U.S. patent application number 16/916399 was filed with the patent office on 2021-01-21 for use of pasteurized akkermansia for treating metabolic disorders.
The applicant listed for this patent is UNIVERSITE CATHOLIQUE DE LOUVAIN, WAGENINGEN UNIVERSITEIT. Invention is credited to Clara BELZER, Patrice CANI, Willem DE VOS, Celine DRUART, Amandine EVERARD, Hubert PLOVIER.
Application Number | 20210015876 16/916399 |
Document ID | / |
Family ID | 1000005123370 |
Filed Date | 2021-01-21 |
![](/patent/app/20210015876/US20210015876A1-20210121-D00001.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00002.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00003.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00004.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00005.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00006.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00007.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00008.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00009.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00010.png)
![](/patent/app/20210015876/US20210015876A1-20210121-D00011.png)
View All Diagrams
United States Patent
Application |
20210015876 |
Kind Code |
A1 |
CANI; Patrice ; et
al. |
January 21, 2021 |
USE OF PASTEURIZED AKKERMANSIA FOR TREATING METABOLIC DISORDERS
Abstract
The present invention relates to pasteurized Akkermansia
muciniphila or fragments thereof for treating a metabolic disorder
in a subject in need thereof. The present invention also relates to
a composition, a pharmaceutical composition and a medicament
comprising pasteurized Akkermansia muciniphila or fragments thereof
for treating a metabolic disorder. The present invention also
relates to the use of pasteurized Akkermansia muciniphila or
fragments thereof for promoting weight loss in a subject in need
thereof.
Inventors: |
CANI; Patrice; (Bruxelles,
BE) ; EVERARD; Amandine; (Wavre, BE) ;
PLOVIER; Hubert; (Rumes, BE) ; DRUART; Celine;
(Quaregon, BE) ; DE VOS; Willem; (Ede, NL)
; BELZER; Clara; (Wageningen, NL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITE CATHOLIQUE DE LOUVAIN
WAGENINGEN UNIVERSITEIT |
Louvain-la-Neuve
Wageningen |
|
BE
NL |
|
|
Family ID: |
1000005123370 |
Appl. No.: |
16/916399 |
Filed: |
June 30, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15759381 |
Mar 12, 2018 |
10736924 |
|
|
PCT/EP2016/071327 |
Sep 9, 2016 |
|
|
|
16916399 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A23L 33/105 20160801;
A23L 33/135 20160801; A61P 3/04 20180101; A61Q 19/06 20130101; A61K
35/741 20130101; A61K 9/0053 20130101; A61K 8/99 20130101; A61K
2800/92 20130101; A23V 2002/00 20130101 |
International
Class: |
A61K 35/741 20060101
A61K035/741; A61K 9/00 20060101 A61K009/00; A23L 33/105 20060101
A23L033/105; A61Q 19/06 20060101 A61Q019/06; A61K 8/99 20060101
A61K008/99; A23L 33/135 20060101 A23L033/135; A61P 3/04 20060101
A61P003/04 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 10, 2015 |
EP |
15184758.9 |
Claims
1. A method for treating a metabolic disorder in a subject in need
thereof, comprising administering to the subject Akkermansia
muciniphila or fragments thereof, wherein the Akkermansia
muciniphila is pasteurized.
2. The method of claim 1, wherein said metabolic disorder is
obesity.
3. The method of claim 1, wherein said metabolic disorder is
selected from the group consisting of: metabolic syndrome;
insulin-deficiency or insulin-resistance related disorders;
diabetes mellitus including type 2 diabetes; glucose intolerance;
abnormal lipid metabolism; atherosclerosis; hypertension;
pre-eclampsia; cardiac pathology; stroke; non-alcoholic fatty liver
disease; hyperglycemia; hepatic steatosis; liver diseases including
fibrosis associated with obesity and abnormal liver functions, more
particularly changes in bile production and immunity; dyslipidemia;
dysfunction of the immune system associated with overweight and
obesity; inflammatory, immune and barrier function diseases
including inflammatory bowel disease, more particularly Crohn's
disease and ulcerative colitis, and irritable bowel syndrome;
cardiovascular diseases; high cholesterol; elevated triglycerides;
asthma; sleep apnea; osteoarthritis; neuro-degeneration;
gallbladder disease; syndrome X; atherogenic dyslipidemia; and
cancer.
4. A method for a) increasing energy expenditure of a subject,
optionally without impacting the food intake of said subject; or b)
increasing satiety in a subject, comprising administering
Akkermansia muciniphila or fragments thereof to the subject,
wherein the Akkermansia muciniphila is pasteurized.
5. (canceled)
6. The method of claim 1, wherein the Akkermansia muciniphila is
orally administered.
7. The method of claim 1, wherein the Akkermansia muciniphila is
administered to the subject in an amount from about 1.10.sup.4 to
about 1.10.sup.12 cells, about 1.10.sup.5 to about 1.10.sup.11
cells, or from about 1.10.sup.6 to about 1.10.sup.10 cells.
8. The method of claim 1, wherein the Akkermansia muciniphila is
administered at least three times a week.
9. The method of claim 1, wherein the Akkermansia muciniphila is
co-administered with another probiotic strain and/or another
bacteria and/or microorganisms with beneficial effects and/or with
one or more prebiotics.
10. The method of claim 1, wherein the Akkermansia muciniphila or
fragments thereof is administered as a composition according to any
one of claims 1 to 9 in association with an excipient.
11. The method of claim 10, wherein said composition is a
nutritional composition.
12. The method of claim 10, wherein said composition is orally
administered.
13. The method of claim 1, wherein the Akkermansia muciniphila is
administered as a pharmaceutical composition in association with a
pharmaceutically acceptable vehicle.
14. (canceled)
15. A method for weight loss in a subject in need thereof,
comprising administering Akkermansia muciniphila or fragments
thereof to the subject, wherein the Akkermansia muciniphila is
pasteurized.
16. The method of claim 15, wherein the Akkermansia muciniphila is
administered as a cosmetic composition, and wherein the Akkermansia
muciniphila is pasteurized.
Description
FIELD OF INVENTION
[0001] The present invention relates to the treatment of metabolic
disorders, such as, for example, metabolic disorders related to
overweight and obesity, such as, for example, Diabetes Mellitus or
high cholesterol. The present invention more specifically relates
to a composition comprising pasteurized Akkermansia spp. or
fragments thereof for treating a metabolic disorder.
BACKGROUND OF INVENTION
[0002] Obesity is a worldwide problem, with an estimated number of
obese adults of about 600 million. This epidemic of obesity is
correlated with a great increase in the prevalence of
obesity-related disorders, such as, for example, diabetes,
hypertension, cardiac pathologies and liver diseases. Due to these
highly disabling pathologies, obesity is currently considered in
western countries as one of the most important public health
problems. There is thus a real need of compositions and methods for
treating or preventing obesity and/or obesity-related
disorders.
[0003] Obesity and obesity-related diseases are associated with (i)
metabolic dysfunctions (with an impact on glucose homeostasis and
lipid metabolism for example); (ii) low grade inflammatory state
associated to higher blood lipopolysaccharides (LPS) levels (also
referred as metabolic endotoxemia); and (iii) impaired gut barrier
function (i.e. increased gut permeability) leading to translocation
of bacteria and/or microorganisms components into organs such as
the liver or the adipose tissue. In order to treat obesity, impact
on at least one, preferably 2 and more preferably 3 of these 3
factors is thus needed. These phenomena (i.e., intestinal
inflammation, LPS and bacterial translocation) are also observed
during inflammatory bowel diseases, such as for instance Crohn's
diseases, colitis, ulcerative colitis, intestinal pain (e.g.,
colic) and other intestinal inflammatory diseases. Interestingly,
both inflammatory bowel diseases and obesity-related diseases are
associated with changes in the gut microbiota composition. Thus,
reinforcing the gut barrier function is one of the major
issues.
[0004] The human gut is colonized by a diverse, complex and dynamic
community of microbes representing over 1000 different species,
which continuously interact with the host (Zoetendal et al., 2008.
Gut. 57(11):1605-1615; Rajilic-Stojanavic and de Vos, 2014. FEMS
Microbiol. Rev. 38:996-1047). The homeostasis of the gut microbiota
is dependent on host characteristics (age, gender, genetic
background . . . ) and environmental conditions (stress, drugs,
gastrointestinal surgery, infectious and toxic agents . . . ), but
also on the day-to-day dietary changes.
[0005] It has been recently acknowledged that the intestinal
microbiota is involved in a number of brain disorders, such as
anxiety, autism (Hsiao et al., 2013. Cell. 155(7):1451-1463),
Parkinson's disease (Scheperjans et al., 2015. Mov. Disord.
30(3):350-8), Alzheimer's disease (Harach et al., 2015.
arXiv:1509.02273), and in multiple sclerosis (Berer et al., 2011.
Nature. 479(7374):538-41).
[0006] Gut microbiota imbalance was also shown to be a risk factor
for the development of cancers such as colorectal cancer (Zitvogel
et al., 2015. Sci. Transl. Med. 7(271):271ps1; Louis et al., 2014.
Nat. Rev. Microbiol. 12(10):661-72).
[0007] Growing evidences also support the role of gut microbiota in
the development of obesity and related disorders (Delzenne &
Cani, 2011. Annu. Rev. Nutr. 31:15-31) and intestinal inflammation
(Wlodarska et al., 2015. Cell Host Microbe. 17(5):577-91), or
intestinal pain (for example, babies' colic) (de Weerth et al.,
2013. Pediatrics. 131:e550). In all these cases (obesity,
intestinal inflammation, colic), dysbiosis of the microbiota can
further disrupt the crosstalk between organs and the integrity of
the intestinal barrier leading to symptoms.
[0008] Therefore, treatment with products that target the gut
microbiota appeared as promising therapeutic tools for treating
obesity and related disorders. These products may consist of living
microbes, such as in the case of most probiotics, or contain dead
microbes or fragments thereof. In addition, these products may
comprise substrates that are used by the gut microbiota, such as in
the case of prebiotics, or contain compounds that change the
balance of the intestinal microbiota, such as specific
antimicrobial compounds.
[0009] For example, WO 2008/076696 describes the gut microbiota as
a therapeutic target for treating obesity and related disorders. WO
2008/076696 specifically describes methods for altering the
abundance of Bacteroidetes and/or Firmicutes in the gut of a
subject, by administering antibiotics and/or probiotics to the
subject.
[0010] Moreover, EP 2 030 623 relates to the prevention and/or
treatment of metabolic disorders, such as, for example, obesity
related disorders, by regulating the amount of Enterobacteria in
the gut. EP 2 030 623 discloses reducing the amount of
Enterobacteria in the gut by administering probiotic bacteria, such
as, for example, Bifidobacterium, Lactococcus, Streptococcus,
Enterococcus or Lactobacillus.
[0011] The patent application US 2012/083514 relates to infant
cereals comprising non-replicating probiotic micro-organisms. US
2012/083514 describes three types of heat treatment: 140.degree. C.
for 15 seconds (ultra high temperature); 74.degree. C., 90.degree.
C. and 120.degree. C. for 15 seconds (high temperature short time);
and 85.degree. C. for 20 minutes (long time low temperature).
However, it is shown in this patent application US 2012/083514 that
the ratio IL12/IL10 strongly increases in bacteria submitted to
heat treatment at 85.degree. C. for 20 minutes. IL12 is a
proinflammatory cytokine, while IL10 is an anti-inflammatory
cytokine. US 2012/083514 thus demonstrates that a heat treatment at
85.degree. C. for 20 minutes increases the inflammatory state of
the subject and is therefore not recommended for treating
inflammatory disorders. Meanwhile, US 2012/083514 demonstrates that
bacteria have to be heated for a very short time (15 seconds) to
present an anti-inflammatory profile.
[0012] Furthermore, the Applicant described that the gut microbiota
is modified in prebiotic-treated obese mice (Everard et al., 2011
November Diabetes. 60(11):2775-86). Moreover, prebiotics (1)
improve glucose and lipid metabolisms in obese and diabetic mice,
(2) reduce plasma LPS and improve gut barrier function (e.g.
reduction of inflammation) in obese mice, (3) induce an increased
enteroendocrine L-cell number in obese and diabetic mice, and (4)
improve leptin sensitivity and glucose homeostasis in diet-induced
obese and diabetic mice.
[0013] The Applicant also described the use of Akkermansia
muciniphila or fragments thereof for treating obesity and related
disorders (WO 2014/076246). Moreover, the Applicant also disclosed
a reduced abundance of Akkermansia muciniphila in the gut of
patients suffering from ulcerative colitis (Rajili -Stojanovi M et
al., 2013 March Inflamm. Bowel Dis. 19(3):481-8). In Crohn's
disease mainly butyrate-producing bacteria were found to be
depleted (Wlodarska et al., 2015. Cell Host Microbe. 17(5):577-91).
However, it was shown that Akkermansia muciniphila, which produces
the short chain fatty acids propionate and acetate, can also give
rise to trophic chains that produce butyrate as end product from
mucus. Butyrate is known to reduce pain sensation in the gut and,
like acetate and propionate, is known to show immune signaling.
Finally, it has been shown that addition of Akkermansia muciniphila
increases the barrier function in a human cell line (Reunanen et
al., 2015. Appl. Environ. Microbiol. 81(11):3655-62). Hence, it is
very likely that Akkermansia muciniphila and its products may
reduce intestinal pain and inflammation as well as reinforce the
gut barrier in healthy human as well as in patients suffering from
intestinal inflammatory diseases. This may not only apply to adults
but also to infants, as reduced butyrate producers were associated
with excessive crying in baby colic and atopic diseases in young
infants (de Weerth et al., 2013. Gut Microbes. 4(5):416-21; Nylund
et al., 2015. Allergy. 70(2):241-4).
[0014] However, here, the Applicant surprisingly showed that
administration of pasteurized Akkermansia muciniphila is more
efficient than non-pasteurized Akkermansia muciniphila to increase
barrier function and treat metabolic dysfunctions associated with
obesity and related disorders. The present invention thus relates
to the use of pasteurized Akkermansia muciniphila or fragments
thereof to increase barrier function and treating obesity and
related disorders.
SUMMARY
[0015] The present invention relates to Akkermansia muciniphila or
fragments thereof for use in treating a metabolic disorder in a
subject in need thereof, wherein Akkermansia muciniphila is
pasteurized. In one particular embodiment, Akkermansia muciniphila
or fragments thereof is for use in treating obesity.
[0016] In one embodiment, Akkermansia muciniphila or fragments
thereof is for use in treating a metabolic disorder, wherein said
metabolic disorder is selected from the group comprising metabolic
syndrome; insulin-deficiency or insulin-resistance related
disorders; Diabetes Mellitus including Type 2 Diabetes; glucose
intolerance; abnormal lipid metabolism; atherosclerosis;
hypertension; pre-eclampsia; cardiac pathology; stroke;
non-alcoholic fatty liver disease; hyperglycemia; hepatic
steatosis; liver diseases including fibrosis associated with
obesity and abnormal liver functions, more particularly changes in
bile production and immunity; dyslipidemia; dysfunction of the
immune system associated with overweight and obesity; inflammatory,
immune and barrier function diseases, including inflammatory bowel
disease, more particularly Crohn's disease and ulcerative colitis,
and irritable bowel syndrome; cardiovascular diseases; high
cholesterol; elevated triglycerides; asthma; sleep apnea;
osteoarthritis; neuro-degeneration; gallbladder disease; syndrome
X; atherogenic dyslipidemia and cancer.
[0017] The present invention also relates to Akkermansia
muciniphila or fragments thereof for increasing energy expenditure
of a subject, preferably without impacting the food intake of said
subject, wherein Akkermansia muciniphila is pasteurized.
[0018] Another object of the invention is Akkermansia muciniphila
or fragments thereof for increasing satiety in a subject, wherein
Akkermansia muciniphila is pasteurized.
[0019] In one embodiment, Akkermansia muciniphila or fragments
thereof for use as described hereinabove is orally
administered.
[0020] In one embodiment, Akkermansia muciniphila or fragments
thereof for use as described hereinabove is administered to the
subject in an amount ranging from about 1.10.sup.4 to about
1.10.sup.12 cells, more preferably from about 1.10.sup.5 to about
1.10.sup.11 cells, and even more preferably from about 1.10.sup.6
to about 1.10.sup.10 cells.
[0021] In one embodiment of the invention, Akkermansia muciniphila
or fragments thereof for use as described hereinabove is
administered at least three times a week.
[0022] In one embodiment, Akkermansia muciniphila or fragments
thereof for use as described hereinabove is co-administered with
another probiotic strain and/or another bacteria and/or
microorganisms with beneficial effects and/or with one or more
prebiotics.
[0023] The present invention also relates to a composition for use
for treating a metabolic disorder or for increasing energy
expenditure of a subject or for increasing satiety in a subject
comprising Akkermansia muciniphila or fragments thereof as
described hereinabove in association with an excipient.
[0024] In one embodiment, said composition for use is a nutritional
composition. In one embodiment, said composition for use is orally
administered.
[0025] Another object of the invention is a pharmaceutical
composition for treating a metabolic disorder or for increasing
energy expenditure of a subject or for increasing satiety in a
subject comprising Akkermansia muciniphila or fragments thereof as
described hereinabove in association with a pharmaceutically
acceptable vehicle.
[0026] The present invention further relates to a medicament for
treating a metabolic disorder or for increasing energy expenditure
of a subject or for increasing satiety in a subject comprising
Akkermansia muciniphila or fragments thereof as described
hereinabove.
[0027] The present invention also relates to the use of Akkermansia
muciniphila or fragments thereof for promoting weight loss in a
subject in need thereof, wherein Akkermansia muciniphila is
pasteurized.
[0028] Another object of the invention is a cosmetic composition
comprising Akkermansia muciniphila or fragments thereof for
promoting weight loss in a subject in need thereof, wherein
Akkermansia muciniphila is pasteurized.
Definitions
[0029] In the present invention, the following terms have the
following meanings: [0030] "Treatment" means preventing (i.e.
keeping from happening), reducing or alleviating at least one
adverse effect or symptom of a disease, disorder or condition. This
term thus refers to both therapeutic treatment and prophylactic or
preventative measures; wherein the object is to prevent or slow
down (lessen) the targeted pathologic condition or disorder. In one
embodiment of the invention, those in need of treatment include
those already with the disorder as well as those prone to have the
disorder or those in whom the disorder is to be prevented. [0031]
"Effective amount" refers to level or amount of agent that is aimed
at, without causing significant negative or adverse side effects to
the target, (1) delaying or preventing the onset of a metabolic
disorder; (2) slowing down or stopping the progression,
aggravation, or deterioration of one or more symptoms of the
metabolic disorder; (3) bringing about ameliorations of the
symptoms of the metabolic disorder; (4) reducing the severity or
incidence of the metabolic disorder; (5) curing the metabolic
disorder; or (6) restoring the normal amount and/or proportion of
Akkermansia muciniphila in the gut of the subject to be treated. An
effective amount may be administered prior to the onset of a
metabolic disorder, for a prophylactic or preventive action.
Alternatively or additionally, the effective amount may be
administered after initiation of the metabolic disorder, for a
therapeutic action. [0032] "Akkermansia muciniphila" refers to the
mucin-degrading bacteria identified by Derrien (Derrien et al.,
2004. Int. J. Syst. Evol. Microbiol. 54:1469-1476). Cells arc
oval-shaped, non-motile and stain Gram-negative. Akkermansia
muciniphila may also be referred as Akkermansia spp. or
Akkermansia-like bacteria. It belongs to the
Chlamydiae/Verrucomicrobia group; Verrucomicrobia phylum. If the
taxonomy should change, the skilled artisan would know how to adapt
the changes in the taxonomy to deduce the strains that could be
used in the present invention. Moreover, the complete genome of
Akkermansia muciniphila has been determined by the Applicant (van
Passel et al., 2011. PLoS One. 6(3):e16876). It is generally
accepted that strains with a nucleotide similarity as
experimentally determined by DNA-DNA hybridization of about 70% can
be considered as the same species--this corresponds to an average
nucleotide identity (ANI) of approximately 95% (Goris et al., 2007.
Int. J. Syst. Evol. Microbiol. 57:81-91). [0033] "Pasteurized
Akkermansia muciniphila" refers to Akkermansia muciniphila
submitted to a heating treatment. In one embodiment, pasteurized
Akkermansia muciniphila refers to Akkermansia muciniphila which was
heated at a temperature from 50.degree. C. to 100.degree. C. for at
least 10 minutes. [0034] "Probiotics" refers to microbial cell
preparations (such as, for example, living microbial cells) which,
when administered in an effective amount, provide a beneficial
effect on the health or well-being of a subject. By definition, all
probiotics have a proven non-pathogenic character. In one
embodiment, these health benefits are associated with improving the
balance of human or animal microbiota in the gastrointestinal
tract, and/or restoring normal microbiota. [0035] "Prebiotic"
refers to a substance, such as, for example, a substance which may
not be digested by humans, but which modulates composition and/or
activity of the gut microbiota through its metabolization by
microorganisms in the gut, thus conferring a beneficial
physiological effect on the host. [0036] "Subject" refers to an
animal, preferably a mammal, more preferably a human. In one
embodiment, the subject is a male. In another embodiment, the
subject is a female. In one embodiment of the invention, a subject
may also refer to a pet, such as, for example, a dog, a cat, a
guinea pig, a hamster, a rat, a mouse, a ferret, a rabbit and the
like. [0037] "Overweight" refers to a subject situation wherein
said subject has a Body Mass Index (BMI) ranging from 25 to 30. As
used herein, BMI is defined as the individual's body mass (in kg)
divided by the square of his/her height (in meter). [0038]
"Obesity" refers to a subject situation wherein said subject has a
BMI superior or equal to 30. [0039] "About" preceding a figure
means plus or less 20%, preferably 10% of the value of said figure.
[0040] "Fragment" may refer to cellular components, metabolites,
secreted molecules and compounds resulting from the metabolism of
pasteurized Akkermansia muciniphila and the like. Fragments may be
obtained, for example, by recovering the supernatant of a culture
of Akkermansia muciniphila after pasteurization or by extracting
cell components or cell fractions, metabolites or secreted
compounds from a culture of Akkermansia muciniphila after
pasteurization. The term fragment may also refer to a degradation
product. A fragment may correspond to a component in the isolated
form or to any mixture of one or more components derived from
pasteurized Akkermansia muciniphila. In one embodiment, a fragment
may correspond to one or more of such a components present in
pasteurized Akkermansia muciniphila that is produced in another
way, such as using recombinant DNA technology, in a microbial host
or in any other (bio)synthetic process. [0041] "Metabolic disorder"
refers to disorders, diseases and conditions caused or
characterized by abnormal weight gain, energy use or consumption,
altered responses to ingested or endogenous nutrients, energy
sources, hormones or other signaling molecules within the body or
altered metabolism of carbohydrates, lipids, proteins, nucleic
acids or a combination thereof. A metabolic disorder may be
associated with either a deficiency or an excess in a metabolic
pathway resulting in an imbalance in metabolism of carbohydrates,
lipids, proteins and/or nucleic acids. Examples of metabolic
disorders include, but are not limited to, metabolic syndrome,
insulin-deficiency or insulin-resistance related disorders,
Diabetes Mellitus (such as, for example, Type 2 Diabetes), glucose
intolerance, abnormal lipid metabolism, atherosclerosis,
hypertension, pre-eclampsia, cardiac pathology, stroke,
non-alcoholic fatty liver disease, hyperglycemia, hepatic steatosis
from different etiology, dyslipidemia, dysfunction of the immune
system associated with overweight and obesity, cardiovascular
diseases, high cholesterol, elevated triglycerides, asthma, sleep
apnea, osteoarthritis, neuro-degeneration, gallbladder disease,
syndrome X, inflammatory and immune disorders, atherogenic
dyslipidemia and cancer.
DETAILED DESCRIPTION
[0042] The Applicant herein shows that the beneficial effects on
metabolism observed after pasteurized Akkermansia muciniphila
administration are more important than after non-pasteurized
Akkermansia muciniphila administration (see Examples).
[0043] Therefore, this invention relates to pasteurized Akkermansia
muciniphila or a fragment thereof for treating, or for use in
treating, metabolic disorders in a subject in need thereof.
[0044] As used herein, a metabolic disorder is a disorder related
to an altered metabolic homeostasis, such as, for example, an
altered glucose or lipid homeostasis.
[0045] In one embodiment of the invention, said metabolic disorder
is obesity.
[0046] Examples of other metabolic disorders include, but are not
limited to, metabolic syndrome, insulin-deficiency or
insulin-resistance related disorders, Diabetes Mellitus (such as,
for example, Type 2 Diabetes), glucose intolerance, abnormal lipid
metabolism, atherosclerosis, hypertension, pre-eclampsia, cardiac
pathology, stroke, non-alcoholic fatty liver disease,
hyperglycemia, hepatic steatosis, dyslipidemia, dysfunction of the
immune system associated with overweight and obesity, liver
diseases (such as, for example, fibrosis associated with obesity,
or abnormal liver functions, including changes in bile production,
immunity, and the like), inflammatory, immune and barrier function
diseases (such as, for example, inflammatory bowel disease,
including Crohn's disease and ulcerative colitis, and irritable
bowel syndrome), cardiovascular diseases, high cholesterol,
elevated triglycerides, asthma, sleep apnea, osteoarthritis,
neuro-degeneration, gallbladder disease, syndrome X, inflammatory
and immune disorders, atherogenic dyslipidemia and cancer.
[0047] In another embodiment, said metabolic disorder is an
overweight and/or obesity related metabolic disorder, i.e. a
metabolic disorder that may be associated to or caused by
overweight and/or obesity. Examples of overweight and/or obesity
related metabolic disorders include, but are not limited to
metabolic syndrome, insulin-deficiency or insulin-resistance
related disorders, Diabetes Mellitus (such as, for example, Type 2
Diabetes), glucose intolerance, abnormal lipid metabolism,
atherosclerosis, hypertension, cardiac pathology, stroke,
non-alcoholic fatty liver disease, hyperglycemia, hepatic
steatosis, dyslipidemia, dysfunction of the immune system
associated with overweight and obesity, cardiovascular diseases,
high cholesterol, elevated triglycerides, asthma, sleep apnea,
osteoarthritis, neuro-degeneration, gallbladder disease, syndrome
X, inflammatory and immune disorders, atherogenic dyslipidemia and
cancer.
[0048] In one embodiment, said metabolic disorder is Diabetes
Mellitus, preferably Type 2 Diabetes. In another embodiment, said
metabolic disorder is hypercholesterolemia (also known as high
cholesterol). In one embodiment, hypercholesterolemia corresponds
to a plasma cholesterol concentration superior or equal to 2 g/L or
5 mmol/L. In another embodiment, hypercholesterolemia corresponds
to a ratio plasma concentration of total cholesterol:plasma
concentration of HDL (high density lipoprotein cholesterol)
superior or equal to 4.5:1, preferably 5:1.
[0049] As used herein, the term "pasteurized Akkermansia
muciniphila" means Akkermansia muciniphila submitted to heating. In
one embodiment, the pasteurized Akkermansia muciniphila of the
invention was heated at a temperature from 50.degree. C. to
100.degree. C., preferably from 60.degree. C. to 95.degree. C.,
more preferably from 70.degree. C. to 90.degree. C. In one
embodiment, the pasteurized Akkermansia muciniphila of the
invention was heated at a temperature of 50, 51, 52, 53, 54, 55,
56, 57, 58 or 59.degree. C. In another embodiment, the pasteurized
Akkermansia muciniphila of the invention was heated at a
temperature of 60, 61, 62, 63, 64, 65, 66, 67, 68 or 69.degree. C.
In yet another embodiment, the pasteurized Akkermansia muciniphila
of the invention was heated at a temperature of 70, 71, 72, 73, 74,
75, 76, 77, 78 or 79.degree. C. In yet another embodiment, the
pasteurized Akkermansia muciniphila of the invention was heated at
a temperature of 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89.degree.
C. In yet another embodiment, the pasteurized Akkermansia
muciniphila of the invention was heated at a temperature of 90, 91,
92, 93, 94, 95, 96, 97, 98, 99.degree. C. or 100.degree. C.
[0050] In one embodiment, the pasteurized Akkermansia muciniphila
of the invention was not heated at a temperature superior to
100.degree. C. In a particular embodiment, the pasteurized
Akkermansia muciniphila of the invention was not heated at an
ultra-high temperature, such as for example at a temperature of
110.degree. C. to 140.degree. C. In one embodiment, the pasteurized
Akkermansia muciniphila of the invention was not heated at a
temperature superior to 90.degree. C. Accordingly, in one
embodiment of the invention, Akkermansia muciniphila was not
sterilized. Sterilization is a treatment intended to destroy, kill
or inactivate all life forms and other biological agents. This
includes microorganisms and their spores as well as viruses and
prions. Unlike sterilization, pasteurization is not intended to
kill all microorganisms but is usually applied to food with the aim
to reduce the number of viable pathogens.
[0051] In one embodiment of the invention, the pasteurized
Akkermansia muciniphila was heated for at least 10 minutes. In
another embodiment of the invention, the pasteurized Akkermansia
muciniphila was heated for at least 15, 20, 25, 30, 35 or 45
minutes. In one embodiment, the pasteurized Akkermansia muciniphila
of the invention was heated for a period from 10 to 45 minutes.
[0052] In one embodiment, the pasteurized Akkermansia muciniphila
was not heated for a short time. In a particular embodiment, the
pasteurized Akkermansia muciniphila was not heated for a time of 1
to 30 seconds, of 1 to 60 seconds, of 1 to 90 seconds or of 1 to
120 seconds. In a preferred embodiment, the pasteurized Akkermansia
muciniphila was not heated for a time of less than 1 minute,
preferably for a time of less than 5, 6, 7, 8, or 9 minutes.
[0053] In one embodiment, the pasteurized Akkermansia muciniphila
was heated at a temperature from 50.degree. C. to 100.degree. C.
for at least 10 minutes. In a particular embodiment, the
pasteurized Akkermansia muciniphila of the invention was heated to
60.degree. C. for 20 or 30 minutes. In another particular
embodiment, the pasteurized Akkermansia muciniphila of the
invention was heated to 70.degree. C. for 20 or 30 minutes. In
another particular embodiment, the pasteurized Akkermansia
muciniphila of the invention was heated to 80.degree. C. for 20 or
30 minutes. In another particular embodiment, the pasteurized
Akkermansia muciniphila of the invention was heated to 90.degree.
C. for 20 or 30 minutes.
[0054] In a particular embodiment, the pasteurized Akkermansia
muciniphila was not heated at a temperature superior to 110.degree.
C. for about 1 to 120 seconds. In another particular embodiment,
the pasteurized Akkermansia muciniphila was not heated at a
temperature superior to 100.degree. C. for about 1 to 120 seconds.
In another particular embodiment, the pasteurized Akkermansia
muciniphila was not heated at a temperature superior to 90.degree.
C. for about 1 to 120 seconds.
[0055] According to one embodiment, pasteurized Akkermansia
muciniphila of the invention are non-viable cells. As used herein,
"non-viable cells" means cells that are not able to proliferate.
Measurement of cell viability and proliferation may be any method
known to one skilled in the art. For example, cell viability and
proliferation may be assessed by spreading a solution containing
pasteurized Akkermansia muciniphila across a petri dish or using
any other culture methods and counting the number of clones or
optical density after a determined time of incubation in optimal
growth conditions. Moreover, it is also possible to determine the
number of cells, including viable as well as non-viable cells at
least as the integrity of the cells is not compromised, by
microscopic observation. While phase-contrast microscopy is a
well-known method to do so, the microbial cells can be further
visualized by specific staining with dyes, fluorescent probes or
antibodies. This allows facilitation of microscopic observations
while the number of stained cells can be also be counted by flow
cytometry. Examples to visualize or counts cells of Akkermansia
muciniphila have been provided by Derrien et al. (2008. Appl.
Environ. Microbiol. 74:1646-8), Derrien et al. (2011. Frontiers
Microbiol. 2:166-175) or Reunanen et al. (2015. Appl. Environ.
Microbiol. 81(11):3655-62).
[0056] In one embodiment, pasteurized Akkermansia muciniphila or a
fragment thereof is substantially purified. As used herein, the
term "substantially purified" means that pasteurized Akkermansia
muciniphila or fragment thereof is comprised in a sample wherein it
represents at least about 50%, preferably at least about 60, 70,
80, 85, 90, 95, 99% or more of the bacterial strains or fragment
thereof of said sample.
[0057] The present invention also relates to a composition
comprising an effective amount of pasteurized Akkermansia
muciniphila or a fragment thereof for treating, or for use in
treating, a metabolic disorder.
[0058] In one embodiment of the invention, the effective amount of
pasteurized Akkermansia muciniphila corresponds to the amount of
the bacteria sufficient for restoring a normal amount and/or
proportion of Akkermansia muciniphila within the gut of the
subject. In one embodiment of the invention, the normal amount
and/or proportion of Akkermansia muciniphila corresponds to the
amount, and/or to the proportion of Akkermansia muciniphila present
in the gut of a healthy subject.
[0059] As used herein, the term "healthy subject" is used to define
a subject which is not affected by the disease to be treated. For
example, if pasteurized Akkermansia muciniphila or a fragment
thereof is used for treating obesity, the healthy subject is not
affected by obesity. Preferably, the healthy subject shares common
characteristics with the subject to be treated, such as, for
example, same gender, age, sex, diet, drugs intake or
geolocation.
[0060] In one embodiment of the invention, the normal proportion of
Akkermansia muciniphila in the gut ranges from about 0.1% to about
10% (in number of Akkermansia muciniphila cells to the total number
of bacteria cells of the gut), preferably from about 0.3% to about
5%, more preferably from about 1% to about 3%.
[0061] In one embodiment, the effective amount of pasteurized
Akkermansia muciniphila of the invention corresponds to an amount
of Akkermansia muciniphila before the step of pasteurization
ranging from about 1.10.sup.2 to about 1.10.sup.15 cfu, preferably
from about 1.10.sup.4 to about 1.10.sup.12 cfu, more preferably
from about 1.10.sup.5 to about 1.10.sup.10 cfu, and even more
preferably from about 1.10.sup.6 to about 1.10.sup.9 cfu, wherein
cfu stands for "colony forming unit".
[0062] In another embodiment of the invention, the effective amount
of pasteurized Akkermansia muciniphila corresponds to an amount of
Akkermansia muciniphila before the step of pasteurization ranging
from about 1.10.sup.6 to about 1.10.sup.10 cfu, preferably from
about 1.10.sup.8 to about 1.10.sup.10 cfu, more preferably from
about 1.10.sup.9 to about 1.10.sup.10 cfu.
[0063] In another embodiment of the invention, the effective amount
of pasteurized Akkermansia muciniphila corresponds to an amount of
Akkermansia muciniphila before the step of pasteurization ranging
from about 1.10.sup.6 to about 1.10.sup.11 cfu, preferably from
about 1.10.sup.8 to about 1.10.sup.11 cfu, more preferably from
about 1.10.sup.10 to about 1.10.sup.11 cfu.
[0064] In one embodiment, the effective amount of pasteurized
Akkermansia muciniphila of the invention ranges from about
1.10.sup.2 to about 1.10.sup.15 cells, preferably from about
1.10.sup.4 to about 1.10.sup.12 cells, more preferably from about
1.10.sup.5 to about 1.10.sup.10 cells, and even more preferably
from about 1.10.sup.6 to about 1.10.sup.9 cells.
[0065] In another embodiment of the invention, the effective amount
of pasteurized Akkermansia muciniphila ranges from about 1.10.sup.6
to about 1.10.sup.10 cells, preferably from about 1.10.sup.8 to
about 1.10.sup.10 cells, more preferably from about 1.10.sup.9 to
about 1.10.sup.10 cells.
[0066] In another embodiment of the invention, the effective amount
of pasteurized Akkermansia muciniphila ranges from about 1.10.sup.6
to about 1.10.sup.11 cells, preferably from about 1.10.sup.8 to
about 1.10.sup.11 cells, more preferably from about 1.10.sup.10 to
about 1.10.sup.11 cells.
[0067] In one embodiment of the invention, the effective amount of
a fragment of pasteurized Akkermansia muciniphila corresponds to an
amount of Akkermansia muciniphila before the step of pasteurization
ranging from fragments derived from about 1.10.sup.2 to about
1.10.sup.15 cfu, preferably from about 1.10.sup.4 to about
1.10.sup.12 cfu, more preferably from about 1.10.sup.5 to about
1.10.sup.10 cfu, and even more preferably from about 1.10.sup.6 to
about 1.10.sup.9 cfu, wherein cfu stands for "colony forming
unit".
[0068] In another embodiment of the invention, the effective amount
of a fragment of pasteurized Akkermansia muciniphila corresponds to
an amount of Akkermansia muciniphila before the step of
pasteurization ranging from fragments derived from about 1.10.sup.6
to about 1.10.sup.10 cfu, preferably from about 1.10.sup.8 to about
1.10.sup.10 cfu, more preferably from about 1.10.sup.9 to about
1.10.sup.10 cfu.
[0069] In another embodiment of the invention, the effective amount
of a fragment of pasteurized Akkermansia muciniphila corresponds to
an amount of Akkermansia muciniphila before the step of
pasteurization ranging from fragments derived from about 1.10.sup.6
to about 1.10.sup.11 cfu, preferably from about 1.10.sup.8 to about
1.10.sup.10 cfu, more preferably from about 1.10.sup.10 to about
1.10.sup.11 cfu.
[0070] In one embodiment of the invention, the effective amount of
a fragment of pasteurized Akkermansia muciniphila ranges from
fragments derived from about 1.10.sup.2 to about 1.10.sup.15 cells,
preferably from about 1.10.sup.4 to about 1.10.sup.12 cells, more
preferably from about 1.10.sup.5 to about 1.10.sup.10 cells, and
even more preferably from about 1.10.sup.6 to about 1.10.sup.9
cells. In another embodiment of the invention, the effective amount
of a fragment of pasteurized Akkermansia muciniphila ranges from
fragments derived from about 1.10.sup.6 to about 1.10.sup.10 cells,
preferably from about 1.10.sup.8 to about 1.10.sup.10 cells, more
preferably from about 1.10.sup.9 to about 1.10.sup.10 cells.
[0071] In another embodiment of the invention, the effective amount
of a fragment of pasteurized Akkermansia muciniphila ranges from
fragments derived from about 1.10.sup.6 to about 1.10.sup.11 cells,
preferably from about 1.10.sup.8 to about 1.10.sup.11 cells, more
preferably from about 1.10.sup.10 to about 1.10.sup.11 cells.
[0072] In one embodiment of the invention, the composition of the
invention comprises an amount of pasteurized Akkermansia
muciniphila corresponding to an amount of Akkermansia muciniphila
before the step of pasteurization ranging from about 1.10.sup.2 to
about 1.10.sup.15 cfu/g of the composition, preferably from about
1.10.sup.4 to about 1.10.sup.12 cfu/g of the composition, more
preferably from about 1.10.sup.5 to about 1.10.sup.10 cfu/g of the
composition and even more preferably from about 1.10.sup.6 to about
1.10.sup.9 cfu/g of the composition.
[0073] In one embodiment of the invention, the composition of the
invention comprises an amount of pasteurized Akkermansia
muciniphila corresponding to an amount of Akkermansia muciniphila
before the step of pasteurization ranging from about 1.10.sup.2 to
about 1.10.sup.15 cfu/mL of the composition, preferably from about
1.10.sup.4 to about 1.10.sup.12 cfu/mL of the composition, more
preferably from about 1.10.sup.5 to about 1.10.sup.10 cfu/mL of the
composition and even more preferably from about 1.10.sup.6 to about
1.10.sup.9 cfu/mL of the composition.
[0074] In another embodiment of the invention, the composition of
the invention comprises an amount of pasteurized Akkermansia
muciniphila corresponding to an amount of Akkermansia muciniphila
before the step of pasteurization ranging from about 1.10.sup.6 to
about 1.10.sup.10 cfu/g or cfu/mL of the composition, preferably
from about 1.10.sup.8 to about 1.10.sup.10 cfu/g or cfu/mL, more
preferably from about 1.10.sup.9 to about 1.10.sup.10 cfu/g or
cfu/mL.
[0075] In another embodiment of the invention, the composition of
the invention comprises an amount of pasteurized Akkermansia
muciniphila corresponding to an amount of Akkermansia muciniphila
before the step of pasteurization ranging from about 1.10.sup.6 to
about 1.10.sup.11 cfu/g or cfu/mL of the composition, preferably
from about 1.10.sup.8 to about 1.10.sup.11 cfu/g or cfu/mL, more
preferably from about 1.10.sup.10 to about 1.10.sup.11 cfu/g or
cfu/mL.
[0076] In one embodiment of the invention, the composition of the
invention comprises an amount of pasteurized Akkermansia
muciniphila ranging from about 1.10.sup.2 to about 1.10.sup.15
cells/g of the composition, preferably from about 1.10.sup.4 to
about 1.10.sup.12 cells/g of the composition, more preferably from
about 1.10.sup.5 to about 1.10.sup.10 cells/g of the composition
and even more preferably from about 1.10.sup.6 to about 1.10.sup.9
cells/g of the composition.
[0077] In one embodiment of the invention, the composition of the
invention comprises an amount of pasteurized Akkermansia
muciniphila ranging from about 1.10.sup.2 to about 1.10.sup.15
cells/mL of the composition, preferably from about 1.10.sup.4 to
about 1.10.sup.12 cells/mL of the composition, more preferably from
about 1.10.sup.5 to about 1.10.sup.10 cells/mL of the composition
and even more preferably from about 1.10.sup.6 to about 1.10.sup.9
cells/mL of the composition.
[0078] In another embodiment of the invention, the composition of
the invention comprises an amount of pasteurized Akkermansia
muciniphila ranging from about 1.10.sup.6 to about 1.10.sup.10
cells/g or cells/mL of the composition, preferably from about
1.10.sup.8 to about 1.10.sup.10 cells/g or cells/mL, more
preferably from about 1.10.sup.9 to about 1.10.sup.10 cells/g or
cells/mL.
[0079] In another embodiment of the invention, the composition of
the invention comprises an amount of pasteurized Akkermansia
muciniphila ranging from about 1.10.sup.6 to about 1.10.sup.11
cells/g or cells/mL of the composition, preferably from about
1.10.sup.8 to about 1.10.sup.11 cells/g or cells/mL, more
preferably from about 1.10.sup.10 to about 1.10.sup.11 cells/g or
cells/mL.
[0080] In one embodiment of the invention, the composition of the
invention comprises an amount of fragments of pasteurized
Akkermansia muciniphila corresponding to an amount of Akkermansia
muciniphila before the step of pasteurization ranging from
fragments derived from about 1.10.sup.2 to about 1.10.sup.15 cfu/g
or cfu/mL of the composition, preferably from about 1.10.sup.4 to
about 1.10.sup.12 cfu/g or cfu/mL of the composition, more
preferably from about 1.10.sup.5 to about 1.10.sup.10 cfu/g or
cfu/mL of the composition and even more preferably from about
1.10.sup.6 to about 1.10.sup.9 cfu/g or cfu/mL of the
composition.
[0081] In another embodiment of the invention, the composition of
the invention comprises an amount of fragments of pasteurized
Akkermansia muciniphila corresponding to an amount of Akkermansia
muciniphila before the step of pasteurization ranging from
fragments derived from about 1.10.sup.6 to about 1.10.sup.10 cfu/g
or cfu/mL of the composition, preferably from about 1.10.sup.8 to
about 1.10.sup.10 cfu/g or cfu/mL, more preferably from about
1.10.sup.9 to about 1.10.sup.10 cfu/g or cfu/mL.
[0082] In another embodiment of the invention, the composition of
the invention comprises an amount of fragments of pasteurized
Akkermansia muciniphila corresponding to an amount of Akkermansia
muciniphila before the step of pasteurization ranging from
fragments derived from about 1.10.sup.6 to about 1.10.sup.11 cfu/g
or cfu/mL of the composition, preferably from about 1.10.sup.8 to
about 1.10.sup.11 cfu/g or cfu/mL, more preferably from about
1.10.sup.10 to about 1.10.sup.11 cfu/g or cfu/mL.
[0083] In one embodiment of the invention, the composition of the
invention comprises an amount of fragments of pasteurized
Akkermansia muciniphila ranging from fragments derived from about
1.10.sup.2 to about 1.10.sup.15 cells/g or cells/mL of the
composition, preferably from about 1.10.sup.4 to about 1.10.sup.12
cells/g or cells/mL of the composition, more preferably from about
1.10.sup.5 to about 1.10.sup.10 cells/g or cells/mL of the
composition and even more preferably from about 1.10.sup.6 to about
1.10.sup.9 cells/g or cells/mL of the composition.
[0084] In another embodiment of the invention, the composition of
the invention comprises an amount of fragments of pasteurized
Akkermansia muciniphila ranging from fragments derived from about
1.10.sup.6 to about 1.10.sup.10 cells/g or cells/mL of the
composition, preferably from about 1.10.sup.8 to about 1.10.sup.10
cells/g or cells/mL, more preferably from about 1.10.sup.9 to about
1.10.sup.10 cells/g or cells/mL.
[0085] In another embodiment of the invention, the composition of
the invention comprises an amount of fragments of pasteurized
Akkermansia muciniphila ranging from fragments derived from about
1.10.sup.6 to about 1.10.sup.11 cells/g or cells/mL of the
composition, preferably from about 1.10.sup.8 to about 1.10.sup.11
cells/g or cells/mL, more preferably from about 1.10.sup.10 to
about 1.10.sup.11 cells/g or cells/mL.
[0086] The present invention also relates to a pharmaceutical
composition comprising an effective amount of pasteurized
Akkermansia muciniphila or a fragment thereof and at least one
pharmaceutically acceptable excipient. In one embodiment of the
invention, the pharmaceutical composition of the invention is for
treating or preventing a metabolic disorder. In another embodiment
of the invention, the pharmaceutical composition is for restoring a
normal proportion of Akkermansia muciniphila or increasing the
abundance of any active compounds of Akkermansia muciniphila in the
gut of a subject in need thereof.
[0087] As used herein the term "pharmaceutically acceptable
excipient" refers to an excipient that does not produce an adverse,
allergic or other untoward reaction when administered to an animal,
preferably a human. It may include any and all solvents, dispersion
media, coatings, isotonic and absorption delaying agents and the
like. For human administration, preparations should meet sterility,
pyrogenicity, general safety and purity standards as required by
FDA Office of Biologics standards.
[0088] The present invention also relates to a medicament
comprising an effective amount of pasteurized Akkermansia
muciniphila or a fragment thereof. In one embodiment of the
invention, the medicament of the invention is for treating or
preventing a metabolic disorder. In another embodiment of the
invention, the medicament is for restoring a normal proportion of
Akkermansia muciniphila in the gut of a subject in need
thereof.
[0089] The present invention also relates to a method for treating
or preventing a metabolic disorder in a subject in need thereof,
wherein said method comprises administering an effective amount of
pasteurized Akkermansia muciniphila or a fragment thereof to the
subject.
[0090] Another object of the invention is a method for restoring a
normal proportion of Akkermansia muciniphila, fragments or other
active compounds of Akkermansia muciniphila in the gut of a subject
in need thereof, wherein said method comprises administering an
effective amount of pasteurized Akkermansia muciniphila or a
fragment thereof to the subject.
[0091] In one embodiment, the method of the invention comprises
administering an effective amount of the composition, of the
pharmaceutical composition or of the medicament of the invention to
the subject.
[0092] In one embodiment of the invention, pasteurized Akkermansia
muciniphila or a fragment thereof, or the composition,
pharmaceutical composition or medicament is administered at least
once a week, preferably at least twice a week, more preferably at
least three times a week, and even more preferably at least four
times a week. In another embodiment, pasteurized Akkermansia
muciniphila or a fragment thereof, or the composition,
pharmaceutical composition or medicament is administered at least
once a day, and preferably at least twice a day.
[0093] In one embodiment, pasteurized Akkermansia muciniphila or a
fragment thereof, or the composition, pharmaceutical composition or
medicament of the invention is administered during 1 week,
preferably during 2, 3, 4, 5, 6, 7 or 8 weeks or more.
[0094] In one embodiment, pasteurized Akkermansia muciniphila or a
fragment thereof, or the composition, pharmaceutical composition or
medicament of the invention is administered for a period that lasts
until the desired outcome is achieved (e.g., weight loss, metabolic
disorder treatment, decrease of cholesterol plasma level . . .
).
[0095] In one embodiment, the administration of pasteurized
Akkermansia muciniphila or a fragment thereof, or the composition,
pharmaceutical composition or medicament of the invention is
permanent, i.e. is not limited in time.
[0096] In one embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day
corresponds to an amount of Akkermansia muciniphila before the step
of pasteurization ranging from 1.10.sup.2 to about 1.10.sup.15
cfu/day, preferably from about 1.10.sup.4 to about 1.10.sup.12
cfu/day, more preferably from about 1.10.sup.5 to about 1.10.sup.10
cfu/day and even more preferably from about 1.10.sup.6 to about
1.10.sup.9 cfu/day.
[0097] In another embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day
corresponds to an amount of Akkermansia muciniphila before the step
of pasteurization ranging from 1.10.sup.6 to about 1.10.sup.10
cfu/day, preferably from about 1.10.sup.8 to about 1.10.sup.10
cfu/day, more preferably from about 1.10.sup.9 to about 1.10.sup.10
cfu/day.
[0098] In another embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day
corresponds to an amount of Akkermansia muciniphila before the step
of pasteurization ranging from 1.10.sup.6 to about 1.10.sup.11
cfu/day, preferably from about 1.10.sup.8 to about 1.10.sup.11
cfu/day, more preferably from about 1.10.sup.10 to about
1.10.sup.11 cfu/day.
[0099] In one embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day ranges
from 1.10.sup.2 to about 1.10.sup.15 cells/day, preferably from
about 1.10.sup.4 to about 1.10.sup.12 cells/day, more preferably
from about 1.10.sup.5 to about 1.10.sup.10 cells/day and even more
preferably from about 1.10.sup.6 to about 1.10.sup.9 cells/day.
[0100] In another embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day ranges
from 1.10.sup.6 to about 1.10.sup.10 cells/day, preferably from
about 1.10.sup.8 to about 1.10.sup.10 cells/day, more preferably
from about 1.10.sup.9 to about 1.10.sup.10 cells/day.
[0101] In another embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day ranges
from 1.10.sup.6 to about 1.10.sup.11 cells/day, preferably from
about 1.10.sup.8 to about 1.10.sup.11 cells/day, more preferably
from about 1.10.sup.10 to about 1.10.sup.11 cells/day.
[0102] In one embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day corresponds to an amount of Akkermansia muciniphila before the
step of pasteurization ranging from fragments derived from
1.10.sup.2 to about 1.10.sup.15 cfu/day, preferably from about
1.10.sup.4 to about 1.10.sup.12 cfu/day, more preferably from about
1.10.sup.5 to about 1.10.sup.10 cfu/day and even more preferably
from about 1.10.sup.6 to about 1.10.sup.9 cfu/day.
[0103] In another embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day corresponds to an amount of Akkermansia muciniphila before the
step of pasteurization ranging from fragments derived from
1.10.sup.6 to about 1.10'.sup.0 cfu/day, preferably from about
1.10.sup.8 to about 1.10.sup.10 cfu/day, more preferably from about
1.10.sup.9 to about 1.10.sup.10 cfu/day.
[0104] In another embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day corresponds to an amount of Akkermansia muciniphila before the
step of pasteurization ranging from fragments derived from
1.10.sup.6 to about 1.10.sup.11 cfu/day, preferably from about
1.10.sup.8 to about 1.10.sup.11 cfu/day, more preferably from about
1.10.sup.10 to about 1.10.sup.11 cfu/day.
[0105] In one embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day ranges from fragments derived from 1.10.sup.2 to about
1.10.sup.15 cells/day, preferably from about 1.10.sup.4 to about
1.10.sup.12 cells/day, more preferably from about 1.10.sup.5 to
about 1.10.sup.10 cells/day and even more preferably from about
1.10.sup.6 to about 1.10.sup.9 cells/day.
[0106] In another embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day ranges from fragments derived from 1.10.sup.6 to about
1.10.sup.10 cells/day, preferably from about 1.10.sup.8 to about
1.10.sup.10 cells/day, more preferably from about 1.10.sup.9 to
about 1.10.sup.10 cells/day.
[0107] In another embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day ranges from fragments derived from 1.10.sup.6 to about
1.10.sup.11 cells/day, preferably from about 1.10.sup.8 to about
1.10.sup.11 cells/day, more preferably from about 1.10.sup.10 to
about 1.10.sup.11 cells/day.
[0108] In one embodiment of the invention, the subject is
overweight. In another embodiment, the subject is obese.
[0109] In one embodiment of the invention, the subject is diagnosed
with a metabolic disorder, such as, for example, with an overweight
and/or obesity related metabolic disorder. In one embodiment of the
invention, the subject is diagnosed with a metabolic disorder, such
as, for example, with a normal weight and/or impaired fasting
glucose and/or hypertriglyceridemia and/or any related metabolic
disorder or cardiovascular risk factor.
[0110] In another embodiment, the subject is at risk of developing
a metabolic disorder, such as, for example, an overweight and/or
obesity related metabolic disorder. In one embodiment, said risk is
related to the fact that the subject is overweight or obese. In
another embodiment, said risk corresponds to a predisposition, such
as, for example, a familial predisposition to a metabolic disorder,
such as, for example, to an overweight and/or obesity related
metabolic disorder.
[0111] In one embodiment of the invention, the subject presents a
deregulation of the gut microbiota composition. Preferably, the gut
microbiota of said subject is depleted in Akkermansia muciniphila
strains. In one embodiment, the proportion of Akkermansia
muciniphila in the gut of the subject is inferior to 1%, preferably
inferior to 0.5%, more preferably inferior to 0.1%, in number of
Akkermansia muciniphila cells to the total number of bacterial
cells in the gut.
[0112] The present invention also relates to the cosmetic use of
pasteurized Akkermansia muciniphila or a fragment thereof for
promoting weight loss in a subject.
[0113] Another object of the invention is thus a cosmetic
composition comprising a cosmetically effective amount of
pasteurized Akkermansia muciniphila or a fragment thereof, and the
use thereof for promoting weight loss in a subject. As used herein,
a "cosmetically effective amount" refers to the amount of a
cosmetic composition necessary and sufficient for promoting a
cosmetic effect, such as, for example, for inducing weight loss in
a subject.
[0114] The present invention also relates to a method for promoting
weight loss in a subject in need thereof, wherein said method
comprises administering a cosmetically effective amount of
pasteurized Akkermansia muciniphila or a fragment thereof to said
subject.
[0115] In one embodiment, the method of the invention comprises
administering a cosmetically effective amount of the composition or
of the cosmetic composition of the invention to the subject.
[0116] In one embodiment of the invention, the cosmetically
effective amount of pasteurized Akkermansia muciniphila corresponds
to an amount of Akkermansia muciniphila before the step of
pasteurization ranging from about 1.10.sup.2 to about 1.10.sup.15
cfu, preferably from about 1.10.sup.4 to about 1.10.sup.12 cfu,
more preferably from about 1.10.sup.5 to about 1.10.sup.10 cfu and
even more preferably from about 1.10.sup.6 to about 1.10.sup.9
cfu.
[0117] In another embodiment of the invention, the cosmetically
effective amount of pasteurized Akkermansia muciniphila corresponds
to an amount of Akkermansia muciniphila before the step of
pasteurization ranging from about 1.10.sup.6 to about 1.10.sup.10
cfu, preferably from about 1.10.sup.8 to about 1.10.sup.10 cfu,
more preferably from about 1.10.sup.9 to about 1.10.sup.10 cfu.
[0118] In another embodiment of the invention, the cosmetically
effective amount of pasteurized Akkermansia muciniphila corresponds
to an amount of Akkermansia muciniphila before the step of
pasteurization ranging from about 1.10.sup.6 to about 1.10.sup.11
cfu, preferably from about 1.10.sup.8 to about 1.10.sup.11 cfu,
more preferably from about 1.10.sup.10 to about 1.10.sup.11
cfu.
[0119] In one embodiment of the invention, the cosmetically
effective amount of pasteurized Akkermansia muciniphila ranges from
about 1.10.sup.2 to about 1.10.sup.15 cells, preferably from about
1.10.sup.4 to about 1.10.sup.12 cells, more preferably from about
1.10.sup.5 to about 1.10.sup.10 cells and even more preferably from
about 1.10.sup.6 to about 1.10.sup.9 cells.
[0120] In another embodiment of the invention, the cosmetically
effective amount of pasteurized Akkermansia muciniphila ranges from
about 1.10.sup.6 to about 1.10.sup.10 cells, preferably from about
1.10.sup.8 to about 1.10.sup.10 cells, more preferably from about
1.10.sup.9 to about 1.10.sup.10 cells.
[0121] In another embodiment of the invention, the cosmetically
effective amount of pasteurized Akkermansia muciniphila ranges from
about 1.10.sup.6 to about 1.10.sup.11 cells, preferably from about
1.10.sup.8 to about 1.10.sup.11 cells, more preferably from about
1.10.sup.10 to about 1.10.sup.11 cells.
[0122] In one embodiment of the invention, the cosmetically
effective amount of fragments of pasteurized Akkermansia
muciniphila corresponds to an amount of Akkermansia muciniphila
before the step of pasteurization ranging from fragments derived
from about 1.10.sup.2 to about 1.10.sup.1' cfu, preferably from
about 1.10.sup.4 to about 1.10.sup.12 cfu, more preferably from
about 1.10.sup.5 to about 1.10.sup.10 cfu and even more preferably
from about 1.10.sup.6 to about 1.10.sup.9 cfu.
[0123] In another embodiment of the invention, the cosmetically
effective amount of fragments of pasteurized Akkermansia
muciniphila corresponds to an amount of Akkermansia muciniphila
before the step of pasteurization ranging from fragments derived
from about 1.10.sup.6 to about 1.10.sup.10 cfu, preferably from
about 1.10.sup.8 to about 1.10.sup.10 cfu, more preferably from
about 1.10.sup.9 to about 1.10.sup.10 cfu.
[0124] In another embodiment of the invention, the cosmetically
effective amount of fragments of pasteurized Akkermansia
muciniphila corresponds to an amount of Akkermansia muciniphila
before the step of pasteurization ranging from fragments derived
from about 1.10.sup.6 to about 1.10.sup.11 cfu, preferably from
about 1.10.sup.8 to about 1.10.sup.11 cfu, more preferably from
about 1.10.sup.10 to about 1.10.sup.11 cfu.
[0125] In one embodiment of the invention, the cosmetically
effective amount of fragments of pasteurized Akkermansia
muciniphila ranges from fragments derived from about 1.10.sup.2 to
about 1.10.sup.15 cells, preferably from about 1.10.sup.4 to about
1.10.sup.12 cells, more preferably from about 1.10.sup.5 to about
1.10.sup.10 cells and even more preferably from about 1.10.sup.6 to
about 1.10.sup.9 cells.
[0126] In another embodiment of the invention, the cosmetically
effective amount of fragments of pasteurized Akkermansia
muciniphila ranges from fragments derived from about 1.10.sup.6 to
about 1.10.sup.10 cells, preferably from about 1.10.sup.8 to about
1.10.sup.10 cells, more preferably from about 1.10.sup.9 to about
1.10.sup.10 cells.
[0127] In another embodiment of the invention, the cosmetically
effective amount of fragments of pasteurized Akkermansia
muciniphila ranges from fragments derived from about 1.10.sup.6 to
about 1.10.sup.11 cells, preferably from about 1.10.sup.8 to about
1.10.sup.11 cells, more preferably from about 1.10.sup.10 to about
1.10.sup.11 cells.
[0128] In one embodiment of the invention, pasteurized Akkermansia
muciniphila or a fragment thereof, or the composition or cosmetic
composition is administered at least once a week, preferably at
least twice a week, more preferably at least three times a week,
and even more preferably at least four times a week. In another
embodiment, pasteurized Akkermansia muciniphila or a fragment
thereof, or the composition or cosmetic composition is administered
at least once a day, and preferably at least twice a day.
[0129] In one embodiment, pasteurized Akkermansia muciniphila or a
fragment thereof, or the composition or cosmetic composition of the
invention is administered during 1 week, preferably 2, 3, 4, 5, 6,
7 or 8 weeks or more.
[0130] In one embodiment, pasteurized Akkermansia muciniphila or a
fragment thereof, or the composition or cosmetic composition of the
invention is administered for a period that lasts until the desired
outcome is achieved (e.g., weight loss . . . ).
[0131] In one embodiment, the administration of pasteurized
Akkermansia muciniphila or a fragment thereof, or the composition
or cosmetic composition of the invention is permanent, i.e. is not
limited in time.
[0132] In one embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day
corresponds to an amount of Akkermansia muciniphila before the step
of pasteurization ranging from 1.10.sup.2 to about 1.10.sup.15
cfu/day, preferably from about 1.10.sup.5 to about 1.10.sup.12
cfu/day, more preferably from about 1.10.sup.8 to about 1.10.sup.10
cfu/day, and even more preferably from about 1.10.sup.9 to about
1.10.sup.10 cfu/day.
[0133] In another embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day
corresponds to an amount of Akkermansia muciniphila before the step
of pasteurization ranging from 1.10.sup.6 to about 1.10.sup.10
cfu/day, preferably from about 1.10.sup.8 to about 1.10.sup.10
cfu/day, more preferably from about 1.10.sup.9 to about 1.10.sup.10
cfu/day.
[0134] In another embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day
corresponds to an amount of Akkermansia muciniphila before the step
of pasteurization ranging from 1.10.sup.6 to about 1.10.sup.11
cfu/day, preferably from about 1.10.sup.8 to about 1.10.sup.11
cfu/day, more preferably from about 1.10.sup.10 to about
1.10.sup.11 cfu/day.
[0135] In one embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day ranges
from 1.10.sup.2 to about 1.10.sup.15 cells/day, preferably from
about 1.10.sup.5 to about 1.10.sup.12 cells/day, more preferably
from about 1.10.sup.8 to about 1.10.sup.10 cells/day, and even more
preferably from about 1.10.sup.9 to about 1.10.sup.10
cells/day.
[0136] In another embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day ranges
from 1.10.sup.6 to about 1.10.sup.10 cells/day, preferably from
about 1.10.sup.8 to about 1.10.sup.10 cells/day, more preferably
from about 1.10.sup.9 to about 1.10.sup.10 cells/day.
[0137] In another embodiment of the invention, the daily amount of
pasteurized Akkermansia muciniphila administered per day ranges
from 1.10.sup.6 to about 1.10.sup.11 cells/day, preferably from
about 1.10.sup.8 to about 1.10.sup.11 cells/day, more preferably
from about 1.10.sup.10 to about 1.10.sup.11 cells/day.
[0138] In one embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day corresponds to an amount of Akkermansia muciniphila before the
step of pasteurization ranging from fragments derived from about
1.10.sup.2 to about 1.10.sup.15 cfu/day, preferably from about
1.10.sup.5 to about 1.10.sup.12 cfu/day, more preferably from about
1.10.sup.8 to about 1.10.sup.10 cfu/day, and even more preferably
from about 1.10.sup.9 to about 1.10.sup.10 cfu/day.
[0139] In another embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day corresponds to an amount of Akkermansia muciniphila before the
step of pasteurization ranging from fragments derived from about
1.10.sup.6 to about 1.10.sup.10 cfu/day, preferably from about
1.10.sup.8 to about 1.10.sup.10 cfu/day, more preferably from about
1.10.sup.9 to about 1.10.sup.10 cfu/day.
[0140] In another embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day corresponds to an amount of Akkermansia muciniphila before the
step of pasteurization ranging from fragments derived from about
1.10.sup.6 to about 1.10.sup.11 cfu/day, preferably from about
1.10.sup.8 to about 1.10.sup.11 cfu/day, more preferably from about
1.10.sup.10 to about 1.10.sup.11 cfu/day.
[0141] In one embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day ranges from fragments derived from about 1.10.sup.2 to about
1.10.sup.15 cells/day, preferably from about 1.10.sup.5 to about
1.10.sup.12 cells/day, more preferably from about 1.10.sup.8 to
about 1.10.sup.10 cells/day, and even more preferably from about
1.10.sup.9 to about 1.10.sup.10 cells/day.
[0142] In another embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day ranges from fragments derived from about 1.10.sup.6 to about
1.10.sup.10 cells/day, preferably from about 1.10.sup.8 to about
1.10.sup.10 cells/day, more preferably from about 1.10.sup.9 to
about 1.10.sup.10 cells/day.
[0143] In another embodiment of the invention, the daily amount of
fragments of pasteurized Akkermansia muciniphila administered per
day ranges from fragments derived from about 1.10.sup.6 to about
1.10.sup.11 cells/day, preferably from about 1.10.sup.8 to about
1.10.sup.11 cells/day, more preferably from about 1.10.sup.10 to
about 1.10.sup.11 cells/day.
[0144] In one embodiment, said subject is not an obese subject. In
another embodiment, said subject is overweight.
[0145] In one embodiment of the invention, the composition, the
pharmaceutical composition, the cosmetic composition or the
medicament further comprises additional probiotic strains or
species, such as, for example, bacterial probiotic strains or
species; prokaryotes probiotics other than bacteria; or fungal
strains or species, preferably yeast strains or species. In one
embodiment, said additional probiotic strains or species are
selected from those naturally present in the gut of the subject,
preferably in the human gut, more preferably in the gut of healthy
human subjects.
[0146] Examples of bacterial probiotic strains or species that may
be used in the present invention include, but are not limited to
Lactobacillus, Laciococcus, Bifidobacterium, Veillonella, Desemzia,
Christensenella, Allobaculum, Coprococcus, Collinsella,
Citrobacter, Turicibacter, Sutterella, Subdoligranulum,
Streptococcus, Sporobacter, Sporacetigenium, Ruminococcus,
Roseburia, Proteus, Propionobacterium, Leuconostoc, Weissella,
Pediococcus, Streptococcus, Prevotella, Parabacteroides,
Papillibacter, Oscillospira, Melissococcus, Dorea, Dialister,
Clostridium, Cedecea, Catenibacterium, Butyrivibrio, Buttiauxella,
Bulleidia, Bilophila, Bacteroides, Anaerovorax, Anaerostopes,
Anaerofilum, Enterobacteriaceae, Fermicutes, Atopobium, Alistipes,
Acinetobacter, Slackie, Shigella, Shewanella, Serratia, Mahella,
Lachnospira, Klebsiella, Idiomarina, Fusobacterium,
Faecalibacterium, Eubacterium, Enterococcus, Enterobacter,
Eggerthella.
[0147] In one particular embodiment, said bacterial probiotic
strains or species are selected from the list comprising
Bifidobacterium and Lactobacillus. In one embodiment,
Bifidobacterium probiotic strains or species are preferably
selected from the group comprising Bifidobacterium animalis, more
preferably Bifidobacterium animalis spp. lactis, and
Bifidobacterium lactis. In one embodiment, Lactobacillus probiotic
strains or species are preferably selected from the group
comprising Lactobacillus rhamnosus, Lactobacillus casei and
Lactobacillus acidophilus.
[0148] Examples of prokaryote strains or species that may be used
in the present invention include, but are not limited to Archaea,
Firmicutes, Verrucomicrobia, Christensenella, Bacteroidetes (such
as, for example, Allistipes, Bacteroides ovatus, Bacteroides
splachnicus, Bacteroides stercoris, Parabacteroides, Prevotella
ruminicola, Porphyromondaceae, and related genus), Proteobacteria,
Betaproteobacteria (such as, for example, Aquabacterium and
Burkholderia), Gammaproteobacteria (such as, for example,
Xanthomonadaceae), Actinobacteria (such as, for example,
Actinomycetaceae and Atopobium), Fusobacteria, Methanobacteria,
Spirochaetes, Fibrobacteres, Deferribacteres, Deinococcus, Thermus,
Cyanobacteria, Methanobrevibacteria, Peptostreptococcus,
Ruminococcus, Coprococcus, Subdolingranulum, Dorea, Bulleidia,
Anaerofustis, Gemella, Roseburia, Dialister, Anaerotruncus,
Staphylococcus, Micrococcus, Propionobacteria, Enterobacteriaceae,
Faecalibacterium, Bacteroides, Parabacteroides, Prevotella,
Eubacterium, Bacilli (such as, for example, Lactobacillus
salivarius and related species, Aerococcus, Granulicatella,
Streptococcus bovis and related genus and Streptococcus intermedius
and related genus), Clostridium (such as, for example, Eubacterium
hallii, Eubacterium limosum and related genus) and
Butyrivibrio.
[0149] Examples of fungal probiotic strains or species, preferably
yeast probiotic strains or species that may be used in the present
invention include, but are not limited Ascomycetes, Zygomycetes and
Deuteromycetes, preferably from the groups Aspergillus, Torulopsis,
Zygosaccharomyces, Hansenula, Candida, Saccharomyces, Clavispora,
Bretanomyces, Pichia, Amylomyces, Zygosaccharomyces, Endomycess,
Hyphopichia, Zygosaccharomyces, Kluyveromyces, Mucor, Rhizopus,
Yarrowia, Endomyces, Debaryomyces, and/or Penicillium.
[0150] In one embodiment of the invention, the composition, the
pharmaceutical composition, the cosmetic composition or the
medicament does not comprise the bacterial strains
Lactobacillus-Enterococcus, Bacteroides and/or Atopobium.
[0151] In one embodiment of the invention, the only one microbial
strain or species, preferably bacterial strain or species,
comprised in the composition, pharmaceutical composition, cosmetic
composition or medicament is Akkermansia muciniphila.
[0152] In one embodiment of the invention, the composition,
pharmaceutical composition, cosmetic composition or medicament
consists of pasteurized Akkermansia muciniphila.
[0153] In another embodiment of the invention, the composition,
pharmaceutical composition, cosmetic composition or medicament
consists essentially of pasteurized Akkermansia muciniphila,
wherein "consisting essentially of" herein means that Akkermansia
muciniphila is the only microbial strain or species, preferably the
only bacterial strain or species comprised in the composition,
pharmaceutical composition, cosmetic composition or medicament.
[0154] In one embodiment of the invention, pasteurized Akkermansia
muciniphila or a fragment thereof activates or inhibits the growth
and/or biological activity of other bacterial strain(s) or species
of the gut microbiota.
[0155] In one embodiment of the invention, the composition, the
pharmaceutical composition, the cosmetic composition or the
medicament further comprises a prebiotic.
[0156] Examples of prebiotics that may be used in the present
invention include, but are not limited to, inulin and inulin-type
fructans, oligofructose, beta-glucans, xylose, arabinose,
arabinoxylan, ribose, galactose, rhamnose, cellobiose, fructose,
lactose, salicin, sucrose, glucose, esculin, tween 80, trehalose,
maltose, mannose, mellibiose, mucus or mucins, raffinose,
fructooligosaccharides, galacto-oligosaccharides, amino acids,
alcohols, fermentable carbohydrates and any combinations
thereof.
[0157] Other non-limiting examples of prebiotics include
water-soluble cellulose derivatives, water-insoluble cellulose
derivatives, unprocessed oatmeal, metamucil, all-bran, and any
combinations thereof.
[0158] Examples of water-soluble cellulose derivatives include, but
are not limited to, methylcellulose, methyl ethyl cellulose,
hydroxyethyl cellulose, ethyl hydroxyethyl cellulose, cationic
hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxyethyl
methylcellulose, hydroxypropyl methylcellulose, and carboxymethyl
cellulose.
[0159] Pasteurized Akkermansia muciniphila or a fragment thereof or
the composition, pharmaceutical composition, cosmetic composition
or medicament of the invention may be administered by several
routes of administration. Examples of adapted routes of
administration include, but are not limited to, oral
administration, rectal administration, administration via
esophagogastroduodenoscopy, administration via colonoscopy,
administration using a nasogastric or orogastric tube and the
like.
[0160] According to an embodiment, pasteurized Akkermansia
muciniphila or a fragment thereof or the composition,
pharmaceutical composition, cosmetic composition or medicament of
the invention is in a form adapted to oral administration.
According to a first embodiment, the form adapted to oral
administration is a solid form selected from the group comprising
tablets, pills, capsules, soft gelatin capsules, sugarcoated pills,
orodispersing tablets, effervescent tablets or other solids.
According to a second embodiment, the form adapted to oral
administration is a liquid form, such as, for example, a drinkable
solution, liposomal forms and the like.
[0161] In one embodiment, the composition, pharmaceutical
composition, cosmetic composition or medicament of the invention
further comprises excipients, diluent and/or carriers selected with
regard to the intended route of administration. Examples of
excipients, diluent and/or carriers include, but are not limited
to, water, phosphate buffer saline, anaerobic phosphate buffer
saline, sodium bicarbonate, juice, milk, yogurt, infant formula,
dairy product, coloring agents, such as, for example, titane
dioxide (E171), iron dioxide (E172) and brilliant black BN (E151);
flavoring agents; thickeners, such as, for example, glycerol
monostearate; sweeteners; coating agents, such as, for example,
refined colza oil, soya oil, peanut oil, soya lecithin or fish
gelatin; diluting agents, such as, for example, lactose,
monohydrated lactose or starch; binding agents, such as, for
example, povidone, pregelatinized starch, gums, saccharose,
polyethylene glycol (PEG) 4000 or PEG 6000; disintegrating agents,
such as, for example, microcrystalline cellulose or sodium
carboxymethyl starch, such as, for example, sodium carboxymethyl
starch type A; lubricant agents, such as, for example, magnesium
stearate; flow agent, such as, for example, colloidal anhydrous
silica, etc. . . . .
[0162] In one embodiment of the invention, the composition,
pharmaceutical composition, cosmetic composition or medicament is
in the form of a nutritional composition, i.e. comprises liquid or
solid food, feed or drinking water. In one embodiment of the
invention, the composition, pharmaceutical composition, cosmetic
composition or medicament is a food product, such as, for example,
dairy products, dairy drinks, yogurt, fruit or vegetable juice or
concentrate thereof, powders, malt or soy or cereal based
beverages, breakfast cereal such as muesli flakes, fruit and
vegetable juice powders, cereal and/or chocolate bars,
confectionary, spreads, flours, milk, smoothies, confectionary,
milk product, milk powder, reconstituted milk, cultured milk,
yoghurt, drinking yoghurt, set yoghurt, drink, dairy drink, milk
drink, chocolate, gels, ice creams, cereals, reconstituted fruit
products, snack bars, food bars, muesli bars, spreads, sauces,
dips, dairy products including yoghurts and cheeses, drinks
including dairy and non-dairy based drinks, sports supplements
including dairy and non-dairy based sports supplements.
[0163] In one embodiment of the invention, the composition,
pharmaceutical composition, cosmetic composition or medicament is
in the form of a food additive, drink additive, dietary supplement,
nutritional product, medical food or nutraceutical composition.
[0164] It is known that obesity and related disorders are
associated with an increased gut permeability and with impaired
mucus production, epithelium barrier, immune system and/or
antibacterial compounds production by the subject; and the
Applicant suggests that the administration of pasteurized
Akkermansia muciniphila may restore these parameters. Therefore,
the present invention also relates to pasteurized Akkermansia
muciniphila or a fragment thereof for decreasing gut permeability
and/or for restoring impaired mucus production and/or for restoring
epithelium barrier and/or for restoring immune system and/or for
restoring the production of antibacterial compounds. Another object
of the invention is a method for decreasing gut permeability and/or
for restoring impaired mucus production and/or for restoring
epithelium barrier and/or for restoring immune system and/or for
restoring the production of antibacterial compounds in a subject in
need thereof, comprising administering an effective or cosmetically
effective amount of pasteurized Akkermansia muciniphila or a
fragment thereof to a subject in need thereof Therefore, the
present invention also relates to pasteurized Akkermansia
muciniphila or a fragment thereof for controlling gut barrier
function, and to a method for controlling gut barrier function
comprising administering an effective or cosmetically effective
amount of pasteurized Akkermansia muciniphila or a fragment thereof
to a subject in need thereof. In one embodiment, pasteurized
Akkermansia muciniphila or a fragment thereof regulates mucus layer
thickness (which may be decreased in obesity or other metabolic
disorders).
[0165] In another embodiment, the administration of pasteurized
Akkermansia muciniphila or a fragment thereof induces the
production of colon antimicrobial peptides, such as, for example,
RegIIIgamma. In another embodiment, the administration of
pasteurized Akkermansia muciniphila or a fragment thereof induces
the production of compounds of the endocannabinoids family, such
as, for example, acylglycerols selected from the group comprising
2-oleoylglycerol, 2-palmitoylglycerol and 2-arachidonoylglycerol.
In another embodiment, the administration of pasteurized
Akkermansia muciniphila or a fragment thereof regulates mucus
turnover.
[0166] Another object of the invention concerns pasteurized
Akkermansia muciniphila or a fragment thereof for use in treating
metabolic dysfunction associated with or caused by a metabolic
disorder. Still another object of the invention is thus a method
for treating metabolic dysfunction associated with or caused by a
metabolic disorder in a subject in need thereof, comprising
administering an effective amount or a cosmetically effective
amount of pasteurized Akkermansia muciniphila or a fragment thereof
to a subject in need thereo.
[0167] The Applicant also showed that the administration of
pasteurized Akkermansia muciniphila controls fat storage and
adipose tissue metabolism. Therefore, another object of the
invention concerns pasteurized Akkermansia muciniphila or a
fragment thereof for use in controlling fat storage and adipose
tissue metabolism. Another object of the invention is also a method
for controlling fat storage and adipose tissue metabolism
comprising administering an effective amount or a cosmetically
effective amount of pasteurized Akkermansia muciniphila or a
fragment thereof to a subject in need thereof. In one embodiment,
said control does not involve any change in food intake. In one
embodiment of the invention, administration of pasteurized
Akkermansia muciniphila or a fragment thereof abolishes metabolic
endotoxemia. In another embodiment, administration of pasteurized
Akkermansia muciniphila or a fragment thereof lowers fat mass. In
another embodiment, administration of pasteurized Akkermansia
muciniphila or a fragment thereof increases mRNA expression of
markers of adipocyte differentiation and lipid oxidation,
preferably without affecting lipogenesis.
[0168] The present invention also relates to pasteurized
Akkermansia muciniphila or a fragment thereof for use in the
regulation of adipose tissue metabolism and glucose homeostasis;
and to a method for regulating adipose tissue metabolism and
glucose homeostasis comprising administering an effective amount or
a cosmetically effective amount of pasteurized Akkermansia
muciniphila or a fragment thereof to a subject in need thereof. In
one embodiment of the invention, the administration of pasteurized
Akkermansia muciniphila or a fragment thereof reverses diet-induced
fasting hyperglycemia. In another embodiment, the administration of
pasteurized Akkermansia muciniphila or a fragment thereof induces a
reduction of at least 10%, preferably of at least 30%, more
preferably of at least 40% of hepatic glucose-6-phosphatase
expression. In another embodiment, the administration of
pasteurized Akkermansia muciniphila or a fragment thereof induces a
reduction of the insulin-resistance index. In one embodiment, said
reduction of the insulin-resistance index is of at least 5%,
preferably of at least 10%, more preferably of at least 15%, 20%,
25%, 30%, 35%, 40%, 45% or 50%.
[0169] The Applicant showed that the administration of pasteurized
Akkermansia muciniphila decreases glucose intolerance and insulin
resistance in high-fat diet fed mice. Therefore, the present
invention also relates to pasteurized Akkermansia muciniphila or a
fragment thereof for decreasing glucose intolerance and/or insulin
resistance; and to a method for decreasing glucose intolerance
and/or insulin resistance comprising administering an effective
amount or a cosmetically effective amount of pasteurized
Akkermansia muciniphila or a fragment thereof to a subject in need
thereof.
[0170] The present invention also relates to pasteurized
Akkermansia muciniphila or a fragment thereof for treating
inflammation, preferably low grade inflammation, associated with or
caused by metabolic disorders; and to a method for treating
inflammation related to metabolic disorders comprising
administering an effective amount or a cosmetically effective
amount of pasteurized Akkermansia muciniphila or a fragment thereof
to a subject in need thereof.
[0171] The Applicant showed that the administration of pasteurized
Akkermansia muciniphila decreases plasma triglycerides levels in
treated mice. Therefore, the present invention also relates to
pasteurized Akkermansia muciniphila or a fragment thereof for
decreasing plasma triglycerides levels; and to a method for
decreasing plasma triglycerides levels comprising administering an
effective amount or a cosmetically effective amount of pasteurized
Akkermansia muciniphila or a fragment thereof to a subject in need
thereof.
[0172] The present invention also relates to pasteurized
Akkermansia muciniphila or a fragment thereof for decreasing plasma
cholesterol; and to a method for decreasing plasma cholesterol
comprising administering an effective amount or a cosmetically
effective amount of pasteurized Akkermansia muciniphila or a
fragment thereof to a subject in need thereof.
[0173] In one embodiment of the invention, the administration of
pasteurized Akkermansia muciniphila or a fragment thereof to a
subject has no impact on food intake of said subject.
[0174] In one embodiment of the invention, the administration of
pasteurized Akkermansia muciniphila or a fragment thereof to a
subject increases energy expenditure of said subject, preferably
without impacting the food intake of said subject.
[0175] The present invention thus also relates to a method of
increasing energy expenditure of a subject, comprising
administering pasteurized Akkermansia muciniphila or a fragment
thereof, or a composition, pharmaceutical composition, cosmetic
composition or medicament of the invention to the subject,
preferably in a therapeutically or cosmetically effective amount.
Preferably, the method of the invention does not comprise or
further comprise modulating the food intake of said subject. In one
embodiment of the invention, the method of the invention increases
energy expenditure, thereby inducing durable weight loss in the
subject, and thereby treating metabolic disorders in said subject,
such as, for example, obesity related metabolic disorders.
[0176] In one embodiment, the administration of pasteurized
Akkermansia muciniphila or a fragment thereof to a subject
increases satiety in said subject. Consequently, according to this
embodiment, the method of the invention increases satiety in a
subject, thereby inducing durable weight loss in the subject, and
thereby treating metabolic disorders in said subject, such as, for
example, obesity related metabolic disorders.
BRIEF DESCRIPTION OF THE DRAWINGS
[0177] FIG. 1 is a set of histograms showing that Akkermansia
muciniphila grown on a mucus-based medium or on a non-mucus-based
growth medium counteracts the increase in body weight gain and fat
mass gain in mice fed a high-fat diet. Furthermore, effects of
pasteurized A. muciniphila on body weight gain and fat mass gain
are stronger than with the live bacterium. (a) Total body weight
gain (g) in mice fed a control diet (CT ND), a high-fat diet (CT
HFD) and treated daily by oral gavage with sterile anaerobic PBS
containing glycerol or mice fed a high-fat diet and treated daily
by oral gavage with live A. muciniphila grown on a mucus-based
medium (HFD Akk M), a non-mucus-based medium (HFD Akk G), or A.
muciniphila grown on a mucus-based medium and pasteurized (HFD Akk
P) for 4 weeks (n=8-10). (2.10.sup.8 bacterial cells suspended in
150 .mu.L of sterile anaerobic PBS). (b) Total fat mass gain (g)
measured by time-domain nuclear magnetic resonance (n=8-10). Data
are shown as mean.+-.SEM. Data with different superscript letters
are significantly different (P<0.05), according to one-way ANOVA
analysis followed by Tukey post-hoc test.
[0178] FIG. 2 is a histogram showing normalization of the adiposity
index of high-fat diet-fed mice after treatment with A.
muciniphila. Adiposity index (g) shown as the addition of the
weight of the epididymal, subcutaneous and mesenteric adipose
depots (n=8-10). Data are shown as mean.+-.SEM. * corresponds to P
value <0.05 when two conditions were compared with an unpaired
two-tailed Student's t-test.
[0179] FIG. 3 is a set of graphs showing a diminution of glucose
intolerance in mice fed a high-fat diet after administration of
pasteurized A. muciniphila to a higher extent than administration
of live A. muciniphila grown either on a mucus-based or
non-mucus-based medium. (a) Plasma glucose profile following 2 g/kg
glucose oral challenge in freely moving mice (n=8-10). (b) Mean
area under the curve (AUC) measured between -30 and 120 min after
glucose load (n=8-10). (c) Insulin resistance index, determined by
multiplying the AUC of plasma glucose (-30 to 120 min) by the AUC
of plasma insulin (-30 to 15 min) (n=8-10). Data are shown as
mean.+-.SEM. Data with different superscript letters are
significantly different (P<0.05), according to one-way ANOVA
analysis followed by Tukey post-hoc test.
[0180] FIG. 4 is a histogram showing modulation of the expression
of markers of intestinal integrity and corrects HFD-induced
metabolic endotoxemia after administration of A. muciniphila grown
on a non-mucus-based medium and either live or pasteurized. (a)
mRNA expression of Ocln, Cldn3 and Lyz1 in the jejunum (n=7-10),
(b) mRNA expression of Ocln, Cldn3 and Lyz1 in the ileum (n=7-10),
(c) Plasma Lipopolysaccharide levels (EU/mL) (n=5-9). Data are
shown as mean.+-.SEM. Data with different superscript letters are
significantly different (P<0.05), according to one-way ANOVA
analysis followed by Tukey post-hoc test.
[0181] FIG. 5 is a set of histograms showing a reduction of body
weight gain and fat mass gain after administration of pasteurized
A. muciniphila to a higher extent than live A. muciniphila grown on
a non-mucus-based medium. (a) Total body weight gain (g) in mice
fed a control diet (CT ND), a high-fat diet (CT HFD) and treated
daily by oral gavage with sterile anaerobic PBS containing glycerol
or mice fed a high-fat diet and treated daily by oral gavage with
live A. muciniphila grown on a non-mucus-based medium (HFD Akk G),
or A. muciniphila grown on a mucus-based medium and pasteurized
(HFD Akk P) (n=16-19) for 5 weeks. (2.10.sup.8 bacterial cells
suspended in 150 .mu.L of sterile anaerobic PBS). (b) Total fat
mass gain (g) measured by time-domain nuclear magnetic resonance
(n=16-19). Data are shown as mean.+-.SEM. Data with different
superscript letters are significantly different (P<0.05),
according to one-way ANOVA analysis followed by Tukey post-hoc
test.
[0182] FIG. 6 is a histogram showing a reduction of adiposity index
after administration of pasteurized A. muciniphila to a higher
extent than live A. muciniphila grown on a non-mucus-based medium.
Adiposity index (g), shown as the combined weight of the
epididymal, subcutaneous and mesenteric adipose depots (n=16-19).
Data are shown as mean.+-.SEM. Data with different superscript
letters are significantly different (P<0.05), according to
one-way ANOVA analysis followed by Tukey post-hoc test.
[0183] FIG. 7 is a set of histograms showing that administration of
pasteurized A. muciniphila counteracts glucose intolerance in mice
fed a high-fat diet to a higher extent than live A. muciniphila.
Mice were fed a control diet (CT ND), a high-fat diet (CT HFD) and
treated daily by oral gavage with sterile anaerobic PBS containing
glycerol or A. muciniphila grown on a non-mucus-based medium,
either live (HFD Akk G), or pasteurized (HFD Akk P) for 5 weeks.
(a) Plasma glucose profile following 2 g/kg glucose oral challenge
in freely moving mice (n=8-10). Data with different superscript
letters are significantly different (P<0.05), according to
two-way ANOVA analysis followed by Bonferonni post-test. (b) Mean
area under the curve (AUC) measured between -30 and 120 min after
glucose load (n=10). (c) Insulin resistance index, determined by
multiplying the AUC of plasma glucose (-30 to 120 min) by the AUC
of plasma insulin (-30 to 15 min) (n=8-10). Data are shown as
mean.+-.SEM. Data with different superscript letters are
significantly different (P<0.05), according to one-way ANOVA
analysis followed by Tukey post-hoc test.
[0184] FIG. 8 is a set of graphs showing that administration of
either live or pasteurized A. muciniphila counteracts glucose
intolerance and insulin resistance in mice fed a high-fat diet. (a)
Plasma glucose profile following 2 g/kg glucose oral challenge in
freely moving mice (n=8-10). Data are shown as mean.+-.SEM. Data
with different superscript letters are significantly different
(P<0.05), according to two-way ANOVA analysis followed by
Bonferonni post-test. (b) Mean area under the curve (AUC) measured
between -30 and 120 min after glucose load (n=8-10). Data are shown
as mean.+-.SEM. Data with different superscript letters are
significantly different (P<0.05), according to one-way ANOVA
analysis followed by Tukey post-hoc test. (c) Ratio of the control
(-) and insulin-stimulated (+) p-IR.beta. on the loading control as
measured by densitometry. (d) Ratio of the control and
insulin-stimulated p-Akt.sup.thr308 on the loading control as
measured by densitometry. (e) Ratio of the control and
insulin-stimulated p-Akt.sup.ser473 on the loading control as
measured by densitometry. (c-e) n=3-5. Data with different
superscript letters are significantly different (P<0.05),
according to two-way ANOVA analysis followed by Bonferonni
post-test.
[0185] FIG. 9 is a photograph (a) and a histogram (b) showing that
administration of pasteurized A. muciniphila counteracts the
effects of a high-fat diet on the mean adipocyte diameter. Mice
were fed a control diet (CT ND), a high-fat diet (CT HFD) and
treated daily by oral gavage with sterile anaerobic PBS containing
glycerol or A. muciniphila grown on a non-mucus-based medium,
either live (HFD Akk G), or pasteurized (HFD Akk P) for 5 weeks.
(a) Representative haematoxylin and eosin-stained picture of
subcutaneous adipose tissue depots. Scale bar: 100 .mu.m. (b) Mean
adipocyte diameter (.mu.m) determined by histological analysis
(n=16-19). (c) Leptin plasma levels measured in the portal vein
(pg/mL) (n=8-10). Data are shown as mean.+-.SEM. Data with
different superscript letters are significantly different
(P<0.05), according to one-way ANOVA analysis followed by Tukey
pose-hoc test.
[0186] FIG. 10 is a histogram showing the reduction of plasma
triglycerides levels after administration of pasteurized A.
muciniphila. Mice were fed a control diet (CT ND), a high-fat diet
(CT HFD) and treated daily by oral gavage with sterile anaerobic
PBS containing glycerol or A. muciniphila grown on a
non-mucus-based medium, either live (HFD Akk G), or pasteurized
(HFD Akk P) for 5 weeks (n=16-19). Data are shown as mean.+-.SEM. P
value is indicated when two conditions were compared with an
unpaired two-tailed Student's t-test (*: P<0.05).
[0187] FIG. 11 is a histogram showing that the administration of
either live or pasteurized A. muciniphila significantly decreases
serum HDL-cholesterol and lead to a similar trend for
LDL-cholesterol. Plasma VLDL, LDL and HDL cholesterol levels
determined by fast protein liquid chromatography (FPLC). Mice were
fed a control diet (CT ND), a high-fat diet (CT HFD) and treated
daily by oral gavage with sterile anaerobic PBS containing glycerol
or A. muciniphila grown on a non-mucus-based medium, either live
(HFD Akk G), or pasteurized (HFD Akk P) for 5 weeks (n=8-10). Data
with different superscript letters are significantly different
(P<0.05), according to two-way ANOVA analysis followed by
Bonferonni post-test.
[0188] FIG. 12 is a histogram showing that the administration of
pasteurized A. muciniphila increases energy excreted in the feces.
Fecal energy measured by indirect bomb calorimetry (kcal/g feces)
(n=5). Mice were fed a control diet (CT ND), a high-fat diet (CT
HFD) and treated daily by oral gavage with sterile anaerobic PBS
containing glycerol or A. muciniphila grown on a non-mucus-based
medium, either live (HFD Akk G), or pasteurized (HFD Akk P) for 5
weeks. Data are shown as mean.+-.SEM. Data with different
superscript letters are significantly different (P<0.05),
according to one-way ANOVA analysis followed by Tukey post-hoc
test.
[0189] FIG. 13 is a graph showing that the administration of
pasteurized A. muciniphila induces a larger correction of the
HFD-induced shift in host urinary metabolomics profile than live A.
muciniphila. (a) Orthogonal Partial Least Squares discriminant
analysis (OPLS-DA) score plots for urine metabolic profiles
(n=5-7). (b) Impact of all treatments on the predictive component 1
of the OPLS-DA analysis. Mice were fed a control diet (CT ND), a
high-fat diet (CT HFD) and treated daily by oral gavage with
sterile anaerobic PBS containing glycerol or A. muciniphila grown
on a non-mucus-based medium, either live (HFD Akk G), or
pasteurized (HFD Akk P) for 5 weeks.
[0190] FIG. 14 is a set of graphs showing the safety assessment of
A. muciniphila after oral administration in overweight/obese
patients (n=5). (A-C) Markers related to inflammation and
hematology: (A)C-reactive protein (mg/dl), (B) Total white blood
cell count (10.sup.3 cells/.mu.L), (C) Prothrombin time (sec).
(D-F) Markers related to kidney function: (D) Urea (mg/dl), (E)
Creatinine (mg/dl), (F) Glomerular filtration rate (mL/min*1.73
m.sup.2). (G-I) Markers related to liver function: (G) Alanine
transaminase activity (IU/l), (H) Aspartate transaminase activity
(IU/l), (I) .gamma.-glutamyltranspeptidase activity (IU/l). (J-K)
Markers related to muscle function: (J) Creatinine kinase activity
(IU/l), (K) Lactate dehydrogenase activity (IU/l).
EXAMPLES
[0191] The present invention is further illustrated by the
following examples.
[0192] We previously showed that daily administration of
Akkermansia muciniphila to mice fed a high-fat diet can impede the
development of obesity (WO 2014/076246).
[0193] With the perspective of transferring these results to
clinical settings, we decided to assess whether A. muciniphila
would retain its effects when cultured on a non-mucus-based medium
suited for human trials. Moreover, our previous results indicated
that autoclaving A. muciniphila abolished its effect on
diet-induced obesity. We therefore sought to investigate the
consequences of another inactivation method (i.e. pasteurization)
on A. muciniphila-mediated effects.
Materials and Methods
Mice
[0194] First experiment: a set of 10-week-old C57BL/6J mice (50
mice, n=10/group) (Charles River, L'Arbresle, France) were housed
in a controlled environment (12 h daylight cycle, lights off at 6
.mu.m) in groups of two mice per cage, with free access to food and
water. Mice were fed a control diet (ND) (AIN93Mi, Research diet,
New Brunswick, N.J., USA) or a high-fat diet (HFD) (60% fat and 20%
carbohydrates (kcal/100 g) D12492i, Research diet, New Brunswick,
N.J., USA).
[0195] Mice were treated daily with an oral administration of
Akkermansia muciniphila grown on a mucin-based medium (HFD Akk M)
or a non-mucus-based medium (HFD Akk G) by oral gavage at the dose
of 2.10.sup.8 cfu/0.15 mL suspended in sterile anaerobic phosphate
buffer saline (PBS). Additionally, one group of mice was treated
daily with an oral administration of Akkermansia muciniphila grown
on a non-mucus-based medium and inactivated by pasteurization (HFD
Akk P). Control groups were treated with an oral gavage of an
equivalent volume of sterile anaerobic PBS (CT ND and CT HFD)
containing a similar end concentration of glycerol (2.5% vol/vol).
Treatment was continued for 4 weeks.
[0196] For the HFD Akk M group, A. muciniphila MucT (ATTC BAA-835)
was grown anaerobically in a mucin-based basal medium as previously
described (Derrien et al., 2004. Int. J. Syst. Evol. Microbiol.
54:1469-1476). Cultures were then washed and suspended in anaerobic
PBS, including 25% (v/v) glycerol, to an end concentration of
1.10.sup.10 cfu/mL.
[0197] For the HFD Akk G group, A. muciniphila MucT (ATTC BAA-835)
was grown anaerobically in non-mucus-based medium. Cultures were
then washed and suspended in anaerobic PBS, including 25% (v/v)
glycerol, to an end concentration of 1.10.sup.10 cfu/mL.
[0198] For the HFD Akk P group, A. muciniphila MucT (ATTC BAA-835)
was grown anaerobically in non-mucus-based medium Cultures were
then washed and suspended in anaerobic PBS, including 25% (v/v)
glycerol, to an end concentration of 1.10.sup.10 cfu/mL. Vials were
then pasteurized by exposure to a temperature of 70.degree. C. for
30 minutes in a water bath.
[0199] Body weight, food and water intake were recorded once a
week. Body composition was assessed by using 7.5 MHz time
domain-nuclear magnetic resonance (TD-NMR) (LF50 minispec, Bruker,
Rheinstetten, Germany).
[0200] Second experiment: a set of 10-week-old C57BL/6J mice (40
mice, n=10/group) (Charles River, L'Arbresle, France) were housed
in a controlled environment (12 h daylight cycle, lights off at 6
.mu.m) in groups of two mice per cage, with free access to food and
water. Mice were fed a control diet (ND) (AIN93Mi; Research diet,
New Brunswick, N.J., USA) or a high-fat diet (HFD) (60% fat and 20%
carbohydrates (kcal/100 g), Research diet D12492i, New Brunswick,
N.J., USA). Mice were treated daily with an oral administration of
Akkermansia muciniphila grown on a non-mucus-based medium and
either live or pasteurized (HFD Akk G and HFD Akk P) by oral gavage
at the dose of 2.10.sup.8 cfu/0.15 mL suspended in sterile
anaerobic phosphate buffer saline. Control groups were treated with
an oral gavage of an equivalent volume of sterile anaerobic
phosphate buffer saline (CT ND and CT HFD). Treatment was continued
for 5 weeks.
[0201] For the HFD Akk G group, A. muciniphila MucT (ATTC BAA-835)
was grown anaerobically in non-mucus-based medium. Cultures were
then washed and suspended in anaerobic PBS, including 25% (v/v)
glycerol, to an end concentration of 1.10.sup.10 cfu/mL.
[0202] For the HFD Akk P group, A. muciniphila MucT (ATTC BAA-835)
was grown anaerobically in non-mucus-based medium. Cultures were
then washed and suspended in anaerobic PBS, including 25% (v/v)
glycerol, to an end concentration of 1.10.sup.10 cfu/mL. Vials were
then pasteurized by exposure to a temperature of 70.degree. C. for
30 minutes in a water bath.
[0203] Body weight, food and water intake were recorded once a
week. Body composition was assessed by using 7.5 MHz time
domain-nuclear magnetic resonance (TD-NMR) (LF50 minispec, Bruker,
Rheinstetten, Germany).
[0204] Fresh urinary samples were collected during the final week
of treatment and directly stored at -80.degree. C. before analysis.
Fecal energy content was measured on fecal samples harvested after
a 24 h period during the final week of treatment by the use of a
bomb calorimeter (Mouse Clinical Institute, 67404 Illkirch,
France).
[0205] Third experiment: a set of 10-week-old C57BL/6J mice (40
mice, n=10/group) (Charles River, L'Arbresle, France) were housed
in a controlled environment (12 h daylight cycle, lights off at 6
.mu.m) in groups of two mice per cage, with free access to food and
water. Mice were fed a control diet (CT ND) (AIN93Mi; Research
diet, New Brunswick, N.J., USA) or a high-fat diet (CT HFD) (60%
fat and 20% carbohydrates (kcal/100 g), Research diet D12492i, New
Brunswick, N.J., USA). Mice were treated daily with an oral
administration of Akkermansia muciniphila grown on a
non-mucus-based medium and either live or pasteurized (HFD Akk G
and HFD Akk P) by oral gavage at the dose of 2.10.sup.8 CFU/0.15 mL
suspended in sterile anaerobic phosphate buffer saline. Control
groups were treated with an oral gavage of an equivalent volume of
sterile anaerobic phosphate buffer saline (CT ND and CT HFD).
Treatment was continued for 5 weeks.
[0206] All mouse experiments were approved by and performed in
accordance with the guidelines of the local ethics committee.
Housing conditions were specified by the Belgian Law of May 29,
2013, regarding the protection of laboratory animals (agreement
number LA1230314).
Oral Glucose Tolerance Test
[0207] 6 h-fasted mice were treated with an oral gavage glucose
load (2 g glucose per kg body weight). Blood glucose levels were
measured before oral glucose load and 15, 30, 60, 90 and 120
minutes after oral glucose load. Blood glucose was determined with
a glucose meter (Accu Check, Aviva, Roche) on blood samples
collected from the tip of the tail vein.
Insulin Resistance Index
[0208] Plasma insulin concentration was determined in 5 .mu.L of
plasma using an ELISA kit (Mercodia) according to the
manufacturer's instructions. Insulin resistance index was
determined by multiplying the area under the curve of both blood
glucose (-30 to 120 minutes) and plasma insulin (-30 and 15
minutes) obtained following the oral glucose tolerance test.
Western-Blot
[0209] To analyze the insulin signaling pathway in the third
experiment, mice were allocated in either a saline-injected
subgroup or an insulin-injected subgroup so that both subgroups
were matched in terms of body weight and fat mass. They then
received 1 mU/g insulin (Actrapid; Novo Nordisk A/S, Denmark) under
anaesthesia (isoflurane, Forene, Abbott, Queenborough, Kent,
England), or an equal volume of saline solution into the portal
vein. Three minutes after injection, mice were killed and liver was
rapidly harvested.
[0210] For detection of proteins of the insulin pathway, tissues
were homogenized in ERK buffer (Triton X-100 0.1%, HEPES 50 mM,
NaCl 5 M, Glycerol 10%, MgCl.sub.2 1.5 mM and DTT 1 mM)
supplemented with a cocktail of protease inhibitors and phosphatase
inhibitors. Equal amounts of proteins were separated by SDS-PAGE
and transferred to nitrocellulose membranes. Membranes were
incubated overnight at 4.degree. C. with antibodies diluted in
Tris-buffered saline Tween-20 containing 1% non-fat dry milk:p-IRb
(1:1,000; sc-25103, Santa Cruz, Calif., USA), p-AktThr308 (1:1.000;
#2965L, Cell Signaling, Danvers, Mass., USA) and p-AktSer473
(1:1.000; #4060L, Cell Signaling). Quantification of
phosphoproteins was performed on 5 animals with insulin injection
and 5 animals with saline injection per group. The loading control
was .beta.-actin (1:10000; ab6276).
Tissue Sampling
[0211] The animals have been anesthetized with isoflurane
(Forene.RTM., Abbott, Queenborough, Kent, England) and blood was
sampled from the portal and cava veins. Mice were then killed by
cervical dislocation before proceeding to tissue sampling. Adipose
depots (epididymal, subcutaneous and mesenteric) were precisely
dissected and weighed; the addition of the weights of all three
adipose tissue depots corresponds to the adiposity index. The
intestinal segments (ileum, cecum and colon), cecal content and
adipose tissue depots were immersed in liquid nitrogen, and stored
at -80.degree. C., for further analysis.
Histological Analyses
[0212] Adipose tissues were fixed in 4% paraformaldehyde for 24
hours at room temperature. Then the samples were immersed in
ethanol 100% for 24 hours prior to processing for paraffin
embedding. Tissue samples, paraffin sections of 5 .mu.m, were
stained with hacmatoxylin and eosin. Images were obtained using the
SCN400 slide scanner (Lcica Biosystcms, Wetzlar, Germany). 5
high-magnification fields were selected at random for each mouse
and adipocyte diameter was determined using ImageJ (Version 1.50a,
National Institutes of Health, Bethesda, Md., USA).
RNA Preparation and Real-Time qPCR Analysis
[0213] Total RNA was prepared from tissues using TriPure reagent
(Roche). Quantification and integrity analysis of total RNA was
performed by running 1 .mu.L of each sample on an Agilent 2100
Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). cDNA was prepared
by reverse transcription of 1 .mu.g total RNA using a Reverse
Transcription System kit (Promega, Leiden, The Netherlands).
Real-time PCRs were performed with the Biorad CFX real-time PCR
system and software (Biorad, Hercules, United States) using Mesa
Fast qPCR (Eurogentec, Seraing, Belgium) for detection according to
the manufacturer's instructions. RPL19 was chosen as the
housekeeping gene. All samples were run in duplicate in a single
96-well reaction plate, and data were analyzed according to the
2.sup..DELTA..DELTA.CT method. The identity and purity of the
amplified product was checked through analysis of the melting curve
carried out at the end of amplification. Primer sequences for the
targeted mouse genes are presented in Table 1 below.
TABLE-US-00001 TABLE 1 Primer sequences for the targeted mouse
genes. Primers Sequence RPL-19 Forward GAAGGTCAAAGGGAATGTGTTCA (SEQ
ID NO: 1) Reverse CCTTGTCTGCCTTCAGCTTGT (SEQ ID NO: 2) Ocln Forward
ATGTCCGGCCGATGCTCTC (SEQ ID NO: 3) Reverse TTTGGCTGCTCTTGGGTCTGTAT
(SEQ ID NO: 4) Cldn3 Forward TCATCGGCAGCAGCATCATCAC (SEQ ID NO: 5)
Reverse ACGATGGTGATCTTGGCCTTGG (SEQ ID NO: 6) Lyz1 Forward
GCCAAGGTCTACAATCGTTGTGAGTTG (SEQ ID NO: 7) Reverse
CAGTCAGCCAGCTTGACACCACG (SEQ ID NO: 8)
Measurement of Plasma Triglycerides
[0214] Plasma samples were assayed for triglycerides by measuring
the glycerol resulting from hydrolysis of triglycerides, using a
commercial kit (DiaSys, Condom, France).
Measurement of Plasma Leptin
[0215] Plasma samples were assayed for leptin through the use of a
multiplex immunoassay kit (Merck Millipore, Brussels, Belgium) and
measured using Luminex technology (Bioplex, Bio-Rad, Belgium)
following the manufacturer's instructions.
Measurement of Plasma Cholesterol (Fast Protein Liquid
Chromatography, FLPC)
[0216] Quantification of plasma lipoproteins was performed using
fast protein liquid chromatography (FPLC, AKTA purifier 10, GE
Healthcare, Chicago, Ill., USA). 50 .mu.L of individual plasma was
injected and lipoproteins were separated on Superose.TM. 6 10/300
GL column (GE Healthcare, Chicago, Ill., USA) with NaCl 0.15 M at
pH 7.4 as mobile phase at a 1 mL/min flow rate. The effluent was
collected into fractions of 0.3 mL then cholesterol and TG content
in each fraction were determined as described above. Quantification
of cholesterol in lipoprotein classes (VLDL, LDL, and HDL) was
performed by measuring the percentage peak area and by multiplying
each percentage to the total amount of cholesterol. Plasma total
cholesterol was measured with commercial kits (CHOD-PAP; BIOLABO
SA, Maizy, France).
Measurement of Fecal Energy
[0217] Fecal energy content was measured on fecal samples harvested
after a 24 h-period during the final week of treatment by the use
of a bomb calorimeter (Mouse Clinical Institute, Illkirch,
France).
Urinary Metabolomics Analyses
[0218] Mouse urine samples were prepared and measured on a
spectrometer (Bruker) operating at 600.22 MHz 1H frequency
according to previously published protocol (Dona A C, 2014); the
.sup.1H NMR spectra were then processed and analyzed as described
previously (Dumas et al., 2006. Proc. Natl. Acad. Sci. USA.
103(33):12511-6).
Quantification of Plasma Lipopolysaccharide
[0219] Portal vein blood LPS concentration was measured using an
Endosafe-Multi-Cartridge System (Charles River Laboratories) based
on the Limulus amacbocyte lysate (LAL) kinetic chromogenic
methodology that measures color intensity directly related to the
endotoxin concentration in a sample. Plasmas were diluted 1/10 with
endotoxin-free buffer to minimize interferences in the reaction
(inhibition or enhancement) and heated 15 minutes at 70.degree. C.
Each sample was diluted 1/100, 1/150, 1/200 or 1/400 with
endotoxin-free LAL reagent water (Charles River Laboratories) and
treated in duplicate, and two spikes for each sample were included
in the determination. All samples have been validated for the
recovery and the coefficient variation. The lower limit of
detection was 0.005 EU/mL.
Determination of the Pasteurization Temperature and Time Range
[0220] Vials containing live bacteria were immersed in a water bath
set to 50, 60, 70, 80 or 90.degree. C. for 15 seconds (0.25
minutes), 2 minutes, 5 minutes, 15 minutes and 30 minutes.
Inactivation of A. muciniphila was assessed by plating 50 .mu.L of
undiluted vial content on Brain-Heart Infusion (BHI)-Agar medium
supplemented with 5% mucus and looking for the presence of
colony-forming units (cfu) after 7 days of incubation at 37.degree.
C. in an anaerobic container. Content of an autoclaved vial was
used as a negative control, and content from a vial non immersed in
a water bath was used as a positive control. This experiment was
performed at two different times.
Mucus-Based Medium
[0221] A. muciniphila was grown in mucus-based medium, washed and
concentrated as described previously (Everard et al., 2013. Proc.
Natl. Acad. Sci. USA. 110:9066-9071). In addition to an untreated
batch of cells, one part was subject to a mild heat treatment by a
30-minute incubation at 70.degree. C.
Non-Mucus-Based Medium
[0222] A. muciniphila was grown in a non-mucus-based medium
consisting of basal anaerobic medium as described previously
(Derrien et al., 2004. Int. J. Syst. Evol. Microbiol. 54:1469-1476)
containing 16 g/L soy-based pepton, 25 mM glucose and 25 mM
N-acetyl-glucosamine and 4 g/L L-threonine. The cells were washed
and concentrated as described previously (Everard et al., 2013.
Proc. Natl. Acad. Sci. USA. 110:9066-9071). In addition to an
untreated batch of cells, one part was subject to a mild heat
treatment by a 30-minute incubation at 70.degree. C.
Safety Assessment of Oral Administration of Live and Pasteurized A.
muciniphila in Overweight or Obese Volunteers
[0223] Results presented are interim safety reports from twenty
overweight and obese patients (Body mass index >25 kg/m.sup.2)
presenting a metabolic syndrome following the NCEP ATP III
definition (any three of the five following criteria: fasting
glycaemia >110 mg/dL, blood pressure .gtoreq.130/85 mm Hg or
antihypertensive treatment, fasting triglyceridemia .gtoreq.150
mg/dL, HDL cholesterol <40 mg/dL for males, 50 mg/dL for
females, and/or waist circumference >102 cm for males, 88 cm for
females). Patients were voluntarily recruited from the Cliniques
Universitaires Saint Luc, Brussels, Belgium between December 2015
and May 2016. Subjects were assigned to any of the treatment arms
following a randomized block design. The exclusion criteria were:
presence of acute or chronic progressive or chronic unstabilized
diseases, alcohol consumption (>2 glasses/day), previous
bariatric surgery, any surgery in the 3 months prior to the study
or planned in the next 6 months, pregnancy or pregnancy planned in
the next 6 months, regular physical activity (>30 minutes of
sports 3 times a week), consumption of dietary supplements (omega-3
fatty acids, probiotics, prebiotics, plant stanols/sterols) in the
month prior the study, inflammatory bowel disease or irritable
bowel syndrome, diabetic gastrointestinal autonomic neuropathy
(such as gastroparesis or reduced gastrointestinal motility),
consumption of more than 30 g of dietary fibers per day,
consumption of vegetarian or unusual diet, lactose intolerance or
milk protein allergy, gluten intolerance, current treatment with
medications influencing parameters of interest (glucose-lowering
drugs such as metformin, DPP-4 inhibitors, GLP-1 receptor agonists,
acarbose, sulfonylueras, glinides, thiazolidinediones, SGLT2
inhibitors, insulin, lactulose, consumption of antibiotics in the 2
months prior the study, glucocorticoids, immunosuppressive agents,
statins, fibrates, orlistat, cholestyramine, or ezetimibe), and
baseline glycated hemoglobin (HbA1c) >7.5%. The Commission
d'Ethique Biomedicale Hospitalo-facultaire from the Universite
catholique de Louvain (Brussels, Belgium) provided ethical approval
for this study and written informed consent was obtained from each
participant. The trial was registered at clinicaltrials.gov as
NCT02637115.
[0224] Subjects were assigned to receive either a daily dose of
placebo (an equivalent volume of sterile PBS containing glycerol),
10.sup.10 CFU live A. muciniphila (Akk S-10.sup.10), 10.sup.9 CFU
live A. muciniphila (Akk S-10.sup.9), or 10.sup.10 CFU pasteurized
A. muciniphila (Akk P-10.sup.10) (placebo and bacteria were
produced at a food-grade level according to good manufacturing
practices) for 3 months. Blood samples were collected at the
beginning of the treatment and a portion was directly sent to the
hospital laboratory to measure relevant clinical parameters.
Different tubes were used based on the clinical parameter:
EDTA-coated tubes for white blood cell count, Sodium
fluoride-coated tubes for fasting glycemia, citrate-coated tubes
for clotting assays, and lithium-heparin-coated tubes for urea and
enzymatic activities. After 2 weeks of treatment, patients came
back to the hospital for a safety visit, where blood samples were
collected to allow comparison of clinical parameters to baseline
values.
[0225] The patients and the physicians were blinded to the
treatment. For FIG. 14 and Tables 3-5, the number of subjects per
group is: Placebo: 5, Akk S-10.sup.10: 5, Akk S-10.sup.9: 5, Akk
P-10.sup.10: 5.
Statistical Analysis
[0226] Data are expressed as means.+-.SEM. Differences between two
groups were assessed using the unpaired two-tailed Student's
t-test. Data sets involving more than two groups were assessed by
ANOVA followed by Tukey post-hoc tests. Data with different
superscript letters are significantly different with P<0.05,
according to the post-hoc ANOVA statistical analysis. Data were
analyzed using GraphPad Prism version 5.00 for windows (GraphPad
Software, San Diego, Calif., USA). Results were considered
statistically significant when P<0.05.
[0227] A two-way ANOVA analysis with a Bonferonni post-test on
repeated measurements was performed for the evolution of glycemia
during the OGTT, for the reparation cholesterol in specific
lipoproteins and for western-blot analyses.
[0228] Human data are expressed as the mean.+-.SD. Differences
between groups were assessed using Kruskal-Wallis test. Differences
between values observed at baseline and at the time of the safety
visit were assessed using a Wilcoxon matched-pairs signed rank
test. Data were analyzed using GraphPad Prism version 7.00 for
Windows (GraphPad Software, San Diego, Calif., USA). The results
were considered statistically significant when p<0.05.
Results
In Vitro Experiments
[0229] In order to optimize the pasteurization protocol, we first
incubated vials containing A. muciniphila in water baths set to a
range of temperature for different times. Pasteurization was
considered effective when no bacteria could be observed after
plating the treated vial contents on a rich medium (Table 2).
TABLE-US-00002 TABLE 2 Combinations of temperatures and exposure
times tested for pasteurization. "Live" corresponds to plates where
cfu were obtained in high numbers. "Borderline"corresponds to
plates where between 1 and 3 cfu were observed. "Inactivated"
corresponds to plates where no cfu could be observed. Temperature
(.degree. C.) 50 60 70 80 90 Exposure 0.25 Live Live Live Live Live
(minutes) 2 Live Live Live Inactivated Inactivated 5 Live Live
Borderline Inactivated Inactivated 15 Live Borderline Borderline
Inactivated Inactivated 30 Borderline Inactivated Inactivated
Inactivated Inactivated
For the further experiments, we have selected a pasteurization of
30 minutes at 70.degree. C. In addition to the viability, the
effect of pasteurization has been tested on the activity of two A.
muciniphila fucosidases and 2 sulfatases (encoded by the genes
Amuc_0010, Amuch_0146 and Amuc_0121 and Amuc_1074; van Passel et
al., 2011. PLoS One. 6(3):e16876). These enzymes are relevant for
the degradation of mucin. For this purpose, their genes were
overexpressed in Escherichia coli as described with a C-terminal
His-tag (Tailford et al., 2015. Nat. Commun. 6:7624) and the
purified proteins were used for the analysis. The enzyme activities
were determined before and after 30 minutes at 70.degree. C. and
this treatment completely resulted in an over 20-fold inactivation
of the enzymatic activities.
In Vivo Experiments
[0230] In a first set of experiments, mice fed a high-fat diet were
treated daily with an oral gavage of live A. muciniphila grown
either on a mucus-based or a non-mucus-based medium. Another group
of mice was treated with an oral gavage of A. muciniphila grown on
a non-mucus-based medium and inactivated by pasteurization (30
minutes at 70.degree. C.). Mice fed standard chow were used as a
control group. Treatment was carried on for 4 weeks.
[0231] We observed that live A. muciniphila treatment reduced
high-fat diet induced body weight and fat mass gain, regardless of
the growth medium used (FIG. 1a-b). Surprisingly, pasteurized A.
muciniphila exerted a stronger effect than the live bacterium, as
mice treated with pasteurized cells showed a similar body weight
gain and fat mass gain to mice fed a control diet (FIG. 1a-b).
Adiposity index, shown as the sum of subcutaneous, visceral and
epididymal adipose tissue depots, was significantly increased in
mice fed a high-fat diet (FIG. 2). Administration of A. muciniphila
counteracted this increase, to a similar extent regardless of the
growth medium or pasteurization.
[0232] We next confirmed our previous results in terms of glucose
tolerance. Indeed, a high-fat diet leads to increased glycaemia
following an oral glucose tolerance test (OGTT), resulting in a
significantly higher area under the curve (AUC) measured between 30
minutes before and 120 minutes after glucose administration (FIG.
3a-b). Administration of A. muciniphila mitigated this increase,
leading to intermediary AUC values, once again independently of the
growth medium and pasteurization.
[0233] When taking into account insulinemia of the mice, the
insulin resistance index of mice fed a high-fat diet was
significantly higher than for control mice (FIG. 3c). Treatment
with A. muciniphila grown on a mucus-based medium resulted in
intermediary insulin resistance (IR) index values between control
and untreated high-fat diet-fed mice. However, although the IR
index of mice treated with A. muciniphila grown on a
non-mucus-based medium was 15% lower than for untreated mice fed a
high-fat diet, it was still significantly higher than for control
mice, while pasteurized A. muciniphila completely normalized the IR
index of mice fed a high-fat diet (FIG. 3c), thereby showing that
pasteurization increases the effects of Akkermansia muciniphila on
glucose tolerance and insulin resistance.
[0234] We previously found that treatment with A. muciniphila could
impact gut barrier function through modulation of antimicrobial
peptides production and regulation of mucus layer thickness. To
further increase our understanding of the cross-talk between A.
muciniphila and the intestinal barrier, we measured the expression
of two markers of intestinal tight junction proteins, namely Ocln
and Cldn3, encoding the proteins Occludin and Claudin 3; as well as
Lyz1 encoding the antimicrobial peptide Lysozyme 1. In the jejunum,
treatment of HFD-fed mice with live or pasteurized A. muciniphila
increased the expression of Ocln, while pasteurized A. muciniphila
specifically increased Lyz1 expression (FIG. 4a). In the ileum,
treatment with live and pasteurized A. muciniphila increased the
expression of Cldn3 and Lyz1 (FIG. 4b). These effects on markers of
intestinal integrity resulted in a complete normalization of plasma
LPS in treated mice (FIG. 4c), showing that both the live and
pasteurized form of A. muciniphila can strengthen the intestinal
barrier and decrease metabolic endotoxemia.
[0235] In a second and third set of experiments, we treated
high-fat diet mice with A. muciniphila grown on the non-mucus-based
medium, either live or pasteurized, to confirm the effects obtained
above. Mice fed standard chow were used as a control group, and
treatment was carried on for five weeks. Treatment with A.
muciniphila grown on non-mucus-based medium lead to a 10 to 15%
decrease of body weight gain, fat mass gain and adiposity index in
mice fed a high-fat diet, although without reaching statistical
significance (FIGS. 5 and 6). Administration of pasteurized A.
muciniphila completely normalized these parameters, once again
showing a stronger effect following pasteurization.
[0236] We also obtained similar results in terms of glucose
tolerance and insulin sensitivity. Indeed, while untreated mice fed
a high-fat diet exhibited a higher AUC during the course of the
OGTT (FIG. 7a-b), treatment with live or pasteurized A. muciniphila
normalized this parameter. The IR index of mice treated with A.
muciniphila grown on a non-mucus-based medium was 20% lower than
for untreated high-fat diet-fed mice, but still significantly
higher than for control mice. However, treatment with pasteurized
A. muciniphila completely normalized the IR index with a two-fold
decrease when compared to the untreated high-fat diet-fed group
(FIG. 7c).
[0237] In the third set of experiments, while untreated mice fed a
high-fat diet exhibited a higher AUC during the course of the OGTT,
treatment with live or pasteurized A. muciniphila significantly
decreased the AUC, showing an improvement of glucose tolerance
(FIG. 8 a-b). In order to further investigate the effects of A.
muciniphila on insulin sensitivity, in addition to the OGTT, we
analyzed insulin-induced phosphorylation of the insulin receptor
(IR) and its downstream mediator Akt in the liver at the threonine
(Akt.sup.thr) and serine (Akt.sup.ser) sites after insulin or
saline solution injection in the portal vein (FIG. 8 c-e). As
previously described, untreated high-fat diet-fed mice displayed
decreased phosphorylation of all assessed proteins when compared to
CT ND mice, reaching significance for Akt.sup.thr (FIG. 8d).
Treatment with A. muciniphila tended to counteract these effects,
with significantly higher levels of p-Akt.sup.ser in mice treated
with the live bacterium (FIG. 8e) when compared to untreated
HFD-fed mice.
[0238] We then measured the mean adipocyte diameter in the
subcutaneous adipose depot, as it is known to be increased in
obesity and to contribute to the development of inflammation and
insulin resistance (Rosen and Spiegelman, 2014. Cell. 156:20-44).
In accordance with the literature, we observed that a high-fat diet
leads to an increased diameter. Treatment with live A. muciniphila
grown on a non-mucus-based did not affect the high-fat
diet-induced-increased diameter. However, administration of
pasteurized A. muciniphila restored the diameter to similar levels
as in control mice (FIG. 9a-b). Treatment with pasteurized A.
muciniphila also normalized leptin concentration to similar levels
as observed in control mice (FIG. 9c).
[0239] The next parameter analyzed concerned the dyslipidemia
induced by high-fat diet feeding. We assessed the effects of A.
muciniphila on hypertriglyceridemia and hypercholesterolemia, which
is associated with atherosclerosis and cardiovascular disease.
Although no difference could be observed between control and
untreated high-fat diet-fed mice, we observed that treatment with
pasteurized A. muciniphila leads to a significant reduction
(between 15 and 20%) of plasma triglyceride levels (FIG. 10).
Regarding plasma cholesterol, treatment with either live or
pasteurized A. muciniphila corrected the HFD-induced
hypercholesterolemia, with significant decreases in plasma
HDL-cholesterol and a similar trend for LDL-cholesterol (FIG.
11).
[0240] To further explain how live and pasteurized A. muciniphila
reduce body weight and fat mass gain without affecting food intake
on a high-fat diet, we measured fecal caloric content and found
that it was significantly increased in mice treated with
pasteurized A. muciniphila but not with live A. muciniphila (FIG.
12). These results suggested a decrease in energy absorption and
therefore energy excretion in the feces following pasteurized A.
muciniphila administration, which could, at least in part, explain
the greater effects observed with pasteurized A. muciniphila.
[0241] We next assessed whether treatment with A. muciniphila could
reduce the HFD-induced shift in the host urinary metabolome (FIG.
13). High-fat diet was the main factor influencing 1H NMR-based
untargeted metabolic profiles on the first O-PLS-DA score (Tpred1)
while treatment with pasteurized A. muciniphila clustered
separately from all other groups regarding the second score
(Tpred2, FIG. 13). This resulted in a normalization of the
HFD-induced shift of 37% with the pasteurized bacterium, and 17%
with the live bacterium (FIG. 13).
[0242] Altogether, these data suggest that the effects of A.
muciniphila on host metabolism arc mostly similar regardless of the
growth medium used. More surprisingly, they also show that
pasteurization potentiates the effects of A. muciniphila. This is
of utmost interest as pasteurization could decrease biosafety
issues associated with the use of a live bacterium while increasing
the efficacy of A. muciniphila in the treatment of obesity and
associated disorders.
Safely Assessment of Oral Administration of Live and Pasteurized A.
muciniphila in Overweight or Obese Volunteers
[0243] We evaluated the safety and tolerability of A. muciniphila
oral administration in overweight and obese volunteers treated with
different doses of live A. muciniphila (Akk S-10.sup.10 and Akk
S-10.sup.9) or pasteurized A. muciniphila (Akk P-10.sup.10) as part
of an ongoing clinical study testing the efficacy of this bacterium
against the metabolic syndrome. Anthropomorphic characteristics of
the patients at the beginning of the intervention are reported in
Table 3.
TABLE-US-00003 TABLE 3 Descriptive characteristics at the beginning
of treatment for all subjects included in the clinical study (n =
5) Placebo Akk S - 10.sup.10 Akk S - 10.sup.9 Akk P - 10.sup.10 Sex
(M/W) 1/4 3/2 2/3 2/3 Age (Years) 53.00 .+-. 10.98 50.40 .+-. 4.72
50.60 .+-. 6.69 52.40 .+-. 7.99 Body weight (Kg) 102.60 .+-. 13.53
111.10 .+-. 19.52 103.80 .+-. 17.03 122.50 .+-. 12.67 Body mass
index 35.84 .+-. 5.98 38.48 .+-. 5.37 36.30 .+-. 3.12 40.71 .+-.
5.71 (Kg/m.sup.2) Waist 116.60 .+-. 13.03 119.50 .+-. 12.35 115.60
.+-. 7.20 124.90 .+-. 8.10 circumference (cm) Fasting glycaemia
100.50 .+-. 10.52 96.13 .+-.2.24 108.30 .+-. 12.91 106.30 .+-.
11.80 (mg/dl)
[0244] We analyzed several clinical parameters investigated in
probiotics safety assessments (Jones et al., 2012. Food. Chem.
Toxicol. 50:2216-2223; Burton et al., 2011. Food Chem. Toxicol.
49(9):2356-64; Wind et al., 2010. Br. J. Nutr. 104(12):1806-16)
before and two weeks after starting the treatment. No significant
changes on markers related to inflammation and hematology, kidney,
liver and muscle function were observed with any formulation of A.
muciniphila (FIGS. 14A-K and Table 4).
TABLE-US-00004 TABLE 4 Descriptive characteristics at the beginning
of treatment for all subjects included in the clinical study (n =
5) Placebo Akk S-10.sup.10 Akk S-10.sup.9 Akk P-10.sup.9 Baseline
Safety Baseline Safety Baseline Safety Baseline Safety Inflammation
& Hematology C-reactive 3.60 .+-. 4.40 .+-. 6.60 .+-. 6.40 .+-.
6.60 .+-. 6.40 .+-. 11.40 .+-. 15.20 .+-. protein 1.67 2.07 5.18
6.07 5.18 6.07 14.33 17.38 (mg dl.sup.-1) White blood 6.43 .+-.
7.07 .+-. 7.91 .+-. 8.36 .+-. 7.91 .+-. 8.36 .+-. 6.89 .+-. 8.20
.+-. cells (10.sup.3 .mu.L.sup.-1) 1.49 1.68 4.08 4.17 4.08 4.17
2.44 1.61 Prothrombin 11.38 .+-. 11.14 .+-. 10.92 .+-. 11.12 .+-.
10.92 .+-. 11.12 .+-. 11.28 .+-. 11.20 .+-. time (sec) 0.55 0.44
0.73 0.80 0.73 0.80 0.56 0.56 Liver enzymes Alanine 24.00 .+-.
23.20 .+-. 27.40 .+-. 24.40 .+-. 27.40 .+-. 24.40 .+-. 29.20 .+-.
27.80 .+-. Aminostrans- 14.82 15.71 27.32 13.85 27.32 13.85 13.72
12.05 ferase activity (IU l.sup.-1) Aspartate 17.00 .+-. 16.60 .+-.
19.33 .+-. 17.67 .+-. 19.33 .+-. 17.67 .+-. 23.00 .+-. 19.80 .+-.
Aminotrans- 6.33 6.35 9.48 5.05 9.48 5.05 9.14 7.98 ferase activity
(IU l.sup.-1) .gamma.-Glutamyl- 22.40 .+-. 23.60 .+-. 40.40 .+-.
33.40 .+-. 40.40 .+-. 33.40 .+-. 45.20 .+-. 42.80 .+-. transferase
15.76 18.05 38.44 24.42 38.44 24.42 28.90 24.94 activity (IU
l.sup.-1) Kidney function Urea (mg dl.sup.-1) 35.20 .+-. 30.00 .+-.
28.60 .+-. 30.40 .+-. 28.60 .+-. 30.40 .+-. 31.40 .+-. 43.40 .+-.
10.26 7.25 9.42 4.98 9.42 4.98 2.88 18.96 Creatinine 0.73 .+-. 0.71
.+-. 0.78 .+-. 0.80 .+-. 0.78 .+-. 0.80 .+-. 0.83 .+-. 0.89 .+-.
(mg dl.sup.-1) 0.11 0.10 0.09 0.15 0.09 0.15 0.18 0.21 Glomerular
92.20 .+-. 95.20 .+-. 88.60 .+-. 88.60 .+-. 88.60 .+-. 88.60 .+-.
83.80 .+-. 78.00 .+-. filtration rate 22.52 17.11 10.06 20.19 10.06
20.19 14.17 15.41 (mL min.sup.-1 1.73 m.sup.-2) Muscle enzymes
Creatinine 78.80 .+-. 79.40 .+-. 92.40 .+-. 94.80 .+-. 92.40 .+-.
94.80 .+-. 162.40 .+-. 135.50 .+-. Kinase activity 25.37 28.06
40.32 38.11 40.32 38.11 122.30 87.53 (IU l.sup.-1) Lactate 176.60
.+-. 167.20 .+-. 172.60 .+-. 176.20 .+-. 172.60 .+-. 176.20 .+-.
180.60 .+-. 171.40 .+-. Dehydrogenase 19.86 22.86 20.74 33.22 20.74
33.22 17.70 34.44 activity (IU l.sup.-1)
[0245] Moreover, the frequency of recorded adverse effects was
similar in all groups (Table 5).
TABLE-US-00005 TABLE 5 Proportion of patients experiencing
self-reported adverse effects (n = 5) Placebo Akk S - 10.sup.10 Akk
S - 10.sup.9 Akk P - 10.sup.9 Nausea 1/5 0 2/5 1/5 Flatulence 0 1/5
3/5 1/5 Bloating 1/5 1/5 0 0 Cramps 1/5 1/5 0 1/5 Borborygmi 0 3/5
3/5 0 Gastric reflux 1/5 0 1/5 0
[0246] Borborygmi were reported by some patients treated with live
A. muciniphila, but the difference with other groups was not
significant.
[0247] While the number of subjects is limited, these first human
data suggest that both live and pasteurized A. muciniphila are well
tolerated in obese/overweight volunteers and appear safe for oral
administration.
[0248] Furthermore, promising trends were observed in terms of fat
mass, glycemia and inflammation markers at the end of the treatment
period for patients treated with the high dose of live and/or
pasteurized A. muciniphila.
Sequence CWU 1
1
8123DNAArtificial SequencePrimer RPL-19 Forward 1gaaggtcaaa
gggaatgtgt tca 23221DNAArtificial SequencePrimer RPL-19 Reverse
2ccttgtctgc cttcagcttg t 21319DNAArtificial SequencePrimer Ocln
Forward 3atgtccggcc gatgctctc 19423DNAArtificial SequencePrimer
Ocln Reverse 4tttggctgct cttgggtctg tat 23522DNAArtificial
SequencePrimer Cldn3 Forward 5tcatcggcag cagcatcatc ac
22622DNAArtificial SequencePrimer Cldn3 Reverse 6acgatggtga
tcttggcctt gg 22727DNAArtificial SequencePrimer Lyz1 Forward
7gccaaggtct acaatcgttg tgagttg 27823DNAArtificial SequencePrimer
Lyz1 Reverse 8cagtcagcca gcttgacacc acg 23
* * * * *