U.S. patent application number 17/021555 was filed with the patent office on 2021-01-28 for nuclease-mediated regulation of gene expression.
The applicant listed for this patent is Sangamo Therapeutics, Inc.. Invention is credited to Andreas Reik.
Application Number | 20210024606 17/021555 |
Document ID | / |
Family ID | 1000005146909 |
Filed Date | 2021-01-28 |
![](/patent/app/20210024606/US20210024606A1-20210128-D00001.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00002.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00003.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00004.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00005.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00006.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00007.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00008.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00009.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00010.png)
![](/patent/app/20210024606/US20210024606A1-20210128-D00011.png)
View All Diagrams
United States Patent
Application |
20210024606 |
Kind Code |
A1 |
Reik; Andreas |
January 28, 2021 |
NUCLEASE-MEDIATED REGULATION OF GENE EXPRESSION
Abstract
The present disclosure is in the field of genome engineering,
particularly targeted modification of the genome of a hematopoietic
cell.
Inventors: |
Reik; Andreas; (Brisbane,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Sangamo Therapeutics, Inc. |
Brisbane |
CA |
US |
|
|
Family ID: |
1000005146909 |
Appl. No.: |
17/021555 |
Filed: |
September 15, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15565811 |
Oct 11, 2017 |
10808020 |
|
|
PCT/US2016/032049 |
May 12, 2016 |
|
|
|
17021555 |
|
|
|
|
62303595 |
Mar 4, 2016 |
|
|
|
62160396 |
May 12, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2510/00 20130101;
C12N 5/0647 20130101; C07K 14/46 20130101; C12N 2501/20 20130101;
C07K 14/705 20130101; C12N 9/22 20130101; A61K 38/00 20130101 |
International
Class: |
C07K 14/705 20060101
C07K014/705; C07K 14/46 20060101 C07K014/46; C12N 5/0789 20060101
C12N005/0789; C12N 9/22 20060101 C12N009/22 |
Claims
1. A pharmaceutical composition comprising genetically modified
cells, the genetically modified cells comprising cells comprising
at least one zinc finger nuclease, the zinc finger nuclease
comprising a zinc finger protein comprising 4, 5 or 6 fingers
designated F1 to F4, F1 to F5 or F1 to F6, each finger comprising a
recognition helix region that recognizes a target subsite wherein
the protein is selected from the group consisting of (i) a protein
comprising the recognition helix regions as follows: TABLE-US-00022
F1: (SEQ ID NO: 7) STGNLTN; F2: (SEQ ID NO: 5) TSGSLTR; F3: (SEQ ID
NO: 2) DQSNLRA; and F4: (SEQ ID NO: 6) AQCCLFH;
(ii) a protein comprising the recognition helix regions as follows:
TABLE-US-00023 F1: (SEQ ID NO: 2) DQSNLRA; F2: (SEQ ID NO: 3)
RPYTLRL; F3: (SEQ ID NO: 8) SRGALKT; F4: (SEQ ID NO: 5) TSGSLTR;
F5: (SEQ ID NO: 2) DQSNLRA; and F6: (SEQ ID NO: 6) AQCCLFH;
(iii) a protein comprising the recognition helix regions as
follows: TABLE-US-00024 F1: (SEQ ID NO: 2) DQSNLRA; F2: (SEQ ID NO:
9) RNFSLTM; F3: (SEQ ID NO: 10) SNGNLRN or (SEQ ID NO: 11) SSYNLAN;
F4: (SEQ ID NO: 5) TSGSLTR; F5: (SEQ ID NO: 2) DQSNLRA; and F6:
(SEQ ID NO: 6) AQCCLFH;
(iv) a protein comprising the recognition helix regions as follows:
TABLE-US-00025 F1: (SEQ ID NO: 13) RSDHLTQ; F2: (SEQ ID NO: 14)
QSGHLAR; F3: (SEQ ID NO: 15) QKGTLGE; F4: (SEQ ID NO: 16) RHRDLSR;
and F5: (SEQ ID NO: 17) RRDNLHS;
(v) a protein comprising the recognition helix regions as follows:
TABLE-US-00026 F1: (SEQ ID NO: 19) RNDHRTT; F2: (SEQ ID NO: 20)
QKAHLIR; F3: (SEQ ID NO: 15) QKGTLGE; F4: (SEQ ID NO: 25) LKRTLKR;
and F5: (SEQ ID NO: 17) RRDNLHS;
(vi) a protein comprising the recognition helix regions as follows:
TABLE-US-00027 F1: (SEQ ID NO: 13) RSDHLTQ; F2: (SEQ ID NO: 22)
QRAHLTR; F3: (SEQ ID NO: 15) QKGTLGE or (SEQ ID NO: 24) QSGTRNH;
F4: (SEQ ID NO: 23) HRNTLVR; and F5: (SEQ ID NO: 17) RRDNLHS;
(vii) a protein comprising the recognition helix regions as
follows: TABLE-US-00028 F1: (SEQ ID NO: 13) RSDHLTQ; F2: (SEQ ID
NO: 20) QKAHLIR; F3: (SEQ ID NO: 15) QKGTLGE or (SEQ ID NO: 24)
QSGTRNH; F4: (SEQ ID NO: 21) RGRDLSR; and F5: (SEQ ID NO: 17)
RRDNLHS;
(viii) a protein comprising the recognition helix regions as
follows: TABLE-US-00029 F1: (SEQ ID NO: 13) RSDHLTQ; F2: (SEQ ID
NO: 14) QSGHLAR; F3: (SEQ ID NO: 24) QSGTRNH; F4: (SEQ ID NO: 16)
QSSDLSR; and F5: (SEQ ID NO: 17) RRDNLHS.
2. The pharmaceutical composition of claim 1, wherein the cells
comprise one or more polynucleotides encoding the zinc finger
nuclease.
3. The pharmaceutical composition of claim 1, wherein the
genetically modified cells are hematopoietic stem cells or
erythroid precursor cells.
4. The pharmaceutical composition of claim 3, wherein the cells are
human cells.
5. The pharmaceutical composition of claim 1, wherein the genetic
modification is selected from the group consisting of insertions,
deletions and combinations thereof.
6. The pharmaceutical composition of claim 1, wherein the genetic
modification is within the +58 region of the BCL11A enhancer
sequence.
7. The pharmaceutical composition of claim 1, further comprising
genetically modified progeny cells produced from the genetically
modified cells.
8. The pharmaceutical composition of claim 7, wherein the
genetically modified progeny cells comprise red blood cell (RBC)
precursor cells or RBCs.
9. The pharmaceutical composition of claim 7, wherein the
genetically modified cells exhibit increased expression of gamma
and/or beta globin as compared to cells without the genomic
modification.
10. The pharmaceutical composition of claim 1, wherein the zinc
finger nuclease comprises a pair of zinc finger nucleases.
11. The pharmaceutical composition of claim 1, wherein the pair of
zinc finger nucleases comprise left and right zinc finger
nucleases.
12. The pharmaceutical composition of claim 11, wherein the left
zinc finger nuclease comprises the zinc finger protein of (i), (ii)
or (iii) and the right zinc finger nuclease comprises the zinc
finger protein of (iv), (v), (vi), (vii) or (viii).
13. The pharmaceutical composition of claim 1, wherein the genetic
modification comprises an insertion.
14. The pharmaceutical composition of claim 13, wherein an
exogenous sequence is inserted into the genome of the cells.
15. The pharmaceutical composition of claim 1, wherein the genetic
modification comprises a deletion.
16. A method of increasing globin production in a subject, the
method comprising: administering the pharmaceutical composition of
claim 7 to the subject.
17. The method of claim 16, wherein the subject is a human.
18. The method of claim 17, wherein the pharmaceutical composition
is administered to bone marrow of the subject and wherein the cell
engrafts, differentiates and matures in the subject.
19. The method of claim 16, wherein the subject has a
hemoglobinopathy.
20. The method of claim 19, wherein the hemoglobinopathy is a
beta-thalassemia or sickle cell disease.
21. A kit comprising the pharmaceutical composition of claim 7.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 15/565,811, filed Oct. 11, 2017, which is a 35 U.S.C. .sctn.
371 filing of PCT/US2016/032049, filed May 12, 2016, which claims
the benefit of U.S. Provisional Application No. 62/160,396, filed
May 12, 2015 and U.S. Provisional Application No. 62/303,595, filed
Mar. 4, 2016, the disclosures of which are hereby incorporated by
reference in their entireties.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Sep. 15, 2020, is named 8328013201_SL.txt and is 9,688 bytes in
size.
TECHNICAL FIELD
[0003] The present disclosure is in the field of genome
engineering, particularly targeted modification of the genome of a
hematopoietic cell.
BACKGROUND
[0004] When one considers that genome sequencing efforts have
revealed that the human genome contains between 20,000 and 25,000
genes, but fewer than 2000 transcriptional regulators, it becomes
clear that a number of factors must interact to control gene
expression in all its various temporal, developmental and tissue
specific manifestations. Expression of genes is controlled by a
highly complex mixture of general and specific transcriptional
regulators and expression can also be controlled by cis-acting DNA
elements. These DNA elements comprise both local DNA elements such
as the core promoter and its associated transcription factor
binding sites as well as distal elements such as enhancers,
silencers, insulators and locus control regions (LCRs) (see Matson
et al. (2006) Ann Rev Genome Hum Genet 7:29-59).
[0005] Enhancer elements were first identified in the SV40 viral
genome, and then found in the human immunoglobulin heavy chain
locus. Now known to play regulatory roles in the expression of many
genes, enhancers appear to mainly influence temporal and spatial
patterns of gene expression. It has also been found that enhancers
function in a manner that is not dependent upon distance from the
core promoter of a gene, and is not dependent on any specific
sequence orientation with respect to the promoter. Enhancers can be
located several hundred kilobases upstream or downstream of a core
promoter region, where they can be located in an intron sequence,
or even beyond the 3' end of a gene.
[0006] Various methods and compositions for targeted cleavage of
genomic DNA have been described. Such targeted cleavage events can
be used, for example, to induce targeted mutagenesis, induce
targeted deletions of cellular DNA sequences, and facilitate
targeted recombination at a predetermined chromosomal locus. See,
e.g., U.S. Pat. Nos. 9,255,250; 9,200,266; 9,045,763; 9,005,973;
9,150,847; 8,956,828; 8,945,868; 8,703,489; 8,586,526; 6,534,261;
6,599,692; 6,503,717; 6,689,558; 7,067,317; 7,262,054; 7,888,121;
7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861; U.S. Patent
Publication Nos. 2003/0232410; 2005/0208489; 2005/0026157;
2005/0064474; 2006/0063231; 2008/0159996; 2010/00218264;
2012/0017290; 2011/0265198; 2013/0137104; 2013/0122591;
2013/0177983; 2013/0196373; 2015/0056705 and 2015/0335708, the
disclosures of which are incorporated by reference in their
entireties.
[0007] These methods often involve the use of engineered cleavage
systems to induce a double strand break (DSB) or a nick in a target
DNA sequence such that repair of the break by an error born process
such as non-homologous end joining (NHEJ) or repair using a repair
template (homology directed repair or HDR) can result in the knock
out of a gene or the insertion of a sequence of interest (targeted
integration). This technique can also be used to introduce site
specific changes in the genome sequence through use of a donor
oligonucleotide, including the introduction of specific deletions
of genomic regions, or of specific point mutations or localized
alterations (also known as gene correction). Cleavage can occur
through the use of specific nucleases such as engineered zinc
finger nucleases (ZFN), transcription-activator like effector
nucleases (TALENs), or using the CRISPR/Cas system with an
engineered crRNA/tracr RNA (`single guide RNA`) to guide specific
cleavage. Further, targeted nucleases are being developed based on
the Argonaute system (e.g., from T. thermophilus, known as `TtAgo`,
see Swarts et al. (2014) Nature 507(7491): 258-261), which also may
have the potential for uses in genome editing and gene therapy.
[0008] Red blood cells (RBCs), or erythrocytes, are the major
cellular component of blood. In fact, RBCs account for one quarter
of the cells in a human. Mature RBCs lack a nucleus and many other
organelles in humans, and are full of hemoglobin, a metalloprotein
that functions to carry oxygen to the tissues as well as carry
carbon dioxide out of the tissues and back to the lungs for
removal. This protein makes up approximately 97% of the dry weight
of RBCs and it increases the oxygen carrying ability of blood by
about seventy fold. Hemoglobin is a heterotetramer comprising two
alpha (.alpha.)-like globin chains and two beta (.beta.)-like
globin chains and 4 heme groups. In adults the .alpha.2.beta.2
tetramer is referred to as Hemoglobin A (HbA) or adult hemoglobin.
Typically, the alpha and beta globin chains are synthesized in an
approximate 1:1 ratio and this ratio seems to be critical in terms
of hemoglobin and RBC stabilization. In a developing fetus, a
different form of hemoglobin, fetal hemoglobin (HbF), is produced
which has a higher binding affinity for oxygen than Hemoglobin A
such that oxygen can be delivered to the baby's system via the
mother's blood stream. There are two genes that encode fetal globin
that are very similar in sequence and are termed HPG1 (also
referred to as Ggamma) and HPG2 (Agamma). Fetal hemoglobin protein
also contains two .alpha. globin chains, but in place of the adult
.beta.-globin chains, it has two fetal gamma (.gamma.)-globin
chains (i.e., fetal hemoglobin is .alpha.2.gamma.2). At
approximately 30 weeks of gestation, the synthesis of gamma globin
in the fetus starts to drop while the production of beta globin
increases. By approximately 10 months of age, the newborn's
hemoglobin is nearly all .alpha.2.beta.2 although some HbF persists
into adulthood (approximately 1-3% of total hemoglobin). The
regulation of the switch from production of gamma- to beta-globin
is quite complex, and primarily involves a down-regulation of gamma
globin transcription with a simultaneous up-regulation of beta
globin transcription.
[0009] Genetic defects in the sequences encoding the hemoglobin
chains can be responsible for a number of diseases known as
hemoglobinopathies, including sickle cell anemia and thalassemias.
In the majority of patients with hemoglobinopathies, the genes
encoding gamma globin remain present, but expression is relatively
low due to normal gene repression occurring around parturition as
described above.
[0010] It is estimated that 1 in 5000 people in the U.S. have
sickle cell disease (SCD), mostly in people of sub-Saharan Africa
descent. There appears to be a benefit for heterozygous carriers of
the sickle cell mutation for protection against malaria, so this
trait may have been positively selected over time, such that it is
estimated that in sub-Saharan Africa, one third of the population
has the sickle cell trait. Sickle cell disease is caused by a
mutation in the 0 globin gene as a consequence of which valine is
substituted for glutamic acid at amino acid #6 (a GAG to GTG at the
DNA level), where the resultant hemoglobin is referred to as
"hemoglobinS" or "HbS." Under lower oxygen conditions, a
conformational shift in the deoxy form of HbS exposes a hydrophobic
patch on the protein between the E and F helices. The hydrophobic
residues of the valine at position 6 of the beta chain in
hemoglobin are able to associate with the hydrophobic patch,
causing HbS molecules to aggregate and form fibrous precipitates.
These aggregates in turn cause the abnormality or `sickling` of the
RBCs, resulting in a loss of flexibility of the cells. The sickling
RBCs are no longer able to squeeze into the capillary beds and can
result in vaso-occlusive crisis in sickle cell patients. In
addition, sickled RBCs are more fragile than normal RBCs, and tend
towards hemolysis, eventually leading to anemia in the patient.
[0011] Treatment and management of sickle cell patients is a
life-long proposition involving antibiotic treatment, pain
management and transfusions during acute episodes. One approach is
the use of hydroxyurea, which exerts its effects in part by
increasing the production of gamma globin. Long term side effects
of chronic hydroxyurea therapy are still unknown, however, and
treatment gives unwanted side effects and can have variable
efficacy from patient to patient. Despite an increase in the
efficacy of sickle cell treatments, the life expectancy of patients
is still only in the mid to late 50's and the associated
morbidities of the disease have a profound impact on a patient's
quality of life.
[0012] Thalassemias are also diseases relating to hemoglobin and
typically involve a reduced expression of globin chains. This can
occur through mutations in the regulatory regions of the genes or
from a mutation in a globin coding sequence that results in reduced
expression or reduced levels or functional globin protein. Alpha
thalassemias are mainly associated with people of Western Africa
and South Asian descent, and may confer malarial resistance. Beta
thalassemia is mainly associated with people of Mediterranean
descent, typically from Greece and the coastal areas of Turkey and
Italy. In thalassemia minor, only one of the .beta. globin alleles
bears a mutation. Individuals will suffer from microcytic anemia,
and detection usually involves lower than normal mean corpuscular
volume (<80 fL). The alleles of subjects with thalassemia minor
are .beta.+/.beta. or .beta.0/.beta. (where `.beta.+` refers to
alleles that allow some amount of .beta. chain formation to occur,
`.beta.` refers to wild type .beta. globin alleles, and `.beta.0`
refers to .beta. globin mutations comprising some form of
deletion). Thalassemia intermedia subject can often manage a normal
life but may need occasional transfusions, especially at times of
illness or pregnancy, depending on the severity of their anemia.
These patients alleles can be .beta.+/.beta.+ or .beta.o/.beta.+.
Thalassemia major occurs when both alleles have thalassemia
mutations. This is severely microcytic and hypochromic anemia.
Untreated, it causes anemia, splenomegaly and severe bone
deformities. It progresses to death before age 20. Treatment
consists of periodic blood transfusion; splenectomy for
splenomegaly and chelation of transfusion-caused iron overload.
Bone marrow transplants are also being used for treatment of people
with severe thalassemias if an appropriate donor can be identified,
but this procedure can have significant risks.
[0013] One approach that has been proposed for the treatment of
both SCD and beta thalassemias is to increase the expression of
gamma globin with the aim to have HbF functionally replace the
aberrant adult hemoglobin. As mentioned above, treatment of SCD
patients with hydroxyurea is thought to be successful in part due
to its effect on increasing gamma globin expression. The first
group of compounds discovered to affect gamma globin reactivation
activity were cytotoxic drugs. The ability to cause de novo
synthesis of gamma-globin by pharmacological manipulation was first
shown using 5-azacytidine in experimental animals (DeSimone (1982)
Proc Nat'l Acad Sci USA 79(14):4428-31). Subsequent studies
confirmed the ability of 5-azacytidine to increase HbF in patients
with .beta.-thalassemia and sickle cell disease (Ley et al. (1982)
N. Engl. J. Medicine 307:1469-1475 and Ley et al. (1983) Blood
62:370-380). In addition, short chain fatty acids (e.g. butyrate
and derivatives) have been shown in experimental systems to
increase HbF (Constantoulakis et al. (1988) Blood 72(6):1961-1967).
Also, there is a segment of the human population with a condition
known as `Hereditary Persistence of Fetal Hemoglobin` (HPFH) where
elevated amounts of HbF persist in adulthood (10-40% in HPFH
heterozygotes (see Thein et al. (2009) Hum. Mol. Genet
18(R2):R216-R223). This is a rare condition, but in the absence of
any associated beta globin abnormalities, is not associated with
any significant clinical manifestations, even when 100% of the
individual's hemoglobin is HbF. When individuals that have a beta
thalassemia also have co-incident HPFH, the expression of HbF can
lessen the severity of the disease. Further, the severity of the
natural course of sickle cell disease can vary significantly from
patient to patient, and this variability, in part, can be traced to
the fact that some individuals with milder disease express higher
levels of HbF.
[0014] One approach to increase the expression of HbF involves
identification of genes whose products play a role in the
regulation of gamma globin expression. One such gene is BCL11A,
first identified because of its role in lymphocyte development.
BCL11A encodes a zinc finger protein that is thought to be involved
in the developmental stage-specific regulation of gamma globin
expression. BCL11A is expressed in adult erythroid precursor cells
and down-regulation of its expression leads to an increase in gamma
globin expression. In addition, it appears that the splicing of the
BCL11A mRNA is developmentally regulated. In embryonic cells, it
appears that the shorter BCL11A mRNA variants, known as BCL11A-S
and BCL11A-XS are primary expressed, while in adult cells, the
longer BCL11A-L and BCL11A-XL mRNA variants are predominantly
expressed. See, Sankaran et al. (2008) Science 322:1839. The BCL11A
protein appears to interact with the beta globin locus to alter its
conformation and thus its expression at different developmental
stages. Use of an inhibitory RNA targeted to the BCL11A gene has
been proposed (see, e.g., U.S. Patent Publication No. 2011/0182867)
but this technology has several potential drawbacks, namely that
complete knock down may not be achieved, delivery of such RNAs may
be problematic and the RNAs must be present continuously, requiring
multiple treatments for life.
[0015] Targeting of BCL11A enhancer sequences provides a mechanism
for increasing HbF. See, e.g., U.S. Patent Publication No.
2015/0132269. Genome wide association studies have identified a set
of genetic variations at BCL11A that are associated with increased
HbF levels. These variations are a collection of SNPs found in
non-coding regions of BCL11A that function as a stage-specific,
lineage-restricted enhancer region. Further investigation revealed
that this BCL11A enhancer is required in erythroid cells for BCL11A
expression, but is not required for its expression in B cells (see
Bauer et al. (2013) Science 342:253-257). The enhancer region was
found within intron 2 of the BCL11A gene, and three areas of
DNAsecI hypersensitivity (often indicative of a chromatin state
that is associated with regulatory potential) in intron 2 were
identified. These three areas were identified as "+62", "+58" and
"+55" in accordance with the distance in kilobases from the
transcription start site of BCL11A. These enhancer regions are
roughly 350 (+55); 550 (+58); and 350 (+62) nucleotides in length
(Bauer 2013, ibid).
[0016] Thus, there remains a need for additional methods and
compositions that for the alteration of BCL11A gene expression for
example to treat hemoglobinopathies such as sickle cell disease and
beta thalassemia.
SUMMARY
[0017] The present invention describes compositions and methods for
use in gene therapy and genome engineering. Specifically, the
methods and compositions described relate to inactivating (e.g., by
completely or partially abolishing its expression) a BCL11A gene,
for example a gene that acts as regulator of one or more additional
genes. In particular, the invention describes methods and
compositions for interfering with enhancer function in a BCL11A
gene to diminish or knock out its activity in specific cell
lineages. Additionally, the invention provides methods and
compositions for interfering with BCL11A enhancer functions wherein
the enhancer sequences are not located within the BCL11A gene. The
resulting down-regulation of the BCL11A gene in these circumstances
in turn results in increased expression of gamma globin.
[0018] In some aspects, the invention comprises a non-naturally
occurring zinc finger protein comprising a zinc finger protein
(ZFP) comprising 4, 5 or 6 fingers, each finger comprising a
recognition helix region that recognizes a target subsite wherein
the recognition helix regions comprise the sequences in the order
shown in a single row of Table 1. In certain embodiments, the ZFP
comprises the recognition helixes as shown in Table 1 for the
proteins designated as follows: 51446, 51463, 51484, 51856, 51857
or 51862 (which bind to the target site shown in SEQ ID NO:1) and
51536, 51949, 51990, 51993, 51979, 51982, 52015, 52032 (which bind
to the target site shown in SEQ ID NO:12). Thus, in certain
embodiments, provided herein is a zinc finger protein including the
following recognition helix regions:
TABLE-US-00001 (i) F1: (SEQ ID NO: 7) STGNLTN; F2: (SEQ ID NO: 5)
TSGSLTR; F3: (SEQ ID NO: 2) DQSNLRA; and F4: (SEQ ID NO: 6)
AQCCLFH; or (ii) F1: (SEQ ID NO: 2) DQSNLRA; F2: (SEQ ID NO: 3)
RPYTLRL; F3: (SEQ ID NO: 8) SRGALKT; F4: (SEQ ID NO: 5) TSGSLTR;
F5: (SEQ ID NO: 2) DQSNLRA; and F6: (SEQ ID NO: 6) AQCCLFH; (iii)
F1: (SEQ ID NO: 2) DQSNLRA; F2: (SEQ ID NO: 9) RNFSLTM; F3: (SEQ ID
NO: 10) SNGNLRN or (SEQ ID NO: 7) STGNLTN or (SEQ ID NO: 11)
SSYNLAN; F4: (SEQ ID NO: 5) TSGSLTR; F5: (SEQ ID NO: 2) DQSNLRA;
and F6: (SEQ ID NO: 6) AQCCLFH; or (iv) F1: (SEQ ID NO: 13)
RSDHLTQ; F2: (SEQ ID NO: 14) QSGHLAR; F3: (SEQ ID NO: 15) QKGTLGE;
F4: (SEQ ID NO: 18) RHRDLSR; and F5: (SEQ ID NO: 17) RRDNLHS; or
(v) F1: (SEQ ID NO: 19) RNDHRTT; F2: (SEQ ID NO: 20) QKAHLIR; F3:
(SEQ ID NO: 15) QKGTLGE; F4: (SEQ ID NO: 21) RGRDLSR or (SEQ ID NO:
25) LKRTLKR; and F5: (SEQ ID NO: 17) RRDNLHS; or (vi) F1: (SEQ ID
NO: 13) RSDHLTQ; F2: (SEQ ID NO: 22) QRAHLTR; F3: (SEQ ID NO: 15)
QKGTLGE or (SEQ ID NO: 24) QSGTRNH; F4: (SEQ ID NO: 23) HRNTLVR;
and F5: (SEQ ID NO: 17) RRDNLHS; or (vii) F1: (SEQ ID NO: 13)
RSDHLTQ; F2: (SEQ ID NO: 20) QKAHLIR; F3: (SEQ ID NO: 15) QKGTLGE
or (SEQ ID NO: 24) QSGTRNH; F4: (SEQ ID NO: 21) RGRDLSR; and F5:
(SEQ ID NO: 17) RRDNLHS; or (viii) F1: F1: (SEQ ID NO: 13) RSDHLTQ;
F2: (SEQ ID NO: 14) QSGHLAR; F3: (SEQ ID NO: 24) QSGTRNH; F4: (SEQ
ID NO: 16) QSSDLSR; and F5: (SEQ ID NO: 17) RRDNLHS.
[0019] In certain embodiments, the zinc finger proteins as
described herein are fused to a functional domain (e.g.,
transcriptional activation domain, transcriptional repression
domain, cleavage domain (to form a zinc finger nuclease), etc.).
Zinc finger nucleases may be used in dimerizing pairs to cleave at
or near one or both of the target sites for the ZFNs of the pair,
for example "left partners" of Table 1 (e.g., 51446, 51463, 51484,
51856, 51857, or 51862) can form dimers with the "right partners"
of Table 1 (e.g., 51536, 51949, 51990, 51993, 51979, 51982, 52015,
or 52032) to cleave BCL11A enhancer sequences.
[0020] In another aspect, the invention comprises delivery of at
least one nuclease (e.g., a nuclease that binds to a BCL11A
enhancer sequence) to a human stem cell or precursor cell (HSC/PC)
for the purpose of genome engineering. In certain embodiments, the
nuclease comprises a zinc finger protein (ZFP) comprising 4, 5 or 6
fingers, each finger comprising a recognition helix region that
recognizes a target subsite wherein the recognition helix regions
comprise the sequences in the order shown in a single row of Table
1. The nuclease(s) as described herein may further comprise a
linker (e.g., between the DNA-binding domain and the cleavage
domain), for example a linker as shown in SEQ ID NOs:26-29 and U.S.
Patent Publication No. 2015/0132269.
[0021] In some embodiments, the nuclease is delivered as a peptide,
while in others it is delivered as a nucleic acid encoding the at
least one nuclease. In some embodiments, more than one nuclease is
used. In some preferred embodiments, the nucleic acid encoding the
nuclease is an mRNA, and in some instances, the mRNA is protected.
In some aspects, the mRNA may be chemically modified (See e.g.
Kormann et al. (2011) Nature Biotechnology 29(2):154-157). In other
aspects, the mRNA may comprise an ARCA cap (see U.S. Pat. Nos.
7,074,596 and 8,153,773). In further embodiments, the mRNA may
comprise a mixture of unmodified and modified nucleotides (see U.S.
Patent Publication No. 2012/0195936). In a preferred embodiment,
the nucleic acid encoding the nuclease(s) is delivered to the
HSC/PC via electroporation. In some embodiments, the nuclease
cleaves at or near the binding site of transcription factor. In
some aspects, the transcription factor is GATA-1.
[0022] In other aspects, the invention comprises a cell or cell
line in which an endogenous BCL11A enhancer sequence is genetically
modified by a nuclease as described herein (e.g., shown in Table
1), for example as compared to the wild-type sequence of the cell.
Nuclease-modified cells or cell lines as described herein are
distinguishable in structure and/or function from both wild-type
and other modified (nuclease-mediated) cells. The genetically
modified cell or cell lines may be heterozygous or homozygous for
the modification. The modifications may comprise insertions (e.g.,
transgene insertion), deletions and/or combinations thereof. In
some preferred embodiments, the insertions, deletions and/or
combinations thereof result in the destruction of a transcription
factor binding site. In certain embodiments, the modification is at
or near the nuclease(s) binding and/or cleavage site(s), for
example, within 1-300 (or any value therebetween) base pairs
upstream or downstream of the site(s) of cleavage, more preferably
within 1-100 base pairs (or any value therebetween) of either side
of the binding and/or cleavage site(s) shown in Table 1, even more
preferably within 1 to 50 base pairs (or any value therebetween) on
either side of the binding and/or cleavage site(s). The
modification may also include modifications to one or more
nucleotides in the cleavage and/or in one or more of the binding
sites. In certain embodiments, one or more of the nuclease target
site(s) is(are) not modified. In other embodiments, at least one of
the target sites for the nuclease(s) is(are) modified. In certain
embodiments, the modification is at or near the "+58" region of the
BCL11A enhancer, for example, at or near a nuclease binding site
shown in any of SEQ ID NO:1 and SEQ ID NO:12. Any cell or cell line
may be modified by the nucleases as described herein, for example a
stem cell (hematopoietic stem cell such as a CD34+ hematopoietic
stem cell) or red blood cell (RBC) precursor cell. Also described
are cells or cell lines obtained following modification by a
nuclease as described herein, for example cells or cell lines
descended from a nuclease-modified cell or cell line. Partially or
fully differentiated cells descended from the modified stem cells
as described herein are also provided (e.g., RBCs or RBC precursor
cells). The cells descended from the nuclease-modified cells may be
propagated (and/or differentiated) in vitro (culture) or may
differentiate within a live subject, for example following ex vivo
administration of a nuclease-modified stem cell. Any of the
genetically modified cells or cell lines disclosed herein may show
increased expression of gamma globin. Compositions such as
pharmaceutical compositions comprising the genetically modified
cells as described herein are also provided.
[0023] In other aspects, the invention comprises delivery of a
donor nucleic acid to a target cell to provide a genetically
modified cell in which the donor is integrated into the cell. The
donor may be delivered prior to, after, or along with the nucleic
acid encoding the nuclease(s) of Table 1. The donor nucleic acid
may comprise an exogenous sequence (transgene) to be integrated
into the genome of the cell, for example, an endogenous locus. In
some embodiments, the donor may comprise a full length gene or
fragment thereof flanked by regions of homology with the targeted
cleavage site. In some embodiments, the donor lacks homologous
regions and is integrated into a target locus through homology
independent mechanism (i.e. NHEJ). The donor may comprise any
nucleic acid sequence, for example a nucleic acid that, when used
as a substrate for homology-directed repair of the nuclease-induced
double-strand break, leads to a donor-specified deletion to be
generated at the endogenous chromosomal locus (e.g., BCL11A
enhancer region) or, alternatively (or in addition to), novel
allelic forms of (e.g., point mutations that ablate a transcription
factor binding site) the endogenous locus to be created. In some
aspects, the donor nucleic acid is an oligonucleotide wherein
integration leads to a gene correction event, or a targeted
deletion.
[0024] In other aspects, the nuclease and/or donor is(are)
delivered by viral and/or non-viral gene transfer methods. In
preferred embodiments, the donor is delivered to the cell via an
adeno-associated virus (AAV). In some instances, the AAV comprises
LTRs that are of a heterologous serotype in comparison with the
capsid serotype.
[0025] In some aspects, deletions comprising regions within the
DNAseI hypersensitive regions of the enhancer (e.g., the +58 region
of the BCL11A enhancer) are made using one or more nucleases as
shown in Table 1. These deletions can comprise from about 1
nucleotide to about 551 nucleotides. Thus, the deletions can
comprise, 1, 5, 10, 15, 20, 25, 30, 40, 50, 100, 150, 200, 250,
300, 350, 400, 450, 500, 550 nucleotides, or any value
therebetween. In some embodiments, the deletions comprise binding
regions for one or more transcription factors. In some preferred
embodiments, the deletions comprise a GATA-1 binding site, or the
binding site for GATA-1 in combination with other factors.
[0026] In some embodiments, the DNA binding domains of Table 1 are
fused to a functional domain. Some aspects include fusion of the
DNA binding domains with domains capable of regulating the
expression of a gene. In some embodiments, the fusion proteins
comprise the DNA binding domain of Table 1 fused to a gene
expression modulatory domain where the modulator represses gene
expression.
[0027] In some embodiments, the HSC/PC cells are contacted with the
nucleases and/or DNA binding proteins of the invention (i.e., ZFPs
as shown in Table 1). In some embodiments, the nucleases and/or DNA
binding proteins are delivered as nucleic acids and in other
embodiments, they are delivered as proteins. In some embodiments,
the nucleic acids are mRNAs encoding the nucleases and/or DNA
binding proteins, and in further embodiments, the mRNAs may be
protected. In some embodiments, the mRNA may be chemically
modified, may comprise an ARCA cap and/or may comprise a mixture of
unmodified and modified nucleotides. Cells or cell lines descended
from these cells are also provided, including partially or fully
differentiated cells.
[0028] In some aspects, the HSC/PC are contacted with the nucleases
and/or DNA binding proteins of the invention ex vivo, following
apheresis of the HSC/PC from a subject, or purification from
harvested bone marrow. In some embodiments, the nucleases described
herein cause modifications within the BCL11A enhancer regions, for
example resulting a genetically modified cell that is structurally
and/or functionally distinct from wild-type and/or other modified
(e.g., nuclease-modified) cells. In further embodiments, the HSC/PC
containing the BCL11A enhancer region modifications are introduced
back into the subject. In some instances, the HSC/PC containing the
BCL11A enhancer region modifications are expanded prior to
introduction. In other aspects, the genetically modified HSC/PCs
are given to the subject in a bone marrow transplant wherein the
HSC/PC engraft, differentiate and mature in vivo. In some
embodiments, the HSC/PC are isolated from the subject following
G-CSF- and/or plerixafor-induced mobilization, and in others, the
cells are isolated from human bone marrow or human umbilical cords.
In some aspects, the subject is treated to a mild myeloablative
procedure prior to introduction of the graft comprising the
modified HSC/PC, while in other aspects, the subject is treated
with a vigorous myeloablative conditioning regimen. In some
embodiments, the methods and compositions of the invention are used
to treat or prevent a hemoglobinopathy. In some aspects, the
hemoglobinopathy is a beta thalassemia, while in other aspects, the
hemoglobinopathy is sickle cell disease.
[0029] In some embodiments, the HSC/PC are further contacted with a
donor molecule. In some embodiments, the donor molecule is
delivered by a viral vector. The donor molecule may comprise one or
more sequences encoding a functional polypeptide (e.g., a cDNA or
fragment thereof), with or without a promoter. Additional sequences
(coding or non-coding sequences) may be included when a donor
molecule is used for inactivation, including but not limited to,
sequences encoding a 2A peptide, SA site, IRES, etc.
[0030] In one aspect, the methods and compositions of the invention
comprise methods for contacting the HSC/PC in vivo. The nucleases
and/or DNA binding proteins are delivered to HSC/PC in situ by
methods known in the art. In some embodiments, the nucleases and/or
DNA binding proteins of the invention comprise a viral particle
that is administered to the subject in need, while in others, the
nucleases and/or DNA binding proteins comprise a nanoparticle (e.g.
liposome). In some embodiments, the viral particles and/or
nanoparticles are delivered to the organ (e.g. bone marrow) wherein
the HSC/PC reside.
[0031] In another aspect, described herein are methods of
integrating a donor nucleic acid into the genome of a cell via
homology-independent mechanisms. The methods comprise creating a
double-stranded break (DSB) in the genome of a cell and cleaving
the donor molecule using a nuclease as described herein, such that
the donor nucleic acid is integrated at the site of the DSB. In
certain embodiments, the donor nucleic acid is integrated via
non-homology dependent methods (e.g., NHEJ). As noted above, upon
in vivo cleavage the donor sequences can be integrated in a
targeted manner into the genome of a cell at the location of a DSB.
The donor sequence can include one or more of the same target sites
for one or more of the nucleases used to create the DSB. Thus, the
donor sequence may be cleaved by one or more of the same nucleases
used to cleave the endogenous gene into which integration is
desired. In certain embodiments, the donor sequence includes
different nuclease target sites from the nucleases used to induce
the DSB. DSBs in the genome of the target cell may be created by
any mechanism. In certain embodiments, the DSB is created by one or
more zinc-finger nucleases (ZFNs), fusion proteins comprising a
zinc finger binding domain, which is engineered to bind a sequence
within the region of interest, and a cleavage domain or a cleavage
half-domain.
[0032] In one aspect, the donor may encode a regulatory protein of
interest (e.g. ZFP TFs, TALE TFs or a CRISPR/Cas TF) that binds to
and/or modulates expression of a gene of interest. In one
embodiment, the regulatory proteins bind to a DNA sequence and
prevent binding of other regulatory factors. In another embodiment,
the binding of the regulatory protein may modulate (i.e. induce or
repress) expression of a target DNA.
[0033] In some embodiments, the transgenic HSC/PC cell and/or
animal includes a transgene that encodes a human gene. In some
instances, the transgenic animal comprises a knock out at the
endogenous locus corresponding to exogenous transgene, thereby
allowing the development of an in vivo system where the human
protein may be studied in isolation. Such transgenic models may be
used for screening purposes to identify small molecules or large
biomolecules or other entities which may interact with or modify
the human protein of interest. In some aspects, the transgene is
integrated into the selected locus (e.g., safe-harbor) into a stem
cell (e.g., an embryonic stem cell, an induced pluripotent stem
cell, a hematopoietic stem cell, etc.) or animal embryo obtained by
any of the methods described herein, and then the embryo is
implanted such that a live animal is born. The animal is then
raised to sexual maturity and allowed to produce offspring wherein
at least some of the offspring comprise edited endogenous gene
sequence or the integrated transgene.
[0034] In another aspect, provided herein is a method of altering
gene expression (e.g., BCL11A and/or a globin gene) in a cell, the
method comprising: introducing, into the cell, one or more
nucleases as described herein (shown in Table 1), under conditions
such that the one or more proteins are expressed and expression of
the gene is altered. In certain embodiments, expression of a globin
gene (e.g., gamma globin or beta globin) is altered (e.g.,
increased). Any of the methods described herein may further
comprise integrating a donor sequence (e.g., transgene or fragment
thereof under the control of an exogenous or endogenous promoter)
into the genome of the cell, for example integrating a donor at or
near the site of nuclease cleavage in the BCL11A gene. The donor
sequence is introduced to the cell using a viral vector, as an
oligonucleotide and/or on a plasmid. The cell in which gene
expression is altered may be, for example, a red blood cell (RBC)
precursor cell and/or a hematopoietic stem cell (e.g., CD34+
cell).
[0035] In other embodiments, provided herein is a method of
producing a genetically modified cell comprising a genomic
modification within an endogenous BCL11A enhancer sequence (a
modification to the nucleotide sequence of the BCL11A enhancer
sequence), the method comprising the steps of: a) contacting a cell
with a polynucleotide (e.g. DNA or mRNA) encoding a zinc finger
nuclease comprising 4, 5, or 6 zinc finger domains in which each of
the zinc finger domains comprises a recognition helix region in the
order shown in a single row of Table 1; b) subjecting the cell to
conditions conducive to expressing the zinc finger protein from the
polynucleotide; and c) modifying the endogenous BCL11A enhancer
sequence with the expressed zinc finger protein sufficient to
produce the genetically modified cell. In certain embodiments, the
cells are stimulated with at least one cytokine (e.g., prior to
step (a)). The polynucleotide may be contacted with the cell using
any suitable method, including but not limited, via transfection,
using a non-viral vector, using a viral vector, by chemical means
or by exposure to an electric field (e.g., electroporation).
[0036] Cells comprising one or a combination of the genomic
modifications described herein are also provided, including cells
descended from the cells produced by the methods described
herein.
[0037] Also provided is a method of treating a patient in need of
an increase in globin gene expression, the method comprising
administering to the patient the pharmaceutical preparation
(genetically modified cells, proteins and/or polynucleotides) as
described herein in an amount sufficient to increase the globin
gene expression in the patient. In certain embodiments, the patient
is known to have, is suspected of having, or is at risk of
developing a thalassemia or sickle cell disease.
[0038] A kit, comprising the nucleic acids, proteins and/or
genetically modified cells of the invention, is also provided. The
kit may comprise nucleic acids encoding the nucleases, (e.g. RNA
molecules or ZFN, TALEN or CRISPR/Cas system encoding genes
contained in a suitable expression vector), or aliquots of the
nuclease proteins, donor molecules, suitable sternness modifiers,
cells, buffers, and/or instructions (e.g., for performing the
methods of the invention) and the like. The invention includes, but
is not limited to, a genetically modified cell (e.g., stem cell
such as a hematopoietic (CD34+) stem cell or RBC precursor cell)
comprising at least one genomic modification made by a nuclease
(e.g., as shown in a single row of Table 1), wherein the genomic
modification is within an endogenous BCL11A enhancer sequence, and
further wherein the genomic modification is selected from the group
consisting of insertions, deletions and combinations thereof and
comprises a modification at or near any of SEQ ID NO:1 and SEQ ID
NO:12. In certain embodiments, the cell is a genetically modified
differentiated cell descended from a stem cell as described herein
(e.g., a RBC descended from a hematopoietic stem cell or RBC
precursor cell).
[0039] The nuclease may comprise at least one zinc finger nuclease
(ZFN) (e.g., as shown in Table 1) and/or at least one TALEN and the
nuclease(s) may be introduced into the cell in protein form and/or
as a polynucleotide encoding the nuclease(s). In certain
embodiments, the genomic modification comprises an insertion that
comprises integration of a donor polynucleotide encoding a
transgene. Also provided are pharmaceutical compositions comprising
one or more of the genetically modified cells as described
herein.
[0040] Also provided is a DNA-binding protein comprising a zinc
finger protein comprising 4, 5 or 6 zinc finger domains comprising
a recognition helix region, wherein the zinc finger proteins
comprise the recognition helix regions in the order shown in a
single row of Table 1. Also provided is a TALE protein comprising a
plurality of repeats that bind to a sequence comprising a portion
(e.g., at least 4, 5, 6 or more) base pairs of the target sites
shown in Table 1. A fusion protein comprising a zinc finger protein
or TALE protein as described herein and a wild-type or engineered
cleavage domain or cleavage half-domain is also provided as are
polynucleotides encoding the proteins (ZFPs, TALEs, ZFNs, TALENs)
as described herein. Cells (e.g., isolated stem cells such as
hematopoietic (CD34+) stem cells) comprising one or more
polynucleotides and/or proteins as described herein are also
provided. Also provided are kits comprising one or more proteins,
polynucleotides and/or cells as described herein.
[0041] A method of altering globin gene expression in a cell (e.g.,
RBC precursor cell and/or hematopoietic stem cell) is also
described, the method comprising: introducing, into the cell, one
or more polynucleotides encoding one or more nucleases as described
herein, under conditions such that the one or more proteins are
expressed and expression of the globin gene (e.g., gamma and/or
beta globin) is altered (e.g., increased). In certain embodiments,
the methods further comprise integrating a donor sequence into the
genome of the cell, for example using a viral vector, as an
oligonucleotide or on a plasmid. The donor sequence may comprise a
transgene under the control of an endogenous or exogenous
promoter.
[0042] Also provided is a method of producing a genetically
modified cell comprising a genomic modification within an
endogenous BCL11A enhancer sequence (e.g., target site as shown in
Table 1), the method comprising the steps of: (a) contacting a cell
with a polynucleotide encoding a fusion protein comprising a zinc
finger nuclease comprising 4, 5, or 6 zinc finger domains in which
each of the zinc finger domains comprises a recognition helix
region in the order shown in a single row of Table 1; (b)
subjecting the cell to conditions conducive to expressing the
fusion protein from the polynucleotide; and (c) modifying the
endogenous BCL11A enhancer sequence with the expressed fusion
protein sufficient to produce the genetically modified cell. In
certain embodiments, the method further comprises stimulating the
cells with at least one cytokine. The polynucleotide(s) may be
delivered inside the cell, for example using a non-viral delivery
system, a viral delivery system, and/or a delivery vehicle and may
comprise subjecting the cells to an electric field.
[0043] Methods of treating a patient in need of an increase in
globin gene expression (e.g., a patient is known to have, is
suspected of having, or is at risk of developing a globinopathy
such as a thalassemia (e.g., .beta.-thalassemia) or sickle cell
disease are also provided, the method comprising administering to
the patient the pharmaceutical composition as described herein
(e.g., proteins, polynucleotides and/or cells) in an amount
sufficient to increase the globin gene expression in the
patient.
[0044] These and other aspects will be readily apparent to the
skilled artisan in light of disclosure as a whole.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] FIG. 1 is a graph depicting the relative ratio of human
gamma globin expression (HBG) to human beta globin expression (HBB)
in red blood cells derived from CD34+ cells edited with the
BCL11a-specific ZFN pairs shown.
[0046] FIGS. 2A and 2B are graphs depicting the activity of two
pairs of BCL11a specific ZFNs in CD34+ cells isolated from
peripheral blood (PB). Cells were transfected using a BTX
electroporation device. The % indels detected (measurement of
detectable NHEJ activity) for each condition are shown below the
graphs for FIG. 2A (mRNA input range from 0.5 to 4 .mu.g) and FIG.
2B (mRNA input range from 2.0 to 8.0 sg).
[0047] FIG. 3 is a graph depicting the expression of human gamma
globin (HBG) as a relative ratio of HBG to human beta globin (HBB)
following erythroid differentiation of the edited PB CD34+ cells
shown in FIG. 2B. Single mRNA species, where the ZFNs are encoded
on the same mRNA molecule but separated by a 2a self-cleaving
peptide sequence (identified as "2a"), are compared to the use of
two mRNAs where each mRNA encodes one of the ZFN pair (identified
as "sep" for separate).
[0048] FIG. 4A and FIG. 4B are graphs depicting the activity of two
pairs of BCL11a specific ZFNs in CD34+ cells isolated from bone
marrow (BM). Cells were transfected using a BTX electroporation
device. The % indels detected (measurement of detectable NHEJ
activity) for each condition are shown below the graphs for FIG. 4A
(mRNA input range from 2.0 to 8.0 .mu.g). FIG. 4B depicts the
activity of one pair of ZFNs where the ZFNs are supplied either as
a single mRNA species with a 2a self-cleaving peptide sequence
separating the sequences encoding each ZFN or when the two ZFNs are
supplied on separate mRNAs.
[0049] FIGS. 5A and 5B depicts activity of ZFN pairs in PB derived
CD34+ cells using a Maxcyte electroporation device. The % indels
detected (measurement of detectable NHEJ activity) for each
condition are shown below the graphs for FIG. 5A and FIG. 5B. FIG.
5A depicts a comparison between two ZFN pairs, and FIG. 5B depicts
the activity of the ZFNs pairs when the ZFNs are supplied either as
a single mRNA species with a 2a self-cleaving peptide sequence
separating the sequences encoding each ZFN or when the two ZFNs are
supplied on separate mRNAs.
[0050] FIG. 6 depicts a graph showing large scale activity of the A
pair (SBS51446/51536) and B pair (SBS51857/51949) in bone marrow
derived CD34+ cells. mRNAs encoding the ZFN pairs were either
supplied as single mRNAs where the sequences encoding each half of
the ZFN pair were separated by a 2a self-cleaving sequence, or as
separate mRNAs encoding each ZFN. Activity is shown in the % indels
detected.
[0051] FIG. 7 shows a graph depicting the relative amount of HBG
and HBB expression detected after 14 days of differentiation
following the large scale gene editing shown in FIG. 6. As before,
samples were tested either as single mRNAs encoding both ZFNs, or
as separate mRNAs. The amount of indels detected at day 0 of
differentiation is shown across the bottom, and demonstrates that
indel activity tracks with the amount of HGB expressed.
[0052] FIG. 8 is a graph depicting the percent of indels detected
in large scale editing of CD34+ cells from bone marrow treated with
pair B, either as single mRNAs or separate mRNAs as described
above.
[0053] FIGS. 9A and 9B are graphs depicting the percent of indels
detected in large scale editing of CD34+ cells from bone marrow
treated with pair B, either as single mRNAs or separate mRNAs as
described above.
[0054] FIGS. 10A and 10B are tables depicting the results of the
off-target analysis for Pair A (FIG. 10A) and Pair B (FIG.
10B).
[0055] FIGS. 11A and 11B are graphs showing real-time RT qPCR
analysis of in vitro differentiation in experiment 1 (FIG. 11A) and
experiment 2 (FIG. 11B) using patient and wild type (wt) cells
treated with SB ZFN mRNA. The graphs show the relative ratios of
gamma globin to alpha globin mRNAs.
[0056] FIGS. 12A and 12B are graphs showing the ratios of gamma
globin to alpha globin in experiment 1 (FIG. 12A) and experiment 2
(FIG. 12B). For the gamma globin values, the values of the Agamma
and Ggamma peaks and, where applicable, the Agamma T peak were
added up.
[0057] FIG. 13 shows a graph of the gamma/beta like protein ratios
graphed according to the allele state in the individual colonies
analyzed. The data were sorted by genotypic class ("+" for
unmodified allele, "-" for edited allele; "+/+" for wild type;
"+/-" for monoallelic modified; and "-/-" for biallelic
modified).
DETAILED DESCRIPTION
[0058] Disclosed herein are compositions and methods for genome
engineering for the modulation of BCL11A and/or gamma globin
expression and for the treatment and/or prevention of
hemoglobinopathies. In particular, nucleases comprising the ZFPs
having the recognition helix regions as shown in a single row of
Table 1 is efficiently achieved in HSC/PC and results in a change
in relative gamma globin expression during subsequent
erythropoiesis. This modulation of BCL11A and gamma globin
expression is particularly useful for treatment of
hemoglobinopathies (e.g., beta thalassemias, sickle cell disease)
wherein there is insufficient beta globin expression or expression
of a mutated form of beta-globin. Using the methods and
compositions of the invention, the complications and disease
related sequelae caused by the aberrant beta globin can be overcome
by alteration of the expression of gamma globin in erythrocyte
precursor cells.
General
[0059] Practice of the methods, as well as preparation and use of
the compositions disclosed herein employ, unless otherwise
indicated, conventional techniques in molecular biology,
biochemistry, chromatin structure and analysis, computational
chemistry, cell culture, recombinant DNA and related fields as are
within the skill of the art. These techniques are fully explained
in the literature. See, for example, Sambrook et al., MOLECULAR
CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor
Laboratory Press, 1989 and Third edition, 2001; Ausubel et al.,
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New
York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY,
Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND
FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS
IN ENZYMOLOGY, Vol. 304, "Chromatin" (P. M. Wassarman and A. P.
Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN
MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (P. B. Becker,
ed.) Humana Press, Totowa, 1999.
Definitions
[0060] The terms "nucleic acid," "polynucleotide," and
"oligonucleotide" are used interchangeably and refer to a
deoxyribonucleotide or ribonucleotide polymer, in linear or
circular conformation, and in either single- or double-stranded
form. For the purposes of the present disclosure, these terms are
not to be construed as limiting with respect to the length of a
polymer. The terms can encompass known analogues of natural
nucleotides, as well as nucleotides that are modified in the base,
sugar and/or phosphate moieties (e.g., phosphorothioate backbones).
In general, an analogue of a particular nucleotide has the same
base-pairing specificity; i.e., an analogue of A will base-pair
with T.
[0061] The terms "polypeptide," "peptide" and "protein" are used
interchangeably to refer to a polymer of amino acid residues. The
term also applies to amino acid polymers in which one or more amino
acids are chemical analogues or modified derivatives of a
corresponding naturally-occurring amino acids.
[0062] "Binding" refers to a sequence-specific, non-covalent
interaction between macromolecules (e.g., between a protein and a
nucleic acid). Not all components of a binding interaction need be
sequence-specific (e.g., contacts with phosphate residues in a DNA
backbone), as long as the interaction as a whole is
sequence-specific. Such interactions are generally characterized by
a dissociation constant (K.sub.d) of 10.sup.-6 M.sup.-1 or lower.
"Affinity" refers to the strength of binding: increased binding
affinity being correlated with a lower K.sub.d.
[0063] A "binding protein" is a protein that is able to bind to
another molecule. A binding protein can bind to, for example, a DNA
molecule (a DNA-binding protein), an RNA molecule (an RNA-binding
protein) and/or a protein molecule (a protein-binding protein). In
the case of a protein-binding protein, it can bind to itself (to
form homodimers, homotrimers, etc.) and/or it can bind to one or
more molecules of a different protein or proteins. A binding
protein can have more than one type of binding activity. For
example, zinc finger proteins have DNA-binding, RNA-binding and
protein-binding activity.
[0064] A "zinc finger DNA binding protein" (or binding domain) is a
protein, or a domain within a larger protein, that binds DNA in a
sequence-specific manner through one or more zinc fingers, which
are regions of amino acid sequence within the binding domain whose
structure is stabilized through coordination of a zinc ion. The
term zinc finger DNA binding protein is often abbreviated as zinc
finger protein or ZFP.
[0065] A "TALE DNA binding domain" or "TALE" is a polypeptide
comprising one or more TALE repeat domains/units. The repeat
domains are involved in binding of the TALE to its cognate target
DNA sequence. A single "repeat unit" (also referred to as a
"repeat") is typically 33-35 amino acids in length and exhibits at
least some sequence homology with other TALE repeat sequences
within a naturally occurring TALE protein.
[0066] Zinc finger and TALE binding domains can be "engineered" to
bind to a predetermined nucleotide sequence, for example via
engineering (altering one or more amino acids) of the recognition
helix region of a naturally occurring zinc finger or TALE protein.
Therefore, engineered DNA binding proteins (zinc fingers or TALEs)
are proteins that are non-naturally occurring. Non-limiting
examples of methods for engineering DNA-binding proteins are design
and selection. A designed DNA binding protein is a protein not
occurring in nature whose design/composition results principally
from rational criteria. Rational criteria for design include
application of substitution rules and computerized algorithms for
processing information in a database storing information of
existing ZFP and/or TALE designs and binding data. See, for
example, U.S. Pat. Nos. 6,140,081; 6,453,242; 6,534,261 and
8,586,526; see also International Patent Publication Nos. WO
98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO
03/016496.
[0067] A "selected" zinc finger protein or TALE is a protein not
found in nature whose production results primarily from an
empirical process such as phage display, interaction trap or hybrid
selection. See e.g., U.S. Pat. Nos. 5,789,538; 5,925,523;
6,007,988; 6,013,453; 6,200,759 and 8,586,526; and International
Patent Publication Nos. WO 95/19431; WO 96/06166; WO 98/53057; WO
98/54311; WO 00/27878; WO 01/60970; WO 01/88197 and WO
02/099084.
[0068] "TtAgo" is a prokaryotic Argonaute protein thought to be
involved in gene silencing. TtAgo is derived from the bacteria
Thermus thermophilus. See, e.g., Swarts et al., ibid, G. Sheng et
al. (2013) Proc. Natl. Acad. Sci. U.S.A. 111:652). A "TtAgo system"
is all the components required including, for example, guide DNAs
for cleavage by a TtAgo enzyme.
[0069] "Recombination" refers to a process of exchange of genetic
information between two polynucleotides, including but not limited
to, donor capture by non-homologous end joining (NHFJ) and
homologous recombination. For the purposes of this disclosure,
"homologous recombination (HR)" refers to the specialized form of
such exchange that takes place, for example, during repair of
double-strand breaks in cells via homology-directed repair
mechanisms. This process requires nucleotide sequence homology,
uses a "donor" molecule to template repair of a "target" molecule
(i.e., the one that experienced the double-strand break), and is
variously known as "non-crossover gene conversion" or "short tract
gene conversion," because it leads to the transfer of genetic
information from the donor to the target. Without wishing to be
bound by any particular theory, such transfer can involve mismatch
correction of heteroduplex DNA that forms between the broken target
and the donor, and/or "synthesis-dependent strand annealing," in
which the donor is used to resynthesize genetic information that
will become part of the target, and/or related processes. Such
specialized HR often results in an alteration of the sequence of
the target molecule such that part or all of the sequence of the
donor polynucleotide is incorporated into the target
polynucleotide.
[0070] In the methods of the disclosure, one or more targeted
nucleases as described herein create a double-stranded break (DSB)
in the target sequence (e.g., cellular chromatin) at a
predetermined site. The DSB may result in deletions and/or
insertions by homology-directed repair or by non-homology-directed
repair mechanisms. Deletions may include any number of base pairs.
Similarly, insertions may include any number of base pairs
including, for example, integration of a "donor" polynucleotide,
optionally having homology to the nucleotide sequence in the region
of the break. The donor sequence may be physically integrated or,
alternatively, the donor polynucleotide is used as a template for
repair of the break via homologous recombination, resulting in the
introduction of all or part of the nucleotide sequence as in the
donor into the cellular chromatin. Thus, a first sequence in
cellular chromatin can be altered and, in certain embodiments, can
be converted into a sequence present in a donor polynucleotide.
Thus, the use of the terms "replace" or "replacement" can be
understood to represent replacement of one nucleotide sequence by
another, (i.e., replacement of a sequence in the informational
sense), and does not necessarily require physical or chemical
replacement of one polynucleotide by another.
[0071] In any of the methods described herein, additional pairs of
zinc-finger proteins or TALEN can be used for additional
double-stranded cleavage of additional target sites within the
cell.
[0072] Any of the methods described herein can be used for
insertion of a donor of any size and/or partial or complete
inactivation of one or more target sequences in a cell by targeted
integration of donor sequence that disrupts expression of the
gene(s) of interest. Cell lines with partially or completely
inactivated genes are also provided.
[0073] In any of the methods described herein, the exogenous
nucleotide sequence (the "donor sequence" or "transgene") can
contain sequences that are homologous, but not identical, to
genomic sequences in the region of interest, thereby stimulating
homologous recombination to insert a non-identical sequence in the
region of interest. Thus, in certain embodiments, portions of the
donor sequence that are homologous to sequences in the region of
interest exhibit between about 80 to 99% (or any integer
therebetween) sequence identity to the genomic sequence that is
replaced. In other embodiments, the homology between the donor and
genomic sequence is higher than 99%, for example if only 1
nucleotide differs as between donor and genomic sequences of over
100 contiguous base pairs. In certain cases, a non-homologous
portion of the donor sequence can contain sequences not present in
the region of interest, such that new sequences are introduced into
the region of interest. In these instances, the non-homologous
sequence is generally flanked by sequences of 50-1,000 base pairs
(or any integral value therebetween) or any number of base pairs
greater than 1,000, that are homologous or identical to sequences
in the region of interest. In other embodiments, the donor sequence
is non-homologous to the first sequence, and is inserted into the
genome by non-homologous recombination mechanisms.
[0074] "Cleavage" refers to the breakage of the covalent backbone
of a DNA molecule. Cleavage can be initiated by a variety of
methods including, but not limited to, enzymatic or chemical
hydrolysis of a phosphodiester bond. Both single-stranded cleavage
and double-stranded cleavage are possible, and double-stranded
cleavage can occur as a result of two distinct single-stranded
cleavage events. DNA cleavage can result in the production of
either blunt ends or staggered ends. In certain embodiments, fusion
polypeptides are used for targeted double-stranded DNA
cleavage.
[0075] A "cleavage half-domain" is a polypeptide sequence which, in
conjunction with a second polypeptide (either identical or
different) forms a complex having cleavage activity (preferably
double-strand cleavage activity). The terms "first and second
cleavage half-domains;" "+ and - cleavage half-domains" and "right
and left cleavage half-domains" are used interchangeably to refer
to pairs of cleavage half-domains that dimerize.
[0076] An "engineered cleavage half-domain" is a cleavage
half-domain that has been modified so as to form obligate
heterodimers with another cleavage half-domain (e.g., another
engineered cleavage half-domain). See, also, U.S. Patent
Publication Nos. 2005/0064474, 2007/0218528, 2008/0131962 and
2011/0201055, incorporated herein by reference in their
entireties.
[0077] The term "sequence" refers to a nucleotide sequence of any
length, which can be DNA or RNA; can be linear, circular or
branched and can be either single-stranded or double stranded. The
term "donor sequence" refers to a nucleotide sequence that is
inserted into a genome. A donor sequence can be of any length, for
example between 2 and 100,000,000 nucleotides in length (or any
integer value therebetween or thereabove), preferably between about
100 and 100,000 nucleotides in length (or any integer
therebetween), more preferably between about 2000 and 20,000
nucleotides in length (or any value therebetween) and even more
preferable, between about 5 and 15 kb (or any value
therebetween).
[0078] "Chromatin" is the nucleoprotein structure comprising the
cellular genome. Cellular chromatin comprises nucleic acid,
primarily DNA, and protein, including histones and non-histone
chromosomal proteins. The majority of eukaryotic cellular chromatin
exists in the form of nucleosomes, wherein a nucleosome core
comprises approximately 150 base pairs of DNA associated with an
octamer comprising two each of histones H2A, H2B, H3 and H4; and
linker DNA (of variable length depending on the organism) extends
between nucleosome cores. A molecule of histone H1 is generally
associated with the linker DNA. For the purposes of the present
disclosure, the term "chromatin" is meant to encompass all types of
cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular
chromatin includes both chromosomal and episomal chromatin.
[0079] A "chromosome" is a chromatin complex comprising all or a
portion of the genome of a cell. The genome of a cell is often
characterized by its karyotype, which is the collection of all the
chromosomes that comprise the genome of the cell. The genome of a
cell can comprise one or more chromosomes.
[0080] An "episome" is a replicating nucleic acid, nucleoprotein
complex or other structure comprising a nucleic acid that is not
part of the chromosomal karyotype of a cell. Examples of episomes
include plasmids and certain viral genomes.
[0081] An "accessible region" is a site in cellular chromatin in
which a target site present in the nucleic acid can be bound by an
exogenous molecule which recognizes the target site. Without
wishing to be bound by any particular theory, it is believed that
an accessible region is one that is not packaged into a nucleosomal
structure. The distinct structure of an accessible region can often
be detected by its sensitivity to chemical and enzymatic probes,
for example, nucleases.
[0082] A "target site" or "target sequence" is a nucleic acid
sequence that defines a portion of a nucleic acid to which a
binding molecule will bind, provided sufficient conditions for
binding exist.
[0083] An "exogenous" molecule is a molecule that is not normally
present in a cell, but can be introduced into a cell by one or more
genetic, biochemical or other methods. "Normal presence in the
cell" is determined with respect to the particular developmental
stage and environmental conditions of the cell. Thus, for example,
a molecule that is present only during embryonic development of
muscle is an exogenous molecule with respect to an adult muscle
cell. Similarly, a molecule induced by heat shock is an exogenous
molecule with respect to a non-heat-shocked cell. An exogenous
molecule can comprise, for example, a functioning version of a
malfunctioning endogenous molecule or a malfunctioning version of a
normally-functioning endogenous molecule.
[0084] An exogenous molecule can be, among other things, a small
molecule, such as is generated by a combinatorial chemistry
process, or a macromolecule such as a protein, nucleic acid,
carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any
modified derivative of the above molecules, or any complex
comprising one or more of the above molecules. Nucleic acids
include DNA and RNA, can be single- or double-stranded; can be
linear, branched or circular, and can be of any length. Nucleic
acids include those capable of forming duplexes, as well as
triplex-forming nucleic acids. See, for example, U.S. Pat. Nos.
5,176,996 and 5,422,251. Proteins include, but are not limited to,
DNA-binding proteins, transcription factors, chromatin remodeling
factors, methylated DNA binding proteins, polymerases, methylases,
demethylases, acetylases, deacetylases, kinases, phosphatases,
integrases, recombinases, ligases, topoisomerases, gyrases and
helicases.
[0085] An exogenous molecule can be the same type of molecule as an
endogenous molecule, e.g., an exogenous protein or nucleic acid.
For example, an exogenous nucleic acid can comprise an infecting
viral genome, a plasmid or episome introduced into a cell, or a
chromosome that is not normally present in the cell. Methods for
the introduction of exogenous molecules into cells are known to
those of skill in the art and include, but are not limited to,
lipid-mediated transfer (i.e., liposomes, including neutral and
cationic lipids), electroporation, direct injection, cell fusion,
particle bombardment, calcium phosphate co-precipitation,
DEAE-dextran-mediated transfer and viral vector-mediated transfer.
An exogenous molecule can also be the same type of molecule as an
endogenous molecule but derived from a different species than the
cell is derived from. For example, a human nucleic acid sequence
may be introduced into a cell line originally derived from a mouse
or hamster. Methods for the introduction of exogenous molecules
into plant cells are known to those of skill in the art and
include, but are not limited to, protoplast transformation, silicon
carbide (e.g., WHISKERS.TM.), Agrobacterium-mediated
transformation, lipid-mediated transfer (i.e., liposomes, including
neutral and cationic lipids), electroporation, direct injection,
cell fusion, particle bombardment (e.g., using a "gene gun"),
calcium phosphate co-precipitation, DEAE-dextran-mediated transfer
and viral vector-mediated transfer.
[0086] By contrast, an "endogenous" molecule is one that is
normally present in a particular cell at a particular developmental
stage under particular environmental conditions. For example, an
endogenous nucleic acid can comprise a chromosome, the genome of a
mitochondrion, chloroplast or other organelle, or a
naturally-occurring episomal nucleic acid. Additional endogenous
molecules can include proteins, for example, transcription factors
and enzymes.
[0087] As used herein, the term "product of an exogenous nucleic
acid" includes both polynucleotide and polypeptide products, for
example, transcription products (polynucleotides such as RNA) and
translation products (polypeptides).
[0088] A "fusion" molecule is a molecule in which two or more
subunit molecules are linked, preferably covalently. The subunit
molecules can be the same chemical type of molecule, or can be
different chemical types of molecules. Examples of the first type
of fusion molecule include, but are not limited to, fusion proteins
(for example, a fusion between a ZFP or TALE DNA-binding domain and
one or more activation domains) and fusion nucleic acids (for
example, a nucleic acid encoding the fusion protein described
supra). Examples of the second type of fusion molecule include, but
are not limited to, a fusion between a triplex-forming nucleic acid
and a polypeptide, and a fusion between a minor groove binder and a
nucleic acid.
[0089] Expression of a fusion protein in a cell can result from
delivery of the fusion protein to the cell or by delivery of a
polynucleotide encoding the fusion protein to a cell, wherein the
polynucleotide is transcribed, and the transcript is translated, to
generate the fusion protein. Trans-splicing, polypeptide cleavage
and polypeptide ligation can also be involved in expression of a
protein in a cell. Methods for polynucleotide and polypeptide
delivery to cells are presented elsewhere in this disclosure.
[0090] A "gene," for the purposes of the present disclosure,
includes a DNA region encoding a gene product (see infra), as well
as all DNA regions which regulate the production of the gene
product, whether or not such regulatory sequences are adjacent to
coding and/or transcribed sequences. Accordingly, a gene includes,
but is not necessarily limited to, promoter sequences, terminators,
translational regulatory sequences such as ribosome binding sites
and internal ribosome entry sites, enhancers, silencers,
insulators, boundary elements, replication origins, matrix
attachment sites and locus control regions.
[0091] "Gene expression" refers to the conversion of the
information, contained in a gene, into a gene product. A gene
product can be the direct transcriptional product of a gene (e.g.,
mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any
other type of RNA) or a protein produced by translation of an mRNA.
Gene products also include RNAs which are modified, by processes
such as capping, polyadenylation, methylation, and editing, and
proteins modified by, for example, methylation, acetylation,
phosphorylation, ubiquitination, ADP-ribosylation, myristilation,
and glycosylation.
[0092] "Modulation" of gene expression refers to a change in the
activity of a gene. Modulation of expression can include, but is
not limited to, gene activation and gene repression. Genome editing
(e.g., cleavage, alteration, inactivation, random mutation) can be
used to modulate expression. Gene inactivation refers to any
reduction in gene expression as compared to a cell that does not
include a ZFP, TALE or CRISPR/Cas system as described herein. Thus,
gene inactivation may be partial or complete.
[0093] A "protected" mRNA is one in which the mRNA has been altered
in some manner to increase the stability or translation of the
mRNA. Examples of protections include the use of replacement of up
to 25% of the cytodine and uridine residues with 2-thiouridine
(s2U) and 5-methylcytidine (m5C). The resulting mRNA exhibits less
immunogenicity and more stability as compared with its unmodified
counterpart. (see Kariko et al. (2012) Molecular Therapy
16(11):1833-1844). Other changes include the addition of a
so-called ARCA cap, which increases the translationability of the
in vitro produced mRNA (see U.S. Pat. No. 7,074,596).
[0094] A "region of interest" is any region of cellular chromatin,
such as, for example, a gene or a non-coding sequence within or
adjacent to a gene, in which it is desirable to bind an exogenous
molecule. Binding can be for the purposes of targeted DNA cleavage
and/or targeted recombination. A region of interest can be present
in a chromosome, an episome, an organellar genome (e.g.,
mitochondrial, chloroplast), or an infecting viral genome, for
example. A region of interest can be within the coding region of a
gene, within transcribed non-coding regions such as, for example,
leader sequences, trailer sequences or introns, or within
non-transcribed regions, either upstream or downstream of the
coding region. A region of interest can be as small as a single
nucleotide pair or up to 2,000 nucleotide pairs in length, or any
integral value of nucleotide pairs.
[0095] "Eukaryotic" cells include, but are not limited to, fungal
cells (such as yeast), plant cells, animal cells, mammalian cells
and human cells (e.g., T-cells).
[0096] The terms "operative linkage" and "operatively linked" (or
"operably linked") are used interchangeably with reference to a
juxtaposition of two or more components (such as sequence
elements), in which the components are arranged such that both
components function normally and allow the possibility that at
least one of the components can mediate a function that is exerted
upon at least one of the other components. By way of illustration,
a transcriptional regulatory sequence, such as a promoter, is
operatively linked to a coding sequence if the transcriptional
regulatory sequence controls the level of transcription of the
coding sequence in response to the presence or absence of one or
more transcriptional regulatory factors. A transcriptional
regulatory sequence is generally operatively linked in cis with a
coding sequence, but need not be directly adjacent to it. For
example, an enhancer is a transcriptional regulatory sequence that
is operatively linked to a coding sequence, even though they are
not contiguous.
[0097] With respect to fusion polypeptides, the term "operatively
linked" can refer to the fact that each of the components performs
the same function in linkage to the other component as it would if
it were not so linked. For example, with respect to a fusion
polypeptide in which a ZFP, TALE or Cas DNA-binding domain is fused
to an activation domain, the ZFP, TALE or Cas DNA-binding domain
and the activation domain are in operative linkage if, in the
fusion polypeptide, the ZFP, TALE of Cas DNA-binding domain portion
is able to bind its target site and/or its binding site, while the
activation domain is able to upregulate gene expression. When a
fusion polypeptide in which a ZFP, TALE or Cas DNA-binding domain
is fused to a cleavage domain, the ZFP, TALE or Cas DNA-binding
domain and the cleavage domain are in operative linkage if, in the
fusion polypeptide, the ZFP, TALE or Cas DNA-binding domain portion
is able to bind its target site and/or its binding site, while the
cleavage domain is able to cleave DNA in the vicinity of the target
site.
[0098] A "functional fragment" of a protein, polypeptide or nucleic
acid is a protein, polypeptide or nucleic acid whose sequence is
not identical to the full-length protein, polypeptide or nucleic
acid, yet retains the same function as the full-length protein,
polypeptide or nucleic acid. A functional fragment can possess
more, fewer, or the same number of residues as the corresponding
native molecule, and/or can contain one or more amino acid or
nucleotide substitutions. Methods for determining the function of a
nucleic acid (e.g., coding function, ability to hybridize to
another nucleic acid) are well-known in the art. Similarly, methods
for determining protein function are well-known. For example, the
DNA-binding function of a polypeptide can be determined, for
example, by filter-binding, electrophoretic mobility-shift, or
immunoprecipitation assays. DNA cleavage can be assayed by gel
electrophoresis. See Ausubel et al., supra. The ability of a
protein to interact with another protein can be determined, for
example, by co-immunoprecipitation, two-hybrid assays or
complementation, both genetic and biochemical.
[0099] A "vector" is capable of transferring gene sequences to
target cells. Typically, "vector construct," "expression vector,"
and "gene transfer vector," mean any nucleic acid construct capable
of directing the expression of a gene of interest and which can
transfer gene sequences to target cells. Thus, the term includes
cloning, and expression vehicles, as well as integrating
vectors.
[0100] The terms "subject" and "patient" are used interchangeably
and refer to mammals such as human patients and non-human primates,
as well as experimental animals such as rabbits, dogs, cats, rats,
mice, and other animals. Accordingly, the term "subject" or
"patient" as used herein means any mammalian patient or subject to
which the or stem cells of the invention can be administered.
Subjects of the present invention include those that have been
exposed to one or more chemical toxins, including, for example, a
nerve toxin.
[0101] "Sternness" refers to the relative ability of any cell to
act in a stem cell-like manner, i.e., the degree of toti-, pluri-,
or oligo-potency and expanded or indefinite self-renewal that any
particular stem cell may have.
Nucleases
[0102] Described herein are compositions, particularly nucleases,
that are useful for in vivo cleavage of a donor molecule carrying a
transgene and nucleases for cleavage of the genome of a cell such
that the transgene is integrated into the genome in a targeted
manner. In certain embodiments, one or more of the nucleases are
naturally occurring. In other embodiments, one or more of the
nucleases are non-naturally occurring, i.e., engineered in the
DNA-binding domain and/or cleavage domain. For example, the
DNA-binding domain of a naturally-occurring nuclease may be altered
to bind to a selected target site (e.g., a meganuclease that has
been engineered to bind to site different than the cognate binding
site). In other embodiments, the nuclease comprises heterologous
DNA-binding and cleavage domains (e.g., zinc finger nucleases;
TAL-effector domain DNA binding proteins; meganuclease DNA-binding
domains with heterologous cleavage domains).
[0103] A. DNA-Binding Domains
[0104] In certain embodiments, the DNA binding domain of one or
more of the nucleases used for in vivo cleavage and/or targeted
cleavage of the genome of a cell comprises a zinc finger protein.
Preferably, the zinc finger protein is non-naturally occurring in
that it is engineered to bind to a target site of choice. See, for
example, See, for example, Beerli et al. (2002) Nature Biotechnol.
20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340;
Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al.
(2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr.
Opin. Struct. Biol. 10:411-416; U.S. Pat. Nos. 6,453,242;
6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136;
7,067,317; 7,262,054; 7,070,934; 7,361,635 and 7,253,273; and U.S.
Patent Publication Nos. 2005/0064474; 2007/0218528 and
2005/0267061, all incorporated herein by reference in their
entireties.
[0105] An engineered zinc finger binding domain can have a novel
binding specificity, compared to a naturally-occurring zinc finger
protein. Engineering methods include, but are not limited to,
rational design and various types of selection. Rational design
includes, for example, using databases comprising triplet (or
quadruplet) nucleotide sequences and individual zinc finger amino
acid sequences, in which each triplet or quadruplet nucleotide
sequence is associated with one or more amino acid sequences of
zinc fingers which bind the particular triplet or quadruplet
sequence. See, for example, co-owned U.S. Pat. Nos. 6,453,242 and
6,534,261, incorporated by reference herein in their
entireties.
[0106] Exemplary selection methods, including phage display and
two-hybrid systems, are disclosed in U.S. Pat. Nos. 5,789,538;
5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759
and 6,242,568; as well as International Patent Publication Nos. WO
98/37186; WO 98/53057; WO 00/27878 and WO 01/88197 and GB Patent
No. 2,338,237. In addition, enhancement of binding specificity for
zinc finger binding domains has been described, for example, in
co-owned International Patent Publication No. WO 02/077227.
[0107] In addition, as disclosed in these and other references,
zinc finger domains and/or multi-fingered zinc finger proteins may
be linked together using any suitable linker sequences, including
for example, linkers of 5 or more amino acids in length. See, also,
U.S. Pat. Nos. 6,479,626; 6,903,185 and 7,153,949 for exemplary
linker sequences 6 or more amino acids in length. The proteins
described herein may include any combination of suitable linkers
between the individual zinc fingers of the protein.
[0108] Selection of target sites; ZFPs and methods for design and
construction of fusion proteins (and polynucleotides encoding same)
are known to those of skill in the art and described in detail in
U.S. Pat. Nos. 6,140,081; 5,789,538; 6,453,242; 6,534,261;
5,925,523; 6,007,988; 6,013,453 and 6,200,759; International Patent
Publication Nos. WO 95/19431; WO 96/06166; WO 98/53057; WO
98/54311; WO 00/27878; WO 01/60970; WO 01/88197; WO 02/099084; WO
98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO
03/016496.
[0109] Nearly any linker (spacer) may be used between one or more
of the components of the DNA-binding domain (e.g., zinc fingers),
between one or more DNA-binding domains and/or between the
DNA-binding domain and the functional domain (e.g., nuclease).
Non-limiting examples of suitable linker sequences include U.S.
Pat. Nos. 8,772,453; 7,888,121; 6,479,626; 6,903,185; and
7,153,949; and U.S. Patent Publication Nos. 2009/0305419;
2015/0064789 and 2015/0132269. Thus, the proteins described herein
may include any combination of suitable linkers between the
individual DNA-binding components and/or between the DNA-binding
domain and the functional domain of the compositions described
herein.
[0110] B. Cleavage Domains
[0111] Any suitable cleavage domain can be operatively linked to
the DNA-binding domains as described herein to form a nuclease. The
cleavage domain may be heterologous to the DNA-binding domain, for
example a zinc finger DNA-binding domain and a cleavage domain from
a nuclease. Heterologous cleavage domains can be obtained from any
endonuclease or exonuclease. Exemplary endonucleases from which a
cleavage domain can be derived include, but are not limited to,
restriction endonucleases and homing endonucleases. See, for
example, 2002-2003 Catalogue, New England Biolabs, Beverly, Mass.;
and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388.
Additional enzymes which cleave DNA are known (e.g., S1 Nuclease;
mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast
HO endonuclease; see also Linn et al. (eds.) Nucleases, Cold Spring
Harbor Laboratory Press, 1993). One or more of these enzymes (or
functional fragments thereof) can be used as a source of cleavage
domains and cleavage half-domains.
[0112] Similarly, a cleavage half-domain can be derived from any
nuclease or portion thereof as set forth above, that requires
dimerization for cleavage activity. In general, two fusion proteins
are required for cleavage if the fusion proteins comprise cleavage
half-domains. Alternatively, a single protein comprising two
cleavage half-domains can be used. The two cleavage half-domains
can be derived from the same endonuclease (or functional fragments
thereof), or each cleavage half-domain can be derived from a
different endonuclease (or functional fragments thereof). In
addition, the target sites for the two fusion proteins are
preferably disposed, with respect to each other, such that binding
of the two fusion proteins to their respective target sites places
the cleavage half-domains in a spatial orientation to each other
that allows the cleavage half-domains to form a functional cleavage
domain, e.g., by dimerizing. Thus, in certain embodiments, the near
edges of the target sites are separated by 5-8 nucleotides or by
15-18 nucleotides. However any integral number of nucleotides or
nucleotide pairs can intervene between two target sites (e.g., from
2 to 50 nucleotide pairs or more). In general, the site of cleavage
lies between the target sites.
[0113] Restriction endonucleases (restriction enzymes) are present
in many species and are capable of sequence-specific binding to DNA
(at a recognition site), and cleaving DNA at or near the site of
binding. Certain restriction enzymes (e.g., Type IIS) cleave DNA at
sites removed from the recognition site and have separable binding
and cleavage domains. For example, the Type IS enzyme FokI
catalyzes double-stranded cleavage of DNA, at 9 nucleotides from
its recognition site on one strand and 13 nucleotides from its
recognition site on the other. See, for example, U.S. Pat. Nos.
5,356,802; 5,436,150 and 5,487,994; as well as Li et al. (1992)
Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc.
Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl.
Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem.
269:31,978-31,982. Thus, in one embodiment, fusion proteins
comprise the cleavage domain (or cleavage half-domain) from at
least one Type IIS restriction enzyme and one or more zinc finger
binding domains, which may or may not be engineered.
[0114] An exemplary Type IIS restriction enzyme, whose cleavage
domain is separable from the binding domain, is FokI. This
particular enzyme is active as a dimer. Bitinaite et al. (1998)
Proc. Natl. Acad. Sci. USA 95:10,570-10,575. Accordingly, for the
purposes of the present disclosure, the portion of the FokI enzyme
used in the disclosed fusion proteins is considered a cleavage
half-domain. Thus, for targeted double-stranded cleavage and/or
targeted replacement of cellular sequences using zinc finger-FokI
fusions, two fusion proteins, each comprising a FokI cleavage
half-domain, can be used to reconstitute a catalytically active
cleavage domain. Alternatively, a single polypeptide molecule
containing a zinc finger binding domain and two FokI cleavage
half-domains can also be used. Parameters for targeted cleavage and
targeted sequence alteration using zinc finger-FokI fusions are
provided elsewhere in this disclosure.
[0115] A cleavage domain or cleavage half-domain can be any portion
of a protein that retains cleavage activity, or that retains the
ability to multimerize (e.g., dimerize) to form a functional
cleavage domain.
[0116] Exemplary Type IIS restriction enzymes are described in U.S.
Pat. No. 7,888,121 incorporated herein in its entirety. Additional
restriction enzymes also contain separable binding and cleavage
domains, and these are contemplated by the present disclosure. See,
for example, Roberts et al. (2003) Nucleic Acids Res.
31:418-420.
[0117] In certain embodiments, the cleavage domain comprises one or
more engineered cleavage half-domain (also referred to as
dimerization domain mutants) that minimize or prevent
homodimerization, as described, for example, in See, e.g., U.S.
Pat. Nos. 7,914,796; 8,034,598 and 8,623,618, the disclosures of
all of which are incorporated by reference in their entireties
herein. Amino acid residues at positions 446, 447, 479, 483, 484,
486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 of
FokI are all targets for influencing dimerization of the FokI
cleavage half-domains.
[0118] Exemplary engineered cleavage half-domains of FokI that form
obligate heterodimers include a pair in which a first cleavage
half-domain includes mutations at amino acid residues at positions
490 and 538 of FokI and a second cleavage half-domain includes
mutations at amino acid residues 486 and 499.
[0119] Thus, in one embodiment, a mutation at 490 replaces Glu (E)
with Lys (K); the mutation at 538 replaces Iso (1) with Lys (K);
the mutation at 486 replaced Gln (Q) with Glu (E); and the mutation
at position 499 replaces Iso (I) with Lys (K). Specifically, the
engineered cleavage half-domains described herein were prepared by
mutating positions 490 (E.fwdarw.K) and 538 (I.fwdarw.K) in one
cleavage half-domain to produce an engineered cleavage half-domain
designated "E490K:I538K" and by mutating positions 486 (Q.fwdarw.E)
and 499 (I.fwdarw.L) in another cleavage half-domain to produce an
engineered cleavage half-domain designated "Q486E:I499L". The
engineered cleavage half-domains described herein are obligate
heterodimer mutants in which aberrant cleavage is minimized or
abolished. See, e.g., U.S. Patent Publication No. 2008/0131962, the
disclosure of which is incorporated by reference in its entirety
for all purposes. In certain embodiments, the engineered cleavage
half-domain comprises mutations at positions 486, 499 and 496
(numbered relative to wild-type FokI), for instance mutations that
replace the wild type Gln (Q) residue at position 486 with a Glu
(E) residue, the wild type Iso (I) residue at position 499 with a
Leu (L) residue and the wild-type Asn (N) residue at position 496
with an Asp (D) or Glu (E) residue (also referred to as a "ELD" and
"ELE" domains, respectively). In other embodiments, the engineered
cleavage half-domain comprises mutations at positions 490, 538 and
537 (numbered relative to wild-type FokI), for instance mutations
that replace the wild type Glu (E) residue at position 490 with a
Lys (K) residue, the wild type Iso (1) residue at position 538 with
a Lys (K) residue, and the wild-type His (H) residue at position
537 with a Lys (K) residue or a Arg (R) residue (also referred to
as "KKK" and "KKR" domains, respectively). In other embodiments,
the engineered cleavage half-domain comprises mutations at
positions 490 and 537 (numbered relative to wild-type FokI), for
instance mutations that replace the wild type Glu (E) residue at
position 490 with a Lys (K) residue and the wild-type His (H)
residue at position 537 with a Lys (K) residue or a Arg (R) residue
(also referred to as "KIK" and "KIR" domains, respectively. See,
e.g., U.S. Pat. Nos. 7,914,796; 8,034,598 and 8,623,618. In other
embodiments, the engineered cleavage half domain comprises the
"Sharkey" and/or "Sharkey mutations" (see Guo et al. (2010) J. Mol.
Biol. 400(l):96-107).
[0120] Engineered cleavage half-domains described herein can be
prepared using any suitable method, for example, by site-directed
mutagenesis of wild-type cleavage half-domains (FokI) as described
in U.S. Pat. Nos. 7,888,121; 7,914,796; 8,034,598 and
8,623,618.
[0121] Alternatively, nucleases may be assembled in vivo at the
nucleic acid target site using so-called "split-enzyme" technology
(see, e.g. U.S. Patent Publication No. 2009/0068164). Components of
such split enzymes may be expressed either on separate expression
constructs, or can be linked in one open reading frame where the
individual components are separated, for example, by a
self-cleaving 2A peptide or IRES sequence. Components may be
individual zinc finger binding domains or domains of a meganuclease
nucleic acid binding domain.
[0122] Nucleases can be screened for activity prior to use, for
example in a yeast-based chromosomal system as described in
International Patent Publication No. WO 2009/042163 and U.S. Patent
Publication No. 2009/0068164. Expression of the nuclease may be
under the control of a constitutive promoter or an inducible
promoter, for example the galactokinase promoter which is activated
(de-repressed) in the presence of raffinose and/or galactose and
repressed in presence of glucose.
[0123] The nuclease(s) as described herein may make one or more
double-stranded and/or single-stranded cuts in the target site. In
certain embodiments, the nuclease comprises a catalytically
inactive cleavage domain (e.g., FokI and/or Cas protein). See,
e.g., U.S. Pat. Nos. 9,200,266 and 8,703,489 and Guillinger et al.
(2014) Nature Biotech. 32(6):577-582. The catalytically inactive
cleavage domain may, in combination with a catalytically active
domain act as a nickase to make a single-stranded cut. Therefore,
two nickases can be used in combination to make a double-stranded
cut in a specific region. Additional nickases are also known in the
art, for example, McCaffery et al. (2016) Nucleic Acids Res.
44(2):e11. doi: 10.1093/nar/gkv878. Epub 2015 Oct. 19.
Target Sites
[0124] As described in detail above, DNA domains can be engineered
to bind to any sequence of choice. An engineered DNA-binding domain
can have a novel binding specificity, compared to a
naturally-occurring DNA-binding domain. In certain embodiments, the
DNA-binding domains bind to a sequence within a BCL11A enhancer
sequence, for example a target site (typically 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21 or even more base pairs) is between
exon 2 and exon 3 of BCL11A, including DNA-binding domains that
bind to a sequence within a DNAseI hypersensitive site in the
BCL11A enhancer sequence (e.g., +58) as shown in Table 1.
Engineering methods include, but are not limited to, rational
design and various types of selection. Rational design includes,
for example, using databases comprising triplet (or quadruplet)
nucleotide sequences and individual zinc finger amino acid
sequences, in which each triplet or quadruplet nucleotide sequence
is associated with one or more amino acid sequences of zinc fingers
which bind the particular triplet or quadruplet sequence. See, for
example, co-owned U.S. Pat. Nos. 6,453,242 and 6,534,261,
incorporated by reference herein in their entireties. Rational
design of TAL-effector domains can also be performed. See, e.g.,
U.S. Patent Publication No. 2011/0301073.
[0125] Exemplary selection methods applicable to DNA-binding
domains, including phage display and two-hybrid systems, are
disclosed in U.S. Pat. Nos. 5,789,538; 5,925,523; 6,007,988;
6,013,453; 6,410,248; 6,140,466; 6,200,759 and 6,242,568; as well
as International Patent Publication Nos. WO 98/37186; WO 98/53057;
WO 00/27878 and WO 01/88197 and GB 2,338,237. In addition,
enhancement of binding specificity for zinc finger binding domains
has been described, for example, in co-owned International Patent
Publication No. WO 02/077227.
[0126] Selection of target sites; nucleases and methods for design
and construction of fusion proteins (and polynucleotides encoding
same) are known to those of skill in the art and described in
detail in U.S. Patent Publication Nos. 2005/0064474 and
2006/0188987, incorporated by reference in their entireties
herein.
[0127] In addition, as disclosed in these and other references,
DNA-binding domains (e.g., multi-fingered zinc finger proteins)
and/or fusions of DNA-binding domain(s) and functional domain(s)
may be linked together using any suitable linker sequences,
including for example, linkers of 5 or more amino acids. U.S. Pat.
Nos. 8,772,453; 7,888,121 (e.g., "ZC" linker); U.S. Pat. Nos.
6,479,626; 6,903,185; and 7,153,949; U.S. Patent Publication Nos.
2009/0305419) and 2015/0064789. The proteins described herein may
include any combination of suitable linkers between the individual
DNA-binding domains of the protein. See, also, U.S. Pat. No.
8,586,526.
Donors
[0128] In certain embodiments, the present disclosure relates to
nuclease-mediated targeted integration of an exogenous sequence
into the genome of a cell using the BCL11A enhancer region-binding
molecules described herein. As noted above, insertion of an
exogenous sequence (also called a "donor sequence" or "donor" or
"transgene"), for example for deletion of a specified region and/or
correction of a mutant gene or for increased expression of a
wild-type gene. It will be readily apparent that the donor sequence
is typically not identical to the genomic sequence where it is
placed. A donor sequence can contain a non-homologous sequence
flanked by two regions of homology to allow for efficient HDR at
the location of interest or can be integrated via non-homology
directed repair mechanisms. Additionally, donor sequences can
comprise a vector molecule containing sequences that are not
homologous to the region of interest in cellular chromatin. A donor
molecule can contain several, discontinuous regions of homology to
cellular chromatin, and, for example, lead to a deletion of a
Bcl11a enhancer region (or a fragment thereof) when used as a
substrate for repair of a DBS induced by one of the nucleases
described here. Further, for targeted insertion of sequences not
normally present in a region of interest, said sequences can be
present in a donor nucleic acid molecule and flanked by regions of
homology to sequence in the region of interest.
[0129] Polynucleotides for insertion can also be referred to as
"exogenous" polynucleotides, "donor" polynucleotides or molecules
or "transgenes." The donor polynucleotide can be DNA or RNA,
single-stranded and/or double-stranded and can be introduced into a
cell in linear or circular form. See, e.g., U.S. Patent Publication
Nos. 2010/0047805 and 2011/0207221. The donor sequence(s) are
preferably contained within a DNA MC, which may be introduced into
the cell in circular or linear form. If introduced in linear form,
the ends of the donor sequence can be protected (e.g., from
exonucleolytic degradation) by methods known to those of skill in
the art. For example, one or more dideoxynucleotide residues are
added to the 3' terminus of a linear molecule and/or
self-complementary oligonucleotides are ligated to one or both
ends. See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci.
USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889.
Additional methods for protecting exogenous polynucleotides from
degradation include, but are not limited to, addition of terminal
amino group(s) and the use of modified internucleotide linkages
such as, for example, phosphorothioates, phosphoramidates, and
O-methyl ribose or deoxyribose residues. If introduced in
double-stranded form, the donor may include one or more nuclease
target sites, for example, nuclease target sites flanking the
transgene to be integrated into the cell's genome. See, e.g., U.S.
Patent Publication No. 2013/0326645.
[0130] A polynucleotide can be introduced into a cell as part of a
vector molecule having additional sequences such as, for example,
replication origins, promoters and genes encoding antibiotic
resistance. Moreover, donor polynucleotides can be introduced as
naked nucleic acid, as nucleic acid complexed with an agent such as
a liposome or poloxamer, or can be delivered by viruses (e.g.,
adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase
defective lentivirus (IDLV)).
[0131] In certain embodiments, the double-stranded donor includes
sequences (e.g., coding sequences, also referred to as transgenes)
greater than 1 kb in length, for example between 2 and 200 kb,
between 2 and 10 kb (or any value therebetween). The
double-stranded donor also includes at least one nuclease target
site, for example. In certain embodiments, the donor includes at
least 2 target sites, for example for a pair of ZFNs or TALENs.
Typically, the nuclease target sites are outside the transgene
sequences, for example, 5' and/or 3' to the transgene sequences,
for cleavage of the transgene. The nuclease cleavage site(s) may be
for any nuclease(s). In certain embodiments, the nuclease target
site(s) contained in the double-stranded donor are for the same
nuclease(s) used to cleave the endogenous target into which the
cleaved donor is integrated via homology-independent methods.
[0132] The donor is generally inserted so that its expression is
driven by the endogenous promoter at the integration site, namely
the promoter that drives expression of the endogenous gene into
which the donor is inserted (e.g., globin, AAVS1, etc.). However,
it will be apparent that the donor may comprise a promoter and/or
enhancer, for example a constitutive promoter or an inducible or
tissue specific promoter.
[0133] The donor molecule may be inserted into an endogenous gene
such that all, some or none of the endogenous gene is expressed. In
other embodiments, the transgene (e.g., with or without globin
encoding sequences) is integrated into any endogenous locus, for
example a safe-harbor locus. See, e.g., U.S. Patent Publication
Nos. 2008/0299580; 2008/0159996 and 2010/00218264.
[0134] Furthermore, although not required for expression, exogenous
sequences may also include transcriptional or translational
regulatory sequences, for example, promoters, enhancers,
insulators, internal ribosome entry sites, sequences encoding 2A
peptides and/or polyadenylation signals.
[0135] The transgenes carried on the donor sequences described
herein may be isolated from plasmids, cells or other sources using
standard techniques known in the art such as PCR. Donors for use
can include varying types of topology, including circular
supercoiled, circular relaxed, linear and the like. Alternatively,
they may be chemically synthesized using standard oligonucleotide
synthesis techniques. In addition, donors may be methylated or lack
methylation. Donors may be in the form of bacterial or yeast
artificial chromosomes (BACs or YACs).
[0136] The double-stranded donor polynucleotides described herein
may include one or more non-natural bases and/or backbones. In
particular, insertion of a donor molecule with methylated cytosines
may be carried out using the methods described herein to achieve a
state of transcriptional quiescence in a region of interest.
[0137] The exogenous (donor) polynucleotide may comprise any
sequence of interest (exogenous sequence). Exemplary exogenous
sequences include, but are not limited to any polypeptide coding
sequence (e.g., cDNAs), promoter sequences, enhancer sequences,
epitope tags, marker genes, cleavage enzyme recognition sites and
various types of expression constructs. Marker genes include, but
are not limited to, sequences encoding proteins that mediate
antibiotic resistance (e.g., ampicillin resistance, neomycin
resistance, G418 resistance, puromycin resistance), sequences
encoding colored or fluorescent or luminescent proteins (e.g.,
green fluorescent protein, enhanced green fluorescent protein, red
fluorescent protein, luciferase), and proteins which mediate
enhanced cell growth and/or gene amplification (e.g., dihydrofolate
reductase). Epitope tags include, for example, one or more copies
of FLAG, His, myc, Tap, HA or any detectable amino acid
sequence.
[0138] In a preferred embodiment, the exogenous sequence
(transgene) comprises a polynucleotide encoding any polypeptide of
which expression in the cell is desired, including, but not limited
to antibodies, antigens, enzymes, receptors (cell surface or
nuclear), hormones, lymphokines, cytokines, reporter polypeptides,
growth factors, and functional fragments of any of the above. The
coding sequences may be, for example, cDNAs.
[0139] For example, the exogenous sequence may comprise a sequence
encoding a polypeptide that is lacking or non-functional in the
subject having a genetic disease, including but not limited to any
of the following genetic diseases: achondroplasia, achromatopsia,
acid maltase deficiency, adenosine deaminase deficiency (OMIM No.
102700), adrenoleukodystrophy, aicardi syndrome, alpha-1
antitrypsin deficiency, alpha-thalassemia, androgen insensitivity
syndrome, apert syndrome, arrhythmogenic right ventricular,
dysplasia, ataxia telangictasia, barth syndrome, beta-thalassemia,
blue rubber bleb nevus syndrome, canavan disease, chronic
granulomatous diseases (CGD), cri du chat syndrome, cystic
fibrosis, dercum's disease, ectodermal dysplasia, fanconi anemia,
fibrodysplasiaossificans progressive, fragile X syndrome,
galactosemis, Gaucher's disease, generalized gangliosidoses (e.g.,
GMI), hemochromatosis, the hemoglobin C mutation in the 6.sup.th
codon of beta-globin (HbC), hemophilia, Huntington's disease,
Hurler Syndrome, hypophosphatasia, Klinefleter syndrome, Krabbes
Disease, Langer-Giedion Syndrome, leukocyte adhesion deficiency
(LAD, OMIM No. 116920), leukodystrophy, long QT syndrome, Marfan
syndrome, Moebius syndrome, mucopolysaccharidosis (MPS), nail
patella syndrome, nephrogenic diabetes insipdius,
neurofibromatosis, Neimann-Pick disease, osteogenesis imperfecta,
porphyria, Prader-Willi syndrome, progeria, Proteus syndrome,
retinoblastoma, Rett syndrome, Rubinstein-Taybi syndrome,
Sanfilippo syndrome, severe combined immunodeficiency (SCID),
Shwachman syndrome, sickle cell disease (sickle cell anemia),
Smith-Magenis syndrome, Stickler syndrome, Tay-Sachs disease,
Thrombocytopenia Absent Radius (TAR) syndrome, Treacher Collins
syndrome, trisomy, tuberous sclerosis, Turner's syndrome, urea
cycle disorder, von Hippel-Landau disease, Waardenburg syndrome,
Williams syndrome, Wilson's disease, Wiskott-Aldrich syndrome,
X-linked lymphoproliferative syndrome (XLP, OMIM No. 308240).
[0140] Additional exemplary diseases that can be treated by
targeted integration include acquired immunodeficiencies, lysosomal
storage diseases (e.g., Gaucher's disease, GM1, Fabry disease and
Tay-Sachs disease), mucopolysaccahidosis (e.g. Hunter's disease,
Hurler's disease), hemoglobinopathies (e.g., sickle cell diseases,
HbC, .alpha.-thalassemia, .beta.-thalassemia) and hemophilias.
[0141] In certain embodiments, the exogenous sequences can comprise
a marker gene (described above), allowing selection of cells that
have undergone targeted integration, and a linked sequence encoding
an additional functionality. Non-limiting examples of marker genes
include GFP, drug selection marker(s) and the like.
[0142] Additional gene sequences that can be inserted may include,
for example, wild-type genes to replace mutated sequences. For
example, a wild-type Factor IX gene sequence may be inserted into
the genome of a stem cell in which the endogenous copy of the gene
is mutated. The wild-type copy may be inserted at the endogenous
locus, or may alternatively be targeted to a safe harbor locus.
[0143] Construction of such expression cassettes, following the
teachings of the present specification, utilizes methodologies well
known in the art of molecular biology (see, for example, Ausubel or
Maniatis). Before use of the expression cassette to generate a
transgenic animal, the responsiveness of the expression cassette to
the stress-inducer associated with selected control elements can be
tested by introducing the expression cassette into a suitable cell
line (e.g., primary cells, transformed cells, or immortalized cell
lines).
[0144] Furthermore, although not required for expression, exogenous
sequences may also transcriptional or translational regulatory
sequences, for example, promoters, enhancers, insulators, internal
ribosome entry sites, sequences encoding 2A peptides and/or
polyadenylation signals. Further, the control elements of the genes
of interest can be operably linked to reporter genes to create
chimeric genes (e.g., reporter expression cassettes).
[0145] Targeted insertion of non-coding nucleic acid sequence may
also be achieved. Sequences encoding antisense RNAs, RNAi, shRNAs
and micro RNAs (miRNAs) may also be used for targeted
insertions.
[0146] In additional embodiments, the donor nucleic acid may
comprise non-coding sequences that are specific target sites for
additional nuclease designs. Subsequently, additional nucleases may
be expressed in cells such that the original donor molecule is
cleaved and modified by insertion of another donor molecule of
interest. In this way, reiterative integrations of donor molecules
may be generated allowing for trait stacking at a particular locus
of interest or at a safe harbor locus.
Delivery
[0147] The nucleases as described herein (Table 1), polynucleotides
encoding these nucleases, donor polynucleotides and compositions
comprising the proteins and/or polynucleotides described herein may
be delivered in vivo or ex vivo by any suitable means into any cell
type.
[0148] Suitable cells include eukaryotic (e.g., animal) and
prokaryotic cells and/or cell lines. Non-limiting examples of such
cells or cell lines generated from such cells include COS, CHO
(e.g., CHO--S, CHO-K1, CHO-DG44, CHO-DUXBI1, CHO-DUKX, CHOK1SV),
VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2/0-Ag14, HeLa,
HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), and perC6 cells as
well as insect cells such as Spodopterafugiperda (Sf), or fungal
cells such as Saccharomyces, Pichia and Schizosaccharomyces. In
certain embodiments, the cell line is a CHO, MDCK or HEK293 cell
line. Suitable cells also include stem cells such as, by way of
example, embryonic stem cells, induced pluripotent stem cells,
hematopoietic stem cells, neuronal stem cells and mesenchymal stem
cells.
[0149] Methods of delivering nucleases as described herein are
described, for example, in U.S. Pat. Nos. 6,453,242; 6,503,717;
6,534,261; 6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113;
6,979,539; 7,013,219 and 7,163,824, the disclosures of all of which
are incorporated by reference herein in their entireties.
[0150] Nucleases and/or donor constructs as described herein may
also be delivered using vectors containing sequences encoding one
or more of the ZFN(s), described herein. Any vector systems may be
used including, but not limited to, plasmid vectors, retroviral
vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors;
herpesvirus vectors and adeno-associated virus vectors, etc. See,
also, U.S. Pat. Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113;
6,979,539; 7,013,219 and 7,163,824, incorporated by reference
herein in their entireties. Furthermore, it will be apparent that
any of these vectors may comprise one or more of the sequences
needed for treatment. Thus, when one or more nucleases and a donor
construct are introduced into the cell, the nucleases and/or donor
polynucleotide may be carried on the same vector or on different
vectors (DNA MC(s)). When multiple vectors are used, each vector
may comprise a sequence encoding one or multiple nucleases and/or
donor constructs. Conventional viral and non-viral based gene
transfer methods can be used to introduce nucleic acids encoding
nucleases and/or donor constructs in cells (e.g., mammalian cells)
and target tissues. Non-viral vector delivery systems include DNA
or RNA plasmids, DNA MCs, naked nucleic acid, and nucleic acid
complexed with a delivery vehicle such as a liposome or poloxamer.
Suitable non-viral vectors include nanotaxis vectors, including
vectors commercially available from InCellArt (France). Viral
vector delivery systems include DNA and RNA viruses, which have
either episomal or integrated genomes after delivery to the cell.
For a review of in vivo delivery of engineered DNA-binding proteins
and fusion proteins comprising these binding proteins, see, e.g.,
Rebar (2004) Expert Opinion Invest. Drugs 13(7):829-839; Rossi et
al. (2007) Nature Biotech. 25(12):1444-1454 as well as general gene
delivery references such as Anderson (1992) Science 256:808-813;
Nabel & Felgner (1993) TIBTECH 11:211-217; Mitani & Caskey
(1993) TIBTECH 11:162-166; Dillon (1993) TIBTECH 11:167-175; Miller
(1992) Nature 357:455-460; Van Brunt (1988) Biotechnology
6(10):1149-1154; Vigne (1995) Restorative Neurology and
Neuroscience 8:35-36; Kremer & Perricaudet (1995) British
Medical Bulletin 51(1):31-44; Haddada et al., in Current Topics in
Microbiology and Immunology Doerfler and Bohm (eds.) (1995); and Yu
et al. (1994) Gene Therapy 1:13-26.
[0151] Methods of non-viral delivery of nucleic acids include
electroporation, lipofection, microinjection, biolistics,
virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic
acid conjugates, naked DNA, artificial virions, and agent-enhanced
uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system
(Rich-Mar) can also be used for delivery of nucleic acids.
[0152] Additional exemplary nucleic acid delivery systems include
those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte,
Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston,
Mass.) and Copernicus Therapeutics Inc., (see for example U.S. Pat.
No. 6,008,336). Lipofection is described in e.g., U.S. Pat. Nos.
5,049,386; 4,946,787 and 4,897,355) and lipofection reagents are
sold commercially (e.g., Transfectam.TM. and Lipofectin.TM.).
Cationic and neutral lipids that are suitable for efficient
receptor-recognition lipofection of polynucleotides include those
of Felgner, International Patent Publication Nos. WO 91/17424 and
WO 91/16024.
[0153] The preparation of lipid:nucleic acid complexes, including
targeted liposomes such as immunolipid complexes, is well known to
one of skill in the art (see, e.g., Crystal (1995) Science
270:404-410; Blaese et al. (1995) Cancer Gene Ther. 2:291-297; Behr
et al. (1994) Bioconjugate Chem. 5:382-389; Remy et al. (1994)
Bioconjugate Chem. 5:647-654; Gao et al. (1995) Gene Therapy
2:710-722; Ahmad et al. (1992) Cancer Res. 52:4817-4820; U.S. Pat.
Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054;
4,501,728; 4,774,085; 4,837,028 and 4,946,787).
[0154] Additional methods of delivery include the use of packaging
the nucleic acids to be delivered into EnGeneIC delivery vehicles
(EDVs). These EDVs are specifically delivered to target tissues
using bispecific antibodies where one arm of the antibody has
specificity for the target tissue and the other has specificity for
the EDV. The antibody brings the EDVs to the target cell surface
and then the EDV is brought into the cell by endocytosis. Once in
the cell, the contents are released (see MacDiarmid et al. (2009)
Nature Biotechnology 27(7):643).
[0155] The use of RNA or DNA viral based systems for the delivery
of nucleic acids encoding engineered ZFPs, TALEs and/or CRISPR/Cas
systems take advantage of highly evolved processes for targeting a
virus to specific cells in the body and trafficking the viral
payload to the nucleus. Viral vectors can be administered directly
to patients (in vivo) or they can be used to treat cells in vitro
and the modified cells are administered to patients (ex vivo).
Conventional viral based systems for the delivery of ZFPs include,
but are not limited to, retroviral, lentivirus, adenoviral,
adeno-associated, vaccinia and herpes simplex virus vectors for
gene transfer. Integration in the host genome is possible with the
retrovirus, lentivirus, and adeno-associated virus gene transfer
methods, often resulting in long term expression of the inserted
transgene. Additionally, high transduction efficiencies have been
observed in many different cell types and target tissues.
[0156] The tropism of a retrovirus can be altered by incorporating
foreign envelope proteins, expanding the potential target
population of target cells. Lentiviral vectors are retroviral
vectors that are able to transduce or infect non-dividing cells and
typically produce high viral titers. Selection of a retroviral gene
transfer system depends on the target tissue. Retroviral vectors
are comprised of cis-acting long terminal repeats with packaging
capacity for up to 6-10 kb of foreign sequence. The minimum
cis-acting LTRs are sufficient for replication and packaging of the
vectors, which are then used to integrate the therapeutic gene into
the target cell to provide permanent transgene expression. Widely
used retroviral vectors include those based upon murine leukemia
virus (MuLV), gibbon ape leukemia virus (GaLV), Simian
Immunodeficiency virus (SIV), human immunodeficiency virus (HIV),
and combinations thereof (see, e.g., Buchscher et al. (1992) J.
Virol. 66:2731-2739; Johann et al. (1992) J. Virol. 66:1635-1640;
Sommerfelt et al. (1990) Virol. 176:58-59; Wilson et al. (1989) J.
Virol. 63:2374-2378; Miller et al. (1991) J. Virol. 65:2220-2224;
International Patent Publication No. WO 94/26877).
[0157] In applications in which transient expression is preferred,
adenoviral based systems can be used. Adenoviral based vectors are
capable of very high transduction efficiency in many cell types and
do not require cell division. With such vectors, high titer and
high levels of expression have been obtained. This vector can be
produced in large quantities in a relatively simple system.
Adeno-associated virus ("AAV") vectors are also used to transduce
cells with target nucleic acids, e.g., in the in vitro production
of nucleic acids and peptides, and for in vivo and ex vivo gene
therapy procedures (see, e.g., West et al. (1987) Virology
160:38-47; U.S. Pat. No. 4,797,368; International Patent
Publication No. WO 93/24641; Kotin (1994) Human Gene Therapy
5:793-801; Muzyczka (1994) J. Clin. Invest. 94:1351. Construction
of recombinant AAV vectors are described in a number of
publications, including U.S. Pat. No. 5,173,414; Tratschin et al.
(1985) Mol. Cell. Biol. 5:3251-3260; Tratschin, et al. (1984) Mol.
Cell. Biol. 4:2072-2081; Hermonat & Muzyczka (1984) PNAS
81:6466-6470; and Samulski et al. (1989) J. Virol.
63:03822-3828.
[0158] At least six viral vector approaches are currently available
for gene transfer in clinical trials, which utilize approaches that
involve complementation of defective vectors by genes inserted into
helper cell lines to generate the transducing agent.
[0159] pLASN and MFG-S are examples of retroviral vectors that have
been used in clinical trials (Dunbar et al. (1995) Blood
85:3048-305; Kohn et al. (1995) Nat. Med. 1:1017-102; Malech et al.
(1997) PNAS 94(22):12133-12138). PA317/pLASN was the first
therapeutic vector used in a gene therapy trial. (Blaese et al.
(1995) Science 270:475-480). Transduction efficiencies of 50% or
greater have been observed for MFG-S packaged vectors. (Ellem et
al. (1997) Immunol Immunother. 44(1):10-20; Dranoff et al. (1997)
Hum. Gene Ther. 1:111-2.
[0160] Recombinant adeno-associated virus vectors (rAAV) are a
promising alternative gene delivery systems based on the defective
and nonpathogenic parvovirus adeno-associated type 2 virus. All
vectors are derived from a plasmid that retains only the AAV 145 bp
inverted terminal repeats flanking the transgene expression
cassette. Efficient gene transfer and stable transgene delivery due
to integration into the genomes of the transduced cell are key
features for this vector system. (Wagner et al. (1998) Lancet
351(9117):1702-3, Kearns et al. (1996) Gene Ther. 9:748-55). Other
AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7,
AAV8, AAV9 and AAVrh.10 and any novel AAV serotype can also be used
in accordance with the present invention.
[0161] Replication-deficient recombinant adenoviral vectors (Ad)
can be produced at high titer and readily infect a number of
different cell types. Most adenovirus vectors are engineered such
that a transgene replaces the Ad E1a, E1b, and/or E3 genes;
subsequently the replication defective vector is propagated in
human 293 cells that supply deleted gene function in trans. Ad
vectors can transduce multiple types of tissues in vivo, including
nondividing, differentiated cells such as those found in liver,
kidney and muscle. Conventional Ad vectors have a large carrying
capacity. An example of the use of an Ad vector in a clinical trial
involved polynucleotide therapy for antitumor immunization with
intramuscular injection (Sterman et al. (1998) Hum. Gene Ther.
7:1083-9). Additional examples of the use of adenovirus vectors for
gene transfer in clinical trials include Rosenecker et al. (1996)
Infection 24(1):5-10; Sterman et al. (1998) Hum. Gene Ther.
9(7):1083-1089; Welsh et al. (1995) Hum. Gene Ther. 2:205-18;
Alvarez et al. (1997) Hum. Gene Ther. 5:597-613; Topf et al. (1998)
Gene Ther. 5:507-513; Sterman et al. (1998) Hum. Gene Ther.
7:1083-1089.
[0162] Packaging cells are used to form virus particles that are
capable of infecting a host cell. Such cells include 293 cells,
which package adenovirus, and .psi.2 cells or PA317 cells, which
package retrovirus. Viral vectors used in gene therapy are usually
generated by a producer cell line that packages a nucleic acid
vector into a viral particle. The vectors typically contain the
minimal viral sequences required for packaging and subsequent
integration into a host (if applicable), other viral sequences
being replaced by an expression cassette encoding the protein to be
expressed. The missing viral functions are supplied in trans by the
packaging cell line. For example, AAV vectors used in gene therapy
typically only possess inverted terminal repeat (ITR) sequences
from the AAV genome which are required for packaging and
integration into the host genome. Viral DNA is packaged in a cell
line, which contains a helper plasmid encoding the other AAV genes,
namely rep and cap, but lacking ITR sequences. The cell line is
also infected with adenovirus as a helper. The helper virus
promotes replication of the AAV vector and expression of AAV genes
from the helper plasmid. The helper plasmid is not packaged in
significant amounts due to a lack of ITR sequences. Contamination
with adenovirus can be reduced by, e.g., heat treatment to which
adenovirus is more sensitive than AAV.
[0163] In many gene therapy applications, it is desirable that the
gene therapy vector be delivered with a high degree of specificity
to a particular tissue type. Accordingly, a viral vector can be
modified to have specificity for a given cell type by expressing a
ligand as a fusion protein with a viral coat protein on the outer
surface of the virus. The ligand is chosen to have affinity for a
receptor known to be present on the cell type of interest. For
example, Han et al. (1995) Proc. Natl. Acad. Sci. USA 92:9747-9751,
reported that Moloney murine leukemia virus can be modified to
express human heregulin fused to gp70, and the recombinant virus
infects certain human breast cancer cells expressing human
epidermal growth factor receptor. This principle can be extended to
other virus-target cell pairs, in which the target cell expresses a
receptor and the virus expresses a fusion protein comprising a
ligand for the cell-surface receptor. For example, filamentous
phage can be engineered to display antibody fragments (e.g., FAB or
Fv) having specific binding affinity for virtually any chosen
cellular receptor. Although the above description applies primarily
to viral vectors, the same principles can be applied to nonviral
vectors. Such vectors can be engineered to contain specific uptake
sequences which favor uptake by specific target cells.
[0164] Gene therapy vectors can be delivered in vivo by
administration to an individual patient, typically by systemic
administration (e.g., intravenous, intraperitoneal, intramuscular,
subdermal, or intracranial infusion) or topical application, as
described below. Alternatively, vectors can be delivered to cells
ex vivo, such as cells explanted from an individual patient (e.g.,
lymphocytes, bone marrow aspirates, tissue biopsy) or universal
donor hematopoietic stem cells, followed by reimplantation of the
cells into a patient, usually after selection for cells which have
incorporated the vector.
[0165] Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.)
containing nucleases and/or donor constructs can also be
administered directly to an organism for transduction of cells in
vivo. Alternatively, naked DNA can be administered. Administration
is by any of the routes normally used for introducing a molecule
into ultimate contact with blood or tissue cells including, but not
limited to, injection, infusion, topical application and
electroporation. Suitable methods of administering such nucleic
acids are available and well known to those of skill in the art,
and, although more than one route can be used to administer a
particular composition, a particular route can often provide a more
immediate and more effective reaction than another route.
[0166] Vectors suitable for introduction of polynucleotides (e.g.
nuclease-encoding and/or double-stranded donors) described herein
include non-integrating lentivirus vectors (IDLV). See, for
example, Ory et al. (1996) Proc. Natl. Acad. Sci. USA
93:11382-11388; Dull et al. (1998) J. Virol. 72:8463-8471; Zuffery
et al. (1998) J. Virol. 72:9873-9880; Follenzi et al. (2000) Nature
Genetics 25:217-222; U.S. Patent Publication No 2009/0117617.
[0167] Pharmaceutically acceptable carriers are determined in part
by the particular composition being administered, as well as by the
particular method used to administer the composition. Accordingly,
there is a wide variety of suitable formulations of pharmaceutical
compositions available, as described below (see, e.g., Remington's
Pharmaceutical Sciences, 17th ed., 1989).
[0168] It will be apparent that the nuclease-encoding sequences and
donor constructs can be delivered using the same or different
systems. For example, the nucleases and donors can be carried by
the same DNA MC. Alternatively, a donor polynucleotide can be
carried by a MC, while the one or more nucleases can be carried by
a standard plasmid or AAV vector. Furthermore, the different
vectors can be administered by the same or different routes
(intramuscular injection, tail vein injection, other intravenous
injection, intraperitoneal administration and/or intramuscular
injection. The vectors can be delivered simultaneously or in any
sequential order.
[0169] Thus, the instant disclosure includes in vivo or ex vivo
treatment of diseases and conditions that are amenable to insertion
of a transgenes encoding a therapeutic protein. The compositions
are administered to a human patient in an amount effective to
obtain the desired concentration of the therapeutic polypeptide in
the serum or the target organ or cells. Administration can be by
any means in which the polynucleotides are delivered to the desired
target cells. For example, both in vivo and ex vivo methods are
contemplated. Intravenous injection to the portal vein is a
preferred method of administration. Other in vivo administration
modes include, for example, direct injection into the lobes of the
liver or the biliary duct and intravenous injection distal to the
liver, including through the bepatic artery, direct injection in to
the liver parenchyma, injection via the hepatic artery, and/or
retrograde injection through the biliary tree. Ex vivo modes of
administration include transduction in vitro of resected
hepatocytes or other cells of the liver, followed by infusion of
the transduced, resected hepatocytes back into the portal
vasculature, liver parenchyma or biliary tree of the human patient,
see e.g., Grossman et al. (1994) Nature Genetics 6:335-341.
[0170] The effective amount of nuclease(s) and donor to be
administered will vary from patient to patient and according to the
therapeutic polypeptide of interest. Accordingly, effective amounts
are best determined by the physician administering the compositions
and appropriate dosages can be determined readily by one of
ordinary skill in the art. After allowing sufficient time for
integration and expression (typically 4-15 days, for example),
analysis of the serum or other tissue levels of the therapeutic
polypeptide and comparison to the initial level prior to
administration will determine whether the amount being administered
is too low, within the right range or too high. Suitable regimes
for initial and subsequent administrations are also variable, but
are typified by an initial administration followed by subsequent
administrations if necessary. Subsequent administrations may be
administered at variable intervals, ranging from daily to annually
to every several years. One of skill in the art will appreciate
that appropriate immunosuppressive techniques may be recommended to
avoid inhibition or blockage of transduction by immunosuppression
of the delivery vectors, see e.g., Vilquin et al. (1995) Human Gene
Ther. 6:1391-1401.
[0171] Formulations for both ex vivo and in vivo administrations
include suspensions in liquid or emulsified liquids. The active
ingredients often are mixed with excipients which are
pharmaceutically acceptable and compatible with the active
ingredient. Suitable excipients include, for example, water,
saline, dextrose, glycerol, ethanol or the like, and combinations
thereof. In addition, the composition may contain minor amounts of
auxiliary substances, such as, wetting or emulsifying agents, pH
buffering agents, stabilizing agents or other reagents that enhance
the effectiveness of the pharmaceutical composition.
Cells
[0172] Also described herein are cells and/or cell lines in which
an endogenous BCL11A enhancer sequence is modified by the nucleases
described herein (Table 1). The modification may be, for example,
as compared to the wild-type sequence of the cell. The cell or cell
lines may be heterozygous or homozygous for the modification. The
modifications to the BCL11A sequence may comprise insertions,
deletions and/or combinations thereof.
[0173] The modification is preferably at or near the nuclease(s)
binding and/or cleavage site(s), for example, within 1-300 (or any
value therebetween) base pairs upstream or downstream of the
site(s) of cleavage, more preferably within 1-100 base pairs (or
any value therebetween) of either side of the binding and/or
cleavage site(s), even more preferably within 1 to 50 base pairs
(or any value therebetween) on either side of the binding and/or
cleavage site(s). In certain embodiments, the modification is at or
near the "+58" region of the BCL11A enhancer, for example, at or
near a nuclease binding site shown in any of the first column of
Table 1.
[0174] Any cell or cell line may be modified, for example a stem
cell, for example an embryonic stem cell, an induced pluripotent
stem cell, a hematopoietic stem cell, a neuronal stem cell and a
mesenchymal stem cell. Other non-limiting examples of cells as
described herein include T-cells (e.g., CD4+, CD3+, CD8+, etc.);
dendritic cells; B-cells. A descendent of a stem cell, including a
partially or fully differentiated cell, is also provided (e.g., a
RBC or RBC precursor cell). Non-limiting examples other cell lines
including a modified BCL11A sequence include COS, CHO (e.g.,
CHO--S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO,
MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2/0-Ag14, HeLa,
HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), and perC6 cells as
well as insect cells such as Spodopterafugiperda (Sf), or fungal
cells such as Saccharomyces, Pichia and Schizosaccharomyces.
[0175] The cells as described herein are useful in treating and/or
preventing a disorder, for example, by ex vivo therapies. The
nuclease-modified cells can be expanded and then reintroduced into
the patient using standard techniques. See, e.g., Tebas et al
(2014) New Eng J Med 370(10):901. In the case of stem cells, after
infusion into the subject, in vivo differentiation of these
precursors into cells expressing the functional transgene also
occurs. Pharmaceutical compositions comprising the cells as
described herein are also provided. In addition, the cells may be
cryopreserved prior to administration to a patient.
[0176] Any of the modified cells or cell lines disclosed herein may
show increased expression of gamma globin. Compositions such as
pharmaceutical compositions comprising the genetically modified
cells as described herein are also provided
Applications
[0177] The methods and compositions disclosed herein are for
modifying expression of protein, or correcting an aberrant gene
sequence that encodes a protein expressed in a genetic disease,
such as a sickle cell disease or a thalassemia. Thus, the methods
and compositions provide for the treatment and/or prevention of
such genetic diseases. Genome editing, for example of stem cells,
can be used to correct an aberrant gene, insert a wild type gene,
or change the expression of an endogenous gene. By way of
non-limiting example, a wild type gene, e.g. encoding at least one
globin (e.g., .alpha. and/or .beta. globin), may be inserted into a
cell (e.g., into an endogenous BCL11a enhancer sequence using one
or more nucleases as described herein) to provide the globin
proteins deficient and/or lacking in the cell and thereby treat a
genetic disease, e.g., a hemoglobinopathy, caused by faulty globin
expression. Alternatively or in addition, genomic editing with or
without administration of the appropriate donor, can correct the
faulty endogenous gene, e.g., correcting the point mutation in
.alpha.- or .beta.-hemoglobin, to restore expression of the gene
and/or treat a genetic disease, e.g. sickle cell disease and/or
knock out or alteration (overexpression or repression) of any
direct or indirect globin regulatory gene (e.g. inactivation of the
.gamma. globin-regulating gene BCL11A or the BCL11A-regulator
KLF1). Specifically, the methods and compositions of the invention
have use in the treatment or prevention of hemoglobinopathies.
[0178] The nucleases of the invention are targeted to the BCL11A
enhancer region, known to be required for the expression of BCL11A,
and hence the down regulation of gamma globin expression.
Modification of this enhancer region may result in erythrocytes
with increased gamma globin expression, and thus may be helpful for
the treatment or prevention of sickle cell disease or beta
thalassemia.
[0179] The following Examples relate to exemplary embodiments of
the present disclosure in which the nuclease comprises a zinc
finger nuclease (ZFN). It will be appreciated that this is for
purposes of exemplification only and that other nucleases can be
used, for example TtAgo and CRISPR/Cas systems, homing
endonucleases (meganucleases) with engineered DNA-binding domains
and/or fusions of naturally occurring of engineered homing
endonucleases (meganucleases) DNA-binding domains and heterologous
cleavage domains and/or fusions of meganucleases and TALE
proteins.
EXAMPLES
Example 1: Assembly of Zinc Finger Nucleases
[0180] ZFNs were assembled against the human BCL11A gene and were
tested by CEL1 assays as described in Miller et al. (2007) Nat.
Biotechnol. 25:778-785. ZFNs specific for the +58 region of the
enhancer region were made as described. The nucleases are shown
below in Table 1:
TABLE-US-00002 TABLE 1 ZFN pairs specific for +58 BCL11A enhancer
region SBS # (target site, Design 5'-3') F1 F2 F3 F4 F5 F6 Left
partner 46801 DQSNLRA RPYTLRL SGYNLEN TSGSLTR DQSNLRA AQCCLFH
aaAGCAACtG (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID
TTAGCTTGCA NO: 2) NO: 3) NO: 4) NO: 5) NO: 2) NO: 6) Ctagacta (SEQ
ID NO: 1) 51446 STGNLTN TSGSLTR DQSNLRA AQCCLFH N/A N/A aaAGCAACtG
(SEQ ID (SEQ ID (SEQ ID (SEQ ID TTAGCttgca NO: 7) NO: 5) NO: 2) NO:
6) ctagacta (SEQ ID NO: 1) 51463 STGNLTN TSGSLTR DQSNLRA AQCCLFH
N/A N/A aaAGCAACtG (SEQ ID (SEQ ID (SEQ ID (SEQ ID TTAGCttgca NO:
7) NO: 5) NO: 2) NO: 6) ctagacta (SEQ ID NO: 1) 51484 DQSNLRA
RPYTLRL SRGALKT TSGSLTR DQSNLRA AQCCLFH aaAGCAACtG (SEQ ID (SEQ ID
(SEQ ID (SEQ ID (SEQ ID (SEQ ID TTAGCTTGCA NO: 2) NO: 3) NO: 8) NO:
5) NO: 2) NO: 6) Ctagacta (SEQ ID NO: 1) 51856 DQSNLRA RNFSLTM
SNGNLRN TSGSLTR DQSNLRA AQCCLFH aaAGCAACtG (SEQ ID (SEQ ID (SEQ ID
(SEQ ID (SEQ ID (SEQ ID TTAGCTTGCA NO: 2) NO: 9) NO: 10) NO: 5) NO:
2) NO: 6) Ctagacta (SEQ ID NO: 1) 51857 DQSNLRA RNFSLTM STGNLTN
TSGSLTR DQSNLRA AQCCLFH aaAGCAACtG (SEQ ID (SEQ ID (SEQ ID (SEQ ID
(SEQ ID (SEQ ID TTAGCTTGCA NO: 2) NO: 9) NO: 7) NO: 5) NO: 2) NO:
6) Ctagacta (SEQ ID NO: 1) 51862 DQSNLRA RNFSLTM SSYNLAN TSGSLTR
DQSNLRA AQCCLFH aaAGCAACtG (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID
(SEQ ID TTAGCTTGCA NO: 2) NO: 9) NO: 11) NO: 5) NO: 2) NO: 6)
Ctagacta (SEQ ID NO: 1) 51477 DQSNLRA RPYTLRL SSSNLTN TSGSLTR
DQSNLRA AQCCLFH aaAGCAACtG (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID
(SEQ ID TTAGCTTGCA NO: 2) NO: 3) NO: 26) NO: 5) NO: 2) NO: 6)
Ctagacta (SEQ ID NO: 1) 51478 DQSNLRA RPYTLRL SSSNLGN TSGSLTR
DQSNLRA AQCCLFH aaAGCAACtG (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID
(SEQ ID TTAGCTTGCA NO: 2) NO: 3) NO: 27) NO: 5) NO: 2) NO: 6)
Ctagacta (SEQ ID NO: 1) 51487 DQSNLRA RPYTLRL SRSALRV TSGSLTR
DQSNLRA AQCCLFH aaAGCAACtG (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID
(SEQ ID TTAGCTTGCA NO: 2) NO: 3) NO: 28) NO: 5) NO: 2) NO: 6)
Ctagacta (SEQ ID NO: 1) Right Partner 47923 RSDHLTQ QSGHLAR QKGTLGE
QSSDLSR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ
ID AGGAAGGgtt NO: 13) NO: 14) NO: 15) NO: 16) NO: 17) tggcctct (SEQ
ID NO: 12) 51536 RSDHLTQ QSGHLAR QKGTLGE RHRDLSR RRDNLHS N/A
caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO:
13) NO: 14) NO: 15) NO: 18) NO: 17) tggcctct (SEQ ID NO: 12) 51949
RNDHRTT QKAHLIR QKGTLGE RGRDLSR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ
ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO: 19) NO: 20) NO: 15) NO:
21) NO: 17) tggcctct (SEQ ID NO: 12) 51990 RSDHLTQ QRAHLTR QKGTLGE
HRNTLVR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ
ID AGGAAGGgtt NO: 13) NO: 22) NO: 15) NO: 23) NO: 17) tggcctct (SEQ
ID NO: 12) 51993 RSDHLTQ QRAHLTR QSGTRNH HRNTLVR RRDNLHS N/A
caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO:
13) NO: 22) NO: 24) NO: 23) NO: 17) tggcctct (SEQ ID NO: 12) 51979
RSDHLTQ QKAHLIR QKGTLGE RGRDLSR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ
ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO: 13) NO: 20) NO: 15) NO:
21) NO: 17) tggcctct (SEQ ID NO: 12) 51982 RSDHLTQ QKAHLIR QSGTRNH
RGRDLSR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ
ID AGGAAGGgtt NO: 13) NO: 20) NO: 24) NO: 21) NO: 17) tggcctct (SEQ
ID NO: 12) 52015 RNDHRTT QKAHLIR QKGTLGE LKRTLKR RRDNLHS N/A
caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO:
19) NO: 20) NO: 15) NO: 25) NO: 17) tggcctct (SEQ ID NO: 12) 52032
RSDHLTQ QSGHLAR QSGTRNH QSSDLSR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ
ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO: 13) NO: 14) NO: 24) NO:
16) NO: 17) tggcctct (SEQ ID NO: 12) 51541 RSDHLTQ QSGHLAR QKGTLGE
RHRDLSR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ
ID AGGAAGGgtt NO: 13) NO: 14) NO: 15) NO: 18) NO: 17) tggcctct (SEQ
ID NO: 12) 51519 RSDHLTQ QSGHLAR QSGTRNH QSSDLSR RRDNLHS N/A
caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO:
13) NO: 14) NO: 24) NO: 16) NO: 17) tggcctct (SEQ ID NO: 12) 51534
RSDHLTQ QSGHLAR QKGTLGE RGRDLSR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ
ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO: 13) NO: 14) NO: 15) NO:
21) NO: 17) tggcctct (SEQ ID NO: 12) 51535 RSDHLTQ QSGHLAR QKGTLGE
RSRDLTR RRDNLHS N/A caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ
ID AGGAAGGgtt NO: 13) NO: 14) NO: 15) NO: 29) NO: 17) tggcctct (SEQ
ID NO: 12) 51556 RSDHLTQ QSGHLAR QKGTLGE FRQTRAR RRDNLHS N/A
caCAGGCTCC (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID AGGAAGGgtt NO:
13) NO: 14) NO: 15) NO: 30) NO: 17) tggcctct (SEQ ID NO: 12) *51446
and 51463 differ in linker sequences
[0181] All ZFNs were tested for functionality (cleavage activity)
and found to be active.
Example 2: Activity of ZFN in Human K562 Cells
[0182] Briefly, human K562 cells were cultured in RPMI supplemented
with 10% FBS and 200,000 cells were transfected with a suboptimal
concentration of 25 ng of each of the plasmid DNA encoding the left
and right ZFN partners by Amaxa Nucleofector.RTM. following the
manufacturer's instructions (Table 2a). In addition, the
experiments were performed with 25 ng of the left ZFN and 5 ng of
the right ZFN (Table 2b). The Cel-I assay (Surveyor.TM.,
Transgenomics) as described in Perez et al. (2008) Nat. Biotechnol.
26:808-816 and Guschin et al. (2010) Methods Mol Biol. 649:247-56),
was used to detect ZFN-induced modifications of the target gene two
or three days after transfection. In this assay, PCR-amplification
of the target site was followed by quantification of insertions
and/or deletions ("indels") by sequencing. Deep sequencing on the
Illumina platform ("miSEQ") was used according to the
manufacturer's instructions to measure editing efficiency as well
as nature of editing-generated alleles. The results are shown below
in Table 2, where the numbers indicate the percent NHEJ activity
observed:
TABLE-US-00003 TABLE 2a Matrix screen in K562 cells (25 ng each
ZFN) 51949 51977 51979 51982 51990 51993 52015 52032 ave. 51856
22.2 21.0 27.7 23.2 21.0 23.9 17.0 26.7 22.8 51857 28.5 24.4 29.4
28.1 26.7 23.9 19.2 32.8 26.6 51862 15.9 16.3 15.5 15.3 11.7 20.8
13.9 22.4 16.5 51877 12.0 13.2 12.4 13.9 10.7 11.3 9.1 13.8 12.1
51879 14.2 15.1 14.9 13.8 12.0 14.4 10.8 16.8 14.0 average 18.6
18.0 20.0 18.8 16.4 18.9 14.0 22.5 46801: 47923 9.3
TABLE-US-00004 TABLE 2b Matrix screen in K562 cells (25 ng left
ZFN, 5 ng right ZFN) 51949 51977 51979 51982 51990 51993 52015
52032 ave 51856 10.9 12.6 16.9 13.4 11.0 12.4 8.5 15.5 12.7 51857
15.7 12.8 15.2 14.1 12.5 14.4 11.8 14.5 13.9 51862 13.0 11.4 13.9
10.4 14.3 12.2 12.2 14.3 12.7 51877 8.2 7.2 8.8 6.7 8.2 7.1 7.0 6.9
7.5 51879 8.5 7.9 11.5 8.3 8.4 7.1 4.9 11.2 8.5 average 11.3 10.4
13.3 10.6 10.9 10.6 8.9 12.5 46801: 47923 7.3
[0183] The ZFNs were also constructed using four different linkers
between the DNA binding domain and the nuclease domain (see U.S.
Patent Publication No. 2015/0064789). The linker sequences tested
are shown below, where the `HTKIH` portion of the sequence is the
carboxy terminus of the DNA binding domain and the `ELEEK` portion
is the amino terminus of the nuclease domain. The underlined
portion is the linker sequence between the two domains:
[0184] Linker Sequences
TABLE-US-00005 L7a: (SEQ ID NO: 31) HTKIH LRGSQLVKSKSEAAAR ELEEK
L7c5: (SEQ ID NO: 32) HTKIH LRGSISRARPLNPHP ELEEK L0: (SEQ ID NO:
33) HTKIH LRGSISRARPLNPHP ELEEK L8c4: (SEQ ID NO: 34) HTKIH
LRGSYAPMPPLALASP ELEEK
[0185] In these experiments, the L0 or L8c4 linkers were tested on
the right side partner in combination with the L7c5 or L7a linkers
on the left side partner. The combinations of the ZFNs were tested
for cleavage activity in K562 cells, and the results (percent NHEJ
activity) are shown below in Table 3.
TABLE-US-00006 TABLE 3 ZEN activity varying domain linkers L7c5
L7c5 L7c5 L7a L7a SBS 51856 51857 51862 46801 51446 ave L0 51949
6.4 9.2 7.3 4.8 10.6 7.66 L0 51977 8.8 8.9 5.6 5.0 8.7 7.41 L0
51979 11.4 10.5 10.8 4.5 11.3 9.70 L0 51982 8.3 9.7 9.3 4.9 10.5
8.56 L0 51990 10.3 11.0 7.5 5.3 10.2 8.86 L0 51993 10.7 13.5 7.3
5.1 10.9 9.52 L0 52015 8.5 8.6 7.2 5.7 6.7 7.34 L0 52032 11.5 11.3
7.0 5.0 14.8 9.91 L0 47923 7.6 7.6 5.0 4.0 11.5 7.14 L8c4 52075
10.9 10.9 7.2 5.6 11.7 9.27 L8c4 52103 9.9 8.9 8.5 3.8 10.9 8.37
L8c4 52105 16.7 13.0 16.3 6.3 15.2 13.49 L8c4 52108 9.7 7.5 6.5 4.2
12.0 7.99 L8c4 52116 12.0 15.7 9.8 4.0 13.4 10.99 L8c4 52119 13.1
9.8 8.3 4.5 10.3 9.19 L8c4 52141 15.2 7.2 6.9 3.4 13.2 9.17 L8c4
52158 9.3 10.3 7.4 3.6 12.5 8.64 L8c4 51536 13.3 12.1 11.3 8.0 15.4
12.04 ave-> 10.76 10.32 8.28 4.88 11.65
Example 3: Activity of the ZFNs in CD34+ Cells
[0186] ZFNs as described herein were also tested in human CD34+
cells. For the CD34+ transduction, a BTX ECM830 device with a 2 mm
gap cuvette was used. Human CD34+ cells were grown in x-vivo10
media (Lonza) with 1.times.CC110 (Stem cell Technology) in
non-tissue culture treated plates. The cells were counted and
collected by centrifugation at 1200 rpm for 10 minutes at room
temperature. The cells were washed 1-2.times. with room temperature
PBS. 200,000 cells were used for each transfection, and they were
resuspended in 100 .mu.L BTexpress solution. For the CD34+
experiments, RNAs encoding the ZFNs was used rather than DNA. RNA
was generated using a mMessageMachine T7 Ultra Kit (Ambion). 500 ng
of RNA encoding each ZFN was added per transfection and the mixture
was transferred to the cuvette. Immediately following transfer, the
mixture was electroporated at 250V for 5 msec. Pre-warmed media was
added to the cuvette and the media plus cells were transferred to a
48 well non-tissue culture treated plates and then incubated at
37.degree. C.
[0187] After two or three days, the cells were then were subject to
genome analysis using an Ilumina MiSeq. To quantitate the percent
of edited alleles, the genomic region of interest was PCR amplified
using primers which add the standard Illumina sequencing adapter
sequences. A second group of 13 rounds of PCR was performed to add
barcode and bridge adapter sequences to both ends. Sequencing was
performed on an Illumina MiSeq according to manufacturer's
protocols for amplicon sequencing. The MiSeq generates paired-end
reads, which are merged and adapter-trimmed using a standard
alignment software. Reads were then demultiplexed by sample via
barcode sequence pairs using custom scripts. Amplicon sequences
were then globally aligned to a reference sequence via an
implementation of the Needleman-Wunsch algorithm (Needlemanand
Wunsch (1970) Jour Mol Bio 48(3):443-53). Gaps or insertions in the
alignment were counted as % NHEJ events, and compared to an
untreated control sample sequence to determine sequence-specific
background rates. The results are shown below in Table 4.
TABLE-US-00007 TABLE 4 ZFN activity in CD34+ cells 51949 51977
51979 51982 51990 51993 52015 52032 51536 ave 51856 38.4 11.9 26.9
23.9 37.3 37.0 26.4 32.1 nd 29.2 51857 52.1 17.2 39.8 30.9 51.0
43.9 35.2 53.9 40.0 40.4 51862 18.4 5.2 13.0 12.4 26.6 20.7 13.7
16.2 17.7 16.0 51877 19.6 6.0 8.9 9.6 24.0 18.3 11.6 19.4 13.7 14.6
51879 36.4 10.6 21.8 19.5 39.2 30.7 21.8 34.4 22.7 26.4 51446 60.1
22.6 41.2 43.6 57.8 50.4 39.7 47.6 nd 45.4 ave 37.5 12.3 25.3 23.3
39.3 33.5 24.7 33.9 23.5
[0188] When an increased amount of input mRNA was used for a
selected set of representative pairs (1 .mu.g each ZFN), additional
amounts of cutting was observed, as shown in Table 5.
TABLE-US-00008 TABLE 5A Table 5A and 5B: Increasing ZFN
concentration leads to increased activity 0.5 ug: 0.5 ug 46801:
47923 1.6 51556: 51484 17.6 1 ug: 1 ug 46801: 47923 1.5 51536:
51446 49.0 52032: 51446 65.7 52032: 51857 60.8 51979: 51446 60.0
51979: 51857 47.5 51536: 51857 55.7 GFP no seq
TABLE-US-00009 TABLE 5B 51536 51541 51556 51519 51534 51535 51446
83.72 87.79 74.11 81.52 84.21 82.22 51484 75.21 84.34 64.20 67.88
79.50 74.22 51463 82.71 85.24 74.00 78.81 85.53 nd 51477 72.02
85.11 63.74 70.42 80.96 78.30 51478 72.33 82.38 58.17 66.22 75.20
70.90 51487 66.27 83.26 64.11 61.97 68.99 70.42
[0189] The above transfections were mostly performed under
conditions non-saturating mRNA inputs to allow us to best compare
the activity of various ZFN combinations. To test the maximum
amount of modification obtainable at or near saturating inputs of
mRNAs we transfected increasing amounts of 2a constructs or
combining two ZFNs in one mRNA into CD34+ cells using BTX
electroporation, and the results are shown below in Table 6.
TABLE-US-00010 TABLE 6 Modification of the Bcl11a Enhancer with
Increasing mRNA input 2A: 2000 ng 4000 ng 8000 ng 51463_2a_51949
59.60 79.83 82.69 51463_2a_52990 67.98 80.17 77.30 51463_2a_52032
58.58 80.36 83.26 51857_2a_51949 61.22 73.89 78.26 51857_2a_51990
60.63 70.55 74.40 51857_2a_52032 55.84 71.17 74.29
euf_51446_2a_51536 56.36 66.69 74.85 euf_46801_2a_47923 51.15 72.20
75.97
[0190] The data in Table 6 show very high modification of the ZFN
target region with increasing mRNA input for all combinations
tested.
[0191] Similar to the experiments done in Experiment 2 analyzing
activity with ZFNs comprising varied linkers, the effect of linkers
on activity was also tested in CD34+ cells. As above, varying
amounts of mRNA (either 500, 1000 or 2000 ng of each) was used to
deliver the ZFNs in these experiments. Table 7 shows the effect of
linker identity on the activity of the ZFN pairs.
TABLE-US-00011 TABLE 7 Effect of linker identity on ZFN activity in
CD34+ cells 500 ng 51463 51857 1000 ng 51463 51857 2000 ng 51463
51857 L0 51949 29.9 31.0 51949 48.8 46.7 51949 44.5 43.5 51979 26.3
23.8 51979 39.2 40.0 51979 36.3 35.1 51990 28.6 28.1 51990 39.8
41.8 51990 36.1 36.3 52032 24.7 25.5 52032 39.6 39.7 52032 37.2
33.6 L8c4 51536 23.0 19.1 51536 36.0 31.0 51536 35.7 30.6 52075
22.1 21.2 52075 34.7 32.0 52075 35.2 27.5 52105 21.9 19.1 52105
37.2 32.8 52105 36.2 31.6 52116 14.7 13.9 52116 27.6 28.8 52116
28.4 28.9 52158 22.2 21.1 52158 36.3 34.9 52158 41.7 38.2 500 ng
51446 1000 ng 51446 2000 ng 51446 51536 19.8 51536 35.5 51536
28.7
Example 4: Differentiation of Edited CD34+ Cells and Hemoglobin
Expression
[0192] To test the effect on relative gamma globin expression, the
mRNAs encoding a representative sample of the ZFN pairs were
introduced into CD34+ cells (obtained from healthy donor
volunteers) by BTX nucleofection according to manufacturer's
instructions. The cells were then differentiated into erythrocytes.
Briefly, CD34.sup.+ cells were purified using Ficoll-Paque (GE
Healthcare) and CD34.sup.+ microbeads (Miltenyi Biotec) according
to the manufacturers' instructions. CD34.sup.+ cells were cultured
in Iscove's MDM with BIT 95000 (StemCell Technologies) in the
presence of growth factors. Cells were differentiated toward the
erythroid lineage using a 3 step liquid culture model. During the
first 6 days (first phase), CD34.sup.+ cells were expanded with SCF
(100 ng/ml), Flt3-L (100 ng/ml), and IL-3 (20 ng/ml). Expanded
cells were then committed and differentiated toward the erythroid
lineage (second phase) with Epo (2 U/ml) and SCF (50 ng/ml). See,
Giarratana et al. (2011) Blood 118(19):5071-9.
[0193] To analyze relative gamma globin expression, the ratios of
mRNAs encoding gamma globin, alpha globin and beta globin following
ZFN treatment were determined at 14 days after the start of
differentiation by RT-PCR analysis. The analysis was done by
standard Taqman.RTM. analysis, following the protocol and using
gene specific assays supplied by the manufacturer (Applied
Biosystems). The relative levels of gamma globin (HBG) was
normalized by the level of alpha (HBA) or beta globin (HBB)
expression where the ratio was compared to the gamma/alpha or
gamma/beta ratio in control cells.
[0194] The data are presented below in Table 8, and demonstrate
that in comparison with cells that were treated with the GFP
encoding plasmid, there was an increase in gamma globin expression
in ZFN-treated cells.
TABLE-US-00012 TABLE 8 Change in gamma globin expression relative
to alpha or beta globin in edited CD34+ cells ZFN pair HBG/HBA
HBG/HBB 46801/47293 2.7 4.4 51446/51536 5.0 8.1 51463/51536 8.0
10.5 51484/51536 3.8 6.4 GFP 1.6 2.8
[0195] In vitro erythroid differentiation of the CD34+ cells
transfected at or near saturating mRNA concentrations followed by
RT-PCR analysis of globin expression as described above shows very
efficient gamma-globin activation by all selected ZFN pairs
targeting the Bcl11a enhancer when compared to the GFP mRNA
transfected control sample (FIG. 1). The data is presented below in
Table 9.
TABLE-US-00013 TABLE 9 Increased ratio of human gamma globin
expression HBG/HBB mRNA used 2 .mu.g 4 .mu.g 8 .mu.g 51463-2a-51949
10.33 17.56 21.84 51463-2a-51990 12.75 16.05 16.96 51463-2a-52032
9.94 17.91 18.97 51857-2a-51949 10.12 14.16 12.21 51857-2a-51990
10.36 12.37 16.47 51857-2a-52032 8.57 15.18 19.01 51446-2a-51536
9.45 10.43 14.76 46801-2a-47923 8.86 12.15 13.10 GFP 1.65
Example 5: Activity of ZFN in CD34+ Cells Using a BTX
Electroporation Device, Separate mRNAs and Single mRNAs
[0196] The activity of two pairs of ZFN were tested in mobilized
human CD34+ cells isolated from human peripheral blood and in CD34+
cells isolated from bone marrow. Briefly, the CD34+ cells were
isolated from healthy donors as follows. Leukapheresis collections
were platelet depleted by low speed centrifugation and supernatant
removal. Following platelet depletion, the cells were labelled with
anti-CD34 magnetic micro-beads (Miltenyi Biotec, Germany) and
positively selected using the Miltenyi CliniMACS Plus Cell
Separator System. Following selection, the positive fraction
(enriched CD34+ HSPC) were washed and resuspended in culture medium
(i.e., X-VIVO 10 medium supplemented with 2 mM L-glutamine, 100
ng/mL each of FMS-like tyrosine kinase 3-ligand (Flt-3L), stem cell
factor (SCF), and thrombopoietin (TPO)) at 1.times.106 cells/mL,
and transferred into VueLife culture bags (Saint-Gobain,
Gaithersburg, Md.) and incubated at 37.degree. C./5% CO2. For
purification of CD34+ cells from bone marrow, collections were
depleted of red blood cells (RBC) by hydroxyethyl starch
sedimentation. Following RBC depletion, the cells were labelled
with anti-CD34 magnetic micro-beads (Miltenyi Biotec, Germany) and
positively selected using the Miltenyi CliniMACS Prodigy. Following
selection, the positive fraction (enriched CD34+ HSPC) were washed
and resuspended in culture medium (i.e., X-VIVO 10 medium
supplemented with 2 mM L-glutamine, 100 ng/mL each of FMS-like
tyrosine kinase 3-ligand (Flt-3L), stem cell factor (SCF), and
thrombopoietin (TPO)) at 1.times.106 cells/mL, and transferred into
VueLife culture bags (Saint-Gobain, Gaithersburg, Md.) and
incubated at 37.degree. C./5% CO2.
[0197] The pairs used were 51446/51536 (pair A) and SBS51857/51949
(pair B). The ZFNs were tested as mRNA introduced into the cells.
For transfection, a BTX device was used. Briefly, 200,000 cells per
sample were suspended in BTXpress Electroporation solution (BTX)
and mixed with the RNA. The mixture was then pulsed for 4 msec at
250 volts and subjected to cold shock conditions (30C overnight)
prior to letting the cells recover at 37.degree. C. Analysis of ZFN
activity was carried out two or three days post-transfection. The
ZFNs were tested as single mRNA species, where a 2a self-cleaving
peptide sequence was used between the two ZFN coding sequences, and
the data is presented in FIG. 2. In addition, the same conditions
were used to test 1 pair of ZFN where the provision of the mRNAs
was as two separate species, where each mRNA encoded a single ZFN.
Table 10a and Table 10b below shows the activity results (% NHEJ or
indels) for the single mRNA approach versus two mRNAs (data
depicted is from several experiments).
TABLE-US-00014 TABLE 10a Comparison of single versus double mRNA
species (% indels) mRNA used 2.0 .mu.g 4.0 .mu.g 51857_2a_51949,
exp. #1 56.0 64.7 51857_2a_51949, exp. #2 61.2 73.9 51857 + 51949
83.1 80.5
TABLE-US-00015 TABLE 10b Comparison of single versus double mRNA
species (% indels) mRNA used 0.5 .mu.g 2.0 .mu.g 4.0 .mu.g
51857_2a_51949, exp. #3 32.0 51.5 58.7 51857 + 51949, exp #3 40.0
58.4 63.1
[0198] We also tested expression of human gamma globin and human
beta globin using TaqMan.RTM. according to standard protocols. The
results were then normalized as a ration of HBG (gamma) over HBB
(beta), and are depicted in FIG. 3, again comparing two pairs of
ZFN: 51446/51536 (pair A) and SBS51857/51949 (pair B). In addition,
expression of HBG and HBB were also measured comparing the
provision of the ZFN pair as a single mRNA, where the sequences
encoding each ZFN in the pair are separated by a 2a self-cleaving
peptide sequence, with conditions where the mRNA encoding each ZFN
was supplied separately. The data demonstrated that under these
conditions, the B pair, SBS51857/51949, was more active in cleaving
the BCL11a target and in causing an increase in HBG expression.
[0199] The ZFN pairs were tested in bone-marrow derived CD34+ cells
and both pairs were again found to be active (see FIG. 4a).
Activity for the SBS51857/51949 pair was also tested where the ZFNs
were supplied on a single mRNA with a 2a or as two separate mRNAs
as described above (FIG. 4b). The SBS51857/51949 pair demonstrated
higher activity than the 51446/51536 pair.
Example 7: Specificity Analysis
Unbiased Capture Analysis:
[0200] The capture assay is based on the observation that
co-introduction of a nuclease and a duplex DNA donor into a target
cell results in the "capture" of donor into a fraction of the
resultant genomic break sites via the NHEJ DNA repair pathway
(Orlando et al. (2010) Nucleic Acids Res. 38(15):e152; Gabriel et
al. (2011) Nat Biotechnol. 29:816-23). Note that this capture event
is not homology driven (indeed the duplex DNA donor does not
contain any homology to the human genome). Note further that the
mRNA encoding the ZFNs cannot be captured into the DNA break,
solely the duplex DNA donor can. Once trapped the duplex genome
represents a permanent tag of the cleavage event. After isolation
of genomic DNA, sites of capture may be identified via primer
extension from the donor into flanking genome sequence, followed by
adapter ligation, PCR, and sequencing of the resulting donor-genome
junctions.
[0201] Briefly, the capture analysis studies were conducted in the
K562 cell line to maximize donor delivery, ZFN expression, and
donor capture into DSB sites; the cells were electroporated with
the ZFN-encoding mRNA and the oligonucleotide duplex donor.
Separately, BM and PB-derived CD34+ cells were electroporated using
the Maxcyte device as described above with the ZFN-encoding mRNA.
The duplex donor oligonucleotide used is shown below (SEQ ID NOs:
37 and 38):
TABLE-US-00016 5' NNNNAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGAT
CCCTCAGACCCTTTTAGTCNNNNNAGTGTGGAAAATCTCTAGCAG 3' 3'
TCATCACACACGGGCAGACAACACACTGAGACCATTGATCTCTAGGGA
GTCTGGGAAAATCAGNNNNNTCACACCTTTTAGAGATCGTCNNNN 5'
[0202] The NNNN at the 5' end of each strand indicates a random,
single strand tetramer overhang, while the underlined NNNN
indicates random duplex sequence that served as a bar code to
differentiate between otherwise identical integration events.
Triplicate samples were prepared for each combination of oligo and
mRNA. On days 7 and 14 post-transfection genomic DNA was isolated
(Qiagen DNeasy Blood and Tissue Kit), and 1 .mu.g (330000
genomes/replicate) was used as input for the amplification
protocol. Samples were then processed essentially as described
(Paruzynski et al. (2010) Nat. Protocols. 5:1379-1395). Amplicons
were purified using a QIAquick PCR Purification Kit (Qiagen), and
amplified by PCR to introduce barcodes and adapters for deep
sequencing on the Illumina platform. Final products were
quantified, pooled and sequenced on a MiSeq Instrument (Illumina)
using a v2 300 cycle sequencing kit with paired-end 150 bp reads
and 8 bp dual index reads to detect the barcodes on each end of the
amplicon. This effort yielded a set of candidate off-target loci
that were then genotyped in BM- or PB-derived CD34 cells The
results identified for pair A (SBS #51446/51536) are shown in FIG.
10a, while the results for pair B (SBS #51857/51949) are shown in
FIG. 10b. The data is further summarized below in Table 11.
TABLE-US-00017 TABLE 11 Off target analysis for pair A and pair B,
CD34+ from Bone Marrow A 250 ug/ml 63% 21 9% B 125 ug/ml 63% 9 3% B
250 ug/ml 74% 20 17%
[0203] Similar studies were performed on CD34+ cells derived from
PB, and Table 12 below summarized the results found.
TABLE-US-00018 TABLE 12 Off target analysis for pair A and pair B,
CD34+ from Peripheral Blood Cumulative ZFNs Dose On-Target #
off-targets Activity St 4 120 ug/ml 60% 11 4% St 5 120 ug/ml 56% 10
3%
Example 6: Activity of ZFN in CD34+ Cells Using a Maxcyte
Electroporation Device, Separate mRNAs and Single mRNAs
[0204] We next ran larger scale experiments using the ZFN pairs in
CD34+ cells using a Maxcyte GT electroporation device. Mobilized
CD34+ cells isolated peripheral blood from normal donors as
described above (PB) were tested as follows: cells (3 million per
sample) were resuspended in RT Maxcyte EP buffer to a final
concentration of 30 e6 cells/mL. Cells were mixed with mRNA and
electroporated using the program specified by manufacturer. Cells
were allowed to recover briefly at 37.degree. C. for twenty
minutes, then diluted and subjected to cold shock conditions
(30.degree. C. overnight) prior to letting the cells recover at
37.degree. C. Activity was analyzed two to three days later.
Experiments were done with both the A pair and the B pair as
previously, where each pair was introduced on a single mRNA (FIG.
5A). The ZFN pair B (SBS51857/51949) was also tested as a single
mRNA or two separate mRNAs as described above (FIG. 5b). In these
experiments, the B pair showed the highest activity.
[0205] For bone marrow derived cells, successful editing required
more mRNA, but high activity was observed (see FIG. 6). The cells
were analyzed for HBG and HBB expression as described above and the
HBG/HBB ratio compared to the percent indel activity at day 0 (FIG.
7). There was a good agreement between higher levels of HBG
expression and higher indel activity.
[0206] More analyses were done using the Maxcyte protocol (FIGS. 8
and 9) where it was found that although the frequency of indels
wasn't always the same in each experiment, the relative activity
(e.g., 2a SBS51857/51949 construct higher than the separate mRNAs)
was observed in each run.
Example 7: Engraftment of Edited Human CD34+ Cells in Mice
[0207] As described above, CD34+ human cells are treated with mRNAs
encoding the +58 enhancer specific ZFNs and then engrafted into NSG
mice. CD34+ cells are obtained from healthy human volunteers. In
some cases, CD34+ mobilization strategies were done, using either
G-CSF (Neupogen.RTM.) or G-CSF+ Plerixafor (Mozobil.RTM.) prior to
apheresis. The G-CSF is administered daily for the four days prior
to apheresis according to manufacturer's instructions, and if
Plerixafor was used, it was administered on the final evening prior
to harvest, again according to manufacturer's instructions. The
apheresis is performed by standard methods. CD34+ cells were
enriched from the mobilized PBMC leukopaks using a Miltenyi
CliniMACs system by standard methods and according to
manufacturer's instructions.
[0208] Capped and poly-adenylated mRNAs encoding the ZFNs are
synthesized using Ambion mMessage mMachine.RTM. T7 ultra kit as
instructed by the manufacturer and then electroporated into the
CD34+ cells using either a Maxcyte GT system or a BTX ECM830
electroporator, both according to manufacturer's instructions.
[0209] NOD.Cg-Prkdc.sup.scid Il2rg.sup.tm1Wjl/SzJ mice are used to
receive the CD34+ transplant. One day (16-24 hours) prior to
implantation, the mice are subject to sub lethal irradiation (300
RAD). The ZFN-treated CD34+ cells from above are transplanted into
the irradiated mice through a tail vein injection, where 1 million
cells in 0.5 mL PBS-0.1% BSA were given per mouse.
[0210] For this experiment, CD34+ cells arc electroporated with
mRNAs encoding the 46801/47923 pair. Genes encoding the ZFNs are
cloned together in a single open reading frame separated by a
sequence encoding a 2A self-cleaving peptide. GFP was used as a
control. Following transplantation into the mice, samples are taken
at either 4, 8 and 12 weeks post-transplant to observe the level of
human cell specific marking in cells.
[0211] The ZFN-edited CD34+ cells engraft and differentiate, and
levels of engraftment are similar between the edited cells as
compared to the unedited controls.
Example 8: Activity of ZFNs in Patient Derived Cells
[0212] The activity of the ZFN were tested in mobilized human CD34+
cells isolated from human peripheral blood and in CD34+ cells
isolated from bone marrow. HSPC from five .beta. thalassemia
subjects (designated P11, P18, P04, P08 and P19) were mobilized and
purified as described (Yannaki et al. (2012) Mol Ther 20(1):230).
In both experiments 200,000 CD34+ cells were electroporated two
days after thawing, using a BTX electroporator (Holliston, Mass.,
Voltage=250 V, pulse length=5 ms) in 100 .mu.L of BTX Express
electroporation solution. Transfections used either 4 .mu.g of
green fluorescent protein (GFP) encoding mRNA (as a control for
electroporation efficiency, and to control for nonspecific effects
of electroporation itself, and for nonspecific effects of
introducing mRNA into the cells), or 4 .mu.g and 8 .mu.g of SB
51857-2a-51949 mRNA.
[0213] In a small scale transfection using the BTX electroporator
these SB 51857/51949 mRNA amounts resulted in equivalent target
gene modification and .gamma.-globin activation to the 80-120 ug/ml
concentrations used in the larger scale MaxCyte device
transfections.
[0214] Following electroporation, a transient overnight culture at
30.degree. C. was performed. Cells were cultured for an additional
48 hours at 37.degree. C. whereupon in vitro differentiation was
initiated and cell aliquots were harvested for analysis of DNA
modification. After transfection, cells were cultured in X Vivo 10
medium (Lonza, Walkersville, Md.) supplemented with the CC 100
cytokine cocktail (Stem Cell Technologies, Vancouver, Canada).
[0215] BCL11A gene modification was measured by MiSeq deep
sequencing 72 hours after electroporation, at the time when the in
vitro differentiation was started (therefore d3 post-transfection
was d0 of the differentiation) and at day 14 of the erythroid
differentiation. The results are shown in Table 13.
[0216] The patient derived CD34+ cell samples we obtained had been
frozen twice prior to use, and therefore some of these sample
exhibited reduced viability and cell growth upon thawing. Low
viability post-thaw has been observed to coincide with higher
reduction in viability after transfection and with lower target
gene modification, especially at the early time points, when the
DNA from non-transfected dead cells is still present. As an SB-ZFN
transfection independent indicator of cell viability after
transfection, Table 13 shows cell viability for each cell source in
the control sample which was transfected with GFP mRNA. The table
shows that patient cell samples P18 in experiment 1 had much lower
viability (38%) than the other two samples (71% and 80%) in this
experiment and did not reach the same modification levels of
.about.70% alleles modified. Similarly in the second experiment at
day 3 patient cell sample P08 showed very poor viability (22%) and
very low early modification levels and suboptimal modification
levels even after expansion and outgrowth of the healthy cells.
TABLE-US-00019 TABLE 13 BCL11A Gene Modification Analysis by MiSeq
GFP Control Target Gene Cell Viability d 3 SB-mRENH Modification
(%) source (%) mRNA (.mu.g) Day 3 Day 14 Experiment WT 71 4 70 69 1
8 72 69 P11 80 4 70 71 8 73 73 P18 38 4 45 53 8 51 59 Experiment WT
89 4 71 72 2 8 77 77 P04 62 4 48 62 8 53 67 P08 22 4 19 62 8 32 68
P19 68 4 ND 69 8 ND 73 ND = no data, WT = wild type
[0217] These data show that disruption of the BCL11A enhancer
following electroporation of SB ZFN mRNA into G CSF mobilized,
purified HSPCs from healthy donors and from thalassemia patients
with .beta. thalassemia occurred in most samples within the range
expected for clinical samples. As a consequence of the low
viability of some of the samples, enhancer disruption in P18 and
P08 was lower than in cells from healthy donor volunteers, and
consequently the two samples with low viability were omitted from
the analyses below. Importantly, samples from subjects that
exhibited robust cell viability (e.g. samples P11 and P04) also
exhibited gene modification levels equivalent to those seen in the
wild type cells.
[0218] Levels of .alpha. and .gamma. globin mRNA isolated from
erythroid progeny of CD34+ HSPC from subjects with .beta.
thalassemia showed an increase in fetal (.gamma.) globin levels
following treatment with SB ZFN mRNA when analyzed by RT qPCR (FIG.
11). Fetal .gamma. globin mRNA levels are shown normalized relative
to a globin mRNA since the thalassemia cells expressed low or no
.beta. globin mRNA.
[0219] Erythroid progeny of CD34+ HSPCs from subjects with .beta.
thalassemia treated with SB ZFN mRNA reveal the anticipated
increase in the ratio of fetal (.gamma.) globin mRNA to .alpha.
globin mRNA, reaching gamma-globin to alpha-globin ratios similar
to those seen in the wild type donor cells, in particular in the
patient samples that showed good viability after thawing and
consequently target gene modification levels comparable to those in
wild type cells.
[0220] Reverse phase HPLC was then used to determine whether
modification of the BCL11A erythroid enhancer elevates fetal
hemoglobin at the protein level.
[0221] The gamma globin (sum of the Agamma and Ggamma peaks)/alpha
globin ratios for the two experiments showed a clear elevation of
fetal globin protein was observed in red blood cells (RBCs) derived
from healthy volunteers and thalassemia patients upon SB ZFN
disruption of the BCL11A enhancer, even though the untreated
gamma/alpha ratios in the thalassemia cells especially in
.beta.0/.beta.0 cells are usually well above those in the wild-type
(wt) cells. Analysis of fetal to adult globin ratios in cells from
patients with .beta. thalassemia major is complicated by the fact
that the tetramerization and precipitation of .alpha. globin in
unmodified cells eliminates it from the HPLC analyzable pool.
[0222] Thus, solely .alpha. globin tetramerized with residual
.beta. globin (in patients with .beta.+ thalassemia) and .gamma.
globin, or solely .alpha. globin tetramerized with .gamma. globin
(in .beta.0/.beta.0 cells) can be revealed in the assay. Therefore,
if .gamma. globin protein levels increase, productively
tetramerized a globin protein levels can increase as well and the
.gamma./.alpha. globin protein ratio underestimated the increase in
.gamma. globin protein levels. Another ratio that was useful to
examine in wild type cells was the .gamma. globin/.beta. like
protein ratio (the latter being the sum of the two .gamma. globin
protein levels plus .delta. globin plus .beta. globin). However in
thalassemia patient cells, particular in the .beta.0/.beta.0 cells,
this ratio was usually over 90% even in non ZFN treated cells and
even substantial increases in .gamma. globin protein levels after
ZFN treatment did not markedly increase this ratio.
Example 9: Analysis of Modified Allele Distribution and Effect on
Fetal Globin in ZFN Treated Wild Type CD34+ Cells
[0223] We also evaluated erythroid cells derived from CD34+ cells
treated with SB ZFN, at the single cell level with respect to two
endpoints: (1) distribution of alleles of BCL11A erythroid enhancer
region rated by the action of the ZFNs between individual cells,
and (2) effect of the distribution of individual alleles (wild type
and genetically modified) on levels of fetal globin (as gauged by
the .gamma./.beta. globin mRNA ratio). Thus, single CD34+ cells
found in SB ZFN HSPC were sorted and differentiated in vitro. The
resulting single cell derived colonies of hemoglobinized cells were
harvested individually; genomic DNA (gDNA) for each of the colonies
was sequenced at the SB ZFN target region in the BCL11A erythroid
enhancer to determine whether the locus has been disrupted, and if
yes, what precise allelic form of the locus was generated. Further,
total RNA was isolated from the same colony, and globin expression
levels in these individual clones were analyzed by real time
reverse transcription quantitative polymerase chain reaction (RT
qPCR).
Methods
[0224] For single cell studies, transfected SB ZFN HSPC cells were
thawed at 37.degree. C., added to 10 mL X VIVO at room temperature,
and spun down at 450.times.g for 5 minutes at room temperature.
Cell pellets were resuspended at 1x 106/mL in X VIVO media
supplemented with Flt3L, TPO, and SCF (100 ng/mL each), penicillin
(100 U/mL), and streptomycin (100 .mu.g/mL). After overnight
culture in a 24 well non tissue culture-treated plate at 37.degree.
C., 5% CO2 in a humidified incubator, cells were collected, spun
down, and resuspended in phosphate buffered saline (PBS)
supplemented with 0.5% bovine serum albumin at 2.times.106/mL.
Cells were sorted into Step 1 erythroid culture media (200
.mu.L/well) in 96 well U bottom non-TC treated plates at 2
cells/well using FACS Aria III. Step 1 erythroid culture media
consisted of Glutamax containing Iscove's Modified Dulbecco's
Medium (IMDM) supplemented with 100 U/mL penicillin, 100 .mu.g/mL
streptomycin, 5% human AB+ plasma, 330 .mu.g/mL human holo
transferrin, 20 .mu.g/mL human insulin, 2 U/mL heparin, 3 U/mL
recombinant human erythropoietin, 100 ng/mL SCF, 5 ng/mL IL 3, and
1 .mu.M/mL hydrocortisone. After 7 days of culture at 37.degree.
C., 5% C02 in Step 1 erythroid culture media, 150 .mu.L of media
per well was removed and replaced with 100 .mu.L Step 2 erythroid
culture media, which was similar to Step 1 media but without the
addition of IL 3 and hydrocortisone. After 4 additional days of
culture, 100 .mu.L media per well was removed and replaced with 100
.mu.L Step 3 media, which was similar to Step 2 media but without
SCF.
[0225] On Day 14 post differentiation, 10 .mu.L of cell suspension
per well was harvested for deep sequencing. Furthermore, 100 .mu.L
of media per well was removed and replaced with 100 .mu.L of fresh
Step 3 media. Remaining cells were cultured for 3 more days when 50
.mu.L of cell suspension per well was collected, stained with an
equal volume of NucRed (2 drop/mL in PBS 0.5% BSA), and enumerated
on Guava easyCyte for cellularity and enucleation rate. Remaining
cells were spun down, wash once with PBS, and lysed in 20 .mu.L
high performance liquid chromatography-(HPLC) grade water. Cell
debris was removed by centrifugation (10,000.times.g, 15 min,
4.degree. C.). Hemolysate was stored at 70.degree. C. until ready
for globin chain analysis by reverse phase ultra performance liquid
chromatography (UPLC).
[0226] Gene modification efficiency was assessed by deep DNA
sequencing. The region of interest (containing the ZFN binding site
within the BCL11A erythroid enhancer region) is polymerase chain
reaction-(PCR) amplified and the level of modification is
determined by paired end deep sequencing on an Illumina MiSeq. To
generate libraries compatible with the Illumina MiSeq sequencing
platform, adaptors, barcodes, and flow cell binder (short DNA
sequence) were attached to the target specific amplicons using two
sets of fusion primers in sequential polymerase chain reactions.
The following primers are used for the MiSeq Adaptor PCR (the
underlined portions are BCL11A erythroid enhancer specific
sequences):
TABLE-US-00020 PRJIYLFN f: (SEQ ID NO: 35)
5'ACACGACGCTCTTCCGATCTNNNNAGTCCTCTTCTACCCCACC and PRJIYLFN r: (SEQ
ID NO: 36) 5'GACGTGTGCTCTTCCGATCTCTACTCTTAGACATAACACACC.
Individual single cell derived erythroid cultures were harvested,
and gDNA was extracted using QuickExtract.TM. (Epicentre) for
genotyping analysis using deep sequencing on the Illumina
platform.
[0227] For globin chain analysis by reverse phase UPLC, 5 .mu.L of
hemolysate was injected onto a Waters Acquity UPLC Protein BEH C4
Column (300 A, 1.7 microm, 2.1 mm.times.100 mm). Elution was
obtained at RT with a flow rate of 0.2 mL/min using an 18 minute
linear gradient of 38% to 42.5% acetonitrile in water with
trifluoroacetic acid constant at 0.1%. Elution was followed at 220
nm. Area percentage for specific globin chains, .gamma., .beta. or
.alpha., representing the amount of each specific globin chains,
was quantitated using Agilent OpenLAB software.
Results
[0228] For this study, 120 or 80 .mu.g/ml SB ZFN was transfected
into CD34+ cells to generate SB ZFN HSPC cells and cell samples
were collected at three days post transfection and analyzed for the
levels of BCL11A erythroid enhancer region disruption by deep
sequencing. This revealed approximately 67% modified BCL11A alleles
in the SB ZFN transfected sample for experiment 1 and 58% for
experiment 2 (Table 14).
[0229] To perform such a single cell analysis, individual cells in
SB ZFN HSPC from two different experiments (1 and 2), were sorted
and plated in 96 well plates and underwent erythroid
differentiation in vitro, and individual single cell cultures were
analyzed by high throughput DNA sequencing as well as globin
expression analysis by UPLC, respectively.
[0230] The MiSeq genotyping results for the single cell cultures
are summarized in Table 14. For each lot of SB ZFN treated HSPC
cells, between 200 300 individual single cell erythroid cultures
were analyzed. Of all the clones with clear phenotypes (mixed
clones excluded, 205 clones for experiment 1 and 265 clones for
experiment 2), 28 or 36% are wild type clones (+/+), 14 or 11% are
heterozygous clones (+/), and 58 or 52% are homozygous (/) clones,
for experiment 1 and experiment 2, respectively. Of all alleles in
the single cell erythroid cultures derived from SB ZFN treated
cells, 65% or 58%, for experiments 1 and 2, respectively, were
disrupted at the BCL11A erythroid enhancer locus. Of all the single
cell erythroid cultures bearing any modified alleles, 81%
(experiment 1) or 82% (experiment 2) of the modified cell clones
had both BCL11A alleles disrupted.
TABLE-US-00021 TABLE 14 Genotyping of Single Cell Erythroid
Cultures Derived from SB ZFN Transfected HSPC Experiment number
SB-ZFN-HSPC Lot #1 #2 Total clones examined 205 265 (Total alleles)
(410) (530) Wild-type Clones 57 96 (+/+) (28%) (36%) Heterozygous
Clones 28 30 (Monoallelic Modified) (14%) (11%) (+/-) Homozygous
Clones 120 139 (Biallellic Modified) (58%) (52%) (-/-) Net Modified
148 169 (Heterozygous [+/-] + (72%) (63%) Biallelic modified [-/-])
Fraction of Modified Cells 81% 82% which are Biallelic modified
BCL11A erythroid enhancer modification 67% 58% in pool before
single cell culture (% of total alleles) % of Total Alleles 65% 58%
Net BC11A erythroid enhancer modification from single cell data (%
of total alleles)
[0231] The data show that a pool of SB ZFN HSPC bearing 58-67%
targeted BCL11A erythroid enhancer modification was made up of
28-36% wild type cells, 11-14% cells bearing a monoallelic
modification, and 52-58% cells bearing biallelic modification of
the target locus.
[0232] Of the clones with clear genotypes, 152 and 172 clones
(experiments 1 and 2, respectively) were successfully
differentiated into erythroid cells in vitro, as indicated by
enucleation rate measured by NucRed stain. These single cell
erythroid cultures were then subjected to reverse phase UPLC
analysis to measure globin chain expression level. Colonies
differed in their degree of erythroid maturation; some variation in
the .gamma./.beta. globin ratio was expected even within colonies
bearing the same BCL11A erythroid enhancer genotype. Furthermore, a
fraction of the disrupted alleles of the BCL11A erythroid enhancer
may retain partial or complete function, potentially as a result of
retaining a GATA 1 binding site (Vierstra et al. (2015) Nat Methods
12(10):927-30; Canver et al. (2015) Nature 527(7577):192-7).
[0233] As can be seen in the data (FIG. 13), the results revealed a
clear correlation between the genotype of a colony for the BCL11A
erythroid enhancer locus and its .gamma./.beta. globin ratio.
Specifically, colonies bearing a biallelic (homozygous)
modification of BCL11A had a mean normalized .gamma./.beta. ratio
of 35% and 39% for experiments 1 and 2, respectively, colonies with
a monoallelic (heterozygous) modification had a mean normalized
.gamma./.beta. ratio of 19% and 13% for experiments 1 and 2,
respectively, and wild type colonies 14% and 13% for experiments 1
and 2, respectively. In a two tailed t test with Welch's
correction, the P value of the "homozygous vs wild type" comparison
are <0.0001 for both experiments 1 and 2; the P value of the
"heterozygous vs homozygous" comparison are <0.0001 for
experiment 1 and 0.0025 for experiment 2; and the P value of the
"heterozygous vs wild type" comparison are 0.02 and 0.0002 for both
experiments 1 and 2, respectively. In the graph below (FIG. 13),
the .gamma./.beta. and .gamma./.alpha. globin ratio is plotted for
all the colonies assayed, sorted by the genotyping class of BCL11A
erythroid enhancer alleles.
[0234] All patents, patent applications and publications mentioned
herein are hereby incorporated by reference in their entirety.
[0235] Although disclosure has been provided in some detail by way
of illustration and example for the purposes of clarity of
understanding, it will be apparent to those skilled in the art that
various changes and modifications can be practiced without
departing from the spirit or scope of the disclosure. Accordingly,
the foregoing descriptions and examples should not be construed as
limiting.
Sequence CWU 1
1
38128DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1aaagcaactg ttagcttgca ctagacta
2827PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 2Asp Gln Ser Asn Leu Arg Ala1 537PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 3Arg
Pro Tyr Thr Leu Arg Leu1 547PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 4Ser Gly Tyr Asn Leu Glu Asn1
557PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 5Thr Ser Gly Ser Leu Thr Arg1 567PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 6Ala
Gln Cys Cys Leu Phe His1 577PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 7Ser Thr Gly Asn Leu Thr Asn1
587PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 8Ser Arg Gly Ala Leu Lys Thr1 597PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 9Arg
Asn Phe Ser Leu Thr Met1 5107PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 10Ser Asn Gly Asn Leu Arg
Asn1 5117PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 11Ser Ser Tyr Asn Leu Ala Asn1 51228DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 12cacaggctcc aggaagggtt tggcctct 28137PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 13Arg
Ser Asp His Leu Thr Gln1 5147PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 14Gln Ser Gly His Leu Ala
Arg1 5157PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 15Gln Lys Gly Thr Leu Gly Glu1 5167PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 16Gln
Ser Ser Asp Leu Ser Arg1 5177PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 17Arg Arg Asp Asn Leu His
Ser1 5187PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 18Arg His Arg Asp Leu Ser Arg1 5197PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 19Arg
Asn Asp His Arg Thr Thr1 5207PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 20Gln Lys Ala His Leu Ile
Arg1 5217PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 21Arg Gly Arg Asp Leu Ser Arg1 5227PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 22Gln
Arg Ala His Leu Thr Arg1 5237PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 23His Arg Asn Thr Leu Val
Arg1 5247PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 24Gln Ser Gly Thr Arg Asn His1 5257PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 25Leu
Lys Arg Thr Leu Lys Arg1 5267PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 26Ser Ser Ser Asn Leu Thr
Asn1 5277PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 27Ser Ser Ser Asn Leu Gly Asn1 5287PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 28Ser
Arg Ser Ala Leu Arg Val1 5297PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 29Arg Ser Arg Asp Leu Thr
Arg1 5307PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 30Phe Arg Gln Thr Arg Ala Arg1 53126PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 31His
Thr Lys Ile His Leu Arg Gly Ser Gln Leu Val Lys Ser Lys Ser1 5 10
15Glu Ala Ala Ala Arg Glu Leu Glu Glu Lys 20 253225PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 32His
Thr Lys Ile His Leu Arg Gly Ser Ile Ser Arg Ala Arg Pro Leu1 5 10
15Asn Pro His Pro Glu Leu Glu Glu Lys 20 253325PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 33His
Thr Lys Ile His Leu Arg Gly Ser Ile Ser Arg Ala Arg Pro Leu1 5 10
15Asn Pro His Pro Glu Leu Glu Glu Lys 20 253426PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 34His
Thr Lys Ile His Leu Arg Gly Ser Tyr Ala Pro Met Pro Pro Leu1 5 10
15Ala Leu Ala Ser Pro Glu Leu Glu Glu Lys 20 253543DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
primermodified_base(21)..(24)a, c, t, g, unknown or other
35acacgacgct cttccgatct nnnnagtcct cttctacccc acc
433642DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 36gacgtgtgct cttccgatct ctactcttag acataacaca cc
423793DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotidemodified_base(1)..(4)a, c, t, g, unknown
or othermodified_base(68)..(72)a, c, t, g, unknown or other
37nnnnagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc ctcagaccct
60tttagtcnnn nnagtgtgga aaatctctag cag 933893DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotidemodified_base(1)..(4)a, c, t, g, unknown or
othermodified_base(26)..(30)a, c, t, g, unknown or other
38nnnnctgcta gagattttcc acactnnnnn gactaaaagg gtctgaggga tctctagtta
60ccagagtcac acaacagacg ggcacacact act 93
* * * * *