotic proteins] at extrinsic and intrinsic pathways (Wang
et al., Curr. Pharm. Des. 2014, 20(42): 6714-6122, 2014).
[0135] The present inventors selected and analyzed several
agonistic and antagonistic proteins for TRAIL-mediated apoptosis,
including poly (ADP-ribose) polymerase (PARP), caspase-8,
caspase-3, B-cell lymphoma-extra large (Bcl-xL), cellular FLICE
(FADD-like IL-1.beta.-converting enzyme)-inhibitory protein
(c-FLIP), and X-linked inhibitor of apoptosis protein (XIAP), and
the TRAIL receptor DR5, which is important in the regulation of
TRAIL resistance in HT29 cells (Zhang et al., Cancer Gene Ther. 12
(3): 228-237, 2005; Saraei et al., Biomed. Pharmacother. 107:
1010-1019, 2018; Geismann et al., Cell Death Dis. 5(10): e1455,
2014]. The levels of these proteins in HT29 cells after treatment
with DOX-TTPNs, empty TTPNs, or free DOX were determined by Western
blotting. As shown in FIG. 34A, treatment with empty TTPNs caused
little or no change in expression levels of this panel of
pro-agonistic and antagonistic proteins compared with controls,
consistent with cell viability and pro-apoptosis analyses. In the
case of treatment with free DOX, all pro-apoptotic proteins showed
an increase in expression and all anti-apoptotic proteins showed a
decrease in expression. However, the effects of free DOX on these
proteins were much smaller than those of DOX-TTPNs. In particular,
DOX-TTPNs induced a considerable increase in the cleaved form of
caspase-3, which directly induces apoptosis in both extrinsic and
intrinsic pathways, and PARP, a substrate of caspase-3. In
contrast, both free DOX and empty TTPNs caused little change in
caspase-3 or PARP expression. In the latter case, the increases in
PARP induced by DOX-2 TTPNs relative to buffer-treated controls
(defined as 1) were 4115-, 811- and 457-fold, respectively. The
cleaved form of caspase-8, which initiates apoptosis, was also
increased in the DOX-TTPN-treated group.
[0136] The anti-apoptotic proteins cFLIPL/S, Bcl-xL and XIAP, play
specific roles in antagonizing TRAIL-mediated apoptosis, inhibiting
cleavage of caspase-8, preventing cytochrome c release upon
translocation to the mitochondrial membrane, and suppressing
activation of caspase-3 to cleaved form, respectively (Zhang et
al., Cancer Gene Ther. 12 (3): 228-237, 2005; Saraei et al.,
Biomed. Pharmacother. 107: 1010-1019, 2018). Treatment of HT29
cells with DOX-TTPNs decreased expression of each of these
anti-apoptotic proteins compared with buffer-treated cells.
Importantly, treatment with DOX-TTPNs decreased the levels of
XIAP--the most potent caspase inhibitor, which acts by direct
binding and inhibiting both initiator and effector 12 caspases--by
a remarkable 67-fold compared with buffer treatment; by comparison,
treatment with free DOX caused a 34-fold decrease in XIAP levels
whereas empty TTPNs had no significant effect.
[0137] Given that combined treatment with DOX and TRAIL upregulated
the TRAIL receptor, DR5, the present inventors next investigated
time-dependent changes in DR5 levels using the above-described
analysis (Das et al., Apoptosis 22(10): 1205-1224, 2017). As shown
in FIG. 34B, free DOX induced a substantial increase in DR5
expression at 4 hours, although DR5 expression reverted to
control-like levels after 12 hours. DOX-TTPN treatment also
increased DR5 levels in HT29 cells, but this increase followed a
different time course. Specifically, DR5 levels in HT29 cells
treated with DOX-TTPNs were lower than those in the free-DOX group
at 4 hours, but the increase in DR5 expression levels was greater
after 12 hours and was sustained for at least 24 hours. In
contrast, empty TTPNs caused no significant change in DR5
expression levels. As indicated above, trimeric or multimeric TRAIL
increased the rate of DR5-mediated endocytosis by .about.2-fold
over 2 hours and the resulting activation of DRs by TRAIL caused a
substantial fraction of DR5 in the cell membrane to shift into the
cell. The difference in the kinetics of DR5-downregulation in
DOX-TTPN-treated cells compared with free-DOX-treated cells may
reflect endocytosis of DR5 with DOX-TTPNs at the early time point
(4 hours) (accounting for the relatively smaller increase in DR5
levels), followed by increased expression of DR5 after 12 hours
owing to the effects of intracellularly delivered DOX (FIG. 34C).
These results demonstrate that, by presenting TRAIL in its
native-like trimeric structure and efficiently promoting
DR5-mediated intracellular delivery of re-sensitizing drugs,
DOX-TTPNs exert a synergistic re-sensitizing effect on
TRAIL-resistant cells. Collectively, these results indicate that
the mechanisms by which DOX-TTPNs re-sensitize cells to
TRAIL-induced apoptosis include efficiently promoting DR5-mediated
intracellular delivery of DOX, increasing the levels of DR5 and
pro-apoptotic proteins, and decreasing the levels of anti-apoptotic
and IAP family proteins.
Example 9: In Vivo Antitumor Efficacy of DOX-TTPNs
[0138] Finally, the present inventors evaluated the apoptotic
activity and antitumor efficacy of DOX-TTPNs in a mouse xenograft
model. To this end, HT29 cells were implanted in mice, and after
tumor volumes reached approximately 80.about.100 mm.sup.3, mice
were intravenously injected with 30 mg/kg of DOX-TTPNs (equivalent
to a DOX dose of 0.4 mg/kg), 0.4 mg/kg of DOX, 15 mg/kg of DOX-FTNs
(equivalent to the number of moles of ferritin in a dose of TTPNs),
or 30 mg/kg of empty TTPNs (equivalent to the number of moles of
TRAIL in a dose of TTPNs) five times every 2 days, respectively. As
shown in FIGS. 35A and 35B, treatment with DOX-TTPNs successfully
suppressed tumor growth, decreasing tumor volumes by 61.5%, whereas
free DOX, empty TTPNs, and DOX-FTNs exerted no significant
tumor-inhibition effect.
[0139] To determine whether tumor growth suppression was induced by
re-sensitization to the apoptotic activity of DOX-TTPNs, the
present inventors extracted tumor tissue from the above-treated
mice at the end of the study and analyzed them for apoptotic cells
using TUNEL (terminal deoxynucleotidyl transferase dUTP nick-end
labeling) staining. As shown in FIGS. 35C and 35D, treatment with
DOX-TTPNs significantly increased the percentage of apoptotic tumor
cells in vivo compared with that in mice treated with empty TTPNs,
free DOX, or DOX-FTNs; the percentages of TUNEL-positive tumor
cells in mice treated with DOX-TTPNs, empty TTPNs, free DOX, or
DOX-FTNs were 50.6, 0.01, 0.07 and 0.57%, respectively.
[0140] Previous studies have demonstrated success in vitro, and in
some cases in vivo, using TRAIL-based combination therapy together
with DOX as TRAIL sensitizers (Refaat et al., Oncol. Lett. 7(5),
1327-1332, 2014; Oh et al., J. Control. Release 220(Pt B): 671-681,
2015; Guo et al., J. Control. Release 154(1): 93-102, 2011; Kim et
al., Biomater. 34(27): 6444-6453, 2013; Kelly et al., Cancer Biol.
Ther. 1(5): 520-533, 2002; Liu et al., Biomater. 33(19): 4907-4916,
2012; Han et al., Biomater. 32(4): 1242-1252, 2011; Hu et al.,
Oncotarget 7(38): 61832-61844, 2016; Jiang et al., Adv. Funct.
Mater. 24(16): 2295-2304, 2014; Jiang et al., Adv. Mater. 27 (6):
1021-1028, 2015; Hu et al., Adv. Mater. 27 (44): 7043-7050, 2015).
However, efficient in vivo antitumor efficacy has required
relatively high doses of sensitizer (1.5.about.7 mg/kg, intravenous
administration) that are not clinically practical (Wennerberg et
al., Int. J. Cancer 133(7): 1643-1652, 2013). Furthermore, the high
concentrations of DOX produce serious cardiac toxicity, which may
become even more severe in combination therapy with TRAIL; at doses
greater than 1 mg/kg, DOX can exhibit side effects in mice
(Chatterjee et al., Cardiol. 115(2): 155-159, 2010). Importantly,
the dose of DOX used with TTPNs in this study was 0.4 mg/kg, which
is much lower than that in previous studies and is below the
cut-off value that causes no side effects. Notably, even at these
exceedingly low doses, DOX was capable of re-sensitizing tumor
cells to apoptotic activity in a TRAIL-resistant tumor model. The
present inventors confirmed that DOX-TTPNs, with their improved
stability, apoptotic activity and efficient intracellular delivery,
successfully activate TRAIL-mediated apoptosis pathways and inhibit
tumor growth in a TRAIL-resistant in vivo model at a minimal dose
of the sensitizer, DOX.
[0141] The present invention has been described with reference to
the above-described examples, but these are merely exemplary, and
those of ordinary skill in the art will understand that various
modifications and equivalent other embodiments are possible
therefrom. Therefore, the true scope of the present invention
should be determined by the technical spirit of the
Sequence CWU 1
1
301529DNAArtificial SequenceTRAIL 95-281 1atgacctctg aggaaaccat
ttctacagtt caagaaaagc aacaaaatat ttctccccta 60gtgagagaaa gaggtcctca
gagagtagca gctcacataa ctgggaccag aggaagaagc 120aacacattgt
cttctccaaa ctccaagaat gaaaaggctc tgggccgcaa aataaactcc
180tgggaatcat caaggagtgg gcattcattc ctgagcaact tgcacttgag
gaatggtgaa 240ctggtcatcc atgaaaaagg gttttactac atctattccc
aaacatactt tcgatttcag 300gaggaaataa aagaaaacac aaagaacgac
aaacaaatgg tccaatatat ttacaaatac 360acaagttatc ctgaccctat
attgttgatg aaaagtgcta gaaatagttg ttggtctaaa 420gatgcagaat
atggactcta ttccatctat caagggggaa tatttgagct taaggaaaat
480gacagaattt ttgtttctgt aacaaatgag cacttgatag acatggacc
5292188PRTArtificial SequenceTRAIL 95-281 2Met Thr Ser Glu Glu Thr
Ile Ser Thr Val Gln Glu Lys Gln Gln Asn1 5 10 15Ile Ser Pro Leu Val
Arg Glu Arg Gly Pro Gln Arg Val Ala Ala His 20 25 30Ile Thr Gly Thr
Arg Gly Arg Ser Asn Thr Leu Ser Ser Pro Asn Ser 35 40 45Lys Asn Glu
Lys Ala Leu Gly Arg Lys Ile Asn Ser Trp Glu Ser Ser 50 55 60Arg Ser
Gly His Ser Phe Leu Ser Asn Leu His Leu Arg Asn Gly Glu65 70 75
80Leu Val Ile His Glu Lys Gly Phe Tyr Tyr Ile Tyr Ser Gln Thr Tyr
85 90 95Phe Arg Phe Gln Glu Glu Ile Lys Glu Asn Thr Lys Asn Asp Lys
Gln 100 105 110Met Val Gln Tyr Ile Tyr Lys Tyr Thr Ser Tyr Pro Asp
Pro Ile Leu 115 120 125Leu Met Lys Ser Ala Arg Asn Ser Cys Trp Ser
Lys Asp Ala Glu Tyr 130 135 140Gly Leu Tyr Ser Ile Tyr Gln Gly Gly
Ile Phe Glu Leu Lys Glu Asn145 150 155 160Asp Arg Ile Phe Val Ser
Val Thr Asn Glu His Leu Ile Asp Met Asp 165 170 175His Glu Ala Ser
Phe Phe Gly Ala Phe Leu Val Gly 180 1853567DNAArtificial
Sequencelinker peptide 3atgacctctg aggaaaccat ttctacagtt caagaaaagc
aacaaaatat ttctccccta 60gtgagagaaa gaggtcctca gagagtagca gctcacataa
ctgggaccag aggaagaagc 120aacacattgt cttctccaaa ctccaagaat
gaaaaggctc tgggccgcaa aataaactcc 180tgggaatcat caaggagtgg
gcattcattc ctgagcaact tgcacttgag gaatggtgaa 240ctggtcatcc
atgaaaaagg gttttactac atctattccc aaacatactt tcgatttcag
300gaggaaataa aagaaaacac aaagaacgac aaacaaatgg tccaatatat
ttacaaatac 360acaagttatc ctgaccctat attgttgatg aaaagtgcta
gaaatagttg ttggtctaaa 420gatgcagaat atggactcta ttccatctat
caagggggaa tatttgagct taaggaaaat 480gacagaattt ttgtttctgt
aacaaatgag cacttgatag acatggacca tgaagccagt 540ttttttgggg
cctttttagt tggctaa 567446PRTArtificial Sequencelinker peptide 4Ala
Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys1 5 10
15Glu Ala Ala Ala Lys Ala Leu Glu Ala Glu Ala Ala Ala Lys Glu Ala
20 25 30Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Ala 35
40 455552DNAArtificial SequenceFerritin 5atgacgaccg cgtccacctc
gcaggtgcgc cagaactacc accaggactc agaggccgcc 60atcaaccgcc agatcaacct
ggagctctac gcctcctacg tttacctgtc catgtcttac 120tactttgacc
gcgatgatgt ggctttgaag aactttgcca aatactttct tcaccaatct
180catgaggaga gggaacatgc tgagaaactg atgaagctgc agaaccaacg
aggtggccga 240atcttccttc aggatatcaa gaaaccagac tgtgatgact
gggagagcgg gctgaatgca 300atggagtgtg cattacattt ggaaaaaaat
gtgaatcagt cactactgga actgcacaaa 360ctggccactg acaaaaatga
cccccatttg tgtgacttca ttgagacaca ttacctgaat 420gagcaggtga
aagccatcaa agaattgggt gaccacgtga ccaacttgcg caagatggga
480gcgcccgaat ctggcttggc ggaatatctc tttgacaagc acaccctggg
agacagtgat 540aatgaaagct aa 5526183PRTArtificial SequenceFerritin
6Met Thr Thr Ala Ser Thr Ser Gln Val Arg Gln Asn Tyr His Gln Asp1 5
10 15Ser Glu Ala Ala Ile Asn Arg Gln Ile Asn Leu Glu Leu Tyr Ala
Ser 20 25 30Tyr Val Tyr Leu Ser Met Ser Tyr Tyr Phe Asp Arg Asp Asp
Val Ala 35 40 45Leu Lys Asn Phe Ala Lys Tyr Phe Leu His Gln Ser His
Glu Glu Arg 50 55 60Glu His Ala Glu Lys Leu Met Lys Leu Gln Asn Gln
Arg Gly Gly Arg65 70 75 80Ile Phe Leu Gln Asp Ile Lys Lys Pro Asp
Cys Asp Asp Trp Glu Ser 85 90 95Gly Leu Asn Ala Met Glu Cys Ala Leu
His Leu Glu Lys Asn Val Asn 100 105 110Gln Ser Leu Leu Glu Leu His
Lys Leu Ala Thr Asp Lys Asn Asp Pro 115 120 125His Leu Cys Asp Phe
Ile Glu Thr His Tyr Leu Asn Glu Gln Val Lys 130 135 140Ala Ile Lys
Glu Leu Gly Asp His Val Thr Asn Leu Arg Lys Met Gly145 150 155
160Ala Pro Glu Ser Gly Leu Ala Glu Tyr Leu Phe Asp Lys His Thr Leu
165 170 175Gly Asp Ser Asp Asn Glu Ser 180730DNAArtificial
SequencewtFN F 7catatgcatc accatcacca tcacacgacc 30824DNAArtificial
SequencewtFN R 8aagcttttag ctttcattat cact 24924DNAArtificial
SequencemTRAIL F 9catatgacct ctgaggaaac catt 241027DNAArtificial
SequencemTRAIL R 10ggatccttag ccaactaaaa aggcccc
271124DNAArtificial SequenceTTPN 1 11catatgacct ctgaggaaac catt
241227DNAArtificial SequenceTTPN 2 12ctcgagacga ccgcgtccac ctcgcag
271327DNAArtificial SequenceTTPN 3 13ggatccgcca actaaaaagg ccccaaa
271424DNAArtificial SequenceTTPN 4 14aagcttttag ctttcattat cact
24156PRTArtificial Sequencelinker peptide 15Gly Ser Ser Gly Gly
Ser1 51618PRTArtificial Sequencelinker peptide 16Lys Glu Ser Gly
Ser Val Ser Ser Glu Gln Leu Ala Gln Phe Arg Ser1 5 10 15Leu
Asp1714PRTArtificial Sequencelinker peptide 17Glu Gly Lys Ser Ser
Gly Ser Gly Ser Glu Ser Lys Ser Thr1 5 101812PRTArtificial
Sequencelinker peptide 18Gly Ser Ala Gly Ser Ala Ala Gly Ser Gly
Glu Phe1 5 10195PRTArtificial Sequencelinker peptide 19Glu Ala Ala
Ala Lys1 52012PRTArtificial Sequencelinker peptide 20Cys Arg Arg
Arg Arg Arg Arg Glu Ala Glu Ala Cys1 5 10218PRTArtificial
Sequencelinker peptide 21Gly Gly Gly Gly Gly Gly Gly Gly1
5226PRTArtificial Sequencelinker peptide 22Gly Gly Gly Gly Gly Gly1
52313PRTArtificial Sequencelinker peptide 23Ala Glu Ala Ala Ala Lys
Glu Ala Ala Ala Ala Lys Ala1 5 10245PRTArtificial Sequencelinker
peptide 24Pro Ala Pro Ala Pro1 52517PRTArtificial Sequencelinker
peptide 25Val Ser Gln Thr Ser Lys Leu Thr Arg Ala Glu Thr Val Phe
Pro Asp1 5 10 15Val266PRTArtificial Sequencelinker peptide 26Pro
Leu Gly Leu Trp Ala1 52710PRTArtificial Sequencelinker peptide
27Thr Arg His Arg Gln Pro Arg Gly Trp Glu1 5 102810PRTArtificial
Sequencelinker peptide 28Ala Gly Asn Arg Val Arg Arg Ser Val Gly1 5
10298PRTArtificial Sequencelinker peptide 29Arg Arg Arg Arg Arg Arg
Arg Arg1 53031PRTArtificial Sequencelinker peptide 30Gly Ser Ser
Gly Gly Ser Gly Ser Ser Gly Gly Ser Gly Gly Gly Asp1 5 10 15Glu Ala
Asp Gly Ser Arg Gly Ser Gln Lys Ala Gly Val Asp Glu 20 25 30
* * * * *